AU2017228711B2

AU2017228711B2 - Polynucleotides, Polypeptides Encoded Thereby, and Methods of Using Same for Increasing Abiotic Stress Tolerance and/or Biomass and/or Yield in Plants Expressing Same

Info

Publication number: AU2017228711B2
Application number: AU2017228711A
Authority: AU
Inventors: Sharon Ayal; Alex Diber; Dotan Dimat; Eyal Emmanuel; Michael Gang; Hagai Karchi; Gil Ronen; Judith Basia Vinocur
Original assignee: Evogene Ltd
Current assignee: Evogene Ltd
Priority date: 2007-07-24
Filing date: 2017-09-15
Publication date: 2019-01-03
Anticipated expiration: 2028-07-24
Also published as: AU2017228711A1; AU2015230753A1; AU2015230753B2

Abstract

Provided are methods of increasing tolerance of a plant to abiotic stress, and/or increasing biomass, growth rate, vigor and/or yield of a plant. The methods are effected by expressing within the plant an exogenous polynucleotide encoding a polypeptide comprising an amino acid sequence at least 90 % homologous to the amino acid sequence selected from the group consisting of SEQ ID NOs:201, 207, 212, 202-206, 208-211, 213-391, 1655, 961-1529, and 1660-1663. Also provided are polynucleotides, nucleic acid constructs, polypeptides and transgenic plants expressing same which can be used to increase tolerance of a plant to abiotic stress, and/or increase biomass, growth rate, vigor and/or yield of a plant.

Description

POLYNUCLEOTIDES, POLYPEPTIDES ENCODED THEREBY, AND METHODS OF USING SAME FOR INCREASING ABIOTIC STRESS TOLERANCE AND/OR BIOMASS AND/OR YIELD IN PLANTS EXPRESSING SAME

FIELD AND BACKGROUND OF THE INVENTION

This application is a divisional of Australian Patent Application No. 2015230753 fded 23 September 2015, which itself was a divisional of Australian Patent Application No. 2014215945 filed 19 August 2014, which itself was a divisional of Australian Patent Application No. 2008278654 filed 24 July 2008, the entire contents of which are herein incorporated by cross[0 reference. The subject matter of this application is related to the applicant’s International Patent Application No. PCT/IL2008/001024 filed 24 July 2008 and claims the benefit of US Provisional Patent Application No. 60/935,046 filed 24 July 2007, the contents of which are incorporated herein by reference in their entirety.

The present invention, in some embodiments thereof, relates to isolated polypeptides and i 5 polynucleotides and more particularly, but not exclusively, to methods of using same for increasing tolerance of a plant to abiotic stress, growth, biomass, vigor and/or yield of a plant.

Abiotic stress (ABS; also referred to as “environmental stress”) conditions such as salinity, drought, flood, suboptimal temperature and toxic chemical pollution, cause substantial damage to agricultural plants. Most plants have evolved strategies to protect themselves against these 10 conditions. However, if the severity and duration of the stress conditions are too great, the effects on plant development, growth and yield are profound. Furthermore, most of the crop plants are highly susceptible to ABS and thus necessitate optimal growth conditions for commercial crop yields. Continuous exposure to stress causes major alterations in plant’s metabolism which ultimately leads to cell death and consequently yield loss. Thus, despite extensive research and intensive crop25 protection measures, losses due to abiotic stress conditions remain in the billions of dollars annually.

Drought is a gradual phenomenon, which involves periods of abnormally dry weather that persists long enough to produce serious hydrologic imbalances such as crop damage and water supply shortage. In severe cases, drought can last many years and result in devastating effects on agriculture and water supplies. With burgeoning population and chronic shortage of available fresh 30 water, drought is not only the number one weather-related problem in agriculture, but it also ranks as one of the major natural disasters of all time, causing not only economic damage (e.g., losses from the US drought of 1988 exceeded $40 billion), but also loss of human lives, as in the 1984-1985 drought in the Horn of Africa which led to a famine that killed 750,000 people. Furthermore, drought is associated with increase susceptibility to various diseases.

2017228711 15 Sep 2017 la

For most crop plants, the land regions of the world are too arid. In addition, overuse of available water results in increased loss of agriculturally-usable land (desertification), and increase of salt accumulation in soils adds to the loss of available water in soils.

[Text continues on page 2.]

2017228711 15 Sep 2017

Salinity, high salt levels, affects one in five hectares of irrigated land. This condition is only expected to worsen, further reducing the availability of arable land and crop production, since none of the top five food crops, i.e., wheat, com, rice, potatoes, and soybean, can tolerate excessive salt. Detrimental effects of salt on plants result from both water deficit which leads to osmotic stress (similar to drought stress) and the effect of excess sodium ions on critical biochemical processes. As with freezing and drought, high salt causes water deficit; and the presence of high salt makes it difficult for plant roots to extract water from their environment. Soil salinity is thus one of the more important variables that determine whether a plant may thrive. In many parts of the world, sizable land areas are uncultivable due to naturally high soil salinity. Thus, salination of soils that are used for agricultural production is a significant and increasing problem in regions that rely heavily on agriculture, and is worsen by over-utilization, over-fertilization and water shortage, typically caused by climatic change and the demands of increasing population. Salt tolerance is of particular importance early in a plant's lifecycle, since evaporation from the soil surface causes upward water movement, and salt accumulates in the upper soil layer where the seeds are placed. On the other hand, germination normally takes place at a salt concentration which is higher than the mean salt level in the whole soil profile.

Germination of many crops is sensitive to temperature. A gene that would enhance germination in hot conditions would be useful for crops that are planted late in the season or in hot climates. In addition, seedlings and mature plants that are exposed to excess heat may experience heat shock, which may arise in various organs, including leaves and particularly fruit, when transpiration is insufficient to overcome heat stress. Heat also damages cellular structures, including organelles and cytoskeleton, and impairs membrane function. Heat shock may produce a decrease in overall protein synthesis, accompanied by expression of heat shock proteins, e.g., chaperones, which are involved in refolding proteins denatured by heat.

Heat stress often accompanies conditions of low water availability. Heat itself is seen as an interacting stress and adds to the detrimental effects caused by water deficit conditions. Water Evaporative demand exhibits near exponential increases with increases in daytime temperatures and can result in high transpiration rates and low plant water potentials. High-temperature damage to pollen almost always occurs in conjunction with drought stress, and rarely occurs under well-watered conditions.

2017228711 15 Sep 2017

Combined stress can alter plant metabolism in novel ways; therefore understanding the interaction between different stresses may be important for the development of strategies to enhance stress tolerance by genetic manipulation.

Excessive chilling conditions, e.g., low, but above freezing, temperatures affect crops of tropical origins, such as soybean, rice, maize, and cotton. Typical chilling damage includes wilting, necrosis, chlorosis or leakage of ions from cell membranes. The underlying mechanisms of chilling sensitivity are not completely understood yet, but probably involve the level of membrane saturation and other physiological deficiencies. For example, pho to inhibition of photosynthesis (disruption of photosynthesis due to high light intensities) often occurs under clear atmospheric conditions subsequent to cold late summer/autumn nights. In addition, chilling may lead to yield losses and lower product quality through the delayed ripening of maize.

Water deficit is a common component of many plant stresses. Water deficit occurs in plant cells when the whole plant transpiration rate exceeds the water uptake. In addition to drought, other stresses, such as salinity and low temperature, produce cellular dehydration.

Salt and drought stress signal transduction consist of ionic and osmotic homeostasis signaling pathways. The ionic aspect of salt stress is signaled via the SOS pathway where a calcium-responsive SOS3-SOS2 protein kinase complex controls the expression and activity of ion transporters such as S0S1. The osmotic component of salt stress involves complex plant reactions that overlap with drought and/or cold stress responses.

Common aspects of drought, cold and salt stress response [Reviewed in Xiong and Zhu (2002) Plant Cell Environ. 25: 131-139] include: (a) transient changes in the cytoplasmic calcium levels early in the signaling event [Knight, (2000) Int. Rev. Cytol. 195: 269-324; Sanders et al. (1999) Plant Cell 11: 691-706]; (b) signal transduction via mitogen-activated and/or calcium dependent protein kinases (CDPKs) and protein phosphatases [Merlot et al. (2001) Plant J. 25: 295-303; Tahtiharju and Palva (2001) Plant J. 26: 461-470]; (c) increases in abscisic acid levels in response to stress triggering a subset of responses; (d) inositol phosphates as signal molecules (at least for a subset of the stress responsive transcriptional changes [Xiong et al. (2001) Genes Dev. 15: 19711984]; (e) activation of phospholipases which in turn generates a diverse array of second messenger molecules, some of which might regulate the activity of stress responsive

2017228711 15 Sep 2017 kinases [e.g., phospholipase D; Frank et al. (2000) Plant Cell 12: 111-124]; (f) induction of late embryogenesis abundant (LEA) type genes including the CRT/DRE responsive COR/RD genes; (g) increased levels of antioxidants and compatible osmolytes such as proline and soluble sugars [Hasegawa et al. (2000) Annu. Rev. Plant Mol. Plant Physiol. 51: 463-499)]; and (h) accumulation of reactive oxygen species such as superoxide, hydrogen peroxide, and hydroxyl radicals.

Abscisic acid biosynthesis is regulated by osmotic stress at multiple steps. Both ABA-dependent and -independent osmotic stress signaling first modify constitutively expressed transcription factors, leading to the expression of early response transcriptional activators, which then activate downstream stress tolerance effector genes.

Several genes which increase tolerance to cold or salt stress can also improve drought stress protection, these include for example, the transcription factor AtCBF/DREBl, OsCDPK7 (Saijo et al. 2000, Plant J. 23: 319-327) or AVP1 (a vacuolar pyrophosphatase-proton pump, Gaxiola et al. 2001, Proc. Natl. Acad. Sei. USA 98: 11444-11449).

Developing stress-tolerant plants is a strategy that has the potential to solve or mediate at least some of these problems. However, traditional plant breeding strategies used to develop new lines of plants that exhibit tolerance to ABS are relatively inefficient since they are tedious, time consuming and of unpredictable outcome. Furthermore, limited germplasm resources for stress tolerance and incompatibility in crosses between distantly related plant species represent significant problems encountered in conventional breeding. Additionally, the cellular processes leading to ABS tolerance are complex in nature and involve multiple mechanisms of cellular adaptation and numerous metabolic pathways.

Genetic engineering efforts, aimed at conferring abiotic stress tolerance to transgenic crops, have been described in the art. Studies by Apse and Blumwald (Curr Opin Biotechnol. 13:146-150, 2002), Quesada et al. (Plant Physiol. 130:951-963, 2002), Holmstrom et al. (Nature 379: 683-684, 1996), Xu et al. (Plant Physiol 110: 249-257, 1996), Pilon-Smits and Ebskamp (Plant Physiol 107: 125-130, 1995) and Tarczynski et al. (Science 259: 508-510, 1993) have all attempted at generating stress tolerant plants.

In addition, several U.S. patents and patent applications also describe polynucleotides associated with stress tolerance and their use in generating stress

2017228711 15 Sep 2017 tolerant plants. U.S. Pat. Nos. 5,296,462 and 5,356,816 describe transforming plants with polynucleotides encoding proteins involved in cold adaptation in Arabidopsis thaliana for promoting cold tolerance.

U.S. Pat. No. 6,670,528 describes transforming plants with polynucleotides encoding polypeptides binding to stress responsive elements for promoting tolerance to abiotic stress.

U.S. Pat. No. 6,720,477 describes transforming plants with a polynucleotide encoding a signal transduction stress-related protein, capable of increasing tolerance of the transformed plants to abiotic stress.

U.S. Application Ser. Nos. 09/938842 and 10/342224 describe abiotic stressrelated genes and their use to confer upon plants tolerance to abiotic stress.

U.S. Application Ser. No. 10/231035 describes overexpressing a molybdenum cofactor sulfurase in plants for increasing tolerance to abiotic stress.

W02004/104162 to Evogene Ltd. teaches polynucleotide sequences and methods of utilizing same for increasing the tolerance of a plant to abiotic stresses and/or increasing the biomass of a plant.

W02007/020638 to Evogene Ltd. teaches polynucleotide sequences and methods of utilizing same for increasing the tolerance of a plant to abiotic stresses and/or increasing the biomass, vigor and/or yield of a plant.

W02007/049275 to Evogene Ltd. teaches isolated polypeptides, polynucleotides encoding same for increasing tolerance of a plant to abiotic stress, and/or for increasing biomass, vigor and/or yield of a plant.

Additional background art includes U.S. Patent Appl. Nos. 20060183137A1 Al and 20030056249A1.

SUMMARY OF THE INVENTION

According to an aspect of some embodiments of the present invention there is provided a method of increasing tolerance of a plant to abiotic stress, the method comprising expressing within the plant an exogenous polynucleotide encoding a polypeptide comprising an amino acid sequence at least 90 % homologous to the amino acid sequence selected from the group consisting of SEQ ID NOs:201, 207, 212, 202206, 208-211, 213-391, 1655, 961-1529, and 1660-1663, thereby increasing the tolerance of the plant to abiotic stress.

2017228711 15 Sep 2017

According to an aspect of some embodiments of the present invention there is provided a method of increasing tolerance of a plant to abiotic stress, the method comprising expressing within the plant an exogenous polynucleotide encoding a polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOs:201, 207, 212, 202-206, 208-211, 213-391, 1655, 961-1529, and 16601663, thereby increasing the tolerance of the plant to abiotic stress.

According to an aspect of some embodiments of the present invention there is provided a method of increasing biomass, growth rate, vigor and/or yield of a plant, the method comprising expressing within the plant an exogenous polynucleotide encoding a polypeptide comprising an amino acid sequence at least 90 % homologous to the amino acid sequence selected from the group consisting of SEQ ID NOs:201, 207, 212, 202206, 208-211, 213-391, 1655, 961-1529, and 1660-1663, thereby increasing the biomass, growth rate, vigor and/or yield of the plant.

According to an aspect of some embodiments of the present invention there is provided a method of increasing biomass, growth rate, vigor and/or yield of a plant, the method comprising expressing within the plant an exogenous polynucleotide encoding a polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOs:201, 207, 212, 202-206, 208-211, 213-391, 1655, 961-1529, and 16601663, thereby increasing the biomass, growth rate, vigor and/or yield of the plant.

According to an aspect of some embodiments of the present invention there is provided an isolated polynucleotide comprising a nucleic acid sequence at least 90 % identical to the nucleic acid sequence selected from the group consisting of SEQ ID NOs:1530, 1561, 1532, 1531, 1562, 1533, 1538, 1549, 1665, 1566, 1554, 1563, 1557, 1564, 1534, 1536, 1552, 1553, 1666, 1547, 1548, 1556, 1559, 1560, 1654, 1555, 1540,

1543, 1668, 1539, 1550, 1558, 1565, 1541, 1667, 1542, 1544, 1537, 1551, 1545, 1-200, 1653, 392-960, and 1656-1659.

According to an aspect of some embodiments of the present invention there is provided an isolated polynucleotide comprising a nucleic acid sequence selected from the group consisting of SEQ ID NOs:1530, 1561, 1532, 1531, 1562, 1533, 1538,1549,

1665, 1566, 1554, 1563, 1557, 1564, 1534, 1536, 1552, 1553, 1666, 1547, 1548,1556,

1559, 1560, 1654, 1555, 1540, 1543, 1668, 1539, 1550, 1558, 1565, 1541, 1667,1542,

1544, 1537, 1551, 1545, 1-200, 1653, 392-960, and 1656-1659.

2017228711 15 Sep 2017

According to an aspect of some embodiments of the present invention there is provided a nucleic acid construct comprising the isolated polynucleotide and a promoter for directing transcription of the nucleic acid sequence.

According to an aspect of some embodiments of the present invention there is provided an isolated polypeptide, comprising an amino acid sequence at least 90 % homologous to the amino acid sequence selected from the group consisting of SEQ ID NOs:201, 207, 212, 202-206, 208-211, 213-391, 1655, 961-1529, and 1660-1663.

According to an aspect of some embodiments of the present invention there is provided an isolated polypeptide, comprising an amino acid sequence selected from the group consisting of SEQ ID NOs:201, 207, 212, 202-206, 208-211, 213-391, 1655, 9611529, and 1660-1663.

According to an aspect of some embodiments of the present invention there is provided a plant cell comprising an exogenous polypeptide comprising an amino acid sequence at least 90 % homologous to the amino acid sequence selected from the group consisting of SEQ ID NOs:201, 207, 212, 202-206, 208-211, 213-391, 1655, 961-1529, and 1660-1663.

According to an aspect of some embodiments of the present invention there is provided a plant cell comprising an exogenous polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOs:201, 207, 212, 202-206, 208-211, 213-391, 1655, 961-1529, and 1660-1663.

According to an aspect of some embodiments of the present invention there is provided a plant cell comprising an exogenous polynucleotide comprising a nucleic acid sequence at least 90 % homologous to the nucleic acid sequence selected from the group consisting of SEQ ID NOs:1530, 1561, 1532, 1531, 1562, 1533, 1538, 1549, 1665, 1566, 1554, 1563, 1557, 1564, 1534, 1536, 1552, 1553, 1666, 1547, 1548, 1556, 1559, 1560, 1654, 1555, 1540, 1543, 1668, 1539, 1550, 1558, 1565, 1541, 1667, 1542, 1544, 1537, 1551, 1545, 1-200, 1653, 392-960, and 1656-1659.

According to an aspect of some embodiments of the present invention there is provided a plant cell comprising an exogenous polynucleotide comprising a nucleic acid sequence selected from the group consisting of SEQ ID NOs:1530, 1561, 1532, 1531, 1562, 1533, 1538, 1549, 1665, 1566, 1554, 1563, 1557, 1564, 1534, 1536, 1552, 1553, 1666, 1547, 1548, 1556, 1559, 1560, 1654, 1555, 1540, 1543, 1668, 1539, 1550, 1558, 1565, 1541, 1667, 1542, 1544, 1537, 1551, 1545, 1-200, 1653, 392-960, and 1656-1659.

2017228711 15 Sep 2017

According to some embodiments of the invention, the nucleic acid sequence is selected from the group consisting of SEQ ID NOs:1530, 1561, 1532, 1531, 1562, 1533, 1538, 1549, 1665, 1566, 1554, 1563, 1557, 1564, 1534, 1536, 1552, 1553, 1666, 1547,

1548, 1556, 1559, 1560, 1654, 1555, 1540, 1543, 1668, 1539, 1550, 1558, 1565, 1541, 1667, 1542, 1544, 1537, 1551, 1545, 1-200, 1653, 392-960, and 1656-1659.

According to some embodiments of the invention, the polynucleotide is selected from the group consisting of SEQ ID NOs:1530, 1561, 1532, 1531, 1562, 1533, 1538,

1549, 1665, 1566, 1554, 1563, 1557, 1564, 1534, 1536, 1552, 1553, 1666, 1547, 1548, 1556, 1559, 1560, 1654, 1555, 1540, 1543, 1668, 1539, 1550, 1558, 1565, 1541, 1667, 1542, 1544, 1537, 1551, 1545, 1-200, 1653, 392-960, and 1656-1659.

According to some embodiments of the invention, the amino acid sequence is selected from the group consisting of SEQ ID NOs:201, 207, 212, 202-206, 208-211, 213-391, 1655, 961-1529, and 1660-1663.

According to some embodiments of the invention, the polypeptide is selected from the group consisting of SEQ ID NOs:201, 207, 212, 202-206, 208-211, 213-391, 1655, 961-1529, and 1660-1663.

According to some embodiments of the invention, the plant cell forms a part of a plant.

According to some embodiments of the invention, the abiotic stress is selected from the group consisting of salinity, drought, water deprivation, low temperature, high temperature, heavy metal toxicity, anaerobiosis, nutrient deficiency, nutrient excess, atmospheric pollution and UV irradiation.

According to some embodiments of the invention, the method further comprising growing the plant expressing the exogenous polynucleotide under the abiotic stress.

Unless otherwise defined, all technical and/or scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of the invention, exemplary methods and/or materials are described below. In case of conflict, the patent specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and are not intended to be necessarily limiting.

8a

2017228711 11 Dec 2018

Definitions of the specific embodiments of the invention as claimed herein follow.

According to a first embodiment of the invention, there is provided a method of increasing biomass, growth rate, seed yield, nitrogen use efficiency and/or abiotic stress tolerance of a plant, the method comprising over-expressing within the plant a polypeptide 5 comprising an amino acid sequence at least 80 % identical to the amino acid sequence set forth in SEQ ID NO: 271, wherein when said abiotic stress is salinity stress then said tolerance to said salinity stress is an increase in said seed yield and/or an increase in said growth rate under salinity stress as compared to a native plant of the same species which is grown under the same growth LO conditions, thereby increasing the biomass, growth rate, seed yield, nitrogen use efficiency and/or abiotic stress tolerance of the plant, wherein the abiotic stress is selected from the group consisting of salinity stress and nitrogen deficiency.

According to a second embodiment of the invention, there is provided a method of L5 growing a crop comprising growing a crop plant over-expressing a polypeptide comprising an amino acid sequence at least 80 % identical to the polypeptide set forth in SEQ ID NO: 271, wherein said crop plant is derived from parent plants over-expressing said polypeptide as compared to a native plant of the same species which is grown under the same growth conditions, and which have been selected for increased biomass, growth rate, seed yield, >0 nitrogen use efficiency and/or abiotic stress tolerance of a plant, wherein the abiotic stress is selected from the group consisting of salinity stress and nitrogen deficiency, and said crop plant over-expressing said polypeptide having said increased biomass, growth rate, seed yield, nitrogen use efficiency and/or abiotic stress tolerance, wherein said tolerance to said salinity stress is an increase in said seed yield and/or an increase in said growth rate under said salinity 25 stress as compared to a native plant of the same species which is grown under the same growth conditions, thereby growing the crop.

According to a third embodiment of the invention, there is provided a method of selecting a plant having increased biomass, growth rate, seed yield, nitrogen use efficiency and/or abiotic stress tolerance, the method comprising:

(a) providing plants over-expressing a polypeptide comprising an amino acid sequence at least 80 % identical to the polypeptide set forth in SEQ ID NO: 271, (b) selecting said plants of step (a) for increased biomass, growth rate, seed yield, nitrogen use efficiency and/or abiotic stress tolerance, wherein the abiotic stress is selected from the group consisting of salinity stress and nitrogen deficiency, wherein said tolerance to

8b

2017228711 11 Dec 2018 said salinity stress is an increase in said seed yield and/or an increase in said growth rate under salinity stress as compared to a native plant of the same species which is grown under the same growth conditions, and (c) growing a crop of said plant selected in step (b), thereby selecting the plant having the increased biomass, growth rate, seed yield, nitrogen use efficiency and/or abiotic stress tolerance.

According to a fourth embodiment of the invention, there is provided a method of increasing root length, root coverage, growth rate of rosette area, growth rate of rosette diameter, and/or increased seed yield of a plant as compared to the root length, root coverage, growth rate of rosette area, growth rate of rosette diameter, and/or seed yield of a control plant of the same species which is grown under the same growth conditions, comprising:

(a) over-expressing within the plant a polypeptide comprising an amino acid sequence at least 80 % identical to the polypeptide set forth in SEQ ID NO: 271, and (b) selecting from plants resultant of step (a) a plant exhibiting an increased root length, root coverage, growth rate of rosette area, growth rate of rosette diameter, and/or seed yield as compared to a control plant of the same species which is grown under the same growth conditions, wherein when said growth conditions comprise salinity stress then said selecting is for a plant exhibiting said increased seed yield and/or said increased growth rate as compared to said control plant of the same species which is grown under the same growth conditions, thereby increasing the root length, root coverage, growth rate of rosette area, growth rate of rosette diameter, and/or seed yield of the plant as compared to the root length, root coverage, growth rate of rosette area, growth rate of rosette diameter, and/or seed yield of the control 10 plant of the same species which is grown under the same growth conditions.

According to a fifth embodiment of the invention, there is provided a method of producing a crop comprising growing a crop plant over-expressing a polypeptide comprising an amino acid sequence at least 80 % identical to the polypeptide set forth in SEQ ID NO: 271, wherein said crop plant is derived from parent plants selected for increased root length, root 15 coverage, growth rate of rosette area, growth rate of rosette diameter, and/or seed yield as compared to the root length, root coverage, growth rate of rosette area, growth rate of rosette diameter, and/or seed yield of a control plant of the same species which is grown under the same growth conditions, wherein when said growth conditions comprise salinity stress then said parent plants are selected for said increased seed yield and/or said increased growth rate as 20 compared to said control plant of the same species which is grown under the same growth

8c

2017228711 11 Dec 2018 conditions, and said crop plant having said increased root length, root coverage, growth rate of rosette area, growth rate of rosette diameter, and/or seed yield, thereby producing the crop.

According to a sixth embodiment of the invention, there is provided a method of selecting a plant having increased root length, root coverage, growth rate of rosette area, growth rate of rosette diameter, and/or seed yield as compared to a control plant of the same species which is grown under the same growth conditions, the method comprising:

(a) providing plants transformed with a nucleic acid construct comprising a polynucleotide comprising a nucleic acid sequence encoding a polypeptide, wherein said polypeptide comprises an amino acid sequence at least 80% identical to SEQ ID NO: 271, and a heterologous promoter for directing transcription of said nucleic acid sequence in a plant cell, and;

(b) selecting from said plants a plant having increased root length, root coverage, growth rate of rosette area, growth rate of rosette diameter, and/or seed yield as compared to a control plant of the same species which is grown under the same growth conditions, wherein when said growth conditions comprise salinity stress then said selecting is for a plant having said increased seed yield and/or said increased growth rate as compared to said control plant of the same species which is grown under the same growth conditions, thereby selecting the plant having increased root length, root coverage, growth rate of rosette area, growth rate of rosette diameter, and/or seed yield as compared to the control plant 5 of the same species which is grown under the same growth conditions.

[Text continues on page 9.]

2017228711 15 Sep 2017

BRIEF DESCRIPTION OF THE DRAWINGS

Some embodiments of the invention are herein described, by way of example only, with reference to the accompanying drawings. With specific reference now to the drawings in detail, it is stressed that the particulars shown are by way of example and for purposes of illustrative discussion of embodiments of the invention. In this regard, the description taken with the drawings makes apparent to those skilled in the art how embodiments of the invention may be practiced.

In the drawings:

FIG. 1 is a schematic illustration of the pGI binary plasmid used for expressing the isolated polynucleotide sequences of the invention. RB - T-DNA right border; LB T-DNA left border; H- Hind\\\ restriction enzyme; X - Xbal restriction enzyme; B BamHI restriction enzyme; S - Sall restriction enzyme; Sm - Smal restriction enzyme; R-I - EcoRI restriction enzyme; Sc - SacI/SstI/Ecll36II; (numbers) - Length in basepairs; NOS pro = nopaline synthase promoter; NPT-II = neomycin phosphotransferase gene; NOS ter = nopaline synthase terminator; Poly-A signal (polyadenylation signal); GUSintron - the GUS reporter gene (coding sequence and intron) The isolated polynucleotide sequences of the invention were cloned into the vector while replacing the GUSintron reporter gene.

FIGs. 2a-b are images depicting visualization of root development of plants grown in transparent agar plates. The different transgenes were grown in transparent agar plates for 17 days and the plates were photographed every 2 days starting at day 7. Figure 2a - An image of a photograph of plants taken following 12 days on agar plates. Figure 2b - An image of root analysis in which the length of the root measured is represented by a red arrow.

DESCRIPTION OF SPECIFIC EMBODIMENTS OF THE INVENTION

The present invention, in some embodiments thereof, relates to isolated polypeptides and polynucleotides encoding same, and more particularly, but not exclusively, to methods of using same for increasing tolerance to abiotic stress, growth rate, yield, biomass and/or vigor of a plant.

Before explaining at least one embodiment of the invention in detail, it is to be understood that the invention is not necessarily limited in its application to the details set

2017228711 15 Sep 2017 forth in the following description or exemplified by the Examples. The invention is capable of other embodiments or of being practiced or carried out in various ways.

While reducing the invention to practice, the present inventors have identified novel polypeptides and polynucleotides which can be used to increase tolerance to abiotic stress, and improve growth rate, biomass, yield and/or vigor of a plant.

Thus, as shown in the Examples section which follows, the present inventors have employed a bioinformatics approach which combines clustering and assembly of sequences from databases of the Arabidopsis, rice and other publicly available plant genomes, expressed sequence tags (ESTs), protein and pathway databases and QTL information with a digital expression profile (“electronic Northern Blot”) and identified polynucleotides and polypeptides which can increase tolerance to abiotic stress, and improve growth, biomass, yield and vigor (SEQ ID NOs: 1-200 and 1653 for polynucleotides; SEQ ID NOs:201-391 and 1655 for polypeptides; Table 1, Example 1). Putative ABST orthologs from monocot species were identified by alignments of ortholog sequences and digital expression profiles (SEQ ID NOs:392-960, 1656-1659 for polynucleotides; SEQ ID NOs:961-1529, 1660-1663 for polypeptides; Table 2, Example 1). As is further described in Tables 3 and 4 of the Examples section which follows, representative polynucleotides were cloned (polynucleotide SEQ ID NOs: 1530, 1538, 1532, 1549, 1665, 1566, 1554, 1563, 1557, 1561, 1564, 1534, 1536, 1552, 1553, 1666, 1547, 1548, 1556, 1559, 1560, 1654, 1555, 1540, 1543 and 1668). Additional polynucleotides having optimized nucleic acid sequences were prepared (polynucleotide SEQ ID NOs: 1531, 1539, 1533, 1550, 1558, 1562, 1565, 1541, 1667, 1542, 1544, 1537, 1551 and 1545). As is further described in the Examples section which follows, transgenic plants exogenously expressing the cloned and/or optimized polynucleotides of the invention were generated. As shown in Tables 5-76, these plants exhibit increased seedling weight, root coverage, root length, and relative growth rate when grown under osmotic stress (in the presence of 25 % PEG), nitrogen deficiency (in the presence of 0.75 mM Nitrogen) or regular conditions. In addition, as shown in Tables 77-188, plants exogenously expressing the polynucleotides of the invention exhibit increased rosette area, rosette diameter, leaf average area, relative growth rate of the above, plants biomass, plant seed yield, 1000 seed weight, and harvest index when grown under salinity stress or normal conditions. Altogether, these results suggest the use of the

2017228711 15 Sep 2017 novel polynucleotides and polypeptides of the invention for increasing abiotic stress tolerance, and improving growth rate biomass, vigor and/or yield of a plant.

Thus, according to one aspect of the invention, there is provided a method of increasing abiotic stress tolerance, growth rate, biomass, yield and/or vigor of a plant. The method is effected by expressing within the plant an exogenous polynucleotide encoding a polypeptide comprising an amino acid sequence at least 60 % homologous to the amino acid sequence selected from the group consisting of SEQ ID NOs:201, 207, 212, 202-206, 208-211, 213-391, 1655, 961-1529, and 1660-1663.

The phrase abiotic stress as used herein refers to any adverse effect on metabolism, growth, reproduction and/or viability of a plant. Accordingly, abiotic stress can be induced by suboptimal environmental growth conditions such as, for example, salinity, water deprivation, water deficit, drought, flooding, freezing, low or high temperature (e.g., chilling or excessive heat), toxic chemical pollution, heavy metal toxicity, anaerobiosis, nutrient deficiency, nutrient excess, atmospheric pollution or UV irradiation. The implications of abiotic stress are discussed in the Background section.

The phrase “abiotic stress tolerance” as used herein refers to the ability of a plant to endure an abiotic stress without suffering a substantial alteration in metabolism, growth, productivity and/or viability.

As used herein the phrase plant biomass refers to the amount (measured in grams of air-dry or dry tissue) of a tissue produced from the plant in a growing season, which could also determine or affect the plant yield or the yield per growing area.

As used herein the phrase plant yield refers to the amount (as determined by weight, volume or size) or quantity (numbers) of tissue produced or harvested per plant or per growing season. Hence increased yield could affect the economic benefit one can obtain from the plant in a certain growing area and/or growing time.

As used herein the phrase plant vigor refers to the amount (measured by weight) of tissue produced by the plant in a given time. Hence increase vigor could determine or affect the plant yield or the yield per growing time or growing area.

As used herein the term increasing refers to at least about 2 %, at least about 3 %, at least about 4 %, at least about 5 %, at least about 10 %, at least about 15 %, at least about 20 %, at least about 30 %, at least about 40 %, at least about 50 %, at least about 60 %, at least about 70 %, at least about 80 % or greater increase in plant abiotic stress tolerance, growth, biomass, yield and/or vigor as compared to a native plant [i.e., a plant

2017228711 15 Sep 2017 not modified with the biomolecules (polynucleotide or polypeptides) of the invention, e.g., a non-transformed plant of the same species which is grown under the same growth conditions).

As used herein, the phrase exogenous polynucleotide refers to a heterologous nucleic acid sequence which may not be naturally expressed within the plant or which overexpression in the plant is desired. The exogenous polynucleotide may be introduced into the plant in a stable or transient manner, so as to produce a ribonucleic acid (RNA) molecule and/or a polypeptide molecule. It should be noted that the exogenous polynucleotide may comprise a nucleic acid sequence which is identical or partially homologous to an endogenous nucleic acid sequence of the plant.

As mentioned, the exogenous polynucleotide of the invention encodes a polypeptide having an amino acid sequence at least about 60 %, at least about 65 %, at least about 70 %, at least about 75 %, at least about 80 %, at least about 81 %, at least about 82 %, at least about 83 %, at least about 84 %, at least about 85 %, at least about 86 %, at least about 87 %, at least about 88 %, at least about 89 %, at least about 90 %, at least about 91 %, at least about 92 %, at least about 93 %, at least about 94 %, at least about 95 %, at least about 96 %, at least about 97 %, at least about 98 %, at least about 99 %, or more say 100 % homologous to the amino acid sequence selected from the group consisting of SEQ ID NOs:201, 207, 212, 202-206, 208-211, 213-391, 1655, 9611529, and 1660-1663.

Homology (e.g., percent homology) can be determined using any homology comparison software, including for example, the BlastP or TBLASTN software of the National Center of Biotechnology Information (NCBI) such as by using default parameters, when starting from a polypeptide sequence; or the tBLASTX algorithm (available via the NCBI) such as by using default parameters, which compares the sixframe conceptual translation products of a nucleotide query sequence (both strands) against a protein sequence database.

Homologous sequences include both orthologous and paralogous sequences. The term “paralogous” relates to gene-duplications within the genome of a species leading to paralogous genes. The term “orthologous” relates to homologous genes in different organisms due to ancestral relationship.

One option to identify orthologues in monocot plant species is by performing a reciprocal blast search. This may be done by a first blast involving blasting the

2017228711 15 Sep 2017 sequence-of-interest against any sequence database, such as the publicly available NCBI database which may be found at: Hypertext Transfer Protocol://World Wide Web (dot) ncbi (dot) nlm (dot) nih (dot) gov. If orthologues in rice were sought, the sequence-ofinterest would be blasted against, for example, the 28,469 full-length cDNA clones from Oryza sativa Nipponbare available at NCBI. The blast results may be filtered. The fulllength sequences of either the filtered results or the non-filtered results are then blasted back (second blast) against the sequences of the organism from which the sequence-ofinterest is derived. The results of the first and second blasts are then compared. An orthologue is identified when the sequence resulting in the highest score (best hit) in the first blast identifies in the second blast the query sequence (the original sequence-ofinterest) as the best hit. Using the same rational a paralogue (homolog to a gene in the same organism) is found. In case of large sequence families, the ClustalW program may be used [Hypertext Transfer Protocol://World Wide Web (dot) ebi (dot) ac (dot) uk/Tools/clustalw2/index (dot) html], followed by a neighbor-joining tree (Hypertext Transfer Protocol://en (dot) wikipedia (dot) org/wiki/Neighbor-joining) which helps visualizing the clustering.

According to some embodiments of the invention, the exogenous polynucleotide encodes a polypeptide consisting of the amino acid sequence set forth by SEQ ID NO:201, 207, 212, 202-206, 208-211, 213-391, 1655, 961-1529, 1660-1662 or 1663.

According to some embodiments of the invention the exogenous polynucleotide comprises a nucleic acid sequence which is at least about 60 %, at least about 65 %, at least about 70 %, at least about 75 %, at least about 80 %, at least about 81 %, at least about 82 %, at least about 83 %, at least about 84 %, at least about 85 %, at least about 86 %, at least about 87 %, at least about 88 %, at least about 89 %, at least about 90 %, at least about 91 %, at least about 92 %, at least about 93 %, at least about 93 %, at least about 94 %, at least about 95 %, at least about 96 %, at least about 97 %, at least about 98 %, at least about 99 %, e.g., 100 % identical to the nucleic acid sequence selected from the group consisting of SEQ ID NOs:1530, 1561, 1532, 1531, 1562, 1533,1538,

1549, 1665, 1566, 1554, 1563, 1557, 1564, 1534, 1536, 1552, 1553, 1666, 1547,1548,

1556, 1559, 1560, 1654, 1555, 1540, 1543, 1668, 1539, 1550, 1558, 1565, 1541,1667,

1542, 1544, 1537, 1551, 1545, 1-200, 1653, 392-960, and 1656-1659.

2017228711 15 Sep 2017

Identity (e.g., percent homology) can be determined using any homology comparison software, including for example, the BlastN software of the National Center of Biotechnology Information (NCBI) such as by using default parameters.

According to some embodiments of the invention the exogenous polynucleotide is at least about 60 %, at least about 65 %, at least about 70 %, at least about 75 %, at least about 80 %, at least about 81 %, at least about 82 %, at least about 83 %, at least about 84 %, at least about 85 %, at least about 86 %, at least about 87 %, at least about 88 %, at least about 89 %, at least about 90 %, at least about 91 %, at least about 92 %, at least about 93 %, at least about 93 %, at least about 94 %, at least about 95 %, at least about 96 %, at least about 97 %, at least about 98 %, at least about 99 %, e.g., 100 % identical to the polynucleotide selected from the group consisting of SEQ ID NOs:1530,

1561, 1532, 1531, 1562, 1533, 1538, 1549, 1665, 1566, 1554, 1563, 1557, 1564, 1534,

1536, 1552, 1553, 1666, 1547, 1548, 1556, 1559, 1560, 1654, 1555, 1540, 1543, 1668,

1539, 1550, 1558, 1565,1541, 1667, 1542, 1544, 1537, 1551, 1545, 1-200, 1653, 392960, and 1656-1659.

According to some embodiments of the invention the exogenous polynucleotide is set forth by SEQ IDNO:1530, 1561, 1532, 1531, 1562, 1533, 1538, 1549, 1665, 1566, 1554, 1563, 1557, 1564, 1534, 1536, 1552, 1553, 1666, 1547, 1548, 1556, 1559, 1560, 1654, 1555, 1540, 1543, 1668, 1539, 1550, 1558, 1565, 1541, 1667, 1542, 1544, 1537, 1551, 1545, 1-200, 1653, 392-960, and 1656-1658 or 1659.

As used herein the term “polynucleotide” refers to a single or double stranded nucleic acid sequence which is isolated and provided in the form of an RNA sequence, a complementary polynucleotide sequence (cDNA), a genomic polynucleotide sequence and/or a composite polynucleotide sequences (e.g., a combination of the above).

As used herein the phrase complementary polynucleotide sequence refers to a sequence, which results from reverse transcription of messenger RNA using a reverse transcriptase or any other RNA dependent DNA polymerase. Such a sequence can be subsequently amplified in vivo or in vitro using a DNA dependent DNA polymerase.

As used herein the phrase genomic polynucleotide sequence refers to a sequence derived (identified or isolated) from a chromosome and thus it represents a contiguous portion of a chromosome.

As used herein the phrase composite polynucleotide sequence refers to a sequence, which is at least partially complementary and at least partially genomic. A

2017228711 15 Sep 2017 composite sequence can include some exonal sequences required to encode the polypeptide of the present invention, as well as some intronic sequences interposing therebetween. The intronic sequences can be of any source, including of other genes, and typically will include conserved splicing signal sequences. Such intronic sequences may further include cis acting expression regulatory elements.

Nucleic acid sequences encoding the polypeptides of the present invention may be optimized for expression. A non-limiting example of an optimized nucleic acid sequence is provided in SEQ ID NO: 1531, which encodes the polypeptide comprising the amino acid sequence set forth by SEQ ID NO:201. Examples of such sequence modifications include, but are not limited to, an altered G/C content to more closely approach that typically found in the plant species of interest, and the removal of codons atypically found in the plant species commonly referred to as codon optimization.

The phrase codon optimization refers to the selection of appropriate DNA nucleotides for use within a structural gene or fragment thereof that approaches codon usage within the plant of interest. Therefore, an optimized gene or nucleic acid sequence refers to a gene in which the nucleotide sequence of a native or naturally occurring gene has been modified in order to utilize statistically-preferred or statistically-favored codons within the plant. The nucleotide sequence typically is examined at the DNA level and the coding region optimized for expression in the plant species determined using any suitable procedure, for example as described in Sardana et al. (1996, Plant Cell Reports 15:677-681). In this method, the standard deviation of codon usage, a measure of codon usage bias, may be calculated by first finding the squared proportional deviation of usage of each codon of the native gene relative to that of highly expressed plant genes, followed by a calculation of the average squared deviation. The formula used is: 1 SDCU = n = 1 N [ ( Xn - Yn)/Yn] 2/N, where Xn refers to the frequency of usage of codon n in highly expressed plant genes, where Yn to the frequency of usage of codon n in the gene of interest and N refers to the total number of codons in the gene of interest. A Table of codon usage from highly expressed genes of dicotyledonous plants is compiled using the data of Murray et al. (1989, Nuc Acids Res. 17:477-498).

One method of optimizing the nucleic acid sequence in accordance with the preferred codon usage for a particular plant cell type is based on the direct use, without performing any extra statistical calculations, of codon optimization Tables such as those provided on-line at the Codon Usage Database through the NIAS (National Institute of

2017228711 15 Sep 2017

Agrobiological Sciences) DNA bank in Japan (Hypertext Transfer Protocol://World Wide Web (dot) kazusa (dot) or (dot) jp/codon/). The Codon Usage Database contains codon usage Tables for a number of different species, with each codon usage Table having been statistically determined based on the data present in Genbank.

By using the above Tables to determine the most preferred or most favored codons for each amino acid in a particular species (for example, rice), a naturallyoccurring nucleotide sequence encoding a protein of interest can be codon optimized for that particular plant species. This is effected by replacing codons that may have a low statistical incidence in the particular species genome with corresponding codons, in regard to an amino acid, that are statistically more favored. However, one or more lessfavored codons may be selected to delete existing restriction sites, to create new ones at potentially useful junctions (5' and 3' ends to add signal peptide or termination cassettes, internal sites that might be used to cut and splice segments together to produce a correct full-length sequence), or to eliminate nucleotide sequences that may negatively effect mRNA stability or expression.

The naturally-occurring encoding nucleotide sequence may already, in advance of any modification, contain a number of codons that correspond to a statisticallyfavored codon in a particular plant species. Therefore, codon optimization of the native nucleotide sequence may comprise determining which codons, within the native nucleotide sequence, are not statistically-favored with regards to a particular plant, and modifying these codons in accordance with a codon usage table of the particular plant to produce a codon optimized derivative. A modified nucleotide sequence may be fully or partially optimized for plant codon usage provided that the protein encoded by the modified nucleotide sequence is produced at a level higher than the protein encoded by the corresponding naturally occurring or native gene. Construction of synthetic genes by altering the codon usage is described in for example PCT Patent Application 93/07278.

Thus, the invention encompasses nucleic acid sequences described hereinabove; fragments thereof, sequences hybridizable therewith, sequences homologous thereto, sequences encoding similar polypeptides with different codon usage, altered sequences characterized by mutations, such as deletion, insertion or substitution of one or more nucleotides, either naturally occurring or man induced, either randomly or in a targeted fashion.

2017228711 15 Sep 2017

The invention provides an isolated polypeptide having an amino acid sequence at least about 60 %, at least about 65 %, at least about 70 %, at least about 75 %, at least about 80 %, at least about 81 %, at least about 82 %, at least about 83 %, at least about 84 %, at least about 85 %, at least about 86 %, at least about 87 %, at least about 88 %, at least about 89 %, at least about 90 %, at least about 91 %, at least about 92 %, at least about 93 %, at least about 93 %, at least about 94 %, at least about 95 %, at least about 96 %, at least about 97 %, at least about 98 %, at least about 99 %, or more say 100 % homologous to an amino acid sequence selected from the group consisting of SEQ ID NO:201, 207, 212, 202-206, 208-211, 213-391, 1655, 961-1529, and 1660-1663.

According to some embodiments of the invention, the polypeptide is set forth by SEQ ID NO:201, 207, 212, 202-206, 208-211, 213-391, 1655, 961-1529, and 1660-1662 or 1663.

The invention also encompasses fragments of the above described polypeptides and polypeptides having mutations, such as deletions, insertions or substitutions of one or more amino acids, either naturally occurring or man induced, either randomly or in a targeted fashion.

The term 'plant as used herein encompasses whole plants, ancestors and progeny of the plants and plant parts, including seeds, shoots, stems, roots (including tubers), and plant cells, tissues and organs. The plant may be in any form including suspension cultures, embryos, meristematic regions, callus tissue, leaves, gametophytes, sporophytes, pollen, and microspores. Plants that are particularly useful in the methods of the invention include all plants which belong to the superfamily Viridiplantae, in particular monocotyledonous and dicotyledonous plants including a fodder or forage legume, ornamental plant, food crop, tree, or shrub selected from the list comprising Acacia spp., Acer spp., Actinidia spp., Aesculus spp., Agathis australis, Albizia amara, Alsophila tricolor, Andropogon spp., Arachis spp, Areca catechu, Astelia fragrans, Astragalus cicer, Baikiaea plurijuga, Betula spp., Brassica spp., Bruguiera gymnorrhiza, Burkea africana, Butea frondosa, Cadaba farinosa, Calliandra spp, Camellia sinensis, Canna indica, Capsicum spp., Cassia spp., Centroema pubescens, Chacoomeles spp., Cinnamomum cassia, Coffea arabica, Colophospermum mopane, Coronillia varia, Cotoneaster serotina, Crataegus spp., Cucumis spp., Cupressus spp., Cyathea dealbata, Cydonia oblonga, Cryptomeria japonica, Cymbopogon spp., Cynthea dealbata, Cydonia oblonga, Dalbergia monetaria, Davallia divaricata, Desmodium spp., Dicksonia

2017228711 15 Sep 2017 squarosa, Dibeteropogon amplectens, Dioclea spp, Dolichos spp., Dorycnium rectum, Echinochloa pyramidalis, Ehraffia spp., Eleusine coracana, Eragrestis spp., Erythrina spp., Eucalyptus spp., Euclea schimperi, Eulalia vi/losa, Pagopyrum spp., Feijoa sellowlana, Fragaria spp., Flemingia spp, Freycinetia banksli, Geranium thunbergii, GinAgo biloba, Glycine javanica, Gliricidia spp, Gossypium hirsutum, Grevillea spp., Guibourtia coleosperma, Hedysarum spp., Hemaffhia altissima, Heteropogon contoffus, Hordeum vulgare, Hyparrhenia rufa, Hypericum erectum, Hypeffhelia dissolute, Indigo incamata, Iris spp., Leptarrhena pyrolifolia, Lespediza spp., Lettuca spp., Leucaena leucocephala, Loudetia simplex, Lotonus bainesli, Lotus spp., Macrotyloma axillare, Malus spp., Manihot esculenta, Medicago saliva, Metasequoia glyptostroboides, Musa sapientum, Nicotianum spp., Onobrychis spp., Ornithopus spp., Oryza spp., Peltophorum africanum, Pennisetum spp., Persea gratissima, Petunia spp., Phaseolus spp., Phoenix canariensis, Phormium cookianum, Photinia spp., Picea glauca, Pinus spp., Pisum sativam, Podocarpus totara, Pogonarthria fleckii, Pogonaffhria squarrosa, Populus spp., Prosopis cineraria, Pseudotsuga menziesii, Pterolobium stellatum, Pyrus communis, Quercus spp., Rhaphiolepsis umbellata, Rhopalostylis sapida, Rhus natalensis, Ribes grossularia, Ribes spp., Robinia pseudoacacia, Rosa spp., Rubus spp., Salix spp., Schyzachyrium sanguineum, Sciadopitys vefficillata, Sequoia sempervirens, Sequoiadendron giganteum, Sorghum bicolor, Spinacia spp., Sporobolus fimbriatus, Stiburus alopecuroides, Stylosanthos humilis, Tadehagi spp, Taxodium distichum, Themeda triandra, Trifolium spp., Triticum spp., Tsuga heterophylla, Vaccinium spp., Vicia spp., Vitis vinifera, Watsonia pyramidata, Zantedeschia aethiopica, Zea mays, amaranth, artichoke, asparagus, broccoli, Brussels sprouts, cabbage, canola, carrot, cauliflower, celery, collard greens, flax, kale, lentil, oilseed rape, okra, onion, potato, rice, soybean, straw, sugar beet, sugar cane, sunflower, tomato, squash tea, maize, wheat, barely, rye, oat, peanut, pea, lentil and alfalfa, cotton, rapeseed, canola, pepper, sunflower, tobacco, eggplant, eucalyptus, a tree, an ornamental plant, a perennial grass and a forage crop. Alternatively algae and other non-Viridiplantae can be used for the methods of the present invention.

According to some embodiments of the invention, the plant used by the method of the invention is a crop plant such as rice, maize, wheat, barley, peanut, potato, sesame, olive tree, palm oil, banana, soybean, sunflower, canola, sugarcane, alfalfa, millet, leguminosae (bean, pea), flax, lupinus, rapeseed, tobacco, popular and cotton.

2017228711 15 Sep 2017

Expressing the exogenous polynucleotide of the invention within the plant can be effected by transforming one or more cells of the plant with the exogenous polynucleotide, followed by generating a mature plant from the transformed cells and cultivating the mature plant under conditions suitable for expressing the exogenous polynucleotide within the mature plant.

According to some embodiments of the invention, the transformation is effected by introducing to the plant cell a nucleic acid construct which includes the exogenous polynucleotide of some embodiments of the invention and at least one promoter capable of directing transcription of the exogenous polynucleotide in the plant cell. Further details of suitable transformation approaches are provided hereinbelow.

As used herein, the term “promoter” refers to a region of DNA which lies upstream of the transcriptional initiation site of a gene to which RNA polymerase binds to initiate transcription of RNA. The promoter controls where (e.g., which portion of a plant) and/or when (e.g., at which stage or condition in the lifetime of an organism) the gene is expressed.

Any suitable promoter sequence can be used by the nucleic acid construct of the present invention. According to some embodiments of the invention, the promoter is a constitutive promoter, a tissue-specific, or an abiotic stress-inducible promoter.

Suitable constitutive promoters include, for example, CaMV 35S promoter (SEQ ID NO:1546; Odell et al., Nature 313:810-812, 1985); Arabidopsis At6669 promoter (SEQ ID NO:1652; see PCT Publication No. W004081173A2); maize Ubi 1 (Christensen et al., Plant Sol. Biol. 18:675-689, 1992); rice actin (McElroy et al., Plant Cell 2:163-171, 1990); pEMU (Last et al., Theor. Appl. Genet. 81:581-588, 1991); CaMV 19S (Nilsson et al., Physiol. Plant 100:456-462, 1997); GOS2 (de Pater et al., Plant I Nov;2(6):837-44, 1992); ubiquitin (Christensen et al., Plant Mol. Biol. 18: 675689, 1992); Rice cyclophilin (Bucholz et al., Plant Mol Biol. 25(5):837-43, 1994); Maize H3 histone (Lepetit et al., Mol. Gen. Genet. 231: 276-285, 1992); Actin 2 (An et al., Plant I. 10( 1); 107-121, 1996), constitutive root tip CT2 promoter (SEQ ID NO:1535; see also PCT application No. IL/2005/000627) and Synthetic Super MAS (Ni et al., The Plant lournal 7: 661-76, 1995). Other constitutive promoters include those in U.S. Pat. Nos. 5,659,026, 5,608,149; 5.608,144; 5,604,121; 5.569,597: 5.466,785; 5,399,680; 5,268,463; and 5,608,142.

2017228711 15 Sep 2017

Suitable tissue-specific promoters include, but not limited to, leaf-specific promoters [such as described, for example, by Yamamoto et al., Plant J. 12:255-265, 1997; Kwon et al., Plant Physiol. 105:357-67, 1994; Yamamoto et al., Plant Cell Physiol. 35:773-778, 1994; Gotor et al., Plant J. 3:509-18, 1993; Orozco et al., Plant Mol. Biol. 23:1129-1138, 1993; and Matsuoka et al., Proc. Natl. Acad. Sei. USA 90:9586-9590, 1993], seed-preferred promoters [e.g., from seed specific genes (Simon, et al., Plant Mol. Biol. 5. 191, 1985; Scofield, et al., J. Biol. Chem. 262: 12202, 1987; Baszczynski, et al., Plant Mol. Biol. 14: 633, 1990), Brazil Nut albumin (Pearson' et al., Plant Mol. Biol. 18: 235- 245, 1992), legumin (Ellis, et al. Plant Mol. Biol. 10: 203-214, 1988), Glutelin (rice) (Takaiwa, et al., Mol. Gen. Genet. 208: 15-22, 1986; Takaiwa, et al., FEBS Letts. 221: 43-47, 1987), Zein (Matzke et al., Plant Mol Biol, 143).323-32 1990), napA (Stalberg, et al., Planta 199: 515-519, 1996), Wheat SPA (Albanietal, Plant Cell, 9: 171- 184, 1997), sunflower oleosin (Cummins, etal., Plant Mol. Biol. 19: 873876, 1992)], endosperm specific promoters [e.g., wheat LMW and HMW, glutenin-1 (Mol Gen Genet 216:81-90, 1989; NAR 17:461-2), wheat a, b and g gliadins (EMBO3:1409-15, 1984), Barley ltrl promoter, barley Bl, C, D hordein (Theor Appl Gen 98:1253-62, 1999; Plant J 4:343-55, 1993; Mol Gen Genet 250:750- 60, 1996), Barley DOF (Mena et al., The Plant Journal, 116(1): 53- 62, 1998), Biz2 (EP99106056.7), Synthetic promoter (Vicente-Carbajosa et al., Plant J. 13: 629-640, 1998), rice prolamin NRP33, rice -globulin Glb-1 (Wu et al., Plant Cell Physiology 39(8) 885- 889, 1998), rice alpha-globulin REB/OHP-1 (Nakase et al. Plant Mol. Biol. 33: 513-S22, 1997), rice ADP-glucose PP (Trans Res 6:157-68, 1997), maize ESR gene family (Plant J 12:235-46, 1997), sorgum gamma- kafirin (PMB 32:1029-35, 1996)], embryo specific promoters [e.g., rice OSHI (Sato et al., Proc. Nati. Acad. Sei. USA, 93: 8117-8122), KNOX (Postma-Haarsma ef al, Plant Mol. Biol. 39:257-71, 1999), rice oleosin (Wu et at, J. Biochem., 123:386, 1998)], and flower-specific promoters [e.g., AtPRP4, chalene synthase (chsA) (Van der Meer, et al., Plant Mol. Biol. 15, 95109, 1990), LAT52 (Twell et al., Mol. Gen Genet. 217:240-245; 1989), apetala- 3].

Suitable abiotic stress-inducible promoters include, but not limited to, saltinducible promoters such as RD29A (Yamaguchi-Shinozalei et al., Mol. Gen. Genet. 236:331-340, 1993); drought-inducible promoters such as maize rabl7 gene promoter (Pla et. al., Plant Mol. Biol. 21:259-266, 1993), maize rab28 gene promoter (Busk et. al., Plant J. 11:1285-1295, 1997) and maize Ivr2 gene promoter (Pelleschi et. al., Plant Mol.

2017228711 15 Sep 2017

Biol. 39:373-380, 1999); heat-inducible promoters such as heat tomato hsp80-promoter from tomato (U.S. Pat. No. 5,187,267).

The nucleic acid construct of some embodiments of the invention can further include an appropriate selectable marker and/or an origin of replication. According to some embodiments of the invention, the nucleic acid construct utilized is a shuttle vector, which can propagate both in E. coli (wherein the construct comprises an appropriate selectable marker and origin of replication) and be compatible with propagation in cells. The construct according to the present invention can be, for example, a plasmid, a bacmid, a phagemid, a cosmid, a phage, a virus or an artificial chromosome.

The nucleic acid construct of some embodiments of the invention can be utilized to stably or transiently transform plant cells. In stable transformation, the exogenous polynucleotide is integrated into the plant genome and as such it represents a stable and inherited trait. In transient transformation, the exogenous polynucleotide is expressed by the cell transformed but it is not integrated into the genome and as such it represents a transient trait.

There are various methods of introducing foreign genes into both monocotyledonous and dicotyledonous plants (Potrykus, I., Annu. Rev. Plant. Physiol., Plant. Mol. Biol. (1991) 42:205-225; Shimamoto et al., Nature (1989) 338:274-276).

The principle methods of causing stable integration of exogenous DNA into plant genomic DNA include two main approaches:

(i) Agrobacterium-mediated gene transfer: Klee et al. (1987) Annu. Rev. Plant Physiol. 38:467-486; Klee and Rogers in Cell Culture and Somatic Cell Genetics of Plants, Vol. 6, Molecular Biology of Plant Nuclear Genes, eds. Schell, J., and Vasil, L. K., Academic Publishers, San Diego, Calif. (1989) p. 2-25; Gatenby, in Plant Biotechnology, eds. Kung, S. and Amtzen, C. J., Butterworth Publishers, Boston, Mass. (1989) p. 93-112.

(ii) Direct DNA uptake: Paszkowski et al., in Cell Culture and Somatic Cell Genetics of Plants, Vol. 6, Molecular Biology of Plant Nuclear Genes eds. Schell, J., and Vasil, L. K., Academic Publishers, San Diego, Calif. (1989) p. 52-68; including methods for direct uptake of DNA into protoplasts, Toriyama, K. et al. (1988) Bio/Technology 6:1072-1074. DNA uptake induced by brief electric shock of plant

2017228711 15 Sep 2017 cells: Zhang et al. Plant Cell Rep. (1988) 7:379-384. Fromm et al. Nature (1986) 319:791-793. DNA injection into plant cells or tissues by particle bombardment, Klein et al. Bio/Technology (1988) 6:559-563; McCabe et al. Bio/Technology (1988) 6:923926; Sanford, Physiol. Plant. (1990) 79:206-209; by the use of micropipette systems: Neuhaus et al., Theor. Appl. Genet. (1987) 75:30-36; Neuhaus and Spangenberg, Physiol. Plant. (1990) 79:213-217; glass fibers or silicon carbide whisker transformation of cell cultures, embryos or callus tissue, U.S. Pat. No. 5,464,765 or by the direct incubation of DNA with germinating pollen, DeWet et al. in Experimental Manipulation of Ovule Tissue, eds. Chapman, G. P. and Mantell, S. H. and Daniels, W. Longman, London, (1985) p. 197-209; and Ohta, Proc. Natl. Acad. Sci. USA (1986) 83:715-719.

The Agrobacterium system includes the use of plasmid vectors that contain defined DNA segments that integrate into the plant genomic DNA. Methods of inoculation of the plant tissue vary depending upon the plant species and the Agrobacterium delivery system. A widely used approach is the leaf disc procedure which can be performed with any tissue explant that provides a good source for initiation of whole plant differentiation. See, e.g., Horsch et al. in Plant Molecular Biology Manual A5, Kluwer Academic Publishers, Dordrecht (1988) p. 1-9. A supplementary approach employs the Agrobacterium delivery system in combination with vacuum infiltration. The Agrobacterium system is especially viable in the creation of transgenic dicotyledonous plants.

There are various methods of direct DNA transfer into plant cells. In electroporation, the protoplasts are briefly exposed to a strong electric field. In micro injection, the DNA is mechanically injected directly into the cells using very small micropipettes. In microparticle bombardment, the DNA is adsorbed on microprojectiles such as magnesium sulfate crystals or tungsten particles, and the microprojectiles are physically accelerated into cells or plant tissues.

Following stable transformation plant propagation is exercised. The most common method of plant propagation is by seed. Regeneration by seed propagation, however, has the deficiency that due to heterozygosity there is a lack of uniformity in the crop, since seeds are produced by plants according to the genetic variances governed by Mendelian rules. Basically, each seed is genetically different and each will grow with its own specific traits. Therefore, it is preferred that the transformed plant be produced

2017228711 15 Sep 2017 such that the regenerated plant has the identical traits and characteristics of the parent transgenic plant. For this reason it is preferred that the transformed plant be regenerated by micropropagation which provides a rapid, consistent reproduction of the transformed plants.

Micropropagation is a process of growing new generation plants from a single piece of tissue that has been excised from a selected parent plant or cultivar. This process permits the mass reproduction of plants having the preferred tissue expressing the fusion protein. The new generation plants which are produced are genetically identical to, and have all of the characteristics of, the original plant. Micropropagation allows mass production of quality plant material in a short period of time and offers a rapid multiplication of selected cultivars in the preservation of the characteristics of the original transgenic or transformed plant. The advantages of cloning plants are the speed of plant multiplication and the quality and uniformity of plants produced.

Micropropagation is a multi-stage procedure that requires alteration of culture medium or growth conditions between stages. Thus, the micropropagation process involves four basic stages: Stage one, initial tissue culturing; stage two, tissue culture multiplication; stage three, differentiation and plant formation; and stage four, greenhouse culturing and hardening. During stage one, initial tissue culturing, the tissue culture is established and certified contaminant-free. During stage two, the initial tissue culture is multiplied until a sufficient number of tissue samples are produced to meet production goals. During stage three, the tissue samples grown in stage two are divided and grown into individual plantlets. At stage four, the transformed plantlets are transferred to a greenhouse for hardening where the plants' tolerance to light is gradually increased so that it can be grown in the natural environment.

According to some embodiments of the invention, the transgenic plants are generated by transient transformation of leaf cells, meristematic cells or the whole plant.

Transient transformation can be effected by any of the direct DNA transfer methods described above or by viral infection using modified plant viruses.

Viruses that have been shown to be useful for the transformation of plant hosts include CaMV, Tobacco mosaic virus (TMV), brome mosaic virus (BMV) and Bean Common Mosaic Virus (BV or BCMV). Transformation of plants using plant viruses is described in U.S. Pat. No. 4,855,237 (bean golden mosaic virus; BGV), EP-A 67,553 (TMV), Japanese Published Application No. 63-14693 (TMV), EPA 194,809 (BV),

2017228711 15 Sep 2017

EPA 278,667 (BV); and Gluzman, Y. et al., Communications in Molecular Biology: Viral Vectors, Cold Spring Harbor Laboratory, New York, pp. 172-189 (1988). Pseudovirus particles for use in expressing foreign DNA in many hosts, including plants are described in WO 87/06261.

According to some embodiments of the invention, the virus used for transient transformations is avirulent and thus is incapable of causing severe symptoms such as reduced growth rate, mosaic, ring spots, leaf roll, yellowing, streaking, pox formation, tumor formation and pitting. A suitable avirulent virus may be a naturally occurring avirulent virus or an artificially attenuated virus. Virus attenuation may be effected by using methods well known in the art including, but not limited to, sub-lethal heating, chemical treatment or by directed mutagenesis techniques such as described, for example, by Kurihara and Watanabe (Molecular Plant Pathology 4:259-269, 2003), Galon et al. (1992), Atreya et al. (1992) and Huet et al. (1994).

Suitable virus strains can be obtained from available sources such as, for example, the American Type culture Collection (ATCC) or by isolation from infected plants. Isolation of viruses from infected plant tissues can be effected by techniques well known in the art such as described, for example by Foster and Tailor, Eds. “Plant Virology Protocols: From Virus Isolation to Transgenic Resistance (Methods in Molecular Biology (Humana Pr), Vol 81)”, Humana Press, 1998. Briefly, tissues of an infected plant believed to contain a high concentration of a suitable virus, preferably young leaves and flower petals, are ground in a buffer solution (e.g., phosphate buffer solution) to produce a virus infected sap which can be used in subsequent inoculations.

Construction of plant RNA viruses for the introduction and expression of nonviral exogenous polynucleotide sequences in plants is demonstrated by the above references as well as by Dawson, W. O. et al., Virology (1989) 172:285-292; Takamatsu et al. EMBO J. (1987) 6:307-311; French et al. Science (1986) 231:1294-1297; Takamatsu et al. FEBS Letters (1990) 269:73-76; and U.S. Pat. No. 5,316,931.

When the virus is a DNA virus, suitable modifications can be made to the virus itself. Alternatively, the virus can first be cloned into a bacterial plasmid for ease of constructing the desired viral vector with the foreign DNA. The virus can then be excised from the plasmid. If the virus is a DNA virus, a bacterial origin of replication can be attached to the viral DNA, which is then replicated by the bacteria. Transcription and translation of this DNA will produce the coat protein which will encapsidate the

2017228711 15 Sep 2017 viral DNA. If the virus is an RNA virus, the virus is generally cloned as a cDNA and inserted into a plasmid. The plasmid is then used to make all of the constructions. The

RNA virus is then produced by transcribing the viral sequence of the plasmid and translation of the viral genes to produce the coat protein(s) which encapsidate the viral

RNA.

In one embodiment, a plant viral polynucleotide is provided in which the native coat protein coding sequence has been deleted from a viral polynucleotide, a non-native plant viral coat protein coding sequence and a non-native promoter, preferably the subgenomic promoter of the non-native coat protein coding sequence, capable of expression in the plant host, packaging of the recombinant plant viral polynucleotide, and ensuring a systemic infection of the host by the recombinant plant viral polynucleotide, has been inserted. Alternatively, the coat protein gene may be inactivated by insertion of the non-native polynucleotide sequence within it, such that a protein is produced. The recombinant plant viral polynucleotide may contain one or more additional non-native subgenomic promoters. Each non-native subgenomic promoter is capable of transcribing or expressing adjacent genes or polynucleotide sequences in the plant host and incapable of recombination with each other and with native subgenomic promoters. Non-native (foreign) polynucleotide sequences may be inserted adjacent the native plant viral subgenomic promoter or the native and a nonnative plant viral subgenomic promoters if more than one polynucleotide sequence is included. The non-native polynucleotide sequences are transcribed or expressed in the host plant under control of the subgenomic promoter to produce the desired products.

In a second embodiment, a recombinant plant viral polynucleotide is provided as in the first embodiment except that the native coat protein coding sequence is placed adjacent one of the non-native coat protein subgenomic promoters instead of a nonnative coat protein coding sequence.

In a third embodiment, a recombinant plant viral polynucleotide is provided in which the native coat protein gene is adjacent its subgenomic promoter and one or more non-native subgenomic promoters have been inserted into the viral polynucleotide. The inserted non-native subgenomic promoters are capable of transcribing or expressing adjacent genes in a plant host and are incapable of recombination with each other and with native subgenomic promoters. Non-native polynucleotide sequences may be inserted adjacent the non-native subgenomic plant viral promoters such that the

2017228711 15 Sep 2017 sequences are transcribed or expressed in the host plant under control of the subgenomic promoters to produce the desired product.

In a fourth embodiment, a recombinant plant viral polynucleotide is provided as in the third embodiment except that the native coat protein coding sequence is replaced by a non-native coat protein coding sequence.

The viral vectors are encapsidated by the coat proteins encoded by the recombinant plant viral polynucleotide to produce a recombinant plant virus. The recombinant plant viral polynucleotide or recombinant plant virus is used to infect appropriate host plants. The recombinant plant viral polynucleotide is capable of replication in the host, systemic spread in the host, and transcription or expression of foreign gene(s) (exogenous polynucleotide) in the host to produce the desired protein.

Techniques for inoculation of viruses to plants may be found in Foster and Taylor, eds. “Plant Virology Protocols: From Virus Isolation to Transgenic Resistance (Methods in Molecular Biology (Humana Pr), Vol 81)”, Humana Press, 1998; Maramorosh and Koprowski, eds. “Methods in Virology” 7 vols, Academic Press, New York 1967-1984; Hill, S.A. “Methods in Plant Virology”, Blackwell, Oxford, 1984; Walkey, D.G.A. “Applied Plant Virology”, Wiley, New York, 1985; and Kado and Agrawa, eds. “Principles and Techniques in Plant Virology”, Van Nostrand-Reinhold, New York.

In addition to the above, the polynucleotide of the present invention can also be introduced into a chloroplast genome thereby enabling chloroplast expression.

A technique for introducing exogenous polynucleotide sequences to the genome of the chloroplasts is known. This technique involves the following procedures. First, plant cells are chemically treated so as to reduce the number of chloroplasts per cell to about one. Then, the exogenous polynucleotide is introduced via particle bombardment into the cells with the aim of introducing at least one exogenous polynucleotide molecule into the chloroplasts. The exogenous polynucleotide is selected such that it is integratable into the chloroplast's genome via homologous recombination which is readily effected by enzymes inherent to the chloroplast. To this end, the exogenous polynucleotide includes, in addition to a gene of interest, at least one polynucleotide stretch which is derived from the chloroplast's genome. In addition, the exogenous polynucleotide includes a selectable marker, which serves by sequential selection procedures to ascertain that all or substantially all of the copies of the chloroplast

2017228711 15 Sep 2017 genomes following such selection will include the exogenous polynucleotide. Further details relating to this technique are found in U.S. Pat. Nos. 4,945,050; and 5,693,507 which are incorporated herein by reference. A polypeptide can thus be produced by the protein expression system of the chloroplast and become integrated into the chloroplast's inner membrane.

Since abiotic stress tolerance, growth, biomass, yield and/or vigor in plants can involve multiple genes acting additively or in synergy (see, for example, in Quesda et al., Plant Physiol. 130:951-063, 2002), the present invention also envisages expressing a plurality of exogenous polynucleotides in a single host plant to thereby achieve superior effect on abiotic stress tolerance, growth, biomass, yield and/or vigor.

Expressing a plurality of exogenous polynucleotides in a single host plant can be effected by co-introducing multiple nucleic acid constructs, each including a different exogenous polynucleotide, into a single plant cell. The transformed cell can then be regenerated into a mature plant using the methods described hereinabove.

Alternatively, expressing a plurality of exogenous polynucleotides in a single host plant can be effected by co-introducing into a single plant-cell a single nucleic-acid construct including a plurality of different exogenous polynucleotides. Such a construct can be designed with a single promoter sequence which can transcribe a polycistronic messenger RNA including all the different exogenous polynucleotide sequences. To enable co-translation of the different polypeptides encoded by the polycistronic messager RNA, the polynucleotide sequences can be inter-linked via an internal ribosome entry site (IRES) sequence which facilitates translation of polynucleotide sequences positioned downstream of the IRES sequence. In this case, a transcribed polycistronic RNA molecule encoding the different polypeptides described above will be translated from both the capped 5' end and the two internal IRES sequences of the polycistronic RNA molecule to thereby produce in the cell all different polypeptides. Alternatively, the construct can include several promoter sequences each linked to a different exogenous polynucleotide sequence.

The plant cell transformed with the construct including a plurality of different exogenous polynucleotides can be regenerated into a mature plant, using the methods described hereinabove.

Alternatively, expressing a plurality of exogenous polynucleotides can be effected by introducing different nucleic acid constructs, including different exogenous

2017228711 15 Sep 2017 polynucleotides, into a plurality of plants. The regenerated transformed plants can then be cross-bred and resultant progeny selected for superior abiotic stress tolerance, growth, biomass, yield and/or vigor traits, using conventional plant breeding techniques.

According to some embodiments of the invention, the plant expressing the exogenous polynucleotide(s) is grown under normal conditions.

According to some embodiments of the invention, the method further comprising growing the plant expressing the exogenous polynucleotide(s) under the abiotic stress.

Thus, the invention encompasses plants exogenously expressing (as described above) the polynucleotide(s) and/or polypeptide(s) of the invention. Once expressed within the plant cell or the entire plant, the level of the polypeptide encoded by the exogenous polynucleotide can be determined by methods well known in the art such as, activity assays, Western blots using antibodies capable of specifically binding the polypeptide, Enzyme-Linked ImmunoSorbent Assay (ELISA), radio-immuno-assays (RIA), immunohistochemistry, immunocytochemistry, immunofluorescence and the like.

Methods of determining the level in the plant of the RNA transcribed from the exogenous polynucleotide are well known in the art and include, for example, Northern blot analysis, reverse transcription polymerase chain reaction (RT-PCR) analysis (including quantitative, semi-quantitative or real-time RT-PCR) and RNA-m situ hybridization.

The polynucleotides and polypeptides described hereinabove can be used in a wide range of economical plants, in a safe and cost effective manner.

The effect of the transgene (the exogenous polynucleotide encoding the polypeptide) on abiotic stress tolerance, growth, biomass, yield and/or vigor can be determined using known methods.

Abiotic stress tolerance - Transformed (i.e., expressing the transgene) and nontransformed (wild type) plants are exposed to an abiotic stress condition, such as water deprivation, suboptimal temperature (low temperature, high temperature), nutrient deficiency, nutrient excess, a salt stress condition, osmotic stress, heavy metal toxicity, anaerobiosis, atmospheric pollution and UV irradiation.

Salinity tolerance assay — Transgenic plants with tolerance to high salt concentrations are expected to exhibit better germination, seedling vigor or growth in high salt. Salt stress can be effected in many ways such as, for example, by irrigating

2017228711 15 Sep 2017 the plants with a hyperosmotic solution, by cultivating the plants hydroponically in a hyperosmotic growth solution (e.g., Hoagland solution with added salt), or by culturing the plants in a hyperosmotic growth medium [e.g., 50 % Murashige-Skoog medium (MS medium) with added salt]. Since different plants vary considerably in their tolerance to salinity, the salt concentration in the irrigation water, growth solution, or growth medium can be adjusted according to the specific characteristics of the specific plant cultivar or variety, so as to inflict a mild or moderate effect on the physiology and/or morphology of the plants (for guidelines as to appropriate concentration see, Bernstein and Kafkafi, Root Growth Under Salinity Stress In: Plant Roots, The Hidden Half 3rd ed. Waisel Y, Eshel A and Kafkafi U. (editors) Marcel Dekker Inc., New York, 2002, and reference therein).

For example, a salinity tolerance test can be performed by irrigating plants at different developmental stages with increasing concentrations of sodium chloride (for example 50 mM, 100 mM, 200 mM, 400 mM NaCl) applied from the bottom and from above to ensure even dispersal of salt. Following exposure to the stress condition the plants are frequently monitored until substantial physiological and/or morphological effects appear in wild type plants. Thus, the external phenotypic appearance, degree of wilting and overall success to reach maturity and yield progeny are compared between control and transgenic plants. Quantitative parameters of tolerance measured include, but are not limited to, the average wet and dry weight, growth rate, leaf size, leaf coverage (overall leaf area), the weight of the seeds yielded, the average seed size and the number of seeds produced per plant. Transformed plants not exhibiting substantial physiological and/or morphological effects, or exhibiting higher biomass than wild-type plants, are identified as abiotic stress tolerant plants.

Osmotic tolerance test - Osmotic stress assays (including sodium chloride and PEG assays) are conducted to determine if an osmotic stress phenotype was sodium chloride-specific or if it was a general osmotic stress related phenotype. Plants which are tolerant to osmotic stress may have more tolerance to drought and/or freezing. For salt and osmotic stress experiments, the medium is supplemented for example with 50 mM, 100 mM, 200 mM NaCl or 15 %, 20 % or 25 % PEG. See also Examples 6 and 7 of the Examples section which follows.

Drought tolerance assay/Osmoticum assay - Tolerance to drought is performed to identify the genes conferring better plant survival after acute water deprivation. To

2017228711 15 Sep 2017 analyze whether the transgenic plants are more tolerant to drought, an osmotic stress produced by the non-ionic osmolyte sorbitol in the medium can be performed. Control and transgenic plants are germinated and grown in plant-agar plates for 4 days, after which they are transferred to plates containing 500 mM sorbitol. The treatment causes growth retardation, then both control and transgenic plants are compared, by measuring plant weight (wet and dry), yield, and by growth rates measured as time to flowering.

Conversely, soil-based drought screens are performed with plants overexpressing the polynucleotides detailed above. Seeds from control Arabidopsis plants, or other transgenic plants overexpressing the polypeptide of the invention are germinated and transferred to pots. Drought stress is obtained after irrigation is ceased accompanied by placing the pots on absorbent paper to enhance the soil-drying rate. Transgenic and control plants are compared to each other when the majority of the control plants develop severe wilting. Plants are re-watered after obtaining a significant fraction of the control plants displaying a severe wilting. Plants are ranked comparing to controls for each of two criteria: tolerance to the drought conditions and recovery (survival) following re-watering.

Cold stress tolerance - One way to analyze cold stress is as follows. Mature (25 day old) plants are transferred to 4 °C chambers for 1 or 2 weeks, with constitutive light. Later on plants are moved back to greenhouse. Two weeks later damages from chilling period, resulting in growth retardation and other phenotypes, are compared between control and transgenic plants, by measuring plant weight (wet and dry), and by comparing growth rates measured as time to flowering, plant size, yield, and the like.

Heat stress tolerance - One way to measure heat stress tolerance is by exposing the plants to temperatures above 34 °C for a certain period. Plant tolerance is examined after transferring the plants back to 22 °C for recovery and evaluation after 5 days relative to internal controls (non-transgenic plants) or plants not exposed to neither cold or heat stress.

Germination tests - Germination tests compare the percentage of seeds from transgenic plants that could complete the germination process to the percentage of seeds from control plants that are treated in the same manner. Normal conditions are considered for example, incubations at 22 °C under 22-hour light 2-hour dark daily cycles. Evaluation of germination and seedling vigor is conducted between 4 and 14

2017228711 15 Sep 2017 days after planting. The basal media is 50 % MS medium (Murashige and Skoog, 1962 Plant Physiology 15, 473-497).

Germination is checked also at unfavorable conditions such as cold (incubating at temperatures lower than 10 °C instead of 22 °C) or using seed inhibition solutions that contain high concentrations of an osmolyte such as sorbitol (at concentrations of 50 mM, 100 mM, 200 mM, 300 mM, 500 mM, and up to 1000 mM) or applying increasing concentrations of salt (of 50 mM, 100 mM, 200 mM, 300 mM, 500 mM NaCl).

Effect of the transgene on plant’s growth, biomass, yield and/or vigor - Plant vigor can be calculated by the increase in growth parameters such as leaf area, fiber length, rosette diameter, plant fresh weight and the like per time.

The growth rate can be measured using digital analysis of growing plants. For example, images of plants growing in greenhouse on plot basis can be captured every 3 days and the rosette area can be calculated by digital analysis. Rosette area growth is calculated using the difference of rosette area between days of sampling divided by the difference in days between samples.

Measurements of seed yield can be done by collecting the total seeds from 8-16 plants together, weighting them using analytical balance and dividing the total weight by the number of plants. Seed per growing area can be calculated in the same manner while taking into account the growing area given to a single plant. Increase seed yield per growing area could be achieved by increasing seed yield per plant, and/or by increasing number of plants capable of growing in a given area.

Evaluation of the seed yield per plant can be done by measuring the amount (weight or size) or quantity (i.e., number) of dry seeds produced and harvested from 816 plants and divided by the number of plants.

Evaluation of growth rate can be done by measuring plant biomass produced, rosette area, leaf size or root length per time (can be measured in cm per day of leaf area).

Fiber length can be measured using fibrograph. The fibrograph system was used to compute length in terms of Upper Half Mean length. The upper half mean (UHM) is the average length of longer half of the fiber distribution. The fibrograph measures length in span lengths at a given percentage point (Hypertext Transfer Protocol://World Wide Web (dot) cottoninc (dot) com/ClassificationofCotton/?Pg=4#Length).

2017228711 15 Sep 2017

Thus, the present invention is of high agricultural value for promoting the yield of commercially desired crops (e.g., biomass of vegetative organ such as poplar wood, or reproductive organ such as number of seeds or seed biomass).

As used herein the term “about” refers to ± 10 %.

The terms comprises, comprising, includes, including, “having” and their conjugates mean including but not limited to.

The term “consisting of means “including and limited to”.

The term consisting essentially of means that the composition, method or structure may include additional ingredients, steps and/or parts, but only if the additional ingredients, steps and/or parts do not materially alter the basic and novel characteristics of the claimed composition, method or structure.

As used herein, the singular form a, an and the include plural references unless the context clearly dictates otherwise. For example, the term a compound or at least one compound may include a plurality of compounds, including mixtures thereof.

Throughout this application, various embodiments of this invention may be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range.

Whenever a numerical range is indicated herein, it is meant to include any cited numeral (fractional or integral) within the indicated range. The phrases “ranging/ranges between” a first indicate number and a second indicate number and “ranging/ranges from” a first indicate number “to” a second indicate number are used herein interchangeably and are meant to include the first and second indicated numbers and all the fractional and integral numerals therebetween.

As used herein the term method refers to manners, means, techniques and procedures for accomplishing a given task including, but not limited to, those manners, means, techniques and procedures either known to, or readily developed from known

2017228711 15 Sep 2017 manners, means, techniques and procedures by practitioners of the chemical, pharmacological, biological, biochemical and medical arts.

It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable subcombination or as suitable in any other described embodiment of the invention. Certain features described in the context of various embodiments are not to be considered essential features of those embodiments, unless the embodiment is inoperative without those elements.

Various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below find experimental support in the following examples.

EXAMPLES

Reference is now made to the following examples, which together with the above descriptions illustrate some embodiments of the invention in a non limiting fashion.

Generally, the nomenclature used herein and the laboratory procedures utilized in the present invention include molecular, biochemical, microbiological and recombinant DNA techniques. Such techniques are thoroughly explained in the literature. See, for example, Molecular Cloning: A laboratory Manual Sambrook et al., (1989); Current Protocols in Molecular Biology Volumes I-III Ausubel, R. M., ed. (1994); Ausubel et al., Current Protocols in Molecular Biology, John Wiley and Sons, Baltimore, Maryland (1989); Perbal, A Practical Guide to Molecular Cloning, John Wiley & Sons, New York (1988); Watson et al., Recombinant DNA, Scientific American Books, New York; Birren et al. (eds) Genome Analysis: A Laboratory Manual Series, Vols. 1-4, Cold Spring Harbor Laboratory Press, New York (1998); methodologies as set forth in U.S. Pat. Nos. 4,666,828; 4,683,202; 4,801,531; 5,192,659 and 5,272,057; Cell Biology: A Laboratory Handbook, Volumes I-III Cellis, J. E., ed. (1994); Current Protocols in Immunology Volumes I-III Coligan J. E., ed. (1994); Stites et al. (eds), Basic and Clinical Immunology (8th Edition), Appleton & Lange, Norwalk, CT (1994); Mishell and Shiigi (eds), Selected Methods in Cellular Immunology, W. H. Freeman and Co., New York (1980); available immunoassays are extensively described in the patent and scientific literature, see, for example, U.S. Pat. Nos. 3,791,932;

2017228711 15 Sep 2017

3,839,153; 3,850,752; 3,850,578; 3,853,987; 3,867,517; 3,879,262; 3,901,654;

3,935,074; 3,984,533; 3,996,345; 4,034,074; 4,098,876; 4,879,219; 5,011,771 and 5,281,521; Oligonucleotide Synthesis Gait, M. J., ed. (1984); “Nucleic Acid Hybridization Hames, B. D., and Higgins S. J., eds. (1985); Transcription and Translation Hames, B. D., and Higgins S. J., Eds. (1984); Animal Cell Culture Freshney, R. I., ed. (1986); Immobilized Cells and Enzymes IRL Press, (1986); A Practical Guide to Molecular Cloning Perbal, B., (1984) and Methods in Enzymology Vol. 1-317, Academic Press; PCR Protocols: A Guide To Methods And Applications, Academic Press, San Diego, CA (1990); Marshak et al., Strategies for Protein Purification and Characterization - A Laboratory Course Manual CSHL Press (1996); all of which are incorporated by reference as if fully set forth herein. Other general references are provided throughout this document. The procedures therein are believed to be well known in the art and are provided for the convenience of the reader. All the information contained therein is incorporated herein by reference.

EXAMPLE 1

IDENTIFYING PUTATIVE ABIOTIC STRESS- TOLERANCE AND OR YIELD/BIOMASS INCREASE GENES

The present inventors have identified genes which increase abiotic stresstolerance (ABST) and/or growth rate/yield/biomass/vigor, as follows. The genes were validated in vivo as previously described in W02004/104162 to the present assignee. All nucleotide sequence datasets used here were originated from publicly available databases. Sequence data from 50 different species (mainly plant species) was introduced into a single, comprehensive database. Other information on gene expression, protein annotation, enzymes and pathways were also incorporated. Major databases used include:

• Genomes o Arabidopsis genome [TAIR genome version 6 (Hypertext Transfer

Protocol://World Wide Web (dot) arabidopsis (dot) org/)] o Rice genome [IRGSP build 4.0 (Hypertext Transfer Protocol://rgp (dot) dna (dot) affrc (dot) go (dot) jp/IRGSP/)].

2017228711 15 Sep 2017 o Poplar [Populus trichocarpa release 1.1 from JGI (assembly release vl .0) (Hypertext Transfer Protocol://World Wide Web (dot) genome (dot) jgi-psf (dot) org/)] o Brachypodium [JGI 4x assembly Hypertext Transfer Protocol://World Wide Web (dot) brachpodium (dot) org)] o Soybean [DOE-JGI SCP, version GlymaO (Hypertext Transfer Protocol://World Wide Web (dot) phytozome (dot) net/)] o Grape [NCBI WGS assembly ftp://ftp (dot) ncbi (dot) nih (dot) gov/ genbank/wgs/)] o Castobean [TIGR/J Craig Venter Institute 4x assemby o Hypertext Transfer Protocol://msc (dot) jcvi (dot) org/r_communis o Sorghum [DOE-JGI SCP, version Sbil Hypertext Transfer Protocol://World Wide Web (dot) phytozome (dot) net/)].

• Expressed EST and mRNA sequences were extracted from o GeneBank versions 154, 157, 160, 161, 164, and 165 (Hypertext Transfer

Protocol://World Wide Web (dot) ncbi (dot) nlm (dot) nih (dot) gov/dbEST/) o RefSeq (Hypertext Transfer Protocol://World Wide Web (dot) ncbi (dot) nlm (dot) nih (dot) gov/RcfScq/).

o TAIR (Hypertext Transfer Protocol ://World Wide Web (dot) arabidopsis (dot) org/).

• Protein and pathway databases o Uniprot (Hypertext Transfer Protocol ://World Wide

W eb .expasy.uniprot. org/).

o AraCyc (Hypertext Transfer Protocol://World Wide Web (dot) arabidopsis (dot) org/biocyc/index (dot) jsp).

o ENZYME (Hypertext Transfer Protocol://expasy.org/enzyme/).

• Microarray datasets were downloaded from o GEO (Hypertext Transfer Protocol://World Wide

Web.ncbi.nlm.nih.gov/geo/) o TAIR (Hypertext Transfer Protocol://World Wide Web.arabidopsis.org/).

o Proprietary Evogene's cotton fiber microarray data

2017228711 15 Sep 2017 • QTL information o Gramene (Hypertext Transfer Protocol ://World Wide Web (dot) gramene (dot) org/qtl/).

Database Assembly was performed to build a wide, rich, reliable annotated and easy to analyze database comprised of publicly available genomic mRNA, ESTs DNA sequences, data from various crops as well as gene expression, protein annotation and pathway data QTLs, and other relevant information.

Database assembly is comprised of a toolbox of gene refining, structuring, annotation and analysis tools enabling to construct a tailored database for each gene discovery project. Gene refining and structuring tools enable to reliably detect splice variants and antisense transcripts, generating understanding of various potential phenotypic outcomes of a single gene. The capabilities of the LEADS platform of Compugen LTD for analyzing human genome have been confirmed and accepted by the scientific committee (Widespread Antisense Transcription, Yelin, et al. (2003) Nature Biotechnology 21, 379-85; Splicing of Alu Sequences, Lev-Maor, et al. (2003) Science 300 (5623), 1288-91), and have proven most efficient in plant genomics as well.

EST clustering and gene assembly - For clustering and assembly of arabidopsis and rice genes the genomic LEADS version was employed. This tool allows most accurate clustering of ESTs and mRNA sequences on genome, and predicts gene structure as well as alternative splicing events and anti-sense transcription.

For organisms with no available full genome sequence data, expressed LEADS as well as TIGR (Hypertext Transfer Protocol ://World Wide Web (dot) tigr (dot) org/) clustering software were applied. The results of the two clustering tools were compared and in cases where clusters predicted by the two tools were significantly different, both versions were presented and considered.

Gene annotation - Predicted genes and proteins were annotated as follows:

• Blast search (Hypertext Transfer Protocol://World Wide Web (dot) ncbi (dot) nlm (dot) nih (dot) gov (dot) library (dot) vu (dot) edu (dot) au/BLAST/ ) against all plant UniProt (Hypertext Transfer Protocol ://World Wide Web (dot) expasy (dot) uniprot (dot) org/) sequences was performed.

• Frame-Finder (Hypertext Transfer Protocol ://World Wide Web (dot) ebi (dot) ac (dot) uk/~guy/estate/) calculations with default statistics was used to predict protein sequences for each transcript.

2017228711 15 Sep 2017 • The predicted proteins were analyzed by InterPro (Hypertext Transfer Protocol://World Wide Web (dot) ebi (dot) ac (dot) uk/interpro/).

• Blast against proteins from AraCyc and ENZYME databases was used to map the predicted transcripts to AraCyc pathways.

• Each transcript was compared using tblastx algorithm (Hypertext Transfer Protocol://World Wide Web (dot) ncbi (dot) nlm (dot) nih (dot) gov (dot) library (dot) vu (dot) edu (dot) au/BLAST/) against all other organism databases to validate the accuracy of the predicted protein sequence, and for efficient detection of orthologs.

Gene expression profiling - Few data sources were exploited for gene expression profiling, namely microarray data and digital expression profile (see below). According to gene expression profile, a correlation analysis was performed to identify genes which are co-regulated under different development stages and environmental conditions.

Publicly available microarray datasets were downloaded from TAIR and NCBI GEO sites, renormalized, and integrated into the database. Expression profiling was one of the most important resource data for identifying genes important for ABST. Moreover, when homolog genes from different crops were responsive to ABST, the genes were marked as highly predictive to improve ABST.

A digital expression profile summary was compiled for each cluster according to all keywords included in the sequence records comprising the cluster. Digital expression, also known as electronic Northern Blot, is a tool that displays virtual expression profile based on the EST sequences forming the gene cluster. The tool can provide the expression profile of a cluster in terms of plant anatomy (in what tissues/organs is the gene expressed), developmental stage (the developmental stages at which a gene can be found) and profile of treatment (provides the physiological conditions under which a gene is expressed such as drought, cold, pathogen infection, etc). Given a random distribution of ESTs in the different clusters, the digital expression provides a probability value that describes the probability of a cluster having a total of N ESTs to contain X ESTs from a certain collection of libraries. For the probability calculations are taken into consideration: a) the number of ESTs in the cluster, b) the number of ESTs of the implicated and related libraries, c) the overall number of ESTs available representing the species. Thereby clusters with low probability values are highly enriched with ESTs from the group of libraries of interest indicating a specialized expression.

2017228711 15 Sep 2017

The concepts of orthology and paralogy have recently been applied to functional characterizations and classifications on the scale of whole-genome comparisons. Orthologs and paralogs constitute two major types of homologs: The first evolved from a common ancestor by specialization, and the latter are related by duplication events. It is assumed that paralogs arising from ancient duplication events are likely to have diverged in function while true orthologs are more likely to retain identical function over evolutionary time.

To further investigate and identify the ABST putative ortholog genes from monocot species, two computational methods were integrated:

(i) Method for alignments of ortholog sequences - based on construction ortholog groups across multiple eukaryotic taxa, using modifications on the Markov cluster algorithm to group putative orthologs and paralogs. These putative orthologs were further organized under Phylogram - a branching diagram (tree) assumed to be an estimate of a phylogeny of the genes.

(ii) Method for generating genes expression profile “Digital Expression ” The present inventors have performed considerable work aimed at annotating sequences. Expression data was analyzed and the EST libraries were classified using a fixed vocabulary of custom terms such as experimental treatments. The annotations from all the ESTs clustered to a gene were analyzed statistically by comparing their frequency in the cluster versus their abundance in the database, allowing to construct a numeric and graphic expression profile of that gene, which is termed “digital expression”.

The rationale of using these two complementary methods is based on the assumption that true orthologs are likely to retain identical function over evolutionary time. These two methods (sequence and expression pattern) provide two different sets of indications on function similarities between two homologous genes, similarities in the sequence level - identical amino acids in the protein domains and similarity in expression profiles.

Overall, 110 genes were identified to have a major impact on ABST when overexpressed in plants. The identified ABST genes, their curated polynucleotide and polypeptide sequences, as well as their updated sequences according to Genebank database are summarized in Table 1, hereinbelow.

Table 1

Identified ABST Genes

SEQ ID NO: Polyn ucleot ide	Gene Name	Cluster Name	Organism	SEQ ID NO: Poly pepti de	Polynucleotide Description	Polypeptide Description
1	ΜΑΒΙ	MAB1.0.ricegbl54BM4211 11 T1	rice	201
2		MAB1.1 .rice gb 157.2\|BM42 1111T1	rice	202	updated to production gbl57.2	updated to production gbl57.2
3	MAB2	MAB2.0.rice\|gbl54\|AU2255 47_T1	rice			No predicted protein
4		MAB2.1.rice\|gbl57.2\|AU225 547_T1	rice		updated to production gbl57.2
5	MAB3	MAB3.0.rice\|gbl54\|BE03999 5 T1	rice	203
6		MAB3.1.ricegbl57.2BE039 995_T1	rice	204	updated to production gbl57.2	updated to production gbl57.2
7	MAB4	MAB4.0.rice\|gbl54\|B181227 7 T1	rice	205
8		MAB4.7.rice\|gbl57.2\|B18122 77 CT1	rice		curated
9	MAB5	MAB5.0.rice\|gbl54\|CB6241 06 T1	rice	206
10	MAB6	MAB6.0.arabidopsis\|gbl54\|Z 47404 T1	arabidopsi s	207
11	MAB7	MAB7.0.arabidopsis\|6\|AT5G 47560.1	arabidopsi s	208
12		MAB7.1.arabidopsis\|gbl65\|A T5G47560 T1	arabidopsi s	209	updated to production gbl65	updated to production gbl65
13	MAB8	MAB8.0.rice\|gbl54\|BU6729 31 T1	rice	210
14		MAB8.7.rice\|gbl54\|BU6729 31_T1	rice		Bioinformatics &DNA Curated
15	MAB9	MAB9.0.arabidopsis gbl54 B E844934 T1	arabidopsi s	211
16	MAB10	MAB10.0.arabidopsisgbl54 Z27056 T1	arabidopsi s	212
17	MAB11	MAB 11.O.arabidopsis gb 154 Z34014 T1	arabidopsi s	213
18		MAB 11.1 .arabidopsis\|gb 1651 AT5G52300 T1	arabidopsi s	214	updated to production gbl65	updated to production gbl65
19	MAB12	MAB12.0.arabidopsisgbl54 ATLT1L40 T1	arabidopsi s	215
20		MAB 12.1 .arabidopsis\|gb 1651 AT5G52310 T1	arabidopsi s	216	updated to production gbl65	updated to production gbl65
21	MAB13	MAB13.0.arabidopsis\|6\|AT2 G38760.1	arabidopsi s	217

SEQ ID NO: Polyn ucleot ide	Gene Name	Cluster Name	Organism	SEQ ID NO: Poly pepti de	Polynucleotide Description	Polypeptide Description
22		MAB 13.1 .arabidopsis\|gb 1651 AT2G38760 T1	arabidopsi s	218	updated to production gbl65	updated to production gbl65
23	MAB 14	MAB14.0.rice\|gbl54\|AB042 259 T1	rice	219
24		MAB14.1.ricegbl57.2 AB04 2259_T1	rice	220	updated to production gbl57.2	updated to production gbl57.2
25	MAB15	MAB 15.0. sorghum gb 15 4 Al 724695 T1	sorghum	221
26	MAB16	MAB16.0.rice\|gbl54\|B17951 72 T1	rice	222
27		MAB 16.1.rice gb 157.2 B1795 172_T1	rice	223	updated to production gbl57.2	updated to production gbl57.2
28	MAB17	MAB17.0.soybeangbl54 BE 821839 T1	soybean	224
29	MAB18	MAB 18.0.barley \|gb 154 \|BF62 5971 T1	barley	225
				226		protein Bioinforma tics & Protein Curated
30	MAB19	M AB 19.0. sorghum gb 15 4 A W563861 T1	sorghum	227
31		MAB 19.1. sorghum\|gb 161 .xe no\|AW563861_Tl	sorghum	228	updated to production gbl61.xeno	updated to production gbl61.xeno
32	MAB20	MAB20.0.arabidopsisgbl54 T04691 T1	arabidopsi s	229
33		MAB20.1.arabidopsis\|gbl65\| AT1G61890 T1	arabidopsi s	230	updated to production gbl65	updated to production gbl65
34	MAB21	MAB21.0.ricegbl54BE2300 53 T1	rice	231
35		MAB21.1.rice\|gbl57.2\|BE23 0053_Tl	rice	232	updated to production gbl57.2	updated to production gbl57.2
36	MAB22	MAB22.0.tomato\|gbl54\|BG7 91299 T1	tomato	233
				234		Curated
37	MAB23	MAB23.0.rice\|gbl54\|B13058 10 T1	rice	235
38	MAB24	MAB24.0.rice\|gbl54\|B18082 73 T1	rice	236
39		MAB24.7.rice\|gbl57.2\|B1808 273 CT1	rice		curated
40	MAB25	MAB25.0.arabidopsis\|6\|ATl G27760.1	arabidopsi s	237

SEQ ID NO: Polyn ucleot ide	Gene Name	Cluster Name	Organism	SEQ ID NO: Poly pepti de	Polynucleotide Description	Polypeptide Description
41		MAB25.1 .arabidopsis\|gb 1651 AT1G2776O_T1	arabidopsi s	238	updated to production gbl65	updated to production gbl65
42	MAB26	MAB26.0.rice\|gbl54\|AW155 625 T1	rice	239
43		MAB26.7.rice\|gbl57.2\|B1305 400 CT1	rice		curated
44	MAB27	MAB27.0.arabidopsisgbl54 AY045660 T1	arabidopsi s	240
45		MAB27.7.arabidopsis\|gbl65\| AT5G24120 CT1	arabidopsi s		curated
46	MAB28	MAB28.0.rice\|gbl54\|B17951 08 T1	rice	241
47		MAB28.7.rice\|gbl57.2\|B1795 108 CT1	rice		curated
48	MAB29	MAB29.0.arabidopsisgbl54 AU239137 T2	arabidopsi s	242
49		MAB29.1 .arabidopsis\|gb 1651 AT2G25600 T1	arabidopsi s	243	updated to production gbl65	updated to production gbl65
50	MAB30	MAB30.0.arabidopsisgbl54 AY062542 T1	arabidopsi s	244
51		MAB30.7.arabidopsis\|gbl65\| AT1G70300 CT1	arabidopsi s		Curated
52	MAB31	MAB31.0. soybean gb 154 B19 68709 T1	soybean	245
53		MAB31.7.soybean\|gbl62\|B19 68709 CT1	soybean	246	Curated	curated
54	MAB32	MAB32.0.rice\|gbl54\|AF0395 32 T1	rice	247
55	MAB33	MAB33.0.maize\|gbl54\|A161 5215 T1	maize	248
56		MAB 3 3.1. maize \| gb 1641A161 5215_T1	maize	249		updated to production gbl64
57	MAB34	MAB34.0.barley\|gbl54\|TG BF625450 T1	barley	250
58		MAB34.1.barley gb 157.2 BF 62545O_T1	barley	251	updated to production gbl57.2	updated to production gbl57.2
59	MAB35	MAB35.0.arabidopsisgbl54 AA651513 T1	arabidopsi s	252
60		MAB3 5.1 .arabidopsis\|gb 1651 AT2G16890 T1	arabidopsi s	253	updated to production gbl65	updated to production gbl65
61	MAB36	MAB36.0.arabidopsis\|gbl54\| AU239340 T1	arabidopsi s	254
62		MAB3 6.1 .arabidopsis\|gb 1651 AT4G2757O_T1	arabidopsi s	255	updated to production gbl65	updated to production gbl65
63	MAB37	MAB37.0.tomato\|gbl54\|BGl 25939 T1	tomato	256

SEQ ID NO: Polyn ucleot ide	Gene Name	Cluster Name	Organism	SEQ ID NO: Poly pepti de	Polynucleotide Description	Polypeptide Description
64		MAB37.7.tomato\|gbl64\|BGl 25939 CT1	tomato		curated
65	MAB38	MAB38.0.wheat\|gbl54\|BE49 2836 T1	wheat	257
66		MAB38.7.wheat\|gbl64\|BE49 2836 CT1	wheat	258	curated	curated
67	MAB39	MAB39.0.barley gbl54 AL5 00200 T1	barley	259
68		MAB39.1.barley gbl57.2 AL 500200_Tl	barley	260	updated to production gbl57.2	updated to production gbl57.2
69	MAB40	MAB40.0.rice\|gbl54\|AA754 628 T1	rice	261
70		MAB40.7.rice\|gbl57.2\|AA75 4628 CT1	rice		curated
71	MAB41	MAB41.0.tomato gb 154 A14 89494 T1	tomato	262
72		MAB41.7 .tomato \| gb 1641A14 89494 CT1	tomato		curated
73	MAB42	M AB 42.0. sorghum gb 15 4 Β E 595950 T1	sorghum	263
74		MAB42.7. sorghum\|gb 161 .xe no\|A1881418 CT1	sorghum	264	curated	curated
75	MAB43	MAB43.0.arabidopsis gb 154 BE662945 T1	arabidopsi s	265
76		MAB43.1 .arabidopsis\|gb 1651 AT5G26920 T1	arabidopsi s	266	updated to production gbl65	updated to production gbl65
77	MAB44	MAB44.0.arabidopsis gbl54 H36025 T1	arabidopsi s	267
78		MAB44.1 .arabidopsis\|gb 1651 AT1G67360 T1	arabidopsi s	268	updated to production gbl65	updated to production gbl65
79	MAB45	MAB45.0.wheat\|gbl54\|TG BQ172359 T1	wheat	269
80		MAB45.1. wheat\|gb 164\|BQ 17 2359_T1	wheat	270	updated to production gbl64	updated to production gbl64
81	MAB46	MAB46.0.arabidopsis\|gbl54\| AA389812 T1	arabidopsi s	271
82	MAB47	M AB 4 7.0. sorghum gbl54 A W672286 T1	sorghum	272
83		M AB 4 7.7. sorghum\| gb 161. xe no\|A1948276 CT1	sorghum	273	Curated	Curated
84	MAB48	MAB48.0.rice\|gbl54\|B18021 61 T1	rice	274
85		MAB48.7.rice\|gbl57.2\|AU09 2454 CT1	rice	275	curated	curated
86	MAB49	MAB49.0.maize\|gbl54\|TG A1621810 T1	maize	276
87		MAB49.7.maize\|gbl64\|A162 1810 CTl	maize		Curated

SEQ ID NO: Polyn ucleot ide	Gene Name	Cluster Name	Organism	SEQ ID NO: Poly pepti de	Polynucleotide Description	Polypeptide Description
88	MAB50	MAB50.0.arabidopsis gbl54 W43146 Tl	arabidopsi s	277
89		MAB50.1 .arabidopsis\|gb 1651 AT5G4857O_T1	arabidopsi s	278	updated to production gbl65	updated to production gbl65
90	MAB91	MAB91.0.arabidopsis gb 154 AU236480 Tl	arabidopsi s	279
				280		curated
91	MAB96	MAB96.0.arabidopsis\|gbl54\| Z27256 Tl	arabidopsi s	281
92		MAB96.7.arabidopsis\|gbl65\| AT5G03800 CT1	arabidopsi s	282	curated	curated
93	MAB99	MAB99.0.tomato\|gbl54\|BG7 35056 Tl	tomato	283
94	MAB100	MAB100.0.arabidopsis gb 15 4\|Z37259 Tl	arabidopsi s	284
95		MAB 100.1 .arabidopsis\|gb 16 5\|AT1GO147O_T1	arabidopsi s	285	updated to production gbl65	updated to production gbl65
96	MAB104	MAB104.0.rice\|gbl54\|BE039 215 Tl	rice	286
97		MAB 104.1 .rice gb 157.2\|BE0 39215_T1	rice	287	updated to production gbl57.2	updated to production gbl57.2
98	MAB121	MAB 121.0. sugarcane gb 15 7 CA079500 Tl	sugarcane	288
99		MAB 121.1. sugarcane gb 15 7. 2\|CA079500_Tl	sugarcane	289	updated to production gbl57.2	updated to production gbl57.2
100	MAB122	MAB122.0.maize\|gbl54\|A19 01344 T9	maize	290
101	MAB123	MAB123.0.barley\|gbl57\|BF6 26638 Tl	barley	291
102		MAB123.1.barley\|gbl57.2\|B F626638_T1	barley	292	updated to production gbl57.2	updated to production gbl57.2
103	MAB124	MAB 124.0. sugarcane gb 157 CA284042 Tl	sugarcane	293
104		MAB 124.1. sugarcane gb 15 7. 2\|CA284042_Tl	sugarcane	294	updated to production gbl57.2	updated to production gbl57.2
105	MAB125	MAB125.0.rice\|gbl57\|CF957 213 Tl	rice	295
106		MAB 125.1 .rice gb 157.2\|CF9 57213_T1	rice	296	updated to production gbl57.2	updated to production gbl57.2
107	MAB126	MAB126.0.grape\|gbl57\|BQ7 97309 Tl	grape	297
108		MAB126.1.grape\|gbl60\|BQ7 97309_Tl	grape	298	updated to production gbl60	updated to production gbl60

2017228711 15 Sep 2017

SEQ ID NO: Polyn ucleot ide	Gene Name	Cluster Name	Organism	SEQ ID NO: Poly pepti de	Polynucleotide Description	Polypeptide Description
109	MAB127	MAB127.0.grape\|gbl57\|CB9 71532 Tl	grape	299
110		MAB127.1.grape\|gbl60\|CB9 71532_T1	grape	300	updated to production gbl60	updated to production gbl60
111	MAB128	M AB 12 8.0. sugarcane gb 15 7 CA142162 Tl	sugarcane	301
112		M AB 12 8.1. sugarcane gb 15 7. 2\|CA142162_T1	sugarcane	302	updated to production gbl57.2	updated to production gbl57.2
113	MAB129	MAB129.0.tomato\|gbl57\|Al 486106 Tl	tomato	303
114		MAB 129.1 .tomato \| gb 1641 Al 4861O6_T1	tomato	304	updated to production gbl64	updated to production gbl64
115	MAB130	MAB130.0.canola\|gbl57\|CD 829694 Tl	canola	305
116	MAB131	MAB 131.0.tomato gb 157 A W928843 Tl	tomato	306
117		MAB131.1.tomato\|gbl64\|A W928843_T1	tomato	307	updated to production gbl64	updated to production gbl64
118	MAB132	MAB 132.0. barley gb 157 BF6 21624 Tl	barley	308
119	MAB133	MAB133.0.barley\|gbl57\|BE4 11546 Tl	barley	309
120		MAB133.1.barley\|gbl57.2\|B E411546T1	barley	310	updated to production gbl57.2	updated to production gbl57.2
121	MAB134	MAB 134.0. barley gb 157 BE4 37407 Tl	barley	311
				312		protein Bioinforma tics & Protein Curated
122	MAB135	MAB135.0.1otus\|gbl57\|A196 7693 Tl	lotus	313
123		MAB135.1.1otusgbl57.2 A19 67693T1	lotus	314	updated to production gbl57.2	updated to production gbl57.2
124	MAB136	MAB136.0.rice\|gbl57\|AK05 8573 Tl	rice	315
125		MAB136.1.ricegbl57.2 AKO 58573_T1	rice	316	updated to production gbl57.2	updated to production gbl57.2
126	MAB137	MAB137.0.barley\|gbl57\|AL 5O8624_T1	barley	317	from provisional patent
127		MAB137.1.barleygbl57.2 A L5O8624_T1	barley	318	updated to production gbl57.2	updated to production gbl57.2

2017228711 15 Sep 2017

SEQ ID NO: Polyn ucleot ide	Gene Name	Cluster Name	Organism	SEQ ID NO: Poly pepti de	Polynucleotide Description	Polypeptide Description
128	MAB138	MAB138.0.potato\|gbl57\|Bll 77281_T1	potato	319	from provisional patent
129		MAB138.1.potato\|gbl57.2\|Bl 177281_T1	potato	320	updated to production gbl57.2	updated to production gbl57.2
130	MAB139	MAB139.0.cotton\|gbl57.2\|A 1727826_T1	cotton	321	from provisional patent
131		MAB 139.1 .cotton\|gb 1641 Al 7 27826_T1	cotton	322	updated to production gbl64	updated to production gbl64
132	MAB140	MAB140.0.barley\|gbl57\|B17 78498_T1	barley	323	from provisional patent
133		MAB 140.1 .barley gb 157.2\|B1 778498_T1	barley	324	updated to production gbl57.2	updated to production gbl57.2
134	MAB141	MAB141.0.barleygbl57BE4 21008_Tl	barley	325	from provisional patent
135	MAB142	MAB142.0.cotton\|gbl57.2\|A 1055631_T2	cotton	326	from provisional patent
136		MAB142.0.cotton\|gbl57.2\|A 105563 IT1	cotton	327	from provisional patent
137		MAB142.1.cotton\|gbl64\|AW 187O41_T1	cotton	328	updated to production gbl64	updated to production gbl64
138	MAB143	MAB143.0.tomato\|gbl57\|Al 487157_T1	tomato	329	from provisional patent
139		MAB143.1.tomato\|gbl64\|Al 487157_T1	tomato	330	updated to production gbl64	updated to production gbl64
140	MAB144	MAB144.0.grape\|gbl57\|CA8 14960T1	grape	331	from provisional patent
141		MAB 144.1.grape gb 160 CA8 14960T1	grape	332	updated to production gbl60	updated to production gbl60
142	MAB145	MAB145.0.barley\|gbl57\|BE4 13365_T1	barley	333	from provisional patent
143	MAB146	MAB146.0.tomato\|gbl57\|Al 773927_T1	tomato	334	from provisional patent
144		MAB 146.1 .tomato \| gb 1641 Al 773927_T1	tomato	335	updated to production gbl64	updated to production gbl64

SEQ ID NO: Polyn ucleot ide	Gene Name	Cluster Name	Organism	SEQ ID NO: Poly pepti de	Polynucleotide Description	Polypeptide Description
145	MAB147	MAB147.0.tobacco\|gbl57\|E B446189 TI	tobacco	336
146		MAB147.1.tobacco\|gbl62\|E B446189T1	tobacco	337	updated to production gbl62	updated to production gbl62
147	MAB148	M AB 14 8.0. medicago gb 15 7 AW256654 TI	medicago	338
148		MAB 148.1.medicago gb 157. 2\|AW256654_T1	medicago	339	updated to production gbl57.2	updated to production gbl57.2
149	MAB150	MAB150.0.canola\|gbl57\|CD 818831 TI	canola	340
150		MAB 150.1 .canola\|gb 161 \|CD 818831T1	canola	341	updated to production gbl61	updated to production gbl61
151	MAB151	MAB151.0.potato\|gbl57\|BQ 513540 TI	potato	342
152		MAB151.1.potato\|gbl57.2\|B Q513540T1	potato	343	updated to production gbl57.2	updated to production gbl57.2
153	MAB152	MAB152.0.grape\|gbl57\|BQ7 98655 TI	grape	344
154		MAB152.1.grape\|gbl60\|BQ7 98655_T1	grape	345	updated to production gbl60	updated to production gbl60
155	MAB153	MAB 15 3.0. sugarcane gb 15 7 BQ533857 TI	sugarcane	346
156		MAB 153.1 .sugarcane gb 157. 2\|BQ533857_T1	sugarcane	347	updated to production gbl57.2	updated to production gbl57.2
157	MAB154	Μ AB 15 4.0. sugarc an e gb 15 7 BQ537570 T3	sugarcane	348
158		MAB 15 4.0. sugarc an e gb 15 7 BQ537570 T2	sugarcane	349
159		MAB 15 4.0. sugarc an e gb 15 7 BQ537570 TI	sugarcane	350
160		MAB 15 4.1. sugarcane gb 15 7. 2\|BQ537570_Tl	sugarcane	351	updated to production gbl57.2	updated to production gbl57.2
161	MAB155	MAB 15 5.0. sorghum gb 15 7 A W676730 TI	sorghum	352
162		MAB 155.1. sorghum\|gb 161.x eno\|AW676730_Tl	sorghum	353	updated to production gbl61.xeno	updated to production gbl61.xeno
163	MAB156	MAB156.0.tobacco\|gbl57\|A B117525 TI	tobacco	354
164		MAB 156.1 .tobacco \| gb 1621A B117525_T1	tobacco	355	updated to production gbl62	updated to production gbl62
165	MAB157	MAB 15 7.0. sugarcane gb 15 7 BQ533820 T2	sugarcane	356

SEQ ID NO: Polyn ucleot ide	Gene Name	Cluster Name	Organism	SEQ ID NO: Poly pepti de	Polynucleotide Description	Polypeptide Description
166		MAB 15 7.0. sugarcane gb 15 7 BQ533820 T1	sugarcane	357
167		MAB 157.1. sugarcane gb 157. 2\|BQ533820_Tl	sugarcane	358	updated to production gbl57.2	updated to production gbl57.2
168	MAB 158	MAB158.0.cotton\|gbl57.2\|A 1054450 T1	cotton	359
169	MAB 159	MAB159.0.canola\|gbl57\|CD 818468 T1	canola	360
170	MAB 160	MAB 160.0.barley\|gbl57\|BF6 22450 T1	barley	361
171	MAB161	MAB 161.0.poplar\|gb 157 \|B U 896597 T1	poplar	362
172		MAB 161.1 .poplar\|gb 15 7.2 \|B U896597_T1	poplar	363	updated to production gbl57.2	updated to production gbl57.2
173	MAB 162	MAB 162.0. sugarcane \| gb 15 71 BU102611 T1	sugarcane	364
174		MAB 162.1. sugarcane \| gb 15 7. 2\|BU 102611_T1	sugarcane	365	updated to production gbl57.2	updated to production gbl57.2
175	MAB 163	MAB163.0.barley\|gbl57\|AL 501813 T1	barley	366
176		MAB163.1.barley\|gbl57.2\|A L501813_Tl	barley	367	updated to production gbl57.2	updated to production gbl57.2
177	MAB 164	MAB 164.0.barley\|gbl57\|BF2 53543 T1	barley	368
178		MAB164.1.barley\|gbl57.2\|B F253543_T1	barley	369	updated to production gbl57.2	updated to production gbl57.2
179	MAB 165	MAB165.0.grape\|gbl57\|BQ7 93123 T1	grape	370
180	MAB 166	MAB166.0.poplar\|gbl57\|CV 228694 T1	poplar	371
181		MAB166.1.poplar\|gbl57.2\|C V228694_T1	poplar	372	updated to production gbl57.2	updated to production gbl57.2
182	MAB 167	MAB167.0.canola\|gbl57\|CX 278043 T1	canola	373
183		MAB 167.1 .canola\|gb 161 \|CX 278O43_T1	canola	374	updated to production gbl61	updated to production gbl61
184	MAB 168	MAB168.0.grape\|gbl57\|BG2 73815 T1	grape	375
185		MAB168.1.grape\|gbl60\|BG2 73815_T1	grape	376	updated to production gbl60	updated to production gbl60
186	MAB 169	MAB169.0.cotton\|gbl57.2\|C OTLEA14BT1	cotton	377

2017228711 15 Sep 2017

SEQ ID NO: Polyn ucleot ide	Gene Name	Cluster Name	Organism	SEQ ID NO: Poly pepti de	Polynucleotide Description	Polypeptide Description
187		MAB169.1.cotton\|gbl64\|CO TLEA14BT1	cotton	378	updated to production gbl64	updated to production gbl64
188	ΜΑΒΙ 70	MAB170.0.barley\|gbl57\|BE4 12505 T1	barley	379
189		MAB 170.1.barley gb 157.2 B E4125O5_T1	barley	380	updated to production gbl57.2	updated to production gbl57.2
190	MAB171	M AB 171.0. sugarcane gb 15 7 CA123631 T1	sugarcane	381
191		MAB171.1 .sugarcane gb 157. 2\|CA123631_T1	sugarcane	382	updated to production gbl57.2	updated to production gbl57.2
192	ΜΑΒΙ 72	MAB 172.0. sugarcane gb 15 7 BQ478980 T1	sugarcane	383
193		MAB 172.0. sugarcane gb 15 7 BQ478980 T2	sugarcane	384
194	MAB173	MAB 173.0. barley gb 157 BY 836652 T1	barley	385
195		MAB 173.1.barley gb 157.2 B Y836652_T1	barley	386	updated to production gbl57.2	updated to production gbl57.2
196	ΜΑΒΙ 74	MAB 174.0. barley gb 157 BG 342904 T1	barley	387
197		MAB 174.1.barley gb 157.2 B G342904T1	barley	388	updated to production gbl57.2	updated to production gbl57.2
198	MAB175	MAB175.0.tomato\|gbl57\|BG 126606 T1	tomato	389
199		MAB175.0.tomato\|gbl57\|BG 126606 T2	tomato	390
200		MAB 175.1.tomato\|gbl64\|BG 126606T1	tomato	391	updated to production gbl64	updated to production gbl64
1653	MAB66	MAB66.0.tomato\|gbl64\|BGl 24832 CT1	tomato	1651

Table 1.

Polynucleotides and polypeptides with significant homology to the identified ABST genes have been identified from the databases using BLAST software using the BlastX 5 algorithm. The query nucleotide sequences were SEQ ID NOs:l, 3, 5, 7, 9, 10, 11, 13,

15, 16, 17, 19, 21, 23, 25, 26, 28, 29, 30, 32, 34, 36, 37, 38, 40, 42, 44, 46, 48, 50, 52,

54, 55, 57, 59, 61, 63, 65, 67, 69, 71 ,73 ,75 ,77, 79, 81, 82, 84, 86, 88, 90, 91, 93, 94,

96, 98, 100, 101, 103, 105, 107, 109, 111, 113, 115, 116, 118, 119, 121, 122, 124, 126, 128, 130, 132, 134, 135, 138, 140, 142, 143, 145, 147, 149, 151, 153, 155, 157, 161, 10 163, 165, 168, 169, 170, 171, 173, 175, 177, 179, 180, 182, 184, 186, 188, 190, 192,

194, 196, 198 and 1653, and the identified ABST homologs are provided in Table 2, below.

2017228711 15 Sep 2017

Table 2 _________________________ABST Gene homologs

Polyn ucleoti de SEQ ID NO:	Cluster name	Organism	Polyp eptid e SEQ ID NO:	Homolog to a polypeptide encoded by polynucleotide SEQ ID NO.	% Glob al identi
392	apple\|gbl57.3\|CN444532_Tl	apple	961	Seq357.MAB157.15.sugarca ne	85
393	apple\|gbl57.3\|CN445371 T1	apple	962	Seq376.MAB 168.15.grape	87
394	apple\|gbl57.3\|CN878026_Tl	apple	963	Seq350.MAB154.15.sugarca ne	80
395	apple\|gbl57.3\|CK900582 T1	apple	964	Seq321.MAB 139.15.cotton	85
396	apple gbl57.3CN888579 T2	apple	965	Seq256.MAB37.15.tomato	86
397	apple gbl57.3CN888579 T3	apple	966	Seq256.MAB37.15.tomato	81
398	apple gbl57.3CO066535 T1	apple	967	Seq370.ΜΑΒΙ 65.15.grape	84
399	apple gbl57.3CN888579 T1	apple	968	Seq256.MAB37.15.tomato	86
400	apple gb 157.3 CN496860 T1	apple	969	Seq321.ΜΑΒΙ 39.15.cotton	81
401	apricot\|gbl57.2\|BQ 134642 T1	apricot	970	Seq329.MAB 143.15.tomato	82
402	apricot\|gbl57.2\|CB822088 T1	apricot	971	Seq256.MAB37.15.tomato	88
403	aquilegia gb 157.3 DR915383 T1	aquilegia	972	Seq321.ΜΑΒΙ 39.15.cotton	83
404	aquilegia\|gb 157.3 \|DR913600 T1	aquilegia	973	Seq344.MAB 152.15.grape	83
405	aquilegia gb 157.3 DR920101 T1	aquilegia	974	Seq370.ΜΑΒΙ 65.15.grape	87
406	aquilegia gbl57.3 DT727583 T1	aquilegia	975	Seq311. MAB13 4.15 .barley	80
407	aquilegia gb 157.3 DR918523 T1	aquilegia	976	Seq376.ΜΑΒΙ 68.15.grape	82
408	arabidopsis\|gbl65\|ATlG6789 0 T2	arabidopsis	977	S eq263. MAB 42.15. sorghum	80
409	arabidopsis\|gbl65\|ATlG7807 0 T2	arabidopsis	978	S eq207. MAB 6.15. arabidop si s	97
410	arabidopsis\|gb 1651 AT 1G5289 0 T3	arabidopsis	979	S eq211. MAB 9.15. arabidop si s	85
411	arabidopsis\|gb 1651AT3G0662 0 T1	arabidopsis	980	Seq357.MAB157.15.sugarca ne	80
412	arabidopsis\|gbl65\|ATlG6789 0 T1	arabidopsis	981	S eq263. MAB 42.15. sorghum	80
413	arabidopsis\|gbl65\|AT5G1486 0 T1	arabidopsis	982	Seq341.MAB 150.15.canola	80
414	arabidopsis\|gb 1651 AT 5G4947 0 T2	arabidopsis	983	S eq263. MAB 42.15. sorghum	81
415	arabidopsis\|gb 1651 AT 5G4947 0 T1	arabidopsis	984	S eq263. MAB 42.15. sorghum	81
416	arabidopsis\|gb 1651AT3G2417 0 T1	arabidopsis	985	Seq376.MAB 168.15.grape	80
417	arabidopsis\|gbl65\|ATlGl 167 0 Tl	arabidopsis	986	Seq229.MAB20.15.arabidop sis	84

2017228711 15 Sep 2017

Polyn ucleoti de SEQ ID NO:	Cluster name	Organism	Po/j’P eptid e SEQ ID NO:	Homolog to a polypeptide encoded by polynucleotide SEQ ID NO.	% Glob al identi ty
418	arabidopsis\|gb 1651AT3G2523 0 T1	arabidopsis	987	Seq370.ΜΑΒΙ 65.15.grape	80
419	arabidopsis\|gbl65\|AT4G3250 0 T2	arabidopsis	988	Seq242.MAB29.15.arabidop sis	81
420	arabidopsis\|gb 1651 AT 5G0676 0 T1	arabidopsis	989	Seq373.MAB 167.15.canola	84
421	arabidopsis\|gb 1651 AT 4G2741 0 T3	arabidopsis	990	S eq211. MAB 9.15. arabidop si s	94
422	arabidopsis\|gbl65\|AT4G2756 0 T1	arabidopsis	991	Seq254.MAB36.15.arabidop sis	94
423	artemisia\|gbl64\|EY047508 T 1	artemisia	992	Seq321.MAB 139.15.cotton	80
424	artemisia\|gbl64\|EY060376 T 1	artemisia	993	Seq376.MAB 168.15.grape	85
425	artemisiagbl64 EY089381 T 1	artemisia	994	Seq256.MAB37.15.tomato	86
426	artemisia\|gbl64\|EY042537 T 1	artemisia	995	Seq349.MAB154.15.sugarca ne	80
427	b juncea\|gb 164 \|E VGN001020 08310737 T1	bjuncea	996	Seq360.MAB 159.15.canola	97
428	bjuncea gbl 64 EVGN084860 04170336 T1	bjuncea	997	Seq373.MAB 167.15.canola	94
429	bjuncea\|gbl64\|EVGN004299 14360666 T1	bjuncea	998	Seq370.MAB 165.15.grape	83
430	bjuncea gbl 64 EVGN002584 30752139P1 T1	bjuncea	999	Seq376.MAB 168.15.grape	80
431	bjuncea\|gbl 64 \|EVGN015689 09822952 T1	bjuncea	1000	Seq373.MAB 167.15.canola	98
432	b oleracea\|gbl61\|DY029719 T1	b oleracea	1001	Seq370.MAB 165.15.grape	82
433	b oleracea\|gbl61\|AM385106 T1	b oleracea	1002	Seq360.MAB 159.15.canola	96
434	b oleracea gbl61AM387179 T1	b oleracea	1003	Seq360.MAB 159.15.canola	91
435	b oleracea\|gbl61\|AM061306 T1	b oleracea	1004	Seq284.MAB100.15.arabido psis	86
436	b oleracea\|gbl61\|AB125639 T1	b oleracea	1005	Seq376.MAB 168.15.grape	80
437	b rapa\|gbl62\|EE523634 T1	b rap a	1006	Seq229.MAB20.15.arabidop sis	92
438	b_rapa\|gb 162\|EX024909_T 1	b rap a	1007	Seq217 .MAB 13.15. arabidop sis	83
439	b rapa\|gbl62\|EX070158 T2	b rap a	1008	S eq211. MAB 9.15. arabidop si s	95
440	b rapa\|gbl62\|CA992067 T1	b rap a	1009	Seq360.MAB 159.15.canola	94
441	b rapa\|gbl62\|EE520623 T1	b rap a	1010	Seq280.MAB91.10.arabidop sis	89
442	b_rapa\|gb 1621C V545 896_T 1	b rap a	1011	S eq208. MAB 7.15. arabidop si s	88
443	b rapa\|gbl62\|CO749564 T1	b rap a	1012	Seq370.MAB 165.15.grape	82
444	b_rapa\|gb 1621C V434105_T 1	b rap a	1013	Seq217 .MAB 13.15. arabidop sis	83

2017228711 15 Sep 2017

Polyn ucleoti de SEQ ID NO:	Cluster name	Organism	Polyp eptid e SEQ ID NO:	Homolog to a polypeptide encoded by polynucleotide SEQ ID NO.	% Glob al identi ty
445	b rapa\|gbl62\|AF008441 Tl	b rap a	1014	Seq376.ΜΑΒΙ 68.15.grape	80
446	b rapa\|gbl62\|EX070158 Tl	b rap a	1015	S eq211. MAB 9.15. arabidop si s	86
447	b rapa\|gbl62\|EX088727 Tl	b rap a	1016	Seq271.MAB46.15.arabidop sis	93
448	b rapa\|gbl62\|BG544469 Tl	b rap a	1017	Seq360.MAB 159.15.canola	82
449	b rapa\|gbl62\|DN962625 Tl	b rap a	1018	Seq237.MAB25.15.arabidop sis	85
450	b_rapa\|gb 1621C V544672_T 1	b rap a	1019	Seq284.MAB100.15.arabido psis	88
451	barley\|gbl57.2\|B1947678 Tl	barley	1020	Seq3 6 8. MAB 164.15 .barley	92
452	barley\|gbl57.2\|AV835424 Tl	barley	1021	Seq257.MAB38.15.wheat	97
453	barley\|gbl57.2\|BE455969 Tl	barley	1022	Seq290.MAB 122.15.maize	84
454	barley gb 157.2 BE519575 T2	barley	1023	S eq263. MAB 42.15. sorghum	81
455	barley\|gbl57.2\|BF625959 Tl	barley	1024	Seq221 .MAB 15.15. sorghum	83
456	barley\|gbl57.2\|BQ461470 Tl	barley	1025	Seq356.MAB157.15.sugarca ne	82
457	basilicum\|gbl57.3\|DY333033 Tl	basilicum	1026	Seq256.MAB37.15.tomato	87
458	bean\|gbl64\|CB542809 Tl	bean	1027	Seq376.MAB 168.15.grape	80
459	bean\|gbl64\|CV529652 Tl	bean	1028	Seq370.MAB 165.15.grape	83
460	bean\|gbl64\|CB543453 Tl	bean	1029	Seq3 6 8. MAB 164.15 .barley	80
461	bean\|gbl64\|CV535253 Tl	bean	1030	Seq256.MAB37.15.tomato	88
462	beet\|gbl62\|BQ592516 Tl	beet	1031	Seq256.MAB37.15.tomato	86
463	beet\|gbl62\|BQ488223_Tl	beet	1032	S eq211. MAB 9.15. arabidop si s	88
464	beet\|gbl62\|BQ583768 Tl	beet	1033	Seq385.MAB173.15.barley	85
465	beet gb 162 BQ591963 Tl	beet	1034	Seq3 6 8. MAB 164.15 .barley	80
466	brachypodium\|gb 161 .xeno\|BE 519575 Tl	brachypodium	1035	Seq356.MAB157.15.sugarca ne	85
467	brachypodium\|gb 161 .xeno\|BG 368321 Tl	brachypodium	1036	Seq247.MAB32.15.rice	81
468	brachypodium\|gb 161 .xeno\|BE 400652 Tl	brachypodium	1037	Seq3 6 8. MAB 164.15 .barley	95
469	brachypodium\|gb 161 .xeno\|AL 502884 Tl	brachypodium	1038	Seq210.MAB8.15.rice	82
470	brachypodium\|gb 161 .xeno\|B Y 836652 Tl	brachypodium	1039	Seq385.MAB173.15.barley	90
471	brachypodium\|gb 161 .xeno\|BE 414917 Tl	brachypodium	1040	Seq309.MAB 133.15.barley	93
472	brachypodium\|gb 161 .xeno\|BF 202085 Tl	brachypodium	1041	Seq291 .MAB 123.15 .barley	83
473	brachypodium\|gb 161 .xeno\|BE 406378 Tl	brachypodium	1042	Seq219.MAB14.15.rice	80
474	brachypodium\|gb 161 .xeno\|BE 517562 Tl	brachypodium	1043	Seq366.MAB 163.15.barley	85
475	brachypodium\|gb 161 .xeno\|BE 420294 Tl	brachypodium	1044	Seq290.MAB 122.15.maize	85
476	brachypodium\|gb 161 .xeno\|BG 369416 Tl	brachypodium	1045	Seq270.MAB45.15. wheat	89
477	brachypodium\|gb 161 .xeno\|BE 406039 T2	brachypodium	1046	Seq241.MAB28.15.rice	93

2017228711 15 Sep 2017

Polyn ucleoti de SEQ ID NO:	Cluster name	Organism	Po/yp eptid e SEQ ID NO:	Homolog to a polypeptide encoded by polynucleotide SEQ ID NO.	% Glob al identi ty
478	brachypodium\|gb 161 .xeno\|BE 418087 TI	brachypodium	1047	Seq325.MAB141.15.barley	86
479	brachypodium\|gb 161 .xeno\|BE 470780 TI	brachypodium	1048	Seq221 .MAB 15.15. sorghum	81
480	brachypodium\|gb 161 .xeno\|AV 835424 TI	brachypodium	1049	Seq257.MAB38.15.wheat	93
481	brachypodium\|gb 161 .xeno\|BE 398656 TI	brachypodium	1050	Seq308.MAB 132.15.barley	93
482	brachypodium\|gb 161 .xeno\|BE 437407 TI	brachypodium	1051	Seq311. MAB 13 4.15 .barley	98
483	brachypodium\|gb 161 .xeno\|BE 406039 T3	brachypodium	1052	Seq3 3 3 .MAB 145.15 .barley	81
484	brachypodium\|gb 161 .xeno\|BE 490408 TI	brachypodium	1053	Seq264.MAB42.10.sorghum	80
485	brachypodium\|gb 161 .xeno\|BE 403745 TI	brachypodium	1054	Seq379.MAB170.15.barley	92
486	brachypodium\|gb 161 .xeno\|BE 490591 TI	brachypodium	1055	Seq366.MAB 163.15.barley	87
487	brachypodium\|gb 161 .xeno\|BQ 461470 T2	brachypodium	1056	Seq356.MAB157.15.sugarca ne	85
488	brachypodium\|gb 161 .xeno\|BE 517562 T2	brachypodium	1057	Seq366.MAB 163.15.barley	83
489	brachypodium\|gb 161 .xeno\|BE 413341 TI	brachypodium	1058	Seq336.MAB 147.15.tobacco	80
490	brachypodium\|gb 161 .xeno\|BE 515529 TI	brachypodium	1059	Seq259.MAB39.15.barley	96
491	brachypodium\|gb 161 .xeno\|D V 471778 TI	brachypodium	1060	Seq348.MAB154.15.sugarca ne	83
492	canola\|gbl61\|EL587045 TI	canola	1061	Seq277.MAB50.15.arabidop sis	87
493	canola\|gb 161 \|CX279297_T 1	canola	1062	Seq280.MAB91. lO.arabidop sis	85
494	canola\|gbl61\|CD815143 TI	canola	1063	Seq222.MAB16.15.rice	80
495	canola\|gbl61\|CD831036_Tl	canola	1064	Seq284.MAB100.15.arabido psis	86
496	canola\|gbl61\|EE466962 TI	canola	1065	Seq360.MAB 159.15.canola	83
497	canola\|gbl61\|CN726580 TI	canola	1066	Seq305.MAB 130.15.canola	89
498	canolagbl61 CD829644 TI	canola	1067	Seq373.MAB 167.15.canola	86
499	canola\|gb 1611A Y245 8 87_T 1	canola	1068	S eq211. MAB 9.15. arabidop si s	87
500	canola\|gbl61\|EE411591 TI	canola	1069	S eq207. MAB 6.15. arabidop si s	88
501	canola\|gbl61\|DY020345 TI	canola	1070	S eq211. MAB 9.15. arabidop si s	92
502	canola\|gbl61\|CD820718 TI	canola	1071	Seq360.MAB 159.15.canola	95
503	canolagbl61 CX189134 TI	canola	1072	Seq221 .MAB 15.15. sorghum	81
504	canola\|gbl61\|EG021120 TI	canola	1073	Seq360.MAB 159.15.canola	83
505	canola\|gb 161 \|ES906182_T 1	canola	1074	Seq244.MAB 30.15 .arabidop sis	92
506	canola\|gb 1611E S911977_T 1	canola	1075	Seq229.MAB20.15.arabidop sis	88

Polyn ucleoti de SEQ ID NO:	Cluster name	Organism	Polyp eptid e SEQ ID NO:	Homolog to a polypeptide encoded by polynucleotide SEQ ID NO.	% Glob al identi ty
507	canola\|gb 161 \|CD814410_T 1	canola	1076	Seq217 .MAB 13.15. arabidop sis	81
508	canola\|gbl61\|ES904177 T1	canola	1077	Seq208.MAB7.15.arabidopsi s	87
509	canola\|gbl61\|CD813775 T1	canola	1078	Seq370.MAB 165.15.grape	82
510	canola\|gb 161 \|CD824419_T 1	canola	1079	Seq229.MAB20.15.arabidop sis	94
511	canola\|gbl61\|CD825454 T1	canola	1080	Seq229.MAB20.15.arabidop sis	90
512	canola\|gbl61\|CD834184_Tl	canola	1081	Seq284.MAB100.15.arabido psis	88
513	canola\|gbl61\|EE469078 T1	canola	1082	Seq370.MAB 165.15.grape	83
514	canola\|gbl61\|GFXAJ53511IX 1 T1	canola	1083	Seq305.MAB 130.15.canola	99
515	canola\|gbl61\|EE448267 T1	canola	1084	Seq222.MAB16.15.rice	80
516	canola\|gb 161 \|CX 193415_T 1	canola	1085	Seq237.MAB25.15.arabidop sis	85
517	canola\|gbl61\|CD813278 T1	canola	1086	Seq375.MAB 168.15.grape	80
518	castorbean gb 160 MDL28401 M000077 T1	castorbean	1087	Seq370.MAB 165.15.grape	86
519	castorbean gb 160 EE25 8294 T1	castorbean	1088	Seq256.MAB37.15.tomato	87
520	castorbean\|gbl60\|MDL28066 M000021 T1	castorbean	1089	Seq370.MAB 165.15.grape	85
521	castorbean\|gbl60\|AM267339 T1	castorbean	1090	Seq222.MAB16.15.rice	80
522	castorbean\|gbl60\|EG659656 T1	castorbean	1091	Seq376.MAB 168.15.grape	83
523	castorbean\|gbl60\|EG656754 T1	castorbean	1092	S eq263. MAB 42.15. sorghum	82
524	castorbean\|gbl60\|EE259826 T1	castorbean	1093	Seq3 62. MAB 161.15 .poplar	83
525	castorbean\|gbl60\|EG659299 T1	castorbean	1094	Seq300.MAB127.15.grape	81
526	castorbean\|gbl60\|EE259565 T1	castorbean	1095	Seq276.MAB49.15.maize	80
527	castorbean\|gb 160\|EE25513 3 T1	castorbean	1096	Seq321.MAB 139.15.cotton	84
528	castorbean\|gbl60\|MDL29822 M003364 T1	castorbean	1097	Seq336.MAB 147.15.tobacco	82
529	castorbean\|gb 160\|EG661241 T1	castorbean	1098	Seq371.MAB 166.15.poplar	85
530	centaurea\|gbl61\|EH713943 T 1	centaurea	1099	Seq321.MAB 139.15.cotton	82
531	centaurea gbl61EH724589 T 1	centaurea	1100	Seq256.MAB37.15.tomato	84
532	centaurea\|gbl61\|EH717520 T 1	centaurea	1101	Seq329.MAB 143.15.tomato	80
533	centaurea\|gbl61\|EH711566 T 1	centaurea	1102	Seq370.MAB 165.15.grape	81
534	centaurea\|gbl61\|EH713337 T 1	centaurea	1103	Seq259.MAB39.15.barley	81

Polyn ucleoti de SEQ ID NO:	Cluster name	Organism	Polyp eptid e SEQ ID NO:	Homolog to a polypeptide encoded by polynucleotide SEQ ID NO.	% Glob al identi ty
535	centaurea\|gbl61\|EH713628 T 1	centaurea	1104	Seq376.MAB 168.15.grape	83
536	centaurea\|gbl61\|EH738263 T 1	centaurea	1105	Seq385.MAB173.15.barley	80
537	centaurea\|gbl61\|EH727723 T 1	centaurea	1106	Seq256.MAB37.15.tomato	84
538	cichorium\|gbl61\|DT212291 T 1	cichorium	1107	Seq370.MAB 165.15.grape	80
539	cichorium gbl61DT211081 T 1	cichorium	1108	Seq376.MAB 168.15.grape	83
540	cichorium\|gbl61\|EH692437 T 1	cichorium	1109	Seq256.MAB37.15.tomato	86
541	cichorium\|gbl61\|DT212218 T 1	cichorium	1110	Seq256.MAB37.15.tomato	89
542	citrus\|gbl57.2\|CB290836 Tl	citrus	1111	Seq376.MAB 168.15.grape	85
543	citrus\|gbl57.2\|BQ624861 Tl	citrus	1112	Seq276.MAB49.15.maize	82
544	citrus gb 157.2 BQ624727 Tl	citrus	1113	Seq370.MAB 165.15.grape	85
545	citrus\|gbl57.2\|CB290836 T2	citrus	1114	Seq376.MAB 168.15.grape	86
546	citrus\|gbl57.2\|CX672218_T2	citrus	1115	Seq357.MAB157.15.sugarca ne	83
547	citrus\|gbl57.2\|CF504250 Tl	citrus	1116	Seq222.MAB16.15.rice	82
548	citrus\|gbl57.2\|CK933948 Tl	citrus	1117	Seq256.MAB37.15.tomato	86
549	clover\|gbl62\|BB926896 Tl	clover	1118	Seq256.MAB37.15.tomato	82
550	clover\|gbl62\|BB904696 Tl	clover	1119	S eq263. MAB 42.15. sorghum	84
551	coffea\|gbl57.2\|DV676382 Tl	coffea	1120	Seq256.MAB37.15.tomato	91
552	coffea gbl57.2 DV688680 Tl	coffea	1121	Seq332.MAB 144.15.grape	83
553	coffea gbl57.2 DQ124044 Tl	coffea	1122	Seq303.MAB 129.15.tomato	80
554	cotton\|gbl64\|BF268276 Tl	cotton	1123	Seq370.MAB 165.15.grape	84
555	cotton gb 164 CO 113031 Tl	cotton	1124	Seq319. MAB 138.15 .potato	80
556	cotton\|gbl64\|A1730186 Tl	cotton	1125	Seq256.MAB37.15.tomato	81
557	cotton\|gbl64\|C0103100 Tl	cotton	1126	Seq256.MAB37.15.tomato	86
558	cotton\|gbl64\|BE051970 Tl	cotton	1127	Seq370.MAB 165.15.grape	84
559	cotton\|gbl64\|A1725698 Tl	cotton	1128	Seq376.MAB 168.15.grape	85
560	cotton\|gbl64\|A1728290 Tl	cotton	1129	Seq370.MAB 165.15.grape	82
561	cotton\|gbl64\|A1055482 Tl	cotton	1130	Seq370.MAB 165.15.grape	85
562	cotton\|gbl64\|ES794517 Tl	cotton	1131	Seq327.MAB 142.15.cotton	81
563	cotton\|gbl64\|BF268276 T2	cotton	1132	Seq370.MAB 165.15.grape	84
564	cotton\|gbl64\|CO109448 Tl	cotton	1133	Seq376.MAB 168.15.grape	83
565	cotton\|gbl64\|DT459182 Tl	cotton	1134	Seq375.MAB 168.15.grape	84
566	cotton\|gbl64\|BG441162 Tl	cotton	1135	Seq256.MAB37.15.tomato	85
567	cowpea gbl65 FF390508 Tl	cowpea	1136	Seq256.MAB37.15.tomato	84
568	cowpea\|gbl65\|FF390203 Tl	cowpea	1137	Seq259.MAB39.15.barley	86
569	cowpea\|gbl65\|DQ267475 Tl	cowpea	1138	Seq376.MAB 168.15.grape	83
570	cowpea gb 165 FF382851 Tl	cowpea	1139	Seq224.MAB 17.15.soybean	89
571	cowpea\|gbl65\|FF394009 Tl	cowpea	1140	Seq370. MAB 165.15. grape	85
572	dandelion\|gbl61\|DQ160099 T 1	dandelion	1141	Seq376.MAB 168.15.grape	82
573	dandeliongbl61 DY823013 T 1	dandelion	1142	Seq256.MAB37.15.tomato	82
574	dandeliongbl61 DY820394 T 2	dandelion	1143	Seq256.MAB37.15.tomato	88

Polyn ucleoti de SEQ ID NO:	Cluster name	Organism	Po/j’P eptid e SEQ ID NO:	Homolog to a polypeptide encoded by polynucleotide SEQ ID NO.	% Glob al identi ty
575	dandeliongbl61 DY813450 T 2	dandelion	1144	Seq256.MAB37.15.tomato	85
576	dandeliongbl61 DY820394 T 1	dandelion	1145	Seq256.MAB37.15.tomato	87
577	fescue\|gbl61\|DT687914 TI	fescue	1146	Seq290.MAB 122.15.maize	93
578	fescuegbl61 DT702477 TI	fescue	1147	Seq291 .MAB 123.15 .barley	87
579	fescue gbl61 DT705881 TI	fescue	1148	Seq311. MAB 13 4.15 .barley	96
580	fescue\|gbl61\|DT682501 TI	fescue	1149	Seq321.MAB 139.15.cotton	82
581	fescue\|gbl61\|DT699000 TI	fescue	1150	Seq309.MAB 133.15.barley	90
582	fescue\|gbl61\|DT706685 TI	fescue	1151	Seq259.MAB39.15.barley	96
583	fescue\|gbl61\|DT698326 TI	fescue	1152	Seq3 6 8. MAB 164.15 .barley	95
584	fescuegbl61 DT677453 TI	fescue	1153	Seq379.MAB170.15.barley	95
585	fescuegbl61 DT674734 TI	fescue	1154	Seq3 3 3 .MAB 145.15 .barley	88
586	ginger\|gbl64\|DY377113 TI	ginger	1155	Seq223.MAB16.15.rice	81
587	grape gb 160 BQ792651 TI	grape	1156	Seq222.MAB16.15.rice	84
588	grape gb 160 BQ793581 TI	grape	1157	Seq371.MAB 166.15.poplar	80
589	iceplant\|gbl64\|BM658279 TI	iceplant	1158	Seq376.MAB 168.15.grape	83
590	iceplant\|gbl64\|BE034140 TI	iceplant	1159	Seq303.MAB 129.15.tomato	81
591	ipomoea\|gbl57.2\|AU224303 TI	ipomoea	1160	Seq256.MAB37.15.tomato	91
592	ipomoea\|gbl57.2\|AU224807 TI	ipomoea	1161	Seq385.MAB173.15.barley	80
593	ipomoea\|gbl57.2\|CJ758382 T 1	ipomoea	1162	Seq371.MAB 166.15.poplar	83
594	lettuce\|gbl57.2\|DW048067 T 1	lettuce	1163	Seq256.MAB37.15.tomato	87
595	lettuce\|gbl57.2\|DW046482 T 1	lettuce	1164	Seq256.MAB37.15.tomato	85
596	lettuce\|gbl57.2\|DW062524 T 1	lettuce	1165	Seq259.MAB39.15.barley	81
597	lettuce\|gbl57.2\|DW048641 T 1	lettuce	1166	Seq370.MAB 165.15.grape	80
598	lettuce\|gbl57.2\|DW055618 T 1	lettuce	1167	Seq3 71. MAB 166.15 .poplar	80
599	lettuce gb 157.2 DY961700_T2	lettuce	1168	S eq211. MAB 9.15. arabidop si s	83
600	lettuce gb 157.2 DW075962 T 1	lettuce	1169	Seq256.MAB37.15.tomato	87
601	lettuce\|gbl57.2\|DW047202 T 1	lettuce	1170	Seq376.MAB 168.15.grape	83
602	lotus\|gbl57.2\|BF177835 TI	lotus	1171	Seq256.MAB37.15.tomato	90
603	lotus\|gbl57.2\|BW601503_Tl	lotus	1172	S eq211. MAB 9.15. arabidop si s	84
604	maize\|gbl64\|T15319 T2	maize	1173	Seq276.MAB49.15.maize	96
605	maize\|gbl64\|A1649734 TI	maize	1174	Seq264.MAB42.10.sorghum	90
606	maize\|gbl64\|BE638692 TI	maize	1175	S eq228. MAB 19.15. sorghum	88
607	maize\|gbl64\|AW498283 TI	maize	1176	Seq210.MAB8.15.rice	80
608	maize\|gbl64\|A1622375 TI	maize	1177	Seq309.MAB 133.15.barley	90
609	maize\|gbl64\|BQ034409 TI	maize	1178	Seq290.MAB 122.15.maize	100
610	maize\|gbl64\|EC895235 TI	maize	1179	Seq210.MAB8.15.rice	86
611	maize\|gbl64\|A1947795 T2	maize	1180	Seq325.MAB141.15.barley	80

Polyn ucleoti de SEQ ID NO:	Cluster name	Organism	Po/j’P eptid e SEQ ID NO:	Homolog to a polypeptide encoded by polynucleotide SEQ ID NO.	% Glob al identi ty
612	maize\|gbl64\|A1947974 T1	maize	1181	Seq227.MAB 19.15.sorghum	93
613	maize\|gbl64\|A1619086 T1	maize	1182	S eq3 46. M AB 15 3.15. sugarca ne	95
614	maize\|gbl64\|AA143925 T1	maize	1183	Seq221 .MAB15.15. sorghum	94
615	maize\|gbl64\|AW179463 T1	maize	1184	Seq321.ΜΑΒΙ 39.15.cotton	82
616	maize\|gbl64\|BE051802 T1	maize	1185	Seq231.MAB21.15.rice	89
617	maize\|gbl64\|A1942091 T1	maize	1186	Seq309.MAB 133.15.barley	89
618	maize\|gbl64\|A1944064 T1	maize	1187	Seq383.MAB 172.15. sugarca ne	96
619	maize\|gbl64\|T15319 T1	maize	1188	Seq276.MAB49.15.maize	96
620	maize\|gbl64\|A1782993 T1	maize	1189	Seq241.MAB28.15.rice	82
621	maize\|gbl64\|T26945 T1	maize	1190	Seq370.MAB 165.15.grape	80
622	maize\|gbl64\|A1941749 T1	maize	1191	Seq269.MAB45.15. wheat	91
623	maize\|gbl64\|A1891255 T1	maize	1192	Seq311. MAB 13 4.15 .barley	95
624	maize\|gbl64\|CD975046 T1	maize	1193	Seq203.MAB3.15.rice	88
625	maize\|gbl64\|AW360563 T1	maize	1194	Seq241.MAB28.15.rice	81
626	maize\|gbl64\|A1901860 T1	maize	1195	Seq259.MAB39.15.barley	85
627	maize gbl64 A1948098_Tl	maize	1196	Seq3 81 .MAB 171.15. sugarca ne	95
628	maize\|gbl64\|A1444730 T1	maize	1197	Seq241.MAB28.15.rice	83
629	maize\|gbl64\|AW216308 T1	maize	1198	Seq288.MAB 121.15.sugarca ne	89
630	maize\|gbl64\|BM268089 T1	maize	1199	Seq3 81 .MAB 171.15. sugarca ne	92
631	maize\|gbl64\|A1438597 T1	maize	1200	S eq3 52. MAB 15 5.15. sorghu m	91
632	maize\|gbl64\|AW927739 T1	maize	1201	Seq350.MAB 154.15.sugarca ne	97
633	maize\|gbl64\|A1891255 T2	maize	1202	Seq311. MAB 13 4.15 .barley	95
634	maize\|gbl64\|A1920760 T1	maize	1203	Seq286.MAB104.15.rice	89
635	medicago gbl57.2 A1974487 T1	medicago	1204	Seq370.MAB 165.15.grape	87
636	medicago\|gbl57.2\|BE325770 T1	medicago	1205	Seq256.MAB37.15.tomato	88
637	medicago\|gbl57.2\|AW685603 T1	medicago	1206	Seq376.MAB 168.15.grape	82
638	medicago\|gbl57.2\|AL368329 T1	medicago	1207	Seq311. MAB 13 4.15 .barley	80
639	medicago gbl 57.2 AW688497 T1	medicago	1208	Seq370.MAB 165.15.grape	80
640	medicago gbl57.2 AL377093 T1	medicago	1209	Seq224.MAB 17.15.soybean	80
641	medicago gbl57.2 A1974241 T1	medicago	1210	Seq334.MAB 146.15.tomato	83
642	medicago\|gbl57.2\|BF632135 T1	medicago	1211	Seq344.MAB 152.15.grape	85
643	melon\|gbl65\|DV633691 T1	melon	1212	Seq376.MAB 168.15.grape	80
644	melon\|gbl65\|DV632564 T1	melon	1213	Seq3 6 8. MAB 164.15 .barley	80
645	melon\|gbl65\|DV633584 T1	melon	1214	Seq344.MAB 152.15.grape	86
646	melon\|gbl65\|AM714958 Tl	melon	1215	Seq259.MAB39.15.barley	81

Polyn ucleoti de SEQ ID NO:	Cluster name	Organism	Po/yp eptid e SEQ ID NO:	Homolog to a polypeptide encoded by polynucleotide SEQ ID NO.	% Glob al identi ty
647	nicotiana benthamiana\|gbl62\| EH364164 T1	nicotiana bent hamiana	1216	Seq256.MAB37.15.tomato	95
648	oat\|gbl64\|CN816769 T1	oat	1217	Seq3 6 8. MAB164.15 .barley	94
649	oat\|gbl64\|BE439108 T1	oat	1218	Seq312.MAB134.10.barley	85
650	onion\|gbl62\|CF437899 T1	onion	1219	Seq256.MAB37.15.tomato	81
651	onion gbl62 CF437716 T1	onion	1220	Seq276.MAB49.15.maize	82
652	onion gbl62 CF439314 T1	onion	1221	Seq370.MAB 165.15.grape	80
653	papaya\|gbl65\|EX245596 T1	papaya	1222	Seq370.MAB 165.15.grape	88
654	papaya gb 165 EX299345 T1	papaya	1223	Seq263.MAB42.15.sorghum	82
655	papaya gb 165 EX248971 T1	papaya	1224	Seq3 62. MAB 161.15 .poplar	86
656	papaya\|gbl65\|EX227965 T1	papaya	1225	Seq332.MAB 144.15.grape	83
657	papaya\|gbl65\|EX264060 T1	papaya	1226	Seq376.MAB 168.15.grape	89
658	papaya\|gbl65\|EX291966 T1	papaya	1227	Seq370.MAB 165.15.grape	82
659	peach\|gbl57.2\|BU039922 T1	peach	1228	Seq300.MAB127.15.grape	82
660	peachgbl57.2BU039373 T1	peach	1229	Seq370.MAB 165.15.grape	83
661	peach\|gbl57.2\|AJ631618 T1	peach	1230	Seq276.MAB49.15.maize	80
662	peach\|gbl57.2\|BU040470 T1	peach	1231	Seq376.MAB 168.15.grape	89
663	peach gbl57.2 BU039381 T1	peach	1232	Seq256.MAB37.15.tomato	88
664	peanut\|gbl61\|ES754023 T1	peanut	1233	Seq332.MAB 144.15.grape	80
665	peanut\|gbl61\|EH043199 T1	peanut	1234	Seq256.MAB37.15.tomato	88
666	pepper gbl57.2 BM063531 T 1	pepper	1235	Seq256.MAB37.15.tomato	96
667	pepper\|gbl57.2\|BM062846 T 1	pepper	1236	Seq221 .MAB 15.15. sorghum	82
668	peppergbl57.2BM061776 T 1	pepper	1237	Seq329.MAB 143.15.tomato	90
669	pepper\|gbl57.2\|BM064151 T 1	pepper	1238	Seq306.MAB131.15.tomato	88
670	peppergbl57.2BM061313 T 1	pepper	1239	S eq211. MAB 9.15. arabidop si s	86
671	pepper gb 157.2 B1480604 T1	pepper	1240	Seq276.MAB49.15.maize	80
672	peri winkle \| gb 164\|EG559012 T1	periwinkle	1241	Seq259.MAB39.15.barley	80
673	petunia gbl57.2 CV292753 T 1	petunia	1242	S eq263. MAB 42.15. sorghum	80
674	petunia\|gbl57.2\|CV298220 T 1	petunia	1243	Seq283.MAB99.15.tomato	81
675	pine\|gbl57.2\|DR088714_Tl	pine	1244	Seq357.MAB157.15.sugarca ne	80
676	pine\|gbl57.2\|AW290504 T1	pine	1245	Seq344.MAB 152.15.grape	82
677	pineapple gb 157.2 CO731309 T1	pineapple	1246	Seq222.MAB16.15.rice	83
678	pineapple\|gbl57.2\|DT336648 T1	pineapple	1247	Seq376.MAB 168.15.grape	81
679	pineapple gb 157.2 CO731994 T1	pineapple	1248	Seq219.MAB14.15.rice	80
680	poplar\|gbl57.2\|A1162293 T1	poplar	1249	Seq298.MAB 126.15.grape	82
681	poplar\|gbl57.2\|A1165439 T1	poplar	1250	Seq298.MAB 126.15.grape	80
682	poplar\|gbl57.2\|A1162293 T3	poplar	1251	Seq298.MAB 126.15.grape	80
683	poplar\|gbl57.2\|B1120274 T3	poplar	1252	Seq256.MAB37.15.tomato	81
684	poplarjgb 157.2 B1120274 T2	poplar	1253	Seq344.MAB 152.15.grape	89

Polyn ucleoti de SEQ ID NO:	Cluster name	Organism	Polyp eptid e SEQ ID NO:	Homolog to a polypeptide encoded by polynucleotide SEQ ID NO.	% Glob al identi ty
685	poplar\|gbl57.2\|BF299457 T1	poplar	1254	Seq370.ΜΑΒΙ 65.15.grape	85
686	poplar\|gbl57.2\|B1120274 T1	poplar	1255	Seq344.MAB 152.15.grape	86
687	poplar\|gbl57.2\|B1122516 T1	poplar	1256	Seq3 62. MAB161.15 .poplar	90
688	poplar\|gbl57.2\|BU821689 T1	poplar	1257	Seq321. ΜΑΒΙ 39.15. cotton	81
689	poplar\|gbl57.2\|A1166955 T1	poplar	1258	Seq344.MAB 152.15.grape	87
690	poplar\|gbl57.2\|B1069450 T1	poplar	1259	Seq376.MAB 168.15.grape	85
691	potato\|gbl57.2\|BG594910 T1	potato	1260	Seq370.MAB 165.15.grape	82
692	potato\|gbl57.2\|AJ487418 T1	potato	1261	Seq321. MAB 139.15. cotton	82
693	potato\|gbl57.2\|BQ516076 T2	potato	1262	Seq3 89.MAB 175.15.tomato	97
694	potato\|gbl57.2\|BE921143_Tl	potato	1263	S eq3 49. MAB 15 4.15. sugarca ne	80
695	potato\|gbl57.2\|BG592541 T1	potato	1264	Seq256.MAB37.15.tomato	90
696	potato\|gbl57.2\|BF052848 T1	potato	1265	Seq321. MAB 139.15. cotton	81
697	potato gb 157.2 BF460150 T1	potato	1266	Seq370.MAB 165.15.grape	84
698	potato\|gbl57.2\|BG097985 T1	potato	1267	Seq303.MAB 129.15.tomato	91
699	potato\|gbl57.2\|BE923564 T1	potato	1268	Seq342. MAB 151.15 .potato	90
700	potato\|gbl57.2\|X86021 T1	potato	1269	Seq334.MAB 146.15.tomato	97
701	potato\|gbl57.2\|BG594768 T1	potato	1270	Seq329.MAB 143.15.tomato	97
702	potato\|gbl57.2\|BF154203 T1	potato	1271	Seq256.MAB37.15.tomato	98
703	potato\|gbl57.2\|BE344306 T1	potato	1272	Seq357.MAB 157.15. sugarca ne	82
704	potato\|gbl57.2\|BF460309 T1	potato	1273	Seq329.MAB 143.15.tomato	98
705	potato\|gbl57.2\|BQ516076 T1	potato	1274	Seq3 90.MAB 175.15 .tomato	96
706	potato\|gbl57.2\|B1176616 T1	potato	1275	Seq256.MAB37.15.tomato	88
707	potato\|gbl57.2\|BQ 117692 T1	potato	1276	Seq354.MAB 156.15.tobacco	86
708	potato\|gbl57.2\|AJ487418 T2	potato	1277	Seq321. MAB 139.15. cotton	81
709	potato\|gbl57.2\|BG351229_Tl	potato	1278	Seq357.MAB 157.15. sugarca ne	81
710	potato\|gbl57.2\|AJ487418 T3	potato	1279	Seq321. MAB 139.15. cotton	84
711	potato\|gbl57.2\|BF154154 T1	potato	1280	Seq256.MAB37.15.tomato	99
712	radish\|gbl64\|EY895633 T1	radish	1281	Seq373. MAB 167.15. canola	93
713	radish\|gb 164\|EX772944_T 1	radish	1282	Seq356.MAB 157.15. sugarca ne	83
714	radish\|gbl64\|EW725846 T1	radish	1283	Seq237.MAB25.15.arabidop sis	84
715	radish\|gbl64\|EV527306 T1	radish	1284	Seq229.MAB20.15.arabidop sis	94
716	radish\|gbl64\|EV565850 T1	radish	1285	Seq277.MAB50.15.arabidop sis	90
717	radish\|gbl64\|EX772722 T1	radish	1286	Seq360. MAB 159.15. canola	88
718	radish gb 164 EX775718 T1	radish	1287	Seq376.MAB 168.15.grape	81
719	radishgbl64 EV535278 T1	radish	1288	Seq360. MAB 159.15. canola	81
720	radish\|gbl64\|EV565334 T1	radish	1289	S eq211. MAB 9.15. arabidop si s	91
721	radish gbl 64 EV528083_Tl	radish	1290	Seq252.MAB35.15.arabidop sis	80
722	radish\|gbl64\|T25168 T1	radish	1291	Seq376.MAB 168.15.grape	80
723	radish\|gbl64\|EV544010 T1	radish	1292	Seq229.MAB20.15 .arabidop sis	91
724	radish\|gb 164 \|E W713 752 T 1	radish	1293	Seq373. MAB 167.15. canola	86

Polyn ucleoti de SEQ ID NO:	Cluster name	Organism	Po/j’P eptid e SEQ ID NO:	Homolog to a polypeptide encoded by polynucleotide SEQ ID NO.	% Glob al identi ty
725	radish\|gbl64\|EV568565 T1	radish	1294	Seq284.MAB100.15.arabido psis	88
726	radish\|gbl64\|EV543867 T1	radish	1295	Seq373. MAB 167.15. canola	88
727	radish\|gb 164\|EX770974_T 1	radish	1296	S eq211. MAB 9.15. arabidop si s	85
728	radish\|gbl64\|EV566819 T1	radish	1297	Seq217 .MAB 13.15. arabidop sis	81
729	rice\|gbl57.2\|NM001059403 T 1	rice	1298	Seq261.MAB40.15.rice	84
730	rice\|gbl57.2\|C28755 T1	rice	1299	Seq321.MAB 139.15.cotton	80
731	rice\|gbl57.2\|AA750806 T1	rice	1300	Seq290.MAB 122.15.maize	83
732	rice gb 157.2 AA751345 T1	rice	1301	Seq321.MAB 139.15.cotton	80
733	rice\|gbl57.2\|BE040195_T6	rice	1302	Seq346.MAB153.15.sugarca ne	95
734	rice\|gbl57.2\|Bll 18752 T1	rice	1303	Seq276.MAB49.15.maize	94
735	rice\|gbl57.2\|AW070148_Tl	rice	1304	Seq350.MAB154.15.sugarca ne	87
736	rice\|gbl57.2\|AW069929 T1	rice	1305	Seq309.MAB 133.15.barley	93
737	ricegbl57.2 AW070094 T1	rice	1306	Seq274.MAB48.15.rice	83
738	rice\|gbl57.2\|AA753115 T4	rice	1307	Seq259.MAB39.15.barley	90
739	rice\|gbl57.2\|B1795037 T4	rice	1308	Seq385.MAB173.15.barley	100
740	rice\|gbl57.2\|AU092454 T1	rice	1309	Seq274.MAB48.15.rice	100
741	rice gbl57.2 AA753115 T3	rice	1310	Seq259.MAB39.15.barley	91
742	rice\|gbl57.2\|BE040195_Tl	rice	1311	Seq346.MAB153.15.sugarca ne	91
743	rice\|gbl57.2\|CB624284 T1	rice	1312	Seq264.MAB42.10.sorghum	82
744	rice\|gbl57.2\|AU030125_T3	rice	1313	Seq357.MAB157.15.sugarca ne	88
745	rice\|gbl57.2\|ALH64313 T1	rice	1314	Seq270.MAB45.15. wheat	84
746	rice\|gbl57.2\|B1799463 T1	rice	1315	Seq221 .MAB 15.15. sorghum	85
747	rice\|gbl57.2\|AW070094 T3	rice	1316	Seq274.MAB48.15.rice	80
748	rice\|gbl57.2\|AA753115 T1	rice	1317	Seq259.MAB39.15.barley	91
749	rice\|gbl57.2\|AU093322 T2	rice	1318	S eq228. MAB 19.15. sorghum	85
750	rice\|gbl57.2\|AU030125 T1	rice	1319	S eq263. MAB 42.15. sorghum	80
751	rice gb 157.2 AA752703 T1	rice	1320	Seq295.MAB125.15.rice	88
752	rice\|gbl57.2\|NM001067464 T 1	rice	1321	Seq205.MAB4.15.rice	93
753	rice\|gbl57.2\|NM001052309 T 1	rice	1322	Seq295.MAB125.15.rice	91
754	rice\|gbl57.2\|CA763128 T2	rice	1323	Seq219.MAB14.15.rice	80
755	rice\|gbl57.2\|AW070148_T2	rice	1324	Seq348.MAB154.15.sugarca ne	87
756	rice\|gbl57.2\|AU093322 T1	rice	1325	S eq228. MAB 19.15. sorghum	86
757	rice gbl57.2 AA753115 T5	rice	1326	Seq259.MAB39.15.barley	94
758	rice\|gbl57.2\|AU030125 T4	rice	1327	S eq263. MAB 42.15. sorghum	80
759	rye\|gbl64\|BF429408 T1	rye	1328	Seq309.MAB 133.15.barley	97
760	rye\|gbl64\|BE494847 T1	rye	1329	Seq3 6 8. MAB 164.15 .barley	97
761	safflower\|gbl62\|EL373402 T 1	safflower	1330	Seq376.MAB 168.15.grape	81
762	safflower\|gbl62\|EL374175 T 1	safflower	1331	Seq259.MAB39.15.barley	83

Polyn ucleoti de SEQ ID NO:	Cluster name	Organism	Po/yp eptid e SEQ ID NO:	Homolog to a polypeptide encoded by polynucleotide SEQ ID NO.	% Glob al identi ty
763	safflower\|gbl62\|EL377332 T 1	safflower	1332	Seq385.MAB173.15.barley	81
764	safflower gb 162 EL3 73487 T 1	safflower	1333	S eq263. MAB 42.15. sorghum	80
765	safflower\|gbl62\|EL374095 T 1	safflower	1334	Seq256.MAB37.15.tomato	86
766	safflower\|gbl62\|EL3 82051 T 1	safflower	1335	Seq256.MAB37.15.tomato	86
767	safflowergbl62EL409148 T 1	safflower	1336	Seq385.MAB173.15.barley	80
768	sorghum\|gb 161. xeno \| A W2249 27 Tl	sorghum	1337	Seq288.MAB121.15.sugarca ne	94
769	sorghum\|gb 161 .xeno \|T26945 T2	sorghum	1338	Seq370.MAB 165.15.grape	81
770	sorghum\|gb 161 .xeno\|A193217 9 T3	sorghum	1339	Seq286.MAB104.15.rice	91
771	sorghum\|gb 161. xeno \|T 15 319 Tl	sorghum	1340	Seq276.MAB49.15.maize	97
772	sorghum\|gb 161 .xeno \| Al 61521 5 Tl	sorghum	1341	Seq248.MAB33.15.maize	92
773	sorghum\|gb 161 .xeno\|BG 1020 66 T2	sorghum	1342	Seq290.MAB 122.15.maize	90
774	sorghum\| gb 161. xeno \| AW6724 19 T2	sorghum	1343	Seq276.MAB49.15.maize	97
775	sorghum\| gb 161. xeno \| AW6724 19 T3	sorghum	1344	Seq276.MAB49.15.maize	95
776	sorghum\|gb 161. xeno \| A19018 6 0 Tl	sorghum	1345	Seq259.MAB39.15.barley	84
777	sorghum\|gb 161 .xeno \| A162199 5 T3	sorghum	1346	Seq384.MAB172.15.sugarca ne	97
778	sorghum gb 161 .xeno A18 8141 8 T2	sorghum	1347	Seq264.MAB42.10.sorghum	100
779	sorghum gb 161 .xeno Al 8 9125 5 Tl	sorghum	1348	Seq311. MAB 13 4.15 .barley	95
780	sorghum gb 161 .xeno A178299 3 Tl	sorghum	1349	Seq241.MAB28.15.rice	84
781	sorghum\|gb 161 .xeno \| A172462 9 Tl	sorghum	1350	Seq350.MAB154.15.sugarca ne	99
782	sorghum\|gb 161 .xeno\| AA1439 25 Tl	sorghum	1351	Seq221 .MAB 15.15. sorghum	100
783	sorghum\|gb 161 .xeno \| A162199 5 T2	sorghum	1352	Seq383.MAB172.15.sugarca ne	99
784	sorghum\|gb 161 .xeno \|T26945 Tl	sorghum	1353	Seq370.MAB 165.15.grape	81
785	sorghum\|gb 161. xeno \| A W1794 63 Tl	sorghum	1354	Seq321.MAB 139.15.cotton	80
786	sorghum\|gb 161 .xeno\|ZMU909 44 T2	sorghum	1355	Seq367.MAB 163.15.barley	80
787	sorghum\|gb 161. xeno \|T 15 319 T2	sorghum	1356	Seq276.MAB49.15.maize	95
788	sorghum\|gb 161 .xeno \| A162199 5 T1	sorghum	1357	Seq383.MAB172.15.sugarca ne	99

Polyn ucleoti de SEQ ID NO:	Cluster name	Organism	Po/yp eptid e SEQ ID NO:	Homolog to a polypeptide encoded by polynucleotide SEQ ID NO.	% Glob al identi ty
789	sorghum\|gb 161 .xeno\|A193217 9 TI	sorghum	1358	Seq286.MAB104.15.rice	90
790	sorghum\|gb 161 .xeno \| A162199 5 T4	sorghum	1359	Seq383.MAB172.15.sugarca ne	99
791	sorghum\|gb 161 .xeno\|ZMU909 44 T3	sorghum	1360	Seq367.MAB 163.15.barley	80
792	sorghum\|gb 161 .xeno\| A166522 9 T2	sorghum	1361	Seq346.MAB153.15.sugarca ne	96
793	sorghum gb 161. xeno A193 9 8 3 6 TI	sorghum	1362	Seq309.MAB 133.15.barley	92
794	sorghum\|gb 161 .xeno\|B109906 8 TI	sorghum	1363	Seq270.MAB45.15. wheat	83
795	sorghum\|gb 161 .xeno \| A166522 9 TI	sorghum	1364	Seq346.MAB153.15.sugarca ne	96
796	sorghum\| gb 161. xeno \| AW6724 19 TI	sorghum	1365	Seq276.MAB49.15.maize	97
797	sorghum\|gb 161. xeno \| A W4982 83 TI	sorghum	1366	Seq210.MAB8.15.rice	83
798	sorghum\|gb 161. xeno \| A W9237 75 TI	sorghum	1367	Seq231.MAB21.15.rice	88
799	sorghum\|gb 161. xeno \|T 15 319 T3	sorghum	1368	Seq276.MAB49.15.maize	85
800	soybeangbl62BG839539 TI	soybean	1369	Seq3 6 8. MAB 164.15 .barley	80
801	soybeangb 162 CA783290 TI	soybean	1370	Seq259.MAB39.15.barley	81
802	soybean\|gbl62\|BU551043 TI	soybean	1371	Seq256.MAB37.15.tomato	88
803	soybean gbl 62 EV282184 TI	soybean	1372	Seq371.MAB 166.15.poplar	82
804	soybean\|gbl62\|B1967468 TI	soybean	1373	Seq3 6 8. MAB 164.15 .barley	80
805	soybean gb 162 B1321879 TI	soybean	1374	Seq259.MAB39.15.barley	81
806	soybean\|gbl62\|AW132704 TI	soybean	1375	Seq256.MAB37.15.tomato	90
807	soybean\|gbl62\|BU764498 TI	soybean	1376	Seq256.MAB37.15.tomato	86
808	soybean\|gbl62\|CA953156 TI	soybean	1377	Seq298.MAB 126.15.grape	80
809	soybeangb 162 CF922618 TI	soybean	1378	Seq259.MAB39.15.barley	84
810	soybean\|gbl62\|BU544425 TI	soybean	1379	Seq357.MAB157.15.sugarca ne	81
811	soybean\|gbl62\|BU765332 TI	soybean	1380	Seq233.MAB22.15.tomato	80
812	soybean\|gbl62\|CA936077 TI	soybean	1381	Seq376.MAB 168.15.grape	83
813	soybean\|gbl62\|BE823013 TI	soybean	1382	Seq376.MAB 168.15.grape	83
814	soybean\|gbl62\|CD417415 TI	soybean	1383	Seq370.MAB 165.15.grape	85
815	soybean\|gbl62\|BE660691 TI	soybean	1384	Seq3 62. MAB 161.15 .poplar	81
816	soybean\|gbl62\|CD395628 TI	soybean	1385	Seq370.MAB 165.15.grape	82
817	soybean\|gbl62\|BU549206 T2	soybean	1386	Seq259.MAB39.15.barley	80
818	soybean\|gbl62\|AW351120 TI	soybean	1387	Seq298.MAB 126.15.grape	82
819	soybean\|gbl62\|AWl32704 T2	soybean	1388	Seq256.MAB37.15.tomato	90
820	soybeangb 162 BE584244 TI	soybean	1389	Seq256.MAB37.15.tomato	91
821	spruce\|gbl62\|CO234968 TI	spruce	1390	Seq344.MAB 152.15.grape	83
822	spurge\|gbl61\|DV146052 TI	spurge	1391	Seq357.MAB157.15.sugarca ne	81
823	spurge gbl61 DV127024 TI	spurge	1392	Seq344.MAB 152.15.grape	83
824	spurge gbl61 DV124157 TI	spurge	1393	Seq376.MAB 168.15.grape	85
825	strawberry gbl 64 EX683450 TI	strawberry	1394	Seq348.MAB154.15.sugarca ne	81

Polyn ucleoti de SEQ ID NO:	Cluster name	Organism	eptid e SEQ ID NO:	Homolog to a polypeptide encoded by polynucleotide SEQ ID NO.	% Glob al identi ty
826	strawberry\|gbl64\|EX683265 T1	strawberry	1395	Seq370.MAB 165.15.grape	81
827	strawberry\|gbl64\|DY675409 T1	strawberry	1396	Seq256.MAB37.15.tomato	81
828	sugarcane\|gb 157.2\|CA115287 T1	sugarcane	1397	Seq357.MAB157.15.sugarca ne	88
829	sugarcane\|gbl57.2\|CA216001 T1	sugarcane	1398	Seq259.MAB39.15.barley	85
830	sugarcane gb 157.2 CA072819 T1	sugarcane	1399	Seq241.MAB28.15.rice	83
831	sugarcane\|gbl57.2\|CA125036 T1	sugarcane	1400	Seq291 .MAB 123.15 .barley	82
832	sugarcane\|gbl57.2\|CA071646 T1	sugarcane	1401	Seq286.MAB104.15.rice	90
833	sugarcane gb 157.2 CAI 17936 T2	sugarcane	1402	S eq228. MAB 19.15. sorghum	93
834	sugarcane\|gbl57.2\|BQ537163 T1	sugarcane	1403	Seq276.MAB49.15.maize	96
835	sugarcane\|gbl57.2\|CA074253 T1	sugarcane	1404	Seq241.MAB28.15.rice	83
836	sugarcane\|gbl57.2\|CA102030 T1	sugarcane	1405	Seq385.MAB173.15.barley	85
837	sugarcane gb 157.2 CA068084 T1	sugarcane	1406	Seq366.MAB 163.15.barley	80
838	sugarcane gb 157.2 CA233048 T1	sugarcane	1407	Seq290.MAB 122.15.maize	80
839	sugarcane gb 157.2 CA090429 T1	sugarcane	1408	Seq288.MAB121.15.sugarca ne	95
840	sugarcane gb 157.2 CA095299 T1	sugarcane	1409	Seq370.MAB 165.15.grape	80
841	sugarcane gb 157.2 BQ533298 T1	sugarcane	1410	Seq311. MAB 13 4.15 .barley	95
842	sugarcane\|gbl57.2\|CA107649 T1	sugarcane	1411	Seq248.MAB33.15.maize	90
843	sugarcane\|gbl57.2\|BQ536274 T1	sugarcane	1412	Seq231.MAB21.15.rice	88
844	sugarcane gb 157.2 CAI 17936 T1	sugarcane	1413	S eq228. MAB 19.15. sorghum	94
845	sugarcane gb 157.2 BQ533234 T1	sugarcane	1414	Seq221 .MAB 15.15. sorghum	99
846	sugarcane\|gbl57.2\|CA072307 T1	sugarcane	1415	Seq309.MAB 133.15.barley	93
847	sugarcane\|gbl57.2\|CA073476 T1	sugarcane	1416	Seq290.MAB 122.15.maize	91
848	sugarcane\|gbl57.2\|CA065809 T1	sugarcane	1417	Seq366.MAB 163.15.barley	80
849	sugarcane\|gbl57.2\|CA072307 T2	sugarcane	1418	Seq309.MAB 133.15.barley	93
850	sunflower\|gbl62\|DY909111 T 1	sunflower	1419	Seq336.MAB 147.15.tobacco	83
851	sunflower\|gbl62\|DY941035 T 1	sunflower	1420	Seq376.MAB 168.15.grape	82

Polyn ucleoti de SEQ ID NO:	Cluster name	Organism	Po/j’P eptid e SEQ ID NO:	Homolog to a polypeptide encoded by polynucleotide SEQ ID NO.	% Glob al identi ty
852	sunflower gbl62 CD857487 T 1	sunflower	1421	Seq370.MAB 165.15.grape	81
853	sunflower\|gbl62\|DY942252 T 1	sunflower	1422	Seq311. MAB 13 4.15 .barley	80
854	sunflowergbl62 CD850784 T 1	sunflower	1423	Seq256.MAB37.15.tomato	83
855	sunflowergbl62 BQ968872 T 1	sunflower	1424	Seq357.MAB157.15.sugarca ne	83
856	sunflower\|gbl62\|EE616266 T 1	sunflower	1425	Seq256.MAB37.15.tomato	84
857	sunflower\|gbl62\|EE641694 T 1	sunflower	1426	Seq256.MAB37.15.tomato	84
858	sunflower\|gbl62\|DY924220 T 1	sunflower	1427	Seq259.MAB39.15.barley	81
859	sunflower\|gbl62\|DY910907 T 1	sunflower	1428	Seq370.MAB 165.15.grape	80
860	sunflower\|gbl62\|AY029172 T 1	sunflower	1429	Seq321.MAB 139.15.cotton	81
861	sunflower\|gbl62\|DY909077 T 1	sunflower	1430	S eq3 21. MAB 139.15.cotton	80
862	sunflower\|gbl62\|DY921635 T 1	sunflower	1431	Seq376.MAB 168.15.grape	83
863	sunflowergbl62DY913894 T 1	sunflower	1432	Seq256.MAB37.15.tomato	82
864	switchgrass gb 165 FE608718 T1	switchgrass	1433	Seq370.MAB 165.15.grape	81
865	switchgrass\|gb 165 \|FE6245 81 T1	switchgrass	1434	Seq3 3 3 .MAB 145.15 .barley	87
866	switchgrass\|gbl65\|FE604798 T1	switchgrass	1435	Seq269.MAB45.15. wheat	90
867	switchgrass\|gbl65\|DN151012 T1	switchgrass	1436	Seq309.MAB 133.15.barley	90
868	switchgrass\|gb 165\|FE619903 T1	switchgrass	1437	Seq383.MAB 172.15.sugarca ne	95
869	switchgrass\|gbl 65 \|DN 144676 T1	switchgrass	1438	Seq385.MAB173.15.barley	87
870	switchgrass\|gbl65\|FE609872 T1	switchgrass	1439	S eq228. MAB 19.15. sorghum	89
871	switchgrass\|gbl 65 \|FE617860 T1	switchgrass	1440	Seq3 81 .MAB 171.15. sugarca ne	88
872	switchgrass\|gbl65\|DN145750 T1	switchgrass	1441	Seq221 .MAB 15.15. sorghum	95
873	switchgrass gb 165 FE597811 T1	switchgrass	1442	Seq248.MAB33.15.maize	83
874	switchgrass\|gb 165\|FE647199 T1	switchgrass	1443	Seq3 81 .MAB 171.15. sugarca ne	90
875	switchgrass\|gbl65\|DN145034 T1	switchgrass	1444	Seq276.MAB49.15.maize	95
876	switchgrass\|gb 165 \|FE617335 T1	switchgrass	1445	Seq286.MAB104.15.rice	91
877	switchgrass gb 165 FE597809 T1	switchgrass	1446	Seq350.MAB 154.15.sugarca ne	95

Polyn ucleoti de SEQ ID NO:	Cluster name	Organism	/Y/j’P eptid e SEQ ID NO:	Homolog to a polypeptide encoded by polynucleotide SEQ ID NO.	% Glob al identi ty
878	switchgrass gbl65 FE597811 T2	switchgrass	1447	Seq248.MAB33.15.maize	85
879	switchgrass\|gbl65\|FE635691 T1	switchgrass	1448	Seq311. MAB 13 4.15 .barley	95
880	switchgrass\|gbl65\|FE653022 T1	switchgrass	1449	Seq385.MAB173.15.barley	83
881	switchgrass\|gb 165 \|DN 144793 T1	switchgrass	1450	Seq259.MAB39.15.barley	90
882	switchgrass\|gbl65\|FE641674 T1	switchgrass	1451	Seq309.MAB 133.15.barley	89
883	thellungiella\|gbl57.2\|DN7756 06 T1	thellungiella	1452	Seq212 .MAB 10.15. arabidop sis	82
884	thellungiella \|gbl57.2\|DN7732 28 T1	thellungiella	1453	S eq211. MAB 9.15. arabidop si s	98
885	thellungiella\|gbl57.2\|DN7727 71 T1	thellungiella	1454	S eq208. MAB 7.15. arabidop si s	89
886	thellungiella gbl 57.2DN7744 22 T1	thellungiella	1455	Seq360.MAB 159.15.canola	83
887	thellungiella gb 157.2 DN7741 40 T1	thellungiella	1456	Seq284.MAB100.15.arabido psis	86
888	tobacco\|gbl62\|DW003503 T1	tobacco	1457	Seq329.MAB 143.15.tomato	93
889	tobacco\|gbl62\|BP532373 T1	tobacco	1458	Seq357.MAB157.15.sugarca ne	82
890	tobaccogbl62 CN949739 T1	tobacco	1459	Seq370.MAB 165.15.grape	84
891	tobacco gbl62BQ843111 T1	tobacco	1460	Seq319. MAB 138.15 .potato	90
892	tobacco\|gbl62\|EB683054 T1	tobacco	1461	Seq307.MAB131.15.tomato	89
893	tobacco gbl 62 EB428197 T1	tobacco	1462	Seq222.MAB16.15.rice	80
894	tobacco\|gbl62\|EB445060 T1	tobacco	1463	Seq283.MAB99.15.tomato	90
895	tobacco\|gbl62\|EB447202 T1	tobacco	1464	Seq3 90.MAB 175.15 .tomato	88
896	tobacco\|gbl62\|DW001113 T1	tobacco	1465	Seq256.MAB37.15.tomato	88
897	tobacco\|gbl62\|EH623692 T1	tobacco	1466	Seq303.MAB 129.15.tomato	85
898	tomato\|gbl64\|BG127210 T1	tomato	1467	Seq342. MAB 151.15 .potato	82
899	tomato gbl64 BG128089 T2	tomato	1468	Seq222.MAB16.15.rice	80
900	tomato\|gbl64\|AW219181 T1	tomato	1469	Seq256.MAB37.15.tomato	90
901	tomato\|gbl64\|BG127288 T1	tomato	1470	Seq370.MAB 165.15.grape	83
902	tomato\|gbl64\|BG133509 T1	tomato	1471	Seq256.MAB37.15.tomato	88
903	tomato gbl64 BG131241 T1	tomato	1472	Seq309.MAB 133.15.barley	80
904	tomato\|gbl64\|BG129621_Tl	tomato	1473	Seq350.MAB154.15.sugarca ne	80
905	tomato\|gbl64\|A1779004 T1	tomato	1474	Seq309.MAB 133.15.barley	81
906	tomato\|gbl64\|BG129572 T1	tomato	1475	Seq321.MAB 139.15.cotton	80
907	tomato\|gbl64\|BG135408 T1	tomato	1476	Seq319. MAB 138.15 .potato	98
908	triphysaria gbl64DRl 73028 T1	triphysaria	1477	Seq329.MAB 143.15.tomato	81
909	triphysaria\|gb 164\|BM3 57524 T2	triphysaria	1478	Seq283.MAB99.15.tomato	85
910	triphysaria gb 164 E Y13 3 83 8 T1	triphysaria	1479	Seq311. MAB 13 4.15 .barley	80
911	triphysaria\|gbl64\|BM357406 T1	triphysaria	1480	Seq329.MAB 143.15.tomato	83
912	triphysaria\|gbl64\|BM357011 T1	triphysaria	1481	Seq259.MAB39.15.barley	80

Polyn ucleoti de SEQ ID NO:	Cluster name	Organism	Po/j’P eptid e SEQ ID NO:	Homolog to a polypeptide encoded by polynucleotide SEQ ID NO.	% Glob al identi ty
913	triphysaria\|gb 164\|BM3 57524 T1	triphysaria	1482	Seq376.MAB 168.15.grape	85
914	triphysaria\|gb 164 \|E Y137290 T1	triphysaria	1483	Seq256.MAB37.15.tomato	88
915	wheat\|gbl64\|CA484259 T1	wheat	1484	Seq241.MAB28.15.rice	84
916	wheat\|gbl64\|BE606422 T1	wheat	1485	Seq379.MAB170.15.barley	96
917	wheat\|gbl64\|BE406378 T1	wheat	1486	Seq219.MAB14.15.rice	80
918	wheat gb 164 BE470780 T1	wheat	1487	Seq221 .MAB 15.15. sorghum	84
919	wheat gb 164 BE418087 T1	wheat	1488	Seq325.MAB141.15.barley	95
920	wheat\|gbl64\|BQ294643 T1	wheat	1489	Seq269.MAB45.15. wheat	94
921	wheat\|gbl64\|BE415314 T1	wheat	1490	Seq250.MAB34.15.barley	82
922	wheat\|gbl64\|AL822647 T1	wheat	1491	Seq259.MAB39.15.barley	98
923	wheat\|gbl64\|BE406667 T1	wheat	1492	Seq250.MAB34.15.barley	89
924	wheat\|gbl64\|BF475039 T1	wheat	1493	Seq221 .MAB 15.15. sorghum	83
925	wheatgbl64 CK196180 T1	wheat	1494	Seq323.MAB 140.15.barley	80
926	wheat\|gbl64\|BE403745 T1	wheat	1495	Seq379.MAB170.15.barley	97
927	wheat\|gbl64\|BQ620260 T1	wheat	1496	Seq311. MAB 13 4.15 .barley	100
928	wheat\|gbl64\|BM138204 T1	wheat	1497	Seq3 3 3 .MAB 145.15 .barley	91
929	wheat\|gbl64\|BE401114 T1	wheat	1498	Seq291 .MAB 123.15 .barley	94
930	wheat\|gbl64\|BE498161 T1	wheat	1499	Seq3 88.MAB 174.15.barley	93
931	wheat\|gbl64\|BQ744502 T1	wheat	1500	Seq250.MAB34.15.barley	85
932	wheat\|gbl64\|BE415172 T1	wheat	1501	Seq366.MAB 163.15.barley	94
933	wheat\|gbl64\|CD490875 T1	wheat	1502	Seq276.MAB49.15.maize	97
934	wheat gbl 64 CA625741 T1	wheat	1503	Seq309.MAB 133.15.barley	87
935	wheat\|gbl64\|BE443720 T1	wheat	1504	Seq318.MAB 137.15.barley	94
936	wheat\|gbl64\|BE420294 T1	wheat	1505	Seq290.MAB 122.15.maize	84
937	wheat\|gbl64\|BE516581 T1	wheat	1506	Seq387.MAB174.15.barley	95
938	wheat\|gbl64\|BE406039 T1	wheat	1507	Seq3 3 3 .MAB 145.15 .barley	90
939	wheat\|gbl64\|BM136483 T1	wheat	1508	Seq3 3 3 .MAB 145.15 .barley	92
940	wheat\|gbl64\|BE425976 T1	wheat	1509	Seq250.MAB34.15.barley	81
941	wheatgbl64 CN011148 T1	wheat	1510	Seq270.MAB45.15. wheat	84
942	wheat\|gbl64\|BE419039 T1	wheat	1511	Seq250.MAB34.15.barley	80
943	wheat\|gbl64\|CA603413 T1	wheat	1512	Seq323.MAB 140.15.barley	85
944	wheatgbl64CA743309 T1	wheat	1513	Seq321. MAB 139.15. cotton	80
945	wheatgbl64 BG262336 T1	wheat	1514	Seq366.MAB 163.15.barley	94
946	wheatgbl64 CD881765 T1	wheat	1515	Seq219.MAB14.15.rice	80
947	wheat\|gbl 64 \|BE3 52629 T1	wheat	1516	Seq291 .MAB 123.15 .barley	96
948	wheat\|gbl64\|BE398656 T1	wheat	1517	Seq308.MAB 132.15.barley	97
949	wheat\|gbl64\|BE403195 T1	wheat	1518	Seq291 .MAB 123.15 .barley	94
950	wheatgbl64 BE488904 T1	wheat	1519	Seq367.MAB 163.15.barley	91
951	wheat gb 164 BE492528 T1	wheat	1520	Seq311. MAB 13 4.15 .barley	100
952	wheat gbl64 BE427383 T1	wheat	1521	Seq219.MAB14.15.rice	80
953	wheat\|gbl64\|CA646957 T1	wheat	1522	Seq250.MAB34.15.barley	89
954	wheat\|gbl64\|BE443720 T2	wheat	1523	Seq318.MAB 137.15.barley	92
955	wheat gb 164 BE490408 T1	wheat	1524	Seq264.MAB42.10.sorghum	81
956	wheat\|gbl64\|BE420295 T1	wheat	1525	Seq379.MAB170.15.barley	96
957	wheat gb 164 AL825998 T1	wheat	1526	Seq308.MAB 132.15.barley	97
958	wheat\|gbl64\|CA693465 T1	wheat	1527	Seq308.MAB 132.15.barley	97
959	wheat\|gbl64\|BE585772 T1	wheat	1528	Seq366.MAB 163.15.barley	95
960	wheat gb 164\|CA613 914_T 1	wheat	1529	Seq356.MAB157.15.sugarca ne	84

2017228711 15 Sep 2017

Polyn ucleoti de SEQ ID NO:	Cluster name	Organism	Polyp eptid e SEQ ID NO:	Homolog to a polypeptide encoded by polynucleotide SEQ ID NO.	% Glob al identi ty
1656	>tomato\|gbl64\|BG129621 T 1	tomato	1660	Seql649. MAB66.tomato	82
1657	potato\|gbl57.2\|BE921143_Tl	potato	1661	Seql649. MAB66.tomato	82
1658	pepper\|gbl57.2\|BM061807 T 1	pepper	1662	Seql649. MAB66.tomato	80
1659	>triphysaria\|gb 164\|BM35701 1_T1	triphysaria	1663	Seql649. MAB66.tomato	80

Table 2: *- Homology was calculated as % of identity over the aligned sequences. The query sequences were polynucleotide sequences SEQ ID NOs:l, 3, 5, 7, 9, 10, 11, 13, 15, 16, 17, 19, 21, 23, 25, 26, 28, 29, 30, 32, 34, 36, 37, 38, 40, 42, 44, 46, 48, 50, 52, 54, 55, 57, 59, 61, 63, 65, 67, 69, 71 ,73 ,75 ,77, 79, 81, 82, 84, 86, 88, 90, 91, 93, 94, 96, 98, 100, 101, 103, 105, 107, 109, 111, 113, 115, 116, 118, 119, 121, 122, 124, 126, 128, 130, 132, 134, 135, 138, 140, 142, 143, 145, 147, 149, 151, 153, 155, 157, 161, 163, 165, 168, 169, 170, 171, 173, 175, 177, 179, 180, 182, 184, 186, 188, 190, 192, 194, 196, 198 and 1649, and the subject sequences are protein sequences identified in the database based on greater than 80 % identity to the predicted translated sequences of the query nucleotide sequences. Shown are the homologous polypeptides and the polynucleotides encoding same.

EXAMPLE 2

GENERA TING THE PUTA TIVE ABST GENES

Several DNA sequences of the ABST genes are synthesized by GeneArt (Hypertext Transfer Protocol://World Wide Web (dot) geneart (dot) com/). Synthetic DNA is designed in silico, based on the encoded amino-acid sequences of the ABST genes and using codon-usage Tables calculated from plant transcrip tomes (example of such Tables can be found in the Codon Usage Database available online at Hypertext Transfer Protocol://World Wide Web (dot) kazusa (dot) or (dot) jp/codon/). The optimized coding sequences are designed in a way that no changes are introduced in the encoded amino acid sequence while using codons preferred for expression in dicotyledonous plants (mainly tomato and Arabidopsis) and monocotyledonous plants such as maize. At least one silent mutation per 20 nucleotide base pairs is introduced in the sequence compared to the original sequences to avoid possible silencing when overexpressing the gene in the target crop. To the optimized sequences the following restriction enzymes sites are added- Sall, Xbal, BamBI, Smal at the 5' end and Sad at the 3' end. The sequences synthesized by the supplier (GeneArt, Gmbh) are cloned in the pCR-Script plasmid.

2017228711 15 Sep 2017

EXAMPLE 3

GENE CLONING AND GENERATION OF BINARY VECTORS FOR PLANT EXPRESSION

To validate their role in improving ABST and yield, selected genes were overexpressed in plants, as follows.

Cloning strategy

Selected genes from those presented in Example 1 were cloned into binary vectors for the generation of transgenic plants. For cloning, the full-length open reading frames (ORFs) were identified. EST clusters and in some cases mRNA sequences were analyzed to identify the entire open reading frame by comparing the results of several translation algorithms to known proteins from other plant species.

In order to clone the full-length cDNAs, reverse transcription (RT) followed by polymerase chain reaction (PCR; RT-PCR) was performed on total RNA extracted from leaves, roots or other plant tissues, growing under either normal or nutrient deficient conditions. Total RNA extraction, production of cDNA and PCR amplification was performed using standard protocols described elsewhere (Sambrook J., E.F. Fritsch, and T. Maniatis. 1989. Molecular Cloning. A Laboratory Manual., 2nd Ed. Cold Spring Harbor Laboratory Press, New York.) which are well known to those skilled in the art. PCR products were purified using PCR purification kit (Qiagen)

Usually, 2 sets of primers were prepared for the amplification of each gene, via nested PCR (meaning first amplifying the gene using external primers and then using the produced PCR product as a template for a second PCR reaction, where the internal set of primers are used). Alternatively, one or two of the internal primers were used for gene amplification, both in the first and the second PCR reactions (meaning only 2-3 primers were designed for a gene). To facilitate further cloning of the cDNAs, an 8-12 bp extension is added to the 5' of each internal primer. The primer extension includes an endonuclease restriction site. The restriction sites are selected using two parameters: (a) the restriction site does not exist in the cDNA sequence; and (b) the restriction sites in the forward and reverse primers are designed such that the digested cDNA is inserted in the sense direction into the binary vector utilized for transformation. In Table 3 below, primers used for cloning ABST genes are provided.

2017228711 15 Sep 2017

Table 3

Cloned ABST genes from cDNA libraries or genomic DNA and the primers used for the cloning

Gene Id	Polynucleotide SEQ ID NO. of the cloned gene	Polypeptide SEQ ID NO. of the encoded polypeptide	Restriction Enzymes used for cloning	Primers used for amplification (SEQ ID NO:)
ΜΑΒΙ	1530	201	EcoRV	ΜΑΒΙ EF EcoRV AAGATATCAGACCAGAGGAGA AGACTCGATC (SEQ ID NO: 1567) ΜΑΒΙ NF EcoRV AAGATATCAGACTCCGTTCGGA GAAAAGG (SEQ ID NO: 1568) ΜΑΒΙ ER EcoRV ATGATATCTGAAGAACATCGCC TTGTCATC (SEQ ID NO: 1569) ΜΑΒΙ NR EcoRV AAGATATCACCTTGTCATCGGA TCATCTCC (SEQ ID NO: 1570)
MAB1GA (optimized for expression in Maize and G.Max)	1531			Synthetic product (from pGA14_MABl_GA)
MAB 14	1538	219	EcoRV	MAB 14 EF EcoRV ATGATATCCAACGAATGAAGA CTAGTAGCTG (SEQ ID NO: 1571) MAB 14 NF EcoRV ATGATATCCCAGATGGAATCCT GCCCT (SEQ ID NO: 1572) MAB 14 ER EcoRV ATGATATCGTGTCAATGAAGG GAACGTGC (SEQ ID NO: 1573) MAB 14 NR EcoRV ATGATATCGCAAATGGATTCAG ATATTCTG (SEQ ID NO: 1574)
MAB14GA (optimized for expression in Maize)	1539			Synthetic product ( from pGA14_MAB14_GA)
MAB 10	1532	212	Sall, Xbal	MAB 10 F Sal GCAGTCGACAACTCACAGTTCC AAACACACA (SEQ ID NO: 1575) MAB lOExtRXbaGGTCTAGAATGTAAATGTCTTC GTATTAGGC (SEQ ID NO: 1576) MAB lONRXbaCCTCTAGAATCACCCGAAATAA CTAGTGTC (SEQ ID NO: 1577)
MAB10GA (optimized for expression in Maize)	1533			Synthetic product ( from pGA18_MAB10_GA)

2017228711 15 Sep 2017

Gene Id	Polynucleotide SEQ ID NO. of the cloned gene	Polypeptide SEQ ID NO. of the encoded polypeptide	Restriction Enzymes used for cloning	Primers used for amplification (SEQ ID NO:)
MAB25	1549	237	Pstl, Smal	MAB25 EF Pstl- AACTGCAGCCATCGTCGTAATC CTTCTAGC (SEQ ID NO:1578) MAB25 NF PstlAACTGCAGTAATCATGGGGAG GAAATCTC (SEQ ID NO:1579) MAB25 ER SmalGGGTGACAATTCCGAGTCTCAG C (SEQ ID NO: 1580) MAB25 NR SmalTCCCGGGCAATTGGTCAATGGC ACTC (SEQ ID NO:1581)
MAB25GA (optimized for expression in Maize)	1550			Synthetic product ( from pGA14_MAB25_GA)
MAB 134	1665	311	Sall, Xbal	MAB 134 EF Sall- AATGTCGACTCTCGTCTTGCTC CCAGAG (SEQ ID NO: 1582) MAB 134 NF Sall- AATGTCGACCGACACCCTTCTC CTCCTC (SEQ ID NO: 1583) MAB 134 ER Xbal- TTTCTAGAATCATATTCCAACA TCCACTTC (SEQ ID NO: 1584) MAB 134 NR Xbal- TTTCTAGACTGCTATGTTCCAC TGACTACAC (SEQ ID NO: 1585)
MAB99	1566	283	Sall, Sacl	MAB99 NF Sall- AAAGTCGACCAGTTAATTCTCC GTTGTCTACTC (SEQ ID NO:1586) MAB99 NR Sacl- TGAGCTCCTGCTTGAAACTTGC TGCTAG (SEQ ID NO: 1587)
MAB36	1554	254	Sall, Xbal	MAB 36 F Sal GGAGTCGACACAGAAATGGGT GGTTTGAAG (SEQ ID NO: 1588) MAB 36 Ext R Xba CCTCTAGAAATGATCACTCACT GCAACTTAG (SEQ ID NO:1589) MAB 36 NRXbaCCTCTAGACACTCACTGCAACT TAGAAACATC (SEQ ID NO: 1590)

2017228711 15 Sep 2017

Gene Id	Polynucleotide SEQ ID NO. of the cloned gene	Polypeptide SEQ ID NO. of the encoded polypeptide	Restriction Enzymes used for cloning	Primers used for amplification (SEQ ID NO:)
MAB7	1563	208	Sall, Xbal	MAB 7 Ex F Sal AACGTCGACGCTCATTTCTCTT CTTCTTTGG (SEQ ID NO:1591) MAB 7 NF Sal GACGTCGACTCTTCTTTGGTTC TTACATTTCTC (SEQ ID NO:1592) MAB 7ExRXbaTCTCTAGAGCAAGACGTTATAA ACCATGC (SEQ ID NO: 1593) MAB 7 NR Xba - TCTCTAGAAGAAGACACGCTG GACAATG (SEQ ID NO:1594)
MAB44	1557	267	Sall, Sacl	MAB 44 NF sal AAGGTCGACCATAAAGAACAG TGACAGGCG (SEQ ID NO: 1595) MAB 44 NR Sc AGAGCTCCACGTAGTACATTTT CACAGCAC (SEQ ID NO: 1596)
MAB44GA (optimized for expression in Maize)	1558			Synthetic product (from pCR4BluntTOPOMAB44GA)
MAB6	1561	207	Sall, Xbal	MAB 6 - Ex F Sal ACCGTCGACCCTTCTCCAATTT CGTAAGC (SEQ ID NO: 1597) MAB 6 NF Sal ACCGTCGACTTCGTAAGCTCAA AGATTTCG (SEQ ID NO:1598) MAB 6 - Ext R Xbal CCTCTAGAACGACTTTTAATCC CTCCAAC (SEQ ID NO:1599) MAB 6 - NR Xbal CCTCTAGACTCCAACAGCCACT ACAACC (SEQ ID NO: 1600)
MAB6GA (optimized for expression in Maize)	1562			Synthetic product (from pGA15_MAB6_GA)
MAB9	1564	211	EcoRV	MAB9 F EcoRV AAGATATCGGTTGCTGAGGAA TCGAAGTAG (SEQ ID NO: 1601) MAB9 ER EcoRV TTGATATCGAGCCAAGTCACAA GGAGTTTAC (SEO ID NO :1602) MAB9 NR EcoRV TTGATATCCTCCGAGTGTCGCA GTAAGC (SEQ ID NO:1603)

2017228711 15 Sep 2017

Gene Id	Polynucleotide SEQ ID NO. of the cloned gene	Polypeptide SEQ ID NO. of the encoded polypeptide	Restriction Enzymes used for cloning	Primers used for amplification (SEQ ID NO:)
MAB9GA (optimized for expression in Maize and G.Max)	1565			Synthetic product (from pGA15_MAB9_GA)
MAB 100	1534	284	Sall, Xbal	MAB 100 EF Sall- AATGTCGACCCAAGTTAAACTT CATATCATACAC (SEQ ID NO: 1604) MAB 100 NF Sall- AATGTCGACGAAGAGTTATTAT GGCGAGCT (SEQ ID NO :1605) MAB 100 ER Xbal- AATGTCGACCCAAGTTAAACTT CATATCATACAC (SEQ ID NO: 1606) MAB 100 NR Xbal- AATCTAGACAAACCCAACTTAT TACATTACG (SEQ ID NO: 1607)
MAB13	1536	217	Sacl, Sall	MAB 13 F Sall new AATGTCGACCTCGAAAATGGC CACCATTAG (SEQ ID NO: 1608) MAB 13 ExR Sc CGAGCTCCAAAAATGCAAGAA TCAAGAG (SEQ ID NO: 1609) MAB 13 F Sal AAGGTCGACTTCTCTCCAAAAT GGCCAC (SEQ ID NO: 1610) MAB 13 NR Sc TGAGCTCTGCAAGAATCAAGA GAAATTTG (SEQ ID NO: 1611)
MAB32	1552	247	EcoRV	MAB32 F EcoRV- AAGATATCCTCCACTTGTTGTT CAATTCCC (SEQ ID NO: 1612) MAB32 ER EcoRVATGATATCGATCTGAACAGCA GTAAGTAAGCC (SEQ ID NO:1613) MAB32 NR EcoRV- ATGATATCTAAGAAGAACAAG ACATGGATCG (SEQ ID NO: 1614)
MAB35	1553	252	Smal	MAB35 FCGTGAGAACTAAGAAACACCC (SEQ ID NO:1615) MAB35 ER SmalTCCCGGGACATCTTTTCAACTA AACCAAGAC (SEQ ID NO: 1616) MAB35 NR SmalTCCCGGGCTAAACCAAGACTTA CACAAGACG (SEQ ID NO: 1617)

2017228711 15 Sep 2017

Gene Id	Polynucleotide SEQ ID NO. of the cloned gene	Polypeptide SEQ ID NO. of the encoded polypeptide	Restriction Enzymes used for cloning	Primers used for amplification (SEQ ID NO:)
MAB 146	1666	334	Sall, Xbal	MAB 146 F Sal- ATTGTCGACAGAGTTATGGGA GATAATAGAGGA (SEQ ID NO:1618) MAB 146 ER Xba - ATTCTAGACTCATTCTGAGCTT TACATGTTC (SEQ ID NO: 1619) MAB 146 NR Xba- TTTCTAGATTGGTTTACACCTC AACTCACTAC (SEQ ID NO: 1620)
MAB2	1547	Non coding	Sall, Xbal	MAB2 F Sall AATGTCGACAACAAATGATCCT TCAGGCAGTTAAAG (SEQ ID NO:1621) MAB2 R Xba TTTCTAGATATTAAAACTTAGA TTCGGGATCAG (SEQ ID NO: 1622)
MAB20	1548	229	Pstl, Smal	MAB20 EF PstlAACTGCAGGATCATCACTTCTC AGATTTCG (SEQ ID NO: 1623) MAB20 NF PstlAACTGCAGAAAAATGAATTCA GAATCGCTAG (SEQ ID NO: 1624) MAB20 ER SmalAACTGCAGGATCATCACTTCTC AGATTTCG (SEQ ID NO: 1625) MAB20 NR SmalTCCCGGGCAATCTGACCTCAAA ACTCCC (SEQ ID NO :1626)

MAB43	1556	265	Pstl, Smal	MAB43 NF Pstl AACTGCAGGATCAATGAAGAT TCGGAACAG (SEQ ID NO: 1627) MAB43 ER Smal TCCCGGGTACAACAAGAAACC TCTGATTC (SEQ ID NO: 1628) MAB43 NR Smal TCCCGGGCCTGTGCCACAGCTA TACTTAC (SEQ ID NO :1629)
MAB46	1559	271	Sall, Sacl	MAB 46 ExF Sal - GAAGTCGACATCCGTAGTTTCA GTTTCGTCC (SEQ ID NO:1630) MAB 46 NF Sal - GAAGTCGACCTTGTCTGTTCCA GATGAAATTG (SEQ ID NO :1631) MAB46 ExR Sc - TGAGCTCCTCTATCGACGTCCG GATTC (SEQ ID NO: 1632) MAB 46 NR Sc - TGAGCTCCGTCCGGATTCATAA ACAAC (SEQ ID NO: 1633)

2017228711 15 Sep 2017

Gene Id	Polynucleotide SEQ ID NO. of the cloned gene	Polypeptide SEQ ID NO. of the encoded polypeptide	Restriction Enzymes used for cloning	Primers used for amplification (SEQ ID NO:)
MAB50	1560	277	Smal	MAB 50 ExF Sal GGAGTCGACCATCGGGACACA TCTTTAGG (SEQ ID NO:1634) MAB50 NF CATCTTTAGGCTCAAGGATTC (SEQ ID NO: 1635) MAB50 ExR Sac TGAGCTCGATCCTCGTTTATTA CAAGTCTG (SEQ ID NO: 1636 ) MAB50 NR Sma TCCCGGGCACACCAAGATTGAT TACAAAGAG (SEQ ID NO: 1637)
MAB66	1654	1655	Sall, Xbal	MAB66 F SalAATGTCGACGATTGGAGATAG GCAGGCA (SEQ ID NO :163 8) MAB66 ER Xba TTTCTAGAGGTAGCCAAAGCTG ACACTC (SEQ ID NO: 1639) MAB66 NR Xba AATCTAGAGAGGCATATGCAC TTCTTATCG (SEQ ID NO: 1640)
MAB4	1555	205	EcoRV	MAB4 EF EcoRV- AAGATATCCAGGACGGGTTCTC GATCAG (SEQ ID NO: 1641) MAB4 NF EcoRVAAGATATCCAGCGAACACGTC TACGATG (SEQ ID NO :1642) MAB4 ER EcoRV - ATGATATCGCACGAGTTCAACT CAGCTG (SEQ ID NO:1643) MAB4 NR EcoRV- ATGATATCGAACTGCTTGAGAT GTAACAGCT (SEQ ID NO :1644)
MAB15GA (optimized for expression in Arabidopsis and maize)	1541	221	Xbal, Sacl	Synthetic product (from pGA4_MAB15)
MAB15a_G A (optimized for expression in Maize)	1667			Synthetic product (from pGA18 MAB15a_GA)
MAB15GA original (original sequence, not optimize)	1540			Synthetic product (from pGAl 4MAB15 _(E VO220)original)

2017228711 15 Sep 2017

Gene Id	Polynucleotide SEQ ID NO. of the cloned gene	Polypeptide SEQ ID NO. of the encoded polypeptide	Restriction Enzymes used for cloning	Primers used for amplification (SEQ ID NO:)
MAB17GA (optimized for expression in Arabidopsis and maize)	1542	224	Xbal, Sacl	Synthetic product (from pGA4_MAB17)
MAB17a_G A (optimized for expression in Maize)	1544			Synthetic product (from pCR4BluntTOPO_MAB17a_GA)
MAB17GA original (original sequence, not optimize)	1543			Synthetic product (pGA14_MAB17_(EVO222)original)
MAB137G A (optimized for expression in Maize, Arabidopsis and tomato)	1537	317	Xbal, Sacl	Synthetic product (from pGA15_MAB137)
MAB3GA (optimized for expression in Maize, Arabidopsis and tomato)	1551	203	Xbal, Sacl	Synthetic product (from pCR4Blunt- Topo_MAB3)
MAB3_GA_ original (original sequence, not optimize)	1668			Synthetic product (from pGA 14_MAB3_(E VO23 5)-original)
MAB18GA (optimized for expression in Arabidopsis and maize)	1545	225	Xbal, Sacl	Synthetic product (from pGA4_MAB18)
Control Gene: GUI	1664

Table 3. Presented are the cloned AB ST genes and control gene(s) by the Gene Id number and the polynucleotide SEQ ID NO. Also presented are the primers and the restriction enzymes used to clone the AB ST genes.

PCR products were digested with the restriction endonucleases (Roche, Switzerland) according to the sites design in the primers (Table 3). Each digested PCR product was inserted into a high copy vector originated from pBlue-script KS plasmid

2017228711 15 Sep 2017 vector (pBlue-script KS plasmid vector, Hypertext Transfer Protocol://World Wide Web (dot) stratagene (dot) com/manuals/212205 (dot) pdf). In case of the high copy vector originated from pBlue-script KS plasmid vector (pGN) PCR product was inserted in the high copy plasmid upstream to the NOS terminator (SEQ ID NO: 1651) originated from pBI 101.3 binary vector (GenBank Accession No. U12640, nucleotides 4417 to 4693), Table 4 below. In other cases (pKSJ_6669a) the At6669 promoter (SEQ ID NO: 1652) is already cloned into the pBlue-script KS, so the gene is introduced downstream of the promoter (Table 4 below).

Sequencing of the inserted genes was performed, using the ABI 377 sequencer (Applied Biosystems). In some cases, after confirming the sequences of the cloned genes, the cloned cDNA accompanied with the NOS terminator was introduced into the binary vectors pGI containing the At6669 promoter via digestion with appropriate restriction endonucleases. In other cases the cloned cDNA accompanied with the At6669 promoter was introduced into the pGI vector (that hasn't already contained the At6669 promoter). In any case the insert was followed by single copy of the NOS terminator (SEQ ID NO: 1651). The digested products and the linearized plasmid vector were ligated using T4 DNA ligase enzyme (Roche, Switzerland).

Table 4

Genes cloned from cDNA libraries or genomic DNA in a High copy plasmid

Gene Name	High copy Plasmid	Amplified from
ΜΑΒΙ	pKSJ 6669	RNA
ΜΑΒΙ		Gene Art
MAB 10		Gene Art
MAB 10	pGN	RNA
MAB 14	pKSJ 6669	RNA
MAB 14		Gene Art
MAB15	pGN	Gene Art (3 plasmids)
MAB17	pGN	Gene Art (3 plasmids)
MAB 137	pGN	Gene Art
MAB25	pKSJ 6669	RNA
MAB25		Gene Art
MAB3	pGN	Gene Art (2 plasmids)
MAB44	pGN	RNA
MAB44		Gene Art
MAB6	pGN	RNA
MAB6		Gene Art
MAB9	pKSJ 6669	RNA
MAB9		Gene Art
MAB 100	pGN	RNA
MAB13	pGN	RNA
MAB 134	pGN	RNA
MAB18	pGN	Gene Art
MAB2	pGN	RNA

2017228711 15 Sep 2017

Gene Name	High copy Plasmid	Amplified from
MAB20	pKSJ 6669	RNA
MAB 146	pGN	RNA
MAB32	pKSJ 6669	RNA
MAB35	pKSJ 6669	RNA
MAB36	pGN	RNA
MAB43	pKSJ 6669	RNA
MAB46	pGN	RNA
MAB50	pKSJ 6669	RNA
MAB7	pGN	RNA
MAB99	pGN	RNA
MAB66	pGN	RNA
MAB4	pKSJ 6669	RNA

Table 4

The pPI plasmid vector was constructed by inserting a synthetic poly-(A) signal sequence, originating from pGL3 basic plasmid vector (Promega, GenBank Accession No. U47295; nucleotides 4658-4811) into the Hindlll restriction site of the binary vector pBI101.3 (Clontech, GenBank Accession No. U12640). pGI (Figure 1) is similar to pPI, but the original gene in the back bone is GUS-Intron, rather than GUS.

At6669, the Arabidopsis thaliana promoter sequence (set forth in SEQ ID NO: 1652) is inserted in the pPI binary vector, upstream to the cloned genes by using the restriction enzymes EiindAAA and Sal\ or BamAAl (Roche), following by DNA ligation and binary plasmid extraction from positive E. coli colonies, as described above.

Positive colonies were identified by PCR using primers which were designed to span the introduced promoter (At6669) and the cloned gene in the binary vector. In all cases the forward PCR primer was the primer set forth in SEQ ID NO: 1650 (from the At6669 promoter) and the reverse primer (derived from the specific cloned gene) was as follows: For ΜΑΒΙ, the reverse primer was SEQ ID NO:1570; for MAB14, the reverse primer was SEQ ID NO: 1574; for MAB10, the reverse primer was SEQ ID NO: 1577; for MAB25, the reverse primer was SEQ ID NO:1581; for MAB134, the reverse primer was SEQ ID NO: 1585; for MAB99, the reverse primer was SEQ ID NO: 1587; for MAB36, the reverse primer was SEQ ID NO: 1590; for MAB7, the reverse primer was SEQ ID NO: 1594; for MAB44, the reverse primer was SEQ ID NO: 1596; for MAB4, the reverse primer was SEQ ID NO: 1600; for MAB9, the reverse primer was SEQ ID NO: 1603 (MAB9); for MAB100, the reverse primer was SEQ ID NO: 1606; for MAB13, the reverse primer was SEQ ID NO: 1611; for MAB32, the reverse primer was SEQ ID NO: 1614; for MAB35, the reverse primer was SEQ ID NO: 1617; for MAB146, the reverse primer was SEQ ID NO: 1620; for MAB2, the reverse primer was SEQ ID

2017228711 15 Sep 2017

NO: 1622; for MAB20, the reverse primer was SEQ ID NO: 1626; for MAB43, the reverse primer was SEQ ID NO: 1629; for MAB46, the reverse primer was SEQ ID NO: 1633; for MAB50, the reverse primer was SEQ ID NO: 1637; for MAB66, the reverse primer was SEQ ID NO: 1640; for MAB4, the reverse primer was SEQ ID NO: 1644; for MAB15 synthetic gene, the reverse primer was SEQ ID NO: 1645; for MAB 17 synthetic gene, the reverse primer was SEQ ID NO: 1646; for MAB 18 synthetic gene, the reverse primer was SEQ ID NO:1647; for MAB137 synthetic gene, the reverse primer was SEQ ID NO: 1648; and for MAB3 synthetic gene, the reverse primer was SEQ ID NO: 1649, which are designed to span the introduced promoter and gene, in the binary vector.

Synthetic sequences [such as of MAB14, nucleotide SEQ ID NO:23, which encodes protein SEQ ID NO:219) of some of the cloned polynucleotides were ordered from a commercial supplier (GeneArt, GmbH). To optimize the coding sequence, codon-usage Tables calculated from plant transcriptomes were used [example of such Tables can be found in the Codon Usage Database available online at Hypertext Transfer Protocol://World Wide Web (dot) kazusa (dot) or (dot) jp/codon/]. The optimized coding sequences were designed in a way that no changes were introduced in the encoded amino acid sequence while using codons preferred for expression in dicotyledonous plants mainly tomato and Arabidopsis; and monocotyledonous plants such as maize. Such optimized sequences promote better translation rate and therefore higher protein expression levels. Parts of the sequences were ordered as the original sequences. To the optimized/non-optimized sequences flanking additional unique restriction enzymes sites were added to facilitate cloning genes in binary vectors.

Promoters used: Arabidopsis At6669 promoter (SEQ ID NO: 1652; which is SEQ ID NO:61 of W004081173 to Evogene Ltd.).

The sequences of the cloned cDNAs are provided in SEQ ID NOs: 1530-1534, 1536-1545, 1547-1566, 1654, 1665, 1666, 1667 and 1668. The protein translation of the amplified cDNA sequence matched exactly that of the initial bioinformatics prediction of the protein sequences. The predicted polypeptide sequences of the cloned polynucleotides are provided in SEQ ID NOs:201, 212, 284, 213, 217, 317, 219, 221, 224, 225, 226, 227, 229, 237, 203, 247, 252, 205, 265, 267, 271, 277, 207, 208, 211, 283, 1655, 311,334, and 254.

2017228711 15 Sep 2017

EXAMPLE 4

TRANSFORMING AGROBACTERIUM TUMEFACIENS CELLS WITH BINARY VECTORS HARBORING PUTATIVE ABST GENES

Each of the binary vectors described in Example 3 above are used to transform Agrobacterium cells. Two additional binary constructs, having a GUS/Luciferase reporter gene replacing the ABST gene (positioned downstream of the At6669 promoter), are used as negative controls.

The binary vectors are introduced to Agrobacterium tumefaciens GV301, or LB4404 competent cells (about 10⁹ cells/mL) by electroporation. The electroporation is performed using a MicroPulser electroporator (Biorad), 0.2 cm cuvettes (Biorad) and EC-2 electroporation program (Biorad). The treated cells are cultured in LB liquid medium at 28 °C for 3 hours, then plated over LB agar supplemented with gentamycin (50 mg/L; for Agrobacterium strains GV301) or streptomycin (300 mg/L; for Agrobacterium strain LB4404) and kanamycin (50 mg/L) at 28 °C for 48 hours. Abrobacterium colonies which developed on the selective media were analyzed by PCR using the primers described above (Example 3) with respect to identification of positive binary vector colonies. The resulting PCR products are isolated and sequenced as described in Example 3 above, to verify that the correct ABST sequences are properly introduced to the Agrobacterium cells.

EXAMPLE 5

TRANSFORMATION OF ARABIDOPSIS THALIANA PLANTS WITH PUTATIVE ABSTGENES

Arabidopsis thaliana Columbia plants (To plants) are transformed using the Floral Dip procedure described by Clough and Bent (10) and by Desfeux et al. (11), with minor modifications. Briefly, To Plants are sown in 250 ml pots filled with wet peatbased growth mix. The pots are covered with aluminum foil and a plastic dome, kept at 4 °C for 3¾ days, then uncovered and incubated in a growth chamber at 18-24 °C under 16/8 hour light/dark cycles. The To plants are ready for transformation six days before anthesis.

Single colonies of Agrobacterium carrying the binary constructs, are generated as described in Example 4 above. Colonies are cultured in LB medium supplemented with kanamycin (50 mg/L) and gentamycin (50 mg/L). The cultures are incubated at 28 C

2017228711 15 Sep 2017 for 48 hours under vigorous shaking and then centrifuged at 4000 rpm for 5 minutes. The pellets comprising the Agrobacterium cells are re-suspended in a transformation medium containing half-strength (2.15 g/L) Murashige-Skoog (Duchefa); 0.044 μΜ benzylamino purine (Sigma); 112 pg/L B5 Gambourg vitamins (Sigma); 5 % sucrose; and 0.2 ml/L Silwet L-77 (OSI Specialists, CT) in double-distilled water, at pH of 5.7.

Transformation of To plants is performed by inverting each plant into an Agrobacterium suspension, such that the above ground plant tissue is submerged for 3-5 seconds. Each inoculated To plant is immediately placed in a plastic tray, then covered with clear plastic dome to maintain humidity and is kept in the dark at room temperature for 18 hours, to facilitate infection and transformation. Transformed (transgenic) plants are then uncovered and transferred to a greenhouse for recovery and maturation. The transgenic To plants are grown in the greenhouse for 3-5 weeks until siliques are brown and dry. Seeds are harvested from plants and kept at room temperature until sowing.

For generating Ti and T₂ transgenic plants harboring the genes, seeds collected from transgenic To plants are surface-sterilized by soaking in 70 % ethanol for 1 minute, followed by soaking in 5 % sodium hypochloride and 0.05 % triton for 5 minutes. The surface-sterilized seeds are thoroughly washed in sterile distilled water then placed on culture plates containing half-strength Murashige-Skoog (Duchefa); 2 % sucrose; 0.8 % plant agar; 50 mM kanamycin; and 200 mM carbenicylin (Duchefa). The culture plates are incubated at 4 °C for 48 hours then transferred to a growth room at 25 °C for an additional week of incubation. Vital Ti Arabidopsis plants are transferred to a fresh culture plates for another week of incubation. Following incubation the Ti plants are removed from culture plates and planted in growth mix contained in 250 ml pots. The transgenic plants are allowed to grow in a greenhouse to maturity. Seeds harvested from Ti plants are cultured and grown to maturity as T₂ plants under the same conditions as used for culturing and growing the Ti plants.

EXAMPLE 6

IMPRO VED ABST IN TISSUE CUL TURE ASS A Y

Assay 1: plant growth under Osmotic stress (PEG) in Tissue culture conditions - Osmotic stress (PEG) - conditions resembling the high osmolarity found during drought (e.g., 25 % PEG8000). One of the consequences of drought is the induction of

2017228711 15 Sep 2017 osmotic stress in the area surrounding the roots; therefore, in many scientific studies, PEG serves to simulate drought.

Surface sterilized seeds are sown in basal media [50 % Murashige-Skoog medium (MS) supplemented with 0.8 % plant agar as solidifying agent] in the presence of Kanamycin (for selecting only transgenic plants). After sowing, plates are transferred for 2-3 days at 4 °C for stratification and then grown at 25 °C under 12-hour light 12hour dark daily cycles for 7 to 10 days. At this time point, seedlings randomly chosen are carefully transferred to plates hold 25 % PEG in 0.5 MS media or normal conditions (0.5 MS media). Each plate contains 5 seedlings of same event, and 3-4 different plates (replicates) for each event. For each polynucleotide of the invention at least four independent transformation events are analyzed from each construct. Plants expressing the polynucleotides of the invention are compared to the average measurement of the control plants Mock- transgenic plants expressing the uidA reporter gene (GUS Intron GUI) under the same promoter were used as control.

Digital imaging - A laboratory image acquisition system, which consists of a digital reflex camera (Canon EOS 300D) attached with a 55 mm focal length lens (Canon EF-S series), mounted on a reproduction device (Kaiser RS), which included 4 light units (4 x 150 Watts light bulb) and located in a darkroom, was used for capturing images of plantlets sawn in square agar plates.

The image capturing process was repeated every 7 days starting at day 0 till day 14. The same camera attached with a 24 mm focal length lens (Canon EF series), placed in a custom made iron mount was used for capturing images.

An image analysis system was used, which consists of a personal desktop computer (Intel P4 3.0 GHz processor) and a public domain program - ImageJ 1.37 (Java based image processing program which was developed at the U.S National Institutes of Health and freely available on the internet at Hypertext Transfer Protocol://rsbweb (dot) nih (dot) gov/). Images were captured in resolution of 6 Mega Pixels (3072 x 2048 pixels) and stored in a low compression JPEG (Joint Photographic Experts Group standard) format. Next, analyzed data was saved to text files and processed using the JMP statistical analysis software (SAS institute).

Seedling analysis - Using the digital analysis seedling data was calculated, including leaf area, root coverage and root length.

2017228711 15 Sep 2017

The Relative Growth Rate (RGR) was calculated according to the following formula I.

Formula I:

Relative growth area rate = (Δ Area / At) * (1/ Area tO)

At is the current analyzed image day subtracted from the initial day (t-tO). Thus, the relative growth area rate is in units of 1/day and length growth rate is in units of 1/day.

At the end of the experiment, plantlets were removed from the media and weighed for the determination of plant fresh weight. Relative Growth Rate is determined 10 by comparing the leaf area, root length and root coverage between each couple of sequential photographs, and results are used to resolve the effect of the gene introduced on plant vigor, under osmotic stress, as well as under optimal conditions. Similarly, the effect of the gene introduced on biomass accumulation, under osmotic stress as well as under optimal conditions, is determined by comparing the plants' fresh weight to control 15 plants (GUI).

Statistical analyses - To identify outperforming genes and constructs, results from the independent transformation events are evaluate for the overall influence of the gene (gene effect) and for each of the tested events (best event). Student’s t test were applied, using significance of p < 0.05 or p < 0.1. The JMP statistics software package 20 is used (Version 5.2.1, SAS Institute Inc., Cary, NC, USA).

Experimental Results

The polynucleotide sequences of the invention were assayed for a number of desired traits.

Tables 5-6 depict analyses of Leaf Area in plants overexpressing the 25 polynucleotides of the invention under the regulation of 6669 promoter under 25 % PEG conditions. Each Table represents an independent experiment, using 4 independent events per gene. Genes not connected by same letter as the control (A, B,) are significantly different from the control, with A indicating a difference at a P < 0.05 level of significance and, A* a difference at a P < 0.1 level of significance.

Table 5: Genes showing improve Leaf Area under 25 % PEG

	Leaf Area [cm^A2], 25% PEG
Gene Id	Day 7 from planting	Day 14 from planting
	LS M	Signific ance*	LSM best Even t	Signifi cance *	% improv ement of Best event	LS M	Signifi cance *	LSM best Event	Significa nee*	% improve ment of Best event
GUI	0.3 8	B	0.38	B		0.6 8	B	0.68	B
ΜΑΒΙ	0.4 9	A	0.63	A	67	0.7 2	B	6	0.80	18
MAB2 5	0.3 3	C	0.49	A	28	0.6 1	B	0.88	A	30

Table 5: LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant difference at P < 0.05, A* meaning significant difference at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 6: Genes showing improve Leaf Area under 25% PEG

	Leaf Area [cm^A2], 25% PEG
Gene Id	Day 7 from planting	Day 14 from planting
	LS M	Signific ance*	LS M best Eve nt	Signif icance *	% improv ement of Best event	LS M	Signif icance *	LSM best Event	Significa nee*	% improve ment of Best event
GUI	0.2 3	B	0.23	B		0.4 4	B	0.44	B
ΜΑΒΙ 5	0.2 5	B	0.32	A	43	0.3 6	B	0.48	B	9
ΜΑΒΙ 7	0.2 7	A	0.36	A	57	0.4 6	B	0.65	A	48
ΜΑΒΙ 8	0.3 0	A	0.36	A	57	0.3 9	B	0.51	B	15
MAB3 5	0.2 1	B	0.26	B	14	0.3 8	B	0.60	A	36

Table 6: LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant difference at P < 0.05, A* meaning significant difference at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Tables 7-9 depict analyses of Roots Coverage in plants overexpressing the polynucleotides of the invention under the regulation of 6669 promoter under 25 % PEG conditions. Each Table represents an independent experiment, using 4 independent events per gene. Genes not connected by same letter as the control (A, B,) are significantly different from the control.

2017228711 15 Sep 2017

Table 7

	Roots Coverage [cm^A2], 25% PEG
Gene Id	Day 7 from planting	Day 14 from planting
	LS M	Signific ance*	LSM best Even t	Signifi cance *	% improv ement of Best event	LSM	Signi fican ce*	LSM best Event	Significa nee*	% improve ment of Best event
GUI	4.3 7	B	4.37	B		6.69	B	6.69	B
ΜΑΒΙ	7.1 7	A	10.3 2	A	136	9.25	A	9.73	A	45

Table 7: LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant difference at P < 0.05, A* meaning significant difference at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 8

	Roots Coverage [cm^A2], 25% PEG
Gene Id	Day 7 from planting	Day 14 from planting
	LS M	Signific ance*	LSM best Even t	Signifi cance *	% improv ement of Best event	LSM	Signi fican ce*	LSM best Event	Significa nee*	% improve ment of Best event
GUI	4.0 4	B	4.04	B		11.0 9	B	11.09	B
ΜΑΒΙ 5	4.5 3	B	5.60	A	39	10.1 0	B	11.74	B	6
ΜΑΒΙ 8	5.2 3	A	6.79	A	68	9.92	B	10.29	B	-7
ΜΑΒΙ 46	5.1 0	B	7.01	A	73	8.67	B	10.04	B	-9

Table 8: LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant difference at P < 0.05, A* meaning significant difference at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 9

	Roots Coverage [cm^A2], 25% PEG
Gene Id	Day 7 from planting	Day 14 from planting
	LS M	Signific ance*	LSM best Even t	Signifi cance *	% improve ment of Best event	LSM	Signi fican ce*	LSM best Event	Significa nee*	% improve ment of Best event
GUI	2.1 1	B	2.11	B		5.67	B	5.67	B
MAB 18	2.0 5	B	2.75	B	30	5.40	B	8.76	A	55
MAB 32	1.9 8	B	5.06	A	140	4.31	B	10.55	A	86

2017228711 15 Sep 2017

MAB 35	2.6 2	B	3.82	A	81	7.19	A*	10.04	A	77
MAB 4	3.0 3	A	5.64	A	168	7.38	A*	11.38	A	101
MAB 146	1.8 4	B	3.65	A	73	5.05	B	9.21	A	63

Table 9: LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant difference at P < 0.05, A* meaning significant difference at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Tables 10-11 depict analyses of Roots Length in plants overexpressing the polynucleotides of the invention under the regulation of 6669 promoter in 25% PEG. Each Table represents an independent experiment, using 4 independent events per gene. Genes not connected by same letter as the control (A, B,) are significantly different 10 from the control.

Table 10

	Roots Length 1cm], PEG 25%
Gene Id	Day 7 from planting	Day 14 from planting
	LS M	Signific ance*	LSM best Even t	Signifi cance *	% improv ement of Best event	LS M	Signifi cance *	LSM best Event	Significa nee*	% improve ment of Best event
GUI	4.7 1	A	4.71	A		5.7 1	B	5.71	B
MAB 1	5.3 7	A	5.91	A	25	6.0 9	B	6.40	B	12

Table 10: LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant difference at P < 0.05, A* meaning significant difference at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 11

	Roots Length 1cm], PEG 25%
Gene Id	Day 7 from planting	Day 14 from planting
	LS M	Signific ance*	LSM best Even t	Signifi cance *	% improv ement of Best event	LS M	Signifi cance *	LSM best Event	Significa nee*	% improve ment of Best event
GUI	2.8 8	B	2.88	B		5.1 1	B	5.11	B
MAB 18	3.2 2	B	4.29	A	49	4.8 6	B	6.33	B	24
MAB 32	2.7 4	B	5.78	A	101	3.7 5	B	7.17	A	40
MAB 35	3.3 5	A*	4.79	A	66	5.3 0	B	6.76	A	32
MAB 4	3.2 5	B	4.80	A	67	5.2 4	B	7.32	A	43

2017228711 15 Sep 2017

MAB 146

2.4 3

B

4.00

A

39

4.0 4

B

6.39

A

25

Table 11: LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant difference at P < 0.05, A* meaning significant difference at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Tables 12-13 depict analyses of Leaf Area RGR in plants overexpressing the polynucleotides of the invention under the regulation of 6669 promoter in 25 % PEG. Each Table represents an independent experiment, using 4 independent events per gene. Genes not connected by same letter as the control (A, B,) are significantly different from the control.

Table 12

	Leaf Area RGR [cm^A2/day], PEG 25%
Gene Id	Day 7 from planting	Day 14 from planting
	LS M	Signific ance*	LSM best Even t	Signifi cance *	% improv ement of Best event	LS M	Signifi cance *	LSM best Event	Significa nee*	% improve ment of Best event
GUI	0.4 6	B	0.46	B		0.1 2	B	0.12	B
MAB 1	0.6 8	A	1.47	A	222	0.2 0	A	0.30	A	151
MAB 17	0.4 3	B	0.50	B	8	0.1 7	B	0.29	A	145
MAB 35	0.6 5	A	0.71	A	54	0.1 9	A	0.23	A	93
MAB 146	0.5 5	B	0.80	A	75	0.1 6	B	0.20	B	66

Table 12: LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant difference at P < 0.05, A* meaning significant difference at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 13

	Leaf Area RGR [cm^A2/day], PEG 25%
Gene Id	Day 7 from planting	Day 10 from planting
	LS M	Signific ance*	LSM best Even t	Signifi cance *	% improv ement of Best event	LS M	Signifi cance *	LSM best Event	Significa nee*	% improve ment of Best event
GUI	0.4 9	B	0.49	B		0.2 4	B	0.24	B
MAB 6	0.8 9	A	1.60	A	226	0.2 7	B	0.33	B	39

Table 13: LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant difference at P < 0.05, A* meaning significant difference at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

2017228711 15 Sep 2017

Tables 14-18 depict analyses of Roots Coverage RGR in plants overexpressing the polynucleotides of the invention under the regulation of 6669 promoter in 25% PEG. Each Table represents an independent experiment, using 4 independent events per 5 gene. Genes not connected by same letter as the control (A, B,) are significantly different from the control.

Table 14

	Roots Coverage RGR \|cm^A2/day\|, PEG 25%
Gene Id	Day 7 from planting	Day 14 from planting
	LS M	Signific ance*	LSM best Even t	Signifi cance *	% improv ement of Best event	LS M	Signifi cance *	LSM best Event	Significa nee*	% improve ment of Best event
GUI	5.7 4	B	5.74	B		0.1 1	B	0.11	B
MAB 25	4.0 3	B	5.44	B	-5	0.1 6	B	0.21	A	96
MAB 44	5.3 2	B	7.79	B	36	0.1 7	B	0.28	A	155

Table 14: LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant difference at P < 0.05, A* meaning significant difference at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 15

	Roots Coverage RGR \|cm^A2/day\|, PEG 25%
Gene Id	Day 7 from planting	Day 14 from planting
	LS M	Signific ance*	LSM best Even t	Signifi cance *	% improv ement of Best event	LS M	Signifi cance *	LSM best Event	Significa nee*	% improve ment of Best event
GUI	0.4 3	B	0.43	B		0.3 0	B	0.30	B
MAB 1	2.1 6	A	3.09	A	621	0.3 6	B	0.43	A	44
MAB 15	1.5 5	A	2.81	A	555	0.3 0	B	0.33	B	9
MAB 17	1.9 9	A	4.08	A	852	0.3 5	B	0.53	A	78
MAB 18	1.4 4	A	1.90	A	343	0.2 9	B	0.36	B	19
MAB 35	1.1 0	B	1.71	B	298	0.3 7	B	0.48	A	59
MAB 146	2.1 6	A	4.03	A	841	0.3 0	B	0.41	A	38

Table 15: LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant difference at P < 0.05, A* meaning significant difference at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 16

2017228711 15 Sep 2017

	Roots Coverage RGR [cm^A2/day], PEG 25%
Gene Id	Day 7 from planting	Day 14 from planting
	LS M	Signific ance*	LS M best Eve nt	Signif icance *	% improv ement of Best event	LS M	Signif icance *	LSM best Event	Significa nee*	% improve ment of Best event
GUI	1.2 7	B	1.27	B		0.0 8	B	0.08	B
ΜΑΒΙ 00	1.2 6	B	1.52	B	19	0.1 2	B	0.19	A	131
ΜΑΒΙ 34	1.6 4	A*	2.20	A	73	0.0 8	B	0.12	B	48
ΜΑΒΙ 3	1.5 7	B	2.16	A	70	0.1 9	A	0.32	A	294
ΜΑΒΙ 5	1.6 1	A*	2.71	A	113	0.1 0	B	0.13	B	56
ΜΑΒΙ 7	2.1 5	A	2.24	A	76	0.1 3	B	0.15	B	88
ΜΑΒ3 GA	1.5 2	B	2.02	A	58	0.0 9	B	0.12	B	45

Table 16: LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 17

	Roots Coverage RGR \|cm^A2/day\|, PEG 25%
Gene Id	Day 7 from planting	Day 14 from planting
	LS M	Signific ance*	LS M best Eve nt	Signif icance *	% improv ement of Best event	LS M	Signif icance *	LSM best Event	Significa nee*	% improve ment of Best event
GUI	0.9 5	B	0.95	B		0.3 0	B	0.30	B
ΜΑΒΙ 8	0.7 5	B	2.04	A	116	0.2 9	B	0.47	A	60
MAB3 5	1.4 4	A*	4.53	A	379	0.3 2	B	0.48	A	63
MAB4	1.2 8	B	2.17	A	129	0.2 9	B	0.44	A	49
ΜΑΒΙ 46	0.4 7	B	0.86	B	-9	0.3 5	B	0.45	A	52

Tablel7: LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 18

2017228711 15 Sep 2017

	Roots Coverage RGR [cm^A2/day], PEG 25%
Gene Id	Day 7 from planting	Day 10 from planting
	LS M	Signific ance*	LS M best Eve nt	Signif icance *	% improv ement of Best event	LS M	Signif icance *	LSM best Event	Significa nee*	% improve ment of Best event
GUI	1.6 6	B	1.66	B		0.2 1	B	0.21	B
MAB4 3	1.4 3	B	2.24	B	35	0.2 9	A	0.39	A	86

Table 18: LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Tables 19-21 depict analyses of Roots Length RGR in plants overexpressing the polynucleotides of the invention under the regulation of 6669 promoter in 25% PEG. Each Table represents an independent experiment, using 4 independent events per gene. Genes not connected by same letter as the control (A, B,) are significantly different from the control.

Table 19

	Roots Length RGR [cm/day], PEG 25%
Gene Id	Day 7 from planting	Day 14 from planting
	LS M	Signific ance*	LS M best Eve nt	Signif icance *	% improv ement of Best event	LS M	Signif icance *	LSM best Event	Significa nee*	% improve ment of Best event
GUI	0.2 3	B	0.23	B		0.0 9	B	0.09	B
ΜΑΒΙ	0.4 6	A	0.58	A	148	0.1 2	A	0.14	A	58
ΜΑΒΙ 5	0.4 3	A	0.58	A	148	0.0 8	B	0.10	B	16
ΜΑΒΙ 7	0.4 5	A	0.57	A	147	0.1 1	A	0.16	A	87
ΜΑΒΙ 8	0.4 1	A	0.44	A	89	0.1 0	B	0.13	A	45
ΜΑΒ3 5	0.3 1	B	0.37	A	59	0.1 0	B	0.13	A	51
ΜΑΒΙ 46	0.4 9	A	0.65	A	178	0.0 9	B	0.10	B	17

Tablel9: LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 20

2017228711 15 Sep 2017

	Roots Length RGR [cm/day], PEG 25%
Gene Id	Day 7 from planting	Day 14 from planting
	LS M	Signific ance*	LS M best Eve nt	Signif icance *	% improv ement of Best event	LS M	Signif icance *	LSM best Event	Significa nee*	% improve ment of Best event
GUI	0.2 0	B	0.20	B		0.0 7	B	0.07	B
ΜΑΒΙ 34	0.2 8	A	0.33	A	68	0.0 7	B	0.08	B	16
ΜΑΒΙ 3	0.3 4	A	0.46	A	133	0.1 1	A	0.15	A	113
ΜΑΒΙ 5	0.3 0	A	0.47	A	139	0.0 6	B	0.07	B	1
ΜΑΒΙ 7	0.3 9	A	0.44	A	121	0.0 9	B	0.10	B	39
ΜΑΒ3 GA	0.2 8	A	0.34	A	72	0.0 5	B	0.08	B	8

Table 20; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 21

	Roots Length RGR [cm/day], PEG 25%
Gene Id	Day 7 from planting	Day 10 from planting
	LS M	Signific ance*	LS M best Eve nt	Signif icance *	% improv ement of Best event	LS M	Signif icance *	LSM best Event	Significa nee*	% improve ment of Best event
GUI	0.2 9	B	0.29	B		0.1 1	B	0.11	B
ΜΑΒΙ 37	0.2 7	B	0.39	A	32	0.1 1	B	0.12	B	11
MAB4 3	0.3 3	B	0.49	A	66	0.1 4	A	0.17	A	60
MAB5 0	0.3 7	A	0.53	A	82	0.1 3	B	0.15	A	45
MAB6	0.3 3	B	0.43	A	47	0.1 2	B	0.15	B	38

Table 21; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Tables 22-23 depict analyses of Plant Fresh Weight in plants overexpressing the polynucleotides of the invention under the regulation of 6669 promoter in 25% PEG. Each Table represents an independent experiment, using 4 independent events per gene. Genes not connected by same letter as the control (A, B,) are significantly different 15 from the control.

Table 22

2017228711 15 Sep 2017

Gene Id	Plant Fresh Weight [grJ, PEG 25%
	LSM	Significance*	LSM best Event	Significance*	% improvement of Best event
GUI	0.20	B	0.20	B
MAB15	0.25	B	0.30	A	51
MAB18	0.21	B	0.26	A	33

Table 22; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 23

Gene Id	Plant Fresh Weight \|gr\|, PEG 25%
	LSM	Significance *	LSM best Event	Significance*	% improvement of Best event
GUI	0.18	B	0.18	B
MAB 17	0.22	B	0.29	A	66
MAB3GA	0.18	B	0.27	A	53

Table 23; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Tables 24-27 depict analyses of Leaf Area in plants overexpressing the polynucleotides of the invention under the regulation of 6669 promoter in normal conditions. Each Table represents an independent experiment, using 4 independent events per gene. Genes not connected by same letter as the control (A, B,) are significantly different from the control.

Table 24

	Leaf Area [cm^A2], Normal Conditions
Gene Id	Day 7 from planting	Day 14 from planting
	LS M	Signific ance*	LSM best Even t	Signifi cance *	% improve ment of Best event	LS M	Signifi cance *	LSM best Event	Significa nee*	% improve ment of Best event
GUI	0.4 9	B	0.49	B		0.8 2	B	0.82	B
MAB 1	0.6 5	A	0.73	A	47	1.0 0	A	1.13	A	38

Table 24; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significantly different at P < 0.05. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 25

2017228711 15 Sep 2017

	Leaf Area [cm^A2], Normal Conditions
Gene Id	Day 7 from planting	Day 14 from planting
	LS M	Signific ance*	LSM best Even t	Signifi cance *	% improv ement of Best event	LS M	Signifi cance *	LSM best Event	Significa nee*	% improve ment of Best event
GUI	0.2 4	B	0.24	B		0.5 6	B	0.56	B
MAB 17	0.3 1	A	0.34	A	40	0.7 3	A	0.90	A	61
MAB 18	0.2 9	A	0.37	A	52	0.6 9	A	0.79	A	42

Table 25: LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 26

	Leaf Area [cm^A2], Normal Conditions
Gene Id	Day 7 from planting	Day 14 from planting
	LS M	Signific ance*	LS M best Eve nt	Signif icance *	% improv ement of Best event	LS M	Signif icance *	LSM best Event	Significa nee*	% improve ment of Best event
GUI	0.3 9	B	0.39	B		0.9 8	B	0.98	B
MAB 15	0.4 6	A*	0.61	A	57	1.2 2	A	1.38	A	41
MAB 17	0.4 6	A*	0.57	A	47	1.1 3	A*	1.32	A	34
MAB3 G A	0.3 8	B	0.56	A	45	0.9 7	B	1.38	A	40

Table 26: LSM = Least square mean; % improvement = compare to control (GUI); ); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in

Table 3 above.

Table 27

	Leaf Area [cm^A2], Normal conditions
Gene Id	Day 7 from planting	Day 10 from planting
	LS M	Signific ance*	LSM best Even t	Signifi cance *	% improv ement of Best event	LS M	Signifi cance *	LSM best Event	Significa nee*	% improve ment of Best event
GUI	0.3 4	B	0.34	B		0.6 7	B	0.67	B
MAB 6	0.3 2	B	0.41	A	19	0.6 0	B	0.74	B	0.60

Table 27: LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

2017228711 15 Sep 2017

Tables 28-31 depict analyses of Roots Coverage in plants overexpressing the polynucleotides of the invention under the regulation of 6669 promoter in normal conditions. Each Table represents an independent experiment, using 4 independent events per gene. Genes not connected by same letter as the control (A, B,) are 5 significantly different from the control.

Table 28

	Roots Coverage \|cm^A2\|, Normal conditions
Gene Id	Day 7 from planting	Day 14 from planting
	LS M	Signific ance*	LSM best Even t	Signifi cance *	% improv ement of Best event	LSM	Signi fican ce*	LSM best Event	Significa nee*	% improve ment of Best event
GUI	3.3 4	B	3.34	B		11.6 1	B	11.61	B
MAB 18	3.3 1	B	4.78	A	43	10.6 6	B	13.30	B	14

Table 28; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 29

	Roots Coverage \|cm^A2\|, Normal conditions
Gene Id	Day 7 from planting
	LSM	Significance*	LSM best Event	Significance*	% improvement of Best event
GUI	5.40	B	5.40	B
MAB 100	5.05	B	7.06	A	31

Table 29: LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 30

	Roots Coverage \|cm^A2\|, Normal conditions
Gene Id	Day 7 from planting	Day 14 from planting
	LS M	Signific ance*	LSM best Even t	Signifi cance *	% improv ement of Best event	LSM	Signi fican ce*	LSM best Event	Significa nee*	% improve ment of Best event
GUI	3.5 3	B	3.53	B		8.52	B	8.52	B
MAB 18	4.1 7	A*	5.30	A	50	9.81	A*	12.89	A	51
MAB 32	2.5 5	B	4.71	A	33	6.40	B	12.37	A	45

2017228711 15 Sep 2017

MAB 35	3.7 3	B	4.59	A	30	8.55	B	11.12	A	30
MAB 46	2.4 6	B	3.42	B	-3	6.55	B	10.98	A	29
MAB 146	2.3 3	B	3.95	B	12	7.05	B	10.86	A	28

Table 30: LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 31

	Roots Coverage \|cm^A2\|, Normal conditions
Gene Id	Day 7 from planting	Day 10 from planting
	LS M	Signific ance*	LSM best Even t	Signif! cance *	% improv ement of Best event	LSM	Signi fican ce*	LSM best Event	Significa nee*	% improve ment of Best event
GUI	3.7 3	B	3.73	B		7.11	B	7.11	B
MAB 6	3.6 3	B	4.94	A	33	6.30	B	8.00	B	13

Table 31: LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Tables 32-33 depict analyses of Roots Length in plants overexpressing the polynucleotides of the invention under the regulation of 6669 promoter in normal conditions. Each Table represents an independent experiment, using 4 independent events per gene. Genes not connected by same letter as the control (A, B,) are significantly different from the control.

Table 32

	Roots Length \|cm\|, Normal conditions
Gene Id	Day 7 from planting	Day 14 from planting
	LS M	Signific ance*	LS M best Eve nt	Signif icance *	% improv ement of Best event	LS M	Signif icance *	LSM best Event	Significa nee*	% improve ment of Best event
GUI	5.8 9	B	5.89	B		6.8 2	B	6.82	B
ΜΑΒΙ	6.7 3	A	7.39	A	26	7.0 2	B	7.63	B	12
MAB 10	5.4 5	B	8.07	A	37	5.8 3	B	8.18	B	20

2017228711 15 Sep 2017

Table 32: LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 33

	Roots Length (cm], Normal conditions
Gene Id	Day 7 from planting	Day 14 from planting
	LS M	Signific ance*	LSM best Even t	Signifi cance *	% improv ement of Best event	LS M	Signifi cance *	LSM best Event	Significa nee*	% improve ment of Best event
GUI	3.9 6	B	3.96	B		6.5 1	B	6.51	B
MAB 18	5.0 7	A	5.70	A	44	7.0 8	A	8.03	A	23
MAB 32	3.6 8	B	6.12	A	55	5.8 2	B	8.22	A	26
MAB 35	4.5 8	A	5.76	A	46	6.7 7	B	7.75	A	19
MAB 46	3.3 9	B	4.31	B	9	5.5 5	B	7.42	A	14
MAB 146	3.1 4	B	4.82	A	22	5.4 7	B	7.48	A	15

Table 33: LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Tables 34-36 depict analyses of Leaf Area RGR in plants overexpressing the polynucleotides of the invention under the regulation of 6669 promoter in normal conditions. Each Table represents an independent experiment, using 4 independent events per gene. Genes not connected by same letter as the control (A, B,) are significantly different from the control.

Table 34

	Leaf Area RGR [cm/day], Normal conditions
Gene Id	Day 7 from planting	Day 14 from planting
	LS M	Signific ance*	LSM best Even t	Signifi cance *	% improv ement of Best event	LS M	Signifi cance *	LSM best Event	Significa nee*	% improve ment of Best event
GUI	0.4 3	B	0.43	B		0.2 0	B	0.20	B
MAB 15	0.7 9	A	1.25	A	189	0.2 1	B	0.27	B	36
MAB 146	0.6 2	B	0.97	A	124	0.1 5	C	0.18	B	-13

2017228711 15 Sep 2017

Table 34: LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 35

	Leaf Area RGR \|cm/day], Normal conditions
Gene Id	Day 7 from planting	Day 14 from planting
	LS M	Signific ance*	LS M best Eve nt	Signif icance *	% improv ement of Best event	LS M	Signif icance *	LSM best Event	Significa nee*	% improve ment of Best event
GUI	0.7 3	B	0.73	B		0.2 1	B	0.21	B
ΜΑΒΙ 00	0.7 2	B	1.00	A	37	0.2 7	B	0.32	A	48
ΜΑΒΙ 34	0.8 5	B	0.92	B	27	0.3 1	A	0.37	A	75
ΜΑΒΙ 5	0.8 8	A*	1.24	A	70	0.2 8	B	0.33	A	56
ΜΑΒΙ 7	0.9 1	A	1.18	A	62	0.2 6	B	0.33	A	55
ΜΑΒ3 GA	0.8 8	B	1.16	A	59	0.2 7	B	0.31	B	46

Table 35: LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P <0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 36

	Leaf Area RGR [cm/day], Normal conditions
Gene Id	Day 7 from planting	Day 14 from planting
	LS M	Signific ance*	LSM best Even t	Signifi cance *	% improv ement of Best event	LS M	Signifi cance *	LSM best Event	Significa nee*	% improve ment of Best event
GUI	0.9 2	B				0.29	B	0.29	B
MAB 32	0.9 5	B	1.31	A	43	0.28	B	0.31	B	5

Table 36: LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Tables 37-41 depict analyses of Roots Coverage RGR in plants overexpressing the polynucleotides of the invention under the regulation of 6669 promoter in normal conditions. Each Table represents an independent experiment, using 4 independent events per gene. Genes not connected by same letter as the control (A, B,) are significantly different from the control.

2017228711 15 Sep 2017

Table 37

	Roots Coverage RGR [cm/day], Normal conditions
Gene Id	Day 7 from planting	Day 14 from planting
	LS M	Signific ance*	LSM best Even t	Signifi cance *	% improv ement of Best event	LS M	Signifi cance *	LSM best Event	Significa nee*	% improve ment of Best event
GUI	5.6 2	B	5.62	B		0.1 8	B	0.18	B
MAB 10	7.6 9	B	15.1 0	A	168	0.0 8	B	0.14	B	-20
MAB 44	5.2 8	B	11.6 9	A	108	0.1 3	B	0.17	B	-5

Table 37: LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 38

	Roots Coverage RGR \|cm/day\|, Normal conditions
Gene Id	Day 7 from planting	Day 14 from planting
	LS M	Signific ance*	LSM best Even t	Signifi cance *	% improv ement of Best event	LS M	Signifi cance *	LSM best Event	Significa nee*	% improve ment of Best event
GUI	0.2 3	B	0.23	B		0.4 0	B	0.40	B
MAB 1	0.9 0	A	1.23	A	444	0.3 3	B	0.42	B	7
MAB 15	1.0 6	A	1.65	A	628	0.3 4	B	0.42	B	6
MAB 18	0.9 4	A	1.76	A	677	0.3 7	B	0.52	B	32
MAB 35	0.5 6	B	1.00	A	342	0.3 8	B	0.41	B	3
MAB 146	0.8 0	A	1.09	A	381	0.3 5	B	0.50	B	26

Table 38; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 39

	Roots Coverage RGR \|cm/day\|, Normal conditions
Gene Id	Day 7 from planting	Day 14 from planting
	LS M	Signific ance*	LSM best Even t	Signifi cance *	% improv ement of Best event	LS M	Signifi cance *	LSM best Event	Significa nee*	% improve ment of Best event
GUI	1.6 4	B	1.64	B		0.1 2	B	0.12	B

2017228711 15 Sep 2017

MAB 134	3.0 9	A	4.38	A	167	0.1 4	B	0.17	B	35
MAB 13	2.4 7	A	2.82	A	72	0.1 1	B	0.13	B	6
MAB 15	1.9 6	B	2.75	A	68	0.1 5	B	0.16	B	33
MAB 17	2.0 9	B	3.09	A	89	0.1 5	B	0.20	A	60

Table 39: LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 40

	Roots Coverage RGR \|cm/day\|, Normal conditions
Gene Id	Day 7 from planting	Day 14 from planting
	LS M	Signific ance*	LSM best Even t	Signifi cance *	% improv ement of Best event	LS M	Signifi cance *	LSM best Event	Significa nee*	% improve ment of Best event
GUI	2.5 3	B	2.53	B		0.2 4	B	0.24	B
MAB 35	1.6 6	B	4.14	A	63	0.2 9	B	0.54	A	123
MAB 4	1.4 6	B	2.64	B	4	0.3 2	B	0.42	A	73
MAB 146	0.6 2	B	0.95	B	-63	0.4 1	A	0.75	A	207

Table 40: LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 41

	Roots Coverage RGR \|cm/day\|, Normal conditions
Gene Id	Day 7 from planting	Day 10 from planting
	LS M	Signific ance*	LSM best Even t	Signifi cance *	% improv ement of Best event	LS M	Signifi cance *	LSM best Event	Significa nee*	% improve ment of Best event
GUI	1.0 8	B	1.08	B		0.3 1	B	0.31	B
MAB 137	1.3 6	B	2.03	A	88	0.2 6	B	0.31	B	1
MAB 43	1.3 9	B	2.35	A	118	0.2 3	B	0.27	B	-12
MAB 50	1.5 7	A	1.98	A	83	0.2 7	B	0.30	B	-3
MAB 6	1.1 6	B	1.94	A	80	0.2 5	B	0.29	B	-6
MAB 99	1.4 8	A	2.63	A	144	0.2 1	B	0.27	B	-13

2017228711 15 Sep 2017

Table 41: LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Tables 42-46 depict analyses of Roots Length RGR in plants overexpressing the polynucleotides of the invention under the regulation of 6669 promoter in normal conditions. Each Table represents an independent experiment, using 4 independent events per gene. Genes not connected by same letter as the control (A, B,) are significantly different from the control.

Table 42

	Roots Length RGR \|cm/day\|, Normal conditions
Gene Id	Day 7 from planting
	LSM	Significance*	LSM best Event	Significance*	% improvement of Best event
GUI	1.07	B	1.07	B
MAB 10	1.29	B	2.01	A	88

Table 42: LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 43

	Roots Length RGR [cm/day], Normal conditions
Gene Id	Day 7 from planting
	LSM	Significance*	LSM best Event	Significance*	% improvement of Best event
GUI	0.17	B	0.17	B
ΜΑΒΙ	0.26	A	0.34	A	93
MAB15	0.32	A	0.45	A	156
MAB17	0.24	A	0.28	A	61
MAB18	0.30	A	0.41	A	136
MAB 146	0.26	A	0.34	A	93

Table 43: LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 44

	Roots Length RGR \|cm/day\|, Normal conditions
Gene Id	Day 7 from planting	Day 14 from planting
	LS M	Signific ance*	LSM best Even t	Signifi cance *	% improv ement of Best event	LS M	Signifi cance *	LSM best Event	Significa nee*	% improve ment of Best event
GUI	0.2 9	B	0.29	B		0.0 8	B	0.08	B
MAB 100	0.3 6	B	0.39	B	31	0.0 8	B	0.13	A	67

2017228711 15 Sep 2017

MAB 134	0.5 1	A	0.63	A	115	0.0 8	B	0.09	B	23
MAB 13	0.5 0	A	0.61	A	107	0.0 8	B	0.09	B	19
MAB 15	0.4 0	A	0.53	A	79	0.0 8	B	0.09	B	19
MAB 17	0.3 8	A*	0.44	A	49	0.1 0	A	0.13	A	70

Table 44: LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 45

	Roots Length RGR \|cm/day\|, Normal conditions
Gene Id	Day 14 from planting
	LSM	Significance*	LSM best Event	Significance*	% improvement of Best event
GUI	0.11	B	0.11	B
MAB32	0.11	B	0.15	A	35
MAB35	0.11	B	0.20	A	76
MAB4	0.11	B	0.17	A	50
MAB 146	0.15	A	0.19	A	71

Table 45: LSM = Least square mean; % improvement = compare to control (GUI); ); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 46

	Roots Length RGR [cm/day], Normal conditions
Gene Id	Day 7 from planting	Day 10 from planting
	LS M	Signific ance*	LSM best Even t	Signifi cance *	% improv ement of Best event	LS M	Signifi cance *	LSM best Event	Significa nee*	% improve ment of Best event
GUI	0.3 1	B	0.31	B		0.1 2	B	0.12	B
MAB 137	0.3 3	B	0.40	A	31	0.1 1	B	0.12	B	-1
MAB 43	0.3 3	B	0.44	A	41	0.1 1	B	0.12	B	-2
MAB 50	0.3 9	A	0.42	A	35	0.1 3	B	0.17	A	34
MAB 6	0.3 0	B	0.41	A	33	0.1 2	B	0.18	A	41

Table 46: LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Tables 47-48 depict analyses of Plant Fresh Weight in plants overexpressing the polynucleotides of the invention under the regulation of 6669 promoter in normal conditions. Each Table represents an independent experiment, using 4 independent

2017228711 15 Sep 2017

100 events per gene. Genes not connected by same letter as the control (A, B,) are significantly different from the control.

Table 47

	Plant Fresh Weight \|gr\|, Normal conditions
Gene Id	Day 14 from planting
	LSM	Significance*	LSM best Event	Significance*	% improvement of Best event
GUI	0.15	B	0.15	B
MAB 15	0.24	A	0.28	A	93
MAB 17	0.21	A	0.25	A	73
MAB 18	0.22	A	0.29	A	101

Table 47: LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 48

	Plant	Fresh Weight [gr], Normal conditions
Gene Id	Day 14 from planting
	LSM	Significance *	LSM best Event	Significance*	% improvement of Best event
GUI	0.20	B	0.20	B
MAB 100	0.28	A*	0.33	A	62
MAB 134	0.23	B	0.34	A	64
MAB 13	0.31	A	0.35	A	73
MAB 15	0.38	A	0.42	A	106
MAB 17	0.37	A	0.53	A	159
MAB3GA	0.28	A*	0.40	A	94

Table 48: LSM = Least square mean; % improvement = compare to control (GUI); ); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Assay 2: plant growth at Nitrogen deficiency under Tissue culture conditions The present inventors have found the NUE (Nitrogen Utilization Efficiency) assay to be relevant for the evaluation of the ABST candidate genes, since NUE deficiency encourages root elongation, increase of root coverage and allows detecting the potential of the plant to generate a better root system under drought conditions. In addition, there are indications in the literature (Wesley et al., 2002 Journal of Experiment Botany Vol. 53, No. 366, pp. 13-25) that biological mechanisms of NUE and drought tolerance are linked.

Surface sterilized seeds are sown in basal media [50 % Murashige-Skoog medium (MS) supplemented with 0.8 % plant agar as solidifying agent] in the presence of Kanamycin (for selecting only transgenic plants). After sowing, plates are

2017228711 15 Sep 2017

101 transferred for 2-3 days at 4 °C for stratification and then grown at 25 °C under 12-hour light 12-hour dark daily cycles for 7 to 10 days. At this time point, seedlings randomly chosen are carefully transferred to plates holding nitrogen-limiting conditions: 0.5 MS media in which the combined nitrogen concentration (NH4NO3 and KNO3) is 0.75 mM (nitrogen deficient conditions) or to plates holding normal nitrogen conditions: 0.5 MS media in which the combined nitrogen concentration (NH4NO3 and KNO₃) is 3 mM (normal nitrogen concentration). All tissue culture experiments were grown at the same time (NUE, PEG and Normal). Results for growth under normal conditions for NUE are the same as for PEG and are presented in assay 1. Each plate contains 5 seedlings of the same event, and 3-4 different plates (replicates) for each event. For each polynucleotide of the invention at least four independent transformation events are analyzed from each construct. Plants expressing the polynucleotides of the invention are compared to the average measurement of the control plants (GUI- harboring the GUS gene under the same promoter) used in the same experiment.

Digital imaging and statistical analysis - Parameters were measured and analyzed as described in Assay 1 above.

Experimental Results - The polynucleotide sequences of the invention were assayed for a number of desired traits.

Tables 49-53 depict analyses of Leaf Area in plants overexpressing the polynucleotides of the invention under the regulation of 6669 promoter in nitrogen deficient conditions. Each Table represents an independent experiment, using 4 independent events per gene. Genes not connected by same letter as the control (A, B) are significantly different from the control.

Table 49

	Leaf Area [cm^A2], NUE 0.75 mM
Gene Id	Day 7 from planting	Day 14 from planting
	LS M	Signific ance*	LS M best Eve nt	Signif icance *	% improv ement of Best event	LS M	Signif icance *	LSM best Event	Significa nee*	% improve ment of Best event
GUI	0.4 5	B	0.45	B		0.4 1	B	0.41	B
ΜΑΒΙ	0.4 9	B	0.65	A	44	0.5 0	A	0.55	A	35
ΜΑΒΙ 0	0.4 6	B	0.62	A	38	0.5 1	A	0.69	A	68
MAB6	0.4 2	B	0.53	B	17	0.4 9	B	0.61	A	49

2017228711 15 Sep 2017

102

Table 49: LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P <0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 50

	Leaf Area 1«η^Λ2], NEE 0.75 mM
Gene Id	Day 7 from planting	Day 14 from planting
	LS M	Signific ance*	LSM best Even t	Signifi cance *	% improv ement of Best event	LS M	Signifi cance *	LSM best Event	Significa nee*	% improve ment of Best event
GUI	0.2 3	B	0.23	B		0.4 1	B	0.41	B
MAB 1	0.2 2	B	0.24	B	5	0.5 0	A	0.55	A	35
MAB 15	0.2 5	B	0.32	A	43	0.5 1	A	0.69	A	68
MAB 17	0.2 7	A	0.36	A	57	0.5 5	A	0.70	A	72
MAB 18	0.3 0	A	0.36	A	57	0.5 9	A	0.73	A	80
MAB 35	0.2 1	B	0.26	B	14	0.4 9	B	0.61	A	49
MAB 146	0.2 6	B	0.28	B	23	0.5 5	A	0.60	A	48

Table 50: LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 51

	Leaf Area 1«η^Λ2], NEE 0.75 mM
Gene Id	Day 7 from planting
	LSM	Significance*	LSM best Event	Significance*	% improvement of Best event
GUI	0.34	B	0.34	B
MAB 17	0.32	B	0.44	A	31
MAB3GA	0.32	B	0.44	A	31

Table 51: LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 52

	Leaf Area 1«η^Λ2], NEE 0.75 mM
Gene Id	Day 7 from planting	Day 14 from planting
	LS M	Signific ance*	LSM best Even t	Signifi cance *	% improv ement of Best event	LS M	Signifi cance *	LSM best Event	Significa nee*	% improve ment of Best event
GUI	0.2 1	B	0.21	B		0.6 3	B	0.63	B

2017228711 15 Sep 2017

103

MAB 18	0.2 3	B	0.31	A	50	0.5 8	B	0.77	A	22
MAB 4	0.2 0	B	0.31	A	48	0.5 4	B	0.82	A	30
MAB 146	0.2 1	B	0.29	A	41	0.4 8	C	0.59	B	-6

Table 52: LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 53

	Leaf Area (cm^A2], NUE 0.75 mM
Gene Id	Day 7 from planting	Day 10 from planting
	LS M	Signific ance*	LS M best Eve nt	Signif icance *	% improv ement of Best event	LS M	Signif icance *	LSM best Event	Significa nee*	% improve ment of Best event
GUI	0.2 7	B	0.27	B		0.5 1	B	0.51	B
MAB4 3	0.2 5	B	0.35	A	29	0.4 7	B	0.60	B	18
MAB5 0	0.2 8	B	0.32	B	19	0.5 4	B	0.66	A	31
MAB6	0.2 8	B	0.35	A	28	0.5 4	B	0.69	A	35
MAB6 6	0.2 8	B	0.34	A	25	0.5 1	B	0.59	B	17
MAB9 9	0.2 7	B	0.35	A	28	0.5 1	B	0.59	B	16

Table 53: LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Tables 54-57 depict analyses of Roots Coverage in plants overexpressing the polynucleotides of the invention under the regulation of 6669 promoter in nitrogen deficient conditions. Each Table represents an independent experiment, using 4 independent events per gene. Genes not connected by same letter as the control (A, B,) 15 are significantly different from the control.

Table 54

	Roots Coverage \|cm^A2\|, NUE 0.75 mM
Gene Id	Day 7 from planting	Day 14 from planting
	LS M	Signific ance*	LS M best Eve nt	Signif icance *	% improv ement of Best event	LSM	Signi fican ce*	LSM best Event	Significa nee*	% improve ment of Best event
GUI	6.1 8	B	6.18	B		14.3 6	B	14.36	B

2017228711 15 Sep 2017

104

ΜΑΒΙ	7.3 3	B	8.56	A	39	13.1 8	B	16.22	B	13
ΜΑΒΙ 0	7.9 3	A	10.3 8	A	68	13.3 2	B	14.67	B	2
MAB2 5	5.8 3	B	6.93	B	12	11.1 2	A	13.90	B	-3
MAB4 4	5.3 7	B	9.93	A	61	11.1 4	A	17.59	B	22
MAB6	6.8 8	B	9.31	A	51	12.7 9	B	15.66	B	9

Table 54: LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 55

	Roots Coverage \|cm^A2\|, NUE 0.75 mM
Gene Id	Day 7 from planting	Day 14 from planting
	LS M	Signific ance*	LSM best Even t	Signifi cance *	% improv ement of Best event	LSM	Signi fican ce*	LSM best Event	Significa nee*	% improve ment of Best event
GUI	4.0 4	B	4.04	B		12.2 4	B	12.24	B
MAB 15	4.5 3	B	5.60	A	39	13.7 0	B	16.40	A	34
MAB 17	4.1 5	B	4.85	B	20	13.1 6	B	15.06	A	23
MAB 18	5.2 3	A	6.79	A	68	14.4 7	A	15.52	A	27
MAB 35	4.0 3	B	4.90	B	21	13.9 5	B	15.62	A	28
MAB 146	5.1 0	B	7.01	A	73	14.6 5	A	15.70	A	28

Table 55; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 56

	Roots Coverage [cm^A2], NUE 0.75 mM
Gene Id	Day 7 from planting	Day 14 from planting
	LS M	Signific ance*	LSM best Even t	Signifi cance *	% improv ement of Best event	LSM	Signi fican ce*	LSM best Event	Significa nee*	% improve ment of Best event
GUI	3.1 4	B	3.14	B		10.8 8	B	10.88	B
MAB 18	5.3 9	A	7.64	A	144	12.7 6	B	16.64	A	53
MAB 32	3.5 8	B	7.13	A	127	9.79	B	16.22	A	49
MAB 35	5.0 0	A	6.49	A	107	13.3 1	A	15.36	A	41

2017228711 15 Sep 2017

105

MAB 4	4.1 6	B	7.34	A	134	12.0 0	B	16.52	A	52
MAB 46	3.0 1	B	3.78	B	21	8.35	C	12.09	B	11
MAB 146	4.2 2	B	7.34	A	134	11.4 8	B	14.98	A	38

Table 56; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 57

	Roots Coverage \|cm^A2\|, NUE 0.75 mM
Gene Id	Day 7 from planting	Day 10 from planting
	LS M	Signific ance*	LS M best Eve nt	Signif icance *	% improv ement of Best event	LSM	Signi fican ce*	LSM best Event	Significa nee*	% improve ment of Best event
GUI	4.5 6	B	4.56	B		9.81	B	9.81	B
MAB6	5.6 6	A	7.98	A	75	10.6 1	B	14.87	A	52
MAB6 6	5.8 3	A	6.58	A	44	10.3 1	B	11.49	B	17

Table 57; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Tables 58-61 depict analyses of Roots Length in plants overexpressing the polynucleotides of the invention under the regulation of 6669 promoter in nitrogen deficient conditions. Each Table represents an independent experiment, using 4 independent events per gene. Genes not connected by same letter as the control (A, B,) are significantly different from the control.

Table 58

	Roots I	.ength 1cm], NEE 0.75 mM
Gene Id	Day 7 from planting
	LSM	Significance*	LSM best Event	Significance*	% improvement of Best event
GUI	6.31	B	6.31	B
MAB44	5.34	B	7.07	A	12

Table 58; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

106

Table 59

2017228711 15 Sep 2017

	Roots Length [cm], NUE 0.75 mM
Gene Id	Day 7 from planting	Day 14 from planting
	LS M	Signific ance*	LSM best Even t	Signifi cance *	% improv ement of Best event	LS M	Signifi cance *	LSM best Event	Significa nee*	% improve ment of Best event
GUI	4.5 5	B	4.55	B		7.2 3	B	7.23	B
MAB 15	4.4 8	B	5.40	A	19	6.9 3	B	7.49	B	4
MAB 18	4.6 1	B	5.48	A	20	7.5 9	B	7.86	B	9
MAB 146	4.7 0	B	5.20	B	14	7.6 6	B	7.95	A	10

Table 59; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 60

	Roots Length \|cm\|, NEE 0.75 mM
Gene Id	Day 7 from planting	Day 14 from planting
	LS M	Signific ance*	LS M best Eve nt	Signif icance *	% improv ement of Best event	LS M	Signif icance *	LSM best Event	Significa nee*	% improve ment of Best event
GUI	3.6 1	B	3.61	B		6.1 5	B	6.15	B
ΜΑΒΙ 8	4.9 3	A	6.44	A	79	7.3 0	A	8.11	A	32
MAB3 2	4.0 2	B	6.48	A	80	6.5 3	B	8.51	A	38
MAB3 5	4.7 0	A	5.47	A	52	7.2 0	A	7.46	A	21
MAB4	4.0 6	A*	5.54	A	54	6.6 0	B	8.02	A	30
ΜΑΒΙ 46	3.7 7	B	5.54	A	54	6.0 9	B	7.19	A	17

Table 60; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 61

	Roots Length \|cm\|, NEE 0.75 mM
Gene Id	Day 7 from planting
	LSM	Significance*	LSM best Event	Significance*	% improvement of Best event
GUI	4.87	B	4.87	B
MAB66	5.27	B	5.74	A	18

Table 61; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

2017228711 15 Sep 2017

107

Tables 62-64 depict analyses of Leaf Area RGR in plants overexpressing the polynucleotides of the invention under the regulation of 6669 promoter in nitrogen deficient conditions. Each Table represents an independent experiment, using 4 independent events per gene. Genes not connected by same letter as the control (A, B,) 5 are significantly different from the control.

Table 62

	Leaf area RGR \|cm/day\|, NUE 0.75 mM
Gene Id	Day 7 from planting	Day 14 from planting
	LS M	Signific ance*	LSM best Even t	Signifi cance *	% improv ement of Best event	LS M	Signifi cance *	LSM best Event	Significa nee*	% improve ment of Best event
GUI	0.4 6	B	0.46	B		0.1 2	B	0.12	B
MAB 1	0.6 8	A	1.47	A	222	0.2 0	A	0.30	A	151
MAB 17	0.4 3	B	0.50	B	8	0.1 7	B	0.29	A	145
MAB 35	0.6 5	A	0.71	A	54	0.1 9	A	0.23	A	93
MAB 146	0.5 5	B	0.80	A	75	0.1 6	B	0.20	B	66

Table 62; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 63

	Leaf area RGR [cm/day], NEE 0.75 mM
Gene Id	Day 7 from planting
	LSM	Significance*	LSM best Event	Significance*	% improvement of Best event
GUI	0.80	B	0.80	B
MAB 18	0.87	B	1.24	A	56
MAB32	0.94	B	1.53	A	91
MAB35	0.96	B	1.21	A	51
MAB4	0.71	B	0.81	B	1
MAB46	0.64	B	0.75	B	-7
MAB 146	0.82	B	1.04	B	30

Table 63; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

108

Table 64

2017228711 15 Sep 2017

	Leaf area RGR [cm/day], NUE 0.75 mM
Gene Id	Day 7 from planting	Day 10 from planting
	LS M	Signific ance*	LS M best Eve nt	Signif icance *	% improv ement of Best event	LS M	Signif icance *	LSM best Event	Significa nee*	% improve ment of Best event
GUI	1.2 2	B	1.22	B		0.2 8	B	0.28	B
ΜΑΒΙ 37	2.1 2	B	5.12	A	319	0.2 9	B	0.35	B	25
MAB4 3	1.9 4	B	5.18	A	323	0.2 9	B	0.35	B	28
MAB5 0	1.1 5	B	1.76	B	44	0.3 2	B	0.41	A	50

Table 64; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Tables 65-69 depict analyses of Roots Coverage RGR in plants overexpressing the polynucleotides of the invention under the regulation of 6669 promoter in nitrogen deficient conditions. Each Table represents an independent experiment, using 4 independent events per gene. Genes not connected by same letter as the control (A, B, 10 C) are significantly different from the control.

Table 65

	Roots Coverage RGR [cm/day], NUE 0.75 mM
Gene Id	Day 7 from planting	Day 14 from planting
	LS M	Signific ance*	LSM best Even t	Signifi cance *	% improv ement of Best event	LS M	Signifi cance *	LSM best Event	Significa nee*	% improve ment of Best event
GUI	5.3 5	B	5.35	B		0.2 8	B	0.28	B
MAB 25	7.3 8	B	11.6 2	A	117	0.1 9	C	0.26	B	-6
MAB 44	7.1 9	B	11.5 2	A	115	0.2 6	B	0.35	B	23

Table 65; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

109

Table 66

2017228711 15 Sep 2017

	Roots Coverage RGR [cm/day], NUE 0.75 mM
Gene Id	Day 7 from planting	Day 14 from planting
	LS M	Signific ance*	LSM best Even t	Signifi cance *	% improv ement of Best event	LS M	Signifi cance *	LSM best Event	Significa nee*	% improve ment of Best event
GUI	0.4 3	B	0.43	B		0.3 0	B	0.30	B
MAB 1	2.1 6	A	3.09	A	621	0.3 6	B	0.43	A	44
MAB 15	1.5 5	A	2.81	A	555	0.3 0	B	0.33	B	9
MAB 17	1.9 9	A	4.08	A	852	0.3 5	B	0.53	A	78
MAB 18	1.4 4	A	1.90	A	343	0.2 9	B	0.36	B	19
MAB 35	1.1 0	B	1.71	B	298	0.3 7	B	0.48	A	59
MAB 146	2.1 6	A	4.03	A	841	0.3 0	B	0.41	A	38

Table 66; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 67

	Roots Coverage RGR \|cm/day\|, NUE 0.75 mM
Gene Id	Day 7 from planting
	LSM	Significance*	LSM best Event	Significance*	% improvement of Best event
GUI	2.30	B	2.30	B
MAB 100	2.85	B	4.02	A	74
MAB 134	4.27	A	5.99	A	160
MAB13	3.95	A	4.84	A	110
MAB15	3.05	A*	3.97	A	73
MAB17	2.96	B	3.76	A	63

Table 67; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 68

	Roots Coverage RGR [cm/day], NUE 0.75 mM
Gene Id	Day 7 from planting	Day 14 from planting
	LS M	Signific ance*	LS M best Eve nt	Signif icance *	% improv ement of Best event	LS M	Signif icance *	LSM best Event	Significa nee*	% improve ment of Best event
GUI	2.2 8	B	2.28	B		0.4 4	B	0.44	B
MAB3 5	2.0 2	B	4.82	A	111	0.3 3	B	0.53	B	20
MAB4	1.8 0	B	2.90	B	27	0.4 0	B	0.63	A	42

2017228711 15 Sep 2017

110

Table 68; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 69

	Roots Coverage RGR [cm/day], NUE 0.75 mM
Gene Id	Day 7 from planting
	LSM	Significance*	LSM best Event	Significance*	% improvement of Best event
GUI	1.60	B	1.60	B
MAB137	2.19	A	2.55	B	60
MAB43	2.00	B	2.75	A	72
MAB50	2.26	A	3.28	A	105
MAB6	2.45	A	2.96	A	85
MAB66	1.81	B	2.87	A	80
MAB99	2.25	A	3.73	A	133

Table 69; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Tables 70-74 depict analyses of Roots Length RGR in plants overexpressing the polynucleotides of the invention under the regulation of 6669 promoter in nitrogen deficient conditions. Each Table represents an independent experiment, using 4 independent events per gene. Genes not connected by same letter as the control (A, B,) are significantly different from the control.

Table 70

	Roots Length RGR \|cm/day\|, NEE 0.75 mM
Gene Id	Day 7 from planting	Day 14 from planting
	LS M	Signific ance*	LSM best Even t	Signifi cance *	% improv ement of Best event	LS M	Signifi cance *	LSM best Event	Significa nee*	% improve ment of Best event
GUI	0.9 9	B	0.99	B		0.0 4	B	0.04	B
MAB 44	1.1 0	B	1.64	A	65	0.0 6	B	0.09	A	108

Table 70; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

111

Table 71

2017228711 15 Sep 2017

	Roots Length RGR [cm/day], NEE 0.75 mM
Gene Id	Day 7 from planting	Day 14 from planting
	LS M	Signific ance*	LSM best Even t	Signifi cance *	% improv ement of Best event	LS M	Signifi cance *	LSM best Event	Significa nee*	% improve ment of Best event
GUI	0.2 3	B	0.23	B		0.0 9	B	0.09	B
MAB 1	0.4 6	A	0.58	A	148	0.1 2	A	0.14	A	58
MAB 15	0.4 3	A	0.58	A	148	0.0 8	B	0.10	B	16
MAB 17	0.4 5	A	0.57	A	147	0.1 1	A	0.16	A	87
MAB 18	0.4 1	A	0.44	A	89	0.1 0	B	0.13	A	45
MAB 35	0.3 1	B	0.37	A	59	0.1 0	B	0.13	A	51

Table 71; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 72

	Roots Length RGR \|cm/day\|, NEE 0.75 mM
Gene Id	Day 7 from planting	Day 14 from planting
	LSM	Signific ance*	LS M best Eve nt	Signif icance *	% improv ement of Best event	LS M	Signif icance *	LSM best Event	Significa nee*	% improve ment of Best event
GUI	0.35	B	0.35	B		0.0 6	B	0.06	B
MA B100	0.46	A	0.61	A	73	0.0 8	B	0.11	A	80
MA B134	0.62	A	0.73	A	107	0.0 9	A	0.10	A	60
MA B13	0.69	A	0.84	A	140	0.0 8	B	0.11	A	66
MA B15	0.52	A	0.58	A	66	0.0 7	B	0.09	B	44
MA B17	0.52	A	0.64	A	81	0.0 8	B	0.09	A	44
MA B3 GA	0.44	B	0.51	A	46	0.0 7	B	0.09	B	38

Table 72; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

112

Table 73

2017228711 15 Sep 2017

	Roots Length RGR [cm/day], NEE 0.75 mM
Gene Id	Day 7 from planting	Day 14 from planting
	LS M	Signific ance*	LSM best Even t	Signifi cance *	% improv ement of Best event	LS M	Signifi cance *	LSM best Event	Significa nee*	% improve ment of Best event
GUI	0.6 1	B	0.61	B		0.1 2	B	0.12	B
MAB 35	0.5 2	B	0.91	A	48	0.1 0	B	0.16	B	29
MAB 4	0.5 3	B	0.65	B	6	0.1 2	B	0.19	A	52
MAB 146	0.3 7	C	0.42	B	-31	0.1 2	B	0.17	A	39

Table 73; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 74

	Roots Length RGR \|cm/day\|, NEE 0.75 mM
Gene Id	Day 7 from planting	Day 10 from planting
	LS M	Signific ance*	LS M best Eve nt	Signif icance *	% improv ement of Best event	LS M	Signif icance *	LSM best Event	Significa nee*	% improve ment of Best event
GUI	0.3 6	B	0.36	B		0.1 1	B	0.11	B
ΜΑΒΙ 37	0.4 6	A	0.55	A	52	0.1 3	B	0.18	A	72
MAB4 3	0.4 1	B	0.53	A	47	0.1 2	B	0.14	B	30
MAB5 0	0.4 8	A	0.57	A	59	0.1 2	B	0.16	A	46
MAB6	0.5 3	A	0.64	A	79	0.1 0	B	0.12	B	9
MAB6 6	0.4 1	B	0.55	A	54	0.1 0	B	0.12	B	9
MAB9 9	0.4 7	A	0.62	A	74	0.1 0	B	0.13	B	19

Table 74; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Tables 75-76 depict analyses of Plant Fresh Weight in plants overexpressing the polynucleotides of the invention under the regulation of 6669 promoter in nitrogen deficient conditions. Each Table represents an independent experiment, using 4 independent events per gene. Genes not connected by same letter as the control (A, B,) 15 are significantly different from the control.

113

Table 75

2017228711 15 Sep 2017

	Plar	it Fresh Weight	[gr], NUE 0.75 mM
Gene Id	Day 14 from planting
	LSM	Significance*	LSM best Event	Significance*	% improvement of Best event
GUI	0.15	B
ΜΑΒΙ	0.25	A	0.46	A	208
MAB6	0.20	B	0.29	A	95

Table 75; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 76

	Plar	it Fresh Weight	\|gr\|, NEE 0.75 mM
Gene Id	Day 10 from planting
	LSM	Significance*	LSM best Event	Significance*	% improvement of Best event
GUI	0.15	B
MAB137	0.18	A	0.19	A	31
MAB50	0.16	B	0.22	A	49
MAB6	0.16	B	0.22	A	52
MAB66	0.15	B	0.19	A	32

Table 76; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

EXAMPLE 7

IMPRO VED ABSTIN GREENHOUSE ASSA Y

ABS tolerance: Yield and plant growth rate at high salinity concentration under greenhouse conditions - This assay follows the rosette area growth of plants grown in the greenhouse as well as seed yield at high salinity irrigation. Seeds were sown in agar media supplemented only with a selection agent (Kanamycin) and Hoagland solution under nursery conditions. The T₂ transgenic seedlings are then transplanted to 1.7 trays filled with peat and perlite. The trails were irrigated with tap water (provided from the pots’ bottom). Half of the plants are irrigated with a salt solution (40-80 mM NaCl and 5 mM CaCl₂) to induce salinity stress (stress conditions). The other half of the plants are continued to be irrigated with tap water (normal conditions). All plants are grown in the greenhouse until plants reach the mature seeds stage, then harvested (the above ground tissue) and weighted (immediately or following drying in oven at 50 °C for 24 hour). High salinity conditions are achieved by irrigation with a solution containing 40-80 mM NaCl (ABS growth conditions) and are compared to regular growth conditions.

2017228711 15 Sep 2017

114

The plants were analyzed for their overall size, growth rate, seed yield, and weight of 1,000 seeds, dry matter and harvest index (HI- seed yield / dry matter). Transgenic plants performance was compared to control plants grown in parallel under the same conditions. Mock- transgenic plants expressing the uidA reporter gene (GUS Intron - GUI) under the same promoter were used as control.

The experiment is planned in nested randomized plot distribution. High salinity conditions are achieved by irrigation with a solution containing 40-80 mM NaCl (ABS growth conditions).

Digital imaging - A laboratory image acquisition system, which consists of a digital reflex camera (Canon EOS 300D) attached with a 55 mm focal length lens (Canon EF-S series), mounted on a reproduction device (Kaiser RS), which included 4 light units (4x150 Watts light bulb) was used for capturing images of plantlets.

The image capturing process was repeated every 2-3 days starting at day 1 after sowing till day 10. The same camera attached with a 24 mm focal length lens (Canon EF series), placed in a custom made iron mount, was used for capturing images of larger plants sawn in white tubs in an environmental controlled greenhouse (as seen on Figures 2a-b). The tubs were square shape include E7 liter trays. During the capture process, the trays were placed beneath the iron mount, while avoiding direct sun light and casting of shadows. This process was repeated every 2-3 days for up to 10 days.

An image analysis system was used, which consists of a personal desktop computer (Intel P4 3.0 GHz processor) and a public domain program - ImageJ E37 (Java based image processing program which was developed at the U.S National Institutes of Health and freely available on the internet at Hypertext Transfer Protocol://rsbweb (dot) nih (dot) gov/). Images were captured in resolution of 6 Mega Pixels (3072 x 2048 pixels) and stored in a low compression JPEG (Joint Photographic Experts Group standard) format. Next, analyzed data was saved to text files and processed using the JMP statistical analysis software (SAS institute).

Vegetative parameters analysis - Using the digital analysis leaves data was calculated, including leaf Average area, Rosette diameter and rosette area. The Relative Growth Rate (RGR) for the rosette parameters was calculated according to Formula I as described in Example 6. On day 80 from sowing, the plants were harvested and left to dry at 30 °C in a drying chamber. The biomass and seed weight of each plot was separated, measured and divided by the number of plants. Dry weight = total weight of

2017228711 15 Sep 2017

115 the vegetative portion above ground (excluding roots) after drying at 30 °C in a drying chamber; Seed yield per plant = total seed weight per plant (gr).

The weight of 1000 seeds was determine as follows: seeds were scattered on a glass tray and a picture was taken. Each sample was weighted and then using the digital analysis, the number of seeds in each sample was calculated. 1000 seeds weight was calculated using formula II:

Formula II

1000 Seed Weight = number of seed in sample/ sample weight X 1000

Harvest Index - The harvest index was calculated using Formula III

Formula III:

Harvest Index = Average seed yield per plant/ Average dry weight

Each construct is validated in its T2 generation. Transgenic plants expressing the uidA reporter gene (GUI) under the same promoter are used as control.

Statistical analyses - To identify genes conferring significantly improved tolerance to abiotic stresses or enlarged root architecture, the results obtained from the transgenic plants are compared to those obtained from control plants. To identify outperforming genes and constructs, results from the independent transformation events tested are analyzed separately. In addition, genes and constructs are also analyzed taking into consideration the results obtained from all the independent transformation events tested the specific construct. For gene versus control analysis Student’s t test were applied, using significance of P < 0.05 or P < 0.1. The JMP statistics software package is used (Version 5.2.1, SAS Institute Inc., Cary, NC, USA).

Experimental Results

Tables 77-86 depict analyses of Rosette Area in plants overexpressing the polynucleotides of the invention under the regulation of 6669 promoter. Each Table represents an independent experiment, using 4 independent events per gene. Genes not connected by same letter as the control (A, B,) are significantly different from the control.

116

Table 77

2017228711 15 Sep 2017

Gene Id	Rosette Area [cm^A2] 80 mM NaCl, Day 3 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	0.58	B	0.58	B
MAB20	0.59	B	0.84	A	43
MAB50	0.57	B	0.88	A	51

Table 77; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 78

Gene Id	Rosette Area [cm^A2] 80 mM NaCl, Day 5 from planting
	LSM	Significance	LSM of Best event	Significanc e	% improvement of best event
GUI	1.27	B	1.27	B
MAB20	1.20	B	1.73	a	36
MAB50	1.21	B	2.04	a	61

Table 78; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 79

Gene Id	Rosette Area [cm^A2] 80 mM NaCl, Day 8 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	3.62	B	3.62	B
MAB20	3.97	B	5.18	A	43
MAB50	3.88	B	6.11	A	69

Table 79; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 80

Gene Id	Rosette Area [cm^A2] 80 mM NaCl, Day 10 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	7.22	B	7.22	B
MAB50	6.75	B	10.18	A	41

Table 80; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

117

Table 81

2017228711 15 Sep 2017

Gene Id	Rosette Area [cm^A2] 80 mM NaCl, Day 3 from planting
	LSM	Significance	LSM of Best event	Significanc e	% improvement of best event
GUI	1.63	B	1.63	B
ΜΑΒΙ	2.03	A	2.29	A	40
MAB6	1.34	B	2.40	A	47

Table 82

Gene Id	Rosette Area [cm^A2] 80 mM NaCl, Day 5 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	2.88	B	2.88	B
ΜΑΒΙ	3.41	A*	3.76	A	31

Table 82; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1; . The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 83

Gene Id	Rosette Area [cm^A2] 80 mM NaCl, Day 3 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	0.73	B	0.73	B
ΜΑΒΙ	0.77	B	0.91	A	25

Table 83; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 84

Gene Id	Rosette Area [cm^A2] 80 mM NaCl, Day 5 from planting
	LSM	Significance	LSM of Best event	Significanc e	% improvement of best event
GUI	1.41	B	1.41	B
ΜΑΒΙ	1.62	A*	2.02	A	44
MAB 17	1.14	B	1.80	A	28

Table 84; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

118

Table 85

2017228711 15 Sep 2017

Gene Id	Rosette Area [cm^A2] 80 mM NaCl, Day 8 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	2.37	B	2.37	B
ΜΑΒΙ	2.59	B	3.56	A	50
MAB 13	2.45	B	3.44	A	45
MAB 17	1.96	C	3.10	A	31

Table 85; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 86

Gene Id	Rosette Area [cm^A2] 80 mM NaCl, Day 10 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	4.67	B	4.67	B
ΜΑΒΙ	5.37	A*	7.93	A	70
MAB 15	4.78	B	6.08	A	30
MAB 17	4.02	B	6.19	A	32
MAB3GA	4.39	B	6.07	A	30

Table 86; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Tables 87-96 depict analyses of Rosette Diameter in plants overexpressing the polynucleotides of the invention under the regulation of 6669 promoter. Each Table represents an independent experiment, using 4 independent events per gene. Genes not connected by same letter as the control (A, B,) are significantly different from the control.

Table 87

Gene Id	Rosette Diameter [cm] 80 mM NaCl, Day 3 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	1.50	B	1.50	B
MAB50	1.35	B	1.80	A	20

Table 87; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

119

Table 88

2017228711 15 Sep 2017

Gene Id	Rosette Diameter [cm] 80 mM NaCl Day 5 from planting
	LSM	Significance	LSM of Best event	Significanc e	% improvement of best event
GUI	2.05	B	2.05	B
MAB50	1.82	C	2.44	A	19

Table 88; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 89

Gene Id	Rosette Diameter [cm] 80 mM NaCl Day 8 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	3.23	B	3.23	B
MAB50	3.16	B	4.12	A	27

Table 89; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 90

Gene Id	Rosette Diameter [cm] 80 mM NaCl Day 10 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	4.47	B	4.47	B
MAB50	4.20	B	5.31	A	19

Table 90; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 91

Gene Id	Rosette Diameter [cm] 80 mM NaCl Day 3 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	2.25	B	2.25	B
ΜΑΒΙ	2.60	A	2.78	A	23

Table 91; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

120

Table 92

2017228711 15 Sep 2017

Gene Id	Rosette Diameter [cm] 80 mM NaCl Day 5 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	2.87	B	2.87	B
ΜΑΒΙ	3.27	A*	9.25	A	223
MAB20	2.63	B	9.69	A	238
MAB6	2.51	B	10.00	A	249

Table 92; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 93

Gene Id	Rosette Diameter [cm] 80 mM NaCl Day 8 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	4.90	B	4.90	B
MAB6	4.35	B	6.26	A	28

Table 93; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 94

Gene Id	Rosette Diameter [cm] 80 mM NaCl Day 5 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	2.05	B	2.05	B
ΜΑΒΙ	2.22	B	2.55	A	25

Table 94; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 95

Gene Id	Rosette Diameter [cm] 80 mM NaCl Day 8 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	2.56	B	2.56	B
ΜΑΒΙ	2.78	B	3.29	A	29
MAB3GA	2.56	B	3.04	A	19

Table 95; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

121

Table 96

2017228711 15 Sep 2017

Gene Id	Rosette Diameter [cm] 80 mM NaCl Day 10 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	3.52	B	3.52	B
ΜΑΒΙ	3.79	B	4.76	A	35
MAB 17	3.24	B	4.14	A	17
MAB3GA	3.44	B	4.12	A	17

Table 96; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Tables 97-105 depict analyses of Leaf Average Area in plants overexpressing the polynucleotides of the invention under the regulation of 6669 promoter. Each Table represents an independent experiment, using 4 independent events per gene. Genes not connected by same letter as the control (A, B,) are significantly different from the control.

Table 97

Gene Id	Leaf Average Area [cm^A2] 80 mM NaCl Day 3 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	0.10	B	0.10	B
MAB25	0.10	B	0.13	A	30

Table 97; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 98

Gene Id	Leaf Average Area [cm^A2] 80 mM NaCl Day 5 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	0.16	B	0.16	B
MAB50	0.15	B	0.23	A	45

Table 98; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

122

Table 99

2017228711 15 Sep 2017

Gene Id	Leaf Average Area [cm^A2] 80 mM NaCl, Day 8 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	0.45	B	0.45	B
MAB50	0.41	B	0.61	A	34

Table 99; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 100

Gene Id	Leaf Average Area [cm^A2] 80 mM NaCl, Day 10 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	0.74	B	0.74	B
MAB50	0.66	B	0.92	A	25

Table 100; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at p < 0.05, A* meaning significant different at p < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 101

Gene Id	Leaf Average Area [cm^A2] 80 mM NaCl, Day 3 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	0.20	B	0.20	B
ΜΑΒΙ	0.25	A	0.28	A	43
MAB6	0.18	B	0.30	A	51
MAB7	0.23	B	0.27	A	36

Table 101; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 102

Gene Id	Leaf Average Area [cm^A2] 80 mM NaCl, Day 8 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	0.69	B	0.69	B
ΜΑΒΙ	0.80	A*	0.86	A*	24
MAB20	0.62	B	0.87	A	25
MAB6	0.59	B	0.99	A	44

Table 102; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

123

Table 103

Gene Id	Leaf Average Area [cm^A2] 80 mM NaCl, Day 5 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	0.20	B	0.20	B
ΜΑΒΙ	0.22	B	0.27	A	30
MAB17	-	-	0.25	A	21

Table 103; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 104

Gene Id	Leaf Average Area [cm^A2] 80 mM NaCl, Day 8 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	0.28	B	0.28	B
ΜΑΒΙ	0.30	B	0.37	A	33
MAB 17	0.24	B	0.34	A	22

Table 104; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 105

Gene Id	Leaf Average Area [cm^A2] 80 mM NaCl, Day 10 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	0.49	B	0.49	B
ΜΑΒΙ	0.55	B	0.76	A	53
MAB15	0.52	B	0.63	A	26
MAB17	0.45	B	0.64	A	28

Table 105; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Tables 106-111 depict analyses of RGR Rosette Area [cm^A2] of plants overexpressing the polynucleotides of the invention under the regulation of 6669 promoter. Each Table represents an independent experiment, using 4 independent events per gene. Genes not connected by same letter as the control (A, B,) are significantly different from the control.

124

Table 106

2017228711 15 Sep 2017

Gene Id	RGR of Rosette Area [cm^A2] 80 mM NaCl, Day 3 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	0.73	B	0.73	B
MAB 10	1.21	B	1.86	A	156
MAB 14	1.31	B	1.80	A	149
MAB2	1.59	A	2.24	A	208
MAB20	1.87	A	2.33	A	221
MAB25	1.44	A	1.63	A*	125
MAB36	1.49	A	1.89	A	161
MAB43	1.73	A	3.85	A	430
MAB44	1.76	A	2.51	A	246
MAB50	1.37	A*	1.57	A*	117
MAB9	1.47	A	1.75	A	141

Table 106; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in

Table 3 above.

Table 107

Gene Id	RGR of Rosette Area [cm^A2] 80 mM NaCl, Day 8 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	0.61	B	0.61	B
MAB 10	0.75	A*	0.91	A	50
MAB 14	0.79	A	0.86	B	42
MAB19	0.78	A	0.85	A	41
MAB2	0.80	A	0.93	A	54
MAB20	0.79	A	0.98	A	61
MAB36	0.83	A	0.95	A	56
MAB44	0.75	A*	0.84	A	38
MAB50	0.76	A*	0.83	B	38
MAB6	0.82	A	0.99	A	64
MAB7	0.78	A	0.87	A	44
MAB9	0.77	A	0.84	A	38

Table 107; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 108

Gene Id	RGR of Rosette Area [cm^A2] 80 mM NaCl, Day 5 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	0.38	B	0.38	B
MAB6	0.37	B	0.51	A	33

Table 108; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

125

Table 109

2017228711 15 Sep 2017

Gene Id			RGR of Rosette Area [cm^A2]
	80 mM NaCl, Day 3 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	0.88	B	0.88	B
MAB 18	0.99	A*	1.24	A	41

Table 109; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 110

Gene Id	RGR of Rosette Area [cm^A2] 80 mM NaCl, Day 5 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	0.47	B	0.47	B
ΜΑΒΙ	0.55	A	0.64	A	38
MAB 13	0.52	A	0.54	A*	16
MAB 17	0.52	A	0.54	A*	17
MAB 18	0.53	A	0.58	A	24
MAB3 GA	0.53	A	0.62	A	33
MAB32	0.52	A*	0.54	A*	17
MAB35	0.54	A	0.57	A	22
MAB4	0.51	A*	0.51	A*	10
MAB46	0.52	A*	0.55	A	19
MAB 146	0.54	A	0.55	A	19
MAB99	0.53	A	0.57	A	23

Table 110; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 111

Gene Id	RGR of Rosette Area [cm^A2] 80 mM NaCl, Day 3 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	0.49	B	0.49	B
ΜΑΒΙ	0.53	B	0.62	A	27
MAB35	0.57	A*	0.59	A*	22
MAB46	0.55	B	0.63	A	30

Table 111; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Tables 112-118 depict analyses of RGR of Rosette Diameter in plants overexpressing the polynucleotides of the invention under the regulation of 6669 promoter. Each Table represents an independent experiment, using 4 independent events per gene. Genes not connected by same letter as the control (A, B,) are significantly different from the control.

2017228711 15 Sep 2017

126

Table 112

Gene Id	RGR of Rosette Diameter [cm]) 80 mM NaCl, Day 3 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	0.28	B
MAB2	0.41	B	0.80	A	184
MAB43	0.46	B	0.83	A	195
MAB44	0.40	B	0.73	A	160

Table 112; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in

Table 3 above.

Table 113

Gene Id		RGR of Rosette Diameter [cm])
	80	mM NaCl, Day 8	from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	0.19	B	0.19	B
ΜΑΒΙ	0.22	B	0.24	B	25
MAB 10	0.25	A	0.29	A	49
MAB 14	0.23	A	0.25	A	31
MAB 19	0.24	A	0.26	A	37
MAB2	0.24	A	0.26	A	34
MAB20	0.25	A	0.29	A	52
MAB25	0.24	A	0.27	A	42
MAB36	0.25	A	0.28	A	45
MAB43	0.22	B	0.25	B	28
MAB50	0.25	A	0.28	A	46
MAB6	0.24	A	0.27	A	41
MAB7	0.22	B	0.27	A	38
MAB9	0.23	A	0.26	A	34

Table 113; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 114

Gene Id	RGR of Rosette Diameter [cm]) 80 mM NaCl, Day 5 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	0.14	B	0.14	B
MAB 10	0.14	B	0.31	A	122
MAB20	0.13	B	0.21	A	49
MAB25	0.15	B	0.33	A	138
MAB9	0.15	B	0.20	A	45

Table 114; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in

Table 3 above.

2017228711 15 Sep 2017

127

Table 115

Gene Id	RGR of Rosette Diameter [cm]) 80 mM NaCl, Day 8 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	0.21	B	0.21	B
MAB20	0.23	B	0.34	A	67
MAB9	0.22	B	0.44	A	114

Table 115; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 116

Gene Id	RGR of Rosette Diameter [cm]) 80 mM NaCl, Day 3 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	0.34	B	0.34	B
MAB 18	0.37	B	0.46	A	35
MAB3 GA	0.34	B	0.43	A	26
MAB35	0.43	A	0.55	A	62
MAB46	0.39	B	0.49	A	42
MAB99	0.34	B	0.43	A	26

Table 116; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 117

Gene Id	RGR of Rosette Diameter [cm]) 80 mM NaCl, Day 5 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	0.16	B	0.16	B
ΜΑΒΙ	0.22	A	0.26	A	66
MAB 18	0.20	A*	0.23	A*	44
MAB46	0.25	A	0.45	A	185
MAB 146	0.20	A*	0.22	A*	42

Table 117; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 118

Gene Id	RGR of Rosette Diameter [cm]) 80 mM NaCl, Day 8 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	0.08	B	0.08	B
MAB35	0.10	B	0.13	A	57
MAB46	0.10	B	0.14	A	64
MAB 146	0.10	B	0.14	A	66
MAB99	0.10	B	0.13	A	56

Table 118; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the

2017228711 15 Sep 2017

128 cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in

Table 3 above.

Tables 119-121 depict analyses of RGR of Leaf Average Area [cm^A2] in plants overexpressing the polynucleotides of the invention under the regulation of 6669 promoter. Each Table represents an independent experiment, using 4 independent events per gene. Genes not connected by same letter as the control (A, B,) are significantly different from the control.

Table 119

Gene Id	RGR of Mean(Leaf Average Area [cm^A2] 80 mM NaCl, Day 3 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	0.35	B	0.35	B
MAB 14	0.34	B	0.63	A	82
MAB25	0.44	B	0.83	A	137
MAB36	0.43	B	0.77	A	120
MAB6	0.24	B	0.70	A	102

Table 119; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 120

Gene Id	RGR of Mean(Leaf Average Area [cm^A2] 80 mM NaCl, Day 5 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	0.32	B	0.32	B
MAB 10	0.32	B	0.56	A	74

Table 120; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 121

Gene Id	RGR of Mean(Leaf Average Area [cm^A2] 80 mM NaCl, Day 3 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	0.39	B	0.39	B
MAB 13	0.41	B	0.57	A	49
MAB 15	0.46	A*	0.54	A	40
MAB 17	0.46	A*	0.50	A*	30

Table 121; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in

Table 3 above.

129

Table 122 depicts analyses of RGR of Leaf Average Area [cm^A2] in plants overexpressing the polynucleotides of the invention under the regulation of 6669 promoter. Each Table represents an independent experiment, using 4 independent events per gene. Genes not connected by same letter as the control (A, B,) are significantly different from the control.

2017228711 15 Sep 2017

Table 122

Gene Id	RGR of Mean(Leaf Average Area [cm^A2] 80 mM NaCl, Day 3 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	0.28	B	0.28	B
MAB2	0.41	B	0.80	A	184
MAB43	0.46	B	0.83	A	195
MAB44	0.40	B	0.73	A	160

Table 122; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 123 depicts analyses of Plot Dry weight (DW) in plants overexpressing the polynucleotides of the invention under the regulation of 6669 promoter. Each Table represents an independent experiment, using 4 independent events per gene. Genes not connected by same letter as the control (A, B,) are significantly different from the control.

Table 123

Gene Id	Dry Weight 80 mM Nat	[g] :i
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	4.00	B	4.00	B
ΜΑΒΙ	4.92	A	6.40	A	60
MAB 134	4.35	B	5.35	A	34
MAB15	4.42	B	5.57	A	39
MAB18	4.52	B	5.35	A	34
MAB3GA	4.53	B	5.47	A	37

Table 123; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Tables 124-126 depict analyses of 1000 Seeds Weight in plants overexpressing the polynucleotides of the invention under the regulation of 6669 promoter. Each Table represents an independent experiment, using 4 independent events per gene. Genes not

130 connected by same letter as the control (A, B,) are significantly different from the control.

2017228711 15 Sep 2017

Table 124

Gene Id	1000 Seeds Weight [g] 80 mM NaCl
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	0.02	B	0.02	B
MAB 14	0.02	B	0.03	A	32
MAB19	0.02	B	0.03	A	27
MAB2	0.02	B	0.03	A	24
MAB6	0.03	A	0.03	A	53

Table 124; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 125

Gene Id	1000 Seeds Weight [g] 80 mM NaCl
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	0.02	B	0.02	B
MAB20	0.02	A*	0.02	A	17
MAB25	0.02	B	0.02	A	20
MAB6	0.02	A*	0.02	A	21
MAB7	0.02	B	0.02	A	21
MAB9	0.02	B	0.02	A	19

Table 125; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 126

	1000 Seeds Weight [g] 80 mM NaCl
	LSM	% improvement of best event	LSM of Best event	Significance	% improvement of best event
GUI	0.02	B	0.02	B
MAB 100	0.02	B	0.02	A	28
MAB 134	0.02	B	0.02	A	26
MAB 17	0.02	B	0.02	A	23
MAB 18	0.02	B	0.02	A	17
MAB32	0.02	B	0.02	A	13
MAB4	0.02	B	0.02	A	19
MAB46	0.02	B	0.02	A	18
MAB99	0.02	B	0.02	A	15

Table 126; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in

Table 3 above.

131

Tables 127-129 depict analyses of Seed Yield per Plant in plants overexpressing the polynucleotides of the invention under the regulation of 6669 promoter. Each Table represents an independent experiment, using 4 independent events per gene. Genes not connected by same letter as the control (A, B,) are significantly different from the control.

2017228711 15 Sep 2017

Table 127

Gene Id	Seed Yield per Plant [g] 80 mM NaCl
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	0.07	B	0.07	B
MAB44	0.11	B	0.22	A	210
MAB50	0.11	B	0.19	A	170

Table 127; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 128

Gene Id	Seed Yield per Plant [g] 80 mM NaCl
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	0.09	B	0.09	B
MAB6	0.11	A*	0.21	A	142
MAB9	0.09	B	0.14	A	59

Table 128; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 129

Gene Id	Seed Yield per Plant [g] 80 mM NaCl
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	0.14	B	0.14	B
ΜΑΒΙ	0.19	A	0.33	A	139
MAB 100	0.17	B	0.24	A	79

Table 129; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 130 depicts analyses of Harvest Index in plants overexpressing the polynucleotides of the invention under the regulation of 6669 promoter. Each Table represents an independent experiment, using 4 independent events per gene. Genes not

132 connected by same letter as the control (A, B,) are significantly different from the control.

2017228711 15 Sep 2017

Table 130

Gene Id	Harvest Index 80 mM NaCl
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	0.11	B	0.11	B
MAB25	0.16	B	0.26	A	139
MAB44	0.20	A*	0.30	A	174
MAB7	0.12	B	0.29	A	172

Table 130; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Tables 131-140 depict analyses of Rosette Area in plants overexpressing the polynucleotides of the invention under the regulation of 6669 promoter. Each Table represents an independent experiment, using 4 independent events per gene. Genes not connected by same letter as the control (A, B,) are significantly different from the control.

Table 131

Gene Id	Rosette Area [cm^A2] Normal conditions, Day 5 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	1.37	B	1.37	B
ΜΑΒΙ	1.43	B	1.80	A	31
MAB9	1.32	B	1.74	A	27

Table 131; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 132

Gene Id	Rosette Area [cm^A2] Normal conditions, Day 8 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	4.73	B	4.73	B
ΜΑΒΙ	4.95	B	6.45	A	36

Table 132; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in

Table 3 above.

133

Table 133

Gene Id	Rosette Area [cm^A2] Normal conditions, Day 10 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	8.45	B	8.45	B
ΜΑΒΙ	8.87	B	11.11	A	31

Table 133; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 134

Gene Id	Rosette Area [cm^A2] Normal conditions, Day 3 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	1.65	B	1.65	B
ΜΑΒΙ	2.09	A	2.27	A	37
MAB36	1.65	B	2.58	A	56
MAB7	1.83	B	2.81	A	70

Table 134; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 135

Gene Id	Rosette Area [cm^A2] Normal conditions, Day 5 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	2.93	B	2.93	B
ΜΑΒΙ	3.60	A*	3.78	A*	29
MAB36	2.91	B	4.55	A	55
MAB7	3.14	B	4.69	A	60

Table 135; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 136

Gene Id	Rosette Area [cm^A2] Normal conditions, Day 8 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	7.73	B	7.73	B
ΜΑΒΙ	9.77	A	10.58	A	37
MAB36	8.05	B	12.12	A	57
MAB7	8.69	B	12.82	A	66

Table 136; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in

Table 3 above.

134

Table 137

2017228711 15 Sep 2017

Gene Id	Rosette Area [cm^A2] Normal conditions, Day 3 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	0.55	B	0.55	B
ΜΑΒΙ	0.58	B	0.81	A	47
MAB 100	0.60	B	0.74	A	34
MAB 15	0.65	A*	0.90	A	64
MAB 17	0.55	B	0.85	A	55

Table 137; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in

Table 3 above.

Table 138

Gene Id	Rosette Area [cm^A2] Normal conditions, Day 5 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	1.03	B	1.03	B
ΜΑΒΙ	1.17	B	1.54	A	49
MAB 100	1.18	B	1.46	A	42
MAB15	1.23	A	1.67	A	62
MAB17	1.01	B	1.59	A	54

Table 138; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 139

Gene Id	Rosette Area [cm^A2] Normal conditions, Day 8 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	2.09	B	2.09	B
ΜΑΒΙ	2.46	B	3.43	A	64
MAB 100	2.29	B	2.81	A	34
MAB 15	2.60	A	3.63	A	73
MAB 17	2.06	B	3.35	A	60

Table 139; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 140

Gene Id	Rosette Area [cm^A2] Normal conditions, Day 10 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	4.81	B	4.81	B
ΜΑΒΙ	5.57	A*	8.29	A	72
MAB 15	5.72	A	8.05	A	67
MAB 17	4.78	B	7.50	A	56

135

Table 140; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in

Table 3 above.

Tables 141-148 depict analyses of Rosette Diameter in plants overexpressing the polynucleotides of the invention under the regulation of 6669 promoter. Each Table represents an independent experiment, using 4 independent events per gene. Genes not connected by same letter as the control (A, B,) are significantly different from the control.

Table 141

Gene Id			Rosette Diameter [cm]
	Normal conditions, Day 8 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	3.52	B	3.52	B
ΜΑΒΙ	3.58	B	4.17	A	18

Table 141; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 142

Gene Id	Rosette Diameter [cm] Normal conditions, Day 3 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	2.28	B	2.28	B
MAB36	2.23	B	2.91	A	28
MAB7	2.47	B	3.11	A	36

Table 142; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 143

Gene Id	Rosette Diameter [cm] Normal conditions 5 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	2.99	B	2.99	B
MAB7	3.24	B	4.08	A	36

Table 143; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in

Table 3 above.

136

Table 144

Gene Id	Rosette Diameter [cm] Normal conditions, Day 8 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	5.00	B	5.00	B
ΜΑΒΙ	5.65	A*	5.87	A*	17
MAB7	5.06	B	6.32	A	26

Table 144; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 145

Gene Id	Rosette Diameter [cm] Normal conditions, Day 3 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	1.30	B	1.30	B
MAB 15	1.48	A	1.69	A	30
MAB 17	1.33	B	1.60	A	23

Table 145; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 146

Gene Id	Rosette Diameter [cm] Normal conditions, Day 5 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	1.87	B	1.87	B
ΜΑΒΙ	1.86	B	2.21	A	18
MAB 15	1.96	B	2.29	A	22
MAB 17	1.78	B	2.26	A	21

Table 146; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 147

Gene Id	Rosette Diameter [cm] Normal conditions, Day 8 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	2.49	B
ΜΑΒΙ	2.60	B	3.14	A	26
MAB 15	2.64	B	3.17	A	27
MAB 17	2.39	B	3.09	A	24

Table 147; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in

Table 3 above.

137

Table 148

2017228711 15 Sep 2017

Gene Id	Rosette Diameter [cm] Normal conditions, Day 10 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	3.49	B	3.49	B
ΜΑΒΙ	3.88	A*	4.81	A	38
MAB 15	3.78	B	4.52	A	29
MAB 17	3.53	B	4.45	A	27

Table 148; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Tables 149-157 depict analyses of Leaf Average Area in plants overexpressing the polynucleotides of the invention under the regulation of 6669 promoter. Each Table represents an independent experiment, using 4 independent events per gene. Genes not connected by same letter as the control (A, B,) are significantly different from the control.

Table 149

Gene Id			Leaf Average Area [cm^A2]
	Normal conditions, Day 5 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	0.17	B	0.17	B
ΜΑΒΙ	0.17	B	0.21	A	27

Table 149; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 150

Gene Id			Leaf Average Area [cm^A2]
	Normal conditions, Day 8 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	0.51	B	0.51	B
ΜΑΒΙ	0.52	B	0.69	A	35

Table 150; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 151

Gene Id	Leaf Average Area [cm^A2] Normal conditions, Day 3 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	0.19	B	0.19	B
ΜΑΒΙ	0.25	A	0.27	A	38
MAB36	0.20	B	0.31	A	58
MAB7	0.23	A*	0.33	A	67

138

Table 151; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in

Table 3 above.

2017228711 15 Sep 2017

Table 152

Gene Id	Leaf Average Area [cm^A2] Normal conditions, Day 5 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	0.32	B	0.32	B
ΜΑΒΙ	0.38	B	0.43	A	34
MAB36	0.32	B	0.46	A	43
MAB7	0.33	B	0.47	A	45

Table 152; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 153

Gene Id	Leaf Average Area [cm^A2] Normal conditions, Day 8 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	0.69	B	0.69	B
MAB36	0.69	B	0.93	A	36
MAB7	0.79	B	1.17	A	71

Table 153; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 154

Gene Id	Leaf Average Area [cm^A2] Normal conditions, Day 3 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	0.11	B	0.11	B
ΜΑΒΙ	0.12	B	0.15	A	28
MAB 15	0.13	B	0.17	A	53
MAB 17	0.11	B	0.15	A	34

Table 154; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 155

Gene Id	Leaf Average Area [cm^A2] Normal conditions, Day 5 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	0.16	B	0.16	B
ΜΑΒΙ	0.17	B	0.21	A	26
MAB 100	0.18	B	0.21	A	30
MAB 15	0.18	A*	0.23	A	39
MAB 17	0.16	B	0.22	A	35

139

Table 155; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in

Table 3 above.

2017228711 15 Sep 2017

Table 156

Gene Id	Leaf Average Area [cm^A2] Normal conditions, Day 8 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	0.24	B	0.24	B
ΜΑΒΙ	0.28	A*	0.37	A	50
MAB 15	0.29	A*	0.37	A	53
MAB 17	0.25	B	0.34	A	40

Table 156; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 157

Gene Id	Leaf Average Area [cm^A2] Normal conditions, Day 10 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	0.54	B	0.54	B
ΜΑΒΙ	0.57	B	0.80	A	49
MAB 15	0.59	B	0.78	A	45
MAB 17	0.51	B	0.74	A	37

Table 157; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Tables 158-166 depict analyses of RGR Rosette Area [cm^A2] of plants overexpressing the polynucleotides of the invention under the regulation of 6669 promoter. Each Table represents an independent experiment, using 4 independent events per gene. Genes not connected by same letter as the control (A, B,) are significantly different from the control.

Table 158

Gene Id	RGR of Rosette Area [cm^A2] Normal conditions, Day 3 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	1.73	B	1.73	B
MAB20	2.18	B	3.62	A	109
MAB43	2.04	B	3.80	A	119
MAB50	2.25	B	3.81	A	120

Table 158; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in

Table 3 above.

140

Table 159

Gene Id	RGR of Rosette Area [cm^A2] Normal conditions, Day 5 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	0.48	B	0.48	B
MAB2	0.58	A*	0.70	A	45
MAB43	0.62	A	0.75	A	56
MAB6	0.52	B	0.72	A	50

Table 159; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 160

Gene Id	RGR of Rosette Area [cm^A2] Normal conditions, Day 8 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	0.84	B	0.84	B
MAB50	0.87	B	0.99	A	18
MAB6	0.87	B	1.06	A	26

Table 160; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 161

Gene Id	RGR of Rosette Area [cm^A2] Normal conditions, Day 10 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	0.39	B	0.39	B
MAB 10	0.44	B	0.54	A	37
MAB36	0.45	B	0.51	A	30
MAB50	0.45	A*	0.53	A	35
MAB6	0.44	B	0.60	A	51
MAB7	0.43	B	0.50	A	27

Table 161; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 162

Gene Id	RGR of Rosette Area [cm^A2] Normal conditions, Day 5 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	0.39	B	0.39	B
MAB20	0.38	B	0.50	A	28
MAB25	0.39	B	0.53	A	38

Table 162; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in

Table 3 above.

141

Table 163

2017228711 15 Sep 2017

Gene Id	RGR of Rosette Area [cm^A2] Normal conditions, Day 8 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	0.55	B	0.55	B
MAB 10	0.64	A*	0.71	A*	30
MAB2	0.63	A*	0.70	A	28
MAB20	0.63	A*	0.67	A*	21
MAB25	0.64	A	0.73	A	32
MAB44	0.65	A	0.77	A	41
MAB50	0.70	A	0.83	A	51
MAB6	0.63	A*	0.81	A	48
MAB7	0.61	B	0.73	A	34
MAB9	0.60	B	0.69	A	26

Table 163; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in

Table 3 above.

Table 164

Gene Id	RGR of Rosette Area [cm^A2] Normal conditions, Day 5 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	0.45	B	0.45	B
MAB13	0.63	A	0.68	A*	49
MAB32	0.50	B	0.74	A	64
MAB46	0.52	B	0.75	A	65
MAB 146	0.64	A	0.88	A	94
MAB99	0.52	B	0.73	A	61

Table 164; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 165

Gene Id	RGR of Rosette Area [cm^A2] Normal conditions, Day 8 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	0.34	B	0.34	B
ΜΑΒΙ	0.36	B	0.45	A	31
MAB99	0.33	B	0.43	A	28

Table 165; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

142

Table 166

2017228711 15 Sep 2017

Gene Id	RGR of Rosette Area [cm^A2] Normal conditions, Day 10 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	0.66	B	0.66	B
MAB13	0.73	B	0.81	A	23
MAB3 GA	0.70	B	0.85	A	29
MAB32	0.70	B	0.86	A	31
MAB99	0.68	B	0.82	A	25

Table 166; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Tables 167-175 depict analyses of RGR of Rosette Diameter in plants overexpressing the polynucleotides of the invention under the regulation of 6669 promoter. Each Table represents an independent experiment, using 4 independent events per gene. Genes not connected by same letter as the control (A, B,) are significantly different from the control.

Table 167

Gene Id	RGR of Rosette Diameter [cm]) Normal conditions, Day 3 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	0.43	B	0.43	B
MAB50	0.70	A*	1.50	A	251
MAB6	0.45	B	1.21	A	183

Table 167; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 168

Gene Id	RGR of Rosette Diameter [cm]) Normal conditions, Day 5 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	0.16	B	0.16	B
MAB 10	0.19	A*	0.21	A*	28
MAB19	0.20	A	0.23	A	45
MAB36	0.18	B	0.21	A	32
MAB50	0.17	B	0.23	A	42
MAB6	0.18	B	0.25	A	57
MAB7	0.18	B	0.24	A	52

Table 168; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in

Table 3 above.

143

Table 169

2017228711 15 Sep 2017

Gene Id	RGR of Rosette Diameter [cm]) Normal conditions, Day 8 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	0.25	B	0.25	B
MAB 10	0.28	A	0.30	A	19
MAB 14	0.27	B	0.31	A	23
MAB19	0.28	A	0.32	A	29
MAB2	0.27	B	0.30	A	21
MAB20	0.27	B	0.29	A	18
MAB36	0.27	A*	0.32	A	28
MAB43	0.25	B	0.26	B	5
MAB44	0.26	B	0.30	A	21
MAB50	0.27	B	0.30	A	21
MAB7	0.28	A*	0.29	A	17
MAB9	0.27	A*	0.30	A	20

Table 169; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in

Table 3 above.

Table 170

Gene Id	RGR of Rosette Diameter [cm]) Normal conditions, Day 10 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	0.17	B	0.17	B
MAB19	0.19	A*	0.23	A	31
MAB2	0.20	A	0.23	A	32
MAB20	0.19	A	0.23	A	33
MAB43	0.19	B	0.21	A	24
MAB44	0.18	B	0.22	A	25
MAB50	0.20	A	0.23	A	32
MAB6	0.19	A*	0.24	A	42
MAB9	0.18	B	0.21	A	25

Table 170; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 171

Gene Id	RGR of Rosette Diameter [cm]) Normal conditions, Day 5from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	0.16	B	0.16	B
MAB50	0.19	B	0.22	A	42
MAB6	0.15	B	0.24	A	49

Table 171; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in

Table 3 above.

144

Table 172

2017228711 15 Sep 2017

Gene Id	RGR of Rosette Diameter [cm]) Normal conditions, Day 10 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	0.22	B	0.22	B
MAB2	0.26	A*	0.28	A	27
MAB20	0.26	B	0.30	A	33
MAB25	0.26	A*	0.29	A*	31
MAB43	0.24	B	0.29	A	29
MAB44	0.25	B	0.29	A	31

Table 172; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in

Table 3 above.

Table 173

Gene Id	RGR of Rosette Diameter [cm]) Normal conditions, Day 3 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	0.29	B	0.29	B
MAB 100	0.37	A*	0.51	a	74
MAB13	0.38	A	0.58	A	95
MAB15	0.36	A	0.45	A	54
MAB18	0.36	A*	0.38	A*	28
MAB3 GA	0.43	A	0.60	A	105
MAB35	0.39	A	0.44	A	50
MAB46	0.31	B	0.49	A	65
MAB 146	0.35	A	0.44	A	50

Table 173; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 174

Gene Id	RGR of Rosette Diameter [cm]) Normal conditions, Day 8 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	0.11	B	0.11	B
ΜΑΒΙ	0.13	A*	0.16	A	49
MAB13	0.13	A*	0.16	A	41
MAB18	0.14	A	0.16	A	45
MAB32	0.13	B	0.15	A	39
MAB 146	0.16	A	0.19	A	72
MAB99	0.12	B	0.15	A	40

Table 174; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in

Table 3 above.

145

Table 175

2017228711 15 Sep 2017

Gene Id	RGR of Rosette Diameter [cm]) Normal conditions, Day 10 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	0.20	B	0.20	B
ΜΑΒΙ	0.25	A	0.27	A	30
MAB17	0.24	A	0.26	A*	25
MAB18	0.25	A	0.31	A	51
MAB35	0.25	A	0.28	A	36
MAB 146	0.25	A	0.28	A	36
MAB99	0.24	A	0.29	A	44

Table 175; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Tables 176-178 depict analyses of RGR of Leaf Average Area [cm^A2] in plants overexpressing the polynucleotides of the invention under the regulation of 6669 promoter. Each Table represents an independent experiment, using 4 independent events per gene. Genes not connected by same letter as the control (A, B,) are significantly different from the control.

Table 176

Gene Id	RGR of Mean(Leaf Average Area [cm^A2] Normal conditions, Day 10 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	0.34	B	0.34	B
MAB 10	0.35	B	0.52	A	56
MAB36	0.40	B	0.52	A	55
MAB7	0.37	B	0.50	A	49

Table 176; LSM = Least square mean; % improvement = compare to control (GUI). The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 177

Gene Id	RGR of Mean(Leaf Average Area [cm^A2] Normal conditions, Day 10 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	0.38	B	0.38	B
MAB 10	0.47	A	0.51	A*	35
MAB2	0.41	B	0.49	A	29
MAB25	0.43	B	0.55	A	44
MAB50	0.47	A	0.53	A	41
MAB7	0.45	A*	0.50	A*	31
MAB9	0.43	B	0.54	A	41

Table 177; LSM = Least square mean; % improvement = compare to control (GUI). The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

146

Table 178

2017228711 15 Sep 2017

Gene Id	RGR of Mean(Leaf Average Area [cm^A2] Normal conditions, Day 5 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	0.23	B	0.23	B
MAB13	0.34	A*	0.39	A*	70
MAB 146	0.35	A*	0.50	A	117
MAB99	0.26	B	0.44	A	89

Table 178; LSM = Least square mean; % improvement = compare to control (GUI). The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Tables 179-180 depict analyses of RGR of Leaf Average Area [cm^A2] in plants overexpressing the polynucleotides of the invention under the regulation of 6669 promoter. Each Table represents an independent experiment, using 4 independent events per gene. Genes not connected by same letter as the control (A, B,) are significantly different from the control.

Table 179

Gene Id	RGR of Mean(Leaf Average Area [cm^A2] Normal conditions, Day 5 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	0.31	B	0.31	B
MAB19	0.35	B	0.48	A	56
MAB43	0.39	B	0.52	A	70
MAB6	0.28	B	0.50	A	62

Table 179; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 180

Gene Id	RGR of Mean(Leaf Average Area [cm^A2] Normal conditions, Day 8 from planting
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	0.69	B	0.69	B
MAB 14	0.72	B	0.92	A	32
MAB6	0.69	B	0.96	A	38

Tables 181-182 depict analyses of Plot Dry weight (DW) in plants overexpressing the polynucleotides of the invention under the regulation of 6669 promoter. Each Table represents an independent experiment, using 4 independent events

Table 180; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in

Table 3 above.

147 per gene. Genes not connected by same letter as the control (A, B,) are significantly different from the control.

2017228711 15 Sep 2017

Table 181

Gene Id	Dry Weight [g] Normal conditions
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	7.75	B	7.75	B
MAB36	10.37	A*	13.21	A	71

Table 181; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 182

Gene Id	Dry Weight [g] Normal conditions
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	5.23	B	5.23	B
ΜΑΒΙ	6.81	A	8.09	A	55
MAB 13	6.08	B	7.61	A	45
MAB 18	6.10	B	8.18	A	56
MAB99	6.51	A*	8.42	A	61

Table 182; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Tables 183-185 depict analyses of 1000 Seeds Weight in plants overexpressing the polynucleotides of the invention under the regulation of 6669 promoter. Each Table represents an independent experiment, using 4 independent events per gene. Genes not connected by same letter as the control (A, B,) are significantly different from the control.

Table 183

Gene Id	1000 Seeds Weight [g] Normal conditions
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	0.02	B	0.02	B
MAB 19	0.02	B	0.03	A	23
MAB2	0.02	B	0.03	A	44
MAB20	0.02	A	0.04	A	71
MAB36	0.02	B	0.03	A	24
MAB50	0.02	B	0.03	A	32
MAB6	0.02	B	0.03	A	22
MAB9	0.02	A	0.02	A	19

148

Table 183; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in

Table 3 above.

2017228711 15 Sep 2017

Table 184

Gene Id	1000 Seeds Weight [g] Normal conditions
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	0.02	B	0.02	B
MAB20	0.02	A*	0.02	A	17
MAB6	0.02	A*	0.02	A	21

Table 184; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Table 185

Gene Id	1000 Seeds Weight [g] Normal conditions
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	0.02	B	0.02	B
MAB 100	0.02	B	0.02	A	23
MAB 17	0.02	A	0.03	A	33
MAB 18	0.02	B	0.02	A	18
MAB35	0.02	B	0.02	A	28
MAB46	0.02	A	0.02	A	21
MAB99	0.02	A	0.03	A	37

Table 185; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

Tables 186-187 depict analyses of Seed Yield per Plant in plants overexpressing the polynucleotides of the invention under the regulation of 6669 promoter. Each Table represents an independent experiment, using 4 independent events per gene. Genes not connected by same letter as the control (A, B,) are significantly different from the control.

Table 186

Gene Id	Seed Yield per Plant [g] Normal conditions
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	0.38	B	0.38	B
ΜΑΒΙ	0.50	B	0.61	A	61
MAB 10	0.46	B	0.59	A	53
MAB 14	0.50	A*	0.60	A	57
MAB36	0.52	A	0.68	A	77
MAB50	0.46	B	0.60	A	56

149

Table 186; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in

Table 3 above.

2017228711 15 Sep 2017

Table 187

Gene Id	Seed Yield per Plant [g] Normal conditions
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	0.32	B	0.32	B
ΜΑΒΙ	0.41	A*	0.49	A	53
MAB 13	0.43	A	0.55	A	69
MAB 18	0.39	B	0.49	A	53
MAB32	0.41	B	0.50	A	56
MAB35	0.41	A*	0.50	A	57
MAB99	0.41	A*	0.51	A	57

Table 187; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants is provided in Table 3 above.

Table 188 depicts analyses of Harvest Index in plants overexpressing the polynucleotides of the invention under the regulation of 6669 promoter. Each Table represents an independent experiment, using 4 independent events per gene. Genes not connected by same letter as the control (A, B,) are significantly different from the control.

Table 188

Gene Id	Harvest Index Normal conditions
	LSM	Significance	LSM of Best event	Significance	% improvement of best event
GUI	0.48	B	0.48	B
MAB 17	0.46	B	0.62	A	28

Table 188; LSM = Least square mean; % improvement = compare to control (GUI); A meaning significant different at P < 0.05, A* meaning significant different at P < 0.1. The SEQ ID NOs. of the cloned genes (according to the Gene Id) which are exogenously expressed in the plants are provided in Table 3 above.

EXAMPLE 8

TRANSFORMA TION OF TOMA TO M82 PLANTS WITH PUTA TIVE ABST

GENES

For the tomato transformation, tomato M82 seeds were previously sterilized with Na-hipochloride 3 % + 2-3 drops of Tween 20 (Polysorbate 20). Seeds were washed 3 times with distilled sterile water. Seeds were then germinated in full strength Nitsch medium and germinated for 8 days 8 days in growth room at 25 °C in the dark. Plantlets were then cut with 2-4 cm stem and insert it into alO-cm Petri dishes that were

2017228711 15 Sep 2017

150 filled with 30-40 ml of MS liquid medium. Cotyledons were then cut and used as explants and later transferred onto KCMS solidified medium with 100 μΜ acetosyringone in a 10-cm Petri dish. Explants were inoculated with A. tumefascience for 30-50 minutes. Explants were co-cultivated for 24 hours and transferred to regeneration media including Kanamycin as selection medium. The resistant regenerated plantlets were then transferred into a rooting medium for 10-14 days until the appearance of the roots.

EXAMPLE 9

GROWTH OF M82 TOMATO TRANSFORMED PLANTS AND PHENOTYPE CHARACTERIZA TIONS

Experimental Procedures

Producing transgenic tomato plants - Plants were transformed as described in Example 8, above. Following transformation, ΤΙ M82 tomato plants were grown until fruit set. T2 seeds have entered experiments to assess abiotic stress resistance.

Experimental Results

Assay 1 - Tomato field trial under regular and water deficient regimes - The tomato field trial was planned as a one source dripping irrigation (OSDI) system similar to a standard farmer field. Since water deficiency is applied in a relatively uniform manner, it allows measuring the effect of drought on small size populations of plants. The OSDI method was developed on the basis of the line source sprinklers irrigation system (Hanks et al. 1976 Soil Sei. Soc Am. J. 40 p. 426-429) with some significant modifications. Instead of sprinkler irrigation, dripping irrigation was used. In order to create a uniform and deep wet layer (at least 60 cm depth), and not the onion shape layer that is typically created by dripping irrigation, a low pressure compensating dripping irrigation system was used. This system enables to supply small amounts of water in a relatively long time frame. The drought stress field trial was performed in light soil, in an open field (net-house) near Rehovot, Israel. Between 4 to 5 events are been evaluated for each gene and the null segregating populations are used as negative controls. During the first three weeks all plants were grown in a nursery under normal irrigation conditions. After this period, plants were transplanted according to commercial growth protocol, maintaining a 30 cm distance between plants reaching a

2017228711 15 Sep 2017

151 total density of 2,600 plants per 1000 sq. m (the recommended density in commercial growth). Each plant was transplanted near a water dripper and further subjected to two different treatments:

Optimal (100 %): optimal irrigation conditions (100 %). Irrigation was applied every 2 days as a standard recommended water supply. Standard recommended water supply is the amount applied by local commercial growers according to standard protocols.

Severe Stress (50 %): 50 % of the optimal amount of water irrigation was applied once a day (at same time as regular irrigation is applied)

All fertilizers were applied according to local standard protocols. Nitrogen was equally applied, as recommended, to all the treatments through the irrigation system. Each row, 193 cm wide, contained two dripping irrigation lines creating coverage of six drippers per 1 sq. m. The irrigation control was performed separately for each treatment. The experiment was structured in a four randomized block design, eight plants per plot. The different water regimes were initiated only four weeks three transplantation, when plants initiated the flowering stage. Water availability in the soil was recorded using tensiometers (used to determine matric water potential Ψιη which allows to evaluate the stress severeness).

Assay 2 - Tomato salt bath experiment - Transgenic tomato seeds are sown in trays containing growth denitrified media. Seedlings are germinated under nursery conditions. The experimental model used was 3 blocks random distributed, where 10 plants per events were sown in each block. At the stage of first true leaf, trays are transferred to different tanks containing growth solution of 300 mM NaCl. For normal treatment, a full Hoagland solution was applied. 5 events for each gene are evaluated while null segregating populations are used as negative controls. The experiment is performed for a period of 8 weeks, where parameters such as chlorophyll content (measured as SPAD units), plant biomass (FW and DW) are measured.

Although the invention has been described in conjunction with specific embodiments thereof, it is evident that many alternatives, modifications and variations will be apparent to those skilled in the art. Accordingly, it is intended to embrace all such alternatives, modifications and variations that fall within the spirit and broad scope of the appended claims.

152

2017228711 15 Sep 2017

All publications, patents and patent applications mentioned in this specification are herein incorporated in their entirety by reference into the specification, to the same extent as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated herein by reference. In addition, citation or 5 identification of any 5 reference in this application shall not be construed as an admission that such reference is available as prior art to the present invention. To the extent that section headings are used, they should not be construed as necessarily limiting.

Any reference to publications cited in this specification is not an admission that the disclosures constitute common general knowledge in Australia.

Claims

CLAIMS:

1. A method of increasing biomass, growth rate, seed yield, nitrogen use efficiency and/or abiotic stress tolerance of a plant, the method comprising over-expressing within the plant a polypeptide comprising an amino acid sequence at least 80 % identical to the amino acid sequence set forth in SEQ ID NO: 271, wherein when said abiotic stress is salinity stress then said tolerance to said salinity stress is an increase in said seed yield and/or an increase in said growth rate under salinity stress as compared to a native plant of the same species which is grown under the same growth conditions, thereby increasing the biomass, growth rate, seed yield, nitrogen use efficiency and/or abiotic stress tolerance of the plant, wherein the abiotic stress is selected from the group consisting of salinity stress and nitrogen deficiency.
2. The method of claim 1, further comprising selecting plants over-expressing said polypeptide for an increased biomass, growth rate, seed yield, abiotic stress tolerance and/or nitrogen use efficiency as compared to a control plant of the same species which is grown under the same growth conditions, wherein the abiotic stress is selected from the group consisting of salinity stress and nitrogen deficiency.
3. A method of growing a crop comprising growing a crop plant over-expressing a polypeptide comprising an amino acid sequence at least 80 % identical to the polypeptide set forth in SEQ ID NO: 271, wherein said crop plant is derived from parent plants over-expressing said polypeptide as compared to a native plant of the same species which is grown under the same growth conditions, and which have been selected for increased biomass, growth rate, seed yield, nitrogen use efficiency and/or abiotic stress tolerance of a plant, wherein the abiotic stress is selected from the group consisting of salinity stress and nitrogen deficiency, and said crop plant over-expressing said polypeptide having said increased biomass, growth rate, seed yield, nitrogen use efficiency and/or abiotic stress tolerance, wherein said tolerance to said salinity stress is an increase in said seed yield and/or an increase in said growth rate under said salinity stress as compared to a native plant of the same species which is grown under the same growth conditions, thereby growing the crop.

154

2017228711 11 Dec 2018
4. The method of claim 3, wherein said growing of said crop plant over-expressing said polypeptide is performed under salinity conditions.
5. The method of claim 3, wherein said growing of said crop plant over-expressing said polypeptide is performed under nitrogen deficient conditions.
6. A method of selecting a plant having increased biomass, growth rate, seed yield, nitrogen use efficiency and/or abiotic stress tolerance, the method comprising:

(a) providing plants over-expressing a polypeptide comprising an amino acid sequence at least 80 % identical to the polypeptide set forth in SEQ ID NO: 271, (b) selecting said plants of step (a) for increased biomass, growth rate, seed yield, nitrogen use efficiency and/or abiotic stress tolerance, wherein the abiotic stress is selected from the group consisting of salinity stress and nitrogen deficiency, wherein said tolerance to said salinity stress is an increase in said seed yield and/or an increase in said growth rate under salinity stress as compared to a native plant of the same species which is grown under the same growth conditions, and (c) growing a crop of said plant selected in step (b), thereby selecting the plant having the increased biomass, growth rate, seed yield, nitrogen use efficiency and/or abiotic stress tolerance.
7. A method of increasing root length, root coverage, growth rate of rosette area, growth rate of rosette diameter, and/or increased seed yield of a plant as compared to the root length, root coverage, growth rate of rosette area, growth rate of rosette diameter, and/or seed yield of a control plant of the same species which is grown under the same growth conditions, comprising:

(a) over-expressing within the plant a polypeptide comprising an amino acid sequence at least 80 % identical to the polypeptide set forth in SEQ ID NO: 271, and (b) selecting from plants resultant of step (a) a plant exhibiting an increased root length, root coverage, growth rate of rosette area, growth rate of rosette diameter, and/or seed yield as compared to a control plant of the same species which is grown under the same growth conditions, wherein when said growth conditions comprise salinity stress then said selecting is for a plant exhibiting said increased seed yield and/or said increased growth rate as compared to said control plant of the same species which is grown under the same growth conditions,

155

2017228711 11 Dec 2018 thereby increasing the root length, root coverage, growth rate of rosette area, growth rate of rosette diameter, and/or seed yield of the plant as compared to the root length, root coverage, growth rate of rosette area, growth rate of rosette diameter, and/or seed yield of the control plant of the same species which is grown under the same growth conditions.
8. The method of claim 7, wherein said selecting in step (b) is performed under normal conditions.
9. The method of claim 7, wherein said selecting in step (b) is performed under an abiotic stress, wherein said abiotic stress is selected from the group consisting of salinity stress and nitrogen deficiency.
10. The method of claim 7, wherein said selecting said plant exhibiting said increased root length, said increased growth rate of rosette area, said increased growth rate of rosette diameter and/or said increased seed yield is performed under normal conditions.
11. The method of claim 7, wherein said selecting said plant exhibiting said increased root coverage is performed under nitrogen deficient conditions.
12. The method of claim 7, wherein said selecting said plant exhibiting said increased growth rate of rosette area, said increased growth rate of rosette diameter, and/or said increased seed yield is performed under a salinity stress.
13. A method of producing a crop comprising growing a crop plant over-expressing a polypeptide comprising an amino acid sequence at least 80 % identical to the polypeptide set forth in SEQ ID NO: 271, wherein said crop plant is derived from parent plants selected for increased root length, root coverage, growth rate of rosette area, growth rate of rosette diameter, and/or seed yield as compared to the root length, root coverage, growth rate of rosette area, growth rate of rosette diameter, and/or seed yield of a control plant of the same species which is grown under the same growth conditions, wherein when said growth conditions comprise salinity stress then said parent plants are selected for said increased seed yield and/or said increased growth rate as compared to said control plant of the same species which is grown under the same growth conditions, and said crop plant having said increased root length, root

156

2017228711 11 Dec 2018 coverage, growth rate of rosette area, growth rate of rosette diameter, and/or seed yield, thereby producing the crop.
14. A method of selecting a plant having increased root length, root coverage, growth rate of rosette area, growth rate of rosette diameter, and/or seed yield as compared to a control plant of the same species which is grown under the same growth conditions, the method comprising:

(a) providing plants transformed with a nucleic acid construct comprising a polynucleotide comprising a nucleic acid sequence encoding a polypeptide, wherein said polypeptide comprises an amino acid sequence at least 80% identical to SEQ ID NO: 271, and a heterologous promoter for directing transcription of said nucleic acid sequence in a plant cell, and;

(b) selecting from said plants a plant having increased root length, root coverage, growth rate of rosette area, growth rate of rosette diameter, and/or seed yield as compared to a control plant of the same species which is grown under the same growth conditions, wherein when said growth conditions comprise salinity stress then said selecting is for a plant having said increased seed yield and/or said increased growth rate as compared to said control plant of the same species which is grown under the same growth conditions, thereby selecting the plant having increased root length, root coverage, growth rate of rosette area, growth rate of rosette diameter, and/or seed yield as compared to the control plant of the same species which is grown under the same growth conditions.
15. The method of any one of claims 1 to 14, wherein said amino acid sequence is at least 85 % identical to the amino acid sequence set forth in SEQ ID NO: 271.
16. The method of any one of claims 1 to 14, wherein said amino acid sequence is at least 90 % identical to the amino acid sequence set forth in SEQ ID NO: 271.
17. The method of any one of claims 1 to 14, wherein said amino acid sequence is at least 95 % identical to the amino acid sequence set forth in SEQ ID NO: 271.
18. The method of any one of claims 1 to 14, wherein said amino acid sequence is set forth in SEQ ID NO: 271.

157

2017228711 11 Dec 2018
19. The method of claim 14, wherein said polynucleotide is selected from the group consisting of SEQ ID NOs: 1559 and 81.
20. The method of any one of claims 1, 7 and 15 to 18, further comprising growing the plant over-expressing said polypeptide under the abiotic stress.