AU2015201983A1 - Immunoglobulin variants and uses thereof - Google Patents

Abstract

The invention provides humanised and chimeric anti-CD20 antibodies for treatment of CD20 malignancies and autoimmune diseases.

Description

1PEANS 13 JUL 2004 Attorney Docket No. Pi990R3 5 TMMUNOGLOBLUUTN VARIANTS AN) USE$ THEREOF II DOF TINE INVENTION 10 The invendon relates to anti-CD20 antibodies and their use in the treatment ofB-cell related diseases. BACKGROUND OF ThE MENTION Lymphocytes are one of several populations of white blood cels; they specieaajy recognize and I5 respond to foreign antigen. The three major classcs of lymphocytes are 3 lymphocytes (B cells), T lymphocytes (1' cells) and natural killer (NK) cells. B lymphocytes are the cells responsible for antibody production and provide humnoral .inmnity. B cells mature within the bone marrow and leave the miarow expressing an anigen-binding antibody on their cell surface When a naive B cell first eounters the andgen for which its membrane-bound antibody is specific, the ecl begins to divide rapidly and its progeny 20 differentiate into memory B cells and effector cIls called "plasma cells". Menory B cells have a longer life span and continue to express membrane-bound antibody with the same specificity as the original parent cell Plasma cells do not produce membrane-bound antibody but instead produce secreted form of the antibody. Secreted antibodies are the major effector ruolecules of humoral immunity. The CD20 antigen (also called human B-lymphocyte-resticted differentiation antigen, Bp35) is a 25 hydrophobic transmembrane protein with a molecular weight of approximately 35 AD located on pre-l3 and mature 3 lymphocytes (Valentine er al J Biot Chem. 264(19):11282-11287 (1989); and Ein.feld et at EMAO J, 7(3):71 1-717 (1988)). The antigen is also expressed on greater than 90% of B cell non.-Hodgkin's lymphonas (NL) (Anderson et at Blood 63(6):1424-1433 (1984)), but is not found on henatopoictie stem cells. pro-B cells, normal plasma cells or other normal tissues (Tedder et at J Immunn J35(2):973-979 30 (1985)). C120 is thought to regulate an eady step(s) in dhe activation process for cell cycle initiation and differentiation (Tedder metal, supra) and possibly functions as a calcium ion channel (Tedder et aL . CelL Mbichem. 14D:195 (1990)). Given the expression of CD20 in B cel lymphomas, this antigen has been a useful therapeutic target to treat such lymphomas. There are more than 300,000 people in the United States with B-cell NHL 35 and more than 56,000 new cases are diagnosed each year. For example, the rituximab (RITUXAN®) antibody which is a genetically engineered chimeri mn rindhuman monoclonal antibody directed against human CD20 antigen (commercially available front Ocnenrtech, Inc-, South San Francisco, California, U.S) is used for the treatment of patients with relapsed or refractoy low-grade or folicular, CD20 positive, B cell non--Todgkin's lymphoma. Rituximab is the antibody revered to as "C2138" in US Patent No. 5,736,137 4() issued April 7, 1998 (Anderson erat) and in US Pat No. 5,776,456, In vtro mechanism of action swdies have demonstrated that RLTUXAN® binds human complement and lyses lymuphoid B cell lines through cumplement-dependent cytotoxicity (CDC) (Reff ex al Blood 83(2):435-445 (1994)). Additionally, it has significant activity' in assays for antibody-dependent cellular cytotoxicity (ADCC). Int v/vo preclinical studies have shown that RJTUXAN@ depletes B cells from the pcripherai blood, lymph nodes, and bone 45 marrow of cynomoigus monkeys, presumably through complement and cell-mediated processes (Reff er at E 267* RCVD AT 4/26/2005 2:48:59 PI [Eastem Daylight iiel*I SVR:USPTO-EFXRF-i/26 t DNIS:2730827*CSID:650 952 9881 DURATION (mm-ss):24-56 Blood 83 (2): 435-445 (1994)). Other anti-CD20 antibodies indicated for the treatment of NHL include the murine antibody Zevalin'TM which is linked to the radioisotope, Yttrium-90 (IDEC Pharmaceuticals, San Diego, CA), Bexxarna' which is another fully murine antibody conjugated to 1-131 (Corixa, WA). 5 A major limitation in the use of murine antibodies in human therapy is the human anti-mouse antibody (HAVIA) response (see, e.g., Miller, R.A. et al. "Monoclonal antibody therapeutic trials in seven patients with T-cell lymphoma" Blood, 62: 988-995,1983; and Schroff, R.W., et al. "Human anti-murine immunoglobulin response in patients receiving monoclonal antibody therapy" 10 Cancer Res., 45:879-885, 1985). Even chimeric molecules, where the variable (V) domains of rodent antibodies are fused to human constant (C) regions, are still capable of eliciting a significant immune response (HACA, human anti-chimeric antibody) (Neuberger et al. Nature (Lond.), 314:268-270,1985). A powerful approach to overcome these limitations in the clinical use of monoclonal antibodies 15 is "humanization" of the murine antibody or antibody from a non-human species (Jones et al. Nature (Lond), 321:522-525,1986; Riechman et al., Nature (Lond), 332:323 -327,1988). Thus, it is beneficial to produce therapeutic antibodies to the CD20 antigen that create minimal or no antigenicity when administered to patients, especially for 20 chronic treatment. The present invention satisfies this and other needs. The present invention provides anti-CD20 antibodies that overcome the limitations of current therapeutic compositions as well as offer additional advantages that will be apparent from the detailed description below. It is to be understood that, if any prior art publication is referred to herein., 25 such reference does not constitute an admission that the publication forms a part of the common general knowledge in the art, in Australia or any other country. In the claims which follow and in the preceding description of the invention, except where the context requires otherwise due to express language or necessary implication, the word "comprise" or variations such as "comprises" or "comprising" 30 is used in an inclusive sense, i.e. to specify the presence of the stated features but not to preclude the presence or addition of further features in various embodiments of the invention. 2 64072671 GHM.tters) P76023 AU.2 KAROLA SUMMARY OF THE INVENTION The present invention provides CD20 binding antibodies or functional fragments thereof, and their use in the treatment of B-cell associated diseases. These antibodies are monoclonal antibodies. In specific embodiments, the antibodies that 5 bind CD20 are humanized or chimeric. The humanized 2117 variants include those that have amino acid substitutions in the FR and affinity maturation variants with changes in the grafted CDRs. The substituted amino acids in the CDR or FR are not limited to those present in the donor or recipient antibody. In other embodiments, the anti-CD20 antibodies of the invention further comprise changes in amino acid i0 residues in the Fc region that lead to improved effector function including enhanced CDC and/or ADCC function and B-cell killing (also referred to herein as B-cell depletion). Other anti-CD20 antibodies of the invention include those having specific changes that improve stability. In a specific embodiment, the humanized 2H7 variants with increased stability are as described in example 6 below. Fucose is deficient variants having improved ADCC function in vivo are also provided. In one embodiment, the chimeric anti-CD20 antibody has murine V regions and human C region. One such specific chimeric anti-CD20 antibody is Rituxan) (Rituximab@; Genentech, Inc.). In a preferred embodiment of all of the antibody compositions and methods 2 oof use of this invention, the humanized CD20 binding antibody is 2H7.v16 having the light and heavy chain amino acid sequence of SEQ ID NO. 21 and 22, respectively, as shown in FIG. 6 and FIG. 7. When referring to the polypeptide sequences in Figures 6, 7 and 8, it should be understood that the first 19 or so amino acids that form the secretory signal sequence are not present in the mature 5 polypeptide. The V region of all other variants based on version 16 will have the amino acid sequences of v16 except at the positions of amino acid substitutions which are indicated in the disclosure. Unless otherwise indicated, the 2H7 variants will have the same L chain as that of v16. The invention provides a humanized antibody that binds human CD20, or an 30 antigen-binding fragment thereof, wherein the antibody is effective to deplete primate B cells in vivo, the antibody comprising in the H chain Variable region (VHI) at least a CDR3 sequence of SEQ [D NO. 12 from an anti-human CD20 anti body and substantially the human consensus framework (FR) residues of human heavy chain subgroup III (V 14 1). In one embodiment, the primate B cells are from human 3 64072671 GHM.tters) P76023 AU.2 KAROLA and Cynomolgus monkey. In one embodiment, the antibody further comprises the H chain CDR I sequence of SEQ ID NO. 10 and CDR2 sequence of SEQ ID NO. I1. In another embodiment, the preceding antibody comprises the L chain CDR1 sequence of SEQ ID NO. 4, CDR2 sequence of SEQ ID NO. 5, CDR3 sequence of 5 SEQ 1D NO. 6 with substantially the human consensus framework (FR) residues of human light chain K subgroup I (VKI). In a preferred embodiment, the FR region in VL has a donor antibody residue at position 46; in a specific embodiment, FR2 in VL has an amino acid substitution of leuL46pro (Leu in the human KI consensus sequence changed to pro which is present in the corresponding position in m2H7). 10 The VH region further comprises a donor antibody residue at at least amino acid positions 49, 71 and 73 in the framework. in one embodiment, in the VH, the following FR positions in the human heavy chain subgroup III are substituted: Ala[I49Glv in FR2; ArgH7iVal and AsnI-73Lys in FR3. In other embodiments, the CDR regions in the humanized antibody further comprise amino acid substitutions i5 where the residues are neither from donor nor recipient antibody. The antibody of the preceding embodiments can comprise the VH sequence of SEQ ID NO.8 of v 16, as shown in FIG. 1B. In a further embodiment of the preceding, the antibody further comprises the VL, sequence of SEQ ID NO.2 of v16, as shown in FIG. I A. 20 In other embodiments, the humanized antibody is 2H7.v31 having the light and heavy chain amino acid sequence of SEQ ID NO. 21 and 23, respectively, as shown in FIG. 6 and FIG. ; 2-l7.v31 having the heavy chain amino acid sequence of SEQ ID NO. 23 as shown in FIG. 8; 2H7.v96 with the amino acid substitutions of D56A and N1O0A in the H chain and S92A in the L chain of v16, 25 In separate embodiments, the antibody of any of the preceding embodiments further comprises at least one amino acid substitution in the Fe region that improves ADCC and/or CDC activity over the original or parent antibody from which it was derived, v.16 being the parent antibody being compared to in most cases, and Rituxan in other cases. One such antibody with improved activity comprises the 30 triple Alanine substitution of S298A/E333A/K334A in the Fc region. One antibody having S298A/E333A/K334A substitution is 21-17.v31 having the heavy chain amino 3a 64072671 GHM.tters) P76023 AU.2 KAROL.A acid sequence of SEQ ID NO. 23. Antibody 2H7.vi 14 and 2H7.v1 15 show at least 10-fold improved ADCC activity as compared to Rituxan. In another embodiment, the antibody further comprises at least one amino acid substitution in the Fc region that decreases CDC activity as compared to the 5 parent antibody from which it was derived which is v16 in most cases. One such antibody with decreased CDC activity as compared to v16 comprises at least the substitution K322A in the H chain. The comparison of ADCC and CDC activity can be assayed as described in the examples. 3b 64072671 GHM.tters) P76023 AU.2 KAROLA Attorney )ocket No, PP990R3 5 In a preferred embodiment, the antibodies of the invention are fill length antibodies wherein the V, region is joined to a human IgG3 heavy chain constant region. In preferred embodiments, the igG is human IgG I or IgG33, In one embodiment, the CD20 binding antibody is conjugated to a cytotoxic agent, in preferred embodiments the cytotoxic agent is a toxin or a radioactive isotope. In one emnbodiment, the antibodies of the invention for use in Iherapeutic or diagnostic purposes are produced in CHO cells. Also provided is a composition comprising an antibody of any one of the preceding embodiments, and a carrier,. In one embodiment, the carrier is a pharmaceutically acceptable carrier. These compositions can be provided in an article of manufacture or a kit, iS The invention also provided a liquid formulation comprising a humanized 2H7 antibody at 20mg/mL antibody, 1I0mM histidine sulfate pH5.8, 60mg/mJ sucrose (6%), 0.2 mg/mi polysurbate 20 (0.02%). The invention also provides an isolated nucleic acid that encodes any of the antibodies disclosed herein, including an expression vector for expressing the antibody. 20 Another aspect of the invention are host cells comprising the preceding nuclcic acids, and host cells that produce the antibody. In a preferred embodiment of the latter, the host cell is a CHO cell. A method of producing these antibodies is provided, the method comprising culturing the host cell that produces the antibody and recovering the anybody from the cell culture. Yet another aspect of the invention is an article of manufacture comprising a container and a 25 composition contained therein, wherein the composition comprises an antibody of any of the preceding embodiments, For use in treating NHL, the article of manufacture further comprises a package insert indicating ubat the composition is used to treat non-Hodgkin's lymphoma. A further aspect of the invention is a method of inducing apoptosis in B cols in vivo, comprising contacting B cells with the antibody of any of the preceding, thereby killing the 3 cels. 30 The invention alo providtet methods of treating the diseases disclosed herein by administation of a C)20 bindirig antibody or funotional fragment thereof, to a Mammal such as a human patient suffering from the disease, In any of the methods for Ireating an autointune disease or a CD20 positive cancer, in one embodiment, the antibody is 2H7.v16 having the light and heavy chain amino acid sequence of SEQ ID No. 21 and 22, respectively, as shown in FIG. 6 and FIG. 7. Thus, one embodiment is a method of treating a 35 CD20 positive cancer, comprising adatinistering to a patient suffering from the cancer, a therapeutically effective amount of a humnanized CD20 binding antibody of the invention. In preferred embodiments, the CD210 positive cancer is a B cell lymipLoma or leukemia including non-Hodgldn's lymphoma (NIHL) or lymphocyte predominant Hodgkin's disease (LPHD), chronic lymphocytic leukemia (CLL) or SLL. In one embodiment of the method of treating a B cell lymphoma or leukemia, the antibody is administered at a 40 dosage range of about 275-375mg/m. In additional embodiments, the treatment method further comprises administering to the patient at least one chemotherapeutic agent, wherein for non--lodgkin's lymphorna (NIL), the chemotherapeutic agent is selected from the group consisting of doxorubicin, cyclophosphamide, vincristinc and prednisolone. 4 E 5167RV AT 412612005 2:48:59 PM [astem Daylight Time]I SVR:USPTO-EFXRF1126 DNIS:2730827 C0SID:650 952 9881 *DURATION (mm ss):2456 - - .M 13 JUL2D4 Attorney Docket No. P1 990R3 5 Also provided is a method of treating an autoinmune disease, comprising administering to a patient suffering from the autoitrnune disease, a therapeutically effective amount of the humanized CD20 binding antibody of any one of the prtceling claims. The autoimmune disease is selected from the gmnup consisting of rheummoid arthritis, juvenile rheumatoid arthritis systemic lupus erythematosus (SLE), Wegener's disease, inflamratory bowl disease, idiopathic thru.ombocytopenic purpura (1IP), thmmbotic 10 irombocytopenic purpura (TT), autoimrnune thrombocytopenia, rilriple sclerosis, psoriasis, IgA nephropathy. 1gM polyneuropathics, myasthenia gravis, vasculitis, diabetes neliitus, Reynauid's syndrome, Sjorgen's syndrome and glomeruionephritis. Where the autoirrnune disease is rheumatoid arthritis, the antibody can be administered in conjunction with a second therapeutic agent which is preferably methotrexate. 15 in these treatment methods, the CD20 binding antibodies can be administered alone or in conjunction with a second therapeutic agent such as a second antibody, or a chemotherapeutic agent or an immunosuppressive agent. The second antibody can be one that binds CD20 or a different B cell antigen, or a NK or T cel] antigen. In one embodiment, the second antibody is a radiolabeled anti-CL20 antibody. In other embodiments, the CD20 binding antibody is conjugated to a cytotoxic agent including a toxin or a 20 radioactive isotope. In another aspect, the invention provides a method of treating an autoimmune disease selected from the group consisting of Dermatomyositis, Wegner's granulomatosis, ANCA, Aplastic anemia, Autoimmune hemolytic anemia (AIlA), factor VRI deficiency, hemophilia A, Autoimmune neutropenia, Casdemans syndrome. Goodpasture's syndrome, solid organ transplant rejection, g dft versus host disease (CVH4,D), IgM 25 mediated. thrombotic thrombocytopenic purpura (TTP), Hashimoto's Thyruiditis, autoirimune hepattis. lymphoid interstitial pneumonitis (HIV), bronchiolitis obliterans (non-transplant) vs, NSIP, GuillainBarre Syndrome, large vessel vasculitis, giant cell (Takayasu's) a3teritis, medium vessel vasculitis, Kawasaki's Disease, polyarteritis nodosa, comprising administering to a patient suffering from the disease, a therapeutically effective amount of a CD20 binding antibody. Tn one embodiment of this method, the CD20 30 binding antibody is Rituxan@. The invention also provides ao isolated nucleic acid comprising the nuckotide sequence of SEQ ID NO.: 24 of tie Cynomolgus monkey CD20 (shown in C10. 19), or a degenerate variant of this sequence. One embodiment is an isolated nucleic acid comprising a sequence that encodes a polypeptide with the omnino acid sequence of SEQ ID NO. 25 (shown PIG, 20), or SEQ ID NO, 25 (FIG. 20) with conservative 35 amino acid substitutions. Another embodiment is a vector comprising the preceding nucleic acid, including an expression vector for expression in a host cell, Included as well is a host cell comprising the vector. Also provided is an isolated polypeptide comprising the amino acid sequence fSEQ TD NO. 25; FTGi. 20) of the Cynomnolgus monkey CD2O. 40 BRIEF DESCRIPTION OF THE FIGURES FIG. IA is a sequence di ignment comparing the amino acid sequences of the light chain variable domain (VL) of each of murine 2H7 (SEQ ID NO, huomanized 2H7. v16 variant (SEQ ID NO. 2 ), and human kappa lightchain subg roup (SEQ ID NO. 3). The CDRs of Yr.of 2H7 and hu2H-i7.v16 are as follows: CDR] (SEQ ID NO,4), CDR2 (SEQ ID NO.5 ), and CDR3 (SEQ I) NO.6). 5 E 6!167 RCVD AT 4/62005 2:48:59 PM [Eastern Daylight Time] SVR:USPTO-EFXRIFii26 *DNIS:27308271 CSID:650 952 9881 *DURATION (mmess):24.56 -PEA/US 13 JUL2004 Attorney Docket No. PI990IR3 5 FIG. JB is a sequence alignment which compares the VH sequences of urine 217 (SEQ ID NO. 7), humanized 2H7.v 16 variant (SEQ ID NO. 8), and the human consensus sequence of heavy chain subgroup Il (SEQ TID NO. 9). The CDRs of Vil of 2F37 and hu2T7.v16 are as follow: CDR I(SEQ ID NO.10), CDR2 (SEQ ID NO1111). and CDR3 (SEQ I) NOJ12). Tn FIG. I A and FIG. I B, the CDR 1, CDR2 and CDR3 in each chain are enclosed within brackets, 10 flanked by the frame work regions. FRI -PFR4, as indicated. 2H7 refers to the murinc 21J7 antibody. The asterisks in between two rows of sequences indicate the positions that ar different between the two sequences. Residue numbering is according to Kabat et al, Sequences of Immunological Interest. 5th Ed. Public Health Service, National Institutes of Health, Bethesda, Md. (1991), with insertions shown as a. b, e, d, and c. 15 FIG. 2 shows the sequence of phagemid pVX4 (SEQ M NO.13) used for construction of 2H7 Pab plasmids (see Example 1) as well as the amino acid sequences of the L chain (SEQ ID NO.] 4) and H chain (SEQ ID NO. 15) of the Fab for the CDR-grafted anti-LFN-c humanized antibody. FIG, 3 shows the sequence of the expression plastid which encodes the chimeric 2H7-v6.8 Fab (SEQ ID NO.16). The amino acid sequences of the L chain (SEQ ID NO17) and H chain (SEQ TD NO18) 20 are shown, 11 , 4 shows the sequence of the plasmid pDR1 (SEQ 1D NO.19; 5391 bp) for expression of irmunoglobulin light chains as desribed in Example 1. p.DI contains sequences encoding an relevant antibody, the light chain of a humanized anti-CD3 antibody (Shalably et al, I. Exp. Med, 175: 217-225 (1992)), the start and stop codons for which arc indicated in bold and underlined, 2.9 FIG. 5 shows the sequence of plasmid pDR 2 (SEQ TD NO-20t 6135 bp) for expression of immunoglobulin heavy chains as described in Example I. pDR2 contains sequences encoding an irrelevant antibody, the heavy chain of a humanized anti-C3 antibody (Shalaby et al, supra), the start and stop codons for which are indicated in bold and underlined. FIG. 6 shows the amino acid sequence of the 2H7.v16 complete L chain (SEQ ID NO.21). The 30 first 19 amimo acids before DIQ are the secretary signal sequence not present in the mature polypeptide chain. FiG. 7 shows the amino acid sequence of the 2H7.v16 complete H chain (SEQ 1D NO.22). The first 19 amino acids before BVQ before are the secretary signal seuence not present in the mature polypeptide chain. Aligning the V 11 sequence in FIG. 'B (SEQ1 ID NO. 8) with the complete H chain 35 sequence, the human yi constant region is from amino acid position, 114471 in SEQ ID NO. 22. PIG. 8 shows the amino acid sequence of the 2H7.v31 complete H chain (SEQ T) NO.23)- The first 19 amino acids before EVQ before are tie secretory signal sequence not present in the mtarure polypeptide chain. Yne iL chain is the same as for 2H7.v 16 (sec FIG. 6). FIG. 9 shows the relative stability of 2H7.v16 and 217,v73 IgG variants as described in Example 6. 40 Assay results wcre normalized to the values prior to incubation and reported as percent remaining after incubation. FIG. 10 is a flow chart summarizing the amino acid changes from the murinc 2H7 to a subset of humanized versions up to v75. 'E 7167 *RCVD AT 41262005 2:48:59 PM [Eastern Dalight Time]*SVR:USPTOEFXRF1126 DNIS:27308271 CSID:650 952 9881 *DURATION (mm-ss):2456 A torney Docket No. P I 990R3 S FIG. I is summary of mean absolute B-cell count FCD3-/CD40+J in a1 groups (2H7 tudy and R ituxan study combined), as described in Example 10, FIG. 2 shows the results of a representarive ADCC assay on fucose deficient 21-17 variants as described in Example 11. FIG. 13 shows the results of the Annexiln V staining plotted as a function of antibody concentration. 10I) R amos Cells were treated with an irrelevant IgGI controA antibody (Herceptin@; circles), Rimuinmab (squares). or rhuMAb 2H7.v I6 (trianglecs) in the presence of a crosslinking secondary antibody and were analyzed by FACS. Figures 13-15 are described in Example 13. FIG. 14 shows the results of the Annexin V and propidium iodida doubic-Xstainiog are plotted as a function of antibody concentration. Ramos cells were treated with an irrelevant IgG1 control antibody 15 (Hereprin@; circles), Ritaximab (squares), or rhuMAb 2H7.v16 (triangles) in the pgrsence of a crosslinking secondary antibody and were analyzed by FACS, FIG. 15 shows the counts (per 10 4) of live, unstained cells are plotted as a function of antibody concentration. Ramos cells were treated with an irrelevant igGl control antibody (H3erceptin@; circles), Rituximab (squares), or rhuMAb 2H7-v1 6 (triangles) in the presence of a crosslinking secondary antibody 20 and were analyzed by FACS. lHGs. 16. 17, 18 show inhibition of Raji cell tumor growth in nudc mice, as described in Example 14. Anials were treated weekly (as indicated by vertical arrows; o=8 mice per group) for 6 weeks with PB3S (control) or with Rituxan@> or rhuMAb 2H7.v 16 at 5 mg/kg (FIG. 16), 0.5 mg/kg (FIG. 17), or 0.05 mg/kg (FIG. 18). 25 FIG. 19 shows the nucleotide (SEQ ID NO. 24 ) and amino acid (SEQ ID NO. 25 ) sequences of Cynomolgus monkey CD20, a: described in Example 15. FIG. 20 shows the arrino acid sequence for cynomolgus monkey (T)20 (SEQ ID NO. 25). Residues that differ front hunan CD20 are underlined and the human residues (SEQ TD NO. 26) are indicated directly below the monkey residue. The putative extracellular domain of the monkey CD20 is in bold type. 30 FIG. 21 shows the results of Cyromnolgus monkey cells expressing CD20 binding to hu2T7.vl 6, .v3 1, ind Rhntan, as described in lExample 15. The anibodics wcr an't-yad for the ability to bind and displace FITC-conjugated murine 2H17 binding to cynomolgus CD20. FIG. 22 shows dose escalation schema for rheumatoid arthritis Phase I/i clinical trial. FIG. 23 shows the vector for expression of 2171 6 in CHO cells. 33 DETAILED DESCRIPTION OF TH E PREFERRED EMBOD1MENTS The "C.D20" antigen is a non-glycosylated, transraembrane phosphoprotein with a molecular weight of approximately 35 kD that is found on the surface of greater than 90% of Bf cells from peripheral blood or ly mphoid organs. )CD20 is expressed during early pre-B cell development and remains until plasma cell 40 differentiation; it is not found on human stem cells, lymphoid progenitor cells or normal phisma cells. (1)20 is present on both normal B cells as well as malignant B cells, Other names for CD20 in the literature include "B-iymphocyte-restricted differentiation antigen" and "Bp35' The CD20 antigen is described in, for example, Clark and Ledbetter, Adv Cwar R~es, 52:811449 (1989) and Valentine et al , Biot Chem. 264(19):1 12F2-1 1287 (1989). 8167 RCVD AT 412612005 2:48:59 PM [Eastem Daylight TmeI SVR:USPTO.EFXRF-iI26 DNIS:27308271 CSID:650 952 9881 DURATION (n.ss):24-56 Attorney Docket No, P I 990R3 13 JUL2004 5 The term "antibody" is used in the broadest scnse and specifically covers monoclonal antibodies (including full length monoclonal antibodies) murltispecific antibodies (e.g. bispecific antibodies), and antibody fragments so long as thcy exhibit the desired biological activity or function. The biological activity of th.e CD20 binding and humanized CD20 binding antibodies of the invention will include at least binding of the antibody to human CD20, more preferably binding to human 10 and othcr primate CD20 (including cynromolgus monkey, rhesus monkey, chimpanzees), The antibodies would bind CD20 with a Kd value of no higher than I x 10-8 preferably a lK value no higher than about I x 10-, and be able to kill or deplete B cells in vivo, preferably by at least 20% when compared to the appropriate negative control which is not treated with such an antibody. R cell depletion can be a result of one or more of ADCC, CDC, apoptosis, or other mechanism. In some embodiments of disease treatment '15 herein, specific effector functions or mechanisms may he desired over others and certain variants of the humanized 2H7 are preferred to achieve those biological functions, such as ADCC. "Antibody fragments" comprise a portion of a full length antibody, generally the antigen binding or variable region thercof . Examples of antibody fragments include Fab. Fab' F(ab')2, and Fv fragments; diabodies; linear antibodies: single-chain antibody molecules: and multispecific antibodies formed from 20 antibody fragments. "Fv" is the minimum antibody fragment which contains a complete antigen-recognition and binding site, This fragment consists of a dimer of one heavy- and one light-chain variable region domain in tight, noncovalent association. From the folding of these two domains emanate six hypervariable loops (3 loops each from the H and L chain) that contribute the amino acid residues for antigen binding and confer 25 antigen binding specificity to the antibody. However, even a single ariable domain (or half of an Fv comprising only three CDRs specific for an antigen) has the ability to recognize and bind antigen, although at a lower affinity than the entire binding site. The term "ronoclonal antibody" as used herein refers to an antibody obtained from a population of substanti ally homogeneous antibodies, ie, the individual antibodies comprising the population are identical 30 except for possible naturally occurring mutations that may be present in minor amounts. Monoclonal ant ibodies are highly specific, being directed against a single antigcnic ste. Furthermore, in conrast To conventional polyclonall) antibody preparations which typically include different antibodies directed against different determinants (epitopes), each monoclonal antibody is directed against a single determninant on the antigen. The modifier "monoclonal" indicates the character of the anybody as being obtained from a 35 substantially homogencous population of antibodies, and is not to be construed as requiring production of the antibody by any particular methxd. For example, the monoclonal antibodies to be used in accordance with the present invention may he made by the hybridorma method first described by Kohler et 01, Nature 256:495 (1975), or may be made by recombinant DNA methods (see, e.g., U.S. Patent No. 4,816,567). The "m tonocional antibodies" may also be isolated from phage antibody libraries using the techniques described 40 in Clackson er af, Nature 352:624-628 (1991) and Marks et aL, J. Mol Biol. 222:581-597 (1991), for eoampie. 'Fvnctional fragments" of the CD20 binding antibodies of the invention are those fragments that retain binding to CD20 with substantially the same affinity as the intact full length molecule from which 8 9167 RCVD AT 4126120052:48:59 PMEastern Daylight Time ISVR:USPTO.EFXRFM-126 DNIS:2730827 C8ID:650 9529881 DURATION mm-ss):24-56 OZV W I J-JULZU04 Attorney Docket No. P1990R3 5 they are derived and show biological activity including depleting B cells as measured by in viro or in vivo assays such as those described herein. The term "variable" refers to the fact that certain segments of the variable doma ins difibr extensively in sequence among antibodies. The V domain mediates antigen binding and define specificity of a particular antibody for its particular antigen, However, the variability is not evenly distributed across the J0 1 10-amino acid span of the variable domains. Instead, the V regions consist of relatively invariant stretches called framework regions (FRs) of 15-30 amino acids separated by shorter regions of extreme variability called "hypervariable regions" that are each 9-12 amino acids long. The variable domains of native heavy and light chains each comprise four FRs, largely adopting a p-sheet configuration, connected by three hypervariable regions, which form loops connecing, and in some cases forming part of, the -sheet 15 structure. The hypervariable regions in each chain are held together in close proximity by the FRs and, with the hypervariable regions from the other chain, contribute to the formation of the antigen-binding site of antibodies (see Kabat et at, Seauences of Proteins of 1munological Interest. 5th Ed. Public Health Service, National Institutes of Health, Bethesda, MD. (1991)). The constant domains are not involved directly in binding an antibody to an antigen, but exhibit various effector functions, such as pardcipation of the 20 antibody in antibody dependent cellular cytotoxicity (ADCC), The term "hypervariable region" when used herein refers to the amino acid residues of an antibody which arm responsible for andgen-binding. The hypervariabTe region generally comprises amino acid residues from a "complemen~arity determining region" or "CDR" (e.g. around about residues 24-34 (L1), 90-56 (L2) and 89-97 tL3) in the V_, and around about 31-35B (11), 50-65 (H2) and 95-102 (H3) in the V1 25 (Kabat et a, Seguences of Proteins of Immunological IntereS 5th Ed. Public Heath Service. National listitotes of Health, Bethesda, MD. (1991)) and/or those residues from a "hypervariable loop" (e.g. residues 26-32 (11), 50-52 (L2) and 91-96 (L3) in the VL, and 26-32 (HI), 52A-55 (H2) and 96-101 (H3) in tie Vn (Chothia and Lesk I Mol. Bio . 196:901-917 (1987)). As referred to herein, the "consensus sequence" or consensus V domain sequence is an artificial 30 sequence derived from a comparison of the amino acid sequences of known human immunoglobulin variable region sequences. Based on these comparisons, recombinant nucleic acid sequences encoding the V domain amino acids that are a consensus of the sequences derived from. the human it and the human H chain subgroup IIT V domains were prepared. The consensus V sequence does not have any known antibody binding specificity or affinity. 35 "Chimeric" antibodies (ininunoglobulins) have a portion of the heavy and/or light chain identicaI with or homologous to corresponding sequences in antibodies derived from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chain(s) is identical with or homologous to corresponding sequences in antibodies derived from another species or belonging to another antibody class or subclass, as well as frag ments of such antibodies, so long as they exlbibit the desired biological 40 activity (UA Patent No, 4,816,567: and Morrison el al, Proc. -aft Acad Sci. USA 81;6851-6855 (1984)). HIuxnanized antibody as used herein is a subset of chimerie antibodies. "Humanized" forms of non-human (e.g, murine) antibodies are chimeric antibodies which contain minimal sequence derived from non-human immunoglobulin. For the most part, humanized antibodies are 9 AWNDED SE2T '01l671R0DAT 4126120052:48:59PMI[Eastem Daylight iie]*SVR:USPT0-EFXRN/li26'DNIS:2730827*0SID:6509529881 I DRATION (mss):206 ---- --- --- o w * - ' Attorney Docket No, P1990R3 3 JUL 2004 5 hinan immunoglobulins (recipient or acceptor antibody) in which hypervariable region residues of thte recipient are replaced by hypervariable region residues from a non-human species (donor antibody) such as mouse, rat, rabbit or nonhunian primate having the desired specificity, affinity, and capacity. In some instances, Fv framework region (FR) residues of the hurfan immunoglobulin are replaced by corresponding non-human residues. Furthermore, humanized antibodies may comprise reidnes which are not found in the 10 recipient antibody or in the donor antibody. These modifications are made to further refine antibody perfomance such as binding affinity. Generally, the humanized antibody will comprise substantially all of at least onc, and typically two, variable dominns, in which al or substantially all of1the hypervariable loops correspond to those of a non-human immunoglobulin and all or substantially all of the FR regions are those of a human imunoglobulin sequence although the FR regions may include one or more amino acid 15 substitutions lhat improve binding affinity. The number of these amino acid substitutions in the PR are typicaly no mre than 6 in the H chain, and in the L chain, no more than 3. The humianized antibody optionally alo will comprise at least a portion of an imunoglobulin constant region (Fe), typically tbaT of a human immunoglobulin. Fur further details, see Jones t al., Nature 321:522~525 (1986); Reichrmann et aL, Nature 332:323-329 (1988); and Presta, Curr, Op. Struct Biot 2:593-596 (1992), 20 Antibody effectorr functions" refer to those biological activities attributable to the Fe region (a native sequence Fe region or amino acid sequence variant Fc region) of an antibody, and vary with the antibody isotype. Examples of antibody effector functions include: Clq binding and complement dependent cytotoxicity; Fe receptor binding: antibody-dependnrt cell-mediated cytotoxicity (ADCC); phagocytosis; down regulation of cell surface receptors (e.g. B cell receptor); and B cell activation. 25 "Antibody-dependent ecliamediated cytotoxicity" or "ADCC" refers to a form of cytotoxicity in which secreted Ig bound onto Fc receptors (FcRs) present on certain cytotoxic cells (e.g. Natural Killer (NK) cells, neutrophils. and macrophages) enable these cytotoxic effector cells to bind specifically to an antigen haring target cell and subsequently kill the target ccil with cytotoxins. The antibodies "arm" the cytotoxic cels and are absolutely required for such killing. The primary cellk for mediating ADCC, NK cells, express 30 Pe:ylRTTX only, whereas monocytes express FeyRI, FeyRHT and FyRTI. FeR expression on hematopoictic cells is summarized in Table 3 on page 464 of Ravetch and Kinet, Arm& Rev. Inmulnol 9:457-92 (1991). To assess ADCC activity of a molecule of interest, an in viro ADCC assay, such as that described in US Patent No. 5,500.362 or 5,821,337 may be performed. Useful effetor cells for such assays include peripheral blood nononuclear cells (PBMC) and Natural Killer (NK) cells. Alternatively, or additionally, ADCC 35 activity of the molecule of interest may be assessedd ir viVO. e.g. in a animal model such as that disclosed in Clynes ei if PiAS (USA) 95:652-656 (1998), "1c receptor" or "FcR" describes a receptor that binds to the Fc region of an antibody. The preferred pcR is a ative sequence human FcR. Moreover, a preferred FeR is one which binds an IgC3 antibody (a gamma receptor) and includes receptors of the FeyRI, FeqRU, and FeqRITI subclasses, including 40 allClic variants and alternatively spliced forms of these receptors. FoyRU receptors include FeyRIA (an actvating receptor") and PcyRlIB (an "inhibiting receptor"), which have similar amino acid sequences that differ primarily in the cytoplasmice domnains thereof. Activating receptor FeytlA contains an immnunoreceptor tyrosine-based activation motif (ITAM) in its cytoplasmic domain, Inhibiting receptor FeylRT-iB contains an immunoreceptor tyrosine-based inhibiton motif (TM) in its cytoplasmic domain. (see 10 196i7 RCVD AT 4/26J20052:48:59 PM[EastermDaylight Timej SVR:USPTD-EFXRF-2J26*DNIS:2730827*0SID:65O 952~881 *DURAT10N mm~ss):24456 F S 13 JUL 2004 Attorney Docker No. P1990R3 5 review M. in Daeron, Annu. Rev. ImmnoL 15:203-234 (1997)). FeRs are viewed in Ravetch and Kinet, Annu, Rev. Immun l 9:457-92 (1991); Capl er a , )munomethds 4:25-34 (l994); and de 4)as er a, I. Lab. CPW, Med. 126:330-41 (1995). Other EcRs, including those to be identified in the future, arc encompassed by the term "FcR" herein, The tcrm also includes the nconatnl receptor, FcRn, which is responsible for the transfer of maternal IgGs to the fetus (Guyer et aL, hLIriol, 117:587 (1976) and Kim 10( et at J. imunWo. 24:249 (1994)). WOOO/42072 (Phresta) describes antibody variants with improved or diminished binding to FoRs. 'The content of that patent publication is specifically incorporated herein by reference. See, also, Shields et at. .1 Biot Chem. 9(2): 6591-6604 (200 ). "Human effector cels" are leukocytes which express one or more FcRs and perform effector 15 functions. Prefembly, the cells express at least FeyRRil and perfbrm ADCC effector function. Examples of human leukocytes which mediate ADCC include peripheral blood mononuclear cells (P.BMC), natural killer (NK) cells, monocytes, cytotoxic T cells and neutrophils; with PBMCs and NK cells being preferred. The effector cells may be isolated frmm a native source, eg. ftom blood. "Complement dependent cytotoxicity" or "CDC" refers to the lysis of a target cell in the presence 2() of complenct. Activation of the classical complement pathway is initiated by the binding of the first component of the complement system (Cl q) to antibodies (of the appropriate subclass) which are bound to their cognate antigen. To assess complement activation, a CDC assay, e.g. as described in Gazzano-Santoro el at., J. lmmrwioL Methods 202:163 (1996), may be performed. Polypeptide variants with altered Pc region amino acid seguonccs and increased or decreased CIq 25 binding capability are described in US patent No. 6,194,5511 nod W099/51642. The contents of those patent publications arc specifically incorporated herein by reference. See, also, Idusogc er a. J. Immunol. 164- 41784;84 (2000). The N-glycosylation site in IgG is at Asn297 in the CH2 domain. The present invention also provides compositions of a CD20-binding, humanized antibody having a F region, wherein about 8-1001% 301 (and preferably about 90~99%) of the antibody in the composition comprises a mature core carbohydrato tructume which luoks fucoa, attacd to the Fc region of the glycoprotein. Such composition were demonstrated herein to exhibit a surprising improvement in binding to FcyRTtA(F1 58), which is not as effective as FeyRITIA (V158) in interacting with human Iga Thus, the compositions herein are anticipated to be superior to previously described anti-CD20 antibody compositions, especially for therapy of humne 35 patients who express FcyRIA (F158). FcyRTIA (F158) is more common than FoyRJIIA (V158) in normal, healthy African Americans and Caucasians. See Lchmbcher e, a'. Blood 94:4.220 (1999). The present application further demonstrates the synergistic increase in Fey'RITI binding and/or ADCC function Iha results from combining the glycosylation variations herein with amino acid sequence modification(s) in the Fe region of the glycoproteimn 40 An "isolated" antibody is one which has been identified and separated and/or recovered from a component of its natural environment Contaminant components of its natural environment arc materials which would interfere with diagnostic or therapeutic uses for the antibody, and may include enzymes, hormones, and other proteinaceous or nonproteinaceous solutes. in preferred embodiments, the antibody will be purified (1) to greater than 95% by weight of antibody as determined by the Lowry method, and most i1 AM2[EDTSH2 T 1W671 RCVD AT 4,!2612005 2:48:59Phil[EastemnDaylight Time]*ISVRUSPT0-EXRIF4126 DNIS:2730827*0810:6509529881 *DURATION (mm.ss):24-56 rJ JQ 1- L J LU U4 Attorney Docket No. P1990R3 $ prferahly more than 99% by weight, (2) to a degree sufficient to obtain at least 15 residues of N-terminal or internal amino acid sequence by use of a spinning cup sequenator, or (3) to homogeneity by SDS-PAGE under reducing or nonreducing conditions using Coomnassie blue or, preferably, silver stain, Isolated antibody includes the antibody in situ within recombinant cells since at least one component of the atibody's natural environment will not be present Ordinarily, however, isolated antibody wil be prepared 0 by at least one purification step. An "isolated" nucleic acid molecule is a nucleic acid molecule that is identified and separated from at least one contaminant nucleic acid molecule with which it is ordinarily associated in the natural source of the antibody nucleic acid. An isolated nucleic acid molecule is other than in the form or setting in which it is found in nature. Isolated nucleic acid molecules therefore are distinguished from the nucleic acid molecule 15 as it exists in natural cells. However, an isolated nucleic acid molecule includes a nucleic acid molecule contained in cells that ordinarily express the antibody where, for example, the nucleic acid molecule is in a chronosonal location different from that of natural cells, The expression "cononi sequences" refers to DINA sequences necessary for the expression of an operably linked coding sequence in a particular host organism. The control sequences that are suitable for 20 prokaryotes, for example, include a promoter, optionally an operator sequence, and a ribosorne binding sire. Eukaryotic cells are known to utilize promoters. polyadenyation signals, and enbaocers. Nucleic acid is "operably linked" when it is placed into a functional relationship with another nucleic acid sequence. For example, DNA for a presequcnce or secretory leader is operably linked to DNA For a polypeptide if it is expressed as a preprotein that participates in the secretion of the polypeptide; a 25 promoter orenhancer is operably linked to a coding sequence if it affects the transcription of the sequence; or a ribosome binding site is operably linked to a coding sequence if it is positioned so as to facitate translation. Generally. "operably linked" means that the DNA sequences being linked are contiguous, and. in the case of a secretory leader, contiguous and in reading phase. However, enhancers do not have to be contguous. Linking is accomplished by ligation at convenient restrion on sites, if such sites do not exist, the 30 synthetic oligonucleotide adaptors or linkers are used in accordance with conventional practice. "Veetr" includes shtle and expresdson vectors. Typically, the plasmid construct wil lm include an origin of replication (etg, the ColB1 origin of replication) and a selectable marker (e,g- ampicillin or teracycline resistance), for replication and selection, respectively, of the plismids in bacteria. An "expression vector" refers to a vector that contains the necessary control sequences or regulatory elements 35 for expression of the antibodies including antibody fragment of the invention, in bacterial or eukaryotic cells. Suitable vectors are disclosed below. The cell that produces a bumanized CD20 binding antibody of the invention will include the bacterial and eukaryotic host cells into which nucleic acid encoding the antibodies have been introduced. Suitable host Cells are disclosed below. 40 The word "label" when used herein refers to a detetable compound or composition which is conjugated directly or indirectly to the antibody. The label may itself be detectable by itself (e.g, radioisotope labels or fluorescent labels) or, in the case of an enzymatic label, may catalyze chemical altermion of a substrate compound or composition which is detectable, 12 6MAE S E ET E 1316P RCVD AT 412612005 2:48:59 Phl Eastemn aylight Time] SVR:USPTO-FXRF-il26* DNIS:273082P1 CSID:650 952 9881 'DURATI0N (mm-ss):24-56 1PEA/US 1 3 JUL 2004 Attorney Docket No. P1990R3 5 An "autoimmune disease" herein is a non-npaignant disease or disorder arising from and directed against an individual's own (self) antigens and/or tissues. As used herein, "B cell depletion" refers to a reduction in B cell levels in an animal or human after drug or antibody treatment, as compared to the 13 cell level before treatment. B cell levels are measurable using well known assays such as those described ir the Experimental Examples. B cell depiction can be 10 complete or partial. In one embodimcnt, the depletion of CD20 expressing B cells is at least 25%. Not to he limited by any one mechanism, possible mechanisms of B-cell depletion include ADCC, CDC, apoptosis, modulation of calcium flux or a combination of two or more of the preceding. The term "cytotoxic agent" as used herein refers to a substance that inhibits or prevents the function of cells and/or causes destruction of cells. The ter is intended to include radioactive isotopes (e.g., 1's' 15 T'", Y and Re'), chemotherapeutic agents, and toxins such as enzymatically active toxins of bacterial, fungal, plant or animal origin, or -fragments thercof. A "chemotherapeutic agent" is a chemical compound useful in the treatment of cancer. Exampics of chemotherapeutic agents include alkalyzing or alkylating agents such as thiotepa and cyclosphospharnide (CYTOXANM); alkyl sulfonates such as busulfan, improsulfan and piposulfan; aziridines such as 20 henzodopa, carboquone, meturadopa, and uredopa; ethylenimincs and methylamelamines including altratamine, triethylenemelaminc, trictylenephosphoramide, triethylenethiophosphaoramide and trimethtyloiomelamine; nitrogen mustards such as chloramabucil, chlomaphazine, cholophosphamide, estrantustine, ifosfamide, mechlorethamine, mechlorethamine oxide hydrochloride, melphalan, novembichin, phenesterine, prednimustine, trofbsfamide, uracil mustard; nitrosureas such as carMustine, chlorozotocin, 25 foremustine, loniustine, nimustite, ranirnustinc; antibiotics such as aclacinomysins, actinomycin, authramycin, azaserine, bloornycins, cactinomycin, calicheamicin, carabicin. carninomycin, carzinophilin, chromomnycins, dactinomyCin, daunorubicin, detorubicin, 6-diazo-5-oxcn-tnorleucine, doxorubicin (Adriamnycin), epirubicin, esorubicin, idarubicin, marcollomycin, mitomycins, mycophenolic acid, nogalamycin, olivomycins, pepiomycin, potfiromycin, tpuromycin, quelarnycin, modorubicin, streptonigrin, 30 streptuzocin, tubercidin, ubenimex, zinostatin, zorubicin; anti-metaboites such as methotrexate and 5 fluomuracil (5-FU); folic acid analogues such as denopterin, methotrexate, pteropterin, trimetrexate; purine analogs such as fludarabine, 6-niercaptopurine, thiamniprine, thioguanine; pyrimidinc analogs Such as ancitabinc, azacitidine, 6-azauridine, carmofur, cytarabine, dideoxyuridinc, doxifluridine, enocitabine, floxuridine, 5-FU; androgens such as calusterone, dromostatolone propionate. epitiostanol, mepitiostane, 35 testolactone; anti-adrenals such as axminoglutethinide, mitotane, trilostane; folic acid replenisher such as frolinic acid; aceglatone; aldophosphamide glycoside; aminolevulinic acid; amsacrine; bestrabucil; bisantrene: edatraxate; defofam ine; dernecolcine; diaziquone; elfornithine; elli ptiniurn acetate; eroglucid; galum nitrate; hydroxytua; lentinan; lonidamine; titoguazone; mitoxantrone: mopidamoL nitracrine; pantostatin; phenamet; pirarubicin; podophyllinic acid; 2-ethyihydrazide; procarbazinc; PSK®; razoxane; 40 si:ofiran; spirogernmnium; tenuazonic acid; triaziquone; 2, 2,2"-trichlorotriethylamine: uretlan; vindesine; dacarbi ne; manoomustine; nmitobroxito; omitolactol: pipobroman; gacytosine; arabinoside ("Ara-C") thliotepa; taxoids, e.g. paclitaxel (TAXOL*, Bristol-Myers Squibb Oncology, Princeton, NJ) and doxetaxel (TAXOTER' ', RhOne-Poulene Rorer, Antony, France); cloraubucii; gemcitabine; 6-thioguanine; mecaptopurine; methotrexate; platinum analogs such as cisplatin and carboplatin; platinum; etoposide (VP 13 AM9E DP9T 141671R0VDAT412612005 2:48:59 PM[jEastemnDaylight Time] ISVR:USPTO-EXRF-il26 *DNIS:2730827*0810D:650 952 9881 1 DURATION (mm-ss):2446 Attorney Docket No. Pi990R3 3 JUL20Q4 5 16); ifosfamide; miromycin C: mioxantrone; Vincristine; vinbiastine; vinorclbine; navelbine; novantrone; toniposide; daunomycin; aminpteria xcloda; ibandronate; CPT-1 3 topoisoerase inhibitor RFS 2(00; difluoromethylornithine (DMFO); retinoic acid; esperamicins; Capeciabine; and pharmaceutically acceptable salts, acids or derivatives of any of the above. Also included in this definition are anti-hormonal agents that act to regulate or inhibit hormone action on tumors such as anti-estrogens including for example 10 tamoxifen, raoxifene. aromnatase iohibiting 4(5)-inidazoles, 4 -hydroxytamoxifen, trioxifene, keoxifene, LY] 17018, onapristone, and toremrnifene (Fareston); anti-androgens such as flutamide, nilutamide, bicalutamidc, leuprolide, and goserelin; other chermothemapeutic agents such as prednisolone. Pharmacentically acceptable salts, acids or derivatives of any of the above are included. "Treting" or "treanent" or "alleviation" refers to both therapeutic treatment and prophylactic or )5 preventative measures, wherein the object is to prevent or slow down (Icssen) the targeted pathologic condition or disorder. A subject is successfully "treated" for a CD20 positive cancer or an autoimnmuone disease if, after receiving a therapeutic amount of a CD20 binding antibody of the invention according to the methods of the present invention, the subject shows observable and/or measurable reduction in or absence of one or more signs and symptoms of the particular disease. For example, for cancer, reduction in the number 20 of cancr cells or absence of the cancer cells: reduction in the tumor size; inhibition (Le., slow to some extent and preferably stap) of tumor metastasis; inhibition, to some extent, of tumor growth; increase in length of remission, and/or relief to some extent, one or more of the symptoms associated with the specific cancer; reduced morbidity and mortality, and improvement in quality of life issues. Reduction of the signs or symptoms of a disease may also be felt by the patient. Treatment can achieve a complete response,. 25 defined as disappearance of all signs of cancer, or a partial response, wherein the size of the tumor is decreased, preferably by more than 50 percent, more preferably by 75%. A patient is also considered treated if the patient experiences stable disease. In a preferred embodiment, the cancer patients are still progression-free in the cancer after one year, preferably after 15 months, 'These parameters for assessing successful treatment and improvement in the disease are readily measurable by routine procedures familiar 31) to a physician of appropriate skill in the art. A teerpeuticaly ffective amount" refers to an amount of an anIbody or a drug cffctive to "treat" a disease or disorder in a subject. In the case of cancer, the therapeutically effective amount of the drug may reduce the number of cancer cells; reduce the tumor size; inhib (i.e. slow to some extent and preferably stop) cancer cell infiltration into peripheral organs; inhibit (i.e, slow to some extent and 35 preferably stop) tumor metastasis; inhibit, to some extent tumor growth; and/or relieve to some extent One or more of the symptoms associated with the cancer. See preceding definition of "treating" "Chronic" administration refers to administration of the agent(s) in a continuous mode as opposed to an acute mode, so as to maintain the initial therapeutic effect (activity) for an extended period of time, "Tntcrmittent" administration is treatment that is not consecutively done without interruption, but rather is 40 cyclic in nature. Composifions and Methods of the Invention The invention provides humanized antibodies that bind human CD20, and preferably other pd';nsate CD20 as well, comprising a 11 Chain having at least one, preferably two or all of the T chain CDRs of a non 14 E 1516*RCVD AT 4120/2005 2:48:59 PM Eastern Dayiight Time]' SVR:USPTO-EFXRF.1(26*DNIS:2730827 C0SID:650 9529881 DURATION (mm-ss):24-56 Attorney Docket No. P1990R3 13 JUL2004 5 hunan species anti--human CD20 antibody (donor antibody), and substantialy all of the framework residues of a human consensus anybody as the recipient antibody, The donor antibody can be from various non human species including mouse, rat, guinea pig, goat, rabbit, horse, primate but most frequently will be a nurine antibody. "Substantially all" in this context is meant that the recipient FR regions in the humanized antibody may include one or more amino acid substitutions not originally present in the human consensus 10 FR sequence. These FR changes may comprise residues not found in the recipient or the donor antibody. Tn one embodiment, tie donor antibody is the murine 2H7 antibody, the V region including the CDR and FR sequences of each of the H and L chains of which are shown in FTG, IA and 1B, In a specific embodiment, the residues for the human Fab framework correspond to the consensus sequence of human V Subgroup I and of Vu subgroup III , these consensus sequences are shown in Figure 'A and Figure 1l, I5 respectively. The humanized 21-17 antibody of the invention will have at least one of the CDRs in the H chain of the marine donor antibody. In one embodiment, the humanized 2117 antibody that bids human CD20 comprises the CDRs of both the I1 and L chains of the donor antibody. In a fuil length antibody, the humanized CD20 binding antibody of the invention will comprise a humanized V domain joined to a C domain of a human immunogiobulin. In a preferred embodiment, the H 20 chai C region is ftom hurn IgO, preferably TgGl or igG3. The L chain C domain is preferably from human x chain, Unless indicated otherwise, a humanized 2H7 antibody version herein will have the V and C domain sequences of 2H17,v16 L chain (FIG. 6, SEQ I) NO, 21) and H chain (FIG 7., SBQ ID NO. 22) except at the positions of amino acid substitutions or changes indicated in the experimental examples below. 25 The humanized CD20 binding antibodies will bind at least human CD20 and preferably bind other primate CD20 such as that of monkeys including cynomolgus and rhesus monkeys, and chimpanzees. The sequence of the cynomuolgus monkey CD20 is disclosed in Example 15 and Figure 19 The biological activity of the CD20 binding antibodies and humanized CD20 finding antibodies of the invention will include at least binding of the antibody to human CD20, more preferably binding to 30 human and primate CD20 includingg cynomolgus monkey, rhesus monkey, chimpanzees), with a K% value of no higher than I x 1 0', preferably a K 4 value ,o higher than abut 1 x 1ot cvuo mne pwffevably a K value no higher than about 1 x 10-IQ and be able to kill or deplete B cells in vitro or in vivo, preferably by at least 20% when compared to the baseline level or appropriate negative control which is not treated with such an antibody. 35 The desired level of B cell depletion will depend on the disease, For the treatment of a CD20 positive cancer, it may be desirable to maximize the depletion of the B cells which are the target of the anti CD20 antibodies of the invention, Thus. for tle treatment of a CD20 positive B cIl neoplasm, it is desirable that the B cell depletion be sufficient to at least prevent progression of the disease which can be assessed by the physician of skill in the art, eg., by monitoring tumor growth (size), proliferation of the cancerous cell 40 type, metastasis, other signs and symptoms of the particular cancer. Preferably, the B cell depletion is sufficient to prevent progression f disease for at least 2 months, more preferably 3 months, even more preferably 4 months, more preferably 5 months. even more preferably 6 or more months. In even more preferred embodiments, the B cell depletion is sufficient to increase the time in remission by at least 6 months, more preferably 9 months, more preferably one year, more preferably 2 years, more preferably 3 15 -16167 RCVD AT 4125i2005 2:48:59 PM [Eastern Daylight Time] SVR:USPTO-EPXRFl26 t DNIS:27308271 CSID:650 952 9881 DURATION mm-ss):24.56 UFAN 13. JULZUO04i Attorney Docket No. P1990R3 5 years. even more preferably 5 or more years. In a most preferred embodiment. the B cell depletion is sufficient to cure the disease, In preferred embodiments. the B cell depletion in a cancer patient is at least about 75% and more preferably, 80%, 85%, 90%, 95% , 99% and even 10)% of the beeline level before treatment. For treatment of an autobfilune disease, it may be desirable to modulate the extent of B cell 10 depletion depending on the disease and/or the severity of the condition in the individual patient, by adjusting the dosage of CD20 binding antibody. Thus, 13 cell depletion can hur does not have to be complete. Or, total B cell depletion may be desired in initial treatment but in subsequent treatments, the dosage may be adjusted to achieve only partial depledon. In one embodiment, the B cell depletion is at least 20%, i.e,, 80% or less of CD20 positive B cells remain as compared to the baseline level before treatment. .3n other 15 embodiments, B cell depletion is 25%, 30%, 401%, 50%, 60%, 70% or greater. Preferably, the B cell depledon is sufficient to halt progression of the disease, more preferably to allviate the signs and symptoms of the particular disease under treatment, even more preferably to cure die disease. The invention also provides bispecific CD20 binding antibodies wherein one arm of the antibody has a humanized H and , chain of the humanized CD20 binding antibody of the invention, and the other arm 20 has V region binding specificity for a second antigen. In specific embodiments. the second antigen is selected from dite group consisting of CD3, CD64. CD32A, CD16, NKG2D or other NK activating ligands. In comparison with Rituxan (rituximab), v] 6 exhibits about 2 to 5 fold increased ADTCC potency , ~3.4 fold decreased CDC than Rituxan. 25 Antibody production Monocona antibodies Monoclonal antibodies may be made using the hybridoma method first described by Kohler er at, NJature, 256:495 (1975), or may be made by recombinant DNA methods (US. Patent No. 4,816,567). In the hybridoma method, a mouse or other appropriate host animal, such as a hamster, is 30 immunized as described above to elich lymphocytes that produce or are capable of producing antibodies that will specifically bind to the protein used for immunization. Alternatively, lymphocytes may be inrxxmized in virm. Aft-er immunization, lymphocytes are isolated and then fused with a myeloma cell line using a suitable fusing agent, such as polyethylene glycol, to form a hybridoma cell (Godliog, Monoclonal Antibodier Principies and Practice, pp.59-103 (Academic Press, 1986)). 359 The hybridoma cells thus prepared are seeded and grown in a suitable culture medium which medium preferably contains one or more substances that inhibit the growth or survival of the urfused, parental myeloma cells (also refcrod to as fusion partner). For example, if the parental myeloma cells lack the enzyme hypoxanthine guanine phosphoribosyl transferase (TIGPRT or HPRT), the selective culture medium for the hybridomas typically will include hypoxanthine, minopterin, and thymidine (HAT 40 medium), which substances prevent the growth of HGPRT-deficient cells. Preferred fusion partner myeloma cells are those that fuse efficiently, support stable highlcvcl production of antibody by the selected antibody-producing cells, and are sensitive to a selective medium that selects against the unfused parental cells. Preferred myeloma cell lines are mrine myeloma lines, such as those derived from MOPC-21 and MPC-l! mouse tumors available from the Salk Institute Ccll Distribution 16 AM D SEE8 E 17167*RCVD AT 4,21/2005 2:48:59 P214[EastemnDaylight TimeY SVR:USPTOEFXRF-il26'DNIS:2730827* C810:650 95290881 1*DURAION (mm-Ss):24-56 Attorney Docket No. P1990R3 5 Center, San Diego, California USA, and SP-2 and derivatives eg, X63-Ag8-653 cells available from the American Type Culture Collection, Rockville, Maryland USA. Human myelona and mouse-human hctromyclnma cell lincs also have bcen described for the production of human monoclonal antibodies (Kuzbor, . InmunoL, 133:3001 (1984): and Brmdeur et at, kfonoelori Anibody Producilon Techniqes and Applications, pp. 51-63 (Marcel Dekker, Inc,, New York, 1987)). 10 Culture medium in which hybridoma cells ate growing is assayed for production of monoclonal antibodies directed against the antigen. Preferably, the binding specificity of monoclonal anibodies produced by hybridoma cells is determined by inmunopreciphation or by an in virra hinding assay, such as radionimunoassay (RIA) or enzyme-lin.ked immunosorbent assay (iTSA). The binding affinity of the monoclonal antibody can, for example, be determined by the Scatchard 15 analysis described in Munson eral., AnaL Biochem., 107.220 (I980). Once hybridona cells that produce antibodies of the desired specificity, affinity, and/or activity are identified, the clones may be subcloned by limiting dilution procedures and grown by standard methods (Goding, Monoclonal Anmihdier; Principles and Pracic., pp.59-103 (Academic Press, 1986)). Suitable culture media for this purpose include, for example, D-MIIM or RPMI- 1640 medium. In addition, the 20 bybidoma cells may be grown in vivo as ascites tumors in an animal e.g, by i.p. injection of the Cells into mice. The monoclonal antibodies secreted by the subclones are suitably separated from the culture medium, ascites fluid. or scrum by conventional antibody purification procedures such as, for example, affinity chromatograsphy (e._, using protein A or protein G-Sepharose) or ion-exchange chromatography, 25 hydroxylapatite chromatography, gel eletrophoresis, dialysis, etc. DNA encoding die mnonoclonal antibodies is readily isolated and sequenced using conventional procedures (*eg., by using oligonucleotide probes that are capable of binding specifically to genes encoding the heavy and light chains of arine antibodies). The hybridoma cells serve as a preferred source of such DNA. Once isolated, the DNA may be placed into expression vectors, which are then transfected into host 30 cells such as E. coli cells, simian COS cells, Chinese Hamster Ovary (CHO) cells, or myelomna cells that do not otherwise produce antibody protein, to obtain the synthesis of monoclonal antibodies in the recombinant hst cells. Review articles on recombinant expression in bacteria of DNA encoding the antibody include Skcrra et aL, Curr. Opinion in InmnoL, 5:256-262 (1993) and PFlckthun, InmunoL Revs, 130:151-18 (1992). 35 In a further embodiment, monoclonal antibodies or antibody fragments can be isolated from antibody phage libraries generated msing the techniques described in McCafferty et al., Naurre 348:552-554 (1990). Clackson e a, Nature. 352:624-628 (1991) and Marks et aL . Mo . B1i1, 222:581-597 (1991) describe the isolation of marine and human antibodies, respecively, using phage libraries. Subsequent publications describe the production of high affinity (nM range) human antibodies by chain shuffling (Marks 40 er al, BiaTechnology, 10:779-783 (1992)), as well as combinatorial infection and in viv recombination as a strategy for constructing very large phage libraries (Waterhouse el al'. Nuc. Acidx Re s- 21:2265-2266 (1993)). TIms, these techniques are viable alternatives to traditional monoclonal antibody hybridoma techniques for isolation of moonocional antibodies, 17 8167R0VD AT 412612005 2:48:59 PI [Eastern Daylight Time] SVR:USPTO-EFXRF-1l26'DNIS:2730827 C810:650 52 9881 1DURATON (mm-ss):24-56 rt I I uQ V / U t L 'J Attorney Docket No. F I99OR3 3 JUL2004 3 The DNA that encodes the antibody may be modified to produce chimeric or fusion antibody polypeptides, for example, by substituting human heavy chain and light chain constant domain (Cj and C 1 ) sequences for the homologous murins sequences (11-. Patent No. 4,816,567; and Morrison, et at, Proc NalA cad. Sci. USA, 81:6851 (1984)). r by fusing the immunoglobulin coding sequence with all or part of the coding sequence for a non-inrunoglobuin polypeptide (heterologous polypeptide). The non 10 immunoglobulin polypepdde sequences can subsrtute for the constant domains of an antibody, or they are substituted for the variable domains of one antigen-combining site of an antibody to create a chimeric bivalent antibody comprising one andgcn-combining site having specificity for an antigen and another antigen-combining site having specificity for a different antigen. 1 5 Humanized antibodies Methods for humanizing non-human antibodies have been described in the art Preferably, a humanized antibody has one or more amino acid residues introduced into it from a source which is non human. These non-human amino acid residues are often referred to as "import" residues, which are typically taken from an "import" variable domain. Humanization can be essenially performed following the method 20 of Winter and co-workers (Jones er al, Nature, 321:522-525 (1986); Reichmann er at, Nature, 332:323-327 (1988): Verhocycon et al, Science, 239:1534-1536 (1988)), by substituting hypervariable region sequences for the corresponding sequences of a human antibody. Accordingly, suck "humanized" antibodies are chimnerc antibodies (U.S. Patent No, 4,816,567) wherein substantially less that, an intact human variable domain has been substituted by the corresponding sequence from a non-human species, In practice, 25 humanized antibodies are typically human antibodies in which some hypervariable region residues and possibly some FR residues are substituted by residues from analogous sites in rodent antibodies. The choice of hunan variable domains, both light and heavy, to be used in making the humanized anibodies is very important to reduce atigewdcity and HAMA response (human anti-mouse antibody) when tho antibody is intended for human therapeutic use. According to the so-called "best-fit" method. the 30 sequence of the variable domain of a rodent antibody is screened against the entire library of known human variable domain sequences. The human V domain sequence which is closest to that of the rodent is identified and the human framework region (FR) within it accepted fbr the humanized antibody (Sims er at, J. mmunol, 151:2296 (1993); Chothia Pr aL, 1 MoL BioL, 196:901 (1987))- A another method uses a particular franework region derived front the consensus sequence of all human antibodies of a particular 35 subgroup flight or heavy chains. h e sane framework my be used for several different humanized antibodies (Carter er at, Pre. Nad. Acad. Sce. USA, 89:4285 (1992): Presta et at . Immunol, 151:2623 (1993)). It is further important that antibodies be humanized with retenbon of high binding affinity for the natigen and other favorable biological properties. To achieve this goal, according to a preferred method, 40 humanized antibodies are prepared by a process of analysis of the parental sequences and various conceptual humanized products using three-dimensional models of the parental and humanized sequences. Three dimensional immunoglobulin models are commonly available and are famisliar to those skilled in the art. Computer programs are available which illustrate and display probable three-dimensional confornational structures of selected candidate imuunoglobulin sequences. Inspection of these displays permits analysis of Is AC5MED SP Eff E 9167 "RCVD AT 412612005 2:48:59 FM[EastemnDaylight Time]*I SRUSPT0-EXRF-1l26* DNIS:2130821 0SID:650 9529881 1 DURATION (mm-ss):24456 Attorney Docket No. P 1 990R3 5 the Tikely r-ole of the residues in the functioning of the candidate immunoglobulin sequence, L ., the analysis of residues that influence the ability of the candidate imrmu noglobulin to bind its antigen. TI this way, FR residues can be selected and combined from the recipient and import sequences so that the desired antibody chameteristic, such as increased affinity for the target antigen(s), is achieved. In general, the hypervariable region residues are directly and must substantially involved in influencing antigen binding. 10 Tho humanized antibody may be an antibody fragment, such as a Fab, which is optionally conjugated with one or more cytotoxic agent(s) in order to generate an innmmunoconjugate. Alternatively, the humanized antibody may be an full length antibody, such as an full length IgG I antibody. Hnn wanilbdies and phage display methodology As an alternative to humanization. human antibodies can be generated. For example, it is now possible to produce transgenic animals (eg,, mice) that are capable, upon immunization, of producing a full rpertoire of human antibodies in the absence of endogenous imnunoglobulin production. For example, it has been described that the hoamozygous deletion of the antibody heavy-chain joining region (I) gene in chimeric and germ-line mutant mice results in complete inhibition of endogenous antibody production, 20 Transfer of lie human germ-li e immunoglobulin gene anray into such germ-line mutant mice will result in tie production of human antibodies upon antigen challenge, See, ag., Jakobovits et alt Proc. Nal Acad Sri. USA. 90:2551 (1993); Jakobovits et at, Nature, 362:255-258 (1993); Bruggemann et at, Year in. jimnanox, 7:33 (1993); U,S, Patent Nos. 5,545,806, 5,569,825, 5,591,669 (all of GenPharm); 5,545,807; and WO 97/17852. 25 Alternatively, phage display technology (McCafferty et al, Nature 348:552-553 [1990]) can he used to produce human antibodies and antibody fragments ir uhtro, front immunooglobulin variable (V) domain gene repertoires from unimmunized donors. According to ihis technique, antibody V domain genes are cloned in-frame imto either a major or rsinor coat protein gene of a filamentous bacteriophage, such as IM 13 or fd, and displayed as functional antibody fragments on the surface of the phage particle. Because the 310 filamentous particle contains a single-stranded DNA copy of the phage genome, selections based on the functional properties of the antibody also result in selection of the gene encoding the antibody exhibiting those properties. Thus, the phage mimics some of the properties of the B-cell, Phage display can be performed in a variety of formats, reviewed in, eg., Johnson, Kevin S. and Chiswell, David J, Curent Opinion in Srcal Bioogy 3:564-571 (1993). Several sources of V-gene segments can be used for phage 35 display. Clackson er at Nature, 352:624-628 (1991) isolated a diverse array of an-oxazolone antibodies from a small random combinatorial library of V gencs.dcrived from the splcens of immunized micec A reperloire of V genes from uinimunized hUMan donors can be constructed and antibodies to a diverse array of antigens (including self-antigens) can be isolated essentially following the techniques described by Marks et altJ. Mot .Bil, 222:58i-597 (1991), or Griflth et at, EIIO J. i2:725-734 (1993), See, also, US, 40 Patent Nos. 5,565,332 and 5,573,905. As discussed above, human antibodies may also be generated by in vitro activated B cells (see U.S. Patents 5,567,610 and 5,22-9,275) 19 AMPEDE59 E20167*RCVD AT 4126!2005 2:48:59 PM [Eastem Daylight Time]*ISVRUSP)TO-EXRM-26*DNIS:2730827*0SID:650 952 9881 1 DURATION (mm-ss):24456 Attorney Docket No. P990R3 MEANS, 13 JUL 2004 A ntibody fragments In certain circumstances there are advantages of using antibody fragments, rather than whole antibodies. The smaller size of the fraginents allows for rapid clearance, and may lead to improved access to solid tumors. Various techniques have been developed fhr the production of antibody fragments. Traditionally, 10 these fragments were derived via proteolytic digestion of intact antibodies (see, e. Morinoto et aL, Journal of Biochemical and Biophysical Methods 24:107-1 17 (1992); and Brennan et at, Science, 229:81 (1985)). However, these fragments can now be produced directly by recombinant host cells. Fab, Fv and ScFv antibody *agments can all be expressed in and secreted from . coli, thus allowing the lieile production of large amounts of these fragments. Antibody fragments can be isolated from the antibody 15 phage libaries discussed above, Alternatively, Pab'-SH fragments can be directly recovered from H, coli and chemically coupled to form F(ab') 2 frag ments (Carter et aL, Bio/Technology 10: 163-167 (1992)). According to another approach, F(ah') 2 fragments can be isolated directly from recombinant host cell culture, Fab and F(ab') fragment with increased in vivo half-life comprising a salvage receptor binding epitope residues are described in U.S. Patent No. 5.869,046. Other techni ques for the production of antibody 2I fragments will be apparent to the silled practitioner, In other embodiments, the antibody of choice is a single chain Fv fragment (scFv). See WO 93/16185; U.S. Patent No. 5,571,894; and U.S. Patent No. 5,587,458. Fy and sFv are the only species with intact combining sites that are devoid of constant regions; thus, they are suitable for reduced nonspecific binding during in vivo use. sFv fusion proteins may be constructed to yield fusion of an effector protein at either the amino or the carboxy terminus of an sFv. See 25 Antibody Engineering, ed. Borrehaeck, su pra, The antibody fragment may also be a linearr antibody", e.g., as described in U.S. Patent 5,641,870 fbr example. Such linear antibody fragments may be monospecific or bispecific. Bspecific andbodies 30 Bispecific antibodies are antibodies that have binding specificities for at least Iwo different cpitopes,. Exemplary bispecific antibodies may bind to two different epitopes of the CD20 protein. Other such antibodies may combine a CD20 binding site with a binding site for another protein, Alternatively, an anti-CD20 arm may be combined with an arm which binds to a triggering molecule on a lcukocyte such as a 'T-cell receptor molecule (e.g. CD3), or Fc receptors for IgG (FcyR), such as FeYRi (CD64), FcyRfJ (CD32) 35 and FeyRll (CD 16), or NKG 2D or other NK cell activating ligand, so as to focus and locaflze cellular defense mechanisms to the CD20--xpressing cel, Bispecific antibodies may also be used to localize cytotoxic agents to cells which express CD20. These antibodies possess a CD20-binding arm and an arm which binds the cytotoxic agent (e.g, saporin, anti-interferon-.. vinca alkaloid, icin A chain, methotrexate or radioactive isotope hapten). Bispecific antibodies cn be prepared as full length antibodies or antibody 40 fragments (eig F(ab') 2 bispecific antibodies). WO 96/16673 describes a bispecific anti-ErbB 2/anitiFcJH antibody and U.S. Patent No. 5.837.234 discloses n bispecific anti-ErbB2/anti-FcyRT antibody. A bispecific antierbB2iFcct antibody is shown in WO98/02463. U.S. Patent No.5,821,337 teaches a bispecific anti-ErbB2/anti-CD, antibody. 20 E 21167'RCVD AT 4Q22005 2:48:59 PM [Eastem Daylight Timer] SVR:USPTO-EFXRF-1i26IDNIS:2730827* C8ID:650 952 9881 DURATION (mm-ss):24-56 Attorney Docket No. P1990R3 5 Methods for making bispecific anti bodies are known in the art, Traditional production of full length hispecific antibodies is based on the co-expression of two inmunoglobulin heavy chain-light chain pairs, where the two chains have different specificities (Millstein et aL, Natre. 305:537-539 (1983)). Because of the random assortment of imminnoglobulin heavy and light chains, these hybridomas (quadromas) produce a potential mixture of 0 different antibody molecules, of which only one has the 10 correct bispecific structure. Purification of the correct molecule, which is usually done by affinity chromatography steps. is rather cumbersome, and the product yields are low. Similar procedures are disclosed in WO 93/08829, and in Traunceker et al, EMBO J, 10:3655-3659 (1991). According to a different approach, antibody variable domains with the desired binding specificities (antibody-antigen combining sites) are fused to immunoglobuin constant domain sequences, Prefcrably, the 15 fusion is with an Ig heavy chain constant domain, comprising at least part of the hinge, C 1 2, and C.

1 3 regions. It is preferred to have the first heavy-chain constant region (CRl) containing the site necessary for light chain bonding, present in at least one of the fusions. DNAs encoding the immunoglobulin heavy chain fusions and, if desired, the immunoglobulin light chain, are inserted into separate expression vectors, and are co-transfected into a suitable host cell. This provides for greater flexibility in adjusting the mutual 20 proportions of the three polypeptide fragments in embodiments when unequal ratios of the three polypeptide chain: used in the construction provide the optimum yield of the desired bispecific antibody. It is, however, possible to insert the coding sequences for two or all three polypepide chains into a single expression vector when the expression of at least two polypeptide chains in equal ratios results in high yields or when the atios have no significant affect on the yield of the desired chain combination. 25 In a preferred embodiment of this approach, the bispecific antibodies are composed of a hybrid immunoglobulin heavy chain with a first binding specificity in one arm, and a hybrid immunoglobulin heavy chain-light chain pair (providing a second binding specificity) in the other arm. Yr was found that this asymmetric structure facilitates the separation of the desired bispecific compound from unwanted immunoglobulin chain combinations, as the presence of an ininunoglobulin light chain in only one half of 30 the bispecific molecule provides for a facile way of separation. This approach is disclosed in WO 94/04690. F-or flurthcr details of generating bispecific antibodies see, for example. Surcsh at aL, Merhods in Enzymology, 121:210 (1986). According to another approach described in U.S. Patent No. 5,73 168, the interface between a pair of antibody molecules can be engineered to maximize the percentage of heterodimers which are recovered 3S from recombinant cell culture. The preferred inorface comprises at least a part of the C);3 domain. In this method, one or more small amino acid side chains from the interface of the first antibody molecule are replaced with larger side chains (e.g. tyrosine or tryptophan). Compensatory cavitiess" of identical or similar size to the large side chain(s) are created on the interface of the second antibody molecule by replacing large amino acid side chains with smaller ones (e.g. alanine or threonine), This provides a 40 mechanism for increasing the yield of the heterodimer over other unwanted end-products such as homnodimters. Bispecific antibodies include cross-linked or "heteroconjugate" antibodies. For example, one of the antibodies in the heteroconjugate can be coupled to avidin, the other to biotin. Such antibodies have, for example. been proposed to target immune system cells to unwanted cells (U.S. Patent No. 4,676,980), and 21 ENDED S t EFF E22167'"RCVD AT 412612005 2:48:59 PM [Eastem DaylighitTime]*SVR:USPT0-EFXRF-1261DNIS:2730827*I0SID:650 952 9881 1*DURATION (mm-ss):24-56 Attorney Docket No. P1990R3 5 for treatment of 11y infection (WO 91/00360, WO 92/200373, and EP 03089). Hiteroconjugate antibodies may be made using any convenient crossslinking methods. Suitable cross-linking agents are well known in the art, and are disclosed in U.S. Patent No. 4,676,980, along with i numbeicr of cross-linking techniques. Techniques for generating specific antibodies from antibody fragments have also been described in the literature. For example, bispecific antibodies can be prepared using chemical linkage. Brennan et at. 10 Science, 229: 81 (1985) describe a procedure wherein intact antibodies are proteolytically cleaved to generate F(ab') 2 fragments. These fragmens arc reduced in the presence of the dithiol conplexing agent, sodium arsenite, to stabilize vicinal dithiols and prevent intcrnoecular disulfide formation. The Fab' fragments generated are then converted to thionitroberzoate (TNB) derivatives, One of the Fa-TNB derivatives is then reconverted to the Fab'thiol by reduction with mercaptocthylamine and is mixed with an 15 equimolar amount of the other Fab'-TNB derivative to form the bispecific antibody. The bispecific antibodies produced can be used as agents for the selective iminobilization of enzymes. Recent progress has facilitated the direct recovery of Fab'-SlJ fragments from E. coli, which can be chemically coupled to form bispecific antibodies, Shalaby er al, .1. Exp. Med., 175: 217-225 (1992) describe the production of a fully humanized bispecific antibody F(ab'):j molecule. Each Fab' fragment was separately 20 secreted from E. coli and subjected to directed chemical coupling in. vitro to form the bispecific antibody. The bispecific antibody thus formed was able to bind to cells overexpressing the Erb2 receptor and normal human T cells, as well as trigger the lyric activity of human cytotoxic lymphocytes against human breast tumor targets. Various techniques for making and isolating bispecifje anybody fragments directly from 25 recombinant cell culture have also been described. For example, bispecifi antibodies have been produced using leucine zippers. Kostelny at aL, J. ImmunoL, 148(5):1547-155S (1992). Tc leucine zipper peptides from the Fos and Jun proteins were linked to the Pab' portions of two different antibodies by gene fusion. The antibody homodimters were reduced at the hinge region to form monomers and then re-oxidized to form the anybody heterodimiers. This method can also be utilized for the production of anybody homnodimcrs. 30 The "diabody" technology described by Hollinger et at, Proc. ANer Acad. Sci USA, 90:6444-6448 (1993) linst provided an alternative mechanism for Snaking hispecifc mnhony fmgments Th fagmea mmprise a Vu connected to a Vt by a linker which is too short to allow pairing between the two domains on the same ebain. Accordingly, the Vn and VT domains of one fragment are forced io pair with the conplementary VL tand V domains of another fragment, thereby forming two an tgen-binding sites. Another strategy for 35 making bispecitic antibody fragments by the use of single-chain Fv (sFv) dimers has also been reported. See cruber er aL, J. LinmunrwL, 152:5368 (1994). Antibodies with more than two valencics are contemplated. For example, trispecific antibodies can h prep ared, Tutt et at I ImmunoL 147: 6M (1991). 40 Mluldivalent Antibodies A multivalent antibody may be internalized (and/or catabolized) faster than a bivalem anybody by a cell expressing an antigen to which the antibodies bind. The antibodies of the pOresent invention can be multivalent antibodies (which are other than of the IgM class) with ihree or more antigen binding sites (e.g. tetravalent antibodies), which can be readily produced by recombinant expression of nucleic acid encoding 22 AMEND SP E E T 23167*RCVD AT 412612005 2:48:59 PM [Eastem aylightiimel tSVR:USPTO-EXRF-126*g0818:2730827* 0810:650 952 9881 DURATION (mmss):24-56 Attorney Docket No. P1 990R3 5 the polypeptide chains of the antibody. The muldivalent antibody can comprise a dimerization domain and three or more antigen binding sites. The preferred dirnerization domain comprises (or consists of) an Fe region or a hinge region. in this scenario, the antibody will comprise an Fe region and three or more antigen binding sites amino-terninal to the Pc region. The preferred multivalent antibody herein comprises (or consists of) three to about eight, but preferably four, antigen binding sites, The multivalcnt antibody 0 comprises at least one polypeptide chain (and preferably two polypeptide chains), wherein the polypeptide chain(s) comprise two or more variable domains. For instance, the polypeptido chain(s) may comprise VDI (X1),-VD2-(X2),Fe, whereir VDl is a first variable domain, VD2 is a second variable domain, Fe is one polypeptide chain of an Fc region, X I and X2 represent an amino acid or polypeptide, and n is 0 or . For instance, the polypeptide chain(s) may comprise: VH-CHI-flexiblC linker-VH-CH i-Fe region chain; or VH 15 CH4 l-VH-CIII-Fc region chain, The multivalent antibody herein preferably further comprises at least two (and preferably four) light chain variable domai polypeptides. The multivalent antibody herein may, for instance, comprise ftom about two to about eight ight chain variable domain polypeptides. The light chain variable domain polypeptides contemplated here comprisc a light chain variable domain and, optionally, further comprise a CL domain. 20 Other araino acid sequence modificarions Amino acid sequence modification(s) of the CD2 binding antibodies described herein are contemphated. For example, it may be desirable to itn rove the binding affinity and/or other biological properties of the antibody. Amino acid sequence variants of the anti-CD20 antibody are prepared by 25 introducing appropriate Rucleotide changes into the anti-CD20 antibody nucleic acid, or by peptide synthesis. Such modifications include, fbr example, deletions from, and/or insertions into and/or substitutions of, residues within the amino acid sequences of the anti-CD20 antibody, Any combination of deletion, insertion, and substitvtion is made to arrive at the final construct, provided that the final construct possesses the desired characteristics. The amino acid changes also may alter post-translational processes of 30 the anti-CD20 antibody, such as changing the number or position of glycosylation sites. A useflkc method for identification of certain residuos or regions of the anti C)20 anfibody that ar preferred locations for mnutagenesis is called "alanine scanning mutagenesis" as described by Cunningham and Wells in Science, 2441081-1085 (1989). Here, a residue or group of target residues are identified (e.., charged residues such as arg, asp, his, lys, and glu) and replaced by a neutral or negatively charged amino 34r acid (most preferably alanine or polyalanine) to affect the interaction of the amino acids with CD20 antigen. Those amino acid locations demonstrating functional sensitivity to the substitutions then are refined by introducing further or other variams at, or for, the sites of substitution. Thus, while the site for introducing an amino acid sequence variation is predetermined, the nature of the mutation per se need not be predetermined. For example, to analyze the performance of a mutation at a given site, ala scannIng or 40 random mutagenesis is conducted at the target codon or region and the expressed anti-CD20 antibody variants are screened for the desired activity. Amino acid sequence insertions include amino- and/or carboxyl-terminal fusions ranging in length from one residue to polypeptidas containing a hundrd or more residueS, as well as intrasequenee insertions of single or mdtipie amino acid residues. Examples of terminal insertions include an anti-CD20 antibody 23 24167RCVD AT 4126120052:48:59 PM [Eastern DayightTime] ISVR:USPTOEFXRF-1i26 DNIS:2730827 CSID:650 952 9881 DURATION (mm.ss):24-56 A ttfrney Dovket No, P19 3 I 99D1 3 JUL 2004 5 With an N-teilina MethiOnyl reSidtle or the an-ibody ifised to a cyvtotoxic polypeptide. other in']Sert iona] varianbi of the aniti-CD2O 'mtibody Tn1Moecu include the fusion to the N- Or C-terminus of the anti4ZD2{) Atibody to an enymne (eR.tr . DBIFT) or a PolYpr ide Which ineren ses the serom half- life of thc witibody Another type of-variapt is an ainino aci~d substiution var-iant. These variants have at least one 10 In aino acid residue in the anti-CD20 antibody rocule replaced by a different residue. The sites of Veatcst interest fOr SubStitUtinal MU'tagenesisJ- include die 1hypervariable -region,, but FR alterations =x also cnmnplcted, Connervive substitutions are shown in theT 'abie below under thec heading of "preferred substitutions'% Iscsutitis eltiachnei biologcal MdtVity, then TVore substantial changes. dcroninated 'exemplary substitutions" in the TIable, or as flitiiier described beow in reference, to amino acid 15 classes, cmay be introduced and dhe products screenecd. YARLE ftz'wAdSunitiis OliginallEesidue Etxem~plary Preferred _____________Subsitustions _____ Slit*~wtions Ala (A) Val' ten; ile val Arg (R) lys$; gin; ann lye Msn (N) gh', l'es, asp, lys; arg gin Asp ()g; a--n Cys (C) set; ala Sem Gin (Q) ana tyiu I 1 (E) asp; gin Gly (G)N ala His (1-1) asn; -1n; lyq; arg a'il lIC (1) feu,, val: mar:. ala. phe, norlenclrWle Len(L)norleucine; ile; -val; met; ala; phe le Lys (W) arg; -In; asn erg IetV, ll; phe; ile leo File (11) leo; VII., iBe, 0aa tyr Cyr pro (P) 3la 5cr (5) thnth Thin (7) Ser se Trp (W) tyr;Phe tF Tyr (Y) trp; Pile; thr; Ser phe "",1 (17) ile; Jeu; myet; phe; ala; norleucine 24 E25167' RCV0 AT 412612005 2:48:59 PM P~astern Dayijgrit Thnel' SVR:USPTO.EPXRF-1126 I N1S:27308271 CSID:'650 952 9881 DURATION (mlss):24.56 IFVUS 1 3 JUL 2004 Attorney Docket No. P1990R3 Substantial modifications in the biological properties of the antibody are accomplished by selecting substitutions that differ significandy in their effect on maintaining (a) the structure of the polypeptide backbone in the area of the substitution, for example, as a sheet or helical conformation, (b) the charge or hydrophobicity of the molecule at the target site, or (c) the bulk of the side chain, Naturally occurring 10 residues are divided into groups based on common side-chain properties: (1) hydrophobic: norleucine, met, ala. val, lcu, ile; (2) neutral. hydrophilic: cys, ser, thr; (3) acidic: asp, glu; (4) basic: asn. gin, his, lys, arg; 15 (5) residues that influence chain orientation: gly, pro; and (6) aromatic: trp, tyr, phe. Non-conservative substitutions will entail exchanging a member of one of these classes for another class, Any cysteinc residue not involved in maintaining the proper conformation of the anti-CD20 20 antibody also may be substituted, generally with scrine, to improve the oxidative stability of the molecule and prevent aberrant crosslinking. Conversely, cysteine bond(s) may be added to the antibody to improve its stability (particularly where the antibody is an antibody fragment such as an Fv fragment). A particularly preferred type of substitutional variant involves substituting one or more hypervariable region residues of a parent antibody (e.g. a humanized or human antibody). Generally, the 25 resulting variant(s) selected for further development will have improved biological properties relative to the parent antibody from which they are generated. A convenient way for generating such substitutional varants involves affinity maturation using phage display, briefly, several hypervariable region sites (e-g- 7 sites) are mutated to generate all possible amino substitutions at each site. The antibody variarns thus generated are displayed in a monovalent fashion from filamentous phage particles as fusions to the gene Ill 30 product of M1 3 packaged within each particle. The phage-displayed variants are then screened for their biological activity (e.g. binding affinity) as herein disclosed. In order to identify candidate hypervariable region sites for modification, alanine scanning mutagenesis can be performed to identify hypervariablo region residues contributing significantly to antigen binding. Alternatively, or additionally, it may be beneficial to analyze a crystal struture of the antigen-antibody complex to identify contact points between 35 the antibody and human CD20. Such contact residues and neighboring residues are candidates for substitution according to the techniques elaborated herein, Once such variants are generated, the panel of variants is subjected to screening as described herein and antibodies with superior properties in one or more relevant assays may be selected for further development. Another type of amino acid variant of the antibody alters the original glycosylation patern of the 40 antibody. By altering is meant deleting one or more carbohydrate moieties found in the antibody. and/or adding one or more glycosylation sites that are not present in the antibody. Glycosylaition of antibodies is typically either N-linked or C-linked. N-inked refers to the attachment of the carbohydrate moiety to the side chain of an asparagine residue The tripeptide sequences asparagioe-X-serine and asparagine-X-threonine, where X is any amino acid except prioline, are the 25 AMENDED SNDU E 2616P RCVD AT 41263205 2:48:59 PM EastemnDaylight Timel SVRUSPi0-EHFXR1261 DNIS:273082P1 CSID:6509052 9881 DURATI0N (mss):24-50 q %V a I ww %. "'P F 9f %J ,r L. W Attorney Docket NoP 990R3 IPE" S 13 JUL 2004 5 recognition sequences for enzymatic attachment of the carbohydrate moiety to the asparagine side chain. Thus, the presence of either of these tripeptide sequences in a polypeptide Creates a potential glycosylation sit, 0-linked glycosylarion refers to the attachrcra of one of the sugars -aceylgalactosamine, galactose, or xylose to a hydroxyamnino acid, most commonly rserine or threonine, although 5-hydroxyproline or 5 hydroxylysine may also be used. 10 Addition of glycosylation sites to the antibody is conveniently accomplished by altering the arnino acid sequence such that it contains one or more of the above-described tripeptide sequences (for N-linked glycosylation sites). The alteration may also be made by the addition of, or substitution by, one or more shrine or threonine residues to the sequence of the original antibody (fir 0-linked gjycosylation sites). Nucleic acid molecules encoding amino acid sequence variants of the ani-C020 antibody are 3 5 prepared by a variety of methods known in the art. These methods include, but are not limited to, isolation from a natural source (in the case of naturally occurring amino acid sequence variants) or preparation by oligonuclcoride-niediated (or site-directed) mutagenesis PCR nutagenesis, and cassette mnutagenesis of an earlier prepared variant or a non-variant version of the anti-CD20 antibody. it may be desirable to modify the antibody of the invention with respect to effector function, efg. so 20 as to enhance antigen-dependent cell--mediated cyotoxicity (ADCC) and/or complement dependent cytotox icity (CDC) of the antibody. This may be achieved by introducing one or more amino acid suhbsitutions in an Fe region of the antibody. Alternatively or additionally, cysteine residue(s) may be introduced in the Fe region, thereby allowing interchain disuflide bond formation in this region- The homodimeric antibody thus generated may have improved internalization capability and/or increased 25 complement-mediated cell killing and antibody-dependent cellular cytotoxicity (ADCC). See Carone at d, . (p Med. 176:1191-I195 (1992) and Shopes, B,. imrmanot 148:2918-2922 (1992). Homodimeric antibodies with enhanced anti-tumor activity may also be prepared using heterobifuncional crmss-linkers as described in Wolff et at Cancer Research 53:2560-2565 (1993). Alternatively, an antibody can be engineered which has dual Fe regions and may thereby have enhanced complement mediated lysis and 30 ADCC capabilities. See Stevensoner aL Arnti-Cancer Drug Design 3:219-230 (1989). To increase the serum half life of the antibody, one may incorporate a salvage receptor binding opitope into the antibody (especially an antibody fragment.) as described in U.S. Patent 5,739.277, for example. As used herein, the term "salvage receptor binding epitopc" refers to an epitope of the P region of an TgC molecule (e.g., IgG. 1,g0 2 Igc:, or ig0 4 ) that is responsible for increasing the in ivo serum half-life 35 of the igG molecule. Other anSibody modifications Other modifications of the antibody are contemplated herein, For example, the antiebdy may be linked to one of a variety of nonproteinaceous polymers, eg., polyethylene glycol, polypropylene glycol, 40 polyoxyalkylens, or copolymers of polyethylene glycol and polypropylene glycoL The antibody also may be entrapped in microcapsules prepared, for example, by coacervation techniques or by interfacial polymerization (fur example, hydroxymethylcelluiose or galatin-microcapsuies and poly (methylmethacylate) microcapsules, respectively), in colloidal drug delivery systems (for example, 26 AMENDED 9A7 27!61PRMVAT4126/2005 2:48:59 P11(EstemnDaylight Time]* SVR:USPT0&EXRF-l26*IDNIS:2130827*0CSID:650 952 9881 *DURATION (mm-ss):24.56 IPE US i 3 JUL2004 Attorney Docket No. P1990R3 5 h posomes, albumill microspheres, microemulsions, nano-particles and nanocapsules), or in macroemulsions. Such techniques are disclosed in Remingios's Pharmaceical Sciences, 16th edition, Oslo, A., Ed, (1980). Screening for antibodies with the desired properties Antibodies with certain biological characteristics may be selected as described in the Experimental 10 Examples. The growth inhibitory efcets of an anti-CD20 antibody of the invention may be assessed by methods known in the art, eg., using cells which express CD20 either endogenously or following transfection with the CD20 gene. For example, tumor cell lines and CD20-transfected cells may treated with an anti-CD20 monoclonal antibody of the invention at various concentrations for a few days (e.g. 2-7) days 15 and stained with crystal violet or MTT or analyzed by some other cnlorimetric assay. Another method of measuring proliferation would be by comparing 1H--bhymidinc uptake by the cells heated in the presence or absence an anti-CD20 antibody of the invention. After antibody treatment, the cells are harvested and the amount of radioactivity incorporatedJ into the DNA quantitated in a scintillation counter. Appropriate positive controls include treatment of a selected cell line with a growth inhibitory antibody known to inhibit 20 growth of that cell line. To sclcet for antibodies which induce cell death, loss of membrane integrity as indicated by, e.g, propidium iodide (P1). trypan blue or 7AAD uptake may be assessed relative to control. A PI uptake assay can be performed in the absence of complement and immune effector cells. CD20-expressing tumor cells are incubated with medium alone or iediurn containing of the appropriate Monoclonal antibody at e.g, about 25 10Ipg/ml . The cells are incubated for a 3 day time period. Following each treatment, cells are washed and aliquoted into 35 mm strainer-capped 12 x 75 tubes (1ml per tube, 3 tubes per treatment group) for removal of cell clumps. Tubes then receive PT (10p±g/ml). Samples may be analyzed using a FACSCANM flow cytometer and FACSCONVERTr 1 CellQuest software (Becton Dickinson). Those antbodies which induce statistically significant levels of cell death as determined by PT uptake may be selected as cell death-inducing 30 antibodies, To screen For antibodies which bind to an epitope on CD20 bound by an antibody of interest, a routine cross-blocking assay such as that described in Antibodie& A Labortory Manual, Cold Spring Harbor Laboratory, Ed Harlow and David Lane (1988), can be performed. This assay can he used to determine if a test antibody binds the same site or epitopie as an anti-CD20 antibody of the invention. Alternatively., or 35 additionally. epitope mapping can be performed by methods known in the art . For example, the and'body sequence can be mautagonized such as by alanine scanning, to identify contact residues. The mutant antibody is initailly tested for binding with polyclonal antibody to ensure proper folding. in a different method, peptides corresponding to different regions of CD20 can be used in competition assys with the test antibodies or with a test antibody and an antibody with a characterized or known epitop. 40 Vectors, Host Cells and Recombinant Methods The invention also provides an isolated nucleic acid encoding a humanized CD20 binding antibody, vectors and host cells comprising the nucleic acid, and recombinant techniques for the production of the antibody. 27 AMEND WE N C E 28167*RCVD AT 412612005 2:48:59 PM[EastemnDayight Time]'*SVR:USPTOEXRN/V26* DNIS:2730827* C8ID:650 95290881 *DURATION (mm-ss):24456 U VIV% I JW f I 1'4 kir _% A trorney Docket No. P1990R3 W 13 JUL200 .5 For recombinant production of the antibody, the nucleic acid encoding h is isolated and inserted into a replicable vector fur further cloning (amplification of the DINA) or forexpression DNA encoding the monoclonal antibody is readily isolated and sequenced using conventional procedures (e0g, by using oligonucleotide probes that are capable of binding specifically to genes encoding the heavy and light chains of the anybody). Many vectors are available. The vector components generally include, but are not limited 10 to, one or more of the following: a signal sequence, an origin of replication, one or more marker genes, an enhancer clement, a promoter, and a transcription termination sequence. (I) Sigrl sequence component The CD20 binding antibody of this invention may be produced recombinantly not only directly, but also as a fusion polypeptidc with a beterologous polypeptide, which is preferably a signal sequence or other 15 polypeptide having a specific cleavage site at the N-terminus of the nature protein or polypeptide. The heterologous signal sequence selected preferably is onc that is recognized and processed (ie, cleaved by a signal peptidase) by the host cell. For prokaryotic host cells thit do not recognize and process the native CD20 binding antibody signal sequence, the signal sequence is substituted by a prokaryotic signal sequence selected, for example, from the group of the alkalin phosphatase, penicillinase, Ipp, or heat-stable 20 erterotoxin 11 leaders. For yeast secretion tite native signal sequence may be substituted by, eg., the yeast invertase leader, ix factor leader (including Saccharonmyces and Klyveronmyces a-factor leaders), or acid phosplhatase leader, the C albicans glucoaiylase leader, or the signal described in WO 90/13646, in mammalian cell expression, mammalian signal sequences as wel as viral secretory leaders, for example, the herpes simplex gD signal, are available. 25 The DNA for such precursor region is ligated in reading frame to DNA encoding the CD20 binding antibody, (ii) Origin of repication Both expression and cloning vectors contain a nucleic acid sequence thia enables the vector to replicate in one or more selected host cells. Generally, in cloning vectors this sequence is one that enables 30 the vector to replicate independently of the host chromosonal DNA, and includes origins of replication or autonomously replicating sequences. Sich sequences are well known for a variety of bacteria, yeast, and viruses, The origin of replication from the plasmid pBR322 is suitable for most Gram-negative bacteria, the 2pt plasiid origin is suitable for yeast, and various viral origins (SV40, polyoma, adenovirus, VSV or BPV) arc useful for cloning vectors in mammalian cells. Generally, the origin of replication component is not 35 needed for mammalian expression vectors (the SV40 origin may typically be used only because it contains the early promoter). (iii) Selection gene component Expression and cloning vectors may contain a selection gene, also termed a selectable marker. Typical selection genes encode proteins that (a) confer resistance to antibiotics or other toxins, eg., 4() ampicillin, neomycin, methotrexate, or tetracycline, (b) complement auxotrophie deficiencies or (c) supply critical nutrients nt available from complex media, e.g., the gene encoding D-alanine racemase for acIll. One example of a selection scheme utilizes a drug to arrest growth of a host cell. Lose cells that are successfully transformed with a heterologous gene produce a protein conferring drug resistance and thus 28 29167*RCVD AT 412612005 2:48:59 PM [Eastern Daylight Time] SVR:USPTO.EFXRF1/26 DNIS:2730827 t CSID:650 952 9881 DURATION (mm-ss):24-56 -IPEA/S 1 3 JUL 2004 A attorney Docket No. P1990R3 5 survive the selection regimen. Examples of such dominant selection use the drugs neomycin, mycophenolic acid and hygromnycin. Another example of suitable selectable markers for marnralian cclis are those that enable the identifications of cells compete to take up the CD20 binding antibody nucleic acid, such as DHFR, thymidine kinase, mctallothioncin-1 and -11, preferably primate metallothionein genes, adenosine deaminase, 0 ornithine decarboxylase, etc. For example. cells transformed with the DHFR selection gene are first identified by culturing all of the tansformants in a culture medium that contains methotrexate (Mtx), a competitive antagonist of DHFR. An appropriate bost cell when wild-type DIVR. is employed is the Chinese hamster ovary (CHO) ecl line deficient in DHFR activity (e.g., ATCC CRL-9096). 15 Alternatively, host cells (particularly wild-type hosts that contain endogenous DHFR) transformed or coa-transformed with DNA sequences encoding CD20 binding antibody, wild-typc DHIFR protein, and another selectable mnarker such as aminoglycoside 3phosphotransferasc (APH) can be selected by cell growth in medium containing a selection agent for the seletable marker such ar, an aminoglycosidic antibiotic, e.g, kanamnycin, neomycin, or 6418. See U.S. Patent No. 4,965,199. 20 A suitable selection gene for use in yeast is the trpl gene percent in the yeast plasmid YRp7 (Stinchcomb et al, Naure, 282:39 (1979)). The trpl gene provides a selection marker for a mutant strain of yeast lacking the ability to grow in tryptophan. for example, ATCC No. 44076 or PBP4- 1. Jones, Genetics, 85 12 (1977). The presence of the trpI lesion in the yeast host cell genome then provides an cffcetive environment for detecting transformation by growth in the absence of tryptophan. Similarly, Leu2-deficient 25 yeast strains (ATCC 20,622 or 38,626) are complemented by known plasmids bearing the Lau2 gene. In addition, vectors derived from the 16 m circular plasmid pKO) can be used for transformation ofKyveroymyces yeasts. Alternatively, an expression system for large-scale production of recombinant calf chymusin was reported for K. lacris. Van den Berg, Bio/Technooy, 8:135 (1990). Stable muni-copy expression vectors for secretion of mature recombinant human serum albumin by industrial strains of 30 Kyveroyces have also been disclosed. Fleer ed aL. Biio/Technology, 9:968-975 (1991). (iv) Promoter component Expression and cloning vectors usually contain a promoter that is recognized by the host organism and is operably linked to the nucleic acid encoding the CD20 binding antibody. Promoters suitable for use with prokaryotic hosts include the phoA promoter . -lactamase and lactose promoter systems, alkaline 3 5 phosphalase promoter, a tryptophan (trp) promoter system, and hybrid promoters such as the tac promoter. However, other known bacterial promoters are suitable. Promoters for use in bacterial systems also will contain a Shine-Dalgarno (S.D.) sequence operably linked to the DNA encoding the CD20 binding antibody. Promoter sequences are known for cukaryote.s. Virtually all cukaryotic genes have an AT-rich region located approximately 25 to 30 bases upstream from the site where transcription is initiated. Another 40 sequence found 70 to 80 bases upstream from the start of transcription of many genes is a CNCAAT region where N may be any nucleotide. At the 3 end of most eukaryotic genes is an AATAAA sequence that nay be the signal for addition of the poly A tail to the 3' end of the coding sequence. All of these sequences arc suitably inserted into eukaryotic expression vectors, 29 AM2D WES E30167 RCIVD AT 412612005 2:48:59 PM [EastemnDaylight Time]* ISVR:,USPTO.EXRF.V26*DNIS:27308271 C81D:650 952 9881 1*DURATI0N (mm-ss):24-56 Attorney Docket No. PI9OR3 WE 1 3 5 Examples of suitable promoter sequences for use with yeast hosts include the promoters for 3 phosphoglycerate kinase or other glycolytic enyrnes, such as enolase, glyceraldehyde-3-phosphate dchydrwgnase. hexokinase, ppuvate decarboxyase, phospbofructokinase, glucose6--phosphatc isoneraso. 3-phosploglycerate mutase, pyruvate kinase, triosephosphatc isomerase, phosphoglucose isomerase, and glucokinase. 10 Other yeast promoters, which are inducible promoters having the additional advantage of transcription controlled by growth conditions, arc the promoter regions for alcohol dehydrogenase 2, isocytochrore C, acid phosphatase, degradative enzymes associated with nitrogern metabolism, metallothioncin, glyceraldehyde-3phosphate dehydrogenase, and enzymes responsible for maltose and galactose utilization. Suitable vectors and promoters for use in yeast expression are further described in EP 15 73,657, Yeast enhancers also are advantageously used with yeast promoters. CD20 binding antibody rmscription from vectors in mammalian host cells is controlled, for example, by promoters obtained from the genomes of viruses such as polyoma virus, fow pox virus, adenovirus (such as Adenovirus 2), bovine papilloma virus, avian sarcoma virus, cytomegalovirus, a retrovirus, hepatitis-B virus and most preferably Simian Virus 40 (SV40), from heterologous mammalian 20 promoters. eg,, the actin promoter or an inmunoglobulin promoter, from beat-shock promoters, provided such promoters are compatible with the host cell systems. The early and late promoters of the SV40 virus are conveniently obtained as an SV40 restriction fragment that also contains the SV40 viral origin of replication. The immediate early promoter of the human cyomegalovirus is conveniently obtained as a Hindm E restriction fragment. A system for expressing DNA 25 in manmalian hosts using the bovine papillona virus as a vector is disclosed in U& Patent No. 4,419,446. A modification of this cystei is described in U.S. Patent No. 4,601978. See aso Reyes ct aL, Nature 297:598601 (1982) on expression of human 1-intcrferon eDNA in mouse cells under the control of a thymidine kjnase promoter from herpes simplex viyus. Alternatively, the Rous Sarcoma Virus long terminal repeat can be used as the promoter. 30 (v) Enmncer element component Transcription of a DNA encoding the CD20 binding antibody of this invention by higher caukaryotes is often increased by inserting an enhancer sequence into the vector. Many enhancer sequences are now known from mammalian genes (globin, elastase, albumin, afetoprotein. and insulin). Typically, however. one will use an enhancer from a eukaryotic cell virus. Examples include the SV40 enhancer on the 35 late side of the replication origin (bp 100-270), the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhances. See also Yaniv, Nature 297:17-18 (1982) on enhancing clements for activation of eukaryofic promoters. The enhancer may be spliced into the vector at a position 5' or 3' to the CD20 binding antibody-encoding sequence, but is preferably located at a site 5' from the promoter. 40 (vi) Transcription terminatWon component Expression vectors used in eukaryotic host cells (yeast, fungi, insect, plant. animal, human, or nucleated cells from other multicllular organisms) will also contain sequences necessary for the termination of transcription and for stabilizing the mRNA. Such sequences are commonly available from thbe Yand, occasionally 3', untranslated regions of eukaryotic or viral UNAs or eDNAs. These regions contain 30 31167MROVD AT 4126/20052:48:59 PM [Eastern Daylight Time] SVR:USPTO-EXRF-1J26 DNIS:2730827 CSID:650 952 9881 *DURATION (mm.ss):24-56 Attorney Docker No. P 990R3 5 nucleotide segments transcribed as polyadenylated fragments in the untranslated portion of the mRNA encoding CD20 binding antibody. One useful transcription termination component is the bovine growth honnone polyadenylation region. See W0941 1026 and the expression vector disclosed therein. (vii) Selection and transformation of host cells Suitable host cells for cloning or expressing the DNA in the vectors herein are the prokaryote, 10 yeast, or higher eukaryote cells described above. Suitable prokaryotes for this purpose include eubacteria, such as Gram-neaTive or Gram-positive organisms, for example, Enterobacteriaceae such as Escherichia, ag. E. coi, Enterobacter, Erwinia, K!ebsieia, Proteus, Salmonella, e.g, Salmonella typhimurirum, Serratia, e g. Srratia marcescans, and Shigella, as well as Bacilli such as B. subtiLis and B. Richeniformis (e.g, B licheniformis 4iP disclosed in DD 266,710 published 12 April 1989), PseudoJmonas such as P. aeruginosa, 15 and Streptomyces. One preferred E. coll cloning host is E coli 294 (ATCC 31,446), although other strains such as E. coi B, E . coli X1.776 (ATCC 31 ,537), and F. coli W3 110 (ATCC 27,325) are suitable. These examples am illustrative rather than limiting. Full length antibody, antibody fragments, and antibody fusion proteins can be produced in bacteria, in particular when glycosylaton and Fc effector functon are not needed, such as when the therapeutic 20 antibody is conjugated to a cytotoxic agent (e.g, a toxin) and the immunoconjugate by itself shows effectiveness in tumor cell destruction. Full length antibodies have greater half life in circulation. Production in E. coli is faster and more cost efficient. For expression of antibody fragments and polypeptides in bacteria, sec, e.g, U.S. 5,648,237 (Carter ect aL), U.S. 5,789,199 (Joly et a.), and U.S. 5,840,523 (Sinunons et al.) which describes translation initiation region (TIR) and signal sequences for 2 optimizing expression and secretion, these patents incorporated herein by reference. After expression, the antibody is isolated from the E. coli cell paste in a soluble fraction and can be purified through, e.g., a protein A or G column depending on the isotype. Final purification can be carried out similar to the process for purifying antibody expressed eg., in CHO cells. In addition to prokaryotes, eukaryotic microbes such as filamrentous fungi or yeast are suitable 30 cloning or expression hosts for (20 binding andbody-encodina vectors. Saccharomyces cerevisiae, or common baker's yeast, is the most commonly used among lower eukaxyotic host microorganisms. However, a number of other genera, species, and strains are commonly available and useful herein, such as Schizosaccharomyces pombe ; Kluyveromyce.s hosts such as, e.g. K lacis, K. fragilil. (ATCC i2,424), K. ulmgaricus (ATCC 16,045), K, wickeramit (ATCC 24,178), K. wahit (ATCC 56,500), K. drosophilarum 35 (ATCC 36.906), K . thermolermns, and K marxianus; yarroywia (EP 402,226); Pichia pastoris (EP 183,070); Candida: Trichoderma reesia (EP 244,234); Neurospora crassa; Schwanniomyces such as Scihwmiomycesaccirdentalis; rnd filamentous fungi such as, .g., Neurospora, Penicillium, Tolypociadien., and Aspergiuhs hosts such as A. nidukl s and A. niger. Suitable host cells for the expression of glycosylated CD20 binding antibody are derived from 40 multicellular organisms. Examples of invertebrate cells include plant and insect cells. Numerous baculoviral strains and variants and corresponding permissive insect host cells from hosts such as Spodoptera frugiperdai (caterpillar), Anedes aegypti (mosquito), Aedes albopictus (mosquito), Drosophila melanogaster (frmitfly), and Biombyx mori have been identified. A variety of viral strains for transfection are publicly available, e.g, the L, I variant of Autographa cajfornica NPV and the Bm-5 Atrain of Bombyx mori 31 E 3218 RCVD AT 41262005 2:48:59 PM [Eastern Daylight Time] t SVR:USPTOEFXRFN!268 DNIS:2730827 1 CSID:650 952 9881 1 DURATION (mm-ss):24-56 MENUS 1 3 JUL 2004 Attorney Docket No. P 990R3 5 NPV. and such viruses rmaiy he used as the virus herein according to the present invention, particularly for trans fiction of Spodcpteraofrsgiperda cells. Plant cell cultures of cotton, corn, potato, soybean, petunia, tomato, and wobaccu can also be utilized as hosts. However, intemst has been greatest in vertebrate cells, and propagation of vertcbrate cells in culture 10 (Lissue culture) has become a routine procedure. Examples of useful mammalian host cell lines are monkey kidney CV I line transforimed by SV40 (COS-7, ATCC CRL. 1651): human embryonic kidney loe (293 or 293 cells subcloned for growth in suspension culture, Girham et a4, J- Gen Viral. 36:59 (1977)) baby hanster kidney col1s (BHK, ATCC CCL 10); Chinese hamster ovary eclls/-DFR (CHO, Urlaub et at, Proc. Natt Acad. Sci. USA 77:4216 (1980)); mouse sctoli cells (TM4, Mather, flio. Reprod 23:243-251 15 (1980) ); monkey kidney cells (CV I ATCC CCL 70); African green monkey kidney cells (VERO-76, ATCC CRL-1587); human cervical carcinoma cells (1U1LA, ATCC CCL 2); canine kidney cells (MDCK, ATCC CCL 34); buffalo rat liver cells (BRL 3A, ATCC CRL 1442); human lung cells (W138, ATCC CCL 75); human liver cells (Hep G2, HB 8065); mouse mammary tumor (MMT 060562, ATCC CCL51); TR cells (Mather et al., Aals XY, Accvd Sc. 383:44-68 (1982)); MRC 5 cells; FS4 cells; and a human bepatoma ,20 line (Hep G21). Host cells are transformed with the above-described expression or cloning vectors for CD20 binding antibody production and cultured in convenional nutrient media modified as appropriate for inducing promoters, selecting transformants, or amplifying the genes encoding the desired sequences. (vlii) Cu!iuring the lwst ce1s 25 The host cells used to produce the CD20 binding antibody of this invention may he cultured in a variety of media, Conmercially ava iable mnedia suc ais THam' F?10 (Sigma), Minimal Essential Medium ((MEM), (Sigma), RPM1-1640 (Sigma), and Dalbecco's Modified Eagle's Medium ((DMEM), Sigma) are Suitable for culturing the host Cells. In addition, any of the media described in Ham e aL, Meth, Enz. 58:44 (1979), Barnes ?etat, Anal Bloc.hem.102:255 (1980), U.S. Pat. Nos. 4,767,704; 4,657.866; 4,927,762; 30 4.560.655: or 5,122,469; WO 90/03430; WO 87/00195; or U.S. Patent Re. 30,985 may be used as culture media for the host cells, Ainy of these media may be supplemeted at necessary with hormone and/or other growth factor (such as insulin, transferrin, or epidermal growth factor), salts (such as sodium chloride, calcium, magnesium, and phosphate), buffers (such as HEPES), nuclcotides (such as adenosinc and thymidine), antibiotics (such as GENTAMYC1NTM drug), trace elements (defined as inorganic compounds 35 usually present at fina concentrations in the micromolar range), and glucose or an equivalent energy source. Any other necessary supplements may also be included at appropriate concentrations that would be known to those skilled in the art. The culture conditions. such as temperature, p-l, and the like, are those previously used with the host cell selected for expression, and will be apparent to the ordinarily skilled artisan. fix) Purification ofantibody 40 When using recombinant techniques, the antibody can be produced iniraceliularly, in the periplasmic space, or directly secreted into the medium. If the antibody is produced intracellularly, as a first step, the particulate debris, either host eclls or lysed fragments, are removed, for example, by centrifugation or ultrafiltration. Carter et at, Bio/Technlology 10:163-167 (1992) describe a procedure for isoladng antibodies which are secreted to the periplastmic space of . coI.F Briefly, cell paste is thawed in the 32 AMENDED STET E3316P'RCVD AT 4126,2005 2:48:59 PM EastemnDaylight Time]IVR:USP)T-EXRF-1126*DONIS:273082P C81D:650 952 9881 *DURATION (mm-ss):24-56 Attorney Docket No. P 990R3 I 13JUL 2004' 5 presence of sodium acetate (pH 3.5), EDTA, and phenylmethyisulfonylDuoride (PMSF) over about 30 min. Celi debris can be removed by centrifugation. Where the antibody i secreted into the ndjium, supernatants from such expression systems are generally first concentrated using a commercially available protein co nce ration fiter, for example, a' Amicon or Millipore Pell icon ultrafiltration unit. A protease inhibitor such as PMSF may be included in any of the foregoing steps to inhibit proteolysis and antibiotics may be 10 included to prevent the growth of adventitious otaminants. The antibody composition prepared from the cells can be purified using, for example, hydroxylapatite chromatography, gel electrophoresis, dialysis, and affinity chromatography, with affinity chromatography being the preferred purification technique, The suitability of protein A as an affinity ligand depends on the species and isotype of any imnunoglobulin Fe domain that is present in the antibody. 15 Protein A can be used to purify antibodies that are based on human yl, 12, or y4 heavy chains (Lindmark er a, I, Imnno. Meth. 62:1-13 (1983)). Protein G is recommended for all mouse isotypes and for human Y3 (uass e't a., EMBOQJ. 5:15671575 (1986)). 'The matrix to which the affinity ligand is attached is most often agarose, but other matrices are available. Mechanically stable matrices such as controlled pore glass or poty(styrenediviny)benzene allow for faster flow rates and shorter processing times than can be achieved 20 with agarose. Where the antibody Comprises a C13 domain, the Bakerbond ABXTMresin (J. T. Baker, Phillipsburg. NJ) is useful for purification. Other techniques for protein purification such as fractionation on an ion-exchange column, ethanol precipitation, Reverse Phase HPLC, chromatography on silica, chromatography on heparin SEPHAROSETM chromatography on an anion or cation exchange resin (such as a polyaspartic acid columo), chromatofocusing, SDS-PAGE, and ammonium sulfate precipitation are also 25 available depending on the antibody to be recovered, Following any preliminary pudfication step(s), the mixture comprising the antibody of interest and contaminants may be subjected to low pH hydrophobic interaction chromatography using an clution buffer at a pHf between about 2.5-4.5, preferably performed at low sah concentrations (e.g.. from about 0-0.25M salt). 30 Antibody cogiegates The antibody may be conjugated to a cytoToxic agent such as a toxin or a radioactive isotope, In certain embodiments, the toxin is calicheaiicin, a mytansinoid, a dolastatin, auristatin B and analogs or derivatives thereof, are preferable. 35 Preferred drugs/toxins inchade DNA damaging agents, inhibitors of microtubuie polymediation or depolymerization and antimetabolites. Preferred classes of cytotoxic agents include, for example, the Czyme inh ibitors such as dihydrofolate reductase inhibitors, and thymidylate synthase inhibitors, DNA intercalators, DNA cleavers, topoisomerase inhibitors, the anthracycline family of drugs, the vinea drugs, the mitomycions, the bleomycins, the cyrotoxic nucleosides, the pteridine family of dmigs, diynenas, the 40 podophyllotoxins and differentiation inducers, Particularly usefi members of those classes include, for example. methotrexate, moetbopterin, dichioromethorrexate, 5-fluorouracil, 6-mercaptopurine, cytosine arabinoside, melphaian, leurosine Jeurosidel ne, actinomnycin, daunorubicin, doxorubici n, N-(5,S diacetoxypentyl)doxorubicin, Morpholino-doxorubicin, 1-(2-choroehthiy)-1,2-dimethanesulfony hydrazide, Ntacetyl spermidine, aminopterin methopterin, esperamicin, mitomycin C, mitomycin A, actinomycin, 332 AMENDED SHEIT 34167'RCVD AT 4,12612005 2:48:59 PWI EastemnDaylight Time]*I SVR:USPi0&EXRM/I26 IDNIS:2730827*0CSID:650 952 9881 T URATION (mm-ss):24-56 Attorney Docket. No. P 1990R3 1 U 04 such as etoposidc or ctoposide ploSphail, vinblastinc Vicito, virajesinct laxol, taxolere, retinoic acid, butyric acid.. N-acety) spern)Jdie- canptothccin, ealicbeasicin. bryostatins, cephalostatins, anamitocin, .ctosirn, m a"Asinoids such aS DM- 1, rnaytansipe, inaytansirnol, N-lmreiy-4,5-! sepuxym aytans inol, C I 9-dechioninaytansinol, C-0-rdoyatnioC-20-demetboxymaytansigol, C-9tXSH Mavw(inol. C ) 0 14-aikoxytnsthbylmaytansiaolt, (>1 4-bydrxy or acetyioxymtetlihrnaytansginoll, C-IS hiydroxy/cvtYioExyyra,,v~nsinol, C-5 Sblixymaytansnol- C-11 9-N-deniethyh naytansinnl and 4,5 dcoxymaytansino), nuriStatills Stch aS dUriStatiB E, M, PIEnd PE3: dolostatins such a.- dolostarin A. dnootatin B, dolostatin C. dolostatin D), dolostatin E (20--epi and I i--pi), dolostafin 0, dolostati. H, doloslatin 1. dolustatin 1, dolostatin 2, dolostatin 3, dolostatint 4, dolostatin 5, dolosratin 6, dfoostatin 7, 15 dolostalin 8, dulustatin 9, dolostatin 10, Oeo-dolostatio 10, dolostatin 11, do utntin 12, dologratin 3 dolostatin 14, dolosmairi 15, dolostatin 16. dolostatin 17, and dolostatin 1 8; cephalostatins such as cephalostafla 1, caphalostatin 2, cephalostatin 3, rephalo,5tatin 4, cephalostatin 5. coplhA-ostatin 6, cphalostatin 7, 25'-epi-cephalostatin 7, 20ei elaot~n7, ctphalostativ 8, cephmilostatin 9, cnphalosatin 10, cepholostatin I JLephalostatin 12,cephaostasin I 3,ccphalostatin 14, ephalosjtatin 20 15 cephnlostatln I 6,cephalostatin 17. cephalostatin 18, and cephalostatfin 19.. Moytansinoids are ndtototic ii~bitors Which act by inkhibiting tubtdi n polymeacriin- Maytansisle was first isolatted from rte cast African shrub A4oyfretaa rerrata (U.S. Patent No, 3.996, 1]). Subsequently, it wa covered tiat certain. microbes also produce maytansinoids, soch as rnaytansino] arid C-3 rucytansinol cstcrs (U.S. Patent No. 4,151,4) Synthetic nuryvinsino4 and derivatives andanlge 21 theroof are Oisclosedi, for example, in U.S. Patent Nos. 4,137,230; 4,248,870, 4,256,746; 4,260,608, 4.20:5,814; 4,2.94,7.57; 4,307,01 <; 4,308,268; ,4,308,269; 4t309,429; 4,313,946; 4,315,929; 4,317,821; 4.322,348; 4,3 31,_598; 4,301,050; 4,364,866;- 4,424,219; 4,450,254; 4,362,66.3; and 4,371,533, thie disclosures or which -are hereby expressly incorporated by T-elerence. Maytansina and rnayransinoid.: have been conjugated to antibodies specifically binding to tumor 30 cell antigens, nmncauae containing maytanqinoids and their therapeutic u. e are dis>closed, for csarnple, in I L S. Paloni Nos. 5,20.6, 5,41 6,0t6- and Hurnpean Patent RP 0 425 235 T1 1. Ahe d czlo.sureq of which mw hereby expressly incorporated by reference. Liu et al, Pro. Nat). Acad. Sci- USA 93-861 8-9623 (1996) described nmunocojugates comprising a maytansinoid des-ignated DM1 linked to the monoclonal antibody C242 directed against, on an colorectal cancer. The conjugate Was found to be highly cytoroxic 35 towards cultured colon cancer cells, and showed antitum-or acrivity in an in v'ivtumorvgowth assny. Cbztri ef at. Can=e Research 52;127-131 (1992) dsre w oonugates in which a maytansinoidws conjugated via a disulfide linkcr to the mrinCia antibody A7 binding to an itntigen on human colon cancer cell lies, or to another murine wonoelonal antibody TA. I that binds; the 11ER 2Jneu oncugeuc. Themrare inany linking groups known in the art for snaking antibody-naytansinid conjugates, 40 includling, for example, those disclosed in U.S. Patcnit No- 5,208,020 or EP Patcnt 0 425 235 B I, and Chari ea l c r, sc 52: 127-131 (1992). The linking groups include disuifide groups- rhioether groups, acid labile groups, phorolabile groups, peptidase labile groups, or esterase labile groups, w% disclosed in the abov,--identffied patent-s, disufdlle and thioerther groups being preferred. 34 35167'ROVO AT 412612005 2:48:59 PM 1[astern Daylight Time] ISVRUSP)TO-EFXF11261 DNIS:2730827 *C810:650 052 §88-11 DURATION (mm-ss):24-56 Attorney iDockect No. P 199OR3 3J L20 15 Conjugate,, Yf the antibody and maytansinoid may be made using a variety of bifunctional protein ceouplimt agents; such as N-ccridy-(2yityiho)propionate (SPDP, succinimidyl4 -(N lejiontthyl cyiohxane. I-erhsylteintinoihliolane (t'I'), bifeunctionaldritve fidoas (such as dirnerhvi adivimidate 11CL), active esters (such asL- disuccinintidyl, suberate), aldehydes (such as glutareldehyde). bis'azido impounds (suelh as Wis (p-azidobentoy1) hs anediamine), bis-dia7onijam t0 derivatives (such as i-pdasnime l-tyladata) diisocyanates9 (such as toluene 2,ti diisocyanato), andhis-active fluorine compounds (such as I -iloo24-iirbneeParticularly prclrri-cd coupling agents include N-suoccinintidyl-3-(2-pyridyldith iio) propiontc (SPDP) (Carlsson e t. Riorhenn..1 173.723-,737 1 19781) an -ocnniy--(-yiy ~atnae(SPP) to provide for a disulfide linkage, is The linker may be attached to the rnaytansincoid molecule at various positions, depending on ffie type of the link. For example, an ester linkage may be formed b-y reaction with -a hydroxyl group using conventional coupling technhque's' The reaction. many occur at the C-3 position having a hydroxyl routh C-14 pnciti on mo.dified with hyrdoxyrnethyl, the C-15 position mnodified with a hydrrsxyl group, and the C ~fl osiionhavng ahydoxy grup.In a preferred embodiment, the linkage is formed at the C-3 position 20) of ronytansinol or a mruytansinol analogue, Caiichteaeicin Anothcer iatncnuaeof interest. comprises an CID2I) binding antibody conjugated to onc or more calicbearnic'in leetles, TIhe calicheamicin family of antibiotics are capable of producing double 25 stranded DNA break,- it sub-picoatolar concentrations. For the preparation of conjugates of the calicheaimicin family, see 11.patents 5,712,374. 5,714,586. 5,739,l 16, 5,767,285, 5,770,701, 5,770,710, 5,773,00] , ,877.296 (all to Arnerican Cyanamid Company). Structural analoguies of ealicheamicin which may be used include, but are not limited to, y7 ', cx' o~' N-acety1-', PSAG and 01i (Hinmoan er ci. Cancer Research 53: 336-3342 (1993), Lode et al Canwer eserch 58. 2925-2928 (1998) and tie aforementioned 30 U.S. parents to American Cyanamnid). Another anti-turnor drug tlhat the antibody can be conjugated is QF ~,hih s n ~f~a RoT~th ralirths-imirin and QFA tXv ~e.1ir itenato nd fl( n~l reMily rvoss the Plasma membrane. Therefore, cellular uptake of these agents tbroligh antibody mediated inmrritliAtion grepatly enhances their cytotoxice ffects 35 Radioactive isoiqpes For selective destruction of the tumor, the antibody may comprise a highly radioactive atom. A variety or radioactive isotopes are available for the production of inadioconjugated anti-CD20 antiJbodies. fixamples include At 2

'

1 it~YR',ks~ S '1~ 2 , ,P and radioactive isotopes of Lu,. When the conjugate is usecd for diagni&~5 ft.-may cortise a radioactive atom for 1cintigraphictudier. for 40 example to 9 9M or 12, or a pin label for nuclear magnetic resonance (NM[R) iaging alsoi known a,; magnetic res-anance imaging, mt-i), such as iedine-lMi again, iodine-!'31, inditim-Il1l, fluorio-19, carbonl 13, nitrogen-IS5. cmyge,-17, gadolinium, manganese'.r or on. The radio- or other labels may be incorporated in the conjugate in, known ways, For example, ilhe poptide way be biosynthesized or may lie synthesfred by chemrieni amnino avid syrithesis using suitable amino 35 361675RCVD AT 412612005 2:48:59 PM [Eastern Daylight Time] I SVR:IJSPTO-EFXRF-11J26I ON1S:2730827 C810:050 952 §881 1DURATION (mss):24-56 Attorney Docket No. P 1 990R3 1 acid preursors involving, for eraple, fluorne-l9 in place ofhydrogen, Labels such as t""' or i, Rc Re"I and Inm. can be attached via a cysteine residue in the peptide. Yttrium-90 can be attached via a lysine residue. The JODOGEN method (Fraker et al (1978) Biochem. B ophys. Res. Common. 80, 49-57 can be used to incorporate iodine- 23. "Monoclonal Antibodies in Imnmunoscintigraphy" (ChataLCRC Press 1989) describes other methods in detaiL 10 Conjugates of the anybody and cytotoxic agent may be made using a variety of bifunctional protein coupling agents such as N-succinimidyl-3-(2-pyridyldithio) propionate (SPDP), succinimidyl4(N manleimdomethyl) cyclohexane-1-carboxylatc, iminothiolane (IT), bifunctional derivatives of imidoesters (such as dimethyl adipimidate HCL), active esters (such as disuccinimidyl suberate), aldehydes (such as glutarcldehydc), bis-azido compounds (such as bis (p-azidobenzoyl) hexanediarine), bis;diazonium 15 derivatives (such as bis-(p-dizoniumbenzoyl)-ethylenediamine), diisocyanates (such as tolyene 2,6 dilsocyanate), and bis-active fluorine compounds (such as For example, a ricin immunotoxin can be prepared as described in Vitetta e at Science 238; 1098 (1987). Carbon-14 labeled 1-isothiocyanatobenzyl-3-mcthylidiethylene triaminepeonaacetic acid (MX-DTFA) is an exemplary cheating agent for conjugation of mdionucleotide to the antibody, See WO94111026. The linker may be a 20 cleavablee linker" facilitating release of the cytotoxic drug in the cell For example, an acid-labile linker, peptidase-sensitive tinker, photolabile linker, dimethyl linker or disulfide-containing tinker (Chari et at Cancer Research 52: 127-131 (1992); U.S. Patent No. 5,208,020) may be used. Therapeutic Uses of the CD20 binding Antibodies 25 . The CD20 binding antibodies of the invention are useful to treat a number of malignant and non malignant diseases including autuirmanunc diseases and related conditions, and CD20 positive cancers including B cell lymphoma and leukemias. Stem cells (B-cell progenitors) in bone marrow lack the CD20 antigen. allowing healthy B-cells to regenerate after treatment and return to normal levels within several rionths. 30 Autoinmune diseases or autoiimune related conditions include arthritis (rheumatoid mthritis, juvenile rheumatoid arthritis, ostcorthritis, psoriatic arthritis), psoriasis, dermatitis including atopic dermatitis; chronic autoimmune urticaia pclymyositis/denmatomyoitis, toxic epidermal necrolysis, systernic sclcrodcrna and sclerosis, responses associated with inlammiuatory bowel disease (LOD) (Crohn's disease, ulcerative colitis), respiratory distress syndrome, adult respiratory distress syndrome (ARDS), 35 meningitis, allergic rhinitis. encephalitis, uveitis, colitis, glomerulonephritis. allergic conditions, eczema, asthma, conditions involving infiltration of T cells and chronic inflammatory responses, atherosclerosis, autoimmune myocarditis, leukocyte adhesion deficiency, systemic lupus erythematosus (SE), lupus (including nephritis, non-renal, discoid, alopecia), juvenile onset diabetes, multiple sclerosis, allergic encephalonyelitis, iMMune responses associated with acute and delayed hypersensitivity mediated by 40 cytokines and T-lymmphiocytes, tuberculosis. sarcoidosis, granulomatosis including Wegeners granulomatosis agranulocytosis vasculitis (including ANCA), aplastic anemia, Coombs positive anemia, Diamond Blackfan anemia, immune hemolytic anemia including autoimmune hemolytic anemia (AITTA), pernicious anenia, pure red cell aplasia (PRCA), Factor V111 deficiency, hemophilia A, autoitmmune neutmpenia, pancytopenia, ldiseases involving leukocyte diapedesis, CNS inflammatory 36 3767 RCVD AT 4126/2005 2:48:59 PM [Eastern Daylight TimeI SVR:USPTO-EFRF-1,126 DNIS:2730827* CSID:650 952 9881 DURATION (mm.ss):24.56 Attorney Docket No, P I99R3 S 1 S 3 JUL 2004 5 dIaorders, niutiplc organ inuy syndloint, myasthenia 21.avis. 1-.tigen-antibody ctomple-x mediated diseases, ~-glomcrular ba'enmt membrane disease, anti-phospholipid an-ibOdy Syndrsrnc, allergic nevi~tis. BMechet disease, Castiesnian'5 -syndrionie, (joudpasture's Syndrome, Lambert-E-aton Myasthurlic SyndroM, Reyllaud's -yndromne. S orgen's syndrome. StevenSJkhnSOn syndrome, solid organ Ir anSPiant. ritOn (inClUding pratreatmi-t flor high panel reactive antbody titers, IgA deposit in tissues, etc), graft versus host disease TO (GWIlD), pemnphigoid bulices, pemphigus (al) including vulgaris, fo alceus)x autoimmune polyeodocrinuopathics, Raiter's disease, stiff-man sqyndrorme, giant cell artcrifis, immune complex nephritis, IgA nephropathy, 1gM polyncutvpathies or lglM mediated neuropathy, idiopathic tirrombocyrtopcnic purpura (7711), f hroinbouie throbocytopenic pur-pura (TTP), amtimatunc thomborytopenia, avtoimmunae disease of the testis and ovary including autoimttne ombitts and ophtifi, primary hypothyroidism;. autcimomune 15 endocrine discx including autoimmune thyroiditis, Chronic thyrninln TahnoosTyoditis)uaet troiditis, idilopathic hypothyroidism. Addison's disease, Gray&3 disease. autoimjtsunc polyglanclular tsyndronies (or polyelandular vndoeririopathy syndromnes), Tye IdaesalorircdtaxInu dependent diabetes mellitus ( DjDM) and Sheehan's syndrome; autoninmune hepatitis, L~ymphoid interstitial rincmnonitis (1-1,), bronclrlollids obliterans (non taruiplant) vs NSTP, Cluillain-Plarre' Syndrom, Large 20 Ves~sel Vasoea1is (;ncluding Polyinyalgia Rheumnatica arnd Gliant Cell (Takayasn's) Arteritis), Medium Vessel Vac-Alids (including Kawasiaki's Diseae arind 1-'uyartcritis Nodosa), ankylosingspondylitis, JBer ger's 01scase (igA nephxopatby), Rapidly Prgessive UJomcruluncptiritis, Primary bihiary cirrhosis-, Celiac sepmie (gltuten elftl'Opathy), Cryoglobuli.senia, ALS, corollary artery &S-Cas-v C.D20 positive Cancers,=r those, nimpriving abnormal proliferation of cell: that express CD1 on 25 the call surface- The C020 positive B cell neoplasms include CD2t)-positive Hodgkin's disease including lym-phocyte predomiinant Hodgkins disease. (TPHD); non-J-lodgkin's lympi oma (IL); folicular center cell (FCC) lympo. nas; acute lymnphocytic leukemia (ALL); Chronic iynphocytic jeukemia (CLL); flairy cell leukemia, The non-Uotlgkins lyniphomna include lowv grade/follicular non-H-odgkin's lymn ,nin (NRL), smoll l-yMpbocytic lyrnpihoro mLa intrrmediara gradelfollicular Nffl, infernoediate gade difmmse N1LE. 30 fiigh grade irniunoblastic NM~., high grade lymnphoblas5tic NHIL, high grade -small non-cleaved cell NIHL, bijlky disease; Nt-Il. plasmacmninid lymi hocytic ly mphom a, mantle cel lymphorna. AIDS- related lymnmea and Waldenstrorn's macroalohbulincmia- Treatment of rclapscK of these cancers arc also contemplated. L)P'JD is a type of Hodgkin'-- disease tbat tend to relapse frequently despite radiation or chemotherapy treatment at d is ch'~ae-ized by C1)20-positive malignart cells- C11, is one of fOur major rp es of 35, leukemnia. A cancert of imature B-Ceis called lymphocytes, CLL is manlfest"d by progressive accusnulation of cells in blood, bone metrow a nd 1 niPhatic tissues. In specific emabodi-ments, the humaised CD20 bindin antibodies and functional fragments thereof amc used to tr-eat. non-Hfodgkin'N lymphoma (NHL), lymphocyte predominant Hodgkini's disease (LPI-ID), small lymphdocytic Iamphoma (SL), cbxoonicr lymphocytic leukemnia, rheumatoid arthritis aid juvenile 4() rhauniatoid. arthriti,systecmic lupus cnythomnatosus (SEE) including lupus neplu'iids, Wegener' s disease, inflainmatory bowel disease, idiopathic thronihocytoponic purpura. (FTP), thrornbotic tlirobocytopcnic porura(TI),autimmnathrombhocytopenia, multiple sclerosis, psriaiisl, A neptiropathy, 1gMl polyneoropaties yasthenia gravis, vascul itis, diabetes Tnellitus, Reynaud' s.syndrome, Sjorgen 's syndrome and g'lomncrulonepliritis 3.7 E 38167-1 RCVD AT 412612005 2:48:59 PMi [Eastern Daylight Time] I VR:U8PTO.EFXRF.1/26 01118:27308271 CSID:650 952 9881 1 DURATION (mm-ss):24.56 Attorney Docket No. P1990R3 'PEA1 3 JUL 2004 5 The humanized CD20 binding antibodies or functional fragments thereof are useful as a single agent treatment in. e.g, for relapsed or refractory low-grade or follicular, C120-positive. B-cell NHL, or can be administered to patiems in conjunction with other drugs in a multi drug regimen. Tidolent lymphoma is a slow-growing, incurable disease in which the average patient survives between six and 10 years following numerous periods of mission and relapse. In one embodimeni, the 10 iumanized CD20 binding antibodies or functional fragments thereof at used to treat indolent NFIL. The parameters for assessing efficacy or success of treatment of the neoplasm will be known to the physician of skill in the appropriate disease. Generally, the physician of skill will look for reduction in the signs and symptoms of the specific disease. Parameters can include median time to disease progression. time in remission, stable disease. 15 The following references describe lympboias and CLL, their diagnoses, treatment and standard medical procedures for measuring treatment efficacy. Canellos GP, Lister, TA, Sklar JL: '-he Lymphomas. W.B.Saunders Company, Philadelphia, 1998; van Besien K and Cabanilias, V: Clinical Manifestations, Staging and Treatment of Non-Hodgkin's Lyrnpboma, Chap, 70, pp 1293-1338, in: Henatology , Basic Principles and Practice, 3rd ed. Hffnan et al. (editors). Churchill Livingstone, Philadelphia, 2000; and Rai, 20 K and Patel, D:Chronic Lymphocytic Leukemia, Chap. 72, pp 1350- 1362, in: Hemasology , Basic Principles and Practice, 3rd ed. Hoffman et al. (editors). Churchill Livingstone, Philadelphia, 2000, The parameters for assessing efficacy or success of tRatment of an autoiimmune or atoimmune related disease will be known in the physician of skiJ in the appropriate disease. Generally, the physician of skill will look for reduction in the signs and symptoms of the specific disease. The following are by way of 25 examples. n one embodiment, the antibodies of the invention are useful to treat rheumatoid arthritis. RA is characterized by inflammation of multiple joints, cartilage loss and bone erosion that leads tojoint destruction and ultimately reduced joint function. Additionally, since RA is a systemic disease, it can have effects in other tissues such as the lungs, eyes and bone marrow. Fewer than 50 percent of patients who 310 have had RA for more than 10 years can continue to work or function normally on a day-to-day basis. The antibodies can be used as first-line there py in patients with early RA (i.e. methotrexate (MTX) naive) and as monotherapy, or in combination with. e~g,, MTX or cyclophosphamide. Or, the antibodies can be used in treatment as second-line therapy for patients who were DMARD and/or MTX refractory, and as monotherapy or in combination with, e.g, MTX. The humani.ed CX20 binding antibodies are useful to 35 prevent and control joint damage, delay structural damage, decrease pain associated with inflammation in RA, and generally reduce the signs and symptoms in moderate to severe RA. The RA patient can be treated with the humanized CD20 antibody prior to, after or together with treatment with other drugs used in treating RA (see combination therapy below). In one embodiment. patients who had previously failed discasn-modifying antirheumatic drugs and/or had an inadequate response to methotrexate alone are treated 40 with a humanized CD20 binding antibody of the invention. In one embodiment of this treatment, the patients arc in a 17-day treatment regimen receiving humanized CD20 binding antibody alone (Ig iv infusions on days I and 15); CD20 binding antibody plus cyclophosphamide (750mg iv infusion days 3 and 17); or CD20 binding antibody plus methotrexate. 38 39/17*RCVD AT 4/2612005 2:48:59 PM [Eastem Daylight Time] ISVR:USPTOS.FXRF-1i26 DNIS:2730827 C81D:650 952 9881 1DURATION (mm-ss):2456 Attorney Docker No. P0OR3 IE / 13 JUL 2004 5 One method of evaluating treatment efficacy in RA is based on American College of Rheumatology (ACR) criteria, which measures the percentage of improvement in tender and swollen joints, among other things, The RA patient can be scored at for example, ACR 20 (20 percent improvement) compared with no antibody tMatment (e.g, baseline before treatment) or treatment with placebo. Other ways of evaluating the efficacy of antibody treatment include X-ray scoring such as the Sharp X-ray score used to score structural 10 damage such as bone erosion and joint space narrowing. Patients can also be evaluated for the prevention of or improvement in disability based on Health Assessment Questionnaire [HAQ] score. AIMS score, SF-36 at time periods during or after treatment. The ACR 20 criteria may include 20% improvement in both tender (painful) joint count and swollen joint count plus a 20% improvement in at least 3 of 5 additional measures: L patient's pain assessment by visual analog scale (VAS), 15 2. patient's global assessment of disease activity (VAS), 3, physician's global assessment of disease activity (VAS), 4, patient's self-assessed disability measured by the Health Assessment Questionnaire, and 5. acute phase reactants, CRP or FSR., 20 The ACR 50 and 70 are defined analogously. Preferably, the patient is administered an amount of a CD20 binding antibody of the invention effective to achieve at least a score of ACR 20, preferably at least ACR 30, more preferably at least ACR50, even more preferably at least ACR70, most preferably at least ACR 75 and higher. 25 Psoriatic arthritis has unique and distinct radiographic features. For psoriatie arthritis, oint erosion and joint space narrowing can be evaluated by the Sharp score as well. The humanized CD20 bindios antibodies of the invention can be used to prevent the joint damage as well as reduce disease signs and symptoms of the disorder. Yet another aspect of the invention is a method of treating Lupus or SLE by administering to the 30 patient suffering from SLE, a therapeutically effective amount of a humanize CD20 binding antibody of the invention. SLEDA sc-ores provide a numerical quantitation of disease activity. The SLED111 is a weighted index of 24 Clinical and laboratory parameters known to correlate with disease activity, with a numerical range of 0-103, see Bryan Gescuk & John Davis, "Novel therapeutic agent for systemic lupus erythematosus" in Current Opinion in Rheumatology 2002,14:515-521. Antibodies to double-stranded DNA 35 are believed to cause renal flares and other manifestations of lupus. Patients undergoing antibody treatment can be monitored for time to renal flare, which is defined as a significant, reproducible increase in serum crelinine, urine protein or blood in the urine. Alternatively or in addition, patients can be monitored for levels of antinuclear antibodies and antibodies to double-stranded DNA. Treatments for SL- include high dose corticosteroids and/or cyclophosphamide (HD0CC). 40 Spondyloarthropathics are a group of disorders of the joints, including ankylosing spondylitis, psoriatic arthritis and Crohn's disease. Treatment success can be determined by validated patient and physician global assessment measuring tools. Various medications are used to treat psoriasis; treatment differs directly in relation to disease severity. Patients with a more mill form of psoriasis typically utilize topical treatments, such as topical 45 steroids, anthralin, ealcipotriene, cobetasol, and tazarotene, to manage the disease while patients with moderate and severe psoriasis are more likely to employ systemic (methotrexate, retinoids, cyclosporine, 24016 RVD AT 4126/2005 2:48:59 PM [Eastern Daylight Timej t SVR:USPTO-EXRF-1/26 DNI:2730827 t CSID:650 9529881 DURATION (mm-ss):24-56 Attorney Docket No. P1990R3 5 PUVA and UVB) therapies. Tars are also used. These therapies have a combination of safety concerns, time consuming regimens, or inconvenient processes of treatment. Furthermore, some require expensive equipment and dedicated space in the office setting. Systemic medications can produce serious side effects, including hypertension, byperlipidemin, bone marrow suppression, liver disease, kidney disease and gastrointestinal upset. Also, the use of phototherapy can increase the incidence of skin cancers. In addition 0 to the inconvenience and discomfort associated with the use of topical therapies, phototherapy and systemic treatments require cycling patients on and off therapy and monitoring lifetime exposure due to their side effects. Treatment efficacy for psoriasis is assessed by monitoring changes in clinical signs and symptonas of the disease including Physician's Global Assessment (PGA) changes and Psorinasis Area and Severity 1.5 Index (PAST) scores, Psoriasis Symptom Assessment (PSA), compared with the baseline condition. The patient can be measured periodically throughout treatment on the Visual analog scale used to indicate the degree of itching experienced at specific time points. Patients may experience an infusion reaction or infusionelated symptos with their first infusion of a thorapeutic antibody. These symptoms vary in severity and generally are reversible with medical 20 intervention. These symptoms include but are not limited to, flu-like fever. chills/rigors, nausea, tujicaria, headache, bronchospasm, angioedcma. It would be desirable for the disease treatment methods of the present invention to Minimize infusion reactions. Thus, another aspect of the invention is a method of treating the diseases disclosed by administering a humaniriea CD20 binding antibody wherein the antibody has reduced or no complement depend cytotoxicity arnd results in redued infusion related symptoms as 25 compared to treatment with Rituxan@O. In one embodiment, the humnanized CD20 binding antibody is 2H7.v I I, Dosag e Depending on the indication to be treated and factors relevant to the dosing that a physician of ski 30 in the field would be familiar with, the antibodies of the invention will be administered at a dosage that is efficacious for the trenrment of that indication while mailing tox icity and side effects. For the treatment of a CD20I positive cancer or an autoimnune disease, the therapeutically effective dosage will be in the range of about 25mg/m 2 to about 400 mg/m t or 500 mg/ml preferably about 250-375mg/m In one embodiment. the dosage range is 275-375 mg/mi In one embodiment of the treatment of a CD20 positive J3 35 call neoplasm, the antibody is administered at a range of 300-375 mg/A For tie treatment of patients suffering from B-cell lymphoma such as non-Hodgkins lymphoma, in a specific embodiment, the anti-CD20 antibodies and burnanized anti-CD20 antibodies of the invention will be adrinstercd to a human pade't at a dosage of 10mg/kg or 375mg/M For treating NTIL, one dosing regimen would be to administer one dose of the antibody composition a dosage of 10mg/kg in the first week of treatment, followed by a 2 week interval, 40 then a second dose of the same amount of antibody is administered. Generally, NHL patients receive such treatment once during a year but upon recurrence of the lymphOtia, such treatment can be repeated. In another dosing regimen, patients treated with low-grade NHL receive four weeks of a version of humani7cd 2H7. preferably v16 (375 mg/m2 weely) followed at week five by three additional courses of the antibody plus standard CHOP (cyclophosphamide, doxorubicin, vincristine and prednisone) or CVP 40 E41167' RCVD AT 41262005 2:48:59 PM jEastem Daylight Time] t SVR:USPTO-EXRF-26 DNIS:2730827 CSID:650 952 9881 'DURATION (mm-ss):24-56 Attorney Docket No. I 990R3 IPEAU 1 3 JUL 2004 5 (cyclophosphamide, vincristine, prednisone) chemotherapy, which was given every three weeks for three cycles. For treating rheumatoid arthritis, in one embodiment, the dosage range for the humainirzd antibody is 125mg/n (equivalent to about 200mg/dose) to 600rg/n 2 , given in two doses, e.g., the first dose of 200mg is administered on day one followed by a second dose of 200mn on day 15. In different 10 cmbodiments, the dosage is 250mg/dose, 275mg. 300mg. 325mg, 350mg, 375mg, 400mg, 42Song. 450mg, 475mg, 500mg, 525mg, 550mg, 575mg, 600mg, In treating disease, the CD20 binding antibodies of the invention can be administered to the patient chronically Or intCrmittenly, as determined by the physician of skill in the disease. A patient administered a drug by intravenous infusion or subcutaneously may experience adverse 15 events such as fevcr, chills, buying sensation, asthenia and headache. To alleviate or miniroize such adverse events, the patient may receive an initial conditioning dose(s) of the antibody followed by a therapeutic dose, The conditioning dose(s) will be lower than the therapeutic dose to condition the patient to tolerte higher dosages. 20 Route ofadmnitration The CD20 binding antibodies air administered to a human patiem in accord with known methods, such as by intravenous administration, e.g., as a bolus or by continuous infusion over a period of time. by subcutaneous, intramuscular, intraperitneal, intracerobrospinal, iintra-articular, imrasynovial, nltsthecal. or inhalation routes, generally by intravenous or subcutaneous administration. 25 In on embodiment, the humanized 2H7 antibody is administered by intravenous infusion with 0.9% sodium chloride solution as an infusion vehicle. Combination Therapy In treating the B cell neoplasmns described above, the patient can be treated with the CD20 binding ,1 antibodies of the present invention in conjunction with one or more therapeutic agents such as a hemothompoutic agent in a rnuliidrug reginen. The CD20 binding antibody can be administcrmd concurreitly, sequentially, or alternating with the chemootherapeutic agent, or after non-rcsponsivencss with other therapy. Standard chemotherapy for lymphoma treatment may include cyclophosphamide, cytarabine, mlphalan and mitoxatrone plus meiphalan. CHOP is one of the most common chemotherapy regimens 35 for ircating Non-Hodgkin's lymphoma. The following are the drugs used in the CHOP regimen: cyclophosphamide (brand names cytoxan, neosar); adriarnycin (doxorubicin / hydroxydoxorublcin); vincristine (Oncovin); and prednisolone (sometimes called Deltasone or Orasone). In particular embodiments, the CD20) binding antibody is administered to a patient in need thereof in combination with one or moot of the following chemotherapeutic agents ofdoxorubicin. cyclophosphamide, vincristine and 40 prednisolone, in a specific embodiment, a patient suffering from a iyntphoRXa (such as a non-Hodgkin's lymphomea) is treated with an anti-CD20 antibody of the present invention in conjunction with CHOP cyclophosphamided, doxorubicin, vincristine and prednisone) therapy. In another embodiment. the cancer patient can be treated with a hunanized CD20 binding antibody of the invention in combination with CVP (cyclophosphamide, vincristine, and prednisone) chemotherapy. In a specific embodiment, the patient 41 AMENDED SHEET E 42167'R1VD AT 4l262005 2:48:59 PM [EastemnDaylight Time]' SVR:USPTD-EFXRF-il26 IDNIS:27308271 0810:6509052 9881 'DURATION (mm-ss):24-56 IPE/US1 3 JUL 2004 Attorney Docket No. P19901 3 5 suffering from CD20-poritive NHL is treated with humanized 217.v16 in conjunction with CVP. In a specific embodiment of the treatment of CLL, the CD20 binding antibody is administered in conjunction with chemotherapy with one or both of fludarabjinc and cytumn. In treating the autoimmune diseases or autoimmune related conditions described above, the parent can be treated with the CD20 binding antibodies of the present invention in conjunction with a second 10 therapeutic agent, such as an inumoul ppressive agent, such as in a mti drug regimen. The CD20 binding antibody can be administered con-CUrently, sequentially or alternating with the immunosuppressive agent or upon non-responsiveness with other therapy. The immunosuppressive agent can be administered at the same or lesser dosages than as set forth in the art. The preferred adjunct iumunosuppressive agent will depend on Many factors, including the type of disorder being treated as well as the patient's history. 15 "Immunosuppressive agent" as used herein for adjunct therapy refers to substances that act to suppress or mask the immune system of a patient. Such agents would include substances that suppress cytokine production, down regulate or suppress self-antigen expression, or mask the MHC antigens. Eyzamples of such agents include steroids such as glucocorticosteroids, e.g, prednisone., methylprednisolone, and dexametbasone; 2-amin--5-substimted pyrimidines (see U.S. Pat. No. 4,665,077), azathioprine 20 (or cyophosphamide, if there is an adverse reaction to azathioprine); bromocryptine; glutaraldehyde (which. masks the MIC antigens, as described in U.S. Pat. No. 4,120,649); anti-idiotypic antibodies for MHC antigens and MIHC fragments; cyclosporin A; cytokine or cytokinc receptor antagonists including anti interferon-y, -P3 or -i antibodies; anti-tumor necrosis factor-ca antibodies; anti-tumor necrosis factor-p antibodies; anti-intericukin-2 antibodies and anti-IL-2 receptor antibodies; anti-L3T4 antibodies; 25 heterologous anti-lymphocyte globulin; pan-T antibodies, preferably anti-CD3 or anti-CD4/CD4a antibodies; soluble peptide containing a LFA-3 binding domain (WO 901081 87 published 7/26/90); streptokinase; TGF-p; streptodornase; RNA or DNA from the host; FK506; RS-61443: deoxyspergualin; rapamnycin; T-cell receptor (U.S. Pat, No. 5,114,721); T-cel receptor fragoients (Offner et a, Science 251430,432 (1991); WO 90111294; and WO 91/01133); and Tce receptor antibodies (EP 340,109) such as 30 T 10B9. For the treatment of rheumatoid arthritis, the patient can be treated with a CD20 antibody of the invention in conjunction with any one or more of the following drugs: DMARDS (disease-modifying anti rheumatic drugs (e.g.. methvtrexate), NSAI or NSAMD (non-steroidal anti-inflammatory drugs), HUMIRAm (adaliniumab; Abbott Laboratories), ARAVA@- (lefluttom.tide), REMICADE@ (infliximabt 35 Centocor Inc., oflMalvern, Pa), ENTBREL. (etancrmept; Immunex, WA), COX-2 inhibitors. DMARDS commonly used in RA are hydroxycioroquine, sulfasalazine, nethutreante, leflunomide, etanercept, infliximab, azathioprine, D-penicillaminc, Gold (oral), Gold (intramuscular), minocycline, cyclosporine, Staphylococcal protein A immunoads option. AdalimumTab is a human monoclonal antibody that binds to TNFe. Iniximab is a chimerie monoclonal antibody that binds tTNFNFa. Etanercept is an 40 "intunoadhesin" fusion protein consisting of the extracellular ligand binding portion of the human 75 kD (p?5) tumor necrosis factor receptor (TNFPR) linked to the Fe portion of a human TgGIL For conventional treatment of RA, see, e.g. "Guidelines for the management of rheumatoid arthritis" Arflhritis & Rheumarism 46(2): 328-346 (February, 2002). In a specific embodiment, the RA patient is tMa ted with a CD20 antibody 42 43!67*RCVD AT 4262005 2:48:59 PM [Eastern Daylight Time] SVR:USPTO-EFXRF126* DNIS:2730827 CSID:650 952 9881 1DURATION (mm-ss):24-56 Attorney Docket No. P 199R3 IPE US 13 JUL 2004 5 of the invention in conjunction with metbotrexate (MTX). An exemplary dosage of MTX is about 7.5 25 rng/kg/wk MIX can he administered orally and subcutaneously, For the treatment of ankylosing spondylitis, psoriatic arthritis and Croba's disease, the patient can ho treated with a CD20 bindig antibody of the invention in conjunction with, for example. Renicade@h (infliximab; from Centocor Inc, of Malvern, Pa.), UNBREL (etanercept; immunex, WA), 10 Treatments for SLE include high-dose corticosteroids and/or cyclophosphanide (HDCC). For the treatment of psoriasis, patients can be administered a CD20 binding antibody in conjunction whih opical treatments, such as topical steroids, anthralirt calcipotriene, clobetasol, and tazarotene, or with anethotrexate, retinoids, cyclosporine, PIJVA and UVB therapies. In one embodiment, the psoriasis patient is treated with the CD20 binding antibody sequentially or concurrently with cyclosporine. i5 Pharmaceutical Formulations Therapeutic formulations of the CD20-binding antibodies used in accordance with the present invention are prepared for storage by mixing an antibody having the desired degree of purity with optional pharmaceutically acceptable cariers excipients or stabilizers (Remington's Pharmaceutical Scienes 16th 20 edition. Osol, A. Ed. (1980)), in the form of lyophilized formulations or aqueous solutions. Acceptable carriers, recipients, or stabilizers are nontoxic to recipients at the dosages and concentrations employed, and include buffers such as phosphate, citrate, and otier organic acids; antioxidants including ascorbic acid and methionine; preservatives (such as octadecyldimethylbenzyl ammoniun chloride; hextamethouium chloride; benzalkonium chloride, benzethonium chloride; phenol, butyl or benzyl alcohol; alkyl parabens such as 25 methyl or propyl paraben; catechol; resorcinol; cyclohexanol; 3-pentanol; and rm-cresol); low molecular weight (less than about 10 residues) polypeptides; proteins, such as scrum albumin, gelatin, or immunoglobulins; hydophilic polymers such as olyvinylpyrrolidone; amino acids such as glycinc, glutamine, asparagine. histidine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugars such as 30 sucrose, mannitol, trchalose or sorbitol; salt-forming counter-ions such as sodium; metal complexes (e.g. Zn protein complexes); and/or non-ionic surfactants such as TWEENrM, PLTRONICSTM or polyethylene glycol (PEG). Exemplary anti-CD20 antibody formulations are described in W09815641 8, expressly incorporated herein by reference. Another fornulation is a liquid iultidose formulation comprising the anti-CD20 35 aiibody at 40 ng/mL, 25 mM acetate, 150 mM trehalose, 0.9% benzyl alcohol, 0.02% polysorbate 20 at pH 5.0 that has a minimum shelf life of two years storage at 2-8"C. Another anti-CD20 formulation of interest comprises [0mg/mL antibody in 9,0 mg/mL sodium chloride, 7135 mg/aL sodium citate dihydrate, 0.7mg/mnL polysorbate 80, and Sterile Water for injection, pH 6.5. Yet another aqueous pharmaceutical formulation comprises 10-30 mM sodium acetate from about pH 4.8 to about pH 5.5. preferably at pH5.5, 40 polysorbate as a surfactant in a an amount of about 0.01-0.1 % v/v, trehalose at an amount of about 2-10% w/v, and benzyl alcohol as a preservative (U.S. 6,171,586). Lyopbitized formulations adapted for subcutancous administration are described in W097/0480'. Such lyophilized formiulations may be constituted with a suitable diluent to a high protein concentration and the reconstituted formulation may be administered subcutaneously to the mammal to be treated herein. 43 44167*RCVD AT 4/26/20052:48:59 PM [Eastern Daylight Time] t SVR:USPTOEFXRF-1126* DNIS:2730827 CSID:650 952 9881 *DURATION (mm.ss):24-56 REAMS13 JULZ200, Attorney Docket No, P1 990R3 5 One formulation for the humanized 217 variants is antibody at 12-14 mg/mL in 10 mM histidine, 6% sucrose, 0.02% polysorbate 20, pH 5A. Ti a specific embodiment, 2117 variants and in particular 2H7-vl6 is formulated at 20mng/mL antibody in 10mM histidine sulfate, 0ni0m.l sucrose,, 0.2 mg/mn polysorbate 20, and Sterile Water for Injection. at pHS.S. 10 Thc formulation herein may also contain more than one active compound as necessary for the particular indication being treated, preferably those with complementary activities that do not adversely affect each other. For example, it may be desirable to furthCr provide a cytotoxic agent, chemotherapeutic ngent, cytokinc or immunosuppressive agent (e.g. one which acts on T cells, such as cyclosporin or an anybody that binds T cells, e.g. one which binds LFA- I). The effective amount of such other agents IS depends on the amount of antibody present in the formulation, the type of disease or disorder or treatment, and other factors discussed above. These are generally used in the same dosages and with administration routes as described herein ur about from I to 9.9% of the heretofore employed dosages, The active ingredients may also be entrapped in microcapsules prepared, for example, by coacervation techrques or by inarfacial polymerization, for example, hydroxymethyicelilose or gelatin 20 microcapsules and poly-(mthylmethacylate) microcapsules, respectively, in colloidal drug delivery systems (for example, liposomes, albumin microspheres, microcmulsions, nano-particles and nanocapsules) or in mnacroemoisions. Such techniques are disclosed in Remigt's Phamaceudea!. Sciences 16th edition, Osol, A. Id (1980). Sustained-release preparations may be prepared. Suitable examples of sustained-release 25 preparations include semi-pcrneablC matrices of solid hydrophobic polyiners containing the antagonist, which matrices arC in the form of shaped articles, e.g. films, or nicrocapsules. Examples of sustained release matrices include polyesters, hydrogels (for example,. poly(2-hydroxyethyl-methacrylate), or poly(vinylalcohol)), polylactides (U.S. Pat. No. 3,773,919), copolymoers of L-glhtarnic acid and, ethyl-L glutamate, non-degradable ethylene-vinyl acetate, degradable lactic acid-glycolic acid copolymers such as 30 the LUPRON DEPOT- (injectable nicrospheres composed of lactic acid-glycolic acid copolymer and lcuprolide acetate), and poly-D-(-)-3-hydroxybotyric acid. The formulations to be used for in vivo administration must be sterile. This is readily accomplished by filtration through sterile filtration membranes. 35 Articles of Manufacture and Kits Another embodiment of the invention is an artcle of manufacture containing materials useful for the treanent of autoimmune diseases and related conditions and CD20 positive cancers such as non Hodgkins lymphoma. The article of manufacture comprises a conainier and a label or package insert on or associated with the container. Suitable containers include, for example, botles, vials, syringes, etc. The 40 containers may be formed fronm a, variety of materials such as glass or plastic. The container holds a composition which is effective for treating the condition and may have a sterile access port (for example the container may he an intravenous solution bag or a vial having a stopper pierceable by a hypodermic injection needle). At least one active agent in the composition is a CD20 binding antibody of the invention. The label 44 A 2 [mE SUF:T E 45/67*RCVD AT 4126/2005 2:48:59 PM[astemnDaylightTime] ISVR:USPTO.EXRF-126 IDNIS:21308271 C81D:650 952 9881 'DURATION (mm-ss):24-56 1 - - - - - -- r - - Attorney Docket No. P 990R3 1PEAU8 1 3 JUL 2004 5 or package insert indicates that the composidon is used for treating the particular condition. The label or package insert will further comprise iostructions for administering the antibody composition to the patient. Package insert refers to instructions customarily included in commercial packages of therapeutic products, that contain information about the indications, usage, dosage, administration, contraindications and/or warnings concoming the use of such therapeutic products. In one embodiment, the package insent indicates 10 that the composition is used for treating non-Hodgkins Jymphoma. Additionally, the article of manufacture may further comprise a second container comprising a pharmaceutically-acceptable buffer, such as bacteriostatic water for injection (BWF), phosphate-buffered saline, Ringer's solution and dextrose solution, It may further include other materials desirable feom a commercial and user standpoint including other buffers, diluents. filters, needles, and syringes. 1$ Kits are also provided that are useful for various purposes, c.g, for B-cell killing assays, as a posive control for apoptosis assays, for purificadon or imunoprecipitation of CD20 from cells. For isoladon and purification of CD20, the kit can contain an anti-CD20 antibody coupled to beads (e.g., sepharose beads). Kits can be provided which contain the antibodies for detection and quantitation of CD20 in vitro, e.g. in an ELISA or a Western blot As with the article of manufacture, the kit comprises a 211 container and a label or package insert on or associated with the container. The container holds a composition comprising at least one anti-CD20 antibody of the invention. Additional containers may be included that contain, e.g., diluents and buffers, control antibodies. The label or package insert may provide a description of the compostion as well as instructions for the intended in vitro or diagnostic use. 25 Cynomolgus monkey CD20 The invention also provides an isolated nucleic acid comprising the nucleotide sequence of SEQ ID NO.: 24 of the Cynomolgus monkey CD20 as shown in FIG 19. Tn one embodiment, the nucleic acid is a cDNA, In one embodiment, the nucleic acid encoding the monkey CD20 is in an expression vector for expression in a host celL Thc nucleotide sequence of SEQ ID NO.: 24 in the expression vector is operably 310 linked to an expression control sequene such as a promoter or promoter and enhancer, The expression control sequence can be can be the native sequence normally associated with the Cynomolgus CD20 gene, or heterologous to the gene. Also provided is an isolated polypeptide comaprising the amino acid sequence 1SE1Q 1D NO. 25; FIG. 19 & 201 of the Cynomolgus monkey CD20, as well as host cells confining the Cynomolgus CD20 nucleic acid In. one aspect the host cells are eukaryotic cells, e.g., CHO cells. Fusion 35 proteins comprising the Cynomolgus CD20 amino acid sequence or fragments of the sequence are also contemplated. Experimental Examples Examle 1 40 Humanization of 2117 anti-CD20 nudne monoclonal antibody Humanization of the urine anti-human CD20 antibody, 2H7 (also referred to herein as m2H7, m for marine), was carried out in a series of site-directed mutagenesis steps. The murine 2H47 antibody variable region sequences and the cineric 2)H7 with the mouse V and human C have been described, see, 45 c.g,, US. patents 5,846,818 and 6,204,023. The CDR residues of 217 were identified by comparing the 45 46167'ROVD AT 4!2612005 2:48:59 PM [Eastern Daylight Time] SVR:USPTO-EFXRF-i261 DNIS:2730827* CSID:650 952 9881 1 DURATION (mm-ss):24-56 Attorney Docker No. P1990R3 13J L20 5 aiiuo acid cquenee of the uisrine ZH7 variable dornains (disclosed in U.S. 5,846.81IS) with the sequences of known antibodies (Kabat Ct al., Sequences of proteins of irnn.1u21ological interest, Fd. 53. public Health Sc-vice, National Institutes of Health, B3atesda, MD) (1991 )). The CDR. rioroim for the light and heavy chains were defined based on sequence hypervariability (Kabatt et al, supra) and are shown in Fig. I A and Fig. 11B, respectively. Using synthetic olgonuce otides (Table 1), site..direcred utgnis(Kunkel. Proc. 11) Nad. Ariad. Sci, 82.488-492 (1985)) was used to introduce, all six of the niurince 2H7 MRD. reniOnS into a comTPi ,le human Fab framnework. correspondispg to a consenstis ISequenCE VrL VJII (VL kappa suhgroup .1, VIF subgroup lit) contained on plismuid pVX4 (Fig. 2). The phagemid pVX4 (1. 2) was used for mutagenesis a-, we] l as for expression of F(ab)s in E coi.1j 1Based on the phagemkl dpb0'720, aderivat.ive of pBO475 (Cunningham et ci,Science 24: 1330-1336 15 ( 1989)), pVX4 contains a DNA frag-ment encoding, n humanized consensus i-cwbgroup T light chain (VYLWd C,_) and a 'hunianized consensus subgroup III heavy chain. (VHWl-C 3 , 1) anri-JFN-rt (interferon a) antiboy. pVX4 also has an alkaine phospharase proinowe and Shine-Dahranoseun btdriefmaohr previously described pU1119-based plasturid. pAK2 (Carter et al., Proc. NatE Acad. Sci. USA 99: 4285 (1992)). A unique Spel restriction site was introduced between the DNA encoding for the F(ab) light and 2() heavy chains. Thec first 23 amino aeids in both .ni.F-thayand light chains are the SMI secretion signal seq uence (Chang er al., Gene 55: 189-196 (1987)). a deoxyuridine-eontaining tetmplate of pVX4;, all six CD~s ofanti.-)N-cs were changed to the marine 2HJ7 (2tI~z. The resultino molecule is referred to as humanized 2H7 version 2 (21 7.v2), or the -COR-swap 25 version" of 21-17; it has the m2M1 COB. resid ueswith the consensus humain FR residues shown in Figures I A and l B. Huminized 2I7,v2 was used for further humanization. Table .1 sbows the oligonuceotfide sequence used to create each of tbe muripe, 2117 (mr2l-17) CD~s in the H and 1. chain. For example, 9he (2DB-H I oioucsiewa. used to recreate, rhe n2H7 H Chain CMORI Ci)R-111, C0R-112 anid CDiR-1-1 refers to te H chbain (2DB 1, C0BR2 and C.DR3. respectively; .10 sinnilarly, CDR-Ll1, CDR-L2anid CDR-L-3 refers to each of the L chain C2DR-. The substitutions ia 7DR--2 were done in two stepij with two oligonuclcotidcs, CDR-142A nnd CMR-Mn2B Table 1. Oligunucicotide sequences used for construction of the CDR-swap of murine 2.H7 CIJRs into a hunian framework in pVX.4. R esidues changed by each oligonuoleotido are underlined., ubttion. Oligonucleofide se-querde, (2DB-A I CTAC ACC AM . (( AqC TAT 6AC..AT(, CAC T0CGT(.CG (SEQ ID NO. 27) CDR42A G ATT AAT C.T (lAG AAC 002 GAG AG AGC TAT AAC CACI AAG __17TiC AAG OCYC MO (SEQ TO NO2,-___) (21)1-T-ll~ (AA TOG O.TT QOCA C3(2( AT TAT CCT 00C AAC 0(2 (AC AC _ _ _ _ _ _ _ _ (SEQ ID NO. 29) ----------- --- CDR-..-13 AT TAT TOT oCIC CCA GIT0GT 6:f.T A TA-T -- A .6C-- AA-CACC TAC ,-,-T- ____________TAG 7 TGi AC G-It TGiG GGT CAA OCIA (SEQ ID NO. 301) COB..Ll C ITOG ACA GCC ACIC T-T TCT QTC ACI TAT ATCI CAT TO (,SEQ ID- NO. 3,1) __---------_---------------_ CDR-L2 AA C.-A (210 AlT TAG (3CCQA'1(0 AAC CEC 0(20 TOT CIGA CIT(.c C ,SEQ ID N0. 32) CDR-L3 TAT TAC TYT CAA CA.GTGO AQC 31(2 AAT CC-CI- CCC ACA 171' CA __________CAG (SEQ ID1 NO0. 33) -_ --- 46 .47/67 RCV0 AT 4126/2005 2:48:59 PtA [Eastern Daylight Time] I SWRUSPTO-EFXRF-1261 DNIS:27308271 C810:650 952 9881 'DURATION (mm-ss):24-55 Atorney Docket No. PI 990R3 IPEA S 13 JUL 2004 5 For cormpariso with humanized constructs, a plasmrid expressing a chimeric 21H7 Fab (containing murine VL and VN domains, and human CL and C1j domains) was constructed by site-directed mutagenesis (KunketL supra) using synthetic oligonucleotides to introduce the marine framework residues into 2R7,., The sequence of the resulting plasinid construct for expression of the chireri Fab known as 2H7.v6,8. is 10 shown in Fig. 3. Each encoded chain of the Fab has a 23 amino acid SAII secretion signal sequence as described for pVX4 (Fig.2) above. Based on a sequence comparison of the marine 2q7 framework residues with the human VjT,V 5 M consensus framework (Figures IA and I B) and previously humanized antibodies (Carter et al. Proc. NeaL Acad. Sci. USA 89:428'5-4289 (1992)), several framework mutations were introduced into the 287,v2 Fab 15 construct by site-directed mutagenesis. These mutations result in a change of certain human consensus framework residues to those found in the marine 2117 framework, at sites that might afiect CDR conformations or antigen contacts. Version 3 contained VH(R7 IV, N73K), version 4 contained VH(R71 V), version 5 contained Vk(R71V, N73K) and VL(L46P), and version 6 contained V11CR71V, N73K) and VI f(L46P, I A7W). 20 Humanized and chimeric Fab versions of m27 antibody were expressed in E. coli and purified as follows. Plasmids were tnnsformed into E. coli strain XL-1 Blue (Stratagene, San Diego, CA) for preparation of double-and single'stranded DNA. For each variant, both light and heavy chains were completely sequenced using the dideoxynucleotide method (Sequenase, U.S. .Biochemical Corp.). Plasmids were transiormed into E. coli strain 16(C9, a derivative of MM294, plated onto LB plates containing 5 gg/mil 25 carbenicillin, and a single colony selected for protein expression. The single colony was grown in 5 ml LB 100 pg/mil carbenicillin for 5-8 h at 37* C, The 5 mil culture was added to 500 mil APS-1 00 pg/mil carbenicillin and allowed to grow for 16 h in a 4 L baffled shake flask at 37'C. AlP5 media consists of: 15g glucose. 11.0 ycase SF, 0.6g yeast extract (cerdd) 0.9g anbydrous MgSO., I O7g NHCI, 3.73g KCI, .2g NaC, 120 mj ) M triethanolamine, p1 7.4, to 1 L water and then sterile filtered through 0- gm 30 Sealkeen filter. CcIls were harvested by centrifugation in a I L centrifuge bottle (Nalgene) at 3000xg and the superntant removed. After freezing for I h, the pellet was resuspended in 25 ml cold 10 81M MES-10 mM LDTA. pH 5.0 (buffer A). 250 pl of 0.1M PMSF (Sigma) was added to inhibit proteolysis and 35 ml of stock 10 mg/ml hen egg white lysozyrme (Sigma) was added to aid lysis of the bacterial cell wall. After 35 gentle shaking on ice for I ft, the sample was centrifuged at 40,00Dxg for 15 rmin. The supernatant was brought to 50 eml with buffer A and loaded onto a 2 nil DEAE column equilibrated with buffer A. The flow through was then applied to a protein G-Sepharosc CL-4B (Pharmacia) column (0.5 nl bed volume) equilibrated with buffer A. The column wa's washed with 10 ml buffer A and elated with 3 mr-l 0,3 M glycine, pH 3.0, into 125 ml. 1 M Tris, pH1 S.10. The F(ab) was then buffer exchanged into PBS using a 4o Centricor-30 (Amicon) and concentrated to a final volume of 0,5 ml. SDS-PAGE gels of A F(ab)s were run to ascertain purity and the molecular weight of each variant was verified by eletrospray mass spectrometry. 47 AM SDET E 4816P RCD AT 4126/2005 2:48:59 PM [aStemnDaylight Time]' SVR:USPT0-EFXRF-126 IDNIS:27308271 CSID:650 952 9881 * DURATION (mm-ss):24-50 Attorney Docket No. P1990R3 I1 3 JUL 2004 5 In cell-based BLISA binding assays (described below), the binding of Fabs, including ehineric 287 Fab, to CD20 was difficult to detect. Therefore, the 2H7 Fab versions were reformatted as full-length Ige1 antibodies for assays and further mutagenesis, Plasmids for expression of full-length IgG's were constructed by submoning the V 1 and Vu domains of chimeie 217 (v6.8) Fab as well as humanized Fab versions 2 to 6 into previously described 10 pRK vectors for mamalian ccl expression (Gormnan et al., DNA PrvL Eng. Tech, 2:3-10 (1990)). Briefly, each Fab construct was digested with EcoRV and l/pl to excise a V. fragment, which was cloned into the EcnRV/Bp sites of plasmid pDRI (Fig. 4) for expression of the complete light chain (VtCL domains). Additionally, each Fab construct was digested with Pourl and Apal to excise a VU fragment, which was cloned into the PvulApaf sites of plasmid pDR2 (Fig. 5) for expression of the complete heavy chain (Vii 15 CH1 -hinge-CHrCH domains). For each IgG variant, transient transfectioos were performed by cotransfLeting a light-chain expressing plasmid and a heavy-chain expressing plasmid into an adenovirus transformed human embryonic kidney cell line, 293 (Graham et a., J. Gen. Virot., 36:59-74, (1977)). Briefly, 293 cells were split on the clay prior to transfecion, and plated in scrum-containing medium. On the following day, double-stranded DNA prepared as a calcium phosphate precipitate was added, followed by 20 pAdVAntageM DNA (Frornega, Madison, WI), and cells were incubated overnight at 37VC. Cells were cultured in scrum-free medium and harvested after 4 days. Antibodies were purified from culture supernatants using protein A-Sepharose CL,41R then buffer exchanged into 10 atM sodium succinate, 140 mM NaC!, pH 6.0, and concentrated using a Ceniricon-10 (Amicon). Protein colcentrations were determined by quantitative amino acid analysis. 25 To measure relative binding affinities to the CD20 antigen, a cell-based ELISA assay was developed. Human B-lymphoblastoid WIL2.S cells (ATCC CRL 8885, American Type Culture Collection, Rockvi~le, MD) were grown in RPMI 1640 supplemented with 2 rM L-glutamine, 20 mnM HEPES, pH 7.2 and I0% heat-inactivated fetal bovine serum in a humidified 5% CO2 incubator. The cells werc washed with PBS containing 1% FBS (assay buffer) and seeded at 250-300,000 cell/well in 96-well round bottom plates 30 (None, Roskilde, Denmark). Two-fold serially diluted standard (156-1000 ng/ml of 217 v6.8 chimeric lgG) and threefold serially diluted samples (2.7-2000 ng/ml) in assay buffer were added to the plates. The plates were buried in ice and incubated for 45 nn. To remove the unbound antibody, 0.1 Lt assay buffer were added to the wells. Plates were centrifuged and supernatants were removed, Cells were washed two more times with 0.2 mnL assay buffer. Antibody bound to the plates was detected by adding peroxidase conjugated 35 goat anti-human Fe antibody (Jackson lmmunoResearch, West Grove, PA) to the plates. After a 45 mrin incubation ens were washed as described before. TMB substrate (3,3'5,5'-tetramethyl benzidine; Kirkegaard & Perry Laboratories. Gaithersburg, MD) was added to the plates. The reaction was stopped by adding I M phosphoric acid. Titration curves were fit with a four-parameter nonlinear regression curve fiting program (KaleidaGraph, Synergy software, Reading, PA). 'The absorbance at the midpoint of the 40 titration curve (mid-OD) and its corresponding concentration of the standard were determined. Then die concentration of each variant at this mid-OD was determined, and the concentration of the standard was divided by that of each variant, Hence the values are a ratio of the binding of each variant relative to the 48 AMENXE D :9 3N ' 49!67*RCVD AT 4126!2005 2:48:59 PM EastemnDaylight Time]* SVRUSPT0EXRF-1261DM18:2730827*ICSID:650 952 9881 'DURATION (mss):24.56 49 standard. Standard deviations in relative affinity (equivalent concentration) were generally +-10% between experiments. As shown in Table 2, binding of the CDR-swap variant (v.2) was extremely reduced compared to chimeric 2H7 (v.6.8) . However, versions 3 to 6 5 showed improved binding. To determine the minimum number of mutations that might be required to restore binding affinity to that of chimeric 2H7, additional mutations and combinations of mutations were constructed by site direct mutagenesis to produce variants 7 to 17 as indicated in Table 2. Tn particular, these included V. mutations A49G, F67A, I69L, N73K, and L78A; and 10 V, mutations M4L, M331, and F71Y. Versions 16 and 17 showed the best relative binding affinities, within 2-fold of that of the chimeric version, with no significant difference (s.d. = +/-10%) between the two, To minimize the number of mutations, version 16, having only 4 mutations of human framework residues to murine framework residues (Table 2) , was therefore chosen as the 15 humanized form for additional characterization. Table 2. Relative binding affinity of humanized 2H7 IgG variants to CD20 compared to chimeric 2H7 using cell-based ELISA. The relative binding is expressed as the concentration of the chimeric 2H7 over the concentration of the variant required for equivalent binding; hence a ratio <1 indicates 20 weaker affinity for the variant. Standard deviation in relative affinity determination averaged +/-10%. Framework substitutions in the variable domains are relative to the CDR-swap version according to the numbering system of Kabat (Kabat et al., supra), 2H7 version Heavy chain(V) substitutions Light chain(Vs) substitutions e 1ative binding 6.8 (chimera) (Chimera) 1 2 (CDR swap) (CDR swap) 0.01 3 R71V, N73K (CDR swap) 0.21 4 R71V (CDR swap) 0.21 5 R71V, N73K L46P 050 6 R71V, N73K L46P, L47W 0.58 7 R71V L46P 0.33 8 R71V, L78A L46P 0.19 9 R71V, F67A , L46P 0.07 10 R71V, F67A, 169L L46P .12 11 R71V, F67A, L78A L46P 0.19 12 R71V L46P, M4L 0.32 13 R71V [ L46P, M331 0.31 71V L46P, F71Y 0.2S 15 R71V L46P, M4L M331 0.26 16 R71V, N73K, A49G L46P 065 17 R71, N73K, A49G L46P, L47W 0.67 Attorney Docket No P1990R3 PE U 1 3 JUL 2004 5 rble 3 Oligonucleotide sequences used for construction of mutations VH(A49G, R7i V, N73K) and VI(TA6P) in humanized 21H7 version 16 (2H7.v 16). Underlined codons encode the indicated arnino acid substitutions. For V1 (R71V, N73K) and Vr (A6P), the oligos are shown as the sense strand sine these were used for mutagenesis on the Fab template, while for V 1 (A49G) the oligo is shown as the anti-sense strand, since this was used with the pRK (IgG heavy chain) template. The protein sequence of version 16 is 10 shown in Fig. 6 and Fig. 7. L $9inj _Oligomicleotide sequence __________________ V,, (R71VN73K) GT TTC ACT ATA ACT GTC GAC AAC TCC AAA AAC ACA TT _________ (SEQ TD NO. 34) _____ V_, JA490) CT (SEQ I) NO. 35) V (L46P) AACTCCGAAACCACTATTTACCT (SEQID NO.36 Exmpe 2 Antigen-binding determinants (paratope) of 2H7 Alanine substitutions (Cunningham & Wells, Scimcc 244: 1081-1085 (1989) were made in 15 2H7-vl 6 or 2H7,v17 in order to test the contributions of individual side chains of the antibody in binding to CD2X gG variants were expressed in 293 cells from pDR1 and pDR2 vectors, purified, and assayed for relative binding affinity as described above. Scycral alanine substitutions resulted in significant decreases in relative binding to CD20 on WIL-25 cells (Table 4). 20 Table 4, Effects of alanine substitutions in the CDR regions of humanized 2H7.v1 6 measured using cell based EISA (WJL2-S cells). The relative binding is expressed as the concentration of the 2H7.v16 parent over the concentration of the variant required for equivalent binding; henec a ratio <I indicates weaker affinity for the variant; a ratio >1 indicates higher affinity for the variant. Standard deviation in relative affinity determination averaged - 10%. Framework substitutions in the variable domains are relative to 25 2H7v16 according to the numbering system of Kabat (Kabat et at, supra). NBD means no detectable binding. The two numbers for version 45 are from separate experiments. 207 CDR leavy chain Light chain Rclativu binding version location substitutions substitutions 16 1-- ___ I _____ -kit.7

------

1-- -- ------------- ------ -- - 140 -1 G26A 0.63 14 HI Y27A 0.47 34 K T28A 0.86 35 H1 F29A 0.07 36 HI 130A - 0-81 37 H1 1S31A j 0.97 ---- 142 1Ul 32A 063 143 41 N33A NDB 144 LI IA M 34A2 145 -a H35A -0.25 q L -5 --- -------- - .(....... 146 R2 A50G - 1 ----------- t- -----

--

|47 P H2 151i N 0 65 50 51167'RCVD A T 412612005 2:48:59 PM [EasternDaylight Time] SVR:USPTO-EFXRF1261DNIS:2730827* CSID,'650 952 9881 *DURATION (mm-ss):24.56 ura'-Nu. 1 3 JUL I£UU4 IA trl~ne Docket No. P 1990R-3 38 ------ 15 2 ------ Y s 2A ----- -------------- 148 --S a _ _ _ - ---------- 0.66 39 1-12 :G53A J_ ______0,89 ___ 67 1H 2 IN54A j-_ _____1,4 [40 1-12 35 ____ 09 441__H2 D6A 1____ 0 19712 T57A __ _ ____0.61 90 S5-2 _____A_ 0.92 191 T-_ 2 Y.59A - 0.74 - 1 -6Q - ---------- 0.- ~93 T,-12 L-__ )61 A - ______J 9-1__ H72 Kj'62A jO.4 95 1.12 jF63A 0 ______f.5 [83 R2 Jy I A -_ _____10.96 149 ----- 12 K64A 0_____------ 15u j2 G65A _____1,2 153 1H3 :V9A - ________ 42 H713 1 V46A .0,99 43 3 Y7 - _____ 63 44 113 iY98A 0-.40 45 H13 ~S99A U4-___ O.8 092 F4__1-3 N 1OA H 13 1 00;aA 08 48___ H __3 .b100bA - -0.78_______ 49__---_-0 3 Ti00cA - [----------002 __9___ IY3]dA 0______98 ____ 6 0 H13 Jr 100CA - ___________ Hl_ 1-131t)01A _ _ _ _ _ ________ 15 H3 V102A .______ . --- ------- --- * A1 I2A________ 118 L I - A25 0,86 119 L I - 8126A 0.98 -120 Li S27A .0.98 121 LI1 - . 8.......... 28A ~ I0' 122 L I - - - 2914__0.4__ 50 LI - A3OA10.9f)____ 51 IL _______ QO 1 ILI K K3.A 1.0 __ 123 1 ....--------- --------------- 1 . L- I F , 1----------- 12_ - 2_ _ _ _ _ P 2 - --- -2 ----- 3--------- ... .__ _ .N 3 - - -------- f125 L2 i-i6 11K 4 52 1 :5267 CDAT 12620 5 3 :48:50 PM......... it)ter ;alih rn~SRUPOEXFI2 NS23 7 l60 §208 URT, m~.s:4 Atorney Dmkt No., P I99Rn 1 3 JUL2004 --------129 i!b3____ - 9A04 55 112 __ 4. W91 A08 56___ L3 592A 57 'F13 __ - - ---- -. 3A 0p36 ___ 5 N13__ 9 A jo.61 131 ILI ------- P95A- ______ B______ 032 11 _____ P96A LIs 1113 . 3 1______ P7A <04.22 Additional atuatons wi(Kue IH-1 CDR iregkfios Substitutions of additional residues and combinations~ of substitutions at CDRZ positions that wvere idiified as important by Aia-scaniting were also teste~d. Several combination variants, particularly v.96 10 appeared to hind mum. tightly than v. 16 Table 5. Effects of comb inationsa of mutations and no-kmcsbtnit~nn thc CDR region. of humanimed 2147.06 mXeaSUred U.SingC Cell-based BUMAS (W1I..--S cells), The relative binding to 1.201 is cxprfe,;sed w as tile conee tratihn of 08e 217,-v16 parent over the Co ncentration of the variant t'equired for 15 cqivalezu binding; hence a rati <1 iodw .t s weaker affinity for the variant$- a ratio >1 indicates higher affinity for the variant. Standard deviation in relari ve offlututy determination averaged +- 1017. Framework substitutonos in the Variabic domains are relative to 2HU7,V16 according to the numb~ering system of 1Kabat (Kabat at 3 1, soprez). 2H7 Hevthinjih chain J~e huiye binding ] 96f' D56A, N1 WA 97 S99T. N1 0GG Y1bl 0.99 98__ S99(1. N I OS, Y]O I 0___b______________) ____ 99 V 1000, Y OWb ___________'0.80 W1 N4S, .5611.7 1 2 N54K, D-56A --__-_----------- 0.48 10W 156A. NIOOA -___ --------2.1 104 S99T, N I0(JO 0 _____181 105 S99GiNI 00S - -- 106 MOQOG - __----__ 167 St 1 0aG, Y I 001mS ________ _____ 136 D56A, N I OA S56A, 592.- 2.6 137 ID56A., N I QA ___________A,551. 892A .1~. . __ 156 .D,56A, Ni I A S20A, S56A. 892A j2.1I___ 107 ID50A, Ni 00SA, Y IOObI I9Anot expre.;Ssed ____ 1 Y27W - .----- - ---- _------ 53107'RCVD AT 412612005 2:48:59 Pr~l [Eastern Daylight Time]j SVR:USPTO-EFXRF-I/261 ONIS:27308271 CS1D:650 952 9881 1DURATION (mm~ss):24-56 Atrrwney lThcket No. P1990R3 18 129Y ____ 18 V29W - ------ ---- 187 Y32W_______.

188 N33C _____D_______ 190 IN33Y ______ ____ i208 1-135S-

--

A~o ,50S .....-__-

---------

20 A5 Of' 211 ASOT. ... _-----_ ---- 16'9 Y 52J17 - - - - --- - --------- N170 !~4 D --- _-_-- Q. 25 0i72 1) *3 6 K_ _ _ _ __ _ _ ---------1 - - '173 D56R 174 D)56H- ----------------- L5j 175 1)56L1 ------------------------ 1. ~2 14 D 5 G ------ -__--_----------------- ~2 15 fD56-N -.- - ------__ __ __ - 216 Jp56Y

------

176 Y59W -_ _ _ __ _ _ ----------__ ---_ ----- 191 x.621)________ _______ 178 F63W -1 -_-----_--__-------- 179 F63y ...... __------ 157 ;Yk)7X 0._________ _______ 64 159 Y98W ------------ ___ -'1064 1160 Y98F ------ -__-_-----___ J 106 N100G ---- _ -__ _ _ -__ _ _ _ _ ------- ---------- 16,1 W 1I00cy ----------------------

---

162 _ l00dF___________ -------______ .2 16 3 F I ieY --- - __----- 0, f 64- F1i(0 c W 0______ .71 ___ 165 1)01 ___ ________ 0.64 166 S99G3.N 10013, S I 03D,Y iO0b deleted 0.99 1217 VJ02Y ______ ________I. ___ 53 E V23"'RCVD AT 412612005 4:38:33 PM~ jpastem DyllgNi Timfe) SVR'U8PTO-EFXRF-1i25 DNI18:2i30827 *C810:650 952 9881 'DURATION (mm-ss):0748 ;I'; 1 - 111. . -- --- - - - -- I. N U '1 3 J U L Z(U4 Attorney Dncket No, P I R3 192 - gF ________ _ 193 10_______~89N ____ 194 - _____________ QVOE ___ _____ ________- Q90N _ _ _ _ 196 1- _____________W91 Y 197 1-_ _ _ __ _ _ _ \ 9]1 F_-_----- 20)5 __________ 92N _____ _______ 20)6 - S920 -------------- 199 - -_ _ _ _ _ _ _ -- 3 -_-_-------- 204 _____!F93&.N94Y' 201 ML_____ _______ '6 202~--IP6 --------- _ ~ 2~ ~~_ ----------- ---------- P 9 6 R --------- 5 Mustatiom at qftes of frameawork huimaii~aton slabsiftuifono Substitution% of additional rosiduasat fram..ewnsk poitions that were changed during hum~anizationi 14) aeelso tested ini the 2HMvt background, In. pw! iUlar, alterntatijve fr=meWOrk SUbstitutions Lhl were neither found in the miiurine -W parcnt nor the hurnart consensuss fiancework wclre made Lit V,_(P46) and Vo(CS 4 O V7]1 and K73), These s;ubstitutions geneeaYb led to file cne is) relative. bitndbig (Jafie 6() indica10;1g t10t there is sumac flexibiity in framework residues ax these positions. Table 6. Reltive binding in a eefllbasud (W1L2-S) assay of ramiewoirk substitutions igG variants are Shown Withi rniuwiongs with respectmt the 2H7.v16 backgr-ound. The relative binding is cxpressed as the concentratioo of die 29l7Mt.8 chimera. over the, conecennation of the variant required forT equivalent binding; licnCe a rnti'o "0idiae weaker affinity for the variant; a ratio >1 indicates higher affinity Rw fthe varjant. 20 Standard deviation in relative affinity deterni nation avcraged +1- I 0%, Frametwork substitutions inl thle variable domnain~s ire relative to 21-7.0 6 according to~ the numbering systm ul' KabIA (Kabat et W.,zpr) (IM variants that Were' assayed wiih 247.vi 6 as the standard co-irparator: relative values are nonaiizod to that of tile Chimera, 21-17 hea vy chin 11ight Chain !Relative binding vision Isubstitutions !sski vtions

..........

___ ___ ----h-kn------ - - - -- -__ _ _ _ _ _ ---- - -- - - - - - - - - - - r, 9 K7!R _____ ____ 0.72 79 K731-1_______ ______ 0-49 1~ _ ------------- _- - - -----__- __--- 81 1V7f11 0.4___ )2 S 2 jV71T 0.59_____-____________________ 84 - 4 9-S ---------- -_ __ _ ------ _ __ _ _ 0.32 -------- _ GE 31231 RCVD AT 412512005I 4 33:33 PN1 [Eastern Daylight Tim~e] SV:ST.'XF12 1 DO IS:27308271 CSID:650 952 §381 DURATION (mtmis):748 IPEA/US 1 3 JUL 2004 Attorney Docket No. P199ORS R5 C491, 86 - P46Ej0.22 87 - P46V 0.51 88 P416T G08 049A, V71792A M L P46T 0.02-)6-A 109 |G49A, A49G, V7IT. K73R S92A, M32L P46T 0.026* I10 K73R, D56A, NI00A 592A, M321, Not expressed 1I1 G49A, V T, K73R46 I 12 049A, A50G, V7T. K73R 0. 12* *) Variants that were assayed with 2H7.v16 as the standard comparator; relative values arc normalized to that of the chimera, Example 5 Humanized 2H7 vadants with enhanced effector functions Because 2F7 can mediate lysis of B-cells through both complemenr-dependent cytotoxicity (CDC) 10 and antihody-deperdent cellular cytntoxicity (ADC C), we sought to produce variants of hunmanized 2H7.vi6 with improved CDC and ADCC activity. Mutations of certain residues witb the Fc regions of other amibodies have been described (Idusogie et a, J. Immunol 166:2571-2S75 (2001)) for improving CDC thni'ugh enhanced binding to the complement component Ciq, Mutations have also been descibed (Shields t at., J. Biol Chem. 276:6591-6604 (2001); Presta et a., Biochen. Soc. Trans. 30:487-490 (2002)) for 1 improving A DC through enhanced IgG binding to activating Fey receptors and reduced IgG binding tn inhibitory Feyreceptors, In particular, three mutations have been identified for improving CDC and ADXCC activity: S298A/E333A/K334A (alw referred to herein as a triple Ala mutant or Yariant; numbering in the Fe region is according to thc EU numbering systern; Kabat et at. supra) as described (Idusogie et al. supra (200 1): Shiclds et al, supra), 20 In order to enhance CDC and ADCC activity of 21-17, a triple Ala mutant of ti 2H7 Pc was constructed. A humanized variant of the anri-HER2 antibody 4d5 has been produced with mutations S298A/E333A/K334A and is known as 4D511c1 10 (Le_ and-p'FBR2 igGI (S298A/F-333A/K334A); Shields et al,, supra). A plasnid, p4DSFc110 encoding antibody 4D5Fc110 (Shields at a, supra) was digested with Apal and 1Lindtll, and the Pc-fragment (containing mutations 3298A/E333A/K334A) was 25 ligated into the ApuiJIIndWil sites of the 21B7 heavy-chain vector pDR2-v16, to produce pDR2-v3 I ' The amino acid sequence of thle version 31 complete H1 chain is shown in Fig. 8, TheLchain i the same as that of vI 6. Although the constant domains of die Fe region of IgGI antibodies are reladive~y conserved within a given species, alelice variations exist (reviewed by Lefranc and Lefranc, in Tt humanI gG sbclasses 30 soolecular analysis of sucnture, function, and rcgulaion, pp. 43-78, F Shakib (ed.), Pergunmon Press, Oxfbrd (1990)). Table 7. Effects of substitutions in the Fe region on CD20 binding. Relative binding to CD20 was measured in a cell-based (WIL2-S) assay of framework substitudoos. Fc mutations (*) are indicated by EU 35 numbering (Kabat, supra) and are relative to the 27v 16 parent, The combination of three Ala changes in 15 GE 4123*RVDAT 4120054:38:33 Phi[Eastem Daylight Time]' SVR:USPT00EXRF-125'DIS$:2730827*0CSID:050 952 9881 *DURATII0N(mms):U748 ItNUS 13 JUL 2004 Attorney Docket No. P) 990R 5 the Fe region of v.31 is described as "Fei 10." TgG variants are shown with mutations with respect to the 2H7.v 16 background. The relative binding is expressed as the concentration of the 2H7v68 chimera over the concentration of the variant required for equivalent binding; hence a ratio <I indicates weaker affinity for the variant Standard deviation in relative affinity determination averaged +/- 10%. 2--7 i PC Relative version Substitutions* binding - --------------- -- ------ 7i 16 0.65 3298A, E333A, K334A . 062 10 Example 6 Humnanized 2H7 variants with enhanced stability For development as therapeutic proteins, it is desirable to choose variants that remain stable with respect to oxidation, deamidation, or other processes that may affect product quality, in a suitable 13 formulation buffer. Tn 2HT v1i6 several residues were identified as possible sources of instability: V. (M32) and VH (M3;4, Ni 00). Therefore, mutations were introduced at these sites tbr comparison with vI 6. Table 8 Relative binding of 2M7 variants designed for enhanced stability and/or effector function, to CD20 in a call-based (WTL2-S) assay. gG variants are shown with mutations with respect to the 21-17.v]6 20 background. The relative binding is expressed as the concertration of the 2117,v6 chimera over the concentration of the variant required for equivalent binding; hence a ratio <1 indicates weaker affinity for the variant. Standard deviation in relative affinity determination averaged +/- 10%. Framework substitutions in the variable domains arc relative to 2H7.vl6 according to the numbering system of Kabat and Fe mutatins (*) are indicated by EU numbering (Kabat et al., supra), (**) Vaiants that were measured 25 with 2H7.06 as the standard comparator; relative values are nurmalized to that of the chimera, Additional F-' mutations were combined with stability or afinity-eabncing mutations to alter or enhance effector functions based on previously reported mutations (Idusogic et al, (2000); idusogie et M. (2001); Shields et aL (2001)). These changes include S298, E333A, K334A as described in Example 5; K322A to reduced CDC activity; D265A to reduce ADCC activity; K326A or K326W to 30 enhance CDC activity; and E356D/M358L t o test the effects of allotypic changes in the Fe region. None of these mutations caused significant differences in CD20 binding affinity 2M Heavy chain Light chain Fc changes Relative version i (Vn) chamgcs (Vt) changes 1 ------------- --- b-- 6.1 (chimera) chimeraa) - 16 . 10,65 62 'M321 046 63 IM34. ----- - 0,49 64 1 OA

------

65 -0LNIOA L47W- 074 66 S99A L17W 0.72 __ _ __ _ _

...

_ _ _

..

__

...

2 67 N54A - - ------------- 56 WE 5623ROVDAT 42612005 4:38:33 FM Easte Daylight Time] SVR:USPTO-EFXRF-1/25 DNIS:2730827* CSID:6509529881 DURATION (mm.ss):07-48 Attorney Docket No. P1 990R3 169 - -------- - _ __ ---------- 0, 170 Ni OA - S294SA, 11333.A, K334A 0~ 17 N I (Y]____ -S2911A, ES'33A, M'324A _ 0.44 '72 IOOIA M321 ___1 11 13 NINOA _ M3ML-______ 0.53 74 NI{IA__ _ M3 21 ~ S299A, 19333AKX334A 0___.61 15 N 100A 13211 9$29M3, F3.33A, K334A GA.6 - .- E356D, M3. ________ 14 _D56k. NIOOA [M32L,S92A 52991A, E333A, 1334A 15 156A, NI0UA M~32L, S92A S298A, 1333k, K334A, 1951.151 .4P* I" - -- 56A, NI 00k 'M32)L S92A 8298A. .K334A, K322A .2 It. 1)56k, NIOO0A ,M12L, 592A 19356D1), M3581-, PY265A 15* 113 1356A, Ni I00k 1432L, 592A 19356iD, M.358L,D265A, K3:)25\V j-___ O~~ 1 .3 1)56A, N 10 WA1W2L 92A 8298k. 8~333A, K334A, ICL26 -12A* 1 1199 D56A, NI0OOA M%321, S92A S298k. 8333A, K334A, K326A, 19356N, N1358L TlI7 15)4 if ____ D265k 0* I -- n5 1 _____5298A, Y322A, X334A _________ ___ ('~)V~rims hatwer asue4 ith2H-7.v1 6as comparat.Or; relat'vc hinding- values are norroalixed co that of the chimera. Tio test the effect of stability snutations on the Y.ate of protin degradati xn, 21H7 v 16 and 2k17, '7 wereforulatd a i2-~l #VjL in 10 VNIM hisddime 69v Sucost, 0.02% polysorbale 20, pH 5.11an incubated at 40'C for 16 days., Thec incubated Lmaples were tbon z!s--atvycd for changes in diagc variants by 11c necroaorpy egreatjo-.- and frau.ncrtation by size, exclusion chromaorpy n 10P relative binding by testing in a cell-based (WMh2-S) asitsay. The .suts Fi_ 9) .how that 2M7 v.73 has greater stability compared o2-7 .6wt rsett loq5&es in tile fraction of ma1.in peak by ion exchange chromatography UndEr accelerated stability conditions. No Significant differences Ware seen with respect to aggregation, fi'asinc-tation, orz binding affnity 15 Exsmple 7 Scatchard amalysis of antibody binding to CD24) on W=L-S cells Eiijuilibriuna dissocintion constants (K were determined fo- 2H97 IgO variant-Cbinding to WTl2 -S ccll using radiolaibefed 21-r! IgO. IgO Variants Weres prodsxedin CHO cellS. P34nntano (source Aor P111 exmperments& is Gcncntoch,1, S. San 1rancisoo, CA) toid murine 2F,7 (fit) Phwrlingen, San 1)iago, CA) were 20 used For comparis-or WWIt KiaaniZed vaj;Rians. ""he marine 217 infibody is algo available from other sources, cg., efliocitnec. and Calbiocheni (both of San Diego, CA), Accurte Chem.1cl & Scientific Corp , (Westbury, NY). Anceli (B~ayport, MN), and Vic-~olei(Vinci, Italy), All dilutioas we've por ormed it) bindig assay buffer (MMedacontaining I% bo)vine serum albumin, 25 nuW 1119P19 pl-I 7,2. and 0.0 1% srodiuin azidc). Aliquots (0.025 mL) of' 12 5 j 2]7v16 (iodinated with lacco-paroxidase) at a 25 concnmation of 0.11 nM were dispensed ino wells (if a V-bottom 96-well rvieroassay plates, and sci-al dilution's (0.05 rnt,) of cold antibody were added and mixed, WTL2- cell (60,0(0 culls in 0.025 mL) wore thon ared. The plate was sealed and incubated at roomn temper-ature for 241h, then centfifuged for 15 min at 3,500) RPM. 'Thle supernataInt was thien aspirated and the call pellet was washied and centrifuged. The QE 6!2j RCVD AT 412612005 4:38:3 PM~ EEasteivn Dayight Time] SVRUSPTO-ERFII25 I N18:27130827 CSID:650 §52 981 'DURATION (mn~ss):0748 Aitorncy Docket No&. P I 99}R3 5 4upceliatart waxs again aspirated, and the pellets were dissolved iii IN NaOl-{and transferred to tubes for pg1r111a counting, 'Ihe dat(a Were used tRw Scatchard analysis (Munsnn and Rodbard, Ancd. Lqtudwn. 107:220-239 (19810)) using the program TJigand (McPherson., Con, ??W. Prosgramsr Boed. 17: 1 07- 114 affinity as Compared to Inurine 21P1. and similar binding affinity to Rituxan® It is expected that 2H-7.v3 I W0 will have. very similar Kd to v,.16 on tho basis of the binding %hown in Table ~7 above. Tbe9, Equilibrium bindinga affinity of 2H17 variants from Seetehard analysiUS 1Anti body variant W, a) n Rir~an0.99+049 3 S2M-1 (inurine) 1,23+0'29 3 2H7,vlO 0.84+1;0.37 4 2F17,v73 1,22+0.39 4 2117.v75 1.09+0-17 {4 1.5 Copement Dependent Cytotox~kty (CDC) Assays 21-17 lgG variants were assayed for their ability to mediate cmpiement-dcpendent lysih of WiL2--S cells.. a (2D2() expressing lyniphoblnaswid B--cell line, essentially as described (idusogice et al-, . b~~n Ib4-:4178-4184 (2110); idusogie, ct al- J. 1hwrwnoL 1 662:2571 -2575 (2001)). Antibodies were serially diluted 1 :3 from a 0,.1 mg/niLJ stock solution. A 01.05 rnL aliquot of each dilntion was added (c a 96--well tissue 201 cuhure Owne that conlainqfd 0.05 ml, of a. solution of normal human complement (Quidel. San Diego, CA) To this mixture, 50,000 WIL.2-8 cells were added in a 0,05 ail, volipme, Allice incubation fir 2h at TC, 0.115 niL of a solution of Alasnar blue (Accumed loreroatloan!l, Westlake, OH-) was added, andinuaio was oniedoraadiinl181 at37"C. Covers w~vte eoe rmtep atealdthey wee shaken fbr 15 win a( rooms 1tXapt-ature on an orbital shaker. Relative fluoresc-ent units (RFU) were rend 2.5 osigig a 530 n excitation filter and a 590 nm Onission filter. An EQ 5 O wis calculated by fitting RFIJ as a ftinction of concentration fo~r each antiody usng Kliarptsofrtware, 'I'le results ('labje 10) Show S'Jrprising improvement in CDC by hurnanixed 2-H7 antibodies, with relative potency similar to Rituxari® for v-73, 3-fold more potent than'RituaxanO fo~r v.75, and 3-fold weaker than Rituxan@ fur V. I6, .30 Tsible 10,. CD)C oed-vity of 2117 anitibodies compared to Rituxan. Numbers >'1 indieake less potent CDC activity than Rituxant' and numbers <1 indicte mroue potent activity than RitumanOD. Anid~iesq were produced lFrom stable C21-10 lines, except that those indicated by ()were produced transiently. 214-7v 16 4. 3.72; 4.0 ________ _______ 21-17.v3l 4 2,21 _______ R1.7.03 4 1,05 12F17,v75 __J4 & -9.3 ____________ E 7i23 RCVD AT 4126,12005 4:38:33 R1 j asfem Daylight Time] I SVR:USPTO-EFXRF.I!P.5 ONIS:2730827 1 COMO: 952 9881 DOURAT1ION (mms):743 Aiunrncy D(W-ket qn P1990R3 2 1.17.Y96-1 4______ 2H7.vl We__4_______ 2H~7.vl 15* 4 0.475 2H~7.v 116* 1- >100 _________________ l2H-7_v 1 35*# 2 10.42 --- ------------ ___ 9ExamDple 9 .4nibradv l3epoidex;t Cellular C3,WWtit-Y fAD(CU) Assays 2117 IgG viuanta were assayed for- their ability to mediate Natural-K&iiler ccU (NI( ecll) lysi9 of 1l WIL2'S cellh, a C.12(icxp essing lynehobla,5gtoidPl-ce1l line, e,,sentlally as described (Shields et al.,J. BalL CI~am.276659-664 t001) uinga actte elidtoonac (DF-) radot.NI cells were prepared from I 0)rfalLof ipineed blodJ, diluted with 100 mn..of PBS5(phosphate buffere4 saline), obtained fromt normal humaun donors vho had been isotyped for FdyRJJI1, also ktoown as CD 16 (Kocrie et al., Blood 90:1 109-1114 (1997)). In this experiment, the NK ccll% were from human donors herryygous f 1,C 16 15 (F15 81V 158). The dil uted bloo-d was layered over 15 rnll of lymphocyre reparation medium (ICN lBiochuemical, Aurora. Ohio) and oentrifugcd Our 20) ii at 2000 RPM, Wvhit. cels at thic f.ceac between layers were dispensed to 4 clean 50-mL tubes, which we~ra filled with RPM[ medium containing 15% fbtal calf serum. Trubca wctre centrif-uzed frw 5 min at 1400 RPMI and the supernatant discarded. Pellets were resus.,pended in MVACS buffFer (0_5f9)'WSA, 2n-M EDTA), and NT( cells were purified u!3ing beads (NK Cell 2f) Isolaflion K~it, 130-046-502) according to the mn oifacturer's pxoto-col (MiJltenyiitah) NK cells wene diluted in MA CS bufier to Zx]10 6 eellshr.L, Serial diludonss of antibkdy (0.05 OiL) in assay medium (l'12DINIUM 50:50 without glycine, Im, HIIPE~S buts'ee pAi 7,2, ~nii~nSrjoyi (100 unit~mL; Giben). glutamine, and I% heat-inactivated fetal bovine serR30) were added to a 96-well round-bottom tissue culture plate. WlVL2-S ealls were diluted in 25 as~say butficr to a concentration of 4 x 105hiiL, WIL'2-S cels (0.05 rob, per well) were miixed with diluted antiblody in the 96-wcll plate and incubated for 30 mn at room temperature to allow binding of antody to (7)21 (opsoni7-ation)_ '1'he ADCC reaction was iiinnt,.r by q2dj1nff 0 1 MTr. 4n+NKjf uprulfCi 4~sh o In funfri wvli 7r2; Triton X-101) was added. The 1plate Wa- then incubated for 4h at 37-C_ ILevels of LDH- released wce 3I) moasured %si1g a cyltoxiciry (UN-I) de~tection kit (Kit# 1644793, Roche DiagnosticS, In~dianapolis.Idi, . following rte auacresinstructions. 0. 1 roL of LDH developer was added to eaich well, followed by lnli~iflf for log, The p3ate w"s then :covere-d with aluminum foil and incubated in the dark at room temperature Imr 15 min, optical density' at 490 n) was then road and use to calculate q,, lysis by dividing, by thet total WT-I measured' in control wfells. !Ly'i% was plotted asa function ofatbd ocnrtoand a 4 35 paramreter curve fit (KaleidaGra',hj) was% I)sed to0 deter-mine FC9 0 conclentrationS. The results shiowed t. hutnni~zd 2.17 ntbdewreactive in AI)CG, with relative potecy 20 f15ld h ig her t han Ri tu mun_ For v,31 and Y,73, 5-40old 11o0re po0tenit thFinn R!iruxp n (D for v.1I6(, a ndc a 1mo 4st 4-fn ld higher than RIJuxan® for v.73, 59 GE 8123 '1100 AT 4/2612005 4:38:33 PrO [Eastern Dayighl Time] SkIR:USTO-EFXRF1i1251 DNIS:2730827 1 CSID:650 952 98811 DURATION (rmis):0743 A uorney Docket No. P I990R.3 5 Toble 11, ADCC activity of 21-17 antihodijes on W1L2M cells compared to 214.vi 16, based on n ex perien fs. (Val u e > I ind icate lower potency than 2H37.v 16 r anf d val ues < I indicate greater potcna-y-) Rituxan® -__ _ _ _ - _ _ __ _ -5.3- -- ------- 21 7x3 1 0.24 2H7.v73 5 1.4 2H7 v75 __ 4 0.25 Additional ADIXC amsys were carried out to cmpare coroblanaon-variant& of 217 ith Rtuxan,& 10 The minslts of these assays indicated tbat 2H7.vl 114 and 2HI1.vl 15 hive > 10-Pbld imprmved AIY2C )Oteicy a% compared to RilayanQ9 (Table 12), Table 12. ADCC activity of 2.7T antibodies on W1L2-S ells compare to Risux-304% based on it exariments (Values >1 indicate lower potency them RituxanM, and viflues <1 indicate. greater potey). 15 ~Artibnl arin t0vrat)C9(itsn Ritwu anu ---- _ _ __ _ __ _ _ _ 2_-1-__-_---------------- 2FI7 v.16 2 052 ___ ______ 21-v.96 - ----- 2- Q581_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 2H7.vlI 14 2 '0.093 _______________1 21-7,vi 16 2 001 In vivo effimts of 21-1 vuranrs in a pilot s tudy in cynomaligus mnonkeys 2T-17 variariLN, produce-d by traasizent tasscinof CHOG cells, were tested in normal male, 20 cynognolgus (M~arrafasricufarls} mn-nkeys in order to evaluate their in Vvo activities, Other anti-CT)20 anfibodics sudb as C2138 (Rituxan-) have demonstrated an ability to deplete B-cells in normal primates (Rel fjet al., lOd 83: 435-44.5 (19,94)). In one study, huinanized 2,147 variants were romparei., In a par-alle] study Rituxan®10 was also tested in cynoni-olaus monkeys. Fouur monkys were used in each of five dose groups: (1) vehicle, (2) 0.00 2,9 mg/kg Itt2l-5.6, (3) 10 mg/kg hu2117.v1 6, (4) 0,05 mg/leg bu110H7.01, and (5) 10 mnglkg hu9,Tl7.v3I. Antibodies were administcredl intra-venously at a concentration ofi0, 0.2, or 20 mglroL, for a total of two doses, one on day I o-fthe study, and another on dlay 8. The fivst day of dosing isdesignated day I and tha previous day is designated day -1 the first, day of feauvery (for 2 animals in each group) is designated as day It. Mlood saMPle.S were COlt'ed ont days -19, -12, 1 (prior to dosing), and W, Oh, 24h, and 72-h 10 following the fIrst dose. Additional samples were taktrn on day 8 (prior to dosinp), day 10 frior to sacrifice oif 2 Uniain s/RoUP), Rnd Wn days 36 and 67 (frW reCOVery finimals). pcriphe:ral 13-cel Ooncatrations ware detenrmined by a PACS method that counted CD34)CD40+ cohns. ntheperccnt of(;D-CVj40± 3 Cell3 Of to0tal lyrnphOCee in monkDey sai'mples were obtained by the following garia~g Strategy. The lymphocyte population was marked on the Frward ocatier/ tide scatter 60 GE 9,23 *RCVO AT 412012005 U1~833 RA Eastern Daylight Time] ISMRUSPTO-EFXRF-1/125 IDNIS:27308271 CSID:651 952 9881 'DURATION (wmSS):0748 - IPEMJS 1 3 JUL 2004 Ntoey tDoct No. P1 990R3 5 scattergram to define Region I (R 1). Using events in R I, fluorescence intensity dot plots were displayed for CD40 and CD3 markers, Fluorescently labeled isotype controls were used to dletermnute respective cutoff points for ()40 and CD3 positivity. The results indicated that both 2Hv1t6 and 2H7.v3 1 were capable of producing full peripheral B cell depletion at the 10 mg/kg dose and partial peripheral B-cell depletion at the Ml5 mg/kg dose (Fig. i. 1). J0 The ame course and extent of B-cell depiction measured during the first 72h of dosing were similar for the two antibodies, Subsequent analysis of the recovery animals indicated that animals treated with 2H7.v31 showed a prolonged depletion of 33-cells as compared to those dosed with 2H7.1 6, In particular, recovery animals treated with 10 1gkg 2H7.v16, B-cells showed substantial 3-cell recovery at some time between sampling an Day 10 and on Day 36. However, for recovery animals treated with 30mg/kg 2-17.v31, B-cells 15 did not show recovery until some time between Day 36 and Day 67 (Fig I 3). This suggests a greater duration of full depletion by about one momb for 2H7.v31 compared to 2H7,v16. No toxicity was observed in the monkey study at low or lgh dose and the gross pathology was normal. U other studies, v16 was well tolerated op to the highest dose evaluated of (100mgkg x2= 1200 ginm2 x2) following Lv. administration of2 doses given 2 weeks apart in these monkeys. 20 Data in Cynomoigus monkeys with 2H7..v 16 versus Rituxan@ suggests that a 5-fold reduction in CDC activity does not adversely affect potency. An antibody with potent ADCC activity but reduced CDC activity may have more favorable safety profile with regard to first infusion reactions than one with greater C1DC activity 25 Example 11 ucose deficient 2117 variant antibodis with enhanced effector fonetion Normal CHO and HEK293 cells add fucose to IgG oligosaccaride to a high degree (97-98%). IgG from sara are also highly fucosylatecd. DPI2, a dihydrofolate reductase minus (DMFR~) CHO ccl line that is fucosylation competent, and 30 Lee]3.1 a cell line that is deficient in protein fucosylatiion were used to produce antibodies for this study. The CHO cell li i Pro-Lc1 3.6a (Lee 13), was obtained from Professor Pamela Stanley of Albert Einstein College of Medicine of Yeshiva University, Parental lines are Pro- (proine auxotroph) and Ga.- (glycine, adenosine, thymidine auxotroph). The CH--DP 12 cell tine is a deivative of the CHO-KI cell line (ATCC #CCL-61 ), which is dihydrofolate reductase deficient, and has a reduced requirement fur insulin. Cell lines 35 were transfccted with cDNA using the Superfect method (Qiagen, Valencia, CA). Selection of the Lecl3 cells expressing tonsfected antibodies was performed using puromycin dihydrocilolde (Calbiochem, San Diego, CA) at 10 gg/mil in growth medium containing: MEM Alpha Medium with L-glutardne, ribonucleosides and deoxyrihanucleosides (GIBCO-BRL, Gaithersburg, MD), supplemented with 1k inactivated PBS (01BCO), 10 mM HETES, and IX penicillin;/streptomycin (GIBCO). The CHO cells were 40 similarly selected in growth medium containing Han's F12 without GUT: Low Glucose DMEM without Olycine with Nal-CO3 supplemented with 5% FBS (GICO), 10 rM HUJPIIS, 2 mM L-glutaine, IX GHT(glycie, hypoxanthinethymidine), and IX penicillin/stroptormycii. Colonies formed within two to three weeks and were pooled for expansion and protein expression. The cell pools were seeded initially at 3 x 106 cells/1o cm plate for small batch protein expression. The cells 6] iC 0/23*RCVD AT 4/26/2005 4:38:33 PM Eastemn ayllght Time]* SVR:USPTOUEXRF~125*DNIB:2130827 CSID:650 952 9881 *DURAION (mmNvs08 1PEAUSI1JULUU04 Attmrey Docket No. P I990R3 5 were converted to serum-free media once they grew to 9)0-95% confluency sard after 3-5 days ccil supernatants were collected and rested i an FC lgG- and intact TgG-ELISA to estimate protein expression leveit l.Vc13 and CHO cells were seeded at approximately 8 x 10 cell15 an plare one day prior to converting to PS24 production medium, supplemented with 10 mg/L recombinant human insulin and . mg/L trace elements. 10 Lec13 cells and DP 12 cells remained in serun-ree production medium for 3-5 days. Supernatants were collected and clarified by centrifulgation in 150 mI conical tubes to remove eclis and debris. The protease inhibitors PMSF and aprotinj (Sigma, St. Louis, MO) were added and the supernatants were concentated 5-fold on stirred cells using MWCO30 filters (Amicon, Beverly, MA) prior to immediate purification using protein G chromatography (Anershanim Pharmacia Biotech. Piscataway, NJ)). All proteins 13 were buffer exchanged into phosphate-buffered saline (PBS) using Centripricp-30 concentrators (Amicon) and analyzed by SDS-polyacrylamide getl cectrophoresis. Protein concentrations were determined using A280 and verified using amino acid composition arialysis. The CHO cells were transfected with vectors expressing humanized 2H7v1 6, 2117v.3 1 and selected as described, The 287v. 16 antibody rains the wild type Fc region while v.31 (see Example 5, Table 7 210 above) has an Fe region wherein 3 amino acid changes were made (S298A. E333A, K334A) which results in higher affinity for the FeyRIFla receptor (Shields et al. I Biot. Chern. 276 (9):6591 -6604 (2001)), Following transfaction and selection, individual colonies of cells were isolated and evaluated for protein expression level and the highest producers were subjected to mnethotrxate selection to select for cells that had amplified the plasmid copy number and which therefore produced higher levels of antibody. Cells were grown, 25 transferred to scrumf foc medium ibr a period of7 days, then the rnedium was collected, loaded entu a protein A column and the antibody was cduted using standard techniques. The final concentration of the antibody was determined using an Elisa that measures intact antibody. All proteins were buffer exchanged ino phosphate-buffered saline (PBS) using Centripriep-30 concentrators. (Amicon) and analyzed by SDS polyacryla mide gel electrophoresis. 30 Marix-Assisted Laser Desorptior/onization Time-of-flight (MALDI-TOF) Mass Spectral Analysis ofAsparagine-nkced QOgosaccha rides: N-linked oligosaccharides were released from recombinant giycoproins using the procedure of Papac et at., Glycobiology 8, 445-434 (1998). Briefly, the wells of a 96 well PVDF-]ined microtitre plate (MIllipore, Bedford, MA) were conditioned with 100 pl methanol that was drawn through the PDV membranes by applying vacuum t the Millipore Multiscrmen vacuum manifold. 35 The conditioned PVDF membrancs were washed wid) 3 X 250 pd water, Between all wash steps the wells were draltied completely by applying gentle vacuum to the manifold. The membranes were washed with reduction and carboxymethylation buffer (RCM) consisting of 6 M guanidine hydrochloride, 360 mM Tris, 2 mM RDTA. pH 8.6. Glycoprotein samples (50 p&g) were applied to individual wells, again drawn through the PVDF membranes by gentle vacuum and the wells were washed with 2 X 50 sf of RCM buffer, The 40 inmobilized samples were reduced by adding 50 gi of a 0,1 M dithiothreitol (DTT) solution to each well and incubatng the ricrotitre plate at 370c for I hr, DT1T was removed by vacuum and the wells were washed 4 x 250 1I5 water, Cystaine residues were carboxylnethylatcd by the addition of 50 1 of a 0.1 M iodoacetic acid (IAA) solution which was freshly prepared in I M NaOG- and diluted to 0.1 M with RCM buffer, Carboxymethylation was accomplished by incubation for 30 mit in the dark at ambient temperature. 62 AME ND E fET 2OE11123*RVD AT 4126120054:38:33PRA[EastemnDaylight Timel SVR:USPTO-EXRF-il125*DNIS:213082P'CSID:6509529881 *DURATilN (mm-rss):0748 Attorney Docket No. P990R3 5 VWcuum was applied to the plate to remove the IAA solution aud the wells were washed with 4 x 250 p. purified water. The PVDF membranes were blocked by the addition of 100 pl of 1% PVP360 (polvvinypyrrolidine 360,000 MW) (Sigma) solution and incubation for I hr at ambient temperature. The PVP-360 solution was removed by gentle vacuum and the wells were washed 4 x 250 pi water. The PNGasc P (New iEngland Biolabs. Beverly, MA) digest solution, 25 [i of a 25 Unit/mI solution in 10 mM This T0 accote, pH 8.4, was added to each well and the digest prneeded for 3 hr at 37*C. After digestion. the samples were transferred to 500 si1 Eppendorf tubes and 25 piL of a L,5 M acetic aid solution was added to each sample. The acidified samples wer incubated for 3 b'T at ambient temperature to Convert the oligosaccharidcs from glycosylamiines to the hydroxyl form. Prior to MALI-TOF mass spectral analysis, the released oligosacclarides were desalted using a 0.7-mnl bed of cation exchange resin (AG50W-X8 resin 15 in the hydrogen form) (Bio-Rad, Herculces, CA) slurried packed into compact reaction tubes (US iochenical, Cleveland, OH). For MALDITOF mass spectral analysis of the samples in the positive mode, the desalted oligosaccharides (0,5 pi aliquots) were applied to the stainless target with 0.5 pil of the 2.5 dihydroxybenzoic acid matrix (sDH) that was prepared by dissolving 2 mg 2,5 dihydroxybcnzoic acid with 0.1 mg of 5 20) mfethoxyslicylic acid in I ml of ethanol/ mM sodium chloride 1:1 (vv), The sample/matrix mixture was dried by vacuum. For analysis in The negative mode, the desalted Il-inked oligosaccharides (0,5 41 aliquots) were applied to the stainless target along with 0.3 pl 2mr4',6-trihydroxyacetophenone mari THAP) prepared in 1:3 (v/v) acetonitrilc/13.3 molM amonium citrate buffer. The sample/matrix mixture was vacuum dried and then allowed to absorb atmiospheric moisture prior to analysis. Released oligosaccharides 25 were analyzed by MALDI-TOP on a PerSeptive BioSystems Voyager-DE mass spectrometer. The mass .spectrmmeter was opernTed at 20 kV either in the positive or negative mode with the linear configuration and utilizing delayed extraction. DNata were acquired using a laser powcr of 1300 and in the data summation mode (240 scans) to Improve the signal to noise. The instrument was calibrated with a mixture of standard oigosaccharides and the data was smoothed uig a 19 poist Savitsky-Golay algorithm before the masses 30 were assigned. Integration of the mass spectral data was achieved using Caesar 70 data analysis software package (SciBridge Software). Neural kiler (NK) c6el7 r nobody depeodem cytoxicty assays. ADCC assays were performed as described in Example 9. NK to target cell (WIL2-S) ratio was 4 to L assays were run for 4 htou rs, and toxcitey was measured as before using lactose dehydrogenase assay. 35 Target clls were opsonized with ibe concenradoos of amibody indicated for 30 min prior to addition of NK calls. The Rituxano@ antibody used was front Genentech (S. San Francisco, CA), Figure 12shows the results of a representative ADCC assay. The results show that underfucosylated anthodies mediate NK cell target cell killing more efficiently than do antibodies with a full complement of fucose. The underfucosylated atibody, 2H7v.31, is 4() most efficient at mediating target cell killing. This antibody is effective at lower concentrations and is capable of mediating killing of a greater percentage of target cells at higher concentrations than are the other antihodies. The activity of the antibodies is as follows: Le 13-derived 2H7 v3 I> Lee 13 derived 27v1 6> Dp1 2 derived 2H7v3 I> Dp12 derived 2H7v16 > or = to Rituxan. The protein and carhohydrate alterations are addhitve. Comparison of tie carbohydrate found on native IgG from the Lec13-produced and CHO 63 AMENDD S2TET 12/239CVD AT 412612005 4:38:33PMpgstemnDqlight Time] M:USP)TOFXRIF-il2P1DNIS;2730827PCSID:650 95290881 *DUAION (mm-s$)0748 If-IN~~~~~~B "WVJ?.~~ ,--W N'I- -111 _ -- . __IIJ JULZULJ4 Anorney Docket No. P1 990R3 5 produced JgG showed no appreciable differences in the extent of galactosylation and hence the results can be attributed solely to the presence/absence of ficose. Example 12 Ficose-deficient 2117 vardant antibodies with endlanced ADCC in vivo It This exarnple describes ADCC activity in vivo of the fucose-deficient humanized 2A7 variants including v.16 and v31 produced in Lec]3 compared to norn Ifuccsylated counterparts produced in DP12, in mice expressing human CD16 [FcRTIRill and human CD20. Generation of huCD20Ty* huCD167q nCWD6' mice Human CD20 transgenic mice were generated from human CD20 hAC DNA (Invitrogen, Carlsbad, 15 CA). Mice were screened based on te FACS analysis of human CD20 expression, HuCD20 Tg' mice were then crossed with huCD1 6TgmCD16t mice to generate huCD20TgthuCD16TCrnD i 6* mice. In vivo treatment Ten to 100 g of each of the 2H7 variants or Rituxan@ is adninistrated to huCD2OTgliuaCD I6Tg~mCD1 6' mice via intraperhonaal injections. Equal amount of isotypc-matehed 20 antibodies will be applied similarly to the negative control group of annals, Mouse tvrnphoceks prepardaion Mouse lymphocytes from whole blood, spleen, lymph nodes and bone marrow are prepared according to standard protocol described in "Current Protocols in Immunology, edited by John Culigan, Ada Kruisbeek, Tavid Marguues, Ethan Shevach and Waren Strober, 1994". 25 FA 'S analysis Half million cells are washed and resuspended in 100 p1 of FACS buffer, which is phosphate buffered saline with 1% BSA, containing 5 ptl af staining or control antibody. Al the staining andbodies, including isosype controls, are. obtained from PharMIngen, San Diego, CA. Human CD20 expression is ascss d by staining with Rimxan® along with FITC-conjugated anti-human1%G1 secondary antibody. 30 FACS analysis is conducted using FACScan and Cell Quest (Becton Dickinson lmmunOcytometry Systems, Sain Jos, CA). All the lymphocytes are defined in the forward and side light scattexiogo, while ol the B lymphocytes are defined with the expressio of B220 on the cell surface. B cell depletion and recovery are assessed by analyzing peripheral B cell counts and analysis of hCD20+ PB cells by FACS in the spleen, lymph node and bone marrow on a daily basis for the firsi week 35 alter hiection and thereafter on a weekly basis. Serum levels of the injeced 217 variant antibody are nonltored. The results of this in vivo assay confirms the in vitro fmdings on the Increased ADCC activity and greater B cell depletion of fucose,-deficient 217 variants over wild-type (with resepet to fucosylation) glycosyluamlan counterparts. 40) 61 WE 13!23 RCVD AT 4/26/2005 4:38:33 PM [astern Daylight Timer SVR:USPTO'EFXRFP125 DNIS:2730827 MED:W0952 9881 DURATION (mmlsS):0N8 IF V~ 13 rJULZUU4 Attorney Dock et No, P I 990R3 5 Examde 13 Apoptosis Activity Anti-CD20 antibodies including Rituxan@ have been shown to induce apoptosis in vitro when crosslinked by a secondary antibody or by chemical means (Shan et W., Blood 9:1644-1652 (1998)t Byrd et [0 al- Blood 99:1038-43 (2002); Pederson et aL., Blood 99:1314-19 (2002)). When chemically crosslinked, marine 2117 timers induced apoptosis of Daudi cells (Ghetie etal., Proc Nad Acad Sci USA 94:7509-14 (1997)). Crosslinking with a secondary antibody also induced apoptosis with the nurine 2H7 antibody (Shanl ct a., 1998). These activities are believed to be physiologically relevant because a variety of mechanisms could lead to crosslinking of anti-CD20 andbodies bound to cell-surface CD2O07. vivo 15 RhuMAb 2H7,v16 nhumanized 2117 v16; RhulAb stands for recombinant human monoclonal antibodyl and Rituxan@ were compared in apoptosis assays in vitro using a secondary crosslinking antibody. Simos cells (CRL-1596, ATCC, Manassas, VA), a C20-expressing. human J3 lymphocyte cl lin, were used to measure the ability of the anti-CD20 monoclonal andbodies rhulAb 217.v16 and Rituxinab versus a ntgative-contrl antibody, Trastuzunmab (H-erceptin®, GJenentech, South San Francisco, CA), to Induce 20 apoptosis as measured through Annexin V staining and propidium iodide dye exclusion (Vybrant@ Apoptosis Assay Kit, Molecular Probes, Scattle, WA). The .Ramos cells were cultured in RPM]- 1640 medium (Gihen, Rockville, MD) containing 10% fetal bovine scrum (Biusource international, Camarillo, CA) and 2 mM L-glutasnle (Gibco). Prior to being assayed, the cells were washed twice in fresh media and then adjusted to a cci conentraion of 2 X I06 per nmL, Cells (150 .Lt) were added to 96-well assay plates 25 (Recton Dickinson, Palo Alto, CA) which contained 150 pL of a predetermined amount of control IgG], rhuMAb 21-17,v 16, or Rituximab, along with F(ab)'2 goat anti-human Fe (Pierce Biotechnology, Rockford, IL). The inA IgG concentrations were 100, 10, 1.0, 0.1, 0.01 and 0.001 nM, and the F(ab)'2 goat anti human Fe antibody concentration was set at twice the respective sampic antibody concentration. Each dilution was set up in triplicate. After a 24-hour incubation at 37* C, the cells were washed twice with PBS 30 and then stained with Annexin V and propidiurn iodide according to the manufacturer's recommendations. 'Ihe saning patterns of the Ramos cells were analyzed by flow cytometry using a FACscan Plow Cytomueter (lecion Dickinson, San Jose, CA), and data were collected for t0 s-periods. The data were reduced usmg the Cellouest Pro software (Bceton Dickinson). Ramos cells that were positive for (1) Annexin V staining, (2) Annexin V and propiduimn iodide double-staining. and (3) the number of unstained live cells, were 35 counted and plotted using KaleidaGraph software (Synergy Software, Reading, PA). Botb rhuMA b 217yI6 and Rituximab induced apoptisis of amrios cells when crosslinked with ani-hunan Fe and as compared to an irrelevant IgG1 control antibody (Figures 13-15). The apoptotic activity of (haMAb 2H7) was slightly lower than that of Rituximab, At 10 aM concentrations of crosslinked rMAIb 217, Rituximab, and control IgGI antibody, fractions of Annexin V stained cells wem 40 18.5, 16.5, 2.5%, respectively, fractions of doubly labeled cells were 29, 3, and 16%, and numbers orf live cells counted per 10 s were 5200, 3100, and 8600. These in vitro data demonstrate that apoptosis is one potential mechanism for in vivo B cell depletion. In viva erosslinking of rhuMAb 2117 or Rituximab bound to cei-surface CD20 may occur through FPyR on the surfaces of intmune effector cells. 65 AMENDED SHDU O GE14123 *100 AT 412612005 4:38:33 PM astemnDaylight Time] SVR:UPTO-0FRF125* DNIS:213082P10$ID:650 952 9881 'DURATION (mms):07NS I NUS 1 3 JUL2004 Attorney Docket No. P1990R3 5 Enmr~e14 In Vivo Suppressiit of Tumor Growth The ability of rhuMAb 2H7,v16 to inhibit the growth of the Raji human B-ells a lymphoma cell inc (ATCC CCL 86), was evaluated in Balbfe nude (athyii) mie. The Raji cells express CD20 and have been reported to grow in nude mice, producing metastatic disease: tumor growth is inhibited by Rituxan@ 10 (Clynes et aL. Nature Medicine 6, 443446 (2000)), Fifty-six 8-10 week old, Balb/c nude mice were divided into 7 groups (A-G) with each group consisting of 9 mice. On day 0, each mouse received a subcutaneous injection of 5 x "0a6 Rji B-lymphuma cells in the flank. Beginning at day 0, each mouse received either 100 W, of the negative-control solution (PBS; phosphatc-buffered saline), Rihxau,@ or 2117.v6. Dosage was dependent on weight and drug delivery was intravenously via the ail vein, Group A nice received PBS. 15 Groups BD received Rituxan@ at 5.0, mg/kg, 0.5 m/kg, and 0.05 mg/kg respectively. Groups E-G mice received 2H7 v.16 at 5.0 mg/kg, 0.5 mg/kg, and 0,05 ing/kg respectively. The injections were repeated every week for 6 weeks. At weekly intervals during treatment, each mouse was inspected for the presence of palpable turOnm, at the site of injection, and the volume of the tumors if present wer measured and recorded. A final inspection was made at week 8 (after a two-week interval of no treatments). 20 Thc results of this study showed that both rhuMAb 2H7.v16 and Rituxan® and were effective at irihibiting suhcutarneous Raji-cell tumor growth in nude mic. (FIxs. 16-1). Tumor growth was observed in the PBS control group begi'ning at 4 weeks. However, no tumor growth was observed in groups treated with Ritausan@ or 2H7.vl6 at 5 mg/kg or 0.5mg/kg for the 8-week duration of the study. In the low-dose 0.05 mg/kg treatment groups, tnore were observed in one animal in the 2117 group and in one animal in the 25 Rituxan® group (PiG. 18). Cloning of Cynomolgus monkey CD2M and antibody binding The CD20 DNA sequence for cynomiolgus monkey (Macaca fanscicularis) was determined upon the 30 isolation of cDNA encoding CD20 from a cynton olgus spleen cDNA library. A SUPERSCRIPTvM Plasmid System for cDNA Synthesis and Flasmoid Cloning (Ca,#18248-013, Invitrogen, Carlsbad, CA) was used with slight modifications to consttct the library. The cDNA library was ligated into a pRKSE vector using restriction sites Xbu 1-and Not L. mRNA was isolated fmom spleen tissue ((California Regional Research Primate Center, Davis, CA.). Priners to amplify cDNA encoding CD20 were designed based on non-coding 35 sequences of human CD20. N-termnal region prima 5'AGTTTGAGAGCAAAATG-3' (SEQ ID NO. 37) and C-terminal region primer 5-AAOCIATGAACACTAAT-3' (SEQ ID NO. 38) were used to ilon' by polymerase chain reaction (PCR) the cDNA encoding cynomolgus monkey CD20. The PCR reaction was carried out using Platinum Taq DNA Polymerase High Fidelity according to the manufacturers recommendation (Gico, Rockville, MD). The PCR product was subcloned into pCR *2.1-TOPW Vector 4.0 Lnvitrogen) and transformed into XL- I blue E. coli (Stratagene. La Jolla. CA). Plasmid DNA containing ligated PCR products was isolated from individual clones and sequenced. The amino acid sequence for cynornolgus monkey CD120 Is shown in Figure 19. Figure 20 shows a comparison of cynomolgus and human CD20. The cynomolgus monkey CD20 is 97.3% similar to human 66 AMENDED SHT CE 151231 RCVD AT 4126120 54:38:33 PM EatemnDayight Time] ISVR:USPT0.EFXRF-11251 DNIS:21308271*SID:650 952 9881 *DUAION (mss):0N48 PR-26bi21&J5 12:07 -UM: WtNt-N iti1 LMHL 00DZC D LeaLS 13 JUL 2004 Attorney Docket No, P1990R3 5 CD20 with H differences. The exuacelhular domain contains one change at V1 57A, while the remaining 7 residues can be found in the cytoplasrmic or transmembrane regions. Antibodies directed against human CD20 were assayed for the ability to bind and displace FITC conjugated marine 2H7 binding to cynuniolgus monkey cells expressing CD20. Twenty milliliters of blood were drawn from 2 cynomolgus monkeys (California Regional Research Primato Center, Davis, CA) into Io sodium heparin and shipped directly to Genentech ia., On the same day, the blond samples were pooled and diluted 1:1 by the addition of 40 ril of phosphate buffered saline (PBS), 20 mi of diluted blood was layered on 4 x 20 ml of Ficoli-Paque IPlus (Amersham Biosciences, Uppsala, Sweden) in 50 nil conical tubes (Cat#352098, Falcon, Franklin Lakes, NJ) and centrifuged at 1300 rpm for 30 minutes R.T. in a Sorval 7 centifugo. (Dupont, Newtown, CT), Tho PBIMC layer was isolated and washed in PBS. Red blood cells 1$ wem lysed in a 0,2% NaCI solution, restored to isotonicity with an equivalent volume of a 1.6% NaCl solution, and centrifuged for 10 minutes at 1000 RPM. The PBMC pullet was resuspended in RPMT 1640 (Oibco, Rockville, MD) containing 5% fetal bovine serum (FBS) and dispensed into a 10 Cm tissue culture dish for I hour at 37" C. The non-adherent B and T cell populations were removed by aspiration, centrifuged and counted. A total of 2.4 x 07Iells were recovered. The resuspended PBMC were distributed 20 into twenty 12 x 75 mm culture tubes (Cat#352053, Falcon), with each tube containing I x 104 cells in a volume of 0,25 ml Tubes were divided into four sets of five tubes. To each sot was added either media (RPMIS640, 5% FBS), tirated amounts of control human IgG antibody, Rhuxan*, 2H7.v16, or 2117,v31. The final concentration of each antibody was 30, 10, 3.3 and I.1 nM. In addition, each tube also received 20 ut of Fluorescein Tsothiocyanate (FITC)-conjugated anti-human CD20 (Cat#55562 2 . BD Biosciences, San 25 Diego, CA). The cOils were gently mixed, incubated for 1 hour on ice and then washed twice in cold PBS. The cell surface staining was analyzed on a Epic XtrMCL (Coulter, Miami, FL), the geometic means derived, plotted (Kaleidacrl.phiv, Synergy Software,, Reading, PA) versus antibody concentrations. Data in Figure 2 l showed that 2H7 v.16 and 2H7 v.31 competitively displaced H-1TC-murine 2117 binding to cynomnigns monkey cells. Furthermore, Rituxano also displaced FITC-murine 2117 binding thus 30 demonstrating that both 2H7 and Rituxan* bind to an ovedapping epirpe on CD20. Tn addition, the data show that the TCm value for 217 v.16, 2H7 v.31 ad RJuxan are similar and fall in the 4-6 nM range. Exam1Kple 16 Phase FiH study of rhuMAb 2H7 (217.vG) in moderate to severe rheumatoid arthritis 35 Protocol Synxopsis A randomized, placebo-controlled, multicentr, blinded phase /11 siudy of the safety of escalating doses of PR070769 (rhuMAb 2M7) in subjects with moderate to severe rheumatoid arthritis receiving stable doses of concomitant methotretate. 40 Objectives The primary objective of this study is to evaluate the safety and tolerability of escalating intravenous (IV) doves of PRO70769 (rhuMAb 27) in subjects with moderate to sever rheumatoid arthritis (RA). 67 AMPOE: SYT AGE 16!2P RCViDAT 4i26120054:38:33PM[EastemnaylightTimfe] SVR:USPT0&5:XRM-112PDNIS:213082P CSID:650 952 9881 *DURATION (me):07NS ~~~~~:~~~ atJ r~' ~e -~- -'~rt u,' 1 3 JUL 2004 Attorney Docket No, PI990R3 5 Study Design This is a randomized, placebo-controlled, ruldicenter, blinded Phase 1/11, investigator- and subject-blinded study of the safety of escalating doses of PRO7769 in combination with NTX in subjects with moderate to savor RA. The study consists of adose escalation phase and a second phase with enrollment of a larger number of subjects. The Sponsor will remain unblended to treatment assignment, 10 Subjects with moderate to severe RA who have failed one to five disease-modifying antirheumatic drug's or biologics who cuvrently have unsatisfactory clinical responses to treatment with MTX will be enrolled. Subjects will be required to receive MTX in fe range of 10-25 mg weekly for at least 12 weeks prior to sndy entry and to be on a stable dose for at least 4 weeks before receiving their initial dose of study 15 drug (PRO70769 or placebo). Subjects may also receive stable doses of oral corticosteroids (up to 10 mg daily or prednisone equivalent) and stable doses of nonsteroidal ami-iofiatnmatory drugs (NSAIDs). Subjects will receive two IV infusions of PRO70769 or placebo equivalent at the indicated dose on Days I and 15 according to the following dose escalation plan (see igure 22), Dose escalation will occur according to specific criteria and after review of safety data by an 20 internal safety data review committee and assessment of acute toxicity 72 hours following the second infusion in the last subject treated in each cohort After the dose escalation phase, 40 additional subjects (32 active and 8 placebo) will be randomized to each of the following dose levels: 2x00 mg, 2x200 mg, 2x500 tog, and 2x 1000 mg, if the dose levels have been demonstrated to be tolerable during the dose escalation phasc. Approximately 205 subjects will be enrolled in the study, 25 B-cell counts will be obtained and recorded. B-cll counts will be evaluated using flow cytomctry in a 48-weck Iolluw-up period beyond the 6-tuouth efficacy evaluatdon.- -cell deptedoo will not be considered a dose-liniting toxicity (DLC), but rather the expected pbarnacodynanmi outcome of PR070769 treatment. in an optional substudy, blood "br scrum and RNA analyses, as well as urine samples will be 30 obtained from subjects at various timepoints. These samples may be used to identify biomnarkers that may be predictive of response to PRO70769 treatment in subjects with moderate to severe RA. Outcome Measures 'he primary outcome measure for this study is the safety and tolerability of PRO70769 in subjects with 35 moderate to severe RA. Study Treatment Cohorts lf subjects will receive two IV Infusions of PRO70769 or placebo equivalent at the indicated dose on Days I and 15 according to the following escalation plan 40 - 10 mg PRO7O769 or placebo equivalent 4 subjects active drug, I control - 50 mg PIO70769 or placebo equivalent 8 subjects active drug, 2 control - 200) mag PRO70769 or placebo equivalent: S subjects active drug, 2 control - 500 mg PRO7769 or placebo equivalent: 8 subjects active drug, 2 control 1000 mg PR070769 or placebo equivalent: 8 subjects active drug, 2 control 45 68 E 17123 RCVD AT 4126,2005 4:38:33 PM Eastern Dayight Time] IVR:USPTO-EPXRPN125 t DNIS:2730827 t CSID:650 952 9881 *DURATION (nm-s):0748 Attorney Docket No, P9]990R3 "rie diseacy of PR070769 Will be nMCaSUTrE. by ACR responscm. Thepemg of subjects who ;achieve an ACR20, ACR50, and ACRYL0 re-SPOnse Will tie tunmaxizvd by treati-eilt gmup arnd 95% Co'-ideact intervals will I.e gellerated for cacti group. Tbe CoMponenlt: of these re. nonse and their change [rom baselisia Mi51 be smrnaried. by treatment and visit Cnclrns Thlt data alCoVedonadte I IAsuc eas in produring humanized CD20 hiridin 5 antibodies, in particular humanized 21-17 antibody variant , that maintained and even enhaniced Their biological properties. Thc humanized 2117 antibodies of theivention hound to CIJ20 at affinities sirnilar to the tturine dulnor and J 5 chimeroic 21-17 antibodies atd were ~tibtive at B cell killing in a pr matc, leading to B cell depletion. Certain variants showed enhanced ADt2C over a chimeric anti-CD2O acitibody currently used tn treat NHLt, favoring the usc of lower doses of the rhrpttcatbd nptc~.Additiondl. whereas it may- be niecessury for a Chitmeric antibody that NIS nturine FR~t rusidues to be administered at a dose effibtivo to a,.hieve completes B coli depletion to obviate, an antibody responsec against it7 the p-resent humanized antibodies can be 20 administered at dosages that achieve partial oir cntnpletE R cell dep.etion, and for different durations (if timle, as dosiired ior the prticular diso and patient Yn addition, these antibodies demonstrated stability in solution. These' properties, of the humanized 2H-7 antiboedies make them ideal for use as immunotherpeutic agent in (tie treatment of CD2() positive c;arcer and autoirnroune diseases;t th, antibodies ar e not expected tq ben immunogenic or will at least be- lemt imml-unogenic than flly murine or Chimneric nnti-CD20 antibodies 25 in human patients. Refertaces cited within this application, including patents, published applications aind mother publications, are herpe-by incorporated 'by relisreftfe. Jie practice of the present invention will employ, unless otherwise inciiente&d conventional lo techniques ofnmolecular biology olid th, like, which -are within the skill of the art. Such tech niq ues are explained fully in tilC literature. See e.g., MLecokir Cio-nna: A abortoty MqgqjTo, (3, Samibrook el 44 Cold Spring Harbor Laboratory, Cold S.pring Harbor. NY , 1989); utn Protocois In Moecua. ~ ky ,F. Ausubel et aL, eds., 1 98' updated); Rssrintial Meula r-~~g (T. Brown cd., IRL Prcvs 199 1); flm lixpressioni Tecbriolon J oeddGI ed&, Academic Press 1991 ); Methods fnr innadAals o 35 'ikr'ti ee A, Bloibweli -I a1L edq., artlett Pub]. 1990); (lane 1:'fr n Eprsio q riglr Stockton Press D9Q;Renhnn.INA MedifodoloevfL] (R. Wu at eL cds.. Academic Press 1995); PICR Prctaical Approgeh (TM, McPherson fn of.. MRLPress at Oxford University Preqs 1991 );9 -'in IiiicLeo] d q ~it~ (W. Gait ed, 1984); Cell1 Clture for T3ikchenmists (, .Adm dle'irSecePlies 1 990); Cen nsfer ectur Iu M mlinelS (3. Miller & M, Calos ed 5., 1987);, Mamin Cell!!tj 40 Aliq echnolony (LButler ed, 1991); Animal3 Cell utureQj. Polrec.asHtaaPes1990); Cltujre of Animal Cell., 2'd Ed. (R. Frrshnev el aL ed&, Alan Ri, Liss 1987), PLoqwCytonetr nd Sorting (M.L Mclanied eral nL dx., Wiley-Liss 1 990): the series Mel tos in Enzvnlolog~ (Ac-adeinic Press, Inc.): Wirth MW and Hauser H. (1993); Immnun-_cbenis-v n Practice, 3rd edition, A. Johnstone & R., Thorpe, Blackwvell Science Cambridge, MA. 1996; Tqchn3Qucs in m upy ±msv,(G. Bullock & P. Pct rus7. eds.. 69 E 18123101 R AT 4,26120054:38:33 PM Pastern Daylight Time] I SVR:USPTO.EFXRF-11251 DNIS:2730827 ICSlD:65 952 9881 'DURATION (mmis):§?748 Academic Press 1982, 1983, 1985, 1989): Handbook of Experimental Immunology, (D. Weir & C. Blackwell, eds.); Current Protocols in Immunology (J. Coligan et al. eds. 1991): Immunoassay (E.P. Diamandis & T.K. Christopoulos, eds.. Academic 5 Press, Inc.. 1996); Goding (1986) Monoclonal Antibodies: Principles and Practice (2"d ed) Academic Press, New York; Ed Harlow and David Lane, Antipodies A laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1988; Antibody Engineering, 2 nd edition (C. Borrebacck, cd., Oxford University Press, 1995); and the series Annual Review of Immunology; the series Advances in 10 Immunology. The entire disclosure in the complete specification of our Australian Patent Application No. 2003301079 and Australian Patent Application No. 2011226858 are by this cross-reference incorporated into the present application. 15 70 6407267_1 (GHMatters) P76023.AU.2 KAROLA

Claims (84)

1. 2. An antibody or an antigen-binding fragment according to claim 1, wherein the antibody comprises the heavy and light chain amino acid sequence of SEQ ID NO. 39 and 40, respectively. [0 3, An antibody or an antigen-binding fragment according to claim 1, wherein the antibody comprises the heavy and light chain amino acid sequence of SEQ ID NO. 39 and 40, respectively, and further comprising at least one amino acid substitution in the Fc region that improves ADCC and/or CDC activity. [5
2. 4. An antibody or an antigen-binding fragment according to claim 3, wherein the amino acid substitutions are S298A/E333A/K334A.
3. 5. An antibody or an antigen-binding fragment according to claim 3 or 4, wherein the ?0 amino acid substitution in the Fe region improves CDC activity.
4. 6. An antibody or an antigen-binding fragment according to claim 5, wherein the amino acid substitution is K326A or K326W. 25 7. An antibody or an antigen-binding fragment according to any one of claims 3 to 6, wherein the FEc further comprises the amino acid substitution K326A.
5. 8. An antibody or an antigen-binding fragment according to claim 3, further comprising at least one amino acid substitution in the Fe region that decreases CDC activity. 30
6. 9. An antibody or an antigen-binding fragment according to claim 8, comprising at least the substitution K322A.
7. 10. An antibody or an antigen-binding fragment according to any one of the preceding 35 claims conjugated to a cytotoxic agent.
8. 11. An antibody or an antigen-binding fragment according to claim 10, wherein the cytotoxic agent is a radioactive isotope or a toxin. -72 12. A composition comprising an antibody or an antigen-binding fragment according to any one of the preceding claims, and a pharmaceutically acceptable carrier. 5 13. An article of manufacture comprising a container and a composition contained therein, wherein the composition comprises an antibody or an antigen-binding fragment according to any one of claims I to 11.
9. 14. An article of manufacture according to claim 13, further comprising a package insert 0 indicating that the composition can be used to treat non-Hodgkin's lymphoma or an autoimmune disease.
10. 15. A method of inducing apoptosis in B cells in vivo, comprising contacting B cells with an antibody or an antigen-binding fragment according to any one of claims I to I1, thereby 15 killing the B cells.
11. 16. A method of treating a CD20 positive cancer, comprising administering to a patient suffering from the cancer, a therapeutically effective amount of a humanized CD20 binding antibody or an antigen-binding fragment according to any one of claims I to 11. 20
12. 17. A method according to claim 16, wherein the CD20 positive cancer is a B cell lymphoma or leukemia.
13. 18. A method according to claim 17, wherein CD20 positive cancer is non-Hodgkin's 25 lymphoma (NHL) or lymphocyte predominant Hodgkin's disease (LPHD).
14. 19. A method according to claim 16, wherein the cancer is chronic lymphocytic leukemia or small lymphocytic lymphoma. 30 20. A method according to any one of claims 16-19, wherein the antibody comprises the light and heavy chain amino acid sequence of SEQ ID NO. 40 and 39, respectively. 21, A method according to any one of claims 16 to 20, wherein the antibody or the 2 antigen-binding fragment is administered at a dosage range of about 275-375mg/m. 3 5
15. 22. A method according to any one of claims 16 to 20, wherein the antibody or the antigen-binding fragment is administered at a dosage range of about 250mg/m 2 to about 500 2 mg/in. - 73 23. A method according to any one of claims 16 to 20, wherein the patient is administered at least two doses of the antibody or the antigen-binding fragment at 375 mg/m 2 per dose. 5 24. A method according to claim 23, wherein the two doses are administered two weeks apart.
16. 25. A method according to any one of claims 16 to 24, further comprising administering to the patient at least one chemotherapeutic agent. [0
17. 26. A method according to claim 25, the cancer is non-Hodgkin's lymphoma (NHL) and the chemotherapeutic agent is selected from the group consisting of doxorubicin, cyclophosphamide, vincristine, prednisolone, and CHOP. [5 27. A method of treating an autoimmune disease, comprising administering to a patient suffering from the autoimmune disease, a therapeutically effective amount of a humanized CD20 binding antibody or an antigen-binding fragment according to any one of claims I to 11. 20 28. A method according to claim 27, wherein the autoimmune disease is selected from the group consisting of rheumatoid arthritis, juvenile rheumatoid arthritis, systemic lupus erythematosus (SLE), lupus nephritis, ulcerative colitis, Wegener's disease, inflammatory bowel disease, idiopathic thrombocytopenic purpura (ITP), thrombotic thrombocytopenic purpura (TTP), autoimmune thrombocytopenia, multiple sclerosis, psoriasis, IgA 25 nephropathy, IgM polyneuropathies, myasthenia gravis, vasculitis, ANCA vasculitis, solid organ transplant rejection, graft versus host disease, diabetes mellitus, Reynaud's syndrome, Sjorgen's syndrome and glomerulonephritis.
18. 29. A method according to claim 28, wherein the autoimmune disease is rheumatoid 30 arthritis.
19. 30. A method according to claim 29, wherein the patient is suffering from moderate to severe rheumatoid arthritis and has failed treatment with at least one disease-modifying anti-rheumatic drug. 35
20. 31. A method according to claim 29 or 30, further comprising administering to the patient a second therapeutic agent. -74
21. 32. A method according to claim 31, wherein the second therapeutic agent is an immimosuppressive agent.
22. 33. A method according to claim 32, wherein the immunosuppressive agent is 5 methotrexate.
23. 34. A method according to claim 29, wherein the humanized CD20 binding antibody comprises the heavy and light chain amino acid sequence of SEQ ID NO. 39 and 40, respectively. t0
24. 35. A method according to claim 34, wherein the antibody or the antigen-binding fragment is administered at a dosage selected from 2x 10mg, 2x50mg, 2x 200mg and 2x5OOmg. 15 36. A method according to any one of claims 27-35, wherein the antibody or the antigen binding fragment is administered by intravenous infusion or subcutaneous administration.
25. 37. A method according to claim 28, wherein the autoimmune disease is multiple sclerosis. 20
26. 38. An isolated nucleic acid that encodes an antibody or an antigen-binding fragment according to any one of claims I to 9.
27. 39. An expression vector encoding an antibody or an antigen-binding fragment according 25 to any one of claims I to 9.
28. 40. A host cell comprising a nucleic acid according to claim 39.
29. 41. A host cell according to claim 40, that produces the antibody or the antigen-binding 30 fragment encoded by the nucleic acid.
30. 42. A host cell according to claim 41, which is a CHO cell.
31. 43. A method of producing a humanized antibody or an antigen-binding fragment, 35 comprising culturing a cell that produces the antibody or the antigen-binding fragment according to any one of claims 1-9. -75 44. A method according to claim 43, further comprising recovering the antibody or the antigen-binding fragment produced by the host cell.
32. 45. An antibody or an antigen-binding fragment produced by a method comprising 5 expressing a nucleic acid encoding an antibody or an antigen-binding fragment according to any one of claims 1 to 9 in a host cell and recovering the antibody or antigen-binding fragment produced by the host cell.
33. 46. An isolated nucleic acid comprising the nucleotide sequence of SEQ ID NO. 24 of the 10 Cynomolgus monkey CD20, or a degenerate variant of this sequence.
34. 47. An isolated nucleic acid comprising a sequence that encodes a polypeptide with the amino acid sequence of SEQ ID NO. 25, or SEQ ID NO. 25 with conservative amino acid substitutions. 15
35. 48. A vector comprising a nucleic acid according to claim 47.
36. 49. A vector according to claim 48, which is an expression vector wherein the nucleic acid is operably linked to an expression control sequence. 20
37. 50. A host cell comprising a nucleic acid according to claim 46 or 47.
38. 51. An isolated polypeptide comprising the amino acid sequence of SEQ ID NO. 25 of the Cynomolgus monkey CD20. 25
39. 52. A liquid formulation comprising a humanized 2H7 antibody at 20mg/mL, 10mM histidine sulfate at pH5.8, 60mg/ml sucrose, and 0.2 mg/ml polysorbate 20 which antibody comprises the heavy and light chain sequence of SEQ ID NO. 39 and 40, respectively. 30 53. A method of treating rheumatoid arthritis (RA) in a human subject comprising administering a CD20 antibody to the subject at a dosage selected from the group consisting of 2x50mg, 2x200mg, and 2x5OOmg.
40. 54. A method according to claim 53, wherein the dosage is 2x5Omg. 35
41. 55. A method according to claim 53, wherein the dosage is 2x200mg.
42. 56. A method according to claim 53, wherein the dosage is 2x5OOmg. -76
43. 57. A method according to claim 53, wherein the CD20 antibody is a humanized antibody. 5 58. A method according to claim 53, wherein the CD20 antibody is a humanized 2H7 antibody.
44. 59. A method according to claim 53, wherein the CD20 antibody is rituximab. 10 60. A method according to claim 53, wherein the RA is moderate to severe RA.
45. 61. Use of a therapeutically effective amount of a humanized CD20 binding antibody or an antigen-binding fragment according to any one of claims I to 11 in the manufacture of a medicament for treating a CD20 positive cancer in a patient suffering from the cancer. 15
46. 62. The use according to claim 61, wherein the CD20 positive cancer is a B cell lymphoma or leukemia.
47. 63. The use according to claim 62, wherein CD20 positive cancer is non-Hodgkin's 20 lymphoma (NHL) or lymphocyte predominant Hodgkin's disease (LPHD).
48. 64. The use according to claim 61, wherein the cancer is chronic lymphocytic leukemia or small lymphocytic lymphoma. 25 65. The use according to claim 63 or 64, wherein the antibody or the antigen-binding fragment comprises the light and heavy chain amino acid sequence of SEQ ID NO. 40 and 39, respectively.
49. 66. The use according to any one of claims 61 to 65, wherein the antibody or the antigen 30 binding fragment is administered at a dosage range of about 275-375mg/m 2 .
50. 67. The use according to any one of claims 61 to 65, wherein the antibody or the antigen binding fragment is administered at a dosage range of about 250mg/m 2 to about 500 mg/mi 2
51. 68. The use according to any one of claims 61 to 65, wherein the patient is administered 35 at least two doses of the antibody or the antigen-binding fragment at 375 mg/m 2 per dose.
52. 69. The use according to claim 68, wherein the two doses are administered two weeks apart. 268129 1 (GHAIt- P7623.AJ -77
53. 70. The use according to any one of claims 61 to 69, further comprising administering to the patient at least one chemotherapeutic agent. 5 71. The use according to claim 70, the cancer is non-Hodgkin's lymphoma (NHL) and the chemotherapeutic agent is selected from the group consisting of doxorubicin, cyclophosphamide, vincristine, prednisolone, and CHOP.
54. 72. Use of a therapeutically effective amount of a humanized CD20 binding antibody or 0 an antigen-binding fragment according to any one of claims I to I1 in the manufacture of a medicament for treating an autoimmune disease in a patient suffering from the autoimmune disease.
55. 73. The use according to claim 72, wherein the autoimmune disease is selected from the t5 group consisting of rheumatoid arthritis, juvenile rheumatoid arthritis, systemic lupus erythematosus (SLE), lupus nephritis, ulcerative colitis, Wegener's disease, inflammatory bowel disease, idiopathic thrombocytopenic purpura (ITP), thrombotic thrombocytopenic purpura (TTP), autoimmune thrombocytopenia, multiple sclerosis, psoriasis, IgA nephropathy, IgM polyneuropathies, myasthenia gravis, vasculitis, ANCA vasculitis, solid ?0 organ transplant rejection, graft versus host disease, diabetes mellitus, Reynaud's syndrome, Sjorgen's syndrome and glomerulonephritis.
56. 74. The use according to claim 73, wherein the autoimmune disease is rheumatoid arthritis. 25
57. 75. The use according to claim 74, wherein the patient is suffering from moderate to severe rheumatoid arthritis and has failed treatment with at least one disease-modifying antirheumatic drug. 30 76. The use according to claim 74 or 75, further comprising administering to the patient a second therapeutic agent.
58. 77. The use according to claim 76, wherein the second therapeutic agent is an immnunosuppressive agent. 35
59. 78. The use according to claim 77, wherein the immunosuppressive agent is methotrexate. -78
60. 79. The use according to claim 74, wherein the humanized CD20 binding antibody comprises the heavy and light chain amino acid sequence of SEQ ID NO. 39 and 40, respectively. 5 80. The use according to claim 79, wherein the antibody or the antigen-binding fragment is administered at a dosage selected from 2x1 0mg, 2x50mg, 2x 200mg and 2x5OOmg.
61. 81. The use according to any one of claims 72-80, wherein the antibody or the antigen binding fragment is administered by intravenous infusion or subcutaneous administration. [0
62. 82. The use according to claim 73, wherein the autoimmune disease is multiple sclerosis.
63. 83. Use of a CD20 antibody in the manufacture of a medicament for treating rheumatoid arthritis (RA) in a human subject, wherein the CD20 antibody is administered to the subject 15 at a dosage selected from the group consisting of 2x5Omg, 2x200mg, and 2x5OOmg.
64. 84. The use according to claim 83, wherein the dosage is 2x5Omg.
65. 85. The use according to claim 83, wherein the dosage is 2x200mg. 20
66. 86. The use according to claim 83, wherein the dosage is 2x5OOmg.
67. 87. The use according to claim 83, wherein the CD20 antibody is a humanized antibody, 25 88. The use according to claim 83, wherein the CD20 antibody is a humanized 2H7 antibody.
68. 89. The use according to claim 83, wherein the CD20 antibody is rituximab. 30 90. The use according to claim 83, wherein the RA is moderate to severe RA.
69. 91. A humanized antibody that binds human CD20, or an antigen-binding fragment thereof, wherein the antibody comprises the heavy and light chain amino acid sequence of SEQ ID NO. 41 and 40, respectively. 35
70. 92. A humanized antibody that binds human CD20, or an antigen-binding fragment thereof, wherein the antibody comprises the heavy and light chain amino acid sequence of SEQ ID NO. 42 and 43, respectively. - 79 93. A humanized antibody that binds human CD20, or an antigen-binding fragment thereof, wherein the antibody comprises the VH sequence of SEQ ID NO.51 and the VL sequence of SEQ H) NO.52. 5
71. 94. The humanized antibody of claim 93, wherein the antibody comprises the heavy and light chain amino acid sequence of SEQ ID NO. 44 and 45, respectively.
72. 95. A humanized antibody that binds human CD20, or an antigen-binding fragment 10 thereof, wherein the antibody comprises the V 1 4 sequence of SEQ ID NO.51 and the VL sequence of SEQ ID NO.53.
73. 96. A humanized antibody according to claim 95, wherein the antibody comprises the heavy and light chain amino acid sequence of SEQ ID NO. 46 and 47, respectively. 15
74. 97. A humanized antibody according to claim 95, wherein the antibody comprises the heavy and light chain amino acid sequence of SEQ ID NO. 48 and 47, respectively.
75. 98. A humanized antibody according to claim 95, wherein the antibody comprises the 20 heavy and light chain amino acid sequence of SEQ ID NO. 49 and 47, respectively.
76. 99. A humanized antibody according to claim 95, wherein the antibody comprises the heavy and light chain amino acid sequence of SEQ ID NO. 50 and 47, respectively. 25 100. A humanized antibody according to claim 93 or 95, wherein the VH region is joined to a human IgG chain constant region.
77. 101. An antibody according to claim 100, wherein the human IgG is IgGI or IgG3. 30 102. An antibody according to claim 101, wherein the human IgG is IgGI.
78. 103. An antibody according to claim 102, wherein the IgGI Fc region comprises the amino acid substitutions S298A/E333A/K334A.
79. 104. A composition comprising a humanized antibody or an antigen-binding fragment 35 according to any one of claims 91-103, and a pharmaceutically acceptable carrier.
80. 105. An isolated nucleic acid that encodes an antibody or an antigen-binding fragment according to any one of claims 91-103. - 80
81. 106. An expression vector encoding an antibody or an antigen-binding fragment according to any one of claims 91-103. 5 107. A host cell comprising a nucleic acid of claim 105.
82. 108. The host cell of claim 107 which is a CHO cell.
83. 109. A method of producing an antibody or an antigen-binding fragment comprising [0 culturing a host cell that produces the antibody or the antigen-binding fragment according to any one of claims 91-103.
84. 110. The method of claim 109, further comprising recovering the antibody or the antigen binding fragment produced by the host cell. 15 111 An antibody or an antigen-binding fragment produced by a method comprising expressing a nucleic acid encoding an antibody or an antigen-binding fragment according to any one of claims 91-103 in a host cell and recovering an antibody expressed by the host cell.