AU2018100A - Novel g protein-coupled receptor - Google Patents

Description

WO 00/34333 PCT/SE99/02302 NOVEL G PROTEIN-COUPLED RECEPTOR Field of the Invention The present invention relates to nucleic acids encoding a novel G protein-coupled receptor and to the receptor itself. 5 Background of the Invention G protein-coupled receptors (GPCRs) constitute a family of proteins sharing a common structural organization characterized by an extracellular N-terminal end, seven hydrophobic alpha helices putatively constituting transmembrane domains and an o intracellular C-terminal domain. GPCRs bind a wide variety of ligands that trigger intracellular signals through the activation of transducing G proteins (Caron et al., Rec. Prog. Horm. Res. 48:277-290 (1993); Freedman et al., Rec. Prog. Horm. Res. 51:319-353 (1996)). 5 Approximately 50-60% of all clinically relevant drugs act by modulating the functions of various GPCRs (Gudermann et al., J. Mol. Med 73:51-63 (1995)). Of particular interest are receptors located in the central nervous system. G protein-coupled receptors in this region are known to be involved in the transmission, modulation and sensation of pain. Thus, G protein-coupled receptors derived from the brain and spinal column may be used o in assays for the identification of new anesthetic and analgesic agents. Summary of the Invention The present invention is based upon the discovery of a novel G protein-coupled receptor which is distinct from previously reported receptors in terms of structure and distribution. 5 It is referred to herein as the "MP-10 receptor." In its first aspect, the invention is directed to a protein, except as existing in nature, comprising an amino acid sequence consisting functionally of SEQ ID NO: I. The term "consisting functionally of" refers to proteins in which the sequence of SEQ ID NO: 1 has o undergone additions, deletions or substitutions which do not substantially alter the functional characteristics of the receptor. The term is intended to encompass proteins having exactly the same amino acid sequence as that of SEQ ID NO: 1, as well as proteins with sequence differences that are not substantial as evidenced by their retaining the basic, qualitative ligand binding and physiological properties of the MP-10 receptor. The term 5 "except as existing in nature" refers to a compound that is either expressed by recombinant means or that is in a purified (preferably substantially purified) state. In a preferred embodiment the protein has an amino acid sequence consisting essentially of the sequence of SEQ ID NO: 1. The invention includes antibodies that bind preferentially to WO 00/34333 PCT/SE99/02302 2 such a protein (i.e., antibodies having at least a 100-fold greater affinity for MP-10 than any other protein): and antibodies made by a process involving the injection of a pharmaceutically acceptable preparation of MP-10 into an animal capable of antibody production. Preferably, monoclonal antibody to MP-10 is produced by administering MP-10 to a mouse and then fusing the mouse's spleen cells with myeloma cells. The invention is also directed to a polynucleotide, except as existing in nature, encoding a protein with an amino acid sequence consisting functionally of SEQ ID NO: 1. This aspect of the invention encompasses polynucleotides encoding proteins consisting essentially of the amino acid sequence of SEQ ID NO: 1, expression vectors comprising such polynucleotides, and host cells transformed with such vectors. Also included is recombinant MP-10 receptor produced by host cells made in this manner. Preferably, the polynucleotide encoding the MP-10 receptor has a sequence consisting essentially of nucleotides 611-1772 of SEQ ID NO:2, and the vectors and host cells used for expression of the receptor also use this particular polynucleotide. In another aspect, the present invention is directed to a method for assaying a test compound for its ability to bind to the MP-10 receptor. The method is performed by incubating a source of MP-10 with a ligand known to bind to the receptor and with the test compound. The source of receptor should, preferably, express a large amount of MP-10 relative to other G protein-coupled receptors. Upon completion of incubation, the ability of the test compound to bind to MP-10 is determined by the extent to which ligand binding has been displaced. Preferably, the receptor present should have the sequence shown in SEQ ID NO: 1. Although not essential, the binding assay can be accompanied by an assay to determine whether a second messenger pathway, e.g., the adenyl cyclase pathway, has become activated. This should help to determine whether a particular compound binding to MP-10 is acting as an agonist or antagonist. An alternative method for determining if a test compound is an MP-10 agonist, a method that does not require any ligand, is to use a cell signaling assay, e.g., an assay measuring either intracellular adenyl cyclase activity or intracellular calcium concentration. The test compound should generally be incubated with cells expressing high amounts of MP-10 relative to other G protein-coupled receptors, typically a cell transfected with an expression vector encoding the MP-10 of SEQ ID NO:I1. Test compounds that are agonists are identified by their causing a statistically significant change in the results obtained from the cell signaling assay when compared to control cells not exposed to test compound. The control cells may be either cells that have not been transfected or cells that have been mock transfected with a vector that does not produce active receptor. MP-10-expressing cells WO 00/34333 PCT/SE99/02302 3 exposed to test compounds that are agonists would typically be expected to show significant signaling responses, for example changes in adenylate cyclase activity or an increase in intracellular calcium concentration relative to control cells. The invention also encompasses a method for determining if a test compound is an antagonist of MP-10 which relies upon the known constitutive activation of G protein coupled receptors that occurs when such receptors are expressed in large amounts. This method requires that DNA encoding the receptor be incorporated into an expression vector so that it is operably linked to a promoter and that the vector then be used to transfect an appropriate host. In order to produce sufficient receptor to result in constitutive receptor activation (i.e., activation in the absence of natural ligand), expression systems capable of copious protein production are preferred, e.g., the MP-10 DNA may be operably linked to a CMV promoter and expressed in COS or HEK293 cells. After transfection, cells with activated receptors are selected based upon their showing increased activity in a cell signaling assay relative to comparable cells that have either not been transfected or that have been transfected with a vector that is incapable of expressing functional MP-10. Typically, cells will be selected either because they show a statistically significant change in intracellular adenyl cyclase activity or in intracellular calcium concentration. The selected cells are contacted with the test compound and the cell signaling assay is repeated to determine if this results in a decrease in activity relative to selected cells that have not been contacted with the test compound. For example, a statistically significant decrease in either adenyl cyclase activity or calcium concentration relative to control cells would indicate that the test compound is an antagonist of MP-10. Preferably the MP-10 used in assays has the sequence of SEQ ID NO: 1. Assays for compounds interacting with MP-10 may be performed by incubating a source containing the receptor (e.g., a stably transformed cell) with a ligand specific for MP-10 both in the presence and absence of test compound and measuring the modulation of intracellular calcium concentration. A significant increase or decrease in ligand-stimulated calcium signaling in response to test compound is indicative of an interaction occurring at the MP-10 receptor. The preferred receptor is that having the amino acid sequence of SEQ ID NO: 1. In another aspect, the present invention is directed to a method for assaying a test compound for its ability to alter the expression of MP-10. This method is performed by growing cells expressing MP-10 in the presence of the test compound. Cells are then collected and the expression of MP-10 is compared with expression in control cells grown under essentially identical conditions but in the absence of test compound. The preferred receptor is one having the amino acid sequence of SEQ ID NO:l. A preferred test WO 00/34333 PCT/SE99/02302 4 compound is an oligonucleotide at least 15 nucleotides in length comprising a sequence complementary to the sequence of the MP- 10 mRNA used in the assay. Brief Description of the Drawings Figure 1. Figure 1 contains the complete nucleotide sequence of a clone constructed by the methods described in the Examples section. The clone was deposited with the International Depository Authority Deutsche Sammlung Von Mikroorganismen Und Zellkulturen GmbH at the address Mascheroder Weg 1 B, D-3300 Braunschweig, Germany. The deposit was made on November 13, 1998 and was given the accession number DSM 12499. Figure 2. Figure 2 shows the deduced amino acid sequence of rat MP-10. The polynucleotide of Figure 1 codes for a protein 387 amino acids in length. Definitions The description that follows uses a number of terms that refer to recombinant DNA technology. In order to provide a clear and consistent understanding of the specification and claims, including the scope to be given such terms, the following definitions are provided. Cloning vector: A plasmid or phage DNA or other DNA sequence which is able to replicate autonomously in a host cell and which is characterized by one or a small number of restriction endonuclease recognition sites. A foreign DNA fragment may be spliced into the vector at these sites in order to bring about the replication and cloning of the fragment. The vector may contain a marker suitable for use in the identification of transformed cells. For example, a marker may provide tetracycline resistance or ampicillin resistance. Expression vector: A vector similar to a cloning vector but which is capable of inducing the expression of the DNA that has been cloned into it, after transformation into a host. The cloned DNA is usually placed under the control of (i.e., operably linked to) certain regulatory sequences such as promoters or enhancers. Promoter sequences may be constitutive, inducible or repressible. Substantially pure: As used herein, "substantially pure" means that the desired product is essentially free from contaminating cellular components. A "substantially pure" protein or nucleic acid will typically comprise at least 85% of a sample, with greater percentages being preferred. Contaminants may include proteins, carbohydrates or lipids. One method for determining the purity of a protein or nucleic acid is by electrophoresing a preparation WO 00/34333 PCT/SE99/02302 5 in a matrix such as polyacrylamide or agarose. Purity is evidenced by the appearance of a single band after staining. Other methods for assessing purity include chromatography and analytical centrifugation. Recombinant protein: A recombinant protein or recombinant receptor is a non-endogenous protein produced by the introduction of an expression vector into host cells. Host: Any prokaryotic or eukaryotic cell that is the recipient of a replicable expression vector or cloning vector is the "host" for that vector. The term encompasses prokaryotic or eukaryotic cells that have been engineered to incorporate a desired gene on its chromosome or in its genome. Examples of cells that can serve as hosts are well known in the art, as are techniques for cellular transformation (see, e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual. 2nd ed. Cold Spring Harbor (1989)). Promoter: A DNA sequence typically found in the 5' region of a gene, located proximal to the start codon. Transcription is initiated at the promoter. If the promoter is of the inducible type, then the rate of transcription increases in response to an inducing agent. Complementary Nucleotide Sequence: A complementary nucleotide sequence, as used herein, refers to the sequence that would arise by normal base pairing. For example, the nucleotide sequence 5'-AGAC-3'would have the complementary sequence 5'- GTCT-3'. Expression: Expression is the process by which a polypeptide is produced from DNA. The process involves the transcription of the gene into mRNA and the translation of this mRNA into a polypeptide. Detailed Description of the Invention The present invention is directed to an MP-10 receptor protein, genetic sequences coding for the protein, a method for assaying compounds binding to MP-10 receptors and a method for assaying compounds for their ability to alter receptor expression. The receptor and the nucleic acid encoding the receptor are defined by the structures shown in figures 1 and 2 and by SEQ ID NOs: 1 and 2. However, the invention encompasses not only sequences identical to those shown in the figures and sequence listing, but also sequences that are essentially the same and sequences that are otherwise substantially the same and which result in a receptor retaining the basic binding characteristics of MP-10.

WO 00/34333 PCT/SE99/02302 6 For example, it is well known that techniques such as site-directed mutagenesis may be used to introduce variations into a protein's structure. Variations in the MP-10 receptor introduced by this or some similar method are encompassed by the invention provided that the resulting receptor retains the basic qualitative binding and physiological characteristics of unaltered MP-10. Thus, the invention relates to proteins comprising amino acid sequences consisting functionally of SEQ ID NO: 1. I. Nucleic Acid Sequences Coding for MP-10 DNA sequences coding for rat MP-10 are expressed throughout the adult rat central nervous system, as well as in the spleen. Tissue from either of these areas may be used as a source for the isolation of nucleic acids coding for the receptor. In addition, cells and cell lines that express MP-10 may be used. These may either be cultured cells that have not undergone transformation or cell lines specifically engineered to express recombinant MP-10. Most preferred are the cells deposited as DSM No. 12499. The deposited cells, DNA encoding MP-10 may be obtained as the result of standard restriction digestions. Alternatively, poly A'mRNA may be isolated from tissue or cells, reverse transcribed and cloned. The cDNA library thus formed may then be screened using probes derived from SEQ ID NO:2. Probes should typically be at least 14 bases in length and should, preferably, not be obtained from regions of the DNA corresponding to highly conserved transmembrane domains of MP-10. MP-10 can also be obtained from recombinant cells containing the full-length MP-10 sequence or from cDNA libraries by performing PCR amplifications using primers located at either end of the MP-10 gene. These primers can be selected from the sequences shown in SEQ ID NO:2.

WO 00/34333 PCT/SE99/02302 7 II. Antibodies to MP-1O The present invention is also directed to antibodies that bind specifically to MP-10 and to a process for producing such antibodies. Antibodies that "bind specifically" are defined as those that have at least a one hundred fold greater affinity for MP-10 than for any other protein. The process for producing such antibodies may involve either injecting the MP-10 protein itself into an appropriate animal or, alternatively, injecting short peptides made to correspond to different regions of the receptor. The peptides should be at least five amino acids in length and should be selected from regions believed to be unique to MP-10. Thus, highly conserved transmembrane regions should generally be avoided in selecting peptides for the generation of antibodies. Methods for making and detecting antibodies are well known to those of skill in the art as evidenced by standard reference works such as: Harlow et al., Antibodies, A Laboratory Manual, Cold Spring Harbor Laboratory, N.Y. (1988)); Klein, Immunology: The Science of Self-Nonself Discrimination (1982); Kennett et al., Monoclonal Antibodies and Hybridomas: A New Dimension in Biological Analyses (1980); and Campbell, "Monoclonal Antibody Technology," in Laboratory Techniques in Biochemistry and Molecular Biology, (1984)). "Antibody," as used herein, is meant to include intact molecules as well as fragments which retain their ability to bind to antigen (e.g., Fab and F(ab 2 fragments). These fragments are typically produced by proteolytically cleaving intact antibodies using enzymes such as papain (to produce Fab fragments) or pepsin (to produce F(ab') 2 fragments). The term "antibody" also refers to both monoclonal antibodies and polyclonal antibodies. Polyclonal antibodies are derived from the sera of animals immunized with the antigen. Monoclonal antibodies can be prepared using hybridoma technology (Kohler et al., Nature 256:495 (1975); Hammerling et al., in: Monoclonal Antibodies and T-Cell Hybridomas, Elsevier, M.Y., pp. 563-681 (1981)). In general, this technology involves immunizing an animal, usually a mouse, with either intact MP-10 or a fragment derived from MP-10. The splenocytes of the immunized animals are extracted and fused with suitable myeloma cells, e.g., SP 2 0 cells. After fusion, the resulting hybridoma cells are selectively maintained in HAT medium and then cloned by limiting dilution (Wands et al., Gastroenterology 80:225-232 (1981)). The cells obtained through such selection are then assayed to identify clones which secrete antibodies capable of binding to MP-10. The antibodies, or fragments of antibodies, of the present invention may be used to detect the presence of MP-10 using any of a variety of immunoassays. For example, the antibodies may be used in radioimmunoassays or in immunometric assays, also known as "two-site" or "sandwich" assays (see Chard, T., "An Introduction to Radioimmune Assay and Related Techniques," in Laboratory Techniques in Biochemistry and Molecular WO 00/34333 PCT/SE99/02302 8 Biology, North Holland Publishing Co., N.Y. (1978)). In a typical immunometric assay, a quantity of unlabeled antibody is bound to a solid support that is insoluble in the fluid being tested, e.g., blood, lymph, cellular extracts, etc. After the initial binding of antigen to immobilized antibody, a quantity of detectably labeled second antibody (which may or may not be the same as the first) is added to permit detection and/or quantitation of bound antigen (see, e.g., Radioimmune Assay Method, Kirkham et al., ed., pp. 199-206, E & S. Livingstone, Edinburgh (1970)). Many variations of these types of assays are known in the art and may be employed for the detection of MP-10. Antibodies to MP-10 may also be used in the purification of either intact receptor or fragments of the receptor (see generally, Dean et al., Affinity Chromatography. A Practical Approach, IRL Press (1986)). Typically, antibody is immobilized on a chromatographic matrix such as Sepharose 4B. The matrix is then packed into a column and the preparation containing MP-10 is passed through under conditions that promote binding, e.g., under conditions of low salt. The column is then washed and bound MP-10 is eluted using a buffer that promotes dissociation from antibody, e.g., buffer having an altered pH or salt concentration. The eluted MP-10 may be transferred into a buffer of choice, e.g., by dialysis, and either stored or used directly. III. Radioligand Assay for Receptor Binding One of the main uses for MP-10 nucleic acids and recombinant proteins is in assays designed to identify agents capable of binding to the receptor. Such agents may either be agonists, mimicking the normal effects of receptor binding, or antagonists, inhibiting the normal effects of receptor binding. Of particular interest is the identification of agents which bind to the MP-10 receptor and modulate intracellular signaling, such as adenyl cyclase activity or intracellular calcium. These agents have potential therapeutic application as either analgesics or anesthetics. In radioligand binding assays, a source of MP-10 is incubated together with a ligand known to bind to the receptor and with the compound being tested for binding activity. The preferred source of MP-10 is cells, preferably mammalian cells, transformed to recombinantly express the receptor. The cells selected should not express a substantial amount of any other G protein-coupled receptor that might bind to ligand and distort results. This can easily be determined by performing binding assays on cells derived from the same tissue or cell line as those recombinantly expressing MP-10 but which have not undergone transformation.

WO 00/34333 PCT/SE99/02302 9 The assay may be performed either with intact cells or with membranes prepared from the cells (see, e.g., Wang et al., Proc. Natl. Acad Sci. U.S.A. 90:10230-10234 (1993)). The membranes, or cells, are incubated with a ligand specific for the MP-10 receptor and with a preparation of the compound being tested. After binding is complete, receptor is separated from the solution containing ligand and test compound, e.g., by filtration, and the amount of binding that has occurred is determined. Preferably, the ligand used is detectably labeled with a radioisotope such as 125I. However, if desired, fluorescent or chemiluminescent labels can be used instead. Among the most commonly used fluorescent labeling compounds are fluorescein isothiocynate, rhodamine, phycoerythrin, phycocyanin, allophycocyanin, o-phthaldehyde and fluorescamine. Useful chemiluminescent compounds include luminol, isoluminol, theromatic acridinium ester, imidazole, acridinium salt, and oxalate ester. Any of these agents can be used to produce a ligand suitable for use in the assay. Nonspecific binding may be determined by carrying out the binding reaction in the presence of a large excess of unlabeled ligand. For example, labeled ligand may be incubated with receptor and test compound in the presence of a thousandfold excess of unlabeled ligand. Nonspecific binding should be subtracted from total binding, i.e. binding in the absence of unlabeled ligand, to arrive at the specific binding for each sample tested. Other steps such as washing, stirring, shaking, filtering and, the like may be included in the assays as necessary. Typically, wash steps are included after the separation of membrane bound ligand from ligand remaining in solution and prior to quantitation of the amount of ligand bound, e.g., by counting radioactive isotope. The specific binding obtained in the presence of test compound is compared with that obtained in the presence of labeled ligand alone to determine the extent to which the test compound has displaced receptor binding. In performing binding assays, care must be taken to avoid artifacts which may make it appear that a test compound is interacting with the MP-10 receptor when, in fact, binding is being inhibited by some other mechanism. For example, the compound being tested should be in a buffer which does not itself substantially inhibit the binding of ligand to MP-10 and should, preferably, be tested at several different concentrations. Preparations of test compound should also be examined for proteolytic activity and it is desirable that antiproteases be included in assays. Finally, it is highly desirable that compounds identified as displacing the binding of ligand to MP-10 receptor be reexamined in a concentration range sufficient to perform a Scatchard analysis of the results. This type of analysis is well known in the art and can be used for determining the affinity of a test compounds for receptor (see, e.g., Ausubel et al., Current Protocols in Molecular Biologv. 11.2.1-11.2.19 (1993): Laboratory Techniques in Biochemistry and Molecular Biolov.

WO 00/34333 PCT/SE99/02302 10 Work et al., ed., N.Y. (1978) etc.). Computer programs may be used to help in the analysis of results (see, e.g., Munson, P., Methods Enzymol. 92:543-577 (1983); McPherson, G.A., Kinetic, EBDA Ligand, Lowry-A Collection of Radioligand Binding Analysis Programs, Elsevier-Biosoft, U.K. (1985)). The activation of receptor by the binding of ligand may be monitored using a number of different assays. For example, adenyl cyclase assays may be performed by growing cells in wells of a microtiter plate and then incubating the wells in the presence or absence of test compound. cAMP may then be extracted in ethanol, lyophilized and resuspended in assay buffer. Assay of cAMP thus recovered may be carried out using any method for determining cAMP concentration, e.g. the Biotrack cAMP Enzyme-immunoassay System (Amersham) or the Cyclic AMP [3H] Assay System (Amersham). Typically, adenyl cyclase assays will be performed separately from binding assays, but it may also be possible to perform binding and adenyl cyclase assays on a single preparation of cells. Other "cell signaling assays" that can be used to monitor receptor activity are described below. IV. Identification of MP-10 Agonists and Antagonists Using Cell Signaling Assays MP-10 receptors may also be used to screen for drug candidates using cell signaling assays. To identify MP-10 agonists, the DNA encoding a receptor is incorporated into an expression vector and then transfected into an appropriate host. The transformed cells are then contacted with a series of test compounds and the effect of each is monitored. Among the assays that can be used are assays measuring cAMP production (see discussion above), assays measuring the activation of reporter gene activity, assays measuring the modulation of the binding of ligand, e.g., GTP-gamma-S, or assays measuring changes in intracellular calcium concentration. Cell signaling assays may also be used to identify MP-10 antagonists. G protein-coupled receptors can be put into their active state even in the absence of their cognate ligand by expressing them at very high concentration in a heterologous system. For example, receptor may be overexpressed using the baculovirus infection of insect Sf9 cells or the MP-10 gene may be operably linked to a CMV promoter and expressed in COS or HEK293 cells. In this activated constitutive state, antagonists of the receptor can be identified in the absence of ligand by measuring the ability of a test compound to inhibit constitutive cell signaling activity. Appropriate assays for this are, again, cAMP assays, reporter gene activation assays or assays measuring the binding of GTP-gamma-S.

WO 00/34333 PCT/SE99/02302 11 One preferred cell signaling assay is based upon cells stably transfected with MP-10 showing a change in intracellular calcium levels in response to incubation in the presence of ligand. Thus, a procedure can be used to identify MP-10 agonists or antagonists that is similar to the radioreceptor assays discussed above except that calcium concentration is measured instead of bound radioactivity. The concentration of calcium in the presence of test compound and ligand is compared with that in the presence of ligand alone to determine whether the test compound is interacting at the MP-10 receptor. A statistically significant increase in intracellular calcium in response to test compound indicates that the test compound is acting as an agonist whereas a statistically significant decrease in intracellular calcium indicates that it is acting as an antagonist. Assays may also be performed that measure the activation of a reporter gene. For example, cells expressing recombinant MP-10 may be transfected with a reporter gene (e.g., a chloramphenicol acetyltransferase or luciferase gene) operably linked to an adenyl cyclase or diacylglycerol response element. The cells are then incubated with test compounds and the expression of the reporter gene is compared to expression in control cells that do not express recombinant MP-10 but that are essentially identical in other respects. A statistically significant change in reporter gene expression in the MP-10-expressing cells is indicative of a test compound that interacts with the MP-10 receptor. V. Assay for Ability to Modulate MP-10 Expression One way to either increase or decrease the biological effects of MP-10 is to alter the extent to which the receptor is expressed in cells. Therefore, assays for the identification of compounds that either inhibit or enhance expression are of considerable interest. These assays are carried out by growing cells expressing MP-10 in the presence of a test compound and then comparing receptor expression in these cells with expression in cells grown under essentially identical conditions but in the absence of test compound. As in the binding assays discussed above, it is desirable that the cells used be substantially free of competing G protein-coupled receptors. One way to measure receptor expression is to fuse the MP-10 sequence to a sequence encoding a peptide or protein that can be readily quantitated. For example, the MP-10 sequence may be ligated to a sequence encoding hemagglutinin and used to stably transfect cells. After incubation with test compound, the hemagglutinin/receptor complex can be immuno-precipitated and Western blots performed using anti-hemagglutinin antibody. Alternatively, Scatchard analysis of binding assays may be performed with labeled ligand to determine receptor number. The binding assays may be carried out as discussed above and will preferably utilize cells that have been engineered to recombinantly express MP-10.

WO 00/34333 PCT/SE99/02302 12 A preferred group of test compounds for inclusion in the MP-10 expression assay consists of oligonucleotides complementary to various segments of the MP-10 nucleic acid sequence shown in SEQ ID NO:2. These oligonucleotides should be at least 15 bases in length and should be derived from non-conserved regions of the receptor nucleic acid sequence. Oligonucleotides which are found to reduce receptor expression may be derivatized or conjugated in order to increase their effectiveness. For example, nucleoside phosphorothioates may be substituted for their natural counterparts (see Cohen, J., Olicodeoxvnucleotides. Antisense Inhibitors of Gene Expression, CRC Press (1989)). The oligonucleotides may also be delivered to a patient in vivo for the purpose of inhibiting MP-10 expression. When this is done, it is preferred that the oligonucleotide be administered in a form that enhances its uptake by cells. For example, the oligonucleotide may be delivered by means of a liposome or conjugated to a peptide that is ingested by cells (see, e.g., U.S. Patent Nos. 4,897,355 and 4,394,448; see also non-U.S. patent documents WO 8903849 and EP 0263740). Other methods for enhancing the efficiency of oligonucleotide delivery are well known in the art and are also compatible with the present invention. Having now described the invention, the same will be more readily understood through reference to the following Examples which are provided by way of illustration and which are not intended to limit the scope of the invention. Examples Example 1: Cloning of Rat MP-10 Degenerate polymerase chain reaction: One method of successfully obtaining MP-10 DNA involves performing a PCR amplification followed by the screening of a cDNA library. The following oligonucleotides were used as PCR primers: 5' TGCCAAGTTACTTCAGTCAC 3' (22748:1F; SEQ ID NO:3) 5' TGCCTCAGGGTGTAGGGAAT 3' (22748:1R; SEQ ID NO:4) These oligonucleotides were used in a polymerase chain reaction mixture (total volume 50 pl) which contained about 250 gg of rat genomic DNA (NOVAGEN), IX PCR buffer (50 mM KCI, 1.5 mM MgCl 2 , 10 mM Tris-HCI (pH 8.9), Pharmacia), 400 pM dNTPs (Pharmacia); 50 pmol each of the above primers and 5U Taq polymerase (Pharmacia). Amplification was carried out on a Gene Amp PCR Sys 9700 (Perkin Elmer: Applied Biosystems). The template was denatured at 95'C for one minute, followed by 30 cycles consisting of denaturation, annealing and extension steps each for 30 seconds at WO 00/34333 PCT/SE99/02302 13 94'C, 50 0 C and 72 0 C, respectively. The resulting product was resolved on a 1 % agarose gel. A major band of 500 bp was excised and purified with Sephaglas BandPrep Kit (Pharmacia) and subcloned into pGEM-T easy (Promega). The plasmids were prepared by the alkaline lysis protocol using a Qiaprep 8 kit (Qiagen) and screened by sequencing using the ABI Prism dRhodamine cycle sequencing ready reaction kit (PE Applied Biosystems). The 500bp rat fragment was identified as a probable GPCR partial sequence since it contained several structural features characteristic of a GPCR. cDNA library screening: The rat MP-10 fragment was used as a tool to isolate the full length rat clone. Several cDNA libraries were screened by PCR using the aforementioned oligonucleotides. One rat cDNA library, Stratagene rat brainstemrn/spinal cord (cat # 936521), was found to be positive. One million plaques were plated, transferred to Hybond N+ filters (Amersham), and denatured for 7 minutes (1.5M NaCI and 0.5M NaOH), followed by two neutralization treatments of 5 minutes each (1.5M NaC1, 0.5M Tris-HCl pH 7 and 0.001 EDTA). The filters were rinsed in 2X SSC and air-dried for one hour at room temperature. The membranes were hybridized overnight at 42 0 C in 50% formamide, 10% dextran sulphate (from a 50% solution), 1% SDS, 5XSSC, 5X Denhardt's, 10mM Tris and 100g/ml of sonicated salmon sperm DNA. The rat MP-10 fragment was randomly labeled using T7 Quick Prime (Pharmacia) and added to the hybridization solution at 10X106 cpm/ml. Filters were washed with 2XSSC/0.1%SDS at room temperature followed by a high stringency wash with 0.1% SDS/0.2XSSC at 65°C. Using this screening procedure, 8 independent clones were identified and isolated by repeated plating and screening with the labeled rat MP-10 PCR fragment. Four independent clones were subjected to sequencing (clones 10, 17, 25 and 33). The DNA analysis revealed that full-length MP-10 had indeed been cloned (clones 10 and 17). Results: The complete nucleotide sequence of the MP-10 cDNA clone is illustrated in Figure 1. The open reading encodes a protein of 387 amino acids (Figure 2). Example 2: In Situ Hybridization Experiments Preparation of tissue: Adult male Sprague-Dawley rats (about 250 gm; Charles River, St Constant, Quebec) were sacrificed by decapitation. Brain, spinal cord with DRGs still attached, and several peripheral tissues (heart, kidney, spleen, liver, lung and skeletal muscle) were promptly removed, snap-frozen in isopentane at -40 0 C for 20 seconds and stored at -80 0 C. Frozen tissue was sectioned at 16 pm in a Microm HM 500 M cryostat (Germany) and thaw-mounted onto ProbeOn Plus slides (Fisher Scientific, Montreal, Quebec). Sections were stored at -80 0 C prior to in situ hybridization.

WO 00/34333 PCT/SE99/02302 14 Riboprobe synthesis: The plasmid pGEMT-MP-10 (containing a 501 bp fragment) was linearized using either PstI or SacII restriction enzymes (Pharmacia Biotech) which cut in the polylinker on either side of the inserted cDNA. Antisense and sense MP-10 riboprobes were transcribed in vitro using either T7 or SP6 RNA polymerases (Promega), respectively in the presence of [ 35 S]UTP (approximately 800 Ci/mmol; Amersham, Oakville, Ontario). Following transcription, the DNA template was digested with DNAse I (Pharmacia). Riboprobes were subsequently purified on ProbeQuant G-50 microcolumns (Pharmacia Biotech, USA) according to the manufacturer's specifications. Quality of labeled riboprobes was verified by polyacrylamide-urea gel electrophoresis. In situ Hybridization: Sections were postfixed in 4% paraformaldehyde (BDH, Poole, England) in 0.1 M phosphate buffer (pH 7.4) for 10 minutes at room temperature (RT) and rinsed in 3 changes of 2X standard sodium citrate buffer (SSC; 0.15 M NaCl. 0.015 M sodium citrate, pH 7.0). Sections were then equilibrated in 0.1 M triethanolamine, treated with 0.25% acetic anhydride in triethanolamine, rinsed in 2X SSC and dehydrated in an ethanol series (50-100%). Hybridization was performed in a buffer containing 75% formamide (Sigma, St-Louis, Mo), 600 mM NaCI, 10 mM Tris (pH 7.5), 1 mM EDTA, lX Denhardt's solution (Sigma), 50 mg/ml denatured salmon sperm DNA (Sigma), 10% dextran sulfate (Sigma), 20 mM dithiothreitol and [ 35 S]UTP-labeled cRNA probes (10 X10 6 cpm/ml) at 55 0 C for 18 hours in humidified chambers. Following hybridization, slides were rinsed in 2X SSC at room temperature, treated with 20 mg/ml RNase IA (Pharmacia) in RNase buffer (10 mM Tris, 500 mM NaC1, 1 mM EDTA, pH 7.5) for 45 min at room temperature and washed to a final stringency of 0.1 X SSC at 70 0 C. Sections were then dehydrated and exposed to Kodak Biomax MR film for 14-21 days and/or dipped in Kodak NTB2 emulsion diluted 1:1 with distilled water and exposed for 6-8 weeks at 4 0 C prior to development and counterstaining with cresyl violet acetate (Sigma). Results: In situ hybridization film autoradiograms revealed that clone MP-10 mRNA is expressed diffusely but ubiquitously in the adult rat central nervous system (CNS). A slightly greater labeling density is observed in superficial laminae (I and II) of the dorsal horn of the spinal cord. A moderate hybridization signal for clone MP-10 message is detected in adult rat spleen, but not in heart, kidney, liver, lung or skeletal muscle. Example 3: Development of an Assay for the MP-1 Endogenous Ligand One method that can be used to identify an endogenous ligand for MP-10, or to screen natural or synthetic compounds for MP-10 binding activity, is to structurally link the receptor, preferably through its carboxy terminus, to a fluorescent probe, e.g., the green fluorescent protein (GFP). Upon stimulation with an agonist, GPCRs internalize WO 00/34333 PCT/SE99/02302 15 (Ashworth et al., Proc. Nat. Acad Sci. USA 92:512-516 (1995)). If the receptors are coupled to a fluorescent probe, internalization can be measured using conventional techniques (e.g. fluorescent microscopy, confocal microscopy, etc). Thus, tissue extracts can be prepared from brain, spinal cord etc., incubated with cells expressing a hybrid MP 10-GFP construct and internalization monitored. Only those fractions that contain an endogenous ligand for MP-10 will cause the hybrid to internalize. Such active fractions can then be further fractionated until a pure ligand is recovered. A similar procedure can be employed to assay for receptor-activating compounds in a complex mixture of synthetic compounds. All references cited herein are fully incorporated herein by reference. Having now fully described the invention, it will be understood by those of skill in the art that the invention may be performed within a wide and equivalent range of conditions, parameters and the like, without affecting the spirit or scope of the invention or any embodiment thereof.

WO 00/34333 PCT/SE99/02302 16 INDICATIONS RELATING TO ,4 DEPOSITED MICROORGANISM (PCT Rule 13bis) A. The indications made below relate to Mne microorganism referred to in the description on page 4 , line 6-10 B. IDENTIFICATION OF DEPOSIT Further deposits are identified on an aditional sheet Name of depositary institution Deutsche SammLung Von Mikroorganismen Und Zelikuituren GambH Address of depositary institution inciu in a postai code and country) Mascheroder Wegl 3 D-3300 Braunschweig Germany Date ot deposit Accession Number November 13, 1998 DSM 12499 C. ADDITIONAL INDICATIONS ileaeve olank ifno applicable) This information is continued on an additional sheet E D. DESIGNATED STATES FOR WHICH INDICATIONS ARE MADE (iftheindicaion are na forall deignaedStata) E. SEPARATE FURNISHINGS OF INDICATION'(leave blankif nat applicable) The indications listed below will be submitted to the International Bureau later (specify~hegenwainatureaftheindicatione,'-.. Acctsia Number of Deposit ') For receiving Oftice use only For International Bureau use only O This sheet was received with the international application 1O This sheet was received by the International Bureau on: Authorized officer Authorized officer orm PCT/RO/134 (July 1992)

Claims (24)

1. A protein, except as existing in nature, comprising the amino acid sequence consisting functionally of SEQ ID NO: 1.

2. The protein of claim 1, wherein said amino acid sequence consists essentially of the amino acid sequence of SEQ ID NO: 1.

3. An antibody made by a process comprising the step of injecting a pharmaceutically acceptable preparation comprising the protein of either claim 1 or claim 2 into an animal capable of producing said antibody.

4. The process of claim 3, wherein said animal is a mouse and said process further comprises fusing spleen cells from said mouse with myeloma cells to produce a monoclonal antibody binding to said protein.

5. An antibody that binds preferentially to the protein of claim 2.

6. A polynucleotide, except as existing in nature, encoding a protein comprising the amino acid sequence consisting functionally of the sequence of SEQ ID NO: 1.

7. The polynucleotide of claim 6, wherein said polynucleotide encodes a protein consisting essentially of the amino acid sequence of SEQ ID NO: 1.

8. An expression vector comprising the polynucleotide of either claim 6 or claim 7.

9. A host cell transformed with the vector of claim 8.

10. Recombinant MP-10 receptor produced by the host cell of claim 9.

11. The polynucleotide of claim 7, wherein said polynucleotide has a sequence consisting essentially of nucleotides 611-1910 of SEQ ID NO:2.

12. An expression vector comprising the polynucleotide of claim 11.

13. A host cell transformed with the vector of claim 12. WO 00/34333 PCT/SE99/02302 18

14. A method of assaying a test compound for its ability to bind to the MP-10 receptor, comprising: a) incubating a source containing said MP-10 receptor with: i) a ligand known to bind to said MP-10 receptor; ii) said test compound; and b) determining the extent to which said ligand binding is displaced by said test compound.

15. The method of claim 14, wherein said MP-10 receptor has the sequence shown in SEQ ID NO: 1.

16. A method for determining if a test compound is an agonist of a MP-10 receptor, comprising: a) incubating a cell expressing said MP-10 receptor with said test compound; and b) determining whether said test compound causes a statistically significant increase in either intracellular adenyl cyclase activity or the intracellular concentration of calcium.

17. The method of claim 16, wherein said MP-10 receptor has the sequence shown in SEQ ID NO:1.

18. A method for determining if a test compound is an antagonist of an MP-10 receptor, comprising: a) incorporating a DNA molecule encoding said MP-10 receptor into an expression vector so that it is operably linked to a promoter; b) transfecting said expression vector into a host; c) selecting cells transfected in step b) that have constitutively activated MP-10 receptors as evidenced by either: i) a statistically significant increase or decrease in intracellular adenyl cyclase activity; or ii) a statistically significant increase in intracellular calcium concentration; d) contacting the cells selected in step c) with said test compound; and e) determining if said test compound causes a statistically significant decrease in either said adenyl cyclase activity or said calcium concentration relative to control cells not contacted with said test compound. WO 00/34333 PCT/SE99/02302 19

19. The method of claim 18, wherein said MP-10 receptor has the sequence shown in SEQ ID NO: 1.

20. A method for assaying a test compound for its ability to alter the activity of an MP-10 receptor, comprising: a) incubating a source containing said MP-10 receptor with: i) a ligand that binds with specificity to said MP-10 receptor; ii) said test compound; and b) determining whether said test compound increases or decreases intracellular calcium concentration in response to said ligand.

21. The method of claim 20, wherein said MP-10 receptor has the sequence shown in SEQ ID NO:1.

22. A method for assaying a test compound for its ability to alter the expression of an MP-10 receptor, comprising: a) growing cells expressing said MP-10 receptor; b) collecting said cells; and c) comparing receptor expression in the cells exposed to said test compound with control cells grown under essentially identical conditions but not exposed to said test compound.

23. The method of claim 22, wherein said cells expressing said MP-10 receptor are cells transformed with an expression vector comprising a polynucleotide sequence encoding a protein with an amino acid sequence consisting essentially of the sequence shown in SEQ ID NO: 1.

24. The method of any one of claims 22 or 23, wherein said test compound is an oligonucleotide at least 15 nucleotides in length and comprising a sequence complementary to the sequence of said MP- 10 receptor.