AU2019400151B2 - Recombinant Escherichia coli system, construction method thereof, and usage in synthesis of α-1,2-fucosylated oligosaccharide - Google Patents

Abstract

i N j 9(- WJP? I IN -Ef |EP $ l (1019)h '43 PdVT WO 2021/093022 A1 2021 4 5 ) 20 (20.05.2021) WIPO T PWC0T (51) IFl--y : (JILIN)BIO-CHEMICAL TECHNOLOGY CO.,LTD) C12N 15/70 (2006.01) C12P19/02 (2006.01) [CN/CN]; +$ li -K f V * C12N 9/10 (2006.01) {W"&%Tt177, Jilin 130033 (CN)o (21) F PCT/CN2019/120873 (72) &l X:W (HUANG,Jin); +JdJLfliFT (22) , MF$NHE: 2019 411A 26 H (26.11.2019) MLt *i* #t& R M E H ,Beijing 102209 (CN)o A't0,-(XUE,Xiaozhou); +PIdLAITV'F (25) ijiH : +7 FZ X JL- 4#9i X HRY, Beijing 102209 (26) Qf ifF: (CN)0 o i 3-(LI, Yu); [ Q $ fl * (30)f : E M = Yt tt 290, Tianjin 300457 (CN) o T 201911119505.9 2019 4 11f15 H (15.11.2019) CN M K(QIN, Huimin); P t 2 1 9 = ti ti 29, Tianjin 300457 (CN) 0 o (71) $f Aa : ff @J f 5 pfA q R is] q f(TONG, Yi); + M #4 9N tf r# V : (NUTRITION & HEALTH RESEARCH INSTITUTE, a EW 1ti 1717 Jilin 130033 (CN)o k COFCO CORPORATION) [CN/CN]; +[Id I 1 (LI, Yi); + Pd n $ f i VF R *fa F, X Z t t 1717 Jilin 130033 (CN)o M$I* 102209 (CN)o A tM** tJIf R'i)(COFCO (54) Title: RECOMBINANT E. COLI SYSTEM, CONSTRUCTION METHOD THEREFOR, AND APPLICATION THEREOF IN SYNTHESIS OF a-1,2-FUCOSYLATED OLIGOSACCHARIDE S(54)& Z: tt{ttL H & a12-t{ t+fYY + ~~ AA CGal-R BB cc -- OR DD? AA DONOR: GDP-FUCOSE BB RECEPTOR: GAL-R CC A-1,2-FUCOSYLTRANSFERASE + GDP-FUCOSE PYROPHOSPHORYLASE DD PRODUCT: A-1,2-FUCOSYLATED OLIGOSACCHARIDE (57) Abstract: The present invention relates to the technical field of genetic engineering, and provides a recombinant E. coli system, a construction method therefor, and an application thereof in the synthesis of an a-1,2-fucosylated oligosaccharide. The recombinant E. coli system has an a-1,2-fucosyltransferase gene and a GDP-fucose pyrophosphorylase gene. By transforming the a-1,2-fucosyl transferase gene and the GDP-fucose pyrophosphorylase gene into E. coli, a genetically engineered strain is constructed to express an CA a-1,2-fucosyltransferase and a GDP-fucose pyrophosphorylase, and the expressed a-1,2-fucose pyrophosphorylase and GDP-fucose pyrophosphorylase are used for enzymatic synthesis of an a-1,2-fucosylated oligosaccharide. W O 2021/093022 A1 ||||I ||||||IDI |||||I|IDI |||||||||i |||||||||||||||||||||||||||||| (CHEN, Bo); + ld J NA rN 'E T X J L -L * M) * #4 Rh X M X HM, Beijing 102209 (CN)o 3 FL (LI, Fan); +ld J 'El T XLK -L *t 4 R X M E H-, Beijing 102209 (CN)0 o 2 (AN, Tai); + l q r T XK S t - * M 4tR M EX HMU, Beijing 102209 (CN)o (74)4tIgA:ILb 5( -Vpn - t I I ['i -] (RUNPING& PARTNERS); +ldI JL S t IL J H hcN 9 Ft 515, Beijing 100190 (CN)o (81) $H5lMiR] R$fW(9S AE, AG, AL, AM, AO, AT, AU, AZ, BA, BB, BG, BH, BN, BR, BW, BY, BZ, CA, CH, CL, CN, CO, CR, CU, CZ, DE, DJ, DK, DM, DO, DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, HN, HR, HU, ID, IL, IN, IR, IS, JO, JP, KE, KG, KH, KN, KP, KR, KW, KZ, LA, LC, LK, LR, LS, LU, LY, MA, MD, ME, MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, OM, PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SA, SC, SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZWc (8 4) $ 1`"- (lj,@M Rh r)HA, V R V- ft WM( -P ) 9%- K I fif): ARIPO (BW, GH, GM, KE, LR, LS, MW, MZ, NA, RW, SD, SL, ST, SZ, TZ, UG, ZM, ZW), KXl (AM, AZ, BY, KG, KZ, RU, TJ, TM), XJI (AL, AT, BE, BG, CH, CY, CZ, DE, DK, EE, ES, FI, FR, GB, GR, HR, HU, IE, IS, IT, LT, LU, LV, MC, MK, MT, NL, NO, PL, PT, RO, RS, SE, SI, SK, SM, TR), OAPI (BF, BJ, CF, CG, CI, CM, GA, GN, GQ, GW, KM, ML, MR, NE, SN, TD, TG). - #t8WCtKdC(t#21(3))o - 'A.tI)]1)iJE('4191UJ5.2(a))o (57)tH P: -&J J'TYT ')Af t $a-1,2 P. AY f(L A P. m 9J T M 7 1,i§§$ 2 a-2 § fH GDP- A V4 NW N2 . M UT id P i -1,2-aWW&f § 2 H GDP- aMMM 2§ 29 §$ ,$ I f 2 li I a-,2 aW & M h fHGDP- A71W A V4 f M ( §, JF t it In (x-1,2- X P.W hf H GDP- VZ. V4fMhfl)T FM~hna-1,2- X 023G~

Description

Recombinant Escherichia coli System, Construction Method Thereof, and Usage

in Synthesis of a-1,2-Fucosylated Oligosaccharide

FIELD

The present disclosure relates to the technical field of gene engineering, in particular

to a recombinant Escherichia coli system, a method for constructing the recombinant

Escherichiacoli system, and usage of the recombinant Escherichia coli system in the

synthesis of a-1,2-fucosylated oligosaccharide, and a method for synthesizing

a-1,2-fucosylated oligosaccharide.

BACKGROUND

With the rapid development of biotechnology and food industry, the research and

development of functional oligosaccharides has become the forefront of International

biotechnology, mainly focusing on oligosaccharides with low molecular weight

prepared through acid and alkali degradation of polysaccharides from natural plants

and microorganisms; in addition, the oligosaccharide industry has become a new

industry used in food, pharmaceutical, agricultural, chemical industries, and so on,

and possesses a great market share. Fucosylated oligosaccharides are a sort of

functional oligosaccharides, and play an important role in blood transportation,

selective regulation of leukocyte endothelial adhesion and individual development.

Researches have demonstrated that the decrease of the content of fucosylated

oligosaccharides in human body may lead to some serious diseases such as leukocyte

adhesion deficiency disease, and even may directly lead to the occurrence of cancer

and atherosclerosis.

Human milk oligosaccharides (HMOs) are a sort of free oligosaccharides in human

milk. The content of HMOs in human milk is only slightly lower than that of fat and

lactose. HMOs are the third major solid substance in human milk, and are important

12394917_1 (GHMatters) P113685.AU active factors in human milk as well. HMOs have complex structures and are in great varieties, and 70% HMOs belong to fucosylated oligosaccharides. HMOs have physiological effects including regulating intestinal flora, boosting immunity, resisting virus infection, reducing inflammation, and promoting the development of infants' brains, etc. As a sort of functional oligosaccharides with special structures,

HMOs participate in the enhancement of the non-immune defense systems of infants,

and will surely play an important role in infant nutrition and health care.

Initially, the fucosylated oligosaccharide production process mainly employed a

chemical synthesis process. However, on one hand, the chemical synthesis process

had drawbacks such as complex synthetic route and stringent control on reaction

conditions, etc.; on the other hand, attention should be paid to the selection of catalyst,

design of appropriate protective groups, and determination of leaving groups of the

donor; moreover, the final synthesis cost of oligosaccharides was very high because

of the high price of the glycoside donor for oligosaccharide synthesis.

Compared with the chemical synthesis process, producing fucosylated

oligosaccharides with biotechnology has many advantages. Moreover, as the

fucosyltransferase gene is discovered in bacteria, whole-cell biosynthesis process and

enzymatic synthesis process have become two major routes for production of

fucosylated oligosaccharides in the field of biotechnology. The whole-cell

biosynthesis process is to insert corresponding genes into the genome of cells using

gene engineering and metabolic engineering techniques, and utilize metabolism of

cell itself to produce fucosylated oligosaccharides. This process requires the cells to

express an excessive amount of fucosyltransferase and provide a large amount of

donor GDP-fucose (guanosine diphosphate-fucose) to ensure that the receptor and

product will not be decomposed in the cells. The enzymatic synthesis process is a

process in which all of the enzymes that participate in the catalytic synthesis of

fucosylated oligosaccharides are separated and purified, and the catalytic reaction is

carried out in vitro. This process can improve enzyme activity by modifying the

fucosyltransferase that participates in the enzyme catalysis and thereby further

12394917_1 (GHMatters) P113685.AU improve the yield of fucosylated oligosaccharides.

a-1,2-fucosyltransferase is an enzyme that transfers the fucosyl to a corresponding

oligosaccharide to formed a-1,2-link. a-1,2-fucosyltransferase belongs to

glycosyltransferase family11. At present, a-1,2-fucosyltransferase gene has been

found in mammals, viruses, plants and bacteria, and research progress on the

enzymatic properties of a-1,2-fucosyltransferase gene have also been made to

different degrees. a-1,2-fucosyltransferase exhibits a wide range of substrate

specificity, which provides a huge advantage for the synthesis of a-1,2-fucosylated

oligosaccharides. However, the yield of fucosylated oligosaccharides has to be further

improved when fucosylated oligosaccharides are produced with biotechnology in the

prior art.

SUMMARY

The technical problem to be solved in the present disclosure is to provide a method

for synthesizing a-1,2-fucosylated oligosaccharide through an enzymatic synthesis

process, in order to solve the problems that the chemical synthesis process in the prior

art have a complex process route and high cost, as well as the biosynthesis process in

the prior art can't achieve a satisfactory yield.

In order to attain the object described above, in one aspect, there is provided a

recombinant Escherichia coli system, transformed with a-1,2-fucosyltransferase gene

and GDP-fucose pyrophosphorylase gene.

In another aspect, there is provided a method for constructing the recombinant

Escherichiacoli system described above, comprising:

(1) cloning the a-1,2-fucosyltransferase gene, and constructing an expression vector

of the a-1,2-fucosyltransferase gene;

(2) cloning the GDP-fucose pyrophosphorylase gene, and constructing an expression

vector of the GDP-fucose pyrophosphorylase gene;

18732002_1 (GHMatters) P113685.AU

(3) transforming the expression vector obtained in the step (1) and the expression

vector obtained in step (2) into Escherichia coli cells to obtain the recombinant

Escherichiacoli system.

In another aspect, there is provided a usage of the recombinant Escherichia coli

system described above in the synthesis of a-1,2-fucosylated oligosaccharide.

In another aspect, there is provided a method for synthesizing a-1,2-fucosylated

oligosaccharide, comprising:

(1) under conditions of reproduction of Escherichia coli, allowing the recombinant

Escherichia coli system described above to reproduce and express the

a-1,2-fucosyltransferase gene and the GDP-fucose pyrophosphorylase gene, to

obtain a-1,2-fucosyltransferase and GDP-fucose pyrophosphorylase;

(2) controlling the a-1,2-fucosyltransferase and the GDP-fucose pyrophosphorylase

obtained in step (1) to contact with a substrate for conversion, to synthesize the

a-1,2-fucosylatedoligosaccharide;

wherein the recombinant Escherichia coli system is transformed with

a-1,2-fucosyltransferase gene and GDP-fucose pyrophosphorylase gene;

wherein the a-1,2-fucosyltransferase gene is derived from Helicobacterpylori, and/or

the GDP-fucose pyrophosphorylase gene is derived from Bacteroidesfragilis;

wherein the a-1,2-fucosyltransferase gene has a nucleotide sequence shown as SEQ

ID NO: 1, and/or the GDP-fucose pyrophosphorylase gene has a nucleotide sequence

shown as SEQ ID NO: 2;

wherein the step (1) refers to inducing and culturing recombinant Escherichiacoli in a

LB liquid culture medium that contains ampicillin and kanamycin, and under the

condition of adding IPTG;

wherein after the culturing is finished, the method comprises protein separation and

purification for the cultured bacteria, so as to obtain purified a-1,2-fucosyltransferase

and GDP-fucose pyrophosphorylase;

18732002_1 (GHMatters) P113685.AU

4a

wherein the substrate for conversion contains GDP-fucose and lactose.

In the present disclosure, constructing a genetically engineered bacterium by

transforming a-1,2-fucosyltransferase gene and GDP-fucose pyrophosphorylase gene

into Escherichia coli, expressing a-1,2-fucosyltransferase and GDP-fucose

pyrophosphorylase, and using the expressed a-1,2-fucosyltransferase and GDP-fucose

pyrophosphorylase to synthesize a-1,2-fucosylated oligosaccharide through an

enzymatic synthesis process. Compared with a-1,2-fucosyltransferase catalyzed from

other sources (e.g., Pirkko, et al. utilizing recombinant Escherichia coli to synthesize

GDP-mannose, and further utilizing yeast expression system to synthesize

GDP-fucose successfully [Mattila P , Jarkko Ribini, Hortling S , et al. Functional

expression of Escherichia coli enzymes synthesizing GDP-L-fucose from inherent

GDP-D-mannose in Saccharomyces cerevisiae[J]. Glycobiology, 2000, (10):1041-7.), the catalytic yield of a-1,2-fucosyltransferase in the present

disclosure is improved by 145.23%.

18732002_1 (GHMatters) P113685.AU

BRIEF DESCRITION OF THE DRAWINGS

Fig. 1 shows the SDS-PAGE electrophoretograms of a-1,2-fucosyltransferase (HpFutr)

(a) and GDP-fucose pyrophosphorylase (FKP) (b);

Fig. 2 is a schematic diagram of the synthesis process of a-1,2-fucosylated

oligosaccharide provided by the present disclosure.

DETAILED DESCRPTION

[0012] The terminals and any value of the ranges disclosed herein are not limited to

the precise ranges or values, such ranges or values shall be comprehended as

comprising the values adjacent to the ranges or values. As for numerical ranges, the

endpoint values of the various ranges, the endpoint values and the individual point

value of the various ranges, and the individual point values may be combined with

one another to produce one or more new numerical ranges, which should be deemed

have been specifically disclosed herein.

According to a first aspect of the present disclosure, the present disclosure provides a

recombinant Escherichia coli system, transformed with a-1,2-fucosyltransferase gene

and GDP-fucose pyrophosphorylase gene.

According to the present disclosure, the a-1,2-fucosyltransferase gene may be any

nucleotide sequence encoding a-1,2-fucosyltransferase in the art. According to a

preferred embodiment of the present disclosure, the a-1,2-fucosyltransferase gene is

derived from Helicobacterpylori, more preferably, the a-1,2-fucosyltransferase gene

has a nucleotide sequence shown as SEQ ID NO: 1.

According to the present disclosure, the GDP-fucose pyrophosphorylase gene may be

any nucleotide sequence encoding GDP-fucose pyrophosphorylase in the prior art.

12394917_1 (GHMatters) P113685.AU

According to a preferred embodiment of the present disclosure, the GDP-fucose

pyrophosphorylase gene is derived from Bacteroides fragilis, more preferably, the

GDP-fucose pyrophosphorylase gene has a nucleotide sequence shown as SEQ ID

NO: 2.

According to the present disclosure, the a-1,2-fucosyltransferase gene and the

GDP-fucose pyrophosphorylase gene may be respectively inserted into a vector to

construct a recombinant vector for expressing a-1,2-fucosyltransferase and a

recombinant vector for expressing GDP-fucose pyrophosphorylase, and then

transform the constructed recombinant expression vectors into host cells of

Escherichiacoli, so as to obtain the recombinant Escherichiacoli system disclosed by

the present disclosure.

Wherein, the construction of the recombinant vector may be carried out with a

conventional method in the art. For example, PCR amplification of

a-1,2-fucosyltransferase gene and GDP-fucose pyrophosphorylase gene may be

carried out respectively with a designed primer that contains expected enzyme cutting

sites, so that the PCR amplification product obtains expected enzyme cutting sites,

and then the obtained PCR products and target vectors are digested with

corresponding restriction enzymes, and the digested products are liked under the

action of a DNA ligase to obtain an expected recombinant vector.

Wherein, the plasmid for constructing the recombinant vector may be any

conventional plasmid that can be expressed in Escherichia coli in the art. According

to a preferred embodiment of the present disclosure, the plasmid for constructing the

recombinant vector that contains a-1,2-fucosyltransferase gene is pCold I plasmid;

according to another preferred embodiment of the present disclosure, the plasmid for

constructing the recombinant vector of GDP-fucose pyrophosphorylase gene is

pET28a plasmid.

According to the present disclosure, the transformation refers to treating cells with

some known methods in molecular biology and genetic engineering, so that the

12394917_1 (GHMatters) P113685.AU treated cells are in a competent state and thus contact with exogenous DNA, and allowing the exogenous DNA to enter the competent cells. Commonly used transformation methods include protoplast transformation, chemical transformation and electroporation transformation.

According to the present disclosure, the Escherichia coli may be any conventional Escherichia coli strain for exogenous gene expression. According to a preferred embodiment of the present disclosure, the Escherichiacoli cells are E. coli C43 cells.

According to a specific embodiment of the present disclosure, the a-1,2-fucosyltransferase gene and the GDP-fucose pyrophosphorylase gene may be respectively transformed into different Escherichia coli cells, and then allow the Escherichia coli transformed with the a-1,2-fucosyltransferase gene and the Escherichia coli transformed with the GDP-fucose pyrophosphorylase gene to reproduce and express corresponding genes respectively, and thereby obtain a target product.

According to another specific embodiment of the present disclosure, the a-1,2-fucosyltransferase gene and the GDP-fucose pyrophosphorylase gene may be respectively transformed into the same Escherichia coli cell, and then allow the Escherichia coli transformed with the a-1,2-fucosyltransferase gene and the GDP-fucose pyrophosphorylase gene to reproduce and express corresponding genes respectively, and thereby obtain a target product.

According to a second aspect of the present disclosure, the present disclosure provides a method for constructing the recombinant Escherichia coli system described above, comprising:

(1) cloning the a-1,2-fucosyltransferase gene, and constructing an expression vector of the a-1,2-fucosyltransferase gene;

(2) cloning the GDP-fucose pyrophosphorylase gene, and constructing an expression vector of the GDP-fucose pyrophosphorylase gene;

12394917_1 (GHMatters) P113685.AU

(3) transforming the expression vector obtained in the step (1) and the expression

vector obtained in step (2) into the same Escherichia coli cell or different

Escherichiacoli cells to obtain the recombinant Escherichiacoli system.

According to a preferred embodiment of the present disclosure, the

a-1,2-fucosyltransferase gene is PCR amplified with a forward primer shown as SEQ

ID No: 3 and a reverse primer shown as SEQ ID No: 4 to obtain enzyme cutting sites

for BamHI and Hind III, then the PCR product and corresponding plasmids are

double-digested by BamHIand Hind III, and then are linked by a DNA ligase to

obtain the expression vector of the a-1,2-fucosyltransferase gene.

According to another preferred embodiment of the present disclosure, the GDP-fucose

pyrophosphorylase gene is PCR amplified with a forward primer shown as SEQ ID

No: 5 and a reverse primer shown as SEQ ID No: 6 to obtain enzyme cutting sites for

BamHI and XhoI, then the PCR product and corresponding plasmids are

double-digested by BamHI and XhoI, and then are linked by a DNA ligase to obtain

the expression vector of the GDP-fucose pyrophosphorylase gene.

According to the present disclosure, in order to obtain positive clones of Escherichia

coli that can express the target genes stably, the method further comprises a step of

screening the transformed Escherichia coli. The step of screening may be carried out

with a conventional method in the art. For example, the transformed Escherichiacoli

may be spread on a LB plate that contains Amp and Kan to culture single colony

strain. The Escherichia coli transformed with the recombinant vectors obtains Amp

and Kan resistance, and thereby positive clones of Escherichia coli transformed with

the recombinant vectors can be obtained through the step of screening.

According to the present disclosure, the obtained recombinant Escherichia coli cells

may be preserved in a 15% glycerine tube for strain preservation.

According to a third aspect, the present disclosure provides an usage of the

recombinant Escherichia coli system described above in the synthesis of

a-1,2-fucosylated oligosaccharide.

12394917_1 (GHMatters) P113685.AU

According to a fourth aspect, the present disclosure provides a method for

synthesizing a-1,2-fucosylated oligosaccharide, comprising:

(1) under conditions of reproduction of Escherichia coli, allowing the recombinant

Escherichia coli system described above to reproduce and express the

a-1,2-fucosyltransferase gene and the GDP-fucose pyrophosphorylase gene, to

obtain a-1,2-fucosyltransferase and GDP-fucose pyrophosphorylase;

(2) controlling the a-1,2-fucosyltransferase and the GDP-fucose pyrophosphorylase

obtained in step (1) to contact with a substrate for conversion, to synthesize the

a-1,2-fucosylated oligosaccharide.

According to the present disclosure, in step (1), the "conditions of reproduction of

Escherichia coli" refer to well-known conditions in the art under which Escherichia

coli can grow and reproduce, for example, in a LB solid or liquid culture medium at

-40 0 C.

According to a preferred embodiment of the present disclosure, in a LB liquid culture

medium that contains ampicillin (the final concentration may be 40-60Og/mL) and

kanamycin (the final concentration may be 40-60tg/mL), and under the condition of

adding IPTG (the concentration may be 0.1-0.5mM), the recombinant Escherichia

coli is induced and cultured at 15-17 0 C, so that it can express the

a-1,2-fucosyltransferase gene and the GDP-fucose pyrophosphorylase gene, and thus

a-1,2-fucosyltransferase and GDP-fucose pyrophosphorylase are obtained.

Wherein, the time when the IPTG is added is a conventional choice in the art, For

example, the IPTG may be added when the OD value of the culture medium reaches

0.6-0.8.

Wherein, the time for inducing and culturing may be selected within a wide range,

such as 12-20h.

According to the present disclosure, after the culturing is finished, the method

provided by the present disclosure further comprises protein separation and

12394917_1 (GHMatters) P113685.AU purification for the cultured bacteria, so as to obtain purified a-1,2-fucosyltransferase and GDP-fucose pyrophosphorylase.

Wherein, the method for protein separation and purification may be a conventional

method in the art. For example, the culture medium may be centrifuged to collect the

bacteria first, and then the bacteria may be broken in a lysis buffer, for example, by

means of ultrasonication, so that the target proteins are dissolved out; then the broken

product is centrifuged and the supernatant is collected; finally, the obtained

supernatant is treated in a nickel column for protein separation and purification. For

example, a Ni-NTA superflow nickel column (from TIANGEN Biotech Co., Ltd.)

may be used.

According to the present disclosure, in step (2), the substrate for conversion is a

substrate well-known in the art, which can be used to synthesize a-1,2-fucosylated

oligosaccharide under the action of a-1,2-fucosyltransferase. For example, the

substrate may contain GDP-fucose and lactose.

In order to improve the efficiency of synthesis of a-1,2-fucosylated oligosaccharide

more effectively, preferably the substrate for conversion further contains Tris-HCl,

MgSO4, ATP and GTP. Wherein, the concentration of each component may vary

within a wide range. According to a preferred embodiment of the present disclosure,

relative to IL substrate for conversion, the concentration of GDP-fucose is 5-15mmol,

the concentration of lactose is 5-15mmol, the concentration of Tris-HCl is 15-25mmol,

the concentration of MgSO4 is 4-6mmol, the concentration of ATP is 5-15mmol, and

the concentration of GTP is 5-15mmol.

According to the present disclosure, the doses of the a-1,2-fucosyltransferase and the

GDP-fucose pyrophosphorylase may be selected in a wide range respectively. In order

to improve the efficiency of synthesis of a-1,2-fucosyloligosaccharide more

effectively, preferably, relative to 1L substrate for conversion, the dose of the

a-1,2-fucosyltransferase is 30-50Og (e.g., 30[g, 32[g, 34g, 36g, 38[g, 40g, 42g,

44jg, 46jg, 48jg, or 50jg), and the dose of the GDP-fucose pyrophosphorylase is

12394917_1 (GHMatters) P113685.AU

-50g (e.g., 30Og, 32[g, 34[g, 36[g, 38[g, 40Og, 424g, 44tg, 46tg, 48[g, or

tg).

It should be noted here that the above-mentioned a-1,2-fucosyltransferase and

GDP-fucose pyrophosphorylase may contact with the substrate for conversion in the

form of the supernatant obtained after the cells are broken, or in the form of the

purified protein obtained through purification. However, no matter in which form the

above-mentioned a-1,2-fucosyltransferase and GDP-fucose pyrophosphorylase

contact with the substrate for conversion, the doses of the a-1,2-fucosyltransferase

and the GDP-fucose pyrophosphorylase above are measured in

a-1,2-fucosyltransferase itself and GDP-fucose pyrophosphorylase itself respectively.

According to the present disclosure, the conditions for synthesis of the

a-1,2-fucosylated oligosaccharide may be conventional conditions in the art. For

example, the temperature may be 36-38°C.

Hereunder the present disclosure will be detailed in examples.

Example 1

This example is provided to describe the construction of recombinant plasmids of

a-1,2-fucosyltransferase gene.

(1) Invitrogen Corporation is entrusted to synthesize a nucleotide sequence shown as

SEQ ID NO: 1 (a-1,2-fucosyltransferase gene), a forward primer shown as SEQ

ID NO: 3, and a reverse primer shown as SEQ ID NO: 4.

SEQ ID NO: 1:

ATGGCTTTTAAAGTGGTGCAAATTTGCGGAGGGCTTGGGAATCAAATGTT TCAATACGCTTTCGCTAAAAGTTTGCAAAAACACTCTAATACGCCTGTGCT GTTAGATATTACTTCTTTTGATTGGAGCAATAGGAAAATGCAATTAGAGCT TTTCCCTATTGATTTACCCTATGCGAATGCAAAAGAAATCGCTATAGCTAA AATGCAACACCTCCCCAAGCTAGTAAGAGATACGCTCAAATACATGGGAT

12394917_1 (GHMatters) P113685.AU

TTGATAGGGTGAGTCAAGAAATCGTGTTTGAATACGAGCCTAAATTGTTA AAGCCAAGCCGCTTGACTTATTTTTATGGCTATTTTCAAGATCCACGATAT TTTGATGCTATATCCCCTTTAATCAAGCAAACTTTCACCCTACCCCACCCC CCCCCCCCCGAAAATGGAAATAATAAAAAAAAAGAGGAAGAATACCACC GCAAACTTGCTTTGATTTTAGCCGCTCAAAACAGCGTGTTTGTGCATATAA GAAGAGGGGATTATGTGGGGATTGGCTGTCAGCTTGGCATTGACTATCAA AAAAAGGCGCTTGAGTATATGGCAAAACGCGTGCCAAACATGGAACTTTT CGTGTTTTGCGAAGACTTAGAATTCACGCAAAATCTTGATCTTGGCTACCC TTTTATGGACATGACCACTAGGGATAGAGAAGAAGAGGCGTATTGGGATA TGCTGCTCATGCAATCCTGTCAGCATGGCATTATCGCTAATAGCACTTATA GCTGGTGGGCGGCTTATTTGATAGAAAATCCAGAAAAAATCATTATTGGC CCCAAACACTGGCTTTTTGGGCATGAGAATATCCTTTGTGAGGAATGGGT GAAAATAGAATCCCATTTTGAGGTAAAATCCCAAAAGTATAACGCTTAA;

SEQ ID NO: 3:

F: 5'-CGGGATCCATGGCTTTTAAAGTGGTGC-3';

SEQ ID NO: 4:

R: 5'-CCCAAGCTTGTTATACTTTTGGGATTTTACCTCAAAATG-3'.

(2) The SEQ ID NO: 1 (a-1,2-fucoidyltransferase gene) is used as a template, the

a-1,2-fucoyltransferase gene is amplified with the PCR reaction system and

amplification procedure as shown in Table 1, the amplified DNA fragments are

detected and confirmed by agarose gel electrophoresis (about 900bp, as

expected), and the PCR product is recovered with an agarose gel DNA Recovery

Kit (from TIANGEN Biotech Co., Ltd.).

Table 1

PCR amplification PCR reaction system Dose Time conditions

ddH 20 12.5[tl 95 0 C 5min

12394917_1 (GHMatters) P113685.AU

1Ox buffer 2pl 95 0C 40s

dNTP 2pL 52 0C 40s 30 cycles

Forward primer 1pl 72 0C 60s

Reverse primer 1pl 72 0C 5min

DNA template 1pl

Taq enzyme 0.5pl

(3) DNA digestion and linking of a-1,2-fucosyltransferase gene: the recovered PCR

product and plasmids pCold I are double-digested with the same restriction

enzymes BamHI and Hind III, then the digested fragments are recovered with the

agarose gel DNA Recovery Kit, and recombinant plasmids are obtained by

linking with Solution I ligase (from Takara Bio Inc.).

(4) Transformation and extraction of the recombinant plasmids: the linked

recombinant plasmids are added into 50pL JM109 competent cells; the mixture

is held in ice bath for 30min., then subjected to heat shock at 42C for 90s, after

which, immediately immersed in ice bath for 5 min, then added into 500pL LB

liquid culture medium, and cultured at 370 C for 1h while shaking. The bacterial

solution is centrifuged at a low speed, then a part of the supernatant is removed,

the remaining bacteria are suspended again, and spread on a LB plate containing

kanamycin, and cultured overnight at 37 0C. A single colony is picked for PCR

verification, the positive clones are confirmed by sequencing, and then the

positive clone plasmids are extracted with a plasmid miniprep kit.

Example 2

This example is provided to describe the construction of recombinant plasmids of

GDP-fucose pyrophosphorylase gene

(1) Invitrogen Corporation is entrusted to synthesize a nucleotide sequence shown as

123949171 (GHMattes) P113685.AU

SEQ ID NO: 2 (GDP-fucose pyrophosphorylase gene), a forward primer shown

as SEQ ID NO: 5, and a reverse primer shown as SEQ ID NO: 6.

SEQ ID NO: 2:

ATGCAGAAGCTGCTGAGTCTGCCGAGTAATTTAGTGCAGAGCTTTCACGA ACTGGAGCGTGTTAATCGCACAGACTGGTTCTGCACCAGTGATCCGGTGG GTAAGAAACTGGGCAGCGGTGGCGGTACCAGTTGGCTGCTGGAGGAATG CTACAACGAGTATAGTGACGGCGCCACCTTCGGCGAATGGCTGGAAAAAG AGAAACGCATTCTGCTGCATGCAGGTGGTCAGAGTCGCCGCTTACCGGGT TACGCACCTAGCGGTAAAATTCTGACCCCTGTGCCGGTGTTTCGTTGGGAG CGCGGCCAGCATCTGGGTCAAAACTTACTGAGTCTGCAATTACCGCTGTA CGAAAAGATTATGAGCCTGGCCCCGGACAAGCTGCACACACTGATCGCCA GCGGCGATGTGTATATTCGCAGTGAGAAACCGCTGCAGAGCATTCCTGAG GCCGACGTTGTGTGCTACGGTCTGTGGGTGGACCCGAGCCTGGCCACCCA TCATGGCGTTTTCGCAAGCGACCGCAAACACCCGGAACAGCTGGACTTCA TGTTACAAAAACCGAGCCTGGCCGAACTGGAAAGCCTGAGTAAAACCCAC TTATTTCTGATGGACATCGGCATCTGGCTGCTGAGCGACCGTGCCGTTGAG ATTCTGATGAAACGCAGTCATAAAGAAAGTAGCGAAGAACTGAAATACT ATGACCTGTATAGCGATTTTGGCCTGGCACTGGGTACACACCCGCGTATC GAGGACGAAGAAGTTAATACACTGAGTGTTGCCATCCTGCCGCTGCCGGG TGGTGAGTTTTATCATTACGGTACCAGCAAGGAACTGATCAGCAGCACCC TGAGCGTGCAGAACAAAGTGTACGATCAACGTCGCATTATGCATCGCAAG GTTAAGCCTAACCCGGCCATGTTTGTGCAGAACGCCGTGGTTCGTATCCCG CTGTGCGCCGAGAATGCCGACCTGTGGATTGAAAATAGCCACATCGGCCC GAAATGGAAGATCGCCAGTCGTCACATCATTACAGGCGTTCCTGAAAACG ATTGGAGTCTGGCCGTTCCGGCAGGTGTGTGTGTTGACGTGGTTCCGATGG GCGATAAAGGCTTTGTTGCCCGTCCGTACGGCCTGGATGATGTTTTTAAGG GCGATTTACGTGATAGTAAGACCACCCTGACAGGCATCCCGTTTGGCGAG TGGATGAGTAAGCGTGGCCTGAGCTACACCGACCTGAAGGGCCGCACCGA CGATTTACAGGCAGTGAGCGTGTTCCCTATGGTTAACAGCGTTGAGGAGC

12394917_1 (GHMatters) P113685.AU

TGGGCCTGGTGTTACGCTGGATGCTGAGCGAACCGGAGCTGGAAGAAGGC AAAAACATCTGGCTGCGTAGCGAACATTTTAGCGCAGACGAGATCAGCGC AGGCGCCAACTTAAAACGTCTGTACGCCCAGCGCGAAGAATTTCGCAAAG GCAATTGGAAGGCCCTGGCCGTGAACCACGAGAAGAGTGTGTTCTACCAA CTGGACCTGGCAGATGCCGCCGAAGATTTTGTTCGCCTGGGCCTGGATAT GCCTGAACTGTTACCGGAGGATGCCCTGCAGATGAGTCGTATTCACAACC GCATGCTGCGTGCACGCATTCTGAAACTGGACGGCAAAGATTACCGTCCG GAAGAGCAAGCAGCATTTGATCTGCTGCGCGATGGCCTGCTGGACGGCAT CAGTAATCGTAAAAGCACCCCGAAGCTGGATGTGTATAGTGACCAGATCG TGTGGGGCCGTAGTCCGGTTCGCATCGACATGGCCGGTGGCTGGACAGAT ACCCCGCCGTACAGTCTGTATAGCGGTGGCAACGTGGTTAACCTGGCCAT TGAACTGAACGGTCAGCCTCCGCTGCAAGTTTATGTGAAGCCGTGCAAAG ACTTCCACATCGTGCTGCGTAGCATCGATATGGGCGCCATGGAAATCGTG AGCACCTTTGACGAGCTGCAGGATTACAAGAAGATTGGCAGCCCGTTTAG TATTCCGAAGGCCGCCCTGAGCTTAGCCGGTTTTGCCCCGGCATTCAGCGC AGTGAGTTACGCCAGTCTGGAGGAGCAGCTGAAAGACTTCGGTGCCGGCA TCGAAGTGACACTGTTAGCCGCAATCCCGGCAGGTAGCGGCCTGGGCACC AGTAGCATCCTGGCCAGTACCGTTCTGGGCGCCATTAATGACTTCTGTGGT TTAGCCTGGGACAAGAACGAAATTTGCCAACGCACCCTGGTTCTGGAGCA GCTGCTGACAACCGGCGGTGGTTGGCAGGATCAATACGGCGGCGTTTTAC AGGGCGTGAAACTGCTGCAGACAGAGGCAGGTTTCGCCCAAAGTCCGTTA GTTCGCTGGCTGCCGGATCACCTGTTTACCCATCCGGAGTACAAAGATTGC CATCTGCTGTATTACACCGGCATTACCCGCACAGCAAAAGGCATCCTGGC AGAGATCGTTAGCAGCATGTTTCTGAATAGCAGTCTGCACCTGAACCTGC TGAGCGAGATGAAGGCCCATGCCCTGGACATGAACGAAGCCATTCAGCGT GGTAGCTTCGTTGAGTTCGGTCGTCTGGTTGGCAAAACCTGGGAGCAAAA CAAAGCCCTGGACAGTGGTACCAACCCGCCGGCAGTTGAGGCCATTATCG ATTTAATCAAGGACTATACCCTGGGTTATAAACTGCCGGGTGCAGGCGGT GGCGGCTACCTGTATATGGTTGCAAAGGACCCGCAAGCAGCAGTTCGTAT CCGCAAGATCCTGACCGAAAATGCACCTAACCCGCGCGCCCGCTTCGTTG

12394917_1 (GHMatters) P113685.AU

AAATGACCCTGAGCGACAAGGGCTTTCAGGTTAGCCGTAGCTAACTCGAG

SEQ ID NO: 5:

F: 5'- CGCGGATCCGGATCCATGCAGAAGC -3';

SEQ ID NO: 6:

R: 5'- CCGCTCGAGCTCGAGTTAGCTACGGCTAACC -3';

(2) The SEQ ID NO: 2 (GDP-fucose pyrophosphorylase gene) is used as a template,

the GDP-fucose pyrophosphorylase gene is amplified with the PCR reaction

system and amplification procedure as shown in Table 2, the amplified DNA

fragments are detected and confirmed by agarose gel electrophoresis (about

2,800bp, as expected), and the PCR product is recovered with an agarose gel

DNA Recovery Kit (from TIANGEN Biotech Co., Ltd.).

Table 2

PCR amplification PCR reaction system Dose Time conditions

ddH 20 12.5 l 95 0C 5min

1Ox buffer 2[1 95 0C 40s

dNTP 2L 52 0C 40s 30 cycles

Forward primer 1 72 0C 3min

Reverse primer 1 1 72 0C 5min

DNA template 1

Taq enzyme 0.5 l

(3) DNA digestion and linking of GDP-fucose pyrophosphorylase gene: the

recovered PCR product and an expression vector pET28a are double-digested

with the same restriction enzymes BamHI and XhoI, then the digested fragments

are recovered with the agarose gel DNA Recovery Kit, and recombinant

12394917_1 (GHMatters) P113685.AU plasmids are obtained by linking with Solution I ligase (from Takara Bio Inc.).

(4) Transformation and extraction of the recombinant plasmids: the linked

recombinant plasmids are added into 50tL JM109 competent cells; the mixture

is held in ice bath for 30min., then subjected to heat shock at 42C for 90s, after

which, immediately immersed in ice bath for 5 min, then added into 500tL LB

liquid culture medium, and cultured at 37 0C for 1h while shaking. The bacterial

solution is centrifuged at a low speed, then a part of the supernatant is removed,

the remaining bacteria are suspended again, and spread on a LB plate containing

kanamycin, and cultured overnight at 37 0C. A single colony is picked for PCR

verification, the positive clones are confirmed by sequencing, and then the

positive clone plasmids are extracted with a plasmid miniprep kit.

Example 3

This example is provided to describe the construction of the recombinant Escherichia

coli system.

(1) The recombinant plasmids constructed in the example 1 and the example 2 are

respectively transformed into different E. coli C43 (DE3) competent cells and

cultured overnight at 37C; a single colony is picked and cultured in a LB liquid

culture medium containing ampicillin and kanamycin; the strain is preserved in

15% glycerol. Thus, E. coil C43 (DE3) recombinant bacteria, i.e., a constructed

recombinant strain expressing a-1,2-fucosyltransferase gene and a constructed

recombinant strain expressing GDP-fucose pyrophosphorylase gene are obtained.

Example 4

This example is provided to describe the protein expression and purification of

a-1,2-fucosyltransferase and GDP-fucose pyrophosphorylase

(1) Protein expression

The recombinant bacteria strains are respectively inoculated into 1OmL LB liquid

culture medium (containing 50tg/mL ampicillin and 50tg/mL kanamycin), cultured

12394917_1 (GHMatters) P113685.AU overnight at 37Cto obtain seed solutions. The seed solutions are transferred at lvol% inoculum size into 100mL LB liquid culture medium (containing 50 g/mL ampicillin), and cultured at 37C while shaking, till the OD6 oo value reaches 0.6-0.8; then, IPTG is added to the culture medium till the final concentration is 0.1-0.5mM; the strain is cultured at 160 C for 16h while shaking, and then centrifuged at 5,000rAnin. for 15min., to collect the bacteria.

(2) Protein separation and purification

mL breaking buffer (50mM Tris (pH=8.0), 100mM NaCl, 20% (v/v) glycerin, 1% (v/v) Triton X-100) is added to the bacteria to suspend the bacteria; the bacteria are broken by ultrasonication, and centrifuged at a high speed; the supernatant is collected and combined with well-balanced Ni-NTA superflow (From TIANGEN Biotech Co., Ltd.) for 1h; the mixed sample is driven to flow through a purification column, and the impurity proteins are washed off with a cleaning buffer. Then the target proteins are dissolved out with an eluting buffer. Through native polyacrylamide gel electrophoresis (SDS-PAGE), it identified that the obtained target proteins (a-1,2-fucosyltransferase (a) and GDP-fucose pyrophosphorylase (b)) are at purity as high as 95% or above respectively. The results are shown in Fig. 1.

Example 5

This example is provided to describe the determination of the yield of a-1,2-fucosylatedoligosaccharide.

As shown in Fig. 2, the specific catalytic process for producing a-1,2-fucosylated oligosaccharide from a-1,2-fucosyltransferase and GDP-fucose pyrophosphorylase through specific catalysis is as follows: fucose is transferred from a glycosyl donor GDP-fucose to a corresponding receptor oligosaccharide to form an a-1,2- link.

Specifically, in an EP tube, relative to IL reaction substrate, 20mmol Tris-HCl, mmol MgSO4, 10mmol ATP, 10mmol GTP, 10mmol lactose, 10mmol GDP fucose, kg a-1,2-fucosyltransferase purified in the example 4 and 40g GDP-fucose pyrophosphorylase purified in the example 4 are added, and the mixture is held

12394917_1 (GHMatters) P113685.AU overnight at 37C for reaction. The yield of a-1,2-fucosylated oligosaccharide is measured according to a standard curve of conversion relationship between lactose and a-1,2-fucosylated oligosaccharide, as well as the decreased amount of lactose in the reaction system. The measured yield of a-1,2-fucosylated oligosaccharide is

82.76%.

Compared with the catalytic yield of a-1,2-fucosyltransferase catalysis under optimal

conditions as disclosed in [Mattila P, Jarkko Rabina, Hortling S, et al. Functional

expression of Escherichia coli enzymes synthesizing GDP-L-fucose from inherent

GDP-D-mannose in Saccharomyces cerevisiae[J]. Glycobiology, 2000,

(10):1041-7.]. the catalytic yield in the present disclosure is improved by 145.23%.

The above content describes in detail the preferred embodiments of the present

disclosure, but the present disclosure is not limited thereto. A variety of simple

modifications can be made in regard to the technical solutions of the present

disclosure within the scope of the technical concept of the present disclosure,

including a combination of individual technical features in any other suitable manner,

such simple modifications and combinations thereof shall also be regarded as the

content disclosed by the present disclosure, each of them falls into the protection

scope of the present disclosure.

It is to be understood that, if any prior art publication is referred to herein, such

reference does not constitute an admission that the publication forms a part of the

common general knowledge in the art, in Australia or any other country.

In the claims which follow and in the preceding description of the invention, except

where the context requires otherwise due to express language or necessary implication,

the word "comprise" or variations such as "comprises" or "comprising" is used in an

inclusive sense, i.e. to specify the presence of the stated features but not to preclude

the presence or addition of further features in various embodiments of the invention.

185234041 (GHMatters) P113685.AU

SEQUENCE LISTING

<110> Nutrition & Health Research Institute ,COFCO Corporation COFCO£¨jilin£©Bio‐Chemical Technology CO.,Ltd <120> Recombinant Escherichia coli System, Construction Method Thereof, and Usage in Synthesis of ¦Á‐1,2‐Fucosylated Oligosaccharide

<130> PAU55164COF‐55163

<160> 6

<170> PatentIn version 3.3

<210> 1 <211> 906 <212> DNA <213> ÓÄÃÅÂÝÐý¸Ë¾ú£¨Helicobacter pylori£©

<400> 1 atggctttta aagtggtgca aatttgcgga gggcttggga atcaaatgtt tcaatacgct 60

ttcgctaaaa gtttgcaaaa acactctaat acgcctgtgc tgttagatat tacttctttt 120

gattggagca ataggaaaat gcaattagag cttttcccta ttgatttacc ctatgcgaat 180

gcaaaagaaa tcgctatagc taaaatgcaa cacctcccca agctagtaag agatacgctc 240

aaatacatgg gatttgatag ggtgagtcaa gaaatcgtgt ttgaatacga gcctaaattg 300

ttaaagccaa gccgcttgac ttatttttat ggctattttc aagatccacg atattttgat 360

gctatatccc ctttaatcaa gcaaactttc accctacccc accccccccc ccccgaaaat 420

ggaaataata aaaaaaaaga ggaagaatac caccgcaaac ttgctttgat tttagccgct 480

caaaacagcg tgtttgtgca tataagaaga ggggattatg tggggattgg ctgtcagctt 540

ggcattgact atcaaaaaaa ggcgcttgag tatatggcaa aacgcgtgcc aaacatggaa 600

cttttcgtgt tttgcgaaga cttagaattc acgcaaaatc ttgatcttgg ctaccctttt 660

atggacatga ccactaggga tagagaagaa gaggcgtatt gggatatgct gctcatgcaa 720

tcctgtcagc atggcattat cgctaatagc acttatagct ggtgggcggc ttatttgata 780

gaaaatccag aaaaaatcat tattggcccc aaacactggc tttttgggca tgagaatatc 840

ctttgtgagg aatgggtgaa aatagaatcc cattttgagg taaaatccca aaagtataac 900

gcttaa 906

<210> 2

<211> 2856 <212> DNA <213> ´àÈõÄâ¸Ë¾ú£¨Bacteroides fragilis£©

<400> 2 atgcagaagc tgctgagtct gccgagtaat ttagtgcaga gctttcacga actggagcgt 60

gttaatcgca cagactggtt ctgcaccagt gatccggtgg gtaagaaact gggcagcggt 120

ggcggtacca gttggctgct ggaggaatgc tacaacgagt atagtgacgg cgccaccttc 180

ggcgaatggc tggaaaaaga gaaacgcatt ctgctgcatg caggtggtca gagtcgccgc 240

ttaccgggtt acgcacctag cggtaaaatt ctgacccctg tgccggtgtt tcgttgggag 300

cgcggccagc atctgggtca aaacttactg agtctgcaat taccgctgta cgaaaagatt 360

atgagcctgg ccccggacaa gctgcacaca ctgatcgcca gcggcgatgt gtatattcgc 420

agtgagaaac cgctgcagag cattcctgag gccgacgttg tgtgctacgg tctgtgggtg 480

gacccgagcc tggccaccca tcatggcgtt ttcgcaagcg accgcaaaca cccggaacag 540

ctggacttca tgttacaaaa accgagcctg gccgaactgg aaagcctgag taaaacccac 600

ttatttctga tggacatcgg catctggctg ctgagcgacc gtgccgttga gattctgatg 660

aaacgcagtc ataaagaaag tagcgaagaa ctgaaatact atgacctgta tagcgatttt 720

ggcctggcac tgggtacaca cccgcgtatc gaggacgaag aagttaatac actgagtgtt 780

gccatcctgc cgctgccggg tggtgagttt tatcattacg gtaccagcaa ggaactgatc 840

agcagcaccc tgagcgtgca gaacaaagtg tacgatcaac gtcgcattat gcatcgcaag 900

gttaagccta acccggccat gtttgtgcag aacgccgtgg ttcgtatccc gctgtgcgcc 960

gagaatgccg acctgtggat tgaaaatagc cacatcggcc cgaaatggaa gatcgccagt 1020

cgtcacatca ttacaggcgt tcctgaaaac gattggagtc tggccgttcc ggcaggtgtg 1080

tgtgttgacg tggttccgat gggcgataaa ggctttgttg cccgtccgta cggcctggat 1140

gatgttttta agggcgattt acgtgatagt aagaccaccc tgacaggcat cccgtttggc 1200

gagtggatga gtaagcgtgg cctgagctac accgacctga agggccgcac cgacgattta 1260

caggcagtga gcgtgttccc tatggttaac agcgttgagg agctgggcct ggtgttacgc 1320

tggatgctga gcgaaccgga gctggaagaa ggcaaaaaca tctggctgcg tagcgaacat 1380

tttagcgcag acgagatcag cgcaggcgcc aacttaaaac gtctgtacgc ccagcgcgaa 1440

gaatttcgca aaggcaattg gaaggccctg gccgtgaacc acgagaagag tgtgttctac 1500 caactggacc tggcagatgc cgccgaagat tttgttcgcc tgggcctgga tatgcctgaa 1560 ctgttaccgg aggatgccct gcagatgagt cgtattcaca accgcatgct gcgtgcacgc 1620 attctgaaac tggacggcaa agattaccgt ccggaagagc aagcagcatt tgatctgctg 1680 cgcgatggcc tgctggacgg catcagtaat cgtaaaagca ccccgaagct ggatgtgtat 1740 agtgaccaga tcgtgtgggg ccgtagtccg gttcgcatcg acatggccgg tggctggaca 1800 gataccccgc cgtacagtct gtatagcggt ggcaacgtgg ttaacctggc cattgaactg 1860 aacggtcagc ctccgctgca agtttatgtg aagccgtgca aagacttcca catcgtgctg 1920 cgtagcatcg atatgggcgc catggaaatc gtgagcacct ttgacgagct gcaggattac 1980 aagaagattg gcagcccgtt tagtattccg aaggccgccc tgagcttagc cggttttgcc 2040 ccggcattca gcgcagtgag ttacgccagt ctggaggagc agctgaaaga cttcggtgcc 2100 ggcatcgaag tgacactgtt agccgcaatc ccggcaggta gcggcctggg caccagtagc 2160 atcctggcca gtaccgttct gggcgccatt aatgacttct gtggtttagc ctgggacaag 2220 aacgaaattt gccaacgcac cctggttctg gagcagctgc tgacaaccgg cggtggttgg 2280 caggatcaat acggcggcgt tttacagggc gtgaaactgc tgcagacaga ggcaggtttc 2340 gcccaaagtc cgttagttcg ctggctgccg gatcacctgt ttacccatcc ggagtacaaa 2400 gattgccatc tgctgtatta caccggcatt acccgcacag caaaaggcat cctggcagag 2460 atcgttagca gcatgtttct gaatagcagt ctgcacctga acctgctgag cgagatgaag 2520 gcccatgccc tggacatgaa cgaagccatt cagcgtggta gcttcgttga gttcggtcgt 2580 ctggttggca aaacctggga gcaaaacaaa gccctggaca gtggtaccaa cccgccggca 2640 gttgaggcca ttatcgattt aatcaaggac tataccctgg gttataaact gccgggtgca 2700 ggcggtggcg gctacctgta tatggttgca aaggacccgc aagcagcagt tcgtatccgc 2760 aagatcctga ccgaaaatgc acctaacccg cgcgcccgct tcgttgaaat gaccctgagc 2820 gacaagggct ttcaggttag ccgtagctaa ctcgag 2856

<210> 3 <211> 27 <212> DNA <213> È˹¤ÐòÁÐ

<400> 3 cgggatccat ggcttttaaa gtggtgc 27

<210> 4 <211> 39 <212> DNA <213> È˹¤ÐòÁÐ

<400> 4 cccaagcttg ttatactttt gggattttac ctcaaaatg 39

<210> 5 <211> 25 <212> DNA <213> È˹¤ÐòÁÐ

<400> 5 cgcggatccg gatccatgca gaagc 25

<210> 6 <211> 31 <212> DNA <213> È˹¤ÐòÁÐ

<400> 6 ccgctcgagc tcgagttagc tacggctaac c 31

Claims (5)

Claims

1. A method for synthesizing a-1,2-fucosylated oligosaccharide, comprising:

(1) under conditions of reproduction of Escherichia coli, allowing the

recombinant Escherichia coli system to reproduce and express the

a-1,2-fucosyltransferase gene and the GDP-fucose pyrophosphorylase gene,

to obtain a-1,2-fucosyltransferase and GDP-fucose pyrophosphorylase;

(2) controlling the a-1,2-fucosyltransferase and the GDP-fucose

pyrophosphorylase obtained in step (1) to contact with a substrate for

conversion, to synthesize the a-1,2-fucosylated oligosaccharide;

Wherein the recombinant Escherichia coli system is transformed with

a-1,2-fucosyltransferase gene and GDP-fucose pyrophosphorylase gene;

Wherein the a-1,2-fucosyltransferase gene is derived from Helicobacter pylori,

and/or the GDP-fucose pyrophosphorylase gene is derived from Bacteroides

fragilis;

Wherein the a-1,2-fucosyltransferase gene has a nucleotide sequence shown as

SEQ ID NO: 1, and/or the GDP-fucose pyrophosphorylase gene has a nucleotide

sequence shown as SEQ ID NO: 2;

Wherein the step (1) refers to inducing and culturing recombinant Escherichia

coli in a LB liquid culture medium that contains ampicillin and kanamycin, and

under the condition of adding IPTG;

Wherein after the culturing is finished, the method comprises protein separation

and purification for the cultured bacteria, so as to obtain purified

a-1,2-fucosyltransferase and GDP-fucose pyrophosphorylase;

Wherein the substrate for conversion contains GDP-fucose and lactose.

18732002_1 (GHMatters) P113685.AU

2. The method of claim 1, wherein the Escherichia coli cells for constructing the

Escherichiacoli system are Escherichiacoli C43 cells.

3. The method of claim 2, wherein the a-1,2-fucosyltransferase gene and the

GDP-fucose pyrophosphorylase gene are included in a same Escherichiacoli cell;

or

the a-1,2-fucosyltransferase gene and the GDP-fucose pyrophosphorylase gene

are included in different Escherichiacoli cells.

4. The method of any of claims 1-3, wherein the substrate for conversion further

contains Tris-HCl, MgS04, ATP and GTP.

5. The method of claim 4, wherein relative to IL substrate for conversion, the

concentration of the GDP-fucose is 5-15mmol, the concentration of the lactose is

5-15mmol, the concentration of the Tris-HCl is 15-25mmol, the concentration of

the MgSO4 is 4-6mmol, the concentration of the ATP is 5-15mmol, the

concentration of the GTP is 5-15mmol, the dose of the a-1,2-fucosyltransferase is

30-50Og, and the dose of the GDP-fucose pyrophosphorylase is 30-50tg.

18732002_1 (GHMatters) P113685.AU

Fig. 1

1/2

Receptor: Gal-R Donor: GPD-fucose

α-1,2-fucosyltransferase + GDP-fucose pyrophosphorylase

Product: α-1,2-fucosylated oligosaccharide

Fig. 2

2/2