AU2020104236A4 - A primer and probe composition, a kit and application for RPA detection of H9N2 subtype avian influenza virus - Google Patents
A primer and probe composition, a kit and application for RPA detection of H9N2 subtype avian influenza virus Download PDFInfo
- Publication number
- AU2020104236A4 AU2020104236A4 AU2020104236A AU2020104236A AU2020104236A4 AU 2020104236 A4 AU2020104236 A4 AU 2020104236A4 AU 2020104236 A AU2020104236 A AU 2020104236A AU 2020104236 A AU2020104236 A AU 2020104236A AU 2020104236 A4 AU2020104236 A4 AU 2020104236A4
- Authority
- AU
- Australia
- Prior art keywords
- primer
- rpa
- avian influenza
- influenza virus
- detection
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
- C12N2760/00011—Details
- C12N2760/16011—Orthomyxoviridae
- C12N2760/16111—Influenzavirus A, i.e. influenza A virus
- C12N2760/16122—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- General Health & Medical Sciences (AREA)
- Virology (AREA)
- General Engineering & Computer Science (AREA)
- Medicinal Chemistry (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Biomedical Technology (AREA)
- Gastroenterology & Hepatology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a primer and probe composition, a kit and application for RPA detection
of H9N2 subtype avian influenza virus, belonging to the technical field of molecular biological
detection,the primers include upstream primer QF and downstream primer QR. Compared with
the existing LAMP method and qPCR technology, the primer and probe composition of the
invention can be used for RPA detection of H9N2 subtype avian influenza virus, which has
low temperature requirement, can be carried out under the isothermal condition of 37-42°C,
and has short detection time and high efficiency. By combining RPA technology with
fluorescence probe, the result can be obtained directly from the reflected fluorescence signal
value, which is intuitive and reliable. Accord to the invention, the H9N2 subtype AIV virus is
detected by design of special primers and probes, so that the method has higher sensitivity and
specificity, can eliminate false positive results, it is simple quick and convenient to operate,
realizes on-site direct detection, and has wide application prospect.
5'3000
E
L2000 H9N2 subtypeAN
61
S1000
66 0Oilherviis modules
0 2 4 5 8 10 12 14 16 18 20
Timeirn]r
Figure1I
1000 -Inlg
41
6.0
C
z_ V 2 4 6 0 ±0 12 I4 16 13 20
66 Tim@':minl
Figure 2
Description
'3000 E L2000 H9N2 subtypeAN 61
S1000
66 0Oilherviis modules 0 2 4 5 8 10 12 14 16 18 20
Timeirn]r
Figure1I
1000 -Inlg
41
6.0 C z_ V 2 4 6 0 ±0 12 I4 16 13 20 66 Tim@':minl
Figure 2
A primer and probe composition, a kit and application for RPA detection of H9N2
subtype avian influenza virus
The invention relates to the technical field of molecular biology, in particular to a primer
and probe composition, a kit and application for RPA detection of H9N2 subtype avian
influenza virus.
H9N2 subtype avian influenza virus belongs to Orthomyxoviridae, and Orthomyxovirus
belongs to single-stranded negative-strand RNA virus, showing polymorphism. The
genome of AIV is composed of 8 RNA segments, which encode different proteins, the
genome of AIV is prone to variation. At present, the traditional pathogen isolation
method is still widely used in the detection of H9N2 subtype avian influenza virus in
China, which is complicated, time-consuming and low in sensitivity. With the
development of molecular biology technology, polymerase chain reaction (PCR), nested
PCR and fluorescence quantitative PCR are widely used in virus detection. However,
PCR technology itself has the problems of easy pollution and low sensitivity, which often
leads to inaccurate detection results. At present, a more specific and sensitive detection
method for H9N2 subtype avian influenza virus is needed.
The purpose of the invention is to provide a primer and probe composition, kit and
application for RPAdetection of H9N2 subtype avian influenza virus, the method has the
advantages of strong specificity and high sensitivity.
In order to achieve the above objective of the invention, the present invention provides
the following technical scheme:
The invention provides a primer and probe composition for RPA detection of H9N2
subtype avian influenza virus,Said primers include upstream primer QF and downstream
primer QR.
The nucleotide sequence of the upstream primer QF is shown as SEQ ID NO.1.
The nucleotide sequence of the downstream primer QR is shown as SEQ ID NO.2.
The nucleotide sequence of the probe is shown as SEQ ID NO.3.
A fluorescent reporter group is inserted between 30-31bp of the sequence of the probe, a
tetrahydrofuran site is inserted between 31-32bp, a fluorescent quenching group is
inserted between 32-33bp, and a phosphate group with tetrahydrofuran site is inserted at
the 3' end of the probe.
Preferably, the fluorescent reporter group comprises FAM.
The invention provides a kit comprising the primer and probe composition described in
the above scheme.
Preferably, the kit also comprises magnesium acetate aqueous solution, RT-Buffer,
enzyme mixture and double distilled water.
Preferably, the kit also comprises a positive reference substance and a negative reference
substance. The positive reference substance comprises RNA of H9N2 subtype avian
influenza virus. The negative reference substance comprises double distilled water.
The invention provides an application of the primer and probe composition or the kit in
RPA detection of H9N2 subtype avian influenza virus for non-diagnostic purposes, and
the application comprises the following steps:
1) Extracting RNA of the sample to be detected.
2) Taking RNA of the sample to be detected as a template, carrying out RPA
amplification reaction and real-time fluorescence detection by using the primer and probe
composition described in the above scheme, and if the amplification curve is detected,
indicating that the sample to be detected contains H9N2 subtype avian influenza virus. If
the amplification curve is not detected, it indicates that the sample to be detected does not
contain H9N2 subtype avian influenza virus.
Preferably, in step 2), it also comprises RPA detection by using RNA of H9N2 subtype
avian influenza virus and double distilled water as templates respectively. The RPA
detection result using RNA of H9N2 subtype avian influenza virus as template is used as
positive control, and the RPA detection result using double distilled water as template is
used as negative control.
Preferably, the reaction system of RPA amplification reaction in step 2) is counted by
jL, which includes 18 L of RPA-H9N2 subtype AIV virus detection reagent, 1 L of
magnesium acetate aqueous solution and 1 L of template, the reagent for detecting RPA
H9N2 subtype AIV virus comprises the following components: RT-Buffer 11.8[tL, upstream primer QF and downstream primer QR each 0.55tL, probe 0.25tL, enzyme mixture 4 L and double distilled water 0.85[tL.
The magnesium acetate concentration in the magnesium acetate aqueous solution is
280mM. The upstream primer QF and the downstream primer QR have concentrations of
Preferably, the procedure of RPA amplification reaction in step 2) is: amplification at 37
42°C for 15-20min.
The beneficial effects of the invention
The invention provides a primer and probe composition for RPA detection of H9N2
subtype avian influenza virus.The primers include upstream primer QF and downstream
primer QR. And the nucleotide sequence of the upstream primer QF is shown as SEQ ID
NO.1. And the nucleotide sequence of the downstream primer QR is shown as SEQ ID
NO.2. And the nucleotide sequence of the probe is shown as SEQ ID NO.3. Compared
with the existing LAMP method and qPCR technology, the primer and probe composition
of the invention can be used for RPA detection of H9N2 subtype avian influenza virus,
which has low temperature requirement, can be carried out under the isothermal condition
of 37-42°C, and has short detection time and high detection efficiency. Compared with
the existing LAMP method and qPCR technology, the primer and probe composition of
the invention can be used for RPA detection of H9N2 subtype avian influenza virus,
which has low temperature requirement, can be carried out under the isothermal condition
of 37-42°C, and has short detection time and high detection efficiency. By combining
RPA technology with fluorescence probe, the result can be judged directly from the
reflected fluorescence signal value, which is intuitive and reliable. Accord to that invention, the H9N2 subtype AIV virus is detected by design of special primers and probes, so that the method has higher sensitivity and specificity, can eliminate false positive, is simple, quick and convenient to operate, realizes on-site direct detection, and has wide application prospect.
Fig. 1 is the RPA specific amplification graph of H9N2 subtype AIV virus in
embodiment 4 of the invention.
Fig. 2 is the amplification graph of RPA detection sensitivity of H9N2 subtype AIV virus
in embodiment 5 of the invention.
The invention provides a primer and probe composition for RPA detection of H9N2
subtype avian influenza virus, the primers include upstream primer QF and downstream
primer QR.
The upstream primer QF has a nucleotide sequence as shown in SEQ ID NO.1,
specifically, 5'-atacacaacctctccaaaccaagcggt-3'.
And the nucleotide sequence of the downstream primer QR is shown in SEQ ID NO.2,
specifically, 5'-gaaatggggcgaaaacccttaatttggcat-3'.
And the nucleotide sequence of the probe is shown in SEQ ID NO.3, specifically, 5'
gaacacattacagagagagaaagttgccccagtagcagac-3'.
A fluorescent reporter group is inserted between 30-31bp, a tetrahydrofuran site (THF) is
inserted between 31-32bp, a fluorescence quenching group (BHQ1) is inserted between
32-33bp, and a phosphate with tetrahydrofuran site is inserted at the 3' end of the probe,
particularly: 5'-GAAACAATCATAGAGAGAAAGTTG(FAM-DT)C(THF)C(BHQ1
DT)CCACAGTAGCAGAC (phosphate)-3'. The fluorescent reporter group preferably
comprises FAM.
In the invention, the primer and probe composition is designed by taking the conserved
region sequence of the NA gene of H9N2 subtype AIV virus as a target gene.
The invention provides a kit comprising the primer and probe composition described in
the above scheme. The kit preferably also comprises magnesium acetate aqueous
solution, RT-Buffer, enzyme mixture, double distilled water, positive reference substance
and negativereference substance,The positive reference substance preferably comprises
RNAof H9N2 subtype avian influenza virus. The negative reference substance preferably
comprises double distilled water.
In the specific implementation process of the invention, the RPA kit is preferably the
Basic kit purchased from TwistDXInc, UK, wherein the enzyme mixture contains
recombinase capable of binding single-stranded nucleic acid (oligonucleotide primer),
single-stranded DNA binding protein (SSB) and strand displacement DNA polymerase.
The enzyme mixture exists in the RPA reaction tube provided by the kit in the form of
freeze-dried powder, and is directly diluted with the reaction buffer brought by the kit
when in use.
The invention provides an application of the primer and probe composition or the kit in
RPA detection of H9N2 subtype avian influenza virus for non-diagnostic purposes, and
the application comprises the following steps:
1) Extracting RNA of a sample to be detected.
2) Taking RNA of the sample to be detected as a template, carrying out RPA
amplification reaction and real-time fluorescence detection by using the primer and probe
composition described in the above scheme, and if the amplification curve is detected,
indicating that the sample to be detected contains H9N2 subtype avian influenza virus. If
the amplification curve is not detected, it indicates that the sample to be detected does not
contain H9N2 subtype avian influenza virus.
A nucleotide sequence of a target fragment obtained by amplification of the invention is
shown as SEQ ID NO.4, specifically, it is:
The method comprises the following steps: firstly, extracting RNA of a sample to be
detected. The method for extracting RNA of the sample to be detected is not particularly
limited, and conventional methods in the field can be adopted.
After obtaining the RNA of the sample to be detected, the invention uses the RNA of the
sample to be detected as a template, utilizes the primer and probe composition described
in the above scheme to carry out RPA amplification reaction and real-time fluorescence
detection, and if the amplification curve is detected, it indicates that the sample to be
detected contains H9N2 subtype avian influenza virus. If the amplification curve is not
detected, it indicates that the sample to be detected does not contain H9N2 subtype avian
influenza virus.
The method preferably also comprises the following steps: carrying out RPA
detection by respectively taking RNA of H9N2 subtype avian influenza virus and double
distilled water as templates. The RPA detection result using RNA of H9N2 subtype avian
influenza virus as template is used as positive control, and the RPA detection result using
double distilled water as template is used as negative control.
In the invention, the RPA amplification reaction system comprises 18 L of RPA-H9N2
subtype AIV virus detection reagent, 1 L of magnesium acetate aqueous solution and
1 Lof template, the reagent for detecting RPA-H9N2 subtype AIV virus comprises the
following components: 11.8tL of rehydration buffer, 0.55tL of upstream primer QF and
0.25tL of downstream primer QR, 0.25tL of probe, 4 L of enzyme mixture and 0.85[tL
of double distilled water. The magnesium acetate concentration in the magnesium acetate
aqueous solution is preferably 280mM. The concentrations of the upstream primer QF
and the downstream primer QR are preferably 10tM, respectively,The concentration of
the template is preferably 1-20ng/4L, more preferably 5-1Ong/L.
In the present invention, the procedure of RPA amplification reaction is preferably as
follows: amplification at 37-42°C for 15-20 min. The temperature of the amplification is
preferably 38-40°C, and the time is preferably 18min.
In the following, the technical scheme of the present invention will be described clearly
and completely in combination with the embodiments of the present invention.
Obviously, the described embodiments are only part of the embodiments of the present
invention, not all of them. Based on the embodiments of the present invention, all other
embodiments obtained by ordinary technicians in the field without creative labor belong
to the scope of protection of thepresent invention.
Unless otherwise specified, the following real-time examples are all operated according
to conventional experimental conditions, and the technical means used in the real-time
embodiments are conventional means well known to those skilled in the field.
RPA kit used in the following examples is Basic kit, which was purchased from
TwistDXInc, UK. The reagent kit includes the enzyme mixture of recombinase capable
of binding single-stranded nucleic acid (oligonucleotide primer), single-stranded DNA
binding protein (SSB) and strand displacement DNA polymerase,The enzyme mixture
exists in the RPA reaction tube provided by the reagent kit in the state of freeze-dried
powder, and is directly diluted with the reaction buffer brought by the reagent kit when in
use. The whole RPA reaction process is carried out in RPA reaction tubes.
Embodiment 1 synthesis of primers and probes
Working principle of RPA reaction: In RPA reaction, three enzymes are needed, namely
recombinase, single-chain binding protein and DNA polymerase. During RPA
amplification, recombinase first combines with upstream and downstream primers to find
homologous double-stranded DNA, once located, chain exchange occurs, and single
stranded binding protein binds with parent chain to prevent it from interacting with
detached template chain. Then, DNA polymerase starts template synthesis from the 3'
ends of the upstream and downstream primers to form two double-stranded DNAs, which
are then cycled to achieve amplification.
According to the conserved sequence of NA gene of H9N2 subtype AIV virus, the target
gene was selected. According to the method of 5-base translation, the designed primers
are 30-35nt in length, avoiding continuous G at 5' end, and G and C at 3' end will be more
beneficial to the stability of enzyme recognition. In the design of RPA fluorescent probe, the modified groups include FAM fluorescent group, BHQ1 quenching group, THF abasic site, 3' end blocking, etc. Besides avoiding the existence of secondary structure, it should avoid overlapping with primers as much as possible, because the synthesized primers can be identified and detected by the probe. The primers and probes of the present invention areshown in Table 1:
Table 1 Nucleotide sequences of primers and probes
Primers Primer and probe sequence(5'-3') Segment length( bp) H9N2 subtype AIV virus ATACACCAACCTCTCCAACAACCAAGCGGT specific upstream primer (SEQ ID NO.1) QF 180 H9N2 subtype AIV virus GAAAATGGGGCGAAACCCTTAATTTGGCAT specific downstream (SEQ ID NO.2) primer QR H9N2 subtype AIV virus GAACAACATTACCATAGAGAGAGAAAGTTG specific probe QP CCCCACAGTAGCAGAC (SEQ ID NO.3)
The specific positions of fluorescence reporter group (FAM), fluorescence quencher
group (BHQ1) and phosphate group of tetrahydrofuran site (THF) in the probe sequence
are as follows:
GAACAACATTACCATAGAGAGAGAAAGTTG(FAM-dT)C(THF)C(BHQ1
dT)CCACAGTAGCAGAC(phosphate).
The NA target gene sequence is selected, the amplified fragment size is 180bp, and its
sequence structure is shown in SEQ IDNo.4:
Embodiment 2 RNA extraction
1) take a tissue sample to be detected, grind it into suspension with PBS at a ratio of 1:10,
put it into a 1.5mLEP tube after autoclaving, freeze-thaw it for 3 times at -80°C,
centrifuge it for 10min at 100OOrpm/min after freeze-thaw, and then dilute it to 10-7.
Take 300 L into 2mLcentrifuge tube, add 900 L TRIZOL reagent, reverse it violently
for 10 times, and let it stand at room temperature for 10min.
2) Add 200 L chloroform, turn it upside down for 6-10 times, let it stand for 5min at
room temperature, centrifuge for 10min at 4°C and 12000rpm/min, and transfer the
supernatant into a 1.5mL centrifuge tube. Then add isopropyl alcohol with the same
volume, shake it gently, put it at -20°C for 30min, centrifuge at 4°C and 12000rpm/min
for 5min, remove the supernatant, add 1mL of 75% ethanol -DEPC aqueous solution,
centrifuge at 4°C and 12000rpm/min for 5min, remove the supernatant, centrifuge at 40 C
and 12000rpm/min for 1min, and use the solvent.
Embodiment 3 RPA detection
RPA amplification system is composed of 20[L, including 18 L of RPA-H9N2 subtype
AIV virus detection reagent, 1 L of 280mM magnesium acetate (MgAc) solution and
1 L of template DNA.
The 18 L reagent for detecting RPA-H9N2 subtype AIV virus includes 11.8tL of
rehydration buffer, 0.55tL of 10PM upstream and downstream primers, 0.25tL of probe,
4 L of enzyme mixture and 0.85 L of ddH20.
The enzyme mixture includes recombinase, single-chain binding protein and DNA
polymerase.
Table 2 RPA reaction system Component concentration Addition name amount Upstream 10[M 0.55 L primer QF Downstream 10[M 0.55 L primer QR Probe 10[M 0.25 L RT-Buffer 11.8 L Enzyme 4 L mixture MgAc 280mM 1 L template 1-20ng/4L 2L ddH20 0.85 L
The procedure of RPA amplification is: temperature 37°C-42°C, reaction time 15min.
RPA amplification reaction was carried out in fluorescence detector.
Embodiment 4 specificity verification
Materials: Primers and probes synthesized in Embodiment 1 above.
H9N2 subtype AIV standard reference strain, Hi-Hi5 subtype AIV, NI subtype AIV,
Newcastle disease virus, infectious bronchitis virus, infectious bursal disease virus,
infectious laryngotracheitis virus, Marek's disease virus and fowlpox virus were kept and
provided by the Laboratory of Poultry Institute of Shandong Academy of Agricultural
Sciences. Using RNA extracted from the above materials as template, RPA detection was
carried out to verify the specificity of primers and probes. The results are shown in Table
3 and Fig. 1, the results show that the probes and primers of the present invention have
strong specificity.
Table 3 Specificity verification
H9N2 subtype AIV virus specific probe Detection irustype QP result
H9N2 subtype AIV 7.58+0.36 Positive Hi subtype AIV N Negative H2 subtype AIV N Negative H3 subtype AIV bacteria N Negative H4 subtype AIV N Negative H5 subtype AIV N Negative H6 subtype AIV N Negative H7 subtype AIV N Negative H8 subtype AIV N Negative H9 subtype AIV N Negative Ni subtype AIV N Negative Newcastle disease virus N Negative Infectious bronchitis virus N Negative Infectious bursal disease N Negative virus Infectious N Negative laryngotracheitis virus Marek's virus N Negative Fowlpox virus N Negative
Embodiment 5 sensitivity detection
RNA of H9N2 subtype AIV standard reference strain was reversed and quantified to
ng/4L respectively, diluted according to iOx gradient, and 2.0tL was taken as template
for each gradient (IOng, Ing, 0.1ng, 0.01ng, 0.001ng) for RPA detection to evaluate the
sensitivity of the invention. The result is shown in Fig. 2, and the sensitivity of this
detection method is 0.0ing.
Embodiment 6 detection of clinical suspicious samples
According to the RPA detection method for H9N2 subtype AIV virus established by the
invention, 20 clinically suspicious samples are detected, and the sample types include
disease materials and serum from different regions such as Shouguang, Yantai, Tai'an
and Jinan. See Table 4 for the sources and numbers of 20 clinical suspicious samples. At the same time, virus isolation and sequencing were used for detection. The fluorescence quantitative detection results are shown in Table 4, and the results show that the method established by the invention is completely consistent with the verification of sequencing results after virus separation, and the method of the invention is accurate and reliable. Table 4 Detection of Clinical Samples
Sample name H9N2 subtype AIV virus specific probe Detection result QP
Positive control 8.91±0.15 H9N2 subtype AIV Sl (blood) N Negative S2 (blood) N Negative S3 (blood) N Negative S4 (blood) N Negative S5 (blood) N Negative S6 (blood) 7.25+0.31 H9N2 subtype AIV S7 (blood) N Negative S8 (blood) N Negative S9 (blood) 10.68+0.24 H9N2 subtype AIV S10 (blood) N Negative S1I(blood) N Negative S12 (blood) N Negative S13 (blood) N Negative S14 (blood) N Negative S15 (sick N Negative material) S16 (sick 7.56+0.12 H9N2 subtype AIV material) S17 (sick N Negative material) S18 (sick N Negative material) S19 (sick N Negative material) S20 (sick N Negative material)
The above is only the preferred embodiment of the present invention, and it should be
pointed out that for ordinary people in the technical field, without departing from the principle of the present invention, several improvements and embellishments can be made, and these improvements and embellishments should also be regarded as the protection scope of the present invention.
Claims (9)
1. A primer and probe composition for RPA detection of H9N2 subtype avian influenza
virus. The primers include upstream primer QF and downstream primer QR.
The nucleotide sequence of the upstream primer QF is shown as SEQ ID NO.1.
The nucleotide sequence of the downstream primer QR is shown as SEQ ID NO.2.
The nucleotide sequence of the probe is shown as SEQ ID NO.3.
A fluorescent reporter group is inserted between 30-31bp of the sequence of the probe, a
tetrahydrofuran site is inserted between 31-32bp, a fluorescent quenching group is
inserted between 32-33bp, and a phosphate group with tetrahydrofuran site is inserted at
the 3' end of the probe.
2. The primer and probe composition according to claim 1, which is characterized in that
the fluorescent reporter group comprises FAM.
3. A kit comprising the primer and probe composition of claim 1 or 2.
4. The kit according to claim 3, which is characterized in thatthe kit also comprising
magnesium acetate aqueous solution, RT-Buffer, enzyme mixture and double distilled
water.
5. The kit according to claim 3 or 4, which is characterized in thatthe kit also comprises a
positive reference substance and a negative reference substance. The positive reference
substance comprises RNAof H9N2 subtype avian influenza virus. The negative reference
substance comprises double distilled water.
6. Application of the primer and probe composition according to claim 1or 2 or the kit
according to any one of claims 3-5 in RPA detection of H9N2 subtype avian influenza
virus for non-diagnostic purposes, the application comprising the following steps:
1) extracting RNA of the sample to be detected.
2) using RNA of the sample to be detected as a template, using the primer and probe
composition of claim 1 or 2 to perform RPA amplification reaction and real-time
fluorescence detection, and if the amplification curve is detected, it indicates that the
sample to be detected contains H9N2 subtype avian influenza virus. If the amplification
curve is not detected, it indicates that the sample to be detected does not contain H9N2
subtype avian influenza virus.
7. The application according to claim 6, characterized in that in step 2),it also comprises
RPA detection using RNA of H9N2 subtype avian influenza virus and double distilled
water as templates respectively. The RPA detection result using RNA of H9N2 subtype
avian influenza virus as template is used as positive control, and the RPA detection result
using double distilled water as template is used as negative control.
8. The application according to claim 6, characterized in that the reaction system of RPA
amplification reaction in step 2) is counted by 20L, including 18Lof RPA-H9N2
subtype AIV virus detection reagent, 1uL of magnesium acetate aqueous solution and
1uL of template. The reagent for detecting RPA-H9N2 subtype AIV virus comprises the
following components: RT-Buffer 11.8jL, upstream primer QF and downstream primer
QR each 0.55L, probe 0.25L, enzyme mixture 4L and double distilled water 0.854L.
The magnesium acetate concentration in the magnesium acetate aqueous solution is
280mM. The upstream primer QF and the downstream primer QR have concentrations of
M.
9. The application according to claim 6, characterized in that the procedure of RPA
amplification reaction in step 2) is: Amplification at 37-42°C for 15-20min.
-1/1- 22 Dec 2020 2020104236
Figure 1
Figure 2
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| AU2020104236A AU2020104236A4 (en) | 2020-12-22 | 2020-12-22 | A primer and probe composition, a kit and application for RPA detection of H9N2 subtype avian influenza virus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| AU2020104236A AU2020104236A4 (en) | 2020-12-22 | 2020-12-22 | A primer and probe composition, a kit and application for RPA detection of H9N2 subtype avian influenza virus |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| AU2020104236A4 true AU2020104236A4 (en) | 2021-03-11 |
Family
ID=74853836
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| AU2020104236A Ceased AU2020104236A4 (en) | 2020-12-22 | 2020-12-22 | A primer and probe composition, a kit and application for RPA detection of H9N2 subtype avian influenza virus |
Country Status (1)
| Country | Link |
|---|---|
| AU (1) | AU2020104236A4 (en) |
-
2020
- 2020-12-22 AU AU2020104236A patent/AU2020104236A4/en not_active Ceased
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106399590B (en) | Universal nucleic acid isothermal detection reagent for respiratory tract infection related adenovirus | |
| CN111394431B (en) | Method for detecting nucleic acid by using double real-time fluorescent isothermal amplification technology | |
| WO2005121367A1 (en) | Diagnostic primers and method for detecting avian influenza virus subtype h5 and h5n1 | |
| CN111286559B (en) | Primer, probe and kit for detecting African swine fever virus | |
| AU2020104141A4 (en) | A primer and probe composition, a kit and application for rpa detection of newcastle disease virus | |
| CN111334614A (en) | Method for detecting novel coronavirus by RT-qPCR technology | |
| CN102251061A (en) | Nucleic acid dual fluorescence PCR (Polymerase Chain Reaction) detection kit for influenza A/B virus | |
| CN112831605A (en) | Multienzyme isothermal amplification detection kit and application thereof | |
| CN115896348A (en) | Primer and probe for dual TaqMan fluorescent quantitative PCR (polymerase chain reaction) of canine distemper virus and canine coronavirus and application of primer and probe | |
| CN110093432B (en) | sRNA marker for distinguishing mycobacterium tuberculosis from BCG vaccine and application thereof | |
| CN102286639A (en) | Type A H1N1/influenza A virus nucleic acid dual fluorescent polymerase chain reaction (PCR) detection kit | |
| GB2401175A (en) | Detection of SARS virus by PCR | |
| CN109439801A (en) | A kind of honeybee Israel acute paralysis virus real-time fluorescent RT-PCR detection reagent box and its detection method | |
| CN108130385A (en) | A kind of human cytomegalovirus kit for detecting nucleic acid | |
| CN102586487B (en) | Double fluorescence quantitative reverse transcription-polymerase chain reaction (RT-PCR) detection kit for duck hepatitis virus I and Muscovy duck parvovirus | |
| AU2020104236A4 (en) | A primer and probe composition, a kit and application for RPA detection of H9N2 subtype avian influenza virus | |
| WO2006132601A1 (en) | Diagnostic primers and method for detecting avian influenza virus subtype h5 and h5n1 | |
| CN110804677A (en) | Nested duplex PCR (polymerase chain reaction) detection primer and kit for distinguishing African swine fever virus wild strain and gene deletion strain | |
| CN102816870A (en) | Primer and kit for detecting coxsackievirus A6 type RT-LAMP (Reverse Transcription Loop-mediated Isothermal Amplification) nucleic acid | |
| CN110669872A (en) | Triple RT-PCR (reverse transcription-polymerase chain reaction) detection primer group, kit and method for H9 and H10 subtype avian influenza viruses | |
| Kuriakose et al. | Detection of avian influenza viruses and differentiation of H5, H7, N1, and N2 subtypes using a multiplex microsphere assay | |
| CN114250311A (en) | CDA primer group and kit for detecting spotted fever group rickettsia and application of CDA primer group and kit | |
| CN109652593B (en) | Fluorescent quantitative PCR (polymerase chain reaction) primer and kit for detecting A-type seneca virus | |
| CN106521038A (en) | High-sensitivity BHV-2 (bovine herpes virus 2) quantitative real-time PCR (polymerase chain reaction) detection method and kit | |
| CN113215329A (en) | Primer, probe and kit for multiplex PCR detection of 7 respiratory subtype influenza viruses |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| FGI | Letters patent sealed or granted (innovation patent) | ||
| MK22 | Patent ceased section 143a(d), or expired - non payment of renewal fee or expiry |