AU2021100640A4 - Rapid biological assay for content of abscisic acid in forest tree seed and use thereof - Google Patents

Abstract

The present disclosure relates to a rapid biological assay for the content of abscisic acid (ABA) in forest tree seeds and use thereof, and belongs to the technical fields of forest tree genetic breeding and molecular biology. According to the method of the present disclosure, identification and relative quantification of the ABA in the difficultly reproducible forest tree seeds may be realized by preparing a forest tree seed aqueous solution, preparing forest tree seed aqueous solutions with concentration gradients, preparing ABA solutions with concentration gradients, treating Arabidopsis thaliana seeds with the forest tree seed aqueous solutions and the ABA solutions, recording the germination of the A. thaliana seeds and plotting a germination curve. Use of the technical solution of the present disclosure can complete the identification and relative quantification of the ABA in the difficultly reproducible forest tree seeds in a low-cost, rapid, and accurate manner. 11 DRAWINGS Sl, preparation of a difficultly reproducible forest tree seed aqueous solution S2, preparation of difficultly reproducible forest tree seed aqueous solutions with concentration gradients S3, preparation of abscisic acid (ABA) aqueous solutions with concentration gradients S4, treatment of Arabidopsis thaliana seeds with the difficultly reproducible forest tree seed aqueous solutions and the ABA solutions S5, recording of the germination of the A. thaliana seeds and plotting of a germination curve S6, testing of expression patterns of ABA responsive marker genes in the A. thaliana FIG. 1

Description

DRAWINGS

Sl, preparation of a difficultly reproducible forest tree seed aqueous solution

S2, preparation of difficultly reproducible forest tree seed aqueous solutions with concentration gradients

S3, preparation of abscisic acid (ABA) aqueous solutions with concentration gradients

S4, treatment of Arabidopsis thalianaseeds with the difficultly reproducible forest tree seed aqueous solutions and the ABA solutions

S5, recording of the germination of the A. thaliana seeds and plotting of a germination curve

S6, testing of expression patterns of ABA responsive marker genes in the A. thaliana

FIG. 1

RAPID BIOLOGICAL ASSAY FOR CONTENT OF ABSCISIC ACID IN FOREST TREE

SEED AND USE THEREOF TECHNICAL FIELD The present disclosure relates to the technical fields of forest tree genetic breeding and molecular biology, and in particular to a rapid biological assay for the content of abscisic acid (ABA) in forest tree seeds and use thereof. BACKGROUND As forest trees survive in the wild for a long time, under the selection pressure of the natural environment, a plurality of generational replacement models have evolved. A plurality of precious timber forest trees produce a plurality of germination-inhibiting substances during seed development, so as to protect the seeds and start to grow and develop under suitable conditions. The resulting characteristics of low seed germination rate and long germination period have become the main limiting factors for the preservation and genetic improvement of germplasm resources of precious timber species. A plurality of studies have proved that ABA is the most important seed germination inhibitor. Therefore, how to quickly determine whether there is a large amount of ABA in forest tree seeds that cause abnormal seed germination is a primary link for the genetic improvement of precious timber species. Methods for detecting ABA mainly include biological assay, immunoassay, chromatography, mass spectrometry, spectroscopy, or electrochemical methods. Herein, the biological assay is the simplest and quickest, and is an effective method for preliminarily determining the type and concentration range of seed inhibitors. Biological assay refers to the classic plant hormone determination method that uses a specific reaction produced when a hormone acts on plant tissues and organs. However, the plant tissues and organs currently used for biological assay are diverse, and there is no perfect data analysis system, the accuracy is low, and application scope has certain limitations. SUMMARY An objective of the present disclosure is to provide a rapid biological assay for the content of ABA in forest tree seeds and use thereof. The method of the present disclosure can solve the technical problems of harsh sample storage requirements, expensive experiment, and long cycle existing in the prior art. The present disclosure provides a rapid biological assay for the content of ABA in forest tree seeds, including the following steps: step 1, crushing forest tree seeds treated with liquid nitrogen, soaking in water for 24-48 h, centrifuging to obtain a supernatant, and filtering to obtain a forest tree seed aqueous solution; step 2, gradiently diluting the forest tree seed aqueous solution obtained in step 1 to obtain forest tree seed aqueous solutions with different concentration gradients; step 3, preparing ABA aqueous solutions with different concentration gradients; step 4, taking Arabidopsis thaliana seeds, and culturing A. thalianawith the forest tree seed aqueous solutions with different concentration gradients obtained in step 2 and the ABA aqueous solutions with different concentration gradients obtained in step 3, using sterile water as a control; where the culture is conducted for 3-7 days at 4-6°C; and step 5, after the culture in step 4, transferring the A. thaliana seeds to a condition of 24-26°C, observing and recording the germination rate of A. thaliana seeds for 5-7 days, and plotting a germination curve to obtain content of ABA in the forest tree seeds; where there is no limitation to time sequence in steps 1 and 3. Preferably, the forest tree seeds in step 1 may include difficultly reproducible forest tree seeds. Preferably, the forest tree seeds and the water in step 1 may have a mass ratio of is 1:(8-12). Preferably, the soaking in step 1 may further be followed by shaking, and the shaking may be conducted for 5-10 min at above 3,500 rpm. Preferably, the gradient dilution in step 2 may be as follows: Ipl of the forest tree seed aqueous solution may be diluted with water to 10 ml, 20 ml, 50 ml, and 100 ml, respectively, and the concentration gradients may be 0.1 ml/L, 0.05 ml/L, 0.02 ml/L, and 0.01 ml/L, respectively. Preferably, in the ABA aqueous solutions with different concentration gradients in step 3, the concentration gradients of the ABA may be 0.1 pmol/L, 0.2 tmol/L, 0.5 tmol/L, 1.0 pmol/L, and 2.0 pmol/L, respectively. Preferably, the A. thalianaseeds in step 4 may be sown on soaked filter paper for culture, and the filter paper may be soaked with the forest tree seed aqueous solutions with different concentration gradients, the ABA aqueous solutions with different concentration gradients, and the sterile water, respectively. Preferably, step 5 may further include identification of the ABA after the content of the ABA in forest tree seeds is obtained. Preferably, the identification of the ABA may be an analysis of expression patterns of ABA responsive genes in the A. thalianaseeds. The present invention further provides use of the assay according to the foregoing technical solution in forest tree genetic breeding. The present disclosure provides a rapid biological assay for the content of ABA in forest tree seeds. According to the method of the present disclosure, identification and relative quantification of the ABA in the difficultly reproducible forest tree seeds may be realized by preparing a forest tree seed aqueous solution, preparing forest tree seed aqueous solutions with concentration gradients, preparing ABA solutions with concentration gradients, treating A. thalianaseeds with the forest tree seed aqueous solutions and the ABA solutions, recording the germination of the A. thaliana seeds and plotting a germination curve. Use of the technical solution of the present disclosure may complete the identification and relative quantification of the ABA in the difficultly reproducible forest tree seeds in a low-cost, rapid, and accurate manner. The present disclosure will provide powerful technical support for the rapid construction and optimization of a difficultly reproducible forest tree seed germination technology system. BRIEF DESCRIPTION OF DRAWINGS FIG. 1 is a schematic flowchart of a method for rapid biological assay for the content of ABA in forest tree seeds provided by the present disclosure; FIG. 2 illustrates the seed germination rate of A. thaliana under different experimental group treatments provided by the present disclosure; FIG. 3 illustrates results of expression patterns of ABA responsive genes in A. thaliana seeds provided by the present disclosure. DETAILED DESCRIPTION The present disclosure provides a rapid biological assay for the content of ABA in forest tree seeds, including the following steps: step 1, crushing forest tree seeds treated with liquid nitrogen, soaking in water for 24-48 h, centrifuging to obtain a supernatant, and filtering to obtain a forest tree seed aqueous solution; step 2, gradiently diluting the forest tree seed aqueous solution obtained in step 1 to obtain forest tree seed aqueous solutions with different concentration gradients; step 3, preparing ABA aqueous solutions with different concentration gradients; step 4, taking A. thaliana seeds, and culturing A. thaliana with the forest tree seed aqueous solutions with different concentration gradients obtained in step 2 and the ABA aqueous solutions with different concentration gradients obtained in step 3, using sterile water as a control; where the culture is conducted for 3-7 days at 4-6°C; and step 5, after the culture in step 4, transferring the A. thaliana seeds to a condition of 24-26°C, observing and recording the germination rate of A. thaliana seeds for 5-7 days, and plotting a germination curve to obtain content of ABA in the forest tree seeds; where there is no limitation to time sequence in steps 1 and 3. In the present disclosure, forest tree seeds treated with liquid nitrogen are crushed, soaked in water for 24-48 h, centrifuged to obtain a supernatant, and filtered to obtain a forest tree seed aqueous solution. In the present disclosure, the forest tree seeds may include difficultly reproducible forest tree seeds. In the present disclosure, the forest tree seeds may preferably be air-dried forest tree seeds that may avoid the inability to use low-temperature facilities to store fresh seeds when sampling in the wild, while ensuring activity of ABA. In the present disclosure, the difficultly reproducible forest trees may preferably include Phellodendronamurense, Acerpictum subsp. mono, Juglans mandshurica, and the like. In the present disclosure, liquid nitrogen is used to treat the seeds, and the extremely low temperature of the liquid nitrogen is beneficial to reduce the difficulty of grinding a variety of seeds. The present disclosure has no special limitation on the crushing operation, and a conventional crushing method may be used. In the present disclosure, the forest tree seeds and the water may preferably have a mass ratio of 1:(8-12), and more preferably 1:10. In the present invention, the soaking may preferably last for 24 h. In the present disclosure, the water for the soaking water may preferably be ultrapure water. In the present disclosure, soaking with ultrapure water may avoid the interference of other impurities. In the present disclosure, the soaking may preferably further be followed by shaking, and the shaking may preferably be conducted for -10 min at above 3,500 rpm, and more preferably for 5 at 3,500 rpm. The present disclosure has no special limitation on the shaking method, as long as a vortex shaker known to those skilled in the art may be used for shaking and mixing well. In the disclosure, the centrifugation may preferably be conducted for 5 min at 10,000 rpm. The shaking and centrifuging operations of the present disclosure may be beneficial to the full extraction of ABA. An objective of the filtration of the present disclosure is to sterilize, as long as filtration sterilization may be conducted using a conventional sterilizer filter well-known to those skilled in the art. Because forest trees grow in the wild for a long time, it is inevitable to be contaminated by bacteria during seed collection and sampling. Filtration sterilization with a sterilizer filter may effectively prevent bacteria from interfering with the results of subsequent A. thaliana germination experiments. In the present disclosure, after collecting the supernatant, a constant volume may be preferably diluted to, and the constant volume to be diluted may preferably be 10 times the mass of the forest tree seeds. Specifically, in an embodiment of the present disclosure, it may be preferable to select 5 g of air-dried, difficultly reproducible forest tree seeds to soak in 50 g (50 mL) of water, and be preferably diluted to volume in a 50 mL volumetric flask after shaking, centrifuging, and filtering. After obtaining the forest tree seed aqueous solution, the present disclosure conducts gradient dilution on the forest tree seed aqueous solution to obtain forest tree seed aqueous solutions with different concentration gradients. In the present disclosure, the gradient dilution may preferably be as follows: Ipl of the forest tree seed aqueous solution may be diluted with water to 10 ml, 20 ml, ml, and 100 ml, respectively, and the concentration gradients may be 0.1 ml/L, 0.05 ml/L, 0.02 ml/L, and 0.01 ml/L, respectively. The above four concentration gradients of the present disclosure are the best standards, and the above concentration gradients of the present disclosure may completely cover the known concentration range of ABA in difficultly reproducible forest tree seeds. The present disclosure prepares ABA aqueous solutions with different concentration gradients. In the present disclosure, in the ABA aqueous solutions with different concentration gradients, the concentration gradients of ABA are 0.1 pmol/L, 0.2 pmol/L, 0.5 pmol/L, 1.0 pmol/L, and 2.0 ptmol/L, respectively. The ABA aqueous solutions of the present disclosure may preferably be sterilized. The above five concentration gradients of the present disclosure may be the best standards, and the above five concentration gradients of the present disclosure may completely cover the known concentration range of ABA in difficultly reproducible forest tree seeds. The present disclosure takes A. thalianaseeds, and cultures A. thalianawith the forest tree seed aqueous solutions with different concentration gradients and the ABA aqueous solutions with different concentration gradients, using sterile water as a control; the culture may preferably be conducted for 3-7 days at 4-6°C, and more preferably for 3-7 days at 4°C. The present disclosure has no special limitation on sources of the A. thaliana, and conventional A. thalianacultivars well known to those skilled in the art may be used, such as A. thaliana (Col-0) wild type. In the present disclosure, the A. thaliana seeds may preferably be sown on soaked filter paper for culture, and the filter paper may be soaked with the forest tree seed aqueous solutions with different concentration gradients, the ABA aqueous solutions with different concentration gradients, and the sterile water, respectively. In the present disclosure, the filter paper may preferably be laid flat in a 75 mm Petri dish, and the A. thaliana seeds may preferably be evenly sown on the filter paper. The control may preferably be filter paper soaked with sterile water, and both the filter paper and the petri dish in the present disclosure may preferably be sterilized before use. In the present disclosure, after the culture, the A. thaliana seeds may be preferably transferred to a condition of 24-26°C, and more preferably 25°C, the germination rate of A. thaliana seeds may be observed and recorded for 5-7 days and more preferably 5 days, and a germination curve may be plotted to obtain content of ABA in the forest tree seeds. In the present disclosure, obtaining the content of ABA in forest tree seeds may further be followed by identification of the ABA. In the present disclosure, the identification of the ABA may preferably be an analysis of expression patterns of ABA responsive genes in the A. thaliana seeds. Specifically, the present disclosure preferably collects A. thaliana seeds treated with the forest tree seed aqueous solutions with different concentration gradients and the ABA aqueous solutions with different concentration gradients at 5 treatment time points (at 1, 2, 3, 4, and 5 days), and an RNA extraction kit is used to extract total RNA; a cDNA reverse transcription kit is used in reverse transcription of RNA for quantitative analysis of gene expression. According to the results of high-throughput RNA transcription data, the present disclosure may preferably screen AT1G53880, AT4G11140, AT5G52310, and AT4G8620 genes as ABA responsive genes in A. thaliana seeds, that is, preferably, primer pairs (nucleotide sequences shown as SEQ ID NOS. 1to 8) may be used to analyze the expression patterns of ABA responsive genes in A. thaliana seeds. In the present disclosure, the four ABA responsive genes during seed development may improve the accuracy of the biological assay of the present disclosure. In the present disclosure, reference gene may be selected as AT3G18780 (ACT2). Expression patterns of candidate genes may be analyzed by using the 2-AACt method for relative quantification. Detailed gene information and primers are shown in Table 1:

Table 1 A. thalianaseeds express quantitative reference genes and ABA-responsive genes Genetic model Expression pattern Primer ID NO. Primer (5'-3') Product Remarks

SEQ ID NO. 1 F: CAGATTGGAG GAGAAGAAGA G AT5G52310 Up 297 bp Marker gene SEQ ID NO. 2 R: CAACGGAATGAGGCGATTTTG

SEQ ID NO. 3 F: GTGATG GTGGTAAGTA TTATTG AT4G18620 Up 234 bp Marker gene SEQ ID NO. 4 R: CATTTTCTTTGTGAGCTTAGC

SEQ ID NO. 5 F: CAGTGTT CCTGTTCCTC CTAAG AT1G53880 Down 141 bp Marker gene SEQ ID NO. 6 R:CTGAATAAGCTCGTCACTTAC

SEQ ID NO. 7 F: CCGTTGTTC TCGGACGACG AC AT4G11140 Down 197 bp Marker gene SEQ ID NO. 8 R: CCGAATAAATCCCCAATATCTTG

SEQ ID NO. 9 F: AATTACCCGATGGGCA AT3G18780 - 108 bp Reference gene SEQ ID NO. 10 R: TCATACTCGGCCTTGGA

As shown in FIG. 1, the specific process of the biological assay described in the example of the present disclosure is as follows: The sample to be tested in the present disclosure is air-dried linden seeds collected in the field. 5 g of linden seeds are weighed, treated with liquid nitrogen, crushed, and soaked in 50 ml of ultrapure water for 24 h; the seeds are shaken and mixed in a vortex shaker (for 5 min at 3,500 rpm); the seeds are centrifuged in a centrifuge at high speed (for 5 min at 10,000 rpm); a supernatant is collected, filtered through a sterilizer filter, and diluted to volume in a 50 ml volumetric flask. In a clean bench, 1 l each of supernatant is dilute to 10 ml (0.1 ml/L), 20 ml (0.05 ml/L), 50 ml (0.02 ml/L), and 100 ml (0.01 ml/L) with sterile water. ABA concentration gradients are set to 0.1 tmol/L, 0.2 pmol/L, 0.5 tmol/L, 1.0 pmol/L, and 2.0 pmol/L (different concentrations of solutions are sterilized), respectively. Filter paper is soaked with different concentrations of linden seed aqueous solutions and ABA solutions, the filter paper is spread in a 75 mm Petri dish, and A. thaliana (Col-0) wild type seeds are evenly sown on the filter paper; in a control group, the filter paper is soaked with sterile water (the filter paper and Petri dishes need to be sterilized). The linden seed aqueous solution treatment group, the ABA solution treatment group, and the control group are all treated for 7 days at 4°C, and transferred into a 25°C culture room, and the germination rate of A. thaliana seeds is observed and recorded for 5 consecutive days. A. thaliana seeds are collected from the linden seed treatment group, the ABA solution treatment group, and the control group at 5 treatment time points (at 1, 2, 3, 4, and 5 days), and total RNA is extracted by using an RNA extraction kit; RNA is reverse transcribed using a reverse transcription kit for quantitative analysis of gene expression. Expression patterns of ABA responsive genes in the A. thaliana seeds are analyzed by using primer pairs (SEQ ID NOS. 1 to 10).

The present invention further provides use of the assay according to the foregoing technical solution in forest tree genetic breeding. The rapid biological assay for the content of ABA in forest tree seeds and use thereof provided by the present disclosure will be described in further detail below in conjunction with specific examples. The technical solution of the present disclosure includes, but is not limited to, the following examples. Example 1 ABA in air-dried linden seeds collected in the field was subjected to a rapid biological assay. Si, 5 g of air-dried, difficultly reproducible forest tree seeds were weighed, treated with liquid nitrogen, crushed, and soaked in 50 ml of ultrapure water for 24 h; the seeds were shaken and mixed in a vortex shaker (for 5 min at 3,500 rpm); the seeds were centrifuged in a centrifuge at high speed (for 5 min at 10,000 rpm); a supernatant was collected, filtered through a sterilizer filter, and diluted to volume in a 50 ml volumetric flask. S2, in a clean bench, 1 l each of supernatant was dilute to 10 ml (0.1 ml/L), 20 ml (0.05 ml/L), ml (0.02 ml/L), and 100 ml (0.01 ml/L) with sterile water. S3, ABA concentration gradients were set to 0.1 tmol/L, 0.2 tmol/L, 0.5pmol/L, 1.0 tmol/L, and 2.0 pmol/L (all solutions were sterilized), respectively. S4, filter paper was soaked with different concentrations of difficultly reproducible forest tree seed aqueous solutions and ABA solutions, the filter paper was spread in a 75 mm Petri dish, and A. thaliana seeds were evenly sown on the filter paper; in a control group, the filter paper was soaked with sterile water (the filter paper and Petri dishes needed to be sterilized). S5, the difficultly reproducible forest tree seed aqueous solution treatment group, the ABA solution treatment group, and the control group were all treated for 7 days at 4°C, and transferred into a 25°C culture room, and the germination rate of A. thaliana seeds was observed and recorded for 5 consecutive days (see FIG. 2, where, A is the control group, B is the ABA solution treatment group, and C is the difficultly reproducible forest tree seed solution treatment group). The results showed that the inhibitory level of 0.1 ml/L linden seed aqueous solution diluted 10-fold was comparable to that of 0.2 pmol/L ABA solution, and the content of ABA in the air-dried linden seeds was 5.2 mg/g according to calculation. S6, A. thaliana seeds were collected from the difficultly reproducible forest tree seed aqueous solution treatment group, the ABA solution treatment group, and the control group at 5 treatment time points (at 1, 2, 3, 4, and 5 days), and total RNA was extracted by using an RNA extraction kit; RNA was reverse transcribed using a reverse transcription kit for quantitative analysis of gene expression. Based on the 2-AACI method for relative quantification, expression patterns of ABA responsive genes in the A. thaliana seeds were quantified using primers with nucleotide sequences shown as SEQ ID NOS. 1 to 8 and A. thaliana reference gene AT3G18780 was quantified using primers with nucleotide sequences shown as SEQ ID NOS. 9 to 10. The results of gene expression analysis showed that (FIG. 3, where A is the difficultly reproducible forest tree seed aqueous solution treatment group, andB is the ABA solution treatment group), AT1G53880 andAT4G11140 genes were significantly down-regulated under the treatment of linden seed extract. AT5G52310 and AT4G18620 genes were significantly up-regulated under the treatment of linden seed extract. It was indicated that the main inhibitory component containing in linden seeds was ABA and the content thereof was about 5.2 mg/g. The above descriptions are merely preferred implementations of the present invention. It should be noted that several improvements and modifications can also be made by those of ordinary skill in the art without departing from the principles of the present disclosure, and these improvements and modifications should also be deemed as the protection scope of the present disclosure.

Claims (5)

1. What is claimed is: 1. A rapid biological assay for the content of abscisic acid (ABA) in forest tree seeds, comprising the following steps: step 1, crushing forest tree seeds treated with liquid nitrogen, soaking in water for 24-48 h, centrifuging to obtain a supernatant, and filtering to obtain a forest tree seed aqueous solution; step 2, gradiently diluting the forest tree seed aqueous solution obtained in step 1 to obtain forest tree seed aqueous solutions with different concentration gradients; step 3, preparing ABA aqueous solutions with different concentration gradients; step 4, taking Arabidopsis thaliana seeds, and culturing Arabidopsis thalianawith the forest tree seed aqueous solutions with different concentration gradients obtained in step 2 and the ABA aqueous solutions with different concentration gradients obtained in step 3, using sterile water as a control; wherein the culture is conducted for 3-7 days at 4-6°C; and step 5, after the culture in step 4, transferring the Arabidopsis thaliana seeds to a condition of 24-26°C, observing and recording the germination rate of Arabidopsis thalianaseeds for 5-7 days, and plotting a germination curve to obtain content of ABA in the forest tree seeds; wherein there is no limitation to time sequence in steps 1 and 3.
2. 2. The assay according to claim 1, wherein the forest tree seeds in step 1 comprise difficultly reproducible forest tree seeds; wherein the forest tree seeds and the water in step 1 have a mass ratio of is 1:(8-12).
3. 3. The assay according to claim 1, wherein the soaking in step 1 is further followed by shaking, and the shaking is conducted for 5-10 min at above 3,500 rpm.
4. 4. The assay according to claim 1, wherein the gradient dilution in step 2 is as follows: Ipl of the forest tree seed aqueous solution is diluted with water to 10 ml, 20 ml, 50 ml, and 100 ml, respectively, and the concentration gradients are 0.1 ml/L, 0.05 ml/L, 0.02 ml/L, and 0.01 ml/L, respectively; wherein in the ABA aqueous solutions with different concentration gradients in step 3, the concentration gradients of the ABA are 0.1 pmol/L, 0.2 pmol/L, 0.5 pmol/L, 1.0 tmol/L, and 2.0 tmol/L, respectively; wherein the Arabidopsis thaliana seeds in step 4 are sown on soaked filter paper for culture, and the filter paper is soaked with the forest tree seed aqueous solutions with different concentration gradients, the ABA aqueous solutions with different concentration gradients, and the sterile water, respectively; wherein step 5 further comprises identification of the ABA after the content of the ABA in forest tree seeds is obtained; wherein the identification of the ABA is an analysis of expression patterns of an ABA responsive gene in the Arabidopsis thalianaseeds.
5. 5. Use of the assay according to any one of claims 1 to 4 in forest tree genetic breeding.