AU2020104082A4 - An Anti-HIV Monoclonal Antibody and a Method for Preparing and Use Thereof - Google Patents

Abstract

The invention discloses an anti-HIV monoclonal antibody and a method for preparing and use thereof. The monoclonal antibody compromises a heavy chain and a light chain, as shown in the sequence listing. The present invention sorts an HIV-specific single memory B cell from an IV infected individual without progression for a long time by using dual antigens of YU2 gp140 trimer and AEl gp140 trimer. The antibody has high binding activity and limited neutralizing activity. The optimized antibody gene cloning protocal improves the amplification efficiency of heavy and light chains. The discovery of the monoclonal antibody not only provides a candidate drug for preventing and treating HIV infection, but also provides a technical reference for the development of a monoclonal antibody against viral infection. 1/6 DRAWINGS A YU gpldO trw Aul gpl4O V~mw 4- VIEI VRCOI 3-3 104074 3. 10-1074 20 - M t SWtrY Pt', FIG.1I

Description

1/6

DRAWINGS

A YU gpldO trw Aul gpl4O V~mw 4- VIEI VRCOI

3-3 104074 3. 10-1074

20

- MtSWtrY

Pt',

FIG.1I

An Anti-HIV Monoclonal Antibody and a Method for Preparing and Use Thereof

Technical Field

[0001] The invention belongs to the technical field of preparation of a monoclonal antibody against viral infection, and specifically relates to a monoclonal antibody that can effectively inhibit human immunodeficiency virus (HIV) infection. Meanwhile, the present invention also relates to a method for preparing the monoclonal antibody, and a use of the antibody in the preparation of an anti-infective drug.

Background Art

[0002] HIV is a lentivirus that infects CD4' immune cells, which belongs to a retrovirus and is first discovered in Central America in 1981. HIV infection can lead to Acquired Immune Deficiency Syndrome (AIDS) in human. There is currently no effective vaccine to prevent HIV infection, and it is almost impossible to cure the virus after infection. There are currently 36.9 million infections worldwide, with approximately 1.7 million new cases each year and 770,000 deaths due to AIDS. There are about 850,000 HIV-infected/AIDS patients in China, and the annual number of newly infected people is about 150,000. Existing antiretroviral therapy (ART) can inhibit the replication of HIV-1 and prolong the life expectancy of patients, but ART cannot clear the virus reservoir, so lifelong medication is required. And the patient compliance, adverse drug reactions and the emergence of drug resistant strains are also major challenges for ART. Therefore, some new strategies are needed to prevent and treat HIV infection, in order to control the spread of the virus and the progress of the disease.

[0003] The isolation and mechanism study of broadly neutralizing antibodies (bNAbs) provide a new method for HIV prevention and control and vaccine design. At present, the phase II clinical studies for 3 bNAbs have completed, and their therapeutic efficacy has been confirmed in HIV-infected patients, and the evaluation of preventive effects has entered the stage of clinical trials. The longer half-life and Fc effect of bNAbs can enhance the body's immune response to HIV-1. Antibody-mediated immune enhancement may be able to better control virus replication and eliminate infected cells to reduce the amount of HIV-1 reservoirs. In addition, the immunological and structural features as well as the site of action of bNAbs have been clarified, which provides new ideas for vaccine design. And immunization strategies based on antigen epitopes and antibody lineages are also being prepared for clinical trials.

[0004] However, it is worth noting that there is still a problem of relatively limited effectiveness of broad-spectrum and highly effective neutralizing antibodies in the treatment of established infections. In patients treated with bNAbs, since escaped strains may be present in advance or the single antibody has relatively little selective stress on the virus, most patients will soon experience a rebound in viral load as a result of the development of the mutated virus after using the antibody for a period of time. Meanwhile, once infection is established, the ability of the neutralizing antibody to block cell-to-cell transmission of viruses will also be significantly reduced. In addition, the currently isolated bNAbs are mainly derived from patients in North America and Africa, in which the epidemic strains are mainly B subtype and C subtype. However, the main epidemic strains in China are CRFO1-AE subtype and CRF07_BC subtype, and crFO1-AE infected patients are characterized by high viral load and rapid progression of disease, so the application of the existing bNAbs is affected and limited to a certain extent, and their efficacy against the epidemic strains and infected patients in China will also be limited. In addition, the current human anti-HIV monoclonal antibody preparation technology has limited amplification efficiency of antibody genes. Therefore, it is necessary to further optimize antibody sorting and molecular cloning technologies to promote the isolation and identification of bNAbs, so as to provide more candidate antibodies for clinical applications.

Summary of the Invention

[0005] The objective of the present invention is to provide an anti-HIV monoclonal antibody with good activity against the deficiencies of the prior art.

[0006] The present invention also provides a method for preparing the monoclonal antibody.

[0007] The objective of the present invention is also to provide a use of the monoclonal antibody in the preparation of a drug for treating and preventing HIV infection.

[0008] The objective of the present invention is achieved through the following technical solutions.

[0009] An anti-HIV monoclonal antibody comprising a heavy chain and a light chain, wherein the monoclonal antibody has a heavy chain variable region of FR-CDR1-FR2 CDR2-FR3-CDR3-FR4 with a nucleotide coding sequence as shown in SEQ ID NO.1 in the sequence listing; a light chain variable region of FR1-CDR1-FR2-CDR2-FR3-CDR3 FR4 with a nucleotide coding sequence as shown in SEQ ID NO.2 in the sequence listing; the monoclonal antibody has the heavy chain variable region of FR1-CDR1-FR2-CDR2 FR3-CDR3-FR4 with an amino acid coding sequence as shown in SEQ ID NO.3 in the sequence listing; the light chain variable region of FR-CDR1-FR2-CDR2-FR3-CDR3 FR4 with an amino acid coding sequence as shown in SEQ ID NO.4 in the sequence listing.

[0010] A method for preparing the anti-HIV monoclonal antibody, comprising the steps of: (1) screening a sample with the best plasma neutralization titer and broad spectrum from an IV-infected individual without progression for a long time as a donor for antibody sorting, based on 12 strains of HIV pseudoviruses with different subtypes and neutralization sensitivities; the 12 strains of HIV pseudoviruses are 4 strains of subtype B: RHPA4259.7, SC42266.8, TRJO4551.58, REJO4541.67; 4 strains of subtype C: Du156.12, Du172.17, Du422.1, ZM55F.PB28a; 4 strains of AE subtype: 2249_13_21; 2316_14_22_3;2149_39_2_2;498_40_324;

(2) sorting an HIV-specific single memory B cell from a peripheral blood mononuclear cell (PBMC) in the donor by using HIV gp140 trimer proteins YU2 gp140 trimer and AEl gp140 trimer as sorting antigens; (3) placing a lysate from the B cell and a carrier RNA in an ice bath for 10 min, the product from which as a template to obtain cDNA by reverse transcription, followed by a nested PCR system amplification for heavy and light chain variable region genes of the antibody; (4) linking the heavy chain variable region of the antibody identified by sequencing with TOPO vector to an expression vector, and linking the light chain variable region of the antibody to an expression vector by homologous recombination, both products from which are expressed for antibodies in 293T, 293F and CHO-S cells; (5) incubating the supernatant from cell expression with 1/1000 rProtein A microspheres for 2 h at room temperature, followed by loading into a chromatography column for antibody purification to obtain the desired anti-HIV monoclonal antibody.

[0011] A use of the anti-HIV monoclonal antibody in the preparation of a drug for treating and preventing HIV infection.

[0012] Compared with the prior art, the present invention has the following beneficial technical effects:

[0013] The present invention sorts an HIV-specific single memory B cell from an IV infected individual without progression for a long time by using dual antigens of YU2 gp140 trimer and AEl gp140 trimer. The antibody has high binding activity and limited neutralizing activity. The optimized antibody gene cloning scheme (see Example 1 for details) improves the amplification efficiency of heavy and light chains. The discovery of the monoclonal antibody not only provides a candidate drug for preventing and treating HIV infection, but also provides a technical reference for the development of a monoclonal antibody against viral infection.

Brief Description of the Drawings

[0014] FIG. 1: Activity identification of HIV-specific antigen gp140 trimer protein. (A) The binding activity of gp140 protein to HIV-1 specific monoclonal antibody. (B) The binding activity of gp140 protein to plasma.

[0015] FIG. 2: Flow cytometric sorting for HIV-specific single memory B cells. CD20+CD27*YU2gp140+AE lgp140' cells were sorted individually into 96-well PCR plates. FSC: forward scattered light; SSC: side scattered light.

[0016] FIG. 3: Nested PCR amplification for antibody variable region genes. (A) PCR results for a heavy chain. (B) PCR results for a light chain ( chain).

[0017] FIG. 4: characteristic analysis of antibody variable region gene sequence (A) The germline gene source of the heavy chain variable region and the light chain variable region. (B) The mutation frequency of the variable region of the heavy chain and the variable region of the light chain. (C) The mutation frequency of different germline gene-derived sequences in the variable region of the heavy chain and the variable region of the light chain. (D) CDR3 length of the heavy chain variable region and the light chain variable region.

[0018] FIG. 5: Identification of expressed antibody protein. (A) Identification of the antibody protein expressed by cells through Western Blot, wherein the left panel represents the cell supernatant, and the right panel represents the intracellular. (B) Identification of the purified antibody protein by SDS-PAGE.

[0019] FIG. 6: The ability of the antibody to bind HIV-1 specific protein. (A) The ability of the antibody to bind the AEl gp140 trimer protein. (B) The ability of the antibody to bind

YU2 gp140 trimer protein. (C) The ability of the antibody to bind CRF_07BC gp140 trimer protein.

[0020] FIG. 7: Analysis of virus inhibition of monoclonal antibody 7D5

Detailed Description of Embodiments

[0021] The present invention will be further described in detail below with reference to the drawings and embodiments, but which are not limit to the technical solution of the present invention. All changes or equivalent replacements based on the teaching of the present invention shall belong to the protection of the present invention.

[0022] Example 1: Detailed description of the preparation process of the anti-HIV monoclonal antibody. (I) Detection of neutralization activity in plasma 1. Sample: This study passed the review of the Ethics Committee of Peking Union Medical College Hospital, and all patients signed informed consent forms. Inclusion criteria: (1) The results of the preliminary screening test and Western blot detection for the HIV antibody were all positive; (2) HIV infection for more than 4 years; (3) No prior treatment with antiretroviral therapy; (4) The viral load in plasma was detectable; (5) With PBMC samples. Exclusion criteria: (1) Age over 65 or under 18 years old; (2) Complicated with vital organ failure cause by serious opportunistic infections; (3) Serious liver and kidney disease; (4) Patients with active tumors; (5) Patients during pregnancy and lactation.

2. Neutralization activity test: the neutralization potency and broad spectrum of 59 samples against 12 HIV-1 pseudovirusess (4 strains of subtype B: RHPA4259.7, SC42266.8, TRJ04551.58, REJ04541.67; 4 strains of C subtype: Dul56.12, Dul72.17, Du422.1, ZM55F.PB28a; 4 strains of AE subtype: 2249_13_2_1; 2316_14_22_3; 2149_39_2_2; 498_40324) were detected. The methods were as follows: (1) The plasma sample was heat-inactivated at 56°C for 1 h, followed by brief centrifugation to remove insoluble substances. (2) In a 96-well cell culture plate, except for adding 150 pl GM (DEME+10% FBS+25 mM HEPES+1% double antibody) for the cell control (column 1), 100 pl GM was added to each well, plus 40 pl GM to 3A-3H and 8A-8H (see the table below). 1 2 3 4 5 6 7 8 9 10 11 12

A C V Q) B C V @ C C V @ @ D C V @) @ E C V M F C V ) G C V @ _

H C V @0

20 60 180 540 1620

(3) 11 l of plasma was pipetted to 3A-B, and ( ) plasma was pipetted to 3C-D in turn, that was, the dilution of the initial plasma was 1:20. (4) The plasma sample was mixed thoroughly, 50 pl from which were transferred into the next well, followed by a series of dilution of 3 times. (5) The HIV-1 pseudovirus was thawed and diluted with GM to 4000TCID5/ml, 50ptl (200TCID 5 o) from which were add to columns 2-12. (6) Incubation at 37°C for 1 h. (7) The TZM-bl cells were digested and resuspended with GM to obtain a cell concentration of 1.3x105 cells/ml, with addition of DEAE-dextranhydrochloride (10 mg/ml) to the concentration of 25 pg/ml. (8) 100 pl of cell suspension (i.e., per 1.3x104 cells) were pipetted to the cell plate with DEAE-dextranhydrochloride to the final concentration of 10 pg/ml.

(9) The cell plate was cultured in an incubator with a temperature of 37°C and a C02 concentration of 5% for 48 h. (10) Reading: cell culture medium was discarded after 48 h from the cell plate, which was washed with 200 pl PBS once and patted to dry; 20 pl Lysis Solution were added to each well with placement at room temperature for 10 min; 100 pl of the reaction substrate diluted with Reaction Buffer at 1:50 were added to each well with incubation at room temperature for 40 min; the plate was read by a microplate reader (setting luminescence 96well costar). (11) Calculation of the 50% inhibition dilution (ID5o) in plasma, the virus inhibition ratio for each dilution in plasma (%) = (VT)/(VC), T was the sample to be tested, C was the cell control, and V was the virus control; ID50was calculated by log(inhibitor) vs.response -Variable slope in GraphPad Prism. 3. Result analysis: the neutralization titer (ID5o) after activity screening was greater than 60, and 6 samples neutralized more than half of the virus strains (>6) could be used as candidate samples for neutralizing antibody sorting (see Table 1). Table 1. Candidate samples with neutralizing activity (ID5o)

No. Sample B8 B14 B16 B17 C3 C4 C5 C12 AEI AE2 AE3 AE4 GEO /12

1 Li-1 464 224 1573 143 26 66 69 <20 <20 <20 <20 20 67.4 8

2 L9-2 301 130 250 218 76 20 147 <20 59 <20 81 94 81.5 10

3 L9-3 163 123 710 224 22 25 346 <20 107 <20 106 62 86.3 10

4 PT15-3 29 <20 576 35 447 <20 <20 132 216 <20 145 <20 62.4 7

5 L8-2 68 63 144 35 47 54 56 74 71 49 144 44 64.3 12

6 PT7-2 172 34 149 <20 57 38 57 22 83 <20 460 280 67.6 10

ID50 was the 50% inhibitory dilution, GEO wsa the geometric mean, and /12 was the number of neutralizing strains. (II) Activity identification of HIV specific antigen 1. Enzyme linked immunosorbent assay (ELISA) to detect antigen activity (1) Antigen coating: the antigen (HIV-1YU2 gp140 timer protein or HIV-1AElgpl4O timer protein) was diluted to 1 g/ml with Phosphate Buffered Saline (PBS), and it was added to a ELISA plate at 100pl/well, with incubation at 37°C for 2 h. (2) Washing: washing for 3 times with PBST (PBS+0.5%o Tween-20). (3) Blocking: 100 pl of blocking solution (PBST+5% BSA) were added to block overnight at 4°C.

(4) Washing: washing with PBST for 3 times. (5) The plasma or antibody was serially diluted by 2 times with blocking solution on the dilution plate by addition of 100[ 1per well to the coated 96-well plate, with incubation at 37°C for 2 h. (6) Washing for 5 times with PBST. (7) The enzyme-labeled secondary antibody was diluted with blocking solution (1:20000) by addition of 100 1 per well, with incubation at 37°C for 1 h. (8) Washing for 5 times with PBST. (9) 100 1 of the mixture of chromogenic solution A and B at a ratio of 1:1 was add to each well, with placement in the dark at room temperature for 5-10 min. (10) 50 1 of the stop solution were added to stop the reaction. (11) Reading at 450 nm by a microplate reader. (12) Calculation of the mean and SD value of the negative plasma control group readings. The maximum dilution factor of the reading value greater than the control group average + 2xSD value was the antibody titer of the sample. 2. Result analysis: gp140 trimer protein could specifically bind to anti-HIV-1 monoclonal antibodies (VRC1, N6, 10-1074 and 10E8), and had a potent binding ability to the plasma of candidate samples (see FIG. 1). (III) Labelling of sorting antigen According to the instruction of Lightning-Link® PerCP Conjugation Kit and Lightning-Link Allophycocyanin (APC) Conjugation Kit labeling kit (Innova Biosciences), HIV-1gp140 trimer protein was fluorescently labelled with the steps as follows: (1) 1 1 of LL-modifier reagent was added to 10 l of HIV-YU2 gp140 trimer protein (at a concentration of 1.4 mg/ml) and 10 1 of HIV-1AE lgp140 trimer protein (at a concentration of 1.1mg/ml) respectively, and mixed gently until uniform. (2) The HIV-1YU2 gp140 trimer protein and LL-modifier mixture was added to 10 g of PerCP fluorescein lyophilized powder, and HIV-1AE1 gp140 trimer protein and LL modifier mixture was added to 10 g of APC fluorescein lyophilized powder, both of which were dissolved and mixed well. (3) Incubation in the dark at room temperature for 3 h. (4) 1 1 of LL-quencher reagent was added with incubation for 30 min before use. (4) Sorting for HIV-specific single memory B cells

(1) PBMC resuscitation: The PBMC (about 1x107 cells) of the frozen candidate samples were quickly resuscitated in a 37°C water bath and resuspended in 10 ml of RPMI 1640 medium (+10% FBS) preheated at 37°C, with centrifugation at 860xg for 5 min. (2) Labeling: the culture medium was discarded, and cells were resuspend in 10 ml of pre-cooled PBS, with centrifugation at 860xg for 5 min, followed by discarding the supernatant; the mixture of fluorescein-labeled antibody (CD20-PE, CD27-FITC) and antigen (YU2 gp140-PerCP, AEl gp140-APC) was added to cells, with incubation at room temperature for 1 h; cells were washed once with 10 ml of pre-cooled PBS and resuspended in 1 ml of pre-cooled PBS. (3) Sorting: the labeled PBMCs were analyzed and sorted on a FACSjazzTM Cell Sorter flow cytometer. CD20+CD27*YU2gp140+AElgp140' antigen-specific memory B cells were individually divided into 20 1 of lysis buffer ( 0.5 1 RNase Out, 5 d 5xfirst strand buffer, 1.25 1 0.1M DTT and 0.0625 1 Igepal) in a 96-well PCR plate. (4) Cryopreservation: quickly placing in dry ice, and moving to -80°C freezer for cryopreservation. (5) Results: A total of about 750 CD20+CD27*YU2gp140+AElgp140+ cells were obtained (see FIG. 2). (V) Gene cloning of a single B cell 1. Reverse transcription After thawing the above frozen 96-well plate, according to the instruction of SuperScript T M IV First-Strand Synthesis System (Invitrogen, 18091050), reagents for reverse transcription were added, with the steps as follows: (1) In a 96-well PCR plate, 1 1 of carrier RNA was added to each well, with placement on ice for 10 min. (2) To each well, addition of 2 1 of random hexamers at 50 ng/[l, 1.5 1 of dNTP mix,each at 10 mM. (3) Heat at 65°C for 5 min and placement on ice for at least 1 min. (4) RNase Inhibitor (40U/ l) 0.5 [ and 1 1 SuperScript IV were added. (5) Reaction conditions: 23°C for 10 min, 50°C for 20 min, followed by 80°C for 10 min. 2. Nested PCR (1) Nested PCR for heavy chain variable region

Primer:

Primer name Primer sequence (5' to 3')

First round

5' L-VH 1 ACAGGTGCCCACTCCCAGGTGCAG 5'L-VH 3 AAGGTGTCCAGTGTGARGTGCAG 5'L-VH 4/6 CCCAGATGGGTCCTGTCCCAGGTGCAG 5'L-VH 5 CAAGGAGTCTGTTCCGAGGTGCAG 3'Cy CHI GGAAGGTGTGCACGCCGCTGGTC Second round 5'EcoR I VH1 CCGGAATTCGTACATTCCCAGGTGCAGCTGGTGCAG 5'EcoR I VH1/5 CCGGAATTCGTACATTCCGAGGTGCAGCTGGTGCAG 5'EcoR I VH3 CCGGAATTCGTACATTCTGAGGTGCAGCTGGTGGAG 5'EcoR I VH3-23 CCGGAATTCGTACATTCTGAGGTGCAGCTGTTGGAG 5'EcoR I VH4 CCGGAATTCGTACATTCCCAGGTGCAGCTGCAGGAG 5'EcoR I VH 4-34 CCGGAATTCGTACATTCCCAGGTGCAGCTACAGCAGTG 5'EcoR I VH 1-18 CCGGAATTCGTACATTCCCAGGTTCAGCTGGTGCAG 5'EcoR I VH 1-24 CCGGAATTCGTACATTCCCAGGTCCAGCTGGTACAG

5'EcoR I VH3-33 CCGGAATTCGTACATTCTCAGGTGCAGCTGGTGGAG 5'EcoR I VH 3-9 CCGGAATTCGTACATTCTGAAGTGCAGCTGGTGGAG 5'EcoR I VH4-39 CCGGAATTCGTACATTCCCAGCTGCAGCTGCAGGAG 5'EcoR I VH 6-1 CCGGAATTCGTACATTCCCAGGTACAGCTGCAGCAG 3'Nhe I JH 1/2/4/5 CTAGCTAGCGCTGAGGAGACGGTGACCAG 3'Nhe I JH 3 CTAGCTAGCGCTGAAGAGACGGTGACCATTG 3'Nhe I JH 6 CTAGCTAGCGCTGAGGAGACGGTGACCGTG

The first round of nested PCR reaction system for the heavy chain gene of the antibody was as follows:

Reagent Usage amount

1Ox buffer 2pl dNTP mix 0 .4 pl

MgCl2 at 25 mM 0.4pl primer mix 1p1

Template 5pl

HotStar Taq DNA polymerase 0.2pl Sterilized distilled water l1 1 Total volume 20gi

PCR reaction conditions: pre-denaturation at 98°C for 15 min; PCR reaction at 94°C for 30 s, 56°C for 30 s, 72°C for 55 s, for 35 cycles; extension at 72°C for 10 min. The second round of nested PCR reaction system for the heavy chain gene of the antibody was as follows:

Reagent Usage amount

1Ox buffer 4g1 dNTP mix 0.8jd MgC2 at 25 mM 0.8pl primer mix 3g1

Template 4 g1

HotStar Taq DNA polymerase 0.3gl

Sterilized distilled water 27.1 1 Total volume 40gl

PCR reaction conditions: pre-denaturation at 98°C for 15 min; PCR reaction at 94°C for 30 s, 58°C for 30 s, 72°C for 45 s, for 40 cycles; extension at 72°C for 10 min. (2) Nested PCR for light chain (kappa) variable region Primer:

Prime: name Primer sequence (5' to 3') First round 5' L Vx 1/2 ATGAGGSTCCCYGCTCAGCTGCTGG 5'L VK 3 CTCTTCCTCCTGCTACTCTGGCTCCCAG 5' L VK 4 ATTTCTCTGTTGCTCTGGATCTCTG 3'CK 543 GTTTCTCGTAGTCTGCTTTGCTCA Second round 5' Pan VK ATGACCCAGWCTCCABYCWCCCTG 3' CK 494 GTGCTGTCCTTGCTGTCCTGCT Third round 5'Vx 1-5 CAACCGGTGTACATTCAGAATTCGTACATTCTGACATCCAGATGACCCAGTC 5'VC 1-9 CAACCGGTGTACATTCAGAATTCGTACATTCAGACATCCAGTTGACCCAGTCT 5'VK 1D-43 CAACCGGTGTACATTCAGAATTCGTACATTGTGCCATCCGGATGACCCAGTC 5'VK 2-24 CAACCGGTGTACATTCAGAATTCGTACATGGGGATATTGTGATGACCCAGAC 5'VK 2-28 CAACCGGTGTACATTCAGAATTCGTACATGGGGATATTGTGATGACTCAGTC 5'Vu 2-30 CAACCGGTGTACATTCAGAATTCGTACATGGGGATGTTGTGATGACTCAGTC 5'Vu 3-11 CAACCGGTGTACATTCAGAATTCGTACATTCAGAAATTGTGTTGACACAGTC 5'Vu 3-15 CAACCGGTGTACATTCAGAATTCGTACATTCAGAAATAGTGATGACGCAGFC 5'VK 3-20 CAACCGGTGTACATTCAGAATTCGTACATTCAGAAATTGTGTTGACGCAGTCT 5'VK 4-1 CAACCGGTGTACATTCAGAATTCGTACATTCGGACATCGTGATGACCCAGT

3'JK 1/4 CAGCCACCGTACGCAGCTGTTTGATYTCCACCTTGGTC 3'JK 2 CAGCCACCGTACGCAGCTGTTTGATCTCCAGCTTGGTC 3'JK 3 CAGCCACCGTACGCAGCTGTTTGATATCCACTTTGGTC 3'JK 5 CAGCCACCGTACGCAGCTGTTTAATCTCCAGTCGTGTC

The first round of nested PCR reaction system for the light chain (kappa) gene of the antibody was as follows:

Reagent Usage amount

PrimerSTAR Max Premix(2x) 1OIt Primer mix 0.8pi Template 5p1 Sterilized distilled water 4 2 1 . p Total volume 20Rl

PCR reaction conditions: pre-denaturation at 98°C for 2 min; 98°C for 10 s, 56°C for s, 72°C for 10 s, for 35 cycles; final extension at 72°C for 5 min.

The second round of nested PCR reaction system for the light chain (kappa) gene of the antibody was as follows:

Reagent Usage amount

PrimerSTAR Max Premix(2x) 10pil Primer mix 0.4pl Template 2g1

Sterilized distilled water 7.6ptl Total volume 20pl

PCR reaction conditions: pre-denaturation at 98°C for 2 min; 98°C for 10 s, 58°C for s, 72°C for 10 s, for 35 cycles; extension at 72°C for 5 min. The third round of nested PCR reaction system for the light chain kappa gene of the antibody was as follows:

Reagent Usage amount

PrimerSTAR Max Premix(2x) 20R1 Primer mix 2.8 1 Template 4d

Sterilized distilled water 13.2[1

Total volume 40pI

PCR reaction conditions: pre-denaturation at 98°C for 2 min; 98°C for 10 s, 60°C for s, 72°C for 10 s, for 35 cycles; extension at 72°C for 5 min. (3) Nested PCR for light chain (Lamda) variable region Primer:

Primer Primer sequence (5' to 3') name First round 5' L Vi 1 GGTCCTGGGCCCAGTCTGTGCTG 5'LV 2 GGTCCTGGGCCCAGTCTGCCCTG 5'LVK3 GCTCTGTGACCTCCTATGAGCTG 5' L V GGTCTCTCTCSCAGCYTGTGCTG 4/5 5'LVi6 GTTCTTGGGCCAATTTTATGCTG 5'L V 7 GGTCCAATTCYCAGGCTGTGGTG 5'LV 8 GAGTGGATTCTCAGACTGTGGTG 3'Ci CACCAGTGTGGCCTTGTTGGCTTG Second round 5'Vi 1 CAACCGGTGTACATTCAGAATTCTCCTGGGCCCAGTCTGTGCTGACKCAG 5'Vi 2 CAACCGGTGTACATTCAGAATTCTCCTGGGCCCAGTCTGCCCTGACTCAG 5'Vi 3 CAACCGGTGTACATTCAGAATTCTCTGTGACCTCCTATGAGCTGACWCAG 5'Vi 4/5 CAACCGGTGTACATTCAGAATTCTCTCTCTCSCAGCYTGTGCTGACTCA 5'Vi 6 CAACCGGTGTACATTCAGAATTCTCTTGGGCCAATTTTATGCTGACTCAG 5'Vi 7/8 CAACCGGTGTACATTCAGAATTCTCCAATTCYCAGRCTGTGGTGACYCAG 3'Cl CAGCCACCGTACGCAGCTGGGYGGGAACAGAGTG

The first round of nested PCR reaction system for the light chain Lamda gene of the antibody was as follows:

Reagent Usage amount

PrimerSTAR Max Premix(2x) lOIl Primer mix 1.6pl Template 5pl

Sterilized distilled water 3. 4 pl Total volume 20[d

PCR reaction conditions: pre-denaturation at 98°C for 2 min; 98°C for 10 s, 58°C for s, 72°C for 10 s, for 35 cycles; final extension at 72°C for 5 min. The second round of nested PCR reaction system for the light chain (Lamda) gene the antibody was as follows:

Reagent Usage amount

PrimerSTAR Max Premix(2x) 20pl Primer mix 1.4pt Template 4g1 Sterilized distilled water 14.6pl Total volume 40pl

PCR reaction conditions: pre-denaturation at 98°C for 2 min; 98°C for 1 Os, 60°C for s, 72°C for 10 s, for 40 cycles; extension at 72°C for 5 min. 3. Gel recovery and purification of PCR products (1) Column equilibration step: 500 pl of balance solution BL were added to the adsorption column CB2 (the adsorption column was placed in the collection tube), with centrifugation at 12,000 rpm for 1 min, and the waste liquid in the collection tube was discarded, and the adsorption column was put back into the collection tube. (2) The single target DNA band was cut from the agarose gel into a clean centrifuge tube, and weighted. (3) An equal volume of PC solution was added to the gel block (if the gel weight was 0.1 g, the volume could be regarded as 100 pl, then adding 1 0 0 pl PC solution), with placement in a water bath at 50°C for about 10 min, during which the centrifuge tube was turned up and down gently to ensure that the glue was fully dissolved (4) The solution obtained in the previous step was added to an adsorption column CB2 (the adsorption column was placed in the collection tube), with centrifugation at 12,000 rpm for 1 min, and the waste liquid in the collection tube was discarded, and the adsorption column CB2 was put into the collection tube. (5) 600 pl of rinsing solution PW (alcohol had been added) were added to the adsorption column CB2, with centrifugation at 12,000 rpm for 1 min, and the waste liquid in the collection tube was discarded, and the adsorption column CB2 was put into the collection tube; the operation steps were repeated. (6) The adsorption column CB2 was put into the collection tube, with centrifugation at 12,000 rpm for 2 min, and the rinse liquid was tried to remove. The adsorption column was placed at room temperature for a few minutes until dry thoroughly. (7) The adsorption column CB2 was put into a clean centrifuge tube, and an appropriate amount of preheated pure water was dropped into the middle of the adsorption membrane, with placement at room temperature for 2 min. Centrifugation at 12,000 rpm for 2 min to collect the DNA solution; the collected DNA solution was dropped onto the adsorption membrane with placement at room temperature for 2 min; centrifugation at 12,000 rpm for 2 min to collect the DNA solution again to increase the amount of DNA recovered. 4. Result analysis: the last round of PCR products was detected by 1% agarose gel electrophoresis(see FIG. 3), and the PCR products with positive fragments between 300 bp and 400 bp were recovered by gel. The concentration of purified DNA fragments was measured using Nanodrop. (VI) Heavy chain gene ligation vector 1. Ligation of the target fragment and the cloning vector Topo:

Reagent Usage amount

pCloneOO7 Blunt Simple Vector 1pl lOxTopo Mix 1 1d PCR gel recovery product 1

Sterilized distilled water 7p1 Total volume 10p1

Reaction at 25°C for 10 min. 2. Transformation of the ligation product into competent cell DH5a (1) Competent cells (100 pl) were thew in an ice bath, with additon of the ligation product (10 pl), and mixed gently until uniform, with placement on ice for 30 min. (2) Placement in a water bath at a temperature of 42°C and heat shock for 45 s, followed by quick transfer to an ice bath, with placement for 2 min. (3) 500 pl of sterile medium LB without antibiotics were added to the centrifuge tube and mixed well, followed by resuscitation in a shaker at a temperature of 37°C and a rotation speed of 200 rpm for 1 h. (4) The recovered bacterial liquid was evenly spred on the LB medium containing ampicillin, and after the bacterial liquid was absorbed, the plate was placed upside down in a 37°C incubator for overnight culture. 3. Plating

A single colony grown on the above LB plate was picked and added to 3 ml of ampicillin-resistant liquid LB medium, and cultured in a shaker at a temperature of 37°C and a rotating speed of 220 rpm for 6 h-7 h. 3 colonies wre picked from each plate. 4. Identification of positive clones The bacterial solution was sent to a biotechnology company for sequencing and identification. 5. Characteristic analysis of antibody heavy chain gene sequence The 181 heavy chain variable regions were derived from 6 different germline genes IGHIV1-2, IGHV1-69, IGHV3-11, IGIV3-15, IGIHV4-38 and IGHV4-59, of which IGIV1-2 accounts for the highest proportion of 63.9%, followed by IGHV1-69, with a proportion of 32.2%; and the sequence homology of genes from the same germline was very high, ranging from 98% to 99%. Compared with germline genes, the mutation frequency of the heavy chain variable region was between 6.5% and 32%, and the mutation frequency of the heavy chain variable region from the germline gene IGHV1-2 was the highest at 32.4%; the mutation frequency of the heavy chain variable region from the germline gene IGHV3-11 was 22%; the mutation frequencies of the heavy chain variable regions from the germline genes IGHV1-69, IGHV3-11, IGHV3-15, IGHV4-38 and IGHIV4-59 was lower, ranging from 6.5% to 10%, (See FIG. 4). In addition, the length analysis of the complementary determining region (CDR) CDR3 loop showed that the heavy chain variable region had 9aa, 1Oaa, l2aa, l4aa or 22aa HCDR3. 6. Ligation and identification of antibody heavy chain gene fragment and expression vector (1) The TOPO-H ligated with the correct antibody heavy chain gene fragment was digested with restriction enzymes EcoR I and Nhe I, with the reaction system as follows:

Reagent Usage amount

Topo-F Plasmid or expression vector CMVR-H 1 g (2-5pl) lOxNEBuffer 3 Rl EcoR I-HF 1 1 Nhe I-HF 11 Deionized water 20-23pl Total volume 30 pl

Reaction conditions: 37°C for 20 min.

After the enzyme digestion, agarose gel electrophoresis and gel recovery and purification were performed, with the same method as above. (2) According to the number of bases in the variable region, the corresponding expression vector was selected for ligation, with the reaction system as follows: Reagent Usage amount

Quick Ligase Reaction Buffer(2X) 5pl CMVR (vector) Il (-3Ong) Heavy chain gene fragment Ipl (-lOng) Quick Ligase 1pl Nuclease-free water 2d Total volume 1p

the above reaction solution was mixed well, with a ligation reaction for 10 min at 0 C. (3) The ligation product was transformed into DH5a competent cells, screened by kanamycin plates, and single clones were picked and cultured and sent for sequencing, with the same method as above. (4) Plasmid small extraction 1) Column balance: 500 tl of balance solution BL were added to the adsorption column CP3, with centrifugation at 12000 rpm for 1 min, and the waste liquid in the collection tube was discarded, and the adsorption column was put back into the collection tube. 2) 3 ml of the bacterial solution cultured overnight were pipetted to a 1.5 ml centrifuge tube, with centrifugation at 12000 rpm for 1 min, and the supernatant was discarded; and collecting repeatedly. 3) 250 pl of solution P1 (RNaseA had been sure to add) were added into the centrifuge tube with bacterial pellets, and the bacterial solution was mixed well by pipetting or shaken by a vortex. 4) 250 pl of solution P2 were added to the centrifuge tube, with gently turning up and down for 6-8 times until mixing well and lysing the bacterial solution. 5) 350 pl of solution P3 were added to the centrifuge tube, with gently turning up and down for 6-8 times immediately until mixing well. At this time, a white flocculent precipitate would appear, with centrifugation at 12000 rpm for 10 min.

6) The supernatant collected in the previous step was transferred by pipetting to the adsorption column CP3 (the adsorption column was placed in the collection tube), and be careful not to pipette the precipitate. After centrifugation at 12000 rpm/min for 1 min, the waste liquid in the collection tube was discarded, and the adsorption column CP3 was put into the collection tube. 7) 600 pl of rinsing solution PW were added to the adsorption column CP3 (please check whether ethanol had been added), with centrifugation at 12000 rpm/min for 1 min, and the waste liquid in the collection tube was discarded, and the adsorption column CP3 was put into the collection tube; the operation Step (7) was repeated. 8) The adsorption column CP3 was put into the collection tube with centrifugation at 12000 rpm/min for 2 min to remove the residual rinsing liquid in the adsorption column. 9) The adsorption column CP3 was put in a clean centrifuge tube, and 30 pl of preheated pure water were dropwised to the center of the adsorption membrane, with placement at room temperature for 5 min, followed by centrifugation at 12000 rpm/min for 2 min to collect the plasmid solution in the centrifuge tube; the operation Step (9) was repeated. (VII) Expression vector for light chain gene ligation 1. The light chain expression vector CMVR-L was double digested with restriction enzymes EcoR I and Pvu II, with the reaction system as follows:

Reagent Usage amount

CMVR-L 1p (lgg) lOxNEBuffer 3 1 EcoR I-HF 1 1 Pvu II-HF 1 1 Deionized water 24pl Total volume 30 pl

Reaction conditions: 37°C for 20 min. After the enzyme digestion, agarose gel electrophoresis and gel recovery and purification were performed, with the same method as above. 2. The homologous recombination of the PCR gel recovered product of the light chain with the double digested expression vector was conducted, with the reaction system as follows:

Reagent Usage amount

SoSoo(2X) 5pl CMVR-L l p (-3Ong) Light chain gene fragment 1d (-1Ong) Nuclease-free water 3tl Total volume io

the above reaction solution was mixed well, with a ligation reaction for 20min at 50°C. 3. The ligation product was transformed into DH5a competent cells, screened by kanamycin plates, and single clones were picked and cultured and sent for sequencing, with the same method as above. 4. Characteristic analysis of antibody heavy chain gene sequence The light chain variable region derived from two different germline genes IGKV1 *03 and IGKV1-33*01, with the proportion of 95% and 5%, respectively. The two light chain variable regions derived from germline genes IGKV1-5*03 and IGKV1-33*01 had mutation frequencies of 4% and 21%, respectively (see FIG. 3). In addition, the length analysis of the CDR3 loop of the complementary determining region (CDR) showed that the LCDR3 had 5aa or 8aa (see FIG. 4). (VIII) Antibody expression in different cell lines 1. Antibody expression in 293T cell system The successfully paired antibody heavy chain and light chain gene expression vector were transiently transfect into 293T cells: (1) 4x105 293T cells per well were plated in a 12-well plate at 24 h before transfection. (2) The confluence of cells on the day of transfection was observed, preferably at %-80%. (3) 1 tg of endotoxin-free plasmid DNA was diluted with 50 pl of Opti-MEM medium. (4) 6 pl of Lipofectamine@2000Reagent were diluted with 50 pl of Opti-MEM medium. (5) The above DNA was mixed with Lipofectamine@2000 in a volume ratio of 1:1, with incubation at room temperature for 5 min. (6) 100 pl of the mixed solution were pipetted and gently added to 293T cells, with culture at 37°C with 5% Co 2 .

(7) After 48 h, cells and supernatant were collected, with centrifugation at 12,000 rpm for 2 min, followed by collecting the supernatant, which was stored at -20°C. 1 ml of pre cooled PBS was pipetted into the centrifuge tube, and the cell pellets was mixed well by pipetting, with centrifugation at 12,000 rpm for 2 min, followed by discarding the supernatant and washing twice. 100 1 cell lysate was adding in an ice bath for 10 min, with centrifugation at 12,000 rpm for 5 min, followed by harvesting the supernatant. The cell culture supernatant and the supernatant harvested after pellets lysis were subjected to SDS-PAGE and Western-Blot detection, respectively (see FIG. 5A). 2. Antibody expression in CHO-S cell system (1) Plasmids from the positively cloned and paired heavy chain and light chain were extracted by the endotoxin-free large extraction kit, and filtered and sterilizeed with a 0.22 tm needle filter. (2) 24 h before transfection, CHO-S cells were passaged at 5x105 cells/ml, and cultured under 120 rmp-135 rpm at 37°C (125 ml shake flask) with 8% C02. 6 6 (3) On the day of transfection, cells with a concentration of about 1.2x10 -1.5x10 cells/ml were diluted to a concentration of 1x106 cells/ml, with the cell survival rate >95% to ensure transfection efficiency; 30 ml of cells were added to 125 ml shake flask. (4) The FreeStyle T M MAX transfection reagent was gently mixed by inversion. (5) 37.5 pg of endotoxin-free and sterile plasmid DNA (molar ratio of weight with light chain was 1:1) were diluted with 0.6 ml OptiProTMSFM and mixed well; in another tube, 37.5 ml of FreeStyle TM MAX Transfection Reagent was dilutred with 0.6 ml of OptiProTMSFM and mixed well by gentle inversion; followed by immediately adding the diluted FreeStyle T M MAX to the diluted DNA solution and mixing gently. (6) DNA-FreeStyle T MMAX mixture was incubated at room temperature for 10 min to form a complex. (7) This 1.2 ml of DNA-FreeStyle TMMAX mixture was added into a 125 ml shake flask containing 30 ml cells, and manually rotated the bottle slowly to mix. (8) The transfected cells were cultured at 37°C with 8% CO2 under 135 rpm for 6 days to 7 days, and then centrifuged at 3000 rpm for 20 min to collect the supernatant. 3. Antibody expression in 293F cell system (1) One day before transfection, 293F cells in the logarithmic growth phase with a viability higher than 90% were plated into a fresh medium at a density of 2x106 cells/ml, with cultivation at 37°C with 5% C02 in a constant temperature shaker (125 ml shake flask) under a rotating speed of 150 rpm-175 rpm. (2) On the day of transfection, sampling and counting the cell density and viability. The cell density should be in the range of 3x106 -5x106 cells/ml, and the viability rate should be higher than 90%. The cell density was adjusted to 3x106 cells/ml, and the volume of each bottle of cell fluid was 30 ml. (3) Preparation of transfection solution: 30 g of DNA (molar ratio of weight with light chain was 1:1) were diluted with 150 mM NaCl solution to a total volume of 0.75 ml, and mixed gently; 100 1 of Sinofection transfection reagent were diluted with 150 mM NaCl to the total volume of 0.75 ml, and mixed gently; the diluted DNA and the transfection reagent were placed separately for about 5 min at the same time and then gently mixed to the total volume of 1.5 ml, and then placed at room temperature for 10 min. (4) The transfection solution was dropwised into the cell culture solution, with gently shaking the culture flask at the same timie, and then put back on the shaker to continue culturing. (5) 1%-5% SMS 293-SUPI feed solution was added at 24 h after transfection, and the feed solution (1%-5%) was added every 48 h. Depending on the expression characteristics of different proteins, samples could be collected within 6-10 days after transfection. (IX) Antibody purification 1. Purification of antibodies by affinity chromatography (1) Buffer preparation: the water and buffer were filtered with a 0.45 m filter membrane, including bonding/washing buffer (0.15 M NaCl, 20 mM Na2HPO 4 , pH7.0), eluting buffer (0.1 M glycine, pH 3.0), Neutralization solution (1 M Tris-HCl, pH 8.5). (2) Sample preparation: the cell supernatant was filtered with a 0.45 mfilter membrane to reduce impurities, improve protein purification efficiency and prevent clogging of the column. (3) Sample purification 1) rProtein A Beads was mixed with the cell supernatant with incubation for 2 h under slow shaking on a shaker. 2) An appropriate amount of rProtein A Beads was loaded into the chromatography column, and the chromatography was equilibrateed with 5 times the column volume of binding Buffer.

3) The incubated cell supernatant was added to the balanced rProtein A Beads, and the effluent was collected; the effluent was added back to the chromatography column with collection of the effluent. 4) Washing with 10 times column volume of washing Buffer to remove non specifically adsorbed impurities. 5) With 10 times the column volume of the eluting buffer to collect the eluate, which was the target protein fraction. 6) Equilibrate the packing with 3 times column volume of binding Buffer and 5 times column volume of deionized water in turn, and finally equilibrate with 5 times column volume of 20% ethanol, and then stored in an equal volume of 20% ethanol with storage at 4 0 C. 7) Protein quantify of the purified antibody by BCA method. The quantitative results showed that the concentration of purified antibody was in a range of 0.1 mg/ml-0.5 mg/ml. 2. Result analysis: SDS-PAGE showed that the protein purity after affinity chromatography was relatively high, suggesting that the target antibody could be used for activity analysis in vitro (see FIG. 5B). (X) Specific binding analysis of a monoclonal antibody 1. The binding ability of a monoclonal antibody to HIV specific antigens detected by ELISA (1) Antigen coating: the antigen (HIV-1gp140 monomer (CRF_07BC) or HIV-1gp140 trimer (YU2 and AEl)) was diluted to 1 g/ml with Phosphate Buffered Saline (PBS), and it was added in a microtiter plate, with incubation at 370 C for 2h at 100 l/well. (2) Washing: washing for 3 times with PBST (PBS+0.5%o Tween-20). (3) Blocking: 100 1 of blocking solution (PBST+5% BSA) were added to block overnight at 40 C. (4) Washing: washing with PBST for 3 times. (5) The antibody was diluted serially by 2 times with blocking solution on the dilution plate (at an initial concentration of 10 g/ml), by additon of 100 1 per well to the coated 96-well plate, with incubation at 37 0 C for 2 h. (6) Washing for 5 times with PBST. (7) The enzyme-labeled secondary antibody was diluted with blocking solution (1:20000) by addition of 100 1 per well, with incubation at 37 0 C for 1 h. (8) Washing for 5 times with PBST.

(9) 100 [ of the mixture of chromogenic solution A and B at a ratio of 1:1 was add to each well, with placement in the dark at room temperature for 5-10 min. (10) 50 1 of the stop solution were added to stop the reaction. (11) Reading at 450 nm by a microplate reader. (12) An antibody concentration-absorbance curve Was depicted. 2. Result analysis: In the 8 tested antibodies, 7D5 had the strongest binding ability to three different subtype antigens, followed by 7F7 and 8H5, while 53, 8A4, 8E5, 8F10 and 8H4 had relatively weaker binding activity to HIV-1 specific antigens. Compared with the control antibody VRC01, the binding activity of 7D5 with B subtype antigen YU2 gp140 trimer and CRF_07BC gp140 monomer was weaker, but the binding activity with AE subtype antigen was significantly higher than VRC01. In addition, the binding ability of 7F7 to AE subtype antigen was also higher than VRC01 (see FIG. 6). (XI) Analysis of the neutralization activity of a monoclonal antibody 1. The neutralization activity of a monoclonal antibody detected by the neutralization test (1) In a 96-well cell culture plate, except for adding 150 1 GM (DEME+10% FBS+25 mM HEPES+1% double antibody) for the cell control (column 1), 100 1 GM was added to each well. (2) The antibody was added to 3A-3H and 8A-8H (ie, antibody was added to 3A B, antibody 4 was added to 3C-D, in turn), the initial concentration of antibody was 20 ptg/ml, with supplement of GM to make the total volume to 150 1 (3) The antibody was mixed thoroughly, 50 1 from which were transferred into the next well, followed by a series of dilution of 3 times. (4) The HIV-1 pseudovirus was thawed under room temperature and diluted with GM to 4000TCID 5o/ml, 50[ 1(200TCID 5 o) from which were add to columns 2-12. (5) Incubation at 37°C for 1 h. (6) The TZM-bl cells were digested and resuspended with GM to obtain a cell concentration of 1.3x105 cells/ml, with addition of DEAE-dextranhydrochloride (10 mg/ml) to the concentration of 25 g/ml. (7) 100 pl of cell suspension (i.e., per 1.3x104 cells) were pipetted to the cell plate with DEAE-dextranhydrochloride to the final concentration of 10 g/ml. (8) Incubation at 37°C with 5% C02 for 48 h.

(10) Reading: cell culture medium was discarded after 48 h from the cell plate, which was washed with 200 pl PBS once and patted to dry; 20 pl of LysisSolution were added to each well with placement at room temperature for 10 min; 100 pl of the reaction substrate diluted with Reaction Buffer at 1:50 were added to each well with incubation at room temperature for 40 min; the plate was read by a microplate reader (setting luminescence 96well costar). (10) Calculation of the 50% inhibitory concentration (IC5 0 ) of the antibody: inhibition rate = (V-T)/(V-C), T was the sample to be tested, C was the cell control, and V was the virus control; IC5 0 was calculated using Graphpad Prism. 2. Result analysis: In the 8 tested antibodies, 7D5 had the best neutralizing activity, which could neutralize B subtype strains and some C subtype strains, and also had partial neutralizing activity on REJ04541.67 of tier3. The IC5 0 of the remaining 7 test antibodies 53, 7F7, 8A4, 8E5, 8F10, 8H4, and 8H5 against the 8 strains of the four subtypes were all greater than 20 pg/ml (see Table 2). Table 2. Antibody neutralization activity (IC5 0 , tg/ml)

TIER2 TIER3

CLADE B C CRFOIAE CRF_07BC B

VIRUS REJO4 DU422. ZM55F. 224913 231614 CH119 CHI1 TRJ04551.

541.67 1 PB28A _2_1 22-3 58 7D5 1.02 16.19 >20 >20 >20 >20 >20 13.16

53 >20 >20 >20 >20 >20 >20 >20 >20

7F7 >20 >20 >20 >20 >20 >20 >20 >20 8A4 >20 >20 >20 >20 >20 >20 >20 >20 8E5 >20 >20 >20 >20 >20 >20 >20 >20

8F10 >20 >20 >20 >20 >20 >20 >20 >20 8H4 >20 >20 >20 >20 >20 >20 >20 >20 8H5 >20 >20 >20 >20 >20 >20 >20 >20

[0023] Example 2: The monoclonal antibody 7D5 obtained in Example 1 was used to inhibit HIV infection 1. Virus inhibition experiment (1) Cell preparation: TZM-bl cells were passaged at least three times after resuscitation, with the cell viability rate of greater than 90%.

(2) In a 96-well cell plate, incubation 50 1 of (200TCIDo) HIV (REJ04541.67) with 100 1 of monoclonal antibody 7D5 at different concentrations at 37°C for 1 h. (3) 100 pl of TZM-bl cells were immediately added at a concentration of 1.3x105 cells/ml, and DEAE-dextran hydrochloride with the final concentration of 10 g/ml had been added to the cell suspension. (4) Incubation at 37°C with 5% C02 for 48 h. (5) Reading: the fluorescence signal in the well plate was detected by a microplate reader. (6) Calculation the virus inhibitory activity of the antibody: inhibition rate=(V-T)/(V C), T was the test sample, C was the cell control, and V was the virus control. 2. Result analysis: from the results, it could be seen that the inhibitory effect of monoclonal antibody 7D5 on the virus was dose-dependent. When the antibody concentration was 10 [g/ml, the inhibition rate on the virus reached 96% (see FIG. 7).

Claims (3)

1. An anti-HIV monoclonal antibody comprising a heavy chain and a light chain, wherein the monoclonal antibody has a heavy chain variable region of FR-CDR-FR2 CDR2-FR3-CDR3-FR4 with a nucleotide coding sequence as shown in SEQ ID NO.1 in the sequence listing; a light chain variable region of FR1-CDR1-FR2-CDR2-FR3-CDR3 FR4 with a nucleotide coding sequence as shown in SEQ ID NO.2 in the sequence listing; the monoclonal antibody has the heavy chain variable region of FR1-CDR1-FR2-CDR2 FR3-CDR3-FR4 with an amino acid coding sequence as shown in SEQ ID NO.3 in the sequence listing; the light chain variable region of FR-CDR1-FR2-CDR2-FR3-CDR3 FR4 with an amino acid coding sequence as shown in SEQ ID NO.4 in the sequence listing.

2. A method for preparing the anti-HIV monoclonal antibody of claim 1, comprising the steps of: (1) screening a sample with the best plasma neutralization titer and broad spectrum from an IV-infected individual without progression for a long time as a donor for antibody sorting, based on 12 strains of HIV pseudoviruses with different subtypes and neutralization sensitivities; the 12 strains of HIV pseudoviruses are 4 strains of subtype B: RHPA4259.7, SC42266.8, TRJO4551.58 and REJO4541.67; 4 strains of subtype C: Du156.12, Du172.17, Du422.1 and ZM55F.PB28a; 4 strains of AE subtype: 224913_2_1, 2316_14_22_3,2149_39_2_2 and498_40_32_4; (2) sorting an HIV-specific single memory B cell from a peripheral blood mononuclear cell in the donor by using HIV gp140 trimer proteins: YU2 gp140 trimer and AEl gp140 trimer as sorting antigens; (3) placing a lysate from the B cell and a carrier RNA in an ice bath for 10 min, the product from which as a template to obtain cDNA by reverse transcription, followed by a nested PCR system amplification for heavy and light chain variable region genes of the antibody; (4) linking the heavy chain variable region of the antibody identified by sequencing with TOPO vector to an expression vector, and linking the light chain variable region of the antibody to an expression vector by homologous recombination, both products from which are expressed for antibodies in 293T, 293F and CHO-S cells;

(5) incubating the supernatant from cell expression with 1/1000 rProtein A microspheres for 2 h at room temperature, followed by loading into a chromatography column for antibody purification to obtain the desired anti-HIV monoclonal antibody.

3. A use of the anti-HIV monoclonal antibody of claim 1 in the preparation of a drug for treating and preventing HIV infection.