AU2013201267A1 - Anti-bacterial vaccine compositions - Google Patents

Abstract

An attenuated Pasteurellaceae bacterium obtained by a method comprising: a) mutating a Pasteurellaceae bacterium that comprises an exbB gene that encodes an amino acid sequence that is at least 70% identical to an exbB amino acid sequence selected from the group consisting of SEQ ID NO: 14 and SEQ ID NO: 141, wherein the mutating comprises performing mutagenesis to the nucleotide sequence of an exbB gene of said bacteria; b) screening the mutated bacterium for decreased virulence compared to virulence of the unmutated bacterium; and c) selecting as an attenuated bacterium a mutated bacterium with decreased virulence.

Description

AUSTRALIA Patents Act COMPLETE SPECIFICATION (ORIGINAL) Class Int. Class Application Number: Lodged: Complete Specification Lodged: Accepted: Published: Priority Related Art: Name of Applicant: PAH P&U LLC Actual Inventor(s): David E Lowery, Michael J Kennedy, Troy E Fuller Address for Service and Correspondence: PHILLIPS ORMONDE FITZPATRICK Patent and Trade Mark Attorneys 367 Collins Street Melbourne 3000 AUSTRALIA Invention Title: ANTI-BACTERIAL VACCINE COMPOSITIONS Our Ref: 963999 POF Code: 466282/285890 The following statement is a full description of this invention, including the best method of performing it known to applicant(s): -1- ANTI-BACTERIAL VACCINE COMPOSITIONS The present application is a divisional application from Australian Patent Application No. 2010201539, which is, in turn, a divisional application from Australian Patent Application No. 2007242960, which is, in turn, a divisional application from Australian Patent Application No. 2005203187, which is, in turn, a divisional application from Australian Patent Application No. 40776/00 (Serial No. 780887), the entire disclosures of which are incorporated herein by reference. FIELD OF THE INVENTION The present invention relates generally to the identification of genes responsible for virulence of Pasteurella multocida and Actinobacillus 10 pleuropneumoniae bacteria, thereby allowing for production of novel attenuated mutant strains useful in vaccines and identification of new anti-bacterial agents that target the virulence genes and their products. BACKGROUND OF THE INVENTION The family Pasteurellaceae encompasses several significant pathogens that infect a wide variety of animals. In addition to P: nultocida, prominent members of the family include Pasteurella haemolytica, Actinobacilius pleuropneunoniae and Haemophilus soinnus. P. multocida is a gram-negative, nonmotile coccobacillus which is found in the normal flora of many wild and domestic animals and is known to cause disease in numerous animal species worldwide [Biberstein, In M. Kilian, W. Frederickson, and E.L. Biberstein (ed.), Haemophilus, Pasteureila, and Actinobacillus. Academic Press, London, p.

6 1-73 (1981)]. The disease manifestations following infection include septicemias, bronchopneumonias, rhinitis, and wound infections [Reviewed in Shewen, et al, In C.L. Gyles and C.O. Thoen (ed.), Pathogenesis of Bacterial Infections in Animals. Iowa State University Press, Ames, p.216 225 (1993), incorporated herein by reference]. Infection by P. nultocida generally results from invasion during periods of stress, but transmission may also occur by aerosol or contact exposure, or via flea and tick vectors. In fowl, P. multocida infection gives rise to acute to peracute septicemia, particularly prevalent in domestic turkeys and wild waterfowl under stress conditions associated with overcrowding, laying, molting, or severe climatic change. In cattle, a similar hemorrhagic septicemia follows infection and manifests conditions including high fever and depression, generally followed by quick death. Transmission is most likely through aerosol contact, but infection can also arise during periods of significant climatic change. In rabbits, infection gives rise to recurring purulent rhinitis, generally followed by conjunctivitis, otitis media, sinusitis, subcutaneous abscesses, and chronic

IA

bronchopneumonia. In severe infections, rabbit mortality arises from acute fibrinous bronchopneumonia, septicemia. or endotoxemia. Disease states normally arise during periods of stress. In pigs, common P. mudhocida disease states include atrophic rhinitis and bacterial pneumonia. Similar pneumonia conditions are also detected in dogs, cats, 5 goats, and sheep. P. muliocida is commonly detected in oral flora of many animals and is therefore a common contaminant in bite and scratch wounds. P..multocida strains are normally designated by capsular serogroup and somatic serotype. Five capsular serogroups (A, B, D, E, and F) and 16 somatic serotypes are distinguished by expression of characteristic heat-stable antigens. Most strains are 10 host specific and rarely infect more than one or two animals. The existence of different serotypes presents a problem for vaccination because traditional killed whole cell bacteria normally provide only serotype-specific protection. H however, it has been demonstrated that natural infection with one serotype can lead to immunological protection against multiple serotypes [Shewen, et al., In C. L. Gyles and C. 0. Thoen (Ed.). Pathogenesis 15 of Bacterial Infections in Animals. Iowa State University Press, Ames, p. 216-225 (1993)] and cross protection can also be stimulated by using inactivated bacteria grown in vivo [Rimler, et al., Am J Vet Res. 42:2117-2121 (1981)). One live spontaneous mutantP. multocida strain has been utilized as a vaccine and has been shown to stimulate a strong immune response [Davis, Poultrv Digest. 20:430-434 (1987), Schlink, et al, 20 Avian Dis. 31(1):13-21 (1987)). This attenuated strain, however, has been shown to revert to a virulent state or cause mortality if the vaccine recipient is stressed [Davis, Poulny Digest. 20:430-434 (1987), Schlink, et al., Avian Dis. 31(1):13-21 (1987)]. Another member of the Pasteurella family, A.pleuropneumoniae exhibits strict host specificity for swine and is the causative agent of highly contagious porcine 25 pleuropneumonia. Infection normally arises in intensive breeding conditions, and is believed to occur by a direct mode of transmission. The disease is often fatal and, as a result, leads to severe economic loss in the swine producing industry. A. pleuropneumoniae infection may be chronic or acute, and infection is characterized by a hemorrhagic, necrotic bronchopneumonia with accompanying fibrinous pleuritis. To 30 date, bacterial virulence has been attributed to structural proteins, including serotype specific capsular polysaccharides, lipopolysaccharides, and surface proteins, as well as extracellular cytolytic toxins. Despite purification and, in some instances cloning. of these virulence factors. the exact role of these virulence factors in A. pleuropnelioniae infection is poorly understood. Twelve serotypes of A. pleuropneunoniae have been identified based on 5 antigenic differences in capsular polysaccharides and production of extracellular toxins. Serotypes 1, 5, and 7 are most relevant to A. pleuropneumoniae infection in the United States, while serotypes 1, 2, 5, 7, and 9 are predominant in Europe. There are at least three significant extracellular toxins of A. pleuropneumoniae that are members of the haemolysin family and are referred to as RTX toxins. RTX toxins are produced by many 10 Gram negative bacteria, including E. coli, Prozeus vulgarisa, and Pasieurella haemolVtica, and the proteins generally share structural and functional characteristics. Toxins from the various serotypes differ, however, in host specificity, target cells, and biological activities. The major A. pleuropneumoniae RTX toxins include ApxJ, ApxIl, and 15 ApxIl. ApxI and ApxUl have haemolytic activity, with ApxI being more potent. Apxll shows no haemolytic activity, but is cytotoxic for alveolar macrophages and neutrophils. Most A. pleuropneumoniae serotypes produce two of these three toxins. For example, serotypes 1, 5, 9, and 1I express Apxl and ApxIl, and serotypes 2, 3, 4, 6, and 8 express ApxII and ApxIU. Serotype 10, however, produces only ApxI, and serotypes 7 and 12 20 express only Apxfl. Those A. pleuropneumoniae serotypes that produce both ApxI and ApxU are the most virulent strains of the bacteria. The Apx toxins were demonstrated to be virulence factors in murine models and swine infection using randomly mutated wild type bacteria [Tascon, et aL.. Mol. Microbiol. 14:207-216 (1994)]. Other A. pleuropneumoniae mutants have also been 25 generated with targeted mutagenesis to inactivate the gene encoding the AopA outer membrane virulence protein [Mulks and Buysee, Gene 165:61-66 (1995)]. In attempts to produce vaccine compositions, traditional killed whole cell bacteria have provided only serotype-specific protection [MacInnes and Smart, supra], however, it has been demonstrated that natural infection with a highly virulent serotype 30 can stimulate strong protective immunity against multiple serotypes [Nielsen, Nord Vet Med. 31:407-13 (1 9 79 ), Nielsen, Nord Pet Med. 36:221-234 (1984), Nielsen, Can J Vet 3 Res. 29:580-582 (1988). Ni elsen. A CTA Vet Scand. 1.5:80-89(1994)]. One defined live attenuated vaccine strain producing an inactive fomi of the ApxlI toxin has shown promise for cross protection in swine [Prideaux, et al.. Infection & nnmnity 67:1962 1966 (1999)], while other undefined live-attenuated mutants have also shown promise 5 [lnzana, et a/., InfectImnnun. 61:1682-6, (1993), Paltineanu. et al.. In International Pig Veterinary Society, 1992, p. 214, Utrera, et al.. In International Pig Veterinary Society, 1992, p. 213]. Because of the problems associated with vaccine formulations comprising bacterial strains with undefined, spontaneous mutations, there exists a need in the an for 10 rational construction of live attenuated bacterial strains for use in vaccines that will safely stimulate protective immunity against homologous and heterologous P. mzultocida and A. pleuropneumoniae serotypes. There further exists a need to identify attenuated bacterial strains and genes required for bacterial virulence, thereby facilitating development of methods to identify anti-bacterial agents. 15 SUMMARY OF THE INVENTION In general, the present invention provides materials and methods for production and use of vaccine compositions comprising attenuated gram negative bacteria. In one aspect, vaccine compositions of the invention comprise attenuated 20 species in the Pasteurellaceae family of bacteria, which is known in the art and described, in part, in Dewhirst, et aL., J. Bacieriol. 174:2002-2013 (1992), incorporated herein by reference in its entirety. Species in the family include, but are not limited to, A. actinomycetencomitans, A. capsulatus, A. equuli, A. lignieresii, A. pleuropneumoniae (H. pleuropneumoniae), A. seminis, A. suis (H. suis), A. ureae (p. ureae), A. capsulatus, 25 Bisgaard taxon I lH. aeg.ptius, H. aphrophilus, H. aphrophilus (H. parainfluenzae), H. ducreyi, H. haemoglobinophilus, H. haemolyticus, H. ifluenzae, H. paracuniculus, H. paragallinarun, H. parahaemolyticus, H. parainfluenzae, (H. paraphrophilus), H. paraphrohaemolyticus, H. paraphrophilus, H. parasuis, H. parasuis type 5, H. segnis, H. somnus, Haemophilus minor group, Haemophilus taxon C, P. aerogenes, P. anatis, 30 P. avium (H. avium), P. canis. P. dogmatis, P. gallinarun, P. haenolytica, P. irehalosi (P. haenolytica biotype T), P. langaa, P. mullocida, P. pneunozropica, P. stomatis, P. 4 vo1CM6?li (H. parainfluenzae). P. v1olantian. Pasteurella species A. Pasteureila species B. and Haemophiisparaphr.oiaiemolrt.icus. Preferably. vaccine compositions comprise attenuated Pas.eurella haemnolwlici. Aci7obacillus pleuropneumoniae, Haemophilus sonus, or Pasteurella mullocida bacteria. In a most preferred embodiment, vaccine 5 compositions of the invention comprise attenuated Pasteurella nuhocida and A. pheropneumoniae bacterial strains. One aspect of the invention provides gram negative bacterial orgapisrnis containing a functional mutation in a gene sequence represented by any one of SEQ ID NOS: 1, 3, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 29 31, 33, 37, 39, 41, 51, 53, 55, 57, 58, 10 60, 68, 70, 72, 74, 76, 78, 80, 82. 84, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 135, 136, 138, 140, 142. 144, 146, 148, 150, 152, 154, 156, 158, 160, 162, 163, and 164, or species homologs thereof, wherein the mutation inhibits or abolishes expression and/or biological activity of an encoded gene product (i.e., the polypeptide encoded by a gene); said functional mutation resulting in attenuated 15 virulence of the bacterial strain. As understood in the art, species homologs include genes found in two or more different species which possess substantial polynucleotide sequence homology and possess the same, or similar, biological functions and/or properties. Preferably polynucleotide sequences which represent species homologs will hybridize under moderately stringent conditions, as described herein by example, and 20 possess the same or similar biological activities and or properties. In another aspect, polynucleotides representing species homologs will share greater than about 60% sequence homology, greater than about 70% sequence homology, greater than about 80% sequence homology, greater than about 90% sequence homology or greater than about 95% sequence homology. Functional mutations that modulate (i.e., increase or decrease) 25 expression and/or biological activity of a gene product include insertions or deletions in the protein coding region of the gene itself or in sequences responsible for, or involved in, control of gene expression. Deletion mutants include those wherein all or part of a specific gene sequence is deleted. in one aspect, the mutation results in deletion of at least about 10%, at least about 20%, at least about 30%, at least about 40% at least about 30 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 98%, or at least about 99% of said gene. In another 5 aspect, the mutation results in an insertion in the gene, wherein the insertion causes decreased expression of a gene product encoded by the mutated gene and/or expression of an inactive gene product encoded by the mutated gene. Also contemplated are compositions, and preferably vaccine compositions, comprising mutated and attenuated 5 gram negative bacterial organisms, optionally comprising a suitable adjuvant and/or a pharmaceutically acceptable diluent or carrier. In order for a modified strain to be effective in a vaccine formulation, the attenuation must be significant enough to prevent the pathogen from evoking severe clinical symptoms, but also insignificant enough to allow limited replication and growth of the bacteria in the host. 1 0 The invention also provides polynucleotides encoding gene products that are required for virulence in gram negative bacteria. Polynucleotides of the invention include DNA, such as complementary DNA, genomic DNA including complementary or anti-sense DNA, and wholly or partially synthesized DNA; RNA, including sense and antisense strands; and peptide nucleic acids as described, for example in Corey, 15 TIBTECH 15:224-229 (1997). VAilencegene-plynucletides of the-invent-ion4nclude those set forth in SEQ ID NOs:1, 3, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 29, 31, 33,37, 39, 41, 51, 53, 55, 57,58, 60,68, 70, 72, 74, 76, 78, 80, 82, 84, 100, 102, 104, 106,108, 110, 112,114,116, 118,120,122, 124, 126,128, 130,132, 134, 135, 136, 138, 140,142, 144, 146,148, 150, 152, 154, 156, 158, 160, 162, 163, and 164, or species homologs thereof, 20 polynuceotides encoding a virulence gene product encoded by a polynucleotide of SEQ ID NOs: 1, 3, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 29, 31, 33, 37, 39, 41, 51, 53, 55, 57, 58, 60, 68, 70, 72, 74, 76, 78, 80, 82, 84, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118,120, 122, 124, 126,128, 130,132, 134, 135, 136, 138, 40,142, 144, 146,148,150, 152, 154, 156, 158, 160, 162, 163, and 164, or a species homolog thereof, and 25 polynucleotide that hybridize, under moderately to highly stringent conditions, to the noncoding strand (or complement) of any one of the polynucleotides set out in SEQ ID. NOs: 1, 3, 7, 9, 11, 13, 15, 17,19, 21, 23, 25, 29, 31, 33, 37, 39, 41, 51, 53, 55, 57, 58, 60, 68, 70, 72, 74, 76, 78, 80, 82, 84, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120,122,124,126,128,130,.132 .134, 135, 136, 138, 140, 142,144, 146, 148, 150,152, 30 154,<156, 158, 160, 162, 163, and T'64;psyi~s hTuhiltgs-thereof. The invention therefore comprehends gene sequences from Pasteurellaceae set out in SEQ ID NOs: 1, 6 3,79 11. 13, 15.17,19,21,23.25.29.31, 33,37,39, 41, 51. 53. 55. 57,58. 60.68.70. 72, 74, 76, 78, 80. 82, 84, 100, 102, 104, 106. 108, 10, 112. 114, 116. 11 8. 120, 122, 124, 126, 128. 130, 132, 134, 1 35, 136. 138, 140, 142, 144, 146.148. 150, 152. 154, 156, 158, 160, 162, 163. and 164, as well as related gene sequences from other gram negative 5 bacterial organisms, including naturally occurring (i.e., species homologs) and artificially induced variants thereof. The invention also comprehends polynucleotides which encode polypeptides deduced from any one of the polynucleotides set out in SEQ ID NOs: 1, 3, 7, 9, I1, 13, 15, 17, 19, 21, 23, 25, 29, 31, 33, 37, 39, 41, 51. 53. 55, 57, 58, 60, 68, 70, 72, 74, 76, 78, 80, 82, 84, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 10 1 24 , 1 2 6 . 128, 130, l 32 , 134, 135, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, and 164, and species hornologs thereof. Knowledge of the sequence of a polynucleotide of the invention makes readily available every possible fragment of that polynucleotide. The invention therefore provides fragments of a polynucleotide of the invention. 15 The invention further embraces expression constructs comprising polynucleotides of the invention. Host cells transformed, transfected or electroporated with a polynucleotide of the invention are also contemplated. The invention provides methods to produce a polypeptide encoded by a polynucleotide of the invention comprising the steps of growing a host cell of the invention under conditions that permit, 20 and preferably promote, expression of a gene product encoded by the polynucleotide, and isolating the gene product from the host cell or the medium of its growth. Identification of polynucleotides of the invention makes available the encoded polypeptides. Polypeptides of the invention include full length and fragment, or truncated, proteins; variants thereof; fusion, or chimeric proteins; and analogs, 25 including those wherein conservative amino acid substitutions have been introduced into wild-type polypeptides. Antibodies that specifically recognize polypeptides of the invention are also provided, and include monoclonal and polyclonal antibodies, single chain antibodies, chimeric antibodies, humanized antibodies, human antibodies, and complementary determining region (CDR)-grafted antibodies, as well as compounds that 30 include CDR sequences which specifically recognize a polypeptide of the invention. The 7 invention also provides ani-idiotype antibodies inmunospecific for antibodies of the invention.

-

According to another aspect of the invention, methods are provided for identifying novel anti-bacteria] agents that modulate the function of gram negative 5 bacteria virulence genes or gene products. Methods of the invention include creening potential agents for the ability to interfere with expression of virulence gene products encoded by the DNA sequences set forth in any one of SEQ ID NOS: 1, 3, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 29, 31, 33, 37, 39, 41, 51, 53, 55, 57, 58, 60, 68, 70, 72, 74, 76, 78, 80, 82, 84, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 10 130, 132, 134, l35, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160,162, 163, and 164, or species homologs thereof, or screening potential agents for the ability to interfere with biological function of a bacterial gene product encoded in whole or in part by a DNA sequence set forth in any one of SEQ ID NOS: 1, 3, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 29, 31, 33, 37, 39, 41, 51, 53, SS, 57, 58, 60,68, 70, 72, 74, 76, 78, 80, 82, 15 84, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 135, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160,.162, 163, and 164, species homologs thereof, or the complementary strand thereof, followed by identifying agents that provide positive results in such-sereeing.assays. In particular, agents that interfere with the expression of virulence gene products include anti-sense 20 polynucleotides and ribozymes that are complementary to the virulence gene sequences. The invention further embraces methods to modulate transcription of gene products of the invention through use of oligonucleotide-directed triplet helix formation. Agents that interfere with the function of virulence gene products include variants of virulence gene products, binding partners of the virulence gene products and 25 variants of such binding. partners, and enzyme inhibitors (where the product is an enzyme). Novel anti-bacterial agents identified bythe methods described herein are provided, as well as methods for treating a subject suffering from infection with gram negative bacteria involving administration of such novel anti-bacterial agents in an 30 amount effective to reduce bacterial presence. 8 Numerous additional aspects and advantages of the invention will become apparent to those skilled in the art upon consideration of the following detailed description of the invention which describes presently prepared embodiments thereof. 5 DETAILED DESCRIPTION OF THE INVENTION "Virulence genes," as used herein, are genes whose function or products are required for successful establishment and/or maintenance of bacterial infection in a host animal. Thus, virulence genes and/or the proteins encoded thereby are involved in pathogenesis in the host organism, but may not be necessary for growth. 10 "Signature-iagged mutagenesis (STM)," as used herein, is a method generally described in International Patent Publication No. WO 96/17951, incorporated herein by reference, and includes, for example, a method for identifying bacterial genes required for virulence in a murine model of bacteremia. In this method, bacterial strains that each have a random mutation in the genome are produced using transposon 15 integration; each insertional mutation carries a different DNA signature tag which allows mutants to be differentiated from each other. The tags comprise 40 bp variable central regions flanked by invariant "arms" of 20 bp which allow the central portions to be co-amplified by polymerase chain reaction (PCR). Tagged mutant strains are assembled in microtiter dishes, then combined to form the "inoculum pool" for infection studies. 20 At an appropriate time after inoculation, bacteria are isolated from the animal and pooled to form the "recovered pool." The tags in the recovered pool and the tags in the inoculum pool are separately amplified, labeled, and then used to probe filters arrayed with all of the different tags representing the mutants in the inoculum. Mutant strains with attenuated virulence are those which cannot be recovered from the infected animal, i.e., 25 strains with tags that give hybridization signals when probed with tags from the inoculum pool but not when probed with tags from the recovered pool. In a variation of this method, non-radioactive detection methods such as chemi luminescence can be used Signature-tagged mutagenesis allows a large number of insertional mutant strains to be screened simultaneously in a single animal for loss of virulence. Screening 30 nineteen pools of mutant P. muhocida strains resulted in the identification of more than 60 strains with reduced virulence, many of which were confirmed to be attenuated in 9 virulence by subsequent determination of an approximate LDso for the individual mutants. Screening of A. pleuropneumoniae mutants resulted in identification of more than 100 strains having mutations in 35 different genes. Of these, mutations in 22 genes results in significantly attenuated A. pleuropneumoniae strains. The nucleotide sequence 5 of the open reading frame disrupted by the transposon insertion was determined by sequencing both strands and an encoded amino acid sequence was deduced. Novelty of both the polynucleotide and amino acid sequences was determined by comparison ofthe sequences with DNA and protein database sequences. The identification of bacterial, and more particularlyP. nultocida and A. 10 pleuropneumoniae virulence genes provides for microorganisms exhibiting reduced virulence (i.e., attenuated strains), which are useful in vaccines. Such microorganisms include Pasteurellaceae mutants containing at least one functional mutation inactivating a gene represented by any one of SEQ ID NOS: 1, 3, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 29, 31, 33,37, 39,41, 51, 53, 55, 57, 58, 60, 68, 70, 72, 74, 76, 78, 80, 82, 84, 100, 102, 15 104,106,108,110,112,114,116,118,120, 122, 124,126,128, 130, 132, 134, 135,136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, 162, 163,.and 164. The worker of ordinary skill in the art will realize that a "functional mutation" may occur in protein coding regions ofa gene of the invention, as well as in regulatory regions that modulate transcription of the virulence gene RNA. 20 The worker of ordinary skill will also appreciate that attenuated P. muliocida and A. pleuropneumnoniae strains of the invention include those bearing more than one functional mutation. More than one mutation may result in additive or synergistic degrees of attenuation. Multiple mutations can be prepared by design or may fortuitously arise from a deletion event originally intended to introduce a single mutation. 25 An example of an attenuated strain with multiple deletions is a Salmonella typhimurium strain wherein the cya and crp genes are functionally deleted. This mutant S. typhimuriun strain has shown promise as a live vaccine. Identification of virulence genes in P. multocida and.A. pleuropneumoniae can provide information regarding similar genes, i.e., species homologs, in other 30 pathogenic species. As an example, identification of the aroA gene led to identification of conserved genes in a diverse number of pathogens, including P. haenolytica, 10 Aerononas hydrophila. Aeromonias salmonicida. SaImonella typhnnwrm. Salmonella enteritidis. Salmonella dublin. Salmonella gallanerum. Bordella pertussis. Yersinia entericoliticea. Neisseria gonorrhoeae. and Bacillus anthracis. In many of these species, attenuated bacterial strains bearing mutations in the aroA gene have proven to be 5 effective in vaccine formulations. Using the virulence genes sequences identified in P. mulrocida, similar or homologous genes can be identified in other organisms, particularly within the Pasteurella family, as well as A. pleuropneunoniae and Haemophilus somn us. Likewise, identification of A. pleuropneumoniae virulence genes can permit identification of related genes in other organisms. Southern hybridization using the P. 10 nmdocida and A. pleuropneunioniae genes as probes can identify these related genes in chromosomal libraries derived from other organisms. Alternatively, PCR can be equally effective in gene identification across species boundaries. As still another alternative, complementation of, for example, a P. mullocida mutant with a chromosomal library from other species can also be used to identify genes having the same or related virulence 15 activity. Identification of related virulence genes can therefore lead to production of an attenuated strain of the other organism which can be useful as still another vaccine formulation. Examples of P. nulrocida genes that have been demonstrated to exist in other species (e.g. . haemolytica. A. pleuropneumoniae and H. sonnus) include genes exbB, arpG, and pnp 20 " Attenuated P. muliocida strains identified using STM are insertional mutants wherein a virulence gene has been rendered non-functional through insertion of transposon sequences in either the open reading frame or regulatory DNA sequences. In one aspect, therefore, the attenuated P. multocida strains, as well as other gram-negative mutant bacterial strains of the invention can bear one or more mutations which result in 25 an insertion in the gene, with the insertion causing decreased expression of a gene product encoded by the mutated gene and/or expression of an inactive gene product encoded by the mutated gene. These insertional mutants still contain all of the genetic information required for bacterial virulence and can possibly revert to a pathogenic state by deletion of the inserted transposon. Therefore, in preparing a vaccine formulation, it 30 is desirable to take the information gleaned from the attenuated strain and create a deletion mutant strain wherein some, most, or all of the virulence gene sequence is

II

removed, thereby precludin2 the possibility that the bacteria will revert to a virulent state. The attenuated P. nultocida strains. as well as other gram-negative mutant bacterial strains of the invention therefore include those bearing one or more mutation which results in deletion of at least about 10%, at least about 20%, at least about 30%, at least 5 about 40% at least about 50%, at least about 60%. at least about 70%. at least about 80%, at least about 90%, at least about 95%, at least about 98%, or at least about 99% of the virulence gene. The vaccine properties of an attenuated insertional mutant identified using STM are expected to be the same or similar to those of a bacteria bearing a deletion in 10 the same gene. However, it is possible that an insertion mutation may exert "polar" effects on adjoining gene sequences, and as a result. the insertion mutant may possess characteristic distinct from a mutant strain with a deletion in the same gene sequence. Deletion mutants can be constructed using any of a number of techniques well known and routinely practiced in the art. 15 In one example, a strategy using counterselectable markers can be employed which has commonly been utilized to delete genes in many bacteria. For a review, see, for example, Reyrat, et al., Infection andlmmunity 66:4011-4017 (1998), incorporated herein by reference. In this technique, a double selection strategy is often employed wherein a plasmid is constructed encoding both a selectable and 20 counterselectable marker, with flanking DNA sequences derived from both sides of the desired deletion. The selectable marker is used to select for bacteria in which the plasmid has integrated into the genome in the appropriate location and manner. The counterselecteable marker is used to select for the very small percentage of bacteria that have spontaneously eliminated the integrated plasmid. A fraction of these bacteria will 25 then contain only the desired deletion with no other foreign DNA present. The key to the use of this technique is the availability of a suitable counterselectable marker. In another technique, the cre-lox system is used for site specific recombination of DNA. The system consists of 34 base pair lox sequences that are recognized by the bacterial cre recombinase gene. If the lox sites are present in the DNA 30 in an appropriate orientation, DNA flanked by the lox sites will be excised by the cre recombinase, resulting in the deletion of all sequences except for one remaining copy of the lox sequence. Using standard recombination techniques, it is possible to delete the targeted gene of interesi in the P. muliocida or A. pleuropneunoniae genome and to replace it with a selectable marker (e.g., a gene coding for kanamycin resistance) that is flanked by the lox sites. Transient expression (by electroporation of a suicide plasmid containing the cre gene under control of a promoter that functions in P. mullocida or A. pleuropneunoniae) of the cre recombinase should result in efficient elimination of the lox flanked marker. This process would result in a mutant containing the desired deletion mutation and one copy of the lox sequences. In another approach, it is possible to directly replace a desired deleted 10 sequence in the P. multocida orA. pleuropneumnoniae genome with a marker gene, such as green fluorescent protein (GFP), P-galactosidase, or luciferase. In this technique, DNA segments flanking a desired deletion are prepared by PCR and cloned into a suicide (non-replicating) vector for P. multocida or 4. pleuropneunoniae. An expression cassette. containing a promoter active in P. mnultocida or A. pleuropneumoniae and the 15 appropriate marker gene, is cloned between the flanking sequences. The plasmid is introduced into wild-type P. mulocida or A. pleuropneumoniae. Bacteria that incorporate and express the marker gene (probably at a very low frequency) are isolated and examined for the appropriate recombination event (i.e., replacement of the wild type gene with the marker gene). 20 .. The reduced virulence of these organisms and their immunogenicity may be confirmed by administration to a subject animal. While it is possible for an avirulent microorganism of the invention to be administered alone, one or more of such mutant microorganisms are preferably administered in a vaccine composition containing suitable adjuvant(s) and pharmaceutically acceptable diluent(s) or carrier(s). The carrier(s) must 25 be "acceptable" in the sense of being compatible with the avirulent microorganism of the invention and not deleterious to the subject to be immunized. Typically, the carriers will be water or saline which will be sterile and pyrogen free. The subject to be immunized is a subject needing protection from a disease caused by a virulent form of P. mullocida, A. pleuropneumoniae, or other pathogenic microorganisms. 30 It will be appreciated that the vaccine of the invention may be useful in the fields of human medicine and veterinary medicine. Thus, the subject to be 13 immunized may be a human or other animal. for example. farm animals including cows, sheep, pigs, horses, goats and poultry (e.g., chickens. turkeys, ducks and geese) companion animals such as dogs and cats: exotic and/or zoo animals; and laboratory animals including mice, rats, rabbits, guinea pigs. and hamsters. 5 The invention also provides polypeptides and corresponding polynucleotides required for P. muliocida or A. pleuropneumoniae virulence. The invention includes both naturally occurring and non-naturally occurring polynucleotides and polypeptide products thereof. Naturally occurring virulence products include distinct gene and polypeptide species as well as corresponding species homologs 10 expressed in organisms other than P. nulocida or A. pleuropneunoniae strains. Non-naturally occurring virulence products include variants of the naturally occurring products such as analogs and virulence products which include covalent modifications. In a preferred embodiment, the invention provides virulence polynucleotides comprising the sequences set forth in SEQ ID NOs: 1, 3, 7, 9,11, 13, 15, 17, 19, 21, 23, 25, 29, 31, 15 33, 37. 39, 41, 51, 53, 55, 57, 58, 60, 68, 70, 72, 74, 76, 78, 80, 82, 84, 100, 102, 104, 106, 108,110,112,114, 116,118,120,122,124, 126,128,130,132, 134, 135, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, 162, 163, and 164, and species homologs thereof, and polypeptides having amino acids sequences encoded by the polynucleotides. 20 The present invention provides novel purified and isolated P. mulocido and A. pleuropneunoniae polynucleotides (e.g., DNA sequences and RNA transcripts, both sense and complementary antisense strands) encoding the bacterial virulence gene products. DNA sequences of the invention include genomic and cDNA sequences as well as wholly or partially chemically synthesized DNA sequences. Genomic DNA of 25 the invention comprises the protein coding region for a polypeptide of the invention and includes variants that may be found in other bacterial strains of the same species. "Synthesized," as used herein and is understood in the art, refers to purely chemical, as opposed to enzymatic, methods for producing polynucleotides. "Wholly" synthesized DNA sequences are therefore produced entirely by chemical means, and "partially" 30 synthesized DNAs embrace those wherein only portions of the resulting DNA were produced by chemical means. Preferred DNA sequences encoding P. multocida 14 virulence gene products are set out in SEQ ID NOs: 1,3, 7, 9. 11. 13, 15. 17. 19. 21. 23. 25, 29,31. 33, 37, 39,41, 51. 53, 55. 57,58. 60, 68, 70, 72, 74. 76, 78. 80. 82, 84, 100, 102, 104, ) 06, 108, 10, 112. 11.4, 116, 118. and 120, 122, 124. 126. 128, 30. 132, 134 135, 136. 138, 140, 142, 144, 146, 148. 150, 152, 154, 156, 158. 160, 162, 163. and 164. 5 and species homologs thereof. Preferred A.pleuropneunoniae DNA sequences encoding virulence gene products are set out in SEQ iD NOs: 122, 124, 126, 128, 130, 132, 134, 135, 136, 138. 140, 142, 144,146, 148, 150,152, 154. 156,158,160, 162, 163,and 164, and species homologs thereof. The worker of skill in the art will readily appreciate that the preferred DNA of the invention comprises a double stranded molecule, for example, 10 molecules having the sequences set forth in SEQ ID NOs: 1,3, 7, 9, 11, 13, 15, 17. 19. 21,23,25,29,31, 33,37,39,41, 51, 53,55, 57, 58, 60, 68, 70, 72, 74, 76, 78, 80, 82, 84, 100, 102, 104, 106, 108, 110, 12, 14, 116, 118, and 120, 122, 124, 126, 128, 130, 32, 134, 135, 136, 138, 140, 142, 144.146, 148, 150, 152,154, 156,158, 160, 162, 163, and 164, and species homologs thereof, along with the complementary molecule (the "non 15 coding strand"or "complement") having a sequence deducible from the sequence of SEQ ID NO: 1, 3, 7, 9, 11, 13, 15, 17 , 19 , 2 1 , 2 3 , 25 , 2 9 , 3 1 , 3 3 , 37 , 3 9

,

4 1 , 5 1 , 5 3 , 55, 57, 58, 60, 68, 70, 72, 74, 76, 78, 80, 82, 84, 100,102, 104, 106, 108, l110, 12, 114, 116, 118, and 120, 122,124, 126, 128, 130, 132, 134,135, 136, 138, 140,142, 144,146, 148, 150, 152, 154, 156, 158, 160, 162, 163, and 164, according to Watson-Crick base pairing rules 20 * for DNA. Also preferred are polynucleotides encoding the gene products encoded by any one of the polynucleotides set out in SEQ ID NOs: 1, 3, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 29, 31, 33, 37, 39, 41, 51, 53, 55, 57, 58, 60, 68, 70, 72, 74, 76, 78, 80, 82, 84, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, and 120, 122, 124, 126, 128, 130, 132, 134, 135, 136,138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, 162, 163, and 164, 25 and species homologs thereof. The invention further embraces species, preferably bacterial, homologs of the P. mulocida and A. pleuropneumoniae DNA. The polynucleotide sequence information provided by the invention makes possible the identification and isolation of polynucleotides encoding related bacterial virulence molecules by well known techniques including Southern and/or Northern 30 hybridization, and polymerase chain reaction (PCR). Examples of related polynucleotides include polynucleotides encoding polypeptides homologous to a 15 virulence gene product encoded by any one of the polynucleotides set out in SEQ ID NOs: 1, 3, 7, 9, 1, 13, 15, 17, 19, 21. 23, 25. 29, 31, 33, 37, 39, 41. 51, 53. 55, 57, 58, 60, 68, 70, 72, 74. 76, 78, 80, 82, 84, 100, 102, 104, 106, 108, 110, 112, 114. 116, 118, and 120,122, 124, 126, 128, 130, 132, 134, 135, 136, 138, 140, 142, 144, 146, 148, 150, 5 152, 154, 156, 158, 160, 162, 163, and 164, and species homologs thereof, and structurally related polypeptides sharing one or more biological and/or physical properties of a virulence gene product of the invention. The invention also embraces DNA sequences encoding bacterial gene products which hybridize under moderately to highly stringent conditions to the 10 non-coding strand, or complement, of any one of the polynucleotides set out in SEQ ID NOs: 1, 3, 7, 9, 11. 13, 15. 17, 19, 21, 23, 25, 29, 31, 33, 37, 39, 41, 51, 53, 55, 57, 58, 60, 68, 70, 72, 74, 76, 78, 80, 82, 84, 100, 102, 104, 106, 108, 110, 112, 114, 116, 11'8, and 120, 122, 124, 126,128, 130, 132, 134,135, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, 162, 163, and 164, and species homologs thereof. DNA 15 sequences encoding virulence polypeptides which would hybridize thereto but for the degeneracy of the genetic code are contemplated by the invention. Exemplary high stringency conditions include a final wash in buffer comprising 0.2X SSC/0.1 % SDS, at 65*C to 75*C, while exemplary moderate stringency conditions include a final wash in buffer comprising 2X SSC/0.1% SDS, at 35*C to 45*C. It is understood in the art that 20 conditions of equivalent stringency can be achieved through variation of temperature and buffer, or salt concentration as described in Ausubel, et at. (Eds.), Protocols in Molecular BioloMv, John Wiley & Sons (1994), pp. 6.0.3 to 6.4.10. Modifications in hybridization conditions can be empirically determined or precisely calculated based on the length and the percentage of guanosine/cytosine (GC) base pairing of the probe. The hybridization 25 conditions can be calculated as described in Sambrook, et al., (Eds.), Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press: Cold Spring Harbor, New York (1989), pp. 9.47 to 9.51. Autonomously replicating recombinant expression constructions such as plasmid and viral DNA vectors incorporating virulence gene sequences are also provided. 30 Expression constructs wherein virulence polypeptide-encoding polynucleotides are operatively linked to an endogenous or exogenous expression control DNA sequence and 16 a transcription terminator are also provided. The virulence genes may be cloned by PCR. using P. mulocida genomic DNA as the template. For ease of inserting the gene into expression vectors. PCR primers are chosen so that the PCR-amplified gene has a restriction enzyme site at the 5' end preceding the initiation codon ATG, and a restriction 5 enzyme site at the 3' end after the termination codon TAG. TGA or TAA. If desirable. the codons in the gene are changed, without changing the amino acids, according to E. coli codon preference described by Grosjean and Fiers, Gene, 18:199-209 (1982), and Konigsberg and Godson, Proc. Natl. A cad. Sci. (USA), 80:687-691 (1983). Optimization of codon usage may lead to an increase in the expression of the gene product when 10 produced in E. coli. If the gene product is to be produced extracellularly, either in the periplasm of E. coli or other bacteria, or into the cell culture medium, the gene is cloned without its initiation codon and placed into an expression vector behind a signal sequence. According to another aspect of the invention, host cells are provided, 15 including procaryotic and eukaryotic cells, either stably or transiently transformed, transfected, or electroporated with polynucleotide sequences ofthe invention in a manner which permits expression o fvirulence polypeptides of the invention. Expression systems of the invention include bacterial, yeast, fungal, viral, invertebrate, and mammalian cells systems. Host cells of the invention are a valuable source of immunogen for 20 development of antibodies specifically immunoreactive with the virulence gene product. Host cells of the invention are conspicuously useful in methods for large scale production of virulence polypeptides wherein the cells are grown in a suitable culture medium and the desired polypeptide products are isolated from the cells or from the medium in which the cells are grown by, for example, immunoaffinity purification or any of the multitude 25 of purification techniques well known and routinely practiced in the art. Any suitable host cell may be used for expression of the gene product, such as E. coli, other bacteria, including P. muliocida, Bacillus and S.. aureus, yeast, including Pichia pastoris and Saccharonyces cerevisiae, insect cells, or mammalian cells, including CHO cells, utilizing suitable vectors known in the art. Proteins may be produced directly or fused 30 to a peptide or polypeptide, and either intracellularly or extracellularly by secretion into the periplasmic space of a bacterial cell or into the cell culture medium. Secretion of a 17 protein requires a signal peptide (also known as pre-sequence); a number of signal sequences from prokaryotes and eukaryotes are known to function for the secretion of recombinant proteins. During the protein secretion process, the signal peptide is removed by signal peptidase to yield the mature protein. 5 To simplify the protein purification process. a purification tag may be added either at the 5' or 3' end of the gene coding sequence. Commonly used purification tags include a stretch of six histidine residues (U.S. Patent Nos. 5,284,933 and 5,310,663), a streptavidin-affinity tag described by Schmidt and Skerra, Protein Engineering, 6:109-122 (1993), a FLAG peptide [Hopp et al., Biotechnology. 6:1205 10 1210 (1988)], glutathione S-transferase [Smith and Johnson, Gene. 67:31-40 (1988)], and thioredoxin [LaVallie er al., Bio/Technologv, 11:187-193 (1993)]. To remove these peptide or polypeptides, a proteolytic cleavage recognition site may be inserted at the fusion junction. Commonly used proteases are factor Xa. thrombin, and enterokinase. The invention also provides purified and isolated P. muhocida and A. 15 pleuropneunoniae virulence polypeptides encoded by a polynucleotide of the invention. Presently preferred are polypeptides comprising the amino acid sequences encoded by any one of the polynucleotides set out in SEQ ID NOs 1, 3, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 29, 31, 33, 37, 39, 41, 51, 53, 55, 57, 58, 60, 68, 70, 72, 74, 76, 78, 80, 82, 84, 100, 102, 104, 106, 108, 110, 112, 114,116, 118, and 120, 122, 124, 126, 128, 130,132, 20 1 34 , 135, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, and 164, and species homologs thereof. The invention embraces virulence polypeptides encoded by a DNA selected from the group consisting of : a) the DNA sequence set out. in any one of SEQ ID NOs: 1, 3, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 29, 31, 33, 37, 39, 41, 51, 53, 55, 57, 58,60, 68, 70,72, 74, 76, 78, 80, 82, 84, 100, 102, 104, 106, 108, 110, 112, 114, 25 116, 118, and 120,122, 124, 126, 128, 130, 132, 134, 135, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, and 164, and species homologs thereof; b) DNA molecules encoding P. mnultocida or A. pleuropneumoniae polypeptides encoded by anyone of SEQ ID NOs: 1, 3, 7, 9, 1,,13, 15, 17, 19, 21, 23, 25,29, 31, 33, 37, 39, 41, 51, 53, 55, 57, 58, 60, 68, 70, 72, 74, 76, 78, 80, 82, 84, 100, 102, 104, 106, 108, 110, 30 l1 2 , 114, 116, 118, and 120, 122, 124, 126, 128, 130, 132, 134, 135, 136, 138, 140, 142, 144, 146, 148,150,152, 154, 156, 158, 160, and 164, and species homologs thereof; and 18 c) a DNA molecule, encoding a virulence gene product. that hybridizes under moderately stringent conditions to the DNA of (a) or (b). The invention also embraces polypeptides, i.e., species homologs and orthologs, that have at least about 99%,at least about 95%, at least about 90%, at least 5 about 85%, at least about 80%, at least about 75%, at least about 7 0%, at least about 65%. at least about 60%, at least about 55%, and at least about 50% identity and/or homology to the preferred polypeptides of the invention. Percent amino acid sequence "identity" xith respect to the preferred polypeptides of the invention is defined herein as the percentage of amino acid residues in the candidate sequence that are identical with 10 the residues in the virulence gene product sequence after aligning both sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. Percent sequence "homology" with respect to the preferred polypeptides of the invention is defined herein as the percentage of amino acid residues in the candidate sequence that are 15 identical with the residues in one of the virulence polypeptide sequences after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and also considering any conservative substitutions as part of the sequence identity. Conservative substitutions can be defined as set out in Tables A and B. 20 Table A Conservative Substitutions I SIDE CHArN CHRACTERISTIC AMINO ACID 25 Aliphatic Non-polar G A P IL V Polar - uncharged C S T M N Q Polar - charged D E 30 KR Aromatic HFWY Other NQDE Polypeptides of the invention may be isolated from natural bacterial cell 35 sources or may be chemically synthesized, but are preferably produced by recombinant 19 procedures involving host cells of the invention. Virulence gene products of the invention may be full length polypeptides, biologically active fragments. or variants thereof which retain specific biological or immunological activity. Variants may comprise virulence polypeptide analogs wherein one or more of the specified (i.e., 5 naturally encoded) amino acids is deleted or replaced or wherein one or more non-specified amino acids are added: (1) without loss of one or more of the biological activities or immunological characteristics specific for the virulence gene product; or (2) with specific disablement of a particular biological activity of the virulence gene product. Deletion variants contemplated also include fragments lacking portions of the 10 polypeptide not essential for biological activity, and insertion variants include fusion polypeptides in which the wild-type polypeptide or fragment thereof have been fused to another polypeptide. Variant virulence polypeptides include those wherein conservative substitutions have been introduced by modification of polynucleotides encoding 15 polypeptides of the invention. Conservative substitutions are recognized in the art to classify amino acids according to their related physical properties and can.be defined as set out in Table A (from WO 97/09433, page 10, published March 13, 1997 (PCT/GB96/02197, filed 9/6/96). Alternatively, conservative amino acids can be grouped as defined in Lehninger, [Biochemistry, Second Edition; Worth Publishers, Inc. 20 NY:NY (1975), pp.71-77) as set out in Table B. 20 Table B Consen-ative Substitutions 1J SIDE CHAIN 5 CHARACTERISTIC AMINO ACID Non-polar (hydrophobic) A. Aliphatic: A L I V P B. Aromatic: F W 10 C. Sulfur-containing: M D. Borderline: G Uncharged-polar A. Hydroxyl: STY B. Amides: NQ 15 C. Sulfhydryl: C D. Borderline: G Positively Charged (Basic): K R H Negatively Charged (Acidic): DE 20 Variant virulence products of the invention include mature virulence gene products, i.e., wherein leader or signal sequences are removed, having additional amino terminal residues. Virulence gene products having an additional methionine residue at position -I are contemplated. as are virulence products having additional methionine and 25 lysine residues at positions -2 and -L. Variants of these types are particularly useful for recombinant protein production in bacterial cell types. Variants of the invention also nclu de gene products wherein amino terminal sequences derived from other proteins have been introduced, as well as variants comprising amino terminal sequences that are not found in naturally occurring proteins. 30 The invention also embraces variant polypeptides having additional amino acid residues which result from use of specific expression systems. For example, use of commercially available vectors that express a desired polypeptide as a fusion protein with glutathione-S-transferase (GST) provide the desired polypeptide having an additional glycine residue at position -I following cleavage of the GST component from the desired 35 polypeptide. Variants which result from expression using other vector systems are also contemplated. Also comprehended by the present invention are antibodies (e.g., monoclonal and polyclonal antibodies, single chain antibodies, chimeric antibodies, 21 humanized, human, and CDR-grafted antibodies. including compounds which include CDR sequences which specifically recognize a polypeptide of the invention) and other binding proteins specific for virulence gene products or fragments thereof. The term "specific for" indicates that the variable regions of the antibodies of the invention 5 recognize and bind a virulence polypeptide exclusively (i.e., are able to distinguish a single virulence polypeptides from related virulence polypeptides despite sequence identity, homology, or similarity found in the family of polypeptides), but may also interact with other proteins (for example, S. aureus protein A or other antibodies in ELISA techniques) through interactions with sequences outside the variable region of the 10 antibodies, and in particular, in the constant region of the molecule. Screening assays to determine binding specificity of an antibody of the invention are well known and routinely practiced in the art. For a comprehensive discussion of such assays. see Harlow et al. (Eds), Antibodies A Laboratory Manual; Cold Spring Harbor Laboratory; Cold Spring Harbor , NY (1988), Chapter 6. Antibodies that recognize and bind fragments 15 of the virulence polypeptides of the invention are also contemplated, provided that the antibodies are first and foremost specific for, as defined above, a virulence polypeptide of the invention from which the fragment was derived. The DNA and amino acid sequence information provided by the present invention also makes possible the systematic analysis of the structure and function of the 20 virulence genes and their encoded gene products. Knowledge of a polynucleotide encoding a virulence gene product of the invention also makes available anti-sense polynucleotides which recognize and hybridize to polynucleotides encoding a virulence polypeptide of the invention. Full length and fragment anti-sense polynucleotides are provided. The worker of ordinary skill will appreciate that fragment anti-sense molecules 25 of the invention include (i) those which specifically recognize and hybridize to a specific RNA (as determined by sequence comparison of DNA encoding a virulence polypeptide of the invention to DNA encoding other known molecules) as well as (ii) those which recognize and hybridize to RNA encoding variants of the family of virulence proteins. Antisense polynucleotides that hybridize to RNA encoding other members of the 30 virulence family of proteins are also identifiable through sequence comparison to identify characteristic, or signature, sequences for the family of molecules. 22 The invention further contemplates methods to modulate gene expression through use of ribozymes.. For a review, see Gibson and Shillitoe, Mo. Biotech. 7:125 137 (1997). Ribozyme technology can be utilized to inhibit translation of mRNA in a sequence specific manner through (i) the hybridization of a complementary RNA to a 5 target mRNA and (ii) cleavage of the hybridized mRNA through nuclease activity inherent to the complementary strand. Ribozymes can be identified by empirical methods but more preferably are specifically designed based on accessible sites on the target mRNA [Bramlage, et al., Trends in Biotech 16:434-438 (1998)]. Delivery of ribozymes to target cells can be accomplished using either exogenous or endogenous delivery 10 techniques well known and routinely practiced in the art. Exogenous delivery methods can include use of targeting liposomes or direct local injection. Endogenous methods include use of viral vectors and non-viral plasmids. Ribozymes can specifically modulate expression of virulence geneswhen designed to be complementary to regions unique to a polynucleotide encoding a virulence 15 gene product. "Specifically modulate" therefore is intended to mean that ribozymes of the invention recognizes only a single polynucleotide. Similarly, ribozymes can be designed to modulate expression of all or some of a family of proteins. Ribozymes of this type are designed to recognize polynucleotide sequences conserved in all or some of the polynucleotides which encode the family of proteins. 20 The invention further embraces methods to modulate transcription of a virulence gene of the invention through use of oligonucleotide-directed triplet helix formation. For a review, see Lavrovsky, et al., Biochem. Mol. Med. 62:11-22 (1997). Triplet helix formation is accomplished using sequence specific oligonucleotides which hybridize to double stranded DNA in the major groove as defined in the Watson-Crick 25 model. Hybridization of a sequence specific oligonucleotide can thereafter modulate activity of DNA-binding proteins, including, for example, transcription factors and polymerases. Preferred target sequences for hybridization include transcriptional regulatory regions that modulate virulence gene product expression. Oligonucleotides which are capable of triplet helix formation are also useful for site-specific covalent 30 modification of target DNA sequences. Oligonucleotides useful for covalent 23 modification are coupled to various DNA damaging agents as described in Lavrovsky, et al. [supro). The identification of P. multocida and .4. pleutropneunoniae virulence genes renders the genes and gene products useful in methods for identifying anti-bacterial 5 agents. Such methods include assaying potential agents for the ability to interfere with expression of virulence gene products represented by the DNA sequences set forth in any one of SEQ ID NOS: 1,3 7, 9, 11, 13, 15, 17, 19, 21, 23 , 25 , 29 , 31 , 33 , 37 , 39, 41 , 51, 53, 55. 57, 58, 60, 68, 70, 72, 74, 76, 78, 80, 82, 84, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118. and 120, 122, 124, 126, 128, 130, 132, 134, 135, 136, 138, 140, 142, 144, 10 146, 148, 150, 152, 154, 156, 158, 160, 162, 163, and 164, and species homojogs thereof (i.e., the genes represented by DNA sequences of SEQ ID NOS: 1, 3, 7,9, 11, 13, 15, 17, 19,21,23, 25, 29, 31, 33, 37, 39, 41, 51, 53, 55, 57, 58, 60, 68, 70, 72, 74, 76, 78, 80, 82, 84, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, and 120, 122, 124, 126, 128, 130, 132, 134,135, 136, 138, 140, 142,144, 146,148, 150, 152, 154,156,158, 160, 162,163, 15 and 164, encode the virulence gene product, or the.DNA sequences of SEQ ID NOS: 1, 3, 7, 9, 11, 13, 15, 17, 19, 21, 23,25, 29, 31, 33,37, 39,41, 51, 53, 55, 57, 58, 60,68, 70, 72, 74, 76, 78, 80, 82, 84, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, and 120, 122, 124,126, 128, 130, 132, 134, 135, 136.138, 140,142, 144,146, 148, 150,152,154, 156, 158, 160, 162, 163, and 164, are adjacent the gene encoding the virulence gene 20 product, or are involved in regulation of expression of the virulence gene product), or assaying potential agents for the ability to interfere with the function of a bacterial gene product encoded in whole or in part by a DNA sequence set forth in any one of SEQ ID NOs: 1, 3, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 29, 31, 33, 37, 39, 41, 51, 53, 55, 57, 58, 60, 68, 70, 72, 74, 76, 78, 80, 82, 84, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 25 and 120, 122, 124, 126, 128, 130,132, 134,135, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, 162, 163, and 164, species homologs thereof, or the complementary strand thereof, followed by identifying agents that are positive in such assays. Polynucleotides and polypeptides useful in these assays include not only the genes and encoded polypeptides as disclosed herein, but also variants thereof that have 30 substantially the same activity as the wild-type genes and polypeptides. 24 The virulence gene products produced by the methods described above are used in high throughput assays to screen for inhibitory agents. The sources for potential agents to be screened are chemical compound libraries, fermentation media of Soreptonycetes, other bacteria and fungi, and cell extracts of plants and other vegetation. 5 For proteins with known enzymatic activity, assays are established based on the activ'ivi and a large number of potential agents are screened for ability to inhibit the activity. For proteins that interact with another protein or nucleic acid, binding assays are established to measure such interaction directly, and the potential agents are screened for ability to inhibit the binding interaction. 10 The use of different assays known in the art is contemplated according to this aspect of the invention. When the function of the virulence gene product is known or predicted by sequence similarity to a known gene product, potential inhibitors can be screened in enzymatic or other types of biological and/or biochemical assays keyed to the function and/or properties of the gene product. When the virulence gene product is 15 known or predicted by sequence similarity to a known gene product to interact with another protein or nucleic acid, inhibitors of the interaction can be screened directly in binding assays. The invention contemplates a multitude of assays to screen and identify inhibitors of binding by the virulence gene product. In one example, the virulence gene product is immobilized and interaction with a binding partner is assessed in the presence 20 and absence of a putative inhibitor compound. In another example, interaction between the virulence gene product and its binding partner is assessed in a solution assay, both in the presence and absence of a putative inhibitor compound. In both assays, an inhibitor is identified as a compound that decreases binding between the virulence gene product and its binding partner. Other assays are also contemplated in those instances wherein 25 the virulence gene product binding partner is a protein. For example, variations of the di-hybrid assay are contemplated wherein an inhibitor of protein/protein interactions is identified by detection of a positive signal in a transformed or transfected host cell as described in PCT publication number WO 95/20652, published August 3, 1995. Candidate inhibitors contemplated by the invention include compounds 30 selected from libraries of potential inhibitors. There are a number of different libraries used for the identification of small molecule modulators, including: (1) chemical 25 libraries. (2) natural product libraries, and (3) combinatorial libraries comprised of random peptides, oligonucleotides or organic molecules. Chemical libraries consist of structural analogs of known compounds or compounds that are identified as "hits" or "leads" via natural product screening. Natural product libraries are collections of 5 microorganisms, animals, plants, or marine organisms which are used to create mixtures for screening by: (1) fermentation and extraction of broths from soil, plant or marine microorganisms or (2) extraction of plants or marine organisms. Natural product libraries include polyketides, non-ribosomal peptides, and variants (non-naturally occurring) thereof. For a review, see Science 282:63-68 (1998). Combinatorial libraries 10 are composed of large numbers of peptides, oligonucleotides, or organic compounds as a mixture. They are relatively easy to prepare by traditional automated synthesis methods, PCR, cloning, or proprietary synthetic methods. Of particular interest are peptide and oligonucleotide combinatorial libraries. Still other libraries of interest include peptide, protein. peptidomimetic, multiparallel synthetic collection, 15 recombinatorial, and polypeptide libraries. For a review of combinatorial chemistry and libraries created therefrom, see Myers, Curr. Opin. Biotechnol. 8:701-707 (1997). Identification of modulators through use of the various libraries described herein permits modification of the candidate "hit" (or "lead") to optimize the capacity of the "hit" to modulate activity. 20 Still other candidate inhibitors contemplated by the invention can be designed and include soluble forms of binding partners, as well as binding partners as chimeric, or fusion, proteins. Binding partners as used herein broadly encompasses antibodies, antibody fragments, and modified compounds comprising antibody domains that are immunospecific for the expression product of the identified virulence gene. 25 Other assays may be used when a binding partner (i.e., ligand) for the virulence gene product is not known, including assays that identify binding partners of the target protein through measuring direct binding of test binding partner to the target protein, and assays that identify binding partners of target proteins through affinity ultrafiltration with ion spray mass spectroscopy/HPLC methods or other physical and 30 analytical methods. Alternatively, such binding interactions are evaluated indirectly using the yeast two-hybrid system described in Fields and Song, Nature, 340:245-246 26 (1989). and Fields and Stemglanz, Trends in Generics. 10:286-292 (1994), both of which are incorporated herein by reference. The two-hybrid syst em is a genetic assay for detecting interactions between two proteins or polypeptides. It can be used to identify proteins that bind to a known protein of interest, or to delineate domains or residues 5 critical for an interaction. Variations on this methodology have been developed to clone genes that encode DNA-binding proteins, to identify peptides that bind to a protein, and to screen for drugs. The two-hybrid system exploits the ability of a pair of interacting proteins to bring a transcription activation domain into close proximity with a DNA binding domain that binds to an upstream activation sequence (UAS) of a reporter gene, 10 and is generally performed in yeast. The assay requires the construction of two hybrid 2enes encoding (I) a DNA-binding domain that is fused to a first protein and (2) an activation domain fused to a second protein. The DNA-binding domain targets the first hybrid protein to the UAS of the reporter gene; however, because most proteins lack an activation domain, this DNA-binding hybrid protein does not activate transcription of the 15 reporter gene. The second hybrid protein, which contains the activation domain, cannot by itself activate expression of the reporter gene because it does not bind the UAS. However, when both hybrid proteins are present, the noncovalent interaction of the first and second proteins tethers the activation domain to the UAS, activating transcription of the reporter gene. When the virulence gene product (the first protein, for example) is 20 already known to interact with another protein or nucleic acid, this assay can be used to detect agents that interfere with the binding interaction. Expression of the reporter gene is monitored as different test agents are added to the system; the presence of an inhibitory agent results in lack of a reporter signal. When the function of the virulence gene product is unknown and no 25 ligands are known to bind the gene product, the yeast two-hybrid assay can also be used to identify proteins that bind to the gene product. In an assay to identify proteins that bind to the first protein (the target protein), a large number of hybrid genes each encoding different second proteins are produced and screened in the assay. Typically, the second protein is encoded by a pool of plasmids in which total cDNA or genomic DNA is ligated 30 to the activation domain. This system is applicable to a wide variety of proteins, and it is not even necessary to know the identity or function of the second binding protein. The 27 system is highly sensitive and can detect interactions not revealed by other methods: even transient interactions may trigger transcription to produce a stable mRNA that can be repeatedly translated to yield the reporter protein. Other assays may be used to search for agents that bind to the target 5 protein. One such screening method to identify direct binding of test ligands to a target protein is described in U.S. Patent No. 5,585,277. incorporated herein by reference. This method relies on the principle that proteins generally exist as a mixture of folded and unfolded states, and continually alternate between the two states. When a test lieand binds to the folded form of a target protein (i.e., when the test ligand is a ligand of the 10 target protein), the target protein molecule bound by the ligand remains in its folded state. Thus, the folded target protein is present to a greater extent in the presence of a test ligand which binds the target protein, than in the absence of a ligand. Binding of the ligand to the target protein can be determined by any method which distinguishes between the folded and unfolded states of the target protein. The function of the target 15 protein need not be known in order for this assay to be performed. Virtually any agent can be assessed by this method as a test ligand, including, but not limited to, metals, polypeptides, proteins, lipids, polysaccharides, polynucleotides and small organic molecules. Another method for identifying ligands for a target protein is described 20 in Wieboldt er al., Anal. Chem., 69:1683-1691 (1997), incorporated herein by reference. This technique screens combinatorial libraries of 20-30 agents at a time in solution phase for binding to the target protein. Agents that bind to the target protein are separated from other library components by centrifugal ultrafiltration. The specifically selected molecules that are retained on the filter are subsequently liberated from the target protein 25 and analyzed by HPLC and pneumatically assisted electrospray (ion spray) ionization mass spectroscopy. This procedure selects library components with the greatest affinity for the target protein, and is particularly useful for small molecule libraries. The inhibitors/binders identified by the initial screens are evaluated for their effect on virulence in in vivo mouse models of P. mulocida infections. Models of 30 bacteremia, endocarditis, septic arthritis, soft tissue abscess, or pneumonia may be utilized. Models involving use of other animals are also comprehended by the invention. 28 For example. rabbits can be challenged with a wild type P. nmdiocida strain before or after administration ofvarying amounts ofa putative inhibitor/binder compound. Control animals, administered only saline instead ofputative inhibitor/binder compound provide a standard by which deterioration of the test animal can be determined. Other animal 5 models include those described in the Animal and Plant Health Inspection Sevice. USDA, January 1, 1994 Edition, §§113.69-113.70; Panciera and Corstvet. Am. J. Vet. Res. 45:2532-2537; Ames, et al., Can. J. Comp. Med. 49:395-400 (1984); and Mukkur, Infection and bnmunity 18:583-585 (1977). Inhibitors/binders that interfere with bacterial virulence are can prevent the establishment of an infection or reverse the 10 outcome of an infection once it is established. Any adjuvant known in the art may be used in the vaccine composition, including oil-based adjuvants such as Freund's Complete Adjuvant and Freund's Incomplete Adjuvant, mycolate-based adjuvants (e.g.,. trehalose dimycolate),. bacteria] lipopolysaccharide (LPS), peptidoglycans (i.e., mureins, mucopeptides, or glycoproteins 15 such as N-Opaca, muramyl dipeptide [MDP), or MDP analogs), proteoglycans (e.g., extracted from Klebsiella pneumoniae), streptococcal preparations (e.g., OK432), BiostimTm (e.g., 01K2), the "Iscoms" of EP 109 942, EP 180 564 and EP 231 039, aluminum hydroxide, saponin, DEAE-dextran, neutral oils (such as miglyol), vegetable oils (such as arachis oil), liposomes, Pluronic@ polyols, the Ribi adjuvant system (see, 20 for example GB-A-2 189 141), or interleukins, particularly those that stimulate cell mediated immunity. An alternative adjuvant consisting of extracts of Amycolata, a bacterial genus in the order Actinomycetales, has been described in U.S. Patent No. 4,877,612. Additionally, proprietary adjuvant mixtures are commercially available. The adjuvant used will depend, in part, on the recipient organism. The amount of adjuvant 25 to administer will depend on the type and size of animal. Optimal dosages may be readily determined by routine methods. The vaccine compositions optionally may include vaccine-compatible pharmaceutically acceptable (i.e., sterile and non-toxic) liquid, semisolid, or solid diluents that serve as pharmaceutical vehicles, excipients, or media. Any diluent known 30 in the art may be used. Exemplary diluents include, but are not limited to, polyoxyethylene sorbitan monolaurate, magnesium stearate, methyl- and 29 propylhydroxybenzoate. talc, al ginates, starches. lactose. sucrose, dextrose. sorbitol. mannitol. gum acacia, calcium phosphate, mineral oil, cocoa butter, and oil oftheobroma. The vaccine compositions can be packaged in forms convenient for delivery. The compositions can be enclosed within a capsule, caplet, sachet, cachet, 5 gelatin, paper, or other container. These delivery forms are preferred when compatible with entry of the immunogenic composition into the recipient organism and, particularly, when the immunogenic composition is being delivered in unit dose form. The dosage units can be packaged, e.g., in tablets, capsules, suppositories or cachets. The vaccine compositions may be introduced into the subject to be 10 immunized by any conventional method including, e.g., by intravenous, intradermal, intramuscular, intramammary, intraperitoneal, or subcutaneous injection; by oral, sublingual, nasal, anal, or vaginal, delivery.- The treatment may consist of a single dose or a plurality of doses over a period of time. The invention also comprehends use of an attenuated bacterial strain of 15 the invention for manufacture of a vaccine medicament to prevent or alleviate bacterial infection and/or symptoms associated therewith. The invention also provides use of inhibitors of the invention for manufacture of a medicament to prevent or alleviate bacterial infection and/or symptoms associated therewith. The present invention is illustrated by the following examples. Example 20 1 describes constructions ofP. muliocida mutants. Example 2 relates to screening for P. mulocida mutants. Example 3 addresses methods to determine virulence of the P. mulocida mutants. Example 4 describes cloning of P. multocida virulence genes. Example 5 addresses identification of genes in other species related to P. mul/ocida virulence genes. Example 6 describes construction of A. pleuropneumoniae mutants. 25 Example 7 addresses screening for attenuated A. pleuropneumoniae mutants. Example 8 relates to identification ofA. pleuropneumoniae virulence genes. Example 9 describes competition challenge ofA. pleuropneumoniae mutants and wild type bacteria. Example 10 characterizes A. pleuropneunoniae genes identified. Example I I addresses efficacy of A. pleuropneumoniae mutant to protect against wild type bacterial challenge. 30 30 Example I Construction of a Library of Tagged-Transposon P. nulrocida Mutants A library of tagged-transposon mutants was constructed in parental vector pLOF/Km [Herrero, ei al.. JBacteriol. 172:6557-67 (1990)] which has previously been 5 demonstrated to be functional and random in P. inullocida (Lee, et al.. Vet Aicrobiol. 50:1 43-8 (1996)]. Plasnid pLOF/Km was constricted as a modification of suicide vector pGP 704 and included a transposase gene under control of the Tac promoter as well as the mini-Tn 10 transposable element encoding kanamycin resistance. Plasmid pTEF-1 was constructed as described below by modifying pLOF/Km to accept sequence tags which 10 contained a semi-random [NK), sequence. Plasmid pLOF/Km was first modified to eliminate the unique KpnI restriction site in the multiple cloning region and then to introduce a new Kpn] site in the mini-Tn10 region. The plasmid was digested with Kpnl and the resulting overhanging ends were filled in with Klenow polymerase according to manufacturer's suggested 15 protocol. Restriction digests and ligations described herein were performed according to manufacturer's suggested protocols (Gibco BRL, Gaithersburg, MD and Boehringer Mannheim, Indianapolis, IN). The blunt end product was self-ligated to produce a plasmid designated pLOF/Km--Kpnl which was transformed into E.coli DH5a:Apir for amplification. E.coli DH5a: (Apir (80dlacZAM15, recAl, endAl, gyrA96, thi-1, 20 hsdR17(r, mk, supE44, relAl, deoR, A(IacZYA-argF)UI69, was propagated at 37 0 C in Luria-Bertani (LB) medium. Plasmids were prepared using QlAGEN SpinPreps from QLAGEN Inc. (Santa Clarita, CA) and digested with Sfil which cuts at a unique site within the mini-Tn10 transposable element. A Sfil-Kpnl-Sfil adaptor was prepared by annealing oligonucleotides TEFI (SEQ ID NO: 86) and TEF3 (SEQ ID NO: 87) and the 25 resulting double-stranded adapter was ligated into the Sf1I site to create plasmid pTEF- 1. Oligonucleotides TEF] and TEF3 (as well as all other oligonucleotides described herein) were synthesized by Genosys Biotechnologies (The Woodlands, TX). TEFI 5'-AGGCCGGTACCGGCCGCCT SEQ ID NO: 86 30 TEF3 5'-CGGCCGGTACCGGCCTAGG SEQ ID NO: 87 31 Unique sequence tags for insertion into the Kpnl site of pTEF-I were prepared as follows. PCR was carried out to generate double stranded DNA tags using a GeneAmp XL PCR Kit (PE Applied Biosysterns, Foster City, CA) under conditions including 250 paM each dNTP, 1.5 mM Mg(OAc),, 100 pmol each primer TEFl4 (SEQ 5 ID NO: 88) and TEF15 (SEQ ID NO: 89), 1 ng TEF26 (SEQ ID NO: 90) as template DNA and 2.5 units recombinant Tth DNA Polymerase XL. TEFl4 5'-CATGGTACCCATTCTAAC SEQ ID NO: 8S 10 TEFI5 S'-CTAGGTACCTACAACCTC SEQ ID NO: 89 TEF26. SEQ ID NO: 90 5'-CTAGGTACCTACAACCTCAAGCTT-{NK]3 AAGCTTGGTTAGAATGGGTACCATG 15 Reaction conditions included an initial incubation at 95 0 C for one minute, followed by thirty cycles of 30 seconds at 95*C, 45 seconds at 45*C, and 15 seconds at 72 0 C, followed by a final incubation at 72*C for two minutes. The PCR products were digested with KpnI and purified using a QLAGEN Nucleotide Removal Kit (QIAGEN, 20 Inc., Chatsworth, GA) according to the manufacturer's suggested protocol. The unique tag sequences were ligated into the mini-Tn10 element of linearized pTEF-1, previously digested with KpnI and dephosphorylated with calf intestinal alkaline phosphatase (Boehringer Mannheim) using standard procedures. The resulting plasmid library was transformed into E.coli DH5cX:Apir. Colony blot analysis was performed according to 25 the DIG User's Guide (Boehringer-Mannheim) with hybridization and detection performed as follows. Hybridizations were essentially performed according to the Genius Non Radioactive User's Guide (Boehringer Mannheim Biochemicals), the product sheet for the DIG-PCR labeling kit (Boehringer Mannheim Biochemicals), and the product sheet 30 for CSPD (Boehringer Mannheim Biochemicals). For preparation of probes, a 100 l primary PCR reaction was set up using Amplitaq PCR buffer (PE Applied Biosystems), 32 200 PM dNTPs, 140 pmol each of primers TEF5 (SEQ ID NO: 91) and TEF6 (SEQ ID NO: 92).2mM MgCl,.2.5 units Amplitaq (PE Applied Biosystems) and I ng ofplasmid DNA. 5 TEF5 5'-TACCTACAACCTCAAGCT SEQ ID NO: 91 TEF6 5'-TACCCATTCTAACCAAGC SEQ ID NO: 92 Cycle conditions included an initial incubation at 95*C for two minutes, followed by 35 10 cycles of 95*C for 30 seconds, 50*C for 45 seconds, 72*C for 15 seconds and a final incubation at 72*C for three minutes. The amplification products were separated using electrophoresis on a 2% - 3:1 NuSieve GTG (FMC BioProducts, Rockland, ME, USA):Agarose gel and the 109 bp product was excised and purified. Gel extractions were carried out using a QIAGEN Gel Extraction kit (QIAGEN). Approximately 15 ng 15 of the primary product was labeled in a 50 pl PCR reaction using the DIG PCR Kit, 50 pmol each of primers TEF24 and TEF25, and a 1:1 mix of DIG Probe Synthesis Mix with 2 mM dNTP stock solution. TEF24 5'-TACCTACAACCTCAAGCTT SEQ ID NO: 93 20 TEF25 5'-TACCCATTCTAACCAAGCTT SEQ ID NO: 94 PCR conditions included an initial incubation at 95*C for four minutes. followed by 25 cycles of 95 0 C for 30 seconds, 50*C for 45 seconds, 72*C for 15 seconds and a final 25 incubation at 72*C for three minutes. The labeled PCR product was digested with HindIIJ in a total reaction volume of 90 IL] and purified from the constant primer arms using a 2% - 3:1 NuSieve GTG (FMC BioProducts):Agarose gel. The region containing the labeled variable tag was excised and the entire gel slice was dissolved and denatured in 10 nil of DIG EasyHyb at 95*C for ten minutes. 30 Dot blots were prepared using a Hybond -N' membrane (Arnersham Pharmacia Biotech). Target DNA for each tag was prepared in 96 well plates using 33 approximately 30 ng of PCR product. An equal volume of 0.1 N NaOH was added to denature the sample and each sample was applied to the membrane with minimal vacuum using a Minifold FIT Dot-Blot Apparatus from Schleicher and Schuell (Keene, NH, USA). Each well was washed with 150 pl of Neutralization Solution (0.5 M Tris /3 M 5 NaCl, pH 7.5) and 150 ptl of 2X SSC. Membranes were UV-crosslinked in a Stratalinker (Stratagene, La Jolla, CA, USA) and prehybridized for one hour in 20 mis DIG EasyHyb Buffer at 42 0 C. The denatured probe was added and hybridization carried out overnight at 42*C. The membrane was washed two times in 2X SSC containing 0.1% SDS for five minutes each wash. Two high stringency washes were performed in 10 50 ml of pre-warmed 0.1X SSC buffer containing 0.1% SDS at 68*C for 15 minutes before proceeding with standard Genius Detection protocols (Genius Manual ). It is desirable to use a non-radioactive detection system for safety, lower cost, ease of use, and reduction of hazardous materials. In initial experiments using similar procedures previously described [Mei, el aL., Mol Microbiol. 26:399-407 15 (1997)], unacceptable background levels of hybridization were obtained in negative controls. In order to decrease background, tag length was increased by 30 bp to a total of70, amplification primers were lengthened to include all sequence flanking the variable region, a lower concentration of dig-dUTP was used, and the conserved sequences flanking the sequence tag region were removed by gel purification. Most significantly, 20 PCR was used to generate [NK]s sequence tags as the target DNA in dot blots rather than the entire plasmids containing the tagged transposons after detecting background hybridization from the transposon itself. Using these modifications background was eliminated making chemiluminescentinon-radioactive screening more effective. Approximately four hundred different transformants resulting from the 25 ligation of pTEF- 1 with the PCR generated sequence tags were screened by colony blot and the 96 strongest hybridizing colonies were assembled into microtiter plates for further use. Even though the likelihood of duplicated tags was very low, half of the plate of master tags was probed against the other to confirm that no tags were duplicated. The plasmi ds containing these tags were purified and transformed into E.coli S 17- I:Xpir (pir, 30 recA, zhi, pro, hsd, (r-m+), RP4-2, (Tc::Mu), (Km::Tn7), [TmpR), [SmR]), and the transformed bacteria propagated at 37*C in Luria-Bertani (LB) medium. Each of the 96 34 E-coli SI7-1 :Apir transformants containing the tagged plasmid pTEF-1 was used in conjugative matins to generate transposon mutants ofP. nuhocida. P. muocida strain TF5 is a spontaneous nalidixic acid resistant mutant denved from UC6731, a bovine clinical isolate. P. muhocida strains were grown on brain heart infusion (BHI) media 5 (Difco Laboratories, Detroit, Ml, USA) at 37*C and in 5% CO, when grown on plates. Matings were set up by growing each E.coli S17-1:Apir /pTEFI:(NK), clone and the TF5 strain to late log phase. Fifty p1 of culture for each tagged-pTEF-1 clone was mixed with 200 pl of the TF5 culture and 50 [l of each mating mixture was spotted onto 0.22 TM filters previously placed on BHJ plates containing 100 mM IPTG and 10 mM 10 MgSO.. Following overnight incubation at 37C with 5% CO,, mating mixtures were washed off of each filter into 3 ml of PBS and 25 pil of each was plated onto BHIN 50

K'

0 0 plates. Following selective overnight growth, colonies were assembled into microtiter plates by toothpick transfer into 200 ptl BHIWK" making sure that each well in a microtiter plate always contained a transposon mutant with the same sequence tag. 15 Following overnight growth, 50 pl of 75% glycerol was added to each well and plates were stored frozen at -80*C. Nineteen pools were assembled by transferring the transposon mutants to microtiter plates making sure that each well contained a transposon mutant with the appropriate tag for that well. In other words, a specific well in each microtiter plate 20 always contained a transposon mutant with the same sequence tag even though the location of the transposon within those mutants may be different. Example 2 Murine Screening for Attenuated P. mullocida Mutants 25 Nineteen pools of Pasteurella mullocida transposon mutants were screened using a murine model of septicemia. Frozen plates of pooled P. mullocida transposon mutants were removed from -80*C storage and subcultured by transferring 10 pt l from each well to a new 96 well round bottom plate (Corning Costar, Cambridge, MA, USA) containing 200 p1l of brain heart infusion (DIFCO) with 50 pIg/ml nalidixic 30 acid (Sigma) and 50 pLg/ml kanamycin (Sigma) (BHIN 5 K"*). Plates were incubated without shaking overnight at 37*C in 5% CO 2 . Overnight plates were subcultured by transferring 10 [l from each well io a new flat bottomed 96-well plate (Coming Costar) 35 containing 100 p1 l of BHI per well and incubating at 37 0 C with shaking at approximately 150 rpm. The OD., was monitored using a micro-titer plate reader. At an OD., of approximately 0.2 to 0.25. each plate was pooled to form the "input pool" by combining 100 pl from each of the wells of the micro-titer plate. The culture was diluted 5 appropriately in BHI to doses of approximately 10', 105, 106 CFU/ml and 0.2 ml of each dilution was used to infect female 14-16 g BALB/c mice by intraperitoneal administration. At two days post-infection, one or two surviving mice were euthanized and the spleens harvested. The entire sp)een was homogenized in 1.0 ml sterile 0.9 % saline. Dilutions of the homogenate from 10V to 105 were prepared and plated onto 10 BHrN- 5

(K

5 plates. Following overnight growth, at least 20,000 colonies were pooled in 10 mis BHI broth to form the "recovered pool" and 0.5 ml of the recovered pool was centrifuged at 3,500 X g and the pellet used to prepare genomic DNA according to a previously described protocol [Wilson, In F. M. Ausubel, et al.,(ed.), Current Protocols in Molecular Biology, vol. 1. John Wiley and Sons, New York, p. 2.4.1-2.4.5. (1997)]. Initial experiments with virulent wild-type P. multocida indicated that organisms could be recovered from the spleen, lungs, kidneys, and liver indicating a truly septicenic model of infection. Dot blots for both the "input" and "recovered"pools were performed as described in Example I and evaluated both by visual inspection and by 20 semi-quantitative analysis. Hybridization was carried out as described in Example I except that 5 pg of genomic DNA from input and recovered pools was used as template. Semi-quantitative analysis indicates whether a significant reduction in a single clone has occurred. If a mutant is unable to survive within the host, then the recovered signal should be very low compared to the input signal yielding a high input/recovered ratio. 25 Most mutants will grow as well in vivo as in vitro and therefore a ratio of their signals should be approximately equal to 1. Clones selected by quantitative analysis as being highly reduced in the recovered pool were selected for further study. Additional clones with questionable input/recovered ratios were also selected after visually evaluating films made from the dot blots. 30 36 Example 3 Determination of Virulence for P. nuhocida Candidate Mutants Each potential mutant which exhibited reduced recovery from splenic tissue was isolated from the original pool plate and used individually in a challenge 5 experiment to verify and roughly estimate the attenuation caused by the transposon mutation. Individual candidate mutants from in vivo screens were grown on Sheep Blood Agar plates ovemight in 5% CO, at 37 0 C. Approximately six colonies of each mutant were inoculated into BHI broth and allowed to grow for six hours. Dilutions were prepared and five mice each were infected as described above with )102, 10', 10'' and IO 10 CFU each. Attenuation was determined by comparing mortality after six days relative to the wild type. Surviving mice were presumed to be protected and then challenged with a dose of wild type P. multocida at a concentration approximately 200-fold greater than the LDo for the wild type strain. Survival rate was then determined for each challenged group of mice. 15 Results indicated that 62 of 120 potential transposon mutants were attenuated, having an approximate

LD

50 of at least 10 fold higher than the wild type strain. The clones and their approximate

LD

5 0 values are listed in Table 1. A control experiment with the wild type strain was run in parallel with each set of challenges and in all cases mortality in wild type-challenged groups was 100%. 20 In addition to LDSO values, Table I also provides data from vaccination and challenge experiments. Briefly, groups of mice (n = 5 to 10) were vaccinated by intraperitoneal injection with the individual P. multocida strains shown in Table I at a dose that was approximately 200 times greater than the LDs, of the virulent, wild type strain. Animals were observed for 28 days after which mortality figures were calculated. 25 Table I P. multocida Virulence Genes Nuclectide Representaive PossibleGene Vaccination Challenge LD, SEQ ID NO: Isolate Function # survivors/total # survivors/total 30 wild e

.

0/10 < 23 PM1 uaB 10/10, 10/10. 10/10 9/10. 9/10 4.3 x 106 11 PMID7 dsbB 1010,5/10 10/10. 55 8.4 x 104 3 5 H1014 ) 3/5 ,1 0/ 10/10 3 05 357M!a9/9 >2 x 105 (H13020) 9 PM2G8 thaC 4 /. 9 * /10 /g >4'110 37 Nucleolide Representit PossibleGene Vaccination ChAlenge LD. SEQ 11) NO: Isulate Function # surviors/total # survivors/iotal 76 M3O aO i H1014()) 3/5 ________ PM I 1H04~ / >6 x 105 II8 PM3Gl i UnkO 4/5. 1010 10/10 >3x 105 j PM784 iroA (UnkB) 0/5 7 PM4CT ihaB (fhaB2 2/5. 10/10. 9/10 10/10. 9/9 >3 x 106 5 -9 PM4GIO-4 dnOA 4/5 >5 0 A PM4D5-T5 apB .. >4 x 105 3 PM45-TI UnkC2 5/5 > x 105 15 PM4F2 I laB (fhoBlin 3/5.6/10. 10/10 6/6, 10/10 3 105 04. PMSF7 mreB 415 2/ X 105 10 7P.M5E2 devB 0-/5. 3/1 0 2/ 103 68 PM6H5-TI XvIA 5/5 .7...- PMbHS vigF H10791 5/5. 9/10 9/9 x 5 108 1 PM7D]2 .pp 5/5.9/10 9/9 I1 I' PSC IRI -T2 UnkCI -/ 6X 10S 15 37 PSC . -T' MT meB 5/5 -6x 105 58 _ PMRCI R IT6 UnkDl 5/5 -6 x 105 . ...- PMIO2 PurF (H1207) 3/5.8/10.8/10 8/8.8/8 >3 x 105 25 PN1IOHIO-T2 HI501 5/5 >1 x 104 20 72 PM I I GS-T2 vei 5/5 >2.4 x 103 2 PM IG8-T4 greA 5/5 >2.4 x 103 84 PM 12HOi yyan 3/5. 0/10 -2.2 x 103 (H10687) 33 PM ISG8-T2 kdtB 5/5 116 PMI5G-TI UnkK 5/5 >1.2x105 104 PM16GII-Tl hmbR 3/5>1.x105 25 29 PM16Gil-T2 hxuC 3/5 - >1.9 X 105 35 PM16HS _piC 5/5, 10/10 10/10 >2.4 x 105 80 PMI6H3 vleA (10019) 5/5. 10/10 > 2.0 x 105 49 PM17H6-TI sopE 4/5 -6 X 105 120 PM17H6 UnkP 4/5 - -6 x 105 30 5 PMI8FS-TS cap5E 5/5 >2.4 x 105 82 PMI8F5-T10 yojB (H10345) 5/5 >2.4 x 105 13 PM19A I e xbB 5/5. 10/10 10/10 >1.2 x 105 - - . PMI9D4 rci 5/5.8/10 8/8 -1.6x105 39 PM20AI2 mioC 3/5, 8/10 8/8 -2 x 104 (HI0669) 35 60 PM2OC2 UnkD2 5/5. 10/10 10/10 >8.2 x 106 Example 4 Cloning and IdentificatioD of Genes Required for P. multocida Virulence Each transposon mutant which was verified to be attenuated was analyzed 40 further to determine the identity of the disrupted open reading frame. DNA from each mutant was amplified, purified, and digested with restriction enzymes that were known not to cut within the transposon and generally produced 4-8 kb fragments that hybridized with the transposon. Using selection for kanamycin resistance encoded by the transposon, at least one fragment for each transposon mutant was cloned. 45 Southern hybridization with multiple restriction enzymes was performed for each attenuated mutant using a labeled 1.8 kb MluI fragment from pLOF/Kim as a probe to identify a suitably sized fragment for cloning. The mini-Tn10 element and 38 flanking DNA from each mutant was cloned into pUC19 and the flanking sequence determiined using internal primers TEF32 and TEF40. primer walking and in some cases universal pUC-19 primers. 5 TEF-32 GGCAGAGCATTACGCTGAC SEQ ID NO: 95 TEF-40 GTACCGGCCAGGCGGCCACGCGTATTC SEQ ID NO: 96 Sequencing reactions were performed using the BigDveTl Dye Terminator Chemistry kit from PE Applied Biosystems (Foster City, CA) and run on an ABI Prism 377 DNA 10 Sequencer. Double stranded sequence for putative interrupted open reading frames was obtained for each clone. Sequencer 3.0 software (Genecodes, Corp., Ann Arbor, MI) was used to assemble and analyze sequence data. GCG programs [Devereux, et al., 1997. Wisconsin Package Version 9.0,9.0 ed. Genetics Computer Group, Inc., Madison] were used to search for homologous sequences in currently available databases. 15 In 37% of the clones that were identified as being attenuated, there were multiple insertions of the mini-Tn10 transposable element. Each insertion, including its flanking sequence was cloned individually into pGP704 and mated into the wild-type strain to produce new mutants of P. multocida, each carrying only one of the multiple original insertions. Individual mutants were retested individually to determine the 20 -.. insertion responsible for the attenuated phenotype. The nucleotide sequence of the disrupted, predicted open reading frame was detennined by sequencing both strands, and the predicted amino acid sequence was used to search currently available databases for similar sequences. Sequences either matched known genes, unknown genes, and hypothetical open reading frames previously sequenced or did not match any previously 25 identified sequence. For those genes having homology to previously identified sequences, potential functions were assigned as set out in Table 1. Example 5 Identification of Related Genes in Other Species 30 In separate experiments, STM was also performed using Actinobacillus pleuropneumoniae (App). One of the App strains contained an insertion in a gene that was sequenced (SEQ ID NO: 97) and identified as a species homolog of the P. multocida 39 apG gene. This result suggested the presence in other bacterial species of homologs to previously unknown P. mulhocida genes that can also be mutated to produce attenuated strains of the other bacteria] species for use in vaccine compositions. In order to determine if homologs of other P. muliocida genes exists in other bacterial species, 5 Southern hybridization was performed on gepomic DNA from other species using theA. pleuropneunoniae aipG gene as a probe. Actinobacillus plewopneunoniae, Posieurella haenolvtica (Ph), P. muithocida, and Haemzophius somnus (Hs) genomic DNA was isolated using the CTAB method and digested with EcoRI and HindIIu for two hours at 37*C. Digested DNA was 10 separated on a 0.7% agarose gel at 40V in TAE buffer ovemight. The gel was immersed sequentially in 0.1 M HCL for 30 minutes, twice in 0.5 M NaOH/1.5 M NaCl for 15 minutes each. and twice in 2.5 M NaCl/l M Tris, pH 7.5. The DNA was transferred to nitrocellulose membranes (Amersham Hybond N') ovemight using 20X SSC buffer (3 M NaCl/0.3 M sodium citrate). The DNA was crosslinked to the membrane using a UV 15 Stratalinker on autocrosslink setting (120 millijoules). The membrane was prehybridized in 5X SSC/1% blocking solution/0. 1% sodium lauroyl sarcosine/0.02% SDS at 50*C for approximately seven hours and hybridized overnight at 50*C in the same solution containing a PCR generated atgG probe. The probe was prepared using primers DEL-1389 (SEQ ID NO: 98) and 20 TEF-46 (SEQ ID NO: 99) in a with a GeneAmp XL PCR kit in a GeneAmp PCR System 2400. Template was genomic A. pleuropneumoniae DNA. DEL-1389 TCTCCATTCCCTTGCTGCGGCAGGG SEQ ID NO: 98 TEF-46 GGAATTACAGCCGGATCCGGG SEQ ID NO: 99 25 The PCR was performed with an initial heating step at 940C for five minutes, 30 cycles of denaturation t 94"C for 30 sec, annealing at 50*C for 30 sec, and elongation at 720C for three minutes, and a final extension step at 72*C for five minutes. The amplification products were separated on an agarose gel, purified using a QIAquick gel purification kit 30 (QIAGEN), and labeled using a DIG-High Primer kit (Boehringer Mannheim). The blot was removed from the hybridization solution and rinsed in 2X SSC and washed two times for five minutes each wash in the same buffer. The blot was then washed two 40 times for 15 minutes each in 0.5X SSC at 60 0 C. Homologous bands were visualized using a DIG Nucleic Acid Detection Kit (Boehrin2er Mannheim). Single bands were detected in Pasteurella haemolirtica. Hoemophuius somnus and A. pleuropneunoniae using EcoRI digested DNA. Two bands were detected 5 using EcoRi digested DNA from Pasteurella nulocida. Example 6 Construction of a Library of Tagged-Transposon P. multocida Mutants Transposon mutagenesis using pLOF/Krn has previously been reported 10 to be functional and random in A. pleuropneunoniae [Tascon, et al.. J Bacteriol. 175:5717-22 (1993)]. To construct tagged transposon mutants ofA. pIeuropneunoniae, each of 96 E. coli S17-I:Xpir transformants containing pre-selected tagged plasmids (pTEF-1:[NK] 3 ,) was used in conjugative matings to generate transposon mutants of A. pleuropn eumoniae strain AP225, a serotype I spontaneous nalidixic acid resistant mutant 15 derived from an in vivo passaged ATCC 27088 strain. A.pleuropneunoniae strains were grown on Brain Heart Infusion (BHI) (Difco Laboratories, Detroit, MI) media with 10 [Lg/ml B-nicotinamide adenine dinucleotide (V'"), (Sigma, St. Louis, Missouri) at 37*C and in 5% CO, when grown on plates. E.coli S17-] :Apir (Apir, recA, thi,pro, hsdR(r ,mL+), RP4-2, (TcR::Mu), (Kmr'::n7), TmpR], [SmR]) was propagated at 37*C in Luria 20 Bertani (LB) medium. Antibiotics when necessary were used at 100 pg/ml ampicillin (Sigma), 50 pg/ml nalidixic acid (NS4)(Sigma), and 50 (K'4) or 100 (K'*) pg/ml of kanamycin (Sigma). Matings were set up by growing each E. coli SI 7-1:Xpir/pTEFl:[NK]J 3 clone and the AP225 strain to late log phase. A 50 pl aliquot of culture for each tagged 25 pTEF-1 clone was mixed with 150 p1 of the APP225 culture, and then 50 pl of each mating mixture was spotted onto 0.22 p.M filters previously placed onto BHIV'* plates containing 100 pM IPTG and 10 mM MgSO 4 . Following overnight incubation at 37*C with 5% C0 2 , mating mixtures were washed off of each filter into 2 ml of PBS and 200 pl of each was plated onto BHIV'*N3*K 1 * plates. After selective overnight growth, 30 colonies were assembled into microtiter plates by toothpick transfer into 200 pl

BIIVINI*K'

0 making sure that each well in a microtiter plate always contained a 41 transposon mutant with the same sequence tag. Following ovemight growth. 50 41 of 75% glycerol was added to each well and plates were stored frozen at -80*C. APP does not appear to have as much bias towards multiple insertions of the mini-Tn 10 element as did P. multocida. Only approximately 3% of the mutants were 5 determined to contain multiple insertions, which is in agreement with the 4% previously reported [Tascon, et al.. JBacteriol. 175:5717-22 (1993)]. A problem in APP consisted of identifying numerous mutants (discussed below) containing insertions into 23S RNA regions: 28 total mutants with insertions into 13 unique sites. This may indicate that 23S RNA contains preferential insertion sites and that the growth of APP is affected by these 10 insertions enough to result in differential survival withinjje host. Southern blot analysis using an APP 23S RNA probe suggests that APP may contain only three ribosomal operons as compared to five in H. influenzae [Fleischmann, el al.. Science 269:496-512 (1995)] and seven complete operons in E. coli [Blattner, et al., Science 277:1453-1474 (1997)]. This site preference and its effect on growth rate maybe a significant barrier to 15 "saturation mutagenesis" since a significant number of clones will contain insertions into these rRNAs and large volume screening will be necessary to obtain additional unique attenuating mutations. Example 7 20 Porcine Screening for Attenuated A. pleuropneunoniae Mutants Twenty pools of A. pleuropneunoniae transposon mutants, containing a total of approximately 800 mutants, were screened using aporcine intratracheal infection model. Each pool was screened in two separate animals. Frozen plates of pooled A. pleuropneumoniae transposon mutants were 25 removed from -80 0 C storage and subcultured by transferring 20 pl.1 from each well to a new 96 well round bottom plate (Coming Costar, Cambridge, MA, USA) containing 180 pl] of BHV 0 N'4K' 0 . Plates were incubated without shaking overnight at 37 0 C in 5% CO,. Overnight plates were then subcultured by transferring 10 pL from each well to a new flat bottomed 96 well plate (Coming Costar) containing 100 p1 of BHNV' per well 30 and incubating at 37*C with shaking at 150 rpm. The ODW 0 was monitored using a microtiter plate reader. At an OD 5 6 , of approximately 0.2 to 0.25, each plate was pooled to forn the "input pool" by combining 100 pl. from each of the wells of the microtiter 42 plate. The culture was diluted appropriately in BHI to approximately 2 X 101 CFU/ml. For each diluted pool, 4.0 ml was used to infect 10-20 kg SPF pigs (Whiteshire-Hamroc, Albion. IN) by iniratracheal administration using a tracheal tube. At approximately 20 hours post-infection, all surviving animals were euthanized and the lungs removed. 5 Lavage was performed to recover surviving bacteria by infusing 150 mIs of sterile PBS into the lungs, which were then massaged to distribute the fluid. The lavage fluid was recovered, and the process was repeated a second time. The lavage fluid was cenrifuged at 450 x g for 10 niinutes to separate out large debris. Supematants were then centrifuged at 2,800 x g to pellet the bacteria. Pellets were resuspended in 5 mIs BHI and plated in 10 dilutions ranging from 10 2 to 10" onto BHIV'"NOK5 0 plates. Following ovemight growth, at least 100,000 colonies were pooled in 10 mls BHI broth to form the "recovered pools". A 0.7 ml portion of each recovered pool was used to prepare genomic DNA by the CTAB method [Wilson, In Ausubel, ei al., (eds.), Current Protocols in Molecular Biology, vol. 1. John Wiley and Sons, New York, p. 2.4.1-2.4.5 (1997)). 15 Recovery from the animals routinely was in the I 0 CFU range from lung lavage. Dot blots were perfornied and evaluated both by visual inspection and by semi-quantitative analysis as described previously. All hybridizations and detections were performed as described. Briefly, probes were prepared by a primary PCR 20 amplification, followed by agarose gel purification of the desired product and secondary PCR amplification incorporating dig-dUTP. Oligonucleotides including TEF5. TEF6, TEF24, TEF25, TEF48 and TEF62, were synthesized by Genosys Biotechnologies (The Woodlands, TX). Primers TEF69, TEF65, and TEF66 were also used for inverse PCR reactions and sequencing. 25 TEF69 GACGTTTCCCGTTGAATATGGCTC SEQ ID NO: 166 TEF65 GCCGGATCCGGGATCATATGACAAGA SEQ ID NO: 167 TEF66 GACAAGATGTGTATCCACCTTAAC SEQ ID NO: 168 30 The labeled PCR product was then digested with HindIII to separate the constant primer arms from the unique tag region. The region containing the labeled variable tag was excised and the entire gel slice was then dissolved and denatured in DIG 43 EasyHvb. Dot blots were prepared and detected using the standard CSPD detection protocol. Film exposures were made for visual evaluation, and luminescent counts per second (LCPS) were determined for each dot blot sample. The LCPSie / LCPS tccavered ratio for each mutant was used to detennine mutants likely to be attenuated. 5 Clones selected as being present in the input pool but highly reduced in the recovered pool were selected for further study. Additional clones with questionable inputirecovered ratios were also selected after visually evaluating films made from the dot blots. A total of 1 10 clones were selected. 10 Example 8 Identification of A. pleuropneunoniae Virulence Genes A partial flanking sequence was determined for each of the 110 mutants by inverse PCR and direct product sequencing. Inverse PCR was used to generate flanking DNA products for direct sequencing as described above. Sequencing reactions 15 were performed using the BigDye" Dye Terminator Chemistry kit from PE Applied Biosystems (Foster City, CA) and run on an ABI Prism 377 DNA Sequencer. Sequencher 3.0 software (Genecodes, Corp., Ann Arbor, MI) was used to assemble and analyze sequence data. GCG programs [Devereux and Haeberli, Wisconsin Package Version 9.0, 9.0 ed. Genetics Computer Group, Inc., Madison (1997)] were used to 20 search for homologous sequences in currently available databases. Table 2 shows the A. pleuropneumoniae genes identified and extent to which open reading frames were determinable. Sequence identification numbers are provided for nucleotide sequences as well as deduced amino acid sequences where located. 25 44 Table 2 A. ple(ropneumlon it)e Open Reading Frames Complete Ooen Reading Frame NO Star1 Codon - Stop Codoli 5 atpH SEQ ID NO: 134 dksA SEQ ID NO: 136 aptG SEQ ID NO: 132 dnaK SEQ ID NO: 13S exbB SEQ ID NO: 140 H10379 SEQ ID NO: 144 OmpP5 SEQ ID NO: 152 OmpP5-2 SEQ ID NO: 150 NO Stan Codon - NO Stop Codon 10 tig SEQ ID NO: 160 pnp SEQ ID NO: 154 fkpA SEQ ID NO: 142 apvA-or I SEQ ID NO: 12 hupA SEQ ID NO: 146 apvA-or 2 SEQ ID NO: 124 rpmF SEQ ID NO: 158 apvB SEQ ID NO: 126 15 Start Codon - NO Stop Codon apvD SEQ ID NO: 130 lpdA SEQ ID NO: 148 RNA or Noncoding Sequences potD SEQ ID NO: 156 tRNA-leu SEQ ID NO: 162 yaeE SEQ ID NO: 164 tRNA-glu SEQ ID NO: 163 apvC SEQ ID NO: 128 20 The putative identities listed in Table 3 (below, Example 9)were assigned by comparison with bacterial databases. The 110 mutants represented 35 groups of unique transposon insertions. The number of different mutations per loci varied, with some clones always containing an insertion at a single site within an ORF to clones 25 containing insertions within different sites of the same ORF. Three multiple insertions were detected in the 110 mutants screened as determined by production of multiple PCR bands and generation of multiple sequence electropherograms. Example 9 30 Competition Challenge of A.pleuropneumoniae Mutants witb Wild Type APP225 A representative clone from each of the unique attenuated mutant groups identified above that was absent or highly reduced in the recovered population was isolated from the original pool plate and used in a competition challenge experiment with the wild type strain (AP225) to verify the relative attenuation caused by the transposon 35 mutation. Mutant and wild type strains were grown in BHIV'* to an OD 590 of 0.6 - 0.9. Approximately 5.0 x 10* CFU each of the wild type and mutant strains were added to 4 mIs BHL. The total 4 ml dose was used infect a 10-20 kg SPF pig by intratracheal 45 administration with a tracheal tube. At approximately 20 hours post-infection. all surviving animals were euthanized and the lungs removed. Lung lavages were performed as described above. Plate counts were carried out on BHJV"'N and BHR"V'ONSUK" to determine the relative numbers of wild type to mutant in both the input cultures and in 5 the lung lavage samples. A Competitive Index (CI) was calculated as the [mutant CFU / wild type CFU],,, / [mutant CFU / wild type CFUrcovered' Of the 35 potential transposon mutants, 22 were significantly attenuated, having a competitive index (CI) of less than 0.2. A transposon mutant that did not seem to be attenuated based on the STM screening results was chosen from one of the pools 10 as a positive control. This mutant had a Cl in vivo of approximately 0.6. An in vitro competition was also done for this mutant resulting in a Cl of 0.8. The mutant was subsequently determined to contain an insertion between 2 phenylalanine tRNA's. Competitive indices for unique attenuated single-insertion mutants are listed in Table 3. Competitive indices for atpG,pnp, and exbB App mutants indicated 15 that the mutants were unable to compete effectively with the wild type strains and were therefore attenuated. Table 3 Virulence and Proposed Function of A. pleuropneunioniae Mutants 20 Mutant Similarity Putative or Known Functions C. AP20A6 arpH ATP svnthase .009 AP7F10 atpG ATP synthase .013 AP 1 7C6 lpdA dihvdrolipoande dehydrogenase .039 25 ANPIE7 exbB transport of iron compounds .003,.003..006 AP3H7 poD Spermidine/pun-escine transport .308 AP8H6 OmpP5 Adhesin / OmpA homolog .184 A?18H8 OmpP5-2 Adhesin/OmpA homolog .552 30 AP3E9 fig Peptidyl-prolyl isomerase .050 AP13C2 Ikp. Peptidyl-prolyl isomerase <.001 AP15CI I pnp Polynucleotide phosphorylase .032 API8F12 hup.4 Histone - like protein .001 35 AP20F8 dks.4 Dosage dependent suppressor of dnaK mutations .075 APG4 dnaK Heat shock rotin - molecular chaperone .376 46 AP.I 7C9 IR.A&-ef Protein Synhesis (gene re2ulation' .059 AP5D6 iRNA-arl, Protein Synthesis .05 AP1 8B2 rpnF' Protein Synthesis 1 APIOE7 __ vlae4 Unknown .001 AP19A5 H10379 Unknown .061 APIOCIO apv4 Unknown 157 AP)8F5 aprB Unknown .103 10 AP2A6 Op'C Unknown .103 AP2C I opvD Unknown .0-1 Accuracy of the CI appeared to be very good as ihe exbB mutant was competed within three different animals yielding Cl's of 0.003, 0.003 and 0.006. The use 15 of a Competitive Index number to assign attenuation based upon one competition in a large animal studywas further confirmed based on preliminary vaccination results in pigs with 7 mutants (n=8) described below in Example I1. Example 10 20 Characterization of Attenuated A. pleuropneumoniae Virulence Genes TheA. pleuropneumoniae genes identified represent fourbroad functional classes: biosynthetic enzymes, cellular transport components, cellular regulation components and unknowns. The atpG gene, encoding the FI-y subunit of the FF, H+-ATPase 25 complex, can function in production of ATP or in the transport of protons by hydrolyzing ATP. A related aipG attenuated mutant was also identified in P. multocida. Another alp gene, atpH, that encodes the F, 8 subunit was also identified. Phenotypes of alp mutants include non-adaptable acid-sensitivity phenotype (Foster, JBacteriol. 173:6896-6902 (1991)], loss of virulence in Salmonella typhinurium [Garcia del Portillo, et al., Infect 30 Immun. 61:4489-4492 (1993)] and P. multocida (above) and a reduction in both transformation frequencies and induction of competence regulatory genes in Haenophilus influenzae Rd [Gwinn, et al., JBaceriol. 179:7315-20 (1997)]. LpdA is a dihydrolipoamide dehydrogenase that is a component of two enzymatic complexes: pyruvate dehydrogenase and 2 -oxoglutarate dehydrogenase. 47 While the relationship to virulence is unknown. production of LpdA is induced in Salmonella typhimuriun when exposed to a bactericidal protein from human which may suggest that this induction may be involved in attempts to repair the outer membrane [Qi, et al.. Mol Microbiol. 17:523-31 (1995)]. 5 Transpon of scarce compounds necessary for growth and survival are critical in vivo. ExbB is a part of the TonB transport complex [Hantke, and Zimmerman, Microbioloiv Letters. 49:31-35 (1981)]. interacting with TonB in at least two distinct ways [Karlsson, et al., Mol Microbiol. 8:389-96 (1993), Karlsson, et al., Mol Microbiol. 8:379-88 (1993)]. Iron acquisition is essential for pathogens. In this work, attenuated 10 exbB mutants in both APP and P. mulocida have been identified. Several TonB dependent iron receptors have been identified in other bacteria [Biswas, et al., Mol. Microhiol. 24:169-179 (1997), Braun, FEMSMicrobiolRev. 16:295-307 (1995), Elkins, et al., Infect 1nmun. 66:151-160 (1998), Occhino, et al.. Mol Microbiol. 29:1493-507 (1998),Stojiljkovic and Srinivasan, J Bacteriol. 179:805-12 (1997)]. A. 15 pleuropneumoniae produces 2 transfenin-binding proteins, which likely depend on the ExbB/ExbD/TonB system, for acquisition ofiron. PotD is a periplasmic binding protein that is required for spermidine (a polyamine) transport [Kashiwagi, et al., JBiol Chem. 268:19358-63 (1993)]. Another member of the Pasteurellaceae family, Pasteurella haemolvuica, contains a homologue of potD (Lpp38) that is a major immunogen in 20 convalescent or outer membrane protein vaccinated calves [Pandher and Murphy, Vet Microbiol. 51:331-41 (1996)]. In P. haemolytica, PotD appeared to be associated with both the inner and outer membranes. The role of PotD in virulence or in relationship to protective antibodies is unknown although previous work has shown poID mutants of Streptococcus pneumoniae to be attenuated [Polissi, et al., Infect. Immun. 66:5620-9 25 (1998)]. Relatively few "classical virulence factors," such as adhesins or toxins with the exception of homologues to OMP P5 of Haemophilus influenzae, were identified. H. influenzae OMP P5 is a major outer membrane protein that is related to the OmpA porin family ofproteins [Munson, eral., MInfect Immun. 61:4017-20(1993)]. 30 OMP P5 in nontypeable Haenophilus hifuenzae has been shown to encode a firnbrial subunit protein expressed as a filamentous structure [Sirakova, et al., Infect Immun. 48 62:2002-20()994)) that contributes to virulence and binding of both mucin and epithelial cells [Miyamoto and Bakaletz, Alicrob Patihog. 21:343-56 (1996), Reddy. ei al., Infect hnmun. 64:1477-9 (1996), Sirakova, et al., Infect /mun. 62:2002-20 (1994)]. A significant finding was identification of two distinct ORFs that appear to encode OMP 5 P5 homologues. This is also the case with two very similarproteins, MOMP and OmpA2 from Haemophilus ducrevi. It remains to be determined whether both are functionally involved in the production of fimbriae and whether the presence of two such ORFs represents a divergent duplication with redundant or complementing functions. Interestingly, the two OMP P5 mutants seem to have disparate Cl values, suggesting a 10 difference in essentiality or functionality for only one copy. OMP P5 has been shown to undergo molecular variation during chronic infections [Duim, et al.. Infect Innnun. 6.5:1351-1356 (1997)], however, this appears to be restricted to a single gene undergoing point mutations resulting in amino acid changes rather than "type switching" due to differential expression of multiple genes. 15 Protein folding enzymes are important accessories for the efficient folding of periplasmic and extracellular proteins, and two genes were identified whose products have peptidyl-prolyl isomerase activity: fkpA and tig (trigger factor). FkpA is a periplasmic protein that is a member of the FK506-binding protein family [Horne and Young, Arch Microbiol. 163:357-65 (1995); Missiakas, et al., Mol Microbiol. 21:871-84 20 (1996)]. FkpA has been shown to contribute to intracellular survival of Salmonella ryphimurium [Horne, et al., Infect immun. 65:806-10 (1997)] and a Legionella pneunophila homolog, mip [Engleberg, et al.. Ifectlmnun. 57:1263-1270 (1989)], is responsible for virulence and infection of macrophages [Cianciotto, et a.. J. Infect. Dis. 162:121-6 (1990); Cianciotto, et al., Infect. Immun. 57:1255-1262 (1989)]. Tig, or 25 trigger factor [Crooke and Wickner, Proc. Nail. Acad. Sci. USA. 84:5216-20 (1987), Guthrie, and Wickner, J Bacteriol. 172:5555-62 (1990), reviewed in Hesterkamp, and Bukau., FEBSLett. 389:32-4 (1996)], is a peptidyl prolyl isomerase containing a typical FKBP region [Callebaut and Mornon, FEBSLett. 374:211-215 (1995)], but is unaffected by FK506 [Stoller, et al., EMBOJ. 14:4939-48 (1995)). Tighas been shown to associate 30 with the ribosomes and nascent polypeptide chains [Hesterkamp, et a/., Proc Natl Acad Sci USA 93:4437-41 (1996), Stoller, et al., EMBOJ. 14:4939-48(1995)]. Possible roles 49 include an unknown influence on cell division [Guthrie, and Wickner, J Bacteriol. 172:5555-62 (1990)] in E. coli, a role in the secretion and activation of the Strepiococcus ppogenes cysteine proteinase [Lyon, et a/.. EMBO J 17:6263-75 (1998)] and survival under starvation conditions in Bacillus subtilis [Gothel. ei al.. Biochemistrv 37:13392-9 5 (1998)). Bacteria] pathogens employ many mechanisms to coordinately regulate gene expression in order to survive a wide variety of environmental conditions within the host. Differences in mRNA stability can modulate gene expression in prokaryotes [Belasco and Higgins, Genc 72:15-23 (1988)]. For example, rr (vacB) is required for 10 expression of plasmid borne virulence genes in Shigella flexneri [Tobe. el a., J Bacterial. 174:6359-67 (1992)) and encodes the RnaseR ribonuclease (Cheng, et al., J Biol. Chem. 273:14077-14080 (1998)]. PNP is a polynucleotide phosphorylase that is involved in the degradation of mRNA. Null pnp /rnr mutants are lethal, suggesting a probable overlap of function. It therefore is possible that both rnr and pnp are involved 15 in the regulation of virulence gene expression. Apnp mutant ofP. multocida is avirulent in a mouse septicenic model (Example 2)]. Other pnp-associated phenotypes include competence deficiency and cold sensitivity in Bacillus subtilis [Wang and Bechhofer, J Bacterial. 178:2375-82 (1996)]. HupA is a bacterial histone-like protein, which in combination with HupB 20 constitute the HU protein in E. coli. Reports have suggested that hupA and hupB.single mutants do not demonstrate any observable phenotype [Huisman, et al., J Bacteriol. 171:3704-12 (1989), Wada, et al., JMolBiol. 204:581-91 (1988)], however, hupA-hupB double mutants have been shown to be cold sensitive, sensitive to heat shock and blocked in many forms of site-specific DNA recombination [Wada, et al., JMolBiol. 204:581-9] 25 (1988), Wada, et al., Gene. 76:345-52 (1989)]. One limited data previously indicated that hupA is directly involved in virulence [Turner, et al., Infect Immun. 66:2099-106 (1998)]. The mechanism of hupA attenuation remains unknown. DnaK is a well known and highly conserved heat shock protein involved in regulatoryresponses to various stressful environmental changes [reviewed in Lindquist 30 and Craig, Annu Rev Genet. 22:631-77 (1988)]. DnaK is also one of the most significantly induced stress proteins in Yersinia enterocolitica after being phagocytosed 50 by macrophages [Yamamoto, et aI.. Microbiol Immlunol. 38:295-300 (1994)] and a Brucella suis dnaK mutant failed to multiply within human macrophage-like cells [Kohler, et al., Mol Aicrobiol. 20:701-12 (1996)]. In contrast, another intracellular pathogen, Listeria mionocytogenes, did not show induction of dnaK after phagocytosis 5 [Hanawa, et al.. Infect Imniun. 63:4595-9 (1995)]. A dnaK mutant of ibrio cholera affected the production of ToxR and its regulated virulence factors in vitro but similar results were not obtained from in vivo grown cells (Chakrabarti, et al., Infect nmun. 67:1025-1033 (1999)]. The Cl of A. pleuropneumonia dnaK mutant was higher than most of the attenuated mutants although still approximately half of the positive control 10 strain. DksA is a dosage dependent suppressor of filamentous and temperature sensitive growth in a dnaK mutant of E. coli [Kang and Craig, JBaceriol. 172:2055-64 (1990)]. There is currently no defined molecular function for DksA, but the gene has been identified as being critical for the virulence of Salmonella typhimuriun in chickens 15 and newly hatched chicks [Turner, et al., Infect Inmun. 66:2099-106 (1998)]. In that work, it was noted that the dksA mutant did not grow well with glucose or histidine but did grow well with glutamine or glutamate as the sole carbon source. This observation may indicate that the dksA mutant is somehow impaired in the biosynthesis of glutamate [Turner, et al., Infect Immun. 66:2099-106 (1998)]. 20 Three genes were identified that have roles in protein synthesis: tRNA leu, tRNA-glu and rpmF. Excluding protein synthesis, tRNA's also have a wide variety of functional roles in peptidoglycan synthesis [Stewart, et al., Nature 230:36-38 (1971)), porphyrin ring synthesis [Jahn, et al., Trends Biochem Sci. 17:215-8 (1992)), targeting ofproteins for degradation [Tobias, et al., Science 254:1374-7 (1991)], post-translational 25 addition of amino acids to proteins [Leibowitz and Soffer,B.B.R.C 36:47-53 (1969)] and mediation of bacterial-eukaryotic interactions [Gray, et al., J Bacteriol. 174:1086-98 (1992), Hromockyj, et al., Mol Microbiol. 6:2113-24 (1992)). More specifically, tRNA leu is implicated in transcription attenuation [Carter, et al., Proc. Natl. A cad. Sci. USA 83:8127-8131 (1986)], lesion formation byPseudomonas syringae [Rich and Willis, J 30 Bacteriol. 179:2247-58 (1997)] and virulence of uropathogenic E. coli [Dobrindt, et al., FEMS Microbiol Lett. 162:135-141 (1998), Ritter, er al., Mol Microbiol. 17:109-21 51 (1995)]. It is unknown whether the tRNA that we have identified represents a minor species of tRNA-leu in A. pleuropneunoniae. Regardless, it is possible that tRNA-leu may have any one of a wide range of functions. RpmF is a ribosomal protein whose gene is also part of an operon containing fatty acid biosynthesis enzymes in E. coli. Further 5 work will be required to indicate if this is the case in A. pleuropneumoniae, although the same clustering offab genes and rpnF occurs in Haeniophilus influenzoe [Fleischmann, et al., Science 269:496-512 (1995)]. The expression of thefah genes is not necessarily dependent on transcripts originating upstream of rpmF as there has been a secondary promoter identified within rpmF [Zhang and Cronan, Jr., J Bacteriol. )80:3295-303 10 (1998)]. The final class of attenuated mutants includes mutations within genes of unknown function or genes that have not been previously identified. Honologs of vaeA and H10379 have previously been identified in Escherichia coli [Blattner, et al., Science 277:1453-1474 (1997)] and Haemophilus influenzae [Fleischmann, er al., Science 15 269:496-512 (1995)], respectively. The remaining unknowns have been designated Actinobacillus pleuropneumoniae virulence genes (apv). The apvC gene shows significant similarity to H10893, however, the proposed similarity of H10893 as a transcriptional repressor similar to the fatty acid response regulator Bm3RI [Palmer, J Biol Chem. 273:18109-16 (1998)] is doubtful. The apvD gene is also most similar to a 20 putative membrane protein (b0878) with unknown function from E. coli [Blattner, et al., Science 277:1453-1474(1997)). Two otherunknowns, apvA and apvB had no significant matches in the public databases. Example 11 25 Safety and Efficacy of A. pleuropneumoniae Mutants Nine groups (n=8) of SPF pigs (4-5 weeks old, 3-10 kg) were used to determine the safety and efficacy of seven A. pleuropneumoniae mutants as live attenuated vaccine strains. Seven groups were infected intranasally with 10'" CFU of each mutant on day 1, One group was vaccinated on days 1 and 15 with the 30 commercially available vaccine Pleuromune (Bayer), and one naive group was not vaccinated. On day 29, all groups were challenged intranaslally with -1-5 x 105 CFU per 52 pig of wild type APP225. All surviving animals were euthanized and necropsied on day 42 of the study. Results are shown in Table 4. Table 4 5 Efficacy of A. pleuropneunoniae Mutants % Mortality following intranasal Vaccn challenge Vaccination Challenge Pleuromune 0 37.5 exbB 0 0 10 tig 12.5 0 fkpA 12.5 0 H10385 50.0 0 pnp 0 0 yaeE 0 0 15 atpG 0 0 None N/A 50.0 The exbB, atpG, pnp, and vaeA mutants caused no mortality when administered at a dosage of 10'0 CFU intranasally. ThefkpA and ig mutant groups had 20 one death each and the H10379 group (highest April 6, 2000CI of the 7 mutants tested shown in Example 9) had four deaths. Wildtype

LD,

0 using this model was generally I x 10' CFU, indicating that each of these mutants is at least 100 fold attenuated and that there is a reasonable correlation between CI and attenuation. 25 Numerous modifications and variations in the invention as set forth in the above illustrative examples are expected to occur to those skilled in the art. Consequently only such limitations as appear in the appended claims should be placed on the invention. 53 The discussion of documents, acts, materials, devices, articles and the like is included in this specification solely for the purpose of providing a context for the present invention. It is not suggested or represented that any or all of these matters formed part of the prior art base or were common general knowledge in the field relevant to the present invention as it existed before the 5 priority date of each claim of this application. Throughout the description and. the claims of this specification the word "comprise" and variations of the word, such as "comprising" and "comprises" is not intended to exclude other additives, components, integers or steps. 10 53A

Claims (24)

1. 2. The method of claim 1, wherein the screening comprises infecting animals and assessing animal survival, wherein attenuation correlates with increased survival.
2. 3. The bacterium of claim 1, wherein the mutation in said mutated bacterium results in decreased expression of a gene product encoded by the mutated gene, wherein the decreased expression of the gene product attenuates the bacterium.
3. 4. The bacterium of claim 1, wherein the mutation in said mutated bacterium results in expression of an inactive gene product encoded by the mutated gene.
4. 5. The bacterium of claim 1, wherein the mutation in said mutated bacterium results in deletion of all or part of said gene.
5. 6. The bacterium of claim 1, wherein the mutation in said mutated bacterium results in deletion of at least 10% of said gene.
6. 7. The bacterium of claim 1, wherein the mutation in said mutated bacterium results in an insertion in the gene, said insertion causing decreased expression of a gene product encoded by the mutated gene and/or expression of an inactive gene product encoded by the mutated gene. 54
7. 8. An attenuated Pasteurellaceae bacterium according claim I selected from the group consisting of Pasteurella haemolyrica, Pasteurella mulocida, Actinobacillus pleuropneumoniae and Haemophilus somnus.
8. 9. The bacterium of claim I that is Pasteurella mulocida.
9. 10. A vaccine composition comprising the bacterium of claim I and a pharmaceutically acceptable carrier. I. The vaccine composition of claim 10, further comprising an adjuvant.
10. 12. A vaccine composition comprising the bacterium of claim 9 and a pharmaceutically acceptable carrier.
11. 13. The vaccine composition of claim 12, further comprising an adjuvant.
12. 14. A method for producing an attenuated Pasteurellaceae bacterium, said method comprising: a) introducing a mutation in an exbB gene comprising the nucleotide sequence of SEQ ID NO. 13 or SEQ ID NO: 140 or a nucleotide sequence that is at least 70% identical to an exbB nucleotide sequence of SEQ ID NO: 13 or SEQ ID NO: 140, wherein the mutation attenuates the bacterium; b) screening the mutated bacterium for decreased virulence compared to virulence of the unmutated bacterium; and c) selecting as an attenuated bacterium a mutated bacterium with decreased virulence.
13. 15. A purified and isolated polynucleotide selected from the group consisting of: a) a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 13 or SEQ ID NO: 140; b) a polynucleotide comprising a nucleotide sequence that encodes the amino acid sequence set forth in SEQ ID NO: 14 or SEQ ID NO: 141; c) a polynucleotide that hybridizes to the complement of the polynucleotide of (a) or (b) under high stringency conditions; and d) a polynucleotide sharing 70% or greater sequence homology to the polynucleotide of (a). 55
14. 16. A purified and isolated Pasteurellaceae polynucleotide, which comprises a nucleotide sequence that encodes a polypeptide comprising the amino acid sequence of SEQ ID NO: 14 or SEQ ID NO: 141, or a biologically or immunologically active fragment thereof, or a Pasteurellaceae species homolog thereof sharing 70% or greater sequence homology to the amino acid sequence of SEQ ID NO: 14 or SEQ ID NO: 141.
15. 17. The polynucleotide of claim 15, which comprises a nucleotide sequence of SEQ ID NO: 13 or SEQ ID NO: 140, or a fragment thereof, or a Pasteurellaceae species homolog thereof sharing 70% or greater sequence homology to the nucleotide sequence of SEQ ID NO: 13 or SEQ ID NO: 140.
16. 18. The polynucleotide of claim 15, which is a DNA.
17. 19. A vector comprising the DNA of claim 18.
18. 20. The vector of claim 19 that is an expression vector, wherein the DNA is operatively linked to an expression control DNA sequence.
19. 21. A host cell stably transformed or transfected with the DNA of claim 18, in a manner allowing the expression of the encoded polypeptide in the host cell.
20. 22. A method for producing a recombinant polypeptide comprising culturing the host cell of claim 21 in a nutrient medium and isolating the encoded polypeptide from the host cell or the nutrient medium.
21. 23. A method for producing a recombinant polypeptide comprising culturing the host cell of claim 21 in a nutrient medium and isolating the encoded polypeptide from the host cell or the nutrient medium.
22. 24. A purified polypeptide comprising the amino acid sequence of SEQ ID NO: 14 or SEQ ID NO: 141, or a fragment thereof, or a Pasteurellaceae species homolog thereof 56 sharing 70% or greater sequence homology to the amino acid sequence of SEQ TD NO: 14 or SEQ ID NO: 141.
23. 25. An antibody that is specifically reactive with a polypeptide comprising the amino acid sequence of SEQ ID NO: 14 or SEQ ID NO: 141, or a fragment thereof, or a Pasteurellaceae species homolog thereof sharing 70% or greater sequence homology to the amino acid sequence of SEQ ID NO: 14 or SEQ ID NO: 141.
24. 26. The antibody of claim 25, that is a monoclonal antibody. 57