Method for Molecular Authentication of Panax ginseng and Panax quinquefolius Using SNP Markers in Dammarenediol Synthase (DS) Gene Inventors: Hua Zhou, Wenru Wu, Liang Liu, and Chunsong Cheng CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority from a US provisional patent application serial number 62/037,129 filed on 14 August 2014, and the disclosure of which is incorporated herein by reference in its entirety. FIELD OF THE INVENTION The present invention is directed to a method for authenticating of Panax ginseng and P quinquefolius based upon the SNP markers in Dammarenediol Synthase (DS) gene. BACKGROUND OF THE INVENTION P. ginseng and P. quinquefolius (American ginseng) are the most widely used Panax species, and the products of these two ginsengs including fresh root, herbal medicine, healthcare products, and other formulations. Because the chemical contents and characters of the two ginsengs are very similar, it is difficult to identify by traditional methods, but they are known to have different properties and medicinal values. P ginseng is considered to be "warm" and used in "yang-deficient" conditions, whereas P. quinquefolius is "cool" and is mainly used in "yin-deficient" conditions. Therefore, it is essential to develop effective methods to accurate quality evaluation and authenticate the origin of herbs, medicinal powder, and commercial ginseng products to safeguard public health as well as consumers' rights. The traditional authentications by phenotypic characteristics, microscopic analysis and physical and chemical methods rely on expert botanical identification of fresh plant or root specimens or on biochemical characterization of active and marker compounds, which are difficult to obtain, even may cause misinterpretation. Molecular markers provide a direct, reliable, and efficient tool for germplasm characterization. There have been a few DNA analysis techniques examining ginseng samples successfully such as random amplification of polymorphic DNA (RAPD) [,1 robust Single nucleotide polymorphism (SNP) markers in ribosomal external transcribed spacer region [2], inter-simple sequence repeat (ISSR), simple sequence repeat (SSR), and amplified fragment length polymorphisms (AFLP) . 1 Studies have found that some DNA polymorphism molecular markers, such as SNP, are phytochemical biosynthesis-related [4-7 and certain type of SNP is able to produce more secondary metabolites, which is usually bioactive components responsible for the therapeutic effects of Chinese medicine and other natural product. If these specific markers are chosen for quality analysis of Chinese medicine, the authenticity and quality (the content of bioactive compounds and efficacy) of Chinese medicine can be accurately determined at the same time, which is important but not realized by now. SNP is a specific molecular marker which can determine the authenticity and probably do quality evaluation of Chinese medicinal materials simultaneously. Ginsenosides are the main active components in ginseng. The first committed step in ginsenoside synthesis is the cyclization of 2,3-oxidosqualene to dammarenediol II by oxidosqualene cyclase, dammarenediol synthase (DS). DS is the key site in the ginsenoside biosynthetic pathway which is believed to be related to the bioactive content of ginseng. The gene encoding DS has been characterized [8]. However, the DS sequence information is inadequate for researchers. The present invention developed an identification technology for P ginseng and P quinquefolius based on the excavation of DS gene sequence. With the aim of establishing a fast and valuable protocol for detection P. ginseng and P. quinquefolius samples, two SNP sites specific to P. ginseng from DS gene are exploited. Based on the SNP sites, two specific primers are designed for P. ginseng and P. quinquefolius respectively. SUMMARY OF THE INVENTION The present invention provides a method for molecular authentication of various ginseng including P ginseng, P quinquefolius, and related parts or products. The present method amplifies and detects the PCR products using specific primers based on single nucleotide polymorphism (SNP) markers in a DS gene fragment generated by nested PCR according to different embodiments of the present invention. The present invention also offers a reliable and definite way to identify the P ginseng or P. quinquefolius herbs, medicinal powder, and commercial ginseng products. BRIEF DESCRIPTION OF DRAWINGS FIG. 1 is a flowchart depicting the primers position by nested-PCR strategy for molecular authentication of P ginseng and P quinquefolius according to an embodiment of the present invention. FIG. 2 shows a sequence alignment of the DS gene fragments of P. ginseng and P. quinquefolius generated by nested PCR with two primers according to an embodiment of the present invention. 2 FIG. 3 shows allele-specific PCR products of DNA from ginseng fresh roots by gel electrophersis; Lane M: D2000 DNA ladder; Lane 1, 2: P quinquefolius; Lane 3: Biantiao; Lane 4: Damaya; Lane 5: Fuxingyihao; Lane 6, 7: Damaya under forest; Lane 8, 9: Shizhu. FIG. 4 shows allele-specific PCR products of DNA from ginseng dry roots by gel electrophersis; Lane M: D2000 DNA ladder; Lane 1, 2, 3: P quinquefolius; Lane 4,5: P ginseng; Lane 6: P notoginseng. FIG. 5 Allele-specific PCR products using DNA from ginseng products. (A: The results by P ginseng specific primers; B: The results by P quinquefolius specific primers.) Lane M: D2000 DNA ladder; Lane 1: Ginseng bolus I, Lane 2: Ginseng bolus II, Lane 3: Ginseng bolus im, Lane 4: American ginseng tea I, Lane 5: American ginseng tea II, Lane 6: Red ginseng tea I, Lane 7: White ginseng tea, Lane 8: Red ginseng teall, Lane 9: American ginseng tablets, Lane 10: Red ginseng drink, Lane 11: American ginseng tea III. FIG. 6 PCR products of different amount of P quinquefolius and P ginseng. Lane M: D2000 DNA ladder; Lane W1-W8: PCR products of 0.1ng, 0.5ng, 1.0ng, 2.Ong, 4.Ong, 6.Ong, 8.Ong, 10.Ong of P quinquefolius, respectively; Lane R1~R8: PCR products of 0.1ng, 0.5ng, 1.Ong, 2.Ong, 4.Ong, 6.Ong, 8.Ong, 10.Ong of P ginseng, respectively. FIG. 7 PCR products of P3 and P4 using DNA mixture of P ginseng and P quinquefolius. Lane M: D2000 DNA ladder; Lane Ri-Ri1: DNA mixture of P ginseng contain 1%, 2%, 5%, 10%, 20%, 50%, 80%, 90%, 95%, 98%, 99% by weight of P quinquefolius, respectively; PCR products of P5 and P6 using DNA mixture of P quinquefolius and P ginseng. Lane M: D2000 DNA ladder; Lane Wi-Wi1: DNA mixture of P quinquefolius contain 1%, 2%, 5%, 10%, 20%, 50%, 80%, 90%, 95%, 98%, 99% by weight of P ginseng, respectively. FIG. 8 The proportion of guanine in DS ssDNA. ***: P<0.01, DS compared with External Transcribed Spacer (ETS) or Internal Transcribed Spacer (ITS). DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS 1. Materials and Methods 1.1 Preparation of Samples Different landraces of P ginseng and P quinquefolius were collected in Jilin Province and Liaoning Province, China. The harvest time and GPS location were recorded in the sample label. The samples were placed in -80'C after cleaning and classification. Other ginseng plants such as P notoginseng and P japonicus were collected in 3 Yunnan and Hubei Province, China. The roots were placed in -80'C after cleaning and classification. P. ginseng drugs (pieces, tea and pill, oral liquid and injection) and P. quinquefolius drugs (pieces and tea) were purchased from local pharmacy in Guangzhou and other cities in China. Sample sources are described as its preparation name. Table 1. The ginseng samples used in this example Growing No. Name Locality Classification Tissue Amount years Fusong County, Jilin 1 P quinquefolius American ginseng 4 Root 5 province 2 Biantiao* Jian City, .!ili Province China cultivar 6 Root 2 Changbai County, Jilin 3 Damaya* Province China cultivar 6 Root 2 4 Fuxingyihao* Fusong County, Jilin China cultivar 6 Root 2 Province Damaya* under Fusong County, Jilin China cultivar 6 Root 5 forest Province 6 Damaya* under Fusong County, Jilin China cultivar 10 Root 3 forest Province 7 Shizhu* Kuandian, Liaoning China cultivar 6 Root 6 Province 8 Shizhu* Kuandian, Liaoning China cultivar 10 Root 3 Province Wensha , Yunnan China cultivar Root 4 9 P notoginseng Provotce Province Note: All samples were deposited in the State Key Laboratory of Quality Research in Chinese Medicine (Macau University of Science and Technology) *There were 4 ginseng cultivars, named as Damaya, Biantiao, Shizhu and Fuxingyihao shown in the above table, they are all belong to P. ginseng in the view of the taxonomy. Table 2. The ginseng products used in this example No. Name Source Classification Amount 1 P quinquefolius Cultivated American China cultivar 30g ginseng in China 2 P quinquefolius Cultivated American American ginseng 30g ginseng in USA 3 P quinquefolius Cultivated American Canada cultivar 30g ginseng in Canada 4 P ginseng Wanmin pharmacy, China cultivar 30g 4 Guangzhou 5 P ginseng EUHO, Shanghai China cultivar 20g 6 P notoginseng Gongshugeng pharmacy, China cultivar 30g Macao Ginseng health 7 Red ginseng tea I Taobao 30g products 8 White ginseng tea Taobao Ginseng health 30g products Ginseng health 9 Red ginseng tea II Taobao 150g products 10 Ginseng bolus I Pharmacy of Guangzhou Chinese patent drug 30 g 11 Ginseng bolus II Pharmacy of Guangzhou Chinese patent drug 20 g 12 Ginseng bolus III Pharmacy of Guangzhou Chinese patent drug 20 g Chinese health 13 American ginseng tea I Taobao products 20g Hong Kong health 14 American ginseng tea II Taobao products lOE 15 Red ginseng drink Taobao Korean health products 14g American ginseng 16 American ginseng tablet Taobao health products 50g American ginseng 17 American ginseng tea III Taobao health products 60g 1.2 DNA extraction DNA is isolated using a plant DNA isolation kit (DNeasy* Plant Mini Kit, QIAGEN). According to manufacturer's instructions, ginseng roots are abrading required, and ginseng commodities such as ginseng tea, ginseng bolus, etc. are used directly in DNA isolation procedure. Since DNA extraction is interfered with caramel, methanol as the extraction solvent replaces the ethanol in the present invention. 1.3 PCR amplification of DS region and gel electrophoresis Primers P1 and P2 (SEQ ID NOs: 1 and 2) are designed according to the conserved sequences of ginseng DS gene downloaded from GenBank (Accession number: AB265170, GU183405, JN596111) to obtain a DS DNA fragment about 750bp length. Primer sets are designed using Primer3 (http://frodo.wi.mit.edu/primer3/) and Primer Premier 5.0 software (Premier, Canada) with the following parameters: primer length from 20 to 26 nucleotides (22 nucleotides as the optimum), PCR product size from 150 to 700bp, optimum annealing temperature at 58 'C, and GC content from30 to 50% (45% as optimum). The primers were synthesized by BGI LifeTech Co., Ltd. 5 (Guangzhou, China). Each 50[1 PCR mixture contains 25[1 of 2xPremix PCR PrimeSTAR HS DNA polymerase (Takara Biotech Co., China), 10 ng of template DNA, 0.2M of each primer. PCR runs are performed using a Veriti* 96 well Thermal cycler (Applied biosystems, USA) with the programs as follow: 1 predenaturation cycle of 2 min at 94'C, 35 cycles of 98'C for 10 sec, 64'C for 10 sec, and 72'C for 45 sec, and a final extension at 72 C for 5 min. PCR products are analyzed via 1.0% agarose gel electrophoresis visualized by SYBR* Safe DNA Gel Stain (Invitrogen, USA) under UV. 1.4 Determination of ginseng DS gene SNP locus Bidirectional sequencing of PCR products are done by BGI. Then, the sequences are analyzed by BLAST (Http://blast.ncbi.nlm.nih.gov/Blast.cgi), and DNA sequence alignments are performed using the sequences present in GenBank by DNAMAN 7.0, to explore SNP of DS gene between different samples. 1.5 Design of allele-specific primers The present invention provides two pairs of primers that generate different profiles of PRC product in P ginseng and P quinquefolius, respectively. The allele-specific primers P4 and P5 are designed based on the SNP sites detected in DS region which amplified by the nuclear DNA. To identify P ginseng and P quinquefolius, allele-specific primers, P3, P4, P5, and P6 are designed (correspond to SEQ ID NOs: 3, 4, 5 and 6, respectively). Additionally, mismatches are introduced deliberately via the substitutions of G for T in primer P5 in order to ensure required allelic specificity. Table 3. The primers used in this example Primer name Sequence (5'-3') Length (bp) P1(DSF272) ACCGCCGTTGAGATTAGATGA 21 P2(DSR574) ACTGACCCAATCATCGTGCTG 21 P3(DF61) ATGCAGTTACAACCGCTGTG 20 P4(DR629G6-1) TGTTTGTTACTCCCTCCGTGCC 22 P5(DF412Q-1) CCATTCGTTCCATAATATTTGATCG 25 P6(DR751) TATAGGATCCCCATCCACCA 20 Note: Bold underlined nucleotide is the additional mismatch introduced via substitution of G for T. Italics nucleotide are the SNPs. The result of PCR products generated with different corresponding pairs of primers in 6 different parts of P ginseng and P quinquefolius are shown in FIGS. 3 to 7, respectively. 1.6 Molecular authentication of P. ginseng and P. quinquefolius by nested-PCR strategy Molecular authentication of P ginseng and P quinquefolius is performed using the method of nested PCR. The first round of PCR is carried out using 1 cycle of 2 min at 94'C, 25 cycles of 30 sec at 98'C, 10 sec at 64'C, and 45 sec at 72'C, with a final extension of 72'C for 5 min. Each 50[1 PCR mixture contains 25[1 of 2xPremix PCR PrimeSTAR HS DNA polymerase (Takara Biotech Co., China), 10 ng of template DNA, 0.2M of primers P1 and P2. Then, the products are diluted 100 times to be the template for the second round of nested PCR. The second round of nested PCR is carried out in 2 PCR tubes, one using the primers P3 and P4, the other one using primers P5 & P6. The PCR cycle profile is as follows: 1 cycle of 30 sec at 98'C, 35 cycles of 10 sec at 98'C, 10 sec at 66'C for P3 and P4 primer pair or 10 sec at 63'C for P5 and P6 primer pair, respectively, and 10 sec at 72'C, with a final extension of 72'C for 7 min. Each 50[1 PCR mixture contains 25[1 of 2xTransStart FastPfu PCR SuperMix (Beijing TransGen Biotech Co., Ltd., China), 1 1 of template DNA, 0.2 [tM of each primer. All of the DNA amplifications are finished in the PCR instrument (Veriti@ 96-Well Fast Thermal Cycler, ABI). PCR products are analyzed via 1.0% agarose gel electrophoresis visualized by SYBR* Safe DNA Gel Stain (Invitrogen, USA) under UV. The nested PCR strategy and position of the primers used in this example are summarized in a flowchart in FIG. 1. 1.7 Sensitivity and specificity test of nested-PCR In order to test the sensitivity of this method, experiments are carried out on different template amount of P. quinquefolius and P. ginseng. The result is that both can be detected when the template amount is 0.1 ng. To check the specificity of this method, DNA mixture samples contain 1%, 2%, 5%, 10%, 20%, 50%, 80%, 90%, 95%, 98%, 99% by weight of P quinquefolius or P ginseng. The established method can detect 1% of intentional adulteration of P ginseng or P. quinquefolius at 10 ng level of total DNA. 2. Results 2.1 Ginseng DS fragment amplification 7 Ginseng DS fragment is obtained by the Primers P1 and P2, and the length is measured 749bp with 2 introns of 128bp and 332bp in length. The BLAST (http://blast.ncbi.nlm.nih.gov/Blast.cgi) results show up to 100% similarity to the DS gene of P ginseng, P quinquefolius and P notoginseng. 2.2 SNP loci confirmation The DNA Multiple sequence alignment analysis shows 6 SNP sites (FIG. 2). Two specific primers, P4 (specific to P ginseng) and P5 (specific to P quinquefolius), are designed on the basis of SNP sites shown in FIG. 2. The relative position and sizes of the expected amplicon are shown that the cultivar-specific amplicons of P ginseng should be 571bp (SEQ ID No: 7), and P quinquefolius should be 341bp (SEQ ID No: 8) under the nested PCR system of the present invention. 2.3 Molecular authentication of P. ginseng and P. quinquefolius Molecular authentication of P ginseng and P quinquefolius is performed using the specific primers and the method of nested PCR of the present invention. As shown in FIG. 3, 4, and 5, the entire P ginseng fresh and dried roots collected from different areas produces specific amplicons of 571bp, whereas the P quinquefolius samples generate amplicons of 341bp. In addition, no specific DNA bands can be amplified in P. notoginseng. Two ginseng species and products containing the two could be clearly identified and P. notoginseng also could be distinguished from the two ginseng samples. In addition, no specific bands can be amplified from fresh roots of P. notoginseng samples (FIG. 3), indicating that no specific amplicon is generated. Therefore, this method is specific for identifying P. ginseng and P. quinquefolius from other panax species. A large number of ginseng samples have been tested and the accuracy of this SNP marker is confirmed. With the two pairs of primers of high specificity, it is to conclude that the method of using nested-PCR according to the embodiments of the present invention can specifically authenticate P ginseng and P quinquefolius, notwithstanding the PCR products of DNA from whole plant (FIG. 3), root (FIG. 4), and products (FIG. 5) of P ginseng and P quinquefolius. 11 kinds of ginseng products were tested by the molecular authentication. All samples have a specific electrophoretic band, and the results showed that two kinds of American ginseng tea mixed with P ginseng and the others consistent with the commodity description shown in FIG 5. 2.4 The sensitivity and specificity test of nested-PCR 8 In order to test the sensitivity of this method, experiments are carried out on different amount of template of P quinquefolius and P ginseng. The result is that both can be detected when the template amount is 0.1 ng, but the P ginseng is more sensitive than P quinquefolius. (FIG. 6) To check the specificity of this method, DNA mixture samples contain 1%, 2%, 5%, 10%, 20%, 50%, 80%, 90%, 95%, 98%, 99% amount of P quinquefolius or P ginseng were respectively used for PCR. As shown in FIG. 7, the established method can detect 1% of intentional adulteration of P ginseng or P quinquefolius at 10 ng level of total DNA. 2.5 The superiority of DS gene over non-functional sequences for quality analysis of Chinese medicine With the development of molecular biology, a growing number of molecular biology techniques have been applied to the quality analysis, mostly identification of varieties of Chinese medicine, most of these studies chose non-functional sequences for this purpose, such as ITS2 [9', ETS"', cox2" 1 , and ESTs", etc. However, the sequences are usually unstable due to high proportion of guanine in comparison with DS gene, which is more resistant to oxidative damage and isomerization[ 1 2 (FIG. 8). There is always significant gene degradation occurred in Chinese medicine during drying process, this situation is even worse in Chinese patent drugs, in which the gene sequences contained by Chinese medicine are largely degraded due to long time and high temperature process in the preparation procedures of Chinese patent drugs. Therefore, the method in the present invention can be more successfully and provide more accurate authentication result than other methods employing non-functional sequences. References [1] Mihalov JJ, Marderosian AD, Pierce JC. DNA Identification of Commercial Ginseng Samples. J Agric Food Chem. 2000 Aug 1;48(8):3744-52. [2] Wang H, Kim M-K, Kwon W-S, Jin H, Liang Z, Yang D-C. Molecular authentication of Panax ginseng and ginseng products using robust SNP markers in ribosomal external transcribed spacer region. J Pharm Biomed Anal. 2011 Jul 15;55(5):972-6. [3] Wang H, Sun H, Kwon W-S, Jin H, Yang D-C. Molecular identification of the Korean ginseng cultivar "Chunpoong" using the mitochondrial nad7 intron 4 region. Mitochondrial DNA. 2009 Jan 1;20(2-3):41-5. [4] Thomas PD, Kejariwal A. Coding single-nucleotide polymorphisms associated with complex vs. Mendelian disease: Evolutionary evidence for differences in 9 molecular effects. PNAS. 2004 Oct 26;101(43):15398-403. [5] Umemoto T, Aoki N. Single-nucleotide polymorphisms in rice starch synthase Ila that alter starch gelatinisation and starch association of the enzyme. Funct Plant Biol. 2005;32(9):763-8. [6] Wang E, Wang J, Zhu X, Hao W, Wang L, Li Q, et al. Control of rice grain-filling and yield by a gene with a potential signature of domestication. Nat Genet. 2008;40(11):1370-4. [7] Shen Z, Liu C, Wang X, Guo W, Li B. Correlation analysis between single nucleotide polymorphism of beta-amyrin synthase and content of glycyrrhizic acid in Glycyrrhiza uralensis. Zhongguo Zhong Yao Za Zhi. 2010 Apr;35(7):813-6. [8] Han JY, Kwon YS, Yang DC, Jung YR, Choi YE. Expression and RNA Interference-Induced Silencing of the Dammarenediol Synthase Gene in Panax ginseng. Plant Cell Physiol. 2006 Dec 1;47(12):1653-62. [9] Yao H, Song J, Liu C, Luo K, Han J, Li Y, et al. Use of ITS2 Region as the Universal DNA Barcode for Plants and Animals. PLoS ONE. 2010 Oct 1;5(10):e13102. [10] Wang H, Sun H, Kwon W-S, Jin H, Yang D-C. Molecular identification of the Korean ginseng cultivar "Chunpoong" using the mitochondrial nad7 intron 4 region. Mitochondrial DNA. 2009 Jan 1;20(2-3):41-5. [11] Sun H, Wang H-T, Kwon W-S, Kim Y-J, In J-G, Yang D-C. A simple and rapid technique for the authentication of the ginseng cultivar, Yunpoong, using an SNP marker in a large sample of ginseng leaves. Gene. 2011 Nov 1;487(1):75-9. [12] Morikawa M, Kino K, Oyoshi T, Suzuki M, Kobayashi T, Miyazawa H. Analysis of Guanine Oxidation Products in Double-Stranded DNA and Proposed Guanine Oxidation Pathways in Single-Stranded, Double-Stranded or Quadruplex DNA. Biomolecules. 2014 Feb 10;4(1):140-59. The references cited herein are also incorporated by references in their entirety. 10