AU2018271407B2 - Isolated polynucleotides and polypeptides, and methods of using same for increasing plant yield and/or agricultural characteristics - Google Patents

Abstract

Provided are isolated polynucleotides which comprise a nucleic acid sequence at least 80% identical to SEQ ID NO: 3487, 1-239, 467-1973, 3481-3486, 3488-3674, 3738 or 3739; isolated polypeptides which comprise an amino acid sequence at least 80% homologous to SEQ ID NO: 246, 240-245, 247-465, 1974-3480, 3675-3736 or 3737, and methods of using same for increasing a yield, biomass, growth rate, vigor, oil content, fiber yield, fiber quality, abiotic stress tolerance, and/or nitrogen use efficiency of a plant.

Description

ISOLATED POLYNUCLEOTIDES AND POLYPEPTIDES, AND METHODS OF USING SAME FOR INCREASING PLANT YIELD AND/OR AGRICULTURAL

CHARACTERISTICS

RELATED APPLICATIONS

This application is a divisional application of Australian Patent Application No. 2017204404, filed on 28 June 2017, which is a divisional of Australian Patent Application No. 2016213786, filed on 11 August 2016, which is a divisional of Australian Patent Application No. 2015202631, filed on 15 May 2015, which is a divisional of Australian Patent Application 10 No. 2010220157, filed on 1 March 2010, and is related to International Patent Application No.

PCT/IB2010/050871, filed on 1 March 2010 and claims priority from U.S. Provisional Patent Application Nos. 61/202,459, filed on 2 March 2009, 61/231,349, filed on 5 August 2009 and 61/282,183, filed on 28 December 2009; each of which is incorporated herein by reference in its entirety.

FIELD AND BACKGROUND OF THE INVENTION

The present invention, in some embodiments thereof, relates to isolated polynucleotides and polypeptides which can increase the yield (e.g., biomass, grain quantity and/or quality), growth rate, vigor, abiotic stress tolerance (ABST), water use efficiency (WUE), nitrogen use 10 efficiency (NUE) and/or fertilizer use efficiency (FUE) of a plant.

The ever-increasing world population and the decreasing availability in arable land for agriculture affect the yield of plants and plant-related products. The global shortage of water supply, desertification, abiotic stress (ABS) conditions (e.g., salinity, drought, flood, suboptimal temperature and toxic chemical pollution), and/or limited nitrogen and fertilizer sources cause 25 substantial damage to agricultural plants such as major alterations in the plant metabolism, cell death, and decreases in plant growth and crop productivity.

Drought is a gradual phenomenon, which involves periods of abnormally dry weather that persists long enough to produce serious hydrologic imbalances such as crop damage, water supply shortage and increased susceptibility to various diseases.

Salinity, high salt levels, affects one in five hectares of irrigated land. None of the top five food crops, i.e., wheat, corn, rice, potatoes, and soybean, can tolerate excessive salt. Detrimental effects of salt on plants result from both water deficit, which leads to osmotic stress (similar to drought stress), and the effect of excess sodium ions on critical biochemical processes. As with freezing and drought, high salt causes water deficit; and the presence of

1a

2018271407 30 Nov 2018 high salt makes it difficult for plant roots to extract water from their environment. Thus, salination of soils that are used for agricultural production is a significant and increasing problem in regions that rely heavily on agriculture, and is worsen by over-utilization, overfertilization and water shortage, typically caused by climatic change and the demands of 5 increasing population.

Suboptimal temperatures affect plant growth and development through the whole plant life cycle. Thus, low temperatures reduce germination rate and high [Text continues on page 2.]

2018271407 30 Nov 2018 temperatures result in leaf necrosis. In addition, mature plants that are exposed to excess heat may experience heat shock, which may arise in various organs, including leaves and particularly fruit, when transpiration is insufficient to overcome heat stress. Heat also damages cellular structures, including organelles and cytoskeleton, and impairs membrane function. Heat shock may produce a decrease in overall protein synthesis, accompanied by expression of heat shock proteins, e.g., chaperones, which are involved in refolding proteins denatured by heat. High-temperature damage to pollen almost always occurs in conjunction with drought stress, and rarely occurs under well-watered conditions. Combined stress can alter plant metabolism in novel ways. Excessive chilling conditions, e.g., low, but above freezing, temperatures affect crops of tropical origins, such as soybean, rice, maize, and cotton. Typical chilling damage includes wilting, necrosis, chlorosis or leakage of ions from cell membranes. Excessive light conditions, which occur under clear atmospheric conditions subsequent to cold late summer/autumn night’s, can lead to photoinhibition of photosynthesis (disruption of photosynthesis). In addition, chilling may lead to yield losses and lower product quality through the delayed ripening of maize.

Suboptimal nutrient (macro and micro nutrient) affect plant growth and development through the whole plant life cycle. One of the essential macronutrients for the plant is Nitrogen. Nitrogen is responsible for biosynthesis of amino acids and nucleic acids, prosthetic groups, plant hormones, plant chemical defenses, and the like. Nitrogen is often the rate-limiting element in plant growth and all field crops have a fundamental dependence on inorganic nitrogenous fertilizer. Since fertilizer is rapidly depleted from most soil types, it must be supplied to growing crops two or three times during the growing season. Additional important macronutrients are Phosphorous (P) and Potassium (K), which have a direct correlation to yield and general plant tolerance.

Yield is affected by various factors, such as, the number and size of the plant organs, plant architecture (for example, the number of branches), grains set length, number of filled grains, vigor (e.g. seedling), growth rate, root development, utilization of water, nutrients (e.g., nitrogen) and fertilizers, and stress tolerance.

Crops such as, com, rice, wheat, canola and soybean account for over half of total human caloric intake, whether through direct consumption of the seeds themselves or through consumption of meat products raised on processed seeds or forage. Seeds are

2018271407 30 Nov 2018 also a source of sugars, oils and metabolites used in industrial processes. The ability to increase plant yield, whether through increase dry matter accumulation rate, modifying cellulose or lignin composition, increase stalk strength, enlarge meristem size, change of plant branching pattern, erectness of levees, increase in fertilization efficiency, enhanced seed dry matter accumulation rate, modification of seed development, enhanced seed filling or by increasing the content of oil, starch or protein in the seeds would have many applications in agricultural and non-agricultural uses such as in the biotechnological production of pharmaceuticals, antibodies or vaccines.

Studies have shown that plant adaptations to adverse environmental conditions are complex genetic traits with polygenic nature. Conventional means for crop and horticultural improvements utilize selective breeding techniques to identify plants having desirable characteristics. However, selective breeding is tedious, time consuming and has an unpredictable outcome. Furthermore, limited germplasm resources for yield improvement and incompatibility in crosses between distantly related plant species represent significant problems encountered in conventional breeding. Advances in genetic engineering have allowed mankind to modify the germplasm of plants by expression of genes-of-interest in plants. Such a technology has the capacity to generate crops or plants with improved economic, agronomic or horticultural traits.

WO publication No. 2009/013750 discloses genes, constructs and methods of increasing abiotic stress tolerance, biomass and/or yield in plants generated thereby.

WO publication No. 2008/122980 discloses genes constructs and methods for increasing oil content, growth rate and biomass of plants.

WO publication No. 2008/075364 discloses polynucleotides involved in plant fiber development and methods of using same.

WO publication No. 2007/049275 discloses isolated polypeptides, polynucleotides encoding same, transgenic plants expressing same and methods of using same for increasing plant abiotic stress tolerance and biomass.

WO publication No. 2004/104162 discloses methods of increasing abiotic stress tolerance and/or biomass in plants and plants generated thereby.

2018271407 30 Nov 2018

WO publication No. 2005/121364 discloses polynucleotides and polypeptides involved in plant fiber development and methods of using same for improving fiber quality, yield and/or biomass of a fiber producing plant.

WO publication No. 2007/020638 discloses methods of increasing abiotic stress tolerance and/or biomass in plants and plants generated thereby.

SUMMARY OF THE INVENTION

According to an aspect of some embodiments of the present invention there is provided a method of increasing yield, biomass, growth rate, vigor, oil content, fiber yield, fiber quality, abiotic stress tolerance, and/or nitrogen use efficiency of a plant, comprising expressing within the plant an exogenous polynucleotide comprising a nucleic acid sequence at least 80 % identical to SEQ ID NO: 3487, 1-239, 467-1973, 3481-3486, 3488-3674, 3738 or 3739, thereby increasing the yield, biomass, growth rate, vigor, oil content, fiber yield, fiber quality, abiotic stress tolerance, and/or nitrogen use efficiency of the plant.

According to an aspect of some embodiments of the present invention there is provided a method of increasing yield, biomass, growth rate, vigor, oil content, fiber yield, fiber quality, abiotic stress tolerance, and/or nitrogen use efficiency of a plant, comprising expressing within the plant an exogenous polynucleotide comprising the nucleic acid sequence selected from the group consisting of SEQ ID NOs: 3487, 1-239, 467-1973, 3481-3486, 3488-3674, and 3738-3739, thereby increasing the yield, biomass, growth rate, vigor, oil content, fiber yield, fiber quality, abiotic stress tolerance, and/or nitrogen use efficiency of the plant.

According to an aspect of some embodiments of the present invention there is provided a method of increasing yield, biomass, growth rate, vigor, oil content, fiber yield, fiber quality, abiotic stress tolerance, and/or nitrogen use efficiency of a plant, comprising expressing within the plant an exogenous polynucleotide comprising a nucleic acid sequence encoding a polypeptide at least 80 % identical to SEQ ID NO: 246, 240-245, 247-465, 1974-3480, 3675-3736 or 3737, thereby increasing the yield, biomass, growth rate, vigor, oil content, fiber yield, fiber quality, abiotic stress tolerance, and/or nitrogen use efficiency of the plant.

2018271407 30 Nov 2018

According to an aspect of some embodiments of the present invention there is provided a method of increasing yield, biomass, growth rate, vigor, oil content, fiber yield, fiber quality, abiotic stress tolerance, and/or nitrogen use efficiency of a plant, comprising expressing within the plant an exogenous polynucleotide comprising a nucleic acid sequence encoding a polypeptide selected from the group consisting of SEQ ID NOs: 246, 240-245, 247-465, 1974-3480, and 3675-3737, thereby increasing the yield, biomass, growth rate, vigor, oil content, fiber yield, fiber quality, abiotic stress tolerance, and/or nitrogen use efficiency of the plant.

According to an aspect of some embodiments of the present invention there is provided an isolated polynucleotide comprising a nucleic acid sequence at least 80 % identical to SEQ ID NO: 3487, 1-239, 467-1973, 3481-3486, 3488-3674, 3738 or 3739, wherein said nucleic acid sequence is capable of increasing yield, biomass, growth rate, vigor, oil content, fiber yield, fiber quality, abiotic stress tolerance, and/or nitrogen use efficiency of a plant.

According to an aspect of some embodiments of the present invention there is provided an isolated polynucleotide comprising the nucleic acid sequence selected from the group consisting of SEQ ID NOs: 3487, 1-239, 467-1973, 3481-3486, 3488-3674, and 3738-3739.

According to an aspect of some embodiments of the present invention there is provided an isolated polynucleotide comprising a nucleic acid sequence encoding a polypeptide which comprises an amino acid sequence at least 80 % homologous to the amino acid sequence set forth in SEQ ID NO: 246, 240-245, 247-465, 1974-3480, 36753736 or 3737, wherein said nucleic acid sequence is capable of increasing yield, biomass, growth rate, vigor, oil content, fiber yield, fiber quality, abiotic stress tolerance, and/or nitrogen use efficiency of a plant.

According to an aspect of some embodiments of the present invention there is provided an isolated polynucleotide comprising a nucleic acid sequence encoding a polypeptide which comprises the amino acid sequence selected from the group consisting of SEQ ID NOs: 246, 240-245, 247-465, 1974-3480, and 3675-3737.

According to an aspect of some embodiments of the present invention there is provided a nucleic acid construct comprising the isolated polynucleotide of claim 5, 6, 7

2018271407 30 Nov 2018 or 8, and a promoter for directing transcription of said nucleic acid sequence in a host cell.

According to an aspect of some embodiments of the present invention there is provided an isolated polypeptide comprising an amino acid sequence at least 80 % homologous to SEQ ID NO: 246, 240-245, 247-465, 1974-3480, 3675-3736 or 3737, wherein said amino acid sequence is capable of increasing yield, biomass, growth rate, vigor, oil content, fiber yield, fiber quality, abiotic stress tolerance, and/or nitrogen use efficiency of a plant.

According to an aspect of some embodiments of the present invention there is provided an isolated polypeptide comprising the amino acid sequence selected from the group consisting of SEQ ID NOs: 246, 240-245, 247-465, 1974-3480, and 3675-3737.

According to an aspect of some embodiments of the present invention there is provided a plant cell exogenously expressing the polynucleotide of claim 5, 6, 7 or 8 or the nucleic acid construct of claim 9.

According to an aspect of some embodiments of the present invention there is provided a plant cell exogenously expressing the polypeptide of claim 10 or 11.

According to some embodiments of the invention, the nucleic acid sequence is as set forth in SEQ ID NO: 3487, 1-239, 467-1973, 3481-3486, 3488-3674, 3738 or 3739.

According to some embodiments of the invention, the polynucleotide consists of the nucleic acid sequence selected from the group consisting of SEQ ID NOs: 3487, 1239, 467-1973, 3481-3486, 3488-3674, and 3738-3739.

According to some embodiments of the invention, the nucleic acid sequence encodes an amino acid sequence at least 80 % homologous to SEQ ID NO: 246, 240245, 247-465, 1974-3480, 3675-3736 or 3737.

According to some embodiments of the invention, the nucleic acid sequence encodes the amino acid sequence selected from the group consisting of SEQ ID NOs: 246, 240-245, 247-465, 1974-3480, and 3675-3737.

According to some embodiments of the invention, the plant cell forms a part of a plant.

According to some embodiments of the invention, the abiotic stress is selected from the group consisting of salinity, drought, water deprivation, low temperature, high

2018271407 27 Apr 2020 temperature, heavy metal toxicity, anaerobiosis, nutrient deficiency, nutrient excess, atmospheric pollution and UV irradiation.

According to some embodiments of the invention, the method further comprises growing the plant under the abiotic stress.

According to some embodiments of the invention, the method, further comprises growing the plant under nitrogen-limiting conditions.

Definitions of the specific embodiments of the invention as claimed herein follow.

According to a first embodiment of the invention, there is provided a method of increasing yield, biomass, growth rate, vigor, and/or nitrogen use efficiency or reducing time to 10 flowering and/or to inflorescence emergence of a plant, comprising over-expressing within the plant a polypeptide comprising an amino acid sequence at least 80% identical to SEQ ID NO: 434, and growing the plant over-expressing said polypeptide under non-stress conditions, thereby increasing the yield, biomass, growth rate, vigor, and/or nitrogen use efficiency, or reducing the time to flowering and/or to inflorescence emergence, of the plant.

According to a second embodiment of the invention, there is provided a method of increasing tolerance of a plant to salinity stress, comprising over-expressing within the plant a polypeptide comprising an amino acid sequence at least 80% identical to SEQ ID NO: 434, and growing the plant over-expressing said polypeptide under salinity stress conditions, thereby increasing the tolerance of the plant to salinity stress.

According to a third embodiment of the invention, there is provided a method of producing a crop, comprising growing a crop plant transformed with an exogenous polynucleotide comprising a nucleic acid sequence encoding a polypeptide at least 80% homologous to the amino acid sequence set forth in SEQ ID NO: 434, wherein the crop plant is derived from plants which have been transformed with said exogenous polynucleotide and 25 which have been selected for increased yield, increased biomass, increased growth rate, increased vigor, increased nitrogen use efficiency, reduced time to flowering and/or reduced time to inflorescence emergence under non-stress conditions as compared to a wild type plant of the same species which is grown under the same growth conditions, and the crop plant has the increased yield, increased biomass, increased growth rate, increased vigor, increased 30 nitrogen use efficiency, reduced time to flowering and/or reduced time to inflorescence emergence under the non-stress conditions, thereby producing the crop.

7a

2018271407 27 Apr 2020

According to a fourth embodiment of the invention, there is provided a method of producing a crop, comprising growing a crop plant transformed with an exogenous polynucleotide comprising a nucleic acid sequence encoding a polypeptide at least 80% homologous to the amino acid sequence set forth in SEQ ID NO: 434, wherein the crop plant is 5 derived from plants which have been transformed with said exogenous polynucleotide and which have been selected for increased tolerance to salinity stress as compared to a wild type plant of the same species which is grown under the same growth conditions, and the crop plant has the increased tolerance to salinity stress, thereby producing the crop.

According to a fifth embodiment of the invention, there is provided a nucleic acid 10 construct comprising an isolated polynucleotide comprising a nucleic acid sequence encoding a polypeptide which comprises an amino acid sequence at least 85% identical to the amino acid sequence set forth in SEQ ID NO: 434, and a heterologous promoter operably linked to said isolated polynucleotide, wherein said nucleic acid sequence is capable of:

(i) increasing yield, biomass, growth rate, vigor, and/or nitrogen use efficiency of a 15 plant under non-stress conditions;

(ii) reducing time to flowering and/or to inflorescence emergence of a plant under non-stress conditions; and/or (iii) increasing tolerance of a plant to salinity stress.

According to a sixth embodiment of the invention, there is provided an isolated 20 polypeptide comprising an amino acid sequence at least 85% identical to SEQ ID NO: 434, wherein said amino acid sequence is capable of:

(i) increasing yield, biomass, growth rate, vigor, and/or nitrogen use efficiency of a plant under non-stress conditions, (ii) reducing time to flowering and/or to inflorescence emergence of a plant under 25 non-stress conditions, and/or (iii) increasing tolerance of a plant to salinity stress.

According to a seventh embodiment of the invention, there is provided a transgenic plant cell comprising the nucleic acid construct of the fifth embodiment.

According to an eighth embodiment of the invention, there is provided a transgenic plant 30 comprising the cell of the seventh embodiment, or the nucleic acid construct of the fifth embodiment.

According to a ninth embodiment of the invention, there is provided a method of selecting plants having increased yield, biomass, growth rate, vigor, and/or nitrogen use efficiency, and/or reduced time to flowering and/or time to inflorescence emergence under non7b

2018271407 27 Apr 2020 stress conditions, or increasing tolerance to salinity stress, the method comprising selecting plants transformed with the nucleic acid construct of the fifth embodiment for an increased trait as compared to a native plant which is grown under the same growth conditions, wherein said trait is selected from the group consisting of: yield under non-stress conditions, biomass under 5 non-stress conditions, growth rate under non-stress conditions, vigor under non-stress conditions, salinity stress tolerance, nitrogen use efficiency under non-stress conditions, reduced time to flowering under non-stress conditions and/or reduced time to inflorescence emergence under non-stress conditions.

Unless otherwise defined, all technical and/or scientific terms used herein have the same 10 meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of the invention, exemplary methods and/or materials are described below. In case of conflict, the patent specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and are not 15 intended to be necessarily limiting.

BRIEF DESCRIPTION OF THE DRAWINGS

Some embodiments of the invention are herein described, by way of example only, with reference to the accompanying drawings. With specific reference now to the drawings in detail, 20 it is stressed that the particulars shown are by way of example and for purposes of illustrative discussion of embodiments of the invention. In this regard, the description taken with the drawings makes apparent to those skilled in the art how embodiments of the invention may be practiced.

In the drawings:

FIG. 1 is a schematic illustration of the modified pGI binary plasmid containing the new

At6669 promoter (SEQ ID NO:4198) and the GUSintron (pQYN_6669) used for expressing the isolated polynucleotide sequences of the invention. RB - T-DNA right border; LB - T-DNA left border; MCS - Multiple cloning site; RE - any restriction enzyme; NOS pro = nopaline synthase promoter; NPT-II = neomycin phosphotransferase gene; NOS ter = nopaline synthase terminator; Poly-A signal (polyadenylation signal); GUSintron - the GUS reporter gene (coding sequence and intron). The isolated polynucleotide sequences of the invention were cloned into the vector while replacing the GUSintron reporter gene.

[Text continues on page 8.]

2018271407 30 Nov 2018

FIG. 2 is a schematic illustration of the modified pGI binary plasmid containing the new At6669 promoter (SEQ ID NO:4198) (pQFN) used for expressing the isolated polynucleotide sequences of the invention. RB - T-DNA right border; LB - T-DNA left border; MCS - Multiple cloning site; RE - any restriction enzyme; NOS pro = nopaline synthase promoter; NPT-II = neomycin phosphotransferase gene; NOS ter = nopaline synthase terminator; Poly-A signal (polyadenylation signal); GUSintron - the GUS reporter gene (coding sequence and intron). The isolated polynucleotide sequences of the invention were cloned into the MCS of the vector.

FIGs. 3A-F are images depicting visualization of root development of transgenic plants exogenously expressing the polynucleotide of some embodiments of the invention when grown in transparent agar plates under normal (FIGs. 3A-B), osmotic stress (15 % PEG; FIGs. 3C-D) or nitrogen-limiting (FIGs. 3E-F) conditions. The different transgenes were grown in transparent agar plates for 17 days (7 days nursery and 10 days after transplanting). The plates were photographed every 3-4 days starting at day 1 after transplanting. FIG. 3A - An image of a photograph of plants taken following 10 after transplanting days on agar plates when grown under normal (standard) conditions. FIG. 3B - An image of root analysis of the plants shown in FIG. 3A in which the lengths of the roots measured are represented by arrows. FIG. 3C - An image of a photograph of plants taken following 10 days after transplanting on agar plates, grown under high osmotic (PEG 15 %) conditions. FIG. 3D - An image of root analysis of the plants shown in FIG. 3C in which the lengths of the roots measured are represented by arrows. FIG. 3E - An image of a photograph of plants taken following 10 days after transplanting on agar plates, grown under low nitrogen conditions. FIG. 3F - An image of root analysis of the plants shown in FIG. 3E in which the lengths of the roots measured are represented by arrows.

DESCRIPTION OF SPECIFIC EMBODIMENTS OF THE INVENTION

The present invention, in some embodiments thereof, relates to isolated polynucleotides and polypeptides which can increase yield, biomass, growth rate, vigor, oil content, fiber yield, fiber quality abiotic stress tolerance, and/or fertilizer use efficiency (e.g., nitrogen use efficiency) of a plant.

2018271407 30 Nov 2018

Before explaining at least one embodiment of the invention in detail, it is to be understood that the invention is not necessarily limited in its application to the details set forth in the following description or exemplified by the Examples. The invention is capable of other embodiments or of being practiced or carried out in various ways.

The present inventors have identified novel polynucleotides and polypeptides which can be used in increasing yield, biomass, growth rate, vigor, oil content, fiber yield, fiber quality abiotic stress tolerance, and/or fertilizer use efficiency (e.g., nitrogen use efficiency) of a plant.

As shown in the Examples section which follows, the present inventors have employed a bioinformatic approach which combines clustering and assembly of sequences from databases of arabidopsis, rice, poplar, brachypodium, soybean, grape, castobean, sorghum and maize and other publicly available plant genomes, expressed sequence tags (ESTs), mRNA sequences, properitary ESTs sequences (Barley, Sorghum), protein and pathway databases, quantitative trait loci (QTL), single nucleotide polymorphism (SNPs) information with a digital expression profile (“electronic Northern Blot”) and identified polynucleotides and polypeptides which can increase yield, growth rate, biomass, vigor, tolerance to abiotic stress, nitrogen use efficiency, water use efficiency and fertilizer use efficiency (SEQ ID NOs: 1-239 for polynucleotides; SEQ ID NOs:240-465 for polypeptides; Table 1, Example 1). Orthologs from plant species which exhibit at least 80 % homology to the identified polypeptides and polynucleotides were also identified (SEQ ID NO:467-1973 for polynucleotides; SEQ ID NOs: 1974-3480 for polypeptides; Table 2, Example 1). Selected genes were cloned (Example 7, Tables 26-28), transformed into agrobacterium tumefaciens cells (Example 8) and further into arabidopsis plants (Example 9). Transgenic plants over-expressing the identified polynucleotides were found to exhibit increased seed yield, oil yield, dry weight, fresh weight, root coverage, root length, harvest index, growth rate, rosette area, biomass, oil percentage in seed and weight of 1000 seeds (Examples 10-11; Tables 29-36), and increased tolerance to abiotic stress conditions such as limiting nitrogen conditions (Example 11, Tables 37-38). Thus, the identified polynucleotides and polypeptides of the invention can be used to increase plant’s yield, biomass (e.g., of grain or any harvestable plant part with economical

2018271407 30 Nov 2018 value), vigor, growth rate, oil content, fiber yield, fiber quality, tolerance to abiotic stress, nitrogen use efficiency, water use efficiency and/or fertilizer use efficiency.

Thus, according to an aspect of some embodiments of the invention there is provided a method of increasing a yield, biomass, growth rate, vigor, oil content, fiber yield, fiber quality, water use efficiency, nitrogen use efficiency, fertilizer use efficiency and/or abiotic stress tolerance of a plant.

The method is effected by expressing within the plant an exogenous polynucleotide comprising a nucleic acid sequence at least 80 % identical to SEQ ID NO: 3487, 1-239, 467-1973, 3481-3486, 3488-3674, 3738 or 3739, thereby increasing the yield, biomass, growth rate, vigor, oil content, fiber yield, fiber quality, water use efficiency, nitrogen use efficiency, fertilizer use efficiency and/or abiotic stress tolerance of the plant.

As used herein the phrase plant yield refers to the amount (e.g., as determined by weight or size) or quantity (numbers) of tissues or organs produced per plant or per growing season. Hence increased yield could affect the economic benefit one can obtain from the plant in a certain growing area and/or growing time.

It should be noted that a plant yield can be affected by various parameters including, but not limited to, plant biomass; plant vigor; growth rate; seed yield; seed or grain quantity; seed or grain quality; oil yield; content of oil, starch and/or protein in harvested organs (e.g., seeds or vegetative parts of the plant); number of flowers (florets) per panicle (expressed as a ratio of number of filled seeds over number of primary panicles); harvest index; number of plants grown per area; number and size of harvested organs per plant and per area; number of plants per growing area (density); number of harvested organs in field; total leaf area; carbon assimilation and carbon partitioning (the distribution/allocation of carbon within the plant); resistance to shade; number of harvestable organs (e.g. seeds), seeds per pod, weight per seed; and modified architecture [such as increase stalk diameter, thickness or improvement of physical properties (e.g. elasticity)] .

As used herein the phrase “seed yield” refers to the number or weight of the seeds per plant, seeds per pod, or per growing area or to the weight of a single seed, or to the oil extracted per seed. Hence seed yield can be affected by seed dimensions (e.g., length, width, perimeter, area and/or volume), number of (filled) seeds and seed filling

2018271407 30 Nov 2018 rate and by seed oil content. Hence increase seed yield per plant could affect the economic benefit one can obtain from the plant in a certain growing area and/or growing time; and increase seed yield per growing area could be achieved by increasing seed yield per plant, and/or by increasing number of plants grown on the same given area.

The term seed (also referred to as grain or kernel) as used herein refers to a small embryonic plant enclosed in a covering called the seed coat (usually with some stored food), the product of the ripened ovule of gymnosperm and angiosperm plants which occurs after fertilization and some growth within the mother plant.

The phrase “oil content” as used herein refers to the amount of lipids in a given plant organ, either the seeds (seed oil content) or the vegetative portion of the plant (vegetative oil content) and is typically expressed as percentage of dry weight (10 % humidity of seeds) or wet weight (for vegetative portion).

It should be noted that oil content is affected by intrinsic oil production of a tissue (e.g., seed, vegetative portion), as well as the mass or size of the oil-producing tissue per plant or per growth period.

In one embodiment, increase in oil content of the plant can be achieved by increasing the size/mass of a plant's tissue(s) which comprise oil per growth period. Thus, increased oil content of a plant can be achieved by increasing the yield, growth rate, biomass and vigor of the plant.

As used herein the phrase plant biomass refers to the amount (e.g., measured in grams of air-dry tissue) of a tissue produced from the plant in a growing season, which could also determine or affect the plant yield or the yield per growing area. An increase in plant biomass can be in the whole plant or in parts thereof such as aboveground (harvestable) parts, vegetative biomass, roots and seeds.

As used herein the phrase “growth rate” refers to the increase in plant organ/tissue size per time (can be measured in cm² per day).

As used herein the phrase plant vigor refers to the amount (measured by weight) of tissue produced by the plant in a given time. Hence increased vigor could determine or affect the plant yield or the yield per growing time or growing area. In addition, early vigor (seed and/or seedling) results in improved field stand.

It should be noted that a plant yield can be determined under stress (e.g., abiotic stress, nitrogen-limiting conditions) and/or non-stress (normal) conditions.

2018271407 30 Nov 2018

As used herein, the phrase “non-stress conditions” refers to the growth conditions (e.g., water, temperature, light-dark cycles, humidity, salt concentration, fertilizer concentration in soil, nutrient supply such as nitrogen, phosphorous and/or potassium), that do not significantly go beyond the everyday climatic and other abiotic conditions that plants may encounter, and which allow optimal growth, metabolism, reproduction and/or viability of a plant at any stage in its life cycle (e.g., in a crop plant from seed to a mature plant and back to seed again). Persons skilled in the art are aware of normal soil conditions and climatic conditions for a given plant in a given geographic location. It should be noted that while the non-stress conditions may include some mild variations from the optimal conditions (which vary from one type/species of a plant to another), such variations do not cause the plant to cease growing without the capacity to resume growth.

The phrase abiotic stress as used herein refers to any adverse effect on metabolism, growth, reproduction and/or viability of a plant. Accordingly, abiotic stress can be induced by suboptimal environmental growth conditions such as, for example, salinity, water deprivation, flooding, freezing, low or high temperature, heavy metal toxicity, anaerobiosis, nutrient deficiency, atmospheric pollution or UV irradiation. The implications of abiotic stress are discussed in the Background section.

The phrase “abiotic stress tolerance” as used herein refers to the ability of a plant to endure an abiotic stress without suffering a substantial alteration in metabolism, growth, productivity and/or viability.

As used herein the phrase “water use efficiency (WUE)” refers to the level of organic matter produced per unit of water consumed by the plant, i.e., the dry weight of a plant in relation to the plant's water use, e.g., the biomass produced per unit transpiration.

As used herein the phrase “fertilizer use efficiency” refers to the metabolic process(es) which lead to an increase in the plant’s yield, biomass, vigor, and growth rate per fertilizer unit applied. The metabolic process can be the uptake, spread, absorbent, accumulation, relocation (within the plant) and use of one or more of the minerals and organic moieties absorbed by the plant, such as nitrogen, phosphates and/or potassium.

2018271407 30 Nov 2018

As used herein the phrase “fertilizer-limiting conditions” refers to growth conditions which include a level (e.g., concentration) of a fertilizer applied which is below the level needed for normal plant metabolism, growth, reproduction and/or viability.

As used herein the phrase “nitrogen use efficiency (NUE)” refers to the metabolic process(es) which lead to an increase in the plant’s yield, biomass, vigor, and growth rate per nitrogen unit applied. The metabolic process can be the uptake, spread, absorbent, accumulation, relocation (within the plant) and use of nitrogen absorbed by the plant.

As used herein the phrase “nitrogen-limiting conditions” refers to growth conditions which include a level (e.g., concentration) of nitrogen (e.g., ammonium or nitrate) applied which is below the level needed for normal plant metabolism, growth, reproduction and/or viability.

Improved plant NUE and FUE is translated in the field into either harvesting similar quantities of yield, while implementing less fertilizers, or increased yields gained by implementing the same levels of fertilizers. Thus, improved NUE or FUE has a direct effect on plant yield in the field. Thus, the polynucleotides and polypeptides of some embodiments of the invention positively affect plant yield, seed yield, and plant biomass. In addition, the benefit of improved plant NUE will certainly improve crop quality and biochemical constituents of the seed such as protein yield and oil yield.

It should be noted that improved ABST will confer plants with improved vigor also under non-stress conditions, resulting in crops having improved biomass and/or yield e.g., elongated fibers for the cotton industry, higher oil content.

The term fiber is usually inclusive of thick-walled conducting cells such as vessels and tracheids and to fibrillar aggregates of many individual fiber cells. Hence, the term fiber refers to (a) thick-walled conducting and non-conducting cells of the xylem; (b) fibers of extraxylary origin, including those from phloem, bark, ground tissue, and epidermis; and (c) fibers from stems, leaves, roots, seeds, and flowers or inflorescences (such as those of Sorghum vulgare used in the manufacture of brushes and brooms).

As used herein the phrase fiber producing plant refers to plants that share the common feature of having an elongated shape and abundant cellulose in thick cell

2018271407 30 Nov 2018 walls, typically termed as secondary walls. Such walls may or may not be lignified, and the protoplast of such cells may or may be viable at maturity. Such fibers have many industrial uses, for example in lumber and manufactured wood products, paper, textiles, sacking and boxing material, cordage, brushes and brooms, filling and stuffing, caulking, reinforcement of other materials, and manufacture of cellulose derivatives.

Example of fiber producing plants, include, but are not limited to, agricultural crops such as cotton, silk cotton tree (Kapok, Ceiba pentandra), desert willow, creosote bush, winterfat, balsa, kenaf, roselle, jute, sisal abaca, flax, com, sugar cane, hemp, ramie, kapok, coir, bamboo, Spanish moss and Agave spp. (e.g. sisal).

According to a preferred embodiment of this aspect of the present invention the fiber producing plant is cotton.

As used herein the phrase fiber quality refers to at least one fiber parameter which is agriculturally desired, or required in the fiber industry (further described hereinbelow). Examples of such parameters, include but are not limited to, fiber length, fiber strength, fiber fitness, fiber weight per unit length, maturity ratio and uniformity.

Cotton fiber (lint) quality is typically measured according to fiber length, strength and fineness. Accordingly, the lint quality is considered higher when the fiber is longer, stronger and finer.

As used herein the phrase fiber yield refers to the amount or quantity of fibers produced from the fiber producing plant.

As used herein the term increasing refers to at least about 2 %, at least about 3 %, at least about 4 %, at least about 5 %, at least about 10 %, at least about 15 %, at least about 20 %, at least about 30 %, at least about 40 %, at least about 50 %, at least about 60 %, at least about 70 %, at least about 80 % or greater increase in plant yield, biomass, growth rate, vigor, oil content, fiber yield, fiber quality, water use efficiency, nitrogen use efficiency, fertilizer use efficiency and/or abiotic stress tolerance as compared to a native plant \i.e., a plant not modified with the biomolecules (polynucleotide or polypeptides) of the invention, e.g., a non-transformed plant of the same species which is grown under the same growth conditions as the transformed plant].

The phrase “expressing within the plant an exogenous polynucleotide” as used herein refers to upregulating the expression level of an exogenous polynucleotide within

2018271407 30 Nov 2018 the plant by introducing the exogenous polynucleotide into a plant cell or plant and expressing by recombinant means, as further described herein below.

As used herein expressing refers to expression at the mRNA and optionally polypeptide level.

As used herein, the phrase exogenous polynucleotide refers to a heterologous nucleic acid sequence which may not be naturally expressed within the plant or which overexpression in the plant is desired. The exogenous polynucleotide may be introduced into the plant in a stable or transient manner, so as to produce a ribonucleic acid (RNA) molecule and/or a polypeptide molecule. It should be noted that the exogenous polynucleotide may comprise a nucleic acid sequence which is identical or partially homologous to an endogenous nucleic acid sequence of the plant.

The term “endogenous” as used herein refers to any polynucleotide or polypeptide which is present and/or naturally expressed within a plant or a cell thereof.

According to some embodiments of the invention, the exogenous polynucleotide comprises a nucleic acid which is at least about 80 %, at least about 81 %, at least about 82 %, at least about 83 %, at least about 84 %, at least about 85 %, at least about 86 %, at least about 87 %, at least about 88 %, at least about 89 %, at least about 90 %, at least about 91 %, at least about 92 %, at least about 93 %, at least about 93 %, at least about 94 %, at least about 95 %, at least about 96 %, at least about 97 %, at least about 98 %, at least about 99 %, e.g., 100 % identical to the nucleic acid sequence selected from the group consisting of SEQ ID NOs: 3487, 1-239, 467-1973, 3481-3486, 3488-3674, and 3738-3739.

Identity (e.g., percent homology) can be determined using any homology comparison software, including for example, the BlastN software of the National Center of Biotechnology Information (NCBI) such as by using default parameters.

According to some embodiments of the invention the exogenous polynucleotide is at least about 80 %, at least about 81 %, at least about 82 %, at least about 83 %, at least about 84 %, at least about 85 %, at least about 86 %, at least about 87 %, at least about 88 %, at least about 89 %, at least about 90 %, at least about 91 %, at least about 92 %, at least about 93 %, at least about 93 %, at least about 94 %, at least about 95 %, at least about 96 %, at least about 97 %, at least about 98 %, at least about 99 %, e.g.,

2018271407 30 Nov 2018

100 % identical to the polynucleotide selected from the group consisting of SEQ ID NOs: 3487, 1-239, 467-1973, 3481-3486, 3488-3674, and 3738-3739.

According to some embodiments of the invention the exogenous polynucleotide consists of the nucleic acid sequence set forth in SEQ ID NO: 3487, 1-239, 467-1973, 3481-3486, 3488-3674, 3738 or 3739.

As used herein the term “polynucleotide” refers to a single or double stranded nucleic acid sequence which is isolated and provided in the form of an RNA sequence, a complementary polynucleotide sequence (cDNA), a genomic polynucleotide sequence and/or a composite polynucleotide sequences (e.g., a combination of the above).

The term “isolated” refers to at least partially separated from the natural environment e.g., from a plant cell.

As used herein the phrase complementary polynucleotide sequence refers to a sequence, which results from reverse transcription of messenger RNA using a reverse transcriptase or any other RNA dependent DNA polymerase. Such a sequence can be subsequently amplified in vivo or in vitro using a DNA dependent DNA polymerase.

As used herein the phrase genomic polynucleotide sequence refers to a sequence derived (isolated) from a chromosome and thus it represents a contiguous portion of a chromosome.

As used herein the phrase composite polynucleotide sequence refers to a sequence, which is at least partially complementary and at least partially genomic. A composite sequence can include some exonal sequences required to encode the polypeptide of the present invention, as well as some intronic sequences interposing therebetween. The intronic sequences can be of any source, including of other genes, and typically will include conserved splicing signal sequences. Such intronic sequences may further include cis acting expression regulatory elements.

According to some embodiments of the invention, the exogenous polynucleotide of the invention encodes a polypeptide which comprises an amino acid sequence at least about 80 %, at least about 81 %, at least about 82 %, at least about 83 %, at least about 84 %, at least about 85 %, at least about 86 %, at least about 87 %, at least about 88 %, at least about 89 %, at least about 90 %, at least about 91 %, at least about 92 %, at least about 93 %, at least about 94 %, at least about 95 %, at least about 96 %, at least about 97 %, at least about 98 %, at least about 99 %, or more say 100 % homologous to the

2018271407 30 Nov 2018 amino acid sequence selected from the group consisting of SEQ ID NOs: 246, 240-245, 247-465, 1974-3480, and 3675-3737.

Homology (e.g., percent homology) can be determined using any homology comparison software, including for example, the BlastP or TBLASTN software of the National Center of Biotechnology Information (NCBI) such as by using default parameters, when starting from a polypeptide sequence; or the tBLASTX algorithm (available via the NCBI) such as by using default parameters, which compares the sixframe conceptual translation products of a nucleotide query sequence (both strands) against a protein sequence database.

Homologous sequences include both orthologous and paralogous sequences. The term “paralogous” relates to gene-duplications within the genome of a species leading to paralogous genes. The term “orthologous” relates to homologous genes in different organisms due to ancestral relationship.

One option to identify orthologues in plant species is by performing a reciprocal blast search. This may be done by a first blast involving blasting the sequence-of-interest against any sequence database, such as the publicly available NCBI database which may be found at: Hypertext Transfer Protocol ://World Wide Web (dot) ncbi (dot) nlm (dot) nih (dot) gov. If orthologues in rice were sought, the sequence-of-interest would be blasted against, for example, the 28,469 full-length cDNA clones from Oryza sativa Nipponbare available at NCBI. The blast results may be filtered. The full-length sequences of either the filtered results or the non-filtered results are then blasted back (second blast) against the sequences of the organism from which the sequence-ofinterest is derived. The results of the first and second blasts are then compared. An orthologue is identified when the sequence resulting in the highest score (best hit) in the first blast identifies in the second blast the query sequence (the original sequence-ofinterest) as the best hit. Using the same rational a paralogue (homolog to a gene in the same organism) is found. In case of large sequence families, the ClustalW program may be used [Hypertext Transfer Protocol://World Wide Web (dot) ebi (dot) ac (dot) uk/Tools/clustalw2/index (dot) html], followed by a neighbor-joining tree (Hypertext Transfer Protocol://en (dot) wikipedia (dot) org/wiki/Neighbor-joining) which helps visualizing the clustering.

2018271407 30 Nov 2018

According to some embodiments of the invention, the exogenous polynucleotide encodes a polypeptide consisting of the amino acid sequence set forth by SEQ ID NO: 246, 240-245, 247-465, 1974-3480, 3675-3736 or 3737.

Nucleic acid sequences encoding the polypeptides of the present invention may be optimized for expression. Examples of such sequence modifications include, but are not limited to, an altered G/C content to more closely approach that typically found in the plant species of interest, and the removal of codons atypically found in the plant species commonly referred to as codon optimization.

The phrase codon optimization refers to the selection of appropriate DNA nucleotides for use within a structural gene or fragment thereof that approaches codon usage within the plant of interest. Therefore, an optimized gene or nucleic acid sequence refers to a gene in which the nucleotide sequence of a native or naturally occurring gene has been modified in order to utilize statistically-preferred or statistically-favored codons within the plant. The nucleotide sequence typically is examined at the DNA level and the coding region optimized for expression in the plant species determined using any suitable procedure, for example as described in Sardana et al. (1996, Plant Cell Reports 15:677-681). In this method, the standard deviation of codon usage, a measure of codon usage bias, may be calculated by first finding the squared proportional deviation of usage of each codon of the native gene relative to that of highly expressed plant genes, followed by a calculation of the average squared deviation. The formula used is:

Formula I

SDCU = n = 1 N [ ( Xn - Yn ) / Yn ] 2 / N, where Xn refers to the frequency of usage of codon n in highly expressed plant genes, where Yn to the frequency of usage of codon n in the gene of interest and N refers to the total number of codons in the gene of interest. A Table of codon usage from highly expressed genes of dicotyledonous plants is compiled using the data of Murray et al. (1989, Nuc Acids Res. 17:477-498).

One method of optimizing the nucleic acid sequence in accordance with the preferred codon usage for a particular plant cell type is based on the direct use, without performing any extra statistical calculations, of codon optimization Tables such as those provided on-line at the Codon Usage Database through the NIAS (National Institute of

2018271407 30 Nov 2018

Agrobiological Sciences) DNA bank in Japan (Hypertext Transfer Protocol://World Wide Web (dot) kazusa (dot) or (dot) jp/codon/). The Codon Usage Database contains codon usage tables for a number of different species, with each codon usage Table having been statistically determined based on the data present in Genbank.

By using the above Tables to determine the most preferred or most favored codons for each amino acid in a particular species (for example, rice), a naturallyoccurring nucleotide sequence encoding a protein of interest can be codon optimized for that particular plant species. This is effected by replacing codons that may have a low statistical incidence in the particular species genome with corresponding codons, in regard to an amino acid, that are statistically more favored. However, one or more lessfavored codons may be selected to delete existing restriction sites, to create new ones at potentially useful junctions (5' and 3' ends to add signal peptide or termination cassettes, internal sites that might be used to cut and splice segments together to produce a correct full-length sequence), or to eliminate nucleotide sequences that may negatively effect mRNA stability or expression.

The naturally-occurring encoding nucleotide sequence may already, in advance of any modification, contain a number of codons that correspond to a statisticallyfavored codon in a particular plant species. Therefore, codon optimization of the native nucleotide sequence may comprise determining which codons, within the native nucleotide sequence, are not statistically-favored with regards to a particular plant, and modifying these codons in accordance with a codon usage table of the particular plant to produce a codon optimized derivative. A modified nucleotide sequence may be fully or partially optimized for plant codon usage provided that the protein encoded by the modified nucleotide sequence is produced at a level higher than the protein encoded by the corresponding naturally occurring or native gene. Construction of synthetic genes by altering the codon usage is described in for example PCT Patent Application 93/07278.

According to some embodiments of the invention, the exogenous polynucleotide is a non-coding RNA.

As used herein the phrase ‘non-coding RNA” refers to an RNA molecule which does not encode an amino acid sequence (a polypeptide). Examples of such non-coding

2018271407 30 Nov 2018

RNA molecules include, but are not limited to, an antisense RNA, a pre-miRNA (precursor of a microRNA), or a precursor of a Piwi-interacting RNA (piRNA).

Non-limiting examples of non-coding RNA polynucleotides are provided in SEQ ID NOs:37 and 43.

Thus, the invention encompasses nucleic acid sequences described hereinabove; fragments thereof, sequences hybridizable therewith, sequences homologous thereto, sequences encoding similar polypeptides with different codon usage, altered sequences characterized by mutations, such as deletion, insertion or substitution of one or more nucleotides, either naturally occurring or man induced, either randomly or in a targeted fashion.

The invention provides an isolated polynucleotide comprising a nucleic acid sequence which is at least about 80 %, at least about 81 %, at least about 82 %, at least about 83 %, at least about 84 %, at least about 85 %, at least about 86 %, at least about 87 %, at least about 88 %, at least about 89 %, at least about 90 %, at least about 91 %, at least about 92 %, at least about 93 %, at least about 93 %, at least about 94 %, at least about 95 %, at least about 96 %, at least about 97 %, at least about 98 %, at least about 99 %, e.g., 100 % identical to the polynucleotide selected from the group consisting of SEQ ID NOs: 3487, 1-239, 467-1973, 3481-3486, 3488-3674, and 3738-3739.

According to some embodiments of the invention the nucleic acid sequence is capable of increasing yield, biomass, growth rate, vigor, oil content, fiber yield, fiber quality, water use efficiency, nitrogen use efficiency, fertilizer use efficiency and/or abiotic stress tolerance of a plant.

According to some embodiments of the invention the isolated polynucleotide consists of a nucleic acid sequence which is at least about 80 %, at least about 81 %, at least about 82 %, at least about 83 %, at least about 84 %, at least about 85 %, at least about 86 %, at least about 87 %, at least about 88 %, at least about 89 %, at least about 90 %, at least about 91 %, at least about 92 %, at least about 93 %, at least about 93 %, at least about 94 %, at least about 95 %, at least about 96 %, at least about 97 %, at least about 98 %, at least about 99 %, e.g., 100 % identical to the polynucleotide selected from the group consisting of SEQ ID NOs: 3487, 1-239, 467-1973, 3481-3486, 34883674, and 3738-3739.

2018271407 30 Nov 2018

According to some embodiments of the invention the isolated polynucleotide comprising the nucleic acid sequence selected from the group consisting of SEQ ID NOs: 3487, 1-239, 467-1973, 3481-3486, 3488-3674, and 3738-3739.

According to some embodiments of the invention the isolated polynucleotide is set forth by SEQ ID NO: 3487, 1-239, 467-1973, 3481-3486, 3488-3674, 3738 or 3739.

According to some embodiments of the invention the isolated polynucleotide consists of a nucleic acid sequence selected from the group of SEQ ID NOs: 3487, 1239, 467-1973, 3481-3486, 3488-3674, and 3738-3739.

The invention provides an isolated polynucleotide comprising a nucleic acid sequence encoding a polypeptide which comprises an amino acid sequence at least about 80 %, at least about 81 %, at least about 82 %, at least about 83 %, at least about 84 %, at least about 85 %, at least about 86 %, at least about 87 %, at least about 88 %, at least about 89 %, at least about 90 %, at least about 91 %, at least about 92 %, at least about 93 %, at least about 93 %, at least about 94 %, at least about 95 %, at least about 96 %, at least about 97 %, at least about 98 %, at least about 99 %, or more say 100 % homologous to the amino acid sequence selected from the group consisting of SEQ ID NO: 246, 240-245, 247-465, 1974-3480, and 3675-3737.

According to some embodiments of the invention the amino acid sequence is capable of increasing yield, biomass, growth rate, vigor, oil content, fiber yield, fiber quality, water use efficiency, nitrogen use efficiency, fertilizer use efficiency and/or abiotic stress tolerance of a plant.

The invention provides an isolated polynucleotide comprising a nucleic acid sequence encoding a polypeptide which comprises the amino acid sequence selected from the group consisting of SEQ ID NOs: 246, 240-245, 247-465, 1974-3480, and 3675-3737.

The invention provides an isolated polypeptide having an amino acid sequence at least about 80 %, at least about 81 %, at least about 82 %, at least about 83 %, at least about 84 %, at least about 85 %, at least about 86 %, at least about 87 %, at least about 88 %, at least about 89 %, at least about 90 %, at least about 91 %, at least about 92 %, at least about 93 %, at least about 93 %, at least about 94 %, at least about 95 %, at least about 96 %, at least about 97 %, at least about 98 %, at least about 99 %, or more say

2018271407 30 Nov 2018

100 % homologous to an amino acid sequence selected from the group consisting of SEQ ID NOs: 246, 240-245, 247-465, 1974-3480, and 3675-3737.

According to some embodiments of the invention, the isolated polypeptide is selected from the group consisting of SEQ ID NOs: 246, 240-245, 247-465, 1974-3480, and 3675-3737.

The invention also encompasses fragments of the above described polypeptides and polypeptides having mutations, such as deletions, insertions or substitutions of one or more amino acids, either naturally occurring or man induced, either randomly or in a targeted fashion.

The term 'plant as used herein encompasses whole plants, ancestors and progeny of the plants and plant parts, including seeds, shoots, stems, roots (including tubers), and plant cells, tissues and organs. The plant may be in any form including suspension cultures, embryos, meristematic regions, callus tissue, leaves, gametophytes, sporophytes, pollen, and microspores. Plants that are particularly useful in the methods of the invention include all plants which belong to the superfamily Viridiplantae, in particular monocotyledonous and dicotyledonous plants including a fodder or forage legume, ornamental plant, food crop, tree, or shrub selected from the list comprising Acacia spp., Acer spp., Actinidia spp., Aesculus spp., Agathis australis, Albizia amara, Alsophila tricolor, Andropogon spp., Arachis spp, Areca catechu, Astelia fragrans, Astragalus cicer, Baikiaea plurijuga, Betula spp., Brassica spp., Bruguiera gymnorrhiza, Burkea africana, Butea frondosa, Cadaba farinosa, Calliandra spp, Camellia sinensis, Canna indica, Capsicum spp., Cassia spp., Centroema pubescens, Chacoomeles spp., Cinnamomum cassia, Coffea arabica, Colophospermum mopane, Coronillia varia, Cotoneaster serotina, Crataegus spp., Cucumis spp., Cupressus spp., Cyathea dealbata, Cydonia oblonga, Cryptomeria japonica, Cymbopogon spp., Cynthea dealbata, Cydonia oblonga, Dalbergia monetaria, Davallia divaricata, Desmodium spp., Dicksonia squarosa, Dibeteropogon amplectens, Dioclea spp, Dolichos spp., Dorycnium rectum, Echinochloa pyramidalis, Ehraffia spp., Eleusine coracana, Eragrestis spp., Erythrina spp., Eucalyptus spp., Euclea schimperi, Eulalia vi/losa, Pagopyrum spp., Feijoa sellowlana, Fragaria spp., Flemingia spp, Freycinetia banksli, Geranium thunbergii, GinAgo biloba, Glycine javanica, Gliricidia spp, Gossypium hirsutum, Grevillea spp., Guibourtia coleosperma, Hedysarum spp., Hemaffhia altissima, Heteropogon contoffus,

2018271407 30 Nov 2018

Hordeum vulgare, Hyparrhenia rufa, Hypericum erectum, Hypeffhelia dissolute, Indigo incamata, Iris spp., Leptarrhena pyrolifolia, Lespediza spp., Lettuca spp., Leucaena leucocephala, Loudetia simplex, Lotonus bainesli, Lotus spp., Macrotyloma axillare, Malus spp., Manihot esculenta, Medicago saliva, Metasequoia glyptostroboides, Musa sapientum, Nicotianum spp., Onobrychis spp., Omithopus spp., Oryza spp., Peltophorum afficanum, Pennisetum spp., Persea gratissima, Petunia spp., Phaseolus spp., Phoenix canariensis, Phormium cookianum, Photinia spp., Picea glauca, Pinus spp., Pisum sativam, Podocarpus totara, Pogonarthria fleckii, Pogonaffhria squarrosa, Populus spp., Prosopis cineraria, Pseudotsuga menziesii, Pterolobium stellatum, Pyrus communis, Quercus spp., Rhaphiolepsis umbellata, Rhopalostylis sapida, Rhus natalensis, Ribes grossularia, Ribes spp., Robinia pseudoacacia, Rosa spp., Rubus spp., Salix spp., Schyzachyrium sanguineum, Sciadopitys vefficillata, Sequoia sempervirens, Sequoiadendron giganteum, Sorghum bicolor, Spinacia spp., Sporobolus fimbriatus, Stiburus alopecuroides, Stylosanthos humilis, Tadehagi spp, Taxodium distichum, Themeda triandra, Trifolium spp., Triticum spp., Tsuga heterophylla, Vaccinium spp., Vicia spp., Vitis vinifera, Watsonia pyramidata, Zantedeschia aethiopica, Zea mays, amaranth, artichoke, asparagus, broccoli, Brussels sprouts, cabbage, canola, carrot, cauliflower, celery, collard greens, flax, kale, lentil, oilseed rape, okra, onion, potato, rice, soybean, straw, sugar beet, sugar cane, sunflower, tomato, squash tea, maize, wheat, barely, rye, oat, peanut, pea, lentil and alfalfa, cotton, rapeseed, canola, pepper, sunflower, tobacco, eggplant, eucalyptus, a tree, an ornamental plant, a perennial grass and a forage crop. Alternatively algae and other non-Viridiplantae can be used for the methods of the present invention.

According to some embodiments of the invention, the plant used by the method of the invention is a crop plant such as rice, maize, wheat, barley, peanut, potato, sesame, olive tree, palm oil, banana, soybean, sunflower, canola, sugarcane, alfalfa, millet, leguminosae (bean, pea), flax, lupinus, rapeseed, tobacco, poplar, cotton and sorghum.

According to some embodiments of the invention, there is provided a plant cell exogenously expressing the polynucleotide of some embodiments of the invention, the nucleic acid construct of some embodiments of the invention and/or the polypeptide of some embodiments of the invention.

2018271407 30 Nov 2018

According to some embodiments of the invention, expressing the exogenous polynucleotide of the invention within the plant is effected by transforming one or more cells of the plant with the exogenous polynucleotide, followed by generating a mature plant from the transformed cells and cultivating the mature plant under conditions suitable for expressing the exogenous polynucleotide within the mature plant.

According to some embodiments of the invention, the transformation is effected by introducing to the plant cell a nucleic acid construct which includes the exogenous polynucleotide of some embodiments of the invention and at least one promoter capable of directing transcription of the exogenous polynucleotide in the plant cell. Further details of suitable transformation approaches are provided herein below.

According to some embodiments of the invention, there is provided a nucleic acid construct comprising the isolated polynucleotide of the invention, and a promoter for directing transcription of the nucleic acid sequence of the isolated polynucleotide in a host cell.

According to some embodiments of the invention, the isolated polynucleotide is operably linked to the promoter sequence.

A coding nucleic acid sequence is “operably linked” to a regulatory sequence (e.g., promoter) if the regulatory sequence is capable of exerting a regulatory effect on the coding sequence linked thereto.

As used herein, the term “promoter” refers to a region of DNA which lies upstream of the transcriptional initiation site of a gene to which RNA polymerase binds to initiate transcription of RNA. The promoter controls where (e.g., which portion of a plant) and/or when (e.g., at which stage or condition in the lifetime of an organism) the gene is expressed.

Any suitable promoter sequence can be used by the nucleic acid construct of the present invention. According to some embodiments of the invention, the promoter is a constitutive promoter, a tissue-specific, or an abiotic stress-inducible promoter.

Suitable constitutive promoters include, for example, CaMV 35S promoter (SEQ ID NO:4196; Odell et al., Nature 313:810-812, 1985); Arabidopsis At6669 promoter (SEQ ID NO:4195; see PCT Publication No. W004081173A2); Arabidopsis new At6669 promoter (SEQ ID NO:4198); maize Ubi 1 (Christensen et al., Plant Sol. Biol. 18:675-689, 1992); rice actin (McElroy et al., Plant Cell 2:163-171, 1990); pEMU (Last

2018271407 30 Nov 2018 et al., Theor. Appl. Genet. 81:581-588, 1991); CaMV 19S (Nilsson et al., Physiol. Plant 100:456-462, 1997); GOS2 (de Pater et al, Plant J Nov;2(6):837-44, 1992); ubiquitin (Christensen et al, Plant Mol. Biol. 18: 675-689, 1992); Rice cyclophilin (Bucholz et al, Plant Mol Biol. 25(5):837-43, 1994); Maize H3 histone (Lepetit et al, Mol. Gen. Genet. 231: 276-285, 1992); Actin 2 (An et al, Plant J. 10(1); 107-121, 1996) and Synthetic Super MAS (Ni et al., The Plant Journal 7: 661-76, 1995). Other constitutive promoters include those in U.S. Pat. Nos. 5,659,026, 5,608,149; 5.608,144; 5,604,121; 5.569,597: 5.466,785; 5,399,680; 5,268,463; and 5,608,142.

Suitable tissue-specific promoters include, but not limited to, leaf-specific promoters [such as described, for example, by Yamamoto et al., Plant J. 12:255-265, 1997; Kwon et al., Plant Physiol. 105:357-67, 1994; Yamamoto et al., Plant Cell Physiol. 35:773-778, 1994; Gotor et al., Plant J. 3:509-18, 1993; Orozco et al., Plant Mol. Biol. 23:1129-1138, 1993; and Matsuoka et al., Proc. Natl. Acad. Sci. USA 90:9586-9590, 1993], seed-preferred promoters [e.g., from seed specific genes (Simon, et al., Plant Mol. Biol. 5. 191, 1985; Scofield, et al., J. Biol. Chem. 262: 12202, 1987; Baszczynski, et al., Plant Mol. Biol. 14: 633, 1990), Brazil Nut albumin (Pearson' et al., Plant Mol. Biol. 18: 235- 245, 1992), legumin (Ellis, et al. Plant Mol. Biol. 10: 203-214, 1988), Glutelin (rice) (Takaiwa, et al., Mol. Gen. Genet. 208: 15-22, 1986; Takaiwa, et al., FEBS Letts. 221: 43-47, 1987), Zein (Matzke et al., Plant Mol Biol, 143).323-32 1990), napA (Stalberg, et al., Planta 199: 515-519, 1996), Wheat SPA (Albanietal, Plant Cell, 9: 171- 184, 1997), sunflower oleosin (Cummins, etal., Plant Mol. Biol. 19: 873876, 1992)], endosperm specific promoters [e.g., wheat LMW and HMW, glutenin-1 (Mol Gen Genet 216:81-90, 1989; NAR 17:461-2), wheat a, b and g gliadins (EMBO3:1409-15, 1984), Barley Itrl promoter, barley Bl, C, D hordein (Theor Appl Gen 98:1253-62, 1999; Plant J 4:343-55, 1993; Mol Gen Genet 250:750- 60, 1996), Barley DOF (Mena et al., The Plant Journal, 116(1): 53- 62, 1998), Biz2 (EP99106056.7), Synthetic promoter (Vicente-Carbajosa et al., Plant J. 13: 629-640, 1998), rice prolamin NRP33, rice -globulin Glb-1 (Wu et al., Plant Cell Physiology 39(8) 885- 889, 1998), rice alpha-globulin REB/OHP-1 (Nakase et al. Plant Mol. Biol. 33: 513-S22, 1997), rice ADP-glucose PP (Trans Res 6:157-68, 1997), maize ESR gene family (Plant J 12:235-46, 1997), sorghum gamma- kafirin (PMB 32:1029-35, 1996); e.g., the Napin promoter (SEQ ID NO:4197)], embryo specific promoters [e.g., rice

2018271407 30 Nov 2018

OSHI (Sato et al., Proc. Natl. Acad. Sci. USA, 93: 8117-8122), KNOX (PostmaHaarsma et al, Plant Mol. Biol. 39:257-71, 1999), rice oleosin (Wu et at, J. Biochem., 123:386, 1998)], and flower-specific promoters [e.g., AtPRP4, chalene synthase (chsA) (Van der Meer, et al., Plant Mol. Biol. 15, 95-109, 1990), LAT52 (Twell et al., Mol. Gen Genet. 217:240-245; 1989), apetala- 3],

Suitable abiotic stress-inducible promoters include, but not limited to, saltinducible promoters such as RD29A (Yamaguchi-Shinozalei et al., Mol. Gen. Genet. 236:331-340, 1993); drought-inducible promoters such as maize rabl7 gene promoter (Pla et al., Plant Mol. Biol. 21:259-266, 1993), maize rab28 gene promoter (Busk et al., Plant J. 11:1285-1295, 1997) and maize Ivr2 gene promoter (Pelleschi et al., Plant Mol. Biol. 39:373-380, 1999); heat-inducible promoters such as heat tomato hsp80-promoter from tomato (U.S. Pat. No. 5,187,267).

The nucleic acid construct of some embodiments of the invention can further include an appropriate selectable marker and/or an origin of replication. According to some embodiments of the invention, the nucleic acid construct utilized is a shuttle vector, which can propagate both in E. coli (wherein the construct comprises an appropriate selectable marker and origin of replication) and be compatible with propagation in cells. The construct according to some embodiments of the invention can be, for example, a plasmid, a bacmid, a phagemid, a cosmid, a phage, a virus or an artificial chromosome.

The nucleic acid construct of some embodiments of the invention can be utilized to stably or transiently transform plant cells. In stable transformation, the exogenous polynucleotide is integrated into the plant genome and as such it represents a stable and inherited trait. In transient transformation, the exogenous polynucleotide is expressed by the cell transformed but it is not integrated into the genome and as such it represents a transient trait.

There are various methods of introducing foreign genes into both monocotyledonous and dicotyledonous plants (Potrykus, I., Annu. Rev. Plant. Physiol., Plant. Mol. Biol. (1991) 42:205-225; Shimamoto et al., Nature (1989) 338:274-276).

The principle methods of causing stable integration of exogenous DNA into plant genomic DNA include two main approaches:

2018271407 30 Nov 2018 (i) Agrobacterium-mediated gene transfer (e.g., T-DNA using Agrobacterium tumefaciens or Agrobacterium rhizogenes); see for example, Klee et al. (1987) Annu. Rev. Plant Physiol. 38:467-486; Klee and Rogers in Cell Culture and Somatic Cell Genetics of Plants, Vol. 6, Molecular Biology of Plant Nuclear Genes, eds. Schell, J., and Vasil, L. K., Academic Publishers, San Diego, Calif. (1989) p. 225; Gatenby, in Plant Biotechnology, eds. Kung, S, and Amtzen, C. J., Butterworth Publishers, Boston, Mass. (1989) p. 93-112.

(ii) Direct DNA uptake: Paszkowski et al., in Cell Culture and Somatic Cell Genetics of Plants, Vol. 6, Molecular Biology of Plant Nuclear Genes eds. Schell, J., and Vasil, L. K., Academic Publishers, San Diego, Calif. (1989) p. 52-68; including methods for direct uptake of DNA into protoplasts, Toriyama, K. et al. (1988) Bio/Technology 6:1072-1074. DNA uptake induced by brief electric shock of plant cells: Zhang et al. Plant Cell Rep. (1988) 7:379-384. Fromm et al. Nature (1986) 319:791-793. DNA injection into plant cells or tissues by particle bombardment, Klein et al. Bio/Technology (1988) 6:559-563; McCabe et al. Bio/Technology (1988) 6:923926; Sanford, Physiol. Plant. (1990) 79:206-209; by the use of micropipette systems: Neuhaus et al., Theor. Appl. Genet. (1987) 75:30-36; Neuhaus and Spangenberg, Physiol. Plant. (1990) 79:213-217; glass fibers or silicon carbide whisker transformation of cell cultures, embryos or callus tissue, U.S. Pat. No. 5,464,765 or by the direct incubation of DNA with germinating pollen, DeWet et al. in Experimental Manipulation of Ovule Tissue, eds. Chapman, G. P. and Mantell, S. H. and Daniels, W. Longman, London, (1985) p. 197-209; and Ohta, Proc. Natl. Acad. Sci. USA (1986) 83:715-719.

The Agrobacterium system includes the use of plasmid vectors that contain defined DNA segments that integrate into the plant genomic DNA. Methods of inoculation of the plant tissue vary depending upon the plant species and the Agrobacterium delivery system. A widely used approach is the leaf disc procedure which can be performed with any tissue explant that provides a good source for initiation of whole plant differentiation. See, e.g., Horsch et al. in Plant Molecular Biology Manual A5, Kluwer Academic Publishers, Dordrecht (1988) p. 1-9. A supplementary approach employs the Agrobacterium delivery system in combination with vacuum

2018271407 30 Nov 2018 infiltration. The Agrobacterium system is especially viable in the creation of transgenic dicotyledonous plants.

There are various methods of direct DNA transfer into plant cells. In electroporation, the protoplasts are briefly exposed to a strong electric field. In microinjection, the DNA is mechanically injected directly into the cells using very small micropipettes. In microparticle bombardment, the DNA is adsorbed on microprojectiles such as magnesium sulfate crystals or tungsten particles, and the microprojectiles are physically accelerated into cells or plant tissues.

Following stable transformation plant propagation is exercised. The most common method of plant propagation is by seed. Regeneration by seed propagation, however, has the deficiency that due to heterozygosity there is a lack of uniformity in the crop, since seeds are produced by plants according to the genetic variances governed by Mendelian rules. Basically, each seed is genetically different and each will grow with its own specific traits. Therefore, it is preferred that the transformed plant be produced such that the regenerated plant has the identical traits and characteristics of the parent transgenic plant. For this reason it is preferred that the transformed plant be regenerated by micropropagation which provides a rapid, consistent reproduction of the transformed plants.

Micropropagation is a process of growing new generation plants from a single piece of tissue that has been excised from a selected parent plant or cultivar. This process permits the mass reproduction of plants having the preferred tissue expressing the fusion protein. The new generation plants which are produced are genetically identical to, and have all of the characteristics of, the original plant. Micropropagation allows mass production of quality plant material in a short period of time and offers a rapid multiplication of selected cultivars in the preservation of the characteristics of the original transgenic or transformed plant. The advantages of cloning plants are the speed of plant multiplication and the quality and uniformity of plants produced.

Micropropagation is a multi-stage procedure that requires alteration of culture medium or growth conditions between stages. Thus, the micropropagation process involves four basic stages: Stage one, initial tissue culturing; stage two, tissue culture multiplication; stage three, differentiation and plant formation; and stage four, greenhouse culturing and hardening. During stage one, initial tissue culturing, the tissue

2018271407 30 Nov 2018 culture is established and certified contaminant-free. During stage two, the initial tissue culture is multiplied until a sufficient number of tissue samples are produced to meet production goals. During stage three, the tissue samples grown in stage two are divided and grown into individual plantlets. At stage four, the transformed plantlets are transferred to a greenhouse for hardening where the plants' tolerance to light is gradually increased so that it can be grown in the natural environment.

According to some embodiments of the invention, the transgenic plants are generated by transient transformation of leaf cells, meristematic cells or the whole plant.

Transient transformation can be effected by any of the direct DNA transfer methods described above or by viral infection using modified plant viruses.

Viruses that have been shown to be useful for the transformation of plant hosts include CaMV, Tobacco mosaic virus (TMV), brome mosaic virus (BMV) and Bean Common Mosaic Virus (BV or BCMV). Transformation of plants using plant viruses is described in U.S. Pat. No. 4,855,237 (bean golden mosaic virus; BGV), EP-A 67,553 (TMV), Japanese Published Application No. 63-14693 (TMV), EPA 194,809 (BV), EPA 278,667 (BV); and Gluzman, Y. et al., Communications in Molecular Biology: Viral Vectors, Cold Spring Harbor Laboratory, New York, pp. 172-189 (1988). Pseudovirus particles for use in expressing foreign DNA in many hosts, including plants are described in WO 87/06261.

According to some embodiments of the invention, the virus used for transient transformations is avirulent and thus is incapable of causing severe symptoms such as reduced growth rate, mosaic, ring spots, leaf roll, yellowing, streaking, pox formation, tumor formation and pitting. A suitable avirulent virus may be a naturally occurring avirulent virus or an artificially attenuated virus. Virus attenuation may be effected by using methods well known in the art including, but not limited to, sub-lethal heating, chemical treatment or by directed mutagenesis techniques such as described, for example, by Kurihara and Watanabe (Molecular Plant Pathology 4:259-269, 2003), Galon et al. (1992), Atreya et al. (1992) and Huet et al. (1994).

Suitable virus strains can be obtained from available sources such as, for example, the American Type culture Collection (ATCC) or by isolation from infected plants. Isolation of viruses from infected plant tissues can be effected by techniques well known in the art such as described, for example by Foster and Tatlor, Eds. “Plant

2018271407 30 Nov 2018

Virology Protocols: From Virus Isolation to Transgenic Resistance (Methods in Molecular Biology (Humana Pr), Vol 81)”, Humana Press, 1998. Briefly, tissues of an infected plant believed to contain a high concentration of a suitable virus, preferably young leaves and flower petals, are ground in a buffer solution (e.g., phosphate buffer solution) to produce a virus infected sap which can be used in subsequent inoculations.

Construction of plant RNA viruses for the introduction and expression of nonviral exogenous polynucleotide sequences in plants is demonstrated by the above references as well as by Dawson, W. O. et al., Virology (1989) 172:285-292; Takamatsu et al. EMBO J. (1987) 6:307-311; French et al. Science (1986) 231:1294-1297; Takamatsu et al. FEBS Letters (1990) 269:73-76; and U.S. Pat. No. 5,316,931.

When the virus is a DNA virus, suitable modifications can be made to the virus itself. Alternatively, the virus can first be cloned into a bacterial plasmid for ease of constructing the desired viral vector with the foreign DNA. The virus can then be excised from the plasmid. If the virus is a DNA virus, a bacterial origin of replication can be attached to the viral DNA, which is then replicated by the bacteria. Transcription and translation of this DNA will produce the coat protein which will encapsidate the viral DNA. If the virus is an RNA virus, the virus is generally cloned as a cDNA and inserted into a plasmid. The plasmid is then used to make all of the constructions. The RNA virus is then produced by transcribing the viral sequence of the plasmid and translation of the viral genes to produce the coat protein(s) which encapsidate the viral RNA.

In one embodiment, a plant viral polynucleotide is provided in which the native coat protein coding sequence has been deleted from a viral polynucleotide, a non-native plant viral coat protein coding sequence and a non-native promoter, preferably the subgenomic promoter of the non-native coat protein coding sequence, capable of expression in the plant host, packaging of the recombinant plant viral polynucleotide, and ensuring a systemic infection of the host by the recombinant plant viral polynucleotide, has been inserted. Alternatively, the coat protein gene may be inactivated by insertion of the non-native polynucleotide sequence within it, such that a protein is produced. The recombinant plant viral polynucleotide may contain one or more additional non-native subgenomic promoters. Each non-native subgenomic promoter is capable of transcribing or expressing adjacent genes or polynucleotide

2018271407 30 Nov 2018 sequences in the plant host and incapable of recombination with each other and with native subgenomic promoters. Non-native (foreign) polynucleotide sequences may be inserted adjacent the native plant viral subgenomic promoter or the native and a nonnative plant viral subgenomic promoters if more than one polynucleotide sequence is included. The non-native polynucleotide sequences are transcribed or expressed in the host plant under control of the subgenomic promoter to produce the desired products.

In a second embodiment, a recombinant plant viral polynucleotide is provided as in the first embodiment except that the native coat protein coding sequence is placed adjacent one of the non-native coat protein subgenomic promoters instead of a nonnative coat protein coding sequence.

In a third embodiment, a recombinant plant viral polynucleotide is provided in which the native coat protein gene is adjacent its subgenomic promoter and one or more non-native subgenomic promoters have been inserted into the viral polynucleotide. The inserted non-native subgenomic promoters are capable of transcribing or expressing adjacent genes in a plant host and are incapable of recombination with each other and with native subgenomic promoters. Non-native polynucleotide sequences may be inserted adjacent the non-native subgenomic plant viral promoters such that the sequences are transcribed or expressed in the host plant under control of the subgenomic promoters to produce the desired product.

In a fourth embodiment, a recombinant plant viral polynucleotide is provided as in the third embodiment except that the native coat protein coding sequence is replaced by a non-native coat protein coding sequence.

The viral vectors are encapsidated by the coat proteins encoded by the recombinant plant viral polynucleotide to produce a recombinant plant virus. The recombinant plant viral polynucleotide or recombinant plant virus is used to infect appropriate host plants. The recombinant plant viral polynucleotide is capable of replication in the host, systemic spread in the host, and transcription or expression of foreign gene(s) (exogenous polynucleotide) in the host to produce the desired protein.

Techniques for inoculation of viruses to plants may be found in Foster and Taylor, eds. “Plant Virology Protocols: From Virus Isolation to Transgenic Resistance (Methods in Molecular Biology (Humana Pr), Vol 81)”, Humana Press, 1998; Maramorosh and Koprowski, eds. “Methods in Virology” 7 vols, Academic Press, New

2018271407 30 Nov 2018

York 1967-1984; Hill, S.A. “Methods in Plant Virology”, Blackwell, Oxford, 1984; Walkey, D.G.A. “Applied Plant Virology”, Wiley, New York, 1985; and Kado and Agrawa, eds. “Principles and Techniques in Plant Virology”, Van Nostrand-Reinhold, New York.

In addition to the above, the polynucleotide of the present invention can also be introduced into a chloroplast genome thereby enabling chloroplast expression.

A technique for introducing exogenous polynucleotide sequences to the genome of the chloroplasts is known. This technique involves the following procedures. First, plant cells are chemically treated so as to reduce the number of chloroplasts per cell to about one. Then, the exogenous polynucleotide is introduced via particle bombardment into the cells with the aim of introducing at least one exogenous polynucleotide molecule into the chloroplasts. The exogenous polynucleotide is selected such that it is integratable into the chloroplast's genome via homologous recombination which is readily effected by enzymes inherent to the chloroplast. To this end, the exogenous polynucleotide includes, in addition to a gene of interest, at least one polynucleotide stretch which is derived from the chloroplast's genome. In addition, the exogenous polynucleotide includes a selectable marker, which serves by sequential selection procedures to ascertain that all or substantially all of the copies of the chloroplast genomes following such selection will include the exogenous polynucleotide. Further details relating to this technique are found in U.S. Pat. Nos. 4,945,050; and 5,693,507 which are incorporated herein by reference. A polypeptide can thus be produced by the protein expression system of the chloroplast and become integrated into the chloroplast's inner membrane.

Since yield (or other parameters affecting yield such as growth rate, biomass, vigor, content of seeds, oil content and the like), fiber yield and/or quality, water use efficiency, fertilizer use efficiency, nitrogen use efficiency and/or abiotic stress tolerance in plants can involve multiple genes acting additively or in synergy (see, for example, in Quesda et al., Plant Physiol. 130:951-063, 2002), the invention also envisages expressing a plurality of exogenous polynucleotides in a single host plant to thereby achieve superior effect on yield, fiber yield and/or quality, water use efficiency, fertilizer use efficiency, nitrogen use efficiency and/or abiotic stress tolerance.

2018271407 30 Nov 2018

Expressing a plurality of exogenous polynucleotides in a single host plant can be effected by co-introducing multiple nucleic acid constructs, each including a different exogenous polynucleotide, into a single plant cell. The transformed cell can then be regenerated into a mature plant using the methods described hereinabove.

Alternatively, expressing a plurality of exogenous polynucleotides in a single host plant can be effected by co-introducing into a single plant-cell a single nucleic-acid construct including a plurality of different exogenous polynucleotides. Such a construct can be designed with a single promoter sequence which can transcribe a polycistronic messenger RNA including all the different exogenous polynucleotide sequences. To enable co-translation of the different polypeptides encoded by the polycistronic messenger RNA, the polynucleotide sequences can be inter-linked via an internal ribosome entry site (IRES) sequence which facilitates translation of polynucleotide sequences positioned downstream of the IRES sequence. In this case, a transcribed polycistronic RNA molecule encoding the different polypeptides described above will be translated from both the capped 5' end and the two internal IRES sequences of the polycistronic RNA molecule to thereby produce in the cell all different polypeptides. Alternatively, the construct can include several promoter sequences each linked to a different exogenous polynucleotide sequence.

The plant cell transformed with the construct including a plurality of different exogenous polynucleotides can be regenerated into a mature plant, using the methods described hereinabove.

Alternatively, expressing a plurality of exogenous polynucleotides can be effected by introducing different nucleic acid constructs, including different exogenous polynucleotides, into a plurality of plants. The regenerated transformed plants can then be cross-bred and resultant progeny selected for superior yield (e.g., growth rate, biomass, vigor, oil content), fiber yield and/or quality, water use efficiency, fertilizer use efficiency, nitrogen use efficiency and/or abiotic stress tolerance traits, using conventional plant breeding techniques.

According to some embodiments of the invention, the plant expressing the exogenous polynucleotide(s) is grown under non-stress or normal conditions (e.g., biotic conditions and/or conditions with sufficient water, nutrients such as nitrogen and

2018271407 30 Nov 2018 fertilizer). Such conditions, which depend on the plant being grown, are known to those skilled in the art of agriculture, and are further, described hereinbelow.

According to some embodiments of the invention, the method further comprising growing the plant expressing the exogenous polynucleotide under the abiotic stress.

Non-limiting examples of abiotic stress conditions include, salinity, drought, water deprivation, excess of water (e.g., flood, waterlogging), etiolation, low temperature, high temperature, heavy metal toxicity, anaerobiosis, nutrient deficiency, nutrient excess, atmospheric pollution and UV irradiation.

Thus, the invention encompasses plants exogenously expressing the polynucleotide(s), the nucleic acid constructs and/or polypeptide(s) of the invention. Once expressed within the plant cell or the entire plant, the level of the polypeptide encoded by the exogenous polynucleotide can be determined by methods well known in the art such as, activity assays, Western blots using antibodies capable of specifically binding the polypeptide, Enzyme-Linked Immuno Sorbent Assay (ELISA), radioimmuno-assays (RIA), immunohistochemistry, immunocytochemistry, immunofluorescence and the like.

Methods of determining the level in the plant of the RNA transcribed from the exogenous polynucleotide are well known in the art and include, for example, Northern blot analysis, reverse transcription polymerase chain reaction (RT-PCR) analysis (including quantitative, semi-quantitative or real-time RT-PCR) and RNA-zn situ hybridization.

The sequence information and annotations uncovered by the present teachings can be harnessed in favor of classical breeding. Thus, sub-sequence data of those polynucleotides described above, can be used as markers for marker assisted selection (MAS), in which a marker is used for indirect selection of a genetic determinant or determinants of a trait of interest (e.g., biomass, growth rate, oil content, fiber yield and/or quality, yield, abiotic stress tolerance, water use efficiency, nitrogen use efficiency and/or fertilizer use efficiency). Nucleic acid data of the present teachings (DNA or RNA sequence) may contain or be linked to polymorphic sites or genetic markers on the genome such as restriction fragment length polymorphism (RFLP), microsatellites and single nucleotide polymorphism (SNP), DNA fingerprinting (DFP), amplified fragment length polymorphism (AFLP), expression level polymorphism,

2018271407 30 Nov 2018 polymorphism of the encoded polypeptide and any other polymorphism at the DNA or RNA sequence.

Examples of marker assisted selections include, but are not limited to, selection for a morphological trait (e.g., a gene that affects form, coloration, male sterility or resistance such as the presence or absence of awn, leaf sheath coloration, height, grain color, aroma of rice); selection for a biochemical trait (e.g., a gene that encodes a protein that can be extracted and observed; for example, isozymes and storage proteins); selection for a biological trait (e.g., pathogen races or insect biotypes based on host pathogen or host parasite interaction can be used as a marker since the genetic constitution of an organism can affect its susceptibility to pathogens or parasites).

The polynucleotides and polypeptides described hereinabove can be used in a wide range of economical plants, in a safe and cost effective manner.

Plant lines exogenously expressing the polynucleotide or the polypeptide of the invention can be screened to identify those that show the greatest increase of the desired plant trait.

The effect of the transgene (the exogenous polynucleotide encoding the polypeptide) on abiotic stress tolerance can be determined using known methods such as detailed below and in the Examples section which follows.

Plant’s growth rate, biomass, yield and/or vigor - Plant vigor can be calculated by the increase in growth parameters such as leaf area, fiber length, rosette diameter, plant fresh weight and the like per time.

The growth rate can be measured using digital analysis of growing plants. For example, images of plants growing in greenhouse on plot basis can be captured every 3 days and the rosette area can be calculated by digital analysis. Rosette area growth is calculated using the difference of rosette area between days of sampling divided by the difference in days between samples.

Evaluation of growth rate can be also done by measuring plant biomass produced, rosette area, leaf size or root length per time (can be measured in cm² per day of leaf area).

Relative growth area can be calculated using Formula IE

Formula II:

Relative growth rate area = Regression coefficient of area along time course

2018271407 30 Nov 2018

Thus, the relative growth area rate is in units of 1/day and length growth rate is in units of 1/day.

Seed yield - Evaluation of the seed yield per plant can be done by measuring the amount (weight or size) or quantity (i.e., number) of dry seeds produced and harvested from 8-16 plants and divided by the number of plants.

For example, the total seeds from 8-16 plants can be collected, weighted using e.g., an analytical balance and the total weight can be divided by the number of plants. Seed yield per growing area can be calculated in the same manner while taking into account the growing area given to a single plant. Increase seed yield per growing area could be achieved by increasing seed yield per plant, and/or by increasing number of plants capable of growing in a given area.

Seed yield can be expressed as thousand kernel weight (1000-weight), which is extrapolated from the number of filled seeds counted and their total weight. Hence, an increased 1000-weight may result from an increased seed size and/or seed weight (e.g., increase in embryo size and/or endosperm size). For example, the weight of 1000 seeds can be determined as follows: seeds are scattered on a glass tray and a picture is taken. Each sample is weighted and then using the digital analysis, the number of seeds in each sample is calculated.

The 1000 seeds weight can be calculated using formula III:

Formula III:

1000 Seed Weight = number of seed in sample/ sample weight X 1000

The Harvest Index can be calculated using Formula IV

Formula IV:

Harvest Index = Average seed yield per plant/ Average dry weight

Since the transgenic plants of the invention have increased yield, it is likely that these plants exhibit an increased growth rate (during at least part of their life cycle), relative to the growth rate of corresponding wild type plants at a corresponding stage in their life cycle. The increased growth rate may be specific to one or more parts of a plant (including seeds), or may be throughout substantially the whole plant. A plant having an increased growth rate may also exhibit early flowering. Increased growth rate during the early stages in the life cycle of a plant may reflect enhanced vigor. The increase in growth rate may alter the harvest cycle (early maturing) of a plant allowing

2018271407 30 Nov 2018 plants to be sown later and/or harvested sooner than would otherwise be possible. If the growth rate is sufficiently increased, it may allow for the sowing of further seeds of the same plant species (for example sowing and harvesting of rice plants followed by sowing and harvesting of further rice plants all within one conventional growing period). Similarly, if the growth rate is sufficiently increased, it may allow for the sowing of further seeds of different plants species (for example the sowing and harvesting of rice plants followed by, for example, the sowing and optional harvesting of soybean, potato or any other suitable plant). Harvesting additional times from the same rootstock in the case of some plants may also be possible. Altering the harvest cycle of a plant may lead to an increase in annual biomass production per area (due to an increase in the number of times (say in a year) that any particular plant may be grown and harvested). An increase in growth rate may also allow for the cultivation of transgenic plants in a wider geographical area than their wild-type counterparts, since the territorial limitations for growing a crop are often determined by adverse environmental conditions either at the time of planting (early season) or at the time of harvesting (late season). Such adverse conditions may be avoided if the harvest cycle is shortened. The growth rate may be determined by deriving various parameters from growth curves, such parameters may be: T-Mid (the time taken for plants to reach 50% of their maximal size) and T-90 (time taken for plants to reach 90% of their maximal size).

According to some embodiments of the invention, increased yield of com may be manifested as one or more of the following: increase in the number of plants per growing area, increase in the number of ears per plant, increase in the number of rows per ear, number of kernels per ear row, kernel weight, thousand kernel weight (1000weight), ear length/diameter, increase oil content per kernel and increase starch content per kernel.

As mentioned, the increase of plant yield can be determined by various parameters. For example, increased yield of rice may be manifested by an increase in one or more of the following: number of plants per growing area, number of panicles per plant, number of spikelets per panicle, number of flowers per panicle, increase in the seed filling rate, increase in thousand kernel weight (1000-weight), increase oil content

2018271407 30 Nov 2018 per seed, increase starch content per seed, among others. An increase in yield may also result in modified architecture, or may occur because of modified architecture.

Similarly, increased yield of soybean may be manifested by an increase in one or more of the following: number of plants per growing area, number of pods per plant, number of seeds per pod, increase in the seed filling rate, increase in thousand seed weight (1000-weight), reduce pod shattering, increase oil content per seed, increase protein content per seed, among others. An increase in yield may also result in modified architecture, or may occur because of modified architecture.

Increased yield of canola may be manifested by an increase in one or more of the following: number of plants per growing area, number of pods per plant, number of seeds per pod, increase in the seed filling rate, increase in thousand seed weight (1000weight), reduce pod shattering, increase oil content per seed, among others. An increase in yield may also result in modified architecture, or may occur because of modified architecture.

Increased yield of cotton may be manifested by an increase in one or more of the following: number of plants per growing area, number of bolls per plant, number of seeds per boll, increase in the seed filling rate, increase in thousand seed weight (1000weight), increase oil content per seed, improve fiber length, fiber strength, among others. An increase in yield may also result in modified architecture, or may occur because of modified architecture.

Oil content - The oil content of a plant can be determined by extraction of the oil from the seed or the vegetative portion of the plant. Briefly, lipids (oil) can be removed from the plant (e.g., seed) by grinding the plant tissue in the presence of specific solvents (e.g., hexane or petroleum ether) and extracting the oil in a continuous extractor. Indirect oil content analysis can be carried out using various known methods such as Nuclear Magnetic Resonance (NMR) Spectroscopy, which measures the resonance energy absorbed by hydrogen atoms in the liquid state of the sample [See for example, Conway TF. and Earle FR., 1963, Journal of the American Oil Chemists' Society; Springer Berlin / Heidelberg, ISSN: 0003-021X (Print) 1558-9331 (Online)]; the Near Infrared (NI) Spectroscopy, which utilizes the absorption of near infrared energy (11002500 nm) by the sample; and a method described in WO/2001/023884, which is based on extracting oil a solvent, evaporating the solvent in a gas stream which forms oil

2018271407 30 Nov 2018 particles, and directing a light into the gas stream and oil particles which forms a detectable reflected light.

Fiber length can be measured using fibrograph. The fibrograph system was used to compute length in terms of Upper Half Mean length. The upper half mean (UHM) is the average length of longer half of the fiber distribution. The fibrograph measures length in span lengths at a given percentage point (Hypertext Transfer Protocol://World Wide Web (dot) cottoninc (dot) com/ClassificationofCotton/?Pg=4#Eength).

Abiotic stress tolerance - Transformed (i.e., expressing the transgene) and nontransformed (wild type) plants are exposed to an abiotic stress condition, such as water deprivation, suboptimal temperature (low temperature, high temperature), nutrient deficiency, nutrient excess, a salt stress condition, osmotic stress, high or low light conditions, heavy metal toxicity, anaerobiosis, atmospheric pollution and UV irradiation.

Salinity tolerance assay - Transgenic plants with tolerance to high salt concentrations are expected to exhibit better germination, seedling vigor or growth in high salt. Salt stress can be effected in many ways such as, for example, by irrigating the plants with a hyperosmotic solution, by cultivating the plants hydroponically in a hyperosmotic growth solution (e.g., Hoagland solution with added salt), or by culturing the plants in a hyperosmotic growth medium [e.g., 50 % Murashige-Skoog medium (MS medium) with added salt]. Since different plants vary considerably in their tolerance to salinity, the salt concentration in the irrigation water, growth solution, or growth medium can be adjusted according to the specific characteristics of the specific plant cultivar or variety, so as to inflict a mild or moderate effect on the physiology and/or morphology of the plants (for guidelines as to appropriate concentration see, Bernstein and Kafkafi, Root Growth Under Salinity Stress In: Plant Roots, The Hidden Half 3rd ed. Waisel Y, Eshel A and Kafkafi U. (editors) Marcel Dekker Inc., New York, 2002, and reference therein).

For example, a salinity tolerance test can be performed by irrigating plants at different developmental stages with increasing concentrations of sodium chloride (for example 50 mM, 100 rnM, 200 mM, 400 rnM NaCl) applied from the bottom and from above to ensure even dispersal of salt. Following exposure to the stress condition the plants are frequently monitored until substantial physiological and/or morphological effects appear in wild type plants. Thus, the external phenotypic appearance, degree of

2018271407 30 Nov 2018 chlorosis and overall success to reach maturity and yield progeny are compared between control and transgenic plants. Quantitative parameters of tolerance measured include, but are not limited to, the average wet and dry weight, growth rate, leaf size, leaf coverage (overall leaf area), the weight of the seeds yielded, the average seed size and the number of seeds produced per plant. Transformed plants not exhibiting substantial physiological and/or morphological effects, or exhibiting higher biomass than wild-type plants, are identified as abiotic stress tolerant plants.

Osmotic tolerance test - Osmotic stress assays (including sodium chloride and PEG assays) are conducted to determine if an osmotic stress phenotype was sodium chloride-specific or if it was a general osmotic stress related phenotype. Plants which are tolerant to osmotic stress may have more tolerance to drought and/or freezing. For salt and osmotic stress experiments, the medium is supplemented for example with 50 mM, 100 mM, 200 mM NaCl or 15 %, 20 % or 25 % PEG.

Drought tolerance assay - Soil-based drought screens are performed with plants overexpressing the polynucleotides detailed above. Seeds from control Arabidopsis plants, or other transgenic plants overexpressing the polypeptide of the invention are germinated and transferred to pots. Drought stress is obtained after irrigation is ceased. Transgenic and control plants are compared to each other when the majority of the control plants develop severe wilting. Plants are re-watered after obtaining a significant fraction of the control plants displaying a severe wilting. Plants are ranked comparing to controls for each of two criteria: tolerance to the drought conditions and recovery (survival) following re-watering.

Quantitative parameters of tolerance measured include, but are not limited to, the average wet and dry weight, growth rate, leaf size, leaf coverage (overall leaf area), the weight of the seeds yielded, the average seed size and the number of seeds produced per plant. Transformed plants not exhibiting substantial physiological and/or morphological effects, or exhibiting higher biomass than wild-type plants, are identified as drought stress tolerant plants

Cold stress tolerance - One way to analyze cold stress is as follows. Mature (25 day old) plants are transferred to 4 °C chambers for 1 or 2 weeks, with constitutive light. Later on plants are moved back to greenhouse. Two weeks later damages from chilling period, resulting in growth retardation and other phenotypes, are compared between

2018271407 30 Nov 2018 control and transgenic plants, by measuring plant weight (wet and dry), and by comparing growth rates measured as time to flowering, plant size, yield, and the like.

Heat stress tolerance - One way to measure heat stress tolerance is by exposing the plants to temperatures above 34 °C for a certain period. Plant tolerance is examined after transferring the plants back to 22 °C for recovery and evaluation after 5 days relative to internal controls (non-transgenic plants) or plants not exposed to neither cold or heat stress.

Germination tests - Germination tests compare the percentage of seeds from transgenic plants that could complete the germination process to the percentage of seeds from control plants that are treated in the same manner. Normal conditions are considered for example, incubations at 22 °C under 22-hour light 2-hour dark daily cycles. Evaluation of germination and seedling vigor is conducted between 4 and 14 days after planting. The basal media is 50 % MS medium (Murashige and Skoog, 1962 Plant Physiology 15, 473-497).

Germination is checked also at unfavorable conditions such as cold (incubating at temperatures lower than 10 °C instead of 22 °C) or using seed inhibition solutions that contain high concentrations of an osmolyte such as sorbitol (at concentrations of 50 rnM, 100 rnM, 200 rnM, 300 mM, 500 rnM, and up to 1000 mM) or applying increasing concentrations of salt (of 50 mM, 100 rnM, 200 mM, 300 mM, 500 mM NaCl).

Water use efficiency (WUE) - can be determined as the biomass produced per unit transpiration. To analyze WUE, leaf relative water content can be measured in control and transgenic plants. Fresh weight (FW) is immediately recorded; then leaves are soaked for 8 hours in distilled water at room temperature in the dark, and the turgid weight (TW) is recorded. Total dry weight (DW) is recorded after drying the leaves at 60 °C to a constant weight. Relative water content (RWC) is calculated according to the following Formula V:

Formula V

RWC = (FW - DW/TW - DW) x 100

Plants that maintain high relative water content (RWC) compared to control lines are considered more tolerant to drought than those exhibiting reduced relative water content. A non limiting example in Arabidopsis is when water uptake by roots matches water loss by transpiration from leaves. Under these circumstances the plant is

2018271407 30 Nov 2018 determined to be under equilibrium and the RWC is about 0.9. When the RWC of transgenic plants decreases significantly less as compared to wild type plants, the transgenic plants are considered more tolerant to drought [Gaxiola et al. PNAS September 25, 2001 vol. 98 no. 20 11444-11449],

Fertilizer use efficiency - To analyze whether the transgenic plants are more responsive to fertilizers, plants are grown in agar plates or pots containing growth media with a limited amount of fertilizer (e.g., nitrogen, phosphate, potassium), essentially as described in Yanagisawa et al (Proc Natl Acad Sci USA. 2004; 101:7833-8). The plants are analyzed for their overall size, time to flowering, yield, protein content of shoot, grain and/or seed production. The parameters checked are the overall size of the mature plant, its wet and dry weight, the weight of the seeds yielded, the average seed size and the number of seeds produced per plant. Other parameters that may be tested are: the chlorophyll content of leaves (as nitrogen plant status and the degree of leaf greenness is highly correlated), amino acid and the total protein content of the seeds or other plant parts such as leaves or shoots, oil content, etc. In this way, nitrogen use efficiency (NUE), phosphate use efficiency (PUE) and potassium use efficiency (KUE) are assessed, checking the ability of the transgenic plants which express the exogenous polynucleotide of the invention to thrive under nutrient restraining conditions. For example, to analyze whether the transgenic Arabidopsis plants are more responsive to phosphate, plants are grown in 250 rnM (phosphate deficient conditions) or 1 mM (optimal phosphate concentration). To test the potassium use efficiency, Arabidopsis plants which express the exogenous polynucleotide of the invention are grown in 0.03 rnM potassium (potassium deficient conditions) or 3 rnM potassium (optimal potassium concentration) essentially as described by Watson et al. Plant Physiol. (1996) 111: 1077-1 083.

Nitrogen determination - The procedure for N (nitrogen) concentration determination in the structural parts of the plants involves the potassium persulfate digestion method to convert organic N to NO3’ (Purcell and King 1996 Argon. J. 88:111113, the modified Cd’ mediated reduction of NO3’ to NO2’ (Vodovotz 1996 Biotechniques 20:390-394) and the measurement of nitrite by the Griess assay (Vodovotz 1996, supra). The absorbance values are measured at 550 nm against a

2018271407 30 Nov 2018 standard curve of NaNCh. The procedure is described in details in Samonte et al. 2006 Agron. J. 98:168-176.

Nitrogen use efficiency - To analyze whether the transgenic Arabidopsis plants are more responsive to nitrogen plant are grown in 0.75- 1.5 mM (nitrogen deficient conditions) or 6-10 mM (optimal nitrogen concentration). Plants are allowed to grow for additional 20 days or until seed production. The plants are then analyzed for their overall size, time to flowering, yield, protein content of shoot and/or grain/ seed production. The parameters checked can be the overall size of the plant, wet and dry weight, the weight of the seeds yielded, the average seed size and the number of seeds produced per plant. Other parameters that may be tested are: the chlorophyll content of leaves (as nitrogen plant status and the degree of leaf greenness is highly correlated), amino acid and the total protein content of the seeds or other plant parts such as leaves or shoots and oil content. Transformed plants not exhibiting substantial physiological and/or morphological effects, or exhibiting higher measured parameters levels than wildtype plants, are identified as nitrogen use efficient plants.

Nitrogen use efficiency assay using plantlets - The assay is done according to Yanagisawa-S. et al. with minor modifications (“Metabolic engineering with Dofl transcription factor in plants: Improved nitrogen assimilation and growth under lownitrogen conditions” Proc. Natl. Acad. Sci. USA 101, 7833-7838). Briefly, transgenic plants which are grown for 7-10 days in 0.5 x MS [Murashige-Skoog] supplemented with a selection agent are transferred to two nitrogen-limiting conditions: MS media in which the combined nitrogen concentration (NH4NO3 and KNO3) was 0.2 mM or 0.05 mM. Plants are allowed to grow for additional 30-40 days and then photographed, individually removed from the Agar (the shoot without the roots) and immediately weighed (fresh weight) for later statistical analysis. Constructs for which only T1 seeds are available are sown on selective media and at least 25 seedlings (each one representing an independent transformation event) are carefully transferred to the nitrogen-limiting media. For constructs for which T2 seeds are available, different transformation events are analyzed. Usually, 25 randomly selected plants from each event are transferred to the nitrogen-limiting media allowed to grow for 3-4 additional weeks and individually weighed at the end of that period. Transgenic plants are compared to control plants grown in parallel under the same conditions. Mock2018271407 30 Nov 2018 transgenic plants expressing the uidA reporter gene (GUS) under the same promoter are used as control.

Grain protein concentration - Grain protein content (g grain protein m’²) is estimated as the product of the mass of grain N (g grain N m’²) multiplied by the N/protein conversion ratio of k-5.13 (Mosse 1990, supra). The grain protein concentration is estimated as the ratio of grain protein content per unit mass of the grain (g grain protein kg’¹ grain).

Thus, the present invention is of high agricultural value for promoting the yield, biomass, growth rate, vigor, water use efficiency, fertilizer use efficiency, nitrogen use efficiency and abiotic stress tolerance of commercially desired crops (e.g., biomass of vegetative organ such as poplar wood, or reproductive organ such as number of seeds or seed biomass).

As used herein the term “about” refers to + 10 %.

The terms comprises, comprising, includes, including, “having” and their conjugates mean including but not limited to.

The term “consisting of means “including and limited to”.

The term consisting essentially of means that the composition, method or structure may include additional ingredients, steps and/or parts, but only if the additional ingredients, steps and/or parts do not materially alter the basic and novel characteristics of the claimed composition, method or structure.

As used herein, the singular form a, an and the include plural references unless the context clearly dictates otherwise. For example, the term a compound or at least one compound may include a plurality of compounds, including mixtures thereof.

Throughout this application, various embodiments of this invention may be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as

2018271407 30 Nov 2018 from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range.

Whenever a numerical range is indicated herein, it is meant to include any cited numeral (fractional or integral) within the indicated range. The phrases “ranging/ranges between” a first indicate number and a second indicate number and “ranging/ranges from” a first indicate number “to” a second indicate number are used herein interchangeably and are meant to include the first and second indicated numbers and all the fractional and integral numerals therebetween.

As used herein the term method refers to manners, means, techniques and procedures for accomplishing a given task including, but not limited to, those manners, means, techniques and procedures either known to, or readily developed from known manners, means, techniques and procedures by practitioners of the chemical, pharmacological, biological, biochemical and medical arts.

It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable subcombination or as suitable in any other described embodiment of the invention. Certain features described in the context of various embodiments are not to be considered essential features of those embodiments, unless the embodiment is inoperative without those elements.

Various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below find experimental support in the following examples.

EXAMPLES

Reference is now made to the following examples, which together with the above descriptions illustrate some embodiments of the invention in a non limiting fashion.

2018271407 30 Nov 2018

Generally, the nomenclature used herein and the laboratory procedures utilized in the present invention include molecular, biochemical, microbiological and recombinant DNA techniques. Such techniques are thoroughly explained in the literature. See, for example, Molecular Cloning: A laboratory Manual Sambrook et al., (1989); Current Protocols in Molecular Biology Volumes I-III Ausubel, R. M., ed. (1994); Ausubel et al., Current Protocols in Molecular Biology, John Wiley and Sons, Baltimore, Maryland (1989); Perbal, A Practical Guide to Molecular Cloning, John Wiley & Sons, New York (1988); Watson et al., Recombinant DNA, Scientific American Books, New York; Birren et al. (eds) Genome Analysis: A Laboratory Manual Series, Vols. 1-4, Cold Spring Harbor Laboratory Press, New York (1998); methodologies as set forth in U.S. Pat. Nos. 4,666,828; 4,683,202; 4,801,531; 5,192,659 and 5,272,057; Cell Biology: A Laboratory Handbook, Volumes I-III Cellis, J. E., ed. (1994); Current Protocols in Immunology Volumes I-III Coligan J. E., ed. (1994); Stites et al. (eds), Basic and Clinical Immunology (8th Edition), Appleton & Lange, Norwalk, CT (1994); Mishell and Shiigi (eds), Selected Methods in Cellular Immunology, W. H. Freeman and Co., New York (1980); available immunoassays are extensively described in the patent and scientific literature, see, for example, U.S. Pat. Nos. 3,791,932; 3,839,153; 3,850,752; 3,850,578; 3,853,987; 3,867,517; 3,879,262; 3,901,654; 3,935,074; 3,984,533; 3,996,345; 4,034,074; 4,098,876; 4,879,219; 5,011,771 and 5,281,521; Oligonucleotide Synthesis Gait, M. J., ed. (1984); “Nucleic Acid Hybridization Hames, B. D., and Higgins S. J., eds. (1985); Transcription and Translation Hames, B. D., and Higgins S. J., Eds. (1984); Animal Cell Culture Freshney, R. 1., ed. (1986); Immobilized Cells and Enzymes IRL Press, (1986); A Practical Guide to Molecular Cloning Perbal, B., (1984) and Methods in Enzymology Vol. 1-317, Academic Press; PCR Protocols: A Guide To Methods And Applications, Academic Press, San Diego, CA (1990); Marshak et al., Strategies for Protein Purification and Characterization - A Laboratory Course Manual CSHL Press (1996); all of which are incorporated by reference as if fully set forth herein. Other general references are provided throughout this document. The procedures therein are believed to be well known in the art and are provided for the convenience of the reader. All the information contained therein is incorporated herein by reference.

2018271407 30 Nov 2018

EXAMPLE 1

IDENTIFYING GENES WHICH IMPROVE YIELD AND AGRONOMICAL IMPORTANT TRAITS IN PLANTS

The present inventors have identified polynucleotides which expression thereof in plants can increase yield, fiber yield, fiber quality, growth rate, vigor, biomass, growth rate, oil content, abiotic stress tolerance (ABST), nitrogen use efficiency (NUE), water use efficiency (WUE) and fertilizer use efficiency (FUE) of a plant, as follows.

All nucleotide sequence datasets used here were originated from publicly available databases or from performing sequencing using the Solexa technology (e.g. Barley and Sorghum). Sequence data from 100 different plant species was introduced into a single, comprehensive database. Other information on gene expression, protein annotation, enzymes and pathways were also incorporated. Major databases used include:

• Genomes o Arabidopsis genome [TAIR genome version 6 (Hypertext Transfer Protocol ://World Wide Web (dot) arabidopsis (dot) org/)] o Rice genome [IRGSP build 4.0 (Hypertext Transfer Protocol://rgp (dot) dna (dot) affrc (dot) go (dot) jp/IRGSP/)].

o Poplar [Populus trichocarpa release 1.1 from JGI (assembly release vl .0) (Hypertext Transfer Protocol://World Wide Web (dot) genome (dot) jgi-psf (dot) org/)] o Brachypodium [JGI 4x assembly, Hypertext Transfer Protocol://World Wide Web (dot) brachpodium (dot) org)] o Soybean [DOE-JGI SCP, version GlymaO (Hypertext Transfer Protocol://World Wide Web (dot) phytozome (dot) net/)] o Grape [French-Italian Public Consortium for Grapevine Genome Characterization grapevine genome (Hypertext Transfer Protocol:// World Wide Web (dot) genoscope (dot) cns (dot) fr /)] o Castobean [TIGR/J Craig Venter Institute 4x assembly [(Hypertext Transfer Protocol ://msc (dot) jcvi (dot) org/r communis] o Sorghum [DOE-JGI SCP, version Sbil [Hypertext Transfer Protocol://World Wide Web (dot) phytozome (dot) net/)].

2018271407 30 Nov 2018 o Partially assembled genome of Maize [Hypertext Transfer Protocol ://maizesequence (dot) org/] • Expressed EST and mRNA sequences were extracted from the following databases:

o GeneBank versions 154, 157, 160, 161, 164, 165, 166 and 168 (Hypertext Transfer Protocol://World Wide Web (dot) ncbi (dot) nlm (dot) nih (dot) gov/dbEST/) o RefSeq (Hypertext Transfer Protocol://World Wide Web (dot) ncbi (dot) nlm (dot) nih (dot) gov/RefSeq/).

o TAIR (Hypertext Transfer Protocol://World Wide Web (dot) arabidopsis (dot) org/).

• Protein and pathway databases o Uniprot [Hypertext Transfer Protocol://World Wide Web (dot) uniprot (dot) org/].

o AraCyc [Hypertext Transfer Protocol ://World Wide Web (dot) arabidopsis (dot) org/biocyc/index (dot) jsp], o ENZYME [Hypertext Transfer Protocol ://expasy (dot) org/enzyme/].

• Microarray datasets were downloaded from:

o GEO (Hypertext Transfer Protocol://World Wide Web.ncbi.nlm.nih.gov/geo/) o TAIR (Hypertext Transfer Protocol://World Wide Web.arabidopsis.org/).

o Proprietary microarray data (W02008/122980).

• QTL and SNPs information o Gramene [Hypertext Transfer Protocol://World Wide Web (dot) gramene (dot) org/qtl/].

o Panzea [Hypertext Transfer Protocol://World Wide Web (dot) panzea (dot) org/index (dot) html].

Database Assembly - was performed to build a wide, rich, reliable annotated and easy to analyze database comprised of publicly available genomic mRNA, ESTs DNA sequences, data from various crops as well as gene expression, protein annotation and pathway data QTLs, and other relevant information.

Database assembly is comprised of a toolbox of gene refining, structuring, annotation and analysis tools enabling to construct a tailored database for each gene discovery project. Gene refining and structuring tools enable to reliably detect splice variants and antisense transcripts, generating understanding of various potential phenotypic outcomes of a single gene. The capabilities of the LEADS platform of

2018271407 30 Nov 2018

Compugen LTD for analyzing human genome have been confirmed and accepted by the scientific community [see e.g., Widespread Antisense Transcription, Yelin, et al. (2003) Nature Biotechnology 21, 379-85; Splicing of Alu Sequences, Lev-Maor, et al. (2003) Science 300 (5623), 1288-91; “Computational analysis of alternative splicing using EST tissue information”, Xie H et al. Genomics 2002], and have been proven most efficient in plant genomics as well.

EST clustering and gene assembly - For gene clustering and assembly of organisms with available genome sequence data (arabidopsis, rice, castorbean, grape, brachypodium, poplar, soybean, sorghum) the genomic LEADS version (GANG) was employed. This tool allows most accurate clustering of ESTs and mRNA sequences on genome, and predicts gene structure as well as alternative splicing events and anti-sense transcription.

For organisms with no available full genome sequence data, expressed LEADS clustering software was applied.

Gene annotation - Predicted genes and proteins were annotated as follows:

Blast search [Hypertext Transfer Protocol://blast (dot) ncbi (dot) nlm (dot) nih (dot) gov /Blast (dot) cgi] against all plant UniProt [Hypertext Transfer Protocol://World Wide Web (dot) uniprot (dot) org/] sequences was performed. Open reading frames of each putative transcript were analyzed and longest ORF with higher number of homologues was selected as predicted protein of the transcript. The predicted proteins were analyzed by InterPro [Hypertext Transfer Protocol ://World Wide Web (dot) ebi (dot) ac (dot) uk/interpro/].

Blast against proteins from AraCyc and ENZYME databases was used to map the predicted transcripts to AraCyc pathways.

Predicted proteins from different species were compared using blast algorithm [Hypertext Transfer Protocol://World Wide Web (dot) ncbi (dot) nlm (dot) nih (dot) gov /Blast (dot) cgi] to validate the accuracy of the predicted protein sequence, and for efficient detection of ortho logs.

Gene expression profiling - Several data sources were exploited for gene expression profiling, namely microarray data and digital expression profile (see below). According to gene expression profile, a correlation analysis was performed to identify

2018271407 30 Nov 2018 genes which are co-regulated under different development stages and environmental conditions and associated with different phenotypes.

Publicly available microarray datasets were downloaded from TAIR and NCBI GEO sites, renormalized, and integrated into the database. Expression profiling is one of the most important resource data for identifying genes important for yield.

A digital expression profile summary was compiled for each cluster according to all keywords included in the sequence records comprising the cluster. Digital expression, also known as electronic Northern Blot, is a tool that displays virtual expression profile based on the EST sequences forming the gene cluster. The tool provides the expression profile of a cluster in terms of plant anatomy (e.g., the tissue/organ in which the gene is expressed), developmental stage (the developmental stages at which a gene can be found) and profile of treatment (provides the physiological conditions under which a gene is expressed such as drought, cold, pathogen infection, etc). Given a random distribution of ESTs in the different clusters, the digital expression provides a probability value that describes the probability of a cluster having a total of N ESTs to contain X ESTs from a certain collection of libraries. For the probability calculations, the following is taken into consideration: a) the number of ESTs in the cluster, b) the number of ESTs of the implicated and related libraries, c) the overall number of ESTs available representing the species. Thereby clusters with low probability values are highly enriched with ESTs from the group of libraries of interest indicating a specialized expression.

Recently, the accuracy of this system was demonstrated by Portnoy et al., 2009 (Analysis Of The Melon Fruit Transcriptome Based On 454 Pyrosequencing) in: Plant & Animal Genomes XVII Conference, San Diego, CA. Transcriptomic analysis, based on relative EST abundance in data was performed by 454 pyrosequencing of cDNA representing mRNA of the melon fruit. Fourteen double strand cDNA samples obtained from two genotypes, two fruit tissues (flesh and rind) and four developmental stages were sequenced. GS FLX pyrosequencing (Roche/454 Life Sciences) of nonnormalized and purified cDNA samples yielded 1,150,657 expressed sequence tags, that assembled into 67,477 unigenes (32,357 singletons and 35,120 contigs). Analysis of the data obtained against the Cucurbit Genomics Database [Hypertext Transfer Protocol://World Wide Web (dot) icugi (dot) org/] confirmed the accuracy of the

2018271407 30 Nov 2018 sequencing and assembly. Expression patterns of selected genes fitted well their qRTPCR data.

To further investigate and identify putative ortho logs of the yield, growth rate, vigor, biomass, growth rate, abiotic stress tolerance (ABST), nitrogen use efficiency (NUE) and fertilizer use efficiency (FUE) genes from other plant species, expression data was analyzed and the EST libraries were classified using a fixed vocabulary of custom terms such as developmental stages (e.g., genes showing similar expression profile through development with up regulation at specific stage, such as at the seed filling stage) and/or plant organ (e.g., genes showing similar expression profile across their organs with up regulation at specific organs such as seed). The annotations from all the ESTs clustered to a gene were analyzed statistically by comparing their frequency in the cluster versus their abundance in the database, allowing to construct a numeric and graphic expression profile of that gene, which is termed “digital expression”. The rationale of using these two complementary methods with methods of phenotypic association studies of QTLs, SNPs and phenotype expression correlation is based on the assumption that true orthologs are likely to retain identical function over evolutionary time. These methods provide different sets of indications on function similarities between two homologous genes, similarities in the sequence level - identical amino acids in the protein domains and similarity in expression profiles.

Overall, 239 genes were identified to have a major impact on plant yield, growth rate, vigor, biomass, growth rate, oil content, abiotic stress tolerance, nitrogen use efficiency, water use efficiency and fertilizer use efficiency when expression thereof is increased in plants. The identified genes, their curated polynucleotide and polypeptide sequences, as well as their updated sequences according to Genbank database are summarized in Table 1, hereinbelow.

Table 1

Identified genes for increasing yield, growth rate, vigor, biomass, growth rate, oil content, abiotic stress tolerance, nitrogen use efficiency, water use efficiency and fertilizer use efficiency of a plant

Gene Name	Cluster Name	Organism	Polynucleotide SEQ ID NO:	Polypeptide SEQ ID NO:
LYM1	rice|gbl57.2|AU058137	rice	1	240
LYM2	rice|gb!57.2|AA750140	rice	2	241

2018271407 30 Nov 2018

Gene Name	Cluster Name	Organism	Polynucleotide SEQ ID NO:	Polypeptide SEQ ID NO:
LYM3	rice|gbl57.2|AU032158	rice	3	242
LYM4	rice|gbl57.2 |AU082697	rice	4	243
LYM5	rice|gbl57.2|AW155107	rice	5	244
LYM6	rice|gbl57.2|AW155114	rice	6	245
LYM7	rice|gbl57.2|BE039635	rice	7	246
LYM8	rice|gbl57.2|BE040233	rice	8	247
LYM9	rice|gbl57.2|BE040806	rice	9	248
LYM10	rice|gbl57.2|BE230434	rice	10	249
LYM12	rice|gbl 57.2|BI807331	rice	11	250
LYM13	rice|gbl57.2|BM037844	rice	12	251
LYM14	rice|gbl57.2|BM038118	rice	13	252
LYM15	rice|gbl57.2|CA761603	rice	14	253
LYM16	rice|gbl57.2|U38074	rice	15	254
LYM17	rice|gbl57.2|AU033038	rice	16	255
LYM19	rice|gbl57.2|BE040457	rice	17	256
LYM20	rice|gbl57.2|BF430570	rice	18	257
LYM21	rice|gbl57.2|BI805660	rice	19	258
LYM22	rice|gbl57.2|BI808357	rice	20	259
LYM23	ricegbl57.2 AA749984	rice	21	260
LYM24	rice|gbl57.2|AF050674	rice	22	261
LYM26	barley|gbl57.3|AJ431915	barley	23	262
LYM30	rice|gbl57.2|AK100743	rice	24	263
LYM31	rice|gbl57.2|AK101734	rice	25	264
LYM32	rice|gbl57.2|AK106380	rice	26	265
LYM34	ricegbl57.2 AK107902	rice	27	266
LYM35	rice|gbl57.2|AK107934	rice	28	267
LYM36	rice|gbl57.2|AK108674	rice	29	268
LYM37	ricegbl57.2 AK111353	rice	30	269
LYM38	barley|gbl57.3|AL508889	barley	31	270
LYM40	rice|gbl57.2|AU082329	rice	32	271
LYM41	rice|gbl57.2|AU096202	rice	33	272
LYM42	ricegbl57.2 AU097348	rice	34	273
LYM43	ricegbl57.2 AU101198	rice	35	274
LYM44	ricegbl57.2 AU172519	rice	36	275
LYM49	maize|gbl64|AW331061	maize	37
LYM51	barley|gbl57.3|BE412472	barley	38	276
LYM52	barley|gbl57.3|BE422132	barley	39	277
LYM53	maize|gbl64|BE511332	maize	40	278
LYM56	barley|gbl57.3|BF625411	barley	41	279
LYM57	rice|gbl57.2|BI809626	rice	42	280
LYM59	barley gbl57.3 BI952737	barley	43
LYM61	maize|gbl64|BM079029	maize	44	281
LYM62	maize|gbl64|BM348041	maize	45	282

2018271407 30 Nov 2018

Gene Name	Cluster Name	Organism	Polynucleotide SEQ ID NO:	Polypeptide SEQ ID NO:
LYM66	barley gbl57.3 BU974981	barley	46	283
LYM67	rice gbl57.2 CA763759	rice	47	284
LYM68	rice gbl57.2 CA767240	rice	48	285
LYM69	rice gbl57.2 CA997856	rice	49	286
LYM73	rice|gbl57.2|CB683204	rice	50	287
LYM74	maize|gbl64|CF075309	maize	51	288
LYM79	maize|gbl64|AW191191	maize	52	289
LYM82	barley gbl57.3 AL507706	barley	53	290
LYM83	barley|gbl57.3|BI952401	barley	54	291
LYM84	barley|gbl57.3|BF622069	barley	55	292
LYM86	rice|gbl57.2|AU031857	rice	56	293
LYM88	arabidopsis gb 165 AT2G3 775 0	arabidopsis	57	294
LYM89	arabidopsis gbl 65 AT5G6749 0	arabidopsis	58	295
LYM90	barley gbl57.3 AV927104	barley	59	296
LYM91	barley|gbl57.3|BE060518	barley	60	297
LYM93	barley gbl57.3 BI955752	barley	61	298
LYM99	barley gbl57.3 BI947870	barley	62	299
LYM95	barley gbl57.3 BI959932	barley	63	300
LYM100	barley|gbl57.3|AV912944	barley	64	301
LYM102	rice|gbl57.2|CA760613	rice	65	302
LYM103	maize|gbl64|CD963970	maize	66	303
LYM105	barley gbl57.3 AL507901	barley	67	304
LYM106	barley|gbl57.3|BI954225	barley	68	305
LYM110	maize|gbl64|BE552618	maize	69	306
LYM111	maize|gbl64|AW053159	maize	70	307
LYM119	maize|gbl64|AW498426	maize	71	308
LYM120	rice gbl57.3 BI795677	rice	72	309
LYM122	rice|gbl 57.3 |BI118816	rice	73	310
LYM125	rice|gbl57.2|AK108452	rice	74	311
LYM126	rice|gbl57.2|AK108969	rice	75	312
LYM127	ricegbl57.2 AU172589	rice	76	313
LYM128	ricegbl57.2 AU172667	rice	77	314
LYM129	rice|gbl57.3|BE230206	rice	78	315
LYM130	rice|gbl57.3|BF430580	rice	79	316
LYM131	rice gbl57.3 CF309827	rice	80	317
LYM132	rice|gbl57.3|BE229876	rice	81	318
LYM134	rice|gbl57.2|BI809462	rice	82	319
LYM136	rice|gbl57.2|AU093861	rice	83	320
LYM137	barley gbl57.3 AL501911	barley	84	321
LYM140	barley|gbl57.3|BF623993	barley	85	322
LYM141	rice gbl57.2 CA761074	rice	86	323
LYM142	barley|gbl57.3|CB866504	barley	87	324

2018271407 30 Nov 2018

Gene Name	Cluster Name	Organism	Polynucleotide SEQ ID NO:	Polypeptide SEQ ID NO:
LYM143	rice|gbl57.3|BI306405	rice	88	325
LYM144	rice|gbl57.2|BM420331	rice	89	326
LYM145	rice gbl57.2AK073109	rice	90	327
LYM148	barley|gbl57.3|AL500574	barley	91	328
LYM149	barley gbl57.3 AL509762	barley	92	329
LYM152	arabidopsis gbl65AT5G5729 0	arabidopsis	93	330
LYM153	rice|gbl57.3|AU066244	rice	94	331
LYM156	barley|gbl57.3|BE421631	barley	95	332
LYM157	barley|gbl57.3|BE454937	barley	96	333
LYM159	barley|gbl57.3|BF259387	barley	97	334
LYM160	barley gbl57.3 BG300909	barley	98	335
LYM161	barley|gbl57.3|BG344928	barley	99	336
LYM162	maize|gbl64|BG462213	maize	100	337
LYM164	rice|gbl57.3|BI805693	rice	101	338
LYM165	maize|gbl64|CD439546	maize	102	339
LYM166	wheatgbl64 CJ547519	wheat	103	340
LYM170	rice|gbl57.2|AU057403	rice	104	341
LYM172	rice|gbl57.2|BE229411	rice	105	342
LYM173	rice|gbl57.3|AA751564	rice	106	343
LYM174	sorghum gbl61.crpAW28430 3	sorghum	107	344
LYM175	rice|gbl57.2|AK060073	rice	108	345
LYM176	rice|gbl57.2|BI305434	rice	109	346
LYM178	barley|gbl57.3|BE421520	barley	110	347
LYM179	maize|gbl64|BE051631	maize	111	348
LYM107	maize|gbl64|AW497895	maize	112	349
LYM109	maize|gbl69.2|CD984002	maize	113	350
LYM112	maize|gbl64|CF038223	maize	114	351
LYM113	maize|gbl64|AW257902	maize	115	352
LYM115	maize|gbl64|CF646135	maize	116	353
LYM116	maize|gbl64|AI964572	maize	117	354
LYM117	maize|gbl64|AI739834	maize	118	355
LYM118	maize|gbl64|CO518843	maize	119	356
LYM121	rice|gbl57.2|AK103124	rice	120	357
LYM123	rice|gbl57.2|AI978352	rice	121	358
LYM135	rice|gbl57.2|AU101278	rice	122	359
LYM138	rice|gbl57.2|BI805497	rice	123	360
LYM146	maize|gbl64|AI770878	maize	124	361
LYM147	maize|gbl64|AI901828	maize	125	362
LYM154	barley|gbl57.3|AV836282	barley	126	363
LYM155	barley|gbl57.3|BE412535	barley	127	364
LYM180	barley|gbl57.3|AJ476822	barley	128	365
LYM181	barley|gbl57.3|AL450622	barley	129	366

2018271407 30 Nov 2018

Gene Name	Cluster Name	Organism	Polynucleotide SEQ ID NO:	Polypeptide SEQ ID NO:
LYM182	barley|gbl57.3|AL507048	barley	130	367
LYM184	barley|gbl57.3|AV833284	barley	131	368
LYM185	barley gbl57.3 AV833969	barley	132	369
LYM186	barley gbl57.3 AV834971	barley	133	370
LYM188	barley|gbl57.3|BE438660	barley	134	371
LYM189	barley|gbl57.3|BF256192	barley	135	372
LYM192	barley|gbl57.3|BF627356	barley	136	373
LYM193	barley|gbl57.3|CB858276	barley	137	374
LYM194	barley gbl57.3 CB860975	barley	138	375
LYM196	maize|gbl64|AI372352	maize	139	376
LYM197	maize|gbl64|AI444704	maize	140	377
LYM198	maize|gbl64|AI491323	maize	141	378
LYM201	maize|gbl64|AI600670	maize	142	379
LYM203	maize|gbl64|AI629486	maize	143	380
LYM204	maize|gbl64|AI649791	maize	144	381
LYM206	maize |gb 1641AI691210	maize	145	382
LYM207	maize|gbl64|AI920398	maize	146	383
LYM208	maize |gb 1641AI941717	maize	147	384
LYM212	maize|gbl64|AW000408	maize	148	385
LYM213	maize|gbl64|AW000438	maize	149	386
LYM215	maize|gbl64|AW498464	maize	150	387
LYM217	maize|gbl64|BE129928	maize	151	388
LYM219	maize|gbl64|BE238495	maize	152	389
LYM220	maize|gbl64|BG842756	maize	153	390
LYM221	maize|gbl64|BI502603	maize	154	391
LYM223	maize|gbl64|BM338985	maize	155	392
LYM224	maize|gbl64|CA401086	maize	156	393
LYM227	maize|gbl64|EC877515	maize	157	394
LYM228	maize|gbl64|EC892599	maize	158	395
LYM232	rice|gbl57.3|AA750121	rice	159	396
LYM233	rice|gbl57.3|AA750182	rice	160	397
LYM234	rice|gbl57.3|AA752388	rice	161	398
LYM236	rice|gbl57.3|AF155334	rice	162	399
LYM238	rice|gbl57.3|AK066551	rice	163	400
LYM239	rice|gbl57.3|AU068651	rice	164	401
LYM240	rice|gbl57.3|AU069131	rice	165	402
LYM241	rice gbl57.3 AU162998	rice	166	403
LYM242	rice gbl57.3 BE039711	rice	167	404
LYM243	rice|gbl57.3|BE228686	rice	168	405
LYM245	rice|gbl57.3|BF430828	rice	169	406
LYM248	rice|gbl57.3|BQ906571	rice	170	407
LYM249	rice gbl57.3 C25903	rice	171	408
LYM250	rice gbl57.3 CA759158	rice	172	409

2018271407 30 Nov 2018

Gene Name	Cluster Name	Organism	Polynucleotide SEQIDNO:	Polypeptide SEQ ID NO:
LYM251	rice gbl57.3 CA759241	rice	173	410
LYM252	rice gbl57.3 CA759659	rice	174	411
LYM254	rice gbl57.3 CB657978	rice	175	412
LYM255	rice|gbl57.3|CF330913	rice	176	413
LYM260	rice|gbl57.3|CI581223	rice	177	414
LYM261	rice|gbl57.3|D41406	rice	178	415
LYM263	sorghum|gb 161 ,crp| AI622410	sorghum	179	416
LYM183	barley gbl57.3 AL509795	barley	180	417
LYM256	rice gbl57.3 CI004090	rice	181	418
LYM200	maize|gbl64|AI5 86731	maize	182	419
LYM267	maize|gbl64|AW231521	maize	183	420
LYM268	rice|gbl57.2|BI800054	rice	184	421
LYM270	maize|gbl64|AI670268	maize	185	422
LYM271	maize|gbl64|CF637107	maize	186	423
LYM272	rice|gbl57.2|CA761620	rice	187	424
LYM273	rice|gbl57.2|BM418692	rice	188	425
LYM274	rice|gbl57.2|AK073201	rice	189	426
LYM277	rice|gbl57.2|BM038097	rice	190	427
LYM278	barley|gbl57.3|BLYTRAA	barley	191	428
LYM283	rice|gbl57.2|D23167	rice	192	429
LYM284	rice|gbl57.2|BI306331	rice	193	430
LYM285	rice|gbl57.2|CB631346	rice	194	431
LYM287	rice|gbl57.2|AK102063	rice	195	432
LYM288	rice|gbl57.2|BE040927	rice	196	433
LYM289	barley gbl57.3 AV925962	barley	197	434
LYM290	maize|gbl64|AA979729	maize	198	435
LYM291	rice gbl57.2 BM037976	rice	199	436
LYM293	rice|gbl57.2|AK059161	rice	200	437
LYM38	barley|gbl57.3|AL508889	barley	201	438
LYM42	ricegbl57.2 AU097348	rice	202	439
LYM51	barley|gbl57.3|BE412472	barley	203	276
LYM52	barley|gbl57.3|BE422132	barley	204	277
LYM56	barley|gbl57.3|BF625411	barley	205	279
LYM59	barley gbl57.3 BI952737	barley	206
LYM66	barley gbl57.3 BU974981	barley	207	440
LYM79	maize|gbl64|AW191191	maize	208	441
LYM83	barley|gbl57.3|BI952401	barley	209	442
LYM90	barley gbl57.3 AV927104	barley	210	296
LYM99	barley gbl57.3 BI947870	barley	211	299
LYM95	barley gbl57.3 BI959932	barley	212	443
LYM148	barley|gbl57.3|AL500574	barley	213	328
LYM159	barley|gbl57.3|BF259387	barley	214	334
LYM161	barley|gbl57.3|BG344928	barley	215	444

2018271407 30 Nov 2018

Gene Name	Cluster Name	Organism	Polynucleotide SEQIDNO:	Polypeptide SEQ ID NO:
LYM166	wheatgbl64 CJ547519	wheat	216	445
LYM175	rice|gbl57.2|AK060073	rice	217	446
LYM109	maize|gbl64|CD984002	maize	218	447
LYM112	maize|gbl64|CF038223	maize	219	448
LYM116	maize|gbl64|AI964572	maize	220	354
LYM117	maize|gbl64|AI739834	maize	221	449
LYM154	barley|gbl57.3|AV836282	barley	222	450
LYM155	barley|gbl57.3|BE412535	barley	223	451
LYM180	barley|gbl57.3|AJ476822	barley	224	452
LYM181	barley|gbl57.3|AL450622	barley	225	453
LYM184	barley|gbl57.3|AV833284	barley	226	454
LYM185	barley gbl57.3 AV833969	barley	227	455
LYM186	barley gbl57.3 AV834971	barley	228	370
LYM188	barley|gbl57.3|BE438660	barley	229	456
LYM189	barley|gbl57.3|BF256192	barley	230	457
LYM192	barley|gbl57.3|BF627356	barley	231	458
LYM193	barley|gbl57.3|CB858276	barley	232	459
LYM194	barley gbl57.3 CB860975	barley	233	460
LYM219	maize|gbl64|BE238495	maize	234	389
LYM221	maize|gbl64|BI502603	maize	235	461
LYM228	maize|gbl64|EC892599	maize	236	462
LYM250	rice gbl57.3 CA759158	rice	237	463
LYM183	barley gbl57.3 AL509795	barley	238	464
LYM272	rice|gbl57.2|CA761620	rice	239	465

Table 1: Provided are the identified genes, their annotation, organism and polynucleotide and polypeptide sequence identifiers.

EXAMPLE 2

IDENTIFICATION OF HOMOLOGOUS SEQUENCES THAT INCREASE YIELD, FIBER YIELD, FIBER QUALITY, GROWTH RATE, BIOMASS, OIL CONTENT, VIGOR, ABST, AND/OR NUE OF A PLANT

The concepts of orthology and paralogy have recently been applied to functional characterizations and classifications on the scale of whole-genome comparisons.

Ortho logs and paralogs constitute two major types of homologs: The first evolved from a common ancestor by specialization, and the latter are related by duplication events. It is assumed that paralogs arising from ancient duplication events are likely to have diverged in function while true orthologs are more likely to retain identical function over evolutionary time.

2018271407 30 Nov 2018

To identify putative orthologs of the genes affecting plant yield, oil yield, oil content, seed yield, growth rate, vigor, biomass, abiotic stress tolerance and/or nitrogen use efficiency, all sequences were aligned using the BLAST (Basic Local Alignment Search Toot). Sequences sufficiently similar were tentatively grouped. These putative orthologs were further organized under a Phylogram - a branching diagram (tree) assumed to be a representation of the evolutionary relationships among the biological taxa. Putative ortholog groups were analyzed as to their agreement with the phylogram and in cases of disagreements these ortholog groups were broken accordingly.

Expression data was analyzed and the EST libraries were classified using a fixed vocabulary of custom terms such as developmental stages (e.g., genes showing similar expression profile through development with up regulation at specific stage, such as at the seed filling stage) and/or plant organ (e.g., genes showing similar expression profile across their organs with up regulation at specific organs such as seed). The annotations from all the ESTs clustered to a gene were analyzed statistically by comparing their frequency in the cluster versus their abundance in the database, allowing the construction of a numeric and graphic expression profile of that gene, which is termed “digital expression”. The rationale of using these two complementary methods with methods of phenotypic association studies of QTLs, SNPs and phenotype expression correlation is based on the assumption that true orthologs are likely to retain identical function over evolutionary time. These methods provide different sets of indications on function similarities between two homologous genes, similarities in the sequence level identical amino acids in the protein domains and similarity in expression profiles.

The search and identification of homologous genes involves the screening of sequence information available, for example, in public databases such as the DNA Database of Japan (DDBJ), Genbank, and the European Molecular Biology Laboratory Nucleic Acid Sequence Database (EMBL) or versions thereof or the MIPS database. A number of different search algorithms have been developed, including but not limited to the suite of programs referred to as BLAST programs. There are five implementations of BLAST, three designed for nucleotide sequence queries (BLASTN, BLASTX, and TBLASTX) and two designed for protein sequence queries (BLASTP and TBLASTN) (Coulson, Trends in Biotechnology: 76-80, 1994; Birren et al., Genome Analysis, I: 543, 1997). Such methods involve alignment and comparison of sequences. The

2018271407 30 Nov 2018

BLAST algorithm calculates percent sequence identity and performs a statistical analysis of the similarity between the two sequences. The software for performing BLAST analysis is publicly available through the National Centre for Biotechnology Information. Other such software or algorithms are GAP, BESTLIT, EASTA and TFASTA. GAP uses the algorithm of Needleman and Wunsch (J. Mol. Biol. 48: 443453, 1970) to find the alignment of two complete sequences that maximizes the number of matches and minimizes the number of gaps.

The homologous genes may belong to the same gene family. The analysis of a gene family may be carried out using sequence similarity analysis. To perform this analysis one may use standard programs for multiple alignments e.g. Clustal W. A neighbour-joining tree of the proteins homologous to the genes in this invention may be used to provide an overview of structural and ancestral relationships. Sequence identity may be calculated using an alignment program as described above. It is expected that other plants will carry a similar functional gene (ortholog) or a family of similar genes and those genes will provide the same preferred phenotype as the genes presented here. Advantageously, these family members may be useful in the methods of the invention. Example of other plants are included here but not limited to, barley (Hordeum vulgare), Arabidopsis (Arabidopsis thaliana), maize (Zea mays), cotton (Gossypium), Oilseed rape (Brassica napus), Rice (Oryza sativa), Sugar cane (Saccharum officinarum), Sorghum (Sorghum bicolor), Soybean (Glycine max), Sunflower (Helianthus annuus), Tomato (Lycopersicon esculentum), Wheat (Triticum aestivum).

The above-mentioned analyses for sequence homology can be carried out on a full-length sequence, but may also be based on a comparison of certain regions such as conserved domains. The identification of such domains, would also be well within the realm of the person skilled in the art and would involve, for example, a computer readable format of the nucleic acids of the present invention, the use of alignment software programs and the use of publicly available information on protein domains, conserved motifs and boxes. This information is available in the PRODOM (Hypertext Transfer Protocol://World Wide Web (dot) biochem (dot) ucl (dot) ac (dot) uk/bsm/dbbrowser/protocol/prodomqry (dot) html), PIR (Hypertext Transfer Protocol ://pir (dot) Georgetown (dot) edu/) or Pfam (Hypertext Transfer Protocol://World Wide Web (dot) sanger (dot) ac (dot) uk/Software/Pfam/) database.

2018271407 30 Nov 2018

Sequence analysis programs designed for motif searching may be used for identification of fragments, regions and conserved domains as mentioned above. Preferred computer programs include, but are not limited to, MEME, SIGNALSCAN, and GENESCAN.

A person skilled in the art may use the homologous sequences provided herein to find similar sequences in other species and other organisms. Homologues of a protein encompass, peptides, oligopeptides, polypeptides, proteins and enzymes having amino acid substitutions, deletions and/or insertions relative to the unmodified protein in question and having similar biological and functional activity as the unmodified protein from which they are derived. To produce such homologues, amino acids of the protein may be replaced by other amino acids having similar properties (conservative changes, such as similar hydrophobicity, hydrophilicity, antigenicity, propensity to form or break a-helical structures or 3-sheet structures). Conservative substitution tables are well known in the art (see for example Creighton (1984) Proteins. W.H. Freeman and Company). Homologues of a nucleic acid encompass nucleic acids having nucleotide substitutions, deletions and/or insertions relative to the unmodified nucleic acid in question and having similar biological and functional activity as the unmodified nucleic acid from which they are derived.

Table 2, hereinbelow, lists a summary of orthologous and homologous sequences of the polynucleotide sequences (SEQ ID NOs: 1-239) and polypeptide sequences (SEQ ID NOs:240-465) presented in Table 1 above, which were identified from the databases using the NCBI BLAST software (e.g., using the Blastp and tBlastn algorithms) and needle (EMBOSS package) as being at least 80% homologous to the selected polynucleotides and polypeptides, and which are expected to increase plant yield, seed yield, oil yield, oil content, growth rate, fiber yield, fiber quality, biomass, vigor, ABST and/or NUE of a plant.

Table 2

Homologues of the identified genes/polypeptides for increasing yield, fiber yield, fiber quality, growth rate, vigor, biomass, growth rate, abiotic stress tolerance, nitrogen use efficiency, water use efficiency and fertilizer use efficiency of a plant

Nucl. SEQ ID NO:	Gene Name	cluster name	Polyp. SEQ ID NO:	Homolog, to SEQ ID NO:	% global identity	Algor.
467	LYM2 H5	brachypodium 09vl D V480246	1974	241	89.1	blastp

2018271407 30 Nov 2018

Nucl. SEQ ID NO:	Gene Name	cluster name	Polyp. SEQ ID NO:	Homolog, to SEQ ID NO:	% global identity	Algor.
468	LYM2 H6	maize|gbl70|AW2249 18	1975	241	86.6	blastp
469	LYM2 H7	millet 09vlEVO454P M002089	1976	241	87.6	blastp
470	LYM2 H8	sorghum 09vlSB07G 004285	1977	241	86.6	blastp
471	LYM2 H4	switchgrass gb 167 FE6 06998	1978	241	89.9	blastp
472	LYM2 H5	wheat|gbl64|BM1368 11	1979	241	80.53	tblastn
473	LYM4 H6	barley gbl 57SOLEXA IBE438934	1980	243	81.5	blastp
474	LYM4 H7	brachypodium 09vl D V469575	1981	243	81.5	blastp
475	LYM4 H2	cenchrus|gbl66|BM08 4020	1982	243	83	blastp
476	LYM4 H8	maize|gbl70|AI60099 4	1983	243	82.2	blastp
477	LYM4 H9	maize|gbl70|AW0544 78	1984	243	82.4	blastp
478	LYM4H10	rice gbl70 QS05G139 50	1985	243	94.7	blastp
479	LYM4H11	sorghum 09vl SB03G 000920	1986	243	83.2	blastp
480	LYM4 H5	switchgrass gb 167 FL7 03533	1987	243	83	blastp
481	LYM4 H6	wheat|gbl64|BE44499 1	1988	243	81.3	blastp
482	LYM5 Hl6	barley gbl 57SOLEXA IBI953887	1989	244	90.9	blastp
483	LYM5 Hl7	brachypodium 09vl D V474010	1990	244	91.3	blastp
484	LYM5 H3	cenchrus|gbl66|EB655 978	1991	244	88.19	tblastn
485	LYM5 H4	fescue gbl61DT6881 32	1992	244	85.8	blastp
486	LYM5 H5	leymus gbl66 EG3949 68	1993	244	90.9	blastp
487	LYM5H18	maize|gbl70|AI78329 0	1994	244	92.1	blastp
488	LYM5 H19	maize|gbl70|BG26515 8	1995	244	92.5	blastp
489	LYM5 H20	rice gbl70 QS02G466 60	1996	244	87.8	blastp
490	LYM5 H21	sorghum 09vl SB04G 031180	1997	244	80.3	blastp
491	LYM5 H22	sorghum 09v 1 SB06G 027060	1998	244	90.9	blastp
492	LYM5 H23	sugarcane gbl57.3 CA 118359	1999	244	91.7	blastp
493	LYM5 H12	switchgrass gbl 67 FE6 41223	2000	244	93.3	blastp
494	LYM5 Hl3	switchgrass gbl 67 FL7 08642	2001	244	92.5	blastp

2018271407 30 Nov 2018

Nucl. SEQ ID NO:	Gene Name	cluster name	Polyp. SEQ ID NO:	Homolog, to SEQ ID NO:	% global identity	Algor.
495	LYM5 H14	wheat|gbl64|BE41473 3	2002	244	90.6	blastp
496	LYM5 Hl5	wheat|gbl64|BE43102 6	2003	244	91.3	blastp
497	LYM5 Hl6	wheat|gbl64|CA61338 0	2004	244	90.9	blastp
498	LYM7 H35	b oleracea|gbl61|AM05 7184	2005	246	81.2	blastp
499	LYM7 H36	barley gbl57SOLEXA IBE413128	2006	246	82.6	blastp
500	LYM7 H37	barley gbl57SOLEXA |BF627706	2007	246	95.7	blastp
501	LYM7 H38	brachypodium 09vl D V468966	2008	246	94.2	blastp
502	LYM7 H39	brachypodium 09vl D V474806	2009	246	82.6	blastp
503	LYM7 H6	bruguiera gb 166 BP94 5554	2010	246	81.2	blastp
504	LYM7 H40	canola|gbl61|CD8116 53	2011	246	81.2	blastp
505	LYM7 H41	canola|gbl61|CD8384 23	2012	246	81.2	blastp
506	LYM7 H42	cassava|09vl|CK6523 48	2013	246	82.6	blastp
507	LYM7 H43	castorbean 09vl XMO 02532394	2014	246	82.6	blastp
508	LYM7 H44	cucumber 09vl AM71 7859	2015	246	82.6	blastp
509	LYM7 H9	eucalyptus gb 166 CB9 67858	2016	246	81.2	blastp
510	LYM7H10	kiwi|gbl66|FG431017	2017	246	81.2	blastp
511	LYM7H11	kiwi|gbl66|FG521634	2018	246	82.6	blastp
512	LYM7 H12	liriodendron| gb 16 61F D 494835	2019	246	82.6	blastp
513	LYM7 H45	maize|gbl70|AI94390 8	2020	246	82.6	blastp
514	LYM7 H46	maize|gbl70|AW2822 44	2021	246	88.4	blastp
515	LYM7 H47	maize|gbl70|LLAI855 232	2022	246	82.61	tblastn
516	LYM7 H48	maize|gbl70|LLDN20 9190	2023	246	82.61	tblastn
517	LYM7 H49	millet 09vlEVO454P M003641	2024	246	91.3	blastp
518	LYM7 H50	millet 09vlEVO454P M019125	2025	246	81.2	blastp
519	LYM7H16	oat|gbl64|CN817490	2026	246	88.4	blastp
520	LYM7H17	oat|gbl64|CN819643	2027	246	82.6	blastp
521	LYM7 H51	poplar|gb 170|BI06944 6	2028	246	81.2	blastp
522	LYD97 H18	poplar|gbl70|BI12366 2	2029	246	81.2	blastp

2018271407 30 Nov 2018

Nucl. SEQ ID NO:	Gene Name	cluster name	Polyp. SEQ ID NO:	Homolog, to SEQ ID NO:	% global identity	Algor.
523	LYM7 H20	rye|gbl64|BE496021	2030	246	94.2	blastp
524	LYM7 H21	rye|gbl64|BE587226	2031	246	81.2	blastp
525	LYM7 H52	sorghum 09vl SB05G 003875	2032	246	88.4	blastp
526	LYM7 H53	sugarcane gbl57.3 CA 079082	2033	246	89.9	blastp
527	LYM7 H54	sugarcane gbl57.3 CA 158782	2034	246	81.2	blastp
528	LYM7 H25	switchgrass gb167 DN 149707	2035	246	82.6	blastp
529	LYM7 H26	switchgrass gb 167 FE6 44021	2036	246	84.1	blastp
530	LYM7 H27	switchgrass gbl 67 FE6 57215	2037	246	80	blastp
531	LYM7 H28	switchgrass gbl 67 FE6 58413	2038	246	88.4	blastp
532	LYM7 H29	switchgrass gbl 67 FL6 89692	2039	246	88.4	blastp
533	LYM7 H30	wheat|gbl64|BE40435 0	2040	246	81.2	blastp
534	LYM7 H31	wheat|gbl64|BE41437 1	2041	246	84.1	blastp
535	LYM7 H32	wheat|gbl64|BE43001 7	2042	246	94.2	blastp
536	LYM7 H33	wheat|gbl64|BE44405 8	2043	246	95.7	blastp
537	LYM7 H34	wheat|gbl64|BE44478 9	2044	246	82.6	blastp
538	LYM7 H35	wheat|gbl64|CA59836 3	2045	246	95.7	blastp
539	LYM8 H7	arabidopsis lyrata|09vl|JGIAL008 627	2046	247	80.2	blastp
540	LYM8 H8	arabidopsis lyrata|09vl|JGIAL021 400	2047	247	83.3	blastp
541	LYM8 Hl	arabidopsis gb 165 AT 3G03110	2048	247	80.6	blastp
542	LYM8 H2	arabidopsis gb 165 AT 5G17020	2049	247	82.9	blastp
543	LYM8 H9	brachypodium 09vl G T774368	2050	247	95.6	blastp
544	LYM8H10	castorbean|09vl |EE25 5045	2051	247	84.2	blastp
545	LYM8H11	che stnut gb 17 0 S RR0 0 6295S0059698	2052	247	85.7	blastp
546	LYM8 H12	cucumber 09v 1 GD17 4631	2053	247	84.5	blastp
547	LYM8H13	lotus|09vl|BP043858	2054	247	83.8	blastp
548	LYM8 H14	lotus 09vlBP071708	2055	247	83.6	blastp
549	LYM8H15	maize|gbl70|AA03070 9	2056	247	92.1	blastp

2018271407 30 Nov 2018

Nucl. SEQ ID NO:	Gene Name	cluster name	Polyp. SEQ ID NO:	Homolog, to SEQ ID NO:	% global identity	Algor.
550	LYM8H16	maize|gbl70|AI62152 2	2057	247	92.2	blastp
551	LYM8H17	medicago 09vlBE205 102	2058	247	83.5	blastp
552	LYM8H18	medicago 09v 1 BM7 7 9128	2059	247	83.9	blastp
553	LYM8 H19	poplar|gbl70|BI12744 4	2060	247	84.8	blastp
554	LYM8 H20	poplar gb 170 BU83 79 11	2061	247	85	blastp
555	LYM8 H21	rice gb 170 OS03G640 80	2062	247	99.72	tblastn
556	LYM8 H22	solanum phureja|09vl|SPHBGl 28228	2063	247	83.2	blastp
557	LYM8 H23	sorghum 09v 1 SBO1G 000490	2064	247	93.9	blastp
558	LYM8 H24	sorghum|09vl|SB02G 009800	2065	247	89	blastp
559	LYM8 H6	soybean|gbl68|BE205 102	2066	247	82.98	tblastn
560	LYM8 H7	soybean|gbl68|BE823 809	2067	247	81.6	blastp
561	LYM8 H25	tomato|09vl|BG12822 8	2068	247	83.33	tblastn
562	LYM9 HO	lolium|09vl|AU24559 9	2069	248	80.1	blastp
563	LYM10H1	antirrhinum|gb 16 61AJ7 86992	2070	249	89.9	blastp
564	LYM10 H207	apple gbl 71 CN44392 9	2071	249	91.3	blastp
565	LYM10 H208	apple gbl 71 CN48976 3	2072	249	91.3	blastp
566	LYM10 H209	apple gbl71 CN87419 2	2073	249	87	blastp
567	LYM10 H210	arabidopsis lyrata|09vl|JGIAL017 989	2074	249	85.5	blastp
568	LYM10 H211	arabidopsis lyrata|09vl|JGIAL025 614	2075	249	91.3	blastp
569	LYM10 H212	arabidopsis lyrata|09vl|JGIAL029 470	2076	249	91.3	blastp
570	LYM10H7	arabidopsis gb 165 AT 3G48570	2077	249	85.5	blastp
571	LYM10H8	arabidopsis gb 165 AT 4G24920	2078	249	91.3	blastp
572	LYM10H9	arabidopsis gb 165 AT 5G50460	2079	249	91.3	blastp
573	LYM10 H10	artemisia gbl 64 EX98 0216	2080	249	88.4	blastp

2018271407 30 Nov 2018

Nucl. SEQ ID NO:	Gene Name	cluster name	Polyp. SEQ ID NO:	Homolog, to SEQ ID NO:	% global identity	Algor.
574	LYM10 Hll	b juncea gbl 64 EVGNO 0323614690486	2081	249	85.5	blastp
575	LYM10 H12	b juncea gbl 64 EVGNO 0357611620134	2082	249	81.16	tblastn
576	LYM10 H13	b juncea gbl 64 EVGNO 0407015981886	2083	249	91.3	blastp
577	LYM10 H14	b juncea gbl 64 EVGNO 1046711722157	2084	249	91.3	blastp
578	LYM10 H15	b juncea gbl 64 EVGNO 1350404310247	2085	249	91.3	tblastn
579	LYM10 H16	b juncea gbl 64 EVGNO 1826229072660	2086	249	91.3	blastp
580	LYM10 H17	b juncea gbl 64 EVGN1 0412810992898	2087	249	86.3	blastp
581	LYM10 H18	b juncea gbl 64 EVGN1 9578802581818	2088	249	81.2	blastp
582	LYM10 H19	b oleracea|gbl61|AM05 9639	2089	249	91.3	blastp
583	LYM10 H20	b oleracea|gb 161 |EH414 574	2090	249	91.3	blastp
584	LYM10 H21	b oleracea|gb 161 |EH427 198	2091	249	81.7	blastp
585	LYM10 H22	b rapa|gbl62|BG544908	2092	249	91.3	blastp
586	LYM10 H23	b rapa|gbl62|DY010003	2093	249	91.3	blastp
587	LYM10 H24	b rapa|gbl62|EE524434	2094	249	91.3	tblastn
588	LYM10 H25	b rapa|gbl62|L35825	2095	249	91.3	blastp
589	LYM10 H26	banana|gbl67|DN2397 48	2096	249	94.2	blastp
590	LYM10 H27	banana|gbl67|ES4325 17	2097	249	95.7	blastp
591	LYM10 H28	banana|gbl67|FL6497 89	2098	249	95.7	blastp
592	LYM10 H29	banana|gbl67|FL6581 61	2099	249	94.2	blastp
593	LYM10 H213	barley gbl 57SOLEXA |AJ433765	2100	249	100	blastp
594	LYM10 H214	barley gbl 57SOLEXA |BE412470	2101	249	100	blastp

2018271407 30 Nov 2018

Nucl. SEQ ID NO:	Gene Name	cluster name	Polyp. SEQ ID NO:	Homolog, to SEQ ID NO:	% global identity	Algor.
595	LYM10 H215	barley gbl57SOLEXA IBF254576	2102	249	98.6	blastp
596	LYM10 H216	barley gbl57SOLEXA IBF257015	2103	249	100	blastp
597	LYM10 H34	beangbl67 CA907476	2104	249	92.75	tblastn
598	LYM10 H35	beangbl67 CA907483	2105	249	94.2	blastp
599	LYM10 H217	beech gb 170 SRR0062 93S0011456	2106	249	92.8	blastp
600	LYM10 H218	beech gb 170 SRR0062 94S0008365	2107	249	88.4	blastp
601	LYM10 H219	brachypodium 09vl D V469126	2108	249	100	blastp
602	LYM10 H220	brachypodium 09vl G T803631	2109	249	92.8	blastp
603	LYM10 H38	bruguiera gb 166 BP94 1922	2110	249	95.7	blastp
604	LYM10 H39	bruguiera gb 166 BP94 4773	2111	249	95.7	blastp
605	LYM10 H40	cacao|gbl67|CU47152 9	2112	249	94.2	blastp
606	LYM10 H41	cacao|gbl67|CU48059 7	2113	249	84.1	blastp
607	LYM10 H42	cacao gbl67CU49329 8	2114	249	89.9	blastp
608	LYM10 H43	canola|gbl61|CD8132 31	2115	249	91.3	tblastn
609	LYM10 H44	canola|gbl61|CD8175 28	2116	249	91.3	tblastn
610	LYM10 H45	canola|gbl61|CD8200 75	2117	249	91.3	tblastn
611	LYM10 H46	canola|gbl61|CD8242 39	2118	249	91.3	tblastn
612	LYM10 H47	canola|gbl61|CD8380 62	2119	249	86.3	blastp
613	LYM10 H48	canola|gbl61|CD8408 08	2120	249	91.3	blastp
614	LYM10 H49	canola|gbl61|CN7324 34	2121	249	91.3	tblastn
615	LYM10 H50	canola|gbl61|DW9992 88	2122	249	91.3	blastp
616	LYM10 H51	canola|gbl61|EE43417 6	2123	249	84.1	blastp
617	LYM10 H52	canola|gb 161 |EE46403 6	2124	249	87	blastp
618	LYM10 H221	cassava|09vl|CK6422 25	2125	249	94.2	blastp
619	LYM10 H222	cassava 09vl DV4557 17	2126	249	94.2	blastp
620	LYM10 H223	cassava 09v 1 FF3 803 8 9	2127	249	94.2	blastp
621	LYM10 H224	castorbean|09vl |EG66 4279	2128	249	92.8	blastp

2018271407 30 Nov 2018

Nucl. SEQ ID NO:	Gene Name	cluster name	Polyp. SEQ ID NO:	Homolog, to SEQ ID NO:	% global identity	Algor.
622	LYM10 H225	castorbean 09vlXM0 02509459	2129	249	91.3	blastp
623	LYM10 H58	c atharanthus | gb 1661E G560643	2130	249	91.3	blastp
624	LYM10 H59	c atharanthus | gb 16 61FD 416462	2131	249	91.3	blastp
625	LYM10 H60	c atharanthus | gb 16 61 FD 420164	2132	249	92.8	blastp
626	LYM10 H61	centaurea|gbl66|EH74 7070	2133	249	87	blastp
627	LYM10 H62	centaurea|gbl66|EH78 8831	2134	249	89.9	blastp
628	LYM10 H226	chestnut gbl 70 SRRO0 6295S0002470	2135	249	95.7	blastp
629	LYM10 H227	chestnut gbl70 SRRO0 6295S0013318	2136	249	92.8	blastp
630	LYM10 H228	cichorium gb 171 FL67 3304	2137	249	85.51	tblasta
631	LYM10 H63	citrus|gbl66|CF41752 0	2138	249	91.3	blastp
632	LYM10 H64	coffeagbl57.2 DV666 460	2139	249	91.3	blastp
633	LYM10 H65	coffeagbl57.2 DV676 797	2140	249	89.86	tblasta
634	LYM10 H66	cotton gb 164 BE05219 8	2141	249	94.2	blastp
635	LYM10 H67	cotton gbl 64 BQ4048 33	2142	249	95.7	blastp
636	LYM10 H68	cotton|gbl64|BQ4074 07	2143	249	92.8	blastp
637	LYM10 H69	cotton gb 164 CK6405 93	2144	249	95.7	blastp
638	LYM10 H70	cotton gbl64DT05275 9	2145	249	88	blastp
639	LYM10 H71	cotton gbl64DT57406 1	2146	249	80.7	blastp
640	LYM10 H72	cowpea gb 166FF3865 43	2147	249	94.2	blastp
641	LYM10 H73	cowpea gb 166 FF3 893 57	2148	249	94.2	tblasta
642	LYM10 H74	cryptomeria|gb 1661 BP 174192	2149	249	89.9	blastp
643	LYM10 H75	cryptomeria|gb 1661 BP 174931	2150	249	88.6	blastp
644	LYM10 H229	cucumber 09vl AM71 5093	2151	249	88.41	tblasta
645	LYM10 H230	cucumber 09vl AM72 0495	2152	249	98.6	blastp
646	LYM10 H231	cucumber 09vl DN90 9507	2153	249	95.7	blastp
647	LYM10 H76	cycas gbl66 CB09149 9	2154	249	88.4	blastp
648	LYM10 H77	cynaragbl67 GE5892 84	2155	249	88.4	blastp

2018271407 30 Nov 2018

Nucl. SEQ ID NO:	Gene Name	cluster name	Polyp. SEQ ID NO:	Homolog, to SEQ ID NO:	% global identity	Algor.
649	LYM10 H78	dandelion gb 161 DY 8 11008	2156	249	88.41	tblastn
650	LYM10 H79	dandelion gb 161 DY 8 39599	2157	249	89.86	tblastn
651	LYM10 H80	eucalyptus gb 166 CD6 69252	2158	249	92.8	blastp
652	LYM10 H232	femgbl71 DK961389	2159	249	88.4	blastp
653	LYM10 H81	fescue gbl61DT7022 92	2160	249	100	tblastn
654	LYM10 H82	fescue gbl61DT7044 58	2161	249	100	tblastn
655	LYM10 H233	flax|09vl|EU829193	2162	249	92.8	blastp
656	LYM10 H234	gerbera|09vl|AJ76119 3	2163	249	89.9	blastp
657	LYM10 H235	gerbera|09v 11AJ76591 3	2164	249	84.1	blastp
658	LYM10 H83	ginger|gbl64|DY3684 24	2165	249	95.65	tblastn
659	LYM10 H84	ginger|gbl64|DY3821 25	2166	249	94.2	blastp
660	LYM10 H85	grape|gbl60|BQ79355 2	2167	249	91.3	blastp
661	LYM10 H86	grape|gbl60|CA80999 7	2168	249	91.3	blastp
662	LYM10 H87	iceplant|gbl64|AI9434 23	2169	249	88.4	blastp
663	LYM10 H88	ipomoea|gbl57.2|BJ55 3479	2170	249	89.86	tblastn
664	LYM10 H89	ipomoea gbl57.2 CB3 29955	2171	249	88.41	tblastn
665	LYM10 H90	ipomoea gbl 57.2 CJ75 1960	2172	249	88.4	blastp
666	LYM10 H236	jatropha|09vl |GO2476 49	2173	249	94.2	blastp
667	LYM10 H91	kiwigbl66 FG397070	2174	249	89.9	blastp
668	LYM10 H92	kiwi|gbl66|FG477805	2175	249	95.7	blastp
669	LYM10 H93	lettuce gbl57.2 DW04 7717	2176	249	88.4	blastp
670	LYM10 H94	lettuce gbl57.2 DW05 1281	2177	249	89.9	blastp
671	LYM10 H95	lettuce gbl57.2 DW08 0235	2178	249	82.61	tblastn
672	LYM10 H96	lettuce gbl57.2 DW10 1958	2179	249	88.4	blastp
673	LYM10 H97	lettuce gbl57.2 DW12 3456	2180	249	88.41	tblastn
674	LYM10 H237	liquorice|gbl71|FS242 287	2181	249	94.2	blastp
675	LYM10 H98	liriodendron| gb 16 61F D 495465	2182	249	95.7	blastp

2018271407 30 Nov 2018

Nucl. SEQ ID NO:	Gene Name	cluster name	Polyp. SEQ ID NO:	Homolog, to SEQ ID NO:	% global identity	Algor.
676	LYM10 H99	liriodendron| gb 16 61F D 500844	2183	249	94.2	blastp
677	LYM10 H238	lolium|09vl|AU24781 9	2184	249	98.6	blastp
678	LYM10 H239	lotus 09vl CB827059	2185	249	92.8	blastp
679	LYM10 H240	lotus|09vl|DN652280	2186	249	89.9	blastp
680	LYM10 H102	lovegrass gbl67DN48 2980	2187	249	98.6	blastp
681	LYM10 H241	maize|gbl70|AI00134 0	2188	249	97.1	blastp
682	LYM10 H242	maize|gbl70|AI66551 2	2189	249	98.6	blastp
683	LYM10 H243	maizegbl70 AI67719 5	2190	249	97.1	blastp
684	LYM10 H244	maize | gb 17 01LLAI619 401	2191	249	97.1	blastp
685	LYM10 H245	maize|gbl70|LLCF003 156	2192	249	81.16	tblastn
686	LYM10 H246	maize | gb 17 01LLDQ24 5943	2193	249	98.6	blastp
687	LYM10 H247	maize|gbl70|W21637	2194	249	98.6	blastp
688	LYM10 H109	marchantia|gbl 66|BJ8 44102	2195	249	87	blastp
689	LYM10 H248	medicago|09vl|AA660 461	2196	249	94.2	blastp
690	LYM10 H249	medicago 09vl AW28 7868	2197	249	94.2	blastp
691	LYM10 H250	medicago 09v 1 LLBQ 138650	2198	249	85.5	blastp
692	LYM10 H112	melon gbl 65 AM7150 93	2199	249	94.2	tblastn
693	LYM10 H113	melon gbl 65 AM7204 95	2200	249	98.55	tblastn
694	LYM10 H114	melon|gbl65|DV6317 10	2201	249	95.7	blastp
695	LYM10 H251	millet|09vl|CD724432	2202	249	98.6	blastp
696	LYM10 H252	monkeyflower|09vl |D V208117	2203	249	91.3	blastp
697	LYM10 H116	nuphar|gbl66|CD4725 02	2204	249	97.1	blastp
698	LYM10 H253	oak gbl70 SRR006307 S0013335	2205	249	94.2	blastp
699	LYM10 H254	oak gbl70 SRR006307 S0023745	2206	249	92.75	tblastn
700	LYM10 H117	oil palm|gbl66|EL684180	2207	249	92.8	blastp
701	LYM10 H118	onion gbl62 BQ58014 8	2208	249	97.1	blastp
702	LYM10 H119	papayagbl65 EX2792 51	2209	249	89.9	blastp

2018271407 30 Nov 2018

Nucl. SEQ ID NO:	Gene Name	cluster name	Polyp. SEQ ID NO:	Homolog, to SEQ ID NO:	% global identity	Algor.
703	LYM10 H255	peanut|gbl71|EE1245 30	2210	249	94.2	blastp
704	LYM10 H256	peanut|gbl71|EE1266 80	2211	249	94.2	blastp
705	LYM10 H257	peanut|gbl 71 |EG0288 25	2212	249	81.2	blastp
706	LYM10 H258	peanutgbl71 EG3739 93	2213	249	94.2	blastp
707	LYM10 H259	pepper gb 171 CA5166 79	2214	249	91.3	blastp
708	LYM10 H260	pepper gbl71GD0537 70	2215	249	89.9	blastp
709	LYM10 H261	petunia gbl71 AF0499 33	2216	249	87	blastp
710	LYM10 H262	petunia gbl71 EB1743 81	2217	249	87	blastp
711	LYM10 H263	physcomitrella| 1 Ον 11A W145358	2218	249	81.2	blastp
712	LYM10 H264	physcomitrella| 1 Ον 1 |B G361572	2219	249	81.2	blastp
713	LYM10 H133	pine|gbl57.2|AL75081 3	2220	249	91.3	blastp
714	LYM10 H134	pine|gbl57.2|AW0648 95	2221	249	91.3	blastp
715	LYM10 H135	pine|gbl57.2|AW2264 88	2222	249	89.9	blastp
716	LYM10 H265	poplar|gbl70|BI12774 5	2223	249	92.8	blastp
717	LYM10 H266	poplar|gbl70|BU8241 90	2224	249	92.8	blastp
718	LYM10 H267	poplar|gbl70|BU8626 32	2225	249	92.8	blastp
719	LYM10 H139	poppy gbl 66 FE96500 9	2226	249	88.4	blastp
720	LYM10 H140	poppy gbl 66 FE96643 0	2227	249	92.8	blastp
721	LYM10 H141	potato|gbl57.2|BG350 890	2228	249	91.3	blastp
722	LYM10 H142	potato|gbl57.2|BG589 211	2229	249	89.86	tblastn
723	LYM10 H143	potato|gbl57.2|BG592 598	2230	249	89.86	tblastn
724	LYM10 H144	potato|gbl57.2|BQ516 058	2231	249	91.3	blastp
725	LYM10 H145	prunus gbl67 BU0395 66	2232	249	92.8	blastp
726	LYM10 H146	prunus gbl 67 BU0467 83	2233	249	87	blastp
727	LYM10 H147	radish|gbl64|EV52635 4	2234	249	91.3	tblastn
728	LYM10 H148	radish|gbl64|EV52839 0	2235	249	91.3	blastp
729	LYM10 H149	radish|gbl64|EV53627 3	2236	249	91.3	blastp

2018271407 30 Nov 2018

Nucl. SEQ ID NO:	Gene Name	cluster name	Polyp. SEQ ID NO:	Homolog, to SEQ ID NO:	% global identity	Algor.
730	LYM10 H150	radish|gbl64|EV54575 1	2237	249	91.3	tblastn
731	LYM10 H151	radish|gbl64|EV54872 1	2238	249	91.3	blastp
732	LYM10 H152	radish|gbl64|EV55048 8	2239	249	91.3	blastp
733	LYM10 H153	radish|gbl64|EV56739 7	2240	249	85.5	blastp
734	LYM10 H154	radish|gbl64|EW7134 25	2241	249	89.9	blastp
735	LYM10 H155	radish|gbl64|FD57055 9	2242	249	89.9	blastp
736	LYM10 H268	rice gb 170 OS06G443 74	2243	249	95.7	blastp
737	LYM10 H157	rose gbl57.2 BI97819 8	2244	249	91.3	tblastn
738	LYM10 H158	rose|gbl57.2|EC58984 2	2245	249	92.75	tblastn
739	LYM10 H159	safflower gbl 62 EL39 3855	2246	249	88.41	tblastn
740	LYM10 H160	safflower|gbl62|EL51 1136	2247	249	89.9	blastp
741	LYM10 H269	senecio gbl70 CO553 399	2248	249	88.4	blastp
742	LYM10 H161	sesame gbl 57.2 BU66 9069	2249	249	91.3	tblastn
743	LYM10 H270	solanum phureja|09vl|SPHAI4 83617	2250	249	89.9	blastp
744	LYM10 H271	solanum phureja|09vl|SPHBGl 27130	2251	249	91.3	blastp
745	LYM10 H272	sorghum 09v 1 SB04G 005280	2252	249	98.6	blastp
746	LYM10 H273	sorghum 09v 1 SB 1OG 026000	2253	249	97.1	blastp
747	LYM10 H164	soybean|gbl68|AA660 461	2254	249	94.2	blastp
748	LYM10 H165	soybean gbl 68 AW47 2512	2255	249	92.8	blastp
749	LYM10 H166	soybean gbl 68 BU544 187	2256	249	94.2	blastp
750	LYM10 H167	spikemoss gbl 65DN8 38422	2257	249	85.51	tblastn
751	LYM10 H168	spruce gb 162 CO2169 79	2258	249	91.3	blastp
752	LYM10 H169	spruce gb 162 CO2170 20	2259	249	91.3	blastp
753	LYM10 H170	spurge gb 161 DV1126 55	2260	249	84.1	blastp
754	LYM10 H171	spurge gbl 61DV1202 63	2261	249	86.5	blastp
755	LYM10 H172	strawberry gb 164 CO3 80171	2262	249	91.3	tblastn

2018271407 30 Nov 2018

Nucl. SEQ ID NO:	Gene Name	cluster name	Polyp. SEQ ID NO:	Homolog, to SEQ ID NO:	% global identity	Algor.
756	LYM10 H173	strawberry) gbl 64|EX6 64646	2263	249	92.8	blastp
757	LYM10 H274	sugarcane gbl57.3 CA 072778	2264	249	97.1	blastp
758	LYM10 H275	sugarcane gbl57.3 CA 087927	2265	249	98.6	blastp
759	LYM10 H276	sugarcane gbl57.3 CA 103056	2266	249	98.6	blastp
760	LYM10 H177	sunflower gb 162 BUO 15373	2267	249	89.86	tblastn
761	LYM10 H178	sunflower gb 162 CD8 49625	2268	249	88.4	blastp
762	LYM10 H179	sunflower gb 162 CD8 51122	2269	249	88.41	tblastn
763	LYM10 H180	switchgrass gb 167 DN 145554	2270	249	98.6	blastp
764	LYM10 H181	switchgrass gbl 67 FE6 33347	2271	249	97.1	blastp
765	LYM10 H182	switchgrass gb 167 FE6 39131	2272	249	98.6	blastp
766	LYM10 H183	switchgrass gb 167 FL7 20694	2273	249	95.7	blastp
767	LYM10 H184	tamarix | gb 16 61EG9 6 8 743	2274	249	85.5	blastp
768	LYM10 H185	tamarix | gb 16 61EG9 69 152	2275	249	88.4	blastp
769	LYM10 H277	teagbl71 FF682807	2276	249	95.7	blastp
770	LYM10 H186	thellungiella| gb 16 71 BI 698898	2277	249	91.3	blastp
771	LYM10 H187	thellungiella gb 16 7 EC 599088	2278	249	91.3	blastp
772	LYM10 H188	tobacco gbl 62 CV020 564	2279	249	81.8	blastp
773	LYM10 H189	tobacco gbl 62 CV021 149	2280	249	80.8	blastp
774	LYM10 H190	tobacco gbl 62 CV021 577	2281	249	91.3	tblastn
775	LYM10 H191	tobacco|gbl62|EB426 093	2282	249	91.3	tblastn
776	LYM10 H192	tobacco|gbl62|EB447 225	2283	249	89.9	blastp
777	LYM10 H278	tomato|09vl|AI483617	2284	249	89.9	blastp
778	LYM10 H279	tomato|09vl|BG12713 0	2285	249	91.3	tblastn
779	LYM10 H195	triphysaria|gbl 64|EX9 88147	2286	249	81.6	blastp
780	LYM10 H196	walnuts gbl 66 CB3 04 079	2287	249	98.6	blastp
781	LYM10 H197	wheat|gbl64|BE42322 6	2288	249	100	tblastn
782	LYM10 H198	wheat|gbl64|BE42385 8	2289	249	100	tblastn

2018271407 30 Nov 2018

Nucl. SEQ ID NO:	Gene Name	cluster name	Polyp. SEQ ID NO:	Homolog, to SEQ ID NO:	% global identity	Algor.
783	LYM10 H199	wheat|gbl64|BE44513 9	2290	249	98.55	tblastn
784	LYM10 H200	wheat|gbl64|BE60483 4	2291	249	98.55	tblastn
785	LYM10 H201	wheat|gbl64|BF47348 2	2292	249	100	tblastn
786	LYM10 H202	wheat|gbl64|BF47481 4	2293	249	98.55	tblastn
787	LYM10 H203	wheatgbl64 BI47989 5	2294	249	98.55	tblastn
788	LYM10 H204	wheat|gbl64|CA61935 7	2295	249	86.96	tblastn
789	LYM10 H205	wheat gbl 64 CA61996 5	2296	249	91.3	tblastn
790	LYM10 H206	wheat|gbl64|CA62731 5	2297	249	83.8	blastp
791	LYM10 H207	wheat|gbl64|DR73720 5	2298	249	85.51	tblastn
792	LYM13 H3	brachypodium 09vl G T794488	2299	251	80.6	blastp
793	LYM13 H4	maize|gbl70|T12684	2300	251	84.5	blastp
794	LYM13 H5	sorghum 09v 1SBO1G 049950	2301	251	84.5	blastp
795	LYM13 H3	switchgrass|gbl67|FE6 34401	2302	251	84.53	tblastn
796	LYM14 Hl	aquilegia gbl57.3 DR9 27713	2303	252	81.1	blastp
797	LYM14 H31	arabidopsis lyrata|09vl|JGIAL009 556	2304	252	80.7	blastp
798	LYM14 H32	arabidopsis lyrata|09vl|JGIAL020 254	2305	252	80.4	blastp
799	LYM14 H2	arabidopsis gb 165 AT 3G11320	2306	252	80.4	blastp
800	LYM14 H3	arabidopsis gb 165 AT 5G05820	2307	252	80.4	blastp
801	LYM14 H4	artemisia|gb 164|EY 03 4514	2308	252	81.7	blastp
802	LYM14 H33	brachypodium 09vl G T762844	2309	252	96	blastp
803	LYM14 H7	canola|gbl61|DY0246 85	2310	252	81.1	blastp
804	LYM14 H34	cassava 09vl CK6500 18	2311	252	80.1	blastp
805	LYM14 H35	castorbean|09vl |EG65 9029	2312	252	80.43	tblastn
806	LYM14 H8	centaurea|gbl 66|EH71 2821	2313	252	80.1	blastp
807	LYM14 H36	cichorium|gbl71 |EH6 88253	2314	252	80.7	blastp
808	LYM14 Hll	cotton|gbl64|AA6599 84	2315	252	80.43	tblastn

2018271407 30 Nov 2018

Nucl. SEQ ID NO:	Gene Name	cluster name	Polyp. SEQ ID NO:	Homolog, to SEQ ID NO:	% global identity	Algor.
809	LYM14 H37	cucumber 09v 1 DN91 0737	2316	252	80.75	tblastn
810	LYM14 H12	ginger|gbl64|DY3589 76	2317	252	83.3	blastp
811	LYM14 H13	iceplant|gbl64|AI8228 35	2318	252	80.75	tblastn
812	LYM14 H14	lettuce gbl57.2 DW15 8376	2319	252	82.3	tblastn
813	LYM14 H15	leymus gbl66 CD8091 80	2320	252	95	blastp
814	LYM14 H38	maize|gbl70|AI78326 0	2321	252	93.8	blastp
815	LYM14 H39	maize|gbl70|AI94167 5	2322	252	95.1	blastp
816	LYM14 H18	melon|gbl65|AM7137 63	2323	252	80.5	tblastn
817	LYM14 H40	monkeyflower|09vl |G 0959633	2324	252	80.12	tblastn
818	LYM14 H41	monkeyflower|09vl |G R111000	2325	252	80.12	tblastn
819	LYM14 H19	papaya|gbl65|EX2611 25	2326	252	81.1	blastp
820	LYM14 H20	radish|gbl64|EW7236 81	2327	252	81.37	tblastn
821	LYM14 H42	solanum phureja|09vl|SPHBG6 28013	2328	252	80.1	blastp
822	LYM14 H43	sorghum 09v 1 SBO1G 038730	2329	252	96	blastp
823	LYM14 H44	sorghum|09vl|SB02G 044050	2330	252	86	blastp
824	LYM14 H23	soybean gb 16 8 AW 5 6 0935	2331	252	80.1	blastp
825	LYM14 H25	spikemoss gbl65 FE43 4307	2332	252	81.06	tblastn
826	LYM14 H45	sugarcane gbl57.3 CA 079818	2333	252	84.2	blastp
827	LYM14 H46	sugarcane gbl57.3 CA 150518	2334	252	93.85	tblastn
828	LYM14 H29	sunflower gb 162 EL4 8 4937	2335	252	80.75	tblastn
829	LYM14 H30	switchgrass gb 167 DN 143407	2336	252	95.4	blastp
830	LYM14 H47	tomato|09vl|BG62801 3	2337	252	80.1	blastp
831	LYM14 H31	wheat|gbl64|BE41600 3	2338	252	83.6	blastp
832	LYM15 H4	brachypodium 09vl D V476162	2339	253	80.2	blastp
833	LYM15 H2	pseudoroegneria gb 16 7|FF343970	2340	253	82	blastp
834	LYM15 H3	wheat|gbl64|BE21329 5	2341	253	81.4	blastp

2018271407 30 Nov 2018

Nucl. SEQ ID NO:	Gene Name	cluster name	Polyp. SEQ ID NO:	Homolog, to SEQ ID NO:	% global identity	Algor.
835	LYM15 H4	wheat|gbl64|BE49683 3	2342	253	81.4	blastp
836	LYM16H9	barley gbl 57SOLEXA IBE421507	2343	254	90.9	blastp
837	LYM16 H10	brachypodium 09vl D V475217	2344	254	92.7	blastp
838	LYM16H3	fescue gbl61DT6911 10	2345	254	93.9	blastp
839	LYM16 Hll	lolium|09vl|AU24687 6	2346	254	84.1	blastp
840	LYD199	maize|gbl70|BI42368 7	2347	254	82.9	blastp
841	LYM16 H12	maize|gbl70|LLFL254 633	2348	254	81.1	tblastn
842	LYM16H5	pseudoroegneria gb 16 7|FF355494	2349	254	92.1	blastp
843	LYM16H6	rye|gbl64|BE494944	2350	254	90.24	tblastn
844	LYM16H7	wheat|gbl64|BE21698 1	2351	254	91.5	blastp
845	LYM16H8	wheat|gbl64|BE41607 1	2352	254	90.9	blastp
846	LYM16H9	wheat|gbl64|BE41811 3	2353	254	91.5	blastp
847	LYM17H6	barley|gbl57SOLEXA |BE602651	2354	255	83.3	blastp
848	LYM17H7	sugarcane gbl57.3 CA 152022	2355	255	80.3	blastp
849	LYM17H3	wheat|gbl64|BE40656 5	2356	255	85.6	blastp
850	LYM17H4	wheat|gbl64|BE42920 9	2357	255	85.6	blastp
851	LYM17H5	wheat|gbl64|BE49071 4	2358	255	86.4	blastp
852	LYM17H6	wheat|gbl64|BQ80319 8	2359	255	85.6	blastp
853	LYM19 H10	barley gbl 57SOLEXA IAL506367	2360	256	86	blastp
854	LYM19 Hll	brachypodium 09vl D V476339	2361	256	87.2	blastp
855	LYM19 H3	leymus|gbl66|EG3872 47	2362	256	84.8	blastp
856	LYM19 H5	pseudoroegneria gb 16 7|FF352256	2363	256	86.9	blastp
857	LYM19 H12	sorghum 09v 1 SB05G 009990	2364	256	82.6	blastp
858	LYM19 H7	switchgrass gbl 67 FE6 03507	2365	256	83.6	blastp
859	LYM19 H8	wheat|gbl64|BE39869 2	2366	256	82.7	blastp
860	LYM19 H9	wheat|gbl64|BE58597 9	2367	256	86.28	tblastn
861	LYM19 H10	wheat|gbl64|BU67232 5	2368	256	81.4	blastp

2018271407 30 Nov 2018

Nucl. SEQ ID NO:	Gene Name	cluster name	Polyp. SEQ ID NO:	Homolog, to SEQ ID NO:	% global identity	Algor.
862	LYM20 H9	barley gbl 57SOLEXA IAL450927	2369	257	86.3	blastp
863	LYM20 H10	brachypodium 09vl D V479896	2370	257	89.1	blastp
864	LYM20 Hll	castorbean 09vl XMO 02519056	2371	257	80	blastp
865	LYM20 H12	maize|gbl70|AI85723 6	2372	257	90.1	blastp
866	LYM20 H5	pseudoroegneria gb 16 7|FF343142	2373	257	89	blastp
867	LYM20 H13	sorghum 09v 1 SBO 1G 009140	2374	257	89.7	blastp
868	LYM20 H14	sugarcane gbl57.3 CA 072511	2375	257	83.9	blastp
869	LYM20 H8	switchgrass gbl 67 FE6 54910	2376	257	84.5	blastp
870	LYM20 H9	wheat|gbl64|BE41198 2	2377	257	88.6	blastp
871	LYM21 Hl	banana|gbl67|FF5574 36	2378	258	80.9	blastp
872	LYM21 H2	banana|gb 167|FF5594 48	2379	258	80.9	blastp
873	LYM21 H27	barley gbl 57SOLEXA IBE437461	2380	258	88.2	blastp
874	LYM21 H28	brachypodium 09vl D V488150	2381	258	95.5	blastp
875	LYM21 H29	brachypodium 09vl G T760558	2382	258	97.3	blastp
876	LYM21 H5	cenchrus|gbl66|EB655 115	2383	258	91.8	blastp
877	LYM21 H6	fescue gbl61DT6806 31	2384	258	90	blastp
878	LYM21 H7	kiwi|gbl66|FG405276	2385	258	81.8	blastp
879	LYM21 H8	leymus gbl 66 CN4657 70	2386	258	88.2	blastp
880	LYM21 H30	lolium|09vl|AU25028 8	2387	258	90	blastp
881	LYM21 H9	lovegrass gbl67DN48 0337	2388	258	92.7	blastp
882	LYM21 H31	maize|gbl70|AI58645 9	2389	258	93.6	blastp
883	LYM21 H32	millet 09vlEVO454P M000432	2390	258	95.5	blastp
884	LYM21 H33	millet 09vlEVO454P M000947	2391	258	91.8	blastp
885	LYM21 H12	pineapple gbl 57.2 CO 731607	2392	258	82.73	tblastn
886	LYM21 H34	rice gbl70 OS02G473 20	2393	258	87.27	tblastn
887	LYM21 H35	sorghum|09vl|SB02G 006170	2394	258	93.6	blastp
888	LYM21 H36	sorghum 09v 1 SB06G 027500	2395	258	95.5	blastp

2018271407 30 Nov 2018

Nucl. SEQ ID NO:	Gene Name	cluster name	Polyp. SEQ ID NO:	Homolog, to SEQ ID NO:	% global identity	Algor.
889	LYM21 H37	sugarcane gbl57.3 BQ 529660	2396	258	93.6	blastp
890	LYM21 H38	sugarcane gbl57.3 BQ 535381	2397	258	92.7	blastp
891	LYM21 H39	sugarcane gbl57.3 CA 118830	2398	258	87.3	blastp
892	LYM21 H19	switchgrass gb 167 DN 151016	2399	258	93.6	blastp
893	LYM21 H20	switchgrass gbl67 FL7 22429	2400	258	94.5	blastp
894	LYM21 H21	switchgrass gb 167 FL9 36988	2401	258	95.5	blastp
895	LYM21 H22	tobacco|gbl62|AM791 579	2402	258	88.2	blastp
896	LYM21 H23	wheat|gbl64|BE35263 2	2403	258	89.1	blastp
897	LYM21 H24	wheat|gbl64|BE40279 2	2404	258	89.1	blastp
898	LYM21 H25	wheat|gbl64|BE49257 5	2405	258	89.09	tblastn
899	LYM21 H26	wheat|gbl64|CA48457 5	2406	258	94.5	blastp
900	LYM21 H27	wheat|gbl64|CA61660 9	2407	258	92.73	tblastn
901	LYM24 Hl	fescue gbl61DT6811 71	2408	261	80.61	tblastn
902	LYM24 H2	leymus gbl66 CD8086 23	2409	261	80.5	blastp
903	LYM24 H8	maize | gb 170|AI62144 0	2410	261	81	blastp
904	LYM24 H9	pseudoroegneria gb 16 7|FF349814	2411	261	80	blastp
905	LYM24 H10	sorghum 09v 1 SB03G 044280	2412	261	83.1	blastp
906	LYM24 Hll	sugarcane gbl57.3 CA 072633	2413	261	82.6	blastp
907	LYM24 H6	switchgrass gb 167 DN 144637	2414	261	84.6	blastp
908	LYM24 H7	switchgrass gb 167 DN 145452	2415	261	85.6	blastp
909	LYM24 H8	wheat|gbl64|BE42590 0	2416	261	80	tblastn
910	LYM26 Hl	wheat|gbl64|BE39890 3	2417	262	88.6	blastp
911	LYM30 H5	brachypodium 09v 1 S RR031799S0073966	2418	263	86.5	blastp
912	LYM30 H6	maize|gbl70|AW5201 85	2419	263	85.8	blastp
913	LYM30 H7	maize|gbl70|AW9276 89	2420	263	85	blastp
914	LYM30 H8	rice|gbl70|OSHG025 80	2421	263	99.2	blastp
915	LYM30 H9	rice gbl70 OS12G025 10	2422	263	87.7	blastp

2018271407 30 Nov 2018

Nucl. SEQ ID NO:	Gene Name	cluster name	Polyp. SEQ ID NO:	Homolog, to SEQ ID NO:	% global identity	Algor.
916	LYM30 H10	sorghum 09v 1 SB05G 001250	2423	263	86.1	blastp
917	LYM30 H5	switchgrass gbl 67 FL7 96240	2424	263	80.16	tblastn
918	LYM31 Hl	rice gbl70 QS12G027 10	2425	264	97.9	blastp
919	LYM35 H5	brachypodium 09v 1 S RR031798S0189278	2426	267	80	blastp
920	LYM35 H6	maize|gbl70|BM4168 80	2427	267	89.7	blastp
921	LYM35 H7	sorghum 09v 1 SB06G 031730	2428	267	86.7	blastp
922	LYM35 H8	sugarcane gbl57.3 CA 105471	2429	267	87.5	blastp
923	LYM35 H4	switchgrass gbl 67 FL9 39819	2430	267	89.9	blastp
924	LYM35 H5	wheat|gbl64|BE50050 4	2431	267	86.1	blastp
925	LYM42 HO	rice|gbl70|OS01G411 20	2432	273	96.7	blastp
925	LYM42 HO	rice|gbl70|OS01G411 20	2432	439	99.83	tblastn
926	LYM43 Hl	rice gbl70 QS12G028 00	2433	274	91.4	blastp
927	LYM52 Hl	b rapa|gbl62|EX068270	2434	277	94.5	blastp
928	LYM52 H2	fescue gbl61CK8028 23	2435	277	84.4	blastp
929	LYM52 H3	leymus gb 16 6 EG3 794 66	2436	277	96.3	blastp
930	LYM52 H10	maize|gbl70|BE13009 4	2437	277	80	blastp
931	LYM52 Hll	maize|gbl70|LLBE05 6010	2438	277	81	blastp
932	LYM52 H12	rice gbl70 QS04G517 92	2439	277	81.4	blastp
933	LYM52 H13	sorghum 09v 1 SB06G 027870	2440	277	82.5	blastp
934	LYM52 H14	sugarcane gbl57.3 AA 577629	2441	277	84.47	tblastn
935	LYM52 H8	switchgrass gb 167 DN 147335	2442	277	82.65	tblastn
936	LYM52 H9	wheat gbl 64 BG90925 9	2443	277	94.5	blastp
937	LYM52 H10	wheat gbl 64 BG90949 3	2444	277	95.1	blastp
938	LYM56 H9	brachypodium 09v 1 S RR031795S0049724	2445	279	85.9	blastp
939	LYM56 H10	maize|gbl70|AI71195 4	2446	279	80.14	tblastn
940	LYM56 H2	pseudoroegneria gb 16 7|FF341776	2447	279	87.9	blastp
941	LYM56 Hll	rice gbl70 QS03G457 20	2448	279	80.1	blastp

2018271407 30 Nov 2018

Nucl. SEQ ID NO:	Gene Name	cluster name	Polyp. SEQ ID NO:	Homolog, to SEQ ID NO:	% global identity	Algor.
942	LYM56 H12	sorghum 09v 1SBO1G 012840	2449	279	81	blastp
943	LYM56 H13	sugarcane gbl57.3 BQ 533995	2450	279	80.14	tblastn
944	LYM56 H6	switchgrass gb 167 FE6 31693	2451	279	84.5	blastp
945	LYM56 H7	switchgrass gb 167 FL7 82747	2452	279	83.1	blastp
946	LYM56 H8	wheat|gbl64|BE40420 7	2453	279	88.7	blastp
947	LYM56 H9	wheat gbl 64 CD91296 3	2454	279	87.8	blastp
948	LYM57 HO	brachypodium 09vl D V475724	2455	280	81.1	blastp
949	LYM62 Hl	sorghum 09v 1 SB 10G 012150	2456	282	88.9	blastp
950	LYM66 Hl	wheat|gbl64|BE40393 2	2457	283	83	blastp
950	LYM66 Hl	wheat|gbl64|BE40393 2	2457	440	83	blastp
951	LYM66 H2	wheat|gbl64|BE40540 9	2458	283	90.4	blastp
951	LYM66 H2	wheat|gbl64|BE40540 9	2458	440	90.4	blastp
952	LYM66 H3	wheat|gbl64|CA60026 3	2459	283	90.1	blastp
952	LYM66 H3	wheat|gbl64|CA60026 3	2459	440	90.1	blastp
953	LYM69 HO	rice gbl70 OS07G425 20	2460	286	98.3	blastp
954	LYM73 H6	brachypodium 09vl D V481090	2461	287	95.8	blastp
955	LYM73 H7	maize|gbl70|AW2561 55	2462	287	93.7	blastp
956	LYM73 H8	sorghum 09vlSB07G 004300	2463	287	94.3	blastp
957	LYM73 H9	sugarcane gbl57.3 CA 117425	2464	287	94.3	blastp
958	LYM73 H5	switchgrass gb 167 DN 145973	2465	287	94.6	blastp
959	LYM73 H6	wheat|gbl64|AF28925 7S1	2466	287	92.67	tblastn
960	LYM79 H3	brachypodium 09v 1 S RR031800S0005207	2467	289	83.8	blastp
961	LYM79 H4	millet 09vlEVO454P M011117	2468	441	82.72	tblastn
962	LYM79 H5	sorghum 09v 1 SB 10G 012140	2469	289	93	blastp
962	LYM79 H5	sorghum 09v 1 SB 10G 012140	2469	441	93.75	tblastn
963	LYM79 Hl	switchgrass gbl 67 FE5 98528	2470	289	90.6	blastp
963	LYM79 Hl	switchgrass gbl 67 FE5 98528	2470	441	91.1	tblastn

2018271407 30 Nov 2018

Nucl. SEQ ID NO:	Gene Name	cluster name	Polyp. SEQ ID NO:	Homolog, to SEQ ID NO:	% global identity	Algor.
964	LYM79 H2	switchgrass gbl 67 FL9 57870	2471	441	86.6	tblastn
965	LYM79 H3	wheat|gbl64|BE59051 8	2472	289	80	blastp
965	LYM79 H3	wheat|gbl64|BE59051 8	2472	441	83.33	tblastn
966	LYM82 Hl	banatia|gbl67|FF5619 62	2473	290	82.1	blastp
967	LYM82 H12	brachypodium 09vl G T816645	2474	290	94.1	blastp
968	LYM82 H2	leymus gb 16 6 EG3 840 73	2475	290	97.9	blastp
969	LYM82 H13	maize|gbl70|AW1811 52	2476	290	90.6	blastp
970	LYM82 H4	melon|gbl65|AM7182 13	2477	290	80.21	tblastn
971	LYM82 H14	millet 09vlEVO454P M002754	2478	290	82.99	tblastn
972	LYM82 H5	pseudoroegneria gb 16 7|FF352234	2479	290	99	blastp
973	LYM82 H15	rice gbl 70QS06G044 60	2480	290	91	blastp
974	LYM82 H16	sorghum 09v 1 SB 10G 002420	2481	290	90.3	blastp
975	LYM82 H8	soybean gbl 68 CA921 223	2482	290	80.21	tblastn
976	LYM82 H17	sugarcane gbl57.3BU 102729	2483	290	90.3	blastp
977	LYM82 H10	switchgrass gb 167 FL7 44837	2484	290	89.6	blastp
978	LYM82 Hll	wheat|gbl64|BE40384 2	2485	290	99	blastp
979	LYM82 H12	wheat|gbl64|CA66078 8	2486	290	99	blastp
980	LYM83 H8	brachypodium 09v 1 S RR031797S0009670	2487	291	86.5	blastp
980	LYM83 H8	brachypodium 09v 1 S RR031797S0009670	2487	442	86.1	blastp
981	LYM83 H9	lolium|09vl|ES699086	2488	291	84.84	tblastn
981	LYM83 H9	lolium|09vl|ES699086	2488	442	84.43	tblastn
982	LYM83 H10	maize|gbl70|AI66534 7	2489	291	82.4	blastp
982	LYM83 H10	maize|gbl70|AI66534 7	2489	442	82.4	blastp
983	LYM83 H3	pseudoroegneria gb 16 7|FF354990	2490	291	97.5	blastp
983	LYM83 H3	pseudoroegneria gb 16 7|FF354990	2490	442	97.1	blastp
984	LYM83 Hll	rice gbl70 QS05G453 00	2491	291	81.6	blastp
984	LYM83 Hll	rice gbl70 QS05G453 00	2491	442	81.1	blastp

2018271407 30 Nov 2018

Nucl. SEQ ID NO:	Gene Name	cluster name	Polyp. SEQ ID NO:	Homolog, to SEQ ID NO:	% global identity	Algor.
985	LYM83 H12	sorghum 09v 1 SB09G 026370	2492	291	82	blastp
985	LYM83 H12	sorghum 09v 1 SB09G 026370	2492	442	81.6	blastp
986	LYM83 H6	switchgrass gb167 DN 149383	2493	291	84	blastp
986	LYM83 H6	switchgrass gb167 DN 149383	2493	442	83.6	blastp
987	LYM83 H7	wheat|gbl64|BE51671 5	2494	291	94.7	blastp
987	LYM83 H7	wheat|gbl64|BE51671 5	2494	442	94.3	blastp
988	LYM83 H8	wheat|gbl64|BF42868 8	2495	291	95.1	blastp
988	LYM83 H8	wheat|gbl64|BF42868 8	2495	442	94.7	blastp
989	LYM84 H8	brachypodium 09v 1 S RR031795S0021840	2496	292	92.8	blastp
990	LYM84 H9	maize|gbl70|AW2821 61	2497	292	82.8	blastp
991	LYM84 H10	maize | gb 17 01LLDQ24 5778	2498	292	98.7	blastp
992	LYM84 H4	pseudoroegneria gb 16 7|FF355744	2499	292	98.3	blastp
993	LYM84 Hll	rice gbl70 OS03G416 12	2500	292	84.58	tblastn
994	LYM84 H12	sorghum 09v 1 SBO1G 014640	2501	292	82.9	blastp
995	LYM84 H7	switchgrass gb 167 FE6 52995	2502	292	81.3	blastp
996	LYM84 H8	wheat|gbl64|BE41769 7	2503	292	95.1	blastp
997	LYM88 HO	arabidopsis lyrata|09vl|JGIAL014 996	2504	294	91.5	blastp
998	LYM89 H5	arabidopsis lyrata|09vl|JGIAL031 299	2505	295	86.36	tblastn
999	LYM89 H2	canola|gbl61|CD8120 18	2506	295	81.8	blastp
1000	LYM89 H3	canola|gbl61|CD8218 97	2507	295	81.8	blastp
1001	LYM89 H4	radish|gbl64|EW7327 98	2508	295	81.65	tblastn
1002	LYM89 H5	radish|gbl64|EX74970 2	2509	295	80.7	blastp
1003	LYM90 H3	brachypodium 09vl D V488904	2510	296	83.2	blastp
1004	LYM90 H2	wheat|gbl64|BQ24215 1	2511	296	94.6	blastp
1005	LYM90 H3	wheat|gbl64|BQ24492 2	2512	296	94.6	blastp
1006	LYM91 Hl	rye|gbl64|BE494176	2513	297	82.5	blastp

2018271407 30 Nov 2018

Nucl. SEQ ID NO:	Gene Name	cluster name	Polyp. SEQ ID NO:	Homolog, to SEQ ID NO:	% global identity	Algor.
1007	LYM91 H2	wheat|gbl64|BE40065 9	2514	297	85.4	blastp
1008	LYM91 H3	wheat|gbl64|CA59311 2	2515	297	86.27	tblastn
1009	LYM93 Hl	wheat|gbl64|BE40153 5	2516	298	93.6	blastp
1010	LYM93 H2	wheat|gbl64|BE41804 7	2517	298	93.6	blastp
1011	LYM93 H3	wheat|gbl64|CA62407 1	2518	298	84.6	blastp
1012	LYM93 H4	wheat|gbl64|CA67840 5	2519	298	94.55	tblastn
1013	LYM93 H5	wheatgbl64 CJ92017 1	2520	298	88.7	blastp
1014	LYM99 H2	brachypodium 09vl D V482533	2521	299	86.8	blastp
1015	LYM99 H2	wheat|gbl64|AL81899 0	2522	299	94.12	tblastn
1016	LYM100 Hl	wheat|gbl64|BE39903 6	2523	301	89.5	blastp
1017	LYM103 H2	sorghum|09vl|SB03G 004410	2524	303	89.69	tblastn
1018	LYM103 H3	sugarcane gbl57.3 CA 078686	2525	303	89.69	tblastn
1019	LYM103 H2	switchgrass gbl 67 FL8 77864	2526	303	87	blastp
1020	LYM105 H5	barley gbl 57SOLEXA IBQ461657	2527	304	90.9	blastp
1021	LYM105 H2	pseudoroegneria gb 16 7|FF366339	2528	304	90.5	blastp
1022	LYM105 H3	wheat|gbl64|BE40533 0	2529	304	90	blastp
1023	LYM105 H4	wheat|gbl64|BE63793 6	2530	304	91.8	blastp
1024	LYM105 H5	wheat|gbl64|BQ74387 5	2531	304	89.4	blastp
1025	LYM106 H8	brachypodium 09vl D V476632	2532	305	80.7	blastp
1026	LYM106 H9	maize | gb 17 01LLDQ24 5927	2533	305	97.9	blastp
1027	LYM106 H3	pseudoroegneria gb 16 7|FF347837	2534	305	96.5	blastp
1028	LYM106 H4	rye|gbl64|BE586535	2535	305	90.3	blastp
1029	LYM106 H5	spruce gbl62DR5435 63	2536	305	84.72	tblastn
1030	LYM106 H6	wheat|gbl64|BE44319 5	2537	305	96.5	blastp
1031	LYM106 H7	wheat|gbl64|BE44526 4	2538	305	97.9	blastp
1032	LYM106 H8	wheat|gbl64|BF48509 8	2539	305	97.2	blastp
1033	LYM110 Hl	sugarcane gbl57.3 CA 204413	2540	306	84.3	tblastn

2018271407 30 Nov 2018

Nucl. SEQ ID NO:	Gene Name	cluster name	Polyp. SEQ ID NO:	Homolog, to SEQ ID NO:	% global identity	Algor.
1034	LYM111 H7	brachypodium 09vl G T765731	2541	307	80.96	tblastn
1035	LYM111 Hl	cenchrus|gbl66|EB657 665	2542	307	87.6	blastp
1036	LYM111 H8	maize|gbl70|AI94154 5	2543	307	89.9	blastp
1037	LYM111 H9	rice gbl70 OS01G570 66	2544	307	81.5	blastp
1038	LYM111 H10	sorghum 09v 1 SB03G 036350	2545	307	91.5	blastp
1039	LYM111 Hll	sorghum 09v 1 SB05G 023720	2546	307	93.1	tblastn
1040	LYM111 H12	sugarcane gbl57.3 CA 072460	2547	307	89.38	tblastn
1041	LYM111 H7	switchgrass gbl 67 FL7 11377	2548	307	90.8	blastp
1042	LYM119 Hl	sorghum 09vl SB05G 003680	2549	308	93.8	blastp
1043	LYM122 Hl	brachypodium 09vl D V469739	2550	310	84.5	blastp
1044	LYM122 Hl	pseudoroegneria gb 16 7|FF350527	2551	310	82.53	tblastn
1045	LYM129 H2	brachypodium 09v 1 S RR031795S0005798	2552	315	80.4	blastp
1046	LYM129 H3	maize|gbl70|BQ48626 9	2553	315	82.8	blastp
1047	LYM129 H4	sorghum 09vl SB03G 044510	2554	315	81.6	blastp
1048	LYM129 H2	switchgrass gbl 67 FE6 43628	2555	315	80.6	blastp
1049	LYM130 Hl	leymusgbl66EG3779 85	2556	316	80.2	blastp
1050	LYM130 H2	rice gbl70 OS05G043 80	2557	316	99.4	blastp
1051	LYM130 H2	wheat|gbl64|BE41476 7	2558	316	80.8	blastp
1052	LYM131 Hl	aquilegia gbl57.3 DR9 17618	2559	317	81.2	blastp
1053	LYM131 H13	barley gbl 57SOLEXA IAL450948	2560	317	83	blastp
1054	LYM131 H14	brachypodium 09vl D V479902	2561	317	85.3	blastp
1055	LYM131 H15	maize|gbl70|AI86132 7	2562	317	90.8	blastp
1056	LYM131 H16	maize|gbl70|AW1298 26	2563	317	82.8	blastp
1057	LYM131 H17	maize|gbl70|AW4531 72	2564	317	91.7	blastp
1058	LYM131 H18	rice gbl70 OS08G127 50	2565	317	85.1	blastp
1059	LYM131 H19	sorghum 09v 1 SB06G 027970	2566	317	91.5	blastp
1060	LYM131 H20	sorghum 09vlSB07G 006320	2567	317	81	blastp

2018271407 30 Nov 2018

Nucl. SEQ ID NO:	Gene Name	cluster name	Polyp. SEQ ID NO:	Homolog, to SEQ ID NO:	% global identity	Algor.
1061	LYM131 H21	sugarcane gbl57.3 CA 068895	2568	317	91.5	blastp
1062	LYM131 Hll	switchgrass gbl 67 FE6 07026	2569	317	81.7	blastp
1063	LYM131 H12	switchgrass gb 167 FL7 08944	2570	317	91.49	tblastn
1064	LYM131 H13	wheat|gbl64|BE41225 7	2571	317	83.7	blastp
1065	LYM134 HO	rice gbl70 QS04G569 90	2572	319	98.8	blastp
1066	LYM137 H2	amborella|gbl66|CK7 58151	2573	321	85.1	blastp
1067	LYM137 H3	antirrhinum|gb 16 61AJ7 88115	2574	321	83.7	blastp
1068	LYM137 H4	antirrhinum|gb 16 61AJ7 91024	2575	321	83	blastp
1069	LYM137 H5	antirrhinum|gb 16 61AJ7 93144	2576	321	83.01	tblastn
1070	LYM137 H217	apple|gbl71|CN44533 3	2577	321	81	blastp
1071	LYM137 H218	apple gbl71CN48901 9	2578	321	82.4	blastp
1072	LYM137 H219	apple gbl 71 CN49188 8	2579	321	81.8	blastp
1073	LYM137 H10	aquilegia gbl57.3 DT7 29599	2580	321	82.7	blastp
1074	LYM137 H220	arabidopsis lyrata|09vl|BQ834082	2581	321	81.8	blastp
1075	LYM137 H221	arabidopsis lyrata|09vl|BQ834260	2582	321	80.5	blastp
1076	LYM137 H222	arabidopsis lyrata|09vl|JGIAL015 196	2583	321	80.5	blastp
1077	LYM137 Hll	arabidopsis gb 165 AT 3G55280	2584	321	81.2	blastp
1078	LYM137 H12	artemisia|gb 164|EY 03 5831	2585	321	85	blastp
1079	LYM137 H13	avocado gbl 64 CO995 706	2586	321	85.3	blastp
1080	LYM137 H14	avocado gbl 64 CV460 574	2587	321	84.6	blastp
1081	LYM137 H15	b juncea gbl 64 EVGN0 0185312102498	2588	321	83.8	blastp
1082	LYM137 H16	b juncea gbl 64 EVGN0 0317014862029	2589	321	81.2	blastp
1083	LYM137 H17	b juncea gbl 64 EVGN0 1375409582897	2590	321	81.2	blastp
1084	LYM137 H223	b nigra|09vl|GT069407	2591	321	81.2	blastp

2018271407 30 Nov 2018

Nucl. SEQ ID NO:	Gene Name	cluster name	Polyp. SEQ ID NO:	Homolog, to SEQ ID NO:	% global identity	Algor.
1085	LYM137 H18	b olerace a| gb 1611 AM 3 9 2244	2592	321	81.2	blastp
1086	LYM137 H19	b olerace a|gb 161 |DY 014 383	2593	321	83.8	blastp
1087	LYM137 H20	b olerace a|gb 161 |DY 023 491	2594	321	83.8	blastp
1088	LYM137 H21	b olerace a|gb 161 |DY 023 494	2595	321	81.2	blastp
1089	LYM137 H22	b olerace a|gb 161 |DY 027 443	2596	321	81.2	blastp
1090	LYM137 H23	b oleracea|gbl61|EE535 717	2597	321	80.5	blastp
1091	LYM137 H24	b rapa|gbl62|BG543640	2598	321	83.77	tblastn
1092	LYM137 H25	b rapa|gbl62|BQ791808	2599	321	80.5	blastp
1093	LYM137 H26	b rapa|gbl62|CA991997	2600	321	81.2	blastp
1094	LYM137 H27	b rapa|gbl62|CV432555	2601	321	81.2	blastp
1095	LYM137 H28	b rapa|gbl62|CV432912	2602	321	81.2	blastp
1096	LYM137 H29	b rapa|gbl62|CV432918	2603	321	83.8	blastp
1097	LYM137 H30	b rapa|gbl62|CX267185	2604	321	81.2	blastp
1098	LYM137 H31	b rapa|gbl62|CX271342	2605	321	81.2	blastp
1099	LYM137 H32	banana|gbl67|DN2395 14	2606	321	85.7	blastp
1100	LYM137 H33	banana|gbl67|ES4316 62	2607	321	86.4	blastp
1101	LYM137 H34	banana|gbl67|FF5581 02	2608	321	85.7	blastp
1102	LYM137 H35	banana|gbl67|FF5587 29	2609	321	86.4	blastp
1103	LYM137 H36	banana|gbl67|FF5608 01	2610	321	85.7	blastp
1104	LYM137 H37	banana|gbl67|FL6573 44	2611	321	85.8	blastp
1105	LYM137 H38	basilicum gb 157.3 DY 342616	2612	321	80.5	blastp
1106	LYM137 H39	beangbl67 CA897728	2613	321	85	blastp
1107	LYM137 H40	beangbl67 CA897730	2614	321	83.1	blastp
1108	LYM137 H41	beet|gbl62|BF011189	2615	321	82.5	blastp

2018271407 30 Nov 2018

Nucl. SEQ ID NO:	Gene Name	cluster name	Polyp. SEQ ID NO:	Homolog, to SEQ ID NO:	% global identity	Algor.
1109	LYM137 H42	beetgbl62 BI096284	2616	321	84.4	blastp
1110	LYM137 H224	brachypodium 09vl D V476457	2617	321	96.1	blastp
1111	LYM137 H225	brachypodium 09vl D V489152	2618	321	96.1	blastp
1112	LYM137 H45	cacao gbl67CA79579 8	2619	321	83.7	blastp
1113	LYM137 H46	cacao gbl67CU47679 8	2620	321	83.8	blastp
1114	LYM137 H47	canola|gbl61|CD8116 40	2621	321	83.8	blastp
1115	LYM137 H48	canola|gbl61|CD8122 85	2622	321	81.2	blastp
1116	LYM137 H49	canola|gbl61|CD8123 12	2623	321	81.2	blastp
1117	LYM137 H50	canola|gbl61|CD8125 01	2624	321	81.2	blastp
1118	LYM137 H51	canola|gbl61|CD8154 20	2625	321	81.2	blastp
1119	LYM137 H52	canola|gbl61|CD8169 02	2626	321	81.2	blastp
1120	LYM137 H53	canola|gbl61|CD8175 91	2627	321	81.2	blastp
1121	LYM137 H54	canola|gbl61|CD8216 63	2628	321	83.8	blastp
1122	LYM137 H55	canola|gbl61|CN7260 29	2629	321	83.8	blastp
1123	LYM137 H56	canola|gbl61|CN7310 28	2630	321	81.2	blastp
1124	LYM137 H57	canola|gbl61|EE47936 8	2631	321	83.8	blastp
1125	LYM137 H58	canola|gbl61|H07535	2632	321	83.8	blastp
1126	LYM137 H226	cassava|09vl|CK6437 71	2633	321	83.1	blastp
1127	LYM137 H227	cassava 09vl CK6474 92	2634	321	83.8	blastp
1128	LYM137 H228	cassava 09vl DV4553 55	2635	321	81.8	blastp
1129	LYM137 H229	castorbean|09vl |EG70 0188	2636	321	85	blastp
1130	LYM137 H230	castorbean 09vl ΧΜ0 02531924	2637	321	84.9	blastp
1131	LYM137 H63	c atharanthus | gb 1661E G556131	2638	321	82.6	blastp
1132	LYM137 H64	c atharanthus | gb 1661E G557604	2639	321	82.6	blastp
1133	LYM137 H65	cenchrus|gbl66|EB652 612	2640	321	93.4	blastp
1134	LYM137 H66	centaurea|gbl 66|EH71 5158	2641	321	83	blastp
1135	LYM137 H67	centaurea|gbl66|EH73 7696	2642	321	84.3	blastp

2018271407 30 Nov 2018

Nucl. SEQ ID NO:	Gene Name	cluster name	Polyp. SEQ ID NO:	Homolog, to SEQ ID NO:	% global identity	Algor.
1136	LYM137 H68	centaurea|gbl66|EH74 6709	2643	321	82.5	blastp
1137	LYM137 H231	chestout gb 170 SRRO0 6295S0004667	2644	321	83.8	blastp
1138	LYM137 H232	chestnut gbl 70 SRRO0 6295S0010167	2645	321	83.1	blastp
1139	LYM137 H233	chickpea|09v2|FE6692 44	2646	321	85.6	blastp
1140	LYM137 H234	chickpea|09v2|FE6716 15	2647	321	85.6	blastp
1141	LYM137 H235	cichorium |gb 171 DT2 10912	2648	321	84.3	blastp
1142	LYM137 H236	cichorium|gbl71 |EH6 81883	2649	321	84.4	blastp
1143	LYM137 H237	cichorium|gbl71 |EH6 96050	2650	321	83.8	blastp
1144	LYM137 H72	citrus|gbl66|CB61057 8	2651	321	83.7	blastp
1145	LYM137 H73	citrus|gbl66|CN18341 5	2652	321	82.9	blastp
1146	LYM137 H74	coffea|gbl57.2|DV663 668	2653	321	85	blastp
1147	LYM137 H75	cotton gbl64AI72852 2	2654	321	84.3	blastp
1148	LYM137 H76	cotton gbl64AI72953 1	2655	321	85	blastp
1149	LYM137 H77	cotton|gbl64|BE05571 9	2656	321	83	blastp
1150	LYM137 H78	cotton|gbl64|BF26964 1	2657	321	84.3	blastp
1151	LYM137 H79	cotton|gb 164|BG4414 96	2658	321	81.8	blastp
1152	LYM137 H80	cowpea|gbl66|BE3362 50	2659	321	83.9	blastp
1153	LYM137 H81	cowpea gb 166 FF3 823 48	2660	321	85.1	blastp
1154	LYM137 H82	cowpea gbl 66 FF3912 67	2661	321	86.9	blastp
1155	LYM137 H83	cryptomeria|gb 1661 BP 176442	2662	321	80.5	blastp
1156	LYM137 H84	cryptomeri a| gb 16 61B W996322	2663	321	81.2	blastp
1157	LYM137 H238	cucumber 09v 1 BGI45 4H0165031	2664	321	81.6	blastp
1158	LYM137 H239	cucumber 09vl CKO 85 893	2665	321	83.7	blastp
1159	LYM137 H240	cucumber 09vl DV63 2825	2666	321	85	blastp
1160	LYM137 H85	cynara|gbl67|GE5881 38	2667	321	84.4	blastp
1161	LYM137 H86	dandelion gb 161 DY 8 04086	2668	321	85.1	blastp
1162	LYM137 H87	dandelion gb 161 DY 8 13115	2669	321	83.8	blastp

2018271407 30 Nov 2018

Nucl. SEQ ID NO:	Gene Name	cluster name	Polyp. SEQ ID NO:	Homolog, to SEQ ID NO:	% global identity	Algor.
1163	LYM137 H88	eucalyptus gbl 66 CT9 80143	2670	321	83.1	blastp
1164	LYM137 H89	eucalyptus gbl 66 CT9 81000	2671	321	81.3	blastp
1165	LYM137 H90	fescue gbl61DT6864 72	2672	321	80.9	blastp
1166	LYM137 H241	flax|09vl|EU829592	2673	321	81	blastp
1167	LYM137 H242	gerbera 09vl AJ75070 7	2674	321	85.6	blastp
1168	LYM137 H243	gerbera 09vl AJ75312 7	2675	321	84.31	tblastn
1169	LYM137 H244	gerbera 09vl AJ75544 0	2676	321	81.7	blastp
1170	LYM137 H91	ginger|gbl64|DY3520 00	2677	321	85.5	blastp
1171	LYM137 H92	ginger|gbl64|DY3569 13	2678	321	83.7	blastp
1172	LYM137 H93	grape|gbl60|CA81633 5	2679	321	80.6	blastp
1173	LYM137 H94	grape|gbl60|CB34828 9	2680	321	81.3	blastp
1174	LYM137 H95	grape|gbl60|CB97964 1	2681	321	84.5	blastp
1175	LYM137 H96	iceplant|gbl64|CA834 927	2682	321	82.5	blastp
1176	LYM137 H97	ipomoe a gb 15 7.2 BU6 90174	2683	321	82.2	blastp
1177	LYM137 H98	ipomoea gbl 57.2 CJ73 8553	2684	321	82.9	blastp
1178	LYM137 H245	jatropha|09vl|GO2473 33	2685	321	85.6	blastp
1179	LYM137 H99	kiwi|gbl66|FG413271	2686	321	83.1	blastp
1180	LYM137 H100	kiwi|gbl66|FG421995	2687	321	84.2	blastp
1181	LYM137 H101	kiwi|gbl66|FG429490	2688	321	83.9	blastp
1182	LYM137 H102	kiwi|gbl66|FG461535	2689	321	84.2	blastp
1183	LYM137 H103	kiwigbl66 FG501757	2690	321	83.6	blastp
1184	LYM137 H104	lettuce gbl57.2CV700 088	2691	321	83.8	blastp
1185	LYM137 H105	lettuce gbl57.2 DW04 6053	2692	321	83	blastp
1186	LYM137 H106	lettuce gbl57.2 DW04 9273	2693	321	83.8	blastp
1187	LYM137 H107	lettuce gbl57.2 DW07 7894	2694	321	83.8	blastp
1188	LYM137 H108	lettuce gbl57.2 DW08 0256	2695	321	83.7	blastp
1189	LYM137 H109	lettuce gbl57.2 DW08 0360	2696	321	83.1	blastp

2018271407 30 Nov 2018

Nucl. SEQ ID NO:	Gene Name	cluster name	Polyp. SEQ ID NO:	Homolog, to SEQ ID NO:	% global identity	Algor.
1190	LYM137 H110	lettuce gbl57.2 DW11 2293	2697	321	83.8	blastp
1191	LYM137 Hill	lettuce gbl57.2 DW14 5178	2698	321	83.8	blastp
1192	LYM137 H112	leymus gbl66 CD8092 09	2699	321	98.7	blastp
1193	LYM137 H246	liquorice gbl71FS239 986	2700	321	83.9	blastp
1194	LYM137 H113	liriodendron|gbl66|CK 743367	2701	321	85.3	blastp
1195	LYM137 H247	lolium|09vl|AU25101 2	2702	321	97.4	blastp
1196	LYM137 H248	lotus|09vl|LLBG6622 85	2703	321	85	blastp
1197	LYM137 H249	lotus|09vl|LLBI41868 7	2704	321	83.9	blastp
1198	LYM137 H250	lotus 09vl LLG00069 21	2705	321	83.7	blastp
1199	LYM137 H115	lovegrass gb 167 EH 18 3574	2706	321	92.8	blastp
1200	LYM137 H116	lovegrass gb 167 EH 18 5967	2707	321	90.1	blastp
1201	LYM137 H251	maize|gbl70|AA97982 2	2708	321	93.4	blastp
1202	LYM137 H252	maize|gbl70|AI61234 9	2709	321	94.7	blastp
1203	LYM137 H253	maize|gbl70|EY96202 7	2710	321	82.89	tblastn
1204	LYM137 H254	maize|gbl70|LLBG32 0994	2711	321	94.1	blastp
1205	LYM137 H255	maize | gb 17 01LLDQ24 5209	2712	321	99.3	blastp
1206	LYM137 H256	maize | gb 17 01LLDQ24 5775	2713	321	81.2	blastp
1207	LYM137 H257	maize|gbl70|T18742	2714	321	93.4	blastp
1208	LYM137 H258	medicago 09vl AW20 8139	2715	321	85.1	blastp
1209	LYM137 H259	medicago 09vl AW28 7975	2716	321	83.6	blastp
1210	LYM137 H260	medicago|09vl |LLAJ8 46422	2717	321	82.47	tblastn
1211	LYM137 H127	melon|gbl65|DV6328 25	2718	321	85	blastp
1212	LYM137 H128	melon|gbl65|DV6329 19	2719	321	83.7	blastp
1213	LYM137 H261	millet 09vl CD725778	2720	321	94.7	blastp
1214	LYM137 H262	millet 09vlEVO454P M001999	2721	321	91.4	blastp
1215	LYM137 H263	monkeyflower|09vl |D V211090	2722	321	81.3	blastp
1216	LYM137 H264	monkeyflower|09vl |G 0948368	2723	321	81.3	blastp

2018271407 30 Nov 2018

Nucl. SEQ ID NO:	Gene Name	cluster name	Polyp. SEQ ID NO:	Homolog, to SEQ ID NO:	% global identity	Algor.
1217	LYM137 H129	nicotiana benthamiana| gb 1621E S 885186	2724	321	85.7	blastp
1218	LYM137 H130	nuphar|gb 166|FD3 861 60	2725	321	85.8	blastp
1219	LYM137 H265	oakgbl70 CU656727	2726	321	83.1	blastp
1220	LYM137 H266	oak gbl70 SRR006307 S0003551	2727	321	83.8	blastp
1221	LYM137 H131	oat|gbl64|CN814837	2728	321	98	blastp
1222	LYM137 H132	oil palm|gbl66|CN59945 7	2729	321	87.2	blastp
1223	LYM137 H133	oil palm|gbl66|EL688664	2730	321	84.5	blastp
1224	LYM137 H134	oniongbl62 CF45144 2	2731	321	85.2	blastp
1225	LYM137 H135	papaya|gbl65|EX2389 83	2732	321	83.1	blastp
1226	LYM137 H136	papaya|gbl65|EX2817 27	2733	321	84.3	blastp
1227	LYM137 H267	peanutgbl71 CD0380 36	2734	321	84.4	blastp
1228	LYM137 H268	peanutgbl71 CD0380 42	2735	321	83.2	blastp
1229	LYM137 H269	peanut gbl 71EH0429 12	2736	321	85.1	blastp
1230	LYM137 H270	pea|09vl|EX570565	2737	321	83.7	blastp
1231	LYM137 H271	pepper gbl 71 BM0631 92	2738	321	83	blastp
1232	LYM137 H272	pepper gbl71CA5184 36	2739	321	81.8	blastp
1233	LYM137 H273	petuniagbl71 CV2988 26	2740	321	83	blastp
1234	LYM137 H274	petunia gbl 71CV2990 96	2741	321	83.7	blastp
1235	LYM137 H275	petunia|gbl71|FN0076 57	2742	321	83.1	blastp
1236	LYM137 H276	poplar|gb 1701 Al 16182 2	2743	321	81.8	blastp
1237	LYM137 H277	poplar|gb 1701 Al16481 2	2744	321	80.4	blastp
1238	LYM137 H278	poplar|gbl70|CN5176 15	2745	321	81.58	tblastn
1239	LYM137 H150	poppy gbl 66 FE96448 2	2746	321	82.6	blastp
1240	LYM137 H151	poppy gbl 66 FE96848 9	2747	321	83.9	blastp
1241	LYM137 H152	potato|gbl57.2|BE923 747	2748	321	83.7	blastp
1242	LYM137 H153	potato|gbl57.2|BF459 639	2749	321	83.7	blastp

2018271407 30 Nov 2018

Nucl. SEQ ID NO:	Gene Name	cluster name	Polyp. SEQ ID NO:	Homolog, to SEQ ID NO:	% global identity	Algor.
1243	LYM137 H155	potato|gbl57.2|BI4070 78	2750	321	82.5	blastp
1244	LYM137 H156	potato|gbl57.2|BQ046 658	2751	321	82.5	blastp
1245	LYM137 H157	prunus gbl67 BU0480 09	2752	321	83.8	blastp
1246	LYM137 H158	prunus gbl67 BU5726 74	2753	321	83.8	blastp
1247	LYM137 H159	pseudoroegneria gb 16 7|FF344271	2754	321	98.7	blastp
1248	LYM137 H160	radish|gbl64|EV52441 2	2755	321	82.5	blastp
1249	LYM137 H161	radish|gbl64|EV52673 2	2756	321	81.2	blastp
1250	LYM137 H162	radish|gbl64|EV52780 6	2757	321	81.2	blastp
1251	LYM137 H163	radish|gbl64|EV53694 9	2758	321	81.2	blastp
1252	LYM137 H164	radish|gbl64|EV53908 7	2759	321	83.1	blastp
1253	LYM137 H165	radish|gbl64|EV54524 8	2760	321	81.2	blastp
1254	LYM137 H166	radish|gbl64|EV57049 2	2761	321	81.2	blastp
1255	LYM137 H167	radish|gbl64|EW7244 65	2762	321	81.2	blastp
1256	LYM137 H168	radish|gbl64|EW7247 37	2763	321	83.1	blastp
1257	LYM137 H169	radish|gbl64|EW7319 70	2764	321	81.2	blastp
1258	LYM137 H170	radish|gbl64|EW7327 28	2765	321	81.2	blastp
1259	LYM137 H171	radish|gbl64|EX75564 1	2766	321	80.4	blastp
1260	LYM137 H172	radish|gbl64|EX75678 4	2767	321	83.8	blastp
1261	LYM137 H173	radish|gbl64|EX75782 4	2768	321	81.2	blastp
1262	LYM137 H279	rice gbl70 OS01G246 90	2769	321	92.2	blastp
1263	LYM137 H280	rice gbl70 OS04G422 70	2770	321	94.1	blastp
1264	LYM137 H176	rye|gbl64|BE493987	2771	321	100	blastp
1265	LYM137 H177	safflower gbl 62 EL37 8228	2772	321	82.4	blastp
1266	LYM137 H178	safflower gbl 62 EL39 9454	2773	321	83.8	blastp
1267	LYM137 H179	safflower|gbl 62|EL41 1711	2774	321	81.7	blastp
1268	LYM137 H281	senecio|gbl70|DY666 439	2775	321	83.01	tblastn

2018271407 30 Nov 2018

Nucl. SEQ ID NO:	Gene Name	cluster name	Polyp. SEQ ID NO:	Homolog, to SEQ ID NO:	% global identity	Algor.
1269	LYM137 H282	solanum phureja|09vl|SPHAA8 24956	2776	321	82.5	blastp
1270	LYM137 H283	solanum phureja|09vl|SPHBQl 15070	2777	321	82.69	tblastn
1271	LYM137 H284	solanum phureja|09vl|SPHTO M289A	2778	321	83.7	blastp
1272	LYM137 H285	sorghum 09v 1 SB06G 021660	2779	321	94.7	blastp
1273	LYM137 H286	sorghum 09v 1 SB 10G 005240	2780	321	94.1	blastp
1274	LYM137 H182	soybean|gbl68|AL365 737	2781	321	85.6	blastp
1275	LYM137 H183	soybean gbl 68 AW20 8139	2782	321	84.3	blastp
1276	LYM137 H184	soybean gbl68 AW28 7975	2783	321	85.6	blastp
1277	LYM137 H185	soybean|gbl68|BE336 250	2784	321	81.9	blastp
1278	LYM137 H186	soybean|gbl68|BE336 251	2785	321	84.5	blastp
1279	LYM137 H187	soybean gbl 68 BI9675 38	2786	321	85	blastp
1280	LYM137 H188	spurge gbl 61 BI99357 4	2787	321	83.8	blastp
1281	LYM137 H189	strawberry gb 164 CO3 78565	2788	321	83.7	blastp
1282	LYM137 H190	strawberry) gbl 64|EX6 85316	2789	321	82.5	blastp
1283	LYM137 H287	sugarcane gbl57.3 AI2 16927	2790	321	94.7	blastp
1284	LYM137 H288	sugarcane gbl57.3 BQ 535570	2791	321	92.8	blastp
1285	LYM137 H289	sugarcane gbl57.3 BQ 535956	2792	321	94.1	blastp
1286	LYM137 H290	sugarcane gbl57.3 BQ 537453	2793	321	93.4	blastp
1287	LYM137 H291	sugarcane gbl57.3 CA 106878	2794	321	94.7	blastp
1288	LYM137 H292	sugarcane gbl57.3 CA 111839	2795	321	93.4	blastp
1289	LYM137 H293	sugarcane gbl57.3 CA 113465	2796	321	92.11	tblastn
1290	LYM137 H198	sunflower gb 162 CD8 46067	2797	321	84.3	blastp
1291	LYM137 H199	sunflower gb 162 CD8 48213	2798	321	84.3	blastp
1292	LYM137 H200	sunflower gb 162 CD8 51130	2799	321	85.6	blastp
1293	LYM137 H201	sunflower gb 162 CD8 53875	2800	321	83.8	blastp

2018271407 30 Nov 2018

Nucl. SEQ ID NO:	Gene Name	cluster name	Polyp. SEQ ID NO:	Homolog, to SEQ ID NO:	% global identity	Algor.
1294	LYM137 H202	switchgrass gb 167 DN 140751	2801	321	92.8	blastp
1295	LYM137 H203	switchgrass gb 167 DN 143966	2802	321	90.8	blastp
1296	LYM137 H204	switchgrass gbl 67 FE6 03312	2803	321	91.4	blastp
1297	LYM137 H205	switchgrass gbl 67 FE6 45253	2804	321	92.8	blastp
1298	LYM137 H294	teagbl71 GE652357	2805	321	84.52	tblastn
1299	LYM137 H295	teagbl71 GH613259	2806	321	81.2	blastp
1300	LYM137 H206	thellungiella gb 167 D N773656	2807	321	81.2	blastp
1301	LYM137 H207	tobacco gb 162 DV157 653	2808	321	82.5	blastp
1302	LYM137 H208	tobacco|gbl62|EB444 171	2809	321	85.1	blastp
1303	LYM137 H209	tobacco|gbl62|EB445 443	2810	321	85.6	blastp
1304	LYM137 H210	tobacco gbl 62 EB679 214	2811	321	83.8	blastp
1305	LYM137 H211	tobacco|gbl62|TOBRP L25A	2812	321	85.7	blastp
1306	LYM137 H296	tomato 09v 1 AA82495 6	2813	321	81.8	blastp
1307	LYM137 H297	tomato 109 v 11 BQ 115 0 7 0	2814	321	83.8	blastp
1308	LYM137 H298	tomato 09vl TOM289 A	2815	321	83.7	blastp
1309	LYM137 H214	wheat|gbl64|BE40186 0	2816	321	99.3	blastp
1310	LYM137 H215	wheat|gbl64|BE40351 6	2817	321	99.3	blastp
1311	LYM137 H216	wheat|gbl64|BE40448 8	2818	321	99.3	blastp
1312	LYM137 H217	wheat|gbl64|CA61289 8	2819	321	82.89	tblastn
1313	LYM137 H299	zinnia|gbl71|AU3044 73	2820	321	83	blastp
1314	LYM140 H18	apple gbl 71 CN87400 7	2821	322	80.1	blastp
1315	LYM140 Hl	banana|gbl67|ES4337 90	2822	322	80	tblastn
1316	LYM140 H19	brachypodium 09vl D V472528	2823	322	90.3	blastp
1317	LYM140 H20	cassava 09vl BM2597 38	2824	322	80.3	blastp
1318	LYM140 H21	cassava 09vl CK6408 86	2825	322	80.3	blastp
1319	LYM140 H22	castorbean|09vl |EG65 6528	2826	322	80.4	blastp
1320	LYM140 H23	chestnut gbl70 SRR00 6295S0060343	2827	322	80	blastp

2018271407 30 Nov 2018

Nucl. SEQ ID NO:	Gene Name	cluster name	Polyp. SEQ ID NO:	Homolog, to SEQ ID NO:	% global identity	Algor.
1321	LYM140 H24	chestout gb 170 SRRO0 6296S0039724	2828	322	80.49	tblastn
1322	LYM140 H4	citrus|gbl66|CB29047 9	2829	322	80.3	blastp
1323	LYM140 H5	cotton gb 164 BF27194 2	2830	322	81.4	blastp
1324	LYM140 H6	cotton gb 164 CA9926 95	2831	322	80.1	blastp
1325	LYM140 H7	cowpea gb 166 FC4597 91	2832	322	80.48	tblastn
1326	LYM140 H25	maize|gbl70|AW3312 87	2833	322	89.2	blastp
1327	LYM140 H9	oil palm|gbl66|ES414711	2834	322	80.8	blastp
1328	LYM140 H10	papayagbl65 EX2277 99	2835	322	80	blastp
1329	LYM140 Hll	radish|gbl64|EV52827 2	2836	322	80.3	blastp
1330	LYM140 H26	rice gbl70 OS04G532 10	2837	322	88.6	blastp
1331	LYM140 H27	sorghum 09v 1 SB06G 028990	2838	322	88.9	blastp
1332	LYM140 H13	soybean gb 16 8 AW 12 6193	2839	322	80	blastp
1333	LYM140 H28	sugarcane gbl57.3 CA 071893	2840	322	88.1	blastp
1334	LYM140 H15	sunflower gb 162 BU6 71805	2841	322	80.1	blastp
1335	LYM140 H16	switchgrass gbl 67 FE6 24047	2842	322	90.5	blastp
1336	LYM140 H17	wheat|gbl64|BE41572 6	2843	322	98.1	blastp
1337	LYM140 H18	wheat|gbl64|BF20061 3	2844	322	86.7	blastp
1338	LYM141 HO	rice gbl70 OS12G029 10	2845	323	86.6	blastp
1339	LYM142 H7	barley gbl 57SOLEXA |BQ761869	2846	324	86.6	blastp
1340	LYM142 H8	brachypodium 09vl D V478753	2847	324	86.8	blastp
1341	LYM142 H3	leymus gb 166 EG4015 96	2848	324	97.7	blastp
1342	LYM142 H4	pseudoroegneria gb 16 7|FF362922	2849	324	97.7	blastp
1343	LYM142 H9	rice gbl70 OS02G335 50	2850	324	83.9	blastp
1344	LYM142 H6	wheat|gbl64|BE40484 3	2851	324	94.4	blastp
1345	LYM142 H7	wheat|gbl64|CA63146 7	2852	324	83.9	blastp
1346	LYM144 HO	brachypodium 09vl G T775853	2853	326	80.6	blastp
1347	LYM148 H10	brachypodium 09vl D V478384	2854	328	91.1	blastp

2018271407 30 Nov 2018

Nucl. SEQ ID NO:	Gene Name	cluster name	Polyp. SEQ ID NO:	Homolog, to SEQ ID NO:	% global identity	Algor.
1348	LYM148 H2	leymus|gbl66|EG3989 61	2855	328	92.73	tblastn
1349	LYM148 Hll	maize|gbl70|AW0600 86	2856	328	84.5	blastp
1350	LYM148 H12	millet 09vlEVO454P M023692	2857	328	82.9	blastp
1351	LYM148 H13	rice gb 170 OS06G454 40	2858	328	82.4	blastp
1352	LYM148 H14	sorghum 09v 1 SB 10G 026570	2859	328	83.3	blastp
1353	LYM148 H6	switchgrass gb 167 FE6 04043	2860	328	82.5	blastp
1354	LYM148 H7	switchgrass gb 167 FE6 41627	2861	328	81.1	blastp
1355	LYM148 H8	wheat|gbl64|BE44289 6	2862	328	96.3	blastp
1356	LYM148 H9	wheat|gbl64|BQ29525 9	2863	328	97	blastp
1357	LYM148 H10	wheat|gbl64|BQ78864 1	2864	328	97	blastp
1358	LYM149 H5	brachypodium 09vl D V488199	2865	329	83.2	blastp
1359	LYM149 H2	pseudoroegneria gb 16 7|FF346387	2866	329	87	blastp
1360	LYM149 H3	wheat|gbl64|BE42905 2	2867	329	87.2	blastp
1361	LYM149 H4	wheat|gbl64|BQ62013 8	2868	329	87.5	blastp
1362	LYM149 H5	wheat|gbl64|CA64142 4	2869	329	89.69	tblastn
1363	LYM152 H14	arabidopsis lyrata|09vl|BQ834051	2870	330	86.7	blastp
1364	LYM152 H15	arabidopsis lyrata|09vl|JGIAL030 307	2871	330	96.7	blastp
1365	LYM152 Hl	arabidopsis gb 165 AT 4G25890	2872	330	82.5	tblastn
1366	LYM152 H2	b oleracea|gb 161 |DY 027 305	2873	330	95	blastp
1367	LYM152 H3	b olerace a gb 161 DY 028 937	2874	330	93.4	blastp
1368	LYM152 H4	b rapa|gbl62|BG544013	2875	330	94.17	tblastn
1369	LYM152 H5	brapa|gbl62|L35776	2876	330	92.6	blastp
1370	LYM152 H6	b rapa|gbl62|L35823	2877	330	95	blastp
1371	LYM152 H7	canola|gbl61|CD8120 96	2878	330	94.2	blastp
1372	LYM152 H8	canola|gbl61|CD8125 52	2879	330	95	blastp

2018271407 30 Nov 2018

Nucl. SEQ ID NO:	Gene Name	cluster name	Polyp. SEQ ID NO:	Homolog, to SEQ ID NO:	% global identity	Algor.
1373	LYM152 H9	canolagbl61 CD8170 37	2880	330	95	blastp
1374	LYM152 H10	canola|gbl61|CD8303 47	2881	330	92.6	blastp
1375	LYM152 H12	radish|gbl64|EV54823 5	2882	330	92.5	blastp
1376	LYM152 H13	radish|gbl64|EW7181 96	2883	330	92.5	blastp
1377	LYM152 H14	thelhmgiella gb 16 7 B M985697	2884	330	91.7	blastp
1378	LYM153 H6	barley gbl 57SOLEXA IBF625242	2885	331	81.5	blastp
1379	LYM153 H7	brachypodium 09v 1 S RR031796S0027091	2886	331	81.5	blastp
1380	LYM153 H2	cenchrus|gbl66|EB654 758	2887	331	80	blastp
1381	LYM153 H8	millet 09vlEVO454P M017552	2888	331	83.1	blastp
1382	LYM153 H9	sorghum 09v 1 SB 10G 003440	2889	331	81.5	blastp
1383	LYM153 H4	switchgrass gb 167 FE6 34744	2890	331	83.1	blastp
1384	LYM153 H5	wheat gbl 64 CD49095 1	2891	331	94.03	tblastn
1385	LYM153 H6	wheat|gbl64|CK21566 0	2892	331	80.3	tblastn
1386	LYM156 H6	barley gbl 57SOLEXA IAL506124	2893	332	96.1	blastp
1387	LYM156 H7	barley gbl 57SOLEXA IBE195142	2894	332	93.1	blastp
1388	LYM156 H3	pseudoroegneria gb 16 7|FF346665	2895	332	92.8	blastp
1389	LYM156 H4	pseudoroegneria gb 16 7|FF354463	2896	332	86.3	blastp
1390	LYM156 H8	rice gbl70 QS07G468 30	2897	332	80	blastp
1391	LYM156 H6	wheat|gbl64|BE63788 8	2898	332	91.8	blastp
1392	LYM157 Hl	barley gbl 57SOLEXA IBG299283	2899	333	94.9	blastp
1393	LYM159 Hl	wheat|gbl64|CA59814 8	2900	334	81.01	tblastn
1394	LYM159 H2	wheat|gbl64|CD86603 7	2901	334	87.7	blastp
1395	LYM159 H3	wheat|gbl64|CD86735 6	2902	334	86.4	blastp
1396	LYM160 Hl	wheat gbl 64 BE39999 7	2903	335	87.6	tblastn
1397	LYM160 H2	wheat|gbl64|BE50020 0	2904	335	80	blastp
1398	LYM161 HO	brachypodium 09vl D V471902	2905	336	81.9	blastp
1398	LYM161 HO	brachypodium 09vl D V471902	2905	444	81.02	tblastn

2018271407 30 Nov 2018

Nucl. SEQ ID NO:	Gene Name	cluster name	Polyp. SEQ ID NO:	Homolog, to SEQ ID NO:	% global identity	Algor.
1399	LYM162 H5	maize|gbl70|AW3311 05	2906	337	84.8	blastp
1400	LYM162 H6	millet 09vlEVO454P M026751	2907	337	85.7	blastp
1401	LYM162 H7	sorghum 09vl SB03G 043995	2908	337	87.5	blastp
1402	LYM162 H8	sugarcane gbl57.3 BQ 536349	2909	337	87.5	blastp
1403	LYM162 H4	switchgrass gbl 67 FL7 38992	2910	337	83.9	blastp
1404	LYM162 H5	switchgrass gbl 67 FL8 29126	2911	337	85.7	blastp
1405	LYM165 H5	maize | gb 17 01LLCO4 5 2769	2912	339	99.2	blastp
1406	LYM165 H6	sorghum 09vl SB03G 030690	2913	339	89.2	blastp
1407	LYM165 H7	sugarcane gbl57.3 BQ 529806	2914	339	81.1	blastp
1408	LYM165 H8	sugarcane gbl57.3 CA 084294	2915	339	90.4	blastp
1409	LYM165 H4	switchgrass gb 167 DN 143471	2916	339	85.9	blastp
1410	LYM165 H5	switchgrass gb 167 DN 144101	2917	339	85.7	blastp
1411	LYM166 Hl	brachypodium 09vl D V486893	2918	340	85.4	tblastn
1411	LYM166 Hl	brachypodium 09vl D V486893	2918	445	85.36	tblastn
1412	LYM170 H7	barley gbl 57SOLEXA AV915706	2919	341	91.6	blastp
1413	LYM170 H8	brachypodium 09v 1 S RR031797S0049196	2920	341	94.8	blastp
1414	LYM170 H9	maize|gbl70|AI66590 2	2921	341	87.3	blastp
1415	LYM170 H10	maize|gbl70|BE05062 8	2922	341	86.4	blastp
1416	LYM170 Hll	sorghum 09v 1 SB03G 036440	2923	341	87.3	blastp
1417	LYM170 H12	sugarcane gbl57.3 CA 067017	2924	341	88.3	blastp
1418	LYM170 H6	switchgrass gb 167 DN 142710	2925	341	87.3	blastp
1419	LYM170 H7	wheat|gbl64|BE41537 1	2926	341	93.5	blastp
1420	LYM172 Hll	brachypodium 09vl D V489358	2927	342	87.6	blastp
1421	LYM172 H12	maize gbl70AA97977 0	2928	342	81.7	blastp
1422	LYM172 H13	maize|gbl70|AI71196 6	2929	342	81.2	blastp
1423	LYM172 H14	maize|gbl70|AI94752 1	2930	342	80.71	tblastn
1424	LYM172 H15	maize|gbl70|AW1201 45	2931	342	82.9	blastp

2018271407 30 Nov 2018

Nucl. SEQ ID NO:	Gene Name	cluster name	Polyp. SEQ ID NO:	Homolog, to SEQ ID NO:	% global identity	Algor.
1425	LYM172 H16	millet 09vlEVO454P M002481	2932	342	85.6	tblastn
1426	LYM172 H17	rice gbl70 OS02G083 64	2933	342	81.8	blastp
1427	LYM172 H18	sorghum 09v 1 SB04G 005430	2934	342	80.43	tblastn
1428	LYM172 H19	sorghum 09v 1 SB 10G 025800	2935	342	83.9	blastp
1429	LYM172 H20	sugarcane gbl57.3 CA 071007	2936	342	80.1	blastp
1430	LYM172 H9	switchgrass gbl 67 FL6 92588	2937	342	80.7	blastp
1431	LYM172 H10	wheat|gbl64|BE40076 1	2938	342	81.25	tblastn
1432	LYM172 Hll	wheat gbl 64 BE49886 8	2939	342	87.77	tblastn
1433	LYM213 Hl	switchgrass gbl 67 FE6 20008	2940	343	80.4	blastp
1433	LYM213 Hl	switchgrass gbl 67 FE6 20008	2940	386	88.7	blastp
1434	LYM174 H3	maize | gb 1701 AW 1449 17	2941	344	89.4	blastp
1435	LYM174 H4	maize|gbl70|AW2673 79	2942	344	86.6	blastp
1436	LYM174 H5	sugarcane gbl57.3 CA 089309	2943	344	92.31	tblastn
1437	LYM174 H3	switchgrass gb 167 DN 150662	2944	344	80.9	blastp
1438	LYM175 HO	maize|gbl70|AW4984 64	2945	345	81.2	blastp
1439	LYM175 Hl	rice gbl70 OS01G690 90	2946	345	95	blastp
1439	LYM175 Hl	rice gbl70 OS01G690 90	2946	446	100	blastp
1440	LYM215 H2	sorghum|09vl|SB03G 043980	2947	345	81.2	blastp
1440	LYM215 H2	sorghum|09vl|SB03G 043980	2947	387	94.6	blastp
1441	LYM176 H2	maize|gbl70|CA45271 3	2948	346	82.2	blastp
1442	LYM176 H3	sorghum|09vl|SB03G 036470	2949	346	83	blastp
1443	LYM176 H2	switchgrass gbl 67 FE6 06366	2950	346	82	blastp
1444	LYM178 H9	brachypodium 09vl D V472161	2951	347	84.9	blastp
1445	LYM178 H10	brachypodium 09v 1 S RR031797S0177787	2952	347	84.6	blastp
1446	LYM178 Hl	fescue gbl61DT6744 27	2953	347	89.4	blastp
1447	LYM178 H2	leymus gb 16 6 EG3945 91	2954	347	84.08	tblastn
1448	LYM178 Hll	maize|gbl70|W21746	2955	347	83.4	blastp

2018271407 30 Nov 2018

Nucl. SEQ ID NO:	Gene Name	cluster name	Polyp. SEQ ID NO:	Homolog, to SEQ ID NO:	% global identity	Algor.
1449	LYM178 H12	millet 09vlEVO454P M001531	2956	347	83.1	blastp
1450	LYM178 H3	pseudoroegneria gb 16 7|FF358503	2957	347	93.6	blastp
1451	LYM178 H13	sorghum|09vl|SB03G 008890	2958	347	83.1	blastp
1452	LYM178 H14	sorghum 09vlSB07G 001060	2959	347	81.9	blastp
1453	LYM178 H15	sugarcane gbl57.3 CA 066169	2960	347	82.4	blastp
1454	LYM178 H16	sugarcane gbl57.3 CA 079726	2961	347	83.1	blastp
1455	LYM178 H8	switchgrass gbl 67 FE6 36508	2962	347	82.4	blastp
1456	LYM178 H9	wheat|gbl64|BQ62075 2	2963	347	94.7	blastp
1457	LYM179 HO	sorghum|09vl|SB08G 006470	2964	348	86.5	blastp
1458	LYM107 H2	brachypodium 09vl G T808738	2965	349	86.9	blastp
1459	LYM107 H3	maize|gbl70|CF07558 7	2966	349	95.2	blastp
1460	LYM107 H4	rice gbl70 OS05G266 60	2967	349	86.4	blastp
1461	LYM107 H5	sorghum|09vl|SB03G 036480	2968	349	95	blastp
1462	LYM109 Hl	maize|gbl70|BG51716 3	2969	350	82.62	tblastn
1462	LYM109 Hl	maize|gbl70|BG51716 3	2969	447	82.6	tblastn
1463	LYM109 H2	sorghum 09vl SB05G 003660	2970	350	88.75	tblastn
1463	LYM109 H2	sorghum 09vl SB05G 003660	2970	447	88.87	tblastn
1464	LYM112 Hl	maize|gbl70|CF03732 2	2971	351	95.4	blastp
1464	LYM112 Hl	maize|gbl70|CF03732 2	2971	448	93.96	tblastn
1465	LYM112 H2	sorghum|09vl|SB02G 039985	2972	351	92.43	tblastn
1465	LYM112 H2	sorghum|09vl|SB02G 039985	2972	448	84.8	blastp
1466	LYM115 HO	sorghum 09v 1 SBO1G 043900	2973	353	90.19	tblastn
1467	LYM116 H3	sorghum 09v 1 SB06G 031340	2974	354	88.2	blastp
1468	LYM116 H2	switchgrass gbl 67 FE6 53493	2975	354	80.88	tblastn
1469	LYM116 H3	switchgrass gbl 67 FL7 90906	2976	354	80.88	tblastn
1470	LYM117 H2	maize|gbl70|GFXAF2 43041X1	2977	355	84.4	blastp
1470	LYM117 H2	maize|gbl70|GFXAF2 43041X1	2977	449	84.5	blastp

100

2018271407 30 Nov 2018

Nucl. SEQ ID NO:	Gene Name	cluster name	Polyp. SEQ ID NO:	Homolog, to SEQ ID NO:	% global identity	Algor.
1471	LYM117 H3	sorghum 09vlSB07G 027220	2978	355	82.3	blastp
1471	LYM117 H3	sorghum 09vlSB07G 027220	2978	449	82.3	blastp
1472	LYM121 Hl	rice gbl70 OS12G026 20	2979	357	90.6	blastp
1473	LYM123 H4	barley gbl 57SOLEXA IAF268595	2980	358	85.5	blastp
1474	LYM123 H5	brachypodium 09vl G T761722	2981	358	84	blastp
1475	LYM123 H6	maize | gb 170|AI79555 8	2982	358	85.2	blastp
1476	LYM123 H7	sorghum 09v 1 SB06G 031680	2983	358	86.3	blastp
1477	LYM123 H4	wheat|gbl64|BE40187 1	2984	358	85.6	blastp
1478	LYM135 Hl	brachypodium 09vl D V480514	2985	359	93.1	blastp
1479	LYM135 H2	maize|gbl70|CB88566 7	2986	359	80.2	blastp
1480	LYM135 H3	sorghum 09v 1 SB 10G 007850	2987	359	84.1	blastp
1481	LYM138 H2	brachypodium 09vl G T810825	2988	360	84	blastp
1482	LYM138 H3	maize|gbl70|AI61233 3	2989	360	86.17	tblastn
1483	LYM138 H4	sorghum 09v 1 SB06G 031570	2990	360	86.33	tblastn
1484	LYM146 H2	brachypodium 09v 1 S RR031798S0143459	2991	361	84.3	blastp
1485	LYM146 H3	rice gbl70 OS03G217 30	2992	361	86.4	blastp
1486	LYM146 H4	sorghum 09v 1 SBO 1G 036160	2993	361	96	blastp
1487	LYM147 HO	sorghum 09vl SB03G 003200	2994	362	82	blastp
1488	LYM154 HO	wheat|gbl64|BE50057 1	2995	363	82.5	blastp
1489	LYM155 H3	brachypodium 09vl D V479969	2996	364	84.7	blastp
1489	LYM155 H3	brachypodium 09vl D V479969	2996	451	83.5	blastp
1490	LYM155 H4	rice gbl70 OS03G588 90	2997	364	81.3	blastp
1490	LYM155 H4	rice gbl70 OS03G588 90	2997	451	80	blastp
1491	LYM155 H3	wheat|gbl64|BQ80101 9	2998	364	92.3	blastp
1491	LYM155 H3	wheat|gbl64|BQ80101 9	2998	451	91.6	blastp
1492	LYM180 HO	brachypodium 09vl D V473436	2999	365	82.9	blastp
1492	LYM180 HO	brachypodium 09vl D V473436	2999	452	83.54	tblastn

101

2018271407 30 Nov 2018

Nucl. SEQ ID NO:	Gene Name	cluster name	Polyp. SEQ ID NO:	Homolog, to SEQ ID NO:	% global identity	Algor.
1493	LYM181 H3	brachypodium 09vl D V485149	3000	366	85.3	blastp
1493	LYM181 H3	brachypodium 09vl D V485149	3000	453	84.68	tblastn
1494	LYM181 H4	maize|gbl70|DR45221 6	3001	366	80.8	blastp
1494	LYM181 H4	maize|gbl70|DR45221 6	3001	453	81.25	tblastn
1495	LYM181 H5	rice |gbl70|OS07G320 10	3002	366	82.8	blastp
1496	LYM181 H6	sorghum|09vl|SB02G 034110	3003	366	83.5	blastp
1497	LYM181 H2	wheat|gbl64|BE42537 7	3004	453	87.16	tblastn
1498	LYM181 H3	wheat|gbl64|BG90502 8	3005	453	93.58	tblastn
1499	LYM182 H8	brachypodium 09vl G T780326	3006	367	87.64	tblastn
1500	LYM182 H9	maize|gbl70|AI79573 7	3007	367	84.27	tblastn
1501	LYM182 H10	millet 09vlEVO454P M084568	3008	367	82.02	tblastn
1502	LYM182 Hll	rice gbl70 QS04G333 00	3009	367	82.02	tblastn
1503	LYM182 H12	sorghum 09v 1 SB06G 015280	3010	367	83.15	tblastn
1504	LYM182 H13	sugarcane gbl57.3 CA 066047	3011	367	83.15	tblastn
1505	LYM182 H6	switchgrass gbl 67 FE6 10729	3012	367	82.02	tblastn
1506	LYM182 H7	switchgrass gbl 67 FL6 99214	3013	367	83.15	tblastn
1507	LYM182 H8	wheat|gbl64|BF20013 6	3014	367	95.51	tblastn
1508	LYM184 H5	brachypodium 09vl D V476770	3015	454	82.68	tblastn
1509	LYM184 H6	brachypodium 09vl G T762544	3016	454	82.61	tblastn
1510	LYM184 H7	brachypodium 09v 1 S RR031799S0153720	3017	454	82.68	tblastn
1511	LYM184 H3	leymus gb 16 6 EG3 851 50	3018	454	84.8	blastp
1512	LYM184 H8	maize | gb 17 01AI69121 0	3019	382	100	blastp
1512	LYM184 H8	maize | gb 17 01AI69121 0	3019	454	80.87	tblastn
1513	LYM206 H2	sorghum 09vlSB07G 021090	3020	382	84.5	blastp
1513	LYM206 H2	sorghum 09vlSB07G 021090	3020	454	80.52	tblastn
1514	LYM184 H4	switchgrass gbl 67 FL7 04827	3021	454	80.5	blastp
1515	LYM184 H5	wheat|gbl64|AL82125 4	3022	368	82.66	tblastn

102

2018271407 30 Nov 2018

Nucl. SEQ ID NO:	Gene Name	cluster name	Polyp. SEQ ID NO:	Homolog, to SEQ ID NO:	% global identity	Algor.
1515	LYM184 H5	wheat|gbl64|AL82125 4	3022	454	86.96	tblastn
1516	LYM185 Hl	pseudoroegneria gb 16 7|FF360278	3023	455	91.53	tblastn
1517	LYM185 H2	wheat gbl 64 BG90607 7	3024	455	85.31	tblastn
1518	LYM186 H4	brachypodium 09vl G T761126	3025	370	90.7	blastp
1519	LYM186 H5	maize|gbl70|BE55288 7	3026	370	82.5	tblastn
1520	LYM186 H6	rice gbl70 QS10G399 30	3027	370	86.3	blastp
1521	LYM186 H7	sorghum 09v 1 SBO 1G 030050	3028	370	86.5	blastp
1522	LYM186 H4	wheat|gbl64|BE42942 5	3029	370	97.6	blastp
1523	LYM188 H8	brachypodium 09vl D V475481	3030	371	92.4	blastp
1523	LYM188 H8	brachypodium 09vl D V475481	3030	456	89.41	tblastn
1524	LYM188 H9	maize|gbl70|AI62272 6	3031	371	87.2	blastp
1524	LYM188 H9	maize|gbl70|AI62272 6	3031	456	83.47	tblastn
1525	LYM188 H10	maize|gbl70|AW4248 65	3032	371	86	blastp
1525	LYM188 H10	maize|gbl70|AW4248 65	3032	456	83.9	tblastn
1526	LYM188 Hll	millet 09vlEVO454P M011140	3033	456	85.17	tblastn
1527	LYM188 H3	pseudoroegneria gb 16 7|FF341644	3034	456	80.5	blastp
1528	LYM188 H12	rice gbl70 QS03G539 60	3035	371	88.2	blastp
1528	LYM188 H12	rice gbl70 QS03G539 60	3035	456	84.75	tblastn
1529	LYM188 H13	sorghum 09v 1SBO 1G 007950	3036	371	87.4	blastp
1529	LYM188 H13	sorghum 09v 1 SBO 1G 007950	3036	456	84.32	tblastn
1530	LYM188 H14	sugarcane gbl57.3 BQ 530106	3037	371	87.4	blastp
1530	LYM188 H14	sugarcane gbl57.3 BQ 530106	3037	456	84.32	tblastn
1531	LYM188 H7	switchgrass gbl 67 FL7 09807	3038	456	84.32	tblastn
1532	LYM188 H8	wheat gbl 64 CA74294 0	3039	456	81.78	tblastn
1533	LYM193 Hl	leymus gb 166 EG3 819 14	3040	459	87.1	tblastn
1534	LYM193 H2	wheat|gbl64|BQ23667 8	3041	459	85.26	tblastn
1535	LYM194 HO	brachypodium 09v 1 S RR031796S0004815	3042	375	84.8	blastp

103

2018271407 30 Nov 2018

Nucl. SEQ ID NO:	Gene Name	cluster name	Polyp. SEQ ID NO:	Homolog, to SEQ ID NO:	% global identity	Algor.
1536	LYM194 Hl	maize|gbl70|BQ53910 2	3043	375	82.1	blastp
1537	LYM194 H2	sorghum 09v 1 SB06G 015320	3044	375	84.9	blastp
1538	LYM194 H3	switchgrass gbl 67 FE6 45079	3045	375	82.9	blastp
1539	LYM194 H4	wheat|gbl64|BE51807 8	3046	375	96.3	blastp
1540	LYM197 H2	sugarcane gbl57.3 BQ 536804	3047	377	88.57	tblasta
1541	LYM198 Hl	sorghum 09v 1 SBO1G 045460	3048	378	85.5	blastp
1542	LYM201 Hl	aquilegia gbl57.3 DR9 15888	3049	379	82.4	blastp
1543	LYM201 H19	arabidopsis lyrata|09vl|JGIAL022 871	3050	379	80.07	tblasta
1544	LYM201 H2	artemisia|gb 164|EY 03 3288	3051	379	80.5	blastp
1545	LYM201 H3	b rapa|gbl62|CV433700	3052	379	80.3	blastp
1546	LYM201 H20	brachypodium 09vl D V471345	3053	379	93.8	blastp
1547	LYM201 H21	brachypodium 09vl G T759255	3054	379	81.2	blastp
1548	LYM201 H22	cassava 09v 1 DQ1383 70	3055	379	82.2	blastp
1549	LYM201 H23	cassava 09vl FF38053 9	3056	379	81.3	blastp
1550	LYM201 H24	castorbean|09vl |EE25 6048	3057	379	81.4	blastp
1551	LYM201 H25	che stnut gb 17 0 S RRO 0 6295S0006313	3058	379	80.6	blastp
1552	LYM201 H7	cotton|gbl64|AI72837 8	3059	379	81.7	blastp
1553	LYM201 H8	cotton gb 164 C00709 70	3060	379	82	blastp
1554	LYM201 H26	cucumber 09vl AM73 1598	3061	379	81.7	blastp
1555	LYM201 H27	lotus 09vlBI41943 7	3062	379	80.5	blastp
1556	LYM201 H28	maize|gbl70|AI97825 4	3063	379	98.2	blastp
1557	LYM201 H29	maize|gbl70|DR97111 8	3064	379	80.1	blastp
1558	LYM201 H30	medicago 09v 1 AW68 4099	3065	379	80.7	blastp
1559	LYM201 H31	oakgbl70 CU656181	3066	379	82.56	tblasta
1560	LYM201 H32	poplar|gbl70|BI06963 7	3067	379	81.3	blastp
1561	LYM201 H33	poplar|gbl70|BU8871 51	3068	379	80.7	blastp

104

2018271407 30 Nov 2018

Nucl. SEQ ID NO:	Gene Name	cluster name	Polyp. SEQ ID NO:	Homolog, to SEQ ID NO:	% global identity	Algor.
1562	LYM201 H34	rice |gbl70|OS02G345 60	3069	379	95.2	blastp
1563	LYM201 H35	solanum phureja|09vl|SPHBGl 23984	3070	379	81.4	blastp
1564	LYM201 H36	solanum phureja|09vl|SPHBGl 29477	3071	379	81.2	blastp
1565	LYM201 H37	sorghum 09v 1 SB04G 022350	3072	379	98.4	blastp
1566	LYM201 H15	soybean gb 168 AL3 67 670	3073	379	80.7	blastp
1567	LYM201 H16	soybean gbl 68 AW68 4099	3074	379	80.5	blastp
1568	LYM201 H38	sugarcane gbl57.3 CA 065291	3075	379	98.6	blastp
1569	LYM201 H18	switchgrass gbl 67 FE6 41755	3076	379	98.2	blastp
1570	LYM201 H39	tomato|09vl|BG12398 4	3077	379	81.4	blastp
1571	LYM201 H40	tomato|09vl|BG12947 7	3078	379	81.2	blastp
1572	LYM201 H19	wheat|gbl64|BE40316 8	3079	379	93.2	blastp
1573	LYM203 H9	barley gbl 57SOLEXA IBI949918	3080	380	84.7	blastp
1574	LYM203 H10	lolium|09vl|AU24700 9	3081	380	85.2	blastp
1575	LYM203 Hll	maize|gbl70|AI62967 5	3082	380	95.7	blastp
1576	LYM203 H12	millet 09vlEVO454P M058394	3083	380	81.7	blastp
1577	LYM203 H13	rice gbl70 QS02G083 80	3084	380	89.2	blastp
1578	LYM203 H14	sorghum 09v 1 SB04G 005460	3085	380	96.8	blastp
1579	LYM203 H15	sugarcane gbl57.3 CA 119568	3086	380	94.1	blastp
1580	LYM203 H6	switchgrass gb 167 DN 142920	3087	380	95.2	blastp
1581	LYM203 H7	switchgrass gbl 67 FE6 17741	3088	380	95.7	blastp
1582	LYM203 H8	wheat|gbl64|BQ80196 6	3089	380	85.7	blastp
1583	LYM203 H9	wheat|gbl64|BQ90323 0	3090	380	86.2	blastp
1584	LYM206 H3	maize|gbl70|AW0559 97	3091	382	84.1	blastp
1585	LYM207 H2	maize|gbl70|BM3402 89	3092	383	86.5	blastp
1586	LYM207 H3	sorghum 09v 1 SB06G 023870	3093	383	94.3	blastp
1587	LYM207 H2	switchgrass gbl 67 FE6 01320	3094	383	82.3	blastp

105

2018271407 30 Nov 2018

Nucl. SEQ ID NO:	Gene Name	cluster name	Polyp. SEQ ID NO:	Homolog, to SEQ ID NO:	% global identity	Algor.
1588	LYM208 H6	maize |gb 17 01AI6913 6 8	3095	384	94.4	blastp
1589	LYM208 H7	rice gbl70 OS09G016 90	3096	384	82	blastp
1590	LYM208 H8	sorghum 09v 1 SBO1G 032070	3097	384	92.1	blastp
1591	LYM208 H9	sorghum|09vl|SB08G 002510	3098	384	86.6	blastp
1592	LYM208 H5	switchgrass gbl 67 FE6 12629	3099	384	90.4	blastp
1593	LYM208 H6	switchgrass gbl 67 FL7 29765	3100	384	90.4	blastp
1594	LYM212 H6	barley gbl 57SOLEXA |BF623682	3101	385	80.3	blastp
1595	LYM212 H7	maize|gbl70|AI67747 4	3102	385	88.5	blastp
1596	LYM212 H8	rice gbl70 OS03G079 10	3103	385	80.11	tblastn
1597	LYM212 H9	sorghum 09v 1 SBO 1G 045480	3104	385	92.5	blastp
1598	LYM212 H10	sugarcane gbl57.3 CA 088789	3105	385	92	blastp
1599	LYM212 H6	wheat|gbl64|BE40224 2	3106	385	80.38	tblastn
1600	LYM213 Hl	maize|gbl70|AW2822 49	3107	386	90.9	blastp
1601	LYM213 H2	sorghum 09v 1 SB06G 018770	3108	386	91.7	blastp
1602	LYM215 H2	switchgrass gbl 67 FE6 18086	3109	387	90.42	tblastn
1603	LYM217 H3	sorghum 09v 1 SBO 1G 043910	3110	388	88.2	blastp
1604	LYM217 H4	sugarcane gbl57.3 CA 136491	3111	388	87.7	blastp
1605	LYM217 H3	switchgrass gbl 67 FE6 06442	3112	388	86.7	blastp
1606	LYM221 Hl	brachypodium 09vl G T792319	3113	391	83.8	blastp
1606	LYM221 Hl	brachypodium 09vl G T792319	3113	461	81.3	blastp
1607	LYM221 H2	rice gbl70 OS03G248 70	3114	391	82.9	blastp
1607	LYM221 H2	rice gbl70 OS03G248 70	3114	461	80.5	blastp
1608	LYM221 H3	sorghum 09v 1 SBO 1G 034610	3115	391	90.7	blastp
1608	LYM221 H3	sorghum 09v 1 SBO 1G 034610	3115	461	88.7	blastp
1609	LYM224 H2	brachypodium 09vl G T762108	3116	393	82.4	blastp
1610	LYM224 H3	sorghum|09vl|SB02G 040000	3117	393	92.9	blastp
1611	LYM224 H2	switchgrass gbl 67 FE6 17506	3118	393	83.19	tblastn

106

2018271407 30 Nov 2018

Nucl. SEQ ID NO:	Gene Name	cluster name	Polyp. SEQ ID NO:	Homolog, to SEQ ID NO:	% global identity	Algor.
1612	LYM227 Hl	sorghum 09v 1 SBO1G 043140	3119	394	88.3	blastp
1613	LYM228 Hl	sorghum 09vl SB09G 006910	3120	395	85	blastp
1613	LYM228 Hl	sorghum 09vl SB09G 006910	3120	462	83.7	blastp
1614	LYM232 H3	sorghum|09vl|SB02G 000450	3121	396	80.4	blastp
1615	LYM232 H4	sugarcane gbl57.3 CA 073189	3122	396	80.8	blastp
1616	LYM232 H3	switchgrass gbl 67 FL8 49399	3123	396	80.7	blastp
1617	LYM233 HO	brachypodium 09v 1 T MPLOS01G70020T1	3124	397	99.6	blastp
1618	LYM234 HO	rice gbl70 OS07G382 90	3125	398	81.3	blastp
1619	LYM236 H99	apple|gbl71|CN48856 8	3126	399	89.1	blastp
1620	LYM236 H100	apple|gbl71|CN88310 0	3127	399	89.6	blastp
1621	LYM236 H3	aquilegia gbl57.3 DR9 19774	3128	399	87.4	blastp
1622	LYM236 H101	arabidopsis lyrata|09vl|JGIAL005 113	3129	399	83.9	blastp
1623	LYM236 H102	arabidopsis lyrata|09vl|JGIAL006 646	3130	399	86.89	tblastn
1624	LYM236 H4	arabidopsis gb 165 AT 1G54340	3131	399	83.5	blastp
1625	LYM236 H5	arabidopsis gb 165 AT 1G65930	3132	399	87.1	blastp
1626	LYM236 H6	artemisia|gb 164|EY 03 4635	3133	399	87.9	blastp
1627	LYM236 H7	avocado gbl 64 CO995 120	3134	399	91.3	blastp
1628	LYM236 H8	b olerace a gb 161 DY 028 218	3135	399	87.2	blastp
1629	LYM236 H9	b rapa|gbl62|CX269094	3136	399	87.2	blastp
1630	LYM236 H10	b rapa|gbl62|GFXAF25 8246X1	3137	399	84.3	tblastn
1631	LYM236 Hll	b rapa|gbl62|L47856	3138	399	87.2	blastp
1632	LYM236 H103	barley gbl 57SOLEXA IAL502504	3139	399	89.3	blastp
1633	LYM236 H13	basilicum gb 157.3 DY 322368	3140	399	87.7	blastp
1634	LYM236 H14	bean gbl 67 |CA896841	3141	399	87.9	blastp
1635	LYM236 H104	brachypodium 09vl D V478973	3142	399	85.3	blastp

107

2018271407 30 Nov 2018

Nucl. SEQ ID NO:	Gene Name	cluster name	Polyp. SEQ ID NO:	Homolog, to SEQ ID NO:	% global identity	Algor.
1636	LYM236 H105	brachypodium 09vl D V482439	3143	399	90.5	blastp
1637	LYM236 H17	cacao|gbl67|DQ44887 5	3144	399	89.2	blastp
1638	LYM236 H18	canola|gbl61|BQ7049 58	3145	399	87.2	blastp
1639	LYM236 H19	canola|gbl61|CD8173 40	3146	399	87.2	blastp
1640	LYM236 H20	canola|gbl61|CD8331 08	3147	399	83.9	blastp
1641	LYM236 H21	canola|gbl61|CX1894 42	3148	399	86.5	blastp
1642	LYM236 H22	canola|gbl61|DY0113 90	3149	399	87.2	blastp
1643	LYM236 H106	cassava|09vl|CK6426 10	3150	399	90.1	blastp
1644	LYM236 H107	cassava 09vl DV4579 42	3151	399	87.5	blastp
1645	LYM236 H108	castorbean|09vl |EE25 6632	3152	399	86.1	blastp
1646	LYM236 H109	castorbean|09vl |EE25 9479	3153	399	90.6	blastp
1647	LYM236 H26	centaurea|gbl66|EH73 1203	3154	399	81.2	blastp
1648	LYM236 H27	centaurea|gbl66|EL93 2337	3155	399	86.6	blastp
1649	LYM236 H110	che stout gb 17 0 S RRO 0 6295S0002580	3156	399	82.27	tblastn
1650	LYM236 Hill	che stout gb 17 0 S RRO 0 6295S0002701	3157	399	89.6	blastp
1651	LYM236 H112	cichorium|gbl71 |EH6 75189	3158	399	87.3	blastp
1652	LYM236 H113	cichorium|gbl71 |EH6 83726	3159	399	89.1	blastp
1653	LYM236 H30	citrus|gbl66|AF17666 9	3160	399	90.6	blastp
1654	LYM236 H31	citrus|gbl66|CD57391 1	3161	399	85.1	blastp
1655	LYM236 H32	coffeagbl57.2 DV663 279	3162	399	87.8	blastp
1656	LYM236 H33	cotton|gbl64|AI72726 0	3163	399	87.2	blastp
1657	LYM236 H34	cotton|gbl64|BF27858 8	3164	399	83.5	blastp
1658	LYM236 H35	cowpea gb 166 FC45 81 36	3165	399	89.1	blastp
1659	LYM236 H36	cynara|gbl67|GE5772 43	3166	399	86.47	tblastn
1660	LYM236 H37	cynara|gbl67|GE5796 63	3167	399	88.6	blastp
1661	LYM236 H38	dandelion gb 161 DY 8 04243	3168	399	86.96	tblastn
1662	LYM236 H39	eucalyptus gb 166 X97 063	3169	399	88	blastp

108

2018271407 30 Nov 2018

Nucl. SEQ ID NO:	Gene Name	cluster name	Polyp. SEQ ID NO:	Homolog, to SEQ ID NO:	% global identity	Algor.
1663	LYM236 H40	fescue gbl 61 |CK8010 45	3170	399	89.8	blastp
1664	LYM236 H41	fescue gbl61DT6747 24	3171	399	90	blastp
1665	LYM236 H42	ginger|gbl64|DY3602 89	3172	399	91.3	blastp
1666	LYM236 H43	grape|gbl60|BM43675 5	3173	399	89.9	blastp
1667	LYM236 H44	kiwi|gbl66|FG396670	3174	399	88.2	blastp
1668	LYM236 H45	kiwigbl66 FG397107	3175	399	88.7	blastp
1669	LYM236 H46	kiwigbl66 FG397291	3176	399	89.4	blastp
1670	LYM236 H47	lettuce gbl57.2 DW08 8948	3177	399	87.4	blastp
1671	LYM236 H48	leymus gbl66 CD8091 60	3178	399	89.6	blastp
1672	LYM236 H49	liriodendron|gbl66|CK 762229	3179	399	88.2	blastp
1673	LYM236 H114	lotus|09vl|AW428686	3180	399	89.4	blastp
1674	LYM236 H115	lotus 09vl BP033879	3181	399	83.7	blastp
1675	LYM236 H51	lovegrass gbl67DN48 0596	3182	399	90.8	blastp
1676	LYM236 H116	maize|gbl70|AI60081 5	3183	399	93.7	blastp
1677	LYM236 H117	maize|gbl70|AW3132 97	3184	399	92.2	blastp
1678	LYM236 H118	maize|gbl70|W21690	3185	399	91.3	blastp
1679	LYM236 H119	medicago 09v 1 AW 19 1201	3186	399	88.2	blastp
1680	LYM236 H120	medicago 09v 1 AW68 9032	3187	399	84.9	blastp
1681	LYM236 H121	millet 09vl CD725798	3188	399	92.5	blastp
1682	LYM236 H122	millet 09vlEVO454P M002708	3189	399	94.2	blastp
1683	LYM236 H123	monkeyflower|09vl |D V206036	3190	399	87.4	blastp
1684	LYM236 H56	nicotiana benthamiana|gb 1621C K291144	3191	399	86.5	blastp
1685	LYM236 H57	oil palm|gbl66|EL684429	3192	399	87.3	blastp
1686	LYM236 H124	peanutgbl71 CD0386 82	3193	399	87.9	blastp
1687	LYM236 H125	pea|09vl|CD860585	3194	399	89.6	blastp
1688	LYM236 H126	pepper gb 171 BM0617 61	3195	399	88	blastp

109

2018271407 30 Nov 2018

Nucl. SEQ ID NO:	Gene Name	cluster name	Polyp. SEQ ID NO:	Homolog, to SEQ ID NO:	% global identity	Algor.
1689	LYM236 H127	pepper gb 171 CA5165 82	3196	399	85.3	blastp
1690	LYM236 H128	petunia gbl 71DC2402 08	3197	399	88.2	blastp
1691	LYM236 H129	physcomitrella| 1 Ον 11A W497149	3198	399	82.2	blastp
1692	LYM236 H62	pine|gbl57.2|AW0102 92	3199	399	85.6	blastp
1693	LYM236 H63	pine|gbl57.2|BX2498 26	3200	399	85.6	blastp
1694	LYM236 H130	poplar gb 170 Al 16195 6	3201	399	89.6	blastp
1695	LYM236 H131	poplar gbl70BI12770 6	3202	399	86.6	blastp
1696	LYM236 H132	poplar|gb 17 01 BI 13161 0	3203	399	86.8	blastp
1697	LYM236 H133	poplar|gbl70|BU8210 63	3204	399	90.4	blastp
1698	LYM236 H66	potato gbl 57.2 BG591 093	3205	399	88	blastp
1699	LYM236 H67	prunusgbl67AF3674 43	3206	399	89.4	blastp
1700	LYM236 H68	radish|gbl64|EV52684 7	3207	399	85.8	blastp
1701	LYM236 H69	radish|gbl64|EV53122 5	3208	399	86.9	blastp
1702	LYM236 H134	rice gbl70 OS01G145 80	3209	399	84.8	blastp
1703	LYM236 H135	rice gbl70 OS01G466 10	3210	399	93	blastp
1704	LYM236 H72	rye|gbl64|BE494776	3211	399	86.17	tblastn
1705	LYM236 H73	safflower gbl 62 EL37 2795	3212	399	87.3	blastp
1706	LYM236 H74	safflower gbl 62 EL37 4725	3213	399	89.1	blastp
1707	LYM236 H136	solanum phureja|09vl|SPHBGl 31802	3214	399	86.3	blastp
1708	LYM236 H137	solanum phureja|09vl|SPHBG6 29432	3215	399	87.7	blastp
1709	LYM236 H138	sorghum 09vl SB03G 029840	3216	399	92	blastp
1710	LYM236 H139	sorghum 09vl SB09G 029110	3217	399	94.7	blastp
1711	LYM236 H77	soybean gbl 68 AW25 7518	3218	399	88.7	blastp
1712	LYM236 H78	soybean gbl 68 AW68 9032	3219	399	85.6	blastp
1713	LYM236 H79	soybean gbl 68 FF554 826	3220	399	84.7	blastp
1714	LYM236 H80	soybean gbl68SOYID H	3221	399	89.4	blastp

110

2018271407 30 Nov 2018

Nucl. SEQ ID NO:	Gene Name	cluster name	Polyp. SEQ ID NO:	Homolog, to SEQ ID NO:	% global identity	Algor.
1715	LYM236 H81	spikemoss gbl65 FE44 1231	3222	399	84.2	blastp
1716	LYM236 H82	spikemoss gbl65 FE44 3181	3223	399	82.3	blastp
1717	LYM236 H83	spruce gbl 62 CO2258 56	3224	399	85	blastp
1718	LYM236 H84	strawberry gbl 64DV4 38767	3225	399	82.6	blastp
1719	LYM236 H140	sugarcane gbl57.3BU 103347	3226	399	94.5	blastp
1720	LYM236 H141	sugarcane gbl57.3 CA 070718	3227	399	92.5	blastp
1721	LYM236 H87	sunflower gb 162 CD8 46861	3228	399	86.6	blastp
1722	LYM236 H88	sunflower gb 162 CD8 54278	3229	399	87.9	blastp
1723	LYM236 H89	switchgrass gb 167 DN 142415	3230	399	92	blastp
1724	LYM236 H90	switchgrass gb 167 DN 143508	3231	399	95.4	blastp
1725	LYM236 H91	switchgrass gb 167 DN 150237	3232	399	95.2	blastp
1726	LYM236 H92	switchgrass gb 167 DN 151575	3233	399	92.2	blastp
1727	LYM236 H93	thellungiella|gb 167|D N774112	3234	399	87.14	tblastn
1728	LYM236 H94	tobacco|gbl62|DV158 343	3235	399	83.3	blastp
1729	LYM236 H95	tobacco gbl62X77944	3236	399	88.5	blastp
1730	LYM236 H142	tomato|09vl|BG13180 2	3237	399	85.6	blastp
1731	LYM236 H143	tomato|09vl|BG62943 2	3238	399	87.3	blastp
1732	LYM236 H98	triphysaria|gbl64|DRl 71747	3239	399	88.4	blastp
1733	LYM236 H99	wheat|gbl64|BE44254 0	3240	399	84.1	blastp
1734	LYM238 HO	rice gbl70 QS05G450 80	3241	400	95.4	blastp
1735	LYM240 H9	barley gbl 57SOLEXA IAL508021	3242	402	91.9	blastp
1736	LYM240 H10	brachypodium 09vl G T810642	3243	402	91.9	blastp
1737	LYM240 Hll	maize gbl70DR97279 0	3244	402	84.2	blastp
1738	LYM240 H12	sorghum|09vl|SB02G 038240	3245	402	84.2	blastp
1739	LYM240 H13	sugarcane gbl57.3 CA 075929	3246	402	82.3	blastp
1740	LYM240 H6	switchgrass gbl 67 FE5 97498	3247	402	81.6	blastp
1741	LYM240 H7	switchgrass gbl 67 FE6 10847	3248	402	80	blastp

111

2018271407 30 Nov 2018

Nucl. SEQ ID NO:	Gene Name	cluster name	Polyp. SEQ ID NO:	Homolog, to SEQ ID NO:	% global identity	Algor.
1742	LYM240 H8	switchgrass gbl 67 FL9 60804	3249	402	81.6	blastp
1743	LYM240 H9	wheat gbl 64 CA67449 1	3250	402	89.93	tblastn
1744	LYM242 H7	barley gbl 57SOLEXA IBE412570	3251	404	82.2	blastp
1745	LYM242 H8	brachypodium 09vl G T764573	3252	404	86.1	blastp
1746	LYM242 H9	maize|gbl70|AI74605 3	3253	404	83.4	blastp
1747	LYM242 H10	millet 09vlEVO454P M008771	3254	404	85	blastp
1748	LYM242 Hll	sorghum|09vl|SB03G 003160	3255	404	82.6	blastp
1749	LYM242 H12	sugarcane gbl57.3 BQ 534251	3256	404	83.8	blastp
1750	LYM242 H5	switchgrass gb 167 DN 143169	3257	404	85.1	blastp
1751	LYM242 H6	switchgrass gbl 67 FE6 54179	3258	404	85	blastp
1752	LYM242 H7	wheat|gbl64|BE40328 5	3259	404	82.6	blastp
1753	LYM248 H3	brachypodium 09vl G T773582	3260	407	84.5	blastp
1754	LYM248 H4	maize|gbl70|AI96695 7	3261	407	88.5	blastp
1755	LYM248 H5	sorghum 09vl SB04G 000645	3262	407	88.2	blastp
1756	LYM248 H2	switchgrass gb 167 DN 149511	3263	407	81.1	blastp
1757	LYM248 H3	wheat|gbl64|BE41803 3	3264	407	84.89	tblastn
1758	LYM250 HO	rice |gbl70|OS09G387 00	3265	409	100	tblastn
1758	LYM250 HO	rice |gbl70|OS09G387 00	3265	463	97.78	tblastn
1759	LYM251 Hl	antirrhinum|gb 16 61AJ5 60114	3266	410	82	blastp
1760	LYM251 H76	apple gbl 71 CN49264 3	3267	410	80.1	blastp
1761	LYM251 H77	arabidopsis lyrata|09vl|JGIAL012 198	3268	410	81.4	blastp
1762	LYM251 H3	arabidopsis gb 165 AT 2G17380	3269	410	80.7	blastp
1763	LYM251 H4	arabidopsis gb 165 AT 4G35410	3270	410	80.12	tblastn
1764	LYM251 H5	b olerace a gb 161 AM 3 8 5265	3271	410	81.4	blastp
1765	LYM251 H6	brapa|gbl62|L33527	3272	410	81.4	blastp
1766	LYM251 H7	banana|gbl67|FF5583 00	3273	410	81.37	tblastn

112

2018271407 30 Nov 2018

Nucl. SEQ ID NO:	Gene Name	cluster name	Polyp. SEQ ID NO:	Homolog, to SEQ ID NO:	% global identity	Algor.
1767	LYM251 H78	barley gbl 57SOLEXA IBE421807	3274	410	81.4	blastp
1768	LYM251 H9	basilicum gb 157.3 DY 343154	3275	410	80.12	tblastn
1769	LYM251 Hll	beangbl67 CV536707	3276	410	80.1	blastp
1770	LYM251 H79	brachypodium 09vl D V469153	3277	410	82.6	blastp
1771	LYM251 H13	canola|gbl61|CN7260 86	3278	410	81.4	blastp
1772	LYM251 H80	cassava 09vl CK6504 27	3279	410	80.12	tblastn
1773	LYM251 H81	cassava 09vl DV4488 85	3280	410	81.4	blastp
1774	LYM251 H82	castorbean 09vl XMO 02514342	3281	410	81.4	blastp
1775	LYM251 H16	c atharanthus | gb 1661E G554670	3282	410	81.4	blastp
1776	LYM251 H17	centaurea|gbl66|EH73 7707	3283	410	81.4	blastp
1777	LYM251 H18	centaurea|gbl66|EH78 2010	3284	410	81.4	blastp
1778	LYM251 H83	che stnut gb 17 0 S RRO 0 6295S0001854	3285	410	80.1	blastp
1779	LYM251 H84	chickpea|09v2| DY 475 463	3286	410	80.12	tblastn
1780	LYM251 H85	cichorium|gbl71 |EH6 77909	3287	410	81.4	blastp
1781	LYM251 H86	cichorium|gbl71 |EH6 81849	3288	410	80.7	blastp
1782	LYM251 H21	citrus|gbl66|CF41901 5	3289	410	82	blastp
1783	LYM251 H22	clover|gbl62|BB93513 6	3290	410	81.4	blastp
1784	LYM251 H23	cowpea gbl66 FF3837 63	3291	410	80.1	blastp
1785	LYM251 H87	cucumber 09vl CKO 85 508	3292	410	80.1	blastp
1786	LYM251 H24	dandelion gb 161 DY 8 22878	3293	410	80.1	blastp
1787	LYM251 H25	eucalyptus gbl 66 CT9 81708	3294	410	80.7	blastp
1788	LYM251 H88	femgbl71 DK949355	3295	410	80.1	blastp
1789	LYM251 H26	fescue gbl61DT7028 20	3296	410	82.6	blastp
1790	LYM251 H89	gerbera|09vl|AJ75631 9	3297	410	80.7	blastp
1791	LYM251 H27	grape|gbl60|CB00819 1	3298	410	82	blastp
1792	LYM251 H28	grape|gbl60|CD79981 9	3299	410	82	blastp
1793	LYM251 H29	ipomoea gbl 57.2 CJ75 1066	3300	410	81.4	blastp

113

2018271407 30 Nov 2018

Nucl. SEQ ID NO:	Gene Name	cluster name	Polyp. SEQ ID NO:	Homolog, to SEQ ID NO:	% global identity	Algor.
1794	LYM251 H90	jatropha|09vl |GO2471 40	3301	410	80.7	blastp
1795	LYM251 H30	lettuce gbl57.2 DW04 5452	3302	410	81.4	blastp
1796	LYM251 H31	liriodendron|gbl66|CK 762515	3303	410	83.2	blastp
1797	LYM251 H91	maize|gbl70|AA97985 6	3304	410	83.23	tblastn
1798	LYM251 H92	maize|gbl70|AI61934 2	3305	410	83.2	blastp
1799	LYM251 H93	maize|gbl70|AW1344 57	3306	410	91.3	tblastn
1800	LYM251 H94	medicago 09vl MSU9 3094	3307	410	82	blastp
1801	LYM251 H36	melon|gbl65|DV6335 83	3308	410	80.1	blastp
1802	LYM251 H95	millet 09vlEVO454P M010186	3309	410	83.2	blastp
1803	LYM251 H96	millet 09vlEVO454P M104784	3310	410	91.93	tblastn
1804	LYM251 H97	monkeyflower|09vl |G R007448	3311	410	82.6	blastp
1805	LYM251 H37	nuphar|gbl66|DT5885 73	3312	410	82	blastp
1806	LYM251 H98	oak|gbl70|DN949793	3313	410	80.1	blastp
1807	LYM251 H38	papaya|gbl65|EX2615 60	3314	410	81.4	blastp
1808	LYM251 H99	peanut|gbl 71 |EH0468 45	3315	410	82	blastp
1809	LYM251 H100	pepper gbl 71BM0682 91	3316	410	83.2	blastp
1810	LYM251 H101	petunia gbl71 FN0050 56	3317	410	82.6	blastp
1811	LYM251 H42	pine|gbl57.2|AA5568 57	3318	410	81.4	blastp
1812	LYM251 H43	pine|gbl57.2|AW2898 37	3319	410	81.4	blastp
1813	LYM251 H102	poplar|gbl70|AI16513 0	3320	410	80.1	blastp
1814	LYM251 H45	poppy gbl66 FG61376 3	3321	410	80.1	blastp
1815	LYM251 H46	potato|gbl57.2|BF054 079	3322	410	82.6	blastp
1816	LYM251 H47	pseudoroegneria gb 16 7|FF342572	3323	410	80.7	blastp
1817	LYM251 H48	radish|gbl64|EV52520 6	3324	410	80.7	blastp
1818	LYM251 H49	radish|gbl64|EV52859 3	3325	410	80.7	blastp
1819	LYM251 H50	radish|gbl64|EV53499 6	3326	410	81.4	blastp
1820	LYM251 H51	radish|gbl64|EV56567 7	3327	410	81.4	blastp

114

2018271407 30 Nov 2018

Nucl. SEQ ID NO:	Gene Name	cluster name	Polyp. SEQ ID NO:	Homolog, to SEQ ID NO:	% global identity	Algor.
1821	LYM251 H103	rice gbl70 OS03G570 40	3328	410	82.6	blastp
1822	LYM251 H53	rye|gbl64|BE637009	3329	410	80.7	blastp
1823	LYM251 H54	safflower|gbl62|EL40 2398	3330	410	81.4	blastp
1824	LYM251 H104	solanum phureja|09vl|SPHBGl 26373	3331	410	82.6	blastp
1825	LYM251 H105	sorghum 09v 1 SBO1G 003840	3332	410	91.3	tblastn
1826	LYM251 H106	sorghum 09v 1 SBO 1G 006180	3333	410	83.2	blastp
1827	LYM251 H57	soybean gbl 68 AW68 5285	3334	410	81.4	blastp
1828	LYM251 H58	soybean gbl68 BQ154 723	3335	410	80.1	blastp
1829	LYM251 H59	spruce gbl 62 Z93 754	3336	410	80.7	blastp
1830	LYM251 H107	sugarcane gbl57.3 BQ 533200	3337	410	83.2	blastp
1831	LYM251 H108	sugarcane gbl57.3BU 103624	3338	410	83.2	blastp
1832	LYM251 H62	sunflower gb 162 CD8 54801	3339	410	81.4	blastp
1833	LYM251 H63	sunflower gbl 62 DY9 17387	3340	410	81.4	blastp
1834	LYM251 H64	sunflower gb 162 EL4 8 5634	3341	410	81.4	blastp
1835	LYM251 H65	switchgrass gb 167 DN 152225	3342	410	83.2	blastp
1836	LYM251 H66	switchgrass gb 167 DN 152580	3343	410	82	blastp
1837	LYM251 H67	switchgrass gbl 67 FL8 27716	3344	410	92.5	blastp
1838	LYM251 H68	thellungiella gb 167 D N776639	3345	410	80.7	blastp
1839	LYM251 H69	tobacco gbl62CV020 782	3346	410	82	blastp
1840	LYM251 H109	tomato|09vl|BG12637 3	3347	410	83.2	blastp
1841	LYM251 H71	triphysaria|gbl 64|EY 0 17996	3348	410	80.7	blastp
1842	LYM251 H72	walnuts gbl 66 EL8929 83	3349	410	80.1	blastp
1843	LYM251 H73	walnuts gb 16 6 EL9034 96	3350	410	80.1	blastp
1844	LYM251 H74	wheat|gbl64|BE44435 6	3351	410	81.4	blastp
1845	LYM251 H75	wheat|gbl64|BE49857 9	3352	410	81.4	blastp
1846	LYM251 H76	wheat|gbl64|BQ90530 8	3353	410	81.4	blastp

115

2018271407 30 Nov 2018

Nucl. SEQ ID NO:	Gene Name	cluster name	Polyp. SEQ ID NO:	Homolog, to SEQ ID NO:	% global identity	Algor.
1847	LYM255 H3	brachypodium 09vl D V486276	3354	413	83.9	blastp
1848	LYM255 H4	maize|gbl70|AA07244 6	3355	413	80.8	blastp
1849	LYM255 H5	sorghum 09vl SB04G 034000	3356	413	82	blastp
1850	LYM255 H3	switchgrass gbl 67 FE6 06184	3357	413	83.8	blastp
1851	LYM260 HO	rice gbl70 QS09G388 00	3358	414	80.5	blastp
1852	LYM263 HO	maize|gbl70|AI67385 9	3359	416	87.47	tblastn
1853	LYM183 H8	brachypodium 09vl D V474476	3360	417	90.5	blastp
1853	LYM183 H8	brachypodium 09vl D V474476	3360	464	90.5	blastp
1854	LYM183 Hl	cenchrus|gbl66|EB655 853	3361	417	83.5	blastp
1854	LYM183 Hl	cenchrus|gbl66|EB655 853	3361	464	83.5	blastp
1855	LYM183 H2	leymusgbl66EG3757 19	3362	417	94.2	blastp
1855	LYM183 H2	leymusgbl66EG3757 19	3362	464	94.2	blastp
1856	LYM183 H9	maize | gb 17 01AI96467 3	3363	417	85.2	blastp
1856	LYM183 H9	maize | gb 17 01AI96467 3	3363	464	85.2	blastp
1857	LYM183 H10	rice gbl 70QS03G607 80	3364	417	84.8	blastp
1857	LYM183 H10	rice gbl 70QS03G607 80	3364	464	84.8	blastp
1858	LYM183 Hll	sorghum 09v 1SBO 1G 003070	3365	417	84.4	blastp
1858	LYM183 Hll	sorghum 09v 1 SBO 1G 003070	3365	464	84.4	blastp
1859	LYM183 H12	sugarcane gbl57.3 CA 111823	3366	417	83.6	blastp
1859	LYM183 H12	sugarcane gbl57.3 CA 111823	3366	464	83.6	blastp
1860	LYM183 H6	switchgrass gb 167 DN 151763	3367	417	83.4	blastp
1860	LYM183 H6	switchgrass gb 167 DN 151763	3367	464	83.4	blastp
1861	LYM183 H7	wheat|gbl64|BE51561 6	3368	417	93.9	tblastn
1861	LYM183 H7	wheat|gbl64|BE51561 6	3368	464	93.63	tblastn
1862	LYM183 H8	wheat|gbl64|BQ16080 3	3369	417	94.7	blastp
1862	LYM183 H8	wheat|gbl64|BQ16080 3	3369	464	94.7	blastp
1863	LYM256 H2	rice gbl 70QS05G451 10	3370	418	87.3	blastp

116

2018271407 30 Nov 2018

Nucl. SEQ ID NO:	Gene Name	cluster name	Polyp. SEQ ID NO:	Homolog, to SEQ ID NO:	% global identity	Algor.
1864	LYM256 H3	rice gbl70 OS10G079 70	3371	418	81.09	tblastn
1865	LYM200 HO	sorghum 09vl SB04G 005600	3372	419	86.5	blastp
1866	LYM267 Hl	sorghum 09v 1 SBO1G 044240	3373	420	88.3	blastp
1867	LYM268 Hl	sugarcane gbl57.3 CA 079076	3374	421	81.6	blastp
1868	LYM270 HO	sorghum|09vl|SB02G 040045	3375	422	82.3	blastp
1869	LYM271 H7	barley gbl 57SOLEXA IBG344953	3376	423	89.9	blastp
1870	LYM271 H8	brachypodium 09vl G T838823	3377	423	89.9	blastp
1871	LYM271 H9	rice gbl70 OS07G434 60	3378	423	91.1	blastp
1872	LYM271 H10	sorghum|09vl|SB02G 040020	3379	423	96.5	blastp
1873	LYM271 Hll	sugarcane gbl57.3 CA 118167	3380	423	89.53	tblastn
1874	LYM271 H6	switchgrass gbl 67 FL6 91032	3381	423	94.2	blastp
1875	LYM271 H7	wheat|gbl64|CJ66420 9	3382	423	91.5	blastp
1876	LYM273 H4	brachypodium 09vl D V469687	3383	425	83.3	blastp
1877	LYM273 H5	maize|gbl70|AW3559 78	3384	425	85.2	blastp
1878	LYM273 H6	sorghum 09vl SB03G 044410	3385	425	84	blastp
1879	LYM273 H4	wheat|gbl64|BE51837 7	3386	425	85	blastp
1880	LYM274 HO	rice gbl70 OS01G702 40	3387	426	100	blastp
1880	LYM274 HO	rice gbl70 OS01G702 40	3387	466	89.2	blastp
1881	LYM278 H9	maize | gb 17 01LLDQ24 4681	3388	428	95.2	blastp
1882	LYM278 H2	rye|gbl64|Z23257	3389	428	92.86	tblastn
1883	LYM278 H3	wheat|gbl64|AL82126 4	3390	428	95.3	blastp
1884	LYM278 H4	wheat|gbl64|BE51672 3	3391	428	94	blastp
1885	LYM278 H5	wheat|gbl64|BF20040 2	3392	428	86.9	tblastn
1886	LYM278 H6	wheat|gbl64|BF47442 3	3393	428	92.86	tblastn
1887	LYM278 H7	wheat gbl 64 BG90946 2	3394	428	89.3	blastp
1888	LYM278 H8	wheatgbl64 BQ57909 7	3395	428	95.24	tblastn
1889	LYM278 H9	wheat|gbl64|CA65034 9	3396	428	83.3	blastp

117

2018271407 30 Nov 2018

Nucl. SEQ ID NO:	Gene Name	cluster name	Polyp. SEQ ID NO:	Homolog, to SEQ ID NO:	% global identity	Algor.
1890	LYM284 H16	barley gbl 57SOLEXA IBE438857	3397	430	86.4	blastp
1891	LYM284 H17	brachypodium 09vl D V474685	3398	430	84.3	blastp
1892	LYM284 H18	brachypodium 09vl D V488161	3399	430	88.2	blastp
1893	LYM284 H3	fescue gbl61DT6744 46	3400	430	86.91	tblastn
1894	LYM284 H19	maize|gbl70|AI63725 6	3401	430	88.5	blastp
1895	LYM284 H20	maize|gbl70|AI86113 1	3402	430	84.3	blastp
1896	LYM284 H21	maize|gbl70|BM5012 76	3403	430	83.8	blastp
1897	LYM284 H22	rice gbl70 OS01G430 20	3404	430	81.4	blastp
1898	LYM284 H23	rice gbl70 OS01G465 70	3405	430	84.6	blastp
1899	LYM284 H24	sorghum|09vl|SB03G 027960	3406	430	80.6	blastp
1900	LYM284 H25	sorghum|09vl|SB03G 029790	3407	430	85.1	blastp
1901	LYM284 H26	sorghum 09v 1 SB09G 029130	3408	430	87.2	blastp
1902	LYM284 H27	sugarcane gbl57.3 BQ 533889	3409	430	84.5	blastp
1903	LYM284 H12	switchgrass gb 167 DN 151636	3410	430	81	blastp
1904	LYM284 H13	switchgrass gbl 67 FE6 34580	3411	430	85.4	blastp
1905	LYM284 H14	switchgrass gbl 67 FL7 12120	3412	430	89.53	tblastn
1906	LYM284 H15	wheat|gbl64|BE40078 9	3413	430	88.1	blastp
1907	LYM284 H16	wheat|gbl64|BF20080 4	3414	430	80.4	blastp
1908	LYM285 H3	brachypodium 09vl D V476342	3415	431	89.2	blastp
1909	LYM285 H4	maize|gbl70|AI37229 8	3416	431	88.1	blastp
1910	LYM285 H5	rice gbl70 OS01G699 00	3417	431	99.82	tblastn
1911	LYM285 H6	sorghum|09vl|SB03G 044210	3418	431	89.3	blastp
1912	LYM285 H3	switchgrass gb 167 DN 142770	3419	431	89.75	tblastn
1913	LYM288 H6	brachypodium 09vl D V471350	3420	433	83.3	blastp
1914	LYM288 Hl	leymus gbl 66 EG3779 96	3421	433	84.7	blastp
1915	LYM288 H7	maize gbl70AI97792 4	3422	433	84.5	blastp
1916	LYM288 H8	sorghum|09vl|SB02G 039240	3423	433	83.9	blastp

118

2018271407 30 Nov 2018

Nucl. SEQ ID NO:	Gene Name	cluster name	Polyp. SEQ ID NO:	Homolog, to SEQ ID NO:	% global identity	Algor.
1917	LYM288 H9	sugarcane gbl57.3 CA 067537	3424	433	85.8	blastp
1918	LYM288 H5	switchgrass gb 167 DN 151710	3425	433	85.3	blastp
1919	LYM288 H6	switchgrass gbl 67 FE6 10990	3426	433	85.3	blastp
1920	LYM289 H39	barley gbl 57SOLEXA IAL500321	3427	434	91.1	blastp
1921	LYM289 H40	barley gbl 57SOLEXA AV915627	3428	434	92.7	blastp
1922	LYM289 H41	barley gbl 57SOLEXA IBF624195	3429	434	98.2	blastp
1923	LYM289 H42	barley gbl 57SOLEXA |BF627133	3430	434	92.7	blastp
1924	LYM289 H43	barley gbl 57SOLEXA |BQ739963	3431	434	92.7	blastp
1925	LYM289 H44	brachypodium 09vl G FXEF059989X41	3432	434	81.8	blastp
1926	LYM289 H7	cacao|gbl67|CU56893 3	3433	434	85.5	blastp
1927	LYM289 H8	fescue gbl 61 |CK8015 01	3434	434	90.9	blastp
1928	LYM289 H9	fescue gbl61DT6836 63	3435	434	90.9	blastp
1929	LYM289 H10	leymus gb 166 EG3 762 87	3436	434	96.4	blastp
1930	LYM289 H45	lolium|09vl|AU24668 3	3437	434	89.1	blastp
1931	LYM289 Hll	lovegrass gbl67DN48 0351	3438	434	87.3	blastp
1932	LYM289 H46	maize|gbl70|AI63724 2	3439	434	81.8	blastp
1933	LYM289 H47	maize|gbl70|LLEC86 5320	3440	434	81.8	blastp
1934	LYM289 H48	maize|gbl70|T12715	3441	434	87.3	blastp
1935	LYM289 H49	millet 09vl CD724594	3442	434	80	blastp
1936	LYM289 H50	millet|09vl|EB410971	3443	434	87.3	blastp
1937	LYM289 H15	oat|gbl64|CN818354	3444	434	90.9	blastp
1938	LYM289 H16	pine apple gb 15 7.2 DT 337702	3445	434	80	blastp
1939	LYM289 H51	rice gbl70 OS06G051 20	3446	434	83.6	blastp
1940	LYM289 H52	sorghum 09v 1 SB09G 005410	3447	434	80	blastp
1941	LYM289 H53	sorghum 09v 1 SB 10G 002980	3448	434	87.3	blastp
1942	LYM289 H54	sugarcane gbl57.3 CA 117495	3449	434	87.3	blastp
1943	LYM289 H55	sugarcane gbl57.3 CA 149658	3450	434	81.8	blastp

119

2018271407 30 Nov 2018

Nucl. SEQ ID NO:	Gene Name	cluster name	Polyp. SEQ ID NO:	Homolog, to SEQ ID NO:	% global identity	Algor.
1944	LYM289 H56	sugarcane gbl57.3CF 575668	3451	434	87.3	blastp
1945	LYM289 H23	switchgrass gb 167 DN 144776	3452	434	80	blastp
1946	LYM289 H24	switchgrass gb 167 DN 144989	3453	434	89.1	blastp
1947	LYM289 H25	switchgrass gbl 67 FE6 07508	3454	434	89.1	blastp
1948	LYM289 H26	switchgrass gbl 67 FL7 36037	3455	434	81.8	blastp
1949	LYM289 H27	wheat|gbl64|AL81111 9	3456	434	98.2	blastp
1950	LYM289 H28	wheat|gbl64|BE44378 6	3457	434	96.4	blastp
1951	LYM289 H29	wheat gbl 64 BG90709 8	3458	434	98.2	blastp
1952	LYM289 H30	wheat|gb 164|BM 13 65 71	3459	434	96.4	blastp
1953	LYM289 H31	wheat|gbl64|BQ80426 1	3460	434	96.4	blastp
1954	LYM289 H32	wheat|gb 164|CA6165 8 6	3461	434	81.8	blastp
1955	LYM289 H33	wheat|gbl64|CA64017 8	3462	434	98.2	blastp
1956	LYM289 H34	wheat|gbl64|CA64378 4	3463	434	98.2	blastp
1957	LYM289 H35	wheatgbl64 CA73397 2	3464	434	80.36	tblastn
1958	LYM289 H36	wheatgbl64 CD89687 3	3465	434	82.1	blastp
1959	LYM289 H37	wheat|gbl64|CJ58670 9	3466	434	89.1	blastp
1960	LYM289 H38	wheat gbl 64 CJ64697 0	3467	434	80	blastp
1961	LYM289 H39	wheatgbl64 CJ90337 8	3468	434	96.4	blastp
1962	LYM290 H10	barley gbl 57SOLEXA |BE412989	3469	435	82.9	blastp
1963	LYM290 Hll	brachypodium 09vl G T759831	3470	435	81.9	blastp
1964	LYM290 H12	rice gbl 70QS04G202 30	3471	435	82.9	blastp
1965	LYM290 H3	rye|gbl64|BE495099	3472	435	81.9	blastp
1966	LYM290 H13	sorghum 09v 1 SBO 1G 009390	3473	435	95.2	blastp
1967	LYM290 H14	sorghum 09v 1 SB06G 004500	3474	435	94.8	blastp
1968	LYM290 H15	sugarcane gbl57.3 BQ 535968	3475	435	95.7	blastp
1969	LYM290 H16	sugarcane gbl57.3 CA 136629	3476	435	80.3	blastp
1970	LYM290 H8	switchgrass gbl 67 FE6 22978	3477	435	91.4	blastp

120

2018271407 30 Nov 2018

Nucl. SEQ ID NO:	Gene Name	cluster name	Polyp. SEQ ID NO:	Homolog, to SEQ ID NO:	% global identity	Algor.
1971	LYM290 H9	wheat|gbl64|BE43009 0	3478	435	83.3	blastp
1972	LYM290 H10	wheat|gbl64|BF19952 4	3479	435	82.4	blastp
1973	LYM293 HO	rice |gbl70|OS09G385 10	3480	437	91.8	blastp

Table 2: Provided are the homologous polypeptides and polynucleotides of the genes for increasing yield (e.g., oil yield, seed yield, fiber yield and/or quality), growth rate, vigor, biomass, abiotic stress tolerance, nitrogen use efficiency, water use efficiency and fertilizer use efficiency genes of a plant which are listed in Table 1 above. Homology was calculated as % of identity over the aligned sequences. The query sequences were polynucleotide sequences SEQ ID NOs: 1-239 and polypeptide SEQ ID NOs:240-465 and the subject sequences are protein sequences identified in the database based on greater than 80 % identity to the predicted translated sequences of the query nucleotide sequences or to the polypeptide sequences. Nucl. = polynucleotide; polyp. = polypeptide; Algor. = algorithm (used for sequence alignment and determination of percent homology).

The following sequences were found to be 100 % identical: SEQ ID NO: 4 is identical to SEQ ID NO: 478; SEQ ID NO: 24 is identical to SEQ ID NO: 914; SEQ ID NO: 79 is identical to SEQ ID NO: 1050; SEQ ID NO: 132 is identical to SEQ ID NO: 3608; SEQ ID NO: 163 is identical to SEQ ID NO: 1734; SEQ ID NO: 249 is identical to SEQ ID NO: 2100, 2101, 2103, and 2108; SEQ ID NO: 321 is identical to SEQ ID NO: 2771; SEQ ID NO: 382 is identical to SEQ ID NO: 3019; SEQ ID NO: 387 is identical to SEQ ID NO: 2945; SEQ ID NO426 is identical to SEQ ID NO: 3387; SEQ ID NO: 446 is identical to SEQ ID NO: 2946; SEQ ID NO: 449 is identical to SEQ ID NO: 3705; SEQ ID NO: 2005 is identical to SEQ ID NO: 2011 and 2012; SEQ ID NO: 2007 is identical to SEQ ID NO: 2043 and 2045; SEQ ID NO: 2038 is identical to SEQ ID NO: 2039; SEQ ID NO: 2071 is identical to SEQ ID NO: 2072; SEQ ID NO: 2075 is identical to SEQ ID NO:2076, 2078, 2079, 2083, 2084, 2086, 2089, 2090, 2092, 2093, 2095, 2120, 2122, 2235, 2236, 2238, 2239, 2277, and 2278; SEQ ID NO: 2080 is identical to SEQ ID NO: 2155, 2176, 2179, 2248, and 2268; SEQ ID NO: 2102 is identical to SEQ ID NO: 2193; SEQ ID NO: 2105 is identical to SEQ ID NO: 2147, 2181, 2196, 2197, 2210, 2211, 2213, 2254, and 2256; SEQ ID NO: 2125 is identical to SEQ ID NO: 2126 and 2127; SEQ ID NO: 2130 is identical to SEQ ID NO: 2131, 2214, 2228, 2231, and 2251; SEQ ID NO: 2134 is identical to SEQ ID NO: 2247; SEQ ID NO: 2144 is identical to SEQ ID NO: 2153 and 2201; SEQ ID NO: 2188 is identical to

2018271407 30 Nov 2018

121

SEQ ID NO: 2191, 2253, 2264, and 2271; SEQ ID NO: 2189 is identical to SEQ ID NO: 2202, 2252, 2265, 2266, 2270, and 2272; SEQ ID NO: 2215 is identical to SEQ ID NO: 2250 and 2284; SEQ ID NO: 2218 is identical to SEQ ID NO: 2219; SEQ ID NO: 2220 is identical to SEQ ID NO: 2221 and 2258; SEQ ID NO: 2356 is identical to SEQ ID NO: 2357 and 2359; SEQ ID NO: 2380 is identical to SEQ ID NO: 2402; SEQ ID NO: 2384 is identical to SEQ ID NO: 2387; SEQ ID NO: 2463 is identical to SEQ ID NO:2464; SEQ ID NO: 2481 is identical to SEQ ID NO: 2483; SEQ ID NO: 2485 is identical to SEQ ID NO: 2486; SEQ ID NO: 2533 is identical to SEQ ID NO: 2538; SEQ ID NO: 2582 is identical to SEQ ID NO: 2583; SEQ ID NO: 2588 is identical to SEQ ID NO: 2594, 2603, 2621, and 2629; SEQ ID NO: 2589 is identical to SEQ ID NO:2590, 2591, 2592, 2595, 2596, 2601, 2604, 2605, 2623, 2624, 2626, 2627, 2630, 2756, 2757, 2758, 2760, 2761, 2762, 2764, 2765, and 2807; SEQ ID NO:2593 is identical to SEQ ID NO:2632, and 2767; SEQ ID NO: 2600 is identical to SEQ ID NO: 2622; SEQ ID NO: 2606 is identical to SEQ ID NO: 2610; SEQ ID NO: 2607 is identical to SEQ ID NO: 2609; SEQ ID NO: 2625 is identical to SEQ ID NO: 2713; SEQ ID NO: 2638 is identical to SEQ ID NO: 2639; SEQ ID NO: 2644 is identical to SEQ ID NO: 2727; SEQ ID NO: 2645 is identical to SEQ ID NO: 2726; SEQ ID NO: 2665 is identical to SEQ ID NO: 2719; SEQ ID NO: 2687 is identical to SEQ ID NO: 2689; SEQ ID NO: 2691 is identical to SEQ ID NO: 2693 and 2698; SEQ ID NO: 2694 is identical to SEQ ID NO: 2697; SEQ ID NO: 2712 is identical to SEQ ID NO: 2816, 2817 and 2818; SEQ ID NO: 2748 is identical to SEQ ID NO: 2749, 2778 and 2815; SEQ ID NO: 2750 is identical to SEQ ID NO: 2751 and 2776; SEQ ID NO: 2779 is identical to SEQ ID NO: 2790 and 2794; SEQ ID NO: 2801 is identical to SEQ ID NO: 2804; SEQ ID NO: 2873 is identical to SEQ ID NO: 2880; SEQ ID NO: 2876 is identical to SEQ ID NO: 2881; SEQ ID NO: 2877 is identical to SEQ ID NO: 2879; SEQ ID NO: 2908 is identical to SEQ ID NO: 2909; SEQ ID NO: 3135 is identical to SEQ ID NO: 3136; SEQ ID NO: 3138 is identical to SEQ ID NO: 3145; SEQ ID NO: 3268 is identical to SEQ ID NO: 3271, 3272, 3278, 3326, and 3327; SEQ ID NO: 3274 is identical to SEQ ID NO: 3351, 3352, and 3353; SEQ ID NO: 3277 is identical to SEQ ID NO: 3296; SEQ ID NO: 3285 is identical to SEQ ID NO: 3313; SEQ ID NO: 3287 is identical to SEQ ID NO: 3302; SEQ ID NO: 3309 is identical to SEQ ID NO: 3333, 3337, 3338, and 3342; SEQ ID NO: 3318 is identical to SEQ ID NO: 3319; SEQ

2018271407 30 Nov 2018

122

ID NO: 3322 is identical to SEQ ID NO: 3331; SEQ ID NO: 3428 is identical to SEQ ID NO: 3430 3431; SEQ ID NO: 3434 is identical to SEQ ID NO: 3435; SEQ ID NO: 3439 is identical to SEQ ID NO: 3440 and 3461; SEQ ID NO: 3448 is identical to SEQ ID NO: 3449 and 3451; SEQ ID NO: 3453 is identical to SEQ ID NO: 3454; SEQ ID NO: 3456 is identical to SEQ ID NO: 3458, 3462 and 3463; SEQ ID NO: 3457 is identical to SEQ ID NO: 3459 and 3468;

The output of the functional genomics approach described herein is a set of genes highly predicted to improve yield and/or other agronomic important traits such as growth rate, vigor, oil content, fiber yield and/or quality, biomass, growth rate, abiotic stress tolerance, nitrogen use efficiency, water use efficiency and fertilizer use efficiency of a plant by increasing their expression. Although each gene is predicted to have its own impact, modifying the mode of expression of more than one gene is expected to provide an additive or synergistic effect on the plant yield and/or other agronomic important yields performance. Altering the expression of each gene described here alone or set of genes together increases the overall yield and/or other agronomic important traits, hence expects to increase agricultural productivity.

EXAMPLE 3

PRODUCTION OF BARLEY TRANSCRIPTOM AND HIGH THROUGHPUT CORRELATION ANALYSIS USING 44K BARLEY OLIGONUCLEOTIDE MICROARRAY

In order to produce a high throughput correlation analysis, the present inventors utilized a Barley oligonucleotide micro-array, produced by Agilent Technologies [Hypertext Transfer Protocol ://World Wide Web (dot) chem. (dot) agilent (dot) com/Scripts/PDS (dot) asp?lPage=50879], The array oligonucleotide represents about 47,500 Barley genes and transcripts. In order to define correlations between the levels of RNA expression and yield or vigor related parameters, various plant characteristics of 25 different Barley accessions were analyzed. Among them, 13 accessions encompassing the observed variance were selected for RNA expression analysis. The correlation between the RNA levels and the characterized parameters was analyzed using Pearson correlation test [Hypertext Transfer Protocol ://World Wide Web (dot) davidmlane (dot) com/hyperstat/A34739 (dot) html].

2018271407 30 Nov 2018

123

Experimental procedures

RNA extraction - Five tissues at different developmental stages [meristem, flower, booting spike, stem, flag leaf], representing different plant characteristics, were sampled and RNA was extracted using TRIzol Reagent from Invitrogen [Hypertext Transfer Protocol ://World Wide Web (dot) invitrogen (dot) com/content (dot)cfm?pageid=469]. Approximately 30-50 mg of tissue was taken from samples. The weighed tissues were ground using pestle and mortar in liquid nitrogen and resuspended in 500 μΐ of TRIzol Reagent. To the homogenized lysate, 100 μΐ of chloroform was added followed by precipitation using isopropanol and two washes with 75 % ethanol. The RNA was eluted in 30 μΐ of RNase-free water. RNA samples were cleaned up using Qiagen’s RNeasy minikit clean-up protocol as per the manufacturer’s protocol (QIAGEN Inc, CA USA).

For convenience, each micro-array expression information tissue type has received a Set ID as summarized in Table 3 below.

Table 3

Barley transcriptom expression sets

Expression Set	Set ID
Meristem	A
Flower	B
Booting spike	C
Stem	D
Flag leaf	E

Table 3

Barley yield components and vigor related parameters assessment - 25 Barley accessions in 4 repetitive blocks (named A, B, C, and D), each containing 4 plants per plot were grown at net house. Plants were phenotyped on a daily basis following the standard descriptor of barley (Table 4, below). Harvest was conducted while 50 % of the spikes were dry to avoid spontaneous release of the seeds. Plants were separated to the vegetative part and spikes, of them, 5 spikes were threshed (grains were separated from the glumes) for additional grain analysis such as size measurement, grain count per spike and grain yield per spike. All material was oven dried and the seeds were threshed manually from the spikes prior to measurement of the seed characteristics (weight and size) using scanning and image analysis. The image analysis system

2018271407 30 Nov 2018

124 included a personal desktop computer (Intel P4 3.0 GHz processor) and a public domain program - ImageJ 1.37 (Java based image processing program, which was developed at the U.S. National Institutes of Health and freely available on the internet [Hypertext Transfer Protocol://rsbweb (dot) nih (dot) gov/]. Next, analyzed data was saved to text files and processed using the JMP statistical analysis software (SAS institute).

Table 4

Barley standard descriptors

Trait	Parameter	Range	Description
Growth habit	Scoring	1-9	Prostrate (1) or Erect (9)
Hairiness of basal leaves	Scoring	P (Presence)ZA (Absence)	Absence (1) or Presence (2)
Stem pigmentation	Scoring	1-5	Green (1), Basal only or Half or more (5)
Days to Flowering	Days		Days from sowing to emergence of awns
Plant height	Centimeter (cm)		Height from ground level to top of the longest spike excluding awns
Spikes per plant	Number		Terminal Counting
Spike length	Centimeter (cm)		Terminal Counting 5 spikes per plant
Grains per spike	Number		Terminal Counting 5 spikes per plant
Vegetative dry weight	Gram		Oven-dried for 48 hours at 70°C
Spikes dry weight	Gram		Oven-dried for 48 hours at 30°C

Table 4.

Grains per spike - At the end of the experiment (50 % of the spikes were dry) all spikes from plots within blocks A-D are collected. The total number of grains from 5 spikes that were manually threshed was counted. The average grain per spike is calculated by dividing the total grain number by the number of spikes.

Grain average size (cm) - At the end of the experiment (50 % of the spikes were dry) all spikes from plots within blocks A-D are collected. The total grains from 5 spikes that were manually threshed were scanned and images were analyzed using the digital imaging system. Grain scanning was done using Brother scanner (model DCP135), at the 200 dpi resolution and analyzed with Image J software. The average grain size was calculated by dividing the total grain size by the total grain number.

Grain average weight (mgr) - At the end of the experiment (50 % of the spikes were dry) all spikes from plots within blocks A-D are collected. The total grains from 5 spikes that were manually threshed were counted and weight. The average weight was calculated by dividing the total weight by the total grain number.

2018271407 30 Nov 2018

125

Grain yield per spike (gr) - At the end of the experiment (50 % of the spikes were dry) all spikes from plots within blocks A-D are collected. The total grains from 5 spikes that were manually threshed were weight. The grain yield was calculated by dividing the total weight by the spike number.

Spike length analysis - At the end of the experiment (50 % of the spikes were dry) all spikes from plots within blocks A-D are collected. The five chosen spikes per plant were measured using measuring tape excluding the awns.

Spike number analysis - At the end of the experiment (50 % of the spikes were dry) all spikes from plots within blocks A-D are collected. The spikes per plant were counted.

Growth habit scoring - At the growth stage 10 (booting), each of the plants was scored for its growth habit nature. The scale that was used was 1 for prostate nature till 9 for erect.

Hairiness of basal leaves - At the growth stage 5 (leaf sheath strongly erect; end of tillering), each of the plants was scored for its hairiness nature of the leaf before the last. The scale that was used was 1 for prostate nature till 9 for erect.

Plant height - At the harvest stage (50 % of spikes were dry) each of the plants was measured for its height using measuring tape. Height was measured from ground level to top of the longest spike excluding awns.

Days to flowering - Each of the plants was monitored for flowering date. Days of flowering was calculated from sowing date till flowering date.

Stem pigmentation - At the growth stage 10 (booting), each of the plants was scored for its stem color. The scale that was used was 1 for green till 5 for full purple.

Vegetative dry weight and spike yield - At the end of the experiment (50 % of the spikes were dry) all spikes and vegetative material from plots within blocks A-D are collected. The biomass and spikes weight of each plot was separated, measured and divided by the number of plants.

Dry weight = total weight of the vegetative portion above ground (excluding roots) after drying at 70 °C in oven for 48 hours;

Spike yield per plant = total spike weight per plant (gr) after drying at 30 °C in oven for 48 hours.

Harvest Index (for barley) - The harvest index is calculated using Formula VI.

2018271407 30 Nov 2018

126

Formula VI: Harvest Index = Average spike dry weight per plant/ (Average vegetative dry weight per plant + Average spike dry weight per plant)

Table 5

Barley correlated parameters (vectors)

Correlated parameter with (units)	Correlation Id
Grains per spike (numbers)	1
Grains size (mm2)	2
Grain weight (miligrams)	3
Grain Yield per spike (gr/spike)	4
Spike length (cm)	5
Spikes per plant (numbers)	6
Growth habit (scores 1-9)	7
Hairiness of basal leaves (scoring 1-2)	8
Plant height (cm)	9
Days to flowering (days)	10
Stem pigmentation (scoring 1-5)	11
Vegetative dry weight (gram)	12
Harvest Index (ratio)	13

Table 5.

Experimental Results

13 different Barley accessions were grown and characterized for 13 parameters as described above. The average for each of the measured parameter was calculated using the JMP software and values are summarized in Tables 6 and 7 below. Subsequent correlation analysis between the various transcriptom sets (Table 3) and the average parameters, was conducted. Follow, results were integrated to the database.

Table 6

Measured parameters of correlation Ids in Barley accessions

Accession /Parameter	6	10	3	5	2	1	7
Amatzya	48.85	62.40	35.05	12.04	0.27	20.23	2.60
Ashqelon	48.27	64.08	28.06	10.93	0.23	17.98	2.00
Canada park	37.42	65.15	28.76	11.83	0.24	17.27	1.92
Havarim stream	61.92	58.92	17.87	9.90	0.17	17.73	3.17
Jordan est	33.27	63.00	41.22	11.68	0.29	14.47	4.33
Klil	41.69	70.54	29.73	11.53	0.28	16.78	2.69
Maale Efraim	ND	52.80	25.22	8.86	0.22	13.47	3.60
Mt Arbel	40.63	60.88	34.99	11.22	0.28	14.07	3.50
Mt Harif	62.00	58.10	20.58	11.11	0.19	21.54	3.00
Neomi	49.33	53.00	27.50	8.58	0.22	12.10	3.67
Neot Kdumim	50.60	60.40	37.13	10.18	0.27	14.36	2.47

127

2018271407 30 Nov 2018

Accession /Parameter	6	10	3	5	2	1	7
Oren canyon	43.09	64.58	29.56	10.51	0.27	15.28	3.50
Yeruham	51.40	56.00	19.58	9.80	0.18	17.07	3.00

Table 6. Provided are the values of each of the parameters measured in Barley accessions according to the following correlation identifications (Correlation Ids): 6 = Spikes per plant; 10 = Days to flowering; 3 = Grain weight; 5 = Spike length; 2 = Grains Size; 1 = Grains per spike; 7 = Growth habit.

Table 7

Barley accessions, additional measured parameters

Accession /Parameter	8	9	4	11	12	13
Amatzya	1.53	134.27	3.56	1.13	78.87	0.45
Ashqelon	1.33	130.50	2.54	2.50	66.14	0.42
Canada park	1.69	138.77	2.58	1.69	68.49	0.40
Havarim stream	1.08	114.58	1.57	1.75	53.39	0.44
Jordan est	1.42	127.75	3.03	2.33	68.30	0.43
Klil	1.69	129.38	2.52	2.31	74.17	0.40
Maale Efraim	1.30	103.89	1.55	1.70	35.35	0.52
Mt Arbel	1.19	121.63	2.62	2.19	58.33	0.48
Mt Harif	1.00	126.80	2.30	2.30	62.23	0.44
Neomi	1.17	99.83	1.68	1.83	38.32	0.49
Neot Kdumim	1.60	121.40	2.68	3.07	68.31	0.45
Oren canyon	1.08	118.42	2.35	1.58	56.15	ND
Yeruham	1.17	117.17	1.67	2.17	42.68	ND

Table 7. Provided are the values of each of the parameters measured in Barley accessions according to the following correlation identifications (Correlation Ids): 8 = Hairiness of basal leaves; 9 = Plant height; 4 = Grain yield per spike; 11 = Stem pigmentation; 12 = Vegetative dry weight; 13 = Harvest Index.

Table 8

Correlation between the expression level of the selected polynucleotides of the invention and their homologues in specific tissues or developmental stages and the phenotypic performance across Barley ecotypes

Gene Name	Expression Set	Correlation Vector	R	P
LYM26	A	12	0.87938	0.00178
LYM26	A	4	0.86421	0.00265
LYM26	A	12	0.85977	0.00069
LYM26	A	4	0.84991	0.00092
LYM26	A	9	0.83315	0.00145
LYM26	A	9	0.81930	0.00689
LYM26	A	5	0.81231	0.00238
LYM26	A	5	0.80624	0.00867
LYM26	C	1	0.74897	0.00799
LYM26	C	1	0.73316	0.02461

128

2018271407 30 Nov 2018

Gene Name	Expression Set	Correlation Vector	R	P
LYM26	A	10	0.72560	0.02691
LYM51	A	10	0.93629	0.00020
LYM51	A	12	0.92036	0.00043
LYM51	A	5	0.88679	0.00144
LYM51	A	9	0.87500	0.00201
LYM51	A	10	0.85681	0.00075
LYM51	A	4	0.82050	0.00674
LYM51	A	5	0.78204	0.00445
LYM51	A	9	0.77050	0.00552
LYM51	A	12	0.74603	0.00838
LYM51	A	4	0.71036	0.01430
LYM59	A	4	0.88939	0.00133
LYM59	A	3	0.80853	0.00834
LYM59	A	2	0.80307	0.00915
LYM59	A	12	0.79319	0.01075
LYM59	A	5	0.73433	0.02426
LYM59	A	10	0.72556	0.02693
LYM66	A	1	0.77697	0.01376
LYM66	A	1	0.75508	0.00722
LYM82	A	10	0.88760	0.00140
LYM82	A	12	0.86378	0.00061
LYM82	A	12	0.85529	0.00329
LYM82	A	10	0.84623	0.00102
LYM82	A	9	0.83000	0.00562
LYM82	A	9	0.82602	0.00173
LYM82	A	4	0.81534	0.00222
LYM82	A	4	0.79017	0.01127
LYM82	A	5	0.78467	0.00424
LYM82	A	5	0.76164	0.01709
LYM84	C	2	0.79418	0.01058
LYM84	B	2	0.79145	0.01928
LYM84	C	3	0.77694	0.01377
LYM84	B	3	0.75502	0.03033
LYM84	A	2	0.70823	0.01473
LYM99	C	7	0.75021	0.01989
LYM99	A	7	0.72294	0.02776
LYM95	B	2	0.81158	0.00436
LYM95	B	3	0.77615	0.00830
LYM95	B	10	0.73186	0.01612
LYM95	C	2	0.72471	0.02719
LYM95	B	5	0.71170	0.02097
LYM100	A	3	0.77258	0.01467
LYM100	A	4	0.76559	0.01619
LYM100	A	2	0.72628	0.02670
LYM105	A	4	0.80126	0.00943
LYM105	A	2	0.80060	0.00953
LYM105	A	3	0.78770	0.01171
LYM105	A	8	0.71795	0.02939
LYM105	B	1	0.71160	0.04775
LYM137	C	5	0.91789	0.00007
LYM137	C	4	0.87211	0.00046
LYM137	C	10	0.86290	0.00063
LYM137	C	12	0.85934	0.00070

129

2018271407 30 Nov 2018

Gene Name	Expression Set	Correlation Vector	R	P
LYM137	C	9	0.82372	0.00183
LYM137	C	3	0.73788	0.02323
LYM137	c	2	0.71562	0.03017
LYM140	c	6	0.83623	0.00968
LYM142	B	6	0.85850	0.01338
LYM142	A	4	0.80126	0.00943
LYM142	A	2	0.80060	0.00953
LYM142	A	3	0.78770	0.01171
LYM142	A	8	0.73208	0.01042
LYM142	A	8	0.71795	0.02939
LYM142	B	1	0.71160	0.04775
LYM148	A	4	0.79887	0.00318
LYM148	A	12	0.76743	0.00583
LYM148	A	4	0.76342	0.01668
LYM148	A	9	0.74349	0.00873
LYM148	A	5	0.70612	0.01516
LYM149	B	7	0.75092	0.03177
LYM156	C	2	0.79406	0.00352
LYM156	C	2	0.77724	0.01371
LYM156	A	2	0.76712	0.00586
LYM156	A	3	0.73707	0.00965
LYM156	C	3	0.71152	0.01407
LYM156	B	3	0.70014	0.05315
LYM157	A	4	0.78681	0.01187
LYM157	A	3	0.73234	0.02485
LYM157	A	12	0.72729	0.02639
LYM160	A	12	0.87825	0.00184
LYM160	A	10	0.82699	0.00596
LYM160	A	12	0.82567	0.00174
LYM160	A	9	0.80855	0.00834
LYM160	A	9	0.80222	0.00297
LYM160	A	10	0.74770	0.00815
LYM160	A	5	0.72266	0.02785
LYM160	A	5	0.71752	0.01292
LYM154	C	2	0.92810	0.00004
LYM154	C	3	0.90313	0.00014
LYM154	c	4	0.85169	0.00088
LYM154	c	5	0.73538	0.00991
LYM154	c	10	0.71818	0.01280
LYM154	c	12	0.70985	0.01440
LYM155	c	6	0.72312	0.04266
LYM155	c	1	0.70598	0.01519
LYM180	c	1	0.76320	0.00628
LYM180	B	6	0.75133	0.05153
LYM181	C	6	0.78450	0.02115
LYM184	B	6	0.82395	0.02266
LYM184	B	6	0.73704	0.01501
LYM189	A	10	0.81585	0.00733
LYM189	A	12	0.81256	0.00777
LYM189	A	9	0.72388	0.02746
LYM189	A	5	0.71589	0.03008
LYM192	A	2	0.86386	0.00061
LYM192	A	3	0.80919	0.00255

130

2018271407 30 Nov 2018

Gene Name	Expression Set	Correlation Vector	R	P
LYM192	A	3	0.77612	0.01393
LYM278	A	4	0.90217	0.00088
LYM278	A	4	0.87108	0.00048
LYM278	A	12	0.81518	0.00742
LYM278	A	3	0.79925	0.00975
LYM278	A	3	0.78102	0.00454
LYM278	A	12	0.76569	0.00601
LYM278	A	2	0.73983	0.00925
LYM38	A	4	0.97624	0.00001
LYM38	A	12	0.82191	0.00191
LYM38	A	8	0.82190	0.00656
LYM38	A	3	0.82153	0.00193
LYM38	A	5	0.81079	0.00246
LYM52	B	8	0.88462	0.00352
LYM52	A	2	0.80812	0.00261
LYM52	A	4	0.80802	0.00841
LYM52	A	3	0.78340	0.01251
LYM52	A	12	0.77364	0.01444
LYM52	A	9	0.75221	0.01938
LYM52	A	5	0.74914	0.02016
LYM52	A	8	0.71086	0.03181
LYM56	A	3	0.85797	0.00073
LYM56	A	4	0.85130	0.00089
LYM56	A	2	0.82071	0.00196
LYM56	A	8	0.76236	0.01692
LYM56	A	12	0.72510	0.01157
LYM83	A	9	0.87556	0.00198
LYM83	A	5	0.87005	0.00050
LYM83	A	12	0.82187	0.00191
LYM90	C	4	0.86848	0.00238
LYM90	C	3	0.81261	0.00777
LYM90	c	12	0.77921	0.01332
LYM90	c	2	0.76512	0.01629
LYM93	A	9	0.86630	0.00056
LYM93	A	12	0.78696	0.00405
LYM93	A	5	0.76542	0.00604
LYM106	A	3	0.79483	0.01047
LYM106	A	2	0.75674	0.01825
LYM106	C	6	0.73962	0.03596
LYM159	c	1	0.82807	0.00584
LYM159	B	8	0.79356	0.01873
LYM161	C	3	0.89287	0.00119
LYM161	C	2	0.88206	0.00165
LYM161	A	6	0.85373	0.00699
LYM161	C	4	0.74623	0.02093
LYM178	C	6	0.83756	0.00945
LYM182	A	6	0.93567	0.00063
LYM185	C	4	0.76455	0.01642
LYM185	A	1	0.75952	0.01759
LYM185	A	6	0.70292	0.01584
LYM186	A	6	0.86003	0.00616
LYM188	A	6	0.82774	0.00166
LYM188	C	2	0.73602	0.02377

131

2018271407 30 Nov 2018

Gene Name	Expression Set	Correlation Vector	R	P
LYM188	C	3	0.71072	0.03186
LYM194	A	2	0.89053	0.00024
LYM194	A	3	0.82982	0.00157
LYM289	A	9	0.77609	0.01394
LYM289	A	5	0.77182	0.01483

Table 8. Provided are the correlations (R) and p-values (P) between the expression levels of selected genes of some embodiments of the invention in various tissues or developmental stages (Expression sets) and the phenotypic performance in various yield (seed yield, oil yield, oil content), biomass, growth rate and/or vigor components [Correlation (Corr.) vector (Vec.)] Corr. Vec. = correlation vector specified in Tables 5, 6 and 7; Exp. Set = expression set specified in Table 3.

EXAMPLE 4

PRODUCTION OF ARABIDOPSIS TRANSCRIPTOM AND HIGH THROUGHPUT CORRELATION ANALYSIS OF YIELD, BIOMASS AND/OR VIGOR RELATED PARAMETERS USING 44K ARABIDOPSIS FULL GENOME OLIGONUCLEOTIDE MICRO-ARRAY

To produce a high throughput correlation analysis, the present inventors utilized an Arabidopsis thaliana oligonucleotide micro-array, produced by Agilent Technologies [Hypertext Transfer Protocol ://World Wide Web (dot) chem. (dot) agilent (dot) com/Scripts/PDS (dot) asp?lPage=50879], The array oligonucleotide represents about 40,000 A. thaliana genes and transcripts designed based on data from the TIGR ATH1 v.5 database and Arabidopsis MPSS (University of Delaware) databases. To define correlations between the levels of RNA expression and yield, biomass components or vigor related parameters, various plant characteristics of 15 different Arabidopsis ecotypes were analyzed. Among them, nine ecotypes encompassing the observed variance were selected for RNA expression analysis. The correlation between the RNA levels and the characterized parameters was analyzed using Pearson correlation test [Hypertext Transfer Protocol ://World Wide Web (dot) davidmlane (dot) com/hyperstat/A34739 (dot) html].

Experimental procedures

RNA extraction - Five tissues at different developmental stages including root, leaf, flower at anthesis, seed at 5 days after flowering (DAF) and seed at 12 DAF, representing different plant characteristics, were sampled and RNA was extracted as

2018271407 30 Nov 2018

132 described in Example 3 above. For convenience, each micro-array expression information tissue type has received a Set ID as summarized in Table 9 below.

Table 9

Tissues used for Arabidopsis transcriptom expression sets

Expression Set	Set ID
Root	A
Leaf	B
Flower	C
Seed 5 DAF	D
Seed 12 DAF	E

Table 9: Provided are the identification (ID) letters of each of the Arabidopsis expression sets (A-E). DAF = days after flowering.

Yield components and vigor related parameters assessment - eight out of the nine Arabidopsis ecotypes were used in each of 5 repetitive blocks (named A, B, C, D and E), each containing 20 plants per plot. The plants were grown in a greenhouse at controlled conditions in 22 °C, and the N:P:K fertilizer (20:20:20; weight ratios) [nitrogen (N), phosphorus (P) and potassium (K)] was added. During this time data was collected, documented and analyzed. Additional data was collected through the seedling stage of plants grown in a tissue culture in vertical grown transparent agar plates. Most of chosen parameters were analyzed by digital imaging.

Digital imaging in Tissue culture - A laboratory image acquisition system was used for capturing images of plantlets sawn in square agar plates. The image acquisition system consists of a digital reflex camera (Canon EOS 300D) attached to a 55 mm focal length lens (Canon EF-S series), mounted on a reproduction device (Kaiser RS), which included 4 light units (4x150 Watts light bulb) and located in a darkroom.

Digital imaging in Greenhouse - The image capturing process was repeated every 3-4 days starting at day 7 till day 30. The same camera attached to a 24 mm focal length lens (Canon EF series), placed in a custom made iron mount, was used for capturing images of larger plants sawn in white tubs in an environmental controlled greenhouse. The white tubs were square shape with measurements of 36 x 26.2 cm and 7.5 cm deep. During the capture process, the tubs were placed beneath the iron mount, while avoiding direct sun light and casting of shadows. This process was repeated every 3-4 days for up to 30 days.

2018271407 30 Nov 2018

133

An image analysis system was used, which consists of a personal desktop computer (Intel P4 3.0

GHz processor) and a public domain program - ImageJ 1.37, Java based image processing program, which was developed at the U.S National Institutes of Health and is freely available on the internet at Hypertext Transfer Protocol ://rsbweb (dot) nih (dot) gov/. Images were captured in resolution of 6 Mega Pixels (3072 x 2048 pixels) and stored in a low compression JPEG (Joint Photographic Experts Group standard) format. Next, analyzed data was saved to text files and processed using the JMP statistical analysis software (SAS institute).

Leaf analysis - Using the digital analysis leaves data was calculated, including leaf number, area, perimeter, length and width. On day 30, 3-4 representative plants were chosen from each plot of blocks A, B and C. The plants were dissected, each leaf was separated and was introduced between two glass trays, a photo of each plant was taken and the various parameters (such as leaf total area, laminar length etc.) were calculated from the images. The blade circularity was calculated as laminar width divided by laminar length.

Root analysis - During 17 days, the different ecotypes were grown in transparent agar plates. The plates were photographed every 3 days starting at day 7 in the photography room and the roots development was documented (see examples in Figures 3A-F). The growth rate of roots was calculated according to Formula VIE

Formula VII:

Relative growth rate of root coverage = Regression coefficient of root coverage along time course.

Vegetative growth rate analysis - was calculated according to Formula VIII. The analysis was ended with the appearance of overlapping plants.

Formula VIII

Relative vegetative growth rate area = Regression coefficient of vegetative area along time course.

For comparison between ecotypes the calculated rate was normalized using plant developmental stage as represented by the number of true leaves. In cases where plants with 8 leaves had been sampled twice (for example at day 10 and day 13), only the largest sample was chosen and added to the Anova comparison.

2018271407 30 Nov 2018

134

Seeds in siliques analysis - On day 70, 15-17 siliques were collected from each plot in blocks D and E. The chosen siliques were light brown color but still intact. The siliques were opened in the photography room and the seeds were scatter on a glass tray, a high resolution digital picture was taken for each plot. Using the images the 5 number of seeds per silique was determined.

Seeds average weight - At the end of the experiment all seeds from plots of blocks A-C were collected. An average weight of 0.02 grams was measured from each sample, the seeds were scattered on a glass tray and a picture was taken. Using the digital analysis, the number of seeds in each sample was calculated.

Oil percentage in seeds - At the end of the experiment all seeds from plots of blocks A-C were collected. Columbia seeds from 3 plots were mixed grounded and then mounted onto the extraction chamber. 210 ml of n-Hexane (Cat No. 080951 Biolab Ltd.) were used as the solvent. The extraction was performed for 30 hours at medium heat 50 °C. Once the extraction has ended the n-Hexane was evaporated using the evaporator at 35 °C and vacuum conditions. The process was repeated twice. The information gained from the Soxhlet extractor (Soxhlet, F. Die gewichtsanalytische Bestimmung des Milchfettes, Polytechnisches J. (Dingier's) 1879, 232, 461) was used to create a calibration curve for the Low Resonance NMR. The content of oil of all seed samples was determined using the Low Resonance NMR (MARAN Ultra- Oxford

Instrument) and its MultiQuant sowftware package.

Silique length analysis - On day 50 from sowing, 30 siliques from different plants in each plot were sampled in block A. The chosen siliques were green-yellow in color and were collected from the bottom parts of a grown plant’s stem. A digital photograph was taken to determine silique’s length.

Dry weight and seed yield - On day 80 from sowing, the plants from blocks A-C were harvested and left to dry at 30 °C in a drying chamber. The biomass and seed weight of each plot was separated, measured and divided by the number of plants. Dry weight = total weight of the vegetative portion above ground (excluding roots) after drying at 30 °C in a drying chamber; Seed yield per plant = total seed weight per plant (gr).

Oil yield - The oil yield was calculated using Formula IX.

2018271407 30 Nov 2018

135

Formula IX:

Seed Oil yield = Seed yield per plant (gr) * Oil % in seed

Harvest Index (seed) - The harvest index was calculated using Formula IV (described above): Harvest Index = Average seed yield per plant/ Average dry weight.

Experimental Results

Nine different Arabidopsis ecotypes were grown and characterized for 18 parameters (named as vectors).

Table 10

Arabidopsis correlated parameters (vectors)

Correlated parameter with	Correlation ID
Root length day 13 (cm)	1
Root length day 7 (cm)	2
Relative root growth (cm /day) day 13	3
Fresh weight per plant (gr) at bolting stage	4
Dry matter per plant (gr)	5
Vegetative growth rate (cm2 / day) till 8 true leaves	6
Blade circularity	7
Lamina width (cm)	8
Lamina length (cm)	9
Total leaf area per plant (cm)	10
1000 Seed weight (gr)	11
Oil % per seed	12
Seeds per silique	13
Silique length (cm)	14
Seed yield per plant (gr)	15
Oil yield per plant (mg)	16
Harvest Index	17
Leaf width/length	18

Table 10. Provided are the Arabidopsis correlated parameters (correlation ID Nos. 1-18). Abbreviations: Cm = centimeter(s); gr = gram(s); mg = milligram(s).

The characterized values are summarized in Tables 11 and 12 below.

Table 11

Measured parameters in Arabidopsis ecotypes

Ecotype	15	16	12	11	5	17	10	13	14
An-1	0.34	118.63	34.42	0.0203	0.64	0.53	46.86	45.44	1.06
Col-0	0.44	138.73	31.19	0.0230	1.27	0.35	109.89	53.47	1.26
Ct-1	0.59	224.06	38.05	0.0252	1.05	0.56	58.36	58.47	1.31
Cvi (N8580)	0.42	116.26	27.76	0.0344	1.28	0.33	56.80	35.27	1.47
Gr-6	0.61	218.27	35.49	0.0202	1.69	0.37	114.66	48.56	1.24
Kondara	0.43	142.11	32.91	0.0263	1.34	0.32	110.82	37.00	1.09
Ler-1	0.36	114.15	31.56	0.0205	0.81	0.45	88.49	39.38	1.18

136

2018271407 30 Nov 2018

Ecotype	15	16	12	11	5	17	10	13	14
Mt-0	0.62	190.06	30.79	0.0226	1.21	0.51	121.79	40.53	1.18
Shakdara	0.55	187.62	34.02	0.0235	1.35	0.41	93.04	25.53	1.00

Table 11. Provided are the values of each of the parameters measured in Arabidopsis ecotypes: 15 = Seed yield per plant (gram); 16 = oil yield per plant (mg); 12 = oil % per seed; 11 = 1000 seed weight (gr); 5 = dry matter per plant (gr); 17 = harvest index; 10 = total leaf area per plant (cm); 13 = seeds per silique; 14 = Silique length (cm).

Table 12

Additional measured parameters in Arabidopsis ecotypes

Ecotype	6	3	2	1	4	9	8	18	7
An-1	0.313	0.631	0.937	4.419	1.510	2.767	1.385	0.353	0.509
Col-0	0.378	0.664	1.759	8.530	3.607	3.544	1.697	0.288	0.481
Ct-1	0.484	1.176	0.701	5.621	1.935	3.274	1.460	0.316	0.450
Cvi (N8580)	0.474	1.089	0.728	4.834	2.082	3.785	1.374	0.258	0.370
Gr-6	0.425	0.907	0.991	5.957	3.556	3.690	1.828	0.356	0.501
Kondara	0.645	0.774	1.163	6.372	4.338	4.597	1.650	0.273	0.376
Ler-1	0.430	0.606	1.284	5.649	3.467	3.877	1.510	0.305	0.394
Mt-0	0.384	0.701	1.414	7.060	3.479	3.717	1.817	0.335	0.491
Shakdar a	0.471	0.782	1.251	7.041	3.710	4.149	1.668	0.307	0.409

Table 12. Provided are the values of each of the parameters measured in Arabidopsis ecotypes: 6 = Vegetative growth rate (cm²/day) until 8 true leaves; 3 = relative root growth (cm/day) (day 13); 2 = Root length day 7 (cm); 1 = Root length day 13 (cm); 4 = fresh weight per plant (gr) at bolting stage; 9. = Lamima length (cm); 8 = Lamina width (cm); 18 = Leaf width/length; 7 = Blade circularity.

Table 13, below, provides selected genes of some embodiments of the invention, the characterized parameters (which are used as x axis for correlation) and the correlated tissue transcriptom along with the correlation value (R, calculated using Pearson correlation). When the correlation coefficient (R) between the levels of a gene’s expression in a certain tissue and a phenotypic performance across ecotypes is high in absolute value (between 0.5-1), there is an association between the gene (specifically the expression level of this gene) and the phenotypic character.

Table 13

Correlation between the expression level of selected genes in specific tissues or developmental stages and the phenotypic performance across Arabidopsis ecotypes

Gene Name	Expression Set	Correlation Vector	R	P
LYM88	E	13	0.75035	0.03198
LYM89	D	10	0.88062	0.00886
LYM89	D	4	0.84712	0.01614
LYM89	A	6	0.84690	0.00797
LYM89	D	5	0.83715	0.01879

137

2018271407 30 Nov 2018

LYM89	D	6	0.70174	0.07884
LYM152	E	14	0.85500	0.00682

Table 13. Provided are the correlations between the expression level of yield improving genes and their homologs in specific tissues or developmental stages (expression sets) and the phenotypic performance (correlation vector) across Arabidopsis ecotypes. The phenotypic characters [correlation (Corr.) vector (Vec.)] include yield (seed yield, oil yield, oil content), biomass, growth rate and/or vigor components as described in Tables 10-12. Exp. Set = expression set according to Table 9 hereinabove.

EXAMPLE 5

PRODUCTION OF ARABIDOPSIS TRANSCRIPTOM AND HIGH THROUGHPUT CORRELATION ANALYSIS OF NORMAL AND NITROGEN LIMITING CONDITIONS USING 44K ARABIDOPSIS OLIGONUCLEOTIDE MICRO-ARRAY

In order to produce a high throughput correlation analysis, the present inventors utilized a Arabidopsis oligonucleotide micro-array, produced by Agilent Technologies [Hypertext Transfer Protocol://World Wide Web (dot) chem (dot) agilent (dot) com/Scripts/PDS (dot) asp?lPage=50879], The array oligonucleotide represents about 44,000 Arabidopsis genes and transcripts. To define correlations between the levels of RNA expression with NUE, yield components or vigor related parameters various plant characteristics of 14 different Arabidopsis ecotypes were analyzed. Among them, ten ecotypes encompassing the observed variance were selected for RNA expression analysis. The correlation between the RNA levels and the characterized parameters was analyzed using Pearson correlation test [Hypertext Transfer Protocol://World Wide Web (dot) davidmlane (dot) com/hyperstat/A34739 (dot) html].

Experimental procedures

RNA extraction - Two tissues of plants [leaves and stems] growing at two different nitrogen fertilization levels (1.5 rnM Nitrogen or 6 mM Nitrogen) were sampled and RNA was extracted as described in Examples 3 above. For convenience, each micro-array expression information tissue type has received a Set ID as summarized in Table 14 below.

2018271407 30 Nov 2018

138

Table 14

Tissues used for Arabidopsis transcriptom expression sets

Expression Set	Set ID
Leaves at 1.5 mM Nitrogen fertilization	A
Leaves at 6 mM Nitrogen fertilization	B
Stems at 1.5 mM Nitrogen fertilization	C
Stem at 6 mM Nitrogen fertilization	D

Table 14: Provided are the identification (ID) letters of each of the Arabidopsis expression sets.

Assessment of Arabidopsis yield components and vigor related parameters under different nitrogen fertilization levels - 10 Arabidopsis accessions in 2 repetitive plots each containing 8 plants per plot were grown at greenhouse. The growing protocol used was as follows: surface sterilized seeds were sown in Eppendorf tubes containing 0.5 x Murashige-Skoog basal salt medium and grown at 23 °C under 12-hour light and 12-hour dark daily cycles for 10 days. Then, seedlings of similar size were carefully transferred to pots filled with a mix of perlite and peat in a 1:1 ratio. Constant nitrogen limiting conditions were achieved by irrigating the plants with a solution containing 1.5 mM inorganic nitrogen in the form of KNO3, supplemented with 2 mM CaCfi, 1.25 mM KH2PO4, 1.50 mM MgSCE, 5 mM KC1, 0.01 mM H3BO3 and microelements, while normal irrigation conditions (Normal Nitrogen conditions) was achieved by applying a solution of 6 mM inorganic nitrogen also in the form of KNO3, supplemented with 2 mM CaCfi, 1.25 mM KH2PO4, 1.50 mM MgSCE, 0.01 mM H3BO3 and microelements. To follow plant growth, trays were photographed the day nitrogen limiting conditions were initiated and subsequently every 3 days for about 15 additional days. Rosette plant area was then determined from the digital pictures. ImageJ software was used for quantifying the plant size from the digital pictures [Hypertext Transfer Protocol://rsb (dot) info (dot) nih (dot) gov/ij/] utilizing proprietary scripts designed to analyze the size of rosette area from individual plants as a function of time. The image analysis system included a personal desktop computer (Intel P4 3.0 GHz processor) and a public domain program - ImageJ 1.37 (Java based image processing program, which was developed at the U.S. National Institutes of Health and freely available on the internet [Hypertext Transfer Protocol://rsbweb (dot) nih (dot) gov/]. Next, analyzed data was saved to text files and processed using the JMP statistical analysis software (SAS institute).

Data parameters collected are summarized in Table 15, hereinbelow.

2018271407 30 Nov 2018

139

Table 15

Arabidopsis correlated parameters (vectors)

Correlated parameter with	Correlation Id
N 1.5 mM; Rosette Area at day 8 [cm2]	1
N 1.5 mM; Rosette Area at day 10 [cm2]	2
N 1.5 mM; Plot Coverage at day 8 [%]	3
N 1.5 mM; Plot Coverage at day 10 [%]	4
N 1.5 mM; Leaf Number at day 10	5
N 1.5 mM; Leaf Blade Area at day 10 [cm2]	6
N 1.5 mM; RGR of Rosette Area at day 3 [cm2/day]	7
N 1.5 mM; t50 Flowering [day]	8
N 1.5 mM; Dry Weight [gr/plant]	9
N 1.5 mM; Seed Yield [gr/plant]	10
N 1.5 mM; Harvest Index	11
N 1.5 mM; 1000 Seeds weight [gr]	12
N 1.5 mM; seed yield/ rosette area at day 10 [gr/cm2]	13
N 1.5 mM; seed yield/leaf blade [gr/cm2]	14
N 1.5 mM; % Seed yield reduction compared to N 6 mM	15
N 1.5 mM; % Biomass reduction compared to N 6 mM	16
N 1.5 mM; N level /DW [SPAD unit/gr]	17
N 1.5 mM; DW/ N level [gr/ SPAD unit]	18
N 1.5 mM; seed yield/ N level [gr/ SPAD unit]	19
N 6 mM; Rosette Area at day 8 [cm2]	20
N 6 mM; Rosette Area at day 10 [cm2]	21
N 6 mM; Plot Coverage at day 8 [%]	22
N 6 mM; Plot Coverage at day 10 [%]	23
N 6 mM; Leaf Number at day 10	24
N 6 mM; Leaf Blade Area at day 10	25
N 6 mM; RGR of Rosette Area at day 3 [cm2/gr]	26
N 6 mM; t50 Flowering [day]	27
N 6 mM; Dry Weight [gr/plant]	28
N 6 mM; Seed Yield [gr/plant]	29
N 6 mM; Harvest Index	30
N 6 mM; 1000 Seeds weight [gr]	31
N 6 mM; seed yield/ rosette area day at day 10 [gr/cm2]	32
N 6 mM; seed yield/leaf blade [gr/cm2]	33
N 6 mM; N level / FW	34
N 6 mM; DW/ N level [gr/ SPAD unit]	35
N 6 mM; N level /DW (SPAD unit/gr plant)	36
N 6 mM; Seed yield/N unit [gr/ SPAD unit]	37

Table 15. Provided are the Arabidopsis correlated parameters (vectors). “N” =

Nitrogen at the noted concentrations; “gr.” = grams; “SPAD” = chlorophyll levels; “t50” = time where 50% of plants flowered; “gr/ SPAD unit” = plant biomass expressed in grams per unit of nitrogen in plant measured by SPAD. “DW” = Plant Dry Weight; FW = Plant Fresh weight; “N level /DW” = plant Nitrogen level measured in SPAD unit per plant biomass [gr]; “DW/ N level” = plant biomass per 10 plant [gr]/SPAD unit; Rosette Area (measured using digital analysis); Plot Coverage at the indicated day [%] (calculated by the dividing the total plant area with the total plot

2018271407 30 Nov 2018

140 area); Leaf Blade Area at the indicated day [cm²] (measured using digital analysis); RGR (relative growth rate) of Rosette Area at the indicated day [cm²/day]; t50 Flowering [day] (the day in which 50% of plant flower); seed yield/ rosette area at day 10 [gr/cm²] (calculated); seed yield/leaf blade [gr/cm²] (calculated); seed yield/ N level [gr/ SPAD unit] (calculated).

Assessment of NUE, yield components and vigor-related parameters - Ten Arabidopsis ecotypes were grown in trays, each containing 8 plants per plot, in a greenhouse with controlled temperature conditions for about 12 weeks. Plants were irrigated with different nitrogen concentration as described above depending on the treatment applied. During this time, data was collected documented and analyzed. Most of chosen parameters were analyzed by digital imaging.

Digital imaging - Greenhouse assay

An image acquisition system, which consists of a digital reflex camera (Canon EOS 400D) attached with a 55 mm focal length lens (Canon EF-S series) placed in a custom made Aluminum mount, was used for capturing images of plants planted in containers within an environmental controlled greenhouse. The image capturing process is repeated every 2-3 days starting at day 9-12 till day 16-19 (respectively) from transplanting.

An image processing system was used, which consists of a personal desktop computer (Intel P4 3.0 GHz processor) and a public domain program - ImageJ 1.37, Java based image processing software, which was developed at the U.S. National Institutes of Health and is freely available on the internet at Hypertext Transfer Protocol ://rsbweb (dot) nih (dot) gov/. Images were captured in resolution of 10 Mega Pixels (3888x2592 pixels) and stored in a low compression JPEG (Joint Photographic Experts Group standard) format. Next, image processing output data was saved to text files and analyzed using the JMP statistical analysis software (SAS institute).

Leaf analysis - Using the digital analysis leaves data was calculated, including leaf number, leaf blade area, plot coverage, Rosette diameter and Rosette area.

Relative growth rate area'. The relative growth rate of the rosette and the leaves was calculated according to Formulas XIV and XVII, respectively.

Seed yield and 1000 seeds weight - At the end of the experiment all seeds from all plots were collected and weighed in order to measure seed yield per plant in terms of total seed weight per plant (gr). For the calculation of 1000 seed weight, an average

2018271407 30 Nov 2018

141 weight of 0.02 grams was measured from each sample, the seeds were scattered on a glass tray and a picture was taken. Using the digital analysis, the number of seeds in each sample was calculated.

Dry weight and seed yield - At the end of the experiment, plant were harvested and left to dry at 30 °C in a drying chamber. The biomass was separated from the seeds, weighed and divided by the number of plants. Dry weight = total weight of the vegetative portion above ground (excluding roots) after drying at 30 °C in a drying chamber.

Harvest Index (seed) - The harvest index was calculated using Formula IV as described above [Harvest Index = Average seed yield per plant/ Average dry weight],

T₅₀ days to flowering - Each of the repeats was monitored for flowering date. Days of flowering was calculated from sowing date till 50 % of the plots flowered.

Plant nitrogen level - The chlorophyll content of leaves is a good indicator of the nitrogen plant status since the degree of leaf greenness is highly correlated to this parameter. Chlorophyll content was determined using a Minolta SPAD 502 chlorophyll meter and measurement was performed at time of flowering. SPAD meter readings were done on young fully developed leaf. Three measurements per leaf were taken per plot. Based on this measurement, parameters such as the ratio between seed yield per nitrogen unit [seed yield/N level = seed yield per plant [gr]/SPAD unit], plant DW per nitrogen unit [DW/ N level= plant biomass per plant [g]/SPAD unit], and nitrogen level per gram of biomass [N level/DW= SPAD unit/ plant biomass per plant (gr)] were calculated.

Percent of seed yield reduction- measures the amount of seeds obtained in plants when grown under nitrogen-limiting conditions compared to seed yield produced at normal nitrogen levels expressed in %.

Experimental Results different Arabidopsis accessions (ecotypes) were grown and characterized for 37 parameters as described above. The average for each of the measured parameters was calculated using the JMP software. Subsequent correlation analysis between the various transcriptom sets (Table 14) was conducted. Following are the results integrated to the database.

2018271407 30 Nov 2018

142

Table 16

Correlation between the expression level of selected genes of the invention and their homologs in tissues under limiting or normal nitrogen fertilization and the phenotypic performance across Arabidopsis ecotypes

Gene Name	Expression Set	Correlation Vector	R	P
LYM88	C	17	0.93533	0.01955
LYM88 LYM8 Hl	D D	16 31	0.79502 0.745282	0.01044 0.021184
LYM10 H7	C	24	0.895562	0.000458
LYM10 H7	C	5	0.77817	0.008026
LYM10 H7	C	21	0.725922	0.017459
LYM10 H7	C	2	0.717752	0.019423
LYM10 H8	C	8	0.850748	0.001806
LYM10 H8	C	27	0.7752	0.008432
LYM10 H8	C	15	0.77175	0.008921
LYM10 H9	A	1	0.844351	0.002119
LYM10 H9	A	2	0.755723	0.01146
LYM10 H9	A	20	0.733447	0.015776
LYM10 H9	A	21	0.722114	0.018356
LYM14 H2	B	27	0.892136	0.000519
LYM14 H2	B	8	0.830273	0.002942
LYM14 H2	C	8	0.816286	0.003967
LYM14 H2	C	8	0.794197	0.006071
LYM14 H2	C	27	0.767463	0.009557
LYM14 H2	C	27	0.733255	0.015818
LYM14 H2	D	1	0.725116	0.027066
LYM14 H3	B	15	0.855842	0.001582
LYM14 H3	C	8	0.802977	0.005158
LYM14 H3	B	8	0.79811	0.005651
LYM14 H3	B	12	0.792747	0.006233
LYM14 H3	B	27	0.785721	0.007057
LYM14 H3	C	27	0.734206	0.015613
LYM14 H3	A	9	0.720081	0.018848
LYM137 Hll	C	20	0.815207	0.004055
LYM137 Hll	C	21	0.79814	0.005648
LYM137 Hll	D	5	0.754601	0.018779
LYM137 Hll	C	24	0.701843	0.023676
LYM152 Hl	D	5	0.714383	0.030592
LYM152 Hl	D	5	0.713442	0.030914
LYM236 H4	B	27	0.937557	6.17E-05
LYM236 H4	B	8	0.921247	0.000153
LYM236 H4	B	15	0.865782	0.001204
LYM236 H4	B	28	0.709595	0.02153
LYM236 H5	A	10	0.737484	0.014922
LYM236 H5	B	10	0.71158	0.021004

Table 16. Provided are the correlations (R) between the expression levels of yield improving genes and their homologs in tissues (leaves or stems) under limiting (1.5 rnM Nitrogen) or normal (6 mM Nitrogen) conditions (Expression sets) and the phenotypic performance in various yield (seed yield, oil yield, oil content), biomass, growth rate and/or vigor components [Correlation (Corr.) vector (Vec.)] under limiting or normal Nitrogen conditions. Corr. Vec. = correlation vector according to Table 15 hereinabove; Exp. Set = expression set according to Table 14 hereinabove.

2018271407 30 Nov 2018

143 EXAMPLE 6 PRODUCTION OF SORGHUM TRANSCRIPTOM AND HIGH THROUGHPUT CORRELATION ANALYSIS WITH ABST RELATED PARAMETRERS USING 44K SORGUHM OLIGONUCLEOTIDE MICRO-ARRAYS

In order to produce a high throughput correlation analysis, the present inventors utilized a Sorghum oligonucleotide micro-array, produced by Agilent Technologies [Hypertext Transfer Protocol ://World Wide Web (dot) chem. (dot) agilent (dot) com/Scripts/PDS (dot) asp?lPage=50879], The array oligonucleotide represents about 44,000 Sorghum genes and transcripts. In order to define correlations between the levels of RNA expression with ABST and yield components or vigor related parameters, various plant characteristics of 17 different sorghum varieties were analyzed. Among them, 10 varieties encompassing the observed variance were selected for RNA expression analysis. The correlation between the RNA levels and the characterized parameters was analyzed using Pearson correlation test [Hypertext Transfer Protocol://World Wide Web (dot) davidmlane (dot) com/hyperstat/A34739 (dot) html].

Correlation of Sorghum varieties across ecotype grown under severe drought conditions

Experimental procedures

Sorghum varieties were grown in 3 repetitive plots, in field. Briefly, the growing protocol was as follows: sorghum seeds were sown in soil and grown under normal condition until around 35 days from sowing, around V8 (Last leaf visible, but still rolled up, ear beginning to swell). At this point, irrigation was stopped, and severe drought stress was developed. In order to define correlations between the levels of RNA expression with drought, yield components or vigor related parameters, the 17 different sorghum varieties were analyzed. Among them, 10 varieties encompassing the observed variance were selected for RNA expression analysis. The correlation between the RNA levels and the characterized parameters was analyzed using Pearson correlation test [Hypertext Transfer Protocol://World Wide Web (dot) davidmlane (dot) com/hyperstat/A34739 (dot) html],

RNA extraction - All 10 selected Sorghum varieties were sample per each treatment. Plant tissues [Flag leaf, Flower meristem and Flower] growing under severe

2018271407 30 Nov 2018

144 drought stress and plants grown under Normal conditions were sampled and RNA was extracted as described in Examples 3 above. For convenience, each micro-array expression information tissue type has received a Set ID as summarized in Table 17 below.

Table 17

Sorghum transcriptom expression sets

Expression Set	Set ID
Sorghum field/Normal/flower meristem	1
Sorghum field/Normal/flower	2
Sorghum field/Normal/flag leaf	3
Drought Stress: Flag leaf	4

Table 17: Provided are the sorghum transcriptom expression sets 1, 2, 3 and 4. Flag leaf = the leaf below the flower; Flower meristem = Apical meristem following panicle initiation; Flower = the flower at the anthesis day. Expression sets 1, 2 and 3 are from plants grown under normal conditions. Expression set 4 derived from plants grown under drought conditions.

The following parameters were collected using digital imaging system:

Average Grain Area (cm²) - At the end of the growing period the grains were separated from the Plant ‘Head’. A sample of ~200 grains were weight, photographed and images were processed using the below described image processing system. The grain area was measured from those images and was divided by the number of grains.

Average Grain Length (cm) - At the end of the growing period the grains were separated from the Plant ‘Head’. A sample of ~200 grains were weight, photographed and images were processed using the below described image processing system. The sum of grain lengths (longest axis) was measured from those images and was divided by the number of grains.

Head Average Area (cm²) At the end of the growing period 5 ‘Heads’ were, photographed and images were processed using the below described image processing system. The ‘Head’ area was measured from those images and was divided by the number of ‘Heads’.

Head Average Length (cm) At the end of the growing period 5 ‘Heads’ were, photographed and images were processed using the below described image processing system. The ‘Head’ length (longest axis) was measured from those images and was divided by the number of ‘Heads’.

2018271407 30 Nov 2018

145

The image processing system was used, which consists of a personal desktop computer (Intel P4 3.0 GHz processor) and a public domain program - ImageJ 1.37, Java based image processing software, which was developed at the U.S. National Institutes of Health and is freely available on the internet at Hypertext Transfer Protocol ://rsbweb (dot) nih (dot) gov/. Images were captured in resolution of 10 Mega Pixels (3888x2592 pixels) and stored in a low compression JPEG (Joint Photographic Experts Group standard) format. Next, image processing output data for seed area and seed length was saved to text files and analyzed using the JMP statistical analysis software (SAS institute).

Additional parameters were collected either by sampling 5 plants per plot or by measuring the parameter across all the plants within the plot.

Total Seed Weight/Head (gr.) - At the end of the experiment (plant ‘Heads’) heads from plots within blocks A-C were collected. 5 heads were separately threshed and grains were weighted, all additional heads were threshed together and weighted as well. The average grain weight per head was calculated by dividing the total grain weight by number of total heads per plot (based on plot). In case of 5 heads, the total grains weight of 5 heads was divided by 5.

FW Head/Plant gr - At the end of the experiment (when heads were harvested) total and 5 selected heads per plots within blocks A-C were collected separetaly. The heads (total and 5) were weighted (gr.) separately and the average fresh weight per plant was calculated for total (FW Head/Plant gr based on plot) and for 5 (FW Head/Plant gr based on 5 plants).

Plant height - Plants were characterized for height during growing period at 5 time points. In each measure, plants were measured for their height using a measuring tape. Height was measured from ground level to top of the longest leaf.

Plant leaf number - Plants were characterized for leaf number during growing period at 5 time points. In each measure, plants were measured for their leaf number by counting all the leaves of 3 selected plants per plot.

Relative Growth Rate was calculated using Formulas X and XI.

Formula X

Relative growth rate of plant height = Regression coefficient of plant height along time course.

2018271407 30 Nov 2018

146

Formula XI

Relative growth rate of plant leaf number = Regression coefficient of plant leaf number along time course.

SPAD - Chlorophyll content was determined using a Minolta SPAD 502 chlorophyll meter and measurement was performed 64 days post sowing. SPAD meter readings were done on young fully developed leaf. Three measurements per leaf were taken per plot.

Vegetative dry weight and Heads - At the end of the experiment (when Inflorescence were dry) all Inflorescence and vegetative material from plots within blocks A-C were collected. The biomass and Heads weight of each plot was separated, measured and divided by the number of Heads.

Dry weight = total weight of the vegetative portion above ground (excluding roots) after drying at 70 °C in oven for 48 hours;

Harvest Index (HI) (Sorghum)- The harvest index was calculated using Formula XII.

Formula XII:

Harvest Index = Average grain dry weight per Head / (Average vegetative dry weight per Head + Average Head dry weight)

FW Heads/(FW Heads + FW Plants) - The total fresh weight of heads and their respective plant biomass were measured at the harvest day. The heads weight was divided by the sum of weights of heads and plants.

Experimental Results different sorghum varieties were grown and characterized for different parameters: The average for each of the measured parameter was calculated using the JMP software (Tables 19-20) and a subsequent correlation analysis between the various transcriptom sets (Table 17) and the average parameters, was conducted (Tables 21). Results were then integrated to the database.

Table 18

Sorghum correlated parameters (vectors)

Correlation Vector	Correlation Id
Average Seed Area cm2-normal	A
Average Seed Length cm-normal	B
FW/Plant gr based on plot-normal	C

147

2018271407 30 Nov 2018

FW Head/Plant gr based on 5 plants-normal	D
FW Head/Plant gr based on plot-normal	E
FW Heads/(FW Heads + FW Plants) based on plot-normal	F
Head Average Area cm2-normal	G
Head Average Length cm-normal	H
HI-normal	J
Leaf SPAD 64 Days Post Sowing-normal	K
Relative Growth Rate of Leaf Num-normal	L
Relative Growth Rate of Plant Height-normal	M
Total Seed Weight/Head gr based on plot-normal	N
Total Seed Weight /Head gr based on 5 heads-normal	O

Table 18. Provided are the Sorghum correlated parameters (vectors), “gr.” = grams; “SPAD” = chlorophyll levels; FW = Plant Fresh weight;’’normal” = standard growth conditions.

Table 19

Measured parameters in Sorghum accessions

Seed Id	A	B	C	D	E	F	G	II	J
20	0.1047	0.3856	162.6	406.5	175.2	0.51	120.1	25.58	200.7
21	0.1124	0.4017	212.6	518	223.5	0.5101	167.6	26.84	127
22	0.1313	0.4446	334.8	148	56.4	0.1154	85.14	21.02	51.8
24	0.1293	0.4496	313.5	423	111.6	0.2626	157.3	26.84	122.4
25						0.1204			54.53
26						0.177			93.92
27	0.1098	0.3999	151.1	423.5	126.2	0.4591	168.5	31.33	327.3
28	0.1134	0.4054	137.6	386.5	107.7	0.4316	109.3	23.18	231.5
29	0.1022	0.3837	168	409.5	123.9	0.4249	135.1	25.7	241.4
30	0.118	0.4186	129	328.9	102.8	0.4416	169	28.82	304.1
31	0.1205	0.4302	97.62	391	82.33	0.4581	156.1	28.13	335.6
32	0.1106	0.4003	99.32	435.8	77.59	0.4473	112.1	22.97	349.6
33	0.1165	0.4094	112.2	429.5	91.17	0.4474	154.7	28.09	293.2
34	0.108	0.4008	157.4	441	150.4	0.5134	171.7	30	410.9
35	0.1048	0.3947	130.5	415.8	109.1	0.4595	168.5	30.54	285.1
36	0.1097	0.3953	135.7	429.5	107.6	0.4425	162.5	27.17	282.7
37	0.1053	0.3924	209.2	428.5	130.9	0.3856	170.5	29.26	204

Table 19: Provided are the values of each of the parameters (as described above) measured in Sorghum accessions (Seed ID) under normal and drought conditions.

Growth conditions are specified in the experimental procedure section.

Table 20

Additional measured parameters in Sorghum accessions

Seed Id	L	M	N	O
20	0.1032	1.891	31.12	47.4
21		1.622	26.35	46.3
22	0.2128	3.418	18.72	28.37
24	0.1862	2.425	38.38	70.4
25	0.1898	3.118
26	0.1599	3.323
27	0.1957	2.178	47.67	63.45

148

2018271407 30 Nov 2018

Seed Id	L	M	N	O
28	0.1694	2.188	31	44.45
29	0.1821	2.572	39.99	56.65
30		2.046	38.36	60
31		2.069	32.1	45.45
32	0.1754	2.547	32.69	58.19
33	0.117	2.327	32.79	70.6
34	0.207	3.039	51.53	70.1
35	0.1859	2.335	35.71	53.95
36	0.151	2.516	38.31	59.87
37	0.24	2.81	42.44	52.65
Table 20: Provided are the values of each of the parameters (as c	escribed above)

measured in Sorghum accessions (Seed ID) under normal and drought conditions. Growth conditions are specified in the experimental procedure section.

Table 21

Correlation between the expression level of selected genes of some embodiments of the invention in various tissues and the phenotypic performance under normal or abiotic stress conditions across Sorghum accessions

Gene Name	Cluster Name	Exp. Set	Corr. Vec.	R	P
LYM174	sorghum |gbl61.crp|AW284303	1	J	0.746	0.013251
LYM263	sorghum|gb 161 ,crp| AI622410	2	O	0.860	0.00292
LYM263	sorghum|gb 161 ,crp| AI622410	2	J	0.847	0.00196
LYM5 H21	sorghum| 09v 11SB04G031180	1	B	0.898	0.00101
LYM5 H21	sorghum 09vl SB04G031180	1	A	0.896	0.00107
LYM8 H23	sorghum 09vl SB01G000490	1	O	0.755	0.018718
LYM8 H23	sorghum 09vl SB01G000490	2	O	0.714	0.030884
LYM10H272	sorghum 09vl SB04G005280	3	L	0.756	0.029952
LYM14 H44	sorghum 09v 1 SB02G044050	2	E	0.769	0.015504
LYM24H10	sorghum 09vl SB03G044280	2	C	0.774	0.014343
LYM24H10	sorghum 09vl SB03G044280	3	B	0.743	0.021898
LYM24H10	sorghum 09vl SB03G044280	3	A	0.728	0.026226
LYM35 H7	sorghum 09vl SB06G031730	2	E	0.823	0.006385
LYM73 H8	sorghum 09vl SB07G0043 00	1	E	0.748	0.02039
LYM82H16	sorghum 09v 1 SB 10G002420	3	J	0.783	0.007439
LYM82H16	sorghum 09v 1 SB 10G002420	3	N	0.780	0.013111
LYM82H16	sorghum 09v 1 SB 10G002420	3	O	0.726	0.02673
LYM82H16	sorghum 09v 1 SB 10G002420	3	G	0.723	0.027818
LYM111 H10	sorghum 09vl SB03G036350	3	C	0.892	0.00122
LYM111 H10	sorghum 09vl SB03G036350	3	A	0.753	0.019062
LYM111 H10	sorghum 09vl SB03G036350	3	B	0.702	0.035192
LYM119H1	sorghum 09vl SB05G003680	2	C	0.759	0.017691
LYM131 H19	sorghum 09vlSB06G027970	1	E	0.841	0.004488
LYM131 H19	sorghum 09vlSB06G027970	3	B	0.787	0.011775
LYM131 H19	sorghum 09vlSB06G027970	3	A	0.762	0.017013
LYM131 H19	sorghum 09vlSB06G027970	1	F	0.700	0.024184
LYM131 H20	sorghum 09vl SB07G006320	1	E	0.854	0.003353
LYM137H285	sorghum 09vl SB06G021660	2	F	0.747	0.013056
LYM137H285	sorghum 09vl SB06G021660	1	E	0.716	0.030132
LYM137H286	sorghum 09vl SB 10G005240	1	E	0.786	0.012037
LYM140 H27	sorghum|09vl|SB06G028990	1	C	0.772	0.014832
LYM148 H14	sorghum 09vl SB10G026570	1	B	0.812	0.007885

149

2018271407 30 Nov 2018

Gene Name	Cluster Name	Exp. Set	Corr. Vec.	R	P
LYM148 H14	sorghum 09vlSB10G026570	1	A	0.770	0.015311
LYM148 H14	sorghum 09vlSB10G026570	1	C	0.768	0.015705
LYM162 H7	sorghum|09vl|SB03G043995	1	N	0.837	0.004911
LYM215 H2	sorghum|09vl|SB03G043980	1	N	0.718	0.029262
LYM178 H13	sorghum|09vl|SB03G008890	3	B	0.862	0.002833
LYM178 H13	sorghum|09vl|SB03G008890	3	A	0.792	0.010892
LYM178 H14	sorghum|09vl|SB07G001060	2	A	0.768	0.01572
LYM179 HO	sorghum|09vl|SB08G006470	1	O	0.818	0.006992
LYM109 H2	sorghum|09vl|SB05G003660	1	B	0.762	0.017077
LYM109 H2	sorghum|09vl|SB05G003660	3	A	0.751	0.019579
LYM109 H2	sorghum|09vl|SB05G003660	1	A	0.732	0.025074
LYM112H2	sorghum| 09v 11SB02G039985	1	B	0.827	0.005944
LYM112H2	sorghum| 09v 11SB02G039985	3	B	0.790	0.011246
LYM112H2	sorghum| 09v 11SB02G039985	1	A	0.789	0.011426
LYM112H2	sorghum| 09v 11SB02G039985	3	A	0.701	0.035452
LYM123 H7	sorghum|09vl|SB06G031680	1	B	0.769	0.015524
LYM181 H6	sorghum| 09v 11SB02G034110	1	B	0.740	0.022556
LYM181 H6	sorghum| 09v 11SB02G034110	3	N	0.724	0.027264
LYM181 H6	sorghum| 09v 11SB02G034110	3	O	0.702	0.035114
LYM182H12	sorghum| 09v 11SB06G015280	1	E	0.767	0.015834
LYM206 H2	sorghum|09vl|SB07G021090	3	N	0.795	0.010488
LYM188H13	sorghum| 09v 11SBO1G007950	1	E	0.788	0.011658
LYM198 Hl	sorghum|09vl|SB01G045460	1	E	0.829	0.005689
LYM201 H37	sorghum| 09v 11SB04G0223 50	2	N	0.741	0.022246
LYM201 H37	sorghum| 09v 11SB04G0223 50	2	D	0.709	0.032326
LYM201 H37	sorghum| 09v 11SB04G0223 50	2	H	0.701	0.035468
LYM207 H3	sorghum|09vl|SB06G023870	3	K	0.781	0.007669
LYM207 H3	sorghum|09vl|SB06G023870	1	E	0.768	0.015595
LYM207 H3	sorghum|09vl|SB06G023870	3	O	0.718	0.029344
LYM207 H3	sorghum|09vl|SB06G023870	1	N	0.716	0.02988
LYM208 H8	sorghum|09vl|SB01G032070	1	N	0.734	0.024302
LYM208 H8	sorghum|09vl|SB01G032070	1	E	0.701	0.03525
LYM212H9	sorghum| 09v 11 SBO 1G045480	1	E	0.841	0.004537
LYM221 H3	sorghum| 09v 11 SBO 1G034610	2	A	0.728	0.02604
LYM221 H3	sorghum| 09v 11 SBO 1G034610	2	C	0.721	0.028264
LYM224 H3	sorghum|09vl|SB02G040000	3	C	0.835	0.005096
LYM224 H3	sorghum|09vl|SB02G040000	3	L	0.827	0.011397
LYM224 H3	sorghum|09vl|SB02G040000	3	M	0.708	0.021888
LYM232 H3	sorghum|09vl|SB02G000450	1	O	0.808	0.00839
LYM232 H3	sorghum|09vl|SB02G000450	1	N	0.759	0.017814
LYM236H139	sorghum| 09v 11SB09G029110	1	A	0.859	0.00303
LYM236H139	sorghum| 09v 11SB09G029110	1	B	0.836	0.004971
LYM248 H5	sorghum|09vl|SB04G000645	3	L	0.878	0.004118
LYM248 H5	sorghum|09vl|SB04G000645	1	N	0.868	0.002424
LYM183 Hll	sorghum|09vl|SB01G003070	1	E	0.832	0.005437
LYM183 Hll	sorghum|09vl|SB01G003070	1	N	0.749	0.020124
LYM267 Hl	sorghum| 09v 11 SBO 1G044240	2	A	0.797	0.010102
LYM267 Hl	sorghum| 09v 11 SBO 1G044240	2	B	0.753	0.019206
LYM267 Hl	sorghum| 09v 11 SBO 1G044240	1	H	0.707	0.033248
LYM267 Hl	sorghum| 09v 11 SBO 1G044240	1	O	0.705	0.033872
LYM267 Hl	sorghum| 09v 11 SBO 1G044240	1	N	0.705	0.033976
LYM270 HO	sorghum|09vl ISB02G040045	1	E	0.820	0.006742
LYM271 H10	sorghum|09vl ISB02G040020	1	N	0.780	0.013152
LYM273 H6	sorghum| 09v 11SB03G044410	3	B	0.955	5.91E-05

150

2018271407 30 Nov 2018

Gene Name	Cluster Name	Exp. Set	Corr. Vec.	R	P
LYM273 H6	sorghum| 09v 11SB03G044410	3	A	0.950	8.6E-05
LYM284 H24	sorghum|09vl|SB03G027960	1	E	0.867	0.00247
LYM289 H52	sorghum|09vl|SB09G005410	3	O	0.928	0.000307
LYM289 H52	sorghum|09vl|SB09G005410	3	N	0.830	0.005588
LYM289 H52	sorghum|09vl|SB09G005410	3	H	0.781	0.012924
LYM289 H52	sorghum|09vl|SB09G005410	3	G	0.714	0.03066
LYM289 H52	sorghum|09vl|SB09G005410	3	D	0.704	0.03412
LYM290 Hl3	sorghum 09vlSB01G009390	1	E	0.766	0.01617

Table 21. Provided are the correlations (R) between the expression levels of yield improving genes and their homologs in tissues (Flag leaf, Flower meristem and Flower; Expression (Exp.) sets) and the phenotypic performance in various yield, biomass, growth rate and/or vigor components [Correlation (Corr.) vector (Vec.)] under stress conditions or normal conditions across Sorghum accessions.

Sorghum vigor related parameters under 100 mM NaCl and low temperature (10 ±2 °C) -Ten Sorghum varieties were grown in 3 repetitive plots, each containing 17 plants, at a net house under semi-hydroponics conditions. Briefly, the growing protocol was as follows: Sorghum seeds were sown in trays filled with a mix of vermiculite and peat in a 1:1 ratio. Following germination, the trays were transferred to the high salinity solution (100 mM NaCl in addition to the Full Hogland solution), low temperature (10 ± 2 °C in the presence of Full Hogland solution) or at Normal growth solution [Full Hogland solution at 28 ± 2 °C],

Full Hogland solution consists of: KNO₃ - 0.808 grams/liter, MgSO₄ - 0.12 grams/liter, KH2PO4 - 0.172 grams/liter and 0.01 % (volume/volume) of ‘Super coratin' micro elements (Iron-EDDHA [ethylenediamine-N,N'-bis(2-hydroxyphenylacetic acid)]- 40.5 grams/liter; Mn - 20.2 grams/liter; Zn 10.1 grams/liter; Co 1.5 grams/liter; and Mo 1.1 grams/liter), solution’s pH should be 6.5 - 6.8],

RNA extraction - All 10 selected Sorghum varieties were sampled per each treatment. Two tissues [leaves and roots] growing at 100 mM NaCl, low temperature (10 ± 2 °C) or under Normal conditions (full Hogland at a temperature between 28 ± 2 °C) were sampled and RNA was extracted as described in Example 3 above.

Table 22

Sorghum transcriptom expression sets

Expression Set	Set ID
Sorghum roots under cold	1
Sorghum vegetative meristem NaCl	2
Sorghum vegetative meristem under low nitrogen	3
Sorghum vegetative meristem under cold conditions	4
Sorghum roots under NaCl	5

151

2018271407 30 Nov 2018

Expression Set	Set ID
Sorghum vegetative meristem under normal conditions	6
Sorghum roots under low nitrogen	7
Sorghum roots under normal	8

Table 22: Provided are the Sorghum transcriptom expression sets. Cold conditions = 10 ± 2 °C; NaCl = 100 rnM NaCl; low nitrogen =1.2 mM Nitrogen; Normal conditions = 16 rnM Nitrogen.

Experimental Results different Sorghum varieties were grown and characterized for the following parameters: Leaf number Normal = leaf number per plant under normal conditions (average of five plants); Plant Height Normal = plant height under normal conditions (average of five plants); Root DW 100 rnM NaCl - root dry weight per plant under salinity conditions (average of five plants); The average for each of the measured parameter was calculated using the JMP software and values are summarized in Table 24 below. Subsequent correlation analysis between the various transcriptom sets and the average parameters were conducted (Table 25). Results were then integrated to the database.

Table 23

Sorghum correlated parameters (vectors)

Correlation Vector	Corr. Id
DW Root/Plant - Cold	A
DW Root/Plant - 100 mM NaCl	B
DW Shoot/Plant - Low Nitrogen	C
DW Root/Plant - Low Nitrogen	D
Leaf number TP-3* - Cold	E
Leaf number TP-3*- 100 mM NaCl	F
Plant Height TP-3*- 100 mM NaCl	G
DW Shoot/Plant - Cold	H
DW Shoot/Plant - Normal	I
Plant Height TP-3* - Low Nitrogen	J
Leaf number TP-3* - Low Nitrogen	K
DW Shoot/Plant - 100 mM NaCl	L
Leaf number TP-3*-Normal	M

Table 23: Provided are the Sorghum correlated parameters. Cold conditions = 10 ± 2 °C; NaCl = 100 mM NaCl; low nitrogen = 1.2 mM Nitrogen; Normal conditions = 16 mM Nitrogen * TP-3 refers to time point 3.

152

2018271407 30 Nov 2018

Table 24

Sorghum accessions, measured parameters

Seed ID	F	B	L	G	E	A	H	M	I
20	3.67	0.35	0.66	14.63	3.88	0.83	1.03	4.17	0.81
22	3.88	1.45	2.43	16.31	4.16	0.95	1.34	4.48	1.89
26	4.28	1.49	2.40	20.56	4.52	1.47	1.71	4.93	2.51
27	4.03	0.81	1.61	14.70	4.28	1.06	1.28	4.53	1.26
28	3.97	1.03	1.77	16.43	4.33	0.71	1.12	4.52	1.55
29	3.98	0.95	1.66	16.12	4.17	1.38	1.69	4.64	1.50
30	3.90	2.00	2.23	15.61	3.94	2.04	2.24	4.49	1.93
31	4.18	1.39	2.76	18.71	4.26	1.03	1.26	4.79	1.95
34	3.70	1.29	1.29	13.65	4.20	1.01	1.08	4.37	1.48
37	3.82	1.76	1.55	15.72	4.04	1.01	1.02	4.54	1.85

Table 24: Provided are the measured parameters under 100 mM NaCl and low temperature (8-10 °C) conditions of Sorghum accessions (Seed ID) according to the Correlation ID numbers (described in Table 23 above) as follows: F [100 rnM NaCl: leaf Number]; B [100 mM NaCl: Root DW]; L [100 mM NaCl: Shoot DW]; G [100 rnM NaCl: Plant height]; E [low temperature: leaf Number]; A [low temperature: Root 10 DW]; H [low temperature: Shoot DW];; M [Normal: leaf Number]; I [Normal: Shoot DW],

Table 25

Correlation between the expression level of selected genes of some embodiments of 15 the invention in roots and the phenotypic performance under normal or abiotic stress conditions across Sorghum accessions

Gene Name	Cluster Id	Exp. Set	Corr. Vec.	R	P
LYM263	sorghum) gb 161. crp| AI622410	5	G	0.705635	0.183016
LYM263	sorghum) gb 161. crp| AI622410	5	F	0.908761	0.032626
LYM263	sorghum) gb 161. crp| AI622410	8	I	0.836212	0.004969
LYM2 H8	sorghum|09vl|SB07G004285	1	A	0.73969	0.01447
LYM4H11	sorghum 09vl SB03G000920	2	B	0.83675	0.00491
LYM4H11	sorghum 09vl SB03G000920	2	B	0.73187	0.02499
LYM4H11	sorghum 09vl SB03G000920	4	E	0.70634	0.03342
LYM14 H43	sorghum09vl SB01G038730	1	A	0.71433	0.02029
LYM19 H12	sorghum 09vl SB05G009990	5	F	0.97628	0.00437
LYM19 H12	sorghum 09vl SB05G009990	5	G	0.88580	0.04552
LYM24H10	sorghum|09vl|SB03G044280	4	H	0.75256	0.01929
LYM24H10	sorghum|09vl|SB03G044280	4	H	0.74948	0.02008
LYM73 H8	sorghum|09vl|SB07G004300	5	F	0.97233	0.00550
LYM73 H8	sorghum|09vl|SB07G004300	5	F	0.92449	0.02462
LYM73 H8	sorghum|09vl|SB07G004300	4	E	0.73646	0.02364
LYM83 H12	sorghum|09vl|SB09G026370	2	F	0.70736	0.03305
LYM129 H4	sorghum|09vl|SB03G044510	1	E	0.72429	0.01784
LYM129 H4	sorghum|09vl|SB03G044510	2	F	0.72339	0.02761
LYM129 H4	sorghum|09vl|SB03G044510	6	I	0.71891	0.02907
LYM129 H4	sorghum|09vl|SB03G044510	6	I	0.71123	0.03168
LYM129 H4	sorghum|09vl|SB03G044510	2	F	0.70792	0.03285
LYM140 H27	sorghum|09vl|SB06G028990	2	G	0.80589	0.00873
LYM140 H27	sorghum|09vl|SB06G028990	2	F	0.78965	0.01136
LYM140 H27	sorghum|09vl|SB06G028990	6	I	0.71625	0.02996

153

2018271407 30 Nov 2018

Gene Name	Cluster Id	Exp. Set	Corr. Vec.	R	P
LYM153 H9	sorghum|09vl|SB10G003440	4	H	0.78966	0.01136
LYM153 H9	sorghum|09vl|SB10G003440	4	H	0.73143	0.02512
LYM153 H9	sorghum|09vl|SB10G003440	4	A	0.71026	0.03202
LYM115 HO	sorghum|09vl|SB01G043900	2	F	0.74903	0.02019
LYM188H13	sorghum|09vl|SB01G007950	5	F	0.87882	0.04971
LYM203 H14	sorghum|09vl|SB04G005460	2	B	0.78001	0.01316
LYM217 H3	sorghum|09vl|SB01G043910	5	B	0.94269	0.01633
LYM217 H3	sorghum|09vl|SB01G043910	5	B	0.93691	0.01884
LYM228 Hl	sorghum|09vl|SB09G006910	1	A	0.72334	0.01806
LYM232 H3	sorghum|09vl|SB02G000450	2	L	0.77653	0.01385
LYM232 H3	sorghum|09vl|SB02G000450	2	F	0.72326	0.02766
LYM240H12	sorghum|09vl ISB02G03 8240	4	H	0.76382	0.01659
LYM240H12	sorghum|09vl ISB02G03 8240	2	L	0.73895	0.02293
LYM251 Hl 06	sorghum|09vl | SB01G006180	5	F	0.95275	0.01224
LYM284 H24	sorghum|09vl|SB03G027960	6	M	0.76300	0.01677
LYM289 H53	sorghum 09vl SB10G002980	5	G	0.91500	0.02936

Table 25. Provided are the correlations (R) between the expression levels yield improving genes and their homologs in various tissues [Expression (Exp.) sets] and the phenotypic performance [yield, biomass, growth rate and/or vigor components (Correlation vector)] under abiotic stress conditions (salinity) or normal conditions across Sorghum accessions. Corr. Vec. = correlation vector as described hereinabove (Table 23).

EXAMPLE 7

GENE CLONING AND GENERATION OF BINARY VECTORS FOR PLANT EXPRESSION

To validate their role in improving oil content, plant yield, seed yield, biomass, fiber yield and/or quality, growth rate, ABST, NUE and/or vigor, selected genes were over-expressed in plants, as follows.

Cloning strategy

Genes listed in Examples 1-6 hereinabove were cloned into binary vectors for the generation of transgenic plants. For cloning, the full-length open reading frame (ORF) was first identified. In case of ORF-EST clusters and in some cases already published mRNA sequences were analyzed to identify the entire open reading frame by comparing the results of several translation algorithms to known proteins from other plant species. To clone the full-length cDNAs, reverse transcription (RT) followed by polymerase chain reaction (PCR; RT-PCR) was performed on total RNA extracted from leaves, flowers, siliques or other plant tissues, growing under normal conditions. Total RNA was extracted as described in Example 3 above. Production of cDNA and PCR amplification was performed using standard protocols described elsewhere (Sambrook

2018271407 30 Nov 2018

154

J., E.F. Fritsch, and T. Maniatis. 1989. Molecular Cloning. A Laboratory Manual., 2nd Ed. Cold Spring Harbor Laboratory Press, New York.) which are well known to those skilled in the art. PCR products were purified using PCR purification kit (Qiagen). In case where the entire coding sequence was not found, RACE kit from Invitrogen (RACE = R apid A ccess to cDNA E nds) was used to access the full cDNA transcript of the gene from the RNA samples described above.

In case genomic DNA was cloned, as in the case of LYM122 (SEQ ID NO:3739) and LYM273 (SEQ ID NO:3738), the genes were amplified by direct PCR on genomic DNA extracted from leaf tissue using the DNAeasy kit (Qiagen Cat. No. 69104).

Usually, 2 sets of primers were synthesized for the amplification of each gene from a cDNA or a genomic sequence; an external set of primers and an internal set (nested PCR primers). When needed (e.g., when the first PCR reaction did not result in a satisfactory product for sequencing), an additional primer (or two) of the nested PCR primers were used. Table 26 below provides primers used for cloning of selected genes.

Table 26

The PCR primers used for cloning the genes of some embodiments of the invention into high copy vectors

Gene Name	Restriction Enzymes used for cloning	Primers used for amplification
LYM1	SalI,XbaI	LYMI NF Sall (SEQ ID NO: 3740) AAAGTCGACAGTAGGCAATCATGTGTGAGG
LYMINRXbal (SEQ ID NO: 3741) AATTCTAGACTAAGCTAGAGAGCTCGACTAATGC
LYM10	Xhol,Kpnl	LYM10 NF Xhol (SEQ ID NO: 3742) ATACTCGAGTCTCCAACCTTGCGAAGG
LYM10 EF Xhol (SEQ ID NO: 3743) ATACTCGAGAACCCGATCTCTCCAACC
LYM10 NR Kpnl (SEQ ID NO: 3744) TATGGTACCCCTGCGAATTCTTGCCTTAG
LYM10 ER Kpnl (SEQ ID NO: 3745) TATGGTACCTGACGCCACCCTCAACTC
LYM100	SalI,XbaI	LYMIOO NF Sall (SEQ ID NO: 3746) AAAGTCGACAGGAAACCCTAACGAAGATACC
LYMIOO EF Sall (SEQ ID NO: 3747) AAAGTCGACGGAAACATACAGGTCGATTGAG
LYMIOO NR Xbal (SEQ ID NO: 3748) AAATCTAGAGGGAAAGTTTAGTAGCACCAAC
LYMIOO ER Xbal (SEQ ID NO: 3749) AAATCTAGAATATAACGTTAGAGCGGAGTGG
LYM102	BamHI.XhoI	LYM102_NF_BamHI (SEQ ID NO: 3750) AAAGGATCCGAGCTGCTGATTGTGAGTCAAG

155

2018271407 30 Nov 2018

Gene Name	Restriction Enzymes used for cloning	Primers used for amplification
		LYM102_NR_XhoI (SEQ ID NO: 3751) AAACTCGAGCTAGGACAGCACTTCAGATAAGACC
LYM103	BamHI,XhoI	LYM103_NF_BamHI (SEQ ID NO: 3752) AAAGGATCCCGACCGAGTCAATCAATCC
LYM103_NR_XhoI (SEQ ID NO: 3753) AAACTCGAGAACAAGTATGACAGGCCAACTC
LYM105	BamHI,XhoI	LYM105_NF_BamHI (SEQ ID NO: 3754) AAAGGATCCTAGCTAGCTTACTCCACAGTGC
LYM105_EF_BamHI (SEQ ID NO: 3755) AAAGGATCCAGCCACACGCTTAGCTTAGC
LYM105_NR_XhoI (SEQ ID NO: 3756) AAACTCGAGCGAGCAGAAATTAACAGCTAAC
LYM105_ER_XhoI (SEQ ID NO: 3757) AAACTCGAGACTACAGATCCAAAGCACGAAC
LYM106	SalI,XbaI	LYM106_NF_SalI (SEQ ID NO: 3758) AAAGTCGACACTCAACGTAGTTCCTCACCTG
LYM106_NR_XbaI (SEQ ID NO: 3759) AAATCTAGAAAGCTTTAGTTCTAGCACACGAC
LYM107	BamHI,XhoI	LYM107_NF_BamHI (SEQ ID NO: 3760) AAAGGATCCGTACTCCTATATTAGGCTCGCTC
LYM107_EF_BamHI (SEQ ID NO: 3761) AAAGGATCCCTGCGTACTCCTATATTAGGCTC
LYM107_NR_XhoI (SEQ ID NO: 3762) AAACTCGAGAATTTGGTATCAGAAACCTTGC
LYM107_ER_XhoI (SEQ ID NO: 3763) AATCTCGAGTGAATCACTCAGTGTGCATGAC
LYM109	Xhol, Stul	LYM109_F2_XhoI (SEQ ID NO: 3764) AAACTCGAGCCCAGCGGACTCCTACTCTG
LYM109_F2_XhoI (SEQ ID NO: 3764) AAACTCGAGCCCAGCGGACTCCTACTCTG
LYM109_R2_StuI (SEQ ID NO: 3765) TTTAGGCCTTCACAGTCTTACAAGTCCGATTGCC
LYM109_R2_StuI (SEQ ID NO: 3765) TTTAGGCCTTCACAGTCTTACAAGTCCGATTGCC
LYM110	BamHI,XhoI	LYMllO NF BamHI (SEQ ID NO: 3766) AAAGGATCCGAACCAAACCTCGGAGAAAC
LYMllONRXhoI (SEQ ID NO: 3767) AAACTCGAGACCATCACCTGTAATACAACTACC
LYM111	Xhol,Sad	LYMlll NF XhoI (SEQ ID NO: 3768) AAACTCGAGGAATCTGGTTGCTCATCTCATC
LYM11 lEFXhoI (SEQ ID NO: 3769) AAACTCGAGCTTCACAACGGACGAGAGG
LYMlllNRSacI (SEQ ID NO: 3770) AAAGAGCTCATAATCGTTGGAACTTGGAATC
LYM11 l ER Sad (SEQ ID NO: 3771) AAAGAGCTCACAGCTTATCCCTACATGCTTC
LYM112	BamHI,XhoI	LYM112_NF_BamHI (SEQ ID NO: 3772) AAAGGATCCTCAATTGAATCAGATGCTCCAC
LYM112_EF_BamHI (SEQ ID NO: 3773) AAAGGATCCATTCCTTTGACCGATTTCTTG

156

2018271407 30 Nov 2018

Gene Name	Restriction Enzymes used for cloning	Primers used for amplification
		LYM112_NR_XhoI (SEQ ID NO: 3774) AAACTCGAGCTAATTAAGACAAATCAGTGGCACC
LYM112_ER_XhoI (SEQ ID NO: 3775) AAACTCGAGACAGAAGGTCGATGTTGATCTG
LYM113	SalI,XbaI	LYM113_NF_SalI (SEQ ID NO: 3776) AAAGTCGACTTCTTGATCTAAATTTGGGTGG
LYM113_EF_SalI (SEQ ID NO: 3777) AAAGTCGACACTAGCTCTGCACTTTCCCTG
LYM113_NR_XbaI (SEQ ID NO: 3778) AAATCTAGAGATTCAAGTGCGTTGTCTGTC
LYM113_ER_XbaI (SEQ ID NO: 3779) AAATCTAGACTTGGTATTTACAGGACAATCG
LYM115	BamHI,XhoI	LYM115_F_BamHI (SEQ ID NO: 3780) AAAGGATCCTCGCCGCAGATGGAAGTCT
LYM115_ER_XhoI (SEQ ID NO: 3781) TTTCTCGAGCAAACTCGTCTGGAGATGGG
LYM116	SalI,XbaI	LYM116_EF_SalI (SEQ ID NO: 3782) AAAGTCGACTTGGCTCCGGATATCGCA
LYM116_ER_XbaI (SEQ ID NO: 3783) AAATCTAGAAGGCAGATGTTCATAACCACAC
LYM117		LYM117_F2_BamHI (SEQ ID NO: 3784) AAAGGATCCCGTCGTCAAGTGCTGGC
LYM117_R2_EcoRV (SEQ ID NO: 3785) AGTGATATCTCAATGTTTAGGGTCTCGGCATG
LYM119	SalI,XbaI	LYM119_NF_SalI (SEQ ID NO: 3786) AAAGTCGACATCGAGTTGTTCGTCCGTC
LYM119_NR_XbaI (SEQ ID NO: 3787) AAATCTAGAACACCAAGCGTACATCTCAGAC
LYM12	XhoI,KpnI	LYM12 EF Xhol (SEQ ID NO: 3788) TTACTCGAGTGCTTCTCTTCTTTCCTCTCTG
LYM12 ER Kpnl (SEQ ID NO: 3789) ATAGGTACCTCACAGCAAACTAACATGAACCG
LYM120	BamHI,XhoI	LYM120_NF_BamHI (SEQ ID NO: 3790) AAAGGATCCGGAAGTCCGGAGTTGGAAG
LYM120_NR_XhoI (SEQ ID NO: 3791) AAACTCGAGCAGTCACTCACACGCTACTACG
LYM121	BamHI,XhoI	LYM121_NF_BamHI (SEQ ID NO: 3792) AAAGGATCCACTGCTGACCAACTTCAGTGTC
LYM121_EF_BamHI (SEQ ID NO: 3793) AAAGGATCCGACAAGGCTATCACATCCAATC
LYM121_NR_XhoI (SEQ ID NO: 3794) AAACTCGAGTTCTAAAGAAACAATCACGCAC
LYM121_ER_XhoI (SEQ ID NO: 3795) AAACTCGAGAGCAGAAGAAACTAGGCATGTG
LYM122G		LYM122_EF_BamHI (SEQ ID NO: 3796) AAAGGATCCTGCAGCCCTGACACACAAC
LYM122_ER_XhoI (SEQ ID NO: 3797) AAACTCGAGACCATCATGTAATACCCACCTC
LYM125		LYM125_EF_BamHI (SEQ ID NO: 3798) AAAGGATCCCTGTGCTTGGAGTAGACACGAG

157

2018271407 30 Nov 2018

Gene Name	Restriction Enzymes used for cloning	Primers used for amplification
		LYM125_ER_KpnI (SEQ ID NO: 3799) AAAGGTACCGGAGAATTTGGATCAGTGCAG
LYM127		LYM127_F2_BamHI (SEQ ID NO: 3800) TTTGGATCCCTTCTTGCTGTCGAACACCAG
LYM127_R2_XhoI (SEQ ID NO: 3801) TTTCTCGAGGTCATGGGATTCTTGTCAGATACTAG
LYM128	BamHI,XhoI	LYM128_NF_BamHI (SEQ ID NO: 3802) TTTGGATCCTTCACACCTCACCGAGCG
LYM128_EF_BamHI (SEQ ID NO: 3803) AAAGGATCCAACCCGTTCACACCTCACC
LYM128_NR_XhoI (SEQ ID NO: 3804) AAACTCGAGGATCACTTGACAATTACCGTGC
LYM128_ER_XhoI (SEQ ID NO: 3805) AAACTCGAGTATGCTGATATGCCAGGTTTAC
LYM129	SalI,XbaI	LYM129_NF_SalI (SEQ ID NO: 3806) AAAGTCGACATTCAGTCTTGTCGGCTACATC
LYM129_EF_SalI (SEQ ID NO: 3807) AAAGTCGACTAGATCAGCCTCGATTCATCTC
LYM129_NR_XbaI (SEQ ID NO: 3808) AAATCTAGAGCTTAATCAGAAGAAACGAACC
LYM129_ER_XbaI (SEQ ID NO: 3809) AAATCTAGAAATTGCACAATACATGAACACG
LYM13	SalI,BamHI	LYM13_NF_SalI (SEQ ID NO: 3810) AAAGTCGACCAAGCGGTAGGAGATGAGG
LYM13_NR_BamHI (SEQ ID NO: 3811) AAAGGATCCTTATAACAACTATTCCCGGTAAGC
LYM130	SalI,XbaI	LYM130_NF_SalI (SEQ ID NO: 3812) AAAGTCGACAGAAATTAAGTTGCCGGAGAG
LYM130_NR_XbaI (SEQ ID NO: 3813) AAATCTAGAATGCAGATGAGAGCTCAAGATG
LYM131	SalI,XhoI	LYM131_NF_SalI (SEQ ID NO: 3814) AAAGTCGACTCCCTACCCTAGTCGATCTCC
LYM131_EF_SalI (SEQ ID NO: 3815) AAAGTCGACGACTCGTCTCCTCGTTGCTC
LYM131_NF_SalI (SEQ ID NO: 3814) AAAGTCGACTCCCTACCCTAGTCGATCTCC
LYM131_ER_XhoI (SEQ ID NO: 3816) AAACTCGAGTATAACACAGGCATAAAGCAGC
LYM132	BamHI,XhoI	LYM132_EF_BamHI (SEQ ID NO: 3817) AAAGGATCCATATTGGAATGCTTCTGTCGTC
LYM132_ER_XhoI (SEQ ID NO: 3818) AAACTCGAGTACACGATAATCACAAACCACG
LYM134	BamHI,XhoI	LYM134_NF_BamHI (SEQ ID NO: 3819) AAAGGATCCATGGTGATTCGGTTGTTGTTAG
LYM134_EF_BamHI (SEQ ID NO: 3820) AAAGGATCCATCGTTGAATTGATGGTGATTC
LYM134_NR_XhoI (SEQ ID NO: 3821) AAACTCGAGTCATACGTCGAAGAACCAGAAC

158

2018271407 30 Nov 2018

Gene Name	Restriction Enzymes used for cloning	Primers used for amplification
		LYM134_ER_XhoI (SEQ ID NO: 3822) AAACTCGAGTGAAACTTTCGCCAACTACAC
LYM135		LYM135_NF_SalI (SEQ ID NO: 3823) AAAGTCGACTTCTGATCTGCTCAGCTAAAGG
LYM135_NR_Sad (SEQ ID NO: 3824) AAAGAGCTCCTGATGCACAAATATGGTAACG
LYM136	BamHI,KpnI	LYM136_NF_BamHI (SEQ ID NO: 3825) AAAGGATCCCCGGTTCTATGTGTAGGAAGAG
LYM136_EF_BamHI (SEQ ID NO: 3826) AAAGGATCCCAGGATGAGTGTTGATCCATTC
LYM136_NR_KpnI (SEQ ID NO: 3827) AAAGGTACCGTCACAAACGCCTCAACATATC
LYM136_ER_KpnI (SEQ ID NO: 3828) AAAGGTACCTTCACCATATTGCTACGAAATC
LYM137	SalI,XbaI	LYM137_NF_SalI (SEQ ID NO: 3829) AAAGTCGACAGTTCAAGAGGCTGTCCTGAG
LYM137_NR_XbaI (SEQ ID NO: 3830) AAATCTAGATCCAATAACATAAGAAACCACG
LYM138	Sall,Sad	LYM138_EF_SalI (SEQ ID NO: 3831) AAAGTCGACAACGAACCACTCTTCTGCATC
LYM138_ER_Sad (SEQ ID NO: 3832) AAAGAGCTCGAAGCAACCTGGAAATAAACTC
LYM14	EcoRV,PstI	LYM14_NF_EcoRV (SEQ ID NO: 3833) AAAGATATCCTCCTCAGATCCACCACCAC
LYM14_NR_PstI (SEQ ID NO: 3834) AATCTGCAGCTAAAATATTCAGGGCTTGTTG
LYM140	XhoI,Sad	LYM140_F_XhoI (SEQ ID NO: 3835) AAACTCGAGCTCCAGCACACGGACGAG
LYM140_ER_Sad (SEQ ID NO: 3836) AAAGAGCTCTACGAGTACGAATTATTGCCAG
LYM141		LYM141_NF_BamHI (SEQ ID NO: 3837) AAAGGATCCACAAGCGTCTTCTTCGTCTTC
LYM141_NR_KpnI (SEQ ID NO: 3838) AAAGGTACCCCATGCCACCCTTACTATACTC
LYM142	Sall,Sad	LYM142_NF_SalB (SEQ ID NO: 3839) TAAGTCGACCACACAGAGCACAGCACAGAG
LYM142_NR_SacB (SEQ ID NO: 3840) TGAGCTCTGAACATGCGACCGTATGC
LYM143	SalI,XbaI	LYM143_NF_SalI (SEQ ID NO: 3841) AAAGTCGACCACTAGCGCACAGATCTCCTAC
LYM143_NR_XbaI (SEQ ID NO: 3842) AAATCTAGAAATAGTGTCCATGAGACGAACG
LYM144	SalI,EcoRV	LYM144_NF_SalI (SEQ ID NO: 3843) AAAGTCGACACGACGAGGAGGAGGATG
LYM144_NR_EcoRV (SEQ ID NO: 3844) AATGATATCACGCATGGATTTCTTTAAGTTG
LYM145	BamHI,XhoI	LYM145_F2_BamHI (SEQ ID NO: 3845) ATCGGATCCTAGCTTTGCCCAGTTTTGCT

159

2018271407 30 Nov 2018

Gene Name	Restriction Enzymes used for cloning	Primers used for amplification
		LYM145_F2_BamHI (SEQ ID NO: 3845) ATCGGATCCTAGCTTTGCCCAGTTTTGCT
LYM145_R2_XhoI (SEQ ID NO: 3846) TTTCTCGAGCTATGCAGTTTTAGCCTAAGGCAAG
LYM145_R2_XhoI (SEQ ID NO: 3846) TTTCTCGAGCTATGCAGTTTTAGCCTAAGGCAAG
LYM146		LYM146_F2_KpnI (SEQ ID NO: 3847) AAAGGTACCCGAGGTCGTCACGCACAG
LYM146_R2_KpnI (SEQ ID NO: 3848) AATGGTACCTGGGTGGTTAGACAGCAAGG
LYM147	SalI,XbaI	LYM147_NF_SalI (SEQ ID NO: 3849) AAAGTCGACCTCTGGCGCTCTCCTATACTC
LYM147_EF_SalI (SEQ ID NO: 3850) AAAGTCGACAGTACGTGTACGTTTCAGGGAG
LYM147_NR_XbaI (SEQ ID NO: 3851) AAATCTAGAAGTACCACTAGCAGAAAGGCAG
LYM147_ER_XbaI (SEQ ID NO: 3852) AAATCTAGATGGCACCCAATACTAGTACCAC
LYM148	BamHI,XhoI	LYM148_NF_BamHI (SEQ ID NO: 3853) AAAGGATCCCTTACCCTTCCCTGAGATCC
LYM148_NR_XhoI (SEQ ID NO: 3854) AAACTCGAGCTAACTACCAAAGTTCAAGCAGCTC
LYM149	SalI,XbaI	LYM149_NF_SalI (SEQ ID NO: 3855) AAAGTCGACACCATGAGTTCATAACAAGAAGG
LYM149_NR_XbaI (SEQ ID NO: 3856) AAATCTAGACTAATACATGGAAGTGCAGACATGC
LYM15	SalI,XbaI	LYM15_NF_SalI (SEQ ID NO: 3857) AAAGTCGACAGGTACAGTATAGTATGACACCGAC
LYM15_NR_XbaI (SEQ ID NO: 3858) AATTCTAGACTACTGTTAACCGCTGATTATATCC
LYM152	SalI,XbaI	LYM152_NF_SalI (SEQ ID NO: 3859) TTTGTCGACGAAGAAGAGATGGGAGTTTTCTC
LYM152_NR_XbaI (SEQ ID NO: 3860) AAATCTAGAATTTCTGACATTACATTATAGTCTCG
LYM153	SalI,XbaI	LYM153_NF_SalI (SEQ ID NO: 3861) AAAGTCGACTTCTCCTCCTACGTTCTACTGG
LYM153_NR_XbaI (SEQ ID NO: 3862) AAATCTAGACTAACAGGGTTTCTCCACTAAGTAAG
LYM155	SalI,XbaI	LYM155_NF_SalI (SEQ ID NO: 3863) AAAGTCGACTCCACTATAAGCAACGCACC
LYM155_EF_SalI (SEQ ID NO: 3864) AAAGTCGACGAAGGAAACTCGGTGACACG
LYM155_NR_XbaI (SEQ ID NO: 3865) AAATCTAGAATGCCATGCTACTAAGAACCTAC
LYM155_ER_XbaI (SEQ ID NO: 3866) AAATCTAGATAAACATCTCATGCCATGCTAC
LYM156	Stul,Stul	LYM156_NF_StuI (SEQ ID NO: 3867) TTTAGGCCTCAAGATCCGCAGAGATGATC
LYM156 NR Stul_2 (SEQ ID NO: 3868) AAAAGGCCTTTAAGTGCTTGCGTCGTTTTACAG

160

2018271407 30 Nov 2018

Gene Name	Restriction Enzymes used for cloning	Primers used for amplification
LYM157_G	XbaI,SacI	LYM157_EF_Xba_B (SEQ ID NO: 3869) AATCTAGACCTCGAGCCACCCACTTTC
LYM157_ER_Sac_B (SEQ ID NO: 3870) TGAGCTCTCACCTTCATCTTGTCTTCACTGGT
LYM159	SalI,XbaI	LYM159_NF_SalI (SEQ ID NO: 3871) AAAGTCGACCTCTACCTTCTTCTTCGGTCAG
LYM159_NR_XbaI (SEQ ID NO: 3872) AAATCTAGAAGCTTAGCTAGGCCAACAATAC
LYM16	SalI,XbaI	LYM16NF Sall (SEQ ID NO: 3873) CTAGTCGACAAGAAATTGGCACAGAAATGG
LYM16 NR Xbal (SEQ ID NO: 3874) TATTCTAGATCAAAGAGCCTAGTGAGCGTCTTC
LYM160	SalI,XbaI	LYM160_F2_SalI (SEQ ID NO: 3875) AAAGTCGACAGGCCAGACCAAAACCATG
LYM160_F2_SalI (SEQ ID NO: 3875) AAAGTCGACAGGCCAGACCAAAACCATG
LYM160_NR_XbaI (SEQ ID NO: 3876) AAATCTAGAAGAGTAACATGGACACACGACC
LYM160_R2_XbaI (SEQ ID NO: 3877) AATTCTAGATCAGTACAAGAGCCAGATGTCTGA
LYM161	BamHI,XhoI	LYM161_EF_BamHI (SEQ ID NO: 3878) AAAGGATCCGAGAGAGGAGCAAAGATTCACC
LYM161_ER_XhoI (SEQ ID NO: 3879) AAACTCGAGTACAGGATGGTTGGTCTTCTTC
LYM162	BamHI,XhoI	LYM162_NF_BamHI (SEQ ID NO: 3880) TTTGGATCCGCATCTAAGCCGAATTGAAG
LYM162_NR_XhoI (SEQ ID NO: 3881) AAACTCGAGCTATTTCATGCTCAGTACCTGCAC
LYM164	SalI,XbaI	LYM164_NF_SalI (SEQ ID NO: 3882) AAAGTCGACATCCAGATGCTTCACATTCTTG
LYM164_NR_XbaI (SEQ ID NO: 3883) AAATCTAGATCGAGTTTGACACGAACTTATG
LYM165		LYM165_F2_XhoI (SEQ ID NO: 3884) AAACTCGAGCTACTCCGATCGGATCCTGAC
LYM165_R2_SacI (SEQ ID NO: 3885) AAAGAGCTCAAACGACGCACGGTCTCAC
LYM17	SmaI,KpnI	LYM17 NF X/Smal (SEQ ID NO: 3886) ATACCCGGGTCTCTCAAGATGGTGGTGCTG
LYM17 NR Kpnl (SEQ ID NO: 3887) TATGGTACCAAGGGCTTAGCAAATTCTTTC
LYM170	SalI,XbaI	LYM170_NF_SalI (SEQ ID NO: 3888) AAAGTCGACATTCTTCGACCTCCTAAACTCC
LYM170_EF_SalI (SEQ ID NO: 3889) AAAGTCGACAGTCTCACACAGATCGCTTCAC
LYM170_NR_XbaI (SEQ ID NO: 3890) AAATCTAGACTACCAACTCAGAACCAGGATGAG
LYM170_ER_XbaI (SEQ ID NO: 3891) AAATCTAGACATACCTATAAGGCTATAACACTGC
LYM172	BamHI,XhoI	LYM172_NF_BamHI (SEQ ID NO: 3892) AAAGGATCCCTCGTCTTCGTCTACTCCACC

161

2018271407 30 Nov 2018

Gene Name	Restriction Enzymes used for cloning	Primers used for amplification
		LYM172_EF_BamHI (SEQ ID NO: 3893) AAAGGATCCCCTCACTCGTAGTCTCGTCTTC
LYM172_NR_XhoI (SEQ ID NO: 3894) AAACTCGAGGGAGCTTTGGAGAATAACAAAC
LYM172_ER_XhoI (SEQ ID NO: 3895) AAACTCGAGCAACAGGTAACTCATTTCCACC
LYM173	BamHI,XhoI	LYM173_NF_BamHI (SEQ ID NO: 3896) AAAGGATCCTCATCAGTTCCCTGTTCTTCAG
LYM173_NR_XhoI (SEQ ID NO: 3897) AAACTCGAGATGACTGGACTAAAGCAACCAC
LYM174	BamHI,KpnI	LYM174_NF_BamHI (SEQ ID NO: 3898) AAAGGATCCCTCTTGCTAGGAGTAGCCTGC
LYM174_NR_KpnI (SEQ ID NO: 3899) AAAGGTACCTATTATCCTACATGCCACATGC
LYM175	SalI,XbaI	LYM175_NF_SalI (SEQ ID NO: 3900) AAAGTCGACCACTCCCTCTTATAGCCCACC
LYM175_NR_XbaI (SEQ ID NO: 3901) AAATCTAGACTAAGTGTACAGTTCACGGCACG
LYM176	SalI,XbaI	LYM176_NF_SalI (SEQ ID NO: 3902) AAAGTCGACTCTCGTTTCTCCTACCCTACAG
LYM176_NR_XbaI (SEQ ID NO: 3903) AAATCTAGACTAACAGTTTCCAGTCAAAGCTACAG
LYM178	SalI,XbaI	LYM178_NF_SalI (SEQ ID NO: 3904) AAAGTCGACCTATCCATCCGCCACAAGAC
LYM178_NR_XbaI (SEQ ID NO: 3905) AAATCTAGAACACAAGACACCATTTCTGGAG
LYM179	SalI,XhoI	LYM179_NF_SalI (SEQ ID NO: 3906) AAAGTCGACAGGATTTCTCTAGGATAGCAGC
LYM179_EF_SalI (SEQ ID NO: 3907) AAAGTCGACCTCAGTCGAGCGAGGATTTC
LYM179_NR_XhoI (SEQ ID NO: 3908) AAACTCGAGAAACAGAGCCTAACAGACATGG
LYM179_ER_XhoI (SEQ ID NO: 3909) AAACTCGAGGGGATGTTTAGACTGCTACAGG
LYM180	BamHI,XhoI	LYM180_NF_BamHI (SEQ ID NO: 3910) TATGGATCCCGACCTTTGATACCAAGCAAG
LYM180_NR_XhoI (SEQ ID NO: 3911) TTACTCGAGCACGGATTAGTTTGTAGTAGCATGG
LYM181		LYM181_F2_BamHI (SEQ ID NO: 3912) AATGGATCCTAAAAATGGCGGCTGCTACTC
LYM181_R2_EcoRV (SEQ ID NO: 3913) TTTGATATCTCATACACGGTTTCATATGGTCGG
LYM183		LYM183_EF_SalI (SEQ ID NO: 3914) AAAGTCGACATCAAACCAACGAGAGCACTAC
LYM183_ER_XbaI (SEQ ID NO: 3915) AAATCTAGAACTTCAGTGTACTTTCCCTTGC
LYM184		LYM184_NF_BamHI (SEQ ID NO: 3916) AAAGGATCCAACACGACTTGTGAGTGAGAGC
LYM184_EF_BamHI (SEQ ID NO: 3917) AAAGGATCCATATGAGTAACGCCATCAGGAG

162

2018271407 30 Nov 2018

Gene Name	Restriction Enzymes used for cloning	Primers used for amplification
		LYM184_NR_XhoI (SEQ ID NO: 3918) AAACTCGAGTGCCTCATTTAATCTTGGGTC
LYM184_ER_XhoI (SEQ ID NO: 3919) AAACTCGAGGAAATTGCCTCATTTAATCTTG
LYM185	BamHI,KpnI	LYM185_NF_BamHI (SEQ ID NO: 3920) AAAGGATCCAATTCGAGATATTTGGCTGTTC
LYM185_EF_BamHI (SEQ ID NO: 3921) AAAGGATCCAGATAGCAAGATAGTCCGGTTG
LYM185_NR_KpnI (SEQ ID NO: 3922) AAAGGTACCGGTCTATCACAAGCATCCTCAC
LYM185_ER_KpnI (SEQ ID NO: 3923) AAAGGTACCACCACCTTTGTGATTGTTTCTC
LYM186	SalI,XbaI	LYM186_NF_SalI (SEQ ID NO: 3924) AAAGTCGACCGACCCAAATTGACATAACTC
LYM186_NR_XbaI (SEQ ID NO: 3925) AAATCTAGAATAGCTGGAACCTGGTATTGAC
LYM188	BamHI,XhoI	LYM188_EF_BamHI (SEQ ID NO: 3926) AAAGGATCCCGAGCTAGGGTTAGGGTTTC
LYM188_ER_XhoI (SEQ ID NO: 3927) AAACTCGAGCAACAACTCACGCTACACATTC
LYM189	SalI,XbaI	LYM189_NF_SalI (SEQ ID NO: 3928) AAAGTCGACCCACGTCCTAGAATGAAAGAG
LYM189_EF_SalI (SEQ ID NO: 3929) AAAGTCGACTTCCTCTGCTTCCCACAGC
LYM189_NR_XbaI (SEQ ID NO: 3930) AAATCTAGACTGTTCATTCACGGTTGCAC
LYM189_ER_XbaI (SEQ ID NO: 3931) AAATCTAGAGCAAATCTGTCGCTTTATTAGG
LYM19	SalI,XbaI	LYM19_NF_SalI (SEQ ID NO: 3932) AAAGTCGACGAGAGAAGAGAGATGGTCCTCC
LYM19_NR_XbaI (SEQ ID NO: 3933) AAATCTAGATTATCATGCTGACTTCTTGCCAC
LYM192	XhoI,EcoRV	LYM192_EF_XhoI (SEQ ID NO: 3934) AAACTCGAGTGAGCAGCGAGCCCTAAC
LYM192_R_EcoRV (SEQ ID NO: 3935) TTTGATATCTCACACTACTAGGGAGTGGAGTAGTAA CTTGA
LYM193	BamHI,XhoI	LYM193_NF_BamHI (SEQ ID NO: 3936) AAAGGATCCCTAGTAGTGTTCTTCCCATTCG
LYM193_EF_BamHI (SEQ ID NO: 3937) AAAGGATCCAACAATCCGTCCTTTCATTTG
LYM193_NR_XhoI (SEQ ID NO: 3938) AAACTCGAGTAAACGACAGCGGTACACATAC
LYM193_ER_XhoI (SEQ ID NO: 3939) AAACTCGAGTACATCTCTAGGCAGCAAACAG
LYM196		LYM196_NF_BamHI (SEQ ID NO: 3940) AAAGGATCCGAGGACACCGCTTGCTTTC
LYM196_NR_XhoI (SEQ ID NO: 3941) AAACTCGAGAACCTTGGATATGACCAATCAG
LYM197	BamHI,XhoI	LYM197_EF_BamHI (SEQ ID NO: 3942) AAAGGATCCCTGTTGCCACATCTAGTGGTTC

163

2018271407 30 Nov 2018

Gene Name	Restriction Enzymes used for cloning	Primers used for amplification
		LYM197_ER_XhoI (SEQ ID NO: 3943) AAACTCGAGCACAATTCAGCGATTATTTCAG
LYM198	BamHI,XhoI	LYM198_F2_BamHI (SEQ ID NO: 3944) ATTGGATCCTTCATTTCCGCCATCCGT
LYM198_R2_XhoI (SEQ ID NO: 3945) AAACTCGAGCACCATCTCTTGCAGAAGGC
LYM2	EcoRV,Kpnl	LYM2_NF_EcoRV (SEQ ID NO: 3946) AAAGATATCCGGTAGGTAGATGAAATTAAGG
LYM2_NR_KpnI (SEQ ID NO: 3947) CGAGGTACCCTAATATGCAGGTCAGCACACAAG
LYM20	EcoRV,Kpnl	LYM20 NF EcoRV (SEQ ID NO: 3948) ATAGATATCACTCCGAATCCGACGCAC
LYM20 EF EcoRV (SEQ ID NO: 3949) ATAGATATCGAGATCCCAACTCCGAATCC
LYM20 NR Kpnl (SEQ ID NO: 3950) TATGGTACCCTACGTAAATCTCAGCACATGC
LYM20 ER Kpnl (SEQ ID NO: 3951) TATGGTACCCTTCTGCAACGTTATTTGAGG
LYM200	BamHI,XhoI	LYM200_NF_BamHI (SEQ ID NO: 3952) AAAGGATCCACTTTACCGGGCTACCATTC
LYM200_EF_BamHI (SEQ ID NO: 3953) AAAGGATCCTTACAAGAGCCTGTGAGCTGAG
LYM200_NR_XhoI (SEQ ID NO: 3954) AAACTCGAGCTTATCTGGACCACACTTGGAC
LYM200_ER_XhoI (SEQ ID NO: 3955) AAACTCGAGAAGAAATACATAGCCCTCCTCC
LYM201	BamHI,XhoI	LYM201_NF_BamHI (SEQ ID NO: 3956) AAAGGATCCGCCTCATCTCGGTTTACTATAAG
LYM201_NR_XhoI (SEQ ID NO: 3957) AAACTCGAGAAGTAGACACAAACCATCCTGG
LYM203	BamHI,XhoI	LYM203_EF_BamHI (SEQ ID NO: 3958) AAAGGATCCTCTATCAAATCAGCCACCTGTC
LYM203_ER_XhoI (SEQ ID NO: 3959) AAACTCGAGCTAGCAACTTTGTAGACCAGACGTG
LYM204		LYM204_NF_BamHI (SEQ ID NO: 3960) AAAGGATCCCTACTACCAGACAGAGAGGACAGG
LYM204_EF_BamHI (SEQ ID NO: 3961) TTTGGATCCGCTTTCTGGCATCGCTACTAC
LYM204_NR_XhoI (SEQ ID NO: 3962) TGTCTCGAGTCAGTAGGAGTTTATGAGATGAACC
LYM204_ER_Xlio (SEQ ID NO: 3963) AAACTCGAGTCAACTCATCATCCGGAACATGGTAC
LYM206	Xhol,EcoRV	LYM206_EF_XhoI (SEQ ID NO: 3964) AAACTCGAGAATTCTAGCAAGGCAGCTCAG
LYM206_ER_EcoRV (SEQ ID NO: 4199) AAAGATATCTAAAGGAGTCGTAGCCCTCTC
LYM207		LYM207_EF_BamHI (SEQ ID NO: 3966) AAAGGATCCACTCTTCCAACCGCTCCTC
LYM207_ER_KpnI (SEQ ID NO: 4200) AAAGGTACCCTAGTCTTGCGAAGTGCGAG
LYM208	BamHI,XhoI	LYM208_F2_BamHI (SEQ ID NO: 3968) AAAGGATCCTGCGGCTGAGTACAGACGAC

164

2018271407 30 Nov 2018

Gene Name	Restriction Enzymes used for cloning	Primers used for amplification
		LYM208_R2_KpnI (SEQ ID NO: 3969) AAAGGTACCCATCAATCCATGCTAATGTAGAGC
LYM21	EcoRV,KpnI	LYM21_NF_EcoRV (SEQ ID NO: 3970) AAAGATATCTCTCGCAGCACAAAGATGG
LYM21 NR Kpnl (SEQ ID NO: 3971) ATAGGTACCTCACCCTTAGTTCTTCACAGTGGTG
LYM212	SalI,XbaI	LYM212_NF_SalI (SEQ ID NO: 3972) AAAGTCGACCTGATACCCATCCATCCACC
LYM212_EF_SalI (SEQ ID NO: 3973) AAAGTCGACACTGACAAACCGGACCCAC
LYM212_NR_XbaI (SEQ ID NO: 3974) AAATCTAGACTAGCAGAGCCGAAGTAGTACGAG
LYM212_ER_XbaI (SEQ ID NO: 3975) AAATCTAGACTAGAACGAAGTAGTACGAGCAAGC
LYM213	BamHI,XhoI	LYM213_EF_BamHI (SEQ ID NO: 3976) AAAGGATCCCAGCTCATCAGAACACAGAAGG
LYM213_ER_XhoI (SEQ ID NO: 3977) AAACTCGAGTTCGACAATTTGCAATAGAAAG
LYM215	BamHI,XhoI	LYM215_F2_BamHI (SEQ ID NO: 3978) AATGGATCCTTCCCTCCCACCGAAATG
LYM215_F2_BamHI (SEQ ID NO: 3978) AATGGATCCTTCCCTCCCACCGAAATG
LYM215_R2_XhoI (SEQ ID NO: 3979) AAACTCGAGGAGCATGCAAAATGGACTAGACT
LYM215_R2_XhoI (SEQ ID NO: 3979) AAACTCGAGGAGCATGCAAAATGGACTAGACT
LYM217	SalI,XbaI	LYM217_F2_SalI (SEQ ID NO:4201 ) AAAGTCGACCGACCGATCCAAGTAGTGAGC
LYM217_R2_XbaI (SEQ ID NO:4202 ) AAATCTAGAAGCTGATAGGCCAGTCAATCC
LYM219	BamHI,KpnI	LYM219_F_BamHI (SEQ ID NO: 3980) AAAGGATCCTAGCAGTCTCGATGGCCG
LYM219_F_BamHI (SEQ ID NO: 3980) AAAGGATCCTAGCAGTCTCGATGGCCG
LYM219_R_KpnI (SEQ ID NO: 3981) TTTGGTACCCGAGTCAGCTTTTGTAATGATAG
LYM219_R_KpnI (SEQ ID NO: 3981) TTTGGTACCCGAGTCAGCTTTTGTAATGATAG
LYM22	SalI,XbaI	LYM22_NF_SalI (SEQ ID NO: 3982) AAAGTCGACTTAGCACACATGGCGTCTTC
LYM22_EF_SalI (SEQ ID NO: 3983) AAAGTCGACCATCGGCATCTTCCTAACTG
LYM22_NR_XbaI (SEQ ID NO: 3984) AATTCTAGATAATCTGTAGATGGCTGCCG
LYM22_ER_SmaI (SEQ ID NO: 3985) AATCCCGGGTAACAACGTACATGCAAGTCATC
LYM220	BamHI,EcoRV	LYM220_NF_BamHI (SEQ ID NO: 3986) AAAGGATCCCGACTTCAAGCATCAGACTACC

165

2018271407 30 Nov 2018

Gene Name	Restriction Enzymes used for cloning	Primers used for amplification
		LYM220_EF_BamHI (SEQ ID NO: 3987) AAAGGATCCAGCACACACATCCTCTAAGTGC
LYM220_NR_EcoRV (SEQ ID NO: 3988) AAAGATATCAACAGCAGTCACTTCACTCGTC
LYM220_ER_EcoRV (SEQ ID NO: 3989) AAAGATATCAAGTGGTACGGCTGAGTGTAAC
LYM221	BamHI,XhoI	LYM221_NF_BamHI (SEQ ID NO: 3990) AAAGGATCCACTGTCCACTGCGTCTGTCTC
LYM221_EF_BamHI (SEQ ID NO: 3991) AAAGGATCCATCGTTAGAGGCTCAGAGTCAG
LYM221_NR_XhoI (SEQ ID NO: 3992) AAACTCGAGACTACGTATTACACGGAGGTGG
LYM221_ER_XhoI (SEQ ID NO: 3993) AAACTCGAGTCTGCAGCATTCCTTAACCTAC
LYM223	XhoI,SacI	LYM223_NF_XhoI (SEQ ID NO: 3994) AAACTCGAGACCTGCCTGCCACTATACTATC
LYM223_EF_XhoI (SEQ ID NO: 3995) AAACTCGAGAGACCCGTCTTAACTCTACCTG
LYM223_NR_SacI (SEQ ID NO: 3996) AAAGAGCTCAGCACCGGTTGATCTAGAATAC
LYM223_ER_SacI (SEQ ID NO: 3997) AAAGAGCTCATTTATCCACGAACCCATATTC
LYM224	BamHI,XhoI	LYM224_EF_BamHI (SEQ ID NO: 3998) AAAGGATCCCAGGCCTCACGTGTCATTC
LYM224_EF_BamHI (SEQ ID NO: 3998) AAAGGATCCCAGGCCTCACGTGTCATTC
LYM224_R2_XhoI (SEQ ID NO: 3999) AAACTCGAGGTTTCCAGCCAACCAGAACAC
LYM224_ER_XhoI (SEQ ID NO: 4000) AAACTCGAGGATCCAAATTGGTAATGCTTTG
LYM228		LYM228_NF_BamHI (SEQ ID NO: 4001) AAAGGATCCGCAAGCACTCCACTTCAAGC
LYM228_F2_BamHI (SEQ ID NO: 4002) AAAGGATCCCTCGAAGTGTCCAAGAAGAACACA
LYM228_R2_KpnI (SEQ ID NO: 4003) TAAGGTACCGAGCTGCAAACATAACGTCGAG
LYM228_R2_KpnI (SEQ ID NO: 4003) TAAGGTACCGAGCTGCAAACATAACGTCGAG
LYM23	BamHI,KpnI	LYM23_NF_BamHI (SEQ ID NO: 4004) AAAGGATCCTCATCTCTCTCCCTCTCATCG
LYM23_NR_KpnI (SEQ ID NO: 4005) AAAGGTACCGTGCTGCTTCAACTATCCTCTC
LYM232		LYM232_EF_BamHI (SEQ ID NO: 4006) AAAGGATCCAAATTCCCAATTTCTTCGGTC
LYM232_ER_XhoI (SEQ ID NO: 4007) AAACTCGAGAGCACACACAGGTTCCTAAGAG
LYM236	SalI,XbaI	LYM236_F_SalI (SEQ ID NO: 4008) AAAGTCGACGACTACCAATCCAATCTCCTCC
LYM236_ER_XbaI (SEQ ID NO: 4009) AAATCTAGAAGAAATGTATAATCGAAGTGCATC
LYM238		LYM238_EF_SmaI (SEQ ID NO: 4010) AAACCCGGGTAGTGGTGGAGAGACGAAACAC

166

2018271407 30 Nov 2018

Gene Name	Restriction Enzymes used for cloning	Primers used for amplification
		LYM238_ER_SacI (SEQ ID NO: 4011) AAAGAGCTCCTACAAGTGCTGACTGCTGAAG
LYM239	BamHI,XhoI	LYM239_EF_BamHI (SEQ ID NO: 4012) AAAGGATCCCTTGGTCCGTCTCCACTCTC
LYM239_R_XhoI (SEQ ID NO: 4013) AAACTCGAGCTAGGATTGGTACTCATTTCTTTGTG
LYM24	SalI,XbaI	LYM24_NF_SalI (SEQ ID NO: 4014) AACGTCGACTCTTCTCTTTCTCTTCTCCTCG
LYM24_NR_XbaI (SEQ ID NO: 4015) ATATCTAGACATTCCAAACATTGTTATCAAAC
LYM240	BamHI,KpnI	LYM240_NF_BamHI (SEQ ID NO: 4016) AAAGGATCCTACTGTAAGCAGTTTCCCACC
LYM240_EF_BamHI (SEQ ID NO: 4017) AAAGGATCCAACAACGCTCGTACTGTAAGC
LYM240_NR_KpnI (SEQ ID NO: 4018) AAAGGTACCACAAGTCATTCTACCAAGCACC
LYM240_ER_KpnI (SEQ ID NO: 4019) AAAGGTACCATACTTTCCTTGCTCTGCTGTC
LYM241		LYM241_NF_BamHI (SEQ ID NO: 4020) AAAGGATCCAAACGGTTGGGAGGTTAGC
LYM241_NR_XhoI (SEQ ID NO: 4021) AAACTCGAGACTGGATCAGATTGTGAAGGTG
LYM242	BamHI,XhoI	LYM242_NF_BamHI (SEQ ID NO: 4022) AAAGGATCCACGACTCCGACGAGCGAC
LYM242_NR_XhoI (SEQ ID NO: 4023) AAACTCGAGAACTCAAGTGGACAAATGTTGC
LYM243	BamHI,XhoI	LYM243_EF_BamHI (SEQ ID NO: 4024) AAAGGATCCAGAAGCGTAGAGCGGTCAAG
LYM243_ER_XhoI (SEQ ID NO: 4025) AAACTCGAGCATTAAGCGAATTAACCATGTG
LYM245	BamHI,KpnI	LYM245_F_BamHI (SEQ ID NO: 4026) AAAGGATCCGCTAGCTACTAGCAAATTGAAGC
LYM245_F_BamHI (SEQ ID NO: 4026) AAAGGATCCGCTAGCTACTAGCAAATTGAAGC
LYM245_NR_KpnI (SEQ ID NO: 4027) AAAGGTACCGGTCACCCGTTAGACTTATGC
LYM245_ER_KpnI (SEQ ID NO: 4028) AAAGGTACCTGGTAAATTATGGGTATTCAGC
LYM248	BamHI,EcoRV	LYM248_F_BamHI (SEQ ID NO: 4029) AAAGGATCCACCACCGCTCGTCTCCAC
LYM248_NR_EcoRV (SEQ ID NO: 4030) AAAGATATCACAAGAGAGATGGTGTGTCAGC
LYM249		LYM249_EF_BamHI (SEQ ID NO: 4031) AAAGGATCCGGGTGTCATCAAACGGACTAC
LYM249_ER_KpnI (SEQ ID NO: 4032) AAAGGTACCCTAAACGAGGTTACGGAATGTGTC
LYM250	SalI,XbaI	LYM250_EF_SalI (SEQ ID NO: 4033) AAAGTCGACGGAATTGGTGAGGTGATGC
LYM250_ER_XbaI (SEQ ID NO: 4034) AAATCTAGACAGATAAACCTCAATCAAAGTCG
LYM251		LYM251_NF_SalI (SEQ ID NO: 4035) AAAGTCGACCTGTCCTCTACTACGCATCTCTC

167

2018271407 30 Nov 2018

Gene Name	Restriction Enzymes used for cloning	Primers used for amplification
		LYM251_NR_XbaI (SEQ ID NO: 4036) AAATCTAGATAATCATCATTGTAGCAGGCAC
LYM252	BamHI,KpnI	LYM252_NF_BamHI (SEQ ID NO: 4037) AAAGGATCCTAGGAAGGATGGTACTGGCTG
LYM252_EF_BamHI (SEQ ID NO: 4038) AAAGGATCCGCGATAGGAAGGATGGTACTG
LYM252_NR_KpnI (SEQ ID NO: 4039) AAAGGTACCAGGCAAACACAATGATTTCAAC
LYM252_ER_KpnI (SEQ ID NO: 4040) AAAGGTACCTGTAACATAAGTACCGGGCAG
LYM254		LYM254_EF_SalI (SEQ ID NO: 4041) AAAGTCGACAATCTCCCACGCTCCAAAG
LYM254_ER_XbaI (SEQ ID NO: 4042) AAATCTAGAAGTTACATTCTTGACCAGCAGC
LYM255	BamHI,XhoI	LYM255_NF_BamHI (SEQ ID NO: 4043) AAAGGATCCCTTCTAGTAGCACAGTAGTAGCAGC
LYM255_NR_XhoI (SEQ ID NO: 4044) AAACTCGAGAACGAGGAAGAATCGGTATATG
LYM256	BamHI,XhoI	LYM256_NF_BamHI (SEQ ID NO: 4045) AAAGGATCCGGAACAACTCGTAGCCATGAC
LYM256_EF_BamHI (SEQ ID NO: 4046) TATGGATCCCAATTTGAGAGCATTTGCTACG
LYM256_NR_XhoI (SEQ ID NO: 4047) TAACTCGAGCTGAACTTAATAGCAATTCCGTAGC
LYM256_ER_XhoI (SEQ ID NO: 4048) AAACTCGAGCGCACTACTGTGCTTCTGAAC
LYM26	SalI,XbaI	LYM26_EF_SalI (SEQ ID NO: 4049) AAAGTCGACTTGCTCCCTCTCTCTCTCTTG
LYM26_ER_XbaI (SEQ ID NO: 4050) AAATCTAGATGTATTCACGAGGTAAACAACG
LYM260		LYM260_NF_BamHI (SEQ ID NO: 4051) AAAGGATCCGAGAGATTAATTAAGTGGCAGG
LYM260_EF_BamHI (SEQ ID NO: 4052) AAAGGATCCAGAAGAGAGATTAATTAAGTGGCAG
LYM260_NR_KpnI (SEQ ID NO: 4053) AAAGGTACCCTAATATCGATCCAAACTCACACAAG
LYM260_ER_KpnI (SEQ ID NO: 3965) AAAGGTACCTACGTGCGTATCATACATGGAG
LYM261		LYM261_EF_SmaI (SEQ ID NO: 4054) AATCCCGGGTCGAGAGGTTTCATTCAGTGC
LYM261_ER_KpnI (SEQ ID NO: 4055) TTTGGTACCTTATTACATTTGGATGGGCTGT
LYM267	SalI,EcoRV	LYM267_F_SalI (SEQ ID NO: 4056) AAAGTCGACGAGCACAGGTAGGGTTTCG
LYM267_ER_EcoRV (SEQ ID NO: 4057) AAAGATATCCACTACCGAAGACTCACACGAC
LYM268		LYM268_EF_XhoI (SEQ ID NO: 4058) AAACTCGAGAACCCTCGCGAATCTGAG
LYM268_ER_EcoRV (SEQ ID NO: 4059) AAAGATATCTAGTTCTCCATTCAGCATCTCC
LYM270	BamHI,XhoI	LYM270_NF_BamHI (SEQ ID NO: 4060) AAAGGATCCAAAGCAGTTCCAGCCTTCC

168

2018271407 30 Nov 2018

Gene Name	Restriction Enzymes used for cloning	Primers used for amplification
		LYM270_EF_BamHI (SEQ ID NO: 4061) AAAGGATCCACCAATGGCTGCCTGAGAC
LYM270_NF_BamHI (SEQ ID NO: 4060) AAAGGATCCAAAGCAGTTCCAGCCTTCC
LYM270_ER_XhoI (SEQ ID NO: 4062) AAACTCGAGGATTGGATATGCCACTTGATTG
LYM271	BamHI,XhoI	LYM271_EF_BamHI (SEQ ID NO: 4063) AAAGGATCCCACCTTCTTCCCAGATCAATAG
LYM271_ER_XhoI (SEQ ID NO: 4064) AAACTCGAGGAAACAAAGCACAGTCAGTAGTAG
LYM273_S	BamHI,XhoI	LYM273_EF_BamHI (SEQ ID NO: 4065) AAAGGATCCTACTAACAAACAGATAATCTCCACG
LYM273_R2_XhoI (SEQ ID NO: 4066) ATACTCGAGAACATGTTGGAGATCTTTGATGC
LYM274	BamHI,XhoI	LYM274_EF_BamHI (SEQ ID NO: 4067) AAAGGATCCGAGAAGCTCCACTCTTCTCCAC
LYM274_ER_XhoI (SEQ ID NO: 4068) AAACTCGAGTATAATGCACAGTTATGGGCAG
LYM277		LYM277_NF_SalI (SEQ ID NO: 4069) AAAGTCGACTCAACGCCCAAGCTAGATTAC
LYM277_NR_SacI (SEQ ID NO: 4070) AAAGAGCTCCTCAACATTGCAACAACTATGG
LYM278	Sall,Sad	LYM278_EF_SalI (SEQ ID NO: 4071) AAAGTCGACGCAGCCACACAACACTATCTC
LYM278_ER_SacI (SEQ ID NO: 4072) AAAGAGCTCTTGACGATACATAGCACATAAGG
LYM283		LYM283_NF_SmaI (SEQ ID NO: 4073) TTTCCCGGGTGCCACTTGTGCGAGGAG
LYM283_R_KpnI (SEQ ID NO: 4074) AACGGTACCTCACCAATCAAAATGTACAATCATGT
LYM284	BamHI,KpnI	LYM284_EF_BamHI (SEQ ID NO: 4075) AAAGGATCCGAGCAACCACCCGTAGTCAG
LYM284_ER_KpnI (SEQ ID NO: 4076) AAAGGTACCACAGCTCAAGTGCTCATTTCTC
LYM285	XhoI,EcoRV	LYM285_NF_XhoI (SEQ ID NO: 4077) AAACTCGAGCCGCCATCTACTCGGAGC
LYM285_EF_XhoI (SEQ ID NO: 4078) AAACTCGAGCCTCCTCCGCCATCTACTC
LYM285_NR_EcoRV (SEQ ID NO: 4079) AAAGATATCAGAATTCACACTGTCCCAACAC
LYM285_ER_EcoRV (SEQ ID NO: 4080) AAAGATATCCAGTTATTATAGGCCTCGTTCC
LYM287	XhoI,EcoRV	LYM287_EF_XhoI (SEQ ID NO: 4081) AAACTCGAGTGATTGCGTTTCCTTAAATATG
LYM287_ER_EcoRV (SEQ ID NO: 4082) AAAGATATCCAATCAATCCTACAAACACAGC
LYM288	Xhol,Sad	LYM288_EF_XhoI (SEQ ID NO: 4083) AAACTCGAGTGTTAGGAAGTGAGGACTGAGC
LYM288_ER_SacI (SEQ ID NO: 4084) AAAGAGCTCGCTCAATTATTCACCATTTCATC
LYM289	SalI,XbaI	LYM289_EF_SalI (SEQ ID NO: 4085) AAAGTCGACGCACAACCCTTGGAGACTTC

169

2018271407 30 Nov 2018

Gene Name	Restriction Enzymes used for cloning	Primers used for amplification
		LYM289_ER_XbaI (SEQ ID NO: 4086) AAATCTAGATCCTCTCATCGAGCTAAGACAC
LYM290	BamHI,KpnI	LYM290_EF_BamHI (SEQ ID NO: 4087) AAAGGATCCATCCGGATCTCCACATTCC
LYM290_ER_KpnI (SEQ ID NO: 4088) AAAGGTACCGAAACAATCTCATGGTCTCTGC
LYM291	SalI,BamHI	LYM291_EF_SalI (SEQ ID NO: 4089) AAAGTCGACACTGAGCTCTCTGCTAAGTTGG
LYM291_ER_BamHI (SEQ ID NO: 4090) AAAGGATCCTCCTAGCAACAGAAGATCCAAG
LYM293	XhoI,SacI	LYM293_NF_XhoI (SEQ ID NO: 4091) AAACTCGAGAGCTTCCTCCCTAGCTGTCC
LYM293_EF_XhoI (SEQ ID NO: 4092) AAACTCGAGGTGTAGCTTCCTCCCTAGCTG
LYM293_NR_SacI (SEQ ID NO: 4093) AAAGAGCTCCTATTCCAGGAGAAGAACAATAAGAG
LYM293_ER_SacI (SEQ ID NO: 4094) AAAGAGCTCCTATTCATGTTCCAGGAGAAGAAC
LYM3	XhoI,KpnI	LYM3_EF_XhoI (SEQ ID NO: 4095) AATCTCGAGATTTATCTGCTTCAATGGCAAC
LYM3_ER_KpnI (SEQ ID NO: 4096) ATAGGTACCCTAAGCATCATTCTGCCTACC
LYM30	SalI,XhoI	LYM30_NF_SalI (SEQ ID NO: 4097) AAAGTCGACCCTCCATCCTTCAGTAATTGG
LYM30_NR_XhoI (SEQ ID NO: 4098) TTTCTCGAGTCAGTCTCCTTGGATGTTTGAGTTG
LYM31	SalI,XhoI	LYM31_NF_SalI (SEQ ID NO: 4099) AAGGTCGACACTCCCAACGTCTACTCTTCC
LYM3 l EF Sall (SEQ ID NO: 4100) AATGTCGACCTCACCACTCCCAACGTCTAC
LYM3 INRXhoI (SEQ ID NO: 4101) AAACTCGAGATGTAAGAATGAAATCTTGTAGCTC
LYM3 lERXhoI (SEQ ID NO: 4102) AATCTCGAGTGCAAGGATGTAAGAATGAAATC
LYM34	BamHI,KpnI	LYM34_NF_BamHI (SEQ ID NO: 4103) AAAGGATCCGAGATAATTAGCTCACTCCATGG
LYM34_NR_KpnI (SEQ ID NO: 4104) TATGGTACCGAATTGGGCCTATGAGACG
LYM35	SalI,XbaI	LYM35_NF_SalI (SEQ ID NO: 4105) AAAGTCGACAACACCTCTCTGGCTCTCTCC
LYM35_NR_SacI (SEQ ID NO: 4106) AAAGAGCTCTCCTAAGACTTTCTCAGCCATC
LYM37	SalI,XbaI	LYM37_NF_SalI (SEQ ID NO: 4203) AAAGTCGACAAAGTTAGCGACCAAGAAACC
LYM37_NR_XbaI (SEQ ID NO: 4204) AAATCTAGACATTTCTTTTGGATGGATGAAC
LYM4	EcoRV,KpnI	LYM4_NF_EcoRV (SEQ ID NO: 4107) AAAGATATCACCTCGAAACCCTAGATCG
LYM4_EF_EcoRV (SEQ ID NO: 4108) AAAGATATCATTCCTCGACCAGCTCACG
LYM4_NR_Kpn (SEQ ID NO: 4109) TTAGGTACCACTCAAAGGAGAGCTTCAGCC

170

2018271407 30 Nov 2018

Gene Name	Restriction Enzymes used for cloning	Primers used for amplification
		LYM4 ER Kpnl (SEQ ID NO: 4110) TAAGGTACCGTTGGCATTCTTCAAACCAG
LYM40		LYM40_NF_SalI (SEQ ID NO: 4111) AAAGTCGACCTCGAGAGCTCAATGATTCG
LYM40_NR_XbaI (SEQ ID NO: 4112) AAATCTAGAACCAACCAATTAAAGGCTAATG
LYM41	SalI,XbaI	LYM41_NF_SalI (SEQ ID NO: 4113) AAAGTCGACGATTGGTTGCTTGGGTTTG
LYM41_NR_XbaI (SEQ ID NO: 4114) AAATCTAGATGCTTTCTTTCAGAACATCTCC
LYM42	SalI,XbaI	LYM42_NF_SalI (SEQ ID NO: 4115) AAAGTCGACAACCTCTCCTCCTCGTCACAC
LYM42_EF_SalI (SEQ ID NO: 4116) AAAGTCGACATCAAACCTCTCCTCCTCGTC
LYM42_NR_XbaI (SEQ ID NO: 4117) AATTCTAGATCACAGGAAGGAGGGGTAGTAACAG
LYM42_ER_XbaI (SEQ ID NO: 4118) AAATCTAGAATTTCCTGCTGTTCATTCAAAG
LYM43	SalI,XbaI	LYM43_NF_SalI (SEQ ID NO: 4119) AAAGTCGACTCAGTGTTCTTCCATTCTTTCC
LYM43_NR_XbaI (SEQ ID NO: 4120) AAATCTAGATTGAATTAGCAGCAGCAAGAG
LYM44	SalI,XbaI	LYM44_NF_SalI (SEQ ID NO: 4121) AAAGTCGACCGAACTAACTAACCATCTCATCC
LYM44_NR_XbaI (SEQ ID NO: 4122) AAATCTAGAATCGTTCGATTATTATTGCTCC
LYM5	EcoRV,PstI	LYM5_EF_EcoRV (SEQ ID NO: 4123) AAAGATATCTCCTCTTCTCAAACTCCATCTC
LYM5_ER_PstI (SEQ ID NO: 4124) AATCTGCAGGGTCCTGTCATGCTGTGTAGTC
LYM51	SalI,XbaI	LYM5 l EF Sall (SEQ ID NO: 4125) AAAGTCGACAATTCACCTCCCAAGCAGAG
LYM51_ER_XbaI (SEQ ID NO: 4126) AAATCTAGAATACAAGGCCTGCACTACCTAC
LYM52	EcoRV,XhoI	LYM52_F_XhoI (SEQ ID NO: 4127) AAACTCGAGAAACCCGATAAGAAAATGGC
LYM52_ER_EcoRV (SEQ ID NO: 4128) TTTGATATCCTAGTGCCATACGTGCCTAACCT
LYM53	SalI,XbaI	LYM53_NF_SalI (SEQ ID NO: 4129) AAAGTCGACATCCTCTCTTTCCACTCCTAGC
LYM53_NR_XbaI (SEQ ID NO: 4130) AAATCTAGATAGCACTCAGCTTAATTGGATG
LYM56	SalI,XbaI	LYM56_F_SalI (SEQ ID NO: 4131) AAAGTCGACCTCGCTTGCCCACTCCTT
LYM56_F_SalI (SEQ ID NO: 4131) AAAGTCGACCTCGCTTGCCCACTCCTT
LYM56_NR_XbaI (SEQ ID NO: 4132) AAATCTAGACTAGCATGATCCTGGATGTTTACTC
LYM56_ER_XbaI (SEQ ID NO: 4133) AAATCTAGAAGCAGAGATAGGCATAAGTCCA
LYM57	EcoRV,XhoI	LYM57_NF_EcoRV (SEQ ID NO: 4134) AAAGATATCACCACTAGGACTCAACGAGAAG

171

2018271407 30 Nov 2018

Gene Name	Restriction Enzymes used for cloning	Primers used for amplification
		LYM57_NR_XhoI (SEQ ID NO: 4135) AACCTCGAGAGTAACATCCGAACGTATACACC
LYM6	SmaI,KpnI	LYM6_NF_X/SmaI (SEQ ID NO: 4136) ATACCCGGGAACCACGCGAAGACATGG
LYM6_NR_KpnI (SEQ ID NO: 4137) TATGGTACCGGATCAGGTTATACTTCTTATTGAC
LYM61	BamHI,XhoI	LYM61_NF_BamHI (SEQ ID NO: 4138) AAAGGATCCAAGCCTGTTCTCTGTCGATTG
LYM61_NR_XhoI (SEQ ID NO: 4139) AAACTCGAGAATGCATGTCCTAGTCTTTACG
LYM62	BamHI,KpnI	LYM62_NF_BamHI (SEQ ID NO: 4140) TTAGGATCCAACATTTACGCGATCCATTG
LYM62_EF_BamHI (SEQ ID NO: 4141) TTAGGATCCATCATCTGCTTTGTCTACCTCG
LYM62_NR_KpnI (SEQ ID NO: 4142) ATCGGTACCTCAACTGAATTCGCTGAAACTTGTC
LYM62_ER_KpnI (SEQ ID NO: 4143) AAAGGTACCGAAAACAAATGGAAGCAATCTG
LYM66	EcoRV,XhoI	LYM66_NF_EcoRV (SEQ ID NO: 4144) AAAGATATCGAGACGCAAGAAACATAGCTC
LYM66_NR_XhoI (SEQ ID NO: 4145) AAACTCGAGCAATCACTGCTACAAATCCGT
LYM67	SalI,XbaI	LYM67_NF_SalI (SEQ ID NO: 4146) TATGTCGACTCTTCTTCACTGAGGCAAGTTC
LYM67_NR_XbaI (SEQ ID NO: 4147) AAGTCTAGATCAAAGATCCATAACATTCCATGC
LYM68	SalI,XhoI	LYM68_NF_SalI (SEQ ID NO: 4148) ATTGTCGACTTGAGATAAAGGCAAAATTACG
LYM68_EF_SalI (SEQ ID NO: 4149) TTTGTCGACGTCTCGTTTCAGATTCTTCTGC
LYM68_NR_XhoI (SEQ ID NO: 4150) TTCCTCGAGTCTCTAGAGTTGCATTCCTTCC
LYM68_ER_XhoI (SEQ ID NO: 4151) TGACTCGAGCATCGTTTACACTGAACCACTG
LYM69	SalI,XbaI	LYM69_NF_SalI (SEQ ID NO: 4152) AAAGTCGACACCCAGGAACACATCATCATC
LYM69_NR_XbaI (SEQ ID NO: 4153) AAATCTAGAAGGACACGTCAAATGAGAAAAC
LYM7	SalI,XbaI	LYM7_NF_SalI (SEQ ID NO: 4154) AAAGTCGACAGTCAGATCCATTCCTCCTCC
LYM7_NR_XbaI (SEQ ID NO: 4155) AATTCTAGAAAAAGTAGCAGCCGGTCATC
LYM73		LYM73_EF_SalI (SEQ ID NO: 4156) AACGTCGACAATCTTGACACCATCTCGCTC
LYM73_ER_StuI (SEQ ID NO: 4157) TTTAGGCCTCTCGCACATTATTTTGTACAGC
LYM79	SalI,XbaI	LYM79_F_SalI (SEQ ID NO: 4158) AAAGTCGACGCGACAGAGAATCCATGGC
LYM79_F_SalI (SEQ ID NO: 4158) AAAGTCGACGCGACAGAGAATCCATGGC
LYM79_NR_XbaI (SEQ ID NO: 4159) AATTCTAGATCAAACTCCTCTTATATGCACCTGC

172

2018271407 30 Nov 2018

Gene Name	Restriction Enzymes used for cloning	Primers used for amplification
		LYM79_ER_XbaI (SEQ ID NO: 4160) AAATCTAGATCAGAAACTAACTCCTCTTATATGCAC C
LYM8	XhoI,KpnI	LYM8 NF Xhol (SEQ ID NO: 4161) ATACTCGAGCTTCCCCGATAGAAATCCATC
LYM8 NR Kpnl (SEQ ID NO: 4162) TAGGGTACCACCAAACAGCACATATGCGG
LYM82	SalI,XbaI	LYM82_EF_SalI (SEQ ID NO: 4163) AAAGTCGACCGCAACCGGAGAGAAATC
LYM82_ER_XbaI (SEQ ID NO: 4164) AAATCTAGATCGACAATCTTCATACACAACG
LYM83		LYM83_NF_BamHI (SEQ ID NO: 4165) AAAGGATCCCGACAGTCACCACTCACCAAC
LYM83_F2_BamHI (SEQ ID NO: 4166) AAAGGATCCTCCGCACGCAACTCAGTG
LYM83_R2_XhoI (SEQ ID NO: 4167) AAACTCGAGCAACGGTAACACACAAGCATTC
LYM83_R2_XhoI (SEQ ID NO: 4167) AAACTCGAGCAACGGTAACACACAAGCATTC
LYM84	BamHI,XhoI	LYM84_NF_BamHI (SEQ ID NO: 4168) AAAGGATCCACCCAGAACCCGAAGAATG
LYM84_F2_BamHI (SEQ ID NO: 4169) AATGGATCCTAAACCCAGAACCCGAAGAATG
LYM84_R2_XhoI (SEQ ID NO: 4170) AAACTCGAGCAAACTGGAGCATAGCAACTAGG
LYM84_R2_XhoI (SEQ ID NO: 4170) AAACTCGAGCAAACTGGAGCATAGCAACTAGG
LYM86	BamHI,XhoI	LYM86_EF_BamHI (SEQ ID NO: 4171) AAAGGATCCCACACACCACAGTCGCAATC
LYM86_ER_XhoI (SEQ ID NO: 4172) AAACTCGAGAGAATCGATGCAGGTAACTACG
LYM88	BamHI,XhoI	LYM88_F_BamHI (SEQ ID NO: 4173) AAAGGATCCACAATAAACAAGATAAATGGAGG
LYM88_F_BamHI (SEQ ID NO: 4173) AAAGGATCCACAATAAACAAGATAAATGGAGG
LYM88_NR_XhoI (SEQ ID NO: 4174) AAACTCGAGTCACACGCAACTTCAGGTTC
LYM88_ER_XhoI (SEQ ID NO: 4175) AAACTCGAGCAAACCGAATTATTACATCAGG
LYM89	Sall,Sad	LYM89_NF_SalI (SEQ ID NO: 4176) AAAGTCGACGGCCGACACATCTGATCTAAC
LYM89_NR_Sad (SEQ ID NO: 4177) AAAGAGCTCTCCCAGAAATATATAAGAACAAGC
LYM9	SalI,XbaI	LYM9_NF_SalI (SEQ ID NO: 4178) AAAGTCGACAACTCCCCAACCAAGCAG
LYM9_NR_XbaI (SEQ ID NO: 4179) AAATCTAGATTAGTACTAAGAGTCGGCTTTGGC
LYM90	SalI,XbaI	LYM90_NF_SalI (SEQ ID NO: 4180) AAAGTCGACCTAAACCCTAACCCTAGATTGG
LYM90_NR_XbaI (SEQ ID NO: 4181) AAATCTAGAAGACTTGGCTAATGCTAACCTG
LYM91	SalI,XbaI	LYM91_F2_SalI (SEQ ID NO: 4182) TAAGTCGACCGTCTCTCAAGCTCGCAGC

173

2018271407 30 Nov 2018

Gene Name	Restriction Enzymes used for cloning	Primers used for amplification
		LYM91_F2_SalI (SEQ ID NO: 4182) TAAGTCGACCGTCTCTCAAGCTCGCAGC
LYM91_R2_XbaI (SEQ ID NO: 4183) ATTTCTAGACGAGAGCCTCTAATGGATCACAG
LYM91_R2_XbaI (SEQ ID NO: 4183) ATTTCTAGACGAGAGCCTCTAATGGATCACAG
LYM93		LYM93_EF_SalI (SEQ ID NO: 4184) AAAGTCGACATTGCACTGCATAGGGCTG
LYM93_ER_XbaI (SEQ ID NO: 4185) AAATCTAGACTAAGAGTTGAGCATGATAAATACGA C
LYM95	SalI,XbaI	LYM95_NF_SalI (SEQ ID NO: 4186) ATAGTCGACGAGAAAGTGGAAGAGAACATGG
LYM95_EF_SalI (SEQ ID NO: 4187) AAAGTCGACCCGCTGGAGAAAGTGGAAG
LYM95_NR_XbaI (SEQ ID NO: 4188) AAATCTAGAGTCCACAGATCCATGTCAAATC
LYM95_ER_XbaI (SEQ ID NO: 4189) AAATCTAGAGTGAATTTGATTTATTGCCAAC
LYM99	BamHI,KpnI	LYM99_NF_BamHI (SEQ ID NO: 4190) AAAGGATCCCCGACCACGGATTGATTC
LYM99_EF_BamHI (SEQ ID NO: 4191) AAAGGATCCTTGACTTGGGTGTCTGGTCC
LYM99_NR_KpnI (SEQ ID NO: 4192) AAAGGTACCGTGCCTATGTCTTCCTAGCATC
LYM99_ER_KpnI (SEQ ID NO: 4193) AAAGGTACCATATTTAGGCGCCAGTAAAGAC

Table 26. Provided are the PCR primers used for cloning the genes of some embodiments of the invention. Fwd = forward primer; Rev = reverse primer; Nested = nested primer for PCR (internal primer); External = external primer for PCR.

To facilitate cloning of the cDNAs/ genomic sequences, a 8-12 bp extension was added to the 5' of each primer. The primer extension includes an endonuclease restriction site. The restriction sites were selected using two parameters: (a). The site did not exist in the cDNA sequence; and (b). The restriction sites in the forward and reverse primers were designed such that the digested cDNA is inserted in the sense 10 formation into the binary vector utilized for transformation.

Each digested PCR product was inserted into a high copy vector pBlue-script KS plasmid vector [pBlue-script KS plasmid vector, Hypertext Transfer Protocol://World Wide Web (dot) stratagene (dot) com/manuals/212205 (dot) pdf] or into plasmids originating from this vector. In cases where the pGXN/ pGXNa high copy 15 vector (originated from pBlue-script KS) was used, the PCR product was inserted upstream to the NOS terminator (SEQ ID NO: 4194) originated from pBI 101.3 binary vector (GenBank Accession No. U12640, nucleotides 4356 to 4693) and downstream to

2018271407 30 Nov 2018

174 the 35S promoter. The digested products and the linearized plasmid vector were ligated using T4 DNA ligase enzyme (Roche, Switzerland). In some cases PCR products were cloned without digestion into pCR-Blunt II-TOPO vector (Invitrogen).

Sequencing of the amplified PCR products was performed, using ABI 377 sequencer (Amersham Biosciences Inc). In all cases, after confirmation of the sequence of the cloned genes, the cloned cDNA accompanied or not with the NOS terminator was introduced into the modified pGI binary vector containing the 6669 promoter [pQFN or pQYN_6669] according to Table 27, via digestion with appropriate restriction endonucleases. In any case the insert was followed by single copy of the NOS terminator (SEQ ID NO:4194).

High copy plasmids containing the cloned genes were digested with restriction endonucleases (New England BioLabs Inc) and cloned into binary vectors according to Table 27, below.

Binary vectors used for cloning:

Evolution of binary vectors construction: The plasmid pPI was constructed by inserting a synthetic poly-(A) signal sequence, originating from pGL3 basic plasmid vector (Promega, Acc No U47295; bp 4658-4811) into the Hindlll restriction site of the binary vector pBI101.3 (Clontech, Acc. No. U12640). pGI (pBXYN) is similar to pPI, but the original gene in the backbone, the GUS gene, was replaced by the GUS-Intron gene followed by the NOS terminator (SEQ ID NO:4194) (Vancanneyt. G, et al MGG 220, 245-50, 1990). The modified pGI vector (pQXYN) is a modified version of the pGI vector in which the cassette is inverted between the left and right borders so the gene and its corresponding promoter are close to the right border and the NPTII gene is close to the left border.

Vectors used for cloning the polynucleotides of some embodiments of the invention: Cloned genes were digested from the high copy vectors and cloned into one of the following binary vectors: pQFN or pQYN_6669.

pQFN (see Figure 2) and pQYN_6669 (see Figure 1) are modified pGI vectors in which the 35S promoter was replaced by the new At6669 promoter (SEQ ID NO:4198). pQYN_6669 contains the GUSintron sequence, while pQFN lacks the GUSintron sequence

2018271407 30 Nov 2018

175

Table 27

Restriction enzyme sites used to clone identified genes according to some embodiments of the invention into binary vectors

Gene name	Binary vector	Restriction enzymes used for cloning into binary vectorFORWARD	Restriction enzymes used for cloning into binary vectorREVERSE	Restriction enzymes used for digesting the binary vector
LYM1	pQFN	Sall	EcoRI	Sall, EcoRI
LYM10	pQFN	Xhol	Kpnl	Xhol, Kpnl
LYM100	pQYN 6669	Sall	EcoRI	Sall, EcoRI
LYM102	pQFN	BamHI	Xhol	BamHI, Xhol
LYM103	pQFN	BamHI	Xhol	BamHI, Xhol
LYM105	pQFN	BamHI	Xhol	BamHI, Xhol
LYM106	pQYN 6669	Sall	EcoRI	Sall, EcoRI
LYM107	pQFN	BamHI	Xhol	BamHI, Xhol
LYM109	pQFN	Xhol	Stul	Xhol, Stul
LYM110	pQFN	BamHI	Xhol	BamHI, Xhol
LYM111	pQFN	Xhol	EcoRI	Xhol, EcoRI
LYM112	pQFN	BamHI	Xhol	BamHI, Xhol
LYM113	pQYN 6669	Sall	EcoRI	Sall, EcoRI
LYM115	pQFN	BamHI	Xhol	BamHI, Xhol
LYM116	pQYN 6669	Sall	EcoRI	Sall, EcoRI
LYM117	pQFN	BamHI	EcoRV	BamHI, Stul
LYM118	pQFN	BamHI	Xhol	BamHI, Xhol
LYM119	pQYN 6669	Sall	EcoRI	Sall, EcoRI
LYM12	pQFN	Xhol	Kpnl	Xhol, Kpnl
LYM120	pQFN	BamHI	Xhol	BamHI, Xhol
LYM121	pQFN	BamHI	Xhol	BamHI, Xhol
LYM122_ G	pQFN	BamHI	Xhol	BamHI, Xhol
LYM122 S	pQFN	BamHI	Xhol	BamHI, Xhol
LYM123	pQFN	BamHI	Xhol	BamHI, Xhol
LYM125	pQFN	BamHI	Kpnl	BamHI, Kpnl
LYM126	pQFN	BamHI	Kpnl	BamHI, Kpnl
LYM127	pQFN	BamHI	Xhol	BamHI, Xhol
LYM128	pQFN	BamHI	Xhol	BamHI, Xhol
LYM129	pQFN	Sall	EcoRI	Sall, EcoRI
LYM13	pQFN	Sall	BamHI	Sall, BamHI
LYM130	pQYN 6669	Sall	EcoRI	Sall, EcoRI
LYM131	pQFN	Sall	Xhol	Sall, Xhol
LYM132	pQFN	BamHI	Xhol	BamHI, Xhol
LYM134	pQFN	BamHI	Xhol	BamHI, Xhol
LYM135	pQFN	Sall	Kpnl	Sall, Kpnl
LYM136	pQFN	BamHI	Kpnl	BamHI, Kpnl
LYM137	pQYN 6669	Sall	EcoRI	Sall, EcoRI
LYM138	pQFN	Sall	Ecl 13611	Sall, Stul
LYM14	pQFN	Sall	BamHI	Sall, BamHI
LYM140	pQFN	Xhol	EcoRI	Xhol, EcoRI
LYM141	pQFN	BamHI	Kpnl	BamHI, Kpnl
LYM142	pQYN 6669	Sall	EcoRI	Sall, EcoRI
LYM143	pQYN 6669	Sall	EcoRI	Sall, EcoRI
LYM144	pQFN	Sall	EcoRV	Sall, Stul
LYM145	pQFN	BamHI	Xhol	BamHI, Xhol

176

2018271407 30 Nov 2018

Gene name	Binary vector	Restriction enzymes used for cloning into binary vectorFORWARD	Restriction enzymes used for cloning into binary vectorREVERSE	Restriction enzymes used for digesting the binary vector
LYM146	pQFN	Kpnl	Kpnl	Kpnl, Kpnl
LYM147	pQFN	Sall	EcoRI	Sall, EcoRI
LYM148	pQFN	BamHI	Xbal	BamHI, Xhol
LYM149	pQYN 6669	Sall	EcoRI	Sall, EcoRI
LYM15	pQFN	Sall	EcoRI	Sall, EcoRI
LYM152	pQYN 6669	Sall	EcoRI	Sall, EcoRI
LYM153	pQYN 6669	Sall	EcoRI	Sall, EcoRI
LYM154	pQFN	Xhol	Stul	Xhol, Stul
LYM155	pQYN 6669	Sall	EcoRI	Sall, EcoRI
LYM156	pQFN	Stul	Stul	Smal, Smal
LYM157_ G	pQYN_6669	Sall	EcoRI	Sall, EcoRI
LYM157 S	pQFN	Sall	Stul	Sall, Stul
LYM159	pQYN 6669	Sall	EcoRI	Sall, EcoRI
LYM16	pQFN	Sall	EcoRI	Sall, EcoRI
LYM160	pQYN 6669	Sall	EcoRI	Sall, EcoRI
LYM161	pQFN	BamHI	Xhol	BamHI, Xhol
LYM162	pQFN	BamHI	Xhol	BamHI, Xhol
LYM164	pQYN 6669	Sall	EcoRI	Sall, EcoRI
LYM165	pQFN	Xhol	Ecl 13611	Xhol, Stul
LYM17	pQFN	Smal	Kpnl	Smal, Kpnl
LYM170	pQYN 6669	Sall	EcoRI	Sall, EcoRI
LYM172	pQFN	BamHI	Xhol	BamHI, Xhol
LYM173	pQFN	BamHI	Xhol	BamHI, Xhol
LYM174	pQFN	BamHI	Kpnl	BamHI, Kpnl
LYM175	pQYN 6669	Sall	EcoRI	Sall, EcoRI
LYM176	pQYN 6669	Sall	EcoRI	Sall, EcoRI
LYM178	pQYN 6669	Sall	EcoRI	Sall, EcoRI
LYM179	pQFN	Sall	Stul	Sall, Stul
LYM180	pQFN	BamHI	Xhol	BamHI, Xhol
LYM181	pQFN	BamHI	EcoRV	BamHI, Stul
LYM183	pQFN	Sall	Xbal	Sall, Stul
LYM184	pQFN	BamHI	Xhol	BamHI, Xhol
LYM185	pQFN	BamHI	Kpnl	BamHI, Kpnl
LYM186	pQFN	Sall	Ecl 13611	Sall, Stul
LYM188	pQFN	BamHI	Xhol	BamHI, Xhol
LYM189	pQYN 6669	Sall	EcoRI	Sall, EcoRI
LYM19	pQYN 6669	Sall	EcoRI	Sall, EcoRI
LYM192	pQFN	Xhol	EcoRV	Xhol, Stul
LYM193	pQFN	BamHI	Xhol	BamHI, Xhol
LYM194	pQFN	Sall	Xhol	Sall, Sall
LYM196	pQFN	BamHI	Xhol	BamHI, Xhol
LYM197	pQFN	BamHI	Xhol	BamHI, Xhol
LYM198	pQFN	BamHI	Xhol	BamHI, Xhol
LYM2	pQFN	EcoRV	Kpnl	Smal, Kpnl
LYM20	pQFN	EcoRV	Kpnl	Smal, Kpnl
LYM200	pQFN	BamHI	Xhol	BamHI, Xhol
LYM201	pQFN	BamHI	Xhol	BamHI, Xhol
LYM203	pQFN	BamHI	Xhol	BamHI, Xhol
LYM204	pQFN	BamHI	Xhol	BamHI, Xhol
LYM206	pQFN	Xhol	EcoRV	Xhol, Stul

177

2018271407 30 Nov 2018

Gene name	Binary vector	Restriction enzymes used for cloning into binary vectorFORWARD	Restriction enzymes used for cloning into binary vectorREVERSE	Restriction enzymes used for digesting the binary vector
LYM207	pQFN	BamHI	Kpnl	BamHI, Kpnl
LYM208	pQFN	BamHI	Kpnl	BamHI, Kpnl
LYM21	pQFN	EcoRV	Kpnl	Smal, Kpnl
LYM212	pQYN 6669	Sall	EcoRI	Sall, EcoRI
LYM213	pQFN	BamHI	Xhol	BamHI, Xhol
LYM215	pQFN	BamHI	Xhol	BamHI, Xhol
LYM217	pQYN 6669	Sall	EcoRI	Sall, EcoRI
LYM219	pQFN	BamHI	Kpnl	BamHI, Kpnl
LYM22	pQYN 6669	Sall	EcoRI	Sall, EcoRI
LYM220	pQFN	BamHI	EcoRV	BamHI, Stul
LYM221	pQFN	BamHI	Xhol	BamHI, Xhol
LYM223	pQFN	Xhol	EcoRI	Xhol, EcoRI
LYM224	pQFN	BamHI	Xhol	BamHI, Xhol
LYM227	pQFN	BamHI	Kpnl	BamHI, Kpnl
LYM228	pQFN	Stul	Kpnl	Kpnl, EcoRV
LYM23	pQFN	BamHI	Kpnl	BamHI, Kpnl
LYM232	pQFN	BamHI	Xhol	BamHI, Xhol
LYM233	pQFN	BamHI	Xhol	BamHI, Xhol
LYM234	pQFN	BamHI	Xhol	BamHI, Xhol
LYM236	pQFN	Sall	EcoRI	Sall, EcoRI
LYM238	pQFN	Smal	Kpnl	Smal, Kpnl
LYM239	pQFN	BamHI	Xhol	BamHI, Xhol
LYM24	pQFN	Sall	EcoRI	Sall, EcoRI
LYM240	pQFN	BamHI	Kpnl	BamHI, Kpnl
LYM241	pQFN	BamHI	Xhol	BamHI, Xhol
LYM242	pQFN	BamHI	Xhol	BamHI, Xhol
LYM243	pQFN	BamHI	Xhol	BamHI, Xhol
LYM245	pQFN	BamHI	Kpnl	BamHI, Kpnl
LYM248	pQFN	BamHI	EcoRV	BamHI, Stul
LYM249	pQFN	BamHI	Kpnl	BamHI, Kpnl
LYM250	pQFN	Sall	Xbal	Sall, Stul
LYM251	pQFN	Sall	Ecl 13611	Sall, Stul
LYM252	pQFN	BamHI	Kpnl	BamHI, Kpnl
LYM254	pQFN	Sall	BamHI	Sall, BamHI
LYM255	pQFN	BamHI	Xhol	BamHI, Xhol
LYM256	pQFN	BamHI	Xhol	BamHI, Xhol
LYM26	pQYN 6669	Sall	EcoRI	Sall, EcoRI
LYM260	pQFN	BamHI	Kpnl	BamHI, Kpnl
LYM261	pQFN	Smal	Kpnl	Smal, Kpnl
LYM267	pQFN	Sall	EcoRV	Sall, Stul
LYM268	pQFN	Xhol	EcoRV	Xhol, Stul
LYM270	pQFN	BamHI	Xhol	BamHI, Xhol
LYM271	pQFN	BamHI	Xhol	BamHI, Xhol
LYM273_ G	pQFN	BamHI	Xhol	BamHI, Xhol
LYM273 S	pQFN	BamHI	Xhol	BamHI, Xhol
LYM274	pQFN	BamHI	Xhol	BamHI, Xhol
LYM277	pQFN	Sall	Ecl 13611	Sall, Stul
LYM278	pQYN 6669	Sall	EcoRI	Sall, EcoRI
LYM283	pQFN	Smal	Kpnl	Smal, Kpnl
LYM284	pQFN	BamHI	Kpnl	BamHI, Kpnl

178

2018271407 30 Nov 2018

Gene name	Binary vector	Restriction enzymes used for cloning into binary vectorFORWARD	Restriction enzymes used for cloning into binary vectorREVERSE	Restriction enzymes used for digesting the binary vector
LYM285	pQFN	Xhol	EcoRV	Xhol, Stul
LYM287	pQFN	Xhol	EcoRV	Xhol, Stul
LYM288	pQFN	Xhol	EcoRI	Xhol, EcoRI
LYM289	pQYN 6669	Sall	EcoRI	Sall, EcoRI
LYM290	pQFN	BamHI	Kpnl	BamHI, Kpnl
LYM291	pQFN	Sall	BamHI	Sall, BamHI
LYM293	pQFN	Xhol	EcoRI	Xhol, EcoRI
LYM3	pQFN	Xhol	Kpnl	Xhol, Kpnl
LYM30	pQFN	Sall	Xhol	Sall, Xhol
LYM31	pQFN	Sall	Xhol	Sall, Xhol
LYM32	pQFN	BamHI	Kpnl	BamHI, Kpnl
LYM34	pQFN	BamHI	Kpnl	BamHI, Kpnl
LYM35	pQYN 6669	Sall	EcoRI	Sall, EcoRI
LYM36	pQFN	Stul	Stul	Stul, Stul
LYM37	pQYN 6669	Sall	EcoRI	Sall, EcoRI
LYM38	pQFN	Sall	BamHI	Sall, BamHI
LYM4	pQFN	EcoRV	Kpnl	Smal, Kpnl
LYM40	pQFN	Sall	EcoRV	Sall, Stul
LYM41	pQYN 6669	Sall	EcoRI	Sall, EcoRI
LYM42	pQYN 6669	Sall	EcoRI	Sall, EcoRI
LYM43	pQYN 6669	Sall	EcoRI	Sall, EcoRI
LYM44	pQYN 6669	Sall	EcoRI	Sall, EcoRI
LYM5	pQFN	Sall	BamHI	Sall, BamHI
LYM51	pQYN 6669	Sall	EcoRI	Sall, EcoRI
LYM52	pQFN	Xhol	EcoRV	Xhol, Stul
LYM53	pQYN 6669	Sall	EcoRI	Sall, EcoRI
LYM56	pQYN 6669	Sall	EcoRI	Sall, EcoRI
LYM57	pQFN	EcoRV	Xhol	Smal, Xhol
LYM6	pQFN	Smal	Kpnl	Smal, Kpnl
LYM61	pQFN	BamHI	Xhol	BamHI, Xhol
LYM62	pQFN	BamHI	Kpnl	BamHI, Kpnl
LYM66	pQFN	EcoRV	Xhol	Smal, Xhol
LYM67	pQYN 6669	Sall	EcoRI	Sall, EcoRI
LYM68	pQFN	Sall	Xhol	Sall, Xhol
LYM69	pQYN 6669	Sall	EcoRI	Sall, EcoRI
LYM7	pQFN	Sall	EcoRI	Sall, EcoRI
LYM73	pQFN	Sall	Stul	Sall, Stul
LYM74	pQFN	Sall	Ecl 13611	Sall, Stul
LYM79	pQYN 6669	Sall	EcoRI	Sall, EcoRI
LYM8	pQFN	Xhol	Kpnl	Xhol, Kpnl
LYM82	pQYN 6669	Sall	EcoRI	Sall, EcoRI
LYM83	pQFN	BamHI	Xhol	BamHI, Xhol
LYM84	pQFN	BamHI	Xhol	BamHI, Xhol
LYM86	pQFN	BamHI	Xhol	BamHI, Xhol
LYM88	pQFN	BamHI	Xhol	BamHI, Xhol
LYM89	pQYN 6669	Sall	EcoRI	Sall, EcoRI
LYM9	pQFN	Sall	EcoRI	Sall, EcoRI
LYM90	pQYN 6669	Sall	EcoRI	Sall, EcoRI
LYM91	pQYN 6669	Sall	EcoRI	Sall, EcoRI
LYM93	pQFN	Sall	Xhol	Sall, Xhol
LYM95	pQYN 6669	Sall	EcoRI	Sall, EcoRI

179

2018271407 30 Nov 2018

Gene name	Binary vector	Restriction enzymes used for cloning into binary vectorFORWARD	Restriction enzymes used for cloning into binary vectorREVERSE	Restriction enzymes used for digesting the binary vector
LYM99	pQFN	BamHI	Kpnl	BamHI, Kpnl

Table 27.

Table 28

Genes cloned from cDNA libraries or genomic DNA in a High copy number plasmid

Gene Name	High copy plasmid	Amplified from Organism Origin	Polynucleotide SEQ ID NO:	Polypeptide SEQ ID NO:
LYM1	pGXN (pKG+Nos+35S)	RICE Oryza sativa L. Japonica ND	cDNA	3481	240
LYM10	pKS(PksJ)	RICE Oryza sativa L. Japonica ND	cDNA	3490	249
LYM100	pGXN (pKG+Nos+35S)	BARLEY Hordeum vulgarc L. Manit	cDNA	3542	301
LYM102	pKS(PksJ)	RICE Oryza sativa L. Japonica ND	cDNA	3543	302
LYM103	pKS(PksJ)	MAIZE Zea mays L. Pioneer 30G54	cDNA	3544	3689
LYM105	pKS(PksJ)	BARLEY Hordeum vulgare L. Manit	cDNA	3545	3690
LYM106	pGXN (pKG+Nos+35S)	BARLEY Hordeum vulgare L. Manit	cDNA	3546	305
LYM107	pKS(PksJ)	MAIZE Zea mays L. ND	cDNA	3589	349
LYM109	pGXNa	MAIZE Zea mays L. ND	cDNA	3590	3702
LYM110	pKS(PksJ)	MAIZE Zea mays L. ND	cDNA	3547	3691
LYM111	pGXNa	MAIZE Zea mays L. Pioneer 30G54	cDNA	3548	307
LYM112	pKS(PksJ)	MAIZE Zea mays L. Pioneer 30G54	cDNA	3591	3703
LYM113	pGXN (pKG+Nos+35S)	MAIZE Zea mays L. Pioneer 30G54	cDNA	3592	352
LYM115	pKS(PksJ)	MAIZE Zea mays L. ND	cDNA	3593	3704
LYM116	pGXN (pKG+Nos+35S)	MAIZE Zea mays L. ND	cDNA	3594	354
LYM117	Topo B	MAIZE Zea mays L. ND	cDNA	3595	3705

180

2018271407 30 Nov 2018

Gene Name	High copy plasmid	Amplified from Organism Origin	Polynucleotide SEQ ID NO:	Polypeptide SEQ ID NO:
LYM118			GeneArt	3596	356
LYM119	pGXN (pKG+Nos+35S)	MAIZE Zea mays L. ND	cDNA	3549	3692
LYM12	pKS(PksJ)	RICE Oryza sativa L. Japonica ND	cDNA	3491	250
LYM120	pKS(PksJ)	RICE Oryza sativa L. Japonica ND	cDNA	3550	309
LYM121	pKS(PksJ)	RICE Oryza sativa L. Japonica ND	cDNA	3597	357
LYM122G	Topo B	RICE Oryza sativa L. Japonica ND	Genomic	3739	310
LYM122 S			GeneArt	3551	310
LYM123			GeneArt	3598	358
LYM125	Topo B	RICE Oryza sativa L. Japonica ND	cDNA	3552	311
LYM126			GeneArt	3553	312
LYM127	Topo B	RICE Oryza sativa L. Japonica ND	cDNA	3554	313
LYM128	pKS(PksJ)	RICE Oryza sativa L. Japonica ND	cDNA	3555	314
LYM129	pGXN (pKG+Nos+35S)	RICE Oryza sativa L. Indica ND+ RICE Oryza sativa L. Japonica ND	cDNA	3556	315
LYM13	pKS(PksJ)	RICE Oryza sativa L. Japonica ND	cDNA	3492	251
LYM130	pGXN (pKG+Nos+35S)	RICE Oryza sativa L. Indica ND	cDNA	3557	316
LYM131	pGXNa	RICE Oryza sativa L. Japonica ND	cDNA	3558	3693
LYM132	pKS(PksJ)	RICE Oryza sativa L. Japonica ND	cDNA	3559	318
LYM134	pKS(PksJ)	RICE Oryza sativa L. Japonica ND	cDNA	3560	319
LYM135	Topo B	RICE Oryza sativa L. Japonica ND	cDNA	3599	359
LYM136	pKS(PksJ)	RICE Oryza sativa L. Japonica ND	cDNA	3561	3694

181

2018271407 30 Nov 2018

Gene Name	High copy plasmid	Amplified from Organism Origin	Polynucleotide SEQ ID NO:	Polypeptide SEQ ID NO:
LYM137	pGXN (pKG+Nos+35S)	BARLEY Hordeum vulgare L. Manit	cDNA	3562	321
LYM138	pGXN (pKG+Nos+35S)	RICE Oryza sativa L. Japonica ND	cDNA	3600	360
LYM14	pKS(PksJ)	RICE Oryza sativa L. Japonica ND	cDNA	3493	252
LYM140	pGXNa	BARLEY Hordeum vulgare L. Manit	cDNA	3563	322
LYM141	Topo B	RICE Oryza sativa L. Japonica ND	cDNA	3564	323
LYM142	pGXN (pKG+Nos+35S)	BARLEY Hordeum vulgare L. Manit	cDNA	3565	324
LYM143	pGXN (pKG+Nos+35S)	RICE Oryza sativa L. Japonica ND	cDNA	3566	325
LYM144	pKS(PksJ)	RICE Oryza sativa L. Japonica ND	cDNA	3567	3695
LYM145	pKS(PksJ)	RICE Oryza sativa L. ND	cDNA	3568	327
LYM146	Topo B	MAIZE Zea mays L. ND	Genomic	3601	3706
LYM147	pGXN (pKG+Nos+35S)	MAIZE Zea mays L. ND	cDNA	3602	3707
LYM148	pKS(PksJ)	BARLEY Hordeum vulgare L. Manit	cDNA	3569	3696
LYM149	pGXN (pKG+Nos+35S)	BARLEY Hordeum vulgare L. Manit	cDNA	3570	329
LYM15	pGXN (pKG+Nos+35S)	RICE Oryza sativa L. Japonica ND	cDNA	3494	253
LYM152	pGXN (pKG+Nos+35S)	ARABIDOPSIS Arabidopsis thaliana Transgenic Columbia	cDNA	3571	330
LYM153	pGXN (pKG+Nos+35S)	RICE Oryza sativa L. Japonica ND	cDNA	3572	331
LYM154			GeneArt	3603	363
LYM155	pGXN (pKG+Nos+35S)	BARLEY Hordeum vulgare L. Manit	cDNA	3604	3708
LYM156	pGXNa	BARLEY Hordeum vulgare L. Manit	cDNA	3573	332

182

2018271407 30 Nov 2018

Gene Name	High copy plasmid	Amplified from Organism Origin	Polynucleotide SEQ ID NO:	Polypeptide SEQ ID NO:
LYM157_G	pGXN (pKG+Nos+35S)	BARLEY Hordeum vulgare L. Manit	cDNA	3574	333
LYM157 S			GeneArt	3574	333
LYM159	pGXN (pKG+Nos+35S)	BARLEY Hordeum vulgare L. Manit	cDNA	3575	3697
LYM16	pGXN (pKG+Nos+35S)	RICE Oryza sativa L. ND	cDNA	3495	254
LYM160	pGXN (pKG+Nos+35S)	BARLEY Hordeum vulgare L. Manit	cDNA	3576	3698
LYM161	pKS(PksJ)	BARLEY Hordeum vulgare L. Manit	cDNA	3577	3699
LYM162	pKS(PksJ)	MAIZE Zea mays L. ND	cDNA	3578	337
LYM164	pGXN (pKG+Nos+35S)	RICE Oryza sativa L. ND	cDNA	3579	3700
LYM165	Topo B	MAIZE Zea mays L. Pioneer 30G54	cDNA	3580	339
LYM17	pKS(PksJ)	RICE Oryza sativa L. ND	cDNA	3496	255
LYM170	pGXN (pKG+Nos+35S)	RICE Oryza sativa L. ND	cDNA	3581	341
LYM172	pKS(PksJ)	RICE Oryza sativa L. Indica ND	cDNA	3582	342
LYM173	pKS(PksJ)	RICE Oryza sativa L. Japonica ND	cDNA	3583	343
LYM174	pKS(PksJ)	SORGHUM Sorghum bicolor Monsanto S5	cDNA	3584	344
LYM175	pGXN (pKG+Nos+35S)	RICE Oryza sativa L. ND	cDNA	3585	345
LYM176	pGXN (pKG+Nos+35S)	RICE Oryza sativa L. Japonica ND	cDNA	3586	346
LYM178	pGXN (pKG+Nos+35S)	ARABIDOPSIS Arabidopsis thaliana ND	cDNA	3587	347
LYM179	pGXNa	MAIZE Zea mays L. Pioneer 30G54	cDNA	3588	3701
LYM180	pKS(PksJ)	BARLEY Hordeum vulgare L. Manit	cDNA	3605	365
LYM181	Topo B	BARLEY Hordeum vulgare L. Manit	cDNA	3606	366
LYM183	Topo B	BARLEY Hordeum vulgare L. Manit	cDNA	3655	3733

183

2018271407 30 Nov 2018

Gene Name	High copy plasmid	Amplified from Organism Origin	Polynucleotide SEQ ID NO:	Polypeptide SEQ ID NO:
LYM184	Topo B	BARLEY Hordeum vulgare L. Manit	cDNA	3607	3709
LYM185	pKS(PksJ)	BARLEY Hordeum vulgare L. Manit	cDNA	3608	369
LYM186	pGXN (pKG+Nos+35S)	BARLEY Hordeum vulgare L. Manit	cDNA	3609	3710
LYM188	pKS(PksJ)	BARLEY Hordeum vulgare L. Manit	cDNA	3610	371
LYM189	pGXN (pKG+Nos+35S)	BARLEY Hordeum vulgare L. Manit	cDNA	3611	3711
LYM19	pGXN (pKG+Nos+35S)	RICE Oryza sativa L. Japonica ND	cDNA	3497	256
LYM192	pKS(PksJ)	BARLEY Hordeum vulgare L. Manit	cDNA	3612	3712
LYM193	pKS(PksJ)	BARLEY Hordeum vulgare L. Manit	cDNA	3613	374
LYM194			GeneArt	3614	3713
LYM196	Topo B	MAIZE Zea mays L. ND	cDNA	3615	376
LYM197	pKS(PksJ)	MAIZE Zea mays L. ND	cDNA	3616	3714
LYM198	pKS(PksJ)	MAIZE Zea mays L. ND	cDNA	3617	378
LYM2	pKS(PksJ)	RICE Oryza sativa L. ND	cDNA	3482	241
LYM20	pKS(PksJ)	RICE Oryza sativa L. Japonica ND	cDNA	3498	257
LYM200	pKS(PksJ)	MAIZE Zea mays L. ND	cDNA	3657	419
LYM201	pKS(PksJ)	MAIZE Zea mays L. ND	cDNA	3618	379
LYM203	pKS(PksJ)	MAIZE Zea mays L. ND	cDNA	3619	380
LYM204	Topo B	MAIZE Zea mays L. Pioneer 30G54	cDNA	3620	381
LYM206	pKS(PksJ)	MAIZE Zea mays L. ND	cDNA	3621	3715
LYM207	Topo B	MAIZE Zea mays L. Pioneer 30G54	cDNA	3622	3716
LYM208	pKS(PksJ)	MAIZE Zea mays L. Pioneer 30G54	cDNA	3623	384

184

2018271407 30 Nov 2018

Gene Name	High copy plasmid	Amplified from Organism Origin	Polynucleotide SEQ ID NO:	Polypeptide SEQ ID NO:
LYM21	pKS(PksJ)	RICE Oryza sativa L. Japonica ND	cDNA	3499	258
LYM212	pGXN (pKG+Nos+35S)	MAIZE Zea mays L. ND	cDNA	3624	3717
LYM213	pKS(PksJ)	MAIZE Zea mays L. ND	cDNA	3625	386
LYM215	pKS(PksJ)	MAIZE Zea mays L. ND	cDNA	3626	3718
LYM217	pGXN	MAIZE Zea mays L. ND	cDNA	3627	3719
LYM219	pKS(PksJ)	MAIZE Zea mays L. Pioneer 30G54	cDNA	3628	3720
LYM22	pGXN (pKG+Nos+35S)	RICE Oryza sativa L. Japonica ND	cDNA	3500	259
LYM220	pKS(PksJ)	MAIZE Zea mays L. Pioneer 30G54	cDNA	3629	3721
LYM221	pKS(PksJ)	MAIZE Zea mays L. Pioneer 30G54	cDNA	3630	3722
LYM223	pGXNa	MAIZE Zea mays L. Pioneer 30G54	cDNA	3631	392
LYM224	pKS(PksJ)	MAIZE Zea mays L. Pioneer 30G54	cDNA	3632	3723
LYM227			GeneArt	3633	394
LYM228	Topo B	MAIZE Zea mays L. Pioneer 30G54	cDNA	3634	3724
LYM23	pKS(PksJ)	RICE Oryza sativa L. Japonica ND	cDNA	3501	260
LYM232	Topo B	RICE Oryza sativa L. Japonica ND	cDNA	3635	3725
LYM233			GeneArt	3636	397
LYM234			GeneArt	3637	398
LYM236	pGXN (pKG+Nos+35S)	RICE Oryza sativa L. Japonica ND	cDNA	3638	3726
LYM238	Topo B	RICE Oryza sativa L. Japonica ND	cDNA	3639	400
LYM239	pKS(PksJ)	RICE Oryza sativa L. Japonica ND	cDNA	3640	3727
LYM24	pGXN (pKG+Nos+35S)	RICE Oryza sativa L. Japonica ND	cDNA	3502	261

185

2018271407 30 Nov 2018

Gene Name	High copy plasmid	Amplified from Organism Origin	Polynucleotide SEQ ID NO:	Polypeptide SEQ ID NO:
LYM240	pKS(PksJ)	RICE Oryza sativa L. Japonica ND	cDNA	3641	402
LYM241	Topo B	RICE Oryza sativa L. Japonica ND	cDNA	3642	3728
LYM242	pKS(PksJ)	RICE Oryza sativa L. Indica ND	cDNA	3643	404
LYM243	pKS(PksJ)	RICE Oryza sativa L. Japonica ND	cDNA	3644	405
LYM245	pKS(PksJ)	RICE Oryza sativa L. Japonica ND	cDNA	3645	406
LYM248	pKS(PksJ)	RICE Oryza sativa L. Indica ND	cDNA	3646	3729
LYM249	Topo B	RICE Oryza sativa L. Japonica ND+ RICE Oryza sativa L. ND	cDNA	3647	3730
LYM250	pGXN (pKG+Nos+35S)	RICE Oryza sativa L. Japonica ND	cDNA	3648	409
LYM251	Topo B	RICE Oryza sativa L. Japonica ND	cDNA	3649	410
LYM252	pKS(PksJ)	RICE Oryza sativa L. Indica ND+ RICE Oryza sativa L. Japonica ND	cDNA	3650	411
LYM254	Topo B	RICE Oryza sativa L. Japonica ND	cDNA	3651	3731
LYM255	pKS(PksJ)	RICE Oryza sativa L. Japonica ND	cDNA	3652	3732
LYM256	pKS(PksJ)	RICE Oryza sativa L. Japonica ND	cDNA	3656	418
LYM26	pGXN (pKG+Nos+35S)	BARLEY Hordeum vulgare L. Manit	cDNA	3503	262
LYM260	Topo B	RICE Oryza sativa L. Japonica ND	cDNA	3653	414
LYM261	Topo B	RICE Oryza sativa L. Japonica ND	cDNA	3654	415
LYM267	pKS(PksJ)	MAIZE Zea mays L. ND	cDNA	3658	420

186

2018271407 30 Nov 2018

Gene Name	High copy plasmid	Amplified from Organism Origin	Polynucleotide SEQ ID NO:	Polypeptide SEQ ID NO:
LYM268	Topo B	RICE Oryza sativa L. Indica ND+ RICE Oryza sativa L. Japonica ND	cDNA	3659	421
LYM270	pKS(PksJ)	MAIZE Zea mays L. ND	cDNA	3660	422
LYM271	pKS(PksJ)	MAIZE Zea mays L. Pioneer 30G54	cDNA	3661	423
LYM273_G	pKS(PksJ)	RICE Oryza sativa L. Japonica ND	Genomic	3738	425
LYM273 S			GeneArt	3662	425
LYM274	pKS(PksJ)	RICE Oryza sativa L. Japonica ND	cDNA	3663	3734
LYM277	Topo B	RICE Oryza sativa L. Japonica ND	cDNA	3664	3735
LYM278	pGXN (pKG+Nos+35S)	BARLEY Hordeum vulgare L. Manit	cDNA	3665	3736
LYM283	Topo B	RICE Oryza sativa L. ND	cDNA	3666	429
LYM284	pKS(PksJ)	RICE Oryza sativa L. Japonica ND	cDNA	3667	430
LYM285	pKS(PksJ)	RICE Oryza sativa L. Japonica ND	cDNA	3668	431
LYM287	pKS(PksJ)	RICE Oryza sativa L. Japonica ND	cDNA	3669	432
LYM288	pGXNa	RICE Oryza sativa L. Indica ND+ RICE Oryza sativa L. Japonica ND	cDNA	3670	3737
LYM289	pGXN (pKG+Nos+35S)	BARLEY Hordeum vulgare L. Manit	cDNA	3671	434
LYM290	pKS(PksJ)	MAIZE Zea mays L. ND	cDNA	3672	435
LYM291	pKS(PksJ)	RICE Oryza sativa L. Japonica ND	cDNA	3673	436
LYM293	pGXNa	RICE Oryza sativa L. Indica ND	cDNA	3674	437
LYM3	pKS(PksJ)	RICE Oryza sativa L. Indica ND	cDNA	3483	3675
LYM30	pGXNa	RICE Oryza sativa L. ND	cDNA	3504	3677

187

2018271407 30 Nov 2018

Gene Name	High copy plasmid	Amplified from Organism Origin	Polynucleotide SEQ ID NO:	Polypeptide SEQ ID NO:
LYM31	pGXNa	RICE Oryza sativa L. ND	cDNA	3505	264
LYM32			GeneArt	3506	265
LYM34	pKS(PksJ)	RICE Oryza sativa L. Indica ND	cDNA	3507	3678
LYM35	pGXN (pKG+Nos+35S)	RICE Oryza sativa L. ND	cDNA	3508	267
LYM36			GeneArt	3509	268
LYM37	pGXN (pKG+Nos+35S)	RICE Oryza sativa L. Japonica ND	cDNA	3510	269
LYM38			GeneArt	3511	270
LYM4	pKS(PksJ)	RICE Oryza sativa L. ND	cDNA	3484	243
LYM40	Topo B	RICE Oryza sativa L. Japonica ND	cDNA	3512	271
LYM41	pGXN (pKG+Nos+35S)	RICE Oryza sativa L. Japonica ND	cDNA	3513	272
LYM42	pGXN (pKG+Nos+35S)	RICE Oryza sativa L. Japonica ND	cDNA	3514	273
LYM43	pGXN (pKG+Nos+35S)	RICE Oryza sativa L. ND	cDNA	3515	274
LYM44	pGXN (pKG+Nos+35S)	RICE Oryza sativa L. Japonica ND	cDNA	3516	275
LYM5	pKS(PksJ)	RICE Oryza sativa L. Indica ND	cDNA	3485	244
LYM51	pGXN (pKG+Nos+35S)	BARLEY Hordeum vulgare L. Manit	cDNA	3517	3679
LYM52	pKS(PksJ)	BARLEY Hordeum vulgare L. Manit	cDNA	3518	277
LYM53	pGXN (pKG+Nos+35S)	MAIZE Zea mays L. ND	cDNA	3519	3680
LYM56	pGXN (pKG+Nos+35S)	BARLEY Hordeum vulgare L. Manit	cDNA	3520	3681
LYM57	pKS(PksJ)	RICE Oryza sativa L. Japonica ND	cDNA	3521	3682
LYM6	pKS(PksJ)	RICE Oryza sativa L. ND	cDNA	3486	3676
LYM61	pKS(PksJ)	MAIZE Zea mays L. ND	cDNA	3522	3683
LYM62	pKS(PksJ)	MAIZE Zea mays L. ND	cDNA	3523	3684
LYM66	pKS(PksJ)	BARLEY Hordeum vulgare L. Manit	cDNA	3524	3685

188

2018271407 30 Nov 2018

Gene Name	High copy plasmid	Amplified from Organism Origin	Polynucleotide SEQ ID NO:	Polypeptide SEQ ID NO:
LYM67	pGXN (pKG+Nos+35S)	RICE Oryza sativa L. ND	cDNA	3525	284
LYM68	pGXNa	RICE Oryza sativa L. ND	cDNA	3526	3686
LYM69	pGXN (pKG+Nos+35S)	RICE Oryza sativa L. ND	cDNA	3527	286
LYM7	pGXN (pKG+Nos+35S)	RICE Oryza sativa L. ND	cDNA	3487	246
LYM73	Topo B	RICE Oryza sativa L. ND	cDNA	3528	287
LYM74			GeneArt	3529	288
LYM79	pGXN (pKG+Nos+35S)	MAIZE Zea mays L. ND	cDNA	3530	3687
LYM8	pKS(PksJ)	RICE Oryza sativa L. Japonica ND	cDNA	3488	247
LYM82	pGXN (pKG+Nos+35S)	BARLEY Hordeum vulgare L. Manit	cDNA	3531	290
LYM83	Topo B	BARLEY Hordeum vulgare L. Manit	cDNA	3532	3688
LYM84	pKS(PksJ)	BARLEY Hordeum vulgare L. Manit	cDNA	3533	292
LYM86	pKS(PksJ)	RICE Oryza sativa L. Indica ND	cDNA	3534	293
LYM88	pKS(PksJ)	ARABIDOPSIS Arabidopsis thaliana Transgenic Columbia	cDNA	3535	294
LYM89	pGXN (pKG+Nos+35S)	ARABIDOPSIS Arabidopsis thaliana Transgenic Columbia	cDNA	3536	295
LYM9	pGXN (pKG+Nos+35S)	RICE Oryza sativa L. ND	cDNA	3489	248
LYM90	pGXN (pKG+Nos+35S)	BARLEY Hordeum vulgare L. Manit	cDNA	3537	296
LYM91	pGXN (pKG+Nos+35S)	BARLEY Hordeum vulgare L. Manit	cDNA	3538	297
LYM93	Topo B	BARLEY Hordeum vulgare L. Manit	cDNA	3539	298
LYM95	pGXN (pKG+Nos+35S)	BARLEY Hordeum vulgare L. Manit	cDNA	3541	300
LYM99	pKS(PksJ)	BARLEY Hordeum vulgare L. Manit	cDNA	3540	299

2018271407 30 Nov 2018

189

Table 28: Cloned and synthetic genes are provided along with the sequence identifiers of their polynucleotides and polypeptides. Also provided are the source organism, tissue and the cloning vectors. ND = not a determined ecotype.

Selected DNA sequences were synthesized by a commercial supplier GeneArt, GmbH [Hypertext Transfer Protocol://World Wide Web (dot) geneart (dot) com/)]. Synthetic DNA is designed in silico. Suitable restriction enzymes sites were added to the cloned sequences at the 5' end and at the 3' end to enabled later cloning into the pQFN/ pQYN_6669 binary vectors downstream of the 6669 promoter (SEQ ID NO:4198).

EXAMPLE 8 TRANSFORMING AGROBACTERIUM TUMEFACIENS CELLS WITH BINARY VECTORS HARBORING PUTATIVE GENES

Each of the binary vectors described in Example 7 above are used to transform Agrobacterium cells. Two additional binary constructs, having a GUS/Luciferase reporter gene replacing the selected gene (positioned downstream of the At6669 promoter), are used as negative controls.

The binary vectors are introduced to Agrobacterium tumefaciens GV301, or LB4404 competent cells (about 10⁹ cells/mL) by electroporation. The electroporation is performed using a MicroPulser electroporator (Biorad), 0.2 cm cuvettes (Biorad) and EC-2 electroporation program (Biorad). The treated cells are cultured in LB liquid medium at 28 °C for 3 hours, then plated over LB agar supplemented with gentamycin (50 mg/L; for Agrobacterium strains GV301) or streptomycin (300 mg/L; for Agrobacterium strain LB4404) and kanamycin (50 mg/L) at 28 °C for 48 hours. Abrobacterium colonies which developed on the selective media are analyzed by PCR using the primers which are designed to span the inserted sequence in the pPI plasmid. The resulting PCR products are isolated and sequenced as described in Example 3 above, to verify that the correct yield sequences are properly introduced to the Agrobacterium cells.

2018271407 30 Nov 2018

190

EXAMPLE 9

PRODUCING TRANSGENIC ARABIDOPSIS PLANTS EXPRESSING SELECTED GENES ACCORDING TO SOME EMBODIMENTS OF THE INVENTION

Materials and Experimental Methods

Plant transformation - The Arabidopsis thaliana var Columbia (To plants) were transformed according to the Floral Dip procedure [Clough SJ, Bent AF. (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. 16(6): 735-43; and Desfeux C, Clough SJ, Bent AF. (2000) Female reproductive tissues are the primary targets of Agrobacterium-mediated transformation by the Arabidopsis floral-dip method. Plant Physiol. 123(3): 895-904] with minor modifications. Briefly, Arabidopsis thaliana Columbia (ColO) T_o plants were sown in 250 ml pots filled with wet peat-based growth mix. The pots were covered with aluminum foil and a plastic dome, kept at 4 °C for 3-4 days, then uncovered and incubated in a growth chamber at 18-24 °C under 16/8 hours light/dark cycles. The To plants were ready for transformation six days before anthesis.

Single colonies of Agrobacterium carrying the binary vectors harboring the yield genes were cultured in LB medium supplemented with kanamycin (50 mg/L) and gentamycin (50 mg/L). The cultures were incubated at 28 °C for 48 hours under vigorous shaking and centrifuged at 4000 rpm for 5 minutes. The pellets comprising Agrobacterium cells were resuspended in a transformation medium which contained half-strength (2.15 g/L) Murashige-Skoog (Duchefa); 0.044 μΜ benzylamino purine (Sigma); 112 pg/L B5 Gambourg vitamins (Sigma); 5 % sucrose; and 0.2 ml/L Silwet L-77 (OSI Specialists, CT) in double-distilled water, at pH of 5.7.

Transformation of To plants was performed by inverting each plant into an Agrobacterium suspension such that the above ground plant tissue was submerged for 3-5 seconds. Each inoculated To plant was immediately placed in a plastic tray, then covered with clear plastic dome to maintain humidity and was kept in the dark at room temperature for 18 hours to facilitate infection and transformation. Transformed (transgenic) plants were then uncovered and transferred to a greenhouse for recovery and maturation. The transgenic To plants were grown in the greenhouse for 3-5 weeks until siliques were brown and dry, then seeds were harvested from plants and kept at room temperature until sowing.

2018271407 30 Nov 2018

191

For generating Ti and T₂ transgenic plants harboring the genes, seeds collected from transgenic To plants were surface-sterilized by soaking in 70 % ethanol for 1 minute, followed by soaking in 5 % sodium hypochlorite and 0.05 % triton for 5 minutes. The surface-sterilized seeds were thoroughly washed in sterile distilled water then placed on culture plates containing half-strength Murashig-Skoog (Duchefa); 2 % sucrose; 0.8 % plant agar; 50 rnM kanamycin; and 200 mM carbenicylin (Duchefa). The culture plates were incubated at 4 °C for 48 hours then transferred to a growth room at 25 °C for an additional week of incubation. Vital Ti Arabidopsis plants were transferred to a fresh culture plates for another week of incubation. Following incubation the Ti plants were removed from culture plates and planted in growth mix contained in 250 ml pots. The transgenic plants were allowed to grow in a greenhouse to maturity. Seeds harvested from Ti plants were cultured and grown to maturity as T₂ plants under the same conditions as used for culturing and growing the Ti plants.

EXAMPLE 10

IMPROVED TRANSGENIC PLANT PERFORMANCE - GREENHOUSE ASS A YS

To analyze the effect of expression of the isolated polynucleotides in plants, plants performance was tested under greenhouse conditions.

Greenhouse assays - The plants were analyzed for their overall size, growth rate, flowering, seed yield, weight of 1,000 seeds, dry matter and harvest index (HIseed yield/dry matter). Transgenic plants performance was compared to control plants grown in parallel under the same conditions. Mock- transgenic plants expressing the uidA reporter gene (GUS-Intron) or with no gene at all, under the same promoter were used as control.

The experiment was planned in nested randomized plot distribution. For each gene of the invention three to five independent transformation events were analyzed from each construct. In cases where a certain event appears more than once, the event was tested in several independent experiments.

Tables 29 and 31 specify the parameters measured in plants in the greenhouse assays (till seed maturation and bolting assay, respectively).

Digital imaging - A laboratory image acquisition system, which consists of a digital reflex camera (Canon EOS 300D) attached with a 55 mm focal length lens

2018271407 30 Nov 2018

192 (Canon EF-S series), mounted on a reproduction device (Kaiser RS), which included 4 light units (4 x 150 Watts light bulb) is used for capturing images of plant samples.

The image capturing process was repeated every 2 days starting from day 1 after transplanting till day 16. Same camera, placed in a custom made iron mount, was used for capturing images of larger plants sawn in white tubs in an environmental controlled greenhouse. The tubs were square shape include 1.7 liter trays. During the capture process, the tubs were placed beneath the iron mount, while avoiding direct sun light and casting of shadows.

An image analysis system was used, which consists of a personal desktop computer (Intel P4 3.0 GHz processor) and a public domain program - Image J 1.39 (Java based image processing program which was developed at the U.S National Institutes of Health and freely available on the internet at Hypertext Transfer Protocol://rsbweb (dot) nih (dot) gov/). Images were captured in resolution of 10 Mega Pixels (3888 x 2592 pixels) and stored in a low compression JPEG (Joint Photographic Experts Group standard) format. Next, analyzed data was saved to text files and processed using the JMP statistical analysis software (SAS institute).

Leaf growth analysis - Using the digital analysis leaves data was calculated, including leaf number, rosette area, rosette diameter, leaf blade area, plot coverage, leaf petiole length.

The vegetative growth rate of the plant was defined by formulas XIII, XIV, XV and XVI.

Formula XIII:

Relative growth rate of leaf blade area = Regression coefficient of leaf area along time course.

Formula XIV:

Relative growth rate of rosette area = Regression coefficient of rosette area along time course.

Formula XV

Relative growth rate of rosette diameter = Regression coefficient of rosette diameter along time course.

2018271407 30 Nov 2018

193

Formula XVI

Relative growth rate of plot coverage = Regression coefficient of plot coverage along time course.

Seeds average weight (Seed weight or 1000 seed weight) - At the end of the experiment all seeds were collected. The seeds were scattered on a glass tray and a picture was taken. Using the digital analysis, the number of seeds in each sample was calculated.

Plant dry weight and seed yield - On about day 80 from sowing, the plants were harvested and left to dry at 30 °C in a drying chamber. The biomass and seed weight of each plot were measured and divided by the number of plants in each plot. Dry weight = total weight of the vegetative portion above ground (excluding roots) after drying at 30 °C in a drying chamber;

Seed yield per plant = total seed weight per plant (gr.).

1000 seed weight (the weight of 1000 seeds) (gr.).

The harvest index was calculated using Formula IV (Harvest Index = Average seed yield per plant/ Average dry weight) as described above.

Oil percentage in seeds - At the end of the experiment all seeds from plots A-C were collected. Columbia seeds from 3 plots were mixed grounded and then mounted onto the extraction chamber. 210 ml of n-Hexane (Cat No. 080951 Biolab Ltd.) were used as the solvent. The extraction was performed for 30 hours at medium heat 50 °C. Once the extraction has ended the n-Hexane was evaporated using the evaporator at 35 °C and vacuum conditions. The process was repeated twice. The information gained from the Soxhlet extractor (Soxhlet, F. Die gewichtsanalytische Bestimmung des Milchfettes, Polytechnisches J. (Dingier's) 1879, 232, 461) was used to create a calibration curve for the Low Resonance NMR. The content of oil of all seed samples was determined using the Low Resonance NMR (MARAN Ultra- Oxford Instrument) and its MultiQuant sowftware package.

Oil yield - The oil yield was calculated using Formula IX (described above).

Silique length analysis - On day 50 from sowing, 30 siliques from different plants in each plot were sampled in block A. The chosen siliques were green-yellow in color and were collected from the bottom parts of a grown plant’s stem. A digital photograph was taken to determine silique’s length.

2018271407 30 Nov 2018

194

Statistical analyses - To identify genes conferring significantly improved tolerance to abiotic stresses, the results obtained from the transgenic plants were compared to those obtained from control plants. To identify outperforming genes and constructs, results from the independent transformation events tested were analyzed separately. Data was analyzed using Student's t-test and results were considered significant if the p value was less than 0.1. The JMP statistics software package was used (Version 5.2.1, SAS Institute Inc., Cary, NC, USA).

Experimental Results

Plants expressing the polynucleotides of the some embodiments of the invention 10 were assayed for a number of commercially desired traits. In cases where a certain event appears more than once, the event was tested in several independent experiments.

Table 29

Measured parameters at the greenhouse till seed maturation assay (T2 experiment) for transformed agriculture improving trait genes

Tested Parameters	Id
Dry Weight (gr)	A
Harvest Index	B
Leaf Blade Area TP4 (cm2)	C
Leaf Number TP4	D
Leaf Petiole Length TP4 (cm)	E
Petiole Relative Area TP4	F
Plot Coverage TP4 (cm2)	G
RGR Of Leaf Blade Area	H
RGR Of Plot Coverage	I
RGR Of Rosette Area	J
RGR Of Rosette Diameter	K
Rosette Area TP4 (cm2)	L
Rosette Diameter TP4 (cm)	M
Seed Yield (gr)	N
Seeds Weight (gr)	O
Blade Relative Area TP4	P
Oil Content	Q
RGR Of Leaf Number	R
Table 29: Provided are the identification (ID) letters of each of t	ie Tested

Parameters. RGR-Relative Growth Rate; TP4- time point 4.

2018271407 30 Nov 2018

195

Table 30

Results obtained in a Greenhouse till seed maturation assay

Gene name	Even t	ID	Mean	P value	% incr. vs. cont.	Gene name	Even t	ID	Mean	P value	% incr. vs. cont.
LYM 16	1162 3.2	A	0.739	2.97E -02	10.4	LYM 9	1163 3.7	P	93.11 5	4.23E -03	3.2
LYM 57	1201 2.6	A	0.841	4.23E -02	25.7	LYM 15	1161 1.3	P	93.13 1	5.66E -03	3.2
LYM 17	1168 1.4	A	0.728	5.16E -02	8.8	LYM 4	1170 2.1	P	93.16 7	7.54E -03	3.2
LYM 10	1174 4.1	A	0.723	8.27E -02	8	LYM 17	1168 2.3	P	92.74 7	8.70E -03	2.8
LYM 95	1212 1.3	A	0.779	9.81E -02	16.5	LYM 17	1168 4.5	P	92.55 4	1.28E -02	2.6
CON TRO L	—	A	0.669	—	0	LYM 2	1169 1.2	P	92.87 5	1.35E -02	2.9
LYM 16	1162 3.5	B	0.543	6.50E -05	45.1	LYM 7	1159 4.3	P	92.51 3	1.79E -02	2.5
LYM 24	1206 3.3	B	0.515	2.78E -04	37.6	LYM 67	1178 2.5	P	94.03 7	1.83E -02	4.2
LYM 10	1174 1.4	B	0.499	3.74E -04	33.4	LYM 44	1188 4.3	P	92.30 6	2.09E -02	2.3
LYM 7	1159 4.2	B	0.498	1.10E -03	33.1	LYM 62	1202 2.4	P	92.29 6	2.21E -02	2.3
LYM 44	1188 5.3	B	0.473	1.50E -03	26.6	LYM 19	1175 1.4	P	92.24 4	2.38E -02	2.2
LYM 15	1161 1.3	B	0.477	3.91E -03	27.7	LYM 17	1168 4.4	P	92.43 8	3.04E -02	2.4
LYM 2	1169 5.1	B	0.457	4.23E -03	22.2	LYM 31	1192 3.1	P	92.39 9	3.32E -02	2.4
LYM 30	1191 3.3	B	0.462	4.25E -03	23.6	LYM 34	1190 3.3	P	92.07	3.49E -02	2
LYM 8	1198 4.1	B	0.472	4.44E -03	26.3	LYM 12	1187 1.3	P	91.99 9	3.94E -02	2
LYM 31	1192 3.1	B	0.471	4.64E -03	26	LYM 15	1161 4.3	P	91.99 6	5.05E -02	1.9
LYM 14	1205 1.1	B	0.454	5.37E -03	21.5	LYM 15	1161 4.4	P	91.87 7	5.09E -02	1.8
LYM 2	1169 2.3	B	0.546	5.62E -03	46	LYM 10	1174 1.4	P	91.97 9	5.99E -02	1.9
LYM 16	1162 4.6	B	0.468	8.76E -03	25.1	LYM 57	1201 2.4	P	91.75 2	6.64E -02	1.7
LYM 66	1195 4.4	B	0.455	9.16E -03	21.7	LYM 24	1206 3.3	P	92.88 3	6.73E -02	2.9
LYM 34	1190 4.3	B	0.442	1.11E -02	18.3	LYM 16	1162 4.6	P	91.72 3	7.65E -02	1.6
LYM 53	1184 3.2	B	0.506	1.24E -02	35.4	LYM 26	1182 4.3	P	91.67 2	7.95E -02	1.6
LYM 35	1181 2.4	B	0.446	1.49E -02	19.2	LYM 66	1195 5.2	P	91.69 3	8.09E -02	1.6
LYM 4	1170 6.5	B	0.456	1.57E -02	21.9	LYM 62	1202 3.7	P	92.17	8.37E -02	2.1

196

2018271407 30 Nov 2018

Gene name	Even t	ID	Mean	P value	% incr. vs. cont.	Gene name	Even t	ID	Mean	P value	% incr. vs. cont.
LYM 15	1161 2.2	B	0.437	1.59E -02	16.9	LYM 30	1191 3.3	P	91.63 7	8.66E -02	1.5
LYM 19	1175 4.1	B	0.448	1.60E -02	19.8	LYM 12	1187 3.4	P	91.84	9.17E -02	1.8
LYM 9	1163 4.6	B	0.466	1.61E -02	24.6	LYM 51	1189 1.1	P	92.63	9.56E -02	2.6
LYM 1	1160 1.1	B	0.465	1.63E -02	24.3	CON TRO L	—	P	90.23 9	—	0
LYM 57	1201 3.1	B	0.429	3.09E -02	14.8	LYM 17	1168 4.5	Q	31.92 5	1.22E -04	13.3
LYM 17	1168 4.5	B	0.501	3.38E -02	34.1	LYM 66	1195 2.1	Q	31.76	1.43E -04	12.7
LYM 30	1191 2.6	B	0.506	3.67E -02	35.3	LYM 34	1190 4.3	Q	31.58 5	2.06E -04	12.1
LYM 24	1206 1.2	B	0.481	4.69E -02	28.5	LYM 17	1168 2.3	Q	32.16	2.39E -04	14.1
LYM 82	1220 3.2	B	0.53	4.78E -02	41.7	LYM 82	1220 3.2	Q	31.18 5	4.56E -04	10.7
LYM 31	1192 4.4	B	0.437	4.78E -02	16.7	LYM 2	1169 2.3	Q	31.17	7.38E -04	10.6
LYM 6	1173 5.1	B	0.42	5.60E -02	12.3	LYM 14	1205 1.1	Q	30.42 5	2.85E -03	8
LYM 8	1198 3.1	B	0.47	6.47E -02	25.8	LYM 43	1179 1.2	Q	31.01 5	3.17E -03	10.1
LYM 6	1173 4.3	B	0.418	6.56E -02	11.9	LYM 43	1179 3.2	Q	31.92	4.77E -03	13.3
LYM 30	1191 2.7	B	0.512	6.75E -02	36.9	LYM 26	1182 4.3	Q	30.13	5.77E -03	6.9
LYM 26	1182 4.3	B	0.483	6.80E -02	29.2	LYM 51	1189 3.4	Q	30.12	7.02E -03	6.9
LYM 8	1198 2.4	B	0.475	7.82E -02	27.1	LYM 10	1174 1.4	Q	30.01	8.17E -03	6.5
LYM 12	1187 1.1	B	0.457	8.07E -02	22.2	LYM 22	1176 1.3	Q	30.89 5	8.20E -03	9.6
LYM 67	1178 2.6	B	0.49	8.15E -02	31.1	LYM 15	1161 1.3	Q	30.05	8.49E -03	6.6
LYM 22	1176 4.1	B	0.474	8.22E -02	26.8	LYM 24	1206 3.3	Q	30.21 5	1.03E -02	7.2
LYM 51	1189 3.4	B	0.476	8.62E -02	27.4	LYM 43	1179 2.2	Q	29.98 5	1.19E -02	6.4
LYM 21	1167 4.5	B	0.516	8.83E -02	38	LYM 62	1202 3.2	Q	29.85 5	1.23E -02	5.9
LYM 7	1159 4.3	B	0.464	8.85E -02	24	LYM 7	1159 1.5	Q	29.84 5	1.27E -02	5.9
LYM 24	1206 4.1	B	0.491	8.92E -02	31.2	LYM 66	1195 5.2	Q	30.36 5	1.58E -02	7.7
LYM 2	1169 1.2	B	0.454	9.14E -02	21.4	LYM 24	1206 1.2	Q	29.76	1.61E -02	5.6
LYM 13	1177 2.2	B	0.474	9.21E -02	26.9	LYM 69	1185 2.2	Q	29.82	1.91E -02	5.8
LYM 68	1194 2.3	B	0.426	9.22E -02	13.9	LYM 62	1202 3.7	Q	29.69	2.03E -02	5.3

197

2018271407 30 Nov 2018

Gene name	Even t	ID	Mean	P value	% incr. vs. cont.	Gene name	Even t	ID	Mean	P value	% incr. vs. cont.
LYM 44	1188 4.3	B	0.414	9.80E -02	10.6	LYM 17	1168 4.4	Q	29.68	2.16E -02	5.3
CON TRO L	—	B	0.374	—	0	LYM 7	1159 2.1	Q	31.66	3.45E -02	12.3
LYM 95	1212 1.3	C	0.73	2.06E -04	46.2	LYM 31	1192 3.1	Q	29.53	3.69E -02	4.8
LYM 10	1174 1.2	C	0.655	3.02E -03	31.2	LYM 53	1184 1.2	Q	30.06	3.89E -02	6.7
LYM 21	1167 1.2	C	0.619	4.67E -03	23.9	LYM 57	1201 2.6	Q	29.38	4.78E -02	4.2
LYM 62	1202 4.2	C	0.626	7.02E -03	25.3	LYM 66	1195 4.4	Q	31.52	5.68E -02	11.8
LYM 66	1195 3.1	C	0.602	1.02E -02	20.5	LYM 14	1205 2.4	Q	29.42	5.94E -02	4.4
LYM	1174	p	0.602	1.02E	20.5	LYM	1189	Q	30.18	6.04E	7.1
10	4.1		-02	51	4.2	5	-02
LYM 4	1170 6.5	c	0.575	3.74E -02	15.2	LYM 68	1194 1.3	Q	30.51 5	6.20E -02	8.3
LYM 44	1188 2.1	c	0.569	5.06E -02	13.9	LYM 8	1198 4.1	Q	29.39 5	6.25E -02	4.3
LYM 66	1195 5.2	c	0.586	5.09E -02	17.4	LYM 30	1191 2.6	Q	31.81 5	6.57E -02	12.9
LYM 82	1220 1.1	c	0.567	6.28E -02	13.6	LYM 13	1177 2.1	Q	29.53	8.65E -02	4.8
LYM	1194	p	0.564	6.49E	13.1	LYM	1206	Q	30.50	9.05E	8.2
68	1.4		-02	24	4.1	5	-02
LYM 95	1212 1.2	c	0.557	9.41E -02	11.6	LYM 44	1188 5.4	Q	29.57	9.26E -02	4.9
CON TRO L	—	c	0.499	—	0	LYM 1	1160 1.1	Q	29.68 5	9.43E -02	5.3
LYM 31	1192 3.1	D	9.125	4.78E -04	8.8	CON TRO L	—	Q	28.18 3	—	0
LYM 26	1182 4.6	D	8.938	4.23E -03	6.5	LYM 175	1265 1.6	A	1.514	2.92E -03	50.2
LYM 4	1170 5.2	D	8.938	4.23E -03	6.5	LYM 256	1332 1.2	A	1.169	5.61E -02	16
LYM 9	1163 2.1	D	8.938	4.23E -03	6.5	LYM 147	1258 1.4	A	1.154	6.79E -02	14.5
LYM 44	1188 2.1	D	8.875	4.88E -03	5.8	CON TRO L	—	A	1.008	—	0
LYM 8	1198 4.1	D	8.875	4.88E -03	5.8	LYM 207	1325 1.4	B	0.356	7.41E -02	8.2
LYM 4	1170 2.1	D	9.5	5.72E -03	13.3	LYM 73	1262 4.1	B	0.362	9.94E -02	9.9
LYM 10	1174 4.5	D	8.813	1.53E -02	5.1	CON TRO L	—	B	0.329	—	0
LYM 24	1206 1.1	D	8.813	1.53E -02	5.1	LYM 206	1260 1.3	C	0.313	3.92E -03	31.8

198

2018271407 30 Nov 2018

Gene name	Even t	ID	Mean	P value	% incr. vs. cont.	Gene name	Even t	ID	Mean	P value	% incr. vs. cont.
LYM 66	1195 2.1	D	8.75	1.97E -02	4.3	LYM 207	1325 1.4	C	0.281	2.47E -02	18.2
LYM 69	1185 1.2	D	8.75	1.97E -02	4.3	LYM 241	1327 1.2	c	0.291	3.27E -02	22.5
LYM 95	1212 1.3	D	8.75	1.97E -02	4.3	LYM 159	1335 4.5	c	0.272	4.39E -02	14.8
LYM 53	1184 2.4	D	9	3.32E -02	7.3	LYM 91	1328 3.1	c	0.268	7.20E -02	13
LYM 16	1162 3.2	D	8.875	6.05E -02	5.8	CON TRO L	—	c	0.237	—	0
LYM 37	1180 3.2	D	8.875	6.05E -02	5.8	LYM 175	1265 3.3	D	9	1.81E -02	3
LYM 57	1201 2.6	D	8.875	6.05E -02	5.8	LYM 206	1260 3.1	D	9	1.81E -02	3
LYM 15	1161 4.4	D	8.688	6.06E -02	3.6	LYM 147	1258 1.4	D	9.25	7.10E -02	5.9
LYM 43	1179 1.5	D	8.688	6.06E -02	3.6	LYM 147	1258 4.4	D	9.25	7.10E -02	5.9
LYM 44	1188 5.3	D	8.625	8.97E -02	2.8	CON TRO L	—	D	8.734	—	0
LYM 53	1184 4.2	D	8.625	8.97E -02	2.8	LYM 207	1325 1.4	E	0.494	2.25E -03	29
LYM 7	1159 4.3	D	8.625	8.97E -02	2.8	LYM 206	1260 1.3	E	0.49	3.51E -03	27.9
CON TRO L	—	D	8.388	—	0	LYM 91	1328 3.1	E	0.451	2.44E -02	17.8
LYM 95	1212 1.3	E	0.871	6.40E -05	20.5	CON TRO L	—	E	0.383	—	0
LYM 10	1174 1.2	E	0.854	1.68E -04	18	LYM 175	1265 1.6	F	8.457	9.98E -03	14.9
LYM 51	1189 3.4	E	0.814	1.64E -03	12.5	LYM 241	1327 1.2	F	7.999	8.84E -02	8.7
LYM 26	1182 4.1	E	0.864	3.71E -03	19.4	CON TRO L	—	F	7.36	—	0
LYM 16	1162 3.2	E	0.793	8.69E -03	9.6	LYM 241	1327 1.2	G	13.92 4	3.22E -02	20.3
LYM 12	1187 1.1	E	0.79	8.71E -03	9.2	LYM 256	1332 2.3	G	13.01 2	5.32E -02	12.5
LYM 41	1183 4.3	E	0.788	9.62E -03	9	LYM 91	1328 3.1	G	12.99 6	5.81E -02	12.3
LYM 44	1188 5.4	E	0.791	2.21E -02	9.3	CON TRO L	—	G	11.57	—	0
LYM 17	1168 1.4	E	0.788	2.38E -02	8.9	LYM 206	1260 1.3	H	0.038	9.68E -03	39.1
LYM 21	1167 3.1	E	0.822	2.48E -02	13.7	LYM 206	1260 2.1	H	0.037	3.48E -02	35.7

199

2018271407 30 Nov 2018

Gene name	Even t	ID	Mean	P value	% incr. vs. cont.	Gene name	Even t	ID	Mean	P value	% incr. vs. cont.
LYM 20	1171 1.1	E	0.786	4.67E -02	8.7	LYM 147	1258 4.4	H	0.036	4.44E -02	30.6
LYM 4	1170 6.5	E	0.818	5.29E -02	13.1	LYM 147	1258 3.3	H	0.035	4.93E -02	29.1
LYM 68	1194 2.3	E	0.786	6.52E -02	8.7	LYM 203	1266 4.1	H	0.035	7.71E -02	27.4
LYM 53	1184 1.1	E	0.823	9.25E -02	13.8	LYM 159	1335 4.6	H	0.035	8.34E -02	28.1
CON TRO L	—	E	0.723	—	0	LYM 241	1327 1.2	H	0.034	9.00E -02	24.6
LYM 34	1190 2.2	F	13.36 3	5.21E -03	33.8	CON TRO L	—	H	0.027	—	0
LYM 17	1168 1.4	F	11.76 4	3.07E -02	17.8	LYM 206	1260 1.3	I	1.904	2.91E -02	34.1
LYM 37	1180 2.2	F	11.83 9	5.95E -02	18.5	LYM 147	1258 3.3	I	1.834	5.96E -02	29.1
CON TRO L	—	F	9.989	—	0	LYM 147	1258 4.4	I	1.823	6.86E -02	28.3
LYM 21	1167 1.2	G	29.31 8	2.73E -03	29	CON TRO L	—	I	1.421	—	0
LYM 95	1212 1.3	G	35.39 8	5.12E -03	55.7	LYM 206	1260 1.3	J	0.238	2.91E -02	34.1
LYM 44	1188 2.1	G	28.41 9	6.04E -03	25	LYM 147	1258 3.3	J	0.229	5.96E -02	29.1
LYM 10	1174 1.2	G	31.63 6	7.14E -03	39.1	LYM 147	1258 4.4	J	0.228	6.86E -02	28.3
LYM 66	1195 3.1	G	28.02	8.78E -03	23.2	CON TRO L	—	J	0.178	—	0
LYM 4	1170 6.5	G	28.51 5	1.11E -02	25.4	LYM 206	1260 1.3	K	0.227	3.54E -02	26.3
LYM 62	1202 4.2	G	30.01 7	1.16E -02	32	LYM 203	1266 4.1	K	0.225	6.18E -02	25.1
LYM 66	1195 5.2	G	27.27 7	1.76E -02	20	LYM 159	1335 4.6	K	0.22	8.46E -02	22.6
LYM 68	1194 1.4	G	26.64 6	3.40E -02	17.2	LYM 206	1260 2.1	K	0.223	8.54E -02	24
LYM 82	1220 1.1	G	26.54 8	4.02E -02	16.8	LYM 241	1327 1.2	K	0.217	9.49E -02	21.1
LYM 9	1163 2.1	G	26.84 5	4.65E -02	18.1	CON TRO L	—	K	0.179	—	0
LYM 53	1184 1.1	G	28.48 2	7.52E -02	25.3	LYM 241	1327 1.2	L	1.74	3.22E -02	20.3
LYM 95	1212 1.2	G	26.98 6	9.98E -02	18.7	LYM 256	1332 2.3	L	1.627	5.32E -02	12.5
CON TRO L	—	G	22.73 5	—	0	LYM 91	1328 3.1	L	1.625	5.81E -02	12.3

200

2018271407 30 Nov 2018

Gene name	Even t	ID	Mean	P value	% incr. vs. cont.	Gene name	Even t	ID	Mean	P value	% incr. vs. cont.
LYM 95	1212 1.3	H	0.094	1.34E -02	47.3	CON TRO L	—	L	1.446	—	0
LYM 10	1174 1.2	H	0.084	7.76E -02	31.9	LYM 206	1260 1.3	M	2.453	2.09E -03	18
CON TRO L	—	H	0.064	—	0	LYM 241	1327 1.2	M	2.397	1.28E -02	15.3
LYM 95	1212 1.3	I	4.691	6.13E -03	54.8	LYM 207	1325 1.4	M	2.296	3.04E -02	10.4
LYM 10	1174 1.2	I	4.228	3.51E -02	39.5	LYM 147	1258 4.4	M	2.386	8.91E -02	14.8
LYM 62	1202 4.2	I	3.957	8.88E -02	30.6	LYM 256	1332 2.3	M	2.239	9.17E -02	7.7
LYM 10	1174 4.5	I	3.988	9.32E -02	31.6	CON TRO L	—	M	2.079	—	0
CON TRO L	—	I	3.03	—	0	LYM 236	1259 4.3	O	0.026	6.00E -02	15.3
LYM 95	1212 1.3	J	0.586	8.07E -03	52.2	LYM 147	1258 4.4	O	0.028	6.46E -02	22.5
LYM 10	1174 1.2	J	0.529	4.45E -02	37.2	CON TRO L	—	o	0.023	—	0
CON TRO L	—	J	0.385	—	0	LYM 157	1334 1.3	P	93.97 7	3.21E -02	2.1
LYM 95	1212 1.3	K	0.411	5.44E -03	28.5	LYM 256	1332 4.2	P	93.95 4	3.46E -02	2.1
LYM 10	1174 1.2	K	0.392	2.01E -02	22.4	LYM 159	1335 4.5	P	93.98 3	7.24E -02	2.1
LYM 10	1174 4.5	K	0.383	4.42E -02	19.7	LYM 223	1267 1.2	P	93.58 7	8.19E -02	1.7
LYM 10	1174 4.1	K	0.378	5.54E -02	18.2	LYM 157	1334 1.7	P	93.61 6	9.88E -02	1.7
LYM 26	1182 4.1	K	0.377	6.36E -02	17.6	CON TRO L	—	P	92.01 8	—	0
LYM 21	1167 1.2	K	0.377	6.69E -02	17.8	LYM 250	1261 3.4	Q	30.53 5	3.32E -03	7.9
LYM 68	1194 1.4	K	0.373	7.72E -02	16.6	LYM 206	1260 1.2	Q	29.68 5	1.79E -02	4.9
CON TRO L	—	K	0.32	—	0	LYM 147	1258 2.3	Q	29.84	3.32E -02	5.5
LYM 21	1167 1.2	L	3.665	3.75E -03	26.8	LYM 203	1266 2.3	Q	31.71 5	3.46E -02	12.1
LYM 95	1212 1.3	L	4.425	5.70E -03	53.1	LYM 157	1334 1.3	Q	29.42	4.35E -02	4
LYM 10	1174 1.2	L	3.954	8.47E -03	36.9	LYM 206	1260 3.2	Q	29.34	6.50E -02	3.7

201

2018271407 30 Nov 2018

Gene name	Even t	ID	Mean	P value	% incr. vs. cont.	Gene name	Even t	ID	Mean	P value	% incr. vs. cont.
LYM 44	1188 2.1	L	3.552	8.51E -03	22.9	LYM 91	1328 3.1	Q	29.24 5	7.37E -02	3.3
LYM 66	1195 3.1	L	3.502	1.25E -02	21.2	CON TRO L	—	Q	28.29 8	—	0
LYM 10	1174 4.1	L	3.498	1.28E -02	21.1	LYM 206	1260 3.1	R	0.682	1.24E -02	27.2
LYM 62	1202 4.2	L	3.752	1.43E -02	29.9	CON TRO L	—	R	0.536	—	0
LYM 4	1170 6.5	L	3.564	1.51E -02	23.4	LYM 113	1244 3.1	B	0.532	9.57E -03	25.9
LYM 66	1195 5.2	L	3.41	2.53E -02	18	LYM 267	1360 4.5	B	0.48	2.91E -02	13.6
LYM 68	1194 1.4	L	3.331	4.96E -02	15.3	LYM 285	1273 4.7	B	0.477	3.69E -02	12.8
LYM 82	1220 1.1	L	3.319	5.85E -02	14.8	LYM 113	1244 4.4	B	0.464	9.15E -02	9.7
LYM 9	1163 2.1	L	3.356	6.43E -02	16.1	CON TRO L	—	B	0.423	—	0
LYM 53	1184 1.1	L	3.56	8.80E -02	23.2	CON TRO L	—	E	0.515	—	0
CON TRO L	—	L	2.889	—	0	LYM 255	1308 1.5	F	8.406	9.80E -05	18.5
LYM 95	1212 1.3	M	3.993	1.50E -05	26.6	LYM 116	1320 4.6	F	7.893	5.HE -04	11.2
LYM 10	1174 1.2	M	3.71	3.24E -04	17.6	LYM 287	1277 1.6	F	7.885	5.55E -04	11.1
LYM 62	1202 4.2	M	3.594	1.18E -03	14	LYM 284	1288 4.6	F	7.834	7.75E -04	10.4
LYM 10	1174 4.1	M	3.58	1.97E -03	13.5	LYM 239	1304 1.7	F	7.666	3.45E -03	8
LYM 82	1220 1.1	M	3.499	8.49E -03	10.9	LYM 113	1244 4.5	F	8.133	6.77E -03	14.6
LYM 44	1188 5.4	M	3.407	2.47E -02	8	LYM 287	1277 1.7	F	7.628	7.48E -03	7.5
LYM 9	1163 2.1	M	3.475	2.70E -02	10.2	LYM 110	1292 3.5	F	8.115	1.19E -02	14.4
LYM 20	1171 1.1	M	3.387	2.94E -02	7.4	LYM 52	1289 5.7	F	7.749	1.33E -02	9.2
LYM 66	1195 3.1	M	3.494	3.07E -02	10.8	LYM 238	1276 4.8	F	8.587	4.56E -02	21
LYM 21	1167 3.1	M	3.421	3.23E -02	8.5	LYM 112	1337 4.4	F	7.715	6.97E -02	8.7
LYM 51	1189 3.4	M	3.481	3.65E -02	10.4	LYM 56	1311 2.5	F	7.798	9.00E -02	9.9
LYM 43	1179 2.2	M	3.43	5.63E -02	8.7	CON TRO L	—	F	7.096	—	0

202

2018271407 30 Nov 2018

Gene name	Even t	ID	Mean	P value	% incr. vs. cont.	Gene name	Even t	ID	Mean	P value	% incr. vs. cont.
LYM 26	1182 4.1	M	3.537	6.22E -02	12.1	LYM 56	1311 1.7	N	0.554	7.80E -02	10.8
LYM 17	1168 2.3	M	3.353	6.60E -02	6.3	CON TRO L	—	N	0.5	—	0
LYM 16	1162 3.2	M	3.512	6.70E -02	11.3	LYM 255	1308 2.9	O	0.025	3.34E -02	7.8
LYM 66	1195 5.2	M	3.419	8.25E -02	8.4	LYM 141	1240 2.4	O	0.027	3.92E -02	19.5
LYM 17	1168 1.4	M	3.326	8.35E -02	5.5	LYM 113	1244 2.1	o	0.025	4.02E -02	7.8
LYM 41	1183 4.3	M	3.318	9.59E -02	5.2	CON TRO L	—	o	0.023	—	0
LYM 21	1167 1.2	M	3.649	9.83E -02	15.7	LYM 181	1357 2.2	P	95.24 7	4.17E -02	1.9
CON TRO L	—	M	3.154	—	0	LYM 239	1304 4.9	P	95.31 7	9.21E -02	2
LYM 66	1195 4.4	N	0.311	2.80E -03	25.1	LYM 232	1302 3.6	P	93.97 6	9.43E -02	0.6
LYM 31	1192 3.1	N	0.302	5.66E -03	21.3	LYM 156	1296 3.5	P	94.45 2	9.56E -02	1.1
LYM 8	1198 2.4	N	0.301	5.78E -03	21.2	CON TRO L	—	P	93.44 1	—	0
LYM 17	1168 3.1	N	0.296	1.02E -02	18.9	LYM 255	1308 2.9	Q	34.41 5	9.06E -03	8.2
LYM 7	1159 4.3	N	0.284	4.39E -02	14	LYM 112	1337 2.3	Q	34.23	1.03E -02	7.6
LYM 57	1201 2.6	N	0.285	5.22E -02	14.6	LYM 196	1361 3.1	Q	33.73 5	3.50E -02	6.1
LYM 17	1168 4.5	N	0.277	8.28E -02	11.1	LYM 121	1321 1.8	Q	33.46	7.26E -02	5.2
LYM 13	1177 2.2	N	0.311	9.17E -02	25.1	LYM 287	1277 1.7	Q	33.23	7.99E -02	4.5
CON TRO L	—	N	0.249	—	0	LYM 56	1311 1.7	Q	33.21	8.34E -02	4.4
LYM 12	1187 2.1	O	0.024	1.60E -05	19.6	LYM 156	1296 3.3	Q	33.4	9.09E -02	5
LYM 22	1176 2.1	O	0.022	4.50E -05	13.3	LYM 238	1276 1.6	Q	34.2	9.81E -02	7.5
LYM 43	1179 2.2	o	0.026	4.80E -05	33.1	CON TRO L	—	Q	31.80 9	—	0
LYM 31	1192 3.4	o	0.022	1.05E -04	12.1
LYM 43	1179 1.2	o	0.022	1.77E -04	11.2
LYM 53	1184 1.1	o	0.022	3.43E -04	10

203

2018271407 30 Nov 2018

Gene name	Even t	ID	Mean	P value	% incr. vs. cont.	Gene name	Even t	ID	Mean	P value	% incr. vs. cont.
LYM 95	1212 1.3	O	0.026	3.71E -04	33.1
LYM 95	1212 1.2	o	0.023	3.96E -04	14.5
LYM 10	1174 4.1	o	0.023	2.55E -03	15.8
LYM 4	1170 2.1	o	0.021	3.43E -03	8.2
LYM 82	1220 4.6	o	0.021	4.85E -03	6.4
LYM 82	1220 4.2	o	0.021	6.10E -03	6.4
LYM 34	1190 4.3	o	0.021	6.18E -03	6.7
LYM 14	1205 4.2	o	0.021	1.02E -02	5.5
LYM 66	1195 4.4	o	0.023	3.15E -02	14.6
LYM 6	1173 4.3	o	0.024	6.98E -02	22.1
LYM 16	1162 3.2	o	0.023	7.55E -02	15.8
LYM 82	1220 1.1	o	0.024	9.20E -02	21.9
CON TRO L	—	o	0.02	—	0

Table 30. Results of the greenhouse experiments. Provided are the measured values of each tested parameter [parameters (ID.) A-P according to the parameters described in Table 29 above] in plants expressing the indicated polynucleotides. “Ev” = event; “P” = P-value; “Mean ” = the average of measured parameter across 5 replicates. % incr. vs. cont. = percentage of increase versus control (as compared to control).

Table 31

Measured parameters at the greenhouse till bolting assay (T2 experiment) for transformed agriculture improving trait genes

Tested Parameters	ID
Blade Relative Area TP4	A
Dry Weight (gr)	B
Fresh Weight (gr)	C
Leaf Blade Area TP4 (cm2)	D
Leaf Number TP4	E
Leaf Petiole Length TP4 (cm)	F
Petiole Relative Area TP4	G
Plot Coverage TP4 (cm2)	H
RGR Of Leaf Blade Area	J
RGR Of Leaf Number	K

204

2018271407 30 Nov 2018

Tested Parameters	ID
RGR Of Plot Coverage	L
RGR Of Rosette Area	M
RGR Of Rosette Diameter	N
Rosette Area TP4 (cm2)	O
Rosette Diameter TP4 (cm)	P

Table 31: Provided are the identification (ID) letters of each of the Tested

Parameters. TP4-time Point 4; RGR - Relative Growth Rate.

Table 32

Results obtained in a T2 experiment at the bolting assay

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM14	12052. 5	A	92.4 05	3.09E03	2.5	LYM31	11923. 4	F	0.48 9	1.69E04	26.4
LYM62	12022. 4	A	92.3 49	4.28E03	2.5	LYM11 6	13202. 12	F	0.47 9	5.48E04	23.8
LYM20	11712. 2	A	92.8 93	5.39E03	3.1	LYM23 8	12764. 8	F	0.45 9	1.64E03	18.6
LYM24	12064. 1	A	92.3 39	6.75E03	2.5	LYM20	11711. 2	F	0.45 8	1.80E03	18.5
LYM57	12012. 2	A	92.2 51	6.81E03	2.4	LYM67	11782. 6	F	0.45 5	2.14E03	17.7
LYM2	11695. 1	A	92.1 21	7.11E03	2.2	LYM88	12193. 1	F	0.49 4	2.43E03	27.7
LYM15	11612. 2	A	94.3 48	1.01E02	4.7	LYM99	12244. 2	F	0.45	3.75E03	16.4
LYM21	11672. 4	A	92.4 04	1.14E02	2.5	LYM23 9	13044. 8	F	0.44 1	9.74E03	13.9
LYM19	11751. 4	A	91.8 36	1.32E02	1.9	LYM24	12061. 4	F	0.43 5	1.27E02	12.5
LYM53	11844. 2	A	91.8 22	1.53E02	1.9	LYM53	11841. 1	F	0.43 4	1.43E02	12.2
LYM12	11871. 1	A	92.9 49	1.90E02	3.2	LYM82	12201. 1	F	0.45 4	1.47E02	17.4
LYM17	11683. 1	A	92.2 67	2.24E02	2.4	LYM26	11824. 1	F	0.46	3.65E02	18.9
LYM57	12012. 4	A	91.6 37	2.27E02	1.7	LYM30	11912. 6	F	0.43 3	4.15E02	12
LYM51	11891. 1	A	91.8 13	2.38E02	1.9	LYM26	11824. 3	F	0.43 6	4.37E02	12.7
LYM41	11832. 2	A	91.5 78	2.83E02	1.6	LYM28 5	12733. 9	F	0.51 8	4.87E02	34
LYM19	11753. 1	A	91.9 58	3.26E02	2.1	LYM62	12023. 2	F	0.44 5	6.80E02	15.1
LYM51	11893. 4	A	91.5 04	3.29E02	1.5	LYM99	12243. 2	F	0.41 8	7.28E02	7.9
LYM35	11812. 3	A	91.4 89	3.40E02	1.5	LYM12 8	12641. 5	F	0.54 6	8.57E02	41
LYM2	11695. 3	A	91.5 33	5.57E02	1.6	LYM95	12121. 2	F	0.51 2	1.12E01	32.3
LYM34	11903. 2	A	91.7 66	6.00E02	1.8	LYM66	11953. 6	F	0.42 7	1.18E01	10.3

205

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM37	11802. 2	A	92.4 9	7.93E02	2.6	LYM23 9	13042. 9	F	0.43 1	1.30E01	11.4
LYM10	11742. 2	A	91.5 36	7.98E02	1.6	LYM12	11872. 1	F	0.54 8	1.47E01	41.7
LYM31	11923. 4	A	91.4 74	8.92E02	1.5	LYM12 8	12641. 3	F	0.40 9	1.66E01	5.8
LYM30	11912. 7	A	91.1 22	9.52E02	1.1	LYM99	12243. 1	F	0.55 4	1.68E01	43.1
LYM9	11632. 1	A	91.3 52	1.07E01	1.4	LYM66	11954. 4	F	0.48 3	1.83E01	24.8
LYM26	11824. 6	A	91.0 76	1.19E01	1.1	LYM23 2	13024. 6	F	0.42	1.96E01	8.6
LYM57	12012. 6	A	91.0 44	1.24E01	1	LYM26	11824. 6	F	0.42 9	2.22E01	10.8
LYM16	11623. 2	A	92.1 18	1.47E01	2.2	LYM43	11791. 4	F	0.41	2.43E01	5.9
LYM69	11854. 2	A	92.1 15	1.61E01	2.2	LYM12	11873. 4	F	0.46 2	2.56E01	19.5
LYM57	12013. 1	A	91.8 86	1.66E01	2	LYM10 3	12713. 5	F	0.44 4	3.55E01	14.8
LYM15	11613. 3	A	91.9 04	1.68E01	2	LYM53	11842. 4	F	0.41 1	3.55E01	6.3
LYM20	11711. 3	A	91.6 69	1.89E01	1.7	LYM28 5	12734. 9	F	0.45 6	4.57E01	18
LYM41	11833. 1	A	91.3 84	1.92E01	1.4	LYM12	11871. 1	F	0.44 8	4.60E01	15.7
LYM67	11783. 5	A	91.0 23	1.94E01	1	LYM12 8	12641. 1	F	0.40 7	5.45E01	5.2
LYM22	11764. 1	A	90.8 53	2.00E01	0.8	LYM30	11913. 4	F	0.39 7	5.70E01	2.6
LYM69	11851. 2	A	91.7 4	2.05E01	1.8	LYM69	11852. 2	F	0.41 1	5.90E01	6.2
LYM66	11953. 1	A	92.2 57	2.06E01	2.4	LYM95	12124. 4	F	0.42 5	6.13E01	9.9
LYM26	11822. 5	A	91.0 28	2.12E01	1	LYM43	11793. 2	F	0.42 1	6.52E01	8.9
LYM30	11912. 6	A	90.8 41	2.14E01	0.8	LYM14	12051. 4	F	0.40 8	6.57E01	5.6
LYM31	11924. 4	A	91.9 21	2.30E01	2	LYM23 2	13024. 7	F	0.43 5	6.69E01	12.5
LYM4	11701. 1	A	91.7 54	2.39E01	1.8	LYM24	12064. 1	F	0.41 6	7.26E01	7.6
LYM14	12051. 4	A	90.8 3	2.43E01	0.8	LYM67	11782. 4	F	0.41 6	7.28E01	7.6
LYM67	11782. 6	A	91.4 69	2.52E01	1.5	LYM30	11913. 5	F	0.40 3	7.37E01	4.3
LYM62	12023. 2	A	91.7 52	2.52E01	1.8	LYM43	11791. 5	F	0.39 7	7.38E01	2.6
LYM57	12013. 5	A	91.6 99	2.60E01	1.8	LYM14 5	12951. 9	F	0.39 4	7.61E01	1.9
LYM68	11942. 2	A	90.9 59	2.62E01	0.9	LYM30	11912. 7	F	0.4	7.69E01	3.4

206

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM19	11752. 2	A	91.0 8	2.63E01	1.1	LYM31	11924. 4	F	0.40 7	7.75E01	5.2
LYM44	11884. 1	A	91.1 09	2.88E01	1.1	LYM99	12244. 1	F	0.40 2	7.94E01	3.8
LYM53	11841. 1	A	92.2 8	2.88E01	2.4	LYM26	11824. 5	F	0.40 6	8.37E01	5
LYM69	11852. 2	A	91.9 59	2.91E01	2.1	LYM20	11716. 5	F	0.39 5	8.66E01	2.1
LYM31	11923. 1	A	90.8 76	2.91E01	0.9	LYM66	11955. 2	F	0.39 2	8.71E01	1.4
LYM66	11955. 2	A	92.7 03	2.94E01	2.9	LYM53	11843. 2	F	0.39 4	8.94E01	1.8
LYM1	11603. 2	A	92.0 51	3.02E01	2.2	LYM23 2	13024. 4	F	0.39 7	9.29E01	2.6
LYM41	11831. 5	A	91.8 26	3.07E01	1.9	LYM15 6	12963. 1	F	0.38 9	9.65E01	0.6
LYM20	11711. 2	A	90.8 81	3.47E01	0.9	LYM88	12194. 2	F	0.38 7	9.95E01	0.1
LYM13	11771. 6	A	90.6 5	3.62E01	0.6	CONTR OL	—	F	0.38 7	—	0
LYM67	11781. 5	A	90.9 95	3.69E01	1	LYM88	12193. 1	G	8.06 6	2.50E05	25.2
LYM2	11691. 2	A	91.3 85	3.77E01	1.4	LYM23 2	13024. 4	G	7.58 9	2.58E04	17.8
LYM30	11913. 4	A	90.8 53	3.81E01	0.8	LYM99	12244. 2	G	7.54 9	3.29E04	17.2
LYM1	11601. 1	A	90.8 59	3.94E01	0.8	LYM88	12191. 2	G	7.73 6	2.37E03	20.1
LYM10	11741. 2	A	91.0 19	3.97E01	1	LYM62	12023. 2	G	7.93 2	2.88E03	23.1
LYM24	12061. 1	A	91.6 43	3.97E01	1.7	LYM30	11912. 6	G	7.21 5	4.09E03	12
LYM13	11772. 1	A	91.7 42	4.02E01	1.8	LYM12 8	12641. 5	G	7.22 8	5.32E03	12.2
LYM14	12051. 1	A	90.7 81	4.03E01	0.7	LYM11 6	13204. 4	G	7.07 5	8.47E03	9.8
LYM4	11705. 2	A	92.1 32	4.20E01	2.2	LYM82	12201. 1	G	7.08 4	8.81E03	9.9
LYM17	11682. 1	A	92.4 67	4.22E01	2.6	LYM69	11852. 2	G	7.05 5	9.96E03	9.5
LYM1	11604. 4	A	91.8 03	4.50E01	1.9	LYM66	11953. 1	G	7.11 8	1.07E02	10.5
LYM8	11982. 4	A	91.7 23	4.54E01	1.8	LYM53	11844. 2	G	7.00 5	1.48E02	8.7
LYM34	11902. 2	A	91.3 34	4.56E01	1.4	LYM57	12012. 6	G	7.01 4	1.54E02	8.9
LYM43	11793. 2	A	91.5 34	4.59E01	1.6	LYM23 8	12764. 8	G	7.25 1	2.21E02	12.5
LYM51	11894. 2	A	91.5 83	4.61E01	1.6	LYM31	11921. 3	G	6.95 5	2.21E02	7.9
LYM21	11674. 5	A	90.7 03	4.62E01	0.7	LYM30	11913. 5	G	7.74 2	2.81E02	20.2

207

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM69	11853. 4	A	91.0 48	5.05E01	1	LYM43	11791. 5	G	7.09 3	2.87E02	10.1
LYM12	11874. 1	A	90.8 63	5.30E01	0.8	LYM53	11842. 4	G	7.51 7	3.17E- 02	16.7
LYM44	11885. 3	A	91.4 11	5.42E01	1.4	LYM99	12244. 1	G	6.95 2	3.21E- 02	7.9
LYM12	11872. 1	A	91.4 94	5.47E01	1.5	LYM15 6	12963. 1	G	6.88 6	3.95E02	6.9
LYM9	11633. 7	A	90.8 19	5.50E01	0.8	LYM41	11831. 1	G	7	4.82E02	8.6
LYM13	11772. 2	A	91.5 48	5.65E01	1.6	LYM31	11923. 4	G	7.55 1	4.93E02	17.2
LYM34	11903. 3	A	91.3 19	5.74E01	1.3	LYM27 1	12724. 9	G	6.86 4	5.02E02	6.5
LYM67	11782. 5	A	90.9 78	5.82E01	1	LYM95	12124. 4	G	6.87 3	5.19E- 02	6.7
LYM51	11893. 2	A	90.8 2	5.94E01	0.8	LYM82	12204. 2	G	7.05 2	1.10E- 01	9.4
LYM15	11611. 3	A	90.3 87	6.12E- 01	0.3	LYM12 5	12932. 6	G	6.75 2	1.22E- 01	4.8
LYM12	11874. 3	A	90.4 71	6.22E01	0.4	LYM12	11872. 1	G	7.49 9	1.25E- 01	16.4
LYM13	11771. 9	A	90.4 21	6.27E01	0.3	LYM12 1	13214. 5	G	6.73 7	1.37E- 01	4.6
LYM62	12022. 2	A	90.9 02	6.52E01	0.9	LYM23 9	13042. 9	G	6.75	1.43E- 01	4.8
LYM41	11834. 2	A	90.9 79	6.83E01	1	LYM66	11954. 4	G	6.90 2	1.52E- 01	7.1
LYM19	11751. 5	A	91.1 21	6.90E01	1.1	LYM51	11894. 2	G	7.54	1.56E- 01	17
LYM35	11813. 5	A	90.6 06	7.22E01	0.6	LYM28 5	12734. 9	G	8.17 9	1.81E- 01	26.9
LYM22	11762. 2	A	90.4 75	7.23E01	0.4	LYM12 8	12641. 4	G	6.70 2	1.87E- 01	4
LYM16	11622. 4	A	90.5 91	7.35E01	0.5	LYM57	12012. 4	G	6.72 5	1.88E- 01	4.4
LYM67	11783. 4	A	90.5 78	7.36E01	0.5	LYM14	12052. 5	G	7.47 2	1.90E- 01	16
LYM17	11684. 4	A	90.5 39	7.37E01	0.5	LYM23 9	13044. 8	G	7.08 7	1.96E- 01	10
LYM41	11831. 1	A	90.5 19	7.60E01	0.5	LYM43	11791. 4	G	8.56 7	2.01E01	33
LYM9	11633. 2	A	90.3 43	7.61E- 01	0.3	LYM12 1	13212. 6	G	7.74 6	2.15E01	20.2
LYM14	12052. 4	A	90.5 86	7.64E01	0.5	LYM99	12243. 1	G	7.93 5	2.19E01	23.1
LYM43	11792. 2	A	90.6 7	7.75E01	0.6	LYM62	12022. 4	G	7.20 9	2.28E01	11.9
LYM66	11953. 6	A	90.6 49	7.76E01	0.6	LYM56	13112. 6	G	7.56 7	2.56E01	17.4
LYM20	11716. 5	A	90.5 96	7.79E01	0.5	LYM14	12054. 2	G	7.74 7	2.74E01	20.2

208

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM37	11803. 1	A	90.3 46	8.10E01	0.3	LYM69	11853. 4	G	7.20 1	3.46E01	11.8
LYM30	11913. 5	A	90.5 39	8.10E01	0.5	LYM12	11873. 4	G	8.01 6	3.55E01	24.4
LYM21	11673. 1	A	90.5 85	8.23E01	0.5	LYM51	11891. 1	G	7.38 6	3.60E01	14.6
LYM17	11684. 5	A	90.7 47	8.33E01	0.7	LYM95	12121. 2	G	6.91 2	3.61E01	7.3
LYM34	11904. 3	A	90.4 07	8.52E01	0.3	LYM14 5	12952. 9	G	7.17	3.74E01	11.3
LYM24	12063. 3	A	90.6 82	8.56E01	0.6	LYM28 4	12884. 7	G	6.91	3.81E01	7.2
LYM2	11692. 3	A	90.2 03	8.71E01	0.1	LYM53	11841. 2	G	7.39	3.85E01	14.7
LYM24	12062. 3	A	90.6	8.81E01	0.5	LYM23 8	12762. 8	G	7.07 5	3.94E01	9.8
LYM22	11762. 1	A	90.2 01	8.83E01	0.1	LYM62	12022. 1	G	7.52 5	3.95E01	16.8
LYM37	11803. 2	A	90.2 44	9.04E01	0.2	LYM43	11791. 2	G	7.70 3	4.20E01	19.5
LYM62	12022. 1	A	90.2 33	9.15E01	0.1	LYM51	11893. 4	G	7.27 2	4.52E01	12.9
LYM51	11892. 1	A	90.1 54	9.39E01	0.1	LYM15 6	12961. 9	G	6.67 7	4.65E01	3.6
LYM10	11744. 1	A	90.1 87	9.50E01	0.1	LYM31	11922. 3	G	6.66 1	4.71E01	3.4
LYM68	11941. 4	A	90.1 63	9.56E01	0.1	LYM43	11793. 2	G	7.39 3	4.87E01	14.7
LYM17	11683. 3	A	90.1 95	9.65E01	0.1	LYM23 2	13024. 6	G	6.59 6	4.89E01	2.4
LYM9	11632. 2	A	90.1 28	9.71E01	0	LYM23 2	13024. 5	G	6.73 2	4.92E01	4.5
LYM19	11754. 1	A	90.1 18	9.95E01	0	LYM14 5	12954. 7	G	6.58	4.97E01	2.1
CONTR OL	—	A	90.1 08	—	0	LYM41	11833. 1	G	6.86 5	5.04E01	6.5
LYM14	12051. 4	B	0.21 1	5.89E03	26.4	LYM12 8	12641. 1	G	6.79 6	5.07E01	5.5
LYM10	11744. 1	B	0.2	1.92E02	20	LYM14	12051. 1	G	6.80 8	5.14E01	5.7
LYM34	11902. 2	B	0.19 2	6.57E02	15.1	LYM53	11841. 1	G	6.94 7	5.15E01	7.8
LYM9	11632. 1	B	0.19 1	7.00E02	14.4	LYM88	12194. 2	G	6.86 4	5.26E01	6.5
LYM2	11695. 1	B	0.18 8	1.04E01	12.5	LYM24	12061. 4	G	6.84 2	5.31E01	6.2
LYM57	12013. 1	B	0.18 8	1.04E01	12.5	LYM62	12023. 4	G	7.30 8	5.31E01	13.4
LYM66	11954. 4	B	0.19 1	1.36E01	14.4	LYM51	11893. 2	G	6.68 9	5.34E01	3.8
LYM57	12012. 4	B	0.19 1	1.42E01	14.7	LYM57	12012. 2	G	6.68 6	5.42E01	3.8

209

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM66	11953. 6	B	0.18 6	1.65E- 01	11.7	LYM30	11912. 7	G	6.94 9	5.55E01	7.8
LYM37	11803. 1	B	0.18 3	1.75E- 01	10.1	LYM66	11953. 6	G	6.63 2	5.60E01	2.9
LYM53	11844. 2	B	0.18 4	1.80E- 01	10.2	LYM53	11843. 2	G	6.95 9	5.75E01	8
LYM9	11632. 2	B	0.18 6	1.90E- 01	11.4	LYM56	13111. 7	G	7.26 8	5.80E01	12.8
LYM35	11812. 3	B	0.18 9	2.46E01	13.2	LYM67	11783. 5	G	6.72 4	5.88E01	4.4
LYM4	11701. 1	B	0.18 4	2.47E01	10.2	LYM95	12124. 5	G	6.84 9	6.12E- 01	6.3
LYM31	11924. 4	B	0.18 1	2.72E01	8.4	LYM31	11924. 4	G	6.59 7	6.17E- 01	2.4
LYM35	11813. 5	B	0.21 9	2.93E01	31.2	LYM41	11832. 2	G	6.53 3	6.27E01	1.4
LYM57	12012. 6	B	0.18 7	2.98E01	12.1	LYM51	11892. 1	G	6.97 8	6.31E- 01	8.3
LYM1	11604. 4	B	0.18 4	3.17E- 01	10.6	LYM43	11792. 2	G	6.78 2	6.47E01	5.2
LYM14	12051. 1	B	0.18	3.27E01	8	LYM28 5	12734. 7	G	7.28 4	6.55E01	13
LYM30	11912. 6	B	0.19 1	3.85E01	14.3	LYM27 1	12721. 8	G	6.63 7	6.59E01	3
LYM13	11771. 6	B	0.20 8	4.16E01	24.9	LYM30	11913. 4	G	7.07	6.73E01	9.7
LYM13	11771. 9	B	0.19 2	4.37E01	15.1	LYM31	11923. 1	G	6.85 4	6.88E01	6.4
LYM31	11923. 1	B	0.17 6	4.57E01	5.4	LYM82	12203. 2	G	6.63 5	7.11E- 01	3
LYM67	11783. 5	B	0.17 8	4.69E01	6.9	LYM20	11716. 3	G	6.74	7.14E- 01	4.6
LYM10	11741. 2	B	0.17 7	5.16E- 01	6.1	LYM23 9	13041. 7	G	6.70 9	7.58E01	4.1
LYM21	11673. 1	B	0.17 6	5.27E01	5.7	LYM24	12064. 1	G	6.57 3	7.64E01	2
LYM69	11851. 2	B	0.17 8	5.36E01	6.5	LYM23 9	13044. 7	G	6.62 9	7.70E01	2.9
LYM69	11852. 2	B	0.17 9	5.45E01	7.6	LYM88	12193. 5	G	6.59 5	7.72E01	2.4
LYM1	11603. 2	B	0.17 3	6.15E- 01	3.5	LYM20	11712. 2	G	6.61 6	7.87E01	2.7
LYM7	11594. 2	B	0.18 4	6.18E- 01	10.2	LYM62	12022. 2	G	6.61 2	7.91E01	2.6
LYM34	11903. 2	B	0.18 8	6.33E01	12.9	LYM67	11782. 6	G	6.50 9	7.99E01	1
LYM21	11674. 5	B	0.17 2	6.73E01	3.1	LYM20	11716. 5	G	6.54 1	8.15E- 01	1.5
LYM68	11942. 3	B	0.17 6	6.91E- 01	5.7	LYM23 2	13024. 7	G	6.66 3	8.27E01	3.4
LYM14	12054. 2	B	0.17 6	7.18E- 01	5.4	LYM26	11824. 1	G	6.55 8	8.57E01	1.8

210

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM30	11913. 4	B	0.17 6	7.18E01	5.4	LYM99	12243. 2	G	6.51 2	8.64E01	1.1
LYM51	11893. 2	B	0.17 1	7.40E01	2.4	LYM12 1	13211. 8	G	6.51 1	8.82E01	1
LYM53	11842. 4	B	0.18 2	7.45E01	9.1	LYM99	12241. 1	G	6.50 3	8.85E01	0.9
LYM44	11884. 3	B	0.17 1	8.45E01	2.4	LYM14	12051. 4	G	6.46 8	8.96E01	0.4
LYM17	11683. 3	B	0.16 9	8.75E01	1.2	LYM67	11782. 4	G	6.53 6	9.09E01	1.4
LYM15	11611. 3	B	0.16 8	9.01E01	0.9	LYM26	11824. 5	G	6.46 9	9.55E01	0.4
LYM8	11982. 7	B	0.16 9	9.10E01	1.2	LYM26	11824. 3	G	6.47 5	9.58E01	0.5
LYM12	11872. 1	B	0.16 9	9.21E01	1.6	LYM95	12121. 4	G	6.45 8	9.88E01	0.2
LYM51	11893. 4	B	0.16 9	9.25E01	1.6	LYM24	12062. 3	G	6.45 7	9.90E01	0.2
LYM34	11903. 3	B	0.16 8	9.59E01	0.5	LYM23 9	13041. 1	G	6.44 8	9.93E01	0.1
LYM7	11592. 1	B	0.16 8	9.67E01	0.5	LYM12	11871. 1	G	6.44 5	9.94E01	0
CONTR OL	—	B	0.16 7	—	0	CONTR OL	—	G	6.44 4	—	0
LYM10	11744. 1	C	2.88 1	4.60E03	21	LYM11 6	13202. 12	H	18.3 12	4.00E06	47.5
LYM35	11813. 5	C	2.85	6.51E03	19.7	LYM88	12193. 1	H	15.6 81	1.86E04	26.3
LYM9	11632. 1	C	2.85	6.67E03	19.7	LYM31	11923. 4	H	14.8 37	1.11E03	19.5
LYM57	12013. 1	C	2.73 8	2.45E02	15	LYM20	11711. 2	H	17.1 26	1.79E03	38
LYM9	11633. 7	C	2.71 3	3.07E02	13.9	LYM53	11841. 1	H	15.6 41	2.39E03	26
LYM35	11812. 3	C	2.68 1	6.94E02	12.6	LYM67	11782. 6	H	16.7 73	4.00E03	35.1
LYM66	11953. 6	C	2.60 6	1.11E01	9.5	LYM82	12201. 1	H	14.9 07	1.38E02	20.1
LYM14	12051. 4	C	2.78 8	2.12E01	17.1	LYM12	11871. 3	H	14.0 33	1.64E02	13.1
LYM57	12012. 4	C	2.55	2.56E01	7.1	LYM26	11824. 3	H	15.3 54	2.22E02	23.7
LYM13	11771. 9	C	2.69 4	2.59E01	13.2	LYM23 8	12764. 8	H	15.5 39	2.58E02	25.2
LYM1	11603. 2	C	2.55	2.80E01	7.1	LYM88	12194. 2	H	13.6 39	3.29E02	9.9
LYM66	11954. 4	C	2.52 5	3.28E01	6.1	LYM99	12244. 2	H	14.0 55	4.42E02	13.2
LYM68	11942. 2	C	2.49 4	4.00E01	4.8	LYM53	11843. 2	H	13.7 52	6.09E02	10.8
LYM30	11912. 6	C	2.66 2	4.05E01	11.8	LYM12 8	12641. 5	H	19.0 1	6.58E02	53.2

211

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM57	12012. 6	C	2.81 3	4.19E01	18.1	LYM99	12243. 1	H	18.3	8.16E02	47.4
LYM34	11902. 2	c	2.68 1	4.48E01	12.6	LYM26	11824. 1	H	16.7 06	8.96E02	34.6
LYM51	11893. 4	c	2.55 6	4.54E01	7.4	LYM12 8	12641. 3	H	16.7 7	9.41E02	35.1
LYM2	11695. 1	c	2.53 8	5.35E01	6.6	LYM23 9	13042. 9	H	15.3 16	1.28E- 01	23.4
LYM69	11851. 2	c	2.65	5.41E- 01	11.3	LYM26	11824. 6	H	15.6 43	1.64E- 01	26
LYM13	11771. 6	c	2.52 5	5.65E01	6.1	LYM28 5	12733. 9	H	18.9 28	1.66E- 01	52.5
LYM53	11844. 2	c	2.61 9	5.75E01	10	LYM20	11716. 5	H	13.6 67	1.68E- 01	10.1
LYM16	11623. 2	c	2.45 6	6.08E01	3.2	LYM24	12061. 4	H	15.8 75	1.72E- 01	27.9
LYM24	12061. 2	c	2.45	6.15E- 01	2.9	LYM30	11912. 7	H	13.1 13	1.73E- 01	5.7
LYM1	11604. 4	c	2.50 6	6.22E01	5.3	LYM11 6	13202. 7	H	14.5 2	1.78E- 01	17
LYM14	12051. 1	c	2.47 5	6.44E01	4	LYM10 3	12713. 5	H	16.2 34	1.81E- 01	30.8
LYM31	11924. 4	c	2.45 6	6.45E01	3.2	LYM66	11954. 4	H	16.5 04	1.98E- 01	33
LYM7	11594. 2	c	2.51 9	6.45E01	5.8	LYM66	11953. 6	H	13.0 82	2.10E01	5.4
LYM34	11903. 2	c	2.52 5	6.69E01	6.1	LYM12	11872. 1	H	19.1 53	2.18E01	54.3
LYM67	11783. 5	c	2.56 3	7.21E- 01	7.6	LYM95	12124. 4	H	14.5 08	2.21E01	16.9
LYM68	11942. 3	c	2.56 9	7.32E01	7.9	LYM66	11955. 2	H	14.1 24	2.35E01	13.8
LYM53	11842. 4	c	2.58 1	7.49E01	8.4	LYM31	11924. 4	H	14.2 78	2.42E01	15
LYM17	11683. 3	c	2.40 6	8.49E01	1.1	LYM95	12121. 2	H	17.1 35	3.06E01	38.1
LYM30	11913. 4	c	2.45 6	8.69E01	3.2	LYM69	11852. 2	H	14.5 17	3.11E- 01	17
LYM69	11852. 2	c	2.42 5	8.75E01	1.9	LYM14	12051. 4	H	14.2 54	3.15E- 01	14.8
LYM51	11891. 1	c	2.43 8	8.88E01	2.4	LYM12	11871. 1	H	16.2 36	3.18E- 01	30.8
LYM44	11884. 3	c	2.41 3	9.00E01	1.3	LYM43	11791. 4	H	13.3 52	3.60E01	7.6
LYM1	11602. 6	c	2.38 8	9.61E01	0.3	LYM10 3	12712. 8	H	14.0 75	4.03E01	13.4
LYM8	11982. 7	c	2.39 4	9.68E01	0.6	LYM23 9	13044. 8	H	13.8 81	4.35E01	11.8
LYM14	12054. 2	c	2.38 8	9.72E01	0.3	LYM62	12023. 2	H	13.4 79	4.46E01	8.6
LYM10	11741. 2	c	2.38 8	9.76E01	0.3	LYM23 2	13024. 6	H	13.4 9	4.54E01	8.7

212

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM9	11632. 2	C	2.38 1	9.97E01	0	LYM67	11782. 4	H	14.2 03	4.80E01	14.4
CONTR OL	—	c	2.38 1	—	0	LYM30	11912. 6	H	13.8 85	4.95E01	11.9
LYM9	11632. 1	D	0.63	7.73E04	26.2	LYM15 6	12963. 1	H	13.6 92	5.55E01	10.3
LYM57	12013. 1	D	0.60 4	2.91E03	21.1	LYM23 2	13024. 7	H	15.4 09	5.68E01	24.1
LYM30	11912. 6	D	0.59	6.70E03	18.3	LYM43	11791. 5	H	12.7 38	5.74E01	2.6
LYM35	11812. 3	D	0.57 4	1.51E02	15.1	LYM99	12243. 2	H	13.0 41	5.75E01	5.1
LYM9	11633. 7	D	0.56 4	7.87E02	13	LYM12 8	12641. 1	H	13.4 74	6.12E01	8.6
LYM10	11744. 1	D	0.58	9.91E02	16.2	LYM12	11873. 4	H	12.8 38	6.27E01	3.4
LYM10	11741. 2	D	0.54 4	9.99E02	9.1	LYM26	11824. 5	H	14.9 28	6.29E01	20.3
LYM57	12012. 4	D	0.54 1	1.20E01	8.5	LYM10 3	12711. 8	H	12.7 5	6.58E01	2.7
LYM31	11924. 4	D	0.56 7	1.79E01	13.5	LYM24	12064. 1	H	13.6 85	6.61E01	10.3
LYM1	11602. 6	D	0.54 1	1.97E01	8.5	LYM26	11821. 2	H	13.6 51	6.78E01	10
LYM1	11603. 2	D	0.58 1	2.09E01	16.4	LYM11 6	13204. 4	H	14.2 29	7.49E01	14.6
LYM51	11891. 1	D	0.54 3	2.39E01	8.7	LYM43	11793. 2	H	13.0 44	8.21E01	5.1
LYM13	11771. 9	D	0.53 8	2.66E01	7.8	LYM14 5	12951. 9	H	12.4 89	8.72E01	0.6
LYM53	11842. 4	D	0.58 6	3.05E01	17.5	LYM30	11913. 5	H	12.8 46	8.73E01	3.5
LYM35	11813. 5	D	0.55 8	3.13E01	11.8	LYM30	11913. 4	H	12.6 58	8.85E01	2
LYM13	11771. 6	D	0.52 4	3.24E01	5	LYM62	12023. 5	H	12.4 88	8.95E01	0.6
LYM14	12051. 4	D	0.56 5	3.33E01	13.3	LYM28 5	12734. 9	H	12.5 63	9.45E01	1.2
LYM69	11852. 2	D	0.53 3	3.41E01	6.8	LYM10 3	12712. 5	H	12.4 58	9.73E01	0.4
LYM66	11953. 6	D	0.53 6	3.86E01	7.4	CONTR OL	—	H	12.4 12	—	0
LYM57	12012. 6	D	0.60 1	3.94E01	20.5	LYM12	11872. 1	J	0.05	1.96E04	59.7
LYM1	11604. 4	D	0.59 1	4.48E01	18.5	LYM11 6	13202. 12	J	0.04 6	3.31E04	47.1
LYM14	12051. 1	D	0.54	4.53E01	8.3	LYM20	11711. 2	J	0.04 5	6.36E04	44.3
LYM34	11902. 2	D	0.56 2	4.60E01	12.6	LYM12 8	12641. 5	J	0.04 4	7.56E04	40.5
LYM2	11695. 1	D	0.54 2	4.83E01	8.6	LYM28 5	12733. 9	J	0.04 5	1.31E03	43.5

213

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM31	11923. 4	D	0.54 6	5.90E01	9.3	LYM23 8	12764. 8	J	0.04 2	4.59E03	34.9
LYM69	11851. 2	D	0.51 6	6.13E- 01	3.3	LYM26	11824. 1	J	0.04 2	7.07E03	33.7
LYM12	11872. 1	D	0.53	6.82E01	6.2	LYM23 9	13042. 9	J	0.04 1	8.56E03	31.8
LYM7	11594. 2	D	0.53	6.83E01	6.2	LYM10 3	12713. 5	J	0.04 2	9.55E03	34
LYM21	11674. 5	D	0.51	6.94E01	2.3	LYM99	12243. 1	J	0.03 9	1.57E02	26.4
LYM68	11942. 3	D	0.53 8	7.30E01	7.7	LYM12	11871. 1	J	0.04 1	1.61E02	31
LYM53	11844. 2	D	0.50 8	7.44E01	1.7	LYM67	11782. 6	J	0.04	1.77E02	28.2
LYM35	11811. 3	D	0.52 9	7.70E01	6.1	LYM11 6	13202. 7	J	0.04	2.12E02	28.6
LYM24	12061. 2	D	0.50 8	7.91E01	1.9	LYM24	12061. 4	J	0.04	2.32E02	28.1
LYM51	11893. 4	D	0.51 3	8.07E01	2.9	LYM26	11824. 6	J	0.03 9	2.72E02	25.9
LYM34	11903. 2	D	0.53 5	8.16E- 01	7.1	LYM12 8	12641. 3	J	0.03 9	3.65E02	25.4
LYM1	11601. 1	D	0.51 5	8.25E01	3.2	LYM26	11824. 3	J	0.03 9	4.30E02	23.4
LYM30	11913. 4	D	0.50 7	9.38E01	1.6	LYM66	11954. 4	J	0.03 8	4.56E02	22.5
LYM43	11791. 4	D	0.5	9.64E01	0.2	LYM10 3	12712. 8	J	0.03 8	5.16E- 02	22.9
CONTR OL	—	D	0.49 9	—	0	LYM95	12121. 2	J	0.03 9	5.69E02	23.8
LYM35	11811. 3	E	10	1.23E02	7.1	LYM24	12064. 1	J	0.03 9	6.86E02	23.9
LYM10	11744. 1	E	10.3 13	2.53E02	10.4	LYM23 2	13024. 7	J	0.04	8.05E02	28.4
LYM30	11912. 6	E	9.85 7	8.06E02	5.6	LYM23 2	13024. 6	J	0.03 8	8.34E02	20.4
LYM34	11902. 2	E	9.75	1.25E01	4.4	LYM14	12051. 4	J	0.03 7	9.99E02	19.7
LYM69	11851. 2	E	9.68 8	1.30E01	3.8	LYM12	11871. 3	J	0.03 7	1.14E01	18.1
LYM69	11852. 2	E	10.1 88	1.53E01	9.1	LYM30	11912. 6	J	0.03 7	1.23E01	18.6
LYM9	11632. 1	E	10.1 25	2.33E01	8.4	LYM23 9	13044. 8	J	0.03 7	1.34E01	17.6
LYM1	11604. 4	E	9.62 5	2.62E01	3.1	LYM31	11924. 4	J	0.03 6	1.64E01	15.9
LYM13	11772. 1	E	9.56 3	3.10E- 01	2.4	LYM15 6	12963. 1	J	0.03 6	1.70E- 01	15.9
LYM12	11872. 1	E	9.5	4.38E01	1.7	LYM23 8	12763. 7	J	0.03 6	1.78E- 01	14.5
LYM26	11824. 6	E	9.62 5	4.45E01	3.1	LYM53	11841. 1	J	0.03 6	1.78E- 01	14.9

214

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM 13	11771. 9	E	9.68 8	4.47E01	3.8	LYM 11 6	13204. 4	J	0.03 8	1.81E01	22.8
LYM 14	12051. 4	E	9.75	4.53E01	4.4	LYM20	11716. 5	J	0.03 6	1.95E01	14.5
LYM37	11801. 1	E	9.56 3	4.57E01	2.4	LYM26	11821. 2	J	0.03 6	2.34E01	14.6
LYM9	11633. 7	E	9.56 3	4.57E01	2.4	LYM26	11824. 5	J	0.03 7	2.36E01	17.1
LYM35	11812. 3	E	9.81 3	4.59E01	5.1	LYM 12 8	12641. 1	J	0.03 5	3.24E01	11.7
LYM 14	12054. 2	E	9.5	5.11E01	1.7	LYM31	11923. 4	J	0.03 5	3.32E01	10.6
LYM53	11842. 4	E	9.81 3	5.48E01	5.1	LYM53	11843. 2	J	0.03 4	3.70E01	9.8
LYM21	11674. 5	E	9.75	6.27E01	4.4	LYM69	11852. 2	J	0.03 4	3.93E01	9.1
LYM1	11601. 1	E	9.43 8	6.42E01	1.1	LYM67	11782. 4	J	0.03 4	4.05E01	9
LYM 14	12051. 1	E	9.43 8	6.42E01	1.1	LYM 10 3	12712. 5	J	0.03 4	4.13E01	9.1
LYM 15	11611. 3	E	9.43 8	6.42E01	1.1	LYM30	11913. 5	J	0.03 4	4.32E01	9.6
LYM53	11844. 2	E	9.43 8	6.42E01	1.1	LYM88	12193. 1	J	0.03 4	4.41E01	8.1
LYM35	11811. 2	E	9.5	6.51E01	1.7	LYM 10 3	12711. 8	J	0.03 4	4.68E01	7.8
LYM37	11803. 2	E	9.5	6.51E01	1.7	LYM99	12244. 2	J	0.03 4	4.71E01	7.7
LYM30	11913. 4	E	9.75	6.79E01	4.4	LYM95	12124. 4	J	0.03 4	4.71E01	7.6
LYM34	11903. 2	E	9.43 8	7.32E01	1.1	LYM31	11921. 3	J	0.03 3	5.04E01	7.3
LYM 19	11751. 4	E	9.5	7.45E01	1.7	LYM66	11955. 2	J	0.03 3	5.27E01	6.6
LYM1	11602. 6	E	9.37 5	8.76E01	0.4	LYM30	11912. 7	J	0.03 3	5.60E01	6.4
LYM57	12012. 6	E	9.43 8	8.89E01	1.1	LYM62	12023. 2	J	0.03 3	5.61E01	6.2
LYM51	11891. 1	E	9.37 5	9.39E01	0.4	LYM20	11716. 3	J	0.03 3	5.84E01	6.4
CONTR OL	—	E	9.33 7	—	0	LYM30	11913. 4	J	0.03 3	6.20E01	5.8
LYM57	12012. 4	F	0.80 6	7.51E02	8.8	LYM23 8	12762. 8	J	0.03 3	6.21E01	5.6
LYM35	11811. 3	F	0.83	2.97E01	12.1	LYM23 8	12763. 5	J	0.03 3	6.27E01	5.3
LYM53	11842. 4	F	0.78 7	3.26E01	6.2	LYM 15 6	12961. 9	J	0.03 3	6.33E01	5.1
LYM 14	12051. 4	F	0.84 6	3.32E01	14.3	LYM57	12012. 2	J	0.03 3	6.41E01	5.1
LYM35	11813. 5	F	0.77 7	3.52E01	4.9	LYM 14 5	12951. 9	J	0.03 3	6.87E01	4.4

215

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM68	11942. 3	F	0.78 6	3.74E01	6.2	LYM 12	11873. 4	J	0.03 2	7.45E01	3.6
LYM30	11912. 6	F	0.80 5	4.37E01	8.6	LYM20	11712. 2	J	0.03 2	7.62E01	3.5
LYM51	11891. 1	F	0.76 4	4.68E01	3.1	LYM41	11831. 5	J	0.03 2	7.96E01	2.8
LYM9	11632. 1	F	0.76 9	5.87E01	3.8	LYM 10 3	12714. 6	J	0.03 2	8.74E01	1.9
LYM9	11633. 7	F	0.76	5.93E01	2.6	LYM28 5	12734. 9	J	0.03 2	8.76E01	1.8
LYM 13	11771. 6	F	0.76 1	6.04E01	2.7	LYM23 9	13044. 7	J	0.03 2	9.02E01	1.4
LYM 13	11771. 9	F	0.76	6.32E01	2.7	LYM82	12201. 1	J	0.03 2	9.28E01	0.9
LYM37	11801. 1	F	0.75 8	6.33E01	2.3	LYM66	11953. 6	J	0.03 1	9.36E01	0.8
LYM7	11594. 2	F	0.75 9	6.93E01	2.5	LYM23 8	12761. 6	J	0.03 1	9.94E01	0.1
LYM57	12012. 6	F	0.76 1	7.81E01	2.8	LYM24	12062. 3	J	0.03 1	9.97E01	0
LYM57	12013. 1	F	0.75 9	8.06E01	2.5	CONTR OL	—	J	0.03 1	—	0
LYM35	11811. 2	F	0.75	8.65E01	1.2	LYM26	11824. 3	K	0.68 6	7.37E03	43.8
LYM 14	12051. 1	F	0.74 8	8.75E01	0.9	LYM69	11852. 2	K	0.65 9	2.22E02	38.2
LYM 10	11744. 1	F	0.74 7	8.99E01	0.9	LYM 12 8	12641. 1	K	0.64 1	3.49E02	34.5
LYM34	11903. 2	F	0.75 7	9.24E01	2.2	LYM95	12121. 2	K	0.64 1	3.71E02	34.4
LYM1	11604. 4	F	0.74 5	9.30E01	0.5	LYM24	12061. 4	K	0.63 3	4.62E02	32.8
CONTR OL	—	F	0.74 1	—	0	LYM 14	12051. 4	K	0.62 7	5.47E02	31.5
LYM37	11801. 1	G	11.9 78	9.54E04	26.2	LYM 12 8	12642. 1	K	0.63 5	5.90E02	33.2
LYM 19	11754. 1	G	10.5 3	1.26E01	11	LYM 12 8	12641. 5	K	0.62 3	7.60E02	30.6
LYM35	11813. 5	G	10.2 83	1.29E01	8.4	LYM 11 6	13202. 12	K	0.60 3	8.80E02	26.5
LYM9	11633. 2	G	10.2 94	1.30E01	8.5	LYM23 8	12764. 8	K	0.60 8	8.89E02	27.5
LYM68	11942. 3	G	10.1 96	1.75E01	7.4	LYM30	11912. 6	K	0.60 5	9.08E02	26.8
LYM4	11706. 5	G	10.3 3	2.38E01	8.8	LYM27 7	13103. 1	K	0.60 2	9.87E02	26.1
LYM35	11811. 3	G	10.9 31	2.53E01	15.2	LYM26	11824. 1	K	0.59 5	1.15E01	24.7
LYM 19	11752. 2	G	10.0 07	3.09E01	5.5	LYM28 5	12733. 9	K	0.59 7	1.19E01	25.2
LYM22	11761. 3	G	10.1 19	3.11E01	6.6	LYM43	11791. 4	K	0.59 6	1.21E01	25

216

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM37	11801. 2	G	10.8 59	3.30E01	14.4	LYM62	12023. 5	K	0.59 3	1.29E01	24.3
LYM43	11791. 4	G	10.4 73	3.51E01	10.4	LYM 12	11873. 4	K	0.59 2	1.35E01	24.2
LYM43	11791. 5	G	10.5 32	3.81E01	11	LYM 11 6	13204. 4	K	0.60 7	1.36E01	27.4
LYM7	11594. 2	G	10.0 52	4.96E01	5.9	LYM30	11913. 4	K	0.59 3	1.53E01	24.3
LYM20	11716. 5	G	10.1 04	5.90E01	6.5	LYM 12 1	13212. 6	K	0.58 4	1.56E01	22.4
LYM8	11983. 1	G	9.74 8	5.93E01	2.7	LYM28 5	12734. 7	K	0.6	1.70E01	25.9
LYM7	11591. 2	G	9.77 1	6.16E01	3	LYM53	11842. 4	K	0.58 1	1.70E01	21.9
LYM67	11781. 5	G	9.71 8	6.39E01	2.4	LYM95	12124. 4	K	0.57 4	1.84E01	20.4
LYM62	12023. 4	G	9.72 3	6.48E01	2.5	LYM20	11711. 2	K	0.58 1	1.90E01	21.7
LYM 16	11624. 4	G	9.76 1	6.89E01	2.9	LYM 12 8	12641. 3	K	0.56 9	2.06E01	19.3
LYM9	11634. 5	G	9.75 3	7.05E01	2.8	LYM62	12023. 2	K	0.57 7	2.14E01	21
LYM53	11842. 4	G	9.67 3	7.13E01	1.9	LYM 14 5	12953. 5	K	0.57 1	2.18E01	19.7
LYM 12	11874. 1	G	9.65 5	7.33E01	1.7	LYM53	11841. 2	K	0.56 8	2.21E01	19
LYM37	11803. 2	G	9.66 3	7.61E01	1.8	LYM28 5	12734. 9	K	0.57 6	2.21E01	20.8
LYM43	11791. 2	G	9.67 6	8.13E01	2	LYM23 2	13024. 4	K	0.57 8	2.36E01	21.2
LYM35	11811. 2	G	9.59 8	8.21E01	1.1	LYM 10 3	12712. 5	K	0.57 1	2.39E01	19.7
LYM62	12023. 7	G	9.59 2	8.31E01	1.1	LYM23 2	13024. 6	K	0.56 6	2.45E01	18.6
LYM68	11943. 2	G	9.65 2	8.34E01	1.7	LYM53	11841. 1	K	0.56 8	2.50E01	19.2
LYM 15	11612. 3	G	9.59	8.47E01	1.1	LYM99	12243. 1	K	0.57 6	2.57E01	20.8
LYM 19	11753. 4	G	9.66 1	8.70E01	1.8	LYM24	12064. 1	K	0.56 8	2.60E01	19
LYM67	11782. 5	G	9.59 4	9.27E01	1.1	LYM 11 0	12923. 8	K	0.55 9	2.60E01	17.2
LYM2	11693. 3	G	9.59 3	9.33E01	1.1	LYM66	11954. 4	K	0.56 5	2.60E01	18.4
LYM43	11793. 2	G	9.56 9	9.71E01	0.8	LYM 10 3	12713. 5	K	0.56 5	2.61E01	18.6
LYM44	11882. 1	G	9.52 9	9.82E01	0.4	LYM 12	11871. 1	K	0.57	2.69E01	19.5
LYM 14	12051. 4	G	9.50 1	9.83E01	0.1	LYM99	12241. 1	K	0.55 8	2.70E01	17.1
LYM 13	11773. 2	G	9.50 1	9.83E01	0.1	LYM82	12201. 1	K	0.56	2.74E01	17.5

217

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM 15	11614. 4	G	9.49 3	9.97E01	0	LYM31	11923. 4	K	0.56 4	2.76E01	18.2
CONTR OL	—	G	9.49	—	0	LYM99	12243. 2	K	0.55 9	2.99E01	17.2
LYM9	11632. 1	H	33.9 14	2.21E04	36.9	LYM 14 5	12954. 8	K	0.55 4	3.06E01	16.1
LYM57	12013. 1	H	29.5 79	9.76E03	19.4	LYM66	11955. 2	K	0.55 7	3.10E- 01	16.7
LYM35	11812. 3	H	29.2 04	1.31E02	17.9	LYM28 4	12884. 6	K	0.55 4	3.10E- 01	16.1
LYM57	12012. 4	H	27.6 26	1.08E- 01	11.5	LYM23 2	13024. 7	K	0.55 4	3.11E- 01	16.1
LYM 10	11744. 1	H	31.6 43	1.14E- 01	27.7	LYM23 9	13044. 8	K	0.55 5	3.13E- 01	16.4
LYM35	11813. 5	H	27.9 93	1.18E- 01	13	LYM43	11793. 2	K	0.56 3	3.17E- 01	18.1
LYM 10	11741. 2	H	26.9 64	1.50E- 01	8.8	LYM 14	12051. 1	K	0.55 3	3.22E01	15.9
LYM69	11852. 2	H	27.5 16	1.79E01	11	LYM 11 6	13202. 7	K	0.55 2	3.34E01	15.7
LYM9	11633. 7	H	27.9 59	1.85E- 01	12.8	LYM95	12124. 5	K	0.54 8	3.45E01	14.9
LYM1	11602. 6	H	27.9 65	1.95E- 01	12.9	LYM 12 1	13211. 8	K	0.54 6	3.49E01	14.4
LYM1	11603. 2	H	28.2 46	2.79E01	14	LYM24	12062. 3	K	0.54 7	3.50E01	14.8
LYM30	11912. 6	H	28.1 63	2.82E01	13.6	LYM67	11782. 5	K	0.54 6	3.51E- 01	14.5
LYM 14	12051. 4	H	29.8 76	3.41E- 01	20.6	LYM53	11843. 2	K	0.54 5	3.52E01	14.3
LYM51	11891. 1	H	27.8 05	3.42E01	12.2	LYM 11 0	12924. 5	K	0.54 8	3.55E01	15
LYM1	11604. 4	H	30.5 41	3.49E01	23.2	LYM99	12244. 2	K	0.54 9	3.59E01	15.1
LYM53	11842. 4	H	30.3 6	3.95E01	22.5	LYM 12	11871. 3	K	0.54 7	3.66E01	14.6
LYM31	11924. 4	H	28.2 44	4.58E01	14	LYM99	12244. 1	K	0.54 9	3.66E01	15.1
LYM57	12012. 6	H	29.9 77	4.61E01	21	LYM27 1	12724. 7	K	0.54 9	3.69E01	15.1
LYM 13	11771. 9	H	26.7 32	4.87E01	7.9	LYM26	11824. 5	K	0.55 7	3.69E01	16.8
LYM34	11902. 2	H	27.8 8	5.04E01	12.5	LYM30	11913. 5	K	0.54 4	3.88E01	14.1
LYM 14	12051. 1	H	26.6 48	5.19E- 01	7.5	LYM67	11781. 5	K	0.54	3.88E01	13.3
LYM21	11674. 5	H	25.8 58	5.35E01	4.3	LYM23 8	12762. 8	K	0.54 4	3.90E01	14.1
LYM35	11811. 3	H	28.1 52	5.73E01	13.6	LYM62	12023. 4	K	0.54 4	3.93E01	14.1
LYM2	11695. 1	H	25.9 7	6.93E01	4.8	LYM 14	12052. 5	K	0.54 7	3.97E01	14.8

218

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM69	11851. 2	H	25.4 99	6.95E01	2.9	LYM31	11921. 3	K	0.54 4	4.06E01	14
LYM7	11594. 2	H	26.0 64	7.54E01	5.2	LYM26	11821. 2	K	0.54	4.06E01	13.3
LYM 13	11771. 6	H	25.2 04	7.64E01	1.7	LYM43	11792. 2	K	0.54	4.06E01	13.3
LYM 12	11872. 1	H	26.3 1	7.68E01	6.2	LYM62	12022. 4	K	0.54	4.18E01	13.3
LYM31	11923. 4	H	26.1 15	7.78E01	5.4	LYM27 1	12721. 8	K	0.53 6	4.26E01	12.3
LYM34	11903. 2	H	27.3 51	7.84E01	10.4	LYM56	13112. 6	K	0.53 6	4.32E01	12.4
LYM51	11893. 4	H	25.7 67	7.97E01	4	LYM 14 5	12951. 9	K	0.53 5	4.47E01	12.2
LYM66	11953. 6	H	25.4 92	8.09E01	2.9	LYM 11 0	12923. 5	K	0.53 4	4.49E01	12.1
LYM68	11942. 3	H	26.0 14	8.37E01	5	LYM 11 0	12921. 7	K	0.53 7	4.51E01	12.6
LYM30	11913. 4	H	26.0 41	8.38E01	5.1	LYM 12	11872. 1	K	0.53 6	4.52E01	12.3
LYM1	11601. 1	H	25.3 77	8.67E01	2.4	LYM20	11711. 3	K	0.53 3	4.57E01	11.8
LYM24	12061. 2	H	25.0 11	9.20E01	0.9	LYM57	12012. 2	K	0.53 4	4.71E01	11.9
LYM1	11602. 1	H	24.9 92	9.73E01	0.9	LYM88	12193. 1	K	0.52 9	4.85E01	11
LYM53	11844. 2	H	24.8 31	9.74E01	0.2	LYM66	11953. 6	K	0.53	4.94E01	11.1
CONTR OL	—	H	24.7 8	—	0	LYM31	11924. 4	K	0.53	5.07E01	11.1
LYM9	11632. 1	J	0.07 9	1.51E- 01	24.8	LYM67	11782. 4	K	0.53 2	5.13E- 01	11.5
LYM57	12013. 1	J	0.07 8	1.83E- 01	23	LYM28 5	12731. 4	K	0.52 5	5.18E- 01	10
LYM57	12012. 6	J	0.07 7	2.25E01	21.2	LYM23 9	13041. 1	K	0.52 3	5.35E01	9.7
LYM30	11912. 6	J	0.07 6	2.26E01	20.6	LYM24	12063. 3	K	0.52 1	5.41E- 01	9.2
LYM53	11842. 4	J	0.07 6	2.65E01	19.4	LYM 15 6	12963. 1	K	0.52 2	5.54E01	9.4
LYM1	11604. 4	J	0.07 5	2.97E01	18.6	LYM 12	11874. 1	K	0.52 1	5.55E01	9.2
LYM1	11603. 2	J	0.07 4	3.28E01	16.8	LYM27 1	12724. 9	K	0.52 2	5.59E01	9.5
LYM 10	11744. 1	J	0.07 3	3.53E01	15.7	LYM 10 3	12713. 7	K	0.52	5.64E01	9.1
LYM31	11924. 4	J	0.07 2	3.90E01	14.6	LYM 14	12054. 2	K	0.51 8	5.72E01	8.6
LYM 14	12051. 4	J	0.07 2	4.24E01	13.6	LYM57	12013. 3	K	0.51 9	5.89E01	8.9
LYM35	11812. 3	J	0.07 2	4.25E01	13.3	LYM31	11923. 1	K	0.51 5	6.17E- 01	7.9

219

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM9	11633. 7	J	0.07 1	4.52E01	12.5	LYM23 8	12761. 6	K	0.51 8	6.24E01	8.5
LYM34	11902. 2	J	0.07 1	4.57E01	12.9	LYM23 2	13024. 5	K	0.51 5	6.30E01	7.9
LYM35	11813. 5	J	0.07 1	4.85E01	11.8	LYM56	13112. 7	K	0.51 2	6.37E01	7.3
LYM57	12012. 4	J	0.07	5.22E01	10.3	LYM26	11824. 6	K	0.51	6.47E01	6.9
LYM51	11891. 1	J	0.06 9	5.53E01	9.8	LYM 10 3	12712. 8	K	0.51 1	6.48E01	7.2
LYM2	11695. 1	J	0.06 9	5.59E01	9.8	LYM41	11831. 1	K	0.50 9	6.63E01	6.8
LYM31	11923. 4	J	0.06 9	5.64E01	9.9	LYM27 7	13101. 1	K	0.50 8	6.88E01	6.6
LYM 13	11771. 9	J	0.06 9	5.93E01	9	LYM56	13111. 7	K	0.50 9	6.88E01	6.7
LYM68	11942. 3	J	0.06 9	5.94E01	9.5	LYM28 4	12884. 7	K	0.50 6	6.90E01	6.2
LYM7	11594. 2	J	0.06 9	5.99E01	8.8	LYM62	12022. 1	K	0.50 4	7.05E01	5.7
LYM66	11953. 6	J	0.06 9	6.12E01	8.5	LYM30	11912. 7	K	0.50 7	7.06E01	6.3
LYM 14	12051. 1	J	0.06 9	6.16E01	8.5	LYM41	11833. 1	K	0.50 1	7.36E01	5.1
LYM 10	11741. 2	J	0.06 8	6.23E01	8.2	LYM 10 3	12714. 6	K	0.50 2	7.61E01	5.3
LYM1	11602. 6	J	0.06 8	6.34E01	7.8	LYM51	11891. 1	K	0.5	7.77E01	4.8
LYM 12	11872. 1	J	0.06 8	6.36E01	8	LYM23 9	13042. 9	K	0.49 8	7.78E01	4.5
LYM69	11852. 2	J	0.06 8	6.55E01	7.3	LYM24	12061. 2	K	0.49 8	7.80E01	4.5
LYM35	11811. 3	J	0.06 8	6.90E01	6.8	LYM 11 6	13201. 8	K	0.49 5	8.03E01	3.9
LYM34	11903. 2	J	0.06 8	7.08E01	6.9	LYM66	11953. 1	K	0.49 6	8.07E01	3.9
LYM 13	11771. 6	J	0.06 7	7.11E01	6.2	LYM27 1	12723. 2	K	0.49 7	8.18E01	4.3
LYM69	11851. 2	J	0.06 6	7.59E01	5.1	LYM27 7	13101. 8	K	0.49 5	8.23E01	3.9
LYM1	11601. 1	J	0.06 5	8.32E01	3.5	LYM 12 5	12934. 7	K	0.49 4	8.28E01	3.6
LYM51	11893. 4	J	0.06 5	8.37E01	3.4	LYM 12 1	13214. 3	K	0.49 3	8.30E01	3.4
LYM43	11791. 4	J	0.06 5	8.52E01	3.1	LYM88	12194. 2	K	0.49 2	8.37E01	3.2
LYM24	12061. 2	J	0.06 5	8.93E01	2.2	LYM20	11716. 5	K	0.49	8.59E01	2.8
LYM53	11844. 2	J	0.06 4	9.21E01	1.6	LYM57	12013. 5	K	0.48 8	8.85E01	2.3
LYM30	11913. 4	J	0.06 4	9.24E01	1.6	LYM66	11952. 2	K	0.48 8	8.89E01	2.4

220

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM 15	11612. 2	J	0.06 4	9.40E01	1.3	LYM 15 6	12961. 9	K	0.48 7	8.92E01	2.1
LYM21	11674. 5	J	0.06 4	9.43E01	1.2	LYM67	11783. 5	K	0.48 5	9.13E01	1.7
CONTR OL	—	J	0.06 3	—	0	LYM23 2	13022. 1	K	0.48 5	9.18E01	1.8
LYM57	12012. 4	K	0.72 4	2.06E01	19.4	LYM67	11782. 6	K	0.48 3	9.35E01	1.3
LYM37	11803. 2	K	0.71 1	2.92E01	17.3	LYM 14 5	12954. 7	K	0.48 2	9.41E01	1.2
LYM26	11824. 6	K	0.69 9	3.16E01	15.3	LYM 12 5	12932. 6	K	0.48 3	9.42E01	1.4
LYM31	11921. 3	K	0.69 6	3.36E01	14.9	LYM 12 5	12933. 8	K	0.48 1	9.60E01	0.8
LYM41	11831. 1	K	0.69 5	3.63E01	14.6	LYM28 5	12732. 5	K	0.48	9.74E01	0.6
LYM62	12023. 7	K	0.68 4	4.19E01	12.8	LYM 15 6	12961. 7	K	0.47 8	9.91E01	0.2
LYM62	12023. 2	K	0.69 9	4.20E01	15.4	CONTR OL	—	K	0.47 7	—	0
LYM37	11801. 1	K	0.68 1	4.37E01	12.4	LYM 12 8	12641. 5	L	2.44 9	2.11E04	59.2
LYM35	11811. 3	K	0.68	4.38E01	12.2	LYM 11 6	13202. 12	L	2.37 5	4.83E04	54.4
LYM69	11852. 2	K	0.67 6	4.46E01	11.6	LYM 12	11872. 1	L	2.46 5	7.52E04	60.2
LYM 16	11622. 4	K	0.68 3	4.47E01	12.6	LYM28 5	12733. 9	L	2.38	9.95E04	54.7
LYM21	11671. 2	K	0.67 4	4.59E01	11.1	LYM99	12243. 1	L	2.24 6	1.78E03	46
LYM53	11841. 2	K	0.67 4	4.66E01	11.1	LYM20	11711. 2	L	2.20 3	4.00E03	43.2
LYM24	12062. 3	K	0.66 8	5.01E01	10.2	LYM26	11824. 1	L	2.17 1	5.72E03	41.1
LYM51	11892. 1	K	0.66 9	5.09E01	10.3	LYM 12 8	12641. 3	L	2.15 6	5.90E03	40.1
LYM 10	11744. 1	K	0.66 8	5.14E01	10.1	LYM95	12121. 2	L	2.15 5	1.11E02	40.1
LYM34	11902. 2	K	0.66 6	5.18E01	9.9	LYM67	11782. 6	L	2.10 7	1.18E02	36.9
LYM 14	12054. 2	K	0.66 5	5.20E01	9.7	LYM66	11954. 4	L	2.09 1	1.19E02	35.9
LYM67	11782. 6	K	0.66	5.62E01	8.9	LYM 12	11871. 1	L	2.08 8	2.29E02	35.7
LYM9	11632. 1	K	0.66	5.63E01	8.9	LYM24	12061. 4	L	2.04 4	2.38E02	32.9
LYM 15	11611. 3	K	0.65 9	6.00E01	8.7	LYM23 8	12764. 8	L	2.03 5	2.46E02	32.3
LYM4	11706. 5	K	0.65 5	6.01E01	8	LYM 10 3	12713. 5	L	2.06 5	2.84E02	34.2
LYM 12	11872. 1	K	0.65 6	6.03E01	8.3	LYM26	11824. 3	L	2.01	2.91E02	30.7

221

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM35	11812. 3	K	0.65 5	6.07E01	8	LYM26	11824. 6	L	1.98	3.86E02	28.7
LYM62	12022. 4	K	0.65 1	6.30E01	7.4	LYM23 9	13042. 9	L	1.97 7	4.34E02	28.5
LYM30	11912. 6	K	0.64 9	6.64E01	7	LYM53	11841. 1	L	1.97 1	4.77E02	28.1
LYM20	11716. 5	K	0.64 6	6.74E01	6.6	LYM88	12193. 1	L	1.93 6	5.80E02	25.8
LYM67	11781. 5	K	0.64 3	6.97E01	6	LYM 11 6	13202. 7	L	1.90 7	8.77E02	24
LYM4	11702. 3	K	0.64	7.22E01	5.6	LYM23 2	13024. 7	L	1.97 1	1.00E01	28.1
LYM69	11851. 2	K	0.63 9	7.23E01	5.4	LYM69	11852. 2	L	1.87 5	1.06E01	21.9
LYM68	11942. 2	K	0.64	7.29E01	5.6	LYM31	11923. 4	L	1.87 2	1.15E01	21.7
LYM35	11812. 4	K	0.64 3	7.31E01	6	LYM82	12201. 1	L	1.84 3	1.30E01	19.8
LYM7	11592. 1	K	0.64	7.32E01	5.6	LYM95	12124. 4	L	1.82 9	1.51E01	18.9
LYM30	11913. 4	K	0.64 1	7.33E01	5.8	LYM 10 3	12712. 8	L	1.84 1	1.53E01	19.6
LYM30	11913. 3	K	0.63 8	7.35E01	5.2	LYM30	11912. 6	L	1.84 2	1.64E01	19.7
LYM8	11982. 6	K	0.63 8	7.37E01	5.2	LYM 14	12051. 4	L	1.83	1.66E01	18.9
LYM2	11692. 3	K	0.64 1	7.40E01	5.8	LYM26	11824. 5	L	1.90 9	1.69E01	24.1
LYM4	11702. 1	K	0.63 4	7.62E01	4.5	LYM31	11924. 4	L	1.81 8	1.86E01	18.2
LYM41	11832. 2	K	0.63 1	7.80E01	4.1	LYM 12	11871. 3	L	1.81 4	1.86E01	17.9
LYM9	11633. 2	K	0.63 4	7.80E01	4.5	LYM24	12064. 1	L	1.81 4	2.15E01	17.9
LYM9	11634. 5	K	0.63	8.00E01	3.9	LYM 15 6	12963. 1	L	1.79 2	2.30E01	16.4
LYM9	11632. 2	K	0.63	8.04E01	3.9	LYM23 2	13024. 6	L	1.78 9	2.39E01	16.2
LYM53	11842. 4	K	0.63 1	8.07E01	4.1	LYM67	11782. 4	L	1.78 6	2.40E01	16.1
LYM68	11941. 3	K	0.62 9	8.08E01	3.7	LYM 11 6	13204. 4	L	1.85 9	2.45E01	20.8
LYM 13	11771. 9	K	0.62 9	8.13E01	3.7	LYM99	12244. 2	L	1.77 2	2.57E01	15.2
LYM57	12012. 2	K	0.62 6	8.34E01	3.3	LYM23 9	13044. 8	L	1.77 6	2.66E01	15.4
LYM21	11674. 1	K	0.62 4	8.48E01	2.9	LYM26	11821. 2	L	1.77 3	2.99E01	15.3
LYM34	11902. 4	K	0.62 4	8.48E01	2.9	LYM20	11716. 5	L	1.74 9	3.04E01	13.7
LYM41	11833. 1	K	0.62 4	8.52E01	2.9	LYM 12 8	12641. 1	L	1.76 3	3.04E01	14.6

222

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM1	11604. 4	K	0.62	8.86E01	2.3	LYM53	11843. 2	L	1.74 6	3.06E01	13.5
LYM9	11633. 7	K	0.62	8.87E01	2.3	LYM66	11955. 2	L	1.74	3.08E01	13.1
LYM 17	11683. 1	K	0.61 9	8.89E01	2.1	LYM62	12023. 2	L	1.73 5	3.31E- 01	12.7
LYM 15	11614. 4	K	0.61 8	9.03E01	1.9	LYM88	12194. 2	L	1.68 1	4.65E01	9.3
LYM20	11716. 3	K	0.61 8	9.05E01	1.9	LYM43	11791. 4	L	1.68 7	4.68E01	9.6
LYM62	12022. 2	K	0.61 6	9.13E01	1.7	LYM 12	11873. 4	L	1.65 8	5.55E01	7.8
LYM4	11705. 2	K	0.61 6	9.15E01	1.7	LYM30	11913. 5	L	1.66 7	5.55E01	8.3
LYM21	11674. 5	K	0.61 5	9.26E01	1.5	LYM30	11912. 7	L	1.65 2	5.73E01	7.4
LYM26	11824. 3	K	0.61 5	9.27E01	1.5	LYM30	11913. 4	L	1.64 4	6.15E- 01	6.8
LYM69	11854. 2	K	0.61 5	9.30E01	1.5	LYM 10 3	12711. 8	L	1.63 7	6.20E01	6.4
LYM67	11783. 4	K	0.61 1	9.57E01	0.8	LYM43	11793. 2	L	1.64 5	6.21E- 01	6.9
LYM37	11801. 2	K	0.61 1	9.57E01	0.8	LYM99	12243. 2	L	1.62 8	6.46E01	5.8
LYM67	11782. 5	K	0.61	9.67E01	0.6	LYM66	11953. 6	L	1.62 7	6.52E01	5.7
LYM62	12023. 4	K	0.61	9.70E01	0.6	LYM 10 3	12712. 5	L	1.62 9	6.58E01	5.9
LYM7	11594. 2	K	0.61	9.70E01	0.6	LYM28 5	12734. 9	L	1.60 8	7.44E01	4.5
LYM 16	11624. 4	K	0.60 9	9.77E01	0.4	LYM 14 5	12951. 9	L	1.59 3	7.83E01	3.5
LYM7	11591. 5	K	0.60 9	9.79E01	0.4	LYM 10 3	12714. 6	L	1.59 5	8.01E- 01	3.7
LYM31	11922. 3	K	0.60 8	9.89E01	0.2	LYM62	12023. 5	L	1.58 6	8.08E01	3.1
LYM8	11984. 1	K	0.60 6	1.00E +00	0	LYM23 8	12762. 8	L	1.58 7	8.13E- 01	3.1
CONTR OL	—	K	0.60 6	—	0	LYM43	11791. 5	L	1.57 6	8.47E01	2.4
LYM9	11632. 1	L	4.46 4	4.79E02	36.6	LYM 15 6	12961. 9	L	1.57	8.76E01	2
LYM 10	11744. 1	L	4.16 6	1.32E- 01	27.5	LYM57	12012. 2	L	1.55 1	9.48E01	0.8
LYM53	11842. 4	L	4.03 6	2.03E01	23.5	LYM20	11716. 3	L	1.55 1	9.50E01	0.8
LYM1	11604. 4	L	4.02 6	2.08E01	23.2	LYM24	12062. 3	L	1.54 6	9.69E01	0.5
LYM57	12012. 6	L	3.96 2	2.47E01	21.3	CONTR OL	—	L	1.53 9	—	0
LYM 14	12051. 4	L	3.94 1	2.56E01	20.6	LYM 12 8	12641. 5	M	0.30 6	5.45E04	53.9

223

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM57	12013. 1	L	3.92 9	2.56E01	20.2	LYM11 6	13202. 12	M	0.29 7	1.21E03	49.2
LYM35	11812. 3	L	3.81 4	3.35E01	16.7	LYM12	11872. 1	M	0.30 8	1.61E03	54.8
LYM30	11912. 6	L	3.73 6	4.19E01	14.3	LYM28 5	12733. 9	M	0.29 8	2.23E03	49.5
LYM31	11924. 4	L	3.73 8	4.20E01	14.4	LYM99	12243. 1	M	0.28 1	4.33E03	41.1
LYM57	12012. 4	L	3.71 3	4.26E01	13.6	LYM20	11711. 2	M	0.27 5	8.94E03	38.4
LYM35	11811. 3	L	3.73	4.30E01	14.2	LYM26	11824. 1	M	0.27 1	1.25E02	36.4
LYM1	11603. 2	L	3.70 5	4.48E01	13.4	LYM12 8	12641. 3	M	0.26 9	1.31E02	35.4
LYM9	11633. 7	L	3.67 4	4.69E01	12.4	LYM95	12121. 2	M	0.26 9	2.19E02	35.4
LYM51	11891. 1	L	3.68	4.70E01	12.6	LYM67	11782. 6	M	0.26 3	2.45E02	32.3
LYM35	11813. 5	L	3.67 7	4.70E01	12.5	LYM66	11954. 4	M	0.26 1	2.53E02	31.3
LYM34	11902. 2	L	3.68 7	4.71E01	12.8	LYM12	11871. 1	M	0.26 1	4.25E02	31.2
LYM1	11602. 6	L	3.67 1	4.75E01	12.3	LYM24	12061. 4	M	0.25 6	4.64E02	28.4
LYM69	11852. 2	L	3.63 4	5.13E01	11.2	LYM23 8	12764. 8	M	0.25 4	4.83E02	27.8
LYM34	11903. 2	L	3.60 5	5.97E01	10.3	LYM10 3	12713. 5	M	0.25 8	5.18E02	29.7
LYM13	11771. 9	L	3.54 1	6.32E01	8.4	LYM26	11824. 3	M	0.25 1	5.70E02	26.3
LYM10	11741. 2	L	3.51 8	6.56E01	7.7	LYM26	11824. 6	M	0.24 8	7.39E02	24.4
LYM12	11872. 1	L	3.50 7	6.78E01	7.3	LYM23 9	13042. 9	M	0.24 7	8.11E02	24.2
LYM14	12051. 1	L	3.50 4	6.80E01	7.2	LYM53	11841. 1	M	0.24 6	8.78E02	23.8
LYM7	11594. 2	L	3.49 3	6.89E01	6.9	LYM88	12193. 1	M	0.24 2	1.07E01	21.6
LYM31	11923. 4	L	3.44 1	7.61E01	5.3	LYM11 6	13202. 7	M	0.23 8	1.51E01	19.8
LYM2	11695. 1	L	3.43 3	7.69E01	5.1	LYM23 2	13024. 7	M	0.24 6	1.54E01	23.8
LYM68	11942. 3	L	3.44	7.72E01	5.3	LYM69	11852. 2	M	0.23 4	1.83E01	17.8
LYM30	11913. 4	L	3.43 5	7.78E01	5.1	LYM31	11923. 4	M	0.23 4	1.95E01	17.6
LYM51	11893. 4	L	3.40 2	8.13E01	4.1	LYM82	12201. 1	M	0.23	2.22E01	15.8
LYM69	11851. 2	L	3.39 1	8.26E01	3.8	LYM26	11824. 5	M	0.23 9	2.44E01	19.9
LYM21	11674. 5	L	3.38 5	8.32E01	3.6	LYM10 3	12712. 8	M	0.23	2.49E01	15.6

224

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM66	11953. 6	L	3.36 6	8.62E01	3	LYM95	12124. 4	M	0.22 9	2.51E01	14.9
LYM1	11601. 1	L	3.33 6	9.04E01	2.1	LYM30	11912. 6	M	0.23	2.60E01	15.7
LYM13	11771. 6	L	3.32 4	9.20E01	1.7	LYM14	12051. 4	M	0.22 9	2.67E01	14.9
LYM24	12061. 2	L	3.30 4	9.49E01	1.1	LYM31	11924. 4	M	0.22 7	2.94E01	14.2
LYM1	11602. 1	L	3.28 8	9.72E01	0.6	LYM12	11871. 3	M	0.22 7	2.96E01	14
LYM7	11592. 1	L	3.26 9	9.97E01	0.1	LYM24	12064. 1	M	0.22 7	3.27E01	14
CONTR OL	—	L	3.26 8	—	0	LYM11 6	13204. 4	M	0.23 2	3.38E01	16.8
LYM9	11632. 1	M	0.55 8	5.61E02	34.5	LYM15 6	12963. 1	M	0.22 4	3.54E01	12.6
LYM10	11744. 1	M	0.52 1	1.52E01	25.5	LYM23 2	13024. 6	M	0.22 4	3.65E01	12.4
LYM53	11842. 4	M	0.50 5	2.31E01	21.6	LYM67	11782. 4	M	0.22 3	3.66E01	12.2
LYM1	11604. 4	M	0.50 3	2.37E01	21.3	LYM99	12244. 2	M	0.22 2	3.92E01	11.3
LYM30	11912. 6	M	0.49 8	2.52E01	20.1	LYM23 9	13044. 8	M	0.22 2	3.98E01	11.6
LYM57	12012. 6	M	0.49 5	2.79E01	19.4	LYM26	11821. 2	M	0.22 2	4.31E01	11.4
LYM14	12051. 4	M	0.49 3	2.90E01	18.8	LYM12 8	12641. 1	M	0.22	4.42E01	10.8
LYM57	12013. 1	M	0.49 1	2.91E01	18.4	LYM20	11716. 5	M	0.21 9	4.53E01	9.9
LYM35	11812. 3	M	0.47 7	3.79E01	14.9	LYM53	11843. 2	M	0.21 8	4.57E01	9.7
LYM31	11924. 4	M	0.46 7	4.69E01	12.6	LYM66	11955. 2	M	0.21 8	4.64E01	9.3
LYM57	12012. 4	M	0.46 4	4.78E01	11.9	LYM62	12023. 2	M	0.21 7	4.90E01	9
LYM35	11811. 3	M	0.46 6	4.79E01	12.4	LYM43	11791. 4	M	0.21 1	6.50E01	6
LYM1	11603. 2	M	0.46 3	5.00E01	11.7	LYM88	12194. 2	M	0.21	6.56E01	5.6
LYM51	11891. 1	M	0.46	5.23E01	10.9	LYM30	11913. 5	M	0.20 8	7.36E01	4.7
LYM9	11633. 7	M	0.45 9	5.24E01	10.7	LYM12	11873. 4	M	0.20 7	7.49E01	4.2
LYM34	11902. 2	M	0.46 1	5.24E01	11.1	LYM30	11912. 7	M	0.20 7	7.70E01	3.8
LYM35	11813. 5	M	0.46	5.24E01	10.8	LYM43	11793. 2	M	0.20 6	8.08E01	3.4
LYM1	11602. 6	M	0.45 9	5.29E01	10.6	LYM30	11913. 4	M	0.20 5	8.09E01	3.3
LYM69	11852. 2	M	0.45 4	5.70E01	9.5	LYM10 3	12711. 8	M	0.20 5	8.25E01	2.8

225

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM34	11903. 2	M	0.45 1	6.52E01	8.6	LYM23 8	12763. 7	M	0.20 4	8.41E01	2.5
LYM13	11771. 9	M	0.44 3	6.95E01	6.7	LYM99	12243. 2	M	0.20 4	8.56E01	2.3
LYM10	11741. 2	M	0.44	7.21E01	6	LYM10 3	12712. 5	M	0.20 4	8.60E01	2.3
LYM12	11872. 1	M	0.43 8	7.42E01	5.7	LYM66	11953. 6	M	0.20 3	8.63E01	2.2
LYM14	12051. 1	M	0.43 8	7.44E01	5.6	LYM28 5	12734. 9	M	0.20 1	9.42E01	1
LYM7	11594. 2	M	0.43 7	7.55E01	5.3	LYM31	11921. 3	M	0.2	9.69E01	0.5
LYM31	11923. 4	M	0.43	8.29E01	3.7	LYM10 3	12714. 6	M	0.19 9	9.90E01	0.2
LYM68	11942. 3	M	0.43	8.37E01	3.7	LYM14 5	12951. 9	M	0.19 9	9.95E01	0.1
LYM2	11695. 1	M	0.42 9	8.38E01	3.5	CONTR OL	—	M	0.19 9	—	0
LYM30	11913. 4	M	0.42 9	8.44E01	3.5	LYM11 6	13202. 12	N	0.25 5	2.10E05	39.1
LYM51	11893. 4	M	0.42 5	8.82E01	2.5	LYM12	11872. 1	N	0.26 3	2.76E04	43.6
LYM69	11851. 2	M	0.42 4	8.97E01	2.2	LYM12 8	12641. 5	N	0.24 1	3.00E04	31.6
LYM21	11674. 5	M	0.42 3	9.04E01	2	LYM20	11711. 2	N	0.23 4	6.41E04	28
LYM66	11953. 6	M	0.42 1	9.33E01	1.4	LYM23 8	12764. 8	N	0.23 6	7.16E04	29.2
LYM1	11601. 1	M	0.41 7	9.76E01	0.5	LYM26	11824. 1	N	0.23 4	1.33E03	28
LYM13	11771. 6	M	0.41 5	9.93E01	0.2	LYM12 8	12641. 3	N	0.23 2	1.75E03	26.7
CONTR OL	—	M	0.41 5	—	0	LYM10 3	12713. 5	N	0.23 1	2.00E03	26.5
LYM9	11632. 1	N	0.36 4	3.31E01	10.1	LYM24	12061. 4	N	0.22 7	3.42E03	24.1
LYM30	11912. 6	N	0.36 3	3.56E01	9.8	LYM23 2	13024. 6	N	0.22 8	3.85E03	24.4
LYM53	11842. 4	N	0.36 3	3.57E01	10.1	LYM28 5	12733. 9	N	0.22 9	4.57E03	25
LYM57	12012. 4	N	0.35 7	4.27E01	8.1	LYM26	11824. 3	N	0.22 6	4.79E03	23.5
LYM35	11813. 5	N	0.35 6	4.55E01	7.8	LYM66	11954. 4	N	0.22 4	5.52E03	22.5
LYM35	11811. 3	N	0.35 7	4.59E01	8.1	LYM23 9	13042. 9	N	0.22 6	5.90E03	23.3
LYM57	12013. 1	N	0.35 5	4.83E01	7.5	LYM30	11912. 6	N	0.22 7	6.07E03	24
LYM14	12051. 4	N	0.35 2	5.51E01	6.5	LYM12 8	12641. 1	N	0.22 5	9.15E03	23.1
LYM9	11633. 7	N	0.34 9	5.80E01	5.6	LYM11 6	13202. 7	N	0.22 1	1.09E02	20.9

226

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM57	12012. 6	N	0.34 9	5.90E01	5.8	LYM31	11924. 4	N	0.22 1	1.24E02	21
LYM43	11791. 4	N	0.34 7	6.19E- 01	5.2	LYM12	11871. 1	N	0.22 6	1.29E02	23.3
LYM68	11942. 3	N	0.34 8	6.27E01	5.5	LYM14	12051. 4	N	0.22	1.51E02	20.4
LYM31	11924. 4	N	0.34 6	6.55E01	4.8	LYM24	12064. 1	N	0.22 6	1.54E02	23.5
LYM34	11902. 2	N	0.34 5	6.78E01	4.4	LYM10 3	12712. 8	N	0.21 9	1.66E02	19.4
LYM51	11891. 1	N	0.34 4	6.78E01	4.2	LYM53	11841. 1	N	0.21 9	1.67E- 02	19.7
LYM10	11744. 1	N	0.34 4	6.92E01	4.2	LYM95	12121. 2	N	0.22	1.74E02	20.4
LYM66	11953. 6	N	0.34 1	7.64E01	3.2	LYM30	11913. 5	N	0.22 4	1.83E02	22.5
LYM1	11604. 4	N	0.34	7.75E01	3.1	LYM31	11923. 4	N	0.21 7	2.07E02	18.9
LYM37	11801. 1	N	0.33 9	8.01E- 01	2.5	LYM23 2	13024. 7	N	0.23 5	2.12E02	28.2
LYM13	11771. 9	N	0.33 8	8.16E- 01	2.5	LYM99	12243. 1	N	0.22	2.16E02	20.1
LYM7	11594. 2	N	0.33 7	8.44E01	2.1	LYM23 9	13044. 8	N	0.21 7	2.68E02	18.4
LYM1	11603. 2	N	0.33 7	8.51E- 01	2	LYM26	11824. 6	N	0.21 7	2.69E02	18.4
LYM13	11771. 6	N	0.33 6	8.71E- 01	1.7	LYM11 6	13204. 4	N	0.23 3	2.78E02	27.6
LYM35	11812. 3	N	0.33 6	8.72E01	1.7	LYM12	11871. 3	N	0.21 8	3.06E02	18.9
LYM9	11633. 2	N	0.33 5	8.86E01	1.5	LYM67	11782. 6	N	0.21 5	3.30E02	17.4
LYM69	11852. 2	N	0.33 3	9.38E01	0.8	LYM53	11843. 2	N	0.21 2	4.67E02	15.7
LYM12	11872. 1	N	0.33 3	9.45E01	0.8	LYM10 3	12712. 5	N	0.21 2	5.01E- 02	16.1
LYM35	11811. 2	N	0.33 1	9.70E01	0.4	LYM30	11913. 4	N	0.21 3	5.21E- 02	16.1
LYM34	11903. 2	N	0.33 1	9.79E01	0.3	LYM88	12193. 1	N	0.21 1	5.46E02	15.1
CONTR OL	—	N	0.33	—	0	LYM23 8	12762. 8	N	0.21 1	5.60E02	15.4
LYM9	11632. 1	O	4.23 9	1.94E- 04	34.8	LYM12	11873. 4	N	0.21 1	5.78E02	15.1
LYM30	11912. 6	O	3.75 4	6.17E- 03	19.4	LYM26	11821. 2	N	0.21 5	6.72E02	17.8
LYM57	12013. 1	o	3.69 7	1.13E02	17.5	LYM69	11852. 2	N	0.21	6.75E02	14.7
LYM35	11812. 3	o	3.65	1.50E02	16	LYM28 5	12734. 9	N	0.21 2	7.54E02	16.1
LYM10	11744. 1	o	3.95 5	1.30E- 01	25.7	LYM26	11824. 5	N	0.22 2	7.68E02	21.1

227

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM57	12012. 4	O	3.45 3	1.41E01	9.8	LYM15 6	12961. 9	N	0.20 8	7.99E02	13.9
LYM35	11813. 5	o	3.49 9	1.51E01	11.2	LYM43	11791. 4	N	0.20 8	8.13E02	13.6
LYM10	11741. 2	o	3.37	2.00E01	7.1	LYM99	12244. 2	N	0.20 7	8.64E02	13.3
LYM9	11633. 7	o	3.49 5	2.27E01	11.1	LYM23 8	12763. 7	N	0.20 5	1.20E01	12
LYM69	11852. 2	o	3.43 9	2.27E01	9.3	LYM15 6	12963. 1	N	0.20 8	1.24E01	13.5
LYM1	11602. 6	o	3.49 6	2.38E01	11.1	LYM82	12201. 1	N	0.20 4	1.29E01	11.7
LYM1	11603. 2	o	3.53 1	3.22E01	12.2	LYM95	12124. 4	N	0.20 4	1.34E01	11.7
LYM14	12051. 4	o	3.73 5	3.69E01	18.7	LYM20	11716. 5	N	0.20 4	1.46E01	11.3
LYM1	11604. 4	o	3.81 8	3.73E01	21.4	LYM31	11921. 3	N	0.20 3	1.70E01	10.9
LYM51	11891. 1	o	3.47 6	3.93E01	10.5	LYM14 5	12951. 9	N	0.20 2	1.80E01	10.4
LYM53	11842. 4	o	3.79 5	4.20E01	20.6	LYM30	11912. 7	N	0.20 2	1.85E01	10.1
LYM57	12012. 6	o	3.74 7	4.88E01	19.1	LYM67	11782. 4	N	0.20 3	2.23E01	11.2
LYM31	11924. 4	o	3.53 1	5.00E01	12.2	LYM20	11712. 2	N	0.20 3	2.24E01	10.7
LYM34	11902. 2	o	3.48 5	5.50E01	10.8	LYM28 5	12734. 7	N	0.2	2.27E01	9.4
LYM13	11771. 9	o	3.34 2	5.66E01	6.2	LYM10 3	12714. 6	N	0.20 4	2.42E01	11.7
LYM14	12051. 1	o	3.33 1	5.99E01	5.9	LYM20	11716. 3	N	0.2	2.43E01	9.3
LYM35	11811. 3	o	3.51 9	6.11E01	11.9	LYM62	12023. 2	N	0.2	2.46E01	9.3
LYM21	11674. 5	o	3.23 2	6.76E01	2.8	LYM66	11953. 6	N	0.19 7	3.17E01	7.7
LYM2	11695. 1	o	3.24 6	7.85E01	3.2	LYM23 8	12763. 5	N	0.19 7	3.17E01	7.7
LYM34	11903. 2	o	3.41 9	8.15E01	8.7	LYM23 2	13024. 5	N	0.19 7	3.18E01	7.7
LYM12	11872. 1	o	3.28 9	8.23E01	4.5	LYM24	12062. 3	N	0.19 7	3.20E01	7.7
LYM7	11594. 2	o	3.25 8	8.24E01	3.6	LYM23 9	13044. 7	N	0.19 7	3.34E01	7.9
LYM31	11923. 4	o	3.26 4	8.39E01	3.8	LYM57	12012. 2	N	0.19 6	3.40E01	7.3
LYM69	11851. 2	o	3.18 7	8.50E01	1.3	LYM10 3	12711. 8	N	0.19 5	4.17E01	6.4
LYM51	11893. 4	o	3.22 1	8.73E01	2.4	LYM53	11842. 4	N	0.19 4	4.55E01	5.8
LYM30	11913. 4	o	3.25 5	8.86E01	3.5	LYM88	12194. 2	N	0.19 3	4.99E01	5.2

228

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM68	11942. 3	O	3.25 2	8.86E01	3.4	LYM14 5	12954. 8	N	0.19 4	5.03E01	6.2
LYM66	11953. 6	o	3.18 6	9.10E01	1.3	LYM12 1	13212. 6	N	0.19 3	5.34E01	5.4
LYM1	11601. 1	o	3.17 2	9.52E01	0.8	LYM23 2	13024. 4	N	0.19 4	5.39E01	6.1
LYM13	11771. 6	o	3.15 1	9.76E01	0.2	LYM67	11782. 5	N	0.19	5.94E01	4.1
CONTR OL	—	o	3.14 6	—	0	LYM43	11793. 2	N	0.19 2	5.99E01	4.7
LYM9	11632. 1	P	3.79 9	3.19E- 03	12.7	LYM14 5	12954. 7	N	0.19 2	6.07E01	4.8
LYM10	11744. 1	P	3.64 2	4.04E02	8	LYM27 7	13103. 1	N	0.19	6.17E- 01	3.9
LYM57	12012. 4	P	3.61 8	9.72E02	7.3	LYM12 1	13211. 8	N	0.19	6.20E01	3.8
LYM30	11912. 6	P	3.63 8	1.05E- 01	7.9	LYM53	11844. 2	N	0.18 9	6.49E01	3.5
LYM9	11633. 7	P	3.55 4	1.21E- 01	5.4	LYM12 8	12642. 1	N	0.19	6.64E01	3.8
LYM35	11813. 5	P	3.61 1	1.25E- 01	7.1	LYM20	11711. 3	N	0.18 9	6.73E01	3.3
LYM35	11812. 3	P	3.53 3	1.68E- 01	4.8	LYM23 8	12761. 6	N	0.19	6.91E- 01	3.7
LYM57	12013. 1	P	3.58 1	1.87E- 01	6.2	LYM66	11955. 2	N	0.18 8	7.07E01	2.9
LYM53	11842. 4	P	3.71 3	3.40E01	10.1	LYM41	11831. 5	N	0.18 8	7.21E- 01	2.7
LYM14	12051. 4	P	3.67	3.72E01	8.9	LYM23 9	13041. 7	N	0.18 8	7.27E01	2.8
LYM1	11603. 2	P	3.50 8	4.36E01	4.1	LYM14 5	12952. 9	N	0.18 9	7.54E01	3.5
LYM35	11811. 3	P	3.64 1	4.94E01	8	LYM41	11834. 2	N	0.18 8	7.59E01	2.7
LYM51	11891. 1	P	3.47	5.07E01	2.9	LYM27 7	13101. 1	N	0.18 6	8.04E01	1.9
LYM13	11771. 9	P	3.46 9	5.23E01	2.9	LYM24	12063. 3	N	0.18 6	8.26E01	1.8
LYM57	12012. 6	P	3.6	5.25E01	6.8	LYM99	12243. 2	N	0.18 5	8.58E01	1.4
LYM1	11604. 4	P	3.57	5.61E- 01	5.9	LYM23 9	13041. 1	N	0.18 6	8.59E01	1.6
LYM31	11924. 4	P	3.50 5	5.77E01	4	LYM43	11791. 5	N	0.18 5	8.70E01	1.2
LYM34	11902. 2	P	3.48 4	6.13E- 01	3.3	LYM15 6	12961. 7	N	0.18 5	9.12E01	0.9
LYM37	11801. 1	P	3.43	6.41E- 01	1.7	LYM31	11923. 1	N	0.18 5	9.12E01	0.9
LYM1	11602. 6	P	3.47 2	6.46E01	3	LYM62	12023. 5	N	0.18 4	9.24E01	0.7
LYM13	11771. 6	P	3.42	6.49E01	1.4	LYM15 6	12963. 4	N	0.18 5	9.26E01	1

229

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM7	11594. 2	P	3.45 4	7.12E01	2.4	LYM11 6	13201. 8	N	0.18 4	9.37E01	0.6
LYM68	11942. 3	P	3.49 6	7.55E01	3.7	LYM41	11832. 2	N	0.18 4	9.65E01	0.4
LYM14	12051. 1	P	3.42 2	7.70E01	1.5	LYM11 0	12924. 5	N	0.18 3	9.85E01	0.2
LYM12	11872. 1	P	3.44 7	8.61E01	2.2	CONTR OL	—	N	0.18 3	—	0
LYM43	11791. 4	P	3.38 8	8.73E01	0.5	LYM11 6	13202. 12	O	2.28 9	9.00E06	42.6
LYM34	11903. 2	P	3.43 1	9.24E01	1.8	LYM88	12193. 1	O	1.96	6.36E04	22.1
LYM35	11811. 2	P	3.39	9.29E01	0.5	LYM20	11711. 2	o	2.14 1	2.08E03	33.4
LYM69	11852. 2	P	3.38 1	9.42E01	0.3	LYM53	11841. 1	o	1.95 5	4.31E03	21.8
LYM30	11913. 4	P	3.38 7	9.73E01	0.4	LYM67	11782. 6	o	2.09 7	4.70E03	30.6
CONTR OL	—	P	3.37 2	—	0	LYM31	11923. 4	o	1.85 5	4.75E03	15.6
LYM12 8	12641. 3	A	93.3 31	6.75E03	3.8	LYM82	12201. 1	o	1.86 3	2.54E02	16.1
LYM90	12393. 2	A	93.3 21	6.94E03	3.8	LYM26	11824. 3	o	1.91 9	3.12E02	19.6
LYM86	12183. 1	A	93.0 89	9.82E03	3.5	LYM23 8	12764. 8	o	1.94 2	3.40E02	21
LYM89	12211. 4	A	92.8 45	1.42E02	3.2	LYM12	11871. 3	o	1.75 4	6.30E02	9.3
LYM14 9	12343. 1	A	92.9 42	1.62E02	3.4	LYM12 8	12641. 5	o	2.37 6	6.82E02	48.1
LYM15 7	13341. 7	A	94.8 77	1.64E02	5.5	LYM99	12243. 1	o	2.28 7	8.62E02	42.5
LYM17 8	12163. 4	A	92.9 18	1.64E02	3.3	LYM26	11824. 1	o	2.08 8	9.91E02	30.1
LYM90	12393. 1	A	92.5 55	2.23E02	2.9	LYM12 8	12641. 3	o	2.09 6	1.04E01	30.6
LYM12 8	12642. 3	A	92.5 17	2.39E02	2.9	LYM99	12244. 2	o	1.75 7	1.07E01	9.5
LYM99	12243. 2	A	92.5 43	2.43E02	2.9	LYM88	12194. 2	o	1.70 5	1.51E01	6.2
LYM20 6	12601. 3	A	93.4 51	2.44E02	3.9	LYM23 9	13042. 9	o	1.91 5	1.56E01	19.3
LYM12 9	12573. 5	A	92.5 22	2.60E02	2.9	LYM53	11843. 2	o	1.71 9	1.75E01	7.1
LYM10 7	12631. 4	A	92.8 99	2.65E02	3.3	LYM28 5	12733. 9	o	2.36 6	1.77E01	47.4
LYM86	12182. 3	A	93.0 33	2.93E02	3.5	LYM26	11824. 6	o	1.95 5	1.91E01	21.8
LYM12 8	12641. 1	A	92.8 97	2.99E02	3.3	LYM24	12061. 4	o	1.98 4	1.96E01	23.6
LYM17 8	12163. 3	A	92.5 04	3.08E02	2.9	LYM10 3	12713. 5	o	2.02 9	2.03E01	26.4

230

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM14 9	12344. 2	A	92.3 23	3.24E02	2.7	LYM66	11954. 4	O	2.06 3	2.20E01	28.5
LYM73	12623. 2	A	92.7 62	3.28E02	3.2	LYM12	11872. 1	o	2.39 4	2.31E01	49.2
LYM6	11735. 1	A	92.3 26	3.43E02	2.7	LYM11 6	13202. 7	o	1.81 5	2.36E01	13.1
LYM86	12181. 3	A	93.2 42	4.14E02	3.7	LYM95	12124. 4	o	1.81 4	2.85E01	13
LYM25 0	12613. 2	A	92.2 15	4.16E02	2.5	LYM31	11924. 4	o	1.78 5	3.22E01	11.2
LYM25 0	12613. 4	A	92.1 65	4.20E02	2.5	LYM20	11716. 5	o	1.70 8	3.22E01	6.4
LYM89	12214. 2	A	92.3 55	4.43E02	2.7	LYM66	11955. 2	o	1.76 5	3.26E01	10
LYM90	12395. 3	A	92.9 38	4.47E02	3.4	LYM95	12121. 2	o	2.14 2	3.32E01	33.5
LYM86	12183. 3	A	92.9 37	4.54E02	3.4	LYM12	11871. 1	o	2.03	3.52E01	26.5
LYM15 7	13341. 4	A	92.3 5	4.58E02	2.7	LYM69	11852. 2	o	1.81 5	3.82E01	13.1
LYM12 9	12573. 3	A	92.8 4	4.79E02	3.2	LYM14	12051. 4	o	1.78 2	4.01E01	11
LYM6	11734. 3	A	92.2 88	5.09E02	2.6	LYM10 3	12712. 8	o	1.75 9	5.04E01	9.6
LYM25 6	13322. 3	A	92.6 41	6.65E02	3	LYM23 9	13044. 8	o	1.73 5	5.52E01	8.1
LYM15 7	13342. 4	A	94.1 06	7.45E02	4.7	LYM67	11782. 4	o	1.77 5	5.69E01	10.6
LYM88	12191. 2	A	91.9 53	7.61E02	2.3	LYM43	11791. 4	o	1.66 9	5.91E01	4
LYM99	12244. 1	A	93.5 09	7.70E02	4	LYM30	11912. 7	o	1.63 9	5.96E01	2.1
LYM17 8	12164. 3	A	91.8 16	8.24E02	2.1	LYM30	11912. 6	o	1.73 6	6.07E01	8.1
LYM25 0	12614. 1	A	91.7 29	8.76E02	2	LYM23 2	13024. 7	o	1.92 6	6.15E01	20
LYM90	12395. 1	A	93.1 65	8.97E02	3.6	LYM62	12023. 2	o	1.68 5	6.23E01	5
LYM91	13283. 4	A	91.6 31	1.00E01	1.9	LYM23 2	13024. 6	o	1.68 6	6.28E01	5.1
LYM17 8	12161. 2	A	92.2 39	1.02E01	2.6	LYM66	11953. 6	o	1.63 5	6.53E01	1.9
LYM12 9	12571. 3	A	91.6 67	1.10E01	1.9	LYM15 6	12963. 1	o	1.71 1	6.79E01	6.6
LYM25 6	13323. 3	A	93.1 78	1.29E01	3.6	LYM26	11824. 5	o	1.86 6	6.82E01	16.3
LYM10 7	12633. 4	A	91.4 72	1.31E01	1.7	LYM12 8	12641. 1	o	1.68 4	7.51E01	4.9
LYM91	13283. 1	A	93.9 48	1.50E01	4.5	LYM24	12064. 1	o	1.71 1	7.64E01	6.6
LYM88	12193. 1	A	91.3 77	1.54E01	1.6	LYM26	11821. 2	o	1.70 6	7.79E01	6.3

231

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM15 7	13341. 1	A	93.6 47	1.57E- 01	4.1	LYM11 6	13204. 4	O	1.77 9	8.04E01	10.8
LYM90	12392. 1	A	92.7 86	1.71E- 01	3.2	LYM99	12243. 2	o	1.63	8.51E- 01	1.6
LYM14 7	12583. 3	A	91.8 46	1.98E- 01	2.1	LYM43	11793. 2	o	1.63	9.41E01	1.6
LYM6	11735. 2	A	92.3 19	2.06E01	2.7	LYM30	11913. 5	o	1.60 6	9.98E01	0.1
LYM10 7	12631. 2	A	92.3 49	2.08E01	2.7	CONTR OL	—	o	1.60 5	—	0
LYM25 0	12614. 2	A	91.1 84	2.30E01	1.4	LYM20	11711. 2	P	2.43 8	2.52E04	17.1
LYM28 3	13304. 4	A	91.8 62	2.32E01	2.2	LYM23 8	12764. 8	P	2.35 7	1.15E- 03	13.2
LYM14 7	12584. 4	A	91.1 39	2.56E01	1.4	LYM11 6	13202. 12	P	2.55 2	3.04E03	22.6
LYM99	12243. 1	A	91.0 86	2.57E01	1.3	LYM53	11841. 1	P	2.33 8	3.08E03	12.3
LYM88	12192. 1	A	91.5 79	2.62E01	1.8	LYM82	12201. 1	P	2.29 4	5.04E03	10.2
LYM28 3	13304. 5	A	91.3 37	2.62E01	1.6	LYM31	11923. 4	P	2.28 4	6.11E- 03	9.7
LYM73	12623. 1	A	92.4 2	2.83E01	2.8	LYM88	12193. 1	P	2.39 3	7.93E03	14.9
LYM14 7	12581. 4	A	91.9 97	2.92E01	2.3	LYM67	11782. 6	P	2.39 3	1.64E02	14.9
LYM89	12214. 3	A	91.7 34	2.94E01	2	LYM12 8	12641. 5	P	2.57 9	3.82E02	23.9
LYM28 3	13302. 2	A	90.9 34	2.99E01	1.1	LYM99	12244. 2	P	2.24 3	4.31E02	7.7
LYM25 6	13321. 2	A	92.2 48	3.12E- 01	2.6	LYM12	11871. 3	P	2.21	4.39E02	6.1
LYM15 9	13354. 6	A	91.4 58	3.15E- 01	1.7	LYM28 5	12733. 9	P	2.53 8	4.87E02	21.9
LYM12 9	12572. 2	A	91.7 27	3.32E01	2	LYM26	11824. 3	P	2.31	5.40E02	10.9
LYM17 8	12164. 2	A	92.0 77	3.32E01	2.4	LYM24	12061. 4	P	2.34 4	5.96E02	12.5
LYM88	12191. 1	A	93.3 57	3.33E01	3.8	LYM12 8	12641. 3	P	2.41 2	6.15E- 02	15.8
LYM25 0	12611. 3	A	91.2 45	3.42E01	1.5	LYM53	11843. 2	P	2.23	6.53E02	7.1
LYM28 3	13302. 1	A	90.8 34	3.50E01	1	LYM66	11954. 4	P	2.44 3	6.54E02	17.3
LYM91	13284. 3	A	90.9 61	3.56E01	1.2	LYM43	11791. 4	P	2.21 1	6.54E02	6.2
LYM14 7	12584. 5	A	93.9 96	4.12E01	4.5	LYM99	12243. 1	P	2.58 2	9.80E02	24
LYM15 9	13352. 4	A	91.0 1	4.60E01	1.2	LYM31	11924. 4	P	2.26 9	1.13E- 01	9
LYM28 3	13303. 2	A	91.4 06	4.71E01	1.6	LYM10 3	12713. 5	P	2.42 1	1.17E- 01	16.3

232

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM 10 7	12632. 1	A	91.6 45	4.88E01	1.9	LYM88	12194. 2	P	2.18 5	1.24E01	4.9
LYM 12 9	12572. 4	A	90.8 78	5.03E01	1.1	LYM26	11824. 6	P	2.33 4	1.30E01	12.1
LYM89	12214. 4	A	93.1 57	5.04E01	3.6	LYM66	11955. 2	P	2.2	1.41E01	5.6
LYM 12 8	12642. 2	A	91.5 58	5.33E01	1.8	LYM 12	11872. 1	P	2.73 9	1.65E01	31.5
LYM25 6	13321. 3	A	91.5 38	5.33E01	1.8	LYM 11 6	13202. 7	P	2.16 3	1.71E01	3.9
LYM20 6	12603. 3	A	91.1 5	5.58E01	1.4	LYM95	12121. 2	P	2.45 6	1.79E01	17.9
LYM23 6	12592. 3	A	91.4 39	5.75E01	1.7	LYM26	11824. 1	P	2.38 9	2.02E01	14.7
LYM23 6	12594. 3	A	91.3 77	6.02E01	1.6	LYM 12	11873. 4	P	2.15 3	2.17E01	3.4
LYM23 6	12592. 4	A	90.9 99	6.25E01	1.2	LYM23 9	13044. 8	P	2.22 3	2.38E01	6.7
LYM 14 7	12583. 1	A	90.9 12	6.62E01	1.1	LYM66	11953. 6	P	2.16 9	2.58E01	4.2
LYM 14 9	12341. 1	A	91.3 27	6.71E01	1.6	LYM23 9	13042. 9	P	2.33	2.67E01	11.9
LYM73	12622. 2	A	91.9 11	6.73E01	2.2	LYM23 2	13024. 6	P	2.22 1	2.68E01	6.6
LYM20 6	12601. 2	A	90.4 59	7.06E01	0.6	LYM 12	11871. 1	P	2.37 8	3.29E01	14.2
LYM20 6	12603. 1	A	90.2 7	7.13E01	0.4	LYM95	12124. 4	P	2.24 5	3.30E01	7.8
LYM6	11733. 2	A	90.2 49	7.32E01	0.4	LYM 14	12051. 4	P	2.23 4	3.46E01	7.3
LYM25 6	13324. 2	A	90.1 78	7.88E01	0.3	LYM30	11912. 7	P	2.13 4	3.65E01	2.5
LYM 14 9	12341. 3	A	90.2 21	7.91E01	0.3	LYM62	12023. 2	P	2.20 2	3.71E01	5.7
LYM91	13284. 4	A	90.4 29	8.53E01	0.6	LYM 10 3	12712. 8	P	2.20 1	3.96E01	5.7
LYM6	11736. 1	A	90.2 97	9.04E01	0.4	LYM20	11716. 5	P	2.15 5	4.05E01	3.5
LYM23 6	12593. 4	A	90.0 2	9.77E01	0.1	LYM69	11852. 2	P	2.18 8	4.52E01	5.1
LYM89	12211. 2	A	89.9 55	9.84E01	0	LYM30	11912. 6	P	2.20 2	5.00E01	5.7
CONTR OL	—	A	89.9 23	—	0	LYM 14 5	12951. 9	P	2.11 7	5.23E01	1.7
LYM99	12243. 1	B	0.44 4	1.98E03	23	LYM 12 8	12641. 1	P	2.19	5.43E01	5.2
LYM 17 8	12163. 3	B	0.40 8	2.91E02	13.1	LYM67	11782. 4	P	2.22 1	5.46E01	6.7
LYM28 3	13302. 1	B	0.49 1	3.45E02	36	LYM23 2	13024. 7	P	2.36 6	5.92E01	13.6
LYM 15 9	13354. 6	B	0.40 6	1.13E01	12.6	LYM30	11913. 5	P	2.21	6.02E01	6.1

233

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM 12 9	12573. 5	B	0.40 9	1.16E- 01	13.3	LYM26	11824. 5	P	2.26 8	6.14E- 01	8.9
LYM25 0	12613. 4	B	0.40 3	1.57E- 01	11.6	LYM 11 6	13204. 4	P	2.29 2	6.62E01	10.1
LYM 17 8	12164. 2	B	0.39 9	2.93E01	10.5	LYM 15 6	12961. 9	P	2.10 6	6.63E01	1.1
LYM23 6	12594. 3	B	0.39 1	2.93E01	8.4	LYM28 5	12734. 9	P	2.18 9	6.81E- 01	5.1
LYM89	12214. 4	B	0.37 9	3.31E- 01	5	LYM24	12064. 1	P	2.18 2	6.92E01	4.8
LYM6	11736. 1	B	0.39 5	3.53E01	9.5	LYM 15 6	12963. 1	P	2.13 8	7.88E01	2.7
LYM91	13284. 3	B	0.48 6	3.66E01	34.6	LYM30	11913. 4	P	2.11 9	8.02E01	1.8
LYM88	12193. 1	B	0.37 8	3.74E01	4.6	LYM26	11821. 2	P	2.13 9	8.11E- 01	2.7
LYM28 3	13302. 2	B	0.38 2	3.95E01	5.8	LYM43	11793. 2	P	2.11 9	8.47E01	1.8
LYM20 6	12601. 2	B	0.44 7	4.11E01	23.9	LYM43	11791. 5	P	2.09 6	8.52E01	0.6
LYM91	13284. 5	B	0.38 9	4.14E01	7.9	LYM 10 3	12712. 5	P	2.08 5	9.78E01	0.1
LYM23 6	12592. 3	B	0.40 3	4.39E01	11.7	CONTR OL	—	P	2.08 2	—	0
LYM28 3	13304. 4	B	0.49 1	4.67E01	36	LYM28 9	12492. 2	A	92.9 47	1.86E- 01	1.4
LYM20 6	12603. 1	B	0.39	4.67E01	8.1	LYM25 5	13082. 5	A	92.8 25	2.17E01	1.3
LYM 17 5	12651. 2	B	0.44 2	4.72E01	22.5	LYM 17 3	12981. 6	A	93.6 46	2.22E01	2.2
LYM73	12623. 2	B	0.42 5	4.91E01	17.8	LYM 10 6	12144. 4	A	92.7 05	3.20E01	1.2
LYM25 0	12611. 3	B	0.42 9	4.98E01	19	LYM21 2	13032. 8	A	92.5 13	3.49E01	1
LYM20 6	12603. 3	B	0.39	4.98E01	8.1	LYM 10 2	12222. 1	A	92.5 3	3.64E01	1
LYM 15 9	13352. 4	B	0.39 6	5.08E01	9.7	LYM61	13171. 8	A	96.6 67	3.77E01	5.5
LYM 15 7	13342. 4	B	0.37 4	5.11E- 01	3.6	LYM22 0	12851. 12	A	92.9 9	4.10E01	1.5
LYM 15 9	13354. 5	B	0.41 2	5.21E- 01	14.3	LYM 11 1	12254. 3	A	92.6 06	4.40E01	1.1
LYM99	12243. 2	B	0.45 1	5.34E01	25.1	LYM28 7	12771. 6	A	93.3 04	4.59E01	1.8
LYM89	12211. 2	B	0.45 4	5.40E01	25.9	LYM21 2	13031. 5	A	93.6 14	4.80E01	2.2
LYM 17 8	12163. 4	B	0.38 8	5.58E01	7.4	LYM 10 6	12142. 2	A	92.2 75	4.86E01	0.7
LYM 12 9	12573. 3	B	0.39 3	5.67E01	9	LYM 13 8	12562. 2	A	92.3 21	4.89E01	0.8
LYM 17 8	12164. 3	B	0.44 8	5.70E01	24.2	LYM 11 9	12461. 1	A	92.3 76	4.93E01	0.8

234

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM 10 7	12631. 4	B	0.43 6	5.95E01	20.9	LYM28 8	12743. 8	A	92.2 88	5.05E01	0.7
LYM25 0	12613. 2	B	0.38 1	5.96E01	5.7	LYM27 0	12871. 7	A	92.6 01	5.14E01	1.1
LYM 17 8	12161. 2	B	0.39 6	5.98E01	9.7	LYM 18 3	12993. 7	A	92.2 09	5.32E01	0.6
LYM 10 7	12633. 4	B	0.39 9	6.05E01	10.7	LYM 13 8	12562. 1	A	92.2 98	5.80E01	0.7
LYM 14 9	12341. 1	B	0.43 8	6.07E01	21.4	LYM21 2	13031. 6	A	92.7 57	5.96E01	1.2
LYM 14 9	12344. 2	B	0.44 6	7.09E01	23.7	LYM22 0	12852. 2	A	92.2 25	6.15E01	0.7
LYM 14 7	12583. 3	B	0.38 9	7.15E01	7.9	LYM44	11885. 4	A	92.0 76	6.37E01	0.5
LYM 12 9	12572. 4	B	0.37 9	7.22E01	5.2	LYM 11 1	12251. 1	A	92.2 35	6.39E01	0.7
LYM88	12191. 2	B	0.36 8	7.24E01	1.9	LYM 18 3	12993. 5	A	92.2 76	6.42E01	0.7
LYM23 6	12591. 1	B	0.37	7.41E01	2.6	LYM28 9	12491. 1	A	92.3 18	6.45E01	0.8
LYM 15 9	13354. 8	B	0.4	7.62E01	10.9	LYM24 2	13053. 7	A	92.3 83	6.48E01	0.8
LYM 14 7	12583. 1	B	0.36 6	7.74E01	1.5	LYM20 1	12833. 9	A	92.1 11	6.51E01	0.5
LYM 17 5	12654. 4	B	0.37 6	7.81E01	4.2	LYM20 1	12833. 7	A	92.1 64	6.53E01	0.6
LYM 14 7	12584. 5	B	0.37 1	8.02E01	2.9	LYM24 2	13051. 8	A	92.2 32	6.65E01	0.7
LYM25 6	13324. 2	B	0.37 5	8.21E01	3.9	LYM20 8	13014. 7	A	92.4 84	6.76E01	0.9
LYM25 0	12614. 1	B	0.37 1	8.33E01	2.7	LYM 19 8	13002. 8	A	92.0 42	6.93E01	0.5
LYM6	11735. 1	B	0.36 3	8.97E01	0.6	LYM 15 3	12323. 2	A	91.9 83	7.00E01	0.4
LYM91	13283. 4	B	0.36 3	9.28E01	0.6	LYM 14 2	12802. 7	A	92.0 44	7.19E01	0.5
LYM73	12623. 3	B	0.36 7	9.60E01	1.7	LYM 18 3	12994. 8	A	92.0 15	7.24E01	0.4
CONTR OL	—	B	0.36 1	—	0	LYM 14 2	12802. 9	A	91.9 61	7.32E01	0.4
LYM25 0	12613. 4	C	4.50 6	3.98E04	15.2	LYM61	13174. 5	A	92.7 81	7.51E01	1.3
LYM20 6	12601. 2	C	4.46 3	1.11E03	14.1	LYM 10 7	12632. 3	A	91.9 22	7.63E01	0.3
LYM 15 9	13354. 6	C	4.33 1	2.97E03	10.7	LYM29 1	12754. 9	A	91.8 75	7.86E01	0.3
LYM20 6	12603. 3	C	4.43 8	3.26E03	13.5	LYM20 1	12833. 6	A	93.2 31	7.98E01	1.8
LYM73	12623. 2	C	4.3	4.40E03	9.9	LYM44	11885. 3	A	91.8 67	8.04E01	0.3
LYM 10 7	12633. 4	C	4.35 6	5.15E03	11.4	LYM 13 0	12332. 1	A	92.0 65	8.21E01	0.5

235

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM 17 8	12163. 3	C	4.19 4	2.03E02	12	LYM 13 7	12153. 1	A	91.9 68	8.65E01	0.4
LYM25 0	12613. 2	c	4.17 5	3.20E02	6.7	LYM 11 1	12254. 4	A	91.8 77	8.89E01	0.3
LYM88	12191. 2	c	4.37 5	3.90E02	11.9	LYM61	13172. 4	A	92.0 25	8.90E01	0.4
LYM 15 9	13352. 4	c	4.27 5	4.86E02	9.3	LYM 10 0	12134. 1	A	91.7 57	8.94E01	0.1
LYM91	13284. 3	c	4.8	6.56E02	22.7	LYM90	12392. 1	A	91.7 9	9.06E01	0.2
LYM20 6	12603. 1	c	4.2	1.21E01	7.4	LYM 13 0	12333. 1	A	91.9 1	9.11E01	0.3
LYM23 6	12594. 3	c	4.18 1	1.21E01	6.9	LYM 19 7	12824. 4	A	91.7 79	9.37E01	0.2
LYM 17 8	12161. 2	c	4.3	1.39E01	9.9	LYM90	12394. 2	A	91.6 91	9.53E01	0.1
LYM90	12395. 1	c	4.16 3	1.59E01	6.4	LYM29 1	12753. 6	A	91.6 69	9.65E01	0
LYM 17 5	12651. 2	c	4.53 8	1.78E01	16	LYM 10 5	12293. 1	A	91.6 57	9.77E01	0
LYM99	12243. 1	c	4.78 1	1.90E01	22.2	LYM20 8	13013. 6	A	91.6 63	9.84E01	0
LYM 15 7	13342. 4	c	4.31 3	2.08E01	10.3	LYM90	12393. 4	A	91.6 27	9.99E01	0
LYM23 6	12592. 3	c	4.31 3	2.53E01	10.3	CONTR OL	—	A	91.6 24	—	0
LYM23 6	12591. 1	c	4.07 5	2.73E01	4.2	LYM 15 2	12373. 2	B	0.35 7	1.21E03	50.4
LYM 12 9	12573. 5	c	4.21 9	2.73E01	7.9	LYM 10 2	12222. 1	B	0.38 6	1.41E03	62.7
LYM25 6	13321. 2	c	4.18 8	3.23E01	7.1	LYM 17 4	12411. 2	B	0.34 4	2.44E03	44.8
LYM6	11735. 1	c	4.14 4	3.41E01	5.9	LYM 11 1	12251. 1	B	0.37 9	3.24E03	59.8
LYM99	12241. 1	c	4.01 3	3.48E01	2.6	LYM 10 0	12133. 3	B	0.34 9	3.88E03	47.2
LYM88	12193. 1	c	4.13 8	3.66E01	5.8	LYM 10 6	12144. 4	B	0.33 4	6.10E03	40.6
LYM6	11736. 1	c	4.63 8	3.77E01	18.6	LYM 10 7	12632. 3	B	0.38 6	6.60E03	62.7
LYM28 3	13304. 4	c	4.56 9	3.87E01	16.8	LYM 17 4	12414. 3	B	0.32 4	7.65E03	36.4
LYM25 0	12611. 3	c	4.56 9	4.20E01	16.8	LYM 10 2	12222. 2	B	0.34 5	9.57E03	45.4
LYM 12 9	12572. 4	c	4.31 9	4.24E01	10.4	LYM 10 7	12631. 2	B	0.31 2	1.54E02	31.4
LYM 17 8	12163. 4	c	4.26 6	4.25E01	9.1	LYM 10 2	12221. 2	B	0.33 6	1.60E02	41.4
LYM 14 7	12583. 3	c	4	4.32E01	2.3	LYM 10 5	12294. 3	B	0.31 3	1.62E02	31.7
LYM25 0	12614. 1	c	4.33 1	4.39E01	10.7	LYM 14 3	12524. 5	B	0.31 2	1.76E02	31.4

236

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM 17 5	12654. 4	C	4.17 8	4.45E01	6.8	LYM 10 0	12133. 1	B	0.32 5	1.79E02	36.9
LYM6	11733. 2	c	4.11 3	4.62E01	5.1	LYM 19 8	13004. 6	B	0.31 9	2.41E02	34.3
LYM 15 9	13354. 5	c	4.51 5	4.68E01	15.4	LYM 13 7	12153. 1	B	0.30 5	2.82E02	28.5
LYM91	13283. 4	c	4.14 4	4.87E01	5.9	LYM 10 7	12632. 1	B	0.34 6	3.57E02	45.6
LYM 17 8	12164. 3	c	4.48 1	5.11E01	14.6	LYM 11 1	12254. 4	B	0.40 4	3.60E02	70.4
LYM28 3	13302. 1	c	4.23 1	5.82E01	8.2	LYM 10 5	12297. 2	B	0.29 7	4.45E02	25.1
LYM25 6	13323. 3	c	3.98 8	6.15E01	2	LYM 13 7	12151. 1	B	0.32 3	4.83E02	36.1
LYM99	12243. 2	c	4.23 8	6.45E01	8.3	LYM 14 3	12523. 4	B	0.29 3	4.91E02	23.2
LYM 10 7	12631. 4	c	4.1	6.53E01	4.8	LYM 11 1	12251. 3	B	0.31 9	5.49E02	34.6
LYM 17 8	12164. 2	c	4.03 1	6.82E01	3.1	LYM 10 6	12142. 3	B	0.33 6	5.57E02	41.4
LYM 14 7	12584. 5	c	4.06 9	6.98E01	4	LYM22 0	12851. 8	B	0.30 1	5.77E02	26.9
LYM25 6	13324. 2	c	4.01 3	7.05E01	2.6	LYM 10 2	12221. 1	B	0.29 9	6.79E02	26.1
LYM88	12192. 1	c	3.98 8	7.11E01	2	LYM 17 4	12412. 1	B	0.38 4	7.26E02	61.7
LYM23 6	12592. 4	c	4.13 8	7.17E01	5.8	LYM 13 7	12152. 1	B	0.28 6	8.50E02	20.3
LYM89	12211. 2	c	4.09 4	7.24E01	4.7	LYM 13 7	12154. 5	B	0.29 1	8.50E02	22.4
LYM 15 7	13341. 4	c	4.05	7.44E01	3.5	LYM 14 3	12524. 7	B	0.28 9	9.00E02	21.7
LYM89	12214. 4	c	3.95 6	7.54E01	1.2	LYM 13 8	12561. 3	B	0.29 3	9.03E02	23.2
LYM86	12181. 2	c	3.98 8	7.84E01	2	LYM 10 2	12222. 3	B	0.40 4	9.03E02	70.1
LYM73	12622. 2	c	4.06 3	8.04E01	3.9	LYM 14 2	12804. 1	B	0.28 5	9.32E02	20
LYM 14 9	12344. 2	c	4.24 4	8.12E01	8.5	LYM 10 5	12293. 1	B	0.28 3	1.01E01	19
LYM 15 9	13354. 8	c	4.03 1	8.41E01	3.1	LYM 10 7	12631. 1	B	0.32 6	1.10E01	37.5
LYM86	12183. 3	c	3.94 4	8.67E01	0.8	LYM21 2	13031. 6	B	0.28 4	1.11E01	19.6
LYM25 6	13322. 3	c	3.92 5	9.00E01	0.4	LYM29 1	12754. 9	B	0.51 6	1.24E01	117.5
LYM28 3	13302. 2	c	3.92 5	9.20E01	0.4	LYM 10 5	12297. 1	B	0.40 2	1.35E01	69.3
LYM6	11735. 2	c	3.93 1	9.33E01	0.5	LYM 13 8	12562. 1	B	0.27 8	1.36E01	17.2
CONTR OL	—	c	3.91 1	—	0	LYM 10 0	12131. 2	B	0.35	1.42E01	47.4

237

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM 10 7	12631. 4	D	0.28 6	2.09E03	30.2	LYM 10 0	12131. 3	B	0.3	1.45E01	26.4
LYM23 6	12592. 3	D	0.28 2	3.DEOS	28.3	LYM28 9	12491. 1	B	0.34 8	1.51E01	46.7
LYM 14 7	12583. 3	D	0.27 8	7.97E03	26.3	LYM 17 3	12982. 7	B	0.32 6	1.56E01	37.5
LYM 12 9	12572. 4	D	0.27	9.42E03	22.7	LYM 10 6	12144. 3	B	0.35 1	1.59E01	48
LYM6	11736. 1	D	0.26 8	1.07E02	22.1	LYM 17 4	12414. 2	B	0.38 4	1.60E01	61.7
LYM 17 8	12163. 4	D	0.28 3	1.31E02	28.9	LYM 10 7	12633. 4	B	0.37 2	1.75E01	56.7
LYM89	12211. 4	D	0.26 9	3.53E02	22.3	LYM21 2	13032. 8	B	0.30 4	1.89E01	28.2
LYM73	12623. 2	D	0.25 4	4.68E02	15.5	LYM 15 3	12324. 2	B	0.27 1	1.90E01	14.3
LYM90	12395. 3	D	0.28 5	6.11E02	29.5	LYM 14 3	12521. 1	B	0.30 3	1.91E01	27.5
LYM99	12243. 2	D	0.26 3	6.21E02	19.6	LYM 13 8	12561. 1	B	0.31 9	1.91E01	34.3
LYM88	12193. 1	D	0.28 8	6.59E02	30.9	LYM 10 0	12134. 1	B	0.29 8	1.91E01	25.6
LYM20 6	12603. 1	D	0.27 1	6.76E02	23.2	LYM 15 2	12371. 3	B	0.31 1	2.03E01	30.9
LYM25 0	12613. 2	D	0.25 1	6.95E02	14.5	LYM28 9	12493. 2	B	0.28 1	2.03E01	18.5
LYM90	12392. 1	D	0.24 9	7.55E02	13.5	LYM 10 6	12142. 2	B	0.45 1	2.04E01	89.9
LYM86	12182. 3	D	0.24 7	9.53E02	12.5	LYM 10 6	12141. 4	B	0.42 7	2.09E01	79.9
LYM90	12395. 1	D	0.27 8	1.03E01	26.4	LYM 17 3	12982. 6	B	0.34	2.21E01	43.3
LYM 14 7	12584. 4	D	0.24 4	1.25E01	11.2	LYM 10 7	12631. 4	B	0.50 3	2.37E01	112.1
LYM 17 8	12161. 2	D	0.26 8	1.42E01	22.2	LYM 13 7	12151. 4	B	0.33 7	2.43E01	41.9
LYM23 6	12594. 3	D	0.24 5	1.49E01	11.3	LYM28 8	12744. 7	B	0.31 9	2.48E01	34.3
LYM 12 8	12641. 3	D	0.24 3	1.63E01	10.8	LYM 15 3	12324. 1	B	0.37 6	2.54E01	58.3
LYM 17 8	12164. 3	D	0.24 2	1.63E01	10.3	LYM 11 1	12254. 3	B	0.27 5	2.65E01	15.9
LYM20 6	12603. 3	D	0.34 5	1.82E01	57	LYM 19 7	12824. 4	B	0.34	2.66E01	43.4
LYM 15 9	13354. 6	D	0.25 7	1.95E01	16.9	LYM 10 2	12222. 6	B	0.52 8	2.70E01	122.3
LYM73	12623. 1	D	0.24 7	2.14E01	12.5	LYM 15 2	12371. 2	B	0.32 3	2.76E01	35.9
LYM 15 9	13354. 5	D	0.24 1	2.20E01	9.8	LYM22 0	12851. 12	B	0.26 6	2.76E01	11.9
LYM 12 9	12573. 3	D	0.26 7	2.33E01	21.4	LYM 13 8	12566. 1	B	0.29 6	2.78E01	24.6

238

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM25 0	12613. 4	D	0.32 6	2.36E01	48.2	LYM 19 8	13002. 6	B	0.40 1	2.91E01	68.8
LYM 10 7	12633. 4	D	0.32 1	2.54E01	45.9	LYM 17 3	12981. 5	B	0.26 8	2.98E01	13
LYM88	12191. 2	D	0.28 5	2.57E01	29.6	LYM 14 2	12802. 9	B	0.32 3	3.06E01	36.1
LYM 17 5	12651. 2	D	0.24 1	2.65E01	9.5	LYM44	11884. 1	B	0.26 3	3.14E- 01	10.6
LYM6	11735. 1	D	0.29 8	2.86E01	35.7	LYM 14 3	12521. 2	B	0.26 5	3.27E01	11.7
LYM25 0	12614. 1	D	0.24	2.88E01	9.2	LYM 15 2	12372. 2	B	0.28 4	3.43E01	19.7
LYM 15 7	13341. 4	D	0.23 5	3.14E- 01	7.1	LYM28 8	12743. 9	B	0.38 1	3.52E01	60.6
LYM 17 8	12163. 3	D	0.27 4	3.28E01	24.7	LYM 17 3	12981. 6	B	0.32 7	3.64E01	37.7
LYM99	12243. 1	D	0.29 8	3.29E01	35.7	LYM 11 1	12252. 2	B	0.40 9	3.69E01	72.2
LYM88	12194. 2	D	0.24 2	3.37E01	10	LYM 11 1	12251. 4	B	0.33 6	3.76E01	41.7
LYM 12 9	12573. 5	D	0.28 6	3.40E01	30	LYM28 9	12491. 4	B	0.35 6	3.78E01	50.1
LYM86	12183. 3	D	0.23 5	3.42E01	6.9	LYM 19 8	13002. 8	B	0.27 6	3.80E01	16.1
LYM89	12214. 2	D	0.28 3	3.49E01	29	LYM 11 9	12463. 2	B	0.33 6	3.81E- 01	41.4
LYM20 6	12601. 2	D	0.33 2	3.68E01	51	LYM 10 5	12294. 2	B	0.30 9	3.82E01	30.3
LYM 12 8	12642. 3	D	0.25 4	4.14E01	15.4	LYM25 5	13082. 5	B	0.26 8	3.92E01	12.7
LYM91	13284. 3	D	0.25 7	4.24E01	16.8	LYM 14 2	12803. 6	B	0.42 6	3.92E01	79.3
LYM23 6	12591. 1	D	0.27	4.45E01	23	LYM 10 5	12295. 2	B	0.32 6	3.98E01	37.5
LYM91	13283. 1	D	0.23 1	4.60E01	5	LYM20 8	13013. 6	B	0.35 9	4.05E01	51.2
LYM89	12214. 3	D	0.25 6	4.88E01	16.3	LYM24 2	13051. 8	B	0.31 2	4.11E01	31.4
LYM20 6	12601. 3	D	0.23 2	5.03E01	5.4	LYM 18 3	12991. 7	B	0.25 8	4.18E01	8.5
LYM86	12183. 1	D	0.24 5	5.08E01	11.6	LYM 11 9	12461. 1	B	0.27	4.22E01	13.8
LYM23 6	12592. 4	D	0.26 9	5.38E01	22.2	LYM 14 2	12801. 8	B	0.25 8	4.22E01	8.8
LYM 17 5	12654. 4	D	0.26 2	5.39E01	19	LYM28 8	12743. 8	B	0.26 9	4.37E01	13.5
LYM90	12393. 1	D	0.25 1	5.42E01	14.3	LYM28 7	12773. 7	B	0.30 3	4.38E01	27.5
LYM25 0	12614. 2	D	0.24 3	5.44E01	10.5	LYM21 2	13031. 5	B	0.26 6	4.43E01	11.9
LYM25 0	12611. 3	D	0.26 5	5.54E01	20.5	LYM25 5	13082. 7	B	0.26 4	4.46E01	11.4

239

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM28 3	13304. 4	D	0.25 1	6.17E01	14.1	LYM 14 3	12524. 2	B	0.30 9	4.52E01	30.3
LYM6	11733. 2	D	0.23 5	6.79E01	6.8	LYM 15 3	12321. 2	B	0.30 3	4.54E01	27.5
LYM 14 7	12584. 5	D	0.22 7	6.93E01	3.3	LYM27 0	12871. 7	B	0.26 4	4.64E01	11.1
LYM 15 7	13342. 4	D	0.24 9	7.01E01	13.2	LYM20 8	13012. 8	B	0.34 9	4.64E01	46.9
LYM91	13283. 4	D	0.24 8	7.12E01	12.8	LYM22 0	12851. 11	B	0.27 3	4.64E01	15
LYM 12 8	12641. 1	D	0.23 6	7.33E01	7.6	LYM25 5	13082. 9	B	0.32 7	4.69E01	37.7
LYM20 6	12603. 2	D	0.22 5	7.44E01	2.4	LYM 15 2	12373. 1	B	0.25 6	4.76E01	8
LYM73	12622. 2	D	0.23 4	8.40E01	6.4	LYM 17 4	12411. 3	B	0.26 5	4.89E01	11.7
LYM 17 5	12654. 6	D	0.22 6	8.63E01	2.7	LYM 17 3	12981. 8	B	0.25 4	4.95E01	7
LYM 15 9	13352. 4	D	0.22 5	8.63E01	2.3	LYM28 8	12741. 9	B	0.26 8	5.10E01	12.7
LYM 14 7	12583. 1	D	0.23 5	8.75E01	7.2	LYM27 0	12871. 5	B	0.26 2	5.13E01	10.5
LYM 17 8	12164. 2	D	0.22 6	8.77E01	3	LYM44	11885. 4	B	0.28 1	5.16E01	18.5
LYM88	12191. 1	D	0.22 5	9.11E01	2.2	LYM 11 9	12462. 2	B	0.36 1	5.34E01	52.2
LYM89	12214. 4	D	0.22 1	9.16E01	0.7	LYM 13 0	12332. 2	B	0.27 5	5.42E01	15.9
LYM 14 9	12344. 2	D	0.22 7	9.29E01	3.5	LYM21 2	13034. 9	B	0.25 6	5.42E01	8
LYM 14 7	12581. 4	D	0.22 3	9.55E01	1.6	LYM 14 2	12804. 3	B	0.25 9	5.43E01	9.3
LYM 17 5	12651. 4	D	0.22 2	9.80E01	1	LYM 19 7	12824. 7	B	0.29 3	5.46E01	23.2
CONTR OL	—	D	0.22	—	0	LYM22 0	12851. 13	B	0.26 2	5.67E01	10.3
LYM 10 7	12633. 4	E	9.18 8	1.23E03	8.4	LYM 19 8	13002. 5	B	0.28 2	5.80E01	18.8
LYM20 6	12603. 3	E	9.18 8	1.23E03	8.4	LYM 13 7	12151. 2	B	0.25 2	5.93E01	6.1
LYM88	12193. 1	E	9.06 3	3.77E03	6.9	LYM 18 3	12993. 7	B	0.27 7	6.04E01	16.7
LYM6	11734. 3	E	9.12 5	2.59E02	7.7	LYM21 2	13034. 8	B	0.29 4	6.34E01	23.8
LYM 15 7	13341. 4	E	8.81 3	4.79E02	4	LYM22 0	12852. 2	B	0.26 1	6.54E01	10.1
LYM28 3	13304. 4	E	8.81 3	4.79E02	4	LYM 13 0	12331. 3	B	0.28 4	6.60E01	19.6
LYM 17 8	12164. 3	E	8.87 5	9.63E02	4.7	LYM28 8	12744. 6	B	0.25 8	6.65E01	8.8
LYM90	12393. 1	E	9.06 3	1.17E01	6.9	LYM29 1	12753. 6	B	0.24 9	6.65E01	5.1

240

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM90	12395. 1	E	9.12 5	1.79E01	7.7	LYM 13 8	12564. 1	B	0.25 9	6.70E01	9
LYM25 0	12613. 4	E	8.68 8	1.79E01	2.5	LYM28 9	12492. 2	B	0.26 3	6.79E01	10.6
LYM99	12243. 2	E	8.68 8	1.79E01	2.5	LYM20 1	12833. 7	B	0.28 1	6.89E01	18.5
LYM 10 7	12631. 4	E	8.75	2.07E01	3.2	LYM 13 0	12334. 1	B	0.24 7	7.13E- 01	4
LYM73	12623. 2	E	8.75	2.07E01	3.2	LYM 13 8	12562. 2	B	0.25 2	7.28E01	6.1
LYM90	12395. 3	E	9.18 8	3.34E01	8.4	LYM 14 2	12802. 7	B	0.24 6	7.38E01	3.5
LYM 14 7	12583. 3	E	8.68 8	4.46E01	2.5	LYM 13 0	12333. 1	B	0.25 7	7.42E01	8.2
LYM25 0	12614. 1	E	8.68 8	4.46E01	2.5	LYM 15 3	12323. 2	B	0.25 5	7.44E01	7.4
LYM 12 8	12642. 3	E	8.62 5	4.56E01	1.8	LYM 10 6	12142. 1	B	0.26 2	7.70E01	10.3
LYM 12 9	12573. 3	E	8.62 5	4.56E01	1.8	LYM27 0	12872. 5	B	0.24 4	7.99E01	2.7
LYM88	12191. 2	E	8.62 5	4.56E01	1.8	LYM 18 3	12994. 7	B	0.24 3	8.20E01	2.4
LYM89	12211. 4	E	8.62 5	4.56E01	1.8	LYM24 2	13053. 7	B	0.24 2	8.52E01	1.9
LYM99	12243. 1	E	8.62 5	4.56E01	1.8	LYM 18 3	12994. 8	B	0.24 3	8.58E01	2.2
LYM20 6	12603. 1	E	8.56 3	5.62E01	1	LYM29 1	12751. 7	B	0.24 3	8.65E01	2.4
LYM6	11733. 2	E	8.56 3	5.62E01	1	LYM28 7	12771. 6	B	0.24 1	8.75E01	1.6
LYM86	12182. 3	E	8.56 3	5.62E01	1	LYM44	11884. 3	B	0.24 6	9.08E01	3.8
LYM6	11735. 1	E	8.81 3	5.79E01	4	LYM27 0	12872. 7	B	0.24 5	9.08E01	3.2
LYM23 6	12591. 1	E	8.75	5.95E01	3.2	LYM25 5	13081. 5	B	0.24 4	9.17E01	3
LYM73	12623. 1	E	8.75	5.95E01	3.2	LYM27 0	12871. 8	B	0.23 8	9.96E01	0.1
LYM 17 8	12163. 3	E	8.68 8	6.19E- 01	2.5	CONTR OL	—	B	0.23 7	—	0
LYM 14 7	12584. 4	E	8.56 3	7.37E01	1	LYM 10 2	12221. 2	C	3.18 1	7.20E05	59.4
LYM91	13283. 1	E	8.56 3	8.30E01	1	LYM 17 4	12411. 2	C	3.1	1.24E- 04	55.4
LYM23 6	12594. 3	E	8.62 5	8.51E- 01	1.8	LYM 11 1	12254. 4	C	3.5	1.46E- 04	75.4
LYM25 0	12613. 2	E	8.5	8.55E01	0.3	LYM 13 7	12151. 1	C	3.04 4	1.55E- 04	52.5
LYM 12 8	12641. 3	E	8.5	8.98E01	0.3	LYM 10 2	12222. 2	C	3.03 1	2.15E04	51.9
LYM20 6	12601. 2	E	8.5	8.98E01	0.3	LYM 19 8	13004. 6	C	2.96 9	2.68E04	48.8

241

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM23 6	12592. 3	E	8.5	8.98E01	0.3	LYM10 6	12144. 4	C	2.88 1	4.76E04	44.4
LYM15 9	13354. 5	E	8.52 1	9.20E01	0.5	LYM17 4	12414. 3	c	2.85 6	5.73E04	43.1
LYM12 9	12572. 4	E	8.5	9.40E01	0.3	LYM15 2	12373. 2	c	2.85 6	6.33E04	43.1
LYM17 5	12653. 3	E	8.5	9.40E01	0.3	LYM10 5	12297. 2	c	2.86 9	7.57E04	43.8
LYM17 8	12164. 2	E	8.5	9.40E01	0.3	LYM13 7	12152. 1	c	2.73 1	1.65E03	36.9
LYM99	12241. 1	E	8.5	9.40E01	0.3	LYM10 0	12134. 1	c	2.88 1	1.87E- 03	44.4
LYM15 7	13342. 4	E	8.5	9.59E01	0.3	LYM10 7	12632. 1	c	2.91 3	2.19E03	46
CONTR OL	—	E	8.47 5	—	0	LYM10 5	12294. 3	c	2.8	2.39E03	40.3
LYM20 6	12603. 3	F	0.57 9	5.70E05	43	LYM10 7	12631. 1	c	2.68 8	2.68E03	34.7
LYM23 6	12592. 3	F	0.48 7	6.32E03	20.3	LYM10 7	12632. 3	c	3.3	3.16E- 03	65.4
LYM73	12623. 1	F	0.44 2	1.25E01	9.2	LYM10 7	12631. 2	c	2.68 1	6.82E03	34.4
LYM12 9	12572. 4	F	0.44 2	1.62E01	9.1	LYM10 0	12133. 3	c	3.29 4	7.28E03	65.1
LYM73	12623. 2	F	0.43 8	1.80E01	8	LYM19 7	12824. 4	c	2.73 8	9.52E03	37.2
LYM15 9	13354. 6	F	0.44 3	1.85E01	9.4	LYM10 6	12141. 4	c	3.67 5	1.04E02	84.2
LYM20 6	12603. 1	F	0.45 6	1.88E01	12.6	LYM15 2	12373. 1	c	2.5	1.15E02	25.3
LYM25 0	12613. 4	F	0.53 3	2.23E01	31.6	LYM14 3	12523. 4	c	2.55 6	1.22E02	28.1
LYM14 7	12583. 3	F	0.43 4	2.25E01	7.1	LYM11 1	12251. 1	c	3.52 5	1.30E02	76.7
LYM90	12395. 3	F	0.43 2	2.54E01	6.6	LYM29 1	12754. 9	c	4.03 1	1.90E02	102
LYM90	12395. 1	F	0.45 9	2.58E01	13.2	LYM14 2	12804. 1	c	2.49 4	2.73E02	25
LYM17 8	12163. 4	F	0.48 7	2.76E01	20.2	LYM10 2	12221. 1	c	2.81 3	3.28E02	41
LYM89	12211. 4	F	0.43 3	2.87E01	7	LYM28 8	12744. 7	c	2.63 8	3.46E02	32.2
LYM25 0	12614. 1	F	0.42 9	3.05E01	5.8	LYM10 0	12131. 2	c	3.15 4	3.50E02	58
LYM10 7	12633. 4	F	0.48 7	3.08E01	20.2	LYM11 1	12254. 3	c	2.56 3	3.71E- 02	28.4
LYM23 6	12591. 1	F	0.48 1	3.14E- 01	18.8	LYM10 5	12297. 1	c	3.26 9	4.57E02	63.8
LYM88	12193. 1	F	0.49	3.39E01	20.9	LYM21 2	13031. 5	c	2.35 4	4.66E02	18
LYM23 6	12594. 3	F	0.46	3.51E- 01	13.6	LYM18 3	12991. 7	c	2.45 6	4.75E02	23.1

242

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM99	12243. 1	F	0.49 6	3.78E01	22.5	LYM10 2	12222. 1	C	3.55 6	5.16E02	78.2
LYM6	11735. 1	F	0.48 2	4.20E01	19.1	LYM14 3	12524. 5	c	2.75 6	5.74E02	38.1
LYM17 8	12161. 2	F	0.46 5	4.22E01	14.9	LYM10 2	12222. 3	c	3.76 9	6.05E02	88.9
LYM25 0	12614. 2	F	0.45 2	4.40E01	11.5	LYM10 5	12293. 1	c	2.41 9	6.23E02	21.2
LYM15 7	13341. 4	F	0.43 5	4.48E01	7.4	LYM27 0	12871. 5	c	2.32 1	6.49E02	16.3
LYM17 5	12654. 4	F	0.47 2	4.48E01	16.5	LYM15 3	12324. 2	c	2.31 3	7.05E02	15.9
LYM12 9	12573. 5	F	0.45 7	4.50E01	12.9	LYM10 0	12133. 1	c	3.28 8	7.40E02	64.8
LYM20 6	12603. 2	F	0.42 2	4.75E01	4.3	LYM10 6	12142. 3	c	3.03 8	8.14E02	52.2
LYM12 8	12641. 1	F	0.42 4	4.85E01	4.7	LYM15 2	12372. 2	c	2.60 5	9.07E02	30.6
LYM17 8	12163. 3	F	0.44 1	4.99E01	8.9	LYM17 4	12414. 2	c	3.1	9.40E02	55.4
LYM20 6	12601. 2	F	0.5	5.39E01	23.5	LYM17 4	12412. 1	c	3.26 9	1.06E01	63.8
LYM88	12191. 2	F	0.44 6	6.11E01	10.2	LYM10 6	12144. 3	c	2.81 3	1.07E01	41
LYM15 9	13354. 5	F	0.41 6	7.19E01	2.8	LYM27 0	12872. 5	c	2.37 5	1.14E01	19
LYM12 9	12573. 3	F	0.41 8	7.51E01	3.1	LYM13 8	12566. 1	c	2.83 8	1.14E01	42.2
LYM89	12214. 3	F	0.41 2	8.15E01	1.7	LYM13 8	12561. 3	c	2.61 9	1.21E01	31.2
LYM89	12214. 2	F	0.42 2	8.16E01	4.1	LYM17 3	12981. 8	c	2.26 3	1.25E01	13.4
LYM28 3	13304. 4	F	0.42	8.23E01	3.8	LYM28 9	12491. 1	c	2.9	1.26E01	45.3
LYM23 6	12592. 4	F	0.42 5	8.29E01	5	LYM14 3	12521. 1	c	2.61 3	1.32E01	30.9
LYM25 0	12611. 3	F	0.41 6	8.42E01	2.7	LYM17 3	12982. 6	c	2.86 3	1.34E01	43.5
LYM10 7	12631. 4	F	0.40 9	9.12E01	0.9	LYM21 2	13032. 8	c	2.43 8	1.36E01	22.2
LYM90	12393. 1	F	0.41 1	9.45E01	1.4	LYM13 8	12562. 1	c	2.56 9	1.40E01	28.7
LYM15 9	13352. 4	F	0.40 7	9.49E01	0.4	LYM21 2	13034. 9	c	2.24 4	1.40E01	12.5
LYM91	13284. 3	F	0.41	9.52E01	1.2	LYM10 6	12142. 2	c	3.73 1	1.41E01	87
LYM91	13283. 4	F	0.41 1	9.54E01	1.4	LYM15 3	12324. 1	c	2.83 1	1.48E01	41.9
CONTR OL	—	F	0.40 5	—	0	LYM10 0	12131. 3	c	2.85 6	1.54E01	43.1
LYM6	11734. 3	G	9.53	2.63E01	9.9	LYM10 7	12631. 4	c	4.22 1	1.57E01	111.6

243

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM20 6	12603. 3	G	9.77 2	3.62E01	12.7	LYM28 9	12493. 2	C	2.23 1	1.58E01	11.8
LYM23 6	12591. 1	G	9.15 7	4.16E01	5.6	LYM15 2	12371. 2	c	2.73 1	1.62E01	36.9
LYM99	12243. 1	G	9.09 6	4.92E01	4.9	LYM22 0	12851. 8	c	2.8	1.62E01	40.3
LYM20 6	12601. 2	G	9.11	5.79E01	5	LYM22 0	12851. 12	c	2.24 4	1.69E01	12.5
LYM25 0	12614. 2	G	8.90 5	6.05E01	2.7	LYM13 8	12561. 1	c	3.11 9	1.71E01	56.3
LYM15 9	13354. 5	G	8.84 5	6.87E01	2	LYM13 7	12151. 2	c	2.28 8	1.75E01	14.6
LYM23 6	12592. 3	G	9.01 3	8.02E01	3.9	LYM14 2	12802. 9	c	2.73 8	1.81E01	37.2
LYM17 5	12654. 4	G	8.97 4	8.11E01	3.5	LYM11 1	12252. 2	c	3.17 5	2.04E01	59.1
LYM25 0	12613. 4	G	8.91 3	8.18E01	2.8	LYM10 2	12222. 6	c	4.18 8	2.20E01	109.9
LYM91	13284. 4	G	8.87 7	8.65E01	2.4	LYM14 2	12801. 8	c	2.19 4	2.26E01	9.9
LYM20 6	12603. 1	G	8.75	8.71E01	0.9	LYM10 5	12294. 2	c	2.72 5	2.36E01	36.6
LYM6	11733. 2	G	8.89 1	8.75E01	2.5	LYM28 8	12743. 9	c	2.64 4	2.36E01	32.5
LYM14 7	12584. 4	G	8.74 7	9.59E01	0.9	LYM10 7	12633. 4	c	2.96 9	2.38E01	48.8
LYM17 5	12651. 4	G	8.74 8	9.72E01	0.9	LYM11 1	12251. 3	c	2.93 8	2.59E01	47.2
LYM17 5	12654. 6	G	8.69 7	9.75E01	0.3	LYM14 3	12524. 7	c	2.36 9	2.68E01	18.7
CONTR OL	—	G	8.67 3	—	0	LYM22 0	12852. 4	c	2.19 4	2.78E01	9.9
LYM10 7	12631. 4	H	14.1 58	3.91E03	35.7	LYM19 8	13002. 6	c	3.35 6	2.79E01	68.2
LYM14 7	12583. 3	H	13.5 34	8.52E03	29.7	LYM20 8	13012. 8	c	2.65	2.79E01	32.8
LYM23 6	12592. 3	H	13.4 87	9.09E03	29.3	LYM28 8	12743. 8	c	2.35 6	2.80E01	18.1
LYM90	12395. 1	H	13.7 8	1.94E02	32.1	LYM17 3	12982. 7	c	2.72 5	2.82E01	36.6
LYM12 9	12572. 4	H	12.8 66	2.83E02	23.3	LYM28 9	12491. 4	c	2.77 5	2.83E01	39.1
LYM20 6	12603. 1	H	13.4 05	4.09E02	28.5	LYM11 9	12463. 2	c	2.89 4	2.84E01	45
LYM14 7	12584. 4	H	12.6 29	4.40E02	21	LYM90	12392. 1	c	2.47 5	2.89E01	24
LYM88	12194. 2	H	12.5 15	4.87E02	20	LYM13 7	12153. 1	c	2.58 8	2.97E01	29.7
LYM6	11736. 1	H	12.3 91	5.69E02	18.8	LYM28 8	12741. 9	c	2.31 9	2.97E01	16.2
LYM89	12211. 4	H	12.7 71	6.74E02	22.4	LYM22 0	12852. 2	c	2.26 9	3.14E01	13.7

244

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM90	12395. 3	H	14.3 16	6.99E02	37.2	LYM14 2	12803. 6	C	3.26 3	3.16E01	63.5
LYM73	12623. 2	H	12.2 01	8.98E02	16.9	LYM28 7	12773. 7	c	2.46 9	3.34E01	23.7
LYM86	12182. 3	H	12.1 23	9.17E02	16.2	LYM14 3	12521. 2	c	2.22 5	3.47E01	11.5
LYM12 8	12641. 3	H	12.2 49	1.00E01	17.4	LYM15 2	12371. 3	c	2.62 5	3.48E01	31.6
LYM20 6	12603. 3	H	17.8 74	1.01E01	71.3	LYM21 2	13031. 6	c	2.46 9	3.77E01	23.7
LYM99	12243. 2	H	12.4 1	1.03E01	18.9	LYM17 3	12981. 6	c	2.47 5	3.79E01	24
LYM17 8	12163. 4	H	12.8 11	1.54E01	22.8	LYM25 5	13082. 7	c	2.16 9	3.81E01	8.7
LYM15 9	13354. 6	H	12.1 93	1.55E01	16.9	LYM10 5	12295. 2	c	2.84 4	3.99E01	42.5
LYM23 6	12594. 3	H	11.8 84	1.59E01	13.9	LYM13 7	12151. 4	c	3.00 6	4.08E01	50.7
LYM88	12193. 1	H	14.7 78	1.60E01	41.6	LYM11 9	12461. 1	c	2.28 1	4.10E01	14.3
LYM17 8	12164. 3	H	12.0 31	1.81E01	15.3	LYM19 8	13002. 5	c	2.61 9	4.15E01	31.2
LYM25 0	12614. 1	H	12.0 94	2.04E01	15.9	LYM11 1	12251. 4	c	3.27 5	4.15E01	64.1
LYM25 0	12613. 4	H	16.0 68	2.07E01	54	LYM13 8	12564. 1	c	2.26 3	4.26E01	13.4
LYM25 0	12613. 2	H	11.6 28	2.09E01	11.5	LYM20 8	13013. 6	c	2.81 9	4.34E01	41.3
LYM73	12623. 1	H	12.0 01	2.10E01	15	LYM18 3	12994. 8	c	2.25 6	4.45E01	13.1
LYM88	12191. 2	H	13.6 05	2.15E01	30.4	LYM15 3	12321. 2	c	2.63 8	4.50E01	32.2
LYM99	12243. 1	H	14.7 65	2.34E01	41.5	LYM14 3	12524. 2	c	2.51 9	4.55E01	26.2
LYM10 7	12633. 4	H	15.4 36	2.76E01	47.9	LYM28 9	12492. 2	c	2.48 1	4.61E01	24.4
LYM17 8	12163. 3	H	13.5 89	2.92E01	30.2	LYM24 2	13051. 8	c	2.40 6	4.75E01	20.6
LYM6	11735. 1	H	15.0 04	3.12E01	43.8	LYM18 3	12994. 7	c	2.43 1	4.77E01	21.8
LYM17 8	12161. 2	H	12.5 7	3.13E01	20.5	LYM25 5	13082. 5	c	2.16 3	4.79E01	8.4
LYM12 8	12642. 3	H	12.5 01	3.37E01	19.8	LYM28 7	12771. 6	c	2.23 1	4.83E01	11.8
LYM12 9	12573. 3	H	12.9 31	3.61E01	23.9	LYM17 3	12981. 5	c	2.33 1	4.84E01	16.8
LYM20 6	12601. 2	H	17.0 33	3.65E01	63.2	LYM28 8	12744. 6	c	2.20 6	4.86E01	10.6
LYM12 9	12573. 5	H	13.6 92	3.66E01	31.2	LYM22 0	12851. 11	c	2.22 9	5.02E01	11.7
LYM89	12214. 2	H	13.5 53	4.00E01	29.9	LYM29 1	12751. 7	c	2.20 6	5.06E01	10.6

245

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM17 5	12651. 2	H	11.2 66	4.15E01	8	LYM25 5	13082. 9	C	2.39 4	5.08E01	20
LYM6	11734. 3	H	11.4 61	4.19E01	9.8	LYM22 0	12851. 13	c	2.17 5	5.17E01	9
LYM90	12392. 1	H	11.1 66	4.25E01	7	LYM29 1	12753. 6	c	2.22 5	5.20E01	11.5
LYM23 6	12591. 1	H	13.1 66	4.56E01	26.2	LYM44	11884. 1	c	2.15	5.32E01	7.8
LYM15 7	13341. 4	H	11.1 31	4.73E01	6.7	LYM13 0	12332. 2	c	2.21 9	5.39E01	11.2
LYM90	12393. 1	H	12.6 01	4.83E01	20.8	LYM19 7	12824. 7	c	2.62 5	5.42E01	31.6
LYM89	12214. 3	H	12.1 81	5.09E01	16.7	LYM11 9	12462. 2	c	2.92 5	5.45E01	46.6
LYM25 0	12614. 2	H	11.8 89	5.16E01	14	LYM24 2	13053. 7	c	2.09 4	5.53E01	4.9
LYM91	13284. 3	H	11.7 62	5.45E01	12.7	LYM44	11885. 4	c	2.35	5.71E01	17.8
LYM28 3	13304. 4	H	12.3 29	5.80E01	18.2	LYM13 7	12154. 5	c	2.31 9	5.87E01	16.2
LYM86	12183. 1	H	11.5 69	5.87E01	10.9	LYM13 0	12331. 3	c	2.5	6.12E01	25.3
LYM23 6	12592. 4	H	12.5 2	5.99E01	20	LYM14 2	12804. 3	c	2.15 6	6.19E01	8.1
LYM6	11733. 2	H	11.3 09	6.05E01	8.4	LYM27 0	12871. 7	c	2.2	6.64E01	10.3
LYM25 0	12611. 3	H	12.0 99	6.19E01	16	LYM17 4	12411. 3	c	2.15	6.66E01	7.8
LYM17 5	12654. 6	H	11.2 42	6.78E01	7.7	LYM18 3	12993. 7	c	2.22 5	6.77E01	11.5
LYM17 5	12654. 4	H	12.1 26	6.86E01	16.2	LYM13 8	12562. 2	c	2.18 1	6.86E01	9.3
LYM20 6	12603. 2	H	10.7 74	7.04E01	3.3	LYM21 2	13034. 8	c	2.31 3	6.90E01	15.9
LYM12 8	12641. 1	H	11.4 1	7.15E01	9.4	LYM27 0	12872. 7	c	2.16 9	7.14E01	8.7
LYM91	13283. 4	H	11.7 98	7.22E01	13.1	LYM13 0	12333. 1	c	2.29 4	7.33E01	15
LYM14 7	12584. 5	H	10.7 33	7.53E01	2.9	LYM15 3	12323. 2	c	2.18 8	7.44E01	9.6
LYM20 6	12601. 3	H	10.7 04	7.86E01	2.6	LYM10 6	12142. 1	c	2.36 3	7.50E01	18.4
LYM15 7	13342. 4	H	11.4 48	7.87E01	9.7	LYM13 0	12334. 1	c	2.05	7.51E01	2.7
LYM14 7	12583. 1	H	11.5 45	8.28E01	10.7	LYM19 8	13002. 8	c	2.21 3	7.61E01	10.9
LYM86	12183. 3	H	10.6 56	8.33E01	2.1	LYM28 7	12771. 7	c	2.06 3	8.00E01	3.4
LYM17 8	12164. 2	H	10.8 38	8.72E01	3.9	LYM44	11882. 1	c	2.10 6	8.42E01	5.6
LYM91	13283. 1	H	10.5 14	9.28E01	0.8	LYM19 8	13005. 6	c	2.06 3	8.64E01	3.4

246

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM73	12622. 2	H	10.7 58	9.28E01	3.1	LYM29 1	12751. 2	C	2.04 2	8.80E01	2.3
LYM14 9	12344. 2	H	10.7 64	9.42E01	3.2	LYM20 1	12833. 7	c	2.08 8	8.82E01	4.6
CONTR OL	—	H	10.4 34	—	0	LYM44	11884. 3	c	2.06 9	9.05E01	3.7
LYM20 6	12603. 3	J	0.04 2	2.32E03	61.6	LYM44	11885. 3	c	2.01 3	9.12E01	0.9
LYM25 0	12613. 4	J	0.03 8	1.29E02	47.8	LYM90	12394. 2	c	2.00 6	9.59E01	0.5
LYM20 6	12601. 2	J	0.03 9	2.60E02	48.5	LYM25 5	13082. 8	c	2	9.86E01	0.2
LYM10 7	12633. 4	J	0.03 7	2.93E02	43.3	CONTR OL	—	c	1.99 5	—	0
LYM6	11735. 1	J	0.03 5	4.68E02	36.2	LYM10 2	12222. 2	D	0.26 5	6.00E06	40
LYM99	12243. 1	J	0.03 5	5.89E02	35.2	LYM28 8	12743. 9	D	0.26 4	1.70E- 05	39.2
LYM88	12191. 2	J	0.03 5	6.27E02	32.8	LYM17 3	12981. 6	D	0.24 8	9.60E05	31
LYM12 9	12573. 5	J	0.03 5	7.06E02	33.1	LYM13 8	12561. 3	D	0.31	1.04E- 04	63.6
LYM23 6	12592. 3	J	0.03 4	7.96E02	30.2	LYM10 7	12631. 4	D	0.23 9	1.13E- 04	26.3
LYM89	12214. 2	J	0.03 4	8.48E02	31.2	LYM10 5	12297. 2	D	0.24	2.13E04	26.7
LYM90	12395. 3	J	0.03 3	8.93E02	28.3	LYM13 0	12332. 1	D	0.28 3	2.74E03	49.6
LYM12 9	12572. 4	J	0.03 3	1.15E- 01	27.1	LYM28 9	12493. 1	D	0.27 2	3.81E- 03	43.6
LYM17 8	12163. 4	J	0.03 3	1.22E- 01	25.9	LYM13 0	12334. 1	D	0.23	4.39E03	21.6
LYM14 7	12583. 3	J	0.03 3	1.28E- 01	25.3	LYM10 2	12222. 1	D	0.22 8	5.99E03	20.7
LYM23 6	12592. 4	J	0.03 3	1.43E- 01	28.1	LYM25 5	13082. 8	D	0.25 2	6.25E03	33.3
LYM10 7	12631. 4	J	0.03 2	1.44E- 01	24.3	LYM10 6	12144. 4	D	0.25 8	6.35E03	36.4
LYM89	12211. 4	J	0.03 2	1.56E- 01	23.7	LYM10 7	12631. 2	D	0.21 6	6.37E03	14.2
LYM6	11736. 1	J	0.03 2	1.66E- 01	24.2	LYM15 3	12323. 2	D	0.28 2	7.68E03	49
LYM90	12395. 1	J	0.03 2	1.73E- 01	22.4	LYM10 5	12293. 1	D	0.27 8	1.12E02	47
LYM88	12193. 1	J	0.03 2	1.92E- 01	21.6	LYM20 1	12833. 7	D	0.21 2	1.16E02	12.1
LYM25 0	12611. 3	J	0.03 2	1.97E01	24.5	LYM11 9	12461. 4	D	0.30 1	1.22E02	59
LYM23 6	12591. 1	J	0.03 2	2.14E01	22.8	LYM28 7	12771. 6	D	0.21 9	1.38E02	15.5
LYM99	12243. 2	J	0.03 1	2.28E01	20.1	LYM10 5	12294. 2	D	0.24 8	1.47E02	31.1

247

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM17 8	12161. 2	J	0.03 1	2.32E01	20.1	LYM17 3	12982. 6	D	0.21 5	1.80E02	13.7
LYM17 8	12163. 3	J	0.03 1	2.45E01	20	LYM13 7	12153. 1	D	0.22 7	2.52E02	19.8
LYM20 6	12603. 1	J	0.03 1	2.53E01	19	LYM15 2	12373. 1	D	0.23 4	2.75E02	23.5
LYM15 9	13354. 6	J	0.03 1	2.78E01	18.6	LYM27 0	12873. 6	D	0.25 2	2.79E02	33.2
LYM12 9	12573. 3	J	0.03 1	2.87E01	18.4	LYM13 8	12561. 1	D	0.39 9	4.37E02	110.9
LYM17 5	12654. 4	J	0.03 1	2.90E01	19.4	LYM28 7	12774. 6	D	0.20 6	4.37E02	8.8
LYM90	12392. 1	J	0.03	3.06E01	16.4	LYM24 2	13052. 5	D	0.21 2	4.61E02	12.1
LYM91	13284. 3	J	0.03 1	3.18E- 01	17.4	LYM13 7	12151. 4	D	0.27	5.04E02	42.4
LYM15 9	13354. 5	J	0.03	3.56E01	15.4	LYM10 0	12133. 3	D	0.20 5	5.59E02	8.1
LYM89	12214. 3	J	0.03	3.58E01	15.8	LYM13 7	12151. 2	D	0.25	6.45E02	32.1
LYM25 0	12613. 2	J	0.03	3.76E01	14.5	LYM28 9	12492. 2	D	0.24 6	6.50E02	29.9
LYM23 6	12594. 3	J	0.02 9	4.45E01	12.5	LYM17 4	12414. 3	D	0.32	7.11E- 02	69
LYM15 7	13342. 4	J	0.03	4.61E01	14	LYM15 3	12322. 1	D	0.21 8	7.32E02	15.3
LYM91	13283. 4	J	0.02 9	4.75E01	13.2	LYM11 1	12254. 4	D	0.23	7.53E02	21.3
LYM73	12623. 2	J	0.02 9	4.77E01	11.7	LYM11 9	12463. 2	D	0.30 2	7.64E02	59.5
LYM17 5	12651. 2	J	0.02 9	4.79E01	11.9	LYM10 6	12142. 2	D	0.30 7	7.80E02	62.1
LYM6	11733. 2	J	0.02 9	4.88E01	11.9	LYM15 3	12324. 2	D	0.27	7.86E02	42.8
LYM86	12182. 3	J	0.02 9	4.94E01	11	LYM10 6	12141. 4	D	0.21 9	7.93E02	15.7
LYM28 3	13304. 4	J	0.02 9	5.17E- 01	11.3	LYM21 2	13032. 8	D	0.23 9	8.15E02	26.2
LYM90	12393. 1	J	0.02 9	5.43E01	10.3	LYM11 9	12461. 1	D	0.30 8	8.59E02	62.9
LYM73	12623. 1	J	0.02 9	5.45E01	9.8	LYM20 1	12833. 9	D	0.20 3	8.86E02	7.2
LYM12 8	12642. 3	J	0.02 9	5.62E01	9.5	LYM10 0	12131. 3	D	0.20 9	9.17E02	10.3
LYM73	12622. 2	J	0.02 9	5.64E01	10.5	LYM28 8	12743. 8	D	0.23 6	9.25E02	24.6
LYM25 0	12614. 2	J	0.02 8	5.82E01	9.3	LYM22 0	12851. 8	D	0.28 6	9.36E02	51.1
LYM86	12183. 1	J	0.02 8	6.07E01	8.6	LYM10 2	12222. 3	D	0.22 9	1.07E- 01	20.9
LYM86	12183. 3	J	0.02 8	6.17E- 01	8.1	LYM10 5	12295. 2	D	0.26 9	1.09E- 01	41.9

248

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM91	13283. 1	J	0.02 8	6.19E01	8	LYM17 4	12411. 2	D	0.27 6	1.10E01	45.9
LYM25 0	12614. 1	J	0.02 8	6.33E01	7.7	LYM28 9	12491. 1	D	0.20 1	1.29E01	6.1
LYM15 7	13341. 4	J	0.02 8	6.74E01	7.2	LYM13 7	12151. 1	D	0.25 3	1.36E01	33.5
LYM17 8	12164. 3	J	0.02 8	6.96E01	6.2	LYM13 8	12562. 2	D	0.24 6	1.48E01	29.8
LYM12 8	12641. 1	J	0.02 8	6.98E01	6.8	LYM10 7	12632. 3	D	0.29 8	1.51E01	57.5
LYM14 7	12584. 4	J	0.02 8	7.13E01	5.8	LYM10 5	12294. 3	D	0.22 6	1.59E01	19.4
LYM17 5	12651. 4	J	0.02 8	7.62E01	5.8	LYM11 9	12462. 1	D	0.27 8	1.80E01	47
LYM15 9	13352. 4	J	0.02 7	7.80E01	4.6	LYM15 3	12324. 1	D	0.28 3	1.89E01	49.3
LYM88	12194. 2	J	0.02 7	7.86E01	4.4	LYM28 8	12743. 5	D	0.27 4	1.92E01	44.7
LYM17 5	12654. 6	J	0.02 7	8.01E01	4.3	LYM17 4	12412. 1	D	0.28 2	2.01E01	48.9
LYM14 7	12583. 1	J	0.02 7	8.50E01	3.7	LYM21 2	13031. 6	D	0.21 1	2.07E01	11.6
LYM14 9	12344. 2	J	0.02 7	8.67E01	3.2	LYM19 7	12821. 6	D	0.22 4	2.15E01	18.1
LYM12 8	12641. 3	J	0.02 7	8.88E01	2.2	LYM10 7	12631. 1	D	0.22 5	2.32E01	18.8
LYM88	12191. 1	J	0.02 7	9.00E01	2.1	LYM90	12395. 3	D	0.23	2.34E01	21.4
LYM20 6	12601. 3	J	0.02 7	9.12E01	1.8	LYM24 2	13051. 8	D	0.22 3	2.35E01	17.6
LYM89	12214. 4	J	0.02 6	9.25E01	1.5	LYM17 3	12981. 5	D	0.22 7	2.35E01	19.7
LYM14 7	12584. 5	J	0.02 6	9.58E01	0.9	LYM13 0	12332. 2	D	0.24 6	2.46E01	29.8
LYM17 8	12164. 2	J	0.02 6	9.69E01	0.6	LYM11 1	12251. 1	D	0.20 3	2.49E01	7.1
LYM14 7	12581. 4	J	0.02 6	9.95E01	0.1	LYM17 4	12411. 3	D	0.29 9	2.57E01	57.9
CONTR OL	—	J	0.02 6	—	0	LYM19 8	13005. 8	D	0.2	2.58E01	5.8
LYM15 7	13341. 4	K	0.69 7	6.89E02	22.1	LYM11 9	12462. 2	D	0.25	2.82E01	32
LYM88	12193. 1	K	0.61 7	4.88E01	8.1	LYM15 3	12321. 2	D	0.23 5	2.89E01	24.2
LYM73	12623. 2	K	0.60 5	6.11E01	6	LYM11 1	12252. 2	D	0.23 9	2.92E01	26.1
LYM10 7	12633. 4	K	0.60 4	6.16E01	5.8	LYM24 2	13053. 7	D	0.21 5	3.07E01	13.4
LYM15 9	13354. 8	K	0.60 3	6.36E01	5.6	LYM10 2	12221. 1	D	0.22 1	3.09E01	16.5
LYM90	12395. 3	K	0.6	6.64E01	5.1	LYM25 5	13082. 9	D	0.22	3.26E01	16

249

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM17 5	12654. 6	K	0.6	6.86E01	5.2	LYM25 5	13082. 5	D	0.28	3.38E01	47.9
LYM90	12393. 2	K	0.59 6	7.01E01	4.4	LYM14 2	12802. 9	D	0.23	3.43E01	21.4
LYM20 6	12603. 3	K	0.59 7	7.01E01	4.6	LYM28 8	12741. 9	D	0.22 9	3.44E01	21.2
LYM25 0	12613. 4	K	0.59 5	7.13E01	4.2	LYM10 6	12144. 3	D	0.24	3.50E01	26.6
LYM12 9	12572. 4	K	0.59 4	7.18E01	4.1	LYM15 2	12371. 2	D	0.28 1	3.62E01	48.6
LYM6	11734. 3	K	0.59 4	7.26E01	4.1	LYM25 5	13082. 7	D	0.25 2	3.81E01	32.9
LYM15 7	13342. 4	K	0.59 4	7.43E01	4.1	LYM10 6	12142. 3	D	0.20 8	3.88E01	9.9
LYM15 9	13351. 1	K	0.59 2	7.73E01	3.7	LYM13 8	12564. 1	D	0.23 1	4.04E01	22
LYM90	12395. 1	K	0.58 6	8.23E01	2.6	LYM28 9	12493. 2	D	0.25 4	4.06E01	34.4
LYM15 9	13354. 5	K	0.58 7	8.28E01	2.9	LYM15 2	12371. 3	D	0.23 3	4.09E01	22.8
LYM90	12393. 1	K	0.58 6	8.34E01	2.6	LYM10 7	12632. 1	D	0.21 8	4.39E01	14.9
LYM99	12243. 1	K	0.58 2	8.78E01	1.9	LYM29 1	12754. 9	D	0.24	4.58E01	26.9
LYM23 6	12591. 1	K	0.58 1	8.85E01	1.8	LYM20 1	12834. 6	D	0.21	4.77E01	10.8
LYM99	12241. 1	K	0.57 8	9.22E01	1.2	LYM10 2	12222. 6	D	0.21 5	5.01E01	13.5
LYM6	11733. 2	K	0.57 7	9.25E01	1.1	LYM18 3	12994. 8	D	0.23 3	5.40E01	23.1
CONTR OL	—	K	0.57 1	—	0	LYM29 1	12753. 6	D	0.21 1	5.42E01	11.2
LYM20 6	12603. 3	L	2.30 3	1.34E03	74.3	LYM13 0	12331. 3	D	0.24 2	5.46E01	27.6
LYM25 0	12613. 4	L	2.05 4	9.93E03	55.4	LYM28 7	12771. 7	D	0.2	5.49E01	5.6
LYM20 6	12601. 2	L	2.13 7	1.29E02	61.7	LYM28 9	12491. 4	D	0.19 6	5.53E01	3.5
LYM10 7	12633. 4	L	1.94 7	3.16E02	47.3	LYM13 0	12333. 1	D	0.21 3	5.99E01	12.3
LYM6	11735. 1	L	1.89 8	4.09E02	43.6	LYM14 3	12524. 7	D	0.23 1	6.05E01	21.8
LYM99	12243. 1	L	1.86 1	4.63E02	40.8	LYM13 7	12154. 5	D	0.23	6.26E01	21.2
LYM88	12193. 1	L	1.80 6	6.33E02	36.6	LYM11 1	12251. 4	D	0.19 6	6.28E01	3.4
LYM90	12395. 3	L	1.79 4	6.59E02	35.8	LYM18 3	12993. 7	D	0.20 5	6.65E01	8.1
LYM10 7	12631. 4	L	1.73 3	1.04E01	31.1	LYM18 3	12993. 5	D	0.20 5	6.71E01	8.2
LYM88	12191. 2	L	1.73 3	1.17E01	31.1	LYM28 7	12773. 7	D	0.20 5	6.87E01	8.5

250

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM 12 9	12573. 5	L	1.74 9	1.18E01	32.3	LYM27 0	12871. 5	D	0.22	7.04E01	15.9
LYM23 6	12592. 3	L	1.72 4	1.21E01	30.4	LYM 14 2	12801. 8	D	0.19 6	7.32E01	3.7
LYM90	12395. 1	L	1.70 8	1.26E01	29.2	LYM 14 3	12524. 5	D	0.21 4	7.37E01	13.1
LYM 14 7	12583. 3	L	1.69 6	1.38E01	28.3	LYM27 0	12871. 7	D	0.19 7	7.40E01	3.8
LYM89	12214. 2	L	1.71 5	1.44E01	29.8	LYM 17 3	12981. 8	D	0.2	7.60E01	5.4
LYM 12 9	12572. 4	L	1.66 3	1.82E01	25.9	LYM44	11885. 4	D	0.19 9	7.63E01	5.2
LYM 17 8	12163. 3	L	1.66 7	1.88E01	26.2	LYM20 8	13012. 5	D	0.20 9	7.67E01	10.3
LYM20 6	12603. 1	L	1.65	1.92E01	24.8	LYM 14 3	12521. 1	D	0.19 2	7.71E01	1.2
LYM23 6	12591. 1	L	1.66 1	2.18E01	25.7	LYM21 2	13034. 9	D	0.21 1	7.93E01	11.3
LYM89	12211. 4	L	1.61	2.51E01	21.8	LYM 17 3	12982. 7	D	0.20 5	8.10E01	8.3
LYM23 6	12592. 4	L	1.62 4	2.79E01	22.9	LYM 19 8	13004. 6	D	0.19 1	8.26E01	1
LYM 12 9	12573. 3	L	1.60 2	2.85E01	21.2	LYM 14 2	12804. 3	D	0.19 8	8.80E01	4.7
LYM 17 8	12163. 4	L	1.57 9	3.05E01	19.5	LYM25 5	13081. 5	D	0.19 7	8.86E01	4.2
LYM6	11736. 1	L	1.57 9	3.15E01	19.5	LYM 19 7	12822. 7	D	0.19 6	8.90E01	3.2
LYM99	12243. 2	L	1.56 2	3.36E01	18.2	LYM27 0	12871. 8	D	0.19 6	9.09E01	3.3
LYM 14 7	12584. 4	L	1.54 7	3.54E01	17.1	LYM27 0	12872. 7	D	0.19 3	9.10E01	2
LYM 15 9	13354. 6	L	1.55 8	3.54E01	17.9	LYM 17 4	12414. 2	D	0.19	9.23E01	0.4
LYM 17 8	12161. 2	L	1.55 6	3.55E01	17.7	LYM 11 1	12251. 3	D	0.19	9.75E01	0.3
LYM90	12393. 1	L	1.56 1	3.57E01	18.1	LYM 10 5	12297. 1	D	0.19	9.79E01	0.4
LYM88	12194. 2	L	1.54 6	3.63E01	17	LYM 18 3	12994. 7	D	0.19	9.91E01	0.1
LYM25 0	12611. 3	L	1.54 6	4.06E01	17	CONTR OL	—	D	0.18 9	—	0
LYM 12 8	12642. 3	L	1.52 4	4.21E01	15.3	LYM 13 8	12561. 1	E	9	2.20E03	10.8
LYM28 3	13304. 4	L	1.53 2	4.27E01	15.9	LYM 13 0	12332. 1	E	8.93 8	3.29E03	10
LYM 17 5	12654. 4	L	1.54 4	4.29E01	16.8	LYM 11 9	12461. 4	E	9	7.75E03	10.8
LYM73	12623. 2	L	1.52	4.29E01	15	LYM 13 0	12334. 1	E	9	7.75E03	10.8
LYM25 0	12614. 1	L	1.51 6	4.32E01	14.7	LYM 15 3	12323. 2	E	9	7.75E03	10.8

251

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM89	12214. 3	L	1.52 3	4.32E01	15.2	LYM 17 4	12412. 1	E	8.62 5	3.12E02	6.2
LYM86	12182. 3	L	1.51	4.46E01	14.2	LYM25 5	13082. 8	E	8.75	3.12E02	7.7
LYM73	12623. 1	L	1.49 8	4.75E01	13.3	LYM25 5	13082. 7	E	8.56 3	5.65E02	5.4
LYM 17 8	12164. 3	L	1.48 9	4.93E01	12.7	LYM 13 0	12332. 2	E	9	9.08E02	10.8
LYM25 0	12614. 2	L	1.49 9	4.94E01	13.4	LYM 11 9	12461. 1	E	8.68 8	1.11E01	6.9
LYM23 6	12594. 3	L	1.49	5.02E01	12.7	LYM22 0	12851. 8	E	8.87 5	1.21E01	9.2
LYM91	13284. 3	L	1.49 2	5.06E01	12.9	LYM 15 3	12324. 1	E	9.06 3	1.37E01	11.5
LYM91	13283. 4	L	1.49 5	5.25E01	13.1	LYM 17 4	12414. 3	E	9.06 3	1.37E01	11.5
LYM 12 8	12641. 3	L	1.46 8	5.48E01	11.1	LYM 10 6	12141. 4	E	8.5	1.45E01	4.6
LYM6	11733. 2	L	1.45 9	5.91E01	10.4	LYM28 7	12771. 6	E	8.5	1.45E01	4.6
LYM25 0	12613. 2	L	1.45 4	5.93E01	10	LYM 10 5	12297. 2	E	8.75	1.65E01	7.7
LYM 17 5	12651. 2	L	1.45 2	6.05E01	9.9	LYM 10 7	12631. 4	E	8.54 5	1.71E01	5.2
LYM 17 5	12654. 6	L	1.45 2	6.13E01	9.9	LYM 10 5	12295. 2	E	8.56 3	1.84E01	5.4
LYM 15 7	13342. 4	L	1.45 4	6.29E01	10	LYM 10 7	12631. 2	E	8.56 3	1.84E01	5.4
LYM 12 8	12641. 1	L	1.44 6	6.33E01	9.4	LYM 11 1	12252. 2	E	8.56 3	1.84E01	5.4
LYM86	12183. 1	L	1.43 2	6.61E01	8.4	LYM 14 3	12524. 7	E	8.37 5	2.21E01	3.1
LYM 15 7	13341. 4	L	1.43 2	6.63E01	8.3	LYM28 9	12493. 2	E	8.87 5	2.51E01	9.2
LYM 14 7	12583. 1	L	1.43 1	7.05E01	8.2	LYM 13 7	12153. 1	E	8.68 8	2.75E01	6.9
LYM90	12392. 1	L	1.40 6	7.24E01	6.4	LYM 15 2	12371. 2	E	8.37 5	3.07E01	3.1
LYM6	11734. 3	L	1.40 5	7.36E01	6.3	LYM28 9	12491. 1	E	8.37 5	3.07E01	3.1
LYM73	12622. 2	L	1.40 2	7.68E01	6.1	LYM 13 8	12562. 2	E	8.43 8	3.12E01	3.8
LYM20 6	12603. 2	L	1.36 1	8.74E01	3	LYM29 1	12754. 9	E	8.43 8	3.12E01	3.8
LYM91	13283. 1	L	1.34 3	9.30E01	1.6	LYM 11 9	12462. 1	E	8.81 3	3.33E01	8.5
LYM 14 9	12344. 2	L	1.34 2	9.41E01	1.6	LYM 10 2	12222. 6	E	8.5	3.37E01	4.6
LYM 17 8	12164. 2	L	1.33 7	9.51E01	1.2	LYM 17 4	12411. 3	E	8.5	3.37E01	4.6
LYM86	12183. 3	L	1.33	9.73E01	0.6	LYM28 8	12741. 9	E	8.87 5	3.53E01	9.2

252

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM 15 9	13352. 4	L	1.33	9.74E01	0.6	LYM 11 1	12254. 4	E	8.31 3	3.67E01	2.3
CONTR OL	—	L	1.32 2	—	0	LYM 11 9	12462. 2	E	8.81 3	4.24E01	8.5
LYM20 6	12603. 3	M	0.28 8	1.32E- 03	69.7	LYM 13 7	12154. 5	E	8.62 5	4.90E01	6.2
LYM25 0	12613. 4	M	0.25 7	1.04E02	51.3	LYM 13 7	12151. 2	E	8.68 8	4.92E01	6.9
LYM20 6	12601. 2	M	0.26 7	1.40E02	57.5	LYM 13 8	12561. 3	E	8.81 3	4.94E01	8.5
LYM 10 7	12633. 4	M	0.24 3	3.48E02	43.4	LYM 17 4	12411. 2	E	8.31 3	5.23E01	2.3
LYM6	11735. 1	M	0.23 7	4.53E02	39.8	LYM28 8	12743. 9	E	8.31 3	5.23E01	2.3
LYM99	12243. 1	M	0.23 3	5.12E- 02	37.1	LYM 11 9	12463. 2	E	8.56 3	5.75E01	5.4
LYM88	12193. 1	M	0.22 6	7.05E02	33.1	LYM28 9	12493. 1	E	8.56 3	5.75E01	5.4
LYM90	12395. 3	M	0.22 4	7.35E02	32.2	LYM 10 6	12144. 4	E	8.5	5.87E01	4.6
LYM 10 7	12631. 4	M	0.21 7	1.17E- 01	27.7	LYM 10 2	12222. 3	E	8.25	5.97E01	1.5
LYM88	12191. 2	M	0.21 7	1.33E- 01	27.6	LYM24 2	13051. 8	E	8.25	5.97E01	1.5
LYM 12 9	12573. 5	M	0.21 9	1.34E- 01	28.8	LYM 13 7	12151. 1	E	8.62 5	6.24E01	6.2
LYM23 6	12592. 3	M	0.21 5	1.38E- 01	27	LYM 13 0	12331. 3	E	8.37 5	7.06E01	3.1
LYM90	12395. 1	M	0.21 4	1.44E- 01	25.9	LYM24 2	13052. 5	E	8.25	7.22E01	1.5
LYM 14 7	12583. 3	M	0.21 2	1.57E- 01	24.9	LYM28 9	12491. 4	E	8.25	7.22E01	1.5
LYM89	12214. 2	M	0.21 4	1.65E- 01	26.3	LYM44	11885. 4	E	8.25	7.22E01	1.5
LYM 17 8	12163. 4	M	0.21	1.72E- 01	24	LYM 10 6	12144. 3	E	8.37 5	7.96E01	3.1
LYM 12 9	12572. 4	M	0.20 8	2.08E01	22.6	LYM 10 6	12142. 2	E	8.25	8.01E- 01	1.5
LYM 17 8	12163. 3	M	0.20 8	2.16E01	22.8	LYM 13 8	12564. 1	E	8.25	8.01E- 01	1.5
LYM20 6	12603. 1	M	0.20 6	2.21E01	21.5	LYM 18 3	12993. 7	E	8.25	8.01E- 01	1.5
LYM23 6	12591. 1	M	0.20 8	2.50E01	22.4	LYM25 5	13082. 5	E	8.25	8.01E- 01	1.5
LYM89	12211. 4	M	0.20 1	2.90E01	18.6	LYM28 8	12743. 8	E	8.25	8.01E- 01	1.5
LYM 17 5	12654. 4	M	0.20 3	3.08E01	19.7	LYM 10 2	12222. 2	E	8.18 8	8.26E01	0.8
LYM23 6	12592. 4	M	0.20 3	3.19E- 01	19.7	LYM27 0	12873. 6	E	8.18 8	8.26E01	0.8
LYM 12 9	12573. 3	M	0.2	3.27E01	18	LYM28 8	12743. 5	E	8.31 3	8.56E01	2.3

253

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM6	11736. 1	M	0.19 7	3.63E01	16.4	LYM14 3	12524. 5	E	8.25	8.96E01	1.5
LYM99	12243. 2	M	0.19 5	3.88E01	15.1	LYM28 8	12744. 6	E	8.18 8	9.43E01	0.8
LYM15 9	13354. 6	M	0.19 5	4.08E01	14.8	CONTR OL	—	E	8.12 5	—	0
LYM14 7	12584. 4	M	0.19 3	4.09E01	14	LYM13 8	12561. 3	F	0.52	2.90E05	66
LYM17 8	12161. 2	M	0.19 4	4.10E01	14.6	LYM28 9	12493. 1	F	0.53	4.10E05	69.3
LYM90	12393. 1	M	0.19 5	4.11E01	15	LYM15 3	12323. 2	F	0.48 6	1.01E- 04	55.1
LYM88	12194. 2	M	0.19 3	4.20E01	13.9	LYM25 5	13082. 8	F	0.46 5	2.39E04	48.5
LYM25 0	12611. 3	M	0.19 3	4.65E01	13.9	LYM11 9	12463. 2	F	0.46 8	2.41E04	49.5
LYM12 8	12642. 3	M	0.19	4.85E01	12.3	LYM13 7	12151. 1	F	0.46	2.99E04	46.9
LYM28 3	13304. 4	M	0.19 2	4.90E01	12.9	LYM10 7	12631. 4	F	0.45 8	3.34E04	46.1
LYM73	12623. 2	M	0.19	4.95E01	12	LYM15 3	12324. 2	F	0.45 5	3.98E04	45.1
LYM89	12214. 3	M	0.19	4.97E01	12.2	LYM13 7	12151. 4	F	0.48 3	5.10E- 04	54.3
LYM25 0	12614. 1	M	0.18 9	4.99E01	11.7	LYM10 5	12293. 1	F	0.44 8	5.60E04	42.9
LYM86	12182. 3	M	0.18 9	5.15E- 01	11.2	LYM11 9	12462. 1	F	0.47 4	1.01E- 03	51.2
LYM73	12623. 1	M	0.18 7	5.48E01	10.4	LYM10 2	12222. 3	F	0.43 2	1.14E- 03	38
LYM25 0	12614. 2	M	0.18 7	5.67E01	10.4	LYM10 5	12297. 2	F	0.42 9	1.36E- 03	37
LYM17 8	12164. 3	M	0.18 6	5.69E01	9.7	LYM10 2	12221. 1	F	0.42 4	1.85E- 03	35.5
LYM23 6	12594. 3	M	0.18 6	5.78E01	9.8	LYM28 8	12743. 9	F	0.43 4	1.86E- 03	38.6
LYM91	13284. 3	M	0.18 7	5.80E01	10	LYM13 8	12562. 2	F	0.40 7	4.58E03	29.8
LYM91	13283. 4	M	0.18 7	5.98E01	10.1	LYM15 3	12321. 2	F	0.4	6.82E03	27.8
LYM12 8	12641. 3	M	0.18 4	6.31E- 01	8.2	LYM10 2	12222. 2	F	0.42 1	7.13E- 03	34.3
LYM6	11733. 2	M	0.18 2	6.76E01	7.5	LYM10 7	12631. 1	F	0.39 8	9.15E03	27.1
LYM25 0	12613. 2	M	0.18 2	6.80E01	7.1	LYM11 9	12461. 1	F	0.45 4	9.42E03	44.9
LYM17 5	12651. 2	M	0.18 1	6.92E01	7	LYM17 4	12412. 1	F	0.52	1.39E02	66
LYM17 5	12654. 6	M	0.18 1	7.00E01	7	LYM13 0	12332. 2	F	0.40 1	1.60E02	27.9
LYM15 7	13342. 4	M	0.18 2	7.13E- 01	7.1	LYM10 0	12133. 3	F	0.38 2	2.01E02	21.9

254

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM 12 8	12641. 1	M	0.18 1	7.21E01	6.5	LYM 13 7	12153. 1	F	0.39 7	2.03E02	26.8
LYM86	12183. 1	M	0.17 9	7.55E01	5.5	LYM 17 3	12982. 6	F	0.39 8	2.07E02	26.9
LYM 15 7	13341. 4	M	0.17 9	7.57E01	5.5	LYM 10 2	12222. 6	F	0.38 1	2.15E02	21.6
LYM 15 9	13354. 5	M	0.17 8	7.87E01	4.8	LYM28 8	12743. 5	F	0.48 3	2.36E02	54.1
LYM 14 7	12583. 1	M	0.17 9	7.91E01	5.4	LYM24 2	13051. 8	F	0.38 9	2.77E02	24.2
LYM90	12392. 1	M	0.17 6	8.29E01	3.6	LYM 17 4	12414. 2	F	0.37 4	3.39E02	19.4
LYM6	11734. 3	M	0.17 6	8.39E01	3.5	LYM 14 3	12521. 1	F	0.39 5	3.46E02	26
LYM73	12622. 2	M	0.17 5	8.64E01	3.3	LYM28 7	12771. 6	F	0.37 4	3.57E02	19.3
LYM20 6	12603. 2	M	0.17	9.89E01	0.2	LYM 10 5	12295. 2	F	0.40 9	3.81E02	30.5
CONTR OL	—	M	0.17	—	0	LYM 19 8	13005. 8	F	0.39 2	4.29E02	25.3
LYM20 6	12603. 3	N	0.24 9	2.57E02	31.4	LYM 10 6	12142. 3	F	0.36 9	4.67E02	17.7
LYM25 0	12613. 4	N	0.24	5.39E02	27	LYM21 2	13031. 6	F	0.40 3	5.15E02	28.7
LYM 10 7	12633. 4	N	0.23 9	8.02E02	26.2	LYM 13 0	12334. 1	F	0.40 1	5.54E02	28.1
LYM88	12191. 2	N	0.23 1	1.01E01	22.1	LYM 13 0	12332. 1	F	0.48 1	5.69E02	53.6
LYM6	11735. 1	N	0.23	1.18E01	21.4	LYM28 9	12493. 2	F	0.41 1	5.77E02	31.1
LYM20 6	12601. 2	N	0.23 6	1.28E01	24.9	LYM 10 7	12632. 1	F	0.38 8	6.16E02	23.7
LYM23 6	12592. 3	N	0.22 5	1.46E01	19.1	LYM44	11882. 1	F	0.36 5	6.29E02	16.4
LYM23 6	12592. 4	N	0.22 8	1.67E01	20.7	LYM 19 7	12821. 6	F	0.43 2	7.71E02	37.7
LYM 12 9	12573. 5	N	0.22 2	2.12E01	17.1	LYM 13 8	12561. 1	F	0.55 7	7.77E02	77.9
LYM99	12243. 1	N	0.22 1	2.18E01	16.8	LYM20 1	12834. 6	F	0.39	7.85E02	24.4
LYM25 0	12611. 3	N	0.22 2	2.41E01	17.3	LYM 17 3	12981. 8	F	0.37 5	8.92E02	19.8
LYM 15 9	13354. 5	N	0.21 8	2.47E01	15.2	LYM 11 1	12254. 4	F	0.37 5	9.07E02	19.8
LYM 15 7	13341. 4	N	0.21 6	2.84E01	14.2	LYM 17 4	12411. 2	F	0.4	9.19E02	27.8
LYM91	13284. 3	N	0.21 8	2.91E01	15.2	LYM 17 4	12414. 3	F	0.48 3	9.49E02	54.1
LYM89	12211. 4	N	0.21 1	3.54E01	11.7	LYM 10 0	12131. 3	F	0.45 9	9.57E02	46.4
LYM 12 9	12572. 4	N	0.21 1	3.67E01	11.3	LYM24 2	13052. 5	F	0.35 7	9.97E02	14

255

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM 15 9	13354. 6	N	0.21	3.95E01	11	LYM 10 7	12632. 3	F	0.49 1	1.05E01	56.9
LYM90	12395. 3	N	0.20 9	4.04E01	10.4	LYM 11 1	12251. 4	F	0.35 6	1.07E01	13.6
LYM 17 8	12161. 2	N	0.21	4.14E01	10.9	LYM 11 1	12252. 2	F	0.48 3	1.09E01	54.1
LYM73	12623. 2	N	0.20 9	4.32E01	10.2	LYM 10 6	12141. 4	F	0.41 6	1.12E01	32.8
LYM23 6	12591. 1	N	0.21 1	4.35E01	11.3	LYM 17 3	12981. 6	F	0.38 7	1.14E01	23.6
LYM20 6	12603. 1	N	0.20 9	4.38E01	10.3	LYM 10 5	12294. 3	F	0.35 6	1.20E01	13.5
LYM 17 8	12163. 4	N	0.20 8	4.45E01	9.8	LYM 11 9	12461. 4	F	0.53 9	1.23E01	71.9
LYM6	11736. 1	N	0.20 8	4.50E01	9.8	LYM 15 2	12373. 1	F	0.39 8	1.26E01	27.1
LYM99	12243. 2	N	0.20 7	4.52E01	9.6	LYM25 5	13082. 9	F	0.41 3	1.28E01	31.9
LYM89	12214. 2	N	0.20 8	4.71E01	10.1	LYM 10 7	12633. 4	F	0.36 4	1.38E01	16.1
LYM23 6	12594. 3	N	0.20 6	5.03E01	8.7	LYM28 7	12774. 6	F	0.37 2	1.44E01	18.9
LYM88	12193. 1	N	0.20 6	5.05E01	8.7	LYM25 5	13082. 7	F	0.52 4	1.53E01	67.3
LYM 17 8	12163. 3	N	0.20 6	5.07E01	8.9	LYM28 9	12491. 4	F	0.37 2	1.56E01	18.7
LYM 17 5	12654. 4	N	0.20 6	5.32E01	9	LYM24 2	13054. 9	F	0.35	1.59E01	11.6
LYM 17 5	12651. 2	N	0.20 5	5.44E01	8.2	LYM 15 3	12322. 1	F	0.43 7	1.73E01	39.4
LYM73	12622. 2	N	0.20 7	5.48E01	9.2	LYM 10 6	12144. 4	F	0.41 9	1.77E01	33.6
LYM90	12392. 1	N	0.20 3	5.60E01	7.2	LYM 10 6	12144. 3	F	0.41 7	1.79E01	33.2
LYM 12 9	12573. 3	N	0.20 4	5.70E01	7.8	LYM 10 5	12294. 2	F	0.39 4	1.86E01	25.9
LYM25 0	12614. 2	N	0.20 3	5.87E01	7.2	LYM 14 3	12524. 2	F	0.36 3	2.01E01	15.8
LYM 14 7	12583. 3	N	0.20 2	5.92E01	6.9	LYM 11 9	12462. 2	F	0.49 7	2.05E01	58.5
LYM91	13283. 4	N	0.20 4	5.95E01	7.7	LYM 15 2	12371. 2	F	0.44 8	2.08E01	42.9
LYM90	12395. 1	N	0.20 2	6.07E01	6.6	LYM 15 3	12324. 1	F	0.49 6	2.14E01	58.4
LYM6	11733. 2	N	0.20 1	6.29E01	6.3	LYM 13 7	12151. 2	F	0.42 9	2.24E01	36.8
LYM25 0	12613. 2	N	0.20 1	6.31E01	6.1	LYM20 1	12833. 9	F	0.35 6	2.26E01	13.5
LYM 15 9	13352. 4	N	0.20 1	6.42E01	6.1	LYM 13 7	12154. 5	F	0.45 9	2.29E01	46.6
LYM 15 7	13342. 4	N	0.20 2	6.50E01	6.9	LYM27 0	12872. 7	F	0.34 2	2.46E01	9.3

256

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM6	11734. 3	N	0.2	6.63E01	5.5	LYM 17 4	12411. 3	F	0.48 4	2.50E01	54.5
LYM 17 5	12651. 4	N	0.19 8	7.57E01	4.9	LYM24 2	13053. 7	F	0.35 1	2.53E01	12
LYM 10 7	12631. 4	N	0.19 6	7.70E01	3.7	LYM27 0	12873. 6	F	0.44	2.56E01	40.5
LYM89	12214. 3	N	0.19 3	8.96E01	1.7	LYM 13 8	12564. 1	F	0.45 5	2.60E01	45.3
LYM28 3	13304. 4	N	0.19 2	9.03E01	1.7	LYM27 0	12872. 5	F	0.34 1	2.66E01	8.9
LYM88	12194. 2	N	0.19 1	9.26E01	1.2	LYM 11 1	12251. 3	F	0.35 5	2.73E01	13.4
LYM90	12393. 1	N	0.19 2	9.27E01	1.2	LYM 10 2	12222. 1	F	0.38 8	2.84E01	23.7
LYM73	12623. 1	N	0.19 1	9.45E01	0.9	LYM25 5	13082. 5	F	0.46 6	2.88E01	48.6
LYM 17 5	12654. 6	N	0.19 1	9.48E01	0.9	LYM 10 0	12134. 1	F	0.34 9	3.08E01	11.4
LYM25 6	13323. 3	N	0.19	9.77E01	0.4	LYM 14 3	12524. 7	F	0.43 8	3.10E- 01	39.9
LYM 12 8	12641. 1	N	0.19	9.78E01	0.4	LYM 15 2	12371. 3	F	0.36 5	3.10E- 01	16.5
CONTR OL	—	N	0.18 9	—	0	LYM29 1	12753. 6	F	0.33 8	3.10E- 01	8
LYM 10 7	12631. 4	O	1.77	3.57E03	32.1	LYM 18 3	12994. 8	F	0.42 2	3.14E- 01	34.8
LYM 17 8	12163. 4	O	1.70 8	5.93E03	27.5	LYM44	11885. 4	F	0.33 9	3.19E- 01	8.1
LYM 14 7	12583. 3	o	1.69 2	7.49E03	26.3	LYM22 0	12851. 8	F	0.46 8	3.32E01	49.4
LYM23 6	12592. 3	o	1.68 6	7.99E03	25.9	LYM 14 2	12804. 1	F	0.40 8	3.37E01	30.4
LYM90	12395. 1	o	1.72 3	2.51E02	28.6	LYM28 8	12741. 9	F	0.44 2	3.47E01	41
LYM 12 9	12572. 4	o	1.60 8	3.01E- 02	20.1	LYM 10 7	12631. 2	F	0.37 7	3.60E01	20.3
LYM 14 7	12584. 4	o	1.57 9	4.98E02	17.9	LYM 13 0	12331. 3	F	0.43 8	3.65E01	39.9
LYM20 6	12603. 1	o	1.67 6	5.34E02	25.1	LYM 19 7	12821. 11	F	0.35 1	3.71E- 01	12.1
LYM88	12194. 2	o	1.56 4	5.43E02	16.8	LYM 18 3	12994. 7	F	0.38 8	3.71E- 01	23.9
LYM6	11736. 1	o	1.54 9	6.34E02	15.6	LYM90	12395. 3	F	0.43 3	3.94E01	38.2
LYM89	12211. 4	o	1.59 6	8.59E02	19.2	LYM25 5	13081. 5	F	0.38	3.98E01	21.4
LYM90	12395. 3	o	1.78 9	8.97E02	33.6	LYM28 7	12771. 7	F	0.34 9	4.04E01	11.3
LYM86	12182. 3	o	1.51 5	1.09E- 01	13.1	LYM28 8	12744. 6	F	0.39 9	4.10E01	27.3
LYM73	12623. 2	o	1.52 5	1.09E- 01	13.9	LYM 14 3	12524. 5	F	0.39 5	4.19E01	26

257

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM20 6	12603. 3	O	2.23 4	1.15E01	66.8	LYM28 9	12491. 1	F	0.33 3	4.32E01	6.2
LYM 12 8	12641. 3	o	1.53 1	1.26E01	14.3	LYM 17 3	12981. 5	F	0.39 8	4.35E01	27.1
LYM99	12243. 2	o	1.55 1	1.32E01	15.8	LYM 10 6	12142. 2	F	0.41 3	4.38E01	31.7
LYM88	12193. 1	o	1.84 7	1.84E01	37.9	LYM 13 7	12152. 1	F	0.39 1	4.50E01	24.8
LYM 15 9	13354. 6	o	1.52 4	1.99E01	13.8	LYM 14 3	12521. 2	F	0.34 6	4.92E01	10.4
LYM23 6	12594. 3	o	1.48 6	2.04E01	10.9	LYM 19 8	13004. 6	F	0.33 9	5.17E01	8.1
LYM25 0	12613. 4	o	2.00 9	2.25E01	49.9	LYM27 0	12871. 8	F	0.36	5.27E01	15
LYM 17 8	12164. 3	o	1.50 4	2.35E01	12.3	LYM 15 2	12372. 2	F	0.36 4	5.34E01	16.1
LYM88	12191. 2	o	1.70 1	2.49E01	27	LYM20 8	13012. 5	F	0.39 9	5.44E01	27.4
LYM99	12243. 1	o	1.84 6	2.59E01	37.8	LYM20 8	13013. 6	F	0.35 3	5.52E01	12.6
LYM25 0	12614. 1	o	1.51 2	2.61E01	12.9	LYM 13 0	12333. 1	F	0.37 2	5.61E01	18.7
LYM73	12623. 1	o	1.5	2.71E01	12	LYM 14 2	12801. 8	F	0.32 7	5.89E01	4.3
LYM25 0	12613. 2	o	1.45 4	2.72E01	8.5	LYM29 1	12751. 2	F	0.33 6	5.96E01	7.2
LYM 10 7	12633. 4	o	1.93	2.97E01	44.1	LYM24 2	13051. 9	F	0.36 1	5.96E01	15.1
LYM 17 8	12163. 3	o	1.69 9	3.27E01	26.8	LYM21 2	13032. 8	F	0.33 8	6.12E01	7.9
LYM6	11735. 1	o	1.87 5	3.35E01	40	LYM28 9	12492. 2	F	0.33 2	6.33E01	5.8
LYM 17 8	12161. 2	o	1.57 1	3.67E01	17.3	LYM27 0	12871. 5	F	0.36 8	6.53E01	17.3
LYM20 6	12601. 2	o	2.12 9	3.80E01	58.9	LYM 18 3	12993. 7	F	0.35 7	6.81E01	13.9
LYM 12 8	12642. 3	o	1.56 3	3.92E01	16.7	LYM 10 0	12133. 1	F	0.34 3	6.89E01	9.6
LYM 12 9	12573. 5	o	1.71 1	3.99E01	27.8	LYM 11 1	12251. 1	F	0.33	6.90E01	5.5
LYM 12 9	12573. 3	o	1.61 6	4.06E01	20.7	LYM28 8	12743. 8	F	0.36 3	7.05E01	15.8
LYM89	12214. 2	o	1.69 4	4.34E01	26.5	LYM61	13174. 7	F	0.33 6	7.42E01	7.2
LYM23 6	12591. 1	o	1.64 6	4.95E01	22.9	LYM29 1	12754. 9	F	0.35	7.44E01	11.8
LYM6	11734. 3	o	1.43 3	5.31E01	7	LYM 13 8	12566. 1	F	0.35 2	7.57E01	12.5
LYM90	12393. 1	o	1.57 5	5.32E01	17.6	LYM 19 7	12824. 7	F	0.33 2	7.58E01	5.8
LYM 17 5	12651. 2	o	1.40 8	5.50E01	5.1	LYM21 2	13034. 9	F	0.33 8	7.64E01	7.9

258

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM 17 5	12654. 4	O	1.59 6	5.60E01	19.1	LYM28 7	12773. 7	F	0.33 7	7.64E01	7.6
LYM89	12214. 3	o	1.52 3	5.70E01	13.7	LYM 19 8	13002. 6	F	0.32 8	7.83E01	4.8
LYM90	12392. 1	o	1.39 6	5.76E01	4.2	LYM 19 8	13002. 5	F	0.33 7	8.11E01	7.5
LYM25 0	12614. 2	o	1.48 6	5.89E01	11	LYM 10 2	12221. 2	F	0.32	8.28E01	2.3
LYM91	13284. 3	o	1.47	6.23E01	9.8	LYM20 1	12831. 5	F	0.32 6	8.38E01	4.1
LYM28 3	13304. 4	o	1.54 1	6.30E01	15.1	LYM 18 3	12993. 5	F	0.32	8.80E01	2.1
LYM 15 7	13341. 4	o	1.39 1	6.32E01	3.9	LYM 14 2	12802. 9	F	0.31 9	8.84E01	1.9
LYM23 6	12592. 4	o	1.56 5	6.43E01	16.8	LYM 14 2	12804. 3	F	0.33 2	8.91E01	5.8
LYM86	12183. 1	o	1.44 6	6.73E01	8	LYM20 1	12833. 7	F	0.32	9.02E01	2.3
LYM25 0	12611. 3	o	1.51 2	6.74E01	12.9	LYM 10 5	12297. 1	F	0.32 2	9.11E01	2.7
LYM6	11733. 2	o	1.41 4	7.15E01	5.5	LYM20 8	13011. 6	F	0.32 5	9.20E01	3.8
LYM91	13283. 4	o	1.47 5	7.75E01	10.1	LYM 19 8	13005. 6	F	0.31 6	9.23E01	0.9
LYM 17 5	12654. 6	o	1.40 5	7.80E01	4.9	LYM 19 7	12822. 7	F	0.31 6	9.30E01	0.7
LYM 12 8	12641. 1	o	1.42 6	7.91E01	6.5	LYM 17 3	12982. 7	F	0.32	9.33E01	2.1
LYM 15 9	13354. 5	o	1.36 5	8.31E01	1.9	LYM27 0	12871. 7	F	0.31 5	9.39E01	0.6
LYM 15 7	13342. 4	o	1.43 1	8.44E01	6.8	LYM20 8	13012. 8	F	0.31 7	9.44E01	1.2
LYM 14 7	12583. 1	o	1.44 3	8.70E01	7.7	LYM 14 3	12523. 4	F	0.31 7	9.74E01	1.3
LYM20 6	12603. 2	o	1.34 7	9.41E01	0.5	LYM90	12392. 1	F	0.31 5	9.85E01	0.4
LYM 17 8	12164. 2	o	1.35 5	9.61E01	1.1	LYM29 1	12751. 7	F	0.31 3	9.97E01	0
LYM 14 7	12584. 5	o	1.34 2	9.84E01	0.2	CONTR OL	—	F	0.31 3	—	0
LYM73	12622. 2	o	1.34 5	9.91E01	0.4	LYM 13 7	12154. 5	G	9.65 2	2.50E03	28.4
LYM 14 9	12344. 2	o	1.34 6	9.92E01	0.5	LYM 10 0	12131. 3	G	9.79 3	2.50E03	30.3
CONTR OL	—	o	1.33 9	—	0	LYM 13 8	12566. 1	G	9.6	3.03E03	27.8
LYM 17 8	12163. 4	P	2.40 5	5.91E03	17	LYM 19 7	12821. 6	G	9.48 7	4.52E03	26.3
LYM23 6	12592. 3	P	2.37 1	7.03E03	15.4	LYM28 8	12744. 6	G	10.0 91	4.70E03	34.3
LYM90	12395. 3	P	2.35 6	1.03E02	14.6	LYM 15 3	12324. 2	G	9.39 9	5.04E03	25.1

259

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM88	12193. 1	P	2.44 5	2.73E02	19	LYM 17 4	12412. 1	G	9.89 8	6.17E- 03	31.7
LYM89	12211. 4	P	2.28 6	3.08E02	11.2	LYM28 8	12743. 9	G	9.30 9	6.49E03	23.9
LYM 14 7	12583. 3	P	2.32 1	3.39E02	12.9	LYM 14 3	12524. 7	G	9.94 8	7.18E- 03	32.4
LYM20 6	12603. 3	P	2.67	3.75E02	29.9	LYM 17 4	12411. 3	G	8.93 8	1.97E02	18.9
LYM20 6	12603. 1	P	2.36 5	4.22E02	15	LYM 14 3	12524. 5	G	9.43 6	2.22E02	25.6
LYM 15 9	13354. 6	P	2.24 4	6.96E02	9.2	LYM 13 8	12561. 1	G	8.80 3	2.93E02	17.1
LYM73	12623. 2	P	2.22 8	8.37E02	8.4	LYM 17 4	12414. 3	G	9.91 8	3.00E02	32
LYM99	12243. 2	P	2.21 7	9.87E02	7.8	LYM 10 2	12222. 3	G	8.78 6	3.08E02	16.9
LYM90	12395. 1	P	2.34 8	1.12E- 01	14.2	LYM24 2	13052. 5	G	8.76 3	3.35E02	16.6
LYM6	11735. 1	P	2.45 9	1.30E- 01	19.6	LYM 10 5	12295. 2	G	8.76	3.42E02	16.6
LYM 14 7	12584. 4	P	2.19 7	1.35E- 01	6.9	LYM25 5	13082. 9	G	9.04 4	3.44E02	20.4
LYM88	12194. 2	P	2.19 4	1.52E- 01	6.8	LYM28 9	12491. 4	G	8.79 6	3.65E02	17.1
LYM 10 7	12631. 4	P	2.30 2	1.87E- 01	12	LYM 10 2	12221. 2	G	9.39 5	3.66E02	25
LYM6	11734. 3	P	2.25 5	1.95E- 01	9.7	LYM 10 0	12131. 2	G	8.71 3	3.84E02	15.9
LYM6	11736. 1	P	2.17 5	1.97E01	5.8	LYM 15 3	12321. 2	G	9.90 2	4.76E02	31.8
LYM73	12623. 1	P	2.20 1	2.31E01	7.1	LYM 13 7	12151. 4	G	8.63 7	4.92E02	14.9
LYM23 6	12594. 3	P	2.18 1	2.39E01	6.1	LYM90	12395. 1	G	8.67 2	4.94E02	15.4
LYM25 0	12613. 4	P	2.57 3	2.42E01	25.2	LYM 13 7	12152. 1	G	9.49	5.11E- 02	26.3
LYM 17 8	12161. 2	P	2.33 7	2.59E01	13.7	LYM 10 7	12631. 1	G	9.23 4	5.21E- 02	22.9
LYM 10 7	12633. 4	P	2.57 1	2.61E01	25.1	LYM28 9	12493. 1	G	11.0 18	5.29E02	46.6
LYM 17 8	12163. 3	P	2.33 5	2.65E01	13.6	LYM 18 3	12994. 7	G	8.60 9	5.68E02	14.6
LYM 12 9	12572. 4	P	2.18	2.78E01	6.1	LYM 15 3	12323. 2	G	8.69 3	6.46E02	15.7
LYM25 0	12613. 2	P	2.18 6	2.87E01	6.3	LYM 10 6	12142. 1	G	8.73 7	6.51E- 02	16.3
LYM86	12182. 3	P	2.14 9	3.06E01	4.5	LYM44	11885. 3	G	8.74	7.16E- 02	16.3
LYM88	12191. 2	P	2.36 2	3.07E01	14.9	LYM27 0	12872. 5	G	8.54 2	7.30E02	13.7
LYM25 0	12614. 1	P	2.15 6	3.08E01	4.9	LYM 17 4	12414. 2	G	9.38	7.53E02	24.8

260

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM12 9	12573. 5	P	2.34	3.12E- 01	13.8	LYM61	13174. 7	G	8.67 5	7.55E02	15.4
LYM12 9	12573. 3	P	2.27 9	3.13E- 01	10.9	LYM10 6	12142. 3	G	8.48 1	7.93E02	12.9
LYM99	12243. 1	P	2.45 2	3.36E01	19.3	LYM10 2	12221. 1	G	8.52 3	8.03E02	13.4
LYM17 8	12164. 3	P	2.14 6	3.40E01	4.4	LYM10 0	12134. 1	G	8.54 7	8.05E02	13.7
LYM12 8	12641. 3	P	2.14 9	3.45E01	4.6	LYM28 8	12741. 9	G	8.47 2	8.26E02	12.7
LYM20 6	12601. 2	P	2.58 8	3.87E01	25.9	LYM28 9	12491. 1	G	8.52 2	8.40E02	13.4
LYM15 7	13341. 4	P	2.14 3	4.06E01	4.2	LYM17 3	12981. 8	G	8.64 9	8.84E02	15.1
LYM25 0	12614. 2	P	2.21 6	4.21E01	7.8	LYM10 7	12632. 3	G	8.46 9	9.28E02	12.7
LYM90	12392. 1	P	2.12 1	4.64E01	3.2	LYM13 8	12561. 3	G	9.89	9.40E02	31.6
LYM89	12214. 2	P	2.29 6	4.65E01	11.7	LYM28 7	12771. 7	G	8.57 3	9.43E02	14.1
LYM15 9	13354. 5	P	2.14 3	4.69E01	4.2	LYM11 9	12461. 4	G	10.0 68	9.61E02	34
LYM23 6	12591. 1	P	2.30 5	5.02E01	12.1	LYM18 3	12994. 8	G	8.64 1	9.88E02	15
LYM90	12393. 1	P	2.20 2	5.67E01	7.1	LYM11 1	12252. 2	G	9.76 7	1.10E01	30
LYM23 6	12592. 4	P	2.26 6	5.72E01	10.2	LYM17 3	12982. 7	G	8.45 6	1.10E01	12.5
LYM17 5	12654. 4	P	2.24 7	5.93E01	9.3	LYM29 1	12753. 6	G	8.43	1.13E01	12.2
LYM25 0	12611. 3	P	2.25 2	6.16E- 01	9.6	LYM10 5	12293. 1	G	8.74 9	1.13E01	16.4
LYM89	12214. 3	P	2.19 2	6.24E01	6.6	LYM13 0	12331. 3	G	9.17 1	1.24E01	22
LYM91	13284. 3	P	2.21 6	6.26E01	7.8	LYM22 0	12852. 4	G	8.54	1.27E- 01	13.6
LYM28 3	13304. 4	P	2.18 4	6.55E01	6.3	LYM90	12393. 1	G	8.36 8	1.28E01	11.4
LYM12 8	12642. 3	P	2.14 3	6.86E01	4.3	LYM44	11884. 1	G	8.32 4	1.29E- 01	10.8
LYM17 5	12651. 2	P	2.09 1	6.92E01	1.7	LYM20 8	13014. 7	G	8.33 6	1.38E01	10.9
LYM91	13283. 4	P	2.17 7	7.80E01	5.9	LYM15 2	12371. 2	G	8.31 6	1.41E01	10.7
LYM15 7	13342. 4	P	2.12 9	8.55E01	3.6	LYM27 0	12871. 8	G	9.58 7	1.48E01	27.6
LYM86	12183. 1	P	2.08 6	8.93E01	1.5	LYM10 6	12144. 3	G	8.49 2	1.51E01	13
LYM12 8	12641. 1	P	2.08 1	9.09E01	1.3	LYM10 0	12133. 1	G	9.10 5	1.51E01	21.2
LYM6	11733. 2	P	2.08	9.12E01	1.2	LYM29 1	12751. 7	G	8.33 2	1.55E01	10.9

261

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM15 9	13352. 4	P	2.07	9.20E01	0.7	LYM90	12395. 3	G	8.26 1	1.57E01	9.9
LYM73	12622. 2	P	2.08 5	9.45E01	1.4	LYM61	13171. 7	G	9.39 6	1.58E01	25
LYM14 7	12583. 1	P	2.09 5	9.49E01	1.9	LYM44	11884. 3	G	8.44 2	1.59E01	12.3
CONTR OL	—	P	2.05 6	—	0	LYM28 8	12743. 5	G	11.0 95	1.61E01	47.6
LYM16 5	12973. 8	A	91.4 61	5.84E02	2.5	LYM17 4	12411. 2	G	8.32 4	1.65E01	10.8
LYM14 2	12803. 6	A	91.2 85	7.62E02	2.3	LYM28 7	12774. 6	G	8.76 8	1.68E01	16.7
LYM24 2	13052. 5	A	91.1 79	8.25E02	2.1	LYM25 5	13082. 7	G	9.39 8	1.69E01	25.1
LYM14 2	12804. 4	A	91.5 2	1.16E01	2.5	LYM14 3	12521. 1	G	9.11 9	1.76E01	21.4
LYM22 0	12851. 7	A	92.0 43	1.54E01	3.1	LYM90	12392. 1	G	8.32	1.76E01	10.7
LYM14 2	12802. 9	A	90.7 34	1.57E01	1.6	LYM25 5	13082. 8	G	10.9 7	1.80E01	46
LYM22 0	12851. 13	A	90.6 71	1.90E01	1.6	LYM21 2	13034. 8	G	9.01 6	1.83E01	20
LYM27 0	12874. 7	A	90.1 87	3.71E01	1	LYM10 2	12222. 2	G	8.42 2	1.87E01	12.1
LYM21 2	13032. 8	A	90.2 58	4.05E01	1.1	LYM24 2	13054. 9	G	9.01 3	1.90E01	19.9
LYM16 5	12973. 6	A	90.3 5	4.28E01	1.2	LYM10 6	12141. 4	G	8.55 8	2.06E01	13.9
LYM22 3	12674. 2	A	90.2 59	4.31E01	1.1	LYM10 7	12631. 4	G	9.99 3	2.10E01	33
LYM27 0	12872. 5	A	90.3 41	4.99E01	1.2	LYM14 3	12521. 2	G	8.35 7	2.11E01	11.2
LYM22 0	12851. 11	A	90.4 46	5.73E01	1.3	LYM20 8	13013. 9	G	8.78 2	2.14E01	16.9
LYM20 3	12664. 1	A	89.7 91	5.92E01	0.6	LYM13 8	12562. 2	G	8.17 5	2.14E01	8.8
LYM16 5	12972. 6	A	89.9 24	6.77E01	0.7	LYM25 5	13082. 5	G	8.23 7	2.26E01	9.6
LYM14 2	12804. 3	A	89.6 63	6.98E01	0.4	LYM10 7	12633. 4	G	9.10 6	2.32E01	21.2
LYM20 3	12662. 3	A	89.5 92	7.80E01	0.4	LYM14 2	12804. 1	G	10.6 62	2.37E01	41.9
LYM21 2	13031. 5	A	89.7 6	8.24E01	0.6	LYM24 2	13051. 9	G	8.60 4	2.43E01	14.5
LYM16 5	12974. 5	A	89.4 51	8.70E01	0.2	LYM19 7	12822. 5	G	9.43 5	2.48E01	25.6
LYM14 2	12801. 8	A	89.8 33	9.02E01	0.6	LYM44	11882. 1	G	9.75 8	2.48E01	29.9
LYM22 0	12852. 4	A	89.4 91	9.29E01	0.2	LYM27 0	12871. 5	G	8.25 5	2.54E01	9.9
LYM20 7	13252. 2	A	89.4 64	9.67E01	0.2	LYM10 0	12133. 3	G	8.86 4	2.58E01	18

262

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM21 2	13034. 9	A	89.3 17	9.73E01	0.1	LYM15 3	12324. 1	G	9.76 5	2.62E01	29.9
CONTR OL	—	A	89.2 68	—	0	LYM10 5	12297. 2	G	8.08 1	2.72E01	7.5
LYM20 3	12662. 3	B	0.35 7	2.54E03	16.5	LYM10 2	12222. 1	G	8.19	2.75E01	9
LYM14 2	12804. 4	B	0.34 6	2.59E02	13.1	LYM11 9	12463. 2	G	8.45 5	2.83E01	12.5
LYM27 0	12872. 8	B	0.32	1.49E01	4.5	LYM13 0	12333. 1	G	8.85 1	2.85E01	17.8
LYM20 7	13251. 5	B	0.32	2.19E01	4.5	LYM15 2	12372. 2	G	9.44 6	2.96E01	25.7
LYM24 2	13051. 8	B	0.32 3	2.70E01	5.5	LYM19 8	13002. 5	G	8.89 7	2.97E01	18.4
LYM21 2	13032. 8	B	0.32 8	3.94E01	6.9	LYM15 2	12373. 1	G	10.5 3	3.04E01	40.1
LYM16 5	12973. 5	B	0.31 1	5.21E01	1.6	LYM13 0	12332. 2	G	8.94 9	3.07E01	19.1
LYM16 5	12974. 5	B	0.34 3	5.67E01	11.8	LYM20 8	13013. 6	G	8.78	3.08E01	16.8
LYM22 0	12851. 11	B	0.32 4	5.74E01	5.9	LYM19 7	12824. 7	G	8.20 9	3.20E01	9.2
LYM16 5	12973. 6	B	0.33 9	5.91E01	10.8	LYM13 0	12334. 1	G	8.52 4	3.27E01	13.4
LYM21 2	13034. 9	B	0.32 2	6.03E01	5.1	LYM15 3	12322. 1	G	10.0 78	3.33E01	34.1
LYM16 5	12972. 6	B	0.31	6.28E01	1.2	LYM11 9	12462. 1	G	11.3 22	3.43E01	50.7
LYM22 3	12674. 5	B	0.31 1	6.63E01	1.6	LYM21 2	13031. 6	G	8.34 4	3.43E01	11
LYM24 2	13054. 9	B	0.32 1	6.88E01	4.7	LYM15 2	12371. 3	G	8.83 5	3.43E01	17.6
LYM22 3	12674. 2	B	0.31 8	7.66E01	3.9	LYM25 5	13081. 5	G	8.36 9	3.44E01	11.4
LYM21 2	13034. 8	B	0.31 4	8.88E01	2.6	LYM13 8	12564. 1	G	9.04 3	3.61E01	20.3
LYM14 2	12804. 3	B	0.30 8	9.13E01	0.4	LYM11 9	12462. 2	G	8.79 1	3.63E01	17
LYM27 0	12872. 7	B	0.30 8	9.59E01	0.4	LYM28 8	12743. 8	G	7.99 1	3.87E01	6.3
CONTR OL	—	B	0.30 6	—	0	LYM20 8	13011. 6	G	9.20 7	3.94E01	22.5
LYM27 0	12872. 8	C	3.21 4	1.73E02	9	LYM18 3	12993. 8	G	8.73 2	4.00E01	16.2
LYM24 2	13051. 8	C	3.05 6	2.19E01	3.6	LYM22 0	12851. 13	G	7.96 2	4.01E01	6
LYM20 3	12662. 3	C	3.39 4	2.48E01	15.1	LYM22 0	12852. 2	G	8.43 1	4.14E01	12.2
LYM16 5	12973. 6	C	3.36 3	2.58E01	14	LYM11 1	12251. 4	G	7.93 8	4.15E01	5.6
LYM22 0	12851. 11	C	3.08 8	3.21E01	4.7	LYM20 1	12833. 9	G	8.43 6	4.26E01	12.3

263

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM27 0	12872. 7	C	3.02 5	4.73E01	2.6	LYM11 9	12461. 1	G	8.18 8	4.34E01	9
LYM20 7	13251. 5	c	3.08 1	4.87E01	4.5	LYM14 3	12524. 2	G	8.46 4	4.56E01	12.6
LYM14 2	12804. 3	c	3.00 6	4.98E01	1.9	LYM29 1	12754. 9	G	8.19 3	4.61E01	9
LYM16 5	12974. 5	c	3.31 9	5.38E01	12.5	LYM19 8	13005. 8	G	7.98 7	4.62E01	6.3
LYM21 2	13032. 8	c	3.14 4	5.50E01	6.6	LYM13 0	12332. 1	G	9.02 5	4.71E01	20.1
LYM24 2	13054. 9	c	3.07 5	6.60E01	4.3	LYM20 1	12834. 6	G	9.02 8	4.74E01	20.1
LYM14 2	12804. 4	c	3.11 9	6.89E01	5.7	LYM17 3	12981. 5	G	9.30 8	4.78E01	23.9
LYM21 2	13034. 9	c	3.06 9	7.34E01	4	LYM21 2	13034. 9	G	7.93 3	4.85E01	5.6
LYM21 2	13034. 8	c	3.08 1	7.88E01	4.5	LYM10 5	12294. 2	G	8.76 5	4.98E01	16.6
LYM16 5	12974. 6	c	2.98 1	8.42E01	1.1	LYM13 7	12151. 1	G	7.90 6	5.03E01	5.2
LYM22 3	12674. 2	c	2.98 1	8.42E01	1.1	LYM19 7	12821. 11	G	8.25 8	5.15E01	9.9
CONTR OL	—	c	2.94 9	—	0	LYM20 8	13012. 5	G	8.23 8	5.34E01	9.6
LYM16 5	12973. 8	D	0.32	2.37E03	23	LYM28 9	12493. 2	G	9.26 5	5.36E01	23.3
LYM20 7	13251. 6	D	0.30 5	1.11E02	17.4	LYM13 7	12153. 1	G	8.62	5.42E01	14.7
LYM16 5	12973. 6	D	0.36	3.31E02	38.6	LYM13 7	12151. 2	G	10.0 46	5.51E01	33.7
LYM20 7	13251. 4	D	0.29 5	5.21E02	13.4	LYM14 2	12801. 8	G	8.68 6	5.67E01	15.6
LYM20 3	12664. 1	D	0.29 5	1.18E01	13.7	LYM13 8	12562. 1	G	7.81 9	5.85E01	4.1
LYM14 2	12804. 4	D	0.32 7	1.20E01	25.7	LYM28 8	12744. 7	G	8.89 5	5.96E01	18.4
LYM22 0	12851. 7	D	0.28 9	1.21E01	11.3	LYM18 3	12991. 7	G	8.05 7	6.16E01	7.2
LYM21 2	13034. 9	D	0.32 1	1.28E01	23.6	LYM19 8	13002. 8	G	7.83 1	6.34E01	4.2
LYM20 3	12662. 3	D	0.39 2	1.71E01	50.9	LYM24 2	13053. 7	G	7.80 2	6.36E01	3.8
LYM16 5	12972. 6	D	0.33 7	2.51E01	29.6	LYM19 8	13004. 6	G	8.07 8	6.38E01	7.5
LYM14 2	12802. 9	D	0.28 8	2.59E01	10.9	LYM29 1	12751. 1	G	7.80 8	6.53E01	3.9
LYM22 0	12851. 11	D	0.27 5	2.93E01	5.7	LYM10 7	12631. 2	G	8.18 8	6.54E01	9
LYM16 5	12974. 5	D	0.36 6	3.60E01	40.7	LYM11 1	12251. 3	G	8.43	6.54E01	12.2
LYM14 2	12804. 3	D	0.28	3.67E01	7.9	LYM11 1	12254. 4	G	8.21	6.60E01	9.3

264

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM21 2	13032. 8	D	0.31 3	3.99E01	20.5	LYM17 3	12982. 6	G	8.19 6	6.75E01	9.1
LYM20 7	13251. 5	D	0.27 1	4.58E01	4.2	LYM90	12394. 2	G	7.74 9	6.78E01	3.1
LYM21 2	13034. 8	D	0.32 6	4.77E01	25.5	LYM28 9	12492. 2	G	7.87 8	6.78E01	4.8
LYM24 2	13051. 8	D	0.31 7	5.01E01	22.2	LYM27 0	12873. 6	G	8.65 6	6.86E01	15.2
LYM24 2	13054. 9	D	0.29 6	5.23E01	14	LYM14 2	12804. 3	G	8.10 5	6.98E01	7.9
LYM14 2	12801. 8	D	0.27 7	5.35E01	6.7	LYM29 1	12751. 2	G	8.02 2	6.99E01	6.7
LYM27 0	12871. 7	D	0.26 6	6.43E01	2.4	LYM10 7	12632. 1	G	8.13 3	7.08E01	8.2
LYM16 5	12973. 5	D	0.28 5	6.48E01	9.5	LYM10 6	12142. 2	G	7.73 6	7.26E01	3
LYM20 3	12664. 2	D	0.27 3	7.59E01	5.1	LYM14 2	12803. 6	G	7.72 3	7.27E01	2.8
LYM14 2	12804. 1	D	0.27 1	8.59E01	4.2	LYM61	13174. 5	G	7.91 6	7.37E01	5.3
LYM27 0	12872. 7	D	0.26 2	8.71E01	0.8	LYM27 0	12872. 7	G	7.67 3	7.48E01	2.1
LYM22 3	12674. 2	D	0.26 1	9.23E01	0.5	LYM22 0	12851. 8	G	8.08 2	7.70E01	7.6
CONTR OL	—	D	0.26	—	0	LYM15 2	12373. 2	G	7.82	7.80E01	4.1
LYM16 5	12973. 8	E	8.62 5	4.10E04	12	LYM20 1	12831. 5	G	7.64	7.97E01	1.7
LYM21 2	13034. 9	E	8.43 8	1.77E03	9.6	LYM19 8	13005. 6	G	7.68 8	8.21E01	2.3
LYM16 5	12973. 6	E	8.75	4.04E03	13.6	LYM11 1	12254. 3	G	7.70 7	8.31E01	2.6
LYM16 5	12972. 6	E	8.31 3	5.10E03	7.9	LYM19 8	13002. 6	G	7.83 7	8.35E01	4.3
LYM14 2	12803. 6	E	8.18 8	1.61E02	6.3	LYM14 3	12523. 4	G	7.68 5	8.37E01	2.3
LYM20 7	13251. 5	E	8.18 8	1.61E02	6.3	LYM19 7	12824. 4	G	7.75 5	8.48E01	3.2
LYM20 3	12664. 1	E	9	5.72E02	16.9	LYM20 1	12833. 6	G	7.59 4	8.73E01	1.1
LYM22 0	12851. 11	E	8	8.14E02	3.9	LYM20 8	13012. 8	G	7.63 1	9.07E01	1.6
LYM14 2	12804. 4	E	8.31 3	1.00E01	7.9	LYM10 6	12144. 4	G	7.55 3	9.41E01	0.5
LYM21 2	13034. 8	E	8.43 8	2.09E01	9.6	LYM10 2	12222. 6	G	7.56 4	9.61E01	0.7
LYM20 3	12662. 3	E	8.62 5	2.09E01	12	LYM22 0	12851. 11	G	7.52 1	9.92E01	0.1
LYM16 5	12974. 5	E	8.31 3	2.60E01	7.9	CONTR OL	—	G	7.51 4	—	0
LYM21 2	13032. 8	E	8.31 3	2.60E01	7.9	LYM17 4	12414. 3	H	16.7 48	1.00E06	72.1

265

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM22 0	12851. 7	E	8.25	3.59E01	7.1	LYM28 8	12743. 9	H	13.8 43	3.30E05	42.2
LYM27 0	12871. 7	E	7.93 8	4.08E01	3.1	LYM25 5	13082. 8	H	13.6 98	4.70E05	40.7
LYM14 2	12801. 8	E	8	4.22E01	3.9	LYM10 6	12144. 4	H	12.9 94	2.04E04	33.5
LYM20 7	13251. 6	E	8	4.22E01	3.9	LYM27 0	12873. 6	H	12.6 95	4.90E04	30.4
LYM14 2	12804. 1	E	8.12 5	4.47E01	5.5	LYM28 9	12492. 2	H	12.1 41	1.30E- 03	24.7
LYM22 3	12674. 2	E	7.81 3	5.05E01	1.4	LYM10 5	12294. 2	H	11.9 67	1.87E- 03	22.9
LYM27 0	12872. 5	E	8.12 5	5.48E01	5.5	LYM13 0	12332. 1	H	15.4 26	3.71E- 03	58.5
LYM24 2	13051. 8	E	8.06 3	5.55E01	4.7	LYM15 3	12323. 2	H	14.6 28	4.86E03	50.3
LYM14 2	12802. 9	E	8	5.67E01	3.9	LYM13 0	12334. 1	H	12.6 21	5.52E03	29.7
LYM20 3	12664. 2	E	7.75	8.10E- 01	0.6	LYM13 7	12153. 1	H	11.4 76	7.32E03	17.9
LYM14 2	12804. 3	E	7.81 3	8.76E01	1.4	LYM15 3	12324. 2	H	13.5 15	7.63E03	38.9
LYM24 2	13052. 5	E	7.75	8.83E01	0.6	LYM17 3	12981. 6	H	11.7 01	8.10E- 03	20.2
LYM22 0	12851. 13	E	7.75	9.38E01	0.6	LYM13 8	12561. 1	H	21.8 1	8.93E03	124.1
LYM24 2	13054. 9	E	7.75	9.50E01	0.6	LYM28 9	12493. 1	H	14.5 47	1.07E02	49.5
CONTR OL	—	E	7.70 1	—	0	LYM11 9	12461. 4	H	16.2 44	1.16E02	66.9
LYM16 5	12973. 6	F	0.59 6	7.95E02	13.5	LYM10 2	12222. 2	H	13.4 08	1.46E02	37.7
LYM14 2	12804. 4	F	0.59 2	1.09E- 01	12.7	LYM10 2	12222. 3	H	11.6 38	1.94E- 02	19.6
LYM16 5	12973. 8	F	0.58 6	1.31E- 01	11.7	LYM10 5	12297. 2	H	12.7 83	2.07E02	31.3
LYM20 3	12664. 1	F	0.63 3	2.49E01	20.5	LYM10 7	12631. 2	H	11.0 91	2.27E02	14
LYM20 3	12662. 3	F	0.69 4	2.67E01	32.3	LYM13 8	12561. 3	H	16.5 24	3.41E- 02	69.8
LYM24 2	13051. 8	F	0.58 2	3.48E01	10.9	LYM11 9	12461. 1	H	15.5 82	6.22E02	60.1
LYM20 7	13251. 6	F	0.56 1	3.53E01	6.8	LYM10 5	12293. 1	H	13.5 58	6.63E02	39.3
LYM24 2	13054. 9	F	0.57	4.74E01	8.5	LYM10 6	12141. 4	H	11.1 04	7.61E- 02	14.1
LYM21 2	13034. 8	F	0.58 7	5.70E01	11.8	LYM21 2	13032. 8	H	11.5 93	7.79E02	19.1
LYM16 5	12972. 6	F	0.55 7	5.84E01	6	LYM11 9	12463. 2	H	15.3 35	8.15E02	57.6
LYM16 5	12974. 5	F	0.57 8	6.31E- 01	10	LYM10 5	12295. 2	H	12.8 55	8.74E02	32.1

266

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM21 2	13034. 9	F	0.54	7.29E01	2.9	LYM17 3	12982. 6	H	10.6 59	8.92E02	9.5
LYM14 2	12804. 1	F	0.54 1	7.41E01	3	LYM11 1	12254. 4	H	11.4 42	9.17E02	17.6
LYM20 7	13251. 4	F	0.53 8	7.77E01	2.4	LYM17 4	12411. 2	H	13.7 91	1.04E01	41.7
LYM16 5	12973. 5	F	0.53 4	8.72E01	1.6	LYM22 0	12851. 8	H	15.0 87	1.22E01	55
LYM21 2	13032. 8	F	0.52 7	9.61E01	0.5	LYM10 5	12294. 3	H	10.8 46	1.28E01	11.4
CONTR OL	—	F	0.52 5	—	0	LYM13 7	12151. 4	H	13.0 64	1.38E01	34.2
LYM20 3	12662. 3	G	10.7 73	2.09E01	11.7	LYM17 4	12412. 1	H	14.7 75	1.64E01	51.8
LYM22 3	12671. 2	G	10.2 17	5.89E01	6	LYM10 6	12142. 2	H	15.8 71	1.65E01	63.1
LYM21 2	13034. 8	G	10.0 24	7.08E01	4	LYM13 0	12332. 2	H	12.9 21	1.74E01	32.8
LYM14 2	12804. 1	G	9.73 1	8.40E01	0.9	LYM24 2	13051. 8	H	11.3 19	1.75E01	16.3
LYM27 0	12871. 7	G	9.68 1	9.77E01	0.4	LYM10 7	12632. 3	H	14.7 68	1.82E01	51.7
CONTR OL	—	G	9.64 1	—	0	LYM15 2	12373. 1	H	11.0 22	2.05E01	13.2
LYM16 5	12973. 6	H	16.9 61	8.98E04	45.3	LYM13 7	12151. 1	H	12.6 58	2.07E01	30
LYM16 5	12973. 8	H	14.7 78	4.30E03	26.6	LYM15 3	12324. 1	H	14.1 97	2.09E01	45.9
LYM20 7	13251. 6	H	14.3 26	3.04E02	22.7	LYM10 7	12631. 4	H	11.1 47	2.14E01	14.5
LYM14 2	12804. 4	H	15.5 89	3.30E02	33.5	LYM11 9	12462. 1	H	14.8 06	2.26E01	52.1
LYM20 3	12664. 1	H	14.0 85	5.01E02	20.7	LYM13 8	12562. 2	H	12.0 98	2.27E01	24.3
LYM21 2	13034. 9	H	14.9 93	9.74E02	28.4	LYM28 9	12491. 1	H	10.6 24	2.38E01	9.1
LYM20 3	12662. 3	H	19.3 28	1.50E01	65.6	LYM17 4	12411. 3	H	15.5 39	2.45E01	59.6
LYM16 5	12972. 6	H	15.6 17	2.04E01	33.8	LYM13 7	12151. 2	H	12.6 94	2.45E01	30.4
LYM20 7	13251. 5	H	12.7 19	2.12E01	9	LYM15 3	12322. 1	H	10.7 28	2.52E01	10.2
LYM22 0	12851. 7	H	13.0 19	2.47E01	11.5	LYM11 1	12252. 2	H	12.3 72	2.55E01	27.1
LYM20 7	13251. 4	H	13.2 24	2.75E01	13.3	LYM28 8	12743. 8	H	11.7 15	2.62E01	20.4
LYM22 0	12851. 11	H	12.5 36	3.05E01	7.4	LYM28 7	12774. 6	H	10.4 25	2.70E01	7.1
LYM16 5	12974. 5	H	17.1 37	3.08E01	46.8	LYM28 8	12743. 5	H	14.2 37	2.75E01	46.3
LYM21 2	13032. 8	H	14.5 04	4.27E01	24.3	LYM24 2	13052. 5	H	10.9 22	2.99E01	12.2

267

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM21 2	13034. 8	H	15.1 69	4.30E01	29.9	LYM10 7	12631. 1	H	11.2 58	3.08E01	15.7
LYM14 2	12801. 8	H	12.8 3	4.42E01	9.9	LYM10 0	12131. 3	H	10.8 77	3.20E01	11.7
LYM14 2	12802. 9	H	12.8 29	4.65E01	9.9	LYM28 9	12491. 4	H	10.5 77	3.20E01	8.7
LYM24 2	13054. 9	H	13.5 01	4.67E01	15.7	LYM90	12395. 3	H	11.5 46	3.34E01	18.6
LYM24 2	13051. 8	H	14.4 12	5.21E- 01	23.5	LYM10 2	12222. 1	H	10.7 14	3.34E01	10.1
LYM14 2	12804. 3	H	12.4 9	5.36E01	7	LYM19 7	12821. 6	H	11.0 8	3.37E01	13.8
LYM16 5	12973. 5	H	12.6 26	6.39E01	8.2	LYM25 5	13082. 7	H	13.6 91	3.37E01	40.7
LYM22 3	12674. 2	H	11.9 68	7.07E01	2.5	LYM11 9	12462. 2	H	13.5 06	3.41E- 01	38.8
LYM14 2	12804. 1	H	12.3 27	8.32E01	5.6	LYM15 2	12371. 2	H	14.3 31	3.57E01	47.2
LYM20 3	12664. 2	H	12.0 83	8.49E01	3.5	LYM15 3	12321. 2	H	12.3 6	3.58E01	27
LYM27 0	12871. 7	H	11.7 94	8.95E01	1	LYM28 7	12771. 6	H	10.2 73	3.68E01	5.5
LYM27 0	12872. 7	H	11.7 54	9.22E01	0.7	LYM28 9	12493. 2	H	14.0 17	3.69E01	44
CONTR OL	—	H	11.6 73	—	0	LYM10 6	12144. 3	H	12.3 56	3.75E01	26.9
LYM20 3	12662. 3	J	0.04 6	2.04E03	50.5	LYM25 5	13082. 5	H	14.4 81	3.83E01	48.8
LYM16 5	12973. 6	J	0.04 2	6.22E03	38.8	LYM28 8	12741. 9	H	11.8 34	4.12E01	21.6
LYM16 5	12974. 5	J	0.04 3	1.62E02	41	LYM13 8	12564. 1	H	11.6 16	4.26E01	19.3
LYM16 5	12972. 6	J	0.03 9	4.57E02	29.2	LYM29 1	12754. 9	H	12.3 03	4.35E01	26.4
LYM14 2	12804. 4	J	0.03 8	6.13E- 02	25.6	LYM10 2	12221. 1	H	10.8 24	4.81E01	11.2
LYM21 2	13034. 8	J	0.03 8	9.39E02	26.4	LYM15 2	12371. 3	H	11.5 86	4.88E01	19
LYM21 2	13034. 9	J	0.03 7	1.03E- 01	22.1	LYM25 5	13082. 9	H	10.8 51	5.04E01	11.5
LYM16 5	12973. 8	J	0.03 7	1.07E- 01	21.7	LYM13 0	12331. 3	H	12.7 14	5.44E01	30.6
LYM21 2	13032. 8	J	0.03 7	1.53E- 01	20.9	LYM21 2	13031. 6	H	10.1 72	5.47E01	4.5
LYM24 2	13051. 8	J	0.03 7	1.67E- 01	20.7	LYM14 3	12524. 7	H	11.9 39	5.72E01	22.7
LYM20 7	13251. 6	J	0.03 6	1.84E- 01	17.5	LYM17 3	12981. 5	H	10.6 49	5.74E01	9.4
LYM20 3	12664. 1	J	0.03 5	2.26E01	16	LYM10 6	12142. 3	H	10.1 39	5.74E01	4.2
LYM20 7	13251. 4	J	0.03 5	2.79E01	14.1	LYM14 2	12802. 9	H	11.0 41	5.91E- 01	13.4

268

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM14 2	12802. 9	J	0.03 5	3.01E01	14	LYM19 8	13005. 8	H	10.1 83	5.92E01	4.6
LYM22 0	12851. 7	J	0.03 5	3.06E01	13.9	LYM10 2	12222. 6	H	10.7 59	6.01E01	10.5
LYM24 2	13054. 9	J	0.03 4	3.48E01	13	LYM13 7	12154. 5	H	12.3 54	6.05E01	26.9
LYM16 5	12973. 5	J	0.03 4	3.92E01	12.3	LYM20 1	12834. 6	H	10.2 94	7.03E01	5.8
LYM14 2	12804. 3	J	0.03 3	4.73E01	9.4	LYM18 3	12994. 8	H	11.3 14	7.10E01	16.2
LYM20 3	12664. 2	J	0.03 3	5.96E01	7.4	LYM44	11885. 4	H	10.2 56	7.27E01	5.4
LYM22 0	12851. 11	J	0.03 2	6.35E01	6.1	LYM24 2	13053. 7	H	10.0 93	7.36E01	3.7
LYM14 2	12804. 1	J	0.03 2	6.79E01	6	LYM29 1	12753. 6	H	10.3 37	7.51E01	6.2
LYM24 2	13053. 7	J	0.03 2	6.82E01	5.5	LYM14 3	12524. 5	H	10.9 26	7.58E01	12.2
LYM14 2	12801. 8	J	0.03 1	7.91E01	3.5	LYM20 1	12833. 7	H	9.92 7	7.73E01	2
LYM27 0	12871. 7	J	0.03 1	8.11E01	3	LYM13 0	12333. 1	H	10.3 53	7.92E01	6.4
LYM22 3	12674. 2	J	0.03 1	9.08E01	1.6	LYM28 7	12773. 7	H	10.3 4	8.02E01	6.2
LYM20 7	13251. 5	J	0.03 1	9.50E01	0.8	LYM18 3	12993. 7	H	10.2 25	8.25E01	5
CONTR OL	—	J	0.03	—	0	LYM18 3	12994. 7	H	9.92 4	8.96E01	2
LYM20 7	13251. 5	K	0.59 4	5.66E02	26.1	LYM21 2	13034. 9	H	10.1 57	9.25E01	4.4
LYM16 5	12973. 6	K	0.57 8	9.58E02	22.8	LYM20 8	13012. 5	H	9.99 2	9.35E01	2.7
LYM20 3	12664. 1	K	0.57 5	1.28E01	22.2	CONTR OL	—	H	9.73 3	—	0
LYM20 3	12662. 3	K	0.56 4	1.31E01	19.8	LYM13 8	12561. 1	J	0.04 4	0.00E +00	114
LYM22 0	12851. 7	K	0.54 3	2.71E01	15.2	LYM11 9	12461. 1	J	0.03 7	1.00E06	76.2
LYM20 7	13251. 6	K	0.53 6	3.18E01	13.9	LYM13 8	12561. 3	J	0.03 5	5.00E06	69.7
LYM21 2	13034. 9	K	0.53	3.55E01	12.6	LYM17 4	12414. 3	J	0.03 6	1.20E05	71.7
LYM21 2	13034. 8	K	0.53 3	3.98E01	13.1	LYM11 9	12461. 4	J	0.03 4	1.30E05	64.1
LYM16 5	12974. 5	K	0.52 2	4.02E01	10.8	LYM11 9	12463. 2	J	0.03 4	1.90E05	64.3
LYM16 5	12973. 8	K	0.52 2	4.55E01	10.8	LYM10 7	12632. 3	J	0.03 4	7.40E05	63
LYM22 3	12672. 5	K	0.51 3	5.04E01	8.9	LYM10 6	12142. 2	J	0.03 4	1.01E04	65.8
LYM14 2	12804. 1	K	0.51 4	5.15E01	9.2	LYM15 3	12324. 1	J	0.03 3	1.07E04	60.5

269

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM22 3	12671. 2	K	0.51 2	5.28E01	8.8	LYM 15 3	12323. 2	J	0.03 2	1.80E04	53.5
LYM24 2	13054. 9	K	0.50 4	6.16E01	7.1	LYM 13 7	12151. 4	J	0.03 1	1.99E04	50.4
LYM21 2	13032. 8	K	0.50 1	6.28E01	6.4	LYM22 0	12851. 8	J	0.03 2	2.34E04	54.5
LYM22 3	12674. 5	K	0.49 6	6.88E01	5.3	LYM 13 0	12332. 1	J	0.03 1	2.64E04	50.1
LYM21 2	13033. 6	K	0.48 9	7.67E01	4	LYM 17 4	12411. 3	J	0.03 4	3.59E04	63.7
LYM 16 5	12972. 6	K	0.49 1	7.69E01	4.3	LYM 10 5	12293. 1	J	0.03 1	6.37E04	49.9
LYM20 3	12663. 2	K	0.48 8	7.77E01	3.6	LYM 17 4	12412. 1	J	0.03 2	8.23E04	51.7
LYM 14 2	12804. 4	K	0.48	8.75E01	2	LYM 10 5	12295. 2	J	0.03 1	1.04E03	48
LYM20 7	13252. 2	K	0.47 9	8.90E01	1.8	LYM28 9	12493. 1	J	0.03	1.42E03	44.8
LYM24 2	13051. 8	K	0.47 9	8.95E01	1.7	LYM25 5	13082. 5	J	0.03 2	1.50E03	56.1
LYM 14 2	12801. 8	K	0.47 9	9.03E01	1.7	LYM 15 3	12324. 2	J	0.03	1.83E03	45.6
LYM27 0	12872. 5	K	0.47 9	9.09E01	1.7	LYM 10 6	12144. 4	J	0.02 9	1.94E03	40.2
LYM21 2	13032. 6	K	0.47 7	9.20E01	1.4	LYM 10 2	12222. 2	J	0.02 9	2.58E03	41.7
LYM20 7	13251. 4	K	0.47 7	9.26E01	1.2	LYM28 8	12743. 5	J	0.03	2.77E03	46
LYM22 0	12851. 13	K	0.47 7	9.27E01	1.2	LYM 10 5	12294. 2	J	0.02 9	3.58E03	39
LYM 14 2	12803. 6	K	0.47 6	9.37E01	1.1	LYM 17 4	12411. 2	J	0.03	3.72E03	44.5
CONTR OL	—	K	0.47 1	—	0	LYM 13 7	12151. 1	J	0.02 9	3.78E03	38.1
LYM20 3	12662. 3	L	2.45 4	6.01E04	67.5	LYM 11 9	12462. 1	J	0.03	3.98E03	43.3
LYM 16 5	12973. 6	L	2.13 8	6.78E03	45.9	LYM28 8	12743. 9	J	0.02 9	4.98E03	37.8
LYM 16 5	12974. 5	L	2.15	1.34E02	46.8	LYM 15 2	12371. 2	J	0.03 1	5.43E03	50.5
LYM 14 2	12804. 4	L	1.96 1	3.94E02	33.9	LYM 13 8	12562. 2	J	0.02 9	5.54E03	38.3
LYM 16 5	12972. 6	L	1.94 8	5.24E02	33	LYM 13 7	12151. 2	J	0.02 8	6.64E03	36.8
LYM21 2	13034. 9	L	1.86 2	9.49E02	27.2	LYM 17 3	12981. 6	J	0.02 8	7.33E03	34.4
LYM21 2	13034. 8	L	1.90 5	9.76E02	30	LYM27 0	12873. 6	J	0.02 8	7.96E03	36.4
LYM 16 5	12973. 8	L	1.83 2	1.21E01	25.1	LYM25 5	13082. 8	J	0.02 8	8.97E03	35.1
LYM20 7	13251. 6	L	1.81 9	1.25E01	24.2	LYM 11 9	12462. 2	J	0.02 9	1.07E02	37.4

270

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM20 3	12664. 1	L	1.79 6	1.54E01	22.6	LYM25 5	13082. 7	J	0.02 9	1.24E02	37.2
LYM21 2	13032. 8	L	1.80 7	1.78E01	23.3	LYM21 2	13032. 8	J	0.02 7	1.37E02	31.2
LYM24 2	13051. 8	L	1.79 2	1.99E01	22.3	LYM 15 3	12321. 2	J	0.02 7	1.78E02	31.6
LYM24 2	13054. 9	L	1.70 9	3.00E01	16.7	LYM 10 5	12297. 2	J	0.02 7	1.78E02	30.6
LYM20 7	13251. 4	L	1.68 5	3.34E01	15	LYM 11 1	12252. 2	J	0.02 7	2.00E02	31.9
LYM22 0	12851. 7	L	1.65 2	4.23E01	12.8	LYM 13 0	12334. 1	J	0.02 6	2.61E02	26.9
LYM 14 2	12802. 9	L	1.61 8	5.12E01	10.5	LYM 10 6	12144. 3	J	0.02 7	2.82E02	30.8
LYM 16 5	12973. 5	L	1.59 5	5.81E01	8.9	LYM28 9	12493. 2	J	0.02 8	3.23E02	34.8
LYM20 7	13251. 5	L	1.58 9	5.87E01	8.5	LYM 13 7	12153. 1	J	0.02 6	3.50E02	26.5
LYM 14 2	12804. 3	L	1.58 1	6.12E01	7.9	LYM 15 2	12373. 1	J	0.02 6	3.60E02	26.5
LYM 14 2	12801. 8	L	1.56 8	6.52E01	7.1	LYM 19 7	12821. 6	J	0.02 6	3.74E02	25.9
LYM22 0	12851. 11	L	1.56 4	6.64E01	6.7	LYM 13 0	12332. 2	J	0.02 6	4.55E02	27.4
LYM 14 2	12804. 1	L	1.55	7.25E01	5.8	LYM90	12395. 3	J	0.02 6	4.79E02	25.8
LYM20 3	12664. 2	L	1.52 4	7.99E01	4.1	LYM28 8	12743. 8	J	0.02 6	5.52E02	24.7
LYM22 3	12674. 2	L	1.50 8	8.52E01	3	LYM28 7	12771. 6	J	0.02 6	5.89E02	23.5
LYM24 2	13053. 7	L	1.49 1	9.09E01	1.8	LYM20 1	12833. 7	J	0.02 5	6.60E02	22.3
LYM27 0	12871. 7	L	1.47 1	9.76E01	0.5	LYM 10 2	12222. 3	J	0.02 6	7.07E02	22.7
LYM20 3	12663. 2	L	1.46 7	9.91E01	0.2	LYM 17 3	12981. 5	J	0.02 6	7.84E02	23.1
CONTR OL	—	L	1.46 5	—	0	LYM29 1	12754. 9	J	0.02 6	8.08E02	26.4
LYM20 3	12662. 3	M	0.30 7	6.02E04	65.1	LYM 11 1	12254. 4	J	0.02 5	8.41E02	22
LYM 16 5	12973. 6	M	0.26 7	7.02E03	43.8	LYM 13 0	12331. 3	J	0.02 7	8.47E02	31
LYM 16 5	12974. 5	M	0.26 9	1.43E02	44.6	LYM 15 3	12322. 1	J	0.02 5	1.13E01	19.3
LYM 14 2	12804. 4	M	0.24 5	4.25E02	31.9	LYM 10 2	12221. 1	J	0.02 5	1.20E01	20
LYM 16 5	12972. 6	M	0.24 4	5.69E02	31	LYM 10 7	12631. 4	J	0.02 5	1.20E01	20.2
LYM21 2	13034. 9	M	0.23 3	1.04E01	25.3	LYM 14 3	12524. 7	J	0.02 6	1.22E01	26.9
LYM21 2	13034. 8	M	0.23 8	1.07E01	28.1	LYM 10 2	12222. 1	J	0.02 5	1.30E01	19.7

271

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM 16 5	12973. 8	M	0.22 9	1.33E- 01	23.2	LYM 18 3	12994. 8	J	0.02 6	1.32E- 01	24.3
LYM20 7	13251. 6	M	0.22 7	1.38E- 01	22.4	LYM 10 7	12631. 2	J	0.02 5	1.38E- 01	18.9
LYM20 3	12664. 1	M	0.22 4	1.69E- 01	20.8	LYM28 8	12741. 9	J	0.02 5	1.56E- 01	19.2
LYM21 2	13032. 8	M	0.22 6	1.96E- 01	21.5	LYM21 2	13031. 6	J	0.02 4	1.70E- 01	16.3
LYM24 2	13051. 8	M	0.22 4	2.19E01	20.5	LYM 13 7	12154. 5	J	0.02 6	1.75E- 01	22.8
LYM24 2	13054. 9	M	0.21 4	3.31E- 01	14.9	LYM28 9	12492. 2	J	0.02 5	1.76E- 01	20.6
LYM20 7	13251. 4	M	0.21 1	3.69E01	13.3	LYM 15 2	12371. 3	J	0.02 5	1.77E01	20.4
LYM22 0	12851. 7	M	0.20 6	4.66E01	11.1	LYM 13 8	12564. 1	J	0.02 5	1.84E- 01	19
LYM 14 2	12802. 9	M	0.20 2	5.62E01	8.9	LYM24 2	13051. 8	J	0.02 4	1.87E- 01	17.1
LYM 16 5	12973. 5	M	0.19 9	6.37E01	7.3	LYM 10 5	12294. 3	J	0.02 4	1.91E- 01	16.8
LYM20 7	13251. 5	M	0.19 9	6.45E01	6.9	LYM 10 6	12141. 4	J	0.02 4	1.95E- 01	16.3
LYM 14 2	12804. 3	M	0.19 8	6.72E01	6.3	LYM25 5	13082. 9	J	0.02 4	2.05E01	16.4
LYM 14 2	12801. 8	M	0.19 6	7.14E- 01	5.5	LYM 13 0	12333. 1	J	0.02 4	2.15E01	16.4
LYM22 0	12851. 11	M	0.19 5	7.28E01	5.2	LYM 14 2	12802. 9	J	0.02 4	2.26E01	17.3
LYM 14 2	12804. 1	M	0.19 4	7.89E01	4.3	LYM24 2	13052. 5	J	0.02 4	2.31E01	14.8
LYM20 3	12664. 2	M	0.19 1	8.68E01	2.5	LYM 10 7	12631. 1	J	0.02 4	2.35E01	15.8
LYM22 3	12674. 2	M	0.18 8	9.25E01	1.4	LYM 18 3	12993. 5	J	0.02 4	2.40E01	15.5
LYM24 2	13053. 7	M	0.18 6	9.85E01	0.3	LYM20 1	12834. 6	J	0.02 4	2.60E01	13.6
CONTR OL	—	M	0.18 6	—	0	LYM 18 3	12993. 7	J	0.02 4	2.63E01	15.1
LYM20 3	12662. 3	N	0.26 4	3.40E02	25.7	LYM 10 6	12142. 3	J	0.02 4	3.01E- 01	13.1
LYM 16 5	12973. 6	N	0.25 2	7.08E02	19.8	LYM21 2	13034. 9	J	0.02 4	3.25E01	17.3
LYM20 7	13251. 6	N	0.23 9	2.15E01	13.5	LYM 10 7	12632. 1	J	0.02 3	3.27E01	13
LYM 16 5	12974. 5	N	0.24 5	2.21E01	16.6	LYM 10 2	12222. 6	J	0.02 3	3.49E01	12.4
LYM20 3	12664. 1	N	0.23 6	2.76E01	12.4	LYM 14 3	12524. 5	J	0.02 4	3.52E01	15.7
LYM 16 5	12972. 6	N	0.23 8	2.78E01	13.2	LYM29 1	12753. 6	J	0.02 3	3.61E- 01	12.4
LYM21 2	13034. 9	N	0.23 5	2.89E01	11.8	LYM 19 8	13005. 8	J	0.02 3	3.80E01	10.4

272

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM21 2	13034. 8	N	0.23 8	2.99E01	13.2	LYM28 7	12771. 7	J	0.02 3	4.35E01	9.5
LYM 14 2	12804. 4	N	0.22 7	4.59E01	8	LYM20 1	12833. 9	J	0.02 3	4.54E01	9.4
LYM 16 5	12973. 8	N	0.22 2	6.03E01	5.6	LYM 14 2	12804. 3	J	0.02 3	4.60E01	11.2
LYM24 2	13053. 7	N	0.22 2	6.06E01	5.7	LYM27 0	12871. 7	J	0.02 3	4.62E01	9.4
LYM 14 2	12804. 1	N	0.22 3	6.06E01	5.9	LYM 14 2	12801. 8	J	0.02 3	4.62E01	9
LYM 14 2	12802. 9	N	0.22	6.96E01	4.3	LYM28 7	12773. 7	J	0.02 3	4.62E01	10.2
LYM24 2	13051. 8	N	0.21 8	7.46E01	3.8	LYM28 9	12491. 4	J	0.02 3	4.64E01	8.6
LYM27 0	12871. 7	N	0.21 8	7.46E01	3.5	LYM 17 3	12982. 7	J	0.02 3	4.68E01	11.3
LYM 16 5	12973. 5	N	0.21 7	7.75E01	3.3	LYM20 8	13012. 5	J	0.02 3	4.71E01	12.1
LYM22 0	12851. 7	N	0.21 7	7.88E01	3.1	LYM44	11885. 4	J	0.02 2	5.57E01	7.6
LYM21 2	13032. 8	N	0.21 7	7.96E01	3	LYM 10 5	12297. 1	J	0.02 2	5.76E01	7.3
LYM24 2	13054. 9	N	0.21 3	9.14E01	1.2	LYM27 0	12871. 8	J	0.02 2	5.94E01	7.6
LYM20 7	13251. 4	N	0.21 3	9.16E01	1.1	LYM25 5	13081. 5	J	0.02 2	5.99E01	8
LYM20 3	12664. 2	N	0.21 3	9.31E01	1	LYM27 0	12871. 5	J	0.02 3	6.13E01	9.1
LYM 14 2	12804. 3	N	0.21 2	9.52E01	0.6	LYM 11 1	12251. 1	J	0.02 2	6.31E01	5.9
LYM20 3	12663. 2	N	0.21 1	9.76E01	0.3	LYM28 9	12491. 1	J	0.02 2	6.50E01	5.6
LYM22 0	12851. 11	N	0.21 1	9.90E01	0.1	LYM24 2	13053. 7	J	0.02 2	6.73E01	5.4
CONTR OL	—	N	0.21	—	0	LYM 18 3	12994. 7	J	0.02 2	7.41E01	4.1
LYM 16 5	12973. 6	O	2.12	1.10E03	43.2	LYM27 0	12872. 7	J	0.02 2	7.82E01	3.7
LYM 16 5	12973. 8	O	1.84 7	4.09E03	24.8	LYM 19 7	12824. 4	J	0.02 1	7.94E01	3.2
LYM20 7	13251. 6	o	1.79 1	3.64E02	20.9	LYM28 7	12774. 6	J	0.02 2	7.96E01	3.5
LYM 14 2	12804. 4	o	1.94 9	4.00E02	31.6	LYM 17 3	12982. 6	J	0.02 1	8.19E01	2.9
LYM20 3	12664. 1	o	1.76 1	6.02E02	18.9	LYM20 8	13013. 6	J	0.02 1	8.22E01	3
LYM21 2	13034. 9	o	1.87 4	1.12E01	26.6	LYM 10 0	12131. 3	J	0.02 1	8.23E01	2.8
LYM20 3	12662. 3	o	2.41 6	1.58E01	63.2	LYM 14 3	12521. 2	J	0.02 1	8.76E01	2
LYM 16 5	12972. 6	o	1.95 2	2.19E01	31.8	LYM 14 3	12523. 4	J	0.02 1	8.78E01	2.7

273

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM20 7	13251. 5	O	1.59	2.62E01	ΊΑ	LYM21 2	13034. 8	J	0.02 1	8.79E01	1.9
LYM22 0	12851. 7	o	1.62 7	2.95E01	9.9	LYM19 8	13004. 6	J	0.02 1	8.86E01	1.7
LYM20 7	13251. 4	o	1.65 3	3.18E- 01	11.6	LYM14 3	12521. 1	J	0.02 1	9.11E01	1.3
LYM16 5	12974. 5	o	2.14 2	3.19E- 01	44.7	LYM29 1	12751. 2	J	0.02 1	9.32E01	1
LYM22 0	12851. 11	o	1.56 7	3.79E01	5.8	LYM10 0	12133. 3	J	0.02 1	9.61E01	0.6
LYM21 2	13034. 8	o	1.89 6	4.48E01	28.1	LYM15 2	12372. 2	J	0.02 1	9.80E01	0.3
LYM21 2	13032. 8	o	1.81 3	4.49E01	22.4	LYM20 8	13012. 8	J	0.02 1	9.84E01	0.3
LYM14 2	12801. 8	o	1.60 4	5.02E01	8.3	CONTR OL	—	J	0.02 1	—	0
LYM24 2	13054. 9	o	1.68 8	5.03E01	14	LYM28 8	12741. 9	K	0.71 3	2.72E01	13.6
LYM14 2	12802. 9	o	1.60 4	5.24E01	8.3	LYM11 9	12462. 2	K	0.70 6	3.08E01	12.4
LYM24 2	13051. 8	o	1.80 2	5.42E01	21.7	LYM28 9	12493. 1	K	0.70 4	3.13E- 01	12.1
LYM14 2	12804. 3	o	1.56 1	6.15E- 01	5.4	LYM14 2	12804. 1	K	0.69 5	3.86E01	10.7
LYM16 5	12973. 5	o	1.57 8	6.95E01	6.6	LYM44	11882. 1	K	0.69 5	3.88E01	10.7
LYM22 3	12674. 2	o	1.49 6	8.67E01	1	LYM14 3	12524. 7	K	0.68 8	4.41E01	9.5
LYM14 2	12804. 1	o	1.54 1	8.75E01	4.1	LYM61	13174. 7	K	0.69 5	4.79E01	10.7
LYM20 3	12664. 2	o	1.51	9.11E01	2	LYM11 9	12461. 4	K	0.67 6	5.05E01	7.6
CONTR OL	—	o	1.48 1	—	0	LYM13 7	12154. 5	K	0.67 5	5.37E01	7.5
LYM16 5	12973. 6	P	2.64 3	2.53E03	17.9	LYM61	13174. 5	K	0.67 5	5.82E01	7.5
LYM20 7	13251. 6	P	2.52 5	1.43E02	12.6	LYM18 3	12994. 7	K	0.66 5	6.12E- 01	5.9
LYM16 5	12973. 8	P	2.47 2	3.44E02	10.2	LYM10 2	12222. 3	K	0.66 3	6.21E- 01	5.6
LYM20 3	12662. 3	P	2.9	8.02E02	29.3	LYM17 4	12414. 3	K	0.66 3	6.23E01	5.6
LYM14 2	12804. 4	P	2.42	1.34E- 01	7.9	LYM22 0	12851. 8	K	0.65 7	6.76E01	4.7
LYM20 7	13251. 4	P	2.38 9	1.67E- 01	6.5	LYM25 5	13082. 7	K	0.65 7	6.95E01	4.7
LYM20 3	12664. 1	P	2.47 8	3.11E- 01	10.5	LYM28 9	12493. 2	K	0.65 3	7.43E01	4
LYM21 2	13034. 9	P	2.45	3.23E01	9.2	LYM19 8	13005. 8	K	0.65	7.67E01	3.5
LYM16 5	12972. 6	P	2.55 8	3.80E01	14.1	LYM11 1	12252. 2	K	0.64 9	7.68E01	3.3

274

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM27 0	12871. 7	P	2.31 4	4.47E01	3.2	LYM90	12395. 1	K	0.65	7.75E01	3.5
LYM21 2	13032. 8	P	2.37	4.77E01	5.7	LYM24 2	13052. 5	K	0.64 9	7.83E01	3.3
LYM 16 5	12974. 5	P	2.60 7	4.77E01	16.2	LYM28 9	12491. 1	K	0.64 7	7.89E01	3
LYM24 2	13051. 8	P	2.42 2	4.96E01	8	LYM 15 3	12322. 1	K	0.64 5	8.11E- 01	2.7
LYM21 2	13034. 8	P	2.57	5.11E- 01	14.6	LYM 10 5	12297. 2	K	0.64 4	8.23E01	2.7
LYM24 2	13054. 9	P	2.35 8	6.45E01	5.1	LYM44	11885. 3	K	0.64 3	8.28E01	2.5
LYM 14 2	12802. 9	P	2.28 6	6.67E01	1.9	LYM 10 2	12222. 6	K	0.64 3	8.39E01	2.5
LYM 16 5	12973. 5	P	2.31 5	7.84E01	3.2	LYM28 8	12744. 7	K	0.64 3	8.42E01	2.5
LYM20 3	12664. 2	P	2.28	8.53E01	1.7	LYM29 1	12754. 9	K	0.64 3	8.48E01	2.5
LYM 14 2	12804. 1	P	2.27 6	8.85E01	1.5	LYM 10 7	12631. 4	K	0.64 1	8.56E01	2.1
LYM22 0	12851. 7	P	2.26	9.04E01	0.8	LYM29 1	12751. 7	K	0.64	8.64E01	2
LYM27 0	12872. 7	P	2.25	9.41E01	0.3	LYM28 8	12743. 9	K	0.64	8.66E01	2
LYM 14 2	12804. 3	P	2.24 5	9.83E01	0.1	LYM 17 4	12414. 2	K	0.64	8.72E01	2
CONTR OL	—	P	2.24 3	—	0	LYM90	12392. 1	K	0.64	8.76E01	1.9
LYM4	11701. 1	A	93.6 53	1.73E03	4	LYM 14 3	12523. 4	K	0.64 1	8.77E01	2.1
LYM21	11672. 4	A	93.5 89	1.90E- 03	3.9	LYM 11 1	12251. 3	K	0.63 9	8.79E01	1.8
LYM 16 2	12231. 3	A	93.4	2.63E03	3.7	LYM 10 2	12221. 1	K	0.63 6	9.12E01	1.3
LYM1	11602. 6	A	93.3 52	2.88E03	3.7	LYM 10 2	12221. 2	K	0.63 3	9.47E01	0.8
LYM4	11702. 3	A	93.2 89	3.25E03	3.6	LYM 17 4	12412. 1	K	0.63 1	9.60E01	0.6
LYM 12 9	12571. 3	A	93.2 81	3.37E03	3.6	LYM25 5	13082. 8	K	0.63	9.70E01	0.4
LYM2	11692. 3	A	93.1 97	3.86E03	3.5	LYM 13 7	12152. 1	K	0.62 9	9.82E01	0.3
LYM2	11695. 3	A	93.1 69	4.02E03	3.5	LYM44	11884. 1	K	0.62 8	9.94E01	0.1
LYM 17 4	12411. 2	A	93.1 89	4.79E03	3.5	CONTR OL	—	K	0.62 8	—	0
LYM 12 9	12573. 5	A	93.2 64	5.07E03	3.6	LYM 13 8	12561. 1	L	2.7	0.00E +00	124.8
LYM9	11632. 2	A	92.9 63	5.75E03	3.2	LYM 17 4	12414. 3	L	2.07 5	1.50E- 05	72.8
LYM9	11634. 5	A	92.7 88	8.06E03	3	LYM 13 8	12561. 3	L	2.06 2	2.00E05	71.7

275

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM1	11602. 1	A	92.6 34	1.10E02	2.9	LYM 11 9	12461. 4	L	2.01 6	4.40E05	67.8
LYM 17	11684. 5	A	92.5 39	1.23E02	2.8	LYM 11 9	12461. 1	L	1.97 8	1.02E- 04	64.7
LYM 11 1	12251. 3	A	92.4 4	1.48E02	2.6	LYM 13 0	12332. 1	L	1.89 5	1.67E- 04	57.8
LYM 16 2	12234. 4	A	92.5 26	1.48E02	2.7	LYM 10 6	12142. 2	L	1.96 9	3.33E04	63.9
LYM4	11706. 5	A	92.4 04	1.58E02	2.6	LYM 11 9	12463. 2	L	1.88 4	4.03E04	56.8
LYM 13 0	12333. 1	A	92.7 28	1.74E- 02	3	LYM22 0	12851. 8	L	1.88	5.61E- 04	56.5
LYM 14 3	12521. 1	A	92.3 55	1.77E02	2.5	LYM 17 4	12411. 3	L	1.93 1	8.78E04	60.7
LYM28 9	12491. 4	A	92.2 93	1.95E02	2.5	LYM 17 4	12412. 1	L	1.83 1	1.48E- 03	52.4
LYM 14 3	12523. 4	A	92.2 43	2.22E02	2.4	LYM28 9	12493. 1	L	1.80 5	1.50E- 03	50.2
LYM 13 0	12331. 3	A	92.6 7	2.48E02	2.9	LYM 10 7	12632. 3	L	1.79 9	2.47E03	49.7
LYM4	11706. 3	A	92.1 34	2.66E02	2.3	LYM 15 3	12323. 2	L	1.78 1	2.51E03	48.2
LYM29 0	12502. 1	A	93.9 71	2.67E02	4.3	LYM 15 3	12324. 1	L	1.79 8	2.61E03	49.7
LYM 17	11683. 1	A	93.1 89	2.71E02	3.5	LYM 11 9	12462. 1	L	1.78	5.10E- 03	48.1
LYM 17	11681. 4	A	92.3 82	2.78E02	2.6	LYM28 8	12743. 9	L	1.70 4	5.72E03	41.9
LYM 13 2	12275. 1	A	92.0 86	2.93E02	2.2	LYM25 5	13082. 5	L	1.82 6	5.79E03	52
LYM26 8	12482. 3	A	92.7 99	3.40E02	3	LYM25 5	13082. 8	L	1.68 7	7.22E03	40.4
LYM 14 3	12524. 7	A	92.0 03	3.43E02	2.2	LYM28 8	12743. 5	L	1.74 5	8.60E03	45.3
LYM 16	11623. 5	A	91.9 94	3.52E02	2.1	LYM25 5	13082. 7	L	1.71 9	1.08E02	43.1
LYM 10 0	12131. 3	A	93.2 35	3.92E02	3.5	LYM 15 3	12324. 2	L	1.66 1	1.28E02	38.3
LYM 14 1	12404. 3	A	92.2 79	3.95E02	2.5	LYM 11 9	12462. 2	L	1.70 5	1.33E02	42
LYM9	11633. 7	A	91.9 68	4.61E02	2.1	LYM 10 2	12222. 2	L	1.64 2	1.38E02	36.7
LYM 16	11623. 2	A	91.9 48	4.62E02	2.1	LYM 15 2	12371. 2	L	1.73 2	1.45E02	44.2
LYM 11 3	12441. 4	A	91.8 32	4.82E02	2	LYM 10 5	12293. 1	L	1.64 8	1.48E02	37.1
LYM 16	11622. 2	A	91.7 95	5.19E- 02	1.9	LYM 13 7	12151. 4	L	1.62 5	1.60E02	35.3
LYM28 9	12491. 1	A	92.5 54	5.47E02	2.8	LYM 17 4	12411. 2	L	1.65 1	1.70E02	37.4
LYM 17 4	12414. 2	A	91.8 86	5.60E02	2	LYM28 9	12493. 2	L	1.71 5	1.88E02	42.8

276

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM 15	11612. 3	A	92.3	6.55E02	2.5	LYM 10 6	12144. 4	L	1.58 8	2.45E02	32.2
LYM 14 3	12521. 2	A	92.3 39	6.73E02	2.5	LYM 10 5	12295. 2	L	1.59 4	2.68E02	32.7
LYM22	11762. 2	A	92.0 49	7.65E02	2.2	LYM 10 5	12297. 2	L	1.59 1	2.80E02	32.4
LYM 14 8	12173. 1	A	93.6 23	7.77E02	4	LYM 13 0	12332. 2	L	1.58 5	2.81E02	31.9
LYM26 8	12483. 4	A	92.1 1	7.91E02	2.3	LYM 13 0	12334. 1	L	1.57	2.87E02	30.7
LYM 15 3	12323. 2	A	92.0 18	8.66E02	2.2	LYM27 0	12873. 6	L	1.55 8	4.30E02	29.7
LYM 12 9	12572. 4	A	95.4 26	8.79E02	6	LYM 11 1	12252. 2	L	1.56	4.53E02	29.8
LYM 15 2	12373. 1	A	92.9 94	9.17E02	3.3	LYM 15 3	12321. 2	L	1.56 6	4.59E02	30.4
LYM 16	11624. 6	A	91.6 07	9.39E02	1.7	LYM 13 7	12151. 1	L	1.54 8	4.97E02	28.8
LYM 11 1	12251. 1	A	91.5 31	9.51E02	1.6	LYM 13 7	12151. 2	L	1.54 3	6.15E02	28.5
LYM 10 2	12222. 3	A	91.6 11	1.04E01	1.7	LYM 10 5	12294. 2	L	1.50 2	7.39E02	25.1
LYM 15 2	12371. 3	A	91.4 65	1.08E01	1.6	LYM 10 6	12144. 3	L	1.53 1	7.99E02	27.4
LYM 10 5	12293. 1	A	92.8 55	1.10E01	3.1	LYM 13 8	12562. 2	L	1.51	8.00E02	25.7
LYM 14 8	12171. 2	A	97.1 89	1.13E01	7.9	LYM29 1	12754. 9	L	1.52 4	8.85E02	26.8
LYM3	12041. 2	A	91.8 2	1.20E01	2	LYM 13 0	12331. 3	L	1.58 4	9.07E02	31.9
LYM29 0	12502. 4	A	92.5 41	1.25E01	2.8	LYM 13 7	12154. 5	L	1.53 5	1.33E01	27.8
LYM22	11762. 1	A	91.5 81	1.28E01	1.7	LYM 14 3	12524. 7	L	1.50 4	1.44E01	25.2
LYM26 8	12482. 1	A	91.5 18	1.36E01	1.6	LYM28 9	12492. 2	L	1.44 2	1.47E01	20.1
LYM3	12043. 1	A	92.1 54	1.37E01	2.3	LYM 10 2	12222. 3	L	1.44	1.55E01	19.8
LYM 11 1	12252. 2	A	92.0 17	1.44E01	2.2	LYM28 8	12741. 9	L	1.45 1	1.68E01	20.8
LYM 13 8	12561. 3	A	91.7 41	1.49E01	1.9	LYM 17 3	12981. 6	L	1.42 7	1.71E01	18.8
LYM 14 8	12172. 1	A	91.8 54	1.50E01	2	LYM 13 7	12153. 1	L	1.42 7	1.79E01	18.8
LYM 15	11611. 3	A	91.2 82	1.57E01	1.4	LYM 13 8	12564. 1	L	1.43 2	1.94E01	19.2
LYM 13 4	12313. 2	A	92.9 27	1.58E01	3.2	LYM90	12395. 3	L	1.42 5	1.97E01	18.6
LYM 14 1	12404. 2	A	92.6 66	1.60E01	2.9	LYM 15 2	12371. 3	L	1.43 9	2.02E01	19.8
LYM 15	11612. 2	A	92.3 99	1.67E01	2.6	LYM21 2	13032. 8	L	1.40 9	2.12E01	17.3

277

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM 13 8	12561. 1	A	91.6 67	1.72E01	1.8	LYM28 8	12743. 8	L	1.41	2.21E01	17.4
LYM 10	11741. 2	A	93.0 84	1.84E01	3.4	LYM 11 1	12254. 4	L	1.39 6	2.43E01	16.2
LYM2	11693. 3	A	91.3 11	1.94E01	1.4	LYM 19 7	12821. 6	L	1.38 3	2.76E01	15.1
LYM 13	11772. 1	A	91.1 62	1.96E01	1.2	LYM24 2	13051. 8	L	1.37 6	3.06E01	14.6
LYM 15 2	12371. 2	A	94.0 35	1.98E01	4.4	LYM 10 7	12631. 4	L	1.36 7	3.11E01	13.8
LYM 14 1	12404. 4	A	91.3 82	2.00E01	1.5	LYM24 2	13052. 5	L	1.37 1	3.18E01	14.1
LYM26 8	12483. 2	A	91.0 85	2.10E01	1.1	LYM 15 3	12322. 1	L	1.35 6	3.52E01	12.8
LYM29 0	12502. 2	A	91.2 45	2.10E01	1.3	LYM 10 6	12141. 4	L	1.35 5	3.53E01	12.8
LYM 13 2	12276. 1	A	91.9 05	2.21E01	2	LYM 15 2	12373. 1	L	1.35 4	3.59E01	12.7
LYM 13 0	12332. 1	A	91.4 23	2.26E01	1.5	LYM 10 7	12631. 2	L	1.35 6	3.69E01	12.9
LYM 13 7	12154. 5	A	92.6 34	2.36E01	2.9	LYM 10 7	12631. 1	L	1.35 4	3.80E01	12.7
LYM 14 1	12402. 4	A	92.7 47	2.36E01	3	LYM 10 2	12221. 1	L	1.35 1	3.82E01	12.4
LYM 13	11771. 6	A	92.6 02	2.48E01	2.8	LYM 18 3	12994. 8	L	1.38 5	3.83E01	15.3
LYM 15	11614. 3	A	90.9 56	2.69E01	1	LYM 10 5	12294. 3	L	1.32 1	4.64E01	10
LYM22	11764. 7	A	92.1 54	2.90E01	2.3	LYM 17 3	12981. 5	L	1.32	4.93E01	9.9
LYM 13 2	12273. 2	A	91.6 78	2.99E01	1.8	LYM28 9	12491. 4	L	1.31 2	5.04E01	9.2
LYM 11 9	12462. 1	A	92.8 84	2.99E01	3.1	LYM 10 2	12222. 1	L	1.31	5.15E01	9.1
LYM9	11633. 2	A	92.3 7	3.05E01	2.6	LYM25 5	13082. 9	L	1.31 4	5.16E01	9.4
LYM1	11603. 2	A	91.1 05	3.08E01	1.2	LYM 14 3	12524. 5	L	1.33 5	5.26E01	11.1
LYM 17	11682. 1	A	91.5 75	3.09E01	1.7	LYM28 9	12491. 1	L	1.30 5	5.32E01	8.6
LYM 19	11751. 5	A	91.9 71	3.18E01	2.1	LYM 14 2	12802. 9	L	1.31 6	5.37E01	9.5
LYM 10	11744. 1	A	90.9 73	3.22E01	1	LYM 10 0	12131. 3	L	1.3	5.51E01	8.2
LYM 11 9	12463. 2	A	91.6 19	3.27E01	1.7	LYM 10 2	12222. 6	L	1.30 3	5.63E01	8.5
LYM 16	11624. 4	A	91.3 28	3.34E01	1.4	LYM28 7	12774. 6	L	1.28 2	6.30E01	6.7
LYM 14 1	12404. 1	A	90.8 94	3.38E01	0.9	LYM 13 0	12333. 1	L	1.27 4	6.78E01	6
LYM 19	11751. 4	A	92.3 74	3.42E01	2.6	LYM 19 8	13005. 8	L	1.26 6	6.94E01	5.4

278

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM 17	11684. 4	A	91.3 21	3.42E01	1.4	LYM 18 3	12993. 7	L	1.27	7.00E01	5.7
LYM 17 4	12411. 3	A	90.9 96	3.43E01	1	LYM 10 6	12142. 3	L	1.26 5	7.00E01	5.3
LYM 10 5	12297. 1	A	92.5 11	3.51E01	2.7	LYM 18 3	12994. 7	L	1.26 4	7.06E01	5.3
LYM 15 2	12372. 2	A	91.6 33	3.54E01	1.7	LYM20 1	12834. 6	L	1.26 1	7.14E01	5
LYM 15 3	12324. 2	A	90.8 81	3.57E01	0.9	LYM29 1	12753. 6	L	1.26 3	7.29E01	5.1
LYM28 9	12493. 6	A	90.7 91	3.59E01	0.8	LYM28 7	12771. 6	L	1.25 8	7.30E01	4.7
LYM 13 0	12332. 2	A	92.2 23	3.66E01	2.4	LYM28 7	12773. 7	L	1.26 3	7.39E01	5.1
LYM 10	11744. 5	A	93.0 31	3.89E01	3.3	LYM21 2	13031. 6	L	1.25 5	7.40E01	4.4
LYM 14 3	12524. 2	A	90.7 7	4.06E01	0.8	LYM44	11885. 4	L	1.25 4	7.56E01	4.4
LYM 10 6	12141. 4	A	90.7 74	4.06E01	0.8	LYM21 2	13034. 9	L	1.26 7	7.63E01	5.5
LYM21	11671. 2	A	91.5 32	4.18E01	1.6	LYM 17 3	12982. 6	L	1.23	8.61E01	2.4
LYM29 0	12504. 1	A	91.0 68	4.24E01	1.1	LYM20 1	12833. 7	L	1.22 7	8.72E01	2.2
LYM 11 1	12254. 4	A	91.0 31	4.40E01	1.1	LYM44	11882. 1	L	1.20 9	9.64E01	0.7
LYM 11 9	12461. 4	A	91.1 97	4.58E01	1.3	LYM20 8	13012. 5	L	1.20 6	9.83E01	0.4
LYM21	11673. 1	A	91.3 87	4.60E01	1.5	CONTR OL	—	L	1.20 1	—	0
LYM 14 0	12262. 3	A	91.3 89	4.61E01	1.5	LYM 13 8	12561. 1	M	0.33 8	0.00E +00	124.8
LYM 14 8	12174. 2	A	91.6 62	4.77E01	1.8	LYM 17 4	12414. 3	M	0.25 9	1.50E05	72.8
LYM 11 1	12254. 3	A	91.1 61	4.82E01	1.2	LYM 13 8	12561. 3	M	0.25 8	2.00E05	71.7
LYM 13 8	12564. 1	A	91.5 67	4.91E01	1.7	LYM 11 9	12461. 4	M	0.25 2	4.40E05	67.8
LYM 19	11754. 1	A	90.5 86	5.02E01	0.6	LYM 11 9	12461. 1	M	0.24 7	1.02E04	64.7
LYM 11 9	12462. 2	A	91.2 66	5.04E01	1.3	LYM 13 0	12332. 1	M	0.23 7	1.67E04	57.8
LYM 10 2	12222. 2	A	91.3 56	5.05E01	1.4	LYM 10 6	12142. 2	M	0.24 6	3.33E04	63.9
LYM 10 5	12297. 2	A	90.8 82	5.68E01	0.9	LYM 11 9	12463. 2	M	0.23 5	4.03E04	56.8
LYM 11 9	12461. 1	A	91.2 25	5.83E01	1.3	LYM22 0	12851. 8	M	0.23 5	5.61E04	56.5
LYM22	11764. 1	A	91.3 11	5.88E01	1.4	LYM 17 4	12411. 3	M	0.24 1	8.78E04	60.7
LYM22	11761. 3	A	90.6 21	6.14E01	0.6	LYM 17 4	12412. 1	M	0.22 9	1.48E03	52.4

279

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM11 3	12442. 1	A	90.8 93	6.16E01	0.9	LYM28 9	12493. 1	M	0.22 6	1.50E03	50.2
LYM13 4	12311. 2	A	90.8 68	6.23E01	0.9	LYM10 7	12632. 3	M	0.22 5	2.47E03	49.7
LYM12 9	12573. 3	A	91.7 22	6.45E01	1.8	LYM15 3	12323. 2	M	0.22 3	2.51E03	48.2
LYM17 4	12414. 3	A	90.6 25	6.59E01	0.6	LYM15 3	12324. 1	M	0.22 5	2.61E03	49.7
LYM10	11742. 1	A	90.4 22	6.74E01	0.4	LYM11 9	12462. 1	M	0.22 2	5.10E03	48.1
LYM1	11601. 1	A	90.9 06	6.83E01	0.9	LYM28 8	12743. 9	M	0.21 3	5.72E03	41.9
LYM29 0	12501. 3	A	90.3 9	6.87E01	0.4	LYM25 5	13082. 5	M	0.22 8	5.79E03	52
LYM14 0	12261. 2	A	91.2 22	6.93E01	1.3	LYM25 5	13082. 8	M	0.21 1	7.22E03	40.4
LYM3	12041. 1	A	91.5 83	6.94E01	1.7	LYM28 8	12743. 5	M	0.21 8	8.60E03	45.3
LYM15 3	12321. 2	A	90.6 16	7.11E01	0.6	LYM25 5	13082. 7	M	0.21 5	1.08E02	43.1
LYM14 8	12174. 1	A	90.5 92	7.15E01	0.6	LYM15 3	12324. 2	M	0.20 8	1.28E02	38.3
LYM10 2	12221. 1	A	90.4 66	7.40E01	0.4	LYM11 9	12462. 2	M	0.21 3	1.33E02	42
LYM14 0	12261. 4	A	90.8 37	7.42E01	0.9	LYM10 2	12222. 2	M	0.20 5	1.38E02	36.7
LYM16 2	12234. 3	A	90.9 09	7.49E01	0.9	LYM15 2	12371. 2	M	0.21 7	1.45E02	44.2
LYM13 2	12271. 4	A	90.2 98	7.84E01	0.3	LYM10 5	12293. 1	M	0.20 6	1.48E02	37.1
LYM12 9	12572. 2	A	90.9 07	7.96E01	0.9	LYM13 7	12151. 4	M	0.20 3	1.60E02	35.3
LYM10 0	12134. 1	A	90.8 09	8.05E01	0.8	LYM17 4	12411. 2	M	0.20 6	1.70E02	37.4
LYM19	11753. 1	A	90.3 1	8.11E01	0.3	LYM28 9	12493. 2	M	0.21 4	1.88E02	42.8
LYM28 9	12493. 2	A	90.5 91	8.24E01	0.6	LYM10 6	12144. 4	M	0.19 9	2.45E02	32.2
LYM10 2	12222. 6	A	90.7 69	8.26E01	0.8	LYM10 5	12295. 2	M	0.19 9	2.68E02	32.7
LYM10	11742. 2	A	90.5 07	8.27E01	0.5	LYM10 5	12297. 2	M	0.19 9	2.80E02	32.4
LYM9	11632. 1	A	90.2 31	8.32E01	0.2	LYM13 0	12332. 2	M	0.19 8	2.81E02	31.9
LYM11 3	12444. 5	A	90.2 43	8.32E01	0.2	LYM13 0	12334. 1	M	0.19 6	2.87E02	30.7
LYM10 2	12222. 1	A	90.9 68	8.39E01	1	LYM27 0	12873. 6	M	0.19 5	4.30E02	29.7
LYM1	11604. 4	A	90.5 74	8.76E01	0.6	LYM11 1	12252. 2	M	0.19 5	4.53E02	29.8
LYM3	12043. 2	A	90.7 01	8.80E01	0.7	LYM15 3	12321. 2	M	0.19 6	4.59E02	30.4

280

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM10 5	12294. 3	A	90.2 28	8.91E01	0.2	LYM13 7	12151. 1	M	0.19 3	4.97E02	28.8
LYM15 3	12324. 1	A	90.3 08	8.94E01	0.3	LYM13 7	12151. 2	M	0.19 3	6.15E02	28.5
LYM15	11614. 4	A	90.1 58	9.00E01	0.1	LYM10 5	12294. 2	M	0.18 8	7.39E02	25.1
LYM13	11772. 2	A	90.2 6	9.44E01	0.2	LYM10 6	12144. 3	M	0.19 1	7.99E02	27.4
LYM28 9	12492. 2	A	90.2 34	9.48E01	0.2	LYM13 8	12562. 2	M	0.18 9	8.00E02	25.7
LYM16 2	12231. 1	A	90.1 45	9.78E01	0.1	LYM29 1	12754. 9	M	0.19	8.85E02	26.8
CONTR OL	—	A	90.0 61	—	0	LYM13 0	12331. 3	M	0.19 8	9.07E02	31.9
LYM13	11771. 6	B	0.27 2	1.17E02	23.1	LYM10 7	12631. 4	M	0.18 2	1.23E01	21.4
LYM12 9	12573. 3	B	0.28 8	2.16E02	30.2	LYM13 7	12154. 5	M	0.19 2	1.33E01	27.8
LYM12 9	12573. 5	B	0.36 4	2.30E02	65	LYM15 3	12322. 1	M	0.18 1	1.40E01	20.6
LYM4	11702. 3	B	0.27	3.35E02	22.3	LYM14 3	12524. 7	M	0.18 8	1.44E01	25.2
LYM4	11701. 1	B	0.25 9	4.26E02	17.5	LYM28 9	12492. 2	M	0.18	1.47E01	20.1
LYM15 2	12373. 2	B	0.37 6	4.78E02	70.4	LYM10 2	12222. 3	M	0.18	1.55E01	19.8
LYM19	11752. 2	B	0.25 5	5.74E02	15.5	LYM28 8	12741. 9	M	0.18 1	1.68E01	20.8
LYM15	11611. 3	B	0.25 5	6.26E02	15.5	LYM17 3	12981. 6	M	0.17 8	1.71E01	18.8
LYM13 8	12561. 1	B	0.26 1	6.50E02	18.3	LYM13 7	12153. 1	M	0.17 8	1.79E01	18.8
LYM17	11682. 1	B	0.32 4	6.56E02	46.9	LYM13 8	12564. 1	M	0.17 9	1.94E01	19.2
LYM17	11683. 1	B	0.26 6	6.67E02	20.3	LYM90	12395. 3	M	0.17 8	1.97E01	18.6
LYM13 0	12333. 1	B	0.25 4	7.69E02	15.2	LYM15 2	12371. 3	M	0.18	2.02E01	19.8
LYM9	11633. 7	B	0.30 1	9.51E02	36.4	LYM21 2	13032. 8	M	0.17 6	2.12E01	17.3
LYM14 8	12171. 2	B	0.28 1	1.01E01	27.4	LYM28 8	12743. 8	M	0.17 6	2.21E01	17.4
LYM4	11706. 3	B	0.31 6	1.05E01	43.2	LYM11 1	12254. 4	M	0.17 5	2.43E01	16.2
LYM4	11705. 2	B	0.31 6	1.25E01	43.1	LYM19 7	12821. 6	M	0.17 3	2.76E01	15.1
LYM9	11632. 2	B	0.33 9	1.56E01	53.4	LYM24 2	13051. 8	M	0.17 2	3.06E01	14.6
LYM2	11691. 2	B	0.24 4	1.73E01	10.4	LYM24 2	13052. 5	M	0.17 1	3.18E01	14.1
LYM16 2	12234. 4	B	0.29 9	2.06E01	35.3	LYM10 6	12141. 4	M	0.16 9	3.53E01	12.8

281

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM14 8	12174. 1	B	0.31 5	2.13E01	42.7	LYM15 2	12373. 1	M	0.16 9	3.59E01	12.7
LYM28 9	12493. 2	B	0.27 1	2.20E01	22.9	LYM10 7	12631. 2	M	0.16 9	3.69E01	12.9
LYM9	11634. 5	B	0.26	2.39E01	17.8	LYM10 7	12631. 1	M	0.16 9	3.80E01	12.7
LYM12 9	12571. 3	B	0.24 9	2.41E01	12.7	LYM10 2	12221. 1	M	0.16 9	3.82E01	12.4
LYM15 3	12323. 2	B	0.25 9	2.51E01	17.2	LYM18 3	12994. 8	M	0.17 3	3.83E01	15.3
LYM11 9	12463. 2	B	0.43 3	2.58E01	95.9	LYM10 5	12294. 3	M	0.16 5	4.64E01	10
LYM13 0	12331. 3	B	0.23 9	2.71E01	8.1	LYM17 3	12981. 5	M	0.16 5	4.93E01	9.9
LYM19	11751. 5	B	0.24 3	2.73E01	9.8	LYM28 9	12491. 4	M	0.16 4	5.04E01	9.2
LYM15	11612. 3	B	0.28 9	2.83E01	31.1	LYM10 2	12222. 1	M	0.16 4	5.15E01	9.1
LYM21	11672. 4	B	0.25 2	2.88E01	14.1	LYM25 5	13082. 9	M	0.16 4	5.16E01	9.4
LYM16	11624. 4	B	0.25 1	3.28E01	13.5	LYM14 3	12524. 5	M	0.16 7	5.26E01	11.1
LYM12 9	12572. 4	B	0.31 6	3.30E01	43	LYM28 9	12491. 1	M	0.16 3	5.32E01	8.6
LYM11 3	12442. 1	B	0.32 6	3.53E01	47.8	LYM14 2	12802. 9	M	0.16 4	5.37E01	9.5
LYM4	11706. 5	B	0.29 6	3.55E01	33.9	LYM10 0	12131. 3	M	0.16 2	5.51E01	8.2
LYM13 2	12275. 1	B	0.28 9	3.63E01	30.8	LYM10 2	12222. 6	M	0.16 3	5.63E01	8.5
LYM12 9	12572. 2	B	0.30 3	3.87E01	37.3	LYM28 7	12774. 6	M	0.16	6.30E01	6.7
LYM13	11773. 2	B	0.31 4	3.98E01	42.1	LYM13 0	12333. 1	M	0.15 9	6.78E01	6
LYM14 3	12521. 2	B	0.26 4	4.18E01	19.7	LYM19 8	13005. 8	M	0.15 8	6.94E01	5.4
LYM14 3	12523. 4	B	0.27 4	4.27E01	24.3	LYM18 3	12993. 7	M	0.15 9	7.00E01	5.7
LYM11 3	12441. 4	B	0.27 8	4.50E01	25.7	LYM10 6	12142. 3	M	0.15 8	7.00E01	5.3
LYM10 6	12141. 4	B	0.25 4	4.54E01	15.1	LYM18 3	12994. 7	M	0.15 8	7.06E01	5.3
LYM13	11772. 1	B	0.27	4.61E01	22.3	LYM20 1	12834. 6	M	0.15 8	7.14E01	5
LYM9	11632. 1	B	0.31 9	4.74E01	44.4	LYM29 1	12753. 6	M	0.15 8	7.29E01	5.1
LYM11 1	12254. 3	B	0.33 5	4.82E01	51.7	LYM28 7	12771. 6	M	0.15 7	7.30E01	4.7
LYM15 3	12324. 2	B	0.30 4	4.85E01	37.6	LYM28 7	12773. 7	M	0.15 8	7.39E01	5.1
LYM10 6	12144. 4	B	0.23 3	4.92E01	5.6	LYM21 2	13031. 6	M	0.15 7	7.40E01	4.4

282

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM1	11602. 1	B	0.23 6	4.95E01	6.7	LYM27 0	12871. 5	M	0.15 9	7.48E01	5.7
LYM13 0	12332. 2	B	0.23 2	4.98E01	5	LYM44	11885. 4	M	0.15 7	7.56E01	4.4
LYM2	11695. 3	B	0.25 1	5.12E01	13.5	LYM21 2	13034. 9	M	0.15 8	7.63E01	5.5
LYM14 1	12404. 1	B	0.27 8	5.13E01	25.7	LYM10 7	12632. 1	M	0.15 6	7.80E01	4
LYM14 1	12402. 4	B	0.24 3	5.22E01	10.1	LYM17 3	12982. 6	M	0.15 4	8.61E01	2.4
LYM16	11624. 6	B	0.29 1	5.38E01	31.9	LYM20 1	12833. 7	M	0.15 3	8.72E01	2.2
LYM13 4	12311. 2	B	0.28 9	5.54E01	31.1	LYM44	11882. 1	M	0.15 1	9.64E01	0.7
LYM11 1	12251. 1	B	0.33 8	5.57E01	53.1	LYM20 8	13012. 5	M	0.15 1	9.83E01	0.4
LYM14 1	12404. 4	B	0.26 1	5.64E01	18	CONTR OL	—	M	0.15	—	0
LYM17	11684. 4	B	0.23	5.76E01	4.2	LYM13 8	12561. 1	N	0.26 1	1.30E05	49
LYM10 6	12142. 1	B	0.29 3	5.87E01	32.8	LYM28 9	12493. 1	N	0.23 4	7.05E04	33.6
LYM13 4	12314. 2	B	0.24 1	6.43E01	9.3	LYM17 4	12414. 3	N	0.22 9	2.54E03	30.8
LYM10 0	12131. 3	B	0.25 1	6.43E01	13.8	LYM11 9	12461. 1	N	0.22 7	3.16E03	29.7
LYM10	11742. 1	B	0.26 7	6.69E01	20.9	LYM13 8	12561. 3	N	0.22 5	3.66E03	28.5
LYM11 1	12251. 3	B	0.23 9	6.76E01	8.4	LYM11 9	12461. 4	N	0.22 4	5.01E03	27.8
LYM11 1	12252. 2	B	0.22 9	6.87E01	3.9	LYM17 4	12411. 3	N	0.22 5	7.02E03	28.9
LYM16	11623. 5	B	0.25 9	6.97E01	17.2	LYM10 6	12142. 2	N	0.22 6	8.45E03	29.3
LYM10 6	12142. 2	B	0.23 3	6.99E01	5.6	LYM15 3	12323. 2	N	0.21 6	1.61E02	23.5
LYM14 8	12173. 1	B	0.22 9	7.02E01	3.6	LYM15 3	12324. 1	N	0.21 7	1.92E02	23.8
LYM15 2	12373. 1	B	0.22 9	7.02E01	3.9	LYM11 9	12463. 2	N	0.21 2	3.04E02	21
LYM13 4	12312. 3	B	0.24 5	7.07E01	11	LYM22 0	12851. 8	N	0.21 2	3.13E02	21.2
LYM29 0	12504. 1	B	0.28 3	7.08E01	28	LYM28 9	12493. 2	N	0.21 7	3.21E02	24.2
LYM16	11623. 2	B	0.25	7.31E01	13.2	LYM17 4	12412. 1	N	0.21 4	3.22E02	22.5
LYM2	11695. 1	B	0.27 7	7.60E01	25.4	LYM13 7	12151. 4	N	0.20 8	4.03E02	19.1
LYM16 2	12231. 1	B	0.23 5	7.79E01	6.4	LYM28 8	12743. 5	N	0.21 3	4.24E02	21.5
LYM2	11692. 3	B	0.25 1	7.87E01	13.5	LYM10 5	12295. 2	N	0.21	4.60E02	19.9

283

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM11 3	12443. 1	B	0.26 1	7.97E01	18	LYM25 5	13082. 8	N	0.21	5.20E02	20.1
LYM15 2	12372. 2	B	0.23 5	8.07E01	6.4	LYM11 9	12462. 1	N	0.21 1	5.82E02	20.8
LYM14 3	12521. 1	B	0.22 6	8.11E- 01	2.5	LYM13 0	12332. 1	N	0.20 7	5.93E02	18.4
LYM13 0	12334. 1	B	0.25 9	8.16E- 01	17.2	LYM10 7	12632. 3	N	0.20 7	6.68E02	18.4
LYM15 3	12324. 1	B	0.24 4	8.17E- 01	10.7	LYM15 3	12324. 2	N	0.20 4	7.50E02	16.6
LYM13 7	12154. 5	B	0.22 6	8.28E01	2.2	LYM11 9	12462. 2	N	0.20 8	7.54E02	19
LYM15	11614. 4	B	0.23 3	8.31E- 01	5.3	LYM10 5	12293. 1	N	0.20 5	7.59E02	17.3
LYM16	11622. 2	B	0.23 3	8.34E01	5.6	LYM15 2	12371. 3	N	0.20 5	7.65E02	17.4
LYM28 9	12493. 6	B	0.24 9	8.38E01	12.7	LYM25 5	13082. 7	N	0.20 7	8.60E02	18.1
LYM1	11604. 4	B	0.23 4	8.63E01	6.2	LYM11 1	12252. 2	N	0.20 3	9.29E02	16.2
LYM28 9	12491. 1	B	0.23 5	8.75E01	6.4	LYM10 2	12222. 2	N	0.20 2	1.09E- 01	15.6
LYM21	11673. 1	B	0.22 6	8.75E01	2.5	LYM25 5	13082. 5	N	0.20 7	1.17E- 01	18.2
LYM13 2	12271. 4	B	0.22 9	9.38E01	3.6	LYM13 7	12151. 2	N	0.20 4	1.18E- 01	16.5
LYM1	11603. 2	B	0.22 2	9.68E01	0.5	LYM10 6	12144. 4	N	0.19 9	1.21E- 01	14
LYM13 8	12561. 3	B	0.22 3	9.70E01	0.8	LYM14 3	12524. 7	N	0.20 4	1.42E- 01	16.6
LYM15 2	12371. 2	B	0.22 1	9.92E01	0.2	LYM28 8	12743. 9	N	0.19 8	1.48E- 01	13.3
CONTR OL	—	B	0.22 1	—	0	LYM15 3	12321. 2	N	0.19 8	1.63E- 01	13.4
LYM9	11632. 2	C	3.26 9	4.30E05	64	LYM15 2	12371. 2	N	0.20 4	1.67E- 01	16.5
LYM4	11705. 2	C	2.99 3	1.48E- 04	50.1	LYM10 5	12294. 2	N	0.19 6	1.85E- 01	11.8
LYM17	11682. 1	C	2.73 1	8.43E04	37	LYM15 3	12322. 1	N	0.19 6	1.90E- 01	11.8
LYM4	11706. 3	C	3.39 4	2.46E03	70.2	LYM10 5	12297. 2	N	0.19 6	1.90E- 01	11.9
LYM12 9	12573. 3	C	3.10 6	2.83E03	55.8	LYM13 7	12151. 1	N	0.19 6	2.05E01	11.8
LYM13 0	12333. 1	C	2.68 1	3.58E03	34.5	LYM14 2	12804. 1	N	0.19 8	2.08E01	13.3
LYM4	11702. 3	C	3.1	4.05E03	55.5	LYM15 2	12373. 1	N	0.19 6	2.17E01	11.8
LYM13 8	12561. 1	C	2.53 1	5.20E03	27	LYM17 4	12411. 2	N	0.19 6	2.21E01	12.1
LYM13	11771. 6	C	2.75 6	6.82E03	38.3	LYM19 7	12821. 6	N	0.19 4	2.27E01	10.6

284

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM15	11612. 3	C	2.49 4	7.56E03	25.1	LYM13 0	12334. 1	N	0.19 3	2.39E01	10.3
LYM9	11634. 5	c	2.63 1	1.39E02	32	LYM10 2	12222. 3	N	0.19 3	2.51E01	10.3
LYM12 9	12573. 5	c	3.51 9	1.43E02	76.5	LYM13 0	12332. 2	N	0.19 1	3.09E01	9.2
LYM17	11683. 1	c	2.39 4	2.12E02	20.1	LYM29 1	12754. 9	N	0.19 4	3.10E01	10.7
LYM12 9	12571. 3	c	2.76 3	2.21E02	38.6	LYM10 6	12144. 3	N	0.19 2	3.17E01	9.9
LYM10 6	12144. 4	c	2.40 6	2.27E02	20.7	LYM27 0	12873. 6	N	0.19	3.42E01	8.7
LYM19	11751. 5	c	2.35 6	3.15E02	18.2	LYM10 2	12222. 1	N	0.19	3.58E01	8.6
LYM4	11701. 1	c	2.84 4	3.92E02	42.6	LYM10 2	12221. 1	N	0.18 8	3.97E01	7.6
LYM11 3	12441. 4	c	2.64 4	4.19E02	32.6	LYM13 7	12153. 1	N	0.18 8	3.97E01	7.7
LYM17	11684. 4	c	2.35 6	5.63E02	18.2	LYM17 3	12981. 6	N	0.18 8	3.98E01	7.7
LYM12 9	12572. 4	c	3.03 8	5.70E02	52.4	LYM90	12395. 3	N	0.18 9	4.04E01	8.2
LYM15	11611. 3	c	2.3	5.79E02	15.4	LYM10 7	12631. 2	N	0.18 9	4.08E01	8.1
LYM11 9	12463. 2	c	3.41 9	8.18E02	71.5	LYM44	11882. 1	N	0.18 8	4.49E01	7.4
LYM1	11602. 1	c	2.28 1	8.53E02	14.4	LYM17 3	12981. 5	N	0.18 7	4.84E01	6.6
LYM14 8	12171. 2	c	2.37 5	1.08E01	19.1	LYM14 3	12524. 5	N	0.18 9	5.07E01	7.9
LYM15 2	12373. 2	c	2.77 5	1.08E01	39.2	LYM24 2	13052. 5	N	0.18 6	5.08E01	6.2
LYM4	11706. 5	c	3.06 9	1.20E01	53.9	LYM13 0	12331. 3	N	0.18 9	5.20E01	8.2
LYM9	11633. 7	c	3.06 3	1.26E01	53.6	LYM28 8	12743. 8	N	0.18 5	5.30E01	6
LYM10 6	12144. 3	c	2.24 4	1.58E01	12.6	LYM13 8	12564. 1	N	0.18 5	5.54E01	5.8
LYM14 1	12402. 4	c	2.38 1	1.63E01	19.4	LYM28 9	12492. 2	N	0.18 4	5.60E01	5.3
LYM16	11624. 4	c	2.42 5	1.90E01	21.6	LYM13 7	12154. 5	N	0.18 6	5.68E01	6.4
LYM13	11773. 2	c	2.61 9	1.93E01	31.4	LYM13 8	12562. 2	N	0.18 3	6.21E01	4.8
LYM10 6	12142. 2	c	2.3	1.99E01	15.4	LYM28 9	12491. 4	N	0.18 2	6.68E01	3.8
LYM13 7	12154. 5	c	2.3	1.99E01	15.4	LYM10 6	12141. 4	N	0.18 1	6.80E01	3.6
LYM13 2	12275. 1	c	2.27 5	2.02E01	14.1	LYM18 3	12994. 7	N	0.18 1	6.90E01	3.7
LYM15 3	12323. 2	c	2.48 1	2.07E01	24.5	LYM10 7	12631. 4	N	0.18 1	6.97E01	3.5

285

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM9	11633. 2	C	2.35 6	2.33E01	18.2	LYM28 9	12491. 1	N	0.18	7.34E01	3
LYM13 4	12314. 2	c	2.28 8	2.41E01	14.7	LYM27 0	12871. 8	N	0.18 1	7.36E01	3.7
LYM12 9	12572. 2	c	3	2.69E01	50.5	LYM14 2	12804. 3	N	0.18 1	7.40E01	3.7
LYM13 4	12312. 3	c	2.2	2.70E01	10.4	LYM24 2	13051. 8	N	0.18	7.41E- 01	3
LYM11 3	12442. 1	c	2.68 1	2.75E01	34.5	LYM44	11885. 3	N	0.18 1	7.62E01	3.2
LYM13	11772. 1	c	2.48 1	2.80E01	24.5	LYM18 3	12994. 8	N	0.18 1	7.66E01	3.7
LYM14 8	12173. 1	c	2.15	2.91E01	7.8	LYM10 6	12142. 3	N	0.17 9	7.88E01	2.4
LYM11 9	12461. 1	c	2.28 8	2.95E01	14.7	LYM11 1	12254. 4	N	0.17 9	7.89E01	2.4
LYM13	11771. 9	c	2.19 4	2.97E01	10	LYM10 7	12631. 1	N	0.17 9	7.99E01	2.4
LYM14 1	12404. 1	c	2.44 4	3.06E01	22.6	LYM20 1	12834. 6	N	0.17 9	8.18E- 01	2.2
LYM16	11624. 6	c	2.68 8	3.41E- 01	34.8	LYM10 0	12131. 3	N	0.17 8	8.46E01	1.7
LYM14 8	12174. 1	c	2.42 5	3.45E01	21.6	LYM21 2	13032. 8	N	0.17 8	8.59E01	1.6
LYM16	11622. 2	c	2.19 4	3.53E01	10	LYM20 1	12833. 9	N	0.17 7	8.96E01	1.1
LYM9	11632. 1	c	3.00 6	3.58E01	50.8	LYM27 0	12871. 5	N	0.17 8	9.11E01	1.5
LYM13 0	12331. 3	c	2.21 9	3.60E01	11.3	LYM10 5	12294. 3	N	0.17 7	9.14E01	1
LYM15 3	12324. 2	c	2.46 9	3.65E01	23.8	LYM10 7	12632. 1	N	0.17 7	9.15E01	1
LYM16	11623. 2	c	2.41 3	3.71E- 01	21	LYM20 1	12833. 7	N	0.17 6	9.24E01	0.8
LYM16 2	12234. 4	c	2.5	3.76E01	25.4	LYM13 7	12152. 1	N	0.17 6	9.43E01	0.7
LYM11 1	12254. 3	c	2.58 1	4.18E01	29.5	LYM20 8	13012. 5	N	0.17 6	9.69E01	0.5
LYM11 1	12251. 1	c	2.68 8	4.40E01	34.8	LYM19 7	12824. 4	N	0.17 6	9.72E01	0.3
LYM17	11681. 4	c	2.11 5	4.53E01	6.1	LYM28 8	12744. 6	N	0.17 6	9.74E01	0.4
LYM15	11614. 4	c	2.12 5	4.67E01	6.6	CONTR OL	—	N	0.17 5	—	0
LYM10 6	12142. 1	c	2.53 1	4.74E01	27	LYM17 4	12414. 3	O	2.09 4	1.00E- 06	72.1
LYM10 6	12141. 4	c	2.35 8	4.96E01	18.3	LYM28 8	12743. 9	O	1.73	3.30E05	42.2
LYM14 3	12521. 2	c	2.18 1	5.05E01	9.4	LYM25 5	13082. 8	o	1.71 2	4.70E05	40.7
LYM19	11752. 2	c	2.08 1	5.38E01	4.4	LYM10 6	12144. 4	o	1.62 4	2.04E04	33.5

286

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM16 2	12231. 3	C	2.10 6	5.41E01	5.7	LYM27 0	12873. 6	O	1.58 7	4.90E04	30.4
LYM11 1	12251. 3	c	2.35	5.87E01	17.9	LYM28 9	12492. 2	o	1.51 8	1.30E03	24.7
LYM14 1	12404. 4	c	2.16 9	6.33E01	8.8	LYM10 5	12294. 2	o	1.49 6	1.87E03	22.9
LYM13 7	12151. 2	c	2.05 8	6.54E01	3.2	LYM10 7	12631. 4	o	1.48 7	2.26E03	22.2
LYM11 1	12254. 4	c	2.18 1	6.62E01	9.4	LYM13 0	12332. 1	o	1.92 8	3.71E03	58.5
LYM16	11623. 5	c	2.28 1	6.77E01	14.4	LYM15 3	12323. 2	o	1.82 8	4.86E03	50.3
LYM15 3	12324. 1	c	2.18 1	6.83E01	9.4	LYM13 0	12334. 1	o	1.57 8	5.52E03	29.7
LYM13 8	12561. 3	c	2.17 5	6.87E01	9.1	LYM13 7	12153. 1	o	1.43 5	7.32E03	17.9
LYM2	11695. 3	c	2.05	6.93E01	2.8	LYM15 3	12324. 2	o	1.68 9	7.63E03	38.9
LYM13 7	12151. 1	c	2.05	7.06E01	2.8	LYM17 3	12981. 6	o	1.46 3	8.10E03	20.2
LYM14 3	12523. 4	c	2.15 6	7.37E01	8.2	LYM13 8	12561. 1	o	2.72 6	8.93E03	124.1
LYM2	11695. 1	c	2.5	7.66E01	25.4	LYM15 3	12322. 1	o	1.43 2	9.89E03	17.7
LYM2	11691. 2	c	2.07 5	7.88E01	4.1	LYM28 9	12493. 1	o	1.81 8	1.07E02	49.5
LYM21	11672. 4	c	2.03 1	7.89E01	1.9	LYM11 9	12461. 4	o	2.03	1.16E02	66.9
LYM13 7	12152. 1	c	2.06 3	7.91E01	3.5	LYM10 2	12222. 2	o	1.67 6	1.46E02	37.7
LYM13 0	12332. 2	c	2.03 1	8.44E01	1.9	LYM10 2	12222. 3	o	1.45 5	1.94E02	19.6
LYM16 2	12231. 1	c	2.12 5	8.45E01	6.6	LYM10 5	12297. 2	o	1.59 8	2.07E02	31.3
LYM13 4	12311. 2	c	2.08 1	8.49E01	4.4	LYM10 7	12631. 2	o	1.38 6	2.27E02	14
LYM29 0	12504. 1	c	2.15	8.69E01	7.8	LYM13 8	12561. 3	o	2.06 6	3.41E02	69.8
LYM16 2	12234. 3	c	2.03 1	9.11E01	1.9	LYM11 9	12461. 1	o	1.94 8	6.22E02	60.1
LYM13 7	12153. 1	c	2.01 3	9.23E01	1	LYM10 5	12293. 1	o	1.69 5	6.63E02	39.3
LYM15 2	12373. 1	c	2.00 6	9.33E01	0.6	LYM10 6	12141. 4	o	1.38 8	7.61E02	14.1
LYM15 2	12371. 2	c	2	9.69E01	0.3	LYM21 2	13032. 8	o	1.44 9	7.79E02	19.1
LYM10	11742. 1	c	2.01 3	9.70E01	1	LYM11 9	12463. 2	o	1.91 7	8.15E02	57.6
LYM17	11684. 5	c	2.00 6	9.72E01	0.6	LYM10 5	12295. 2	o	1.60 7	8.74E02	32.1
LYM28 9	12491. 1	c	2	9.93E01	0.3	LYM17 3	12982. 6	o	1.33 2	8.92E02	9.5

287

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
CONTR OL	—	C	1.99 4	—	0	LYM 11 1	12254. 4	O	1.43	9.17E02	17.6
LYM 14 8	12171. 2	D	0.36 2	3.00E06	59.2	LYM 17 4	12411. 2	o	1.72 4	1.04E01	41.7
LYM 14 3	12524. 7	D	0.34 4	1.40E05	51.3	LYM22 0	12851. 8	o	1.88 6	1.22E01	55
LYM1	11602. 1	D	0.31 3	8.90E05	37.7	LYM 10 5	12294. 3	o	1.35 6	1.28E01	11.4
LYM 13 0	12333. 1	D	0.30 9	1.24E04	36	LYM 13 7	12151. 4	o	1.63 3	1.38E01	34.2
LYM 10	11744. 1	D	0.30 1	2.98E04	32.6	LYM 17 4	12412. 1	o	1.84 7	1.64E01	51.8
LYM 10	11741. 2	D	0.38 2	3.43E04	67.9	LYM 10 6	12142. 2	o	1.98 4	1.65E01	63.1
LYM 16 2	12234. 3	D	0.29 9	4.64E04	31.4	LYM 13 0	12332. 2	o	1.61 5	1.74E01	32.8
LYM 10 2	12222. 2	D	0.29 2	6.30E04	28.6	LYM24 2	13051. 8	o	1.41 5	1.75E01	16.3
LYM 15	11614. 3	D	0.29 1	7.21E04	28	LYM 10 7	12632. 3	o	1.84 6	1.82E01	51.7
LYM 14 0	12262. 3	D	0.29	7.39E04	27.5	LYM 15 2	12373. 1	o	1.37 8	2.05E01	13.2
LYM4	11706. 5	D	0.28 9	8.21E04	27	LYM 13 7	12151. 1	o	1.58 2	2.07E01	30
LYM 10 5	12293. 1	D	0.29 8	8.36E04	31	LYM 15 3	12324. 1	o	1.77 5	2.09E01	45.9
LYM1	11602. 6	D	0.40 6	1.24E03	78.7	LYM 11 9	12462. 1	o	1.85 1	2.26E01	52.1
LYM 15 2	12372. 2	D	0.28 6	1.76E03	26	LYM 13 8	12562. 2	o	1.51 2	2.27E01	24.3
LYM 13 2	12273. 2	D	0.28 3	1.88E03	24.6	LYM28 9	12491. 1	o	1.32 8	2.38E01	9.1
LYM 13 2	12271. 4	D	0.27 5	3.78E03	20.8	LYM 17 4	12411. 3	o	1.94 2	2.45E01	59.6
LYM 17	11684. 4	D	0.27 1	1.10E02	19.2	LYM 13 7	12151. 2	o	1.58 7	2.45E01	30.4
LYM 11 9	12461. 4	D	0.27 3	1.11E02	20	LYM 11 1	12252. 2	o	1.54 6	2.55E01	27.1
LYM 16 2	12231. 3	D	0.27 8	1.15E02	22.4	LYM28 8	12743. 8	o	1.46 4	2.62E01	20.4
LYM 13	11771. 6	D	0.26 2	2.00E02	15.2	LYM28 7	12774. 6	o	1.30 3	2.70E01	7.1
LYM9	11632. 2	D	0.26 1	2.89E02	15	LYM28 8	12743. 5	o	1.78	2.75E01	46.3
LYM 11 9	12463. 2	D	0.28 5	4.01E02	25.5	LYM24 2	13052. 5	o	1.36 5	2.99E01	12.2
LYM 14 1	12404. 2	D	0.25 5	4.81E02	12.1	LYM 10 7	12631. 1	o	1.40 7	3.08E01	15.7
LYM 13 8	12561. 1	D	0.32 8	5.35E02	44.5	LYM 10 0	12131. 3	o	1.36	3.20E01	11.7
LYM 19	11751. 5	D	0.29 1	5.76E02	28	LYM28 9	12491. 4	o	1.32 2	3.20E01	8.7

288

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM 19	11753. 1	D	0.27 4	6.46E02	20.5	LYM90	12395. 3	O	1.44 3	3.34E01	18.6
LYM28 9	12493. 6	D	0.25 3	7.62E02	11.2	LYM 10 2	12222. 1	o	1.33 9	3.34E01	10.1
LYM26 8	12483. 2	D	0.25 6	7.90E02	12.7	LYM 19 7	12821. 6	o	1.38 5	3.37E01	13.8
LYM 12 9	12573. 5	D	0.25 1	8.16E02	10.4	LYM25 5	13082. 7	o	1.71 1	3.37E01	40.7
LYM 14 8	12174. 1	D	0.30 3	8.57E02	33.3	LYM 11 9	12462. 2	o	1.68 8	3.41E01	38.8
LYM28 9	12493. 2	D	0.31	1.00E01	36.3	LYM 15 2	12371. 2	o	1.79 1	3.57E01	47.2
LYM9	11632. 1	D	0.34 4	1.06E01	51.2	LYM 15 3	12321. 2	o	1.54 5	3.58E01	27
LYM1	11604. 4	D	0.32 1	1.12E01	41.4	LYM28 7	12771. 6	o	1.28 4	3.68E01	5.5
LYM 10	11742. 2	D	0.30 3	1.26E01	33.2	LYM28 9	12493. 2	o	1.75 2	3.69E01	44
LYM1	11603. 2	D	0.28	1.48E01	23	LYM 10 6	12144. 3	o	1.54 4	3.75E01	26.9
LYM 11 9	12462. 2	D	0.36 1	1.51E01	58.8	LYM25 5	13082. 5	o	1.81	3.83E01	48.8
LYM 14 3	12521. 1	D	0.25 9	1.56E01	14.1	LYM28 8	12741. 9	o	1.47 9	4.12E01	21.6
LYM 17	11681. 4	D	0.24 9	1.61E01	9.6	LYM 13 8	12564. 1	o	1.45 2	4.26E01	19.3
LYM 13	11772. 1	D	0.24 8	1.66E01	9.1	LYM29 1	12754. 9	o	1.53 8	4.35E01	26.4
LYM 11 9	12462. 1	D	0.29 8	1.76E01	31.1	LYM 10 2	12221. 1	o	1.35 3	4.81E01	11.2
LYM 15	11612. 2	D	0.26 3	1.80E01	15.8	LYM 15 2	12371. 3	o	1.44 8	4.88E01	19
LYM 10 2	12221. 1	D	0.24 4	1.81E01	7.3	LYM25 5	13082. 9	o	1.35 6	5.04E01	11.5
LYM 17 4	12411. 2	D	0.30 4	1.83E01	33.9	LYM 13 0	12331. 3	o	1.58 9	5.44E01	30.6
LYM 16	11624. 4	D	0.24 4	1.94E01	7.2	LYM21 2	13031. 6	o	1.27 2	5.47E01	4.5
LYM21	11673. 1	D	0.26	1.96E01	14.4	LYM 14 3	12524. 7	o	1.49 2	5.72E01	22.7
LYM 17	11684. 5	D	0.24 2	2.39E01	6.4	LYM 17 3	12981. 5	o	1.33 1	5.74E01	9.4
LYM 13 8	12561. 3	D	0.32 1	2.41E01	41.1	LYM 10 6	12142. 3	o	1.26 7	5.74E01	4.2
LYM4	11705. 2	D	0.27 3	2.47E01	20.2	LYM 14 2	12802. 9	o	1.38	5.91E01	13.4
LYM 13 8	12562. 1	D	0.24 2	2.58E01	6.5	LYM 19 8	13005. 8	o	1.27 3	5.92E01	4.6
LYM 14 1	12404. 3	D	0.27 4	2.69E01	20.7	LYM 10 2	12222. 6	o	1.34 5	6.01E01	10.5
LYM 17	11683. 1	D	0.24 2	2.69E01	6.3	LYM 13 7	12154. 5	o	1.54 4	6.05E01	26.9

289

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM 19	11754. 1	D	0.26 1	2.73E01	15	LYM20 1	12834. 6	O	1.28 7	7.03E01	5.8
LYM 15 2	12371. 2	D	0.27 1	2.75E01	19.3	LYM 18 3	12994. 8	o	1.41 4	7.10E- 01	16.2
LYM 13 0	12334. 1	D	0.24 5	2.83E01	7.7	LYM44	11885. 4	o	1.28 2	7.27E01	5.4
LYM 13 4	12311. 2	D	0.28 4	3.00E01	25	LYM24 2	13053. 7	o	1.26 2	7.36E01	3.7
LYM 14 1	12402. 4	D	0.29 6	3.09E01	30.2	LYM 10 7	12632. 1	o	1.28 9	7.44E01	5.9
LYM2	11692. 3	D	0.24 2	3.13E- 01	6.6	LYM29 1	12753. 6	o	1.29 2	7.51E- 01	6.2
LYM9	11633. 7	D	0.27 7	3.20E01	22	LYM 14 3	12524. 5	o	1.36 6	7.58E01	12.2
LYM 19	11751. 4	D	0.29 2	3.24E01	28.3	LYM20 1	12833. 7	o	1.24 1	7.73E01	2
LYM 16 2	12231. 1	D	0.27 9	3.32E01	22.6	LYM 13 0	12333. 1	o	1.29 4	7.92E01	6.4
LYM 14 8	12173. 1	D	0.28 9	3.33E01	27.2	LYM28 7	12773. 7	o	1.29 3	8.02E01	6.2
LYM 14 3	12524. 2	D	0.26 3	3.48E01	15.6	LYM 18 3	12993. 7	o	1.27 8	8.25E01	5
LYM 15	11612. 3	D	0.28 5	3.59E01	25.4	LYM27 0	12871. 5	o	1.29 2	8.85E01	6.2
LYM28 9	12491. 1	D	0.28 1	3.79E01	23.7	LYM 18 3	12994. 7	o	1.24	8.96E01	2
LYM 13 0	12332. 2	D	0.27 4	3.79E01	20.6	LYM21 2	13034. 9	o	1.27	9.25E01	4.4
LYM 17 4	12414. 3	D	0.31 3	3.80E01	37.5	LYM20 8	13012. 5	o	1.24 9	9.35E01	2.7
LYM 10 0	12133. 1	D	0.25 2	3.84E01	10.8	CONTR OL	—	o	1.21 7	—	0
LYM 14 1	12404. 4	D	0.27	3.96E01	18.9	LYM28 9	12493. 1	P	2.45 7	6.00E06	34.4
LYM 16 2	12234. 4	D	0.30 7	4.01E01	35	LYM 15 3	12323. 2	P	2.34 8	3.90E05	28.5
LYM21	11671. 2	D	0.25 2	4.34E01	11.1	LYM 13 8	12561. 1	P	2.89 6	4.80E05	58.4
LYM 15	11611. 3	D	0.28 6	4.64E01	25.9	LYM28 8	12743. 9	P	2.27 8	1.08E- 04	24.6
LYM 10	11744. 5	D	0.26 3	4.65E01	15.5	LYM 10 6	12144. 4	P	2.16 2	1.09E- 03	18.3
LYM 17 4	12412. 1	D	0.28 3	4.68E01	24.5	LYM 13 0	12334. 1	P	2.12 3	1.12E- 03	16.2
LYM 17 4	12411. 3	D	0.25 9	4.73E01	13.9	LYM 10 5	12297. 2	P	2.12 3	1.13E03	16.1
LYM28 9	12491. 4	D	0.25	4.85E01	9.9	LYM 17 3	12981. 6	P	2.08 8	2.27E03	14.2
LYM 11 3	12442. 1	D	0.23 5	5.12E- 01	3.6	LYM 10 5	12293. 1	P	2.25 2	3.65E03	23.2
LYM 14 3	12521. 2	D	0.24 4	5.14E- 01	7.1	LYM 10 5	12294. 2	P	2.06 1	3.93E03	12.8

290

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM 10 2	12222. 3	D	0.27 4	5.18E01	20.7	LYM 13 7	12153. 1	P	2.05 7	4.42E03	12.5
LYM 11 1	12251. 1	D	0.26 4	5.22E01	16.1	LYM 19 7	12821. 6	P	2.05 8	4.44E03	12.6
LYM 17	11682. 1	D	0.27 2	5.33E01	19.6	LYM 13 8	12561. 3	P	2.48 7	6.03E03	36.1
LYM26 8	12483. 4	D	0.25 8	5.50E01	13.3	LYM 10 7	12631. 4	P	2.03 4	7.95E03	11.3
LYM21	11672. 4	D	0.26 5	5.55E01	16.5	LYM 10 2	12222. 3	P	2.07 9	9.12E03	13.8
LYM29 0	12502. 4	D	0.25 5	6.03E01	12.4	LYM 11 1	12254. 4	P	2.01 3	1.74E02	10.1
LYM26 8	12482. 3	D	0.23 9	6.08E01	5.1	LYM 10 2	12222. 1	P	2.01 9	1.77E02	10.5
LYM29 0	12501. 3	D	0.24 2	6.70E01	6.6	LYM 10 6	12141. 4	P	1.99 9	1.86E02	9.4
LYM 10 5	12294. 2	D	0.26 3	7.15E01	15.6	LYM 11 9	12463. 2	P	2.42 7	2.00E02	32.8
LYM 10 0	12131. 3	D	0.24 6	7.22E01	8.2	LYM 15 3	12322. 1	P	2.02 5	2.34E02	10.8
LYM 11 1	12252. 2	D	0.25 2	7.44E01	10.7	LYM27 0	12873. 6	P	2.19	2.39E02	19.8
LYM1	11601. 1	D	0.24 1	7.48E01	6.1	LYM 10 2	12222. 2	P	2.26	2.62E02	23.6
LYM22	11762. 1	D	0.23 6	7.59E01	3.6	LYM 13 7	12151. 4	P	2.24 7	2.89E02	22.9
LYM 14 8	12172. 1	D	0.25 1	7.85E01	10.2	LYM 17 4	12414. 3	P	2.53 3	2.94E02	38.6
LYM26 8	12482. 1	D	0.24 3	8.20E01	6.9	LYM21 2	13032. 8	P	2.00 4	3.00E02	9.6
LYM 13 7	12153. 1	D	0.24	8.22E01	5.4	LYM 15 2	12373. 1	P	2.09 4	4.88E02	14.6
LYM 10	11742. 1	D	0.24 3	8.33E01	7.1	LYM 10 2	12221. 1	P	1.96 9	5.91E02	7.7
LYM 16 2	12233. 2	D	0.23 6	8.50E01	3.7	LYM 11 9	12461. 4	P	2.48 3	6.35E02	35.8
LYM 14 0	12261. 4	D	0.23 4	8.56E01	2.9	LYM 13 0	12332. 2	P	2.18 3	6.35E02	19.5
LYM29 0	12502. 1	D	0.23 4	8.96E01	3.1	LYM 15 3	12324. 2	P	2.20 7	6.58E02	20.7
LYM 14 3	12523. 4	D	0.23 2	9.21E01	1.9	LYM28 9	12492. 2	P	2.06 3	6.71E02	12.8
LYM9	11633. 2	D	0.23	9.45E01	1.4	LYM 17 3	12982. 6	P	1.94 4	7.81E02	6.4
LYM 11 1	12254. 4	D	0.22 8	9.48E01	0.3	LYM28 9	12493. 2	P	2.30 7	8.42E02	26.2
LYM 15 2	12373. 2	D	0.22 7	9.98E01	0	LYM 13 7	12151. 1	P	2.14 5	9.13E02	17.3
CONTR OL	—	D	0.22 7	—	0	LYM22 0	12851. 8	P	2.29 4	9.18E02	25.5
LYM4	11706. 5	E	8.93 8	2.20E05	18.6	LYM 10 0	12131. 3	P	2.00 1	1.04E01	9.5

291

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM10 2	12222. 2	E	8.87 5	3.70E05	17.8	LYM13 0	12332. 1	P	2.43 7	1.12E01	33.4
LYM11 9	12462. 2	E	8.86 6	3.80E05	17.7	LYM11 9	12461. 1	P	2.38 3	1.15E01	30.4
LYM13 8	12561. 1	E	8.81 3	4.40E05	16.9	LYM24 2	13051. 8	P	2.01 1	1.19E- 01	10
LYM10	11742. 2	E	8.68 8	9.10E05	15.3	LYM28 8	12743. 5	P	2.29 9	1.24E01	25.8
LYM10 5	12293. 1	E	8.56 3	2.01E04	13.6	LYM10 6	12142. 2	P	2.41 1	1.25E01	31.9
LYM15 2	12372. 2	E	8.56 3	2.01E04	13.6	LYM10 5	12295. 2	P	2.24 3	1.29E- 01	22.7
LYM1	11602. 6	E	9.12 5	7.59E04	21.1	LYM10 5	12294. 3	P	1.95 3	1.30E01	6.9
LYM19	11753. 1	E	8.31 3	1.23E03	10.3	LYM10 7	12631. 2	P	2.02 2	1.32E01	10.7
LYM1	11603. 2	E	8.25	1.75E03	9.5	LYM15 3	12324. 1	P	2.30 9	1.37E- 01	26.3
LYM10	11744. 1	E	8.12 5	4.92E03	7.8	LYM17 4	12412. 1	P	2.35 9	1.38E01	29.1
LYM13 0	12333. 1	E	8.37 5	9.64E03	11.1	LYM17 4	12411. 2	P	2.25 8	1.41E01	23.5
LYM13 2	12271. 4	E	8.37 5	9.64E03	11.1	LYM24 2	13052. 5	P	2.00 2	1.43E01	9.5
LYM17 4	12414. 3	E	8.37 5	9.64E03	11.1	LYM10 7	12632. 3	P	2.32 6	1.47E- 01	27.2
LYM10	11741. 2	E	9.06 3	1.38E02	20.3	LYM10 6	12144. 3	P	2.13 1	1.69E- 01	16.6
LYM13 0	12332. 2	E	8.68 8	2.64E02	15.3	LYM17 4	12411. 3	P	2.45 8	1.72E- 01	34.5
LYM13 0	12334. 1	E	8.68 8	2.64E02	15.3	LYM21 2	13031. 6	P	1.96 9	1.78E- 01	7.7
LYM14 1	12402. 4	E	8.68 8	2.64E02	15.3	LYM15 2	12371. 3	P	2.06	1.86E01	12.7
LYM11 3	12442. 1	E	7.93 8	3.53E02	5.3	LYM25 5	13082. 8	P	2.31 2	2.00E01	26.5
LYM9	11632. 1	E	8.43 8	4.54E02	12	LYM15 3	12321. 2	P	2.11	2.02E01	15.4
LYM14 3	12524. 7	E	9	4.73E02	19.4	LYM11 9	12462. 1	P	2.41 8	2.08E01	32.3
LYM13 2	12275. 1	E	7.87 5	5.28E02	4.5	LYM24 2	13053. 7	P	1.91 4	2.14E01	4.7
LYM9	11633. 7	E	7.87 5	5.28E02	4.5	LYM28 8	12743. 8	P	2.07 2	2.20E01	13.4
LYM17	11681. 4	E	7.91 7	5.73E02	5.1	LYM28 9	12491. 1	P	1.95 9	2.38E01	7.2
LYM10 0	12133. 1	E	8.31 3	6.24E02	10.3	LYM11 1	12252. 2	P	2.14 8	2.40E01	17.5
LYM11 9	12461. 4	E	8.31 3	6.24E02	10.3	LYM25 5	13082. 9	P	1.99 8	2.41E01	9.3
LYM21	11672. 4	E	8	6.71E- 02	6.2	LYM11 9	12462. 2	P	2.21 8	2.61E01	21.3

292

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM 17	11684. 4	E	8.18 8	8.91E02	8.6	LYM 13 7	12151. 2	P	2.21 2	2.66E01	21
LYM 19	11751. 5	E	8.18 8	8.91E02	8.6	LYM28 9	12491. 4	P	1.92 5	2.70E01	5.3
LYM 14 3	12524. 2	E	7.81 3	1.19E- 01	3.7	LYM 10 7	12631. 1	P	1.99 8	2.73E01	9.3
LYM 15	11614. 3	E	7.81 3	1.19E- 01	3.7	LYM 10 6	12142. 3	P	1.93 1	2.87E01	5.6
LYM 14 8	12171. 2	E	8.06 3	1.33E- 01	7	LYM 13 8	12562. 2	P	2.04 4	3.08E01	11.8
LYM 16 2	12231. 3	E	8.06 3	1.33E- 01	7	LYM25 5	13082. 5	P	2.27	3.12E- 01	24.2
LYM 19	11754. 1	E	8.06 3	1.33E- 01	7	LYM25 5	13082. 7	P	2.20 9	3.30E01	20.9
LYM 14 1	12404. 2	E	7.87 5	1.45E- 01	4.5	LYM 15 2	12371. 2	P	2.28 3	3.57E01	24.9
LYM28 9	12491. 4	E	7.87 5	1.45E- 01	4.5	LYM90	12395. 3	P	2.04 1	3.80E01	11.7
LYM 11 9	12463. 2	E	8.25	1.49E- 01	9.5	LYM28 7	12771. 6	P	1.87 8	3.99E01	2.8
LYM28 9	12493. 2	E	8.25	1.49E- 01	9.5	LYM 10 7	12632. 1	P	1.94 4	4.04E01	6.4
LYM 16 2	12234. 3	E	8.43 8	1.63E- 01	12	LYM 10 2	12222. 6	P	1.94 2	4.04E01	6.2
LYM 14 8	12174. 1	E	8.62 5	1.74E- 01	14.5	LYM28 8	12741. 9	P	2.04	4.14E01	11.6
LYM 14 0	12262. 3	E	7.75	1.85E- 01	2.8	LYM 13 8	12564. 1	P	2.04 9	4.46E01	12.1
LYM3	12042. 1	E	7.75	1.85E- 01	2.8	LYM29 1	12754. 9	P	2.07 7	4.54E01	13.7
LYM 15	11611. 3	E	8.47 9	1.89E- 01	12.5	LYM28 7	12774. 6	P	1.89 9	4.58E01	3.9
LYM 14 1	12404. 4	E	8.31 3	1.97E01	10.3	LYM 17 3	12981. 5	P	1.95 9	4.85E01	7.2
LYM 16 2	12234. 4	E	8.43 8	2.63E01	12	LYM 13 0	12331. 3	P	2.13 3	4.95E01	16.7
LYM28 9	12493. 6	E	8	2.66E01	6.2	LYM 13 7	12154. 5	P	2.09 5	5.07E01	14.6
LYM29 0	12502. 4	E	8	2.66E01	6.2	LYM20 1	12834. 6	P	1.97	5.14E- 01	7.8
LYM 17 4	12411. 2	E	8.68 8	2.73E01	15.3	LYM 14 3	12524. 7	P	2.08 8	5.44E01	14.2
LYM29 0	12501. 3	E	8.25	2.78E01	9.5	LYM20 1	12833. 9	P	1.86 4	5.52E01	2
LYM1	11604. 4	E	8.06 3	3.07E01	7	LYM 14 2	12802. 9	P	1.93 1	5.89E01	5.7
LYM21	11673. 1	E	8.06 3	3.07E01	7	LYM20 1	12833. 7	P	1.88 3	6.03E01	3
LYM 17	11683. 1	E	7.75	3.22E01	2.8	LYM 18 3	12994. 8	P	2.00 6	6.56E01	9.7
LYM2	11692. 3	E	7.75	3.22E01	2.8	LYM 10 0	12133. 3	P	1.85 3	6.64E01	1.4

293

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM 11 9	12462. 1	E	8.68 8	3.33E01	15.3	LYM 13 0	12333. 1	P	1.91 3	6.70E01	4.7
LYM 14 1	12404. 3	E	8.12 5	3.36E01	7.8	LYM 14 3	12524. 5	P	1.99	6.99E01	8.9
LYM 10 2	12222. 3	E	8.43 8	3.42E01	12	LYM29 1	12753. 6	P	1.89 3	7.11E01	3.6
LYM28 9	12491. 1	E	8.75	3.45E01	16.1	LYM 14 2	12804. 1	P	1.90 1	7.24E01	4
LYM 13 7	12153. 1	E	7.81 3	3.45E01	3.7	LYM 14 3	12521. 1	P	1.84 8	7.39E01	1.1
LYM 14 3	12521. 1	E	7.81 3	3.45E01	3.7	LYM44	11885. 4	P	1.86 4	7.91E01	2
LYM21	11671. 2	E	8.18 8	3.58E01	8.6	LYM27 0	12871. 8	P	1.90 6	8.00E01	4.3
LYM 17	11682. 1	E	7.93 8	3.99E01	5.3	LYM27 0	12871. 5	P	1.94	8.20E01	6.1
LYM1	11602. 1	E	8	4.16E01	6.2	LYM20 8	13012. 5	P	1.90 1	8.47E01	4
LYM 15 2	12371. 2	E	8	4.16E01	6.2	LYM 18 3	12994. 7	P	1.85 7	8.51E01	1.6
LYM26 8	12483. 2	E	8	4.16E01	6.2	LYM 19 8	13005. 8	P	1.84 2	8.74E01	0.8
LYM 19	11751. 4	E	8.18 8	4.45E01	8.6	LYM 18 3	12993. 7	P	1.86 5	8.86E01	2.1
LYM 15	11612. 3	E	8.25	4.51E01	9.5	LYM 15 2	12372. 2	P	1.86 1	8.88E01	1.8
LYM26 8	12482. 3	E	8.06 3	5.16E01	7	LYM28 7	12773. 7	P	1.86	8.96E01	1.8
LYM 13 2	12273. 2	E	7.81 3	5.31E01	3.7	LYM 14 2	12804. 3	P	1.86 9	9.02E01	2.3
LYM 13 8	12562. 1	E	7.75	5.45E01	2.8	LYM21 2	13034. 9	P	1.87	9.29E01	2.3
LYM 13 8	12564. 1	E	7.75	5.45E01	2.8	LYM44	11882. 1	P	1.84 9	9.29E01	1.2
LYM3	12041. 1	E	7.75	5.45E01	2.8	LYM25 5	13081. 5	P	1.84 8	9.43E01	1.1
LYM 14 8	12173. 1	E	8.31 3	5.58E01	10.3	LYM 13 7	12152. 1	P	1.83 4	9.58E01	0.3
LYM26 8	12483. 4	E	7.62 5	5.60E01	1.2	LYM 17 4	12414. 2	P	1.83 2	9.58E01	0.2
LYM 10 6	12141. 4	E	7.68 8	5.77E01	2	LYM 18 3	12993. 5	P	1.83 9	9.59E01	0.6
LYM2	11693. 3	E	7.68 8	5.77E01	2	LYM27 0	12872. 7	P	1.83 6	9.62E01	0.4
LYM9	11633. 2	E	7.68 8	5.77E01	2	LYM 17 3	12982. 7	P	1.83 6	9.78E01	0.4
LYM 16 2	12231. 1	E	8	5.91E01	6.2	LYM 17 3	12981. 8	P	1.83 2	9.86E01	0.3
LYM 10 5	12294. 2	E	7.87 5	6.19E01	4.5	CONTR OL	—	P	1.82 8	—	0
LYM 13 8	12561. 3	E	7.87 5	6.19E01	4.5	LYM57	12012. 2	A	93.3 2	8.80E03	2.5

294

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM17 4	12412. 1	E	7.85 4	6.25E01	4.2	LYM14	12054. 2	A	93.0 18	1.70E02	2.2
LYM3	12041. 2	E	8.06 3	6.33E01	7	LYM14 8	12171. 2	A	93.0 29	1.75E02	2.2
LYM10	11742. 1	E	7.81 3	6.40E01	3.7	LYM15 2	12373. 1	A	92.6 21	4.54E02	1.8
LYM17 4	12411. 3	E	8.12 5	6.61E- 01	7.8	LYM43	11791. 2	A	93.7 04	4.64E02	2.9
LYM12 9	12573. 5	E	7.62 5	6.64E01	1.2	LYM14 0	12262. 3	A	92.8 65	5.07E02	2
LYM10 2	12221. 1	E	7.75	6.70E01	2.8	LYM13 2	12273. 2	A	93.0 98	5.40E02	2.3
LYM13 4	12311. 2	E	7.75	6.70E01	2.8	LYM13 0	12331. 3	A	92.4 87	5.67E02	1.6
LYM15	11612. 2	E	7.75	6.70E01	2.8	LYM66	11954. 5	A	93.4 27	5.73E02	2.6
LYM3	12043. 1	E	7.75	6.70E01	2.8	LYM11 9	12461. 4	A	93.2 97	6.70E02	2.5
LYM11 1	12251. 1	E	7.87 5	6.83E01	4.5	LYM43	11791. 4	A	92.3 85	7.11E- 02	1.5
LYM13	11771. 6	E	7.87 5	6.83E01	4.5	LYM24	12063. 3	A	93.2 33	7.13E- 02	2.4
LYM9	11632. 2	E	7.60 7	7.08E01	0.9	LYM29 0	12504. 1	A	93.3 5	8.10E- 02	2.6
LYM10 2	12222. 6	E	7.87 5	7.30E01	4.5	LYM51	11891. 1	A	92.5 07	8.56E02	1.6
LYM17 4	12414. 2	E	7.75	7.43E01	2.8	LYM11 9	12462. 1	A	92.3 46	8.64E02	1.5
LYM10 0	12131. 3	E	7.81 3	7.57E01	3.7	LYM14	12051. 1	A	93.3 18	9.94E02	2.5
LYM14 0	12261. 1	E	7.62 5	7.90E01	1.2	LYM14 0	12264. 1	A	92.4 5	1.09E- 01	1.6
LYM28 9	12492. 2	E	7.64 3	8.18E- 01	1.4	LYM14 0	12261. 4	A	93.7 06	1.36E- 01	2.9
LYM10	11744. 5	E	7.62 5	8.54E01	1.2	LYM10 0	12131. 2	A	92.8 99	1.46E- 01	2.1
LYM2	11695. 3	E	7.62 5	8.54E01	1.2	LYM66	11955. 2	A	93.9 05	1.53E- 01	3.2
LYM19	11752. 2	E	7.68 8	8.62E01	2	LYM17 4	12411. 2	A	91.9 81	1.83E- 01	1.1
LYM10 6	12142. 2	E	7.56 3	8.70E01	0.4	LYM67	11781. 5	A	92.2 97	1.95E- 01	1.4
LYM14 3	12523. 4	E	7.56 3	8.70E01	0.4	LYM57	12012. 6	A	92.0 94	1.96E- 01	1.2
LYM15 3	12321. 2	E	7.62 5	8.89E01	1.2	LYM95	12124. 4	A	92.0 49	2.11E01	1.1
LYM14 8	12172. 1	E	7.56 3	9.62E01	0.4	LYM15 2	12372. 2	A	93.0 98	2.28E01	2.3
LYM14 8	12174. 2	E	7.56 3	9.62E01	0.4	LYM17 2	12302. 2	A	91.9 37	2.30E01	1
LYM4	11705. 2	E	7.54 2	9.88E01	0.1	LYM11 9	12462. 2	A	92.9 69	2.34E01	2.1

295

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
CONTR OL	—	E	7.53 6	—	0	LYM95	12124. 6	A	93.6 93	2.49E01	2.9
LYM 14 3	12524. 7	F	0.51 2	4.90E05	57.7	LYM68	11942. 2	A	91.9 02	2.57E01	1
LYM 13 8	12561. 1	F	0.50 8	5.30E05	56.2	LYM29 0	12502. 4	A	92.1 94	3.14E- 01	1.3
LYM28 9	12493. 2	F	0.48 5	1.47E- 04	49.2	LYM51	11894. 2	A	93.1 54	3.27E01	2.3
LYM 10	11742. 2	F	0.46 9	2.28E04	44.2	LYM53	11844. 2	A	92.7 58	3.35E01	1.9
LYM 10 2	12222. 2	F	0.47 5	3.63E04	46.1	LYM 10 0	12131. 3	A	92.1 72	3.40E01	1.3
LYM 14 8	12174. 1	F	0.45 5	4.47E04	40	LYM31	11923. 1	A	92.4 07	3.77E01	1.5
LYM 13 2	12271. 4	F	0.45 4	4.55E04	39.8	LYM67	11782. 6	A	92.1 38	3.82E01	1.2
LYM 11 9	12463. 2	F	0.44	9.36E04	35.6	LYM3	12043. 1	A	91.8 72	4.24E01	0.9
LYM 19	11754. 1	F	0.44	9.71E04	35.6	LYM24	12061. 4	A	94.3 5	4.31E01	3.7
LYM 13 2	12273. 2	F	0.45 5	1.09E- 03	40.1	LYM 14 3	12523. 4	A	92.4 69	4.55E01	1.6
LYM 10	11741. 2	F	0.52 5	1.40E- 03	61.5	LYM 14	12051. 4	A	92.8 27	4.66E01	2
LYM 10 5	12293. 1	F	0.42 5	2.11E03	30.8	LYM 17 0	12453. 2	A	91.5 12	4.71E01	0.5
LYM 19	11753. 1	F	0.43 9	2.71E03	35	LYM 13 8	12566. 1	A	91.5 08	4.74E01	0.5
LYM4	11705. 2	F	0.42	2.85E03	29.4	LYM25 4	12472. 3	A	92.4 69	5.07E01	1.6
LYM 11 9	12461. 4	F	0.41 6	3.48E03	28.2	LYM25 4	12474. 4	A	93.0 13	5.16E- 01	2.2
LYM 10	11744. 1	F	0.45 9	7.24E03	41.1	LYM 15 2	12371. 2	A	91.4 63	5.20E01	0.5
LYM 15 2	12371. 2	F	0.39 9	1.05E02	22.8	LYM 13 7	12152. 1	A	92.2 31	5.23E01	1.3
LYM 19	11751. 4	F	0.39 7	1.36E02	22.1	LYM 14	12052. 5	A	91.5 87	5.37E01	0.6
LYM 13 0	12334. 1	F	0.48 2	1.68E02	48.5	LYM69	11852. 2	A	92.8 9	5.41E- 01	2
LYM 13 7	12153. 1	F	0.39 6	1.72E02	22	LYM68	11942. 3	A	91.4 29	5.48E01	0.4
LYM4	11706. 5	F	0.47 3	1.86E02	45.6	LYM43	11792. 2	A	93.0 65	5.58E01	2.2
LYM 17 4	12414. 3	F	0.51 5	1.92E02	58.5	LYM69	11853. 5	A	91.5 2	5.63E01	0.5
LYM28 9	12491. 4	F	0.39 9	1.98E02	22.7	LYM69	11853. 4	A	91.4 8	5.87E01	0.5
LYM 14 1	12402. 4	F	0.45 1	2.34E02	38.9	LYM67	11782. 4	A	92.5 68	6.01E- 01	1.7
LYM9	11632. 1	F	0.55 7	2.82E02	71.3	LYM 16 2	12234. 3	A	92.2 61	6.30E01	1.4

296

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM 14 0	12262. 3	F	0.43 1	3.06E02	32.7	LYM 13 2	12275. 1	A	91.4 68	6.30E01	0.5
LYM 13 0	12333. 1	F	0.43 9	3.87E02	35	LYM67	11782. 5	A	91.3 78	6.44E01	0.4
LYM 15 2	12372. 2	F	0.41 2	3.93E02	26.7	LYM26 8	12481. 1	A	91.4 41	6.58E01	0.5
LYM1	11604. 4	F	0.43 9	4.25E02	35.1	LYM31	11921. 3	A	91.5 36	6.83E01	0.6
LYM1	11603. 2	F	0.37 7	4.78E02	16	LYM95	12121. 4	A	91.6 2	6.87E01	0.7
LYM 14 1	12404. 3	F	0.37 1	6.69E02	14.3	LYM 14 3	12524. 2	A	91.6 62	7.07E01	0.7
LYM 16 2	12231. 1	F	0.43 3	7.48E02	33.4	LYM57	12013. 3	A	92.4 76	7.11E01	1.6
LYM 13	11772. 1	F	0.36 9	7.58E02	13.7	LYM62	12022. 4	A	91.9 5	7.18E01	1
LYM1	11602. 1	F	0.37 9	7.70E02	16.7	LYM26	11824. 1	A	91.6 83	7.41E01	0.7
LYM 16 2	12231. 3	F	0.39 9	8.40E02	22.7	LYM 17 4	12412. 1	A	91.3 87	7.62E01	0.4
LYM 16	11624. 4	F	0.39 5	8.75E02	21.6	LYM67	11783. 5	A	91.7 09	7.63E01	0.8
LYM 13 8	12561. 3	F	0.46 8	8.78E02	44	LYM 10 5	12293. 1	A	91.7 57	7.81E01	0.8
LYM9	11632. 2	F	0.38 5	9.44E02	18.5	LYM30	11913. 5	A	91.6 17	7.83E01	0.7
LYM 14 0	12261. 1	F	0.36 9	9.78E02	13.6	LYM95	12124. 5	A	91.3 05	7.91E01	0.3
LYM 17	11681. 4	F	0.40 8	9.89E02	25.5	LYM 17 2	12301. 2	A	91.3 51	7.92E01	0.4
LYM 10 0	12133. 1	F	0.43 2	1.18E01	33	LYM43	11791. 5	A	91.2 02	7.93E01	0.2
LYM1	11602. 6	F	0.55 4	1.25E01	70.6	LYM53	11843. 2	A	94.9 42	7.95E01	4.3
LYM 17 4	12411. 3	F	0.44 4	1.29E01	36.6	LYM 17 0	12454. 2	A	91.4 69	7.97E01	0.5
LYM28 9	12492. 2	F	0.36 9	1.39E01	13.6	LYM 11 9	12463. 2	A	91.4 89	8.08E01	0.5
LYM 16 2	12234. 4	F	0.42 7	1.55E01	31.5	LYM 11 1	12254. 4	A	91.5 09	8.21E01	0.5
LYM 14 0	12264. 1	F	0.36	1.58E01	10.7	LYM31	11922. 3	A	91.5 75	8.21E01	0.6
LYM 12 9	12573. 5	F	0.35 9	1.61E01	10.5	LYM 13 8	12562. 1	A	91.4 48	8.41E01	0.5
LYM 13 2	12275. 1	F	0.39 9	1.64E01	22.9	LYM 17 4	12411. 3	A	91.3 86	8.43E01	0.4
LYM 15 3	12323. 2	F	0.35 8	1.76E01	10.2	LYM51	11893. 2	A	91.3 33	8.55E01	0.3
LYM21	11673. 1	F	0.41 3	1.80E01	27.1	LYM 17 0	12453. 3	A	91.3 21	8.70E01	0.3
LYM 15	11612. 2	F	0.37 8	1.96E01	16.3	LYM62	12021. 1	A	91.1 7	8.74E01	0.2

297

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM 16 2	12234. 3	F	0.42 4	1.97E01	30.6	LYM 14 0	12261. 2	A	91.3 21	8.80E01	0.3
LYM 14 1	12404. 4	F	0.41 8	1.98E01	28.7	LYM 13 4	12312. 4	A	91.2 4	8.83E01	0.2
LYM 14 8	12171. 2	F	0.45 2	2.19E01	39	LYM 17 2	12301. 3	A	91.3 64	8.86E01	0.4
LYM 19	11752. 2	F	0.40 8	2.21E01	25.5	LYM 15 2	12372. 1	A	91.1 44	8.89E01	0.1
LYM 11 9	12462. 2	F	0.45 7	2.36E01	40.7	LYM 14 3	12521. 1	A	91.3 89	8.93E01	0.4
LYM 15	11611. 3	F	0.44 6	2.37E01	37.3	LYM30	11913. 3	A	91.2 04	8.94E01	0.2
LYM 13	11771. 6	F	0.35 5	2.37E01	9.2	LYM 11 9	12461. 1	A	91.1 51	9.05E01	0.1
LYM 19	11751. 5	F	0.39 6	2.37E01	21.9	LYM57	12012. 4	A	91.4 74	9.22E01	0.5
LYM 11 3	12442. 1	F	0.40 7	2.56E01	25.4	LYM25 4	12474. 3	A	91.2 98	9.38E01	0.3
LYM 13 8	12564. 1	F	0.35 5	2.62E01	9.4	LYM 14	12052. 4	A	91.1 21	9.52E01	0.1
LYM 15	11614. 4	F	0.35 8	2.72E01	10.1	LYM62	12023. 4	A	91.1 12	9.60E01	0.1
LYM 13 0	12332. 2	F	0.48 1	2.74E01	48	LYM66	11952. 1	A	91.0 69	9.64E01	0
LYM1	11601. 1	F	0.40 3	2.92E01	24.1	LYM43	11793. 2	A	91.0 6	9.73E01	0
LYM 14 0	12261. 4	F	0.35 9	2.93E01	10.6	LYM 11 1	12254. 3	A	91.0 41	9.81E01	0
LYM 10 2	12222. 3	F	0.45 1	2.97E01	38.8	LYM 13 0	12332. 2	A	91.0 95	9.83E01	0.1
LYM 10	11742. 1	F	0.39 4	3.00E01	21.1	LYM 15 2	12376. 1	A	91.0 52	9.90E01	0
LYM 13 4	12311. 2	F	0.40 1	3.03E01	23.4	CONTR OL	—	A	91.0 24	—	0
LYM 14 8	12174. 2	F	0.34 9	3.05E01	7.4	LYM69	11853. 5	B	0.38 2	7.33E03	13.4
LYM 17 4	12414. 2	F	0.39 3	3.10E01	20.9	LYM53	11841. 2	B	0.40 7	1.01E02	20.8
LYM28 9	12493. 6	F	0.38	3.17E01	17.1	LYM 13 8	12561. 1	B	0.41 8	1.55E02	24
LYM22	11762. 1	F	0.36 1	3.24E01	11.2	LYM 13 4	12314. 2	B	0.36 6	5.15E02	8.8
LYM 17 4	12412. 1	F	0.42 5	3.25E01	30.9	LYM 14 0	12264. 1	B	0.36 2	7.22E02	7.5
LYM21	11671. 2	F	0.39 3	3.28E01	21	LYM 11 9	12461. 1	B	0.39 7	1.11E01	17.8
LYM 11 1	12251. 1	F	0.39 5	3.31E01	21.4	LYM30	11913. 5	B	0.35 6	1.56E01	5.6
LYM 17	11684. 5	F	0.34 7	3.33E01	6.9	LYM53	11844. 2	B	0.37 7	1.57E01	11.9
LYM9	11633. 7	F	0.40 6	3.55E01	25	LYM51	11894. 2	B	0.35 8	1.63E01	6.3

298

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM11 1	12254. 4	F	0.34 6	3.64E01	6.5	LYM51	11891. 1	B	0.35 8	1.64E01	6.2
LYM14 3	12524. 2	F	0.35 2	3.68E01	8.3	LYM10 0	12131. 2	B	0.36 1	1.82E01	7.3
LYM10 6	12142. 2	F	0.35 1	3.69E01	8.1	LYM53	11841. 1	B	0.36 1	1.82E01	7.3
LYM15	11614. 3	F	0.42 7	3.69E01	31.5	LYM11 1	12251. 3	B	0.39 8	2.06E01	18.2
LYM10	11744. 5	F	0.35 3	3.79E01	8.6	LYM14 3	12524. 2	B	0.44 6	2.56E01	32.3
LYM11 9	12462. 1	F	0.49	3.83E01	50.8	LYM57	12013. 5	B	0.38 3	2.62E01	13.6
LYM17 4	12411. 2	F	0.39 3	3.90E01	20.8	LYM13 8	12561. 3	B	0.38 1	2.70E01	13.2
LYM26 8	12483. 2	F	0.42 7	3.97E01	31.4	LYM11 1	12252. 2	B	0.36 8	2.79E01	9.1
LYM17	11684. 4	F	0.37 9	4.02E01	16.6	LYM17 2	12301. 2	B	0.35	3.03E01	3.9
LYM13	11771. 9	F	0.39 2	4.05E01	20.7	LYM13 8	12562. 1	B	0.35 7	3.98E01	6
LYM28 9	12491. 1	F	0.43	4.12E01	32.5	LYM26 8	12482. 3	B	0.35 9	4.07E01	6.7
LYM29 0	12502. 4	F	0.34 5	4.15E01	6.3	LYM51	11893. 2	B	0.34 8	4.13E01	3.4
LYM17	11682. 1	F	0.41	4.20E01	26.2	LYM10 5	12295. 2	B	0.36 7	4.31E01	8.9
LYM14 8	12172. 1	F	0.36 9	4.31E01	13.6	LYM10 5	12293. 1	B	0.36	4.56E01	6.9
LYM10 5	12294. 2	F	0.38 9	4.33E01	19.8	LYM29 0	12502. 4	B	0.35 1	4.58E01	4.3
LYM2	11695. 3	F	0.35 1	4.55E01	7.9	LYM26 8	12483. 2	B	0.37 3	4.72E01	10.8
LYM10 2	12222. 6	F	0.37 1	4.65E01	14.2	LYM14 3	12521. 2	B	0.37 8	5.08E01	12.1
LYM15	11612. 3	F	0.38 5	4.85E01	18.5	LYM62	12021. 1	B	0.36 8	5.10E01	9.3
LYM14 3	12521. 1	F	0.35 3	4.93E01	8.6	LYM68	11941. 4	B	0.40 8	5.11E01	21.2
LYM29 0	12501. 3	F	0.39 9	5.13E01	22.9	LYM29 0	12501. 3	B	0.36 1	5.13E01	7.3
LYM15 3	12321. 2	F	0.38 8	5.47E01	19.4	LYM14 8	12174. 2	B	0.34 7	5.34E01	3
LYM17	11683. 1	F	0.33 8	5.62E01	4	LYM31	11923. 4	B	0.35 1	5.39E01	4.3
LYM26 8	12483. 4	F	0.36 1	5.88E01	11.1	LYM14	12052. 5	B	0.34 6	5.46E01	2.8
LYM10 2	12221. 1	F	0.34 8	5.96E01	7.2	LYM11 1	12254. 4	B	0.34 6	5.71E01	2.8
LYM2	11693. 3	F	0.36 8	6.14E01	13.1	LYM51	11893. 4	B	0.34 9	5.77E01	3.7
LYM13 8	12562. 1	F	0.36 1	6.15E01	11.1	LYM13 7	12153. 1	B	0.37 8	5.84E01	12.3

299

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM21	11672. 4	F	0.34 7	6.16E01	6.8	LYM13 2	12271. 4	B	0.34 6	5.95E01	2.8
LYM13	11773. 2	F	0.33 8	6.25E01	4	LYM13 8	12564. 1	B	0.34 6	6.18E01	2.8
LYM13 2	12275. 3	F	0.37	6.32E01	13.9	LYM30	11913. 3	B	0.38 8	6.38E01	15.2
LYM13 0	12331. 3	F	0.35 8	6.50E01	10.2	LYM13 7	12152. 1	B	0.34 4	6.57E01	2.3
LYM14 8	12173. 1	F	0.37 8	6.57E01	16.3	LYM14	12052. 4	B	0.34 6	6.71E01	2.6
LYM3	12041. 2	F	0.34 3	6.88E01	5.7	LYM11 9	12462. 2	B	0.34 3	6.92E01	1.9
LYM13 7	12151. 1	F	0.34 2	6.98E01	5.3	LYM25 4	12474. 4	B	0.35	6.93E01	3.9
LYM10 6	12141. 4	F	0.34 9	7.07E01	7.4	LYM43	11791. 5	B	0.34 1	7.48E01	1.3
LYM14 1	12404. 2	F	0.34 6	7.13E01	6.6	LYM62	12022. 1	B	0.35 7	7.54E01	6
LYM14 3	12521. 2	F	0.33 7	7.26E01	3.6	LYM53	11842. 4	B	0.35 8	7.57E01	6.3
LYM10 5	12294. 3	F	0.35 3	7.73E01	8.6	LYM10 5	12297. 1	B	0.35 9	7.60E01	6.7
LYM10 0	12131. 3	F	0.34 5	8.18E01	6	LYM16 2	12231. 3	B	0.36 1	7.67E01	7.3
LYM9	11633. 2	F	0.34	8.64E01	4.6	LYM13 7	12151. 1	B	0.34 1	7.73E01	1.3
LYM11 1	12252. 2	F	0.34	8.78E01	4.8	LYM57	12013. 3	B	0.36 2	7.76E01	7.5
LYM26 8	12482. 1	F	0.33	8.79E01	1.6	LYM68	11941. 3	B	0.35 7	7.84E01	6
LYM11 3	12444. 4	F	0.32 8	9.04E01	0.8	LYM17 2	12301. 3	B	0.34 9	8.04E01	3.7
LYM16 2	12233. 2	F	0.32 7	9.42E01	0.5	LYM14 8	12174. 1	B	0.34 7	8.07E01	3
LYM10 2	12222. 1	F	0.32 8	9.74E01	0.9	LYM51	11892. 1	B	0.34 4	8.21E01	2.3
LYM15 3	12324. 1	F	0.32 7	9.76E01	0.5	LYM53	11843. 2	B	0.35 2	8.35E01	4.4
LYM10 6	12144. 4	F	0.32 6	9.76E01	0.3	LYM26 8	12481. 1	B	0.33 9	8.37E01	0.8
CONTR OL	—	F	0.32 5	—	0	LYM13 7	12151. 2	B	0.34 1	8.42E01	1.3
LYM19	11752. 2	G	9.40 2	2.33E04	43.1	LYM68	11942. 3	B	0.34 3	8.62E01	1.9
LYM14 3	12524. 7	G	8.84 9	3.23E04	34.7	LYM29 0	12502. 1	B	0.33 9	8.75E01	0.6
LYM13 2	12275. 3	G	8.76 7	4.00E04	33.4	LYM13 4	12313. 2	B	0.33 9	8.82E01	0.6
LYM15	11614. 4	G	8.72 9	4.28E04	32.9	LYM30	11913. 4	B	0.35 5	8.85E01	5.5
LYM4	11705. 2	G	8.61 6	5.60E04	31.2	LYM15 2	12373. 2	B	0.34 5	8.86E01	2.4

300

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM9	11632. 1	G	8.60 5	6.15E04	31	LYM31	11922. 3	B	0.34 4	9.08E01	2.3
LYM13	11772. 2	G	8.53 1	7.47E04	29.8	LYM69	11852. 2	B	0.34 3	9.23E01	1.9
LYM17 4	12414. 3	G	8.46 5	9.60E04	28.8	LYM67	11781. 5	B	0.34	9.46E01	1
LYM13 2	12273. 2	G	8.48 1	1.28E03	29.1	LYM15 2	12372. 1	B	0.33 9	9.51E01	0.6
LYM10 5	12294. 3	G	8.32	1.52E03	26.6	LYM57	12012. 6	B	0.33 8	9.53E01	0.2
LYM13 8	12561. 1	G	8.22 5	2.11E03	25.2	LYM13 7	12154. 5	B	0.33 8	9.64E01	0.4
LYM19	11754. 1	G	8.14 3	2.69E03	23.9	LYM17 2	12304. 2	B	0.34 1	9.64E01	1.3
LYM11 3	12444. 5	G	8.01 5	4.33E03	22	LYM57	12012. 2	B	0.33 8	9.71E01	0.2
LYM11 1	12252. 2	G	7.97 2	5.09E03	21.3	LYM26 8	12482. 1	B	0.33 8	9.86E01	0.2
LYM15 3	12324. 1	G	8.02 2	6.24E03	22.1	LYM67	11783. 5	B	0.33 7	9.93E01	0.1
LYM13 0	12334. 1	G	8.04 6	6.78E03	22.5	CONTR OL	—	B	0.33 7	—	0
LYM17 4	12411. 3	G	8.77 2	1.45E02	33.5	LYM13 7	12152. 1	C	4.38 8	2.02E02	15.2
LYM17	11683. 1	G	7.67 9	1.61E02	16.9	LYM53	11844. 2	C	4.37 5	2.89E02	14.9
LYM13 0	12331. 3	G	7.68 4	1.97E02	17	LYM11 1	12251. 3	C	4.3	4.04E02	12.9
LYM15	11611. 3	G	7.85	2.01E02	19.5	LYM51	11894. 2	C	4.27 5	4.70E02	12.3
LYM10	11742. 1	G	8.12 7	2.10E02	23.7	LYM14 8	12174. 2	C	4.32 5	5.44E02	13.6
LYM17	11682. 1	G	7.60 4	2.15E02	15.7	LYM13 8	12561. 1	C	4.3	6.41E02	12.9
LYM11 1	12254. 4	G	7.60 1	2.17E02	15.7	LYM11 1	12252. 2	C	4.22 5	6.83E02	11
LYM15 3	12321. 2	G	8.37 4	2.39E02	27.5	LYM11 9	12461. 1	C	4.21 5	8.43E02	10.7
LYM11 3	12443. 1	G	7.57 4	2.47E02	15.3	LYM11 1	12254. 4	C	4.18 1	1.22E01	9.8
LYM10 0	12134. 1	G	7.56 2	2.55E02	15.1	LYM53	11841. 1	C	4.25	1.46E01	11.6
LYM28 9	12493. 2	G	8.63	3.01E02	31.4	LYM29 0	12501. 3	C	4.16 9	1.58E01	9.5
LYM22	11764. 7	G	7.56 6	3.04E02	15.2	LYM13 7	12153. 1	C	4.64 1	1.63E01	21.9
LYM13 0	12332. 1	G	7.50 5	3.23E02	14.2	LYM14 3	12524. 2	C	4.31 3	1.76E01	13.3
LYM1	11601. 1	G	9.44 5	3.25E02	43.8	LYM13 7	12154. 5	C	4.10 6	1.78E01	7.9
LYM15 3	12322. 1	G	7.46 2	3.90E02	13.6	LYM13 4	12314. 2	C	4.34 4	1.83E01	14.1

301

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM10 0	12133. 1	G	7.94 8	4.23E02	21	LYM13 8	12564. 1	C	4.19 4	2.80E01	10.2
LYM10 2	12221. 1	G	7.44 4	4.24E02	13.3	LYM25 4	12474. 4	c	4.13 8	2.93E01	8.7
LYM14 0	12261. 4	G	7.46	4.52E02	13.5	LYM11 9	12462. 2	c	4.13 1	3.11E01	8.5
LYM22	11761. 3	G	7.41 8	4.69E02	12.9	LYM51	11893. 2	c	4.16 9	3.79E01	9.5
LYM10 5	12293. 1	G	7.40 4	5.03E02	12.7	LYM69	11853. 5	c	3.98 8	3.90E01	4.7
LYM13 2	12271. 4	G	8.77 8	5.13E02	33.6	LYM14 0	12264. 1	c	4.11 3	4.20E01	8
LYM13 2	12275. 1	G	7.73 7	5.17E02	17.8	LYM10 5	12297. 1	c	3.98 1	4.86E01	4.6
LYM13 4	12312. 3	G	8.64 6	5.27E02	31.6	LYM51	11893. 4	c	4.24 4	5.14E01	11.5
LYM16 2	12234. 4	G	7.46 1	5.37E02	13.6	LYM13 8	12561. 3	c	4.28 1	5.21E01	12.4
LYM19	11753. 1	G	7.79 3	6.24E02	18.6	LYM68	11941. 4	c	4.12 3	5.24E01	8.3
LYM28 9	12493. 6	G	8.21 8	6.32E02	25.1	LYM13 4	12312. 4	c	3.95 6	6.33E01	3.9
LYM13 8	12566. 1	G	7.34 9	8.04E02	11.9	LYM13 8	12562. 1	c	3.91 3	6.53E01	2.8
LYM3	12042. 1	G	8.32 8	8.35E02	26.8	LYM53	11843. 2	c	3.97 5	6.64E01	4.4
LYM13 4	12314. 2	G	8.44 2	8.52E02	28.5	LYM53	11841. 2	c	4.02	6.89E01	5.6
LYM21	11674. 5	G	7.26 1	9.00E02	10.5	LYM11 1	12251. 1	c	3.99 4	7.37E01	4.9
LYM15 2	12371. 3	G	7.55 4	9.80E02	15	LYM25 4	12472. 3	c	3.98 8	7.61E01	4.7
LYM13 4	12311. 2	G	7.53 9	1.05E01	14.7	LYM26	11824. 1	c	3.96 9	7.64E01	4.2
LYM11 1	12251. 1	G	7.51 2	1.05E01	14.3	LYM17 2	12304. 1	c	3.86 4	7.87E01	1.5
LYM10 6	12144. 4	G	7.54	1.07E01	14.8	LYM14 0	12261. 1	c	3.85 6	8.15E01	1.3
LYM28 9	12491. 4	G	7.44 2	1.10E01	13.3	LYM51	11891. 1	c	3.85	8.33E01	1.1
LYM13	11773. 2	G	7.78	1.11E01	18.4	LYM51	11892. 1	c	3.85 6	8.47E01	1.3
LYM16	11624. 4	G	7.50 4	1.12E01	14.2	LYM13 7	12151. 2	c	3.88 1	8.63E01	1.9
LYM16 2	12233. 2	G	7.20 5	1.15E01	9.7	LYM13 7	12151. 1	c	3.89 4	8.70E01	2.3
LYM10 6	12144. 3	G	8.29 8	1.25E01	26.3	LYM11 9	12462. 1	c	3.83 1	9.06E01	0.6
LYM3	12041. 2	G	7.35 1	1.34E01	11.9	LYM26	11824. 5	c	3.83 1	9.06E01	0.6
LYM13 8	12562. 1	G	7.15 6	1.44E01	8.9	LYM57	12013. 3	c	3.88	9.10E01	1.9

302

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM13 7	12153. 1	G	8.56 5	1.46E- 01	30.4	LYM29 0	12504. 1	C	3.85 6	9.32E01	1.3
LYM11 3	12442. 2	G	7.70 3	1.48E- 01	17.3	LYM25 4	12474. 3	c	3.82 5	9.39E01	0.5
LYM17	11681. 4	G	7.50 6	1.49E- 01	14.3	LYM10 0	12131. 2	c	3.81 9	9.68E01	0.3
LYM10 2	12222. 2	G	7.66 1	1.59E- 01	16.6	LYM66	11954. 5	c	3.81 3	9.80E01	0.1
LYM13 0	12333. 1	G	7.53 8	1.65E- 01	14.7	LYM57	12012. 6	c	3.81 3	9.80E01	0.1
LYM11 3	12442. 1	G	8.27 7	1.67E- 01	26	CONTR OL	—	c	3.80 7	—	0
LYM10 5	12294. 2	G	7.50 4	1.68E- 01	14.2	LYM13 4	12314. 2	D	0.47 4	2.43E04	37.7
LYM10	11742. 2	G	8.76 4	1.69E- 01	33.4	LYM26 8	12482. 3	D	0.45 2	7.22E04	31.3
LYM14 1	12404. 4	G	8.02 8	1.72E- 01	22.2	LYM31	11923. 4	D	0.44 2	1.43E- 03	28.3
LYM14 0	12261. 1	G	8.77	1.78E- 01	33.5	LYM13 8	12561. 1	D	0.49	4.94E03	42.3
LYM1	11602. 1	G	7.47 4	1.80E- 01	13.8	LYM17 0	12453. 2	D	0.43	7.39E03	24.9
LYM16 2	12231. 3	G	7.51 2	1.84E- 01	14.3	LYM14 8	12171. 2	D	0.43 5	8.04E03	26.3
LYM10 2	12222. 3	G	7.90 6	1.85E- 01	20.3	LYM57	12013. 5	D	0.41 4	1.08E02	20.3
LYM10 0	12131. 2	G	7.78 3	1.88E- 01	18.5	LYM68	11942. 3	D	0.43 1	1.45E02	25.2
LYM14 1	12404. 1	G	7.44 3	1.92E- 01	13.3	LYM43	11791. 5	D	0.47 1	1.54E02	36.6
LYM13	11772. 1	G	7.64 3	1.99E01	16.3	LYM14 0	12264. 1	D	0.40 8	1.74E02	18.5
LYM1	11602. 6	G	7.44 3	1.99E01	13.3	LYM10 0	12131. 2	D	0.49 5	4.32E02	43.5
LYM4	11706. 3	G	7.16 6	2.00E01	9.1	LYM13 7	12152. 1	D	0.39	4.90E02	13.2
LYM15 3	12323. 2	G	7.96 8	2.11E01	21.3	LYM57	12012. 2	D	0.39	5.17E- 02	13.1
LYM2	11695. 3	G	7.81 9	2.19E01	19	LYM69	11853. 5	D	0.42 8	6.11E- 02	24.3
LYM3	12043. 1	G	8.85 6	2.24E01	34.8	LYM14	12052. 4	D	0.38 7	6.34E02	12.5
LYM13	11771. 9	G	8.78 2	2.27E01	33.7	LYM14 3	12524. 2	D	0.45 9	6.71E- 02	33.1
LYM28 9	12492. 2	G	7.52 1	2.28E01	14.5	LYM53	11841. 1	D	0.46 2	7.65E02	34.1
LYM16 2	12231. 1	G	7.97 6	2.31E01	21.4	LYM14 8	12174. 1	D	0.53 7	8.03E02	55.9
LYM11 3	12444. 4	G	8.06 6	2.38E01	22.8	LYM29 0	12502. 4	D	0.44 4	8.80E02	28.8
LYM13 0	12332. 2	G	8.4	2.46E01	27.9	LYM10 5	12294. 3	D	0.40 1	9.08E02	16.3

303

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM10	11744. 5	G	7.02 5	2.46E01	6.9	LYM11 9	12462. 1	D	0.50 1	1.14E01	45.4
LYM17 4	12412. 1	G	8.37	2.55E01	27.4	LYM68	11941. 3	D	0.42 9	1.18E01	24.5
LYM9	11632. 2	G	7.50 5	2.64E01	14.2	LYM57	12012. 6	D	0.37 5	1.65E01	8.9
LYM10 0	12133. 3	G	7.44 4	2.66E01	13.3	LYM13 7	12151. 1	D	0.42 7	1.68E01	23.9
LYM15 2	12372. 2	G	7.52	2.67E01	14.5	LYM30	11913. 5	D	0.41 1	1.70E01	19.2
LYM11 9	12461. 4	G	8.26 4	2.68E01	25.8	LYM43	11791. 4	D	0.41 7	1.74E01	21.1
LYM14 0	12262. 3	G	8.23 2	2.72E01	25.3	LYM11 1	12252. 2	D	0.65 8	1.79E01	90.8
LYM14 0	12264. 1	G	8.75 3	2.84E01	33.2	LYM13 8	12561. 3	D	0.45 2	2.37E01	31.3
LYM14 8	12172. 1	G	8.29 5	2.85E01	26.3	LYM15 2	12372. 2	D	0.38 1	2.51E01	10.5
LYM13 8	12564. 1	G	7.27	2.88E01	10.7	LYM11 9	12462. 2	D	0.41 7	2.52E01	21.1
LYM14 3	12521. 1	G	7.43 3	2.89E01	13.1	LYM11 1	12254. 4	D	0.39 5	2.69E01	14.7
LYM4	11706. 5	G	7.38 1	2.90E01	12.4	LYM13 7	12154. 5	D	0.40 8	2.69E01	18.3
LYM10 6	12141. 4	G	7.83 6	2.92E01	19.3	LYM11 1	12251. 3	D	0.4	3.04E01	16
LYM10 2	12222. 6	G	7.60 8	2.95E01	15.8	LYM30	11912. 6	D	0.42 4	3.16E01	22.9
LYM2	11693. 3	G	7.68	3.07E01	16.9	LYM62	12021. 1	D	0.42	3.20E01	22
LYM10 6	12142. 2	G	8.08 5	3.09E01	23.1	LYM26 8	12481. 1	D	0.39 5	3.24E01	14.6
LYM11 9	12461. 1	G	8.06 1	3.13E01	22.7	LYM43	11792. 2	D	0.38 6	3.28E01	12
LYM14 8	12174. 2	G	7.99 7	3.17E01	21.7	LYM13 0	12331. 3	D	0.36 4	3.67E01	5.8
LYM10 5	12297. 1	G	7.58 9	3.25E01	15.5	LYM13 7	12153. 1	D	0.39 4	3.68E01	14.4
LYM10	11744. 1	G	8.49 4	3.37E01	29.3	LYM68	11942. 2	D	0.38 2	3.96E01	11
LYM29 0	12501. 3	G	8.09 8	3.38E01	23.3	LYM68	11943. 2	D	0.40 6	4.05E01	17.7
LYM2	11695. 1	G	7.38 2	3.44E01	12.4	LYM17 2	12301. 2	D	0.41 2	4.21E01	19.4
LYM9	11633. 7	G	7.29 6	3.48E01	11.1	LYM53	11844. 2	D	0.41 4	4.32E01	20.1
LYM17 4	12414. 2	G	7.92 2	3.51E01	20.6	LYM51	11893. 4	D	0.45	4.63E01	30.7
LYM13	11771. 6	G	7.03 5	3.52E01	7.1	LYM11 9	12461. 1	D	0.48 6	4.65E01	41
LYM3	12041. 1	G	8.12 9	3.75E01	23.7	LYM10 5	12295. 2	D	0.37 9	4.68E01	10

304

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM19	11751. 5	G	7.91 1	3.82E01	20.4	LYM51	11893. 2	D	0.36 8	4.81E01	6.8
LYM15	11614. 3	G	7.80 7	3.82E01	18.8	LYM15 2	12376. 1	D	0.39 4	4.85E01	14.5
LYM1	11604. 4	G	7.12 2	3.96E01	8.4	LYM13 4	12312. 4	D	0.36 9	4.91E01	7.2
LYM13 7	12152. 1	G	8.26 1	4.00E01	25.7	LYM51	11894. 2	D	0.36	5.02E01	4.4
LYM21	11674. 1	G	6.88 2	4.03E01	4.8	LYM15 2	12372. 1	D	0.43	5.13E- 01	24.8
LYM13 7	12151. 1	G	7.90 1	4.07E01	20.3	LYM62	12022. 1	D	0.37 3	5.37E01	8.1
LYM16 2	12234. 3	G	8.00 4	4.22E01	21.8	LYM11 1	12254. 3	D	0.44 6	5.43E01	29.5
LYM13 8	12561. 3	G	6.87	4.25E01	4.6	LYM10 0	12131. 3	D	0.35 7	5.49E01	3.5
LYM28 9	12491. 1	G	7.20 2	4.30E01	9.6	LYM14 3	12524. 7	D	0.45	5.61E- 01	30.6
LYM12 9	12573. 5	G	7.19 8	4.45E01	9.6	LYM29 0	12502. 2	D	0.40 1	5.62E01	16.4
LYM13 2	12276. 1	G	7.23 2	4.45E01	10.1	LYM14	12051. 4	D	0.36 5	5.63E01	6
LYM10	11741. 2	G	7.63 3	4.60E01	16.2	LYM67	11783. 5	D	0.38 6	6.06E01	12
LYM2	11691. 2	G	7.39 6	4.69E01	12.6	LYM43	11793. 2	D	0.37 5	6.13E- 01	8.9
LYM17	11684. 5	G	7.52 7	4.73E01	14.6	LYM30	11912. 7	D	0.35 9	6.25E01	4.1
LYM11 1	12254. 3	G	7.47 4	4.74E01	13.8	LYM10 0	12133. 3	D	0.35 6	6.28E01	3.4
LYM15 3	12324. 2	G	7.35 1	4.78E01	11.9	LYM11 9	12461. 4	D	0.37 6	6.48E01	9.1
LYM17	11684. 4	G	7.29	4.79E01	11	LYM68	11941. 4	D	0.35 3	6.66E01	2.5
LYM11 9	12462. 2	G	6.94 1	4.86E01	5.6	LYM10 0	12134. 1	D	0.36 3	6.77E01	5.5
LYM15 2	12371. 2	G	7.56 5	4.94E01	15.2	LYM29 0	12501. 3	D	0.36 2	7.05E01	5.2
LYM16	11623. 5	G	7.01 1	4.96E01	6.7	LYM95	12124. 4	D	0.35 2	7.39E01	2.1
LYM14 1	12404. 3	G	7.03 6	5.07E01	7.1	LYM26	11824. 6	D	0.36 2	7.57E01	5
LYM21	11673. 1	G	8.61 7	5.09E01	31.2	LYM14 3	12521. 2	D	0.35 1	7.58E01	1.8
LYM10 6	12142. 1	G	7.44 8	5.21E- 01	13.4	LYM13 8	12562. 1	D	0.36 3	7.64E01	5.3
LYM21	11671. 2	G	9.05 8	5.24E01	37.9	LYM13 2	12275. 1	D	0.35 1	7.77E01	2
LYM3	12043. 2	G	8.68 8	5.30E01	32.2	LYM13 2	12276. 1	D	0.35 2	7.92E01	2.1
LYM14 1	12402. 4	G	7.38 4	5.30E01	12.4	LYM25 4	12474. 4	D	0.37 5	7.96E01	9

305

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM11 3	12441. 4	G	7.04 9	5.31E01	7.3	LYM13 2	12271. 4	D	0.35 6	8.08E01	3.4
LYM10 2	12222. 1	G	7.91 7	5.33E01	20.5	LYM13 0	12332. 2	D	0.35 7	8.15E01	3.6
LYM26 8	12483. 2	G	7.79 4	5.34E01	18.6	LYM67	11782. 4	D	0.35 6	8.23E01	3.2
LYM22	11762. 1	G	7.80 1	5.39E01	18.7	LYM53	11842. 4	D	0.36 2	8.38E01	5.2
LYM11 9	12462. 1	G	7.69 2	5.48E01	17.1	LYM51	11891. 1	D	0.34 8	8.52E01	1.1
LYM15	11612. 3	G	7.17 5	5.52E01	9.2	LYM14 8	12173. 1	D	0.34 8	9.01E01	1
LYM10 0	12131. 3	G	7.14 5	5.60E01	8.8	LYM15 2	12373. 1	D	0.35 3	9.14E01	2.6
LYM14 3	12523. 4	G	7.04 6	5.67E01	7.2	LYM16 2	12231. 3	D	0.34 9	9.41E01	1.3
LYM14 8	12174. 1	G	7.40 3	5.77E01	12.7	LYM26 8	12482. 1	D	0.35	9.52E01	1.7
LYM19	11751. 4	G	7.08 4	5.88E01	7.8	LYM66	11954. 4	D	0.34 5	9.97E01	0.1
LYM14 3	12521. 2	G	6.96 2	6.60E01	6	CONTR OL	—	D	0.34 5	—	0
LYM11 1	12251. 3	G	6.83 2	6.96E01	4	LYM11 1	12252. 2	E	9.68 8	7.00E06	21.3
LYM15	11612. 2	G	6.95 6	6.97E01	5.9	LYM53	11841. 1	E	9.06 3	1.80E04	13.5
LYM16	11623. 2	G	7.05	7.01E01	7.3	LYM57	12013. 5	E	9	2.83E04	12.7
LYM10 5	12297. 2	G	6.78 9	7.14E01	3.3	LYM10 5	12297. 1	E	8.87 5	6.26E04	11.2
LYM11 9	12463. 2	G	6.81 3	7.50E01	3.7	LYM13 8	12561. 1	E	9.5	7.87E04	19
LYM13 7	12151. 2	G	6.99 2	7.65E01	6.4	LYM10 0	12131. 2	E	8.81 3	1.02E03	10.4
LYM26 8	12483. 4	G	6.84 4	7.81E01	4.2	LYM14 8	12174. 1	E	9.25	1.72E03	15.9
LYM26 8	12482. 1	G	6.75 5	8.29E01	2.8	LYM69	11853. 5	E	9.25	1.72E03	15.9
LYM9	11633. 2	G	6.80 3	8.47E01	3.5	LYM14 3	12524. 2	E	8.68 8	2.72E03	8.8
LYM14 1	12404. 2	G	6.78 6	8.53E01	3.3	LYM30	11913. 5	E	8.68 8	2.72E03	8.8
LYM29 0	12502. 4	G	6.64 1	8.59E01	1.1	LYM30	11913. 4	E	8.59 8	4.80E03	7.7
LYM21	11672. 4	G	6.67	8.97E01	1.5	LYM43	11791. 4	E	8.56 3	7.93E03	7.2
LYM12 9	12572. 2	G	6.61 6	9.20E01	0.7	LYM67	11783. 5	E	8.74 1	1.00E02	9.5
LYM13 4	12312. 4	G	6.75 9	9.21E01	2.9	LYM14 0	12264. 1	E	8.5	1.16E02	6.5
LYM22	11764. 1	G	6.64 8	9.44E01	1.2	LYM14 3	12521. 2	E	8.5	1.16E02	6.5

306

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM29 0	12502. 2	G	6.60 7	9.83E01	0.6	LYM43	11791. 5	E	8.75	1.31E02	9.6
LYM 14 8	12173. 1	G	6.58 2	9.90E01	0.2	LYM68	11941. 3	E	8.75	1.31E02	9.6
CONTR OL	—	G	6.57	—	0	LYM68	11942. 3	E	9.31 3	1.72E02	16.6
LYM 14 3	12524. 7	H	16.0 67	1.30E05	63.3	LYM 11 9	12461. 1	E	9.18 8	2.19E02	15.1
LYM 14 8	12171. 2	H	16.1 14	1.80E05	63.8	LYM 14 3	12524. 7	E	9.18 8	2.19E02	15.1
LYM 13 0	12333. 1	H	14.8 09	6.50E05	50.5	LYM51	11894. 2	E	8.43 8	2.49E02	5.7
LYM 10	11741. 2	H	18.7 1	9.40E05	90.1	LYM95	12124. 4	E	8.43 8	2.49E02	5.7
LYM4	11706. 5	H	14.0 74	2.31E04	43	LYM51	11893. 2	E	9.06 3	2.84E02	13.5
LYM 10 2	12222. 2	H	14.0 87	2.46E04	43.2	LYM30	11913. 3	E	8.93 8	3.78E02	11.9
LYM1	11602. 1	H	13.9 72	2.52E04	42	LYM 14	12052. 4	E	8.5	5.02E02	6.5
LYM 10 5	12293. 1	H	13.8 79	3.34E04	41	LYM29 0	12502. 2	E	8.5	5.02E02	6.5
LYM 10	11744. 1	H	13.8 5	3.39E04	40.8	LYM 13 4	12314. 2	E	8.81 3	5.19E02	10.4
LYM 16 2	12234. 3	H	13.5 67	4.59E04	37.9	LYM 10 5	12294. 2	E	8.31 3	8.12E02	4.1
LYM 14 0	12262. 3	H	12.9 58	1.39E03	31.7	LYM 13 0	12332. 2	E	8.87 5	1.03E01	11.2
LYM 15	11614. 3	H	12.8 9	1.69E03	31	LYM 13 7	12153. 1	E	8.26 8	1.05E01	3.6
LYM 15 2	12372. 2	H	13.5 17	5.83E03	37.4	LYM 16 2	12234. 3	E	8.37 5	1.08E01	4.9
LYM 11 9	12461. 4	H	12.4 16	7.53E03	26.2	LYM29 0	12501. 3	E	8.37 5	1.08E01	4.9
LYM1	11602. 6	H	19.4 77	7.70E03	97.9	LYM62	12022. 1	E	8.37 5	1.08E01	4.9
LYM 13 2	12273. 2	H	12.9 17	1.21E02	31.3	LYM 11 9	12462. 2	E	8.56 3	1.10E01	7.2
LYM 13 0	12334. 1	H	13.0 43	1.44E02	32.5	LYM 17 2	12302. 2	E	8.56 3	1.10E01	7.2
LYM 10 0	12133. 1	H	11.9 96	1.53E02	21.9	LYM 14 8	12172. 1	E	8.25	1.24E01	3.3
LYM 16 2	12231. 3	H	12.2 08	2.21E02	24.1	LYM95	12121. 2	E	8.25	1.24E01	3.3
LYM28 9	12493. 2	H	14.5 44	2.84E02	47.8	LYM 13 0	12331. 3	E	8.75	1.31E01	9.6
LYM 11 9	12463. 2	H	13.3 26	3.16E02	35.4	LYM 13 0	12334. 1	E	8.75	1.31E01	9.6
LYM 17	11684. 4	H	12.3 64	3.64E02	25.7	LYM 13 7	12151. 1	E	9.25	1.43E01	15.9
LYM 14 1	12404. 2	H	11.4 75	3.87E02	16.6	LYM68	11941. 4	E	8.41 1	1.43E01	5.3

307

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM1	11603. 2	H	12.6 74	4.14E02	28.8	LYM 17 0	12453. 2	E	8.95 5	1.60E01	12.2
LYM 13 8	12561. 1	H	16.1 27	4.40E02	63.9	LYM 11 1	12254. 3	E	8.62 5	1.71E01	8
LYM28 9	12493. 6	H	11.2 2	6.44E02	14	LYM 10 0	12134. 1	E	8.43 8	1.72E01	5.7
LYM26 8	12483. 2	H	12.0 16	8.02E02	22.1	LYM 14	12051. 4	E	8.43 8	1.72E01	5.7
LYM 10 2	12221. 1	H	11.1 37	8.39E02	13.2	LYM68	11942. 2	E	8.43 8	1.72E01	5.7
LYM 19	11751. 5	H	13.3 1	8.63E02	35.3	LYM26 8	12482. 3	E	8.81 3	1.79E01	10.4
LYM 13	11771. 6	H	11.5 97	9.59E02	17.9	LYM 10 0	12131. 3	E	8.5	2.31E01	6.5
LYM9	11632. 2	H	11.3 93	1.03E01	15.8	LYM 10 0	12133. 3	E	8.5	2.31E01	6.5
LYM9	11632. 1	H	16.5 55	1.11E01	68.2	LYM 13 8	12566. 1	E	8.5	2.31E01	6.5
LYM1	11604. 4	H	14.5 31	1.12E01	47.7	LYM24	12061. 2	E	8.5	2.31E01	6.5
LYM 14 8	12174. 1	H	14.4 88	1.13E01	47.2	LYM26	11824. 6	E	8.5	2.31E01	6.5
LYM 14 1	12402. 4	H	14.4 02	1.20E01	46.4	LYM25 4	12472. 3	E	8.25	2.39E01	3.3
LYM 10	11742. 2	H	13.9 28	1.24E01	41.5	LYM 10 5	12293. 1	E	8.18 8	2.52E01	2.5
LYM 13 8	12562. 1	H	10.9 15	1.30E01	10.9	LYM51	11891. 1	E	8.18 8	2.52E01	2.5
LYM 19	11753. 1	H	12.6 87	1.39E01	28.9	LYM67	11781. 5	E	8.18 8	2.52E01	2.5
LYM 14 3	12521. 1	H	11.2 54	1.45E01	14.4	LYM29 0	12502. 1	E	8.75	2.56E01	9.6
LYM 13 2	12271. 4	H	12.1 4	1.46E01	23.4	LYM 14 8	12173. 1	E	9	2.70E01	12.7
LYM 11 9	12462. 2	H	17.0 13	1.48E01	72.9	LYM 11 1	12251. 1	E	8.56 3	2.76E01	7.2
LYM 17 4	12411. 2	H	14.0 25	1.60E01	42.5	LYM 11 9	12462. 1	E	8.56 3	2.76E01	7.2
LYM 11 3	12442. 1	H	10.8 41	1.67E01	10.2	LYM 15 2	12372. 1	E	8.56 3	2.76E01	7.2
LYM 15	11612. 2	H	11.8 62	1.76E01	20.5	LYM51	11893. 4	E	8.56 3	2.76E01	7.2
LYM4	11705. 2	H	11.3 3	1.76E01	15.1	LYM 15 2	12372. 2	E	8.31 3	2.80E01	4.1
LYM 19	11754. 1	H	11.7 11	1.84E01	19	LYM 17 2	12301. 2	E	8.31 3	2.80E01	4.1
LYM 12 9	12573. 5	H	10.7 42	2.00E01	9.2	LYM26 8	12483. 2	E	8.31 3	2.80E01	4.1
LYM9	11633. 7	H	12.3 18	2.07E01	25.2	LYM31	11923. 1	E	8.31 3	2.80E01	4.1
LYM2	11692. 3	H	10.8 66	2.22E01	10.4	LYM 13 8	12561. 3	E	8.81 3	2.84E01	10.4

308

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM 14 3	12524. 2	H	11.8 56	2.30E01	20.5	LYM31	11923. 4	E	8.81 3	2.84E01	10.4
LYM 13 0	12332. 2	H	13.3 97	2.34E01	36.2	LYM29 0	12504. 1	E	8.83	2.91E01	10.6
LYM 11 9	12462. 1	H	14.4 98	2.51E01	47.3	LYM62	12021. 1	E	8.62 5	3.08E01	8
LYM21	11673. 1	H	11.7 72	2.65E01	19.6	LYM 13 2	12271. 4	E	8.37 5	3.23E01	4.9
LYM 17 4	12414. 3	H	14.9 66	2.87E01	52.1	LYM 13 7	12154. 5	E	8.68 8	3.33E01	8.8
LYM 13 8	12561. 3	H	14.5 29	2.90E01	47.7	LYM68	11943. 2	E	8.68 8	3.33E01	8.8
LYM 14 1	12404. 3	H	12.2 56	2.98E01	24.6	LYM 15 2	12376. 1	E	8.43 8	3.55E01	5.7
LYM 15	11612. 3	H	13.1 03	2.99E01	33.2	LYM29 0	12502. 4	E	8.43 8	3.55E01	5.7
LYM 13 4	12311. 2	H	12.6 8	3.01E01	28.9	LYM31	11922. 3	E	8.43 8	3.55E01	5.7
LYM 15	11611. 3	H	12.5 42	3.17E01	27.5	LYM53	11844. 2	E	8.43 8	3.55E01	5.7
LYM 19	11751. 4	H	13.2 51	3.21E01	34.7	LYM 11 1	12254. 4	E	9.18 8	3.72E01	15.1
LYM 16 2	12231. 1	H	12.6 69	3.42E01	28.8	LYM 15 3	12321. 2	E	8.49 1	3.76E01	6.3
LYM28 9	12491. 4	H	11.3 87	3.46E01	15.7	LYM 15 2	12371. 2	E	8.56 3	3.96E01	7.2
LYM 17	11684. 5	H	10.5 15	3.52E01	6.9	LYM 10 5	12295. 2	E	8.62 5	4.09E01	8
LYM 15 2	12371. 2	H	12.3 07	3.54E01	25.1	LYM30	11912. 6	E	8.31 3	4.71E01	4.1
LYM21	11671. 2	H	12.0 4	3.73E01	22.4	LYM51	11892. 1	E	8.31 3	4.71E01	4.1
LYM29 0	12501. 3	H	11.4 64	3.76E01	16.5	LYM57	12012. 2	E	8.31 3	4.71E01	4.1
LYM 16	11624. 4	H	10.4 69	3.83E01	6.4	LYM 13 8	12562. 1	E	8.18 8	4.71E01	2.5
LYM 14 1	12404. 4	H	12.4 83	3.95E01	26.9	LYM 14 0	12261. 4	E	8.18 8	4.71E01	2.5
LYM28 9	12491. 1	H	13.3 58	3.97E01	35.8	LYM 16 2	12231. 1	E	8.18 8	4.71E01	2.5
LYM 17	11683. 1	H	10.4 48	4.15E01	6.2	LYM 14 0	12262. 3	E	8.37 5	4.75E01	4.9
LYM 14 8	12173. 1	H	12.8 42	4.17E01	30.5	LYM 14 8	12171. 2	E	8.5	4.82E01	6.5
LYM 16 2	12234. 4	H	14.1 45	4.21E01	43.7	LYM30	11912. 7	E	8.56 3	4.85E01	7.2
LYM 13	11772. 1	H	10.8 15	4.47E01	9.9	LYM26 8	12481. 1	E	8.62 5	4.87E01	8
LYM 17 4	12411. 3	H	11.9 25	4.47E01	21.2	LYM 10 0	12133. 1	E	8.12 5	5.09E01	1.8
LYM26 8	12483. 4	H	11.4 76	4.61E01	16.6	LYM 13 7	12152. 1	E	8.12 5	5.09E01	1.8

309

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM 17 4	12412. 1	H	11.5 03	4.65E01	16.9	LYM 14	12052. 5	E	8.12 5	5.09E01	1.8
LYM 10 2	12222. 3	H	12.8 38	4.66E01	30.5	LYM26	11824. 5	E	8.12 5	5.09E01	1.8
LYM 11 1	12251. 1	H	11.9 87	4.83E01	21.8	LYM 13 2	12275. 1	E	8.56 3	5.52E01	7.2
LYM21	11672. 4	H	11.7 25	4.84E01	19.2	LYM53	11842. 4	E	8.5	5.58E01	6.5
LYM26 8	12482. 3	H	10.7 87	4.91E01	9.6	LYM57	12012. 6	E	8.25	6.05E01	3.3
LYM 17 4	12414. 2	H	10.2 74	5.09E01	4.4	LYM69	11853. 4	E	8.5	6.15E- 01	6.5
LYM 10	11744. 5	H	11.5 27	5.13E- 01	17.1	LYM 13 2	12276. 1	E	8.24 1	6.23E01	3.2
LYM29 0	12502. 4	H	11.7 49	5.22E01	19.4	LYM 10 5	12294. 3	E	8.18 8	6.34E01	2.5
LYM 17	11682. 1	H	12.2 86	5.68E01	24.9	LYM69	11852. 4	E	8.18 8	6.34E01	2.5
LYM 10 5	12294. 2	H	12.2 91	6.34E01	24.9	LYM95	12124. 5	E	8.06 3	6.47E01	1
LYM 13 7	12153. 1	H	10.9 38	6.48E01	11.2	LYM95	12124. 6	E	8.12 5	6.82E01	1.8
LYM 17	11681. 4	H	10.4 05	6.58E01	5.7	LYM43	11793. 2	E	8.43 8	7.13E- 01	5.7
LYM 10	11742. 1	H	11.3 48	7.13E- 01	15.3	LYM 13 0	12332. 1	E	8.37 5	7.33E01	4.9
LYM 11 1	12252. 2	H	11.4 94	7.14E- 01	16.8	LYM 14 0	12261. 1	E	8.25	7.45E01	3.3
LYM 10 0	12131. 3	H	10.8 07	7.19E01	9.8	LYM67	11782. 6	E	8.06 3	7.71E01	1
LYM 14 0	12261. 4	H	10.2 94	7.56E01	4.6	LYM 14	12051. 1	E	8.12 5	7.75E01	1.8
LYM9	11633. 2	H	10.5 62	7.61E- 01	7.3	LYM25 4	12474. 4	E	8.18 8	7.80E01	2.5
LYM 16 2	12233. 2	H	10.5 24	7.66E01	6.9	LYM26 8	12482. 1	E	8.25 9	8.09E01	3.4
LYM 13 2	12275. 1	H	10.0 29	7.80E01	1.9	LYM69	11854. 2	E	8.10 7	8.10E- 01	1.5
LYM 14 8	12172. 1	H	10.7 95	8.12E- 01	9.7	LYM 13 0	12333. 1	E	8.06 3	8.49E01	1
LYM26 8	12482. 1	H	10.4 8	8.16E- 01	6.5	LYM 13 8	12564. 1	E	8.06 3	8.49E01	1
LYM29 0	12502. 1	H	10.4 11	8.38E01	5.8	LYM 17 0	12452. 3	E	8.06 3	8.49E01	1
LYM22	11762. 1	H	10.1 61	8.39E01	3.3	LYM 13 4	12311. 2	E	8.12 5	8.60E01	1.8
LYM1	11601. 1	H	10.2 4	8.44E01	4.1	LYM62	12022. 2	E	8.12 5	8.60E01	1.8
LYM2	11693. 3	H	10.0 26	8.49E01	1.9	LYM66	11954. 4	E	8.12 5	8.82E01	1.8
LYM 14 3	12521. 2	H	9.99 5	9.08E01	1.6	LYM3	12043. 1	E	8.06 3	9.13E01	1

310

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM 13	11771. 9	H	9.91 8	9.11E01	0.8	LYM 15 2	12373. 1	E	8	9.40E01	0.2
LYM29 0	12504. 1	H	10.0 34	9.18E01	2	LYM 15 3	12322. 1	E	8	9.63E01	0.2
LYM 14 3	12523. 4	H	10.0 41	9.29E01	2	LYM31	11924. 4	E	8	9.80E01	0.2
LYM 10 2	12222. 6	H	10.0 68	9.54E01	2.3	CONTR OL	—	E	7.98 4	—	0
LYM 11 1	12254. 4	H	9.86 5	9.76E01	0.3	LYM 13 7	12151. 1	F	0.63 6	3.25E04	50
CONTR OL	—	H	9.84	—	0	LYM57	12013. 5	F	0.60 5	7.25E04	42.7
LYM1	11602. 6	J	0.05	2.90E05	82.4	LYM 13 4	12314. 2	F	0.60 5	7.28E04	42.7
LYM 10	11741. 2	J	0.04 7	2.61E04	69.6	LYM 13 8	12561. 3	F	0.60 3	8.37E04	42.2
LYM 14 8	12171. 2	J	0.04 4	1.16E- 03	57.9	LYM51	11893. 2	F	0.60 7	1.97E03	43
LYM 14 3	12524. 7	J	0.04 3	1.72E- 03	56	LYM26 8	12482. 3	F	0.57 6	2.18E03	35.7
LYM 11 9	12462. 2	J	0.04 4	2.18E03	60.3	LYM68	11942. 3	F	0.57	2.74E03	34.3
LYM9	11632. 1	J	0.04 2	3.46E03	51.9	LYM 14 8	12174. 1	F	0.79 5	3.37E03	87.5
LYM 13 8	12561. 1	J	0.03 9	1.28E02	42.5	LYM29 0	12502. 4	F	0.56 3	3.59E03	32.8
LYM1	11604. 4	J	0.03 9	1.45E02	41.6	LYM69	11853. 5	F	0.63	4.12E03	48.5
LYM1	11602. 1	J	0.03 9	1.68E02	41.3	LYM68	11941. 3	F	0.67 6	4.18E03	59.3
LYM 13 8	12561. 3	J	0.03 8	2.14E02	39.2	LYM 13 7	12153. 1	F	0.54 4	7.80E03	28.2
LYM28 9	12493. 2	J	0.03 8	3.13E- 02	38	LYM 13 7	12154. 5	F	0.58 4	1.03E- 02	37.8
LYM 10	11742. 2	J	0.03 8	3.37E02	35.8	LYM 14 3	12521. 2	F	0.54 1	1.35E02	27.5
LYM 17 4	12414. 3	J	0.03 8	3.60E02	37.6	LYM43	11791. 5	F	0.55 2	1.40E02	30.2
LYM 16 2	12234. 4	J	0.03 9	3.75E02	39.7	LYM30	11913. 4	F	0.57 8	1.86E02	36.3
LYM 13 0	12333. 1	J	0.03 7	4.04E02	34.6	LYM30	11913. 5	F	0.53 7	1.99E02	26.7
LYM 10 2	12222. 2	J	0.03 7	4.21E02	33.3	LYM29 0	12501. 3	F	0.51 6	2.54E02	21.7
LYM 17 4	12411. 2	J	0.03 7	4.72E02	33.9	LYM53	11841. 1	F	0.63 2	2.58E02	49.1
LYM 16 2	12234. 3	J	0.03 7	4.72E02	34	LYM 17 0	12453. 2	F	0.51 1	3.14E- 02	20.5
LYM 15	11614. 3	J	0.03 7	4.86E02	32.3	LYM 14 0	12264. 1	F	0.50 8	3.58E02	19.9
LYM 14 8	12174. 1	J	0.03 6	5.71E- 02	30.8	LYM30	11913. 3	F	0.51 3	4.45E02	20.9

311

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM 10 5	12293. 1	J	0.03 6	5.84E02	31.5	LYM 10 5	12297. 1	F	0.50 3	4.63E02	18.6
LYM 14 0	12262. 3	J	0.03 6	6.17E02	30	LYM62	12022. 1	F	0.50 1	5.09E02	18.2
LYM 11 9	12462. 1	J	0.03 6	6.65E02	30.3	LYM31	11923. 4	F	0.57 4	5.51E02	35.4
LYM 10	11744. 1	J	0.03 6	7.19E02	29.9	LYM68	11943. 2	F	0.60 4	5.83E02	42.4
LYM 19	11751. 5	J	0.03 6	7.62E02	29.3	LYM 15 2	12372. 2	F	0.51 7	5.83E02	21.9
LYM 14 1	12402. 4	J	0.03 6	7.71E02	30.2	LYM 10 5	12295. 2	F	0.55 2	6.04E02	30.1
LYM 15 2	12372. 2	J	0.03 5	9.41E02	27.8	LYM 13 7	12152. 1	F	0.50 4	6.15E02	18.8
LYM 13 4	12311. 2	J	0.03 6	9.65E02	28.5	LYM 13 8	12561. 1	F	0.64 4	7.28E02	51.8
LYM 19	11751. 4	J	0.03 6	9.82E02	28.8	LYM62	12021. 1	F	0.50 4	8.04E02	18.8
LYM 15	11611. 3	J	0.03 6	1.02E01	30.1	LYM30	11912. 6	F	0.52 1	9.04E02	22.9
LYM 16 2	12231. 3	J	0.03 5	1.13E01	25.7	LYM 11 1	12252. 2	F	0.81 7	9.40E02	92.5
LYM 15	11612. 3	J	0.03 5	1.21E01	26.5	LYM 11 9	12462. 2	F	0.51 3	9.81E02	21
LYM 14 8	12173. 1	J	0.03 5	1.32E01	26.4	LYM29 0	12502. 2	F	0.52 4	1.07E01	23.6
LYM1	11603. 2	J	0.03 4	1.32E01	24.2	LYM 10 0	12131. 2	F	0.57 5	1.17E01	35.6
LYM 17	11684. 4	J	0.03 4	1.34E01	24	LYM 14	12051. 1	F	0.48 8	1.25E01	15.1
LYM 17 4	12412. 1	J	0.03 5	1.37E01	26.8	LYM29 0	12502. 1	F	0.48	1.39E01	13.1
LYM 16 2	12231. 1	J	0.03 4	1.41E01	24.4	LYM 14 3	12524. 2	F	0.59 4	1.41E01	40
LYM 13 2	12273. 2	J	0.03 4	1.52E01	22.6	LYM 13 8	12562. 1	F	0.51 2	1.65E01	20.7
LYM 13 2	12271. 4	J	0.03 4	1.55E01	23.2	LYM 13 8	12564. 1	F	0.47 2	1.84E01	11.3
LYM4	11705. 2	J	0.03 4	1.60E01	23.1	LYM 17 2	12301. 2	F	0.51 1	1.88E01	20.4
LYM 19	11753. 1	J	0.03 4	1.68E01	21.9	LYM 15 2	12376. 1	F	0.52 8	1.96E01	24.5
LYM 11 9	12461. 4	J	0.03 4	1.68E01	22.2	LYM 14	12052. 4	F	0.53 2	1.98E01	25.5
LYM28 9	12491. 1	J	0.03 4	1.81E01	21.7	LYM 11 9	12462. 1	F	0.56 7	2.22E01	33.7
LYM 11 9	12463. 2	J	0.03 4	1.84E01	21.5	LYM 10 0	12134. 1	F	0.50 8	2.22E01	19.7
LYM 14 1	12404. 3	J	0.03 3	2.00E01	21	LYM 10 5	12294. 3	F	0.51 6	2.28E01	21.6
LYM 13 0	12332. 2	J	0.03 4	2.03E01	21.2	LYM 13 2	12271. 4	F	0.5	2.30E01	17.9

312

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM 14 1	12404. 4	J	0.03 3	2.07E01	20.4	LYM51	11891. 1	F	0.47 1	2.32E01	11
LYM4	11706. 5	J	0.03 3	2.13E01	19.8	LYM67	11783. 5	F	0.54 1	2.36E01	27.6
LYM9	11633. 7	J	0.03 3	2.16E01	21	LYM26	11824. 6	F	0.51 6	2.42E01	21.6
LYM 15 2	12371. 2	J	0.03 3	2.34E01	19.7	LYM26 8	12481. 1	F	0.52 2	2.44E01	23
LYM 17	11682. 1	J	0.03 3	2.45E01	20.4	LYM 14	12051. 4	F	0.46 7	2.48E01	10.2
LYM21	11673. 1	J	0.03 3	2.57E01	18.1	LYM 14 8	12171. 2	F	0.46 8	2.60E01	10.4
LYM21	11672. 4	J	0.03 3	2.70E01	18.7	LYM 13 0	12332. 2	F	0.46 6	2.86E01	9.9
LYM 15	11612. 2	J	0.03 2	2.77E01	17.4	LYM 10 0	12133. 3	F	0.47 4	2.88E01	11.8
LYM9	11632. 2	J	0.03 2	2.83E01	17.2	LYM53	11844. 2	F	0.52 2	3.01E- 01	23.1
LYM 14 3	12521. 1	J	0.03 2	2.83E01	17.1	LYM51	11893. 4	F	0.61 5	3.06E01	45.1
LYM 14 3	12524. 2	J	0.03 2	2.84E01	17.3	LYM 15 2	12372. 1	F	0.62 5	3.14E- 01	47.3
LYM 10 2	12222. 3	J	0.03 3	2.90E01	18.6	LYM 11 1	12251. 1	F	0.46 8	3.26E01	10.4
LYM 10	11744. 5	J	0.03 2	3.16E- 01	16.9	LYM 16 2	12231. 3	F	0.47	3.29E01	10.8
LYM 13	11771. 6	J	0.03 2	3.27E01	16.2	LYM 11 9	12461. 1	F	0.64 9	3.29E01	52.9
LYM 11 1	12251. 1	J	0.03 2	3.47E01	16.1	LYM 14 3	12524. 7	F	0.58 3	3.35E01	37.3
LYM 10 5	12294. 2	J	0.03 2	3.57E01	17.1	LYM 13 0	12331. 3	F	0.48	3.48E01	13.2
LYM 17 4	12411. 3	J	0.03 2	3.66E01	14.4	LYM 13 0	12334. 1	F	0.47 6	3.58E01	12.3
LYM 19	11754. 1	J	0.03 2	3.67E01	14.1	LYM 13 2	12275. 1	F	0.45 6	3.63E01	7.5
LYM26 8	12483. 2	J	0.03 1	3.73E01	13.8	LYM 11 1	12254. 4	F	0.55 3	3.74E01	30.4
LYM26 8	12483. 4	J	0.03 2	3.80E01	15	LYM 11 1	12254. 3	F	0.60 3	3.81E- 01	42.1
LYM29 0	12502. 4	J	0.03 2	3.97E01	14.2	LYM 14 8	12173. 1	F	0.51 3	4.04E01	20.9
LYM28 9	12493. 6	J	0.03 1	4.46E01	11.8	LYM68	11942. 2	F	0.48 9	4.14E01	15.3
LYM 14 1	12404. 2	J	0.03 1	4.48E01	12.2	LYM57	12012. 2	F	0.46 2	4.14E01	9
LYM 13	11772. 1	J	0.03 1	4.52E01	12.1	LYM57	12012. 6	F	0.46 2	4.28E01	9
LYM21	11671. 2	J	0.03 1	4.72E01	11.1	LYM 10 0	12131. 3	F	0.48 2	4.31E01	13.6
LYM 12 9	12573. 5	J	0.03 1	4.89E01	10.8	LYM 15 3	12321. 2	F	0.50 7	4.37E01	19.5

313

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM 17	11681. 4	J	0.03 1	4.90E01	10.8	LYM 16 2	12234. 3	F	0.45 6	4.41E01	7.6
LYM 14 3	12521. 2	J	0.03	5.23E01	10.1	LYM24	12061. 2	F	0.51 5	4.44E01	21.5
LYM 14 8	12172. 1	J	0.03 1	5.23E01	11.5	LYM 13 4	12312. 4	F	0.46 7	4.57E01	10.2
LYM28 9	12491. 4	J	0.03	5.61E01	9.4	LYM68	11941. 4	F	0.46 5	4.72E01	9.6
LYM 10 0	12133. 1	J	0.03	5.63E01	9	LYM30	11912. 7	F	0.48 5	4.92E01	14.2
LYM 10 2	12221. 1	J	0.03	5.66E01	9.1	LYM 13 2	12276. 1	F	0.51 3	4.98E01	21
LYM 10 0	12131. 3	J	0.03	5.87E01	9.1	LYM95	12124. 4	F	0.45 4	5.03E01	7.1
LYM2	11692. 3	J	0.03	5.92E01	8.4	LYM 14 8	12174. 2	F	0.46 7	5.95E01	10.2
LYM 16	11624. 4	J	0.03	6.06E01	8	LYM43	11791. 4	F	0.48 8	5.95E01	15.1
LYM29 0	12501. 3	J	0.03	6.10E01	8.3	LYM 15 2	12371. 2	F	0.47 6	6.25E01	12.3
LYM 10	11742. 1	J	0.03	6.16E01	8.9	LYM66	11954. 4	F	0.50 1	6.29E01	18.2
LYM 13 8	12562. 1	J	0.03	6.36E01	7.3	LYM67	11781. 5	F	0.44 6	6.32E01	5.3
LYM 17	11684. 5	J	0.03	6.40E01	7.2	LYM67	11782. 6	F	0.44 2	6.43E01	4.3
LYM 11 1	12252. 2	J	0.03	6.46E01	8.2	LYM 14 0	12261. 1	F	0.46 5	6.49E01	9.6
LYM26 8	12482. 1	J	0.03	6.52E01	7.8	LYM 17 2	12302. 2	F	0.47 1	6.57E01	11
LYM 17	11683. 1	J	0.02 9	6.68E01	6.6	LYM31	11922. 3	F	0.47	6.61E01	10.8
LYM1	11601. 1	J	0.02 9	6.76E01	6.7	LYM 14	12052. 5	F	0.43 9	6.69E01	3.4
LYM 13 7	12153. 1	J	0.02 9	6.95E01	6.6	LYM51	11894. 2	F	0.44	6.79E01	3.7
LYM 16 2	12233. 2	J	0.02 9	6.97E01	6.4	LYM 17 0	12452. 3	F	0.44 1	6.91E01	3.9
LYM26 8	12482. 3	J	0.02 9	7.03E01	6	LYM 15 3	12322. 1	F	0.48 5	6.92E01	14.4
LYM 13 0	12334. 1	J	0.02 9	7.32E01	5.2	LYM62	12022. 2	F	0.46 4	7.01E01	9.4
LYM22	11762. 1	J	0.02 9	8.38E01	3.2	LYM 10 5	12293. 1	F	0.44 8	7.04E01	5.7
LYM 14 0	12261. 4	J	0.02 8	8.73E01	2.6	LYM31	11923. 1	F	0.45 1	7.09E01	6.4
LYM 14 3	12523. 4	J	0.02 8	9.21E01	1.6	LYM69	11854. 2	F	0.44 7	7.13E01	5.5
LYM 11 1	12254. 4	J	0.02 8	9.41E01	1.1	LYM26 8	12482. 1	F	0.48 6	7.27E01	14.5
LYM2	11693. 3	J	0.02 8	9.79E01	0.4	LYM 11 9	12461. 4	F	0.44 4	7.34E01	4.8

314

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM10 2	12222. 6	J	0.02 8	9.79E01	0.5	LYM26 8	12483. 2	F	0.46 1	7.41E- 01	8.6
LYM11 3	12442. 1	J	0.02 8	9.82E01	0.4	LYM11 1	12251. 3	F	0.45 2	7.42E01	6.5
CONTR OL	—	J	0.02 8	—	0	LYM16 2	12231. 1	F	0.45	7.55E01	6.2
LYM11 9	12462. 2	K	0.62 7	1.12E02	31.8	LYM10 0	12133. 1	F	0.44 6	7.57E01	5.3
LYM14 8	12174. 1	K	0.61 7	2.05E02	29.8	LYM26	11824. 5	F	0.44 2	7.76E01	4.1
LYM26 8	12483. 2	K	0.60 7	2.07E02	27.7	LYM15 2	12373. 1	F	0.46	7.98E01	8.4
LYM26 8	12482. 3	K	0.61 2	2.74E02	28.6	LYM69	11853. 4	F	0.45 5	8.07E01	7.3
LYM10 2	12222. 6	K	0.61 6	3.04E02	29.6	LYM25 4	12474. 4	F	0.46 6	8.11E- 01	9.9
LYM4	11706. 5	K	0.60 3	3.66E02	26.7	LYM17 2	12301. 3	F	0.43 9	8.30E01	3.6
LYM10 2	12222. 2	K	0.60 8	4.08E02	27.9	LYM95	12124. 5	F	0.43	8.69E01	1.4
LYM14 3	12524. 7	K	0.61 4	4.15E02	29.2	LYM13 0	12333. 1	F	0.43 8	8.73E01	3.2
LYM15	11611. 3	K	0.59	4.46E02	24.1	LYM14 8	12172. 1	F	0.43 1	8.75E01	1.7
LYM14 0	12261. 1	K	0.58 5	4.64E02	22.9	LYM53	11842. 4	F	0.44 9	8.83E01	5.8
LYM11 9	12461. 4	K	0.58 9	4.73E02	23.8	LYM43	11793. 2	F	0.44 6	9.06E01	5.1
LYM21	11674. 5	K	0.58 1	5.23E02	22.2	LYM14 0	12262. 3	F	0.43 3	9.11E01	2.2
LYM13 2	12271. 4	K	0.58 4	5.49E02	22.8	LYM25 4	12472. 3	F	0.42 9	9.16E01	1.1
LYM13 0	12332. 2	K	0.58 6	6.37E02	23.3	LYM13 7	12151. 2	F	0.43 6	9.21E01	2.7
LYM10 0	12131. 2	K	0.58 4	7.48E02	22.8	CONTR OL	—	F	0.42 4	—	0
LYM10 0	12133. 1	K	0.58 3	8.16E02	22.7	LYM14 8	12174. 1	G	10.5 31	6.00E05	46.2
LYM13 8	12561. 1	K	0.58 2	9.29E02	22.5	LYM10 5	12297. 1	G	9.40 6	9.40E05	30.6
LYM14 1	12402. 4	K	0.57 8	9.33E02	21.5	LYM13 7	12154. 5	G	9.27 2	1.82E- 04	28.7
LYM10	11741. 2	K	0.57 2	9.81E02	20.4	LYM29 0	12502. 1	G	9.12 1	2.85E04	26.6
LYM10	11742. 2	K	0.57 1	1.03E- 01	20	LYM13 2	12271. 4	G	8.89 9	5.40E04	23.5
LYM15 2	12372. 2	K	0.57 2	1.06E- 01	20.2	LYM11 1	12252. 2	G	8.92 3	5.44E04	23.9
LYM10 5	12293. 1	K	0.56 4	1.39E- 01	18.6	LYM29 0	12502. 2	G	8.83 2	7.44E04	22.6
LYM17	11681. 4	K	0.56 6	1.40E- 01	19.1	LYM14 3	12524. 2	G	8.77	9.08E04	21.7

315

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM 13 7	12153. 1	K	0.56 4	1.47E01	18.5	LYM26 8	12482. 3	G	8.97 3	1.05E03	24.6
LYM21	11671. 2	K	0.56 9	1.48E01	19.6	LYM67	11781. 5	G	8.53 4	2.64E03	18.5
LYM 10	11742. 1	K	0.56 4	1.50E01	18.6	LYM 13 8	12561. 1	G	10.3 11	3.08E03	43.1
LYM28 9	12491. 4	K	0.54 9	1.64E01	15.5	LYM 13 8	12561. 3	G	9.90 1	3.55E03	37.4
LYM 15 3	12321. 2	K	0.55 3	1.68E01	16.3	LYM57	12013. 5	G	9.58 3	3.82E03	33
LYM28 9	12491. 1	K	0.57 3	1.78E01	20.5	LYM 14 3	12524. 7	G	8.42 2	3.87E03	16.9
LYM 17 4	12411. 2	K	0.56	1.82E01	17.7	LYM29 0	12501. 3	G	8.47 4	4.45E03	17.6
LYM22	11764. 1	K	0.54 7	1.85E01	15	LYM 15 3	12322. 1	G	8.56 6	4.91E03	18.9
LYM28 9	12493. 2	K	0.54 9	1.87E01	15.5	LYM67	11783. 5	G	8.89 6	8.15E03	23.5
LYM 10 6	12142. 2	K	0.54 7	1.97E01	15	LYM 14 0	12261. 1	G	8.62 4	9.34E03	19.7
LYM 17 4	12412. 1	K	0.55 7	2.01E01	17.2	LYM43	11791. 5	G	8.22 7	1.13E02	14.2
LYM 17 4	12414. 2	K	0.54 9	2.07E01	15.5	LYM26 8	12483. 2	G	8.17 3	1.25E02	13.4
LYM 10 5	12297. 1	K	0.55	2.08E01	15.6	LYM 11 1	12251. 1	G	8.20 6	1.25E02	13.9
LYM 15 2	12373. 1	K	0.54 2	2.24E01	14	LYM 10 0	12134. 1	G	8.49 3	1.46E02	17.9
LYM22	11764. 7	K	0.54 5	2.25E01	14.5	LYM30	11913. 5	G	9.10 6	1.46E02	26.4
LYM 11 9	12462. 1	K	0.55 5	2.28E01	16.8	LYM 13 4	12311. 2	G	8.00 5	2.81E02	11.1
LYM1	11602. 6	K	0.56 1	2.30E01	18	LYM 13 0	12334. 1	G	8.53 9	3.38E02	18.5
LYM 13 0	12334. 1	K	0.55 9	2.36E01	17.5	LYM 16 2	12231. 1	G	9.30 8	3.90E02	29.2
LYM 13 8	12564. 1	K	0.54 6	2.43E01	14.8	LYM30	11912. 7	G	7.96 2	4.08E02	10.5
LYM26 8	12481. 1	K	0.53 6	2.59E01	12.6	LYM68	11941. 3	G	10.2 35	4.13E02	42.1
LYM3	12041. 2	K	0.55 1	2.68E01	15.9	LYM 10 0	12133. 1	G	8.26 4	5.83E02	14.7
LYM 10 2	12222. 3	K	0.54 6	2.81E01	14.8	LYM 15 3	12324. 1	G	9.05 9	5.91E02	25.7
LYM 16 2	12234. 3	K	0.54 1	2.97E01	13.9	LYM 10 0	12131. 3	G	7.84 5	6.29E02	8.9
LYM 16 2	12234. 4	K	0.54	3.06E01	13.6	LYM26 8	12483. 4	G	8.17 6	6.43E02	13.5
LYM 14 8	12173. 1	K	0.54 7	3.18E01	15.1	LYM31	11923. 4	G	8.75	7.07E02	21.5
LYM29 0	12501. 3	K	0.53 3	3.19E01	12	LYM57	12012. 2	G	8.17 4	8.06E02	13.5

316

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM9	11632. 1	K	0.53 7	3.25E01	13	LYM17 4	12411. 3	G	9.04 6	8.44E02	25.6
LYM11 3	12442. 1	K	0.52 7	3.29E01	10.9	LYM53	11843. 2	G	7.79 6	8.61E02	8.2
LYM19	11754. 1	K	0.52 7	3.47E01	10.8	LYM13 7	12151. 1	G	10.0 24	8.70E02	39.1
LYM11 1	12251. 1	K	0.53 2	3.60E01	11.9	LYM11 1	12254. 3	G	8.78 6	9.05E02	22
LYM11 9	12463. 2	K	0.53 3	3.81E- 01	12.1	LYM95	12121. 2	G	7.75 2	1.05E01	7.6
LYM15	11614. 3	K	0.52 5	3.92E01	10.4	LYM16 2	12234. 4	G	8.33 7	1.12E01	15.7
LYM14 0	12264. 1	K	0.52 4	3.93E01	10.2	LYM30	11913. 3	G	8.02 4	1.18E01	11.4
LYM19	11753. 1	K	0.52 3	4.08E01	10	LYM10 5	12295. 2	G	8.79 8	1.36E01	22.1
LYM14 1	12404. 3	K	0.52 5	4.11E01	10.3	LYM3	12042. 1	G	7.69 7	1.37E- 01	6.8
LYM10	11744. 1	K	0.52 2	4.16E01	9.8	LYM13 2	12275. 1	G	7.68 6	1.44E01	6.7
LYM13 0	12331. 3	K	0.52 3	4.27E01	9.9	LYM68	11942. 2	G	8.30 5	1.48E01	15.3
LYM28 9	12493. 6	K	0.51 9	4.34E01	9.2	LYM13 7	12152. 1	G	8.27 8	1.51E01	14.9
LYM19	11752. 2	K	0.53 2	4.41E01	11.8	LYM15 2	12372. 1	G	9.36 1	1.57E- 01	29.9
LYM13 8	12562. 1	K	0.51 9	4.60E01	9.2	LYM26 8	12482. 1	G	9.01 1	1.64E01	25.1
LYM29 0	12502. 4	K	0.51 9	4.61E01	9.1	LYM13 4	12314. 2	G	9.93 5	1.83E01	37.9
LYM10 5	12294. 3	K	0.51 8	5.00E01	8.9	LYM16 2	12231. 3	G	8.42 8	1.87E- 01	17
LYM1	11603. 2	K	0.51 5	5.19E- 01	8.3	LYM66	11952. 1	G	8.19 4	1.92E- 01	13.7
LYM17 4	12414. 3	K	0.51 3	5.33E01	7.8	LYM66	11954. 4	G	8.63 1	2.06E01	19.8
LYM17	11682. 1	K	0.51 5	5.34E01	8.2	LYM43	11791. 4	G	8.57 4	2.13E01	19
LYM29 0	12502. 2	K	0.52 1	5.41E- 01	9.6	LYM26	11824. 6	G	8.67	2.15E01	20.3
LYM14 1	12404. 4	K	0.51 4	5.48E01	8.1	LYM31	11921. 3	G	8.12 7	2.23E01	12.8
LYM3	12041. 1	K	0.50 8	5.57E01	6.9	LYM14 8	12174. 2	G	9.02 6	2.26E01	25.3
LYM26 8	12482. 1	K	0.50 6	5.59E01	6.5	LYM11 1	12251. 3	G	8.39 6	2.31E01	16.5
LYM16 2	12233. 2	K	0.50 6	5.75E01	6.4	LYM24	12062. 3	G	8.37 8	2.38E01	16.3
LYM15 2	12371. 3	K	0.50 7	5.75E01	6.6	LYM13 7	12151. 2	G	7.63 7	2.41E01	6
LYM16 2	12231. 1	K	0.51 3	5.85E01	7.8	LYM11 1	12254. 4	G	8.57 1	2.44E01	19

317

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM15 2	12371. 2	K	0.50 5	5.88E01	6.2	LYM68	11942. 3	G	7.98 9	2.45E01	10.9
LYM10 6	12141. 4	K	0.50 5	5.96E01	6.1	LYM15 3	12323. 2	G	7.58 8	2.51E01	5.3
LYM15	11612. 3	K	0.50 6	6.17E01	6.4	LYM13 8	12564. 1	G	8.79 9	2.53E01	22.1
LYM10 5	12297. 2	K	0.50 7	6.20E01	6.5	LYM67	11782. 6	G	7.56 3	2.57E01	5
LYM10 5	12294. 2	K	0.50 5	6.39E01	6.1	LYM68	11943. 2	G	8.64 9	2.60E01	20.1
LYM21	11672. 4	K	0.50 4	6.50E01	5.9	LYM62	12022. 1	G	8.78 1	2.63E01	21.9
LYM1	11604. 4	K	0.5	6.53E01	5.1	LYM14	12051. 1	G	7.58 7	2.72E01	5.3
LYM15	11612. 2	K	0.50 2	6.56E01	5.6	LYM13 8	12562. 1	G	8.86 2	2.79E01	23
LYM14 1	12404. 2	K	0.50 1	6.61E01	5.3	LYM15 2	12376. 1	G	7.95 2	2.80E01	10.4
LYM17	11684. 4	K	0.50 2	6.69E01	5.5	LYM26	11821. 2	G	7.54 4	2.80E01	4.7
LYM19	11751. 4	K	0.50 4	6.71E01	5.9	LYM10 5	12294. 3	G	8.88 5	2.83E01	23.3
LYM10	11744. 5	K	0.49 8	6.80E01	4.8	LYM26	11824. 5	G	7.68 2	2.83E01	6.6
LYM4	11706. 3	K	0.49 6	6.93E01	4.4	LYM10 0	12131. 2	G	7.59 6	2.88E01	5.4
LYM13 2	12275. 1	K	0.49 8	7.10E01	4.8	LYM13 7	12153. 1	G	9.25 6	2.90E01	28.5
LYM11 3	12444. 4	K	0.49 4	7.42E01	3.8	LYM51	11891. 1	G	7.81	2.91E01	8.4
LYM12 9	12573. 5	K	0.49 4	7.44E01	3.8	LYM69	11853. 5	G	8.64 3	2.92E01	20
LYM13	11773. 2	K	0.49 2	7.46E01	3.5	LYM51	11893. 4	G	9.29 8	2.98E01	29.1
LYM13 0	12333. 1	K	0.49 5	7.48E01	4	LYM62	12022. 2	G	8.81 4	3.09E01	22.3
LYM16	11624. 4	K	0.49 2	7.53E01	3.4	LYM11 9	12462. 1	G	7.62 6	3.21E01	5.8
LYM14 3	12521. 1	K	0.49 4	7.62E01	3.8	LYM17 2	12301. 2	G	8.25	3.22E01	14.5
LYM12 9	12571. 3	K	0.49 3	7.92E01	3.7	LYM14 3	12521. 2	G	9.22 8	3.24E01	28.1
LYM13	11772. 2	K	0.48 8	8.40E01	2.6	LYM31	11924. 4	G	8.26 9	3.35E01	14.8
LYM9	11633. 2	K	0.48 6	8.54E01	2.2	LYM14	12052. 5	G	8.09 1	3.45E01	12.3
LYM29 0	12502. 1	K	0.48 7	8.54E01	2.4	LYM62	12021. 1	G	8.69 5	3.46E01	20.7
LYM9	11634. 5	K	0.48 4	8.82E01	1.7	LYM53	11841. 1	G	9.04 5	3.63E01	25.6
LYM10 6	12144. 4	K	0.48 4	8.84E01	1.8	LYM67	11782. 5	G	7.53 4	3.65E01	4.6

318

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM17 4	12411. 3	K	0.48 5	8.98E01	1.9	LYM11 9	12461. 1	G	8.65 5	3.72E01	20.1
LYM26 8	12483. 4	K	0.48 2	9.01E01	1.5	LYM30	11912. 6	G	7.91	3.80E01	9.8
LYM12 9	12572. 2	K	0.48 1	9.19E01	1.2	LYM30	11913. 4	G	14.9 39	3.98E01	107.4
LYM13 4	12311. 2	K	0.48	9.39E01	0.9	LYM25 4	12471. 2	G	8.13 6	4.05E01	12.9
LYM9	11633. 7	K	0.48	9.41E01	0.8	LYM24	12061. 2	G	8.90 5	4.08E01	23.6
LYM13	11771. 9	K	0.47 9	9.49E01	0.7	LYM53	11844. 2	G	8.51 6	4.19E01	18.2
LYM13 7	12151. 1	K	0.47 9	9.51E01	0.7	LYM13 0	12333. 1	G	8.44	4.29E01	17.1
LYM13 4	12312. 3	K	0.47 8	9.61E01	0.6	LYM51	11893. 2	G	8.6	4.35E01	19.4
LYM16 2	12231. 3	K	0.47 8	9.64E01	0.6	LYM51	11892. 1	G	8.00 7	4.43E01	11.1
LYM2	11693. 3	K	0.47 7	9.81E01	0.3	LYM26	11824. 3	G	7.46 7	4.44E01	3.6
CONTR OL	—	K	0.47 6	—	0	LYM14 8	12173. 1	G	7.90 9	4.46E01	9.8
LYM1	11602. 6	L	2.50 7	2.00E05	100.5	LYM62	12023. 4	G	7.50 5	4.48E01	4.2
LYM10	11741. 2	L	2.40 5	3.80E05	92.3	LYM17 0	12453. 3	G	8.37 8	4.85E01	16.3
LYM11 9	12462. 2	L	2.19 1	8.04E04	75.2	LYM16 2	12234. 3	G	8.24 6	4.91E01	14.5
LYM9	11632. 1	L	2.13 4	1.01E03	70.6	LYM17 0	12452. 3	G	7.89	4.91E01	9.5
LYM14 3	12524. 7	L	2.09 4	1.DEOS	67.4	LYM31	11922. 3	G	8.37 4	5.24E01	16.2
LYM14 8	12171. 2	L	2.03 3	1.84E03	62.6	LYM13 4	12313. 2	G	8.02 8	5.29E01	11.4
LYM13 8	12561. 1	L	2.04 1	2.32E03	63.2	LYM15 3	12321. 2	G	8.37 4	5.39E01	16.2
LYM17 4	12414. 3	L	1.92 1	9.20E03	53.6	LYM25 4	12472. 3	G	7.44 5	5.40E01	3.3
LYM1	11604. 4	L	1.85 3	1.20E02	48.1	LYM15 2	12371. 2	G	8.10 3	5.47E01	12.5
LYM10 2	12222. 2	L	1.84 7	1.29E02	47.7	LYM29 0	12502. 4	G	7.86 5	5.54E01	9.2
LYM13 0	12333. 1	L	1.86 8	1.31E02	49.3	LYM13 0	12332. 2	G	9.59 4	5.61E01	33.2
LYM14 8	12174. 1	L	1.84	1.45E02	47.1	LYM17 2	12302. 2	G	7.73 6	5.61E01	7.4
LYM28 9	12493. 2	L	1.86 8	1.45E02	49.3	LYM3	12041. 1	G	8.49 2	5.64E01	17.9
LYM14 1	12402. 4	L	1.84 1	1.66E02	47.2	LYM62	12022. 4	G	7.94 9	5.65E01	10.3
LYM11 9	12462. 1	L	1.84 1	1.92E02	47.2	LYM13 0	12331. 3	G	7.74 8	5.70E01	7.5

319

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM10	11742. 2	L	1.79 5	2.33E02	43.5	LYM17 4	12411. 2	G	7.83 7	5.73E01	8.8
LYM13 8	12561. 3	L	1.82 3	2.34E02	45.8	LYM13 8	12566. 1	G	7.71 6	5.76E01	7.1
LYM1	11602. 1	L	1.79 2	2.41E02	43.2	LYM14	12052. 4	G	7.77 6	5.91E01	7.9
LYM10 5	12293. 1	L	1.77 6	2.81E02	42	LYM43	11791. 2	G	8.02 5	6.07E01	11.4
LYM17 4	12411. 2	L	1.77 8	3.09E02	42.1	LYM69	11853. 4	G	7.97 7	6.13E01	10.7
LYM10	11744. 1	L	1.75 2	3.26E02	40.1	LYM68	11941. 4	G	7.69 3	6.29E01	6.8
LYM16 2	12234. 4	L	1.83 8	3.42E02	47	LYM26 8	12481. 1	G	7.84 4	6.40E01	8.9
LYM15 2	12372. 2	L	1.74 4	4.01E02	39.4	LYM43	11793. 2	G	8.08 7	6.72E01	12.3
LYM4	11706. 5	L	1.72 9	4.16E02	38.3	LYM53	11842. 4	G	8.04 9	6.85E01	11.7
LYM16 2	12234. 3	L	1.74 2	4.19E02	39.3	LYM31	11923. 1	G	7.71 3	7.10E01	7.1
LYM13 0	12332. 2	L	1.71 7	5.60E02	37.3	LYM14 8	12172. 1	G	7.51 6	7.34E01	4.3
LYM19	11751. 5	L	1.69 2	6.21E02	35.3	LYM13 2	12276. 1	G	7.88 7	7.39E01	9.5
LYM15	11614. 3	L	1.67 6	6.35E02	34	LYM10 5	12294. 2	G	7.42 7	7.63E01	3.1
LYM11 9	12463. 2	L	1.67 5	7.13E02	33.9	LYM11 9	12462. 2	G	7.29 4	7.81E01	1.2
LYM14 0	12262. 3	L	1.65 8	7.47E02	32.6	LYM53	11841. 2	G	7.54 6	7.89E01	4.7
LYM15	11612. 3	L	1.67 5	7.83E02	33.9	LYM10 0	12133. 3	G	7.31 7	7.97E01	1.6
LYM28 9	12491. 1	L	1.68 2	8.02E02	34.5	LYM51	11894. 2	G	7.29 6	8.21E01	1.3
LYM13 0	12334. 1	L	1.65 8	8.07E02	32.6	LYM11 9	12461. 4	G	7.33 6	8.46E01	1.8
LYM19	11751. 4	L	1.68 4	8.28E02	34.6	LYM95	12124. 5	G	7.47 1	8.50E01	3.7
LYM19	11753. 1	L	1.62 5	1.03E01	29.9	LYM10 5	12293. 1	G	7.46 7	8.53E01	3.6
LYM13 4	12311. 2	L	1.64	1.05E01	31.1	LYM25 4	12474. 4	G	7.73 7	8.61E01	7.4
LYM16 2	12231. 1	L	1.63 7	1.06E01	30.9	LYM25 4	12474. 3	G	7.32 1	8.99E01	1.6
LYM13 2	12273. 2	L	1.61 9	1.07E01	29.5	LYM17 0	12453. 2	G	7.23 9	9.08E01	0.5
LYM1	11603. 2	L	1.61 4	1.10E01	29	LYM17 2	12301. 3	G	7.31 9	9.09E01	1.6
LYM11 9	12461. 4	L	1.61 3	1.13E01	29	LYM17 0	12452. 4	G	7.24 9	9.33E01	0.6
LYM15	11611. 3	L	1.63 3	1.16E01	30.6	LYM69	11852. 4	G	7.22 5	9.80E01	0.3

320

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM17	11684. 4	L	1.60 9	1.17E01	28.6	LYM14	12051. 4	G	7.24 4	9.80E01	0.6
LYM14 8	12173. 1	L	1.63 9	1.21E01	31	LYM14 3	12521. 1	G	7.21 1	9.94E01	0.1
LYM14 1	12404. 4	L	1.59 5	1.46E01	27.6	CONTR OL	—	G	7.20 4	—	0
LYM10 2	12222. 3	L	1.61 5	1.50E01	29.1	LYM13 8	12561. 1	H	25.0 53	4.46E04	61.4
LYM26 8	12483. 2	L	1.56 9	1.55E01	25.5	LYM13 4	12314. 2	H	23.0 18	4.64E04	48.3
LYM16 2	12231. 3	L	1.57 2	1.57E01	25.7	LYM26 8	12482. 3	H	22.6 16	7.44E04	45.7
LYM13 2	12271. 4	L	1.57	1.71E01	25.5	LYM43	11791. 5	H	23.8 24	1.69E03	53.5
LYM15 2	12371. 2	L	1.56 8	1.80E01	25.4	LYM10 0	12131. 2	H	24.7 77	2.60E03	59.6
LYM14 1	12404. 3	L	1.56	1.82E01	24.7	LYM14 0	12264. 1	H	20.4 54	8.48E03	31.8
LYM21	11671. 2	L	1.54 8	1.95E01	23.8	LYM68	11942. 3	H	21.8 99	9.46E03	41.1
LYM9	11633. 7	L	1.55 1	1.99E01	24	LYM57	12013. 5	H	21.3 79	1.02E02	37.7
LYM17	11682. 1	L	1.57 2	2.12E01	25.7	LYM14 3	12524. 2	H	22.0 43	1.20E02	42
LYM10 5	12294. 2	L	1.58	2.17E01	26.3	LYM14 8	12174. 1	H	29.3 6	1.27E02	89.1
LYM10 0	12133. 1	L	1.52	2.30E01	21.5	LYM31	11923. 4	H	22.0 07	1.51E02	41.8
LYM15	11612. 2	L	1.52 1	2.35E01	21.6	LYM17 0	12453. 2	H	19.3 73	2.87E02	24.8
LYM11 1	12251. 1	L	1.53 3	2.43E01	22.6	LYM69	11853. 5	H	20.5 73	3.39E02	32.5
LYM14 3	12524. 2	L	1.51 5	2.44E01	21.2	LYM29 0	12502. 4	H	22.4 69	3.42E02	44.7
LYM21	11673. 1	L	1.51 6	2.45E01	21.2	LYM13 0	12331. 3	H	18.9 05	3.44E02	21.8
LYM17 4	12411. 3	L	1.51 5	2.58E01	21.1	LYM13 7	12151. 1	H	21.7 62	3.90E02	40.2
LYM29 0	12502. 4	L	1.51 7	2.60E01	21.3	LYM53	11841. 1	H	22.5 4	5.42E02	45.2
LYM21	11672. 4	L	1.50 6	2.73E01	20.4	LYM51	11893. 2	H	18.8 76	6.70E02	21.6
LYM19	11754. 1	L	1.49 1	2.79E01	19.2	LYM13 8	12561. 3	H	23.0 75	7.08E02	48.7
LYM29 0	12501. 3	L	1.48 3	3.11E01	18.6	LYM14 8	12171. 2	H	21.1 07	7.50E02	36
LYM17 4	12412. 1	L	1.48 6	3.12E01	18.8	LYM11 9	12462. 2	H	19.8 45	8.05E02	27.8
LYM10	11744. 5	L	1.47 9	3.29E01	18.2	LYM57	12012. 2	H	18.1 27	8.18E02	16.8
LYM13	11771. 6	L	1.47 6	3.30E01	18	LYM11 9	12462. 1	H	25.6 04	8.45E02	64.9

321

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM26 8	12483. 4	L	1.47 8	3.34E01	18.1	LYM14	12052. 4	H	18.1 08	9.10E02	16.7
LYM9	11632. 2	L	1.46 7	3.38E01	17.3	LYM68	11941. 3	H	21.3 83	9.75E02	37.7
LYM4	11705. 2	L	1.46 5	3.38E01	17.1	LYM43	11791. 4	H	20.1 59	1.06E- 01	29.9
LYM28 9	12491. 4	L	1.46 4	3.49E01	17	LYM13 7	12152. 1	H	17.8 11	1.18E- 01	14.7
LYM14 3	12521. 1	L	1.45 3	3.61E- 01	16.2	LYM10 5	12294. 3	H	18.8 02	1.43E- 01	21.1
LYM14 1	12404. 2	L	1.45 6	3.64E01	16.4	LYM11 1	12252. 2	H	35.5 94	1.61E- 01	129.3
LYM10	11742. 1	L	1.47 7	3.68E01	18.1	LYM30	11913. 5	H	19.9 62	1.68E- 01	28.6
LYM28 9	12493. 6	L	1.43 1	4.07E01	14.4	LYM26 8	12481. 1	H	18.4 91	1.73E- 01	19.1
LYM10 2	12221. 1	L	1.42 5	4.39E01	13.9	LYM13 0	12334. 1	H	17.4 32	1.74E- 01	12.3
LYM11 1	12252. 2	L	1.44 1	4.63E01	15.2	LYM14 8	12173. 1	H	18.3 18	1.82E- 01	18
LYM13 8	12562. 1	L	1.40 7	4.77E01	12.5	LYM68	11943. 2	H	20.4 73	1.93E- 01	31.9
LYM13 7	12153. 1	L	1.41 4	4.85E01	13.1	LYM13 7	12154. 5	H	19.4 06	2.03E01	25
LYM26 8	12482. 3	L	1.39 7	5.07E01	11.7	LYM15 2	12372. 2	H	17.7 21	2.08E01	14.2
LYM2	11692. 3	L	1.39 1	5.24E01	11.2	LYM10 0	12131. 3	H	17.3 47	2.10E01	11.7
LYM13	11772. 1	L	1.38 5	5.50E01	10.8	LYM10 5	12295. 2	H	18.6 36	2.16E01	20.1
LYM12 9	12573. 5	L	1.37	5.85E01	9.5	LYM13 0	12332. 2	H	19.3 96	2.39E01	25
LYM16 2	12233. 2	L	1.37 4	5.94E01	9.8	LYM29 0	12501. 3	H	18.1 76	2.41E01	17.1
LYM10 0	12131. 3	L	1.36 9	6.12E- 01	9.5	LYM17 2	12301. 2	H	19.4 01	2.45E01	25
LYM11 3	12442. 1	L	1.35 4	6.33E01	8.2	LYM68	11942. 2	H	18.8 4	2.53E01	21.4
LYM14 8	12172. 1	L	1.36 8	6.37E01	9.4	LYM62	12022. 1	H	18.1 31	2.65E01	16.8
LYM17	11681. 4	L	1.34 5	6.69E01	7.6	LYM57	12012. 6	H	17.8 54	2.67E01	15
LYM26 8	12482. 1	L	1.34 9	6.71E- 01	7.9	LYM11 1	12251. 3	H	19.2 31	2.86E01	23.9
LYM16	11624. 4	L	1.33 9	6.83E01	7.1	LYM11 1	12254. 4	H	19.7 09	2.89E01	27
LYM17	11684. 5	L	1.33 2	7.05E01	6.5	LYM51	11894. 2	H	17.1 23	3.01E- 01	10.3
LYM9	11633. 2	L	1.33 4	7.13E- 01	6.7	LYM30	11912. 6	H	20.5 01	3.16E- 01	32.1
LYM17 4	12414. 2	L	1.32	7.47E01	5.6	LYM53	11844. 2	H	20.1 69	3.27E01	29.9

322

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM17	11683. 1	L	1.31 3	7.74E01	5	LYM13 2	12271. 4	H	17.7 65	3.38E01	14.4
LYM29 0	12502. 1	L	1.31 3	7.90E01	5	LYM62	12021. 1	H	19.7 79	3.40E01	27.4
LYM14 0	12261. 4	L	1.30 4	8.12E01	4.2	LYM13 7	12153. 1	H	16.7 96	3.54E01	8.2
LYM1	11601. 1	L	1.30 3	8.13E01	4.2	LYM10 0	12134. 1	H	17.7 39	3.54E01	14.3
LYM10 2	12222. 6	L	1.30 8	8.19E01	4.6	LYM15 2	12376. 1	H	18.5 14	3.63E01	19.3
LYM2	11693. 3	L	1.28 9	8.60E01	3	LYM51	11893. 4	H	22.5 79	3.83E01	45.5
LYM13 2	12275. 1	L	1.28 8	8.64E01	3	LYM10 0	12133. 3	H	16.6 99	4.07E01	7.6
LYM14 3	12521. 2	L	1.28 2	8.86E01	2.5	LYM14 3	12521. 2	H	16.5 83	4.25E01	6.8
LYM22	11762. 1	L	1.28	8.94E01	2.3	LYM11 1	12254. 3	H	22.3 09	4.38E01	43.7
LYM14 3	12523. 4	L	1.27 2	9.24E01	1.7	LYM14	12051. 4	H	17.1 86	4.39E01	10.7
LYM13	11771. 9	L	1.26 2	9.58E01	0.9	LYM15 2	12372. 1	H	20.5 78	4.63E01	32.6
LYM11 1	12254. 4	L	1.26 2	9.60E01	0.9	LYM14 3	12524. 7	H	23.4 43	4.73E01	51
LYM13 8	12564. 1	L	1.25 1	1.00E +00	0	LYM13 4	12312. 4	H	16.9 24	4.79E01	9
CONTR OL	—	L	1.25 1	—	0	LYM29 0	12502. 2	H	19.0 66	4.84E01	22.8
LYM1	11602. 6	M	0.31 3	3.40E05	94.2	LYM68	11941. 4	H	16.6 57	4.90E01	7.3
LYM10	11741. 2	M	0.30 1	6.50E05	86.3	LYM11 9	12461. 1	H	23.2 76	4.91E01	49.9
LYM11 9	12462. 2	M	0.27 4	1.29E03	69.7	LYM26	11824. 6	H	17.6 42	4.94E01	13.7
LYM9	11632. 1	M	0.26 7	1.64E03	65.3	LYM13 2	12275. 1	H	16.5 39	5.07E01	6.5
LYM14 3	12524. 7	M	0.26 2	1.85E03	62.2	LYM67	11783. 5	H	17.1 09	5.29E01	10.2
LYM14 8	12171. 2	M	0.25 4	3.03E03	57.5	LYM13 2	12276. 1	H	17.0 95	5.30E01	10.1
LYM13 8	12561. 1	M	0.25 5	3.74E03	58.1	LYM11 9	12461. 4	H	16.9 19	5.75E01	9
LYM17 4	12414. 3	M	0.24	1.42E02	48.8	LYM43	11792. 2	H	17.3 89	5.90E01	12
LYM1	11604. 4	M	0.23 2	1.88E02	43.5	LYM53	11842. 4	H	18.3 13	5.93E01	18
LYM13 0	12333. 1	M	0.23 3	2.02E02	44.7	LYM30	11912. 7	H	16.9 2	6.04E01	9
LYM10 2	12222. 2	M	0.23 1	2.03E02	43.1	LYM95	12124. 4	H	16.2 55	6.19E01	4.7
LYM28 9	12493. 2	M	0.23 3	2.20E02	44.7	LYM13 8	12562. 1	H	17.0 22	6.38E01	9.7

323

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM 14 8	12174. 1	M	0.23	2.25E02	42.5	LYM30	11913. 3	H	16.5 14	6.50E01	6.4
LYM 14 1	12402. 4	M	0.23	2.54E02	42.6	LYM43	11793. 2	H	17.2 97	6.59E01	11.4
LYM 11 9	12462. 1	M	0.23	2.88E02	42.6	LYM 16 2	12231. 3	H	16.7 71	6.82E01	8
LYM 13 8	12561. 3	M	0.22 8	3.48E02	41.2	LYM67	11782. 4	H	16.2 8	6.90E01	4.9
LYM 10	11742. 2	M	0.22 4	3.55E02	39	LYM26	11824. 5	H	15.9 6	7.43E01	2.8
LYM1	11602. 1	M	0.22 4	3.66E02	38.8	LYM31	11922. 3	H	16.0 61	7.61E01	3.5
LYM 10 5	12293. 1	M	0.22 2	4.23E02	37.6	LYM 15 2	12371. 2	H	16.5 7	7.69E01	6.7
LYM 17 4	12411. 2	M	0.22 2	4.59E02	37.7	LYM69	11852. 4	H	16.0 5	7.87E01	3.4
LYM 16 2	12234. 4	M	0.23	4.82E02	42.4	LYM25 4	12474. 4	H	16.8 55	8.07E01	8.6
LYM 10	11744. 1	M	0.21 9	4.91E02	35.7	LYM 11 1	12251. 1	H	15.7 98	8.44E01	1.8
LYM 15 2	12372. 2	M	0.21 8	5.92E02	35.1	LYM 15 2	12373. 1	H	16.2 37	8.53E01	4.6
LYM 16 2	12234. 3	M	0.21 8	6.16E02	34.9	LYM26 8	12483. 2	H	16.0 6	8.84E01	3.5
LYM4	11706. 5	M	0.21 6	6.18E02	34	LYM51	11891. 1	H	15.7 1	8.91E01	1.2
LYM 15	11611. 3	M	0.22 1	7.09E02	36.8	LYM 17 2	12302. 2	H	15.7 68	9.46E01	1.6
LYM 13 0	12332. 2	M	0.21 5	8.05E02	33	LYM66	11954. 4	H	15.8 84	9.47E01	2.3
LYM 19	11751. 5	M	0.21 2	8.99E02	31.1	LYM 13 8	12564. 1	H	15.6 54	9.64E01	0.8
LYM 15	11614. 3	M	0.21	9.28E02	29.8	LYM 14 0	12262. 3	H	15.6 52	9.65E01	0.8
LYM 11 9	12463. 2	M	0.20 9	1.02E01	29.8	LYM29 0	12502. 1	H	15.5 92	9.67E01	0.4
LYM 13 2	12271. 4	M	0.20 9	1.03E01	29.8	LYM 17 0	12452. 3	H	15.5 73	9.84E01	0.3
LYM 14 0	12262. 3	M	0.20 7	1.08E01	28.5	LYM26 8	12482. 1	H	15.5 28	9.99E01	0
LYM 15	11612. 3	M	0.20 9	1.11E01	29.7	CONTR OL	—	H	15.5 23	—	0
LYM28 9	12491. 1	M	0.21	1.13E01	30.3	LYM 11 1	12252. 2	J	0.07 5	6.99E04	88
LYM 13 0	12334. 1	M	0.20 7	1.15E01	28.5	LYM 14 8	12174. 1	J	0.06	1.71E02	51.2
LYM 19	11751. 4	M	0.21	1.16E01	30.4	LYM 10 0	12131. 2	J	0.05 7	3.78E02	43.8
LYM 19	11753. 1	M	0.20 3	1.46E01	25.9	LYM 11 9	12462. 1	J	0.05 7	4.39E02	42.8
LYM 13 4	12311. 2	M	0.20 5	1.46E01	27	LYM 13 4	12314. 2	J	0.05 6	5.26E02	40.2

324

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM16 2	12231. 1	M	0.20 5	1.48E01	26.8	LYM13 8	12561. 1	J	0.05 6	5.33E02	40.8
LYM13 2	12273. 2	M	0.20 2	1.51E01	25.4	LYM53	11841. 1	J	0.05 3	1.00E01	33.8
LYM1	11603. 2	M	0.20 2	1.55E01	25	LYM11 9	12461. 1	J	0.05 5	1.12E01	39
LYM11 9	12461. 4	M	0.20 2	1.59E01	24.9	LYM43	11791. 5	J	0.05 2	1.28E01	30.7
LYM14 8	12173. 1	M	0.20 5	1.64E01	26.9	LYM14 3	12524. 2	J	0.05 2	1.29E01	30.9
LYM17	11684. 4	M	0.20 1	1.64E01	24.6	LYM13 8	12561. 3	J	0.05 2	1.37E01	31
LYM14 1	12404. 4	M	0.19 9	1.99E01	23.6	LYM26 8	12482. 3	J	0.05 2	1.50E01	29.7
LYM10 2	12222. 3	M	0.20 2	2.01E01	25.1	LYM51	11893. 4	J	0.05 2	1.68E01	31.2
LYM17 4	12412. 1	M	0.20 1	2.06E01	24.5	LYM17 0	12453. 2	J	0.05	1.80E01	26.5
LYM26 8	12483. 2	M	0.19 6	2.14E01	21.6	LYM14 8	12171. 2	J	0.05	1.84E01	25.8
LYM16 2	12231. 3	M	0.19 6	2.16E01	21.8	LYM29 0	12502. 4	J	0.05 1	1.91E01	27.3
LYM4	11705. 2	M	0.19 7	2.21E01	22.2	LYM69	11853. 5	J	0.05	1.99E01	25.8
LYM15 2	12371. 2	M	0.19 6	2.42E01	21.5	LYM14 3	12524. 7	J	0.05 2	2.03E01	30.5
LYM14 1	12404. 3	M	0.19 5	2.46E01	20.8	LYM15 2	12372. 1	J	0.05 1	2.08E01	27.9
LYM21	11671. 2	M	0.19 4	2.63E01	19.9	LYM31	11923. 4	J	0.04 9	2.30E01	23.8
LYM9	11633. 7	M	0.19 4	2.66E01	20.2	LYM62	12021. 1	J	0.04 9	2.47E01	23.5
LYM17	11682. 1	M	0.19 6	2.76E01	21.7	LYM68	11941. 3	J	0.04 9	2.49E01	22.7
LYM10 5	12294. 2	M	0.19 7	2.79E01	22.4	LYM68	11942. 3	J	0.04 9	2.51E01	22.9
LYM10 0	12133. 1	M	0.19	3.08E01	17.7	LYM30	11912. 6	J	0.04 9	2.52E01	23.6
LYM15	11612. 2	M	0.19	3.12E01	17.8	LYM13 7	12151. 1	J	0.04 9	2.56E01	23
LYM11 1	12251. 1	M	0.19 2	3.17E01	18.8	LYM11 1	12254. 3	J	0.05	2.65E01	26.4
LYM14 3	12524. 2	M	0.18 9	3.24E01	17.4	LYM13 7	12154. 5	J	0.04 9	2.67E01	22.6
LYM21	11673. 1	M	0.19	3.25E01	17.4	LYM43	11791. 4	J	0.04 7	3.56E01	18.4
LYM17 4	12411. 3	M	0.18 9	3.38E01	17.3	LYM57	12013. 5	J	0.04 7	3.61E01	17.9
LYM29 0	12502. 4	M	0.19	3.39E01	17.5	LYM53	11844. 2	J	0.04 7	3.67E01	18.8
LYM21	11672. 4	M	0.18 8	3.57E01	16.6	LYM30	11913. 5	J	0.04 7	3.74E01	18.1

325

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM19	11754. 1	M	0.18 6	3.68E01	15.5	LYM17 2	12301. 2	J	0.04 7	3.74E01	17.8
LYM29 0	12501. 3	M	0.18 5	4.02E01	14.9	LYM14 0	12264. 1	J	0.04 6	4.03E01	16.5
LYM10	11744. 5	M	0.18 5	4.23E01	14.5	LYM11 1	12251. 3	J	0.04 6	4.13E01	16.2
LYM13	11771. 6	M	0.18 4	4.24E01	14.3	LYM10 5	12294. 3	J	0.04 6	4.21E01	15.8
LYM26 8	12483. 4	M	0.18 5	4.28E01	14.5	LYM11 9	12462. 2	J	0.04 6	4.34E01	16.2
LYM9	11632. 2	M	0.18 3	4.36E01	13.6	LYM29 0	12502. 2	J	0.04 7	4.34E01	16.7
LYM28 9	12491. 4	M	0.18 3	4.48E01	13.4	LYM68	11943. 2	J	0.04 6	4.46E01	15
LYM10	11742. 1	M	0.18 5	4.60E01	14.4	LYM26 8	12481. 1	J	0.04 6	4.64E01	14.3
LYM14 3	12521. 1	M	0.18 2	4.66E01	12.6	LYM13 7	12153. 1	J	0.04 6	4.66E01	14.7
LYM14 1	12404. 2	M	0.18 2	4.66E01	12.7	LYM13 7	12152. 1	J	0.04 6	4.76E01	14.3
LYM28 9	12493. 6	M	0.17 9	5.20E01	10.9	LYM11 1	12254. 4	J	0.04 5	5.19E- 01	12.8
LYM17	11681. 4	M	0.17 9	5.21E- 01	11	LYM67	11783. 5	J	0.04 5	5.24E01	13.1
LYM10 2	12221. 1	M	0.17 8	5.52E01	10.4	LYM14	12052. 4	J	0.04 5	5.38E01	12
LYM11 1	12252. 2	M	0.18	5.64E01	11.6	LYM15 2	12376. 1	J	0.04 5	5.55E01	11.7
LYM13 8	12562. 1	M	0.17 6	5.99E01	9	LYM57	12012. 2	J	0.04 4	5.56E01	11.6
LYM13 7	12153. 1	M	0.17 7	5.99E01	9.6	LYM43	11792. 2	J	0.04 5	5.60E01	11.9
LYM26 8	12482. 3	M	0.17 5	6.31E- 01	8.3	LYM68	11942. 2	J	0.04 4	6.17E- 01	9.8
LYM2	11692. 3	M	0.17 4	6.50E01	7.8	LYM13 4	12312. 4	J	0.04 3	6.74E01	8.3
LYM13	11772. 1	M	0.17 3	6.76E01	7.3	LYM13 8	12562. 1	J	0.04 3	6.85E01	7.9
LYM12 9	12573. 5	M	0.17 1	7.18E- 01	6.1	LYM10 5	12295. 2	J	0.04 3	6.88E01	7.9
LYM16 2	12233. 2	M	0.17 2	7.20E01	6.4	LYM15 2	12372. 2	J	0.04 3	6.89E01	7.7
LYM10 0	12131. 3	M	0.17 1	7.38E01	6.1	LYM25 4	12474. 4	J	0.04 3	7.03E01	8.3
LYM14 8	12172. 1	M	0.17 1	7.57E01	6	LYM51	11893. 2	J	0.04 3	7.27E01	6.7
LYM11 3	12442. 1	M	0.16 9	7.72E01	4.9	LYM57	12012. 6	J	0.04 3	7.31E- 01	6.8
LYM26 8	12482. 1	M	0.16 9	8.03E01	4.5	LYM11 9	12461. 4	J	0.04 3	7.38E01	6.7
LYM16	11624. 4	M	0.16 7	8.24E01	3.7	LYM10 0	12134. 1	J	0.04 2	7.60E01	6

326

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM 17	11684. 5	M	0.16 7	8.48E01	3.2	LYM 13 2	12276. 1	J	0.04 2	7.61E01	5.8
LYM9	11633. 2	M	0.16 7	8.49E01	3.4	LYM29 0	12501. 3	J	0.04 2	7.65E01	5.8
LYM 17 4	12414. 2	M	0.16 5	8.92E01	2.3	LYM62	12022. 1	J	0.04 2	7.73E01	5.6
LYM 17	11683. 1	M	0.16 4	9.20E01	1.7	LYM26	11824. 6	J	0.04 2	7.80E01	5.3
LYM29 0	12502. 1	M	0.16 4	9.25E01	1.7	LYM51	11891. 1	J	0.04 2	8.08E01	4.6
LYM 10 2	12222. 6	M	0.16 3	9.46E01	1.3	LYM43	11793. 2	J	0.04 2	8.24E01	4.5
LYM 14 0	12261. 4	M	0.16 3	9.55E01	1	LYM 10 0	12131. 3	J	0.04 1	8.31E01	4
LYM1	11601. 1	M	0.16 3	9.57E01	0.9	LYM 14 3	12521. 2	J	0.04 1	8.39E01	3.9
CONTR OL	—	M	0.16 1	—	0	LYM 13 2	12275. 1	J	0.04 1	8.53E01	3.6
LYM 10	11741. 2	N	0.27 4	1.39E04	51	LYM 10 0	12133. 3	J	0.04 1	8.80E01	2.9
LYM9	11632. 1	N	0.27 2	1.71E04	49.7	LYM51	11894. 2	J	0.04 1	8.81E01	2.9
LYM1	11602. 6	N	0.27	1.78E04	48.6	LYM67	11782. 4	J	0.04 1	8.84E01	2.9
LYM 14 3	12524. 7	N	0.26 7	4.23E04	46.9	LYM 14	12051. 4	J	0.04 1	8.90E01	2.7
LYM 11 9	12462. 2	N	0.25 2	5.22E03	38.9	LYM53	11842. 4	J	0.04 1	9.19E01	2.1
LYM 10	11742. 2	N	0.23 6	1.12E02	29.9	LYM 17 2	12302. 2	J	0.04	9.57E01	1.1
LYM28 9	12493. 2	N	0.23 5	1.37E02	29.4	LYM 13 0	12331. 3	J	0.04	9.66E01	0.8
LYM 17 4	12414. 3	N	0.23 8	1.53E02	30.8	LYM26 8	12482. 1	J	0.04	9.71E01	0.7
LYM 14 8	12171. 2	N	0.23 4	1.54E02	29	LYM 13 2	12271. 4	J	0.04	9.73E01	0.7
LYM 10 5	12293. 1	N	0.23 3	1.86E02	28	LYM 16 2	12231. 3	J	0.04	9.76E01	0.6
LYM 13 8	12561. 1	N	0.23 5	1.90E02	29.3	LYM 14	12051. 1	J	0.04	9.76E01	0.6
LYM 10 2	12222. 2	N	0.23 1	2.04E02	27.3	LYM30	11912. 7	J	0.04	9.77E01	0.6
LYM 14 8	12174. 1	N	0.23	2.20E02	26.7	LYM69	11854. 2	J	0.04	9.77E01	0.5
LYM 13 0	12333. 1	N	0.23 2	2.21E02	27.5	LYM 15 2	12373. 1	J	0.04	9.81E01	0.5
LYM 16 2	12234. 3	N	0.23 1	2.61E02	27.1	LYM 14 8	12173. 1	J	0.04	9.85E01	0.4
LYM1	11604. 4	N	0.23	2.80E02	26.7	CONTR OL	—	J	0.04	—	0
LYM 15	11614. 3	N	0.22 7	3.23E02	25.2	LYM67	11783. 5	K	0.74 1	6.72E04	44.8

327

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM 15 2	12372. 2	N	0.22 8	3.31E- 02	25.6	LYM 13 2	12276. 1	K	0.69 6	1.12E02	36
LYM 16 2	12234. 4	N	0.23 6	3.39E02	30	LYM 13 8	12566. 1	K	0.65 9	1.33E02	28.9
LYM 14 1	12402. 4	N	0.22 6	4.06E02	24.5	LYM 11 9	12461. 1	K	0.67 1	1.72E02	31.2
LYM 13 4	12311. 2	N	0.22 6	4.65E02	24.2	LYM69	11853. 5	K	0.65 7	2.56E02	28.4
LYM 19	11751. 5	N	0.22 3	4.82E02	22.9	LYM 13 7	12151. 1	K	0.64 8	2.68E02	26.8
LYM 10	11744. 1	N	0.22 4	4.91E02	23.5	LYM 13 8	12561. 1	K	0.63 8	3.91E- 02	24.7
LYM1	11602. 1	N	0.22 4	5.06E02	23.2	LYM 10 5	12297. 1	K	0.64 6	4.88E02	26.3
LYM 13 2	12271. 4	N	0.22 1	5.78E02	21.8	LYM30	11913. 3	K	0.63 1	5.27E02	23.3
LYM 17 4	12411. 2	N	0.22 3	5.88E02	22.8	LYM53	11841. 1	K	0.64 1	5.90E02	25.3
LYM 14 0	12262. 3	N	0.22 1	6.40E02	21.4	LYM 11 1	12251. 1	K	0.62 7	6.03E02	22.5
LYM 11 9	12461. 4	N	0.22	7.17E02	21.3	LYM24	12061. 2	K	0.63 1	6.18E- 02	23.3
LYM4	11706. 5	N	0.21 9	8.19E- 02	20.4	LYM24	12064. 1	K	0.61 8	6.89E02	20.9
LYM 15	11611. 3	N	0.22 4	8.23E02	23.1	LYM25 4	12471. 2	K	0.61 5	7.20E02	20.3
LYM 13 0	12332. 2	N	0.22 2	8.28E02	22.3	LYM31	11923. 1	K	0.61 7	8.28E02	20.6
LYM26 8	12483. 2	N	0.21 7	9.09E02	19.5	LYM57	12013. 5	K	0.61 7	8.35E02	20.7
LYM 17 4	12412. 1	N	0.22	9.27E02	20.8	LYM 10 5	12295. 2	K	0.62	8.37E02	21.2
LYM 16 2	12231. 1	N	0.21 7	1.07E- 01	19.4	LYM 10 5	12293. 1	K	0.61 1	8.53E02	19.5
LYM 19	11751. 4	N	0.21 8	1.07E- 01	19.8	LYM51	11893. 2	K	0.62	8.98E02	21.3
LYM 13 8	12561. 3	N	0.21 7	1.08E- 01	19.3	LYM62	12022. 1	K	0.61 2	9.67E02	19.7
LYM 14 1	12404. 4	N	0.21 7	1.08E- 01	19.3	LYM68	11942. 3	K	0.60 5	1.06E- 01	18.2
LYM 19	11753. 1	N	0.21 4	1.09E- 01	18.1	LYM 14 8	12174. 1	K	0.61 5	1.10E- 01	20.3
LYM 17 4	12411. 3	N	0.21 7	1.15E- 01	19.2	LYM 11 1	12254. 4	K	0.61 4	1.13E- 01	20.1
LYM 13 2	12273. 2	N	0.21 3	1.19E- 01	17.4	LYM26 8	12482. 3	K	0.61 6	1.16E- 01	20.4
LYM 17	11684. 4	N	0.21 4	1.19E- 01	17.9	LYM 11 1	12252. 2	K	0.60 9	1.28E- 01	19.1
LYM4	11705. 2	N	0.21 5	1.21E- 01	18.1	LYM67	11782. 5	K	0.60 2	1.28E- 01	17.6
LYM 15	11612. 3	N	0.21 7	1.25E- 01	19.3	LYM62	12023. 4	K	0.60 6	1.29E- 01	18.4

328

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM9	11632. 2	N	0.21 5	1.26E01	18.3	LYM 14 8	12172. 1	K	0.60 1	1.35E01	17.5
LYM 11 9	12462. 1	N	0.21 6	1.29E01	18.6	LYM 14 3	12524. 2	K	0.60 5	1.51E01	18.2
LYM21	11673. 1	N	0.21 3	1.36E01	17.4	LYM 13 8	12564. 1	K	0.61 6	1.54E01	20.4
LYM29 0	12501. 3	N	0.21 6	1.42E01	18.7	LYM 13 4	12311. 2	K	0.59 9	1.66E01	17.1
LYM 13 0	12334. 1	N	0.21 3	1.48E01	17.3	LYM26	11824. 6	K	0.60 2	1.76E01	17.6
LYM 17	11682. 1	N	0.21 7	1.52E01	19.2	LYM29 0	12504. 1	K	0.59 6	1.83E01	16.5
LYM 16 2	12231. 3	N	0.21 1	1.58E01	16.2	LYM95	12124. 4	K	0.59 1	1.85E01	15.5
LYM 10 0	12133. 1	N	0.21	1.59E01	15.8	LYM 15 3	12321. 2	K	0.59 5	1.94E01	16.4
LYM 19	11754. 1	N	0.21 1	1.60E01	15.9	LYM 17 0	12453. 2	K	0.58 5	2.40E01	14.3
LYM 14 8	12173. 1	N	0.21 4	1.61E01	17.8	LYM30	11913. 5	K	0.58 5	2.41E01	14.3
LYM 13 7	12153. 1	N	0.21	1.80E01	15.8	LYM 11 9	12462. 2	K	0.58 6	2.44E01	14.7
LYM 13 8	12562. 1	N	0.20 8	1.95E01	14.6	LYM 14 3	12524. 7	K	0.6	2.47E01	17.4
LYM 10 2	12221. 1	N	0.20 8	1.97E01	14.5	LYM 17 2	12302. 2	K	0.57 8	2.79E01	13
LYM 15	11612. 2	N	0.20 8	2.06E01	14.6	LYM68	11943. 2	K	0.58 3	2.80E01	14
LYM 13	11772. 1	N	0.20 9	2.08E01	14.9	LYM 13 2	12275. 1	K	0.58 5	2.80E01	14.3
LYM1	11601. 1	N	0.20 9	2.18E01	15.2	LYM66	11955. 2	K	0.57 5	2.85E01	12.4
LYM 14 3	12521. 1	N	0.20 7	2.19E01	14	LYM29 0	12502. 2	K	0.57 7	2.87E01	12.8
LYM 15 2	12371. 2	N	0.20 8	2.27E01	14.5	LYM 14 0	12261. 1	K	0.59 8	2.92E01	16.8
LYM28 9	12491. 4	N	0.20 6	2.34E01	13.6	LYM29 0	12502. 1	K	0.57 8	2.94E01	13
LYM1	11603. 2	N	0.20 5	2.45E01	13	LYM 13 4	12314. 2	K	0.57 5	2.95E01	12.4
LYM26 8	12483. 4	N	0.20 8	2.49E01	14.4	LYM62	12021. 1	K	0.57 9	3.02E01	13.2
LYM21	11672. 4	N	0.20 7	2.55E01	14	LYM 14	12052. 5	K	0.57 4	3.05E01	12.2
LYM28 9	12493. 6	N	0.20 5	2.58E01	12.7	LYM95	12121. 2	K	0.57 3	3.13E01	12
LYM21	11671. 2	N	0.20 6	2.59E01	13.3	LYM26 8	12481. 1	K	0.57 5	3.22E01	12.5
LYM 11 1	12251. 1	N	0.20 7	2.60E01	13.9	LYM69	11854. 2	K	0.57	3.32E01	11.5
LYM 11 9	12463. 2	N	0.20 5	2.61E01	12.9	LYM62	12022. 2	K	0.57 4	3.34E01	12.2

329

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM 10	11744. 5	N	0.20 6	2.65E01	13.5	LYM30	11912. 7	K	0.57 4	3.35E01	12.3
LYM 14 8	12172. 1	N	0.20 9	2.78E01	15	LYM69	11853. 4	K	0.57 8	3.42E01	13
LYM 14 1	12404. 2	N	0.20 3	2.88E01	11.9	LYM 13 2	12275. 3	K	0.56 9	3.42E01	11.2
LYM 13	11771. 6	N	0.20 5	2.89E01	12.6	LYM 13 0	12333. 1	K	0.56 5	3.66E01	10.6
LYM 14 1	12404. 3	N	0.20 4	2.94E01	12.1	LYM 10 5	12294. 2	K	0.56 3	3.67E01	10.1
LYM 10 2	12222. 3	N	0.20 7	3.08E01	14.2	LYM31	11922. 3	K	0.56 7	3.69E01	10.8
LYM28 9	12491. 1	N	0.20 6	3.10E- 01	13.2	LYM 17 0	12453. 3	K	0.56 8	3.72E01	11.1
LYM 17	11681. 4	N	0.20 2	3.14E- 01	11.3	LYM25 4	12473. 1	K	0.56 3	4.05E01	10
LYM26 8	12482. 3	N	0.20 3	3.18E- 01	11.5	LYM31	11924. 4	K	0.57	4.08E01	11.4
LYM 16 2	12233. 2	N	0.20 2	3.39E01	11.3	LYM 15 2	12376. 1	K	0.56 4	4.22E01	10.3
LYM 17 4	12414. 2	N	0.20 1	3.47E01	10.8	LYM57	12012. 2	K	0.56 5	4.26E01	10.4
LYM 16	11624. 4	N	0.2	3.59E01	10.2	LYM 14	12051. 4	K	0.56	4.29E01	9.5
LYM 12 9	12573. 5	N	0.2	3.63E01	10.2	LYM 14 0	12261. 4	K	0.55 7	4.32E01	9
LYM29 0	12502. 4	N	0.20 2	3.73E01	11.1	LYM 13 0	12334. 1	K	0.55 8	4.46E01	9.1
LYM26 8	12482. 1	N	0.19 8	4.54E01	9	LYM 13 7	12154. 5	K	0.55 6	4.67E01	8.7
LYM 10 5	12294. 2	N	0.2	4.70E01	10	LYM 10 0	12131. 3	K	0.55 7	4.69E01	9
LYM 13 2	12275. 3	N	0.2	4.79E01	10	LYM53	11841. 2	K	0.55 8	4.74E01	9.2
LYM 19	11752. 2	N	0.19 7	4.82E01	8.5	LYM26 8	12483. 4	K	0.56 5	4.77E01	10.4
LYM 14 3	12524. 2	N	0.19 6	4.88E01	7.8	LYM68	11941. 3	K	0.55 5	4.80E01	8.6
LYM9	11633. 7	N	0.19 6	4.90E01	8.1	LYM 17 0	12452. 4	K	0.55 9	4.81E01	9.3
LYM 15 3	12321. 2	N	0.19 6	5.19E- 01	7.7	LYM 14 8	12173. 1	K	0.55 5	4.86E01	8.5
LYM 11 1	12254. 4	N	0.19 5	5.30E01	7.1	LYM26 8	12482. 1	K	0.55 8	4.94E01	9.1
LYM 13 2	12275. 1	N	0.19 4	5.34E01	7	LYM26	11821. 2	K	0.56	5.00E01	9.4
LYM 14 3	12521. 2	N	0.19 4	5.39E01	6.9	LYM31	11921. 3	K	0.55 8	5.05E01	9.1
LYM 10	11742. 1	N	0.19 6	5.54E01	7.8	LYM31	11923. 4	K	0.55 4	5.08E01	8.3
LYM 10 2	12222. 6	N	0.19 6	5.56E01	7.9	LYM 15 3	12322. 1	K	0.56	5.10E- 01	9.5

330

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM 13	11771. 9	N	0.19 3	5.98E01	6.2	LYM30	11913. 4	K	0.54 9	5.23E01	ΊΑ
LYM 11 3	12442. 1	N	0.19 2	6.01E01	5.9	LYM53	11844. 2	K	0.55 2	5.40E01	7.9
LYM2	11693. 3	N	0.19 2	6.18E01	5.7	LYM 13 8	12561. 3	K	0.55 1	5.44E01	7.7
LYM 14 0	12261. 4	N	0.19 1	6.66E01	4.9	LYM 15 2	12372. 1	K	0.55 2	5.48E01	7.9
LYM 16	11622. 2	N	0.19	6.70E01	4.8	LYM24	12061. 4	K	0.54 8	5.49E01	7.2
LYM 13 0	12331. 3	N	0.18 9	7.24E01	4.2	LYM 17 2	12304. 2	K	0.55 2	5.50E01	7.8
LYM 10 0	12131. 3	N	0.18 9	7.44E01	3.9	LYM 14 8	12174. 2	K	0.55 2	5.65E01	7.9
LYM2	11692. 3	N	0.18 8	7.48E01	3.6	LYM25 4	12474. 3	K	0.55	5.67E01	7.6
LYM 13 8	12564. 1	N	0.18 8	7.56E01	3.5	LYM51	11891. 1	K	0.54 3	5.74E01	6.2
LYM 11 1	12252. 2	N	0.18 9	7.61E01	4.2	LYM 15 2	12371. 2	K	0.54 8	5.75E01	7.2
LYM 10 6	12141. 4	N	0.18 8	7.62E01	3.5	LYM43	11793. 2	K	0.55	5.77E01	7.6
LYM 14 1	12404. 1	N	0.18 7	7.90E01	3	LYM 15 2	12373. 1	K	0.55	5.98E01	7.6
LYM28 9	12492. 2	N	0.18 7	8.07E01	2.9	LYM25 4	12474. 4	K	0.54 6	6.00E01	6.7
LYM 15 3	12324. 2	N	0.18 7	8.23E01	2.9	LYM67	11781. 5	K	0.54 2	6.09E01	6
LYM 17	11684. 5	N	0.18 5	8.58E01	2	LYM43	11791. 5	K	0.54 5	6.10E01	6.6
LYM 11 9	12461. 1	N	0.18 5	8.84E01	1.7	LYM51	11892. 1	K	0.54 3	6.25E01	6.2
LYM 14 3	12523. 4	N	0.18 5	8.92E01	1.6	LYM 10 0	12131. 2	K	0.54 1	6.31E01	5.8
LYM9	11633. 2	N	0.18 4	9.21E01	1.3	LYM 14 3	12521. 2	K	0.53 9	6.33E01	5.4
LYM 17	11683. 1	N	0.18 3	9.35E01	0.9	LYM 16 2	12231. 1	K	0.53 9	6.33E01	5.4
LYM 10 6	12142. 2	N	0.18 2	9.73E01	0.4	LYM 14 3	12521. 1	K	0.53 9	6.47E01	5.4
LYM22	11764. 1	N	0.18 2	9.75E01	0.4	LYM67	11782. 6	K	0.53 9	6.49E01	5.4
LYM22	11762. 1	N	0.18 2	9.78E01	0.3	LYM53	11843. 2	K	0.54	6.70E01	5.5
LYM 14 0	12264. 1	N	0.18 2	9.80E01	0.3	LYM26	11824. 5	K	0.53 6	6.75E01	4.7
LYM 15 3	12323. 2	N	0.18 2	9.81E01	0.3	LYM 13 0	12332. 1	K	0.54 2	6.78E01	5.9
LYM 10 6	12144. 4	N	0.18 2	9.82E01	0.3	LYM66	11952. 1	K	0.53 5	6.92E01	4.6
LYM 10 5	12294. 3	N	0.18 2	9.87E01	0.2	LYM 10 0	12133. 3	K	0.53 3	7.11E01	4.2

331

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
CONTR OL	—	N	0.18 2	—	0	LYM29 0	12502. 4	K	0.53 4	7.21E- 01	4.4
LYM 14 3	12524. 7	O	2.00 8	1.50E- 05	58.2	LYM 16 2	12234. 3	K	0.53 3	7.24E01	4.2
LYM 14 8	12171. 2	O	2.01 4	2.00E05	58.6	LYM 17 4	12414. 3	K	0.53 3	7.34E01	4.2
LYM 13 0	12333. 1	o	1.85 1	7.90E05	45.8	LYM 14 3	12523. 4	K	0.53 2	7.42E01	3.9
LYM 10	11741. 2	o	2.33 9	1.39E- 04	84.2	LYM 14	12051. 1	K	0.53 1	7.52E01	3.8
LYM4	11706. 5	o	1.75 9	2.95E04	38.5	LYM 14 0	12262. 3	K	0.53 1	7.59E01	3.8
LYM 10 2	12222. 2	o	1.76 1	3.14E- 04	38.7	LYM24	12063. 3	K	0.52 9	7.68E01	3.5
LYM1	11602. 1	o	1.74 7	3.45E04	37.5	LYM43	11791. 4	K	0.53	7.70E01	3.7
LYM 10 5	12293. 1	o	1.73 5	4.36E04	36.6	LYM 14 8	12171. 2	K	0.52 9	7.79E01	3.4
LYM 10	11744. 1	o	1.73 1	4.44E04	36.3	LYM51	11894. 2	K	0.52 9	7.80E01	3.5
LYM 16 2	12234. 3	o	1.69 6	6.35E04	33.6	LYM 17 4	12411. 3	K	0.52 7	8.03E01	3
LYM 14 0	12262. 3	o	1.62	2.10E03	27.6	LYM 15 3	12323. 2	K	0.52 7	8.05E01	3
LYM 13 2	12271. 4	o	1.61 8	2.28E03	27.4	LYM26 8	12483. 2	K	0.52 6	8.15E- 01	2.9
LYM 15	11614. 3	o	1.61 1	2.52E03	26.9	LYM 16 2	12231. 3	K	0.52 7	8.18E- 01	3
LYM 15 2	12372. 2	o	1.69	8.69E03	33.1	LYM 13 4	12313. 2	K	0.52 3	8.47E01	2.3
LYM1	11602. 6	o	2.43 5	9.41E03	91.7	LYM 13 7	12151. 2	K	0.52 3	8.53E01	2.3
LYM 11 9	12461. 4	o	1.55 2	1.28E- 02	22.2	LYM 14	12054. 2	K	0.52 2	8.56E01	2.1
LYM 13 2	12273. 2	o	1.61 5	1.84E02	27.2	LYM 13 2	12271. 4	K	0.52 2	8.70E01	2
LYM 13 0	12334. 1	o	1.63	2.12E02	28.4	LYM26	11824. 3	K	0.52	8.83E01	1.7
LYM 10 0	12133. 1	o	1.49 9	2.74E02	18.1	LYM68	11942. 2	K	0.52	8.89E01	1.6
LYM28 9	12493. 2	o	1.81 8	3.54E02	43.2	LYM 13 4	12312. 3	K	0.51 9	9.12E01	1.4
LYM 16 2	12231. 3	o	1.52 6	3.61E- 02	20.2	LYM57	12012. 6	K	0.51 9	9.13E01	1.4
LYM 11 9	12463. 2	o	1.66 6	4.22E02	31.2	LYM68	11941. 4	K	0.51 8	9.13E01	1.3
LYM 13 8	12561. 1	o	2.01 6	5.07E02	58.8	LYM95	12124. 5	K	0.51 8	9.25E01	1.2
LYM 17	11684. 4	o	1.54 6	5.44E02	21.7	LYM 10 0	12133. 1	K	0.51 7	9.31E01	1
LYM1	11603. 2	o	1.58 4	5.79E02	24.8	LYM 11 9	12461. 4	K	0.51 6	9.42E01	1

332

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM 14 1	12404. 2	O	1.43 4	7.37E02	13	LYM 15 2	12372. 2	K	0.51 4	9.65E01	0.5
LYM 19	11751. 5	o	1.66 4	1.05E01	31	LYM 14 0	12264. 1	K	0.51 4	9.70E01	0.5
LYM26 8	12483. 2	o	1.50 2	1.15E01	18.3	LYM57	12013. 3	K	0.51 4	9.72E01	0.4
LYM9	11632. 1	o	2.06 9	1.20E01	63	LYM 13 7	12152. 1	K	0.51 3	9.74E01	0.4
LYM28 9	12493. 6	o	1.40 3	1.25E01	10.5	LYM30	11912. 6	K	0.51 3	9.76E01	0.4
LYM1	11604. 4	o	1.81 6	1.26E01	43	LYM3	12041. 1	K	0.51 3	9.85E01	0.3
LYM 14 8	12174. 1	o	1.81 1	1.28E01	42.6	LYM 11 9	12462. 1	K	0.51 2	9.90E01	0.2
LYM 14 1	12402. 4	o	1.8	1.35E01	41.8	LYM26	11824. 1	K	0.51 2	9.97E01	0
LYM 10	11742. 2	o	1.74 1	1.42E01	37.1	LYM62	12022. 4	K	0.51 2	9.97E01	0
LYM 13	11771. 6	o	1.45	1.49E01	14.2	LYM 10 5	12294. 3	K	0.51 2	9.97E01	0
LYM 11 9	12462. 2	o	2.12 7	1.57E01	67.5	CONTR OL	—	K	0.51 1	—	0
LYM 10 2	12221. 1	o	1.39 2	1.62E01	9.6	LYM 11 1	12252. 2	L	4.3	3.60E05	126.4
LYM 19	11753. 1	o	1.58 6	1.69E01	24.9	LYM 14 8	12174. 1	L	3.57 9	4.94E04	88.4
LYM9	11632. 2	o	1.42 4	1.70E01	12.1	LYM 11 9	12462. 1	L	3.12 5	7.46E03	64.5
LYM 17 4	12411. 2	o	1.75 3	1.79E01	38.1	LYM 10 0	12131. 2	L	3.04 1	1.01E02	60.1
LYM 17	11681. 4	o	1.38 5	1.88E01	9.1	LYM 13 8	12561. 1	L	3.06 2	1.03E02	61.2
LYM 15	11612. 2	o	1.48 3	2.29E01	16.8	LYM43	11791. 5	L	2.89 8	1.80E02	52.6
LYM 14 3	12521. 1	o	1.40 7	2.32E01	10.8	LYM 13 4	12314. 2	L	2.86 6	2.55E02	50.9
LYM 19	11754. 1	o	1.46 4	2.44E01	15.3	LYM 13 8	12561. 3	L	2.84 5	3.12E02	49.8
LYM9	11633. 7	o	1.54	2.49E01	21.3	LYM53	11841. 1	L	2.77 8	4.04E02	46.2
LYM 13 8	12562. 1	o	1.36 4	2.52E01	7.4	LYM26 8	12482. 3	L	2.77 7	4.10E02	46.2
LYM 13 0	12332. 2	o	1.67 5	2.61E01	31.9	LYM29 0	12502. 4	L	2.75 6	5.17E02	45.1
LYM 11 9	12462. 1	o	1.81 2	2.70E01	42.7	LYM 14 3	12524. 2	L	2.7	5.53E02	42.2
LYM 14 3	12524. 2	o	1.48 2	2.87E01	16.7	LYM51	11893. 4	L	2.78 2	6.14E02	46.4
LYM 17 4	12414. 3	o	1.87 1	3.05E01	47.3	LYM 13 7	12151. 1	L	2.69 8	6.26E02	42
LYM 13 8	12561. 3	o	1.81 6	3.10E01	43	LYM31	11923. 4	L	2.66 5	6.28E02	40.3

333

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM 11 3	12442. 1	O	1.35 5	3.16E01	6.7	LYM 14 3	12524. 7	L	2.88 3	6.35E02	51.8
LYM21	11673. 1	o	1.47 1	3.28E01	15.9	LYM68	11942. 3	L	2.65 9	7.46E02	40
LYM 15	11612. 3	o	1.63 8	3.31E01	29	LYM 11 9	12461. 1	L	2.85 1	7.88E02	50.1
LYM 13 4	12311. 2	o	1.58 5	3.39E01	24.8	LYM68	11941. 3	L	2.63 1	7.90E02	38.5
LYM 14 1	12404. 3	o	1.53 2	3.45E01	20.7	LYM 14 8	12171. 2	L	2.59 5	9.52E02	36.6
LYM 19	11751. 4	o	1.65 6	3.52E01	30.4	LYM57	12013. 5	L	2.59 2	9.88E02	36.4
LYM2	11692. 3	o	1.35 8	3.74E01	7	LYM 11 1	12254. 3	L	2.67 7	1.14E01	40.9
LYM 12 9	12573. 5	o	1.34 3	3.76E01	5.7	LYM69	11853. 5	L	2.54 5	1.23E01	34
LYM4	11705. 2	o	1.52 3	3.80E01	19.9	LYM30	11912. 6	L	2.52 7	1.45E01	33
LYM 16 2	12231. 1	o	1.58 4	3.81E01	24.7	LYM 14 0	12264. 1	L	2.49 5	1.50E01	31.3
LYM 15 2	12371. 2	o	1.53 8	4.01E01	21.1	LYM 15 2	12372. 1	L	2.55 8	1.54E01	34.6
LYM 15	11611. 3	o	1.69 4	4.12E01	33.4	LYM68	11943. 2	L	2.48 8	1.58E01	31
LYM21	11671. 2	o	1.50 5	4.27E01	18.5	LYM43	11791. 4	L	2.45 4	1.80E01	29.2
LYM28 9	12491. 1	o	1.67	4.28E01	31.5	LYM62	12021. 1	L	2.44 9	1.93E01	28.9
LYM28 9	12491. 4	o	1.42 3	4.32E01	12.1	LYM53	11844. 2	L	2.46 1	1.95E01	29.6
LYM 14 1	12404. 4	o	1.56	4.38E01	22.9	LYM30	11913. 5	L	2.44 3	1.99E01	28.6
LYM 16 2	12234. 4	o	1.76 8	4.46E01	39.2	LYM 13 7	12154. 5	L	2.43 8	2.03E01	28.4
LYM 14 8	12173. 1	o	1.60 5	4.55E01	26.4	LYM 17 0	12453. 2	L	2.39 6	2.19E01	26.2
LYM29 0	12501. 3	o	1.43 3	4.56E01	12.8	LYM 11 9	12462. 2	L	2.39	2.40E01	25.8
LYM 10 2	12222. 3	o	1.60 5	5.03E01	26.4	LYM 11 1	12254. 4	L	2.39 9	2.43E01	26.3
LYM 17 4	12411. 3	o	1.49 1	5.04E01	17.4	LYM 17 2	12301. 2	L	2.36 5	2.52E01	24.5
LYM 17 4	12412. 1	o	1.55 4	5.23E01	22.4	LYM 11 1	12251. 3	L	2.35 9	2.67E01	24.2
LYM26 8	12483. 4	o	1.43 4	5.36E01	13	LYM51	11893. 2	L	2.33 2	2.92E01	22.8
LYM 11 1	12251. 1	o	1.49 8	5.37E01	18	LYM29 0	12502. 2	L	2.35 7	2.97E01	24.1
LYM21	11672. 4	o	1.46 6	5.47E01	15.4	LYM 10 5	12294. 3	L	2.30 5	3.15E01	21.3
LYM29 0	12502. 4	o	1.46 9	5.82E01	15.7	LYM 13 0	12332. 2	L	2.29 4	3.24E01	20.8

334

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM10	11744. 5	O	1.44 1	5.83E01	13.5	LYM68	11942. 2	L	2.29 8	3.35E01	21
LYM13	11772. 1	o	1.35 2	5.92E01	6.5	LYM26 8	12481. 1	L	2.27 5	3.51E- 01	19.7
LYM17	11684. 5	o	1.31 4	6.05E01	3.5	LYM10 5	12295. 2	L	2.27 7	3.56E01	19.9
LYM17	11682. 1	o	1.53 6	6.12E- 01	20.9	LYM13 0	12331. 3	L	2.24 1	3.81E- 01	18
LYM26 8	12482. 3	o	1.34 8	6.33E01	6.2	LYM14 8	12173. 1	L	2.24 7	3.93E01	18.3
LYM16	11624. 4	o	1.30 9	6.51E- 01	3.1	LYM15 2	12376. 1	L	2.24 6	3.97E01	18.2
LYM10 5	12294. 2	o	1.53 6	6.73E01	21	LYM29 0	12501. 3	L	2.23 5	4.07E01	17.7
LYM17	11683. 1	o	1.30 6	6.85E01	2.9	LYM57	12012. 2	L	2.22 5	4.17E01	17.1
LYM13 7	12153. 1	o	1.36 7	7.39E01	7.7	LYM13 2	12276. 1	L	2.21 6	4.40E01	16.6
LYM11 1	12252. 2	o	1.43 7	7.64E01	13.1	LYM14	12052. 4	L	2.20 1	4.53E01	15.9
LYM10	11742. 1	o	1.41 8	7.68E01	11.7	LYM13 7	12152. 1	L	2.20 4	4.55E01	16
LYM10 0	12131. 3	o	1.35 1	8.06E01	6.4	LYM62	12022. 1	L	2.19 5	4.65E01	15.5
LYM17 4	12414. 2	o	1.28 4	8.53E01	1.1	LYM10 0	12134. 1	L	2.18 7	4.81E01	15.1
LYM9	11633. 2	o	1.32	8.63E01	4	LYM26	11824. 6	L	2.17 7	4.90E01	14.6
LYM16 2	12233. 2	o	1.31 5	8.71E- 01	3.6	LYM57	12012. 6	L	2.16 9	5.11E- 01	14.2
LYM14 8	12172. 1	o	1.34 9	8.73E01	6.3	LYM53	11842. 4	L	2.17 9	5.18E- 01	14.7
LYM26 8	12482. 1	o	1.31	9.06E01	3.2	LYM67	11783. 5	L	2.16 2	5.19E- 01	13.8
LYM14 0	12261. 4	o	1.28 7	9.25E01	1.3	LYM13 2	12271. 4	L	2.15 7	5.24E01	13.5
LYM29 0	12502. 1	o	1.30 1	9.27E01	2.5	LYM10 0	12131. 3	L	2.14 1	5.42E01	12.7
LYM1	11601. 1	o	1.28	9.68E01	0.8	LYM15 2	12372. 2	L	2.13 2	5.59E01	12.2
LYM22	11762. 1	o	1.27	9.99E01	0	LYM13 8	12562. 1	L	2.12 4	5.80E01	11.8
CONTR OL	—	o	1.27	—	0	LYM43	11792. 2	L	2.11 9	6.05E01	11.6
LYM14 3	12524. 7	P	2.58 1	6.00E06	38	LYM51	11894. 2	L	2.09 7	6.19E- 01	10.4
LYM14 8	12171. 2	P	2.42 2	1.00E- 04	29.5	LYM13 0	12334. 1	L	2.08 2	6.35E01	9.6
LYM14 8	12174. 1	P	2.32 4	1.00E- 04	24.2	LYM43	11793. 2	L	2.09 2	6.44E01	10.1
LYM4	11706. 5	P	2.30 2	1.40E- 04	23.1	LYM13 4	12312. 4	L	2.08 2	6.55E01	9.6

335

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM10	11744. 1	P	2.29 7	1.80E04	22.8	LYM14	12051. 4	L	2.07 7	6.58E01	9.4
LYM10 5	12293. 1	P	2.29 9	2.18E04	22.9	LYM11 9	12461. 4	L	2.07 2	6.66E01	9.1
LYM10	11742. 2	P	2.36 4	3.58E04	26.4	LYM13 2	12275. 1	L	2.06 5	6.78E01	8.7
LYM10 2	12222. 2	P	2.24 3	6.39E04	19.9	LYM30	11912. 7	L	2.05 7	6.96E01	8.3
LYM13 2	12273. 2	P	2.21 5	6.83E04	18.4	LYM16 2	12231. 3	L	2.05 6	7.00E01	8.2
LYM13 2	12271. 4	P	2.21	7.22E04	18.2	LYM13 7	12153. 1	L	2.05 4	7.02E01	8.1
LYM13 0	12333. 1	P	2.37 4	9.53E04	26.9	LYM25 4	12474. 4	L	2.06 6	7.04E01	8.8
LYM14 0	12262. 3	P	2.18 6	1.21E03	16.9	LYM14 3	12521. 2	L	2.04 9	7.08E01	7.8
LYM1	11602. 1	P	2.25 3	3.80E03	20.4	LYM10 0	12133. 3	L	2.03 5	7.35E01	7.1
LYM16 2	12234. 3	P	2.29 2	6.47E03	22.6	LYM30	11913. 3	L	2.02 7	7.48E01	6.7
LYM13 0	12334. 1	P	2.19 3	9.35E03	17.3	LYM68	11941. 4	L	2.01 3	7.74E01	6
LYM19	11751. 5	P	2.25 4	9.64E03	20.5	LYM15 2	12371. 2	L	2.01 2	7.89E01	5.9
LYM13	11771. 6	P	2.07 8	1.10E02	11.1	LYM67	11782. 4	L	1.99 1	8.22E01	4.8
LYM28 9	12493. 2	P	2.34 7	1.26E02	25.5	LYM26	11824. 5	L	1.97 3	8.52E01	3.9
LYM11 9	12463. 2	P	2.16 6	1.42E02	15.8	LYM13 8	12564. 1	L	1.97 6	8.53E01	4
LYM10	11741. 2	P	2.72 9	1.57E02	45.9	LYM51	11891. 1	L	1.97 2	8.55E01	3.8
LYM10 2	12221. 1	P	2.05 8	1.68E02	10.1	LYM15 2	12373. 1	L	1.97 6	8.56E01	4
LYM15 2	12372. 2	P	2.24 3	2.00E02	20	LYM95	12124. 4	L	1.96 2	8.74E01	3.3
LYM17	11684. 4	P	2.11 1	2.86E02	12.9	LYM26 8	12483. 2	L	1.96 2	8.79E01	3.3
LYM1	11602. 6	P	2.69 1	3.00E02	43.9	LYM31	11922. 3	L	1.95 9	8.80E01	3.1
LYM14 1	12404. 2	P	2.03	3.41E02	8.5	LYM17 2	12302. 2	L	1.94 8	9.08E01	2.6
LYM15	11612. 2	P	2.08 3	3.48E02	11.4	LYM14	12051. 1	L	1.94 4	9.11E01	2.4
LYM14 3	12524. 2	P	2.02 6	3.61E02	8.3	LYM69	11852. 4	L	1.93 9	9.21E01	2.1
LYM13	11772. 1	P	2.06 1	3.72E02	10.2	LYM11 1	12251. 1	L	1.93 6	9.27E01	1.9
LYM14 3	12521. 1	P	2.05 4	4.46E02	9.8	LYM66	11954. 4	L	1.92 2	9.59E01	1.2
LYM10 0	12133. 1	P	2.12	4.61E02	13.4	LYM10 5	12297. 1	L	1.91 2	9.76E01	0.6

336

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM16	11624. 4	P	2.01 4	4.89E02	7.7	LYM14 0	12262. 3	L	1.90 6	9.87E01	0.3
LYM17	11681. 4	P	2.01 9	5.10E02	8	LYM29 0	12502. 1	L	1.90 6	9.88E01	0.3
LYM19	11753. 1	P	2.14 9	5.24E02	14.9	CONTR OL	—	L	1.9	—	0
LYM13 8	12562. 1	P	2.00 8	6.33E02	7.3	LYM11 1	12252. 2	M	0.53 7	2.20E05	121
LYM1	11603. 2	P	2.09 6	8.89E02	12.1	LYM14 8	12174. 1	M	0.44 7	3.03E04	84
LYM9	11632. 1	P	2.65 5	9.51E02	42	LYM11 9	12462. 1	M	0.39 1	5.76E03	60.6
LYM11 9	12461. 4	P	2.17 2	9.96E02	16.1	LYM10 0	12131. 2	M	0.38	7.86E03	56.3
LYM12 9	12573. 5	P	1.98 9	1.00E01	6.3	LYM13 8	12561. 1	M	0.38 3	8.16E03	57.4
LYM19	11754. 1	P	2.12 5	1.17E01	13.6	LYM43	11791. 5	M	0.36 2	1.43E02	49
LYM17 4	12411. 2	P	2.28 7	1.23E01	22.3	LYM13 4	12314. 2	M	0.35 8	2.14E02	47.3
LYM11 3	12442. 1	P	2.05 4	1.24E01	9.8	LYM13 8	12561. 3	M	0.35 6	2.71E02	46.2
LYM14 1	12402. 4	P	2.33	1.29E01	24.6	LYM11 9	12461. 1	M	0.37 3	3.52E02	53.4
LYM15	11614. 3	P	2.23 2	1.30E01	19.4	LYM53	11841. 1	M	0.34 7	3.56E02	42.8
LYM28 9	12493. 6	P	2.05 1	1.31E01	9.7	LYM26 8	12482. 3	M	0.34 7	3.61E02	42.7
LYM9	11632. 2	P	2.11 3	1.36E01	13	LYM29 0	12502. 4	M	0.34 4	4.73E02	41.6
LYM13 8	12561. 1	P	2.47	1.39E01	32	LYM14 3	12524. 2	M	0.33 8	4.96E02	38.8
LYM11 9	12462. 2	P	2.51 9	1.48E01	34.7	LYM31	11923. 4	M	0.33 3	5.67E02	37
LYM9	11633. 7	P	2.10 2	1.55E01	12.4	LYM13 7	12151. 1	M	0.33 7	5.76E02	38.7
LYM16 2	12231. 1	P	2.16 3	1.88E01	15.6	LYM51	11893. 4	M	0.34 8	5.87E02	43
LYM16 2	12231. 3	P	2.12 8	1.99E01	13.8	LYM14 3	12524. 7	M	0.36	6.28E02	48.2
LYM4	11705. 2	P	2.12 7	2.10E01	13.8	LYM68	11942. 3	M	0.33 2	6.98E02	36.7
LYM14 1	12404. 3	P	2.09 8	2.18E01	12.2	LYM68	11941. 3	M	0.32 9	7.35E02	35.2
LYM17 4	12414. 3	P	2.42 4	2.25E01	29.6	LYM14 8	12171. 2	M	0.32 4	9.03E02	33.4
LYM1	11604. 4	P	2.31 6	2.37E01	23.8	LYM57	12013. 5	M	0.32 4	9.44E02	33.2
LYM19	11751. 4	P	2.19 9	2.40E01	17.6	LYM17 0	12453. 2	M	0.32 1	9.97E02	31.9
LYM28 9	12491. 4	P	2.03 3	2.41E01	8.7	LYM11 1	12254. 3	M	0.33 5	1.15E01	37.6

337

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM13 8	12561. 3	P	2.30 6	2.48E01	23.3	LYM69	11853. 5	M	0.31 8	1.20E01	30.8
LYM13 4	12311. 2	P	2.17 8	2.62E01	16.5	LYM30	11912. 6	M	0.31 6	1.45E01	29.9
LYM13 0	12332. 2	P	2.28	2.65E01	21.9	LYM14 0	12264. 1	M	0.31 2	1.48E01	28.2
LYM21	11673. 1	P	2.11 4	2.76E01	13	LYM15 2	12372. 1	M	0.32	1.56E01	31.5
LYM15 2	12371. 2	P	2.12 7	2.84E01	13.7	LYM68	11943. 2	M	0.31 1	1.58E01	27.9
LYM11 9	12462. 1	P	2.28 1	3.03E01	21.9	LYM43	11791. 4	M	0.30 7	1.81E01	26.1
LYM26 8	12483. 2	P	2.12 1	3.07E01	13.4	LYM62	12021. 1	M	0.30 6	1.96E01	25.9
LYM17 4	12414. 2	P	2.01 6	3.46E01	7.8	LYM53	11844. 2	M	0.30 8	1.99E01	26.5
LYM17 4	12411. 3	P	2.15 1	3.50E01	15	LYM30	11913. 5	M	0.30 5	2.03E01	25.6
LYM15	11612. 3	P	2.18 7	3.58E01	16.9	LYM13 7	12154. 5	M	0.30 5	2.08E01	25.3
LYM17 4	12412. 1	P	2.15 5	3.66E01	15.2	LYM11 9	12462. 2	M	0.29 9	2.48E01	22.9
LYM14 8	12173. 1	P	2.15 3	3.73E01	15.1	LYM11 1	12254. 4	M	0.3	2.52E01	23.3
LYM14 1	12404. 4	P	2.15 8	3.80E01	15.4	LYM17 2	12301. 2	M	0.29 6	2.60E01	21.6
LYM29 0	12501. 3	P	2.12 5	3.82E01	13.6	LYM13 2	12276. 1	M	0.29 5	2.66E01	21.5
LYM16 2	12234. 4	P	2.29 6	4.09E01	22.8	LYM11 1	12251. 3	M	0.29 5	2.78E01	21.2
LYM11 1	12251. 1	P	2.09 8	4.17E01	12.2	LYM51	11893. 2	M	0.29 1	3.06E01	19.9
LYM15	11611. 3	P	2.21 4	4.19E01	18.4	LYM29 0	12502. 2	M	0.29 5	3.12E01	21.2
LYM22	11762. 1	P	1.92 1	4.32E01	2.7	LYM67	11783. 5	M	0.29 2	3.23E01	20
LYM13 2	12275. 1	P	1.95 7	4.42E01	4.7	LYM10 5	12294. 3	M	0.28 8	3.31E01	18.5
LYM21	11671. 2	P	2.07 9	4.44E01	11.1	LYM13 0	12332. 2	M	0.28 7	3.41E01	17.9
LYM17	11684. 5	P	1.91 8	4.53E01	2.6	LYM68	11942. 2	M	0.28 7	3.54E01	18.1
LYM2	11692. 3	P	1.91 8	4.54E01	2.6	LYM26 8	12481. 1	M	0.28 4	3.71E01	16.9
LYM13 7	12153. 1	P	2.03 3	4.60E01	8.7	LYM10 5	12295. 2	M	0.28 5	3.77E01	17
LYM10 2	12222. 3	P	2.20 6	4.62E01	18	LYM13 0	12331. 3	M	0.28	4.04E01	15.2
LYM17	11683. 1	P	1.93 6	4.85E01	3.5	LYM14 8	12173. 1	M	0.28 1	4.20E01	15.5
LYM28 9	12491. 1	P	2.16 8	5.00E01	15.9	LYM15 2	12376. 1	M	0.28 1	4.24E01	15.4

338

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM10	11744. 5	P	2.06	5.04E01	10.1	LYM29 0	12501. 3	M	0.27 9	4.35E01	14.9
LYM1	11601. 1	P	2.07 5	5.18E01	10.9	LYM57	12012. 2	M	0.27 8	4.46E01	14.4
LYM26 8	12483. 4	P	2.04 9	5.28E01	9.5	LYM14	12052. 4	M	0.27 5	4.87E01	13.1
LYM17	11682. 1	P	2.15 4	5.33E01	15.2	LYM13 7	12152. 1	M	0.27 6	4.89E01	13.3
LYM21	11672. 4	P	2.07 1	5.40E01	10.7	LYM62	12022. 1	M	0.27 4	5.01E01	12.8
LYM11 1	12254. 4	P	1.92 9	5.68E01	3.2	LYM13 7	12153. 1	M	0.27 5	5.04E01	13.1
LYM13	11771. 9	P	1.97 4	5.76E01	5.5	LYM10 0	12134. 1	M	0.27 3	5.19E01	12.4
LYM26 8	12482. 3	P	1.97 4	5.94E01	5.5	LYM26	11824. 6	M	0.27 2	5.29E01	11.9
LYM2	11693. 3	P	1.92 9	5.99E01	3.1	LYM57	12012. 6	M	0.27 1	5.53E01	11.5
LYM29 0	12502. 4	P	2.02 5	6.17E01	8.3	LYM53	11842. 4	M	0.27 2	5.60E01	12
LYM14 0	12261. 4	P	1.94 7	6.59E01	4.1	LYM13 2	12271. 4	M	0.27	5.68E01	10.8
LYM26 8	12482. 1	P	1.96 9	6.73E01	5.3	LYM68	11941. 4	M	0.26 9	5.74E01	10.5
LYM14 8	12172. 1	P	2.06 9	6.76E01	10.6	LYM10 0	12131. 3	M	0.26 8	5.89E01	10.1
LYM10	11742. 1	P	1.99 9	6.93E01	6.9	LYM15 2	12372. 2	M	0.26 6	6.09E01	9.6
LYM19	11752. 2	P	1.95 4	6.98E01	4.5	LYM13 8	12562. 1	M	0.26 6	6.32E01	9.2
LYM14 3	12521. 2	P	1.91 1	7.08E01	2.2	LYM43	11792. 2	M	0.26 5	6.58E01	8.9
LYM10 5	12294. 2	P	2.02 5	7.30E01	8.3	LYM51	11894. 2	M	0.26 2	6.76E01	7.8
LYM11 1	12252. 2	P	2	7.59E01	6.9	LYM13 0	12334. 1	M	0.26	6.96E01	7
LYM10 0	12131. 3	P	1.94	7.90E01	3.7	LYM43	11793. 2	M	0.26 2	7.03E01	7.5
LYM15 3	12323. 2	P	1.89 3	7.92E01	1.2	LYM13 4	12312. 4	M	0.26	7.16E01	7
LYM16 2	12233. 2	P	1.92 7	7.99E01	3	LYM14	12051. 4	M	0.26	7.20E01	6.8
LYM14 3	12523. 4	P	1.91	8.45E01	2.1	LYM11 9	12461. 4	M	0.25 9	7.29E01	6.5
LYM2	11695. 3	P	1.88 5	8.49E01	0.8	LYM13 2	12275. 1	M	0.25 8	7.43E01	6.1
LYM15 3	12321. 2	P	1.91 5	8.77E01	2.4	LYM30	11912. 7	M	0.25 7	7.63E01	5.7
LYM9	11633. 2	P	1.91 3	8.81E01	2.3	LYM25 4	12474. 4	M	0.25 8	7.67E01	6.2
LYM13 0	12331. 3	P	1.88 6	9.18E01	0.9	LYM16 2	12231. 3	M	0.25 7	7.67E01	5.7

339

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM13 2	12275. 3	P	1.90 8	9.31E01	2	LYM14 3	12521. 2	M	0.25 6	7.77E01	5.3
LYM10 2	12222. 6	P	1.88 2	9.74E01	0.6	LYM26 8	12482. 1	M	0.25 7	7.87E01	5.7
LYM29 0	12502. 1	P	1.87 1	9.99E01	0	LYM10 0	12133. 3	M	0.25 4	8.07E01	4.6
CONTR OL	—	P	1.87	—	0	LYM69	11854. 2	M	0.25 4	8.16E01	4.4
LYM10 3	12713. 5	A	95.4 46	6.40E05	3.7	LYM15 3	12321. 2	M	0.25 4	8.20E01	4.4
LYM20	11711. 2	A	94.1 99	1.22E03	2.3	LYM30	11913. 3	M	0.25 3	8.23E01	4.2
LYM51	11891. 1	A	93.9 81	1.89E03	2.1	LYM15 2	12371. 2	M	0.25 2	8.64E01	3.4
LYM11 0	12921. 7	A	94.0 61	1.99E03	2.2	LYM67	11782. 4	M	0.24 9	9.03E01	2.3
LYM30	11913. 3	A	93.9 36	2.18E03	2.1	LYM13 8	12564. 1	M	0.24 7	9.36E01	1.6
LYM31	11924. 4	A	93.8 65	2.88E03	2	LYM15 2	12373. 1	M	0.24 7	9.38E01	1.6
LYM56	13111. 5	A	93.8 43	2.90E03	2	LYM26	11824. 5	M	0.24 7	9.39E01	1.4
LYM82	12204. 2	A	93.8 24	3.63E03	1.9	LYM51	11891. 1	M	0.24 6	9.42E01	1.3
LYM95	12121. 2	A	94.2 94	3.66E03	2.4	LYM95	12124. 4	M	0.24 5	9.64E01	0.8
LYM30	11913. 4	A	94.5 32	5.55E03	2.7	LYM26 8	12483. 2	M	0.24 5	9.65E01	0.9
LYM14 5	12951. 9	A	93.6 12	6.11E03	1.7	LYM31	11922. 3	M	0.24 5	9.70E01	0.7
LYM95	12124. 6	A	93.5 99	6.49E03	1.7	LYM17 2	12302. 2	M	0.24 4	9.95E01	0.1
LYM12 8	12641. 3	A	93.5 73	6.95E03	1.7	CONTR OL	—	M	0.24 3	—	0
LYM41	11834. 2	A	93.7 77	7.60E03	1.9	LYM11 1	12252. 2	N	0.36 5	8.67E04	57.1
LYM43	11791. 5	A	94.1 66	8.49E03	2.3	LYM14 8	12174. 1	N	0.31 2	1.65E02	34.3
LYM66	11954. 4	A	93.6 58	1.06E02	1.7	LYM69	11853. 5	N	0.29 5	5.60E02	27
LYM14	12051. 4	A	93.4 06	1.22E02	1.5	LYM13 8	12561. 1	N	0.29 6	6.19E02	27.2
LYM11 6	13202. 12	A	93.7 53	1.48E02	1.9	LYM11 9	12462. 1	N	0.29	8.42E02	24.7
LYM27 1	12721. 9	A	93.4 59	1.61E02	1.5	LYM10 0	12131. 2	N	0.28 8	8.55E02	23.7
LYM14 5	12954. 8	A	93.3 11	1.71E02	1.4	LYM14 3	12524. 2	N	0.28 6	9.40E02	22.8
LYM41	11832. 2	A	93.2 79	1.90E02	1.3	LYM68	11941. 3	N	0.28 1	1.21E01	21
LYM26	11821. 2	A	93.2 94	2.17E02	1.4	LYM11 9	12461. 1	N	0.29 5	1.24E01	26.9

340

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM53	11841. 1	A	93.6 75	2.30E02	1.8	LYM67	11783. 5	N	0.28 3	1.38E01	21.6
LYM27 1	12724. 7	A	93.5 39	2.83E02	1.6	LYM13 4	12314. 2	N	0.27 7	1.56E01	18.9
LYM23 2	13024. 7	A	93.3 05	2.83E02	1.4	LYM13 8	12561. 3	N	0.27 8	1.57E- 01	19.4
LYM27 1	12723. 2	A	93.1 62	3.14E- 02	1.2	LYM31	11923. 4	N	0.27 7	1.57E- 01	19
LYM67	11782. 6	A	94.3 35	3.97E02	2.5	LYM29 0	12502. 4	N	0.27 7	1.64E01	19
LYM11 0	12923. 8	A	94.0 14	4.09E02	2.1	LYM57	12013. 5	N	0.27 6	1.67E- 01	18.7
LYM15 6	12961. 7	A	93.7 81	4.22E02	1.9	LYM26 8	12482. 3	N	0.27 6	1.68E01	18.8
LYM88	12191. 1	A	93.4 38	4.39E02	1.5	LYM53	11841. 1	N	0.27 6	1.75E- 01	18.7
LYM23 2	13024. 6	A	93.0 9	4.49E02	1.1	LYM62	12021. 1	N	0.27 5	2.00E01	18.4
LYM23 9	13044. 8	A	93.0 69	4.51E02	1.1	LYM14 3	12524. 7	N	0.28	2.15E01	20.4
LYM23 9	13042. 9	A	94.2 42	5.48E02	2.4	LYM30	11913. 5	N	0.27 3	2.18E01	17.4
LYM10 3	12712. 8	A	93.6 97	7.12E- 02	1.8	LYM53	11844. 2	N	0.27 2	2.53E01	16.7
LYM67	11782. 5	A	93.3 1	7.48E02	1.4	LYM51	11893. 4	N	0.27 2	2.62E01	16.8
LYM26	11824. 5	A	93.2 3	9.64E02	1.3	LYM30	11912. 6	N	0.26 8	2.72E01	15.1
LYM24	12064. 1	A	92.9 77	1.09E- 01	1	LYM68	11942. 3	N	0.26 7	2.76E01	15
LYM24	12061. 4	A	93.5 87	1.10E01	1.7	LYM17 0	12453. 2	N	0.26 4	3.05E01	13.5
LYM26	11824. 6	A	93.6 26	1.16E01	1.7	LYM68	11943. 2	N	0.26 5	3.08E01	14
LYM28 5	12733. 9	A	93.4 76	1.19E- 01	1.6	LYM11 1	12254. 3	N	0.27 1	3.36E01	16.4
LYM99	12243. 2	A	93.2 27	1.26E01	1.3	LYM13 7	12151. 1	N	0.26 1	3.59E01	12.4
LYM66	11952. 2	A	92.7 47	1.33E01	0.8	LYM14 0	12264. 1	N	0.26	3.88E01	11.6
LYM82	12201. 5	A	93.0 06	1.35E01	1	LYM15 2	12372. 1	N	0.26 4	3.92E01	13.5
LYM95	12124. 4	A	93.5 98	1.41E01	1.7	LYM43	11791. 5	N	0.25 8	4.06E01	11
LYM26	11824. 1	A	94.0 62	1.54E01	2.2	LYM13 7	12154. 5	N	0.25 8	4.09E01	11
LYM53	11844. 2	A	92.9 49	1.58E01	1	LYM29 0	12502. 2	N	0.25 8	4.41E01	10.8
LYM23 8	12762. 8	A	92.6 61	1.75E- 01	0.7	LYM11 1	12251. 3	N	0.25 7	4.46E01	10.7
LYM57	12013. 3	A	93.0 63	1.82E01	1.1	LYM10 5	12295. 2	N	0.25 6	4.60E01	10.1

341

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM12 5	12934. 5	A	94.0 64	1.92E- 01	2.2	LYM11 1	12254. 4	N	0.25 5	4.96E01	9.7
LYM12 8	12641. 5	A	93.6 44	1.94E- 01	1.7	LYM26 8	12481. 1	N	0.25 3	5.27E01	8.6
LYM51	11894. 2	A	92.9 55	1.98E- 01	1	LYM51	11893. 2	N	0.25 1	5.42E01	8
LYM66	11955. 2	A	93.6 58	2.03E01	1.7	LYM51	11891. 1	N	0.25 1	5.54E01	7.9
LYM23 8	12763. 5	A	93.4 75	2.13E01	1.6	LYM68	11942. 2	N	0.25 1	5.61E- 01	8.1
LYM20	11712. 2	A	92.9 72	2.19E01	1	LYM17 2	12301. 2	N	0.25	5.79E01	7.6
LYM14 5	12953. 5	A	93.9 25	2.34E01	2	LYM13 7	12153. 1	N	0.24 9	5.93E01	7.3
LYM53	11843. 2	A	92.9	2.43E01	0.9	LYM13 8	12562. 1	N	0.24 9	6.03E01	6.9
LYM12 5	12932. 8	A	97.2 38	2.56E01	5.6	LYM43	11791. 4	N	0.24 9	6.08E01	6.9
LYM28 4	12883. 5	A	95.3 09	2.58E01	3.5	LYM10 5	12294. 3	N	0.24 8	6.13E- 01	6.7
LYM41	11831. 5	A	93.3 47	2.68E01	1.4	LYM14 8	12171. 2	N	0.24 8	6.13E- 01	6.7
LYM28 4	12884. 7	A	93.4 92	2.80E01	1.6	LYM10 0	12131. 3	N	0.24 8	6.13E- 01	6.6
LYM12 5	12934. 7	A	92.5 35	2.81E01	0.5	LYM62	12022. 1	N	0.24 7	6.26E01	6.4
LYM26	11824. 3	A	94.2 93	2.82E01	2.4	LYM13 2	12276. 1	N	0.24 9	6.26E01	6.9
LYM27 7	13104. 9	A	94.2 32	3.03E01	2.4	LYM13 0	12331. 3	N	0.24 7	6.36E01	6.1
LYM15 6	12963. 4	A	93.3 22	3.23E01	1.4	LYM26	11824. 6	N	0.24 8	6.42E01	6.5
LYM27 7	13101. 1	A	93.4 57	3.32E01	1.5	LYM14	12052. 4	N	0.24 5	6.80E01	5.5
LYM27 7	13105. 7	A	93.1 65	3.34E01	1.2	LYM15 2	12376. 1	N	0.24 6	6.82E01	5.6
LYM88	12194. 2	A	92.7 73	3.50E01	0.8	LYM43	11792. 2	N	0.24 6	6.97E01	5.7
LYM30	11912. 7	A	93.3 71	3.68E01	1.4	LYM10 0	12134. 1	N	0.24 5	7.03E01	5.3
LYM10 3	12712. 5	A	94.0 13	3.80E01	2.1	LYM57	12012. 2	N	0.24 4	7.15E- 01	4.8
LYM11 6	13204. 4	A	92.4 11	4.06E01	0.4	LYM10 5	12297. 1	N	0.24 3	7.31E- 01	4.7
LYM99	12244. 1	A	92.8 73	4.11E01	0.9	LYM13 7	12152. 1	N	0.24 2	7.68E01	3.9
LYM57	12013. 5	A	92.8 67	4.13E01	0.9	LYM15 2	12372. 2	N	0.24 2	7.69E01	3.9
LYM12 8	12641. 1	A	92.4 36	4.13E01	0.4	LYM10 0	12133. 3	N	0.24 1	7.86E01	3.6
LYM11 0	12924. 5	A	93.5 92	4.13E01	1.7	LYM11 9	12462. 2	N	0.24 1	7.88E01	3.7

342

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM66	11953. 6	A	93.5 38	4.18E01	1.6	LYM24	12061. 2	N	0.24 1	7.97E01	3.6
LYM57	12012. 2	A	92.7 05	4.22E01	0.7	LYM14 3	12521. 2	N	0.24	8.16E- 01	3.1
LYM14 5	12952. 9	A	92.4 82	4.55E01	0.5	LYM14 8	12173. 1	N	0.24	8.22E01	3
LYM99	12241. 1	A	93.2 81	4.58E01	1.3	LYM69	11854. 2	N	0.23 9	8.47E01	2.5
LYM15 6	12961. 9	A	93.7 23	4.82E01	1.8	LYM14	12051. 4	N	0.23 7	8.82E01	2
LYM56	13112. 7	A	93.7 81	4.85E01	1.9	LYM13 2	12271. 4	N	0.23 7	8.82E01	2
LYM82	12201. 1	A	92.9 48	5.15E- 01	1	LYM29 0	12501. 3	N	0.23 7	8.83E01	2
LYM11 6	13202. 7	A	92.9 51	5.22E01	1	LYM26 8	12482. 1	N	0.23 8	8.83E01	2.3
LYM23 9	13041. 7	A	92.4 82	5.31E- 01	0.5	LYM15 2	12373. 1	N	0.23 7	9.00E01	1.9
LYM28 4	12884. 6	A	92.9 58	5.74E01	1	LYM25 4	12474. 4	N	0.23 7	9.03E01	1.9
LYM56	13112. 5	A	93.5 18	5.79E01	1.6	LYM68	11941. 4	N	0.23 6	9.24E01	1.3
LYM15 6	12963. 3	A	92.9 31	5.88E01	1	LYM13 0	12334. 1	N	0.23 5	9.24E01	1.2
LYM51	11893. 4	A	92.9 63	5.94E01	1	LYM11 1	12251. 1	N	0.23 5	9.41E01	1
LYM12 1	13211. 8	A	92.8 58	6.05E01	0.9	LYM14	12052. 5	N	0.23 5	9.44E01	0.9
LYM11 0	12923. 5	A	92.5 76	6.26E01	0.6	LYM66	11954. 4	N	0.23 5	9.46E01	1.1
LYM67	11782. 4	A	92.5 33	6.33E01	0.5	LYM14 0	12261. 1	N	0.23 4	9.57E01	0.8
LYM12	11871. 1	A	92.3 19	6.34E01	0.3	LYM15 2	12371. 2	N	0.23 4	9.76E01	0.4
LYM10 3	12713. 7	A	93.4 6	6.35E01	1.5	CONTR OL	—	N	0.23 3	—	0
LYM62	12022. 4	A	93.3 15	6.56E01	1.4	LYM13 4	12314. 2	O	2.87 7	1.57E- 04	44.9
LYM43	11793. 2	A	92.8 4	6.72E01	0.9	LYM26 8	12482. 3	O	2.82 7	2.54E04	42.3
LYM69	11852. 4	A	92.3 47	6.74E01	0.3	LYM13 8	12561. 1	o	3.13 2	7.56E04	57.7
LYM31	11923. 1	A	93.0 48	6.91E- 01	1.1	LYM43	11791. 5	o	2.97 8	3.01E- 03	49.9
LYM99	12244. 2	A	92.2 12	7.08E01	0.2	LYM10 0	12131. 2	o	3.09 7	5.61E- 03	55.9
LYM95	12121. 4	A	92.3 76	7.27E01	0.4	LYM17 0	12453. 2	o	2.58 9	6.69E03	30.3
LYM43	11792. 2	A	92.6 2	7.34E01	0.6	LYM14 0	12264. 1	o	2.55 7	7.02E03	28.7
LYM14	12052. 4	A	92.7 27	7.41E- 01	0.7	LYM57	12013. 5	o	2.67 2	1.45E02	34.6

343

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM66	11953. 1	A	92.6 66	7.44E01	0.7	LYM68	11942. 3	O	2.73 7	1.48E02	37.8
LYM 12	11872. 1	A	92.7 24	7.81E01	0.7	LYM 14 3	12524. 2	o	2.75 5	1.94E02	38.7
LYM23 8	12764. 8	A	92.2 36	7.83E01	0.2	LYM 14 8	12174. 1	o	3.67	2.35E02	84.8
LYM 11 6	13201. 8	A	92.4 84	7.84E01	0.5	LYM31	11923. 4	o	2.75 1	2.44E02	38.5
LYM82	12203. 3	A	92.1 75	8.22E01	0.1	LYM 13 0	12331. 3	o	2.36 3	2.49E02	19
LYM23 8	12761. 6	A	92.2 22	8.23E01	0.2	LYM69	11853. 5	o	2.57 2	4.76E02	29.5
LYM67	11781. 5	A	92.6 22	8.43E01	0.6	LYM29 0	12502. 4	o	2.80 9	5.25E02	41.4
LYM23 2	13024. 4	A	92.9 31	8.45E01	1	LYM 13 7	12151. 1	o	2.72	5.81E02	37
LYM67	11783. 5	A	92.1 82	8.54E01	0.1	LYM57	12012. 2	o	2.26 6	6.86E02	14.1
LYM88	12193. 1	A	92.1 08	8.99E01	0.1	LYM51	11893. 2	o	2.35 9	7.59E02	18.8
LYM20	11716. 3	A	92.2 57	9.05E01	0.2	LYM53	11841. 1	o	2.81 7	7.71E02	41.9
LYM 12 1	13214. 3	A	92.3 09	9.05E01	0.3	LYM 14	12052. 4	o	2.26 4	8.31E02	14
LYM23 2	13022. 1	A	92.2 36	9.28E01	0.2	LYM 13 2	12276. 1	o	2.27 4	9.43E02	14.5
LYM31	11921. 3	A	92.0 86	9.31E01	0	LYM 13 8	12561. 3	o	2.88 4	9.53E02	45.2
LYM27 1	12721. 8	A	92.2 1	9.39E01	0.2	LYM 14 8	12171. 2	o	2.63 8	1.02E01	32.8
LYM99	12243. 1	A	92.1 42	9.40E01	0.1	LYM68	11941. 4	o	2.22 3	1.03E01	11.9
LYM88	12193. 5	A	92.1 79	9.49E01	0.1	LYM 11 9	12462. 1	o	3.20 1	1.06E01	61.2
LYM 12 1	13211. 6	A	92.1 25	9.70E01	0.1	LYM 11 9	12462. 2	o	2.48 1	1.06E01	24.9
LYM69	11853. 5	A	92.0 63	9.73E01	0	LYM 13 7	12152. 1	o	2.22 6	1.08E01	12.1
LYM28 4	12882. 5	A	92.0 91	9.89E01	0	LYM68	11941. 3	o	2.67 3	1.27E01	34.6
LYM 12 5	12931. 5	A	92.0 65	9.94E01	0	LYM43	11791. 4	o	2.52	1.37E01	26.9
CONTR OL	—	A	92.0 48	—	0	LYM 11 1	12252. 2	o	4.44 9	1.69E01	124
LYM95	12124. 4	B	0.39 1	1.15E01	8.6	LYM 13 0	12334. 1	o	2.17 9	1.70E01	9.7
LYM69	11852. 2	B	0.38 8	1.69E01	7.7	LYM 10 5	12294. 3	o	2.35	1.77E01	18.3
LYM51	11891. 1	B	0.42 1	3.86E01	16.9	LYM30	11913. 5	o	2.49 5	2.05E01	25.6
LYM66	11953. 6	B	0.37 6	4.19E01	4.3	LYM26 8	12481. 1	o	2.31 1	2.11E01	16.4

344

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM67	11782. 6	B	0.40 8	4.83E01	13.3	LYM 14 8	12173. 1	O	2.29	2.22E01	15.3
LYM66	11954. 4	B	0.37 2	5.30E01	3.2	LYM 10 0	12131. 3	o	2.16 8	2.24E01	9.2
LYM99	12244. 1	B	0.36 9	6.38E01	2.4	LYM68	11943. 2	o	2.55 9	2.28E01	28.9
LYM67	11782. 4	B	0.37 4	6.79E01	3.9	LYM 15 2	12372. 2	o	2.21 5	2.44E01	11.5
LYM99	12243. 1	B	0.36 5	8.06E01	1.3	LYM 13 7	12154. 5	o	2.42 6	2.44E01	22.1
LYM43	11793. 2	B	0.37 4	8.36E01	3.9	LYM 10 5	12295. 2	o	2.33	2.62E01	17.3
LYM31	11924. 4	B	0.36 9	9.06E01	2.5	LYM 13 0	12332. 2	o	2.42 4	2.81E01	22.1
LYM57	12013. 3	B	0.36 3	9.80E01	0.8	LYM 17 2	12301. 2	o	2.42 5	2.87E01	22.1
CONTR OL	—	B	0.36	—	0	LYM29 0	12501. 3	o	2.27 2	2.90E01	14.4
LYM95	12124. 4	C	4.28 1	2.01E03	22.8	LYM68	11942. 2	o	2.35 5	3.00E01	18.6
LYM66	11953. 6	C	4.23 8	4.68E03	21.6	LYM62	12022. 1	o	2.26 6	3.17E01	14.1
LYM67	11782. 4	C	4.00 6	2.07E02	14.9	LYM57	12012. 6	o	2.23 2	3.21E01	12.4
LYM99	12244. 1	C	4.00 6	2.94E02	14.9	LYM 11 1	12254. 4	o	2.46 4	3.28E01	24
LYM99	12243. 2	C	3.96 9	3.28E02	13.9	LYM 11 1	12251. 3	o	2.40 4	3.30E01	21
LYM66	11954. 4	C	3.91 3	3.91E02	12.3	LYM30	11912. 6	o	2.56 3	3.48E01	29
LYM69	11852. 2	C	3.93 1	5.24E02	12.8	LYM51	11894. 2	o	2.14	3.52E01	7.8
LYM67	11782. 5	C	3.87 5	5.34E02	11.2	LYM53	11844. 2	o	2.52 1	3.61E01	26.9
LYM82	12203. 3	C	3.81 3	9.88E02	9.4	LYM 13 7	12153. 1	o	2.25 2	3.67E01	13.4
LYM88	12194. 2	C	3.79 4	1.08E01	8.8	LYM62	12021. 1	o	2.47 2	3.77E01	24.5
LYM51	11891. 1	C	3.81 3	1.95E01	9.4	LYM 13 2	12271. 4	o	2.22 1	4.01E01	11.8
LYM53	11841. 1	C	3.74 4	2.04E01	7.4	LYM51	11893. 4	o	2.82 2	4.03E01	42.1
LYM43	11791. 5	C	3.68 1	2.86E01	5.6	LYM 11 9	12461. 1	o	3.04 9	4.11E01	53.5
LYM99	12241. 1	C	3.65	3.67E01	4.7	LYM 15 2	12376. 1	o	2.31 4	4.14E01	16.5
LYM67	11782. 6	C	4.25	3.83E01	21.9	LYM 10 0	12134. 1	o	2.21 7	4.18E01	11.6
LYM53	11841. 2	C	3.63 1	4.57E01	4.2	LYM 11 1	12254. 3	o	2.78 9	4.58E01	40.4
LYM82	12201. 5	C	3.79 4	4.71E01	8.8	LYM 10 0	12133. 3	o	2.08 7	4.87E01	5.1

345

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM43	11793. 2	C	3.79 4	5.39E01	8.8	LYM14 3	12524. 7	O	2.93	4.89E01	47.6
LYM67	11783. 5	c	3.59 4	6.03E01	3.1	LYM15 2	12372. 1	o	2.57 2	4.90E01	29.5
LYM53	11842. 4	c	3.57 5	6.17E01	2.6	LYM14 3	12521. 2	o	2.07 3	5.09E01	4.4
LYM99	12243. 1	c	3.58 8	6.17E01	2.9	LYM14	12051. 4	o	2.14 8	5.20E01	8.2
LYM82	12201. 1	c	3.56 9	6.50E01	2.4	LYM29 0	12502. 2	o	2.38 3	5.23E01	20
LYM51	11893. 4	c	3.59	6.68E01	3	LYM67	11783. 5	o	2.30 7	5.53E01	16.2
LYM88	12193. 1	c	3.69 4	7.08E01	6	LYM26	11824. 6	o	2.20 5	5.59E01	11
LYM88	12193. 5	c	3.68 1	7.16E01	5.6	LYM13 4	12312. 4	o	2.11 6	5.72E01	6.5
LYM69	11854. 2	c	3.55 6	7.53E01	2	LYM13 2	12275. 1	o	2.06 7	6.20E01	4.1
LYM66	11955. 2	c	3.62 5	8.66E01	4	LYM53	11842. 4	o	2.28 9	6.36E01	15.3
LYM51	11892. 1	c	3.5	9.37E01	0.4	LYM43	11792. 2	o	2.17 4	6.56E01	9.4
CONTR OL	—	c	3.48 5	—	0	LYM11 9	12461. 4	o	2.11 5	6.64E01	6.5
LYM11 6	13202. 12	D	0.37 9	1.40E05	41.9	LYM30	11912. 7	o	2.11 5	6.90E01	6.5
LYM67	11782. 6	D	0.33 7	4.39E04	26.2	LYM13 8	12562. 1	o	2.12 8	7.14E01	7.1
LYM12 8	12641. 5	D	0.36 4	8.83E04	36.4	LYM43	11793. 2	o	2.16 2	7.20E01	8.9
LYM20	11711. 2	D	0.36 3	8.90E04	36.1	LYM30	11913. 3	o	2.06 4	7.61E01	3.9
LYM23 8	12764. 8	D	0.33 4	7.05E03	25.3	LYM16 2	12231. 3	o	2.09 6	7.65E01	5.6
LYM88	12193. 1	D	0.29 8	2.70E02	11.8	LYM95	12124. 4	o	2.03 2	7.69E01	2.3
LYM12	11871. 3	D	0.29 8	3.76E02	11.8	LYM67	11782. 4	o	2.03 5	8.22E01	2.5
LYM11 6	13202. 7	D	0.32 1	3.92E02	20.2	LYM15 3	12321. 2	o	2.05 1	8.30E01	3.3
LYM23 9	13042. 9	D	0.33	5.21E02	23.8	LYM15 2	12371. 2	o	2.07 1	8.45E01	4.3
LYM53	11841. 1	D	0.30 3	7.50E02	13.5	LYM25 4	12474. 4	o	2.10 7	8.58E01	6.1
LYM26	11824. 3	D	0.31 2	8.07E02	17	LYM26 8	12482. 1	o	2.11 1	8.72E01	6.3
LYM99	12243. 1	D	0.34 8	8.18E02	30.4	LYM69	11854. 2	o	2.00 6	9.07E01	1
LYM31	11923. 4	D	0.28 9	1.00E01	8.3	LYM31	11922. 3	o	2.00 8	9.14E01	1.1
LYM31	11924. 4	D	0.29 7	1.21E01	11.4	LYM15 2	12373. 1	o	2.03	9.27E01	2.2

346

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM66	11955. 2	D	0.28 9	1.36E- 01	8.5	LYM69	11852. 4	O	2.00 6	9.29E01	1
LYM53	11843. 2	D	0.28 7	1.41E- 01	7.7	LYM26	11824. 5	o	1.99 5	9.47E01	0.5
LYM26	11824. 6	D	0.32 7	1.42E- 01	22.4	LYM26 8	12483. 2	o	2.00 7	9.62E01	1.1
LYM28 5	12733. 9	D	0.38	1.57E- 01	42.3	CONTR OL	—	o	1.98 6	—	0
LYM20	11716. 5	D	0.29 2	1.84E- 01	9.5	LYM68	11941. 3	P	2.99 1	4.57E04	24.7
LYM 10 3	12713. 5	D	0.34 6	1.85E- 01	29.6	LYM 13 4	12314. 2	P	2.97 4	5.82E04	24
LYM24	12061. 4	D	0.32 7	1.93E- 01	22.7	LYM 14 8	12174. 1	P	3.46 1	9.68E04	44.3
LYM 14	12051. 4	D	0.30 7	1.94E- 01	15	LYM57	12013. 5	P	2.90 1	1.36E- 03	20.9
LYM26	11824. 1	D	0.33 8	1.97E01	26.8	LYM26 8	12482. 3	P	2.94 5	2.74E03	22.8
LYM23 8	12763. 7	D	0.28 3	1.97E01	6.1	LYM31	11923. 4	P	2.94 4	2.83E03	22.7
LYM66	11954. 4	D	0.32 2	2.07E01	20.7	LYM 14 0	12264. 1	P	2.79 1	5.07E03	16.4
LYM 12	11872. 1	D	0.40 4	2.11E01	51.6	LYM 10 0	12131. 2	P	3.08 5	6.47E03	28.6
LYM99	12244. 2	D	0.28 3	2.45E01	6.2	LYM 13 0	12331. 3	P	2.71 2	1.54E02	13
LYM 12	11871. 1	D	0.33 4	2.71E01	25.1	LYM 14 8	12171. 2	P	2.74 8	1.78E02	14.5
LYM 12 8	12641. 3	D	0.32 5	2.98E01	21.7	LYM51	11893. 2	P	2.69 9	1.88E02	12.5
LYM23 9	13044. 8	D	0.30 2	3.23E01	13	LYM 13 8	12561. 1	P	3.15 4	2.51E02	31.5
LYM23 2	13024. 6	D	0.29 5	3.63E01	10.7	LYM69	11853. 5	P	2.96 8	2.79E02	23.7
LYM 10 3	12712. 8	D	0.30 5	3.64E01	14.3	LYM29 0	12502. 4	P	2.88 6	2.85E02	20.3
LYM95	12121. 2	D	0.33 2	3.79E01	24.5	LYM 17 0	12453. 2	P	2.70 3	2.98E02	12.7
LYM95	12124. 4	D	0.28 9	4.16E01	8.4	LYM 14 3	12524. 2	P	2.94 3	3.25E02	22.7
LYM69	11852. 2	D	0.28 1	4.94E01	5.2	LYM68	11942. 3	P	2.86 6	3.61E- 02	19.5
LYM 15 6	12963. 1	D	0.29	5.11E- 01	8.6	LYM53	11841. 1	P	2.97 1	4.36E02	23.9
LYM82	12201. 1	D	0.27 5	5.11E- 01	3.1	LYM57	12012. 2	P	2.62 9	5.16E- 02	9.6
LYM67	11782. 4	D	0.28 8	5.17E- 01	8.1	LYM 11 9	12462. 1	P	3.13 4	6.34E02	30.7
LYM30	11912. 6	D	0.29	5.57E01	8.6	LYM 13 7	12152. 1	P	2.59 6	8.59E02	8.2
LYM24	12064. 1	D	0.3	5.74E01	12.5	LYM62	12022. 1	P	2.63	8.66E02	9.6

347

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM26	11824. 5	D	0.30 9	6.01E01	15.9	LYM 13 8	12561. 3	P	3.01 4	8.88E02	25.6
LYM23 2	13024. 7	D	0.33	6.01E01	23.6	LYM 13 7	12151. 1	P	2.92 6	9.19E02	22
LYM30	11912. 7	D	0.27 7	6.08E01	3.7	LYM 13 7	12153. 1	P	2.70 2	9.26E02	12.6
LYM26	11821. 2	D	0.28 6	6.37E01	7.3	LYM 13 0	12332. 2	P	2.67 3	1.06E01	11.4
LYM 10 3	12711. 8	D	0.27 3	6.74E01	2.5	LYM43	11791. 5	P	2.94 9	1.06E01	22.9
LYM 10 3	12712. 5	D	0.27 3	6.81E01	2.3	LYM43	11791. 4	P	2.73 9	1.20E01	14.2
LYM 11 6	13204. 4	D	0.31	7.10E01	16.3	LYM 11 1	12252. 2	P	3.85	1.23E01	60.5
LYM62	12023. 2	D	0.27 3	7.33E01	2.2	LYM 10 5	12295. 2	P	2.70 5	1.58E01	12.8
LYM 12 8	12641. 1	D	0.27 9	7.45E01	4.4	LYM 10 0	12131. 3	P	2.55 1	1.66E01	6.3
LYM57	12012. 2	D	0.27 1	7.62E01	1.4	LYM30	11913. 5	P	2.82 3	1.67E01	17.7
LYM66	11953. 6	D	0.27	7.80E01	1.3	LYM 13 7	12154. 5	P	2.67 4	1.74E01	11.5
LYM31	11921. 3	D	0.26 9	8.84E01	1	LYM 10 0	12134. 1	P	2.62 5	1.75E01	9.4
LYM30	11913. 5	D	0.27 3	8.96E01	2.4	LYM 11 9	12462. 2	P	2.68 3	1.81E01	11.8
LYM 15 6	12961. 9	D	0.26 8	9.20E01	0.6	LYM 13 0	12334. 1	P	2.54 3	2.00E01	6
LYM 14 5	12951. 9	D	0.26 7	9.76E01	0.2	LYM30	11912. 6	P	2.79 4	2.04E01	16.5
CONTR OL	—	D	0.26 7	—	0	LYM68	11941. 4	P	2.53 5	2.13E01	5.7
LYM26	11824. 3	E	8.81 3	2.28E03	8.7	LYM 10 5	12294. 3	P	2.68 5	2.22E01	11.9
LYM82	12201. 1	E	9.12 5	4.62E03	12.5	LYM68	11943. 2	P	2.85 3	2.25E01	18.9
LYM28 5	12733. 9	E	9	7.67E03	11	LYM26 8	12481. 1	P	2.67 2	2.31E01	11.4
LYM24	12064. 1	E	8.62 5	9.72E03	6.4	LYM 11 1	12251. 3	P	2.68 9	2.51E01	12.1
LYM53	11841. 1	E	8.87 5	1.34E02	9.4	LYM 14	12052. 4	P	2.60 9	2.63E01	8.8
LYM 12	11872. 1	E	8.56 3	2.18E02	5.6	LYM 13 4	12312. 4	P	2.51 8	2.68E01	4.9
LYM95	12121. 2	E	9.31 3	2.37E02	14.8	LYM 11 1	12254. 4	P	2.75 3	2.72E01	14.7
LYM31	11923. 4	E	8.75	2.50E02	7.9	LYM57	12012. 6	P	2.52 4	2.86E01	5.2
LYM43	11791. 4	E	8.75	2.50E02	7.9	LYM62	12021. 1	P	2.82 7	2.91E01	17.8
LYM99	12243. 2	E	8.75	2.50E02	7.9	LYM 15 2	12372. 2	P	2.62 3	3.12E01	9.3

348

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM 12 8	12641. 5	E	9.18 8	3.04E02	13.3	LYM 14 3	12521. 2	P	2.53 9	3.29E01	5.8
LYM67	11782. 6	E	8.62 5	4.97E02	6.4	LYM53	11844. 2	P	2.85 1	3.42E01	18.8
LYM99	12244. 2	E	8.62 5	4.97E02	6.4	LYM 17 2	12301. 2	P	2.68 8	3.44E01	12.1
LYM66	11954. 4	E	8.93 8	5.42E02	10.2	LYM67	11783. 5	P	2.69 8	3.48E01	12.5
LYM99	12243. 1	E	9.25	7.13E02	14.1	LYM51	11893. 4	P	2.94 2	3.50E01	22.6
LYM30	11913. 4	E	8.43 8	7.36E02	4	LYM 13 2	12271. 4	P	2.56 9	3.58E01	7.1
LYM66	11953. 6	E	8.43 8	7.36E02	4	LYM29 0	12502. 2	P	2.69 4	3.87E01	12.3
LYM95	12124. 4	E	8.43 8	7.36E02	4	LYM 11 9	12461. 1	P	3.08 3	3.95E01	28.5
LYM 12 8	12641. 3	E	8.81 3	7.63E02	8.7	LYM68	11942. 2	P	2.67 3	3.96E01	11.4
LYM 10 3	12713. 5	E	8.5	1.05E01	4.8	LYM 15 2	12376. 1	P	2.63 2	4.09E01	9.7
LYM26	11824. 6	E	8.5	1.05E01	4.8	LYM 13 8	12562. 1	P	2.59	4.09E01	8
LYM24	12061. 4	E	9	1.06E01	11	LYM29 0	12501. 3	P	2.57 1	4.21E01	7.2
LYM23 8	12764. 8	E	8.68 8	1.12E01	7.1	LYM51	11891. 1	P	2.50 1	4.32E01	4.2
LYM 14 5	12951. 9	E	8.37 5	1.13E01	3.3	LYM 11 1	12254. 3	P	2.96 4	4.42E01	23.6
LYM88	12194. 2	E	8.56 3	1.73E01	5.6	LYM 14 3	12524. 7	P	2.92 8	4.42E01	22
LYM26	11824. 1	E	8.75	1.74E01	7.9	LYM95	12124. 4	P	2.48 5	4.88E01	3.6
LYM20	11711. 2	E	8.93 8	1.81E01	10.2	LYM 14 8	12173. 1	P	2.55 1	4.89E01	6.3
LYM 14	12051. 4	E	8.81 3	2.22E01	8.7	LYM 15 2	12372. 1	P	2.81 6	5.25E01	17.4
LYM 11 6	13202. 12	E	8.37 5	2.33E01	3.3	LYM 10 0	12133. 3	P	2.50 1	5.25E01	4.3
LYM99	12241. 1	E	8.37 5	2.33E01	3.3	LYM26	11824. 6	P	2.61 9	5.33E01	9.2
LYM30	11912. 6	E	8.31 3	2.38E01	2.5	LYM 11 1	12251. 1	P	2.46 3	5.41E01	2.7
LYM23 9	13042. 9	E	8.43 8	2.80E01	4	LYM51	11894. 2	P	2.46 2	5.54E01	2.6
LYM69	11852. 2	E	8.93 8	2.86E01	10.2	LYM 14	12051. 4	P	2.53 4	5.68E01	5.6
LYM 12 8	12641. 1	E	8.5	3.24E01	4.8	LYM 10 5	12297. 1	P	2.47 5	5.86E01	3.1
LYM57	12012. 2	E	8.5	3.24E01	4.8	LYM 13 2	12276. 1	P	2.53 2	5.96E01	5.5
LYM31	11921. 3	E	8.55 4	3.53E01	5.5	LYM43	11792. 2	P	2.56 4	6.02E01	6.9

349

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM66	11955. 2	E	8.93 8	3.68E01	10.2	LYM30	11913. 3	P	2.45 6	6.49E01	2.4
LYM88	12193. 1	E	8.62 5	3.80E01	6.4	LYM 16 2	12231. 3	P	2.49 6	6.50E01	4.1
LYM66	11952. 2	E	8.37 5	4.66E01	3.3	LYM30	11913. 4	P	2.47 2	6.77E01	3
LYM23 2	13024. 7	E	8.31 3	4.68E01	2.5	LYM 11 9	12461. 4	P	2.51 5	7.10E- 01	4.9
LYM99	12244. 1	E	8.43 8	4.71E01	4	LYM 15 2	12371. 2	P	2.50 8	7.20E01	4.5
LYM31	11924. 4	E	8.56 3	4.80E01	5.6	LYM53	11842. 4	P	2.58 9	7.25E01	7.9
LYM51	11891. 1	E	8.25	5.02E01	1.7	LYM43	11793. 2	P	2.53 5	7.25E01	5.7
LYM53	11842. 4	E	8.25	5.02E01	1.7	LYM30	11912. 7	P	2.44 2	7.59E01	1.8
LYM62	12023. 5	E	8.25	5.02E01	1.7	LYM 15 2	12373. 1	P	2.50 3	7.68E01	4.3
LYM62	12023. 2	E	8.68 8	5.52E01	7.1	LYM26	11824. 5	P	2.42 8	7.79E01	1.2
LYM 12	11873. 4	E	8.43 8	5.87E01	4	LYM 13 2	12275. 1	P	2.42 4	8.07E01	1.1
LYM 12	11871. 3	E	8.18 8	6.37E01	1	LYM69	11852. 4	P	2.43 9	8.44E01	1.7
LYM53	11843. 2	E	8.18 8	6.37E01	1	LYM31	11922. 3	P	2.42 5	8.59E01	1.1
LYM67	11782. 4	E	8.43 8	6.63E01	4	LYM25 4	12474. 4	P	2.48 7	8.63E01	3.7
LYM43	11793. 2	E	8.43 8	7.17E01	4	LYM26 8	12482. 1	P	2.47 1	8.81E- 01	3
LYM26	11821. 2	E	8.31 3	7.24E01	2.5	LYM66	11954. 4	P	2.47 8	8.96E01	3.3
LYM 12	11871. 1	E	8.5	7.33E01	4.8	LYM 15 3	12321. 2	P	2.42 3	9.16E01	1
LYM23 9	13044. 8	E	8.18 8	7.69E01	1	LYM29 0	12502. 1	P	2.41 1	9.36E01	0.5
LYM28 5	12734. 9	E	8.31 3	7.80E01	2.5	LYM62	12022. 2	P	2.41 2	9.44E01	0.5
LYM43	11791. 5	E	8.12 5	9.18E01	0.2	LYM67	11782. 4	P	2.40 6	9.49E01	0.3
LYM 11 6	13204. 4	E	8.18 8	9.28E01	1	LYM 16 2	12234. 3	P	2.4	9.95E01	0
LYM30	11913. 5	E	8.18 8	9.28E01	1	CONTR OL	—	P	2.39 9	—	0
LYM23 2	13024. 6	E	8.12 5	9.39E01	0.2
LYM30	11912. 7	E	8.18 8	9.39E01	1
LYM67	11782. 5	E	8.12 5	9.62E01	0.2
LYM26	11824. 5	E	8.12 5	9.89E01	0.2

350

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
CONTR OL	—	E	8.10 9	—	0

Table 32. Results of the greenhouse experiments. Provided are the measured values of each tested parameter [parameters (ID.) A-P according to the parameters described in Table 31 above] in plants expressing the indicated polynucleotides. “Ev” = event; “P” = P-value; “Mean ” = the average of measured parameter across replicates. % incr. vs. cont. = percentage of increase versus control (as compared to control).

EXAMPLE 11

IMPROVED TRANSGENIC PLANT PERFORMANCE - TISSUE CULTURE ASSAYS

To analyze the effect of expression of the isolated polynucleotides in plants, plants performance was tested in tissue culture.

Plant growth under favorable conditions in tissue culture using T1 or T2 plants - The experiments used either T2 seeds (T2 experiments herein below) or T1 seeds (T1 experiments herein below). Surface sterilized T1 or T2 seeds were sown in basal media [50% Murashige-Skoog medium (MS) supplemented with 0.8% plant agar as solidifying agent] in the presence of Kanamycin (for selecting only transgenic plants). After sowing, plates were transferred for 2-3 days for stratification at 4 °C and then grown at 25 °C under 12-hour light 12-hour dark daily cycles for 7 to 10 days. At this time point, at T2 experiments seedlings randomly chosen were carefully transferred to plates containing 0.5 MS media. Each plate contained 5 seedlings of the same transgenic event, and 3-4 different plates (replicates) for each event. For each polynucleotide of the invention at least four independent transformation events were analyzed from each construct. Plants expressing the polynucleotides of the invention were compared to the average measurement of the control plants (empty vector or GUS reporter gene under the same promoter) used in the same experiment. Alternatively, at T1 experiments seedlings randomly chosen were carefully transferred to plates containing 0.5 MS media. Each plate contained 5 T1 seedlings representing 5 independent transgenic events, and 3-4 different plates (total of 15-20 events). Plants expressing the polynucleotides of the invention were compared to the average

2018271407 30 Nov 2018

351 measurement of the control plants (empty vector or GUS reporter gene under the same promoter) used in the same experiment.

Plant growth under low nitrogen conditions in Tissue culture using T2 plants - Surface sterilized seeds were sown in basal media [50 % Murashige-Skoog medium (MS) supplemented with 0.8 % plant agar as solidifying agent] in the presence of Kanamycin (used as a selecting agent). After sowing, plates were transferred for 2-3 days for stratification at 4 °C and then grown at 25 °C under 12-hour light 12-hour dark daily cycles for 7 to 10 days. At this time point, seedlings randomly chosen were carefully transferred to plates containing % MS media (15 mM N) for the normal nitrogen concentration treatment and 0.75 mM nitrogen for the low nitrogen concentration treatments. Each plate contained 5 seedlings of the same transgenic event, and 3-4 different plates (replicates) for each event. For each polynucleotide of the invention at least four independent transformation events were analyzed from each construct. Plants expressing the polynucleotides of the invention were compared to the average measurement of the control plants (empty vector or GUS reporter gene under the same promoter) used in the same experiment.

For both experiments the same plant parameters were being measured and being described below:

Digital imaging - A laboratory image acquisition system, which consists of a digital reflex camera (Canon EOS 300D) attached with a 55 mm focal length lens (Canon EF-S series), mounted on a reproduction device (Kaiser RS), which included 4 light units (4x150 Watts light bulb) and located in a darkroom, is used for capturing images of plantlets sawn in agar plates.

The image capturing process is repeated every 4 days starting at day 1 till day 10. An image analysis system was used, which consists of a personal desktop computer (Intel P4 3.0 GHz processor) and a public domain program - ImageJ 1.39 [Java based image processing program which was developed at the U.S. National Institutes of Health and freely available on the internet at Hypertext Transfer Protocol://rsbweb (dot) nih (dot) gov/]. Images were captured in resolution of 10 Mega Pixels (3888 x 2592 pixels) and stored in a low compression JPEG (Joint Photographic Experts Group standard) format. Next, analyzed data was saved to text files and processed using the JMP statistical analysis software (SAS institute).

2018271407 30 Nov 2018

352

Seedling analysis - Using the digital analysis seedling data was calculated, including leaf area, root coverage and root length.

The relative growth rate for the various seedling parameters was calculated according to the following formulas XVII, VII and XVIII.

Formula XVII:

Relative growth rate of leaf area = Regression coefficient of leaf area along time course.

Formula VII (above) Relative growth rate of root coverage = Regression coefficient of root coverage along time course.

Formula XVIII:

Relative growth rate of root length = Regression coefficient of root length along time course.

At the end of the experiment, plantlets were removed from the media and weighed for the determination of plant fresh weight. Plantlets were then dried for 24 hours at 60 °C, and weighed again to measure plant dry weight for later statistical analysis. Growth rate is determined by comparing the leaf area coverage, root coverage and root length, between each couple of sequential photographs, and results were used to resolve the effect of the gene introduced on plant vigor under optimal conditions. Similarly, the effect of the gene introduced on biomass accumulation, under optimal conditions, is determined by comparing the plants' fresh and dry weight to that of control plants (containing an empty vector or the GUS reporter gene under the same promoter). From every construct created, 3-5 independent transformation events were examined in replicates.

Statistical analyses - To identify genes conferring significantly improved plant vigor or enlarged root architecture, the results obtained from the transgenic plants were compared to those obtained from control plants. To identify outperforming genes and constructs, results from the independent transformation events tested were analyzed separately (T2 experiments) or as average of events (T1 experiments). To evaluate the effect of a gene event (T2 experiments) or gene (T1 experiment) over a control the data is analyzed by Student’s t-test and the p value is calculated. Results were considered significant if p < 0.1. The JMP statistics software package was used (Version 5.2.1, SAS Institute Inc., Cary, NC, USA).

2018271407 30 Nov 2018

353

Tables 33, 35 and 37 specify the parameters measured in plants in the tissue culture assays (T2 plants, T1 plants and low nitrogen T2 plants).

Experimental Results

Plants expressing the polynucleotides of the invention were assayed for a 5 number of commercially desired traits. In cases where a certain event appears more than once, the event was tested in several independent experiments.

Table 33

Measured parameters at the tissue culture assay (T2 experiment) for transformed agriculture improving trait genes

Tested Parameters	ID
Dry Weight (gr)	A
Fresh Weight (gr)	B
RGR Of Root Coverage	C
Roots Coverage TP3 (cm2)	D
RGR Of Roots Length	E
Roots Length TP3 (cm)	F
Leaf Area TP3 (cm)	G
RGR Of Leaf Area	H
Table 33: Provided are the identification (ID) letters o	each of the Tested

Parameters. TP3 -Time Point 3; RGR- Relative Growth Rate.

Table 34

Results obtained in a T2 experiment at the tissue culture assay

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM37	11801. 2	A	0.00 7	4.96E04	60.3	LYMl	1160 2.6	H	0.10 4	0.00E +00	124
LYM34	11902. 2	A	0.00 6	2.28E02	33.5	LYM132	1227 5.3	H	0.08 5	0.00E +00	82.4
LYM34	11904. 3	A	0.00 6	7.24E02	27.6	LYM178	1216 4.3	H	0.10 6	0.00E +00	128.4
LYM34	11901. 1	A	0.00 5	8.11E02	15.8	LYM132	1227 1.4	H	0.07 5	1.00E- 06	61.2
LYM35	11813. 5	A	0.00 5	8.90E02	14.7	LYMl	1160 1.1	H	0.07 4	2.00E06	60.1
CONTR OL	—	A	0.00 5	—	0	LYM178	1216 3.3	H	0.09 3	2.00E06	100.8
LYM34	11904. 3	B	0.11 9	8.41E02	27.7	LYM132	1227 6.1	H	0.08 6	6.00E06	84.4
LYM35	11813. 5	B	0.10 9	9.32E02	16.8	LYM134	1231 4.2	H	0.07 5	3.10E- 05	61.1
CONTR OL	—	B	0.09 3	—	0	LYM6	1173 6.1	H	0.07 7	5.10E- 05	66

354

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM37	11801. 1	C	0.69 7	1.40E- 05	69.9	LYM268	1248 2.1	H	0.07 2	6.60E05	54.4
LYM 12	11874. 1	c	0.59	3.88E02	43.9	LYM 129	1257 3.5	H	0.07 8	1.22E04	68.6
LYM35	11813. 5	c	0.51 8	7.38E02	26.2	LYM1	1160 3.2	H	0.06 6	5.10E04	42.6
LYM37	11803. 2	c	0.52 7	8.20E02	28.3	LYM268	1248 3.2	H	0.07 2	5.20E04	54.1
LYM34	11902. 2	c	0.50 5	9.84E02	23.1	LYM134	1231 3.2	H	0.09 8	8.99E04	111.5
CONTR OL	—	c	0.41	—	0	LYM178	1216 4.2	H	0.06 4	I.35E03	37.5
LYM37	11801. 1	D	6.17 8	1.90E- 05	69.5	LYM5	1243 2.1	H	0.07 2	1.67E03	54.4
LYM41	11831. 5	D	4.33 1	7.99E02	18.8	LYM268	1248 3.4	H	0.07	3.94E03	50.7
CONTR OL	—	D	3.64 5	—	0	LYM268	1248 2.3	H	0.06 4	5.44E03	36.9
LYM37	11801. 1	E	0.5	9.40E05	48.1	LYM5	1243 5.1	H	0.06 7	9.04E03	44.9
LYM34	11902. 4	E	0.43 4	4.61E03	28.8	LYM6	1173 5.1	H	0.06 4	1.69E02	37.6
LYM 12	11871. 1	E	0.42 1	1.67E02	24.7	LYM6	1173 5.2	H	0.05 9	1.93E02	27.1
LYM 12	11874. 1	E	0.47 5	2.60E02	40.6	LYM 129	1257 2.2	H	0.05 9	2.39E02	26.6
LYM 12	11873. 4	E	0.43 7	2.78E02	29.5	LYM 129	1257 1.3	H	0.06 1	5.64E02	31
LYM 12	11872. 1	E	0.41 9	3.43E02	24.3	LYM132	1227 3.2	H	0.06 1	6.13E02	32.2
LYM37	11803. 2	E	0.44	4.37E02	30.4	LYM1	1160 2.1	H	0.05 7	6.26E02	21.7
LYM134	12312. 3	E	0.41 3	4.44E02	22.3	LYM5	1243 6.2	H	0.05 9	8.93E02	27.3
LYM178	12164. 2	E	0.45 5	4.69E02	34.8	CONTR OL	—	H	0.04 6	—	0
LYM34	11903. 3	E	0.41 8	4.86E02	24	LYM236	1259 4.3	A	0.00 8	1.51E03	116.1
LYM41	11831. 1	E	0.41	5.41E- 02	21.5	LYM254	1247 1.1	A	0.00 8	2.78E03	98.7
LYM178	12161. 1	E	0.40 3	7.68E02	19.6	LYM 162	1223 1.1	A	0.00 6	3.13E03	46.6
LYM41	11833. 1	E	0.41 5	8.54E02	23.1	LYM42	1199 2.2	A	0.00 6	4.31E03	47.3
CONTR OL	—	E	0.33 7	—	0	LYM148	1217 1.2	A	0.00 6	5.66E03	53.1
LYM37	11801. 1	F	6.04 7	6.62E04	37	LYM 170	1245 2.3	A	0.00 8	1.06E02	100.6
LYM34	11902. 4	F	5.24 6	9.78E04	18.8	LYM250	1261 3.2	A	0.00 8	1.81E02	93.6
LYM41	11831. 5	F	5.45	2.57E03	23.5	LYM 172	1230 1.3	A	0.00 5	2.24E02	40.8
LYM41	11831.	F	5.58	4.3 IE-	26.5	LYM206	1260	A	0.00	2.33E-	69.1

355

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
	1		3	03			3.2		7	02
LYM 12	11873. 4	F	5.77 6	1.16E02	30.8	LYM236	1259 2.3	A	0.01 1	2.33E02	194.5
LYM37	11801. 2	F	5.41 1	1.89E02	22.6	LYM 140	1226 1.4	A	0.00 5	2.36E02	37.6
LYM178	12161. 1	F	5.19 7	2.62E02	17.7	LYM236	1259 1.1	A	0.00 8	4.87E02	94.9
LYM35	11813. 5	F	5.42 1	3.01E02	22.8	LYM 172	1230 4.1	A	0.00 6	5.05E02	46
LYM 12	11871. 1	F	4.91	3.40E02	11.2	LYM 170	1245 3.3	A	0.00 8	5.28E02	102.6
LYM34	11903. 3	F	5.27 1	5.80E02	19.4	LYM99	1224 4.2	A	0.00 5	5.35E02	31.8
LYM 12	11872. 1	F	4.93 3	9.08E02	11.8	LYM 176	1238 5.1	A	0.00 8	6.09E02	92.9
LYM37	11803. 2	F	5.32 5	9.97E02	20.6	LYM254	1247 3.1	A	0.00 6	6.78E02	51.1
CONTR OL	—	F	4.41 4	—	0	LYM206	1260 1.3	A	0.00 5	8.81E02	23.5
LYM34	11902. 2	G	0.51	1.12E04	35.6	CONTR OL	—	A	0.00 4	—	0
LYM132	12271. 4	G	0.53 5	1.40E04	42.2	LYM250	1261 3.2	B	0.15 5	1.17E03	115.8
LYM37	11801. 1	G	0.53	3.38E03	41.1	LYM 170	1245 2.3	B	0.15	1.88E03	108.2
LYM35	11813. 5	G	0.53 2	4.76E03	41.6	LYM 140	1226 1.4	B	0.10 3	2.97E03	42.9
LYM41	11831. 5	G	0.48 5	5.92E03	29.1	LYM254	1247 1.1	B	0.14 6	4.61E03	103.2
LYM34	11904. 3	G	0.51 1	1.03E02	36	LYM42	1199 2.2	B	0.11 2	6.00E03	55
LYM37	11801. 2	G	0.55 3	2.50E02	47.2	LYM236	1259 4.3	B	0.16 6	7.83E03	130.6
LYM35	11814. 1	G	0.49 6	4.22E02	31.9	LYM148	1217 1.2	B	0.11 8	9.52E03	63.8
LYM37	11803. 2	G	0.46	4.24E02	22.3	LYM99	1224 4.2	B	0.09 4	1.23E02	31
LYM35	11812. 4	G	0.49 5	4.88E02	31.7	LYM89	1221 1.2	B	0.15 7	1.54E02	117.7
LYM37	11802. 2	G	0.69 8	5.08E02	85.6	LYM 162	1223 1.1	B	0.10 9	1.59E02	52
LYM178	12161. 1	G	0.43 2	5.38E02	15	LYM236	1259 2.3	B	0.21 8	1.74E02	202.4
LYM41	11831. 1	G	0.46 7	8.64E02	24.4	LYM 172	1230 4.1	B	0.11 8	2.52E02	63.6
LYM178	12163. 3	G	0.43 9	8.80E02	16.7	LYM 176	1238 5.1	B	0.14 7	2.76E02	103.9
LYM37	11803. 1	G	0.44 5	9.23E02	18.3	LYM254	1247 3.1	B	0.12 3	3.29E02	70.5
CONTR OL	—	G	0.37 6	—	0	LYM206	1260 3.2	B	0.13 9	3.64E02	92.4
LYM37	11802. 2	H	0.07 1	8.35E04	82.3	LYM236	1259 1.1	B	0.14 8	3.71E02	105.8

356

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM37	11801. 1	H	0.05 6	2.75E03	44.2	LYM 170	1245 3.3	B	0.15 6	4.30E02	116.8
LYM37	11801. 2	H	0.05 4	6.30E03	40.3	LYM250	1261 4.1	B	0.09	4.32E02	24.8
LYM35	11813. 5	H	0.05 1	1.52E02	32.4	LYM 172	1230 2.2	B	0.08 9	4.68E02	23.7
LYM132	12271. 4	H	0.05 2	1.70E02	34.1	LYM250	1261 3.4	B	0.09 9	4.78E02	37
LYM37	11803. 2	H	0.05	2.33E02	29.6	LYM206	1260 1.3	B	0.1	5.38E02	39.3
LYM35	11812. 4	H	0.05 2	2.59E02	33.2	LYM 140	1226 1.2	B	0.08 9	5.71E02	23.4
LYM34	11902. 2	H	0.04 9	2.97E02	27.4	LYM206	1260 3.1	B	0.08 8	6.78E02	22.5
LYM34	11904. 3	H	0.05	7.81E02	28.4	LYM 170	1245 3.2	B	0.09 4	7.55E02	30.7
LYM 12	11874. 1	H	0.05	9.07E02	30.1	LYM206	1260 2.1	B	0.12 3	8.33E02	70.1
LYM35	11814. 1	H	0.04 7	9.82E02	22.5	LYM 170	1245 2.4	B	0.12 8	8.37E02	77.1
CONTR OL	—	H	0.03 9	—	0	LYM 140	1226 2.2	B	0.09	9.03E02	24.7
LYM82	12203. 5	A	0.01 1	1.26E03	111.5	LYM 176	1238 4.1	B	0.09 6	9.40E02	33
LYM268	12482. 1	A	0.00 7	2.56E03	34.2	CONTR OL	—	B	0.07 2	—	0
LYM82	12201. 2	A	0.00 8	5.53E03	51.6	LYM 172	1230 1.3	C	0.90 9	0.00E +00	131.8
LYM5	12436. 1	A	0.00 6	8.15E03	24.2	LYM 176	1238 4.1	C	0.86 9	0.00E +00	121.6
LYM86	12183. 1	A	0.00 7	8.76E03	43.6	LYM206	1260 3.2	C	0.96 2	0.00E +00	145.4
LYM 129	12573. 1	A	0.01	1.15E02	91.5	LYM236	1259 1.1	C	1.00 8	0.00E +00	157.2
LYM268	12484. 2	A	0.00 9	2.45E02	73.6	LYM236	1259 2.3	C	0.99 9	0.00E +00	154.8
LYM268	12483. 4	A	0.01 4	2.66E02	180.3	LYM236	1259 4.3	C	0.86 2	0.00E +00	119.8
LYM 129	12572. 2	A	0.00 7	2.78E02	38.7	LYM250	1261 3.2	C	0.93 7	0.00E +00	139
LYM8	11984. 1	A	0.01 1	3.56E02	125.9	LYM254	1247 1.1	C	0.83 2	0.00E +00	112.2
LYM86	12183. 3	A	0.00 7	9.36E02	39.7	LYM 170	1245 2.4	C	0.78 4	1.00E06	100.1
CONTR OL	—	A	0.00 5	—	0	LYM 170	1245 2.3	C	0.82 6	1.00E05	110.8
LYM268	12482. 1	B	0.13 8	1.55E03	47.8	LYM 170	1245 3.2	C	0.78 9	1.00E05	101.4
LYM82	12203. 5	B	0.18 9	5.29E03	102.1	LYM148	1217 1.2	C	0.80 9	1.10E05	106.5
LYM86	12183. 1	B	0.14 2	1.04E02	51.8	LYM206	1260 2.1	C	0.89 5	1.10E05	128.4
LYM 129	12573.	B	0.17	1.16E-	83.7	LYM 172	1230	C	0.71	1.30E-	81

357

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
	1		1	02			4.1			05
LYM268	12484. 2	B	0.14 6	1.19E02	56.8	LYM162	1223 1.1	C	0.89 8	1.70E05	129
LYM82	12201. 2	B	0.13 3	1.75E02	42.9	LYM162	1223 1.2	c	0.85 6	2.40E05	118.5
LYM268	12483. 4	B	0.24 3	2.03E02	160.1	LYM176	1238 1.3	c	0.69 1	4.30E05	76.2
LYM129	12572. 2	B	0.12 6	4.67E02	35.3	LYM250	1261 4.1	c	0.74	8.00E05	88.8
LYM5	12436. 1	B	0.11	7.62E02	18.2	LYM206	1260 3.3	c	0.73 6	1.02E04	87.7
CONTR OL	—	B	0.09 3	—	0	LYM89	1221 4.2	c	0.71 3	1.44E04	81.9
LYM268	12483. 4	C	1.19 3	0.00E +00	184.9	LYM176	1238 5.1	c	0.84 7	1.46E04	116
LYM82	12203. 5	C	0.93 3	1.00E06	122.9	LYM172	1230 2.2	c	0.77 7	1.54E04	98.2
LYM8	11984. 1	C	0.84 6	1.20E05	102.1	LYM254	1247 1.2	c	0.65 7	2.37E04	67.6
LYM82	12203. 2	C	1.04 7	2.30E05	149.9	LYM99	1224 4.2	c	0.66 5	5.09E04	69.6
LYM268	12484. 2	C	0.74 9	4.40E05	79	LYM250	1261 1.3	c	0.66 6	5.70E04	69.8
LYM5	12436. 2	C	0.70 8	1.17E04	69	LYM172	1230 1.2	c	0.62 1	6.43E04	58.4
LYM44	11884. 3	C	0.68 3	5.09E04	63.2	LYM170	1245 3.3	c	0.70 9	6.67E04	80.9
LYM86	12183. 3	C	0.59 9	4.64E03	43.1	LYM89	1221 4.1	c	0.69 4	7.89E04	77.2
LYM129	12573. 1	C	0.63 4	4.95E03	51.5	LYM236	1259 2.4	c	0.69 8	8.40E04	78
LYM129	12572. 2	C	0.61 6	5.99E03	47.2	LYM42	1199 2.2	c	0.75	8.94E04	91.4
LYM86	12182. 3	C	0.58 5	1.21E02	39.6	LYM140	1226 1.2	c	0.63 4	1.55E03	61.8
LYM268	12481. 3	C	0.65 5	1.25E02	56.5	LYM89	1221 4.3	c	0.63 6	1.76E03	62.3
LYM5	12436. 1	C	0.59 2	1.26E02	41.3	LYM89	1221 1.2	c	0.69	1.81E03	76
LYM44	11882. 1	C	0.61 2	1.33E02	46.2	LYM162	1223 3.2	c	0.59 4	2.55E03	51.5
LYM268	12482. 1	C	0.55 8	3.20E02	33.2	LYM99	1224 4.1	c	0.63 1	3.I2E03	60.9
LYM44	11885. 3	C	0.54 6	5.94E02	30.3	LYM140	1226 1.4	c	0.61 4	3.48E03	56.5
CONTR OL	—	C	0.41 9	—	0	LYM254	1247 2.3	c	0.60 9	4.02E03	55.4
LYM268	12483. 4	D	10.3 19	2.40E05	190.3	LYM162	1223 4.3	c	0.59 1	4.28E03	50.8
LYM5	12436. 2	D	6.06 9	1.53E03	70.7	LYM3	1204 1.2	c	0.58 4	5.59E03	48.9
LYM44	11884. 3	D	5.87 6	2.29E03	65.3	LYM99	1224 1.1	c	0.57 3	6.37E03	46.2

358

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM82	12203. 5	D	8.17	2.69E03	129.8	LYM89	1221 4.4	C	0.60 1	ΊΑΊΕ03	53.3
LYM268	12484. 2	D	6.62 7	3.76E03	86.4	LYM250	1261 3.4	c	0.59 8	7.72E03	52.6
LYM86	12183. 3	D	5.31 3	3.87E03	49.5	LYM290	1250 2.1	c	0.63 5	8.21E03	61.9
LYM86	12182. 3	D	4.99 6	8.33E03	40.6	LYM290	1250 1.3	c	0.63 6	1.00E02	62.3
LYM129	12572. 2	D	5.33 6	1.25E02	50.1	LYM148	1217 3.5	c	0.60 8	1.17E02	55.2
LYM129	12573. 1	D	5.39	1.80E02	51.6	LYM148	1217 3.1	c	0.55 5	1.44E02	41.6
LYM5	12436. 1	D	5.20 3	2.16E02	46.4	LYM206	1260 1.3	c	0.60 6	1.63E02	54.7
LYM82	12203. 2	D	9.17 2	2.69E02	158	LYM148	1217 2.1	c	0.54 4	3.03E02	38.8
LYM8	11984. 1	D	7.27 7	3.07E02	104.7	LYM254	1247 4.3	c	0.54 3	3.66E02	38.4
LYM44	11885. 3	D	4.76 8	3.08E02	34.1	LYM3	1204 1.1	c	0.53 1	3.68E02	35.5
LYM268	12482. 1	D	4.71 4	3.75E02	32.6	LYM99	1224 3.2	c	0.58 4	4.06E02	48.9
LYM44	11882. 1	D	5.20 5	6.64E02	46.4	CONTR OL	—	c	0.39 2	—	0
CONTR OL	—	D	3.55 5	—	0	LYM176	1238 4.1	D	7.65 5	0.00E +00	132.7
LYM268	12483. 4	E	0.52 9	1.08E02	41.8	LYM172	1230 4.1	D	6.29 8	1.30E05	91.4
LYM44	11884. 3	E	0.50 4	2.21E02	35.2	LYM170	1245 2.4	D	6.86 3	3.10E05	108.6
LYM82	12203. 2	E	0.52 8	2.55E02	41.7	LYM176	1238 1.3	D	6.03 9	3.20E05	83.6
LYM82	12203. 5	E	0.49 4	6.19E02	32.5	LYM254	1247 1.2	D	5.66 3	1.13E04	72.2
LYM86	12182. 3	E	0.47 4	7.22E02	27.2	LYM172	1230 1.3	D	7.85 3	3.12E04	138.7
LYM86	12183. 3	E	0.46 9	9.75E02	25.7	LYM172	1230 1.2	D	5.34 7	3.95E04	62.5
CONTR OL	—	E	0.37 3	—	0	LYM254	1247 1.1	D	7.28	5.95E04	121.3
LYM268	12483. 4	F	6.55 1	4.20E05	48.7	LYM99	1224 1.1	D	4.88 5	1.02E03	48.5
LYM82	12203. 5	F	6.54	4.30E05	48.4	LYM162	1223 3.2	D	5.09 5	1.13E03	54.9
LYM82	12203. 2	F	6.36 6	2.44E04	44.5	LYM236	1259 1.1	D	8.65 5	1.52E03	163.1
LYM44	11884. 3	F	5.87 5	6.63E04	33.4	LYM236	1259 4.3	D	7.79 6	2.20E03	137
LYM86	12182. 3	F	5.58 6	2.72E03	26.8	LYM162	1223 4.3	D	5.02 3	2.44E03	52.7
LYM86	12183. 3	F	5.72 4	3.20E03	29.9	LYM206	1260 3.2	D	8.33	2.58E03	153.2
LYM8	11983.	F	5.55	3.24E-	26.1	LYM148	1217	D	4.69	2.92E-	42.6

359

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
	1		6	03			3.1		2	03
LYM5	12436. 1	F	5.83 1	3.79E03	32.3	LYM236	1259 2.3	D	8.56 4	2.99E03	160.3
LYM268	12484. 2	F	5.89 8	5.85E03	33.9	LYM3	1204 1.2	D	5.08 3	3.81E03	54.5
LYM86	12181. 2	F	5.39 6	7.40E03	22.5	LYM140	1226 1.4	D	5.32 1	3.93E03	61.7
LYM129	12572. 2	F	5.55 5	8.48E03	26.1	LYM250	1261 3.2	D	8.02 2	4.46E03	143.9
LYM5	12432. 2	F	5.25 2	2.59E02	19.2	LYM148	1217 1.2	D	7.07 6	4.80E03	115.1
LYM44	11882. 1	F	5.40 9	3.28E02	22.8	LYM170	1245 3.2	D	6.92	5.21E03	110.4
LYM5	12432. 1	F	5.11 6	3.85E02	16.1	LYM89	1221 4.3	D	5.75	6.25E03	74.8
LYM44	11885. 4	F	5.08 5	4.84E02	15.4	LYM206	1260 3.3	D	6.59 9	8.50E03	100.6
LYM129	12573. 1	F	5.08 2	5.14E02	15.3	LYM89	1221 4.2	D	6.28 5	1.03E02	91
LYM5	12436. 2	F	5.77 2	5.31E02	31	LYM99	1224 4.2	D	5.74 2	1.05E02	74.5
LYM5	12435. 1	F	5.49 8	6.21E02	24.8	LYM250	1261 4.1	D	6.30 8	1.09E02	91.8
LYM8	11982. 6	F	5.08 9	7.04E02	15.5	LYM170	1245 2.3	D	7.21	1.17E02	119.2
LYM8	11984. 1	F	5.99 9	9.59E02	36.2	LYM140	1226 1.2	D	5.41	1.38E02	64.5
CONTR OL	—	F	4.40 6	—	0	LYM254	1247 2.3	D	5.26 8	1.47E02	60.1
LYM5	12436. 1	G	0.63 8	1.29E04	50.3	LYM250	1261 1.3	D	5.79 6	1.51E02	76.2
LYM129	12573. 1	G	0.84 9	1.56E04	99.9	LYM89	1221 4.1	D	6.21	1.65E02	88.8
LYM82	12203. 5	G	0.84 7	2.51E04	99.4	LYM172	1230 2.2	D	6.67 2	1.89E02	102.8
LYM86	12183. 3	G	0.68 7	4.03E04	61.7	LYM206	1260 2.1	D	7.77 2	1.91E02	136.2
LYM268	12482. 1	G	0.60 3	5.49E04	42	LYM162	1223 1.1	D	7.88 5	1.92E02	139.7
LYM268	12483. 4	G	1.05 4	6.89E04	148	LYM3	1204 1.1	D	4.68 4	2.07E02	42.4
LYM82	12201. 2	G	0.64 3	1.52E03	51.4	LYM162	1223 1.2	D	7.35 9	2.76E02	123.7
LYM268	12484. 2	G	0.76 8	1.52E03	80.8	LYM236	1259 2.4	D	6.22 4	2.84E02	89.2
LYM86	12183. 1	G	0.60 2	2.17E03	41.6	LYM99	1224 4.1	D	5.46 7	2.84E02	66.2
LYM44	11882. 1	G	0.54 4	4.43E03	28.1	LYM176	1238 5.1	D	7.50 3	2.87E02	128.1
LYM44	11885. 3	G	0.55 2	4.98E03	29.9	LYM290	1250 1.2	D	4.36 7	2.94E02	32.8
LYM82	12204. 6	G	0.55 8	7.03E03	31.3	LYM148	1217 2.1	D	4.71 1	3.20E02	43.2

360

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM129	12572. 2	G	0.67 1	7.23E03	57.9	LYM170	1245 3.3	D	6.28 2	3.38E02	91
LYM44	11884. 3	G	0.53 2	7.42E03	25.3	LYM250	1261 3.4	D	5.34 5	3.40E02	62.5
LYM5	12436. 2	G	0.54 5	8.39E03	28.2	LYM89	1221 1.2	D	6.24 7	4.75E02	89.9
LYM8	11984. 1	G	0.84 9	1.84E02	99.8	LYM89	1221 4.4	D	4.93 2	4.87E02	49.9
LYM86	12182. 3	G	0.52 6	2.43E02	23.7	LYM42	1199 2.2	D	6.54	5.04E02	98.8
LYM6	11735. 2	G	0.49	8.02E02	15.4	LYM148	1217 3.5	D	5.37 2	6.79E02	63.3
LYM82	12203. 2	G	0.83 4	8.07E02	96.2	LYM254	1247 4.3	D	4.62 5	6.91E02	40.6
CONTR OL	—	G	0.42 5	—	0	LYM290	1250 2.1	D	5.37	7.87E02	63.2
LYM129	12573. 1	H	0.08 5	0.00E +00	100.9	LYM206	1260 1.3	D	5.29 6	8.29E02	61
LYM268	12483. 4	H	0.10 8	0.00E +00	156.5	CONTR OL	—	D	3.29	—	0
LYM8	11984. 1	H	0.08 9	0.00E +00	110.3	LYM236	1259 1.1	E	0.59 4	2.26E03	47.4
LYM82	12203. 5	H	0.08 8	1.00E06	108.4	LYM172	1230 2.2	E	0.59 6	3.04E03	47.9
LYM268	12484. 2	H	0.07 4	2.30E05	75.8	LYM176	1238 1.3	E	0.57 7	4.24E03	43.2
LYM86	12183. 3	H	0.06 6	2.60E04	56.3	LYM140	1226 1.2	E	0.56 6	4.95E03	40.6
LYM268	12482. 1	H	0.06 2	1.28E03	46.3	LYM99	1224 4.1	E	0.56 6	6.16E03	40.6
LYM129	12572. 2	H	0.06 5	1.65E03	53.7	LYM172	1230 4.1	E	0.56 4	7.50E03	40.1
LYM82	12203. 2	H	0.08 7	1.78E03	106.5	LYM170	1245 3.2	E	0.56 3	7.87E03	39.8
LYM5	12436. 1	H	0.06	2.89E03	41.7	LYM170	1245 2.4	E	0.56 7	8.02E03	40.8
LYM86	12183. 1	H	0.06	5.56E03	41	LYM254	1247 2.3	E	0.55 3	8.60E03	37.2
LYM5	12436. 2	H	0.05 9	8.00E03	39	LYM148	1217 1.2	E	0.56 3	9.63E03	39.9
LYM82	12201. 2	H	0.05 9	8.96E03	40.3	LYM206	1260 2.1	E	0.56 2	1.25E02	39.6
LYM82	12204. 6	H	0.05 7	1.25E02	34.6	LYM99	1224 4.2	E	0.54	1.39E02	34
LYM44	11884. 3	H	0.05 6	1.64E02	32.6	LYM236	1259 2.3	E	0.55 5	2.06E02	37.7
LYM268	12481. 3	H	0.06 1	2.53E02	44.7	LYM250	1261 3.2	E	0.54 2	2.10E02	34.5
LYM44	11885. 3	H	0.05 6	2.57E02	33.6	LYM254	1247 1.2	E	0.55	2.13E02	36.6
LYM44	11882. 1	H	0.05 5	3.23E02	29.4	LYM206	1260 3.2	E	0.55 7	2.43E02	38.4
LYM5	12432.	H	0.05	5.25E-	34.7	LYM170	1245	E	0.53	2.59E-	33.7

361

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
	2		7	02			2.3		8	02
LYM86	12182. 3	H	0.05 3	7.08E02	24.8	LYM89	1221 4.4	E	0.55 7	2.64E02	38.2
CONTR OL	—	H	0.04 2	—	0	LYM236	1259 2.4	E	0.53 4	2.66E02	32.6
LYM89	12214. 3	A	0.00 6	5.91E04	43.4	LYM206	1260 3.3	E	0.54 2	2.79E02	34.5
LYM250	12611. 3	A	0.00 6	4.67E03	44.1	LYM172	1230 1.3	E	0.52 7	3.29E02	30.7
CONTR OL	—	A	0.00 4	—	0	LYM172	1230 1.2	E	0.52 3	3.72E02	29.8
LYM250	12611. 3	C	0.72 4	1.68E02	39.6	LYM148	1217 3.1	E	0.54 7	3.85E02	35.7
CONTR OL	—	C	0.51 9	—	0	LYM89	1221 4.1	E	0.55 4	3.89E02	37.6
LYM250	12611. 3	D	6.63 3	3.09E02	40.5	LYM89	1221 1.2	E	0.52 9	3.96E02	31.3
CONTR OL	—	D	4.72 1	—	0	LYM250	1261 4.1	E	0.53 5	4.14E02	32.8
LYM250	12611. 3	E	0.53 1	7.01E02	18.9	LYM162	1223 1.1	E	0.54	4.51E02	34.1
CONTR OL	—	E	0.44 7	—	0	LYM42	1199 2.2	E	0.52 8	5.37E02	31.2
LYM250	12611. 3	F	6.62 7	1.48E03	22.7	LYM206	1260 1.3	E	0.51	6.40E02	26.6
LYM236	12591. 1	F	6.19 7	1.53E02	14.7	LYM250	1261 1.3	E	0.52 5	6.99E02	30.4
LYM99	12243. 2	F	6.22	2.59E02	15.1	LYM206	1260 4.3	E	0.50 3	7.47E02	24.9
CONTR OL	—	F	5.40 2	—	0	LYM236	1259 4.3	E	0.51	8.71E02	26.7
LYM250	12611. 3	G	0.63 3	4.48E03	30.7	LYM176	1238 5.1	E	0.52 6	8.97E02	30.6
LYM89	12214. 3	G	0.63 2	3.84E02	30.6	LYM254	1247 1.1	E	0.51 3	9.45E02	27.4
CONTR OL	—	G	0.48 4	—	0	LYM176	1238 4.1	E	0.50 7	9.46E02	26
LYM250	12611. 3	H	0.06 6	4.26E02	29.7	CONTR OL	—	E	0.40 3	—	0
CONTR OL	—	H	0.05 1	—	0	LYM170	1245 3.2	F	7.24 6	1.00E06	71.9
LYM130	12332. 2	A	0.00 8	7.52E04	183.7	LYM170	1245 2.4	F	7.20 7	1.00E06	71
LYM102	12222. 1	A	0.00 6	1.71E03	86.6	LYM236	1259 1.1	F	7.23 9	1.00E06	71.7
LYM130	12334. 1	A	0.00 7	2.90E03	123.4	LYM148	1217 1.2	F	6.95 1	3.00E06	64.9
LYM138	12561. 3	A	0.00 5	3.10E03	74.1	LYM172	1230 1.3	F	7.00 6	3.00E06	66.2
LYM141	12404. 2	A	0.00 6	8.08E03	106.7	LYM99	1224 4.2	F	6.7	3.00E06	59
LYM106	12142. 2	A	0.00 4	1.83E02	48.1	LYM176	1238 1.3	F	7.08 9	4.00E06	68.2

362

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM138	12566. 1	A	0.00 4	1.99E02	46.4	LYM176	1238 4.1	F	7.17 1	3.30E05	70.1
LYM100	12133. 3	A	0.00 5	2.31E02	62.3	LYM99	1224 4.1	F	6.71 5	3.40E05	59.3
LYM141	12404. 3	A	0.00 8	3.47E02	151	LYM254	1247 2.3	F	6.57 3	3.80E05	56
LYM106	12144. 3	A	0.00 5	3.82E02	59	LYM172	1230 4.1	F	6.85 2	4.90E05	62.6
LYM119	12462. 1	A	0.00 4	6.49E02	46.4	LYM140	1226 1.2	F	6.62 3	5.40E05	57.1
LYM130	12331. 3	A	0.00 4	7.03E02	48.1	LYM170	1245 2.3	F	6.77 7	6.70E05	60.8
LYM137	12152. 1	A	0.00 8	7.19E02	160.3	LYM3	1204 1.1	F	6.22 8	7.30E05	47.8
LYM100	12131. 2	A	0.00 4	7.74E02	45.6	LYM148	1217 3.5	F	6.63 9	7.60E05	57.5
LYM102	12221. 2	A	0.00 7	8.15E02	117.6	LYM206	1260 3.2	F	7.10 5	1.19E- 04	68.6
LYM130	12332. 1	A	0.00 4	9.91E02	48.1	LYM254	1247 1.1	F	6.78 1	1.27E- 04	60.9
CONTR OL	—	A	0.00 3	—	0	LYM89	1221 4.2	F	7.10 8	1.46E- 04	68.6
LYM141	12404. 2	B	0.13 4	1.20E- 05	79	LYM206	1260 3.1	F	5.79 3	2.05E04	37.4
LYM138	12561. 3	B	0.11 4	2.78E04	52.9	LYM250	1261 3.2	F	6.78 2	2.08E04	60.9
LYM102	12222. 1	B	0.11 3	9.40E04	51.4	LYM140	1226 1.4	F	6.07 9	2.18E04	44.2
LYM130	12332. 1	B	0.11 7	7.14E- 03	55.7	LYM172	1230 1.2	F	6.31 7	2.83E04	49.9
LYM130	12332. 2	B	0.18 9	1.06E02	152.1	LYM290	1250 1.2	F	5.64 8	3.03E04	34
LYM106	12142. 2	B	0.10 4	1.16E- 02	38.3	LYM290	1250 1.3	F	6.47 2	3.12E- 04	53.6
LYM130	12334. 1	B	0.17 6	1.48E02	135	LYM236	1259 4.3	F	7.03 3	3.99E04	66.9
LYM141	12404. 3	B	0.15 5	3.07E02	106.5	LYM89	1221 1.2	F	6.81 3	4.03E04	61.6
LYM138	12566. 1	B	0.1	3.93E02	33.3	LYM162	1223 1.1	F	7.20 3	5.06E04	70.9
LYM137	12152. 1	B	0.16 4	4.75E02	119.7	LYM148	1217 2.1	F	5.78 9	5.46E04	37.3
LYM100	12131. 2	B	0.10 8	5.45E02	44.1	LYM99	1224 1.1	F	5.77	6.25E04	36.9
LYM119	12462. 1	B	0.11	6.36E02	46.8	LYM206	1260 2.1	F	6.96	6.53E04	65.1
LYM113	12444. 5	B	0.14 4	6.90E02	91.8	LYM236	1259 2.4	F	6.74 1	7.46E04	59.9
CONTR OL	—	B	0.07 5	—	0	LYM236	1259 2.3	F	6.47 1	8.01E- 04	53.5
LYM137	12153. 1	C	0.75	3.30E05	73.3	LYM162	1223 1.2	F	6.80 5	8.61E- 04	61.4
LYM102	12222.	C	0.68	3.41E-	57.4	LYM250	1261	F	6.19	1.05E-	47

363

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
	1		1	04			3.4		6	03
LYM141	12404. 3	C	0.73 9	1.80E03	70.8	LYM 176	1238 5.1	F	6.84 2	1.76E03	62.3
LYM137	12152. 1	c	0.63	2.56E03	45.6	LYM 172	1230 2.2	F	6.85 1	1.79E03	62.5
LYM138	12561. 3	c	0.61 5	2.31E02	42.1	LYM250	1261 4.1	F	6.73 3	1.94E03	59.7
LYM130	12332. 2	c	0.58 8	2.32E02	36	LYM206	1260 3.3	F	6.66 6	1.97E03	58.2
LYM 102	12221. 2	c	0.57 8	5.38E02	33.7	LYM42	1199 2.2	F	6.76 5	2.50E03	60.5
LYM 100	12133. 3	c	0.55 5	5.62E02	28.4	LYM89	1221 4.1	F	6.51 9	2.76E03	54.7
LYM141	12404. 2	c	0.54 7	7.44E02	26.5	LYM254	1247 1.2	F	6.58 9	2.87E03	56.3
CONTR OL	—	c	0.43 3	—	0	LYM 162	1223 4.3	F	5.85 8	3.38E03	39
LYM 102	12222. 1	D	5.94 2	1.65E03	46.8	LYM3	1204 1.2	F	5.20 3	3.62E03	23.4
LYM137	12152. 1	D	5.64 8	2.45E03	39.5	LYM250	1261 1.3	F	6.66 4	3.93E03	58.1
LYM137	12153. 1	D	6.55 1	2.59E03	61.8	LYM206	1260 1.3	F	5.60 5	5.24E03	33
LYM 100	12133. 3	D	5.09 9	5.27E02	26	LYM89	1221 4.3	F	5.83 7	6.12E03	38.5
LYM130	12332. 2	D	5.25 3	6.20E02	29.8	LYM 162	1223 3.2	F	5.95 8	8.02E03	41.4
CONTR OL	—	D	4.04 8	—	0	LYM254	1247 4.3	F	5.75 8	8.41E03	36.6
LYM137	12153. 1	E	0.56 9	1.28E03	41.7	LYM3	1204 3.2	F	4.99 3	1.23E02	18.5
LYM141	12404. 3	E	0.55 9	1.44E02	39.3	LYM42	1199 2.1	F	5.51 4	1.45E02	30.8
LYM138	12561. 3	E	0.51	3.15E02	27	LYM290	1250 2.1	F	5.90 9	2.95E02	40.2
LYM 102	12222. 1	E	0.50 1	4.11E02	24.8	LYM148	1217 3.1	F	6.08 6	3.14E02	44.4
LYM 100	12133. 3	E	0.49 3	5.35E02	22.9	LYM206	1260 4.3	F	4.95 9	4.80E02	17.7
CONTR OL	—	E	0.40 1	—	0	LYM148	1217 4.1	F	4.97 1	6.23E02	17.9
LYM138	12561. 3	F	6.64 9	2.18E03	31.5	LYM99	1224 3.2	F	5.67 5	6.51E02	34.6
LYM 100	12133. 3	F	6.46 9	2.22E03	27.9	LYM 140	1226 2.3	F	5.43 7	8.77E02	29
LYM138	12562. 1	F	5.95 7	5.93E03	17.8	LYM42	1199 4.1	F	5.06 8	9.11E02	20.2
LYM 102	12222. 1	F	6.27	6.30E03	24	CONTR OL	—	F	4.21 5	—	0
LYM137	12153. 1	F	6.74 3	9.51E03	33.3	LYM254	1247 1.1	G	0.77 3	3.00E06	72.9
LYM113	12444. 5	F	5.95 7	1.07E02	17.8	LYM99	1224 4.2	G	0.56 9	1.23E03	27.3

364

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM102	12221. 2	F	5.89 2	1.12E02	16.5	LYM206	1260 1.3	G	0.63	1.78E03	40.9
LYM137	12152. 1	F	5.94 9	1.63E02	17.6	LYM170	1245 2.3	G	1.02 4	2.21E03	129
LYM119	12461. 4	F	5.79 3	2.27E02	14.5	LYM176	1238 4.1	G	0.67 5	2.30E03	51
LYM130	12332. 2	F	5.63 8	4.49E02	11.5	LYM250	1261 3.2	G	0.88 6	2.49E03	98.2
LYM113	12443. 1	F	5.68 1	8.19E02	12.3	LYM42	1199 2.2	G	0.68 8	4.52E03	53.8
CONTR OL	—	F	5.05 8	—	0	LYM172	1230 1.2	G	0.55 5	4.63E03	24.2
LYM102	12222. 1	G	0.64 1	5.60E03	61.2	LYM236	1259 4.3	G	0.92 3	4.63E03	106.6
LYM138	12561. 3	G	0.56 3	7.37E03	41.4	LYM162	1223 1.1	G	0.70 4	5.43E03	57.5
LYM130	12332. 2	G	0.73 3	8.67E03	84.3	LYM148	1217 1.2	G	0.74 4	6.77E03	66.5
LYM137	12152. 1	G	0.75 2	1.54E02	88.9	LYM236	1259 2.3	G	1.06 3	6.78E03	137.7
LYM141	12404. 2	G	0.53 8	2.41E02	35.3	LYM172	1230 4.1	G	0.62 3	7.31E03	39.4
LYM138	12566. 1	G	0.5	2.70E02	25.7	LYM206	1260 3.2	G	0.74 9	9.52E03	67.5
LYM130	12334. 1	G	0.54 4	4.27E02	36.6	LYM176	1238 5.1	G	0.99 7	1.09E02	123.1
LYM143	12521. 2	G	0.47 8	7.49E02	20.2	LYM250	1261 4.2	G	0.57 2	1.38E02	27.9
LYM138	12562. 1	G	0.47 6	9.14E02	19.7	LYM89	1221 4.2	G	0.54 7	1.62E02	22.4
CONTR OL	—	G	0.39 8	—	0	LYM250	1261 3.4	G	0.68 1	1.94E02	52.3
LYM141	12404. 3	H	0.07 7	5.80E05	96.5	LYM170	1245 2.4	G	0.76	2.00E02	70
LYM102	12222. 1	H	0.06 5	8.00E05	65.8	LYM89	1221 1.2	G	0.71 4	2.05E02	59.8
LYM137	12152. 1	H	0.07 3	8.50E05	85.8	LYM140	1226 1.4	G	0.70 1	2.10E02	56.9
LYM130	12332. 2	H	0.06 8	9.70E05	73.7	LYM170	1245 3.2	G	0.64 2	2.18E02	43.5
LYM137	12153. 1	H	0.06 6	1.26E- 03	66.9	LYM140	1226 2.2	G	0.56 9	2.43E02	27.3
LYM138	12561. 3	H	0.05 4	1.01E02	37.1	LYM170	1245 3.3	G	0.90 9	2.78E02	103.3
LYM141	12404. 2	H	0.05 3	1.35E02	34.4	LYM236	1259 1.1	G	0.87 4	2.83E02	95.5
LYM102	12221. 2	H	0.05 8	1.40E02	46.1	LYM89	1221 4.4	G	0.53 7	2.84E02	20.2
LYM130	12334. 1	H	0.05 2	3.72E02	30.7	LYM99	1224 3.1	G	0.62 3	3.48E02	39.3
LYM138	12562. 1	H	0.05	4.54E02	26	LYM89	1221 4.3	G	0.63 6	4.21E02	42.2
LYM138	12566.	H	0.04	7.16E-	22.8	LYM176	1238	G	0.59	4.33E-	32.1

365

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
	1		8	02			4.2		1	02
LYMl 00	12133. 3	H	0.04 9	7.66E02	25.2	LYM206	1260 3.3	G	0.58 5	4.64E02	31
LYMl 06	12144. 3	H	0.04 9	8.55E02	24	LYMl 40	1226 1.2	G	0.51	5.15E- 02	14
CONTR OL	—	H	0.03 9	—	0	LYMl 76	1238 2.2	G	0.58 5	5.38E02	30.8
LYM153	12321. 2	A	0.01 2	9.21E03	102.4	LYM42	1199 2.1	G	0.64 1	5.45E02	43.4
LYMl 52	12376. 1	A	0.01 1	4.22E02	75.2	LYM148	1217 3.5	G	0.67 3	5.74E02	50.6
LYM148	12174. 1	A	0.00 8	5.19E- 02	28.7	LYM89	1221 4.1	G	0.63 1	5.75E02	41.2
LYMl 40	12262. 2	A	0.00 8	9.10E02	23.8	LYM206	1260 2.1	G	0.73 2	5.75E02	63.6
CONTR OL	—	A	0.00 6	—	0	LYM254	1247 3.1	G	0.56 8	5.82E02	27
LYM153	12321. 2	B	0.24 5	2.61E03	69.9	LYM3	1204 1.2	G	0.66 5	6.39E02	48.8
LYMl 52	12376. 1	B	0.20 3	8.19E02	40.9	LYM42	1199 3.1	G	0.52 8	6.87E02	18.2
CONTR OL	—	B	0.14 4	—	0	LYMl 72	1230 1.3	G	0.54 9	8.21E02	22.8
LYMl 52	12376. 1	C	1.18 4	0.00E +00	138.6	LYMl 76	1238 1.3	G	0.56 3	8.39E02	26
LYM153	12321. 2	C	1.04 1	1.30E- 05	109.9	LYM290	1250 4.1	G	0.65 9	8.59E02	47.4
LYMl 70	12452. 3	C	0.84	2.70E05	69.4	CONTR OL	—	G	0.44 7	—	0
LYMl 49	12344. 2	C	0.82 9	5.50E05	67.1	LYMl 70	1245 2.3	H	0.09 9	0.00E +00	113.2
LYMl 72	12301. 2	C	0.90 5	6.80E05	82.3	LYM236	1259 2.3	H	0.10 9	0.00E +00	135.8
LYMl 74	12412. 1	C	0.80 9	9.50E05	63.2	LYM250	1261 3.2	H	0.08 8	0.00E +00	90.5
LYM153	12322. 1	C	0.87 7	1.92E- 04	76.8	LYM236	1259 4.3	H	0.08 8	1.00E- 06	89
LYMl 72	12301. 3	C	0.86	2.07E04	73.3	LYM254	1247 1.1	H	0.07 7	1.00E- 06	64.9
LYMl 76	12381. 3	C	0.78 1	3.32E04	57.5	LYMl 76	1238 5.1	H	0.09 6	6.00E06	106.2
LYMl 70	12454. 2	C	0.76 6	5.34E04	54.4	LYM206	1260 3.2	H	0.07 8	1.20E- 05	68.2
LYMl 74	12411. 3	C	0.74 8	1.82E- 03	50.8	LYMl 70	1245 3.3	H	0.09 2	7.00E05	97.6
LYMl 62	12234. 4	C	0.74 3	2.64E03	49.7	LYMl 70	1245 2.4	H	0.07 8	8.10E- 05	67.9
LYM289	12493. 2	C	0.74 7	3.09E03	50.6	LYM236	1259 1.1	H	0.08 7	1.34E- 04	87.2
LYMl 74	12411. 2	C	0.78 5	4.17E03	58.3	LYMl 62	1223 1.1	H	0.07 1	2.54E04	52.4
LYMl 11	12254. 3	C	0.76 4	4.75E03	54	LYM89	1221 1.2	H	0.07 1	5.66E04	52

366

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM148	12174. 1	C	0.72 5	5.96E03	46.1	LYM42	1199 2.2	H	0.06 6	5.77E04	43
LYM162	12234. 3	c	0.73 3	1.17E02	47.7	LYM206	1260 1.3	H	0.06 5	6.02E04	39.1
LYM148	12171. 2	c	0.68 4	2.29E02	37.8	LYM148	1217 1.2	H	0.06 9	9.52E04	49.3
LYM105	12293. 1	c	0.65 8	2.67E02	32.6	LYM176	1238 4.1	H	0.06 6	1.86E03	42.7
LYM162	12231. 2	c	0.68	2.78E02	37.1	LYM206	1260 2.1	H	0.07 3	2.16E03	58.3
LYM174	12414. 3	c	0.65	5.52E02	30.9	LYM172	1230 4.1	H	0.06 3	2.61E03	36.2
LYM170	12452. 4	c	0.63 6	5.67E02	28.2	LYM250	1261 3.4	H	0.06 6	2.68E03	43
LYM153	12323. 2	c	0.68 4	5.84E02	37.9	LYM170	1245 3.2	H	0.06 4	3.33E03	38.6
LYM148	12173. 5	c	0.65 2	6.99E02	31.4	LYM140	1226 1.4	H	0.06 6	4.14E03	41.3
LYM290	12502. 4	c	0.63 5	7.97E02	28.1	LYM99	1224 3.1	H	0.06 3	6.82E03	35.1
LYM254	12474. 4	c	0.61 7	8.58E02	24.4	LYM99	1224 4.2	H	0.05 9	7.05E03	27.3
LYM148	12173. 1	c	0.63 2	9.21E02	27.3	LYM89	1221 4.1	H	0.06 5	7.10E03	40.5
CONTR OL	—	c	0.49 6	—	0	LYM206	1260 3.3	H	0.06 1	8.74E03	31.6
LYM152	12376. 1	D	10.1 84	0.00E +00	134.7	LYM250	1261 4.2	H	0.06	9.60E03	29.4
LYM170	12452. 3	D	7.08	7.80E05	63.2	LYM42	1199 2.1	H	0.06 4	1.49E02	37.4
LYM176	12381. 3	D	6.67	2.52E04	53.7	LYM254	1247 3.1	H	0.06	1.84E02	28.6
LYM149	12344. 2	D	7.18 2	2.74E04	65.5	LYM290	1250 4.1	H	0.06 5	2.04E02	39.9
LYM174	12412. 1	D	6.75 1	3.53E04	55.6	LYM89	1221 4.3	H	0.06 1	3.34E02	30.8
LYM170	12454. 2	D	6.62 6	3.98E04	52.7	LYM172	1230 1.2	H	0.05 7	3.68E02	22.3
LYM174	12411. 3	D	6.49 7	3.90E03	49.7	LYM42	1199 3.1	H	0.05 8	3.99E02	24.2
LYM289	12493. 2	D	6.46 9	8.75E03	49.1	LYM89	1221 4.4	H	0.05 7	4.67E02	22.5
LYM162	12234. 4	D	6.25 3	1.01E02	44.1	LYM148	1217 3.5	H	0.06 2	4.81E02	33.2
LYM105	12293. 1	D	5.67	1.26E02	30.7	LYM140	1226 1.2	H	0.05 6	5.27E02	19.9
LYM172	12301. 3	D	7.41 2	1.63E02	70.8	LYM236	1259 2.4	H	0.06 1	6.49E02	30.4
LYM172	12301. 2	D	7.67 4	1.83E02	76.9	LYM250	1261 4.1	H	0.05 5	9.32E02	19.6
LYM153	12321. 2	D	8.90 1	1.85E02	105.2	LYM176	1238 1.3	H	0.05 6	9.61E02	20.1
LYM153	12322.	D	7.58	2.24E-	74.7	LYM290	1250	H	0.06	9.74E-	35.7

367

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
	1			02			1.3		3	02
LYM148	12174. 1	D	6.39	2.38E02	47.3	CONTR OL	—	H	0.04 6	—	0
LYM254	12474. 4	D	5.37 7	2.95E02	23.9	LYM90	1239 2.1	A	0.00 5	1.00E06	108.9
LYM111	12254. 3	D	6.64 2	3.13E02	53.1	LYM213	1284 2.9	A	0.00 4	5.60E05	48.5
LYM 170	12452. 4	D	5.43 8	5.31E02	25.3	LYM 107	1263 3.4	A	0.00 6	1.12E04	153.5
LYM148	12171. 2	D	6.00 8	5.50E02	38.5	LYM157	1334 1.1	A	0.00 6	1.62E03	130.7
LYM 174	12411. 2	D	6.70 3	6.07E02	54.5	LYM90	1239 4.2	A	0.00 5	2.24E03	78.2
LYM 162	12231. 2	D	5.94 8	7.11E02	37.1	LYM 107	1263 1.4	A	0.00 5	9.45E03	104
LYM 162	12234. 3	D	6.31 9	8.38E02	45.6	LYM 180	1344 1.7	A	0.00 4	1.15E02	58.4
LYM 172	12304. 1	D	5.12 6	9.20E02	18.2	LYM90	1239 5.3	A	0.00 5	1.27E02	115.8
CONTR OL	—	D	4.33 9	—	0	LYM248	1350 1.6	A	0.00 4	1.40E02	74.3
LYM 176	12381. 3	E	0.57	2.35E02	42.8	LYM52	1289 5.7	A	0.00 5	1.64E02	87.1
LYM 172	12301. 2	E	0.56 3	3.24E02	41.1	LYM52	1289 4.6	A	0.00 5	2.41E02	93.1
LYM 174	12412. 1	E	0.56	3.53E02	40.3	LYM213	1284 1.8	A	0.00 7	2.71E02	161.4
LYM153	12322. 1	E	0.54 7	5.02E02	37.1	LYM68	1194 2.2	A	0.00 4	3.03E02	77.2
LYM254	12474. 4	E	0.54 5	5.08E02	36.5	LYM157	1334 1.3	A	0.00 7	3.06E02	193.1
LYM111	12254. 3	E	0.54 2	6.45E02	35.8	LYM 180	1344 1.5	A	0.00 3	3.17E02	20.8
LYM 170	12454. 2	E	0.53 7	6.57E02	34.5	LYM52	1289 1.8	A	0.00 7	3.60E02	183.2
LYM 172	12301. 3	E	0.54 3	6.79E02	36.1	LYM68	1194 3.5	A	0.00 4	3.69E02	46.5
LYM148	12174. 1	E	0.53 5	6.85E02	34	LYM213	1284 1.6	A	0.00 8	3.70E02	235.6
LYM 152	12376. 1	E	0.54 3	7.05E02	36.1	LYM117	1362 2.6	A	0.00 5	4.17E02	85.1
LYM 174	12411. 2	E	0.53 5	7.56E02	34.1	LYM117	1362 1.8	A	0.00 4	4.82E02	57.4
LYM153	12321. 2	E	0.54 3	7.70E02	36.1	LYM52	1289 4.8	A	0.00 8	5.80E02	217.8
LYM 170	12452. 3	E	0.53	8.57E02	32.8	LYM68	1194 1.3	A	0.00 4	5.93E02	41.6
LYM148	12171. 2	E	0.52 3	9.20E02	31.1	LYM248	1350 2.7	A	0.00 4	6.41E02	65.3
CONTR OL	—	E	0.39 9	—	0	LYM117	1362 4.4	A	0.00 4	7.16E02	72.3
LYM 149	12344. 2	F	6.80 1	1.57E03	33.2	LYM52	1289 4.7	A	0.00 6	7.32E02	152.5

368

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM 152	12376. 1	F	7.02 3	1.62E03	37.5	LYM157	1334 1.4	A	0.00 5	7.51E02	106.9
LYM148	12171. 2	F	6.66 3	2.42E03	30.5	LYM213	1284 1.7	A	0.00 5	8.38E02	114.9
LYM254	12474. 4	F	6.67 1	2.45E03	30.7	LYM 180	1344 3.7	A	0.00 3	8.44E02	28.7
LYM 174	12412. 1	F	6.79 1	2.67E03	33	LYM 180	1344 2.6	A	0.00 4	9.89E02	50.5
LYM 170	12454. 2	F	6.64 1	2.92E03	30.1	CONTR OL	—	A	0.00 3	—	0
LYM 170	12452. 3	F	6.74 2	3.91E03	32	LYM90	1239 2.1	B	0.15 2	1.06E03	81.1
LYM 172	12301. 3	F	6.70 6	5.41E03	31.3	LYM 107	1263 1.4	B	0.13 6	2.69E03	61.9
LYM148	12174. 1	F	6.44 9	5.65E03	26.3	LYM90	1239 5.3	B	0.13 5	5.72E03	60.8
LYM153	12321. 2	F	6.67 8	5.68E03	30.8	LYM157	1334 1.1	B	0.14 6	1.69E02	73.9
LYM153	12322. 1	F	6.44 3	5.80E03	26.2	LYM213	1284 1.6	B	0.20 3	1.93E02	141.6
LYM 176	12381. 3	F	6.44 2	5.82E03	26.2	LYM117	1362 1.8	B	0.10 5	2.79E02	24.6
LYM289	12493. 2	F	6.37	7.79E03	24.8	LYM 107	1263 3.4	B	0.14 4	3.61E02	71.1
LYM 172	12301. 2	F	6.40 1	8.13E03	25.4	LYM68	1194 2.2	B	0.11 1	4.71E02	31.8
LYM 174	12414. 3	F	6.25 9	1.53E02	22.6	LYM52	1289 4.6	B	0.13 1	4.73E02	55.6
LYM 174	12411. 2	F	6.33 8	1.62E02	24.1	LYM52	1289 4.8	B	0.18 4	4.84E02	118.7
LYM148	12173. 5	F	6.26 8	1.64E02	22.7	LYM157	1334 1.3	B	0.16 5	5.02E02	96.8
LYM 140	12262. 3	F	6.2	1.65E02	21.4	LYM52	1289 4.7	B	0.16 4	5.10E02	94.7
LYM111	12254. 3	F	6.35 2	1.66E02	24.4	LYM52	1289 1.8	B	0.14 7	5.39E02	75.3
LYM 176	12384. 1	F	6.08 7	2.67E02	19.2	LYM90	1239 4.2	B	0.11	5.40E02	30.6
LYM 170	12453. 2	F	6.09 8	3.46E02	19.4	LYM52	1289 5.7	B	0.15	5.54E02	78.1
LYM111	12252. 2	F	6.02 9	3.90E02	18.1	LYM248	1350 2.7	B	0.12	6.58E02	43.3
LYM 162	12234. 4	F	5.98	4.10E02	17.1	LYM213	1284 2.9	B	0.09 9	6.68E02	17.3
LYM153	12323. 2	F	6.03 5	4.13E02	18.2	LYM117	1362 2.6	B	0.13 6	6.92E02	61.7
LYM 162	12234. 3	F	6.27 6	4.14E02	22.9	LYM213	1284 1.8	B	0.18 6	9.20E02	121.5
LYM 170	12452. 4	F	5.96	4.49E02	16.7	CONTR OL	—	B	0.08 4	—	0
LYM 149	12343. 2	F	6.25 5	5.80E02	22.5	LYM 107	1263 3.4	C	0.99 1	0.00E +00	94.3
LYM 162	12231.	F	6.01	6.32E-	17.9	LYM 107	1263	C	0.94	0.00E	85.1

369

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
	2		9	02			1.4		4	+00
LYM 152	12373. 2	F	5.84 6	7.37E02	14.5	LYM52	1289 4.6	C	1.01 2	0.00E +00	98.3
LYM289	12493. 6	F	5.78 7	9.53E02	13.3	LYM52	1289 1.8	c	0.92 8	0.00E +00	81.9
CONTR OL	—	F	5.10 6	—	0	LYM68	1194 2.2	c	0.98	0.00E +00	92.1
LYM 152	12376. 1	G	0.99 3	4.96E04	50.8	LYM52	1289 4.8	c	0.95 4	1.00E- 06	87
LYM153	12321. 2	G	1.04 8	4.01E03	59.2	LYM213	1284 1.6	c	0.87	3.00E06	70.5
LYM148	12174. 1	G	0.91 6	6.30E03	39.2	LYM90	1239 2.1	c	0.86 9	1.10E- 05	70.4
LYM290	12502. 4	G	0.79 9	4.73E02	21.3	LYM157	1334 1.3	c	0.93 6	3.10E- 05	83.5
LYM 172	12301. 2	G	0.86 2	5.63E02	30.9	LYM157	1334 1.1	c	0.82 3	1.04E- 04	61.3
LYM 140	12262. 2	G	0.81 4	8.61E02	23.6	LYM90	1239 5.3	c	0.82	1.17E- 04	60.6
LYM 174	12411. 3	G	0.86 7	9.28E02	31.7	LYM157	1334 1.4	c	0.81 2	1.51E- 04	59.2
CONTR OL	—	G	0.65 8	—	0	LYM90	1239 4.2	c	0.77 9	2.54E04	52.8
LYM 152	12376. 1	H	0.10 3	1.39E- 04	65.4	LYM68	1194 1.4	c	0.78 8	3.36E04	54.5
LYM153	12321. 2	H	0.10 6	2.48E04	69.7	LYM248	1350 1.6	c	0.78 4	5.63E04	53.7
LYM 172	12301. 2	H	0.08 8	1.64E02	41	LYM 107	1263 1.1	c	0.76 4	6.45E04	49.7
LYM148	12174. 1	H	0.08 6	1.81E02	38.1	LYM117	1362 2.6	c	0.74	I.38E03	45.1
LYM 174	12411. 3	H	0.08 5	4.51E02	36.4	LYM52	1289 5.7	c	0.72 4	2.87E03	42
CONTR OL	—	H	0.06 3	—	0	LYM52	1289 4.7	c	0.74 1	3.BEOS	45.2
LYM 175	12651. 2	A	0.00 5	1.27E- 03	85.3	LYM90	1239 3.1	c	0.72 8	8.19E03	42.6
LYM 107	12632. 1	A	0.00 5	7.98E03	96.3	LYM157	1334 2.4	c	0.71	1.13E02	39.2
LYM203	12663. 2	A	0.00 6	1.07E02	104.6	LYM 107	1263 1.2	c	0.67 1	2.27E02	31.6
LYM128	12642. 1	A	0.00 4	3.17E- 02	53.2	LYM213	1284 1.7	c	0.68	2.56E02	33.4
LYM128	12641. 3	A	0.00 4	5.95E02	64.2	LYM68	1194 2.3	c	0.67 9	3.65E02	33
LYM 175	12654. 4	A	0.00 4	7.53E02	47.7	LYM90	1239 5.1	c	0.67 6	5.36E02	32.6
CONTR OL	—	A	0.00 3	—	0	LYM68	1194 1.3	c	0.64 4	5.48E02	26.2
LYM 107	12631. 1	B	0.09 2	9.39E03	28.3	LYM248	1350 3.5	c	0.64 7	6.20E02	26.8
LYM 175	12654. 4	B	0.11 2	1.18E02	55.8	LYM117	1362 1.8	c	0.64 7	6.25E02	26.8

370

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM203	12663. 2	B	0.12 2	1.66E02	69.5	LYM117	1362 4.7	C	0.63 6	7.06E02	24.6
LYM 107	12632. 1	B	0.12 5	2.43E02	73.7	LYM117	1362 3.9	c	0.62 9	9.82E02	23.2
LYM 175	12651. 2	B	0.11 7	2.91E02	62.4	CONTR OL	—	c	0.51	—	0
LYM128	12642. 1	B	0.09 6	3.18E- 02	33.2	LYM213	1284 1.6	D	7.63 8	4.50E05	69.8
LYM128	12641. 3	B	0.09 6	6.27E02	33.4	LYM117	1362 2.6	D	6.21 9	9.60E05	38.3
LYM203	12662. 2	B	0.15	7.88E02	108.2	LYM 107	1263 1.2	D	5.85 2	3.86E04	30.1
CONTR OL	—	B	0.07 2	—	0	LYM68	1194 2.2	D	8.37 1	4.18E04	86.1
LYM128	12642. 1	C	0.59	4.98E04	67	LYM52	1289 1.8	D	8.04 8	4.29E04	78.9
LYM203	12663. 2	C	0.49 6	2.37E02	40.5	LYM90	1239 4.2	D	6.75 1	1.42E- 03	50.1
LYM203	12662. 2	C	0.52 9	5.42E02	49.7	LYM 107	1263 1.1	D	6.53 1	2.91E03	45.2
LYM128	12641. 3	C	0.44 7	7.46E02	26.7	LYM52	1289 5.7	D	6.18 3	5.76E03	37.5
LYM 107	12631. 2	C	0.48 2	8.17E- 02	36.6	LYM52	1289 4.6	D	8.57 2	6.41E- 03	90.6
CONTR OL	—	C	0.35 3	—	0	LYM 107	1263 1.4	D	8.24 9	7.31E03	83.4
LYM128	12642. 1	D	5.09 8	4.34E03	62	LYM90	1239 2.1	D	7.58 6	1.12E02	68.6
LYM128	12641. 3	D	4.17 6	1.25E02	32.7	LYM52	1289 4.8	D	8.22 8	1.31E02	82.9
LYM203	12663. 2	D	4.26 6	7.47E02	35.6	LYM 107	1263 3.4	D	8.64 4	1.42E02	92.2
CONTR OL	—	D	3.14 6	—	0	LYM90	1239 5.3	D	7.12	1.67E- 02	58.3
LYM128	12641. 3	E	0.44 7	9.19E04	33	LYM157	1334 1.4	D	7.11 4	1.98E02	58.2
LYM128	12641. 5	E	0.43 3	3.42E03	28.7	LYM68	1194 1.4	D	6.66 3	2.04E02	48.1
LYM128	12642. 1	E	0.44	4.86E03	30.8	LYM117	1362 4.7	D	5.48 2	2.19E02	21.9
LYM203	12663. 2	E	0.41 3	2.97E02	22.8	LYM68	1194 1.3	D	5.57 8	2.27E02	24
LYM203	12662. 2	E	0.40 4	3.66E02	20.3	LYM157	1334 1.1	D	7.02 6	2.67E02	56.2
LYM128	12641. 1	E	0.41 4	8.08E02	23.3	LYM248	1350 1.6	D	6.80 9	3.00E02	51.4
CONTR OL	—	E	0.33 6	—	0	LYM117	1362 1.8	D	5.70 3	4.86E02	26.8
LYM128	12642. 1	F	6.01 2	8.60E05	45.8	LYM52	1289 4.7	D	6.31 4	5.92E02	40.4
LYM128	12641. 3	F	5.47 9	1.32E- 04	32.9	LYM157	1334 1.3	D	8.09 2	7.45E02	79.9
LYM203	12663.	F	5.07	7.26E-	23	LYM213	1284	D	6.06	8.34E-	34.8

371

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
	2			03			1.7		2	02
LYM203	12664. 1	F	4.69 9	7.69E03	14	LYM 180	1344 3.7	D	5.25 9	8.41E02	16.9
LYM203	12662. 2	F	5.04 1	1.20E02	22.3	LYM157	1334 2.4	D	6.14 3	8.49E02	36.6
LYM128	12641. 5	F	4.68 6	1.21E02	13.7	CONTR OL	—	D	4.49 8	—	0
LYM 175	12651. 4	F	4.80 2	1.96E02	16.5	LYM68	1194 1.4	E	0.61 6	1.55E03	41.7
LYM 107	12632. 3	F	4.57 3	3.01E02	10.9	LYM 107	1263 1.1	E	0.59 8	3.20E03	37.5
LYM 107	12631. 2	F	5.32 5	7.35E02	29.1	LYM68	1194 2.2	E	0.59 3	4.66E03	36.4
LYM128	12641. 1	F	5.15 1	7.83E02	24.9	LYM52	1289 4.6	E	0.59 6	4.93E03	37.2
CONTR OL	—	F	4.12 3	—	0	LYM248	1350 3.5	E	0.58 8	5.03E03	35.2
LYM 107	12632. 1	G	0.52 5	1.77E03	47.2	LYM90	1239 3.1	E	0.58 7	5.49E03	34.9
LYM128	12642. 1	G	0.56 8	2.05E03	59.3	LYM52	1289 5.7	E	0.58 6	5.79E03	34.7
LYM128	12641. 3	G	0.51 9	4.67E03	45.3	LYM68	1194 1.3	E	0.58 6	6.68E03	34.7
LYM203	12663. 2	G	0.58 3	1.40E02	63.4	LYM52	1289 4.8	E	0.57 9	9.24E03	33.1
LYM 107	12631. 1	G	0.44 7	4.06E02	25.4	LYM90	1239 4.2	E	0.56 9	1.49E02	30.9
LYM 175	12651. 2	G	0.56 8	5.89E02	59.1	LYM157	1334 1.3	E	0.55 4	2.88E02	27.3
LYM203	12662. 2	G	0.60 9	5.96E02	70.7	LYM213	1284 1.6	E	0.55 3	2.96E02	27.1
CONTR OL	—	G	0.35 7	—	0	LYM248	1350 1.6	E	0.55 8	3.17E02	28.3
LYM128	12642. 1	H	0.05 7	4.93E03	57.5	LYM 107	1263 3.4	E	0.54 6	4.23E02	25.5
LYM203	12663. 2	H	0.05 6	9.28E03	55.3	LYM157	1334 1.1	E	0.54 5	4.29E02	25.2
LYM203	12662. 2	H	0.06	1.20E02	65	LYM 180	1344 1.7	E	0.54 1	5.32E02	24.4
LYM128	12641. 3	H	0.05 1	2.49E02	40.3	LYM157	1334 1.4	E	0.54	5.93E02	24.2
LYM 175	12651. 2	H	0.05 6	2.52E02	55.8	LYM 107	1263 1.2	E	0.53 9	6.08E02	24
LYM 107	12632. 1	H	0.05 1	2.94E02	40.3	LYM90	1239 2.1	E	0.53 3	8.04E02	22.5
CONTR OL	—	H	0.03 6	—	0	LYM68	1194 2.3	E	0.52 6	9.63E02	20.9
LYM224	13435. 3	A	0.00 7	0.00E +00	90.7	CONTR OL	—	E	0.43 5	—	0
LYM217	13182. 1	A	0.00 9	9.40E05	160	LYM 107	1263 3.4	F	7.25 1	0.00E +00	30.4
LYM23	12783. 5	A	0.00 7	6.40E04	99	LYM68	1194 2.2	F	7.60 7	0.00E +00	36.8

372

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM164	12813. 5	A	0.01	1.20E03	169	LYM90	1239 3.1	F	7.20 6	0.00E +00	29.6
LYM164	12813. 8	A	0.00 9	2.03E03	143.6	LYM52	1289 4.8	F	6.93 2	3.00E06	24.7
LYM251	13073. 8	A	0.00 7	3.58E03	84.6	LYM157	1334 1.3	F	6.85 4	1.40E05	23.3
LYM122	13712. 3	A	0.00 5	3.83E03	45.5	LYM90	1239 4.2	F	6.94 1	1.40E05	24.9
LYM274	13414. 2	A	0.00 9	4.46E03	138.1	LYM68	1194 1.3	F	7.08 2	7.00E05	27.4
LYM217	13181. 11	A	0.00 9	4.68E03	136.7	LYM180	1344 1.5	F	6.59 6	8.70E05	18.6
LYM79	13132. 2	A	0.01	6.39E03	166.9	LYM157	1334 1.4	F	6.80 5	1.05E04	22.4
LYM273	13721. 3	A	0.01 1	7.17E03	201.2	LYM248	1350 3.5	F	7.13	1.31E04	28.3
LYM273	13721. 1	A	0.00 7	8.18E- 03	81.8	LYM52	1289 5.7	F	6.93 6	2.60E04	24.8
LYM249	13631. 1	A	0.00 6	8.20E03	64.7	LYM90	1239 5.3	F	6.74 7	7.99E04	21.4
LYM23	12783. 7	A	0.01	8.56E03	162.1	LYM107	1263 1.1	F	6.89	9.89E04	23.9
LYM122	13713. 2	A	0.00 7	8.63E03	80.4	LYM180	1344 3.7	F	6.93 4	1.01E03	24.7
LYM249	13633. 1	A	0.01	9.46E03	172.4	LYM52	1289 1.8	F	6.48 6	1.57E- 03	16.7
LYM193	13484. 3	A	0.00 8	9.51E03	127.8	LYM248	1350 1.6	F	7.25 6	2.13E03	30.5
LYM245	13061. 6	A	0.00 7	1.45E02	82.5	LYM213	1284 1.6	F	6.73 6	3.86E03	21.2
LYM273	13722. 4	A	0.00 7	1.60E02	90.1	LYM157	1334 1.1	F	6.31 2	3.94E03	13.6
LYM251	13072. 8	A	0.00 9	1.70E- 02	138.1	LYM90	1239 5.1	F	6.79 6	4.94E03	22.2
LYM217	13181. 7	A	0.00 6	1.82E02	53	LYM107	1263 1.2	F	6.84 6	6.89E03	23.2
LYM23	12782. 6	A	0.00 8	2.17E02	114.8	LYM248	1350 2.7	F	6.67 3	6.91E- 03	20
LYM122	13714. 4	A	0.01	2.25E02	166.2	LYM157	1334 2.4	F	6.44 2	7.43E03	15.9
LYM245	13062. 5	A	0.00 8	2.38E02	131.2	LYM107	1263 1.4	F	6.95 9	8.62E03	25.2
LYM79	13133. 1	A	0.00 6	3.11E- 02	62.6	LYM52	1289 4.6	F	7.32 8	1.06E02	31.8
LYM23	12784. 6	A	0.00 7	4.14E02	95.5	LYM68	1194 1.4	F	6.93 7	1.08E02	24.8
LYM251	13073. 7	A	0.00 8	4.14E02	126.4	LYM68	1194 2.3	F	6.77 1	1.09E02	21.8
LYM273	13723. 1	A	0.00 8	4.80E02	123	LYM117	1362 1.8	F	6.43 1	1.47E02	15.7
LYM224	13434. 2	A	0.00 6	4.97E02	59.9	LYM180	1344 2.6	F	6.00 3	1.85E02	8
LYM251	13074.	A	0.00	5.26E-	49.6	LYM213	1284	F	6.00	1.91E-	7.9

373

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
	6		5	02			2.8		1	02
LYM274	13413. 4	A	0.00 6	5.58E02	76.3	LYM 180	1344 1.7	F	6.81 4	2.38E02	22.6
LYM273	13722. 3	A	0.00 7	6.00E02	80.4	LYM90	1239 2.1	F	6.51 8	3.57E02	17.2
LYM224	13435. 1	A	0.01	6.64E02	177.9	LYM52	1289 4.7	F	6.23 2	5.88E02	12.1
LYM217	13183. 2	A	0.00 9	6.68E02	156.6	LYM213	1284 1.7	F	6.42 9	9.76E02	15.6
LYM217	13181. 6	A	0.00 6	6.76E02	62.6	CONTR OL	—	F	5.55 9	—	0
LYM79	13133. 3	A	0.00 5	6.76E02	41.3	LYM68	1194 2.2	G	0.71 9	1.00E- 06	54.5
LYM23	12783. 8	A	0.00 5	7.66E02	30.4	LYM90	1239 5.3	G	0.72 4	1.00E- 06	55.5
LYM 122	13714. 2	A	0.00 8	7.70E02	114.8	LYM117	1362 3.9	G	0.58 6	5.20E05	25.8
LYM249	13631. 2	A	0.00 7	8.25E02	105.1	LYM248	1350 1.6	G	0.71 9	6.60E05	54.4
LYM274	13415. 2	A	0.00 7	8.30E02	83.2	LYM117	1362 2.6	G	0.70 9	5.32E04	52.2
LYM249	13631. 4	A	0.00 5	8.68E02	31.7	LYM 107	1263 1.4	G	0.73 3	5.34E04	57.3
LYM251	13072. 6	A	0.00 9	9.27E02	159.3	LYM 180	1344 1.7	G	0.66 4	1.17E- 03	42.6
LYM240	12682. 1	A	0.00 9	9.57E02	148.4	LYM52	1289 1.8	G	0.87 8	1.61E- 03	88.5
CONTR OL	—	A	0.00 4	—	0	LYM213	1284 1.6	G	1.09 8	2.01E03	135.7
LYM251	13073. 8	B	0.14 5	7.17E04	59.3	LYM68	1194 3.5	G	0.65 3	2.34E03	40.2
LYM 164	12813. 8	B	0.16 6	8.84E04	82.4	LYM117	1362 1.8	G	0.60 8	3.36E03	30.6
LYM 122	13712. 3	B	0.12 2	8.94E04	33.4	LYM90	1239 4.2	G	0.64 4	3.68E03	38.4
LYM217	13182. 1	B	0.17 9	1.19E- 03	96.3	LYM52	1289 4.6	G	0.69	3.90E03	48.2
LYM273	13721. 3	B	0.22 1	1.26E- 03	142.7	LYM157	1334 1.1	G	0.80 4	3.92E03	72.7
LYM249	13631. 1	B	0.15 9	1.43E- 03	74.6	LYM 107	1263 3.4	G	0.82 9	5.17E- 03	78
LYM273	13721. 1	B	0.13 2	1.54E- 03	44.4	LYM52	1289 5.7	G	0.78 6	1.65E02	68.8
LYM 193	13484. 3	B	0.16 5	2.86E03	80.7	LYM52	1289 4.8	G	0.98 7	1.95E02	111.9
LYM79	13132. 2	B	0.2	3.59E03	119.3	LYM117	1362 4.7	G	0.59 2	2.59E02	27.2
LYM217	13181. 11	B	0.20 3	4.90E03	123.1	LYM213	1284 1.8	G	0.74 6	2.62E02	60.2
LYM 122	13714. 4	B	0.24 9	4.98E03	172.7	LYM 180	1344 1.5	G	0.63 2	2.70E02	35.7
LYM273	13723. 1	B	0.16 5	8.86E03	80.7	LYM117	1362 4.4	G	0.57 6	2.79E02	23.6

374

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM274	13411. 2	B	0.11 4	1.00E02	24.9	LYM248	1350 2.7	G	0.68 5	2.84E02	47.1
LYM274	13414. 2	B	0.18 9	1.01E02	107.4	LYM 107	1263 2.1	G	0.58 8	2.98E02	26.3
LYM249	13633. 1	B	0.19 5	1.09E02	114.2	LYM157	1334 1.4	G	0.88 2	3.13E02	89.4
LYM245	13062. 5	B	0.19 7	1.37E02	116.1	LYM68	1194 1.3	G	0.57 3	5.05E02	23
LYM274	13413. 4	B	0.14 1	1.41E02	54.1	LYM157	1334 1.3	G	0.83 4	5.09E02	79.2
LYM23	12783. 7	B	0.20 4	1.57E02	123.9	LYM 107	1263 1.1	G	0.68 8	5.95E02	47.8
LYM224	13435. 3	B	0.14 9	2.06E02	63.9	LYM90	1239 2.1	G	0.63 3	6.01E02	35.9
LYM79	13134. 3	B	0.14	2.13E02	53.9	LYM157	1334 1.7	G	0.71 7	8.11E02	54
LYM251	13072. 8	B	0.16 1	2.19E02	76.5	LYM52	1289 4.7	G	0.72	9.20E02	54.6
LYM23	12783. 8	B	0.13 1	2.26E02	43.9	LYM213	1284 1.7	G	0.69 8	9.67E02	49.9
LYM 164	12813. 5	B	0.22 1	2.28E02	142.7	CONTR OL	—	G	0.46 6	—	0
LYM23	12782. 7	B	0.12 5	2.52E02	36.8	LYM 107	1263 3.4	H	0.08 1	0.00E +00	83.3
LYM217	13181. 7	B	0.12 4	3.28E02	35.6	LYM 107	1263 1.4	H	0.07 8	0.00E +00	75.7
LYM23	12782. 6	B	0.16	3.33E02	76	LYM117	1362 2.6	H	0.08	0.00E +00	79.3
LYM273	13722. 3	B	0.14 8	4.38E02	62.3	LYM157	1334 1.4	H	0.09 2	0.00E +00	108
LYM 122	13712. 1	B	0.14 7	4.52E02	61.4	LYM157	1334 1.1	H	0.08	0.00E +00	80.9
LYM251	13072. 6	B	0.23 1	4.55E02	153.2	LYM213	1284 1.6	H	0.11 1	0.00E +00	149.2
LYM251	13074. 6	B	0.12 8	4.80E02	40.5	LYM52	1289 4.8	H	0.10 3	0.00E +00	131.6
LYM131	12791. 5	B	0.13 6	5.54E02	49.2	LYM52	1289 1.8	H	0.09 3	0.00E +00	108.9
LYM240	12682. 1	B	0.16 4	5.66E02	80.3	LYM52	1289 5.7	H	0.08 3	0.00E +00	87
LYM 122	13713. 2	B	0.14 6	5.87E02	60.6	LYM90	1239 5.3	H	0.07 6	0.00E +00	71
LYM23	12784. 6	B	0.18	6.16E02	97.8	LYM68	1194 2.2	H	0.07 4	1.00E06	67.4
LYM79	13133. 3	B	0.13 1	6.29E02	43.3	LYM52	1289 4.6	H	0.07 5	2.00E06	68.1
LYM 122	13714. 2	B	0.17 6	6.66E02	93.6	LYM157	1334 1.3	H	0.08 5	3.00E06	92.7
LYM249	13631. 2	B	0.17 2	6.94E02	88.8	LYM213	1284 1.8	H	0.07 4	1.70E05	66.3
LYM224	13435. 1	B	0.22 5	7.12E02	146.6	LYM248	1350 1.6	H	0.06 9	3.10E05	56.2
LYM217	13183.	B	0.19	7.76E-	115.6	LYM90	1239	H	0.06	3.80E-	54.1

375

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
	2		7	02			4.2		8	05
LYM23	12783. 5	B	0.16 2	8.12E02	112	LYM 107	1263 1.1	H	0.07 3	4.60E05	65.3
LYM217	13181. 6	B	0.14 5	8.35E02	59	LYM68	1194 3.5	H	0.06 9	6.60E05	54.6
LYM40	13732. 1	B	0.14 3	8.41E02	56.4	LYM52	1289 4.7	H	0.07 4	1.57E04	66.8
LYM79	13133. 1	B	0.15 6	9.62E02	70.9	LYM90	1239 2.1	H	0.06 8	2.75E04	52.6
LYM273	13722. 4	B	0.14	9.64E02	54	LYM213	1284 1.7	H	0.07	5.36E04	58.5
CONTR OL	—	B	0.09 1	—	0	LYM157	1334 1.7	H	0.07	7.79E04	57.3
LYM 122	13714. 4	C	0.90 5	0.00E +00	135.4	LYM117	1362 4.7	H	0.06 2	2.19E03	39.2
LYM 122	13713. 2	C	0.68 1	0.00E +00	77	LYM117	1362 4.4	H	0.06	4.46E03	35.7
LYM131	12793. 3	C	0.66 3	0.00E +00	72.4	LYM248	1350 2.7	H	0.06 3	4.46E03	41
LYM 164	12813. 5	C	0.93 3	0.00E +00	142.7	LYM 180	1344 1.7	H	0.06	4.78E03	35
LYM 193	13482. 4	C	0.74 5	0.00E +00	93.9	LYM117	1362 3.9	H	0.05 9	7.75E03	31.9
LYM217	13181. 6	C	0.85 9	0.00E +00	123.4	LYM68	1194 1.4	H	0.06	9.46E03	36.1
LYM23	12783. 7	C	0.78	0.00E +00	102.9	LYM 180	1344 1.5	H	0.05 8	1.89E02	30.4
LYM245	13062. 5	C	0.77 3	0.00E +00	101.1	LYM 107	1263 2.1	H	0.05 7	1.94E02	29.2
LYM245	13061. 6	C	0.64 6	0.00E +00	68	LYM90	1239 3.1	H	0.06	2.02E02	36.1
LYM249	13631. 2	C	0.88 6	0.00E +00	130.4	LYM68	1194 1.3	H	0.05 7	2.16E02	29.1
LYM249	13633. 1	C	0.84 4	0.00E +00	119.6	LYM157	1334 2.4	H	0.05 9	2.17E02	33.1
LYM251	13073. 8	C	1.06	0.00E +00	175.7	LYM68	1194 2.3	H	0.06 3	2.18E02	42.3
LYM251	13073. 7	C	0.91 8	0.00E +00	138.9	LYM 180	1344 2.6	H	0.05 7	3.88E02	27.7
LYM251	13072. 6	C	0.77 7	0.00E +00	102.2	LYM117	1362 1.8	H	0.05 5	5.30E02	24.2
LYM251	13072. 8	C	0.77	0.00E +00	100.4	CONTR OL	—	H	0.04 4	—	0
LYM251	13074. 6	C	0.75 5	0.00E +00	96.5	LYM268	1248 2.3	A	0.00 4	6.00E06	66.2
LYM273	13723. 1	C	0.88 6	0.00E +00	130.5	LYM 140	1226 1.2	A	0.00 4	5.80E05	59.4
LYM273	13721. 3	C	0.75 5	0.00E +00	96.3	LYM 162	1223 1.3	A	0.00 6	7.40E05	130.9
LYM273	13722. 4	C	0.66 5	0.00E +00	73	LYM 13	1177 4.1	A	0.00 6	1.23E04	132.9
LYM274	13414. 2	C	0.85 5	0.00E +00	122.3	LYM 140	1226 1.1	A	0.00 5	2.00E04	74.9

376

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM274	13415. 2	C	0.84 7	0.00E +00	120.2	LYM134	1231 4.2	A	0.00 4	3.70E04	68.1
LYM274	13413. 4	c	0.82 4	0.00E +00	114.4	LYM162	1223 4.3	A	0.00 8	7.16E04	204.3
LYM40	13734. 2	c	0.61 1	0.00E +00	58.9	LYM132	1227 1.4	A	0.00 5	8.37E04	79.7
LYM79	13132. 2	c	0.81 1	0.00E +00	110.9	LYM140	1226 1.4	A	0.00 4	1.14E03	47.8
LYM79	13133. 1	c	0.71	0.00E +00	84.6	LYM289	1249 1.1	A	0.00 5	1.21E03	110.6
LYM79	13134. 3	c	0.63 8	0.00E +00	66	LYM290	1250 4.1	A	0.00 4	2.88E03	49.8
LYM249	13631. 4	c	0.59 4	1.00E06	54.4	LYM290	1250 2.4	A	0.00 5	3.71E03	101.9
LYM122	13712. 3	c	0.62 4	2.00E06	62.3	LYM113	1244 4.4	A	0.00 5	3.73E03	104.8
LYM273	13722. 3	c	0.65	2.00E06	69.2	LYM140	1226 2.2	A	0.00 7	4.11E03	187.9
LYM23	12784. 6	c	0.62 5	3.00E06	62.5	LYM134	1231 2.4	A	0.00 6	5.01E03	122.2
LYM224	13435. 1	c	0.69 1	4.00E06	79.7	LYM268	1248 3.4	A	0.00 6	5.96E03	150.2
LYM249	13631. 1	c	0.57 4	7.00E06	49.3	LYM132	1227 5.3	A	0.00 5	7.41E03	73.9
LYM40	13732. 1	c	0.72 8	1.00E05	89.4	LYM268	1248 2.1	A	0.00 9	1.25E02	246.9
LYM79	13133. 3	c	0.58 9	1.50E05	53.1	LYM102	1222 2.3	A	0.01 3	1.32E02	387.9
LYM240	12682. 1	c	0.89 8	1.80E05	133.5	LYM3	1204 1.2	A	0.00 5	1.33E02	107.7
LYM131	12791. 8	c	0.73 4	3.10E05	90.9	LYM289	1249 3.2	A	0.00 6	1.44E02	144.4
LYM274	13413. 1	c	0.61 7	4.50E05	60.5	LYM3	1204 2.1	A	0.00 5	1.46E02	108.7
LYM260	13095. 7	c	0.58 6	7.10E05	52.5	LYM162	1223 4.4	A	0.00 5	1.69E02	101
LYM23	12782. 6	c	0.63 5	8.80E05	65.2	LYM113	1244 4.5	A	0.00 5	1.98E02	96.1
LYM40	13732. 2	c	0.57	1.08E04	48.4	LYM113	1244 2.2	A	0.00 5	2.39E02	95.2
LYM260	13095. 1	c	0.76 9	1.25E04	100	LYM289	1249 2.2	A	0.00 8	2.43E02	194.7
LYM122	13712. 1	c	0.59 4	1.35E04	54.4	LYM106	1214 2.1	A	0.00 9	2.45E02	261.4
LYM164	12814. 8	c	0.56 5	2.55E04	47	LYM113	1244 2.1	A	0.00 6	2.58E02	136.7
LYM245	13064. 8	c	0.57 9	3.35E04	50.6	LYM132	1227 3.2	A	0.00 3	2.75E02	25.6
LYM122	13714. 2	c	0.61 8	3.64E04	60.6	LYM134	1231 2.3	A	0.00 7	2.91E02	155.1
LYM164	12814. 7	c	0.56 8	5.97E04	47.6	LYM148	1217 3.1	A	0.00 6	2.96E02	130
LYM224	13434.	c	0.54	8.91E-	41.8	LYM13	1177	A	0.00	2.97E-	36.2

377

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
	2		5	04			2.2		4	02
LYM164	12813. 8	C	0.53 4	9.49E04	38.8	LYM132	1227 6.1	A	0.00 8	3.01E02	206.3
LYM224	13435. 5	c	0.55 4	1.23E03	44	LYM129	1257 3.1	A	0.00 4	3.03E02	71
LYM193	13484. 4	c	0.53 1	1.25E03	38	LYM102	1222 2.1	A	0.01 2	3.89E02	345.4
LYM23	12783. 8	c	0.51 5	1.59E03	33.9	LYM134	1231 1.2	A	0.00 6	4.57E02	122.2
LYM193	13484. 3	c	0.53 7	2.28E03	39.7	LYM268	1248 1.1	A	0.00 4	5.25E02	72.9
LYM217	13182. 1	c	0.54 4	3.30E03	41.4	LYM10	1174 4.5	A	0.00 4	5.94E02	47.8
LYM249	13631. 3	c	0.49 4	5.23E03	28.5	LYM148	1217 2.1	A	0.00 6	6.12E02	116.4
LYM79	13134. 2	c	0.50 4	8.40E03	31.1	LYM113	1244 3.1	A	0.00 8	6.54E02	197.6
LYM273	13721. 1	c	0.50 5	1.06E02	31.4	LYM289	1249 1.4	A	0.00 4	6.60E02	52.7
LYM260	13095. 8	c	0.49 7	1.36E02	29.2	LYM102	1222 2.2	A	0.00 8	7.00E02	222.7
LYM23	12782. 7	c	0.50 3	1.53E02	30.9	LYM10	1174 2.2	A	0.00 4	8.72E02	44
LYM245	13061. 8	c	0.48 3	1.73E02	25.7	LYM13	1177 2.1	A	0.00 5	9.00E02	77.8
LYM23	12783. 5	c	0.48 7	1.88E02	26.7	LYM129	1257 3.5	A	0.00 5	9.06E02	85.5
LYM217	13181. 7	c	0.47 9	3.48E02	24.7	LYM102	1222 1.1	A	0.00 7	9.14E02	183.1
LYM224	13432. 1	c	0.46 5	3.71E02	21	LYM106	1214 4.4	A	0.00 4	9.31E02	66.2
CONTR OL	—	c	0.38 4	—	0	LYM3	1204 3.2	A	0.00 4	9.69E02	70
LYM122	13713. 2	D	6.38 8	0.00E +00	77	CONTR OL	—	A	0.00 3	—	0
LYM249	13631. 4	D	5.39 8	0.00E +00	49.6	LYM13	1177 4.1	B	0.13 2	3.00E06	64.6
LYM273	13723. 1	D	7.90 7	0.00E +00	119.1	LYM3	1204 1.2	B	0.13 4	2.20E04	66.7
LYM249	13631. 3	D	4.59 9	3.10E05	27.4	LYM162	1223 4.3	B	0.18 6	4.15E04	131.8
LYM249	13631. 1	D	5.21 5	4.80E05	44.5	LYM162	1223 4.4	B	0.12	6.94E04	49.1
LYM251	13073. 8	D	9.27 6	2.48E04	157	LYM140	1226 1.2	B	0.10 3	8.53E04	28
LYM131	12793. 3	D	5.81 7	2.93E04	61.2	LYM3	1204 3.2	B	0.10 4	3.07E03	29.9
LYM164	12813. 5	D	8.33 4	4.25E04	130.9	LYM290	1250 2.4	B	0.13	3.23E03	61.6
LYM245	13061. 6	D	6.16 3	1.03E03	70.8	LYM132	1227 6.1	B	0.15 9	3.74E03	98.1
LYM273	13722. 4	D	5.99 7	1.03E03	66.2	LYM162	1223 1.3	B	0.13 6	5.97E03	69.7

378

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM23	12783. 8	D	4.63 1	2.39E03	28.3	LYM134	1231 2.3	B	0.15 7	6.63E03	95.2
LYM40	13734. 2	D	5.44 6	2.86E03	50.9	LYM289	1249 1.1	B	0.12 8	7.98E03	59
LYM217	13181. 6	D	7.55 6	3.51E03	109.4	LYM140	1226 2.2	B	0.17 4	8.75E03	117.3
LYM224	13432. 1	D	4.16 5	4.08E03	15.4	LYM132	1227 5.3	B	0.11 4	8.82E03	41.5
LYM274	13415. 2	D	7.41 9	4.10E03	105.6	LYM289	1249 2.2	B	0.19	1.16E02	137.4
LYM251	13074. 6	D	6.66 6	4.94E03	84.7	LYM268	1248 2.1	B	0.19 2	1.21E02	139.2
LYM249	13633. 1	D	8	4.95E03	121.7	LYM113	1244 2.1	B	0.14 5	1.30E02	80.3
LYM23	12783. 7	D	7.13 7	6.65E03	97.7	LYM268	1248 3.4	B	0.13 2	1.32E02	64.2
LYM79	13134. 3	D	5.54	7.39E03	53.5	LYM3	1204 2.1	B	0.14 2	1.38E02	77.1
LYM122	13714. 4	D	8.31 5	8.23E03	130.4	LYM290	1250 4.1	B	0.09 5	1.49E02	17.8
LYM79	13133. 1	D	6.17 9	1.22E02	71.2	LYM148	1217 3.1	B	0.14 1	1.51E02	75.8
LYM79	13132. 2	D	7.31 5	1.42E02	102.7	LYM134	1231 2.4	B	0.13 9	1.55E02	73.1
LYM251	13072. 6	D	7.17 5	1.42E02	98.8	LYM290	1250 2.1	B	0.09 6	1.59E02	20
LYM251	13073. 7	D	8.23	1.56E02	128	LYM106	1214 4.4	B	0.10 3	1.67E02	28.3
LYM251	13072. 8	D	6.89 6	1.59E02	91.1	LYM102	1222 2.3	B	0.25 2	2.42E02	213.8
LYM273	13721. 3	D	6.84 4	1.74E02	89.6	LYM148	1217 2.1	B	0.12 7	2.50E02	58.1
LYM274	13414. 2	D	7.66 7	1.85E02	112.4	LYM106	1214 2.1	B	0.19 4	2.73E02	141.6
LYM245	13062. 5	D	6.54 3	2.21E02	81.3	LYM102	1222 2.1	B	0.23 7	3.04E02	195.1
LYM40	13732. 2	D	5.37 3	2.26E02	48.9	LYM113	1244 4.5	B	0.13 3	3.89E02	65.3
LYM122	13712. 3	D	5.38 4	2.45E02	49.2	LYM129	1257 3.5	B	0.13 5	3.90E02	67.9
LYM224	13435. 1	D	6.55 4	2.96E02	81.6	LYM129	1257 1.3	B	0.15 1	4.13E02	88.4
LYM249	13631. 2	D	7.72	3.46E02	113.9	LYM268	1248 2.3	B	0.09 4	4.38E02	17.1
LYM273	13722. 3	D	5.77 7	3.61E02	60.1	LYM113	1244 4.4	B	0.13 6	4.55E02	69.1
LYM79	13133. 3	D	5.12 6	3.67E02	42	LYM289	1249 3.2	B	0.13	4.69E02	62.4
LYM23	12784. 6	D	5.42 8	3.91E02	50.4	LYM113	1244 3.1	B	0.18 6	5.16E02	131.8
LYM193	13482. 4	D	6.65 4	4.51E02	84.4	LYM134	1231 1.2	B	0.13 9	5.91E02	73.4
LYM193	13484.	D	4.89	4.61E-	35.6	LYM132	1227	B	0.10	6.45E-	31.3

379

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
	4		5	02			1.4		5	02
LYM274	13413. 4	D	7.88 9	4.88E02	118.6	LYM129	1257 3.1	B	0.11 4	6.88E02	41.7
LYM193	13481. 2	D	4.14	5.04E02	14.7	LYM140	1226 1.4	B	0.09 6	7.22E02	19.9
LYM40	13732. 1	D	6.93 9	5.19E02	92.3	LYM106	1214 1.4	B	0.12 1	7.36E02	50.4
LYM122	13712. 1	D	5.60 8	5.71E02	55.4	LYM102	1222 2.2	B	0.19 2	7.66E02	139.1
LYM164	12813. 8	D	4.76 6	6.09E02	32	LYM162	1223 3.2	B	0.11 4	8.96E02	42.5
LYM164	12814. 8	D	5.12 6	6.17E02	42	LYM140	1226 1.1	B	0.09 6	9.02E02	19.5
LYM240	12682. 1	D	8.44 4	6.37E02	134	LYM13	1177 2.2	B	0.13 1	9.05E02	63.5
LYM260	13095. 7	D	5.14 7	6.73E02	42.6	CONTR OL	—	B	0.08	—	0
LYM274	13413. 1	D	5.52 8	7.60E02	53.2	LYM102	1222 2.3	C	1.24 2	0.00E +00	203.7
LYM23	12783. 5	D	4.38 8	7.70E02	21.6	LYM102	1222 2.1	C	1.14 8	0.00E +00	180.7
LYM131	12791. 8	D	6.88 2	8.02E02	90.7	LYM106	1214 2.1	C	0.74 4	0.00E +00	82.1
LYM193	13484. 3	D	5.01 9	9.01E02	39.1	LYM113	1244 4.4	C	0.80 5	0.00E +00	96.9
CONTR OL	—	D	3.60 9	—	0	LYM113	1244 3.1	C	0.79 4	0.00E +00	94.1
LYM251	13073. 8	E	0.58 4	1.00E06	58.3	LYM129	1257 3.5	C	0.86 1	0.00E +00	110.7
LYM251	13074. 6	E	0.57 7	1.00E06	56.3	LYM132	1227 6.1	C	0.74 9	0.00E +00	83.3
LYM249	13631. 2	E	0.58 2	4.00E06	57.8	LYM148	1217 3.1	C	0.79 8	0.00E +00	95.1
LYM164	12811. 8	E	0.55 1	6.00E06	49.2	LYM148	1217 2.1	C	0.73 4	0.00E +00	79.5
LYM217	13181. 6	E	0.56 7	1.50E05	53.6	LYM162	1223 4.3	C	0.97 8	0.00E +00	139.2
LYM245	13062. 5	E	0.53 7	3.50E05	45.6	LYM162	1223 1.2	C	0.73 2	0.00E +00	79
LYM245	13064. 8	E	0.52 2	1.42E04	41.5	LYM268	1248 2.3	C	0.78 4	0.00E +00	91.8
LYM122	13713. 2	E	0.52 2	2.35E04	41.5	LYM268	1248 3.4	C	0.76 2	0.00E +00	86.3
LYM164	12813. 5	E	0.54 4	2.41E04	47.5	LYM268	1248 3.2	C	0.74	0.00E +00	81
LYM122	13712. 3	E	0.51 9	2.99E04	40.7	LYM289	1249 2.2	C	0.84 5	0.00E +00	106.7
LYM251	13073. 7	E	0.52 7	4.09E04	42.7	LYM289	1249 1.1	C	0.78 9	0.00E +00	92.9
LYM273	13722. 4	E	0.50 5	9.21E04	36.9	LYM289	1249 3.6	C	0.78 5	0.00E +00	92
LYM273	13723. 1	E	0.50 2	1.54E03	36.1	LYM289	1249 3.2	C	0.72 1	0.00E +00	76.4

380

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM23	12783. 7	E	0.49 3	2.29E03	33.5	LYM290	1250 2.4	C	0.77 7	0.00E +00	90
LYM131	12791. 8	E	0.48 7	2.71E03	31.9	LYM148	1217 3.5	c	0.71 1	1.00E06	73.9
LYM251	13072. 8	E	0.49 8	2.78E03	35	LYM268	1248 2.1	c	0.77 2	1.00E06	88.9
LYM260	13095. 7	E	0.49 1	3.02E03	32.9	LYM290	1250 1.2	c	0.72 4	1.00E06	77.1
LYM249	13631. 1	E	0.48 9	3.23E03	32.5	LYM129	1257 1.3	c	0.77 6	2.00E06	89.9
LYM249	13631. 4	E	0.49 8	3.49E03	34.8	LYM162	1223 1.3	c	0.74 6	2.00E06	82.5
LYM131	12793. 3	E	0.48 6	3.59E03	31.8	LYM102	1222 2.2	c	0.74 8	5.00E06	83.1
LYM251	13072. 6	E	0.48 3	4.03E03	31	LYM10	1174 4.5	c	0.71 1	7.00E06	73.8
LYM79	13132. 2	E	0.47 8	5.43E03	29.6	LYM134	1231 4.2	c	0.65 8	2.30E05	61
LYM79	13134. 3	E	0.47 3	7.86E03	28	LYM10	1174 1.4	c	0.68 3	2.80E05	67
LYM193	13482. 4	E	0.47 8	8.17E03	29.6	LYM113	1244 2.1	c	0.64 8	3.30E05	58.5
LYM79	13133. 1	E	0.48 1	8.28E03	30.4	LYM13	1177 4.1	c	0.64 1	3.30E05	56.7
LYM274	13415. 2	E	0.47 5	9.01E03	28.6	LYM134	1231 1.2	c	0.65 1	7.30E05	59.3
LYM40	13734. 2	E	0.46 9	9.05E03	27.2	LYM289	1249 1.4	c	0.65 4	1.15E04	60
LYM260	13095. 1	E	0.49 6	1.32E02	34.3	LYM148	1217 1.2	c	0.60 8	1.49E04	48.7
LYM224	13434. 2	E	0.46 6	1.34E02	26.4	LYM140	1226 1.4	c	0.62 2	1.52E04	52.1
LYM79	13133. 3	E	0.46 5	1.55E02	25.9	LYM134	1231 2.4	c	0.61 6	1.68E04	50.6
LYM164	12814. 7	E	0.46 7	1.71E02	26.5	LYM148	1217 4.1	c	0.60 8	1.69E04	48.6
LYM274	13413. 4	E	0.47 5	2.10E02	28.6	LYM106	1214 2.2	c	0.64 7	2.21E04	58.2
LYM40	13732. 1	E	0.47 5	2.15E02	28.7	LYM268	1248 1.1	c	0.63 9	2.23E04	56.3
LYM40	13732. 2	E	0.46	2.66E02	24.6	LYM290	1250 2.1	c	0.61	4.18E04	49.3
LYM260	13095. 8	E	0.46 2	2.67E02	25.3	LYM290	1250 4.1	c	0.60 9	6.87E04	48.9
LYM23	12784. 6	E	0.45 3	2.97E02	22.8	LYM113	1244 4.5	c	0.59 6	7.01E04	45.7
LYM274	13414. 2	E	0.45 7	2.97E02	23.7	LYM102	1222 1.1	c	0.64 8	1.55E03	58.5
LYM240	12682. 1	E	0.46 2	4.66E02	25.1	LYM3	1204 2.1	c	0.57	2.95E03	39.4
LYM23	12782. 6	E	0.45 1	5.25E02	22.2	LYM129	1257 3.1	c	0.58 1	3.85E03	42.1
LYM193	13481.	E	0.43	6.58E-	18.9	LYM140	1226	c	0.57	4.08E-	40.5

381

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
	2		9	02			2.3		4	03
LYM23	12783. 8	E	0.43 8	8.19E02	18.6	LYM134	1231 2.3	C	0.56 7	4.13E03	38.6
LYM224	13435. 5	E	0.43 8	8.43E02	18.8	LYM 10	1174 1.2	c	0.55 9	4.92E03	36.8
LYM273	13722. 3	E	0.44	9.76E02	19.3	LYM132	1227 3.2	c	0.56 3	5.24E03	37.6
CONTR OL	—	E	0.36 9	—	0	LYM290	1250 1.3	c	0.55 2	5.82E03	34.9
LYM131	12791. 8	F	6.80 9	0.00E +00	41.1	LYM 106	1214 1.4	c	0.57 7	7.47E03	41.2
LYM251	13073. 8	F	7.17 8	0.00E +00	48.8	LYM 140	1226 1.1	c	0.54	1.12E02	32.2
LYM251	13074. 6	F	7.04 2	0.00E +00	46	LYM3	1204 1.1	c	0.54 7	1.19E02	33.7
LYM251	13073. 7	F	6.98 8	0.00E +00	44.9	LYM132	1227 1.4	c	0.56 5	1.23E02	38.3
LYM251	13072. 6	F	6.46 5	0.00E +00	34	LYM 10	1174 2.2	c	0.56 9	1.23E02	39.3
LYM40	13734. 2	F	5.90 2	0.00E +00	22.3	LYM 140	1226 2.2	c	0.56	1.42E02	36.9
LYM249	13631. 3	F	5.61 7	1.00E06	16.4	LYM 13	1177 2.1	c	0.53	1.46E02	29.6
LYM 164	12811. 8	F	5.94 1	2.00E06	23.1	LYM3	1204 1.2	c	0.52 4	2.55E02	28.1
LYM79	13134. 3	F	5.85 2	2.00E06	21.3	LYM 129	1257 2.2	c	0.52 1	3.13E02	27.5
LYM245	13064. 8	F	6.21 5	3.00E06	28.8	LYM 102	1222 2.6	c	0.52 2	3.24E02	27.7
LYM274	13415. 2	F	6.45 4	1.40E05	33.8	LYM 13	1177 2.2	c	0.51 6	4.80E02	26.2
LYM274	13413. 4	F	6.96 3	4.00E05	44.3	LYM132	1227 5.1	c	0.50 1	6.79E02	22.6
LYM 193	13481. 2	F	5.96	8.50E05	23.5	LYM 162	1223 4.4	c	0.50 1	6.95E02	22.5
LYM79	13132. 2	F	6.12 2	1.83E04	26.9	LYM 13	1177 1.6	c	0.51 9	7.56E02	26.9
LYM 122	13714. 4	F	6.25 4	3.39E04	29.6	LYM 140	1226 1.2	c	0.50 2	8.74E02	22.7
LYM 122	13712. 1	F	6.19	3.43E04	28.3	LYM3	1204 3.2	c	0.49 4	9.78E02	20.9
LYM245	13062. 5	F	5.76 8	3.71E04	19.6	CONTR OL	—	c	0.40 9	—	0
LYM249	13631. 2	F	6.98 7	4.32E04	44.8	LYM268	1248 2.3	D	6.51 6	0.00E +00	87.6
LYM 193	13482. 4	F	6.30 8	4.55E04	30.8	LYM268	1248 3.4	D	6.28 8	2.00E06	81
LYM217	13181. 6	F	6.75 3	5.78E04	40	LYM148	1217 1.2	D	5.18 9	4.00E05	49.4
LYM 164	12814. 8	F	5.56 1	7.94E04	15.3	LYM289	1249 2.2	D	7.22 3	7.40E05	107.9
LYM131	12793. 3	F	6.00 3	1.10E03	24.4	LYM148	1217 4.1	D	5.09 6	9.60E05	46.7

382

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM23	12783. 7	F	6.27 5	1.34E- 03	30.1	LYMl 40	1226 1.1	D	4.51 2	3.53E04	29.9
LYMl 22	13713. 2	F	6.76 5	1.65E- 03	40.2	LYMl 3	1177 2.1	D	4.46 7	8.33E04	28.6
LYM245	13061. 6	F	6.11 7	3.30E03	26.8	LYM148	1217 3.1	D	6.76 7	1.30E- 03	94.8
LYM273	13722. 4	F	6.08 9	3.52E03	26.2	LYM290	1250 2.4	D	6.42 5	2.00E03	85
LYMl 64	12813. 5	F	6.91 5	5.03E03	43.3	LYMl 62	1223 4.3	D	8.82	2.51E03	153.9
LYM249	13631. 1	F	5.83	5.49E03	20.8	LYMl 62	1223 1.2	D	6.02 6	2.51E03	73.5
LYM273	13723. 1	F	6.30 3	5.56E03	30.6	LYM289	1249 3.6	D	6.41 3	2.68E03	84.6
LYM40	13732. 1	F	6.44 6	6.08E03	33.6	LYM289	1249 3.2	D	5.99 7	3.69E03	72.6
LYM224	13435. 1	F	6.00 1	6.99E03	24.4	LYM132	1227 6.1	D	6.25 7	4.48E03	80.1
LYM240	12682. 1	F	6.59 4	9.82E03	36.7	LYMl 13	1244 2.1	D	5.43 5	4.57E03	56.5
LYMl 22	13712. 3	F	5.82 2	1.17E02	20.7	LYM290	1250 1.3	D	4.57 3	5.64E03	31.7
LYM224	13435. 5	F	5.72 6	1.24E- 02	18.7	LYMl 3	1177 4.1	D	5.36 3	6.31E03	54.4
LYM249	13633. 1	F	6.40 5	1.51E02	32.8	LYM132	1227 5.3	D	4.07 6	6.87E03	17.3
LYM40	13732. 2	F	6.01 5	1.52E02	24.7	LYM148	1217 3.5	D	5.83 6	6.99E03	68
LYM274	13414. 2	F	5.79 2	1.60E02	20.1	LYMl 06	1214 2.1	D	6.27 9	7.68E03	80.8
LYM224	13432. 1	F	5.18 4	1.77E02	7.5	LYMl 13	1244 4.4	D	6.70 6	9.46E03	93
LYM249	13631. 4	F	6.1	2.05E02	26.4	LYMl 13	1244 4.5	D	4.96 5	1.05E- 02	42.9
LYM260	13095. 7	F	5.94 3	2.05E02	23.2	LYMl 02	1222 2.3	D	10.3 47	1.06E02	197.9
LYM260	13095. 1	F	6.16 5	2.12E02	27.8	LYM289	1249 1.1	D	6.56	1.24E02	88.8
LYM251	13072. 8	F	5.90 1	2.20E02	22.3	LYMl 13	1244 3.1	D	6.78 4	1.25E02	95.3
LYMl 64	12814. 7	F	5.8	2.60E02	20.2	LYM268	1248 3.2	D	6.26 3	1.30E02	80.3
LYM274	13413. 1	F	5.83 4	2.70E02	20.9	LYM134	1231 2.4	D	5.22 4	1.38E02	50.4
LYMl 93	13484. 4	F	5.59 9	3.59E02	16.1	LYM134	1231 4.2	D	5.60 9	1.45E02	61.5
LYM79	13133. 1	F	5.78 2	4.30E02	19.8	LYM148	1217 2.1	D	6.05 5	1.59E02	74.3
LYM273	13721. 3	F	5.38 6	4.48E02	11.6	LYMl 40	1226 1.4	D	5.19 2	1.62E02	49.5
LYM79	13133. 3	F	5.45 2	4.87E02	13	LYM290	1250 1.2	D	6.09 7	1.82E02	75.5
LYM23	12782.	F	5.25	6.38E-	8.8	LYMl 29	1257	D	7.10	2.09E-	104.6

383

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
	7		1	02			3.5		7	02
LYM260	13095. 8	F	5.58 8	9.86E02	15.8	LYM290	1250 2.1	D	5.03 8	2.88E02	45
CONTR OL	—	F	4.82 4	—	0	LYM3	1204 2.1	D	4.82 3	3.26E02	38.8
LYM224	13435. 3	G	0.76 4	0.00E +00	72.3	LYM162	1223 1.3	D	6.43 4	3.53E02	85.2
LYM40	13734. 2	G	0.56 7	1.08E04	27.9	LYM134	1231 1.2	D	5.55 8	3.62E02	60
LYM273	13722. 4	G	0.85 6	4.09E04	93.1	LYM102	1222 2.1	D	9.50 6	3.77E02	173.6
LYM273	13721. 1	G	0.70 1	6.35E04	58.1	LYM129	1257 2.2	D	4.35	3.96E02	25.2
LYM273	13721. 3	G	1.06 3	7.82E04	139.6	LYM10	1174 1.4	D	5.71 2	4.08E02	64.4
LYM122	13712. 3	G	0.63 2	8.84E04	42.4	LYM129	1257 1.3	D	6.49 5	4.89E02	87
LYM251	13073. 8	G	0.87 9	1.02E03	98.3	LYM3	1204 3.2	D	4.15 2	5.04E02	19.5
LYM23	12783. 5	G	0.66 3	1.60E03	49.5	LYM10	1174 4.5	D	5.88 6	5.04E02	69.4
LYM164	12813. 5	G	0.82 4	3.06E03	85.8	LYM132	1227 5.1	D	4.22 8	5.06E02	21.7
LYM249	13633. 1	G	0.94 4	3.80E03	112.9	LYM10	1174 1.2	D	4.70 1	5.08E02	35.3
LYM79	13132. 2	G	0.88 1	4.30E03	98.7	LYM268	1248 2.1	D	6.36	5.11E02	83.1
LYM217	13182. 1	G	0.79 7	5.62E03	79.6	LYM134	1231 2.3	D	4.74 2	5.15E02	36.5
LYM23	12783. 7	G	0.87 1	6.19E03	96.5	LYM102	1222 2.2	D	6.47 6	5.30E02	86.4
LYM193	13484. 3	G	0.77	7.00E03	73.6	LYM268	1248 1.1	D	5.36 4	5.40E02	54.4
LYM249	13631. 1	G	0.69 6	7.39E03	56.9	LYM162	1223 4.4	D	4.15 4	5.73E02	19.6
LYM251	13072. 8	G	0.80 7	8.13E03	82	LYM290	1250 4.1	D	5.10 5	5.84E02	47
LYM122	13713. 2	G	0.72 1	8.93E03	62.6	LYM3	1204 1.1	D	4.53 8	6.02E02	30.7
LYM274	13414. 2	G	0.89 5	1.25E02	101.9	LYM132	1227 3.2	D	4.75 5	6.21E02	36.9
LYM224	13435. 5	G	0.54 9	1.36E02	23.7	LYM106	1214 2.2	D	5.33 5	6.22E02	53.6
LYM79	13133. 3	G	0.65 2	1.38E02	47.1	LYM289	1249 1.4	D	5.47 2	6.26E02	57.5
LYM217	13181. 11	G	0.67 7	1.41E02	52.7	LYM3	1204 1.2	D	4.40 2	6.70E02	26.7
LYM273	13723. 1	G	0.82 5	1.50E02	86	LYM102	1222 2.6	D	4.51 8	8.47E02	30.1
LYM122	13714. 4	G	0.93 9	1.71E02	111.7	LYM140	1226 2.3	D	4.82 6	8.91E02	38.9
LYM251	13073. 7	G	0.96 4	1.78E02	117.4	LYM129	1257 3.1	D	4.88 8	9.60E02	40.7

384

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM274	13411. 2	G	0.53	2.47E02	19.6	CONTR OL	—	D	3.47 4	—	0
LYM245	13062. 5	G	0.74 2	2.75E02	67.4	LYM129	1257 3.5	E	0.70 9	4.00E06	62.2
LYM23	12782. 6	G	0.79 4	2.84E02	79.1	LYM289	1249 3.6	E	0.69 7	7.00E06	59.3
LYM274	13413. 4	G	0.79 1	3.21E- 02	78.4	LYM162	1223 1.2	E	0.65 9	7.90E05	50.8
LYM122	13712. 1	G	0.69 5	3.25E02	56.7	LYM102	1222 2.3	E	0.67 5	8.60E05	54.3
LYM245	13061. 6	G	0.82	3.44E02	84.9	LYM290	1250 2.4	E	0.63 2	2.93E04	44.5
LYM23	12784. 6	G	0.75 2	3.82E02	69.6	LYM148	1217 3.5	E	0.62 5	5.90E04	43
LYM251	13072. 6	G	0.90 7	3.90E02	104.5	LYM102	1222 2.1	E	0.63 8	7.08E04	46
LYM251	13074. 6	G	0.64 3	3.93E02	45.1	LYM290	1250 1.2	E	0.62 2	7.15E- 04	42.1
LYM40	13732. 2	G	0.56 3	4.57E02	27	LYM268	1248 2.3	E	0.61 3	1.36E- 03	40.2
LYM23	12782. 7	G	0.54 1	4.89E02	22	LYM10	1174 4.5	E	0.60 7	1.97E03	38.8
LYM217	13181. 7	G	0.56 2	5.20E02	26.7	LYM148	1217 2.1	E	0.6	2.71E03	37.1
LYM217	13183. 2	G	0.91 3	5.21E- 02	106	LYM148	1217 4.1	E	0.59 1	3.47E03	35.1
LYM164	12813. 8	G	0.65	5.77E02	46.5	LYM140	1226 1.4	E	0.59	4.44E03	34.9
LYM273	13722. 3	G	0.63 9	5.87E02	44.1	LYM268	1248 3.4	E	0.59 5	4.63E03	36.1
LYM224	13435. 1	G	0.92 7	5.89E02	108.9	LYM268	1248 3.2	E	0.58 6	5.11E- 03	34.1
LYM217	13181. 6	G	0.62 2	6.07E02	40.2	LYM113	1244 3.1	E	0.58	7.96E03	32.6
LYM274	13415. 2	G	0.71 8	6.41E- 02	61.8	LYM289	1249 1.1	E	0.57 2	1.03E02	30.8
LYM240	12682. 1	G	0.80 8	6.42E02	82.2	LYM289	1249 2.2	E	0.58 2	1.07E02	33.1
LYM79	13133. 1	G	0.60 4	6.96E02	36.2	LYM132	1227 3.2	E	0.56 6	1.31E02	29.5
LYM224	13434. 2	G	0.64 3	7.21E- 02	44.9	LYM290	1250 1.3	E	0.56 6	1.39E02	29.4
LYM122	13714. 2	G	0.78	8.03E02	75.9	LYM106	1214 2.2	E	0.56 5	1.55E02	29.3
LYM245	13064. 8	G	0.56 9	8.26E02	28.3	LYM10	1174 2.2	E	0.56 8	1.60E02	30
LYM40	13732. 1	G	0.68	8.52E02	53.3	LYM13	1177 4.1	E	0.56 2	1.77E02	28.5
LYM249	13631. 2	G	0.80 4	8.60E02	81.3	LYM113	1244 4.4	E	0.55 4	2.37E02	26.7
LYM23	12783. 8	G	0.5	8.97E02	12.7	LYM134	1231 1.2	E	0.55 3	2.63E02	26.4
LYM79	13134.	G	0.55	9.71E-	25.7	LYM10	1174	E	0.55	2.69E-	26.7

385

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
	3		7	02			1.4		4	02
CONTR OL	—	G	0.44 3	—	0	LYM10	1174 1.2	E	0.54 8	3.19E- 02	25.4
LYM122	13714. 4	H	0.09 5	0.00E +00	118.7	LYM132	1227 5.1	E	0.55 1	3.90E02	26
LYM122	13713. 2	H	0.07 2	0.00E +00	66.2	LYM132	1227 6.1	E	0.55	3.90E02	25.8
LYM122	13712. 3	H	0.06 4	0.00E +00	47	LYM290	1250 4.1	E	0.54 8	4.08E02	25.2
LYM164	12813. 5	H	0.08	0.00E +00	84.1	LYM129	1257 1.3	E	0.54 9	4.67E02	25.5
LYM193	13484. 3	H	0.07 3	0.00E +00	67	LYM289	1249 3.2	E	0.54 1	5.42E02	23.7
LYM217	13183. 2	H	0.08 9	0.00E +00	104.8	LYM289	1249 1.4	E	0.54 3	5.79E02	24.1
LYM217	13182. 1	H	0.08 4	0.00E +00	93	LYM113	1244 2.1	E	0.54	6.19E- 02	23.4
LYM217	13181. 11	H	0.06 9	0.00E +00	58.8	LYM102	1222 2.2	E	0.54 1	6.54E02	23.6
LYM224	13435. 3	H	0.07	0.00E +00	60.5	LYM134	1231 4.2	E	0.53	7.02E02	21.2
LYM23	12783. 7	H	0.08 9	0.00E +00	104	LYM102	1222 2.6	E	0.52 4	9.02E02	19.9
LYM23	12782. 6	H	0.08 2	0.00E +00	89	LYM140	1226 2.3	E	0.53 1	9.82E02	21.4
LYM23	12784. 6	H	0.07 3	0.00E +00	68.3	CONTR OL	—	E	0.43 7	—	0
LYM23	12783. 5	H	0.06 6	0.00E +00	51.8	LYM129	1257 3.5	F	7.52 9	0.00E +00	48.8
LYM245	13061. 6	H	0.08 1	0.00E +00	85.2	LYM148	1217 4.1	F	6.57 6	0.00E +00	30
LYM245	13062. 5	H	0.07 8	0.00E +00	79.4	LYM102	1222 2.6	F	6.33 1	1.00E- 06	25.2
LYM249	13633. 1	H	0.09 8	0.00E +00	123.9	LYM134	1231 1.2	F	6.31 4	1.00E- 06	24.8
LYM249	13631. 1	H	0.06 8	0.00E +00	56.9	LYM290	1250 2.4	F	6.93 4	3.00E06	37.1
LYM251	13073. 7	H	0.09 7	0.00E +00	122.4	LYM132	1227 3.2	F	6.46 8	8.00E06	27.9
LYM251	13073. 8	H	0.08 8	0.00E +00	102.1	LYM289	1249 1.1	F	6.65 7	2.20E05	31.6
LYM251	13072. 6	H	0.08 7	0.00E +00	100.7	LYM290	1250 1.3	F	6.05 9	4.00E05	19.8
LYM251	13072. 8	H	0.08 7	0.00E +00	99.1	LYM134	1231 4.2	F	6.20 4	7.70E05	22.6
LYM251	13074. 6	H	0.06 8	0.00E +00	56.4	LYM148	1217 3.1	F	6.77	1.40E- 04	33.8
LYM273	13721. 3	H	0.10 6	0.00E +00	143.3	LYM13	1177 4.1	F	6.45 9	1.53E- 04	27.7
LYM273	13723. 1	H	0.08 9	0.00E +00	104	LYM290	1250 1.2	F	6.82 3	1.66E- 04	34.9
LYM273	13722. 4	H	0.08 1	0.00E +00	85.6	LYM113	1244 4.4	F	6.32 5	1.73E- 04	25

386

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM273	13721. 1	H	0.07 4	0.00E +00	70.2	LYM 10	1174 4.5	F	7.04 4	1.83E04	39.3
LYM273	13722. 3	H	0.06 7	0.00E +00	54.8	LYM268	1248 3.2	F	6.83	1.89E04	35
LYM274	13414. 2	H	0.09 4	0.00E +00	115.6	LYM289	1249 2.2	F	6.92 6	2.40E04	36.9
LYM274	13413. 4	H	0.07 8	0.00E +00	78.9	LYM289	1249 3.6	F	7.10 8	4.29E04	40.5
LYM79	13132. 2	H	0.09 5	0.00E +00	117	LYM148	1217 2.1	F	6.75 4	6.38E04	33.5
LYM79	13133. 3	H	0.07	0.00E +00	60.2	LYM268	1248 2.3	F	6.81 4	7.13E04	34.7
LYM217	13181. 6	H	0.06 6	1.00E06	51.9	LYM113	1244 3.1	F	6.92 5	9.38E04	36.9
LYM249	13631. 2	H	0.08 5	1.00E06	95.9	LYM 140	1226 1.4	F	6.84 7	1.17E03	35.4
LYM274	13415. 2	H	0.07 4	1.00E06	69.9	LYM148	1217 3.5	F	6.56 8	1.48E03	29.8
LYM79	13133. 1	H	0.06 4	1.00E06	47.7	LYM113	1244 4.5	F	6.07 9	1.72E03	20.2
LYM 164	12813. 8	H	0.06 7	2.00E06	54	LYM 102	1222 2.1	F	7.22 6	2.12E03	42.8
LYM224	13435. 1	H	0.08 9	2.00E06	104.8	LYM 10	1174 1.2	F	5.97 6	2.26E03	18.1
LYM240	12682. 1	H	0.08 2	2.00E06	89	LYM 106	1214 2.2	F	6.15 8	2.57E03	21.7
LYM 122	13714. 2	H	0.07 7	5.00E06	77.8	LYM 162	1223 1.2	F	6.89 9	2.78E03	36.4
LYM40	13734. 2	H	0.05 6	5.00E06	28.3	LYM 10	1174 1.4	F	6.12 8	3.19E03	21.2
LYM 122	13712. 1	H	0.06 3	1.70E05	43.7	LYM148	1217 1.2	F	6.27 6	4.06E03	24.1
LYM224	13434. 2	H	0.06 4	2.70E05	47.3	LYM 162	1223 4.3	F	6.65 1	5.16E03	31.5
LYM40	13732. 1	H	0.06 8	3.00E05	55.4	LYM268	1248 3.4	F	6.74 6	5.50E03	33.4
LYM217	13181. 7	H	0.05 7	9.40E05	31.2	LYM 102	1222 2.3	F	7.19 8	7.29E03	42.3
LYM79	13134. 3	H	0.05 7	1.09E04	31.8	LYM289	1249 3.2	F	6.30 5	7.70E03	24.6
LYM260	13095. 7	H	0.06 3	1.15E04	45.5	LYM113	1244 2.1	F	6.43 8	1.27E02	27.3
LYM23	12782. 7	H	0.05 6	1.57E04	28	LYM 102	1222 2.2	F	6.67 7	1.28E02	32
LYM40	13732. 2	H	0.05 6	1.93E04	28.4	LYM290	1250 4.1	F	6.29 6	1.34E02	24.5
LYM131	12791. 5	H	0.06	3.33E04	37.3	LYM132	1227 5.1	F	6.32 2	1.46E02	25
LYM245	13064. 8	H	0.05 7	4.25E04	29.9	LYM132	1227 5.3	F	5.86 3	1.47E02	15.9
LYM274	13411. 2	H	0.05 3	6.16E04	22.6	LYM132	1227 6.1	F	6.53 6	1.48E02	29.2
LYM79	13134.	H	0.05	1.51E-	24.6	LYM 106	1214	F	6.22	1.59E-	23

387

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
	2		4	03			2.1			02
LYM260	13095. 1	H	0.07	2.31E03	61.7	LYM 10	1174 2.2	F	6.22 6	1.66E02	23.1
LYM23	12783. 8	H	0.05 2	2.84E03	18.8	LYM 106	1214 1.4	F	5.81 1	2.02E02	14.9
LYM274	13413. 1	H	0.05 5	9.12E03	25.3	LYM 162	1223 1.3	F	6.50 8	2.18E02	28.7
LYM249	13631. 4	H	0.05 1	9.60E03	17.4	LYM 129	1257 1.3	F	6.49 9	3.26E02	28.5
LYM 164	12814. 8	H	0.06 1	1.06E02	39.9	LYM 13	1177 2.2	F	6.13	3.39E02	21.2
LYM224	13435. 5	H	0.05	1.25E02	15.3	LYM132	1227 1.4	F	5.81 4	4.00E02	14.9
LYM131	12791. 8	H	0.06 4	1.66E02	47.4	LYM 13	1177 2.1	F	5.74 3	6.50E02	13.5
LYM 193	13482. 4	H	0.05 5	2.52E02	26.1	LYM 129	1257 3.1	F	5.78 3	6.75E02	14.3
LYM260	13095. 8	H	0.05 2	4.62E02	19.8	LYM 13	1177 3.2	F	5.50 5	6.85E02	8.8
LYM224	13432. 1	H	0.04 9	4.71E02	13	LYM3	1204 2.1	F	5.67 3	6.99E02	12.1
CONTR OL	—	H	0.04 4	—	0	LYM268	1248 1.1	F	6.05 6	7.44E02	19.7
LYM 122	13711. 3	A	0.01 1	1.00E06	231.7	LYM134	1231 2.4	F	6.02 8	9.99E02	19.2
LYM234	14093. 2	A	0.01	2.10E05	192.5	CONTR OL	—	F	5.05 8	—	0
LYM 189	13315. 2	A	0.01	5.08E04	197.1	LYM134	1231 2.4	G	0.70 4	0.00E +00	57.1
LYM217	13183. 2	A	0.00 8	5.11E04	130.3	LYM 140	1226 1.2	G	0.63 6	0.00E +00	42
LYM 189	13314. 5	A	0.00 5	9.45E04	67.4	LYM 162	1223 4.3	G	0.91 2	1.00E06	103.5
LYM79	13134. 3	A	0.00 5	9.97E04	62	LYM290	1250 2.4	G	0.66 7	1.30E05	48.9
LYM161	13233. 5	A	0.00 7	1.28E03	124.2	LYM 162	1223 4.4	G	0.75	5.67E04	67.5
LYM217	13186. 1	A	0.01 2	1.32E03	275.4	LYM 140	1226 2.2	G	0.90 3	6.14E04	101.7
LYM217	13181. 9	A	0.00 8	1.81E03	134.2	LYM132	1227 6.1	G	0.82 1	1.92E03	83.4
LYM32	13964. 1	A	0.00 8	2.09E03	144.9	LYM 140	1226 1.4	G	0.54 3	2.25E03	21.2
LYM234	14092. 5	A	0.01 2	2.20E03	277	LYM 13	1177 2.2	G	0.63 4	3.99E03	41.6
LYM240	12683. 5	A	0.01	2.37E03	192.5	LYM289	1249 2.2	G	0.88	4.21E03	96.5
LYM219	13332. 9	A	0.01 1	3.78E03	233.2	LYM132	1227 1.4	G	0.60 9	4.24E03	36
LYM278	13364. 5	A	0.00 4	3.79E03	24.4	LYM289	1249 1.1	G	0.69 1	5.40E03	54.3
LYM245	13061. 8	A	0.01 3	3.90E03	306.9	LYM268	1248 2.1	G	0.93 6	6.27E03	108.9

388

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM234	14092. 1	A	0.00 5	5.44E03	42	LYM3	1204 1.2	G	0.66 1	6.62E03	47.6
LYM74	13954. 1	A	0.01 4	8.73E03	315.4	LYM 162	1223 1.3	G	0.74 8	7.40E03	67
LYM74	13954. 2	A	0.00 9	1.17E02	175.6	LYM268	1248 3.4	G	0.71 7	7.99E03	60.2
LYM188	13244. 6	A	0.00 5	1.21E02	53.6	LYM290	1250 4.1	G	0.56 2	8.97E03	25.4
LYM 189	13311. 3	A	0.00 9	1.35E02	186.4	LYM3	1204 3.2	G	0.63 5	9.85E03	41.8
LYM 189	13311. 2	A	0.01	1.83E02	194.8	LYM148	1217 3.1	G	0.84 9	1.05E02	89.5
LYM274	13415. 2	A	0.01 2	1.98E02	273.9	LYM 13	1177 4.1	G	0.78 9	1.16E02	76.1
LYM79	13132. 2	A	0.01 3	2.07E02	300	LYM 140	1226 1.1	G	0.52 1	1.27E02	16.3
LYM217	13182. 1	A	0.01 2	2.10E02	269.3	LYM 106	1214 2.1	G	0.91 9	1.37E02	105.3
LYM240	12682. 1	A	0.01 2	2.22E02	264.7	LYM134	1231 2.3	G	0.78 1	1.42E02	74.4
LYM 189	13315. 1	A	0.01 7	2.23E02	422.8	LYM3	1204 2.1	G	0.69 3	2.41E02	54.8
LYM188	13244. 7	A	0.00 6	2.61E02	87.3	LYM113	1244 2.1	G	0.70 2	2.51E02	56.8
LYM79	13133. 2	A	0.00 9	3.08E02	161.8	LYM 102	1222 2.3	G	1.04	2.56E02	132.2
LYM79	13133. 3	A	0.00 9	3.18E02	183.3	LYM113	1244 4.5	G	0.67 2	3.11E02	50
LYM 189	13314. 4	A	0.00 9	3.27E02	167.9	LYM289	1249 3.2	G	0.74 7	3.12E02	66.7
LYM188	13244. 4	A	0.01	3.40E02	220.2	LYM 129	1257 3.5	G	0.69	3.20E02	54.1
LYM79	13134. 1	A	0.01	3.50E02	194.8	LYM113	1244 4.4	G	0.64 7	3.21E02	44.4
LYM274	13413. 1	A	0.00 9	3.63E02	166.4	LYM134	1231 1.2	G	0.70 2	3.87E02	56.7
LYM234	14092. 8	A	0.01 2	3.81E02	268.5	LYM 129	1257 3.1	G	0.58 2	3.90E02	30
LYM74	13952. 2	A	0.00 9	3.97E02	181	LYM132	1227 5.3	G	0.61 4	3.97E02	37
LYM32	13963. 4	A	0.00 8	4.02E02	151.8	LYM113	1244 3.1	G	0.86 5	4.24E02	93.2
LYM274	13413. 4	A	0.00 9	4.20E02	169.5	LYM 102	1222 2.1	G	1.12 4	4.88E02	151
LYM234	14091. 1	A	0.00 8	4.79E02	131.1	LYM 106	1214 4.4	G	0.63 8	5.62E02	42.4
LYM161	13233. 6	A	0.01	5.45E02	220.9	LYM 102	1222 2.2	G	0.88 7	6.97E02	98.1
LYM240	12683. 9	A	0.00 4	5.60E02	28.2	LYM148	1217 2.1	G	0.64 9	7.46E02	44.8
LYM79	13131. 1	A	0.00 7	6.26E02	116.5	LYM 102	1222 1.1	G	0.74 4	7.72E02	66.1
LYM32	13963.	A	0.00	6.95E-	49.7	LYM 10	1174	G	0.55	8.52E-	24.1

389

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
	1		5	02			4.5		6	02
LYM273	13721. 3	A	0.00 6	7.08E02	80.4	LYM290	1250 1.2	G	0.66 4	9.90E02	48.2
LYM79	13134. 2	A	0.00 4	7.89E02	32.8	CONTR OL	—	G	0.44 8	—	0
LYM217	13181. 6	A	0.00 5	8.18E02	61.2	LYM 102	1222 2.1	H	0.11 8	0.00E +00	160.6
LYM 122	13713. 4	A	0.00 5	9.83E02	51.2	LYM 102	1222 2.3	H	0.11 3	0.00E +00	149.3
CONTR OL	—	A	0.00 3	—	0	LYM 106	1214 2.1	H	0.09 1	0.00E +00	101.4
LYM161	13233. 5	B	0.14 6	0.00E +00	123.8	LYM132	1227 6.1	H	0.08 4	0.00E +00	85.3
LYM 189	13314. 5	B	0.10 3	0.00E +00	57.6	LYM 140	1226 2.2	H	0.08 8	0.00E +00	94.1
LYM234	14093. 2	B	0.18 1	3.00E06	177.1	LYM148	1217 3.1	H	0.08 4	0.00E +00	86.3
LYM32	13964. 1	B	0.14 5	5.12E- 04	122.8	LYM 162	1223 4.3	H	0.09 1	0.00E +00	100.3
LYM234	14092. 5	B	0.21 9	6.15E- 04	235.5	LYM268	1248 2.1	H	0.09 4	0.00E +00	108.2
LYM 122	13711. 3	B	0.22 5	6.83E04	245.3	LYM289	1249 2.2	H	0.09 2	0.00E +00	104
LYM240	12683. 5	B	0.17 9	8.14E- 04	173.6	LYM 13	1177 4.1	H	0.07 9	1.00E- 06	74.4
LYM245	13061. 8	B	0.24	1.32E- 03	268.1	LYM 162	1223 4.4	H	0.07 4	3.00E06	64.8
LYM217	13186. 1	B	0.19 7	1.61E- 03	202.2	LYM268	1248 3.4	H	0.07 6	3.00E06	68.5
LYM217	13183. 2	B	0.14 4	1.66E- 03	120.5	LYM134	1231 2.3	H	0.07 7	4.00E06	70
LYM 189	13315. 2	B	0.21 2	4.60E03	224.4	LYM113	1244 3.1	H	0.08 7	5.00E06	91.5
LYM219	13332. 9	B	0.19 4	5.69E03	197.9	LYM 162	1223 1.3	H	0.07 4	8.00E06	63.1
LYM74	13954. 2	B	0.15 7	7.07E03	141.3	LYM290	1250 2.4	H	0.07 1	1.30E- 05	57.2
LYM217	13182. 1	B	0.23 1	7.34E03	253.5	LYM 129	1257 3.5	H	0.07 5	2.20E05	66.3
LYM234	14092. 1	B	0.08 7	7.90E03	33	LYM134	1231 2.4	H	0.06 9	3.10E- 05	52.5
LYM278	13364. 5	B	0.07 6	8.29E03	17	LYM 102	1222 2.2	H	0.08 7	7.00E05	91.6
LYM74	13954. 1	B	0.24 8	8.32E03	280	LYM289	1249 1.1	H	0.06 9	9.40E05	53.2
LYM217	13181. 9	B	0.15 1	8.57E03	130.7	LYM113	1244 4.4	H	0.07 1	1.12E- 04	56.9
LYM 189	13311. 2	B	0.17 4	8.79E03	166.7	LYM134	1231 1.2	H	0.07 1	1.62E- 04	57.5
LYM32	13963. 4	B	0.16 3	8.96E03	149.3	LYM 102	1222 1.1	H	0.07 6	2.25E04	68.8
LYM240	12683. 9	B	0.07 7	9.39E03	18.7	LYM289	1249 3.2	H	0.07 1	2.37E04	57.5

390

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM 189	13311. 3	B	0.17 6	1.20E02	169	LYM3	1204 2.1	H	0.06 8	4.18E04	49.7
LYM79	13134. 1	B	0.17 3	1.36E02	165.4	LYM113	1244 2.1	H	0.06 7	7.34E04	49.1
LYM79	13133. 3	B	0.16 9	1.42E02	158.3	LYM148	1217 2.1	H	0.06 8	8.70E04	50.9
LYM240	12682. 1	B	0.20 2	1.49E02	209.5	LYM 129	1257 1.3	H	0.07	1.22E- 03	54.8
LYM79	13132. 2	B	0.23 7	1.69E02	262.6	LYM113	1244 4.5	H	0.06 6	1.82E- 03	45.3
LYM188	13244. 7	B	0.11 6	1.77E02	77.9	LYM290	1250 1.2	H	0.06 8	1.94E- 03	50
LYM188	13244. 6	B	0.10 2	2.08E02	56.2	LYM3	1204 1.2	H	0.06 3	2.54E03	38.7
LYM 189	13315. 1	B	0.28 1	2.09E02	330	LYM 140	1226 1.2	H	0.06 1	4.70E03	34.5
LYM79	13134. 2	B	0.08 7	2.10E02	33.3	LYM3	1204 3.2	H	0.06 1	6.01E- 03	35.8
LYM 189	13314. 4	B	0.15 8	2.19E02	141.4	LYM132	1227 5.3	H	0.06 1	9.29E03	34.2
LYM188	13244. 4	B	0.19 6	2.23E02	200.6	LYM 13	1177 2.2	H	0.06	9.79E03	32.3
LYM161	13233. 6	B	0.18 5	2.28E02	183.3	LYM 106	1214 1.4	H	0.06 3	1.25E- 02	39.7
LYM274	13415. 2	B	0.21 7	2.29E02	232.4	LYM 106	1214 4.4	H	0.06	1.94E02	32.6
LYM274	13413. 4	B	0.15 2	2.34E02	133.3	LYM268	1248 1.1	H	0.06 1	2.01E02	34.4
LYM234	14091. 1	B	0.14 9	2.38E02	129	LYM134	1231 4.2	H	0.05 9	2.35E02	29.9
LYM79	13133. 2	B	0.15 6	2.45E02	139.7	LYM 129	1257 3.1	H	0.05 7	3.09E02	27.1
LYM79	13134. 3	B	0.10 9	2.50E02	67.5	LYM132	1227 1.4	H	0.05 7	3.88E02	25.2
LYM273	13721. 3	B	0.11 2	2.82E02	71.3	LYM113	1244 2.2	H	0.05 9	3.90E02	30
LYM274	13413. 1	B	0.16 7	3.18E- 02	156.6	LYM 10	1174 4.5	H	0.05 6	5.50E02	24.8
LYM217	13181. 6	B	0.1	3.59E02	53.3	LYM290	1250 4.1	H	0.05 6	5.52E02	23
LYM234	14092. 8	B	0.20 8	3.90E02	219.4	LYM 129	1257 2.2	H	0.05 5	9.34E02	21.4
LYM32	13963. 1	B	0.09 3	5.12E- 02	42.1	LYM289	1249 1.4	H	0.05 6	9.88E02	23.2
LYM74	13952. 2	B	0.15 4	5.75E02	136.2	CONTR OL	—	H	0.04 5	—	0
LYM79	13131. 1	B	0.15 2	6.99E02	133.1	LYM248	1350 2.6	A	0.00 4	1.00E- 05	49
LYM161	13234. 6	B	0.13 6	7.51E- 02	108.5	LYM79	1313 4.7	A	0.00 4	6.75E04	67
LYM219	13334. 8	B	0.11 4	7.99E02	74.8	LYM157	1334 1.4	A	0.00 6	1.12E- 03	127
LYM219	13331.	B	0.14	9.01E-	127.7	LYM 180	1344	A	0.00	1.29E-	75

391

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
	1		9	02			2.7		4	03
CONTR OL	—	B	0.06 5	—	0	LYM 180	1344 2.6	A	0.00 4	2.39E03	78
LYM 122	13711. 3	C	0.94 7	0.00E +00	73.9	LYM52	1289 4.6	A	0.00 4	3.08E03	50
LYM161	13233. 6	C	1.00 1	0.00E +00	83.9	LYM157	1334 1.1	A	0.00 7	3.26E03	182
LYM 189	13315. 1	C	1.28 1	0.00E +00	135.3	LYM79	1313 1.6	A	0.00 6	3.45E03	146
LYM 189	13315. 2	C	1.27 8	0.00E +00	134.6	LYM213	1284 2.8	A	0.00 9	5.95E03	260
LYM 189	13311. 2	C	1.04 3	0.00E +00	91.5	LYM157	1334 1.3	A	0.01 3	6.38E03	420
LYM219	13332. 9	C	1.16 9	0.00E +00	114.6	LYM 120	1338 2.2	A	0.00 7	1.08E02	192
LYM234	14092. 5	C	1.19 6	0.00E +00	119.5	LYM213	1284 2.9	A	0.00 8	1.10E02	235
LYM240	12683. 5	C	1.11 4	0.00E +00	104.6	LYM117	1362 4.7	A	0.00 4	1.29E02	59
LYM240	12682. 1	C	1.05 3	0.00E +00	93.4	LYM79	1313 2.6	A	0.00 4	1.41E02	64
LYM274	13413. 4	C	1.20 5	0.00E +00	121.3	LYM52	1289 5.7	A	0.00 9	1.45E02	262
LYM274	13415. 2	C	1.10 8	0.00E +00	103.4	LYM 107	1263 1.1	A	0.00 7	1.50E02	189
LYM32	13964. 1	c	1.00 1	0.00E +00	83.9	LYM 120	1338 2.8	A	0.00 7	1.53E02	160
LYM74	13954. 1	c	1.34 6	0.00E +00	147.2	LYM 120	1338 2.1	A	0.00 6	1.71E02	157
LYM74	13954. 2	c	1.13 3	0.00E +00	108.1	LYM213	1284 1.8	A	0.00 5	1.96E02	114
LYM79	13132. 2	c	1.06 6	0.00E +00	95.8	LYM227	1454 2.1	A	0.00 4	2.27E02	43
LYM79	13134. 1	c	1.01 8	0.00E +00	86.9	LYM 120	1338 2.3	A	0.00 8	2.67E02	225
LYM217	13181. 6	c	0.97 4	1.00E06	78.9	LYM52	1289 4.7	A	0.01 1	3.21E02	334
LYM245	13061. 8	c	0.94 9	1.00E06	74.3	LYM227	1454 4.2	A	0.00 4	3.26E02	53
LYM32	13963. 4	c	0.94 9	2.00E06	74.3	LYM52	1289 4.8	A	0.00 5	3.45E02	88
LYM188	13244. 4	c	0.90 7	3.00E06	66.6	LYM 180	1344 1.7	A	0.00 9	3.65E02	259
LYM 189	13311. 3	c	0.92 3	3.00E06	69.5	LYM248	1350 3.5	A	0.00 4	3.65E02	75
LYM234	14091. 1	c	0.98 1	1.40E05	80.1	LYM213	1284 1.6	A	0.00 6	3.85E02	125
LYM217	13186. 1	c	0.88 9	1.90E05	63.3	LYM 107	1263 3.4	A	0.00 4	3.86E02	71
LYM234	14092. 8	c	0.95 7	1.90E05	75.7	LYM117	1362 2.6	A	0.00 4	3.99E02	51
LYM234	14093. 2	c	0.87 2	3.90E05	60.1	LYM227	1454 2.3	A	0.00 3	4.02E02	37

392

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM79	13133. 2	C	0.90 3	5.00E05	65.8	LYM227	1454 2.5	A	0.00 3	4.55E02	32
LYM74	13952. 2	c	0.95	1.17E04	74.4	LYM 120	1338 2.4	A	0.00 4	4.58E02	59
LYM161	13233. 5	c	0.79 3	3.92E04	45.6	LYM248	1350 4.6	A	0.00 3	4.71E02	29
LYM274	13413. 1	c	0.91 9	7.62E04	68.8	LYM52	1289 1.8	A	0.00 4	5.01E02	62
LYM219	13331. 1	c	0.78 8	2.74E03	44.8	LYM79	1313 1.5	A	0.00 4	5.09E02	54
LYM79	13131. 1	c	0.82 5	3.08E03	51.6	LYM 107	1263 2.1	A	0.00 4	5.18E02	55
LYM240	12683. 9	c	0.75 3	3.59E03	38.2	LYM248	1350 2.7	A	0.00 3	5.65E02	27
LYM188	13244. 7	c	0.76 7	4.32E03	40.8	LYM117	1362 3.9	A	0.00 4	5.72E02	63
LYM161	13234. 6	c	0.77 1	5.36E03	41.5	LYM157	1334 2.4	A	0.00 3	6.07E02	30
LYM79	13133. 3	c	0.76 5	9.03E03	40.4	LYM117	1362 1.8	A	0.00 4	6.42E02	41
LYM 189	13314. 4	c	0.75	9.65E03	37.7	LYM 180	1344 1.5	A	0.00 7	9.29E02	178
LYM273	13721. 3	c	0.70 6	2.08E02	29.7	CONTR OL	—	A	0.00 3	—	0
LYM79	13134. 3	c	0.70 8	2.18E02	30	LYM79	1313 2.6	B	0.09 7	0.00E +00	57
LYM188	13244. 6	c	0.67 6	6.45E02	24.2	LYM248	1350 2.6	B	0.08 4	3.80E05	36.3
LYM234	14092. 1	c	0.66	8.67E02	21.2	LYM52	1289 4.6	B	0.07 7	1.17E03	24.1
LYM32	13963. 1	c	0.68 6	9.24E02	26	LYM 120	1338 2.8	B	0.14 3	1.23E03	130.6
CONTR OL	—	c	0.54 5	—	0	LYM213	1284 2.8	B	0.19 7	1.73E03	218
LYM32	13964. 1	D	8.65 1	0.00E +00	79.9	LYM157	1334 1.4	B	0.11 7	3.42E03	88.4
LYM219	13332. 9	D	10.4 91	1.00E05	118.2	LYM227	1454 4.2	B	0.09 3	4.06E03	50.6
LYM 122	13711. 3	D	8.61 1	5.80E05	79.1	LYM 120	1338 2.2	B	0.16 4	4.26E03	164.9
LYM161	13233. 5	D	7.32 6	1.20E04	52.3	LYM 107	1263 3.4	B	0.10 2	4.42E03	65.5
LYM188	13244. 4	D	8.09 7	2.06E04	68.4	LYM52	1289 5.7	B	0.18 5	4.74E03	198.5
LYM234	14092. 5	D	10.5 4	7.64E04	119.2	LYM117	1362 1.8	B	0.08 3	5.00E03	33.8
LYM79	13132. 2	D	9.36	3.54E03	94.6	LYM 180	1344 2.6	B	0.09 5	5.31E03	53.8
LYM74	13954. 2	D	9.85 5	5.72E03	104.9	LYM 107	1263 1.1	B	0.18 2	5.88E03	193.5
LYM 189	13315. 2	D	10.9 46	5.76E03	127.6	LYM248	1350 4.6	B	0.08	6.04E03	29.8
LYM74	13954.	D	11.9	6.16E-	149.1	LYM157	1334	B	0.17	6.92E-	183.8

393

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
	1		81	03			1.1		6	03
LYM274	13413. 4	D	10.3 17	7.08E03	114.5	LYM157	1334 1.3	B	0.28 9	8.30E03	367.8
LYM161	13233. 6	D	8.86 9	8.43E03	84.4	LYM 120	1338 2.4	B	0.08 7	8.44E03	41.4
LYM274	13415. 2	D	9.62 3	8.58E03	100.1	LYM79	1313 1.6	B	0.15 3	9.73E03	146.6
LYM245	13061. 8	D	8.36 8	8.65E03	74	LYM117	1362 2.5	B	0.08 9	1.06E02	44
LYM 189	13315. 1	D	11.2 93	1.02E02	134.8	LYM157	1334 2.4	B	0.09 2	1.14E02	49
LYM234	14093. 2	D	7.63 2	1.08E02	58.7	LYM 120	1338 2.3	B	0.18 9	1.26E02	205.1
LYM240	12683. 9	D	6.76 1	1.26E02	40.6	LYM52	1289 1.8	B	0.09 9	1.29E02	60.4
LYM 189	13311. 3	D	8.14 9	1.49E- 02	69.5	LYM227	1454 1.5	B	0.08 6	1.29E- 02	39.2
LYM79	13134. 1	D	9.34 7	1.65E02	94.4	LYM213	1284 2.9	B	0.18 3	1.30E02	195.5
LYM32	13963. 4	D	8.28 8	1.66E02	72.4	LYM 180	1344 1.7	B	0.20 3	1.33E02	227.8
LYM240	12682. 1	D	9.74 7	1.72E02	102.7	LYM 120	1338 2.1	B	0.14 9	1.38E02	140.6
LYM 189	13311. 2	D	8.99	1.94E02	87	LYM213	1284 1.6	B	0.12 5	1.59E02	102.2
LYM79	13134. 3	D	6.43 1	1.94E02	33.7	LYM 180	1344 2.7	B	0.10 2	2.04E02	64.6
LYM217	13186. 1	D	7.5	1.95E02	56	LYM52	1289 4.7	B	0.23 7	2.09E02	282.8
LYM217	13181. 6	D	8.44 3	1.96E02	75.6	LYM117	1362 2.6	B	0.09 5	2.67E02	53.3
LYM273	13721. 3	D	6.13 2	3.30E02	27.5	LYM213	1284 1.8	B	0.11 8	2.79E02	91.6
LYM234	14092. 1	D	5.87 8	3.41E- 02	22.2	LYM248	1350 3.5	B	0.1	2.95E02	62
LYM240	12683. 5	D	9.95 7	3.82E02	107.1	LYM227	1454 2.1	B	0.09 6	4.16E02	55.3
LYM79	13133. 2	D	8.25 2	4.16E02	71.6	LYM213	1284 1.5	B	0.08 9	4.72E02	43.5
LYM234	14091. 1	D	8.58 6	5.33E02	78.5	LYM117	1362 3.9	B	0.08 9	4.77E02	44.2
LYM234	14092. 8	D	8.37 3	5.62E02	74.1	LYM248	1350 2.7	B	0.07 6	5.33E02	23.7
LYM161	13234. 6	D	7.15	7.26E02	48.7	LYM 107	1263 2.1	B	0.09 8	6.41E- 02	57.9
LYM219	13331. 1	D	7.09 6	7.41E- 02	47.6	LYM 180	1344 1.5	B	0.16 2	6.47E02	162.6
LYM188	13244. 7	D	6.69	8.77E02	39.1	LYM227	1454 2.5	B	0.07 1	7.28E02	15.4
CONTR OL	—	D	4.80 9	—	0	LYM52	1289 4.8	B	0.11 1	7.53E02	79.6
LYM 189	13315. 2	E	0.66 2	3.29E03	29.1	LYM117	1362 4.7	B	0.08 2	7.84E02	33

394

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM274	13413. 4	E	0.64 6	1.08E02	26.1	LYM248	1350 1.6	B	0.07 7	8.28E02	24.4
LYM189	13315. 1	E	0.64 1	1.59E02	25	CONTR OL	—	B	0.06 2	—	0
LYM219	13332. 9	E	0.61 3	4.07E02	19.6	LYM107	1263 1.1	C	0.83 1	0.00E +00	94.2
LYM161	13233. 6	E	0.60 2	7.90E02	17.4	LYM120	1338 2.3	C	1.03 8	0.00E +00	142.4
LYM32	13964. 1	E	0.6	7.97E02	17	LYM157	1334 1.3	C	1.14 1	0.00E +00	166.5
CONTR OL	—	E	0.51 3	—	0	LYM157	1334 1.4	C	0.91 8	0.00E +00	114.5
LYM219	13332. 9	F	7.58 6	1.00E06	29	LYM213	1284 2.8	C	1.03 5	0.00E +00	141.7
LYM32	13964. 1	F	6.96 2	7.00E06	18.4	LYM52	1289 4.7	C	0.8	0.00E +00	86.9
LYM240	12682. 1	F	6.84 3	3.90E05	16.4	LYM213	1284 2.9	C	0.76 2	1.00E06	77.9
LYM74	13954. 1	F	7.08 5	4.60E05	20.5	LYM120	1338 2.2	C	0.82 8	6.00E06	93.3
LYM79	13134. 1	F	7.2	1.08E03	22.5	LYM248	1350 3.5	C	0.74 1	6.00E06	73
LYM274	13413. 4	F	7.26 2	1.40E03	23.5	LYM52	1289 5.7	C	0.72 4	2.50E05	69.1
LYM79	13132. 2	F	6.66 2	1.94E- 03	13.3	LYM213	1284 1.6	C	0.7	3.20E05	63.5
LYM189	13315. 2	F	7.59 1	1.99E03	29.1	LYM120	1338 2.1	C	0.69 5	6.10E- 05	62.3
LYM234	14092. 5	F	7.11 7	2.84E03	21.1	LYM180	1344 1.7	C	0.76 3	8.30E05	78.3
LYM189	13315. 1	F	7.39 6	2.91E03	25.8	LYM180	1344 2.7	C	0.67 5	1.83E04	57.6
LYM74	13954. 2	F	7.08 9	5.06E03	20.6	LYM79	1313 1.5	C	0.68	2.64E04	58.9
LYM161	13233. 6	F	6.97 8	1.61E02	18.7	LYM157	1334 1.1	C	0.66 6	5.55E04	55.6
LYM161	13233. 5	F	6.50 2	2.85E02	10.6	LYM117	1362 1.8	C	0.65 9	8.30E04	53.8
LYM122	13711. 3	F	6.64 3	3.74E02	13	LYM79	1313 1.6	C	0.65 9	1.51E03	53.9
LYM240	12683. 5	F	6.97 8	4.00E02	18.7	LYM52	1289 4.8	C	0.67	1.78E03	56.5
LYM79	13134. 3	F	6.40 3	5.79E02	8.9	LYM52	1289 1.8	c	0.62 4	1.88E03	45.8
LYM274	13415. 2	F	6.39	6.01E- 02	8.7	LYM227	1454 2.3	c	0.64 7	2.21E03	51.2
LYM245	13061. 8	F	6.36 6	7.89E02	8.3	LYM157	1334 2.4	c	0.61 6	4.48E03	43.8
LYM217	13181. 6	F	6.76 6	8.26E02	15.1	LYM79	1313 2.6	c	0.60 5	4.76E03	41.3
CONTR OL	—	F	5.87 9	—	0	LYM120	1338 2.8	c	0.60 7	5.79E03	41.7
LYM189	13315.	G	1.28	1.90E-	167.8	LYM180	1344	c	0.61	8.13E-	42.7

395

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
	2		4	05			1.5		1	03
LYM217	13183. 2	G	0.97 3	4.10E05	103	LYM117	1362 2.6	C	0.59 3	8.16E03	38.5
LYM74	13954. 2	G	0.93 1	6.30E05	94.1	LYM248	1350 1.6	c	0.60 4	8.30E03	41.1
LYM234	14092. 5	G	1.20 4	1.92E04	151.1	LYM213	1284 1.5	c	0.59 4	9.39E03	38.7
LYM122	13711. 3	G	1.15 9	3.08E04	141.7	LYM227	1454 4.2	c	0.59 3	1.48E02	38.6
LYM240	12683. 5	G	1.04 2	7.28E04	117.2	LYM107	1263 1.2	c	0.58 8	1.80E02	37.4
LYM79	13134. 3	G	0.80 8	1.09E03	68.5	LYM117	1362 2.5	c	0.60 4	1.90E02	41
LYM245	13061. 8	G	1.27 1	1.20E03	165.1	LYM107	1263 3.4	c	0.56 4	2.80E02	31.8
LYM79	13132. 2	G	1.32	I.33E03	175.3	LYM52	1289 4.6	c	0.54 8	4.99E02	27.9
LYM234	14093. 2	G	0.94 3	1.41E03	96.7	LYM79	1313 4.7	c	0.53 6	7.39E02	25.2
LYM74	13954. 1	G	1.31 3	1.81E03	173.7	CONTR OL	—	c	0.42 8	—	0
LYM217	13186. 1	G	0.91 1	1.88E03	90.1	LYM157	1334 1.4	D	8.10 1	0.00E +00	121.4
LYM32	13963. 1	G	0.66 5	2.56E03	38.7	LYM213	1284 2.9	D	6.77 7	1.47E04	85.2
LYM161	13233. 6	G	1.06 4	2.90E03	121.9	LYM213	1284 1.6	D	6.03 9	2.00E04	65
LYM217	13182. 1	G	1.08 3	3.10E03	125.8	LYM52	1289 4.7	D	7.31 4	8.85E04	99.9
LYM219	13332. 9	G	1.06 3	4.10E03	121.8	LYM117	1362 2.6	D	5.11 3	1.50E03	39.7
LYM161	13233. 5	G	1.09 9	4.42E03	129.2	LYM107	1263 1.1	D	7.34 6	1.55E03	100.8
LYM274	13415. 2	G	1.15	4.92E03	139.8	LYM180	1344 2.7	D	6.26 6	1.64E03	71.2
LYM274	13413. 4	G	0.89 9	6.80E03	87.4	LYM120	1338 2.1	D	6.10 3	2.38E03	66.8
LYM189	13315. 1	G	1.43 7	7.49E03	199.8	LYM157	1334 1.3	D	9.88 6	2.61E03	170.2
LYM189	13311. 2	G	1.02 9	7.55E03	114.6	LYM52	1289 1.8	D	5.27 9	3.81E03	44.3
LYM32	13964. 1	G	0.84 4	7.69E03	76	LYM248	1350 3.5	D	6.50 1	4.31E03	77.7
LYM79	13134. 1	G	0.99	1.05E02	106.5	LYM107	1263 3.4	D	5.08 1	6.28E03	38.9
LYM234	14091. 1	G	0.91 9	1.09E02	91.6	LYM79	1313 2.6	D	5.27 2	7.18E03	44.1
LYM188	13244. 4	G	1.04 9	1.17E02	118.7	LYM79	1313 4.7	D	4.84 4	7.92E03	32.4
LYM217	13181. 9	G	0.77 5	1.18E02	61.6	LYM79	1313 1.5	D	5.96 1	1.41E02	62.9
LYM240	12683. 9	G	0.57 9	1.27E02	20.7	LYM52	1289 5.7	D	6.30 2	1.43E02	72.2

396

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM189	13311. 3	G	0.98	1.37E02	104.4	LYM157	1334 1.1	D	6.12 7	1.48E02	67.4
LYM278	13364. 5	G	0.57 4	1.37E02	19.7	LYM213	1284 2.8	D	9.74 5	1.57E02	166.3
LYM240	12682. 1	G	1.13 2	1.51E02	136.1	LYM157	1334 2.4	D	5.41 8	1.58E02	48.1
LYM79	13133. 3	G	0.97 4	1.51E02	103.1	LYM120	1338 2.8	D	5.23 3	2.06E02	43
LYM234	14092. 8	G	1.15	2.17E02	139.7	LYM120	1338 2.3	D	9.17 2	3.14E02	150.7
LYM188	13244. 6	G	0.58	2.18E02	20.9	LYM213	1284 1.5	D	5.04 4	3.32E02	37.9
LYM79	13134. 2	G	0.62 2	2.53E02	29.6	LYM117	1362 1.8	D	5.51 3	4.02E02	50.7
LYM32	13963. 4	G	0.96 7	2.55E02	101.8	LYM120	1338 2.2	D	7.20 7	4.05E02	97
LYM79	13133. 2	G	0.95	2.59E02	98	LYM79	1313 3.6	D	4.40 4	4.15E02	20.4
LYM189	13314. 5	G	0.60 4	2.68E02	26	LYM52	1289 4.6	D	4.63 7	4.35E02	26.7
LYM161	13234. 6	G	0.98 9	2.76E02	106.3	LYM248	1350 1.6	D	5.17 8	5.20E02	41.5
LYM74	13952. 2	G	0.83 7	3.56E02	74.5	LYM180	1344 1.5	D	5.62 1	5.27E02	53.6
LYM189	13314. 4	G	0.80 3	3.63E02	67.4	LYM180	1344 1.7	D	6.61 6	5.74E02	80.8
LYM274	13413. 1	G	0.82 3	4.32E02	71.6	LYM79	1313 1.6	D	5.67 2	6.56E02	55
LYM79	13131. 1	G	0.94 1	5.88E02	96.2	LYM227	1454 2.3	D	5.39 8	8.39E02	47.5
LYM188	13244. 7	G	0.74 1	6.09E02	54.5	CONTR OL	—	D	3.65 9	—	0
LYM234	14092. 1	G	0.61 6	6.23E02	28.6	LYM157	1334 1.3	E	0.56 3	8.32E03	39.2
LYM219	13331. 1	G	0.77 8	8.27E02	62.3	LYM248	1350 3.5	E	0.54 4	1.60E02	34.6
CONTR OL	—	G	0.48	—	0	LYM248	1350 1.6	E	0.53 1	2.70E02	31.5
LYM122	13711. 3	H	0.12 1	0.00E +00	155.6	LYM120	1338 2.2	E	0.52 2	4.43E02	29.2
LYM161	13233. 6	H	0.11 2	0.00E +00	136	LYM120	1338 2.3	E	0.52 3	6.14E02	29.4
LYM161	13233. 5	H	0.11	0.00E +00	133.1	LYM107	1263 1.1	E	0.51 1	6.15E02	26.4
LYM161	13234. 6	H	0.10 5	0.00E +00	122	LYM120	1338 2.8	E	0.51 1	6.32E02	26.4
LYM188	13244. 4	H	0.10 5	0.00E +00	121.6	LYM52	1289 1.8	E	0.49 8	9.65E02	23.4
LYM189	13315. 1	H	0.14 6	0.00E +00	207.9	CONTR OL	—	E	0.40 4	—	0
LYM189	13315. 2	H	0.13 3	0.00E +00	181.1	LYM107	1263 1.1	F	6.51 7	0.00E +00	32.4
LYM189	13311.	H	0.10	0.00E	123.6	LYM157	1334	F	6.66	0.00E	35.4

397

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
	2		6	+00			1.4		3	+00
LYM 189	13311. 3	H	0.09 9	0.00E +00	109.8	LYM79	1313 1.5	F	6.65 8	2.30E05	35.3
LYM217	13182. 1	H	0.11 7	0.00E +00	146.7	LYM79	1313 2.6	F	6.26 9	6.80E05	27.4
LYM217	13183. 2	H	0.09 6	0.00E +00	102.8	LYM248	1350 3.5	F	6.84 9	7.40E05	39.1
LYM217	13186. 1	H	0.09	0.00E +00	91	LYM 107	1263 3.4	F	6.42	1.94E04	30.4
LYM219	13332. 9	H	0.11	0.00E +00	132.5	LYM248	1350 1.6	F	6.55	2.54E04	33.1
LYM234	14092. 5	H	0.12 3	0.00E +00	160.3	LYM213	1284 2.8	F	7.02 9	2.62E04	42.8
LYM234	14092. 8	H	0.11 9	0.00E +00	151.6	LYM 180	1344 2.7	F	6.27 4	3.41E04	27.5
LYM234	14093. 2	H	0.10 1	0.00E +00	113.6	LYM213	1284 2.9	F	6.02 8	4.41E04	22.4
LYM234	14091. 1	H	0.09 4	0.00E +00	98.2	LYM213	1284 1.6	F	5.83 6	5.41E04	18.6
LYM240	12683. 5	H	0.10 9	0.00E +00	130.7	LYM 120	1338 2.2	F	6.34 5	1.79E03	28.9
LYM240	12682. 1	H	0.10 9	0.00E +00	130	LYM157	1334 1.1	F	5.67 7	2.64E03	15.3
LYM245	13061. 8	H	0.12 8	0.00E +00	170.9	LYM157	1334 1.3	F	6.75 2	3.09E03	37.2
LYM274	13415. 2	H	0.11 9	0.00E +00	152.5	LYM 180	1344 1.7	F	5.93 5	3.68E03	20.6
LYM274	13413. 4	H	0.09 5	0.00E +00	101.8	LYM 180	1344 1.5	F	6.07 1	4.41E03	23.3
LYM274	13413. 1	H	0.08 7	0.00E +00	84.2	LYM52	1289 4.7	F	6.00 8	5.17E03	22.1
LYM32	13963. 4	H	0.10 2	0.00E +00	116.1	LYM 120	1338 2.3	F	6.67 4	8.09E03	35.6
LYM32	13964. 1	H	0.08 9	0.00E +00	87.8	LYM52	1289 1.8	F	5.77 4	9.79E03	17.3
LYM74	13954. 1	H	0.12 8	0.00E +00	171.4	LYM79	1313 4.7	F	5.60 1	1.44E02	13.8
LYM74	13954. 2	H	0.09 3	0.00E +00	96.9	LYM227	1454 2.3	F	5.91	1.57E02	20.1
LYM79	13132. 2	H	0.13 4	0.00E +00	183.6	LYM79	1313 3.6	F	5.77 8	2.12E02	17.4
LYM79	13133. 3	H	0.10 1	0.00E +00	114.2	LYM 107	1263 1.2	F	5.76 4	2.69E02	17.1
LYM79	13134. 1	H	0.1	0.00E +00	111.5	LYM 120	1338 2.1	F	5.44 8	2.96E02	10.7
LYM79	13133. 2	H	0.09 7	0.00E +00	104.7	LYM117	1362 1.8	F	5.54 1	3.11E02	12.6
LYM79	13134. 3	H	0.08 2	0.00E +00	73.1	LYM117	1362 2.6	F	5.57 8	3.16E02	13.3
LYM 189	13314. 4	H	0.08 3	1.00E06	75.5	LYM157	1334 2.4	F	5.90 6	4.04E02	20
LYM74	13952. 2	H	0.08 5	1.00E06	80.6	LYM52	1289 4.6	F	5.68 6	5.87E02	15.5

398

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM79	13131. 1	H	0.09 7	1.00E06	104.4	LYM157	1334 1.1	F	5.64 7	6.06E02	14.7
LYM219	13331. 1	H	0.08 2	1.20E05	73.8	LYM120	1338 2.8	F	5.59 7	7.48E02	13.7
LYM188	13244. 7	H	0.07 9	1.40E05	66.2	LYM248	1350 2.7	F	5.61 7	7.50E02	14.1
LYM217	13181. 9	H	0.07 1	7.40E05	50	CONTR OL	—	F	4.92 3	—	0
LYM219	13334. 8	H	0.07 5	4.81E04	59.2	LYM79	1313 4.7	G	0.78 3	0.00E +00	69
LYM32	13963. 1	H	0.06 4	1.00E03	34.7	LYM120	1338 2.8	G	0.93 7	6.00E06	102.4
LYM273	13721. 3	H	0.06 7	1.42E03	40.7	LYM180	1344 2.6	G	0.70 8	1.72E04	52.9
LYM189	13314. 5	H	0.06 3	1.80E03	33.5	LYM79	1313 2.6	G	0.63 5	2.20E04	37.1
LYM234	14092. 1	H	0.06 4	2.49E03	34.5	LYM248	1350 2.6	G	0.6	3.71E04	29.4
LYM217	13181. 6	H	0.06 7	2.63E03	41	LYM227	1454 4.2	G	0.61 2	4.69E04	32
LYM188	13244. 6	H	0.06 2	3.19E03	30.8	LYM107	1263 3.4	G	0.69 5	6.12E04	50.1
LYM219	13334. 7	H	0.06 5	6.05E03	37.1	LYM120	1338 2.1	G	1.05 6	8.03E04	128
LYM79	13134. 2	H	0.06 1	6.73E03	28.6	LYM227	1454 2.1	G	0.62 5	8.16E04	34.9
LYM240	12683. 9	H	0.05 9	1.03E02	25.6	LYM117	1362 2.6	G	0.67 8	8.66E04	46.3
LYM122	13713. 4	H	0.06 1	1.40E02	29.1	LYM157	1334 1.1	G	1.03 8	1.08E03	124.2
LYM278	13364. 5	H	0.05 8	2.02E02	23.2	LYM157	1334 1.4	G	0.73 7	1.15E03	59.1
LYM274	13413. 3	H	0.06	2.07E02	27.2	LYM157	1334 1.3	G	1.52 8	1.56E03	229.9
LYM240	12684. 8	H	0.05 9	5.27E02	24.1	LYM120	1338 2.2	G	1.05 7	1.65E03	128.2
CONTR OL	—	H	0.04 7	—	0	LYM107	1263 1.1	G	1.08 5	2.28E03	134.2
LYM1	11603. 2	A	0.00 6	2.00E06	74.1	LYM227	1454 1.5	G	0.61	2.98E03	31.8
LYM1	11601. 1	A	0.00 7	1.20E05	83.9	LYM120	1338 2.4	G	0.61 4	4.29E03	32.6
LYM132	12275. 3	A	0.00 7	1.63E04	96.5	LYM213	1284 2.8	G	1.20 5	4.34E03	160.1
LYM178	12164. 2	A	0.00 6	2.14E03	58	LYM248	1350 3.5	G	0.75 1	4.94E03	62.2
LYM132	12271. 4	A	0.00 7	3.64E03	97.2	LYM180	1344 2.7	G	0.83 9	5.84E03	81.2
LYM1	11604. 4	A	0.00 5	3.68E03	29.4	LYM52	1289 5.7	G	1.04 4	6.49E03	125.4
LYM268	12483. 2	A	0.00 8	6.62E03	111.2	LYM157	1334 2.4	G	0.60 9	6.86E03	31.5
LYM5	12432.	A	0.00	6.64E-	28.7	LYM180	1344	G	1.02	7.31E-	121.8

399

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
	2		5	03			1.5		7	03
LYM178	12164. 3	A	0.01 1	1.01E02	206.3	LYM213	1284 1.8	G	0.73 2	7.99E03	58
LYM134	12314. 2	A	0.00 6	1.05E02	77.6	LYM120	1338 2.3	G	1.09 9	8.19E- 03	137.3
LYM268	12482. 3	A	0.00 6	1.08E02	58.7	LYM52	1289 4.7	G	1.15 3	8.28E03	148.8
LYM129	12571. 3	A	0.00 6	1.11E02	54.5	LYM213	1284 2.9	G	1.14 3	8.30E03	146.8
LYM178	12163. 3	A	0.01 1	1.16E02	202.1	LYM79	1313 1.6	G	1.11	8.39E03	139.7
LYM1	11602. 6	A	0.01 1	1.60E02	197.2	LYM180	1344 1.7	G	1.22 4	1.13E02	164.3
LYM1	11602. 1	A	0.00 5	1.79E02	46.2	LYM157	1334 1.1	G	0.52 7	1.68E02	13.9
LYM268	12482. 1	A	0.00 7	2.35E02	97.9	LYM227	1454 2.5	G	0.56 9	1.84E- 02	22.7
LYM132	12276. 1	A	0.00 9	2.60E02	146.9	LYM52	1289 4.6	G	0.52 5	1.93E02	13.4
LYM129	12572. 2	A	0.00 5	2.65E02	46.2	LYM52	1289 1.8	G	0.67 1	2.02E02	44.8
LYM5	12432. 1	A	0.00 6	4.79E02	70.6	LYM117	1362 1.8	G	0.57	2.22E02	23
LYM6	11735. 1	A	0.00 6	5.37E02	58	LYM213	1284 1.6	G	0.78 2	2.30E02	68.9
LYM132	12273. 2	A	0.00 5	5.62E02	44.1	LYM107	1263 2.1	G	0.64 8	2.97E02	39.9
LYM268	12483. 4	A	0.00 6	6.34E02	65	LYM117	1362 3.9	G	0.67 7	4.19E02	46
LYM6	11736. 1	A	0.00 6	6.64E02	71.3	LYM117	1362 4.7	G	0.69 5	5.21E- 02	49.9
LYM6	11733. 2	A	0.00 4	6.75E02	13.3	LYM117	1362 2.5	G	0.63 4	5.88E02	36.9
LYM6	11735. 2	A	0.00 5	6.93E02	49	LYM52	1289 4.8	G	0.73	6.31E02	57.5
LYM134	12313. 2	A	0.01 1	7.63E02	216.1	LYM79	1313 1.5	G	0.65 4	7.90E02	41.2
LYM129	12573. 5	A	0.00 7	7.95E02	102.8	CONTR OL	—	G	0.46 3	—	0
CONTR OL	—	A	0.00 4	—	0	LYM107	1263 1.1	H	0.10 7	0.00E +00	141.1
LYM132	12275. 3	B	0.13 4	1.00E- 06	86.1	LYM120	1338 2.3	H	0.11 1	0.00E +00	148.8
LYM1	11603. 2	B	0.12 4	3.20E05	72.1	LYM120	1338 2.2	H	0.10 7	0.00E +00	139.8
LYM1	11601. 1	B	0.12 3	4.10E05	71.4	LYM120	1338 2.1	H	0.10 2	0.00E +00	129.7
LYM132	12271. 4	B	0.12 4	1.69E- 04	71.8	LYM120	1338 2.8	H	0.09 4	0.00E +00	111.3
LYM268	12483. 2	B	0.14 2	8.85E04	96.8	LYM157	1334 1.3	H	0.14 6	0.00E +00	228.5
LYM178	12164. 2	B	0.11 1	2.98E03	54.4	LYM157	1334 1.1	H	0.09 6	0.00E +00	117

400

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM5	12432. 2	B	0.09	6.77E03	25.1	LYM180	1344 1.7	H	0.11 4	0.00E +00	157.5
LYM134	12314. 2	B	0.13 8	7.76E03	91.2	LYM180	1344 1.5	H	0.09 7	0.00E +00	119.2
LYM129	12571. 3	B	0.11	9.48E03	52.8	LYM213	1284 2.8	H	0.11 4	0.00E +00	157
LYM1	11602. 6	B	0.21 4	9.84E03	197.7	LYM213	1284 2.9	H	0.10 7	0.00E +00	141.1
LYM268	12482. 3	B	0.12 4	1.45E02	71.8	LYM52	1289 4.7	H	0.11 7	0.00E +00	162.5
LYM268	12482. 1	B	0.12 9	1.64E02	78.6	LYM52	1289 5.7	H	0.10 5	0.00E +00	136
LYM129	12572. 2	B	0.10 1	1.69E02	40.1	LYM79	1313 1.6	H	0.10 8	0.00E +00	142.5
LYM129	12573. 3	B	0.08 7	1.94E02	21	LYM180	1344 2.7	H	0.08	1.00E06	79.4
LYM6	11735. 2	B	0.13	2.15E02	80.5	LYM157	1334 1.4	H	0.07 7	3.00E06	73.4
LYM178	12164. 3	B	0.21 5	2.21E02	199.1	LYM213	1284 1.6	H	0.07 7	1.70E05	74.3
LYM178	12163. 3	B	0.22 7	2.30E02	214.8	LYM79	1313 4.7	H	0.07	6.90E05	57.7
LYM5	12432. 1	B	0.11 6	2.54E02	60.7	LYM52	1289 4.8	H	0.07 5	1.89E04	67.6
LYM6	11735. 1	B	0.10 7	2.65E02	48.9	LYM227	1454 4.2	H	0.06 7	4.24E04	49.8
LYM132	12276. 1	B	0.18	2.72E02	150.1	LYM107	1263 3.4	H	0.06 6	5.81E04	48.6
LYM134	12313. 2	B	0.22 9	3.20E02	217.6	LYM117	1362 2.6	H	0.06 6	5.92E04	49
LYM268	12483. 4	B	0.12 8	4.11E02	77.8	LYM248	1350 3.5	H	0.06 7	7.50E04	50.7
LYM134	12312. 4	B	0.09 6	6.12E02	33.5	LYM213	1284 1.8	H	0.06 7	7.87E04	50.6
LYM129	12573. 5	B	0.14 4	6.28E02	99.7	LYM52	1289 1.8	H	0.06 7	9.77E04	49.6
LYM6	11736. 1	B	0.13	7.91E02	80.6	LYM117	1362 2.5	H	0.06 7	9.85E04	51.7
LYM1	11604. 4	B	0.08 3	9.90E02	16	LYM180	1344 2.6	H	0.06 5	1.09E03	45.8
CONTR OL	—	B	0.07 2	—	0	LYM117	1362 3.9	H	0.06 4	3.89E03	44.7
LYM1	11602. 6	C	0.96 5	0.00E +00	91.4	LYM79	1313 2.6	H	0.06 2	5.30E03	38.5
LYM1	11601. 1	C	0.83	8.30E05	64.7	LYM107	1263 2.1	H	0.06 3	5.57E03	41.7
LYM268	12483. 2	C	0.80 3	1.01E04	59.3	LYM120	1338 2.4	H	0.06 1	5.57E03	38.2
LYM132	12276. 1	C	0.93 6	1.06E04	85.8	LYM117	1362 4.7	H	0.06 4	5.91E03	43.9
LYM178	12164. 3	C	0.83 1	1.49E04	64.9	LYM248	1350 2.6	H	0.06	9.80E03	35.3
LYM129	12571.	C	0.79	1.72E-	57.5	LYM213	1284	H	0.06	1.07E-	39

401

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
	3		4	04			1.5		2	02
LYM129	12573. 5	C	0.83	1.82E04	64.6	LYM227	1454 2.1	H	0.05 9	1.46E02	33.2
LYM268	12482. 3	c	0.75 2	4.97E04	49.2	LYM157	1334 2.4	H	0.06	1.46E02	34.4
LYM268	12483. 4	c	0.75 2	8.08E04	49.2	LYM117	1362 1.8	H	0.06	1.51E02	34.5
LYM178	12163. 3	c	0.84 9	8.09E04	68.5	LYM79	1313 1.5	H	0.06	2.75E02	35.8
LYM5	12435. 1	c	0.77 1	9.77E04	52.9	LYM227	1454 1.5	H	0.05 7	3.75E02	28.4
LYM134	12314. 2	c	0.73 3	1.55E03	45.5	CONTR OL	—	H	0.04 4	—	0
LYM178	12164. 2	c	0.67 9	7.95E03	34.7	LYM79	1313 1.6	A	0.00 4	9.00E06	63
LYM134	12313. 2	c	0.73 9	8.31E03	46.6	LYM79	1313 3.6	A	0.00 4	1.55E03	61
LYM132	12275. 3	c	0.67 5	1.62E02	34	LYM79	1313 1.5	A	0.00 4	3.66E02	40
LYM1	11603. 2	c	0.68 3	3.61E02	35.6	LYM79	1313 2.6	A	0.00 4	3.91E02	47
CONTR OL	—	c	0.50 4	—	0	LYM227	1454 4.2	A	0.00 4	5.01E02	72
LYM1	11602. 6	D	8.10 9	7.70E05	79.7	LYM79	1313 4.7	A	0.00 3	5.24E02	39
LYM268	12483. 2	D	6.77 9	9.34E04	50.3	LYM227	1454 2.5	A	0.00 3	7.71E02	35
LYM268	12482. 3	D	6.31 8	9.47E04	40	CONTR OL	—	A	0.00 3	—	0
LYM129	12571. 3	D	6.58 7	1.03E03	46	LYM79	1313 3.6	B	0.08 9	3.95E03	23.5
LYM134	12314. 2	D	6.14 6	2.72E03	36.2	LYM227	1454 4.2	B	0.10 1	1.09E02	40.9
LYM1	11601. 1	D	7.07 4	6.19E03	56.8	LYM227	1454 2.1	B	0.08 2	5.43E02	14.7
LYM268	12483. 4	D	6.37 5	1.10E02	41.3	LYM79	1313 1.5	B	0.09 3	7.88E02	28.9
LYM178	12164. 2	D	5.68 1	1.80E02	25.9	LYM79	1313 2.6	B	0.09 5	8.38E02	32.4
LYM129	12573. 5	D	7.10 5	1.84E02	57.5	LYM227	1454 2.5	B	0.08 5	9.81E02	18.4
LYM178	12164. 3	D	6.94 1	1.87E02	53.8	CONTR OL	—	B	0.07 2	—	0
LYM132	12276. 1	D	7.98 5	3.78E02	77	LYM79	1313 4.7	C	0.66 5	5.00E05	49.9
LYM5	12435. 1	D	6.43 3	4.32E02	42.6	LYM79	1313 2.6	C	0.68 3	1.75E04	53.9
LYM132	12275. 3	D	5.76 9	5.38E02	27.9	LYM227	1454 4.2	C	0.60 6	2.21E03	36.6
LYM178	12163. 3	D	7.17 1	6.48E02	59	LYM79	1313 3.6	C	0.61 4	5.09E03	38.3
CONTR OL	—	D	4.51 1	—	0	LYM79	1313 1.5	C	0.60 6	6.01E03	36.5

402

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM178	12164. 3	E	0.61 8	6.14E04	35.8	LYM227	1454 2.5	C	0.58 9	9.41E03	32.9
LYM5	12435. 1	E	0.6	6.85E04	31.8	LYM79	1313 1.6	c	0.55 9	2.18E02	26
LYM134	12314. 2	E	0.59 8	1.04E03	31.5	LYM227	1454 2.3	c	0.57 6	2.31E02	29.9
LYM268	12482. 3	E	0.59	1.49E03	29.6	CONTR OL	—	c	0.44 4	—	0
LYM129	12571. 3	E	0.59 6	1.76E03	31	LYM79	1313 4.7	D	5.69 8	4.00E06	47.8
LYM132	12276. 1	E	0.59 5	2.11E03	30.8	LYM79	1313 1.6	D	5.05 1	2.55E04	31
LYM1	11602. 6	E	0.58	4.57E03	27.6	LYM227	1454 4.2	D	5.17 6	7.52E03	34.3
LYM132	12275. 3	E	0.58 7	9.38E03	29	LYM79	1313 1.5	D	5.50 4	5.52E02	42.8
LYM178	12164. 2	E	0.55 7	1.30E02	22.5	LYM79	1313 2.6	D	5.91 1	5.61E02	53.3
LYM268	12483. 4	E	0.53 9	4.86E02	18.5	LYM227	1454 2.5	D	5.15 9	6.06E02	33.8
LYM178	12163. 3	E	0.55 3	5.88E02	21.4	LYM79	1313 3.6	D	5.42 9	8.59E02	40.9
LYM1	11601. 1	E	0.54 3	6.29E02	19.2	CONTR OL	—	D	3.85 5	—	0
LYM129	12573. 5	E	0.54 8	7.27E02	20.4	LYM79	1313 4.7	F	6.19 1	5.25E04	18
LYM5	12432. 1	E	0.53 2	7.47E02	16.9	LYM79	1313 2.6	F	6.15 8	6.45E03	17.4
LYM129	12572. 2	E	0.52	7.70E02	14.4	LYM79	1313 1.5	F	6.28 6	7.80E03	19.8
CONTR OL	—	E	0.45 5	—	0	LYM227	1454 2.3	F	5.86 3	7.80E02	11.7
LYM268	12482. 3	F	6.79 7	1.32E04	22.4	CONTR OL	—	F	5.24 7	—	0
LYM5	12435. 1	F	6.56 6	5.75E04	18.2	LYM79	1313 1.6	G	0.75 6	8.17E03	48
LYM134	12314. 2	F	6.85 8	2.92E03	23.5	LYM227	1454 4.2	G	0.57 5	3.56E02	12.6
LYM132	12276. 1	F	6.96 8	4.43E03	25.4	CONTR OL	—	G	0.51 1	—	0
LYM129	12571. 3	F	6.61 4	1.13E02	19.1	LYM79	1313 1.6	H	0.07 5	1.40E05	50.2
LYM178	12164. 3	F	6.68 5	1.23E02	20.3	LYM227	1454 4.2	H	0.06 2	1.36E02	24.5
LYM268	12483. 2	F	6.47 7	1.34E02	16.6	LYM79	1313 3.6	H	0.06 2	1.76E02	25.2
LYM268	12483. 4	F	6.49 4	1.43E02	16.9	LYM79	1313 1.5	H	0.06 4	2.54E02	28.1
LYM1	11602. 6	F	6.60 7	1.52E02	18.9	LYM227	1454 2.5	H	0.06 1	3.57E02	22.1
LYM1	11601. 1	F	6.59 5	2.97E02	18.7	LYM79	1313 4.7	H	0.05 9	6.68E02	19.2
LYM178	12164.	F	6.10	4.81E-	9.9	LYM79	1313	H	0.05	8.94E-	18.9

403

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
	2		6	02			2.6		9	02
LYM132	12275. 3	F	6.54 6	7.02E02	17.8	CONTR OL	—	H	0.05	—	0
LYMl 29	12573. 5	F	6.54 4	9.24E02	17.8
CONTR OL	—	F	5.55 5	—	0
LYMl	11601. 1	G	0.75	8.00E06	56.3
LYM132	12271. 4	G	0.76	1.00E- 05	58.3
LYM132	12275. 3	G	0.84 1	4.10E05	75.2
LYM268	12482. 1	G	0.73 8	2.75E04	53.6
LYM178	12164. 3	G	1.03 1	1.85E- 03	114.7
LYMl	11603. 2	G	0.66 5	1.89E- 03	38.5
LYM134	12314. 2	G	0.75 9	2.43E03	58.1
LYMl	11602. 6	G	1.00 2	3.24E03	108.6
LYM178	12164. 2	G	0.61 5	7.36E03	28
LYM178	12163. 3	G	0.92 9	1.03E02	93.6
LYM132	12276. 1	G	0.83 3	1.10E02	73.5
LYM6	11736. 1	G	0.75	1.25E02	56.2
LYMl 29	12573. 5	G	0.78 6	2.28E02	63.6
LYM268	12483. 2	G	0.72 8	2.44E02	51.6
LYM6	11735. 2	G	0.59 4	2.79E02	23.7
LYM268	12482. 3	G	0.63	3.55E02	31.3
LYM5	12432. 1	G	0.74 1	3.96E02	54.3
LYMl 29	12572. 2	G	0.59 8	4.01E02	24.5
LYMl	11602. 1	G	0.58 8	5.84E02	22.4
LYM268	12483. 4	G	0.70 8	6.03E02	47.5
LYM134	12313. 2	G	0.96 8	6.92E02	101.5
CONTR OL	—	G	0.48	—	0
LYM136	13423. 1	A	0.00 6	4.00E06	156.7	LYMl 60	1347 2.1	A	0.01	0.00E +00	138.8

404

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYMl	11601. 1	A	0.00 4	2.49E04	69.1	LYM136	1342 3.4	A	0.00 9	1.48E- 04	118.5
LYM136	13421. 5	A	0.00 6	1.77E03	129.9	LYM293	1339 1.2	A	0.00 7	5.51E- 03	57.6
LYM84	13404. 4	A	0.00 4	3.79E03	81.4	LYM293	1339 1.4	A	0.00 9	8.63E03	106
LYMl	11602. 6	A	0.00 7	5.63E03	182.5	LYM136	1342 1.7	A	0.00 8	1.58E02	94
LYMl	11603. 2	A	0.00 5	7.42E03	125.8	LYM136	1342 1.8	A	0.00 8	2.02E02	92.2
LYM84	13401. 2	A	0.00 5	1.15E- 02	91.8	LYMl 60	1347 1.1	A	0.00 8	3.06E02	95.2
LYM84	13403. 1	A	0.00 7	1.33E02	170.1	LYM84	1340 3.1	A	0.00 8	3.34E02	90.4
LYM84	13403. 3	A	0.00 5	1.48E02	99	LYMl 60	1347 2.2	A	0.00 7	3.80E02	78.5
LYM136	13421. 6	A	0.00 5	2.79E02	116.5	LYM84	1340 3.3	A	0.01 2	6.33E02	186
LYM136	13421. 8	A	0.00 7	2.82E02	189.7	LYM293	1339 2.2	A	0.00 7	6.99E02	70.1
LYM84	13403. 2	A	0.00 6	2.92E02	156.7	LYM84	1340 1.2	A	0.00 7	7.32E02	66.6
LYMl	11602. 1	A	0.00 4	3.31E- 02	70.1	LYM293	1339 1.9	A	0.00 7	7.86E02	67.8
LYM136	13423. 2	A	0.00 4	3.85E02	79.4	LYM136	1342 1.5	A	0.00 8	8.34E02	99.4
LYMl	11604. 4	A	0.00 3	5.00E02	39.2	LYMl 60	1347 1.4	A	0.00 6	9.24E02	31.3
CONTR OL	—	A	0.00 2	—	0	CONTR OL	—	A	0.00 4	—	0
LYM84	13401. 2	B	0.09 3	1.52E- 03	80.5	LYMl 60	1347 2.1	B	0.21 8	5.01E- 03	128.9
LYMl	11601. 1	B	0.09	4.19E03	75.6	LYM136	1342 3.4	B	0.19	7.33E03	100
LYM136	13423. 1	B	0.12 5	5.82E03	143.9	LYM136	1342 1.8	B	0.17 3	1.03E02	81.6
LYM84	13403. 3	B	0.1	6.00E03	95.1	LYM293	1339 1.2	B	0.13 8	1.09E02	44.7
LYM136	13421. 5	B	0.10 3	8.84E03	100	LYM84	1340 1.2	B	0.13 8	1.59E02	44.7
LYM136	13421. 6	B	0.12 3	9.57E03	139	LYM136	1342 1.7	B	0.15 3	2.38E02	60.5
LYMl	11602. 6	B	0.13	1.32E02	153.7	LYM84	1340 3.3	B	0.27 5	3.54E02	189.5
LYM136	13423. 2	B	0.08 8	1.41E02	70.7	LYMl 60	1347 2.2	B	0.15 5	6.63E02	63.2
LYM136	13421. 8	B	0.15 5	2.23E02	202.4	LYM293	1339 1.4	B	0.19 3	7.66E02	102.6
LYM84	13403. 2	B	0.15 5	2.32E02	202.4	LYM136	1342 1.5	B	0.18	8.25E02	89.5
LYM84	13404. 4	B	0.09 5	2.70E02	85.4	LYMl 60	1347 1.1	B	0.18	8.25E02	89.5
LYMl	11603.	B	0.10	2.70E-	109.8	LYM84	1340	B	0.19	8.89E-	105.3

405

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
	2		8	02			3.1		5	02
LYMl	11604. 4	B	0.07 3	3.33E02	41.5	CONTR OL	—	B	0.09 5	—	0
LYM1	11602. 1	B	0.08 8	3.79E02	70.7	LYM136	1342 1.5	G	1.16	1.40E05	113.3
LYM84	13403. 1	B	0.15	5.94E02	192.7	LYM 160	1347 2.1	G	1.07 3	1.70E05	97.2
CONTR OL	—	B	0.05 1	—	0	LYM 160	1347 1.1	G	0.97 3	1.00E04	78.9
LYMl	11601. 1	G	0.75	7.00E06	88.7	LYM84	1340 3.1	G	0.91 5	1.04E04	68.3
LYM84	13403. 1	G	0.75	8.00E06	88.7	LYM136	1342 3.4	G	1.08	1.69E03	98.6
LYM84	13404. 4	G	0.64	9.30E05	61	LYM136	1342 1.8	G	1.03 5	3.80E03	90.3
LYMl	11603. 2	G	0.63 5	7.21E04	59.7	LYM293	1339 1.4	G	1.19 3	5.56E03	119.3
LYM136	13421. 6	G	0.68 8	1.51E03	73	LYM84	1340 1.2	G	0.83	7.52E03	52.6
LYM84	13401. 2	G	0.68 8	2.17E03	73	LYM84	1340 3.3	G	1.41 8	7.77E03	160.7
LYMl	11602. 6	G	0.78 3	3.89E03	96.9	LYM 160	1347 2.2	G	0.76	1.94E02	39.8
LYM136	13423. 1	G	0.83	4.81E03	108.8	LYM136	1342 1.7	G	0.88	2.80E02	61.8
LYM84	13403. 3	G	0.72	4.83E03	81.1	LYM293	1339 1.2	G	0.74	4.83E02	36.1
LYM136	13421. 5	G	0.62	6.93E03	56	LYM293	1339 2.2	G	0.88 5	4.98E02	62.8
LYM84	13403. 2	G	0.78 5	1.19E02	97.5	LYM136	1342 3.2	G	0.79 5	8.04E02	46.2
LYM136	13421. 8	G	0.87 8	1.65E02	120.8	LYM293	1339 1.9	G	0.81 3	8.66E02	49.4
LYM136	13423. 2	G	0.61	2.94E02	53.5	LYM 160	1347 1.4	G	0.72 5	9.93E02	33.3
LYMl	11604. 4	G	0.51 5	2.96E02	29.6	CONTR OL	—	G	0.54 4	—	0
CONTR OL	—	G	0.39 8	—	0	LYM136	1342 1.5	H	0.12 2	0.00E +00	119
LYM136	13423. 1	H	0.08 1	0.00E +00	101.6	LYM 160	1347 2.1	H	0.11 8	0.00E +00	110.6
LYM84	13403. 1	H	0.07 6	0.00E +00	88.3	LYM84	1340 3.3	H	0.15	1.00E06	168.9
LYMl	11602. 6	H	0.07 7	1.00E06	91.4	LYM136	1342 3.4	H	0.11 6	3.00E06	108.4
LYMl	11601. 1	H	0.06 8	2.00E06	70.4	LYM293	1339 1.4	H	0.12 1	6.00E06	116.8
LYM84	13403. 2	H	0.08 3	2.00E06	107	LYM136	1342 1.8	H	0.10 6	7.20E05	90.5
LYM136	13421. 8	H	0.08 7	4.00E06	116.3	LYM 160	1347 1.1	H	0.09 7	1.50E04	74.2
LYM136	13421. 6	H	0.06 8	7.00E06	68.1	LYM84	1340 3.1	H	0.08 9	8.80E04	59.1

406

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYM84	13403. 3	H	0.07	9.00E06	74.3	LYM136	1342 1.7	H	0.09 4	1.79E03	68.6
LYM84	13401. 2	H	0.06 5	2.60E05	62.6	LYM84	1340 1.2	H	0.08 6	3.12E- 03	54.6
LYM136	13421. 5	H	0.06 6	2.80E05	65	LYM293	1339 2.2	H	0.09 3	3.73E03	66.4
LYM1	11603. 2	H	0.06 2	3.00E05	54.9	LYM 160	1347 2.2	H	0.08 5	5.45E03	51.8
LYM84	13404. 4	H	0.06	7.80E05	48.6	LYM293	1339 1.9	H	0.08 4	2.09E02	50.7
LYM136	13423. 2	H	0.06 1	1.90E- 03	51.8	LYM293	1339 1.2	H	0.07 8	2.83E02	40.1
LYM1	11604. 4	H	0.05 4	4.45E03	35.4	LYM136	1342 3.2	H	0.08 1	3.88E02	44.5
LYM1	11602. 1	H	0.05 3	1.86E02	31.5	LYM 160	1347 1.4	H	0.07 5	6.82E02	34.5
CONTR OL	—	H	0.04	—	0	CONTR OL	—	H	0.05 6	—	0
LYM84	13403. 2	C	1.02 7	1.40E- 05	80.2	LYM136	1342 1.5	C	0.90 8	0.00E +00	100.7
LYM136	13423. 1	C	1.02 3	1.50E- 05	79.7	LYM136	1342 1.8	C	0.87 3	0.00E +00	93.1
LYM136	13421. 8	C	1.02 8	7.30E05	80.6	LYM293	1339 1.2	C	0.79 2	0.00E +00	75.2
LYM84	13403. 1	C	0.89 3	1.60E- 04	56.8	LYM 160	1347 2.1	C	0.72 1	1.00E- 06	59.5
LYM84	13403. 3	C	0.86 7	6.59E04	52.3	LYM84	1340 3.3	C	1.08 9	1.00E- 06	140.8
LYM136	13421. 6	C	0.85 3	2.33E03	49.8	LYM136	1342 3.2	C	0.83 1	3.00E06	83.8
LYM136	13423. 2	C	0.86 4	3.27E03	51.7	LYM293	1339 1.4	C	1.07 1	3.00E06	136.8
LYM1	11603. 2	C	0.81 7	3.91E- 03	43.4	LYM 160	1347 1.1	C	0.77 2	3.10E- 05	70.6
LYM84	13401. 2	C	0.80 4	4.08E03	41.2	LYM84	1340 1.2	C	0.69 2	SHOEOS	52.9
LYM1	11602. 6	C	0.86 2	5.42E03	51.3	LYM136	1342 3.4	C	0.77 7	4.90E05	71.7
LYM1	11601. 1	C	0.78 9	1.01E02	38.6	LYM 160	1347 2.2	C	0.67 2	1.41E04	48.7
LYM1	11604. 4	C	0.82 3	1.54E02	44.5	LYM84	1340 3.1	C	0.64 6	2.21E04	42.9
LYM84	13404. 4	C	0.73 4	2.94E02	28.8	LYM293	1339 1.9	C	0.76 3	2.73E04	68.7
LYM1	11602. 1	C	0.72 7	4.75E02	27.6	LYM136	1342 1.7	C	0.72 7	8.57E04	60.7
LYM136	13421. 5	C	0.71 5	7.12E- 02	25.5	LYM293	1339 2.2	C	0.66 8	1.97E02	47.8
CONTR OL	—	C	0.57	—	0	CONTR OL	—	C	0.45 2	—	0
LYM1	11604. 4	E	0.58 3	3.46E03	26.5	LYM84	1340 3.3	E	0.55 9	5.55E02	23
LYM84	13403.	E	0.57	1.03E-	24.6	CONTR		E	0.45		0

407

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
	2		4	02		OL			4
LYM136	13421. 8	E	0.55 1	1.41E02	19.7	LYM136	1342 1.8	D	7.68 5	9.00E05	87.2
LYM84	13403. 3	E	0.56 2	1.74E02	21.9	LYM136	1342 1.5	D	8.41 8	1.06E04	105
LYM1	11601. 1	E	0.54 9	2.97E02	19.1	LYM 160	1347 2.1	D	6.28	5.37E04	52.9
LYM84	13401. 2	E	0.54 3	4.13E02	17.9	LYM293	1339 1.2	D	6.82 3	2.80E03	66.1
LYM84	13403. 1	E	0.53 5	4.77E02	16.1	LYM84	1340 3.1	D	5.88	8.55E03	43.2
LYM84	13404. 4	E	0.52 8	5.27E02	14.6	LYM84	1340 1.2	D	6.16 5	9.88E03	50.1
LYM136	13423. 2	E	0.54 3	5.95E02	18	LYM136	1342 3.2	D	7.68 5	1.61E02	87.2
LYM1	11602. 1	E	0.52 5	6.56E02	13.9	LYM 160	1347 1.1	D	6.81 8	1.69E02	66
CONTR OL	—	E	0.46 1	—	0	LYM84	1340 3.3	D	9.51 8	2.04E02	131.8
LYM136	13423. 1	D	8.86 3	8.70E05	75.8	LYM136	1342 3.4	D	7.01 5	2.44E02	70.8
LYM84	13403. 1	D	7.74 8	3.02E03	53.7	LYM 160	1347 2.2	D	5.75 8	2.55E02	40.2
LYM84	13403. 2	D	8.73 8	5.76E03	73.4	LYM293	1339 1.4	D	9.49	2.56E02	131.1
LYM84	13403. 3	D	7.59 8	8.31E03	50.7	LYM293	1339 1.9	D	6.7	4.90E02	63.2
LYM84	13401. 2	D	7.03 8	9.19E03	39.6	LYM136	1342 1.7	D	6.53 3	5.11E02	59.1
LYM84	13404. 4	D	6.51 5	1.63E02	29.3	CONTR OL	—	D	4.10 6	—	0
LYM1	11603. 2	D	7.22 3	2.00E02	43.3	LYM136	1342 1.5	F	6.76 5	1.52E03	21.7
LYM136	13421. 8	D	8.99 3	2.33E02	78.4	LYM136	1342 3.2	F	6.73	2.68E03	21.1
LYM1	11601. 1	D	6.88 8	2.44E02	36.7	LYM136	1342 1.8	F	6.94 3	3.01E03	24.9
LYM136	13421. 6	D	7.33 5	3.72E02	45.5	LYM84	1340 1.2	F	6.2	9.41E03	11.5
LYM136	13423. 2	D	7.40 5	4.76E02	46.9	LYM136	1342 1.7	F	6.38	3.57E02	14.8
LYM1	11602. 6	D	7.60 5	4.83E02	50.9	LYM293	1339 1.9	F	6.22 3	4.78E02	11.9
LYM1	11602. 1	D	6.27 8	4.96E02	24.6	LYM84	1340 3.3	F	6.78 3	5.99E02	22
CONTR OL	—	D	5.04	—	0	LYM293	1339 1.2	F	6.20 8	7.14E02	11.7
LYM136	13421. 8	F	7.01 8	1.11E04	27.1	LYM 160	1347 1.1	F	6.12 5	9.99E02	10.2
LYM84	13404. 4	F	6.47 8	3.96E04	17.3	CONTR OL	—	F	5.55 9	—	0
LYM136	13423. 1	F	6.81	7.54E04	23.3

408

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr. vs. cont.	Gene name	Event	I D	Mea n	P value	% incr. vs. cont.
LYMl	11601. 1	F	6.77 5	2.36E03	η.Ί
LYM84	13403. 3	F	6.76 5	3.61E03	22.5
LYM84	13403. 1	F	6.53	4.49E03	18.3
LYM84	13403. 2	F	6.90 3	5.58E03	25
LYMl	11603. 2	F	6.81 3	6.13E03	23.4
LYM136	13423. 2	F	6.79	7.54E03	23
LYM84	13401. 2	F	6.63 3	1.04E02	20.1
LYMl	11602. 1	F	6.27 5	1.24E02	13.7
LYM136	13421. 6	F	6.11 3	1.93E02	10.7
LYMl	11604. 4	F	6.70 8	2.78E02	21.5
CONTR OL	—	F	5.52 1	—	0

Table 34. Results of the tissue culture experiments. Provided are the measured values of each tested parameter [parameters (ID.) A-F according to the parameters described in Table 33 above] in plants expressing the indicated polynucleotides. “Ev” = event; “P” = P-value; “Mean ” = the average of measured parameter across 5 replicates. % incr. vs. cont. = percentage of increase versus control (as compared to control).

Table 35

Measured parameters at the tissue culture assay (T1 experiment) for transformed agriculture improving trait genes

Tested Parameters	ID
Dry Weight (gr)	A
Fresh Weight (gr)	B
RGR Of Root Coverage	C
Roots Coverage TP3 (cm2)	D
RGR Of Roots Length	E
Roots Length TP3 (cm)	F
Leaf Area TP3 (cm)	G
RGR Of Leaf Area	H
Leaf Area TP1 (cm)	I
Roots Length TP1 (cm)	J

Table 35: Provided are the identification (ID) letters of each of the Tested Parameters.

TP3 = Time point 3; RGR - relative growth rate. TP1 = Time point 1.

409

2018271407 30 Nov 2018

Table 36

Results obtained in a Tl experiment at the tissue culture assay

Gene name	ID	Mean	P value	% incr. vs. cont	Gene name	ID	Mean	P value	% incr. vs. cont
LYM161	A	0.014	1.24E- 03	90.4	LYM240	H	0.078	2.23E-02	31.2
LYM219	A	0.01	2.07E- 03	28.3	LYM228	H	0.077	2.59E-02	29.8
LYM83	A	0.01	1.93E- 02	30.6	LYM189	H	0.076	3.81E-02	28
LYM278	A	0.009	3.67E- 02	25.9	LYM184	H	0.082	4.23E-02	37.8
LYM204	A	0.01	5.84E- 02	36.3	LYM248	H	0.076	6.24E-02	27.1
LYM155	A	0.013	6.05E- 02	70.7	CONTROL	H	0.06	—	0
LYM221	A	0.009	9.70E- 02	22.9	LYM117	A	0.009	5.26E-04	65.7
CONTROL		0.007		0	LYM146	A	0.01	1.17E-02	81.5
LYM161	B	0.282	9.40E- 05	75.5	LYM144	A	0.007	1.61E-02	34.3
LYM83	B	0.213	3.45E- 03	32.5	LYM93	A	0.008	7.31E-02	43.5
LYM219	B	0.207	2.66E- 02	28.8	LYM123	A	0.006	7.96E-02	19
LYM204	B	0.207	6.73E- 02	28.8	LYM127	A	0.007	9.16E-02	32.1
LYM155	B	0.267	9.60E- 02	66.3	CONTROL	A	0.005	—	0
LYM278	B	0.191	9.94E- 02	18.9	LYM117	B	0.198	7.40E-05	75.7
CONTROL		0.161		0	LYM127	B	0.159	8.58E-04	41.3
LYM221	C	0.468	1.90E- 03	94.9	LYM146	B	0.186	8.64E-03	65.3
LYM155	C	0.468	2.86E- 03	95.2	LYM192	B	0.148	1.44E-02	31.7
LYM161	C	0.484	3.41E- 03	101.5	LYM144	B	0.153	4.48E-02	35.5
LYM188	C	0.4	2.12E- 02	66.5	LYM93	B	0.172	5.30E-02	52.3
LYM 144	C	0.355	9.94E- 02	48.1	LYM135	B	0.178	5.72E-02	58
CONTROL		0.24		0	LYM123	B	0.156	5.80E-02	38.4
LYM188	D	3.425	1.59E- 03	67.6	LYM200	B	0.153	6.00E-02	35.5
LYM221	D	3.964	1.79E- 03	94	CONTROL	B	0.113	—	0
LYM155	D	3.85	1.26E- 02	88.4	LYM135	C	0.625	1.90E-05	79.8
LYM 144	D	3.038	4.84E- 02	48.6	LYM127	C	0.614	5.30E-05	76.4
LYM161	D	4.023	7.69E-	96.8	LYM146	C	0.553	1.54E-04	58.8

410

2018271407 30 Nov 2018

Gene name	ID	Mean	P value	% incr. vs. cont	Gene name	ID	Mean	P value	% incr. vs. cont
			02
CONTROL		2.044		0	LYMl 17	C	0.537	5.03E-04	54.2
LYM155	E	0.444	9.80E- 03	58.2	LYMl 54	c	0.56	1.78E-03	60.9
LYM221	E	0.413	2.08E- 02	47	LYM192	c	0.492	3.37E-03	41.5
LYMl 88	E	0.41	2.14E- 02	46.1	LYM93	c	0.477	8.26E-03	37
LYM161	E	0.412	2.44E- 02	46.6	LYM200	c	0.483	9.48E-03	38.9
LYMl 44	E	0.405	2.83E- 02	44.2	LYM144	c	0.473	1.14E-02	35.8
CONTROL		0.281		0	LYM123	c	0.473	1.75E-02	35.8
LYMl 88	F	4.053	6.86E- 04	41.3	LYM273	c	0.473	1.83E-02	35.8
LYMl 44	F	3.97	2.09E- 03	38.4	CONTROL	c	0.348	—	0
LYM221	F	4.058	3.24E- 03	41.5	LYM192	D	4.217	1.10E-03	42.2
LYM161	F	3.914	2.30E- 02	36.5	LYM93	D	4.075	1.12E-03	37.4
LYM278	F	3.493	5.26E- 02	21.8	LYM144	D	4.057	4.97E-03	36.8
LYM155	F	4.084	5.40E- 02	42.4	LYMl 17	D	4.4	7.86E-03	48.4
LYM204	F	3.68	6.02E- 02	28.3	LYM146	D	4.555	9.70E-03	53.6
CONTROL		2.868		0	LYM200	D	4.151	3.73E-02	40
LYM83	G	0.883	2.63E- 04	31.7	LYM135	D	5.162	4.62E-02	74
LYM161	G	1.129	1.06E- 03	68.3	LYM127	D	5.078	5.37E-02	71.2
LYM221	G	0.856	4.40E- 03	27.7	LYM123	D	4.062	7.29E-02	37
LYM278	G	0.834	9.29E- 03	24.3	CONTROL	D	2.966	—	0
LYM155	G	1.024	2.05E- 02	52.8	LYM127	E	0.535	9.11E-04	48.7
LYMl 44	G	0.823	3.31E- 02	22.7	LYM135	E	0.508	2.21E-03	41
LYM204	G	0.789	4.70E- 02	17.6	LYMl 17	E	0.463	1.53E-02	28.7
CONTROL		0.671		0	LYM93	E	0.448	2.20E-02	24.5
LYM161	H	0.122	4.00E- 06	71.4	LYM192	E	0.444	3.60E-02	23.2
LYM155	H	0.112	2.07E- 04	56.9	LYMl 54	E	0.456	4.57E-02	26.7
LYM83	H	0.096	7.84E- 03	35.1	CONTROL	E	0.36	—	0
LYM278	H	0.09	3.91E- 02	26.5	LYM93	F	4.431	8.92E-04	21.7

411

2018271407 30 Nov 2018

Gene name	ID	Mean	P value	% incr. vs. cont	Gene name	ID	Mean	P value	% incr. vs. cont
LYM221	H	0.089	4.80E- 02	25.3	LYM192	F	4.435	9.73E-03	21.8
LYM 144	H	0.088	6.23E- 02	23.8	LYM144	F	4.132	6.49E-02	13.5
CONTROL		0.071		0	LYMD3	F	4.108	7.42E-02	12.8
LYM227	A	0.01	8.00E- 05	53.1	LYM135	F	4.683	9.16E-02	28.6
LYM32	A	0.007	1.81E- 03	19.8	CONTROL	F	3.641	—	0
LYM40	A	0.009	1.92E- 03	49.9	LYMD7	G	0.72	6.DE-04	22.6
LYM273	A	0.009	2.65E- 03	44.7	LYM117	G	0.904	2.69E-03	53.9
LYM273	A	0.01	3.DE- OS	63.1	LYM192	G	0.701	3.05E-03	19.3
LYM200	A	0.01	8.53E- 03	57.9	LYM135	G	0.885	1.05E-02	50.7
LYM118	A	0.008	2.84E- 02	24.2	LYM146	G	0.854	1.87E-02	45.4
LYM 164	A	0.009	3.85E- 02	39.1	LYM144	G	0.693	2.45E-02	18
LYM23	A	0.008	6.86E- 02	32.3	LYM93	G	0.737	9.00E-02	25.4
LYM93	A	0.01	8.67E- 02	61.9	CONTROL	G	0.588	—	0
LYM 122	A	0.008	9.35E- 02	28.3	LYM117	H	0.095	1.50E-05	62.9
CONTROL		0.006		0	LYM135	H	0.09	4.07E-04	55.5
LYM227	B	0.248	4.10E- 05	47.9	LYM146	H	0.085	9.67E-04	46.9
LYM40	B	0.216	2.49E- 04	28.6	LYM93	H	0.075	2.94E-02	29.7
LYM273	B	0.231	7.82E- 03	37.8	LYMD7	H	0.073	7.67E-02	25.7
LYM200	B	0.251	1.45E- 02	49.8	CONTROL	H	0.058	—	0
LYM 146	B	0.229	1.83E- 02	36.6	LYM180	A	0.006	1.39E-04	44.3
LYM273	B	0.249	1.90E- 02	48.6	LYM243	A	0.006	3.56E-03	64.4
LYM 164	B	0.222	2.09E- 02	32.2	LYM194	A	0.006	9.85E-03	62.5
LYM 154	B	0.216	3.87E- 02	28.8	LYM221	A	0.005	4.06E-02	34.6
LYM 122	B	0.189	6.35E- 02	12.9	LYM204	A	0.006	4.55E-02	60.5
LYM135	B	0.197	7.69E- 02	17.4	LYM109	A	0.005	6.49E-02	29.4
CONTROL		0.168		0	LYM233	A	0.007	7.DE-02	70.9
LYM234	C	0.482	5.87E- 02	32.1	CONTROL	A	0.004	—	0

412

2018271407 30 Nov 2018

Gene name	ID	Mean	P value	% incr. vs. cont	Gene name	ID	Mean	P value	% incr. vs. cont
LYM200	C	0.469	6.18E- 02	28.7	LYM243	B	0.148	1.67E-02	28.8
LYM227	c	0.47	6.80E- 02	28.9	CONTROL	B	0.115	—	0
LYM 154	c	0.481	7.23E- 02	31.9	LYM233	C	0.383	4.28E-04	55.4
CONTROL		0.364		0	LYM204	C	0.377	6.67E-04	52.8
LYM200	D	3.874	5.17E- 02	27.9	LYM248	C	0.377	1.32E-03	53.1
CONTROL		3.029		0	LYM194	C	0.366	1.66E-03	48.4
LYM273	G	1.057	1.01E- 04	23	LYMl 86	C	0.387	1.93E-03	57.1
LYM227	G	1.033	1.50E- 04	20.2	LYM243	C	0.347	4.89E-03	40.9
LYM200	G	1.012	2.71E- 04	17.8	LYM83	C	0.349	5.96E-03	41.5
LYM273	G	1.027	2.79E- 04	19.6	LYMl 09	C	0.34	1.16E-02	38
LYM 154	G	1.022	1.12E- 02	18.9	LYM228	C	0.336	1.95E-02	36.4
LYM 164	G	1.027	8.89E- 02	19.5	LYMl 15	C	0.339	1.96E-02	37.7
LYM 146	G	1.063	8.89E- 02	23.7	LYM252	C	0.34	2.33E-02	38
LYM40	G	0.97	9.15E- 02	12.9	CONTROL	C	0.246	—	0
LYM135	G	1.045	9.75E- 02	21.6	LYM243	D	2.941	4.12E-03	38.7
CONTROL		0.859		0	LYMl 15	D	2.938	6.77E-03	38.6
LYM93	H	0.117	2.44E- 02	29.7	LYM194	D	3.087	8.47E-03	45.6
LYM 146	H	0.112	3.08E- 02	24.4	LYM233	D	3.284	1.36E-02	54.9
LYM273	H	0.108	4.22E- 02	20.3	LYM204	D	3.176	2.25E-02	49.8
LYM273	H	0.107	5.78E- 02	19	LYM83	D	2.959	3.59E-02	39.6
LYM 154	H	0.108	6.06E- 02	19.8	LYMl 09	D	2.886	4.28E-02	36.1
LYM 164	H	0.108	6.30E- 02	20	LYM248	D	3.188	5.13E-02	50.4
LYM135	H	0.108	7.21E- 02	19.8	CONTROL	D	2.12	—	0
LYM227	H	0.106	7.58E- 02	17.7	LYM248	E	0.416	9.58E-03	27.1
LYM200	H	0.106	7.94E- 02	17.6	LYM204	E	0.389	6.24E-02	19.1
LYM234	H	0.107	8.46E- 02	18.6	LYM233	E	0.39	7.40E-02	19.4
CONTROL		0.09		0	LYM83	E	0.385	8.68E-02	17.7
LYM131	A	0.008	2.70E-	60.5	CONTROL	E	0.327	_	0

413

2018271407 30 Nov 2018

Gene name	ID	Mean	P value	% incr. vs. cont	Gene name	ID	Mean	P value	% incr. vs. cont
			02
LYM 194	A	0.007	5.17E- 02	36.9	LYM115	F	3.729	2.49E-03	13.6
LYM261	A	0.006	5.62E- 02	29.7	LYM248	F	4.115	5.82E-03	25.3
LYM 185	A	0.01	5.77E- 02	99.7	LYM228	F	3.665	2.44E-02	11.6
LYM 123	A	0.007	7.73E- 02	39	LYM204	F	3.852	4.19E-02	17.3
LYM 192	A	0.006	7.80E- 02	14.4	LYM83	F	3.788	6.51E-02	15.4
CONTROL		0.005		0	LYM233	F	3.97	8.99E-02	20.9
LYM252	B	0.165	5.43E- 03	38.4	CONTROL	F	3.284	—	0
LYM131	B	0.181	2.17E- 02	51.5	LYM233	G	0.768	5.26E-03	41.5
LYM 194	B	0.164	3.02E- 02	37.5	LYM194	G	0.73	1.12E-02	34.5
LYM 185	B	0.225	3.55E- 02	87.9	LYM228	G	0.597	4.27E-02	9.8
LYM 123	B	0.154	4.39E- 02	28.9	LYM243	G	0.676	4.45E-02	24.5
CONTROL		0.12		0	LYM215	G	0.626	6.82E-02	15.4
LYM 185	C	0.527	6.00E- 06	97.4	LYM204	G	0.697	8.47E-02	28.3
LYM 123	C	0.495	1.50E- 05	85.7	CONTROL	G	0.543	—	0
LYM131	C	0.454	2.90E- 05	70.4	LYM233	H	0.078	1.07E-04	38.3
LYM 194	C	0.413	1.09E- 03	54.7	LYM194	H	0.077	4.96E-04	36.3
LYM243	C	0.406	3.94E- 03	52.1	LYM204	H	0.069	2.23E-02	23.5
LYM252	C	0.375	1.15E- 02	40.5	LYM243	H	0.068	2.43E-02	20.9
LYM233	C	0.366	1.81E- 02	37.2	LYM252	H	0.071	2.64E-02	26.5
LYM215	C	0.338	7.24E- 02	26.7	CONTROL	H	0.056	—	0
CONTROL		0.267		0	LYM189	A	0.009	3.27E-04	32.5
LYM131	D	3.668	3.37E- 04	67.4	LYM32	A	0.01	8.84E-03	51.3
LYM215	D	2.788	1.33E- 02	27.2	LYM219	A	0.01	4.76E-02	49.4
LYM 194	D	3.34	2.15E- 02	52.4	LYM240	A	0.009	5.15E-02	33.2
LYM 123	D	4.004	3.68E- 02	82.7	LYM161	A	0.01	7.76E-02	52
LYM 185	D	4.257	5.21E- 02	94.2	CONTROL	A	0.007	—	0
LYM233	D	3.014	6.12E-	37.5	LYM32	B	0.19	9.39E-04	27.5

414

2018271407 30 Nov 2018

Gene name	ID	Mean	P value	% incr. vs. cont	Gene name	ID	Mean	P value	% incr. vs. cont
			02
LYM252	D	3.036	7.43E- 02	38.5	LYM249	B	0.225	2.56E-03	51
CONTROL		2.192		0	LYM189	B	0.21	3.29E-02	40.5
LYM131	E	0.469	8.00E- 06	42.8	LYM193	B	0.193	6.69E-02	29.1
LYM 185	E	0.47	2.28E- 04	43.1	LYM261	B	0.177	7.40E-02	18.5
LYM 123	E	0.448	3.49E- 04	36.4	CONTROL	B	0.149	—	0
LYM 194	E	0.411	6.53E- 03	25.3	LYM234	C	0.531	0.00E+00	123.9
LYM243	E	0.407	8.35E- 03	24	LYM249	C	0.539	0.00E+00	127.6
LYM252	E	0.383	7.84E- 02	16.6	LYM219	C	0.517	7.00E-06	118.2
CONTROL		0.328		0	LYM240	C	0.415	2.30E-05	75.1
LYM131	F	4.042	7.90E- 05	32	LYM74	C	0.443	6.30E-05	86.9
LYM243	F	3.668	1.22E- 02	19.8	LYM179	C	0.406	1.06E-04	71.1
LYM215	F	3.383	3.49E- 02	10.5	LYM161	C	0.409	1.34E-04	72.4
LYM 194	F	3.635	4.63E- 02	18.8	LYM79	C	0.412	1.71E-04	73.6
LYM 123	F	3.912	5.09E- 02	27.8	LYM188	C	0.38	5.35E-04	60.3
LYM 185	F	4.091	7.35E- 02	33.7	LYM278	C	0.376	1.23E-03	58.5
CONTROL		3.061		0	LYM261	C	0.369	1.75E-03	55.6
LYM131	G	0.834	1.00E- 06	54	LYM224	C	0.382	3.15E-03	61.3
LYM 123	G	0.78	2.30E- 05	44.1	LYM189	C	0.349	5.89E-03	47.3
LYM233	G	0.643	8.49E- 03	18.8	LYM32	C	0.341	2.37E-02	44
LYM252	G	0.713	2.16E- 02	31.8	LYM193	C	0.322	4.86E-02	35.6
LYM243	G	0.656	2.67E- 02	21.2	LYM155	C	0.302	9.72E-02	27.2
LYM 192	G	0.669	2.77E- 02	23.5	CONTROL	C	0.237	—	0
LYM261	G	0.637	3.41E- 02	17.7	LYM240	D	3.448	1.00E-06	67.3
LYM 194	G	0.715	5.43E- 02	32	LYM188	D	3.137	6.00E-06	52.2
LYM 185	G	0.825	5.58E- 02	52.4	LYM179	D	3.35	9.72E-04	62.6
CONTROL		0.541		0	LYM189	D	2.884	1.31E-03	39.9
LYM131	H	0.087	3.00E- 06	53.4	LYM234	D	4.399	4.93E-03	113.5

415

2018271407 30 Nov 2018

Gene name	ID	Mean	P value	% incr. vs. cont	Gene name	ID	Mean	P value	% incr. vs. cont
LYM 185	H	0.092	1.70E- 05	62.1	LYM249	D	4.486	8.04E-03	m.i
LYM 123	H	0.083	3.10E- 05	46.2	LYM74	D	3.651	9.49E-03	112
LYM252	H	0.077	2.13E- 03	34.4	LYM261	D	3.07	2.24E-02	49
LYM 194	H	0.077	3.63E- 03	34.1	LYM161	D	3.381	2.29E-02	64.1
LYM 192	H	0.073	1.17E- 02	27.3	LYM278	D	3.171	2.40E-02	53.9
LYM261	H	0.069	4.77E- 02	20.8	LYM79	D	3.427	3.04E-02	66.3
LYM243	H	0.068	7.19E- 02	18.9	LYM219	D	4.274	7.53E-02	107.4
CONTROL		0.057		0	LYM155	D	2.558	8.03E-02	24.1
LYM245	A	0.008	1.20E- 02	38.7	CONTROL	D	2.061	—	0
LYM228	A	0.008	1.47E- 02	44.3	LYM249	E	0.438	5.00E-06	53.9
LYM240	A	0.008	2.80E- 02	45.2	LYM234	E	0.431	3.10E-05	51.7
LYM260	A	0.007	3.74E- 02	27.4	LYM219	E	0.401	1.65E-03	41.2
LYM 189	A	0.007	3.75E- 02	27	LYM224	E	0.397	2.21E-03	39.7
LYM 184	A	0.009	5.19E- 02	49.1	LYM179	E	0.378	3.93E-03	33
CONTROL		0.006		0	LYM79	E	0.383	5.24E-03	34.7
LYM245	B	0.16	1.51E- 02	41.9	LYM240	E	0.362	8.54E-03	27.4
LYM260	B	0.15	2.23E- 02	33	LYM74	E	0.373	9.36E-03	31.3
LYM 189	B	0.136	4.67E- 02	20.6	LYM189	E	0.352	2.77E-02	23.9
LYM240	B	0.144	5.98E- 02	27.5	LYM261	E	0.35	3.22E-02	23
LYM228	B	0.148	7.33E- 02	31.1	LYM188	E	0.352	3.95E-02	23.9
LYM 184	B	0.159	8.46E- 02	41.5	LYM193	E	0.351	5.12E-02	23.4
CONTROL		0.113		0	LYM161	E	0.348	5.53E-02	22.4
LYM 184	C	0.46	1.23E- 03	98.6	LYM32	E	0.344	8.20E-02	21
LYM240	C	0.363	6.06E- 03	56.9	LYM251	E	0.338	9.37E-02	18.9
LYM 109	C	0.33	2.96E- 02	42.4	CONTROL	E	0.284	—	0
LYM245	C	0.322	5.20E- 02	39.3	LYM74	F	3.635	3.70E-05	18.8
LYM248	C	0.323	5.28E- 02	39.7	LYM249	F	4.232	3.54E-03	38.3

416

2018271407 30 Nov 2018

Gene name	ID	Mean	P value	% incr. vs. cont	Gene name	ID	Mean	P value	% incr. vs. cont
LYM189	C	0.318	6.19E- 02	37.2	LYM240	F	3.548	3.55E-03	16
LYM186	c	0.315	6.33E- 02	36	LYM234	F	4.189	3.00E-02	36.9
CONTROL		0.232		0	LYM261	F	3.464	4.23E-02	13.2
LYM109	D	2.67	9.12E- 04	41.4	LYM179	F	3.591	9.25E-02	17.4
LYM186	D	2.588	1.06E- 02	37	CONTROL	F	3.06	—	0
LYM240	D	2.99	1.63E- 02	58.4	LYM240	G	0.919	5.00E-06	57.4
LYM189	D	2.592	1.94E- 02	37.3	LYM249	G	0.849	1.20E-05	45.4
LYM245	D	2.594	4.12E- 02	37.4	LYM278	G	0.879	9.10E-05	50.5
LYM115	D	2.352	4.59E- 02	24.6	LYM261	G	0.799	1.65E-04	36.8
LYM248	D	2.622	7.42E- 02	38.8	LYM224	G	0.739	2.43E-04	26.5
LYM180	D	2.304	7.43E- 02	22	LYM189	G	0.853	1.11E-03	46
CONTROL		1.888		0	LYM161	G	0.913	1.62E-03	56.3
LYM240	E	0.391	1.32E- 02	29.6	LYM79	G	0.915	2.06E-03	56.7
LYM248	E	0.386	2.03E- 02	28.1	LYM188	G	0.747	1.25E-02	27.9
LYM186	E	0.384	2.65E- 02	27.4	LYM219	G	0.841	1.69E-02	44.1
LYM184	E	0.417	5.28E- 02	38.2	LYM74	G	0.762	1.99E-02	30.4
LYM180	E	0.366	6.72E- 02	21.5	LYM179	G	0.795	4.21E-02	36.2
LYM109	E	0.364	7.31E- 02	20.8	LYM234	G	0.815	4.73E-02	39.5
CONTROL		0.301		0	CONTROL	G	0.584		0
LYM240	F	3.576	2.32E- 03	26.9	LYM161	H	0.097	2.10E-05	62.6
LYM109	F	3.246	1.05E- 02	15.2	LYM240	H	0.094	4.70E-05	57.3
LYM248	F	3.449	1.22E- 02	22.4	LYM79	H	0.095	7.60E-05	59.9
LYM180	F	3.271	3.14E- 02	16	LYM189	H	0.091	1.67E-04	53.1
LYM186	F	3.533	4.22E- 02	25.3	LYM278	H	0.088	4.71E-04	47.7
LYM189	F	3.237	6.97E- 02	14.8	LYM249	H	0.086	7.09E-04	45.4
LYM115	F	3.16	7.89E- 02	12.1	LYM219	H	0.087	1.31E-03	46
CONTROL		2.819		0	LYM234	H	0.086	2.25E-03	44.5
LYM184	G	0.774	3.40E-	36	LYM261	H	0.082	3.68E-03	38.3

417

2018271407 30 Nov 2018

Gene name	ID	Mean	P value	% incr. vs. cont	Gene name	ID	Mean	P value	% incr. vs. cont
			05
LYM228	G	0.749	1.29E- 03	31.6	LYM32	H	0.086	4.72E-03	44.3
LYM 189	G	0.726	6.50E- 03	27.5	LYM179	H	0.081	1.11E-02	35.5
LYM240	G	0.735	2.55E- 02	29.1	LYM74	H	0.081	1.50E-02	36.7
LYM 186	G	0.653	4.33E- 02	14.7	LYM188	H	0.077	2.66E-02	29.3
CONTROL		0.569		0	LYM224	H	0.077	4.09E-02	30.1
					CONTROL	H	0.059		0
					LYM38	B	0.115		13.8
					LYM126	B	0.136		34.3
					CONTROL	B	0.101		0
LYM36	A	0.004	E-4.75 01	6.7	LYM36	I	0.138	E-014.84	7.8
CONTROL	A	0.004		0	CONTROL	I	0.128		0
LYM36	I	0.09	E-4.34 01	7	LYM36	J	0.693	E-017.20	3.3
CONTROL	I	0.084	_	0	CONTROL	J	0.671	_	0

Table 36. Results of the tissue culture experiments. Provided are the measurec values of each tested parameter [parameters (ID.) A-F according to the parameters described in Table 35 above] in plants expressing the indicated polynucleotides. “Ev” = event; “P” = P-value; “Mean ” = the average of measured parameter across events.

% incr. vs. cont. = percentage of increase versus control (as compared to control).

Table 37

Measured parameters at the tissue culture assay low nitrogen (T2 experiment) for transformed agriculture improving trait genes

Tested Parameters	ID
Dry Weight (gr)	G
Fresh Weight (gr)	H
RGR Of Root Coverage	I
Roots Coverage TP3 (cm2)	J
RGR Of Roots Length	K
Roots Length TP3 (cm)	L
Leaf Area TP3 (cm)	M
RGR Of Leaf Area	N
Table 37: Provided are the identification (ID) letters o	each of the Tested

Parameters. TP3 - Time Point 3; RGR- Relative Growth Rate plants were grown on low nitrogen as described above.

2018271407 30 Nov 2018

418

Table 38

Results obtained in a T2 experiment at the tissue culture assay low nitrogen

Gene name	Event	I D	Mea n	P value	% incr . vs. cont	Gene name	Event	I D	Mea n	P value	% incr . vs. cont
LYM17 8	12161 .1	G	0.006	2.07E03	39.1	LYM5	12432 .1	G	0.007	1.40E05	69.3
LYM37	11801 .2	G	0.007	3.50E03	60	LYM268	12483 .2	G	0.007	1.56E04	56.6
LYM34	11901 .1	G	0.006	3.63E03	31.9	LYM1	11602 .6	G	0.009	2.16E04	107. 8
CONTR OL	—	G	0.004	—	0	LYM178	12164 .3	G	0.009	3.01E03	110. 2
LYM37	11801 .2	I	1.024	1.65E04	56.9	LYM132	12275 .3	G	0.006	3.52E03	50.6
LYM178	12161 .1	I	1.023	5.17E04	56.8	LYM129	12572 .2	G	0.006	5.24E03	41.6
CONTR OL	—	I	0.652	—	0	LYM1	11604 .4	G	0.006	5.89E03	39.2
LYM12	11873 .4	L	6.672	5.23E03	23	LYM129	12571 .3	G	0.006	7.22E03	45.2
LYM37	11801 .2	L	6.593	5.54E03	21.5	LYM268	12483 .4	G	0.008	7.89E03	95.8
CONTR OL	—	L	5.425	—	0	LYM178	12164 .2	G	0.006	8.14E03	50.6
LYM5	12436 .1	G	0.008	3.89E04	83.5	LYM132	12273 .2	G	0.005	8.21E03	30.7
LYM86	12183 .3	G	0.007	5.67E04	63	CONTR OL	—	G	0.004	—	0
LYM82	12203 .5	G	0.011	2.31E03	153	LYM1	11602 .6	H	0.177	1.00E06	103. 6
LYM82	12201 .2	G	0.008	2.64E03	77.8	LYM5	12432 .1	H	0.142	1.94E04	64
LYM86	12182 .3	G	0.007	2.83E03	49.9	LYM268	12483 .2	H	0.154	9.59E04	76.8
CONTR OL	—	G	0.004	—	0	LYM129	12572 .2	H	0.123	1.86E03	41.4
LYM268	12482 .1	H	0.115	8.00E06	61.6	LYM132	12275 .3	H	0.144	2.77E03	66.3
LYM82	12203 .5	H	0.189	2.40E04	166	LYM129	12573 .5	H	0.13	3.59E03	50.2
LYM44	11884 .1	H	0.12	6.61E04	67.8	LYM6	11735 .1	H	0.118	8.04E03	36
LYM6	11735 .2	H	0.102	6.94E04	43.6	LYM178	12164 .2	H	0.133	9.56E03	53.6
LYM82	12201 .2	H	0.144	1.47E03	101. 5	CONTR OL	—	H	0.087	—	0
LYM129	12573 .1	H	0.122	1.54E03	71.9	LYM268	12483 .4	I	1.459	0.00E+ 00	94.9
LYM86	12183 .3	H	0.132	1.66E03	85.3	LYM5	12435 .1	I	1.327	5.00E06	77.2
LYM86	12182 .3	H	0.124	2.94E03	73.7	LYM178	12164 .3	I	1.39	2.60E05	85.7

419

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr . vs. cont	Gene name	Event	I D	Mea n	P value	% incr . vs. cont
LYM5	12436 .1	H	0.155	6.44E03	118. 2	LYM129	12571 .3	I	1.264	3.90E05	68.7
LYM129	12572 .2	H	0.121	7.61E03	69.9	LYM129	12573 .5	I	1.215	4.60E05	62.3
LYM82	12204 .6	H	0.091	9.35E03	27.4	LYM268	12483 .2	I	1.195	7.50E05	59.5
LYM5	12435 .1	H	0.104	9.36E03	45.6	LYM268	12482 .3	I	1.16	3.42E04	54.9
LYM8	11984 .1	H	0.15	9.54E03	110. 2	LYM134	12314 .2	I	1.199	4.26E04	60.1
CONTR OL	—	H	0.071	—	0	LYM1	11603 .2	I	1.094	1.02E03	46.1
LYM268	12483 .4	I	1.515	0.00E+ 00	124. 3	LYM5	12432 .2	I	1.082	2.26E03	44.5
LYM82	12203 .2	I	1.459	0.00E+ 00	116	LYM268	12482 .1	I	1.23	4.74E03	64.3
LYM82	12203 .5	I	1.419	8.00E06	110. 1	LYM1	11602 .6	I	1.073	6.12E03	43.2
LYM8	11984 .1	I	1.336	1.10E05	97.9	LYM132	12276 .1	I	1.134	7.20E03	51.5
LYM44	11882 .1	I	1.135	2.40E05	68.1	CONTR OL	—	I	0.749	—	0
LYM5	12436 .1	I	1.264	3.40E05	87.2	LYM268	12483 .4	J	12.19	3.00E05	90.2
LYM86	12183 .3	I	1.056	1.39E04	56.3	LYM5	12435 .1	J	10.94 5	1.14E03	70.8
LYM86	12182 .3	I	1.219	1.86E04	80.5	LYM129	12571 .3	J	10.37 5	1.25E03	61.9
LYM5	12436 .2	I	1.072	2.95E04	58.7	LYM129	12573 .5	J	10.09 3	2.32E03	57.5
LYM82	12201 .2	I	0.986	3.76E04	46	LYM268	12483 .2	J	9.908	2.57E03	54.6
LYM44	11884 .3	I	1.094	5.32E04	62	LYM268	12482 .3	J	9.59	4.95E03	49.6
LYM44	11885 .4	I	1.249	1.21E03	85	CONTR OL	—	J	6.409	—	0
LYM268	12484 .2	I	1.147	1.40E03	69.9	LYM129	12571 .3	K	0.76	6.00E05	41.4
LYM8	11982 .7	I	0.958	1.62E03	41.9	LYM5	12435 .1	K	0.754	6.90E05	40.3
LYM8	11983 .1	I	1.007	1.85E03	49.1	CONTR OL	—	K	0.538	—	0
LYM129	12573 .1	I	0.935	2.77E03	38.4	LYM129	12571 .3	L	7.821	3.52E04	23.6
LYM129	12573 .3	I	0.901	2.85E03	33.4	LYM5	12435 .1	L	7.76	5.05E04	22.6
LYM268	12482 .1	I	0.992	3.37E03	46.9	LYM268	12483 .4	L	7.69	6.12E04	21.5
LYM6	11734 .3	I	1.105	5.28E03	63.6	CONTR OL	—	L	6.328	—	0
LYM5	12435	I	1.047	6.27E-	55.1	LYM5	12432	M	0.837	3.00E-	67.1

420

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr . vs. cont	Gene name	Event	I D	Mea n	P value	% incr . vs. cont
	.1			03			.1			06
LYM129	12572 .2	I	0.97	7.93E03	43.6	LYM129	12571 .3	M	0.732	2.50E05	46.1
CONTR OL	—	I	0.675	—	0	LYM132	12273 .2	M	0.685	8.40E05	36.7
LYM82	12203 .2	J	12.32 8	1.84E03	118. 3	LYM1	11604 .4	M	0.692	1.78E04	38.1
LYM129	12573 .3	J	7.459	3.21E03	32.1	LYM129	12573 .5	M	0.797	3.26E04	59.1
LYM268	12483 .4	J	12.72 6	6.83E03	125. 4	LYM178	12163 .3	M	0.668	6.70E04	33.4
LYM82	12201 .2	J	8.641	8.55E03	53	LYM1	11602 .6	M	0.95	7.84E04	89.7
CONTR OL	—	J	5.647	—	0	LYM5	12435 .1	M	0.756	8.12E04	51.1
LYM82	12203 .2	K	0.636	1.22E03	30	LYM132	12275 .3	M	0.727	1.36E03	45.3
LYM5	12435 .1	K	0.624	1.73E03	27.8	LYM1	11602 .1	M	0.676	1.74E03	35.1
LYM86	12182 .3	K	0.622	2.13E03	27.3	LYM268	12483 .4	M	0.889	2.41E03	77.5
LYM268	12483 .4	K	0.628	3.66E03	28.5	LYM178	12164 .3	M	0.93	2.60E03	85.7
LYM44	11884 .3	K	0.614	5.55E03	25.7	LYM178	12164 .2	M	0.732	4.37E03	46.3
CONTR OL	—	K	0.489	—	0	LYM129	12572 .2	M	0.7	5.37E03	39.9
LYM82	12203 .2	L	7.098	1.50E05	35.2	LYM134	12314 .2	M	0.746	5.84E03	48.9
LYM86	12182 .3	L	6.996	2.30E05	33.3	LYM1	11603 .2	M	0.78	9.55E03	55.8
LYM268	12483 .4	L	7.232	2.69E04	37.8	CONTR OL	—	M	0.501	—	0
LYM5	12435 .1	L	6.758	3.03E04	28.7	LYM1	11602 .6	N	0.098	0.00E+ 00	96
LYM82	12203 .5	L	7.346	4.61E04	39.9	LYM178	12164 .3	N	0.094	0.00E+ 00	87
LYM86	12183 .3	L	6.532	8.44E04	24.4	LYM268	12483 .4	N	0.092	0.00E+ 00	83.5
LYM5	12432 .1	L	6.265	1.21E03	19.3	LYM5	12432 .1	N	0.083	1.00E06	65.1
LYM5	12436 .1	L	6.713	1.40E03	27.9	LYM5	12435 .1	N	0.083	6.00E06	65.5
LYM44	11884 .3	L	6.768	1.41E03	28.9	LYM129	12573 .5	N	0.08	7.00E06	60.5
LYM268	12484 .2	L	6.748	3.26E03	28.5	LYM1	11603 .2	N	0.082	1.10E05	64.2
LYM44	11885 .4	L	6.724	3.68E03	28.1	LYM129	12571 .3	N	0.076	2.30E05	52.5
LYM8	11983 .1	L	6.614	5.58E03	26	LYM178	12164 .2	N	0.078	3.10E05	55.3

421

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr . vs. cont	Gene name	Event	I D	Mea n	P value	% incr . vs. cont
LYM5	12436 .2	L	6.52	6.08E03	24.2	LYM132	12275 .3	N	0.073	7.30E05	45.8
LYM86	12181 .3	L	6.239	6.93E03	18.8	LYM132	12273 .2	N	0.071	8.20E05	41.5
LYM8	11984 .1	L	6.951	8.05E03	32.4	LYM132	12276 .1	N	0.076	1.27E04	52.1
CONTR OL	—	L	5.25	—	0	LYM1	11604 .4	N	0.071	1.52E04	41
LYM82	12203 .2	M	0.836	8.30E05	110. 7	LYM5	12432 .2	N	0.077	1.63E04	53.8
LYM129	12572 .2	M	0.675	4.28E04	69.9	LYM268	12482 .1	N	0.082	1.98E04	63
LYM268	12482 .1	M	0.63	6.12E04	58.6	LYM129	12572 .2	N	0.072	2.38E04	44.1
LYM82	12203 .5	M	0.836	9.33E04	110. 6	LYM134	12313 .2	N	0.084	2.41E04	67.5
LYM86	12183 .3	M	0.684	1.14E03	72.2	LYM134	12314 .2	N	0.073	6.27E04	45.5
LYM82	12204 .6	M	0.491	1.31E03	23.6	LYM268	12483 .2	N	0.077	1.02E03	52.9
LYM82	12201 .2	M	0.787	1.98E03	98.1	LYM1	11602 .1	N	0.068	1.34E03	36.8
LYM268	12483 .4	M	0.825	2.72E03	107. 9	LYM132	12271 .4	N	0.075	2.22E03	49.5
LYM5	12436 .1	M	0.776	3.22E03	95.3	LYM178	12163 .3	N	0.064	7.09E03	26.9
LYM268	12484 .2	M	0.743	4.16E03	87.2	LYM1	11601 .1	N	0.067	8.58E03	34.4
LYM8	11984 .1	M	0.716	4.66E03	80.3	CONTR OL	—	N	0.05	—	0
LYM8	11982 .7	M	0.565	8.97E03	42.3
LYM5	12435 .1	M	0.674	9.05E03	69.7
LYM86	12182 .3	M	0.719	9.47E03	81.2
LYM268	12481 .1	M	0.627	9.53E03	58
CONTR OL	—	M	0.397	—	0
LYM268	12483 .4	N	0.085	0.00E+ 00	112. 8
LYM82	12203 .2	N	0.088	0.00E+ 00	119. 9
LYM82	12203 .5	N	0.087	0.00E+ 00	116. 8
LYM5	12436 .1	N	0.078	1.00E06	95.5
LYM82	12201 .2	N	0.074	2.00E06	85
LYM8	11984	N	0.075	3.00E-	87

422

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr . vs. cont	Gene name	Event	I D	Mea n	P value	% incr . vs. cont
	.1			06
LYM86	12183 .3	N	0.072	3.00E06	80.7
LYMl 29	12573 .1	N	0.073	1.00E- 05	82.5
LYM268	12484 .2	N	0.073	1.20E- 05	82.9
LYM86	12182 .3	N	0.074	2.00E05	85.7
LYM5	12435 .1	N	0.072	2.60E05	80.5
LYM268	12482 .1	N	0.066	6.90E05	63.7
LYMl 29	12572 .2	N	0.068	8.00E05	71.2
LYM268	12481 .3	N	0.066	8.40E05	64
LYM44	11884 .3	N	0.067	9.10E05	68
LYM268	12481 .1	N	0.062	4.98E04	54.5
LYM44	11885 .4	N	0.068	5.74E04	70.9
LYM5	12436 .2	N	0.062	9.56E04	55.4
LYM8	11982 .7	N	0.059	1.14E- 03	47
LYM44	11884 .1	N	0.057	2.22E03	42
LYM8	11982 .4	N	0.057	2.75E03	42.3
LYM82	12201 .1	N	0.056	5.28E03	39
LYM86	12183 .1	N	0.056	7.02E03	40.5
LYM44	11885 .3	N	0.059	7.80E03	46.7
LYM44	11882 .1	N	0.056	8.64E03	40.3
CONTR OL	—	N	0.04	—	0
LYM136	13423 .2	H	0.006	2.00E06	107. 3	LYM136	13423 .2	N	0.085	0.00E+ 00	82.6
LYM136	13421 .8	G	0.005	8.66E04	75.6	LYM136	13421 .8	N	0.082	0.00E+ 00	75.9
LYM84	13404 .4	G	0.007	2.84E03	113. 8	LYM84	13404 .4	N	0.092	0.00E+ 00	96.7
LYM136	13421 .6	G	0.006	2.89E03	94.3	LYM84	13401 .2	N	0.088	0.00E+ 00	88
LYMl	11601 .1	G	0.005	5.24E03	61	LYMl	11601 .1	N	0.081	1.00E06	73.2

423

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr . vs. cont	Gene name	Event	I D	Mea n	P value	% incr . vs. cont
LYM84	13403 .3	G	0.006	5.30E03	87.8	LYM84	13403 .3	N	0.08	2.00E06	70.6
LYM84	13401 .2	G	0.007	5.52E03	130. 9	LYM84	13403 .2	N	0.073	2.00E06	55.9
LYM1	11603 .2	G	0.004	9.31E03	42.3	LYM136	13423 .1	N	0.085	3.00E06	81.3
LYM84	13403 .2	G	0.005	1.53E02	58.5	LYM1	11602 .6	N	0.07	1.40E05	49.8
LYM1	11602 .6	G	0.005	2.06E02	50.4	LYM136	13421 .6	N	0.075	2.50E05	60.5
LYM136	13423 .1	G	0.007	3.33E02	123. 6	LYM84	13403 .1	N	0.07	7.20E05	50.5
LYM136	13421 .5	G	0.005	5.81E02	72.4	LYM136	13421 .5	N	0.074	1.10E04	57.9
CONTR OL	—	G	0.003	—	0	LYM1	11603 .2	N	0.071	1.87E04	51.2
LYM1	11601 .1	H	0.103	1.93E04	78.3	LYM1	11604 .4	N	0.058	2.56E02	23.7
LYM84	13403 .3	H	0.11	1.55E03	91.3	LYM1	11602 .1	N	0.056	7.26E02	19.1
LYM84	13403 .2	H	0.113	1.81E03	95.7	CONTR OL	—	N	0.047	—	0
LYM136	13423 .2	H	0.13	4.05E03	126. 1	LYM136	13421 .8	I	1.163	9.90E05	51.6
LYM1	11603 .2	H	0.093	4.55E03	60.9	LYM136	13423 .1	I	1.209	8.12E04	57.6
LYM84	13404 .4	H	0.13	6.79E03	126. 1	LYM1	11603 .2	I	0.993	1.65E03	29.4
LYM1	11602 .6	H	0.103	7.66E03	78.3	LYM84	13404 .4	I	1.095	2.56E03	42.7
LYM136	13423 .1	H	0.148	9.13E03	156. 5	LYM84	13403 .2	I	1.009	3.97E03	31.5
LYM136	13421 .8	H	0.128	1.35E02	121. 7	LYM84	13403 .1	I	0.997	4.57E03	30
LYM84	13401 .2	H	0.133	1.58E02	130. 4	LYM136	13423 .2	I	1.104	4.86E03	43.9
LYM136	13421 .5	H	0.105	2.31E02	82.6	LYM84	13403 .3	I	1.035	8.51E03	34.9
LYM136	13421 .6	H	0.11	2.99E02	91.3	LYM84	13401 .2	I	1.049	2.01E02	36.8
LYM84	13403 .1	H	0.095	9.17E02	65.2	LYM136	13421 .6	I	0.996	2.96E02	29.8
CONTR OL	—	H	0.058	—	0	LYM1	11601 .1	I	0.899	6.99E02	17.1
LYM136	13421 .8	M	0.805	0.00E+ 00	84	LYM1	11604 .4	I	0.884	9.29E02	15.3
LYM84	13403 .2	M	0.683	0.00E+ 00	56	CONTR OL	—	I	0.767	—	0
LYM1	11602 .6	M	0.713	1.50E04	62.9	LYM1	11603 .2	J	8.538	1.59E03	30
LYM84	13404	M	0.893	6.76E-	104	LYM84	13403	J	8.743	1.76E-	33.1

424

2018271407 30 Nov 2018

Gene name	Event	I D	Mea n	P value	% incr . vs. cont	Gene name	Event	I D	Mea n	P value	% incr . vs. cont
	.4			04			.1			02
LYMl	11601 .1	M	0.84	7.01E- 04	92	LYM136	13421 .8	J	10.11 5	2.04E02	54
LYM136	13423 .2	M	0.835	7.48E04	90.9	LYM84	13403 .2	J	8.468	3.82E02	28.9
LYM84	13403 .1	M	0.675	1.60E- 03	54.3	LYM84	13404 .4	J	9.658	5.32E02	47
LYM84	13403 .3	M	0.79	2.37E03	80.6	LYMl	11604 .4	J	7.745	5.47E02	17.9
LYM84	13401 .2	M	0.86	2.92E03	96.6	LYM136	13423 .1	J	10.39 8	6.40E02	58.3
LYM136	13423 .1	M	0.84	4.59E03	92	LYMl	11601 .1	J	7.858	6.86E02	19.6
LYMl	11603 .2	M	0.693	8.94E03	58.3	CONTR OL	—	J	6.568	—	0
LYM136	13421 .6	M	0.738	9.38E03	68.6	LYM136	13421 .8	L	7.173	1.89E- 03	21.6
LYMl	11604 .4	M	0.54	1.15E- 02	23.4	LYM84	13404 .4	L	7.105	3.22E03	20.4
LYM136	13421 .5	M	0.685	1.62E- 02	56.6	LYM84	13403 .1	L	6.823	8.12E- 03	15.7
LYMl	11602 .1	M	0.538	5.30E02	22.9	LYMl	11603 .2	L	6.868	9.56E03	16.4
CONTR OL	—	M	0.438	—	0	LYMl	11601 .1	L	6.538	2.95E02	10.8
						LYM136	13423 .2	L	6.88	3.42E02	16.6
						LYM84	13403 .2	L	6.445	7.62E02	9.3
						CONTR OL	—	L	5.899	—	0

Table 38. Results of the tissue culture T2 experiments. Provided are the measured values of each tested parameter [parameters (ID.) G-L according to the parameters described in Table 37 above] in plants expressing the indicated polynucleotides. “Ev” = event; “P” = P-value; “Mean ” = the average of measured 5 parameter across events. % incr. vs. cont. = percentage of increase versus control (as compared to control).

These results demonstrate that the polynucleotides of the invention are capable of improving yield and additional valuable important agricultural traits such as increase 10 of biomass, abiotic stress tolerance, nitrogen use efficiency, yield, vigor, fiber yield and/or quality. Thus, transformed plants showing improved fresh and dry weight demonstrate the gene capacity to improve biomass a key trait of crops for forage and plant productivity; transformed plants showing improvement of seed yield demonstrate the genes capacity to improve plant productivity; transformed plants showing

425

2018271407 30 Nov 2018 improvement of plot coverage and rosette diameter demonstrate the genes capacity to improve plant drought resistance as they reduce the loss of soil water by simple evaporation and reduce the competition with weeds; hence reduce the need to use herbicides to control weeds. Transformed plants showing improvement of relative growth rate of various organs (leaf and 5 root) demonstrate the gene capacity to promote plant growth and hence shortening the needed growth period and/or alternatively improving the utilization of available nutrients and water leading to increase of land productivity; Transformed plants showing improvement of organ number as demonstrated by the leaf number parameter exhibit a potential to improve biomass yield important for forage crops and improve the plant productivity; Transformed plants 10 showing increased root length and coverage demonstrate the gene capacity to improve drought resistance and better utilization of fertilizers as the roots can reach larger soil volume; Transformed plants showing improvement of leaf petiole relative area and leaf blade area demonstrate the genes capacity to cope with limited light intensities results from increasing the plant population densities and hence improve land productivity.

b

Although the invention has been described in conjunction with specific embodiments thereof, it is evident that many alternatives, modifications and variations will be apparent to those skilled in the art. Accordingly, it is intended to embrace all such alternatives, modifications and variations that fall within the spirit and broad scope of the appended claims.

’0 All publications, patents and patent applications mentioned in this specification are herein incorporated in their entirety by reference into the specification, to the same extent as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated herein by reference. In addition, citation or identification of any reference in this application shall not be construed as an admission that such reference is 25 available as prior art to the present invention. To the extent that section headings are used, they should not be construed as necessarily limiting.

Any reference to publications cited in this specification is not an admission that the disclosures constitute common general knowledge in Australia.

426

2018271407 30 Nov 2018

Other embodiments of the invention as described herein are defined in the following paragraphs:

1. A method of increasing yield, biomass, growth rate, vigor, oil content, fiber yield, fiber quality, abiotic stress tolerance, and/or nitrogen use efficiency of a plant, comprising expressing within the plant an exogenous polynucleotide comprising a nucleic acid sequence at least 80 % identical to SEQ ID NO: 3487, 1-239, 467-1973, 3481-3486, 3488-3674, 3738 or 3739, thereby increasing the yield, biomass, growth rate, vigor, oil content, fiber yield, fiber quality, abiotic stress tolerance, and/or nitrogen use efficiency of the plant.

2. A method of increasing yield, biomass, growth rate, vigor, oil content, fiber yield, fiber quality, abiotic stress tolerance, and/or nitrogen use efficiency of a plant, comprising expressing within the plant an exogenous polynucleotide comprising the nucleic acid sequence selected from the group consisting of SEQ ID NOs: 3487, 1-239, 467-1973, 3481-3486, 3488-3674, and 3738-3739, thereby increasing the yield, biomass, growth rate, vigor, oil content, fiber yield, fiber quality, abiotic stress tolerance, and/or nitrogen use efficiency of the plant.

3. A method of increasing yield, biomass, growth rate, vigor, oil content, fiber yield, fiber quality, abiotic stress tolerance, and/or nitrogen use efficiency of a plant, comprising expressing within the plant an exogenous polynucleotide comprising a nucleic acid sequence encoding a polypeptide at least 80 % identical to SEQ ID NO: 246, 240-245, 247-465, 1974-3480, 36753736 or 3737, thereby increasing the yield, biomass, growth rate, vigor, oil content, fiber yield, fiber quality, abiotic stress tolerance, and/or nitrogen use efficiency of the plant.

4. A method of increasing yield, biomass, growth rate, vigor, oil content, fiber yield, fiber quality, abiotic stress tolerance, and/or nitrogen use efficiency of a plant, comprising expressing within the plant an exogenous polynucleotide comprising a nucleic acid sequence encoding a polypeptide selected from the group consisting of SEQ ID NOs: 246, 240-245, 247-465, 19743480, and 3675-3737, thereby increasing the yield, biomass, growth rate, vigor, oil content, fiber yield, fiber quality, abiotic stress tolerance, and/or nitrogen use efficiency of the plant.

5. An isolated polynucleotide comprising a nucleic acid sequence at least 80 % identical to SEQ ID NO: 3487, 1-239, 467-1973, 3481-3486, 3488-3674, 3738 or 3739, wherein said nucleic acid sequence is capable of increasing yield, biomass, growth rate, vigor, oil content, fiber yield, fiber quality, abiotic stress tolerance, and/or nitrogen use efficiency of a plant.

6. An isolated polynucleotide comprising the nucleic acid sequence selected from the group consisting of SEQ ID NOs: 3487, 1-239, 467-1973, 3481-3486, 3488-3674, and 37383739.

7. An isolated polynucleotide comprising a nucleic acid sequence encoding a polypeptide

427

2018271407 30 Nov 2018 which comprises an amino acid sequence at least 80 % homologous to the amino acid sequence set forth in SEQ ID NO: 246, 240-245, 247-465, 1974-3480, 3675-3736 or 3737, wherein said nucleic acid sequence is capable of increasing yield, biomass, growth rate, vigor, oil content, fiber yield, fiber quality, abiotic stress tolerance, and/or nitrogen use efficiency of a plant.

8. An isolated polynucleotide comprising a nucleic acid sequence encoding a polypeptide which comprises the amino acid sequence selected from the group consisting of SEQ ID NOs: 246, 240-245, 247-465, 1974-3480, and 3675-3737.

9. A nucleic acid construct comprising the isolated polynucleotide of paragraph 5, 6, 7 or 8, and a promoter for directing transcription of said nucleic acid sequence in a host cell.

10. An isolated polypeptide comprising an amino acid sequence at least 80 % homologous to SEQ ID NO: 246, 240-245, 247-465, 1974-3480, 3675-3736 or 3737, wherein said amino acid sequence is capable of increasing yield, biomass, growth rate, vigor, oil content, fiber yield, fiber quality, abiotic stress tolerance, and/or nitrogen use efficiency of a plant.

11. An isolated polypeptide comprising the amino acid sequence selected from the group consisting of SEQ ID NOs: 246, 240-245, 247-465, 1974-3480, and 3675-3737.

12. A plant cell exogenously expressing the polynucleotide of paragraph 5, 6, 7 or 8 or the nucleic acid construct of paragraph 9.

13. A plant cell exogenously expressing the polypeptide of paragraph 10 or 11.

14. The method of paragraph 1 or 3, the isolated polynucleotide of paragraph 5 or 7, the nucleic acid construct of paragraph 9, or the plant cell of paragraph 12, wherein said nucleic acid sequence is as set forth in SEQ ID NO: 3487, 1-239, 467-1973, 3481-3486, 3488-3674, 3738 or 3739.

15. The method of paragraph 1, 2, 3 or 4, the isolated polynucleotide of paragraph 5, 6, 7 or 8, the nucleic acid construct of paragraph 9, or the plant cell of paragraph 12, wherein said polynucleotide consists of the nucleic acid sequence selected from the group consisting of SEQ ID NOs: 3487, 1-239, 467-1973, 3481-3486, 3488-3674, and 3738-3739.

16. The method of paragraph 1, 2, 3 or 4, the isolated polynucleotide of paragraph 5, 6, 7 or 8, the nucleic acid construct of paragraph 9, or the plant cell of paragraph 12, wherein said nucleic acid sequence encodes an amino acid sequence at least 80 % homologous to SEQ ID NO: 246, 240-245, 247-465, 1974-3480, 3675-3736 or 3737.

17. The method of paragraph 1, 2, 3 or 4 or the isolated polynucleotide of paragraph 5, 6, 7 or 8, the nucleic acid construct of paragraph 9, or the plant cell of paragraph 12, wherein said nucleic acid sequence encodes the amino acid sequence selected from the group consisting of SEQ ID NOs: 246, 240-245, 247-465, 1974-3480, and 3675-3737.

428

2018271407 30 Nov 2018

18. The plant cell of paragraph 12 or 13, wherein said plant cell forms a part of a plant.

19. The method of paragraph 1, 2, 3 or 4, the isolated polynucleotide of paragraph 5 or 7, or the nucleic acid construct of paragraph 9, the isolated polypeptide of paragraph 10, the plant cell of paragraph 12 or 13, wherein the abiotic stress is selected from the group consisting of salinity, drought, water deprivation, low temperature, high temperature, heavy metal toxicity, anaerobiosis, nutrient deficiency, nutrient excess, atmospheric pollution and UV irradiation.

20. The method of paragraph 1, 2, 3 or 4, further comprising growing the plant under the abiotic stress.

21. The method of paragraph 1, 2, 3 or 4, further comprising growing the plant under nitrogen-limiting conditions.

Still further embodiments are within the scope of the following claims.

Claims (20)

1. CLAIMS:

   1. A method of increasing yield, biomass, growth rate, vigor, and/or nitrogen use efficiency or reducing time to flowering and/or to inflorescence emergence of a plant, comprising over-expressing within the plant a polypeptide comprising an amino acid sequence at least 80% identical to SEQ ID NO: 434, and growing the plant over-expressing said polypeptide under non-stress conditions, thereby increasing the yield, biomass, growth rate, vigor, and/or nitrogen use efficiency, or reducing the time to flowering and/or to inflorescence emergence, of the plant.
2. 2. A method of increasing tolerance of a plant to salinity stress, comprising overexpressing within the plant a polypeptide comprising an amino acid sequence at least 80% identical to SEQ ID NO: 434, and growing the plant over-expressing said polypeptide under salinity stress conditions, thereby increasing the tolerance of the plant to salinity stress.
3. 3. The method of claim 1 or claim 2, wherein said polypeptide is expressed from an exogenous polynucleotide which comprises a nucleic acid sequence at least 80% identical to SEQ ID NO: 3671 or 197.
4. 4. A method of producing a crop, comprising growing a crop plant transformed with an exogenous polynucleotide comprising a nucleic acid sequence encoding a polypeptide at least 80% homologous to the amino acid sequence set forth in SEQ ID NO: 434, wherein the crop plant is derived from plants which have been transformed with said exogenous polynucleotide and which have been selected for increased yield, increased biomass, increased growth rate, increased vigor, increased nitrogen use efficiency, reduced time to flowering and/or reduced time to inflorescence emergence under non-stress conditions as compared to a wild type plant of the same species which is grown under the same growth conditions, and the crop plant has the increased yield, increased biomass, increased growth rate, increased vigor, increased nitrogen use efficiency, reduced time to flowering and/or reduced time to inflorescence emergence under the non-stress conditions, thereby producing the crop.
5. 5. A method of producing a crop, comprising growing a crop plant transformed with an exogenous polynucleotide comprising a nucleic acid sequence encoding a polypeptide at least 80% homologous to the amino acid sequence set forth in SEQ ID NO: 434, wherein the crop plant is derived from plants which have been transformed with said exogenous polynucleotide

   430

   2018271407 27 Apr 2020 and which have been selected for increased tolerance to salinity stress as compared to a wild type plant of the same species which is grown under the same growth conditions, and the crop plant has the increased tolerance to salinity stress, thereby producing the crop.
6. 6. The method of claim 4 or claim 5, wherein said exogenous polynucleotide comprises a nucleic acid sequence at least 80% identical to SEQ ID NO: 3671 or 197.
7. 7. A nucleic acid construct comprising an isolated polynucleotide comprising a nucleic acid sequence encoding a polypeptide which comprises an amino acid sequence at least 85% identical to the amino acid sequence set forth in SEQ ID NO: 434, and a heterologous promoter operably linked to said isolated polynucleotide, wherein said nucleic acid sequence is capable of:

   (i) increasing yield, biomass, growth rate, vigor, and/or nitrogen use efficiency of a plant under non-stress conditions;

   (ii) reducing time to flowering and/or to inflorescence emergence of a plant under non-stress conditions; and/or (iii) increasing tolerance of a plant to salinity stress.
8. 8. The nucleic acid construct of claim 7, wherein said isolated polynucleotide comprises a nucleic acid sequence at least 85% identical to SEQ ID NO: 3671 or 197.
9. 9. An isolated polypeptide comprising an amino acid sequence at least 85% identical to SEQ ID NO: 434, wherein said amino acid sequence is capable of:

   (i) increasing yield, biomass, growth rate, vigor, and/or nitrogen use efficiency of a plant under non-stress conditions, (ii) reducing time to flowering and/or to inflorescence emergence of a plant under non-stress conditions, and/or (iii) increasing tolerance of a plant to salinity stress.
10. 10. A transgenic plant cell comprising the nucleic acid construct of claim 7 or claim 8.
11. 11. A transgenic plant comprising the cell of claim 10, or the nucleic acid construct of claim 7 or claim 8.

    431

    2018271407 27 Apr 2020
12. 12. A method of selecting plants having increased yield, biomass, growth rate, vigor, and/or nitrogen use efficiency, and/or reduced time to flowering and/or time to inflorescence emergence under non-stress conditions, or increasing tolerance to salinity stress, the method comprising selecting plants transformed with the nucleic acid construct of claim 7 or claim 8 for an increased trait as compared to a native plant which is grown under the same growth conditions, wherein said trait is selected from the group consisting of: yield under non-stress conditions, biomass under non-stress conditions, growth rate under non-stress conditions, vigor under non-stress conditions, salinity stress tolerance, nitrogen use efficiency under non-stress conditions, reduced time to flowering under non-stress conditions and/or reduced time to inflorescence emergence under non-stress conditions.
13. 13. The method of any one of claims 1, 2, 4, 5 and 12, the nucleic acid construct of claim 7, the isolated polypeptide of claim 9, the plant cell of claim 10, or the transgenic plant of claim 11, wherein said polypeptide is at least 90% identical to SEQ ID NO: 434.
14. 14. The method of any one of claims 1, 2, 4, 5, and 12, the nucleic acid construct of claim 7, the isolated polypeptide of claim 9, the plant cell of claim 10, or the transgenic plant of claim 11, wherein said polypeptide is at least 95% identical to SEQ ID NO: 434.
15. 15. The method of any one of claims 1, 2, 4, 5, and 12, the nucleic acid construct of claim 7, the isolated polypeptide of claim 9, the plant cell of claim 10, or the transgenic plant of claim 11, wherein said polypeptide is selected from the group consisting of SEQ ID NOs: 434, and 3427-3468.
16. 16. The method of any one of claims 1, 2, 4, 5, and 12, the nucleic acid construct of claim 7, the isolated polypeptide of claim 9, the plant cell of claim 10, or the transgenic plant of claim 11, wherein said polypeptide is set forth in SEQ ID NO: 434.
17. 17. The method of claim 3 or claim 6, the nucleic acid construct of claim 8, the plant cell of claim 10, or the transgenic plant of claim 11, wherein said nucleic acid sequence is at least 90% identical to the polynucleotide set forth in SEQ ID NO: 3671.

    432

    2018271407 27 Apr 2020
18. 18. The method of claim 3 or claim 6, the nucleic acid construct of claim 8, the plant cell of claim 10, or the transgenic plant of claim 11, wherein said nucleic acid sequence is selected from the group consisting of SEQ ID NOs: 3671, 197 and 1920-1961.
19. 19. The method of any one of claims 1-6, and 12, further comprising growing the plant under nitrogen-limiting conditions.
20. 20. The method of any one of claims 1-6, and 13-18, further comprising selecting said plant for an increased trait as compared to a native plant of the same species which is grown under the same growth conditions, said trait being selected from the group consisting of: yield under non-stress conditions, biomass under non-stress conditions, growth rate under non-stress conditions, salinity stress tolerance, nitrogen use efficiency under non-stress conditions, and/or for a reduced time to flowering or time to inflorescence emergence under non-stress conditions.