AU2012216267A1 - Chemokine binding activity of viral TNF receptors and related proteins - Google Patents

Abstract

CANRPonbl\DCC\GRS\4S40X)2_l DOC-15/8I/Oi2 Chemokine binding activity of viral TNF receptors and related proteins Abstract Chemokine binding activity of viral TNF receptors and related proteins. The invention relates to a C-terminal domain (CTD) of viral tumour necrosis factor receptors (vTNFRs) CrmB or CrmD or CTD homologues (CTD1, CTD2 and CTD3) from poxvirus and their functional homologues, including derivatives, and fragments, for use in binding chemokines and their analogues and/or to enhance the immunomodulatory properties of TNFRs or in bloking binding of chemokines to their corresponding cell surface receptors and/or to modulate chemokine biological activity.

Description

Australian Patents Act 1990 - Regulation 3.2 ORIGINAL COMPLETE SPECIFICATION STANDARD PATENT Invention Title: Chemokine binding activity of viral TNF receptors and related proteins The following statement is a full description of this invention, including the best method of performing it known to me: P/00/01 I WO 2006/024533 PCT/EP2005/009449 Chemokine binding activity of viral TNF receptors and related proteins This invention relates to the use of the C-terminal domain (CTD) of the tumour 5 necrosis factor receptors (TNFRs) encoded by poxviruses and named cytokine response modifier B and D (CrmB and CrmD) and homologues, derivatives or fragments thereof to modulate chemokine activity and to enhance the immunomodulatory properties of TNFRs. It also relates to fusion polypeptides, pharmaceutical compositions and test kits comprising the proteins of the invention. 10 Background of the invention Poxviruses are complex DNA viruses that encode up to 200 genes. Variola virus (VaV) was the causative agent of smallpox, one of the.most devastating human diseases 15 that was eradicated as a result of the use of vaccinia virus (VV) as a smallpox vaccine in the WHO global eradication campaign. Cowpox virus (CPV) is related to VV and is thought to be a rodent virus that causes sporadic infections in a number of mammals. Ectromelia virus (EV) is a natural mouse pathogen and the causative agent of mousepox, a generalized mouse disease with similarities to human smallpox. 20 The immune response has evolved as an efficient mechanism of protection from infection by pathogens such as viruses. To replicate in the immunocompetent host, viral mechanisms to evade the immune response have evolved (Alcami & Koszinowski, 2000). Poxviruses encode a broad variety of proteins that counteract the host immune 25 response (Alcami, 2003, Seet et al., 2003). One of the immunomodulatory mechanisms encoded by poxviruses is the production of secreted proteins that bind cytokines, a family of proteins that regulate the immune response. Four secreted TNFRs encoded by poxviruses have been described, and named 30 Cytokine response modifier B (CrmB), CrmC, CrmD and CrmE (Hu et al., 1994, Loparev et al., 1998, Saraiva & Alcami, 2001, Smith et al., 1996). These proteins have amino acid sequence similarity to the cysteine-rich domains (CRDs) present in the human TNFRs and constituting the TNF binding extracellular domain. The viral proteins lack the transmembrane and intracellular domains of the cellular TNFRs (Fig. 1 and 2).

WO 2006/024533 PCT/EP2005/009449 2 All four vTNFRs have been shown to be secreted from virus-infected cells, to bind TNF and to block TNF biological activity. The CRDs of vTNFRs are predicted to bind TNF, and this has been demonstrated for the CrmB homologue encoded by 5 myxoma virus (M-T2) (Schreiber et al., 1997), and our own experiments showing that the three N-terminal CRDs of CrmD encode TNF binding and inhibitory activity (see below). Representative members of two of the vTNFRs namedCrmB and CrmD are: CPV CrmB (SEQ ID N* 11 and 12), VaV CrmB (SEQ ID No 9 and 10), CPV CrmD (SEQ ID N* 10 1 and 2) and EV CrmD (SEQ ID No 3 and 4). CrmB and CrmD have an additional CTD with no amino acid sequence similarity to cellular proteins in the databases (Fig. 1 and 2). This domain is not required for TNF binding and its function has not been defined. Three open reading frames (ORFs) encoded by poxviruses have amino acid sequence similarity to the CTD of vTNFRs. Representative members of these ORFs are EV E12 15 (CTD1) (SEQ ID N* 5 and 6) , EV E184 (CTD2) (SEQ ID N* 19 and 20), and CPV B21RN218 (CTD3) (Accession No. 072758 and SEQ ID N* 13 and 14) (Fig. 1 and 2). A number of secreted proteins that bind chemokines have been described in several poxviruses and herpesviruses (Alcami et al., 1998, Bryant et al., 2003, Graham 20 et al., 1997, Lalani et al., 1997, Parry et al., 2000, van Berkel et al., 2000) (Table 1). These virus-encoded chemokine binding proteins (vCKBPs) have no amino acid sequence similarity to the cellular seven-transmembrane-domain chemokine receptors or other cellular proteins (Alcami, 2003, Seet et al., 2003, Seet & McFadden, 2002). Structural and functional studies on the 35kDa vCKBP encoded by CPV and M3 25 encoded by murine gammaherpesvirus 68 (MHV-68) have demonstrated that these viral proteins represent novel protein domains or structures that have the ability to bind chemokines (Alexander et al., 2002, Carfi et al., 1999). The ability of some of the vCKBPs to block leukocyte migration into infected tissues and viral pathogenesis has been demonstrated (Bridgeman et al., 2001, Graham et al., 1997, Johnston & 30 McFadden, 2004, Lalani et al., 1999, Reading et al., 2003). The C-terminal domain (CTD) of the viral TNF receptors (vTNFRs) cytokine response modifier B (CrmB) and CrmD have no ascribed function to date and no sequence similarity to host proteins. We found that this domain confers these vTNFRs WO 2006/024533 PCT/EP2005/009449 3 the ability to bind several chemokines, and that the CTD expressed independently of the TNF binding domain of vTNFRs binds chemokines. This protein domain is also found in three additional poxvirus-encoded proteins predicted to be secreted, and we show that two of them encoded by the E12 gene of ectromelia virus (EV) and B21R gene of 5 cowpox virus (CPV) bind chemokines. We propose that the CTD of vTNFRs defines a novel structural domain that binds chemokines. These proteins may modulate chemokine activity in vivo and be used to modulate adverse immune and inflammatory responses in a number of human disease conditions. The expression of this CTD fused to soluble TNFRs may enhance the immunomodulatory properties of TNFRs already 10 used in the clinic. In addition, the CTD enhance the TNF binding activity of the N terminal cysteine-rich domains of vTNFRs, and vTNFRs bind other members of the TNF ligand superfamily. Summary and description of the invention 15 A first aspect of the present invention, comprises a C-terminal domain (CTD) of viral TNF receptors CrmB and/or CrmD from poxvirus and their homologues CTD1, CTD2 and CTD3 from poxvirus, including functional homologues, derivatives, and fragments, for use in binding chemokines and their analogues and/or to enhance the 20 immunomodulatory properties of TNFRs. A preferred aspect of the invention comprises CTD from CrmB and/or CrmD from poxvirus and their functional homologues CTD1, CTD2 and CTD3 from poxvirus, including homologues, derivatives, and fragments, for use in blocking binding of 25 chemokines to corresponding cell surface receptors and/or to modulate chemokine binding activity. Homologues of the CTD from CrmB and/or CrmD from poxvirus can be obtained, e.g. by mutation of the nucleotide sequences encoding the CDT from CrmB and/or CrmD 30 and expression from the mutated sequence, and/or by use or derivation from related gene sequences. Alternatively, they can be obtained, e.g. by identifying gene sequences homologous to the CTD from CrmB and/or CrmD by screening databases containing either protein sequences or nucleotide sequences encoding proteins, for example by screening the Swissprot database in which homology can be determined using the Blast WO 2006/024533 PCT/EP2005/009449 4 program, e.g. using any of the possible algorithms. An acceptable level of homology over the whole sequence is at least about 20%, e.g. about 30%. Homology of a functional fragment of the CTD from CrmB and/or CrmD with other proteins can be lower than this, e.g. about 10%. 5 Functional homologues, including derivatives or fragments of the CTD from CrmB or CrmD or the CTD homologues (CTD1, CTD2 and CTD3) can be checked for their capacity to bind chemokines by appropriate methods equivalent to the cross-linking assays using for example radiolabelled chemokines or with other methods measuring 10 protein-protein interactions such as Surface Plasmon Resonance (SPR, BlAcore). In a more preferred embodiment of the invention, the CTD from CrmB comprises any of SEQ ID N* 26 or SEQ ID N* 28; the CTD from CrmD comprises any of SEQ ID N* 22 or SEQ ID N* 24; and the CTD homologues (CTD1, CTD2 and CTD3) comprises any 15 of the following: SEQ ID N" 8, SEQ ID N* 14, SEQ ID N* 6, SEQ ID N"20, SEQ ID N 0 18, SEQ ID N 0 16 and the proteins encoded by genes CPV V201 (Accession No. Q8QMP4), D12L (Accession No. P87598), B6R (Accession No. 072743) or B21R (Accession No. 072758). 20 A second aspect of the invention provides a nucleic acid molecule which encodes for the CTD of the invention including homologues derivatives, and fragments. It also falls within the invention the complementary strand of the latter nucleic acids; and a nucleic acid molecule which differs from the sequence coding for a CDT according to the invention including homologues, derivatives and fragments due to the degeneracy of the 25 genetic code. In a preferred embodiment of the invention, the sequences coding for the CTD from CrmB comprises any of SEQ ID N* 25 or 27; the sequences coding for the CTD from CrmD comprises any of SEQ ID N 0 21 or SEQ ID N* 23; and the sequences coding 30 for the CTD of the functional homologues comprises any of the sequences encoded by the following genes: V014 (SEQ ID N 0 7), V201, V218 (SEQ ID N 0 13), D12L, B6R, B21R, E12 (SEQ ID N* 5), E184 (SEQ ID N 0 19), VACWR189 (SEQ ID N 0 17) or VACWR206 (SEQ ID N 0 15) (fig. 1 and 2).

WO 2006/024533 PCT/EP2005/009449 5 According to a third aspect of the invention, a fusion polypeptide can be made comprising any of the CTD from CrmB or CrmD or CTD homologues (CTD1, CTD2 and CTD3), including functional homologues, derivatives and fragments fused to a polypeptide sequence of the same or other origin. 5 In a preferred embodiment of the invention, the CTD from CrmB or CrmD or CTD homologues (CTD1, CTD2 and CTD3) including functional homologues, derivatives and fragments can be coupled with other substances, either covanlently or non-covanlently. Coupling products can be fusion proteins. The expression of CTD fused to soluble 10 TNFRs enhances the immunomodulatory properties of TNFRs already use in clinic. The C-terminal domain provides a molecular scaffolding that enhances the TNF binding activity of the N-terminal CRD; e.g. CRD (1, 2) binding properties are enhance in this way. In addition this enhancement can make vTNFRs bind other members of the TNF ligand superfamily. 15 Thus in a further aspect of the invention, the fusion polypeptide comprises the CTD from CrmB or CrmD or their CTD homologues (CTD1, CTD2 and CTD3), including functional homologues, derivatives and fragments fused to the N-terminal TNF binding domain of vTNFRs, preferably fused to TNFRs of human origin. 20 In a still further embodiment of the invention, the fusion proteins made comprising any of the CTD from CrmB or CrmD or CTD homologues (CTD1, CTD2 and CTD3), including functional homologues, derivatives and fragments fused to a polypeptide sequence of other origin confers chemokine binding properties to the latter. 25 For certain purposes, coupling partners can be coupled to the CTD from CrmB or CrmD or their CTD homologues (CTD1, CTD2 and CTD3), including functional homologues, derivatives and fragments by known chemical coupling methods, for example biotinylation of one partner and derivatisation of the other with a binding partner 30 of biotin, such as avidin. Any of the CTD from CrmB or CrmD or their CTD homologues (CTD1, CTD2 and CTD3), including functional homologues, derivatives and fragments as described above (Proteins of the Invention), can for example be used to bind either chemokines and their 6 analogues with an animal species origin or specificity corresponding to the host range of the parent virus from which the protein comes, and/or chemokines and their analogues with human origin and/or specificity. 5 Amongst derivatives of the Proteins of the Invention which are within the scope of the invention are polypeptides having eequences encoding for proteins of the Invention modified by deletion or substitution, which retain the chemokine binding properties of the protein of the invention. For example, it can be useful to delete any immunogenio amino acid motifs, or replace such motifs with a less Immunogenic amino acid sequence. 10 Alternatively, a modification which can Induce immunological tolerance In a host can be introduced into the sequences that code forthe Proteins of the Invention. The invention also extends to nucleotide sequences e.g. DNA cassettes Incorporating suitable promoters (from a specific tissue or a constitutive promoter) 15 encoding the proteins of the invention and Its modified forms including homologues, such as fragments or their fusion products with other polypeptides, and such expression cassettes included in suitable plasmid or other vectors, e.g. viral vectors. The Proteins of the invention can for example be used to bind C chemokines, CC 20 chemokines, CXC chemokines or CX3C chemokines. In accordance with an aspect of the invention, the Proteins of the invention can be used to block the binding of such chemokines to their receptors or to Inhibit the biological activity, whether In-vitro, e.g. In biological samples or In-vivo. 25 This effect can be exploited for example in specific binding tests using labelled reactants, e.g. for diagnostic and measurement purposes. The labelled reactant can be either of the Proteins of the invention, or a chemokine, or a chemokine receptor, according to the configuration of the test for desired purposes in hand. 30 Accordingly, an aspect of the invention also lies in compositions for carrying out such tests, e.g. the labelling product of the proteins of the invention; calibrated test aliquots of either of these: the product of binding the proteins of the Invention to a solid phase suitable to take part In a specific binding test as mentioned herein; calibrated test aliquots of one of the binding partners in the reaction; and test kits associating two or WO 2006/024533 PCT/EP2005/009449 7 more of such reagents. The test can be for example an assay for a chemokine or for a chemokine receptor. The binding effect can also be exploited in the inhibition of effects mediated by 5 chemokines that can be bound by the Proteins of the Invention. According to a further aspect of the invention a pharmaceutical composition comprising a CTD from CrmB and/or CrmD and/or the CTD homologues (CTD1, CTD2 and CTD3), and/or functional homologue, derivative or fragment thereof and/or fusion 10 with other proteins and/or expression cassettes and/or plasmids or other vectors, can be used in binding to a chemokine or a chemokine analogue in vivo, or in blocking binding of a chemokine to a corresponding cell surface receptor in vivo, to produce an immunomodulatory effect. 15 According to a still further aspect of the invention a pharmaceutical composition can comprise a protein of the invention, for use as an anti-inflammatory agent, in appropriate therapeutic (anti-inflammatory) amount. The proteins of the invention can be formulated with compatible per se 20 conventional pharmaceutical excipients for delivery to a subject to be treated. According to a preferred embodiment of the invention, a nucleotide sequence encoding any of the proteins of the invention or fusion proteins comprising the Proteins of the Invention can be inserted under control of a suitable promoter. The gene delivery 25 system can be a viral or non viral vector system. Such a vector can be used to confer on a target transfected cell the ability to produce the proteins of the invention for example for anti-inflammatory purposes when the target cell is in-vivo in a host that is the subject of treatment. Such anti-inflammatory purposes can include for example use to inhibit effects mediated by chemokines, e.g. by chemokines which promote or are associated 30 with disease, for example an inflammatory disease such as rheumatoid arthritis. Anti inflammatory purposes also include reduction of host immune response against elements of the vector delivery system and/or against other gene products expressed in the target cell after gene delivery by a vector system, whether it is from the same vector WO 2006/024533 PCT/EP2005/009449 8 as that which delivers the proteins of the invention or from a separate delivery vector for such another delivered gene. The proteins of the inventions or vectors expressing the Proteins of the Invention 5 can be administered to cells in vivo, for example by any suitable systemic delivery route. Alternatively the administration can be targeted, e.g. by direct injection, such as by intravenous injection at or near the site of the target cells and/or site of inflammation in the subject to be treated. 10 Forms of administration can be chosen to limit the immune response of the host to the proteins of the invention. For example, the proteins of the invention or a vector system expressing them can be delivered with another immunosuppressant or anti inflammatory substance. 15 A still further aspect of the invention relates to VV vaccines against free of the proteins of the invention and/or vTNFRs. Some vTNFRs and CTD-related proteins are expressed by some VV strains used as smallpox vaccine in humans or as recombinant viral vectors for expression of proteins from other pathogens to induce immunity. Neutralization of the chemokine binding activities of these proteins may decrease 20 adverse effects reported after smallpox vaccination with W, by limiting viral replication and/or virus-induced immunopathology. Antibodies or reagents that neutralize the chemokine binding activity of the vTNFRs or CTDs can attenuate human smallpox, protect from fatal human smallpox and reduce the adverse effects caused by VV vaccination. 25 Another aspect of the invention includes a method of detection of a chemokine or chemokine analogue by incubating a sample that contains a chemokine or chemokine analogue with a reagent comprising the Proteins of the Invention. 30 Another aspect of the invention refers to the use of the Proteins of the Invention to produce a medicament to treat the adverse effects caused by W vaccination or the pathology caused by smallpox, based on antibodies to the Proteins of the Invention or reagents that inhibit the chemokine binding activity of vTNFRs or the CTD homologues.

WO 2006/024533 PCT/EP2005/009449 9 Other aspects of the present invention will result obvious to a person of ordinary skill in the art. Brief description of the Figures 5 Fig. 1. Schematic representation of vTNFRs and CTD homologues in different viruses. The gene name in each virus is indicated. Fig. 2. Multiple sequence alignment of vTNFRs CrmB and CrmD with CTD 10 homologues. Fig. 3. Identification of EV CrmD as an IL-8 (CXCL8) binding protein. (a) Cross linking of 1251-IL-8 to media from EV-infected cells showed the presence of an IL-8 binding activity not expressed by VV. (b) EV full-length CrmD expressed from a 15 recombinant VV binds IL-8 whereas CrmD CRD(1-4) does not. (c) Binding of 1251-IL-8 to recombinant CrnD was not inhibited in the presence of excess human or mouse TNF. (d) Cross-linking of 1251-IL-8 to CPV CrmD and CrmB expressed in the baculovirus system. 20 Fig. 4. Role of the CrnD CRD and CTD in TNF binding and activity inhibition. (a) Schematic representation of the constructs containing combinations of the EV CrmD CRDs and CTD. (b) Competition of binding of 1251-TNF to U937 cells by supernatants from cells infected with W recombinants expressing the indicated CrmD constructs. (c) Biological activity of recombinant CrmD constructs determined as the percentage of 25 TNF-induced cytotoxicity in mouse L929 cells in the presence of increasing doses of supernatants of cells infected with the indicated recombinant Ws or VV WR. (d) Inhibition of TNF-induced cytotoxicity by supernatants from cells infected with the indicated recombinant baculoviruses, 30 Fig. 5. Chemokine binding to EV CrmD. Purified recombinant EV CrmD protein was amine-coupled to a CM5 biosensor chip to a level of 5000RU. This chip was used to screen the binding to all commercially available human chemokines in a BlAcoreX (Uppsala, Sweden). In all cases, 30pl of a 100nM chemokine solution was injected at 10pl/min flow. Maximum binding level was plotted against the binding level after 120s of CERPwotbnDCCORW42858._a.DC-12/122noI 10 dissociation (stability of complex) for each chemokine. Inset: Affinity constants for the shown chemokines as determined by SPR kinetic analyses. For kinetic analyses, purified recombinant EV CrmD protein was amine-coupled to a CM5 biosensor chip to a level of 1200RU (Rmax<200RU). Different chemokine concentrations were injected at a flow rate of 30pl/min for 2 min and dissociation monitored for an additional 5 min. Fitting of the curves was performed with the BlAevaluation software using a 1:1 Langmuir binding model. Fig. 6. Alignment of the amino acid sequence of camelpox virus (CMLV) and VaV CrmB proteins. Conserved residues are indicated with an asterisk. Positions mutated are shown in red. The CRD (1-4) and CTD are indicated. Fig. 7. Different domains of VaV CrmB bind to TNF and chemokines. Binding of human TNFa (red) and human CXCL12D (CK, blue) to full-length VaV CrmB, VaV CrmB CRD (1-4) or VaV CrmB CTD purified proteins analyzed by SPR. Fig. 8. Inhibition of TNF and chemokine biological activity by VaV CrmB. (a) Inhibition of TNF-induced cytotoxicity. TNF was preincubated for 2 h at 37C with the indicated amount of purified recombinant proteins in 1 00 l of complete DMEM supplemented with actinomycin D (4pg / ml). The mixture was then added to 2x10 4 L929 cells seeded the day before in 96-well plates and cell death assessed 16 to 18 h later. O.D. 490nm of cuadruplicates (mean ± SD) is plotted each case. "Celulas" / "cel ActD": controls for cell viability; "TNF": control for cell death; "CrmB": TNF preincubated with VaV CrmB; "CRD": TNF preincubated with VaV CrmB CRD(1-4); "IgG1": TNF preincubated with IgG1, control for specificity. (b) Chemotaxis assay. Human CCL25 (1OOnM) alone or in the presence of increasing amounts of purified recombinant protein was incubated at 37C for 30 minutes and placed in the lower compartment of a 24well-Transwell chamber. After this period, 5 x 105 MOLT-4 cells were added in 100pl complete RPMI containing 0.1 % FCS to the top well and the plate incubated in a 37*C for 4 hours. % of migration of MOLT-4 cells towards the bottom well was determined by FACS analysis. 100% migration was set as the number of cells that migrate in the presence of chemokine only. Fig. 9. Chemokine binding to VaV CrmB. Purified recombinant VaV CrmB protein was amine-coupled to a CM5 biosensor chip to a level of 5000RU. This chip was used to screen the binding to all commercially available human chemokines in a BlAcoreX (Uppsala, Sweden). In all cases, 30pl of a 1OOnM chemokine solution was injected at 10pl/min flow. Maximum binding level was plotted against the binding level after 120s of C.R"orblrDCCiGRS\442859_1.DOC-12/12/201I 11 dissociation (stability of complex) for each chemokine. Inset: Affinity constants for the shown chemokines as determined by SPR kinetic analyses. For kinetic analyses, purified recombinant VaV CrmB protein was amine-coupled to a CM5 biosensor chip to a level of 1200RU (Rmax<200RU). Different chemokine concentrations were injected at a flow rate of 30pl/min for 2 min and dissociation monitored for an additional 5min. Fitting of the curves was performed with the BlAevaluation software using a 1:1 Langmuir binding model. Fig. 10. Fusion of the W 35kDa vCKBP to CRD(1-4) of VaV CrmB confers CrmB the ability to bind chemokines. (a) Cross-linking assay for chemokine binding. Supernatants from High5 cells mock-infected of infected with the recombinant baculoviruses "Bac VaV CrmB CRD(1-4)" (Bac106), "Bac VaV CrmB" (Bac107), and "Bac VaV CrmB CRD(1-4)/35K" (Bac109) were incubated with 400pM of 1 2 s1-CCL3. Complexes between the recombinant proteins and CCL3 were cross-linked by using EDC and products analysed by SDS-PAGE and autoradiography. (b) Inhibition of TNF-induced cytotoxicity. TNF was preincubated for 2h at 37C with the corresponding supernatants in 100 pl of complete DMEM supplemented with actinomycin D (41g / ml). The mixture was then added to 2x1 04 L929 cells seeded the day before in 96-well plates and cell death assessed 16 to 18 h later. O.D. 490nm is plotted against the different samples. Detailed description of the invention The invention, and materials and methods applicable to carrying out embodiments thereof, are further illustrated in the following examples, but without intent to limit its scope. Examples WO 2006/024533 PCT/EP2005/009449 12 Example 1: Materials and Methods 1.1.- Poxviruses CPV, EV and VV were propagated in vitro by infecting confluent monolayers of Bsc-I cells. 5 1.2.- Cloning of camelpox CrmB and generation of VaV CrmB ORF 264 of strain CMS of camelpox virus, corresponding to the CrmB gene was amplified by PCR using oligonucleotides CMLV 264 Eco (5' GCGGAATTCATGAAGTCCGTATTATACTCG) and CMLV 264 Xho (5' 10 GCGCTCGAGTAAAAAGTGGGTGGGTTTGG) and purified CMLV DNA as a template. The PCR product was cloned into EcoRl / Xhol digested pBacl (Novagen) to generate plasmid pRA1. The absence of mutations in the amplified gene was confirmed by DNA sequencing. The DNA corresponding to the VaV (strain Bangladesh 1975; ORF 188) was obtained by multiple-site directed mutagenesis of plasmid pRA1 using the 15 "QuikChange Multi Site-Directed Mutagenesis Kit (Stratagene)" following the manufacturer's instructions. The mutations introduced are shown in Fig. 6. After several consecutive rounds of site-directed mutagenesis, plasmid pRA105 was obtained. This plasmid contains the sequence coding for VaV (BSH 1975 strain) CrmB fused to a C terminal His tag provided by the original pBacl plasmid. The presence of all the 20 mutations and absence of unwanted additional mutations was confirmed by direct sequencing. 1.3.- Construction of recombinant baculoviruses and vaccinia viruses expressing CrmD from EV or CPV 25 For expression in the baculovirus system, DNA encoding full length or truncated versions of CrmD (Table 3) was PCR-amplified with the specific oligonucleotides (Table 4), and cloned into pBAC-1. Recombinant baculoviruses were generated by homologous recombination in SF21 insect cells transfected with recombinant pBAC-1 plasmids and the linearized baculovirus DNA as described (Alcami et al., 1998). 30 vTNFRs were also expressed from a VV expression system. The genes of interest were cloned into pMJ601 for expression of the gene from a strong VV promoter (Davison & Moss, 1990). The gene of interest is inserted into the thymidine kinase locus of the VV genome by homologous recombination, and the recombinant VV selected in C WRPonbrDCCPGM4OG 285a.DOC-12IlOiII 13 the presence of bromodeoxiuridine and identified by colour selection (expression of p-galactosidase and staining with X-gal). VTNFRs were expressed from VV Western Reserve, a virus strain that does not encode TNF binding activity (Alcami et al., 1999). 1.4.- Generation of recombinant baculoviruses expressing VaV CrmB, VaV CrmB CRD(1-4), VaV CrmB CTD, EV E12, EV E184, CPV V218 and VaV CrmB CRD(1-4) fused to CPV 35kDa protein The full length VaV CrmB gene fused to a C-terminal His tag was subcloned into EcoRI / Sphl digested pFastBacl (Invitrogen) to generate pRA107. The N-terminal domain of VaV CrmB including the four CRDs and corresponding to residues 1 (M) to 192 (C) was amplified by PCR using oligonucleotides VaV 188 Eco (5' GCGGAATTCATGAAGTCCGTATTATACTTG) and VaV 188 CRDs1-4 Xho (5' GCGCTCGAGACACGATGTGTCGTTAACTGG) using pRA107 as a template. The amplified fragment was cloned in-frame with a C-terminal his tag provided by the EcoRI / Xhol digested pBacl (Novagen) to generate pRA99. pRA99 was digested with EcoRI / Sphl and the fragment carrying the VaV CrmB CRDs 1 to 4 fused to the His tag cloned into pFastBacl as before to generate pRA1 06. The CTD of VaV CrmB (residues T1 94 to L348) was PVR amplified with oligonucleotides VaV 188 Cter-PflMI (5' CGCCCACCCAATGGAACTAGGACGACCAC-TACCGG) and H347R 3 using pRA107 as a template. This fragment was digested with Pfmll and Xhol and cloned into pRA107 digested with the same enzymes. This generates pRA108, a plasmid that encodes a fusion protein composed of the 29 N-terminal residues of VaV CrmB (which includes the predicted signal peptide) followed by the CTD of CrmB and an additional His tag. The absence of unwanted mutations in pRA106, pRA107 and pRA108 was confirmed by sequencing the complete inserts in all cases. The EV gene E12 was amplified by PCR using oligonucleotides El (5'-GCGGGA TCCATGATAAACATAAACATAAACACAATAC) and E2 (5'-GCGGCGGCCGCAT TAATAGTTCTAGTAGCGCAAG) and purified EV (strain naval.Cam) DNA as a template. The PCR product was cloned into Barn HI / Not I digested pBacl (Novagen) generating plasmid pMS51. The E12 gene was subcloned into Barn HI / Xho I-digested pRA106 to give plasmid pAH18, which contains the E12 gene fused to a C-terminal sequence coding for a His-tag in a pFastbac (Invitrogen) backbone. The CPV Brighton Red strain ORF V218 was PCR-amplified using WO 2006/024533 PCT/EP2005/009449 14 oligonucleotides 5V218 EcoRi (5'-CGCGAATTCATGATGATATACGGATTAATAGC) and 3'V218 Sall (5'-GCGGTCGACACCATCGACACCACTCATC) and purified viral DNA as a template. The PCR product was cloned into Eco RI / Xho I digested pRA106 to generate plasmid pAH17, which contains the CPV V218 gene fused to a C-terminal 5 sequence coding for a His-tag in a pFastbac (Invitrogen) backbone. The fragment corresponding to residues S23 to V246 of the CPV (strain Brighton Red) 35kDa protein was PCR-amplified using oligonucleotides 5'35KBR-S23 (5' CGCCTCGAGTCATTCTCATCCTCATCCTC) and 3' 35KBR (-stop)(5' CGCCTCGAGGACACACGCTATAAGTTTTGC) and purified viral DNA as a template. 10 The PCR product was cloned into Xho I digested pRA106 to generate plasmid pRA109. This plasmid carries the sequence encoding VaV CrmB CRD (1-4) fused in frame to the sequence encoding CPV 35kDa vCKBP without its signal peptide and with a C-terminal His tag in a pFastBac backbone (Invitrogen). 15 Recombinant baculoviruses were obtained using the Bac-to-Bac expression system (Invitrogen) as described by the manufacturer. Briefly the plasmids pRA106, pRA107, pRA108, pRA109, pAH17 and pAH18 were transformed into competent DH1OBac bacteria, were a transposition event generates the corresponding recombinant bacmids. These were purified and transfected into High5 insect cells and three days 20 after trasnfection, the recombinant baculoviruses vBac106, vBac107, vBacl08, vBac1O9, vBacAH17 and vBacAH18 harvested from the cell culture supernatants. These viruses were further amplified in one single step to generate a high titer recombinant virus stock for protein production. 25 The E184 gene from EV was PCR-amplified with the oligonucleotides 5'E184 (5' GCGGAATTCATGTATAAAAAACTAATAACGTTT) and 3'E184 Xhol (5' CGCCTCGAGAAAATCATATTTTGAATAATATGTA) and purified EV DNA as template. The PCR product was cloned into the pRA106 plasmid digested with EcoRI and Xhol, generating pAH11. The correct DNA sequence was confirmed. Plasmid pAH11 was 30 used to generate the recombinant baculovirus vBacAH11, as described above, expressing the EV E184 protein fused to a histidine tag to facilitate the purification of the protein.

WO 2006/024533 PCT/EP2005/009449 15 1.5.- Protein expression and purification To express the recombinant proteins, High5 cells were infected at high multiplicity (10pfu/cell) and the supernantants from infected cultures harvested at three days post infection (d.p.i.). The presence of proteins in these supernatants was 5 confirmed by Western blot and / or, in the case of the full length and N-terminal VaV CrmB constructs, a TNF binding assay in solution (Alcami et al., 1999). The samples were concentrated to approximately 2.5ml on a stirred ultrafiltration cell (Amicon) using YM-3 membranes (Millipore) and buffer exchanged into binding buffer (50mM phosphate, 300mM NaCl, 10mM Imidazole, pH 7.4) on PD-10 desalting columns 10 (Amersham-Pharamcia Biosciences). The His-tagged recombinant proteins were affinity purified using Vivapure Metal Chelate columns (Vivascience) following the manufactrer's recommendations. The purity and ammount of purified proteins was checked on Coomassie-blue stained SDS-polyacrylamide gels. For TNF protection and chemotaxis inhibition assays, recombinant proteins were dialyzed against PBS. 15 1.6.- Biomolecular interaction analysis by Surface Plasmon Resonance (SPR) Cytokine binding specificity and affinity constants were determined using a BlAcore X biosensor (Biacore, Uppsala, Sweden). For ligand screening experiments, purified recombinant proteins were amine-coupled to CM5 chips to a level of aprox. 5000 20 RU (5000 pg/mm 2 ) in each case. Comercially available cytokines (Peprotech, R&D Systems) were then injected at 100nM in HBS-EP buffer (10mM Hepes, 150 mM NaCl, 3mM EDTA, 0.005 % (v/v) surfactant P20; pH 7.4) at a flow rate of 5 pl/min and association and dissociation monitored. The surface was regenerated after each injection using 10mM glycine-HCI pH2.0. For kinetic analysis, the recombinant proteins 25 were immobilised at low densities (Rmax < 200RU). Different concentrations of the corresponding analyte were then injected at a flow rate of 30 pl/min over a 2min period and allowed to dissociate for an additional 5min. All Biacore sensorgrams were analysed using BlAevaluation 3.2 software. Bulk refractive index changes were removed by subtracting the reference flow cell responses and the average response of a blank 30 injection was subtracted from all analyte sensorgrams to remove systematic artifacts. Kinetic data were globally fitted to a 1:1 Langmuir model.

C:WRPortbliDCCM'iRWO42B58_l.DOC-121i22i 20 16 1.7.- Inhibition of TNF-induced cytotoxicity TNF-induced cytotoxicity assays were performed on mouse L929 cells as described previously (Loparev et al., 1998, Saraiva & Alcami, 2001, Schreiber et al., 1997, Smith et al., 1996). TNF (20ng/ml) (R&D Systems) was preincubated for 2 h at 37C with purified recombinant proteins i 100 1d of complete DMEM supplemented with actinomycin D (4ptglml) (Sigma). The mixture was then added to 2x10 4 cells seeded the day before in 96-well plates and cell death assessed 16 to 18 h later using the "CellTiter 96@ Aqueous One Solution cell proliferation assay" (Promega) following the manufacturer's recommendations. 1.8.- Chemotaxis assay The migration of MOLT-4 cells was assessed using 24 well Transwell@ plates with 3m pore size filters (Costar) as described previously (Zaballos et al., 1999). Briefly, human CCL25 (100nM) (R&D Systems) alone or in the presence of increasing amounts of purified recombinant protein was incubated at 37C for 30 minutes and placed in the lower compartment. After this period, 5 x 10 5 MOLT-4 cells were added in 100 Id complete RPMI containing 0.1 % FCS to the top well and the plate incubated in a 37 0 C, 5% CO 2 , 95% humidified incubator. Migration of MOLT-4 cells towards the bottom well was determined after 4 hours by flow cytometry. Example 2: Results 2.1.- The vTNFR CrnD encoded by EV and CPV binds chemokines Searching for novel viral secreted proteins that bind chemokines, we performed cross linking assays with 1251-CXCL8 and identified a novel secreted vCKBP encoded by the poxvirus EV (Fig. 3a). This activity was absent in VV samples and of higher molecular size than the 35kDa vCKBP encoded by W and other poxviruses, a protein that can cross-link CXCL8 but does not block its biological activity due to its low affinity for CXCL8 (Alcami et al., 1998, Graham et al., 1997, Lalani et al., 1998). Unexpectedly, we found that the vTNFR CrmD encoded by EV, known to bind TNF, has the additional property of binding CXCL8 (Fig. 3b). Using truncated versions of the CrmD protein expressed in the VV expression system, we have shown that the 3 N-terminal CRDs of CrmD are necessary to block TNF activity (Fig. 4a,b,c) and the CTD is not necessary for WO 2006/024533 PCT/EP2005/009449 17 TNF binding but confers CrmD the ability to bind chemokines (Fig. 3b). Different domains of CrmD appear to be involved in TNF and chemokine binding since cross linking of CXCL8 to CrmD cannot be blocked in the presence of TNF (Fig. 3c) and binding of TNF to CrmD is not inhibited in the presence of CXCL8 (not shown). Using the 5 Surface Plasmon Resonance (SPR, BlAcore X) technology we have tested the potential interaction of purified EV CrmD to all commercially available chemokines of human and mouse origin, and have identified that CrmD binds with high affinity several chemokines (Fig. 5). 10 2.2.- The vTNFR CrmB encoded by CPV and VaV binds chemokines To test whether the other vTNFR encoding an extended CTD binds chemokines, we expressed CrmB from CPV in the baculovirus system and showed that it binds CXCL8 in cross-linking assays (Fig. 3d). CrmB is also encoded by the human pathogen VaV, the causative agent of smallpox. We have generated the CrmB gene of VaV by 15 extensive site-directed mutagenesis of the CrmB gene from the related camelpox virus (Fig. 6) and expressed the protein in the baculovirus system. We first tested that purified VaV CrmB protein binds TNF (Fig. 7) and inhibits TNF biological activity (Fig. 8a). CrmB was also tested for binding to all available human chemokines by SPR and we demonstrated that CrmB binds with high affinity a number of chemokines (Fig. 9). A 20 truncated version of VaV CrmB lacking the CTD did not bind chemokines (Fig. 7). Moreover, expression and purification of the CTD of VaV CrmB has demonstrated that the CTD encodes the chemokine binding activity of CrmB (Fig. 7). This is corroborated by SPA analysis showing that TNF and chemokines bind to different sites in CrmB (not shown). 25 2.3.- The vTNFR CrmB encoded by VaV blocks migration of Molt4 cells induced by CCL25 in vitro The high affinity of the vTNFRs CrmB and CrmD for some chemokines suggests that these viral proteins may act as decoy receptors sequestering chemokines and 30 preventing chemokines from binding to their specific receptors on leukocytes and inducing signals that trigger cell migration. We show tha VaV CrmB inhibits the migration of Molt4 cell, expressing relevant receptors, in response to the chemokine CCL25 (Fig. 8b).

WO 2006/024533 PCT/EP2005/009449 18 2.4.- Proteins related to the CTD of vTNFRs (CTD homologues) bind chemokines As indicated above, three proteins encoded by poxviruses have amino acid sequence similarity to the CTD of the vTNFRs (CrmB and CrmD) (Fig. 1 and 2). These proteins, named CTD1, CTD2 and CTD3 have an N-terminal signal peptide suggesting 5 that they are secreted. Expression of two of these proteins, EV E12 (CTD1), EV184 (CTD2) and CPV B21 R (CTD3), in the baculovirus system has shown that both proteins are secreted into the medium. Purified EV E12 protein was tested for binding to all mouse chemokines and found to bind several chemokines with high affinity (Table 2). In addition, we have determined by SPR that the purified proteins CPV B21R and V E184 10 bind CCL21, CCL24, CCL25, CCL27, CCL28, CXCL10, CXCL11, CXCL120, CXCL13 and CXCL14 from mouse, and human CCL26The VV WR B7R (CTD2) has been shown to be translocated to the lumen of the endoplasmic reticulum and to be retained inside the cell rather than being secreted (Price et al., 2000). Some of the CTD homologues may function to block the activity of chemokines such as CCL27 that have been known 15 to be expressed inside the cell as well (Gortz et al., 2002). A W mutant lacking the B7R gene is attenuated in a murine intradermal model (Price et al., 2000). 2.5.- The vTNFRs CrmD from EV and CrmB from VaV bind other TNF ligand superfamily members 20 TNF is a member of a large family of immune mediators with structural similarities, known as the TNF ligand (TNFL) superfamily (Locksley et al., 2001, Wallach, 2001). EV CrmD and VaV CrmB were tested by SPR for binding to all commercially available TNF ligand superfamily members and found to bind APRIL (TNFL13) (CrmD Kd 110 pM; CrmB Kd 2 nM) and LIGHT (TNFL14) (CrmD Kd 140 nM; CrmB Kd 2 nM). 25 This suggests that CrmD and CrmB (and maybe other vTNFRs) may inhibit the biological activity of several TNF ligand superfamily members. 2.6.- The CTD of vTNFRs may influence the ability of the CRDs to bind TNF with high affinity 30 As shown above, a truncated vTNFR CrmD comprising the N-terminal CRD(1,2) looses affinity for TNF and does not block TNF biological activity, while CRD(1-3) binds TNF and inhibits its activity (Fig. 4a,b,c). Surprisingly, when CRD(1,2) is expressed fused to CTD it recovers TNF inhibitory activity, showing that CTD may enhance the TNF binding activity of the N-terminal CRDs of the vTNFR (Fig. 4d).

WO 2006/024533 PCT/EP2005/009449 19 2.7.- Virus-encoded proteins are formed of domains that bind immune ligands independently The data shown here indicate that the vTNFRs CrmB and CrmD are composed 5 of two independent domains (Fig. 1 and 2). The N-terminal CRDs have the ability to bind TNF while the CTD binds chemokines in an independent fashion. This is demonstrated by the finding that CRD(1,4) from CrmB retains TNF binding activity and CTD from CrmB has chemokine binding activity when expressed independently. The concept that these regions of viral proteins represent structural modules or domains that bind immune 10 mediators is emphasized by the finding that: (1) purified CTD of VaV CrmB binds chemokines (Fig. 7); (2) the CTD of CrmB and CrmD encoded by CPV can be exchanged and still confer chemokine binding activity (not shown); (3) three different proteins related to vTNFR CTD (EV E12, EV E184 and CPV B21R) encode chemokine binding activity (Table 2); and (4) fusion of the CPV 35kDa vCKBP to the CRD(1,4) of 15 VaV CrmB confers this protein the ability of binding chemokines without affecting the TNF-inhibitory activity (Fig. 10). Therefore, these viral domains may be exchanged or combined to generate immune modulatory proteins that block the activity of several cytokines. We propose that the CTD of vTNFRs defines a novel protein structure/domain that binds immune proteins such as chemokines or other proteins involved in the 20 immune system and confers vTNFRs the ability to bind other immunomodulatory proteins in addition to TNF. References Alcami, A. (2003). Viral mimicry of cytokines, chemokines and their receptors. Nat Rev 25 Immunol 3, 36-50. Alcami, A., Khanna, A., Paul, N. L. & Smith, G. L. (1999). Vaccinia virus strains Lister, USSR and Evans express soluble and cell-surface tumour necrosis factor receptors. J. Gen. Virol. 80, 949-59. Alcami, A. & Koszinowski, U. H. (2000). Viral mechanisms of immune evasion. Immunol. 30 Today 21, 447-55. Alcami, A., Symons, J. A., Collins, P. D., Williams, T. J. & Smith, G. L. (1998). Blockade of chemokine activity by a soluble chemokine binding protein from vaccinia virus. J. Immunol. 160, 624-33.

WO 2006/024533 PCT/EP2005/009449 20 Alexander, J. M., Nelson, C. A., van Berkel, V., Lau, E. K., Studts, J. M., Brett, T. J., Speck, S. H., Handel, T. M., Virgin, H. W. & Fremont, D. H. (2002). Structural basis of chemokine sequestration by a herpesvirus decoy receptor. Cell 111, 343-56. 5 Bridgeman, A., Stevenson, P. G., Simas, J. P. & Efstathiou, S. (2001). A secreted chemokine binding protein encoded by murine gammaherpesvirus-68 is necessary for the establishment of a normal latent load. J Exp Med 194, 301-12. Bryant, N. A., Davis-Poynter, N., Vanderplasschen, A. & Alcami, A. (2003). Glycoprotein G isoforms of some alphahepesviruses function as broad-spectrum chemokine 10 binding proteins. EMBO J. 22, 833-846. Carfi, A., Smith, C. A., Smolak, P. J., McGrew, J. & Wiley, D. C. (1999). Structure of a soluble secreted chemokine inhibitor vCCI (p35) from cowpox virus. Proc. Natl. Acad. Sci. U. S. A. 96,12379-83. Davison, A. J. & Moss, B. (1990). New vaccinia virus recombination plasmids 15 incorporating a synthetic late promoter for high level expression of foreign proteins. Nucleic Acids Res 18, 4285-6. Gortz, A., Nibbs, R. J., McLean, P., Jarmin, D., Lambie, W., Baird, J. W. & Graham, G. J. (2002). The chemokine ESkine/CCL27 displays novel modes of intracrine and paracrine function. J Immunol 169, 1387-94. 20 Graham, K. A., Lalani, A. S., Macen, J. L., Ness, T. L., Barry, M., Liu, L. Y., Lucas, A., Clark-Lewis, I., Moyer, R. W. & McFadden, G. (1997). The T1/35kDa family of poxvirus-secreted proteins bind chemokines and modulate leukocyte influx into virus-infected tissues. Virology 229, 12-24. Hu, F., Smith, C. A. & Pickup, D. J. (1994). Cowpox virus contains two copies of an early 25 gene encoding a soluble secreted form of the type 11 TNF receptor. Virology 204, 343-356. Johnston, J. B. & McFadden, G. (2004). Technical knockout: understanding poxvirus pathogenesis by selectively deleting viral immunomodulatory genes. Cell Microbiol 6, 695-705. 30 Lalani, A. S., Graham, K., Mossman, K., Rajarathnam, K., Clark-Lewis, I., Kelvin, D. & McFadden, G. (1997). The purified myxoma virus gamma interferon receptor homolog M-T7 interacts with the heparin-binding domains of chemokines. J Virol 71, 4356-63.

WO 2006/024533 PCT/EP2005/009449 21 Lalani, A. S., Masters, J., Graham, K., Liu, L., Lucas, A. & McFadden, G. (1999). Role of the myxoma virus soluble CC-chemokine inhibitor glycoprotein, M-T1, during myxoma virus pathogenesis. Virology 256, 233-45. Lalani, A. S., Ness, T. L., Singh, R., Harrison, J. K., Seet, B. T., Kelvin, D. J., McFadden, 5 G. & Moyer, R. W. (1998). Functional comparisons among members of the poxvirus T1/35kDa family of soluble CC-chemokine inhibitor glycoproteins. Virology 250, 173-84. Locksley, R. M., Killeen, N. & Lenardo, M. J. (2001). The TNF and TNF receptor superfamilies: integrating mammalian biology. Cell 104, 487-501. 10 Loparev, V. N., Parsons, J. M., Knight, J. C., Panus, J. F., Ray, C. A., Buller, R. M., Pickup, D. J. & Esposito, J. J. (1998). A third distinct tumor necrosis factor receptor of orthopoxviruses. Proc. Nat. A cad. Sci. U. S. A. 95, 3786-3791. Parry, C. M., Simas, J. P., Smith, V. P., Stewart, C. A., Minson, A. C., Efstathiou, S. & Alcami, A. (2000). A broad spectrum secreted chemokine binding protein 15 encoded by a herpesvirus. J. Exp. Med. 191, 573-8. Price, N., Tscharke, D. C., Hollinshead, M. & Smith, G. L. (2000). Vaccinia virus gene B7R encodes an 18-kDa protein that is resident in the endoplasmic reticulum and affects virus virulence. Virology 267, 65-79. Reading, P. C., Symons, J. A. & Smith, G. L. (2003). A soluble chemokine-binding 20 protein from vaccinia virus reduces virus virulence and the inflammatory response to infection. J Immunol 170, 1435-42. Saraiva, M. & Alcami, A. (2001). CrmE, a novel soluble tumor necrosis factor receptor encoded by poxviruses. J. Virol. 75, 226-33. Schreiber, M., Sedger, L. & McFadden, G. (1997). Distinct domains of M-T2, the 25 myxoma virus TNF receptor homolog, mediate extracellular TNF binding and intracellular apoptosis inhibition. J. Virol. 71, 2171-2181. Seet, B. T., Johnston, J. B., Brunetti, C. R., Barrett, J. W., Everett, H., Cameron, C., Sypula, J., Nazarian, S. H., Lucas, A. & McFadden, G. (2003). Poxviruses and immune evasion. Annu Rev Immunol 21, 377-423. 30 Seet, B. T. & McFadden, G. (2002). Viral chemokine-binding proteins. J Leukoc Biol 72, 24-34. Smith, C. A., Hu, F. Q., Smith, T. D., Richards, C. L., Smolak, P., Goodwin, R. G. & Pickup, D. J. (1996). Cowpox virus genome encodes a second soluble WO 2006/024533 PCT/EP2005/009449 22 homologue of cellular TNF receptors, distinct from CrmB, that binds TNF but not LT alpha. Virology 223, 132-147. van Berkel, V., Barrett, J., Tiffany, H. L., Fremont, D. H., Murphy, P. M., McFadden, G., Speck, S. H. & Virgin, H. 1. (2000). Identification of a gammaherpesvirus selective 5 chemokine binding protein that inhibits chemokine action. J. Virol. 74, 6741-7. Wallach, D. (2001). TNF ligand and TNF/NGF receptor families. In Cytokine Reference, pp. 377-412. Edited by J. Oppenheim & M. Feldman: Academic Press. Zaballos, A., Gutierrez, J., Varona, R., Ardavin, C. & Marquez, G. (1999). Cutting edge: identification of the orphan chemokine receptor GPR-9-6 as CCR9, the receptor 10 for the chemokine TECK. J Immunol 162, 5671-5. Table 1. Chemokine binding proteins encoded bypoxviruses and herpesviruses Protein Virus Bindingspecificity References vCKBPl M-T7 Poxvirus: Myxoma virus Broad CC (Lalani et al., 1997) vCKBP2 35kDa, Poxvirus: Vaccinia virus, chemokines (Alcami et al., M-TI, cowpox virus, ectromelia 1998, Graham et al., vCCI virus, myxoma virus, 1997, Seet et al., variola virus, orf virus 2003, Smith et al., 1997, Smith & Alcami, vCKBP3 M3 gG broad broad 2000) (Parry et al., vCKBP4 2000, van Berkel et Gammaherpesvirus: al., 2000) (Bryant et murine gammaherpesvirus al., 2003) 68 Alphaherpesvirus: equine herpesvirus, bovine herpesvirus 15 WO 2006/024533 PCT/EP2005/009449 23 Table 2. Affinity constants (KD) of EV E12 protein for different chemokines obtained by SPR. The purified recombinant protein was thiolcoupled to a low level and different concentrations of the indicated chemokines injected at high flow rate using a BlAcoreX. The KD for each case was determined using the BlAevaluation software. Chemokine KD (nM) mCCL21 0.5 mCCL25 0.7 mCCL27 2 mCXCL11 1 mCXCL13 1.5 mCXCL14 1.5 5 WO 2006/024533 PCT/EP2005/009449 24 Table 3: Recombinant plasmids prepared in order to express vTNFRs. The referred inserts were amplified by PCR from viral DNA using the indicated pair of oligonucleotides (for the oligonucleotides sequences see Table 4). EV refers to strain Hampstead and 5 CPV to strain Brighton Red. 5 CrmD-7 BamHi EV crnD _55 pMS1 3.' CmiDl9: Xhol 5' CrmD-7 BaniH E cYrmD-CRD 1,2 50 pMS42 3 CrmD-29 Nor 5 CrmD-7 BamlHI EV crmD-CRD ,2?3 50 pMS4'6 3PT-3* Oot1 5' CrmD-7 BamjHI EVcrmO-CRD J2,3;,4 50 _ _ SpMS4 3' FF-4 N 6t 5F1 . PVNotl EV crm9-NCOT- 50 p6. 3' P1-2 Xho! EV cnD Ct subcloned into NotI/XhoI EV ct.mD-CRD J,2.CTD: RT1 of pMS42 EV cnni Ctsibcloned into &dIlXhoI of pMS46 5' PT-5 . .Not! CPV pcrmB-CTD 50: pPTS .3 T-6 Xhol CPV rnB;Et subcloned into6f1/Xhol EV crmD-CRD 12,2,G.,4PV crinB. CTD 3 of pMS48; 5' SF-1 50 EcoRi p-4 CPV crmB.-CRD J.,2,3;4-EV crmD CTD 3'FPT-7 Not] WO 2006/024533 PCT/EP2005/009449 25 .. iCfnD -B7M 3' CtnD.-15 pn S-, CrMD-7)?th EV crmD-CRD., 1_______5 3Y CrmD-23' 5.HnI M9 Table 4: Oligonucleotides used for expression of EV CrmD and CPV CrmB in the baculovirus and VV systems 5 Oligonucleolide Sequence (S '> 3 5' CrmD-7 CGCGTMIAAACGGATCCATGATGAAGATGACAGCATCATA 3' CrmD-9 CGCCTCGAGATCTCMTCACAATCATFIGGTGG 3' GrinD-i15 CGCGGTACCTCAATCT=1ICACAATCKTfGG 3' CrmD-22 CGCGGTACCTTAATCTATGCGT'fAAAGGACAGATCAC 3' CnmD-23 GCGAAGCTIIACCATGGGTAGTATCCGGATGCACAGACAC 3' CrmD-24 GCGAAGC=lJACCATGGACAAGAGGTCF1'GTlAACAGGATAC 3'CnrnD-29 GCGGCGGCCGCGTAGTATCCGGATGCACAGACAC 5 PT-I GCGGCGGCCGCCAA1TCGAGTATAGGAAGCAGCAGTAC 3 PT-2 GCGCTCGAGATCTC'TI7CACAATCA'TI'GGTGG 3 'PT-3 GCGGCGGGCGCATCTATGCTGT7rAAAGGACAGATCAC 3'PT-4 GCGGCGGCCGCACAAGAGGTCTrT-AACAGGATAC 5 'PT-5 GCGGCGGCCGCCACTCGGACGACCACTACCGGTCTC 3 PT-6 GCGCTCGAGTAAAAAGTGGGTGGGATACTGGGAA 3 PT-7 GCGGCGGCCGCACACGATGTGTCGTrGACGGGATAC 5' SF-I GCGGGTACCGAA'rrCACCATGGAGTCATATATATTGCTATTGC C:WRPonhrDCC'RSWo42_I.DOC-12/12I2 I 25a Throughout this specification and the claims which follow, unless the context requires otherwise, the word "comprise", and variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integers or steps. The reference in this specification to any prior publication (or information derived from it), or to any matter which is known, is not, and should not be taken as, an acknowledgement or admission or any form of suggestion that that prior publication (or information derived from it) or known matter forms part of the common general knowledge in the field of endeavour to which this specification relates.

Claims (20)

1.- A C-terminal domain (CTD) of viral tumour necrosis factor receptors (vTNFRs) CrmB or CrmD from poxvirus, CTD homologues (CTD1, CTD2 and CTD3) from poxvirus and their functional 5 homologues, including derivatives and fragments thereof, having chemokine binding activity.

2.- The CTD from CrmB according to claim 1, consisting of SEQ ID N* 26 or SEQ ID N" 28.

3.- The CTD from CrmD according to claims, consisting of SEQ ID NO 22 or SEQ ID NO 24. 10

4.- The CTD homologue according to claim 1, consisting of SEQ ID NO 8 or SEQ ID N" 14 or SEQ ID N" 6 or SEQ ID N 0 20 or SEQ ID NO 18 or SEQ ID N* 16 or any of the proteins encoded by genes V201, D12L, B6R or B21R from poxvirus. 15 5.- A fusion polypeptide comprising a CTD or CTD homologue, according to claims 1-4, fused to a polypeptide sequence of the same or other origin.

6.- Fusion polypeptide according to claim 5 wherein the fusion polypeptide consists on a CTD according to any of claims 1-4 fused to an N-terminal TNF binding domain of TNFRs. 20

7.- Fusion polypeptide, according to claim 6, wherein the TNFRs are of human origin.

8.- A polynucleotide consisting of a sequence encoding a CTD or CTD homologue, according to claims 1-4, or a fusion polypeptide according to claims 5-7. 25

9.- An expression cassette comprising a polynucleotide according to claim 8.

10.- A viral vector or an expression plasmid comprising a polynucleotide according to claim 8 or an expression cassette according to claim 9. 30

11.- A pharmaceutical composition comprising a CTD or CTD homologue according to claims 1-4 or a fusion polypeptide according to claims 5-7 or an expression cassette according to claim 9 or a viral vector or expression plasmid according to claim 10. 27

12.- Pharmaceutical composition, according to claim 11, for use In blocking binding of a chemokine to a. corresponding cell surface chemokine receptor or to Inhibit the biological activity of chemokines In vivo. 5 13.- Pharmaceutcal composition according to claims 11-12, for use In producing an anti Inflammatory effect.

14.- Pharmaceutical composition according to claims 11-13, which comprises an additional Immunosuppressant or anti-Inflammatory substance. 10

15.- A test kit comprising a CTD or CTD hamologue according to claims 1-4 and a labelled or immobilised reactant, for detecting or measuring a chemokine, chemokine analogue, or chemokine receptor in vitro. 15 . 16.- Use of a C-terminal domain (CTD) of viral tumour necrosis factor receptors (vTNFRs) CrmB or CrmD from poxvirus, CTD homologues (CTD1, CTD2 and CTD3) from poxvirus and their functional homologues, including derivatives and fragments thereof, according to claims 1-4, In binding chemokines and their analogues and/or to enhance the immunomodulatory properties of TNFRs. 20

17.- Use of a C-terminal domain (CTD) of viral tumour necrosis factor receptors (vTNFRs) CrmB or CrmD from poxvirus, CTD homologues (CTD1, CTD2 and CTD3) from poxvirus and their functional homologues, Including derivatives and fragments thereof, according to claims 1-4, in blocking binding of chemokines to their corresponding cell surface receptors and/or to modulate 25 chemokine biological activity.

18.- Use of a CTD or CTD homologue according to claims 1-4 or a fusion polypeptide according to claims 5-7 or an expression cassette according to claim 9 or a viral vector or expression plasmid according to claim 10, in the manufacture of a medicament for administration to a subject to 30 produce an anti-inflammatory effect.

19.- Use of a CTD or CTD homologue according to claims 1-4 in the manufacture of a medicament for administration to a subject to bind to a chemokine analogue present In a virus or parasite to block entry of said virus or parasite into cells. 35 28

20.- Methqd for attenuating the adverse effects associated to a vaccinia virus vaccine by deletion or inactivation of CTD or CTD homologues according to claims 1-4.

21.- Use of a CTD or CTD homologues according to claims 1-4 or a fusion polypeptide according 5 to claims 5-7 or an expression cassette according to claim 9 or a viral vector or expression plasmid according to claim 10, in the manufacture of a medicament for the treatment of adverse effects caused by vaccinia virus vaccination or the treatment of the pathology caused by variola virus in human smallpox. 10 22.- Use of the CTD or CTD homologues according to claims 1-4, for obtaining specific antibodies which inhibit the chemokine binding ability of said CTD or CiD homologues.

23.- Use of antibodies, according claim 22, or reagents that inhibit the chemokine binding activity of the CTD or CTD homologues according to claims 1-4, for the manufacture of a medicament for 15 the treatment of adverse effects caused by vaccinia virus vaccination or the treatment of the pathology caused by variola virus in human smallpox.

24.- A method of detecting a substance that comprises a chemokine or chemokine analogue, which is based on contacting a sample possibly comprising said substance to be tested with a 20 reagent comprising a CTD or CTD homologue according to claims 1-4 thereby to bind said chemokine or chemokine analogue.