AU2020103435A4 - Method for preparing (s)-1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid and derivatives thereof - Google Patents

Abstract

Disclosed in the present disclosure is a method for preparing (S)-1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid and derivatives thereof, comprising: taking a racemate of a compound represented by Formula (I) or a racemate of a salt of the compound represented by Formula (I) as a substrate, and making a R-isomer of the compound represented by Formula (I) in the substrate react under the catalysis of oxidative dehydrogenase to generate imino acid represented by formula (II); and converting the imino acid represented by Formula (II) into an S-isomer of the compound represented by Formula (I) in the presence of pipecolic acid reductase and a coenzyme capable of supplying hydrogen anions. The present disclosure is featured by mild reaction condition, strong stereoselectivity, high reaction efficiency, high conversion rate, etc. R, R, NH N R2::OH R2 O OH 0 OH

Description

SPECIFICATION METHOD FOR PREPARING (S)-1,2,3,4-TETRAHYDROISOQUINOLINE-1-CARBOXYLIC ACID AND DERIVATIVES THEREOF

Technical Field of the Invention

The present disclosure belongs to the field of biocatalysis technology, in particular, relates to a method for preparing (S)-1,2,3,4-tetrahydroisoquinoline-1 carboxylic acid and derivatives thereof.

Background of the Invention

1,2,3,4-tetrahydroisoquinoline compounds are a very important class of pharmaceutical intermediates, which are widely used in the synthesis of multiple drugs. In recent years, Hu et al. (Discovery of a small-molecule inhibitor and cellular probe of Keap1-Nrf2 protein-protein interaction [J]. Bioorg Med Chem Lett, 2013, 23(10): 3039-43) used (S)- 1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid as the starting compound to synthesize an inhibitor targeting Kelch-like ECH-associated protein 1 (Keap1), which is expected to be used in treatment and prevention of cancer, diabetes, Alzheimer's disease and Parkinson's disease, etc.. However, most of isoquinoline alkaloids having medical value have 6,7-dimethoxy (such as papaverine and emetine), which is beneficial to reduce the hydrophobicity of drug molecules and improve druggability, such as 6,7-dimethoxy-1,2,3,4 tetrahydroisoquinoline-1-carboxylic acid. In the prior art, there are two kinds of method to prepare optically pure (S) 1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid or (S)-6,7-dimethoxy-1,2,3,4 tetrahydroisoquinoline-1-carboxylic acid: chemical chiral synthesis and biocatalytic chiral resolution. The chemical chiral synthesis method starts from chiral raw materials to synthesize (S)- 1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid, or example, Kurata et al. used optically pure alkene isoquinoline as the starting material to asymmetrically synthesize (S)- 1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid in a three-step sequence of ozonolysis, NaBH 4 in-situ reduction, tetramethyl-piperidine N-oxide (TEMPO) oxidation, and trifluoroacetic acid-mediated deprotection of N-tert-butoxycarbonyl (Synthesis of Optically Pure (R)- and (S)-Tetrahydroisoquinoline-1- and -3-Carboxylic Acids [J]. Synthesis, 2015, 47(09): 1238-44). This method has a low yield and complicated steps, and is not suitable for industrialized application. Bulyszko et al. employed Petasis synthesis and Pomeranz-Fritsch-Bobbitt synthesis to diastereoselectively synthesize (S)-6,7-dimethoxy- 1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid, with ee value of 90% (Synthesis of (+)-6,7-Dimethoxy-1,2,3,4-tetrahydroisoquinoline-1-carboxylic Acid, a Diastereoselective Approach [J]. EuropeanJournalof Organic Chemistry, 2015, 2015(2): 383-8). By contrast, the biocatalysis has advantages such as strong stereoselectivity, mild reaction conditions, which is a potential advantageous method for preparing (S)- 1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid or derivatives thereof. Pail et al. synthesized (S)-6,7-dimethoxy-1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid through subtilisin-catalysed dynamic kinetic resolution of 6,7-dimethoxy-1,2,3,4 tetrahydroisoquinoline-1-carboxylic acid, with 53.46 g/L substrate, 80 mg/mL immobilized enzyme, at 3 °C and pH 8.5 for 3 days, in a yield 92 %, ee value of product 93 % (Directed (R)- or (S)-Selective Dynamic Kinetic Enzymatic Hydrolysis of 1,2,3,4-Tetrahydroisoquinoline-l-carboxylic Esters [J]. European Journalof Organic Chemistry, 2008, 2008(31): 5269-76). This method has mild reaction conditions, strong stereoselectivity, and a relatively simple process, however, the optical purity of the products needs to be improved.

Summary of the Invention The present disclosure is aimed to solve the shortage of the prior art, and provide a novel method for preparing (S)-1,2,3,4-tetrahydroisoquinoline-1 carboxylic acid and derivatives thereof.

To achieve the above purpose, the technical solution employed by the present disclosure is as follows: A method for preparing an S-isomer of a compound represented by Formula

(I), R1

NH R2)

0 OH

(I) in Formula (I), R1 and R2 are independently selected from the group consisting of hydrogen, C 1 -C 6 alkyl, C 1 -C 6 alkoxy, and the method comprises the following steps: taking a racemate of a compound represented by Formula (I) or a racemate of a salt of the compound represented by Formula (I) as a substrate, and making a R-isomer of the compound represented by Formula (I) in the substrate react under the catalysis of oxidative dehydrogenase to generate imino acid represented by formula (II); R,

N R2)D T O OH()

converting the imino acid represented by Formula (II) into an S-isomer of the compound represented by Formula (I) in the presence of pipecolic acid reductase and a coenzyme capable of supplying hydrogen anions. According to some preferred aspects of the present disclosure, in Formula (I), R 1 and R2 are independently selected from the group consisting of hydrogen, methyl, ethyl, isopropyl, methoxy, or ethoxy. According to some preferred aspects of the present disclosure, the salt is a one-valence salt, specifically, preferably is an alkali metal salt or ammonium salt, wherein, the alkali metal salt may be for example a lithium salt, a sodium salt, or a potassium salt.

According to some preferred aspects of the present disclosure, an S-isomer of the compound represented by Formula (I)is (S)-1,2,3,4-tetrahydroisoquinoline-1 carboxylic acid or (S)-6,7-dimethoxy-1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid. According to the present disclosure, the oxidative dehydrogenase is an enzyme capable of selectively catalyzing the R-isomer of the compound represented by Formula (I), with a selectivity greater than or equal to 80 %, preferably greater than or equal to 90 %. According to some preferred aspects of the present disclosure, the oxidative dehydrogenase is D-amino acid oxidase. According to the present disclosure, the D-amino acid oxidase is selected from the group consisting of D-amino acid oxidase or its mutants derived from Trigonopsis variabilisCBS 4095 or other D-amino acid oxidase whose amino acid sequence homology is greater than 80 % therewith, D-amino acid oxidase or its mutants derived from Fusariumgraminearum CS3005 or other D-amino acid oxidase whose amino acid sequence homology is greater than 80 % therewith, D-amino acid oxidase or its mutants derived from Fusariumpoae 2516 or other D-amino acid oxidase whose amino acid sequence homology is greater than 80 therewith, D-amino acid oxidase or its mutants derived from Fusariumsolani %

M-0718 or other D-amino acid oxidase whose amino acid sequence homology is greater than 80 % therewith, combinations thereof. Preferably, the D-amino acid oxidase has an amino acid sequence as shown in SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3 or SEQ ID NO. 4. According to some specific and preferred aspects of the present disclosure, the added amount of the D-amino acid oxidase is based on the wet weight of cells after centrifugation at 8000 rpm for 10 min, and the added amount of the cells is 1 to 5 %

of the weight of the reaction system. According to some specific and preferred aspects of the present disclosure, the use form of the D-amino acid oxidase is unorganized D-amino acid oxidase, crude enzyme containing unorganized D-amino acid oxidase, pure D-amino acid oxidase, immobilized D-amino acid oxidase, or cells intracellularly expressing D-amino acid oxidase. Further, the cell is an engineering bacteria expressing D-amino acid oxidase and containing an expression vector pET-28a(+), and a host cell of the engineering bacteria is E. coli BL21(DE3); wherein, the D-amino acid oxidase gene is connected to the expression vector pET-28a(+). According to the present disclosure, the pipecolic acid reductase is selected from the group consisting of pipecolic acid reductase or its mutants derived from Pseudomonasputida KT2440 or other pipecolic acid reductase whose amino acid sequence homology is greater than 80 %therewith, pipecolic acid reductase or its mutants derived fromPseudomonas aeruginosaPAO1 or other pipecolic acid reductase whose amino acid sequence homology is greater than 80 % therewith, pipecolic acid reductase or its mutants derived fromPseudomonasfluorescensPf0-1 or other pipecolic acid reductase whose amino acid sequence homology is greater than 80 %therewith, pipecolic acid reductase or its mutants derived from Pseudomonas entomophila str. L48 or other pipecolic acid reductase whose amino acid sequence homology is greater than 80 % therewith, combinations thereof. Preferably, the pipecolic acid reductase has an amino acid sequence as shown in SEQ ID NO. 5, SEQ ID NO. 6, SEQ ID NO. 7 or SEQ ID NO. 8. According to some specific and preferred aspects of the present disclosure, the added amount of the pipecolic acid reductase is based on the wet weight of cells after centrifugation at 4000 rpm for 10 min, and the added amount of the cells is 1 to 5 % of the weight of the reaction system. According to some specific and preferred aspects of the present disclosure, the use form of the pipecolic acid reductase is unorganized pipecolic acid reductase, crude enzyme containing unorganized pipecolic acid reductase, pure pipecolic acid reductase, immobilized pipecolic acid reductase, or cells intracellularly expressing pipecolic acid reductase. Further, the cell is an engineering bacteria expressing pipecolic acid reductase and containing an expression vector pET-28a(+), and a host cell of the engineering bacteria is E. coli BL21(DE3); wherein, the pipecolic acid reductase gene is connected to the expression vector pET-28a(+). According to some preferred aspects of the present disclosure, the coenzyme capable of supplying hydrogen anions is NADH and/or NADPH. According to some preferred aspects of the present disclosure, the reaction to generate imino acid is also carried out in the presence of flavin adenine dinucleotide (FAD). The reaction being carried out in the presence of FAD, contributes to improve the conversion rate. Further, FAD equivalents is equal to or in excess of the substrate equivalents. In general, the prepared crude D-amino acid oxidase already has enough FAD, and in the case of directly using the crude enzyme, there is no need to add additional FAD. In the case ofusing pure D-amino acid oxidase, an appropriate amount of FAD can be added as needed. According to some preferred aspects of the present disclosure, the reaction to generate imino acid is also carried out in the presence of catalase. According to some specific and preferred aspects of the present disclosure, the reaction to generate imino acid is also carried out at a setting temperature in an aerobic environment. According to some preferred aspects of the present disclosure, the setting temperature ranges from 20 to 70 °C. More preferably, the setting temperature ranges from 20 to 50 °C. Further preferably, the setting temperature ranges from 30 to 40 °C. According to some specific and preferred aspects of the present disclosure, the implementation process of the method comprises: first building a reaction system, then controlling the reaction system to react at a setting temperature in an aerobic environment, in which the reaction system comprises the substrate, the oxidative dehydrogenation, the pipecolic acid reductase, the coenzyme, a coenzyme regeneration system and a solvent, the reaction system selectively comprises a pH buffer and/or pH regulator, the coenzyme comprises NAD+ (oxidized form of nicotinamide adenine dinucleotide) and/or NADH (reduced form of nicotinamide adenine dinucleotide), or, the coenzyme comprises NADP+ (oxidized form of nicotinamide adenine dinucleotide phosphate) and/or NADPH (reduced nicotinamide adenine dinucleotide phosphate). According to some preferred aspects of the present disclosure, the pH of the reaction system is controlled to be 6 to 9. More preferably, the pH of the reaction system is controlled to be 7 to 8.5. According to some preferred aspects of the present disclosure, the concentration of the initial substrate in the reaction system is controlled to be 1 to g/L. More preferably, the concentration of the initial substrate in the reaction system is controlled to be 1 to 20 g/L. According to a specific aspect of the present disclosure, the concentration of the initial substrate in the reaction system is controlled to be 5 g/L. According to a specific and preferred aspect of the present disclosure, the pH buffer is phosphate, which can be dissolved in water to prepare a phosphate buffer solution. According to some preferred aspects of the present disclosure, the pH regulator is ammonia, alkali metal hydroxide or aqueous solution thereof. According to a specific and preferred aspect of the present disclosure, the pH regulator is 20 wt% to 35 wt% ammonia. According to another specific aspect of the present disclosure, the pH regulator is aqueous solution of sodium hydroxide or potassium hydroxide. According to some specific and preferred aspects of the present disclosure, the added amount of the coenzyme is 1 %.to 1 % of the substrate concentration. According to the present disclosure, the coenzyme regeneration system comprises a coenzyme regeneration enzyme and a coenzyme regeneration substrate. According to some preferred aspects of the present disclosure, the coenzyme regeneration enzyme is glucose dehydrogenase, and the coenzyme regeneration substrate is glucose; or the coenzyme regeneration enzyme is alcohol dehydrogenase, and the coenzyme regeneration substrate is isopropanol. According to a specific aspect of the present disclosure, the glucose specifically uses D-glucose.

According to a specific aspect of the present disclosure, the glucose dehydrogenase is derived from Bacillus subtilis 168; and/or, the alcohol dehydrogenase is derived from Lactobscillus kefir DSM20587. Preferably, the glucose dehydrogenase has an amino acid sequence as shown in SEQ ID NO. 9. Preferably, the alcohol dehydrogenase has an amino acid sequence as shown in SEQ ID NO. 10. According to some preferred aspects of the present disclosure, the reaction system further comprises catalase. According to some preferred aspects of the present disclosure, the catalase is bovine liver catalase lyophilized powder. According to a specific aspect of the present disclosure, the enzyme activity of the bovine liver catalase lyophilized powder is 4000 U/mg. According to some preferred aspects of the present disclosure, a ratio of enzyme activities of the catalase and the oxidative dehydrogenase is (100 to 400): 1. According to som preferred aspects of the present disclosure, the reaction system further comprises flavin adenine dinucleotide. According to some specific and preferred aspects of the present disclosure, the method further comprises a separation step. According to the present disclosure, the separation step comprises: adjusting the pH of the reaction system after the reaction to 5.0 - 6.0, heating to denature and precipitate proteins, vacuum filtering, concentrating the filtrate, cooling and crystallizing, and drying to give an S-isomer of the compound represented by Formula (I). Due to the implementation of the above technical solutions, the present disclosure has the following beneficial effects over the prior art: The present disclousre finds out that in the co-presence of pipecolic acid reductase and a coenzyme capable of supplying hydrogen anions, the imino acid can be efficiently converted into the S-isomer of the compound represented by Formula (I), which has good selectivity, high yield, mild reaction conditions, and a relatively simple process, and the ee value of the S-isomer with respect to the R-isomer in the prepared product is > 99%.

Brief Description of the Drawings

Figure 1 shows a HPLC spectrum of two optical isomers of the substrate racemic 1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid (1 g/L); in which, the retention time of 8.810 min is (R)- 1,2,3,4 tetrahydroisoquinoline-1-carboxylic acid; the retention time of 12.685 min is (S) 1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid; Figure 2 is a HPLC spectrum of a sample taken at 0 hours in the reaction system in Embodiment 3; Figure 3 is a HPLC spectrum of a sample taken after 16 hours of reaction in Embodiment 3.

Detailed Description of Exemplary Embodiments

The present disclosure provides a novel method for preparing (S)-1,2,3,4 tetrahydroisoquinoline-1-carboxylic acid and derivatives thereof, and this method has advantages such as mild reaction conditions, strong stereoselectivity, high reaction efficiency and high yield, and has an industrialized application prospect. According to a specific aspect of the present disclosure, the method takes racemic 1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid or racemic 6,7 dimethoxy-1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid as a substrate, and obtains (S)-1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid or (S)-6,7-dimethoxy 1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid throught the catalysis of a multienzyme system, and the multienzyme system consists of oxidase dehydrogenase (preferably D-amino acid oxidase), catalase, pipecolic acid reductase and coenzyme (preferably NADP* and/or NADPH), coenzyme regeneration system, etc.. The specific principle is: racemic 1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid or racemic 6,7-dimethoxy-1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid is taken as a substrate, the stereoselectivity of the D-amino acid oxidase is utilized to catalyze the oxidative dehydrogenation of the (R)-1,2,3,4-tetrahydroisoquinoline -1-carboxylic acid or (R)-6,7-dimethoxy-1,2,3,4-tetrahydroisoquinoline-1 carboxylic acid to generate imino acid, and the (S)-1,2,3,4-tetrahydroisoquinoline 1-carboxylic acid or (S)-6,7-dimethoxy-1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid is basically not been catalyzed and remained in the reaction system. The hydrogen peroxide produced during the reaction process is catalytically decomposed into water and oxygen through catalase. The imino acid is asymmetrically reduced into (S)-1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid or (S)-6,7-dimethoxy-1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid through pipecolic acid reductase. During this process, the reduced coenzyme II, namely reduced nicotinamide adenine dinucleotide phosphate (NADPH) is oxidized to NADP* (oxidized form of nicotinamide adenine dinucleotide phosphate), and the NADP+ is reduced to NADPH through the coenzyme regeneration system. The course of reaction is as follows: RI D-amino acid RI RI oxidase 'C NH 1 ~N +) - NH R2 2 R2 R2 O OH o OH OOH

1: R1 = H, R2= H catalase imino acid (S)-1: RI = H R2= H

2 Ri = -MeO, R,= -MeO (S)-2: RI = -MeO, R2= -MCO

coenzyme | pipecolic acid reductase regenerationsysten NADP'

by-product coenzyme regeneration

coenzyne substrate

regeneration enzyme

Further, the reaction to generate the imino acid is preferably carried out in the presence of flavin adenine dinucleotide (FAD), and during the reaction process, flavin adenine dinucleotide (FAD) is reduced to FADH 2, and then molecular oxygen is reduced to hydrogen peroxide (H 2 0 2 ), and FADH 2 isoxidized to FAD. The hydrogen peroxide is catalytically decomposed into water and oxygen through catalase. The course of reaction is as follows:

D-amino acid R R NH oxidase N NH N NH R) FAD FADH, R.

0 OH 0 OH OOH : Rj= H R2= H H20 2 imn aci (S)-1: R,= H, R2 = H immnoacid(S-:R= MR,=Me 2: R, = -MeO, R 2 = -MeO catalase (S)2R1 =-MeO,R2=-MeO pipecolic acid reductase

regenerationsystem NADPH NADP+

by-product W coenzyme regeneration coenzyme substrate regeneration enzyme

As preferred, the D-amino acid oxidase is derived from Trigonopsis variabilis, Fusariumgraminearum,Fusariumpoae or Fusariumsolani. Specifically, the D-amino acid oxidase is derived from Trigonopsis variabilis CBS 4095, Fusarium graminearum CS3005, Fusariumpoae 2516 or Fusariumsolani M-0718. As preferred, the pipecolic acid reductase is derived from Pseudomonas putida, Pseudomonas aeruginosa,Pseudomonasfluorescens,or Pseudomonas entomophila str. Specifically, the pipecolic acid reductase is derived from pipecolic acid reductase or its mutants from Pseudomonasputida KT2440, Pseudomonas aeruginosa PAG1,Pseudomonasfluorescens PfO-1 or Pseudomonas entomophila str L48 or other pipecolic acid reductase whose amino acid sequence homology is greater than 80 % therewith. As preferred, the coenzyme regeneration system comprises a coenzyme regeneration enzyme and a coenzyme regeneration substrate, and the coenzyme regeneration enzyme is derived from Bacillus subtilis or Lactobscillus kefir Specifically, the coenzyme regeneration enzyme is glucose dehydrogenase derived from Bacillus subtilis 168, or, alcohol dehydrogenase derived from Lactobscillus kefir DSM20587. Specifically, in the reaction system, the use form of the multienzyme system may be unorganized enzymes, crude enzymes, engineering bacteria resting cells expressing the recombinase, pure enzymes, or immobilized enzymes. As preferred, the concentration of the initial substrate racemic 1,2,3,4 tetrahydroisoquinoline-1-carboxylic acid or racemic 6,7-dimethoxy-1,2,3,4 tetrahydroisoquinoline--carboxylic acid in the reaction system ranges from 1 to 20 g/L. More preferably, the concentration of the initial substrate in the reaction system is controlled to be 1 to 20 g/L. According to a specific aspect of the present disclosure, the concentration of the initial substrate in the reaction system is controlled to be 5 g/L. As preferred, in the reaction system, the added amount of the D-amino acid oxidase is based on the wet weight of cells after centrifugation at 4000 rpm for 10 min, and the added amount of the cells is 1 to 5 % of the weight of the reaction liquid. As preferred, in the reaction system, the catalase is bovine liver catalase lyophilized powder with an enzyme activity of 4000 U/mg, and a ratio of enzyme activities of the catalase and the D-amino acid oxidase is (100 to 400): 1. As preferred, in the reaction system, the added amount of the pipecolic acid reductase is based on the wet weight of cells after centrifugation at 4000 rpm for 10 min, and the added amount of the cells is I to 5 % of the weight of the reaction liquid. As preferred, in the reaction system, the added amount of the coenzyme regeneration enzyme is based on the wet weight of cells after centrifugation at 4000 rpm for 10 min, and the added amount of the cells is 1 to 5 % of the weight of the reaction liquid. As preferred, in the reaction system, oxidized form of nicotinamide adenine dinucleotide phosphate (NADP+) may be added as the initial coenzyme, and the added amount of the coenzyme is 1 %.to 1 %. As preferred, in the reaction system, the reaction temperature is 20 to 70 °C, the reaction time is 6 to 72 hours, the pH of the reaction liquid is 6 to 9; more preferably, the temperature is 30 to 40 °C, and the reaction time is 12 to 48 hours.

The pH of the reaction is controlled to be 7 to 8.5 through the phosphoric acid buffer. In the following, the present disclosure is further explained combining with specific embodiments. It should be understood that the following embodiments are only for illustrating the present disclosure, rather than limiting the scope of the present disclosure. The experimental methods in the embodiments of the present disclosure are conventional methods, unless otherwise specified. The genes used in the embodiments of the present disclosure is synthesized by Sangon Biotech (Shanghai) Co., Ltd.. E. coli BL21(DE3) strain was purchased from Novagen; DNA marker, PrimeStar DNA polymerase, low molecular weight standard protein and other molecular biology experiment reagents were purchased from TaKaRa. For specific operations of gene cloning and expression, please refer to "Molecular Cloning: A Laboratory Manual" edited by J. Sambrook et al.. The present disclosure analyzed each product and substrate of the catalytic reaction through high performance liquid chromatography (HPLC). The HPLC analysis method of racemic 1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid was: column/ CHIRALPAK* ZWIX(-); column temperature/ 25 °C; flow rate/ 0.4 mL/min; detection wavelength/ UV 220 nm; mobile phase: HPLC grade methanol (add 50 mM formic acid and 25 mM dihexylamine). See Figure 1 for the specific peaks of related substances. The HPLC analysis method of racemic 6,7-dimethoxy 1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid was: column/ Chirobiotic TAG; column temperature/ 25 °C; flow rate/ 0.8 mL/min; detection wavelength/ UV 220 nm and 232 nm; mobile phase: HPLC grade methanol/water (1:1) (Directed (R)- or (S)-Selective Dynamic Kinetic Enzymatic Hydrolysis of 1,2,3,4 Tetrahydroisoquinoline-1-carboxylic Esters [J]. EuropeanJournalof Organic Chemistry, 2008, 2008(31): 5269-76).

Embodiment 1: Construction of Genetically Engineered Strains 1.1 Screening of D-amino acid oxidase and construction of genetically engineered bacteria expressing D-amino acid oxidase According to the specificity of the substrates, D-amino acid oxidase derived from microorganisms can be divided into two categories: 1) prefers amino acids with smaller side chain groups (such as D-alanine) as the substrate, such as D-amino acid oxidase derived from Fusarium oxysporum; 2) prefers amino acids with larger side chain groups (such as D-phenylalanine) as the substrate, such as D-amino acid oxidase derived from Trigonopsis variabilis(POLLEGIONI L, MOLLA G, SACCHI S, et al. Properties and applications of microbial D-amino acid oxidases: current state and perspectives [J]. Apple MicrobiolBiotechnol, 2008, 78(1): 1-16.). BLASTp analysis of the amino acid sequences of these two D-amino acid oxidases were carried out in the National Center for Biotechnology Information (NCBI) database (https://www.ncbi.nlm.nih.gov/), and 4 kinds of D-amino acid oxidases with different sequence identities were selected for further study (as shown in Table 1). Table 1: D-amino acid oxidases derived from four different sources Serial Protein Source NCBI accession Protein sequence NO. name number E1 FsDAAO Fusariumsolani M-0718 BAA00692.1 SEQ ID NO. 1

E2 FgDAAO FusariumgraminearumCS3005 EYB24484.1 SEQ ID NO. 2

E3 FpDAAO Fusariumpoae 2516 OBS19408.1 SEQ ID NO. 3 E4 TvDAAO Trigonopsis variabilisCBS 4095 CAA90322.1 SEQ ID NO. 4

The above-mentioned D-amino acid oxidase gene sequences were codon-optimized and sent to Sangon Biotech (Shanghai) Co., Ltd. for gene synthesis, and cloned into the recombinant expression plasmid pET-28a(+). The recombinant plasmid was transferred into the expression host E.coli BL21(DE3), and after sequencing was verified to be correct, glycerol with an initial concentration of 25 % was added to the obtained engineered bacteria liquid and stored at -80 °C for later use. 1.2 Construction of genetically engineered bacteria expressing pipecolic acid reductase The pipecolic acid reductase genes were respectively cloned from

Pseudomonasputida KT2440 genome, PseudomonasaeruginosaPA Igenome, Pseudomonasfluorescens PfO-1 genome or Pseudomonas entomophila str. L48 genome (shown in Table 2). Table 2: Pipecolic acid reductases derived from four different sources Serial Protein Source NCBI accession Protein NO. name number sequence

E5 PpdpkA PseudomonasputidaKT2440 SKC02707.1 SEQ ID NO. 5

E6 PadpkA Pseudomonas aeruginosaPAOI NP_249943.1 SEQ ID NO. 6

E7 PfdpkA PseudomonasfluorescensPfO-I ABA74308.1 SEQ ID NO. 7

E8 PedpkA Pseudomonas entomophila str L48 CAK15457.1 SEQ ID NO. 8

The PCR upstream primers and downstream primers were designed according to the corresponding gene DNA sequences. The primers of pipecolic acid reductase derived from Pseudomonasputida KT2440 are: KT2440-F: 5'- CGGGATCC ATGTCCGCACCTTCCACCAGCAC -3'(BamHI) KT2440-R: 5'- CCCAAGCTT TCAGCCAAGCAGCTCTTTCAGG -3' (HindIII) The primers of pipecolic acid reductase derived from Pseudomonas aeruginosa PAO1 are: PAOl-F: 5'- CGGGATCCGTGATCCGAATGACGCTGGAC -3' (BamHI) PAO1-R: 5'- CCCAAGCTTTCACTCCAGCAACGCCAGC -3'(HindIII) The primers of pipecolic acid reductase derived from Pseudomonas fluorescens PfO-1 are: PfO-1-F: 5'- CGGGATCCATGTCTGCGCCACACGATC -3'(BamH I) PfO-1-R: 5'-CCGCTCGAGTTACTCGCCGGCCAGTTCAC-3'(XhoI) The primers of pipecolic acid reductase derived from Pseudomonas entomophila str L48 are: L48-F: 5'- CGGGATCCGTGCGCGTAGCCTTCAAC -3'(BamHI) L48-R: 5'- CCCAAGCTTTCACCTCGCCAGCGCCTTC -3'(HindIII) Restriction endonuclease cleavage sites were inserted to the upstream and downstream primers respectively, as indicated by the underline, and the specific restriction endonucleases are shown in parentheses of the primer sequences. The Pseudomonasputida KT2440 genome DNA, the Pseudomonas aeruginosa PAO1 genome DNA, the PseudomonasfluorescensPf0-1 genome DNA, and the Pseudomonas entomophilastr. L48 genome DNA were used as templates, the corresponding upstream and downstream primers were utilized to perform PCR amplification reaction, and the PCR reaction system and the reaction conditions are as follows: PCR amplification system: DNA polymerase 25 pL; Upstream primer (10 pmol/pl) 2.5 pL; Downstream primer (10 pmol/pl) 2.5 pL; Template 2.5 pL; ddH20 17.5 pL. PCR amplification conditions: 1) Initial denaturation at 95 °C for 5 min; 2) 30 cycles denaturation at 95 °C for 10 s, annealing at 58 °C for 15 s, and extension at 72 °C for 10 s; 3) Extension at 72 °C for 10 min; 4) Heat preservation at 4 °C. After the PCR amplification reaction was completed, 1.0 % agarose gel electrophoresis was used to detect the amplification result, and the result showed that the amplified product was a single band of about 1000 bp. The target band was recovered with a DNA recovery and purification kit, and refer to the purification kit instructions for specific steps. The expression vector pET-28a(+) and the PCR amplified product were double digested with corresponding restriction endonucleases. After the enzyme digestion was completed, the target band was recovered with a DNA recovery and purification kit. Subsequently, the double digested PCR amplification product was ligated to the expression vector pET-28a(+) with corresponding sticky ends by T4 DNA ligase, and the ligation system is shown in Table 3 below: Table 3: Construction system of recombinant expression plasmid

Reagent Volume PCR amplification product: 10 pL pET-28a(+) plasmid 7 pL T4 ligase 1 L 10 x ligase Buffer 2 tL

The enzyme-ligated product was transformed into E. coli DH5a competent

cells, plated, and a single colony was cultured in an LB liquid medium, the positive

transformants were identified by PCR and sent to the sequencing company to verify

the correctness of the inserted sequence. Plasmids were extracted from verified

positive transformants, and refer to the plasmid extraction kit for related methods.

The recombinant expression vector was transferred into the expression host E. coli

BL21(DE3), and after PCR and sequencing of the bacteria liquid were verified to be

correct, glycerol with an initial concentration of 25 % was added to the obtained

engineered bacteria liquid and stored at -80 °C for later use. 1.3 Construction of genetically engineered bacteria expressing coenzyme regeneration enzyme The glucose dehydrogenase gene was cloned fromBacillus subtilis 168

genome (NCBI accession number: NP_388275.1, SEQ ID NO. 9); the alcohol dehydrogenase gene was cloned from Lactobacillus kefiri DSM20587 genome

(NCBI accession number: AAP94029.1, SEQ ID NO. 10). The specific method and steps refer to the construction method of pipecolic acid reductase expression strain

in Section 1.2. The corresponding upstream primers and downstream primers were

as follows:

The primers of the glucose dehydrogenase derived from Bacillus subtilis 168

are: BGdh-F: 5'- GAAGATCTGATGTATCCGGATTTAAAAGGAAAAGTC-3'(Bgl II) BGdh-R: 5'- CATGCCATGGTTAACCGCGGC-3'(Nco I) The primers of the alcohol dehydrogenase derived from Lactobacillus kefiri

DSM20587 are: LAdh-F: 5'- CCGAATTCATGACCGATCGTCTGAAGGGC-3'(EcoR I) LAdh-R: 5'- CCCAAGCTTTCACTGTGCGGTATACCCGCC-3'(Hind III).

Embodiment 2 2.1 Cultivation of microorganisms The composition of liquid LB medium: peptone 10 g/L, yeast powder 5 g/L, and NaC1 10 g/L were dissolved in deionized water to volume, and sterilized at 121 °C for 20 min, for use. If it was a solid LB medium, 15 g/L agar was added. The engineered bacteria containing the D-amino acid oxidase gene was inoculated into 5 mL liquid LB (containing 50 pg/ml kanamycin) medium, and cultured with shaking at 200 rpm at 37 °C for about 8 hours. 1 % (V/V) inoculation amount was inoculated in 100 mL liquid LB (containing 50 pg/ml kanamycin) medium for culture, after OD 60 0 reached 0.6 - 0.8, an inducer isopropyl thiogalactoside (initial concentration was 0.1 mM) was added, and the system was induced at 18 °C for 15 h. After the culture was finished, the culture solution was poured into a 100 mL centrifuge tube and centrifuged at 4000 rpm for 10 min, the supernatant was discarded, and the bacterial cells was collected, washed twice with mM phosphate buffer (pH 8.0), and stored at -80 °C in a ultra-low temperature refrigerator for later use. 2.2 Preparation of crude enzyme The cells were resuspended in 25 mL phosphate buffer (50 mM, pH 8.0), subject to ultrasonication, and centrifuged to obtain the supernatant, which was crude enzyme containing D-amino acid oxidase or pipecolic acid reductase or coenzyme regeneration enzyme.

Embodiment 3: FsDAAO-PpdpkA multienzyme coupling to prepare (S)-1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid According to the method of Embodiment 2, crude D-amino acid oxidase derived fromFusariumsolani M-0718, crude pipecolic acid reductase derived from Pseudomonasputida KT2440, and crude glucose dehydrogenase derived from Bacillus subtilis 168 were prepared, respectively. 0.2 g of racemic 1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid hydrochloride was weighted and added to a 100 mL reaction bottle, 10 mL phosphate buffer (50 mM, pH = 8.0) was added, and the solution was mixed evenly, and adjusted to pH 8.0 with 30 % ammonia. 20 ml FsDAAO crude enzyme (the crude enzyme contained enough coenzyme FAD, therefore, there was no need to add additional FAD to the reaction system of the crude enzyme), 7.6 ml PpdpkA crude enzyme, 2.4 ml crude glucose dehydrogenase, 2 mg catalase, NADP* and D-glucose were added, to make the concentration of the racemic 1,2,3,4 tetrahydroisoquinoline--carboxylic acid be 5 g/L, the concentration of NADP+ be 0.05 mM and the concentration of D-glucose be 15 mM in the initial reaction system. After mixing evenly, a sample was taken immediately as "0 hour". The reaction temperature was controlled by a water bath at 30 °C, the system was magnetically stirred, the reaction pH was adjusted in the range from 8 to 8.5 with ammonia, and a sample was taken after 16 hours of reaction. The contents of the two configurations of 1,2,3,4- tetrahydroisoquinoline-1-carboxylic acid in the samples were tested by high performance liquid chromatography, that is, the concentrations (g/L) of the two configurations of 1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid in the reaction liquid can be known. The test results were shown in Figure 2 and Figure 3, FsDAAO exhibits strict R-configuration stereoselectivity, a yield of (S)-1,2,3,4-tetrahydroisoquinoline-1 carboxylic acid in the reaction liquid was 98.4% (yield = actual product concentration (g/L)/ theoretical product concentration (g/L) x 100 %), and ee value was 99.2 %.

Embodiment 4: FpDAAO-PadpkA multienzyme coupling to prepare (S)-1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid According to the method of Embodiment 2, crude D-amino acid oxidase derived fromFusariumpoae 2516, crude pipecolic acid reductase derived from Pseudomonas aeruginosa PAO1, and crude alcohol dehydrogenase derived from Lactobacillus kefiri DSM20587 were prepared, respectively. 0.4 g of racemic 1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid hydrochloride was weighted and added to a 100 mL reaction bottle, 10 mL phosphate buffer (50 mM, pH = 8.0) was added, and the solution was mixed evenly, and adjusted to pH 8.0 with 30 % ammonia. 20 ml FpDAAO crude enzyme, 8 ml PadpkA crude enzyme, 2.4 ml crude alcohol dehydrogenase, 2 mg catalase, NADP+ and isopropanol were added, to make the concentration of the racemic 1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid be 10 g/L, the concentration of NADP+ be 0.1 mM and the concentration of isopropanol be 25 mM in the initial reaction system. After mixing evenly, a sample was taken immediately as "0 hour". The reaction temperature was controlled by a water bath at 30 °C, the system was magnetically stirred, and a sample was taken after 30 hours of reaction. The contents of the two configurations of 1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid in the samples were tested by high performance liquid chromatography, that is, the concentrations (g/L) of the two configurations of 1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid in the reaction liquid can be known. The yield of (S)-1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid in the reaction liquid was 95.2% (the calculation method was the same as Embodiment 3), and ee value was 99.4 %.

Embodiment 5: FgDAAO-PfdpkA multienzyme coupling to prepare (s)-1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid According to the method of Embodiment 2, crude D-amino acid oxidase derived fromFusariumgraminearumCS3005, crude pipecolic acid reductase derived from PseudomonasfluorescensPfO-1, and crude glucose dehydrogenase derived from Bacillus subtilis 168 were prepared, respectively. 0.04 g of racemic 1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid hydrochloride was weighted and added to a 100 mL reaction bottle, 10 mL phosphate buffer (50 mM, pH = 8.0) was added, and the solution was mixed evenly, and adjusted to pH 8.0 with 30 % ammonia. 20 ml FgDAAO crude enzyme, 7.5 ml PfdpkA crude enzyme, 2.5 ml crude glucose dehydrogenase, 2 mg catalase, NADP+ and D-glucose were added, to make the concentration of the racemic 1,2,3,4- tetrahydroisoquinoline-1-carboxylic acid in the initial reaction system be 1 g/L, the concentration of NADP* be 0.01 mM and the concentration of D-glucose be 3 mM. After mixing evenly, a sample was taken immediately as "0 hour". The reaction temperature was controlled by a water bath at 30 °C, the system was magnetically stirred, the reaction pH was adjusted in the range from 8 to 8.5 with ammonia, and a sample was taken after 6 hours of reaction. The contents of the two configurations of 1,2,3,4-tetrahydroisoquinoline--carboxylic acid in the samples were tested by high performance liquid chromatography, that is, the concentrations (g/L) of the two configurations of 1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid in the reaction liquid can be known. The yield of (S)-1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid in the reaction liquid was 99.4% (the calculation method was the same as Embodiment 3), and ee value was 99.1%.

Embodiment 6: TvDAAO-PedpkA multienzyme coupling to prepare (S)-1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid According to the method of Embodiment 2, crude D-amino acid oxidase derived from Trigonopsis variabilisCBS 4095, crude pipecolic acid reductase derived from Pseudomonas entomophila str L48, and crude alcohol dehydrogenase derived from Lactobacillus kefiri DSM20587 were prepared, respectively. 0.8 g of racemic 1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid hydrochloride was weighted and added to a 100 mL reaction bottle, 10 mL phosphate buffer (50 mM, pH = 8.0) was added, and the solution was mixed evenly, and adjusted to pH 8.0 with 30 % ammonia. 20 ml TvDAAO crude enzyme, 8 ml PedpkA crude enzyme, 2.4 ml crude alcohol dehydrogenase, 2 mg catalase, NADP+ and isopropanol were added, to make the concentration of the racemic 1,2,3,4 tetrahydroisoquinoline-1-carboxylic acid be 20 g/L, the concentration of NADP+ be 0.1 mM and the concentration of isopropanol be 50 mM in the initial reaction system. After mixing evenly, a sample was taken immediately as "0 hour". The reaction temperature was controlled by a water bath at 30 °C, the system was magnetically stirred, and a sample was taken after 50 hours of reaction. The contents of the two configurations of 1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid in the samples were tested by high performance liquid chromatography, that is, the concentrations (g/L) of the two configurations of 1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid in the reaction liquid can be known. The yield of (S)-1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid in the reaction liquid was 92.5% (the calculation method was the same as Embodiment 3), and ee value was 99.2%.

Embodiment 7: FsDAAO-PpdpkA multienzyme coupling to prepare (S)-6,7-dimethoxy-1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid According to the method of Embodiment 2, crude D-amino acid oxidase derived fromFusariumsolani M-0718, crude pipecolic acid reductase derived from Pseudomonasputida KT2440, and crude glucose dehydrogenase derived from Bacillus subtilis 168 were prepared, respectively. 0.2 g of racemic 6,7-dimethoxy-1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid was weighted and added to a 100 mL reaction bottle, 10 mL phosphate buffer (50 mM, pH = 8.0) was added, and the solution was mixed evenly, and adjusted to pH 8.0 with 30 % ammonia. 20 ml FsDAAO crude enzyme, 7.6 ml PpdpkA crude enzyme, 2.4 ml crude glucose dehydrogenase, 2 mg catalase, NADP+ and D-glucose were added, to make the concentration of the racemic 6,7-dimethoxy 1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid be 5 g/L, the concentration of NADP+ be 0.05 mM and the concentration of D-glucose be 15 mM in the initial reaction system. After mixing evenly, a sample was taken immediately as "0 hour". The reaction temperature was controlled by a water bath at 30 °C, the system was magnetically stirred, the reaction pH was adjusted in the range from 8 to 8.5 with ammonia, and a sample was taken after 19 hours of reaction. The contents of the two configurations of 6,7-dimethoxy-1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid in the samples were tested by high performance liquid chromatography, that is, the concentrations (g/L) of the two configurations of 6,7-dimethoxy-1,2,3,4-tetrahydroisoquinoline-1- carboxylic acid in the reaction liquid can be known. The yield of (S)-6,7 dimethoxy-1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid in the reaction liquid was 97.4% (the calculation method was the same as Embodiment 3), and ee value was 99.1%.

Embodiment 8: FpDAAO-PfdpkA multienzyme coupling to prepare (S)-6,7-dimethoxy-1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid According to the method of Embodiment 2, crude D-amino acid oxidase derived fromFusariumpoae 2516, crude pipecolic acid reductase derived from PseudomonasfluorescensPfO-1, and crude alcohol dehydrogenase derived from Lactobacillus kefiri DSM20587 were prepared, respectively. 0.16g of racemic 6,7-dimethoxy-1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid was weighted and added to a 100 mL reaction bottle, 10 mL phosphate buffer (50 mM, pH = 8.0) was added, and the solution was mixed evenly, and adjusted to pH 8.0 with 30 % ammonia. 20 ml FpDAAO crude enzyme, 8 ml PfdpkA crude enzyme, 2 ml crude alcohol dehydrogenase, 2 mg catalase, NADP+ and isopropanol were added, to make the concentration of the racemic 6,7-dimethoxy 1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid be 4 g/L, the concentration of NADP* be 0.01 mM and the concentration of isopropanol be 10 mM in the initial reaction system. After mixing evenly, a sample was taken immediately as "0 hour". The reaction temperature was controlled by a water bath at 30 °C, the system was magnetically stirred, and a sample was taken after 20 hours of reaction. The contents of the two configurations of 6,7-dimethoxy-1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid in the samples were tested by high performance liquid chromatography, that is, the concentrations (g/L) of the two configurations of 6,7-dimethoxy-1,2,3,4-tetrahydroisoquinoline-1 carboxylic acid in the reaction liquid can be known. The yield of (S)-6,7 dimethoxy-1,2,3,4-tetrahydroisoquinoline--carboxylic acid was 94.8% (the calculation method was the same as Embodiment 3), and ee value was 99.2%.

Embodiment 9: FgDAAO-PadpkA multienzyme coupling to prepare (S)-6,7-dimethoxy-1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid According to the method of Embodiment 2, crude D-amino acid oxidase derived fromFusariumgraminearumCS3005, crude pipecolic acid reductase derived from PseudomonasaeruginosaPAO1, and crude glucose dehydrogenase derived fromBacillus subtilis 168 were prepared, respectively. 0.1 g of racemic 6,7-dimethoxy-1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid was weighted and added to a 100 mL reaction bottle, 10 mL phosphate buffer (50 mM, pH = 8.0) was added, and the solution was mixed evenly, and adjusted to pH 8.0 with 30 % ammonia. 20 ml FgDAAO crude enzyme, 8 ml PadpkA crude enzyme, 2 ml crude glucose dehydrogenase, 2 mg catalase, NADP* and D-glucose were added, to make the concentration of the racemic 6,7-dimethoxy-1,2,3,4 tetrahydroisoquinoline--carboxylic acid be 2.5 g/L, the concentration of NADP* be 0.01 mM and the concentration of D-glucose be 5 mM in the initial reaction system. After mixing evenly, a sample was taken immediately as "0 hour". The reaction temperature was controlled by a water bath at 30 °C, the system was magnetically stirred, the reaction pH was adjusted in the range from 8 to 8.5 with ammonia, and a sample was taken after 20 hours of reaction. The contents of the two configurations of 6,7-dimethoxy-1,2,3,4- tetrahydroisoquinoline-1-carboxylic acid in the samples were tested by high performance liquid chromatography, that is, the concentrations (g/L) of the two configurations of 6,7-dimethoxy-1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid in the reaction liquid can be known. The yield of (S)-6,7-dimethoxy-1,2,3,4 tetrahydroisoquinoline-1-carboxylic acid was 96.5% (the calculation method was the same as Embodiment 3), and ee value was 99.2%.

Embodiment 10: TvDAAO-PedpkA multienzyme coupling to prepare (S)-6,7-dimethoxy-1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid According to the method of Embodiment 2, crude D-amino acid oxidase derived from Trigonopsis variabilis CBS 4095, crude pipecolic acid reductase derived from Pseudomonas entomophila str L48, and crude alcohol dehydrogenase derived from Lactobacillus kefiri DSM20587 were prepared, respectively. 0.5 g of racemic 6,7-dimethoxy-1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid was weighted and added to a 100mL reaction bottle, 10 mL phosphate buffer (50 mM, pH = 8.0) was added, and the solution was mixed evenly, and adjusted to pH 8.0 with 30 % ammonia. 20 ml TvDAAO crude enzyme, 8 ml PedpkA crude enzyme, 2 ml crude alcohol dehydrogenase, 2 mg catalase, NADP+ and isopropanol were added, to make the concentration of the racemic 6,7-dimethoxy-1,2,3,4 tetrahydroisoquinoline-1-carboxylic acid be 12.5 g/L, the concentration of NADP+ be 0.02 mM and the concentration of isopropanol be 25 mM in the initial reaction system. After mixing evenly, a sample was taken immediately as "0 hour". The reaction temperature was controlled by a water bath at 30 °C, the system was magnetically stirred, and a sample was taken after 24 hours of reaction. The contents of the two configurations of 6,7-dimethoxy-1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid in the samples were tested by high performance liquid chromatography, that is, the concentrations (g/L) of the two configurations of 6,7-dimethoxy-1,2,3,4-tetrahydroisoquinoline-1 carboxylic acid in the reaction liquid can be known. The yield of (S)-6,7 dimethoxy-1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid was 92.4% (the calculation method was the same as Embodiment 3), and ee value was 99.5%.

Embodiment 11: Pure FsDAAO-PpdpkA multienzyme coupling to prepare (s)-1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid Preparation of substrate solution: 50 mM phosphate buffer solution (pH = 8.0) was used to prepare 10 g/L of racemic 1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid solution, which was adjusted to pH 8.0 with 30 % ammonia. 1 ml substrate solution was added to a 5 mL reaction tube, then pure FsDAAO, sodium flavin adenine dinucleotide, catalase, pure PpdpkA, NADP*, pure glucose dehydrogenase, and D-glucose were added, and a phosphate buffer (50 mM, pH=8.0) was added to a total volume of 2 ml, to make the concentration of the substrate racemic 1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid be 5 g/L, the initial concentration of the pure FsDAAO be 0.74 mg/ml, the initial concentration of FAD be 100 pM, the initial concentration of the pure PpdpkA be 2.4 mg/ml, the initial concentration of the pure glucose dehydrogenase be 0.1 mg/ml, the initial concentration of the NADP* be 0.01 mM, the initial concentration of the catalase be 0.01 mg/ml, and the initial concentration of D-glucose be 15 mM in the initial reaction system. After mixing evenly, a sample was taken immediately as "0 hour". The reaction tube was placed at a 30 °C thermostatic water bath, and the system was magnetically stirred and reacted for 2 hours. After the reaction was completed, the contents of the two configurations of 1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid in the samples were tested by high performance liquid chromatography, that is, the concentrations (g/L) of the two configurations of 1,2,3,4-tetrahydroisoquinoline-1- carboxylic acid in the reaction liquid can be known. The yield of (S)-1,2,3,4- tetrahydroisoquinoline-1-carboxylic acid was 99.2% (the calculation method was the same as Embodiment 3), and ee value was 99.5%.

Embodiment 12: Pure FsDAAO-PpdpkA multienzyme coupling to prepare (S)-6,7-dimethoxy-1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid Preparation of substrate solution: 50 mM phosphate buffer solution (pH = 8.0) was used to prepare 10 g/L of racemic 6,7-dimethoxy-1,2,3,4 tetrahydroisoquinoline-1-carboxylic acid solution, which was adjusted to pH 8.0 with 30 % ammonia. 1 ml substrate solution was added to a 5 mL reaction tube, then pure FsDAAO, sodium flavin adenine dinucleotide, catalase, pure PpdpkA, NADP+, pure glucose dehydrogenase, and D-glucose were added, and a phosphate buffer (50 mM, pH=8.0) was added to the system to a total volume of 2 ml, to make the concentration of the substrate racemic 6,7-dimethoxy-1,2,3,4 tetrahydroisoquinoline-1-carboxylic acid be 4 g/L, the initial concentration of the pure FsDAAO be 0.74 mg/ml, the initial concentration of FAD be 100 pM, the initial concentration of the pure PpdpkA be 2.4 mg/ml, the initial concentration of the pure glucose dehydrogenase be 0.1 mg/ml, the initial concentration of the NADP+ be 0.01 mM, the initial concentration of the catalase be 0.01 mg/ml, and the initial concentration of D-glucose be 8 mM in the initial reaction system. After mixing evenly, a sample was taken immediately as "0 hour". The reaction tube was placed at a 30 °C thermostatic water bath, and the system was magnetically stirred and reacted for 3 hours. After the reaction was completed, the contents of the two configurations of 6,7-dimethoxy-1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid in the samples were tested by high performance liquid chromatography, that is, the concentrations (g/L) of the two configurations of 6,7-dimethoxy-1,2,3,4 tetrahydroisoquinoline-1-carboxylic acid in the reaction liquid can be known. The yield of (S)-6,7-dimethoxy-1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid was 99.1% (the calculation method was the same as Embodiment 3), and ee value was 99.4%.

Embodiment 13: FsDAAO-PpdpkA multienzyme coupling to prepare (S)-1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid According to the method of Embodiment 2, crude D-amino acid oxidase derived fromFusariumsolani M-0718, crude pipecolic acid reductase derived from Pseudomonasputida KT2440, and crude glucose dehydrogenase derived from Bacillus subtilis 168 were prepared, respectively. 0.2g of racemic 1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid hydrochloride was weighted and added to a 100 mL reaction bottle, 10 mL phosphate buffer (50 mM, pH = 8.0) was added, and the solution was mixed evenly, and adjusted to pH 8.0 with 5 M sodium hydroxide solution. 20 ml FgDAAO crude enzyme, 7.6 ml PpdpkA crude enzyme, 2.4 ml crude glucose dehydrogenase, 2 mg catalase, NADP+ and D-glucose were added, to make the initial concentration of the racemic 1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid be 5 g/L, the initial concentration of NADP+ be 0.01 mM, and the initial concentration of D-glucose be mM. After mixing evenly, a sample was taken immediately as "0 hour". The reaction temperature was controlled by a water bath at 30 °C, the system was magnetically stirred, the reaction pH was adjusted in the range from 8 to 8.5 with 0.5 M sodium hydroxide solution, and a sample was taken after 16 hours of reaction. The contents of the two configurations of 1,2,3,4-tetrahydroisoquinoline-1- carboxylic acid in the samples were tested by high performance liquid chromatography, that is, the concentrations (g/L) of the two configurations of 1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid in the reaction liquid can be known. The yield of (S)-1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid in the reaction liquid was 99.1% (the calculation method was the same as Embodiment 3), and ee value was 99.4%.

Embodiment 14: FsDAAO-PpdpkA multienzyme coupling to prepare (S)-6,7-dimethoxy-1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid According to the method of Embodiment 2, crude D-amino acid oxidase derived fromFusariumsolani M-0718, crude pipecolic acid reductase derived from Pseudomonasputida KT2440, and crude glucose dehydrogenase derived from Bacillus subtilis 168 were prepared, respectively. 0.2g of racemic 6,7-dimethoxy-1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid was weighted and added to a 100 mL reaction bottle, 10 mL phosphate buffer (50 mM, pH = 8.0) was added, and the solution was mixed evenly, and adjusted to pH 8.0 with 5 M sodium hydroxide solution. 20 ml FgDAAO crude enzyme, 7.6 ml PpdpkA crude enzyme, 2.4 ml crude glucose dehydrogenase, 2 mg catalase, NADP+ and D-glucose were added, to make the initial concentration of the racemic 6,7-dimethoxy-1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid be 5 g/L, the initial concentration of NADP+ be 0.01 mM, and the initial concentration of D-glucose be mM. After mixing evenly, a sample was taken immediately as "0 hour". The reaction temperature was controlled by a water bath at 30 °C, the system was magnetically stirred, the reaction pH was adjusted in the range from 8 to 8.5 with 0.5 M sodium hydroxide solution, and a sample was taken after 18 hours of reaction. The contents of the two configurations of 6,7-dimethoxy-1,2,3,4- tetrahydroisoquinoline-1-carboxylic acid in the samples were tested by high performance liquid chromatography, that is, the concentrations (g/L) of the two configurations of 6,7-dimethoxy-1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid in the reaction liquid can be known. The yield of (S)-6,7-dimethoxy-1,2,3,4 tetrahydroisoquinoline--carboxylic acid was 98.6% (the calculation method was the same as Embodiment 3), and ee value was 99.1%.

Embodiment 15: Preparation and separation of (S)-1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid The substrate solution and the reaction system were as in Embodiment 3. After the reaction was completed, pH of the reaction system was adjusted to 5.0 - 6.0. The system was placed at a 99 °C water bath to precipitate degenerated proteins, and vacuum filtered. The filtrate was rotary evaporated at 65 °C to concentrate the reaction volume by 10 times. The system was placed on ice, cooled, and vacuum filtered. The precipitated white crystals are carefully scraped off, placed in an oven, dried and weighed. 0.2 g of white dried crystals was weighed, dissolved in 50 mM phosphate buffer solution (pH = 8.0) to a volume of 50 ml, and sampled. The contents of the two configurations of 1,2,3,4-tetrahydroisoquinoline 1-carboxylic acid in the sample was tested by high performance liquid chromatography, that is, the contents (g/L) of the two configurations of 1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid in the separated product can be known. The yield of (S)-1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid was 80.2%, and ee value was 99.8%.

Embodiment 16: Preparation and separation of (S)-6,7-dimethoxy-1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid The substrate solution and the reaction system were as in Embodiment 7. After the reaction was completed, pH of the reaction system was adjusted to 5.0 - 6.0. The system was placed at a 99 °C water bath to precipitate degenerated proteins, and vacuum filtered. The filtrate was rotary evaporated at 65 °C to concentrate the reaction volume by 10 times. The system was placed on ice, cooled, and vacuum filtered. The precipitated white crystals are carefully scraped off, placed in an oven, dried and weighed. 0.25 g of white dried crystals was weighed, dissolved in 50 mM phosphate buffer solution (pH = 8.0) to a volume of 50 ml, and sampled. The contents of the two configurations of 6,7-dimethoxy-1,2,3,4 tetrahydroisoquinoline-1-carboxylic acid in the sample was tested by high performance liquid chromatography, that is, the contents (g/L) of the two configurations of 6,7-dimethoxy-1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid in the separated product can be known. The yield of (S)-6,7-dimethoxy-1,2,3,4 tetrahydroisoquinoline-1-carboxylic acid was 78.5%, and ee value was 99.8%.

Control 1: Preparation of (S)-1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid by FsDAAO Preparation of substrate solution: 50 mM phosphate buffer solution (pH = 8.0) was used to prepare 10 g/L of racemic 1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid solution , which was adjusted to pH 8.0 with 30 % ammonia. 1 ml of substrate solution was added to a 5 ml reaction tube, and then 1 ml FsDAAO crude enzyme (the crude enzyme contained enough coenzyme FAD, therefore, there was no need to add additional FAD to the reaction system of the crude enzyme) was added. After mixing evenly, a sample was taken immediately as "0 hour" and analyzed through HPLC. The reaction tube was placed at a 30 °C thermostatic water bath, and the system was magnetically stirred and reacted for 30 hours. After the reaction was completed, the contents of the two configurations of 1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid in the samples were tested through HPLC, that is, the concentrations (g/L) of the two configurations of 1,2,3,4 tetrahydroisoquinoline-1-carboxylic acid in the reaction system can be known. FsDAAO exhibited strict R-configuration stereoselectivity, and the yield was 49.9 %, and ee value of (S)-1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid was above 99 %.

Control 2: Preparation of (S)-1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid by FsDAAO-NaCNBH 3

Preparation of substrate solution: 50 mM phosphate buffer solution (pH = 8.0) was used to prepare 10 g/L of racemic 1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid solution, which was adjusted to pH 8.0 with 30 % ammonia. 20 ml of substrate solution was added to a 100 ml reactor, and then 20 ml FsDAAO crude enzyme (the crude enzyme contained enough coenzyme FAD, therefore, there was no need to add additional FAD to the reaction system of the crude enzyme), 8 mg catalase lyophilized powder, and 0.3 g NaCNBH 3 were added. After mixing evenly, a sample was taken immediately as "0 hour". The reaction system was placed at a 30 °C thermostatic water bath, magnetically stirred, reacted for 30 hours, and sampled. The contents of the two configurations of 1,2,3,4 tetrahydroisoquinoline-1-carboxylic acid in the samples were tested by high performance liquid chromatography, that is, the concentrations (g/L) of the two configurations of 1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid in the reaction liquid can be known.FsDAAO exhibited strict R-configuration stereoselectivity, and the yield of (S)-1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid was 78.8%, and ee value was above 99.2 %. The embodiments described above are only for illustrating the technical concepts and features of the present disclosure, and are intended to make those skilled in the art being able to understand the present disclosure and thereby implement it, and should not be concluded to limit the protective scope of this disclosure. Any equivalent variations or modifications according to the spirit of the present disclosure should be covered by the protective scope of the present disclosure.

Claims (24)

1. A method for preparing an S-isomer of a compound represented by Formula

(I), R,

/1 NH R2-

0 OH

(I) in Formula (I), R1 and R2 are independently selected from the group consisting of hydrogen,C 1-C 6 alkyl,C 1-C 6alkoxy, is characterized in that, the method comprises the following steps: taking a racemate of a compound represented by Formula (I) or a racemate of a salt of the compound represented by Formula (I) as a substrate, and making a R-isomer of the compound represented by Formula (I) in the substrate react under the catalysis of oxidative dehydrogenase to generate imino acid represented by formula

(II);

N R2

0 OH(I)

converting the imino acid represented by Formula (II) into an S-isomer of the compound represented by Formula (I) in the presence of pipecolic acid reductase and a coenzyme capable of supplying hydrogen anions.

2. The method according to claim 1, is characterized in that, in Formula (I), R1 and R2 are independently selected from the group consisting of hydrogen, methyl, ethyl, isopropyl, methoxy, or ethoxy, and the salt is an alkali metal salt or an ammonium salt.

3. The method according to claim 1, is characterized in that, an S-isomer of the compound represented by Formula (I) is (S)-1,2,3,4-tetrahydroisoquinoline-1-carboxylic acid or (S)-6,7-dimethoxy-1,2,3,4 tetrahydroisoquinoline-1-carboxylic acid.

4. The method according to claim 1, is characterized in that, the oxidative dehydrogenase is an enzyme capable of selectively catalyzing the R-isomer of the compound represented by Formula (I), with a selectivity greater than or equal to 80 %,preferably greater than or equal to 90 %.

5. The method according to claim 1 or 4, is characterized in that, the oxidative dehydrogenase is D-amino acid oxidase.

6. The method according to claim 5, is characterized in that, the D-amino acid oxidase is selected from the group consisting of D-amino acid oxidase or its mutants derived from Trigonopsis variabilisCBS 4095 or other D-amino acid oxidase whose amino acid sequence homology is greater than 80 % therewith, D-amino acid oxidase or its mutants derived fromFusariumgraminearum CS3005 or other D-amino acid oxidase whose amino acid sequence homology is greater than 80 % therewith, D-amino acid oxidase or its mutants derived fromFusarium poae 2516 or other D-amino acid oxidase whose amino acid sequence homology is greater than 80 % therewith, D-amino acid oxidase or its mutants derived from Fusariumsolani M-0718 or other D-amino acid oxidase whose amino acid sequence homology is greater than 80 % therewith, combinations thereof.

7. The method according to claim 5, is characterized in that, the use form of the D-amino acid oxidase is unorganized D-amino acid oxidase, crude enzyme containing unorganized D-amino acid oxidase, pure D-amino acid oxidase, immobilized D-amino acid oxidase, or cells intracellularly expressing D-amino acid oxidase.

8. The method according to claim 7, is characterized in that, the cell is an engineering bacteria expressing D-amino acid oxidase and containing an expression vector pET-28a(+), and a host cell of the engineering bacteria is E. coli BL21(DE3); wherein, the D-amino acid oxidase gene is connected to the expression vector pET-28a(+).

9. The method according to claim 1, is characterized in that, the pipecolic acid reductase is selected from the group consisting of pipecolic acid reductase or its mutants derived from Pseudomonasputida KT2440 or other pipecolic acid reductase whose amino acid sequence homology is greater than 80 % therewith, pipecolic acid reductase or its mutants derived fromPseudomonasaeruginosa PA0 Ior other pipecolic acid reductase whose amino acid sequence homology is greater than 80 % therewith, pipecolic acid reductase or its mutants derived from PseudomonasfluorescensPf0-1 or other pipecolic acid reductase whose amino acid sequence homology is greater than 80 % therewith, pipecolic acid reductase or its mutants derived from Pseudomonas entomophila str. L48 or other pipecolic acid reductase whose amino acid sequence homology is greater than 80 % therewith, combinations thereof.

10. The method according to claim 1, is characterized in that, the use form of the pipecolic acid reductase is unorganized pipecolic acid reductase, crude enzyme containing unorganized pipecolic acid reductase, pure pipecolic acid reductase, immobilized pipecolic acid reductase, or cells intracellularly expressing pipecolic acid reductase.

11. The method according to claim 10, is characterized in that, the cell is an engineering bacteria expressing pipecolic acid reductase and containing an expression vector pET-28a(+), and a host cell of the engineering bacteria is E. coli BL21(DE3); wherein, the pipecolic acid reductase gene is connected to the expression vector pET-28a(+).

12. The method according to claim 1, is characterized in that, the coenzyme capable of supplying hydrogen anions is NADH and/or NADPH.

13. The method according to claim 1, is characterized in that, the reaction to generate imino acid is also carried out in the presence of flavin adenine dinucleotide (FAD).

14. The method according to claim 1, is characterized in that, the reaction to generate imino acid is also carried out in the presence of catalase.

15. The method according to claim 1, is characterized in that, the reaction to generate imino acid is also carried out at a setting temperature in an aerobic environment.

16. The method according to claim 15, is characterized in that, the setting temperature ranges from 20 to 70 °C.

17. The method according to claim 1 or 15, is characterized in that, the implementation process of the method comprises: first building a reaction system, then controlling the reaction system to react at a setting temperature in an aerobic environment, in which the reaction system comprises the substrate, the oxidative dehydrogenation, the pipecolic acid reductase, the coenzyme, a coenzyme regeneration system and a solvent, the reaction system selectively comprises a pH buffer and/or pH regulator, the coenzyme comprises NAD+ and/or NADH, or, the coenzyme comprises NADP+ and/or NADPH.

18. The method according to claim 17, is characterized in that, the coenzyme regeneration system comprises a coenzyme regeneration enzyme and a coenzyme regeneration substrate.

19. The method according to claim 18, is characterized in that, the coenzyme regeneration enzyme is glucose dehydrogenase, and the coenzyme regeneration substrate is glucose; or the coenzyme regeneratiio enzyme is alcohol dehydrogenase, and the coenzyme regeneration substrate is isopropanol.

20. The method according to claim 19, is characterized in that, the glucose dehydrogenase is derived fromBacillus subtilis 168; and/or, the alcohol dehydrogenase is derived from Lactobscillus kefir DSM20587.

21. The method according to claim 17, is characterized in that, the reaction system further comprises catalase.

22. The method according to claim 21, is characterized in that, the catalase is bovine liver catalase lyophilized powder.

23. The method according to claim 21, is characterized in that, a ratio of enzyme activities of the catalase and the oxidative dehydrogenase is (100 to 400): 1.

24. The method according to claim 17, is characterized in that, the reaction system further comprises flavin adenine dinucleotide.