AU2017200511B2 - Engineered zinc finger proteins targeting plant genes involved in fatty acid biosynthesis - Google Patents

Engineered zinc finger proteins targeting plant genes involved in fatty acid biosynthesis Download PDF

Info

Publication number
AU2017200511B2
AU2017200511B2 AU2017200511A AU2017200511A AU2017200511B2 AU 2017200511 B2 AU2017200511 B2 AU 2017200511B2 AU 2017200511 A AU2017200511 A AU 2017200511A AU 2017200511 A AU2017200511 A AU 2017200511A AU 2017200511 B2 AU2017200511 B2 AU 2017200511B2
Authority
AU
Australia
Prior art keywords
gly gly
artificial sequence
seq
description
dna
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
AU2017200511A
Other versions
AU2017200511A1 (en
Inventor
Russell Dekelver
Manju Gupta
Jeffrey C. Miller
Stephen Novak
Joseph F. Petolino
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Sangamo Therapeutics Inc
Corteva Agriscience LLC
Original Assignee
Sangamo Therapeutics Inc
Corteva Agriscience LLC
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from AU2010308569A external-priority patent/AU2010308569B2/en
Application filed by Sangamo Therapeutics Inc, Corteva Agriscience LLC filed Critical Sangamo Therapeutics Inc
Priority to AU2017200511A priority Critical patent/AU2017200511B2/en
Publication of AU2017200511A1 publication Critical patent/AU2017200511A1/en
Assigned to DOW AGROSCIENCES, LLC, SANGAMO THERAPEUTICS, INC. reassignment DOW AGROSCIENCES, LLC Alteration of Name(s) of Applicant(s) under S113 Assignors: DOW AGROSCIENCES, LLC, SANGAMO BIOSCIENCES, INC.
Application granted granted Critical
Publication of AU2017200511B2 publication Critical patent/AU2017200511B2/en
Assigned to SANGAMO THERAPEUTICS, INC., CORTEVA AGRISCIENCE LLC reassignment SANGAMO THERAPEUTICS, INC. Request to Amend Deed and Register Assignors: DOW AGROSCIENCES, LLC
Ceased legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Landscapes

  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)

Abstract

The disclosure relates generally to the fields of the genome engineering and protein expression in plants. In particular, the present disclosure relates to engineered DNA-binding domains, for example, zinc finger proteins, that target genes involved in fatty acid synthesis and methods of using such zinc finger proteins in modulating genes expression, gene inactivation, and targeted gene modification to generate plants with altered fatty acid profiles.

Description

C12N 15/82 (2006.01) C12N 5/04 (2006.01)
A01H 5/00 (2006.01) (21) Application No: 2017200511 (22) Date of Filing: 2017.01.25 (43) Publication Date: 2017.02.16 (43) Publication Journal Date: 2017.02.16 (44) Accepted Journal Date: 2018.04.05 (62) Divisional of:
2015203725 (71) Applicant(s)
Sangamo Therapeutics, lnc.;Dow AgroSciences, LLC (72) Inventor(s)
Dekelver, Russell;Gupta, Manju;Miller, Jeffrey C.;Novak, Stephen;Petolino, Joseph F.
(74) Agent / Attorney
FPA Patent Attorneys Pty Ltd, Level 43 101 Collins Street, Mebourne, VIC, 3000, AU (56) Related Art
US 20040204345 A1
The disclosure relates generally to the fields of the genome engineering and protein expression in plants. In particular, the present disclosure relates to engineered DNA-binding domains, for example, zinc finger proteins, that target genes involved in fatty acid synthesis and methods of using such zinc finger proteins in modulating genes expression, gene inactivation, and targeted gene modification to generate plants with altered fatty acid profiles.
2017200511 25 Jan 2017
ABSTRACT
1001707101
2017200511 25 Jan 2017
ENGINEERED ZINC FINGER PROTEINS TARGETING PLANT GENES INVOLVED IN FATTY ACID BIOSYNTHESIS
CROSS-REFERENCE TO RELATED APPLICATIONS [0001] This application is a divisional of Australian patent application 2015203725, which is a divisional of AU 2010308569, all of which claim the benefit of U.S. Provisional Application No. 61/279,528, filed October 22, 2010, the entire disclosures of which are incorporated herein by reference.
TECHNICAL FIELD [0002a] The disclosure relates generally to the fields of genome engineering and protein expression in plants. In particular, the present disclosure relates to engineered DNA-binding domains, for example, zinc finger proteins, that target genes involved in fatty acid synthesis and methods of using such zinc finger proteins in modulating gene expression, gene inactivation, and targeted gene modification to generate plants with altered fatty acid profiles.
BACKGROUND [0002b] Reference to any prior art in the specification is not, and should not be taken as, an acknowledgment, or any form of suggestion, that this prior art forms part of the common general knowledge in Australia or any other jurisdiction or that this prior art could reasonably be expected to be ascertained, understood and regarded as relevant by a person skilled in the art.
[0003] Diets high in saturated fats increase low density lipoproteins (LDL), which in turn causes the deposition of cholesterol on blood vessels, a pre-condition closely con-elated with atherosclerosis and coronary heart disease (Conner et al., Coronary Heart Disease: Prevention, Complications, and Treatment, J.B. Lippincott, Philadelphia, 1984 pp. 43-64,). By contrast, diets high in monounsaturated fats have been shown to reduce heart disease. Oleic acid, the only monounsaturated fat in most edible vegetable oils, lowers LDL as effectively as linoleic acid, but does not affect high density lipoproteins (HDL) levels (Mensink et al. (1989) New England J. Med., 321 :436-441). Furthermore, diets high in monounsaturated fats are also correlated with reduced systolic blood pressure (Williams et al. (1987) J. Am. Med. Assoc., 257:3251-3256, 1987).
[0004] In light of the effect of fatty acids on diet and health, attempts have been made to alter the fatty acid profile of plants used for edible and industrial purposes. However, conventional methods of altering plants to improve the fatty acid profile rely on mutagenesis (e.g., chemical, radiation, etc.) and/or breeding and are
2017200511 25 Jan 2017 time-consuming, laborious and do not specifically target selected genes. See, e.g., U.S. PatentNo. 5,861,187.
[0005] Recently, engineered DNA-binding domains such as meganuclease
DNA-binding domains and zinc fingers proteins (ZFPs) have been used advantageously to selectively modulate gene expression and for targeted alteration of gene sequences in plants (see, e.g., U.S. Patents Nos. 7,262,054, 7,235,354, 7,220,719, 7,001,768, and 6,534,261; U.S. Patent Publication Nos. 2008/0182332 and U.S. Serial No. 12/284,888). Zinc finger proteins (ZFPs) are proteins that bind to DNA, RNA and/or protein, in a sequence-specific manner, by virtue of a metal stabilized domain known as a zinc finger. See, for example, Miller et al. (1985) EMBO J. 4:1609-1614; Rhodes etal. (1993) Sci. Amer. 268(2):56-65; and Klug (1999) J. Mol. Biol. 293:215-218. ZFPs are commonly found in transcription factors, and to date, over 10,000 zinc finger sequences have been identified in several thousand known or putative transcription factors.
[0006] DNA-binding domains can also be used with nuclease domains to make engineered nucleases. For example, the DNA-binding domain of a homing endonuclease can be altered to generate novel homing endonucleases. Similarly, zinc finger domains have also been combined with nuclease cleavage domains to produce zinc finger nucleases (ZFNs) for specific targeting of a double-stranded break to the region of a genome where modification (e.g., deletion, mutation, homologous recombination, or insertion of an exogenous sequence) is desired (see, e.g., U.S. Patent Application Publication Nos. 2007/0134796; 2005/0064474; 2008/0182332). Engineered ZFPs greatly facilitate the insertion of exogenous sequences or modification of endogenous sequences at specific target sites in plants and provide for targeted alteration of plant genomes with greater efficiencies than conventional methods (see, e.g., U.S. Patents Nos. 7,262,054, 7,235,354, 7,220,719, 7,001,768, and 6,534,261).
[0007] Nonetheless, there remains a need for compositions and methods for targeted alteration of genes involved in fatty acid synthesis in order to produce plants and plant products (e.g., plant oils) having selected fatty acids. By producing plant varieties with reduced levels of individual and total saturated fats in the seed oil, oilbased food products which contain less saturated fats can be produced. Such products will benefit public health by reducing the incidence of atherosclerosis and coronary heart disease.
2017200511 25 Jan 2017
SUMMARY [0008] The present disclosure provides compositions and methods for modulating expression and for targeted alteration in whole plants or plant cells of one or more plant genes involved in fatty acid biosynthesis, thereby altering the fatty acid composition in the whole plant or plant cells. Whole plants or plant cells can be from monocotyledonous (monocots) or dicotyledonous (dicots) plant species, including in some particular embodiments oil-producing plants, and also include cultured cells, cells in a plant at any stage of development, and plant cells that have been removed from a whole plant and which cells (or their descendants) will be regenerated into plants. Plant cells can contain one or more homeologous or paralogous gene sequences, any number of which or all of which can be targeted for modification by the methods disclosed herein.
[0009] In one aspect, described herein is a DNA-binding domain (e.g., zinc finger protein (ZFP)) that specifically binds to a gene involved in a plant fatty acid biosynthesis pathway. In some embodiments, the gene is a Brassica napus gene. In some particular embodiments, the Brassica napus gene can encode Acetyl-COA carboxylase (ACCase), β-ketoacyl-ACP synthetases (KAS, e.g., KAS I - KAS IV), Fatty acid thioesterase B (FATB, e.g,, FATB1 - FATB5, or other plastidial thioesterases), Fatty acid synthase (FAS), Fatty acid elongase (FAE, e.g., FAE1), Fatty acid thioesterase A (FatA), Fatty acid desaturase (Fad2, Fad3), plastidial G-3-P dehydrogenase (GPDH), glycerokinase (GK), stearoyl-acyl carrier protein desaturase (S-ACP-DES), and oleoyl-ACP hydrolase. In some particular embodiments, the gene can be an ortholog or a homolog of these genes in other oil-producing plant species.
[0010] In a still further aspect, fusion proteins comprising any of the DNAbinding domains (e.g., ZFPs) described herein are also provided. In certain embodiments, the fusion protein comprises a zinc finger protein and a transcriptional regulatory domain (e.g., activation or repression domain), also known as a ZFP TF.
In other embodiments, the fusion protein comprises a ZFP and a nuclease domain to form a zinc finger nuclease (ZFN) that cleaves in a genomic region of interest with the target gene. In certain embodiments, the ZFN comprises a fusion polypeptide comprising an engineered zinc finger binding domain having specificity for a gene involved in a plant fatty acid biosynthesis pathway (e.g., a gene encoding ACCase, KAS I, KAS Π, KAS HI, KAS IV, FATB1, FATB2, FATB3, FATB4, FATB5, FAS,
2017200511 25 Jan 2017
FAEl, FatA, Fad2, Fad3, GPDH, GK, or S-ACP-DES) and a cleavage domain, and/or one or more fusion polypeptides comprising an engineered zinc finger binding domain and a cleavage half-domain. In certain embodiments, the zinc finger binding domains bind to a target site as shown in Table 2 or Table 10A. In certain embodiments, the zinc finger binding domains comprise a sequence selected from the group consisting of zinc finger proteins comprising the recognition domains (e.g., a single row) shown in Table 1 or Table 10B. Cleavage domains and cleavage half domains can be obtained, for example, from various restriction endonucleases and/or homing endonucleases. In one embodiment, the cleavage half-domains are derived from a Type IIS restriction endonuclease (e.g., Fok I). .
[0011] In other aspects, provided herein are polynucleotides encoding any of the DNA-binding domains (e.g., zinc finger proteins) and/or fusion proteins described herein. In certain embodiments, described herein is a ZFP expression vector comprising a polynucleotide, encoding one or more ZFPs described herein, operably linked to a promoter. In one embodiment, one or more of the ZFPs are ZFNs.
[0012] The ZFPs and fusion proteins comprising these ZFPs may bind to and/or cleave a gene involved in fatty acid synthesis within the coding region of the gene or in a non-coding sequence within or adjacent to the gene, such as, for example, a leader sequence, trailer sequence or intron, or within a non-transcribed region, either upstream or downstream of the coding region. In certain embodiments, the ZFPs or ZFNs bind to and/or cleave a coding sequence or a regulatory sequence of a gene involved in fatty acid biosynthesis.
[0013] In another aspect, described herein are compositions comprising one or more proteins, fusion proteins or polynucleotides as described herein. Plant cells may contain one unique gene target or multiple paralogous copies of the same gene. Thus, compositions may comprise one or more ZFP-containing proteins (and polynucleotides encoding same) that target one or more genes involved in fatty acid synthesis in a plant cell. The ZFPs may target all paralogous or homeologous genes and selected particular paralogous or homeologous genes in a plant cell or a combination thereof.
[0014] In another aspect, provided herein is a plant host cell comprising one or more proteins or polynucleotides (e.g., ZFP expression vectors) as described herein. For polynucleotides, the plant host cell may be stably transformed or transiently transfected or a combination thereof with one or more ZFP expression
2017200511 25 Jan 2017 vectors. In one embodiment, the one or more ZFP expression vectors express one or more ZFNs in the plant host cell. In another embodiment, the one or more ZFP expression vectors express one or more ZFP TFs in the plant host cell.
[0015] In another aspect, described herein is a method for modulating expression of one or more genes involved in fatty acid biosynthesis in a plant cell, the method comprising:· (a) introducing, into the plant cell, one or more expression vectors encoding one or more ZFP TFs that bind to a target site in the one or more genes involved in fatty acid biosynthesis under conditions such that the ZFP TFs is (are) expressed and expression of the one or more genes is modulated. Modulation may be activation or repression. In certain embodiments, at least one target site is in a
ACCase, KAS I, KAS Π, KAS ΙΠ, KAS PZ, FATB1, FATB2, FATB3, FATB4, FATB5, FAS, FAE1, FatA, Fad2, Fad3, GPDH, GK, and/or S-ACP-DES gene(s). In other embodiments, more than one gene involved in fatty acid biosynthesis is modulated. In any of the methods of modulating expression of genes involved in fatty acid biosynthesis as described herein, the methods result in plant cells with modified fatty acid content, for example, a reduction of the amount of saturated fats in the plant cells. In some embodiments, the modified fatty acid content in the plant cells results in a modified fatty acid content in the seeds of the plant, for example, a reduction of the amount of saturated fats in the seeds of the plant. In some embodiments the plant an oil-producing plant with modified fatty acid consent in the seeds of the oilproducing plant (e.g., reduced saturated fats). In some particular embodiment, the plant is a Brassica napus plant with modified fatty acid consent in the seeds of the Brassica napus plant (e.g., reduced saturated fats).
[0016] In another aspect, described herein is a method for cleaving one or more genes involved in fatty acid biosynthesis in a plant cell, the method comprising: (a) introducing, into the plant cell, one or more expression vectors encoding one or more nucleases (e.g., ZFNs) that bind to a target site in the one or more genes involved in fatty acid biosynthesis under conditions such that the nucleases (e.g., ZFN(s)) is (are) expressed and the one or more genes are cleaved. In certain embodiments, at least one target site is in a gene encoding ACCase, KAS I, KAS II, KAS ΠΙ, KAS IV, FATB1, FATB2, FATB3, FATB4, FATB5, FAS, FAE1, FatA, Fad2, Fad3, GPDH, GK, and/or S-ACP-DES. In other embodiments, more than one gene involved in fatty acid biosynthesis is cleaved. Furthermore, in any of the
2017200511 25 Jan 2017 methods described herein, cleavage of the one or more genes may result in deletion, addition and/or substitution of nucleotides in the cleaved region.
[0017] In yet another aspect, described herein is a method for introducing an exogenous sequence into the genome of a plant cell, the method comprising the steps of: (a) contacting the cell with an exogenous sequence (donor vector); and (b) expressing one or more nucleases (e.g., zinc finger nucleases) as described herein in the cell, wherein the one or more nucleases cleave chromosomal DNA; such that cleavage of chromosomal DNA in step (b) stimulates incorporation of the donor vector into the genome by homologous recombination. In certain embodiments, the one or more nucleases are fusions between the cleavage domain of a Type Ils restriction endonuclease and an engineered zinc finger binding domain. In other embodiments, the nuclease comprises a homing endonuclease, for example a homing endonuclease with a modified DNA-binding domain. In any of the methods described herein, the exogenous sequence may encode a protein product.
[0018] In a still further aspect, a transgenic or a non-transgenic plant cell obtained according to any of the methods described herein is also provided.
[0019] In another aspect, provided herein is a plant comprising a transgenic or a non-transgenic plant cell obtained as described herein.
[0020] In another aspect, provided herein is a seed from a plant comprising a transgenic or non-transgenic plant cell obtained as described herein.
[0021] In another aspect, provided herein is oil from a seed extracted from a plant comprising a transgenic or non-transgenic plant cell obtained as described herein.
BRIEF DESCRIPTION OF THE DRAWINGS [0022] Figure 1 is a schematic depicting fatty acid biosynthesis pathways in canola (B. napus). This was adapted as per John Shanklin, Brookhaven National Laboratory, Upton, NY (Thelen and Ohlrogge, 2002, Metabolic engineering 4:12-21). [0023] Figure 2 is a schematic depicting the target site locations within the
KASII gene for various exemplary KASII-targeted ZFP TFs. Numbers indicate the target sites for the ZFPs contained within the constructs shown in Table ΙΠ. ZFP designs are shown in Tables I and Π.
[0024] Figure 3 is a graph depicting KASII mRNA expression in TO plant leaves transformed with KASII-activating ZFP TF construct 4695, as assayed by
2017200511 25 Jan 2017 qRT-PCR. An average of 27 control plants was used to calculate fold up-regulation shown in the graph. More than 3-fold KASII mRNA up-regulation was observed in certain events.
[0025] Figure 4 is a graph depicting KASII-ZFP TF/tubulin expression ratios in T1 plant leaves detected via qRT-PCR. Three events were compared along with corresponding nulls.
[0026] Figure 5 is a graph depicting the average KASII/tubulin mRNA expression ratios in ZFP TF-containing and segregating null T1 plants of each of three event as determined by qRT-PCR. 2-3 fold KASII mRNA up-regulation was observed in these T1 plant leaves.
[0027] Figures 6A and 6B are graphs, drawn with JMP statistical software for one-way analysis of target fatty acid(s), depicting a consistent and significant (p = <0.001) decrease in Total C16 (6A) and decrease in Total C16/Total C18 ratios (6B) in ZFP TF positive and sibling null plants within each event. Total C16 was comprised of 06:0 and 06:1 contents and total C18 was comprised of 08:0,18:1, 18:2 and 18:3 contents.
[0028] Figure 7 depicts a sequence alignment of AF318307 and AF244520.
Shading indicates regions of exact homology.
[0029] Figure 8 depicts a sequence alignment of SEQ ID NO:3, SEQ ID
NO:4, SEQ ID NO:46, SEQ ID NO:30, AC189461, and BH723504. Forward and reverse primer sequences (SEQ ID NOs 28 and 29) for amplification of the βketoacyl-ACP synthetase Π cDNA are highlighted by broken lines above the corresponding sequence. Shading indicates regions of exact homology.
[0030] Figure 9 depicts FatB4 and FatB5 gene expressions in B. napus callus lines transgenic for different ZFP TF designs present in constructs pDAB4690 pDAB4692.17 lines for control and 25 lines for each of the ZFP constructs were analyzed. Black bars = FatB4 mRNA expression; gray bars = FatB5 mRNA expression.
[0031] Figure 10 shows FatB4 and FatB5 expressions in B. napus TO , transgenic plant leaves analyzed with qRT-PCR. Three constructs comprising ZFP TFs, pDAB4689 - pDAB4691 were tested in transgenic plants. Total number of independent TO transgenic plants analyzed for this experiment was 40, 62,41, and 22 for pDAB 4689 - pDAB4691 and pDAB8210 respectively. Nex710 control was comprised of 10 plants. Ninety-seven percent of the transgenic events for 3 ZFP TF
2017200511 25 Jan 2017 constructs were positive for ZFP TF expression, as determined by the ZFP TF expression assay (Example 8.3). Similar results were obtained when native tubulin mRNA expression was used as a reference to normalize FatB gene expressions. Black bar = FatB4 expression; gray bar = FatB5 expression.
[0032] Figure 11 is a plot displaying a linear relationship between FatB genes and Tubulin expression when analyzed from TI plants. Black squares = FatB4 expression; gray diamonds = FatB5 expression.
[0033] Figure 12 shows qRT-PCR for FatB4 and FatB5 expression in TI plant leaves transgenic for ZFP TF construct pDAB4691. Black squares = FatB4 expression; gray diamonds = FatB5 expression.
[0034] Figure 13 is a one way analysis of Cl 8:0 content by sample using JMP statistical software.
[0035] Figure 14 shows a one way analysis of total Cl 6/08 content by sample using JMP statistical analysis software.
[0036] Figure 15 depicts an analysis of TI FA profiles of mature seed comprising 4 ZFP TF construct events is shown with JMP statistical software. A and B panels represent one way analysis by sample (construct) of 08:0 content and 06:0/08:0 content respectively, [0037] Figure 16 depicts an analysis of TI FA profiles of mature seed comprising 4 ZFP TF construct events is shown with JMP statistical software. A and B panels display one way analysis by sample (construct) of 04:0 and 06:1 content respectively, highlighting the differentiating attribute of construct pDAS5227. Analysis of TI FA profiles of mature seed comprising 4 ZFP TF construct events is shown with JMP statistical software, A and B panels display one way analysis by sample (construct) of 04:0 and 06:1 content respectively, highlighting the differentiating attribute of construct pDAS5227.
[0038] Figure 17 displays FatB5 mRNA down-regulation (black bars) in T2 immature seed transformed with pDAS5227 ZFP TF construct. ZFP TF expression is represented by ERF3 expression (gray bars). 25 DAF immature seeds were analyzed from four - null, three heterozygous (5227_12ZF-1) and four homozygous (5227_12ZF-2) TI plants ofthe event 5227-12.
[0039] Figure 18 shows FatB5 niRNA down-regulation (black bars) in T2 immature seed transformed with pDAS5212 ZFP TF construct. ZFP TF mRNA expression is represented by KRAB1 expression (gray bars). 25 DAF immature seeds
2017200511 25 Jan 2017 were analyzed from five null, three heterozygous and four homozygous plants of the event 5212-4.
[0040] Figure 19 shows a one way analysis of total saturated fatty acids (sats.) by zygosity in T2 seed of ZFP TF event 5227-12. T2 seed obtained from TI null, heterozygous and homozygous parent plants are labeled as 5227-12ZF null, 5227-12ZF(l) and 5227-12ZF(2), respectively.
[0041] Figure 20 shows a one way analysis of total saturated fatty acids (sats.) by zygosity in T2 seed of ZFP TF event 5212-4. T2 seed obtained from TI null, heterozygous and homozygous parent plants are labeled as 5212-4ZF null, 521210 4ZF(1) and 5212-4(2) respectively..
• DETAILED DESCRIPTION [0042] Disclosed herein are compositions and methods useful for modulation of expression and targeted cleavage and alteration of one or more genes involved in fatty acid synthesis in plants. Regulation of such genes can be modulated, e.g., by using engineered ZFP transcription factors or modifying gene regulatory regions. Genes can be altered, e.g., by targeted cleavage followed by intrachromosomal homologous recombination or by targeted cleavage followed by homologous recombination between an exogenous polynucleotide (comprising one or more regions of homology with the gene nucleotide sequence) and a genomic sequence.
[0043] Genomic sequences include those present in chromosomes, episomes, organellar genomes (e.g., mitochondria, plastids), artificial chromosomes and any other type of nucleic acid present in a cell such as, for example, amplified sequences, double minute chromosomes and the genomes of endogenous or infecting bacteria and viruses. Genomic sequences can be normal (i.e., wild-type) or mutant; mutant sequences can comprise, for example, insertions, deletions, translocations, rearrangements, and/or point mutations. A genomic sequence can also comprise one of a number of different alleles.
[0044] Compositions disclosed herein comprise one or more ZFPs comprising engineered zinc finger binding domains, polynucleotides encoding these polypeptides, and combinations of ZFPs and ZFP-encoding polynucleotides. A zinc finger binding domain can comprise one or more zinc fingers (e.g., 2, 3, 4, 5, 6, 7, 8, 9 or more zinc fingers), and can be engineered to bind to any genomic sequence of a gene, including
2017200511 25 Jan 2017 regulatory sequences operatively linked to the gene, involved in fatty-acid biosynthesis.
[0045] ZFPs as described herein can be used to regulate gene expression, either through activation or repression of gene transcription. ZFPs comprising fusions of zinc finger domains linked to regulatory domains can be constructed to create chimeric transcription factors that activate or repress transcription. ZFPs can also be used for targeted cleavage of a genomic region of interest by linking zinc finger domains with nuclease cleavage domains (or cleavage half-domains) to produce zinc finger nucleases. Thus, by identifying a target genomic region of interest at which gene regulation, cleavage, or recombination is desired, one can, according to the methods disclosed herein, construct a zinc finger protein comprising one or more fusion proteins comprising one or more regulatory domains and/or cleavage domains (or cleavage half-domains) linked to a zinc finger domain engineered to recognize a gene sequence in that genomic region. The presence of such a ZFP comprising a fusion protein (or proteins) in a cell will result in binding of the fusion protein(s) to its (their) binding site(s) and altered regulation or cleavage within or near the genomic region. Additionally, if a genomic region is cleaved and an exogenous polynucleotide homologous to that genomic region is also present in the cell, homologous recombination occurs at a high rate between the genomic region and the exogenous polynucleotide.
[0046] As shown in Figure 1, there are several genes that are involved in fatty acid biosynthesis. Thus, compositions described herein may target one or more of these genes in a plant cell, including but not limited to ACCase, KAS I, KAS H, KAS III, KAS IV, FATB1, FATB2, FATB3, FATB4, FATB5, FAS, FAE1, FatA, Fad2,
Fad3, GPDH, GK, or S-ACP-DES gene(s) and orthologs, paralogs, and homeologs of these genes. For example, 1, 2, 3, 4, 5, or more genes involved in fatty acid biosynthesis can be targeted by proteins (e.g., ZFPs) disclosed herein. Therefore, one or more ZFPs or expression vectors encoding ZFPs of different specificities may be combined to target the desired genes of interest in a plant.
General [0047] Practice of the methods, as well as preparation and use of the compositions disclosed herein employ, unless otherwise indicated, conventional techniques in molecular biology, biochemistry, chromatin structure and analysis,
2017200511 25 Jan 2017 computational chemistry, cell culture, recombinant DNA and related fields as are within the skill of the art. These techniques are fully explained in the literature. See, for example, Sambrook et al. MOLECULAR CLONING: A LABORATORY MANUAL,
Second edition, Cold Spring Harbor Laboratory Press, 1989 and Third edition, 2001;
Ausubel et al., CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons,
New York, 1987 and periodic updates; the series METHODS IN ENZYMOLOGY,
Academic Press, San Diego; Wolffe, CHROMATIN STRUCTURE AND FUNCTION, Third edition, Academic Press, San Diego, 1998; METHODS IN ENZYMOLOGY, Vol. 304, “Chromatin” (P.M. Wassarman and A. P. Wolffe, eds.), Academic Press, San Diego,
1999; and METHODS IN MOLECULAR BIOLOGY, Vol. 119, “Chromatin Protocols” (P.B. Becker, ed.) Humana Press, Totowa, 1999.
Definitions [0048] The terms nucleic acid, polynucleotide, and oligonucleotide are used interchangeably and refer to a deoxyribonucleotide or ribonucleotide polymer, in linear or circular conformation, and in either single- or double-stranded form. For the purposes of the present disclosure, these terms are not to be construed as limiting with respect to the length of a polymer. The terms can encompass known analogues of natural nucleotides, as well as nucleotides that are modified in the base, sugar and/or phosphate moieties (e.g., phosphorothioate backbones). In general, an analogue of a particular nucleotide has the same base-pairing specificity; i.e., an analogue of A will base-pair with T.
[0049] The terms polypeptide, peptide and protein are used interchangeably to refer to a polymer of amino acid residues. The term also applies to amino acid polymers in which one or more amino acids are chemical analogues or modified derivatives of a corresponding naturally-occurring amino acids.
[0050] Binding refers to a sequence-specific, non-covalent interaction between macromolecules (e.g., between a protein and a nucleic acid). Not all components of a binding interaction need be sequence-specific (e.g., contacts with phosphate residues in a DNA backbone), as long as the interaction as a whole is sequence-specific. Such interactions are generally characterized by a dissociation constant (K^) of 10‘6 M'1 or lower. “Affinity” refers to the strength of binding: increased binding affinity being correlated with a lower Kj.
[0051] A binding protein is a protein that is able to bind non-covalently to another molecule, A binding protein can bind to, for example, a DNA molecule (a DNA11
2017200511 25 Jan 2017 binding protein), an RNA molecule (an RNA-binding protein) and/or a protein molecule (a protein-binding protein). In the case of a protein-binding protein, it can bind to itself (to form homodimers, homotrimers, etc.) and/or it can bind to one or more molecules of a different protein or proteins. A binding protein can have more than one type of binding activity, For example, zinc finger proteins have DNA-binding, RNA-binding and proteinbinding activity.
[0052] A zinc finger DNA binding protein (or binding domain) is a protein, or a domain within a larger protein, that binds DNA in a sequence-specific manner through one or more zinc fingers, which are regions of amino acid sequence within the binding domain whose structure is stabilized through coordination of a zinc ion. The term zinc finger
DNA binding protein is often abbreviated as zinc finger protein or ZFP.
[0053] Zinc finger binding domains can be engineered to bind to a predetermined nucleotide sequence (e.g., a target sequence in any gene involved in fatty acid biosynthesis). Non-limiting examples of methods for engineering zinc finger proteins are design and selection. A designed zinc finger protein is a protein not occurring in nature whose design/composition results principally from rational criteria. Rational criteria for design include application of substitution rules and computerized algorithms for processing information in a database storing information of existing ZFP designs and binding data. See, for example, U.S. Patents 6,140,081;
6,453,242; 6,534,261; and 6,785,613; see, also WO 98/53058; WO 98/53059;
WO 98/53060; WO 02/016536 and WO 03/016496; and U.S. Patents 6,746,838; 6,866,997; and 7,030,215. Thus, an “engineered” zinc finger protein or “nonnaturally occurring” zinc finger protein is one in which one or more of the component zinc finger DNA binding domains (recognition helices) are not naturally occurring and have been engineered to bind to a pre-selected target site.
[0054] A selected zinc finger protein is a protein not found in nature whose production results primarily from an empirical process such as phage display, interaction trap or hybrid selection. See e.g., US 5,789,538; US 5,925,523; US 6,007,988;
US 6,013,453; US 6,200,759; US 6,733,970; US RE39.229; and WO 95/19431;
WO 96/06166; WO 98/53057; WO 98/54311; WO 00/27878; WO 01/60970 WO 01/88197 and WO 02/099084.
[0055] The term sequence refers to a nucleotide sequence of any length, which can be DNA or RNA; can be linear, circular or branched and can be either single-stranded or double stranded. The term donor sequence refers to a nucleotide
2017200511 25 Jan 2017 sequence that is inserted into a genome. A donor sequence can be of any length, for example between 2 and 25,000 nucleotides in length (or any integer value therebetween or thereabove), preferably between about 100 and 5,000 nucleotides in length (or any integer therebetween), more preferably between about 200 and 2,500 nucleotides in length.
[0056] A homologous sequence refers to a first sequence which shares a degree of sequence identity with a second sequence, and whose sequence may be identical to that of the second sequence. A homologous, non-identical sequence refers to a first sequence which shares a degree of sequence identity with a second sequence, but whose sequence is not identical to that of the second sequence. For example, a polynucleotide comprising the wild-type sequence of a mutant gene is homologous and non-identical to the sequence of the mutant gene. In certain embodiments, the degree of homology between the two sequences is sufficient to allow homologous recombination therebetween, by utilizing normal cellular mechanisms. Two homologous non-identical sequences can be of any length and their degree of non-homology can be as small as a single nucleotide (e.g., for correction of a genomic point mutation by targeted homologous recombination) or as large as 10 or more kilobases (e.g., for insertion of a gene at a predetermined site in a chromosome). Two polynucleotides comprising the homologous non-identical sequences need not be the same length. For example, an exogenous polynucleotide (i.e., donor polynucleotide) of between 20 and 10,000 nucleotides or nucleotide pairs can be used.
[0057] Techniques for determining nucleic acid and amino acid sequence identity are known in the art. Typically, such techniques include determining the nucleotide sequence of the mRNA for a gene and/or determining the amino acid sequence encoded thereby, and comparing these sequences to a second nucleotide or amino acid sequence. Genomic sequences can also be determined and compared in this fashion. In general, identity refers to an exact nucleotide-to-nucleotide or amino acid-to-amino acid correspondence of two polynucleotides or polypeptide sequences, respectively. Two or more sequences (polynucleotide or amino acid) can be compared by determining their percent identity. The percent identity of two sequences, whether nucleic acid or amino acid sequences, is the number of exact matches between two aligned sequences divided by the length of the shorter sequences and multiplied by 100. An approximate alignment for nucleic acid
2017200511 25 Jan 2017 sequences is provided by the local homology algorithm of Smith and Waterman, Advances in Applied Mathematics 2:482-489 (1981). This algorithm can be applied to amino acid sequences by using the scoring matrix developed by Davhoff, Atlas of Protein Sequences and Structure, M.O. Dayhoff ed., 5 suppl. 3:353-358, National
Biomedical Research Foundation, Washington, D.C., USA, and normalized by
Gribskov, Nucl. Acids Res. 14(6):6745-6763 (1986). An exemplary implementation of this algorithm to determine percent identity of a sequence is provided by the Genetics Computer Group (Madison, WI) in the “BestFit” utility application. The default parameters for this method are described in the Wisconsin Sequence Analysis
Package Program Manual, Version 8 (1995) (available from Genetics Computer Group, Madison, WI). A preferred method of establishing percent identity in the context of the present disclosure is to use the MPSRCH package of programs copyrighted by the University of Edinburgh, developed by John F. Collins and Shane S. Sturrok, and distributed by IntelliGenetics, Inc. (Mountain View, CA). From this suite of packages the Smith-Waterman algorithm can be employed where default parameters are used for the scoring table (for example, gap open penalty of 12, gap extension penalty of one, and a gap of six). From the data generated the “Match” value reflects sequence identity. Other suitable programs for calculating the percent identity or similarity between sequences are generally known in the art, for example, another alignment program is BLAST, used with default parameters. For example, BLASTN and BLASTP can be used using the following default parameters: genetic code = standard; filter - none; strand = both; cutoff = 60; expect = 10; Matrix = BLOSUM62; Descriptions = 50 sequences; sort by = HIGH SCORE; Databases = non-redundant, GenBank + EMBL + DDBJ + PDB + GenBank CDS translations +
Swiss protein + Spupdate + PIR. Details of these programs can be found on the internet. With respect to sequences described herein, the range of desired degrees of sequence identity is approximately 35% to 100% and any integer value therebetween. Typically the percent identities between sequences are at least 35%-40%; 40%-45%; 45%-50%; 50%-60%; 60%-70%; 70-75%, preferably 80-82%, more preferably 8530 90%, even more preferably 92%, still more preferably 95%, and most preferably 98% sequence identity.
[0058J Alternatively, the degree of sequence similarity between polynucleotides can be determined by hybridization of polynucleotides under conditions that allow formation of stable duplexes between homologous regions,
2017200511 25 Jan 2017 followed by digestion with single-stranded-specific nuclease(s), and size determination of the digested fragments. Two nucleic acid, or two polypeptide sequences are substantially homologous to each other when the sequences exhibit at least about 70%-75%, preferably 80%-82%, more preferably 85%-90%, even more preferably 92%, still more preferably 95%, and most preferably 98% sequence identity over a defined length of the molecules, as determined using the methods above. As used herein, substantially homologous also refers to sequences showing complete identity to a specified DNA or polypeptide sequence. DNA sequences that are substantially homologous can be identified in a Southern hybridization experiment under, for example, stringent conditions, as defined for that particular system.
Defining appropriate hybridization conditions is within the skill of the art. See, e.g., Sambrook et al., supra·, Nucleic Acid Hybridization: A Practical Approach, editors B.D. Hames and S.J. Higgins, (1985) Oxford; Washington, DC; ERL Press).
[0059] Selective hybridization of two nucleic acid fragments can be determined as follows. The degree of sequence identity between two nucleic acid molecules affects the efficiency and strength of hybridization events between such molecules. A partially identical nucleic acid sequence will at least partially inhibit the hybridization of a completely identical sequence to a target molecule. Inhibition of hybridization of the completely identical sequence can be assessed using hybridization assays that are well known in the art (e.g., Southern (DNA) blot, Northern (RNA) blot, solution hybridization, or the like, see Sambrook, et al., Molecular Cloning: A Laboratory Manual, Second Edition, (1989) Cold Spring Harbor, N.Y.). Such assays can be conducted using varying degrees of selectivity, for example, using conditions varying from low to high stringency. If conditions of low stringency are employed, the absence of non-specific binding can be assessed using a secondary probe that lacks even a partial degree of sequence identity (for example, a ' probe having less than about 30% sequence identity with the target molecule), such that, in the absence of non-specific binding events, the secondary probe will not hybridize to the target, [0060] When utilizing a hybridization-based detection system, a nucleic acid probe is chosen that is complementary to a reference nucleic acid sequence, and then by selection of appropriate conditions the probe and the reference sequence selectively hybridize, or bind, to each other to form a duplex molecule, A nucleic acid molecule that is capable of hybridizing selectively to a reference sequence under
2017200511 25 Jan 2017 moderately stringent hybridization conditions typically hybridizes under conditions that allow detection of a target nucleic acid sequence of at least about 10-14 nucleotides in length having at least approximately 70% sequence identity with the sequence of the selected nucleic acid probe. Stringent hybridization conditions typically allow detection of target nucleic acid sequences of at least about 10-14 nucleotides in length having a sequence identity of greater than about 90-95% with •s the sequence of the selected nucleic acid probe. Hybridization conditions useful for probe/reference sequence hybridization, where the probe and reference sequence have a specific degree of sequence identity, can be determined as is known in the art (see, for example, Nucleic Acid Hybridization: A Practical Approach, editors B.D. Hames and S.J. Higgins, (1985) Oxford; Washington, DC; IRL Press).
[0061] Conditions for hybridization are well-known to those of skill in the art.
Hybridization stringency refers to the degree to which hybridization conditions disfavor the formation of hybrids containing mismatched nucleotides, with higher stringency correlated with a lower tolerance for mismatched hybrids. Factors that affect the stringency of hybridization are well-known to those of skill in the art and include, but are not limited to, temperature, pH, ionic strength, and concentration of organic solvents such as, for example, formamide and dimethylsulfoxide. As is known to those of skill in the art, hybridization stringency is increased by higher temperatures, lower ionic strength and lower solvent concentrations.
[0062] With respect to stringency conditions for hybridization, it is well known in the art that numerous equivalent conditions can be employed to establish a particular stringency by varying, for example, the following factors: the length and nature of the sequences, base composition of the various sequences, concentrations of salts and other hybridization solution components, the presence or absence of blocking agents in the hybridization solutions (e.g., dextran sulfate, and polyethylene glycol), hybridization reaction temperature and time parameters, as well as, varying wash conditions. The selection of a particular set of hybridization conditions is selected following standard methods in the art (see, for example, Sambrook, et al.,
Molecular Cloning: A Laboratory Manual. Second Edition, (1989) Cold Spring Harbor, N.Y.).
[0063] Recombination1' refers to a process of exchange of genetic information between two polynucleotides. For the purposes of this disclosure, homologous recombination (HR) refers to the specialized form of such exchange
2017200511 25 Jan 2017 that takes place, for example, during repair of double-strand breaks in cells. This process requires nucleotide sequence homology, uses a donor molecule for template repair of a target molecule (i.e., the one that experienced the double-strand break), and is variously known as non-crossover gene conversion or short tract gene conversion, because it leads to the transfer of genetic information from the donor to the target. Without wishing to be bound by any particular theory, such transfer can involve mismatch correction of heteroduplex DNA that forms between the broken target and the donor, and/or synthesis-dependent strand annealing, in which the donor is used to resynthesize genetic information that will become part of the target, and/or related processes. Such specialized HR often results in an alteration of the sequence of the target molecule such that part or all of the sequence of the donor polynucleotide is incorporated into the target polynucleotide.
[0064] Cleavage refers to the breakage of the covalent backbone of a DNA molecule. Cleavage can be initiated by a variety of methods including, but not limited to, enzymatic or chemical hydrolysis of a phosphodiester bond. Both single-stranded cleavage and double-stranded cleavage are possible, and double-stranded cleavage can occur as a result of two distinct single-stranded cleavage events. DNA cleavage can result in the production of either blunt ends or staggered ends. In certain embodiments, fusion polypeptides are used for targeted double-stranded DNA cleavage.
[0065] A cleavage domain comprises one or more polypeptide sequences which possesses catalytic activity for DNA cleavage. A cleavage domain can be contained in a single polypeptide chain or cleavage activity can result from the association, of two (or more) polypeptides.
[0066] A cleavage half-domain is a polypeptide sequence, which in conjunction with a second polypeptide (either identical or different) forms a complex having cleavage activity (preferably double-strand cleavage activity).
V [0067] Chromatin is the nucleoprotein structure comprising the cellular genome. Cellular chromatin comprises nucleic acid, primarily DNA, and protein, including histones and non-histone chromosomal proteins. The majority of eukaryotic cellular chromatin exists in the form of nucleosomes, wherein a nucleosome core comprises approximately 150 base pairs of DNA associated with an octamer comprising two each of histones H2A, H2B, H3 and H4; and linker DNA (of variable length depending on the organism) extends between nucleosome cores. A
2017200511 25 Jan 2017 molecule of histone Hl is generally associated with the linker DNA. For the purposes of the present disclosure, the term “chromatin” is meant to encompass all types of cellular nucleoprotein, both prokaryotic and eukaryotic. Cellular chromatin includes both chromosomal and episomal chromatin.
[0068] A chromosome, is a chromatin complex comprising all or a portion of the genome of a cell. The genome of a cell is often characterized by its karyotype, which is the collection of all the chromosomes that comprise the genome of the cell. The genome of a cell can comprise one or more chromosomes.
[0069] An episome is a replicating nucleic acid, nucleoprotein complex or other structure comprising a nucleic acid that is not part of the chromosomal karyotype of a cell. Examples of episomes include plasmids and certain viral genomes.
[0070] An accessible region is a site in cellular chromatin in which a target site present in the nucleic acid can be bound by an exogenous molecule which recognizes the target site. Without wishing to be bound by any particular theory, it is believed that an accessible region is one that is not packaged into a nucleosomal structure. The distinct structure of an accessible region can often be detected by its sensitivity to chemical and enzymatic probes, for example, nucleases.
[0071] A target site or target sequence is a nucleic acid sequence that defines a portion of a nucleic acid to which a binding molecule will bind, provided sufficient conditions for binding exist. For example, the sequence 5’-GAATTC-3’ is a target site for the Eco RI restriction endonuclease.
[0072] An exogenous molecule is a molecule that is not normally present in a cell, but can be introduced into a cell by one or more genetic, biochemical or other methods. Normal presence in the cell” is determined with respect to the particular developmental stage and environmental conditions of the cell. Thus, for example, a molecule that is present only during embryonic development of muscle is an exogenous molecule with respect to an adult muscle cell. Similarly, a molecule induced by heat shock is an exogenous molecule with respect to a non-heat-shocked cell. An exogenous molecule can comprise, for example, a functioning version of a malfunctioning endogenous molecule or a malfunctioning version of a normallyfunctioning endogenous molecule.
[0073] An exogenous molecule can be, among other things, a small molecule, such as is generated by a combinatorial chemistry process, or a macromolecule such
2017200511 25 Jan 2017 as a protein, nucleic acid, carbohydrate, lipid, glycoprotein, lipoprotein, polysaccharide, any modified derivative of the above molecules, or any complex comprising one or more of the above molecules. Nucleic acids include DNA and RNA, can be single- or double-stranded; can be linear, branched or circular; and can be of any length. Nucleic acids include those capable of forming duplexes, as well as triplex-forming nucleic acids. See, for example, U.S. Patent Nos. 5,176,996 and 5,422,251. Proteins include, but are not limited to, DNA-binding proteins, transcription factors, chromatin remodeling factors, methylated DNA binding proteins, polymerases, methylases, demethylases, acetylases, deacetylases, kinases, phosphatases, integrases, recombinases, ligases, topoisomerases, gyrases and helicases.
[0074] An exogenous molecule can be the same type of molecule as an endogenous molecule, e.g., an exogenous protein or nucleic acid. For example, an exogenous nucleic acid can comprise an infecting viral genome, an Agrobacterium tumefaciens T-strand, a plasmid or episome introduced into a cell, or a chromosome that is not normally present in the cell. Methods for the introduction of exogenous molecules into cells are known to those of skill in the art and include, but are not limited to, lipid-mediated transfer (i.e., liposomes, including neutral and cationic lipids), electroporation, direct injection, cell fusion, particle bombardment, calcium phosphate co-precipitation, DEAE-dextran-mediated transfer and viral vectormediated transfer. The exogenous molecule non-plant molecule, for example, a mammalian (e.g., human or humanized) antibody.
[0075] By contrast, an endogenous molecule is one that is normally present in a particular cell at a particular developmental stage under particular environmental conditions. For example, an endogenous nucleic acid can comprise a chromosome, the genome of a mitochondrion, chloroplast or other organelle, or a naturallyoccurring episomal nucleic acid. Additional endogenous molecules can include proteins, for example, transcription factors and enzymes.
[0076] A fusion molecule is a molecule in which two or more subunit molecules are linked, preferably covalently. The subunit molecules can be the same chemical type of molecule, or can be different chemical types of molecules.
Examples of the first type of fusion molecule include, but are not limited to, fusion proteins (for example, a ZFN comprising a fusion between a ZFP DNA-binding domain and a cleavage domain) and fusion nucleic acids (for example, a nucleic acid
2017200511 25 Jan 2017 encoding the fusion protein described supra). Examples of the second type of fusion molecule include, but are not limited to, a fusion between a triplex-forming nucleic acid and a polypeptide, and a fusion between a minor groove binder and a nucleic acid.
[0077] Expression of a fusion protein in a cell can result from delivery of the fusion protein to the cell or by delivery of a polynucleotide encoding the fusion protein to a cell, wherein the polynucleotide is transcribed, and the transcript is translated, to generate the fusion protein. Trans-splicing, polypeptide cleavage and polypeptide ligation can also be involved in expression of a protein in a cell. Methods for polynucleotide and polypeptide delivery to cells are presented elsewhere in this disclosure.
[0078] A gene, for the purposes of the present disclosure, includes a DNA region encoding a gene product (see infra), as well as all DNA regions which regulate the production of the gene product, whether or not such regulatory sequences are adjacent to coding and/or transcribed sequences'. Accordingly, a gene includes, but is not necessarily limited to, promoter sequences, terminators, translational regulatory sequences such as ribosome binding sites and internal ribosome entry sites, enhancers, silencers, insulators, boundary elements, replication origins, matrix attachment sites and locus control regions. · [0079] Gene expression refers to the conversion of the information, contained in a gene, into a gene product. A gene product can be the direct · transcriptional product of a gene (e.g., mRNA, tRNA, rRNA, antisense RNA, ribozyme, shRNA, micro RNA, structural RNA or any other type of RNA) or a protein produced by translation of a mRNA. Gene products also include RNAs which are modified, by processes such as capping, polyadenylation, methylation, and editing, and proteins modified by, for example, methylation, acetylation, • phosphorylation, ubiquitination, ADP-ribosylation, myristilation, and glycosylation. [0080] Modulation of gene expression refers to a change in the activity of a gene. Modulation of expression can include, but is not limited to, gene activation and gene repression, [0081] Plant cells include, but are not limited to, cells of monocotyledonous (monocots) or dicotyledonous (dicots) plants. Non-limiting examples of monocots include cereal plants such as maize, rice, barley, oats, wheat, sorghum, rye, sugarcane, pineapple, onion, banana, and coconut. Non-limiting examples of dicots include
2017200511 25 Jan 2017 tobacco, tomato, sunflower, cotton, sugarbeet, potato, lettuce, melon, soybean, canola (rapeseed), and alfalfa. Plant cells may be from any part of the plant and/or from any stage of plant development. Therefore, plant cells may be cells from seeds of the plant. In some embodiments, the plant or plant cell is, or is derived from, a plant involved in the production of vegetable oils for edible and/or industrial uses (i.e., an “oil-producing plant”). Exemplary oil-producing plants include, but are not limited to, Brassica sp. (e.g., Brassica napus including canola cultivars), maize, soybean, crambe, mustard, castor bean, peanut, sesame, cotton, linseed, safflower, oil palm, flax, sunflower, and coconut.
[0082] A region of interest is any region of cellular chromatin, such as, for example, a gene or a non-coding sequence within or adjacent to a gene, in which it is desirable to bind an exogenous molecule. Binding can be for the purposes of targeted DNA cleavage and/or targeted recombination. A region of interest can be present in a chromosome, an episome, an organellar genome (e.g,, mitochondrial, chloroplast), or an infecting viral genome, for example. A region of interest can be within the coding region of a gene, within transcribed non-coding regions such as, for example, leader sequences, trailer sequences or introns, or within non-transcribed regions, either upstream or downstream of the coding region. A region of interest can be as small as a single nucleotide pair or up to 25,000 nucleotide pairs in length, or any integral value of nucleotide pairs.
[0083] The terms operative linkage and operatively linked (or “operably linked”) are used interchangeably with reference to a juxtaposition of two or more components (such as sequence elements), in which the components are arranged such that both components function normally and allow the possibility that at least one of the components can mediate a function that is exerted upon at least one of the other components. By way of illustration, a transcriptional regulatory sequence, such as a promoter, is operatively linked to a coding sequence if the transcriptional regulatory sequence controls the level of transcription of the coding sequence in response to the presence or absence of one or more transcriptional regulatory factors. A transcriptional regulatory sequence is generally operatively linked in cis with a coding sequence, but need not be directly adjacent to it. For example, an enhancer is a transcriptional regulatory sequence that is operatively linked to a coding sequence, even though they are not contiguous.
2017200511 25 Jan 2017 {0084] With respect to fusion polypeptides, the term operatively linked can refer to the fact that each of the components performs the same function in linkage to the other component as it would if it were not so linked. For example, with respect to a fusion polypeptide in which a ZFP DNA-binding domain is fused to a regulatory domain, the ZFP DNA-binding domain and the regulatory domain are in operative linkage if, in the fusion polypeptide, the ZFP DNA-binding domain portion is able to bind its target site and/or its binding site, while the regulatory domain is able to regulate expression of DNA in the vicinity of the target site.
[0085] A functional fragment of a protein, polypeptide or nucleic acid is a protein, polypeptide or nucleic acid whose sequence is not identical to the full-length protein, polypeptide or nucleic acid, yet retains the same function as the full-length protein, polypeptide or nucleic acid. A functional fragment can possess more, fewer, or the same number of residues as the corresponding native molecule, and/or can contain one ore more amino acid or nucleotide substitutions. Methods for determining the function of a nucleic acid (e.g., coding function, ability to hybridize to another nucleic acid) are well-known in the art. Similarly, methods for determining protein function are well-known. For example, the DNA-binding function of a polypeptide can be determined, for example, by filter-binding, electrophoretic mobility-shift, or immunoprecipitation assays. DNA cleavage can be assayed by gel electrophoresis. See Ausubel et al., supra. The ability of a protein to interact with another protein can be determined, for example, by co-immunoprecipitation, twohybrid assays or complementation, both genetic and biochemical. See, for example, Fields et al. (1989) Nature 340:245-246; U.S. Patent No. 5,585,245 and PCT WO 98/44350.
[0086] As used herein, “saturated fatty acids” include, but are not limited to, lauric (02:0), myristic (04:0), palmitic (06:0) and stearic (08:0) acids.
Similarly, “monounsaturated fatty acids” and “polyunsaturated fatty acids” include, but are not limited to, 08 fatty acids such as oleic acid (08:1), reduced linoleic acid (08:2) and reduced linolenic acid (08:3).
Target sites [0087] The disclosed methods and compositions include fusion proteins comprising a DNA-binding domain (e.g., ZFP) and a regulatory domain or cleavage (nuclease) domain (or a cleavage half-domain), in which the DNA-binding domain
2017200511 25 Jan 2017 (e.g., zinc finger domain), by binding to a sequence in cellular chromatin in a gene involved in fatty acid synthesis, directs the activity of the transcriptional regulatory domain or cleavage domain (or cleavage half-domain) to the vicinity of the sequence and, hence, modulates transcription or induces cleavage in the vicinity of the target sequence.
[0088] As set forth elsewhere in this disclosure, a zinc finger domain can be engineered to bind to virtually any desired sequence. Accordingly, after identifying a region of interest containing a sequence at which gene regulation, cleavage, or recombination is desired, one or more zinc finger binding domains can be engineered to bind to one or more sequences in the region of interest, [0089] Selection of a target site in a genomic region of interest in cellular chromatin of any gene involved in fatty acid biosynthesis (e.g., see Figure 1) for binding by a zinc finger domain (e.g., a target site) can be accomplished, for example, according to the methods disclosed in co-owned US Patent No. 6,453,242 (Sept. 17,
2002), which also discloses methods for designing ZFPs to bind to a selected sequence. It will be clear to those skilled in the art that simple visual inspection of a nucleotide sequence can also be used for selection of a target site. Accordingly, any means for target site selection can be used in the claimed methods.
[0090] In certain embodiments, the ZFPs as described herein bind to a target site in a gene encoding ACCase, KAS I, KAS Π, KAS III, KAS IV, FATB1, FATB2, FATB3, FATB4, FATB5, FAS, FAE1, FatA, Fad2, Fad3, GPDH, GK, and/or S-ACP-DES.
[0091] Target sites are generally composed of a plurality of adjacent target subsites. A target subsite refers to the sequence (usually either a nucleotide triplet, or a nucleotide quadruplet that can overlap by one nucleotide with an adjacent quadruplet) bound by an individual zinc finger. See, for example, WO 02/077227. If the strand with which a zinc finger protein makes most contacts is designated the target strand “primary recognition strand,” or “primary contact strand,” some zinc finger proteins bind to a three base triplet in the target strand and a fourth base on the non-target strand. A target site generally has a length of at least 9 nucleotides and, accordingly, is bound by a zinc finger binding domain comprising at least three zinc fingers. However binding of, for example, a 4-finger binding domain to a 12nucleotide target site, a 5-finger binding domain to a 15-nucleotide target site or a 6finger binding domain to an 18-nucleotide target site, is also possible. As will be
2017200511 25 Jan 2017 apparent, binding of larger binding domains (e.g., 7-, 8-, 9-finger and more) to longer target sites is also possible.
[0092] It is not necessary for a target site to be a multiple of three nucleotides.
For example, in cases in which cross-strand interactions occur (see, e.g., US Patent
6,453,242 and WO 02/077227), one or more of the individual zinc fingers of a multifinger binding domain can bind to overlapping quadruplet subsites. As a result, a three-finger protein can bind a 10-nucleotide sequence, wherein the tenth nucleotide is part of a quadruplet bound by a terminal finger, a four-finger protein can bind a 13nucleotide sequence, wherein the thirteenth nucleotide is part of a quadruplet bound by a terminal finger, etc.
[0093] The length and nature of amino acid linker sequences between individual zinc fingers in a multi-finger binding domain also affects binding to a target sequence. For example, the presence of a so-called “non-canonical linker,” “long linker” or “structured linker” between adjacent zinc fingers in a multi-finger binding domain can allow those fingers to bind subsites which are not immediately adjacent. Non-limiting examples of such linkers are described, for example, in US Patent No. 6,479,626 and WO 01/53480. Accordingly, one or more subsites, in a target site for a zinc finger binding domain, can be separated from each other by 1, 2, 3, 4, 5 or more nucleotides. To provide but one example, a four-finger binding domain can bind to a 13-nucleotide target site comprising, in sequence, two contiguous 3-nucleotide subsites, an intervening nucleotide, and two contiguous triplet subsites. See, also, U.S. Application No. 61/130,099 for compositions and methods for linking artificial nucleases to bind to target sites separated by different numbers of nucleotides. Distance between sequences (e.g., target sites) refers to the number of nucleotides or nucleotide pairs intervening between two sequences, as measured from the edges of the sequences nearest each other.
[0094] In certain embodiments, ZFPs with transcription factor function are designed. For transcription factor function, simple binding and sufficient proximity to the promoter are all that is generally needed. Exact positioning relative to the promoter, orientation, and within limits, distance does not matter greatly. This feature allows considerable flexibility in choosing target sites for constructing artificial transcription factors. The target site recognized by the ZFP therefore can be any suitable site in the target gene that will allow activation or repression of gene expression by a ZFP, optionally linked to a regulatory domain. Preferred target sites
2017200511 25 Jan 2017 include regions adjacent to, downstream, or upstream of the transcription start site. In addition, target sites that are located in enhancer regions, repressor sites, RNA polymerase pause sites, and specific regulatory sites (e.g., SP-1 sites, hypoxia response elements, nuclear receptor recognition elements, p53 binding sites), sites in the cDNA encoding region or in an expressed sequence tag (EST) coding region. [0095] In other embodiments, ZFPs with nuclease activity are designed.
Expression of a ZFN comprising a fusion protein comprising a zinc finger binding domain and a cleavage domain (or of two fusion proteins, each comprising a zinc finger binding domain and a cleavage half-domain), in a cell, effects cleavage in the vicinity of the target sequence. In certain embodiments, cleavage depends on the binding of two zinc finger domain/cleavage half-domain fusion molecules to separate target sites. The two target sites can be on opposite DNA strands, or alternatively, both target sites can be on the same DNA strand.
DNA binding domains [0096] Any DNA binding domain can be used in the practice of the present invention. In certain embodiments, the DNA binding domain comprises a zinc finger binding domain of one or more zinc fingers (Miller et al. (1985) EMBO J. 4:16091614; Rhodes (1993) Scientific American Feb.:56-65; US Patent No. 6,453,242).
Typically, a single zinc finger domain is about 30 amino acids in length. Structural studies have demonstrated that each zinc finger domain (motif) contains two beta sheets (held in a beta turn which contains the two invariant cysteine residues) and an alpha helix (containing the two invariant histidine residues), which are held in a particular conformation through coordination of a zinc atom by the two cysteines and the two histidines.
[0097] Zinc fingers include both canonical C2H2 zinc fingers (i.e., those in which the zinc ion is coordinated by two cysteine and two histidine residues) and noncanonical zinc fingers such as, for example, C3H and C2HC zinc fingers (those in which the zinc ion is coordinated by three cysteine residues and one histidine residue, see, e.g., U.S. Patent Publication No. 2008/0182332) and C4 zinc fingers (those in which the zinc ion· is coordinated by four cysteine residues). See also WO 02/057293. [0098] Zinc finger binding domains can be engineered to bind to a sequence of choice. See, for example, Beerli et al. (2002) Nature Biotechnol. 20:135-141; Pabo et al. (2001) Ann. Rev. Biochem. 70:313-340; Isalan et al. (2001) Nature Biotechnol.
2017200511 25 Jan 2017
19:656-660; Segal etal. (2001) Curr. Opin. Biotechnol. 12:632-637; Choo et al. (2000) Curr. Opin. Struct. Biol. 10:411-416. An engineered (or non-naturally occurring) zinc finger binding domain can have a novel binding specificity, compared to a naturally-occurring zinc finger protein. Engineering methods include, but are not limited to, rational design and various types of selection. Rational design includes, for example, using databases comprising triplet (or quadruplet) nucleotide sequences and individual zinc finger amino acid sequences, in which each triplet or quadruplet nucleotide sequence is associated with one or more amino acid sequences of zinc fingers which bind the particular triplet or quadruplet sequence. See, for example, co10 owned U.S. Patents 6,453,242 and 6,534,261. Additional design methods are disclosed, for example, in U.S. Patents 6,746,838; 6,785,613; 6,866,997; and 7,030,215. · · [0099] Exemplary selection methods, including phage display and two-hybrid systems, are disclosed in US Patents 5,789,538; 5,925,523; 6,007,988; 6,013,453;
6,410,248; 6,140;466; 6,200,759; and 6,242,568; as well as WO 98/37186;
WO 98/53057; WO 00/27878; WO 01/88197 and GB 2,338,237.
[0100] Enhancement of binding specificity for zinc finger binding domains has been described, for example, in co-owned US Patent No. 6,794,136.
[0101] Since an individual zinc finger binds to a three-nucleotide (i.e., triplet) sequence (or a four-nucleotide sequence which can overlap, by one nucleotide, with the four-nucleotide binding site of an adjacent zinc finger), the length of a sequence to which a zinc finger binding domain is engineered to bind (e.g., a target sequence) will determine the number of zinc fingers in an engineered zinc finger binding domain.
For example, for ZFPs in which the finger motifs do not bind to overlapping subsites, a six-nucleotide target sequence is bound by a two-finger binding domain; a ninenucleotide target sequence is bound by a three-finger binding domain, etc. As noted herein, binding sites for individual zinc fingers (i.e., subsites) in a target site need not be contiguous, but can be separated by one or several nucleotides, depending on the length and nature of the amino acids sequences between the zinc fingers (i.e., the inter-finger linkers) in a multi-finger binding domain.
[0102] In a multi-finger zinc finger binding domain, adjacent zinc fingers can be separated by amino acid linker sequences of approximately 5 amino acids (socalled “canonical” inter-finger linkers) or, alternatively, by one or more non-canonical linkers. See, e.g., co-owned US Patent Nos. 6,453,242 and 6,534,261. For
2017200511 25 Jan 2017 engineered zinc finger binding domains comprising more than three fingers, insertion of longer (“non-canonical”) inter-finger linkers between certain of the zinc fingers may be preferred as it may increase the affinity and/or specificity of binding by the binding domain. See, for example, U.S. Patent No. 6,479,626 and WO 01/53480,
Accordingly, multi-finger zinc finger binding domains can also be characterized with respect to the presence and location of non-canonical inter-finger linkers. For example, a six-finger zinc finger binding domain comprising three fingers (joined by two canonical inter-finger linkers), a long linker and three additional fingers (joined by two canonical inter-finger linkers) is denoted a 2x3 configuration. Similarly, a binding domain comprising two fingers (with a canonical linker therebetween), a long linker and two additional fingers (joined by a canonical linker) is denoted a 2x2 protein. A protein comprising three two-finger units (in each of which the two fingers are joined by a canonical linker), and in which each two-finger unit is joined to the adjacent two finger unit by a long linker, is referred to as a 3x2 protein.
[0103] The presence of a long or non-canonical inter-finger linker between two adjacent zinc fingers in a multi-finger binding domain often allows the two fingers to bind to subsites which are not immediately contiguous in the target sequence. Accordingly, there can be gaps of one or more nucleotides between subsites in a target site; i.e., a target site can contain one or more nucleotides that are not contacted by a zinc finger. For example, a 2x2 zinc finger binding domain can bind to two six-nucleotide sequences separated by one nucleotide, i.e., it binds to a 13-nucleotide target site. See also Moore et al. (2001a) Proc. Natl. Acad. Sci. USA 98:1432-1436; Moore et al. (2001b) Proc. Natl. Acad. Sci. USA 98:1437-1441 and WO 01/53480. ' , [0104] As mentioned previously, a target subsite is a three- or four-nucleotide sequence that is bound by a single zinc finger. For certain purposes, a two-finger unit is denoted a binding module. A binding module can be obtained by, for example, selecting for two adjacent fingers in the context of a multi-finger protein (generally three fingers) which bind a particular six-nucleotide target sequence. Alternatively, modules can be constructed by assembly of individual zinc fingers. See also WO 98/53057 and WO 01/53480.
[0105] In one embodiment, described herein is a zinc finger binding domain comprising an amino acid sequence as shown in Table 1. In another embodiment, the disclosure provides a polynucleotide encoding a zinc finger binding domain, wherein
2017200511 25 Jan 2017 the zinc finger binding domain comprises an amino acid sequence as shown in Table 1, [0106] Alternatively, the DNA-binding domain may be derived from a nuclease. For example, the recognition sequences of homing endonucleases and meganucleases such as VScel, l-Ceul, Pl-Pspl, Pl-Sce, 1-SceTV, l-Csml, l-Panl, 1Scell, l-Ppol, 1-Scelll, 1-Crel, l-Tevl, Ϊ-Tevll and I-7evIII are known. See also U.S. Patent No. 5,420,032; U.S. Patent No. 6,833,252; Belfort et al. (1997) Nucleic Acids Res, 25:3379-3388; Dujone/aZ. (1989) Gene 82:115-118; PerlereiaZ. (1994) Nucleic Acids Res. 22, 1125-1127; Jasin (1996) Trends Genet. 12:224-228; Gimble et al. (1996) J. Mol. Biol. 263:163-180; Argast et al. (1998) J. Mol. Biol. 280:345353 and the New England Biolabs catalogue. In addition, the DNA-binding specificity of homing endonucleases and meganucleases can be engineered to bind non-natural target sites. See, for example, Chevalier et al. (2002) Molec. Cell 10:895905; Epinat et al. (2003) Nucleic Acids Res. 31:2952-2962; Ashworth et al. (2006)
Nature 441:656-659; Paques et al. (2007) Current Gene Therapy 7:49-66; U.S. Patent Publication No. 20070117128.
[0107] In other embodiments, the DNA-binding domain comprises a naturally occurring or engineered (non-naturally occurring) TAL effector DNA binding domain. The plant pathogenic bacteria of the genus Xanthomonas are known to cause many diseases in important crop plants. Pathogenicity of Xanthomonas depends on a conserved type III secretion (T3S) system which injects more than 25 different effector proteins into the plant cell. Among these injected proteins are transcription activator-like (TAL) effectors which mimic plant transcriptional activators and manipulate the plant transcriptome (see Kay et al (2007) Science 318:648-651).
These proteins contain a DNA binding domain and a transcriptional activation domain. One of the most well characterized TAL-effectors is AvrBs3 from Xanthomonas campestgris pv. Vesicatoria (see Bonas et al (1989) Mol Gen Genet 218: 127-136 and W02010079430). TAL-effectors contain a centralized domain of tandem repeats, each repeat containing approximately 34 amino acids, which are key to the DNA binding specificity of these proteins. In addition, they contain a nuclear localization sequence and an acidic transcriptional activation domain (for a review see Schomack S, et al (2006) J Plant Physiol 163(3): 256-272). In addition, in the phytopathogenic bacteria Ralstonia solanacearum two genes, designated brgll and hpxl7 have been found that are homologous to the AvrBs3 family of Xanthomonas in
2017200511 25 Jan 2017 the R. solanacearum biovar 1 strain GMI1000 and in the biovar 4 strain RSI000 (See Heuer et al (2007) Appl andEnvir Micro 73(13): 4379-4384). These genes are 98.9% identical in nucleotide sequence to each other but differ by a deletion of 1,575 bp in the repeat domain of hpxl7. However, both gene products have less than 40% sequence identity with AvrBs3 family proteins of Xanthomonas.
[0108] Specificity of these TAL effectors depends on the sequences found in the tandem repeats. The repeated sequence comprises approximately 102 bp and the repeats are typically 91-100% homologous with each other (Bonas et al, ibid). Polymorphism of the repeats is usually located at,positions 12 and 13 and there appears to be a one-to-one correspondence between the identity of the hypervariable diresidues at positions 12 and 13 with the identity of the contiguous nucleotides in the TAL-effector’s target sequence (see Moscou and Bogdanove, (2009) Science 326:1501 and Boch et al (2009) Science 326:1509-1512). Experimentally, the natural code for DNA recognition of these TAL-effectors has been determined such that an
HD sequence at positions 12 and 13 leads to a binding to cytosine (C), NG binds to T, NI to A, C, G or T, NN binds to A or G, and ING binds to T. These DNA binding repeats have been assembled into proteins with new combinations and numbers of repeats, to make artificial transcription factors that are able to interact with new sequences and activate the expression of a non-endogenous reporter gene in plant cells (Boch et al, ibid). Engineered TAL proteins have been linked to a Fokl cleavage half domain to yield a TAL effector domain nuclease fusion (TALEN) exhibiting activity in a yeast reporter assay (plasmid based target). Christian et al ((2010) Genetics epub 10.1534/genetics.ll0,120717).
Regulatory domains [0109] The DNA-binding domains (e.g., ZFPs) described herein can optionally be associated with regulatory domains for modulation of gene expression. The ZFP can be covalently or non-covalently associated with one or more regulatory domains, alternatively two or more regulatory domains, with the two or more domains being two copies of the same domain, or two different domains. The regulatory domains can be covalently linked to the ZFP, e.g., via an amino acid linker, as part of a fusion protein. The ZFPs can also be associated with a regulatory domain via a noncovalent dimerization domain, e.g., a leucine zipper, a STAT protein N terminal domain, or an FK506 binding protein (see, e.g., O'Shea, Science 254: 539 (1991),
2017200511 25 Jan 2017
Barahmand-Pour et al, Curr. Top. Microbiol. Immunol. 211:121-128 (1996); Klemm et al., Annu. Rev. Immunol. 16:569-592 (1998); Klemm et al., Anna. Rev. Immunol. 16:569-592 (1998); Ho et al., Nature 382:822-826 (1996); and Pomeranz et al., Biochem. 37:965 (1998)). The regulatory domain can be associated with the ZFP at any suitable position, including the C- or N-terminus of the ZFP.
[0110] Common regulatory domains for addition to the ZFP include, e.g., effector domains from transcription factors (activators, repressors, co-activators, corepressors), silencers, nuclear hormone receptors, oncogene transcription factors (e.g., myc, jun, fos, myb, max, mad, rel, ets, bcl, myb, mos family members etc.); DNA repair enzymes and their associated factors and modifiers; DNA rearrangement enzymes and their associated factors and modifiers; chromatin associated proteins and their modifiers (e.g., kinases, acetylases and deacetylases); and DNA modifying enzymes (e.g., methyltransferases, topoisomerases, helicases, ligases, kinases, phosphatases, polymerases, endonucleases) and their associated factors and modifiers.
[0111] Transcription factor polypeptides from which one can obtain a regulatory domain include those that are involved in regulated and basal transcription. Such polypeptides include transcription factors, their effector domains, coactivators, silencers, nuclear hormone receptors (see, e.g., Goodrich et al., Cell 84:825-30 (1996) for a review of proteins and nucleic acid elements involved in transcription;
transcription factors in general are reviewed in Bames and Adcock, Clin. Exp. Allergy 25 Suppl. 2:46-9 (1995) and Roeder, Methods Enzymol. 273:165-71(1996)). Nuclear hormone receptor transcription factors are described in, for example, Rosen et al., J Med. Chem. 38:4855-74 (1995). The C/EBP family of transcription factors are reviewed in Wedel et al., Immunobiology 193:171-85 (1995). Coactivators and co25 repressors that mediate transcription regulation by nuclear hormone receptors are reviewed in, for example, Meier, Eur. J Endocrinol. 134(2):158-9 (1996); Kaiser et al., Trends Biochem. Sci, 21:342-5 (1996); and Utley et al., Nature 394:498-502 (1998)). GATA transcription factors, which are involved in regulation of hematopoiesis, are described in, for example, Simon, Nat. Genet. 11:9-11 (1995);
Weiss et al., Exp. Hematol. 23:99-107. TATA box binding protein (TBP) and its associated TAP polypeptides (which include TAF30, TAF55, TAF80, TAF 10, TAFI 50, and TAF250) are described in Goodrich and Tjian, Curr. Opin. Cell Biol. 6:403-9 (1994) and Hurley, Curr. Opin. Struct. Biol, 6:69-75 (1996). The STAT family of transcription factors are reviewed in, for example, Barahmand-Pour et al., Curr. Top,
2017200511 25 Jan 2017
Microbiol. Immunol. 211:121-8 (1996). Transcription factors involved in disease are reviewed in Aso et al., J Clin. Invest. 97:1561-9 (1996).
' [0112] In one embodiment, the KRAB repression domain from the human
KOX-1 protein is used as a transcriptional repressor (Thiesen et al., New Biologist
2:363-374 (1990); Margolin et al., Proc. Natl. Acad. Sci USA 91:4509-4513 (1994);
Pengue et al., Nucl. Acids Res. 22:2908-2914 (1994); Witzgall et al., Proc. Natl. Acad. Sci USA 91:4514-4518 (1994)). In another embodiment, KAP-1, a KRAB corepressor, is used with KRAB (Friedman et al., Genes Dev. 10:2067-2078 (1996)). Alternatively, KAP-1 can be used alone with a ZFP, Other preferred transcription factors and transcription factor domains that act as transcriptional repressors include MAD (see, e.g., Sommer et al., J. Biol. Chem. 273:6632-6642 (1998); Gupta et al., Oncogene 16:1149-1159 (1998); Queva et al., Oncogene 16:967-977 (1998); Larsson et al., Oncogene 15:737-748 (1997); Laherty et al., Cell 89:349-356 (1997); and Cultraro et al, Mol Cell. Biol. 17:2353-2359 (19977)); FKHR (forkhead in rhapdosarcoma gene; Ginsberg et al., Cancer Res. 15:3542-3546 (1998); Epstein et al, Mol, Cell. Biol. 18:4118-4130 (1998)); EGR-1 (early growth response gene product-1; Yan et al., Proc. Natl. Acad. Sci USA 95:8298-8303 (1998); and Liu et al., Cancer Gene Ther. 5:3-28 (1998)); the ets2 repressor factor repressor domain (ERD; Sgouras et al., EMBO J 14:4781-4793 ((19095)); the MAD smSIN3 interaction domain (SID; Ayer et al., Mol. Cell. Biol. 16:5772-5781 (1996)); and the ERF3 (ethylene response factor-3) amphiphilic repression domain, EAR (Ohta, M., et al. (2001), Plant Cell 13:1959-1968).
[0113] In one embodiment, the HSV VP16 activation domain is used as a transcriptional activator (see, e.g., Hagmann et al., J. Virol. 71:5952-5962 (1997)).
Other preferred transcription factors that could supply activation domains include the VP64 activation domain (Seipel et al., EMBO J. 11:4961-4968 (1996)); nuclear hormone receptors (see, e.g,, Torchia et al., Curr. Opin. Cell. Biol. 10:373-383 (1998)); the p65 subunit of nuclear factor kappa B (Bitko and Barik, J. Virol. 72:5610-5618 (1998) and Doyle and Hunt, Neuroreport 8:2937-2942 (1997)); EGR-1 (early growth response gene product-1; Yan et al., Proc. Natl. Acad. Sci USA 95:8298-8303 (1998); and Liu etal., Cancer Gene Ther. 5:3-28 (1998)); and the maize anthocyanin biosynthetic pathway regulatory protein, Cl (S.A. Goff, et al,, (1991), Genetics and Development 5:298-309).
2017200511 25 Jan 2017 [0114] Kinases, phosphatases, and other proteins that modify polypeptides involved in gene regulation are also useful as regulatory domains for ZFPs. Such modifiers are often involved in switching on or off transcription mediated by, for example, hormones. Kinases involved in transcriptional regulation are reviewed in
Davis, Mol. Reprod. Dev. 42:459-67 (1995), Jackson et al., Adv. Second Messenger PhosphoproteinRes. 28:279-86 (1993), and Boulikas, Crit. Rev. Eukaryot. Gene Expr. 5:1-77 (1995), while phosphatases are reviewed in, for example, Schonthal and Semin, Cancer Biol. 6:239-48 (1995). Nuclear tyrosine kinases are described in Wang, Trends Biochem. Sci. 19:373-6 (1994).
[0115] As described, useful domains can also be obtained from the gene products of oncogenes (e.g., myc, jun, fos, myb, max, mad, rel, ets, bcl, .myb, mos family members) and their associated factors and modifiers. Oncogenes are described in, for example, Cooper, Oncogenes, 2nd ed., The Jones and Bartlett Series in Biology, Boston, Mass., Jones and Bartlett Publishers, 1995. The ets transcription factors are reviewed in Waslylk et al., Eur. J. Biochem. 211:7-18 (1993) and Crepieux etal., Crit, Rev. Oncog. 5:615-38 (1994). Myc oncogenes are reviewed in, for example, Ryan et al., Biochem. J. 314:713-21 (1996). The jun and fos transcription factors are described in, for example, The Fos and Jun Families of Transcription Factors, Angel and Herrlich, eds. (1994). The max oncogene is reviewed in Hurlin et al., Cold Spring Harb. Symp. Quant. Biol. 59:109-16. The myb gene family is reviewed in Kanei-Ishii et al., Curr. Top. Microbiol. Immunol. 211:89-98 (1996). The mos family is reviewed in Yew et al., Curr. Opin. Genet. Dev. 3:19-25 (1993).
[0116] ZFPs can include regulatory domains obtained from DNA repair enzymes and their associated factors and modifiers. DNA repair systems are reviewed in, for example, Vos, Curr. Opin. Cell Biol. 4:385-95 (1992); Sancar, Ann. Rev. Genet. 29:69-105 (1995); Lehmann, Genet. Eng. 17:1-19 (1995); and Wood,
Ann. Rev. Biochem. 65:135-67 (1996). DNA rearrangement enzymes and their associated factors and modifiers can also be used as regulatory domains (see, e.g., Gangloff et al., Experientia 50:261-9 (1994); Sadowski, FASEBJ. 7:760-7 (1993)).
[0117] Similarly, regulatory domains can be derived from DNA modifying enzymes (e.g., DNA methyltransferases, topoisomerases, helicases, ligases, kinases, phosphatases, polymerases) and their associated factors and modifiers. Helicases are reviewed in Matson et al., Bioessays, 16:13-22 (1994), and methyltransferases are described in Cheng, Curr. Opin. Struct. Biol. 5:4-10 (1995). Chromatin associated
2017200511 25 Jan 2017 proteins and their modifiers (e.g., kinases, acetylases and deacetylases), such as histone deacetylase (Wolffe, Science 272:371-2 (1996)) are also useful as domains for addition to the ZFP of choice. In one preferred embodiment, the regulatory domain is a DNA methyl transferase that acts as a transcriptional repressor (see, e.g., Van den
Wyngaert et al., FEBSLett. 426:283-289 (1998); Flynn et al., J. Mol. Biol, 279:101116 (1998); Okano et al., Nucleic Acids Res. 26:2536-2540 (1998); and Zardo and Caiafa, J. Biol, Chem. 273:16517-16520 (1998)). In another preferred embodiment, endonucleases such as Fokl are used as transcriptional repressors, which act via gene cleavage (see, e.g., WO95/09233; and PCT/US94/01201).
[0118] Factors that control chromatin and DNA structure, movement and localization and their associated factors and modifiers; factors derived from microbes (e.g., prokaryotes, eukaryotes and virus) and factors that associate with or modify them can also be used to obtain chimeric proteins. In one embodiment, recombinases and integrases are used as regulatory domains. In one embodiment, histone acetyltransferase is used as a transcriptional activator (see, e.g., Jin and Scotto, Mol. Cell. Biol. 18:4377-4384 (1998); Wolffe, Science 272:371-372 (1996); Taunton et al,, Science 272:408-411 (1996); and Hassig etal., Proc. Natl. Acad. Sci USA 95:35193524 (1998)). In another embodiment, histone deacetylase is used as a transcriptional repressor (see, e.g., Jin and Scotto, Mol. Cell. Biol. 18:4377-4384 (1998); Syntichaki and Thireos, J. Biol. Chem. 273:24414-24419 (1998); Sakaguchi et al,, Genes Dev. 12:2831-2841 (1998); and Martinez et al,J, Biol. Chem. 273:23781-23785 (1998)). [0119] Linker domains between polypeptide domains, e.g., between two ZFPs or between a ZFP and a regulatory domain, can be included. Such linkers are typically polypeptide sequences, such as poly gly sequences of between about 5 and 200 amino acids. Linkers can be flexible or rigid amino acid subsequences which are synthesized as part of a recombinant fusion protein. See, e.g., U.S. Patent No. 6,534,261; Liu etal., Proc. Nat. Acad. Sci. USA, 95:5525-5530 (1997); Pomerantz et al., Proc. Nat. Acad. Sci. USA 92:9752-9756 (1995); Kim et al., Proc. Nat. Acad. Sci. USA 93:1156-1160 (1996); herein incorporated by reference in their entireties.
Alternatively, flexible linkers can be rationally designed using computer program capable of modeling both DNA-binding sites and the peptides themselves (Desjarlais and Berg, Proc. Nat. Acad. Sci. USA 90:2256-2260 (1993), Desjarlais and Berg, Proc. Nat. Acad. Sci. USA 91:11099-11103 (1994) or by phage display methods.
2017200511 25 Jan 2017 [0120] In other embodiments, a chemical linker is used to connect synthetically or recombinantly produced domain sequences. Such flexible linkers are known to persons of skill in the art. For example, polyethylene glycol) linkers are available from Shearwater Polymers, Inc. Huntsville, Ala. These linkers optionally have amide linkages, sulfhydryl linkages, or heterofunctional linkages. In addition to covalent linkage of ZFPs to regulatory domains, non-covalent methods can be used to produce molecules with ZFPs associated with regulatory domains.
Cleavage domains [0121] As noted above, the DNA-binding domain may also be associated with a cleavage (nuclease) domain. For example, homing endonucleases may be modified in their DNA-binding specificity while retaining nuclease function. In addition, zinc finger proteins may also be fused to a cleavage domain to form a zinc finger nuclease (ZFN). The cleavage domain portion of the fusion proteins disclosed herein can be obtained from any endonuclease or exonuclease. Exemplary endonucleases from which a cleavage domain can be derived include, but are not limited to, restriction endonucleases and homing endonucleases. See, for example, 2002-2003 Catalogue, New England Biolabs, Beverly, MA; and Belfort etal. (1997) Nucleic Acids Res. 25:3379-3388. Additional enzymes which cleave DNA are known (e.g., SI Nuclease;
mung bean nuclease; pancreatic DNase I; micrococcal nuclease; yeast HO endonuclease; see also Linn et al. (eds.) Nucleases, Cold Spring Harbor Laboratory Press, 1993). One or more of these enzymes (or functional fragments thereof) can be used as a source of cleavage domains and cleavage half-domains.
[0122] Similarly, a cleavage half-domain can be derived from any nuclease or portion thereof, as set forth above, that requires dimerization for cleavage activity. In general, two fusion proteins are required for cleavage if the fusion proteins comprise cleavage half-domains. Alternatively, a single protein comprising two cleavage halfdomains can be used. The two cleavage half-domains can be derived from the same endonuclease (or functional fragments thereof), or'each cleavage half-domain can be derived from a different endonuclease (or functional fragments thereof). In addition, the target sites for the two fusion proteins are preferably disposed, with respect to each other, such that binding of the two fusion proteins to their respective target sites places the cleavage half-domains in a spatial orientation to each other that allows the cleavage half-domains to form a functional cleavage domain, e.g., by dimerizing.
2017200511 25 Jan 2017
Thus, in certain embodiments, the near edges of the target sites are separated by 5-8 nucleotides or by 15-18 nucleotides. However any integral number of nucleotides or nucleotide pairs can intervene between two target sites (e.g., from 2 to 50 nucleotide pairs or more). In general, the site of cleavage lies between the target sites.
[0123] Restriction endonucleases (restriction enzymes) are present in many species and are capable of sequence-specific binding to DNA (at a recognition site), and cleaving DNA at or near the site of binding. Certain restriction enzymes (e.g., Type IIS) cleave DNA at sites removed from the recognition site and have separable binding and cleavage domains. For example, the Type IIS enzyme Fok I catalyzes double-stranded cleavage of DNA, at 9 nucleotides from its recognition site on one strand and 13 nucleotides from its recognition site on the other. See, for example, US Patents 5,356,802; 5,436,150 and 5,487,994; as well as Li et al. (1992) Proc. Natl. Acad. Sci. USA 89:4275-4279; Li et al. (1993) Proc. Natl. Acad. Sci. USA 90:27642768; KimeZa/. (1994a) Proc. Natl. Acad. Sci. USA 91:883-887; Kim etal. (1994b)
J, Biol. Chem. 269:31,978-31,982. Thus, in one embodiment, fusion proteins comprise the cleavage domain (or cleavage half-domain) from at least one Type IIS restriction enzyme and one or more zinc finger binding domains, which may or may not be engineered.
[0124] An exemplary Type IIS restriction enzyme, whose cleavage domain is separable from the binding domain, is Fok I. This particular enzyme is active as a dimer. Bitinaite et al, (1998) Proc. Natl. Acad. Sci. USA 95: 10,570-10,575. Accordingly, for the purposes of the present disclosure, the portion of the Fok I enzyme used in the disclosed fusion proteins is considered a cleavage half-domain. Thus, for targeted double-stranded cleavage and/or targeted replacement of cellular sequences using zinc finger-FoA I fusions, two fusion proteins, each comprising a Fokl cleavage half-domain, can be used to reconstitute a catalytically active cleavage domain. Alternatively, a single polypeptide molecule containing a zinc finger binding domain and two Fok I cleavage half-domains can also be used. Parameters for targeted cleavage and targeted sequence alteration using zinc finger-Fok I fusions are provided elsewhere in this disclosure.
[0125] A cleavage domain or cleavage half-domain can be any portion of a protein that retains cleavage activity, or that retains the ability to multimerize (e.g., dimerize) to form a functional cleavage domain.
2017200511 25 Jan 2017 [0126] Exemplary Type IIS restriction enzymes are described in International
Publication WO 07/014275, incorporated herein in its entirety. Additional restriction enzymes also contain separable binding and cleavage domains, and these are contemplated by the present disclosure. See, for example, Roberts et al. (2003)
Nucleic Acids Res. 31:418-420.
[0127] In certain embodiments, the cleavage domain comprises one or more engineered cleavage half-domain (also referred to as dimerization domain mutants) that minimize or prevent homodimerization, as described, for example, in U.S. Patent Publication Nos. 20050064474; 20060188987; 20080131962, the disclosures of all of which are incorporated by reference in their entireties herein. Amino acid residues at positions 446, 447,479,483, 484,486, 487, 490, 491, 496, 498, 499, 500, 531, 534, 537, and 538 of Fok I are all targets for influencing dimerization of the Fok I cleavage half-domains.
[0128] Exemplary engineered cleavage half-domains of Fok I that form obligate heterodimers include a pair in which a first cleavage half-domain includes mutations at amino acid residues at positions 490 and 538 of Fokl and a second cleavage half-domain includes mutations at amino acid residues 486 and 499.
[0129] Thus, in certain embodiments, the mutation at 490 replaces Glu (E) with Lys (K); the mutation at 538 replaces Iso (I) with Lys (K); the mutation at 486 replaced Gln (Q) with Glu (E); and the mutation at position 499 replaces Iso (I) with Lys (K). Specifically, the engineered cleavage half-domains described herein were prepared by mutating positions 490 (E—>K) and 538 (I—+K) in one cleavage halfdomain to produce an engineered cleavage half-domain designated “E490K:I538K” and by mutating positions 486 (Q—>E) and 499 (I—+L) in another cleavage half25 domain to produce an engineered cleavage half-domain designated “Q486E:I499L”. The engineered cleavage half-domains described herein are obligate heterodimer mutants in which aberrant cleavage is minimized or abolished. See, e.g., Example 1 of U.S. Patent Publication No. 2008/0131962, the disclosure of which is incorporated by reference in its entirety for all purposes. See, also, Szczepek et al. (2007) Nat
Biotechnol 25:786-793. In certain embodiments, the engineered cleavage half-domain comprises mutations at positions 486, 499 and 496 (numbered relative to wild-type Fokl), for instance mutations that replace the wild type Gln (Q) residue at position 486 with a Glu (E) residue, the wild type Iso (I) residue at position 499 with a Leu (L) residue and the wild-type Asn (N) residue at position 496 with an Asp (D) or Glu (E)
2017200511 25 Jan 2017 residue (also referred to as a “ELD” and “ELE” domains, respectively). In other embodiments, the engineered cleavage half-domain comprises mutations at positions 490, 538 and 537 (numbered relative to wild-type FokT), for instance mutations that replace the wild type Glu (E) residue at position 490 with a Lys (K) residue, the wild type Iso (I) residue at position 538 with a Lys (K) residue, and the wild-type His (H) residue at position 537 with a Lys (K) residue or a Arg (R) residue (also referred to as “KKK” and “KKR” domains, respectively). In other embodiments, the engineered cleavage half-domain comprises mutations at positions 490 and 537 (numbered relative to wild-type FokI), for instance mutations that replace the wild type Glu (E) residue at position 490 with a Lys (K) residue and the wild-type His (H) residue at position 537 with a Lys (K) residue or a Arg (R) residue (also referred to as “KIK” and “KIR” domains, respectively). (See US provisional application 61/337,769 filed ' February 8, 2010). In other embodiments, the engineered cleavage half domain comprises the “Sharkey” and/or “Sharkey’ ” mutations (see Guo et al, (2010) J. Mol.
Biol, doi: 10.1016/j.jmb.2OI0.04.060).
[0130] Engineered cleavage half-domains described herein can be prepared using any suitable method, for example, by site-directed mutagenesis of wild-type cleavage half-domains (FokT) as described in U.S. Patent Publication Nos. 20050064474 and 20080131962.
[0131] Another preferred Type IIS restriction enzyme is Bill (see Zaremba e/ al, (2004) J. Mol Biol. 336(1):81-92). The cleavage domain of this enzyme maybe separated from its DNA binding domain and operably linked to a zinc finger DNA binding domain to create a ZFN.
Fusion proteins [0132] Methods for design and construction of fusion proteins (and polynucleotides encoding same) are known to those of skill in the art. For example, methods for the design and construction of fusion proteins comprising DNA-binding domains (e.g., zinc finger domains) and regulatory or cleavage domains (or cleavage half-domains), and polynucleotides encoding such fusion proteins, are described in co-owned U.S. Patents 6,453,242 and 6,534,261 and U.S. Patent Application Publications 2007/0134796 and 2005/0064474; herein incorporated by reference in their entireties.
2017200511 25 Jan 2017 [0133] In certain embodiments, polynucleotides encoding the fusion proteins are constructed. These polynucleotides can be inserted into a vector and the vector can be introduced into a cell (see below for additional disclosure regarding vectors and methods for introducing polynucleotides into cells).
[0134] As noted above, in certain embodiments, the fusion protein comprises a zinc finger protein that binds to a target site in a gene involved in fatty acid biosynthesis and at least one transcriptional regulatory domain, for example an activation or repression domain.
[0135] In other embodiments of the methods described herein, a zinc finger nuclease comprises a fusion protein comprising a zinc finger binding domain and a cleavage half-domain from the Fok I restriction enzyme, and two such fusion proteins are expressed in a cell. Expression of two fusion proteins in a cell can result from delivery of the two proteins to the cell; delivery of one protein and one nucleic acid encoding one of the proteins to the cell; delivery of two nucleic acids, each encoding one of the proteins, to the cell; or by delivery of a single nucleic acid, encoding both proteins, to the cell. In additional embodiments, a fusion protein comprises a single polypeptide chain comprising two cleavage half domains and a zinc finger binding domain. In this case, a single fusion protein is expressed in a cell and, without wishing to be bound by theory, is believed to cleave DNA as a result of formation of an intramolecular dimer of the cleavage half-domains.
[0136] In certain embodiments, the components of the zinc finger nucleases (e.g., ZFP-Fok I fusions) are arranged such that the zinc finger domain is nearest the amino terminus of the fusion protein, and the cleavage half-domain is nearest the carboxy-terminus. This mirrors the relative orientation of the cleavage domain in naturally-occurring dimerizing cleavage domains such as those derived from the Fok I enzyme, in which the DNA-binding domain is nearest the amino terminus and the cleavage half-domain is nearest the carboxy terminus. In these embodiments, dimerization of the cleavage half-domains to form a functional nuclease is brought about by binding of the fusion proteins to sites on opposite DNA strands, with the 5’ ends of the binding sites being proximal to each other.
[0137] In additional embodiments, the components of the fusion proteins (e.g.,
ZFP-FoA: I fusions) are arranged such that the cleavage half-domain is nearest the amino terminus of the fusion protein, and the zinc finger domain is nearest the carboxy-terminus. In these embodiments, dimerization of the cleavage half-domains
2017200511 25 Jan 2017 to form a functional nuclease is brought about by binding of the fusion proteins to sites on opposite DNA strands, with the 3’ ends of the binding sites being proximal to each other.
[0138] In yet additional embodiments, a first fusion protein contains the cleavage half-domain nearest the amino terminus of the fusion protein, and the zinc finger domain nearest the carboxy-terminus, and a second fusion protein is arranged such that the zinc finger domain is nearest the amino terminus of the fusion protein, and the cleavage half-domain is nearest the carboxy-terminus. In these embodiments, both fusion proteins bind to the same DNA strand, with the binding site of the first fusion protein containing the zinc finger domain nearest the carboxy terminus located to the 5’ side of the binding site of the second fusion protein containing the zinc finger domain nearest the amino terminus.
[0139] In certain embodiments, the disclosed fusion proteins the amino acid sequence between the zinc finger domain and the cleavage domain (or cleavage half15 domain) is denoted the “ZC linker.” The ZC linker is to be distinguished from the inter-finger linkers discussed above. See, e.g., U.S. Patent Publications 20050064474A1 and 20030232410, and International Patent Publication W005/084190, for details on obtaining ZC linkers that optimize cleavage.
[0140] In one embodiment, the disclosure provides a ZFN comprising a zinc finger protein having the recognition helix amino acid sequences shown in Table 1 or Table 10. In another embodiment, provided herein is a ZFN expression vector comprising a nucleotide sequence encoding a ZFP having the recognition helices shown in Table 1 or Table 10.
Regulation of Gene Expression [0141] A variety of assays can be used to determine whether a ZFP modulates gene expression. The activity of a particular ZFP can be assessed using a variety of in vitro and in vivo assays, by measuring, e.g., protein or mRNA levels, product levels, enzyme activity; transcriptional activation or repression of a reporter gene, using, e.g,, immunoassays (e.g., ELISA and immunohistochemical assays with antibodies), hybridization assays (e.g., RNase protection, northerns, in situ hybridization, oligonucleotide array studies), colorimetric assays, amplification assays, enzyme activity assays, phenotypic assays, and the like.
2017200511 25 Jan 2017 [0142] ZFPs are typically first tested for activity in vitro using ELISA assays and then using kidney cells. The ZFP is often first tested using a transient expression system with a reporter gene, and then regulation of the target endogenous gene is tested in cells and in whole plants, both in vivo and ex vivo. The ZFP can be recombinantly expressed in a cell, recombinantly expressed in cells transplanted into a plant, or recombinantly expressed in a transgenic plant, as well as administered as a protein to plant or cell using delivery vehicles described below. The cells can be immobilized, be in solution, be injected into a plant, or be naturally occurring in a transgenic or non-transgenic plant.
[0143] Modulation of gene expression is tested using one of the in vitro or in vivo assays described herein. Samples or assays are treated with a ZFP and compared to control samples without the test compound, to examine the extent of modulation. For regulation of endogenous gene expression, the ZFP typically has a IQ of200 nM or less, more preferably 100 nM or less, more preferably 50 nM, most preferably 25 nM or less.
[0144] The effects of the ZFPs can be measured by examining any of the parameters described above. Any suitable gene expression, phenotypic, or physiological change can be used to assess the influence of a ZFP. When the ' functional consequences are determined using intact cells or plants, one can also measure a variety of effects such as plant growth, transcriptional changes to both known and uncharacterized genetic markers (e.g., northern blots or oligonucleotide array studies), changes in cell metabolism such as cell growth or pH changes, and changes in intracellular second messengers such as cGMP. .
[0145] Preferred assays for ZFP regulation of endogenous gene expression can be performed in vitro. In one preferred in vitro assay format, ZFP regulation of endogenous gene expression in cultured cells is measured by examining protein production using an ELISA assay. The test sample is compared to control cells treated with an empty vector or an unrelated ZFP that is targeted to another gene.
[0146] In another embodiment, ZFP regulation of endogenous gene expression is determined in vitro by measuring the level of target gene mRNA expression. The level of gene expression is measured using amplification, e.g., using PCR, LCR, or hybridization assays, e.g., northern hybridization, RNase protection, dot blotting. RNase protection is used in one embodiment. The level of protein or mRNA is detected using directly or indirectly labeled detection agents, e.g.,
2017200511 25 Jan 2017 fluorescently or radioactively labeled nucleic acids, radioactively or enzymatically labeled antibodies, and the like, as described herein.
[0147] Alternatively, a reporter gene system can be devised using the target gene promoter operably linked to a reporter gene such as luciferase, green fluorescent protein, CAT, or β-gal. The reporter construct is typically co-transfected into a cultured cell. After treatment with the ZFP of choice, the amount of reporter gene transcription, translation, or activity is measured according to standard techniques known to those of skill in the art.
[0148] Transgenic and non-transgenic plants are also used as a preferred embodiment for examining regulation of endogenous gene expression in vivo.
Transgenic plants can stably express the ZFP of choice. Alternatively, plants that transiently express the ZFP of choice, or to which the ZFP has been administered in a delivery vehicle, can be used. Regulation of endogenous gene expression is tested using any one of the assays described herein.
Methods for targeted cleavage [0149] The disclosed methods and compositions can be used to cleave DNA at a region of interest in cellular chromatin (e.g., at a desired or predetermined site in a genome, for example, within or adjacent to a gene involved in fatty acid biosynthesis).
For such targeted DNA cleavage, a zinc finger binding domain is engineered to bind a target site at or near the predetermined cleavage site, and a fusion protein comprising the engineered zinc finger binding domain and a cleavage domain is expressed in a cell. Upon binding of the zinc finger portion of the fusion protein to the target site, the DNA is cleaved near the target site by the cleavage domain. The exact site of cleavage can depend on the length of the ZC linker.
[0150] Alternatively, two fusion proteins, each comprising a zinc finger binding domain and a cleavage half-domain, are expressed in a cell, and bind to target sites which are juxtaposed in such a way that a functional cleavage domain is reconstituted and DNA is cleaved in the vicinity of the target sites. In one embodiment, cleavage occurs between the target sites of the two zinc finger binding domains. One or both of the zinc finger binding domains can be engineered.
[0151] For targeted cleavage using a zinc finger binding domain-cleavage domain fusion polypeptide, the binding site can encompass the cleavage site, or the
2017200511 25 Jan 2017 near edge of the binding site can be 1, 2, 3, 4, 5, 6, 10, 25, 50 or more nucleotides (or any integral value between 1 and 50 nucleotides) from the cleavage site. The exact location of the binding site, with respect to the cleavage site, will depend upon the particular cleavage domain, and the length of the ZC linker. For methods in which two fusion polypeptides, each comprising a zinc finger binding domain and a cleavage half-domain, are used, the binding sites generally straddle the cleavage site. Thus the near edge of the first binding site can be 1, 2, 3,4, 5, 6,10, 25 or more nucleotides (or any integral value between 1 and 50 nucleotides) on one side of the cleavage site, and the near edge of the second binding site can be 1,2, 3,4, 5,6, 10,
25 or more nucleotides (or any integral value between 1 and 50 nucleotides) on the other side of the cleavage site. Methods for mapping cleavage sites in vitro and in vivo are known to those of skill in the art.
[0152] Thus, the methods described herein can employ an engineered zinc finger binding domain fused to a cleavage domain. In these cases, the binding domain is engineered to bind to a target sequence, at or near where cleavage is desired. The fusion protein, or a polynucleotide encoding same, is introduced into a plant cell.
Once introduced into, or expressed in, the cell, the fusion protein binds to the target sequence and cleaves at or near the target sequence. The exact site of cleavage depends on the nature of the cleavage domain and/or the presence and/or nature of linker sequences between the binding and cleavage domains. In cases where two fusion proteins, each comprising a cleavage half-domain, are used, the distance between the near edges of the binding sites can be 1, 2, 3, 4, 5, 6, 7, 8,9,10,25 or more nucleotides (or any integral value between 1 and 50 nucleotides). Optimal levels of cleavage can also depend on both the distance between the binding sites of the two fusion proteins (see, for example, Smith et al. (2000) Nucleic Acids Res.
28:3361-3369; Bibikova et al. (2001)W. Cell. Biol. 21:289-297) and the length of the ZC linker in each fusion protein. See, also, U.S. Patent Publication
20050064474A1 and International Patent Publications W005/084190, W005/014791 and W003/080809.
[0153] In certain embodiments, the cleavage domain comprises two cleavage half-domains, both of which are part of a single polypeptide comprising a binding domain, a first cleavage half-domain and a second cleavage half-domain. The cleavage half-domains can have the same amino acid sequence or different amino acid sequences, so long as they function to cleave the DNA.
2017200511 25 Jan 2017 [0154] Cleavage half-domains may also be provided in separate molecules.
For example, two fusion polypeptides may be introduced into a cell, wherein each polypeptide comprises a binding domain and a cleavage half-domain. The cleavage half-domains can have the same amino acid sequence or different amino acid sequences, so long as they function to cleave the DNA. Further, the binding domains bind to target sequences which are typically disposed in such a way that, upon binding of the fusion polypeptides, the two cleavage half-domains are presented in a spatial orientation to each other that allows reconstitution of a cleavage domain (e.g., by dimerization of the half-domains), thereby positioning the half-domains relative to each other to form a functional cleavage domain, resulting in cleavage of cellular chromatin in a region of interest. Generally, cleavage by the reconstituted cleavage domain occurs at a site located between the two target sequences. One or both of the proteins can be engineered to bind to its target site.
[0155] The two fusion proteins can bind in the region of interest in the same or opposite polarity, and their binding sites (i.e., target sites) can be separated by any number of nucleotides, e.g., from 0 to 200 nucleotides or any integral value therebetween. In certain embodiments, the binding sites for two fusion proteins, each comprising a zinc finger binding domain and a cleavage half-domain, can be located between 5 and 18 nucleotides apart, for example, 5-8 nucleotides apart, or 15-18 nucleotides apart, or 6 nucleotides apart, or 16 nucleotides apart, as measured from the edge of each binding site nearest the other binding site, and cleavage occurs between the binding sites.
[0156] The site at which the DNA is cleaved generally lies between the binding sites for the two fusion proteins. Double-strand breakage of DNA often results from two single-strand breaks, or “nicks,” offset by 1,2,3,4, 5, 6 or more nucleotides, (for example, cleavage of double-stranded DNA by native Fok I results from single-strand breaks offset by 4 nucleotides). Thus, cleavage does not necessarily occur at exactly opposite sites on each DNA strand. In addition, the structure of the fusion proteins and the distance between the target- sites can influence whether cleavage occurs adjacent a single nucleotide pair, or whether cleavage occurs at several sites. However, for many applications, including targeted recombination and targeted mutagenesis (see infra) cleavage within a range of nucleotides is generally sufficient, and cleavage between particular base pairs is not required.
2017200511 25 Jan 2017 [0157] As noted above, the fusion protein(s) can be introduced as polypeptides and/or polynucleotides. For example, two polynucleotides, each comprising sequences encoding one of the aforementioned polypeptides, can be introduced into a cell, and when the polypeptides are expressed and each binds to its target sequence, cleavage occurs at or near the target sequence. Alternatively, a single polynucleotide comprising sequences encoding both fusion polypeptides is introduced into a cell. Polynucleotides can be DNA, RNA or any modified forms or analogues or DNA and/or RNA.
[0158] To enhance cleavage specificity, additional compositions may also be employed in the methods described herein. For example, single cleavage halfdomains can exhibit limited double-stranded cleavage activity. In methods in which two fusion proteins, each containing a three-finger zinc finger domain and a cleavage half-domain, are introduced into the cell, either protein specifies an approximately 9nucleotide target site. Although the aggregate target sequence of 18 nucleotides is likely to be unique in a mammalian and plant genomes, any given 9-nucleotide target site occurs, on average, approximately 23,000 times in the human genome. Thus, non-specific cleavage, due to the site-specific binding of a single half-domain, may occur. Accordingly, the methods described herein contemplate the use of a dominantnegative mutant of a cleavage half-domain such as Fok I (or a nucleic acid encoding same) that is expressed in a cell along with the two fusion proteins. The dominantnegative mutant is capable of dimerizing but is unable to cleave, and also blocks the cleavage activity of a half-domain to which it is dimerized. By providing the dominant-negative mutant in molar excess to the fusion proteins, only regions in which both fusion proteins are bound will have a high enough local concentration of functional cleavage half-domains for dimerization and cleavage to occur. At sites where only one of the two fusion proteins is bound, its cleavage half-domain forms a dimer with the dominant negative mutant half-domain, and undesirable, non-specific cleavage does not occur.
Expression vectors [0159] A nucleic acid encoding one or more proteins (e.g., ZFPs) as described herein can be cloned into a vector for transformation into prokaryotic or eukaryotic cells for replication and/or expression. Vectors can be prokaryotic vectors, e.g., plasmids, or shuttle vectors, insect vectors, viral vectors, or eukaryotic vectors. A
2017200511 25 Jan 2017 nucleic acid encoding a ZFP can also be cloned into an expression vector, for administration to a plant cell.
[0160] To express the ZFPs, sequences encoding the ZFPs are typically subcloned into an expression vector that contains a promoter to direct transcription.
Suitable bacterial and eukaryotic promoters are well known in the art and described, e.g., in Sambrook et al., Molecular Cloning, A Laboratory Manual (2nd ed. 1989; 3rd ed., 2001); Kriegler, Gene Transfer and Expression: A Laboratory Manual Stockton Press, New York (1990); and Current Protocols in Molecular Biology (Ausubel et al., supra. Bacterial expression systems for expressing the ZFP are available in, e.g., E.
coli, Bacillus sp., and Salmonella (Palva et al., Gene 22:229-235 (1983)). Kits for such expression systems are commercially available. Eukaryotic expression systems for mammalian, plant, yeast, and insect cells are well known by those of skill in the art and are also commercially available.
[0161] The promoter used to direct expression of a ZFP-encoding nucleic acid depends on the particular application. For example, a strong constitutive promoter suited to the host cell is typically used for expression and purification of ZFPs.
[0162] In contrast, when a ZFP is administered in vivo for regulation of a plant gene (see, “Nucleic Acid Delivery to Plant Cells” section below), either a constitutive or an inducible promoter is used, depending on the particular use of the ZFP. Non20 limiting examples of plant promoters include promoter sequences derived from A. thaliana ubiquitin-3 (ubi-3) (Callis, et al., 1990, J. Biol. Chem. 265-12486-12493); A. tumefaciens mannopine synthase (Amas) (Petolino et al., U.S. Patent No. 6,730,824); and/or Cassava Vein Mosaic Virus (CsVMV) (Verdaguer et al., (1996), Plant Molecular Biology 31:1129-1139). See, also, Examples.
]0163] In addition to the promoter, the expression vector typically contains a transcription unit or expression cassette that contains all the additional elements required for the expression of the nucleic acid in host cells, either prokaryotic or eukaryotic. A typical expression cassette thus contains a promoter operably linked, e.g., to a nucleic acid sequence encoding the ZFP, and signals required, e.g., for efficient polyadenylation of the transcript, transcriptional termination, ribosome binding sites, or translation termination. Additional elements of the cassette may include, e.g.', enhancers, heterologous splicing signals, and/or a nuclear localization signal (NLS).
2017200511 25 Jan 2017 [0164] The particular expression vector used to transport the genetic information into the cell is selected with regard to the intended use of the ZFP, e.g., expression in plants, animals, bacteria, fungus, protozoa, etc. (see expression vectors described below). Standard bacterial and animal expression vectors are known in the art and are described in detail, for example, U.S. Patent Publication 20050064474A1 and International Patent Publications W005/084190, W005/014791 and W003/080809. .
[0165] Standard transfection methods can be used to produce bacterial, mammalian, plant, yeast or insect cell lines that express large quantities of protein, which can then be purified using standard techniques (see, e.g., Colley et al., J. Biol. Chem. 264:17619-17622 (1989); Guide to Protein Purification, in Methods in Enzymology, vol. 182 (Deutscher,’ed., 1990)). Transformation of eukaryotic and prokaryotic cells are performed according to standard techniques (see, e.g., Morrison, J. Bact. 132:349-351 (1977); Clark-Curtiss and Curtiss, Methods in Enzymology
101:347-362 (Wue/al., eds., 1983).
[0166] Any of the well known procedures for introducing foreign nucleotide sequences into such host cells may be used. These include the use of calcium phosphate transfection, polybrene, protoplast fusion, electroporation, ultrasonic methods (e.g·., sonoporation), liposomes, microinjection, naked DNA, plasmid vectors, viral vectors, both episomal and integrative, and any of the other well known methods for introducing cloned genomic DNA, cDNA, synthetic DNA or other foreign genetic material into a host cell (see, e.g., Sambrook et al., supra). It is only necessary that the particular genetic engineering procedure used be capable of successfully introducing at least one gene into the host cell capable of expressing the protein of choice.
Nucleic Acid Delivery to Plant Cells [0167] As noted above, DNA constructs may be introduced into (e.g., into the genome of) a desired plant host by a variety of conventional techniques. For reviews of such techniques see, for example, Weissbach and Weissbach Methods for Plant Molecular Biology (1988, Academic Press, N.Y.) Section VIII, pp. 421-463; and Grierson and Corey, Plant Molecular Biology (1988, 2d Ed.), Blackie, London, Ch. 7-9.
2017200511 25 Jan 2017 [0168] For example, the DNA construct may be introduced directly into the genomic DNA of the plant cell using techniques such as electroporation and microinjection of plant cell protoplasts, or the DNA constructs can be introduced directly to plant tissue using biolistic methods, such as DNA particle bombardment (see, e.g., Klein et al., (1987) Nature 327:70-73). Alternatively, the DNA constructs may be combined with suitable T-DNA flanking regions and introduced into a conventional Agrobacterium tumefaciens host vector. Agrobacterium tumefaciens-meUieXed. transformation techniques, including disarming and use of binary vectors, are well described in the scientific literature. See, for example Horsch et al., (1984) Science 233:496-498, and Fraley et al., (1983) Proc. Nat'l. Acad. Sci. USA 80:4803.
[0169] In addition, gene transfer may be achieved using non-Agrobacterium bacteria or viruses such as Rhizobium sp. NGR234, Sinorhizoboium meliloti, Mesorhizobium loti, potato virus X, cauliflower mosaic virus and cassava vein mosaic virus and/or tobacco mosaic virus, See, e.g., Chung et al. (2006) Trends Plant Sci. 11(1):1-4.
[0170] The virulence functions of the Agrobacterium tumefaciens host will direct the insertion of the construct and adjacent marker into the plant cell DNA when the cell is infected by the bacteria using binary T-DNA vector (Bevan (1984) Nuc.
Acid Res. 12:8711-8721) or the co-cultivation procedure (Horsch et al. (1985) Science 227:1229-1231). Generally, the Agrobacterium transformation system is used to engineer dicotyledonous plants (Bevan et al., (1982) Ann. Rev. Genet 16:357-384; Rogers et al., (1986) Methods Enzymol. 118:627-641). The Agrobacterium transformation system may also be used to transform, as well as transfer, DNA to monocotyledonous plants and plant cells. See U.S. Patent No. 5, 591,616;
Hemalsteen et al., (1984) EMBO J3:3039-3041; Hooykass-Van Slogteren et al., (1984) Nature 311:763-764; Grimsley et al. (1987) Nature 325:1677-179; Boulton et al., (1989) Plant Mol. Biol. 12:31-40.; and Gould et al., (1991) Plant Physiol. 95:426-434.
[0171] Alternative gene transfer and transformation methods include, but are not limited to, protoplast transformation through calcium-, polyethylene glycol (PEG)- or electroporation-mediated uptake of naked DNA (see Paszkowski et al. (1984)/3:2717-2722, Potrykus etal. (1985) Molec. Gen. Genet. 199:169-177; Fromm et al. (1985) Proc. Nat. Acad. Sci. USA 82:5824-5828; and Shimamoto (1989)
2017200511 25 Jan 2017
Nature 338:274-276) and electroporation of plant tissues (D'Halluin et al. (1992) Plant Cell 4:1495-1505). Additional methods for plant cell transformation include microinjection, silicon carbide mediated DNA uptake (Kaeppler et al. (1990) Plant Cell Reporter 9:415-418), and microprojectile bombardment (see Klein et al. (1988)
Proc. Nat. Acad. Sci. USA 85:4305-4309; and Gordon-Kamm et al. (1990) Plant Cell 2:603-618) or nanoparticles.
[0172] The disclosed methods and compositions can be used to insert exogenous sequences into a predetermined location in a plant cell genome. This is useful inasmuch as expression of an introduced transgene into a plant genome depends critically on its integration site. Accordingly, genes encoding, e.g., nutrients, antibiotics or therapeutic molecules can be inserted, by targeted recombination, into regions of a plant genome favorable to their expression.
[0173] Transformed plant cells which are produced by any of the above transformation techniques can be cultured to regenerate a whole plant which possesses the transformed genotype and thus the desired phenotype. Such regeneration techniques rely on manipulation of certain phytohormones in a tissue culture growth medium, typically relying on a biocide and/or herbicide marker which has been introduced together with the desired nucleotide sequences. Plant regeneration from cultured protoplasts is described in Evans, et al., Protoplasts
Isolation and Culture in Handbook of Plant Cell Culture, pp. 124-176, Macmillian Publishing Company, New York, 1983; and Binding, Regeneration of Plants, Plant Protoplasts, pp. 21-73, CRC Press, Boca Raton, 1985. Regeneration can also be obtained from plant callus, explants, organs, pollens, embryos or parts thereof. Such regeneration techniques are described generally in Klee et al. (1987) Ann. Rev. of
Plant Phys. 38:467-486.
[0174] Nucleic acids introduced into a plant cell can be used to confer desired traits on essentially any plant. A wide variety of plants and plant cell systems may be engineered for the desired physiological and agronomic characteristics described herein using the nucleic acid constructs of the present disclosure and the various transformation methods mentioned above. In preferred embodiments, target plants and plant cells for engineering include, but are not limited to, those monocotyledonous and dicotyledonous plants, such as crops including grain crops (e.g., wheat, maize, rice, millet, barley), fruit crops (e.g., tomato, apple, pear, strawberry, orange), forage crops (e.g., alfalfa), root vegetable crops (e.g., carrot,
2017200511 25 Jan 2017 potato, sugar beets, yam), leafy vegetable crops (e.g., lettuce, spinach); flowering plants (e.g., petunia, rose, chrysanthemum), conifers and pine trees (e.g., pine fir, spruce); plants used in phytoremediation (e.g., heavy metal accumulating plants); oil crops (e.g., sunflower, rape seed, soybean) and plants used for experimental purposes (e.g·., Arabidopsis). Thus, the disclosed methods and compositions have use over a broad range of plants, including, but not limited to, species from the genera Asparagus, Avena, Brassica, Citrus, Citrullus, Capsicum, Cucurbita, Daucus, Erigeron, Glycine, Gossypium, Hordeum, Lactuca, Lolium, Lycopersicon, Malus, Manihot, Nicotiana, Orychophragmus, Oryza, Persea, Phaseolus, Pisum, Pyrus,
Prunus, Raphanus, Secale, Solanum, Sorghum, Triticum, Vitis, Vigna, and Zea.
[0175] One of skill in the art will recognize that after the expression cassette is stably incorporated in transgenic plants and confirmed to be operable, it can be introduced into other plants by sexual crossing. Any of a number of standard breeding techniques can be used, depending upon the species to be crossed.
[0176] A transformed plant cell, callus, tissue or plant may be identified and isolated by selecting or screening the engineered plant material for traits encoded by the marker genes present on the transforming DNA. For instance, selection may be performed by growing the engineered plant material on media containing an inhibitory amount of the antibiotic or herbicide to which the transforming gene construct confers resistance. Further, transformed plants and plant cells may also be identified by screening for the activities of any visible marker genes (e.g., the β-glucuronidase, luciferase, B or Cl genes) that may be present on the recombinant nucleic acid constructs. Such selection and screening methodologies are well known to those skilled in the art.
[0177] Physical and biochemical methods also may be used to identify plant or plant cell transformants containing inserted gene constructs. These methods include but are not limited to: 1) Southern analysis or PCR amplification for detecting and determining the structure of the recombinant DNA insert; 2) Northern blot, SI RNase protection, primer-extension or reverse transcriptase-PCR amplification for detecting and examining RNA transcripts of the gene constructs; 3) enzymatic assays for detecting enzyme or ribozyme activity, where such gene products are encoded by the gene construct; 4)'protein gel electrophoresis, Western blot techniques, immunoprecipitation, or enzyme-linked immunoassays, where the gene construct products are proteins. Additional techniques, such as in situ hybridization, enzyme
2017200511 25 Jan 2017 staining, and immunostaining, also may be used to detect the presence or expression of the recombinant construct in specific plant organs and tissues. The methods for doing all these assays are well known to those skilled in the art.
[0178] Effects of gene manipulation using the methods disclosed herein can be observed by, for example, northern blots of the RNA (e.g., mRNA) isolated from the tissues of interest. Typically, if the amount of mRNA has increased, it can be assumed that the corresponding endogenous gene is being expressed at a greater rate than before. Other methods of measuring gene and/or CYP74B activity can be used. Different types of enzymatic assays can be used, depending on the substrate used and the method of detecting the increase or decrease of a reaction product or by-product. In addition, the levels of and/or CYP74B protein expressed can be measured immunochemically, i.e., ELISA, RIA, EIA and other antibody based assays well known to those of skill in the art, such as by electrophoretic detection assays (either with staining or western blotting). The transgene may be selectively expressed in some tissues of the plant or at some developmental stages, or the transgene may be expressed in substantially all plant tissues, substantially along its entire life cycle. However, any combinatorial expression mode is also applicable.
[0179] The present disclosure also encompasses seeds of the transgenic plants described above wherein the seed has the transgene or gene construct, and including seeds with desired modified oil profiles. The present disclosure further encompasses the progeny, clones, cell lines or cells of the transgenic plants described above wherein said progeny, clone, cell line or cell has the transgene or gene construct. [0180] Administration of effective amounts is by any of the routes normally, used for introducing ZFPs into ultimate contact with the plant cell to be treated. The
ZFPs are administered in any suitable manner, preferably with acceptable carriers. Suitable methods of administering such modulators are available and well known to those of skill in the art, and, although more than one route can be used to administer a particular composition, a particular route can often provide a more immediate and more effective reaction than another route.
[0181] Carriers may also be used and are determined in part by the particular composition being administered, as well as by the particular method used to administer the composition. Accordingly, there is a wide variety of suitable formulations of compositions that are available.
2017200511 25 Jan 2017
Applications [0182] As noted above, targeted modulation of genes involved in fatty acid synthesis can be used to quickly and efficiently generate plant oils of the desired fatty acid profile.
[0183] Altering the fatty acid compositions of plant oils from oil-producing plants such as, for example canola, has profound implications for food production and, consequently, on dietary health. For example, canola-quality oilseed Brassica varieties with reduced levels of saturated fatty acids in the seed oil can be used to produce food products which promote cardiovascular health. The methods and compositions described herein can be used to generate oil-producing plants with low palmitic and/or stearic acid content, which reduce the levels of saturated fatty acids in the plant oil. Similarly, generating oil-producing plants with increased levels of oleic acid content will also reduce the amount of saturated fatty acids in the plant oil. [0184], Furthermore, the methods and compositions described herein can be used to increase palmitic acid content, for example in oils produced from such plants.
Oils high in palmitic acid content are particularly useful in the formulation of margarines.
[0185] . In addition, targeted alteration of fatty acid profiles as described herein can be used to generate plants (and plant oils) which are low in linolenic acid. Low linolenic acid oils show increased stability; foods made using these oils do not go off in terms of flavor or odor as quickly as foods made from plant materials with high linolenic acid concentrations.
EXAMPLES [0186] Below are examples of specific embodiments for carrying out the present disclosure. The examples are offered for illustrative purposes only, and are not intended to limit the scope of the present disclosure in any way.
[0187] Efforts have been made to ensure accuracy with respect to numbers used (e.g., amounts, temperatures, etc.), but some experimental error and deviation should, of course, be allowed for.
2017200511 25 Jan 2017
Example 1: Target sequence identification in Brassica napus L
1.1 Target Sequence Identification [0188] In this example, endogenous DNA sequences encoding β-ketoacylACP synthetase II (KAS II) enzyme native to Brassica napus L (canola) were identified. These genes were selected as exemplary targets to demonstrate transcriptional regulation via engineered zinc-finger protein transcription factors (ZFP TF) resulting in desired modification of fatty acid biosynthesis and concomitant altered seed oil profiles. The enzyme β-ketoacyl-ACP synthetase II catalyzes the conversion of 16:0-ACP to 18:0-ACP and the subsequent formation of oleic acid (Ohlrogge and Browse, 1995, The Plant Cell, 7: 957-970). A reported Arabidopsis thaliana fabl mutant of the β-ketoacyl-ACP synthetase II gene resulted in a 65% reduction in enzyme activity and concomitant increases of stearic acid content by 7% and 3% in leaves and roots, respectively (Wu et al., 1994, Plant Physiology, 106: 143150). A stably expressing transformed soybean β-ketoacyl-ACP synthetase Π transgene in canola decreased seed palmitic acid content by 0.8% and introduction of the same gene in tobacco decreased the palmitic acid content by 2% (Japanese Patent Publication #501446/1995).
[0189] cDNA sequences of β-ketoacyl-ACP synthetase Π have been reported from multiple plant species including Arabidopsis thaliana (GenBank: AF318307) and Brassica napus (GenBank: AF244520). The alignment of A. thaliana and B.
napus cDNA sequences (GenBank: AF318307 and AF244520, respectively) showed that the AF244520 sequence was incomplete (Figure 7). This truncated B. napus DNA sequence was missing several hundred base pairs at the 5’ end. In addition, since B. napus is an amphidiploid species resulting from the combination of the chromosome sets of B. rapa (2n - 20, AA) and B. oleracea (2n = 18, CC) (Morinaga, 1934, Cytologia, 6:62-67; U.N., 1935, Japanese J. Bot., 7:389-452), it is predicted that there would be more than one β-ketoacyl-ACP synthetase II gene in this species. The additional 5’ UTR sequences present in the cDNA sequences were identified and obtained. These 5’ β-ketoacyl-ACP synthetase II gene sequences served as targets for transcriptional up-regulation via ZFP- TFs in the present examples.
1.2 Total RNA Isolation [0190] Total RNA was isolated from immature seed of Brassica napus (canola) genotype Nex710 (Crop Certificate 99-7049208-501) 15 days after
2017200511 25 Jan 2017 flowering (DAF) using Qiagen’s RNEASY® PLANT MINI KIT (Qiagen, Valencia, CA). Total mRNA was treated with RNase-free DNase as per manufacturer’s recommendation to remove any contaminating DNA that might amplify during quantitative RT-PCR.
1.3 5’ RACE and Sequence Analysis [0191 ] Rapid amplification of cDNA ends (RACE) specific to the 5 ’ end of the B. napus β-ketoacyl-ACP synthetase II cDNA (GenBank AF244520) was performed using FIRSTCHOICE® RLM-RACE kit from Ambion (Ambion, Austin,
TX) per manufacturer’s recommendations. To obtain the 5’ cDNA sequence, a synthetic RNA adapter was annealed to the 5’ uncapped mRNA region. A primer supplied with the kit (5’CGCGGATCCGAACACTGCGTTTGCTGGCTTTGATGAAA - 3’) (SEQ ID NO:1) and a second primer (5’- CTCGAGCTGCTACTGCTAGTTCCGGTGGAGGAGCC 15 3 ’) (SEQ ID NO:2) which was designed to bind within the partial B. napus cDNA sequence (GenBank AF244520) were used to amplify a fragment to determine the unknown upstream sequence. The 5’ RACE amplification identified about 500 base pairs of new B. napus sequences. Contigs of four clearly different 5’ cDNA sequences of β-ketoacyl-ACP synthetase Π genes (SEQ ID NO: 3, SEQ ID NO: 4,
SEQ ID NO: 46, and SEQ ID NO: 30) were identified when the amplified sequences were aligned (Figure 8). These 5’ sequences showed high levels of homology to B. rapa (GenBank: AC189461) and 5. oleracea (GenBank: BH723504) sequences from the same region.
[0192] ZFP TF binding sequences were identified in the 5’ cDNA sequences of β-ketoacyl-ACP synthetase II genes. The sequences from the upstream region of βketoacyl-ACP synthetase II genes (Table 2) served as targets for ZFP TF binding (Table 1). Plasmid constructs: pDAB4695, pDAB4696, pDAB4697, and pDAB4698 containing the engineered ZFP TF designs were used to stably transform B. napus as described in the next sections. It was hypothesized that engineered ZFP TFs upon expression in plant cells would bind to the endogenous β-ketoacyl-ACP synthetase II targets resulting in modified mRNA expression of the target.
2017200511 25 Jan 2017
Example 2: Design of ZFP DNA binding domains specific to β-ketoacyI-ACP synthetase II gene [0193] Zinc finger proteins were designed against various targets sites in the
B. napus β-ketoacyl-ACP synthetase II gene promoter region and 5’ untranslated and translated region. See, Figure 2. The recognition helices for representative ZFP designs are shown below in Table 1. Target sites of the zinc finger designs are shown below in Table 2.
Table 1: β-ketoacyl-ACP synthetase Π Zinc finger Designs
ZFP FI F2 F3 F4 F5 F6
14025 RSDNLSV (SEQ ID NO:5) QKINLQV (SEQ ID NO: 6) RSDTLSE (SEQ ID NO:7) TRSSRIN (SEQ ID NO:8) RSDALAR (SEQ ID NO:9) N/A
14033 RSDHLSA (SEQ ID NO: 10) TSSSRIN (SEQ ID NO:11) RSDNLAR (SEQ ID NO: 12) DRSHLAR (SEQ ID NO: 13) RSDNLSE (SEQ ID NO: 14) RNAHRTT (SEQ ID NO: 15)
14035 QSGNLAR (SEQ ID NO: 16) RSDHLSE (SEQ ID NO: 17) QKANRTK (SEQ ID NO: 18) RSDDLTR (SEQ ID NO: 19) TSANLSR (SEQ ID NO:20) N/A
14047 RSDDLSK (SEQ ID NO:21) RSANLTR (SEQ ID NO:22) RSDDLTR (SEQ ID NO: 19) RSDHLSE (SEQ ID NO: 17) DKSNRKK (SEQ ID NO:23) N/A
Table 2: Target Sites of β-ketoacyl-ACP synthetase II Zinc Fingers
ZFP Target Site (5’ to 3’) ZFP target/binding site present in SEQ ID Nos.
14025 cGTGGAGACGtCAAAAGa (SEQ ID NO: 24) 3, 4,46 and 30
14033 aAGGAAGGGCGAGAAAAGGg (SEQ ID NO: 25) 3 and 4
14035 aGATGCGTAACAGGAAg (SEQ ED NO: 26) 3, 4, 46 and 30
14047 cTACCGGGCGGAGTCGt (SEQ ID NO: 27) 3, 4 and 30
[0194] The β-ketoacyl-ACP synthetase Π designs were incorporated into zinc finger expression vectors encoding a protein having at least one finger with a CCHC
2017200511 25 Jan 2017 structure. See, U.S. Patent Publication No. 2008/0182332. In particular, the last finger in each protein had a CCHC structure (architecture).
[0195] The zinc finger-encoding sequences were then fused to sequences encoding a VP 16 activation domain and an opaque-2 nuclear localization signal.
Expression of the fusion proteins was driven by a relatively strong constitutive promoter such as a promoter derived from the Arabidopsis thaliana Ubiquitin 10 (AtUbilO) promoter. Exemplary vectors are shown in Table 3 below.
Example 3: ZFP TF-mediated up-regulation of the native β-ketoacyl-ACP 10 synthetase II gene(s) in B. napus [0196] In order to assess the functionality of designed zinc-finger proteins in plant cells, methods for the expression of such proteins in living plant cells were utilized. DNA encoding zinc-finger proteins can be delivered into plant cells under conditions where the DNA is not incorporated into the plant cell genome. Thus, the
DNA molecule is transiently maintained in plant cells and acts as a template for gene expression. Alternatively, DNA encoding zinc-finger proteins can be delivered into plant cells under conditions that allow the DNA to be incorporated into the plant cell genome, resulting in transgenesis of the zinc-finger protein encoding genes such that the DNA molecule is stably maintained in the plant cells and acts as a template for gene expression. One skilled in the art may utilize either transient or transgenic expression of zinc-finger proteins encoding DNAs in order to assess the functionality of these proteins in living plant cells.
3.1 Construct Design [0197] The binary plasmids designed and constructed for this project are listed in Table 3.
Table 3: Construct description for ZFP TFs targeted to B. napus KASII
S.N. ZFP Construct No. Gene Cassette
1 14025 pDAB4695 AtubilO/ZFPl-Vpl6/AtuORF23/CsVMV//Mrt/AtuORFl
2 14033 pDAB4696 AtubilO/ZFP2-Vpl6/AtuORF23/CsVMV/pai/AtuORFl
3 14035 pDAB4697 AtubilO/ZFP3-Vpl6/AtuORF23/CsVMV/pai/AtuORFl
4 14047 pDAB4698 AtubilO/ZFP4-Vpl6/AtuORF23/CsVMV/pai/AtuORFl
AtUbilO = Arabidopsis thaliana Ubiquitin 10 promoter, CsVMV = Cassava Vein Mosaic Virus promoter, ZFP = zinc finger protein gene, pat = phosphinothricin acyl
2017200511 25 Jan 2017 transferase gene, AtuORFl = Agrobacterium tumefaciens 3’ UTR 1 and AtuORF23 =
Agrobacterium tumefaciens 3’ UTR 23.
[0198] pDAB4695 is a binary plasmid which contains the 14025 v3 / VP 16 and pat gene expression cassettes. This construct includes the following gene elements; RB7 MAR v3 (Matrix Attachment Region (Thompson et al., 1997, WO9727207)) :: AtUbilO Promoter v2 (Arabidopsis thaliana Ubiquitin-10 Promoter (Callis, etal., 1990,7. Biol. Chem. 265-12486-12493)) :: 14025 v3 Zinc Finger/
VP 16 Fusion :: Atu ORF23 3’UTR vl (Agrobacterium tumefaciens Open Reading
Frame 23, 3’UnTranslated Region (Gelvin et al., 1987, EP222493)) :: CsVMV Promoter v2 (Cassava Vein Mosaic Virus Promoter (Verdaguer et al., 1996, Plant Molecular Biology 31:1129-1139)):: pat v5 (Phosphinothricin Acetyl Transferase (Wohlleben et al., 1988, Gene 70:25-37)):: AtuORF 1 3’UTR v4 (Agrobacterium tumefaciens Open Reading Frame 1, 3’UnTranslated Region (Huang et al., J.
Bacteriol. 172:1814-1822)). The binary was constructed by cloning a DNA fragment containing the 14025 v3 Zinc Finger IVP16 fusion into pDAB3916 via Ncol - Sacl restriction sites. The resulting construct which was labeled as pDAB8221 contained the AtUbilO Promoter v2 :: 14025 v3 Zinc Finger IVP16 Fusion :: Atu ORF23 3’UTR vl gene expression cassette. pDAB8221 was cloned into the pDAB7309 binary via an L-R Gateway® Reaction (Invitrogen, Carlsbad, CA). This reaction produced pDAB4695 and was confirmed via restriction enzyme digestions and sequencing reactions.
[0199] pDAB4696 is a binary plasmid which contains the 14033 v3 / VP 16 and pat gene expression cassettes. This construct includes the following gene elements; RB7 MAR v3 :: AtUbilO Promoter v2 :: 14033 v3 Zinc Finger / VP16 Fusion :: Atu ORF23 3’UTR vl :: CsVMV Promoter v2 :: pat v5 :: AtuORF 1 3’UTR v4. The binary was constructed by cloning a DNA fragment containing the 14033 v3 Zinc Finger / VP 16 fusion into pDAB3916 via Ncol- Sacl restriction sites. The resulting construct which was labeled as pDAB8222 contained the AtUbilO Promoter v2 :: 14033 v3 Zinc Finger / VP16 Fusion :: Atu ORF23 3’UTR vl gene expression cassette. pDAB8222 was cloned into the pDAB7309 binary via an L-R Gateway® Reaction (Invitrogen, Carlsbad, CA). This reaction produced pDAB4696 and was confirmed via restriction enzyme digestions and sequencing reactions.
2017200511 25 Jan 2017 [0200] pDAB4697 is a binary plasmid which contains the 14035 v3 / VP 16 and pat gene expression cassettes. This construct includes the following gene elements; RB7 MAR v3 :: AtUbilO Promoter v2 :: 14035 v3 Zinc Finger IVP16 Fusion :: Atu ORF23 3’UTR vl :: CsVMV Promoter v2 ::pat v5 :: AtuORF 1 3’UTR v4. The binary was constructed by cloning a DNA fragment containing the 14035 v3
Zinc Finger / VP 16 fusion into pDAB3916 via Ncol-Saclrestriction sites, The resulting construct which was labeled as pDAB8223 contained the AtUbilO Promoter v2 :: 14035 v3 Zinc Finger / VP16 Fusion :: Atu ORF23 3’UTR vl gene expression cassette. pDAB8223 was cloned into the pDAB7309 binary via an L-R Gateway®
Reaction (Invitrogen, Carlsbad, CA). This reaction produced pDAB4697 and was confirmed via restriction enzyme digestions and sequencing reactions.
[0201] pDAB4698 is a binary plasmid which contains the 14047 v3 / VP 16 and pat gene expression cassettes. This construct includes the following gene elements; RB7 MAR v3 :: AtUbilO Promoter v2 :: 14047 v3 Zinc Finger / VP 16
Fusion :: Atu ORF23 3’UTR vl :: CsVMV Promoter v2 :: pat v5 :: AtuORF 1 3’UTR v4. The binary was constructed by cloning a DNA fragment containing the 14047 v3 Zinc Finger / VP 16 fusion into pDAB3916 via Ncol-Sad restriction sites. The resulting construct which was labeled as pDAB8224 contained the AtUbilO Promoter v2 :: 14047 v3 Zinc Finger / VP16 Fusion :: Atu ORF23 3’UTR vl gene expression cassette. pDAB8224 was cloned into the pDAB7309 binary via an L-R Gateway® Reaction (Invitrogen, Carlsbad, CA), This reaction produced pDAB4698 and was confirmed via restriction enzyme digestions and sequencing reactions.
3.2 Agrobacterium Transformation [0202] Agrobacterium cells were prepared for electroporation using the protocol described in Weigel D., Glazebrook J. Arabidopsis: A Laboratory Manual. Cold Spring Harbor Laboratory Press, 2002: pgl23-124. Minor modifications were made to the protocol that allowed for optimal growth of Agrobacterium (i.e. YEP media was substituted for LB). Independently, 1.5-3 pg of plasmid DNA for each construct was added to 50 pi of C58 :: Z707s Agrobacterium tumefaciens cells and gently mixed. The mixture was transferred to cold 0.2 cm GENE PULSER® cuvettes (BioRad Hercules, CA) and placed on ice. The cuvettes were then placed in a cold GENE PULSER® rack (BioRad, Hercules, CA) and electroporated at the following conditions: capacitance output 25 pFarad, capacitance extender 960 pFarad, resistance
2017200511 25 Jan 2017
200 ohms, and voltage 2.5 kVolts. Immediately after electroporation, 950 μΐ of SOC medium (Invitrogen, Carlsbad, CA) was added and the mixture was transferred to a Falcon 2059 tube (Becton Dickinson and Co., Franklin Lakes, NJ) or equivalent. The transformed cells were then incubated at 28°C for 1 hour. After incubation, 50 μΙ, 100 μΐ, and 200 μΐ of cells were plated on separate YEP medium plates (10 gm yeast extract, 10 gm peptone, 5 gm NaCI, 10 gm sucrose, and 15 gm agar in 1 Liter of water) containing antibiotics as appropriate. The plates were grown inverted at 28°C for approximately 36-48 hours. Single colonies were picked and propagated in 50 ml of liquid YEP (10 gm yeast extract, 10 gm peptone, 5 gm NaCI, and 10 gm sucrose in
1 Liter of water), containing antibiotics as appropriate, at 28°C for approximately 36 hours.
[0203] The Agrobacterium tumefaciens strain was confirmed via a ketolactose test. Putatively transformed colonies were streaked out on lactose agar and incubated at 28°C for 48 hours. The plates were then flooded with Benedict’s Solution. The plates were monitored; streaked isolates which turned the Benedict’s Solution from blue to yellow were confirmed as Agrobacterium (Bouzar, H., Jones, J., Bishop, A. “Simple Cultural Tests for Identification of Agrobacterium Biovars.” Methods in Molecular Biology, Volume 44. Humana Press, 1995: 9-13).
[0204] After completing a QIAGEN® low copy mini-prep protocol (Qiagen,
Valencia, CA), purified plasmid DNA was prepared from the bacterial cultures. DNA integrity was evaluated by restriction digest. Clones with the expected banding patterns were identified and glycerol stocks were prepared by adding 500 μΐ of bacterial culture to 500 μΐ of sterile glycerol (Sigma Chemical Co., St. Louis, MO) and inverting to mix. Glycerol stocks were frozen on dry ice and stored at -80°C.
·
3.3 Transformation of B. napus with ZFP TFs [0205] Preparation of Hypocotyl Segments: seeds of B. napus genotype, Nex
710, were surface-sterilized with 10% commercial bleach for 10 minutes and rinsed 3 times with sterile distilled water. The seeds were dried via a sterile paper towel then placed in a Phyta-tray containing ‘germination medium’ consisting of one half concentration of MS basal medium (Murashige and Skoog, Physiol Plant 15(3): 473497, 1962), 20 g/L sucrose, and 8 g/L TC Agar (PhytoTechnology Laboratories, Shawnee Mission, KS) and maintained under growth regime set at 23° C, and a photoperiod of 16 hrs light/8 hrs dark.
2017200511 25 Jan 2017 [0206] On day 5, seedlings were checked for sterility and the Phyta-tray was placed inside an EDGEGARD® laminar flow hood (The Baker Company, Sanford, ME) to maintain sterility. Using sterile forceps and dissecting scissors, plants were removed from the Phyta-tray and the aerial (meristem and cotyledon) region and roots were detached and discarded. Hypotcotyls were placed into a 100 x 25mm petri dish containing sterile distilled water which is required to prevent drying. Hypocotyls were placed onto the lid of a 100 x 25mm petri dish and cut transversely into 3mm segments using a #10 scalpel. Hypocotyl segments were placed on ‘callus induction medium’ consisting of MS medium containing 30 g/L sucrose, 1 mg/L kinetin and 1 mg/L 2,4-D solidified with 7g/L TC Agar including a sterile filter paper. The plates were placed into a clear STERILITE® tub and maintained under the same growth regime for 3 days, as a pre-treatment.
[0207] On day 8, the segments were then transferred into a 100 x 25 sterile petri plate containing 20 mL of ‘liquid culture medium’ consisting of Linsmaier and .Skoog basal medium (1965) containing 30 g/L glucose, A strength Gamborg vitamins (1968), 215.2 mg/1 kinetin and 221,04 mg/1 2,4-D for a 1 hour pretreatment, The ‘liquid culture medium’ was removed from the hypocotyl segments and 40mL of Agrobacterium suspension (containing either pDAB4695, pDAB4696, pDAB4697 or pDAB4698 in Z707s) at a 50 Klett was vortexed briefly and poured into the 100 x
25mm petri dish containing hypocotyl segments for a 30 minute treatment. After 30 minutes, all of the Agrobacterium suspension was removed using a double stacked pipette. The treated hypocotyls were placed back onto the ‘callus induction medium’ plus filter papers, returned to the STERILITE® tub, covered with a dark lid and returned to the culture room under the same growth regime as above, for a 3 day co25 cultivation period. After 3 days, the hypocotyls were placed directly onto ‘callus induction medium’ containing lmg/L HERBIACE®, placed back into the tub with a clear lid and returned to the culture room, maintaining the same growth regime as above. After 1 week, the hypocotyls were transferred directly to ‘callus induction medium’ with selection at 3 mg/L HERBIACE® for 2 weeks for further callus development and transferred to ‘callus induction medium’ with selection at 5mg/L HERBIACE for 2-8 weeks for additional callus development. Once a sufficient amount of callus was available it was submitted for molecular analysis.
[0208] Regeneration of Plants from Aged Canola Callus: Canola callus tissue was placed onto ‘shoot regeneration medium’ consisting of MS medium containing
2017200511 25 Jan 2017 g/L sucrose, 3 mg/L benzyaminopurine, 0.5 g/L MES [2-(N-morpholion) ethane sulfonic acid], 5 mg/L silver nitrate, lmg/L zeatin, 250 mg/L carbenicillin, 300 mg/L timentin and 7 g/L TC Agar with selection at 5 mg/L HERBIACE®, plates were wrapped with 3M tape and place under growth regime set at 23° C, and a photoperiod of 16 hrs light/8 hrs dark. The tissues were then moved to ‘shoot elongation medium’ consisting of MS medium containing 0.5 g/L MES, 300 mg/L timentin, 20 g/L sucrose and 7 g/L TC Agar with selection at 5 mg/L HERBIACE®. Plantlets were transferred to ‘rooting medium’ consisting of'Λ MS medium containing 10 g/L sucrose, 0.5 mg/L indolebutyric acid, 300 mg/L timentin and 8 g/L TC Agar with selection at 5 mg/L HERBIACE®.
[0209] Once roots established on the plantlet in vitro, they were transplanted to 5 V” pots containing Metro Mix 360. The plants were covered with a clear solo cup and placed into a conviron for acclimation. After 48-72 hours, cups were removed to allow air circulation. After a total of seven days, the pots were shifted from the conviron to a greenhouse bay for further development. Plants were grown under a 16:8-hour photoperiod, with daytime and nighttime temperature between 2224°C. When the primary flowering stem began to elongate and form flower buds, the entire plant was covered with a selfing bag to prevent outcrossing. Seeds derived from self-pollinations were harvested about four months after transplanting.
[0210] Preparation of Agrobacterium·. The Agrobacterium from a glycerol stock was streaked, four days prior to treatment, onto ‘semi solid bacterial growth medium’ consisting of 10 g/L Peptone, 10 g/L Yeast Extract, 5 g/L NaCl, 10 g/L Sucrose plus 100 mg/L spectinomycin and 250 mg/L streptomycin and solidified with 15 g/L Bacto Agar and grown for two days in an incubator (Fisher Scientific Isotemp
Incubator) at 28°C. After 2 days, a small loop of Agrobacterium was placed into a 500mL sterile disposable baffled flask containing 150mL ‘liquid bacterial growth medium’ (same as above minus solidifying agent), 250mg/L of streptomycin and 100mg/L of spectinomycin, grown for 16 hours overnight at 28° C in the dark on an enclosed shaker (New Brunswick Scientific Innova 4330 refrigerated incubator shaker) at 200 rpm. After 16 hours the Agrobacterium culture was removed from the shaker and aliquotted into 50mL centrifuge tubes (one containing 35mL for preparation and two containing 50mL for revalidation). The centrifuge tubes are placed into a centrifuge (Beckman Model J2-21 centrifuge) and centrifuged at 6,000
2017200511 25 Jan 2017 rpm for 15 minutes and subsequently re-suspended in the ‘liquid culture medium’ to a final density of Klett 50 with a red filter.
Example 4: Analysis of Transformed Callus Samples 5 [0211] Putatively transformed B. napus callus samples were analyzed for alterations in mRNA expressions for β-ketoacyl-ACP synthetase II endogenous gene, tubulin endogenous gene and ZFP TF transgene. The tubulin mRNA levels were used as an internal control to normalize the expression of ZFP TF and β-ketoacyl-ACP synthetase Π mRNAs. The ZFP TF mRNA expression data was used to confirm the presence of at least one functional ZFP TF transgene in transformed calli.
4.1 Callus Sample Preparation [0212] Approximately 40-50 eight-week-old callus samples of B. napus were obtained after the transformation of Nex710 hypocotyl tissue. They were individually transformed with the ZFP TF constructs, pDAB4695, pDAB4696, pDAB4697, and pDAB4698 as described above in Example 3.3. Control samples were obtained by transformation of a control binary construct containing a pat gene expression cassette (AtUbilO Promoter v2 :: pat v3 :: Atu ORF1 3’UTR v3). All samples were grown in HERBIACE-supplemented cell culture medium until their harvest.
[0213] Total RNA was prepared from the fresh callus tissue using QIAGEN
RNEASY 96 Kit (Qiagen, Valencia, CA). The RNA was treated with RNase-free DNase according to the kit’s instructions to remove any genomic DNA contaminants. First strand synthesis was set up according to the Superscript® III Reverse Transcriptase Enzyme (Invitrogen, Carlsbad, CA) manufacturer’s instructions and primed using random hexamers. The synthesized cDNA strands were diluted in water at ratios of 1:10 and 1:50 (this provides sufficient template to PCR amplify multiple targets). Each aliquot was saved at -20°C indefinitely.
4.2 β-ketoacyl-ACP synthetase II mRNA Expression Analysis [0214] qRT-PCR reaction mixes were set up for amplification of the βketoacyl-ACP synthetase II cDNA as follows: 7.5 pL of 2X LC480 Probes Master Buffer (Roche Diagnostic, Indianapolis, IN), 0.3 pL gene specific forward primer (SEQ ID NO: 28: 5’- TTGACTCGAGCTGCTACTGC -3’; nucleotide positions 544 - 563 for SEQ ID NO: 3 in Figure 8 alignment) from 10 pM stock, 0.3 pL gene
2017200511 25 Jan 2017 specific reverse primer (SEQ ID NO: 29: 5’- TTTCCATATCCATCGCAACA -3’; nucleotide positions 588 - 607 for SEQ ID NO: 3 in Figure 8 alignment) from 10 pM stock, 0,15 pL UPL probe #25 from LIGHTCYCLER® 480 Probes Master, (Roche Diagnostic, Indianapolis, IN), 1.5 pL of 10% (w/v) polyvinyl pyrrolidone-40 (PVP5 40), and 3.9 pL water . The UPL probe (Roche Diagnostics, Indianapolis, USA) is a locked nucleic acid and therefore has a higher Tm than otherwise calculated. All components were put back in the freezer prior to handling standards and unknowns. A 384-weIl microplate was demarcated and labeled, 13.5 pL of master mix was added per well. A sealing foil was gently attached to the microplate. The plate was centrifuged for 1 minute at 3,000 rpm in a Qiagen microplate centrifuge. 1.5 pL of thawed, diluted synthesized cDNA strands were added. Additionally, 1.5 pL of plasmid DNA copy number standards were added to separate wells in a dilution series from lowest to highest concentrations, these standards were compared to the βketoacyl-ACP synthetase II cDNA (synthesized from total mRNA) to quantitate the copy number. β-ketoacyl-ACP synthetase Π DNA copy number standard series were made by cloning the target amplicon into a pCR2.1 plasmid (Invitrogen, Carlsbad, CA) and making a dilution series for quantifying the copy number, A foil seal was firmly affixed to the plate and centrifuged as previously described. A PCR program was performed as follows: i. Activate 95°C for 5 minutes; ii. Denature 95°C for 10 sec @ 4.8°C/sec; iii. Anneal/Extend 60°C for 25 sec @ 2.5°C/sec; iv. Acquire 72°C for 1 sec @ 4.8°C/sec; Repeat step ii - iv, 40-50 more times; Cool to 38°C for 5 sec. DNA was amplified in Real-time PCR instrumentation LC480 (Roche, Indianapolis, IN) or equivalent. The amplicon size was 64 base pairs. The forward and reverse primer sequences employed in this PCR assay matched perfectly with the corresponding sequences present in two of the β-ketoacyl-ACP synthetase II gene targets, SEQ ID NOs: 3 and 30 (Figure 8). Therefore, this assay represented quantitative expression of two β-ketoacyl-ACP synthetase II gene targets. .
4.3 Tubulin mRNA Expression Analysis [0215] The tubulin gene, a native gene of Brassica napus (GenBank:
AF258790 and GenBank: DU106489), was used as a reference standard to accurately normalize mRNA expression signal across genes in qRT-PCR assays. cDNA
2017200511 25 Jan 2017 synthesized for β-ketoacyl-ACP synthetase II qRT-PCR assay (described in example 4.1) was also used in tubulin qRT-PCR assay as described below.
[0216] A qRT-PCR was set up with 0.3 pL of a gene specific forward primer (SEQ ID NO: 31: 5’- ACAGCGATTGCCTACAAGG -3’) (10 μΜ stock) and 0.3 pL ofa gene specific reverse primer (SEQ ID NO: 32: 5’AGATGGTTAAGATCACCAAAGG -3’) (10 μΜ stock), 1.5 pL of 10% (w/v) PVP40, 3.9 pL water and 7.5 pL 2X LIGHTCYCLER® 480 SYBR Green I Master Mix (Roche, Indianapolis, IN) to detect and quantify DNA. A 384-well microplate was demarcated and labeled, 13.5 pL of master mix was added per well. A sealing foil was gently attached to the microplate. The plate was centrifuged for 1 minute at 3,000 rpm in a Qiagen microplate centrifuge. The sealing foil was removed and 1.5 pL of thawed, diluted synthesized cDNA strands were added. Additionally, 1.5 pL of plasmid DNA copy number standards were added to separate wells in a dilution series from lowest to highest concentrations, these standards were compared to the tubulin cDNA (synthesized from total mRNA) to quantitate the copy number. Tubulin DNA copy number standard series were made by cloning the target amplicon into a pCR2,l plasmid (Invitrogen, Carlsbad, CA) and making a dilution series for quantifying the copy number. A foil seal was firmly affixed to the plate and centrifuged as previously described. A PCR program was run as follows: i. Activate 95°C for 10 minutes; ii.
Denature 95°C for 10 sec @ 4.8°C/sec; iii. Anneal/Extend 55.5°C for 20 sec @ 2.5°C/sec; iv. Acquire 72°C for 20 sec @ 4.8°C/sec; steps ii - iv were repeated 39 more times; vi. Cool to 38°C for 5 sec. DNA was amplified in Real-time PCR instrumentation LC480 or equivalent. A 307 base pair amplicon was amplified in this reaction. This reverse primer spans a 78 bp intron based upon the GenBank sequence.
Therefore, amplicons amplified from the genomic DNA would not be favored and genomic DNA contaminants would be of higher molecular weight and can easily be differentiated from that of cDNA by running amplicons on an agarose gel.
4.4 ZFP TF mRNA Expression Analysis [0217] Expression of ZFP TF mRNA was quantitated from cDNA samples that were originally synthesized for β-ketoacyl-ACP synthetase Π mRNA (described above in Example 4.1). A TaqMan PCR assay was designed from the ZFP cassette by anchoring primers to the opaque-2 NLS sequence at the 5’ and VP 16 sequence at the
2017200511 25 Jan 2017
3’. The PCR assay was set up using: 0.5 pL forward primer “OP2_NLS_F1” (SEQ ID NO: 33: 5’- AAGGAAGAGGAAGGAGTCTAACAG -3’) from 10 μΜ stock, 0.5 pL reverse primer “VP16_R1” (SEQ ID 34: 5’- CTTCTGCTCTCCACCGTA -3') from 10 pM stock, 0.25 pL probe “VP16_MGB_185” (SEQ ED NO: 45: 5’ 5 TTGATGGTGAAGATGT -3’) from 5 pM stock, 1.5 pL of 10% (w/v) PVP-40, 1.5 pL lOx Hot Start PCR buffer, 1.0 pL 25mM MgCfi, 1.2 'pL dNTP (2.5mM each),
0.15 pL Hot Start Taq Polymerase (Qiagen, Valencia, CA), and 6.9 pL water, The cocktail was amplified using LIGHTCYCLER® 480 (Roche Diagnostics, USA). A 384-well microplate was demarcated and labeled, 13.5 pL of master mix was added per well. A sealing foil was gently attached to the microplate. The plate was centrifuged for 1 minute at 3,000 rpm in a Qiagen microplate centrifuge. The sealing foil was removed and 1.5 pL of thawed, diluted synthesized cDNA strands were added, A foil seal was firmly affixed to the plate and centrifuged as previously described. A PCR program was run as follows: i. Activate 95°C for 15 minutes; ii,
Denature 95°C for 20 sec @ 4.8°C/sec; iii. Anneal/Extend 60°C for 20 sec @
2.5°C/sec; iv. Acquire 72°C for 55 sec @ 4.8°C/sec; steps ii - iv were repeated 44 more times; vi, Cool to 38°C for 5 sec. DNA was amplified in Real-time PCR instrumentation LC480 or equivalent. The amplicon size was 775 base pairs. ZFP TF cDNA/mRNA copy number was determined using a standard series in which the target amplicon was cloned into a plasmid and making a dilution series for PCR assays as described for β-ketoacyl-ACP synthetase II and tubulin examples above.
4.5 Expression Analysis of Callus Samples [0218] ZFP TF mRNA expression was measured in 8-week-old transgenic callus samples putatively transformed with ZFP TFs and growing on HERBIACE® selection medium (see Example 3). ZFP TF quantitative mRNA expression, as measured with qRT-PCR assay, was detected in samples transformed with only ZFP TF containing constructs but not in samples containing the control construct. This data indicated that the assay was specific to ZFP TF expression and that control calli did contain ZFP TF trans gene.
[0219] Ratios of β-ketoacyl-ACP synthetase II and tubulin mRNA expression were calculated, based on qRT-PCR results, to discern the expression differences between callus samples. The highest mRNA up-regulation of the β-ketoacyl-ACP
2017200511 25 Jan 2017 synthetase II mRNA was observed in canola callus samples transformed with the pDAB4695 construct (Table 4). This 27% up-regulation was statistically significant (p = 0.05) over that of control samples.
Table 4: KASII mRNA expression in B. napus callus samples transformed with different ZFP TF constructs
Construct Number of call! Analyzed KasII/Tubulin expression Mean KasII/Tubulin expression STDEV
4695 23 3.69 1.20
4696 20 2.81 0.84
4697 24 3.18 0.93
4698 24 3.03 0.68
Control 14 2.90 1.12
Example 5: Analysis of Transformed TO Plant Samples
I
5.1 Analysis of β-ketoacyl-ACP synthetase II, Tubulin, and ZFP TF mRNA
Expression [0220] TO canola plants containing pDAB4695 transgene construct were grown up to the 6-leaf plant stage and analyzed for mRNA expressions of the β15 ketoacyl-ACP synthetase II endogenous gene, tubulin endogenous gene, and ZFP TF transgene. The transgenic plants were compared to control samples that had been transformed with a binary construct containing a pat gene expression cassette (AtUbi 10 Promoter v2 :: pat v3 :: Atu ORF1 3 ’UTR v3). Six leaf punches from a standard size paper puncher were sampled on iee from each plant and total mRNA was extracted with Qiagen 96-well RNeasy RNA extraction kit according to the manufacturer’s instructions. (Qiagen, Carlsbad, CA), The β-ketoacyl-ACP synthetase II, tubulin, and ZFP TF mRNA expression analyses were completed using the protocols described above in Example 4.
[0221] The expression of β-ketoacyl-ACP synthetase II mRNA varied among independent transgenic TO plants. Greater than 3-fold mRNA up-regulation was observed among the 16 events analyzed (Figure 3). All plants were positive for ZFP
2017200511 25 Jan 2017
TF expression. In addition, 27 control plants were used to calculate a β-ketoacyl-ACP synthetase II mRNA expression baseline. The mean expression of the β-ketoacylACP synthetase II mRNA from the baseline control was compared to the expression of β-ketoacyl-ACP synthetase Π mRNA from individual ZFP TF plant events to calculate the fold-increase of expression (Figure 3). These plants were grown to maturity to obtain TI seed. Prior to flowering, all plants were individually covered with selfing bags to facilitate self pollination of flowers within a plant. TI seed of these plants were collected approximately 4 months following their transfer to the greenhouse.
[0222] Events 3, 6 and 12.2 (hereafter referred to as event 12), representing different β-ketoacyl-ACP synthetase II mRNA expression ranges, were selected for further study.
Example 6: Analysis of Transformed TI Plant Samples
6,1 Fatty Acid Analysis of TI Seed [0223] Single seed fatty acid analysis was performed on 24 individual TI seeds, per event, to study ZFP TF effects on alteration in the fatty acid contents (Table 5). A fatty acid methyl ester (FAME) analysis method based on AOCS method Ce2 66(97) was employed and all numbers in Table 5 are displayed as a percentage of the total fatty acids present in canola seeds.
2017200511 25 Jan 2017
Table 5: Fatty acid profile of individual TI seed measured with FAME analysis
Events C16:0 C16:1 C18:0 C18:1 C18:2 C18:3 Total C18
3 Low 2.8 0.3 1.6 76.1 12.2 3.7 93.6
3 Low 2.9 0.3 1.4 76.7 11.8 4.0 93.9
3 Low 2.9 0.3 1.4 75.7 13.0 3.8 93.9
3 High 3.6 0.3 1.4 75.1 13.0 3.5 93.1
3 High 3.8 0.4 1.4 75.6 12.0 3.8 92.8
3 High 4.0 0.4 1.5 74.8 12.6 3.7 92.5
Mean (n = 24) 3.3 0.3 1.5 75.7 12.4 3.8 93.3
STD Dev (n = 24) 0.5 0.1 0.1 0.7 0.5 0.1 0.34
12 Low 3.1 0.2 1.5 76.4 12.0 3.8 93.6
12 Low 3.2 0.3 1.4 77.0 11.5 3.4 93.3
12 Low 3.2 0.2 1.8 80.9 7.5 3.2 93.5
12 High 3.6 0.3 1.5 76.8 11.7 3.1 93.2
12 High 3.6 0.3 1.6 76.0 11.9 3.5 93.0
12 High 3.6 0.3 1.8 77.3 10.8 3.0 92.9
Mean (n = 24) 3.4 0.3 1.6 77.4 10.9 3.3 93.2
STD Dev (n = 24) 0.2 0.0 0.2 1.8 1.7 0.3 0.23
6 Low 3.2 0.5 1.9 81.3 8.1 2.1 93.3
6 Low 3.3 0.5 1.2 79.6 10.1 2.3 93.1
6 Low 3.5 0.5 2.6 80.6 7.5 1.9 92.6
6 High 4.4 0.5 2.4 77.7 10.7 1.5 92.2
6 High 4.5 0.6 2.2 77.1 10.5 1.8 91.6
6 high 4.6 0.7 1.3 77.4 11.0 1.7 91.4
Mean (n = 24) 3.9 0.5 1.9 78.9 9.6 1.9 92.4
STD Dev (n = 24) 0.6 0.1 0.6 1.8 1.5 0.3 0.54
Nex710 Mean (n=216) 3.8 0.4 2.3 78.1 9.5 2.5 92.5
STD Dev (n=216) 0.2 0.0 0.6 1.8 1.6 0.7 0.45
[0224] For sample preparation, individual single seeds were placed into labeled cluster tubes on a 96-well extraction plate containing one 1/8” steel ball (Small Parts, Miramar, FL). Tubes were capped and the seed dry ground in a GenoGrinder (SPEX CertiPrep Group, Metuchen, NJ) for 3.0 minutes at 1300 strokes/minute. The caps were removed and 0.6 mL of heptane was added to each well. The wells were re-capped and placed back into the GenoGrinder for additional grinding for 2.0 minutes at 1200 strokes/min. The samples were then removed and centrifuged at 3700 rpm for 10.0 minutes at 6°C. Using a Beckman Coulter MC Robot, the supernatant was transferred to a 96 well plate with glass inserts (MicroLiter, Suwanee, GA). 40 p.L of 1% sodium methoxide was added to the sample. The sodium methoxide was diluted from a stock 30% solution with methanol (Fluka/Sigma Aldrich, St. Louis, MO), The plates were capped with a Teflon lined mat and allowed to incubate at room temp for 4 hours before GC analysis.
[0225] Samples were analyzed for fatty acid contents on an Agilent 6890 GCFED (Agilent Technologies, Santa Clara, CA) equipped with a J&W Scientific DB-23
2017200511 25 Jan 2017 column, 15 meter x 0.25 mm ID column and 0.25 μπι film thickness, (J&W Scientific, Folsom, CA). The initial oven temperature was 200°C and this temperature was maintained for the duration of the run. The inlet was set to split ratio of 1:100 and a temperature of 280°C. A ramped flow rate of 0.8 mL/min helium was maintained for the initial two minutes. The flow was then increased at a rate of 1.0 mL/min to 2.5 mL/min and held for 1.5 minutes. The detector was set to 300°C with a constant carrier gas make up and column flow of 30 mL/min, fuel hydrogen flow of 30 mL/min, and oxidizer flow of 400 mL/min. An injection volume of 2^L was used for all samples.
[0226] Individual fatty acid methyl ester peaks were identified by comparison with the retention times of methyl ester reference standards (GLC#428, Nu-ChekPrep, Inc., Elysian, MN) using Waters Corp. Empower Software. Individual percent areas were calculated for all analytes in the reference standard based upon the total integrated chromatography peak areas. A heptane blank was also shot to identify any contamination on the GC.
[0227] A comparison of TI seed with the three lowest 06:0 levels (which are most likely ZFP TF positive plants) and the three highest 06:0 levels (which are most likely ZFP TF null plants) indicated that changes in the 06:0 content could be due to the segregation of the ZFP TF transgene (Table 5). A corresponding change in total 08 (08:0 + 08:1 + 08:2 + 08:3) was also observed in all events; seeds with low 06:0 levels had increased total 08 levels and vice versa. This was despite the variability in individual fatty acid contents of08:0, 08:1, 08:2 and 08:3 due to the segregation offad2 and fad3 mutant genes (Hu, X., et al. Theor. Appl. Genet. 2006,113: 497-507) in the Nex710 genotype that was transformed. Therefore, the next step was undertaken to identify the ZFP TF positive and sibling null plants in a TI segregating population of each event to detect the actual change in the fatty acid profile in similar genetic backgrounds.
6.2 ZFP TF Presence Analysis in TI Plants [0228] 100-150 TI seedlings of all three transgenic events 3, 6, and 12, were screened to identify ZFP TF positive and sibling null plants (Table 6). Plants were tested for the presence of at least one full-length cassette of the ZFP TF transgene.
' Total genomic DNA from the leaves of these plants was isolated as per manufacturer’s recommendations with the QIAGEN PLANT DNEASY extraction kit
2017200511 25 Jan 2017 (Qiagen, Valencia, CA). The protocol was modified by adding PVP- 40 to the Qiagen buffer API at a final concentration of 1%. The purified gDNA was quantified by a PICOGREEN® DNA Quantification protocol (Molecular Probes, Inc., Eugene, OR). The DNA samples were assayed for the presence of at minimum, one full-length copy of the ZFP TF transgene in a PCR assay containing the following reagents: 5 pL
10X EX Taq buffer (Takara Bio Inc., Otsu, Siga, Japan), 5 pL 10% polyvinyl pyrrolidone-40, 1.0 pL ubilO forward primer (SEQ ID NO: 35: 5’GGTCAACGGATCAGGATATTCTTG -3’) from 10 μΜ stock , 1.0 pL AtuORF23 reverse primer ( SEQ ID NO: 36: 5’- CCATGTTGGCAAAGGCAACC -3’), 10 μΜ stock, 4 uL of dNTPs (2.5 mM each), 0.2 pL TaKaRa EX Taq™ Hot Start, 31.8 pL water and 2 pL DNA at a concentration of 10 ng/pL. PCR cycling conditions were as follows: 94°C for 2 min, 10 cycles of touch-down PCR with 98°C for 10 sec, 65°C for 20 sec with decreasing temperature of 0.5°C at every cycle to 60°C followed by 72°C for 3:00 min. This was followed by 35 cycles of 98°C for 10 sec, 60°C for 20 sec and
72°C for 3:00 min and a final extension of 72°C for 10 min. 5 pi of each reaction was run on a 1% agarose gel to detect for the presence of the expected size ZFP TF band of 2662 bp.
[0229] A quantitative Real Time-PCR assay for the pat gene, which is molecularly linked to the ZFP TF in the pDAB4695 construct, was developed and applied to identify pat positive and null plants to confirm its genetic segregation with the ZFP TF cassette to which it is molecularly linked,
Table 6: Identification of ZFP TF positive and sibling null plants in TI
Events Total TI seed planted TI ZFP TF/nuIl plants identified TI ZFP TF/null plants advanced to T2 seed
3 150 115/7 12/7
6 100 66/27 5/5
12' 150 126/6 8/6
[0230] The reaction mix for pat TaqMan RT-PCR assay was comprised of the following: 3 pL Roche LIGHTCYCLER® Cycler 480 II Probes 2X master mix, 0.6 pL 10% PVP-40, 0.2 pL each of pat forward primer (SEQ ED NO: 37: 5’25
2017200511 25 Jan 2017
ACAAGAGTGGATTGATGATCTAGAGAGGT -3’) fromlO μΜ stock, 0.2 pL PAT reverse primer (SEQ ID NO: 38: 5’- CTTTGATGCCTATGTGACACGTAAACAGT -3’) from 10 μΜ stock, 0.2 pL probe (SEQ ED NO: 39: 5’- 6FAMCCAGCGTAAGCAATACCAGCCACAACACC-quencher -3’) from 5 μΜ stock, and it was multiplexed with the following reagents for internal reference standard of
HMG (GenBank: AF127919), as follows: 0.2 pL each of HMG forward primer (SEQ ID NO: 40: 5’- CCTCTCTACCACCGTCTCACATG -3’) from 10 μΜ stock, 0.2 pL HMG reverse primer (SEQ ID NO: 41: 5’- GATCTGGCCGGACTGTTTCA -3’) from 10 μΜ stock, 0.2 pL probe (SEQ ID NO: 42: 5’- 6FAM10 CGCTCCTCAGCTACCACCTCAACCA-quencher -3’), from 5 μΜ stock, 1 μΐ,
DNA and 0.2 pL water. PCR cycling conditions were: 1 cycle of 95°C for 5 min, 40 cycles of 95°C for 10 sec, 60°C for 40 sec and 72°C for lsec. All samples were amplified in triplicate in 384-well plates along with 1-4 copy transgenic genomic DNA standards in a Roche LIGHTCYCLER® 480 PCR machine.
[0231] Based on the segregation ratios of the ZFP TF positive and null plants within each event, events 3, 6 and 12 contained approximately 2, 1, and 2 insertions respectively of the ZFP TF transgene in the B. napus genome (Table 6, Column 3). This data matched with the pat gene segregation data in all three events.
6.3 β-ketoacvl-ACP synthetase Π mRNA up-regulation in Tl plants [0232] All Tl ZFP TF positive and sibling null plants shown in Table 6,
Column 3 were then subjected to mRNA expression analysis for the endogenous βketoacyl-ACP synthetase II gene, ZFP TF transgene, and endogenous tubulin gene. The latter served as a reference gene to normalize for β-ketoacyl-ACP synthetase II and ZFP TF gene expressions, Six leaf punches from each of the 6-leaf plant stage were sampled on ice and total RNA was extracted using the QIAGEN RNAEASY® kit. cDNA strand synthesis and dilutions were completed as described in Example 4.1.
[0233] qRT-PCR analysis of the synthesized cDNA was completed for all three genes. The β-ketoacyl-ACP synthetase Π and tubulin mRNA expression analysis were performed as described in Examples 4.2 and Example 4.3, respectively. The ZFP TF assay was modified. The PCR reaction was set up as follows: The reaction conditions were as follows: 7.5 pL of 2X LC480 Probes Master Buffer (Roche Diagnostic, Indianapolis, IN), 0.3 pL gene specific forward Primer #1 (SEQ
2017200511 25 Jan 2017
ID NO: 43: 5’- TCGATCTTGATATGTTGGGAGA -3’) (10 μΜ stock), 0.3 pL gene specific reverse Primer #2 (SEQ ID NO: 44: 5’- AGGTGCAGAATCATGTGGTG 3’) (10 μΜ stock), 0.15 pL UPL probe #85, 1.5 pL of 10% (w/v) PVP-40, and 3.9 pL water. A 384-well micro-plate was demarcated and 13.5 pL of the mix described above was added per well. A sealing foil was attached to the plate, and the plate was centrifuged for 1 minute at 3000 rpm. The film was removed and 1.5 pL of the thawed, diluted first strands were added per well. In addition, cDNA standards were added to separate control wells. The foil seal was sealed upon the plate and the centrifugation step was repeated. A PCR program was run with the following conditions; i. activate 95°C for 5 minutes, ii. denature 95°C for 10 sec (@ 4.8°C/sec), iii. anneal/extend 60°C for 25 sec (@ 2.5°C/sec), iv. acquire 72°C for 1 sec (@ 4.8°C/sec), v. repeat steps ii - iv 39-49 more times, vi. cool to 38°C for 5 sec.
[0234] ZFP TF mRNA expression was lowest in event 6 and highest in event of the ZFP TF positive samples (Figure 4). The null plants did not express ZFP TF mRNA indicating that the ZFP TF assay was specific to ZFP TF transgene presence. The mRNA levels of the β-ketoacyl-ACP synthetase II gene, the target for ZFP TF, up-regulated in ZFP TF positive plants of all events (Figure 5). Up to a 3-4 fold increase in β-ketoacyl-ACP synthetase II mRNA expression was observed by pairwise comparisons of the ZFP TF positive and corresponding sibling null plants within each event. The up-regulation of β-ketoacyl-ACP synthetase II mRNA levels was relative to the increase in ZFP TF mRNA expression levels within each event (Figure 4), i.e. lowest in event 6 and highest in event 3.
6.4 Fatty Acid Analysis of TI Plant Leaves [0235] A second set of TI leaf samples were collected for fatty acid analysis concurrent to the collection of mRNA analysis samples described in Example 6.3, However, only a subset of the samples were analyzed for fatty acids for only those plants that were advanced to maturity as shown in Table 6, column 4. Fatty acid methyl ester (FAME) analysis of leaf material was completed as follows. Leaf material of 10-100 mg was collected on ice and then freeze dried prior to a transmethylation reaction with 0.25M sodium methoxide in anhydrous methanol at 40°C for 20 minutes. After the transmethylation reaction the fatty acids were extracted three times with a heptane solution containing heptadecanoin as a surrogate
2017200511 25 Jan 2017 standard. The isolated hexane fractions were dried down and resuspended in a known volume of heptane. The resulting fatty acids methyl ester (FAME) was analyzed via GC-FID using a BPX 70 capillary column from SGE (15m x 0.25mm x 0.25pm). Each FAME was identified by their retention time and quantified by the injection of a rapeseed oil reference mix from Matreya LLC as the calibration standard. The completeness of the reaction was verified by checking the presence of endogenous FAMES in a fourth extraction/derivation.
[0236] All three events showed a decrease in total Cl6:0 contents and a concomitant increase in total Cl 8 contents in pair-wise comparisons of ZFP TF positive and corresponding sibling null plants within each event (Table 7). For example, event 12 ZFP TF positive plants demonstrated a reduction in 06:0 content by 6.3% and an increase in total Cl8 content by 1.44% compared to its own sibling null plants.
Table 7: T1 leaf fatty acid profile
Sample name Plants Analyzed C16:0 Total C18
Mean Std Dev Mean Std Dev
12null 6 10.98 0.31 69.93 0.91
12ZFP 8 10.29 0.39 70.94 1.02
’3null 7 10.79 0.56 69.84 1.18
3ZFP 12 10.34 0.29 71.25 0.74
6null 5 11.94 0.47 70.36 . 1.91
6ZFP 5 10.44 0.62 72.16 2.88
Example 7: Analysis of ZFP TF Transgenic T2 Seed [0237] A subset of ZFP TF positive plants demonstrating the highest βketoacyl-ACP synthetase Π mRNA expressions and sibling null plants within each event were advanced to maturity to obtain T2 seed (Table 6, column 4). The exception was event 3, where a few ZFP TF positive plants with lower expression ranges were also advanced. These could represent the other segregating insertion of the pDAB4695 transgene. Each T1 plant was covered with a meshed bag to facilitate υ
self pollination within a given plant. Seeds were harvested and fatty acid levels were assayed.
[0238] T2 fatty acid analysis was performed on a pool of 24 seeds per plant as described for T1 seed analysis in Example 6.1. The results showed a decrease in
06:0 content in ZFP TF positive plants of all three events by pair-wise comparison
2017200511 25 Jan 2017 with their corresponding sibling null plants (Tables 8A and 8B). This decrease in C16:0 contents was 12.6%, 11.2% and 22.3% for events 12, 3 and 6, respectively. A consistent decrease was also observed in Cl6:1 content. Corresponding to the decrease in the 06:0 and 06:1 contents, a concomitant increase in total 08 (08:0 + 08:1 + Cl 8:2 + 08:3) content was observed in ZFP TF positive plants in a pairwise comparison with the corresponding sibling null plants. All three pair-wise comparisons of ZFP TF positive and corresponding sibling null plants were statistically significant (p = <0.001) for increases in total 06 (06:0 + 06:1) content, and total C16/total 08 content upon analysis with JMP statistical software (Figure 6, A and B). Although the three events were variable in their 06:0 content based on sibling null plant observations (Tables 8A and 8B), ZFP TF was efficacious in decreasing the 06:0 content to approximately similar levels; between ~ 2.93 to 3.05. While all ZFP TF positive plants of events 3 and 12 set seeds (Tables 8 and 9), only one ZFP TF containing plant of event 6 set seed. This particular plant of event 6 was highest in the 06:0 content based on Tl leaf fatty acid data. Tables 8A and 8B show comparison of T2 fatty acid profile of’three B. napus transgenic events of pDAB4695 ZFP TF positive and corresponding sibling null plants. This data was obtained with FAME analysis and is described in Section 6.1. 02:0 to C24:l fatty acids were analyzed and major ones are shown in these tables. A11 numbers were represented as a percentage of total fatty acids present in/?. napus seeds.
Table 8A: 06:0,06:1,08:0, C:18:l, C:18:2 and C:18:3 fatty acid analysis
Samples 06:0 06:1 08:0 08:1 C18:2 08:3
12Null Mean 3.49 ' 0.26 1.29 76.59 11.45 3.73
Std. Dev. (n=6) 0.06 0.01 0.05 0.25 0.21 0.04
12ZFP Mean 3.05 0.20 1.33 76.53 11.63 3.87
STD DEV
(n=8) 0.11 0.02 0.04 0.39 0.33 0.06
3Null Mean 3.30 0.25 1.31 74.34 13.18 3.94
Std. Dev. (n=7) 0.17 0.02 0.10 1.04 0.86 0.25
3ZFP Mean 2.93 0.18 1.30 74.10 13.62 4.14
STD DEV
(n=12) 0.12 0.01 0.08 1.80 1.45 0.25
6NuIl Mean 3.77 0.38 2.02 73.46 12.42 3.66
Std. Dev. (n=4) 0.15 0.08 0.14 2.80 2.44 0.66
6ZFP (n=l) 2.93 0.17 1.07 77.89 10.65 3.24
2017200511 25 Jan 2017
Table 8B: C20:0, C20:l, C20:2, C22:0, C22:l, C24:0 and C24:l fatty acid analysis
Samples C20-.0 C20:l C20:2 C22:0 C22-.1 C24:0 C24:l
12Null Mean 0.53 1.26 0.05 0.33 0.02 0.14 0.14
Std. Dev. (n=6) 0.03 0.07 0.01 0.04 0.01 0.02 0.02
12ZFP Mean 0.55 1.37 0.06 0.36 0.02 0.15 0.16
STD DEV (n=8) 0.02 0.05 0.01 0.02 0.01 0.01 0.02
3NulI Mean 0.59 1.49 0.06 0.43 0.02 0.15 0.21
Std. Dev. (n=7) 0.07 0.11 0.01 0.07 0.01 0.03 0.04
3ZFP Mean 0.57 1.57 0.07 0.42 0.03 0.15 0.19
STD DEV (n=12) 0.04 0.21 0.02 0.07 0.01 0.04 0.04
6NuII Mean 0.80· 1.49 0.07 0.54 0.03 '0.30 0.24
Std. Dev. (n=4) 0.08 0.13 0.01 0.08 0.01 0.07 0.02
6ZFP (n=l) 0.52 1.86 0.07 0.42 0.04 0.20 0.22
[0239] Table 9 displays total fatty acid profiles based on the individual fatty acids shown in Tables 8A and 8B.
Table 9
Samples Total C18* Total LC** Total Sats***
12Null Mean 93.06 95.52 5.83
STD DEV
(n=6) 0.13 0.05 0.09
12ZFP Mean 93.36 96.01 5.48
STD DEV
(n=8) 0.11 0.13 0.09
3Null Mean 92.78 95.74 5.82
STD DEV
(n=7) 0.39 0.17 0.32
3ZFP Mean 93.16 96.14 5.41
STD DEV
(n=12) 0.41 0.13 0.19
6Nuli Mean 91.55 95.01 7.47
STD DEV
(n-4) 0.36 0.29 0.40
6ZFP ( n=1) 92.85 96.18 5.17
’Total C18 represents a sum of following carbons: Cl 8:0, Cl 8:1, Cl 8:2 and Cl 8:3.
’’Total LC or long chain represents a sum of the following carbons: total Cl 8 + total C20 (C20:0 +
C20:1 + C20:2) + total C22 (C22:0 + C22:l)+ total C24 (C24:0 + C24:l)
1Q ’’’Total Sats represents all saturated fatty acids shown in Tables 8A and 8B.
2017200511 25 Jan 2017 [0240] Combining all long chain fatty acids (total Cl 8, total C20, total C22 and total C24), an increase of 0.4% to 1.2% was observed in ZFP TF positive plants of different events compared to sibling nulls. Among the longer chain fatty acids, an increase of C20;l by 25% was noticeable in ZFP TF positive plants for event 6. A decrease in total saturated fatty acid content was also observed in ZFP TF containing plants in all events. It ranged from a 6% reduction in event 12 to 31% reduction in event 6.
[0241] In summary, ZFP TF-mediated transcriptional up-regulation of the β10 ketoacyl-ACP synthetase II gene in TO and T1 plants and the concomitant decrease in total C16 and increase in total C18 fatty acid contents in T2 seed was exemplified. These data demonstrate the successful application of novel ZFP TF technologies to target and modify specific genes in the fatty acid biosynthesis pathway resulting in predicted changes in seed oil profiles, which are heritable across generations of progeny.
Examples 8-15: FatB Up -regulation/Down-reguIation [0242] Plastids are the major site for de novo fatty acid biosynthesis in higher plants (Ohlrogge et al., 1979, Proc Natl Acad Sci USA76A194-8; Thelen and
Ohlrogge, 2002, Metabolic Engineering 4:12-21). Fatty acids not utilized in the plastids are exported to cytoplasm through the specific activity of acyl-ACP thioesterases (FATs) by hydrolyzing acyl-acyl carrier proteins (acyl-ACP) to release free fatty acids. There are two classes of FAT enzymes in plants, FATA and FATB. The FATA class prefers 18:1-ACP in vitro while the FATB class prefers saturated'· acyl-ACP substrates, such as 16:0-ACP and 18:0-ACP, but also shows other heterogeneous substrate specificity (Doermann et al, 1995, Arch. Biochem. Biophys. 316:612-618; Voelker et al., 1997, Plant Physiology 114: 669-677; Salas and Ohlrogge, 2002, Archives of Biochemistry and Biophysics, 403:25-34). Similar to FATA, FATB is also regarded to be present in all plant tissues, but predominantly expresses in developing seeds (Jha et al., 2006, Plant Physiology and Biochemistry 44:645-655).
[0243] The Arabidopsis nuclear genome encodes for two FatA genes and a single FatB gene. Inactivation of the FatB activity can dramatically decrease saturated fatty acid content in glycerolipids. For example, in a FatB mutant created by the
2017200511 25 Jan 2017 insertion of a T-DNA, palmitate (16:0) and stearate (18:0) content were reduced by 42 - 56% and 30 - 50% respectively depending on the tissue (Bonaventure et al., The Plant Cell, 2003 15:1020-1033). The plant growth rate was greatly impacted in this mutant resulting in 50% less fresh weight at 4 weeks compared to wild-type. This finding supports the view that FatB serves as a major factor governing the fate of the saturated fatty acids in plants.
[0244] The major oilseed crop Brassica napus is an amphidiploid species closely related to the model species Arabidopsis, but has a genome size of approximately eight times larger than that of Arabidopsis. As a result, six FatB genes have been reported in this species (WO 2009/007091) compared to one in Arabidopsis. This complexity makes it difficult to understand the function of individual FatB genes for their manipulation. Conversely, the presence of a higher number of genes makes it easier to manipulate the expression of multiple gene toward the desired fatty acid goal instead of knocking one out completely. Zinc finger transcription factors have been known to bind to essentially any DNA sequence and modulate gene function of the targeted genes (Van Eenennaam et al., Metab. Eng. 2004 6:101-108; Sanchez et al., 2006, Plant Biotechnology Journal 4:103-114). As a result, this tool can be applied to FatB genes for understanding their function in B. napus. This knowledge would assist in manipulating the expression of one to multiple
FatB genes towards desired “healthier” canola seed oil that is lower in saturated fatty acids.
[0245] Examples 8-15 following demonstrate transcriptional up-regulation of
FatB genes in Brassica napus L. resulting in fatty acid profile changes in seeds.
Example 8: Target Sequence Identification for FatB genes in Brassica napus L.
8.1 Target Sequence Identification [0246] A modified Genome Walking protocol was employed to discover and characterize the promoter sequences for the FatB genes of Brassica napus variety Nex710. These nucleotide sequences were isolated and identified for the design and production of ZFP TFs, which can be used to modify gene expression of the FatB gene. Nine genome walking libraries were constructed using the Clontech Genome Walking Kit (Palo Alto, CA). These libraries were used to obtain ~1 kb of sequence upstream of the transcription start site for the FatB genes. A forward pair of nested FatB gene-specific primers were designed and synthesized based on available FatB
2017200511 25 Jan 2017
EST sequences from public databases. A reverse pair of nested primers were designed and synthesized to hybridize to the adapter sequences. Multiple PCR fragments were amplified from the nine libraries. The resulting PCR fragments were cloned into TOPO vectors (Invitrogen, Carlsbad, CA, USA) and sequenced to identify the FatB promoter sequences. Two different FatB genes, FatB4 and FatBS, were identified based on this approach. It was observed that although the coding sequences of these FatB genes were highly conserved, the sequences diverged in the 5’ UTR and promoter regions.
[0247] FatB expression and quantitation of the FatB4 and FatBS genes via quantitative RT-PCR analysis in developing B. napus seed suggested that the genes were highly expressed in B. napus seed. Total RNA was isolated, quantified, and the transcription initiation sites were mapped as described above in Example 1. The promoter sequences of these two genes were utilized to design ZFP TFs for transcriptional expression modification.
Example 9: Design of ZFP DNA Binding Domains Specific to FatB genes [0248] Zinc finger proteins were designed against various targets sites in the
FatB gene. The target sites and recognition helices for representative ZFP designs are shown below in Tables 10A and 10B.
Table 10A: Target binding sites for FatB ZFP TFs
ZFP FatB4 Target site (5' to 3') FatB 5 Target Site (5’ to 3’) FatB specificity
13685* aaCGAAAGgAGATCGAGAGAGg agagag (SEQ ID NO:47) No binding site FatB4
13714 No binding site cgAAAGGGAGATCGAGAGAG gcaccgca (SEQIDNO:48) FatB5
13722 aaGGAGAAcTTTAGGGTTTGGgg agact (SEQ ID NO:49) aaGGAGAAtTTTAGGGTTTGG ggagact (SEQ ID NO:50) FatB4 and FatB5
13743** ctCCGAAGAGATTGGCGTAAcac ttcgt (SEQ IDNO:51) ctCCGAAGAGATTGGCGTAAc cttcatt (SEQ ID NO:52) FatB4 and FatBS
2017200511 25 Jan 2017
Table lOB: ZFP recognition helix regions
ZFP i*** 2 3 4 5 6
13685 RSDNLSA (SEQ ID NO:75) QSAHRKT (SEQ ID N076) RSDDLSK (SEQ ID 140:21) QSSHRKT (SEQ ID NO:77) RSDHLSV (SEQ ID NO:78) QNAHRIE (SEQ ID NO:79)
13714 RSDNLSA (SEQ ID NO:75) QSAHRKT (SEQ ID 140:76) RSDDLSK (SEQ ID 140:21) QSSHRKT (SEQ ID NO:77) RSDHLSK (SEQ ID NO:80) QNANRIT (SEQ ID NO:81)
13722 RSDHLST (SEQ ID NO:82) HSNTRKN (SEQ ID 140:83) RSDHLSQ (SEQ ID 140:84) NSASRKN (SEQ ID NO:85) QSGNLAR (SEQ ID NO: 16) QSGHLSR (SEQ ID NO:86)
13743 NSDSLTE (SEQ ID NO:87) RRADLSR (SEQ ID NO:88) RSDSLSA (SEQ ID NO:89) QNAHRKT (SEQ ID 140:90) RSDHLSQ (SEQ ID NO:84) RNADRIT (SEQ ID NO:91)
““Capital letters represent the ZFP binding sequence while flanking small letters represent the flanking sequence context for ZFP TF binding site. The small italics letters in between the capital letters represent the skipped bases in the ZFP design.
** ZFP binding sequence is the same between FatB4 and FatB5, but the 3 ’ flanking sequences are different between the two genes.
*** numbers represent the zinc finger (1 is finger 1,2 is finger 2, etc.)
Example 10: ZFP TF - Mediated Up-Regulation of Native FatB Genes in B.
napus [0249] To exemplify ZFP TF-mediated up-regulation of FatB within B. napus cells, constructs were built containing four designs of ZFP TF genes (Tables 10 and 11), these genes were stably delivered into B. napus cells through Agrobacteriummediated transformation.
10.1 Construct Design [0250] The ZFP TF binary plasmids designed and constructed are listed in
Table 11 below. Expression of the ZFP TF genes was driven by a relatively strong constitutive promoter, such as a promoter derived from the Cassava Vein Mosaic
Virus (CsVMV) promoter. Agrobacterium-m&liate<l plant transformation was conducted as described in Example 3.2 to stably incorporate ZFP TFs into the B. napus genome.
Table 11: Construct description of ZFP TFs targeted to B. napus FatB genes
2017200511 25 Jan 2017
S.N. ZFP Construct No. Gene Cassette
1 13685 pDAB4689 RB7 MAR/CsVMV/Op-2 NLS-ZFP 13685 VP16/AtuORF23 3' UTR/AtUbilO/Pat/AtuORFl 3' UTR
2 13714 pDAB4690 RB7 MAR/CsVMV/Op-2 NLS-ZFP 13714- VP16/AtuORF23 3' UTR/AtUbilO/Pat/AtuORFl 3' UTR
3 13722 pDAB4691 RB7 MAR/CsVMV/Op-2 NLS-ZFP 13722- VP16/AtuORF23 3'UTR/AtUbilO/Pat/AtuORFl 3’ UTR
4 13743 pDAB4692 RB7 MAR/CsVMV/Op-2 NLS-ZFP 13743- VP16/AtuORF23 3’UTR/AtUbilO/Pat/AtuORFl 3’ UTR
[0251] pDAB4689 is a binary plasmid which contains the opaque-2 (Op-2)
Nuclear Localization Sequence or NLS /13685/ VP 16 and pat gene expression cassettes. This construct includes the following gene elements; RB7 MAR v3 (Matrix Attachment Region (Thompson et al., 1997, WO9727207)):: CsVMV Promoter v2 (Cassava Vein Mosaic Virus Promoter (Verdaguer et al,, 1996, Plant Molecular Biology 31: 1129-1139)) :: opaque-2 NLS (Van Eenennaam et al., 2004, Metabolic Engineering 6:101-108; Holmes-Davis et al., 2005, Plant Molecular
Biology 57:411-423)/13685 Zinc Finger/VP16 (Jamieson et al., Biochem. Biophy. Res. Commun. 2006, 348:873-879) Fusion :: AtuORF23 3’UTR vl (Agrobacterium tumefaciens Open Reading Frame 23, 3’UnTranslated Region (Gelvin et al., 1987, EP222493)):: AtUbilO Promoter v2 (Arabidopsis thaliana Ubiquitin-10 Promoter (Callis, etal., 1990, J. Biol. Chem. 265-12486-12493)) :: patvS (Phosphinothricin
Acetyl Transferase (Wohlleben et al., 1988, Gene 70:25-37)):: AtuORF 1 3’UTR v4 (Agrobacterium tumefaciens Open Reading Frame 1, 3’UnTranslated Region (Huang et al., J. Bacteriol. 172:1814-1822)). The binary was constructed by cloning a DNA fragment containing the opaque-2 NLS/13685 Zinc Finger/VP16 fusion into pDAB3912 viz. Ncol-Sacl restriction sites. The resulting construct which was
2017200511 25 Jan 2017 labeled as pDAB8215 contained the CsVMV Promoter v2 :: opaque-2 NLS/13685 Zinc Finger/VP16 Fusion :: AtuORF23 3’UTR vl gene expression cassette. pDAB8215 was cloned into the pDAB4668 binary via an L-R Gateway Reaction (Invitrogen, Carlsbad, CA). This reaction produced pDAB4689 and was confirmed via restriction enzyme digestions and sequencing reactions.
[0252] . pDAB4690 is a binary plasmid which contains the opaque-2
NLS/13714/VP 16 and pat gene expression cassettes. This construct includes the following gene elements; RB7 MAR v3 :: CsVMV Promoter v2 :: opaque-2 NLS/13714 Zinc Finger/VP16 Fusion :: AtuORF23 3’UTR vl :: AtUbi 10 Promoter v2 :: pat v5 :: AtuORF 1 3’UTR v4. The binary was constructed by cloning a DNA fragment containing the opaque-2 NLS/13714 Zinc Finger/VP16 fusion into pDAB3912 via Ncol- Saclrestriction sites. The resulting construct which was
N labeled as pDAB8216 contained the CsVMV Promoter v2 :: opaque-2 NLS/13714 Zinc Finger/VP16 Fusion :: AtuORF23 3’UTR vl gene expression cassette.
pDAB8216 was cloned into the pDAB4668 binary via an L-R Gateway Reaction (Invitrogen, Carlsbad, CA). This reaction produced pDAB4690 and was confirmed via restriction enzyme digestions and sequencing reactions.
[0253] pDAB4691 is a binary plasmid which contains the opaque-2
NLS/13722/VP 16 and pat gene expression cassettes. This construct includes the following gene elements; RB7 MAR v3 :: CsVMV Promoter v2 :: opaque-2
NLS/13722 Zinc Finger/VP16 Fusion :: AtuORF23 3’UTR vl :: AtUbilO Promoter v2 :: pat v5 (Phosphinothricin Acetyl Transferase :: AtuORF 1 3’UTR v4. The binary was constructed by cloning a DNA fragment containing the opaque-2 NLS/13722 Zinc Finger/VP16 fusion into pDAB3912 via Ncol-Sad restriction sites.
The resulting construct which was labeled as pDAB8217 contained the CsVMV
Promoter v2 :: opaque-2 NLS/13722 Zinc Finger/VP16 Fusion :: AtuORF23 3’UTR vl gene expression cassette. pDAB8217 was cloned into the pDAB4668 binary via an L-R Gateway Reaction (Invitrogen, Carlsbad, CA). This reaction produced pDAB4691 and was confirmed via restriction enzyme digestions and sequencing reactions.
[0254] pDAB4692 is a binary plasmid which contains the opaque-2
NLS/13743/VP 16 and pat gene expression cassettes. This construct includes the following gene elements; RB7 MAR v3 (Matrix Attachment Region :: CsVMV Promoter v2 :: opaque-2 NLS/13743 Zinc Finger/VP16 Fusion :: AtuORF23 3’UTR
2017200511 25 Jan 2017 vl :: AtUbilO Promoter v2 (Arabidopsis thaliana Ubiquitin-10 Promoter :: pat v5 :: AtuORF 1 3’UTR v4, The binary was constructed by cloning a DNA fragment containing the opaque-2 NLS/13743 Zinc Finger/VP16 fusion into pDAB3912 via Ncol- Sacl restriction sites. The resulting construct which was labeled as pDAB8218 contained the CsVMV Promoter v2 :: opaque-2 NLS/13743 Zinc Finger/VPl 6 Fusion :: AtuORF23 3’UTR vl gene expression cassette. pDAB8218 was cloned into the pDAB4668 binary via an L-R Gateway Reaction (Invitrogen, Carlsbad, CA). This reaction produced pDAB4692 and was confirmed via restriction enzyme digestions and sequencing reactions.
Example 11: Analysis of Transformed Callus Samples [0255] Transgenic B. napus callus lines were produced by the transformation of four ZFP TF constructs, pDAB4689 - pDAB4692, and a control construct, pDAB8210, via Agrobacterium - mediated plant transformation as described in
Example 3.2. The control construct, pDAB8210, was comprised of a pat gene expression cassette (AtUbilO Promoter /pat / AtuORFl 3’ UTR) and a non-target ZFN cassette (CsVMV Promoter / ZFN I AtuORF23 3’ UTR). Total RNA was extracted and cDNA synthesized from all lines as described in Example 4.1. The only modification to the previously-described protocol was the use of Oligo dT primers for priming the cDNA reactions instead of random hexamers and the corresponding modification of the cDNA reaction, per manufacturer’s specifications.
11.1 FatB4 and FatB5 mRNA Expression Analysis
11.1.1 FatB4 quantitative Real-time PCR (qRT-PCR) Assay for B, napus [0256] A PCR mix was set up as follows for cDNA amplification of FatB4'.
1.5 pL lOXHot Start PCR Buffer (Qiagen, Valencia, USA), 1.2 pL of 10 mM dNTPs, 1 pL 25 mM MgCl2, 0.15 pL Qiagen Hot Start Taq (5U/pL), 0.5 pL zz!43 FW primer of 10 pM stock (SEQ ID NO: 53: CTTTGAACGCTTATCTTCCTC) (10 pM stock), 0.5 pL FATB5_R4 REV primer of 10 pM stock (SEQ ID NO: 54:
TTCCACAACATCTCCCCAAG), 0.25 pL TaqMan MGB probe (Life Technologies, Carlsbad, California) FatB4_MGB_Probe_4 of 5pM stock ( SEQ ID NO: 55: FAMCTCAGGCTCCACCC), 1.5 pL of 10% (w/v) PVP-40), and H2O to 13.5 pL per reaction. The appropriate quadrant(s) of a 384-well micro-plate were demarcated and filled with 13.5 pL of master mix per well. A sealing foil was then attached to the
2017200511 25 Jan 2017 plate gently. The plate was centrifuged for 1 minute at 3,000 rpm in a Qiagen microplate centrifuge. Next, 1.5 pL thawed, diluted first strand cDNAs were added to appropriate wells, followed by the addition of 1.5 pL plasmid cDNA standards from lowest to highest concentration of DNA into control wells. Finally, a sealing foil was firmly affixed to the plate and centrifuged. The PCR program was run in a
LIGHTCYCLER® 480 Real-Time PCR System (Roche Diagnostics, Indianapolis, IN, USA), using the following program: 1) activate 95°C for 15 minutes; 2)·denature 95°C for 20-30 sec (@ 4.8°C/sec); 3) anneal 60°C for 20-30 sec (@ 2.5°C/sec); 4) acquire 72°C for 45-60 sec (@ 4.8°C/sec); repeat step 2) -- 4), 39-49 more times; 5) cool to
38°C for 5 sec. to stop the reaction.
[0257] The FatB4 amplicon was 678 bp in size. This sequence spans a 79 bp intron based upon the genomic sequence. In addition, the reverse primer was designed to spans an intron thus favoring specific amplification of only FatB4 cDNAs, thereby eliminating amplification of the genomic DNA.
11.1.2 FatB5 qRT-PCR assay for B. napus [0258] A PCR mix was set up as follows for cDNA amplification of FatB5·.
1.5 pL 10X Hot Start PCR Buffer (Qiagen, Valencia, USA), 1.2 pL of 10 mMdNTPs, 1 pL 25 mM MgCh, 0.15 pL Qiagen Hot Start Taq (5U/pl), 0.5 pL zzl45 FW primer of 10 pM stock (SEQ ID NO: 56: CTTTGAAAGCTCATCTTCCTC), 0.5 pL FATB5_R4 REV primer of 10 pM stock (SEQ ID NO; 57: TTCCACAACATCTCCCCAAG), 0.25 pL TaqMan MGB probe (Life technologies, Carlsbad, California) FatB5_MGB_Probe_l of 5pM stock (SEQ ED NO: 58: FAMAACCTTCATCCTCCCA), 1.5 pL of 10% (w/v) PVP-40), and H2O to 13.5 pL per reaction. The remaining assay and the PCR cycle specifications were as described for FatB4 qRT-PCR assay in Example 11.1.1.
[0259] The amplicon produced was 678 bp in size. This cDNA sequence spans a 76 bp intron based upon the genomic sequence. In addition, the reverse primer was designed to span an intron thus favoring the cDNA amplification of
FatB5, thereby eliminating amplification of the genomic DNA,
11.2 Tubulin mRNA Expression analysis [0260] This assay was completed as described in Example 4.3.
2017200511 25 Jan 2017
11.3 ZFP TF mRNA Expression Analysis [0261] To callus sample ZFP TF mRNA analysis was completed as per
Example 4.4. The amplicon size in this assay was less than 1 Kb depending on the ZFP size in each of the designs. To plant ZFP TF expression quantitation was performed with a VP16 activation domain-based assay as follows. A VP16 qRT-PCR mix was set up as follows for cDNA amplification of ZFP TF\ 7.5 pL LIGHTCYCLER® 480 Probes Master 2X Buffer (Roche Diagnostics, Indianapolis, IN, USA), 0.3 pL VP16_UPL_F1 primer of 10 pM stock (SEQ ID NO: 59: TCGATCTTGATATGTTGGGAGA), 0.3 pL VP16_UPL_R1 of 10 pM stock (SEQ
ID NO: 60: AGGTGCAGAATCATGTGGTG), 0.15 pL UPL Probe#85 (Roche
Diagnostics, Indianapolis, IN, USA), 1.5 pL of 10% (w/v) PVP-40), and H2O to 13.65 pL. The appropriate quadrant(s) of a 384-well micro-plate were demarcated and filled with 13.5 pL of master mix per well. A sealing foil was then attached to the plate gently. The plate was centrifuged for I minute at 3000 rpm in a Qiagen micro-plate centrifuge. Thawed, diluted first strand cDNAs were added atl.5 pL, followed by the addition of 1.5 pL plasmid cDNA standards from low to high concentrations into control wells. A sealing foil was firmly affixed to the plate and centrifuged, A PCR program was run in a LIGHTCYCLER® 480 Real-Time PCR System (Roche Diagnostics, Indianapolis, IN, USA) using the following conditions: 1) activate 95°C for 5 minutes; 2) denature 95°C for 10 sec (@ 4.8°C/sec); 3) anneal/Extend 60°C for 25 sec (@ 2.5°C/sec); 4) acquire 72°C for 1 sec (@ 4.8°C/sec); 5) repeat step 2-4, 3949 more times. Finally the reaction was cooled to 38°C for 5 sec. to stop the reaction. [0262] The VP 16 amplicon size was 68 bp this fragment size corresponds to the VP] 6 fragment which was expected to be produced by the PCR amplification.
11.4 Expression analysis of callus samples [0263] Transgenic callus lines growing on HERBIACE® selection were analyzed for FatB4, FatB5, tubulin and ZFP TF expression levels by qRT-PCR. The tubulin gene served as a reference gene to normalize the expression of FatB4, FatB5 and ZFP TF mRNA levels. The FatB4/tubulin and FatB5/tubulin ratios were calculated to normalize mRNA expressions. Results showed statistically significant FatB4 mRNA and FatB5 mRNA up-regulation for construct designs pDAB4691 (p = 0.005; Fig. 9). pDAB4692 callus lines showed an upregulation trend in FatB4 and FatB5 mRNA, but the trend was not statistically significant. pDAB4689 callus lines
2017200511 25 Jan 2017 were also analyzed in a separate experiment, which showed an upregulation trend, but was not statistically significant (data not shown). Control cell lines did not amplify a ZFP TF specific amplicon, confirming that the ZFP TF assay was specific to the ZFP TF expressing lines only.
Example 12: Expression Analysis of Transgenic To Plant Samples
12,1 Assay for B, nanus Actin for use as an internal control for qRT-PCR [0264] Total RNA was extracted and cDNA synthesized from all lines as described in Example 11. A PCR mix was set up as follows for cDNA amplification of actin (Bo Yang et al., 2007, Plant Science 173:156-171; actin gene Genbank accession no. AF111812): 7.5 pL LIGHTCYCLER® 480 SYBR Green I Master 2X Buffer, 0.3 pL BN_Actin_F primer of 10 pM stock (SEQ ID NO: 61: ACGAGCTACCTGACGGACAAG), 0.3 pL BN_Actin_R of 10 pM stock (SEQ ID NO: 62: GAGCGACGGCTGGAAGAGTA), 1.5 pL of 10% (w/v) PVP-40), and q/s with H2O to 13.5 pL. The appropriate quadrant(s) of a 384-well micro-plate were demarcated and filled with 13.5 pL of master mix per well, A sealing foil was then attached to the plate gently. The plate was centrifuged for 1 minute at 3000 rpm in a Qiagen micro-plate centrifuge. Thawed, diluted first strand cDNAs were added atl.5 pL, followed by the addition of 1.5 pL cDNA standards from low to high concentrations in control wells. A sealing foil was firmly affixed to the plate and centrifuged. A PCR program was run in a LIGHTCYCLER® 480 Real-Time PCR System (Roche Diagnostics, Indianapolis, IN, USA) using the following conditions:
1) activate 95°C for 10 minutes; 2) denature 95°C for 10 sec (@ 4.8°C/sec); 3) anneal/Extend 60°C for 20 sec (@ 2.5°C/sec); 4) acquire 72°C for 20 sec (@
4.8°C/sec); 5) repeat step 2-4, 39-49 more times. Finally the reaction was cooled to
38°C for 5 sec. to stop the reaction. The amplicon produced was 80 bp in size.
12,2 FatB4 and FatB5 mRNA Expression Analysis [0265] B. napus plants that had been transformed with pDAB468930 pDAB4691 were assayed for increased mRNA expression of FatB4 and FatB5. In addition, two types of controls were used. A non-transgenic control consisting of Nex710 plants served as a negative control. A second transgenic control of B. napus Nex710 plants which had been transformed with pDAB8210 was also analyzed. The pDAB8210 construct design consisted of two gene expression cassettes. The pat gene
2017200511 25 Jan 2017 expression cassette (AtUbilO promoter :: pat gene :: AtuORFl 3’ UTR) and a nontarget Zinc Finger Nuclease (ZFN) gene expression cassette (AtUbilO promoter :: ZFN gene :: AtuORF23 3’ UTR). The ZFN expressed in pDAB8210 was not expected to bind and cleave the genome of B. napus Nex710 plants and should not alter the phenotype of these plants.
[0266] Putative transgenic calli growing on HERBIACE® selection were regenerated into plants (Example 3.3). Leaf samples were collected from the 6-leaf stage B. napus plants growing in the greenhouse for mRNA expression analysis. Six leaf punches from each plant were isolated and placed on ice prior to RNA extraction.
Total RNA was extracted using the QIAGEN RNEASY kit. cDNA synthesis and subsequent dilutions were completed as described in Example 11. The expression analysis protocol for FatB4 and FatB5 via qRT-PCR is described above. ZFP TF expression analysis was plus/minus with the assay. The actin reference gene qRTPCR assay is described above.
[0267] To leaf expression for FatB4 and FatB5 genes varied between constructs (Fig. 10). The highest FatB4 and FatBS mRNA up-regulation was observed in pDAB4691 transgenic plant events which resulted in ah overall 2.0 - 2.5 fold increases in mRNA expressions as compared to Nex710 non-transgenic and pDAB8210 transgenic controls. Expression of both genes was statistically significant (below p = 0.05) as compared to controls. Therefore, further characterization of the constructs was continued with pDAB4691.
Example 13: Analysis of Transgenic Tj plants
13.1 Fatty Acid Analysis of U seed [0268] A significant difference in Cl8:0 content between “Low” and “High” oil seed of event pDAB4691-003-049.1 (“event 49”) was observed (Table 12). The C18:0 content of the “Low” category seed was similar to that of the Nex710 (nontransgenic control) and pDAB8210 (transgenic control) lines. The Cl 8:0 content in the “High” seed correlated with ZFP TF expression which resulted in FatB gene(s) up-regulation. Some increases in C20:0, C22:0 and C24:0 were also observed based on the flow of C18:0 into longer chain fatty acids. 06:0 content in individual seed did not appear to change within either of the “Low” or “High” categories. This result is indicative of the fact that pDAB4691 ZFP TF binds and up-regulates the FatB
2017200511 25 Jan 2017 gene(s) specific for C18:0-ACP to Cl 8:0 enzymatic reactions rather than the 06:0ACP to 06:0 reactions (see Example 1, Fig. 1).
Table 12: Fatty Acid profile of individual Tj seed measured with FAME analysis
Samples* Total Sats 06:0 06:1 08:0 C20:0 C22:0 C24:0
Event 49 Low 6.35 4.11 0.48 1.45 0.46 0.21 0.07
Event 49 Low 6.35 3.70 0.35 1.62 0.58 0.30 0.12
Event 49 Low 6.49 3.64 0.36 1.66 0.62 0.32 0.18
Event 49 High 7.50 3.55 0.42 2.59 0.80 0.34 0.17
Event 49 High 7.74 3.63 0.45 2.59 0.88 0.38 0.22
Event 49 High 7.93 3.67 0.47 2.82 0.86 0.38 0.17
Event 49 Mean (n=24) 6.90 3.70 0.40 2.03 0.67 0.31 0.15
Event 49 Std Dev (n=24) 0.51 0.14 0.05 0.37 0.10 0.04 0.03
Nex710 Mean (n=24) 6.47 3.70 0.45 1.79 0.57 0.26 0.11
Nex710 Std Dev (n=24) 0.35 0.24 0.06 0.17 0.06 0.04 0.03
8210 Mean (n= 150) 6.27 3.51 0.34 1.63 0.61 0.33 0.14
8210 Std Dev (n=l 50) 0.40 0.24 0.07 0.25 0.08 0,05 0.04
*Fatty acid analysis was performed on 24 individual Tj seec of event 49 and ' Nex710,
and 144 seed of pDAB8210 comprised of 6 events. “Low” and “High” categories represent specific FA content of the individual seed when sorted based on 08:0 content.
13.2 ZFP TF Presence Analysis in Ti Plants 10 [0269] One-hundred Tt seeds of event 49 were planted in the greenhouse.
Ninety-seven plants germinated into seedlings. ZFP TF copy number was estimated using a pat qRT-PCR assay as described in Example 6.2 for plant material isolated from the 2-4 leaf stage. Event 49 contained multiple insertions (~3 insertions) and 0-7 pat gene, and hence ZFP TF, copies segregated into the Ti population. Only one null plant was identified from the Ti population.
2017200511 25 Jan 2017
13,3 FatB4 and FatB5 mRNA up-regulation in Ti plants [0270] Native FatB gene expression analysis was performed on all 97 plants of the segregating T| population. Non-transgenic Nex710 plants which were planted at the same time were included in the study as controls. Six-leaf punches per plant were harvested and placed on ice until RNA extraction could be completed. Total RNA was extracted using the QIAGEN RNEASY kit. cDNA synthesis and subsequent dilutions were completed as described in Example 11. Expression analysis oiFatB4, FatBS, tubulin and VP 16 (ZFP TF) was performed as described above.
[0271 ] Statistical analysis of the ratios of FatB4fFatB5 and tubulin showed significant linear trends with tubulin expression (Fig. 11) indicating that increases in FatB4/FatB5 did not have a 1:1 relationship with increases in the endogenous control, tubulin. As such, the ratios were not used in this analysis, and tubulin was included as a covariable in models of the expression oiFatB4/FatB5. To remove any co-linearity between tubulin and VP 16 (ZFP TF), the incidence matrices for the model equations were orthagonalized.
[0272] The following model was fit to all datasets in the current study: where status, is the transgenic status of y,jk (transgenic or null/control);
yiJk = statust + transgenic * VP16 + eiJk transgenic* VP 16 is a linear regression on VP 16 nested within transgenic lines; and ejjk is the random residual. Given that there were three repeated measurements for each sample, a correlated residual structure was used:
25 r Ί Φ Φ
R-σ2 e I ® n Φ 1 Φ
Φ Φ 1
where In is the identity matrix with rank equal to the number of samples and φ is the 30 correlation between residuals of repeated measures.
[0273] Results of analysis for event 49 detected significant up-regulation in
FatB4 with nested regressions of FatB4 expression on VP 16 showing highly significant positive slopes (Fig. 12, Table 13). For FatB5, nested regressions showed positive slopes for up-regulation, and the slope was statistically significant. For the
2017200511 25 Jan 2017 up-regulation events it should be noted that the transformed and control plants were not from the same line so there could be some confounding of the line and transformation effects.
Table 13: Results for up-regulation events
Event Gene Effect Solution P-Value
4691-3-049.001 FatB4 Transformed-control 10331.11 <0.00001
T ransformed* VP 16 0.764E-05 <0.00001
FatB5 Transformed-control 5084.09 <0.00001
Transformed* VP16 0.308E-05 <0.00001
ATransformed-control - the difference in least square mean expression between transformed lines and lines not carrying transgenes. Transformed*VP16 = regression of FatB4/FatB5 expression on VP16 expression nested within transgenic lines.
[0274] Event 49 Τi plants were then sorted based on the FatB4/tubulin and then FatB5/tubulin expression ratios to find the highest expressing plants for advancement to T2 generation in the greenhouse. Eight of the highest expressing FatB4 plants were selected for advancement to maturity. Six of these plants were also the highest expressing for FatB5. The ZFP TF copy number in these highest expressing plants varied from 2-4 copies while the copy number that segregated in the entire T1 progeny were 0 -7 copies. For control plants, one null plant of event 49 and ten Nex710 control plants were also advanced to maturity for T2 seed collection.
13.4 Fatty Acid analysis of T7 seed [0275] · Fatty acid (FA) analysis was performed on a 24 seed bulk of all plants as described in Example 6.1. The FA profile of one null plant was combined with ten Nex710 control plants for control FA profile calculations. On average, a 12% increase in the C18:0 content was observed for event 49 compared to that of Nex710 (Tables 14A and 14B). This increase was statistically significant at p = 0.05 (Fig. 13). The long chain FAs, such as C20:0, C22:0 and C24:0, also showed some increases leading to increase in the total saturated FA content by 5%. Since FatB enzyme catalyzes the conversion of 08:0 ACP into Cl8:0 free FA, more 08:0 will be accumulated as a result MFatB4 and FatB5 transcriptional up-regulation (Fig. 1). The pDAB4691 (Example 6, Tables 1 and 2), is specific to both FatB4 and FatB5 genes, which resulted in a significant change in the FA profile (Tables 14A and 14B).
2017200511 25 Jan 2017
Table 14A: Fatty acid profile (06:0, 06:1, 08:0,08:1, 08:2 and
08:3) of event 49 transgenic and Nex710 control samples
S.N. Plant ID Total Sats 06:0 06:1 08:0 08:1 08:2 08:3
1 4691-3-049 (8) 6.42 3.47 0.24 1.61 76.32 11.20 3.52
2 Nexera710 (11) 6.11 3.40 0.23 1.44 76.26 11.25 3.76
Numbers in brackets in column 2 represent number of plants analyzed.
Table 14B: Fatty acid (C20:0, C20:l, C20:2, C22:0, C22:l, C24:0, C24:l) profile of event 49 transgenic and Nex710 control samples
S.N. Plant ID Total Sats C20:0 C20:l C20:2 C22:0 C22:l C24:0 C24:l
1 4691-3- 049 (8) 6.42 0.66 1.39 0.05 0.43 0.02 0.21 0.18
2 Nexera710 (11) 6.11 0.61 1.43 0.06 0.41 0.02 0.20 0.17
Numbers in brackets in column 2 represent number of plants analyzed.
[0276] No significant changes in total 06 content was observed with native
FatB4 andFatB5 gene up-regulation. It is likely that catalysis of C16:0-ACP to 06:0 occurs with other FatB genes but not with FatB4 and FatBS, the exemplified targets for up-regulation using the pDAB4691 ZFP TF design (Fig. 1).
[0277] Individual seed 06:0 content did not appear to change in TI seed “Low” and “High” categories (Table 12), indicative of the fact that pDAB4691 ZFP
TF design more specifically binds to the FatB gene(s) for C18:0-ACP to 08:0 enzymatic reaction rather than C16:0-ACP to 06:0 reaction (Fig. 1), [0278] It should be noted that up-regulation of the native β-ketoacyl-ACP synthetase II genes (Examples 1-6) induced by ZFP TF brought about different changes in the FA profile as compared to the native FatB4 and FatBS gene up20 regulations. For example, β-ketoacyl-ACP synthetase II gene up-regulation caused statistically significant reduction in 06:0 and 06:1 contents and concomitant
2017200511 25 Jan 2017 increase in total Cl 8 content as compared to their null segregants ( Example 6, Fig. 6, Tables 5 and 8). Comparatively, ZFP-TF-mediated FatB gene up-regulation caused statistically significant increases in the Cl 8:0 content but no apparent change in the 06:0 content (Fig. 14). Again these changes in the FA profiles through ZFP TF5 mediated up-regulation of the β-ketoacyl-ACP synthetase II and FatB genes concur as per the FA biosynthesis pathway (Fig. 1).
Example 14: ZFP TF Constructs Design for Plant Transformation [0279] Four constructs were designed and built for transcriptional down10 regulation of the FatB genes in B. napus L (Table 15). The best FatB up-regulation ZFP designs, 13722 and 13714, were employed for demonstration oiFatB downregulation (Examples 9 -13). These ZFP designs were fused to an opaque-2 nuclear localization signal and a repression domain consisting of either KRAB1 (Hanna-Rose and Hansen, 1996, Trends in Genetics, 12:229-234) or NtERF3 (Ohta et al., The Plant
Cell, 2001, 13:1959-1968), to construct functional ZFP TFs. All ofthe ZFP TFs were expressed under seed-specific promoters; either the Arabidopsis thaliana Lipid Transfer Protein 2 Promoter (AtLTP170 Promoter) (Genbank ID: NC_003076) or the Phaseolus vulgaris β-Phaseolin Promoter (PvPhas Promoter) (U.S. Patent No. 5,591,605) were used.
Table 15: ZFP TF construct details for targeted down-regulation of FatB genes
S.N. ZFP design Construct No. Gene Cassettes
1 13722 pDAS5203 AtLTP170/Op-2* NLS-ZFP-13722-KRAB1/ORF23 3' UTR//AtUbilO/Pat/AtuORFl 3' UTR
2 13714 pDAS5204 AtLTP170/Op-2 NLS-ZFP-13714-KRAB1/ORF23 3' UTR//AtUbilO/Pat/AtuORFl 3' UTR
3 13722 pDAS5212 PvPhas/Op-2-NLS-ZFP13722-KRABl/Phas 3' UW/AtUbilO/Pat/AtuORFl 3'UTR
4 13722 PDAS5227 AtLTP170/Op-2 NLS-ZFP-13722-NtERF3/ORF23 3' UW/AtUbilO/Pat/AtuORFl 3' UTR
* Op-2 = Opaque-2 Nuclear Localization Signal [0280] pDAS5203 is a binary plasmid which contained the opaque-2
NLS/13722/KRAB1 and pat gene expression cassettes. This construct includes the following gene elements; AtLTP Promoter 170 :: opaque-2 NLS/13722 Zinc
Finger/KRABl Fusion :: AtuORF23 3’UTR vl :: AtUbi 10 Promoter v2 :: pat v5 ::
2017200511 25 Jan 2017
AtuORFl 3’UTR v4. The binary was constructed by cloning a DNA fragment containing the opaque-2 NLS/13722 Zinc Finger/KRABl fusion into a Gateway donor vector. The resulting construct contained the AtLTP Promoter 170 :: opaque-2 NLS/13722 Zinc Finger/KRABl Fusion :: AtuORF23 3’UTR vl gene expression cassette. This construct was cloned into a binary via an L-R Gateway Reaction (Invitrogen, Carlsbad, CA). This reaction produced pDAS5203 and was confirmed via restriction enzyme digestions and sequencing reactions.
[0281] pDAS5204 is a binary plasmid which contained the opaque-2
NLS/13714/KRAB1 and pat gene expression cassettes. This construct includes the following gene elements; AtLTP Promoter 170 :: opaque-2 NLS/13714 Zinc
Finger/KRABl Fusion :: AtuORF23 3’UTR vl :: AtUbilO Promoter v2 :: patvS :: AtuORFl 3’UTR v4. The binary was constructed by cloning a DNA fragment containing the opaque-2 NLS/13714 Zinc Finger/KRABl fusion into a Gateway donor vector, The resulting construct contained the AtLTP Promoter 170 :: opaque-2
NLS/13714 Zinc Finger/KRABl Fusion :: AtuORF23 3’UTR vl gene expression cassette. This construct was cloned into a binary via an L-R Gateway Reaction (Invitrogen, Carlsbad, CA). This reaction produced pDAS5204 and was confirmed via restriction enzyme digestions and sequencing reactions.
[0282] pDAS5212 is a binary plasmid which contains the opaque-2
NLS/13722/KRAB1 and pat gene expression cassettes. This construct includes the following gene elements; PvPhas Promoter :: opaque-2 NLS/13722 Zinc Finger/KRABl Fusion :: AtuORF23 3’UTR vl :: AtUbilO Promoter v2 :: pat v5 ·:; AtuORFl 3’UTR v4. The binary was constructed by cloning a DNA fragment containing the opaque-2 NLS/13722 Zinc Finger/KRABl fusion into a Gateway donor vector. The resulting construct contained the PvPhas Promoter :: opaque-2 NLS/13722 Zinc Finger/KRABl Fusion :: AtuORF23 3’UTR vl gene expression cassette. This construct was cloned into a binary via an L-R Gateway Reaction (Invitrogen, Carlsbad, CA). This reaction produced pDAS5212 and was confirmed via restriction enzyme digestions and sequencing reactions.
[0283] pDAS5227 is a binary plasmid which contains the opaque-2
NLS/13722/NtERF3 and pat gene expression cassettes. This construct includes the following gene elements; RB7 MAR v3 :: AtLTP Promoter 170 :: opaque-2 NLS/13722 Zinc Finger/NtERF3 Fusion :: AtuORF23 3’UTR vl :: AtUbilO Promoter v2 :: pat v5 :: AtuORFl 3’UTR v4. The binary was constructed by cloning a DNA
2017200511 25 Jan 2017 fragment containing the opaque-2 NLS/13722 Zinc Finger/NtERF3 fusion into a Gateway donor vector. The resulting construct contained the AtLTP Promoter 170 :: opaque-2 NLS/13722 Zinc Finger/NtERF3 Fusion :: AtuORF23 3’UTR vl gene expression cassette. This construct was cloned into a binary via an L-R Gateway
Reaction (Invitrogen, Carlsbad, CA). This reaction produced pDAS5227 and was confirmed via restriction enzyme digestions and sequencing reactions.
[0284] The constructs were stably transformed into B. napus variety Nex710 by Agrobacterium-me&ated. transformation of hypocotyl explants (Example 3.2 3.3). To plants growing in the greenhouse were self pollinated and Ti seed collected four months after transplanting.
Example 15: Analysis of Tl seed transgenic for 4 ZFP TF constructs [0285] Tj seeds were obtained from transgenic events (lines) 8, 20, 37 and 15 of constructs pDAS5203, pDAS5204, pDAS5212 and pDAS5227, respectively. Five
Nex710 plant seed were used as controls. FA analysis was performed on 24 individual seeds of each of the T i transgenic event, as described earlier in Example 6.1, to first identify the ZFP TF construct that most effectively alters the FA profile.
15.1 Fatty Acid (FA) Analysis ofTl seed [0286] Constructs pDAS5203, pDAS5212 and pDAS5227 produced transgenic events with the lowest total saturated FA profiles in comparison to control Nex710 (Table 16). Pair wise differences between each of the two construct events, pDAS5203 and pDAS5212, and Nex710 control were significant (p=<0.005).
' However the pair wise difference of pDAS5227 exhibited a strong trend (p=0.06).
One of the events from pDAS5203 contained the lowest total saturated FA content of 5.3% (not shown) compared to an average of 6.38% in the Nex710 control. This is a 17% reduction in total saturated FAs.
2017200511 25 Jan 2017
Table 16A: Tl seed FA profile of multiple construct transgenic events
Construct No. Type of Analysis Total Sats 04:0 06:0 06:1 08:0 08:1 08:2 08:3
pDAS5212 Mean (n=37)* 6.00 0.05 3.60 0.24 1.38 75.88 12.24 3.41
PDAS5212 Std Dev (n=37) 0.21 0.01 0.20 0.02 0.14 1.36 1.03 0.41
PDAS5212 p value** 0.01 0.07 0.89 0.47 <0.0001 0.39 0.37 0.94
pDAS5204 Average (n=20) 6.26 0.05 3.52 0.25 1.65 76.33 11.52 3.58
pDAS5204 Std Dev (n=20) 0.29 0.01 0.15 0.02 0.16 0.78 0.66 0.30
PDAS5204 p value 0.43 0.72 0.52 0.69 0.32 0.16 0.04 0.34
PDAS5203 Average (n=8) 5.98 0.05 3.68 0.26 1.33 75.32 12.74 3.55
PDAS5203 Std Dev (n=8) 0.36 0.01 0.25 0.05 0.13 1.76 1.31 0.47
pDAS5203 p value 0.02 0.06 0.45 0.96 0.0001 0.96 0.98 0.49
PDAS5227 ' Average (n=15) 6.09 0.03 3.63 0.32 1.32 75.43 12.32 3.73
pDAS5227 Std Dev (n-15) 0.35 0.00 0.29 0.09 0.12 1.69 1.36 0.37.
PDAS5227 p value 0.07 0.002 0.69 0.012 <0.0001 0.84 0.48 0.1
Nex710 Average (n=5) 6.38 0.04 3.59 0.26 1.73 75.28 12.76 3.40
Nex710 Std Dev (n~5) 0.61 0.01 0.15 0.03 0.49 3.00 2.76 0.43
* Numbers in brackets show the number of events included in analysis.
♦*p value of equal or less than 0,05 was considered statistically significant and was calculated with JMP software.
2017200511 25 Jan 2017
Table 16B: T1 seed FA profile of multiple construct transgenic events
Construct No. Type of Analysis Total Sats C20:0 C20:l C20:2 C22:0 C24:0 C24:l
pDAS5212 Mean (n=37)* 6.00 0.54 1.33 0.06 0.30 0.13 0.08
pDAS5212 Std Dev (n=37) 0.21 0.04 0.11 0.01 0.03 0.05 0.04
pDAS5212 p value** 0.01 0.03 0.003 0.14 0.76 0.26 0.23
pDAS5204 Average (n=20) 6.26 0.59 1.20 0.05 0.32 0.13 0.11
pDA85204 Std Dev (n=20) 0.29 0.06 0.17 0.01 ' 0.05 0.05 0.03
pDAS5204 p value 0.43 0.79 0.20 0.87 0.68 0.29 0.63
pDAS5203 Average (n=8) 5.98 0.51 1.28 0.05 0.29 0.12 0.11
pDAS5203 Std Dev (n=8) 0.36 0.03 0.15 0.01 0.02 0:01 0.05
pDAS5203 p value 0.02 0.006 0.048 0.42 0.56 0.55 0.84
PDAS5227 Average (n=15) 6.09 0.56 1.39 0.06 0.39 0.15 0.16
pDAS5227 Std Dev (n=15) 0.35 0.07 0.23 0.01 0.10 0.08 0.05
pDAS5227 p value 0.07 0.21 0.0005 0.066 0.008 0.081 0.004
Nex710 Average (n=5) 6.38 0.60 1.10 0.05 0.31 0.11 0.10
Nex710 Std Dev (n=5) 0.61 0.13 0.09 0.01 0.07 0.05 0.08
* Numbers in brackets show the number of events included in analysis.
**p value of equal or less than 0.05 was considered statistically significant and was calculated with JMP software.
[0287] The specific FAs profiles of events pDAS5203, pDAS5212 and pDAS5227 resulted in a 21-25% reduction in Cl8:0 as compared to Nex710 (Fig. 15A). All of these differences were statistically significant at or below p = 0.001 (Table 16). Other long chain FAs, C20:0, C22:0 and C24:0 also showed declines in concentration. However, no changes in 06:0 content was observed resulting in a significant increase in 06:0/08:0 content in all three construct transgenic events (Fig. 165B).
2017200511 25 Jan 2017 [0288] FA profile of pDAS5227 transgenic seed showed a distinct difference as compared to pDAS5203 and pDAS5212. A 23% reduction in 04:0 (p = 0.002) and a 19% increase in 06:1 (p = 0,01) contents were observed in pDAS5227 seed as compared to Nex710 (Fig. 16A & B, Table 16). The pDAS5227 ZFP TF design is identical to that of pDAS5203 and pDAS5212 except for the presence of an ERF3 down-regulation domain fused to ZFP instead of a KRAB1 domain (Table 15).
[0289] A different ZFP design, 13714, present in pDAS5204 was not as effective in 08:0 reduction compared to the 13722 design (Table 16). Unlike the 13722 design which binds to both the FatB4 and FatBS genes, the 13714 design binds • 10 only to the FatBS gene (Example 9, Table 10B).
15.2 Identification of plants for mRNA analysis [0290] Two transgenic events, 5212[1]-004 and 5227[4]-012, which were produced by transformation with constructs pDAS5212 and pDAS5227, respectively, were selected for FatBS transcriptional down-regulation analysis. Fifty to onehundred Ti seed were planted in the greenhouse and plants were grown. Four leaf punches were collected from plants at the 2-3 leaf stage. This plant material was analyzed for ZFP TF copy number using a pat qRT-PCR assay (Example 6.2). Random ZFP null and ZFP positive plants were then selected for advancement to maturity to collect T2 seed (Table 17). Immature pods from the same plants were collected 25 days after flowering (DAF) for FatB mRNA analysis. Both events segregated as a single copy. These events were labeled as 5212-4 and 5227-12.
2017200511 25 Jan 2017
Table 17: Transgenic event screening for identification of ZFP positive and null plants.
Event Name T1 Seed/plant Plant No. Copy No. #Plants to T2
5212-004 Seed planted 50
Seed germinated 49
Screening for pat copy number 17 Null 5
26 1 copy 3
5 2 copy 4
1 NT*
ChiTest 0.04
5227-12 Seed planted 100
Seed germinated IP ' 96
Screening for pat copy number 19 Null 4
32 1 copy 3
27 2 copy 4
18 ΝΓ
ChiTest 0.034
*NT = Not tested.
15.3 RNA Extraction and qRT-PCR Assay Development [0291] RNA was isolated from immature Brassica seed with the plant
RNAEASY® kit obtained from Qiagen (Valencia, CA). Seeds were placed in cluster tubes containing RLT buffer (Qiagen) /β- mercaptoethanol (BME) and a stainless steel bead. Samples were put into a cluster tube rack and homogenized at 500 strokes per min for 5 minutes in a bead mill (Kleco, Visalia, CA). The tube rack was turned 180 degrees and homogenized for an additional 5 minutes. Samples were then transferred to 1.5 ml Eppendorf tubes and centrifuged for 5 minutes at 20,000 x g and the supernatant was transferred to a fresh tube. RNA was isolated as describe by the manufacturers protocol (Qiagen; Valencia, CA). RNA was eluted from the columns with 50 uL of RNase free water and the RNA samples were quantified with a NanoDrop 8000 by Thermo Scientific (Wilmington, DE).
[0292] Ten to twenty micrograms of the RNA was treated with TURBO
DNA-free (catalog number AMI907; Applied Biosystems, Foster City, CA) DNase in
1.5ml RNase/DNase free tubes to remove genomic DNA. For each RNA sample a fifty microliter reaction was prepared containing RNA, IX DNase buffer, and 2 units of TURBO DNase. Reactions were incubated at 37°C for 30 minutes. Five microliters (5 μΐ) of DNase inactivation reagent was added to each tube and mixed. Samples were incubated at room temperature for three minutes, mixed again, and
2017200511 25 Jan θ incubated at room temperature for an additional two minutes. Samples were
CN centrifuged at 20,000xg for five minutes. Forty microliters (40 pi) of the supernatant was removed while leaving behind the DNase inactivation slurry. Each DNase treated sample was quantified with the Nanodrop so that equivalent amounts of RNA could be used for cDNA synthesis.
[0293] Complementary DNA (cDNA) was prepared for each RNA sample by using the cDNA High Capacity kit (Applied Biosystems, Foster City, CA). Briefly, 1.5μ g of RNA was used as template in a fifty microliter reaction containing IX reverse transcription buffer, IX dNTPs, IX random oligomers, and 125 units of 10 Multiscribe reverse transcriptase. Additionally, noRT control reactions were prepared for each using 1,5pg of DNase treated RNA under the same conditions as above without the Multiscribe reverse transcriptase. All samples were incubated at 25°C for 10 minutes, 37°C for 2 hours, 85°C for 5 minutes, and overnight at 4°C.
[0294] Primers and probes were designed with the Primer Express 3 software from Applied Biosystems (Foster City, CA) for FATB, KASII, ERF3, KRAB1, and Tubulin. Primers were synthesized by Integrated DNA Technologies (Coralville, IA). The following are the sequences for the primers:
SEQ ID NO: 63: FATB5 fwd - 5’ TCGCTGCCATAACAACCATTT 3’;
SEQ ID NO: 64: FATB5 rev - 5’ CGCCTGGGTTTCCAGTCA 3’;
SEQ ID NO: 65: KRAB1 fwd - 5’ AAGGATGTGTTCGTGGATTTCA 3’;
SEQ ID NO: 66: KRAB1 rev - 5’ CACAATCTGCTGTGCAGTATCAAG 3’;
SEQ ID NO: 67: ERF3 fwd - 5’ GCGGGCGGGAGTTGTTA 3’;
SEQ ID NO: 68: ERF3 rev - 5’ CCCCATCGGCGTTACATG 3’;
SEQ ID NO: 69: TUBULIN fwd - 5’ GAAGCTGAGAACAGCGATTGC 3’;
SEQ ID NO: 70: TUBULIN rev - 5’ GTTCCTCCTCCCAACGAATG 3’.
Probes were 6FAM/MGB synthesized by Applied Biosystems (Foster City, CA):
SEQ ID NO: 71: FATB5 probe 6FAM TTTCTCAGCCGCCA;
SEQ ID NO: 72: KRAB1 probe 6FAM TAGGGAAGAGTGGAAGCT;
SEQ ID NO: 73: ERF3 probe 6FAM CAGGCCTCAGCCTT; and 30 SEQ ID NO:74: TUBULIN probe 6FAM TACAAGGTTTCCAAGTTT.
[0295] The gene expression ofFatB, ERF3, KRAB1 and tubulin were evaluated by real-time PCR with an Applied Biosystem 7900HT (Foster City, CA). A standard curve was prepared using aliquots of several cDNA samples within the
2017200511 25 Jan 2017 different groups to establish the dynamic range and efficiency of the assay. Subsequent 1:5 and 1:4 serial dilutions of the initial dilution were made. Each cDNA sample was diluted 1:50 with lOmM Tris, pH7.5. PCR reactions were prepared in a twenty microliter volume containing IX Gene Expression Master Mix (Applied
Biosystems; Foster City, CA)S 0.8 μΜ of forward and reverse primers, 0.2 μΜ of gene specific 6FAM/MGB probe and 4 microliter of diluted cDNA. All reactions were run under the following conditions in the Applied Biosystem 7900HT with SDS version
2.4 software: Step 1) 50°C for 2 minutes; Step 2) 95°C for 10 minutes; Step 3) at 95°C for 15 seconds, and; Step 4) at 60°C for 1 minute. Steps 3 and 4 were repeated for 39 additional cycles. Tubulin gene expression was evaluated on each plate whereas FatB, ERF3, and KRAB1 were run separately. All reactions were carried out in triplicate.
[0296] Standard curves were evaluated for regression and slope and threshold values adjusted as necessary. The noRT samples (minus reverse transcriptase controls that contained RNA with all cDNA reaction components except the reverse transcriptase) were compared with corresponding samples to ensure that a Ct difference of 5 to 7 was present. The data was imported into Excel for analysis. The average quantity value of FatB, ERF3, and KRABl was normalized to the quantity average of tubulin and reported as FatB and tubulin expression ratios.
15.4 Analysis of seed-specific FatB5 mRNA down-regulation in immature seeds [0297] Results showed that FatB mRNA down-regulation 25 days after flowering (DAF) in immature seed was dependent on the state of zygosity of the Ti plants. For example, no apparent FatBS mRNA down-regulation was observed in the heterozygous plants (1 copy) of 5227-12 immature seed (Fig. 17). However, when the ZFP TF expression increased to 2-fold in the homozygous plants (2 copy), a 21% reduction in FatB5 mRNA expression was observed (p = 0.025). Similar results were obtained in another event, 5212-4, of a different construct, pDAS5212. In this event, again, no apparent FatB5 down-regulation was observed in the heterozygous plants (Fig, 18). However, a 15% reduction in the FatBS transcripts was observed in the homozygous plants when ZFP TF expression increased.
]0298] The null, heterozygous and homozygous plants of both events were advanced to maturity and FA profile was determined in a pool of 24 seed of each plant. This process of segregating out null lineages from the ZFP TF-containing lineages permitted FA profile differences which more closely reflected the presence of the ZFP TF.
2017200511 25 Jan 2017
15.4 Analysis of FA profile in T? Mature seed 5 [0299] T2 mature seed FA profiles varied depending upon the ZFP TF zygosity of the Ti parent plant for event 5227-12 (Tables 18A and 18B). Although the heterozygous T] plants did not exhibit any apparent FatB mRNA down-regulation in 25 DAF immature seed, their seed FA profile exhibited an 8% reduction in Cl 8:0 content, No significant decrease in Cl6:0 content was observed. In addition, minor
10' increases in Cl8:1 (oleic) and subsequent down-stream FAs were observed resulting in an overall 5.5% reduction in total saturated FA (Tables 18A and 18B, Fig. 19). When 5227-12 T) plants were homozygous for ZFP TF, the FatB mRNA was downregulated significantly. The FA profile of these T2 seed was different. An 11% increase in Cl6:1 content was observed resulting in a 2.7% reduction in total saturated
FA (Tables 18A and 18B). However, no further reduction in Cl 8:0 as compared to the heterozygous plants was observed. These changes concurred with the Ti mature seed FA profile (Example 15.1).
Table 18A: Indicated FA profile of T2 mature seed of event 5227-12
Plant ID Copy # Total Sats 04:0 06:0 06:1 08:0 08:1 (Oleic) 08:1 (vaccenlc) Total 08:1 08:2 08:3
5227-12 Mean (n=4) 0 7.21 0.05 4.00 0.28 2.06 71.47 5.27 76.74 10.92 3.22
5227-12 Std Dev (n=4) 0 0.21 0.01 0.09 0.02 0.10 0.56 0.29 0.62 0.29 0,34
5227-12 Mean (n~3) 1 6.84 0.05 3.82 0.25 1.88 71.99 4.88 76.87 11.03 3.33
5227-12 Std Dev (n=3) 1 0.33 0.01 0.33 0,03 0.04 0.50 0.19 0.32 0.05 0.31
5227-12 Mean (n=4) 2 7.00 0.05 3.96 0.30 1.91 70.99 5.09 76.08 11.62 3,30
5227-12 Std Dev (n=4) 2 0.29 0.00 0.47 0.03 0.40 1.50 0.25 1.44 1.21 0.26
2017200511 25 Jan 2017
Table 18B: FA profile of T2 mature seed of event 5227-12
Plant ID Copy Number Total Sats C20:0 C20:l C20:2 C22:0 C24:0 C24:l
5227-12 Mean (n=4) 0 7.21 0.64 1.01 0.04 0.27 0.13 0.09
5227-12 Std Dev (n=4) 0 0.21 0.03 0.02 0.01 0.01 0.03 0.01
5227-12 Mean (n=3) 1 6.84 0.62 1.07 0.04 0.28 0.12 0.09
5227-12 Std Dev (n=3) 1 0.33 0.02 0.11 0.00 0.03 0.02 0.01
5227-12 Mean (n=4) 2 7.00 0.62 1.06 0.04 0.27 0,12 0.08
5227-12 Std Dev (n=4) 2 0.29 0.09 0.03 0.01 0.03 0.03 0.01
[03001 Similar results were obtained in T2 mature seed FA profiles of event
5212-4. In heterozygous plant seed, a 5.5% reduction in 08:0 content was observed resulting in a total saturated FA reduction of 3.2% (Table 18, Fig. 20). A minor increase in 08:1 was also observed; otherwise the concentrations of the remaining FAs exhibited minor decreases. Homozygous plants did not show a higher reduction in 08:0 content as compared to that of hemizygous plants despite significant downregulation of FatB mRNA.
[0301] In summary, transcriptional down-regulation of the FatB5 gene with seed-specific expression of ZFP TFs has been demonstrated in these examples. The ZFP TFs were effective in conferring transcriptional down-regulation of the target FatBS gene in T2 homozygous seed.' However, the reduction in Cl 8:0 in T2 homozygous seed was not more than that of T2 segregating seed. These results indicate that the homozygous ZFP TF copies may be triggering a feedback mechanism to adjust the FA profile since the FatB genes are indispensible for plant growth and development (Bonaventure et al., The Plant Cell, 2003 15:1020-1033). It is noteworthy that FatB mRNA down-regulation mediated by ZFP TF in the immature seed is inversely related to that of FatB up-regulation for changes in the 08:0 content.
100
2017200511 25 Jan 2017 [0302] These examples show that ZFP TF targeted effects on the native FatB genes specifically altered FatB mRNA quantity, thus resulting in specific and heritable FA profile changes in B. napus.
Table 19A: FA profile of event 5212-4 T2 seed at different zygosity levels
Plant No. Copy No. %TotaI Sats 04:0 06:0 06:1 08:0 08:1 08:2 08:3
5212-4 Mean (n=5) 0 7.02 0.05 3.94 0.32 1.88 76.03 11.17 3,50
5212-4 Std Dev (n=5) 0 0.29 0.01 0.18 0.02 0.12 1.44 1.06 0.56
5212-4 Mean (n=5) 1 6.79 0.04 3.83 0.32 1.81 76.86 10.74 3.36
5212-4 Std Dev (n=5) 1 ' 0.19 0.00 0.07 0.01 0.17 0.26 0.31 0.11
5212-4 Mean (n=5) 2 6.96 0.04 3.89 0.32 1.89 76.38 11.00 3.38
5212-4 Std Dev (n=5) 2 0.24 0.00 0.08 0.01 0.16 0.81 0.78 0.30
101
2017200511 25 Jan 2017
Table 19B; FA profile of event 5212-4 T2 seed at different zygosity levels
Plant No. Copy No. %TotaI Sats C20:0 C20:l C20.-2 C22;0 C24:0 C24;l
5212-4 Mean 0 7.02 0.64 1.16 0.04 0.33 0.20 0.11
5212-4 Std Dev (n=5) 0 0.29 0.07 0.06 0.01 0.04 0.05 0.01
5212-4 Mean (n=5) 1 6.79 0.62 1.11 0.04 0.31 0.18 0.10
5212-4 Std Dev (n=5) 1 0.19 0.05 0.03 0.00 0.03 0.02 0.00
5212-4 Mean (n-5) · 2 6.96 0.63 1.12 0.05 0.31 0.21 0.10
5212-4 Std Dev (n=5) 2 0.24 0.07 0.05 0.01 0.03 0.05 0.01
[0303J All patents, patent applications and publications mentioned herein are hereby incorporated by reference, in their entireties, for all purposes.
[0304] Although disclosure has been provided in some detail by way of illustration and example for the purposes of clarity of understanding, it will be apparent to those skilled in the art that various changes and modifications can be practiced without departing from the spirit or scope of the disclosure. Accordingly, the foregoing descriptions and examples should not be construed as limiting.
102
1001707101
2017200511 25 Jan 2017

Claims (18)

  1. CLAIMS:
    1. A non-naturally occurring plant cell in which the fatty acid content of the cell is altered as compared to a wild-type cell following binding of a fusion molecule comprising a functional domain and a DNA-binding domain that binds to a target site as shown in any of SEQ ID NO:24-27 or 47-52 in the genome of the plant cell.
  2. 2. The plant cell of claim 1, wherein the DNA-binding domain comprises a zinc finger protein.
  3. 3. The plant cell of claim 1 or claim 2, wherein the functional domain is a transcriptional regulatory domain or a cleavage domain.
  4. 4. A plant or seed comprising one or more plant cells according to claims 1 to 3.
  5. 5. The plant or seed of claim 4, wherein the plant is a Brassica plant.
  6. 6. A method of producing a plant cell or plant according to any of claims 1 to 5, the method comprising:
    introducing, into the plant cell, one or more expression vectors comprising at least one polynucleotide encoding the fusion molecule, under conditions such that the fatty acid content of the cell is modified.
  7. 7. The method of claim 6, wherein expression of at least one acyl-ACP thioesterases (FAT) or βketoacyl-ACP synthetase II (KAS) gene is modulated by the fusion molecule.
  8. 8. The method of claim 6 or 7, wherein expression of at least one FAT gene and/or at least one KAS gene is activated.
  9. 9. The method of claim 6 or 7, wherein expression of at least one FAT gene and/or at least one KAS gene is repressed.
  10. 10. The method of claim 8, wherein expression of at least one FAT gene is activated and at least one KAS gene is repressed,
  11. 11. The method of claim 9, wherein expression of at least one FAT gene is repressed and at least one KAS gene is activated.
  12. 12. The method of any of claims 9 to 11, wherein the fusion molecule is a nuclease and at least one FAT and/or KAS gene is cleaved.
  13. 13. The method of claim 12, further comprising the step of introducing a donor nucleic acid such the donor vector is introduced into the site of cleavage by homologous recombination.
    103
    1/18
    2017200511 25 Jan 2017
    FIG.1
    2/18 ο
    (Μ § Η-ϊ
    ΙΤ) (Μ
    ΙΤ)
    Ο
    Ο (Μ
    1^
    Ο (Μ
    Transcription start
    Promoter
    ZFP designs 4695 4696 4697 4698 v-Y' 400 bps
    FIG. 2 c
    πί
    0)
    2! 2 ό -P 2· c 3 o < o
    Z i;
    E Q. — u. ω tZi
    3.5
    2.5 2
    1.5
    11.. I i
    0.5
    LL iiiiiiimiuin
    CM (*> m (O h- o
    CM
    CM ci t- CM ▼“ id id cd
    16.2
    Control
    Event number
    FIG. 3 ο
    3/18
    2017200511 25 Jan
    Events
    FIG. 4
    Events
    FIG. 5
    2017200511 25 Jan 2017
    4/18
    Q.
    U_
    N
    CO □
    c co
    a.
    u.
    N co □
    c co
    N
    CM □
    c
    CM o
    cx
    E co ω
    8ίΟ|Β)°1 /91-0 iejo±
    CD
    a.
    LL
    N
    CO o
    c to
    a.
    LL
    N
    CO
    C
    CO
    LL
    N
    CM =3
    C
    CM
    0>
    CX
    E co w
    910 lEl°l
    FIG. 6
    2017200511 25 Jan 2017
    5/18
    AF244520 (1) . AF318307 (1) Consensus (1) AF244520 (1) AF318307 (51) Consensus (51) AF244520 (1) AF318307 (10.1) Consensus (101) AF244520 (1) AF318307 (151) Consensus (151) AF244520 (1) AF318307 (201) Consensus (201) AF244520 (1) AF318307 (251) Consensus (251) AF244520 (1) AF318307 (301) Consensus (301) AF244520 (1) AF318307 (351) Consensus (351) AF244520 (18) AF318307 (400) Consensus (401) AF244520 (68) AF318307 (444) Consensus (451) AF244520 (118) AF318307 (494) Consensus (501) AF244520 (168) AF318307 (544) Consensus . (551) AF244520 (218) AF318307 (594) Consensus (601)
    1 50
    ATTCTCTCTTCTTCTCTTCACCCATTTCTCGCTTTCTCCTTTGTTCTCTC
    51 100
    ATCTGGGTTCTTCTCAAAGCCTCTTCCTTTTTTTGCCATGGTGGGTGCGT
    101 150
    CTTCCTCTTACGCATCTCCGTTATGTACCTGGTTTGTTGCTGCTTGCATG
    151 200
    TCCGTCTCTCACGGTGGAGGAGATAGCCGTCAGGCTGTTGCTCTTCAATC
    201 250
    TGGTGGGCGGAGTCGGCGAAGGAGGCAGCTTAGCAAATGCTCTGTCGCTT
    251 300
    CTGGATCCGCTAGCATTCAGGCTCTCGTCACTTCTTGTTTGGATTTTGGT
    301 350
    CCTTGTACTCACTACAACAACAACAATGCATTGTCTTCTCTCTTTGGATC
    351
    400
    G T CTGCT 450
    GAATAGTGTTTCTTTGAATCGAAACCAGAGGAG,
    401
    AGTTCCGGTGGA3GA 3CCATGGCTGTTGCGATGGA1ATGGAAAAGGAAGC lAGCTCCGGTGGAl- - -GCCATGGCAGTl- - -|GATGGAjG(ATGGAAAAGGAAGC GCCATGGC GT
    AG TCCGGTGGA 451
    GATGGA ATGGAAAAGGAAGC 500
    CAApOTlteECAadAAACCfllCCTACGGAGCAGCGCfcGGGTTGTTGTGACAG TGC GGTTA ACAA3 AAACCA CCTACGGAGCAGCG Γ CGAGTTGTAGTGACAG
    GGTT ACAA AAACC CCTACGGAGCAGCG CG GTTGT GTGACAG 501 550
    GCATGGGAGTTGAAACATCA C GCATGGGAGTTGAAACATCA^ ^GGTCATGACCCTG 3GTCATGACCC1AC
    ACACCTTITATGAG AIACCTTCTATGAG
    GCATGGGAGTTGAAACATCA T GGTCATGACCC 551
    A ACCTT TATGAG 600
    AAT AAT imG CTACAAGGCAACAGTGGTATTAGCCAGATTGA CTACAAGGCAACAGTGGTATTAGCCAGATTGA GAATTTTGATTG AlAATTTTGATTG AAT T CTACAAGGCAACAGTGGTATTAGCCAGATTGA AATTTTGATTG
    TTCTG TTTCCTACG GAATTGC GGAGAGATCAA TTCTCGACTG 651 700
    FIG. 7A
    2017200511 25 Jan 2017
    6/18
    AF244520
    AF318307
    Consensus
    AF244520
    AF318307
    Consensus
    AF244520
    AF318307
    Consensus
    AF244520
    AF318307
    Consensus
    AF244520
    AF318307
    Consensus
    AF244520
    AF318307
    Consensus
    AF244520
    AF318307
    Consensus
    AF244520
    AF318307
    Consensus
    AF244520
    AF318307
    Consensus
    AF244520
    AF318307
    Consensus
    AF244520
    AF318307
    Consensus
    AF244520
    AF318307
    Consensus
    AF244520
    AF318307
    Consensus (268) (644) (651) (318) (694) (701) (368) (744) (751) (418) (794) ¢801) (468) (844) (851) (518) (894) (901) (568) (944) (951) (618) (994) (1001) (668) (1044) (1051) (718) (1094) (1101) (768) (1144) (1151) (818) (1194) (1201) (868) (1244) (1251)
    AAGG 3 TGGGTTGCTCCAAAACI AAGG A TGGGTTGCTCCAAAAC]
    AGGATGGACAAG TTCATGCTC iggatggacaaHttcatgctc AAGG TGGGTTGCTCCAAAACT TC AA AGGATGGACAA TTCATGCTC 701 750
    IA IA
    TATCTTCTCACIGCTGG CAAGAA 3 GCTTTGG T TGATGGTGGGGT A AC TATCTTCTCAqApCTGGh^GAAiAiGCTTTGqcfrGATGGTGGGGTfllAC
    TATCTTCTCAC GCTGG AAGAA GCTTTGG TGATGGTGGGGT AC GA 751 800
    GAAGT ATGGCAGAGTTTGACAAA CCAAATG GGAGT TTGATTGGCT 801 850
    C GCAATGGGAGG ATGAAGGTCTTT A GATGCTATTGAAGCT TGA 851 900
    ATCTCTTACAAGAAGATGAATCCTTT TGTGT CCTTT GCGACAAC AA 901 950
    CATGGGTTCTGCTATGCTTGC ΓΤ rGGATCTGGGATGGATGGGGCCAAACT CATGGGTTCTGCTATGCTTGC CA rGGATCTGGGATGGATGGGGCCAAACT
    CATGGGTTCTGCTATGCTTGC
    951
    TGGATCTGGGATGGATGGGGCCAAACT
    1000
    ATTCTAT TCAACTGCTTGTGC ACAAGCAACTTTTGCATTCT AATTCA 1001 1050
    GCAAACCACATTAT AAAGG GAAGCTGATGTAATGCTCTGTGGTGGCTC
    1051 _1100
    1CAGTTATTATTCCAATAGGGTTGGGAGGTTTTGTTGCATGCCC \GTTATTATTCCAATAGGGTTGGGAGGTTTTGTTGCATGCCC GAT CAGTTATTATTCCAATAGGGTTGGGAGGTTTTGTTGCATGCCG G 1101 1150
    CTCTTTC CAAAGGAATAATGATCCCACAAAAGCTTCACG CCTTGGGAT 1151 1200
    A CAA CGAGATGGTTTCGTGATGGGAGAGGGAGCTGGAGTT T 1201
    CTTTT
    1250
    GGAAGA CT GA CATGCTAAGAAAAGAGG GCAAC ATCTA GCAGAGT
    1251
    1300
    TCCT GGTGGGAGTTTCACATGTGATGCCTATCACATGACCGAGCCTC C 1301 1350
    FIG. 7B
    2017200511 25 Jan 2017
    7/18
    AF244520
    AF318307
    Consensus
    AF244520
    AF318307
    Consensus
    AF244520
    AF318307
    Consensus 'AF244520 AF318307
    Consensus
    AF244520
    AF318307
    Consensus
    AF244520
    AF318307
    Consensus
    AF244520
    AF318307
    Consensus
    AF244520
    AF318307
    Consensus
    AF244520
    AF318307
    Consensus
    AF244520
    AF318307
    Consensus
    AF244520
    AF318307
    Consensus
    AF244520
    AF318307
    Consensus
    AF244520
    AF318307
    Consensus (918) (1294) (1301) (968) (1344) (1351) (1018) (1394) (1401) (1068) (1444) (1451) (1118) (1494) (1501) (1168) (1544) (1551) (1218) (1594) (1601) (1268) (1644) (1651) (1318) (1694) (1701) (1365) (1744) (1751) ¢1415) (1768) (1801) (1465) (1768) (1851) (1515) (1768) (1901)
    CCTGATGG GCTGGTGT ATTCT TGTATTGAGAGAGC TT GCT TGC 1351 1400
    TGGGATTTCCAA GAACA'ATAAA TA ATAAATGCACATGCAACCTC A 1401 1450
    C C GCTGGAGA TTAAGGA TACCAAGCCCTTGCTCACTG TTTGGC 1451 1500
    CAAAATCCTGAG
    CAAAATCCTGAGlC
    CAAAATCCTGAG
    1501
    IlAATTCCACAAAATCTATGATTGGACACTT LTTCCACAAAATCTATGATTGGACACTT
    GCTGGGAGCTGCTGGGGCCGT
    GCTGGGAGCTGCTGGGGCCG’lK
    Τ AA GT AATTCCACAAAATCTATGATTGGACACTT 1550 ilC)GCAACTGTGCAGGClCATAA
    GCTGGGAGCTGCTGGGGCCGT
    1551
    SCTGTfllQCAACTGTGCAGGQGATAC GA GCTGT GCAACTGTGCAGGC ATA
    1600
    GGACCGGATGGGTTCATCCAAATATCAACCT GAGA TCCAGACA TGGA 1601 1650
    GTGGATACAAA TGCTGGTGGGTCCT AGAAGGAGAGA TGGACATTAA 1651 ' · 1700
    AGCAGCCTTGTCAAATTCATTCGGGTTTGGTGG CA AACTCCAGCATCA '
    1701 1750
    TTTTTGCTCCTTACAAGTGAAAGC
    1751_ _
    TGjdTTGTlGfrAACTTGCTGTAAl TG A TTGT A TAACTTGCTGTAAGl-1
    A CA TTGC TGTACTCCAAACC 1800
    TACAAGAACTCCCCATGTTATGTT
    TG TTGT TAACTTGCTGTAAG GT
    1801 1850
    GTTGCGGGAATCAACACAGTTTGTTAAACTACCAAGAGCTAAGCTAAGTT
    1851 1900
    TCCTTAGGATCAAGATCCGTTTGTGCCAGAGAACTTGGACAAAGAGCAAA
    1901 1950
    CGTAGCAGAGTTTGGATTTAGCTTCCGTGTGATACCTTTTGAGTGGAATC
    1951
    2000
    FIG. 7C
    2017200511 25 Jan 2017
    8/18
    AF244520 (1565) AF318307 (1768) Consensus (1951) AF244520 (1615) AF318307 (1768) Consensus (2001) AF244520 (1665) AF318307 (1768) Consensus (2051)
    TTTGTAGCCTTTTCTTTTTTGTAGTGTTTCATTTCTATTTGTTAATCATT
    2001 2050
    ACAATCTGAAAATTGCCAAACCAATTCTCCGTTAAATTTAGTAACTCTAC
    2051 · ' 2079
    ACAAAAAAAAAAAAAAAAAAAAAAAAAAA
    FIG. 7D
    2017200511 25 Jan 2017
    9/18
    Seq ID 3 Seq ID 4
    Seq ID 46 Seq ID 47
    AC189461
    BH723504
    Consensus
    Seq ID 3 Seq ID 4
    Seq ID 46 Seq ID 47
    AC189461
    BH723504
    Consensus
    Seq ID 3 Seq ID 4
    Seq ID 46 Seq ID 47 AC189461
    BH723504
    Consensus
    Seq ID 3 Seq ID 4
    Seq ID 46 Seq ID 47 AC189461 BH723504 Consensus
    Seq ID 3 Seq ID 4 Seq ID 46 Seq ID 47 AC189461 BH723504 Consensus
    Seq ID 3 Seq ID 4 Seq ID 46 Seq ID 47 AC189461 BH723504 Consensus (1) (1) (1) (1) (1) (1) (1) (1) (1) (1) (1) (1) (51) ¢51) (1) (1) (1) (1) (1) (101) (101)
    ACGGCACTTTACGCACCAATATATACCATATGGTAGCCAGTTAAGGGTAC
    51 100
    GAAGTGATTTTCCCCTTTTCTTATGTATACAGACTCCAATTCCCCAAATT
    101
    150
    -GAATTCGCCCTT
    -GAATTCGCCCTT
    -GAATTCGCCCTT ιΤΑΤΊΊ
    TACTCTGGTCATCGAACATCGATACGTTTGTATGTATGT^jCGiT^TTATqr] • GAATTCGCCCTT
    151 200
    (13) CGCGGA (13) CGCGGA (13) CGCGGA
    (1) (13) (151) (151) (51) (51) (53) (1) (63) (196) (201) (89) (96) (102) (1) (112) (245) (251)
    TCCGAACACTGCGTTTGCTGGCTTTGATGAAA........TCCGAACACTGCGTTTGCTGGCTTTGATGAAA.........
    TCCGAACACTGCGTTTGCTGGCTTTGATGAAA 3-------C
    SAT^^^^T^^^^^a ^TAAGC^A^|^ AGCAAGTGC
    CGCGGA TCCGAACACTGCGTTTGCTGGCTTTGATGAAA
    201 250
    GT.
    - - - - ATI TTGTATG
    Jatcttttgacgtctccacgcacgagtttacgcatcc|ca
    I :gi
    ATGTATCTTTTGACGTCTCCACG
    TATGTATCTTTTGACGTCTCCAO
    ACGAGTTTACGCATCCA
    ACGAGTTTACGCATCCA
    TCGC'
    -TTTTG'
    TGTATGTATCTTTTGACGTCTCCACGCACGAGTTTACGCATCCA
    251 _ 300
    GACGCCTCldTTAGAGAGAAGAGAGAGATCGAGATCGAjTlfT^TC - -|5(ffC| GACGCCTCGTTAGAGAGAAGAGAGAGATCGAGATCGAGATCG^GAirCSAT GACGCCTCGTTAGAGAGAAGAG^GAGATCGAGATCGAGATCGAjGAlrcpAT
    GACGCCTCGTTAGAGAGAAGAGAGAGATCGAGATCGAjTjTCjCTC - -fCfcfTC TACGCtTC'ltGiCA^GiCCTCC,lteAlAlAGAGA|GA)3AGAiGAl3AGATCGAiA-[TCfigc: GACGCCTCGTTAGAGAGAAGAGAGAGATCGAGATCGAGATCGA TC TC 301 350
    FIG. 8A
    10/18
    2017200511 25 Jan 2017
    Seq ID 3 Seq ID 4
    Seq ID 46 Seq ID 47
    AC189461
    BH723504
    Consensus
    Seq ID 3 Seq ID 4
    Seq ID 46 Seq ID 47
    AC189461
    BH723504
    Consensus
    Seq ID 3 Seq ID 4
    Seq ID 46 Seq ID 47
    AC189461
    BH723504
    Consensus
    Seq ID 3 Seq ID 4
    Seq ID 46 Seq ID 47
    AC189461
    BH723504
    Consensus
    Seq ID 3 Seq ID 4
    Seq ID 46 Seq ID 47 AC189461 BH723504 Consensus
    Seq ID 3 Seq ID 4 Seq ID 46 Seq ID 47 AC189461 BH723504 Consensus (137) (146) (152) (1) (159) (294) (301) (186) (194) (200) (1) (208) (327) (351) . (235) (240) (246). (1) (258) (372) (401) (277) (282) (289) (21) (306) (410).
    (451) (324) (332) (339) (68) (353) (457) (501) (374) (382) (389) (118) (403) (507) (551)
    ICTCTCTCTCTCGTGAMCTCATTTCC^ljTiyCCGCli-lAGATT
    CTCTCTCTCTCGTGAATCTCATTTCCCCTTACCGCT-(AGATT CTCTCTCTCTCGTGAATCTCATTTCCCCTTACCGCIlATlGATT
    TTAAlA|C^l)CTCTCTCTCTCGTGAATCTCATTTCCCCTTACCGCf|-AlGATT TTAA.TTTA--AAClCTCTCTCGTGAaF:lTl-......|c|.....|cgct[-a|gatt
    351_
    CTCTCTTCACCCTTTTCTCGCCCTTCCTTC
    CTCTCTTCACCCTTTTCTCGCCCTTCCTTC
    CTCTCTTCACCCTTTTCTCGCCCTTCCTTC ttaatcc ctctctctctcgtgaatctcatttccccttaccgct agatt _400
    CT - dTCCTCATTA0TTTTTT
    ----TCCTCATTATTTTTTT
    ----rCCTCATTATTTTTTT
    CTCTCTTCACCCTTTTCTCGCCCTTCCTTC
    401
    TCCTCATTATTTTTTT 450
    TT
    GCCATG
    500
    GTCGTCTTCTGCTCTCTCTC TC CTC AGCACTC 451
    GTGGGTGfcfTGCTGCGTCTTlC---(CTG|lfrACGCATCTCdGdrATGCACCT|G
    GTGGGTG 2 TGCTGCGTCTT CTTC CTGITACGCATCTCC GC TATGCACCT3 GTGGGTG S TGCTGCGTCTTCTTC CTGITACGCATCTCC GC TATGCACCT 3
    GTGGGTG CTGCTGCGTCTT C CTGITACGCATCTCC GC TATGCACCT 3
    GTGGGTG C TGCTGCGTCTT C---CTG C TACGCATCTCC GC TATGCACCT 3 GTGGGTqqTGCTGCGTCTTK: - - -IcTGpTrACGCATCTCqCTlrATGCACCTfr GTGGGTGCTGCTGCGTCTTC
    501
    CTGTTACGCATCTCCGCTATGCACCTG
    550
    G TTCGT C GC C GC C TGCATGTCC 3 TCTC C CACGGCGGCGG A 3ΑΊICCCG A C G TTCGT C GC Ϊ GC ΐ TGCATGTCC 3 TCTC C CACGGCGGCGG A GAT ICCCG A C G TTCGT C GC Ϋ GC YTGCATGTCC 3 TCTC CCACGGCGGCGG A GAT ICCCG A C G TTCGT C GC 2 GC CTGCATGTCC 3 TCTC 2 CACGGCGGCGG A SATICCCG A C G TTCGT C GC Ϊ GC 2 TGCATGTCC 3 TCTC C CACGGCGGCGG A SAT I CCCG A C C TTCGTI GC 13C ΐ TGCATGTCCC TCTCΓ CACGGCGGCGG Ϊ GAT A CCCG12
    GTTCGTCGCTGCCTGCATGTCCGTCTCCCACGGCGGCGGAGATTCCCGAC 551 600
    AAGCdG|lJCGCTCTCAAATCTACdGGGCGGAGHCGTCGAA(±lAGAdAlACAjG
    AAGCCJ3T CfflcBCTCAAATCTACC GGGCGGAGICGTCGAAG 2 AGAC 3 ACA 3 AAGCcfcfT CgclaCTCAAATCTACC GGGCGGAG I CGTCGAAG 2 AGAC A ACA 3 AAGCCpi CGCTCTCAAATCTACC 3GGCGGAGICGTCGAAG 2 AGAC A ACA 3 AAGCCOT CGCTCTCAAATCTACC GGGCGGAG I CGTCGAAG 2 AGAC A ACA A
    AAGCCOTd- T-------------^GGCGGAGjqCGTCGAAGqAGACjAkCAPl
    AAGCCGTCGCTCTCAAATCTACCGGGCGGAGTCGTCGAAGCAGACAACAG 601 650
    FIG.8B
    11/18
    2017200511 25 Jan 2017
    Seq ID 3 Seq ID 4
    Seq ID 46 Seq ID 47
    AC189461
    BH723504
    Consensus
    Seq ID 3 Seq ID 4
    Seq ID 46 Seq ID 47
    AC189461
    BH723504
    Consensus
    Seq ID 3 Seq ID 4
    Seq ID 46 Seq ID 47
    AC189461
    BH723504
    Consensus
    Seq ID 3 Seq ID 4
    Seq ID 46 Seq ID 47
    AC189461
    BH723504
    Consensus
    Seq ID 3 Seq ID 4
    Seq ID 46 Seq ID 47 AC189461 BH723504 Consensus
    Seq ID 3 Seq ID 4 Seq ID 46 Seq ID 47 AC189461 BH723504 Consensus (424) (432) (439) (168) (453) (542) (601) (453) (479) (468) (197) (494) (583) (651) (487) (519) (502) (231) (534) (627) (701) (532) (564) (547) (276) ¢579) (677) (751) (582) (611) (597) (326) (629) (727) (801) (622) (651) (637) (366) (676) (776) (851)
    CTCiACfCAAATGCTl.........ICTGGATCCGGTAGCjAGr)............
    CTC AC CAAATGCTTGGCTCTTTCTGGATCCGGTAGC 3TT- - - CA0GAGGfc]
    -+-+--— CTGGATCCGGTAGC AG|------B----CTGGATCCGGTAGC AG-----------CTGGATCCGGTAGC AGpGTTCABcAGGjc CTGGATCCGGTAGC AffTCTCGTigrCTTjc CTGGATCCGGTAGCfiG G C _ 700
    CTC AC CAAATGCI CTCACCAAATGCI CTC AC CAAATGCI CTC3GCAAATGCT CTCACCAAATGCI
    651
    CIACTTCC ΓΤ1GG GCCTTGCA A TCACTACAA T tCIACTTCC TTIGG GCCTTGCA A TCACTACAA iCIACTTCC TTIGG GCCTTGCA A TCACTACAA T 1ACIACTTCC ΓΤΤ GG GCCTTGCA A TCACTACAA T TCTCGIICAC Γ ACTTCC ΓΤΤ GG GCCTTGCA A TCACTACAA T
    TCTCG1
    701
    TTGITTGGAG TTIAA GCCTTGCA 3 TCACTACAA
    CACTACTTCCTTTGGGCCTTGCAATCACTACAAT
    CAAGAACAACA
    750
    GC CT TGICTT--CTCTCITCGGATCGAA CTCTG TTTCTCTC AATCGA GC CT TGICTT--CTCTCITCGGATCGAA CTCTG TTTCTCICAATCGA GC CITGICTT- -CTCTCITCGGATCGAA CTCTG TTTCTCICAATCGA GC CT TGICTT--CTCTCITCGGATCGAA CTCTG TTTCTCIC AATCGA GC CT TGICTT--CTCTCITCGGATCGAA CTCTGTTTCTCTCAATCGA
    AAqGC AA TG C CTT TC CTCTC CTCGGATCGAA TAGCC TTTCTCT 3 AATCGA
    GCCTTGTCTT CTCTCTTCGGATCGAACTCTGTTTCTCTCAATCGA 751__FWD-.......... 800
    AA
    CCAGAGGA GGT TGA C TC GA GC TGCTA CT
    AA C CAGAGGA GGI IGA A TC TG GC TGI- - AA C CAGAGGA GGT TGA X TC 3C TGC1]
    AA C CAGAGGA GGT TGA
    Clt Clf dTC}GA)3CfrGCTA CT
    CTt
    T AG TTCCGGT 3GAGGAGC IT AG TTCCGGT 3GAGGAGC !T AG TTCCGGT 3OAGGAGC !T AG TTCCGGT 3GAGGAGC IT AG TTCCGGT AATTltyjAjC
    AA CCAGAGGA 3GITGA C TC GA 3C TGCTA
    AAHCAGAGGAlAA(jrGATOcfeAbcfiA[3TmCTflCTiiBrTCCGGT|AT(A[AACAT AACCAGAGGAGGTTGACTCGAGCTGCTACTGCTAGTTCCGGTGGAGGAGC
    801 --------.-.--Λ-,----REV 850
    3- - -[ATGGlCTteTTGCGJ^rGiGAfljAl-frGjGAAlAlA^GtAAGCjCAlAGjGiltr C ATGG CT 3TTGCGA TG GA T A
    C---ATGG CT 3TTGCGA TG GAIA C - - - ATGG CT 3TTGCGA TG 3AIA
    ATTTCAlC - - - CAAT CT jjSGTTTI TG AT I TG T< TCTTCTjgCCA@AATET^AA^CTlT^IinrqT C
    851 .G3AAGCCAAGGIT G3AAGCCAAGGIT TGfcAAjAlAG 3 AAGC CA AG GIΓ TATTSTTTGCASAGflTr
    GACAA CAAACCTCC T ACGGACAA CAAACCCCC1ACG GACAA CAAACCCCCIACG GACAA CAAACCTCC1ACG
    TlAfrdGtTTTGICAla-lGldr ATGGCTGTTGCGATGGATA TGGAAAAGGAAGCCAAGGTT _900
    3c^drij3TTGTGACAGGCA
    GAGCA3CG-GAGCA3CGgagcarJcg-GAGCA3CG!TTTTTGT-TiA( gjTljljrTG GACAACAAACCTCCTACG GAGCAGCG 901
    GACAA3CTTTG: GACAAGCTTTG:
    C CGTG TT 3TlGiGTGACAGGCA C CGTG TT SljgGTGACAGGCA C CGjGjG TT 3TTGTGACAGGCA ΑΙΑΑΟΓΤΤ C TCjTp TT TAjTGT^TTATGT
    TATlAlAA|G[rTTiC[rCCT|TTl------------CCGTGTTGTTGTGACAGGCA 950
    FIG. 8C
    12/18
    2017200511 25 Jan 2017
    Seq ID 3 (668) Seq ID 4 (697) Seq ID 46 (683) Seq ID 47 (412) AC189461 (725) BH723504 (813) Consensus (901) Seq ID 3 (718) Seq ID 4 (733) Seq ID 46 (719) Seq ID 47 (448) AC189461 (775) BH723504 (813) Consensus (951) Seq ID 3 (737) Seq ID 4 (733) Seq ID 46 ¢719) Seq ID 47 (448) AC189461 (825) BH723504 (813) Consensus (1001) Seq ID 3 (737) Seq ID 4 (733) Seq ID 46 (719) Seq ID 47 (448) AC189461 (875) BH723504 (813) Consensus (1051)
    TGGGACTTGAAACATCACTAGGTCA^AC^CTGACACCTTTTATGAGAAT
    TGGGAGTTGAAACATCACTAGGTCAAGGGCGAATTCl-------------TGGGAGTTGAAACATCACTAGGTCAAGGGCGAATTC-------------TGGGAGTTGAAACATCACTAGGTCAAGGGCGAATTC|- -............
    WTTtG^lflAA^TGATTjCjftWCltl^^GiA^C@jGjrTfrAACGGGA7kAGTATG
    TGGGAGTTGAAACATCACTAGGTCAAGGGCGAATTC
    951 1000
    CTCCTACAAGGGCGAATTC------------------------------CTGATTTGGAATCTCAGCTTAATTGTCAAGTTTCATTCTTTATTGTGTGT
    1001
    1050
    GTAATATGCAAAGCACATTTCTGTGAGTTTGATTCAATATTGGACTCTAG
    1051 1069
    ATAAGGAGTATGATGATAC
    FIG. 8D
    13/18
    2017200511 25 Jan 2017 <
    z
    O'
    CQ
    H <
    U.
    FIG. 9
    FIG. 10
  14. 14/18
    2017200511 25 Jan 2017 o Ratio FatB4/VP16 Ratio FatB4/VP16
    Tubulin
    FIG. 11
    Tubilin
    FIG. 12
  15. 15/18
    2017200511 25 Jan 2017
    FIG. 13
    FIG. 14
  16. 16/18
    2017200511 25 Jan 2017
    Sample Sample
    FIG. 16
  17. 17/18
    2017200511 25 Jan 2017
    ZFP TF copy number
    FIG. 17
    CO c o 3 nJ •g or £ 2
    01 0) w o UJ m <-r CQ $ *±
    CO iv “ E
    -0.5
    1,50.5-
    5212_4ZF-1 5212_4ZF-2
    ZFP TF copy number
    FIG. 18
  18. 18/18
    2017200511 25 Jan 2017
    5227-12Null 5227-12ZF(1) 5227-12ZF(2) zygosity
    FIG. 19
    7.5 j 7.4 7.3 -
    Event-Copy#
    FIG. 20
    2017200511 25 Jan 2017
    SEQUENCE LISTING <110> DOW AGROSCIENCES LLC et al.
    <120> ENGINEERED ZINC FINGER PROTEINS TARGETING PLANT GENES INVOLVED IN FATTY ACID BIOSYNTHESIS
    <130> 8325-4006.40 <140> PCT/US2010/002817 <141> 2010-10-22 <150> 61/279,528 <151> 2009-10-22 <160> 96 <170> PatentIn version 3.5 <210> 1 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial primer Sequence: Synthetic <400> 1 cgcggatccg aacactgcgt ttgctggctt tgatgaaa 38
    <210> 2 <211> 35 <212> DNA <213> Artificial Sequence <220>
    <223> Description of Artificial Sequence: Synthetic primer <400> 2 ctcgagctgc tactgc.tagt tccggtggag gagcc <210> 3 <211> 736 <212> DNA <213> Brassica napus <400> 3
    gaattcgccc ttcgcggatc cgaacactgc gtttgctggc tttgatgaaa atcttttgac 60 gtctccacgc acgagtttac gcatcccaga cgcctcctta gagagaagag agagatcgag 120 atcgatttcc tccctcttaa acctctctct ctctcgtgaa tctcatttcc ctttgccgct 180 agattctctc ttcacccttt tctcgccctt ccttcctctc ctcattactt ttttgtcgtc 240 ttctgctctc tctctctctc agcactcttc gccatggtgg gtgctgctgc gtcttcctgt 300
    2017200511 25 Jan 2017
    tacgcatctc cgctatgcac ctggttcgtc gccgcctgca tgtccgtctc ccacggcggc 360 ggagattccc gacaagccgt cgctctcaaa tctaccgggc ggagtcgtcg aagcagacaa 420 cagctcacca aatgctctgg atccggtagc agcactactt cctttgggcc ttgcaatcac 480 tacaatgcct tgtcttctct cttcggatcg aactctgttt ctctcaatcg aaaccagagg 540 aggttgactc gagctgctac tgctagttcc ggtggaggag ccatggctgt tgcgatggat 600 atggaaaagg aagccaaggt tgacaacaaa cctcctacgg agcagcgccg ggttgttgtg 660 acaggcatgg gagttgaaac atcactaggt catgaccctg acacctttta tgagaatctc 720 ctacaagggc gaattc 736
    <210> 4 <211> 732 <212> DNA <213> Brassica napus <400> 4
    gaattcgccc ttcgcggatc cgaacactgc gtttgctggc tttgatgaaa atgtatgtat 60 cttttgacgt ctccacgtac gagtttacgc atccagacgc ctcgttagag agaagagaga 120 gatcgagatc gagatcgaga tcgatttcct ccctctctct ctcgtgaatc tcatttcccc 180 ttaccgctag attctctctt cacccttttc tcgcccttcc ttctcctcat tatttttttg 240 tcgtcttctg ctctctcaca gcactcttct ctttagctat ggtgggtggt gctgcgtctt 300 cttcctgtta cgcatctccg ctatgcacct ggttcgtcgc tgcttgcatg tccgtctccc 360 acggcggcgg agattcccga caagccgtct ccctcaaatc taccgggcgg agtcgtcgaa 420 gcagacgaca gctcaccaaa tgcttggctc tttctggatc cggtagcgtt caggaggctc 480 tcgtcactac ttcctttggg ccttgcaatc actacaatgc cttgtcttct ctcttcggat 540 cgaactctgt ttctctcaat cgaaaccaga ggaggttgaa tctggctgct gctagttccg 600 gtggaggagc catggctgtt gcgatggata tgcaaaagga agccaaggtt gacaacaaac 660 cccctacgga gcagcgccgt gttgtggtga caggcatggg agttgaaaca tcactaggtc 720 aagggcgaat tc 732
    <210> 5 <211> 7 <212> PRT <213> Artificial Sequence <220>
    <223> Description of Artificial Sequence: Synthetic peptide <400> 5
    Arg Ser Asp Asn Leu Ser Val
    7'
    2017200511 25 Jan 2017 <210> 6 <211> 7 <212> PRT <213> Artificial Sequence <220>
    <223> Description of Artificial Sequence: Synthetic peptide <400> 6
    Gin Lys Ile Asn Leu Gin Val
    1 5 <210> 7 <211> 7 <212> PRT <213> Artificial Sequence <220>
    <223> Description of Artificial Sequence: Synthetic peptide <400> 7
    Arg Ser Asp Thr Leu Ser Glu
    1 5 <210> 8 <211> 7 <212> PRT <213> Artificial Sequence <220>
    <223> Description of Artificial Sequence: Synthetic peptide <400> 8
    Thr Arg Ser Ser Arg Ile Asn
    1 5 <210> 9 <211> 7 <212> PRT <213> Artificial Sequence <220>
    <223> Description of Artificial Sequence: Synthetic peptide <400> 9
    Arg Ser Asp Ala Leu Ala Arg
    1 5 <210> 10 <211> 7
    2017200511 25 Jan 2017
    <212> PRT <213> Artificial Sequence <220> <223> Description peptide of Artificial <400> 10
    Arg Ser Asp His Leu Ser Ala 1 5
    Sequence;
    Synthetic <210> 11 <211> 7 <212> PRT <213> Artificial Sequence <220>
    <223> Description of Artificial Sequence: peptide <400> 11
    Thr Ser Ser Ser Arg Ile Asn
    1 5
    Synthetic <210> 12 <211> 7 <212> PRT <213> Artificial Sequence <220>
    <223> Description of Artificial Sequence: peptide <400> 12
    Arg Ser Asp Asn Leu Ala Arg
    1 5
    Synthetic <210> 13 <211> 7 <212> PRT <213> Artificial Sequence <220>
    <223> Description of Artificial Sequence: peptide <400> 13
    Asp Arg Ser His Leu Ala Arg
    1 . 5
    Synthetic <210> 14 <211> 7 <212> PRT <213> Artificial Sequence <220>
    <223> Description of Artificial Sequence:
    Synthetic
    Γ
    1'
    2017200511 25 Jan 2017 peptide <400> 14
    Arg Ser Asp Asn Leu Ser Glu 1 5 <210> 15 <211> 7 <212> PRT <213> Artificial Sequence <220 <223> Description of Artificial Sequence: peptide <400 15
    Arg Asn Ala His Arg Thr Thr
    1 5
    Synthetic
    <210> 16 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial peptide <400> 16
    Gin Ser Gly Asn Leu Ala Arg 1 5
    Sequence:
    Synthetic
    <210> 17 . <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial peptide <400> 17
    Arg Ser Asp His Leu Ser Glu 1 5
    Sequence:
    Synthetic
    <210 <211> <212> <213> 18 7 PRT Artificial Sequence <220> <223> Description of Artificial peptide <400> 18
    Gin Lys Ala Asn Arg Thr Lys 1 5
    Sequence :
    Synthetic φ
    2017200511 25 Jan 2017 <210> 19 <211> 7 <212> PRT <213> Artificial Sequence <220>
    <223> Description of Artificial Sequence: peptide <400> 19
    Arg Ser Asp Asp Leu Thr Arg
    1 5
    Synthetic <210> 20 <211> 7 <212> PRT <213> Artificial Sequence <220>
    <223> Description of Artificial Sequence: peptide <400> 20
    Thr Ser Ala Asn Leu Ser Arg
    1 5
    Synthetic
    <210> 21 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial peptide <400> 21
    Arg Ser Asp Asp Leu Ser Lys 1 5
    Sequence:
    Synthetic <210> 22 <211> 7 <212> PRT <213> Artificial Sequence <220>
    <223> Description of Artificial Sequence: peptide <400> 22
    Arg Ser Ala Asn Leu Thr Arg
    1 5
    Synthetic <210> 23 <211> 7 <212> PRT
    P
    2017200511 25 Jan 2017 <213> Artificial Sequence <220>
    <223> Description of Artificial Sequence: Synthetic peptide <400> 23
    Asp Lys Ser Asn Arg Lys Lys
    1 5 <210> 24 <211> 18 <212> DNA <213> Artificial Sequence <220>
    <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 24 cgtggagacg tcaaaaga 18 <210> 25 <211> 20 <212> DNA <213> Artificial Sequence <220>
    <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 25 aaggaagggc gagaaaaggg <210> 26 <211> 17 <212> DNA <213> Artificial Sequence <220>
    <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 26 agatgcgtaa caggaag <210> 27 <211> 17 <212> DNA <213> Artificial Sequence <220> .
    <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 27 ctaccgggcg gagtcgt
    Γ
    2017200511 25 Jan 2017
    <210> 28 <211> 20 <212> DNA . <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic primer <400> 28 .
    ttgactcgag gtgctactgc 20 <210> 29 <211> 20 <212> DNA <213> Artificial Sequence <220>
    <223> Description of Artificial Sequence: Synthetic primer ' <400> 29 tttccatatc catcgcaaca 20 <210> 30 <211> 447 <212> DNA <213> Brassica napus <400> 30
    actcagcact cttcgccatg gtgggtgctg ctgcgtcttc ctgttacgca tctccgctat 60 gcacctggtt cgtcgccgcc tgcatgtccg tctcccacgg cggcggagat tcccgacaag 120 ccgtcgctct caaatctacc gggcggagtc gtcgaagcag acaacagctc accaaatgct 180 ctggatccgg tagcagcact acttcctttg ggccttgcaa tcactacaat gccttgtctt 240 ctctcttcgg atcgaactct gtttctctca atcgaaacca gaggaggttg actcgagctg 300 ctactgctag ttccggtgga ggagccatgg ctgttgcgat ggatatggaa aaggaagcca 360 aggttgacaa caaacctcct acggagcagc gccgggttgt tgtgacaggc atgggagttg 420 aaacatcact aggtcaaggg cgaattc 447
    <210> 31 <211> 19 <212> DNA <213> Artificial Sequence <220>
    <223> Description of Artificial Sequence: Synthetic primer <400> 31
    2017200511 25 Jan 2017 acagcgattg cctacaagg <210? 32 <211? 22 <212? DNA <213? Artificial Sequence <220?
    <223> Description of Artificial Sequence: Synthetic primer <400? 32 agatggttaa gatcaccaaa gg <210? 33 <211? 24 <212? DNA <213? Artificial Sequence <220?
    <223? Description of Artificial Sequence: Synthetic primer <400? 33 aaggaagagg aaggagtcta acag <210? 34 <211? IS <212? DNA <213? Artificial Sequence <220?
    <223? Description of Artificial Sequence: Synthetic primer <400? 34 cttctgctct ccaccgta <210? 35 <211? 24 <212? DNA <213? Artificial Sequence <220?
    <223? Description of Artificial Sequence: Synthetic primer <400? 35 ggtcaacgga tcaggatatt cttg 24
    <210? 36 <211? 20 <212? DNA <213? Artificial Sequence <220?
    r
    2017200511 25 Jan 2017 <223> Description of Artificial Sequence: Synthetic primer <400> 36 ccatgttggc aaaggcaacc <210> 37 <211> 29 <212> DNA <213> Artificial Sequence <220>
    <223> Description of Artificial Sequence: Synthetic primer <400> 37 acaagagtgg attgatgatc tagagaggt <210> 38 <211> 29 <212> DNA <213> Artificial Sequence <220>
    <223> Description of Artificial Sequence: Synthetic primer <400> 38 ctttgatgcc tatgtgacac gtaaacagt <210> 39 <211> 29 <212> DNA <213> Artificial Sequence <220>
    <223> Description of Artificial Sequence: Synthetic probe <400> 39 ccagcgtaag caataccagc cacaacacc <210> 40 <211> 23 <212^ DNA <21'3> Artificial Sequence <220>
    <223> Description of Artificial Sequence: Synthetic primer <400> 40 cctctctacc accgtctcac atg <210> 41 <211> 20 r
    2017200511 25 Jan 2017 <212> DNA <213> Artificial Sequence <220>
    <223> Description of Artificial Sequence: Synthetic primer <400> 41 gatctggccg gactgtttca <210> 42 <211> 25 <212> DNA <213> Artificial Sequence <220>
    <223> Description of Artificial Sequence; Synthetic probe <400> 42 cgctcctcag ctaccacctc aacca <210> 43 <211> 22 <212> DNA <213> Artificial Sequence <220>
    <223> Description of Artificial Sequence: Synthetic primer <400> 43 tcgatcttga tatgttggga ga <210> 44 <211> 20 <212> DNA <213> Artificial Sequence <220>
    <223> Description of Artificial Sequence: Synthetic primer <400> 44 aggtgcagaa tcatgtggtg <210> 45 <211> 16 <212> DNA <213> Artificial Sequence <220>
    <223> Description of Artificial Sequence: Synthetic probe <400> 45 ttgatggtga agatgt
    2017200511 25 Jan 2017 <210> 46 <211> 718 <212> DNA <213> Brassica napus <400> 46
    gaattcgccc ttcgcggatc cgaacactgc gtttgctggc tttgatgaaa gcttgtatgt 60 atgtatcttt tgacgtctcc acgtacgagt ttacgcatcc agacgcctcg ttagagagaa 120 gagrgagatc gagatcgaga tcgagatcga tttcctccct ctctctctcg tgaatctcat 180 ttccccttac cgctagattc tctcttcacc cttttctcgc ccttccttct cctcattatt 240 tttttgtcgt cttctgctct ctcwcakcwc tcwkcwctct tmgcyatggt gggtgstgct 300 gcgtcttctt cctgttacgc atctccgcta tgcacctggt tcgtcgcygc ytgcatgtcc 360 gtctcccacg gcggcggaga ttcccgacaa gccgtckcyc tcaaatctac cgggcggagt 420 cgtcgaagca gacaacagct caccaaatgc tctggatccg gtagcagcac tacttccttt 480 gggccttgca atcactacaa tgccttgtct tctctcttcg gatcgaactc tgtttctctc 540 aatcgaaacc agaggaggtt gamtcgwgct gctrctgcta gttccggtgg aggagccatg 600 gctgttgcga tggatatgca aaaggaagcc aaggttgaca acaaaccccc tacggagcar 660 cgccgtgttg tggtgacagg catgggagtt gaaacatcac taggtcaagg gcgaattc 718
    <210> 47 <211> 28 <212> DNA .
    <213> Artificial Sequence <220>
    <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 47 .
    aacgaaagga gatcgagaga ggagagag 28 <210> 48 <211> 28 <212> DNA <213> Artificial Sequence <220>
    <223> Description of Artificial Sequence: Synthetic oligonucleotide .
    <400> 48 cgaaagggag atcgagagag gcaccgca 28 <210> 49 <211> 28
    2017200511 25 Jan 2017 <212> DNA <213> Artificial Sequence <220>
    <223> Description of Artificial Sequence; Synthetic oligonucleotide <400> 49 aaggagaact ttagggtttg gggagact <210> 50 <211> 28 <212> DNA <213> Artificial Sequence <220>
    <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 50 aaggagaatt ttagggtttg gggagact <210> 51 <211> 28 <212> DNA <213> Artificial Sequence <220>
    <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 51 '· ctccgaagag attggcgtaa cacttcgt <210> 52 <211> 28 ' <212> DNA <213> Artificial Sequence <220>
    <223> Description of Artificial Sequence: Synthetic oligonucleotide ' <400> 52 ' ctccgaagag attggcgtaa ccttcatt <210> 53 <211> 21 <212> DNA <213> Artificial Sequence <220>
    <223> Description of Artificial Sequence: Synthetic primer <400> 53 ctttgaacgc ttatcttcct c r
    © <N
    2017200511 25 Jan <210> 54 <211> 20 <212> DNA <213> Artificial Sequence <220>
    <223> Description of Artificial Sequence: Synthetic primer <400> 54 ttccacaaca tctccccaag <210> 55 <211> 14 <212> DNA <213> Artificial Sequence <220>
    <223> Description of Artificial Sequence: Synthetic probe <400> 55 ctcaggctcc accc <210> 56 <211> 21 <212> DNA <213> Artificial Sequence <220>
    <223> Description of Artificial Sequence: Synthetic primer <400> 56 ctttgaaagc tcatcttcct c <210> 57 <211> 20 <212> DNA <213> Artificial Sequence <220>
    <223> Description of Artificial Sequence: Synthetic primer <400> 57 ttccacaaca tctccccaag <210> 58 <211> 16 <212> DNA <213> Artificial Sequence <220>
    <223> Description of Artificial Sequence: Synthetic
    Γ
    2017200511 25 Jan 2017 probe <400? 58 aaccttcatc ctccca 16 <210? 59 <211> 22 <212> DNA <213> Artificial Sequence <220 <223> Description of Artificial Sequence: Synthetic primer <400> 59 tcgatcttga tatgttggga ga <210? 60 <211? 20 <212? DNA <213? Artificial Sequence <220?
    <223? Description of Artificial Sequence: Synthetic primer <400? 60 aggtgcagaa tcatgtggtg <210 61 <211? 21 <212? DNA <213? Artificial Sequence <220?
    <223? Description of Artificial Sequence: Synthetic primer <400? 61 acgagctacc tgacggacaa g <210? 62 <211> 20 <212? DNA <213> Artificial Sequence <220?
    <223? Description of Artificial Sequence: Synthetic primer <400> 62 gagcgacggc tggaagagta <210? 63 <211> 21 <212? DNA r
    2017200511 25 Jan 2017 <213? Artificial Sequence <220?
    <223> Description of Artificial Sequence: Synthetic primer <400> 63 tcgctgccat aacaaccatt t <210> 64 <211> 18 <212? DNA <213> Artificial Sequence <220?
    <223> Description of Artificial Sequence: Synthetic primer <400? 64 cgcctgggtt tccagtca <210> 65 <211> 22 <212? DNA <213> Artificial Sequence <220?
    <223? Description of Artificial Sequence: Synthetic primer <400> 65 aaggatgtgt tcgtggattt ca <210> 66 <211> 24 <212? DNA <213> Artificial Sequence <220>
    <223> Description of Artificial Sequence: Synthetic primer <400> 66 cacaatctgc tgtgcagtat caag <210? 67 <211> 17 <212> DNA <213> Artificial Sequence <220>
    <223? Description of Artificial Sequence: Synthetic primer <400> 67 gcgggcggga gttgtta ο
    2017200511 25 Jan <210> 68 <211> 18 <212> DNA <213> Artificial Sequence <220>
    <223> Description of Artificial Sequence: Synthetic primer <400> 68 ccccatcggc gttacatg <210> 69 <211> 21 <212> DNA <213> Artificial Seguence <220>
    <223> Description of Artificial Sequence: Synthetic primer <400> 69 gaagctgaga acagcgattg c <210> 70 <211> 20 <212> DNA <213> Artificial Sequence <220>
    <223> Description of Artificial Sequence: Synthetic primer <400> 70 gttcctcctc ccaacgaatg <210> 71 <211> 14 <212> DNA <213> Artificial Sequence <220>
    <223> Description of Artificial Sequence: Synthetic probe <400> 71 tttctcagcc gcca <210> 72 <211> 18 <212> DNA s ' <213> Artificial Sequence <220>
    <223> Description of Artificial Sequence: Synthetic probe ο
    2017200511 25 Jan <400? 72 tagggaagag tggaagct <210> 73 <211> 14 <212? DMA <213? Artificial Sequence <220?
    <223> Description of Artificial Sequence: Synthetic probe <400? 73 caggcctcag cctt <210? 74 <211? 18 <212? DNA <213> Artificial Sequence <220?
    <223> Description of Artificial Sequence: Synthetic probe <400? 74 tacaaggttt ccaagttt . <210? 75 <211? 7 <212? PRT <213? Artificial Sequence <220?
    <223> Description of Artificial Sequence: Synthetic peptide <400? 75
    Arg Ser Asp Asn Leu Ser Ala 1 5 <210? 76 <211? 7 <212? PRT <213? Artificial Sequence <220?
    <223? Description of Artificial Sequence: Synthetic peptide <400? 76
    Gln Ser Ala His Arg Lys Thr
    1- 5 <210? 77 <211? 7 r
    2017200511 25 Jan 2017
    <212> PRT <213> Artificial Sequence <220> <223> Description peptide of Artificial <400> 77
    Gin Ser Ser His Arg Lys Thr 1 5
    Sequence:
    Synthetic
    <210 78 <211> 7 <212> PRT <213> Artificial Sequence <2 2 0> <223> Description of Artificial peptide <400> 78
    Arg Ser Asp His Leu Ser Val 1 5
    Sequence:
    Synthetic
    <210> 79 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description peptide of Artificial <400> 79
    Gin Asn Ala His Arg Ile Glu 1 5
    Sequence :
    Synthetic <210> 80 <211> 7 <212> PRT <213> Artificial Sequence <220>
    <223> Description of Artificial Sequence: peptide <400> 80
    Arg Ser Asp His Leu Ser Lys
    1 5
    Synthetic
    <210> <211> <212> <213> 81 7 PRT Artificial Sequence <220> <223> Description of Artificial
    Sequence :
    Synthetic
    2017200511 25 Jan 2017 peptide <400> 81
    Gin Asn Ala Asn Arg Ile Thr 1 5 <210> 82 <211> 7 <212> PRT <213> Artificial Sequence <220> · <223> Description of Artificial Sequence; peptide <400> 82
    Arg Ser Asp His Leu Ser Thr
    1 5
    Synthetic <210> 83 <211> 7 <212> PRT <213> Artificial Sequence <220>
    <223> Description of Artificial Sequence: peptide
    Synthetic ' <400> 83
    His Ser Asn Thr Arg Lys Asn 1 5
    <210> 84 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial peptide <400> 84
    Arg Ser Asp His Leu Ser Gin 1 5
    Sequence :
    Synthetic
    <210> 85 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial peptide <400> 85
    Asn Ser Ala Ser Arg Lys Asn 1 5
    Sequence :
    Synthetic ο
    2017200511 25 Jan
    <210> 86 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial peptide <400> 86 Gin Ser Gly His Leu Ser Arg 1 5
    Sequence :
    Synthetic
    <210> <211> <212> <213> 87 7 PRT Artificial Sequence <220> <223> Description of Artificial peptide <400> 87
    Asn Ser Asp Ser Leu Thr Glu 1 5
    Sequence:
    Synthetic <210> 88 <211> 7 <212> PRT <213> Artificial Sequence <220>
    <223> Description of Artificial Sequence: peptide <400> 88
    Arg Arg Ala Asp Leu Ser Arg
    1 5 <210> 89 <211> 7 <212> PRT <213> Artificial Sequence <220>
    <223> Description of Artificial Sequence: peptide <400> 89
    Arg Ser Asp Ser Leu Ser Ala
    1 5
    Synthetic
    Synthetic <210> 90 <211> 7 <212> PRT
    2017200511 25 Jan 2017 <213> Artificial Sequence <220>
    <223> Description of Artificial Sequence: Synthetic peptide <400> 90
    Gln Asn Ala His Arg Lys Thr
    1 5 <210> 91 <211> 7 <212> PRT <213> Artificial Sequence <220>
    <223> Description of Artificial Sequence: Synthetic peptide <400> 91
    Arg Asn Ala Asp Arg Ile Thr
    1 5 <210> 92 <211> 200 <212> PRT <213> Artificial Sequence <220>
    <223> Description of Artificial Sequence: Synthetic polypeptide <220>
    <221> misc_feature <222> (1)..(200) <223> This region may encompass 5 to 200 Gly residues <400> 92
    Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly 1 5 10 15 Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly 20 25 30 Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly 35 40 45 Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly 50 55 60 Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly 65 70 75 80
    2017200511 25 Jan 2017
    Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly 85 90 95 Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly 100 105 110 Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly 115 120 125 Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly 130 135 140 Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly 145 150 155 160 Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly 165 170 175 Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly 180 185 190 Gly Gly Gly Gly Gly Gly Gly Gly
    195 200 <210> 93 <211> 1693 <212> DNA <213> Brassica napus <400> 93
    ctcgagctgc tactgctagt tccggtggag gagccatggc tgttgcgatg gatatggaaa 60 aggaagccaa ggttgacaac aaacctccta cggagcagcg cegggttgtt gtgacaggca 120 tgggagttga aacatcacta ggtcatgacc ctgacacctt ttatgagaat ctcctacaag 180 gcaacagtgg tattagccag attgagaatt ttgattgttc tgcttttcct acgagaattg 240 ctggagagat caagtcattc tcgactgaag ggtgggttgc tccaaaactc tcaaagagga 300 tggacaagtt catgctctat cttctcactg ctggcaagaa ggctttggtt gatggtgggg 360 taaccgaaga agtcatggca gagtttgaca aagccaaatg cggagtcttg attggctctg 420 caatgggagg catgaaggtc tttcaagatg ctattgaagc tatgaagatc tcttacaaga 480 agatgaatcc tttctgtgtg cctttcgcga caacgaacat gggttctgct atgcttgctt 540 tggatctggg atggatgggg ccaaactatt ctatctcaac tgcttgtgca acaagcaact 600 tttgcattct caattcagca aaccacatta tcaaaggaga agctgatgta atgctctgtg 660 gtggctcgga ttcagttatt attccaatag ggttgggagg ttttgttgca tgccgtgctc 720
    2017200511 25 Jan 2017
    780 tttctcaaag gaataatgat cccacaaaag cttcacgccc ttgggatagc aaccgagatg gtttcgtgat gggagaggga gctggagttt tgcttttgga agagcttgaa catgctaaga 840 aaagaggagc aacaatctat gcagagttcc ttggtgggag tttcacatgt gatgcctatc 900 acatgaccga gcctcgccct gatggtgctg gtgtgattct gtgtattgag agagcattgg 960 ctgatgctgg gatttccaaa gaacagataa actatataaa tgcacatgca acctctacac 1020 cagctggaga ccttaaggag taccaagccc ttgctcactg ctttggccaa aatcctgaga 1080 taaaagttaa ttccacaaaa tctatgattg gacacttgct gggagctgct ggggccgttg 1140 aagctgtcgc aactgtgcag gccataagga ccggatgggt tcatccaaat atcaaccttg 1200 agagtccaga caatggagtg gatacaaatt tgctggtggg tcctgagaag gagagattgg 1260 acattaaagc agccttgtca aattcattcg ggtttggtgg ccacaactcc agcatcattt 1320 ttgctcctta caagtgaaag cactcattgc ctgtactcca aacctggttg tgtaacttgc 1380 tgtaagtgtt tacaagaact ccccatgtta tgttgttgcg ggaatcaaca cagtttgtta 1440 aactaccaag agctaagcta agtttcctta ggatcaagat ccgtttgtgc cagagaactt 1500 ggacaaagag caaacgtagc agagtttgga tttagcttcc gtgtgatacc ttttgagtgg 1560 aatctttgta gccttttctt ttttgtagtg tttcatttct atttgttaat cattacaatc 1620 tgaaaattgc caaaccaatt ctccgttaaa tttagtaact ctacacaaaa aaaaaaaaaa 1680 aaaaaaaaaa aaa 1693 <210> 94 <211> 1767 <212> DNA <213> Arabidopsis thaliana <400> 94 attctctctt cttctcttca cccatttctc gctttctcct ttgttctctc atctgggttc 60 ttctcaaagc ctcttccttt ttttgccatg gtgggtgcgt cttcctctta cgcatctccg 120 ttatgtacct ggtttgttgc tgcttgcatg tccgtctctc acggtggagg agatagccgt 180 caggctgttg ctcttcaatc tggtgggcgg agtcggcgaa ggaggcagct tagcaaatgc 240 tctgtcgctt ctggatccgc tagcattcag gctctcgtca cttcttgttt ggattttggt 300 ccttgtactc actacaacaa caacaatgca ttgtcttctc tctttggatc gaatagtgtt 360 tctttgaatc gaaaccagag gagattgaat cgtgctgcta gctccggtgg agccatggca 420 gtgatggaga tggaaaagga agctgcggtt aacaagaaac cacctacgga gcagcgtcga 480 gttgtagtga caggcatggg agttgaaaca tcattgggtc atgacccaca taccttctat 540 gagaatttgc. tacaaggcaa cagtggtatt agccagattg aaaattttga ttgttctgaa 600
    2017200511 25 Jan 2017 tttcctacgc gaattgcggg agagatcaaa agcttctcga ctgaaggatg ggttgctcca 660
    aaactttcta aaaggatgga caaattcatg ctctatcttc tcacagctgg taagaaagct 720 ttggctgatg gtggggttac tgatgaagta atggcagagt ttgacaaaac caaatgtgga 780 gttttgattg gctcggcaat gggaggaatg aaggtctttt acgatgctat tgaagctctg 840 agaatctctt acaagaagat gaatcctttt tgtgtacctt ttgcgacaac aaacatgggt 900 tctgctatgc ttgccatgga tctgggatgg atggggccaa actattctat ttcaactgct 960 tgtgccacaa gcaacttttg cattctgaat tcagcaaacc acattattaa aggtgaagct 1020 gatgtaatgc tctgtggtgg ctcagatgca gttattattc caatagggtt gggaggtttt 1080 gttgcatgcc gggctctttc acaaaggaat aatgatccca caaaagcttc acgtccttgg 1140 gataccaatc gagatggttt cgtgatggga gagggagctg gagttctact tttggaagaa 1200 ctcgagcatg ctaagaaaag aggtgcaact atctacgcag agttcctcgg tgggagtttc 1260 acatgtgatg cctatcacat gaccgagcct caccctgatg gggctggtgt tattctctgt 1320 attgagagag cgttagctag tgctgggatt tccaaggaac aaataaatta cataaatgca 1380 catgcaacct caacgcatgc tggagatatt aaggaatacc aagcccttgc tcactgtttt 1440 ggccaaaatc ctgagcttaa ggtaaattcc acaaaatcta tgattggaca cttgc.tggga 1500 gctgctgggg ccgtggaggc tgttgcaact gtgcaggcga tacggaccgg atgggttcat 1560 ccaaatatca acctcgagaa tccagacagt ggagtggata caaagctgct ggtgggtcct 1620 aagaaggaga gactggacat taaagcagcc ttgtcaaatt cattcgggtt tggtggtcat 1680 aactccagca tcatttttgc tccttacaag tgaaagcgaa agcagttgct tgtactccaa 1740 acctgattgt ataacttgct gtaaggt 1767
    <210> 95 <211> 893 <212> DNA <213> Brassica rapa
    <400> 95 gacatggata ttttctgaga tttggaagtg tggatttgat ataagcaaag caaagcaagt 60 gctcgcttgt atgtatcttt tgacgtctcc acgcacgagt ttacgcatcc agacgcctcg 120 ttagagagaa gagagagatc gagatcgatt cctccctctt aaacctctct ctctctcgtg 180 aatctcattt ccccttaccg ctagattctc tcttcaccct tttctcgccc ttccttcctt 240 ctcctcatta cttttttgtc gtcttctgct ctctctctct ctcagcactc ttcgctttag 300 ctatggtggg tgctgctgcg tcttcctgct acgcatctcc gctatgcacc tggttcgtcg 360 ctgcctgcat gtccgtctcc cacggcggcg gagattcccg acaagccgtc gctctcaaat 420
    2017200511 25 Jan 2017
    ctagcgggcg gagtcgtcga agcagacaac aactcaccaa atgctctgga tccggtagca 480 gcgttcagca ggctctcgtc actacttcct ttgggccttg caatcactac aatgccttgt · 540 cttctctctt cggatcgaac tctgtttctc tcaatcgaaa ccagaggagg ttgactcgag 600 ctgctactgc tagttccggt aatttaacat ttcaccaatc tgggtttttg atttgtgggt 660 attgtttgca gagttgacaa gctttgtttt tgttagtaaa gtttctcttt ttatgtgttt 720 atgttatttg gtcaaatgat tcaacttgga gatcaagttt aacgggaaag tatgctgatt 780 tggaatctca gcttaattgt caagtttcat tctttattgt gtgtgtaata tgcaaagcac 840 atttctgtga gtttgattca atattggact ctagataagg agtatgatga tac 893
    <210> 96 <211> 812 <212> DNA <213> Brassica oleracea <400> 96
    acggcacttt acgcaccaat atataccata tggtagccag ttaagggtac gaagtgattt 60 tccccttttc ttatgtatac agactccaat tccccaaatt tactctggtc atcgaacatc 120 gatacgtttg tatgtatgta cgtcttatct ctctctctgg ctatctctgt gtgttttgtt 180 gttaataaca ggaggttttg ttttgttttc tttgacgtct ccacgcacga ttttaagcct 240 ccgttacgct ctgcacgcct cctgaaagag agagagagag agatcgaatc atcttaatta 300 aacctctctc gtgaatccgc tagattctct cttcaccgtt ttctcgcctc tcctctcctc 360 tccattttgt tttcttcttc ttcgtcttct tcttcttgcc attgccatgg tgggtgctgc 420 tgcgtcttcc tgttacgcat ctcccttatg caccttcttc gttgctgctt gcatgtccct 480 ctctcacggc ggcggtgata cccgtcaagc ctttgggcgg agccgtcgaa ggagacaaca 540 gctcggcaaa tgctctggat ccggtagcat tctcgtgtct tcttgtttgg agtttaagcc 600 ttgcagtcac tacaacaaga acaacaaagg caatgccttt cctctcctcg gatcgaatag 660 cctttctctg aatcgaaagc agaggaaact gaatcgagca acttcttctt cttccggtat 720 aaacattctt ctcccaaaat ctcaagtctt ggtttctggg tatcgtttgc aagctgacaa 780 gctttgtttt ttgtgtataa agtttctcct tt 812
AU2017200511A 2009-10-22 2017-01-25 Engineered zinc finger proteins targeting plant genes involved in fatty acid biosynthesis Ceased AU2017200511B2 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2017200511A AU2017200511B2 (en) 2009-10-22 2017-01-25 Engineered zinc finger proteins targeting plant genes involved in fatty acid biosynthesis

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US27952809P 2009-10-22 2009-10-22
US61/279,528 2009-10-22
AU2010308569A AU2010308569B2 (en) 2009-10-22 2010-10-22 Engineered zinc finger proteins targeting plant genes involved in fatty acid biosynthesis
PCT/US2010/002817 WO2011049627A1 (en) 2009-10-22 2010-10-22 Engineered zinc finger proteins targeting plant genes involved in fatty acid biosynthesis
AU2015203725A AU2015203725B2 (en) 2009-10-22 2015-07-02 Engineered zinc finger proteins targeting plant genes involved in fatty acid biosynthesis
AU2017200511A AU2017200511B2 (en) 2009-10-22 2017-01-25 Engineered zinc finger proteins targeting plant genes involved in fatty acid biosynthesis

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
AU2015203725A Division AU2015203725B2 (en) 2009-10-22 2015-07-02 Engineered zinc finger proteins targeting plant genes involved in fatty acid biosynthesis

Publications (2)

Publication Number Publication Date
AU2017200511A1 AU2017200511A1 (en) 2017-02-16
AU2017200511B2 true AU2017200511B2 (en) 2018-04-05

Family

ID=53716673

Family Applications (2)

Application Number Title Priority Date Filing Date
AU2015203725A Ceased AU2015203725B2 (en) 2009-10-22 2015-07-02 Engineered zinc finger proteins targeting plant genes involved in fatty acid biosynthesis
AU2017200511A Ceased AU2017200511B2 (en) 2009-10-22 2017-01-25 Engineered zinc finger proteins targeting plant genes involved in fatty acid biosynthesis

Family Applications Before (1)

Application Number Title Priority Date Filing Date
AU2015203725A Ceased AU2015203725B2 (en) 2009-10-22 2015-07-02 Engineered zinc finger proteins targeting plant genes involved in fatty acid biosynthesis

Country Status (1)

Country Link
AU (2) AU2015203725B2 (en)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040204345A1 (en) * 1999-01-12 2004-10-14 Sangamo Biosciences, Inc. Modulation of endogenous gene expression in cells

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040204345A1 (en) * 1999-01-12 2004-10-14 Sangamo Biosciences, Inc. Modulation of endogenous gene expression in cells

Also Published As

Publication number Publication date
AU2015203725A1 (en) 2015-07-30
AU2015203725B2 (en) 2017-02-02
AU2017200511A1 (en) 2017-02-16

Similar Documents

Publication Publication Date Title
US10017775B2 (en) Engineered zinc finger proteins targeting plant genes involved in fatty acid biosynthesis
JP6352250B2 (en) Target modification of malate dehydrogenase
AU2014341934B2 (en) Optimal soybean loci
AU2014341927B2 (en) Optimal maize loci
KR20150043539A (en) Fad2 performance loci and corresponding target site specific binding proteins capable of inducing targeted breaks
KR20160079864A (en) Optimal soybean loci
HUE029916T2 (en) Engineered zinc finger proteins targeting 5-enolpyruvyl shikimate-3-phosphate synthase genes
JP2013517770A (en) Targeted genome modification
AU2017200511B2 (en) Engineered zinc finger proteins targeting plant genes involved in fatty acid biosynthesis
CN113412332A (en) Improved methods for producing high levels of PUFAs in plants

Legal Events

Date Code Title Description
HB Alteration of name in register

Owner name: DOW AGROSCIENCES, LLC

Free format text: FORMER NAME(S): DOW AGROSCIENCES, LLC; SANGAMO BIOSCIENCES, INC.

Owner name: SANGAMO THERAPEUTICS, INC.

Free format text: FORMER NAME(S): DOW AGROSCIENCES, LLC; SANGAMO BIOSCIENCES, INC.

FGA Letters patent sealed or granted (standard patent)
HB Alteration of name in register

Owner name: CORTEVA AGRISCIENCE LLC

Free format text: FORMER NAME(S): DOW AGROSCIENCES, LLC

Owner name: SANGAMO THERAPEUTICS, INC.

Free format text: FORMER NAME(S): DOW AGROSCIENCES, LLC

MK14 Patent ceased section 143(a) (annual fees not paid) or expired