AU2020102009A4

AU2020102009A4 - In vitro expression of pear PbrRALF2 protein and preparation method of polyclonal antibody thereof

Info

Publication number: AU2020102009A4
Application number: AU2020102009A
Authority: AU
Inventors: Peng CAO; Xiaobing Kou; Juyou Wu; Shaoling Zhang
Original assignee: Nanjing Agricultural University
Current assignee: Nanjing Agricultural University
Priority date: 2020-08-27
Filing date: 2020-08-27
Publication date: 2020-10-01
Anticipated expiration: 2028-08-27

Abstract

The invention discloses a pear PbrRALF2 protein expression in vitro and a preparation method of its polyclonal antibody, which comprises the following steps. Clone the PbrRALF2 gene of pear flower powder by designing primers; construct the recombinant expression vector PbrALF2-pCold-TF of Escherichia coli; transform the recombinant expression vector PbrALF2-pCold-TF into Escherichia coli BL21 (DE3) to construct the recombinant strain expressing pear PbrRALF2 protein; express he recombinant strain and purify it by nickel column affinity chromatography; use the purified recombinant pear PbrRALF2 protein as antigen to prepare pear PbrRALF2 polyclonal antibody by polyclonal antibody preparation method. This invention can realize the expression of pear PbrRALF2 protein in vitro, and prepare the pear PbrRALF2 polyclonal antibody with high titer and good specificity, which can fully meet the needs of related experiments and industrialization.

Description

In vitro expression of pear PbrRALF2 protein and preparation method of polyclonal antibody thereof

TECHNICAL FIELD

[01] The invention relates to the technical field of bioengineering, in particular to in vitro expression of pear PbrRALF2 protein and a preparation method of its polyclonal antibody.

BACKGROUND

[02] Pollen germination and normal growth of pollen tube in stylus are important guarantees for successful double fertilization of flowering plants. If the pollen tube grows too fast, it will cause the pollen tube to break early before reaching the ovary, and the fertilization will fail; if the pollen tube grows too slowly, the pollen tube will not reach the ovary in the best fertilization time, resulting in fertilization failure. Pear is a typical cross-pollinated plant, and the research on self-regulation mechanism of pear pollen tube growth rate has both theoretical and practical value. In recent 30 years, many researches have been done on the mechanism of RALF regulating plant growth at home and abroad, and the primary problem in the study of RALF's biological function is the preparation of RALF protein. However, since the RALF protein is only about 5 kDa, the extraction process in plants is quite difficult, which brings great resistance to the study. Therefore, the preparation of recombinant plant RALF protein by genetic engineering technology is an effective way to solve the above problems.

[03] Using genetic engineering technology to prepare recombinant protein is a promising technical means. Up to now, there are many protein expression systems, such as prokaryotic expression system, eukaryotic expression system and cell-free expression system. Escherichia coli expression system is one of the most commonly used prokaryotic expression systems. Compared with the traditional method of extracting protein from living materials, this system has the advantages of clear genetic background and biochemical characteristics, fast growth, low cost, high expression level, relatively simple separation and purification of expression products and convenient large-scale production. For a long time, there have been numerous cases of successfully expressing recombinant proteins.

SUMMARY

[04] A technical problem to be solved by the invention is to provide an in vitro expression method of pear PbrRALF2 protein with low cost, high yield and easy purification.

[05] Another object of the present invention is to provide a preparation of polyclonal antibodies by using the recombinant pear PbrRALF2 proteome prepared by the above method.

[06] The technical problem solved by the invention is realized by adopting the following technical scheme.

[07] The method for pear RALF protein expression in vitro comprises the following steps.

[08] a. Extracting the total RNA of pear flower powder, reverse transcribing it into cDNA, and designing primer PCR to amplify pear PbrRALF2 gene.

[09] b. Constructing a prokaryotic recombinant expression vector which is used to express pear PbrRALF2 protein.

[010] c. Transforming the prokaryotic recombinant expression vector constructed in step b into Escherichia coli strain BL21 (DE3) to construct PbrRALF2 recombinant expression strain.

[011] d. Culturing the PbrRALF2 recombinant expression strain constructed in step c until the OD60o reaches 0.4-0.6, and after low temperature treatment, adding an inducer IPTG to induce expression of pear PbrRALF2 protein.

[012] e. Purifying the pear PbrRALF2 protein being induced expression.

[013] In step a, the forward primer for PCR amplification of pear PbrRALF2 gene is 5'- CGGGATCCATGGAGTTTGACATGGACTCG -3', and the reverse primer is

'-GCTCTAGATTAACTCCTGCACCTTGTGATG-3'. T he PCR reaction system for PCR amplification of pear PbrRALF2 gene is: 30tL ddH20, 2L upstream and downstream primers respectively, 2 cDNA, 10 L 5 x Phusion HF Buffer, 1 L 10mm dNTP, 2L 25mm MgSO 4 and 1 L Phusion DNA. The reaction conditions of PCR are cycles of pre-denaturation at 98°C for 2 min, then at 98°C for 15 s, 62°C for 30 s, 68°C for 1 min, and final extension at 68°C for 10 min. Moreover, there are 6 His-Tag in the N-terminal of pear PbrRALF2 protein.

[014] In step b, when constructing prokaryotic recombinant expression vector used for express pear PbrRALF2 protein, the prokaryotic expression vector used is Escherichia coli expression vector pCold-TF, and the insertion site for cloning pear PbrRALF2 gene is between BamHI and XbaI restriction sites. Preferably, the PCR products are analyzed by 2% agarose gel electrophoresis and recovered by gel cutting. The recovered products are digested by BamHI and XbaI restriction enzymes, and then connected to BamHI and XbaI sites of Escherichia coli expression vector pCold-TF, which are similarly digested.

[015] In step d, the low-temperature treatment is to put it on ice for 5-10 minutes, and then stands at 15-17C for 40-60 minutes. The final concentration of the inducer IPTG is 0.5-1.0 mmol/L, and the condition of inducing expression is induced at 15 17°C for 20-24 h.

[016] In step d, the detailed process of pear PbrRALF2 protein induced expression is to inoculate the PbrRALF2 recombinant expression strain into 100 ml LB liquid medium containing 100 g/ml ampicillin according to the volume ratio of 1:50, with overnight shock culturing in 220-250 rpm at 37°C, and then transfer it into 300 ml LB liquid medium containing 100 g/ml ampicillin according to the volume ratio of 1:50 with overnight shock culturing in 200240 rpm at 37°C until ODoo reaches 0.4 0.6, and then quickly place it on ice for 5-10 minutes and left it for 50 minutes at 16 °C and then add IPTG with final concentration of 0.5 mmol/L to culture it with 220-240 rpm at 16 °Cfor 24 h.

[017] The detailed process of purifying the induced expression pear PbrRALF2 protein in step e is that after completing the induced expression, centrifuge it with 12000 rpm at 4°C for 10 minutes and discard the supernatant, collect the precipitate, and then add lysis solution to the precipitate for re-suspension sedimentation. Break the re suspension bacterial liquid by ultrasonic, and then centrifuge it with 12000 rpm for 15 minutes. Collect the supernatant, and after filtering it by a 0.45 m filter membrane and balancing the chromatography medium with 10 times column volume of equilibrium buffer, purify it by nickel column affinity chromatography. Collect the purified protein, concentrate and desalt at 4°C with 6000 rpm using ultrafiltration tube with 30 kDa cut off, and store it at -80°C for later use.

[018] The lysis solution contains 140 mM sodium chloride, 2.7 mM potassium chloride, 10 mM disodium hydrogen pHosphate, 1.8 mM potassium dihydrogen phosphate and 50x EDTA-free protease inhibitor cocktail iii, with a pH value of 7.3.

[019] The formula of the equilibrium buffer solution is 500 mM sodium chloride, mM Tri-hydroxymethyl aminomethane, and 5 mM imidazole, and the pH value is 7.3.

[020] The elution process of purifying pear PbrRALF2 protein by nickel column affinity chromatography is as follows. Use 10 times of column volume of equilibrium buffer (500 mM sodium chloride, 20 mM Tri-hydroxymethyl aminomethane, 5 mM imidazole, with pH 7.3) to equilibrates the column, and the flow rate is controlled at 1 ml/min. Let 20 ml of protein supernatant filtered by filter membrane passes through purification column, and the flow rate is controlled at 1 ml/min. Use 20 times column volume of cleaning solution containing 50 mM imidazole (500 mM sodium chloride, mM Tri-hydroxymethyl aminomethane, 50 mM imidazole, pH value 7.3) to wash the column, and the flow rate is controlled at 1 ml/min. Elute the purification column with 10 times column volume of eluent containing 300 mM imidazole (500 mM sodium chloride, 20 mM tris (hydroxymethyl) aminomethane, 300 mM imidazole, with pH value 7.3), and control the flow rate to 1 ml/min. Collect the eluent to obtain purified protein, and use ultrafiltration tube whose cut-off flow rate is 30 kDa to concentrate and desalt it at 4°C with 6000 rpm, and finally preserve it at -80 °C.

[021] The method for preparing pear PbrRALF2 polyclonal antibody is to use the recombinant pear PbrRALF2 protein prepared above as immunogen to obtain the polyclonal antibody. The preparation process of the polyclonal antibody can be as follows. Immunize Japanese big-ear white rabbits with the recombinant pear PbrRALF2 protein as antigen. Emulsify the recombinant pear PbrRALF2 protein with equal volume of Freund's incomplete adjuvant and inject it to the experimental rabbits for the first immunization. After three weeks, the second immunization is performed in the same way, then carry out booster immunization once every two weeks for a total of four immunizations, and collect blood after the last immunization for seven days to collect antiserum. Preferably, 500 g of recombinant pear PbrRALF2 protein is emulsified with Freund's complete adjuvant in equal volume and injected into experimental rabbits for the first immunization. Three weeks later, 300 g of recombinant pear PbrRALF2 protein is emulsified with the same volume of Freund's incomplete adjuvant to immunize the experimental rabbits for the second time.

[022] The recombinant pear PbrRALF2 protein prepared by the above method is used as immunogen to obtain polyclonal antibody.

[023] The application of the polyclonal antibody in preparing a kit for detecting pear PbrRALF2 protein.

[024] A kit for detecting pear PbrRALF2 protein comprises the polyclonal antibody.

[025] The invention has the beneficial effects as follows.

[026] (1) The method of molecular biology is adopted to express and purify pear PbrRALF2 protein in vitro for the first time, which also lays a foundation for further antibody preparation.

[027] (2) The method of in vitro expression and purification of protein in the present invention is suitable for all pear RALF genes, and can be flexibly adapted according to own research purposes and needs.

[028] (3) The pear PbrRALF2 protein expressed by the invention can directly inhibit the pollen growth of Dangshan pear under the in vitro treatment condition, and has theoretical guiding significance and application reference value for the research on the self-regulation mechanism of pear pollen tube growth.

[029] (4) The pear PbrRALF2 protein antibody in the invention can be specifically combined with pear pollen protein and purified pear PbrRALF2 protein, which indicates it has good specificity and can be widely applicable to various immunological detection tools for detecting pear PbrRALF2 protein.

BRIEF DESCRIPTION OF THE FIGURES

[030] FIG. 1 is a signal peptide prediction diagram of pear PbrRALF2 gene sequence.

[031] FIG. 2 is an agarose gel electrophoresis diagram of PCR amplification of pear PbrRALF2 gene, wherein, Marker is the standard molecular mass of DNA.

[032] FIG. 3 is a diagram of SDS-PAGE after induced expression and purification of recombinant pear PbrRALF2 protein, wherein, Marker is that standard molecular weight of protein.

[033] FIG. 4 is a Western blotting diagram of purified recombinant pear PbrRALF2 protein identified by anti-His(C-term) monoclonal antibody as primary antibody, wherein Marker is that standard molecular weight of protein.

[034] FIG. 5 is a diagram of antibody titer evaluation by ELISA, wherein, the abscissa is different dilution ratio and the ordinate is OD490 absorption value.

[035] FIG. 6 is a Western blot diagram of the prepared polyclonal antibody and recombinant pear PbrRALF2 protein, wherein Marker is that standard molecular weight of protein.

DESCRIPTION OF THE INVENTION

[036] Embodiments of the present invention are described in detail below. The embodiments described below by referring to the drawings are exemplary and are only used to explain the present invention, and cannot be understood as limit to the present invention.

[037] Embodiment 1 Construction and identification of PbrRALF2-pcold-TF recombinant plasmid

[038] (1) sequence analysis and clone of pear PbrRALF2 gene

[039] (1.1) The gene nucleotide sequence of pear PbrRALF2 is SEQ ID NO:1 and amino acid sequence is SEQ ID NO:2. Use sequence analysis website SignalP4.1Server ( http://www.cbs.dtu.dk/services/SignalP/ ) to analyze and remove the sequence of signal peptide and precursor peptide (FIG. 1).

[040] (1.2) Take fresh Dangshan pear pollen, extract the pollen RNA of Dangshan pear according to the instructions of the plant total RNA extraction kit, and reverse transcribe it into cDNA with the reverse transcription kit.

[041] (1.3) Primer design and PCR reaction. The upstream primer (PbrRALF2 pCold-BamHI-Forward) is designed as '-CGGGATCCATGGAGTTTGACATGGACTCG-3' (underlined is BamiHI restriction site; the bold part is the start codon), and the downstream primer (PbrRALF2-pCold-XbaI-Reverse) is '-GCTCTAGATTAACTCCTGCACCTTGTGATG -3'(underlined is XbaI restriction site). Use cDNA as template to carry out PCR amplification, and the PCR reaction system (total reaction system 50 l) comprises ddh20 30pl, upstream and downstream primers 2pl each, cDNA 2pl, 5xPhusion HF Buffer 10pl, 10mm dNTP lpl, 25mm MgSO4 24l and Phusion DNA Polymerase 1pl. The reaction conditions of PCR are 35 cycles of pre-denaturation at 98°C for 2 min, at 98°C for 15 s, 62°C for 30 s, 68°C for 1 min, and final extension at 68°C for 10 min.

[042] (1.4) PCR products are analyzed and identified by 2% agarose gel electrophoresis and recovered by gel cutting, as shown in FIG.2. There is a clear bright band at 100-250 bp, which is consistent with the expected size.

[043] PCR products are recovered according to the instructions of gel extraction kit and rapid agarose gel DNA recovery kit of Kangwei Century company. The recovered PCR products are digested with BamHI and XbaI restriction enzymes, and then inserted into BamHI and XbaI sites of Escherichia coli expression vector pCold TF with the same double digestion by T4-DNA ligase (refer to vector map of TAKARA company), and ligated at 4°C for 18 h to construct PbrRALF2-pCold-TF recombinant plasmid, which is transformed into Escherichia coli strain DH5a, and cultured on LB solid plate (containing 100 g/ml ampicillin) at 37°C. After the single colony is identified by enzyme digestion, its sequence is verified by DNA sequencing of Suzhou Jinweizhi biotechnology Co., Ltd. Sequencing results indicate that the sequence of coding region of pear PbrRALF2 gene is consistent with the prediction and the recombinant plasmid is successfully constructed and name it PbrRALF2-pCold-TF.

[044] Embodiment 2 Expression of pear PbrRALF2 protein in Escherichia coli

[045] 1. Obtain a recombinant expression strain used to express pear PbrRALF2

[046] Select and inoculate sequenced successfully bacteria into 4 ml LB liquid medium containing ampicillin (100 g/ml) with overnight shock culturing in 250 rpm at 37°C. Extract PbrRALF2-pCold-TF recombinant expression vector according to QuickPure Plasmid Mini kit of Kangwei Century company. Transform 1 ng of recombinant expression vector pbraraf2-pcold-TF into Escherichia coli BL21(DE3) by chemical method, then coat it on LB plate containing 100 g/mL ampicillin to screen recombinant, and the culture temperature is 37°C and time is overnight. The obtained recombinants are genetic engineering bacteria used to express pear PbrRALF2. Randomly select a single colony for streaking culture. Inoculate a small amount of streaked culture bacteria into 1 ml LB (containing 100 g/ml ampicillin) liquid culture medium with overnight shock culturing in 250 rpm at 37°C. Absorb 1 1 bacteria solution as template, and verify it by PCR, then add 300 1 sterilized 20 %(v/v) glycerol into700 1 bacteria solution, mix well, and quickly freeze it with liquid nitrogen and store it at - 80°C to obtain the recombinant expression strain used to express pear PbrRALF2.

[047] 2. Induced expression, purification and identification of recombinant pear PbrRALF2 protein

[048] (2.1) induced expression of pear PbrRALF2 protein

[049] The pear PbrRALF2 recombinant expression strain is inoculated into 100 ml LB (containing 100 g/ml ampicillin) liquid culture medium according to the volume ratio of 1:50, and the recombinant expression strain is activated by shaking culture at 37°C and 240 rpm overnight. The activated recombinant expression strain is transferred to 300 ml LB liquid medium (containing 100 g/mL ampicillin) according to the volume ratio of 1:50, and the culture conditions are 37°C and 220-240 rpm. After shaking culture the OD600 of bacterial liquid to 0.4 ~ 0.6, quickly place it on ice for ~10 minutes, and then place it in a shaking table at 16°C for 50 minutes. Finally, add IPTG with final concentration of 0.5 ~ 1.0 mmol/1 and induce the expression by shaking culture at 16 °C and 240 rpm for 20 ~ 24 h. Collect 4 ml bacterial liquid after induced expression under different conditions, centrifuge, discard supernatant, add 200 1 10% SDS each, heat at 100°C for 5min to denature protein, cool in ice for 2min, centrifuge at 12000 rpm at 4°C for 10min, take 50 1 supernatant. Then 50 L 2 x SDS-PAGE buffer is added to each sample, and 10 1 of each buffer is taken for SDS-PAGE electrophoresis. The expression of pbrralf2 protein in pear is detected by Coomassie brilliant blue staining.

[050] (2.2) purification of pear PbrRALF2 protein

[051] The recombinant expression strain of pear PbrRALF2 is inoculated into 100 ml LB (containing 100 g/ml ampicillin) liquid culture medium according to the volume ratio of 1:50, and the recombinant expression strain is activated by shaking culture at 37°C and 240 rpm overnight. The activated recombinant expression strain is transferred to 300 ml LB liquid culture medium (containing 100 g/mL ampicillin) according to the volume ratio of 1:50, and the culture conditions are 37°C and 240 rpm. After shaking culture the OD600 of bacterial liquid to 0.4 ~ 0.6, it is quickly placed on ice for 10 minutes, then placed in a shaker at 16°C for 50 minutes. Finally, add IPTG with final concentration of 0.5 mmol/L and induce the expression by shaking culture at 16 °C and 240 rpm for 24 h.. After the completion of the expression, the supernatant is discarded after centrifugation at 4°C and 12000 rpm for 10 minutes, and the cell precipitate is collected. The cell is re-suspended with 20 ml lysate (140 mM sodium chloride, 2.7 mM potassium chloride, 10 mM disodium hydrogen phosphate, 1.8mM potassium dihydrogen phosphate, 50x EDTA-free protease inhibitor cocktail III, pH 7.3), and then crushed by ultrasonic wave with power of 240 W. The conditions are as follows: open for 3 s, stop for 7 s, repeat 10 times, and crush until the solution is clear. After ultrasonic crushing, centrifuge at 12000 rpm at 4°C for 15 minutes, collect supernatant, and filter the supernatant with 0.45 m filter membrane to remove impurities. The recombinant protein of pear PbrRALF2 is purified by Ni-NTA agarose affinity chromatography packing from Merck Millipore Company, Germany. The specific operations are as follows. Use 10 times of column volume of equilibrium buffer (500 mM sodium chloride, 20 mM Tri-hydroxymethyl aminomethane, 5 mM imidazole, with pH 7.3) to equilibrates the column, and the flow rate is controlled at 1 ml/min. Let 20 ml of protein supernatant filtered by filter membrane passes through purification column, and the flow rate is controlled at 1 ml/min. Use 20 times column volume of cleaning solution containing 50 mM imidazole (500 mM sodium chloride, mM Tri-hydroxymethyl aminomethane, 50 mM imidazole, pH value 7.3) to wash the column, and the flow rate is controlled at 1 ml/min. Elute the purification column with 10 times column volume of eluent containing 300 mM imidazole (500 mM sodium chloride, 20 mM tris (hydroxymethyl) aminomethane, 300 mM imidazole, with pH value 7.3), and control the flow rate to 1 ml/min. Collect the eluent to obtain purified protein, and use ultrafiltration tube whose cut-off flow rate is 30 kDa to concentrate and desalt it at 4°C with 6000 rpm, and finally preserve it at -80 °C. Take a small amount of protein for SDS-PAGE electrophoresis purity analysis and Western Blotting identification, and the results are shown in FIG.3. The Western Blotting identification result of anti-His(C-term) monoclonal antibody is shown in FIG. 4, and it is identified as pear PbrRALF2 recombinant protein.

[052] Embodiment 3: Preparation of pear PbrRALF2 protein polyclonal antibody and evaluation of antibody titer and specificity

[053] According to the instructions of BCA protein concentration determination kit, determine the protein concentration of purified recombinant pear PbrRALF2 protein. The purified recombinant pear PbrRALF2 protein is used as antigen to immunize Japanese big-ear white rabbits. Collect 0.5 ml of blood from ear vein before immunization, and collect serum to use as negative control for subsequent ELISA detection.

[054] Emulsify the 500 g purified recombinant pear PbrRALF2 protein dissolved in 0.5 ml PBS with equal volume of Freund's complete adjuvant and use it to immunize the experimental rabbits for the first time. After three weeks, emulsify the 300 g purified recombinant pear PbrRALF2 protein dissolved in 0.3 ml PBS with equal volume of Freund's incomplete adjuvant and use it to immunize the experimental rabbits for the second time. Then carry out booster immunization once every two weeks for a total of four immunizations using 300 g purified recombinant pear PbrRALF2 protein, and collect blood after the last immunization for one week to collect antiserum.

[055] Negative serum is used as negative control, antibody titer is determined by ELISA (negative serum was used as negative control), and antibody specificity is determined by Western blotting. The titer of antibody is defined as the highest dilution multiple when the absorbance of diluted antiserum at 490 nm is 2.1 times higher than that of serum before immunization (negative control). The ELISA results are shown in FIG. 5, which shows that the titer of pear PbrRALF2 polyclonal antibody is about 1: 1024000. Western blotting analysis indicates that the specificity of the prepared pear PbrRALF2 polyclonal antibody is good, as shown in FIG. 6.

[056] Although the invention has been described with reference to specific examples, it will be appreciated by those skilled in the art that the invention may be embodied in many other forms, in keeping with the broad principles and the spirit of the invention described herein.

[057] The present invention and the described embodiments specifically include the best method known to the applicant of performing the invention. The present invention and the described preferred embodiments specifically include at least one feature that is industrially applicable

Claims

THE CLAIMS DEFINING THE INVENTION ARE AS FOLLOWS:

1. A method for expression of pear RALF protein in vitro is characterized by comprising the following steps.

a. Extracting the total RNA of pear flower powder, reverse transcribing it into cDNA, and designing primer PCR to amplify pear PbrRALF2 gene.

b. Constructing a prokaryotic recombinant expression vector which is used to express pear PbrRALF2 protein.

c. Transforming the prokaryotic recombinant expression vector constructed in step b into Escherichia coli strain BL21 (DE3) to construct PbrRALF2 recombinant expression strain.

d. Culturing the PbrRALF2 recombinant expression strain constructed in step c until the ODoo reaches 0.4-0.6, and after low temperature treatment, adding an inducer IPTG to induce expression of pear PbrRALF2 protein.

e. Purifying the pear PbrRALF2 protein being induced expression.

2. The method for expression of pear PbrRALF2 protein in vitro according to claim 1 is characterized in that in step a, the forward primer for PCR amplification of pear PbrRALF2 gene is 5'- CGGGATCCATGGAGTTTGACATGGACTCG -3', and the reverse primer is 5'-GCTCTAGATTAACTCCTGCACCTTGTGATG-3'.

3. The method for expression of pear PbrRALF2 protein in vitro according to claims 1 or 2 is characterized in that in step a, the PCR reaction system for PCR amplification of pear PbrRALF2 gene is: 30 L ddH20, 2L upstream and downstream primers respectively, 2 cDNA, 10 L 5 x Phusion HF Buffer, 1 L 0mm dNTP, 2 L mm MgSO4 and 1 L Phusion DNA. The reaction conditions of PCR are 35 cycles of pre-denaturation at 98°C for 2 min, then at 98°C for 15 s, 62°C for 30 s, 68°C for 1 min, and final extension at 68°C for 10 min.

4. The method for expression of pear PbrRALF2 protein in vitro according to claims 1 is characterized in that in step b, when constructing prokaryotic recombinant expression vector used for express pear PbrRALF2 protein, the prokaryotic expression vector used is Escherichia coli expression vector pCold-TF, and the insertion site for cloning pear PbrRALF2 gene is between BamHI and XbaI restriction sites.

5. The method for expression of pear PbrRALF2 protein in vitro according to claims 1 is characterized in that in step d, the low temperature treatment is to put it on ice for 5-10 min, and then to stand at 15-17 °C for 40-60 min. The final concentration of the inducer IPTG is 0.5-1.0 mmol/L and the condition for inducing expression is to induce 20-24 h at 15-17 °C.

6. The method for expression of pear PbrRALF2 protein in vitro according to claims lor 5 is characterized in that in step d, the detailed process of pear PbrRALF2 protein induced expression is to inoculate the PbrRALF2 recombinant expression strain into 100 ml LB liquid medium containing 100 g/ml ampicillin according to the volume ratio of 1:50, with overnight shock culturing in 220-250 rpm at 37°C, and then transfer it into 300 ml LB liquid medium containing 100 g/ml ampicillin according to the volume ratio of 1:50 with overnight shock culturing in 200240 rpm at 37°C until OD6oo reaches 0.4-0.6, and then quickly place it on ice for 5-10 minutes and left it for minutes at 16 °C and then add IPTG with final concentration of0.5 mmol/L to culture it with 220-240 rpm at 16°Cfor 24 h.

The detailed process of purifying the induced expression pear PbrRALF2 protein in step e is that after completing the induced expression, centrifuge it with 12000 rpm at 4°Cfor 10 minutes and discard the supernatant, collect the precipitate, and then add lysis solution to the precipitate for re-suspension sedimentation. Break the re suspension bacterial liquid by ultrasonic, and then centrifuge it with 12000 rpm for 15 minutes. Collect the supernatant, and after filtering it by a 0.45 m filter membrane and balancing the chromatography medium with 10 times column volume of equilibrium buffer, purify it by nickel column affinity chromatography. Collect the purified protein, concentrate and desalt at 4°C with 6000 rpm using ultrafiltration tube with 30 kDa cut off, and store it at -80°C for later use.

The lysis solution contains 140 mM sodium chloride, 2.7 mM potassium chloride, 10 mM disodium hydrogen pHosphate, 1.8 mM potassium dihydrogen phosphate and 50x EDTA-free protease inhibitor cocktail iii, with a pH value of 7.3.

The formula of the equilibrium buffer solution is 500 mM sodium chloride, 20 mM Tri-hydroxymethyl aminomethane, and 5 mM imidazole, and the pH value is 7.3.

7. The method for preparing pear PbrRALF2 polyclonal antibody is characterized by using recombinant pear PbrRALF2 protein prepared by any one of claims 1-6 as immunogen to obtain polyclonal antibody.

8. A polyclonal antibody obtained by using the recombinant pear PbrRALF2 protein prepared by any one of claims 1-6 as an immunogen.

9. Application of the polyclonal antibody of claim 8 in preparing a kit for detecting pear PbrRALF2 protein.

10. A kit for detecting pear PbrRALF2 protein is characterized in that it comprises the polyclonal antibody of claim 8.