AU2019100972A4 - Primer set, kit, and method for detecting porcine deltacoronavirus - Google Patents
Primer set, kit, and method for detecting porcine deltacoronavirus Download PDFInfo
- Publication number
- AU2019100972A4 AU2019100972A4 AU2019100972A AU2019100972A AU2019100972A4 AU 2019100972 A4 AU2019100972 A4 AU 2019100972A4 AU 2019100972 A AU2019100972 A AU 2019100972A AU 2019100972 A AU2019100972 A AU 2019100972A AU 2019100972 A4 AU2019100972 A4 AU 2019100972A4
- Authority
- AU
- Australia
- Prior art keywords
- pdcov
- primer
- present
- probe
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/005—Assays involving biological materials from specific organisms or of a specific nature from viruses
- G01N2333/08—RNA viruses
- G01N2333/165—Coronaviridae, e.g. avian infectious bronchitis virus
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Analytical Chemistry (AREA)
- Wood Science & Technology (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention discloses a primer set, a kit, and a method for detecting porcine deltacoronavirus (PDCoV), and relates to the field of viral molecular biological detection. The primer set provided by the present invention includes an upstream primer, a downstream primer, and a probe. The sequence of the upstream primer is depicted in SEQ ID NO. 1, the sequence of the downstream primer is depicted in SEQ ID NO. 2, and the sequence of the probe is depicted in SEQ ID NO. 3. Using the primer set of the present invention, the lower limit of detection (LLD) of the PDCoV is 26.6 copies/pL, featuring strong specificity, high sensitivity, and good between-run and within-run reproducibilities. One hundred and twenty clinical porcine fecal samples were assayed by the present invention, and the result showed a PDCoV positive rate of 25%.
Description
PRIMER SET, KIT, AND METHOD FOR DETECTING PORCINE DELTACORONAVIRUS
TECHNICAL FIELD
The present invention relates to the field of viral molecular biological detection, and in particular to a primer set, a kit, and a method for detecting porcine deltacoronavirus (PDCoV).
BACKGROUND
Porcine deltacoronavirus (PDCoV), also known as porcine coronavirus HKU15, primarily infects the entire length of the porcine small intestine, resulting in enteritis, accompanied by diarrhea and vomiting. Morbidity and mortality are up to 50-100% in suckling pigs. To date, detection methods for PDCoV mainly include ELISA, RT-PCR, and fluorogenic quantitative PCR assays in China and overseas. PDCoV assay and identification become more and more difficult because PDCoV has a similar clinical morbidity to porcine epidemic diarrhea virus (PEDV) and transmissible gastroenteritis virus (TGEV). Among many PDCoV assays, RT-PCR assay becomes one of the principal means of investigation of PDCoV assay due to its high sensitivity and specificity; however, because conventional RT-PCR shows a low PDCoV-positive rate and the sensitivity and specificity of the assay remain insufficient to satisfy the diagnosis of clinical samples of PDCoV, it is of importance in establishing a detection method with strong specificity, high sensitivity and improved PDCoV-positive rate on the basis of conventional RT-PCR.
SUMMARY
In view of this, the objective of the present invention is to provide a primer set, a kit, and a method for detecting porcine deltacoronavirus (PDCoV). The positive rate of the virus is high, and the specificity and sensitivity of the method satisfy the diagnostic requirements of a clinical PDCoV sample.
In order to achieve the foregoing invention objective, the present invention provides the following technical solutions:
The present invention provides a primer set for detecting PDCoV, including an upstream primer, a downstream primer, and a probe, where the sequence of the upstream primer is depicted in SEQ ID NO. 1, the sequence of the downstream
2019100972 29 Aug 2019 primer is depicted in SEQ ID NO. 2, and the sequence of the probe is depicted in SEQ ID NO. 3.
The present invention further provides a TaqMan fluorogenic quantitative PCR kit for detecting PDCoV, including the upstream primer, the downstream primer, and the probe according to claim 1.
Preferably, concentrations of both the upstream and downstream primers are 0.75 pmol/L, and the concentration of the probe is 0.2 pmol/L.
The present invention further provides a method for detecting PDCoV, including the following steps: (1) extracting and reversely transcribing analyte RNAto obtain a template cDNA;
(2) extracting and reversely transcribing PDCoV RNA to obtain a positive standard; and (3) using the primer set or the kit for TaqMan fluorogenic quantitative PCR of the template cDNAand the positive standard;
there is no chronological relationship between step (1) and step (2).
Preferably, the system of the TaqMan fluorogenic quantitative PCR of step (3) is moderate, and 20 pL each of the reaction system includes the following components: 4 μΙ_ of 5* buffer, 1 μΙ_ of dNTP, 1 μΙ_ of RRI, 0.5 μΙ_ of GoTaq, 2 μΙ_ of template cDNA or positive standard, 0.5 μΙ_ of primer, 0.5 pL of probe, and 10.5 μΙ_ of deionized water;
the reaction procedure of the TaqMan fluorogenic quantitative PCR is: predenaturation at 95°C for 2 min, followed by denaturation at 95°C for 15 s, and annealing and extension at 56°C for 1 min, with a total of 40 cycles of the procedure of the denaturation, annealing and extension.
The present invention provides a primer set for detecting porcine deltacoronavirus (PDCoV), including an upstream primer, a downstream primer, and a probe, where the sequence of the upstream primer is depicted in SEQ ID NO. 1, the sequence of the downstream primer is depicted in SEQ ID NO. 2, and the sequence of the probe is depicted in SEQ ID NO. 3. The primer set of the present invention is designed and synthesized according to the N gene sequence of PDCoV.
In an embodiment of the present invention, the primer set could specifically detect PDCoV, but the test was negative for porcine transmissible gastroenteritis virus (TGEV), porcine epidemic diarrhea virus (PEDV), porcine kobuvirus (PKV), porcine reproductive and respiratory syndrome virus (PRRSV), and foot and mouth disease virus (FMDV). Repeated experiment was carried out using plasmid standards at three
2019100972 29 Aug 2019 different concentrations: 2.66*106, 2.66*105, and 2.66*104copies/pL. The coefficient of variation (CV) of cycle threshold (CT) was lower than 2%, suggesting that the method has good specificity; the standard curve slope was -3.461 and the correlation coefficient (R2) was 0.998, suggesting a good linear relationship between threshold and template concentration. For 10-fold serial plasmid standard dilutions, the lower limit of detection (LLD) was 2.66*101 copies/pL of plasmid DNAs, suggesting that the method has good sensitivity. One hundred and twenty clinical porcine fecal samples were assayed by the present invention, and the result showed a PDCoV positive rate of 25%. The primer set of the present invention features strong specificity, high sensitivity, and good between-run and within-run reproducibilities, and can be used for diagnosis of clinical PDCoV samples.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 shows a diagram of PCR amplified products of an N gene sequence of PDCoV provided by an embodiment of the present invention;
FIG. 2 shows a standard curve plot of TaqMan probe real-time fluorogenic quantitative PCR of PDCoV provided by an embodiment of the present invention;
FIG. 3 shows a graph of kinetic curves of TaqMan probe real-time fluorogenic quantitative PCR of PDCoV provided by an embodiment of the present invention;
FIG. 4 shows a graph of specificity test results of TaqMan probe real-time fluorogenic quantitative PCR of PDCoV provided by an embodiment of the present invention;
FIG. 5 shows a graph of sensitivity test results of TaqMan probe real-time fluorogenic quantitative PCR of PDCoV provided by an embodiment of the present invention.
DETAILED DESCRIPTION
The present invention provides a primer set for detecting porcine deltacoronavirus (PDCoV), including an upstream primer, a downstream primer, and a probe, where the sequence of the upstream primer is depicted in SEQ ID NO. 1, the sequence of the downstream primer is depicted in SEQ ID NO. 2, and the sequence of the probe is depicted in SEQ ID NO. 3.
The design of the primer set of the present invention is preferably based on the complete genome sequence of porcine deltacoronavirus (PDCoV) published on
2019100972 29 Aug 2019
GenBank; DNA Star software is used for sequence alignment to search a conserved N gene sequence; probe design software, Primer Express5.0, is used to design a pair of primers and a probe, and the detailed information is shown in Table 1. In the present invention, the primer set is preferably synthesized artificially and is synthesized by Beijing Genomics Institute Group in the embodiment of the present invention.
Table 1 Primers and probe sequence of PDCoV
| Name of the primer | Primer sequence | SEQ NO. | ID | |
| Upstream | PDCoV-F | TAAGGATGCGCTCAACACGGTCGT | 1 | |
| primer | ||||
| Downstrea | PDCoV-R | CCAATCCTGI I I GTCTGCTGGCA | 2 | |
| m primer | ||||
| Probe | PDCoV-Pro | FAM-TGGTGCCAATGTCGGCTCTGCAGAC | 3 | |
| be | A-BHQ1 |
The present invention further provides a TaqMan fluorogenic quantitative PCR kit for detecting PDCoV, including the upstream primer, the downstream primer, and the probe according to claim 1. Concentrations of both the upstream and downstream primers of the present invention are preferably 0.75 pmol/L, and the concentration of the probe is preferably 0.2 pmol/L. The kit of the present invention further includes: 5* buffer, dNTP, RRI, and GoTaq.
The present invention further provides a method for detecting PDCoV, including the following steps: (1) extracting and reversely transcribing analyte RNA to obtain a template cDNA;
(2) extracting and reversely transcribing PDCoV RNA to obtain a positive standard; and (3) using the primer set or the kit for TaqMan fluorogenic quantitative PCR of the template cDNAand the positive standard;
there is no chronological relationship between step (1) and step (2).
When the present invention detects PDCoV, analyte RNA is extracted and reversely transcribed to obtain a template cDNA. Extracting the analyte RNA is not
2019100972 29 Aug 2019 specifically limited in the present invention, and conventional RNA extraction methods in the field may be used. The analyte of the present invention is preferably from a piglet intestinal content sample. The present invention conducts the RNA extracted on reverse transcription. The reverse transcription method is not specifically limited in the present invention, and commercially available reverse transcription kits in the field may be used.
The present invention extracts and reversely transcribes PDCoV RNA to obtain a positive standard. Extraction of the PDCoV RNA of the present invention is preferably conducted in accordance with the operating instructions of RNeasy Mini kit(50)QIAGen, specifically including the steps of: pipetting 350 pl_ of viral suspension into a 1.5 mL centrifuge tube, adding isovolumetric RLT and 3.5 μΙ_ of β-mercaptoethanol, standing on ice for 5-10 min, then adding 700 μΙ_ of absolute alcohol rapidly, slowly mixing well, taking out a minicolumn, adding 700 μΙ_ of mixture, centrifuging for 15 s at 12000 rpm/min, discarding the fluid from a collection tube, and repeating once; then adding 500 μΙ_ of RW1, standing on ice for 1 min, centrifuging for 15 s at 12000 rpm/min, changing another new collection tube, adding 700 μΙ_ of RW2, centrifuging for 15 s at 12000 rpm/min, discarding the fluid from the collection tube, adding 700 μΙ_ of RW2, centrifuging for 2 min at 12000 rpm/min, placing the minicolumn into a prepared RNase-free 1.5 mL centrifuge tube, adding 30 pL of RNase-free water, standing for 1 min, centrifuging for 1 min at 12000 rpm/min, taking out the minicolumn, and storing the extracted RNA in a freezer at -20°C for use.
The positive standard of the present standard is preferably positive plasmid. When the present standard prepares the positive plasmid, preferably the RNA of the virus is reversely transcribed into cDNA, and PCR amplification is conducted with the cDNA as a template. In the present invention, the sequences of the primers for the PCR amplification are preferably depicted in SEQ ID NO.4 (AGCCCAGGAAACGCGACCAATCTGC) and SEQ ID NO.5 (ATGATGCTTTTGAGATAAAGCAGGA). The primers of the present invention are a pair of specific primers designed lateral to a fluorescent quantitative primer. The present invention conducts a product amplified by the primer on agarose gel electrophoresis; provided that there is a specific band, amplification result will be in accordance with the designed target fragment; positive PCR product is purified, cloned to a PMD-20T carrier, and transformed into DH5a competent cells. The present invention cultures the transformed cells, screens out positive transformants
2019100972 29 Aug 2019 by means of blue-white selection, expands culture, and then extracts plasmids; after double digestion with Hind III and EcoRI, a carrier band of -2736 bp and a target band of - 648 bp are obtained. The present invention preferably conducts the short band obtained on gene detection, and the gene detection of the present invention is conducted by Beijing Genomics Institute Group. In an embodiment of the present invention, the amplified PCR product was 100% homologous to a template sequence; after purification and measurement with Nanodrop 2000 Spectrophotometer, the concentration of the positive plasmid extracted was 98.5 ng/pL, and OD260/OD280 was 1.86, storing at -70°C for use.
After the template cDNA and the positive standard is obtained, the present invention conducts the template cDNA and the positive standard on TaqMan fluorogenic quantitative PCR by means of the primer set or the kit. The TaqMan fluorogenic quantitative PCR system of the present invention is moderate, and 20 pleach of the reaction system preferably includes the following components: 4 pl_ of 5* buffer, 1 μΙ_ of dNTP, 1 μΙ_ of RRI, 0.5 μΙ_ of GoTaq, 2 μΙ_ of plasmid standard, 0.5 μΙ_ of primer, 0.5 μΙ_ of probe, and 10.5 μΙ_ of deionized water.
The reaction procedure of the TaqMan fluorogenic quantitative PCR is preferably: predenaturation at 95°C for 2 min, followed by denaturation at 95°C for 15 s, and annealing and extension at 56°C for 1 min, with a total of 40 cycles of the procedure of the denaturation, annealing and extension.
In the present invention, the criteria for judgment of positivity or negativity of the analyte are preferably that it will be:
(1) positive: if the analyte has a Ct value of <35.0, and shows a curve with an obvious exponential growth phase;
(2) suspicious: if the analyte has a Ct value of >35.0 and there is a sample with a typical amplification curve, then the test will be repeated; and (3) negative: if the Ct value of the analyte is undetectable, and there is no obvious amplification curve.
The primer set, kit, and method for detecting PDCoV will be described in detail below in ligation with the embodiment of the present invention and should not be construed as limiting the scope of the invention.
Embodiment 1
1. Extraction of PDCoV RNA
Extraction of PDCoV RNA was conducted in accordance with the operating
2019100972 29 Aug 2019 instructions of RNeasy Mini kit(50)QIAGen, specifically including the steps of: pipetting 350 pl_ of viral suspension into a 1.5 mL centrifuge tube, adding isovolumetric RLT and 3.5 pL of β-mercaptoethanol, standing on ice for 5-10 min, then adding 700 pL of absolute alcohol rapidly, slowly mixing well, taking out a minicolumn, adding 700 pL of the mixture, centrifuging for 15 s at 12000 rpm/min, discarding the fluid from a collection tube, and repeating once; then adding 500 pL of RW1, standing on ice for 1 min, centrifuging for 15 s at 12000 rpm/min, changing another new collection tube, adding 700 pL of RW2, centrifuging for 15 s at 12000 rpm/min, discarding the fluid from the collection tube, adding 700 pL of RW2, centrifuging for 2 min at 12000 rpm/min, placing the minicolumn into a prepared RNase-free 1.5 mL centrifuge tube, adding 30 pL of RNase-free water, standing for 1 min, centrifuging for 1 min at 12000 rpm/min, taking out the minicolumn, and storing the extracted RNA in a freezer at -20°C for use.
2. Preparation of positive RNA standard
A pair of specific primers were designed lateral to a fluorescent quantitative primer. The extracted viral RNA was reversely transcribed into cDNA, then PCR amplification was conducted on the pair of specific primers lateral to the fluorescent quantitative primer with the reversely transcribed cDNA, and a negative control was set up (without template cDNA). The product amplified was assayed by 1.5% agarose gel electrophoresis and result was observed, as shown in FIG. 1 (all letters and numbers in FIG. 1 separately represent: M1 as a DNA ladder, 1 as a negative control, 2 as a PCR product of N gene of PDCoV strain, 3 as a recombinant plasmid Hind IH+EcoRI double-digested product, and M2 as a DNA ladder). The PCR product had a specific band at 648 bp after 1.5% agarose gel electrophoresis, and amplification result was in accordance with the designed target fragment. Positive PCR product was purified, cloned to a PMD-20T carrier, and transformed into DH5a competent cells. Positive transformants were screened out by means of blue-white selection, culture was expanded, and then plasmids were extracted; after double digestion with Hind III and EcoRI, a carrier band of -2736 bp and a target band of - 648 bp were obtained. Sequenced by Beijing Genomics Institute Group, results showed that the amplified PCR product was 100% homologous to the template sequence. After purification and measurement with Nanodrop 2000 Spectrophotometer, the concentration of the positive plasmid extracted was 98.5 ng/pL, and OD260/OD280 was 1.86, storing at -70°C for use.
2019100972 29 Aug 2019
3. Fluorogenic quantitative PCR system and optimization of reaction procedure
Taq DNA Polymerase (Promega, USA) was used as a fluorogenic quantitative PCR mixture.
Primers: PDCoV-F: TAAGGATGCGCTCAACACGGTCGT;
PDCoV-R: CCAATCCTGTTTGTCTGCTGGCA;
PDCoV-Probe: FAM-TGGTGCCAATGTCGGCTCTGCAGACA-BHQ1.
Reaction system: The total volume was 20 pL, including: 5* buffer 4 pL, dNTP 1 μΙ_, RRI 1 pL, GoTaq 0.5 μΙ_, plasmid standard 2 pL, primer 0.5 μΙ_, probe 0.5 μΙ_, and deionized water 10.5 pL;
Reaction procedure: predenaturation at 95°C for 2 min, followed by denaturation at 95°C for 15 s, and annealing and extension at 56°C for 1 min, with a total of 40 cycles of the procedure of the denaturation, annealing and extension.
4. Establishment of fluorogenic quantitative standard curve
Using a calculation formula of copy number, i.e., copy concentration = [6.023 χ 1023 x (concentration ng/pL χ 10’9)]/base number χ 660, the copy number was calculated as 2.66 χ 1010 copies/pL; after 10-fold serial dilution with 2.66x1010 copies/pL as an initial concentration, 2.66 χ 106, 2.66 χ 105, 2.66 χ 104, 2.66 χ 103, 2.66 χ 102, and 2.66 χ 101 copies/pL plasmids were obtained as templates and assayed on Agilent Stratagene Mx3005p qPCR system; an amplification kinetic curve for detecting PDCoV (FIG. 3, where: 1-6 indicate that PDCoV plasmid concentrations are 2.66 χ 106, 2.66 χ 105, 2.66 χ 104, 2.66 χ 103, 2.66 χ 102, and 2.66 χ 101 copies/pL, respectively, and 7 indicates a negative control) was obtained, and the corresponding standard curve was calculated, as shown in FIG. 2; from FIG. 2, there was a good linearity when the concentration of fluorogenic quantitative PCR standard of PDCoV ranged from 2.66 χ 101 to 2.66 χ 106 copies/pL, with Y = -3.46 χ lg(x) + 41.58, an amplification efficiency of 94.5% and a correlation coefficient (R2) of 0.998.
5. Sensitivity test
After 10-fold serial dilution with 2.66x107 copies/pL as an initial concentration of positive plasmid, 2.66 χ 107, 2.66 χ 106, 2.66 χ 105, 2.66 χ 104, 2.66 χ 103, 2.66 χ 102, and 2.66 χ 101 copies/pL plasmids were obtained as templates, fluorogenic quantitative PCR was conducted, and a kinetic curve of sensitivity was obtained, as shown in FIG. 4 (where 1-7 indicate that PDCoV plasmid concentrations are 2.66 χ 107, 2.66 χ 106, 2.66 χ 105, 2.66 χ 104, 2.66 χ 103, 2.66 χ 102, and 2.66 χ 101 copies/pL, respectively, and 8 indicates a negative control); combined with FIG. 2,
2019100972 29 Aug 2019 when the copy number of the standard was 2.66 χ 101 copies/pL, it remained detectable, but the blank control was not amplified, suggesting that the lower limit of detection (LLD) of the detection method could be up to 26.6 copies/pL, with positivity when CT value was lower than 40.
6. Specificity test
In order to verify the specificity of fluorogenic quantitative PCR established by the present experiment, RNA extraction kit was used to extract RNAs of porcine reproductive and respiratory syndrome virus (PRRSV), foot and mouth disease virus (FMDV), porcine kobuvirus (PKV), porcine transmissible gastroenteritis virus (TGEV), and porcine epidemic diarrhea virus (PEDV) and reversely transcribe them into cDNAs, which were amplified by PCR with their respective primers to obtain the corresponding specific fragments; the five viruses were verified as positive strains, and the reversely transcribed cDNAs could be amplified normally. Fluorogenic quantitative PCR amplification was carried out with cDNAs of PRRSV, FMDV, PKV, TGEV, and PEDV as templates, and negative and positive controls were set up. Test results are shown in FIG. 5 (where all numbers separately indicate: 1 as PDCoV, 2 as PRRSV, 3 as FMDV, 4 as PKV, 5 as TGEV, 6 as PEDV, and 7 as a negative control). From FIG. 5, for PRRSV, FMDV, PKV, TGEV, PEDV, and negative control, fluorogenic quantitative PCR showed no amplification curve, but only 2.66x108 copies/pL plasmid PDCoV showed a good amplification curve. It was indicated that the TaqMan real-time fluorogenic quantitative PCR assay established by the experiment had good specificity.
7. Reproducibility test (1) Between-run reproducibility test: Taking three different concentrations (2.66 χ 106, 2.66 χ 105, and 2.66 χ 104 copies/pL) of plasmid standard samples, reproducibility test was carried out in triplicate under the same conditions; CT values obtained were tested and analyzed. It turned out that their coefficients of variation (CVs) of CT values were 1.6%, 1.2%, and 1.1%, respectively, all of which were below 2% (as shown in Table 2), indicating that the TaqMan real-time fluorogenic quantitative PCR assay for PDCoV established by the experiment had good between-run reproducibility.
2019100972 29 Aug 2019
Table 2 Between-run reproducibility of real-time fluorogenic quantitative PCR assay for PDCoV
Mean cycle
Sample Between-run reproducibility threshold CV%
| 2.66 χ 104 | 27.20 | 27.68 | 28.12 | 28.07 | 1.6 |
| 2.66 χ 105 | 23.20 | 23.72 | 23.19 | 23.84 | 1.2 |
| 2.66 χ 106 | 20.32 | 20.14 | 19.86 | 20.07 | 1.1 |
(2) Within-run reproducibility test: Taking three different concentrations (2.66 χ 106, 2.66 x 105, and 2.66 χ 104 copies/pL) of plasmid standard samples, within-run reproducibility test was carried out, each concentration was repeated in triplicate, test results were statistically analyzed, and their CVs were calculated: CV (β) = standard deviation (SD)/mean (x). It turned out that CVs of CT values were 1.1%, 1.2%, and 0.4%, respectively, all of which were below 2% (as shown in Table 3). It was indicated that the TaqMan real-time fluorogenic quantitative PCR assay for PDCoV established by the experiment had good within-run reproducibility.
Table 3 Within-run reproducibility of real-time fluorogenic quantitative PCR assay for PDCoV
Mean cycle
Sample Within-run reproducibility threshold CV%
| 2.66 χ 104 | 27.52 | 27.25 | 27.31 | 27.46 | 0.50 |
| 2.66 χ 105 | 23.26 | 23.16 | 23.07 | 23.67 | 0.40 |
| 2.66 χ 106 | 20.03 | 19.50 | 20.13 | 20.03 | 1.70 |
8. Detection of clinical sample
Using the method established by the present invention, TaqMan fluorogenic
2019100972 29 Aug 2019 quantitative PCR assay was conducted on 120 porcine fecal samples collected from Gansu, Hainan, Qinghai, and Chongqing between 2016 and 2018. Meanwhile, negative and positive controls were set up and detected by conventional RT-PCR assay for comparison. Detection results were compared with those by conventional RT-PCR assay. Conventional RT-PCR assay was done by means of specific primers. For detailed method, refer to operating instructions for RT-PCR kit. Detection results are shown in Table 4:
Table 4 Detection results of clinical samples by real-time fluorogenic quantitative
PCR assay for PDCoV
Amount of positive sample
Sample collection Quantity Conventional PCR TaqMan real-time site fluorogenic quantitative
PCR
| Gansu | 25 | 6 | 8 |
| Hainan | 18 | 3 | 5 |
| Qinghai | 37 | 4 | 7 |
| Chongqing | 40 | 8 | 10 |
From Table 4, 21 positive samples could be detected by conventional RT-PCR assay, with a positive rate of 17.5%, while 30 positive samples could be detected by the TaqMan real-time fluorogenic quantitative PCR assay of the present invention, with a positive rate of 25%, which was 1.4-fold higher than that by means of conventional RT-PCR assay, indicating that the TaqMan real-time fluorogenic quantitative PCR assay established by the present invention was more sensitive to PDCoV.
The present invention provides a primer set, a kit, and a method for detecting PDCoV, featuring strong specificity, high sensitivity, and good between-run and within-run reproducibilities with regard to detection of PDCoV.
2019100972 29 Aug 2019
The foregoing descriptions are only preferred implementation manners of the present invention. It should be noted that for a person of ordinary skill in the art, several improvements and modifications may further be made without departing from the principle of the present invention. These improvements and modifications should also be deemed as falling within the protection scope of the present invention.
Claims (5)
1. A primer set for detecting porcine deltacoronavirus (PDCoV), comprising an upstream primer, a downstream primer, and a probe, wherein the sequence of the upstream primer is depicted in SEQ ID NO. 1, the sequence of the downstream primer is depicted in SEQ ID NO. 2, and the sequence of the probe is depicted in SEQ ID NO. 3.
(2) extracting and reversely transcribing PDCoV RNA to obtain a positive standard; and (3) using the primer set according to claim 1 or the kit according to claim 2 or 3 for TaqMan fluorogenic quantitative PCR of the template cDNA and the positive standard; wherein there is no chronological relationship between step (1) and step (2).
2. ATaqMan fluorogenic quantitative PCR kit for detecting porcine deltacoronavirus (PDCoV), comprising the upstream primer, the downstream primer, and the probe according to claim 1.
3. The kit according to claim 2, wherein concentrations of both the upstream and downstream primers are 0.75 pmol/L, and the concentration of the probe is 0.2 pmol/L.
4. A method for detecting porcine deltacoronavirus (PDCoV), comprising the following steps: (1) extracting and reversely transcribing analyte RNAto obtain a template cDNA;
5. The method according to claim 4, wherein the system of the TaqMan fluorogenic quantitative PCR of step (3) is moderate, and 20 pl_ each of the reaction system comprises the following components: 4 μΙ_ of 5* buffer, 1 μΙ_ of dNTP, 1 μΙ_ of RRI, 0.5 μΙ_ of GoTaq, 2 μΙ_ of template cDNA or positive standard, 0.5 μΙ_ of primer, 0.5 μΙ_ of probe, and 10.5 μΙ_ of deionized water;
the reaction procedure of the TaqMan fluorogenic quantitative PCR is: predenaturation at 95°C for 2 min, denaturation at 95°C for 15 s, and annealing and extension at 56°C for 1 min; the procedure of the denaturation, annealing and extension is a total of 40 cycles.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| AU2019100972A AU2019100972A4 (en) | 2019-08-29 | 2019-08-29 | Primer set, kit, and method for detecting porcine deltacoronavirus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| AU2019100972A AU2019100972A4 (en) | 2019-08-29 | 2019-08-29 | Primer set, kit, and method for detecting porcine deltacoronavirus |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| AU2019100972A4 true AU2019100972A4 (en) | 2019-10-03 |
Family
ID=68063116
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| AU2019100972A Ceased AU2019100972A4 (en) | 2019-08-29 | 2019-08-29 | Primer set, kit, and method for detecting porcine deltacoronavirus |
Country Status (1)
| Country | Link |
|---|---|
| AU (1) | AU2019100972A4 (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112724208A (en) * | 2020-12-25 | 2021-04-30 | 中山大学 | SADS-CoV recombinant S protein extracellular segment and preparation method and application thereof |
-
2019
- 2019-08-29 AU AU2019100972A patent/AU2019100972A4/en not_active Ceased
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112724208A (en) * | 2020-12-25 | 2021-04-30 | 中山大学 | SADS-CoV recombinant S protein extracellular segment and preparation method and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110982943B (en) | Novel coronavirus RT-PCR detection method and kit | |
| CN111004870B (en) | Novel coronavirus N gene nucleic acid detection kit | |
| AU2019100992A4 (en) | Primer set, kit, and method for detecting porcine epidemic diarrhea virus | |
| CN108060269B (en) | DPO primer group for detecting porcine epidemic diarrhea virus, porcine transmissible gastroenteritis virus and porcine rotavirus and application thereof | |
| CN111500791B (en) | Triple FQ-PCR detection method for porcine epidemic diarrhea virus, porcine delta coronavirus and porcine acute diarrhea syndrome coronavirus | |
| CN110760620A (en) | Classical swine fever virus and African classical swine fever virus dual-fluorescence PCR detection reagent, kit and detection method | |
| WO2018059195A1 (en) | Hrm detection primer, kit, and method for quickly identifying classical strain and variant strain of porcine epidemic diarrhea virus | |
| CN111394519A (en) | Novel coronavirus nucleic acid quantitative detection kit based on digital PCR and application | |
| CN107686864A (en) | Porcine epidemic diarrhea virus TaqMan fluorescent quantitation RT PCR kits and its detection method | |
| CN113652505B (en) | Method and kit for detecting novel coronavirus and VOC-202012/01 mutant strain thereof | |
| CN107699635B (en) | Fluorescent RPA (reverse transcriptase amplification) detection method for porcine epidemic diarrhea virus | |
| CN110735006A (en) | African swine fever TaqMan real-time fluorescent quantitative PCR (polymerase chain reaction) detection primer and kit | |
| CN117660702B (en) | Fluorescent quantitative PCR primer group and method for detecting Liquorice pangolin virus | |
| CN111471797A (en) | RT-RPA primer pair, probe, kit and detection method for detecting feline coronavirus | |
| AU2019100972A4 (en) | Primer set, kit, and method for detecting porcine deltacoronavirus | |
| CN116004920B (en) | Fluorescence PCR detection method and kit for four different lineages of strains of porcine reproductive and respiratory syndrome | |
| CN116814859A (en) | Primer probe composition, kit and method for identifying African swine fever virus genes I and II | |
| CN116287391A (en) | RPA primer for detecting tobacco target spot disease, primer/probe combination and application thereof | |
| CN115851705A (en) | Probe, primer and kit for identifying virulent and attenuated strains of porcine epidemic diarrhea virus | |
| CN114410842A (en) | Nucleic acid detection kit, primer probe set and detection method for four enteroviruses | |
| CN113981140A (en) | Detection method of novel coronavirus delta mutant strain and nucleic acid detection kit | |
| CN110157836B (en) | Primer, probe and method for detecting IBRV and BVDV | |
| CN113215154A (en) | Primer combination and kit for TGEV, PEDV and PDCoV triple PCR detection and application thereof | |
| CN111440900A (en) | Double one-step direct amplification real-time fluorescence quantitative RT-PCR detection kit for swine fever virus and African swine fever virus and application thereof | |
| CN106755567B (en) | Real-time fluorescence quantitative PCR (polymerase chain reaction) detection primer, probe, detection kit and detection method for simian SRV (sequence-related syndrome Virus) |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| FGI | Letters patent sealed or granted (innovation patent) | ||
| MK22 | Patent ceased section 143a(d), or expired - non payment of renewal fee or expiry |