Gene Expression Markers for Breast Cancer Prognosis The entire disclosure in the complete specification of our Australian Patent Application No. 2012206980 is by this cross-reference incorporated into the present specification. 5 Background of the Invention Field of the Invention The present invention provides genes and gene sets the expression of which is important in LO the diagnosis and/or prognosis of breast cancer. Description of the Related Art Oncologists have a number of treatment options available to them, including different combinations of chemotherapeutic drugs that are characterized as "standard of care," and a number of L5 drugs that do not carry a label claim for particular cancer, but for which there is evidence of efficacy in that cancer. Best likelihood of good treatment outcome requires that patients be assigned to optimal available cancer treatment, and that this assignment be made as quickly as possible following diagnosis. Currently, diagnostic tests used in clinical practice are single analyte, and therefore do not to capture the potential value of knowing relationships between dozens of different markers. Moreover, diagnostic tests are frequently not quantitative, relying on immunohistochemistry. This method often yields different results in different laboratories, in part because the reagents are not standardized, and in part because the interpretations are subjective and cannot be easily quantified. RNA-based tests have not often been used because of the problem of RNA degradation over time and the fact that it is 25 difficult to obtain fresh tissue samples from patients for analysis. Fixed paraffin-embedded tissue is more readily available and methods have been established to detect RNA in fixed tissue. However, these methods typically do not allow for the study of large numbers of genes (DNA or RNA) from small amounts of material. Thus, traditionally fixed tissue has been rarely used other than for immunohistochemistry detection of proteins. 30 Recently, several groups have published studies concerning the classification of various cancer types by microarray gene expression analysis (see, e.g. Golub el al., Science 286:53 1-537 (1999); Bhattacharjae et al., Proc. NatL Acad. Sci. USA 98:13790-13795 (2001); Chen-Hsiang et aL, Bioinformatics 17 (Suppl. 1):S316-S322 (200 1); Ramaswamy et aL, Proc. NatL Acad. Sci. USA 98:15149-15154 (2001)). Certain classifications of human breast cancers based on gene expression 35 patterns have also been reported (Martin e aL, Cancer Res. 60:2232-223 8 (2000); West et al, Proc. Nail Acad. Sci. USA 98:11462-1 1467 (2001); Sorlie et al, Proc. Nail Acad. Sci. USA 98:10869 10874 (200 1); Yan el al, Cancer Res. 61:8375-8380 (200 1)). However, these studies mostly focus 1 6456359_1 (GHMauers) P57536 AU.3 LECWNR 4-May-15 on improving and refining the already established classification of various types of cancer, including breast cancer, and generally do not provide new insights into the relationships of the differentially expressed genes, and do not link the findings to treatment strategies in order to improve the clinical outcome of cancer therapy. 5 Although modern molecular biology and biochemistry have revealed hundreds of genes whose activities influence the behavior of tumor cells, state of their differentiation, and their sensitivity or resistance to certain therapeutic drugs, with a few exceptions, the status of these genes has not been exploited for the purpose of routinely making clinical decisions about drug treatments. One notable exception is the use of estrogen receptor (ER) protein expression in breast carcinomas to LO select patients to treatment with anti-estrogen drugs, such as tamoxifen. Another exceptional example is the use of ErbB2 (Her2) protein expression in breast carcinomas to select patients with the Her2 antagonist drug Herceptin@ (Genentech, Inc., South San Francisco, CA). Despite recent advances, the challenge of cancer treatment remains to target specific treatment regimens to pathogenically distinct tumor types, and ultimately personalize tumor treatment L5 in order to maximize outcome. Hence, a need exists for tests that simultaneously provide predictive information about patient responses to the variety of treatment options. This is particularly true for breast cancer, the biology of which is poorly understood. It is clear that the classification of breast cancer into a few subgroups, such as Erb32' subgroup, and subgroups characterized by low to absent gene expression of the estrogen receptor (ER) and a few additional transcriptional factors (Perou et ?o a/, Nature 406:747-752 (2000)) does not reflect the cellular and molecular heterogeneity of breast cancer, and does not allow the design of treatment strategies maximizing patient response. It is to be understood that, if any prior art publication is referred to herein, such reference does not constitute an admission that the publication forms a part of the common general knowledge in the art, in Australia or any other country. 25 Summary of the Invention The present invention provides a set of genes, the expression of which has prognostic value, specifically with respect to disease-free survival. The present invention accommodates the use of archived paraffin-embedded biopsy material 30 for assay of all markers in the set, and therefore is compatible with the most widely 2 6458359_J (GHlMelers) P$75368AU.3 LEOWNIR 4-May-15 available type of biopsy material. It is also compatible with several different methods of tumor tissue harvest, for example, via core biopsy or fine needle aspiration, Further, for each member of the gene set, the invention specifies oligonucleotide sequences that can be used in the test. 5 In one aspect, the invention concerns a method of predicting the likelihood of long term survival of a breast cancer patient without the recurrence of breast cancer, comprising determining the expression level of one or more prognostic RNA transcripts or their expression products in a breast cancer tissue sample obtained from the patient, normalized against the expression level of all RNA transcripts or their products in the breast cancer tissue 10 sample, or of a reference set of RNA transcripts or their expression products, wherein the prognostic RNA transcript is the transcript of one or more genes selected from the group consisting of: TP53BP2, GRB7, PR, CD68, Bcl2, KRT14, IRSI, CTSL, EstR1, Chk1, IGFBP2, BAGi, CEGPI, STK15, GSTM1, FH1T, RIZ1, Al, SURV, BBC3, IGF1R, p27, GATA3, ZNF217, EGFR, CD9, MYBL2, IflFla, pS2, ErbB3, TOP2B, MDM2, RAD51C, 15 KRT19, TS, Her2, KLK10, p-Catenin, y-Catenin, MCM2, PI3KC2A, IGFI, TBP, CCNB1, FBXOS, and DR5, wherein expression of one or more of GRB7, CD68, CTSL, Chk1, AIB1, CCNB1, MCM2, FBX05, Her2, STK15, SURV, EGFR, MYBL2, HIFla, and TS indicates a decreased likelihood of long-term survival without breast cancer recurrence, and 20 the expression of one or more of TP53BP2, PR, Bc2, KRT14, EstR1, IGFBP2, BAG1, CEGP1, KLK1O, p-Catenin, y-Catenin, DR5, PI3KCA2, RAD5IC, GSTM1, FT, RIZ1, BBC3, TBP, p 2 7 , IRS1, IGF1R, GATA3, ZNF217, CD9, pS2, ErbB3, TOP2B, MDM2, IGF1, and KRT19 indicates an increased likelihood of long-term survival without breast cancer recurrence. 25 In a particular embodiment, the expression levels of at least two, or at least 5, or at least 10, or at least 15 of the prognostic RNA transcripts or their expression products are determined. In another embodiment, the method comprises the determination of the expression levels of all prognostic RNA transcripts or their expression products. In another particular embodiment, the breast cancer is invasive breast carcinoma. 30 In a further embodiment, RNA is isolated from a fixed, wax-embedded breast cancer tissue specimen of the patient. Isolation may be performed by any technique known in the art, for example from core biopsy tissue or fine needle aspirate cells. 3 In another aspect, the invention concerns an array comprising polynucleotides hybridizing to two or more of the following genes: o-Catenin, AIB1, AKT1, AKT2, p-actin, BAGI, BBC3, Bol2, CCNB1, CCNDl, CD68, CD9, CDH1, CEGP1, Chk1, CIAP1, cMet.2, Contig 27882, CTSL, DR5, EGFR, EIF4E, BPHX1, ErbB3, EstR1, FBXO5, FHIT1 FRP1, 5 GAPDH, GATA3, G-Catenin, GRB7, GRO1, GSTMI, GUS, HER2, HIFIA, HNF3A, IGF1R, IGFBP2, KLK10, KRT14, KRT17, KRT18, KRT19, KRT5, Maspin, MCM2, MCM3, MDM2, MMP9, MTA1, MYBL2, P14ARF, p27, P53, PI3KC2A, PR, PRAMB, pS2, RADS1C,.3RB1, RIZZ, STK15, STMY3, SURV, TGFA, TOP2B, TP53BP2, TRAIL, TS, upa, VDR, VBGF, and ZNF217. 10 In particular embodiments, the array comprises polynucleotides hybridizing to at least 3, or at least 5, or at least 10, or at least 15, or at least 20, or all of the genes listed above. In another specific embodiment, the array comprises polynucleotides hybridizing to the following genes: TP53BP2, GRB7, PR, CD68, Bcl2, KRT14, IRS1, CTSL, EstR1, Chkl, IGFBP2, BAG1, CEGP1, STK15, GSTM1, FHIT, RIZ1, AIB1, SURV, BBC3, IGF1R, p27, 15 GATA3, ZNF217, EGFR, CD9, MYBL2, HlFla, pS2, RIZI, ErbB3, TOP2B, MDM2, RAD51C, KRT19, TS, Her2, KLK10, p-Catenin, 7-Catenin, MCM2, PI3KC2A, IGPI, TBP, CCNB1, FBXO5 and DR5. The polynucleotides can be cDNAs, or oligonucleotides, and the solid surface on which they are displayed may, for example, be glass. 20 In another aspect, the invention concerns a method of predicting the likelihood of long-term survival of a patient diagnosed with invasive breast cancer, without the recurrence of breast cancer, comprising the steps of: (1) determining the expression levels of the RNA transcripts or the expression products of genes or a gene set selected from the group consisting of 25 (a) TP53BP2, Bo12, BAD, EPHX1, PDGFRP, DIABLO, XIAP, YB1, CA9, and KRT8; (b) GRB7, CD68, TOP2A, Bol2, DIABLO, CD3, ID1, PPMID, MCM6, and WISPI; (c) PR, TP53BP2, PRAMB, DIABLO, CTSL, IGFBP2, TIMP1, CA9, MMP9, and COX2; (d) CD68, GRB7, TOP2A, Bc12, DIABLO, CD3, ID1, PPMID, MCM6, and WISPI; (e) Bc12, TP53BP2, BAD, BPHX1, PDGFRp, DIABLO, XIAP, YB1, CA9, and KRT8; 30 (f) KRT14, KRT5, PRAME, TP53BP2, GUS1, AEI, MCM3, CCNBI, MCM6, and ID1; 4 (g) PRAME, TP53BP2, EstRi, DIABLO, CTSL, PPM1D, GRB7, DAPK1, BBC3, and VEGFB; (h) CTSL2, GRB7, TOP2A, CCNB1, Bol2, DIABLO, PRAME, EMS1, CA9, and EpCAM; 5 (i) EstR1, TP53BP2, PRAME, DIABLO, CTSL, PPM1D, GRB7, DAPK1, BBC3, and VEGFB; (k) Chkl, PRAME, TP53BP2, GRB7, CA9, CTSL, CCNBl, TOP2A, tumor size, and IGFBP2; (1) IGFBP2, GRB7, PRAME, DIABLO, CTSL, p-Catenin, PPMID, Chk1, WISP1, and 10 LOTI; (m) HER2, TP53BP2, Bol2, DIABLO, TIMP1, EPHXI, TOP2A, TRAIN, CA9, and AREG; (n) BAG!, TP53BP2, PRAME, IL6, CCNB1, PAIl, AREG, tumor size, CA9, and Ki67; (o) CEGPi, TP53BP2, PRAMB, DIABLO, Bc12, COX2, CCNB1, STK15, and AKT2, 15 and FGF18; (p) STK15, TP53BP2, PRAME, IL6, CCNE, AKT2, DIABLO, cMet, CCNE2, and COX2; (q) KLKI10, EstR1, TP53BP2, PRAME, DIABLO, CTSL, PPM1D, GRB7, DAPK1, and BBC3; 20 (r) AB1, TPS3BP2, Bc2, DIABLO, TIMPI, CD3, p53, CA9, GRB7, and EPHX1 (s) BBC3, GRB7, CD68, PRAME, TOP2A, CCNBI, EPHX1, CTSL GSTM1, and APC; (t) CD9, GRB7, CD68, TOP2A, Bol2, CCNB1, CD3, DIABLO, ID1, and PPMlD; (w) BGFR, KRT14, GRB7, TOP2A, CCNB1, CTSL, Bol2, TP, KLK10, and CA9; 25 (x) HIFla, PR, DIABLO, PRAME, Chkl, AKT2, GRB7, CCNEI, TOP2A, and CCNB1; (y) MDM2, TP53BP2, DIABLO, Bc2, AIB1, TIMP1, CD3, p53, CA9, and HER2; (z) MYBL2, TP53BP2, PRAME, IL6, Bcl2, DIABLO, CCNE1, EPHXI, TIMP1, and CA9; (aa) p27, TP53BP2, PRAME, DIABLO, Bc12, COX2, CCNE, STK15, AKT2, and ID1; 30 (ab) RAD51, GRB7, CD68, TOP2A, CIAlP2, CCNB1, BAG1, IL6, FGFR1, and TP53BP2; (ac) SURV, GRB7, TOP2A, PRAME, CTSL, GSTMI, CCNB1, VDR, CA9; and CCNE2; (ad) TOP2B, TPS3BP2, DIABLO, Bcl2, TIMP1, AM1, CA9, p53, KRT8, and BAD; 5 (ae) ZNF217, GRB7, TP53BP2, PRAME, DIABLO, Bcl2, COX2, CCNEI, APC4, and p Catenin, in a breast cancer tissue sample obtained from the patient, normalized against the expression levels of all RNA transcripts or their expression products in said breast cancer tissue sample, 5 or of a reference set of RNA transcripts or their products; (2) subjecting the data obtained in step (1) to statistical analysis; and (3) determining whether the likelihood of said long-term survival has increased or decreased. In a further aspect, the invention concerns a method of predicting the likelihood of 10 long-term survival of a patient diagnosed with estrogen receptor (ER)-positive invasive breast cancer, without the recurrence of breast cancer, comprising the steps of: (1) determining the expression levels of the RNA transcripts or the expression products of genes of a gene set selected from the group consisting of CD68; CTSL; FBXO5; SURV; CCNB1; MCM2; Chkl; MYBL2; HfIA; cMET; EGFR; TS; STK15, IGFRI; BC12; 15 HNF3A; TP53BP2; GATA3; BBC3; RAD51C; BAGl; IGFBP2; PR; CD9; RBt; EPHXI; CEGP1; TRAIL; DR5; p 27 ; p53; MTA; RI11; ErbB3; TOP2B; EIF4E, wherein expression of the following genes in ER-positive cancer is indicative of a reduced likelihood of survival without cancer recurrence following surgery: CD68; CTSL; FBXO5; SURV; CCNB1; MCM2; Chki; MYBL2; HIF1A; cMET; EGFR; TS; STK15, and wherein expression of the ?0 following genes is indicative of a better prognosis for survival without cancer recurrence following surgery: IGFRI; BC12; HNF3A; TP53BP2; GATA3; BBC3; RAD51C; BAG1; IGFBP2; PR; CD9; RBI; EPHX1; CEGPl; TRAIL; DR5; p27; p53; MTA; RIZ1; ErbB3; TOP2B; EIF4E. (2) subjecting the data obtained in step (1) to statistical analysis; and 25 (3) determining whether the likelihood of said long-term survival has increased or decreased. In yet another aspect, the invention concerns a method of predicting the likelihood of long-term survival of a patient diagnosed with estrogen receptor (ER)-negative invasive breast cancer, without the recurrence of breast cancer, comprising determining the expression levels 30 of the RNA transcripts or the expression products of genes of the gene set CCND1; UPA; HNF3A; CDHI; Her2; GRB7; AKT1; STMY3; a-Catenin; VDR; GRO1; KT14; KLKlO; Maspin, TGFa, and FRP1, wherein expression of the following genes is indicative of a 6 reduced likelihood of survival without cancer recurrence: CCNDI; UPA; HNF3A; CDHi; Her2; GRB7; AKTi; STMY3; a-Catenin; VDR; GRO1, and wherein expression of the following genes is indicative of a better prognosis for survival without cancer recurrence: KT14; KLKI0; Maspin, TGFa, and FRPl. 5 In a different aspect, the invention concerns a method of preparing a personalized genomics profile for a patient, comprising the steps of: (a) subjecting RNA extracted from a breast tissue obtained from the patient to gene expression analysis; (b) determining the expression level of one or more genes selected from the breast 10 cancer gene set listed in any one of Tables 1-5, wherein the expression level is normalized ~ against a control gene or genes and optionally is compared to the amount found in a breast cancer reference tissue set; and (c) creating a report summarizing the data obtained by the gene expression analysis. 15 The report may, for example, include prediction of the likelihood of long term survival of the patient and/or recommendation for a treatment modality of said patient. In a further aspect, the invention concerns a method for amplification of a gene listed in Tables 5A and B by polymerase chain reaction (PCR), comprising performing said PCR by using an amplicon listed in Tables 5A and B and a primer-probe set listed in Tables 6A-F. 20 In a still further aspect, the invention concerns a PCR amplicon listed in Tables 5A and B. In yet another aspect, the invention concerns a PCR primer-probe set listed in Tables 6A-F. The invention further concerns a prognostic method comprising: 25 (a) subjecting a sample comprising breast cancer cells obtained from a patient to quantitative analysis of the expression level of the RNA transcript of at least one gene selected from the group consisting of GRB7, CD68, CTSL, Chkl, AIBI, CCNB1, MCM2, FBXO5, Her2, STK15, SURV, BGFR, MYBL2, HIFla, and TS, or their product, and (b) identifying the patient as likely to have a decreased likelihood of long-term 30 survival without breast cancer recurrence if the normalized expression levels of the gene or genes, or their products, are elevated above a defined expression threshold. In a different aspect, the invention concerns a prognostic method comprising: 7 (a) subjecting a sample comprising breast cancer cells obtained from a patient to quantitative analysis of the expression level of the RNA transcript of at least one gene selected from the group consisting of TP53BP2, PR, Bcl2, KRT14, EstRI, IGFBP2, BAG1, - CEGPI, KLKIO, p-Catenin, y-Catenin, DR5, PI3KCA2, RAD51C, GSTM1, PIET, RIZ1, 5 BBC3, TBP, p27, IRS1, IGFIR, GATA3, ZNF217, CD9, pS2, ErbB3, TOP2B, MDM2, IGFI, and KRT19, and (b) identifying the patient as likely to have an increased likelihood of long-term survival without breast cancer recurrence if the normalized expression levels of the gene or genes, or their products, are elevated above a defined expression threshold. 10 The invention further concerns a kit comprising one or more of (1) extraction buffer/reagents and protocol; (2) reverse transcription buffer/reagents and protocol; and (3) qPCR buffer/reagents and protocol suitable for performing any of the foregoing methods.
S
Brief Description of the Drawings Table 1 is a list of genes, expression of which correlate with breast cancer survival. Results from a retrospective clinical trial. Binary statistical analysis. Table 2 is a list of genes, expression of which correlates with breast cancer survival in s estrogen receptor (ER) positive patients. Results from a retrospective clinical trial. Binary statistical analysis. Table 3 is a list of genes, expression of which correlates with breast cancer survival in estrogen receptor (ER) negative patients. Results from a retrospective clinical trial, Binary statistical analysis. .0 Table 4 is a list of genes, expression of which correlates with breast cancer survival. Results from a retrospective clinical trial. Cox proportional hazards statistical analysis. Tables 5A and B show a list of genes, expression of which correlate with breast cancer survival. Results from a retrospective clinical trial. The table includes accession numbers for the genes, and amplicon sequences used for PCR amplification. .5 Tables 6A-6F. The table includes sequences for the forward and reverse primers (designated by "f" and "r", respectively) and probes (designated by "p") used for PCR amplification of the amplicons listed in Tables SA-B. Detailed Description of the Preferred Embodiment !0 A. Definitions Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Singleton et al., Dictionary of Microbiology and Molecular Biology 2nd ed., J. Wiley & Sons (New York, NY 1994), and March, Advanced Organic Chemistry Reactions, Mechanisms and Structure 4th ed., John 25 Wiley & Sons (New York, NY 1992), provide one skilled in the art with a general guide to many of the terms used in the present application. One skilled in the art will recognize many methods and materials similar or equivalent to those described herein, which could be used in the practice of the present invention. Indeed, the present invention is in no way limited to the methods and materials described. For purposes of the 30 present invention, the following terms are defined below. In the claims which follow and in the description of the invention, except where the context requires otherwise due to express language or necessary implication, the word "comprise" or variations such as "comprises" or "comprising" is used in an inclusive sense, i.e. to specify the presence of the stated features but not to preclude the presence or addition of further features in 35 various embodiments of the invention. 9 6*4359.. (GHMallers) P57538 AU 3 LEOWNR 4.M~ay- I5 The term "microarray" refers to an ordered arrangement of hybridizable array elements, preferably polynucleotide probes, on a substrate. The term "polynucleotide," when used in singular or plural, generally refers to any polyribonucleotide or polydeoxribonucleotide, which may be unmodified RNA or DNA or 5 modified RNA or i)NA, Thus, for instance, polynucleotides as defined herein include, without limitation, single- and double-stranded DNA, DNA including single- and double stranded regions, single- and double-stranded RNA, and RNA including single- and double stranded regions, hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically, double-stranded or include single- and double-stranded regions. In addition, 10 the term "polynucleotide" as used herein refers to triple-stranded regions comprising RNA or DNA or both RNA and DNA. The strands in such regions may be from the same molecule or from different molecules. The regions may include all of one or more of the molecules, but more typically involve only a region of some of the molecules. One of the molecules of a triple-helical region often is an oligonucleotide. The term "polynucleotide" specifically 15 includes cDNAs. The term includes DNAs (including cDNAs) and RNAs that contain one or more modified bases. Thus, DNAs or RNAs with backbones modified for stability or for other reasons are "polynucleotides" as that term is intended herein. Moreover, DNAs or RNAs comprising unusual bases, such as inosine, or modified bases, such as tritiated bases, are included within the term "polynucleotides" as defined herein. In general, the term 20 "polynucleotide" embraces all chemically, enzymatically and/or metabolically modified forms of unmodified polynucleotides, as well as the chemical forms of DNA and RNA characteristic of viruses and cells, including simple and complex cells. The term "oligonucleotide" refers to a relatively short polynucleotide, including, without limitation, single-stranded deoxyribonucleotides, single- or double-stranded 25 ribonucleotides, RNA:DNA hybrids and double-stranded DNAs. Oligonucleotides, such as single-stranded DNA probe oligonucleotides, are often synthesized by chemical methods, for example using automated oligonucleotide synthesizers that are commercially available. However, oligonucleotides can be made by a variety of other methods, including in vitro recombinant DNA-mediated techniques and by expression of DNAs in cells and organisms. 30 The terms "differentially expressed gene," "differential gene expression" and their synonyms, which are used interchangeably, refer to a gene whose expression is activated to a higher or lower level in a subject suffering from a disease, specifically cancer, such as breast 10 cancer, relative to its expression in a normal or control subject. The terms also include genes whose expression is activated to a higher or lower level at different stages of the same disease. It is also understood that a differentially expressed gene may be either activated or inhibited at the nucleic acid level or protein level, or may be subject to alternative splicing to result in a 5 different polypeptide product. Such differences may be evidenced by a change in mRNA levels, surface expression, secretion or other partitioning of a polypeptide, for example. Differential gene expression may include a comparison of expression between two or more genes or their gene products, or a comparison of the ratios of the expression between two or more genes or their gene products, or even a comparison of two differently processed 10 products of the same gene, which differ between normal subjects and subjects suffering from a disease, specifically cancer, or between various stages of the same disease. Differential expression includes both quantitative, as well as qualitative, differences in the temporal or cellular expression pattern in a gene or its expression products among, for example, normal and diseased cells, or among cells which have undergone different disease events or disease 15 stages. For the purpose of this invention, "differential gene expression" is considered to be present when there is at least an about two-fold, preferably at least about four-fold, more preferably at least about six-fold, most preferably at least about ten-fold difference between the expression of a given gene in normal and diseased subjects, or in various stages of disease development in a diseased subject. 20 The phrase "gene amplification" refers to a process by which multiple copies of a gene or gene fragment are formed in a particular cell or cell line. The duplicated region (a stretch of amplified DNA) is often referred to as "amplicon." Usually, the amount of the messenger RNA (mRNA) produced, i.e., the level of gene expression, also increases in the proportion of the number of copies made of the particular gene expressed. 25 The term "diagnosis" is used herein to refer to the identification of a molecular or pathological state, disease or condition, such as the identification of a molecular subtype of head and neck cancer, colon cancer, or other type of cancer. The term "prognosis" is used herein to refer to the prediction of the likelihood of cancer-attributable death or progression, including recurrence, metastatic spread, and drug 30 resistance, of a neoplastic disease, such as breast cancer. The term "prediction" is used herein to refer to the likelihood that a patient will respond either favorably or unfavorably to a drug or set of drugs, and also the extent of those 11 responses, or that a patient will survive, following surgical removal or the primary tumor and/or chemotherapy for a certain period of time without cancer recurrence. The predictive methods of the present invention can be used clinically to make treatment decisions by choosing the most appropriate treatment modalities for any particular patient. The predictive 5 methods of the present invention are valuable tools in predicting if a patient is likely to respond favorably to a treatment regimen, such as surgical intervention, chemotherapy with a given drug or drug combination, and/or radiation therapy, or whether long-tern survival of the patient, following sugery and/or termination of chemotherapy or other treatment modalities is likely. 10 The term "long-term' survival is used herein to refer to survival for at least 3 years, more preferably for at least 8 years, most preferably for at least 10 years following surgery or other treatment. The term "tumor," as used herein, refers to all neoplastic cell growth and proliferation, whether malignant or benign, and all pre-cancerous and cancerous cells and tissues. 1$ The terms "cancer" and "cancerous" refer to or describe the physiological condition in mammals that is typically characterized by unregulated cell growth. Examples of cancer include but are not limited to, breast cancer, colon cancer, lung cancer, prostate cancer, hepatocellular cancer, gastric cancer, pancreatic cancer, cervical cancer, ovarian cancer, liver cancer, bladder cancer, cancer of the urinary tract, thyroid cancer, renal cancer, carcinoma, 20 melanoma, and brain cancer. The "pathology" of cancer includes all phenomena that compromise the well-being of the patient. This includes, without limitation, abnormal or uncontrollable cell growth, metastasis, interference with the normal functioning of neighboring cells, release of cytokines or other secretory products at abnormal levels, suppression or aggravation of inflammatory or 25 immunological response, neoplasia, premalignancy, malignancy, invasion of surrounding or distant tissues or organs, such as lymph nodes, etc. "Stringency" of hybridization reactions is readily determinable by one of ordinary skill in the art, and generally is an empirical calculation dependent upon probe length, washing temperature, and salt concentration. In general, longer probes require higher temperatures for 30 proper annealing, while shorter probes need lower temperatures. Hybridization generally depends on the ability of denatured DNA to reanneal when complementary strands are present in an environment below their melting temperature. The higher the degree of desired 12 homology between the probe and hybridizable sequence, the higher the relative temperature which can be used. As a result, it follows that higher relative temperatures would tend to make the reaction conditions more stringent, while lower temperatures less so. For additional details and explanation of stringency of hybridization reactions, see Ausubel et al., Current 5 Protocols in Molecular Biology, Wiley Interscience Publishers, (1995). "Stringent conditions" or "high stringency conditions", as defined herein, typically: (1) employ low ionic strength and high temperature for washing, for example 0.015 M sodium chloride/0.0015 M sodium citrate/0.1% sodium dodecyl sulfate at 50*C; (2) employ during hybridization a denaturing agent, such as formarnide, for example, 50% (v/v) formamide with 10 0.1% bovine serum albumin/0.I% Ficoll/O.1% polyvinylpyrrolidone/5OmM sodium phosphate buffer at pH 6.5 with 750 mM sodium chloride, 75 mM sodium citrate at 42*C; or (3) employ 50% fonnamide, 5 x SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5 x Denhardt's solution, sonicated salmon sperm DNA (50 pg/ml), 0.1% SDS, and 10% dextran sulfate at 420C, with washes at 42*C in 0.2 x SSC 15 (sodium chloride/sodium citrate) and 50% formamide at 55"C, followed by a high-stringency wash consisting of 0.1 x SSC containing EDTA at 55"C. "Moderately stringent conditions" may be identified as described by Sambrook et al., Molecular Clonig A Laborto ManuaL New York: Cold Spring Harbor Press, 1989, and include the use of washing solution and hybridization conditions (e.g, temperature, ionic 20 strength and %SDS) less stringent that those described above. An example of moderately stringent conditions is overnight incubation at 37C in a solution comprising: 20% formamide, 5 x SSC (150 mM NaCl, 15 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5 x Denhardt's solution, 10% dextran sulfate, and 20 mg/nil denatured sheared salmon sperm DNA, followed by washing the filters in 1 x SSC at about 37-50"C. The 25 skilled artisan will recognize how to adjust the temperature, ionic strength, etc. as necessary to accommodate factors such as probe length and the like. In the context of the present invention, reference to "at least one," "at least two," "at least five," etc. of the genes listed in any particular gene set means any one or any and all combinations of the genes listed, 30 The terms "expression threshold," and "defined expression threshold" are used interchangeably and refer to the level of a gene or gene product in question above which the gene or gene product serves as a predictive marker for patient survival without cancer 13 recurrence. The threshold is defined experimentally from clinical studies such as those described in the Example below. The expression threshold can be selected either for maximum sensitivity, or for maximum selectivity, or for minimum error. The determination of the expression threshold for any situation is well within the knowledge of those skilled in 5 the art. B. Detailed Description The practice of the present invention will employ, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), 10 microbiology, cell biology, and biochemistry, which are within the skill of the art. Such techniques are explained fully in the literature, such as, "Molecular Cloning: A Laboratory Manual", 2 "d edition (Sambrook et al., 1989); "Oligonucleotide Synthesis" (M.J. Gait, ed., 1984); "Animal Cell Culture" (R.L Freshney, ed., 1987); "Methods in Enzymology" (Academic Press, Inc.); "Handbook of Experimental Immunology", 4t edition (D.M. Weir & 15 C.C. Blackwell, eds., Blackwell Science Inc., 1987); "Gene Transfer Vectors for Mammalian Cells" (.M. Miller & M.P. Calos, eds., 1987); "Current Protocols in Molecular Biology" (F.M. Ausubel et al., eds., 1987); and "PCR: The Polymerase Chain Reaction", (Mullis et al., eds., 1994). 1. Gene Expression Profling 20 In general, methods of gene expression profiling can be divided into two large groups: methods based on hybridization analysis of polynucleotides, and methods based on sequencing of polynucleotides. The most commonly used methods known in the art for the quantification of mRNA expression in a sample include northern blotting and in situ hybridization (Parker & Barnes, Methods in Molecular Biology 106:247-283 (1999)); RNAse 25 protection assays (Hod, Biotechniques 13:852-854 (1992)); and reverse transcription polymerase chain reaction (RT-PCR) (Weis et aL, Trends in Genetics 8:263-264 (1992)). Alternatively, antibodies may be employed that can recognize specific duplexes, including DNA duplexes, RNA duplexes, and DNA-RNA hybrid duplexes or DNA-protein duplexes. Representative methods for sequencing-based gene expression analysis include Serial 30 Analysis of Gene Expression (SAGE), and gene expression analysis by massively parallel signature sequencing (MPSS). 2. Reverse Transcriptase PCR (RT-PCR) 14 Of the techniques listed above, the most sensitive and most flexible quantitative method is RT-PCR, which can be used to compare mRNA levels in different sample populations, in normal and tumor tissues, with or without drug treatment, to characterize patterns of gene expression, to discriminate between closely related mRNAs, and to analyze 5 RNA structure. The first step is the isolation of mRNA from a target sample. The starting material is typically total RNA isolated from human tumors or tumor cell lines, and corresponding normal tissues'or cell lines, respectively. Thus RNA can be isolated from a variety of primary tumors, including breast, lung, colon, prostate, brain, liver, kidney, pancreas, spleen, thymus, 10 testis, ovary, uterus, etc., tumor, or tumor cell lines, with pooled DNA from healthy donors. If the source of mRNA is a primary tumor, mRNA can be extracted, for example, from frozen or archived paraffin-embedded and fixed (e.g. formalin-fixed) tissue samples. General methods for mRNA extraction are well known in the art and are disclosed in standard textbooks of molecular biology, including Ausubel et al., Current Protocols of 15 Molecular Biology, John Wiley and Sons (1997). Methods for RNA extraction from paraffin embedded tissues are disclosed, for example, in Rupp and Locker, Lab Invest. 56:A67 (1987), and De Andr6s et aL, BioTechniques 18:42044 (1995). In particular, RNA isolation can be performed using purification kit, buffer set and protease from commercial manufacturers, such as Qiagen, according to the manufacturer's instructions. For example, total RNA from 20 cells in culture can be isolated using Qiagen RNeasy mini-columns. Other commercially available RNA isolation kits include MasterPurem Complete DNA and RNA Purification Kit (EPICENTRE®, Madison, WI), and Paraffin Block RNA Isolation Kit (Ambion, Inc.). Total RNA from tissue samples can be isolated using RNA Stat-60 (Tel-Test). RNA prepared from tumor can be isolated, for example, by cesium chloride density gradient centrifugation. 25 As RNA cannot serve as a template for PCR, the first step in gene expression profiling by RT-PCR is the reverse transcription of the RNA template into cDNA, followed by its exponential amplification in a PCR reaction. The two most commonly used reverse transcriptases are avilo myeloblastosis virus reverse transcriptase (AMV-RT) and Moloney murine leukemia virus reverse transcriptase (MMLV-RT). The reverse transcription step is 30 typically primed using specific primers, random hexamers, or oligo-dT primers, depending on the circumstances and the goal of expression profiling. For example, extracted RNA can be reverse-transcribed using a GeneAmp RNA PCR kit (Perkin Elmer, CA, USA), following the 15 manufacturer's instructions. The derived cDNA can then be used as a template in the subsequent PCR reaction. Although the PCR step can use a variety of thermostable DNA-dependent DNA polymerases, it typically employs the Taq DNA polymerase, which has a 5'-3' nuclease 5 activity but lacks a 3'-5' proofreading endonuclease activity. Thus, TaqMan@& PCR typically utilizes the 5'-nuclease activity of Taq or Tth polymerase to hydrolyze a hybridization probe bound to its target amplicon, but any enzyme with equivalent 5' nuclease activity can be used. Two oligonucleotide primers are used to generate an amplicon typical of a PCR reaction. A third oligonucleotide, or probe, is designed to detect nucleotide sequence located between the 10 two PCR primers. The probe is non-extendible by Taq DNA polymerase enzyme, and is labeled with a reporter fluorescent dye and a quencher fluorescent dye. Any laser-induced emission from the reporter dye is quenched by the quenching dye when the two dyes are located close together as they are on the probe. During the amplification reaction, the Taq DNA polymerase enzyme cleaves the probe in a template-dependent manner. The resultant 15 probe fragments disassociate in solution, and signal from the released reporter dye is free from the quenching effect of the second fluorophore. One molecule of reporter dye is liberated for each new molecule synthesized, and detection of the unquenched reporter dye provides the basis for quantitative interpretation of the data. TaqMan@ RT-PCR can be performed using commercially available equipment, such 20 as, for example, ABI PRISM 7 700 TM Sequence Detection System" (Perkin-Ehner-Applied Biosystems, Foster City, CA, USA), or Lightcycler (Roche Molecular Biochemicals, Mannheim, Gemany). In a preferred embodiment, the 5' nuclease procedure is run on a real time quantitative PCR device such as the ABI PRISM 7 7 00 TM Sequence Detection SystemT". The system consists of a thermocycler, laser, charge-coupled device (CCD), camera and 25 computer. The system amplifies samples in a 96-well format on a thermocycler. During amplification, laser-induced fluorescent signal is collected in real-time through fiber optics cables for all 96 wells, and detected at the CCD. The system includes software for running the instrument and for analyzing the data. 5'-Nuclease assay data are initially expressed as Ct, or the threshold cycle. As 30 discussed above, fluorescence values are recorded during every cycle and represent the amount of product amplified to that point in the amplification reaction. The point when the fluorescent signal is first recorded as statistically significant is the threshold cycle (Ct). 16 To minimize errors and the effect of sample-to-sample variation, RT-PCR is usually performed using an internal standard. The ideal internal standard is expressed at a constant level among different tissues, and is unaffected by the experimental treatment. RNAs most frequently used to normalize patterns of gene expression are mRNAs for the housekeeping 5 genes glyceraldehyde-3-phosphate-dehydrogenase (GAPDH) and D-actin. A more recent variation of the RT-PCR technique is the real time quantitative PCR, which measures PCR product accumulation through a dual-labeled fluorigenic probe (i.e., TaqMan@ probe). Real time PCR is compatible both with quantitative competitive PCR, where internal competitor for each target sequence is used for normalization, and with 10 quantitative comparative PCR using a normalization gene contained within the sample, or a housekeeping gene for RT-PCR. For further details see, e.g. Held et al., Genome Research 6:986-994 (1996). The steps of a representative protocol for profiling gene expression using fixed, paraffin-embedded tissues as the RNA source, including mRNA isolation, purification, primer 15 extension and amplification are given in various published journal articles {for example: T.E. Godfrey et al,. I. Molec. Diagnostics 2: 84-91 [20001; K. Specht et at, Am. J. Pathol. 158: 419-29 [2001]}. Briefly, a representative process starts with cutting about 10 pmu thick sections of paraffin-embedded tumor tissue samples. The RNA is then extracted, and protein and DNA are removed. After analysis of the RNA concentration, RNA repair and/or 20 amplification steps may be included, if necessary, and RNA is reverse transcribed using gene specific promoters followed by RT-PCR. According to one aspect of the present invention, PCR primers and probes are designed based upon intron sequences present in the gene to be amplified. In this embodiment, the first step in the primer/probe design is the delineation of intron sequences 25 within the genes. This can be done by publicly available software, such as the DNA BLAT software developed by Kent, W.L, Genome Res. 12(4):656-64 (2002), or by the BLAST software including its variations. Subsequent steps follow well established methods of PCR primer and probe design. In order to avoid non-specific signals, it is important to mask repetitive sequences 30 within the introns when designing the primers and probes. This can be easily accomplished by using the Repeat Masker program available on-line through the Baylor College of Medicine, which screens DNA sequences against a library of repetitive elements and returns a 17 query sequence in which the repetitive elements are masked. The masked intron sequences can then be used to design primer and probe sequences using any commercially or otherwise publicly available primer/probe design packages, such as Primer Express (Applied Biosystems); MGB assay-by-design (Applied Biosystems); Primer3 (Steve Rozen and Helen 5 J. Skaletsky (2000) Primer3 on the WWW for general users and for biologist programmers. In: Krawetz S, Misener S (eds) Bioinformatics Methods and Protocols; Methods in Molecular Biology. Humana Press, Totowa, NJ, pp 365-386) The most important factors considered in PCR primer design include primer length, melting temperature (Tm), and GIC content, specificity, complementary primer sequences, 10 and 3'-end sequence. In general, optimal PCR primers are generally 17-30 bases in length, and contain about 20-80%, such as, for example, about 50-60% G+C bases. Tm's between 50 and 80 "C, e.g. about 50 to 70 *C are typically preferred. For further guidelines for PCR primer and probe design see, e.g. Dieffenbach, C.W. et al., "General Concepts for PCR Primer Design" in: PCR Priner, A Laboratory Manual, Cold 15 Spring Harbor Laboratory Press, New York, 1995, pp. 133-155; Innis and Gelfand, "Optimization of PCRs" in: PCR Protocols, A Guide to Methods and Applications, CRC Press, London, 1994, pp. 5-11; and Plasterer, T.N. Primerselect: Primer and probe design. Methods Mol. Biol. 70:520-527 (1997), the entire disclosures of which are hereby expressly incorporated by reference. 20 3. Microarrays Differential gene expression can also be identified, or confirmed using the microarray technique. Thus, the expression profile of breast cancer-associated genes can be measured in either fresh or paraffin-embedded tumor tissue, using microarray technology. In this method, polynucleotide sequences of interest (including cDNAs and oligonucleotides) are plated, or 25 arrayed, on a microchip substrate. The arrayed sequences are then hybridized with specific DNA probes from cells or tissues of interest. Just as in the RT-PCR method, the source of mRNA typically is total RNA isolated from human tumors or tumor cell lines, and corresponding normal tissues or cell lines. Thus RNA can be isolated from a variety of primary tumors or tumor cell lines. If the source of mRNA is a primary tumor, mRNA can be 30 extracted, for example, from frozen or archived paraffin-embedded and fixed (e.g. formalin fixed) tissue samples, which are routinely prepared and preserved in everyday clinical practice. 18 In a specific embodiment of the microarray technique, PCR amplified inserts of cDNA clones are applied to a substrate in a dense array. Preferably at least 10,000 nucleotide sequences are applied to the substrate. The microarrayed genes, immobilized on the microchip at 10,000 elements each, are suitable for hybridization under stringent conditions. 5 Fluorescently labeled cDNA probes may be generated through incorporation of fluorescent nucleotides by reverse transcription of RNA extracted from tissues of interest. Labeled oDNA probes applied to the chip hybridize with specificity to each spot of DNA on the array. After stringent washing to remove non-specifically bound probes, the chip is scanned by confocal laser microscopy or by another detection method, such as a CCD camera. Quantitation of 10 hybridization of each arrayed element allows for assessment of corresponding mRNA abundance. With dual color fluorescence, separately labeled cDNA probes generated from two sources of RNA are hybridized painvise to the array. The relative abundance of the transcripts from the two sources corresponding to each specified gene is thus determined simultaneously. The miniaturized scale of the hybridization affords a convenient and rapid 15 evaluation of the expression pattern for large numbers of genes. Such methods have been shown to have the sensitivity required to detect rare transcripts, which are expressed at a few copies per cell, and to reproducibly detect at least approximately two-fold differences in the expression levels (Schena et al., Proc. Natl. Acad. Sci, USA 93(2):106-149 (1996)). Microarray analysis can be performed by commercially available equipment, following 20 manufacturer's protocols, such as by using the Affynetrix GenChip technology, or Incyte's microarray technology. The development of microarray methods for large-scale analysis of gene expression makes it possible to search systematically for molecular markers of cancer classification and outcome prediction in a variety of tumor types. 25 4. Serial Analysis of Gene E ression (SAUE Serial analysis of gene expression (SAGE) is a method that allows the simultaneous and quantitative analysis of a large number of gene transcripts, without the need of providing an individual hybridization probe for each transcript. First, a short sequence tag (about 10-14 bp) is generated that contains sufficient information to uniquely identify a transcript, provided 30 that the tag is obtained from a unique position within each transcript. Then, many transcripts are linked together to form long serial molecules, that can be sequenced, revealing the identity of the multiple tags simultaneously. The expression pattern of any population of transcripts 19 can be quantitatively evaluated by determining the abundance of individual tags, and identifying the gene corresponding to each tag. For more details see, e.g. Velculescu et al, Science 270:484-487 (1995); and Velculesou et al., Cell 88:243-51 (1997). 5. MassARRA Y Technology 5 The MassARRAY (Sequenom, San Diego, California) technology is an automated, high-throughput method of gene expression analysis using mass spectrometry (MS) for detection. According to this method, following the isolation of RNA, reverse transcription and PCR amplification, the cDNAs are subjected to primer extension. The cDNA-derived primer extension products are purified, and dipensed on a chip array that is pre-loaded with 10 the components needed for MALTI-TOF MS sample preparation. The various cDNAs present in the reaction are quantitated by analyzing the peak areas in the mass spectrum obtained. 6. Gene Expreggion Analysis by Massively Parallel Signature Seauencing MP35i This method, described by Brenner et al, Nature Biotechnology 18:630-634 (2000), is 15 a sequencing approach that combines non-gel-based signature sequencing with in vitro cloning of millions of templates on separate 5 Rm diameter microbeads. First, a microbead library of DNA templates is constructed by in vitro cloning. This is followed by the assembly of a planar array of the template-containing microbeads in a flow cell at a high density (typically greater than 3 x 106 microbeads/cm). The free ends of the cloned templates on 20 each microbead are analyzed simultaneously, using a fluorescence-based signature sequencing method that does not require DNA fragment separation. This method has been shown to simultaneously and accurately provide, in a single operation, hundreds of thousands of gene signature sequences from a yeast cDNA library. 7. hnnunohistochemistrv 25 Rnmunohistochemistry methods are also suitable for detecting the expression levels of the prognostic markers of the present invention. Thus, antibodies or antisera, preferably polyclonal antisera, and most preferably monoclonal antibodies specific for each marker are used to detect expression. The antibodies can be detected by direct labeling of the antibodies themselves, for example, with radioactive labels, fluorescent labels, hapten labels such as, 30 biotin, or an enzyme such as horse radish peroxidase or alkaline phosphatase. Alternatively, unlabeled primary antibody is used in conjunction with a labeled secondary antibody, comprising antisera, polyclonal antisera or a monoclonal antibody specific for the primary 20 antibody. Immunohistochemistry protocols and kits are well known in the art and are commercially available. 8. Proteomics The term "proteome" is defined as the totality of the proteins present in a sample (e.g. 5 tissue, organism, or cell culture) at a certain point of time. Proteomics includes, among other things, study of the global changes of protein expression in a sample (also referred to as "expression proteomics"). Proteomics typically includes the following steps: (1) separation of individual proteins in a sample by 2-D gel electrophoresis (2-D PAGE); (2) identification of the individual proteins recovered from the gel, e.g. my mass spectrometry or N-terminal 0 sequencing, and (3) analysis of the data using bioinformatics. Proteomics methods are valuable supplements to other methods of gene expression profiling, and can be used, alone or in combination with other methods, to detect the products of the prognostic markers of the present invention. 9. General Description ofthe mRNA Isolation Purl catio nd A .5 The steps of a representative protocol for profiling gene expression using fixed, paraffin-embedded tissues as the RNA source, including mRNA isolation, purification, primer extension and amplification are given in various published journal articles {for example: T.E. Godfrey et al. I. Molec. Diagnostics 2: 84-91 [2000]; K. specht et al., Am. J. Pathol. 158: 419-29 [2001]), Briefly, a representative process starts with cutting about 10 Ln thick ,0 sections of paraffin-embedded tumor tissue samples. The RNA is then extracted, and protein and DNA are removed. After analysis of the RNA concentration, RNA repair and/or amplification steps may be included, if necessary, and RNA is reverse transcribed using gene specific promoters followed by RT-PCR. Finally, the data are analyzed to identify the best treatment option(s) available to the patient on the basis of the characteristic gene expression 25 pattern identified in the tumor sample examined. 10. Breath Cancer aG et A aed Gene Subseauences- and tink-al Application of Gene Expression Data An important aspect of the present invention is to use the measured expression of certain genes by breast cancer tissue to provide prognostic information. For this purpose it is 30 necessary to correct for (normalize away) both differences in the amount of RNA assayed and variability in the quality of the RNA used. Therefore, the assay typically measures and incorporates the expression of certain normalizing genes, including well known housekeeping 21 genes, such as QAPDH and Cypl. Alternatively, normalization can be based on the mean or median signal (Ct) of all of the assayed genes or a large subset thereof (global normalization approach). On a gene-by-gene basis, measured normalized amount of a patient tumor mRNA is compared to the amount found in a breast cancer tissue reference set. The number (N) of 5 breast cancer tissues in this reference set should be sufficiently high to ensure that different reference sets (as a whole) behave essentially the same way, If this condition is met, the identity of the individual breast cancer tissues present in a particular set will have no significant impact on the relative amounts of the genes assayed. Usually, the breast cancer tissue reference set consists of at least about 30, preferably at least about 40 different FPE LO breast cancer tissue specimens. Unless noted otherwise, normalized expression levels for each mRNA/tested tumor/patient will be expressed as a percentage of the expression level measured in the reference set. More specifically, the reference set of a sufficiently high number (e.g. 40) of tumors yields a distribution of normalized levels of each mRNA species. The level measured in a particular tumor sample to be analyzed falls at some percentile within 15 this range, which can be determined by methods well known in the art. Below, unless noted otherwise, reference to expression levels of a gene assume normalized expression relative to the reference set although this is not always explicitly stated. Further details of the invention will be described in the following non-limiting Example 20 Example A& Phase II Study of GnExrsinn79 liant Breast Twaora A gene expression study was designed and conducted with the primary goal to molecularly characterize gene expression in paraffin-embedded, fixed tissue samples of 25 invasive breast ductal carcinoma, and to explore the correlation between such molecular profiles and disease-free survival. Study design Molecular assays were performed on paraffin-embedded, formalin-fixed primary 30 breast tumor tissues obtained from 79 individual patients diagnosed with invasive breast cancer. All patients in the study had 10 or more positive nodes. Mean age was 57 years, and mean clinical tumor size was 4.4 cm. Patients were included in the study only if 22 histopathologic assessment, performed as described in the Materials and Methods section, indicated adequate amounts of tumor tissue and homogeneous pathology. Materials and Methods 5 Each representative tumor block was characterized by standard histopathology for diagnosis, semi-quantitative assessment of amount of tumor, and tumor grade. A total of 6 sections (10 microns in thickness each) were prepared and placed in two Costar Brand Microcentrifuge Tubes (Polypropylene, 1.7 mL tubes, clear; 3 sections in each tube), If the tumor constituted less than 30% of the total specimen area, the sample may have been crudely [0 dissected by the pathologist, using gross microdissection, putting the tumor tissue directly into the Costar tube. If more than one tumor block was obtained as part of the surgical procedure, the block most representative of the pathology was used for analysis. 15 Gene Expression Analysis mRNA was extracted and purified from fixed, paraffin-embedded tissue samples, and prepared for gene expression analysis as described in section 9 above. Molecular assays of quantitative gene expression were performed by RT-PCR, using the ABI PRISM 7900 Sequence Detection SystemTm (Perkin-Emer-Applied Biosystems, 10 Foster City, CA, USA). ABI PRISM 7900TM consists of a therocycler, laser, charge-coupled device (CCD), camera and computer. The system amplifies samples in a 384-well format on a thermocycler. During amplification, laser-induced fluorescent signal is collected in real-time through fiber optics cables for all 384 wells, and detected at the CCD. The system includes software for running the instrument and for analyzing the data. 25 Analysis and Results Tumor tissue was analyzed for 185 cancer-related genes and 7 reference genes. The threshold cycle (CT) values for each patient were normalized based on the median of the 7 reference genes for that particular patient. Clinical outcome data were available for all patients from a review of registry data and selected patient charts. 30 Outcomes were classified as: 0 died due to breast cancer or to unknown cause or alive with breast cancer recurrence; 23 I alive without breast cancer recurrence or died due to a cause other than breast cancer Analysis was performed by: 1. Analysis of the relationship between normalized gene expression and the 5 binary outcomes of 0 or 1. 2. Analysis of the relationship between normalized gene expression and the time to outcome (0 or I as defined above) where patients who were alive without breast cancer recurrence or who died due to a cause other than breast cancer were censored. This approach was used to evaluate the prognostic impact of individual genes and also sets of multiple 0 genes. Analwis of patients with invasive breast carcinoma by binary aproach In the first (binary) approach, analysis was performed on all 79 patients with invasive breast carcinoma. A t test was performed on the groups of patients classified as either no recurrence and no breast cancer related death at three years, versus recurrence, or breast .5 cancer-related death at three years, and the p-values for the differences between the groups for each gene were calculated. Table I lists the 47 genes for which the p-value for the differences between the groups was <0.10. The first column of mean expression values pertains to patients who neither had a metastatic recurrence of nor died from breast cancer. The second column of mean expression 0 values pertains to patients who either had a metastatic recurrence of or died from breast cancer. Table 1 Mean Moan t-value df p Vaid N Valid N BoI2 -0.15748 -1.22816 4.00034 75 0.000147 35 42 PR -2.67225 -5.49747 3.61540 75 0.000541 35 42 IGFIR -0.59390 -1.71506 3.49158 75 0.000808 35 42 BAG1 0.18844 -0.68509 3.42973 75 0.000985 35 42 CD68 -0.52275 0.10983 -3.41186 75 0.001043 35 42 EstRi -0.35581 -3.00699 3.32190 75 0.001384 35 42 CTSL -0.64894 -0.09204 -3.26781 75 0.001637 35 42 IGFBP2 -0.81181 -1.78398 3.24158 75 0.001774 35 42 GATA3 1.80525 0,57428 3.15608 75 0.002303 35 42 TP53BP2 -4.71118 -6.09289 3.02888 75 0.003365 35 42 EstR1 3.67801 1.64693 3.01073 75 0.003550 35 42 CEGPI -2.02566 -4.25537 2.85620 75 0.005544 35 42 SURV -3.67493 -2.96982 -2.70544 75 0.008439 35 42 p27 0.80789 0.28807 2.55401 75 0.012678 35 42 Chk1 -3.37981 -2.80389 -2A6979 75 0.015793 35 42 B03 -4.71789 -5,62957 2.46019 75 0.016189 35 42 24 ZNF217 1.10038 0.62730 2,42282 75 0.017814 35 42 EGFR -2.88172 -2.20556 -2.34774 75 0.021527 35 42 CD9 1.29955 0.91025 2.31439 75 0.023386 35 42 MYBL2 -3.77489 -3.02193 -2.29042 75 0.024809 35 42 HIFIA -0.44248 0.03740 -2.25950 75 0.026757 35 42 GRB7 -1.96063 -1.05007 -2.25801 75 0.026854 35 42 pS2 -1.00691 -3.13749 2.24070 75 0.028006 35 42 RIZI -7.62149 -8.38750 2.20226 75 0.030720 35 42 ErbB3 -6.89508 -7.44326 2.16127 75 0.033866 35 42 TOP2B 0.45122 0.12665 2.14616 75 0.035095 35 42 MDM2 1.09049 0.69001 2.10967 75 0.038223 35 42 PRAME -6.40074 -7.70424 2.08126 75 0.040823 35 42 GUS -1.51683 -1.89280 2.05200 75 0.043661 35 42 RAD51C -5.85618 -6.71334 2.04575 75 0.044288 35 42 AtB1 -3.08217 -2.28784 -2.00600 75 0.048462 35 42 STK15 -3.11307 -2.59454 -2.00321 75 0.048768 35 42 GAPDH -0.35829 -0.02292 -1.94326 75 0.055737 35 42 FHIT -3.00431 -3.67175 1.86927 75 0.065489 35 42 KRT19 2.52397 2.01694 1.85741 75 0.067179 35 42 TS -2.83607 -2.29048 -1.83712 75 0.070153 35 42 GSTM1 -3.69140 -4.38623 1.83397 75 0.070625 35 42 G- 0.31875 -0.15524 1.80823 75 0.074580 35 42 Catenin AKT2 0.78858 0A6703 1.79276 75 0.077043 35 42 CCNBI -4.26197 -3.51628 -1.78803 75 0.077810 35 42 P13KC2A -2.27401 -2.70265 1.76748 75 0.081215 35 42 FBXOS -4.72107 -4.24411 -1.75935 75 0.082596 35 42 DRS -5.80850 -6.55501 1.74345 75 0.085353 35 42 CIAPI -2.81825 -3.09921 1.72480 75 0.088683 35 42 MCM2 -2.87541 -2.50683 -1.72061 75 0.089445 35 42 CCNDI 1.30995 0.80905 1.68794 75 0.095578 35 42 EIF4E -5.37657 -6.47156 1.68169 75 0.096788 35 42 In the foregoing Table 1, negative t-values indicate higher expression, associated with worse outcomes, and, inversely, higher (positive) t-values indicate higher expression associated with better outcomes. Thus, for example, elevated expression of the CD68 gene (t 5 value = -3.41, CT mean alive< CT mean deceased) indicates a reduced likelihood of disease free survival. Similarly, elevated expression of the BCl2 gene (t-value = 4.00; CT mean alive> CT mean deceased) indicates an increased likelihood of disease free survival. Based on the data set forth in Table 1, the expression of any of the following genes in breast cancer above a defined expression threshold indicates a reduced likelihood of survival 10 without cancer recurrence following surgery: Grb7, CD68, CTSL, Chkl, Her2, STKl5, AIB 1, SURV, EGFR, MYBL2, HIFla. Based on the data set forth in Table 1, the expression of any of the following genes in breast cancer above a defined expression threshold indicates a better prognosis for survival 25 without cancer recurrence following surgery; TP53BP2, PR, Bc62, KRT14, EstR1, IGFBP2, BAG1, CEGPI, KLK10, p Catenin, GSTMI, FIT, Rizi, IGFI, BBC3, IGFRi, TBP, p27, IRSI, IGF1R, GATA3, CBGPI, ZNF217, CD9, pS2, ErbB3, TOP2B, MDM2, RAD51, and KRT19. 5 Anawis of ER positive patients by binarv apprawg& 57 patients with normalized CT for estrogen receptor (ER) >0 (i.e., ER positive patients) were subjected to separate analysis, A t test was performed on the two groups of patients classified as either no recurrence and no breast cancer related death at three years, or recurrence or breast cancer-related death at three years, and the p-values for the differences 0 between the groups for each gene were calculated. Table 2, below, lists the genes where the p-value for the differences between the groups was <0.105. The first column of mean expression values pertains to patients who neither had a metastatic recurrence nor died from breast cancer. The second column of mean expression values pertains to patients who either had a metastatic recurrence of or died from breast cancer. 5 Table2 Mean Mean t-value df p Valld N Valid N IGF R -0.13975 -1.00435 3.65063 56 0.000584 30 27 Bc12 0.15345 -0.70480 3.55488 55 0.000786 30 27 CD68 -0.54779 0.19427 -3.41818 55 0.001193 30 27 HNF3A 0.39617 -0.63802 3.20750 55 0.002233 30 27 CTSL -0.66726 0.00354 -3.20692 55 0.002237 30 27 TP53BP2 -4.81858 -6.44425 3.13698 55 0.002741 30 27 GATA3 2.33386 1.40803 3.02958 55 0.003727 30 27 BBC3 -4.54979 -5.72333 2.91943 55 0.005074 30 27 RAD51C -5.63363 -6.94841 2.85475 55 0.006063 30 27 BAGI 0.31087 -0.50669 2.61524 56 0.011485 30 27 IGFBP2 -0.49300 -1.30983 2.59121 55 0.012222 30 27 FBXO -4.86333 -4.05564 -2.56325 55 0.013135 30 27 EstR1 0.68368 -0.66555 2.56090 55 0.013214 30 27 PR -1.89094 -3.86602 2.52803 55 0.014372 30 27 SURV -3.87857 -3.10970 -2.49622 55 0.015579 30 27 CD9 1.41691 0.91725 2,43043 55 0.018370 30 27 RB1 -2.51662 -2.97419 2.41221 55 0.019219 30 27 EPHX1 -3.91703 -5.85097 2.29491 55 0.025578 30 27 CEGPI -1.18600 -2.95139 2.26608 55 0.027403 30 27 CCNB1 -4.44522 -3.35763 -2.25148 55 0.028370 30 27 TRAIL 0.34893 -0.56574 2.20372 55 0.031749 30 27 EstR1 4.60346 3.60340 2.20223 55 0.031860 30 27 DRS -5.71827 -6.79088 2.14540 55 0.036345 30 27 MCM2 -2.96800 -2.48458 -2.10518 55 0.039857 30 27 Chk1 -3.46968 -2.85708 -2.08597 55 0.041633 30 27 p27 0.94714 0.49666 2.04313 55 0.045843 30 27 MYBL2 -3,97810 -3.14837 -2.02921 55 0.047288 30 27 GUS -1.42486 -1.82900 1.99758 55 0.050718 30 27 26 P53 -1.08810 -1.47193 1.92087 55 0.059938 30 27 HIFIA -0.40925 0.11688 -1.91278 55 0.060989 30 27 cMet -6.36835 -5.58479 -1.88318 55 0.054969 30 27 EGFR -2.95785 -2.28105 -1.86840 55 0.067036 30 27 MTA1 -7.55365 -8.13656 1.81479 55 0.075011 30 27 RIZ1 -7.52785 -8.25903 1.79518 55 0.078119 30 27 ErbB3 -6.62488 -7.10826 1.79255 55 0.078545 30 27 TOP2B 0.54974 0.27531 1.74888 55 0.085891 30 27 EIF4E -5.06603 -6.31426 1.68030 55 0.098571 30 27 TS -2.95042 -2,36167 -1.67324 55 0.099959 30 27 STK15 -3,25010 -2.72118 -1.64822 55 0.105010 30 27 For each gene, a classification algorithm was utilized to identify the best threshold value (CT) for using each gene alone in predicting clinical outcome. Based on the data set forth in Table 2, expression of the following genes in ER 5 positive cancer above a defined expression level is indicative of a reduced likelihood of survival without cancer recurrence following surgery: CD68; CTSL; FBXO5; SURV; CCNBI; MCM2; Chk1; MYBL2; HJF1A; cMET; EGFR; TS; STK15. Many of these genes (CD68, CTSL, SURV, CCNBI, MCM2, Chkl, MYBL2, EGFR, and STK15) were also identified as indicators of poor prognosis in the previous analysis, not limited to ER-positive .0 breast cancer. Based on the data set forth in Table 2, expression of the following genes in ER-positive cancer above a defined expression level is indicative of a better prognosis for survival without cancer recurrence following surgery: IGFR1; BC12; HNF3A; TP53BP2; GATA3; BBC3; RAD51C; BAG1; iGFBP2; PR; CD9; RB1; EPHXl; CEGP1; TRAIL; DRS; p27; p53; MTA; RIZ1; ErbB3; TOP2B; E1F4E. Of the latter genes, IGFRI; BCI2; TP53BP2; L5 GATA3; BBC3; RAD5lC; BAG1; IGFBP2; PR; CD9; CEGPl; DRS; p27; RIZ1; BrbB3; TOP2B; EIF4E have also been identified as indicators of good prognosis in the previous analysis, not limited to ER-positive breast cancer. Analisi of ER negative patients by binary aproach Twenty patients with normalized CT for estrogen receptor (ER) <1.6 (i.e., ER negative 20 patients) were subjected to separate analysis. A t test was performed on the two groups of patients classified as either no recurrence and no breast cancer related death at three years, or recurrence or breast cancer-related death at three years, and the p-values for the differences between the groups for each gene were calculated. Table 3 lists the genes where the p-value for the differences between the groups was <0.118. The first column of mean expression 25 values pertains to patients who neither had a metastatic recurrence nor died from breast 27 cancer. The second column of mean expression values pertains to patients who either had a metastatic recurrence of or died from breast cancer. Table 3 Mean Mean t-value df p Valid N Valid N KRT14 -1.95323 -6.69231 4.03303 18 0.000780 5 15 KLKIO -2.68043 -7.11288 3.10321 18 0.006136 5 15 CCNDI -1.02285 0.03732 -2.77992 18 0.012357 5 15 Upa -0.91272 -0.04773 -2.49460 18 0.022560 5 15 HNF3A -6.04780 -2.36469 -2.43148 18 0.025707 5 15 Maspln -3.56145 -6.18678 2.40169 18 0.027332 5 15 CDH1 -3.54450 -2.34984 -2.38755 18 0.028136 5 15 HER2 -1.48973 1.53108 -2,35826 18 0.029873 5 15 GRB7 -2.55289 0.00036 -2.32890 18 0.031714 5 15 AKTI -0.36849 0.46222 -2.29737 18 0.033807 5 15 TGFA -4.03137 -5.67225 2.28546 18 0.034632 5 15 FRP1 1.45776 -1.39459 2.27884 18 0.035097 5 15 STMY3 -1.59610 -0.26305 -2.23191 18 0.038570 5 15 Contig -4.27585 -7.34338 2.18700 18 0.042187 5 15 27882 A-Catentn -1.19790 -0.39085 -2.15624 18 0.044840 5 15 VOR -4.37823 -2.37167 -2.15620 18 0.044844 5 15 GRO1 -3.65034 -5.97002 2.12286 18 0.047893 5 15 MCM3 -3.86041 -5.55078 2.10030 18 0.050061 5 15 B-actin 4.69672 5.19190 -2.04951 18 0.055273 5 15 HIFIA -0.64183 -0.10566 -2.02301 18 0.058183 5 15 MMP9 -8.90613 -7.35163 -1.88747 18 0.075329 5 15 VEGF 0.37904 1,10778 -1.87451 18 0.077183 5 15 PRAME -4.95855 -7.41973 1.86668 18 0.078322 5 15 AIB1 -3.12245 -1.92934 -1.86324 18 0.078829 5 15 KRT5 -1.32418 -3.62027 1.85919 18 0.079428 5 15 KRT1 8 1.08383 2.25369 -1.83831 18 0.082577 5 15 KRT17 -0.69073 -3.56536 1.78449 18 0.091209 5 15 P14ARF -1.87104 -3.36534 1.63923 18 0,118525 5 15 5 Based on the data set forth in Table 3, expression of the following genes in ER negative cancer above a'defined expression level is indicative of a reduced likelihood of survival without cancer recurrence (p<0.05): CCND1; UPA; HNF3A; CDH1; Her2; GRB7; AKT1; STMY3; a-Catenin; VDR; GRO1. Only 2 of these genes (Her2 and Grb7) were also 10 identified as indicators of poor prognosis in the previous analysis, not limited to ER-negative breast cancer. Based on the data set forth in Table 3, expression of the following genes in ER-negative cancer above a defined expression level is indicative of a better prognosis for survival without cancer recurrence (KT14; KLK10; Maspin, TGFa, and FRP1. Of the latter genes, only KLK10 has been identified as an indicator of good prognosis in the previous 15 analysis, not limited to ER-negative breast cancer. 28 Analysis of multi le geead indicators of outcome Two approaches were taken in order to determine whether using multiple genes would provide better discrimination between outcomes. First, a discrimination analysis was performed using a forward stepwise approach. 5 Models were generated that classified outcome with greater discrimination than was obtained with any single gene alone. According to a second approach (time-to-event approach), for each gene a Cox Proportional Hazards model (see, e.g. Cox, D. R., and Oakes, D. (1984), Analysis of Survival Data, Chapman and Hall, London, New York) was defined with time to recurrence or death LO as the dependent variable, and the expression level of the gene as the independent variable. The genes that have a p-value < 0.10 in the Cox model were identified, For each gene, the Cox model provides the relative risk (RR) of recurrence or death for a unit change in the expression of the gene. One can choose to partition the patients into subgroups at any threshold value of the measured expression (on the CT scale), where all patients with [5 expression values above the threshold have higher risk, and all patients with expression values below the threshold have lower risk, or vice versa, depending on whether the gene is an indicator of bad (RR>1.01) or good (RR<1.01) prognosis. Thus, any threshold value will define subgroups of patients with respectively increased or decreased risk, The results are summarized in Table 4. The third column, with the heading: exp(coef), shows RR values. 20 29 Table 4 Gene coef exp(coef) se(coef) z p TP53BP2 -0.21892 0.803386 0.068279 -3.20625 0.00134 GRB7 0.235697 1.265791 0.073541 3.204992 0.00135 PR -0.10258 0.90251 0.035864 -2.86018 0.00423 CD68 0.465623 1.593006 0.167785 2.775115 0.00552 BcI2 -0.26769 0.765148 0.100785 -2.65603 0.00791 KRT14 -0.11892 0.887877 0.046938 -2.53359 0.0113 PRAME -0.13707 0.871912 0.054904 -2.49649 0.0125 CTSL 0.431499 1.539564 0.185237 2.329444 0.0198 EstR1 -0.07686 0.926018 0.034848 -2.20561 0.0274 ChkI 0.284466 1.329053 0.130823 2.174441 0.0297 IGFBP2 -0.2152 0.806376 0.099324 -2.16669 0.0303 HER2 0.155303 1.168011 0.072633 2.13818 0.0325 BAG1 -0.22695 0.796959 0.106377 -2.13346 0.0329 CEGPI -0.07879 0.924236 0.036959 -2.13177 0.033 STKI5 0.27947 1,322428 0.132762 2.105039 0,0353 KLK10 -0.11028 0.895588 0.05245 -2.10248 0.0355 B.Catenin -0.16536 0.847586 0.084796 -1.95013 0.0512 EstR1 -0.0803 0.922842 0.042212 -1.90226 0.0571 GSTM1 -0.13209 0.876266 0.072211 -1.82915 0.0674 TOP2A -0.11148 0.894512 0.061855 -1,80222 0.0715 A1I1 0.152968 1.165288 0.086332 1.771861 0.0764 FHIT -0.15572 0.855802 0.088205 -1.7654 0.0775 RIZ -0.17467 0.839736 0,099464 -1.75609 0.0791 SURV 0.185784 1,204162 0.106625 1.742399 0.0814 IGF1 -0.10499 0.900338 0.060482 -1.73581 0.0826 BBC3 -0.1344 0.874243 0.077613 -1.73163 0.0833 IGF1R -0.13484 0.873858 0.077889 -1.73115 0.0834 DIABLO 0.284336 1.32888 0.166556 1.707148 0.0878 TBP -0.34404 0.7089 0.20564 -1.67303 0.0943 p 27 -0.26002 0.771033 0.1564 -1.66256 0.0964 IRS1 -0.07585. 0.926957 0.046096 -1.64542 0.0999 The binary and time-to-event analyses, with few exceptions, identified the same genes 5 as prognostic markers*. For example, comparison of Tables I and 4 shows that 10 genes were represented in the top 15 genes in both lists. Furthermore, when both analyses identified the same gene at [p<0.10], which happened for 21 genes, they were always concordant with respect to the direction (positive or negative sign) of the correlation with survival/recurrence. Overall, these results strengthen the conclusion that the identified markers have significant 10 prognostic value. For Cox models comprising more than two genes (multivariate models), stepwise entry of each individual gene into the model is performed, where the first gene entered is pre selected from among those genes having significant univariate p-values, and the gene selected 30 for entry into the model at each subsequent step is the gene that best improves the fit of the model to the data. This analysis can be performed with any total number of genes. In the analysis the results of which are shown below, stepwise entry was performed for up to 10 genes. 5 Multivariate analysis is performed using the following equation; RR=exp[coef(geneA) x Ct(geneA) + coef(geneB) x Ct(geneB) + coef(geneC) x Ct(geneC) +............]. In this equation, coefficients for genes that are predictors of beneficial outcome are positive numbers and coefficients for genes that are predictors of unfavorable outcome are [0 negative numbers. The "Ct' values in the equation are ACts, i.e. reflect the difference between the average normalized Ct value for a population and the normalized Ct measured for the patient in question. The convention used in the present analysis has been that ACts below and above the population average have positive signs and negative signs, respectively (reflecting greater or lesser mRNA abundance). The relative risk (RR) calculated by solving 15 this equation will indicate if the patient has an enhanced or reduced chance of long-term survival without cancer recurrence. Multivariategane analmis of 79 vtents with invaive brast cariafl A multivariate stepwise analysis, using the Cox Proportional Hazards Model, was performed on the gene expression data obtained for all 79 patients with invasive breast 20 carcinoma. The following ten-gene sets have been identified by this analysis as having particularly strong predictive value of patient survival: (a) TP53BP2, Bcl2, BAD, EPHX1, PDGFRp, DIABLO, XIAP, YB1, CA9, and KRT8. (b) GRB7, CD68, TQP2A, Bc12, DIABLO, CD3, ID1, PPMlD, MCM6, and WISP1. (c) PR, TP53BP2, FRAME, DIABLO, CTSL, IGFBP2, TIMP1, CA9, MMP9, and COX2. 25 (d) CD68, GRB7, TOP2A, Bcl2, DIABLO, CD3, ID1, PPM1D, MCM6, and WISPl. (e) Bcl2, TP53BP2, BAD, EPHX1, PDGFRp, DIABLO, XIAP, YBl, CA9, and KRT8. (f) KRT14, KRTS, PRAME, TP53BP2, GUSI, A2B1, MCM3, CCNB1, MCM6, and ID1. (g) PRAMB, TP53BP2, EstR1, DIABLO, CTSL, PPM1D, GRB7, DAPK1, BBC3, and VEGFB. 30 (h) CTSL2, GRB7, TOP2A, CCNB1, Bcl2, DIABLO, FRAME, EMS1, CA9, and EpCAM. 31 (i) EstR1, TP53BP2, PRAME, DIABLO, CTSL, PPMLD, GRB7, DAPK1, BC3, and VEGFB. (k) Chk1, PRAME, p53BP2, GRB7, CA9, CTSL, CCNB1, TOP2A, tumor size, and IGFBP2. 5 (1) IGFBP2, GRB7, PRAMB, DIABLO, CTSL, p-Catenin, PPMID, Chkl, WISP1, and LOT1. (n) HER2, TP53BP2, Bc12, DIABLO, TIMPi, EPHXI, TOP2A, TRAIL, CA9, and AREG. (n) BAG1, TPS3BP2, PRAMB, IL6, CCNB1, PAQl, AREG, tumor size, CA9, and Ki67. 10 (o) CEGP1, TP53BP2, PRAMB, DIABLO, Be12, COX2, CCNB1, STK15, and AKT2, and FGFI8. (p) STK15, TP53BP2, PRAME, IL6, CCNE, AKT2, DIABLO, eMet, CCNE2, and COX2. (q) KLKIO, EstR1, TP53BP2, PRAME, DIABLO, CTSL, PPMID, GRB7, DAPK1, and 15 BBC3. (r) AIB1, TP53BP2, Bol2, DIABLO, TIMPI, CD3, p53, CA9, GRB7, and EPHX1 (s) BBC3, GRB7, CD68, PRAMB, TOP2A, CCNB1, EPHXI, CTSL GSTM1, and APC. (t) CD9, GRB7, CD68, TOP2A, Bcl2, CCNB1, CD3, DIABLO, ID1, and PPM1D. 20 (w) BGFR, KRT14, GRB7, TOP2A, CCNB1, CTSL, Bcl2, TP, KLK10, and CA9. (x) HIlt, PR, DIABLO, PRAME, Chkl, AKT2, GRB7, CCNE1, TOP2A, and CCNB 1. (y) MDM2, TP53BP2, DIABLO, Bc2, AI 1, TIMP 1, CD3, p53, CA9, and HER2. (z) MYBL2, TP53BP2, PRAME, IL6, Bcl2, DIABLO, CCNEI, F.PHXI, TIMP1, and CA9. 25 (aa) p27, TP53BP2, PRAMB, DIABLO, Bol2, COX2, CCNE1, STK15, AKT2, and ID. (ab) RAD51, GRB7, CD68, TOP2A, CIAP2, CCNBI, BAG1, IL6, FGFR1, and TP53BP2. (ac) SURV, GRB7, TOP2A, PRAME, CTSL, GSTM1, CCNB1, VDR, CA9, and CCNE2. (ad) TOP2B, TP53BP2, DIABLO, Bcl2, TIMP1, AIB1, CA9, p53, KRT8, and BAD, (ae) ZNF217, GRB7, p53BP2, PRAMB, DIABLO, Bcl2, COX2, CCNE1, APC4, and D 30 Catenin. 32 While the present invention has been described with reference to what are considered to be the specific embodiments, it is to be understood that the invention is not limited to such embodiments. To the contrary, the invention is intended to cover various modifications and equivalents included within the spirit and scope of the appended claims. For example, while 5 the disclosure focuses on the identification of various breast cancer associated genes and gene sets, and on the personalized prognosis of breast cancer, similar genes, gene sets and methods concerning other types of cancer are specifically within the scope herein. All references cited throughout the disclosure are hereby expressly incorporated by reference. [0 33 Gene ArCcsflof Seq AMl NMSOSS34 GCGGCGAGnCCATAAGTGAGGTGCGAGGAMTAGGCGGGGGAGGATCMMATAC1TGCTGATGGrGACTA AM~ NhLOQSi63 CG3GTTCThTG3CGCGAGATTGTGTGAG3aGCACTACCTGOACTOGGAGAAGMGTGGTGTrACCGGGA APC NmoiLoGoSB G3AGAGCAC3GMTGTarrCTGCATACAGGTCAOGGGG3(AGCCMTGGflCAGMAGMATCGAGTGT AREG NKt001657 TGTrGAGTGMPTGOCTTCTAGTASTrGMCCGTCCTCGGGAGCCGACTATGACTACTAGMAGAGTATATMACGMCCACM 8-stcln NILOGI 101 CAGOAGATGIGGATCAGCMGCAGOAGTATGACG3AGTOOGGCCCCTCCATCGTCAGGGOMAATGC 9-CoLenin NM..0015D4 GGCTCTTGTGCGTACTGTC~rnCGGGTGGTGACAGGOGAGO.ATCACGGCCTGCCATTGTGCTCTTCGCATCTA BAD NIL032989 GG.GTCAGGTGCCTCGAGATCGGGCTrGGGGCCAGAGCATG'rTCCAGATC.CCAG3AGTTGAGCCGAGTOAGAG GAGl 1NM.004323 CGGrrGTCAGCACTOOMTACMGATG3t-TGCCaGOTCATGflMTrTGOAmmAAMAGTCCAOAGGPGAGGTflGMC e 803 NMtL014417 CCTGGAOGGOTCcTGTACMTC~cTCATGG.AC~eTCCGlTrAcCAGGGGCGACAGAGCCGCCGAOATGGAGCCCMflAO 8c12 NNLGCOS3 OAGATGGACCTAGACCATAGATTT0ACGCGMGACACATGGGAAAGCCrflATCATAGG CA9 froL00216 ATCCTAGCCC.TGOTMrTOGCCTCCl-rrTGCTGTCACCAGCGTCGCGTTCOnTOO43AGATGAGMAGGCAG CCN 51 N14031958 rCAGonGGCAGACCATOTACATATGTCCCAAGAtGnC'rATGCADOMTMTrGTG7GCCCMAG~AnT CCND NNLOO17SS GCATOTnCGTGGCCTCTMAGATGMGGAGACCA700000TiACGOCGAMAGCTTCATTACACCG OCHEI NM.0012fl AAAGMGATG;ATGACCGGGrrrACCOAMCTCACGTGCAAGCOTCGGATTrGCACCATCAGAG~aCTC. CCNE2 NMS57749 ATGCTGTG ~CTrCCTiCCMTGGGGTrrC~rACATGTAGGrrIGTrGOTMATMCCI IrIIrITATATCACMITTGGGT C03z NM000734 AGATOAOTOGMGGCGC1rTCACCGCGGCCATCCTGCAGGCACAOTGCOATACAQASGCA COBB NM_.001251 nrG1TCCCAGCCTGTGTCCACCTCMGCCCAoATTCAGATICGAGTCATGTACACMACCCAGGGTGGAG3GAG' Cos NMSC017BD QGGGTGGMCGAGTrTAT0TCAOAATCTGCGCCMGAAGGAkCGTACTCGAAACW70CACCGTG CDtlI NIWLOC4SSO TGAGTGTCCCCGGTATCnrCCCCCCTGCCAATccCATGAATTG0GAAMATrnATGAAAATCTGAMGCOGCTh CEOPi NkL020974 TGACMTCAGCACACCTGCATCACCGTCGGMAGAGGGCCTGAGCTGCyrAATMGATCACGGCTGTOTCA: 01*1 NM.0l 274 GAYAAT'TGGTACAAGGATCAGCT~rCCAGCCACATTCCTOATCATTCTTGTACAGTTACM~ACC ClAP 1 N4P301166 TGCCTG.TGOTGOGCCTCAGTAACGGAACCAAAGGATGATGCTATGTCAGAACACCGGAGGCATflTC CIAP2 - htO0l 165 GGA7ArrCCGTGGCTCfAflcAACrTCTCCA1CMTCCTGTMCTCCAGACA7CMGArmTCTrfGATGAAG emit 14MS00245 GACArrCOAGTCCTGCATcMTGCCTCTOT(CC(CAOOcTTCAGTGTGGGGTGOACGA wGTTGATCOAG Conlgg 278 AKOCO5iB . GCATCCTGGCCAAAGrCCA-cCAGGCTAGAGGCCCTGCT7CCCMCTACCAGCTGAGOI0GGTC coxa NILC009e3 T0TGCAGAGTTGGMGOACGTCTATGGTGACATCGATGC.TGTGGAGCTGTATCCTGCCMfCTGTAGAMGCCTOGGO CTSL NWL001S12 GGGAGGCTnATCTCAOTGzAGTGAGCAGMATCMGTAGACIG3CTCTGGGCCTCMAGGCMATOMGGCCTG 07512 *NM_001333- TGTCTCACTSAGCGAGCAGMATCTGOTGGACTOCGTGCCOMGGCMT-CAGGGCTGCMATGGT OAPK1 NM_004831 CGCTGAOCATGAAMTOTGTCACCGGCTGAoGGAGmGATATACMACACAtGnGTGw(3GA DIABLO NNLOISBST CACMTGGCGGCTCTrGMGAGT1'GGCTGTOGCGCAGCGTM~rTCArTCTCAGGTAOAAAGTGmTGT DRS NNL00o3842 CTOTGAGACAGGCnTCGATGATnTOAGArnGGTGCCTTGATCTGGAGCCGTATGAGGfGGOCTrTGG BGFR N14005228 TG7C0ATG04ACTTCAGMCACTOGAGCTGCATGTGATCCMGOTGTOOCAT EIR4E Nm001968 GATCTAAGATGGGACTGTCGMCGCGO&ACOACCCTATCCTMTCCCCOATAAGMGAGGAtt&ACGGAT CTM EMS1 NMOOS231 GOGAGTGTCACTGAGTCCnTGAMT0rCTCC.CCTGCCCOGOGGGTCTCTGGAfGGACCOMAUTGCA EpCAM NMOOn$ 4 -GGGCCTCCAGMACMTGATGGOATGATCCTGATGCS3A1AGAGCGGCTCnrAGGCMGCATOA EPNXI NIL000120 ACCGTAGGCTTGCTCTOGAO CTOO7cGTGGTGCTGCTATTA1TAOJGAGTMACCGArCCA * Erb63 Nhtfl0182 COGJTOTCAT1GCCAG3ATAOACAGOTCAGGSTACTCCTOCTCOGGMGCACC~m~rnOAGTGGGTCTOAGnCO e oiRi1 NPkp00125 CGTOOTGCCCCTCTATGAOOTGOTrGCTGGAGATGCTGGACGCGCACCGCCTACATGOCCCACTAGCC P52(05 NM012177 SGT=TArTYAAATGCMrACTAGAGTGOCTG~~mrcG AATTCAC FUPI a N)L00362 CGGTAG3T0MGTCCGGATCMGGGCMAGGAGACGGAMTCCTG7CATGMCGMGGMGC FUFRI NMSZZ3109 OACGGGACATCACCAATCACACTATAAAGAAACCACGGCCOGCCGGTOGAG3GCACCC P1117 NMj02012 CCAGrGGA0CGCTVCCATACTGCGTCTGA7GMAGTGCCGATflCAGOACCCAGA3AG ,FRP 1 NMSC3OI2 T-iGAC-TGTACTAG~TCCGG'AATCArAAOOA~=~fGTT 0-Catonin NNLO02n3O TCAGCArCGAG0OAAT0A0GAGGATGAGC0TGCO0GCGCCATAAGCmMAGMMOOCACC GAPON Nt0O2C45 AI-TCOAOOATGGCAAA1-CAGGCACGTOMGCTGAOGOAAGCrGTATCMTOOWAATCCOATC GATA3 NMS002051 CAAAGO(AGCTATTGMTGTGTGTMnCMCACTMTCGGCOCCATCTGTGMTMAGOOAflCTACT ORBI NMSOSI 0 COATOTUOCATC TTG1TFGGCTCCCCACCC1IC-GAGGCCTCAGATATACCCTOGTGGCC I GROI NhtjDl5t CDAAAGAGCTGMCAGTGACMTCCPACTGAOCAGMGGOGAGGAGGM0ACTOACTGGTGGCTOTGQGA GSTMI NM..000661 AACAUGAAGA-AAOTGGAGrCGATTAAAGCGGCGTAATCGTGC GUS NMSCOIS1 CCCAOTCATAOCMTCACAAGTIGGMM~AGCCCOTrAC1tAG3CMGAOTGTAC 2 &CTGCOTG NER2 11M320441I CGGTG YGAOA&OGTGCAGCMGCOGTmTGCCC;GAdOGTGCTATGGTCTGGGOATGAGOACUGCG~tAGG HIFIA N1k001520 TGMCATWAGTCTGCMACATGGMAGGTATOACTGcACAGGcAC:An~CAcGTATATATACCAMOAACCTCA IINP3A NM_004495 TCOAGGATGrTAGGAAOTGMAGATGGAAUOGCATGMAACCACOAOGACAGCTACTACGCAII3ACGOr oiD NMt002165 AOMCC GTOAG GCGTGGATCAGACATCACAGATOAUATTClTGflA LOPI N1M,000613 TCCGGAGCTGTGATTMAGAGGCTGAGAThrTTGCGCACCOTMCT*GCCMGTCAGOCTCTGOTCG [DPI A NM_0OOBTS GCATGGTAGICCGMGATTCAAGTCAAATCGG0AGATGGATACCOAATATOTAGAGACrTAflACCGGW.M IGFAPZ NhLOCO97 GTGGACACACATGMCAT0UGGCGGG0AGCAGTGCTGOCGGCCCTCGYGOO3TAThMGG lie Nyp00800 OCTG~Crr~cmGATGGcTG~mMGATGGATGCfCGAAMTGAflMGAGAOACfGCCflGT IRs 1 NIL006544 CCACAGCTCACCU0GTCGGTGT0ATCCCAGCTOCCAGCT~CCCAOAGAGGMO3AGACTGOACTGG 1047 NMS002417 CGGATTGGTGGACrACGAGGGTGrACMGTCGCCGCGGGA7CGGGCAGTfGTAA KLKIO NMSOD2fl6GCCAA 7CTGCACTTtCC~A~~r-oAccc~ac~AT3rAAOc( KRT14 NMJJOCSZ$ 60gOTAArAOCAATCTo(MACrrAGCTAGAAGWTAA-CrA3OA KRTI? NILOOO4Zt CGAG"GOTnCTTCAGCAAGACAGAGGACTGAACCGAGGTGGOACCMAG=TGAOTGTGr.AGAGT KARTiS NMO000224 AGAGATCGAGGCTTOMGOAGGAGC0TGOTTTATMMGMCAZCACGMGAGGMGTAMtAA( 0 0 KRTIS NMtO2276 TGAGOGGCAGMATCAGGAGTACCAGGGTCATGACAT9$GCCGCGAGA COACCTCCGCA KRTS NIL000424 TrCAGTGG;AaMGGAGTTGAOATMACTCTCTTGTACAGCAGTornCTaATAT~GCA KRTS NM00D2273 (;AGACTCTACGTGGTGGCCCTGAGGTACAOGTACTCC(WOTTT LOTI vwli NMt1002856 GGA.GACCAOOTGMMGACACTCCAGACACGACCCCMOMTGGCTTTGGGT(TGTAGArGTGOGMAGTAO Meupin NILOOIGSP CAGATGGCCAflMGAG.AAATrfAGCTGACMCAGTGACGACCAG-AOCAAATC~flGTGGflMTFGCGG MOM2 NNLOO402G 0AC~rnGCCCTACCTrTCATTCCGGCGTGACMOMAT6AGCTGTTGOOTOflATACTMGC~ATGGOI MOM3 NM_00238 GS3ACMTCCCTAGiACALWTATG0COTr CTGTGTACMGG(ATCAOCAGACCATCAOOATCCAGGAGAT MOMS NI&008915 7GATOGOTATTGTACAOfCATCACAG ~rnCATACC MOACAGOOnCAGCA C~rG GGn1COTCCA MOMZ NM_=O2 CTACAGOWGCCC1AGTCCGGATCGATGCTGTATrMOTCArGTATGGlTGfIT lIMPS NMS00499 4 GA0AACCAATOTC.ACCGAAOGAGCT0GAAGGATAGCTTACCG0TAGGffAAGTcOOOG-TG MTAI 1M004N1% CCCCTCACGTGAAGAGAOGCGCTCCrrCGGOGAACTOGGGAG~AGAGGAMGCGCGCTAA0CnAflGC MYBLI NMI0024B5 GCOGT~.AaTTGCror~-QCATOOGAMCCrGOCAC-CM PI 4ARF S75535 CCOTcGTrGTGATGrT(ATGGAGAGCGTC1GGACAGOeCG~CaAGMO(ACCGl~rTGATG p27 NPL004064 OGGTGGACCACOMAGAOTMCCCGGGAOTTGGAGMGCACTGCAGASACATGGOCAGGCGAGC P43 N14j00546 GrMGCCrrGCrGCMTASGTGGTCAGMG3A~ CAGOCCAGOflCGTCCGG PAIl NM40OGS02 OCGCAAOGTGGrrrACCTAGGGTGGCCTOGTT-GGCCATGCTCCAGCTGACAAAGAGGAGMCCACA PDOF~b NM002609 OCAGT-CTCOTnCCAGCTAr.AG~rAAATGTCCGTOCG3A0TGCTGGAGCTMAGT3OAACCC - T P13KCZ.A NM_002645 ATACCMTCACGCAMACCAGCTArflTTMTCAGTCACAGCGCAiAJCATATGCGMMTAAA-GCTAaGm pPMID "M_003620 GCCATCCGCAAACnTOrrTCGCTTTCACCnOCAIGTOGGAAACTGGCGGMTGGOOC PR NhLOQOS02G GCATCAGGCTGTCATATGTGTCCTTACCGTGGAGCTGTGGTO17QTArM0/LGGCMTGGMG0GCAGCACAACTACT PRAMS NH1005 1 TOTCOATA7CTOCTnCAGA0TCTOCTGCAGCACOTCATCGGGCTGAGCMT0TL3ACCCACPTGC p 5 2 NM,003225 GCCCTCCCA0TGTOCAAMTMGGG0TGCTG lIIICGAGCACTTGGTGGGGTcOCOTG;i-GTTCTA7~TMTAOArCG3ACG, RADS IC NM_058218 GA~rnT~nGACAOG0AGCATACCCArGGG~nCATPATCACCTCTGflAGACTAGAGATATCfl=GGGGA~ RBI N1L00321 OGAGCCCTACMGTITCCTATCAOCTACG3ATGCTGA(G0MATTATA~rTACCCCGMO~TCC RIZI NkLOl 223i CCAGACGAGCOGATAGMGCGSGGAGCGTGAGGTGTGATGGGGMAGAGGAGAGGAGAGGAGOA SY _ NOSco36 CATMnCAGOAG0ACTOTrCTTGGCACTGGAOTCCTGCCCCCCTGTGAfGMaGGTC STMY3 NIKfiOSB4C CCTSGAGGCTGCMCATACCTCAATCTG1rOASGCGSrATCCTCTGMGCCCTn7rCGCAGCATGTATCCCA(CCAnGTA Table n2 SURV -NK00I1165 rar TeATTCCoaGGCnTACCAGQ;TOGT QAMAGTSo.e~A(o~ TCCC.rcTAOAGcTGACAGcTrT rep NMSQZ1 94 GCOAAUCMA~kCCA~GTGrGGTAC~G(CAAGGGCC TG3FA NP&,003236 OGGOCCGC'rCATGCT-MrAMGA3CMTIGCtAACCGCAACCG iMP I NMS0324 TCCGGT~AAACTMCT3CCAyGACVACTCCOOCCCGTCA roP2A NMSOIOS7 TCCA GAAGGTATCAAGAT7GCOGTTOTCCGOAACOA roPze NNISOIQO TGTGOACATOTTCCCTAGATCCOCTCTAGCCACCnTThTCCACGQCGGTCGOGCTAG tP NM001953 CTATAGCAGCAGAGAtTOACAGACCGTGGACAOCr.GCTCATCACACCTCCACCGAQAmACrOOT TPS3Ben NNL0OS420 G~-CATrCGG~rAACGGACCAACGCTGGCACOGCOTAACAC ~rAJL NM_0381 CflCACAGTGCTCCTGCAGTOOTCTOI-TGTGGCTGMCACTGTOACMA-CCGACTGMGCAGATO r NM..oo1o71 GCOcTcoGGccfTCIA~CATcGCCAGCTACGCCTGCTCACGTACATGiAnOCOACATOACG 191 NMJ0265 GTGG3ATGTGCCCTGMGGACMAGGCAGSCGTCACACGAGAGTC:TCACACUCTflACCCTGATCCGCAG /OR NMSWO37O GCOCTGGArrTAGAAAACCMGTaTGGATCTGGGACCCm-CCn-CCnGCCCTGGCnGTM-J ISP HMjOz3?8 CTCGCTOTCTGACGMITCOTCTOCAGrOG1GCCGCG !IGFB NM377 TOCAGCTGOOOOrATG=~CGCGAG~ATCCTACGTC qISP NMOD3552 AGGCTCTAC-CCCTCGCGAMAAGTOACACMTGrTGGT( Ulp NMLO1167 SCCrGAAAArAOACCAATCG~fACCGTTrT~GAAAT~.CC T-I eNKOO4SSS AS3ACTOTGGArin-TA'm1-GnAAGOAAAA)GoGTGGAGC JTSATGWAAITGGTG;GTOnCC .NFI 7 NM_006526 ACCCAGTAGGAOMOOCATACTGCCOArGCGGCWOmCAGOTACCCCACTO Gene Accesslon Probe Name Seq Len AI1 NM 006534 819941AIB113 GCGGCGAG7TCCGATTTA 19 A1B1 ~NM_006534 81995/AIB1.r3 TGAGTCCACCATCCAGOCAAGT 21 A11 NM 006534 S5055/AIBI.p3 ATGGCGGCGGGAGGATCAAAA 21 AKTI NMP05163 S0010/AKT1,f3 CGCTTCTATGGCGCTGAGAT 20 AKT1 NM_005163 S0012/AKTI,r3 TCCCGGTACACCACGTTCTT 20 AKTI NM 005163 S4776/AKTI.p3 CAGCCCTGGACTACCTGCACTCG 24 AKT2 NM.001626 S0828/AKT2.f3 TCCTGCCACCCITCAAACC 19 AKT2 NM_001626 90829,AKT2.r3 GGCGGTAAATT.CATCATCGAA 21 AKT2 NM_001626 64727/AKT2.p3 CAGGTCACGTCCGAGGTCGACACA 24 APC NM_000038 80022/APC.f4 GGACAGCAGGAATGTGTTTC ' 20 APC NM_000038 S0024/APC.r4 ACCCACTCGATTTGTCTG 20 APC NM_000036 84888/APC.p4 CATTGGCTCCCCGTGACCTGTA 22 AREG NM_001657 S0025/AREGS2 TGTGAGTGAAATGCCTTCTAGTAGTGA . 27 AREG NM_001657 80027/AREG.r2 TTGTGGTTCGTTATCATACTCTTCTGA 27 AREG NM_001657 S4889/AREG.p2 CCGTCCTCGGGAGCCGACTATGA . 23 B-actin NM_001104 S0034/B-actLf2 CAGCAGATGTGGATCAGCAAG 21 B-actin NMfOI101 80036/B-acti.r2 GCATTTGCGGTGGACGAT 18 B-actirl -NM3001101 54730/B-acti.p2 AGGAGTATGACGAGTCCGGCCCC 23 B-Catenin NM 001904 S2150/B-Cate.f3 GGCTCTTGTGCGTACTGTCCTT 22 B-Catenin NM 001 904 S2161/B-Cate.r3 TCAGATGACGAAGAGCACAGATG 23 B-Catenin NM_001904. S5046/B-Cate.p3 AGGCTCAGTGATGTCTTCCCTGTCACCAG 29 BAD NM_032989 S2011/BAD.fl GGGTCAGGTGCCTCGAGAT 19 BAD NM_032989 S2012/BAD.r1 CTGCTCACTCGGCTCAAACTC 21 BAD .NM_,32989 S5058/BAD.pl . TGGGCCCAGAGCATGTTCCAGATC 24 BAG1 NM004323 -S1386/BAG1.f2 CGTTGTCAGCACTTGGAATACAA 23 BAG1 NM004323 S1387/BAG1.r2 GrTCAACCTCTTCCTGTGGACTGT 24 BAG1 NM_004323 S4731/BAGI.p2 CCCAATTAACATGACCCGGCAACCAT 26 BBC3 NM.014417 S15841BBC3.f2 CCTGGAGGGTCCTGTACAAT - 20 BBC3 NM_014417 - 1585/BBC3.r2 . CTAATGGGCTCCATCTCG 19 BBC3 NM_014417 S4890/8C3.p2 CATCATGGGACTCCTGCCCTTACC 24 Bc12. NM_000633 S0043/Bcl2.f2 CAGATGGACCTAGTACCCACTGAGA 25 BcI2 NM_000633 S0045/Bc]2.r2 CCTATGATTTMAAGGGCATTTlliC -. 24 Bc12 NM_000633 S4732/Bc12.p2 TTCCACGCCGAAGGACAGCGAT 22 CA9 NM_001216 S1398/CA9.f3 ATCCTAGCCCTGGT1TnTGG .20 'CA9. NMI001216 -S1399/CA9.r3 CTGCCTTCTCATCTGCACAA 20 CA9' NM_O1216 34938/CA9.p3 TTTGCTGTCACCAGCGTCGC 20 CONBI NM_031966 S1720/CCNS1.f2 TTCAGGTTGTTGCAGGAGAC. 20 CCNBI NM_031966 S1721/CCNB1.r2 .CATCTTCTTGGGCACACAAT 20 CCNB1 NM031966 34733/CCNSI.p2 TGTCTCCATTATTGATCGGTTCATGCA 27 CCNDI NM_001758 S0058/CCND1.f3 GCATGTTCGTGGCCTCTAAGA 21 CCNDI NM._001758 30060/CCNDI.r3 CGGTGTAGATGCACAGCTTCTC 22 CCND1 NM_001758 S4986/CCNDI.p3 AAGGAGACCATCCCCCTGACGGC 23 CCNE1 NM_001238 S1446/CCNEI.fl AAAGAAGATGATGACCGGG1TrAC. 24 CONEI NM-001238 S1447/CCNEI.r1 GAGCCTCTGGATGGTGCAAT 20 CONEI NM_001238 S4944/CCNE1.pi CAAACTCAACGTGCAAGCCTCGGA 24 CCNE2 NM 057749 .8146/CCNE2,f2 ATGCTGTGGCTCCTTCCTAACT 22 CCNE2 NM_057749 S14591CCNE2.r2 ACCCAAATTGTGATATACAAAAAGGTT 27 CCNE2 NM_957749 S4945/CCNE2.p2 TACCAAGCAACCTACATGTCAAGAAAGCCC 30 CD3z NM-000734 S0064/CD3z.f1 AGATGAAGTGGAAGGCGCTT 20 CD3z NM_000734 80066/CD3z.ri TGCCTCTGTAATCGGCAACTG 21 CD3z NMf000734 34988/CD3z.pl CACCGCGGOCATCCTGCA 18 0068 NM_001251 50067/CD68.f2 TGGTTCCCAGCCCTGTGT . 18 CD68 NM_001251 SO069/CD68.r2 CTCCTCCACCCTGGGTTGT 19 CD66 NM..001251 84734/CD68.p2 CTCCAAGCCCAGATTCAGATTCGAGTCA 28 CD9 NM 001769 .80686/C0911 . GGGCGTGGAACAGTTTATCT 20 CD9 NM_001769 80687/CD9.rl CACGGTGAAGGT-TTCGAGT 19 CD9 NMO1 769 S4792/CD9.pl AGACATOTGdCCCAAGAAGGACGT 24 CDH1 NM_004360 30073/CDH1.f3 TGAGTGTCCCCCGGTATCTTC 21 CODH NM 004360- S0075/CDH1.r3 CAGCCGCTTTCAGATTTTCAT 21 COH NM_004360 84990/CDH1.p3 TGCCAATCCCGATGAAATTGGAAATTT 27 CEGP1 NM_020974 S1494/CEGP1.I2 TGACAATCAGCACACCTGCAT 21 CEGPI 'NM_.020974 S1495/CEGP1.r2 TGTGACTACAGCCGTGATCCTTA 23 CEGPi -NM.020974 S4735/CEGP1.p2 CAGGCCCTCTTCCGAGCGGT 20 Chkl NM_001274 S1422/Chkl.f2 GATAAATTGGTACAAGGGATCAGCTT 26 Chki NM001274 S1423/Chk1.r2 . GGGTGCCAAGTAACTGACTATTCA 24 Chk1 NM_001274. S4941/Chk1.p2 CCAGCCCACATGTCCTGATCATATGC 26 CIAPI NM001166 60764/CIAPI.f2 TGCCTGTGGTGGGAAGCT 18 CIAPI NM001166 S0765/CIAPI.r2 GGAAAATGCCTCCGGTGTT 19 CIAPI NM 001166 'S4802/CIAPI.p2 TGACATAGCATCATCCTTTGGTTCCCAGTT 30 cOAP2 NM_001165 80076/cAP2.2 GGATATTTCCGTGGCTCTTATTCA 24 clAP2 . NM 001165 SOO8/cIAP2.r2 CTTCTCATCAAGGCAGAAAAATCTT 25 clAP2 NM_001165 S4991/cIAP2.p2 TCTCCATCAAATCCTGTAAACTCCAGAGCA 30 cMet NM 000245 80082/cMet.f2 GACATTTCCAGTCCTGCAGTCA 22 cMet NM_000245 S0084/cMet.r2 CTCCGATCGCACACATTTGT 20 cMet NM 000245 S4993/cMet.p2 TGCCTCTCTGCCCCACCCTTTGT 23 Contig 27882 AKOS00618 S2633/ContIg.f3 GGCATCCTGGCCCAAAGT 18 Contig 27882 AK000618- S2634/Contig.r3 GACCCCCTCAGCTGGTAGTTG 21 Contig 27882 AK000618 S4977/ContIg.p3 CCCAAATCCAGGCGGCTAGAGGC 23 COX2 -NM_00963 S0088/COX2.fi TCTGCAGAGTTGGAAGCACTCTA -23 COX2 NM_000963 $0090/COX2.r1 GCCGAGGCTTTTCTACCAGAA 21 COX2 NM000963 84995/COX2.p1 . CAGGATACAGCTCCACAGCATCGATGTC.. 2B CTSL NM_001912 81303/CTSLf2 GGGAGGCTTATCTCACTGAGTGA. 23 CTSL NM 001912- S1304/CTSL.r2 CCATTGCAGCCrCATTGC 19 CTSL NM_001912. S4899/CTSL.p2 TTGAGGCCCAGAGCAGTCTACCAGATTCT 29 CTSL2 NM 001333 . S4354/CTSL2.fl TGTCTCACTGAGCGAGCAGAA 21 CTSL2 .NM O01333 S4355/CTSL2.r1 ACCATTGCAGCCCTGATTG 19 CTSL2 ' NM~001333 S4356/CTSL2.pl CTTGAGGACGCGAACAGTCCACCA 24 DAPKI NM.004938 . 91768/DAPKI.f3 CGCTGACATCATGAATGTTCCT 22. DAPK1 NM 004938 S1769/DAPK1.r3 TCTCTTTCAGCAACGATGTGTCTT 24 .DAPK1 NM_004938 S4927/DAPK1.p3 TCATATCCAAACTCGCCTCCAGCCG 25 DIABLO . NM019887 S0808/DIABLO.fi CACAATGGCGGCTCTGAAG 19 DIABLO . NM_019887 S0809/DIABLO.rl ACACAAACACTGTCTGTACCTGAAGA 26 DIABLO NM_019887 S4813/DIABLO.pl AAGT.TACGCTGCGCGACAGCCAA 23 DRS NM.003842 S2551/DR5.f2 CTCTGAGACAGTGCTTCGATGACT 24' DR5 NM_003842 S2552/DR5.r2 CCATGAdGCCCAACTCCT 19 DRS NM.003842 S4979/DR5.p2 CAGACTTGGTGCCCTTGACTCC 23 EGFR . NM_005228 S0103/EGFR.f2 TGTCGATGGACTTCCAGAAC 20 EGFR NM 005228 S0105/EGFR.r2 ATTGGGACAGGTTGGATCA 19 EGFR NM 005228 S4999/EGFR.p2 CACCT.GGGCAGCTGCCAA 18. EIF4E NM_001968 S0106/EIF4E.fl GATCTAAGATGGCGACTGTCGAA 23 EIF4E NM_001968 - 0108/EIF4E.r.1 - TTAGATTCCGTTTCTCCTCTTCTG 25 EIF4E NM001968 S5000/EJF4E.pl ACCACCCCTACTCCTAATCCCCCGACT 27 EMS1 NM_005231 -S263/EMS1.fi GGCAGTGTCACTGAGTCCTTGA 22 EMSI NM.005231 82664/EI1,r1 TGCACTGTGCGTCCCAAT 18 EMS1 . NM_005231 S4956/EM31.pl AT.CCTCCCCTGCCCCGCG - 18 EpCAM NM.002354 S1807/EpCAM.i GGGCCCTCCAGAACAATGAT 20 EpCAM NM_002354 81808/EpCAM.rl TGCACTGCTTGGCCTTAAAGA 21 EpCAM NM_002354 64984/EpCAM.p1 CCGCTCTCATCGCAGTCAGGATCAT 25 EPHX1 NM-000120 S1865/EPHX1.2 ACCGTAGGCTCTGCTCTGAA 20 EPHX1 NM_000120 S1866/EPHX1I.r2 TGGTCCAGGTGGAAAACTTC 20 EPHX1 ' NM-000120 S4754/EPHX1.p2 AGGCAGCCAGACCCACAGGA 20 ErbB3 NM_001982 80112/ErbB3.fl CGGTTATGTCATGCCAGATACAC 23 ErbB3 NM_001982 S0114/ErbBS.rl GAACTGAGACCCACTGAAGAAAGG . 24 Erb83 NM001982 S5002/Erb83.p1 CCTCAAAGGTACTCCCTCCTCCCGG 25 EstRi NM000125 SO115IEstR1.fl CGTGGTGCCCCTCTATGAC 19 EstR1 NM,000125 80117/EstR1.rl GGCTAGTGGGCGCATGTAG 19 EstR1 NM_000125 S4737iEstRi.pl CTGGAGATGCTGGACGCCC 19 FBXOS NM_012177 S2017/FBX05.rl GGATTGTAGACTGTCACCGAAATTC 25 FBXO NM012177 S2018IFBXOS.fi GGCTATTCCTCATTTTCTCTACAAAGTG 28 FBXO5 NM 012177 S5061/FBXOS.pl CCTCCAGGAGGCTACCTTCTTCATGTTCAC .30 FGF18 NM_003862 81665/FGF18.12 CGGTAGTCAAGTCCGGATCAA 21 , FGF18 NM_003862 31666/FGF18.r2 GCTTOCCTTTGCGGTTCA 18 FGF18 NM003882 S4914/FGF18.p2 CAAGGAGACGGAATTCTACCTGTGC 25 FGFRI NM_023109' S081B/FGFRI.f3 CACGGGACATTCACCACATC 20 FGFRI NM_023109 S0819/FGFR1.r3 GGGTGCCATCCACTTCACA 19 FGFRI NM.023109 S4816/FGFR1.p3 ATAAAAAGACAACCAACGGCCGACTGC 27 FHIT NM_002012 S2443/FHIT.f1 CCAGTGGAGCGCTTCCAT 18 FHIT NM 002012 82444/FH1T.rl CTCTCTGGGTCGTCTGAAACAA 22 FHIT NM_002012' S2445/FHIT.pl TCGGCCACTTCATCAGGACGCAG 23 FHIT NM002012 64921/FHIT.pl .TCGGCCACTTCATCAGGACGCAG 23 FRP1 NM003012 S1804/FRPI.f3 TTGGTACCTGTGGGTTAGCA 20 FRP1 NM003012 S1805/FRPI.r3 CACATCCAAATGCAAACTGG 20 FRP1 NM.003012 S4983/FRPI.p3 TCCCCAGGGTAGAATTCAATCAGAGC 26 G-Catenln NM_002230 S2153/G-Cate.fl TCAGCAGCAAGGGCATCAT 19 G-Catenln NM_002230 S2154/G-Cate.r1 GGTGG1TTTCTTGAGCGTGTACT 23 G-Catenin NM_002230 S5044/G-Cate.pl CGOCCCGCAGGCCTCATCCT 19 GAPDH NM 002046 S0374/GAPDH.fl ATTCCACCCATGGCAAATTC 20 GAPDH NM_002046 -0375/GAPDH.rl GATGGGATTTCCATTGATGACA 22 GAPDH NM 002046 S4738/GAPDH.pl CCGTTCTCAGCCTTGACGGTGC 22 GATA3 NM.002051 S0127GATA3.f3 CAAAGGAGCTCACTGTGGTGTCT 23 GATA3 NM002051 S0129/GATA3.r3 GAGTCAGAATGGCTTATTCACAGATG 26 GATA3 NM 002051 85005/GATA3.p3 TGTTCCAACCACTGAATCTGGACC 24 GR57 NM 005310 .SD130/GRB7.f2 CCATCTGCATCCATCTTGTT 20 GR87 NM 005310 30132/GRB7.r2 GGCCACCAGGGTA1TATCTG 20 GRB7 NM..005310 S4726/GRB7.pZ CTCCCCACCCTTGAGAAGTGCCT 23 . ORO1 NM0I01' S0133/GRO1.f2 CGAAAAGATGCTGAACAGTGACA 23 GRO1 NM_001511 80135/GRO1.r2 TCAGGAACAGCCACCAGTGA 20 GROl NM.001511 -.S5006/GRO.p2 CTTCCTCCTCCCTTCTGGTCAGTTGGAT 28 GSTM1 NM_00561 S2026/GSTM1.rl GGCCCAGCTTGAATTTTCA 20 GSTMI NM 000661 S2027/GSTMI.f1 AAGCTATGAGGAAAAGAAGTACACGAT 27 GSTMI NM 000561 S4739GSTM1.pl TCAGCCACTGGCTTCTGTCATAATCAGGAG 30 GUS NM_000181 S01391GUSfi CCCACTCAGTAGCCAAGTCA 20 GUS NM 000181 S0141/GUS.rl CACGCAGGTGGTATCAGTCT 20 GUS NMJOOI81 S4740/GUS.p1 TCAAGTAAACGGGCTGTTCCAAACA 27 HER2 NM_004448 50142/HER2.f3 CGGTGTGAGAAGTGCAGCAA 20 HER2 NM -004448 S0144/HER2.r3 CCTCTCGCAAGTGCTCCAT 19 HER2 NM 004448 S4729/HER2.p3 CCAGACCATAGCACACTCGGGCAC 24 HIF1A NM 001530 S1207/HIF1A.f3 TGAACATAAAGTCTGCAACATGGA 24 HIF1A NM001530 S1208/HiF1A.r3 TGAGGTTGGTTACTGTTGGTATCATATA 28 HIFIA NM3001'530 S4753HIF1A.p3 TTGCACTGCACAGGCCACATTCAC 24 HNF3A NMS004496 S0148/HNF3A.fl TCCAGGATGTTAGGAAOTGTGAAG 24 HNF3A NMj004496, 80150/HNF3A.rl GCGTGTCTGCGTAGTAGCTGTT 22 HNF3A NM_004496 S5006/HNF3A.p1 AGTCGCTGGTTTCATGCCCTTCCA 24 101 NM-002165 50820/101.11 AGAACCGCAAGGTGAGCAA 19 101 NM 002105 30021/1 .r1 TCCAACTGAAGGTCCCTGATG 21 ID1 NM002166 S4832/ID1.pl TGGAGATTCTCCAGCACGTCATCGAC 26 IGFI NM_000618 S0154/IGFI12 TOCGGAGCTGTGATCTAAGGA 21 IGF1 NM000618 50156/IGF1.r2 CGGACAGAGCGAGCTGACTT 20 IGFI NM_000618 S5010/IGF1.p2 TGTATTGCGCACCCCTCAAGCCTG 24 IGF1R NM_000875 S1249/IGF1R.f3 GCATGGTAGCCGAAGATTTCA 21 IGFlR NMt000875 S1250/lGFlR.r3 TTTCCGGTAATAGTCTGTCTCATAGATATC 30 IGFIR NM 000875 S4895/IGFIR.p3 CGCGTCATACCAAMTCTCCGATTTTGA 28 IGFBP2 NM_000597 S1128/IGFBP2.f1 GTGGACAGCACCATGAACA 19 IGFBP2 NM_000597 31129/1GFBP2.rl CCTTCATACCCGACTTGAGG 20 IGFBP2 NM_000597 S4837/IGFBP2.p1 CTTCCGGCCAGCACTGCCTC 20 IL6 NM 000600 S0760/L6.f3 CCTGAACCTTCCAAAGATGG 20 ILS NMj000600 50761/lL6.r3 ACCAGGCAAGTCTCCTCATT 20 ILS NM_,000600 S4800/1L6.p3 CCAGATTGGAAGCATCCATCTTTTTCA 27 IRSI NM_005544 61943/IRSI.f3 CCACAGCTCACCTTCTGTCA 20 IRS1 NM_005544 S1944/IRS1,r3 CCTCAGTGCCAGTCTCTTCC 20. IRS1 NM_005544 S50501IRS1.p3 TCCATCGCAGCTCCAGCCAG 20 KI-67 NM9002417, S0436/KI-67.12 CGGACTTTGGGTGCGACTT 19 KI-67 NM 002417 S0437/KI-67,r2 TTACAACTCTTCCACTGGGACGAT 24 Ki-67 NM.002417 S4741/KI-67.p2 CCACTTGTCGAACCACCGCTCGT 23 KLK10 NM002776 S2624/KLK10.f3 GCCCAGAGGCTCCATCGT 18 KLK10 NM_.002776 82625/KLK10.r3 'CAGAGGTTTGAACAGTGCAGACA 23 KLK10 NM 002776 S4978/KLK1O.p3 - CCTCTTCCTCCCCAGTCGGCTGA 23 KRT14 NM_000526 81 853/KRT14.f1 GGCCTGCTGAGATCAAAGAC 20 KRT14 NM:000526 S1854/KRT14.r1 GTCCACTGTGGCTGTGAGAA 20 KRT14 NM_000526 85037/KRT14.pl TGTTCCTCAGGTCCTCAATGGTCTTG 26 KRT17 NM_000422 801 72/KRT1 7.f2 CGAGGATTGGTTCTTCAGCAA 21 KRT17 NM_000422 Sa174/KRT17.r2 ACTCTGCACCAGCTCACTGTTG 22 KRT17 NM_000422 S5013/KRT17.p2 CACCTCGCGGTTCAGTTCCTCTGT 24 KRT18 NM_000224 81710/KRT18.12 AGAGATCGAGGCTCTCAAGG 20 KRT18 NM.000224 S1711/KRT18.r2 GGCCTTTTACTTCCTCTTCG . 20 KRT18 NM000224 S4762/KRT18.p2 TGGTTCTTCTTCATGAAGAGCAGCTCC 27 KRT19 NM002276 S1515/KRT19.f3 TGAGCGGCAGAATCAGGAGTA 21 KRT19 NM_002276 .S15i6KRT19.r3 TGCGGTAGGTGGCAATCTC 19 KRT1 9 NM_002276 34866/KRT19.p3' OTCATGGACATCA-AGTCGCGGCTG 24 KRT5 NM_000424 S0175/KRT5.f3 TCAGTGGAGAAGGAGTTGGA 20 KRT5 NM000424 S0177/KRT5.r3 TGCCATATCCAGAGGAAACA 20 KRT5 NM 000424 S5015/KRT5.p3 CCAGTCAACATCTCTGTTGTCACAAGCA 28 KRTB NM_002273 S2588/KRT8,f3 GGATGAAGCTTACATGAACAAGGTAGA 27 KRTB NM002273 S2589/KRT8.r3 CATATAGCTGCCTGAGGAAGTGAT 25 KRT8 NM 00227.3 S4952/KRT8.p3 CGTOGGTCAGCCCTTCCAGGC 21 LOTI variant I NM 002656 S0692/LOT1 v.f2 GGAAAGACCACCTGAAAAACCA 22 LOTI variant 1 NM002656- S0693/LOTI v.r2 GTACTTCTTCCCACACTCCTCACA 24 LOTI variant 1 NM_002656 - 84793/LOTI v.p2 ACCCACGACCCCAACAAAATGGC 23 Maspin NM002639 S0836/Maspin.f2 CAGATGGCCACTTTGAGAACATT 23 Maspin NM_002639 S0837/Maspin.r2 GGCAGCATTAACCACAAGGATT 22 Maspin - NM_002639 S4835/Maspin.p2. AGCTGACAACAGTGTGAACGACCAGACC 28 MoM2 NM_004526 81602/MCM2.f2 GACTTTTGCCCGCTACCTTTC '21 MCM2 NM -004526 S1603/MCM2.r2 GCCACTAACTGCTTCAGTATGAAGAG 26 MCM2 NMt004526 84900/MCM2.p2 ACAGCTCATTG1TGTCACGCCGGA 24 MCM3 NM 002388 $1524/MCM3.f3. GGAGACAATCCCCTGAGA 20 MCM3 .NM_002388 81525/MCM3.r3' ATCTCCTGGATGGTGATGGT 20 MCM3 NM002388 S4870/MCM3.p3 TGGCCTTTCTGTCTACAAGGATCACCA 27 MCM6' NM3005915 S1 704/MCM6.f3 TGATGGTCCTATGTGTCACATTCA 24 MCM6 NM 005915 S1705/MCM6Ar TGGGACAGGAAACACACCAA 20 MCM6 NM 005915 S4919/MCM6.p3 CAGG1TTCATACCAACACAGGCTCAGCAC 30 MDM2 NM:002392 80830/MDM2.fl CTACAGGGACGCCATCGAA 19 MDM2 NM 002392 S0831/MDM2.r1 ATCCAACCAATCACCTGAATGTr 23 MDM2 NM:002392 948341MOM2.p1 CTTACACCAGCATCAAGATCCGG 23 MMP9 NM D04994 S0656/MMP9.f1 GAGAACCAATCTCACCGACA 20 MMP9 NM_004994. 80657/MMP9.rl CACCCGAGTGTAACCATAGC 20 MMP9 NMC004994 .S4760/MMP9.p1 ACAGGTATTCCTCTGCCAGCTGCC 24 MTA1 NMj004689 S2369/MTA1.fi CCGCCCTCACCTGAAOAGA 19 MTA1 NM_004689 32370/MTAi.r1 GGAATAAGTTAGCCGCGCTTCT 22 MTA1 NM~004689 S4855/MTAI.pl CCCAGTGTCCGCCAAGGAGCG 21 MYBL2 NM002466 .33270/MYBL2.f1 GCCGAGATCGCCAAGATG 18 MYBL2 NM 002466 S3271/MYBL2.rl CTTTTGATGGTAGAGTTCCAGTGATTC 27 MYBL2 NM002466 S4742/MYBL2.pi CAGCATTGTCTGTCCTCCCTGGCA 24 P14ARF 378535 S2842/P14ARF.f1 CCCTCGTGCTGATGCTACT 19 P14ARF 378535 32843/P14A.RFr1 CATCATGACCTGGTCTTCTAGG 22 P14ARF 878535 S4971IP14ARF.pl CTGCCCTAGACGCTGGCTCCTC 22 p27 NM_004064 S0205/p27.f3 CGGTGGACCACGAAGAGTTAA 21 p27 NM_004064 S0207/p27.r3 GGCTCGCCTCTTCCATGTC 19 p27 NM.004064 S4750/p27.p3 - CCGGGACTTGGAGAAGCACTGCA 23 P53 NM_000546 S0208/P53.f2 CTTTGAACCOTTGCTTGCAA 20 P53 NM 000546 S0210/P53,r2 CCCGGGACAAAGCAAATG 18 P53 NM 000546 S5065/P53.p2 AAGTCCTGGGTGCTTCTGACGCACA 25 PAIli NM_000602 S0211/PAI1.t3 CCGCAACGTGGTTTTCTCA 19 PAI1 NM_000602 S0213/PAII.r3 TGCTGGGTTTCTCCTCCTGTT 21 PAl NM_000602 S5066/PAI1.p3 CTCGGTGTTGGCCATGCTCCAG 22 PDGFRb NM0.02609 S1346/PDGFRb.f3 CCAGCTOTCCTTCCAGCTAC 20 PDGF.Rb NM 002609 S1347/PDGFRb.r3 G'GGTGGCTCTCACTTAGCTC 20 PDGFRb NM002609 S4931/PDGFRb.p3 ATCAATGTCCCTGTCCGAGTGCTG 24 313KC2A NM_002645 S2020/P13KC2.rl CACACTAGCATTTOTCGCATA 23 '13KC2A NM_002645 S2021/Pi3KC2.f1 ATACCMTOACCGCACAAACC 21 I3KC2A .NM_002645 S5062/Pt3KC2.p1 - TGCGCTGTGACTGGACT7AACAAATAGCCT 30 'PMlD NNL003620 S3159/PPMID.fl GCCATCCGCAAAGGCTT - 18 'PMID NM_003620 83160/PPM1D.ri GGCCATTCCGCCAGTTTC 18 'PMID NM 003620 S4856/PPM1D.pi TCGCTTGTCACCTTGCCATGTGG 23 3R NM..000926 S1336/PR.f6 GCATCAGGCTGTCATTATGG 20 DR - NM 000926 S1337/PR.rS AGTAGTGTGCTGCCCTTCC 20 R NM:000926 S4743/PR.p6 TGTCCTTACCTGTGGGAGCTGTAAGGTC 28 DRAME NMl006115 819865/PRAMEf3 TCTCCATATCTGCCTTGOAGAGT 23 DRAME NM_006115 S1986/PRAMEr3 GCACGTGGGTCAGATTGCT 19 'RAME NM_006115 S4756/PRAME.p3 TCCTGCAGCACCTCATCGGGCT 22 pS2 NM 003225 80241/pS2.f2 GCCCTOCCAGTGTGCAAAT 19 pS2 NM003225 S0243/pS2.r2 CGTCGATGGTATTAGGATAGAAGOA 25 pS2 NM_003225 S5026/pS2.p2 TGCTGTTTCGACGACACCGTTCG 23 RAD51C NM_0582i S2606/RADS1 C.f3 GAACCTTGAGCAGGAGCATACC - 24 RAD51C NM058216 S26071RAD51 Cr3 TCCACCCCCAAGAATATCATCTAGT 25 RADSIC . NM058216 S4764/RADSIC.p3 AGGGCTTCATAATCACCTTCTGTTC 25 RBI .NM_000321 S2700/RB1.fl CGAAGCCCTTACAAGTTTCC 20 RBI NM.000321 $270iRB1.rl GGACTCTTCAGGGGTGAAAT 20 RB1 NM_000321 84765/RB1.pl CCCTTACGGATTCCTGGAGGGAAC 24 RIZ1 NM_012231 S1320/RIZ1.f2 OCAGACGAGCGATTAGAAGC 20 RIZ. NM_012231 S1321/RIZI.r2 TCCTCCTCTTCCTCCTCCTC 20 RIZ1 NM.012231 S4761/RIZ1.p2 TGTGAGGTGAATGATGGGGGA 23 STK15 NM_003600 S0794/STKIS.f2 CATCTTCCAGGAGGACCACT 20 STK15 NM-003600 S0795/STK1 5.r2 TCCGACCTTCAATCATTTCA 20 STK15 NM.003600 S4745/STKI5p2 CTCTGTGGCACCCTGGACTACCTG 24 STMY3 NM005940. S2067/STMY3.f3 CCTGGAGGCTGCAACATACC 20 STMY3 NM_005940 S2068/STMY3.r3 TACAATGGCTTTGGAGGATAGCA 23 STMY3 -NM_0.05940 S4746/STMY3.p3 ATCCTCCTGAAGCCTTTTCGCAGC . 25 SURV NM_001168 SO259/SURV.f2- TGTT[GATTCCCGGGCTTA 20 SURV NM 001168 so261/SURV.r2 CAAAGCTGTCAGCTCTAGCAAAAG 24 SURV NM:001168 S4747/SURV.p2 TGCCTTCTTCCTCCCTCACTTCTCACCT 28 TBP NM003194 - S0262/TBP.fl GCCCGAAACGCCGAATATA 19 TBP NM0l931g4 S0264/TBP.r1 CGTGGCTCTCTTATCCTCATGAT 23 TBP NM003194 S4751IIBP.p1P TACCGCAGCAAACCGCTTGGG 21 TGFA NM_003236 S0489/TGFAf2. GGTGTGCCACAGACCTTCCT 20 TGFA NM003236 SO49OTGFA.r2 ACGGAGTTCTTGACAGAGTTrTGA 24 TOFA NM_003236 S4768/TGFA.p2 TTGGCCTGTAATCACCTGTGCAGCCTT 27 TIMP1 NM003254 81695TlMP1.f3 TCCCTGCGGTCCCAGATAG 19 TIMPI NM_003254 S1696/TIMP1.r3 GTGGGAACAGGGTGGACACT 20 TIMPI .NM_003254 S49IfDiMP1.p3 ATCCTGCCCGGAGTGAACTGAAGC 25 TOP2A NM001067 S0271/TOP2Af4 AATCCAAGGGGGAGAGTGAT 20 TOP2A NM_001067 80273/ToP2A.r4 GTACAGATTTrGCCCGAGGA 20 TOP2A .NM 001067 S4777/TOP2A.p4 CATATGGACrrTGACTCAGCTGTGGC 26 TOP2B NM_001 068 S0274/TOP28.f2 TGTGGACATCTTCCCCTCAGA .2 TOP28 NM001 068 S027.6ITOP28.r2 CTAGCCCGACCGGTTCGT 18 TOP2B NM_001068, S4778/TOP28.p2 TTCCCTACTGAGCCACCTTCTCTG 24 TP NMO1 953 80277/TP.f3 CTATATGCAGCCAGAGATGTGACA 24 TP NM001953 S0279/TPr3 CCACGAGTTCTTACTGAGAATGG - 24 TP NM_001953 S4779/TP.p3 ACAGCCTGCCACTCATCACAGCC 23 TP53BP2 NM_005426 S19311TP538P12 GGGCCAAATATTCAGAAGC 19 TP53BP2 NM005426 SI932/TP53BP.r2 GGATGGGTATGATGGGACAG 20 TP53BP2 NM_005426 S5049/TPS38P.p2 CCACCATAGCGGCCATGGAG 20 TRAIL NM 003810 32539/TRAIL.1 CTTCACAGTGCTCCTGCAGTCT 22 TRAIL NM003810 S2540/TRAIL.r1 CATCTGCTTCAGCTCGTTGGT 21 TRAIL NM003810 34980/TRAILp1 AAGTACACGTAAGTTACAGCCACACA' 26 TS NM 001071 So280/TS.fl GCCTCGGTGTGCCTTTGA 18 TS NM 001071 60282/TS.rl CGTGATGTGCGCAATCATG 19 TS NM001071 S4780/TS.p1 CATCGCCAGCTACGCCCTGCTC 22 upa NM .002658 SO283/upa.f3 GTGGATGTGCCCTGAAGGA 19 upa NM_002658 80285/upa.r3 CTGCGGATCCAGGGTAAGAA 20 Table 6F upa NM_002658 S4769/upa.p3 AAGCCAGGCGTCTACACGAGAGTCTCAC 28 VDR - NM_000376 82745NDR.f2 GCCCTGGATTTCAGAAAGAG 20 VDR NM_000376 82746NOR.r2 AGTTACAAGCCAGGGAAGGA 20 VDR NM00376 S4962NDR.p2 CAAGTCTGGATCTGGGAGCCTTTCC 25 VEGF NM_003376 SO286NEGF.fl CTGCTGTCTTGGGTGCATTG 20 VEGF NM_003376 S0288NEGF.rl GCAGCCTGGGACCACTG Is VEGF NM_003376 S4782NEGF.p1 TTGCCTTGCTGCTCTACCTCCACCA 25 VEGFB NM_003377' S2724NEGFB.f1 TGACGATGGCCTGGAGTGT - 19 VEGFB NM 003377 S2725NEGFB.rl GGTACCGGATCATGAGGATCTG 22 VEGFB NM_00337.7 S496ONEGFB.pl CTGGGCAGCACCAAGTCCGGA 21 WISP1 NM 003882 Si7I/WISPI.f1 AGAGGCATCCATGAACTTCACA 22 WISPI NM 003882 81672/WISP1.r1 CAAACTCCACAGTACTTGGGTTGA 24 W1SPi NM003882 S491 5/WISP1.pi CGGGCTGCATCAGCACACGC 20 XIAP NM_001167 SO289/XIAP.fi GCAGTTGGAAGACACAGGAAAGT 23 XIAP NM_001167 SO291/XLAP.r1 TGCGTGGCACTA1TTCAAGA 21 XIAP NM_.001187 84752/XIAP.pI TCCCCAAATTGCAGATTTATCAACGGC 27 YB-1 NM 004559 S1194NB-1.f2 AGACTGTGGAGTTTGATGTTGTTGA 25 YB-1 -NM 004559 $1195NB-I.r2' GGAACACCACCAGGACCTGTAA 22 YB-i NM_004559 84843/YB-i.p2 -TTGcTGCCTCCGCACCCTTTTCT 23 ZNF217 NM 006526 -S2739/ZNF217.f3 ACCCAGTAGCAAGGAGAAGC 20 ZNF217 NM~006526 S27401ZNF217.r3 CAGCTGGTGGTAGGTTCTGA 20 ZNF217 - NM 006526 S4961/ZNF217.p3 CACTCACTGCTCCGAGTGCGG 21