AU2013203696A1

AU2013203696A1 - Recombinant Viral Vectors and Uses Therefor

Info

Publication number: AU2013203696A1
Application number: AU2013203696A
Authority: AU
Inventors: Michael FRESE; Mario LOBIGS
Original assignee: University of Canberra
Current assignee: University of Canberra
Priority date: 2012-06-25
Filing date: 2013-04-11
Publication date: 2014-01-16
Also published as: WO2014000026A1

Abstract

This invention discloses recombinant hepatitis delta viral (HDV) vectors that are useful inter alia in the treatment or prevention of hepatitis virus infections. The viral vectors are predicated on the stable integration of heterologous nucleic acid 5 sequences into a HDV genome, which confer a substantially rod-like secondary structure on the resulting recombinant HDV genome.

Description

TITLE OF THE INVENTION "RECOMBINANT VIRAL VECTORS AND USES THEREFOR" [0001] This application claims priority to Australian Provisional Application No. 2012902684 entitled "Recombinant Viral Vectors and Uses Therefor" filed 25 June 5 2012, the contents of which are incorporated herein by reference in their entirety. FIELD OF THE INVENTION [0002] This invention relates generally to recombinant hepatitis delta viral vectors that can be used, for example, in the treatment or prevention of hepatitis virus infections. The invention further relates to compositions and methods that employ these 10 vectors. BACKGROUND OF THE INVENTION [0003] Hepatitis delta virus (HDV) is a subviral satellite as it can only propagate in the presence of hepatitis B virus (HBV). Indeed, HDV can only productively infect individuals who have HBV, and currently 15 million are co-infected 15 worldwide. Of significance, superinfection of HBV carriers with HDV causes severe liver disease and results in a high rate of chronicity. [0004] HDV is a small, spherical virus with a 36 nm diameter. It has an outer coat containing three hepatitis B virus (HBV) envelope proteins (designated large, medium, and small hepatitis B surface antigens), and host lipids surrounding an inner 20 nucleocapsid. The nucleocapsid contains a negative sense, single-stranded, closed circular RNA of approximately 1700 nucleotides and about 200 molecules of hepatitis D antigen (HDAg) for each genome. The central region of HDAg has been shown to bind RNA. [0005] The HDV circular genome is unique to animal viruses because it is the 25 smallest known viral genome that infects mammals and has a high G/C nucleotide content (about 60%). Additionally, its nucleotide sequence is about 70% self complementary, allowing the HDV genome to form a partially double-stranded RNA structure that is described as "rod-like." [0006] During replication, three forms of RNA are made using host cell RNA 30 polymerases; circular genomic RNA, circular complementary antigenomic RNA, and a linear polyadenylated antigenomic RNA, which is the mRNA containing the open - 1 reading frame for the HDAg. Initial studies implicated RNA polymerase II in HDV replication; however, one study has shown that RNA polymerases I and III also interact with HDV RNA, suggesting a more complex reliance on several host polymerases (Greco-Stewart et al., 2009.Virology 386: 12-15). Evidence suggests that synthesis of 5 the different RNA species occurs in different subcellular locations, mediated by distinct cellular polymerases: synthesis of antigenomic RNA occurs in the nucleolus mediated by RNA polymerase I, whereas synthesis of genomic RNA takes place more diffusely in the nucleoplasm by RNA polymerase II (Li et al., 2006. J Virol 80: 6478-6486). Notably, the RNA polymerases treat the HDV RNA genome as double-stranded DNA 10 due to the folded rod-like structure it is in and possibly due to the action of the HDAg. A schematic representation of wild-type HDV genomic RNA, antigenomic RNA and mRNA is shown in Figure 1. [0007] Replication of the circular HDV RNA template occurs via a rolling circle mechanism that is unique to animal viruses but analogous to that of plant viroids. 15 HDV RNA is synthesized first as linear RNA that contains many copies of the genome. The genomic and antigenomic RNA contain a sequence of about 85 nucleotides that acts as a ribozyme, which self-cleaves the linear RNA into monomers. These monomers are then ligated to form circular RNA. [0008] HDV uses ADARI editing of the viral antigenome RNA to switch 20 from viral RNA replication to packaging. At early times in the replication cycle, the virus produces a short form of HDAg, termed HDAg-S, which is required for RNA synthesis. At later times, as result of editing at the amber/W site, the virus produces a long form of HDAg, termed HDAg-L, which is required for packaging, but inhibits further RNA synthesis as levels increase. 25 [0009] HDV superinfection in HBV-infected individuals often results in chronic HDV, which further increases the mortality rate associated with chronic hepatitis B. Unfortunately, however, present therapies often fail to resolve chronic hepatitis, are expensive, and have serious side-effects. [0010] Accordingly, there is an urgent need to develop effective means for 30 treating or preventing hepatitis infections, including chronic hepatitis B/D infections. -2- SUMMARY OF THE INVENTION [0011] The present inventors have developed a novel strategy for stably inserting heterologous nucleotide sequences into the HDV genome. In particular, they have discovered that it is possible to stably insert an heterologous nucleotide sequence 5 into a site of a HDV genome provided that a substantially complementary heterologous nucleotide sequence is inserted into another site of the HDV genome whereby the heterologous nucleotide sequences are in juxtaposition to permit annealing to each other and to thereby maintain the rod-like secondary structure of the HDV genome and confer stability thereto. 10 [0012] Accordingly, in one aspect, the present invention provides recombinant single-stranded, circular hepatitis delta virus (HDV) RNA genomes. These genomes generally comprise or consist essentially of in operable connection: a promoter; an open reading frame (ORF) for a hepatitis delta antigen (HDAg); a polyadenylation signal; and a HDV ribozyme, wherein the genomes comprise 15 substantially complementary portions conferring a rod-like secondary structure, wherein the genomes are characterized in that they comprise at a first site a first heterologous nucleotide sequence and at a second site a second heterologous nucleotide sequence that is substantially complementary to the first heterologous nucleotide sequence wherein the first and second sites are spaced from each other to permit annealing between the 20 first and second heterologous nucleotide sequences. [0013] In a related aspect, the present invention provides recombinant single stranded, circular hepatitis delta virus (HDV) RNA genomes, comprising a first portion and a second portion, wherein the first portion comprises in operable connection: (1) a promoter; (2) an open reading frame (ORF) for a hepatitis delta antigen (HDAg); (3) a 25 polyadenylation signal; (4) a HDV ribozyme; and (5) a first heterologous nucleotide sequence, and wherein the second portion is substantially complementary to the first portion so as to permit annealing between the portions. Suitably, the annealing between the portion confers a rod-like secondary structure on the genome. [0014] In some embodiments, the first heterologous nucleotide sequence 30 comprises a nucleotide sequence that is only transcribed into RNA (e.g., a non-coding sequence, illustrative examples of which include functional RNA molecules such as rRNA, tRNA, RNAi, ribozymes and antisense RNA). In other embodiments, the first -3heterologous nucleotide sequence comprises a nucleotide sequence that is both transcribed into mRNA and translated into a polypeptide. Thus, the present invention encompasses embodiments in which the first heterologous nucleotide sequence comprises a coding sequence for an exogenous polypeptide. Suitably, the exogenous 5 polypeptide is selected from a polypeptide of a pathogenic organism (e.g., other than the HDAg), an alloantigen, an autoantigen, a cancer or tumor antigen or any other polypeptide that has therapeutic activity. In specific embodiments, the exogenous polypeptide is or comprises a cytokine (e.g., a cytokine that attenuates HDV, illustrative example of which include interferons (IFNs) including type I IFNs such as IFN-3. Thus, 10 the present invention provides recombinant HDV genomes engineered to stably express heterologous nucleotide sequences including cytokine-encoding sequences, which can provide a means of attenuating virulence (i.e., addressing safety concerns) and/or augmenting immunity against or resistance to HDV and optionally HBV or hepatitis C virus (HCV) in a subject (e.g., a human) to which they are administered. In some 15 embodiments, the coding sequence further comprises a nucleotide sequence that encodes a proteolytic cleavage site positioned to facilitate release of the exogenous polypeptide upon proteolytic processing of a precursor polypeptide comprising the exogenous polypeptide and the HDAg. In specific embodiments, the coding sequence comprises a nucleotide sequence encoding a signal peptide (which is suitably upstream 20 of the coding sequence for the exogenous polypeptide) for transit of the exogenous polypeptide to a particular cellular compartment or into an extracellular environment. Suitably, the signal peptide directs translocation of the exogenous polypeptide across an endoplasmic reticulum (ER) membrane within a host cell (e.g., hepatocyte) infected by the virus. In some embodiments, the exogenous polypeptide is exported to the host cell 25 surface, presented on the cell surface as a peptide with a major histocompatibility antigen, secreted from the cell, or remains in the cytoplasm of the cell. [0015] In some embodiments, the first heterologous nucleotide sequence is located downstream of the promoter and upstream of the ORF. In illustrative examples of this type, the first heterologous nucleotide sequence comprises a coding sequence for 30 an exogenous polypeptide, which is operably connected to the promoter, and an internal ribosome entry site (IRES) that is operably connected to the ORF. [0016] In other embodiments, the first heterologous nucleotide sequence is located downstream of the ORF and suitably upstream of the polyadenylation site. In -4illustrative examples of this type, the first heterologous nucleotide sequence comprises an internal ribosome entry site (IRES) operably connected to a coding sequence for an exogenous polypeptide. [0017] In some embodiments, the first heterologous nucleotide sequence 5 comprises a first coding sequence for an exogenous polypeptide and a second coding sequence for a proteolytic cleavage site, wherein the first and second coding sequences are in frame with each other and with the ORF to thereby encode a precursor polypeptide, wherein the proteolytic cleavage site is positioned between the exogenous polypeptide and the HDAg in the precursor polypeptide to facilitate release of the 10 exogenous polypeptide upon proteolytic cleavage of the proteolytic cleavage site. In illustrative examples of this type, the first heterologous nucleotide sequence comprises a first coding sequence for an exogenous polypeptide and a second coding sequence for a so-called "self-cleaving" peptide (e.g., 2A or 2A-like self-cleaving peptide), wherein the first and second coding sequences are in frame with each other and with the ORF. In 15 some of these examples, the first heterologous nucleotide sequence is located downstream of the promoter and upstream of the ORF, and the second coding sequence is downstream of the first coding sequence and upstream of the ORF. In some other examples, the first heterologous nucleotide sequence is located downstream of the ORF, wherein the second coding sequence is upstream of the first coding sequence and 20 downstream of the ORF. [0018] In other embodiments, the first heterologous nucleotide sequence is located downstream of the HDV ribozyme. In illustrative examples of this type, the first heterologous nucleotide sequence is operably connected to another promoter (e.g., a promoter other than the promoter that is operably connected to the ORF). 25 [0019] Suitably, an operably connected promoter in the recombinant genome is a DNA dependent RNA polymerase (e.g., RNA polymerase I, II or III) promoter, illustrative examples of which include native or wild-type HDV promoters. [0020] In some embodiments, the first heterologous nucleotide sequence has a G/C nucleotide content that substantially accords with the G/C content of the HDV 30 genome, usually between about 55% and about 65% (e.g., about 60%). -5- [0021] In some embodiments, the first heterologous nucleotide sequence has at least about 50% (and at least 51% to at least 99% and all integer percentages in between) sequence identity to the second heterologous nucleotide sequence. [0022] In another aspect, the present invention provides methods for 5 producing a recombinant single-stranded, circular hepatitis delta virus (HDV) RNA genome. These methods generally comprise, consist or consist essentially of: providing a parent single-stranded, circular HDV RNA genome, which comprises in operable connection: a promoter; an open reading frame (ORF) for a hepatitis delta antigen (HDAg); a polyadenylation signal; and a HDV ribozyme, and which has substantially 10 complementary portions that anneal to one another and confer a rod-like secondary structure on the parent genome, and inserting into the parent genome at a first site a first heterologous nucleotide sequence and at a second site a second heterologous nucleotide sequence that is substantially complementary to the first heterologous nucleotide sequence to form the recombinant HDV genome, wherein the first and second sites are 15 spaced from each other in the recombinant genome to permit annealing between the first and second heterologous nucleotide sequences. [0023] Suitably, the methods comprise inserting the first and second heterologous nucleotide sequences such that they do not interfere or impair annealing of the complementary portions of the parent genome. 20 [0024] In some embodiments, the methods comprise inserting the first heterologous nucleotide sequence downstream of the promoter and upstream of the ORF and inserting the second heterologous nucleotide sequence downstream of the nucleotide sequence of the parent genome that is substantially complementary and anneals to the ORF and upstream of the nucleotide sequence of the parent genome that 25 is substantially complementary and anneals to the promoter. [0025] In other embodiments, the methods comprise inserting the first heterologous nucleotide sequence downstream of the ORF and upstream of the polyadenylation signal and inserting the second heterologous nucleotide sequence downstream of the nucleotide sequence of the parent genome that is substantially 30 complementary and anneals to the polyadenylation signal and upstream of the nucleotide sequence of the parent genome that is substantially complementary and anneals to the ORF. -6- [0026] In still other embodiments, the methods comprise inserting the first heterologous nucleotide sequence downstream of the ribozyme and upstream of portions of the parent genome that are substantially complementary and anneal to each other and inserting the second heterologous nucleotide sequence downstream of those 5 portions and upstream of the nucleotide sequence of the parent genome that is substantially complementary and anneals to the ribozyme. [0027] In some embodiments, the first heterologous nucleotide sequence has at least 50% (and at least 51% to at least 99% and all integer percentages in between) sequence identity to the second heterologous nucleotide sequence. 10 [0028] In some embodiments, the methods further comprise modifying the G/C content of the first and second heterologous nucleotide sequences to substantially accord with the G/C content of the parent genome. In representative examples of this type, the G/C content of the first and second heterologous nucleotide sequences is modified so that it is between about 55% to about 65% (e.g., about 60%). 15 [0029] Yet another aspect of the present invention provides nucleic acid molecules (e.g., a DNA molecule such as a cDNA molecule) comprising, consisting or consisting essentially of a sequence corresponding to a recombinant HDV genome as broadly described above and elsewhere herein or to an antigenome thereof. Suitably, the nucleic acid molecules are in isolated form. 20 [0030] Still another aspect of the present invention provides vectors comprising, consisting or consisting essentially of a nucleic acid molecule as broadly described above and elsewhere herein. [0031] In a further aspect of the present invention a recombinant hepatitis delta virus (HDV) is provided, comprising, consisting or consisting essentially of a 25 recombinant genome as broadly described above and elsewhere herein. Suitably, the HDV is in isolated form. [0032] Another aspect of the present invention provides pharmaceutical compositions comprising, consisting or consisting essentially of a recombinant HDV as broadly described above and elsewhere herein, and a pharmaceutically acceptable 30 excipient, diluent or carrier. -7- [0033] Still another aspect of the present invention provides immunomodulating compositions comprising, consisting or consisting essentially of a recombinant HDV as broadly described above and elsewhere herein, and optionally an adjuvant or immunostimulant. 5 [0034] In a further aspect, the present invention provides methods for eliciting an immune response to a hepatitis delta virus (HDV) in a subject (e.g., a human). These methods generally comprise, consist or consist essentially of administering to the subject an effective amount of a recombinant HDV as broadly described above and elsewhere herein so as to elicit an immune response to the HDV. 10 [0035] In a related aspect, the present invention provides methods for treating or preventing a hepatitis delta virus (HDV) infection in a subject (e.g., a human). These methods generally comprise, consist or consist essentially of administering an effective amount of a recombinant HDV as broadly described above and elsewhere herein to the subject. 15 [0036] In some embodiments, the first heterologous nucleotide sequence comprises a cytokine-encoding sequence, including an interferon-encoding sequence, which is useful, for example, in the treatment of hepatitis virus infections, including HDV, HBV and/or HCV infections. Thus, in another aspect, the present invention provides methods for treating or preventing a hepatitis infection in a subject (e.g., a 20 human). These methods generally comprise, consist or consist essentially of administering an effective amount of a recombinant HDV as broadly described above and elsewhere herein to the subject, wherein the first heterologous nucleotide sequence comprises a coding sequence for a cytokine (e.g., one that codes for a type I IFN such as IFN-, a type II IFN such as IFN-y or a type III IFN such as IFN-A). 25 [0037] In another related aspect, the present invention provides a recombinant hepatitis delta virus (HDV) as broadly described above and elsewhere herein, or a composition as broadly described above and elsewhere herein, for use in eliciting an immune response to a HDV in a subject (e.g., a human). [0038] In still another aspect of the present invention, methods are provided 30 for eliciting an immune response to an exogenous polypeptide in a subject (e.g., a human). These methods generally comprise, consist or consist essentially of administering a recombinant hepatitis delta virus (HDV) as broadly described above and -8elsewhere herein to the subject so as to elicit an immune response to the exogenous polypeptide. In non-limiting examples, the exogenous polypeptide is an antigen of the subject or an antigen of a microorganism (e.g., bacteria, protozoa, viruses for example other than the HDV such as hepatitis B virus (HBV) and hepatitis C virus (HCV) and 5 used to generate the recombinant HDV of the invention, yeast, fungi, and the like). [0039] In a related aspect, the present invention provides a recombinant hepatitis delta virus (HDV) as broadly described above and elsewhere herein, or a composition as broadly described above and elsewhere herein, for use in preventing or treating an infection by a pathogen (e.g., other than the HDV used to generate the 10 recombinant HDV of the invention) in a subject (e.g., a human). [0040] Another aspect of the present invention provides methods for delivering an exogenous polypeptide having therapeutic activity to a subject (e.g., a human). These methods generally comprise, consist or consist essentially of administering a hepatitis delta virus (HDV) as broadly described above and elsewhere 15 herein to the subject, whereby the exogenous polypeptide is produced in a host cell of the subject. In illustrative examples of this type, the host cell is a hepatocyte. The therapeutic polypeptide may remain inside the cell, become associated with a cell membrane, or may be secreted from the cell. [0041] Yet another aspect of the present invention provides methods for 20 producing an exogenous polypeptide in a host cell (e.g., a vertebrate host cell). These methods generally comprise, consist or consist of contacting a susceptible host cell with a recombinant hepatitis delta virus (HDV) composition as broadly described above and elsewhere herein, wherein the first heterologous nucleotide sequence comprises a coding sequence for the exogenous polypeptide, and culturing the host cell for a period 25 of time to allow production of the exogenous polypeptide by the host cell. Suitably, the methods further comprise purifying the exogenous polypeptide. -9- BRIEF DESCRIPTION OF THE DRAWINGS [0042] Preferred embodiments of the present invention are described infra, by way of example only, with reference to the accompanying drawings wherein: [0043] Figure 1 is a schematic representation showing a wild-type hepatitis 5 delta virus (HDV) genome, anti-genome and mRNA. The single-stranded RNA genome/ anti-genome is highly self-complementary and forms a 'rod-like' secondary structure. Characteristic features of the anti-genomic RNA (top panel) include a putative promoter (pro) sequence upstream of the open reading frame for the short (S) and long (L) form of the hepatitis delta antigen (HDAg), a polyadenylation signal (poly A) and 10 the anti-genomic ribozyme (ribo) sequence; features of the genomic RNA (middle panel) include a promoter sequence (pro) and the genomic ribozyme (ribo) sequence. HDV mRNAs (bottom panel) feature a 5'-cap structure (Cap) and a poly A tail (zigzag line). The asterisk indicates the position of the editing site that, if edited, extends the HDAg open reading frame by 19 codons and switches the expression from S to L. Note 15 that not all elements are drawn to scale. [0044] Figure 2 is a schematic representation showing the recombinant HDV genome rHDV-hulFNbeta-JRES-HDAg. The heterologous nucleotide sequence of interest, which comprises a human interferon-beta coding sequence (huIFN-) and an internal ribosome entry site (IRES), is inserted between the HDV promoter (pro) 20 sequence and the hepatitis delta antigen (HDSAg) open reading frame. To maintain the 'rod-like' secondary structure of the viral genome, an additional, 'stabilizing', partially complementary sequence has been inserted opposite the first insertion. SS, signal sequence; asterisk, editing site. [0045] Figure 3 is schematic representation showing an illustration of the 25 RNA secondary structures of the HDV genome. RNA sequences were analyzed using RNAfold (http://rna. tbi.univie.ac.at). Predicted minimum free energy structures and base pair probabilities are shown for (a) the parental, wild-type HDV genome, (b) a modified genome into which the human IFN-beta coding sequence has been inserted upstream of the HDSAg open reading frame, a manipulation that destroys the typical 30 'rod-like' structure of the genome (c) a modified genome that contains the IFN sequence described above and partially complementary, 'stabilizing' sequences which restore the 'rod-like' RNA structure; and (d) a modified genome that contains the IFN - 10 sequence, the EMCV IRES sequence and partially complementary, 'stabilizing' sequences. Note that the RNA secondary structure in (d) corresponds to the schematic representation rHDV-huIFNbeta-IRES-HDAg shown in Figure 2. [0046] Figure 4 is photographic representation showing the recombinant 5 HDV genome rHDV-huIFNbeta-IRES-HDAg construct is replication competent. COS 7 cells were transfected with plasmids encoding recombinant HDV genomes and/ or helper plasmids providing HDAg in trans. Total RNA was extracted 6 days after transfection, cDNA synthesis was performed using a genomic-specific primer, and PCR was performed using primers binding to anti-genomic-specific primers flanking the 10 insertion site for the IFN gene. Lane 1, co-transfection of helper plasmids pJC126.S/B and pJC126.S/N; lane 2, pJC126 (encoding wild-type rHDV); lane 3, pJC126S/B and pJC 126.IFN.IRES (encoding rHDV-huIFNbeta-IRES-HDAg); lane 4, pJC 126S/N and pJC126.IFN.IRES; lane 5, pJC126. S/B and pJC126.dellO (replication-deficient HDV mutant with a frame shifting deletion in HDAg); lane 6, pJC 126.S/N and pJC126del10. 15 Grey triangles, 0.7 and 1.7 kb amplicons representing wild-type and IFN co-expressing recombinant HDV genomes, respectively. [0047] Figure 5 is schematic representation showing another embodiment of a recombinant HDV genome, rHDV-HDAg-IRES-huIFNbeta. An internal ribosome entry site (IRES) and the sequence of interest - here exemplified by the human 20 interferon-beta coding sequence (huIFN-3) - have been inserted between the hepatitis delta antigen (HDSAg) open reading frame and the polyadenylation signal (poly A). To maintain the 'rod-like' secondary structure of the viral genome, an additional, 'stabilizing', partially complementary sequence has been inserted opposite the first insertion. SS, signal sequence; asterisk, editing site. 25 [0048] Figure 6 is schematic representation showing another embodiment of a recombinant HDV genome, rHDV-HDAg-2A-huIFNbeta. The sequence of interest here exemplified by the human interferon-beta coding sequence (huIFN-3) - has been fused to a '2A-like' motif (2A) and inserted (in-frame) immediately after the hepatitis delta antigen (HDSAg) coding sequence. To maintain the 'rod-like' secondary structure 30 of the viral genome, an additional, 'stabilizing', partially complementary sequence has been inserted opposite the first insertion. SS, signal sequence; asterisk, editing site. - 11 - [0049] Figure 7 is schematic representation showing a further embodiment of a recombinant HDV genome, rHDV-HDAg-ribo-insertion (example No. 4). The region between the anti-genomic ribozyme and the tip of the 'rod' is another potential site for inserting sequences/ genes of interest (not further specified in this example). To 5 maintain the 'rod-like' secondary structure of the viral genome, an additional, 'stabilizing', partially complementary sequence has been inserted opposite the first insertion. SS, signal sequence; asterisk, editing site. [0050] Some figures and text contain color representations or entities. Color illustrations are available from the Applicant upon request or from an appropriate Patent 10 Office. A fee may be imposed if obtained from a Patent Office. - 12 - DETAILED DESCRIPTION OF THE INVENTION 1. Definitions [0051] Unless defined otherwise, all technical and scientific terms used 5 herein have the same meaning as commonly understood by those of ordinary skill in the art to which the invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, preferred methods and materials are described. For the purposes of the present invention, the following terms are defined below. 10 [0052] The articles "a" and "an" are used herein to refer to one or to more than one (i.e. to at least one) of the grammatical object of the article. By way of example, "an element" means one element or more than one element. Thus, for example, the term "virus" also includes a plurality of viruses. [0053] As used herein, "and/or" refers to and encompasses any and all 15 possible combinations of one or more of the associated listed items, as well as the lack of combinations when interpreted in the alternative (or). [0054] The terms "antigen" and "epitope" are well understood in the art and refer to the portion of a macromolecule which is specifically recognized by a component of the immune system, e.g., an antibody or a T-cell antigen receptor. 20 Epitopes are recognized by antibodies in solution, e.g., free from other molecules. Epitopes are recognized by T-cell antigen receptor when the epitope is associated with a class I or class II major histocompatibility complex molecule. A "CTL epitope" is an epitope recognized by a cytotoxic T lymphocyte (usually a CD8' cell) when the epitope is presented on a cell surface in association with an MHC Class I molecule. 25 [0055] The term "antigenome" means a positive sense viral RNA molecule or DNA molecule complementary to the entire negative sense single stranded viral RNA genome. [0056] An "allergen" refers to a substance that can induce an allergic or asthmatic response in a susceptible subject. 30 [0057] By "about" is meant a quantity, level, value, number, frequency, percentage, dimension, size, amount, weight, position or length that varies by as much - 13 - 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 % to a reference quantity, level, value, number, frequency, percentage, dimension, size, amount, weight, position or length. [0058] It will be understood that the term "between" when used in reference to a range of numerical values encompasses the numerical values at each endpoint of the 5 range. For example, a nucleotide sequence of between 10 and 20 nucleotides in length is inclusive of a nucleotide sequence of 10 nucleotides in length and a nucleotide sequence of 20 residues in length. [0059] Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly 10 dictates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges is also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, 15 ranges excluding either both of those included limits are also included in the invention. [0060] "Attenuation" or "attenuated" as used herein means a reduction of viral virulence. Virulence is defined as the ability of a virus to cause disease in a particular host. Thus the term "attenuated" is synonymous with "less pathogenic" or sometimes with "apathogenic". 20 [0061] It will be understood that the term "between" when used in reference to a range of numerical values encompasses the numerical values at each endpoint of the range. For example, a nucleotide sequence of between 10 and 20 nucleotides in length is inclusive of a nucleotide of 10 residues in length and a nucleotide of 20 residues in length. 25 [0062] As used herein, the term "cis-acting sequence" or "cis-regulatory region" or similar term shall be taken to mean any sequence of nucleotides which is derived from an expressible genetic sequence wherein the expression of the genetic sequence is regulated, at least in part, by the sequence of nucleotides. Those skilled in the art will be aware that a cis-regulatory region may be capable of activating, silencing, 30 enhancing, repressing or otherwise altering the level of expression and/or cell-type specificity and/or developmental specificity of any structural gene sequence. - 14 - [0063] The term "cistron" refers to a section of DNA or RNA that contains the genetic codes for a single polypeptide or a protein, and may function as a hereditary unit. Thus, the term "bicistronic" refers to the existence in the recombinant viruses of the invention of two unrelated cistrons which are expressed from a single viral 5 transcriptional unit. One cistron may comprise an open reading frame of the virus and the other cistron may comprise a coding sequence for an exogenous polypeptide. [0064] By "coding sequence" is meant any nucleic acid sequence that contributes to the code for the polypeptide product of a gene. By contrast, the term "non-coding sequence" refers to any nucleic acid sequence that does not contribute to 10 the code for the polypeptide product of a gene. [0065] Throughout this specification, unless the context requires otherwise, the words "comprise," "comprises" and "comprising" will be understood to imply the inclusion of a stated step or element or group of steps or elements but not the exclusion of any other step or element or group of steps or elements. Thus, use of the term 15 "comprising" and the like indicates that the listed elements are required or mandatory, but that other elements are optional and may or may not be present. By "consisting of' is meant including, and limited to, whatever follows the phrase "consisting of'. Thus, the phrase "consisting of' indicates that the listed elements are required or mandatory, and that no other elements may be present. By "consisting essentially of" is meant 20 including any elements listed after the phrase, and limited to other elements that do not interfere with or contribute to the activity or action specified in the disclosure for the listed elements. Thus, the phrase "consisting essentially of' indicates that the listed elements are required or mandatory, but that other elements are optional and may or may not be present depending upon whether or not they affect the activity or action of 25 the listed elements. [0066] By "control element" or "control sequence" is meant nucleic acid sequences (e.g., DNA) necessary for expression of an operably linked coding sequence in a particular host cell. The control sequences that are suitable for prokaryotic cells for example, include a promoter, and optionally a cis-acting sequence such as an operator 30 sequence and a ribosome binding site. Control sequences that are suitable for eukaryotic cells include transcriptional control sequences such as promoters, polyadenylation signals, transcriptional enhancers, translational control sequences such as translational - 15 enhancers and internal ribosome binding sites (IRES), nucleic acid sequences that modulate mRNA stability, as well as targeting sequences that target a product encoded by a transcribed polynucleotide to an intracellular compartment within a cell or to the extracellular environment. 5 [0067] By "corresponds to" or "corresponding to" is meant a nucleic acid sequence that displays substantial sequence identity to a reference nucleic acid sequence (e.g., at least about 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 97, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% or even up to 100% sequence identity to all or a 10 portion of the reference nucleic acid sequence) or an amino acid sequence that displays substantial sequence similarity or identity to a reference amino acid sequence (e.g., at least 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 97, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% or even up to 100% sequence similarity or identity to all or a 15 portion of the reference amino acid sequence). [0068] By "effective amount", in the context of treating or preventing a condition or for modulating an immune response to a target antigen or organism is meant the administration of an amount of an agent (e.g., a recombinant virus) or composition to an individual in need of such treatment or prophylaxis, either in a single 20 dose or as part of a series, that is effective for the prevention of incurring a symptom, holding in check such symptoms, and/or treating existing symptoms, of that condition or for modulating the immune response to the target antigen or organism. The effective amount will vary depending upon the health and physical condition of the individual to be treated, the taxonomic group of individual to be treated, the formulation of the 25 composition, the assessment of the medical situation, and other relevant factors. It is expected that the amount will fall in a relatively broad range that can be determined through routine trials. [0069] It will be understood that "eliciting" or "inducing" an immune response as contemplated herein includes stimulating an immune response and/or 30 enhancing a previously existing immune response. [0070] As used herein, the terms "encode," "encoding" and the like refer to the capacity of a nucleic acid to provide for another nucleic acid or a polypeptide. For - 16 example, a nucleic acid sequence is said to "encode" a polypeptide if it can be transcribed and/or translated to produce the polypeptide or if it can be processed into a form that can be transcribed and/or translated to produce the polypeptide. Such a nucleic acid sequence may include a coding sequence or both a coding sequence and a non 5 coding sequence. Thus, the terms "encode," "encoding" and the like include an RNA product resulting from transcription of a DNA molecule, a protein resulting from translation of an RNA molecule, a protein resulting from transcription of a DNA molecule to form an RNA product and the subsequent translation of the RNA product, or a protein resulting from transcription of a DNA molecule to provide an RNA product, 10 processing of the RNA product to provide a processed RNA product (e.g., mRNA) and the subsequent translation of the processed RNA product. [0071] The term "endogenous" refers to a gene or nucleic acid sequence or segment that is normally found in a host organism. [0072] The term "expression" with respect to a gene sequence refers to 15 transcription of the gene and, as appropriate, translation of the resulting mRNA transcript to a protein. Thus, as will be clear from the context, expression of a coding sequence results from transcription and translation of the coding sequence. Conversely, expression of a non-coding sequence results from the transcription of the non-coding sequence. 20 [0073] As used herein, it will be understood that the term "hepatitis delta virus" or "HDV" encompasses all viruses within the Deltavirus genus, including HDV as classified by the International Committee on Taxonomy of Viruses (ICTV). [0074] The term "gene" as used herein refers to any and all discrete coding regions of a genome, as well as associated non-coding and regulatory regions. The gene 25 is also intended to mean an open reading frame encoding one or more specific polypeptides, and optionally comprising one or more introns, and adjacent 5' and 3' non coding nucleotide sequences involved in the regulation of expression. In this regard, the gene may further comprise control signals such as promoters, enhancers, termination and/or polyadenylation signals that are naturally associated with a given gene, or 30 heterologous control signals. Accordingly, the term "gene" includes and encompasses a nucleic acid molecule capable of being used to produce mRNA, antisense RNA, siRNA, - 17 shRNA, miRNA and the like. Genes may or may not be capable of being used to produce a functional protein. Genes can include both coding and non-coding regions. [0075] The term "heterologous nucleotide sequence" is used herein to describe genetic material that has been or is about to be artificially introduced into a 5 genome of a host organism and that is transmitted to the progeny of that host. The heterologous nucleotide sequence will typically comprise a polynucleotide that is capable of being transcribed into RNA and optionally, translated and/or expressed under appropriate conditions. In some embodiments, it confers a desired property to the recombinant HDV (e.g., attenuation) into which it is introduced, or otherwise leads to a 10 desired therapeutic or diagnostic outcome. In some embodiments, it is transcribed into a molecule that interferes with transcription or translation (e.g., antisense molecule) or mediates RNA interference (e.g., siRNA or shRNA). In some embodiments, the heterologous nucleotide sequence comprises a plurality of coding sequences, which in illustrative examples encode the same exogenous polypeptide or different exogenous 15 polypeptides. [0076] The terms "heterologous polypeptide," "foreign polypeptide" and "exogenous polypeptide" are used interchangeably to refer to any peptide or polypeptide which is encoded by a heterologous nucleotide sequence," "foreign nucleotide sequence" and "exogenous nucleotide sequence," as defined above. 20 [0077] The term "host cell" refers to a cell into which a vector including a recombinant HDV of the invention is introduced. Host cells of the invention include, but need not be limited to, bacterial, yeast, animal (including vertebrate animals falling within the scope of the term "subject" as defined herein, an illustrative example host cell of which includes a hepatocyte ) insect and plant cells. Host cells can be unicellular, 25 or can be grown in tissue culture as liquid cultures, monolayers or the like. Host cells may also be derived directly or indirectly from tissues or may exist within an organism including animals. [0078] As used herein, the term "immunogenic" when used in the context of a given agent such as, for example, a nucleotide sequence, polypeptide, an heterologous 30 nucleotide sequence, an heterologous polypeptide, an antigen, or an epitope, means that the agent has a capability to induce an immune response, enhance an existing immune response, or alter an existing immune response, either alone, or acting in combination - 18 with other agent(s). The immune response may include a humoral and/or cellular immune response in a subject. As used herein, "antigenic amino acid sequence," "antigenic polypeptide," or "antigenic peptide" means an amino acid sequence that, either alone or in association with an accessory molecule (e.g., a class I or class II major 5 histocompatibility antigen molecule), can elicit an immune response in a subject. [0079] It will be understood that "inducing" an immune response as contemplated herein includes eliciting or stimulating an immune response and/or enhancing a previously existing immune response. [0080] As used herein, the term "internal ribosomal entry site" or "IRES" 10 refers to a viral, cellular, or synthetic (e.g., a recombinant) nucleotide sequence which allows for initiation of translation of an mRNA at a site internal to a coding region within the same mRNA or at a site 3' of the 5' end of the mRNA, to provide for translation of an operably linked coding region located downstream of (i.e., 3' of) the internal ribosomal entry site. This makes translation independent of the 5' cap structure, 15 and independent of the 5' end of the mRNA. An IRES sequence provides necessary cis acting sequences required for initiation of translation of an operably linked coding region. [0081] As used herein the term "isolated" is meant to describe a compound of interest (e.g., a recombinant virus, a nucleic acid molecule such as a genome, a 20 polypeptide, etc.) that is in an environment different from that in which the compound naturally occurs. "Isolated" is meant to include compounds that are within samples that are substantially enriched for the compound of interest and/or in which the compound of interest is partially or substantially purified. [0082] As used herein, the term "live virus" refers to a virus that retains the 25 ability of infecting and replicating in an appropriate subject or host cell. [0083] The term "operably connected" or "operably linked" as used herein refers to a juxtaposition wherein the components so described are in a relationship permitting them to function in their intended manner. For example, a transcriptional control sequence (e.g., a promoter) "operably linked" to a coding sequence refers to 30 positioning and/or orientation of the transcriptional control sequence relative to the coding sequence to permit expression of the coding sequence under conditions compatible with the transcriptional control sequence. Alternatively, "operably - 19 connecting" an heterologous nucleotide sequence to the ORF of a HDV encompasses positioning and/or orientation of the heterologous nucleotide sequence relative to the HDV ORF so that (1) the heterologous nucleotide sequence and the ORF are transcribed together to form a single chimeric transcript and optionally (2) if the heterologous 5 nucleotide sequence itself comprises a coding sequence, the coding sequence of the heterologous nucleotide sequence is 'in-frame' with the HDV ORF to produce a chimeric open reading frame comprising the coding sequence of the heterologous nucleotide sequence and the HDV ORF. In another example, an IRES operably connected to the coding sequence of a heterologous nucleotide sequence refers to 10 positioning and/or orientation of the IRES relative to the coding sequence to permit cap independent translation of the coding sequence. [0084] The terms "open reading frame" and "ORF" refer to the amino acid sequence encoded between translation initiation and termination codons of a coding sequence. The terms "initiation codon" and "termination codon" refer to a unit of three 15 adjacent nucleotides ('codon') in a coding sequence that specifies initiation and chain termination, respectively, of protein synthesis (mRNA translation). [0085] As used herein, the term "parent virus" will be understood to be a reference to a virus that is modified to incorporate heterologous genetic material to form a recombinant virus of the present invention. 20 [0086] The terms "polynucleotide," "polynucleotide sequence," "nucleotide sequence," "nucleic acid" or "nucleic acid sequence as used herein designate mRNA, RNA, cRNA, cDNA or DNA. The term typically refers to polymeric form of nucleotides of at least 10 bases in length, either ribonucleotides or deoxynucleotides or a modified form of either type of nucleotide. The term includes single and double 25 stranded forms of RNA or DNA. [0087] "Polypeptide," "peptide," "protein" and "proteinaceous molecule" are used interchangeably herein to refer to molecules comprising or consisting of a polymer of amino acid residues and to variants and synthetic analogues of the same. Thus, these terms apply to amino acid polymers in which one or more amino acid residues are 30 synthetic non-naturally occurring amino acids, such as a chemical analogue of a corresponding naturally occurring amino acid, as well as to naturally-occurring amino acid polymers. This term also includes within its scope two or more complementing or - 20 interactive polypeptides comprising different parts or portions (e.g., polypeptide domains, polypeptide chains etc.) of a luciferase polypeptide of the present invention, wherein the individual complementing polypeptides together reconstitute the activity of the different parts or portions to form a functional luciferase polypeptide. Such 5 complementing polypeptides are used routinely in protein complementation assays, which are well known to persons skilled in the art. [0088] As used herein the term "recombinant" as applied to "nucleic acid molecules," "polynucleotides" and the like is understood to mean artificial nucleic acid structures (i.e., non-replicating cDNA or RNA; or replicons, self-replicating cDNA or 10 RNA) which can be transcribed and/or translated in host cells or cell-free systems described herein. Recombinant nucleic acid molecules or polynucleotides may be inserted into a vector. Non-viral vectors such as plasmid expression vectors or viral vectors may be used. The kind of vectors and the technique of insertion of the nucleic acid construct according to this invention is known to the artisan. A nucleic acid 15 molecule or polynucleotide according to the invention does not occur in nature in the arrangement described by the present invention. In other words, an heterologous nucleotide sequence is not naturally combined with elements of a parent virus genome (e.g., promoter, ORF, polyadenylation signal, ribozyme). [0089] As used herein, the term "recombinant virus" will be understood to be 20 a reference to a "parent virus" comprising at least one heterologous nucleotide sequence. [0090] The term "self-cleaving peptide" facilitates co-translational separation of a nascent polypeptide chain into two independent parts. [0091] The term "sequence identity" as used herein refers to the extent that 25 sequences are identical on a nucleotide-by-nucleotide basis or an amino acid-by-amino acid basis over a window of comparison. Thus, a "percentage of sequence identity" is calculated by comparing two optimally aligned sequences over the window of comparison, determining the number of positions at which the identical nucleic acid base (e.g., A, T, C, G, I) or the identical amino acid residue (e.g., Ala, Pro, Ser, Thr, 30 Gly, Val, Leu, Ile, Phe, Tyr, Trp, Lys, Arg, His, Asp, Glu, Asn, Gln, Cys and Met) occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison (i.e., - 21 the window size), and multiplying the result by 100 to yield the percentage of sequence identity. For the purposes of the present invention, "sequence identity" will be understood to mean the "match percentage" calculated by the DNASIS computer program (Version 2.5 for windows; available from Hitachi Software engineering Co., 5 Ltd., South San Francisco, California, USA) using standard defaults as used in the reference manual accompanying the software. [0092] The terms "signal sequence" or "signal peptide refers to a short (about 3 to about 60 amino acids long) peptide that directs co- or post-translational transport of a protein from the cytosol to certain organelles such as the nucleus, mitochondrial 10 matrix, and endoplasmic reticulum, for example. For proteins having an ER targeting signal peptide, the signal peptides are typically cleaved from the precursor form by signal peptidase after the proteins are transported to the ER, and the resulting proteins move along the secretory pathway to their intracellular (e.g., the Golgi apparatus, cell membrane or cell wall) or extracellular locations. "ER targeting signal peptides," as 15 used herein include amino-terminal hydrophobic sequences which are usually enzymatically removed following the insertion of part or all of the protein through the ER membrane into the lumen of the ER. Thus, it is known in the art that a signal precursor form of a sequence can be present as part of a precursor form of a protein, but will generally be absent from the mature form of the protein. When a protein is said to 20 comprise an ER targeting signal sequence, it is to be understood that, although a precursor form of the protein does contain the signal sequence, a mature form of the protein will likely not contain the signal sequence. Examples of ER targeting signal peptides or sequences that are functional in mammalian cells include the following: the signal sequence for interleukin-7 (IL-7) described in U.S. Patent No. 4,965,195; the 25 signal sequence for interleukin-2 receptor described in Cosman et al. ((1984), Nature 312:768); the interleukin-4 receptor signal peptide described in EP Patent No. 0 367 566; the type I interleukin-1 receptor signal sequence described in U.S. Patent No. 4,968,607; the type II interleukin-1 receptor signal peptide described in EP Patent No. 0 460 846; the signal sequence of human IgG (METDTLLLWVLLLWVPGSTG); and the 30 signal sequence of human growth hormone (MATGSRTSLLLAFGLLCLPWLQEGSA). Many other ER-targeting signal sequences are known in the art, including ones from prokaryotes (e.g., viruses), insects (copepods, - 22 ostracods, etc.), reptilians and avians as well as artificial ER targeting signal sequences such as: LLLVGILFWA and MLLLLLLLLPQAQA. [0093] "Similarity" refers to the percentage number of amino acids that are identical or constitute conservative substitutions as defined in Table A below. Similarity 5 may be determined using sequence comparison programs such as GAP (Deveraux et al. 1984, Nucleic Acids Research12: 387-395). In this way, sequences of a similar or substantially different length to those cited herein might be compared by insertion of gaps into the alignment, such gaps being determined, for example, by the comparison algorithm used by GAP. 10 TABLE A: EXEMPLARY CONSERVATIVE AMINO ACID SUBSTITUTIONS Original Residue Exemplary Substitutions Ala Ser Arg Lys Asn Gln, His Asp Glu Cys Ser Gln Asn Glu Asp Gly Pro His Asn, Gin Ile Leu, Val Leu Ile, Val Lys Arg, Gln, Glu Met Leu, Ile, Phe Met, Leu, Tyr Ser Thr Thr Ser Trp Tyr Tyr Trp, Phe - 23 - Val Ile, Leu [0094] Terms used to describe sequence relationships between two or more polynucleotides or polypeptides include "reference sequence," "comparison window", "sequence identity," "percentage of sequence identity" and "substantial identity". A 5 "reference sequence" is at least 12 but frequently 15 to 18 and often at least 25 monomer units, inclusive of nucleotides and amino acid residues, in length. Because two polynucleotides may each comprise (1) a sequence (i.e., only a portion of the complete polynucleotide sequence) that is similar between the two polynucleotides, and (2) a sequence that is divergent between the two polynucleotides, sequence comparisons 10 between two (or more) polynucleotides are typically performed by comparing sequences of the two polynucleotides over a "comparison window" to identify and compare local regions of sequence similarity. A "comparison window" refers to a conceptual segment of at least 6 contiguous positions, usually about 50 to about 100, more usually about 100 to about 150 in which a sequence is compared to a reference sequence of the same 15 number of contiguous positions after the two sequences are optimally aligned. The comparison window may comprise additions or deletions (i.e., gaps) of about 20% or less as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. Optimal alignment of sequences for aligning a comparison window may be conducted by computerized implementations 20 of algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package Release 7.0, Genetics Computer Group, 575 Science Drive Madison, WI, USA) or by inspection and the best alignment (i.e., resulting in the highest percentage homology over the comparison window) generated by any of the various methods selected. Reference also may be made to the BLAST family of programs as for 25 example disclosed by Altschul et al., 1997, Nucl. Acids Res.25:3389. A detailed discussion of sequence analysis can be found in Unit 19.3 of Ausubel et al., "Current Protocols in Molecular Biology", John Wiley & Sons Inc, 1994-1998, Chapter 15. [0095] The terms "subject," "patient," "host" or "individual" used interchangeably herein, refer to any subject, particularly a vertebrate subject, and even 30 more particularly a mammalian subject, for whom therapy or prophylaxis is desired. Suitable vertebrate animals that fall within the scope of the invention include, but are - 24 not restricted to, any member of the subphylum Chordata including primates (e.g., humans, monkeys and apes, and includes species of monkeys such from the genus Macaca (e.g., cynomologus monkeys such as Macaca fascicularis, and/or rhesus monkeys (Macaca mulatta)) and baboon (Papio ursinus), as well as marmosets (species 5 from the genus Callithrix), squirrel monkeys (species from the genus Saimiri) and tamarins (species from the genus Saguinus), as well as species of apes such as chimpanzees (Pan troglodytes)), rodents (e.g., mice rats, guinea pigs), lagomorphs (e.g., rabbits, hares), bovines (e.g., cattle), ovines (e.g., sheep), caprines (e.g., goats), porcines (e.g., pigs), equines (e.g., horses), canines (e.g., dogs), felines (e.g., cats), avians (e.g., 10 chickens, turkeys, ducks, geese, companion birds such as canaries, budgerigars etc.), marine mammals (e.g., dolphins, whales), reptiles (snakes, frogs, lizards etc.), and fish. A preferred subject is a human in need of treatment or prophylaxis of a condition. However, it will be understood that the aforementioned terms do not imply that symptoms are present. 15 [0096] As used herein, the terms "treatment", "treating", and the like, refer to obtaining a desired pharmacologic and/or physiologic effect. The effect may be prophylactic in terms of completely or partially preventing a disease or symptom thereof and/or may be therapeutic in terms of a partial or complete cure for a disease and/or adverse effect attributable to the disease. "Treatment", as used herein, covers any 20 treatment of a disease in a mammal, particularly in a human, and includes: (a) preventing the disease from occurring in a subject which may be predisposed to the disease but has not yet been diagnosed as having it; (b) inhibiting the disease, i.e., arresting its development; and (c) relieving the disease, i.e., causing regression of the disease. 25 [0097] As used herein, the term "5' untranslated region" or "5' UTR" refers to a sequence located upstream (i.e., 5') of a coding region. Typically, a 5' UTR is located downstream (i.e., 3') to a promoter region and 5' of a coding region downstream of the promoter region. Thus, such a sequence, while transcribed, is upstream of the translation initiation codon and therefore is generally not translated into a portion of the 30 polypeptide product. [0098] The term "3 untranslated region" or "3 UTR" refers to a nucleotide sequence downstream (i.e., 3') of a coding sequence. It generally extends from the first - 25 nucleotide after the stop codon of a coding sequence to just before the poly(A) tail of the corresponding transcribed mRNA. The Y UTR may contain sequences that regulate translation efficiency, mRNA stability, mRNA targeting and/or polyadenylation. [0099] The terms "wild-type," "native" or "naturally-occurring" as used 5 herein to describe viruses, refer to a genotype of a virus found in nature. [0100] Each embodiment described herein is to be applied mutatis mutandis to each and every embodiment unless specifically stated otherwise. 2. Recombinant Hepatitis Delta Viruses [0101] Despite the potential advantages offered by live recombinant HDVs, 10 to date it has not been possible to stably incorporate foreign or heterologous nucleotide sequences of interest into the genomes of these viruses. The present inventors have surprisingly discovered, however, that stable insertion of a heterologous nucleotide sequence of interest is possible provided the recombinant HDV genome retains or maintains a substantially "rod-like" secondary structure, as for example found in wild 15 type or naturally-occurring HDV genomes. In accordance with the present invention, the rod-like secondary structure of the HDV genome can be retained, maintained or restored by inserting a "stabilizing" heterologous nucleotide sequence generally at a different site in the HDV genome to the one used for inserting the heterologous nucleotide sequence of interest, in which the stabilizing heterologous nucleotide 20 sequence is substantially complementary to the heterologous nucleotide sequence of interest, whereby the heterologous nucleotide sequences are in juxtaposition to permit annealing to each other and to thereby retain, maintain or restore the rod-like secondary structure of the HDV genome. Recombinant HDV genomes constructed according to this strategy are remarkably stable over multiple replication cycles. 25 [0102] Accordingly, the present invention provides a recombinant single stranded, circular HDV RNA genome, which comprises or consists essentially of in operable connection: a promoter; an ORF for a HDAg; a polyadenylation signal; and a HDV ribozyme, wherein the genome comprises substantially complementary portions conferring a rod-like secondary structure, and wherein the genome comprises at a first 30 site a first heterologous nucleotide sequence and at a second site a second heterologous nucleotide sequence that is substantially complementary to the first heterologous nucleotide sequence wherein the first and second sites are spaced from each other to - 26 permit annealing between the first and second heterologous nucleotide sequences. Generally, the HDV genome will comprise in order from 5' to 3', the promoter, the ORF, the polyadenylation signal and the ribozyme. In non-limiting examples, the first site, which defines where the first heterologous nucleotide sequence is inserted into the 5 HDV genome, can be between adjacent genome elements (e.g., between the promoter and the ORF, or between the ORF and the polyadenylation signal or between the polyadenylation signal and the ribozyme or downstream of the ribozyme). The second site, which defines where the second 'stabilizing' heterologous nucleotide sequence is inserted into the HDV genome, will generally be located between portions of the HDV 10 genome that are substantially complementary and anneal to the adjacent elements between which the first heterologous nucleotide sequence is inserted. Suitably, the first and second sites are chosen so that insertion of the first and second heterologous nucleotide sequences into those sites does not interfere or impair annealing of the complementary portions of the parent genome (e.g., so that the rod-like secondary 15 structure of the HDV genome is retained, maintained or restored). [0103] The first and second heterologous nucleotide sequences will generally display at least 50% (and at least 51% to at least 99% and all integer percentages in between) and up to 100% sequence identity to each other to permit annealing therebetween. 20 [0104] It is generally desirable to modify the G/C content of the first and second heterologous nucleotide sequences so that their G/C content is between about 55% to about 65% (e.g., about 60%) to substantially accord with the G/C content of the parent HDV genome and to facilitate annealing between the heterologous nucleotide sequence under the same conditions permitting annealing between substantially 25 complementary portions of the HDV genome. In illustrative examples of this type, if the first heterologous sequence comprises a coding sequence for an exogenous polypeptide, the codon composition of the coding sequence is modified/optimized using the degeneracy of the genetic code so that the G/C content of the coding sequence is substantially in accord with the G/C content of the parent HDV genome. 30 [0105] If desired, in silico analysis may be employed to predict whether the RNA secondary structure of a recombinant HDV genome is likely to adopt a rod-like structure. A representative RNA structure prediction software/algorithm includes - 27 - RNAfold available on the RNAfold Webserver (which is currently operated by the Institute for Theoretical Chemistry, University of Vienna, Austria (http://rna.tbi.univie.ac.at/). Alternative software/algorithms that may be used for analysis include for example: CentroidFold, CentroidHomfold, CONTRAfold, 5 CyloFold, KineFold, Mfold, Pknots, PknotsRG, RNA123, RNAfold, RNAshapes, RNAstructure, Sfold, UNAFold, Crumple, BARNACLE, FARNA, iFoldRNA, MC Fold MC-Sym Pipeline, NAST, RNA123, Carnac, CentroidAlifold, CentroidAlign, CMfinder, CONSAN, Dynalign, FoldalignM, KNetFold, LARA, LocaRNA, MASTR, Murlet, MXSCARNA, PARTS, Pfold, PETfold, PMcomp/PMmulti, R-COFFEE, 10 RNA123, RNAalifold, RNAcast, RNAforester, RNAmine, RNASampler, SCARNA, SimulFold, Stemloc, StrAl, TFold, WAR, Xrate. Illustrative sources for these software/algorithms can be found for example at: http://en.wikipedia.org/wiki/ ListofRNAstructure-predictionsoftware. [0106] In some embodiments, the first heterologous nucleotide sequence is 15 inserted downstream of the promoter and upstream of the ORF and the second heterologous nucleotide sequence is inserted downstream of the nucleotide sequence of the parent genome that is substantially complementary and anneals to the ORF and upstream of the nucleotide sequence of the parent genome that is substantially complementary and anneals to the promoter. In non-limiting examples of this type, the 20 first heterologous nucleotide sequence comprises a coding sequence for an exogenous polypeptide, which is operably connected to the promoter, and an internal ribosome entry site (IRES) that is operably connected to the ORF, to define a bicistronic recombinant HDV genome. In other illustrative examples, the first heterologous nucleotide sequence comprises a first coding sequence for an exogenous polypeptide 25 and a second coding sequence for a proteolytic cleavage site, wherein the first and second coding sequences are in frame with each other and with the ORF to thereby encode a precursor polypeptide, wherein the second coding sequence is downstream of the first coding sequence and upstream of the ORF, wherein the proteolytic cleavage site is positioned between the exogenous polypeptide and the HDAg in the precursor 30 polypeptide to facilitate release of the exogenous polypeptide upon proteolytic cleavage of the proteolytic cleavage site. [0107] In other embodiments, the first heterologous nucleotide sequence is inserted downstream of the ORF and upstream of the polyadenylation signal and the - 28 second heterologous nucleotide sequence is inserted downstream of the nucleotide sequence of the parent genome that is substantially complementary and anneals to the polyadenylation signal and upstream of the nucleotide sequence of the parent genome that is substantially complementary and anneals to the ORF. In illustrative examples of 5 this type, the first heterologous nucleotide sequence comprises an internal ribosome entry site (IRES) operably connected to a coding sequence for an exogenous polypeptide, to define a bicistronic recombinant HDV genome. In other representative examples, the first heterologous nucleotide sequence comprises a first coding sequence for an exogenous polypeptide and a second coding sequence for a proteolytic cleavage 10 site, wherein the first and second coding sequences are in frame with each other and with the ORF to thereby encode a precursor polypeptide, wherein the second coding sequence is downstream of the ORF and upstream of the first coding sequence, wherein the proteolytic cleavage site is positioned between the exogenous polypeptide and the HDAg in the precursor polypeptide to facilitate release of the exogenous polypeptide 15 upon proteolytic cleavage of the proteolytic cleavage site. [0108] In still other embodiments, the methods comprise inserting the first heterologous nucleotide sequence downstream of the ribozyme and upstream of portions of the parent genome that are substantially complementary and anneal to each other and inserting the second heterologous nucleotide sequence downstream of those 20 portions and upstream of the nucleotide sequence of the parent genome that is substantially complementary and anneals to the ribozyme. In non-limiting examples of this type, the first heterologous nucleotide sequence is operably connected to another promoter (e.g., a promoter other than the promoter that is operably connected to the ORF) and suitably to another polyadenylation site (e.g., a polyadenylation site other 25 than the polyadenylation site that is operably connected to the ORF). Suitably, an operably connected promoter in the recombinant genome is a DNA dependent RNA polymerase (e.g., RNA polymerase I and/or RNA polymerase II) promoter, illustrative examples of which include native or wild-type HDV promoters. [0109] Suitably, the recombinant viruses are live, attenuated recombinant 30 viruses. In specific embodiments, the recombinant viruses are replication-competent meaning that they are capable of reproducing in a host cell that they have infected suitably in the presence of HBV that has also infected the host cell. - 29 - 2.1 Hepatitis delta viruses [0110] Recombinant viruses of the present invention may be produced by genetic modification of a "parent" virus. The parent virus is modified to incorporate foreign or exogenous genetic material in the form of a heterologous nucleotide sequence 5 to produce the recombinant virus. Accordingly, it will be understood that reference herein to a specific type of recombinant virus (e.g., a "recombinant HDV") denotes a parent virus of the indicated type that has been modified to incorporate foreign or exogenous genetic material. [0111] Although no particular limitation exists regarding the specific type of 10 recombinant HDVs provided herein, the present invention encompasses any recombinant viruses classified within the Deltavirus genus under the International Committee on Taxonomy of Viruses (ICTV). Such "delta viruses" will include any genotype of HDV including, but not limited to, HDV genotypes I, II, III, IV, V, VI and VII. 15 [0112] Non-limiting parent HDV genomes for insertion of heterologous nucleotide sequence according to the present invention are listed in Table B: TABLE B: ILLUSTRATIVE PARENT HDV GENOMES FOR PREPARING RECOMBINANT HDVs GenBank Description Accession No. D01075.1 Hepatitis delta virus genomic RNA, complete genome AM779579.1 Hepatitis delta virus dFr2395 LHD gene for large HD antigen, genomic RNA, strain dFr2395 AM902165.1 Hepatitis delta virus dFr2172 LHD gene for large HD antigen, genomic RNA, strain dFr2172 AM902177.1 Hepatitis delta virus dFr2012 LHD gene for large HD antigen, genomic RNA, strain dFr2012 AM902163.1 Hepatitis delta virus dFr2067 LHD gene for large HD antigen, genomic RNA, strain dFr2067 AM779578.1 Hepatitis delta virus dFr2239b LHD gene for large HD antigen, genomic RNA, strain dFr2239b AM779587.1 Hepatitis delta virus dTk7 LHD gene for large HD antigen, genomic RNA, strain dTk7 - 30 - AM902179.1 Hepatitis delta virus dFr2042 LHD gene for large HD antigen, genomic RNA, strain dFr2042 AM779597.1 Hepatitis delta virus dTk2 LHD gene for large HD antigen, genomic RNA, strain dTk2 AM902172.1 Hepatitis delta virus dFr2264 LHD gene for large HD antigen, genomic RNA, strain dFr2264 M28267.1 Human hepatitis delta virus encoding delta-antigen RNA, complete cds AF098261.1 Hepatitis D virus from Canada, complete genome M55042.1 Hepatitis D virus delta antigen (HDAg) mRNA, complete cds AJ000558.1 Hepatitis D Virus complete genome X0445 1.1 Hepatitis delta virus (HDV) RNA genome M21012.1 Hepatitis delta virus RNA, complete genome AJ307077.1 Hepatitis delta virus complete genome, isolate W5 AM779594.1 Hepatitis delta virus dTk27 LHD gene for large HD antigen, genomic RNA, strain dTk27 AM779586.1 Hepatitis delta virus dTk28 LHD gene for large HD antigen, genomic RNA, strain dTk28 HM046802.1 Hepatitis delta virus isolate JN, complete genome X85253.1 Hepatitis D virus complete genome containing delta antigen ORF AY648956.1 Hepatitis delta virus isolate TW1435#47, complete genome AM779596.1 Hepatitis delta virus dTk21 LHD gene for large HD antigen, genomic RNA, strain dTk21 M92448.1 Hepatitis D virus, 5' end L22066.1 Hepatitis delta virus antigen gene, complete cds, and autocleavage/ligation sites AB118848.1 Hepatitis delta virus DNA, complete genome, strain:Nagasaki(JA-N1) AY648957.1 Hepatitis delta virus isolate TW5132#24, complete genome AM902175.1 Hepatitis delta virus dFr2406 LHD gene for large HD antigen, genomic RNA, strain dFr2406 AM779582.1 Hepatitis delta virus dTk35 LHD gene for large HD antigen, genomic RNA, strain dTk35 AM779591.1 Hepatitis delta virus dTk5 LHD gene for large HD antigen, genomic - 31 - RNA, strain dTk5 AY633627.1 Hepatitis delta virus isolate IR-1, complete genome AF425644.1 Hepatitis D virus isolate TWD2577-66 genotype I, complete genome AF104263.1 Hepatitis D virus strain TW2667, complete genome AY648959.1 Hepatitis delta virus isolate TW3678#25, complete genome AY648958.1 Hepatitis delta virus isolate TW1573#4, complete genome AM779590.1 Hepatitis delta virus dTk38 LHD gene for large HD antigen, genomic RNA, strain dTk38 AM779588.1 Hepatitis delta virus dTk34 LHD gene for large HD antigen, genomic RNA, strain dTk34 AM779581.1 Hepatitis delta virus dTkl LHD gene for large HD antigen, genomic RNA, strain dTkl AM902173.1 Hepatitis delta virus dFr2380 LHD gene for large HD antigen, genomic RNA, strain dFr2380 AM779584.1 Hepatitis delta virus dTk4 LHD gene for large HD antigen, genomic RNA, strain dTk4 AB118849.1 Hepatitis delta virus DNA, complete genome, strain:Nagasaki(JA-N2) AM902166.1 Hepatitis delta virus dFr2189 LHD gene for large HD antigen, genomic RNA, strain dFr2189 X77627.1 Hepatitis D virus genomic RNA for HDAg AM902174.1 Hepatitis delta virus dFr2404 LHD gene for large HD antigen, genomic RNA, strain dFr2404 AM779595.1 Hepatitis delta virus dTkl2 LHD gene for large HD antigen, genomic RNA, strain dTkl2 AM779589.1 Hepatitis delta virus dTk3 LHD gene for large HD antigen, genomic RNA, strain dTk3 HQ005366.1 Hepatitis delta virus isolate 6, complete genome AM779585.1 Hepatitis delta virus dTk6 LHD gene for large HD antigen, genomic RNA, strain dTk6 HQ005369.1 Hepatitis delta virus isolate 4, complete genome HQ00537 1.1 Hepatitis delta virus isolate 2, complete genome HQ005368.1 Hepatitis delta virus isolate 9, complete genome HQ005372.1 Hepatitis delta virus isolate 3, complete genome - 32 - HQ005367.1 Hepatitis delta virus isolate 8, complete genome AM779583.1 Hepatitis delta virus dTklO LHD gene for large HD antigen, genomic RNA, strain dTklO U81989.1 Hepatitis delta virus from Ethiopia genotype IC, complete genome HQ005364.1 Hepatitis delta virus isolate 5, complete genome M58629.1 Hepatitis delta virus large and small antigens (HDAg) gene, complete cds HQ005365.1 Hepatitis delta virus isolate 7, complete genome M84917.1 Hepatitis D virus RNA sequence AM902169.1 Hepatitis delta virus dFr2236 LHD gene for large HD antigen, genomic RNA, strain dFr2236 AM902168.1 Hepatitis delta virus dFr2045 LHD gene for large HD antigen, genomic RNA, strain dFr2045 AM779592.1 Hepatitis delta virus dTk8 LHD gene for large HD antigen, genomic RNA, strain dTk8 AM779577.1 Hepatitis delta virus dFr2284 LHD gene for large HD antigen, genomic RNA, strain dFr2284 HQ005370.1 Hepatitis delta virus isolate 1, complete genome AM779593.1 Hepatitis delta virus dTkl3 LHD gene for large HD antigen, genomic RNA, strain dTkl3 AM902178.1 Hepatitis delta virus dFr204O LHD gene for large HD antigen, genomic RNA, strain dFr204O AM90217 1.1 Hepatitis delta virus dFr2258 LHD gene for large HD antigen, genomic RNA, strain dFr2258 AM902167.1 Hepatitis delta virus dFr2201 LHD gene for large HD antigen, genomic RNA, strain dFr2201 AM902164.1 Hepatitis delta virus dFr2137 LHD gene for large HD antigen, genomic RNA, strain dFr2137 AM779580.1 Hepatitis delta virus dFr2046 LHD gene for large HD antigen, genomic RNA, strain dFr2046 AM902180.1 Hepatitis delta virus dFr2043 LHD gene for large HD antigen, genomic RNA, strain dFr2043 AM779574.1 Hepatitis delta virus dFr508 LHD gene for large HD antigen, genomic RNA, strain dFr508 - 33 - AM779576.1 Hepatitis delta virus dFr2544 LHD gene for large HD antigen, genomic RNA, strain dFr2544 AM902181.1 Hepatitis delta virus dFr2210 LHD gene for large HD antigen, genomic RNA, strain dFr2210 AM902176.1 Hepatitis delta virus dFr2411 LHD gene for large HD antigen, genomic RNA, strain dFr2411 U81988.1 Hepatitis delta virus from Somalia genotype IC, complete genome AM902170.1 Hepatitis delta virus dFr2244 LHD gene for large HD antigen, genomic RNA, strain dFr2244 EF514907.1 Hepatitis delta virus isolate ZA, complete genome EF514906.1 Hepatitis delta virus isolate SO, complete genome AM779575.1 Hepatitis delta virus dFr2119 LHD gene for large HD antigen, genomic RNA, strain dFr2119 EF514903.1 Hepatitis delta virus isolate CB, complete genome EF514904.1 Hepatitis delta virus isolate NK, complete genome EF514905.2 Hepatitis delta virus isolate OA, complete genome S75645.1 HDAg [hepatitis D virus (HDV) hepatitis D virus HDV, Chinese isolate SZ 93, Genomic, 840 nt] AJ309873.1 Hepatitis D Virus partial ag gene for hepatitis delta small antigen, genomic RNA, isolate Yakut-30 AJ309878.1 Hepatitis D Virus partial ag gene for hepatitis delta small antigen, genomic RNA, isolate Yakut-724 AJ309872.1 Hepatitis D Virus partial ag gene for hepatitis delta antigen, genomic RNA, isolate Yakut-12 AJ309871.1 Hepatitis D Virus partial ag gene for hepatitis delta antigen, genomic RNA, isolate Yakut-8 AY526577.1 Hepatitis delta virus small delta antigen gene, complete cds D90191.1 Hepatitis delta virus gene for hypothetical protein, complete cds, isolate: 7/6/89 D90190.1 Hepatitis delta virus gene for hypothetical protein, complete cds, isolate: 9/20/86 AJ309876.1 Hepatitis D Virus partial ag gene for hepatitis delta small antigen, genomic RNA, isolate Yakut-51 AJ309879.1 Hepatitis D Virus partial mRNA for hepatitis delta antigen (ag gene), - 34 isolate Yakut-26 X60193.1 Hepatitis delta virus HDVJS U19598.1 Hepatitis D virus large hepatitis delta antigen (HDAg) gene, complete cds AB 118846.1 Hepatitis delta virus DNA, complete genome, strain:Miyako(JA-M37) AF425645.1 Hepatitis D virus isolate TWD2476-38 genotype Ila, complete genome AY261457.1 Hepatitis D virus isolate TW2479-12s, complete genome DQ519393.2 Hepatitis delta virus genotype I delta antigen gene, complete cds ABi18845.1 Hepatitis delta virus DNA, complete genome, strain:Miyako(JA-M36) [0113] In specific embodiments, the recombinant HDV genome is prepared using the parent HDV RNA genome (-) JC126, which comprises, consists or consists essentially of the nucleotide sequence: 5 [0114] ccugagccaaguuccgagcgaggagacgcggggggaggaucagcucccgag aggggaugucacgguaaagagcauuggaacgucggagaaacuacucccaagaagcaaagagagg ucuuaggaagcggacgagauccccacaacgccggagaaucucuggaaggggaaagaggaaggug gaagaaaaaggggcgggccucccgauccgaggggcccaaucccagaucuggagagcacuccggc ccgaaggguugaguagcacucagagggaggaauccacucggagaugagcagagaaaucaccucc 10 agaggaccccuucagcgaacaagaggcgcuucgagcgguaggaguaagaccauagcgauaggag gagaugcuaggaguagggggagaccgaagcgaggaggaaagcaaagaaagcaacggggcuagcc gguggguguuccgccccccgagaggggacgagugaggcuuaucccggggaacucgacuuaucgu ccccaucuagcgggaccccggacccccuucgaaagugaccggagggggugcugggaacaccggg gaccaguggagccaugggaugcccuucccgaugcucgauuccgacuccccccccaagggucgcc 15 cuggcgggaccccacucugcaggguccgcguuccauccuuucuuaccugauggccggcaugguc ccagccuccucgcuggcgccggcugggcaacauuccgaggggaccguccccucgguaauggcga augggacccacaaaucucucuagauuccgauagagaaucgagagaaaaguggcucucccuuagc cauccgaguggacgugcguccuccuucggaugcccaggucggaccgcgaggagguggagaugcc augccgacccgaagaggaaagaaggacgcgagacgcaaaccugugaguggaaacccgcuuuauc 20 uggggucgacaacucuggggagaaaagggcggaucggcugggaagaguauauccuauggaaauc ccugguuuccccugauguccagccccuccccgguccgagagaagggggacuccgggacucccug cagauuggggacgaagccgcccccgggcgcuccccucgauccaccuucgaggggguucacaccc ccaaccggcgggccggcuacucuucuuucccuucucucgucuuccucggucaaccuccugaguu ccucuucuuccuccuugcugagguucuugccucccgccgauagcugcuucuucuuguucucgag 25 ggccuuccuucgucggugauccugccucuccuugucggugaauccuccccugagaggccucuuc - 35 ccagguccggagucuaccuccaucugguccguucgggcccucuucgccgggggagcccccucuc cauccuuauccuucuuuccgagaauuccuuugauguuccccagccagggauuuucguccucuau cuucuugaguuucuucuuugucuuccggaggucucucucgaguuccucuaacuucuuucuuccg gccacccacugcucgaggaucucuucucucccuccgcgguucuuccucgacucggaccggcuca 5 ucucggcuagaggcggcaguccucaguacucuuacucuuuucuguaaagaggagacugcuggac ucgccgcccgagcccgag [SEQ ID NO:1]. [0115] cDNA is generally used to make the recombinant HDV genome and thus the present invention encompasses the use of a cDNA sequence corresponding to the HDV JC126 strain parent RNA genome, which comprises, consists or consists 10 essentially of the nucleotide sequence: [0116] cctgagccaagttccgagcgaggagacgcggggggaggatcagctcccgag aggggatgtcacggtaaagagcattggaacgtcggagaaactactcccaagaagcaaagagagg tcttaggaagcggacgagatccccacaacgccggagaatctctggaaggggaaagaggaaggtg gaagaaaaaggggcgggcctcccgatccgaggggcccaatcccagatctggagagcactccggc 15 ccgaagggttgagtagcactcagagggaggaatccactcggagatgagcagagaaatcacctcc agaggaccccttcagcgaacaagaggcgcttcgagcggtaggagtaagaccatagcgataggag gagatgctaggagtagggggagaccgaagcgaggaggaaagcaaagaaagcaacggggctagcc ggtgggtgttccgccccccgagaggggacgagtgaggcttatcccggggaactcgacttatcgt ccccatctagcgggaccccggacccccttcgaaagtgaccggagggggtgctgggaacaccggg 20 gaccagtggagccatgggatgcccttcccgatgctcgattccgactccccccccaagggtcgcc ctggcgggaccccactctgcagggtccgcgttccatcctttcttacctgatggccggcatggtc ccagcctcctcgctggcgccggctgggcaacattccgaggggaccgtcccctcggtaatggcga atgggacccacaaatctctctagattccgatagagaatcgagagaaaagtggctctcccttagc catccgagtggacgtgcgtcctccttcggatgcccaggtcggaccgcgaggaggtggagatgcc 25 atgccgacccgaagaggaaagaaggacgcgagacgcaaacctgtgagtggaaacccgctttatc tggggtcgacaactctggggagaaaagggcggatcggctgggaagagtatatcctatggaaatc cctggtttcccctgatgtccagcccctccccggtccgagagaagggggactccgggactccctg cagattggggacgaagccgcccccgggcgctcccctcgatccaccttcgagggggttcacaccc ccaaccggcgggccggctactcttctttcccttctctcgtcttcctcggtcaacctcctgagtt 30 cctcttcttcctccttgctgaggttcttgcctcccgccgatagctgcttcttcttgttctcgag ggccttccttcgtcggtgatcctgcctctccttgtcggtgaatcctcccctgagaggcctcttc ccaggtccggagtctacctccatctggtccgttcgggccctcttcgccgggggagccccctctc catccttatccttctttccgagaattcctttgatgttccccagccagggattttcgtcctctat cttcttgagtttcttctttgtcttccggaggtctctctcgagttcctctaacttctttcttccg 35 gccacccactgctcgaggatctcttctctccctccgcggttcttcctcgactcggaccggctca - 36 tctcggctagaggcggcagtcctcagtactcttactcttttctgtaaagaggagactgctggac tcgccgcccgagcccgag [SEQ ID NO: 2]. [0117] SEQ ID NO:2 differs from the published sequence corresponding to the HDV JC126 strain parent genome (as set out in GenBank Accession No. M21012.1) 5 at 7 positions as follows: [0118] nucleotide 45: A to T [0119] nucleotide 221: T deleted [0120] nucleotide 619: C deleted [0121] nucleotide 840: C to G 10 [0122] nucleotide 1343: G to C [0123] nucleotide 1389: G to C [0124] nucleotide 1633: A to T [0125] As a result the corrected sequence contains only 1677 nucleotides. 2.2 Heterologous nucleotide sequences of interest (HSI) 15 [0126] Recombinant viruses of the present invention comprise a first heterologous nucleotide sequence or interest (HSI), which encompasses any nucleotide sequence inserted into the genome of the parent virus, which does not normally exist or naturally occur in that genome. The HSI may therefore include a sequence that is identical to a sequence in the genome of the parent virus, or, a sequence that differs 20 from sequences in the genome of the parent virus. In certain embodiments, the HSI comprises a nucleotide sequence from a HDV that is different to the parent virus including, but not limited to, different viral strains; and different viral serotypes. The HSI may encode an exogenous transcript product that interferes with transcription or translation (e.g., antisense molecule) or mediates RNA interference (e.g., siRNA or 25 shRNA). Alternatively, or in addition, the HSI may encode an exogenous polypeptide product. [0127] Exogenous polypeptides include polypeptides from any of a variety of pathogenic organisms, including, but not limited to, viruses, bacteria, yeast, fungi, and protozoa; cancer- or tumor-associated antigens; "self' antigens (i.e., autoantigens); - 37 foreign antigens (e.g., alloantigens and allergens) from other than pathogenic organisms; proteins that have a therapeutic activity; and the like. [0128] Where the polypeptide comprises one or more antigenic epitopes, any nucleic acid molecule comprising a nucleotide sequence which encodes a polypeptide 5 which, when produced by a cell infected by a recombinant HDV of the invention, increases an immune response is suitable for use in the present invention. Nucleic acid sequences encoding one or more exogenous polypeptides (e.g., antigens or epitopes) of interest can be included in a recombinant HDV as defined herein. If more than one exogenous antigen or epitope of interest is encoded by the heterologous nucleic acid 10 sequences, they can be antigens or epitopes of a single pathogen or antigens or epitopes from more than one (different) pathogen. In some embodiments, such an organism is a pathogenic microorganism. For example, such an exogenous epitope may be found on bacteria, parasites, viruses, yeast, or fungi that are the causative agents of diseases or disorders. In other embodiments, the antigen is an allergen. In still other embodiments, 15 the antigen is a cancer- or tumor-associated antigen. [0129] Pathogenic viruses include, but are not limited to, Retroviridae (e.g., human immunodeficiency viruses, such as HIV- 1 (also referred to as HTLV-III, LAV or HTLV-II1/LAV, or HIV-III); and other isolates, such as HIV-LP; Picornaviridae (e.g., polio viruses, hepatitis A virus; enteroviruses, human coxsackie viruses, rhinoviruses, 20 echoviruses); Caliciviridae (e.g., strains that cause gastroenteritis, including caliciviruses such as Norwalk virus); Togaviridae (e.g., equine encephalitis viruses, rubella viruses); Flaviridae (e.g., dengue viruses, encephalitis viruses, yellow fever viruses, hepatitis C virus); Coronaviridae (e.g., coronaviruses); Rhabdoviridae (e.g., vesicular stomatitis viruses, rabies viruses); Filoviridae (e.g., ebola viruses); 25 Paramyxoviridae (e.g., parainfluenza viruses, mumps virus, measles virus, respiratory syncytial virus); Orthomyxoviridae (e.g., influenza viruses); Bunyaviridae (e.g., Hantaan viruses, orthobunyaviruses, phleboviruses and nairoviruses); Arenaviridae (hemorrhagic fever viruses); Reoviridae (e.g., reoviruses, orbiviruses and rotaviruses); Birnaviridae; Hepadnaviridae (Hepatitis B virus); Parvoviridae (parvoviruses); 30 Papovaviridae (papilloma viruses, polyoma viruses); Adenoviridae (most adenoviruses); Herpesviridae (herpes simplex virus (HSV) 1 and 2, varicella zoster virus, cytomegalovirus (CMV)); Poxviridae (variola viruses, vaccinia viruses, pox viruses); - 38 and Iridoviridae (e.g., African swine fever virus); and unclassified viruses; and astroviruses. [0130] Pathogenic bacteria include, but are not limited to, Helicobacter pyloris, Borelia burgdorferi, Legionella pneumophila, Mycobacteria sps (e.g., M. 5 tuberculosis, M. avium, M. intracellulare, M. kansaii, M. gordonae), Staphylococcus aureus, Neisseria gonorrhoeae, Neisseria meningitidis, Listeria monocytogenes, Streptococcus pyrogenes (Group A Streptococcus), Streptococcus agalactiae (Group B Streptococcus), Streptococcus (viridans group), Streptococcus faecalis, Streptococcus bovis, Streptococcus (anaerobic spp.), Streptococcus pneumoniae, pathogenic 10 Campylobacter sp., Enterococcus sp., Haemophilus influenzae, Bacillus anthracis, Corynebacterium diphtheriae, Corynebacterium sp., Erysipelothrix rhusiopathiae, Clostridium perfringens, Clostridium tetani, Enterobacter aerogenes, Klebsiella pneumoniae, Pasturella multocida, Bacteroides sp., Fusobacterium nucleatum, pathogenic strains of Escherichia coli, Streptobacillus moniliformis, Treponema 15 pallidium, Treponema pertenue, Leptospira, and Actinomyces israelli. [0131] Infectious fungi include, but are not limited to, Cryptococcus neoformans, Histoplasma capsulatum, Coccidioides immitis, Blastomyces dermatitidis, Chlamydia trachomatis and Candida albicans. [0132] Infectious protozoa include, but are not limited to, Plasmodium spp., 20 e.g., Plasmodiumfalciparum; Trypanosomes, e.g., Trypanosoma cruzi; and Toxoplasma gondii. [0133] Allergens include, but are not limited to, pollens, insect venoms, animal dander dust, fungal spores and drugs (e.g., penicillin). Examples of natural, animal and plant allergens include proteins specific to the following genera: Canine 25 (Canis familiaris); Dermatophagoides (e.g., Dermatophagoidesfarinae); Felis (Felis domesticus); Ambrosia (Ambrosia artemiisfolia; Lolium (e.g., Lolium perenne or Lolium multiflorum); Cryptomeria (Cryptomeria japonica); Alternaria (Alternaria alternata); Alder; Alnus (Alnus gultinosa); Betula (Betula verrucosa); Quercus (Quercus alba); Olea (Olea europa); Artemisia (Artemisia vulgaris); Plantago (e.g., 30 Plantago lanceolata); Parietaria (e.g., Parietaria officinalis or Parietaria judaica); Blattella (e.g., Blattella germanica); Apis (e.g., Apis multiflorum); Cupressus (e.g., Cupressus sempervirens, Cupressus arizonica and Cupressus macrocarpa); Juniperus - 39 - (e.g., Juniperus sabinoides, Juniperus virginiana, Juniperus communis and Juniperus ashei); Thuya (e.g., Thuya orientalis); Chamaecyparis (e.g., Charnaecyparis obtusa); Periplaneta (e.g., Periplaneta americana); Agropyron(e.g., Agropyron repens); Secale (e.g., Secale cereale); Triticum (e.g., Triticum aestivum); Dactylis (e.g., Dactylis 5 glomerata); Festuca (e.g., Festuca elatior); Poa (e.g., Poa pratensis or Poa compressa); Avena (e.g., Avena sativa); Holcus (e.g., Holcus lanatus); Anthoxanthum (e.g., Anthoxanthum odoratum); Arrhenatherum (e.g., Arrhenatherum elatius); Agrostis(e.g., Agrostis alba); Phleum (e.g., Phleum pratense); Phalaris (e.g., Phalaris arundinacea); Paspalum (e.g., Paspalum notatum); Sorghum (e.g., Sorghum halepensis); and Bromus 10 (e.g., Bromus inermis). [0134] Any of a variety of known cancer- or tumor-associated antigens can be inserted into a HDV of the invention. The entire antigens may be, but need not be, inserted. Instead, a portion of a cancer- or tumor-associated antigen, e.g., an epitope, particularly an epitope that is recognized by a CTL, may be inserted. Tumor-associated 15 antigens (or epitope-containing fragments thereof) which may be inserted into HDV include, but are not limited to, MAGE-2, MAGE-3, MUC-1, MUC-2, HER-2, high molecular weight melanoma-associated antigen MAA, GD2, carcinoembryonic antigen (CEA), TAG-72, ovarian-associated antigens OV-TL3 and MOV 18, TUAN, alpha-feto protein (AFP), OFP, CA-125, CA-50, CA-19-9, renal tumor-associated antigen G250, 20 EGP-40 (also known as EpCAM), S100 (malignant melanoma-associated antigen), p53, prostate tumor-associated antigens (e.g., PSA and PSMA), and p2lras. [0135] Other antigens of interest include, but are not limited to, sperm associated antigens, venoms, hormones, and the like. Sperm-associated proteins are known in the art, and a nucleic acid molecule encoding any such protein is suitable for 25 use herein. See, e.g., Primakoff (1994) Reproductive Immunol. 31:208-210; Naz et al. (1995) Human Reprod. Update 1:1-18; Kerretal. (1998) J. Reprod. Immunol. 40:103 118; and U.S. Pat. No. 6,197,940. Hormones of interest include, but are not limited to, human chorionic gonadotrophin (hCG). Hormones such as hCG are useful to elicit specific antibodies, for use as contraceptive. Venoms of interest include those from any 30 poisonous animal, e.g., snake venoms, including, but not limited to, a-neurotoxins, kappa toxins, p-neurotoxins, dendrotoxins, cardiotoxins, myotoxins, and hemorrhaging. Of particular interest in some embodiments are modified venoms that elicit specific antibodies, but are not themselves toxic. Such modified venoms are useful to elicit an - 40 immune response to a venom, and in many embodiments, elicit a protective immune response such that, upon subsequent exposure to the venom from an animal source, any adverse physiological effects of the venom are mitigated. [0136] A "therapeutic protein" includes a protein that the host does not 5 produce but is in need of; a protein that the host does not normally produce, but which has a therapeutic activity; a protein that the host produces, but produces in inadequate amounts; a protein that the host produces but in a form which is inactive, or which has reduced activity compared with an activity normally associated with the protein; or a protein that the host produces in adequate amounts and with normal activity associated 10 with that protein. Therapeutic proteins include naturally-occurring proteins, and recombinant proteins whose amino acid sequences differ from a naturally-occurring counterpart protein, which recombinant proteins have substantially the same, an altered activity, or enhanced activity relative to a naturally-occurring protein. Proteins that have therapeutic activity include, but are not limited to, cytokines, including, but not limited 15 to, interleukins, endothelin, colony stimulating factors, tumor necrosis factor, and interferons; hormones, including, but not limited to, a growth hormone, insulin; growth factors, including, but not limited to human growth factor, insulin-like growth factor; bioactive peptides; trophins; neurotrophins; soluble forms of a membrane protein including, but not limited to, soluble CD4; enzymes; regulatory proteins; structural 20 proteins; clotting factors, including, but not limited to, factor XIII; erythropoietin; tissue plasminogen activator; etc. [0137] In specific embodiments, the exogenous polypeptide is a cytokine, which according to the present invention also encompasses a chemokine. In certain embodiments, the cytokine is identical or substantially identical to a cytokine produced 25 in a subject to which the recombinant virus is administered. [0138] Although no particular limitation exists regarding the particular cytokine encoded by the HSI, the cytokine is suitably one that is associated with antiviral immune responses in the host organism. Non-limiting examples of suitable cytokines include interleukins, interferons, tumor necrosis factor-alpha (TNF-a), alpha 30 defensins, RANTES (CCL5), CXCL1O (IP1O) and the like. [0139] The HSI may comprise a plurality of cytokine-encoding nucleic acid sequences. This includes duplicate(s) of a nucleic acid sequence encoding a specific - 41 cytokine and/or combinations of different nucleic acid sequences encoding different cytokines. [0140] In specific embodiments, the cytokine expressed by the recombinant virus may be sufficient to reduce the virulence (i.e., degree of pathogenicity) of the 5 virus such that potentially adverse effects are avoided in a subject to which the virus is administered. The virulence of a recombinant virus of the present invention may be assessed using a number of methods known in the art. For example, the virulence of a given recombinant virus may be assessed using cell culture-based assays, animal models (e.g., mouse, rat, hamster, primate) and/or assessing the monitoring subjects(s) 10 to which the virus has been administered. [0141] In certain embodiments the cytokine is an interferon. In illustrative embodiments of this type, the interferon is a type I interferon. For example, the interferon may be a mammalian type I interferon (e.g., interferon-alpha (IFN-a), interferon-beta (IFN-), interferon-kappa (IFN-K), interferon-delta (IFN-6), interferon 15 epsilon (IFN-s), interferon-tau (IFN-T), interferon-omega (IFN-w), or interferon-zeta (IFN-()). Alternatively, the interferon may be a type II interferon (e.g., interferon gamma (IFN-y)) or a type III interferon (e.g., an IFN-A such IFN-Al, IFN-A2 and IFN A3). The use of interferons with the recombinant HDVs of the present invention is particularly advantageous as interferons interfere with viral replication within host cells, 20 activate immune cells, such as natural killer cells and macrophages; increase recognition of infection or tumor cells by up-regulating antigen presentation to T lymphocytes; and increase the ability of uninfected host cells to resist new infection by virus. Thus, interferon-expressing HDVs are useful in a range of applications including the treatment of viral infections (e.g., HBV infections, HBV/HDV co-infections or HCV infections). 25 [0142] In certain embodiments the cytokine is interferon-beta (IFN-). Suitably, the cytokine is mammalian interferon-beta (IFN-), and more suitably human interferon-beta (IFN-). Without limitation to a specific sequence, the human interferon-beta (IFN-) may be defined by the amino acid sequence set forth in GenBank accession number AAC41702.1. 30 [0143] The HSI encoding the exogenous protein to be produced by a host cell following infection of the host cell by a recombinant HDV of the present invention can be obtained by techniques known in the art, including but not limited to, chemical or - 42 enzymatic synthesis, purification from genomic DNA of the microorganism, by purification or isolation from a cDNA encoding the exogenous protein, by cDNA synthesis from RNA of an organism, or by standard recombinant methods (Sambrook et al., (1989) "Molecular Cloning: A Laboratory Manual", (2nd ed., Cold Spring Harbor 5 Laboratory Press, Plainview, New York; and Ausubel et al. (Eds), (2000-2010), "Current Protocols in Molecular Biology", John Wiley and Sons, Inc.). Nucleotide sequences encoding many of the above-listed exogenous proteins are publicly available. Variant of such sequences can readily be generated by those skilled in the art using standard recombinant methods, including site-directed and random mutagenesis. The 10 nucleic acid molecule encoding the exogenous polypeptide can further include sequences that direct secretion of the protein from the cell, sequences that alter RNA and/or protein stability, and the like. 2.3 Ancillary elements [0144] A coding sequence of the HSI may comprise at least one nucleotide 15 sequence encoding a proteolytic cleavage site. The proteolytic cleavage site may be advantageous in facilitating cleavage and release of the encoded polypeptide from the HDAg. In certain embodiments, the proteolytic cleavage site is a so-called "self cleaving" peptide sequence. Illustrative self-cleaving peptides are encoded by some picornaviruses as well as a number of other single- and double-stranded RNA viruses 20 (Doronina et al., 2008, Biochem Soc Trans. 36:712-716; de Felipe 2004, Genet Vaccines Ther. 2:13; Halpin et al., 1999, Genet Vaccines Ther. 2:13). In some embodiments, self-cleaving peptides are selected from "2A" and "2A-like" self-cleaving sequences, which suitably comprise the consensus motif D-V/I-E-X-N-P-G-P. These sequences are understood to act co-translationally by preventing the formation of a 25 normal peptide bond between the glycine and last proline, resulting in the ribosome skipping to the next codon, and the nascent peptide cleaving between the glycine and proline. After cleavage, the short 2A or 2A-like peptide remains fused to the C-terminus of the upstream protein, while the proline is added to the N-terminus of the downstream protein. Other sequences encoding proteolytic cleavage sites and methods for their 30 incorporation into polypeptides of interest are well known in the art and described in standard texts. In some embodiments, the proteolytic cleavage site-encoding sequence is placed upstream (i.e., 5') of the HSI coding sequence. In other embodiments, the nucleotide sequence encoding the proteolytic cleavage site is located upstream (i.e., 5') - 43 and downstream (i.e., 3') of the HIS coding sequence. In still other embodiments, the proteolytic cleavage site-encoding sequence is placed upstream (i.e., 3') of the HSI coding sequence. Suitably, the proteolytic cleavage sites is positioned to facilitate release of the encoded exogenous polypeptide upon proteolytic processing of a 5 recombinant viral polyprotein precursor comprising the encoded exogenous polypeptide. [0145] In some embodiments, a coding sequence of the HSI comprises a nucleotide sequence encoding a signal peptide for directing transport of an exogenous polypeptide within a host cell (e.g., to the endoplasmic reticulum) and/or to the cell 10 exterior. [0146] In some embodiments, a coding sequence of the HSI is operably linked to an internal ribosome binding site (IRES). Any of a variety of naturally occurring or synthetic (e.g., recombinant) IRES sequences can be used in the recombinant HDV of the invention. Naturally occurring IRES sequences are known in 15 the art and include, but are not limited to, IRES sequences derived from mengovirus, bovine viral diarrhea virus (BVDV), encephalomyocarditis virus (EMCV), hepatitis C virus (HCV; e.g., nucleotides 1202-1812 of the nucleotide sequence provided under GenBank Accession number AJ242654), GTX, Cyr61 a, Cyr6lb, poliovirus, the immunoglobulin heavy-chain-binding protein (BiP), immunoglobulin heavy chain, a 20 picomavirus, murine encephalomyocarditis virus, poliovirus, and foot and mouth disease virus (e.g., nucleotide numbers 600-1058 of the nucleotide sequence provided under GenBank Accession No. AF308157). Other IRES sequences such as those reported in WO 96/01324; WO 98/49334; WO 00/44896; and U.S. Pat. No. 6,171,821 can be used in the recombinant HDVs of the invention. 25 [0147] Mutants, variants and derivatives of naturally occurring IRES sequences may be employed in the present invention provided they retain the ability to initiate translation of an operably linked coding sequence located 3' of the IRES. An IRES sequence suitable for use in the present invention has at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 30 95%, or more, nucleotide sequence identity with a naturally occurring IRES. An IRES sequence suitable for use in the present invention may also be a fragment of a naturally - 44 occurring IRES, provided the fragment functions to allow ribosome attachment and initiate translation of an operably linked Y coding region. 2.4 Illustrative size and positioning of the heterologous nucleic acid sequence [0148] Without imposing any specific limitation on the length of an 5 heterologous nucleotide sequence introduced into a parent HDV genome, in some embodiments an heterologous nucleotide sequence is from about 12 to about 3000 nucleotides in length, for example from 12 to about 18, from about 15 to about 24, from about 21 to about 30, from about 30 to about 60, from about 60 to about 90, from about 90 to about 120, from about 120 to about 150, from about 150 to about 180, from about 10 180 to about 240, from about 240 to about 300, from about 300 to about 600, from about 600 to about 1200, from about 1200 to about 1500, from about 1500 to about 2100, from about 2100 to about 2400, or from about 2400 to about 3000 nucleotides in length. In some embodiments, an heterologous nucleotide sequence is no more than 300,400,500,600,700,800,900,1000,1100,1200,1300,1400,1500,1600,1700, 15 1800, 1900,2000,2100,2200,2300,2400,2500,2600,2700,2800,2900,3000 nucleotides in length. In some embodiments, the first and second heterologous nucleotides sequences combined are no more than 150, 200, 300, 400, 500, 600, 700, 800,900,1000,1100,1200,1300,1400,1500,1600,1700,1800,1900,2000,2100, 2200, 2300, 2400, 2500, 2600, 2700, 2800, 2900, 3000 nucleotides in length. 20 [0149] Suitably an exogenous polypeptide encoded by an HSI is from about 4 to about 1000 amino acids in length, for example from about 4 to about 6, from about 5 to about 8, from about 7 to about 10, from about 10 to about 20, from about 20 to about 30, from about 30 to about 40, from about 40 to about 50, from about 50 to about 60, from about 60 to about 80, from about 80 to about 100, from about 100 to about 200, 25 from about 200 to about 400, from about 400 to about 500, from about 500 to about 700, from about 700 to about 800, or from about 800 to about 1000 amino acids in length. In some embodiments, an exogenous polypeptide is no more than 50, 100, 150, 300, 400, 500, 600, 700, 800, 900, 1000 amino acids in length. 2.5 Preparation of nucleic acid molecules corresponding to the recombinant HDV 30 RNA genome and recombinant HDV [0150] The present invention also encompasses processes for preparing a recombinant HDV RNA genome of the invention. Illustrative process include - 45 constructing antigenomic cDNA corresponding to the recombinant HDV RNA antigenome and transcribing the cDNA to form a mixture containing an antigenomic RNA; and thereafter isolating the antigenomic RNA. These processes are well known to persons of skill in the art and include standard recombinant methods as described for 5 example by Sambrook et al., (1989) supra; and Ausubel et al. (Eds), (2000-2010), supra. [0151] The present invention is also directed toward a recombinant HDV comprising a recombinant antigenomic RNA that comprises heterologous nucleotide sequences as described herein. In an illustrative process, the recombinant HDV can be 10 produced by: [0152] (i) providing a cell (e.g., a hepatocyte such as a differentiated hepatocyte) or cell line (e.g., HepG2.2.15) that is infected with HBV or that expresses (e.g., using helper vectors) coding sequences for HBV envelope proteins or envelope proteins from a related virus (e.g., woodchuck hepatitis virus (WHV)); 15 [0153] (ii) transfecting the cells with a vector comprising a cDNA encoding the antigenomic RNA or antigenomic RNA that has been prepared for example by in vitro transcription; and [0154] (iii) isolating recombinant HDV from a supernatant of the medium of step (ii) to obtain the recombinant HDV. 20 [0155] Thus, within the scope of the present invention are a cDNA comprising a nucleotide sequence corresponding to a recombinant antigenomic HDV RNA, a cell containing the cDNA, a vector comprising the cDNA, a cell containing the cDNA, a cell containing the recombinant antigenomic RNA, and a recombinant HDV containing the recombinant RNA genome of the invention or antigenome thereof. In 25 some embodiments, the recombinant HDV containing the recombinant RNA genome of the invention or antigenome thereof is in isolated form or is substantially purified. - 46 - 3. Compositions [0156] The present invention further provides compositions, including pharmaceutical compositions, comprising a recombinant HDV of the invention. Representative compositions may include a buffer, which is selected according to the 5 desired use of the recombinant HDV, and may also include other substances appropriate to the intended use. Where the intended use is to induce an immune response, the composition is referred to as an "immunogenic" or "immunomodulating" composition. Such compositions include preventative compositions (i.e., compositions administered for the purpose of preventing a condition such as an infection) and therapeutic 10 compositions (i.e., compositions administered for the purpose of treating conditions such as an infection). An immunomodulating composition of the present invention may therefore be administered to a recipient for prophylactic, ameliorative, palliative, or therapeutic purposes. [0157] Those skilled in the art can readily select an appropriate buffer, a wide 15 variety of which are known in the art, suitable for an intended use. In some instances, the composition can comprise a pharmaceutically acceptable excipient, a variety of which are known in the art and need not be discussed in detail herein. Pharmaceutically acceptable excipients have been amply described in a variety of publications, including, for example, A. Gennaro (2000) "Remington: The Science and Practice of Pharmacy", 20 20th edition, Lippincott, Williams, & Wilkins; Pharmaceutical Dosage Forms and Drug Delivery Systems (1999) H. C. Ansel et al., eds 7.sup.th ed., Lippincott, Williams, & Wilkins; and Handbook of Pharmaceutical Excipients (2000) A. H. Kibbe et al., eds., 3.sup.rd ed. Amer. Pharmaceutical Assoc. [0158] In some embodiments, the compositions comprise more than one (i.e., 25 different) recombinant HDV of the invention (e.g., recombinant HDV comprising different heterologous nucleic acid sequences including different HSIs). [0159] Pharmaceutical compositions of the present invention may be in a form suitable for administration by injection, in a formulation suitable for oral ingestion (such as, for example, capsules, tablets, caplets, elixirs), in the form of an ointment, 30 cream or lotion suitable for topical administration, in a form suitable for delivery as an eye drop, in an aerosol form suitable for administration by inhalation, such as by - 47 intranasal inhalation or oral inhalation, or in a form suitable for parenteral administration, that is, subcutaneous, intramuscular or intravenous injection. [0160] Supplementary active ingredients such as adjuvants or biological response modifiers can also be incorporated into pharmaceutical compositions of the 5 present invention. Although adjuvant(s) may be included in pharmaceutical compositions of the present invention they need not necessarily comprise an adjuvant. In such cases, reactogenicity problems arising from the use of adjuvants may be avoided. [0161] In general, adjuvant activity in the context of a pharmaceutical 10 composition of the present invention includes, but is not limited to, an ability to enhance the immune response (quantitatively or qualitatively) induced by immunogenic components in the composition (e.g., a recombinant virus of the present invention). This may reduce the dose or level of the immunogenic components required to produce an immune response and/or reduce the number or the frequency of immunizations required 15 to produce the desired immune response. [0162] Any suitable adjuvant may be included in a pharmaceutical composition of the present invention. For example, an aluminum-based adjuvant may be utilized. Suitable aluminum-based adjuvants include, but are not limited to, aluminum hydroxide, aluminum phosphate and combinations thereof. Other specific examples of 20 aluminum-based adjuvants that may be utilized are described in European Patent No. 1216053 and United States Patent No. 6,372,223. Other suitable adjuvants include Freund's Incomplete Adjuvant and Complete Adjuvant (Difco Laboratories, Detroit, Mich.); Merck Adjuvant 65 (Merck and Company, Inc., Rahway, N.J.); AS-2 (SmithKline Beecham, Philadelphia, Pa.); aluminum salts such as aluminum hydroxide 25 gel (alum) or aluminum phosphate; salts of calcium, iron or zinc; an insoluble suspension of acylated tyrosine; acylated sugars; cationically or anionically derivatized polysaccharides; polyphosphazenes; biodegradable microspheres; monophosphoryl lipid A and quil A; oil in water emulsions including those described in European Patent No. 0399843, United States Patent No. 7,029,678 and PCT Publication No. WO 30 2007/006939; and/or additional cytokines, such as GM-CSF or interleukin-2, -7, or -12, granulocyte-macrophage colony-stimulating factor (GM-CSF), tumor necrosis factor (TNF) monophosphoryl lipid A (MPL), cholera toxin (CT) or its constituent subunit, - 48 heat labile enterotoxin (LT) or its constituent subunit, toll-like receptor ligand adjuvants such as lipopolysaccharide (LPS) and derivatives thereof (e.g., monophosphoryl lipid A and 3-Deacylated monophosphoryl lipid A), muramyl dipeptide (MDP) and F protein of respiratory syncytial virus (RSV). 5 [0163] Pharmaceutical compositions of the present invention may be provided in a kit. The kit may comprise additional components to assist in performing the methods of the present invention such as, for example, administration device(s), buffer(s), and/or diluent(s). The kits may include containers for housing the various components and instructions for using the kit components in the methods of the present 10 invention. 4. Dosages and Routes of Administration [0164] The recombinant HDV composition is administered in an "effective amount" that is, an amount effective to achieve production of the exogenous polypeptide in the host at a desired level. One skilled in the art would be able, by 15 routine experimentation, to determine an effective, non-toxic amount of a recombinant virus described herein to include in a pharmaceutical composition of the present invention for the desired therapeutic outcome. In general, a pharmaceutical composition of the present invention can be administered in a manner compatible with the route of administration and physical characteristics of the recipient (including health status) and 20 in such a way that it elicits the desired effect(s) (i.e. therapeutically effective, immunogenic and/or protective). For example, the appropriate dosage of a pharmaceutical composition of the present invention may depend on a variety of factors including, but not limited to, a subject's physical characteristics (e.g., age, weight, sex), whether the compound is being used as single agent or adjuvant therapy, the type of 25 MHC restriction of the patient, the progression (i.e., pathological state) of a virus infection, and other factors that may be recognized by one skilled in the art. Various general considerations that may be considered when determining an appropriate dosage of a pharmaceutical composition of the present invention are described, for example, in Gennaro (2000) "Remington: The Science and Practice of Pharmacy", 20th edition, 30 Lippincott, Williams, & Wilkins; and Gilman et al., (Eds), (1990), "Goodman And Gilman's: The Pharmacological Bases of Therapeutics", Pergamon Press. - 49 - [0165] The dose of recombinant HDV administered to an individual will generally be in a range of from about 102 to about 108, from about 103 to about 106, or from about 104 to about 10 5 genome equivalents (GE). [0166] In some embodiments, an "effective amount" of a subject recombinant 5 HDV is an amount sufficient to achieve a desired therapeutic effect. [0167] In some embodiments, an "effective amount" of a subject recombinant HDV is an amount of recombinant HDV that is effective in a selected route of administration to elicit an immune response to an exogenous polypeptide. [0168] In some embodiments, e.g., where the exogenous polypeptide is one 10 associated with a pathogenic microorganism, an "effective amount" is an amount that is effective to facilitate protection of the host against infection, or symptoms associated with infection, by a pathogenic organism, e.g., to reduce a symptom associated with infection, and/or to reduce the number of infectious agents in the individual. In these embodiments, an effective amount reduces a symptom associated with infection and/or 15 reduces the number of infectious agents in an individual by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90%, or more, when compared to the symptom or number of infectious agents in an individual not treated with the recombinant HDV, or treated with the parent HDV. Symptoms of infection by 20 a pathogenic microorganism, as well as methods for measuring such symptoms, are known in the art. Methods for measuring the number of pathogenic microorganisms in an individual are standard in the art. [0169] In some embodiments, e.g., where the exogenous polypeptide is a cancer- or tumor-associated antigen, an "effective amount" of a recombinant HDV is an 25 amount of recombinant HDV that is effective in a route of administration to elicit an immune response effective to reduce or inhibit cancer or tumor cell growth, to reduce cancer or tumor cell mass or cancer or tumor cell numbers, or to reduce the likelihood that a cancer or tumor will form. In these embodiments, an effective amount reduces tumor growth and/or the number of tumor cells in an individual by at least about 10%, 30 at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90%, or more, when compared to the tumor growth and/or number of tumor cells in an individual not treated - 50 with the recombinant HDV or treated with the parent HDV. Methods of measuring tumor growth and numbers of tumor cells are known in the art. [0170] The amount of recombinant HDV in each dose is selected as an amount that induces an immune response to the encoded exogenous polypeptide 5 antigen, and/or that induces an immunoprotective or other immunotherapeutic response without significant, adverse side effects generally associated with typical vaccines. Such amount will vary depending upon which specific exogenous polypeptide is employed, whether or not the vaccine formulation comprises an adjuvant, and a variety of host dependent factors. 10 [0171] An effective dose of recombinant HDV nucleic acid-based composition will generally involve administration of from about 1-1000 pg of nucleic acid. Alternatively, an effective dose of recombinant HDV will generally be in a range of from about 102 to about 108, from about 103 to about 106, or from about 104 to about 10 5 genome equivalents (GE). An optimal amount for a particular immunomodulating 15 composition can be ascertained by standard studies involving observation of antibody titers and other responses in subjects. The levels of immunity provided by the immunomodulating composition can be monitored to determine the need, if any, for boosters. Following an assessment of antibody titers in the serum, optional booster immunizations may be desired. The immune response to the protein of this invention is 20 enhanced by the use of adjuvant and/or an immunostimulant. [0172] A pharmaceutical composition of the present invention can be administered to a recipient by standard routes, including, but not limited to, parenteral (e.g., intravenous). [0173] A pharmaceutical composition of the present invention may be 25 administered to a recipient in isolation or in conjunction with additional therapeutic agent(s). In embodiments where a pharmaceutical composition is concurrently administered with therapeutic agent(s), the administration may be simultaneous or sequential (i.e., pharmaceutical composition administration followed by administration of the agent(s) or vice versa). 30 [0174] Typically, in treatment applications, the treatment may be for the duration of the disease state or condition. Further, it will be apparent to one of ordinary skill in the art that the optimal quantity and spacing of individual dosages will be -51 determined by the nature and extent of the disease state or condition being treated, the form, route and site of administration, and the nature of the particular individual being treated. Optimum conditions can be determined using conventional techniques. [0175] In many instances (e.g., preventative applications), it may be desirable 5 to have several or multiple administrations of a pharmaceutical composition of the present invention. For example, a pharmaceutical composition may be administered 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more times. The administrations may be from about one to about twelve week intervals, and in certain embodiments from about one to about four week intervals. Periodic re-administration may be desirable in the case of recufrent 10 exposure to a particular pathogen or allergen targeted by a pharmaceutical composition of the present invention. [0176] It will also be apparent to one of ordinary skill in the art that the optimal course of administration can be ascertained using conventional course of treatment determination tests. 15 [0177] Where two or more entities are administered to a subject "in conjunction" or "concurrently" they may be administered in a single composition at the same time, or in separate compositions at the same time, or in separate compositions separated in time. [0178] Certain embodiments of the present invention involve the 20 administration of pharmaceutical compositions in multiple separate doses. Accordingly, the methods for the prevention (i.e. vaccination) and treatment of infection described herein encompass the administration of multiple separated doses to a subject, for example, over a defined period of time. Accordingly, the methods for the prevention (i.e., vaccination) and treatment of infection disclosed herein include administering a 25 priming dose of a pharmaceutical composition of the present invention. The priming dose may be followed by a booster dose. The booster may be for the purpose of re vaccination. In various embodiments, the pharmaceutical composition or vaccine is administered at least once, twice, three times or more. [0179] Methods for measuring the immune response are known to persons of 30 ordinary skill in the art. Exemplary methods include solid-phase heterogeneous assays (e.g., enzyme-linked immunosorbent assay), solution phase assays (e.g., electrochemiluminescence assay), amplified luminescent proximity homogeneous - 52 assays, flow cytometry, intracellular cytokine staining, functional T-cell assays, functional B-cell assays, functional monocyte-macrophage assays, dendritic and reticular endothelial cell assays, measurement of NK cell responses, IFN-y production by immune cells, quantification of virus RNA/DNA in tissues or biological fluids (e.g., 5 quantification of HBV RNA (GE) in serum, or quantification of HBV cccDNA in the liver), oxidative burst assays, cytotoxic-specific cell lysis assays, pentamer binding assays, and phagocytosis and apoptosis evaluation. 5. Uses of Recombinant Hepatitis Delta Viruses of the Invention [0180] Recombinant HDVs of the invention are useful to deliver a 10 polypeptide to a mammalian host (e.g., in the liver of the host); and to elicit or increase an immune response to an antigen encoded by the recombinant virus. Recombinant HDVs of the present are also useful for producing the exogenous polypeptide in host cells, such as mammalian, particularly human, cells or other cell types. The exogenous protein can further be isolated or purified using standard methods. 15 5.1 Methods for delivering a therapeutic polypeptide to a mammalian host [0181] The present invention provides methods for delivering a polypeptide to a mammalian host. The methods generally involve administering a recombinant HDV of the invention to a vertebrate host, wherein the virus enters a host cell and the exogenous polypeptide is expressed either by itself or as a polyprotein with HDAg, 20 which is optionally processed in a host cell to provide separate polypeptides. In some embodiments, the exogenous polypeptide remains intracellular. In other embodiments, the exogenous polypeptide becomes associated with the plasma membrane of a host cell. In other embodiments, the exogenous polypeptide is secreted from the cell. In those embodiments in which the exogenous polypeptide is secreted from the cell, the 25 exogenous polypeptide can be secreted into the extracellular milieu, e.g., the interstitial fluid; and/or the exogenous polypeptide can enter the blood stream; and/or the exogenous polypeptide can bind to and/or enter a cell other than the cell in which it was produced. [0182] In some embodiments, the exogenous polypeptide is one that has 30 therapeutic activity, such that when the protein is produced in the mammalian host, a therapeutic effect is achieved. Whether, and at what level, a therapeutic protein is produced in an individual is readily determined using any known method, e.g., methods - 53 for detecting the presence of and/or measuring the amount of a protein, including, but not limited to, an enzyme-linked immunosorbent assay, a radioimmunoassay, and the like, using specific antibody; and methods for detecting the presence of and/or measuring the amount of a biological activity associated with the protein. Whether a 5 therapeutic effect is achieved can be determined using a method appropriate to the particular therapeutic effect. For example, whether a therapeutic effect is achieved when insulin is delivered to a host using the subject method can be determined by measuring glucose levels in the individual. 5.2 Methods of increasing an immune response to an exogenous polypeptide 10 [0183] The present invention provides methods for eliciting an immune response to an antigen. The methods generally involve administering a recombinant HDV of the invention to a vertebrate host, wherein the virus enters a host cell, the exogenous polypeptide is expressed as a polyprotein with at least one virus protein, and an immune response is elicited to the exogenous polypeptide. 15 [0184] In some embodiments, recombinant HDVs as described herein are useful for inducing an immune response to an antigen in an individual. When the exogenous polypeptide is produced in a vertebrate host, it induces an immune response to the exogenous polypeptide. In many embodiments, the immune response protects against a condition or disorder caused by or associated with expression of or the 20 presence in the host of, an antigen comprising the epitope. In some embodiments the antigen is a pathogen-associated antigen, and the immune response provides protection against challenge or infection by the exogenous pathogen (bacterial, viral, fungal, parasitic) in which the antigen occurs. Recombinant HDV of the invention are, therefore, useful as immunomodulating compositions (also referred to herein as 25 "immunogenic compositions") to elicit and/or enhance an immune response to the antigen. [0185] In some embodiments, the exogenous polypeptide is an antigenic polypeptide of a microbial pathogen. Such recombinant HDVs can then be administered to a host to prevent or treat infection by the pathogen, or to prevent or treat symptoms of 30 such pathogenic infection. Of particular interest in some embodiments is the prevention or treatment of infection or disease caused by microbial pathogens that, during the course of infection, are present intracellularly, e.g., viruses (e.g., HIV), bacteria (e.g., - 54 - Shigella, Listeria, mycobacteria, and the like), parasites (e.g., malarial parasites, illustrative examples of which include Plasmodiumfalciparum; trypanosomes, and the like), etc. Antigenic polypeptides of such microbial pathogens are well known in the art, and can be readily selected for use in the present recombinant HDV immunomodulating 5 composition by the ordinarily skilled artisan. [0186] In addition, a recombinant HDV of the invention can be used as a delivery vehicle to delivery any antigen to an individual, to provoke an immune response to the antigen. In some embodiments, recombinant HDV of the invention are used as bivalent or multivalent immunomodulating composition to treat human or 10 veterinary diseases caused by infectious pathogens, particularly viruses, bacteria, and parasites. Examples of epitopes which could be delivered to a host in a multivalent HDV composition of the invention include multiple epitopes from various serotypes of Group B streptococcus, influenza virus, rotavirus, and other pathogenic organisms known to exist in nature in multiple forms or serotypes; epitopes from two or more 15 different pathogenic organisms; and the like. [0187] Suitable subjects include naive subjects (i.e., subjects who were never exposed to the antigen such that the antigen or pathogen entered the body), and subjects who were previously exposed to the antigen, but did not mount a sufficient immune response to the pathogenic organism. 20 [0188] In other embodiments, a polypeptide antigen expressed on a given cancer or tumor cell (e.g., a cancer- or tumor-associated antigen) is inserted into a recombinant HDV of the invention as described herein. Such recombinant HDV can be administered to an individual having, or suspected of having, a cancer or tumor. In some cases, such recombinant HDV can be administered to an individual who does not have a 25 cancer or tumor, but in whom protective immunity is desired. As is often the case, the immune system does not mount an immune response effective to inhibit or suppress cancer or tumor growth, or eliminate a cancer or tumor altogether. Cancer- or tumor associated antigens are often poorly immunogenic; perhaps due to an active and ongoing immunosuppression against them. Furthermore, cancer patients tend to be 30 immunosuppressed, and only respond to certain T-dependent antigens. In these cases, introduction into the host of a recombinant HDV of the invention which expresses an - 55 exogenous peptide polypeptide corresponding to an antigen expressed on the tumor cell surface can elicit an immune response to the tumor in the host. [0189] Non-limiting cancer- or tumor-associated antigens (or epitope containing fragments thereof) which may be inserted into HDV include, but are not 5 limited to, MAGE-2, MAGE-3, MUC-1, MUC-2, HER-2, high molecular weight melanoma-associated antigen MAA, GD2, carcinoembryonic antigen (CEA), TAG-72, ovarian-associated antigens OV-TL3 and MOV18, TUAN, alpha-feto protein (AFP), OFP, CA-125, CA-50, CA-19-9, renal tumor-associated antigen G250, EGP-40 (also known as EpCAM), S100 (malignant melanoma-associated antigen), p53, prostate 10 tumor-associated antigens (e.g., PSA and PSMA) and p2lras. [0190] Suitable subjects include subjects who do not have cancer, but are considered at risk of developing cancer; and subjects who have cancer, but who have not mounted an immune response sufficient to reduce or eliminate the cancer. [0191] Whether an immune response has been elicited to a pathogenic 15 organism, cancer or tumor can be determined (quantitatively, e.g., by measuring a parameter, or qualitatively, e.g., by assessing the severity of a symptom, or by detecting the presence of a particular parameter) using known methods. Methods of measuring an immune response are well known in the art and include enzyme-linked immunosorbent assay (ELISA) for detecting and/or measuring antibody specific to a given pathogenic 20 organism, cancer or tumor antigen; and in vitro assays to measure a cellular immune response (e.g., a CTL assay using labeled, inactivated cells expressing the epitope on their cell surface with MHC Class I molecules). Whether an immune response is effective to facilitate protection of the host against infection, or symptoms associated with infection, by a pathogenic organism can be readily determined by those skilled in 25 the art using standard assays, e.g., determining the number of pathogenic organisms in a host (e.g., measuring viral load, and the like); measuring a symptom caused by the presence of the pathogenic organism in the host (e.g., body temperature, CD4' T cell counts, and the like). Whether an immune response is elicited to a given cancer or tumor can be determined by methods standard in the art, including, but not limited to, assaying 30 for the presence and/or amount of cancer- or tumor-associated antigen-specific antibody in a biological sample derived from the individual, e.g., by enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), and the like; assaying for the - 56 presence and/or numbers of CTLs specific for a cancer- or tumor-associated antigen; and the like. Assays for determining the presence and/or numbers of cancer- or tumor associated antigen-specific CTLs are known in the art and include, but are not limited to, chromium-release assays, tritiated thymidine incorporation assays, and the like. 5 Standard immunological protocols may be used, which can be found in a variety of texts, including, e.g., Current Protocols in Immunology (J. E. Coligan, A. M. Kruisbeek, D. H. Margulies, E. M. Shevach and W. Strober Eds. 1991). Whether an immune response is effective in reducing the number of tumor cells in an individual can be determined by standard assays, including, but not limited to, measuring tumor cell mass, 10 measuring numbers of tumor cells in an individual, and measuring tumor cell metastasis. Such assays are well known in the art and need not be described in detail herein. 5.3 Methods for producing an exogenous polypeptide [0192] The invention further provides methods of producing an exogenous 15 polypeptide in a vertebrate host cell. The methods generally involve contacting a susceptible host cell with a recombinant HDV of the invention with, culturing the host cell for a period of time to allow production of the exogenous polypeptide by the host cell. In some embodiments, the methods further comprise purifying the exogenous polypeptide from the host cell or from the culture medium. 20 [0193] In some embodiments, the exogenous protein remains intracellular (e.g., in the cytoplasm, in a cell membrane, or in an organelle), in which case the cells are disrupted. A variety of protocols for disrupting cells to release an intracellular protein are known in the art, and can be used to extract an exogenous protein from a cell. In other embodiments, the exogenous protein is secreted into the medium in which 25 the cells are grown. [0194] Any convenient protein purification procedures may be employed, where suitable protein purification methodologies are described in Guide to Protein Purification, (Deuthser ed.) (Academic Press, 1990). For example, a lysate may prepared from the infected host cell, or a cell culture supernatant may be produced, and 30 the exogenous protein purified using HPLC, exclusion chromatography, gel electrophoresis, affinity chromatography, and the like. - 57 - [0195] The methods disclosed herein may provide several improvements over existing methods, particularly in the context of recombinant virus stability infection. [0196] One improvement may be that an heterologous nucleotide sequence inserted in a HDV genome may remain genetically stable (i.e. resist mutation/deletion) 5 over extended numbers of viral replication cycles, provided that a substantially complementary heterologous nucleotide sequence is also inserted into the HDV genome at a different site to permit annealing between the heterologous nucleotide sequences. [0197] Another improvement may be that an exogenous cytokine expressed by a recombinant virus of the present invention (e.g., a type-I IFN such as interferon 10 beta) may attenuate virulence in a host organism to which the virus is administered. This may result in a self-limiting infection minimizing potentially adverse effects on the host organism. [0198] Another improvement may be that despite the attenuated virulence, the administration of a recombinant virus of the present invention to a subject may 15 induce a similar level of immunity against the targeted microorganism (e.g., a target virus) to that which may be achieved by administering the targeted microorganism (i.e. wild-type). [0199] A further improvement may be that an exogenous cytokine expressed by a recombinant virus of the present invention (e.g., a type I IFN such as interferon 20 beta) may act as a molecular adjuvant in the host organism enhancing humoral and/or cell-mediated immunity. [0200] Still another improvement may be that a recombinant virus of the present invention administered to a subject may continue to propagate until the immune system is sufficiently activated to halt the infection, thereby providing a means of 25 inducing stronger immune responses. [0201] Yet another improvement may be that a recombinant virus of the present invention administered to a subject may not revert to a pathogenic state over extended numbers of viral replication cycles. [0202] Another improvement may be that the expression of cytokine by the 30 recombinant virus may prevent the appearance of revertant viruses. - 58 - [0203] It will be appreciated by persons skilled in the art that numerous variations and/or modifications may be made to the invention as shown in the specific embodiments without departing from the spirit or scope of the present invention as broadly described. The present embodiments are, therefore, to be considered in all 5 respects as illustrative and not restrictive. [0204] In order that the invention may be readily understood and put into practical effect, particular preferred embodiments will now be described by way of the following non-limiting examples. - 59 - EXAMPLES EXAMPLE 1 CONSTRUCTING A RECOMBINANT HDV CAPABLE OF CO-EXPRESSING IFN-BETA [0205] Based on a well-characterized, 1.2-length cDNA clone of HDV 5 (Gudima et al. 2002, J Virol. 76(8):3709-19), a recombinant HDV was generated with a genome that is much longer than that of the wild-type virus (Figure 2). The new virus has been named rHDV-huIFNbeta-IRES-HDAg and contains a coding sequence for the human IFN-3 protein followed by the EMCV IRES, inserted downstream of the putative HDV promoter and immediately upstream of the hepatitis delta antigen 10 (HDAg) open reading frame. The inserted human IFN-3 coding sequence is based on the GenBank reference sequence NM_002176.2 but the sequence has been artificially edited to (i) increase the G/C content, i.e. 88 nucleotides in 78 codons have been edited to increase the G/C content from 45 to 60%; (ii) optimize codon usage; and (iii) destroy alter-native open reading frames. Furthermore, partially complementary, so-called 15 'stabilizing' sequences that 'mirror' the IFN coding and IRES sequence have been inserted into the genome to restore the 'rod-like' RNA secondary structure of the genome/ anti-genome that has been destroyed by the first insertion. Note that these sequences have also been artificially edited to (i) reduce complementarity (85 mismatches, 10 insertions, and 9 deletions); (ii) introduce 'Wobble' base-pairing; and 20 (iii) introduce a unique restriction site. Due to the editing of the IFN gene and any complementary sequence, the present inventors were not able to rely on 'conventional' cDNAs for the generation of recombinant HDVs; instead they employed in vitro gene synthesis to generate all inserts. [0206] The nucleotide sequence of rHDV-huIFNbeta-IRES-HDAg 25 comprises, consists or consists essentially of the sequence: [0207] cctgagccaagttccgagcgaggagacgcggggggaggatcagctcccgag aggggatgtcacggtaaagagcattggaacgtcggagaaactactcccaagaagcaaagagagg tcttaggaagcggacgagatccccacaacgccggagaatctctggaaggggaaagaggaaggtg gaagaaaaaggggcgggcctcccgatccgaggggcccaatcccagatctggagagcactccggc 30 ccgaagggttgagtagcactcagagggaggaatccactcggagatgagcagagaaatcacctcc agaggaccccttcagcgaacaagaggcgcttcgagcggtaggagtaagaccatagcgataggag gagatgctaggagtagggggagaccgaagcgaggaggaaagcaaagaaagcaacggggctagcc - 60 ggtgggtgttccgccccccgagaggggacgagtgaggcttatcccggggaactcgacttatcgt ccccatctagcgggaccccggacccccttcgaaagtgaccggagggggtgctgggaacaccggg gaccagtggagccatgggatgcccttcccgatgctcgattccgactccccccccaagggtcgcc caggaatggcgggaccccactctgcagggtccgcgttccatcctttcttacctgatggccggca 5 tggtcccagcctcctcgctggcgccggctgggcaacattccgaggggaccgtcccctcggtaat ggcgaatgggacccacaaatctctctagattccgatagagaatcgagagaaaagtggctctccc ttagccatccgagtggacgtgcgtcctccttcggatgcccaggtcggaccgcgaggaggtggag atgccatgccgacccgaagaggaaagaaggacgcgagacgcaaacctgtgagtggaaacccgct ttattcactggggtcgacaactctggggagaaaagggcggatcggctgggaagagtatatccta 10 tggaaatccctggtttcccctgatgtcagcccctccccggtccgagagaagggggactccggg actccctgcagattggggacgaagccgcccccgggcgctcccctcgatccaccttcgagggggt tcacacccccaaccggcgggccggctactcttctttcccttctctcgtcttcctcggtcaacct cctgagttcctcttcttcctccttgctgaggttcttgcctcccgccgatagctgcttcttcttg ttctcgagggccttccttcgtcggtgatcctgcctctccttgtcggtgaatcctcccctgagag 15 gcctcttcccaggtccggagtctacctccatctggtccgttgggccctcttgccgggggagc cccctctccatccttatccttctttccgagaattcctttgatgttccccagccagggattttcg tcctctatcttcttgagtttcttctttgtcttccggaggtctctctcgagttcctctaacttct ttcttccggccacccactgctcgaggatctcttctctccctccgcggttcttcctcgactcgga ccggctcatggtattatcgtgtttttcaaaggaaaaccacgtccccgtggttcggggggcctag 20 acgttttttaacctcgactaaacacatgtaaagcatgtgcaccgaggccccagatcagatccca tacaatggggtaccttctgggcatccttcagccccttgttgaatacgcttgaggagagccattt gactctttccacaactatccaactcacaacgtggcactggggttgtgccgcctttgcaggtgta tcttatacacgtggcttttggccgcagaggcacctgtcgccaggtggggggttccgctgcctgc aaagggtcgctacagacgttgtttgtcttcaagaagcttccagaggaactgcttccttcacgac 25 attcaacagaccttgcattcctttgggagaggggaaagacccctaggaatgctcgtcaagaag acagggccaggtttccgggccctcacattgccaaaagacggcaatatggtggaaaataactcag ttccggaggtaaccggtcagccggttgatgaagtagaagttccgcaggatctccacccggacga tggtccaggcgcagtgt gagtactccttggcct tcaggtagtgcaggatccgcccgtagtaccg cttcaggtgcaggctgctcatgagcttgccccgggtgaagtcctccttctccagcttctcctcc 30 aggacggtcttcaggtggttgatctggtggtagacgttggccaggaggttctccacgatggtct cgttccagccggtgctagagctgtcctgccggaagatggcgaagatgttctggagcatctcgta gatggtcagggcggcgtcctccttctggaactgctgcagctgcttgatctcctcggggatgtcg aagttcatcctgtccttgaggcagtactccagccgcccgttcagctgccacaggagcttctggc actggaagttgctgctccgctgcaggaagcccagcaggttgtagctcatggacagggcggtggt 35 ggagaagcacagcaggagggcgatctggaggaggcacttgttggtcatctcggctagaggcggc agtcctcagtactcttactcttttctgtaaagaggagactgctggactcgccgcccgagcccga gcctgaccaacacgtgccagcctccagaaggccctcctgccctgctcaccaccaccgcattgtc -61catgaggaacaacctgcagggctccgacagcggagctgcaact tccacagccagagcct cctgc ggcagcgagaacgggcggacggagtgcacgcctcaagatcaggatgcacttcgtcgtccccgtg gagatcctgcagctgctgcggcctgaaggtggacgccgccgagaccatcctacgagcagctcca gaactacttcgccatcgcaccggcaggtgagctctagcgcggctggtgcgagaccttcgtggag 5 tccctcctggcctcgtctaccaccagcacgaccacctgacgtccgtcctggcgagaagctggag ctggaggacaacacccggaaggcaagcacgtgagcccctgcaccaagagcggtactcagggcgg aatccaccactaccaccaggccaagcgagtacagcctcgcgcctggacgtacgtccgggaggag atccaagcggaacttcaccttcatcctccggctgaccggaaacctccggcactgagttactttc caccatatgccgtctggtggcaatgtgacgggcccggtcgcctggccctgcgcttcttgccggg 10 catacctaggggtcgaacccctctcgccgaaggatcgcaaggtctgcggaatgtcgtgggaag cagaccctctggaagccgcttgaagacacccaacgtctgtcggcgaccctgcgcaggggcggc tccccccagcctggcgacaggcgcctcagcggccgcgccacgtgactaagatacacctgcgctg gcggcacgcaccccagtgcccgttgtgagttggcgagttgtggctggagtcaacatggcactc ct cctgcgtatt caactcggggctgt cggatgcccagctggtaccccgcgtatgggat ctgcgc 15 tggggcctcggagcacatgcttgccatgtgttacgtcgaggttagaaaacgtcgcggccccccg ctccacgcggacgtggttcgtcctttgaattacacgataatgcc [SEQ ID NO:2]; [0208] wherein: [0209] Corrected* genomic (-) HDV sequence as set forth in SEQ ID NO: 1 is shown in black; 20 [0210] + IIFN-beta coding sequence is shown in gray italics; [0211] + IFN-beta complementary sequence is shown in gray bold italics; [0212] + EMCV IRES sequence is shown in black bold typeface; [0213] + EMCV IRES complementary sequence is shown in black shadow typeface. 25 [0214] The present inventors have extensively modeled the consequences of large insertions into the wild-type HDV genome in silico by using RNAfold, a minimum free energy RNA structure prediction program (University of Vienna, Austria; http://ma.tbi.univie.ac.at). They found that an insertion of the IFN coding sequence alone destabilizes the 'rod-like' structure of the HDV genome with structural 30 implications that reach into the putative promoter region (Figure 3b), a phenomenon that can be reversed with the introduction of partially complementary, 'stabilizing' sequences (Figure 3c). Even the introduction of the EMCV IRES, a sequences capable of forming a sophisticated RNA secondary structures on its own, did not destroy the - 62 - 'rod-like' structure of the HDV genome when a practically complementary, 'stabilizing' sequence was inserted at the opposite site of the 'rod' (Figure 3d). EXAMPLE 2 EVIDENCE FOR REPLICATION COMPETENCY OF THE NEWLY GENERATED rHDV 5 huIFNbeta-IRES-HDAg [0215] The present inventors also conducted a series of experiments in which they transfected cultured (COS) cells with eukaryotic expression plasmids encoding a 1.2-length cDNA clone of rHDVIFNbeta-IRES-HDAg and helper plasmids that provide small amounts of the HDAg in trans. Total RNA was isolated at several times post 10 transfection, cDNA was synthesized using an genomic-specific primer and then analyzed for HDV RNA by PCR using a primer pair that amplifies a product encompassing the insertion site for the IFN coding and IRES sequence. The results shown in Figure 4 indicate that rHDVIFNbeta-IRES-HDAg indeed replicates. The present inventors have repeated the experiments with different primers and analyzed 15 different time points, which has revealed that specific bands can be amplified at day 6 and day 9 but disappear later (data not shown) a finding that is in line with the intracellular replication pattern of the wild-type HDV genome. [0216] Taken together, these studies indicate that it is possible to manipulate the HDV genome in order to express a gene of interest. This newly developed 20 technology will transform HDV into a superior gene delivery vehicle for example for the liver. Furthermore a recombinant, live-attenuated HDV co-expressing IFN-3 (or other antiviral/ immune-modulatory cytokines) could be utilized as a therapeutic vaccine to treat chronic hepatitis B. EXAMPLE 3 25 ALTERNATE IRES-EMPLOYING RECOMBINANT HDV CONSTRUCT [0217] An alternative strategy for insertion and expression of heterologous nucleotide sequences in HDV is shown in Figure 5, which illustrates a schematic representation of the construct rHDV-HDAg-IRES-huIFNbeta. In this construct, an IRES sequence followed by the human IFN-3 sequence is inserted downstream of the 30 HDAg open reading frame and before the poly A signal. - 63 - [0218] The nucleotide sequence of rHDV-HDAg-IRES-huIFNbeta comprises, consists or consists essentially of the sequence: [0219] cctgagccaagttccgagcgaggagacgcggggggaggatcagctcccgag aggggatgtcacggtaaagagcattggaacgtcggagaaactactcccaagaagcaaagagagg 5 tcttaggaagcggacgagatccccacaacgccggagaatctctggaaggggaaagaggaaggtg gaagaaaaaggggcgggcctcccgatccgaggggcccaatcccagatctggagagcactccggc ccgaagggttgagtagcactcagagggaggaatccactcggagatgagcagagaaatcacctcc agaggaccccttcagcgaacaagaggcgcttcgagcggtaggagtaagaccatagcgataggag gagatgctaggagtagggggagaccgaagcgaggaggaaagcaaagaaagcaacggggctagcc 10 ggtgggtgttccgccccccgagaggggacgagtgaggcttatcccggggaactcgacttatcgt ccccatctagcgggaccccggacccccttcgaaagtgaccggagggggtgctgggaacaccggg gaccagtggagccatgggatgcccttcccgatgctcgattccgactccccccccaagggtcgcc ccatcgatcgttactttccaccatatgccgtctggtggcaatgtgacgggcccggtcgcctggc cctgcgcttcttgccgggcatacctaggggtcgaacccctctcgccgaaggatcgcaaggtctg 15 cggaatgtcgtgcggaagcagaccctctggaagccgcttgaagacacccaacgtctgtcggcga ccctgcgcaggcggcggctccccccagcctggcgacaggcgcctcagcggcccggccacgtgac taagatacacctgcgctggcggcacgcaccccagtgccccgttgtgagttggcgagttgtggct ggagtcaacatggcactcctcctgcgtattcaactcggggctgtcggatgcccagctggtaccc cgcgtatgggatctgcgctggggcctcggagcacatgcttgccatgtgttacgtcgaggttaga 20 aaacgtcgcggccccccgctccacgcggacgtggttcgtcctttgaattacacgataatgcccc tgaccaacacgtgccagcctccagaaggccctcctgccctgctcaccaccaccgcattgtccat gaggaacaacctgcagggctccgacagcggagctgcaacttccacagccagagcctcctgcggc agcgagaacgggcggacggagtgcacgcctcaagatcaggatgcacttcgtcgtccccgtggag atcctgcagctgctgcggcctgaaggtggacgccgccgagaccatcctacgagcagctccagaa 25 ctacttcgccatcgcaccggcaggtgagctctagcgcggctggtgcgagaccttcgtggagtcc ctcctggcctcgtctaccaccagcacgaccacctgacgtccgtcctggcgagaagctggagctg gaggacaacacccggaaggcaagcaggtgagcccctgcaccaagagcggtactcagggcggaat tcaccactaccaccaggccaagcgagtacagcctcgcgcctggacgtacgtccgggaggagatc caagcggaacttcaccttcatcctccggctgaccggaaacctccggcaacgatcggtggcggga 30 ccccactctgcagggtccgcgttccatcctttcttacctgatggccggcatggtcccagcctcc tcgctggcgccggctgggcaacattccgaggggaccgtcccctcggtaatggcgaatgggaccc acaaatctctctagattccgatagagaatcgagagaaaagtggctctcccttagccatccgagt ggacgtgcgtcctccttcggatgcccaggtcggaccgcgaggaggtggagatgccatgccgacc cgaagaggaaagaaggacgcgagacgcaaacctgtgagtggaaacccgctttattgatcagttc 35 cggaggtaaccggtcagccggttgatgaagtagaagttccgcaggatctccacccggacgatgg tccaggcgcagtgtgagtactccttggccttcaggtagtgcagaatccgcccgtagtaccgctt - 64 caggtgcaggctgctcatcagcttgccccgggtgaagtcctccttctccagcttctcctccagg acggtcttcaggtggttgatctggtggtagacgttggccaggaggttctccacgatggtctcgt tccagccggtgctagagctgtcctgccggaagatggcgaagatgttctggagcatctcgtagat ggtcagggcggcgtcctccttctggaactgctgcagctgcttgatctcctcggggatgtcgaag 5 ttcatcctgtccttgaggcagtactccagccgcccgttcagctgccacaggagcttctggcact ggaagttgctgctccgctgcaggaagcccagcaggttgtagctcatggacagggcggtggtgga gaagcacagcaggagggcgatctggaggaggcacttgttggtcatggtattatcgtgtttttca aaggaaaaccacgtccccgtggttcggggggcctagacgttttttaacctcgactaaacacatg taaagcatgtgcaccgaggccccagatcagatcccatacaatggggtaccttctgggcatcctt 10 cagccccttgttgaatacgcttgaggagagccatttgactctttccacaactatccaactcaca acgtggcactggggttgtgccgcctttgcaggtgtatcttatacacgtggcttttggccgcaga ggcacctgtcgccaggtggggggttccgctgcctgcaaagggtcgtacagacgttgtttgtct tcaagaagcttccagaggaactgcttccttcacgacattcaacagaccttgcattcctttggcg agaggggaaagacccctaggaatgct cgtcaagaagacagggccaggttt ccgggccctcacat 15 tgccaaaagacggcaatatggtggaaaataactgatcatgactggggtcgacaactctggggag aaaagggcggatcggctgggaagagtatatcctatggaaatccctggtttcccctgatgtccag cccctccccggtccgagagaagggggactccgggactccctgcagattggggacgaagccgccc ccgggcgctcccctcgatccaccttcgagggggttcacacccccaaccggcgggccggctactc ttctttcccttctctcgtttcctcggtcaacctcctgagttcctcttcttcctccttgctgag 20 gttcttgcctcccgccgatagctgcttcttcttgttctcgagggccttccttcgtcggtgatcc tgcctctccttgtcggtgaatcctcccctgagaggcctcttcccaggtccggagtctacctcca tctggtccgttcgggccctcttcgccgggggagccccctctccatccttatccttctttccgag aattcctttgatgttccccagccagggattttcgtcctctatcttcttgagtttcttctttgtc ttccggaggtctctctcgagttcctctaacttctttcttccggccacccactgctcgaggatct 25 cttctctccctccgcggttttcctcgactggaccggctcatctcggtagaggggcagtcc tcagtactcttactcttttctgtaaagaggagactgtggactcgccgcccgagcccgag (SEQ ID NO:3]; [0220] wherein: [0221] Corrected* genomic (-) HDV sequence as set forth in SEQ ID NO: 1 is 30 shown in black; [0222] + IFN-beta coding sequence is shown in gray bold italics; [0223] + IFN-beta complementary sequence is shown in gray italics; [0224] + EMCV IRES sequence is shown in black shadow typeface; - 65 - [0225] + EMCV IRES complementary sequence is shown in black bold typeface. EXAMPLE 4 RECOMBINANT HDV CONSTRUCT EMPLOYING SELF-CLEAVING PEPTIDE 5 [0226] An alternative strategy for insertion and expression of heterologous sequences in HDV is shown in Figure 6, which illustrates a schematic representation of the construct rHDV-HDAg-2A-huIFNbeta. In this example, the recombinant HDV genome is capable of expressing a gene of interest but that does not feature an IRES sequence. Instead, a picornavirus '2A-like' motif is inserted in-frame between the 10 HDAg and the IFN-3 coding sequence, creating rHDV-HDAg-2A-huIFNbeta (Figure 5). The insertion of a '2A-like' motif allows the expression of two or more proteins from a single open reading frame (de Felipe et al., 2006, Trends Biotechnol. 24(2):68 75) by a translational recoding event in which a peptide bond is 'skipped' during elongation (Doronina et al., 2008, supra). Since the function of the '2A-like' motif is 15 believed to be mediated by amino acids rather than the coding sequence, the G/C content of rHDV-HDAg-2A-huIFNbeta can be fully controlled, i.e., all artificially inserted sequences can be edited to match G/C levels found in the wild-type HDV backbone. Another advantage of using a '2A-like' sequence element is that these elements are relatively short. For example a particular '2A-like' sequence disclosed by 20 Osborne et al., (2005, Mol Ther 12: 569-574) comprises only 63 nts. As a consequence, rHDV-HDAg-2A-huIFNbeta is much smaller than the other two recombinant genomes, which may enhance efficient packaging of recombinant HDV genomes. EXAMPLE 5 RECOMBINANT HDV CONSTRUCT WHERE INSERTION IS DOWNSTREAM OF THE 25 RIBOZYME [0227] Another strategy for insertion and expression of heterologous nucleotide sequences in HDV is shown in Figure 7, which illustrates a schematic representation of the construct rHDV-HDAg-ribo-insertion. In this construct, an heterologous nucleotide sequence of interest, which comprises a coding sequence (e.g., 30 IFN-3 coding sequence) is inserted downstream of the ribozyme and upstream of the 'tip' of the rod. - 66 - [0228] The disclosure of every patent, patent application, and publication cited herein is hereby incorporated herein by reference in its entirety. [0229] The citation of any reference herein should not be construed as an admission that such reference is available as "Prior Art" to the instant application. 5 [0230] Throughout the specification the aim has been to describe the preferred embodiments of the invention without limiting the invention to any one embodiment or specific collection of features. Those of skill in the art will therefore appreciate that, in light of the instant disclosure, various modifications and changes can be made in the particular embodiments exemplified without departing from the scope of 10 the present invention. All such modifications and changes are intended to be included within the scope of the appended claims. - 67 -

Claims

1. A recombinant single-stranded, circular hepatitis delta virus (HDV) RNA genome, which comprises in operable connection: a promoter; an open reading frame (ORF) for a hepatitis delta antigen (HDAg); a polyadenylation signal; and a HDV 5 ribozyme, wherein the genome comprises substantially complementary portions conferring a rod-like secondary structure, the genome characterized in that it comprises at a first site a first heterologous nucleotide sequence and at a second site a second heterologous nucleotide sequence that is substantially complementary to the first heterologous nucleotide sequence wherein the first and second sites are spaced from 10 each other to permit annealing between the first and second heterologous nucleotide sequences.

2. A recombinant single-stranded, circular hepatitis delta virus (HDV) RNA genome comprising a first portion and a second portion, wherein the first portion comprises in operable connection: (1) a promoter; (2) an open reading frame (ORF) for 15 a hepatitis delta antigen (HDAg); (3) a polyadenylation signal; (4) a HDV ribozyme; and (5) a first heterologous nucleotide sequence, and wherein the second portion is substantially complementary to the first portion so as to permit annealing between the portions.

3. A recombinant single-stranded, circular hepatitis delta virus (HDV) RNA 20 genome comprising a first portion and a second portion, wherein the first portion comprises in operable connection: (1) a promoter; (2) an open reading frame (ORF) for a hepatitis delta antigen (HDAg); (3) a polyadenylation signal; (4) a HDV ribozyme; and (5) a first heterologous nucleotide sequence, and wherein the second portion is substantially complementary to the first portion so as to permit annealing between the 25 portions and to confer a rod-like secondary structure to the genome.

4. A recombinant genome according to claim 2 or claim 3, wherein the second portion comprises a second heterologous nucleotide sequence that is substantially complementary to the first heterologous nucleotide sequence to permit annealing between the first and second heterologous nucleotide sequences. 30

5. A recombinant genome according to any one of claims 1 to 4, wherein the first heterologous nucleotide sequence is located downstream of the promoter and upstream of the ORF. - 68 -

6. A recombinant genome according to claim 5, wherein the first heterologous nucleotide sequence comprises a coding sequence for an exogenous polypeptide, which is operably connected to the promoter, and an internal ribosome entry site (IRES) that is operably connected to the ORF. 5

7. A recombinant genome according to any one of claims 1 to 4, wherein the first heterologous nucleotide sequence is located downstream of the ORF.

8. A recombinant genome according to claim 7, wherein the first heterologous nucleotide sequence is located upstream of the polyadenylation site.

9. A recombinant genome according to claim 8, wherein the first heterologous 10 nucleotide sequence comprises an internal ribosome entry site (IRES) operably connected to a coding sequence for an exogenous polypeptide.

10. A recombinant genome according to any one of claims 5, 7 or 8, wherein the first heterologous nucleotide sequence comprises a first coding sequence for an exogenous polypeptide and a second coding sequence for a proteolytic cleavage site, 15 wherein the first and second coding sequences are in frame with each other and with the ORF to thereby encode a precursor polypeptide, wherein the proteolytic cleavage site is positioned between the exogenous polypeptide and the HDAg in the precursor polypeptide to facilitate release of the exogenous polypeptide upon proteolytic cleavage of the proteolytic cleavage site. 20

11. A recombinant genome according to any one of claims 5, 7 or 8, wherein the first heterologous nucleotide sequence comprises a first coding sequence for an exogenous polypeptide and a second coding sequence for a self-cleaving, wherein the first and second coding sequences are in frame with each other and with the ORF.

12. A recombinant genome according to claim 10 or claim 11, wherein the first 25 heterologous nucleotide sequence is located downstream of the promoter and upstream of the ORF, and wherein the second coding sequence is downstream of the first coding sequence and upstream of the ORF.

13. A recombinant genome according to claim 10 or claim 11, wherein the first heterologous nucleotide sequence is located downstream of the ORF, and wherein the 30 second coding sequence is upstream of the first coding sequence and downstream of the ORF.

14. A recombinant genome according to any one of claims 1 to 4, wherein the first heterologous nucleotide sequence is located downstream of the HDV ribozyme. - 69 -

15. A recombinant genome according to claim 14, wherein the first heterologous nucleotide sequence is operably connected to another promoter.

16. A recombinant genome according to any one of claims 1 and 4 to 15, wherein the first heterologous nucleotide sequence has a G/C nucleotide content of 5 about 55-65%.

17. A recombinant genome according to any preceding claim, wherein the first heterologous nucleotide sequence has a G/C nucleotide content of about 60%.

18. A recombinant genome according to any preceding claim, wherein the first heterologous nucleotide sequence has at least about 50% (and at least 51% to at least 10 99% and all integer percentages in between) sequence identity to the second heterologous nucleotide sequence.

19. A recombinant genome according to any preceding claim, wherein the first heterologous nucleotide sequence comprises a coding sequence for an exogenous polypeptide, wherein the exogenous polypeptide is a cytokine. 15

20. A recombinant genome according to claim 19, wherein the cytokine attenuates the HDV.

21. A recombinant genome according to claim 19 or claim 20, wherein the cytokine is an interferon (IFN).

22. A recombinant genome according to any one of claims 19 to 21, wherein 20 the cytokine is a type I IFN.

23. A recombinant genome according to claim 23, wherein the cytokine is IFN P:.

24. A recombinant genome according to any one of claims 1 to 18, wherein the first heterologous nucleotide sequence comprises a coding sequence for an exogenous 25 polypeptide, and wherein the exogenous polypeptide is selected from a polypeptide of a pathogenic organism, an alloantigen, an autoantigen, a cancer or tumor antigen or any other polypeptide that has therapeutic activity.

25. A recombinant genome according to any preceding claim, wherein the first heterologous nucleotide sequence comprises a coding sequence for an exogenous 30 polypeptide, and wherein the coding sequence further comprises a nucleotide sequence encoding a signal peptide for transit of the exogenous polypeptide to a particular cellular compartment or into an extracellular environment. - 70 -

26. A recombinant genome according to claim 25, wherein the nucleotide sequence encoding the signal peptide is positioned upstream of the coding sequence for the exogenous polypeptide.

27. A recombinant genome according to claim 25, wherein the signal peptide 5 directs translocation of the exogenous polypeptide across an endoplasmic reticulum (ER) membrane within a host cell infected by the virus.

28. A recombinant genome according to any preceding claim, wherein the first heterologous nucleotide sequence comprises a coding sequence for an exogenous polypeptide, and wherein the exogenous polypeptide is exported to the host cell surface, 10 presented on the cell surface as a peptide with a major histocompatibility antigen, secreted from the cell, or remains in the cytoplasm of the cell.

29. A recombinant genome according to any one of claims 1 to 4, wherein the first heterologous nucleotide sequence comprises a nucleotide sequence that is only transcribed into RNA. 15

30. A nucleic acid molecule comprising a sequence corresponding to the recombinant genome of any preceding claim or to an antigenome thereof.

31. A vector comprising the nucleic acid molecule of claim 30.

32. A recombinant hepatitis delta virus (HDV) comprising the genome of any one of claims 1 to 29. 20

33. A pharmaceutical composition comprising a recombinant HDV according to claim 32, and a pharmaceutically acceptable excipient, diluent or carrier.

34. An immunomodulating composition comprising a recombinant HDV according to claim 32, and optionally an adjuvant or immunostimulant.

35. A method for eliciting an immune response to a hepatitis delta virus (HDV) 25 in a subject, the method comprising administering to the subject an effective amount of a recombinant HDV according to claim 32 so as to elicit an immune response to the HDV.

36. A method for treating or preventing a hepatitis delta virus (HDV) infection in a subject, the method comprising administering an effective amount of a recombinant 30 HDV according to claim 32 to the subject.

37. A recombinant hepatitis delta virus (HDV) according to claim 32, or a composition according to claim 33 or claim 34, for use in inducing an immune response to a HDV in a subject. -71 -

38. A method for eliciting an immune response to an exogenous polypeptide in a subject, the method comprising administering a recombinant hepatitis delta virus (HDV) according to claim 32 to the subject so as to elicit an immune response to the exogenous polypeptide. 5

39. A method according to claim 38, wherein the exogenous polypeptide is an antigen of the subject or an antigen of a microorganism.

40. A recombinant hepatitis delta virus (HDV) according to claim 32, or a composition according to claim 33 or claim 34, for use in preventing or treating an infection by a pathogen in a subject. 10

41. A method for delivering an exogenous polypeptide having therapeutic activity to a subject, the method comprising administering a hepatitis delta virus (HDV) according to claim 32 to the subject, whereby the exogenous polypeptide is produced in a host cell of the subject.

42. A method according to claim 41, wherein the host cell is a hepatocyte. 15

43. A method according to claim 41 or claim 42, wherein the therapeutic polypeptide remains inside the cell.

44. A method according to claim 41 or claim 42, wherein the therapeutic polypeptide becomes associated with a cell membrane.

45. A method according to claim 41 or claim 42, wherein the therapeutic 20 polypeptide is secreted from the cell.

46. A method for producing an exogenous polypeptide in a host cell (e.g., a vertebrate host cell), the method comprising contacting a susceptible host cell with a recombinant hepatitis delta virus (HDV) according to claim 32, wherein the first heterologous nucleotide sequence comprises a coding sequence for the exogenous 25 polypeptide, and culturing the host cell for a period of time to allow production of the exogenous polypeptide by the host cell.

47. A method according to claim 46, further comprising purifying the exogenous polypeptide.

48. A method for producing a recombinant single-stranded, circular hepatitis 30 delta virus (HDV) RNA genome, the method comprising: providing a parent single stranded, circular HDV RNA genome, which comprises in operable connection: a promoter; an open reading frame (ORF) for a hepatitis delta antigen (HDAg); a polyadenylation signal; and a HDV ribozyme, and which has substantially - 72 - complementary portions that anneal to one another and confer a rod-like secondary structure on the parent genome, and inserting into the parent genome at a first site a first heterologous nucleotide sequence and at a second site a second heterologous nucleotide sequence that is substantially complementary to the first heterologous nucleotide 5 sequence to form the recombinant HDV genome, wherein the first and second sites are spaced from each other in the recombinant genome to permit annealing between the first and second heterologous nucleotide sequences.

49. A method according to claim 48, comprising inserting the first and second heterologous nucleotide sequences such that they do not interfere or impair annealing of 10 the complementary portions of the parent genome.

50. A method according to claim 48 or claim 49, comprising inserting the first heterologous nucleotide sequence downstream of the promoter and upstream of the ORF and inserting the second heterologous nucleotide sequence downstream of the nucleotide sequence of the parent genome that is substantially complementary and 15 anneals to the ORF and upstream of the nucleotide sequence of the parent genome that is substantially complementary and anneals to the promoter.

51. A method according to claim 48 or claim 49, comprising inserting the first heterologous nucleotide sequence downstream of the ORF and upstream of the polyadenylation signal and inserting the second heterologous nucleotide sequence 20 downstream of the nucleotide sequence of the parent genome that is substantially complementary and anneals to the polyadenylation signal and upstream of the nucleotide sequence of the parent genome that is substantially complementary and anneals to the ORF.

52. A method according to claim 48 or claim 49, comprising inserting the first 25 heterologous nucleotide sequence downstream of the ribozyme and upstream of portions of the parent genome that are substantially complementary and anneal to each other and inserting the second heterologous nucleotide sequence downstream of those portions and upstream of the nucleotide sequence of the parent genome that is substantially complementary and anneals to the ribozyme. 30

53. A method according to any one of claims 48 to 53, wherein the first heterologous nucleotide sequence has at least 70% sequence identity to the second heterologous nucleotide sequence. - 73 -

54. A method according to any one of claims 48 to 54, further comprising modifying the G/C content of the first and second heterologous nucleotide sequences to substantially accord with the G/C content of the parent genome.

55. A method according to claim 54, wherein the first and second heterologous 5 nucleotide sequences have a G/C nucleotide content of between about 55% to about 65%.

56. A method according to claim 54, wherein the first and second heterologous nucleotide sequences have a G/C nucleotide content of about 60%.

57. A method for treating or preventing a hepatitis infection in a subject, the 10 method comprising, consisting or consisting essentially of administering an effective amount of a recombinant HDV according to claim 32, wherein the first heterologous nucleotide sequence comprises a coding sequence for a cytokine.

58. A method according to claim 57, wherein the cytokine is an interferon.

59. A method according to claim 57, wherein the cytokine is an interferon is 15 selected from a type I IFN, a type II IFN or a type III IFN.

60. A method according to claim 59, wherein the a type I IFN is IFN-a or IFN - 74 -