AU2017352591A1

AU2017352591A1 - A two-part device for T-cell receptor synthesis and stable genomic integration to TCR-presenting cells

Info

Publication number: AU2017352591A1
Application number: AU2017352591A
Authority: AU
Inventors: Ryan Edward Hill; Reagan Micheal JARVIS; Luke Benjamin PASE
Original assignee: Genovie AB
Current assignee: Genovie AB
Priority date: 2016-11-07
Filing date: 2017-11-07
Publication date: 2019-05-02
Anticipated expiration: 2037-11-07
Also published as: CN110023497A; EP3535393B1; NZ752583A; EP3535393A1; JP2019534048A; ES2900151T3; US11274309B2; WO2018083318A1; JP6803480B2; KR20190076995A; CN110023497B; CA3039420A1; DK3535393T3; AU2017352591B2; US20190283017A1; KR102614328B1

Abstract

The present invention relates to a two-part device, wherein a first part is a multicomponent TCR ORF reconstitution and engineering system (TORES), and a second part is a multicomponent engineered TCR-presenting cell system (eTPCS).

Description

A two-part device for T-cell receptor synthesis and stable genomic integration to TCR-presenting cells

Field of the invention

The present invention relates to the construction, assembly and use of a two-part device for rapid synthesis of native and sequence-diversified T-cell receptor (TCR) open reading frames (ORFs), and the integration of these TCR ORFs to the genome of TCRpresenting cells. Due to the large degree of diversity generated in the natural TCR genesis process by somatic recombination, it is challenging to provide TCR open reading frames (ORFs) within genetic constructs on a high-throughput and cost-effective basis for testing and manipulation of TCR function. The first part of the present invention provides a pre-assembled two-component vector library system consisting of VariableConstant entry vectors (V-C entry) and Joining donor (J donor) vectors comprising portions of TCR gene segments. The two component system is designed in such a way that when a V-C entry vector selected from the V-C entry vector library is combined with a J donor vector selected from the J donor vector library, along with a synthetic DNA oligonucleotide duplex encoding TCR complementarity determining region 3 (odeCDR3) in a restriction enzyme digestion / ligase cycle reaction, a single vector is created reconstituting the full-length TCR ORF. Such a vector library system enables PCR-independent methods for rapid and cost effective generation of TCR ORFs in a selected vector context. In addition, this system permits novel workflows for generating synthetic TCR sequences for affinity and/or functional maturation workflows. This TCR ORF Reconstitution and Engineering System (TORES) is thus a strong tool for TCR functional analysis and engineering, when combined with the second part of the present invention, which represents an engineered TCR-presenting cell (eTPC). These eTPC cells contain a pair of synthetic genomic receiver sites that are paired with the TCR-encoding vector outputs from the TORES. Thus, TCR ORFs generated within the TORES are directly submitted to integration to the genome of an eTPC, such that the eTPC may be used for rapid, high-throughput generation of stable derivative cells that present TCR pairs (eTPC-t) for various analytical purposes. Importantly, the eTPC constitutively expresses all components of the CD3 complex, but lacks endogenous expression of TCR alpha, beta, gamma and delta chains. Overall, this two-part device may be used to rapidly generate eTPC-t as central components for analytical and clinical immunodiagnostic systems. Furthermore, the present invention relates to the use of the two-part device to identify, characterise and engineer TCRs for diagnostics, medicine, research and development.

WO 2018/083318

PCT/EP2017/078378

Introduction to the invention

Immune surveillance by T lymphocytes (T-cells) is a central function in the adaptive immunity of all jawed vertebrates. Immune surveillance by T-cells is achieved through a rich functional diversity across T-cell subtypes, which serve to eliminate pathogen-infected and neoplastic cells and orchestrate adaptive immune responses to invading pathogens, commensal microorganisms, commensal non-self factors such as molecular components of foodstuffs, and even maintain immune tolerance of self. In order to respond to various foreign and self factors, T-cells must be able to specifically detect molecular constituents of these foreign and self factors. Thus T-cells must be able to detect a large cross-section of the self and non-self molecules that an individual encounters, with sufficient specificity to mount efficient responses against pathogenic organisms and diseased self, while avoiding the mounting of such responses against healthy self. The highly complex nature of this task becomes clear when considering the practically unlimited diversity of both foreign and self molecules, and that pathogenic organisms are under evolutionary pressure to evade detection by T-cells.

The T-cell Receptor (TCR)

T-cells are primarily defined by the expression of a T-cell receptor (TCR). The TCR is the component of the T-cell that is responsible for interacting with and sensing the targets of T-cell adaptive immunity. In general terms, the TCR is comprised of a heterodimeric protein complex presented on the cell surface. Each of the two TCR chains are composed of two extracellular domains, being the variable (V)-region and the constant (C)-region, both of the immunoglobulin superfamily (IgSF) domain, forming antiparallel β-sheets. These are anchored in the cell membrane by a type-1 transmembrane domain, which adjoins a short cytoplasmic tail. The quality of the T-cells to adapt and detect diverse molecular constituents arises from variation in the TCR chains that is generated during T-cell genesis. This variation is generated by somatic recombination in a similar manner to antibody genesis in B-cells.

TCR chain diversity

The T-cell pool consists of several functionally and phenotypically heterogeneous subpopulations. However, T-cells may be broadly classified as αβ or γδ according to the somatically rearranged TCR isoform they express at their surface. There exist two TCR chain pair isoforms; TCR alpha (TRA) and TCR beta (TRB) pairs; and TCR gamma (TRG) and TCR delta (TRD) pairs. T-cells expressing TRA:TRB pairs are referred to as

WO 2018/083318

PCT/EP2017/078378 αβ T-cells, while T-cells expressing TRG:TRD pairs are often referred to as γδ T-cells.

TCRs of both αβ and γδ forms are responsible for recognition of diverse ligands, or ‘antigens’, and each T-cell generates αβ or γδ receptor chains de novo during T-cell maturation. These de novo TCR chain pairs achieve diversity of recognition through generation of receptor sequence diversity in a process called somatic V(D)J recombination after which each T-cell expresses copies of a single distinctly rearranged TCR. At the TRA and TRG loci, a number of discrete variable (V) and functional (J) gene segments are available for recombination and juxtaposed to a constant (C) gene segments, thus referred to as VJ recombination. Recombination at the TRB and TRD loci additionally includes a diversity (D) gene segment, and is referred to as VDJ recombination.

Each recombined TCR possess potential for unique ligand specificity, determined by the structure of the ligand-binding site formed by the a and β chains in the case of αβ T-cells or y and δ chains in the case of γδ T-cells. The structural diversity of TCRs is largely confined to three short hairpin loops on each chain, called complementarity-determining regions (CDR). Three CDRs are contributed from each chain of the receptor chain pair, and collectively these six CDR loops sit at the membrane-distal end of the TCR extracellular domain to form the antigen-binding site.

Sequence diversity in each TCR chain is achieved in two modes. First, the random selection of gene segments for recombination provides basal sequence diversity. For example, TRB recombination occurs between 47 unique V, 2 unique D and 13 unique J germline gene segments. In general, the V gene segment contributes both the CDR1 and CDR2 loops, and are thus germline encoded. The second mode to generate sequence diversity occurs within the hypervariable CDR3 loops, which are generated by random deletion of template nucleotides and addition of non-template nucleotides, at the junctions between recombining V, (D) and J gene segments.

TCR:CD3 Complex

Mature αβ and γδ TCR chain pairs are presented at the cell surface in a complex with a number of accessory CD3 subunits, denoted ε, γ, δ and ζ. These subunits associate with αβ or γδ TCRs as three dimers (εγ, εδ, ζζ). This TCR:CD3 complex forms the unit for initiation of cellular signalling responses upon engagement of a αβ or γδ TCR with cognate antigen. The CD3 accessories associated as a TCR:CD3 complex contribute signalling motifs called immunoreceptor tyrosine-based activation motifs (ITAMs).

WO 2018/083318

PCT/EP2017/078378

CD3s, CD3y and CD36 each contribute a single ITAM while the CD3( homodimer contains 3 ITAMs. The three CD3 dimers (εγ, εδ, ζζ) that assemble with the TCR thus contribute 10 ITAMs. Upon TCR ligation with cognate antigen, phosphorylation of the tandem tyrosine residues creates paired docking sites for proteins that contain Src homology 2 (SH2) domains, such as the critical ζ-chain-associated protein of 70 kDa (ZAP70). Recruitment of such proteins initiate the formation of TCR:CD3 signalling complexes that are ultimately responsible for T-cell activation and differentiation.

αβ T-cells αβ T-cells are generally more abundant in humans than their γδ T-cell counterparts. A majority of αβ T-cells interact with peptide antigens that are presented by complexes on the cell surface. These complexes are referred to as Major Histocompatibility Complexes (MHC), encoded by Human Leucocyte Antigen (HLA) family of genes, for simplicity both the gene and MHC will collectively be referred to herein as HLA. PeptideHLA (pHLA)-recognising T-cells were the first to be described and are by far the best characterised. More rare forms of αβ T-cells have also been described. Mucosal-associated invariant T (MAIT) cells appear to have a relatively limited a and β chain diversity, and recognise bacterial metabolites rather than protein fragments. The invariant natural killer T-cells (iNK T-cells) and germline-encoded mycolyl-reactive T-cells (GEM T-cells) are restricted to recognition of glycolipids that are cross-presented by non-HLA molecules. iNK T-cells are largely considered to interact with CD Id-presented glycolipids, whereas GEM T-cells interact with CD1b-presented glycolipids. Further forms of T-cells are thought to interact with glycolipids in the context of CD1 a and CD1 c, however, such cells are yet to be characterised in significant detail.

Conventional αβ T-cells

The key feature of most αβ T-cells is the recognition of peptide antigens in the context of HLA molecules. These are often referred to as ‘conventional’ αβ T-cells. Within an individual, self-HLA molecules present peptides from self and foreign proteins to Tcells, providing the essential basis for adaptive immunity against malignancies and foreign pathogens, adaptive tolerance towards commensal organisms, foodstuffs and self. The HLA locus that encodes HLA proteins is the most gene-dense and polymorphic region of the human genome, and there are in excess of 12,000 alleles described in humans. The high degree of polymorphism in the HLA locus ensures a diversity of peptide antigen presentation between individuals, which is important for immunity at the population level.

WO 2018/083318

PCT/EP2017/078378

HLA class I and II

There are two forms of classical HLA complexes: HLA class I (HLAI) and HLA class II (HLAII). There are three classical HLAI genes: HLA-A, HLA-B, HLA-C. These genes encode a membrane-spanning α-chain, which associates with an invariant 32-microglobulin (β2Μ) chain. The HLAI α-chain is composed of three domains with an immunoglobulin fold: a1, a2 and a3. The a3 domain is membrane-proximal and largely invariant, while the a1 and a2 domains together form the polymorphic membrane-distal antigen-binding cleft. There are six classical HLAII genes: HLA-DPA1, HLA-DPB1, HLADQA1, HLA-DQB1, HLA-DRA, and HLA-DRB1. These genes encode paired DP, DQ and DR heterodimeric HLA complexes comprising a α-chain and a β-chain. Each chain has two major structural domains with an immunoglobulin fold, where the a2 and β2 domain comprise membrane-proximal and largely invariant modules similar to that of HLAI a3 domain. The HLAII a2 and β2 domains together form the membrane-distal antigen-binding cleft and are regions of high polymorphism.

The antigen-binding cleft of HLAI and HLAII comprises two anti-parallel α-helices on a platform of eight anti-parallel β-sheets. In this cleft the peptide antigen is bound and presented in an extended conformation. The peptide-contacting residues in HLAI and HLAII are the location of most of the sequence polymorphism, which constitutes the molecular basis of the diverse peptide repertoires presented by different HLA alleles. The peptide makes extensive contacts with the antigen-binding cleft and as a result each HLA allele imposes distinct sequence constraints and preferences on the presented peptides. A given peptide will thus only bind a limited number of HLAs, and reciprocally each allele only accommodates a particular fraction of the peptide collection from a given protein. The set of HLAI and HLAII alleles that is present in each individual is called the HLA haplotype. The polymorphism of HLAI and HLAII genes and the co-dominant expression of inherited alleles drives very large diversity of HLA haplotype across the human population, which when coupled to the enormous sequence diversity of αβ TCR, presents high obstacles to standardisation of analysis of these HLA-antigen-TCR interactions.

αβ TCR engagement of HLAI and HLAII

The αβ TCR recognize peptides as part of a mixed pHLA binding interface formed by residues of both the HLA and the peptide antigen (altered self). HLAI complexes are presented on the surface of nearly all nucleated cells and are generally considered to

WO 2018/083318

PCT/EP2017/078378 present peptides derived from endogenous proteins. T-cells can thus interrogate the endogenous cellular proteome of an HLAI-presenting cell by sampling pHLAI complexes of an interacting cell. Engagement of HLAI requires the expression of the TCR co-receptor CD8 by the interacting T-cell, thus HLAI sampling is restricted to CD8⁺ αβ T-cells. In contrast, the surface presentation of HLAII complexes is largely restricted to professional APC, and are generally considered to present peptides derived from proteins exogenous to the presenting cell. An interacting T-cell can therefore interrogate the proteome ofthe extracellular microenvironment in which the presenting cell resides. The engagement of HLAII requires the expression of the TCR co-receptor CD4 by the interacting T-cell, thus HLAII sampling is restricted to CD4⁺ αβ T-cells.

Thymic selection of αβ TCR

The role of αβ TCR as described above is the detection of pHLA complexes, such that the TCR-presenting T-cell can raise responses germane to the role of that T-cell in establishing immunity. It should be considered that the αβ TCR repertoire generated within an individual must account for the immense and unforeseen diversity of all foreign antigens likely to be encountered in the context of a specific haplotype and prior to their actual occurrence. This outcome is achieved on a background where extremely diverse and numerous αβ TCRs are generated in a quasi-randomised manner with the potential to recognise unspecified pHLA complexes while only being specifically instructed to avoid strong interactions with self pHLA. This is carefully orchestrated during T-cell maturation in a process call thymic selection.

During the first step of T-cell maturation in the thymus, T-cells bearing αβ TCRs that are incapable of interacting with self-pHLA complexes with sufficient affinity, are deprived of a survival signal and eliminated. This step called positive selection assures that the surviving T-cells carry a TCR repertoire that is at least potentially capable of recognizing foreign or altered peptides presented in the right HLA context. Subsequently, αβ TCR that strongly interact with self-pHLA and thus have the potential to drive autoimmunity are actively removed through a process of negative selection. This combination of positive and negative selection results in only T-cells bearing αβ TCRs with low affinity for self-pHLA populating the periphery. This establishes an αβ T-cell repertoire that is self-restricted but not self-reactive. This highly individualised nature of T-cell genesis against HLA haplotype underscores the challenges in standardised analysis αβ TCR-antigen-HLA interactions. Moreover, it forms the basis of both graft rejection and graft versus host disease and the general principle that αβ TCRs identified in

WO 2018/083318

PCT/EP2017/078378 one individual may have completely different effect in a second individual, which has clear implications for TCR-based and T-cell based therapeutic and diagnostic strategies emerging in clinical practice.

Unconventional αβ T-cells

The non-HLA-restricted, or ‘unconventional’, forms of αβ T-cells have very different molecular antigen targets. These unconventional αβ T-cells do not engage classical HLA complexes, but rather engage conserved HLA-like proteins such as the CD1 family or MR1. The CD1 family comprises four forms involved in antigen cross-presentation (CD1a, b, c and d). These cell surface complexes have an α-chain resembling HLAI, which forms heterodimers with β2Μ. A small hydrophobic pocket presented at the membrane distal surface of the α-chain forms a binding site for pathogen-derived lipidbased antigens. Innate like NK T-cells (iNK T-cells) form the most well understood example of lipid/CD 1 family recognition and GEM T-cells representing another prominent example. The ‘Type I’ iNK T-cells are known to interact strongly with the lipid a-GalCer in the context of CD1d. These iNK T-cells display very limited TCR diversity with a fixed TCR α-chain (Va10/Ja18) and a limited number of β-chains (with restricted νβ usage) and they have been likened to innate pathogen-associated molecular patterns (PAMPS) recognition receptors such as Toll-like and Nod-like receptors. In contrast, ‘Type II’ NK T-cells present a more diverse TCR repertoire, and appear to have a more diverse mode of CD1 d-lipid complex engagement. GEM T-cells recognize mycobacteria-derived glycolipids presented by CD 1b, however, the molecular details of antigen presentation by CD1a, b and c as well as their T-cell recognition are only beginning to be understood.

MAIT cells largely express an invariant TCR α-chain (TRAV1-2 ligated to TRAJ33, TRAJ20, orTRAJ12), which is capable of pairing with an array of TCR β-chains. Instead of peptides or lipids MAIT TCRs can bind pathogen-derived folate- and riboflavinbased metabolites presented by the HLAI-like molecule, MR1. The limited but significant diversity in the TCRs observed on MAIT TCRs appear to enable the recognition of diverse but related metabolites in the context of the conserved MR1.

It is not well-understood how non-classical HLA-restricted αβ T-cell TCRs are selected in the thymus during maturation. However, it appears likely that the fundamental process of negative and positive selection outlined above still applies and some evidence suggests that this occurs in specialized niches within the thymus.

WO 2018/083318

PCT/EP2017/078378 γδ T-cells

In contrast to the detailed mechanistic understanding of αβ TCR genesis and pHLA engagement, relatively little is known about the antigen targets and context of their γδ Tcell counterparts. This is in part due to their relatively low abundance in the circulating T-cell compartment. However, it is broadly considered that γδ T-cells are not strictly HLA restricted and appear to recognize surface antigen more freely, similar to antibodies. More recently it has become appreciated that γδ T-cells can dominate the resident T-cell compartment of epithelial tissues, the main interaction site ofthe immune system with foreign antigen. In addition, various mechanisms for γδ T-cell tumour immunuosurveillance and surveillance of other forms of dysregulated-self are beginning to emerge in the literature. The specific antigen targets of both innate-like and adaptive γδ T-cells remain poorly defined but the tissue distribution and fast recognition of PAMPs suggests a fundamental role for γδ T-cells both early in responses to foreign antigens as well as early in life when the adaptive immune system is still maturing.

The diverse functions of γδ T-cells appear to be based on different Vy V6 gene segment usage and can be broadly understood in two main categories in which γδ T-cells with largely invariant TCRs mediate innate-like recognition of PAMPs very early during infection. Beyond PAMPs these type of γδ T-cells are furthermore believed to recognize self-molecules, including phosphoantigens that could provide very early signatures of cellular stress, infection and potentially neoplastic development. Recognition of PAMPs and such so-called danger associated molecular patterns (DAMPS) as well as the large numbers of tissue-restricted innate-like γδ T-cells strongly suggests that these cells are suited to respond rapidly to antigenic challenge without the need for prior activation, homing and clonal expansion.

A second form of γδ T-cells are considered to be more adaptive in nature, with a highly diverse γδ TCR repertoire and the ability to peripherally circulate and access lymphoid tissues directly. Such antigen-specific γδ T-cells have been described for common human pathogens such as CMV and they appear to form a memory response. However, it has also been observed that γδ T-cells show only relatively limited clonal proliferation after activation and little data is available on the extent of TCR diversity and specific responses of γδ T-cells in peripheral circulation, or in tissues. Furthermore, while it is generally considered that γδ TCRs do not interact with pHLA complexes and thus, do not engage with peptide antigens in this context, only a few antigen targets of γδ T

WO 2018/083318

PCT/EP2017/078378 cells have been characterised and the underlying molecular framework is only poorly understood.

The low frequency of peripheral γδ T-cells and the difficulty to study tissue-resident Tcells in humans has limited our knowledge of how this important and diverse type of Tcells participate in adaptive immune responses. This emerging area of research would require more reliable technologies with which to capture and characterise rare γδ Tcells, isolate their TCR pairs, and to identify their cognate antigens.

Antigens and Antigen-presenting cells

In the context of T-cells and TCRs, antigens may be defined as any molecule that may be engaged by a TCR and resulting in a signal being transduced within the T-cell. The most well characterised T-cell antigens are peptides presented in an HLAI and HLAII complex, and which are engaged by conventional αβ T-cells. However, in recent years it has become apparent that non-conventional αβ T-cells and γδ T-cells are able to engage a wide range of biomolecules as antigens, including lipids, lipopeptides, glycopeptides, glycolipds and a range of metabolites and catabolites. In addition, it has emerged that γδ T-cells may be able to engage fully folded proteins directly in an antibody-like fashion. Therefore, the view of T-cell antigens being largely restricted to HLApresented peptides has expanded over the past two decades to include almost any biomolecule. With this concept in mind, it is relevant to define what may be considered an antigen-presenting cell (APC).

As defined in the previous sections, HLAI and HLAII have a disparate expression profiles across cell types. It is widely accepted that nearly all nucleated cells present HLAI complexes on the cell surface, and are thus competent to present peptide antigens for T-cell sampling. In contrast, HLAII has a restricted expression profile, and at least in steady state conditions is only expressed on the surface of cells that have a specialist role in antigen presentation, including dendritic cells (DC), macrophage and B-cells. These specialist cell types are often referred to as professional APC. For the purposes of this document, the term APC is used to describe any nucleated cell that is capable of presenting an antigen for sampling by αβ or γδ T-cells. Such antigens are not restricted to those presented as ‘cargo’ in specific antigen-presenting complexes such as HLA and HLA-like molecules, but may also include any cell-surface presented moiety that is able to engage a αβ or γδ TCR-bearing cell.

WO 2018/083318

PCT/EP2017/078378

Therapeutic use of TCRs

Adoptive transfer of primary T-cells was first trialled in a clinical setting in the early 1990s, starting with ex vivo expanded T-cells polarised towards viral antigens to confer viral immunity in immunocompromised patients. Similar approaches using primary Tcells expanded ex vivo against specific cancer antigens were soon after trialled in treatment of malignancies. One limitation in these early approaches that continues to be a challenge today is a lack of understanding of the nature and diversity of T-cells clashing with the need to finely-optimize their composition in the therapeutic product. At present, the use of ex vivo expanded primary T-cells has largely been abandoned by the pharmaceutical industry with the exception of a handful of initiatives using primary Tcells with specificity for viral antigens.

In recent years the ability to reliably introduce genetic material into primary human cells has seen a variety of experimental genetically modified T-cell therapeutics arise. Such therapeutic cell products aim to harness the power of T-cell responses and redirect Tcell specificity towards a disease-associated antigen target, for example, an antigen uniquely expressed by malignant cells. These have largely relied on the transfer of a chimeric antigen receptor (CAR) into recipient T-cells, rather than actual TCR chain pairs. A CAR represents a targeting moiety (most often a single-chain antibody element targeting a surface expressed protein of malignant cells) grafted to signal receptor elements such as the ζ-chain of the CD3 complex, to produce a synthetic chimeric receptor that mimics CD3-TCR function. These so-called CAR T-cell (CAR-T) products have met mixed success in clinical trials to date and despite their potential are not easy to translate beyond tumours with inherent unique molecular targets such as B-cell malignancies. Alternatively, the transfer of full-length TCR chain pair ORFs into T-cells is of emerging interest. Such TCR-engineered T-cell therapeutics are at present limited by challenging manufacturing processes, and like the CAR-T products, a dearth of validated antigen targets and targeting constructs. To date this has been focused on the use of αβ TCRs for recognition of peptide antigens presented by HLAI on malignant cells and a fundamental challenge of this approach is the need for antigens that are specific to malignant cells.

It has been considered that since the TCR-pHLA interaction is of relatively low-affinity, native TCRs are likely to be suboptimal for TCR-engineered T-cell therapies. Several approaches have been devised to affinity-mature TCRs in vitro, in much the same

WO 2018/083318

PCT/EP2017/078378 manner as single-chain antibody affinity maturation. These TCR affinity maturation approaches generally also utilise a single-chain formats, wherein the V-region of one chain is fused to V-region of another chain to make a single polypeptide construct. Such single polypeptides may then be used in phage- or yeast- display systems adapted from antibody engineering workflows, and passed through rounds of selection based on target binding. Two inherent limitations exist in such a single-chain TCR approach in terms of yielding functional TCR chain pairs. Firstly, the selection is based on binding affinity to the target. However, it has been well documented that TCR affinity does not always correlate to the strength or competency of TCR signalling output. Secondly, the selection of single-chain constructs based on affinity does not always translate to equivalent affinities once they are reconstituted as full-length receptors.

In a therapeutic context, there exists an additional and crucial limitation in affinity-matured TCR pairs. That is, considering their sequences have been altered, the resulting constructs by definition have no longer been subject to thymic selection, wherein TCRs that react strongly to self-antigens are deleted from the repertoire. Therefore, these modified TCRs carry an inherent risk of being auto-reactive, which is very difficult to rule out in vitro using current methods. For the same reason, any selected or engineered TCR for therapeutic application needs to be individualised. If TCRs are artificially engineered or native TCRs applied across individuals, cross-reactivities have to be ruled out on the basis of the HLA haplotype and presented peptide repertoire of each specific individual in order to avoid potentially catastrophic autoimmunity. This is due to the fact that thymic selection is conducted on a background of all available HLA molecules specific only to that given individual. The likelihood of such cross-reactivity is unclear. However, the ability of our TCR repertoire to recognize pHLA complexes of other individuals of the same species as foreign is a fundamental property of adaptive immunity and underpins graft rejection and graft versus host disease. Recent clinical trials using a matured TCR chain pair against the cancer-specific melanoma associated antigen (MAGE) highlighted the potential problem of bypassing thymic selection. When autologous T-cells harbouring the matured TCRs were infused back to two cancer patients, these patients rapidly developed a fatal heart disease. Subsequent studies determined that the MAGE-specific matured TCRs were cross-reactive with an HLAI-presented peptide from the heart protein titin. This strongly suggests that cross-reactivity is a distinct possibility in therapeutic use of TCRs.

WO 2018/083318

PCT/EP2017/078378

A distinct avenue of utilising TCRs for therapeutic purposes is in their use as affinity reagents in much the same manner as antibody therapeutic substances. Single-chain TCR molecules have been trialled for delivery of conjugated drug substances to specific HLA-antigen expressing cell populations. Such an approach is generally considered safer than CAR-T or TCR engineered T-cell therapeutics, as administration ofthe drug substance may simply be withdrawn. However, the potential for cross-reactivity and off target effects that are difficult to predict remains a potential limitation in this setting.

TCR repertoire detection in clinical diagnostics

In a related aspect, there is an emerging interest in using the detection ofthe abundance of specific TCR sequences for clinical diagnostic purposes. With the rise of deep-sequencing methods in particular, it is possible to capture the full TCR diversity within an individual globally and for matched αβ pairs in specific contexts. This potentially represents a means to diagnose specific conditions and disease states simply by detecting the abundance of expanded T-cell clones, as proxy readout for established immune response against a disease-associated antigen in the patient. However, such global approaches are currently limited to very strong immune responses with established clinical time-points and suffer from the underlying difficulty in identifying the specific antigen target of any particular TCR identified via sequencing.

Therapeutic and diagnostic use of T-cell antigens

The fundamental strength of harnessing adaptive immune responses translates into a central technical challenge in that the exquisite specificity of the TCR-antigen interaction requires detailed knowledge ofthe antigens specifically associated with each pathogen, cancer cell or autoimmune disease. Furthermore, each antigen may be presented by a specific antigen presenting complex, or allele thereof, such that antigen discovery must be performed for each relevant HLA gene and allele. For several infectious diseases like HIV, influenza and CMV that are associated with strong adaptive immune responses and generally display conserved epitope response hierarchies, the most important epitopes have been mapped in context of some common HLA. Similarly, the fields of cancer, allergy and autoimmunity have seen increased and systematic efforts to map the associated T-cell antigens. However, these are challenging procedures and the efforts to systematically describe T-cell antigens associated with different clinical contexts are hindered by the absence of efficient, robust, fast and scalable protocols.

WO 2018/083318

PCT/EP2017/078378

Specifically, cancer cells represent a challenging and important aspect as most of the peptides presented on the surface of malignant cells are self antigens or very similar to self antigens. Therefore, thymic selection will have deleted TCRs that could strongly recognize these peptides, while at the same time the tumour has evolved to evade immune recognition. This means that potent immune responses against established tumours are relatively rare and targets difficult to predict or discover. However, these responses do exist and, importantly, are generally associated with better outcome. The target of such responses, tumour-associated-antigens (TAA), will in most cases have distinguishing characteristics from self and be derived from proteins that are overexpressed during cancer development, otherwise absent from the cell type at this stage of development or specifically altered through genetic mutation or post-translational modifications such as phosphorylation.

When available, the knowledge of such epitopes makes it possible to interrogate the associated T-cell response for fundamental discovery, diagnostic purposes and for example as a test of vaccine efficacy. Importantly, they also provide highly specific targets for T-cell tolerization in allergy and autoimmunity and, crucially, point towards valuable targets for specific immunotherapy and against malignant cells. Malignancies represent a particularly valuable target as the promise of cellular immunotherapies and the progress in the T-cell manipulations are slowed by a lack of validated target TAAs that go beyond the few cases where specific markers for the type of cancer happen to be available. In the light of the potential of cellular therapy and lack of validated targets the identification of promising TCR antigens remains one of the most pressing bottlenecks of TCR-based immunotherapy, particularly in the effort to treat cancer.

Technological aspects of TCR and T-cell antigen analyses

Overall, the development of TCR-based therapies is still in its early stages, and success has been limited. Diagnostic approaches, while of immense potential, have seldom been deployed into controlled clinical studies that aim to assess patient disease states or response to therapy. Underdeveloped techniques for the reliable capture of native TCR chain pairs, and standardised systematic analysis of TCR-antigen interactions at high-throughput and in a functional context of cell-cell communication, has been the main hurdle to the development of TCR-based therapies and diagnostics.

WO 2018/083318

PCT/EP2017/078378

Deep sequencing approaches have led to an improved understanding of T-cell receptor diversity in heath and disease. However, these approaches have generally focused on short stretches spanning the CDR3 regions, mainly of the TCR β-chain. Most studies have ignored the contribution of the TCR α-chain, and few have sought to analyse paired αβ chains as well as the antigen specificity of TCRs determined to be of interest. Recent workflows using single cell encapsulation and genetic barcoding has enabled the pairing of native TCR αβ or γδ chain pairs and analysis of full-length sequences, however, such workflows remain experimental.

Isolated TCR chain pairs may be analysed in terms of antigen specificity in either biophysical or functional modes. Biophysical analysis requires the recombinant production of both the TCR as well as the analyte antigen in soluble form. In the case of HLA-restricted TCRs this would thus require the generation of all individual TCRs as well as the cognate pHLA complexes. This is technically highly challenging, slow and very lowthroughput. Furthermore, such analysis would only provide interaction affinities, which are not well-correlated with functional characteristics in predictable ways.

Until recently, the detailed functional analysis of isolated TCR sequences in a cellular context has been limited to laborious protocols of transfection of analyte TCR chain pairs into primary T-cells or immortal T-cell lines, and detection of cellular responses by traditional flow cytometric analysis of cell activation, or detection of secreted factors from the transfected cells upon antigen challenge. In a recent publication by Guo et al, rapid cloning, expression, and functional characterization of paired TCR chains from single-cells was reported (Molecular Therapy - Methods and clinical development (2016) 3:15054). In this study, analyte human αβ TCR pairs were expressed in a reporter cell line that lacked αβ TCR expression, and which contained a green fluorescent protein (GFP) reporter system linked to the Nur77 promoter that is activated upon TCR stimulation. This system remains inefficient due to the lack of standardised TCR integration into the reporter cell line genome, and does not provide a systematic manner for cell-bound antigen challenge by an APC element.

Similar to workflows for identification of TCRs against known T-cell antigens, the de novo discovery of novel T-cell antigens in health and disease remains highly challenging. Most approaches remain biophysical in nature, and aim to produce candidate antigens that may be tested in immunisation protocols, or through identifying cognate

WO 2018/083318

PCT/EP2017/078378

TCRs as addressed above. Little or no standardisation exists in the field of T-cell antigen discovery, and the field is largely restricted to academic study.

With the accumulating interest in TCRs and their cognate antigen in both therapeutic and diagnostic use, and the emergence of means to capture significant numbers of native TCR αβ and γδ chain pairs, there remains a lack of reliable high-throughput and standardised technologies for the systematic analysis of TCR-antigen interactions. Importantly, there is a lack of standardised systems for functional analysis of TCR chain pairs in the native context of cell-cell communication wherein both the TCR and antigen are presented by a viable cell. Moreover, there is a lack of systems that may achieve TCR candidate selection, and/or affinity/functional maturation of TCR chain pairs, in the relevant context of cell-cell communication.

As described, there is currently a lack of standardised technologies for the highthroughput generation and expression of TCR chains, and their expression in a native cellular context. It is highly desirable to possess a system in which full-length TCRs may be generated rapidly, and inserted as single copies into the genome of a TCR-presenting cell such that said TCRs are presented in a native CD3 cell-surface complex for analysis. A CD3 complex-presented TCR pair assures that affinity analyses are reflective of the actual native TCR composition, which is not the case for single-chain TCR and other non-native TCR-display technology. Moreover, the presentation of TCR pairs in a CD3 complex is an absolute requirement for functional analysis of TCR pairs. Functional analysis, meaning analysis of TCR signalling output, is of critical importance in TCR engineering workflows where signal output is the parameter that is generally of greatest importance for therapeutic use, and is not well-correlated with the affinity of a TCR with cognate antigen/HLA.

Detailed description of the invention

The present invention addresses the above-mentioned needs. The present invention provides a two-part device suited for the genetic reconstitution and/or sequence diversification of TCR ORFs, and then insertion of these ORFs into engineered TCR-presenting cells (eTPC) for functional analysis and/or selection. Such a device is suitable for obtaining native and/or sequence-diversified chain pairs that may be rapidly analysed and selected in the native cell surface context of a CD3 complex.

WO 2018/083318

PCT/EP2017/078378

The first part of the two-part device contains of a two-component vector system comprising pre-assembled libraries of vectors harbouring variable (V), joining (J) and constant (C) sequences for TCR chains. The first component of the system comprises and V-C entry vector containing V and C sequences (component 1 A). The second component of the system comprises a J donor vector containing J sequence (component 1B). The two-component vector system is pre-assembled into libraries of V-C entry vectors and J donor vectors with all desirable V-C sequence combinations and J sequences, respectively. The two-component vector system is designed in such a manner that a single V-C entry vector and a single J donor vector with desired sequences can be combined with a third component, a short DNA oligonucleotide duplex encoding CDR3 (odeCDR3) (component 1C) sequence to reconstitute a full-length TCR ORF in vitro, in a single-tube reaction, in a restriction enzyme and ligase dependent and PCR independent manner. This three component TCR ORF reconstitution and engineering system (TORES) is ideally suited to rapidly generate large libraries of native, sequence-diversified or synthetic TCR ORFs for affinity or functional maturation workflows.

The first part of the present invention, defined as TORES, is summarised in Figure 1, Part 1. A selected V-C entry vector containing V and C TCR gene segments required for a target full-length TCR ORF is combined with a J donor vector that contains the required J TCR gene segment. The full-length TCR ORF is completed by the addition of an odeCDR3, which accounts for non-germline sequence generated during V(D)J recombination, and interposed by fixed germline encoded V and J sequence encoded by the V-C entry vector and J donor vector, respectively. The two-component vector system, and the third odeCDR3 component, is designed such that when combined into a restriction enzyme and ligase reaction, the desired full V-CDR3-J-C TCR ORF is reconstituted. Thus, this first part of the two-part device is used to assemble TCR ORFs into specific vector contexts, such that these TCR-encoding vectors represent integration vectors for operation of the second part of the two-part device.

The second part of the two-part device, comprises an engineered multicomponent cellular system, defined as engineered T-cell receptor presenting cell system (eTPCS). The second part. The multi-component system, comprised of at least three components summarised in Figure 1, Part 2. Firstly, an engineered TCR presenting cell (eTPC) (component 2A). secondly containing a pair of engineered genomic receiver

WO 2018/083318

PCT/EP2017/078378 sites (component 2B and 2D). Thirdly TCR-encoding genetic integration vectors derived from the first, TORES part, of the two-part device, which match the genomic receiver sites contained within the eTPC (component 2C and 2E). The matched genomic receiver site and integration vector (termed an integration couple) is used for rapid, stable integration of genetic material encoding TCR pairs. The eTPC may also further include an optional fourth component, a TCR-stimulation response element (component 2F), for in vitro detection and characterisation of TCR signalling response.

The two-part device is thus used to obtain native or sequence-diversified TCR ORFs in a specific integration vector context, or libraries thereof, and by combining these integration vectors with a matched eTPC, obtain an analyte eTPC expressing a single TCR pair (eTPC-t), or library thereof.

The present invention is used for rapid, high-throughput generation of stable derivative analyte cells that present full-length TCR pairs (eTPC-t). This two-part device is well suited for generating TCR-centric cell-based inputs to an analytical system that may be used directly in both research settings and clinical immunodiagnostic procedures. Thus, the two-part device is generally employed to derive TCR ORFs to subsequently prepare one or more analyte eTPC-t. These analyte eTPC-t are then combined with one or more analyte antigens (collectively the eTPC:Antigen system, eTPC:A) to obtain one or more outputs (Figure 24). The analyte antigen is provided by analyte antigenpresenting cells (APC) and/or as soluble or immobilised analyte antigen and/or presented on non-cell based particles (NCBP).

The present invention provides a standardised, flexible and systemisable two-part device to generate TCR ORFs (TORES) and engineered cell lines stably expressing TCR pairs on the cell surface (eTPCS). Single TCR ORF pairs may be presented by the engineered cells within the two-part device for detailed analyses, as may libraries of TCR ORFs. The generation of libraries of native or sequence-diversified TCR-presenting cells may be used for analytical or screening purposes to identify or engineer novel TCR specificities, or identify a cognate antigen for particular TCR pairs. The standardisation that is central to the present invention is a significant improvement on existing methodologies in terms of increasing reproducibility, decreasing production cycle times and thus decreasing costs of generating such analyte material. This standardisation is achieved through the robust integration vector / genomic receiver site subsystems that

WO 2018/083318

PCT/EP2017/078378 permit reliable ORF integration in controlled copy number at controlled genomic location; a significant improvement over previous random integrative and viral approaches to achieve similar TCR-presenting cells.

TORES: first part of the two-part device

The first part of the two-part device is denoted a TORES, which comprises a two-component vector system assembled into a library containing all required V, C and J gene segments for reconstitution of target TCR ORFs (Figure 1, Part 1). For instance, a library can be constructed to contain all gene segments encoding native protein sequences of the human TRA and TRB loci as described in Example 1.

It is sufficient to reconstitute a full-length TCR ORF using TORES, using sequence information that define the target TCR, V, J and C gene segment usage, along with nongermline CDR3 sequence. From this information, the V-C entry vector and J donor vector that correspond to the V/C and J usage of the target TCR ORF are first selected. An odeCDR3, representing a third component of the first part, corresponding the nongermline CDR3 sequence that is needed to complete the full-length TCR ORF is also generated. The three components are combined with a Type IIS restriction enzyme and DNA ligase enzyme in a reaction to generate the target full-length TCR ORF, and byproducts, as described in Figure 2. The resulting reconstituted full-length TCR is contained within the V-C entry vector backbone, thus contains all vector features contained within this parent construct.

The action of the Type IIS restriction enzyme of the three combined components (Figure 2,b,c) within a restriction enzyme / ligase reaction, results in two reaction by-products and two reaction intermediates. The V-C entry vector derived reaction by product is the excised native selection marker and Type IIS binding sites (Figure 2d). The J donor vector backbone from which the J segment part has been excised represents a second reaction by product (Figure 2e). The excised J segment part from the J donor vector represents a reaction intermediate, and contains both a J segment part, a small C part from the C segment, and single stranded overhangs required for ligation (Figure 2f). The second reaction intermediate is the parental V-C entry backbone containing the V and C segments, and single stranded overhangs required for ligation (Figure 2g). The final product of reaction represents a full-length TCR ORF reconstituted within the parental V-C entry vector backbone, comprised of ligation of the odeCDR3 (Figure 2c), the excised J segment part (Figure 2f) and the V-C entry backbone carrying the V

WO 2018/083318

PCT/EP2017/078378 and C gene segments (Figure 2g).

The V-C entry vector and J donor vector components of the first part

The first part of the two-part device includes one or more V-C entry vector (component 1A) containing

a. origin of replication,

b. a first positive selection marker,

c. 5’ genetic element, or elements,

d. Kozak Sequence,

e. TCR variable gene segment,

f. a first Type IIS sequence, for site specific recognition and cleavage by a Type IIS restriction enzyme,

g. a negative selection marker,

h. a second Type IIS sequence

i. TCR constant gene segment, and

j. 3’ genetic element, or elements wherein, a) and b) are used for propagation and selection of both parental V-C entry vector and the reconstituted TCR ORF-containing vector in a bacterial host; c) and j) are used to define the mode of integration to a matched genomic receiver site (component 2B or 2D) of the second part of the two part device, and any additional features required for downstream application; d) ensures efficient initiation of translation in eukaryotic cells; e) represents the variable (V) gene segment from the start codon to a motif at the 5’ edge of the CDR3 region conserved across all V segments in a given two-component vector system; f) represents a Type IIS recognition sequence that directs a Type IIS restriction enzyme to cut in the 5’ direction as to create a standardised single stranded overhang at the 3’ end of the V gene segment; g) represents a negative selection marker to eliminate parental V-C entry vector during operation of the system to reconstitute a full-length TCR ORF; h) represents a Type IIS recognition sequence that directs a Type IIS restriction enzyme to cut in the 3’ direction as to create a standardised single stranded overhang at the 5’ end of the C gene segment; i) represents the C gene segment from a motif at the 5’ end of the C gene segment conserved across all C segments, or part of the C gene segment lacking a proportion of the 5’ end of the C gene segment, in a given two-component vector system, and which defines the boundary with the J segment (see Figure 2a).

WO 2018/083318

PCT/EP2017/078378

The first part of the two-part device comprises a component designated 1B, includes one or more J-donor vector containing

a. origin of replication,

b. a second positive selection marker,

c. a third Type IIS sequence,

d. TCR Joining gene segment,

e. A C part, corresponding to a small 5’ portion of a constant gene segment, and

f. a fourth Type IIS sequence.

wherein, a) and b) are used for propagation and selection of the J donor vector; c) represents a Type IIS recognition sequence that directs a Type IIS restriction enzyme to cut in the 3’ direction as to create a standardised single stranded overhang at the 5’ end of the J gene segment; d) represents the Joining (J) gene segment starting from a 5’ motif defining the 3’ edge of the CDR3 region conserved across all J segments in a given two-component vector system, to a 3’ sequence that incorporates C part, representing a 5’ portion of the C segment encoded by V-C entry vector(s) contained within the two-component system; f) represents a Type IIS recognition sequence that directs a Type IIS restriction enzyme to cut in the 5’ direction as to create a standardised single stranded overhang at the 3’ end of the J gene segment, and contained within the C part portion of the sequence (see Figure 2b).

A J-donor vector does not strictly need to carry a C part sequence, encoding a small 5’ portion of the C gene segment. This C part is used to optimise and standardise overhangs for the reconstitution reaction during operation of a TORES. This is because of the higher sequence variation found at the 3’ end of J gene segments, such that inclusion of a C part thus allows standardisation by generation of overhangs within the less diverse C gene segment. In the instance of constructing a TORES for a TCR loci from other organism that does not have 3’ J segment diversity, or using synthetic J gene segments, this C-part may be omitted in favour of standardisation of overhangs within said J segments. This would reduce the complexity of the J donor library construction.

Each of the first, second, third and fourth Type IIS sequences encoded in the V-C entry vector(s) and J donor vector(s), may be the same or different. Preferably, they are the same. This ensures that each of the restriction sites within the two-component vector system is compatible with the same Type IIS enzyme, and only a single enzyme is needed for the restriction enzyme / ligase reaction during reconstitution of full-length

WO 2018/083318

PCT/EP2017/078378

TCR ORF using TORES. Type IIS enzymes do not cut within their recognition sequence, and thus the single-stranded overhangs are generated extrinsic to the recognition sequence. Therefore, the nature of the overhang generated upon Type IIS restriction enzyme action is dependent on both the orientation of the recognition sequence, and indeed the adjacent sequence (see Example 1).

Alternatively, each of the Type IIS restriction sequences may be different from one another. However, with the addition of each unique recognition sequence, an additional Type IIS enzyme must be incorporated into the restriction enzyme / ligase reaction. This would increase the complexity and cost of a reconstitution reaction for assembling a full-length TCR ORF.

The first and second positive selection markers within the V-C entry vector and J donor vector, respectively, are preferably different. This is to ensure that the V-C entry vector, which provides the backbone of the final full-length TCR ORF product, can be selected for independently of the J donor vector, and thus eliminate transformants that carry undigested or re-circularised J donor vectors that would otherwise contribute background to the reconstitution reaction (see Figure 2).

The positive selection markers can be selected from

a. an antibiotic resistance gene,

b. an auxotroph complementing gene,

c. a reporter gene wherein the choice, formatting and application of such positive selection markers are well known to those skilled in the art.

The 5’ genetic element incorporated into a V-C entry vector comprises one or more elements selected from

a. gene cis/acting element,

b. heterospecific recognition site for recombinase enzymes,

c. a 5’ homologous recombination arm for a genomic site of interest’

d. a mRNA splice acceptor site,

e. an internal ribosomal entry site, and

f. epigenetic insulator sequence

WO 2018/083318

PCT/EP2017/078378 wherein, at least one of b) and c) are included, and are matched to the genomic receiver sites included for as component 2B and 2D of the two part device; a) drives expression of the transcript encoded by the full-length TCR ORF product reconstituted within the V-C entry vector backbone; b) represents a sequence that directs site-directed recombination in the presence of recombinase enzymes to insert the full-length TCR ORF product reconstituted within the V-C entry vector backbone into a specific genomic context of the eTPC of part 2 of the two part device; c) represents a sequence that directs site-directed homologous recombination to insert the full-length TCR ORF product reconstituted within the V-C entry vector backbone into a genomic context of the eTPC of part 2 of the two part device; d) permits engineered domain-fusion approaches to manipulate the form of the protein expressed from the full-length TCR ORF reconstituted in the V-C entry vector backbone e) permits cap-independent initiation of translation of the mRNA expressed from the full-length TCR ORF reconstituted in the V-C entry vector backbone f) permits insulation of transcriptional activity otherwise affected by enhancer elements in a genomic context of where the full-length TCR ORF reconstituted in the V-C entry vector backbone may be inserted.

A cis/acting element may be included to drive expression of TCRs reconstituted into a V-C entry vector backbone once inserted to the genomic receiver sites of the eTPC. However, this would permit transient expression of TCR chains on delivery of the generated integration vectors to the eTPC during integration. Therefore, it is preferential for cis/acting element(s) to be included within the genomic receiver site itself, such that TCR chains may only be expressed once integrated to the correct genomic context.

A V-C entry vector backbone may encode a heterospecific recognition site for recombinase enzymes permitting recombinase mediated cassette exchange (RMCE) of reconstituted full length TCR ORFs, Example 1, when said vector containing a reconstituted TCR ORF is transfected into mammalian cells in the presence of appropriate recombinase enzyme.

A first Type IIS recognition sequence that is included in the V-C entry vector is orientated to cleave 5’ of said recognition sequence and within the TCR variable gene segment (Figure 2a) to produce a single-stranded DNA overhang at the 3’ end of the variable gene segment (Figure 2g) that is complementary to that at the 5’ end of the synthesised odeCDR3 (Figure 2c) For details on how this first Type IIS recognition sequence is designed, see Examples 1 and 2.

WO 2018/083318

PCT/EP2017/078378

A V-C entry vector contains a negative selection marker between the first Type IIS recognition sequence, and the second Type IIS recognition sequence (infra vide, Figure 2a). This negative selection marker is selected from one or more

a. a restriction enzyme recognition site not contained elsewhere in the first component or within the TCR joining gene segment,

b. a gene encoding a bactericidal agent,

c. a reporter element.

wherein, the negative selection marker is used to eliminate host cells transformed with parental V-C entry vector, and thus reduce the background of a reconstitution reaction when using the first positive selection marker to select for transformants containing the target TCR ORF within the V-C entry vector backbone (see Example 3).

With the exception of the negative selection marker itself, all other sequences in the two-part system must be devoid of said sequence as to not confer undue negative selection of the basis of the inclusion of this sequence elsewhere in the system.

In the present context, a second Type IIS recognition sequence that is included in the V-C entry vector is orientated to cleave 3’ of said recognition sequence and within the TCR constant gene segment (Figure 2a) to produce a single-stranded DNA overhang at the 5’ end of the constant gene segment (Figure 2g) that is complementary to that at the 3’ end of the J donor fragment reaction intermediate (Figure 2f) For details on how this second Type IIS recognition sequence is designed, see Examples 1 and 2.

The 3’ genetic element incorporated into a V-C entry vector comprises one or more elements selected from

a. a terminator element,

b. heterospecific recognition site for recombinase enzymes,

c. a 3’ homologous recombination arm for a genomic site of interest,

d. a mRNA splice donor site,

e. an internal ribosomal entry site, and

f. epigenetic insulator sequence.

WO 2018/083318

PCT/EP2017/078378 wherein, at least one of b) and c) are included, and are matched to the genomic receiver sites included for as component 2B and 2D of the two part device; a) represents a sequence that directs transcriptional termination for effective mRNA production of the TCR ORF in situ and may encode a poly-A signal; b) represents a sequence that directs site-directed recombination in the presence of recombinase enzymes to insert the full-length TCR ORF product reconstitute within the V-C entry vector backbone into a specific genomic context of the eTPC of part 2 of the two part device c) represents a sequence that directs site-directed homologous recombination to insert the full-length TCR ORF product reconstituted within the V-C entry vector backbone into a specific genomic context of the eTPC of part 2 of the two part device; d) permits the fusion of a TCR ORF to a transcriptional unit after integration into a genomic locus encoding a downstream mRNA splice acceptor site to manipulate the strength of TCR expression levels or form of the protein expressed from the full-length TCR ORF reconstituted in the V-C entry vector backbone e) permits cap-independent initiation of translation of the mRNA expressed from the full-length TCR ORF reconstituted in the V-C entry vector backbone f) Prevent inappropriate interaction between adjacent chromatin domains, thus insulating the full-length TCR ORF from adjacent transcriptional regulation or spread of heterochromatin in a genomic context of where the reconstituted TCR ORF in the V-C entry vector backbone may be inserted

A terminator element may be included to ensure transcriptional termination during expression of TCRs reconstituted into a V-C entry vector backbone, and integrated into the genomic receiver sites of the eTPC. The terminator sequence may also be included within the genomic receiver site itself as outlined in Example 1.

A V-C entry vector backbone may encode a heterospecific recognition site for recombinase enzymes permitting recombinase mediated cassette exchange (RMCE) of reconstituted full length TCR ORFs, Examples 1, when said vector containing a reconstituted TCR ORF is a transfected into eTPC with matched genomic receiver sites in the presence of appropriate recombinase enzyme as outlined in Examples 3, 4 and 5.

A J donor vector contains a J gene segment with a C-part sequence, representing a 5’ fragment of the C gene segment, to the 3’ of the J gene segment (Figure 2b).

WO 2018/083318

PCT/EP2017/078378

The C-part sequence is designed to standardise the single stranded overhangs generated by Type IIS enzyme action within the at the 3’ end of the J donor vector-derived J fragment reaction intermediate (Figure 2f), and that at the 5’ end of the C gene segment within the Type IIS digested open V-C entry vector reaction intermediate (Figure 2g).

A third Type IIS recognition sequence that is included in the J donor vector is orientated to cleave 3’ of said recognition sequence and within the TCR joining gene segment (Figure 2b) to produce a single-stranded DNA overhang at the 5’ end of the joining gene segment (Figure 2f) that is complementary to that at the 5’ end of the synthesised odeCDR3 (Figure 2c) For details on how this third Type IIS recognition sequence is designed, see Examples 1 and 2

A fourth Type IIS recognition sequence that is included in the J donor vector is orientated to cleave 5’ of said recognition sequence and within the TCR C-part (Figure 2b) to produce a single-stranded DNA overhang at the 3’ end of the C-part (Figure 2f) that is complementary to that at the 5’ Type IIS digested open V-C entry vector reaction intermediate (Figure 2g). For details on how this third Type IIS recognition sequence is designed, see Examples 1 and 2.

Within the two-part vector system, all vectors sequences should not contain extra Type IIS recognition sequences for the Type IIS restriction enzyme used for TORES assembly reactions. Inclusion of such sequences would result in Type IIS restriction enzyme action within the encoded gene segments or parts, and result in disruption of the TCR reconstitution process. Similarly, the Type IIS recognition sequences should not be included in the odeCDR3 representing a third system component (infra vide).

A two-component vector system of the TORES may be constructed for any collection of TCR chains. In example 1 below, two-component vector systems are constructed for the human TRA and TRB loci, encoding the human TCR alpha and beta chains, respectively. The construction of such a TORES is equally applicable in the context ofthe TRD and TRG loci, encoding the TCR delta and gamma chain pair, respectively, or indeed for any TRA/TRB, TRD/TRG or variant TCR chain pair system found in jawed vertebrates. Such a TORES system may also incorporate synthetic TCR gene fragments to permit assembly of synthetic variant TCR OFRs for engineering of cell-expressed TCRs or recombinant TCR proteins.

WO 2018/083318

PCT/EP2017/078378

The third odeCDR3 component of the first part of the two-part system

To reconstitute a full-length TCR ORF using any given TORES, a small ORF fragment not encoded by the two-component V-C entry vector and J donor vector system is required as a third component. This third component takes the form of an oligonucleotide duplex encoding CDR3 (odeCDR3), designated component 1C.

Such a third component 1C, odeCDR3, comprises

a. a first single strand overhang sequence complimentary to the overhang generated by the Type IIS restriction enzyme binding to the first Type IIS recognition site within the TCR variable gene segment of the V-C entry vector,

b. a double strand segment encoding a TCR CDR3 region and devoid of negative selection element, which negative selection element is as defined in claim 10, and also devoid of any Type IIS restriction sequences for the Type IIS restriction enzyme(s) added to the TORES reactions mix.

c. a second single strand overhang sequence complimentary to the overhang generated by the Type IIS restriction enzyme binding to the third Type IIS recognition site within the TCR joining gene segment of the J donor vector.

Alternatively,

d. the odeCDR3 can be comprised of a dsDNA molecule encoding the CDR3 flanked by two Type IIS enzymes consistent with the first or second component, oriented such that when digested a product comprising of a, b and c described previously is generated, and two by-products encoding short dsDNA fragments the Type IIS sites. This alternative dsDNA odeCDR3 is compatible the restriction enzyme / ligase reaction, not requiring prior digestion.

Methods to use a TORES to reconstitute full-length TCR ORFs

A TORES, the first part of the two-part device, can be used to reconstitute a full-length TCR ORF in a genetic vector context, from sequence information, as is presented for a human TRA/TRB chain pair in Example 3.

To operate a TORES to reconstitute a full-length TCR ORF from sequence information, given the resource of a two-component vector system for a given TCR chain, the method comprises

a. selecting a V-C entry vector,

b. selecting a J donor vector,

WO 2018/083318

PCT/EP2017/078378

c. selecting an odeCDR3,

d. combining a, b and c to react with i) Type IIS restriction enzyme(s) to cleave all Type IIS restriction enzyme recognition and cleavage sites present in the V-C entry vector and in the J donor vector and ii) DNA ligase enzyme and iii) subjecting the combined mix to a temperature controlled reaction,

e. transforming the reaction product obtained from step d to a selectable host organism competent for DNA vector propagation, and

f. performing a selection of host organism to obtain full length reconstituted TCR open reading frame in the V-C entry vector backbone.

wherein, a) and b) are selected on the basis ofthe selected vector encoding the V,J and C gene segments in the target full-length TCR ORF; c) is selected on the basis of completing the full-length TCR ORF sequence not encoded by the V-C entry or J donor vectors selected in a) and b), and bounded by the Variable and Joining segments encoded therein; d) combining the three selected components into a reaction mixture along with a restriction enzyme that will cut the first, second, third and fourth Type IIS restriction enzyme recognition sequences within the V-C entry and J donor vectors; e) generally represents transformation-competent bacteria; f) selection of host is on the basis of the first positive selection marker provided by the V-C entry vector backbone.

Generally, a workflow to select and define the genetic elements of a full-length TCR ORF for reconstitution entails de novo sequencing of TCR chains from target organism tissues. A generalised workflow, would incorporate reverse transcription and PCR based amplification of TCR chain pairs from sorted single cells with subsequent Sanger sequencing. Alternative sequencing methods may be applied; the generally critical parameter is to maintain TCR ORF pairing. Moreover, There exists a requirement for high-quality sequence information spanning V, CDR3, J and C segments ofthe TCR ORF, which dictates the specific sequencing approach(es) taken.

A method for selecting and reconstituting a TCR open reading frame thus comprises

a. Obtaining a TCR open reading frame sequence wherein said sequence information is sufficient to identify i) variable gene segment usage ii) constant gene segment usage iii) joining gene segment usage iv) a full CDR3 sequence spanning the variable gene segment border to the joining gene segment border, and

b. selecting a V-C entry vector corresponding to the variable and constant gene segments identified in step a. i) and a. ii), respectively, and

WO 2018/083318

PCT/EP2017/078378

c. selecting a J donor vector corresponding to the joining gene segment identified in step a, iii), and

d. generating an odeCDR3 corresponding to CDR3 sequence identified in step a.

iv), and

e. combining b, c and d to react with i) Type IIS restriction enzyme(s) to cleave all Type IIS restriction enzyme recognition and cleavage sites present in the V-C entry vector and in the J donor vector and ii) DNA ligase enzyme, iii) subjecting the combined mix to a temperature controlled reaction, and

f. transforming the reaction product obtained from step e. to a selectable host organism competent for plasmid replication, and

g. performing a selection of host organism to obtain full length reconstituted TCR ORF in the V-C entry vector backbone.

wherein, a) is conducted by sequencing methods well known to one skilled in the art, able to obtain sufficient sequence length and quality to identify all four required genetic elements; b) and c) are selected from a TORES library containing required vectors; d) is synthesised de novo, or selected from a odeCDR3 library; e) is conducted in a single reaction vessel.

In order to select the appropriate V-C entry vector, J donor vector and odeCDR3, target TCR sequences were aligned against a library of V, C and J gene segments fortheir corresponding TCR chains to determine the V, C and J segment usage of the target chain. This sequence alignment and analysis step must also permit the definition of the CDR3 coding sequence, and thus the definition of odeCDR3 sequence. Thus, overall such sequence analysis permits the selection of V-C entry vectors and J donor vectors for TCR chain reconstitution. The analysis also permits the synthesis of odeCDR3 for each chain reconstitution reaction.

It is desirable to conduct the Type IIS digestion and DNA ligase-dependent ligation (step e) in a single reaction. This minimises processing steps, and is made possible by the design of the system, with Type IIS restriction enzymes cutting outside their recognition sequences, such that a number of unique overhangs may be generated with a single enzyme, thus maintaining efficient directional cloning of the J donor vector reaction intermediate and odeCDR3 into the V-C entry vector backbone.

Alternatively, the Type IIS restriction digest and DNA ligation may be performed in sequential procedures.

WO 2018/083318

PCT/EP2017/078378

One example of a common application of the TORES is exemplified in the context of single-cell fluorescence-activated cell sorting (FACS) of antigen-specific = T-cells from human tissues for reverse transcription and PCR based amplification of TRA/TRB TCR chain pairs, followed by Sanger sequencing. This is a generally applicable workflow, wherein any tissue may be the source of T-cells from any jawed vertebrate, and cells may be sorted based on any phenotypic characteristics. The single-sorted cells need not be stained for antigen specificity using pHLA-multimer reagents.

The TCR sequencing approach used is not restricted to any particular method or technology, provided sufficient high-quality sequence information is obtained such that the above-defined genetic characteristics of the TCR ORF(s) can be defined based on said sequence information.

The use of FACS for partitioning single cells such that native TCR chain pairs may be sequenced and identified is a powerful method due to the accurate and rich phenotypic information that may be collected with multi-specificity antibody panels. However, other methods exist to partition cells, including; emulsion PCR; digital PCR approaches using microfluidic cell encapsulation, droplet digital PCR using physical partitioning substrates.

It is generally desirable to obtain native TCR pairs from a source material, as both chains of a TCR pair contribute to HLA-antigen engagement and recognition. However, there are instances where recovery of just a single chain may be desirable, such as high-throughout screening of a single chain against a set specificity. In such a case, TCRs may be amplified and/or sequenced from non-partitioned cells.

Methods to use a TORES to generate full-length TCR ORFs with diversified sequence A TORES system is ideally suited to generate diversified full-length TCR ORFs in several systematic modes. Such systematic diversification may be applied to affinity and/or functional maturation workflows for TCR chains. Such diversification of target TCR chain sequences is well described in Example 5.

WO 2018/083318

PCT/EP2017/078378

Such TCR ORF sequence diversification methods follow the same general scheme as for a reconstitution reaction. Diversification can be conducted in multiple parallel reconstitution reactions, whereby a single variant TCR ORF is generated per reaction. However, in most scenarios it is desirable to generate a pool of variant TCR ORFs in a single reaction. Each of these approaches is achieved by providing multiple variants of one or more of each genetic component (V-C entry vector, J donor vector, odeCDR3) to a reconstitution reaction.

As described in Example 5, a TCR ORF can be systematically diversified at the CDR3 region by adding a pool of odeCDR3 with defined positional sequence diversity (Figure 3).

A method for selecting and reconstituting a TCR open reading frame to achieve TCR ORF diversity in the CDR3 region, thus comprises

d. generating two or more odeCDR3 corresponding to CDR3 sequence identified in step a. iv), with variant sequence composition, and

g. performing a selection of host organism to obtain full length reconstituted TCR open reading frame in the V-C entry vector backbone.

WO 2018/083318

PCT/EP2017/078378 wherein, a) is conducted by sequencing methods well known to one skilled in the art, able to obtain sufficient sequence length and quality to identify all four required genetic elements; b) and c) are selected from a TORES library containing required vectors; d) is synthesised de novo, or selected from a odeCDR3 library; e) is conducted in a single reaction vessel

Such a method can be achieved by pooling all odeCDR3 variants to a single reaction to generate a pool of sequence-diversified, but may be equally achieved by providing each odeCDR3 variant to a parallel reaction.

Variant odeCDR3 can be generated via a variety of methods well known to those skilled in the art. The selection of position and extent of odeCDR3 degeneracy/diversity can range from a single residue change at a single position, to completely degenerate sequence to the length of the odeCDR3.

A TCR ORF can be systematically diversified by maintaining the CDR3 region via provision of a single odeCDR3, but diversifying V,C and J segment usage by providing two or more of the V-C entry vector and/or J donor vector to the reconstitution reaction (Figures 4, 5 and 6).

A method for selecting and reconstituting a TCR open reading frame with diversified V,C and/or J segment usage, thus comprises

b. selecting two or more V-C entry vectors not corresponding to the variable and constant gene segments identified in step a. i) and a. ii), respectively, and

c. selecting two or more J donor vectors not corresponding to the joining gene segment identified in step a, iii), and

d. generating an odeCDR3 corresponding to CDR3 sequence identified in step a. iv), and

WO 2018/083318

PCT/EP2017/078378

Such a method can be achieved by pooling all V-C entry vectors and/or J donor vector variants to a single reaction to generate a pool of sequence-diversified, but may be equally achieved by proving each vector variant to a parallel reaction.

Each V-C entry and J donor vector from a given library could be selected to provide full coverage of V,C and J gene segments.

Any combination of CDR3 and V, C and J diversification describe above could be used to generate pools or libraries of diversified TCR ORFs.

This system can be used to generate entirely synthetic libraries of TCRs ORFs with full coverage of native V,C and J gene segment usage, and defined CDR3 characteristics.

Features of a TORES with regard to Reconstitution and Diversification Methods As mentioned above, it is desirable to conduct the assembly reaction with a single Type IIS restriction enzyme. This economises the use of restriction enzyme, and is made possible by the nature of Type IIS action, and the design of unique single stranded overhangs in the two-component vector system and odeCDR3.

Alternatively, up to four Type IIS restriction enzyme recognition sequences across the four Type IIS recognition sites of the V-C entry vector and J donor vector.

For efficient cloning of TCR ORF products, at least one step of negative selection is performed during the assembly of a full-length TCR ORF using the TORES, selected from

WO 2018/083318

PCT/EP2017/078378

a. performing restriction enzyme digest of reaction product to eliminate parental VC entry vector

b. performing a conditional bactericidal agent selection to eliminate competent hosts transformed with parental V-C entry vector, and/or

c. performing selection of host cells transformed with parental V-C entry vector by way of reporter identification.

wherein, the negative selection is used to eliminate parental V-C entry vector that have remained undigested by the Type IIS enzyme(s), or have re-ligated to the parental form after digestion.

Elimination of parental V-C entry vector is critical, considering that the V-C entry vector backbone, and thus the positive selection marker carried in this backbone, is used for positive selection of the vector containing the full-length TCR ORF reaction product.

In the present context, negative selection is performed using a restriction enzyme site has been designed within the reaction by-product excised from the V-C entry vector (Figure 2d). This negative selection procedure is described in examples 3.

Any one, or a combination of the above-mentioned negative selection methods can be employed to eliminate parental V-C entry vector from the final cloned products. Such a negative selection procedure may be omitted if the cloning efficiency is deemed high enough for efficient recovery of cloned reaction products.

The selection of the cloned full-length TCR ORF containing vectors in transformed host organism is required to obtain the final cloned product. Such selections are well-known to those skilled in the art.

A host organism represents bacteria that are either induced or naturally transformation competent, and the selection of transformants containing the full-length TCR ORF contained in a V-C entry vector backbone comprises antibiotic selection. This entails adding antibiotic to the culture system in which the transformed cells are placed, and resistance to this antibiotic is encoded by the gene represented as the first positive selection marker in the V-C entry vector backbone.

WO 2018/083318

PCT/EP2017/078378

Alternatively, removal of auxotrophic factors of the culture system in which transformants are placed can be a form of positive selection, wherein auxotrophic complementation is conferred by a gene product encoded in the V-C entry vector backbone. A combination of the above-described positive selections may be employed.

V-C entry vector and J donor vector libraries

For the efficient operation of a TORES to perform reconstitution or diversification of selected TCR ORFs, the pre-construction of a V-C entry vector and J donor vector library is required. It is from this library, which is specific for each TCR chain form, that selections are made to fulfil the V/J/C usage of the target TCR ORF sequence, when complemented with the odeCDR3 sequence.

V-C entry and J donor vector libraries may be constructed to contain all germline TCR V/J/C gene segments of an organism having such TCRs. Such a library may also include all V-C combinations in the V-C entry vector, as for the TRB locus specific TORES presented in Example 1, wherein the library is replicated with both Constant gene segments against each Variable segment.

A library of V-C entry and J donor vectors may contain V/J/C gene segments, such that translated amino acid sequence of the encoded protein is unmodified in relation to the protein sequence encoded by the germline gene segments.

Such a library permits change in the underlying nucleic acid sequence as to generate a library otherwise devoid of unwanted Type IIS recognition sequences, or positive and negative selection elements. Changes in the underlying nucleic acid sequence can also be used for codon optimisation, for optimal expression of reconstituted TCR chains.

Alternatively, a library of V-C entry and J donor vectors may contain V/J/C gene segments, such that translated amino acid sequence of the encoded protein is modified in relation to the protein sequence encoded by the germline gene segments.

Such a library may be used to construct TCRs with characteristics that are optimised for different diagnostic or therapeutic uses. Changes in framework residues or regions within the V/J/C gene segments could be used to increase expression or stability in various scenarios, such as expression of TCRs as soluble reagents. Similarly, alterations in framework regions that are not involved in direct HLA-antigen contacts may be

WO 2018/083318

PCT/EP2017/078378 used to alter the signalling capacity of reconstituted TCRs produced by the TORES. Affinity tags or immunogenic sequences may also be encoded within framework regions as to aid in purification and/or detection of the reconstituted TCRs in downstream applications.

V-C entry and J donor vector libraries may be assembled into kit comprising a combination of

a. one or more V-C entry vectors encoding combinations of Variable and Constant gene segments, and

b. one or more J donor vectors encoding J gene segments, and optionally

c. one or more odeCDR3, or one or more pooled libraries of odeCDR3, with single stranded overhangs, pre-exposed or flanked by Type IIS restriction sites for liberation during the restriction digestion / ligation reaction, matched to V-C entry vector and J donor vector single strand overhangs, and optionally

d. one or more standardised odeCDR3 with single stranded overhangs, pre-exposed or flanked by Type IIS restriction sites for liberation during the restriction digestion / ligation reaction, matched to V-C entry vector and J donor vector single strand overhangs as positive control odeCDR3, and optionally

e. A pre-assembled full-length TCR ORF as a reference wherein, a) and b) cover the required genetic diversity of gene segments from a target organism, with unmodified or modified amino acid sequence relevant for the intended application; c) is used for reconstitution of TCR chains with defined or diversified CDR3; d) is used as a positive control in reconstitution reactions, e) is used as a positive control in downstream applications of full-length TCR ORFs reconstituted with the V-C entry vector and J donor vector libraries provided in said kit.

Definition of Part 1 device outputs as Part 2 device inputs

In operation of the overall two-part device, the first part (TORES) is used to generate one or more TCR chains within the defined integration vector context. TCR represent heterodimeric complexes, such that a TORES will generally comprise two parallel assembly subsystems for each chain of a TCR chain pair. Thus, a TORES, as the first part of the two-part device will generate two outputs comprising two integration vectors each encoding one chain of a TCR chain pair, or libraries thereof. Products components 2C and 2E of the TORES system this represent integration vectors that are presented in the V-C entry backbone of component 1 A.

WO 2018/083318

PCT/EP2017/078378

These outputs from part 1 of the two-part device are used as direct inputs to the second part of the two-part device (Figure 1). These vector outputs from the first part and inputs to the second part are designated components 2C and 2E. Each of these inputs is paired with a genomic receiver site components 2B and 2D, respectively, encoded within the eTPC (component 2A), to form two independent integration couples.

The pair of integration couples are independently isolated from one another as to ensure that each integration event delivers only a single TCR ORF for each chain of a TCR pair, and thereby preferentially obtaining a standardised eTPC that presents a single species of TCR surface protein (TCRsp), designated eTPC-t.

eTPCS: second part of the two-part device

The multicomponent eTPC system (eTPCS) is depicted in Figure 1, part 2. The multicomponent eTPCS comprises a first component eTPC, designated component 2A, containing two genomic receiver sites, components 2B and 2D, which are paired with two TCR-encoding integration vectors obtained from the first part of the device, components 2C and 2E. Overall, the introduction of a complementary pair of TCR chains to the genomic receiver sites (components 2B and 2D) via integration vectors (components 2C and 2E), converts the eTPC (component 2A) into a variant eTPC that expresses TCR surface protein (TCRsp), designated eTPC-t (Figure 8).

An eTPC, component 2A, represents the base component of the multicomponent system, to which all other components of the system relate. Therefore, the eTPC contains certain features, that are native or engineered, that make the eTPC suitable for use to create analyte eTPC-t populations, and their use.

The eTPC, component 2A,

i. Lacks endogenous expression of TCR chains alpha, beta, delta and gamma, and ii. Expresses CD3 proteins which are conditionally presented on the surface of the cell only when the cell expresses a complementary pair of TCR chains and iii. Contains further modification, designated components 2B and 2D, as genomic receiver sites for integration of a single ORF encoding one analyte TCR chain of alpha, beta, delta or gamma at each site wherein i) may be obtained by selection of a naturally occurring cell population lacking said expression, or may be engineered to lack such expression; ii) may be obtained by

WO 2018/083318

PCT/EP2017/078378 selection of a naturally occurring cell population comprising said expression, or may be engineered to comprise such expression; iii) may be achieved by utilising sequences intrinsic to the genome of the eTPC, or introduced by means of genetic engineering.

The selection of an eTPC cell candidate that lacks TCR chains alpha, beta, delta and gamma from naturally occurring cell populations can be achieved by methods well known in the art. Staining of target cells with affinity reagents specifically for TCR chains alpha, beta, delta and gamma, and selection of cells TCR chains alpha, beta, delta and gamma may directly achieve this.

Engineering an eTPC to lack TCR chains alpha, beta, delta and gamma expression may be achieved by untargeted and targeted means. Untargeted mutagenesis ofthe cell can be achieved by providing a chemical, radiological or other mutagen to the cell, and then selecting cells lacking expression target TCR chains alpha, beta, delta and gamma expression. Targeted mutation ofthe genomic loci can be achieved via different means, including but not limited to site directed mutagenesis via

i. zinc-finger nucleases ii. CRISPR/Cas9 mediated targeting iii. Synthetic transcription activator-like effector nucleases (TALEN) wherein said site-directed nucleases induce site-specific double stranded DNA breaks increasing the chance of error prone DNA repair at the target loci, after which mutated cells are obtained by selecting cells lacking TCR alpha, beta, delta and gamma expression.

Options for integration of CD3 and the components 2B and/or 2D are well known to those skilled in the art but may include homology directed recombination (HDR) and/or random integration methods, wherein HDR may be promoted by targeted mutation of the genomic loci at which HDR is to occur, and can be achieved via different means, including but not limited to site directed mutagenesis via

i. zinc-finger nucleases ii. CRISPR/Cas9 mediated targeting iii. Synthetic transcription activator-like effector nucleases (TALEN) wherein said site-directed nucleases induce site-specific DNA-repair by HDR at target loci. After such events, a proportion of cells will have incorporated HDR vector, an can be selected and/or determined via any combination of the following, iv. Non-destructive phonotypical expression analysis

WO 2018/083318

PCT/EP2017/078378

v. Destructive phonotypical expression analysis vi. Genetic analysis

Wherein iv and vi are the preferred methods for selection and determination of successful genomic integration events.

Alternatively, viral vectors could be used to deliver the required components in a sitedirected or undirected manner.

Considering that the eTPC component 2A is designed to be used in conjunction with the analyte antigens within analytical workflows, in the preferred aspect the eTPC contains features that minimise the eTPC presenting factors that would interfere in such analyses.

The eTPC component 2A optionally lacks endogenous surface expression of at least one family of analyte antigen presenting complexes (aAPX) and/or analyte antigenic molecules (aAM), wherein the lack of surface expression is selected as to minimise interference in matched analyses of target analyte antigens.

The family of aAPX may be any of the following

i. HLA class I ii. HLA class II iii. non-HLA antigen-presenting complex.

An aAM is selected from

i. a polypeptide or complex of polypeptides translated from the analyte antigenic molecule ORF(s) ii. a peptide derived from a polypeptide translated from the analyte antigenic molecule ORF(s) iii. a peptide derived from altering the component A proteome iv. a polypeptide derived from altering the component A proteome

v. a metabolite derived from altering the component A metabolome

The component 2A eTPC may optionally additionally include T-cell co-receptors, wherein such features permit robust or varying forms of communication of the analyte eTPC to the analyte APC, wherein the tuneable communication is relevant to identification or characterisation of specific analyte TCRsp and/or analyte antigens.

WO 2018/083318

PCT/EP2017/078378

In the present context, the eTPC component 2A may optionally express CD4 and/or CD8, wherein expression of CD4 or CD8 restrict eTPC to engaging aAPX of type HLAII and HLAI, respectively.

The eTPC component 2A may optionally expresses CD28 and/or CD45, wherein CD28 and CD45 contribute to signal sensitivity through positive feed forward effects on signalling, whereas they may also contribute to signal specificity through negative feedback effects on signalling, as it relates to signalling though an expressed analyte TCRsp.

The component 2A eTPC may optionally additionally include introduced cell surface adhesion molecule components, or ablation of endogenous cell surface adhesion molecules, to promote the eTPC engagement with analyte APC and formation of the immunological synapse, or to avoid tight binding and formation of deleterious cell clustering within analytical workflows involving APC, respectively.

Such adhesion molecules that may be introduced as additional ORFs to component 2A, or genetically ablated from component 2A, can be selected from the integrin family of adhesion proteins.

An eTPC is designed to assay binding of cognate analyte antigen, either through detectable engagement of analyte antigen reagents, or through a native or engineered eTPC-centric response to stimulation by cognate antigen, within analytical workflows using the eTPC:A system (infra vide). It is thus desirable to have a standardised reporter readout for signalling response from stimulation of the expressed TCRsp.

The eTPC component 2A, may further contain a component designated 2F, a synthetic genomic TCR-stimulation response element selected from

i. A single component synthetic construct containing at least one native promoter and/or at least one synthetic promoter and at least one reporter ii. A multi-component synthetic construct designed with at least one native promoter and/or at least one synthetic promoter and at least one reporter wherein activation of i and/or ii is dependent on at least one signal transduction pathway selected from a synthetic pathway, a native pathway or a combination thereof.

WO 2018/083318

PCT/EP2017/078378

The TCR-encoding integration vectors that form pairs with the genomic receiver site as part ofthe eTPC, are designated Components 2C and 2E.

Each of these components 2C and 2E encode a single TCR chain ORF, and are required to convert an eTPC into a TCRsp-expressing eTPC-t.

Each of the vectors, components 2C or 2E, carry 5’ and 3’ genetic elements flanking the encoded TCR ORF is designed to target either genomic receiver site 2B or 2D, respectively. These integration couples must be reasonably insulated from each other as to assure only one TCR ORF is inserted into each genomic receiver site as determined by the 2B-2C or 2D-2E integration coupling relationship.

As described above, Components 2C and 2E are derived from the TORES, representing the first part of the device. Thus, the features of the first part vector backbone architecture is matched to the genomic receiver sites, components 2B and 2D, ofthe component 2A eTPC.

The pair of integration couples contained within the eTPC as described above preferably have a feature(s) that permit re-use of the site to remove a single TCR chain from a genomic receiver site once integrated.

Such cycling between TCR ORF and a non-TCRsp expressing construct can permit interchange of a single TCR ORF expressed in an eTPC-t, as to generate and intermediate expressing a single chain of TCR, and thus no TCRsp expression. This intermediate is designated eTPC-x (See figure 7). Such recycling can be achieved with recombinase enzymes, as to execute RCME.

Genomic receiver site recycling may also be achieved by use of other recombinaselike enzymes, use of transposable elements, and/or the use of homologous directed recombination with or without the use of site-directed endonucleases.

The genomic receiver sites, components 2B and 2D, may be selected from the following

i. A synthetic construct designed for recombinase mediated cassette exchange (RMCE) ii. A synthetic construct designed for site directed homologous recombination

WO 2018/083318

PCT/EP2017/078378 wherein i) is the preferred form a genomic receiver site for RMCE. The RMCE method may employ selected heterospecific sites that are specific for individual recombinase enzymes, such that each component 2B and 2D possess insulated specificity.

The genomic receiver sites, component 2B and 2D comprises of at least one of the following genetic elements

i. Heterospecific recombinase sites ii. Homologous arms iii. Eukaryotic promoter iv. Eukaryotic conditional regulatory element

v. Eukaryotic terminator vi. Selection marker vii. Splice acceptor site viii. Splice donor site ix. Non-protein coding gene

x. Insulator xi. Mobile genetic element xii. Meganuclease recognition site xiii. Internal ribosome entry site (IRES) xiv. Viral self-cleaving peptide element xv. A kozak consensus sequence

Wherein, at least i) or ii) should be included.

A preferred genomic receiver site would comprise of two different arrangements using the following selected elements from the previously stated list of element.

The first arrangement is for receiving a single ORF encoding one TCR chains and a selection mark of integration, via RMCE integration wherein the arrangement is

5’ -[A] [B] [C] [D] [E] [F]- 3’ wherein

A) is element iii) a constitutive or inducible Eukaryotic promoter

B) is element i) heterospecific recombinase site 1

C) is element xv) a Kozak consensus sequence

D) is element vi) a FACS and/or MACS compatible encoded protein marker

E) is element i) heterospecific recombinase site 2

WO 2018/083318

PCT/EP2017/078378

F) is element v) Eukaryotic terminator

The second arrangement is for receiving a two ORF encoding one or more TCR chains and/or a selection mark of integration, via RMCE integration wherein the arrangement is

5’ -[A] [B] [C] [D] [E] [F] [G] [Η] [I]- 3’ wherein

A) is element iii) a constitutive or inducible Eukaryotic promoter

B) is element i) heterospecific recombinase site 1

C) is element xv) a Kozak consensus sequence

D) is element vi) a FACS and/or MACS compatible encoded protein marker 1

E) is element v) a Eukaryotic bidirectional transcriptional terminator

F) is element vi) a FACS and/or MACS compatible encoded protein marker 2

G) is element xv) a Kozak consensus sequence

H) is element i) heterospecific recombinase site 2

I) is element iii) a constitutive or inducible Eukaryotic promoter furthermore, in this second arrangement the elements F, G, and I are encoded in the antisense direction.

Component 2C and 2E comprise of at least one of the following genetic elements

WO 2018/083318

PCT/EP2017/078378 xvi. Selection marker of integration xvii. An antibiotic resistance cassette xviii. A bacterial origin of replication xix. A yeast origin of replication xx. A cloning site

A preferred genetic integration vector, component 2C and component 2E, would comprise of two different possible arrangements using the following selected elements from the previously stated list of elements.

The first arrangement is for delivery of a single ORF encoding one or more TCR chains and/or a selection marker of integration, via RMCE integration wherein the arrangement is

5’ - [A] [B] [C] [D] [E] - 3’ wherein

A) is element i) heterospecific recombinase site 1

B) is element xv) a Kozak consensus sequence

C) is element xx) a cloning site of a single ORF encoding a TCR chain and/or element xvi) a selection marker of integration

D) is element i) heterospecific recombinase site 2

E) is element xvii) An antibiotic resistance cassette and element xviii) a bacterial origin of replication, in no specific orientation furthermore, the elements viii and/or xiv may be used to link multiple TCR chains and/or element xvi together.

The second arrangement is for delivery of one or more ORFs encoding one TCR chains and/or a selection mark of integration, via RMCE integration wherein the arrangement is

5’ - [A] [B] [C] [D] [E] [F]- 3’ wherein

A) is element i) heterospecific recombinase site 1

B) is element xv) a Kozak consensus sequence

C) is element xx) a cloning site for introduction of two or more ORF, with eukaryotic terminators, encoding at least one TCR chain and/or element xvi) a selection marker of integration

WO 2018/083318

PCT/EP2017/078378

D) is element xv) a Kozak consensus sequence (antisense direction)

E) is element i) heterospecific recombinase site 2

F) is element xvii) An antibiotic resistance cassette and element xviii) and/or a bacterial origin of replication, in no specific orientation furthermore, the elements viii and/or xiv may be used to link multiple TCR chains and/or element xvi together within each ORF.

A preferred genetic integration vector, component 2Y and component 2Z, for conversion of eTPC-t to eTPC-x (see Figures 7 and 10) would comprise the same integration vector requirements as 2C and 2E above, though not encoding any TCR chain ORF, and preferably encoding a marker of integration.

Use of Integration couples to compile eTPC-x and eTPC-t

The above described multicomponent system may be used in multiple ways to prepare distinct forms of analyte eTPC populations, or libraries thereof, that serve to present analyte TCRsp to analyte antigen within analytical or preparative workflows of the eTPC:A system.

The efficient integration of a predictable copy number of one or more ORFs into the genomic receiver site is highly advantageous for operation of a standardised eTPCS, where analyte eTPC-t populations may be rapidly prepared and characterised. Thus, the genomic receiver site(s) and coupled integration vector(s) are critical to the function of the eTPCS. It is also desirable that the component 2B and component 2D are amenable to a method of preparation of an eTPC-t, as described above, wherein, the introduction of a single pair of complementary TCR chains is rapid, repeatable, with a high likelihood of correct integration and delivery of only a single pair. The combination of the genetic integration vectors with an eTPC to produce eTPC-x and/or eTPC-t can be achieved in several modes (Figure 7). The eTPC-t populations that are created need to derive analyte TCR chains from certain sources with which to analyse candidate antigens.

The sources of analyte TCR chain sequences information to define the components used in the TORES reaction can be derived from

i. Paired cloning of TCR chain ORF sequence(s) from primary T-cells ii. Unpaired cloning of TCR chain ORF sequence(s) from primary T-cells iii. Synthetic TCR chain ORF sequence(s)

WO 2018/083318

PCT/EP2017/078378 wherein i) is preferable for discovery of native TCRsp that are not likely to be generally cross reactive against self aAPX and/or the aAPX cargo due to thymic selection; ii) may be used to identify candidate TCR affinity reagents; iii) may be used in affinity maturation of TCR affinity reagents or de novo creation of TCR chains.

A multicomponent system comprising two integration couples may be used to prepare an eTPC-t from component 2A, by providing component 2C and 2E each combined with one ORF encoding one chain of a complementary TCR chain pair, such that both analyte TCR chains are integrated to genomic receiver site, component 2B or 2D, to create 2B’ and 2D’. The resulting cell line expresses the provided TCR pair, and it is presented at the cell surface as a TCRsp. An eTPC-t may be prepared by simultaneous integration of two complementary TCR chains to form a TCRsp (Figure 8). An eTPC-t may be prepared by stepwise integration of two complementary TCR chains to form a TCRsp, via an eTPC-χ intermediate (Figure 9).

An eTPC-χ may be prepared from an eTPC-t by providing either one of further integration vectors, components 2Y or 2Z, which encode markers of integration or no ORF (Figure 10). Combination of component 2Y or 2Z to an eTPC-t would exchange either of the sites to obtain a single TCR chain expressing eTPC-x.

In the abovementioned examples of preparing analyte eTPC-χ and/or eTPC-t populations from eTPC, the multicomponent system (eTPCS) is used to provide known analyte TCR chains in a defined manner to prepare discrete populations of analyte eTPC expressing defined TCRsp. Such a process may be repeated many times to build libraries of eTPC-χ and/or eTPC-t as input to analytical or preparative workflows. An alternative approach is to take pooled libraries of analyte TCR chains combined with genetic integration vectors, and integrate these in a shotgun fashion to obtain pooled libraries of analyte eTPC-t wherein each eTPC-t express a single species of TCRsp, but collectively as a pool present multiple TCRsp species (see Figures 11 to 14). This is particularly useful when analysing large libraries of candidate TCRsp against analyte antigens.

An eTPCS comprising two integration couples may be used to prepare an eTPC-t pool from component 2A in one step, by providing component 2C combined with a library of multiple ORF encoding a pool of single analyte TCR chains such that each pair is inWO 2018/083318

PCT/EP2017/078378 tegrated to site 2B, to create 2B’, within each cell. Simultaneously, providing component 2E combined with a library of multiple ORF encoding a pool of single analyte TCR chains complementary to first library provided in component 2C, such that each analyte complementary TCR chain is integrated to site 2D, to create 2D’, within each cell. Each resulting cell in the eTPC-t pool has a randomised single selection of complementary analyte TCR chains, such that each cell in the pool expresses a unique randomised TCRsp. Such a pooled library would contain all possible combinations of provided complementary TCR chains from the sets proceed in C’ and E’ (Figure 11).

An eTPCS comprising two integration couples may be used to prepare an eTPC-t pool from a previously obtained e-TPC-x in one step, wherein the site 2B has been converted to 2B’ and contains the single analyte TCR chain. An eTPC-t is prepared by providing component 2E combined with a library of multiple ORF encoding a pool of single analyte TCR chains complementary to the already integrated chain, such that each TCR chain of the provided component 2E library is singularly integrated to site 2D, to create 2D’. Each resulting cell in the eTPC-t pool has the analyte TCR chain provided by the starting eTPC-x, and a randomised single selection of the complementary analyte TCR chain, such that each cell in the pool expresses a unique TCRsp. Such an approach is used when analysing the effect of varying a single chain against a fixed chain in a complementary TCR chain pair (Figure 12).

An eTPCS comprising two integration couples may be used to prepare an eTPC-x pool. An eTPC-x is prepared by providing component 2C combined with a library of multiple ORF encoding a pool of single analyte TCR chains, wherein the complementary chain is omitted, such that each TCR chain of the provided component 2C library is integrated to site 2B, to create 2B’, within each cell. Each resulting cell in the in the eTPC-x, has a randomised single selection of complementary analyte TCR chain, such that each cell in the pool expresses a unique single TCR chain (Figure 13). Such an approach is used when preparing an eTPC-x library to assay against single or multiple complementary TCR chains integrated via the second integration couple as in the previous example (Figure 14).

An eTPC-x, or libraries thereof, can be used for transient transfection of a TCR chain

ORF that is complementary to the integrated TCR ORF at 2B’ in the eTPC-x, in order to rapidly screen TCRsp derivatives in a target assay.

WO 2018/083318

PCT/EP2017/078378

Contacting analyte eTPC-t with analyte antigen

The present invention relates to the provision of two multicomponent systems that form a two-part device for use in deriving analytical eTPC-t populations for compilation of analytical devices that are collectively termed eTPC:Antigen (eTPC:A) systems (Figure 24). Within the two-part device, the first part is used to derive TCR ORFs in integration vector contexts, which are then inserted to a matched eTPC comprising the second part. Thus, the operation of the two-part device entails the use of one or more of each component 1 A, 1B and 1C to derive one or more component 2C and 2E, which are used in conjunction with component 2A, containing at least components 2B and 2D, to compile one or more eTPC-t. These analyte eTPC-t are then combined with one or more analyte antigens within an analytical eTPC:A system to obtain one or more outputs. The analyte antigen is provided by analyte antigen-presenting cells (APC) and/or as soluble or immobilised affinity reagent and/or presented on non-cell based particles (NCBP).

An analyte antigen represents any entity that a TCR can putatively engage in the eTPC:A system, and may be represented by;

i. aAPX (analyte Antigen-presenting complex) and/or ii. aAM (analyte antigenic molecule) and/or iii. aAPX:aAM (analyte Antigen-presenting complex presenting an analyte antigenic molecule) and/or iv. CM (a non-analyte cargo molecule) and/or

v. aAPX:CM (analyte Antigen-presenting complex presenting a cargo molecule) wherein an aAPX represents a complex that is able to present an aAM; an aAM is any molecule that is directly recognised by a TCR or when loaded in an aAPX; an aAPX:aAM is an aAPX with a loaded aAM; a CM is a cargo molecule that may be loaded in the aAPX, but which is not an analyte, thus may be derived from an analyte antigen presenting cell (APC) or the assay system itself; aAPX:CM is an aAPX with a CM loaded.

These forms of analyte antigens may be presented to the eTPC in different modes within an eTPC:A system, represented as;

i. an analyte antigen presenting cell (APC) and/or ii. a soluble or immobilised affinity reagent and/or iii. a non-cell based particle (NCBP), wherein an analyte antigen presenting cell (APC) is considered any APC that is able to

WO 2018/083318

PCT/EP2017/078378 present an antigen to the eTPC-t; an affinity reagent is considered any reagent that is prepared as analyte to probe TCRsp binding and/or stimulation at the cell surface of the eTPC-t in an eTPC:A system. Such reagents will often represent analyte antigenic molecules (aAM), analyte antigen-presenting complexes (aAPX), or aAPX loaded with aAM (aAPX:aAM). A typical example of an aAPX:aAM is an pHLA-multimer reagent (e.g. ‘tetramers’) used to stain TCRs. Affinity reagents in this context could also represent antibodies or similar entities; a non-cell based particle (NCBP) acts in a similar manner to an affinity reagent, inasmuch that the particle presents an analyte antigen or other entity that is to be assessed for TCRsp engagement at the surface of a eTPC-t within and eTPC:A system. However, an NCBP is considered as a larger entity that can further carry genetic or other information that is to act as an identifier, either directly or by proxy, of the presented analyte antigen or other binding entity. A typical example of an NCBP would be a bacteriophage in a phage-display scenario, wherein phage may display antibody fragment antigen binding (FAB). Positively labelled eTPC-t may be recovered along with the phage, and sequenced to identify FABs specific for the TCRsp at the surface of a eTPC-t.

An analytical eTPC:A system is comprised of a selection of one or more of analyte antigen with one or more eTPC-t populations (Figure 24). The analyte eTPC-t populations are prepared using the multicomponent system as described above (Figures 1 to 14). The eTPC:A system is provided in a format that permits physical contact between the analyte antigens and analyte eTPC-t populations, wherein such contact is permissive of complex formation between one or more analyte antigen and TCRsp of one or more analyte eTPC-t, wherein the analyte antigen is any of the following vi. aAPX (analyte Antigen-presenting complex) and/or vii. aAM (analyte antigenic molecule) and/or viii. aAPX:aAM (analyte Antigen-presenting complex presenting a analyte antigenic molecule) and/or ix. CM (a non-analyte cargo molecule) and/or

x. aAPX:CM (analyte Antigen-presenting complex presenting a cargo molecule) wherein the analyte antigen is either, presented by an analyte APC, or presented by a soluble and/or immobilised affinity reagent, or NCBP such that complex formation may lead to stabilisation of such a complex and wherein such complex formation leads to observable labelling of the eTPC-t and/or the induction of signalling within the analyte eTPC via component 2F, if included and/or an observable signal in the analyte APC, which may be measured.

WO 2018/083318

PCT/EP2017/078378

In the present context, an eTPC:A system comprises of:

i. an input of a single analyte eTPC-t; or ii. an input of a pooled library of analyte eTPC-t and combined with one of the following:

iii. an input of a single analyte APC; or iv. an input of a single analyte affinity reagent; or

v. an input of a single analyte NCBP; or vi. an input of a pooled library of analyte APC; or vii. an input of a pooled library of analyte affinity reagent; or viii. an input of a pooled library of analyte NCBP

Contacting in a buffer system

A contact between an analyte APC and analyte eTPC-t is performed in a permissive cell culture or buffer system, wherein said system comprises media that is permissive to the function of both analyte APC and analyte eTPC-t cells.

A contact between a soluble analyte affinity, immobilised affinity reagent and/or analyte NCBP and an analyte eTPC-t is performed in a permissive buffered system, wherein said system comprises a buffered medium that is permissive to function of both the analyte antigen and analyte eTPC-t cells.

Labelling eTPC-t with affinity reagents or NCBP

An analyte eTPC-t obtained from the two-part device may be used for characterisation of a TCRsp presented by the eTPC-t. Such characterisation may be conducted in a manner where the analyte eTPC-t is contacted with an immobilised or soluble affinity reagent or non-cell based particle (NCBP) in such a manner as to label the eTPC-t (Figure 15).

Labelling may be considered to be detected by direct observation of the label through such methods as flow cytometry, microscopy, spectrometry or luminometry or alternatively by means of capture with an immobilised affinity reagent or NCBP. In a similar manner, the affinity reagent or NCBP may stimulate the reporter element, component 2F, if included. Stimulation of component 2F would allow selection of eTPC-t and/or affinity reagent or NCBP for identification (Figure 16).

WO 2018/083318

PCT/EP2017/078378

Signal responses definition

An analyte eTPC-t obtained from the two-part device is used for characterisation of a signal response of the analyte eTPC-t, expressing analyte TCRsp, to an analyte antigen, wherein such a signal response may be either binary or graduated, and may be measured as intrinsic to the eTPC-t (Figures 15,16 and 17) and/or intrinsic to the APC, if included (Figure 18). Such signals may be detected through methods such as flow cytometry, microscopy, spectrometry or luminometry or other methods known to those skilled in the art.

Contacting with an APC with signal responses

An analyte APC may also be contacted with the eTPC-t within an eTPC:A system. Generally, the response will be measured by reported signal within the eTPC-t (Figure 17), but may also be measured by reported signal within the APC (Figure 18).

General method - Selecting an eTPC-t

The method for selecting one or more analyte eTPC-t from an input analyte eTPC-t or a library of analyte eTPC-t, from the combined eTPC:A system, to obtain one or more analyte eTPC-t wherein the expressed TCRsp binds to one or more analyte antigen comprises

i. Combining one or more analyte eTPC-t with one or more analyte antigen resulting in a contact between an analyte TCRsp with an analyte antigen and at least one of ii. Measuring a formation, if any, of a complex between one or more analyte TCRsp with one or more analyte antigen and/or iii. Measuring a signal from a labelled analyte antigen and/or iv. Measuring a signal response by the analyte eTPC-t, if any, induced by the formation of a complex between one or more analyte TCRsp with one or more analyte antigen and/or

v. Measuring a signal response by the analyte APC, if any, induced by the formation of a complex between one or more analyte TCRsp with one or more analyte antigen and vi. Selecting one or more analyte eTPC-t based on step ii, iii, iv and/or v wherein the selection is made by a positive and/or negative measurement wherein i, iv and vi or i, v and vi comprise the preferred arrangements.

General method - Selecting an analyte antigen

WO 2018/083318

PCT/EP2017/078378

The method for selecting one or more analyte antigen from an input analyte antigen or a library of analyte antigen, to obtain one or more analyte antigen wherein the expressed analyte antigen binds to one or more analyte TCRsp presented by the analyte eTPC-t comprises

i. Combining one or more analyte antigen with one or more analyte eTPC-t, resulting in a contact between an analyte antigen presented by the analyte antigen with analyte TCRsp of one or more analyte eTPC-t and ii. Measuring a formation, if any, of a complex between one or more analyte antigen with one or more analyte TCRsp and/or iii. Measuring a signal from a labelled analyte antigen and/or iv. Measuring a signal response in the one or more analyte eTPC-t, if any, induced by the formation of a complex between the analyte TCRsp with the analyte antigen and/or

v. Measuring a signal response, if any, by the analyte APC induced by the formation of a complex between one or more analyte TCRsp with one or more analyte antigen and vi. Selecting one or more analyte antigen from step ii, iii, iv and/or v wherein the selection is made by a positive and/or negative measurement wherein i, iv and vi or i, v and vi comprise the preferred arrangements.

General method for signal response

A method for selecting analyte eTPC-t and/or analyte APC and/or affinity reagents and/or NCBP from the combined eTPC:A system on the basis of a reported signal response comprises

i. Determining a native signalling response and/or ii. Determining a synthetic signalling response, if the eTPC-t contains component 2F, and/or if the APC contains an equivalent synthetic reporter element.

An induced native or synthetic signal response that is intrinsic to APC and/or eTPC-t is measured by detecting an increase or decrease in one or more of the following

i. a secreted biomolecule ii. a secreted chemical iii. an intracellular biomolecule iv. an intracellular chemical

v. a surface expressed biomolecule vi. a cytotoxic action of the analyte eTPC-t upon the analyte APC

WO 2018/083318

PCT/EP2017/078378 vii. a paracrine action of the analyte eTPC-t upon the analyte APC such that a signal response is induced in the analyte APC and is determined by detecting an increase or decrease any of i to v viii. a proliferation of the analyte eTPC-t ix. an immunological synapse between the analyte eTPC-t and the analyte APC wherein said detected signal responses are compared to the non-induced signal response state intrinsic to analyte APC and/or analyte eTPC-t prior to assemble of the combined eTPC:A system and/or a parallel assembled combined system wherein analyte APC and/or analyte eTPC-t may present control analyte antigen and/or analyte TCR species and/or soluble analyte antigen that are known not to induce a signal response within the combined eTPC:A system in use.

Method of selection by labelling and/or signal response

A method for selecting analyte eTPC-t and/or analyte affinity reagents and/or analyte NCBP from the combined eTPC:A system on the basis of a measureable labelling of an eTPC-t by said affinity reagent or NCBP comprises;

i. Determining a labelling of the eTPC-t by an affinity reagent or NCBP and may also comprise ii. Determining a native signalling response and/or iii. Determining a synthetic signalling response, if the eTPC-t contains component 2F.

wherein selecting an eTPC-t and/or affinity reagent and/or NCBP by detecting labelling of the eTPC-t may comprise detection of the surface labelling of the eTPC-t by an affinity reagent and/or NCBP via including a detectable label on the affinity reagent and/or NCBP. Such detectable labels may be fluorescent, luminescent, spectrometric, chemical, radiochemical or affinity moieties. Thus, such selection of eTPC-t may be conducted on the basis of FACS, MACS or equivalent high-throughput screening and selection methodologies.

Summary

Within the combined eTPC:A system, measuring a signal response in the one or more analyte eTPC-t or in the one or more analyte APC, or the labelling of an eTPC-t, which may be mediated by the formation of a complex between the analyte TCRsp with the analyte antigen, is critical to selection of primary system outputs (Figure 24 step v), wherein the primary system outputs are single cells or pools of cells, and/or or single affinity reagent or pools of affinity reagents and/or or single NCBP or pools of NCBP.

WO 2018/083318

PCT/EP2017/078378

The selection of cells or reagents may be made on the presence or absence of a reported signal response in either and/or both of the contacted analyte APC or analyte eTPC-t cells, or through the measurable labelling of eTPC-t with an affinity reagent or NCBP.

Obtaining primary system outputs from the eTPC:A system

The present invention relates to the provision of a two-part device from which analyte eTPC-t are derived. These analyte eTPC-t are then combined with one or more analyte antigens via the eTPC:A system as described previously to obtain one or more outputs. The analyte antigen is provided by analyte antigen-presenting cells (APC) and/or as soluble or immobilised analyte antigen and/or presented on non-cell based particles (NCBP). The system is comprised of a selection of one or more of analyte antigen with one or more eTPC-t populations (Figure 24). The eTPC:A system is provided in a format that permits physical contact between the analyte antigens and analyte eTPC-t populations, wherein such contact is permissive of complex formation between one or more analyte antigen and TCRsp of one or more analyte eTPC-t, wherein the analyte antigen is any of the following

i. aAPX and/or ii. aAM and/or iii. aAPX:aAM and/or iv. CM and/or

v. aAPX:CM wherein the analyte antigen is either provided as, presented by an analyte APC, or presented by a soluble and/or immobilised analyte affinity reagent or analyte NCBP such that complex formation may lead to stabilisation of such a complex and wherein leads to labelling of the eTPC-t and/or the induction of signalling within the analyte eTPC, if included and/or the analyte APC, may be reported and measured.

The modes of induced signal response reporting, and/or eTPC-t labelling, are described above, and it is these reported responses and/or labelling that are required to be measured in obtaining the primary output of the two-part device compiled into an eTPC:A system.

Primary outputs from the eTPC:A system are selected cell populations and/or selected affinity reagents or selected NCBP, wherein the selection is made on the basis of;

i. a measurable labelling of eTPC-t by affinity reagent or NCBP and/or

WO 2018/083318

PCT/EP2017/078378 ii. a detected signal response in an eTPC-t and/or iii. lack of a detected signal response in an eTPC-t and/or iv. a detected signal response in an analyte APC and/or

v. a lack of detected signal response in an analyte APC;

wherein a primary output may be represented as a single cell, or a pool of cells and/or one or more eTPC-t-associated affinity regent or NCBP.

A selection of analyte affinity reagent, NCBP or analyte APC and/or analyte eTPC-t from the combined eTPC:A system may be made on the basis of a response in the contacting cell. That is, an analyte APC may be selected on that basis of a reported response, or lack thereof, in the contacting analyte eTPC-t. Conversely, an analyte eTPC-t may be selected on that basis of a reported response, or lack thereof, in the contacting analyte antigen, or in the case wherein the analyte antigen is an analyte affinity reagent or NCBP, the analyte affinity reagent or NCBP can selected from the eTPC-t response.

Primary APC outputs from the system are selected cells, wherein selection is made based on the presence or absence of a reported signal response in either analyte APC or eTPC-t, and these cells may comprise one or more of APC and/or eTPC-t wherein the selected cells may comprise a single cell, a pool of cells of the same identity, a pool of cells of different identities (Figure 24 step v).

Primary eTPC-t outputs from the system are selected cells, wherein selection is made based on the presence or absence of a reported signal response, and these cells comprise eTPC-t, wherein selected cells may comprise a single cell, a pool of cells of the same identity, a pool of cells of different identities (Figure 24 step v).

Primary analyte affinity reagents or NCBP outputs from the system are selected cells with or without associated affinity reagent or NCBP, wherein selection is made based on the presence or absence of a labelling or reported signal response by the analyte eTPC-t, wherein selected affinity reagent or NCBP may comprise a single affinity reagent or NCBP, a pool of affinity reagent or NCBP of the same identity, a pool of affinity reagent or NCBP of different identities (Figure 24 step v).

The reported signals in the analyte APC and/or analyte eTPC-t in a combined eTPC:A system may be used to select analyte cell populations or analyte affinity reagents or

WO 2018/083318

PCT/EP2017/078378

NCBP to provide the primary outputs.

A primary output of APC and/or eTPC-t types may be achieved in an instance wherein the combined eTPC:A system is of binary culture nature (e.g. Figures 15 to 18) by selecting the desired analyte APC and/or analyte eTPC-t population from the binary system.

A primary output of an eTPC-t may be achieved in an instance wherein the combined eTPC:A system is of binary composition of one or more analyte eTPC-t with a analyte antigen (e.g. Figures 19 to 21) by selecting the desired analyte eTPC-t population that is labelled with the analyte affinity reagent or NCBP, or activated by the analyte affinity reagent or NCBP or analyte APC within the eTPC:A system.

A primary output of an analyte affinity reagent or NCBP may be achieved in an instance wherein the combined eTPC:A system is of binary composition of one or more analyte eTPC-t with a analyte affinity reagent or NCBP (e.g. Figure 21) by selecting the desired analyte eTPC-t population that is labelled with, and/or has a signal induced by, the analyte affinity regent or NCBP from the eTPC:A system.

A primary output of APC may be achieved from an instance wherein the combined eTPC:A system is of fixed analyte eTPC-t and pooled library analyte APC (e.g. Figure 22) by selecting analyte APC based on a detection of a response, or lack thereof, within the analyte APC.

Modes of obtaining outputs from the eTPC:A System

There are several distinct modes in which the primary outputs may be obtained, wherein each mode entails a step of sorting. Sorting may be achieved through fluorescence-activated cell sorting (FACS) and/or magnetic-activated cell sorting (MACS) and/or distinct affinity-activated cell sorting methods.

Primary output APC and/or eTPC-t cells, and/or eTPC-associated affinity reagents or NCBP, may be obtained by single cell sorting to obtain a single cell and/or cell sorting to a pool to obtain a pool of cells.

Primary output APC and/or eTPC-t cells may be obtained by single cell sorting to obWO 2018/083318

PCT/EP2017/078378 tain a single cell, and optionally subsequent outgrowth of the single cells to obtain monoclonal pool of selected APC or eTPC-t cells.

Primary output APC and/or eTPC-t cells may be obtained by cell sorting to a pool to obtain a pool of cells, and optionally subsequent outgrowth of the pool of cells to obtain a pool of selected APC and/or eTPC-t cells.

Obtaining terminal system outputs from the eTPC:A system

Subsequent to the above-described methods of obtaining primary outputs, wherein primary outputs are selected analyte APC and/or analyte eTPC-t that are selected on the basis of a measured signal response, or stable complex formation, such that the terminal outputs from the eTPC:A system may be obtained via further processing of the selected APC and/or eTPC primary outputs.

In the present context, terminal outputs from the multicomponent system are the identities of

i. aAPX and/or ii. aAM and/or iii. aAPX:aAM and/or iv. CM and/or

v. aAPX:CM and/or vi. TCRsp presented by the analyte APC or analyte eTPC-t or an analyte affinity reagent or NCBP, and obtained as primary outputs from the multicomponent system by their selection from the combined eTPC:A system.

Within the eTPC:A system, it is often the case that analyte molecules that are presented by the analyte APC and analyte eTPC are genetically encoded. It may also be the case that an analyte NCBP has a genetically encoded identity, in the case of bacteriophage displayed NCBP, for example. Therefore, to identify the analyte molecules presented by the analyte APC or analyte eTPC-t, genetic sequencing of the prepared analyte APC, eTPC-t and analyte NCBP may be performed.

APC may be processed such that genetic sequence is obtained for the genome or transcriptome of the sorted and/or expanded APC cells to determine the identity of

i. aAPX and/or ii. aAM and/or

WO 2018/083318

PCT/EP2017/078378 iii. aAPX:aAM iv. CM and/or

v. aAPX:CM and/or wherein the obtained identities represent terminal outputs from the eTPC:A system. In the present context, analyte NCBP that possess a genetic component may be processed such that genetic sequence is obtained for the genome or transcriptome of the sorted and/or expanded analyte NCBP to determine the identity of analyte NCBP, wherein the obtained identities represent terminal outputs from the eTPC:A system.

An eTPC-t may be processed such that genetic sequence is obtained for component 2B’ and/or component 2D’ of the sorted and/or expanded eTPC-t cells to determine the identity of TCRsp, wherein the obtained identify of the TORES generated TCRsp represents a terminal output from the eTPC:A system.

eTPC may be processed such that genetic sequence is obtained for the genome or transcriptome of the sorted and/or expanded eTPC-t cells to determine the identity of TCRsp, wherein the obtained identify of TCRsp represents a terminal output from the eTPC:A system.

Genetic sequencing can be achieved by a range of modes, and from a range of genetic material sources, with and without specific processing.

In the present context, the sequencing step may be preceded by

i. Extracting of genomic DNA and/or ii. Extracting of components 2B’ and/or 2D’ RNA transcript and/or iii. Amplifying by a PCR of the DNA encoding component 2B’ and/or 2D’ iv. Amplifying by a RT-PCR of RNA transcript derived from component 2B’ and/or 2D’.

The sequencing step may be destructive to the APC or eTPC-t or analyte NCBP, or pool thereof, obtained as primary outputs from the multicomponent system.

If it is desirable to obtain primary outputs from the eTPC:A system wherein the sequencing step has been destructive to the primary output eTPC-t, the sequence information obtained as terminal output of the two-part device may be used to prepare equivalent output eTPC-t as analyte eTPC-t.

WO 2018/083318

PCT/EP2017/078378

In the above described scenarios of genetically encoded analyte molecules, the terminal outputs of the eTPC:A system may be obtained by obtaining sequence information from component 2B’ and/or 2D’, and/or from the cell genome and/or transcriptome. However, in some embodiments the antigen information will not be genetically encoded. Post-translationally modified antigens, antigens provided to the combined eTPC:A system through non-genetic means, antigens that are emergent from a induced or modified state of the analyte APC proteome or metabolite, CM intrinsic to the eTPC:A system, and affinity reagents or NCBP without a genetic element, may not reasonably be identified through genetic sequencing means.

In the important case of aAM that may be provided to the eTPC:A system by non-genetic means, there are two distinct modes through which an APC may present a provided aAM as an aAPX:aAM complex. In the first scenario the aAM is provided in a form that may directly bind to the aAPX and forms an aAPX:aAM complex at the cells surface. An example of such an aAM would be a peptide antigen for an HLA complex. In the second scenario, the aAM is provided is in a form that may be taken up by the analyte APC and processed such that it is loaded as cargo in the aAPX and forms an aAPX:aAM complex at the cells surface.

A method to select and identify an aAM cargo or a CM cargo, wherein the cargo is a metabolite and/or a peptide, that is loaded in an aAPX of an APC selected and obtained by as a primary output of the multicomponent system, comprises

i. isolating an aAPX:aAM or an aAPX:CM or the cargo aM or the cargo CM and ii. identifying the loaded cargo wherein the identified loaded cargo (CM or aAM) represent terminal outputs of the twopart device.

There are generally two modes through which a cargo molecule may be identified from a selected APC. First, a forced release of the cargo from the aAPX:aAM or aAPX:CM results in isolation of the aAM or CM that is available for subsequent identification. An example of this is acid-washing of the APC to liberate peptide aAM from HLA complexes. Secondly, the capture of the aAPX:aAM or aAPX:CM, for example, by liberation of the complex and immunoaffinity isolation methods, results in isolation of the aAPX:aAM or aAPX:CM compelxes, such that aAM or CM can be identified.

Methods for identifying isolated aAM and/or CM directly, or from the isolated

WO 2018/083318

PCT/EP2017/078378 aAPX:aAM or an aAPX:CM complexes, can comprise

i. Mass spectrometry analysis ii. Peptide sequencing analysis wherein the contain aAM and/or CM identities are terminal outputs from the two-part device.

Determining the affinity of the TCRsp for analyte antigen using the two-part device as an eTPC:A system

Subsequent to the above-described methods of obtaining primary outputs, wherein primary outputs are selected analyte eTPC-t cells that are selected on the basis of a measured signal response, the eTPC-t primary outputs may be subjected to an affinity analysis to determine the affinity of the TCRsp to a cognate analyte antigen wherein the analyte antigen is any of the following

i. aAPX and/or ii. aAM and/or iii. aAPX:aAM and/or iv. CM and/or

v. aAPX:CM and wherein the analyte antigen is either provided as a soluble affinity reagent or presented by an analyte APC, or analyte NCBP such that the affinity of the analyte TCRsp is determined according to the following method

i. Labelling the selected analyte eTPC-t with the analyte antigen at range of concentrations ii. Conducting FACS analysis on the stained analyte eTPC-t of step a iii. Determining the intensity of fluorescent labelling of the analyte eTPC-t over the range of concentrations of analyte antigen iv. Calculating the affinity of the TCRsp to the analyte antigen

The affinity of the analyte TCRsp may also be determined by the previously described method but wherein a labelled reference may also be included, such that the affinity is calculated using the ratio of the analyte antigen fluorescence intensity to the reference fluorescence intensity wherein the labelled reference is selected from

i. The analyte eTPC-t labelled with an affinity reagent to one of the analyte TCR chains or to both analyte TCR chains ii. The analyte eTPC-t labelled with an affinity reagent to one or more of the CD3 proteins

WO 2018/083318

PCT/EP2017/078378 iii. a cell or particle presenting a labelled reference single TCR chain or labelled reference pair of TCR chains

Legends to Figures

Figure 1. A two-part device comprising a TCR ORF reconstitution and engineering system (TORES) and engineered TCR-presenting cell system (eTPCS).

Part one of the two-part device represents a TCR ORF reconstitution and engineering system (TORES, upper panel). This system represents a library-based two-component vector system of fixed sequence, which when combined with a third component of unfixed sequence is used to reconstitute and diversify TCR ORFs. The function of the overall library feature of the TCR ORF reconstitution system is illustrated in the upper panel. A single V-C entry vector is selected from a library of V-C entry vectors with varying V-C combinations (Component 1A). This selection is based on the required V-C combination sequences for a selected TCR chain. A single J entry vector is selected from a library of J donor vectors with varying J gene segments encoded (Component 1B). This selection is based on the required J combination sequences for the same selected TCR chain as that of the V-C entry vector. Finally, an oligomeric duplex encoding CDR3 (odeCDR3) is selected as to complete the full-length ORF of the target TCR chain (Component 1C). These three components (1 A, 1B and 1C) are combined into a single reaction along with appropriate restriction and ligase enzymes. The reaction cycle produces a reconstituted TCR ORF in a single step in the V-C entry vector backbone context (Reaction Product). This TCR ORFs represent integration vector components 2C and 2E of the second part of the two-part device.

Part two of the two-part device represents an engineered TCR presenting cell system (eTPCS), comprising five or six components. The first component 2A is the eTPC line itself with all required engineered features of that cell. The eTPC 2A contains three further components, two of which are 2B and 2D, which are genomic receiver sites for integration of an analyte TCR chain pair. A third optional component included in the eTPC, 2A, is a synthetic reporter construct that is induced upon TCR ligation, 2F. Two additional independent components, 2C and 2E, represent genetic integration vectors for site-directed integration of ORFs into sites 2B and 2D, respectively, where arrows indicate coupled specificity. Components 2C and 2E each represent a reaction product from the first part of the two-part device.

WO 2018/083318

PCT/EP2017/078378

Figure 2. Generic description of genetic input, byproducts, intermediates and product of the two-component vector system to assemble a TCR ORF using a TORES.

Depicted are the two components of the vector system (a and b), the oligonucleotide duplex (c), when these three components are combined into a single reaction with Type IIS restriction enzyme and ligase, two reaction byproducts (d and e), two reaction intermediates (f and g) and one reaction product (h) is generated. Input vectors and product ofthe two-component system are depicted as circularized plasmid schematics with genetic elements depicted as labeled boxes; open plasmid vectors that represent byproduct or intermediate are non-circularized plasmid schematics with genetic elements depicted as labeled boxes; and linear DNA are depicted as series of labeled boxes describing genetic elements.

a) Depicts is a circularized plasmid schematic of a V-C entry vector with minimally required genetic elements depicted as labelled boxes. Kozak, refers to consensus sequence that plays a role in the efficient initiation of translation. V-segment, refers to a selected sequence encoding a proportion of a TCR variable germline ORF, or mutant/synthetic ORF. Type IIS refers to a Type IIS restriction enzyme binding site orientated such the enzyme cleaves in the 5’ direction. Type IIS refers to a Type IIS restriction enzyme binding site orientated such the enzyme cleaves in the 3’ direction. ve selection, refers to a negative selection element designed to be detrimental to a plasmid harboring the sequence during the full-length TCR reconstruction reaction, or subsequent selection steps. C-segment, refers to a selected sequence encoding a proportion of a TCR constant germline ORF, or mutant/synthetic ORF. +ve selection #1, refers to the first positive selection marker of the TORES used to convey a selective advantage to the organism harboring the vector, and which is different to the positive selection marker ofthe second vector component (b). Ori, refers to an origin of replication used for the propagation of plasmid within a compatible host. 5' genetic element, refers to any desired genetic element that provides attributes required for downstream application ofthe reconstructed full-length TCR, and should be situated 5’ ofthe reconstructed full-length TCR, at least including a sequence guiding directed integration to the genomic receiver sites contained within the eTPCS. 3' genetic element, refers to to any desired genetic element that provides attributes required for downstream application ofthe reconstructed full-length TCR, and should be situated 3’ ofthe fulllength TCR ORF, at least including a sequence guiding directed integration to the genomic receiver sites contained within the eTPCS.

WO 2018/083318

PCT/EP2017/078378

b) Depicts a circularized plasmid schematic of a J donor vector with minimally required genetic features depicted as labeled boxes. J segment part, refers to a DNA sequence encoding a proportion of a TCR joining germline ORF, or mutant/synthetic J gene segment. C part, refers to a small 5' portion of the TCR Constant gene segment. Type IIS refers to a Type IIS restriction enzyme binding site orientated such the enzyme cleaves in the 5’ direction. Type IIS refers to a Type IIS restriction enzyme binding site orientated such the enzyme cleaves in the 3’ direction. +ve selection #2, refers to the second positive selection marker of the TORES used to convey a selective advantage to the organism harbouring the vector, and which is different to the first positive selection marker of the first vector component (a). Ori, refers to an origin of replication used for the propagation of plasmid within a compatible host.

c) Depicted is a third component that completes the target TCR ORF sequence as an oligonucleotide duplex encoding CDR3 region (odeCDR3). This DNA duplex containing CDR3 sequence flanked by two single stranded DNA overhangs, overhang φ1 -5’ and overhang φ1 -3’. Overhang φ1 -5’ is compatible with the overhang φ1 -3’ in the open V-C entry vector intermediate (g). Overhang φ2-3’ is compatible with the overhang φ2-5’ in the donor fragment intermediate (f).

d) Digestion of the V-C entry vector (a) by the Type IIS restriction enzyme results in a linear DNA V-C entry vector reaction byproduct containing the -ve selection element and the Type IIS and Type IIS -> elements.

e) Digestion of the J donor vector (b) by the Type IIS restriction enzyme results in a linearised plasmid byproduct containing all genetic elements of the parental plasmid except those carried in the excised J donor fragment intermediate (f).

f) Digestion of the J donor vector (b) by the Type IIS restriction enzyme results in a linear DNA fragment containing the J segment part and C part flanked by single strand DNA overhangs, overhang φ2-5’ and overhang φ3-3’. Overhang φ2-5’ is compatible with the overhang φ2-3’ in CDR3 DNA oligonucleotide duplex (c). Overhang φ3-3’ is compatible with the overhang φ3-5’ in the open V-C entry vector intermediate (g).

g) Digestion of the V-C entry vector (a) by the Type IIS restriction enzyme results in a non-circularized plasmid intermediate containing all genetic elements of the parental

WO 2018/083318

PCT/EP2017/078378 plasmid except those carried in the excised linear DNA V-C entry vector reaction byproduct (d). Digestion additionally creates two single stranded DNA overhangs, overhang φ1 -3’ and overhang φ3-5’. Overhang φ1 -3’ compatible with the overhang φ1 -5’ in the CDR3 DNA oligonucleotide duplex (c). Overhang φ3-5’ is compatible with the overhang φ3-3’ in the J donor fragment intermediate (f).

h) Ligation of all three compatible single-stranded DNA overhangs results in the fulllength TCR ORF vector as circularized plasmid (h). This plasmid contains all genetic elements of the parental V-C entry vector (a) with the exception of the excised V-C entry vector reaction by-product (d). In addition, the full-length TCR ORF vector incorporates the CDR3 sequence from the CDR3 DNA oligonucleotide duplex (c) and J segment part and C part from the J donor fragment reaction intermediate (f). Arrows indicate the approximate points of ligation between compatible single-stranded DNA overhangs φ1, φ2 and φ3. Ligation point φ1 is comprised of the φ1 -3’ and φ1 -5’ elements donated by the V-C entry vector reaction intermediate (g) and CDR3 DNA oligonucleotide duplex (c), respectively. Ligation point φ2 is comprised φ2-3’ and φ2-5’ elements donated by the CDR3 DNA oligonucleotide duplex (c) and the J donor fragment reaction intermediate (f), respectively. Ligation point φ3 is comprised φ3-3’ and φ3-5’ elements donated by the J donor fragment reaction intermediate (f) and the V-C entry vector reaction intermediate (g), respectively.

Figure 3 Operation of the TORES to generate CDR3-diversified TCR chains Depicted is a schematic representation of the TORES when used to generate fulllength TCR chains with diversified CDR3 inserts. A parental TCR is defined with V-J-C usage, and defined CDR3 region sequence. The corresponding single V-C entry vector (box i) and single J donor vector (box ii) are placed in the reaction tube. A pool of odeCDR3 with defined positional nucleotide degeneracy and/or point mutagenesis that changes the coded amino acid sequence is synthesized (Box iii). Such a CDR3 pool could include completely randomized CDR3 sequences within the bounds of the defined odeCDR3 framework, as to create ‘synthetic’ CDR3 containing full-length TCR ORF with germline V-J-C usage. These three components (Box i, ii and iii) are combined into a single reaction along with appropriate restriction and ligase enzymes. The reaction cycle produces a number of variant reconstituted full-length TCR ORFs, proportional to the number of variant odeCDR3 included, in a single step in the V-C entry vector backbone context (Box iv).

WO 2018/083318

PCT/EP2017/078378

Figure 4 Operation of the TORES to generate V-segment diversified TCR chains Depicted is a schematic representation of the TORES when used to generate fulllength TCR chains with diversified V-segment usage. A parental TCR is defined with VJ-C usage, and defined CDR3 region sequence. The corresponding single J donor vector (box ii) is placed in the reaction tube, as is the single odeCDR3 synthesized to correspond with parental CDR3 region sequence (Box iii). A selection of V-C entry vectors is also added to the reaction tube, corresponding to the V- and C- segments desired in the product V-segment diversified full length TCR ORF product (Box i). These three components (Box i, ii and iii) are combined into a single reaction along with appropriate restriction and ligase enzymes. The reaction cycle produces a number of variant reconstituted full-length TCR ORFs, proportional to the number of variant V-C entry vectors included, in a single step in the V-C entry vector backbone context (Box iv).

Figure 5 Operation of the TORES to generate J-segment diversified TCR chains Depicted is a schematic representation of the TORES when used to generate fulllength TCR chains with diversified J-segment usage. A parental TCR is defined with VJ-C usage, and defined CDR3 region sequence. The corresponding single V-C entry vector (box i) is placed in the reaction tube, as is the single odeCDR3 synthesized to correspond with parental CDR3 region sequence (Box iii). A selection of J donor is also added to the reaction tube, corresponding to the J segments desired in the product Jsegment diversified full length TCR ORF product (Box ii). These three components (Box i, ii and iii) are combined into a single reaction along with appropriate restriction and ligase enzymes. The reaction cycle produces a number of variant reconstituted full-length TCR ORFs, proportional to the number of variant J donor vectors included, in a single step in the V-C entry vector backbone context (Box iv).

Figure 6 Operation of the TORES to generate V/J-segment diversified TCR chains

Depicted is a schematic representation of the TORES when used to generate fulllength TCR chains with diversified V- and J- segment usage. A parental TCR is defined with V-J-C usage, and defined CDR3 region sequence. The corresponding single odeCDR3 synthesized to correspond with parental CDR3 region sequence (Box iii). A selection of V-C entry vectors and J donor vectors are added to the reaction tube, corresponding to the combination of V- (C-) and J- segments desired in the product V/Jsegment diversified full length TCR ORF product (Box ii). These three components (Box i, ii and iii) are combined into a single reaction along with appropriate restriction

WO 2018/083318

PCT/EP2017/078378 and ligase enzymes. The reaction cycle produces a number of variant reconstituted full-length TCR ORFs, proportional to the number of V-C and J donor vector combinations possible from those included, in a single step in the V-C entry vector backbone context (Box iv).

Figure 7 Compilation of intermediate eTPC-x and analyte eTPC-t populations from eTPC.

The operation of the two-part device entails the insertion of vectors prepared within the TORES into eTPCS to prepare analyte eTPC populations to create cells expressing analyte TCRsp, or an intermediate expressing single analyte TCR chains. An eTPC presenting TCRsp is termed eTPC-t, and may be created by introduction of two complimentary TCR chain encoding ORFs to the eTPC (step i). An eTPC expressing a single analyte TCR chain alone is termed an eTPC-x, and may be created by introduction of a single TCR chain encoding ORF(s) to the eTPC (step ii). A eTPCt may alternatively be created from an eTPC-x, wherein a second complimentary TCR chain encoding ORF is introduced to an existing eTPC-x (step iii). In some instances, an eTPC-x may be created from an eTPC-t by removing a single analyte TCR chain (step iv).

Figure 8 Compilation of an eTPC-t in one step.

The eTPC 2A contains distinct genomic receiver sites 2B and 2D. The eTPC 2A may further contain a TCR signal response element 2F. Distinct genetic integration vectors 2C and 2E generated within the TORES are independently coupled to 2B and 2D, respectively. Integration vector 2C encodes a single TCR chain, and integration vector 2E encodes a second complementary TCR chain. The eTPC 2A is combined with integration vectors 2C and 2E. The resulting cell has insert 2C exchanged to the 2B genomic receiver site to create site 2B’ and deliver an ORF for a first TCR chain. In addition, the resulting cell line has insert 2E exchanged to the 2D genomic receiver site to create site 2D’ and deliver an ORF for a second TCR chain. This cell is capable of presenting a TCRsp at the surface, and is thus designated a eTPC-t.

Figure 9 Compilation of an eTPC-t in two steps via an eTPC-x intermediate.

The eTPC 2A contains distinct genomic receiver sites 2B and 2D. The eTPC 2A may further contain a TCR signal response element 2F. Distinct genetic integration vectors 2C and 2E generated within the TORES are independently coupled to 2B and 2D,

WO 2018/083318

PCT/EP2017/078378 respectively. Integrative vector 2C encodes a single TCR chain, and integration vector 2E encodes a second reciprocal TCR chain. In STEP 1 an eTPC 2A is combined with integrative vector 2C. The resulting cell has the TCR ORF of 2C exchanged to the 2B genomic receiver site to create site 2B’ and deliver an ORF for a first TCR chain. This cell expresses only a single TCR chain and is thus designated a eTPC-x. Genomic receiver site 2D remains unused. In STEP 2, the eTPC-x is combined with integration vector 2E. The resulting cell has insert 2E exchanged to the 2D genomic receiver site to create site 2D’ and deliver an ORF for a second complementary TCR chain. This cell is capable of presenting a TCRsp at the surface, and is thus designated a eTPC-t.

Figure 10 Reversion of an eTPC-t to an eTPC-x

The cell depicted in the upper panel is capable of presenting a TCRsp at the surface, and is thus designated a eTPC-t. This eTPC-t has genomic receiver sites 2B and 2D occupied by TCR ORFs, rendering them in the 2B’ and 2D’ forms. Genetic integration vectors harbouring genomic receiver site marker(s), and coupled to sites 2B’ or 2D’, designated 2Y and 2Z. Addition of 2Y or 2Z to the eTPC-t will exchange the genomic receiver site marker for the TCR chain encoded by either 2B’ or 2D’. The resulting cell expresses only a single TCR chain, and thus is designated eTPC-x.

Figure 11 Shotgun compilation of an eTPC-t pool from an eTPC to express random combinations of TCRsp from a TCR chain library.

The eTPC 2A contains distinct genomic receiver sites 2B and 2D. Distinct genetic integration vectors 2C and 2E are independently coupled to 2B and 2D, respectively. Integration vectors 2C i and 2C ii each encode a single TCR chain, and integration vectors 2E i and 2E ii each encode a complementary single TCR chain. The eTPC 2A may further contain a TCR signal response element 2F. The eTPC 2A is combined with integration vectors 2C i, 2C ii, 2E i and 2E ii. The resulting cell pool has TCR ORF of 2C i or 2C ii exchanged to the 2B genomic receiver site, in multiple independent instances to create sites 2B’ i and 2B’ ii, each delivering a single ORF for a TCR chain. The resulting cell pool further has insert 2E i or 2E ii exchanged to the 2D genomic receiver site, in multiple independent instances to create sites 2D’ i and 2D’ ii, each delivering a single ORF for a TCR chain complementary to those at sites 2C’i and 2C’ii.

The resulting eTPC-t cell pool comprises a mixed population of four distinct cell cohorts each expressing a discrete randomised TCRsp at the surface comprised of one of each complementary TCR chains contained in the initial vector library. This process

WO 2018/083318

PCT/EP2017/078378 can be scaled to different number of 2C and 2E variants to achieve cell libraries with randomized TCRsp presentation at various scales.

Figure 12 Shotgun compilation of an eTPC-t pool from an eTPC-x with unpaired analyte TCR chains to express random combinations of paired TCR chain pairs from a TCR chain library.

A precompiled eTPC-x contains the exchanged genomic receiver site 2B’ expressing a single TCR chains and the distinct genomic receiver site 2D. Distinct genetic integration vectors 2E i and 2E ii are coupled to 2D. Integration vectors 2E i and 2E ii each encode a single TCR chain. The eTPC-x may further contain a TCR signal response element 2F. The eTPC-x is combined with integration vectors 2E i and 2E ii. The resulting cell pool has insert 2E i or 2E ii exchanged to the 2D genomic receiver site, in multiple independent instances to create sites 2E i and 2E ii, each delivering a single ORF for a TCR chain. The resulting eTPC-t cell pool comprises a mixed population of distinct cell cohorts expressing a discrete TCRsp at the surface comprised of the TCR chain expressed from 2B’ paired with a single randomised complementary TCR chain contained in the initial vector library.

Figure 13 Shotgun compilation of an eTPC-x pool from an eTPC to express random members of a TCR chain library.

The eTPC 2A contains distinct genomic receiver sites 2B and 2D. Distinct genetic integration vectors 2C and 2E are independently coupled to 2B and 2D, respectively. Integration vectors 2C i, 2C ii and 2C ii each encode a single TCR chain. The eTPC 2A may further contain a TCR signal response element 2F. The eTPC 2A is combined with integration vectors 2C i, 2C ii, and 2C iii. The resulting cell pool has TCR OFF of 2C i, 2C ii or 2C iii exchanged to the 2B genomic receiver site, in multiple independent instances to create sites 2B’ i, 2B’ ii or 2B’ iii each delivering a single ORF for a TCR chain. The resulting eTPC-x cell pool comprises a mixed population of distinct cell cohorts each expressing a discrete randomised TCR chain contained in the initial vector library. This process can be scaled to different number of 2C variants to achieve cell libraries with randomized TCR chain presentation at various scales.

Figure 14 Shotgun compilation of an eTPC-t pool from a pool of eTPC-x with unpaired analyte TCR chains to express random combinations of paired TCRsp from a TCR chain library.

WO 2018/083318

PCT/EP2017/078378

A pool of eTPC-x contains the exchanged genomic receiver site 2B’ i, 2B’ ii or 2B’ iii, each expressing a single TCR chain, and the distinct genomic receiver site 2D. Distinct genetic integration vectors 2E is coupled to 2D. Integration vectors 2E encodes a single TCR chain. The eTPC-x may further contain a TCR signal response element 2F. The eTPC-x pool is combined with integration vectors 2E. The resulting cell pool has TCR ORF of 2E exchanged to the 2D genomic receiver site, in multiple independent instances to create site 2D’, delivering a single ORF for a TCR chain. The resulting eTPC-t cell pool comprises a mixed population of distinct cell cohorts expressing a discrete TCRsp at the surface comprised of the TCR chain expressed from a combination ofthe 2B’ encoded TCR chains, paired with TCR chain contained in 2D’. This process can be scaled to different number of 2E variants to achieve cell libraries with randomized TCRsp presentation at various scales.

Figure 15 Operation of a combined analyte eTPC:A system showing possible analyte affinity reagent- or NCBP-bound eTPC-t output states.

The analyte eTPC-t contains sites 2B’ and 2D’ each integrated with one ORF encoding a reciprocal TCRsp at the surface. When analyte eTPC-t and analyte affinity reagent or NCBP are contacted, different eTPC-t labelling states can be achieved; in this example one negative and three positive. The negative state is the resting state ofthe input eTPC-t, with no detectable binding ofthe analyte affinity reagent or NCBP, denoting failure of the analyte affinity reagent or NCBP to form a stable complex with the eTPC-t-presented TCRsp. Three positive states show hypothetical range of the degree of binding of the analyte affinity reagent or NCBP, as denoted by darker shading of the cells. This indicates a graded binding of analyte affinity reagent or NCBP analyte to the TCRsp expressed by eTPC-t population.

Figure 16 Operation of a combined analyte eTPC:A system showing possible signal-reported eTPC-t-output states in response to analyte affinity reagent or NCBP.

The analyte eTPC-t contains sites 2B’ and 2D’ each integrated with one ORF encoding a reciprocal TCRsp at the surface. The eTPC-t further contains a TCR signal response element 2F. When analyte eTPC-t and analyte affinity reagent or NCBP are contacted, different eTPC-t response states can be achieved, in this example one negative and three positive. The negative state is the resting state ofthe eTPC-t, with no signal strength at the 2F element, denoting failure ofthe analyte affinity reagent or NCBP to form a complex and stimulate the eTPC-t presented TCRsp. Three positive

WO 2018/083318

PCT/EP2017/078378 states show increasing signal strength from the 2F. States 2F’+, 2F’++ and 2F’+++ denote low, medium and high signal strength, respectively. The gene product of 2F denoted as hexagons accumulates to report signal strength of each cell state, as denoted by darker shading of the cells. This indicates a graded response of analyte TCRsp expressed by eTPC-t population towards analyte affinity reagent or NCBP resulting in signal transduction to the 2F element.

Figure 17 Operation of a combined analyte eTPC:A system showing possible signal-reported eTPC-t-output states in response to analyte APC.

The analyte eTPC-t contains sites 2B’ and 2D’ each integrated with one ORF encoding a reciprocal TCRsp at the surface. The eTPC-t further contains a TCR signal response element 2F. When analyte eTPC-t and analyte APC populations are contacted, different eTPC-t response states can be achieved, in this example one negative and three positive. The negative state is the resting state of the eTPC-t, with no signal strength at the 2F element, denoting failure of the analyte APC-presented aAPX:aAM/CM or aAM to stimulate the eTPC-t presented TCRsp. Three positive states show increasing signal strength from the 2F. States 2F’+, 2F’++ and 2F’+++ denote low, medium and high signal strength, respectively. The gene product of 2F denoted as hexagons accumulates to report signal strength of each cell state, as denoted by darker shading of the cells. This indicates a graded response of analyte TCRsp expressed by eTPC-t population towards analyte aAPX:aAM/CM or aAM presented by the analyte APC.

Figure 18 Operation of a combined analyte eTPC:A system showing possible analyte APC output states.

The analyte eTPC-t contains sites 2B’ and 2D’ each integrated with one ORF encoding a reciprocal TCRsp at the surface. The eTPC-t further contains a TCR signal response element 2F. When analyte eTPC-t and analyte APC populations are contacted, different APC response states can be achieved, in this example one negative and three positive. The negative state is the resting state of the analyte APC, denoting failure of the TCRsp chain pair to stimulate the aAPX:aAM/CM or aAM complex presented by the analyte APC. Three positive states show increasing signal strength from the contacted aAPX:aAM/CM or aAM. The reported signal strength of each cell state, is denoted by *, **, ***, and also denoted by darker shading of the cells. This indicates a graded response of analyte aAPX:aAM/CM or aAM towards the analyte TCRsp chain pair presented by the analyte eTPC-t.

WO 2018/083318

PCT/EP2017/078378

Figure 19 Operation of a combined eTPC:A to identify TCRsp chain pairs binding with analyte affinity reagent or NCBP from a pool of eTPC-t.

The eTPC-t pool contains cells harbouring sites 2B’ i, ii or iii and 2D’ i, ii or iii, wherein each eTPC-t is integrated with a pair of ORFs encoding a pair of complementary TCR chains, and thus each cell cohort in the population expresses a discrete TCRsp at the surface. An analyte affinity reagent or NCBP is contacted with the analyte eTPC-t pool. In the present example, only the pair of TCR chains expressed from 2B’ i/2D’ i (TCRsp i) is specific for the analyte affinity reagent or NCBP such that, only the cell cohort of the eTPC-t that bears TCRsp i (etTPC-t*) is able to detectably bind the analyte antigen or NCBP (*). The eTPC-t* bound to analyte affinity reagent- or NCBP- may be selected from the pool on the basis of the affinity reagent- or NCBP- labelling. Subsequently the analyte TCRsp-encoding ORFs of the selected and isolated eTPC-t* can be identified by sequencing of 2B’ and 2D’ DNA directly or indirectly through reverse-transcriptase PCR of the expressed transcripts of 2B’ and 2D’.

Figure 20 Operation of a combined eTPC:A system to identify TCRsp chain pairs from a pool of eTPC-t via induction of a signal-report response through stimulation with analyte affinity reagent or NCBP.

The eTPC-t pool contains cells harbouring sites 2B’ i, ii or iii and 2D’ i, ii or iii, wherein each eTPC-t is integrated with a pair of ORFs encoding a complementary Pair of TCR chains, and thus each cell cohort in the population expresses a discrete TCRsp at the surface. The eTPC-t further contains a TCR signal response element 2F. An analyte antigen or NCBP is contacted with the analyte eTPC-t pool. In the present example, only the Pair of TCR chains expressed from 2B’ i/2D’ i (TCRsp i) is specific for the analyte affinity reagent or NCBP such that, only the cell cohort of the eTPC-t that bears TCRsp i (eTPC-t*) is able to induce a signal report response via element 2F (*). The eTPC-t* bound to analyte affinity reagent- or NCBP- may be selected from the pool of eTPC-t on the basis of the affinity reagent- or NCBP- labelling. Subsequently, the analyte TCRsp-encoding ORFs of the selected and isolated eTPC-t* can be identified by sequencing of 2B’ and 2D’ DNA directly or indirectly through reverse-transcriptase PCR of the expressed transcripts of 2B’ and 2D’.

Figure 21 Operation of a combined eTPC:A system to identify TCRsp chain pairs from an eTPC-t pool via induction of a signal-report response through stimulation with analyte APC

WO 2018/083318

PCT/EP2017/078378

The eTPC-t pool contains cells harboring sites 2B’ i, ii or iii and 2D’ i, ii or iii, wherein each eTPC-t is integrated with a pair of ORFs encoding a reciprocal TCR chain pair, and thus each cell cohort in the population expresses a discrete TCRsp at the surface.

The eTPC-t further contains a TCR signal response element 2F. The analyte APC express on the surface an aAPX:aAM/CM or aAM. In the present example, only the TRC chain pair expressed from 2B’ i/2D’ i (TCRsp i) is specific for the aAPX:aAM/CM or aAM presented by the analyte APC, such that when eTPC-t pool and analyte APC population are contacted, only the cell cohort of the eTPC-t that bears TCRsp i (eTPCt*) reports TCRsp engagement through state 2F’. The eTPC-t* stimulated by the analyte APC may be selected from the pool on the basis of signal-report response. Subsequently, the analyte TCRsp-encoding ORFs of the selected and isolated eTPC-t* can be identified by sequencing of 2B’ and 2D’ DNA directly or indirectly through reversetranscriptase PCR of the expressed transcripts of 2B’ and 2D’.

Figure 22 Operation of a combined eTPC:A system to identify analyte antigens presented by analyte APC, via induction of an APC-centric signal-report response

The analyte APC pool contains cells expressing varied aAPX:aAM/CM or aAM on their surface. The analyte eTPC-t contain the exchanged genomic receiver site 2B’ and 2D’ driving the expression of a TCRsp at the surface. In the present example, only the complex aAPX:aAM/CM or aAM i is specific for the TCRsp presented by the analyte eTPC-t, such that when analyte APC pool and analyte eTPC-t population are contacted, only the cell cohort expressing aAPX:aAM/CM i responds (*). This response may be an intrinsic signal response to eTPC-t engagement, such as a change in surface phenotype, transcript abundance or cell death. The responding analyte APC may be selected to determine aAPX:aAM/CM or aAM that has been contacted by the analyte TCRsp presented bet the analyte eTPC-t.

Figure 23 Operation of a combined eTPC:A system to identify affinity reagent or NCBP from a pool of such entities via capture of the affinity reagent or NCBP reagent by an eTPC-t

The analyte eTPC-t contain the exchanged genomic receiver site 2B’ and 2D’ driving the expression of a TCRsp at the surface. An affinity reagent or NCBP pool is contacted with analyte eTPC-t, which permits the binding of analyte affinity reagent or NCBP specific for TCRsp presented by the analyte eTPC-t. In the present depiction, the TCRsp specifically binds only affinity reagent or NCBP i, and thus the analyte

WO 2018/083318

PCT/EP2017/078378 eTPC-t is labelled with only affinity reagent or NCBP i. An affinity reagent or NCBP may thus be selected from the pool via association with the eTPC-t, to identify those affinity reagents or NCBP specific for the analyte TCRsp presented by the analyte eTPC-t.

Figure 24 Operation of the two-part TORES/eTPCS device for preparing eTPC-t for assembly of a combined eTPC:A system

The overall analytical system in which the two-part TORES/eTPCS device is used to prepare analyte engineered TCR-presenting cells (eTPC-t) with various analyte antigens or antigen-presenting cells or particles into combined eTPC:A system. It is from the combined eTPC:A system that primary outputs are derived, and from these primary outputs that terminal outputs are derived. Operation of the overall system comprises two phases, the preparation phase, and the analytical phase.

In one aspect of Phase 1, analyte antigens provided as analyte affinity reagents, APC and/or NCBP are prepared. Such analyte antigens express antigens in various forms of antigenic moiety; analyte antigen-presenting complexes (aAPX); analyte antigenic molecules (aAM); aAPX with loaded aAM cargo (aAPX:aAM); a cargo molecule (CM); an aAPX loaded with CM (aAPX:CM); wherein the analyte antigens represent those to be tested for affinity or signal induction against the analyte eTPC-t (step i). In another aspect of Phasel, the two-part TORES/eTPCS device is used to prepare cells expressing analyte TCR chain pairs (TCRsp) at the cell surface (step ii). An eTPC presenting a TCRsp at the cell surface is termed an eTPC-t, wherein the eTPC-t present TCRsp to analyte antigens to test affinity or signal induction against the analyte antigens. The contact of eTPC-t and analyte antigens results from the assembly of a combined eTPC:A system (step iii).

Phase 2 of the overall system is the contacting of eTPC-t and analyte antigens prepared in Phase 1, resulting in the assembly of a combined eTPC:A system (step iii). Contacted analyte affinity reagent, APC and NCBP present analyte antigen moieties to the analyte eTPC-t and potentially bind eTPC-t based on complex formation with the presented TCRsp. Within the combined eTPC:A system, outputs of the analyte antigens, or analyte eTPC-t may change their signal state (denoted with *, and the darker shading) such that those responding species may be identified (step iv). Based on altered signal states within the eTPC:A system, specific analyte affinity reagent, APC and/or NCBP may be selected on their ability to induce a response in an eTPC-t, or the

WO 2018/083318

PCT/EP2017/078378 ability of an eTPC-t to induce a response in them. A response may be any detectable change in the state of any analyte, including an active signal-based reporting response from a cell-based analyte, or the binding of one analyte to another. Similarly, an analyte eTPC-t may be selected on the ability of to induce a response in the contacted analyte antigens, or for those analytes to induce a signal response in the eTPC-t. Selection based on this responsiveness yields the primary outputs of the combined eTPC:A system (step v). By obtaining the analyte cells, affinity reagents or NCBPs from step v, the presented analyte aAPX, aAM, aAPX:aAM, CM, aAPX:CM and/or TCRsp , may be identified as the terminal output of the device operation (step vi).

Figure 25 Arrangement of V cloning fragments for the construction of V-C entry vectors

Depicted is a representation of the V cloning fragments used to assemble V-C entry vectors of a TORES for human TRA and TRB TCR chains as described in Example 1.

The V cloning fragment is flanked by unique primer bind sequences at 5’ and 3’ end to facilitate PCR-mediated amplification of the cloning fragments. Bbsl sites represent a specific Type IIS restriction enzyme binding sites used in the assembly of the V-C entry vector, where indicates that the recognition site is orientated to cut in the 3’ direction of the site, and indicates that the site is orientated to cut in the 5’ direction. The Bbsl site cuts 5’ of the encoded Kozak sequence to create overhang*1. The Bsal site cuts to create the 5’ Notl overhang within the Notl 5’ fragment. Overhang*1 and the 5’ Notl overhang ultimately ligate with overhang*1’ of digested V-C entry vector backbone, and the 3’ Notl overhang of the digested C cloning fragment, respectively, in assembly of the V-C entry vector. The Notl 5’ fragment represents a 6 nucleotide 5’ fragment of the Notl recognition sequence, wherein Notl acts as the negative selection marker to eliminate parental V-C entry vector in operation of the TORES. The complete Notl recognition site is reconstituted with the 3’ Notl fragment, provided by the C cloning fragment. The V-segment represents the TCR V gene segment that is to be encoded by the final V-C entry vector, and encodes from the ATG start codon of the give V segment to the last Cys codon of the V segment that defines the border of the CDR3 region. The Bsal site is the Type IIS restriction enzyme recognition sequence used during operation of the TORES system to reconstitute a full-length TCR ORF. Action of the Bsal enzyme, wherein the site is orientated to cut in the 5’ direction, results in the creation of overhang φ1 at the 3’ end of the V segment that encompasses the three nu

WO 2018/083318

PCT/EP2017/078378 cleotides ofthe last Cys codon of each V segment, and the third nucleotide ofthe codon preceding that Cys codon. This overhang is standardized among all V segments in a given TORES set. Ultimately, the overhang φ1 at the 3’ of the V segment ligates with overhang overhang φ1 at the 5’ odeCDR3 in operation of the TORES system to reconstitution of a full-length TCR ORF. All sp denote the addition of one or more nucleotides to create the correct spacing between the Type IIS recognition sequences and the target overhang sequences, or to space the Notl recognition and cut site for efficient action.

Figure 26 Arrangement of C cloning fragments for the construction of V-C entry vectors

Depicted is a representation ofthe C cloning fragments used to assemble V-C entry vectors of a TORES for human TRA and TRB TCR chains as described in Example 1.

The C cloning fragment is flanked by unique primer bind sequences at 5’ and 3’ end to facilitate PCR-mediated amplification ofthe cloning fragments. Bbsl sites represent a specific Type IIS restriction enzyme binding sites used in the assembly ofthe V-C entry vector, where indicates that the recognition site is orientated to cut in the 3’ direction of the site, and indicates that the site is orientated to cut in the 5’ direction. The Bbsl site cuts to create the 3’ Notl overhang within the Notl 3’ fragment. The Bsal site cuts 3’ of the stop codon of the C segment to create overhang*2 at the 3’ end of the C segment. Overhang*2 and the 3’ Notl overhang ultimately ligate with Overhang*2’ of the digested V-C entry vector backbone, and the 5’ Notl overhang ofthe digested V cloning fragment, respectively, in assembly of the V-C entry vector. The Notl 3’ fragment represents a 6 nucleotide 3’ fragment ofthe Notl recognition sequence, wherein Notl acts as the negative selection marker to eliminate parental V-C entry vector in operation ofthe TORES. The complete Notl recognition site is reconstituted with the 5’ Notl fragment, provided by the V cloning fragment.

The C-segment represents the TCR C gene segment that is to be encoded by the final V-C entry vector, and encodes from the cytosine residue 5’ of the first Glu codon of the C gene segment to the stop codon. The Bsal site is the TyellS restriction enzyme recognition sequence used during operation ofthe TORES system to reconstitute a full-length TCR ORF. Action of the Bsal enzyme, wherein the site is orientated to cut in the 3’ direction, results in the creation of overhang φ3 at the 5’ end of the C segment.

WO 2018/083318

PCT/EP2017/078378

This overhang is standardized among all C segments in a given TORES set. Ultimately, the overhang φ3 at the 5’ of the C segment ligates with overhang overhang φ3 at the 3’ C part of the J donor vector in operation of the TORES system to reconstitution of a full-length TCR ORF. All sp denote the addition of one or more nucleotides to create the correct spacing between the Type IIS recognition sequences and the target overhang sequences, or to space the Notl recognition and cut site for efficient action.

Figure 27 Arrangement of V-C entry vector backbone for the construction of V-C entry vectors

Depicted is a representation of the V-C entry vector backbone used to assemble V-C entry vectors of a TORES for human TRA and TRB TCR chains as described in Example 1.

The circular plasmid DNA contains an origin of replication (Ori) and a positive selection marker #1. This selection marker is used for selection of transformed hosts when isolating clones of V-C entry vector backbone and V-C entry vectors during the assembly, and also for the selection of vectors containing full-length TCR ORFs during operation of the TORES. 5’ and 3’ genetic elements encode the target elements that flank the final TCR ORF after generation of full-length TCR ORF after its generation by TORES operation. A 5’ genetic element might represent a mammalian promoter element to drive the expression of TCR transcripts, and a 3’ genetic element might represent a transcriptional terminator sequence. The ACC65I site represents a restriction enzyme recognition sequence, wherein action of the Acc65l enzyme results in the creation of Overhang*1’. This Overhang*1’ ligates with Overhang*1 in the digested V cloning fragment during assembly of the V-C entry vector. The Xbal site represents a restriction enzyme recognition sequence, wherein action of the Xbal enzyme results in the creation of Overhang*2’. This Overhang*2’ ligates with Overhang*2 in the digested C cloning fragment during assembly of the V-C entry vector. Sp denotes the addition of nucleotides to space the Acc65l and Xbal recognition sites for efficient action of both enzymes.

Figure 28 Arrangement of the J receiving cassette fragment

Depicted is a representation of a J receiving cassette fragment used in the assembly of J donor vectors of a TORES for human TRA and TRB TCR chains as described in Example 1. A J receiving cassette fragment is inserted into a J donor backbone to generate a J receiving cassette vector.

WO 2018/083318

PCT/EP2017/078378

A J receiving cassette fragment is generated by annealing two complimentary oligonucleotides to create a linear double stranded DNA construct with 4-nucleotide single stranded overhangs at the 5’ and 3’ ends that are used for insertion of the fragment to the J donor vector backbone. Overhang*3 at the 5’ end of the J receiving cassette fragment ligates with Overhang*3’ of the digested J donor vector backbone, whereas Overhang*4 at the 3’ end ligates with Overhang*4’ of the digested J donor vector backbone.

The Bsal sites represent the Type IIS restriction recognition sites used in the operation of the TORES to assemble a full-length TCR ORF. Bsal site is orientated to cut in the 5’ direction, and acts ipon the C part sequence to generate Overhang φ3 at the 3’ C part. Bsal site ultimate acts on the J segment part of the J donor vector to create Overhang φ2 at the 5’end of the J segment part. Bsal element also contains Overhang*5, which is generated by action of the Bbsl on the Bbsl site during assembly of the J donor vector.

The Bbsl sites represent the Type IIS restriction recognition sites used to assemble the J donor vector. The Bbsl site cuts the Bsal element to generate Overhang*5, whereas the Bbsl site cuts the 5’ end of the C part to generate Overhang*6. Overhang’^ and Overhang*6 ultimately ligate with Overhang*5’ and Overhang*6’ of the J segment part, respectively. The C part represents a small portion of the target C gene segment to permit standardized generation of non-palindromic overhangs during operation of the TORES. This C part is ultimately carried at the 3’ end of the J segment part, and forms part of the sequence that ligates with the C segment carried by the digested V-C entry vector in operation of the TORES to generate a full-length TCR ORF. The Notl site represents a negative selection marker used to eliminate the parental J receiving cassette vector during generation of the J donor vector. All sp denote the addition of one or more nucleotides to create the correct spacing between the Type IIS recognition sequences and the target overhang sequences, or to space the Notl recognition and cut site for efficient action.

Figure 29 Arrangement of the J donor backbone

Depicted is a representation of J a donor vector backbone used in the assembly of J donor vectors of a TORES for human TRA and TRB TCR chains as described in Example 1. A J receiving cassette fragment is inserted into a J donor backbone to generate a J receiving cassette vector.

WO 2018/083318

PCT/EP2017/078378

The circular plasmid DNA contains an origin of replication (Ori) and a positive selection marker #2. This selection marker is used for selection of transformed hosts when isolating clones of J donor vector backbone and J donor vectors during the assembly. Importantly, this positive selection marker is distinct from positive selection marker #1 within the V-C entry vectors, such that parental J donor vectors are eliminated under positive selection on #1 during operation of the TORES to generate full-length TCR ORFs in the context of the V-C entry vector backbone.

The EcoRI site represents a restriction enzyme recognition sequence, wherein action of the EcoRI enzyme results in the creation of Overhang*3’. This Overhang*3’ ligates with Overhang*3 in the annealed J receiving cassette fragment during assembly of the J receiving cassette vector. The Xbal site represents a restriction enzyme recognition sequence, wherein action of the Xbal enzyme results in the creation of Overhang*4’. This Overhang*4’ ligates with Overhang*4 in the annealed J receiving cassette fragment during assembly of the J receiving cassette vector. Sp denotes the addition of nucleotides to space the Acc65l and Xbal recognition sites for efficient action of both enzymes.

Figure 30 Arrangement of the J receiving cassette vector

Depicted is a representation of a J donor vector backbone used in the assembly of J donor vectors of a TORES for human TRA and TRB TCR chains as described in Example 1. A J receiving cassette vector is created by insertion of a J receiving cassette fragment into a J donor backbone.

WO 2018/083318

PCT/EP2017/078378

The Bsal sites represent the Type IIS restriction recognition sites used in the operation ofthe TORES to assemble a full-length TCR ORF. Bsal site is orientated to cut in the 5’ direction, and acts ipon the C part sequence to generate Overhang φ3 at the 3’ C part. Bsal site ultimate acts on the J segment part of the J donor vector to create Overhang φ2 at the 5’end ofthe J segment part. Bsal element also contains Overhang*5, which is generated by action of the Bbsl on the Bbsl site during assembly of the J donor vector.

The Bbsl sites represent the Type IIS restriction recognition sites used to assemble the J donor vector. The Bbsl site cuts the Bsal element to generate Overhang*5, whereas the Bbsl site cuts the 5’ end of the C part to generate Overhang*6. Overhang’^ and Overhang*6 ultimately ligate with Overhang*5’ and Overhang*6’ ofthe J segment part, respectively.

The C part represents a small portion ofthe target C gene segment to permit standardized generation of non-palindromic overhangs during operation ofthe TORES. This C part is ultimate carried at the 3’ end of the J segment part, and forms part of the sequence that ligates with the C segment carried by the digested V-C entry vector in operation ofthe TORES to generate a full-length TCR ORF. The Notl site represents a negative selection marker used to eliminate the parental J receiving cassette vector during generation of the J donor vector.

All sp denote the addition of one or more nucleotides to create the correct spacing between the Type IIS recognition sequences and the target overhang sequences, or to space the Notl recognition and cut site for efficient action.

Figure 31 Arrangement of a J segment part

Depicted is a representation of a J segment part that is used in the assembly of J donor vectors of a TORES for human TRA and TRB TCR chains as described in Example 1. A J segment part is inserted into a J receiving cassette vector to create a J donor vector.

Annealing complimentary single stranded oligonucleotides to form a linear double stranded DNA construct with single stranded overhangs at either terminus generates a

J segment part. Overhang*5’ at the 5’ terminus anneals with Overhang*5 generated

WO 2018/083318

PCT/EP2017/078378 within the J receiving cassette vector digested with Bbsl. Overhang*6’ at the 3’ terminus anneals with Overhang*6 generated within the J receiving cassette vector digested with Bbsl.

The J segment part represents the target J gene segment sequence. Depending on the style of the J donor vector being constructed (i.e. short or long) the 5’ border of the J segment part is defined differently. For short J donor vectors, the 5’ border of the J segment part is defined as the Phe-Ala/Gly or Trp-Gly motifs that are used to define the canonical border between the J and CDR3 portions of a full-length TCR ORF. For long J donor vectors, the 5’ border of the J segment part is extended ten to twelve nucleotides 5’ of the Phe-Ala/Gly or Trp-Gly motif. This extends the portion of the overall TCR ORF encoded by the J donor vector, and conversely shortens the length of the odeCDR3 required to construct a full-length TCR ORF in operation of the TORES. At the 3’ end of the J segment part is encoded a single Adenine residue (A), which represent the first nucleotide of the C fragment. This adenine is excluded from the J receiving cassette vector.

Figure 32 Validation of reconstituted TORES TRA and TRB vectors by integration to eTPC

The TORES system was used to generate a model TCR alpha/beta pair (JG9-TCR), which has a known specificity for a HCMV antigen presented in HLA-A*02:01. The TORES produced each chain in either a Component 2C or 2E context (see example 3). An eTPC-t was created through RMCE by transfection of component 2C and 2E plasmids and a construct encoding flp recombinase into the eTPC line ACL-488, which harbours two genomic integration sites, 2B and 2D, encoding reporters BFP and RFP, respectively. 10 days after transfection, individual cells diminished for the BFP and RFP signals, encoded by Components 2B and 2D selection markers, were sorted as single cells. Resulting monoclonal eTPC-t ACL-851 were analysed in parallel with the parental eTPC, and a single example presented, a) and b) Parental eTPC cell line ACL-488 and an example monoclonal was analysed by flow cytometry for BFP and RFP signals. The plot displays live single cells as BFP versus RFP, showing the eTPC cell line is positive for selection markers present in component 2B and 2D (a), and resulting monoclone has lost these markers as expected for integration couple events between 2B/2C and 2D/2E (b). Percentage values represent the percentage of double positive cells in a) and double negative cells in b). c) to f) eTPC ACL-488 and monoclone eTPC-t ACL-851 were stained with antibodies for CD3 and TCR alpha/beta (TCRab)

WO 2018/083318

PCT/EP2017/078378 and HLA multimer reagent specific for the JG9-TCR (Dex HLA-A*02:01-NLVP) and analysed by flow cytometry and gated for live single cells. The parental eTPC line showed no positive staining for CD3 or TCR on the cell surface (c), and was also negative for staining with HLA multimer reagent (d). In contrast, the resulting monoclone showed positive staining for both CD3 and TCR on the cell surface (e) and showed positive staining with the multimer reagent specific for the expressed JG9-TCR. Percentage values represent the percentage of CD3/TCRab double positive cells in c) and e), and CD3/HLA-multimer double positive cells in d) and f). g) Genomic DNA was prepared from monoclonal eTPC-t ACL-851 and subjected to PCR with primers specific for the JG9-TCR-alpha chain encoded by component 2D’, or the JG9-TCR-beta chain encoded by component 2B’. PCR products were resolved by agarose gel and observed as expected band size, h) Genomic DNA was prepared from monoclonal eTPC-t ACL851 and subjected to digital drop PCR with primers and probes specific for the JG9TCR-alpha chain encoded by component 2D’, or the JG9-TCR-beta chain encoded by component 2B’. A reference amplicon primer/probe pair for an intron of the TCR alpha constant (TRAC) was included. The table presents ratios of reference to TCR alpha and TCR beta. A ratio of close to 0.33 indicates that a single copy of each TCR alpha and beta chain is present in the eTPC-t line ACL-851, which is a triploid line.

Figure 33: Demonstration of eTPC-x reversion from eTPC-t

A parental eTPC-t cell line ACL-851, expressing a TCR alpha and beta chain at site D’ and B’, respectively was reverted to a eTPC-x line by exchanging component D’ with a donor vector encoding GFP (Component Z). Component Z contained recombinase heterospecific F14/ F15 sites flanking the GFP ORF, and was thus compatible with Component D’. eTPC-t line ACL-851 was transfected with Component Z along with a construct encoding flp recombinase. 7 days after transfection, individual cells positive for GFP signals were sorted and grown as monoclones. Resulting monoclonal eTPC-x lines were analysed by flow cytometry in parallel with the parental eTPC-t, and a single example presented, a) and b) The monolcone eTPC-x ACL-987 derived from parental eTPC-t ACL-851 was analysed by flow cytometry for GFP expression along with the parental line. Plots display SSC versus GFP parameters of gated live single cells. The parental cell line has no GFP expression (a), while the monoclone ACL-987 has gained GFP as expected (b), indicating exchange of the TCR alpha ORF for a GPF ORF. c) and d) The monolcone eTPC-x ACL-987 derived from parental ACL-851 along with the parental eTPC-t ACL-851 were stained with antibodies for CD3 and TCRab and ana

WO 2018/083318

PCT/EP2017/078378 lysed by flow cytometry. Plots display CD3 versus TCRab parameters gated on live single cells. The parental cell showed positive staining for both CD3 and TCRab (c), while the derived monoclone showed negative staining for both (d); confirming loss of TCR alpha ORF in the derived eTPC-χ line.

Figure 34: Demonstration of shotgun integration into eTPC-χ to create pool of eTPC-t

An eTPC-t pool was created from an eTPC-χ parental line expressing a single TCR beta chain in Component B’. The eTPC-χ line expressed GFP as the reporter at available site 2D. A pool of 64 variant TCR alpha chains, including the parental chain, were constructed with the TORES system to represent a pool of Component 2E (see Example 5). The parental TCR chain pair represents the JG9-TCR with known specificity for a HCMV antigen presented in HLA-A*02:01. The Component 2E pool was transfected into the parental eTPC-χ ACL-987 along with a construct encoding flp recombinase. A polyclonal line was selected by sorting for GFP positive cells 10 days after transfection. The resulting ACL-988 polyclonal eTPC-t was subsequently sorted on the basis of negative staining for GFP and positive or negative staining for HLA multimer reagent (DEX HLA-A*02:01-NLVP). Recovered single cells were sequenced to identify the encoded TCR-alpha chains and compared to a parallel analysis of each of the TCR-alpha chain variants paired with the native TCR-beta chain in terms of staining with an HLA multimer reagent specific for the parental TCR chain pair, a) and b) Parental eTPC-χ ACL987 line and resulting polyclone eTPC-t ACL-988 line were analysed by flow cytometry for GFP expression. Plots display SSC versus GFP parameters of live single cells. Parental cell line shows positive signal for GFP, indicating intact component 2D (a). Derived polyclonal line shows half positive and half negative for GFP (b), indicating that half of the cells in the polyclonal population have potentially exchanged the GFP ORF at 2D for TCR alpha ORF to form component 2D’, c) and d) Parental eTPC-χ ACL-987 line and resulting polyclone eTPC-t ACL-988 line were stained with and CD3 antibody and HLA multimer with specificity for the parental JG9-TCR (DEX HLA-A*02:01-NLVP), and analysed by flow cytometry. Plots display CD3 versus HLA multimer parameters of live single cells. The parental cell line is negative for both CD3 and HLA multimer staining (c). The left hand panel of d) displays gated GFP-negative events, and the right hand GFP-positive events. Only GFP-negative events, where the component 2D is converted to 2D’, shows CD3 positive staining, of which a subset shows positive staining for HLA multimer. Single cells from the gated HLA multimer negative and positive gate were sorted and the integrated ORF at component 2D’ sequenced to determine

WO 2018/083318

PCT/EP2017/078378 identity of TCR alpha ORF.

e) All 64 JG9-TCR-alpha variants were cloned into an expression construct that permitted each to be independently transfected to parental eTPC-χ (ACL-987). Relative staining units (RSU) against the HLA-A*02:01-NLVP tetramer reagent was determined for each. RSU is calculated as the ratio of the mean fluorescence intensity (MFI) of HLAA*02:01-NLVP tetramer signal for the CD3 positive population over the CD3 negative population, and is indicative of the binding strength of each TCR chain pair variant to the HLA multimer reagent.. Each point plotted in Figure e) represents the observed RSU for each 64 variants. Open circles correlate to the sequenced cells recovered from the GFP-negative/HLA multimer-positive gate. Open triangles correlate to the sequenced cells recovered from the GFP-negative/HLA multimer-negative gate.

Figure 35: Functional demonstration of component 2F

The eTPC-t cell line carrying a component 2F (ACL-1277), wherein the TCR chains at Component 2B’ and 2D’ encode a TCR pair that is specific for HMCV antigenic peptide NLVPMVATV presented in HLA-A*02:01. The component 2F reporter was RFP. This eTPC-t was contacted for 24 hours with various APC lines of differing HLA characteristics in the presence and absence of model peptide antigens, and the contact cultures analysed by flow cytometry. Flow cytometry histogram plots show event counts against RFP signal of viable single T-cells identified by antibody staining for a specific surface marker that was not presented by the APCs. a) and b) APC cells expressing only HLAA*02:01 (ACL-209) were pulsed with NLVPMVATV (a) or VYALPLKML (b) peptides and subsequently co-cultured with eTPC-t for 24 hrs. c) and d) APC cells expressing only HLA-A*24:02 (ACL-963) were pulsed with NLVPMVATV (c) or VYALPLKML (d) peptides and subsequently co-cultured with eTPC-t for 24 hrs. e) APC cells expressing only HLA-A*02:01 (ACL-209) were left without peptide pulsing and subsequently cocultured with eTPC-t for 24 hrs. f) APC cells that express no HLA on the cell surface (ACL-128) were pulsed with NLVPMVATV and subsequently co-cultured with eTPC-t for 24 hrs.RFP signal was significantly increased in the eTPC-t ACL-1277 only in the presence of HLA-A*02:01 expressing cells pulsed with NLVPMVATV, representing the known target of the expressed TCR. Histogram gates and values reflect percentage of events in the RFP positive and RFP negative gates. This indicates the specific response of Component 2F to engagement of eTPC-t expressed TCRsp with cognate HLA/antigen (aAPX:aAM).

WO 2018/083318

PCT/EP2017/078378

Materials and methods

DNA Sequencing

All sequencing referred to within the presented examples was conducted by the Sanger method, and conducted by GATC Biotec AB, Sweden.

DNA Synthesis

All DNA synthesis referred to within the presented examples was conducted by Integrated DNA technologies BVBA, Belgium.

DNA Fragments >125 bp were synthesised as linear double stranded DNA molecules as a ‘gBIock Gene Fragments’ product.

DNA Fragments 15-60 nt were synthesised as single stranded DNA molecules as a ‘Custom Oligonucleotide Fragment’ product.

DNA Fragments 61-124 nt were synthesised as single stranded DNA molecules as a ‘Ultramer DNA oligonucleotide Fragment’ product.

Vector library assembly and cloning

The construction of vectors described in the examples comprises a variety of methods well known to those skilled in the art, and specific reaction compositions are outlined in detail in Examples 1 to 3. The following key materials were used in the described procedures:

Table 1: Vector library assembly and cloning reagents

Product	Supplier	Supplier Number
Acc651	New England BioLabs	R0599L
Bbsl HF	New England BioLabs	R3539L
DH5alpha competent cells	Thermo Fisher Scientific	18265017
DNA clean and concentrator kit	Zymo Research	D4030
EcoR1	New England BioLabs	R3101S
Notl	New England BioLabs	R3189L
QIAamp DNA Mini kit	Qiagen	51306

WO 2018/083318

PCT/EP2017/078378

QIAquick Gel Extraction kit	Qiagen	28704
Qiagen Plasmid Plus Midi kit	Qiagen	12945
T4 ligase	New England BioLabs	M0202L
T4 ligase buffer 10x	New England BioLabs	B0202S
Xbal	New England BioLabs	R0145S
Xhol	New England BioLabs	R0146S

Oligonucleotide duplex encoding CDR3 (odeCDR3) assembly odeCDR3 were routinely assembled by annealing partially complementary single stranded oligonucleotides. A detailed description of reaction composition and condi5 tions is provided in Example 2. The following key materials were used in the described procedures:

Table 2: Oligonucleotide duplex assembly reagents

Product	Supplier	Supplier Number
T4 ligase buffer 10 x	New England BioLabs	B0202S
T4 PNK	New England BioLabs	M0201L

TCR reconstitution

A detailed description of reaction composition and conditions is provided in Example 3.

The following key materials were used in the described procedures.

Table 3: TCR reconstitution reagents

Product	Supplier	Supplier Number
Bsal-HF	New England BioLabs	R3535L
CutSmart buffer 10 x	New England BioLabs	B7204S
DH5alpha competent cells	Thermo Fisher Scientific	18265017
Notl-HF	New England BioLabs	R3189L
QIAamp DNA Mini kit	Qiagen	51306
T4 Ligase	New England BioLabs	M0202L
T4 Ligase buffer 10 x	New England BioLabs	B0202S

WO 2018/083318

PCT/EP2017/078378

Transfection of cells

All cells used in this application were derived from HEK293 cells. One day prior to transfection, cells were seeded at a density of 1.2-1.4 x10⁶ cells/60mm dish in 90% DMEM + 2mML-glutamine + 10% HI-FBS (Life Technologies).

The following day, cells with 65% confluency were transfected with a total amount of 5ug DNA and jetPEI ® (Polyplus transfection reagent, Life Technologies) at a N/P ratio of 6. Stock solutions of DNA and jetPEI ® were diluted in sterile 1M NaCI and 150mM NaCI respectively. The final volume of each solution was equivalent to 50% of the total mix volume. The PEI solution was then added to the diluted DNA and the mixture was incubated at room temperature for 15min. Finally, the DNA/PEI mixtures were added to the 60-mm dishes, being careful not to disrupt the cell film. The cells were incubated for 48 hours at (37 °C, 5% CO2, 95% relative humidity) prior to DNA delivery marker expression analysis. The medium was replaced before transfection.

RMCE between a paired integration couple

For RMCE integration, cells were transfected with 0.6 pg of DNA vectors encoding FLP, (V4.I.8), 2 pg of Component 2C/2Y, 2 pg of Component 2E/2Z, 0.4 pg of DNA encoding a marker to track DNA delivery. 2 days after transfection cell positive for the DNA delivery marker, either GFP or RFP positive, were sorted by FACS. 4-10 days aftertransfection, individual cells displaying diminished fluorescent protein signal, encoded by Components 2D and 2B selection markers were sorted by FACS. The exception being for generating ACL-987 where individual cells displaying GFP positivity were sorted by FACS.

Transient expression of TCR chain pairs to characterization of their RSU For transient expression, cells were transfected with DNA vectors encoding FLP, (V4.I.8), JG9-TCR-alpha variant (VP.7751 .RC1 ,A1 to VP.7751 .RC1 .H8), JG9-TCRbeta WT chain (V3.C.5), and DNA vector vehicle (V1 .C.2). 2 days after transfection, all cells were stained with HLA-A*02:01-NLVP tetramer and anti-CD3 antibodies. RSU were calculated as the ratio of the mean fluorescence intensity (MFI) of HLA-A*02:01NLVP tetramer signal for the CD3 positive population over the CD3 negative population, and was indicative of the binding strength of each TCR chain pair variant.

Fluorescence activated cell sorting (FACS)

WO 2018/083318

PCT/EP2017/078378

Single cell sorting or polyclone sorting was achieved through standard cell sorting methodologies using a BDInflux instrument. Briefly, ACL cells were harvested with TrypLE™ Express Trypsin (ThermoFisher Scientific) and resuspended in a suitable volume of DPBS 1X (Life Technologies) prior to cell sorting, in DMEM 1X medium containing 20% HI-FBS and Anti-Anti 100X (Life Technologies).

Cells were stained with HLA-multimer reagent on ice for 10 mins, then with CD3 and/or TCRab antibodies. Detection of specific cell fluorescent properties by the BDInflux instrument are defined in table 4.

Sorting of single cells for monoclonal generation, the cells displaying the phenotype interest were deposited into 96-well plates, containing 200 ul of growth medium. One to two plates was sorted per sample. Polyclonal cell sorts were directed into FACS tubes, containing media, using the Two-way sorting setting in the cell sorter Influx™ (BD Biosciences).

Single cells sorts for molecular characterization of their JG9-TCR-alpha variant were sorted to PCR plate pre-loaded with 5 pL of nuclease-free water. Specimens were snap-frozen until subsequent processing.

Table 4

Vectors

ID	Name
V1.A.4	pcDNA3.1_GFP
V1.A.6	pcDNA3.1_RFP
V1.C.2	pMA-SV40pA
V3.C.5	pMA-CS-JG9-TCRbeta
V4.H.9	pMA-F14-GFP-F15
V7.A.3	pMA-F14-TCR-JG9-alpha-F15
V7.A.4	pMA-FRT-TCR-JG9-beta-F3
V8.F.8	F14-TCRaF15 CDR3degen.64mix
V4.I.8	CMVpro-Flp-sv40pA-V2
VP.7751.RC 1-A1 to H8	64 individual vectors, each encode a different member of JG9-TRA CDR3 64 variants set

WO 2018/083318

PCT/EP2017/078378

Table 5

BD Influx filters

Protein	Fluorochrome	Filter
Cas9/GFP	GFP	488-530/40
HLA-A, B, C	PE-Cy5	561-670/30
BFP	BFP	405-460/50
RFP	RFP	561-585/29
TCRab (R63)	APC	640-670/30
CD3 (R78)	APC-H7	640-750LP
CD3 (R71)	APC	640-760/30
DEX HLA-A*02:01-NLVP	PE	561-585/29

Genomic DNA extraction for genetic chararterization

DNA was extracted from 5x10⁶ cells using the QIAamp DNA Minikit (Qiagen). DNA was stored in 1xTE (10mM Tris pH8.0 and 0.1 mM EDTA)

PCR reactions to assess the RMCE- integration of the TRA-ORF and TRB-ORF into component 2B or 2D

Primers used to assess integration of the TRA-ORF, annealed to the TRA-C segment (forward primer 1.F.7) and the sv40pA terminator (Reverse primer 15.H.2) that is a preexisting part of the genomic receiving sites. Expected size 566bp

Primers used to assess integration of the TRB-ORF, annealed to the TRB-C segment (forward primer 1.F.9) and the sv40pA terminator (Reverse primer 15.H.2) that is a preexisting part of the genomic receiving sites. Expected size 610bp.

Table 6 - PCR reagents for assess integration of the TRA-ORF or TRB-ORF

PCR TRA specific primers	volumes/reaction
5xPhusion buffer	4 ul
DNTPs	0,2 ul
Phusion DNA polymerase	0,15 ul
1.F.7 TRAC-GT-F1	0,5 ul
15.H.2 sv40pA-GT-R1	0,5 ul
H20	up to 20 ul
DNA(100nq)	1 ul (100 ng/ul)

WO 2018/083318

PCT/EP2017/078378

PCR TRB specific primers	volumes/reaction
5xPhusion buffer	4 ul
DNTPs	0,2 ul
Phusion DNA polymerase	0,15 ul	5
1.F.9 TRBC2-GT-F1	0,5 ul
15.H.2 sv40pA-GT-R1	0,5 ul
H20	up to 20 ul
DNA (100 nq)	1 ul (100 ng/ul)

Table 7 - PCR cycle conditions

Step	Temperature	Time
Initial Denaturation	98°C	30 sec
30 cycles	98°C	10 sec
	60°C	10 sec
	72°C	15 sec
Final extenstion	72°C	10 min

PCR products were run on a 1% Agarose gel in 1XTAE buffer, using the PowerPac

Basic (Bio-Rad), stained with 10,000 dilution of sybersafe and analyzed with Fusion SL (Vilber Lourmat).

ddPCR reactions to assess the copy number of TRA-ORF and TRB-ORF in the genome after DNA delivery.

DNA of selected ACL-851 monoclones was analysed by using specific primers and probed targeting the TCR_ORF C segment of interest

Primers and probe used to assess TRA-ORF copy number, annealed to the TRA-C segment (forward primer 1.F.7, Reverse primer 1.F.8 and probe 1.G.1)

Primers and probe used to assess TRB-ORF copy number, annealed to the TRB-C segment (forward primer 1.F.9, Reverse primer 1.F.10 and probe 1.G.2)

WO 2018/083318

PCT/EP2017/078378

In all cases, a reference gene (TRAC) was simultaneously screened to chromosome determine copy numbers, using primers 10.A.9 and 10.A.10 together with the fluorescent probe 10.B.6 conjugated with HEX. Integration copy number considered that HEK293 cells are triploid for reference gene (TRAC).

Prior to Droplet Digital PCR, DNA was digested with Mfel (NEB) to separate tandem integrations. The reaction setup and cycling conditions were followed according to the protocol for ddPCR™ Supermix for Probes (No dUTP) (Bio-Rad), using the QX200™ Droplet Reader and Droplet Generator and the C1000 Touch™ deep-well Thermal cy10 cler (Bio-Rad).

Table 8

ddPCR conditions
Step 1	Step 2	Step 3	Step 4	Step 5	Step 6
95°C	94 °C	60 °C	Goto 2 x 39	98 °C	8 °C
10:00	0:30	1:00	10:00	oo

Data was acquired using the QuantaSoft™ Software, using Ch1 to detect FAM and Ch2 for HEX.

WO 2018/083318

PCT/EP2017/078378

Table 9 ddPCR Primers and probes

ID	Name	Sequence
1.F.7	TRAC-GT-F1	ATGTGCAAACGCCTTCAAC
1.F.8	TRAC-GT-R1	TTCGGAACCCAATCACTGAC
1.G.1	TRAC-probe-FAM	TTTCTCGACCAGCTTGACATCACAGG
1.F.9	TRBC2-GT-F1	GCTGTCAAGTCCAGTTCTACG
1.F.10	TRBC2-GT-R1	CTTGCTGGTAAGACTCGGAG
1.G.2	TRBC2-probe-FAM	CAAACCCGTCACCCAGATCGTCA
10.A.9	TRAC-TCRA-ex1-F1	CTGATCCTCTTGTCCCACAGATA
10.A.10	TRAC-TCRA-ex1-F1	GACTTGTCACTGGATTTAGAGTCTCT
10.B.6	TRAC-probe(HEX)	ATCCAGAACCCTGACCCTGCCG

Table 10 - ACL cell lines

ID	Components	Comments
ACL-488	2B, 2D	2B encodes BFP, 2D encodes RFP
ACL-851	2B’, 2D’	eTPC-t, 2B’ encodes wtJG9-TCRb, 2D’ encodes wtJG9-TCRa
ACL-987	2B’, 2D	eTPC-x, 2B’ encodes wtJG9-TCRb, 2D’ encodes GFP
ACL-988	2B’, 2D’	Polyclone eTPC-t, 2B’ encodes wtJG9-TCRb, 2D’ encodes a JG9-TCRa 64x variant
ACL-1063	2B, 2D, 2F	eTPC with responder element, 2B and 2D encodes selection markers
ACL-1277	2B’, 2D’, 2F	eTPC-t with responder element, 2B’ and 2D’ encodes TCR chain pairs
ACL-209		eAPC-p, expressing HLA-A*02:01
ACL-963		eAPC-p, expressing HLA-A*24:02
ACL-128		eAPC, HLA-ABC null

WO 2018/083318

PCT/EP2017/078378

Sequencing of TCR alpha and beta chains from single T-cells

Individual FACS-sorted eTPC-t-cells were subjected to a two-step amplification process that entails a V-region specific primer collection for each TRA and TRB, followed by paired nested PCR reactions that create TRA and TRB amplicons for sequence analysis. This procedure is described previously (Han et. al. Nat Biotechnol. 2014 32(7): 684-692). The following materials were used in the described procedures:

Table 11: Single cell RT-PCR and nested PCR reagents

Product	Supplier	Supplier Number
2x Reaction Mix	Thermo Scientific	12574035
5X Phusion HF Buffer	Thermo Fisher Scientific	F-549S
dNTPs	Thermo Fisher Scientific	10297018
Nuclease free water	Qiagen	129114
Phusion Hot Start II DNA Polymer- ase	Thermo Fisher Scientific	F-549S
SuperScript® III One- Step RT- PCR System with Platinum® Taq High Fidelity DNA Polymerase	Thermo Scientific	12574035

Demonstration of functional component 2F eTPC-t and APC cells were routinely cultured in RPMI+10% heat-inactivated Fetal Calf Serum (complete media) between 0.2 x 10^Λ6 - 1.5 x 10^Λ6 cells/ml, at 37°C, 90% relative humidity and 5% CO2. Peptides NLVPMVATV and VYALPLKML were synthetized by Genescript, and received lyophilized. Peptide primary stocks were suspended in 10% DMSO and sorted at -80’C. Working stocks were prepared at the time of administration, at 50 μΜ in complete media (50x concentrated). The following APCs presenting HLA-A*02:01 (ACL-209) or HLA-A*24:02 (ACL-963) or HLA-null (ACL-128) were used. The eTPC-t cell line (ACL-1277, Component 2A) was engineered with two unique genomic receiver sites (Components 2B, 2D), engineered to be

WO 2018/083318

PCT/EP2017/078378

HLA Null, utilizing native CD3 expression, and harboring a two-component, synthetic response element (Component 2F). In addition, ACL-1277 had Components B, D converted to B’ / D’ with the integration of TCR alpha/beta ORF encoding a TCRsp specific for pHLA: HLA-A*02:01-NLVPMVATV (See Example

8).

Antigen pulsing procedure

Actively growing cultures of APC cells (0.5-1.0 x 10^Λ6 cells/ml) were suspended, sample taken and counted to determine cell concentration. Subsequently, 1 million cells were harvested, washed once with Dulbecco’s phosphate buffered saline (DPBS, Gibco) followed by suspension in complete media with 1 pM of peptide or no peptide at a cell concentration between 1 to 2 x 10^Λ6 cells/ml. Cells were incubated for 2 h in standard culturing conditions, in a 24-well culture plate. After 2 h the cells were harvested, pelleted by centrifugation (400 ref, 3 min), followed by 3 x 10 ml washes with DPBS. Cells were subsequently suspended at 0.2 x 10^Λ6 cells/ml in complete media.

eTPC-t havesting

Actively growing cultures of eTPC-t cells (0.5-1.0 x 10^Λ6 cells/ml) were suspended, sample taken and counted to determine cell concentration. Cells were harvested, washed once with PBS and then suspended at a concentration of 0.6 x 10^Λ6 cells/ml in complete media.

Contacting eTPC-t and APC in an eTPC:A system

To each well of a 96-well round-bottom plate, 50 pl of complete media, 50 pl of APC , followed by 50 pl of eTPC-t were added. This equated to approximately 10,000 APC and 30,000 eTPC-t for a ratio of 1:3, at a total cell concentration of approximately 0.27 x 10^Λ6 cells/ml. The cell mixture was then incubated for approximately 24 hours at standard culturing conditions.

Staining and analysis

After 24 hours incubation, the cells were harvested, and transplanted into 0.75 ml Vbottom Micronic tubes, washed once with 500 pl DPBS and subsequently stained with Dead Cell Marker (DCM-APC-H7) as follows; to each well 25 pl of staining solution was added, cells suspended by mixing and then incubated for 15-20 min. The staining solution comprised of 0.5 pl DCM-APC-H7 per 100 pl staining solution. After incubation,

WO 2018/083318

PCT/EP2017/078378 cells were washed twice with 500 μΙ DPBS+2%FCS (Wash Buffer). Cells were then stained for surface markers unique to the eTPC-t; to each well 30 μΙ of staining solution was added, cells suspended by mixing and then incubated for 30-45 min. The staining solution comprised of 2.5 μΙ anti-myc-AF647 per 100 μΙ staining solution (clone 9E10, Santa Cruz Biotech). After incubation, cells were washed twice with 500 μΙ Wash buffer, then suspended in 200 μΙ of Wash buffer and then analysed by FACS on a LSRFortessa (BD Biosciences).

Examples

Example 1 Design and assembly of a TORES system for human TRA and TRB A TORES consists of a V-C entry vector library and J donor vector library for a given TCR chain. When combined with a target odeCDR3 sequence to be inserted into a selected V-J-C context, a full-length TCR ORF can be reconstituted. Through varying odeCDR3 sequence features and/or V/J/C selection, this reconstitution step may also represent a sequence diversification step in TCR ORF engineering workflows. In the present example, the design and assembly of a complete TORES system for human TRA and TRB chains is described.

Design and assembly of TRA V-C entry vector library for native human TRA repertoire In the present example, the design and assembly of a TRA V-C entry vector library that contains the native human TRA V-C sequence repertoire is described. A modular assembly method is used, such that the construction of V-C entry vector libraries may be rapidly cycled for other TCR chains from humans, other organisms, or for synthetic TCR chains.

The DNA components required for a TRA V-C vector library are:

I. A TRA V cloning fragment for each functional TRA V gene segment encoded in the human genome

II. Single TRA C cloning fragment

III. A V-C entry vector backbone

In the present example, the TRA V and TRA C cloning fragments were synthesized and used to assemble into a target V-C entry vector backbone in a single restriction enzyme and ligase reaction.

In the present example, a pair of heterospecific FRTV-C entry vector backbones are

WO 2018/083318

PCT/EP2017/078378 used to assemble TRA and TRB V-C entry vector libraries. Each TRA and TRB V-C entry vector libraries are constructed with vector backbones containing distinct flippase recognition target (FRT) sequences, representing the 5’ and 3’ genetic elements included in the V-C entry system, component 2C and 2E. Thus, the product TRA / TRB pairs generated in operation of this TORES may be submitted to rapid genomic integration into the eTPC cells containing genomic receiver sites (components 2B and 2D) that include compatible FRT sites within their 5’ and 3’ genetic elements.

In the present example, TRA V-C entry vector contains F14 and F15 FRT sequences as the 5’ and 3’ genetic elements, respectively. This F14/F15 V-C entry vector backbone sequence is presented as SEQ0688.

In the present example, the TRA V-C entry vector library is constructed using Type IIS restriction enzyme Bbsl. The Type IIS restriction enzyme used in functioning of the complete TORES to reconstitute full-length TRA ORFs is Bsal.

Design of synthetic TRA V cloning fragments

The arrangement of genetic elements of the TRA V cloning fragments in the present example is depicted in Figure 25.

Each end of the TRA V cloning fragment encodes a standardized 5’ and 3’ primer bind DNA sequence of 20 nucleotides for propagation of the overall fragment by PCR.

Proximal to the 5' primer bind a Bbsl Type IIS restriction enzyme binding site is encoded, wherein the direction of the Bbsl binding site guides the Bbsl enzyme to cut the DNA 3' to its recognition sequence. Overhangs generated by Bbsl enzymatic activity are encoded by Overhang *1. This overhang is designed to permit directed ligase-dependent cloning with an arm of the V-C entry vector backbone.

A consensus kozak sequence is encoded 5' of the ATG start codon within the TRA V gene segment for efficient initiation of translation of the final reconstituted and expressed TRA mRNA. In the present example, each TRA V segment encodes all amino acids from the start methionine residue until its last cysteine (Cys) of the TRA V segment. This Cys residue is generally recognised as a border of the TRA variable gene segments, the deletion of which is rare in naturally occurring recombined and functional TRA chains. Where necessary, native human TRA V consensus sequences have been

WO 2018/083318

PCT/EP2017/078378 edited to remove recognition sequences for any restriction enzymes used within assembly or reconstitution operations with the TORES, and also any enzymes used in downstream applications.

To the 3’ end of the TRA V segment a Bsal Type IIS restriction enzyme binding site is encoded, Bsal The direction of the Bsal binding site guides the Bsal enzyme to cut the DNA 5' to its recognition sequence. The resulting overhang sequence is designed to encompass the last cysteine codon of the V segment element and the 3^rd nucleotide for amino acid codon preceding the cysteine. Thus the action of Bsal on the designed sequence creates a TRA V Cys-overhang φ1 at the 3’ end of the TRA V segment. In the present example, this Cys-overhang φ1 is standardized among all included TRA V segments to simplify and unify the cloning strategy. Where necessary the nucleotides encoding the TRA V genetic element were changed to encode this standardised overhang but not change the translated amino acid sequence. This Bsal 4· site is utilized during the full length TRA reconstitution reaction.

In this present example, the V-C entry vector negative selection marker is a Notl restriction enzyme binding site. To construct a Notl binding site, two halves of the site are combined when the TRA V cloning fragment and TRA C cloning fragment are ligated together. The TRA V cloning fragment encodes the Notl 5' segment of six nucleotides.

To the 5’ end of the 3' primer bind sequence encodes a second Bbsl restriction site, that directs Bbsl enzyme to cut the DNA 5' to its recognition sequence, Bbsl The action of Bbsl on the designed sequence thus creates an overhang of 4 nucleotides, Notl 5' overhang, which is designed to be complementary to the overhang generated on the TRA C DNA fragment and reconstitute a Notl binding site upon ligation.

Sp denote nucleotide additions to specific points of the TRA V cloning fragment to achieve the correct spacing of Type IIS restriction enzyme binding site and the cut site, when adjacent to such sites. Sp blocks flanking the Notl restriction enzyme binding site sequence have been used to space the Notl binding and cut site appropriately for efficient action. The selection of nucleotides considered the potential impact of DAM methylation of the Bsal binding site.

WO 2018/083318

PCT/EP2017/078378

Full DNA sequences for the TRA V cloning fragments in the present example of native human TRA chains are provided as SEQ0001 to SEQ0046. These sequences includes the 5’ primer bind and 3’ primer bind sequences.

Design of synthetic TRA C cloning fragment

The arrangement of genetic elements of the TRA C cloning fragments in the present example is depicted in Figure 26.

Each end of the TRA C cloning fragment encodes a standardized 5’ and 3’ primer bind DNA sequence of 20 nucleotides for propagation of the overall fragment by PCR.

Proximal to the 5' primer bind sequence a Bbsl restriction enzyme recognition site is encoded, such that Bbsl enzyme will cut the DNA 3' to its recognition sequence, Bbsl ».

The TRA C cloning fragment encodes the Notl 3' segment of six nucleotides, which completes a Notl recognition site that will make up the V-C entry vector negative selection marker. The adjacent Bbsl -> restriction site acts upon the Notl 3' element to create the Notl 3' overhang of four nucleotides. This overhang is designed to be complementary to the Notl 5’ overhang generated on the TRA V DNA fragment and reconstitute a full Notl binding site upon assembly of V-C entry vectors.

To the 3’ end of the Notl 3' element, the TRA C cloning fragment encodes a Bsal restriction enzyme binding site, Bsal The direction of the Bsal binding site guides the Bsal enzyme to cut the DNA 5' to its recognition sequence. The resulting overhang sequence is designed to start from the first cytosine of the TRA C genetic fragment, TRA C overhang φ3. This Bsal -> site is utilized during the full length TRA reconstitution reaction. The Bsal -> enzyme acts upon the TRA C segment encoded in the V-C entry vector to create the necessary TRA C overhang φ3 during reconstitution reactions. A consensus TRA C sequence from the cytosine residue 5' of the first glutamine codon until the stop codon is included in the TRA C cloning fragment in the present example

To the 5’ of the 3' primer bind encodes a Bbsl restriction enzyme recognition sequence, Bbsl The direction of the Bbsl binding site guides the Bbsl enzyme to cut

WO 2018/083318

PCT/EP2017/078378 the DNA 5' to its recognition sequence. Overhangs generated by Bbsl enzymatic activity are encoded by Overhang *2. The design of this overhang permits directed ligasedependent cloning with an arm of the V-C entry vector backbone during assembly.

Sp denote nucleotide additions to specific points of the TRA C cloning fragment to achieve the correct spacing of Type IIS restriction enzyme binding site and the cut site, when adjacent to such sites. Sp blocks flanking the Notl restriction enzyme binding site sequence have been used to space the Notl binding and cut site appropriately for efficient action. The selection of nucleotides considered the potential impact of DAM methylation of the Bsal binding site

The full DNA sequence for the TRA C cloning fragment in the present example of native human TRA chains are presented as, SEQ0047. This sequence includes the 5’ primer bind and 3’ primer bind sequences.

Design of V-C entry vector backbone for transient expression of reconstituted TRA ORF in mammalian cells

In the present example, the V-C entry vector backbone is derived from the pMA plasmid. It encodes a Col E1 origin of replication, ori, along with antibiotic resistance betalactamase gene, positive selection #1. Beta-lactamase confers resistance to the penicillin group of beta-lactam antibiotics such as ampicillin and carbenicillin.

The vector backbone, as depicted in Figure 27, encodes the required genetic elements that confer the appropriate functionality for downstream applications of the fully reconstituted TRA ORF. In this present example, the 5' genetic element encodes the CMV constitutive mammalian promoter and the 3' genetic element encodes the SV40pA polyadenylation signal to permit transient expression of the fully reconstituted TRA ORF in a mammalian cell.

In the present example, the vector backbone encodes Acc65l and Xbal restriction enzyme binding sites that generate overhang *T and overhang *2’, respectively. Overhang *T is complementary to overhang *1 within the TRA V cloning fragment (figure 25). Overhang *2’ is complementary to overhang *2 within the TRA C cloning fragment (figure 26). These complementary overhangs permit directed cloning of the TRA V and TRA C cloning fragments into the V-C entry vector backbone.

WO 2018/083318

PCT/EP2017/078378

Sp feature denotes nucleotides added between the Acc65l and Xbal restriction enzyme recognition sites required for distancing the two sites for efficient action.

The sequence of the vector backbone from the 5' genetic element encoding the FRT F14 site, to the 3' genetic element encoding the FRT F15 is presented as SEQ0688.

Method to assemble TRA V-C entry vector library

This method utilizes standard molecular biology techniques to assemble selected TRA V cloning fragment (Figure 25) and TRA C cloning fragment (Figure 26) into a given V-C entry vector backbone (Figure 2) to create a TRA V-C entry vector (Component 1A, Figure 2a). In this present example, the method performs the restriction enzyme digestion and ligation reaction in a single reaction.

RE digestion and ligation reaction

100 ng of linear vector backbone (linearised by ACC65I and Xbal digestion) ng of TRA V genetic fragment ng of TRA C genetic fragment pl 10x NEB ligase buffer

0.5 pl of Bbsl pl of T4 DNA ligase

Up to 20 pl of H₂O

Reaction conditions

Step 1; 2 min at 37°C

Step 2; 3 min at 16°C

Repeat step 1 and 2, 20 times min at 50°C min at 80°C

Return to room temperature

Resulting product is transformed into competent E.coli cells that are selected for carbenicillin-resistant colonies. Plasmids isolated from selected colonies are sequenced to determine correctly assembled constructs. The procedure is repeated for each independent V segment cloning fragment. The resulting constructs make up the TRA V-C entry vector library for use in reconstitution of full-length TRA ORFs for later use in transient expression of said reconstituted TRA in mammalian cells. The sequence of

WO 2018/083318

PCT/EP2017/078378 the cloned V-C fragments that make up the TRA V-C entry vector library is presented as SEQ0049 to SEQ0094. The presented sequences include all the Kozac sequence preceding the start codon of the variable segment, to the stop codon of the C segment.

Design and assembly of TRA J Donor vector library for native human TRA repertoire In the present example, a TRA J receiving cassette fragments are constructed and inserted to a J donor vector backbone to create a J receiving cassette vector. Subsequently, a synthetic TRA J segment parts may be assembled into a TRA J receiving cassette vector to create the J Donor vector library. This flexible multistep assembly method allows rapid and cost effective engineering of J donor segment features, such as variations in J segment length.

The DNA components required for a TRA J donor vector library are:

I. TRA J receiving cassette fragment

II. J donor vector backbone

III. TRA J receiving cassette vector

IV. TRA J segment part

Design of synthetic TRA J receiving cassette fragment

The annealing of two single stranded DNA oligonucleotides is used to generate the receiving site cassette fragment that by design contains 4-nucleotide single-strand overhangs at each end of the DNA fragment; Overhang *3 and Overhang *4. The 4-nucleotide overhangs to permit directed ligase-dependent cloning into a J donor vector backbone to create the TRA J receiving cassette vector, depicted in Figure 28.

The pair of Type IIS restriction sites, Bsal 4· and Bsal -> are positioned at the 5' and 3' end of the receiving site cassette DNA fragment. The direction of the Bsal recognition site is to guide Bsal enzyme to cut the DNA towards the centre of the construct. These sites are used during TRA ORF reconstitution protocol by generating overhang Φ2-5 ' and overhang φ3-3'. Overhang φ3 is a component of the TRA C part encoded in the receiving cassette fragment, while overhang φ2 is defined after the TRA J segment part is cloned (infra vide).

The Bbsl pair of Type IIS recognition sites Bbsl and Bbsl are encoded near the middle of the cassette and used for assembly of the TRA J donor vector, in creating complementary overhangs included in synthesized TRA J segment parts (infra vide).

WO 2018/083318

PCT/EP2017/078378

100

The 5’ Bbsl site, Bbsl cuts into the Bsal site to create overhang *5 at the 3’ end of this feature. The 3 Bbsl site, Bbsl cuts into the TRA C part element, to create overhang *6 at the 5’ end of this element. These overhangs are encoded within the Bsal and TRA C part features of this construct as to avoid addition of non-native nucleotides that would be incorporated into the final reconstituted TRA ORF.

The region between Bbsl enzyme generated overhang and the Bsal enzyme generated overhang encodes a proportion of the TRA C region starting from the second nucleotide of the TRA C genetic fragment, TRA C part. The motivation for starting from the second nucleotide of the TRA C genetic fragment is because in the present example of a human TRA locus TORES, the resulting overhang is TATC and not a palindromic overhang, which would be the case if the beginning of the TRA C genetic fragment were including (resulting overhang ATAT). A palindromic overhang should be avoided, as it would permit two vector ends joining without the required TRA J segment part insert. The orientation ofthe Bbsl -> site permits the in-frame ligase dependent cloning of all TRA J fragments 3' end to the 5' beginning of the TRA C region in the receiving site cassette. The orientation of the Bsal site permits the in-frame ligasedependent cloning of the beginning of the TRA C region with the remaining TRA C fragments in the final step of the TRA full length ORF reconstitution protocol using a complete TORES.

Between the two Bbsl binding sites is an 8 nucleotide recognition sequence for the enzyme Notl. This restriction site is utilized as a negative selection marker to reduce the background ofthe parental plasmid colonies. This is achieved when Notl enzyme is added after the TRA J gene fragment insertion has been performed. Therefore plasmids correctly cloning a TRA J gene fragment would remain circular in the presence of Notl enzyme but parental plasmids that did not exchange its Notl site for a TRA J gene fragment will be linearized, in turn biasing the bacterial transformation to propagate a complete circular TRA J fragment-containing plasmid.

Sp denote nucleotide additions to specific points of the TRA J receiving cassette fragment to achieve the correct spacing of Type IIS restriction enzyme binding site and the cut site, when adjacent to such sites. Sp blocks flanking the Notl restriction enzyme binding site sequence have been used to space the Notl binding and cut site appropriately for efficient action. Additional nucleotides have been included to maintain correct reading frame within the final reconstituted full-length TRA. The selection of nucleotides

WO 2018/083318

PCT/EP2017/078378

101 considered the potential impact of DAM methylation ofthe Bsal binding site.

The full DNA sequence for the TRA J receiving cassette fragment oligonucleotides in the present example of native human TRA chains are presented as, SEQ0095 and SEQ0096. Both forward (F1) and reverse (R1) oligonucleotide sequences are listed.

Design of the J donor vector backbone

The J donor vector backbone is used to insert the TRA J receiving cassette fragment to create the TRA J receiving cassette vector. The backbone is thus carried through to the J Donor vector library. In the final reaction to create TRA full-length ORFs, this backbone is a reaction byproduct (Figure 2e), and thus carries minimal features as depicted in Figure 29.

In the present example, the J donor vector backbone encodes a Col E1 origin of replication, ori. The antibiotic resistance is the aminoglycoside 3'-phosphotransferase gene, positive selection selection #2. Aminoglycoside 3'-phosphotransferase confers resistance to antibiotic substrates such as kanamycin, streptomycin, neomycin, and gentamicin. This alternate positive selection is used to ensure J donor vectors are not selected for after full-length TCR ORF reconstitution, which are selected on positive selection #1.

In the present example the vector EcoRI and Xhol restriction enzyme binding sites that generates complementary overhang, overhang *3’ and overhang *4’, respectively. Overhang *3’ is complementary with Overhang *3 contained within the TRA J receiving cassette fragment. Overhang *4’ is complementary with Overhang *4 contained within the TRA J receiving cassette fragment. These overhangs permits directed cloning of the TRA J receiving cassette fragment.

Sp block denotes nucleotides added between the EcoRI and Xhol restriction enzyme binding sites for distancing the two sites to ensure efficient action.

In the present example, the J donor backbone is presented as SEQ0097.

Method to assemble the TRA J receiving cassette vector

This method utilizes standard molecular biology techniques to assemble the given TRA

J receiving cassette fragments (Figure 28) into a given J donor vector backbone

WO 2018/083318

PCT/EP2017/078378

102 (Figure 29) to create a TRA J receiving cassette vector (Figure 30). The resulting

TRA J receiving cassette vector is used to insert TRA J segment parts (Figure 31) to construct TRA J Donor vectors (Component 1B, Figure 2b).

First, the two oligonucleotides to form the TRA J receiving cassette DNA fragment must be phosphorylated and annealed.

Reaction mix

Oligonucleotide (sense strand) (100 μΜ) 1pl

Oligonucleotide (anti-sense strand) (100 μΜ) 1pl

T4 ligase buffer 10x 1pl

T4 PNK 1pl

H₂O 6pl

Reaction conditions

Incubate for 37°C for 1 hour

Denature at 95°C for 5 min

Anneal sense and anti-sense oligonucleotides by slowly cooling the reaction down to 25°C at 3°C per min

Assembly ligation of TRA J receiving cassette fragments and J donor vector backbone.

Reaction mix

Linear vector backbone 100 ng

Receiving site cassette DNA fragment (0.5 μΜ) 2 pl

T4 ligase buffer 10x 2 pl

T4 ligase 0.5 pl

H2O up to 20 pl

Reaction conditions

Incubate for 1 hour at 25°C

Heat inactivate at 65°C for 10 min

Resulting product is transformed into competent E.coli cells and selected for Kanamycin resistant colonies. Resistant colonies are selected to determine correctly assembled constructs. The resulting plasmid is the TRA J receiving cassette vector. In the

WO 2018/083318

PCT/EP2017/078378

103 present example, the TRA J receiving cassette vector is presented as SEQ0098 and depicted in Figure 30.

Design of synthetic TRA J segment parts

Having generated the TRA J receiving cassette vector synthetic TRA J segment parts must be generated to insert into this vector. Each TRA J sequence is inserted into an independent TRA J receiving cassette vector context to generate the TRA J donor vector library as part of the human TRA TORES.

The TRA J donor vector library comes in two different forms, comprised of a long or short J segment part. The short TRA J segment part encodes all amino acids from the start of the CDR3 border codon. However, considering that the majority of TRA J segments are trimmed back by less than 10 nucleotides during TCR rearrangement, a TRA J donor library containing a longer TRA J germline segment is designed, long TRA J segment part. The motivation for a longer TRA J gene fragment library is that a shorter oligonucleotide duplex encoding CDR3 (odeCDR3) would be required for the full length TRA reconstitution, than if the short TRA J fragment would be used. Since highly variable sequences are provided as short oligonucleotide duplexes, odeCDR3, a shorter CDR3 oligonucleotide synthesis is less likely to contain truncated or mutated oligonucleotide contaminants and therefore reduce the likelihood of oligonucleotide duplex with sequence errors being cloned during full length TRA reconstruction. Furthermore, shorter odeCDR3 syntheses are cost-saving.

The TRA J segment parts are constructed by annealing two single-stranded DNA oligonucleotides designed to contain 4-nucleotide single-strand overhangs at each end of the DNA fragment. The resulting TRA J segment part is depicted in Figure 31.

The 5’ overhang designated Overhang *5’ is complementary to the Overhang *5 generated within J donor receiving cassette vector by Bbsl action. The 3’ overhang designated Overhang *6’ is complementary to the Overhang *6 generated within J donor receiving cassette vector by Bbsl action. This pair of complementary overhangs permits directional cloning of the TRA J segment parts into the TRA J receiving cassette vector.

The Short TRA J segment part encodes all amino acids from the start of the CDR3-J border Phe codon. The CDR3 is defined as the sequence flanked by the C-terminalWO 2018/083318

PCT/EP2017/078378

104 conserved Cys of the V region, and Phe of the J region which is part of the Phe-Gly/Ala conserved motif. This conserved Phe-Gly/Ala motif is utilized to standardize the 5' overhangs of the TRA J fragments to TTTG for downstream TRA reconstitution. The exceptions to this standardization in the present example are human TRAJ33 and TRAJ38 that border the CDR3 region with Trp and Gly. The 5' overhangs are TGGG for both TRAJ33 and TRAJ38 in the present example.

The long TRA J segment part is designed to encode more amino acids N-terminal of the CDR3 border amino acids. The start point of each long gene fragment is at the first nucleotide of an amino acid codon positioned 10-12 nt from the 5' end of the germline encoded TCR joining element. The 5’ end of each long TRA J segment part remains identical to that of the short TRA J segment part.

To both short and long TRA J segment parts an adenine, represented as the A block in figure 11, is added to the 3' end of each TRA J segment part. This adenine represents the first nucleotide of the TRA C fragment that is excluded from the TRA J receiving cassette.

The sequences of the short TRA J segment parts of the present example of native human J segments are presented as SEQ0099 to SEQ0210 and the long TRA J segment parts SEQ0211 to SEQ0322. In both cases, both forward (F1) and reverse (R1) oligonucleotide sequences are listed.

Method to assemble the Short or Long J-Donor vector library

This method utilizes standard molecular biology techniques to clone the Short TRA J segment or Long TRA J segment part part (Figure 31) into the TRA J receiving cassette vector (Figure 30) to create TRA J donor vectors (Component 1B, Figure 2b) containing the short or long TRA J segments. In this present example, the method performs the restriction enzyme digestion and ligation reaction in a single reaction.

The DNA components required for a J donor vector library is as follows:

I. Short TRA J segment part or Long TRA J segment part

II. J donor receiving cassette vector

Phosphorylation and Annealing two oligonucleotides to form the TRA J segment part

WO 2018/083318

PCT/EP2017/078378

105

DNA fragment

Reaction mix

Oligonucleotide (sense strand) (100 μΜ) μΙ

Oligonucleotide (anti-sense strand) (100 μΜ)

T4 ligase buffer 10x

T4 PNK

H₂O μΙ μΙ μΙ μΙ

Reaction conditions

Incubate for 37°C for 1 hour

Denature at 95°C for 5 min

Anneal sense and anti-sense oligonucleotides by slowly cooling the reaction down to

25°C at 3°C per min

RE digestion and ligation reaction

TRA J receiving cassette backbone 100 ng

TRA J DNA fragment (0.5 μΜ) 2 μΙ

10x NEB T4 ligase buffer 2 μΙ

Bbsl 0.5 μΙ

T4 DNA ligase 0.5 μΙ

H₂O up to 20 μΙ

Reaction conditions

Step 1; 2 min at 37°C

Step 2; 3 min at 16°C

Repeat step 1 and 2, 20 times min at 50°C min at 80°C

Return to room temperature

Add 0.5 μΙ of Notl enzyme and incubate for 30 min at 37°C to linearize parental vector.

Reaction product is transformed into competent E.coli cells and selected for Kanamycin resistance. Selected resistant colonies are sequenced to determine correctly assemWO 2018/083318

PCT/EP2017/078378

106 bled constructs. The resulting constructs make up the TRA J donor vector library, encoding either a long or a short TRA J gene fragment.

The sequence of the resulting libraries, excluding backbone sequence outside of the Bsal recognition sites, are presented as SEQ0323 to SEQ0378 for the TRA short J donor library and SEQ0379 to SEQ0434 for the TRA long J donor library.

Design and assembly of TRB V-C entry vector and TRB J Donor vector libraries for native human TRB repertoire

In the above sections, the design and assembly of V-C entry vector and J donor vector libraries for the native human TRA repertoire was described in detail. The overall design and assembly of such vector libraries encoding sequences of the TRB repertoire is essentially the same. In the present example, the design and assembly of the TRB V-C entry vector and TRB J Donor vector libraries will be briefly outlined in order to construct a TORES or the native human TRB TCR locus.

It is important to note that the V-C entry vector backbones for the TRA and TRB chains contain differing FRT sites, as to pair the resultant vector products from operation of the system (Components 2C and 2E), with the genomic receiver sites of the eTPC-t (Components 2B and 2D). This means that only a single TRA or TRB chain will be integrated into each eTPC cell via the paired integration couple. In the present example, whereas the TRA chains have been placed in a V-C entry vevtor context bouded by FRT F14 and F15 sites, the TRB chains have been bounded by FRT FRT and F3 sites.

Design and assembly of TRB V-C entry vector library for native human TRB repertoire In the present example, the design and assembly of a TRB V-C entry vector library that contains the native human TRB V-C sequence repertoire.

The DNA components required for a TRB V-C vector library are:

I. A TRB V cloning fragment for each functional TRB V gene segment encoded in the human genome

II. TRB C1 or TRB C2 cloning fragment

III. A V-C entry vector backbone

WO 2018/083318

PCT/EP2017/078378

107

In contrast to the human TRA locus, the human TRB locus encodes two distinct constant segments, TRB C1 and C2. Thus, to capture both constant regions, two V-C entry vector sets are constructed to pair each of the V segments with each C1 and C2 segments.

In the present example, the TRB V and TRB C cloning fragments were synthesized and used to assemble into a target V-C entry vector backbone in a single restriction enzyme and ligase reaction. In the present example, the target V-C entry backbone was designed to permit transient expression of reconstituted TRB ORFs within mammalian cells.

In the present example, the TRB V-C entry vector library is constructed using Type IIS restriction enzyme Bbsl. The Type IIS restriction enzyme used in functioning of the library to reconstitute full-length TRB ORFs is Bsal.

Design of synthetic TRB V cloning fragments

The arrangement of genetic elements of the TRB V cloning fragments is identical to those of the TRA V cloning fragments described above 1, as depicted in Figure 25.

Full DNA sequences for the TRB V cloning fragments in the present example of native human TRB chains are presented as SEQ0435 to SEQ481.

Design of synthetic TRB C cloning fragment

The arrangement of genetic elements of the TRB C cloning fragments is identical to those of the TRA C cloning fragments described above, as depicted in Figure 26.

The TRB locus encodes two distinct C segments, and both are included in the design of the TRB V-C entry vector library.

The full DNA sequence for the TRB C cloning fragments in the present example of native human TRB chains are presented as SEQ0482 and SEQ0483.

Method to assemble TRB V-C entry vector library

The method to assemble the given TRB V and TRB C cloning fragments into a given

V-C entry vector backbone to create a TRB V-C entry vector is identical to that described above for the TRA system. The V-C entry vector backbone used for the TRB VWO 2018/083318

PCT/EP2017/078378

108

C entry vector in the present example contains FRT and F3 FRT sequences as the 5’ and 3’ genetic elements, respectively. This FRT/F3 V-C entry vector backbone sequence is presented as SEQ0689. The differing FRT site context between TRA and TRB TORES systems insulates the integration vectors from one another, and pairs them with the gemoic receiver sites of the eTPC as a pair of integration couples.

The sequence of the cloned V-C fragments that make up the TRA V-C entry vector library is presented as SEQ0484 to SEQ0577.

Design and assembly of TRB J Donor vector library for native human TRB repertoire In the present example, the design and assembly of a TRB J Donor vector library that contains the native human TRB J sequence repertoire.

In the present example, a TRB J receiving cassette fragments are constructed and inserted to a J donor vector backbone to create a TRB J receiving cassette vector. Subsequently, a synthetic TRB J segment part may be assembled into a TRB J receiving cassette vector to create the TRB J Donor vector library. This flexible multistep assembly method allows rapid and cost effective engineering of J donor segment features, such as variations in J segment length.

This procedure follows the same pattern as the TRA J donor vector assembly described in Example 2. However, it should be noted that since the J receiving cassette fragments contain parts of the C segment, the TRA J and TRB J receiving cassette fragments differ with regard to the C part sequence, that must correspond to the respective C gene segments. Moreover, in contrast to TRA J scenario that only requires a single J receiving cassette fragments, the TRB J requires two distinct J receiving cassette fragments to account for the use of alternate C1 and C2 segments.

The DNA components required for a TRB J donor vector library are:

I. TRB J C1 or TRB J C2 receiving cassette fragment

II. J donor vector backbone

III. TRB J C1 or TRB J C2 receiving cassette vector

IV. TRB J segment part

Design of synthetic TRA J receiving cassette fragment

WO 2018/083318

PCT/EP2017/078378

109

The annealing of two single stranded DNA oligonucleotides is used to generate the receiving cassette fragments, which contain 4-nucleotide single-strand overhangs at each end of the DNA fragment, depicted in Figure 28. The 4-nucleotide overhangs permit directed ligase-dependent cloning into a J donor vector backbone to create the TRB J receiving cassette vector,

The two receiving cassette fragments required for alternate use of C1 and C2 segments are presented as SEQ0578 and SEQ0581. For each fragment, the forward (F1) and reverse (R1) oligonucleotide sequences are provided.

Method to assemble the TRB J receiving cassette vectors

The method for assembly of the TRB J receiving cassette vectors is identical to that of the method for assembly of TRA J receiving cassette vectors described in Example 2. The same J donor vector backbone (SEQ0097) is used to generate two TRB J receiving cassette vectors, each containing one C1 or C2 part corresponding to the alternate C segments for the TRB locus.

The resulting two TRB J receiving cassette vector is used to insert TRB J segment parts to construct TRB J Donor vectors.

The resulting TRB J receiving cassette vectors are presented as SEQ0582 and SEQ0583.

Design of synthetic TRB J segment parts

The TRB J segment parts are constructed by annealing two single-stranded DNA oligonucleotides designed to contains 4-nucleotide single-strand overhangs at each end of the DNA fragment. The arrangement of this part and method of assembly are identical to that of the TRA J segment parts, and depicted in Figure 31.

In the case of the Short TRB J segment part encodes all amino acids from the start of the CDR3-J border Phe codon. The CDR3 is defined as the sequence flanked by the C-terminal-conserved Cys of the V region, and Phe of the J region, which is part of the Phe-Gly motif conserved across all human TRB J segments. This conserved Phe-Gly motif is utilized to standardize the 5' overhangs of the TRA J fragments to TTTG for downstream TRB reconstitution. Unlike the TRA J segments, there are no exceptions to this standardized overhang in the TRA J segment parts in the present example.

WO 2018/083318

PCT/EP2017/078378

110

To both short and long TRB J segment parts an adenine, represented as the A block in figure 11, is added to the 3' end of each TRB J segment part. This adenine represents the first nucleotide of the TRB C fragment that is excluded from the TRB J receiving cassettes.

The sequences of the short TRB J segment parts of the present example of native human J segments are presented as SEQ0584 to SEQ0609, and the long TRB J segment parts SEQ0610 to SEQ0635. In both cases, both forward (F1) and reverse (R1) oligonucleotide sequences are listed.

Method to assemble TRB Short or Long J Donor vector library

The procedure to assemble the TRB J donor libraries is identical to that of the TRA libraries described abive. However, in the case of the TRB libraries, there are four libraries to generate, in contrast to the short and long libraries for the TRA locus segments.

In the case of TRB libraries, each short and long libraries can be constructed to carry each of the alternate C1 and C2 C segments, resulting in four subsets within the TRB J donor library.

The DNA components required for a J donor vector library is as follows:

I. Short TRB J segment part or Long TRB J segment part

II. TRB J C1 or TRB J C2 receiving cassette vector

Following the same procedure as described above, the four resulting subsets within the TRB J donor library are generated. The sequence of the resulting libraries, excluding backbone sequence outside of the Bsal recognition sites is presented.

TRB C1 short J donor library presented as SEQ0636 to SEQ0648

TRB C2 short J donor library presented as SEQ0649 to SEQ0661

TRB C1 long J donor library presented as SEQ0662 to SEQ0674

TRB C2 long J donor library presented as SEQ0675 to SEQ0687

WO 2018/083318

PCT/EP2017/078378

111

Example 2 Design and generation of oligonucleotide duplex encoding CDR3 (odeCDR3)

In the above example, the design and construction of the TORES as V-C entry vector and J donor vector libraries human TRA and TRB chains is described to output fulllength human TCR chains as components 2C and 2E of the overall two-part device.

The utilization of these V-C entry vector and J donor vector libraries for one-step reconstitution of full-length TCR open reading frames requires an oligonucleotide duplex encoding CDR3 (odeCDR3) construct to be provided in order to complete the target fulllength TCR chain sequence (Figure 2c). Once V-C entry vector and J donor vector libraries are generated, these vectors represent stock items that may be drawn upon indefinitely to select desired V-J-C combinations of target full-length TCR chains sequences. In contrast, the odeCDR3 represents a short unique sequence specific to the target full-length TCR ORF.

The present example describes the design and generation of odeCDR3 for use in the native human TRA and TRB vector platforms.

Design of the TRA odeCDR3

The annealing of two single stranded DNA oligonucleotides generates an odeCDR3 that contains 4-nucleotide single-strand overhangs at each end of the DNA fragment, as depicted in Figure 2c. The 4-nucleotide overhangs are designed to permit directed ligase dependent cloning to the 3' end of the TRA V segment encoded in the entry vector, (Overhang φ1-5') and the 5' end of the TRA J fragment during TRA reconstitution (Overhang φ2-3')· Overhang φ1-5' is standardised to CTGC, complementary to the standardized Overhang φ1-5 encoded in the V segment of the TRA V-C entry vector. In the case of Overhang φ2-3', there are two sequence forms that this can take, which is determined by sequence divergence among J segments from the human TRA locus. For native human TRA J segments TRAJ33 and TRAJ38, the Overhang φ2-3' is standardized to TGGG, complementary to the Overhang φ2-3 encoded in the J donor vector of these two J segments. For all other human TRA J segments Overhang φ2-3' is standardized to TTTG, complementary to the Overhang φ2-3 encoded in the J donor vector of these J segments (see Example 1).

WO 2018/083318

PCT/EP2017/078378

112

Design of the TRB odeCDR3

As for the TRB odeCDR3, the annealing of two single stranded DNA oligonucleotides generates an odeCDR3 that contains 4-nucleotide single-strand overhangs at each end of the DNA fragment, as depicted in Figure 4c. The 4-nucleotide overhangs are designed to permit directed ligase dependent cloning to the 3' end of the TRB V segment encoded in the entry vector, Overhang φ1 -5', and the 5' end of the TRB J fragment during TRB reconstitution, Overhang φ2-3'. The Overhang φ1-5' is standardised to TTGC, complementary to the standardized Overhang φ1-5 encoded in the V segment of the TRB V-C entry vectors. In contrast to the TRA odeCDR3 where two alternative Overhang φ2-3 forms are required, for the TRB odeCDR3 Overhang φ2-3 is standardized to TTTG, complementary to the Overhang φ2-3 encoded in the J donor vector of all TRB J segments (see Example 1).

General odeCDR3 design

In general, an odeCDR3 design must be matched to the overhangs the 4-nucleotide overhangs are designed to permit directed ligase dependent cloning to the 3' end of the V segment encoded in the entry vector (Overhang φ1-5') and the 5' end of the J fragment during reconstitution, (Overhang φ2-3').

Method to generate phosphorylated CDR3 DNA oligonucleotide duplex Phosphorylation and Annealing two oligonucleotides to form the odeCDR3

Reaction mix

Oligonucleotide (sense strand) (100 μΜ) 1pl

Oligonucleotide (anti-sense strand) (100 μΜ) 1pl

T4 ligase buffer 10x 1pl

T4 PNK 1pl

H₂O 6pl

Reaction conditions

Incubate for 37°C for 1 hour

Denature at 95°C for 5 min

25°C at 3°C per min

WO 2018/083318

PCT/EP2017/078378

113

Example 3 Demonstration of the two-part device comprising of TORES and eTPCS to generate a eTPC-t

This example describes the steps used for defining the vector library components and odeCDR3 required to reconstitute TRA and TRB full length TCR ORFs given sequence information of the target TCRs. The present example demonstrates the TORES process to assemble a full-length model TRA and TRB TCR chain pair. The present example also demonstrates eTPCS by integration of the said vectors into an eTPC via RMCE tp generate a eTPC-t and subsequently confirm its TCR pair specificity by staining of surface-presented TCR with specific HLA-multimer reagent.

Selection of V-C entry vector, J donor vector and odeCDR3

The sequences of all possible germline fragments that are represented in the cloning library are aligned to a TRA or TRB sequences of interest. The genetic fragments with the highest identity to the TRA or TRB sequence determines which V, J and C genetic element will constitute the desired TRA or TRB clonotype sequences. For TRA, the appropriate V-C entry vector is selected based on the determination of the V usage of the desired TRA. For TRB, when sequence coverage is sufficient to determine the V and C usage, the appropriate V-C entry vector will be selected that corresponds to the V usage of the desired TRB clonotype, in addition to whether said clonotype uses TRBC1 orTRBC2.

In the case when both the short and long version of the specific TRAJ or TRB J genetic element align to the TRA and TRB sequence, respectively, the corresponding plasmids encoding the longer genetic elements will be used for the TRA reconstruction.

The odeCDR3 sequence required for the TRA to be synthesised is determined as the region between the 3' end of the TRA V aligned genetic fragment and the 5' end of the aligned TRAJ genetic fragment. The oligonucleotide sense strand requires the additional 5' 4-nucleotide overhang, Overhang φ1 -5', CTGC that is universal to the overhang generated on the TRA V entry vector when digested with Bsal, Overhang φ1 -3'. The complementary oligonucleotide anti-senses strand requires the additional 5' 4-nucleotide overhang, Overhang φ2-3', that is unique to the overhang specifically for the TRAJ vector added to the TRA reconstruction reaction, Overhang φ2-5'.

WO 2018/083318

PCT/EP2017/078378

114

The CDR3 sequence required for the TRB to be synthesised is determined as the region between the 3' end of the TRB V aligned genetic fragment and the 5' end of the aligned TRB J genetic fragment. The oligonucleotide sense strand requires the additional 5' 4-nucleotide overhang, Overhang φ1 -5', TTGC that is universal to the overhang generated on the TRB V entry vector when digested with Bsal, Overhang φ1-3'. The complementary oligonucleotide anti-senses strand requires the additional 5' 4-nucleotide overhang, Overhang φ2-3', that is unique to the overhang specifically for the TRB J vector added to the TCR reconstruction reaction Overhang φ2-5'.

In the present example, a model TCR TRA/TRB pair (JG9-TCR) is used with a known specificity for a Human cytomegalovirus (HCMV) antigen presented in HLA-A*02:01. This antigenic peptide is derived from the HCMV pp65 protein, and the full amino acid sequence ofthe peptide antigen that is presented in HLA-A*02:01 is NLVPMVATV. The sequences ofthe TRA (JG9-TCR-alpha) and TRB (JG9-TCR-beta) chains are presented as SEQ701 and SEQ702, respectively.

Based on this full-length sequence it was straightforward to select the appropriate V-C entry and J donor vectors from the TRA and TRB libraries.

In the present example the TRA V-C entry vector SEQ0088 (from list 0049 to 0094), in the SEQ0698 backbone, and J donor vector SEQ0371 (from list 0323 to 0378) were selected.

In the present example the TRB V-C entry vector SEQ0563 (from list 0484 to 0577), in the SEQ0688 backbone, and J donor vector SEQ0637 (from list 0636 to 0687) were selected.

The odeCDR3 synthesised for the TRA chain is presented in SEQ703 and SEQ704 as sense and antisense, respectively.

The odeCDR3 synthesised for the TRB chain is presented in SEQ705 and SEQ706 as sense and antisense, respectively.

Method for full-length reconstitution

WO 2018/083318

PCT/EP2017/078378

115

For each ofthe TRA and TRB components selected above, restriction enzyme / ligase cycle reactions were performed as described below.

RE digestion and ligation reaction

V-C entry vector 100 ng

J donor vector 60 ng odeCDR3 oligonucleotide duplex (0.5 pM) 2 pl

10x T4 ligase buffer 2 pl

Bsal 0.5 pl

T4 DNA ligase 0.5 pl

H2O up to 20 pl

Reaction conditions

Step 1; 2 min at 37°C

Step 2; 3 min at 16°C

Repeat step 1 and 2, 20 times min at 50°C min at 80°C

Return to room temperature

Add 0.5 pl of Notl enzyme and incubate for 30 min at 37°C

The resulting reaction product was transformed into competent E.coli cells and plated on carbenicillin containing plates.

Screening and sequencing carbenicillin resistant colonies was conducted to determine correctly assembled constructs. Screening of colonies was performed by restriction enzyme diagnostic digest of isolated plasmid DNA, and the expected DNA fragment sizes were observed by DNA electrophoresis. The resulting constructs encode the full length TCR alpha and beta clone sequences.

Validation of reconstituted TRA ad TRB vectors

To verify the specificity of the reconstituted TCR TRA/TRB pair above, an eTPC-t in was generated with said pair, wherein the parental eTPC contains distinct synthetic geWO 2018/083318

PCT/EP2017/078378

116 nomic receiver sites Component 2B and 2D. The sites Component 2B and 2D designed to match the RMCE sites in the generated integration vectors Component 2C and 2E, each of which encodes a single chain of a TCR pair (JG9-TCR)

This example uses a parental eTPC cell line ACL-488, which is TCR null, HLA null, CD4 null and CD8 null, and further containing Component 2B and 2D. Component 2B comprises two unique heterospecific recombinase sites, FRT and F3 that flank a Kozak sequence and ORF encoding the selection marker, blue fluorescent protein (BFP). Encoded 5’ of the FRT site, is an EF1a promoter and 3’ of the F3 site is a SV40 polyadenylation signal terminator. Component 2D comprises two unique heterospecific recombinase sites, F14 and F15, which were different to Component 2B. These sites flank a Kozak sequence and ORF that encodes the selection marker, the red fluorescent protein, (RFP). Encoded 5’ of the F14 site is an EF1a promoter, and 3’ of the F15 site is a SV40 polyadenylation signal terminator.

The above-described components 2C and 2E generated with the TORES comprise two heterospecific recombinase sites, FRT/F3 (2C) and F14/F15 (2E), thus being matched to Component 2B and 2D, respectively. Component 2C further comprises, between the FRT/F3 sites, of a Kozak sequence, start codon and TCR ORF encoding JG9-TCRbeta chain. Component 2E further comprises, between the F14/F15 sites, of a Kozak sequence, start codon and TCR ORF encoding JG9-TCR-alpha chain.

An eTPC-t was created through RMCE by electroporation ACL-488 (eTPC). Four to ten days after electroporation, individual cells displaying diminished fluorescent protein signal, BFP and RFP, encoded by Components 2D and 2B selection markers, were sorted by FACS. Individual monoclones were outgrown and then phenotypically assessed. The resulting monoclone, ACL-851, was BFP and RFP negative (figure 32 a and b). ACL-851 also showed TCR and CD3 surface expression while the parental cell line did not (figure 32 c and e). Furthermore, the introduced JG9-TCR showed specific staining with the HLA-A*02:01- NLVP tetramer, indicating that it is a functional TCRsp on the surface of the eTPC-t (figure 32 d to f). ACL-851 was confirmed by PCR to contain the TCRsp encoded by Component 2B’ and Component 2D’ integrated into the genome (figure 32 g and h).

In summary, an eTPC was converted to an eTPC-t, by use of an RMCE based integration method to integrate TCR ORF delivered in Component 2C and 2E, generated in

WO 2018/083318

PCT/EP2017/078378

117 the TORES, such that Components 2B and 2D were converted into Component 2B’ and 2D’, and where by this eTPC-t expressed a functional TCRsp on the surface of the cell. Furthermore, this example demonstrates operation of a simple eTPC:A system, where a binary composition of an eTPC-t and analyte antigen were combined and the eTPC-t selected based on a complex formation between the soluble analyte antigen (HLA multimer: HLA-A*02:01-NLVPMVATV).

Example 4: Demonstration of eTPC-x reversion from eTPC-t

The present example describes conversion of an eTPC-t to an eTPC-x, wherein the eTPC-x has component 2B’ encoding a TCR chain ORF and Component 2D is available for integration of complementary TCR chain ORF. Conversion of Component2 D’ of the eTPC-t to Component D of the eTPC-x is achieved by use of a genetic donor vector (Component 2Z) matched to Component 2D’.

In this example, the parental eTPC-t cell line ACL-851 generated in example 3 was used. Component 2Z is a plasmid vector comprised of two heterospecific recombinase sites, F14/F15 matched to Component 2D’, a Kozak sequence, start codon and an ORF encoding a green fluorescent protein (GFP) as a selection marker of integration. The eTPC-t was combined with Component 2Z and a vector encoding RMCE recombinase enzyme by electroporation, whereupon the cells were subsequently selected for loss of CD3 presentation and gain of the GFP selection marker of integration. The monolcone ACL-987 was phenotypically characterised by FACS, and it was observed that the ACL-987 has gained GFP and lost CD3 and TCRab (Figure 33 b, d), indicating successful exchange of JG9-TCR-alpha with the GFP ORF and conversion of Component D’ to Component D, and thus generation of an eTPC-x. In comparison the parental eTPC-t, ACL-851, is lacking GFP expression and has CD3 and TCRab surface expression (Figure 33 a to c).

In summary, this example demonstrates conversion of an eTPC-t to an eTPC-x, with removal of the JG9-TCR-alpha TCR ORF at Component 2D’ in exchange for the GFP selection marker of integration thereby creating Component 2D, for further integration coupling events of alternative complementary TCR chain ORF. This conversion was conducted using the RMCE method for genomic integration.

WO 2018/083318

PCT/EP2017/078378

118

Example 5: Demonstration of generation of sequence-diversified pool of TCR variants in one step via TORES, and shotgun integration into eTPC-x to create pool of eTPC-t

The present example describes how a pool of vectors encoding 64 single JG9-TCR-alpha variants (as Component 2E) were generated and integrated into a parental eTPCx cell line containing a single JG9-TCR-beta (described in example 4) to create a pooled eTPC-t library where each individual cell integrated a single TRA chain to present a library of eTPC-t where each cell expresses a single discrete TCRsp on the surface. Such a method is referred to as ‘shotgun’ integration. The 64 JG9-TCRa variants have been created by modifying the CDR3 sequence that falls at the junction of the V and J fragments by way of a method described in Figure 3. This single-reaction diversification is shown to produce a TCR set with a wide range of affinities to a specific HLAmultimer reagent when presented on the surface of mammalian cells with its natural TRB chain pair. This approach is ideally suited for rapid TCR-engineering using fulllength TCR ORFs that may be presented and selected in a functional context of viable mammalian cells.

Rapid TCR chain diversification via odeCDR3 degeneracy

The diversification and selection of TCR ORFs is desirable to engineer TCRs chain pairs with altered specificities, affinities and/or signalling capacity. The TORES system is suited to the rapid generation of collections of TCR chains that are systematically altered from the original target sequence. In the present example, an approach of diversifying a model TCR chain pair by including an odeCDR3 to a reconstitution reaction with a defined and limited nucleotide degeneracy at selected codon positions is presented. This approach was used to diversify the JG9-TCR-alpha chain of the model JG9-TCR pair presented in Example 3.

Generation of diverse TRA chain collection

Figure 3 presents the overall strategy for generating a sequence-diversified collection of TCR chains in a single reaction by use of an odeCDR3 pool. A single C-V entry vector and J donor vector are selected to represent the target V, J and C gene segments in the final full-length TCR product (Figure 3, box i and box ii). An odeCDR3 pool is generated with selected diversity, such that there are a number of different CDR3 sequences represented in the odeCDR3 pool (Figure 3, Box iii). When all components are combined into a restriction enzyme / ligase cycle reaction, the resulting product are

WO 2018/083318

PCT/EP2017/078378

119 a collection of constructs containing full-length TCR chains of defined V,J C gene segment usage, and a defined diversity in the CDR3 region (Figure 3, Box iv). The number of diversified full-length TCR chains in the final product is directly proportional to the number of odeCDR3 variants in the initial odeCDR3 pool added to the reaction.

In the present example, the JG9-TRA-alpha chain was the target of sequence diversification, and this was achieved through synthesis of odeCDR3 sense and antisense oligos with nucleotide degeneracy at 3 distinct positions, each altering a separate codon to result in the possibility of 4 different amino acids at each of the three codons. The codons were selected for degeneracy were spaced across the CDR3 loop. The odeCDR3 oligos are presented as SEQ0743 and SEQ0744, wherein degenerate codons are denoted N.

The odeCDR3 oligos were annealed by the method outlined in Example 2, with the 4fold amino acid degeneracy at 3 separate codon positions resulting in an odeCDR3 product pool with 64 unique sequences, including the original coding sequence (i.e.SEQ0701).

The odeCDR3 was used to assemble the full-length TRA ORFs by the method outlined in Example 3 to create 64 unique TRA ORFs with 4-fold amino acid degeneracy at 3 distinct codon positions. In the present example, the odeCDR3 was synthesised with degenerated nucleotide usage at the indicated positions, and thus reconstitution was performed in a single tube to generate all 64 chain variants.

In parallel, each variant JG9-TCR-alpha chain, and the JG9-TCR-beta chain, was also cloned into a separate V-C entry backbone (SEQ0048), which permits transient transfection for parallel characterisation. All of the expected clones were prepared as isolated vectors and sequence confirmed.

Characterisation of diversified JG9-TCR-alpha chains with TRB chain pair

In this example, the parental eTPC-χ cell line ACL-987, expressing JG9-TCR-beta (in Component 2B’) and CD3 chains (the construction of the cell line is described in example 4), was used. Component 2D encodes the selection marker GFP and is described in example 6. In this example, the 64 JG9-TCR-alpha variants were generated, creating a pool of Component 2E, flanked by F14/ F15 sites.

WO 2018/083318

PCT/EP2017/078378

120

An eTPC-t pool was created through RMCE by electroporation of the 64 Components 2E into ACL-987. Polyclones were selected on the basis of GFP expression. The resulting polyclone, ACL-988, comprised of both GFP positive and GFP negative cell populations, unlike the parental line which comprised of only GFP positive cells (figure 34a and b). However, only GFP negative population showed consistently strong CD3 expression, indicating successful conversion of Component 2D into Component 2D’ and therefore eTPC-x has been converted into eTPC-t (figure 34c and d). Furthermore, ACL-988 GFP negative populations showed two distinct intensities when stained with the JG9-TCR specific tetramer reagent (HLA-A*02:01-NLVP), suggesting that this population is comprised of cells that express TCR variants with varying binding efficiency.

In parallel, characterization of all 64 JG9-TCR-alpha variants together with WT JG9TCR-beta were transiently expressed in a parental eTPC (ACL-987). Using this transient assay, relative staining units (RSU) against the HLA-A*02:01-NLVP tetramer reagent to a reference for each TCR pair presented in the above-described pooled eTPC-t expressing variant JG9-TCR were determined. RSU were calculated as the ratio of the mean fluorescence intensity (MFI) of HLA-A*02:01-NLVP tetramer signal for the CD3 positive population over the CD3 negative population, and was indicative of the binding strength of each TCR chain pair variant. After the independent transfection of the parental ACL-987 line with each JG9-TCR-alpha variant, the cells were stained with antibodies against CD3 and with a HLA-A*02:01-NLVP tetramer reagent and analysed by flow cytometry. Each point plotted in Figure 34e represents the observed RSU for each 64 variants.

To confirm ACL-988 cells that were HLA-A*02:01 NLVP positive encode high RSU TRA variants and those HLA-A*02:01 NLVP negative encode low RSU TRA variants, individual cells for each population and their TRA were sequenced and are plotted in figure 34e. Indeed, individual ACL-988 cells that were HLA-A*02:01 NLVP positive encoded TRA variants that predominantly showed high RSU results in the individually tested variants (Figure 34e, open circles). Moreover, individual ACL-988 cells that were HLA-A*02:01 NLVP negative encoded TRA variants that predominantly showed low RSU results (figure 34e open triangles).

In summary, the present example generates the generation of a pooled library of

CDR3-diversified TCR ORF encoding vectors in a single reaction. This pooled library is encoded in a vector context that is matched with an eTPC genomic receiver site. A

WO 2018/083318

PCT/EP2017/078378

121 pooled eTPC-t library containing multiple TCRs was successfully generated in a single step using shotgun integration into an eTPC-x encoding a native reciprocal TCR ORF. The genetically modified polyclonal cell line ACL-988 that was generated presented a library of TCRsp that could be functionally selected for a range of staining intensities against an HLA tetramer reagent specific for the native pair. This represents a powerful and rapid approach for selective engineering of TCR pairs that are selected in the native context of a CD3 complex presented on the surface of a human cell.

Example 6: Functional demonstration of component 2F

Herein describes an eTPC cell line (ACL-1063, Component 2A) engineered with two unique genomic receiver sites (Components 2B and 2D), engineered to be null for HLA expression, utilizing native CD3 expression, and harbouring a two-component, synthetic response element (Component 2F).

The response elements comprised of a Driver-Activator component and an AmplifierReport component, wherein both units utilized synthetic enhancers. The Driver is a synthetic enhancers that is responsive to the native TCR signalling pathways, encoding three sets of tandem transcription factor binding sites for NFAT-AP1-NFkB (3xNF-APNB). Upon transcriptional activation, the Driver induces expression of the activator protein, a synthetic designed transcription factor derived by fusion of the Herpes VP16 activation domain, the GAL4 DNA binding domain and two nuclear localization signals at the N- and C-terminals (NV16G4N), to which the cognate DNA recognition sequence is present 6 times in tandem in the Amplifier enhancers region. Both the Driver and Amplifier enhancers utilized the core promoter sequence (B recognition element (BRE), TATA Box, Initiator (INR) and transcriptional start site (TSS) from CMV IE1 promoter, immediately 3’ of the respective transcription factor binding sites. The Amplifier upon transcriptional activation drives expression of the reporter, RFP.

In this experiment, the eTPC cell line was converted to an eTPC-t cell line (ACL-1277) as described previously in example 3, wherein the TCR chains at Component 2B’ and 2D’ encode a TCR pair that is specific for HCMV HLA-A*02:01-NLVPMVATV.

The eTPC-t cell line was then challenged against APCs presenting HLA-A*02:01 (ACL209) or HLA-A*24:02 (ACL-963) or was HLA-null (ACL-128). Wherein the APCs were pulsed with either peptide NLVPMVATV or VYALPLKML or no peptide. Subsequently,

30,000 eTPC-t were co-cultured with 10,000 APCs for 24h. After 24h the cells were

WO 2018/083318

PCT/EP2017/078378

122 harvested, washed, stained with markers specific for the eTPC and APC in order to distinguish the populations, and analysed by flow cytometry. Strong activation of the eTPC-t, Component 2F (RFP+ expression >80%) was only observed in eTPC-t challenged with the known cognate target antigen, i.e. the APC with A*02:01-NLVPMATV 5 (Figure 35).

In conclusion, an eTPC cell line containing a functional component 2F was engineered, and subsequently used to create an eTPC-t. Upon interaction of the eTPC-t with APC presenting its cognate target T-cell antigen, a response was measurable as 10 an increase in RFP expression. Conversely, when contacted with APC presenting a non-cognate T-cell antigen and HLA, or no HLA allele, no measurable increase in RFP expression above background was exhibited by the eTPC-t. The eTPC-t with a functional component 2F can therefore be used for the identification and characterization of the functional interaction between T cell receptors and cognate T-cell antigens pre15 sentedbyAPC.

Sequences

In the following is given a table showing the sequences mentioned herein.

SEQ number	Name	Reference example	Description
0001-0046	TRA V cloning fragments	Example 1	Full DNA sequences of the TRA V fragment
0047	TRA C constant cloning fragment	Example 1	Full DNA sequence of the TRA C fragment
0048	V-C entry vector backbone transient	Example 5	DNA sequence of the vector backbone from the 5' genetic element encoding the CMV constitutive promoter to the 3' genetic element encoding the SV40pA polyadenylation signal

WO 2018/083318

PCT/EP2017/078378

123

0049-0094	TRA V-C entry vector library sequence	Example 1	DNA sequences of the cloned V-C fragments that make up the TRA V-C entry vector library
0095-0096	TRA J receiving cassette fragments	Example 1	Full DNA sequence of the TRA J receiving cassette fragment oligonucleotides
0097	J donor backbone	Example 1	J donor vector backbone is used to insert the TRA J receiving cassette fragment to create the TRA J receiving cassette vector
0098	TRA J receiving cassette vector	Example 1	See above
0099-0210	TRA J Short segment part	Example 1	Encodes all amino acids from the start of the CDR3-J border Phe codon
0211-0322	TRA J Long segment part	Example 1	Encodes more amino acids N-terminal of the CDR3 border amino acids
0323-0378	TRA J Short donor vector	Example 1	TRA short J donor library
0379-0434	TRA J Long donor vector	Example 1	TRA long J donor library
0435-0481	TRB V cloning fragment	Example 1	Full DNA sequences for the TRB V cloning fragments
0482-0483	TRB C constant cloning fragments	Example 1	Full DNA sequences of the TRB C cloning fragments

WO 2018/083318

PCT/EP2017/078378

124

0484-0577	TRB V-C entry vector library sequence	Example 1	Sequences of the cloned V-C fragments that make up the TRA V-C entry vector library
0578-0581	TRB J receiving cassette fragments	Example 1	TRB J receiving cassette fragments are constructed and inserted into a J donor vector backbone to create a TRB J receiving cassette vector
0582-0583	TRB J receiving cassette vectors	Example 1	See above
0584-0609	TRB J Short segment part	Example 1	DNA sequences of the short TRB J segment parts
0610-0635	TRB J Long segment part	Example 1	DNA sequences of the long TRB J segment parts
0636-0648	TRB C1 J Short donor vector	Example 1	TRB C1 short J donor library
0649-0661	TRB C2 J Short donor vector	Example 1	TRB C2 short J donor library
0662-0674	TRB C1 J Long donor vector	Example 1	TRB C1 long J donor library
0675-0687	TRB C2 J Long donor vector	Example 1	TRB C2 long J donor library
0688	V-C entry vector backbone F14-F15	Example 1	F14/F15 V-C entry vector backbone sequence used to construct TRA V-C entry library
0689	V-C entry vector backbone FRT-F3	Example 1	FRT/F3 V-C entry vector backbone sequence used to construct TRB V-C entry library

WO 2018/083318

PCT/EP2017/078378

125

0701-0702	JG9 TRA and TRB full sequences copy	Example 3	DNA sequences of the TRA and TRB chains
0703-0706	JG9 odeCDR3 sequences	Example 3	odeCDR3 synthesised for the TRA and TRB chains
0743-0744	degenerate TRA odeCDR3s Example 9	Example 5	odeCDR3 oligos

<210> 745 <223> pcDNA3.1_GFP vector V1 .A.4 <210> 746 <223> pcDNA3.1_RFP vector V1.A.6 <210> 747 <223> pMA-SV40pA vector V1.C.2 <210> 748 <223> pMA-CS-JG9-TCRbeta vector V3.C.5 <210> 749 <223> pMA-F14-GFP-F15 vector V4.H9 <210> 750 <223> pMA-F14-TCR-JG9-alpha-F15 vector V7.A.3 <210> 751 <223> pMA-FRT-TCR-JG9-beta-F3 vector V7.A.4 <210> 752 <223> F14-TCRaF15 CDR3degen.64mix vector V8.F.8 <210> 753 <223> CMVpro-Flp-sv40pA-V2 vector V4.1.8 <210> 754 <223> JG9-TRA CDR3 64 variants vectors backbone VP.7751 .RC1-A1 to

H8 <210> 755 <223> CDR3 sequence of a JG9-TRA 64 variant VP.7751 ,RC1_A1 <210> 756 <223> CDR3 sequence of a JG9-TRA 64 variant VP.7751 ,RC1_A2 <210> 757 <223> CDR3 sequence of a JG9-TRA 64 variant VP.7751 ,RC1_A3 <210> 758 <223> CDR3 sequence of a JG9-TRA 64 variant VP.7751.RC1_A4

WO 2018/083318

PCT/EP2017/078378 <210> 759 <223> CDR3 sequence <210> 760 <223> CDR3 sequence <210> 761 <223> CDR3 sequence <210> 762 <223> CDR3 sequence <210> 763 <223> CDR3 sequence <210> 764 <223> CDR3 sequence <210> 765 <223> CDR3 sequence <210> 766 <223> CDR3 sequence <210> 767 <223> CDR3 sequence <210> 768 <223> CDR3 sequence <210> 769 <223> CDR3 sequence <210> 770 <223> CDR3 sequence <210> 771 <223> CDR3 sequence <210> 772 <223> CDR3 sequence <210> 773 <223> CDR3 sequence <210> 774 <223> CDR3 sequence <210> 775 <223> CDR3 sequence

126 of a JG9-TRA 64 variant VP.7751 ,RC1_A5 of a JG9-TRA 64 variant VP.7751 ,RC1_A6 of a JG9-TRA 64 variant VP.7751 ,RC1_A7 of a JG9-TRA 64 variant VP.7751 ,RC1_A8 of a JG9-TRA 64 variant VP.7751 ,RC1_B1 of a JG9-TRA 64 variant VP.7751 ,RC1_B2 of a JG9-TRA 64 variant VP.7751 ,RC1_B3 of a JG9-TRA 64 variant VP.7751 ,RC1_B4 of a JG9-TRA 64 variant VP.7751 ,RC1_B5 of a JG9-TRA 64 variant VP.7751 ,RC1_B6 of a JG9-TRA 64 variant VP.7751 ,RC1_B7 of a JG9-TRA 64 variant VP.7751 ,RC1_B8 of a JG9-TRA 64 variant VP.7751 ,RC1_C1 of a JG9-TRA 64 variant VP.7751 ,RC1_C2 of a JG9-TRA 64 variant VP.7751 ,RC1_C3 of a JG9-TRA 64 variant VP.7751 ,RC1_C4 of a JG9-TRA 64 variant VP.7751 .RC1 C5 <210> 776 <223> CDR3 sequence of a JG9-TRA 64 variant VP.7751 ,RC1_C6

WO 2018/083318

PCT/EP2017/078378 <210> 777 <223> CDR3 sequence <210> 778 <223> CDR3 sequence <210> 779 <223> CDR3 sequence <210> 780 <223> CDR3 sequence <210> 781 <223> CDR3 sequence <210> 782 <223> CDR3 sequence <210> 783 <223> CDR3 sequence <210> 784 <223> CDR3 sequence <210> 785 <223> CDR3 sequence <210> 786 <223> CDR3 sequence <210> 787 <223> CDR3 sequence <210> 788 <223> CDR3 sequence <210> 789 <223> CDR3 sequence <210> 790 <223> CDR3 sequence <210> 791 <223> CDR3 sequence <210> 792 <223> CDR3 sequence <210> 793 <223> CDR3 sequence

127 of a JG9-TRA 64 variant VP.7751 ,RC1_C7 of a JG9-TRA 64 variant VP.7751 ,RC1_D1 of a JG9-TRA 64 variant VP.7751 ,RC1_D2 of a JG9-TRA 64 variant VP.7751 ,RC1_D3 of a JG9-TRA 64 variant VP.7751 ,RC1_D4 of a JG9-TRA 64 variant VP.7751 ,RC1_D5 of a JG9-TRA 64 variant VP.7751 ,RC1_D6 of a JG9-TRA 64 variant VP.7751 ,RC1_D7 of a JG9-TRA 64 variant VP.7751 ,RC1_D8 of a JG9-TRA 64 variant VP.7751 ,RC1_E1 of a JG9-TRA 64 variant VP.7751 ,RC1_E2 of a JG9-TRA 64 variant VP.7751 ,RC1_E3 of a JG9-TRA 64 variant VP.7751 ,RC1_E4 of a JG9-TRA 64 variant VP.7751 ,RC1_E5 of a JG9-TRA 64 variant VP.7751 ,RC1_E6 of a JG9-TRA 64 variant VP.7751 ,RC1_E7 of a JG9-TRA 64 variant VP.7751 .RC1 E8 <210> 794 <223> CDR3 sequence of a JG9-TRA 64 variant VP.7751.RC1_F1

WO 2018/083318

PCT/EP2017/078378 <210> 795 <223> CDR3 sequence <210> 796 <223> CDR3 sequence <210> 797 <223> CDR3 sequence <210> 798 <223> CDR3 sequence <210> 799 <223> CDR3 sequence <210> 800 <223> CDR3 sequence <210> 801 <223> CDR3 sequence <210> 802 <223> CDR3 sequence <210> 803 <223> CDR3 sequence <210> 804 <223> CDR3 sequence <210> 805 <223> CDR3 sequence <210> 806 <223> CDR3 sequence <210> 807 <223> CDR3 sequence <210> 808 <223> CDR3 sequence <210> 809 <223> CDR3 sequence <210> 810 <223> CDR3 sequence <210> 811 <223> CDR3 sequence

128 of a JG9-TRA 64 variant VP.7751 ,RC1_F2 of a JG9-TRA 64 variant VP.7751 ,RC1_F3 of a JG9-TRA 64 variant VP.7751 ,RC1_F4 of a JG9-TRA 64 variant VP.7751 ,RC1_F5 of a JG9-TRA 64 variant VP.7751 ,RC1_F6 of a JG9-TRA 64 variant VP.7751 ,RC1_F7 of a JG9-TRA 64 variant VP.7751 ,RC1_F8 of a JG9-TRA 64 variant VP.7751 ,RC1_G1 of a JG9-TRA 64 variant VP.7751 ,RC1_G2 of a JG9-TRA 64 variant VP.7751 ,RC1_G3 of a JG9-TRA 64 variant VP.7751 ,RC1_G4 of a JG9-TRA 64 variant VP.7751 ,RC1_G5 of a JG9-TRA 64 variant VP.7751 ,RC1_G6 of a JG9-TRA 64 variant VP.7751 ,RC1_G7 of a JG9-TRA 64 variant VP.7751 ,RC1_G8 of a JG9-TRA 64 variant VP.7751 ,RC1_H1 of a JG9-TRA 64 variant VP.7751 .RC1 H2 <210> 812 <223> CDR3 sequence of a JG9-TRA 64 variant VP.7751.RC1_H3

WO 2018/083318

PCT/EP2017/078378

129 <210> 813 <223> CDR3 sequence of a JG9-TRA 64 variant VP.7751.RC1_H4 <210 814 <223> CDR3 sequence of a JG9-TRA 64 variant VP.7751.RC1_H5 <210> 815 <223> CDR3 sequence of a JG9-TRA 64 variant VP.7751.RC1_H6 <210> 816 <223> CDR3 sequence of a JG9-TRA 64 variant VP.7751.RC1_H7 <210> 817 <223> CDR3 sequence of a JG9-TRA 64 variant VP.7751.RC1_H8

Abbreviations
aAM	Analyte antigenic molecule
aAPX	Analyte antigen-presenting complex
a-GalCer	Alpha-Galactosyl ceramide
aT	Analyte TCR
APC	Antigen-presenting cell
APX	Antigen-presenting complex
B-cell	B lymphocytes
β2Μ	Beta 2 Microglobulin
BFP	Blue fluorescent protein
C (-region)	Constant region
CAR	Chimeric antigen receptor
CAR-T	CAR T-cell
CD1b	Cluster of differentiation 1 b
CD1d	Cluster of differentiation 1d
CD3	Cluster of differentiation 3
CDR	Complementarity-determining regions
CM	Cargo molecules
CMV	Cytomegalovirus
C-region	Constant region
CRISPR	Clustered Regularly Interspaced Short Palindromic Repeats
D (-region)	Diversity region
DAMPS	Danger associated molecular patterns
DC	Dendritic cells
DNA	Deoxyribonucleic acid
dsDNA	Double stranded DNA
eAPC	Engineered antigen-presenting cell
eAPC-a	Engineered antigen-presenting cell expressing an analyte antigenic molecule
eAPC-p	Engineered antigen-presenting cell that present an analyte antigen-presenting comple

WO 2018/083318

PCT/EP2017/078378

130

	Engineered antigen-presenting cell that presents an analyte antigen-presenting
eAPC-pa	complex and analyte antigenic molecule
eAPCS	Engineered antigen-presenting cell system
eTPC	Engineered TCR-presenting cell
eTPC-t	Engineered TCR-presenting cell that present full-length TCR pairs
eTPCS	Engineered TCR-presenting cell system
FAB	Antibody fragment antigen binding
FACS	Fluorescence-activated cell sorting
FRT GEM T-	Flippase recognition target
cells	Germ line-encoded mycolyl-reactive T-cells
GFP	Green fluorescent protein
gRNA	Cas9 guide RNA
HCMV	Human Cytomegalovirus
HDR	Homology directed recombination
HIV	Human immunodeficiency virus
HLA	Human leukocyte antigen
HLAI	HLA class I
HLAII	HLA class II
IgSF	Immunoglobulin superfamily
iNK T-cells	Invariant natural killer T-cells
IRES	Internal ribosome entry site
ITAM	Immunoreceptor tyrosine-based activation motif
J-donor	Joining donor
J-region	Joining region
MACS	Magnetic-activated cell sorting
MAGE	Melanoma associated antigen
MAIT	Mucosal-associated invariant T
MHC	Major Histocompatability Complex
MR1	Major histocompatibility complex class l-related gene protein
mRNA	Messenger ribonucleic acid
NCBP	Non-cell based particles
NK T-cells	Natural killer T cells
odeCDR3	Oligonucleotide duplex encoding CDR3
ORF	Open reading frame
PAMPS	Pathogen-associated molecular patterns
PCR	Polymerase chain reaction
pH LA	Peptide HLA
RFP	Red fluorescent protein
RMCE	Recombinase mediated cassette exchange
RNA	Ribonucleic acid
RT	Reverse Transcription

WO 2018/083318

PCT/EP2017/078378

131

SH2

T-cells

TAA TALEN

TCR TCRsp TORES

TRA TRB TRD

TRG

Src homology 2

T lymphocytes

Tumour-associated-antigens

Transcription activator-like effector nucleases

T-cell Receptor

TCR surface proteins in complex with CD3

TCR ORF Reconstitution and Engineering System

TCR alpha

TCR beta

TCR delta

TCR gamma

V-C entry vector

V (-region)

ZAP-70

Variable-Constant entry vector

Variable region ζ-chain-associated protein of 70 kDa

Definitions

Adaptive immunity: A subsystem of the overall immune system that is composed of highly specialized, systemic cells and processes that eliminate pathogens or prevent their growth.

A pair of complementary TCR chains: Two TCR chains wherein the translated proteins are capable of forming a TCRsp on the surface of a TCR presenting cell

Affinity: Kinetic or equilibrium parameter of an interaction between two or more molecules or proteins

Affinity Reagent: Any reagent that is prepared as analyte to probe TCRsp binding and/or stimulation at the cell surface of the eTPC-t in an eTPC:A system

Allele: Variant form of a given gene aAM: Analyte antigenic molecule. Generally, a protein but could also be a metabolite that is expressed by a cell from their genomic DNA and/or a specific introduced genetic sequence. The AM is expressed in the cell and a fragment can then be presented on the cell surface by an APX as cargo or on its own. Either as cargo or not, the AM can then be the target of T-cell receptor bearing cells or related affinity reagents.

Amplicon: a piece of DNA or RNA that is the source and/or product of artificial amplification using various methods including PCR.

WO 2018/083318

PCT/EP2017/078378

132

Analyte: an entity that is of interest to be identified and/or measured and/or queried in the combined system

Antibody: Affinity molecule that is expressed by specialized cells of the immune system called B-cells and that contains of two chains.

Antigen: any molecule that may be engaged by a TCR and results in a signal being transduced within the T-cell

Analyte antigen: collectively the eTPC:Antigen system (eTPC:A) representing any entity presenting an antigen for analytical determination

Antigen-binding cleft: long cleft or groove that is the site at which peptide antigens bind to the MHC-I molecule.

APC: Antigen-presenting cell. A cell capable of presenting antigen on its cell surface, generally in the context of an HLA.

aAPX: Analyte antigen-presenting complex. A protein that is expressed and presented on the cell surface by nucleated cells from genes/ORF encoding genomic DNA and/or a specific introduced genetic sequence. The APX presents a cargo, being either a peptide or other metabolite molecules.

Autoimmunity: is the system of immune responses of an organism against its own healthy cells and tissues.

C (-region): Constant gene segment. One of the gene segments that is used to assemble the T-cell receptor. The c-region is a distinct segment that rather than driving diversity of the TCR, defines its general function in the immune system.

C cloning fragment: Constant Cloning fragment. Also referred to as a C gene segment cloning fragment. A construct carrying a portion of a C gene segment used to construct a V-C entry vector.

Cargo-loading machinery: Cellular set of proteins that generate and load cargo molecules on APX from proteins or other presented molecules found in the cell.

Cis-acting element: regions of non-coding DNA that regulate the transcription of nearby ORFs.

WO 2018/083318

PCT/EP2017/078378

133

C-part: Constant part. A small portion of Constant gene segment sequence carried by a J receiving cassette fragment, J receiving cassette and J donor vector to standardise overhang sequences for operation of the TORES to reconstitute TCR ORFs.

CDR: complementarity-determining regions. Short sequences on the antigen-facing end of TCRs and antibodies that perform most of the target binding function. Each antibody and TCR contains six CDRs and they are generally the most variable part of the molecules allowing detection of a large number of diverse target molecules.

CM: Cargo molecules. Peptide or metabolite that is presented by an antigen-presenting complex for example a HLA I or HLA II. The CM can be expressed by the cell intrinsically from the genomic DNA, introduced into the culture medium or expressed from a specifically introduced genetic sequence.

Cognate Antigen: An antigen, often presented by an HLA, that is recognised in a particular TCR. TCR and antigen are cognate objects.

Copy-number: The whole number occurrence of a defined sequence encoded within the genome of a cell.

Cytogenetic: The study of inheritance in relation to the structure and function of chromosomes, i.e. determine the karyotype of a cell

Cytotoxic/Cytotoxicity: Process in which a T-cells releases factors that directly and specifically damage a target cell.

D (-region): Diversity gene segment. One of the gene segments that is used to assemble the T-cell receptor. Each individual has a large number of different variations of these regions making it possible for each individual to arm T-cells with a very large variety of different TCR.

Dimer: is an oligomer consisting of two structurally similar monomers joined by bonds that can be either strong or weak, covalent or intermolecular.

DNA: Desoxyribonucleic acid. Chemical name of the molecule that forms genetic material encoding genes and proteins.

Endogenous: Substance that originated from within a cell

WO 2018/083318

PCT/EP2017/078378

134 eTPC:A system: eTPC:Antigen system. The system in which a eTPC-t is contacted with analyte antigen

Eukaryotic conditional regulatory element: A DNA sequence that can influence the activity of a promoter, which may be induced or repressed under defined conditions

Eukaryotic Promoter: A DNA sequence that encodes a RNA polymerase biniding site and response elements. The sequence of the promoter region controls the binding of the RNA polymerase and transcription factors, therefore promoters play a large role in determining where and when your gene of interest will be expressed.

Eukaryotic terminator/Signal terminator: A DNA sequence that are recognized by protein factors that are associated with the RNA polymerase II and which trigger the termination process of transcription. It also encodes the poly-A signal

Engineered Cell: A cell whereby the genome has been engineered through genetic modification modified.

Epitope: An epitope, also known as antigenic determinant, is the part of an antigen that is recognized by the immune system, specifically by antibodies, B cells, or T cells. For example, the epitope is the specific piece of the antigen to which an antibody binds.

Epigenetic insulator sequence: DNA element that disrupts the communication between a regulatory sequence, such as an enhancer or a silencer, and a promoter.

eTPC system: eTPCS, the system by which eTPC-t cells, or libraries thereof, are prepared for combination in the eAPC:eTPC system

FACS/Flow Cytometry: Fluorescence-activated cell sorting. Flow cytometry is a technique by which individual cells can be analyzed en masse for the expression of specific cell surface and intracellular markers. A variation of that technique, cell sorting, allows cells that carry a defined set of markers to be retrieved for further analysis.

Family of APX: A set of several similar genes that encode functionally related proteins, which constitute an antigen pressing complex

Flp Recombinase: A recombinase (Flippase, Flp) derived from the 2 pm plasmid of

WO 2018/083318

PCT/EP2017/078378

135 baker's yeast Saccharomyces cerevisiae.

Fluorescent (protein) marker: Molecule that has specific extinction and emission characteristics and can be detected by Microscopy, FACS and related techniques.

Germline gene segments: (TCR) Gene segments that are naturally occurring in humans.

Gene cis acting elements: are present on the same molecule of DNA as the gene they regulate whereas trans-regulatory elements can regulate genes distant from the gene from which they were transcribed. Cis-regulatory elements are often binding sites for one or more trans-acting factors.

Genetic barcoding: DNA barcoding is a taxonomic method that uses a short genetic marker in an organism's DNA to identify it as belonging to a particular species.

Genomic Receiver Site: A site within the genome for targeted integration of donor genetic material encoded within a Genetic Donor Vector.

Genomic Receiver Site Recycling: The reversion of an occupied genomic receiver site back to the conformation wherein a new analyte (TCR) ORF can be integrated

Haplotype: a set of genetic determinants located on a single chromosome.

HLA haplotype: a set of HLAI and HLA II alleles that are present in each individual.

Heterospecific recombinase sites: A DNA sequence that is recognized by a recombinase enzyme to promote the crossover of two DNA molecules.

HLA I: Human Leukocyte Antigen class I. A gene that is expressed in humans in all nucleated cells and exported to the cell surface where it presents as cargo short fragments, peptides, of internal proteins to T-cell receptors. As such it presents fragments of potential ongoing infections along with intrinsic proteins. The HLA I can additionally present as cargo peptides that are added to the culture medium, generated from proteins expressed form introduced genetic elements or generated from proteins that are taken up by the cell. HLA class I genes are polymorphic meaning that different individuals are likely to have variation in the same gene leading to a variation in presentation. Related to HLA class II.

HLA II: Human Leukocyte Antigen Class II. A gene that is expressed in humans in

WO 2018/083318

PCT/EP2017/078378

136 specific cells that are coordinating and helping the adaptive immune response for example dendritic cells. Related to HLA class I. HLA class II proteins are exported to the cell surface where they present as cargo short fragments, peptides, of external proteins to T-cell receptors. As such it presents fragments of potential ongoing infections along with intrinsic proteins. The HLA II can additionally present as cargo peptides that are added to the culture medium, generated from proteins expressed form introduced genetic elements or generated from proteins that are taken up by the cell. HLA class II genes are polymorphic meaning that different individuals are likely to have variation in the same gene leading to a variation in presentation.

Homologous arms: A stretch of DNA that has near identical sequence identity to a complement homologous arm and therefore promote the exchange of two DNA molecules by the cellular process, homology directed repair.

Immune surveillance: Process in which the immune system detects and becomes activated by infections, malignancies or other potentially pathogenic alterations.

Immunotherapy: a type of treatment that boosts the body's natural defenses to fight a disease. It uses substances made by the body or in a laboratory to improve or restore immune system function.

Insulator: A DNA sequence that prevents a gene from being influenced by the activation or repression of nearby genes. Insulators also prevent the spread of heterochromatin from a silenced gene to an actively transcribed gene.

Integration: The physical ligation of a DNA sequence into a chromosome of a cell

Integration vector: The product of TORES containing TCR ORFs, and matched to genomic receiver sites, containing genetic elements at the 5’ and 3’ ends to enable integration.

Integration couple: matched integration vector and genomic receiver site

Internal ribosome entry site (IRES): A DNA sequence that once transcribed encodes a RNA element that allows the initiation of translation in a cap-independent manner

Isoform: any of two or more functionally similar proteins that have a similar but not identical amino acid sequence and are either encoded by different genes or by RNA

WO 2018/083318

PCT/EP2017/078378

137 transcripts from the same gene which have had different exons removed.

J (-region): Joining segment. One of the gene segments that is used to assemble the T-cell receptor. Each individual has a large number of different variations of these regions making it possible for each individual to arm T-cells with a very large variety of different TCR.

J donor backbone: Joining donor backbone. The vector backbone into which a J receiving cassette fragment is inserted to create a J receiving cassette vector.

J donor vector: The vector of the two-component vector system that carries the J TCR segment, and donates this segment to the V-C entry vector during reconstitution of a full-length TCR ORF.

J receiving cassette fragment: Joining receiving cassette fragment. A cloning fragment that carries a C-part used to construct a J receiving cassette vector.

J receiving cassette vector: Joining receiving cassette vector. The vector, carrying a C-part, into which a J segment part is inserted to create a J donor vector.

J segment part: Joining segment part. A DNA construct carring a portion of a J gene segment that is inserted into a J receiving cassette vector to generate a J donor vector.

Kozak Sequence: Short sequence required for the efficient initiation of translation

Major HLA class I: a Family of APX that comprise of the genes HLA-A, HLA-B and HLA-C

Matched: When two components encode genetic elements that direct and restrict the interaction between the complemented components

Meganuclease recognition site: A DNA sequence that is recognized by a endodeoxyribonuclease, commonly referred to as a meganuclease

Metabolite: A molecule created or altered through metabolic pathways of the cell

Mobile genetic element: A DNA sequence that can permit the integration of DNA with the activity of transposases enzymes

Monoclone cell line: A defined group of cells produced from a single ancestral cell by repeated cellular replication

WO 2018/083318

PCT/EP2017/078378

138 mRNA splice acceptor site: At the 5' end the DNA nucleotides are GT [GU in the premessenger RNA (pre-mRNA)]; at the 3' end they are AG. These nucleotides are part of the splicing sites. DONOR-SPLICE: splicing site at the beginning of an intron, intron 5' left end. ACCEPTOR-SPLICE: splicing site at the end of an intron, intron 3' right end.

Multimer: A protein complex consisting of multiple identical monomers. Often used in context of HLA multimer reagent.

Native: an entity that is naturally occurring in the cell

Negative Selection Marker: A selectable marker that confers negative selection of a vector and/or of host organism carrying said marker-bearing vector

Non-cell-based Particle: (NCBP) acts in a similar manner to an affinity reagent, inasmuch that the particle presents an analyte antigen or other entity that is to be assessed for TCRsp engagement at the surface of a eTPC-t within and eTPC:A system. However, an NCBP is considered as a larger entity that can further carry genetic or other information that is to act as an identifier, either directly or by proxy, of the presented analyte antigen or other binding entity. A typical example of an NCBP would be a bacteriophage in a phage-display scenario

Non-coding gene: A non protein coding DNA sequence that is transcribed into functional non-coding RNA molecules odeCDR3: oligonulcotide duplex encoding complementarity-determining regions. A synthetic construct carrying CDR3 genetic sequence with terminal overhangs, used in conjunction with the two-component vector system to reconstitute a full-length TCR ORF.

Origin of replication: a particular sequence in a vector, plasmid or genome at which replication is initiated.

ORF: Open reading frame. Stretch of genetic material that encodes a translation frame for synthesis of a protein (polypeptide) by the ribosome

Overhang: A single stranded sequence at the terminus of a double stranded nucleic acid molecule. Often referred to as sticky or cohesive ends.

PCR: Polymerase chain reaction in which a specific target DNA molecule is exponentially amplified

WO 2018/083318

PCT/EP2017/078378

139

Peptide: short string of amino acids between 6-30 amino acids in length

Phenotypic analysis: Analysis of the observable characteristics of a cell.

Plasmid: A genetic construct can replicate independently of the chromosomes, typically a small circular DNA strand in the cytoplasm of a bacterium or protozoan.

Polymorphic: Present in different forms in individuals ofthe same species through the presence of different alleles of the same gene.

Polypeptide: Protein consisting of a stretch of peptides, forming a three-dimensional structure.

Positive Selection Marker: A selectable marker that confers positive selection of a vector and/or host organism carrying said marker-bearing vector

Primer: Short DNA sequence that allows specific recognition of a target DNA sequence for example during a PCR.

Professional APC: any nucleated cell capable of presenting an antigen for sampling by alpha beta and gamma delta T-cells.

Promoter: Regulatory DNA element for the controlled initiation of gene expression.

Recombinase: Enzymes that mediate genetic recombination.

Reporter Element: A genetic element that mediates a reported signal in the organism or vector bearing said element. May be used as a positive or negative selection maker.

Restriction Enzyme Cleavage Sequence: The genetic sequence cleaved by a restriction enzyme, which can be extrinsic or intrinsic to the recognition sequence of said restriction enzyme.

Restriction Enzyme Recognition Sequence: The genetic sequence recognised and engaged by a restriction enzyme.

Selectable marker: A DNA sequence that confers a trait suitable for artificial selection methods

Splice acceptor site: A DNA sequence at the 3' end of the intron AM, APX CM or afWO 2018/083318

PCT/EP2017/078378

140 finity reagent for interaction with cells with TCRsp on the surface, or TCRsp based reagents

Splice donor site: A DNA sequence at the 5' end of the intron

Somatic V(D)J recombination: process after which each T-cell expresses copies of a single distinctly rearranged TCR. Refers to recombination at the TRB and TRD loci and additionally include a diversity (D) gene segment.

Suicide gene: A gene that will mediate cell death within the host organism carrying said gene. May be used as a positive or negative selection marker.

Synthetic: an entity that is artificially generated.

T-cell: T lymphocyte. White blood cell that expresses a T-cell receptor on its surface. Selected by the immune system to not react with the own body but have the potential to recognize infections and malignancies as well as reject grafts from most members of the same species.

T-cell maturation: process that allows T-cells to distinguish cells that belong to the body and are healthy from those that aren't healthy or don't belong to the body at all. Takes place in the thymus

T-cell repertoire: distinct set of T-cell receptors

TCR: T-cell Receptor. Affinity molecule expressed by a subgroup of lymphocytes called T-lymphocytes. In humans the TCR recognizes cargo presented by APX CM or APX AM, including fragments from virus or bacterial infections or cancerous cells. Therefore, the TCR recognition is an integral part of the adaptive immune system. The TCR consists of two chains that are paired on the cell surface. The TCR expressed on the surface of each cells is assembled at random from a large pool of varied genes (the v,d,j and c segments) and thus each individual has a pool of T-cells expressing a very large and diverse repertoire of different TCRs.

Terminator element: is a section of nucleic acid sequence that marks the end of a gene or operon in genomic DNA during transcription. This sequence mediates transcriptional termination by providing signals in the newly synthesized mRNA that trigger processes which release the mRNA from the transcriptional complex. These processes include the direct interaction of the mRNA secondary structure with the complex and/or

WO 2018/083318

PCT/EP2017/078378

141 the indirect activities of recruited termination factors. Release of the transcriptional complex frees RNA polymerase and related transcriptional machinery to begin transcription of new mRNAs. The termination element is in the template strand of DNA and consists of two inverted repeats separated by half a dozen bases and followed by a run of adenines (A’s).

Thymic selection: Immature thymocytes undergo a process ofselection, based on the specificity of their T-cell receptors. This involves selection of T cells that are functional (positive selection), and elimination of T cells that are autoreactive (negative selection). The medulla of the thymus is the site of T Cell maturation.

Tumour associated antigens: Tumor antigen is an antigenic substance produced in tumor cells, i.e., it triggers an immune response in the host. Tumor antigens are useful tumor markers in identifying tumor cells with diagnostic tests and are potential candidates for use in cancer therapy.

TRA: TCR alpha encoding locus. One of the four different locus encoding genes that can form a VDJ recombined TCR chain. Translated TCR alpha chain proteins typically pair with translated TCR beta chain proteins to form alpha/beta TCRsp.

TRB: TCR beta encoding locus. One of the four different locus encoding genes that can form a VDJ recombined TCR chain. Translated TCR beta chain proteins typically pair with TCR alpha chain proteins to form alpha/beta TCRsp.

TRD: TCR delta encoding locus. One of the four different locus encoding genes that can form a VDJ recombined TCR chain. Translated TCR delta chain proteins typically pair with translated TCR gamma chain proteins to form gamma/delta TCRsp.

TRG: TCR gamma encoding locus. One of the four different locus encoding genes that can form a VDJ recombined TCR chain. Translated TCR gamma chain proteins typically pair with translate TCR delta chain proteins to form gamma/delta TCRsp.

Two-component vector system: a single V-C entry vector and a single J donor vector with desired sequences can be combined with a short DNA oligonucleotide duplex encoding CDR3 (odeCDR3) sequence to reconstitute a full length TCR ORF in vitro in a single-tube reaction, in a restriction enzyme and ligase dependent and PCR independent manner.

WO 2018/083318

PCT/EP2017/078378

142

Type I transmembrane domain: single-pass molecules anchored to the lipid membrane with a stop-transfer anchor sequence and their N-terminal domain targeted to the endoplasmic reticulum lumen during synthesis (and the extracellular space, if mature forms are located on Plasmalemma).

Type IIS Restriction Enzyme: restriction enzymes that recognize asymmetric DNA sequences and cleave outside of their recognition sequence.

V (-region): Variable region. One of the gene segments that is used to assemble the T-cell receptor. Each individual has a large number of different variations of these regions making it possible for each individual to arm T-cells with a very large variety of different TCR.

V-C entry vector: The vector of the two-component vector system that carries the V and C TCR segments, and which receives sequences from the J donor vectors and odeCDR3 during reconstitution of a full-length TCR ORF.

V cloning fragment: Variable Cloning fragment. Also referred to as a V gene segment cloning fragment. A construct carrying a portion of a V gene segment used to construct a V-C entry vector.

Vector: A vector is a genetic construct that carries genetic information. In the present context vector usually describes plasmidic DNA vectors. A vector can represent any such construct that can be propagated and selected in a host organism.

Claims

Claims

1. A two-part device, wherein a first part is a multicomponent TCR ORF reconstitution and engineering system (TORES), and a second part is a multicomponent engineered TCR-presenting cell system (eTPCS).
2. A two-part device according to claim 1 wherein operation of a TORES provides one or more genetic integration vectors, components 2C and/or 2E, each encoding an analyte TCR ORF selected from

a. a native TCR chain

b. a sequence-diversified TCR chain

c. a synthetic TCR chain
3. A two-part device according to claim 2, wherein the one or more genetic integration vectors, components 2C and/or 2E, are used as input in the second part of the two-part device.
4. A two-part device according to claim 1, wherein eTPCS provides one or more analyte eTPC in which one or more TORES-derived analyte TCR chain pairs are presented, and the one or more analyte eTPC is selected from

a. eTPC-t and/or

b. eTPC-x and/or

c. one or more libraries thereof.
5. A two-part device according to claim 4, wherein a pair of analyte TCR chains are expressed as TCR surface proteins in complex with CD3 (TCRsp) by an analyte eTPC.
6. A two-part device according to claim 1, wherein the first part, TORES, comprises two separate components, wherein the first component 1A is a vector carrying variable and constant (V-C) T-cell receptor (TCR) gene segments, and the second component 1B is a vector carrying joining (J) TCR gene segments.
7. A two-part device according to claim 6, wherein component 1A is a V-C entry vector containing

WO 2018/083318

PCT/EP2017/078378

144

a. origin of replication,

b. a first positive selection marker

c. 5’ genetic element, or elements,

d. Kozak Sequence,

e. TCR variable gene segment,

f. a first Type IIS sequence, for site specific recognition and cleavage by a Type IIS restriction enzyme,

g. a negative selection marker,

h. a second Type IIS sequence

i. TCR constant gene segment, and

j. 3’ genetic element, or elements.
8. A two-part device according to claim 6 or 7, wherein component 1B is a J donor vector containing

a. origin of replication,

b. a second positive selection marker,

c. a third Type IIS sequence,

d. TCR Joining gene segment,

e. a C part, corresponding to a small 5’ portion of a constant gene segment, and

f. a fourth Type IIS sequence.
9. A two-part device according to any of claims 7-8, wherein the 5’ genetic element of component 1A further comprises one or more elements selected from

a. gene cis/acting element,

b. heterospecific recognition site for recombinase enzymes,

c. a 5’ homologous recombination arm for a genomic site of interest’

d. a mRNA splice acceptor site,

e. an internal ribosomal entry site, and

f. epigenetic insulator sequence

g. wherein the 5’ genetic element must contain at least b or c.
10. A two-part device according any of claims 7-9, wherein the negative selection marker in component 1A is selected from one or more of the following

WO 2018/083318

PCT/EP2017/078378

145

a. a restriction enzyme recognition site not contained elsewhere in the first component or within the TCR joining gene segment,

b. a gene encoding a conditional bactericidal agent, and

c. a reporter element.
11. A two-part device according to any of claims 8-10, wherein the 3’ genetic element of component 1A further comprises one or more elements selected from

a. a terminator element,

b. heterospecific recognition site for recombinase enzymes,

c. a 3’ homologous recombination arm for a genomic site of interest,

d. a mRNA splice donor site,

e. an internal ribosomal entry site, and

f. epigenetic insulator sequence.

wherein the 3’ genetic element must contain at least b or c.
12. A two-part device according to any of claims 7-11, wherein the first and second positive selection markers of the first part are different and are selected from an antibiotic resistance gene and/or auxotroph complementing gene.
13. A two-part device according to any of the preceding claims, wherein the first part further comprises a third component 1C comprising an oligonucleotide duplex encoding CDR3 (odeCDR3)
14. A two-part device according to claim 13, wherein 1C comprises

a. a first single strand overhang sequence complimentary to first Type IIS restriction enzyme recognition and cleavage site in 1A,

b. a double strand segment encoding a TCR CDR3 region and devoid of negative selection element in 1A, wherein a negative selection element is devoid of any Type IIS restriction sequences of component 1A or 1B, and

c. a second single strand overhang sequence complimentary to the third Type IIS restriction enzyme recognition and cleavage site in 1B;

or 1C comprises

WO 2018/083318

PCT/EP2017/078378

146

d. a single double-stranded DNA molecule encoding a TCR CDR3 flanked by Type IIS restriction enzyme sites such that when cleaved generates the molecule defined in claims 13a to c.
15. A two-part device according to claim 1, wherein the second part, eTPCS, comprises a first component, an engineered TCR-presenting cell (eTPC), designated component 2A, wherein component 2A is a cell that lacks endogenous surface expression of at least one family of analyte antigen-presenting complexes (aAPX) and/or analyte antigenic molecule (aAM).
16. A two-part device according to claim 15, wherein the family of aAPX may be any of the following

a. HLA class I

b. HLA class II

c. non-HLA antigen-presenting complex.
17. A two-part device according to claim 15, wherein component 2A

a. Lacks endogenous expression of TCR chains alpha, beta, delta and gamma, and

b. Expresses CD3 proteins which are conditionally presented on the surface of the cell only when the cell expresses a complementary pair of TCR chains and

c. Contains a further components designated 2B and 2D, genomic receiver sites, each for integration of a single ORF encoding one analyte TCR chain of alpha, beta, delta or gamma.
18. A two-part device according to any of claims 15-17, wherein component 2C and 2E, are matched to component 2B and 2D, respectively, and wherein the component 2C and 2E are designed to deliver a single ORF encoding one analyte TCR chain of alpha, beta, delta and/or gamma, and wherein 2C and/or 2E optionally encodes a selection marker of integration, such that the analyte TCR chains can be expressed as TCR surface protein in complex with the CD3 (TCRsp) on component 2A.

WO 2018/083318

PCT/EP2017/078378

147
19. A two-part device according to any of claims 15-18, wherein component 2A

a. Lacks endogenous expression of TCR chains alpha, beta, delta and gamma, and

b. Expresses CD3 proteins which are conditionally presented on the surface of the cell only when the cell expresses a complementary pair of TCR chains and

c. Contains a further component designated 2B, a genomic receiver site for integration of a single ORF encoding at least one analyte TCR chain of alpha, beta, delta or gamma, and/or two ORFs encoding pair of analyte TCR chains, and component 2C comprises a genetic integration vector that is matched to component 2B, and wherein component 2C is designed to deliver

a. A single ORF encoding at least one analyte TCR chain of alpha, beta, delta and/or gamma and/or

b. Two ORFs encoding a pair of analyte TCR chains.

and wherein a and/or b optionally encodes a selection marker of integration, such that the analyte TCR chains can be expressed as TCR surface protein in complex with the CD3 (TCRsp) on component 2A.
20. A two-part device according to any of claims 15-19, wherein component 2A, further contains a component designated 2F, a synthetic genomic TCR-stimulation response element selected from

a. A single component synthetic construct containing at least one native promoter and/or at least one synthetic promoter and at least one reporter

b. A multi-component synthetic construct designed with at least one native promoter and/or at least one synthetic promoter and at least one reporter, and wherein activation of a and/or b is dependent on at least one signal transduction pathway selected from a synthetic pathway, a native pathway or a combination thereof.

WO 2018/083318

PCT/EP2017/078378

148
21. A two-part device according to any of claims 16-20, wherein the genomic receiver site 2B and 2D is selected from

a. A synthetic construct designed for recombinase mediated cassette exchange (RMCE)

b. A synthetic construct designed for site directed homologous recombination.
22. A according to claim 21, wherein the genomic receiver site 2B and 2D is a synthetic construct designed for recombinase mediated cassette exchange (RMCE).
23. A two-part device according to any of claims 15-22, wherein the aAM is selected from

a. a polypeptide or complex of polypeptides translated from the analyte antigenic molecule ORF(s)

b. a peptide derived from a polypeptide translated from the analyte antigenic molecule ORF(s)

c. a peptide derived from altering the component A proteome

d. a polypeptide derived from altering the component A proteome

e. a metabolite derived from altering the component A metabolome.
24. A two-part device according to any of claims 15-23, wherein component 2A expresses CD4 and/or CD8.
25. A two-part device according to any of claims 15-24, wherein component 2A expresses additional TCR co-receptors.
26. A two-part device according to any of claims 15-25, wherein component 2A expresses CD28 and/or CD45.
27. A two-part device according to any of claims 16-26, wherein component 2B and 2D is included and comprises of at least one of the following genetic elements

WO 2018/083318

PCT/EP2017/078378

149

a. Heterospecific recombinase sites

b. Homologous arms

c. Eukaryotic promoter

d. Eukaryotic conditional regulatory element

e. Eukaryotic terminator

f. Selection marker

g. Splice acceptor site

h. Splice donor site

i. Non-protein coding gene

j. Insulator

k. Mobile genetic element

l. Meganuclease recognition site

m. Internal ribosome entry site (IRES)

n. Viral self-cleaving peptide element.

o. A Kozak consensus sequence
28. A two-part device according to any of claims 15-27, wherein the component 2C and 2E are included and comprise of at least one of the following genetic elements

a. Heterospecific recombinase sites

b. Homologous arms

c. Eukaryotic promoter

d. Eukaryotic conditional regulatory element

e. Eukaryotic terminator

WO 2018/083318

PCT/EP2017/078378

150

f. Selection marker

g. Selection marker of integration

h. Splice acceptor site

i. Splice donor site

j. Non-protein coding gene

k. Insulator

l. Mobile genetic element

m. Meganuclease recognition site

n. Internal ribosome entry site (IRES)

o. A viral self-cleaving peptide element

p. An antibiotic resistance cassette

q. A bacterial origin of replication

r. A yeast origin of replication

s. A cloning site.

t. A kozak consensus sequence
29. A two-part device according to any of claims 16-28, wherein the component 2B and 2D are included and are for RMCE integration of a single ORF and comprises:

a. A Eukaryotic promoter

b. A pair of heterospecific recombinase sites matched with those of 2C and 2E

c. A Kozak consensus sequence

d. A selection marker

WO 2018/083318

PCT/EP2017/078378

151

e. A Eukaryotic terminator.
30. A two-part device according to any of claims 15-29, wherein component 2C and 2E are present and are each for RMCE integration of a single ORF and comprise the following genetic elements contributed by component 1 A:

a. A pair of heterospecific recombinase sites matched with those of 2B and 2D

b. A Kozak consensus sequence

c. A TCR ORF reconstituted by operation ofthe Part 1 TORES.
31. A two-part device according to any of claims 15-30, wherein component 2C and 2E are included and are contributed by operation ofthe TORES to provide a single analyte TCR chain pair.
32. A two-part device according to any of claims 15-31, wherein component 2C and/or 2E are included and are contributed by operation ofthe TORES to provide a library of analyte TCR chain pairs encoded by 2C and/or 2E.
33. A two-part device according to claim 31 or 32, wherein the analyte TCR chain encoding sequences are derived from

a. Paired sequencing of TCR chain ORF sequence(s) from primary Tcells and reconstitution in the part 1 TORES

b. Unpaired sequencing of TCR chain ORF sequence(s) from primary T-cells and reconstitution in part 1 TORES

c. Synthetic TCR chain ORF sequence(s) generated by operation of the TORES.
34. A two-part device according to any of claims 31-33, wherein one or more component 2C and/or 2E is combined with component 2A, to integrate two complementary analyte TCR chains encoded in component 2C and/or 2E, into components 2B and/or 2D, to obtain a cell, designated an eTPC-t, wherein components 2B and/or 2D become components 2B’ and/or 2D’ such that it expresses an analyte TCRsp on the surface of component 2A.

WO 2018/083318

PCT/EP2017/078378

152
35. A two-part device according to any of claims 31-33, wherein one of component 2C or 2E is combined with component A, to integrate one analyte TCR chain encoded in component 2C or 2E, into components 2B or 2D, to obtain a cell, designated eTPC-x, wherein components B or D become components 2B’ or 2D’ such that the eTPC-x expresses a single TCR chain.
36. A two-part device according to any of claim 35, wherein one of component 2C or 2E is combined with an eTPC-x, to integrate one analyte TCR chain encoded in component 2C or 2E that is complementary to the TCR chain expressed in the eTPC-x, into components 2B or 2D, of the eTPC-x, to obtain an eTPC-t, wherein components 2B or 2D become components 2B’ or 2D’ such that it expresses an TCRsp on the surface of the eTPC-t.
37. Use of a multicomponent system to generate at least one analyte eTPC-t.
38. Use of at least one analyte eTPC-t in a diagnostic device.
39. A diagnostic device comprising one or more analyte eTPC-t.
40. A diagnostic device according to claim 39 further comprising one or more analyte antigen.
41. Use of one or more eTPCs as a control reagent.
42. Use according to claim 41 in an assay.
43. The use according to claim 42, wherein the assay is a flow cytometry assay.