AU2013204555A1 - Protecting modified viruses from neutralizing antibodies using the reovirus sigma 1 protein - Google Patents
Protecting modified viruses from neutralizing antibodies using the reovirus sigma 1 protein Download PDFInfo
- Publication number
- AU2013204555A1 AU2013204555A1 AU2013204555A AU2013204555A AU2013204555A1 AU 2013204555 A1 AU2013204555 A1 AU 2013204555A1 AU 2013204555 A AU2013204555 A AU 2013204555A AU 2013204555 A AU2013204555 A AU 2013204555A AU 2013204555 A1 AU2013204555 A1 AU 2013204555A1
- Authority
- AU
- Australia
- Prior art keywords
- leu
- ser
- thr
- gly
- ile
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Abandoned
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/525—Virus
- A61K2039/5256—Virus expressing foreign proteins
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/66—Microorganisms or materials therefrom
- A61K35/76—Viruses; Subviral particles; Bacteriophages
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2720/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsRNA viruses
- C12N2720/00011—Details
- C12N2720/12011—Reoviridae
- C12N2720/12022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biochemistry (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Virology (AREA)
- Biomedical Technology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Gastroenterology & Hepatology (AREA)
- General Engineering & Computer Science (AREA)
- Immunology (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Peptides Or Proteins (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
Provided herein is a modified, non-reovirus virus comprising a reovirus sigma 1 protein. Methods of making a modified, non-reovirus virus comprising a reovirus sigma 1 protein and methods of using same are also provided.
Description
PROTECTING MOIFIED VIRUSES FROM NEUTRALIZING ANTIBODIES USING TIlE REO VIRUS SIGMA 1 PROTEIN BACKGROUND 5 The name reovirus derives from an acronym for respiratory enteric orphan virus, reflecting that the initial isolates came from human respiratory and enteric tracts but were not associated with serious disease. Reovirus has a viral cell attachment protein called sigma 1 protein, which is encoded by the Si gene and which is responsible for binding reovirus to specific receptors on the surface of cells. 10 SUMMARY Provided herein is a modified, non-reovirus virus comprising a reovirus sigma 1 protein, wherein the reovirus sigma I protein replaces the native attachment protein of the non-reovirus virus, and wherein the modified virus does not comprise any portion of the native attachment protein of the non-reovirus virus. 15 Further provided is a method of making a non-reovirus virus that is protected from neutralizing antibodies comprising, replacing the native attachment protein of the non reovirus virus with a reovirus sigma I protein, wherein the full-length sequence of the native attachment protein of the non-reovirus virus is replaced with a reovirus sigma I protein. 20 Also provided is a method of treating a cell proliferative disorder in a mammal by administering an effective amount of the modified, non-reovirus virus to a subject with a proliferative disorder. The modified, non-reovirus virus promotes substantial lysis of cells of the proliferative disorder (e.g., cells of a neoplasm). DESCRIPTION OF DRAWINGS 25 Figure 1 illustrates a clinical trial schema. Figure 2 shows that neutralizing antibodies (NAB), are present at baseline and increase following treatment, whilst the viral genome is only transiently detectable after infusion in plasma. (A) Samples collected from each patient prior to their first virus infusion were tested for baseline NAB levels. Plot shows neutralization of reovirus induced killing of 30 L929 cells by serial dilutions of samples as measured by MTT assay at 72 hrs. L929 cells were treated with reovirus only (+reovirus) or left untreated (UN) as positive and negative controls respectively, and an antireovirus polyclonal goat antibody (Ab3054) was used as a standard curve for the assay at a staring dilution of 1:1000. (B) Changes in endpoint reovirus NAB titer in each patient over time (NA denotes samples that were unavailable for 35 analysis). (C) Patient plasma was assessed for reovirus RNA by RT-PCR over time.
I
Reovirus RNA or RNase-free water were included as positive and negative controls respectively. Figure 3 shows that despite circulating NAB, PBMC transiently carry reovirus after infusion, which can replicate in and kill target cells in vitro. (A) Day 1 postinfusion patient 5 PBMC were assessed either directly for reovirus RNA by RTPCR ('neat') or after an additional amplification step on L929 cells for 7 days ('amplified'). Reovirus RNA and RNase-free water were included as positive and negative controls respectively, as well as a 1:10 dilution of stock reovirus or 5% DMEM incubated on L929 cells as amplified positive and negative controls respectively (AMP). Later time points for patients 3 and 4 are also 10 shown. (B) Patient PBMC were assessed for functional reovirus in a TCID 50 assay where L929 cells were cultured with serial dilutions of P13MC and observed 7 days later for CPE. Photomicrographs show patient results from day I post-infusion PBMC for all samples, as well as later time points for patients 3 and 4. 1:10 dilution of stock reovirus or 5% DMEM (UN) were incubated on L929 cells as positive and negative controls respectively. Rounded 15 up cells and unused (red) media signify CPE. (C) Reovirus-induced cell killing by Day I PBMC samples was further confirmed in the TCID 50 assay by MTT analysis. * denotes statistical significance with p <0.05 versus untreated control. (D) Viral titers in TCIDSO/ml, as determined by the Spearman-Karber statistical method, in each patient PBMC sample over time. (NA denotes samples that were unavailable for analysis). 20 Figure 4 shows that granulocytes similarly carry replication-competent reovirus after infusion. (A) Day I post-infusion granulocytes from patients 7 to 10 were assessed for reovirus RNA by RT-PCR, using both neat and amplified samples as for PBMC in Figure 3A. (B) Granulocytes from patients 7 to 10 were assessed for functional reovirus in a
TCID
5 o assay as for PBMC in Figure 3B. Photomicrographs show day 1 post-infusion 25 granulocyte dilutions; rounded up cells and unused (red) media signify CPE. (C) Reovirus induced cell killing by granulocytes from patients 7 to 10 was further confirmed in the
TCID
50 assay by MTT analysis. * denotes statistical significance with p <0.05 versus untreated control. (D) Viral titers in TCID50/ml, as determined by the Spearman-Karber statistical method, in granulocytes from patients 7 to 10 over time. (NA denotes samples 30 that were unavailable for analysis).). Figure 5 shows that platelets also carry reovirus after infusion. (A) Day I post infusion platelets from patients 7 to 10 were assessed for reovirus RNA by RT-PCR, using both neat and amplified samples as for PBMC in Figure 3A. (B) Platelets from patients 7 to 10 were assessed for functional reovirus in a TCID 50 assay as for PBMC in Figure 3B. 2 Photomicrographs show day 1 post-infusion platelet dilutions; rounded up cells and unused (red) media signify CPE. (C) Reovirus-induced cell killing by platelets from patients 7 to 10 was further confirmed in the TCID 5 0 assay by MTT analysis. * denotes statistical significance with p <0.05 versus untreated control. (D) Viral titers in TCID 5 o/ml, as 5 determined by the Spearman-Karber statistical method, in platelets from patients 7 to 10 over time. (NA denotes samples that were unavailable for analysis). Figure 6 shows intravenous reovirus is selectively delivered to metastatic colorectal tumor cells within the liver. (A) Immunohistochemistry images showing expression of reovirus protein (red stain) in resected colorectal liver metastases (magnification x 400). 10 One representative case each of weak (left) and strong (right) staining are shown, illustrating consistently greater signal in malignant cells (black arrows) relative to tumor stroma (red arrows). (B) Immunohistochemistry images for expression of reovirus protein (red stain) in normal liver resected as a margin around colorectal liver metastases (magnification x 400). One representative case each of faint (left) and negative (right) 15 staining is shown. (C) Representative electron microscopy image showing immunogold staining of reovirus sigma 3 capsid (arrowed black dots), within colorectal liver metastases. Scale bar represents 500nm. (D) RGB image analyses of resected colorectal liver metastases, using the Nuance System (magnification x400). Images are from one representative patient and show reovirus staining (red) and caspase-3 staining (brown) (left 20 image; arrow indicates changes of nuclear and cytoplasmic degeneration in reovirus infected tumor cells). Right image shows conversion of the RGB image to: fluorescent green (caspase-3), fluorescent red (reovirus) and yellow (co-expression). Figure 7 shows that replication competent reovirus can be retrieved from tumor tissue. (A) RGB image analyses of resected colorectal liver metastases, using the Nuance 25 System (magnification x200). Images are from one representative patient and show: (top left) reovirus staining (red) and tubulin staining (brown) (malignant cells are marked by a black arrow and tumor stroma is marked by a red arrow); (top right) conversion of the RGB image to fluorescent red (reovirus); (bottom left) conversion of the RGB image to fluorescent green (tubulin) and (bottom right) co-expression of reovirus and tubulin 30 (yellow) (B) Single cell suspensions of freshly resected tumor and liver tissue from patients 7 to 10 were incubated with L929 cells for 24-48 hrs before being removed and replaced with 5% DMEM. Supernatants were collected after a further 5-7 days of culture and assessed for reovirus replication using a standard plaque assay. Photographs of plaques from tumor samples show representative wells of: 1:2500 supernatant dilution (patient 7), 3 neat supernatant (patients 8 and 9) and 1:1200 dilution (patient 10). Photographs of liver samples show representative negative wells of neat supernatant from all patients. A lxi0-6 dilution of stock reovirus or 5% DMEM alone were included as positive and negative controls respectively. (C) Culture supernatants from tumor plaques assays performed in (B) 5 were assessed for reovirus sigma 3 protein by western blotting. Presence of reovirus was confirmed in all 4 samples by a band at 41 KDa. DETAILED DESCRIPTION Provided herein is a modified, non-reovirus virus comprising a reovirus sigma I protein, wherein the reovirus sigma I protein replaces the native attachment protein of the 10 non-reovirus virus, and wherein the modified virus does not comprise any portion of the native attachment protein of the non-reovirus virus. In the modified, non-reovirus virus disclosed herein, the reovirus sigma 1 protein attaches to carrier cells that protect the virus from neutralizing antibodies during in vivo delivery. In the modified, non-reovirus virus disclosed herein the reovirus sigma 1 protein 15 attaches to carrier cells that protect the virus from neutralizing antibodies during in vivo delivery to a tumor, for example, during systemic delivery. The non-reovirus virus can be, but is not limited to, an adenovirus, a vaccinia virus, a paramyxovirus, a herpes simplex virus or a parapox virus. The modified, non-reovirus virus can be an oncolytic virus. Further provided is a method of making a non-reovirus virus that is protected from 20 neutralizing antibodies comprising replacing the native attachment protein of the non reovirus virus with a reovirus sigma 1 protein, wherein the full-length sequence of the native attachment protein of the non-reovirus virus is replaced with a reovirus sigma 1 protein. In the methods of making a non-reovirus virus, replacement of the native attachment protein of the virus with a reovirus sigma 1 protein allows the virus to attach to 25 carrier cells which protect the virus from neutralizing antibodies during in vivo delivery. As used herein, the term sigma- 1 protein refers to the polypeptide encoded by the SI genome segment of a reovirus. The term reovirus refers to any type or strain of reovirus. Thus, the sigma-I protein can be from any strain or type of reovirus. The term reovirus refers to any virus classified in the reovirus genus, whether naturally occurring, modified, or 30 recombinant. The human reovirus includes three serotypes: type I (strain Lang or T I L), type 2 (strain Jones, T2J), and type 3 (strain Dearing or strain Abney, T3D). The three serotypes are easily identifiable on the basis of neutralization and hemagglutinin-inhibition assays. A reovirus according to this disclosure can be a type 3 mammalian orthoreovirus. Type 3 mammalian orthoreoviruses include, without limitation, Dearing and Abney strains 4 (f3D or '3A, respectively). See, for example, ATCC Accession Nos. VR-232 and VR 824. The reovirus may be naturally occurring or modified. The reovirus is naturally occurring when it can be isolated from a source in nature and has not been intentionally modified by humans in the laboratory. For example, the reovirus can be from a field 5 source, that is, from a human who has been infected with the reovirus. Thus, the sigma-I protein is, optionally, from a naturally occurring, modified or recombinant reovirus. Optionally, the sigma-I protein is from a serotype 1, 2 or 3 reovirus. Optionally, the sigma 1 protein is from a serotype 3 reovirus. Optionally, the sigma-1 protein is from a Dearing strain or Abney strain reovirus. Optionally, the sigma-I protein is from a Dearing strain 10 reovirus. Sigma-i polypeptides include, but are not limited to, SEQ ID NO: 1, SEQ ID NO:2 and SEQ ID NO:3 and can be found at GenBank Accession Nos. MI0262. 1, JQ599138, and ACV52070. 1. As discussed in more detail below, the polypeptides can include one or more modifications. Optionally, the sigma-i polypeptide is modified to have increased 15 infectivity. See, for example, SEQ ID NO:3, which can be found at GenBank Accession No. JQ599138 (Shmulevitz et al., J. Virol. 86(13):7403-13 (2012)). It is understood that the nucleic acids that can encode those peptide, polypeptide, or protein sequences, variants and fragments thereof are also disclosed. This would include all degenerate sequences related to a specific polypeptide sequence, i.e. all nucleic acids having 20 a sequence that encodes one particular polypeptide sequence as well as all nucleic acids, including degenerate nucleic acids, encoding the disclosed variants and derivatives of the polypeptide sequences. Thus, while each particular nucleic acid sequence may not be written out herein, it is understood that each and every sequence is in fact disclosed and described herein through the disclosed polypeptide sequence. Further, nucleic acids 25 encoding the sigma-I protein include, but are not limited to SEQ ID NO:4, and SEQ ID NO:5, and SEQ ID NO:6, and can be found at GenBank Accession Nos. GQ468272.1, M10262.1 and JQ599138. As with all peptides, polypeptides, and proteins, including fragments thereof, it is understood that additional modifications in the amino acid sequence of the provided agents 30 that are polypeptides can occur that do not alter the nature or function of the peptides, polypeptides, or proteins. Such modifications include, for example, conservative amino acids substitutions and are discussed in greater detail below. Thus, the provided agents comprising polypeptides or nucleic acids can be further modified and varied so long as the desired function is maintained. It is understood that one way to define any known 5 modifications and derivatives or those that might arise, of the disclosed nucleic acid sequences and proteins herein is through defining the modifications and derivatives in terms of identity to specific known sequences. Specifically disclosed are polypeptides which have at least 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83 , 84, 85, 86, 87, 88, 89, 90, 91, 5 92, 93, 94, 95, 96, 97, 98, 99 percent identity to the polypeptides provided herein. Those of skill in the art readily understand how to determine the identity of two polypeptides. For example, the identity can be calculated after aligning the two sequences so that the identity is at its highest level. Another way of calculating identity can be performed by published algorithms. 10 Optimal alignment of sequences for comparison may be conducted by the local identity algorithm of Smith and Waterman, Adv. Apple. Math 2:482 (1981), by the identity alignment algorithm of Needleman and Wunsch, J. Mol Biol. 48: 443 (1970), by the search for similarity method of Pearson and Lipman, Proc. NatI. Acad. Sci. USA 85: 2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and 15 TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, WI), or by inspection. The same types of identity can be obtained for nucleic acids by, for example, the algorithms disclosed in Zuker, Science 244:48-52 (1989); Jaeger et al., Proc. Natl. Acad. Sci. USA 86:7706-7710 (1989); Jaeger et al., Methods Enzymol. 183:281-306 (1989), 20 which are herein incorporated by reference for at least material related to nucleic acid alignment. It is understood that any of the methods typically can be used and that in certain instances the results of these various methods may differ, but the skilled artisan understands if identity is found with at least one of these methods, the sequences would be said to have the stated identity and to be disclosed herein. 25 Protein modifications include amino acid sequence modifications. Modifications in amino acid sequence may arise naturally as allelic variations (e.g., due to genetic polymorphism), may arise due to environmental influence (e.g., exposure to ultraviolet light), or may be produced by human intervention (e.g., by mutagenesis of cloned DNA sequences), such as induced point, deletion, insertion, and substitution mutants. These 30 modifications can result in changes in the amino acid sequence, provide silent mutations, modify a restriction site, or provide other specific mutations. Amino acid sequence modifications typically fall into one or more of three classes: substitutional, insertional, or deletional modifications. Insertions include amino and/or terminal fusions as well as intrasequence insertions of single or multiple amino acid residues. Insertions ordinarily will 6 be smaller insertions than those of amino or carboxyl terminal fusions, for example, on the order of one to four residues. Deletions are characterized by the removal of one or more amino acid residues from the protein sequence. Typically, no more than about from 2 to 6 residues are deleted at any one site within the protein molecule. Amino acid substitutions 5 are typically of single residues, but can occur at a number of different locations at once; insertions usually will be on the order of about from 1 to 10 amino acid residues; and deletions will range about from 1 to 30 residues. Deletions or insertions preferably are made in adjacent pairs, i.e., a deletion of 2 residues or insertion of 2 residues. Substitutions, deletions, insertions or any combination thereof may be combined to arrive at a final 10 construct. The mutations must not place the sequence out of reading frame and preferably will not create complementary regions that could produce secondary mRNA structure. Substitutional modifications are those in which at least one residue has been removed and a different residue inserted in its place. Such substitutions generally are made in accordance with the following Table 1 and are referred to as conservative substitutions. 15 Table 1:Amino Acid Substitutions Amino Acid Substitutions (others are known in the art) Ala Ser, Gly, Cys Arg Lys, Gin, Met, lie Asn Gin, His, Glu, Asp Asp Glu, Asn, Gin Cys Ser, Met, Thr Gin Asn, Lys, Glu, Asp Glu Asp, Asn, GIn Gly Pro, Ala His Asn, GIn Ile Leu, Val, Met Leu Ile, Val, Met Lys Arg, Gin, Met, lie Met Leu, Ile, Val Phe Met, Leu, Tyr, Trp, His Ser Thr, Met, Cys Thr Ser, Met, Val Trp Tyr, Phe 7 Amino Acid Substitutions (others are known in the art) Tyr Trp, Phe, HIs Val lie, Leu, Met Modifications are generated in the nucleic acid of a virus using any number of methods known in the art. For example, site directed mutagenesis can be used to modify a nucleic acid sequence. One of the most common methods of site-directed mutagenesis is 5 oligonucleotide-directed mutagenesis. In oligonucleotide-directed mutagenesis, an oligonucleotide encoding the desired change(s) in sequence is annealed to one strand of the DNA of interest and serves as a primer for initiation of DNA synthesis. In this manner, the oligonucleotide containing the sequence change is incorporated into the newly synthesized strand. See, for example, Kunkel, 1985, Proc. Natl. Acad. Sci. USA, 82:488; Kunkel et al., 10 1987, Meth. Enzymol., 154:367; Lewis & Thompson, 1990, Nucl. Acids Res., 18:3439; Bohnsack, 1996, Meth. Mol. Biol., 57:1; Deng & Nickoloff, 1992, Anal. Biochem., 200:81; and Shimada, 1996, Meth. Mol. Bio., 57:157. Other methods are routinely used in the art to introduce a modification into a sequence. For example, modified nucleic acids are generated using PCR or chemical synthesis, or polypeptides having the desired change in 15 amino acid sequence can be chemically synthesized. See, for example, Bang & Kent, 2005, Proc. Natl. Acad. Sci. USA, 102:5014-9 and references therein. Selection on a cell type on which virus is not usually grown (e.g., human cells) and/or chemical mutagenesis (see, for example, Rudd & Lemay, 2005, J. Gen. Virology, 86:1489-97) also can be used to generate modifications in the nucleic acid of a virus. 20 Non-reovirus viruses that are used in the provided methods include, but are not limited to, viruses that are members in the family of myoviridae, siphoviridae, podoviridae, tectiviridae, corticoviridae, plasmaviridae, lipothrixviridae, fuselloviridae, poxviridae, iridoviridae, phycodnaviridae, baculoviridae, herpesviridae, adenoviridae, papovaviridae, polydnaviridae, inoviridae, microviridae, geminiviridae, circoviridae, parvoviridae, 25 hepadnaviridae, retroviridae, cystoviridae, birnaviridae, paramyxoviridae, rhabdoviridae, filoviridae, orthomyxoviridae, bunyaviridae, arenaviridae, leviviridae, picornaviridae, sequiviridae, comoviridae, potyviridae, caliciviridae, astroviridae, nodaviridae, tetraviridae, tombusviridae, coronaviridae, flaviviridae, togaviridae, and birnaviridae. Immunoprotected viruses and reassortant or recombinant non-reovirus viruses of these and other viruses are 30 also encompassed by the provided methods. A few non-reovirus viruses are discussed 8 below, and a person of ordinary skill in the art can practice the present methods using additional non-reovirus viruses as well according to the disclosure herein and knowledge available in the art. Optionally, the non-reovirus virus is a virus selected from the group consisting of an 5 adenovirus, a vaccinia virus, a paramyxovirus, a herpes simplex virus or a parapox virus. Optionally, the non-reovirus virus contains only one modification, the replacement of the native attachment protein of the non-reovirus virus with the reovirus sigma-1 protein. As used herein, the term native refers to the origin of the molecule. As used herein, the term native attachment protein refers to the protein of the non-reovirus virus that specifically 10 binds one or more molecules, e.g., a receptor, on a cell. The attachment protein facilitates viral entry into the cell. Optionally, the attachment protein is a capsid protein. Some non reovirus viruses express more than one attachment protein. As provided herein, the sigma-1 protein can replace one, two, three, four, and the like, or all of the native attachment proteins expressed by a non-reovirus virus. Optionally, the sigma-I protein replaces all of 15 the native attachment proteins of the non-reovirus virus. Thus, the promoter for controlling expression of the sigma-1 protein may be obtained from various sources. The reovirus sigma- 1 protein can be expressed from the native attachment protein promoter or from the sigma-I protein promoter. Optionally, the promoter is obtained from, for example, the genomes of viruses such as polyoma, Simian 20 Virus 40 (SV40), adenovirus, retroviruses, hepatitis-B virus and cytomegalovirus, or from heterologous mammalian promoters, e.g., beta actin promoter. In the non-reovirus virus, the sigma-I protein can be expressed from its native promoter (i.e., the sigma- 1 promoter) or from the promoter of the native attachment protein. Optionally, the entire native attachment protein is replaced by the sigma-l protein. Optionally, the entire native 25 attachment protein is replaced with the sigma- 1 protein and its promoter. Optionally, the promoter of the native attachment protein remains intact. By way of example, the non-reovirus virus can be an adenovirus, which attaches to cellular targets through the adenovirus fiber protein. Thus, optionally, the sigma-I protein replaces the entire adenovirus fiber protein. Optionally, the non-reovirus virus is a vaccinia 30 virus. Native attachment proteins of vaccinia virus include, but are not limited to, A27L and H3L proteins. As described herein, the reovirus sigma-I protein can replace one or all of these attachment proteins of the vaccinia virus. At a minimum, at least one native attachment protein is replaced by the sigma- 1 protein. Optionally, as discussed above, the reovirus sigma-I protein is expressed from its native promoter. Optionally, the non 9 reovirus virus is a paramyxovirus, e.g., a Newcastle disease virus, Native attachment proteins of paramyxoviruses include, but are not limited to, hemagglutinIn-neuraminidase (HN), hemagglutinin glycoprotein (H), glycoprotein (G) and fusion (F) proteins. As described herein, the reovirus sigma-1 protein can replace one or all of these attachment 5 proteins of the paramyxovirus. Optionally, the non-reovirus viruses contain one or more additional modifications. By way of example, the adenovirus can be a mutant adenovirus carrying a 24 base pair deletion in the EIA region (Fueyo, J., et al., Oncogene 19(l):2-12 (2000)), e.g., the Delta24 virus. Optionally, the adenovirus is mutated in the VAI or VAII region. Optionally, the 10 non-reovirus virus is a Delta24 virus or an adenovirus mutated in the VAI or VAI region wherein the native attachment protein, i.e., the adenovirus fiber protein, is replaced with the reovirus sigma- 1 protein. Optionally, the vaccinia virus comprises one or more additional modifications selected from the group consisting of a modification in the K3L and/or E3L region, a modification in the thymidine kinase (TK) gene, a modification in the vaccinia 15 growth factor (VGF) gene, and combinations thereof. Optionally, the non-reovirus virus is a herpes simplex virus comprising one or more additional modifications including, but not limited to, a mutation in the y134.5 gene. Optionally, the non-reovirus virus is a parapox virus. Optionally, the parapox virus is a parapoxvirus orf virus mutated in the OV20.0L gene. 20 The provided non-reovirus viruses comprising a sigma-I protein that replaces the native attachment protein of the non-reovirus virus can be made using methods known to those of skill in the art. For example, the non-reovirus viruses can be made as set forth as described in many standard laboratory manuals, such as Sambrook et al., Molecular Cloning: A Laboratory Manual (Fourth Edition), Cold Spring Harbor Laboratory Press, 25 Cold Spring Harbor, N.Y. (2012). The nucleic acid sequences of the sigma-I protein may include the coding sequence for the mature polypeptide, by itself, or the coding sequence for the mature polypeptide in reading frame with other coding sequences, such as those encoding a leader or secretory sequence. The nucleic acid sequence may also contain non coding 5' and 3' sequences, such as transcribed, non-translated sequences, splicing and 30 polyadenylation signals, ribosome binding sites and sequences that stabilize mRNA. Also provided is a method for treating a cell proliferative disorder in a mammal, comprising administering an effective amount of modified oncolytic non-reovirus virus comprising a reovirus sigma I to a subject with a proliferative disorder under conditions that result in substantial lysis of cells of the proliferative disorder. 10 As used herein, the term proliferative disorder refers to any cellular disorder in which the cells proliferate more rapidly than normal tissue growth. A proliferative disorder includes, but is not limited to, neoplasms, which are also referred to as tumors. A neoplasm can include, but is not limited to, pancreatic cancer, breast cancer, brain cancer (e.g., 5 glioblastoma), lung cancer, prostate cancer, colorectal cancer, thyroid cancer, renal cancer, adrenal cancer, liver cancer, neurofibromatosis I, and leukemia. A neoplasm can be a solid neoplasm (e.g., sarcoma or carcinoma) or a cancerous growth affecting the hematopoietic system (e.g., lymphoma or leukemia). Other proliferative disorders include, but are not limited to, neurofibromatosis. 10 The modified, non-reovirus virus described herein can be included, along with a pharmaceutically acceptable carrier, in a pharmaceutical composition. Such pharmaceutical compositions can include, for example, one or more chemotherapeutic agents and/or one or more immunosuppressive agents. Representative routes of administration include, for example, direct injection, intravenously, intravascularly, intrathecally, intramuscularly, 1s subcutaneously, intraperitoneally, topically, orally, rectally, vaginally, nasally, or by inhalation. The methods of treating a proliferative disorder as described herein can be accompanied by one of more procedures such as surgery, chemotherapy, radiation therapy, and immunosuppressive therapy. A virus having a modified sequence as disclosed herein is administered in an 20 amount that is sufficient to treat the proliferative disorder (e.g., an "effective amount"). A proliferative disorder is "treated" when administration of a virus having a modified sequence to proliferating cells affects one or more symptoms or clinical signs of the disorder including, e.g., increasing lysis (e.g., "oncolysis") of the cells, reducing the number of proliferating cells, reducing the size or progression of a neoplasm, reducing pain 25 associated with the neoplasm, as compared to the signs or symptoms in the absence of the treatment. As used herein, the term "oncolysis" means at least 10% of the proliferating cells are lysed (e.g., at least 20%, 30%, 40%, 50%, or 75% of the cells are lysed). The percentage of lysis can be determined, for example, by measuring the reduction in the size of a neoplasm or in the number of proliferating cells in a mammal, or by measuring the 30 amount of lysis of cells in vitro (e.g., from a biopsy of the proliferating cells). An effective amount of a virus having a modified sequence is determined on an individual basis and is based, at least in part, on the particular virus used; the individual's size, age, gender; and the size and other characteristics of the proliferating cells. For example, for treatment of a human, approximately 103 to 1012 plaque forming units (PFU) 11 of a virus is used, depending on the type, size and number of proliferating cells or neoplasms present. The effective amount can be from about 1.0 pfu/kg body weight to about 10"5 pfu/kg body weight (e.g., from about 102 pflu/kg body weight to about t0" pfu/kg body weight). A virus is administered in a single dose or in multiple doses (e.g., 5 two, three, four, six, or more doses). Multiple doses are administered concurrently or consecutively (e.g., over a period of days or weeks). Treatment with a virus having a modified sequence lasts from several days to several months or until diminution of the disease is achieved. As used herein, a pharmaceutically acceptable carrier includes e a solid, semi-solid, 10 or liquid material that acts as a vehicle, carrier or medium for the modified virus. Thus, for example, compositions containing a virus having a modified sequence are in the form of tablets, pills, powders, lozenges, sachets, cachets, elixirs, suspensions, emulsions, solutions, syrups, aerosols (as a solid or in a liquid medium), ointments containing, for example, up to 10% by weight of the active compound, soft and hard gelatin capsules, suppositories, sterile 15 injectable solutions, and sterile packaged powders. Some examples of suitable carriers include phosphate-buffered saline or another physiologically acceptable buffer, lactose, dextrose, sucrose, sorbitol, mannitol, starches, gum acacia, calcium phosphate, alginates, tragacanth, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, sterile water, syrup, and methyl 20 cellulose. A pharmaceutical composition additionally can include, without limitation, lubricating agents such as talc, magnesium stearate, and mineral oil; wetting agents; emulsifying and suspending agents; preserving agents such as methyl- and propylhydroxy benzoates; sweetening agents; and flavoring agents. Pharmaceutical compositions of the invention can be formulated to provide quick, sustained or delayed release of a virus having 25 a modified sequence after administration by employing procedures known in the art. In addition to the representative formulations described below, other suitable formulations for use in a pharmaceutical composition are found in Remington: The Science and Practice of Pharmacy (2003, Gennaro & Gennaro, eds., Lippincott Williams & Wilkens). For preparing solid compositions such as tablets, a virus having a modified sequence 30 is mixed with a pharmaceutical carrier to form a solid composition. Optionally, tablets or pills are coated or otherwise compounded to provide a dosage form affording the advantage of prolonged action. For example, a tablet or pill comprises an inner dosage and an outer dosage component, the latter being in the form of an envelope over the former. The two components, for example, are separated by an enteric layer which serves to resist 12 disintegration in the stomach and permit the inner component to pass intact into the duodenum or to be delayed in release. A variety of materials are used for such enteric layers or coatings, such materials including a number of polymeric acids and mixtures of polymeric acids with such materials as shellac, cetyl alcohol, and cellulose acetate. 5 Liquid formulations that include a virus having a modified sequence for oral administration or for injection generally include aqueous solutions, suitably flavored syrups, aqueous or oil suspensions, and flavored emulsions with edible oils such as corn oil, cottonseed oil, sesame oil, coconut oil, or peanut oil, as well as elixirs and similar pharmaceutical vehicles. 10 Compositions for inhalation or insufflation include solutions and suspensions in pharmaceutically acceptable, aqueous or organic solvents, or mixtures thereof, and powders. These liquid or solid compositions optionally contain suitable pharmaceutically acceptable excipients as described herein. Such compositions are administered, for example, by the oral or nasal respiratory route for local or systemic effect. Compositions in 15 pharmaceutically acceptable solvents are nebulized by use of inert gases. Nebulized solutions are inhaled, for example, directly from the nebulizing device, from an attached face mask tent, or from an intermittent positive pressure breathing machine. Solution, suspension, or powder compositions are administered, orally or nasally, for example, from devices which deliver the formulation in an appropriate manner. 20 Another formulation that is employed in the methods taught herein employs transdermal delivery devices ("patches"). Such transdermal patches are used to provide continuous or discontinuous infusion of a reovirus having a modified sequence. The construction and use of transdermal patches for the delivery of pharmaceutical agents are performed according to methods known in the art. See, for example, U.S. Patent No. 25 5,023,252. Such patches are constructed for continuous, pulsatile, or on-demand delivery of a reovirus having a modified sequence. A virus having a modified sequence is optionally chemically or biochemically pretreated (e.g., by treatment with a protease such as chymotrypsin or trypsin) prior to administration (e.g., prior to inclusion in the pharmaceutical composition). Pretreatment 30 with a protease removes the outer coat or capsid of the virus and can be used to increase the infectivity of the virus. Additionally or alternatively, a virus having a modified sequence is coated in a liposome or micelle to reduce or prevent an immune response in a mammal that has developed immunity toward the virus. Such viruses are referred to as "immunoprotected viruses." See, for example, U.S. Patent Nos. 6,565,831 and 7,014,847. 13 A virus having a modified sequence or a pharmaceutical composition comprising such a virus can be packaged into a kit. It is contemplated that a kit optionally includes one or more chemotherapeutic agents and/or anti-antivirus antibodies. A pharmaceutical composition, for example, is formulated in a unit dosage form. The term "unit dosage 5 forms" refers to physically discrete units suitable as unitary dosages for human subjects and other mammals, each unit containing a predetermined quantity of a virus having a modified sequence calculated to produce the desired therapeutic effect in association with a suitable pharmaceutically acceptable carrier. The details of one or more aspects of the modified non-reovirus viruses or related 10 methods are set forth in the accompanying drawings and the description below, Other features, objects, and advantages of the viruses and methods will be apparent from the drawings and detailed description, and from the claims. Thus, the materials, methods, and examples are illustrative only and not intended to be limiting. All publications, patent applications, patents, and other references mentioned herein 15 are incorporated by reference in their entirety. EXAMPLES Although oncolytic viruses represent a novel cytotoxic and immunogenic approach to the treatment of cancer, how they evade the anti-viral immune response and the level of selectivity of their delivery to tumor over normal tissue, has not been investigated in 20 humans. In this study, patients were treated with a single cycle of intravenous reovirus prior to planned surgery to resect colorectal cancer metastases in the liver. Tracking the viral genome in the circulation showed that reovirus could be detected in both plasma and blood mononuclear, granulocyte and platelet cell compartments after infusion. Despite the presence of neutralizing antibodies at baseline in all patients, replication-competent 25 reovirus, functional for transfer to kill target cells in vitro, could be recovered from blood cells but not plasma, suggesting that transport by cells could protect virus for potential delivery to tumors. Analysis of the surgical specimen demonstrated greater, selective expression of reovirus protein in malignant cells compared to either tumor stroma or surrounding normal liver tissue. There was evidence of viral factories within tumor and 30 recovery of replicating virus from tumor (but not liver) was achieved in all 4 patients from whom fresh tissue was available. Hence, protective cell carriage following systemic administration was able to selectively deliver reovirus to tumor, despite the presence of neutralizing antibodies in the circulation. These findings provide new preclinical and 14 clinical avenues for enhancing in vivo immune evasion and effective intravenous delivery of oncolytic viruses to patients in vivo. Naturally occurring or genetically modified oncolytic viruses (OV) specifically target tumor cells for replication and cell death. In addition to their direct cytotoxic effects, 5 OV can also stimulate a therapeutic anti-tumor immune response. A number of OV have now progressed through preclinical and early clinical testing, with no indication of major toxicity and encouraging evidence of anti-tumor activity. A phase III study of a herpes simplex virus (OncoVex) has been completed in melanoma, and a randomized trial using a vaccinia virus (JX-594) to treat hepatocellular cancer is due to open shortly. The optimal 10 route of administration for clinical application of OV remains unresolved. Direct intratumoral injection ensures that the virus effectively accesses the tumor microenvironment for immune activation as well as direct cell killing, and circumvents the concern of inactivation of intravenous virus in the circulation by neutralizing antibodies (NAB) present at baseline and/or induced on repeat administration. However, intratumoral 15 injection is technically challenging and limits application to accessible tumor sites; moreover, systemic delivery remains more acceptable to clinicians. OncoVex is injected directly into tumor deposits, whilst JX-594 has been delivered by both intratumoral and systemic routes. A recent report of intravenous JX-594 confirmed successful delivery of the virus to tumor, although in this phase I, single infusion study, the majority of patients were 20 negative for anti-vaccinia NAB at the time of treatment. Reovirus is a genetically unmodified, non-pathogenic dsRNA ubiquitous virus with anti-cancer activity mediated both by direct targeting of malignant cells with activation of the ras pathway, and stimulation of anti-tumor immunity. Clinical grade reovirus (Type 3 Dearing; Reolysin@) has been through Phase I/II trials using either intratumoral or 25 intravenous injection, alone or in combination with radiotherapy or chemotherapy, and is currently being tested intravenously in the Phase III setting in combination with carboplatin and paclitaxel in squamous cell carcinoma of the head and neck. However, how the virus is transported following intravenous injection from blood to tumor in patients, and how such delivery may be improved, has not been explored in humans. 30 Disclosed herein is a clinical study in which a single cycle of intravenous reovirus monotherapy was given to patients prior to a planned resection of colorectal cancer metastatic to the liver. Detailed analysis of sequential blood samples and resected tissue allowed characterization of: i) the distribution, carriage and replication competence of reovirus within different blood compartments; ii) access of reovirus to tumor cells and 15 tumor stroma versus normal liver and iii) replication of reovirus within tumor versus normal liver, to address how the virus may evade anti-viral immunity for selective delivery to tumors in patients. Patients, study _rocedures and sample collection 5 Patients with colorectal cancer metastatic to the liver, due to undergo routine, planned resection with radical intent were approached about the study at a single centre. Written, informed consent was obtained in accordance with local institutional ethics and review approval. Clinical grade Dearing type 3 Reolysin@ was provided by Oncolytics Biotech Incorporated (Calgary, Canada), but otherwise the trial was sponsored, run and 10 funded by the University of Leeds, UK. Eligibility criteria included age 18 to 75; completion of any prior therapy at least 4 weeks before entry into the study (2 of 10 patients had had neoadjuvant chemotherapy to reduce disease burden prior to surgery); Eastern Cooperative Oncology Group (ECOG) performance score of < 2; life expectancy of at least 3 months; absolute neutrophil count > 1.5 x 109/L; platelets > 100 x109/L; hemoglobin > 15 9.0 mg/dL; serum creatinine 5 1.5x institutional upper limit of normal (ULN), total bilirubin < 1.5X ULN; aspartate transaminase/alanine transaminase < 2.5x ULN; a negative pregnancy test for females of childbearing potential. Exclusion criteria included extensive liver disease requiring surgery more extensive than an extended hemihepatectomy; known brain metastases; known HIV, hepatitis B or C infections; pregnancy or breast-feeding; 20 clinically significant cardiac disease (New York Heart Association class III or IV); dementia or altered mental state that would prohibit informed consent. The study was approved by the appropriate ethics and biological safety committees (EUDRACT number 2007/000258-29; MREC 08/HI 306/73). As described in Vidal et al. (Clin. Cancer Res. 14: 7127-7137 (2008)) a single cycle of 1 x 1010 TCID 5 o reovirus was prepared and 25 administered as an intravenous infusion over 60 minutes daily from days 1 to 5, between 6 and 28 days before surgery. Blood samples were taken immediately prior to, and I hour following, the first reovirus infusion; immediately before infusions on days 3 and 5; within 3 hours before surgery and at I and 3 months following surgery. Tumor and adjacent normal hepatic parenchyma were excised, preserving margins for histological diagnosis and 30 confirmation of the adequacy of resection at the time of surgery. Blood sample processing PBMC were isolated from K3EDTA anti-coagulated whole blood by density gradient centrifugation using Lymphoprepi" (Axis-Shield UK, Dundee, UK) as per manufacturer's instructions. PBMC were frozen in freezing medium (90% fetal calf serum 16 (FCS; Biosera, Ringmer, UK) containing 10% DMSO (Sigma-Aldrich Ltd., Irvine, UK)) at a cell density of 5 x 106/mil. Granulocytes were isolated from the same K3EDTA anti coagulated whole blood using a 2-step procedure. Briefly, following PBMC harvest, granulocytes were collected from the lower white cell interface. Granulocytes were then 5 further purified using PolymorphprepTM (Axis-Shield), as per manufacturer's instructions. Purified granulocytes were frozen in freezing medium at a cell density of Ix 10 7 /ml. Platelets and red blood cells were isolated from K3EDTA anti-coagulated whole blood collected in a 6ml Vacuette (Greiner Bio-One Ltd., Stonehouse, UK). The Vacuette was centrifuged at 21 Og with no brake for 10 mins and the platelet rich plasma (PRP) top layer 10 was collected (the red blood cells were retained for processing separately), before a further centrifugation at 21 Og for 10 mins was performed to remove any contaminating white blood cells. PRP was then centrifuged at 800g for 10 mins to pellet the platelets. Platelets were then washed twice in 5ml MACS buffer (Ca 2 Mg 2 + free-PBS (Oxoid, Basingstoke, UK) + 1% FCS + 0.2% EDTA (Sigma), centrifuging at 800g for 10 minutes for each wash. 15 Platelets were frozen in I ml RNase-free water (Sigma). The red blood cells retained in the Vacuette were centrifuged at 2 000g for 10 mins. The upper white blood cell layer was removed, before aliquots of red blood cells were collected and frozen. Serum was isolated from whole blood collected in serum clot activator Vacuettes (Greiner) and plasma was isolated from whole blood collected in K3EDTA Vacuettes. Vacuettes were spun at 2000g 20 for 10 mins, before serum and plasma were collected from the upper interfaces and aliquots were frozen. All samples were stored at -80"C until required. 17 Cell lines and reovirus The murine fibroblastic cell line, L929 was cultured in Dulbecco's Modified Eagle's Medium (DMEM; Sigma), supplemented with 5% (v/v) FCS, 1% (v/v) glutamine (Sigma), and 0.5% (v/v) penicillin/ streptomycin (5% DMEM) (Sigma). Cells were cultured at 370 C 5 in a humidified atmosphere containing 5% CO 2 and were routinely tested for, and found to be negative of, mycoplasma infection, Clinical grade Dearing type 3 reovirus (Reolysin) was titered using a standard plaque assay protocol and stored in the dark at -80*C for laboratory experiments. TCIDs experiments 10 L929s were seeded at lx104 in 96 well plates and incubated for 24 hrs before experiments. Supernatants were aspirated and 100gL of ten-fold dilutions (starting at 1:10) of PBMC, granulocytes, platelets and plasma samples were added to L929 cells. Additional plating media was added to the wells 1-2 hours after infection/treatment and cells then incubated for 6 days. A 1:10 dilution of stock reovirus and 5% DMEM were incubated on 15 L929 cells as positive and negative controls respectively. CPE (i.e. reovirus-induced cell death) was assessed by examination under a light microscope to calculate viral titer in TCIDso/ml (using the Spearman-Karber statistical method). Photomicrographs were also taken. L929 cell survival/cell death was also confirmed at the end of the assay using an MTT assay, as described below. 20 MTT assay Cell survival was quantified using a 3-(4, 5-Dimethylthiazol-2-yl)-2, 5 diphenyltetrazolium bromide (MTT; Sigma) assay. 20pL/well of MTT at 5mg/ml was added to treated cells. After 4 hrs of incubation at 37*C, crystals were solubilized in DMSO and absorbance measured at 550nm. 25 RNA detection RNA was extracted from PBMC, granulocytes, platelets and plasma samples using the QIAamp Viral Mini Kit and amplified using the OneStep RT-PCR Kit (both Qiagen, West Sussex, UK). Reovirus sigma 3 cDNA targeted primers (Sigma) used were: forward 5'-GGGCTGCACATTACCACTGA (SEQ ID NO: 1) and reverse 5' 30 CTCCTCGCAATACAACTCGT (SEQ ID NO: 2) and a detection limit of 35 cycles was used for evaluation. Samples were run on a 2% agarose gel and analyzed for reovirus RNA by the presence of a 300bp PCR product. Positive (reovirus RNA) and negative (RNase-free water) controls were included. For viral detection following amplification (to assess whether functional, replication competent virus was present in samples, but only at low 18 levels), 1:10 dilutions of samples (alongside positive and negative controls) were incubated on L929 cells as described above for the TCID50 assay, before cells and supernatants were harvested and tested for reovirus RNA as described. Neutrahzing anti-reovirus antibody detection 5 Patient antibody titers were detected in samples using a modified neutralizing antibody assay as described in White et al. (Gene Ther. 15:911-920 (2008)). Immunohistochemistry and fluorescence for reovirus. casnase and tubulin Immunohistochemistry was performed as described in Comins et al. (Clin. Cancer Res 2010) using the Benchmark LT automated slide stainer (Ventana Medical Systems, 10 Tucson, AZ) according to the manufacturer's instructions. Caspase-3 and tubulin antibodies were purchased from Abcam (Cambridge, MA) and reovirus antibody was supplied by Oncolytics Inc. Optimized dilutions used for detection of antibodies were: 1:6000 (reovirus); 1:50 (caspase-3) and 1:100 (tubulin). All antigen retrievals were performed for 30 min. The antigens were detected with the Ultraview Universal DAB or Fast Red system 15 (Ventana), with a counterstain of hematoxylin. Negative controls included omission of primary antibody and internal controls of cells/tissues known to be negative for the targets. Co-localization signal was interpreted using the Nuance microscope/computer based interface system (Cambridge Research Instrumentation Incorporated, Hopkinton, MA), using co-expression analyses as described in Nuovo et al. (Nat. Protoc. 4:107-115 (2009)) 20 and Nuovo (Methods, 52:307-315 (2010)). In brief, the Nuance system dissects the colorimetric based signal for different chromogens and converts these colorbased signals to fluorescence-based signals. This allows performance of 'fluorescence-mixing' combinations to determine if a given cell has zero, one, or two or more signals. Electron microscopy 25 Tissue specimens were fixed in 3% gluteraldehyde (Sigma) for a minimum of 4 hrs and stored in 70% ethanol until further processing. Specimens were then dehydrated and embedded by a 1 hr incubation step at -20*C in a 2:1 mixture of L.R. WhiteTM (Sigma) and ethanol, followed by three I hr incubations at -20 0 C in L.R.WhiteTM alone. Finally, a polymerization step (in gelatine capsules) was performed at 37'C for 5 days. 80- 100 nm 30 sections were then cut and set on nickel grids. After blocking in PBS/2% bovine serum albumin (BSA), sections were incubated for 1 hr with 25 d drops of anti-reovirus sigma 3 antibody (Developmental Studies Hybridoma Bank, Iowa, US), diluted 1:800, followed by a 1 hr incubation with 25 pl drops of rabbit antimouse IgG antibody (Dako Cytomation,Stockport, UK), diluted 1:40. Finally, al hr incubation was performed with 25 19 p drops of Protein-A Immunogold Particles (10 nm; Aurion, Wageningen, Netherlands), diluted 1:20, then a final 20 min stain with Uranyl acetate. Specimens were viewed using a Phillips/FE] CM10 Transmission Electron Microscope running at 80kV. Images were captured onto Kodak Electron Image Film (Type SO-163), using an exposure time of 2 5 seconds. Retrieval of replication competent virus from tissue Tissue specimens were dissected into 5 mm cubes before disaggregation into a single cell suspension using a Cell Dissociation Sieve & Tissue Grinder Kit (Sigma). Cells were then passed through a 7 0pm cell strainer (BD Biosciences, Oxford, UK) and any 10 debris removed by 2 washes in PBS. The single cell suspension was then added to semi confluent L929 cells for 24-48 hrs, before being removed and replaced with 5% DMEM. After a further 5-7 days of culture, supernatant was collected and reovirus replication was determined by standard plaque assay using L929 cells. Briefly, samples (either neat or diluted in serum-free medium) were added to L929 cells and incubated at 37*C for 4 hrs. 15 Samples were gently removed, before overlay medium comprising DMEM supplemented with 5% (v/v) FCS and 1.6% (w/v) carboxymethylcellulose (Sigma), was added to each well. After 72 hrs, supernatants were collected (and stored for analysis by Western blotting) before cells were gently washed 3 times with PBS and fixed using 0.1% (v/v) gluteraldehyde (Sigma) for 10 mins. Plaques were visualized using 1% methylene blue 20 (Sigma) and images taken using a Canon Ixus 100 digital camera. Western blotting Samples (collected from plaques assays as described above) were prepared in 2 x Laemmli buffer and denatured at 95'C for 5 mins. Proteins were separated on 10% SDS polyacrylamide gels by electrophoresis and transferred to a HybondTMC Super 25 nitrocellulose membrane (Amersham Bio Sciences, Little Chalfont, Buckinghamshire, UK), before being blocked in Odyssey blocking buffer (Li-Cor@ Biosciences UK Ltd., Cambridge, UK) overnight at 4'C. Membranes were probed with anti-reovirus sigma 3 antibody (1:200 dilution), then secondary IgGAlexa- Fluor680 (1:5000 dilution; Invitrogen, Paisley, UK). Nitrocellulose membranes were visualised on a Li-Cor@ Odyssey Infrared 30 Imager at 700 nm and analysed using Odyssey Application Software (vl.2). Presence of reovirus in the samples was confirmed by a band at 41 KDa. Statistical analysis p values were calculated using two way ANOVA and statistical significance is denoted by *p<0.05. 20 Results Patients, study design and toxicity Ten patients were recruited into this translational biological endpoint clinical trial. All patients were scheduled to undergo resection of colorectal cancer liver metastases with 5 radical intent as part of standard clinical care. The patients' clinical characteristics are shown in Table 1 and the trial schema, involving administration of a single cycle of intravenous reovirus prior to the planned surgery, is illustrated in Figure 1. Treatment with reovirus was well tolerated, with the most common side effects being flu-like symptoms, consistent with previous clinical experience. There were no Grade 3 or 4 toxicities and 10 Grade 1/2 toxicity comprised nausea (1 patient), constipation (I patient), headache (I patient), pyrexia (6 patients), myalgia (3 patients), rigors (I patient), leukopenia (1 patient), insomnia (1 patient), hallucination (I patient) and hypotension (I patient) (Table 1). In 3 patients, fewer than the planned 5 doses of reovirus were given. In I patient, a single infusion was omitted due to clinical concern about a falling white cell count, whilst in the 15 other 2 cases only I and 3 treatments were given respectively, because of the patients' own concerns that flu-like symptoms might interfere with the planned surgery, leading them to decline subsequent infusions. Surgery took place between 6 and 28 days following the last reovirus treatment. This timing was determined by clinical factors (in particular, intensive care bed availability); in no case was surgery delayed due to reovirus toxicity. The 20 endpoints of this trial were: i) tracking the development of the NAB response to reovirus after treatment; ii) detection of the virus in different blood compartments (plasma, peripheral blood mononuclear cells (PBMC), granulocytes, platelets and red cells); iii) assessment of reovirus within resected tumor and normal liver and iv) monitoring of toxicity, particularly in relation to the planned surgery. Reovirus genome, but not 25 replication-competent virus, is detectable in plasma after systemic delivery, despite the presence of neutralizing antibodies. It was first confirmed that anti-reovirus NAB were present in the patients at baseline (Figure 2A) and, consistent with other intravenous monotherapy trials, found that titers increased following intravenous treatment, peaking around the time of surgery (Figure 2B). Test to detect the presence of virus were performed, 30 initially in plasma, using the following assays. First, RT-PCR of RNA was performed directly ('neat' RT-PCR), to look for the viral genome. Next, retrieval of replication competent virus was assessed by adding plasma to reovirus-sensitive L929 cells in a TCID50 assay. This quantifies viral titer by demonstration of the cytopathic effect (CPE) and cytotoxicity of serial dilutions of samples against L929 cells. Further, an 'amplified' 21 RT-PCR on RNA extracted from L929 cells at the end of this TCID50 assay was carried out, to confirm increased genome band intensity consistent with viral replication. Clear bands were seen on immediate RT-PCR of plasma at I hour after the first infusion, whilst in all but 2 patients no reovirus genome was detected at later time points (Figure 2C). In 5 patients 3 and 4, bands were also seen on days 3 and 5 (i.e. in samples taken immediately prior to the third and fifth infusions, respectively). However, when plasma was tested in virus amplification assays on L929 cells, no replicating reovirus was seen as evidenced by either CPE/cytotoxicity or a positive, amplified RT-PCR signal. Hence, free virus in the circulation is readily detectable in plasma, particularly early during treatment, but is 10 functionally neutralized for productive infection and cell killing, presumably by the NAB present at baseline prior to the first reovirus infusion. Peripheral blood mononuclear cells carry reovirus that is functional for replication and target killing PBMC were isolated from patient blood samples and again tested for input (neat) 15 and amplified (replication-competent) virus. Figure 3A shows by RT-PCR that neat reovirus could be detected in PBMC at I hour following the first infusion, as evidenced by weak bands detectable in some patients only. However, in marked contrast to plasma, this signal was dramatically amplified in all patients after culture of PBMC on L929 cells for 7 days, consistent with viral hand-off to, and replication in, target L929 cells in vitro. This 20 amplified signal was also detected at later time points in patient 3 (day 5; a day 3 sample was not available) and patient 4 (days 3 and 5); all later time points were negative in all other patients. The presence of replicating, cytotoxic virus on patient PBMC was further evidenced by CPE of L929 cells (Figure 3B), as well as L929 killing as measured by an MTT assay (Figure 3C), at the end of the 7 day PBMC/L929 co-culture. Finally, the viral 25 titer (TCID5o/ml) on PBMC was calculated, as shown in Figure 3D. Interestingly, patients 3 and 4 were the only cases in which replicating virus was detected in amplification assays beyond the 1 hour post-first infusion time point (Figures 3B, C, D), the same patients and later time points in which plasma remained positive by neat PCR (Figure 2B). Together, these data show that PBMC carry the virus in patients following intravenous delivery, 30 despite the presence of NAB at baseline (Figure 2A). In marked contrast to plasma, functional, replicative PBMC-associated virus can be handed-off to target L929 cells in vitro, thus providing a protective delivery mechanism for systemic reovirus to tumor in patients. 22 Granulocytes and platelets, but not red blood cells, also carry reovirus in patients. Other fractions of blood cells collected from patients for their ability to hitchhike reovirus were studied using the same assays as described for PBMC. Specifically, granulocytes, platelets and red blood cells were tested as blood components potentially able to bind to 5 and/or carry virus (granulocytes and platelets were only available from patients 7 to 10). Figures 4 and 5 show that, in 3 of 4 patients, both granulocytes and platelets, similar to PBMC, carried oncolytically functional virus, as evidenced by assays of neat and amplified RTPCR (Figures 4/5A), CPE (Figures 4/5B) and target killing (Figures 4/5C) of L929 cells. Viral titers are shown in Figures 4/5D, which also show that reovirus was only detected in 10 granulocytes and platelets I hour after the first infusion (the corresponding neat and amplified RT-PCR assays were also negative at later time points in all cases for granulocytes and platelets). Moreover, no reovirus was detected in red blood cells at any time point in any sample, although immediate RT-PCR was the only assay technically feasible for these samples. Hence, granulocytes and platelets, as well as PBMC, though not 15 red blood cells, can potentially hitchhike reovirus to tumor targets in patients, despite the presence of NAB. Systemic reovirus is preferentially delivered to tumor cells Resected tumor and surrounding normal liver (excised as a margin around metastases) were first tested for reovirus by immunohistochemistry for the sigma 3 capsid 20 protein. In 9 of the 10 patients (but in none of 3 control patients tested who had had resections out with the trial), reovirus protein was detected. Tumor staining was scored as absent (1 patient), weak (3 patients), or strong (6 patients). Figure 6A shows representative data from one patient with weak, and one with strong, tumor staining. In all 9 cases where tumor was positive for reovirus, the colorectal metastases stained more strongly than tumor 25 stroma (black versus red arrows in Figure 6A) or surrounding liver, consistent with selective reovirus delivery to, and/or replication in, malignant over non-malignant cells. Some staining of normal liver tissue was seen. In 5 patients, faint positive staining of hepatocytes was seen (of which in 4 there was associated strong tumor staining, and in 1 weak tumor staining), whilst the liver tissue samples of the other 5 cases were scored as negative 30 (including the single case in which tumor was negative). Figure 6B shows a representative example of faint hepatocyte staining as well as a negative case. The presence of reovirus protein in resected tumor was further confirmed by electron microscopy (Figure 6C). Further, in 4 patients where enough tissue was available for analysis, reovirus was seen to co-localize with caspase 3 (Figure 6D), consistent with tumor cell apoptosis (between 5 and 23 30% of reovirus-positive cells co-stained for caspase, whereas in the single case where no reovirus was apparent, no caspase was seen). The changes of nuclear and cytoplasmic degeneration in infected tumor cells (arrowed on Figure 6D) are also consistent with reovirus-associated apoptosis in the caspase 3 positive cells. Hence, systemically 5 administered reovirus was found in resected tissue in all but I of 10 cases, with tumor cells consistently staining more strongly than either tumor-associated stroma or resected, adjacent normal liver. R~eplcatiou-competent reovirus can be retrieved from resented tumor but not liver tissue 10 The detection of reovirus capsid protein illustrates successful delivery of virus to target tissue, but does not address whether the virus is, or has been, functional for replication. To further address the question of replication of reovirus specifically in tumor, sections were stained for co-localization of reovirus and tubulin as an indirect marker of replication within viral factories. In 4 of 6 assessable tumors (i.e. with adequate available 15 tissue), co-localization was seen. In these cases, 15, 30, 40 and 40% of reovirus-expressing tumor cells were also scored positive for tubulin, with co-staining confined to tumor, as opposed to stromal, cells (a representative patient is shown in Figure 7A). Next, direct retrieval of replication-competent reovirus from resected specimens was attempted. Initially, when freeze/thaw lysates from tumor and liver were pulsed onto L929 cells, no 20 CPE or viral plaques were seen. However, for patients 7 to 10, additional experiments designed to increase the sensitivity of viral detection, by taking tissue direct from theatre, making single liver or tumor cell suspensions, and processing these directly as described herein were performed. This modified technique avoids any loss of virus during lysate preparation (due to freeze-thaw and/or retention of virus in pelleted cell debris), and also 25 harnesses the enhanced delivery of reovirus to targets from intact infected cells compared to free virus. Under these conditions, fresh tumor (but not liver) cells from all 4 patients tested did yield virus, as demonstrated by plaques on L929 cells as shown in Figure 7B. Figure 7C confirms these plaques as reovirus by western blot, whilst liver samples were again negative. Hence, replication-competent reovirus could be retrieved from tumor, but not 30 liver, of patients tested following intravenous delivery. Surgical outcome All 10 patients proceeded to their planned surgery with no delay attributable to reovirus treatment, and there was no unexpected or excessive surgical morbidity in 24 COMparison to non-tr il patients undergoing -similar operations (e~g.blolsstieo discharge from hospital). Table I Fiet Aize~ x Tp orN l 7o. o; Tume Ietweenhfuna1 Txet vye-1 II xeite c it ) .ovil us I eovlilts infusloll S: ~ ae Uiul ions 51u1x(.IV (days) 1 74 M R~ight Extended Nausea(2 he miheP a tctAfy & Col nStIpation(Ti kj 1 inen t 2 I1!e aJac , c (2) 9etSteC: c-Y Fyrex: I a (2) Mvya1lia (2) 2 62 M 2, czinent1 , 5 1 None meta ste tonies 3 73 M _R 1 21 None 4 05 M :F 5- 19 Pyrexia (Z" hemi tj F e cic4ny 5 62 M P~g514 Rigor s (2) h em nh e comy 6 50 F P_ i)it 5 6 tMyalogia (1) bh tp ihep~ctrny Fyrexia (I1" 7 18 M RI 2.4 8 Pyrexia (1) hemiheptetory Leukop~is (2) 3 65 F Segmen~t5 10 17.CSOnia (2) Rigors (2) 9 70 M Pig~at f6 Pyrex ia(I~ h emi ep atedaorj 1) 3 M eent 3,4,6 63 M SM 14 PYrexia(I) metastectoznies Hypotension 1) 25
Claims (12)
1. A modified non-reovirus virus comprising a reovirus sigma 1 protein, wherein the reovirus sigma I protein replaces the native attachment protein of the non-reovirus virus, and wherein the modified virus does not comprise any portion of the native attachment protein of the non-reovirus virus.
2. The non-reovirus virus of claim 1, wherein the reovirus sigma 1 protein attaches to carrier cells which protect the virus from neutralizing antibodies during in vivo delivery.
3. The non-reovirus virus of claim 2, wherein the reovirus sigma I protein attaches to carrier cells that protect the virus from neutralizing antibodies during in vivo delivery to a tumor.
4. The non-reovirus virus of any of claims 1-3, wherein the virus is an adenovirus, a vaccinia virus, a herpes simplex virus, a paramyxovirus, or a parapox virus.
5. The method of any of claims 1-4, wherein the non-reovirus virus is an oncolytic virus.
6. A method of making a non-reovirus virus that is protected from neutralizing antibodies comprising, replacing the native attachment protein of the non-reovirus virus with a reovirus sigma 1 protein, wherein the full-length sequence of the native attachment protein of the non-reovirus virus is replaced with a reovirus sigma 1 protein.
7. The method of claim 6, wherein replacement of the native attachment protein of the non-reovirus virus with a reovirus sigma I protein allows the non-reovirus virus to attach to carrier cells that protect the virus from neutralizing antibodies during in vivo delivery.
8. A method for treating a cell proliferative disorder in a mammal, comprising administering an effective amount of the virus of claim 5 to a subject with a proliferative disorder under conditions that result in substantial lysis of cells of the proliferative disorder.
9. The method of claim 8, wherein the cell proliferative disorder is a neoplasm.
10. The method of any one of claims 1-8, wherein the sigma-I protein is selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:3.
11. The method of any one of claims 1-10, wherein the sigma-I protein is under the control of its native promoter. 26
12. The method of any one of claims 1-10, wherein the sigma-I protein is under the control of the promoter of the native attachment protein. 27 4243866_1 SEQUENCE LISTING <110> Oncolytics Biotech Inc. <120> Protecting Modified Viruses from Neutralizing Antibodies Using the Reovirus Sigma-1 Protein <130> 95178-869384 (092WO1) <150> 61/640,403 <151> 2012-04-30 <160> 6 <170> PatentIn version 3.5 <210> 1 <211> 455 <212> PRT <213> reovirus <400> 1 Met Asp Pro Arg Leu Arg Glu Glu Val Val Arg Leu Ile Ile Ala Leu 1 5 10 15 Thr Ser Asp Asn Gly Ala Ser Leu Ser Lys Gly Leu Glu Ser Arg Val 20 25 30 Ser Ala Leu Glu Lys Thr Ser Gln Ile His Ser Asp Thr Ile Leu Arg 35 40 45 Ile Thr Gln Gly Leu Asp Asp Ala Asn Lys Arg Ile Ile Ala Leu Glu 50 55 60 Gln Ser Arg Asp Asp Leu Val Ala Ser Val Ser Asp Ala Gln Leu Ala 65 70 75 80 Ile Ser Arg Leu Glu Ser Ser Ile Gly Ala Leu Gln Thr Val Val Asn 85 90 95 Gly Leu Asp Ser Ser Val Thr Gln Leu Gly Ala Arg Val Gly Gln Leu 100 105 110 Glu Thr Gly Leu Ala Glu Leu Arg Val Asp His Asp Asn Leu Val Ala 115 120 125 Arg Val Asp Thr Ala Glu Arg Asn Ile Gly Ser Leu Thr Thr Glu Leu 130 135 140 Ser Thr Leu Thr Leu Arg Val Thr Ser Ile Gln Ala Asp Phe Glu Ser 145 150 155 160 Arg Ile Ser Thr Leu Glu Arg Thr Ala Val Thr Ser Ala Gly Ala Pro 165 170 175 Leu Ser Ile Arg Asn Asn Arg Met Thr Met Gly Leu Asn Asp Gly Leu Page 1 4243866_1 180 185 190 Thr Leu Ser Gly Asn Asn Leu Ala Ile Arg Leu Pro Gly Asn Thr Gly 195 200 205 Leu Asn Ile Gln Asn Gly Gly Leu Gln Phe Arg Phe Asn Thr Asp Gln 210 215 220 Phe Gln Ile Val Asn Asn Asn Leu Thr Leu Lys Thr Thr Val Phe Asp 225 230 235 240 Ser Ile Asn Ser Arg Ile Gly Ala Thr Glu Gln Ser Tyr Val Ala Ser 245 250 255 Ala Val Thr Pro Leu Arg Leu Asn Ser Ser Thr Lys Val Leu Asp Met 260 265 270 Leu Ile Asp Ser Ser Thr Leu Glu Ile Asn Ser Ser Gly Gln Leu Thr 275 280 285 Val Arg Ser Thr Ser Pro Asn Leu Arg Tyr Pro Ile Ala Asp Val Ser 290 295 300 Gly Gly Ile Gly Met Ser Pro Asn Tyr Arg Phe Arg Gln Ser Met Trp 305 310 315 320 Ile Gly Ile Val Ser Tyr Ser Gly Ser Gly Leu Asn Trp Arg Val Gln 325 330 335 Val Asn Ser Asp Ile Phe Ile Val Asp Asp Tyr Ile His Ile Cys Leu 340 345 350 Pro Ala Phe Asp Gly Phe Ser Ile Ala Asp Gly Gly Asp Leu Ser Leu 355 360 365 Asn Phe Val Thr Gly Leu Leu Pro Pro Leu Leu Thr Gly Asp Thr Glu 370 375 380 Pro Ala Phe His Asn Asp Val Val Thr Tyr Gly Ala Gln Thr Val Ala 385 390 395 400 Ile Gly Leu Ser Ser Gly Gly Ala Pro Gln Tyr Met Ser Lys Asn Leu 405 410 415 Trp Val Glu Gln Trp Gln Asp Gly Val Leu Arg Leu Arg Val Glu Gly 420 425 430 Gly Gly Ser Ile Thr His Ser Asn Ser Lys Trp Pro Ala Met Thr Val 435 440 445 Ser Tyr Pro Arg Ser Phe Thr Page 2 4243866_1 450 455 <210> 2 <211> 455 <212> PRT <213> reovirus <400> 2 Met Asp Pro Arg Leu Arg Glu Glu Val Val Arg Leu Ile Ile Ala Leu 1 5 10 15 Thr Gly Asp Asn Gly Thr Ser Leu Ser Lys Gly Leu Glu Ser Arg Ile 20 25 30 Ala Ala Leu Glu Lys Thr Ser Gln Ile His Ser Asp Thr Leu Leu Arg 35 40 45 Ile Thr Gln Gly Leu Asp Asp Ala Asn Lys Arg Ile Ile Ala Leu Glu 50 55 60 Gln Ser Arg Asp Asp Leu Val Ala Ser Val Ser Asp Ala Gln Leu Ala 65 70 75 80 Ile Ser Arg Leu Glu Asn Ser Val Gly Ala Leu Gln Thr Ala Ile Asn 85 90 95 Gly Leu Asp Ser Ser Val Thr Gln Leu Gly Gly Arg Val Gly Gln Leu 100 105 110 Glu Thr Gly Leu Ala Gly Leu Arg Ala Asp His Asp Asn Leu Ala Thr 115 120 125 Arg Val Asp Thr Ala Glu Arg Asn Ile Gly Ser Leu Thr Thr Glu Leu 130 135 140 Ser Thr Leu Thr Leu Arg Val Thr Ser Ile Gln Ser Asp Phe Glu Ser 145 150 155 160 Arg Ile Ala Thr Leu Glu Arg Thr Ala Val Thr Ser Ala Ala Ala Pro 165 170 175 Leu Ser Ile Ser Asn Asn Arg Met Thr Met Gly Leu Asn Asp Gly Leu 180 185 190 Thr Leu Ser Gly Asn Asn Leu Ala Ile Arg Leu Pro Gly Asn Thr Gly 195 200 205 Leu Asn Ile Gln Asn Gly Gly Leu Gln Phe Arg Phe Asn Thr Asp Gln 210 215 220 Phe Gln Ile Val Asn Asn Asn Leu Thr Leu Lys Thr Thr Ile Phe Asp 225 230 235 240 Page 3 4243866_1 Pro Ile Asn Ser Arg Ile Ser Thr Ile Glu Gln Ser Tyr Val Val Ser 245 250 255 Ala Val Thr Pro Leu Arg Leu Asn Ser Ser Thr Lys Val Leu Asp Met 260 265 270 Leu Ile Asp Ser Ser Thr Leu Glu Ile Asn Ser Ser Gly Gln Leu Ala 275 280 285 Val Lys Ser Thr Ser Pro Asn Leu Arg Tyr Pro Ile Ala Asp Val Ser 290 295 300 Gly Ser Ile Gly Val Ser Pro Asn Tyr Arg Phe Arg Gln Ser Met Trp 305 310 315 320 Ile Gly Ile Val Ser Tyr Ser Gly Ser Gly Leu Ser Trp Arg Ile Gln 325 330 335 Val Asn Ser Asp Ile Phe Ile Ala Asp Asp Tyr Ile His Ile Cys Leu 340 345 350 Pro Ala Phe Asp Gly Phe Thr Ile Ala Asp Gly Gly Asp Leu Ser Leu 355 360 365 Asn Phe Val Thr Gly Leu Leu Pro Pro Leu Leu Thr Gly Asp Thr Glu 370 375 380 Pro Ala Phe His Asn Asp Val Val Thr Tyr Gly Ala Arg Thr Ile Ala 385 390 395 400 Ile Gly Leu Ser Ser Gly Gly Thr Pro Gln Tyr Ile Ser Lys Asn Leu 405 410 415 Trp Val Glu Gln Trp Gln Asp Gly Val Leu Arg Leu Arg Val Glu Gly 420 425 430 Gly Gly Leu Ile Thr His Ser Asn Ser Lys Trp Pro Ala Met Thr Ile 435 440 445 Ser Tyr Pro Arg Ser Phe Thr 450 455 <210> 3 <211> 455 <212> PRT <213> reovirus <400> 3 Met Asp Pro Arg Leu Arg Glu Glu Val Val Arg Leu Ile Ile Ala Leu 1 5 10 15 Page 4 4243866_1 Thr Ile Asp Asn Gly Ala Ser Leu Ser Lys Gly Leu Glu Ser Arg Val 20 25 30 Ser Ala Leu Glu Lys Thr Ser Gln Ile His Ser Asp Thr Ile Leu Arg 35 40 45 Ile Thr Gln Gly Leu Asp Asp Ala Asn Lys Arg Ile Ile Ala Leu Glu 50 55 60 Gln Ser Arg Asp Asp Leu Val Ala Ser Val Ser Asp Ala Gln Leu Ala 65 70 75 80 Ile Ser Arg Leu Glu Ser Ser Ile Gly Ala Leu Gln Thr Val Val Asn 85 90 95 Gly Leu Asp Ser Ser Val Thr Gln Leu Gly Ala Arg Val Gly Gln Leu 100 105 110 Glu Thr Gly Leu Ala Glu Leu Arg Val Asp His Asp Asn Leu Val Ala 115 120 125 Arg Val Asp Thr Ala Glu Arg Asn Ile Gly Ser Leu Thr Thr Glu Leu 130 135 140 Ser Thr Leu Thr Leu Arg Val Thr Ser Ile Gln Ala Asp Phe Glu Ser 145 150 155 160 Arg Ile Ser Thr Leu Glu Arg Thr Ala Val Thr Ser Ala Gly Ala Pro 165 170 175 Leu Ser Ile Arg Asn Asn Arg Met Thr Met Gly Leu Asn Asp Gly Leu 180 185 190 Thr Leu Ser Gly Asn Asn Leu Ala Ile Arg Leu Pro Gly Asn Thr Gly 195 200 205 Leu Asn Ile Gln Asn Gly Gly Leu Gln Phe Arg Phe Asn Thr Asp Gln 210 215 220 Phe Gln Ile Val Asn Asn Asn Leu Thr Leu Lys Thr Thr Val Phe Asp 225 230 235 240 Ser Ile Asn Ser Arg Ile Gly Ala Thr Glu Gln Ser Tyr Val Ala Ser 245 250 255 Ala Val Thr Pro Leu Arg Leu Asn Ser Ser Thr Lys Val Leu Asp Met 260 265 270 Leu Ile Asp Ser Ser Thr Leu Glu Ile Asn Ser Ser Gly Gln Leu Thr 275 280 285 Page 5 4243866_1 Val Arg Ser Thr Ser Pro Asn Leu Arg Tyr Pro Ile Ala Asp Val Ser 290 295 300 Gly Gly Ile Gly Met Ser Pro Asn Tyr Arg Phe Arg Gln Ser Met Trp 305 310 315 320 Ile Gly Ile Val Ser Tyr Ser Gly Ser Gly Leu Asn Trp Arg Val Gln 325 330 335 Val Asn Ser Asp Ile Phe Ile Val Asp Asp Tyr Ile His Ile Cys Leu 340 345 350 Pro Ala Phe Asp Gly Phe Ser Ile Ala Asp Gly Gly Asp Leu Ser Leu 355 360 365 Asn Phe Val Thr Gly Leu Leu Pro Pro Leu Leu Thr Gly Asp Thr Glu 370 375 380 Pro Ala Phe His Asn Asp Val Val Thr Tyr Gly Ala Gln Thr Val Ala 385 390 395 400 Ile Gly Leu Ser Ser Gly Gly Ala Pro Gln Tyr Met Ser Lys Asn Leu 405 410 415 Trp Val Glu Gln Trp Gln Asp Gly Val Leu Arg Leu Arg Val Glu Gly 420 425 430 Gly Gly Ser Ile Thr His Ser Asn Ser Lys Trp Pro Ala Met Thr Val 435 440 445 Ser Tyr Pro Arg Ser Phe Thr 450 455 <210> 4 <211> 1416 <212> DNA <213> reovirus <400> 4 gctattggtc ggatggatcc tcgcctacgt gaagaagtag tacggctgat aatcgcatta 60 acgagtgata atggagcatc actgtcaaaa gggcttgaat caagggtctc ggcgctcgag 120 aagacgtctc aaatacactc tgatactatc ctccggatca cccagggact cgatgatgca 180 aacaaacgaa tcatcgctct tgagcaaagt cgggatgact tggttgcatc agtcagtgat 240 gctcaacttg caatctccag attggaaagc tctatcggag ccctccaaac agttgtcaat 300 ggacttgatt cgagtgttac ccagttgggt gctcgagtgg gacaacttga gacaggactt 360 gcagagctac gcgttgatca cgacaatctc gttgcgagag tggatactgc agaacgtaac 420 attggatcat tgaccactga gctatcaact ctgacgttac gagtaacatc catacaagcg 480 gatttcgaat ctaggatatc cacgttagag cgcacggcgg tcactagcgc gggagctccc 540 Page 6 4243866_1 ctctcaatcc gtaataaccg tatgaccatg ggattaaatg atggactcac gttgtcaggg 600 aataatctcg ccatccgatt gccaggaaat acgggtctga atattcaaaa tggtggactt 660 cagtttcgat ttaatactga tcaattccag atagttaata ataacttgac tctcaagacg 720 actgtgtttg attctatcaa ctcaaggata ggcgcaactg agcaaagtta cgtggcgtcg 780 gcagtgactc ccttgagatt aaacagtagc acgaaggtgc tggatatgct aatagacagt 840 tcaacacttg aaattaattc tagtggacag ctaactgtta gatcgacatc cccgaatttg 900 aggtatccga tagctgatgt tagcggcggt atcggaatga gtccaaatta taggtttagg 960 cagagcatgt ggataggaat tgtctcctat tctggtagtg ggctgaattg gagggtacag 1020 gtgaactccg acatttttat tgtagatgat tacatacata tatgtcttcc agcttttgac 1080 ggtttctcta tagctgacgg tggagatcta tcgttgaact ttgttaccgg attgttacca 1140 ccgttactta caggagacac tgagcccgct tttcataatg acgtggtcac atatggagca 1200 cagactgtag ctatagggtt gtcgtcgggt ggtgcgcctc agtatatgag taagaatctg 1260 tgggtggagc agtggcagga tggagtactt cggttacgtg ttgagggggg tggctcaatt 1320 acgcactcaa acagtaagtg gcctgccatg accgtttcgt acccgcgtag tttcacgtga 1380 ggatcagacc accccgcggc actggggcat ttcatc 1416 <210> 5 <211> 1368 <212> DNA <213> reovirus <400> 5 atggatcctc gcttacgtga agaagtagtg cgattaataa ttgcattgac gggcgataat 60 ggaacatcat tgtcaaaagg gcttgaatca aggattgcag cgctcgaaaa gacgtcccaa 120 atacactctg atactctcct caggatcacc caaggactcg atgatgcaaa taaacgaatc 180 atcgctcttg aacaaagtag ggacgacctg gttgcatcag tcagtgatgc acaacttgca 240 atctccagat tggaaaactc tgtcggagcc ctccaaacag ctatcaatgg acttgattcg 300 agtgttaccc agctgggtgg tcgagtggga cagcttgaga caggacttgc aggattacgc 360 gctgaccacg acaatctcgc tacgagagtg gatactgcgg aacgtaacat tggatcattg 420 accactgagc tatctacact tacattacgt gtgacctcca tacaatcgga tttcgaatct 480 cgaatagcca cattagagcg tacagcggtc actagcgcag cggcacctct ctcgattagc 540 aataatcgta tgactatggg cttgaatgac ggattaacat tgtcgggaaa taatcttgcc 600 attcgactgc caggaaacac aggtctgaat attcagaatg gtggacttca atttcggttt 660 aatactgacc agttccagat agttaacaat aacttgactc tcaagacaac tatctttgat 720 ccaatcaact ccagaataag tacgattgaa caaagttacg tggtatcagc agtgactccc 780 ttgaggctta atagcagtac caaggtgttg gacatgctca tagatagctc gactcttgaa 840 attaactcta gcggacaatt agccgtgaag tcgacatcgc ctaacttaag atatccaatt 900 Page 7 4243866_1 gctgatgtta gtggtagtat aggagtgagc cctaactata ggttcaggca gagcatgtgg 960 ataggaatag tttcatactc tggtagtggg ttgagttgga ggatacaggt gaattctgac 1020 atcttcattg ctgatgatta tatacacata tgtcttccag cttttgatgg tttcacaata 1080 gccgacggtg gagatctatc gttaaacttt gtcacaggat tgttgccacc gctactcacc 1140 ggggatactg agccggcttt ccataatgat gtagttacgt atggggcacg gactatagct 1200 atagggttgt cgtcaggtgg tacgcctcag tatataagta agaacttgtg ggtggagcag 1260 tggcaggatg gagtactacg gttgcgtgtt gaaggagggg gcttgatcac gcattcgaat 1320 agtaaatggc ctgccatgac catttcttat ccacgcagtt tcacgtga 1368 <210> 6 <211> 1416 <212> DNA <213> reovirus <400> 6 gctattggtc ggatggatcc tcgcctacgt gaagaagtag tacggctgat aatcgcatta 60 acgattgata atggagcatc actgtcaaaa gggcttgaat caagggtctc ggcgctcgag 120 aagacgtctc aaatacactc tgatactatc ctccggatca cccagggact cgatgatgca 180 aacaaacgaa tcatcgctct tgagcaaagt cgggatgact tggttgcatc agtcagtgat 240 gctcaacttg caatctccag attggaaagc tctatcggag ccctccaaac agttgtcaat 300 ggacttgatt cgagtgttac ccagttgggt gctcgagtgg gacaacttga gacaggactt 360 gcagagctac gcgttgatca cgacaatctc gttgcgagag tggatactgc agaacgtaac 420 attggatcat tgaccactga gctatcaact ctgacgttac gagtaacatc catacaagcg 480 gatttcgaat ctaggatatc cacgttagag cgcacggcgg tcactagcgc gggagctccc 540 ctctcaatcc gtaataaccg tatgaccatg ggattaaatg atggactcac gttgtcaggg 600 aataatctcg ccatccgatt gccaggaaat acgggtctga atattcaaaa tggtggactt 660 cagtttcgat ttaatactga tcaattccag atagttaata ataacttgac tctcaagacg 720 actgtgtttg attctatcaa ctcaaggata ggcgcaactg agcaaagtta cgtggcgtcg 780 gcagtgactc ccttgagatt aaacagtagc acgaaggtgc tggatatgct aatagacagt 840 tcaacacttg aaattaattc tagtggacag ctaactgtta gatcgacatc cccgaatttg 900 aggtatccga tagctgatgt tagcggcggt atcggaatga gtccaaatta taggtttagg 960 cagagcatgt ggataggaat tgtctcctat tctggtagtg ggctgaattg gagggtacag 1020 gtgaactccg acatttttat tgtagatgat tacatacata tatgtcttcc agcttttgac 1080 ggtttctcta tagctgacgg tggagatcta tcgttgaact ttgttaccgg attgttacca 1140 ccgttactta caggagacac tgagcccgct tttcataatg acgtggtcac atatggagca 1200 cagactgtag ctatagggtt gtcgtcgggt ggtgcgcctc agtatatgag taagaatctg 1260 tgggtggagc agtggcagga tggagtactt cggttacgtg ttgagggggg tggctcaatt 1320 acgcactcaa acagtaagtg gcctgccatg accgtttcgt acccgcgtag tttcacgtga 1380 Page 8 4243866_1 ggatcagacc accccgcggc actggggcat ttcatc 1416 Page 9
Applications Claiming Priority (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US201261640403P | 2012-04-30 | 2012-04-30 | |
US61/640,403 | 2012-04-30 | ||
PCT/CA2013/000250 WO2013163724A1 (en) | 2012-04-30 | 2013-03-15 | Protecting modified viruses from neutralizing antibodies using the reovirus sigma 1 protein |
Publications (1)
Publication Number | Publication Date |
---|---|
AU2013204555A1 true AU2013204555A1 (en) | 2013-11-14 |
Family
ID=49514132
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
AU2013204555A Abandoned AU2013204555A1 (en) | 2012-04-30 | 2013-03-15 | Protecting modified viruses from neutralizing antibodies using the reovirus sigma 1 protein |
Country Status (3)
Country | Link |
---|---|
AU (1) | AU2013204555A1 (en) |
TW (1) | TW201346034A (en) |
WO (2) | WO2013163724A1 (en) |
Families Citing this family (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
SG11201900439XA (en) | 2016-07-21 | 2019-02-27 | Kolon Life Science Inc | Recombinant vaccinia virus and use thereof |
JP2022542294A (en) * | 2019-08-01 | 2022-09-30 | ザ ユニバーシティ オブ ノース カロライナ アット チャペル ヒル | Compositions and methods for binding to antibodies and inhibiting neutralizing antibodies |
Family Cites Families (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6110461A (en) * | 1997-08-13 | 2000-08-29 | Oncolytics Biotech Inc. | Reovirus for the treatment of neoplasia |
CA2508238C (en) * | 1997-08-13 | 2008-01-15 | Oncolytics Biotech Inc. | Reovirus for the treatment of neoplasia |
US6136307A (en) * | 1997-08-13 | 2000-10-24 | Oncolytics Biotech Inc. | Reovirus for the treatment of cellular proliferative disorders |
AR035227A1 (en) * | 2001-02-20 | 2004-05-05 | Oncolytics Biotech Inc | USE OF A CHEMOTHERAPEUTIC AGENT FOR THE MANUFACTURE OF A MEDICINAL PRODUCT FOR THE SENSITIZATION OF NEOPLASSIC CELLS RESISTANT TO CHEMOTHERAPEUTIC AGENTS WITH REOVIRUS |
CA2621127C (en) * | 2005-08-31 | 2014-02-25 | Oncolytics Biotech Inc. | Treatment with an oncolytic virus and an immunostimulant for in vivo enhancement of immune system recognition of neoplasms |
DK1984007T3 (en) * | 2006-02-13 | 2015-12-07 | Oncolytics Biotech Inc | Application of Low-dose local immunosuppression for amplification of viral oncolytic therapy |
-
2013
- 2013-03-15 WO PCT/CA2013/000250 patent/WO2013163724A1/en active Application Filing
- 2013-03-15 AU AU2013204555A patent/AU2013204555A1/en not_active Abandoned
- 2013-04-19 WO PCT/CA2013/000390 patent/WO2013163727A1/en active Application Filing
- 2013-04-26 TW TW102114981A patent/TW201346034A/en unknown
Also Published As
Publication number | Publication date |
---|---|
WO2013163727A1 (en) | 2013-11-07 |
WO2013163724A1 (en) | 2013-11-07 |
TW201346034A (en) | 2013-11-16 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
ES2765489T3 (en) | Adenovirus expressing immune cell-stimulating receptor agonist (s) | |
US20180214538A1 (en) | Generation of antibodies to tumor antigens and generation of tumor specific complement dependent cytotoxicity by administration of oncolytic vaccinia virus | |
JP2007527719A (en) | Modified oncolytic virus | |
ES2445704T3 (en) | Methods for the treatment of proliferative cell disorders | |
Holzmüller et al. | YB‐1 dependent virotherapy in combination with temozolomide as a multimodal therapy approach to eradicate malignant glioma | |
Brochu-Lafontaine et al. | Addition of exogenous polypeptides on the mammalian reovirus outer capsid using reverse genetics | |
US20190134120A1 (en) | Methods for the treatment of bladder cancer | |
US10639337B2 (en) | Method for treating cancer with a Coxsackievirus B3 (CVB3) variant | |
US20220088096A1 (en) | Oncolytic myxoma virus expressing fast p14 to treat hematological cancer | |
EP2296678A1 (en) | Modulating interstitial pressure and oncolytic viral delivery and distribution | |
WO2007099401A2 (en) | Oncolytic attenuated reoviruses for treatment of proliferative disorders | |
AU2013204555A1 (en) | Protecting modified viruses from neutralizing antibodies using the reovirus sigma 1 protein | |
Wu et al. | An oncolytic adenovirus 11p vector expressing adenovirus death protein in the E1 region showed significant apoptosis and tumour-killing ability in metastatic prostate cells | |
Welsh et al. | Sequence polymorphisms in the reovirus σ1 attachment protein modulate encapsidation efficiency and replication in mice | |
Kemp et al. | Characterization of a replicating expanded tropism oncolytic reovirus carrying the adenovirus E4orf4 gene | |
WO2012022496A2 (en) | Method for killing tumor stem cells | |
Rebetz et al. | Fiber mediated receptor masking in non-infected bystander cells restricts adenovirus cell killing effect but promotes adenovirus host co-existence | |
EP3068411A1 (en) | Oncolytic viruses and increased cancer treatment regimens | |
US20210008136A1 (en) | Improved Oncolytic Reovirus | |
US20220105143A1 (en) | T cell repertoire dynamics and oncolytic viral therapy | |
US20240091285A1 (en) | Compositions and methods of treatment of tumors expressing putative zika virus receptor proteins | |
Wollenberg | Tweaking reovirus T3D to boost the oncolytic potency | |
Kemp | Enhancing reovirus for use in oncolytic virotherapy | |
Chen et al. | Advancing Lung Cancer Treatment with Combined c-Met Promoter-Driven Oncolytic Adenovirus and Rapamycin | |
Jandick et al. | Creation and characterization of a recombinant mammalian orthoreovirus expressing σ1 fusion proteins encoding human epidermal growth factor receptor 2 peptides |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
MK5 | Application lapsed section 142(2)(e) - patent request and compl. specification not accepted |