AU2020384026A1

AU2020384026A1 - Use of LncRNA-266 in preparation of a medicament for inducing differentiation of brown adipose cells

Info

Publication number: AU2020384026A1
Application number: AU2020384026A
Authority: AU
Inventors: Xiaoyu Liu; Jinyu MA; Cheng Sun; Xin TANG
Original assignee: Nantong University
Current assignee: Nantong University
Priority date: 2019-11-15
Filing date: 2020-08-24
Publication date: 2021-08-05
Anticipated expiration: 2040-08-24
Also published as: CN112294835A; AU2020384026B2; WO2021093401A1; CN112294835B

Abstract

Pharmaceutical use of a long chain non-coding RNA (LncRNA-266), i.e. use of LncRNA-266 in the preparation of a medicament for inducing the differentiation of brown adipose cells, being capable of promoting the energy consumption of the body and resisting obesity. By treating obese mice with LncRNA-266, the results show that lncRNA-266 can promote the differentiation of beige adipose cells into brown adipose cells in the obese mice, consume body energy, and inhibit weight gain. It is further discovered that LncRNA-266 can decrease blood glucose level in the obese mice, and increase insulin sensitivity.

Description

USE OF LNCRNA-266 IN PREPARATION OF MEDICAMENT FOR INDUCING DIFFERENTIATION OF BROWN ADIPOCYTES

TECHNICAL FIELD

The present invention belongs to the field of medicine, and in particular relates to use of LncRNA-266 in preparation of a medicament for inducing differentiation of brown adipocytes and promoting body energy metabolism.

BACKGROUND

Obesity is a physiological state of energy metabolism disorder, manifested as excessive energy accumulation in the body in the form of fat. Obesity is a serious threat to human health. It induces a variety of metabolic diseases, such as fatty liver, type 2 diabetes, cardiovascular diseases, specific types of cancer and so on. Adipose tissues are mainly divided into two types, including white adipose tissues and brown adipose tissues. In terms of energy metabolism, white adipocytes contain a lot of triglycerides, so white adipose tissues are mainly used as an organ to store energy. On the contrary, brown adipocytes contain a large number of mitochondria and highly express uncoupling protein UCP1, which can transform the stored energy into heat through uncoupling and dissipate the heat, so BAT is considered as an energy consuming organ. Therefore, it is reasonable to speculate that if the heat production of BAT is increased by some means, it will undoubtedly delay the weight gain and alleviate obesity. Long noncoding RNAs (LncRNAs) are a type of RNA molecules that are more than 200 bp in length and have no function of encoding proteins. At the early stage, it was thought that these LncRNAs were only by-products of gene transcription and had no specific physiological function. However, recent studies have found that many LncRNAs have very important physiological functions, and their abnormal levels may lead to developmental defects and the occurrence and development of a variety of diseases.

SUMMARY

An objective of the present invention is to provide pharmaceutical use of long noncoding RNAs (LncRNA-266). The specific technical solution is as follow: Use of LncRNA-266 in preparation of a medicament for inducing differentiation of

I brown adipocytes, the cDNA sequence of the LncRNA-266 being as set forth in SEQ ID No:1. The LncRNA-266 can induce beige adipocytes to differentiate into brown adipocytes, thereby promoting body energy metabolism and inhibiting weight gain. Further, the LncRNA-266 can decrease body blood glucose level and improve insulin sensitivity. Another objective of the present invention is to provide a medicament for inducing differentiation of brown adipocytes, which includes LncRNA-266 or a vector expressing LncRNA-266. The vector is one or more selected from the group consisting of plasmids, expression cassettes, viruses and cells. The medicament can consume body energy and inhibit body weight gain by inducing beige adipocytes to differentiate into brown adipocytes. The medicament can decrease body blood glucose level and improve insulin sensitivity. The present invention studies the induction effect of LncRNA-266 on browning of beige fat. By constructing adenoviruses expressing LncRNA-266 (Ad-LncRNA-266), using the constructed adenoviruses expressing LncRNA to transduce preadipocytes, and then performing directional induction of brown adipocytes, the results of oil red staining and qRT-PCR show that LncRNA-266 can significantly induce the preadipocytes to differentiate into brown adipocytes, and the expression of the specific genes UCP1 of the brown adipocytes show a high trend. Further, the present invention constructs its interfering viruses (Ad-LncRNA-266 shRNA) and uses the constructed interfering viruses to transduce preadipocytes. The results show that down regulating the expression of LncRNA-266 can inhibit the differentiation of the preadipocytes into the brown adipocytes, and the expression of UCP1 genes shows a downtrend. It is proved that LncRNA-266 can promote the differentiation of the preadipocytes into the brown adipocytes. In the present invention, at the level of live animals, the adenoviruses expressing LncRNA-266 (Ad-LncRNA-266) are injected directly into inguinal beige adipose tissues of obese mice (type 2 diabetic model mice). Three weeks after virus injection, it was found that the inguinal beige adipose tissues are transformed into brown adipose tissues, and the expression of UCP1 is significantly increased. In addition, LncRNA-266 can significantly decrease blood glucose and serum insulin levels in type 2 diabetic mice, and significantly increase glucose tolerance and insulin tolerance in obese mice, indicating that LncRNA-266 can improve glucose clearance in type 2 diabetic mice and improve insulin sensitivity thereof.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 illustrates differentiation of preadipocytes into brown adipocytes induced by LncRNA-266. FIG. 1A illustrates results of oil red staining of adipocytes. FIG. 1B illustrates an expression level of UCP1 genes detected by quantitative PCR. *** p < 0.001, Student's t test analysis. FIG. 2 illustrates differentiation of preadipocytes into brown adipocytes inhibited by interfering expression of LncRNA-266. FIG. 2A illustrates results of oil red staining of adipocytes. FIG. 2B illustrates an expression level of UCP1 genes detected by quantitative PCR. ** p < 0.01, Student's t test analysis. FIG. 3 illustrates influence of LncRNA-266 on blood glucose level in type 2 diabetic mice. ** p < 0.01, Student's t test analysis. FIG. 4 illustrates influence of LncRNA-266 on serum insulin level in type 2 diabetic mice. * p < 0.05, Student's t test analysis. FIG. 5 illustrates influence of LncRNA-266 on glucose tolerance in type 2 diabetic mice. ** p < 0.01, *** p < 0.001, Student's t test analysis. FIG. 6 illustrates influence of LncRNA-266 on insulin tolerance in type 2 diabetic mice. * p < 0.05, * * * p < 0.001, Student's t test analysis.

FIG. 7 illustrates treatment with LncRNA-266 to promote transformation of inguinal beige adipose tissues of mice into brown adipose tissues. FIG. 7A illustrates a fat morphology. FIG. 7B illustrates an expression level of UCP1 genes detected by quantitative PCR. *** p < 0.001, Student's t test analysis.

DETAILED DESCRIPTION

The specific steps of the present invention are described by the following examples, but are not limited to the examples. The terms used in the present invention, unless otherwise stated, generally have the meanings commonly understood by those of ordinary skill in the art. The present invention is further described below in detail with reference to specific examples and relevant data. It should be understood that the examples are only used to exemplify the present invention, but do not limit the scope of the present invention in any manner.

In the following examples, various processes and methods that are not described in detail are conventional methods known in the art.

Example 1 Construction of over-expressing and interfering viruses of LncRNA-266 Preparation of over-expressing viruses: over-expressing viruses were constructed by Gateway series kits of Invitrogen in this study. First, a complete sequence of LncRNA was amplified by PCR, and is then connected with an intermediate vector pENTR3C-Entry Vector was connected and sent to the company for sequencing, the vector with correct sequence was connected to a target vector (pAd-CMV-DEST Vector) by recombination (LR), after confirming the correctness by sequencing, positive plasmids were extracted and digested by endonuclease Pac I, and 293A cells were transfected using Lipofectamine 2000 liposome of Invitrogen. The formation of viral plaques was observed about one week later. After most of the viral plaques appeared, 293A cells were collected and repetitively frozen at -80°C and 37°C to break the cells. Centrifugation was performed and supernatant was collected to obtain first-generation viruses. Second-generation viruses were obtained by the same method after the first-generation viruses continued to infect 293A cells. The second-generation viruses could be stored in a refrigerator at -80°C for subsequent experiments after virus titer detection. Control viruses were adenovirus expressing LacZ (Ad-LacZ). Plasmids for constructing the viruses were pAd/CMV/V5-GW/LacZ, which were provided by Invitrogen. After digested by Pac I, they were used to transfect 293A cells. The process of transfection and virus preparation was the same as above. Preparation of interfering viruses: Gateway series kits of Invitrogen were used. First, shRNA was designed by using on-line software of Invitrogen and sent to Life to synthesize single-stranded DNA which was then annealed to form double-stranded DNA, the double-stranded DNA is connected with an intermediate vector BLOCK-it U6 RNAi Entry Vector and sent to the company for sequencing, the vector with correct sequence was connected to a target vector (pAd/BLOCK-iT-DEST Vector) by recombination (LR), after confirming the correctness by sequencing, positive plasmids were prepared and digested by endonuclease Pac I, and 293A cells were transfected using Lipofectamine 2000 liposome of Invitrogen. Virus collection and amplification were as described above. Control viruses were Ad-NC shRNA, and the construction method was the same as above. Example 2 Differentiation of preadipocytes induced by LncRNA-266 Primary preadipocyte culture: 8-week-old male C57BL/6J mice were used. Inguinal white adipose tissues were taken and put in a centrifuge tube, and digested by collagenase digestion solution (1 mg/ml collagenase dissolved in a separation buffer solution, including 0.123 M NaCl, 5 mM KCl, 1.3 mM CaC2, 5 nM glucose, 100 mM Hepes, 4% BSA) in a water bath at 37°C for 30 min, and oscillation was performed once every 5 min, filtration was performed by using a 100 m nylon screen, and centrifugation was performed at 200 g * 5 min. The supernatant was removed, 2 ml of separation buffer solution were added to fully suspend the cells, and centrifugation was performed at 200 g * 5 min. The supernatant was removed, and 2 ml of culture medium (DMEM high-glucose medium, 20% fetal bovine serum, 20 mM Hepes, 100 U/ml penicillin/streptomycin) were added to fully suspend the cells. The cells were seeded in a culture dish and cultured in a 5% C02 incubator at 37C. Directionally induced differentiation of brown adipocytes: In order to detect the effect of LncRNA-266 on the transformation of preadipocytes into brown adipocytes, before an inducing medium was added, 1*108 PFU over-expressing viruses (Ad-LncRNA-266) or interfering viruses (Ad-LncRNA-266 shRNA) were respectively added to preadipocytes for treatment. The medium was absorbed 24 hours later and replaced with a brown adipocyte inducing medium. The inducing medium included DMEM high-glucose medium, 10% fetal bovine serum, 20 mM insulin, 1 nM T3, 0.5 mM IBMX, 125 M indomethacin, and 1 M dexamethasone. Rosiglitazone was added after 2 days of induction. After 2 days, the medium was replaced with a basic inducing medium (DMEM high-glucose medium, 10% fetal bovine serum, 20 mM insulin, 1 nM T3) for inducing for 3-4 days, and the medium was replaced with a fresh medium every other day. (1) Oil red staining After cell treatment, the supernatant medium was removed, PBS was added for cleaning once, PBS was removed, and 4% paraformaldehyde was added for fixation at room temperature for 20-30 min. Then, PBS was used for cleaning 1-2 times, PBS was completely removed, oil red working liquid was added, the cells were placed on a low-speed shaker for incubation for 50-60 min (room temperature), the oil red working liquid was removed, PBS was added for cleaning 3 times, inversion was performed for taking a picture under a microscope. The results are as shown in FIG. 1A and FIG. 2A. The results in FIG. 1A show that LncRNA-266 can significantly increase the accumulation of lipid droplets in the cells, indicating that the preadipocytes are induced to differentiate into brown adipocytes. FIG. 2A illustrates that down regulating the expression of LncRNA-266 will decrease the accumulation of lipid droplets in the cells, indicating that the induced differentiation of preadipocytes into brown adipocytes is inhibited. (2) Expression level of genes detected by quantitative PCR Total RNAs were extracted by Trizol reagent (product of Invitrogen), and then transcribed into cDNAs by cDNA synthesis Kit (product of Bio-Rad). With this cDNAs as templates, SYBR Green Supermix (product of Bio-Rad) was used to analyze the gene expression level. A detection instrument was iQ5 Multicolor Real-Time PCR Detection System (product of Bio-Rad). For the results, the mRNA level was calculated by a 2-ACt method. 18S housekeeping genes were used to calibrate the mRNA level. Used primer sequences were as follows: 18S rRNA forward primer: 5'-AGTCCCTGCCCTTTGTACACA-3'(SEQ ID No: 2); 18S rRNA reverse primer: 5'-CGTTCCGAGGGCCTCACT-3'(SEQ ID No: 3); UCP1 forward primer: 5'-AGGCTTCCAGTACCATTAGGT -3' (SEQ ID No: 4); UCP1 reverse primer: 5'-CTGAGTGAGGCAAAGCTGATTT-3'(SEQ ID No: 5). qRT-PCR results are as shown in FIG. 1B and FIG. 2B. The results in FIG. 1B show that LncRNA-266 can significantly induce the expression of the specific genes UCP1 of the brown adipocytes. The results in FIG. 2B show that down regulating the expression of LncRNA-266 can significantly decrease the expression of UCP1 genes. These results suggest that LncRNA-266 can significantly induce preadipocytes to differentiate into brown adipocytes. Example 3 Influence of LncRNA-266 on glucose metabolism in type 2 diabetic mice 6-week-old male C57BL/6J mice were fed with high-fat diet (Research Diet, 45% calories from fat) for 90 days, and then induced into obese mice (i.e., type 2 diabetic mice). The adenovirus expressing LncRNA-266 (Ad-LncRNA-266) was injected directly into the inguinal beige adipose tissues of the type 2 diabetic mice. The dose was 40 1 of viruses (1*1012 PFU) per inguen on a single side of each mouse. The mice in the control group were injected with the equal dose of control viruses (Ad-LacZ). After 3 weeks of virus injection, various physiological indexes were detected. After fasting for 12 hours, blood was taken from tail veins of the mice, and the blood glucose level was quantitatively detected by a blood glucose meter (Bayer, Mishawaka, IN). The results are as shown in FIG. 3. The results in FIG. 3 show that treatment with LncRNA-266 can decrease the blood glucose level of type 2 diabetic model mice. After fasting for 12 hours, blood was taken from tail veins, and the serum insulin level was determined by a mouse serum insulin level kit (Rat/mouse insulin ELISA kit, Mercodia, 2758702). The results are as shown in FIG. 4. The results in FIG. 4 show that LncRNA-266 can decrease the serum insulin level and improve hyperinsulinemia in type 2 diabetic mice. Mice were fasted overnight (from 8 pm to 8 am the next day) and intraperitoneally injected with D-glucose (0.5 g/kg). Tail vein blood was taken respectively at 0, 15, 30, 60 and 90 min after glucose injection to determine the blood glucose at each time point using a blood glucose meter (Bayer) to investigate the glucose tolerance. The results are as shown in FIG. 5.

The results in FIG. 5 show that treatment with LncRNA-266 can significantly promote glucose clearance in peripheral blood of type 2 diabetic mice. After fasted for 6 hours (from 8 am to 2 pm), mice were intraperitoneally injected with recombinant human insulin (0.75 IU/kg) (purchased from Eli Lilly, Indianapolis, IN). Tail vein blood was taken respectively at 0, 15, 30, 60 and 90 min after glucose injection to determine the blood glucose at each time point using a blood glucose meter (Bayer) to investigate the insulin tolerance. The results are as shown in FIG. 6. The results in FIG. 6 show that treatment with LncRNA-266 can enhance the response capability of insulin in type 2 diabetic mice and improve the insulin sensitivity. At the end of the experiment, the mice were sacrificed after anesthesia, the mice were dissected quickly, and the inguinal fat was extracted for the following detection. The general morphology of the inguinal adipose tissue is as shown in FIG. 7A. The results in FIG. 7A show that treatment with LncRNA-266 can significantly deepen the color of inguinal adipose tissues. FIG. 7B illustrates quantitative PCR detection, and the results show that LncRNA-266 can significantly improve the expression level of UCP1 genes in the inguinal adipose tissues. To sum up, the results in FIG. 7 show that treatment with LncRNA-266 can promote transformation of inguinal beige adipose tissues of mice into brown adipose tissues.

Sequence listing

<110> Nantong University

<120> Use of LncRNA-266 in preparation of medicament for promoting body energy metabolism

<160> 5

<170> SIPOSequenceListing 1.0

<210> 1 <211> 841 <212> DNA <213> Mouse

<400> 1 gatgagcctttagcatcctacctgggacaggtggcctgaccgcagctatggaaacaagag 60 aaggcagaagatcgtgatgtgctacgtgtgctgacgggtggatcatgccatcggactgct 120 gggccgaccagccacacacgatactgaggacaggtgaccattattgtctttgcttcatca 180 ggaagacatgcccgtcactgttctgaggacagggaggaggacactacagcatttgggaca 240 ttacccactcacactatagtaagaaaaccacattgccctattgtaccagagacaggctga 300 ccaacaacatcgccgtaactagagcatttgcgcagactggtgtcactgaggaagggccaa 360 caatactgtgccactgggtcacaagcaggcgggacgacgccaggtcaacgcttggacagg 420 aagactgacaccaggaagtgcacgggaacctcgagggatacacatggtccgggctagccc 480 tgtttgggacccgcattcctgtgacagccctggcttatatccccttggctgcgtgccaac 540 tgttggaaccctttctggattgccaggtgagcagaaaggattgagtttaaattgtcagct 600 cctcctgacagcttctcagactaaagccccagataccacagaatactgaatcatttgagc 660 cgctgcttgtttaagcgttatgccctaggagtgtggctgatgaagtggagactccctcag 720 gatcaagtgtcctctgtacccctctaacaagaggggggacacccactactgcttggccag 780 cccactctctcactagcaaccccttgctccaacacctgcctcagctgacgccatgagaga 840 t 841

<210> 2 <211> 21 <212> DNA <213> Artificial Sequence

<400> 2 agtccctgccctttgtacac a 21

<210> 3 <211> 18 <212> DNA

<213> Artificial Sequence

<400> 3 cgttccgagg gcctcact 18

<210> 4 <211> 21 <212> DNA <213> Artificial Sequence

<400> 4 aggcttccag taccattagg t 21

<210> 5 <211> 22 <212> DNA <213> Artificial Sequence

<400> 5 ctgagtgaggcaaagctgattt 22

Claims

CLAIMS What is claimed is:

1. Use of LncRNA-266 in preparation of a medicament for inducing differentiation of brown adipocytes, the cDNA sequence of the LncRNA-266 being as set forth in SEQ ID No:1.

2. The use according to claim 1, wherein the LncRNA-266 induces beige adipocytes to differentiate into brown adipocytes, thereby promoting body energy metabolism.

3. The use according to claim 1, wherein the LncRNA-266 inhibits weight gain.

4. The use according to claim 1, wherein the LncRNA-266 decreases body blood glucose level and improves insulin sensitivity.

5. A medicament for inducing differentiation of brown adipocytes, comprising LncRNA-266 or a vector expressing LncRNA-266.

6. The medicament according to claim 5, wherein the vector is one or more selected from the group consisting of plasmids, expression cassettes, viruses and cells.

7. The medicament according to claim 5, wherein the medicament consumes body energy and inhibits body weight gain by inducing beige adipocytes to differentiate into brown adipocytes.

8. The medicament according to claim 5, wherein the medicament decreases body blood glucose level and improves insulin sensitivity.

FIG. 1

FIG. 2

FIG. 3

FIG. 4

FIG. 5

FIG. 6

FIG. 7