AU2018260848B2 - Development of dengue virus vaccine components - Google Patents

Abstract

fit\Interwovn\NRPortbl\DCC\FMT\10995888_l.docx-26/08/2016 ABSTRACT The invention is related to a dengue virus or chimeric dengue virus that contains a mutation in the 3' untranslated region (3'-UTR) comprising a A30 mutation that removes the TL-2 homologous structure in each of the dengue virus serotypes 1, 2, 3, and 4, and nucleotides additional to the A30 mutation deleted from the 3'-UTR that removes sequence in the 5' direction as far as the 5'boundary of the TL-3 homologous structure in each of the dengue virus serotypes 1, 2, 3, and 4, or a replacement of the 3'-UTR of a dengue virus of a first serotype with the 3'-UTR of a dengue virus of a second serotype, optionally containing the A30 mutation and nucleotides additional to the A30 mutation deleted from the 3'-UTR; and immunogenic compositions, methods of inducing an immune response, and methods of producing a dengue virus or chimeric dengue virus.

Description

II:\fintInterwoenNRPortb\DCC\FMT\17988434_i oex-7/Itl2018

DEVELOPMENT OF DENGUE VIRUS VACCINE COMPONENTS

Related Applications This application claims the benefit of U.S. Provisional Application No. 60/837,723, filed August 15, 2006, the disclosure of which is incorporated herein by reference in its entirety. This is a divisional of Australian Patent Application No. 2016219680, which is a divisional of Australian Patent Application No. 2013263788, which is a divisional of Australian Patent Application No. 2007285929, the originally-filed specifications of which are incorporated herein by reference in their entirety.

Field of the Invention The invention relates to mutations in the 3' untranslated region of the genome of dengue virus serotypes 1, 2, 3, and 4 that are useful in attenuating the growth characteristics of dengue virus vaccines.

Description of the Related Art There are four serotypes of dengue virus (dengue virus type1 [DEN1], DEN2, DENS, and DEN4) that annually cause an estimated 50 to 100 million cases of dengue fever and 500,000 cases of the more severe form of dengue virus infection known as dengue hemorrhagic fever/dengue shock syndrome (Gubler, D. J. and M. Meltzer 1999 Adv Virus Res 53:35-70). Dengue virus is widely distributed throughout the tropical and semitropical regions of the world, and the number of dengue virus infections continues to increase due to the expanding range of its Aedes aegypti mosquito vector. A vaccine is not available for the control of dengue disease despite its importance as a reemerging disease. The goal of immunization is to protect against dengue virus disease by the induction of a long-lived neutralizing antibody response against each of the four serotypes. Simultaneous protection against all four serotypes is required, since an increase in disease severity can occur in persons with preexisting antibodies to a heterotypic dengue virus. Such immunization can be achieved economically with a live, attenuated virus vaccine. Dengue viruses are positive-sense RNA viruses belonging to the Flavivirus genus. The approximately 11,000-base genome contains a single open reading frame encoding a

II:\fintInterwo nNRPortb\DCC\FMT\17988434_ idoex-7 It 2018

polyprotein which is processed by proteases of both viral and cellular origin into three structural proteins (C, prM, and E) and at least seven nonstructural (NS)proteins. Both ends of the dengue virus genome contain an untranslated region (UTR), and the overall genome organization is 5'-UTR-C-prM -E-NS1-NS2A-NS2B-NS3 -N S4A-NS4B-N S5-UTR-3'. The 3'UTR is nearly 400 bases in length and is predicted to contain several stem-loop structures conserved among dengue virus serotypes (Brinton, M. A. et al. 1986 Virology

- 1A -

153:113-121, Hahn, C. S. et al. 1987 J Mol Biol 198:33-41, Proutski, V. et al. 1997 Nucleic Acids Res 25:1194-1202, Rauscher, S. et al. 1997 RNA 3:779-791, Shurtleff, A. et al. 2001 Virology 281:75-87). One such stem-loop structure, identified as TL-2 in the proposed secondary structure of the 3' UTR (Proutski, V. et al. 1997 Nucleic Acids Res 25:1194 1202), was previously removed by deletion of 30 nucleotides from the DEN4 genome (3' nucleotides 172 to 143) (Men, R. et at 1996 JVirol 70:3930-3937) and has subsequently been designated as the A30 mutation (Durbin, A. P. et al. 2001 Am J Trop Med Hyg 65:405 413). The resulting virus, rDEN430, was shown to be attenuated in rhesus monkeys compared to parental viruses containing an intact TL-2 sequence and is attenuated in humans (Durbin, A. P. et al 2001 Am J Trop Med Hyg 65:405-413). Summary of the Invention The invention is related to a dengue virus or chimeric dengue virus comprising a mutation in the 3' untranslated region (3'-UTR) selected from the group consisting of: (a) a A30 mutation that removes the TL-2 homologous structure in each of the dengue virus serotypes 1, 2, 3, and 4, and nucleotides additional to the A30 mutation deleted from the 3'-UTR that removes sequence in the 5' direction as far as the 5' boundary of the TL-3 homologous structure in each of the dengue virus serotypes 1, 2, 3, and 4; and (b) a replacement of the 3'-UTR of a dengue virus of a first serotype with the 3'-UTR of a dengue virus of a second serotype, optionally containing the A30 mutation and nucleotides additional to the A30 mutation deleted from the 3'-UTR; and immunogenic compositions, methods of inducing an immune response, and methods of producing a dengue virus or chimeric dengue virus. Brief Description of the Drawings Figure 1. Two approaches to attenuate dengue viruses. A) (a-c) Deletion of additional nucleotides from the 3'-UTR (DEN3 wt Sleman/78, SEQ ID NO: 1). B) Replacement of the 3'-UTR of a dengue virus of a first serotype with the 3'-UTR of a dengue virus of a second serotype. Figures 2 - 5. Predicted secondary structure of the TL-1, TL-2 and TL-3 region of the 3'-UTR of each DEN serotype. The GenBank accession number of the sequence used for construction of each secondary structure model is indicated. Only the last 278, 281, 276 and 281 nucleotides of DEN1, DEN2, DEN3, and DEN4, respectively, which comprise TL

1, TL-2 and TL-3, are used to avoid circularization of the structure and subsequent misfolding of known and experimentally-verified structural elements. The mfold program contraints specific for each structure model are indicated. Nucleotides that border the principle deletions are circled and numbered, with nucleotide numbering beginning at the 3' genome end (reverse-direction numbering system). Figure 2 - SEQ ID NO: 2; Figure 3 SEQ ID NO: 3; Figure 4 - SEQ ID NO: 4; Figure 5 - SEQ ID NO: 5. Figures 6 - 9. A30 deletion mutation depicted for each of the dengue virus serotypes DEN1, DEN2, DEN3 and DEN4. The A30 mutation deletes nt 174 to 145 of DEN], nt 173 to 144 of DEN 2, nt 173 to 143 of DEN3, and nt 172 to 143 of DEN4, with reverse-direction numbering system. The deleted region is indicated by the A symbol. Figure 6 - SEQ ID NO: 6; Figure 7 - SEQ ID NO: 7; Figure 8 - SEQ ID NO: 8; Figure 9

- SEQ ID NO: 9.

Figures 10 - 13. A30/31 deletion mutation depicted for each of the dengue virus serotypes DEN1, DEN2, DEN3 and DEN4. In addition to the deletion of the nucleotides comprising the A30 mutation, the A31 mutation deletes nt 258 to 228 of DEN1, DEN2, DEN3, and DEN4, with reverse-direction numbering system. The deleted region is indicated by the A symbol. Figure 10 - SEQ ID NO: 10; Figure 11 - SEQ ID NO: 11;

Figure 12 - SEQ ID NO: 12; Figure 13 - SEQ ID NO: 13.

Figures 14 - 17. A86 deletion mutation depicted for each of the dengue virus serotypes DEN], DEN2, DEN3 and DEN4. The A86 mutation deletes nt 228 to 145 of DEN1, nt 228 to 144 of DEN 2, nt 228 to 143 of DEN3, and nt 228 to 143 of DEN4, with reverse-direction numbering system. The deleted region is indicated by the A symbol. Figure 14 - SEQ ID NO: 14; Figure 15 - SEQ ID NO: 15; Figure 16 - SEQ ID NO: 16;

Figure 17 - SEQ ID NO: 17.

Figure 18. Chimerization of rDEN3 with the rDEN4 or rDEN4A30 3'-UTR. A) Recombinant 3'-UTR chimeric dengue viruses were constructed by replacing the 3'-UTR of rDEN3 with regions derived from either rDEN4 or rDEN4A30. The relative location of the A30 mutation in the 3'-UTR is indicated by an arrow. The junctions between the ORF and UTR for rDEN3 and rDEN4 are indicated asjunctions I and 2, respectively. Intertypic junction 3 is also indicated for the resultingchimeric viruses. B) Nucleotide and amino acid sequence of the junction regions are shown. For junction 3, nucleotide substitutions used to introduce a unique Hpal restriction enzyme recognition site are shown in lower case. Junction 1 - SEQ ID NOs: 18 (nucleotide) and 19 (amino acid); Junction 2 - SEQ ID NOs: 20 (nucleotide) and 21 (amino acid); Junction 3 - SEQ ID NOs: 22 (nucleotide) and 23 (amino acid). Figure 19. Replication in Vero cells and C6/36 cells. Four mutant viruses were compared to wild type rDEN3 for replication in Vero cells and C6/36 cells. 75 cm2 flasks of confluent cells were infected at a multiplicity of infection of 0.01. Aliquots of 0.5 ml were removed from flasks daily for seven days. After addition of SPG to a concentration of IX, samples were frozen on dry ice and stored at -80°C. Virus titer was determined by plaque assay on Vero cells for all samples. The limit of detection is 1.0IogjoPFU/ml. Detailed Description of the Preferred Embodiment Definitions Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs, See, e.g., Singleton P and Sainsbury D., Dictionary of Microbiology and Molecular Biology 3rd ed., J. Wiley & Sons, Chichester, New York, 2001, and Fields Virology 4th ed., Knipe D.M. and Howley P.M. eds, Lippincott Williams & Wilkins, Philadelphia 2001. The term "about" means within 3, 2, or 3 nucleotides. Mutant Dengue Viruses and Chimeric Dengue Viruses A goal of the invention is to develop a set of type-specific, live attenuated dengue vaccine components that can be formulated into a safe, effective, and economical tetravalent dengue vaccine. The A30 mutation attenuates DEN4 in rhesus monkeys (Men, R. et al. 1996.1 Virol 70:3930-3937)). The A30 mutation removes a homologous structure (TL-2) in each of the dengue virus serotypes 1, 2, 3, and 4 (Figure 2 - 5). However, the A30 mutation was found to not attenuate DEN3 in rhesus monkeys. An embodiment of the invention provides dengue viruses and chimeric dengue viruses having one or more mutations that result in attenuation, methods of making such dengue viruses, and methods for using these dengue viruses to prevent or treat dengue virus infection. The mutation (or mutations) in the dengue virus of the invention is present in the 3' untranslated region (3'-UTR) formed by the most downstream approximately 384 nucleotides of the viral RNA, which have been shown to play a role in determining attenuation. The viruses and methods of the invention are described further, as follows.

One example of a dengue virus that can be used in the invention is the serotype 3, Sleman/78 strain. The applicability of the invention to all members of the dengue virus taxonomic group is inferred by the observation that the properties of other dengue virus strains are similar to that of any one dengue virus strain. Dengue viruses have been grouped into four serotypes (DEN1, DEN2, DEN3 and DEN4). Numerous strains have been identified for each of the four serotypes. The complete genomic sequences of various dengue virus strains are provided as Genbank accession numbers in Table A. Table A. Examples of Dengue Virus Strains Serotype Strain Accession No. 1 02-20 AB178040 1 16007 AF180817 1 16007 PDK-13 AF180818 1 259par00 AF514883 1 280par00 AF514878 1 293arq00 AY206457 1 295arg00 AF514885 1 297ari00 AF514889 1 301arg00 AF514876 1 98901518 AB189120 1 98901530 AB189121 1 A88 AB074761 1 Abidjan AF298807 1 ARG0028 AY277665 1 ARG0048 AY277666 1 ARG9920 AY277664 1 BR-90 AF226685 1 BR-01-MR AF513110 I BR-97-111 AF311956 1 BR-97-233 AF311958 1 BR-97-409 AF311957 1 Cambodia AF309641 1 FGA-89 AF226687 1 FGA-NA d1d AF226686 1 Fj231-04 DQ193572 1 GD05-99 AY-37638 1 GD23-95 AY373427 1 GZ-80 AF350498 1 D1-hu-Yap-NllD27-2004 AB204803 1 D1-H-IMTSSA-98-606 AF298808 1 Mochizuki A6074760 1 D1,Myanmar.059-01 AY708047 1 D1.Myanmar.194-01 AY713474 1 D1.MVanmar.206-01 AY713475 1 D1.Myanmar.23819-96 AY722802 1 D1.Myanmar.305-01 AY713476 1 Dl.Myanmar.31459-98 AY726555 1 D1.Myanmar.31987-98 AY726554 1 D1.Myanmar.32514-98 AY722803

Serotype JStrain Accession No. I JDI.Myanmar.37726-01 AY726549 I JDl.Myanmar.38862-01 AY726550 1 1D1.Myanmar.40553-71 JAY 713473 I 1DI.Myanmar.40568-76 jAY722801 I 1D1.Myanmar.44168-01 AY726551 I I .Myanmar.44988-02 AY726552 I 1D1.Myanmar.49440-02 AY726553 1______rWestern Pacific-delta30 JAY145123 1______Western Pacific rDEN ImutF JAY145122 1 1S275-90 1A75711 I______D1-hu-Seycheles-NIID41-2003 IAB195673 1 1Singapore 8114-93 AY762084 1[Si gapore S275-90 IM87512 1 IThD1 0008 81 1AY732483 1tThDI 0049 01 IAY732482 ____I____ ThD1 0081 82 1AY732481 1 IThD1 0097 94 IAY732480 1_____ThD1 0102 01 1AY732479 1____ ThD1 0323 91 IAY732478 1 IThD1 0336 91 1AY732477 1____ ThD1 0442 80 [AY732476 I____ ThD1 0488 94 AY732475 I_____ ThD1 0673 80 AY732474 I _____Recombinant Western Pacific IAY145121 I_____ Nauru Island Western Pacific 45AZ5 INC 001477 _______I___1 _ INauru Island, Western Pacific Bethesda IU88535 I____ 1Nauru Island Western Pacific 45AZ5-PDK27IU88537 2 131 TAF100469 2 I16681 -PDK53 M84728 2 16681 Blok M84727 2 16681 Kinney U87411I _______________2______________ 43______AF204178__________ 2 ~ 44 AF204177 2 98900663 AB189122 2 98900665 AB 189123 2 2 98900666 BAO5i AB189124 IAY858035 i ________2 __ Banqkok 1974 IAJ487271 ______2____ BR64022 IAF489932 2 1C0166 IAF100463 2 1 C0167 1 AF100464 2 1C0371 AF100461 2 1C0390 AFi100462 2 1China 04 AF119661 2 lCubal 15-97 AY702036 2 1Cuba13-97 AY702034 2 Cubal65-97 AY702038 2 [Cuba2O5-97 AY702039 2 ICuba58-97 AY702035 2 [Cuba8g-97 AY702037 2 DR23-01 JABi22020 2 1DR31-01 JAB122021

Serotype Strain Accession No. 2 DR59-01 ABI 22022 2 FJ-1 0 AF276619 2 FJI11-99 AF359579 2 1348600 AY702040 2 IQT1797 AF100467 2 IQT2913 AF100468 2 Jamaica-NA1409 M20558 2 K0008 AF100459 2 K0010 AF100460- 2 Mara4 AF100466 2 DE N2-H- IMTSSA- MART- 98-703 AF208496 2 New Guinea C AF038403 2 NewGuinea C-PUO-218 hybrid AF038402 2 New Guinea-C M29095 2 PDK-53 U87412 2 SI vaccine NC 001474 2 TB16i AY858036-._ 2 ThD2 0017 98 DQ181799 2 ThD2 0026 88 DQ1 81802__ 2 ThD2 0038 74 DQ181806 2 2 2 jThD2 ThD2 0055 99 0078 01 ThD2 0168 79 DQ181798 DQ181797 DQ181805 2 ThD2 0263 95 DQ181800 2 1ThD2 0284 90 DQ181801 2 1ThD2 0433 85 DQ181803 2 1ThD2 0498 84 DQ181804 2 1ThNH-28-93 AF022435 2 IThNH29-93 AF169678 2 1ThNH36-93 AF169679 2 1ThNH45-93 AF16968d0 2 1ThNH-52-93 AF022436 Il 2 1ThNH54-93 AF169682 2 1ThNH55-93 AF169681 2 ~ ThNH62-93 AF169683 2 jThNH63-93 AF169684 2 ThNH69-93 AF169685 2 -ThNH73-93 AF169a6 2 1-]ThNH76-93 AF169687 2 IThNH81-93 AF169688 2 IThNH-p36-93 AF022441 2 IThNH-7-93 AF022434 2 ThNH-PI 1-93 AF022437 2 TThNH-P12-93 AF022438 2 IThNH~p14-93 AF022439 2 jThNH-p1 6-93 AF022440 2 JTonqa-74 AY744147 2 TSVO1 AY037116 2 ITaiwan-O008DH F AY776328 2 IVen2 AF100465 3 1D3-H-IMTSSA-MART-1999-1243 AY099337 3 JD3-H-IMTSSA-SRI-2000-1266 AY099336

Serotype Strain | Accession No. 3 80-2 AF317645 3 98901403 AB189125 3 98901437 AB189126 3 98901517 AB189127 3 98902890 AB189128 3 BA51 AY858037 3 BDH02-1 AY496871 3 BDH02-3 AY496873 3 BDH02-4 AY496874 3 BDH02-7 AY496877 3 BR74886-02 AY679147 3 C0331-94 AY876494 3 C0360-94 AY923865 3 den3 88 AY858038 3 den3 98 AY858039 3 FW01 AY858040 3 FW06 AY858041 3 H87 NC 001475 3 D3-Hu-TLO18NIID-2005 AB214879 3 D3-Hu-TL029NIID-2005 AB214880 3 D3-Hu-TL109NIID-2005 AB214881 3 D3-Hu-TL129NIID-2005 AB214882 3 InJ 16 82 DQ401690 3 KJ30i AY858042 3 KJ46 AY858043 3 KJ71 AY858044 3 mutant BDHO2 01 DQ401689 3 mutant BDHO2 03 DQ401691 3 mutant BDHO2 04 DQ401692 3 mutant BDHO2 07 DQ401693 3 mutant InJ 16 82 DQ401694 3 mutant PhMH J1 97 DQ401695 3 PF89-27643 AY744677 3 PF89-320219 AY744678 3 PF90-3050 AY744679 3 PF90-3056 AY744680 3 PF90-6056 AY744681 3 PF92-2956 AY744682 3 PF92-2986 AY744683 3 PH86 Ai858045 3 PhMH-J1-97 AY496879 3 P164 AY858046 3 Singapore AY662691 3 Singapore 8120-95 AY766104 3 Sleman-78 AY648961 3 TB16 A858047 3 TB551 AY858048 3 ThD3 0007 87 AY676353 3 ThD3 0010 87 A676353 3 ThD3 0055 93 AY676351 3 ThD3 0104 93 AY676350 3 ThD3 1283 98 AY676349

Serotype Strain Accession No. 3 ThD3 1687 98 Y676348 3 PF92-4190 AY744684 3 PF94-136116 AY744685 3 Taiwan-739079A AY776329 4 2A AF375822 4 Recombinant clone rDEN4 AF326825 4 2Adel30 AF326826 4 814669 AF326573 4 B5 AF289029 4 rDEN4del3O AF326827 4 H241 AY947539 | 4 rDEN4 NC 002640 I 4 Singapore 8976-95 AY762085 4 SW38i AY858050 4 ThD4 0017 97 AY618989 4 ThD4 0087 77 AY618991 4 ThD4 0348 91 AY618990 4 ThD4 0476 97 AY618988 4 ThD4 0485 01 AY618992 4 ThD4 0734 00 AY618993 4 Taiwan-2K0713 AY776330 4 Unknown M14931

Mutations can be made in the 3'-UTR of a wild type infectious clone, e.g., dengue

virus serotype 3, strain Sleman/78 or an infectious clone of another wild type, virulent dengue virus, and the mutants can then be tested in an animal model system (e.g., in mouse

and/or monkey model systems) to identify sites that cause attenuation. Attenuation is

judged by, for example, detection of decreased viremia. One or more additional mutations found to attenuate the wild-type virus are optionally introduced into a wild type dengue virus, and these mutants are tested in an animal model system (e.g., in a mouse and/or a monkey model system) to determine whether the resulting mutants are attenuated. Mutants

that are found to be attenuated can then be used as new vaccine strains that have increased safety, due to attenuation. In addition to the viruses listed above, dengue viruses including chimeric dengue

viruses that include one or more attenuating mutations are included in the invention. These chimeras can consist of a dengue virus of a first serotype (i.e., a background dengue virus) in which a structural protein (or proteins) has been replaced with a corresponding structural protein (or proteins) of a dengue virus of a second serotype. For example, the chimeras can

consist of a background dengue virus in which the prM and E proteins of the dengue virus of the first serotype have been replaced with the prM and E proteins of the dengue virus of the second serotype, The chimeric viruses can be made from any combination of dengue viruses of different serotypes. The dengue virus against which immunity is sought is the source of the inserted structural protein(s). As is noted above, mutations that are included in the viruses of the present invention are attenuating. These mutations are present in the dengue virus 3'-UTR structure to attenuate the virus. Mutations can be made in the3'-UTR using standard methods, such as site-directed mutagenesis. One example of the type of mutation present in the viruses of the invention is substitutions, but other types of mutations, such as deletions and insertions, can be used as well. In addition, as is noted above, the mutations can be present singly or in the context of one or more additional mutations. Referring to Figure 1, two approaches were taken to attenuate dengue virus. In one aspect, nucleotides additional to the A30 mutation were deleted from the 3'-UTR. In another aspect, the 3'-UTR of a dengue virus of a first serotype was replaced with the 3' UTR from a dengue virus of a second serotype (optionally containing the A30 mutation and nucleotides additional to the A30 mutation deleted from the 3'-UTR). Deletion of Nucleotides Additional to the A30 Mutation from the 3'-UTR Referring to Figures 2 - 5, using the first approach, the 3-UTR of dengue viruses contain various conserved sequence motifs. The sequence of the DEN4 3'-UTR is illustrated in Figure 5. The genome of DEN4 strain 814669 contains 10,646 nucleotides, of which the last 384 nt at the 3- terminus are untranslated (non-coding). The locations of various sequence components in this region are designated with the reverse-direction numbering system. These sequences include the 3' distal secondary structure (nt 1 to 93), predicted to form stem-loop 1 (SL-1), which contains terminal loop 1 (TL-1). Nucleotides 117 - 183 form stem-loop 2 (SL-2) which contains TL-2. Nucleotides 201 - 277 form a pair of stem-loops (SL-3) which in part contains TL-3. Although the primary sequence of stem loop I differs slightly among the dengue serotypes, the secondary structure is strictly conserved (compare Figures 2 - 5). Although the nucleotide spacing between SL-2 and neighboring SL-1 and SL-3 differ among the dengue virus serotypes, the overall structure of SL-2 is well-conserved, In addition, the exposed 9 nucleotides that comprise TL-2 are identical within all 4 dengue serotypes. it is TL-2 and its supporting stem structure that are removed by the A30 mutation (about nt 143 - 172). Removal of these 30 nucleotides results in formation of a new predicted structural element (SL-2A30) which has a primary sequence and secondary structure which is identical for each of the dengue virus serotypes (compare Figures 6 - 9).

Figures 10 - 13 illustrate the approach where nuclotides additional to the A30 mutation are deleted from the 3-UTR. The A30 mutation removes the TL-2 homologous structure in each of the dengue virus serotypes 1, 2, 3, and 4. The approach where nucleotides additional to the A30 mutation are deleted from the 3-UTR removes the TL-2 homologous structure and sequence up to and optionally including the TL-3 homologous structure so that the deletion extends as far as the 5' boundary of the TL-3 homologous structure in each of the dengue virus serotypes 1, 2, 3, and 4. In the approach illustrated in Figures 10 - 14, an additional deletion of about 31 nucleotides from TL-3 results in formation of a new predicted structural element (SL-3A31). Referring to Figures 14 - 17, the A86 mutation removes the TL-2 homologous structure and removes sequence up to the TL-3 homologous structure in each of the dengue virus serotypes DEN1, DEN2, DEN3 and DEN4. This deletion results in the formation of a new predicted structural element (SL-2A86). In some embodiments that involve deletion of nucleotides additional to the A30 mutation, nucleic acid deletions are made to the 3'-UTR structure of the dengue virus genome to attenuate the virus while maintaining its immunogenicity. The deletions include the A30 deletion (nt 173-143 of the serotype 3 Sleman/78 strain in an exemplary manner or corresponding thereto in other strains of DEN1, DEN2, DEN3, or DEN4; numbering is from the 3' end of the viral genome) in addition to deletion of additional 3'-UTR sequence that is contiguous or non-contiguous to the A30 deletion. The A30 deletion corresponds to the TL-2 structure of the 3'-UTR. One type of embodiment, termed rDENA30/31, rDEN2A30/31, rDEN3A30/31, or rDEN4A30/31 includes the original A30 deletion and a non-contiguous 31 nt deletion that removes both the original TL-2 and TL-3 structures. Another type of embodiment, termed rDENlA61, rDEN2A61, rDEN3A6], or rDEN4A61 includes the A30 deletion and deletion of 31 contiguous nucleotides extending 3' from the A30 deletion. Another type of embodiment, termed rDEN1A86, rDEN2A86, rDEN3A86, or rDEN4A86, includes the A30 deletion and deletion of 56 contiguous nucleotides extending 5' from the A30 deletion. For DEN3, a complete list of mutant viruses constructed to contain 3'-UTR deletion mutations is presented below in Table 2.

Replacement of the 3'-UTR of a Dengue Virus of a First Serotype with the 3'-UTR from a Dengue Virus of a Second Serotype Using the second approach, the 3'-UTR of rDEN3 may be replaced with the 3-UTR of rDEN4, optionally containing the A30 mutation and nucleotides additional to the A30 mutation deleted from the 3'- UTR. Other examples include replacement of the 3'-UTR of rDEN3 with the 3'-UTR of dengue virus serotypes 1 and 2, optionally containing the A30 mutation and nucleotides additional to the A30 mutation deleted from the 3'-UTR. Other examples include: replacement of the 3'-UTR of rDENI with the 3'-UTR of dengue virus serotypes 2, 3, and 4, optionally containing the A30 mutation and nucleotides additional to the A30 mutation deleted from the 3'-UTR; replacement of the 3'-UTR of rDEN2 with the 3'-UTR of dengue virus serotypes 1, 3. and 4, optionally containing the A30 mutation and nucleotides additional to the A30 mutation deleted from the 3'-UTR; and, replacement of the 3-UTR of rDEN4 with the 3'-UTR of dengue virus serotypes 1, 2, and 3, optionally containing the A30 mutation and nucleotides additional to the A30 mutation deleted from the 3'-UTR. Embodiments that involve replacement of the 3'-UTR of a dengue virus of a first serotype with the 3'-UTR of dengue virus of a second serotype include: a) rDEN1-3'D2, rDEN1-3'D2x, rDEN1-3'D3, rDEN1-3'D3x, rDEN1-3'D4, rDEN1 3'D4x; rDEN1/2-3'D, rDENI/2-3'Dix, rDENI/2-3'D3, rDEN1/2-3'D3x, rDENI/2-3'D4, rDEN1/2 3'D4x; rDENI/3-3'DI, rDENI/3-3'Dlx, rDEN1/3-3'D2, rDEN/3-3'D2x, rDEN1/3-3'D4, rDEN1/3 3'D4x; rDEN1/4-3'D1, rDEN1/4-3'Dlx, rDENI/4-3'D2, rDEN1/4-3'D2x, rDENI/4-3'D3, rDEN1/4 3'D3x; b) rDEN2-3'D1, rDEN2-3'D1x, rDEN2-3'D3, rDEN2-3D3x, rDEN2-3'D4, rDEN2 3'D4x; rDEN2/1-3'D2, rDEN2/1-3'D2x, rDEN2/1-3'D3, rDEN2/1-3'D3x, rDEN2/1-3'D4, rDEN2/1 3'D4x; rDEN2/3-3'D1, rDEN2/3-3'Dlx, rDEN2/3-3'D2, rDEN2/3-3'D2x, rDEN2/3-3'D4, rDEN2/3 3'D4x; rDEN2/4-3'D, rDEN2/4-3'DIx, rDEN2/4-3'D2, rDEN2/4-3'D2x, rDEN2/4-3'D3, rDEN2/4 3D3x; c) rDEN3-3'D1, rDEN3-3'Dlx, rDEN3-3'D2, rDEN3-3'D2x, rDEN3-3'D4, rDEN3 3'D4x; rDEN3/1-3'D2, rDEN3/1-3'D2x, rDEN3/1-3'D3, rDEN3/-3'D3x, rDEN3/1-3"D4, rDEN3/1 3'D4x; rDEN3/2-3'DI, rDEN3/2-3'D1x. rDEN3/2-3'D3, rDEN3/2-3'D3x, rDEN3/2-3'D4, rDEN3/2 3'D4x; rDEN3/4-3'DI, rDEN3/4-3'Dlx, rDEN3/4-3'D2, rDEN3/4-3'D2x, rDEN3/4-3'D3, rDEN3/4 3'D3x; and d) rDEN4-3'DI, rDEN4-3'Dlx, rDEN4-3'D2, rDEN4-3'D2x, rDEN4-3'D3, rDEN4 3'D3x; rDEN4/]-3'D2, rDEN4/-3'D2x, rDEN4/1-3'D3, rDEN4/1-3'D3x, rDEN4/1-3'D4, rDEN4/1 3'D4x; rDEN4/2-3'DI, rDEN4/2-3'Dlx, rDEN4/2-3'D3, rDEN4/2-3'D3x, rDEN4/2-3'D4, rDEN4/2 3'D4x; rDEN4/3-3'D1, rDEN4/3-3'Dlx, rDEN4/3-3'D2, rDEN4/3-3'D2x, rDEN4/3-3'D4, rDEN4/3 3'D4x; where x is a mutation listed in Table 2. Method of Making and Using Dengue or Chimeric Dengue Viruses The viruses (including chimeric viruses) of the present invention can be made using standard methods in the art. For example, an RNA molecule corresponding to the genome of a virus can be introduced into host cells, e.g., Vero cells, from which (or the supernatants of which) progeny virus can then be purified. In this method, a nucleic acid molecule (e.g., an RNA molecule) corresponding to the genome of a virus is introduced into the host cells, virus is harvested from the medium in which the cells have been cultured, and the virus is fonulated for the purposes of vaccination.

The viruses of the invention can be administered as primary prophylactic agents in adults or children at risk of infection, or can be used as secondary agents for treating

infected patients. For example, in the case of DEN virus and chimeric DEN viruses, the

vaccines can be used in adults or children at risk of DEN virus infection, or can be used as

secondary agents for treating DEN virus-infected patients. Examples of patients who can be treated using the DEN virus-related vaccines and methods of the invention include (i) children in areas in which DEN virus is endemic, (ii) foreign travelers, (iii) military personnel, and (iv) patients in areas of a DEN virus epidemic. Moreover, inhabitants of

regions into which the disease has been observed to be expanding (e.g., beyond Sri Lanka,

East Africa and Latin America), or regions in which it may be observed to expand in the future can be treated according to the invention. Formulation of the viruses of the invention can be carried out using methods that are standard in the art. Numerous pharmaceutically acceptable solutions for use in vaccine preparation are well known and can readily be adapted for use in the present invention by those of skill in this art (see, e.g., Remington's Pharmacutical Sciences (18th edition), ed. A. Gennaro, 1990, Mack Publishing Co., Easton, PA). The viruses can be diluted in a physiologically acceptable solution, such as sterile saline, sterile buffered saline, or L-15 medium. In another example, the viruses can be administered and formulated, for example, as a fluid harvested from cell cultures infected with dengue virus or chimeric dengue virus. The vaccines of the invention can be administered using methods that are well known in the art, and appropriate amounts of the vaccines administered can readily be determined by those of skill in the art. For example, the viruses of the invention can be formulated as sterile aqueous solutions containing between 102 and 107 infectious units (eg., plaque-forming units or tissue culture infectious doses) in a dose volume of 0.1 to 1.0 ml, to be administered by, for example, intramuscular, subcutaneous, or intradermal routes. Further, the vaccines of the invention can be administered in a single dose or, optionally, administration can involve the use of a priming dose followed by a booster dose that is administered, e.g., 2-6 months later, as determined to be appropriate by those of skill in the art. Optionally, adjuvants that are known to those skilled in the art can be used in the administration of the viruses of the invention. Adjuvants that can be used to enhance the immunogenicity of the viruses include, for example, liposomal formulations, synthetic adjuvants, such as (e.g., QS21), muramyl dipeptide, monophosphoryl lipid A, or polyphosphazine. Although these adjuvants are typically used to enhance immune responses to inactivated vaccines, they can also be used with live vaccines. Nucleic Acid Sequences Nucleic acid sequences of DEN viruses are useful for designing nucleic acid probes and primers for the detection of deletion or chimeric 3'-UTRs in a sample or specimen with high sensitivity and specificity. Probes or primers corresponding to deletion or chimeric 3' UTRs can be used to detect the presence of deletion or chimeric 3'-UTRs in general in the sample, to quantify the amount of deletion or chimeric 3'-UTRs in the sample, or to monitor the progress of therapies used to treat DEN virus infection. The nucleic acid and corresponding amino acid sequences are useful as laboratory tools to study the organisms and diseases and to develop therapies and treatments for the diseases. Nucleic acid probes and primers selectively hybridize with nucleic acid molecules encoding deletion or chimeric 3'-UTRs or complementary sequences thereof. By "selective" or "selectively" is meant a sequence which does not hybridize with other nucleic acids to prevent adequate detection of the deletion or chimeric 3-UTRs. Therefore, in the design of hybridizing nucleic acids, selectivity will depend upon the other components present in the sample. The hybridizing nucleic acid should have at least 70% complementarity with the segment of the nucleic acid to which it hybridizes. As used herein to describe nucleic acids, the term "selectively hybridizes" excludes the occasional randomly hybridizing nucleic acids, and thus has the same meaning as "specifically hybridizing." The selectively hybridizing nucleic acid probes and primers of this invention can have at least 70%, 80%, 85%, 90%, 95%, 97%, 98% and 99% complementarity with the segment of the sequence to which it hybridizes, preferably 85% or more. The present invention also contemplates sequences, probes and primers that selectively hybridize to the encoding nucleic acid or the complementary, or opposite, strand of the nucleic acid. Specific hybridization with nucleic acid can occur with minor modifications or substitutions in the nucleic acid, so long as functional species-species hybridization capability is maintained. By "probe" or "primer" is meant nucleic acid sequences that can be used as probes or primers for selective hybridization with complementary nucleic acid sequences for their detection or amplification, which probes or primers can vary in length forn about 5 to 100 nucleotides, or preferably from about 10 to

50 nucleotides, or most preferably about 18-24 nucleotides. Isolated nucleic acids are provided herein that selectively hybridize with the species-specific nucleic acids under stringent conditions and should have at least five nucleotides complementary to the sequence of interest as described in Molecular Cloning: A Laboratory Manual, 2"d ed., Sambrook, Fritsch and Maniatis, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1989. If used as primers, the composition preferably includes at least two nucleic acid molecules which hybridize to different regions of the target molecule so as to amplify a desired region. Depending on the length of the probe or primer, the target region can range between 70% complementary bases and full complementarity and still hybridize under stringent conditions. For example, for the purpose of detecting the presence of deletion or chimeric 3'-UTRs, the degree of complementarity between the hybridizing nucleic acid (probe or primer) and the sequence to which it hybridizes is atleast enough to distinguish hybridization with a nucleic acid from other organisms. The nucleic acid sequences of the invention include a diagnostic probe that serves to report the detection of a cDNA amplicon amplified from the viral genomic RNA template by using a reverse-transcription/polymerase chain reaction (RT-PCR), as well as forward and reverse amplimers that are designed to amplify the cDNA amplicon. In certain instances, one of the amplimers is designed to contain a vaccine virus-specific mutation at the 3'-terminal end of the amplimer, which effectively makes the test even more specific Ibr the vaccine strain because extension of the primer at the target site, and consequently amplification, will occur only if the viral RNA template contains that specific mutation. Automated PCR-based nucleic acid sequence detection systems have been recently developed. TaqMan assay (Applied Biosystems) is widely used. A more recently developed strategy for diagnostic genetic testing makes use of molecular beacons (Tyagi and Kramer 1996 Nature Biotechnology 14:303-308). Molecular beacon assays employ quencher and reporter dyes that differ from those used in the TaqMan assay. These and other detection systems may be used by one skilled in the art. Dengue virus type 3 (DEN3) vaccine components generated by introduction of deletions in the 3' untranslated region (UTR) or exchange of the DEN3 3'-UTR with that of DEN4 There are four dengue virus serotypes (DENI, DEN2, DEN3, and DEN4) which circulate in tropical and subtropical regions of the world inhabited by more than 2.5 billion people (Gubler DJ 1998 Clin Microbiol Rev 11:480-496). DEN viruses are endemic in at least 100 countries and cause more human disease than any other arbovirus. Annually, there are an estimated 50-100 million dengue infections and hundreds of thousands of cases of dengue hemorrhagic fever/ shock syndrome (DHF/DSS), with children bearing much of the disease burden (Gubler DJ and Meltzer M 1999 Adv Virus Res 53:35-70). DHF/DSS remains a leading cause of hospitalization and death of children in at least eight southeast Asian countries (World Health Organization 1997 Dengue Haemorrhagic Fever: Diagnosis, Treatment, Prevention and Control, 2 "dedition, WHO, Geneva). The dramatic increase in both the incidence and severity of disease caused by the four DEN serotypes over the past two decades is due in large part to the geographic expansion of the mosquito vectors, Aedes aegypti and Aedes albopictus, and the increased prevalence of the four DEN serotypes (Gubler DJ 1998 Clin Microbiol Rev 11:480-496). The dengue viruses are maintained in a life cycle oftransmission from mosquito to human to mosquito with no other apparent viral reservoir participating in this life cycle in urban settings (Rice CM, 1996 in Flaviviridae: The viruses and their replication, Fields BN, Knipe DM, Howley PM, Chanock RM, Melnick JL, Monath TP, Roizman B, Straus SE, eds. Fields Virology. Philadelphia: S Lippincott-Raven Publishers, pp. 931-959). The DEN viruses, members of the Flaviviridae family, have spherical virions of approximately 40 to 60 nm which contain a single-stranded positive-sense RNA genome. A single polypeptide is co-translationally processed by viral and cellular proteases generating three structural proteins (capsid C, membrane M, and envelope E) and at least seven non-structural (NS) proteins. The genome organization of the DEN viruses is 5 UTR-C-prM-E-NSI-NS2A-NS2B-NS3-NS4A-NS4B-NS5-UTR-3' (UTR-untranslated region, prM-membrane precursor) (Rice CM, 1996 in Flaviviridae: The viruses and their replication, Fields BN, Knipe DM, Howley PM, Chanock RM, Melnick JL, Monath TP, Roizman B, Straus SE, eds. Fields Virology. Philadelphia: Lippincott-Raven Publishers, pp. 931-959). In response to the increasing incidence and severity of DEN infection, development of vaccines is being pursued to prevent DEN virus disease. An economical vaccine that prevents disease caused by the DEN viruses has become a global public health priority. The cost-effectiveness, safety, and long-tern efficacy associated with the live attenuated vaccine against yellow fever (YF) virus, another mosquito-borne flavivirus, serves as a model for the feasibility of developing of a live attenuated DEN virus vaccine (Monath TP, 1999 in Yellow fever, Plotkin SA, Orenstein WA, eds. Vaccines, Philadelphia: W.B. Saunders Co., 815-879). Additionally, an effective live attenuated Japanese encephalitis (JE) virus vaccine is used in Asia, and inactivated virus vaccines are available for JE and tick-borne encephalitis virus. The need for a vaccine against the DEN viruses is mounting, and, despite much effort, the goal of developing a safe and efficacious DEN virus vaccine has yet to be attained. An effective DEN virus vaccine must confer protection from each serotype because all four serotypes commonly circulate in endemic regions and secondary infection with a heterologous serotype is associated with increased disease severity. We have employed two strategies for generating live attenuated vaccine components against each serotype that can then be combined into tetravalent formulations (Blaney JE et a]. 2006 Viral Immunol. 19:10-32). First, reverse genetics has been used to introduce an attenuating 30 nucleotide deletion (A30) mutation into the 3'-UTR of cDNA clones of each

DEN serotype (Durbin, AP et a]. 2001 Am J Trop Med Hvg 65:405-413; Whitehead SS et al. 2003 J Virol 77:1653-1657; Blaney JE et al. 2004 Am J Trop Med Hyg 71:811-821; Blaney JE et al 2004 BMCnfDis 4:39). Initially, the rDEN430 vaccine component was found to be attenuated in rhesus monkeys (Table 1) and phase I/II clinical trials in humans have demonstrated that virus infection results in low viremia, is strongly immunogenic, and exhibits minimal reactogenicity with no observation of serious adverse events (Durbin, A. P. et al. 2001 Am J Trop Med Hyg 65:405-413; Durbin et al. 2005 J lnfDis 191:710-718). Recently, the rDENIA30 vaccine component, which was also attenuated in rhesus monkeys (Table 1), has been found to share a similar phenotype in clinical trials as that observed for rDEN4A30; low viremia, strong immunogenicity, and minimal reactogenicity in 20 volunteers (Whitehead SS et al. 2003 J Virol 77:1653-1657; Blaney JE et al. 2006 Viral Immunol. 19:10-32). Unfortunately, the rDEN2A30 and rDEN3A30 vaccine components did not appear to be satisfactorily attenuated in rhesus monkeys during pre-clinical testing and there is no plan to test these in humans (Table 1) (Blaney JE et al. 2004 Am J Trop Med Hyg 71:811-821; Blaney JE et al. 2004 BMC Inf Dis 4:39). Consequently, an alternative strategy for vaccine development has been generation of antigenic chimeric viruses by replacement of structural proteins of the attenuated rDEN4A30 vaccine component with those from DEN2 or DEN3 yielding the rDEN2/4A30 and rDEN3/4A30 vaccine components, respectively (Whitehead SS et al. 2003 Vaccine 23:4307-4316; Blaney JE et al. 2004 Am J Trop Med Hyg 71:811-821). TherDEN2/4A30 vaccine virus has been tested in humans and appears safe and strongly immunogenic, while clinical evaluation of the rDEN3/4A30 virus is currently planned.

Table 1. Effects of theA30 mutation on the four DEN serotypes in rhesus monkeys

Vireniaa Geometric Virus %of Mean no. of Mean peak mean vireuic viremic virus titer neutralizing Reference Monkeys days per (logOPFU/nil antibody titerb monkey ±SE) rDEN1 100 2.8 2.1* 0.1 1,230 Whitehead et a]. J. Virol, 2003, rDEN1A30 50 0.5 0.8 * 0.1 780 77:1653

rDEN2 100 4.0 1.9 * 0.1 173 Blaney eta]. BMC Inf rDEN2A30 100 2.8 1.7* 0.2 91 Dis., 2004, 4:39

rDEN3 100 2.3 1.4* 0.2 363 Blaney et al. Am. 3. Trop. Med. Hyg., rDEN3A30 100 2.0 1.5* 0.2 265 2004, 71:811

rDEN4 100 3.0 2.2*0.2 322 Hanley et al. Vaccine, 2004, rDEN4A30 100 2.0 1.4 0.2 154 22:3440 a Groups of rhesus monkeys were inoculated subcutaneously with 5.0 logo PFU of the indicated virus in a Iml dose. Serum was collected daily for 10 days. Virus titer in serum was detennined by plaque assay in Vero cells. b Plaque reduction (60%) neutralizing antibody titers were detennined on day 28 serum using indicated wild type virus. Reciprocal dilution of geometric mean is indicated.

Here, we describe novel vaccine components for the DEN3 serotype generated by genetic modification of the 3'-UTR of the DEN3 cDNA clone (Blaney JE et al. 2004 Am J Trop Med Hyg 71:811-821). Development of these DEN3 vaccine components, which possess the full complement of wild type DEN3 proteins, is important for two reasons. First, the present vaccine component for DEN3, rDEN3/4A30, may be found to be under- or over-attenuated in clinical trials. Second, an optimal vaccine for conferring protection from disease caused by DEN3 may require induction of T cell responses against the entire set of DEN3 proteins, rather than just the M and E which are the only DEN3 sequences present in the rDEN3/4A30 chimeric virus. To generate additional DEN3 vaccine components, novel deletions which encompass or border the A30 deletion in the 3'-UTR were introduced into the rDEN3 cDNA clone. Alternatively, the 3'-UTR of the rDEN3 cDNA clone was replaced with that of rDEN4 or rDEN430. Viable viruses were analyzed for attenuation phenotypes in tissue culture, SCID mice transplanted with HuH-7 cells, and rhesus monkeys. Three mutant viruses (rDEN3A30/31, rDEN3686, and rDEN3-3'D4A30) have preclinical phenotypes which suggest they maybe safe and immunogenic in humans.

Generation of rDEN3 deletion mutants We sought to generate expanded deletion mutations which include the original A30 (nt 173-143) mutation. Table 2 lists seven deletion mutations which encompass the original A30 mutation including A50, A61, A80, A86, A16A, A116B, and A146. In addition, the A30/31 mutation includes the original A30 mutation and a non-contiguous 31 nt deletion. The L\31 mutation was also generated alone to discern the contribution of either A30 or A31 in the combined A30/31 deletion mutation. The location of bordering nucleotides of deletions in the predicted secondary structure of the DEN3 3'-UTR are indicated in Figure 4. In addition, the predicted secondary structure of the DEN3 3-UTR for rDEN3A30, rDEN330/31, and rDEN3A86 are indicated in Figures 8, 12, and 16, respectively. Table 2. Deletion mutations created in the 3-UTR of DEN3 Sleman/78 Mutation Deleted nucleotidesa Deletion junction A30 173-143 -CCAAAGACU A31 258-228 -CUGCAGACU A50 192- 143 -CACAAGACU A61 173- 113 -CCGAAUAAA A80 192-113 -CACAAUAAA A86 228-143 -UAGCAGACU Al16 (A) 228-113 -UAGCAUAAA A116 (B) 258- 143 -CUGCAGACU A]46 258-113 -CUGCAUAAA A30/31 173-143 -CCAAAGACU 258-228 -CUGCAGACU Numbering is from the 3'-end of viral genome

PCR mutagenesis was used to introduce the nine new deletion mutations into the DEN3 Sleman/78 cDNA plasmid, p3, which was previously used to generate the rDEN3A30 vaccine component (Blaney JE et al. 2004 Am J Trop Med Hyg 71:811-821). The p3-frag.4 cDNA subclone was used as the template for PCR reactions with indicated pairs of mutagenic oligonucleotides listed in Table 3, except for the A30/31 deletion mutation which used p3-frag.4A30 cDNA subclone as a template. PCR products were ligated and used to transform competent bacterial cells. Plasmid DNA was isolated fiom bacterial clones and the presence of the appropriate deletion mutation was confirmed by sequence analysis. To generate intact DEN3 cDNA plasmids containing the deletion mutations, the Kpn]-PstI fragment (963 nt) from the mutated p3-frag.4 cDNA subclones were introduced into the p3-7164 cDNA plasmid. The p3-7164 plasmid encodes the 7164 Vero cell adaptation mutation which had previously been shown to enhance growth and transfection efficiencyin Vero cells (Blaney JE et al. 2004 Am J Trop Med Hyg 71:811 821). Full length p3 plasmids containing the deletion mutations were confirmed to ontain the correct 3'-UTR sequence. Mutations in addition to the engineered deletions were identified in the rDEN3A30/31 and rDEN386 viruses when compared to the DEN3 p3 plasmid cDNA (Genbank # AY656169) (Table 4). Table 3. Mutagenic primer sequences for construction of 3'-UTR deletions

Primer name Sequence (5'->3') 113F TAAAAACAGCATATTGACGCTGGGAG (SEQ ID NO: 24) 143F GACTAGAGGTTAGAGGAGAC (SEQ ID NO: 25) 228F GACTAGCGGTTAGAGGAGACCCC (SEQ ID NO: 26) 173R TCGGGCCCCGCTGCTGCGTTG (SEQ ID NO: 27) 173R (for A30) TTGGGCCCCGCTGCTGCGTTG (SEQ ID NO: 28) 192R TGTGTCATGGGAGGGGTCTC (SEQ ID NO: 29) 228R GCTACACCGTGCGTACAGCTTCC (SEQ ID NO: 30) 258R GCAGCCTCCCAGGTTTTACGTCC (SEQ ID NO: 31)

Table 4. Mutations in addition to the engineered deletions that were identified in the rDEN3A30/31 and rDEN386 viruses when compared to the DEN3 p3 plasmid cDNA (Genbank #AY656169)

Gene Nucleotide Nucleotide Amino acid Amino acid Virus position substitution position change rDEN3A30/31 NS4B 7164" U -C 115 Val - Ala NS4B 7398 C-+ U 193 Ala-+ Val

rDEN3A86 M 512 A4G 26 Lys -Glu NS3 6076 C -U 521 silent NS4B 7164a U -C 115 Val - Ala NS5 8623 U-+ C 353 silent NS5 10 2 6 7b A4U END end - Tyr 3'-UTR 10455 G >C

SThe 7164 mutation is a Vero cell adaptation mutation which was engineered into the cDNA construct. b There is a mixed population at this nt position (A-)A/U) that changes the stop codon (UAA) at the end of NS5 to UAU which encodes Tyr. This would serve to extend NS5 by 2 amino acids (Tyr-Thr-End) because a stop codon remains atnts 10271-10273.

For recovery of viruses, 5'-capped RNA transcripts were synthesized in vitro from cDNA plasmids and transfected into either Vero cells or C6/36 cells. Prior to transcription and generation of infectious virus, the tinker sequences were removed from cDNA plasmids by digestion with Spel. Plasmids were then recircularized by ligation, linearized with Acc651 (isoschizomer of Kpnl which cleaves leaving only a single 3' nucleotide), and transcribed in vitro using SF6 polymerase. Purified transcripts were then transfected into Vero or C6/36 cells. Recombinant viruses encoding each of the nine mutations, A30/31, A31, A50, A61, A80, A86, Al16A, Al16B, and A146, were successfully recovered in C6/36 cells, while only rDENA31 was recovered in Vero cells. The rDEN3 deletion mutant viruses were then passaged once in Vero cells followed by biological cloning by two terminal dilutions in Vero cells. Cloned viruses were then passaged two to seven times in Vero cells in an attempt to reach a stock titer of at least 6.0 logioPFU/ml which is considered sufficient to allow for cost-effective manufacture. Three recombinant viruses (rDEN3A50, rDEN3A16A, and rDEN3AI46) were found to be excessively restricted for replication in Vero cells, despite being viable. Therefore, these three viruses were not studied further. The genetic sequence of the 3'-UTR was determined for the six remaining deletion mutant viruses that reached peak virus titers of at least 6.0 ogIoPFU/ml. The correct 3'-UTR sequence with the appropriate deletion was found for rDEN361, rDEN380, rDEN3A86 and rDEN3A30/31. However, two mutant viruses were found to contain additional deletions or mutations and were deemed to potentially have unstable genotypes. First, rDEN331 had the correct 3'-UTR deletion of nt 258-228 but also contained a 25 nt deletion of nt 222-198. Second, rDEN3AI 16B had the correct 3'-UTR deletion of nt 258 143 but also contained a 8 nt deletion of nt 430-423 and a single A->G substitution at nt 265. The potential of genetic instability with these viruses precludes their use as vaccine components so they were not further studied. Therefore, of the nine original deletions constructed, four mutant viruses were found to replicate efficiently in Vero cells and were studied further; rDEN3A61, rDEN3A80, rDEN3A86 and rDEN3A30/31. Generation of rDEN3 chimeric viruses with the 3'-UTR derived from rDEN4 or rDEN4A30 Another strategy was employed to generate novel rDEN3 vaccine components; replacement of the 3'-UTR of the rDEN3 cDNA clone with that of rDEN4 or rDEN4A30 (Figure 18A). The 3'-UTR chimeric virus, rDEN3-3'D4A30, was designed to be a vaccine component for inclusion in tetravalent formulations which share the A30 deletion mutation among all four serotypes. The rDEN3-3D4 virus was designed to discern the contribution of the 3'-UTR chimerization and the A30 mutation to any observed phenotypes. The p3-3'D4A30 plasmid was generated as follows. First, PCR mutagenesis was used to introduce a Hpal restriction site into the p3-frag.4 cDNA subclone (Figure 18B). PCR products were ligated and used to transform competent bacteria] cells. Plasmid DNA was isolated from bacterial clones and the presence of the appropriate deletion mutation was confirmed by sequence analysis. To introduce the rDEN4A30 3'-UTR into the p3 frag.4(HpaI) cDNA subclone, a 364 nt fragment encompassing the p4A30 3'-UTR was amplified by PCR using a forward primer (5 AACAACAACAAACACCAAAGGCTATTG-3', SEQ ID NO: 32) and reverse primer (5'-CCTACCGGTACCAGAACCTGTTG-3', SEQ ID NO: 33). To generate the p3 frag.4-3'D4A30 cDNA subelone, the Hpal-KpnI fragment was removed from p3 frag.4(Hpal) and replaced with the p4A30 3-UTR PCR fragment which had been cleaved by KpnI. The Pstl-Kpnl fragment of p3-frag.4-3D4A30 was introduced into the p3 plasmid to make the full length cDNA clone, p3-3'D4A30. The sequence of the 3'-UTR and NS5 junction were confirmed to be correct. To generate p3-3'D4, the 30 deleted nucleotides of the A30 deletion mutation were introduced into the p3-frag.4-3'D4A30 subclone. Briefly, the Mlul-Kpnl fragment of p3 frag.4-3'D4A30, which encompasses the A30 region, was replaced with the corresponding fragment of p4 to make the plasmid, p3-frag.4-3'D4. To generate a full length p3 genome, the Pstl-Kpnl fragment of p3 was replaced withthe corresponding fragment of p3-frag.4 3'D4. The 3'-UTR sequence of the p3-3'D4 plasmid was determined to be correct and contained the missing 30 nt of theA30mutation. For recovery of viruses, 5'-capped RNA transcripts were synthesized in vitro from cDNA plasmids and transfected into either Vero cells or C6/36 cells. Prior to transcription and generation of infectious virus, the linker sequences were removed from cDNA plasmids by digestion with Spel. Plasmids were then recircularized by ligation, linearized with Acc651 (isoschizomer of Kpn] which cleaves leaving only a single 3' nucleotide), and transcribed in vitro using SP6 polymerase. Purified transcripts were then transfected into Vero or C6/36 cells. rDEN3-3'D4 was recovered in C6/36 cells and Vero cells, while rDEN3-3'D4A30 could only be recovered in Vero cells. Mutant viruses were then passaged once in Vero cells followed by biological cloning by two terminal dilutions in Vero cells. rDEN3-3'D4 and rDEN3-3'D4A30 were then passaged four or six times in Vero cells, respectively. The genetic sequence of the NS5 - 3'-UTR junction and 3'-UTR was found to be correct for rDEN3-3'D4 and rDEN3-3'D4A30. Therefore, both viruses were studied further. Mutations were also identified in the rDEN3-3"D4A30 virus compared to the DEN3 p3 plasmid cDNA clone (5'-UTR and genes) and DEN4 p4 cDNA clone (3'-UTR) (Table 5). Table 5. Mutations in the rDEN3-3D4A30 virus compared to the DEN3 p3 plasmid cDNA clone (5'-UTR and genes) and DEN4 p4 cDNA clone (3'-UTR)

Virus Gene Nucleotide Nucleotide Amino acid Amino acid position substitution position change rDEN3-3'D4A30 C 250 U-+ C 52 silent NS3 5899 U-+ C 462 silent NS4Ba 7164 U -C 115 Val ]Ala 3'UTR 10534 A- G " The 7164 mutation is a Vero cell adaptation mutation which was engineered into the cDNA construct. Replication of DEN3 mutant viruses in SCID-HuH-7 mice The four deletion mutant viruses (rDEN3A30/31, rDEN3A61, rDEN3A80, and rDEN3A86) which were found to replicate to high titer in Vero cells and were confirmed to have the correct 3'-UTR sequence and the rDEN3-3'D4 and rDEN3-3'D4A30 viruses were first evaluated in SCID-HuH-7 mice. The rDEN3-3'D4 and rDEN3-3'D4A30 were compared to determine the effect on replication of the 3'-UTR chimerization and any further attenuation conferred by the A30 mutation. SCID-HuH-7 mice contain solid tumors of the HuH-7 human hepatoma cell line, and analysis of virus replication in this mouse model serves as a surrogate for DEN virus replication in the human liver. Numerous DEN virus mutant viruses have been identified by evaluation in SCID-HuH-7 mice (Blaney JE et al. 2002 Virology 300:125-139; Hanley et al. 2004 Vaccine 22:3440-3448; Blaney JE et al. 2006 Virallinmunol. 19:10-32). This mouse model provided the original evidence that the rDEN3A30 virus was not attenuated compared to parent virus rDEN3, while the antigenic chimeric virus, rDEN3/4A30, was approximately 100-fold restricted in replication in the SCID-HuH-7 mice when compared to wild type parent viruses (Blaney JE et al. 2004 Am J Trop Med Hyg 71:811-821).

For analysis of virus replication in SCID-HuH-7 mice, four to six week-old SCID mice (Tac:Icr:Ha(ICR)-Prkdc'id) (Taconic Farms) were injected intraperitoneally with 0.1 mL phosphate-buffered saline containing 107 HuH-7 cells which had been propagated in tissue culture. Tumors were detected in the peritoneum five to six weeks after transplantation, and tumor-bearing mice were infected by direct inoculation into the tumor with 104 PFU of virus in 50 p Opti-MEM 1. Serum was collected from infected mice on day 7 post-infection and frozen at -80°C. The virus titer was determined by plaque assay in Vero cells. As indicated in Table 6, wild type DEN3 Sleman/78 replicated to a mean peak virus titer of nearly 106.9 PFU/ml. Although a decreased level of replication was observed for each of the six mutant viruses, the differences in replication were not statistically significant. However, rDEN3A86 and rDEN3-3'D4A30 were more than 10-fold restricted in replication compared to wild type DEN3 virus, while the replication of rDEN3A30/31 was slightly less than 10-fold restricted. On the basis of this arbitrary cut-off, these three viruses were selected for further evaluation. It is important to note that the rDEN4A30 virus which has a well-characterized, attenuation and non-reactogenic phenotype in humans was found to be only 6-fold restricted in replication in SCID-HuH -7 mice compared to wild type rDEN4 virus (Hanley et al. 2004 Vaccine 22:3440-3448). Table 6. Replication of mutant DEN3 viruses in HuH-7-SCID mice.

No. of Mean peak Fold-reduction Virus Mice virus titer compared to i(logiopfulml ± SE) DEN3 (Sleman/78) DEN3 (Sleman/78) 8 6.9 ±0.1 rDEN3A30/31 8 6.0 ± 0.3 8 rDEN3A61 9 6.3 ± 0.2 4 rDEN3A80 9 6.3 ±0.3 4 rDEN3A86 10 5.6 ± 0.4 20 rDEN3-3'D4 11 6.5 0.4 3 rDEN3-3'D4A30 9 5.7 0.2 16

'Groups of HuH-7-SCID mice were inoculated into the tumor with 4.0 logo PFU of the indicated virus. Serum was collected on day 7 and virus titer was determined in Vero cells.

Because the rDEN3-3'D4A30 virus and the rDEN3A30/31 and rDEN3A86 viruses encode the full set of DEN3 structural and non-structural proteins, they would be expected to induce the full complement of humoral and cellular immunity. This more complete immune induction would be advantageous compared to that induced by the chimeric rDEN3/4A30, which encodes only the structural proteins of DEN3.

Replication of DEN3 mutant viruses in tissue culture The level of virus replication in Vero cells and mosquito C6/36 cells was assessed for the rDEN3A30/31 and rDEN3A86 deletion mutant viruses and the rDEN3-3'D4 viruses with and without A30. Replication in Vero cells was analyzed because these cells are the substrate for manufacture, while growth in C6/36 cells was assessed because attenuation phenotypes in these mosquito cells may be associated with restricted replication in Aedes mosquitoes which serve as the vector for DEN virus transmission (Hanley et a]. 2003 Virology 312:222-232). Growth kinetics were evaluated as follows. Confluent monolayers ofVero cells and C6/36 cells in 75 cm2 flasks were infected at a multiplicity of infection of 0.01. Aliquots of 0.5 ml tissue culture supernatant were removed daily for seven days, combined with SPG stabilizer, and frozen at -80°C. Virus titer of all samples was determined by plaque assay in Vero cells. Thelimit of detection fortheplaque assay is 1.0 logioPFU/ml. The replication kinetics of each virus in both cell lines is shown in Figure 19. In Vero cells, rDEN3630/3, rDEN386, and rDEN3-3'D4A30 replicated to a peak level that approximated that of wild type rDEN3 and with similar kinetics to that of wild type rDEN3. These three vaccine components reached peak virus titers of 6.5 to 6.7 logioPFU/ml which demonstrates the feasibility of manufacture for each of these viruses. In Vero cells, the rDEN3-3'D4 virus replicated to a peak titer of 7.8 logoPFU/ml which is nearly 100-fold higher than that observed for wild type rDEN3 indicating that inclusion of the DEN4 3' UTR may augment replication in Vero cells. This could also be attributed to more efficient Vero cell adaptation of the rDEN3-3'D4 virus. rDEN4 replicates to a peak titer of approximately 8.0 logiPFU/ml which indicates that the chimeric virus achieves a peak titer that does not exceed that of either of its parent viruses (Blaney JE et al. 2006 Viral 1mmunol.19:10-32). Analysis of virus replication in C6/36 cells demonstrated that rDEN3A86 and rDEN3-3'D4A30 reached peak titers approximately 10-fold lower than the peak virus titer of wild type rDEN3 virus, 6.9 logoPFU/ml (Figure 19). The rDEN3-3'D4 virus replicated to a peak titer similar to that observed for wild type rDEN3. The most striking result was the lack of replication observed in C6/36 cells for the rDEN3A30/31 virus. After day 1, virus was not detected in culture medium fiom C6/36 cells infected with rDEN330/31 virus despite the efficient replication observed in Vero cells. These results were confirmed in a second independent growth curve experiment and indicate a host range attenuation phenotype in tissue culture which is envisioned as being accompanied by an attenuation phenotype in mosquitoes as well. Replication and immunogenicity of DEN3 mutant viruses in rhesus monkeys Based on the slight attenuation in SCID-Hu-1-7 mice and efficient growth in Vero cells, rDEN3A30/31, rDEN3A86, and rDEN3-3'D4A30 were evaluated in rhesus monkeys. The mutant viruses were compared with wild type DEN3 for level and duration of viremia, neutralizing antibody induction, and the ability to confer protection from wild type DEN3 virus challenge. The rDEN3-3'D4 virus was also evaluated to discern the contribution of the 3'-UTR chimerization upon attenuation with and without the A30 mutation. An attenuation phenotype in rhesus monkeys has generally been a strong predictor of safety for vaccine components in clinical trials including rDEN4A30, rDENIA30, and rDEN2/4A30 (Blaney JE et al. 2006 Viral Immunol. 19:10-32). Groups of four rhesus monkeys were inoculated subcutaneously with 105 PFU of the indicated viruses (Table 7). Two monkeys were mock infected with virus diluent. For detection of viremia, serum was collected on days 0-8 and on day 10 and frozen at -80°C. Virus titer in serum samples was determined by plaque assay in Vero cells. Serum was collected on day 28 for detection of neutralizing antibodies directed against DEN3. Levels of neutralizing antibodies were determined using a plaque reduction neutralization assay in Vero cells against wild type DEN3 virus. On day 35 post-infection, all monkeys were challenged by subcutaneous infection with 105 PFU DEN3 wild type virus. Serum was collected on days 0-8 and on day 10 and frozen at -80°C. Virustiterin serum samples was determined by plaque assay in Vero cells.

WO 2008/022196 PCT/US2007/07600(4

+1 oo

-4 -; +1 VD V V V V 00 C

V3 000 00

00

o o000

o). 0o

i>~'22'2'22'2 V3 0 nVv du1

+1n 00

a> > 00

00 00 J >, O

cd u~ cd 01C

V3V .90 >N ,

0 -0

00

tU Hn>= tjV3

00 c) 0

28 k

Wild type DEN3 Sleman/78 virus replicated in rhesus monkeys to a mean peak virus titer of 1.8 logoPFU/ml serum with all monkeys developing viremia (Table 7). These results parallel previous studies of DEN3 in rhesus monkeys (Blaney JE et al. 2004 Am J Trop Med Hyg 71:811-821). No viremia was detected in any monkey infected with any of the three vaccine components, rDEN3A30/31, rDEN3A86, or rDEN3-3'D4A30 demonstrating a clear attenuation phenotype for each of these viruses in rhesus monkeys. Interestingly, the rDEN3-3'D4 virus was detected in 75% of monkeys with a mean peak virus titer of 1.3 logioPFU/ml serum suggesting that the presence of the A30 mutation is critical for attenuation of the 3'-UTR chimeric virus. Despite the lack of detectable viremia, mean neutralizing antibody levels in monkeys infected with rDEN3A30/31 and rDEN3A86 reached levels similar to that of wild type DEN3 virus, 1:253 (Table 7). In contrast, the rDEN3-3'D4A30 virus induced mean neutralizing antibody levels approximately three-fold lower than DEN3. However, 100% ofmonkeys immunized with each vaccine component seroconverted as defined by a four-fold or greater rise in serum neutralizing antibody levels after infection. Thus all monkeys were deemed to be infected by each of the vaccine components despite the lack of detectable viremia. Determination of virus titer in serum after challenge with DEN3 virus indicated that immunization with each of the vaccine components induced complete protection from detectable viremia as would be expected given the observed neutralizing antibody levels. Replication in mosquitoes. Replication of rDEN3 and rDEN3A30/31 was studied in Toxorynchites amboinenesis mosquitoes. Intrathoracic inoculation of serial ten-fold dilutions of test virus was perfonred as described previously (Troyer J.M. e al. 2001 Am. J. Trop. Med. Hyg. 65:414-9). After a 14 day incubation, heads were separated and homogenized in diluent. Virus titer in head homogenates was determined by plaque assay in Vero cells. Based on the attenuation of rDEN3A30/31 in rhesus monkeys and its restricted replication in C6/36 mosquito cells, rDENA30/31 was compared to wild type rDEN3 for infectivity and level of replication in highly sensitive Toxorynchites amboinensis mosquitoes (Table 8). Ten-fold serial dilutions of virus were inoculated intrathoracically, and the ability to infect head tissues was evaluated by performing a plaque assay on mosquito head homogenates after a 14 day incubation. The infectivity of rDEN3 and rDENA30/31 was very similar as the 50% mosquito infectious dose was approximately 3 101 PFU for both viruses (Table 8). However, the level of replication of rDENA30/31 in the heads of infected mosquitoes was about 5- to 50-fold reduced. This reduction was significant at the 102. and 10" PFU doses tested. This finding indicates that although rDENA30/31 has infectivity for Toxorynchites by intrathoracic infection similar to that of wild type rDEN3, there is a statistically significant restriction in the level of replication in mosquitoes afforded by theA 30/31 mutation. Table 8. Replication of rDEN3 and rDEN3A30/31 in Toxorynchites amboinensis

Dosea No / Mean virus Reduction (logIO) Virus (log.oPFU) tested infected titer compared to same (logioPFU/head) dose of wt virus rDEN3 wt 2.3 20 90 4.2 ± 0.]d 1.3 19 53 4.2± 0.1 0.3 17 18 4.3 ± 0.3

rDEN3A30/31 2.3 12 83 2.7 03d 1.5 1.3 16 44 3.1+ 0.3 1.1 0.3 8 13 3.6 0.0 0.7

a Virus titer administered intrathoracically in a 0.2[l inocuhim. b Percentage of mosquitoes with detectable virus at day 14 post-inoculation was determined by plaque assay on mosquito head homogenates in Vero cells . Calculated using only values of virus-positive heads. d For 103 PFU dose of rDEN3 and rDEN3A30/31, mean virus titers were significantly different as determined by a Tukey-Kramer post-hoc test (P < 0.001). e For 10 1PFU dose of rDEN3 and rDEN3A30/31, mean virus titers were significantly different as determined by a Tukey-Kramer post-hoc test (P<0.005).

While the present invention has been described in some detail for purposes of clarity and understanding, one skilled in the art will appreciate that various changes in form and detail can be made without departing from the true scope of the invention. All figures, tables, and appendices, as well as patents, applications, and publications, referred to above, are hereby incorporated by reference.

Throughout this specification and the claims which follow, unless the context requires otherwise, the word "comprise", and variations such as "comprises" and "comprising", will be understood to imply the inclusion of a stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integers or steps.

The reference in this specification to any prior publication (or information derived from it), or to any matter which is known, is not, and should not be taken as an acknowledgment or admission or any form of suggestion that that prior publication (or information derived from it) or known matter forms part of the common general knowledge in the field of endeavour to which this specification relates.

30A

Claims (16)

THE CLAIMS DEFINING THE INVENTION ARE AS FOLLOWS:

1. A nucleic acid encoding a dengue virus or chimeric dengue virus comprising a mutation in the 3'untranslated region (3'-UTR) comprising:

a A30 mutation that removes nucleotides 173 to 144 of dengue serotype 2 or nucleotides 172 to 143 of dengue serotype 4, using reverse-direction numbering, and nucleotides additional to the A30 mutation deleted from the 3'-UTR that removes sequence in the 5' direction selected from the group consisting of:

nucleotides from about 228 to about 144 of DEN 2 or nucleotides from about 228 to about 143 of DEN4, designated with the reverse-direction numbering system (A86); and

nucleotides from about 258 to about 228 of DEN 2 or nucleotides from about 258 to about 228 of DEN4, designated with the reverse-order numbering system (A30/31).

2. An immunogenic composition comprising a nucleic acid encoding a dengue virus or chimeric dengue virus according to claim 1 or a dengue virus or chimeric dengue virus comprising said nucleic acid.

3. The immunogenic composition of claim 2 that is tetravalent for dengue serotypes 1, 2, 3, and 4.

4. A method of inducing an immune response to a dengue virus in a subject comprising administering the immunogenic composition of claim 2 or claim 3 to a subject to induce an immune response to a dengue virus.

5. A method of producing a nucleic acid encoding a dengue virus or chimeric dengue virus comprising introducing a mutation into the 3' untranslated region (3'-UTR) comprising:

a A30 mutation that removes nucleotides 173 to 144 of dengue serotype 2 or nucleotides 172 to 143 of dengue serotype 4, using reverse-direction numbering, and nucleotides additional to the A30 mutation deleted from the 3'-UTR that removes sequence in the 5' direction selected from the group consisting of: nucleotides from about 228 to about 144 of DEN 2 or nucleotides from about 228 to about 143 of DEN4, designated with the reverse-direction numbering system; and nucleotides from about 258 to about 228 of DEN 2 or nucleotides from about 258 to about 228 of DEN4, designated with the reverse-order numbering system.

6. A dengue virus or chimeric dengue virus comprising the nucleic acid encoding the dengue virus of claim 1.

7. An immunogenic composition that is tetravalent for dengue serotypes 1, 2, 3, and 4, wherein the composition comprises a nucleic acid encoding a dengue 3 virus or chimeric dengue 3 virus wherein the 3' untranslated region (3'-UTR) of the dengue 3 virus or chimeric dengue 3 virus comprises a A30/31 mutation, such that the A30 mutation deletes nucleotides from about 173 to 143 of dengue 3 and the A31 mutation deletes nucleotides from about 258 to 228 of dengue 3, designated with the reverse order numbering system.

8. The immunogenic composition of claim 7, further comprising a nucleic acid encoding a chimeric dengue virus comprising rDEN2/4A30, wherein the A30 mutation deletes nucleotides from about 172 to 143 of the 3'-UTR of dengue 4, designated with the reverse-order numbering system.

9. A method of inducing an immune response to a dengue virus in a subject, comprising administering the immunogenic composition of claim 8 to a subject to induce an immune response to dengue virus.

10. A nucleic acid encoding a dengue virus or chimeric dengue virus comprising a A30 mutation in the 3'-untranslated region (3'-UTR) and an additional mutation, wherein the additional mutation comprises one or more of: (a) A31, corresponding to deleted nucleotides 258-228 of the 3'-UTR of DEN3 Sleman/78 and having the deletion junction -CUGCAGACU-; (b) A50, corresponding to deleted nucleotides 192-143 of the 3'-UTR of DEN3 Sleman/78 and having the deletion junction -CACAAGACU-; (c) A61, corresponding to deleted nucleotides 173-113 of the 3'-UTR of DEN3 Sleman/78 and having the deletion junction -CCGAAUAAA-; (d) A80, corresponding to deleted nucleotides 192-113 of the 3'-UTR of DEN3 Sleman/78 and having the deletion junction -CACAAUAAA-; (e) Al16(A), corresponding to deleted nucleotides 228-113 of the 3' UTR of DEN3 Sleman/78 and having the deletion junction -UAGCAUAAA-; (f) A116(B), corresponding to deleted nucleotides 258-143 of the 3' UTR of DEN3 Sleman/78 and having the deletion junction -CUCCAGACU-; and (g) A146, corresponding to deleted nucleotides 258-113 of the 3'-UTR of DEN3 Sleman/78 and having the deletion junction -CUGCAUAAA-.

11. The nucleic acid encoding a dengue virus or chimeric dengue virus of claim 10, wherein the dengue serotype is dengue 1, 2, 3, or 4.

12. An immunogenic composition comprising the nucleic acid encoding the dengue virus or chimeric dengue virus of claim 10 or claim 11, or a dengue virus or chimeric dengue virus comprising said nucleic acid.

13. The immunogenic composition of claim 13, that is tetravalent for dengue serotypes 1, 2, 3, and 4.

14. A method of inducing an immune response to a dengue virus in a subject, comprising administering the nucleic acid of any one of claims 1, 10, and 11 or the immunogenic composition of claim 12 or claim 13 to a subject to induce an immune response to dengue virus.

15. A dengue virus or chimeric dengue virus comprising the nucleic acid encoding the dengue virus or chimeric dengue virus of claim 10 or claim 11.

16. Use of the nucleic acid of any one of claims 1, 10 and11 or the immunogenic composition of any one of claims 2, 3, 7, 8, 12 and 13 for the preparation of a medicament for inducing an immune response to dengue virus in a subject.