AU2012213964A1 - Methods of administering/dosing anti-RSV antibodies for prophylaxis and treatment - Google Patents

Abstract

Methods of Administering/Dosing Anti-RSV Antibodies for Prophylaxis and Treatment The present invention encompasses novel antibodies and fragments thereof which immunospecifically bind to one or more RSV antigens and compositions comprising said antibody fragments. The present invention encompasses methods preventing respiratory syncytial virus (RSV) infection in a human, comprising administering to said human a 1o prophylactically effective amount of one or more antibodies or fragments thereof that immunospecifically bind to one or more RSV antigens, wherein a certain serum titer of said antibodies or antibody fragments is achieved in said human subject. The present invention also encompasses methods for treating or ameliorating symptoms associated with a RSV infection in a human, comprising administering to said human a is therapeutically effective amount of one or more antibodies or fragments thereof that immunospecifically bind to one or more RSV antigens, wherein a certain serum titer of said antibodies or antibody fragments is achieved in said human subject. The present invention further encompasses compositions comprising antibodies or fragments thereof that immunospecifically bind to a SRV antigen, and methods using said compositions for 20 detection or diagnosis of a RSV infection.

Description

S&F Ref: 773240D4 AUSTRALIA PATENTS ACT 1990 COMPLETE SPECIFICATION FOR A STANDARD PATENT Name and Address Medlmmune, LLC, of One MedImmune Way, of Applicant: Gaithersburg, Maryland, 20878, United States of America Actual Inventor(s): Herren Wu James F. Young Jeffry Watkins Leslie S. Johnson Scott Koenig William Huse Address for Service: Spruson & Ferguson St Martins Tower Level 35 31 Market Street Sydney NSW 2000 (CCN 3710000177) Invention Title: Methods of administering/dosing anti-RSV antibodies for prophylaxis and treatment The following statement is a full description of this invention, including the best method of performing it known to me/us: 5845c(6610676_1) METHODS OF ADMINISTERING/DOSING ANTI-RSV ANTIBODIES FOR PROPHYLAXIS AND TREATMENT 5 1. INTRODUCTION The present invention relates to compositions comprising antibodies or fragments thereof that irnmunospecifically bind to a RSV antigen and methods for preventing, treating or ameliorating symptoms associated with respiratory syncytial virus (RSV) infection utilizing said compositions. In particular, the present invention relates to methods for 10 preventing, treating or ameliorating symptoms associated with RSV infection, said methods comprising administering to a human subject an effective amount of one or more antibodies or fragments thereof that inmunospecifically bind to a RSV antigen, wherein a certain serum titer of said antibodies or antibody fragments is achieved in said human subject. The present invention also relates to detectable or diagnostic compositions comprising 15 antibodies or fragments thereof that inmunospecifically bind to a RSV antigen and methods for detecting or diagnosing RSV infection utilizing said compositions. 2. BACKGROUND OF THE INVENTION Respiratory syncytial virus (RSV) is the leading cause of serious lower respiratory 20 tract disease in infants and children (Feigen et al., eds., 1987, In: Textbook ofPediatric Infectious Diseases, WB Saunders, Philadelphia at pages 1653-1675; New Vaccine Development, Establishing Priorities, Vol. 1, 1985, National Academy Press, Washington DC at pages 397-409; and Ruuskanen et al., 1993, Curr. Probl. Pediatr. 23:50-79). The yearly epidemic nature of RSV infection is evident worldwide, but the incidence and 25 severity of RSV disease in a given season vary by region (Hall, C.B., 1993, Contemp. T~ediat.ix 9* 1'0) hreprtrgoso-h othnhmshrimayeni 6 weeks to 2 years of age and uncommonly in the first 4 weeks of life during nosocomial epidemics (Hall et al., 1979, New Engl. J. Med. 300:393-396). Children at increased risk 30 from RSV infection include preterm infants (Hall et al., 1979, New Engl. J. Med. 300:393 396) and children with bronchopulmonary dysplasia (Groothuis et al., 1988, Pediatrics 82:199-203), congenital heart disease (MacDonald et al., New Engl. J. Med. 307:397-400), congenital or acquired irmunodeficiency (Ogra et al., 1988, Pediatr. Infect. Dis. J. 7:246 249; and Pohl et al., 1992, J. Infect. Dis. 165:166-169), and cystic fibrosis (Abman et al., 35 -1- 1988, J. Pediatr. 113:826-830). The fatality rate in infants with heart or lung disease who are hospitalized with RSV infection is 3%-4% (Navas et al., 1992, J. Pediatr. 121:348-354). RSV infects adults as well as infants and children. In healthy adults, RSV causes predominantly upper respiratory tract disease. It has recently become evident that some 5 adults, especially the elderly, have symptomatic RSV infections more frequently than had been previously reported (Evans, A.S., eds., 1989, Viral Infections of Humans. Epidemiology and Control, 3 rd ed., Plenum Medical Book, New York at pages 525-544). Several epidemics also have been reported among nursing home patients and institu tionalized young adults (Falsey, A.R., 1991, Infect. Control Hosp. Epidemiol. 12:602-608; 10 and Garvie et al., 1980, Br. Med. J. 281:1253-1254). Finally, RSV may cause serious disease in immunosuppressed persons, particularly bone marrow transplant patients (Hertz et al., 1989, Medicine 68:269-28 1). Treatment options for established RSV disease are limited. Severe RSV disease of the lower respiratory tract often requires considerable supportive care, including 15 administration of humidified oxygen and respiratory assistance (Fields et al., eds, 1990, Fields Virology, 2" ed., Vol. 1, Raven Press, New York at pages 1045-1072). The only drug approved for treatment of infection is the antiviral agent ribavirin (American Academy of Pediatrics Conunittee on Infectious Diseases, 1993, Pediatrics 92:501-504). It has been shown to be effective in the treatment of RSV pneumonia and bronchiolitis, modifying the 20 course of severe RSV disease in immunocompetent children (Smith et al., 1991, New Engl. J. Med. 325:24-29). However, ribavirin has had limited use because it requires prolonged aerosol administration and because of concerns about its potential risk to pregnant women who may be exposed to the drug during its administration in hospitals gs. While a vaccine might prevent RSV infection, no vaccine is yet licensed for this 25 indication. A major obstacle to vaccine development is safety. A formalin-inactivated vaccine, though immunogenic, unexpectedly caused a higher and more severe incidence of lower respiratory tract disease due to RSV in immunized infants than in infants immunized with a similarly prepared trivalent parainfluenza vaccine (Kim et al., 1969, Am. J. Epidemiol. 89:422-434; and Kapikian et al., 1969, Am. J. Epidemiol. 89:405-421). Several 30 candidate RSV vaccines have been abandoned and others are under development (Murphy et al., 1994, Virus Res. 32:13-36), but even if safety issues are resolved, vaccine efficacy must also be improved. A number of problems remain to be solved. Immunization would be required in the immediate neonatal period since the peak incidence of lower respiratory tract disease occurs at 2-5 months of age. The immaturity of the neonatal immune response 35 together with high titers of maternally acquired RSV antibody may be expected to reduce -2vaccine immunogenicity in the neonatal period (Murphy et al., 1988, J. Virol. 62:3907 3910; and Murphy et al., 1991, Vaccine 9:185-189). Finally, primary RSV infection and disease do not protect well against subsequent RSV disease (Henderson et al., 1979, New Engl. J. Med. 300:530-534). 5 Currently, the only approved approach to prophylaxis of RSV disease is passive inmunization. Initial evidence suggesting a protective role for IgG was obtained from observations involving maternal antibody in ferrets (Prince, G.A., Ph.D. diss., University of California, Los Angeles, 1975) and humans (Lambrecht et al, 1976, J. Infect. Dis. 134:211 217; and Glezen et al., 1981, J. Pediatr. 98:708-715). Heuning et al. (Morell et al., eds., 10 1986, Clinical Use of Intravenous Immunoglobulins, Academic Press, London at pages 285 294) recognized the possible utility of RSV antibody in treatment or prevention of RSV infection during studies involving the pharmacokinetics of an intravenous immune globulin (IVIG) in newborns suspected of having neonatal sepsis. They noted that I infant, whose respiratory secretions yielded RSV, recovered rapidly after IVIG infusion. Subsequent 15 analysis of the IVIG lot revealed an unusually high titer of RSV neutralizing antibody. This same group of investigators then examined the ability of hyperimmune serum or immune globulin, enriched for RSV neutralizing antibody, to protect cotton rats and primates against RSV infection (Prince et al., 1985, Virus Res. 3:193-206; Prince et al., 1990, J. Virol. 64:3091-3092; Hemming et al., 1985, J. Infect. Dis. 152:1083-1087; Prince et al., 1983, 20 Infect. Inunun. 42:81-87; and Prince et al., 1985, J. Virol. 55:517-520). Results of these studies suggested that RSV neutralizing antibody given prophylactically inhibited respiratory tract replication of RSV in cotton rats. When given therapeutically, RSV antibody reduced pulmonary viral replication both in cotton rats and in a nonhuman primate model. Ndfrermore, passive infusion of immune serum or immune globulin did not 25 produce enhanced pulmonary pathology in cotton rats subsequently challenged with RSV. "Recent duiic1 studies'have aemonstratea The dbility of tiiis passively a8iiistere RSV hyperimmune globulin (RSV IYlG) to protect at-risk children from severe'ower respiratory infection by RSV (Groothius et al., 1993, New Engi. J. Med. 329:1524-1530; and The PREVENT Study Group, 1997, Pediatrics 99:93-99). While this is a major 30 advance in preventing RSV infection, this treatment poses certain limitations in its widespread use. First, RSV IVIG must be infused intravenously over several hours to achieve an effective dose. Second, the concentrations of active material in hyperimmune globulins are insufficient to treat adults at risk or most children with comprised cardiopulmonary function. Third, intravenous infusion necessitates monthly hospital visits 35 during the RSV season. Finally, it may prove difficult to select sufficient donors to produce -3a hyperimmune globulin for RSV to meet the demand for this product. Currently, only approximately 8% of normal donors have RSV neutralizing antibody titers high enough to qualify for the production of hyperimmunre globulin. One way to improve the specific activity of the immunoglobulin would be to 5 develop one or more highly potent RSV neutralizing monoclonal antibodies (MAbs). Such MAbs should be human or humanized in order to retain favorable phannacokinetics and to avoid generating a human anti-mouse antibody response, as repeat dosing would be required throughout the RSV season. Two glycoproteins, F and G, on the surface of RSV have been shown to be targets of neutralizing antibodies (Fields et al., 1990, supra; and Murphy et al., 10 1994 , supra). These two proteins are also primarily responsible for viral recognition and entry into target cells; G protein binds to a specific cellular receptor and the F protein promotes fusion of the virus with the cell. The F protein is also expressed on the surface of infected cells and is responsible for subsequent fusion with other cells leading to syncytia formation. Thus, antibodies to the F protein may directly neutralize virus or block entry of 15 the virus into the cell or prevent syncytia formation. Although antigenic and structural differences between A and B subtypes have been described for both the G and F proteins, the more significant antigenic differences reside on the G glycoprotein, where amino acid sequences are only 53% homologous and antigenic relatedness is 5% (Walsh et al., 1987, J. Infect. Dis. 155:1198-1204; and Johnson et al., 1987, Proc. Natl. Acad. Sci. USA 84:5625 20 5629). Conversely, antibodies raised to the F protein show a high degree of cross-reactivity among subtype A and B viruses. Beeler and Coelingh (1989, J. Virol. 7:2941-2950) conducted an extensive analysis of 18 different murine MAbs directed to the RSV F protein. Comparison of the biologic and biochemical properties of these MAbs resulted in the identification of three distinct antigenic sites (designated A, B, and C). Neutralization 25 studies were performed against a panel of RSV strains isolated from 1956 to 1985 that demonstrated hat epitopes v/ithin'antigenic sites A and C are highly conserved, while the epitopes of anfigenic site B are variaie. A humanized antibody directed to an epitope in the A antigenic site of the F protein of RSV, SYNAGIS@, is approved for intramuscular administration to pediatric patients for 30 prevention of serious lower respiratory tract disease caused by RSV at recommended monthly doses of 15 mg/kg of body weight throughout the RSV season (November through April in the northern hemisphere). SYNAGIS@ is a composite of human (95%) and murine (5%) antibody sequences. See, Johnson et al., 1997, J. Infect. Diseases 176:1215-1224 and U.S. Patent No. 5,824,307, the entire contents of which are incorporated herein by 35 reference. The human heavy chain sequence was derived from the constant domains of -4human IgG, and the variable framework regions of the VH genes or Cor (Press et al., 1970, Biochem. J. 117:641-660) and Cess (Takashi et al., 1984, Proc. Natl. Acad. Sci. USA 81:194-198). The human light chain sequence was derived from the constant domain of CK and the variable framework regions of the VL gene K104 with JK-4 (Bentley et al., 1980, 5 Nature 288:5194-5198). The murine sequences derived from a murine monoclonal antibody, Mab 1129 (Beeler et al., 1989, J. Virology 63:2941-2950), in a process which involved the grafting of the murine complementarity determining regions into the human antibody frameworks. Although SYNAGIS® has been successfully used for the prevention of RSV 10 infection in pediatric patients, multiple intramuscular doses of 15 mg/kg of SYNAGISTM is required to achieve a prophylactic effect. In pediatric patients less than 24 months of age, the mean half-life of SYNAGIS@ has been shown to be 20 days and monthly intramuscular doses of 15 mg/kg have been shown to result in a mean t standard derivation 30 day serum titer of 37 ± 21 ptg/ml after the first injection, 57 + 41 ig/ml after the second injection, 68 J 15 51 pg/ml after the third injection, and 72 + 50 [tg/ml after the fourth injection (The IMpact RSV Study Group, 1998, Pediatrics 102:531-537). Serum concentrations of greater than 30 ig/ml have been shown to be necessary to reduce pulmonary RSV replication by 100 fold in the cotton rat model of RSV infection. However, the administration of multiple intramuscular doses of 15 mg /kg of antibody is inconvenient for the patient. Thus, a need 20 exists for antibodies that inununospecifically bind to a RSV antigen, which are highly potent, have an improved pharmacokinetic profile, and thus have an overall improved therapeutic profile. Further, a need exists for antibodies that inununospecifically:bind to a RSV antigen which require less frequent administration. Citation or discussion of a reference herein shall not be construed as an admission 25 that such is prior art to the present invention. 3. SMKYU ENETU The present invention is based, in part, on the development of methods for achieving or inducing a prophylactically or therapeutically effective serum titer of an antibody or 30 fragment thereof that immnunospecifically binds to a respiratory syncytial virus (RSV) antigen in a mammal by passive immunization with such an antibody or fragment thereof, which methods require lower dosages and/or less frequent administration than previously known methods. The present invention is also based, in part, on the identification of antibodies with higher affinities for a RSV antigen which result in increased efficacy for 35 prophylactic or therapeutic uses such that lower serum titers are prophylactically or therapeutically effective, thereby permitting administration of lower dosages and/or reduced frequency of administration. The present invention provides methods of preventing, neutralizing, treating and ameliorating one or more symptoms associated with RSV infection in a subject comprising 5 administering to said subject one or more antibodies or fragments thereof which immunospecifically bind to one or more RSV antigens with high affinity and/or high avidity. Because a lower serum titer of such antibodies or antibody fragments is therapeutically or prophylactically effective than the effective serum titer of known antibodies, lower doses of said antibodies or antibody fragments can be used to achieve a 10 serum titer effective for the prevention, neutralization, treatme - and the amelioration of symptoms associated with a RSV infection. The use of lower causes of antibodies or fragments thereof which inununospecifically bind to one or more RSV antigens reduces the likelihood of adverse effects. Further, the high affinity and/or high avidity of the antibodies of the invention or fragments thereof enable less frequent administration of said antibodies 15 or antibody fragments than previously thought to be necessary for the prevention, neutralization, treatment or the amelioration of symptoms associated with a RSV infection. The present invention also provides antibodies which imimunospecifically bind to one or more RSV antigens and have increased in vivo half-lives relative to known antibodies such as, e.g., SYNAGIS@. In particular, the present invention encompasses 20 antibodies which immunospecifically bind to one or more RSV antigens and have increased in vivo half-lives relative to known antibodies (e.g., SYNAGIS@), said increased half-lives resulting from one or more modifications (e.g., substitutions, deletions, or insertions) in amino acid residues identified to be involved in the interaction of the Fc domain of said antibodies and the FcRn receptor. The present invention also encompasses pegylated 25 antibodies and fragments thereof which immunospecifically bind to one or more RSV antigens and have increased in vivo half-lives relative to known antibodies such as, e.g., SYNAG[S@. The increased in vivo halfIlives 61' antibodies or'fragments fhereofWiidh immunospecifically bind to one or more RSV antigens reduce the dosage and/or frequency of administration of said antibodies or fragments thereof to a subject. 30 The invention encompasses sustained release formulations for the administration of one or more antibodies or fragments thereof which immunospecifically bind to one or more RSV antigens to a subject. The sustained release formulations reduce the dosage and/or frequency of administration of said antibodies or antibody fragments to a subject. Further, the sustained release formulations may be administered to maintain a therapeutically or 35 -6prophylactically effective serum titer which does not exceed a certain maximum serum titer for a certain period of time. The present invention encompasses methods of delivering one or more antibodies or fragments thereof which immunospecifically bind to one or more RSV antigens directly to 5 the site of RSV infection. In particular, the invention encompasses pulmonary delivery of one or more antibodies or fragments thereof which immunospecifically bind to one or more RSV antigens. The improved methods of delivering of one or more antibodies or fragments thereof which immunospecifically bind to one or more RSV antigens reduce the dosage and/or frequency of administration of said antibodies or antibody fragments to a subject. 10 The present invention provides antibodies or fragments thereof which immunospecifically bind to one or more RSV antigens and have an association rate constant or k 0 , rate (antibody (Ab) + antigen (Ag) iAb-Ag)of at least 10' M's', at least 5 X 10 5

M

's", at least 106'-'s', at least 5 X 106 M's-', at least 10' M's', at least 5 X 10' M's', or at least 108 M-s'. In particular, the present invention provides compositions for use in the 15 prevention, treatment or amelioration of one or more symptoms associated with a RSV infection, said compositions comprising one or more antibodies or fragments thereof which immunospecifically bind to one or more RSV antigens and have an a k, rate of at least 10' M's', at least 5 X 105 M's', at least 106 M-s', at least 5 X 106 M's', at least 10' M's', at least 5 X 10' M-s', or at least 10 M-s'. 20 The present invention provides antibodies or fragments thereof which inimunospecifically bind to one or more RSV antigens and have a kff rate (antibody (Ab) + antigen (Ag)*-Ab-Ag) of less than 10' s', less than 5 X 10' s', less than 10. s1, less than 5 X 100 s', less than 10' s', less than 5 X 104 s-, less than 10' s', less than 5 X 104 s-, less than 1 O's', less than 5 X 0 s', less than 10 s-', less than 5 X 10' s', less than 107 s', less 25 than 5 X 10-'s 4 , less than 10' s', less than 5 X 10's", less than 10-'s', less than 5 X 10-'s-, otdem ftharryi"'tN. In parread-r, th-e present-ivennoi~r-repovides cmoiimreneit prevention, treatment or am6lioration of one or more symptoms assodiatea Wtn a'RSV infection, said compositions comprising one or more antibodies or fragments thereof which immunospecifically bind to one or more RSV antigens and have a kf rate of less than 10- s 30 ', less than 5 X 10' s', less than 10-'s-, less than 5 X 10-'s', less than 104 s4, less than 5 X 10- s-, less than 104 s-, less than 5 X 1 0 4 s-, less than 10- s-, less than 5 X 10-'s-, less than 106 s', less than 5 X 10-6 s, less than 10' s-, less than 5 X 10- s-, less than 10- s', less than 5 X 10 8 s', less than 10-9 s-, less than 5 X 10 9 s-, or less than 1010 s-. The present invention also provides antibodies or fragments thereof which 35 immunospecifically bind to one or more RSV antigens and have an affinity constant or K, -7- (k,,/k..) of at least 102 M', at least 5 X 102 M-', at least 103 M, at least 5 X 10' M-1, at least 10' M', at least 5 X 10' M, at least 10' M1, at least 5 X 10' M-, at least 106 M', at least 5 X 10' M, at least 10' M", at least 5 X 107M, at least 10' M', at least 5 X 108 M', at least 10' M', at least 5 X 109 M, at least 10'0 M, at least 5 X 1010 M', at least 10" M-, at least 5 5 X 10" M, at least 1012 M-, at least 5 X 1012 M', at least 10" M, at least 5 X 10" M', at least 10" M, at least 5 X 10" M', at least 10" M', or at least 5 X 10'" M. In particular, the present invention provides compositions for use in the prevention, treatment or amelioration of one or more symptoms associated with a RSV infection, said compositions comprising one or more antibodies or fragments thereof which immunospecifically bind to 10 one or more RSV antigens and have a K, of at least 102 M', at least 5 X 102 M-, at least 10 M-, at least 5 X 10' M', at least 10' M', at least 5 X 10' M', at least 10' M', at least 5 X 10' M', at least 106 M-, at least 5 X 106 M', at least 10' M', at least 5 X 10'M', at least 108 M-, at least 5 X 108 M-, at least 109 M', at least 5 X 10' M', at least 10'" M', at least 5 X 10'* M-, at least 10" M', at least 5 X 10" M', at least 102 M-, at least 5 X 10"2 M-, at 15 least 10" M-', at least 5 X 10" M', at least 10" M', at least 5 X 10" M', at least 10'" M-', or at least 5 X 10" M. The present invention provides antibodies or fragments thereof which immunospecifically bind to one or more RSV antigens and have a median effective concentration (EC 50 ) of less than 0.01 nM, less than 0.025 nM, less than 0.05 nM, less than 20 0.1 nM, less than 0.25 nM, less than 0.5 nM, less than 0.75 nM, less than I nM, less than 1.25 nM, less than 1.5 nM, less than 1.75 nM, or less than 2 nM\I, in an in vitro nicroneutralization assay In particular, the present invention provides compositions for use in the prevention, treatment or amelioration of one or more symptoms associated with a RSV infection, said compositions comprising one or more antibodies or fragments thereof 25 which immunospecifically bind to one or more RSV antigens and have an EC 50 of less than 0:01 fiM,less 'than0O2' iM,;iesstnan-0.TJ5 ril<,less than "0. fiM,"less than".'25 fiM;"less than 03 riM,Tss than'':75 riM,'less than 1 riM,'Tess thanT.25 iMIessthanT:5 im,1ess than 1.75 nM, or less than 2 nM, in an in vitro microneutralization assay The present invention also provides antibodies or fragments thereof comprising a 30 VH domain having the amino acid sequence of any VH domain listed in Table 2 and compositions comprising said antibodies or antibody fragments for use in the prevention, treatment or amelioration of one or more symptoms associated with a RSV infection. The present invention also provides antibodies or fragments thereof comprising one or more VH complementarity determining regions (CDRs) having the amino acid sequence of one or 35 more VH CDRs listed in Table 2 and/or Table 3 and compositions comprising said - 8antibodies or antibody fragments for use in the prevention, treatment or amelioration of one or more symptoms associated with a RSV infection. The present invention also provides antibodies or fragments thereof comprising a VL domain having the amino acid sequence of any VL domain listed in Table 2. The present invention also provides antibodies or 5 fragments thereof comprising one or more VL CDRs having the amino acid sequence of one or more VL CDRs listed in Table 2 and/or Table 3 and compositions comprising said antibodies or antibody fragments for use in the prevention, treatment or amelioration of one or more symptoms associated with a RSV infection. The present invention further provides antibodies comprising a VH domain and a VL domain having the amino acid sequence of 10 any VH domain and VL domain listed in Table 2 and compositions comprising said antibodies or antibody fragments for use in the prevention, treatment or amelioration of one or more symptoms associated with a RSV infection. The present invention further provides antibodies comprising one or more VH CDRs and one or more VL CDRs having the amino acid sequence of one or more VH CDRs and one or more VL CDRs listed in Table 2 and/or 15 3 and compositions comprising said antibodies or antibody fragments for use in the prevention, treatment or amelioration of one or more symptoms associated with a RSV infection. In the above embodiments, preferably the antibody binds inuunospecifically to a RSV antigen. The present invention also encompasses methods for achieving a serum titer of at 20 least 40 pg/ml of one or more antibodies or fragments thereof that immunospecifically bind to one or more RSV antigens in a mammal, preferably a primate and most preferably a human. In particular, the present invention provides methods for achieving a serum titer of at least 40 pig/ml (preferably at least 75 pg/ml, more preferably at least 100 pg/ml, and most preferably at least 150 ptg/ml) of an antibody or fragment thereof that immunospecifically 25 binds to a RSV antigen in a non-primate mammal, comprising administering a dose of less than 2.5 mglkg (preferably 1.5 mgfkg or less) of the antibody or anfibody fragment to the non-primate mammal and measuring the serum titer of the antibody or antibody fragment at least I day after administering the dose to the non-primate mammal. The present invention also provides methods for achieving a serure-tkmw 1a ifD A(ferably-at least 30 200 pig/ml) of an antibody or fragment thereof that immunospecifically binds to a RSV antigen in a non-primate manual, comprising administering a dose of approximately 5 mg/kg of the antibody or antibody fragment to the non-primate mammal and measuring the serum titer of the antibody or antibody fragment at least I day after the administration of the dose to the non-primate mammal. 35 -9- The present invention also provides methods for achieving a serum titer of at least 40 ig/ml of an antibody or fragment thereof that immunospecifically binds to a RSV antigen in a primate, comprising administering a first dose of 10 mg/kg (preferably 5 mg/kg or less and more preferably 1.5 mg/kg or less) of the antibody or antibody fragment to the 5 primate and measuring the serum titer of the antibody or antibody fragment 20 days (preferably 25, 30, 35 or 40 days) after administrating the first dose to the primate and prior to the administration of any subsequent dose. The present invention also provides methods for achieving a serum titer of at least 75 pg/ml (preferably at least 100 ptg/ml, at least 150 pg/ml, or at least 200 pig/ml) of an antibody or fragment thereof that immunospecifically 10 binds to a RSV antigen in a primate, comprising administering a first dose of approximately 15 mg/kg of the antibody or antibody fragment to the primate and measuring the serum titer of the antibody or antibody fragment 20 days (preferably 25, 30, 35 or 40 days) after administering the first dose to the primate but prior to any subsequent dose. The present invention also provides methods for preventing, treating, or 15 ameliorating one or more symptoms associated with a RSV infection in a human subject, said methods comprising administering to said human subject at least a first dose of approximately 15 mg/kg of an antibody or fragment thereof that immunospecifically binds to a RSV antigen so that said human subject has a serum antibody titer of at least 75 pig/mil, preferably at least 100 pg/ml, at least 150 pg/mI, or at least 200 Ig/ml 30 days after the 20 administration of the first dose of the antibody or antibody fragment and prior to the administration of a subsequent dose. The present invention also provides methods for preventing, treating or ameliorating one or more symptoms associated with a RSV infection in a human subject, said methods comprising administering to said human subject at least a first dose of less than 15 mg/kg (preferably 10 mg/kg or less, more preferably 5 mg/kg or 25 less, and most preferably 1.5 mg/kg or less) of an antibody or fragment thereof that imnunospedi'fically'binds to a'RSV antigen so that said human subject'has a serum antibody titer of at least 75 pg/ml, preferably at least 100 pg/ml, at least 150 pg/ml, or at least 200 pg/ml 30 days after the administration of the first dose of the antibody or antibody fragment and prior to the administration of a subsequent dose. The present invention further provides 30 methods for preventing, treating or ameliorating one or more symptoms associated with a RSV infection in a human subject, said methods comprising administering to said human subject a first dose of an antibody or fragment thereof that immunospecifically binds to a RSV antigen such that a prophylactically or therapeutically effective serum titer of less than 10 pg/ml is achieved no more than 30 days after administering the antibody or antibody 35 fragment. - 10- The present invention provides methods for achieving a therapeutically or prophylactically effective serum titer in a manual, said methods comprising administering to said mammal an antibody or fragment thereof which immunospecifically binds to a RSV k antigen and which has a kon rate (antibody (Ab) + antigen (Ag) -*Ab-Ag)of at least 2.5 x 5 10 5

M

1 s', preferably at least 3 x 10 5 M s-, at least 5 x 10 5 M' s', at least 10 6 M4 s 1 , at least 5 x10 6

M

1 s', at least 10 7 M- s-, at least 5 xl0 7 M s-1 or at least 10 8 M' s'. In particular, the present invention provides methods for achieving a therapeutically or prophylactically effective serum titer, wherein said effective serum titer is less than 30 pg/ml (and is preferably at least 2 pg/ml, more preferably at least 4 pg/ml, and most preferably at least 6 10 fig/nil) after a certain number of days (for example, but not limited to, 20, 25, 30 or 35 days) without any other dosing within that period, comprising administering to a manual an antibody or fragment thereof which immunospecifically binds to a RSV antigen and which has a k. rate of at least 2.5 X 10 5 M-'s, preferably at least 3 X 10 5 Ms', at least 5 X 10 5

M

's-, at least 106 M's', at least 5 X 106 M"s-, at least I07 M's', at least 5 X 10 M's', or at 15 least 10" M's'. Preferably, the antibody or antibody fragment has a higher k. rate than SYNAGIS@. The present invention also provides methods of neutralizing RSV using an antibody or fragment thereof which immunospecifically bind to a RSV antigen and which has a k, rate of at least 2.5 X I0 M-s', preferably at least 3 X 1O M's', at least 5 X 105 M-'s, at 20 least 106 Ms', at least 5 X 106 M's', at least 10' Ms", at least 5 X 10' M's', or at least 10' M-'s to achieve a prophylactically or therapeutically effective serum titer, wherein said effective serum titer is less than 30 pig/ml (and is preferably at least 2 pg/ml, more preferably at least 4 ig/ml, and most preferably at least 6 Vg/ml) 20, 25, 30, or 35 days after administration without any other dosage administration. Preferably, the antibody or 25 antibody fragment has a higher k( rate than SYNAGIS@. The present invention also provides methods for preventing, treating or ameliorating one or more symptoms associated with a RSV infection in a mammal, preferably a human, said methods comprising administering to said mammal, a dose of less than 15 mg/kg (preferably 5 mg/kg or less, more preferably 3 mg/kg or less, and most preferably 1.5 mg/kg 30 or less) of an antibody or fragment thereof which immunospecifically binds to a RSV antigen and has a kn rate of at least 2.5 X 10' M's', preferably at least 3 X 10' M's', at least 5 X 10M-s-, at least 106 M-'s-, at least 5 X 106 M's-, at least 107 M-'s", at least 5 X 107 M's', or at least 108 M4s. Preferably, the antibody or antibody fragment has a higher k 0 , rate for the RSV F glycoprotein than SYNAGIS@. 35 - 11 - The present invention also provides methods for achieving a therapeutically or prophylactically effective serum titer in a mammal, said methods comprising administering to said mammal an antibody or fragment thereof which immunospecifically binds to a RSV antigen and which has a Kff rate (antibody (Ab) + antigen (Ag)<-Ab-Ag)of less than 6.5 x 5 104 sec', less than 5 x 10- sec', less than 3 x 104 sec', less than 2 x 104 sec', less than 1 x 101 sec', or less than 5 x 10 sec'. In particular, the present invention provides methods for achieving a therapeutically or prophylactically effective serun titer, wherein said effective serum titer is less than 30 pg/ml (and is preferably at least 2 ig/ml, more preferably at least 4 ig/ml, and most preferably at least 6 ptg/ml) after a certain number of 10 days (for example, but not limited to, 20, 25, 30 or 35 days) without any other dosing within that period, comprising administering to a mammal an antibody or fragment thereof which Timmunospecifically binds to a RSV antigen and which has a Kff rate of less than 6.5 x 10' sec', less than 5 x 10' sec', less than 3 x 10' sec', less than 2 x 104 sec', less than I x 10 sec', or less than 3 x 10-3 sec'. Preferably, the antibody or fragment thereof has a lower K.

0 f 15 rate than SYNAGIS@. The present invention also provides methods of neutralizing RSV using an antibody or antibody fragment thereof which immunospecifically binds to a RSV antigen and which has a Koff rate of less than 6.5 x 10' sec', less than 5 x 10 ' sec', less than 3 x 104 sec', less than 2 x 104 sec', less than I x 10' sec', or less than 5 x 10-3 sec' to achieve a 20 prophylactically or therapeutically effective serum titer, wherein said effective serum titer is less than 30 pg/ml (and is preferably at least 2 ig/ml, more preferably at least 4 pg/ml, and most preferably at least 6 Rg/ml) 20, 25, 30, or 35 days after administration without any other dosage administration. Preferably, the antibody or antibody fragment has a lower K.ff than SYNAGIS@. 25 The present invention also provides methods for preventing, treating, or am&fiorating one or more symptoms assodiatea vfth a'RSV'ir'fection in a mammsi, preferdb'ly a human, said methods composing administering to a said mammal a dose of less than 15 mg/kg (preferably 5 mg/kg or less, more preferably 3 mg/kg or less, and most preferably 1.5 mg/kg or less) of an antibody or a fragment thereof which 30 immunospecifically binds to a RSV antigen and which has a K, rate of less than 6.5 x 104 sec', less than 5 x 104 sec4, less than 3 x 104 sec', less than 2 x 104 sec', less than I x 104 sec', or less than 5 x 104 sec-. Preferably, the antibody or antibody fragment has a lower Kff rate than SYNAGIS@. The present invention also provides methods for achieving a therapeutically or 35 prophylactically effective serum titer in a mammal, said methods comprising administering -12to said mammal an antibody or fragment thereof which immunospecifically binds to a RSV antigen and which has an EC 5 0 of less than 0.01 nM, less than 0.025 nM, less than 0.05 nM, less than 0.1 nM, less than 0.25 nM, less than 0.5 nM, less than 0.75 nM, less than 1 nM, less than 1.25 nM, less than 1.5 nM, less than 1.75 nM, or less than 2 nM, in an in vitro 5 microneutralization assay. In particular, the present invention provides methods for achieving a therapeutically or prophylactically effective serum titer, wherein said effective serui titer is less than 30 pig/ml (and is preferably at least 2 pg/ml, more preferably at least 4 pg/ml, and most preferably at least 6 pg/ml) after a certain number of days (for example, but not limited to, 20, 25, 30 or 35 days) without any other dosing within that period, 10 comprising administering to a mammal an antibody or fragment thereof which immunospecifically binds to a RSV antigen and which has an ECo of less than 0.01 nM, less than 0.025 nM, less than 0.05 nM, less than 0.1 nM, less than 0.25 nl\4, less than 0.5 nM, less than 0.75 nM, less than I nM, less than 1.25 nM, less than 1.5 nM, less than 1.75 nM, or less than 2 nM, in an in vitro microneutralization assay Preferably, the antibody or 15 antibody fragment has a lower EC 5 0 than SYNAGIS@. The present invention also provides methods of neutralizing RSV using an antibody or fragment thereof which immunospecifically binds to a RSV antigen and which has an

EC

50 of less than 0.01 nM, less than 0.025 nM, less than 0.05 nM, less than 0.1 nM, less than 0.25 nM, less than 0.5 nM, less than 0.75 nM, less than 1 nM, less than 1.25 nM, less 20 than 1.5 nM, less than 1.75 nM, or less than 2 nM, in an in vitro microneutralization assay to achieve a prophylactically or therapeutically effective serum titer, wherein said effective serum titer is less than 30 pg/mI (and is preferably at least 2 Vg/ml, more preferably at least 4 pg/ml, and most preferably at least 6 pg/ml) 20, 25, 30, or 35 days after administration without any other dosage administration. Preferably, the antibody or antibody fragment has 25 a lower EC 50 than SYNAGIS@. T--ce =-pit- Y -hynion-also'.-pondsvthon&~ ds-ferr-prev entinag,-'treating'-oy rmtim athyg one or more symptoms associated -with a'RS'Q iniection-in a mamnatl, prefer'diy alhuman, said methods comprising administering to said mammal a dose of less than 15 mg/kg (preferably 5 mg/kg or less, more preferably 3 mg/kg or less, and most preferably 1.5 mg/kg 30 or less) of an antibody or a fragment thereof which immunospecifically binds to a RSV antigen and which has an EC 50 of less than 0.01 nM, less than 0.025 nM, less than 0.05 nM, less than 0.1 nM, less than 0.25 nM, less than 0.5 nM, less than 0.75 nM, less than 1 nM, less than 1.25 nM, less than 1.5 nM, less than 1.75 nM, or less than 2 nM, in an in vitro microneutralization assay. Preferably, the antibody or antibody fragment has a lower EC 50 35 than SYNAGIS@. - 13 - The present invention provides methods for achieving a therapeutically or prophylactically effective serum titer in a mammal, said methods comprising administering to said mammal an antibody or fragment thereof which immunospecifically binds to a RSV antigen and which has an affinity constant (K) for a RSV antigen of at least 2 X 10' M-, at 5 least 5 X 10' M', at least 109 M, at least 5 X 109 M', at least 10'* M', at least 5 X 10'0 M1, at least 10" M', at least 5 X 10" M, at least 1012 M', at least 5 X 102 M', at least 10" M , at least 5 X 10" M", at least 10" M-', at least 5 X 10" V, at least 10" M-', or at least 5 X 10" M-. In particular, the present invention also provides methods for achieving a therapeutically or prophylactically effective serum titer, wherein said effective serum titer is 10 less than 30 pg/ml (and is preferably at least 2 ig/mil, more preferably at least 4 pg/ml, and most preferably at least 6 pg/ml) after a certain number of days (for example, but not limited to, 20, 25, 30 or 35 days) without any other dosing within that period, comprising administering to a mammal an antibody or fragment thereof that has an affinity constant (K) for a RSV antigen of at least 2 X10' M-', at least 2.5 X10 8 M-, at least 5 XIO' M', at 15 least 10' M, at least 5 X10 9 M-, at least 10'* M', at least 5 X1O 0 * M', at least 10" M-, at least 5 XIO" M', at least 1012 M', at least 5 XO' 2 M', at least 10" M', at least 5X10' 3 M', at least 10" M-', at least 5 X10" M', at least 10" M', or at least 5 XIO" MW. Preferably, the antibody or antibody fragment has a higher affinity for a RSV F glycoprotein than SYNAGIS@. 20 The present invention also provides methods of achieving a therapeutically or prophylactically effective serum titer, wherein said effective serum titer is less than 30 pLg/ml (and is preferably at least 2 jig/ml, more preferably at least 4 pEg/ml, and most preferably at least 6 pg/mI) after a certain number of days (for example, but not limited to, 20, 25, 30 or 35 days) without any other dosing within that period, comprising 25 administering to a mammal an antibody or fragment thereof which immunospecifically binds to a RSV antigen with a higher avidity than known antibodies such as, e.g., SYNAGIS@. The present invention also provides methods of neutralizing RSV using an antibody or fragment thereof that has an affinity constant (K) for a RSV antigen of at least 2 X10' 30 M', at least 2.5 X 10' M', at least 5 X 10' M', at least 10' M, at least 5 X 109 M-, at least 10'" M', at least 5 X 1010 M', at least 10" M', at least 5 X 10" M', at least 10)2 M', at least 5 X 10 2 M1, at least 10" M-', at least 5 X 10" M4, at least 10" M', at least 5 X 10" M', at least 10" M', or at least 5 X 10" MW to achieve a prophylactically or therapeutically effective serum titer, wherein said effective serum titer is less than 30 ptg/mI (and is at least 35 2 pg/ml and more preferably at least 6 pg/ml) 20, 25, 30, or 35 days after administration -14without any other dosage administration. Preferably, the antibody or antibody fragment has a higher affinity for the RSV F glycoprotein than SYNAGIS@. The present invention also provides methods of neutralizing RSV using an antibody or fragment thereof that has a higher avidity than known antibodies such as, e.g., SYNAGIS@. 5 The present invention also provides methods for preventing, treating or ameliorating one or more symptoms associated with a RSV infection in a mammal, preferably a human, said methods comprising administering to said mammal a dose of less than 15 mg/kg (preferably 5 mg/kg or less, more preferably 3 mg/kg or less, and most preferably 1.5 mg/kg or less) of an antibody or fragment thereof that has an affinity constant (K for a RSV 10 antigen of at least 2X10 8 M-', at least 2.5X108 M-, at least 5X10 8 M-', at least 109 4', at least 5 X 109 M', at least 10' M', at least 5 X 1010 M', at least 10" M', at least 5 X 10" M', at least 1012 M', at least 5 X 1012 M4', at least 10" M', at least 5 X 10" M', at least 10"4 M', at least 5 X 104' M-', at least 10" M', or at least 5 X 10' M-'. Preferably, the antibody or antibody fragment has a higher affinity for the RSV F glycoprotein than SYNAGIS@. 15 The present invention also provides methods for preventing, treating or ameliorating one or more symptoms associated with a RSV infection in a mammal, preferably a human, said methods comprising administering to said mammal a first dose of less than 15 mg/kg (preferably 5 mg/kg or less, more preferably 3 mg/kg or less, and most preferably 1.5 mg/kg or less) of an antibody or fragment thereof that has a higher avidity than known antibodies 20 such as, e.g., SYNAGIS@. The present invention encompasses methods for preventing, treating or ameliorating one or more symptoms associated with a RSV infection in a mammal, preferably a human, comprising administering to said mammal a first dose of a prophylactically or therapeutically effective amount of one or more antibodies or fragments thereof that 25 immunospecifically bind to one or more RSV antigens with higher avidity and/or higher affmiity than known antibodies such as, e.g., SYNAGIS@, wherein said effective amount is less than 15 mg/kg (preferably 5 mg/kg or less, more preferably 3 mg/kg or less, and most preferably 1.5 mg/kg or less) of said antibodies or antibody fragments which dose results in a serum titer of less than 30 pg/mI (which is preferably at least 2 pg/ml, more preferably at 30 least 4 pg/ml, and most preferably at least 6 pg/ml) at least 20 days (preferably at least 25, at least 30, or at least 35 days) after the administration of the first dose and prior to the administration of a subsequent dose. In particular, the present invention provides methods for preventing, treating, or ameliorating one or more symptoms associated with a RSV infection in a human subject, comprising administering to said human subject a first dose of 35 less than 5 mg/kg (preferably 3 mg/kg or less, and most preferably 1.5 mg/kg) of an - 15 antibody or fragment thereof that immunospecifically binds to a RSV antigen with higher avidity and/or higher affinity than known antibodies such as, e.g., SYNAGIS@ (e.g., an affinity of at least 2X10 M4', at least 2.5X10' M-', at least 5X10' M', at least 10' M', at least 5 X 109 M-', at least 10'0 M', at least 5 X 101' M', at least 10" M-', at least 5 X 10" 5 M', at least 10 " M', or at least 5 X 10" M-') so that said human subject has a serum antibody titer of less than 30 ig/ml (which is preferably at least 2 pig/mI, more preferably at least 4 jig/ml, and most preferably at least 6 pLg/ml) at least 20 days (preferably at least 25, at least 30, or at least 35 days) after the administration of the first dose of the antibody or antibody fragment and prior to the administration of a subsequent dose. 10 The present invention also provides methods for preventing, treating or ameliorating one or more symptoms associated with a RSV infection in a mammal, said methods comprising administering to said mammal a first dose of one or more antibodies or fragments thereof comprising a VH domain having an amino acid sequence of any VH domain listed in Table 2 to achieve a therapeutically or prophylactically effective serum 15 titer, wherein said effective serum titer is less than 30 jig/mI (and is preferably at least 2 pg/ml, more preferably at least 4 pg/ml, and most preferably at least 6 pg/ml) after a certain number of days (for example, but not limited to, 20, 25, 30 or 35 days) without any other dosing within that period. The present invention also provides methods for preventing, treating or ameliorating one or more symptoms associated with a RSV infection in a 20 mammal, said methods comprising administering to said manual a first dose of one or more antibodies or fragments thereof comprising one or more VH complementarity determining regions (CDRs) having the amino acid sequence of one or more VH CDRs listed in Table 2 and/or Table 3 to achieve a therapeutically or prophylactically effective serum titer, wherein said effective serum titer is less than 30 fig/ml (and is preferably at .25 e.ast.2:p gi,.mmefemhiy.kalt- 4 :.a md fenmst- 6. .after.a certain number of days (for example, but not limited to, 20, 25, 30 or 35 days) without any other dosing within that period. Preferably, said antibodies or antibody fragments immunospecifically bind to a RSV antigen. The present invention also provides methods for preventing, treating or ameliorating 30 one or more symptoms associated with a RSV infection in a mammal, said methods comprising administering to said mammal a first dose of one or more antibodies or fragments thereof comprising a VL domain having the amino acid sequence of any VL domain listed in Table 2 to achieve a therapeutically or prophylactically effective serum titer, wherein said effective serum titer is less than 30 ptg/ml (and is preferably at least 2 35 ptg/ml, more preferably at least 4 pig/ml, and most preferably at least 6 ig/ml) after a certain - 16number of days (for example, but not limited to, 20, 25, 30 or 35 days) without any other dosing within that period. The present invention also provides methods for preventing, treating or ameliorating one or more symptoms associated with a RSV infection in a mammal, said methods comprising administering to said mammal a first dose of one or 5 more antibodies or fragments thereof comprising one or more VL CDRs having the amino acid sequence of one or more VL CDRs listed in Table 2 and/or Table 3 to achieve a therapeutically or prophylactically effective serum titer, wherein said effective serum titer is less than 30 Vg/ml (and is preferably at least 2 pg/ml, more preferably at least 4 ig/ml, and most preferably at least 6 pg/ml) after a certain number of days (for example, but not 10 limited to, 20, 25, 30 or 35 days) without any other dosing within that period. Preferably, said antibodies or antibody fragments immunospecifically bind to a RSV antigen. The present invention also provides methods for preventing, treating or ameliorating one or more symptoms associated with a RSV infection in a mammal, said methods comprising administering to said mammal a first dose of one or more antibodies or 15 fragments thereof comprising a VH domain and a VL domain having the amino acid sequence of any VH domain and VL domain listed in Table 2 to achieve a therapeutically or prophylactically effective serum titer, wherein said effective serum titer is less than 30 pg/ml (and is preferably at least 2 pg/ml, more preferably at least 4 pg/ml, and most preferably at least 6 pg/ml) after a certain number of days (for example, but not limited to, 20 20, 25, 30 or 35 days) without any other dosing within that period. The present invention also provides methods for preventing, treating or ameliorating one or more symptoms associated with a RSV infection in a mammal, said methods comprising administering to said mammal a first dose of one or more antibodies or fragments thereof comprising one or more VH CDRs and one or more VL CDRs having the amino acid sequence of one or more 25 VH CDRs and one or more VL CDRs listed in Table 2 and/or 3 to achieve a therapeutically or prtphTyIactilly eective-senrtitervrherein'saidft- m e'issthan M pg/niL (and'is preferabbly at'least'2 pgril, more pre'ferily aflieast 4 pg)nii, and most preferably at least 6 pg/mil) after a certain number of days (for example, but not limited to, 20, 25, 30 or 35 days) without any other dosing within that period. Preferably, said 30 antibodies or antibody fragments immunospecifically bind to a RSV antigen. In a specific embodiment, the present invention provides methods for preventing, treating or ameliorating one or more symptoms associated with a RSV infection in a mammal, said methods comprising administering to said mammal a first dose of one or more antibodies or fragments thereof comprising a VH domain having an amino acid 35 sequence of SEQ ID NO:7, 9, 17, 24, 28, 33, 36, 40, 44,48, 51, 67, or 78 and/or a VL - 17 domain having an amino acid sequence of SEQ ID NO:8, 11, 13, 21,26, 30, 34, 38, 42,46, 49, 52, 54, 56, 58, 60, 62, 64, 65, 68, 70, 71, 74 or 76 to achieve a therapeutically or prophylactically effective serum titer, wherein said effective serum titer is less than 30 pg/ml (and is preferably at least 2 ig/ml, more preferably at least 4 pg/ml, and most 5 preferably at least 6 ig/ml) after a certain number of days (for example, but not limited to, 20, 25, 30 or 35 days) without any other dosing within that period. In a preferred embodiment, the present invention provides methods for preventing, treating or ameliorating one or more symptoms associated with a RSV infection in a mammal, said methods comprising administering to said mammal a first dose of one or more antibodies or 10 fragments thereof comprising a VH domain having an amino acid sequence of SEQ ID NO:9, 17, 24, 28, 33, 36, 40, 44, 48, 51, 55, 67 or 78 and/or a VL domain having an amino acid sequence of SEQ ID NO:13, 21, 26, 30, 34, 38, 42, 46, 49, 52, 54, 56, 58, 60, 62, 64, 65, 68, 70, 71, 74 or 76 to achieve a therapeutically or prophylactically effective serum titer, wherein said effective serum titer is less than 30 pg/ml (and is preferably at least 2 ig/ml, 15 more preferably at least 4 jig/nil, and most preferably at least 6 pg/ml) after a certain number of days (for example, but not limited to, 20, 25, 30 or 35 days) without any other dosing within that period. In another embodiment, the present invention provides methods for preventing, treating or ameliorating one or more symptoms associated with a RSV infection in a mammal, said methods comprising administering to said mammal a first dose 20 of one or more antibodies or fragments thereof comprising a VH CDR3 having an amino acid sequence of SEQ ID NO:3, 12, 20, 29, or 79 and a VL CDR3 having an amino acid sequence of SEQ ID NO:6, 16 or 61 to a therapeutically or prophylactically effective serum titer, wherein said effective serum titer is less than 30 jig/ml (and is preferably at least 2 jig/ml, more preferably at least 4 pg/ml, and most preferably at least 6 pg/ml) after a certain 25 number of days (for example, but not limited to, 20, 25, 30 or 35 days) without any other dosing within that period. 'The present invention also provides compositions comprising one or more antibodies or fragments thereof which immunospecifically bind to one or more RSV antigens and which have increased in vivo half-lives compared to known anti-RSV 30 antibodies as a result of, e.g., one or more modifications in amino acid residues identified to be involved in the interaction between the Fc domain of said antibodies or antibody fragments and the FcRn receptor. In one embodiment, a composition of the invention comprises HL-SYNAGIS or an antigen-binding fragment thereof. In another embodiment, a composition of the invention comprises one or more antibodies or fragments thereof 35 which immunospecifically bind to one or more RSV antigens with a higher avidity and/or a - 18 higher affinity than known antibodies such as, e.g., SYNAGIS@ (e.g., antibodies or antibody fragments with an affinity of at least 2X10 8 M', at least 2.5X10 8 M', at least 5X1O M-', at least 10' M', at least 5 X 109 M-', at least 10' M~', at least 5 X 10'0 M-, at least 10" M, at least 5 X 10" M-', at least 10" M', or at least 5 X 10" M-1 for a RSV 5 antigen) and which comprise an Fc domain with increased affinity for the FcRn receptor relative to the Fc domain of SYNAGIS®. In accordance with this embodiment, the increased affinity of the Fc domain of said antibodies or antibody fragments results in an in vivo half-life of said antibodies or antibody fragments of at least 25 days, preferably at least 30 days, more preferably at least 30 days, and most preferably at least 40 days. In another 10 embodiment, a composition of the invention comprises HL-SYNAGIS or an antigen binding fragment thereof and one or more antibodies or fragments thereof which inununospecifically bind to one or more RSV antigens and which comprise an Fc domain with increased affinity for the FcRn receptor relative to the Fc domain of SYNAGIS@. The present invention also provides compositions comprising one or more pegylated 15 antibodies or fragments thereof which irnmunospecifically bind to one or more RSV antigens. In one embodiment, a composition of the invention comprises pegylated SYNAGIS@ or a fragment thereof. In another embodiment, a composition of the invention comprises one or more pegylated antibodies or fragments thereof that immunospecifically bind to one or more RSV antigens with higher avidity and/or higher affinity than known 20 antibodies such as, e.g., SYNAGIS@. In yet another embodiment, a composition of the invention comprises pegylated SYNAGIS@ or an antigen-binding fragment thereof and one or more pegylated antibodies or fragments thereof that immunospecifically bind to one or more RSV antigens with higher avidity and/or higher affinity than known antibodies such as, e.g., SYNAGIS@. 25 The present invention also provides compositions comprising one or more pegylated antibodies or fragments thereof which comprise an Fc domain with increased affinity for the FcRn receptor relative to the Fc domain of SYNAGIS@. In one embodiment, a composition of the invention comprises a pegylated HL-SYNAGlS or an antigen-binding fragment thereof. In another embodiment, a composition of the invention comprises one or more 30 pegylated antibodies or fragments thereof which immunospecifically bind to one or more RSV antigens with a higher avidity and/or a higher affinity than known such as, e.g., SYNAGIS@ and which comprise an Fc domain with increased affinity for the FcRn receptor relative to the Fe domain of SYNAGIS@ The present invention encompasses methods for preventing, treating or ameliorating 35 one or more symptoms associated with a RSV infection in a mammal, preferably a human, -19comprising administering to said mammal a first dose of a prophylactically or therapeutically effective amount of HL-SYNAGIS or an antigen-binding fragment thereof, wherein said effective amount is approximately 15 mg/kg of said antibodies or fragments thereof which dose results in a serum titer of at least 30 pg/ml at least 30 days after the 5 administration of the first dose and prior to the administration of a subsequent dose. In particular, the present invention provides methods for preventing, treating or ameliorating one or more symptoms associated with a RSV infection in a human subject, comprising administering to said human subject a first dose of 15 mg/kg of 1L-SYNAGIS or an antigen-binding fragment thereof so that said human subject has a serum antibody titer of at 10 least 30 pg/ml at least 30 days after the administration of the first dose of the antibody or antibody fragment and prior to the administration of a subsequent dose. The present invention also encompasses methods for preventing, treating or ameliorating one or more symptoms associated with a RSV infection in a mammal, preferably a human, comprising administering to said manmal a first dose of a 15 prophylactically or therapeutically effective amount of one or more antibodies or fragments thereof which have increased in vivo half-lives and which immunospecifically bind to one or more RSV antigens with higher avidity and/or higher affinity than known antibodies such as, e.g., SYNAGIS@ (e.g., antibodies or antibody fragments with an affinity of at least 2X10 8 M', at least 2.5X1O M', at least 5X10' M', at least 109 M', at least 5 X 109 M4, at 20 least 101* M', at least 5 X 1010 M', at least 10" M', at least 5 X 10" M', at least 10" M-, or at least 5 X 1012 M 4 for a RSV antigen), wherein said effective amount is less than 15 mg/kg (preferably 5 mg/kg or less, more preferably 3 mg/kg or less, and most preferably 1.5 mg/kg or less) of said antibodies or fragments thereof which dose results in a serum titer of less than 30 pg/ml (which is preferably at least 2 pg/ml, more preferably at least 4 pg/ml, 25 and most preferably at least 6 pg/ml) at least 20 days (preferably at least 25, at least 30, or at least 35 days) after the administration of the first dose and prior to the administration of a subsequent dose. In particular, the present invention provides methods for preventing, treating or ameliorating one or more symptoms associated with a RSV infection in a human subject, comprising administering to said human subject a first dose of less than 5 mg/kg 30 (preferably 1.5 mg/kg or less) of an antibody or a fragment thereof which has an increased in vivo half-life and which immunospecifically binds to a RSV antigen with higher avidity and/or higher affinity than known antibodies such as, e.g., SYNAGIS@ (e.g., antibodies or antibody fragments with an affinity of at least 2X10' M', at least 2.5X 10' M', at least 5X10 8 M', at least 10' M', at least 5 X 10' M', at least 1010 M-, at least 5 X 10'0 M', at 35 least 10" M', at least 5 X 10" M', at least 1012 M-, or at least 5 X 10" M-' for a RSV -20antigen) so that said human subject has a serum antibody titer of less than 30 ig/ml (which is preferably at least 2 pg/ml, more preferably at least 4 pg/ml, and most preferably at least 6 pg/mil) at least 25 days (preferably at least 30, at least 35, or at least 40 days) after the administration of the first dose of the antibody or antibody fragment and prior to the 5 administration of a subsequent dose. The present invention provides sustained release formulations comprising one or more antibodies or fragments thereof that immunospecifically bind to one or more RSV antigens. In one embodiment, a sustained release formulation comprises SYNAGIS@ or a fragment thereof. In another embodiment, a sustained release formulation comprises one or 10 more antibodies or fragments thereof that immunospecifically bind to one or more RSV antigens with higher avidity and/or higher affinity than known antibodies such as, e.g., SYNAGIS@ (e.g., antibodies or antibody fragments with an affinity of at least 2X10' M-, at least 2.5X108 M-', at least 5X10' M', at least 109 M', at least 5 X 109 M', at least 10'0 M-, at least 5 X 10" M', at least 10" M', at least 5 X 10" M', at least 1012 M-, or at least 5 X 15 1012 M for a RSV antigen). In another embodiment, a sustained release formulation comprises SYNAGIS@ or an antigen-binding fragment thereof and one or more antibodies or fragments thereof that immunospecifically bind to one or more RSV antigens with higher avidity and/or higher affinity than known antibodies such as, e.g., SYNAGIS@ (e.g., antibodies or antibody fragments with an affinity of at least 2X10 M', at least 2.5X10 8 M', 20 at least 5X10 8 M', at least 10' M, at least 5 X 10' M-, at least 1010 M', at least 5 X 10'* M at least 10" M4, at least 5 X 10" M4, at least 10" M'. or at least 5 X 10" M' for a RSV antigen). In another embodiment, HL-SYNAGIS or an antigen-binding fragment thereof is formulated in as sustained release formulation. In yet another embodiment, antibodies or fragments thereof which have higher avidity and/or higher affinity for one or more RSV 25 antigens than known antibodies such as, e.g..., SYNAGIS@[e.g., antibodies or antibody fragments with an affinity of at least 2X10' M4, at least 2.5X10' M., at least 5X10' M-', at least 10' M', at least 5 X 10' M', at least 10'" M-, at least 5 X 10'0 M, at least 10" M-, at least 5 X 10" M-', at least 1012 M-1, or at least 5 X 1012 M for a RSV antigen) and which comprises an Fc domain with increased affinity for the FcRn receptor relative to the Fc 30 domain of SYNAGIS@ are formulated in sustained release formulations. The present invention also provides methods for preventing, treating or ameliorating one or more symptoms associated with a RSV infection in a mammal, preferably a human, comprising administering to said mammal a first dose of a prophylactically or therapeutically effective amount of one or more antibodies or fragments thereof that 35 immunospecifically bind to one or more RSV antigens in a sustained release formulation, -21 wherein said effective amount is a dose of 15 mg/kg or less of said antibodies or fragments thereof, which dose, preferably results in a serum titer of at least 2 pg/ml (preferably at least 5 pg/ml, at least 10 pg/ml, at least 20 pg/ml, at least 30 pg/ml, or at least 40 pg/ml) for at least 20 days (preferably at least 25, 30, 35 or 40 days) after the administration of the first 5 dose and prior to the administration of a subsequent dose. In one embodiment, a mammal, preferably a human, is administered a first dose of a prophylactically or therapeutically effective amount of SYNAGIS@ or an antigen-binding fragment thereof in a sustained release formulation, wherein said effective amount is a dose of approximately 15 mg/kg of SYNAGIS@ or an antigen-binding fragment thereof which 10 dose results in a serum titer of at least 20 pg/ml (preferably at least 30 pg/ml, more preferably at least 40 pg/ml, and most preferably at least 50 pg/ml) for at least 30 days (preferably at least 35 days, more preferably at least 40 days, and most preferably at least 45 days) after the administration of the first dose and prior to the administration of a subsequent dose. In a preferred embodiment, a mammal, preferably a human, is 15 administered a first dose of a prophylactically or therapeutically effective amount of SYNAGIS@ or an antigen-binding fragment thereof in a sustained release formulation, wherein said effective amount is a dose of 15 mg/kg or less of SYNAGIS@ or an antigen binding fragment thereof which dose results in a serum titer of 20 pg/ml (preferably at least 30 pg/ml, more preferably at least 40 pg/ml, and most preferably at least 50 pg/ml) at least 20 30 days (preferably at least 35 days, more preferably at least 40 days, and most preferably at least 45 days) after the administration of the first dose and prior to the administration of a subsequent dose. In another embodiment, a mammal, preferably a human, is administered a first dose of a prophylactically or therapeutically effective amount of one or more antibodies or 25 fragments thereof which immunospecifically bind to one or more RSV antigens with higher a;Viity ati of Higher affitiity thAi'known atff'oodies sidh as, e.g2"TRNGIS&\e.g., at least 5X10 8 M', at least 10' M-, at least 5 X 109 M', at least 1010 M', at least 5 X 1010 M 1, at least 10" M 4 , at least 5 X 10" M', at least 10" M-, or at least 5 X 10" M' for a RSV 30 antigen) in a sustained release formulation, wherein said effective amount is a dose of less than 15 mg/kg (preferably 5 mg/kg or less, more preferably 3 mg/kg or less, and most preferably 1.5 mg/kg or less) of said antibodies or antibody fragments which dose results in a serum titer of less than 30 pg/ml (which is preferably at least 2 pg/mI, more preferably at least 4 pg/ml, and most preferably at least 6 pg/ml) for at least 20 days (preferably at least 35 25, at least 30, at least 35, or at least 40 days) after the administration of the first dose and - 22 prior to the administration of a subsequent dose. In a preferred embodiment, a mammal, preferably a human, is administered a first dose of a prophylactically or therapeutically effective amount of one or more antibodies or fragments thereof which immunospecifically bind to one or more RSV antigens with higher avidity and/or higher affinity than known 5 antibodies such as, e.g., SYNAGIS@ (e.g., antibodies or antibody fragments with an affinity of at least 2X10 8 M', at least 2 .5X10 M', at least 5X10 8 M-, at least 109 M, at least 5 X 109 M , at least 10'* M-, at least 5 X 10'* M', at least 10" M, at least 5 X 10" 1 M-', at least 1012 M", or at least 5 X 102 M" for a RSV antigen) in a sustained release formulation, wherein said effective amount is a dose of less than 15 mg/kg of said antibodies or antibody 10 fragments which dose results in a serum titer of 10 ptg/ml for at least 20 days (preferably at least 25, at least 30, at least 35 or at least 40 days) after the administration of the first dose and prior to the administration of a subsequent dose. In accordance with this embodiment, the prophylactically or therapeutically effective amount of the dose of the antibodies or antibody fragments is approximately 0.5 mg/kg, preferably 1 mg/kg, 1.5 ing/kg, 3 mg/kg, 5 15 mg/kg, 7.5 mg/kg, 10 mg/kg, 12 mg/kg, or 14 mg/kg. In another preferred embodiment, a mammal, preferably a human, is administered a first dose of a prophylactically or therapeutically effective amount of one or more antibodies or fragments thereof which immunospecifically bind to one or more RSV antigens with higher avidity and/or higher affinity than known antibodies such as, e.g., SYNAGIS@ (e.g., antibodies or antibody 20 fragments with an affinity of at least 2X10' M', at least 2.5X10' M', at least 5X10 8 M', at least 10' M-, at least 5 X 109 M-, at least 10'* M', at least 5 X 10'0 M', at least 10" M', at least 5 X 10" M-, at least 1012 M', or at least 5 X 1012 M for a RSV antigen) in a sustained release formulation, wherein said effective amount is a dose of 1.5 mg/kg of said antibodies or antibody fragments which dose results in a serum titer of 10 pig/nd for at least 20 days 25 (preferably at least 25, at least 30, at least 35, or at least 40 days) after the administration of the first dose and prior to the administration of a subsequent dose. Additionally, the present invention provides sustained release compositions comprising one or more antibodies or fragments thereof which immunospccifically bind to one or more RS. 30 titer in a subject for a certain period of time without exceeding a particular serum titer. In one embodiment, a sustained release formulation comprising SYNAGIS@ or an antigen binding fragment thereof maintains a serum titer in a mammal, preferably a human, of approximately 25 pg/nl (preferably 30 ig/ml, more preferably 40 [ig/ml, and most preferably 50 pg/ml) without exceeding a serum titer of approximately 100 ptg/ml 35 (preferably 75 jig/nil) for at least 20 days (preferably at least 25, 30, 35, or 40 days). In - 23 another embodiment, a sustained release formulation comprising one or more antibodies or fragments thereof which immunospecifically bind to one or more RSV antigens with a higher avidity and/or a higher affinity than previously known antibodies such as, e.g., SYNAGIS@, maintains a serum titer in a mammal, preferably a human, of approximately 2 5 pg/ml (preferably 6 ptg/ml, 10 ig/ml, 20 pg/ml, or 30 gg/ml) without exceeding a serum titer of approximately 40 pg/ml (preferably 75 jig/ml) for at least 20 days (preferably at least 25, 30, 35, or 40 days). The present invention encompasses methods of preventing, treating or ameliorating one or more symptoms of RSV infection in a mammal, preferably a human, by 10 administering sustained release formulations of one or more antibodies or fragments thereof which immunospecifically bind to one or more RSV antigens and which have increased in vivo half-lives. In one embodiment, a sustained release formulation comprising HL SYNAGIS or an antigen-binding fragment thereof is administered to a mammal, preferably a human, to prevent, treat, or ameliorate one or more symptoms associated with a RSV 15 infection. In another embodiment, a sustained release formulation comprising one or more antibodies or fragments thereof which have higher avidity and/or higher affinity for one or more RSV antigens than known antibodies such as, e.g., SYNAGIS@ (e.g., antibodies or antibody fragments with an affinity of at least 2X10 3 M', at least 2.5X10 8 M-, at least 5X10 8 M', at least 10' M', at least 5 X 10' M', at least 10'0 M', at least 5 X 10'0 M', at 20 least 10" M', at least 5 X 10" M', at least 1012 M-, or at least 5 X 1012 M' for a RSV antigen) and which comprises an Fc domain with increased affinity for the FcRn receptor relative to the Fc domain of SYNAGIS@ are administered to a mammal, preferably a human, to prevent, treat, or ameliorate one or more symptoms associated with a RSV infection. 25 The present invention also provides pulmonary delivery systems for administering one or more anfibodfies or'fragmients theredt Wi6h immunospedifically bind to one or more RSV unAigens. 'in -parficular, the present invention proVides composifions 'or pilmonary delivery, said compositions comprising one or more antibodies or fragments thereof which immunospecifically bind to one or more RSV antigens. SYNAGIS@ or an antigen-binding 30 fragment thereof can be incorporated into compositions for pulmonary delivery. HL SYNAGIS or an antigen-binding fragment thereof can be incorporated into compositions for pulmonary delivery. One or more antibodies or fragments thereof that bind to one or more RSV antigens with higher affinity and/or higher avidity than known antibodies such as, e.g., SYNAGIS@ (e.g., antibodies or antibody fragments with an affinity of at least 35 2X10' M-', at least 2.5X10 8 M-, at least 5X10 8 M, at least 10' M', at least 5 X 109 M', at - 24 least 101" M-, at least 5 X 10" M, at least 10" M", at least 5 X 10" M-', at least 1012 M-, or at least 5 X 10" M for a RSV antigen) can be incorporated into compositions for pulmonary delivery. Further, one or more antibodies or fragments thereof which bind to one or more RSV antigens with higher affinity and/or higher avidity than known antibodies 5 such as., e.g., SYNAGIS@ (e.g., antibodies or antibody fragments with an affinity of at least 2X10 8 M', at least 2.5X10' M', at least 5X10' M', at least 10' M', at least 5 X 10' M-, at least 1010 M', at least 5 X 101* M-1, at least 10" M, at least 5 X 10" M-', at least 10" M', or at least 5 X 101" M for a RSV antigen) and which comprise an Fc domain with increased affinity for the FcRn receptor relative to the Fc domain of SYNAGIS@ can be incorporated 10 into compositions for pulmonary delivery. The present invention also provides methods for preventing, treating or ameliorating one or more symptoms associated with a RSV infection, said methods comprising administering to a mammal, preferably a human, a composition for pulmonary delivery comprising one or more antibodies or fragments thereof which iinmunospecifically bind to 15 one or more RSV antigens. In particular, the present invention provides methods for preventing, treating or ameliorating one or more symptoms associated with a RSV infection, said methods comprising administering to a mammal, preferably a human, a composition for pulmonary delivery comprising SYNAGIS@ or fragments thereof. The present invention also provides methods for preventing, treating or ameliorating one or more 20 symptoms associated with a RSV infection, said methods comprising administering to a mammal, preferably a human, a composition for pulmonary delivery comprising one or more antibodies or fragments thereof which immunospecifically bind to one or more RSV antigens with higher affinity and/or higher avidity than known antibodies such as, e.g., SYNAGIS@ (e.g., antibodies or antibody fragments having an affinity of at least 2X10 8 M, 25 at least 2.5X10 8 M4, at least 5X10 8 M', at least 10' M, at least 5 X 10' M4, at least 1010 M-., at least 5 X 1010 M. at least 10" M, at least 5 X 10" M, at least 1012 M-, or at least 5 X 10" M' for one or more RSV antigens). In one embodiment, a first dose of a prophylactically or therapeutically effective amount of a composition comprising SYNAGIS@ or an antigen-binding fragment thereof is 30 administered to the lungs of a mammal, preferably a human, and results in an antibody concentration of at least 20 ng per mg of lung protein (preferably at least 40 ng/mg, at least 60 ng/mg, at least 80 ng/mg, at least 50 ng/mg, at least 75 ng/mg, at least 100 ng/ing, or at least 150 ng/mg) at least 20 days (preferably at least 25, 30, 35 or 40 days) after the administration of the first dose and prior to the administration of a subsequent dose. 35 Preferably, the prophylactically or therapeutically effective amount is a dose of - 25 approximately 0.01 mg/kg, (preferably at least 0.1 mg/kg, at least 1 mg/kg, at least 2 mg/kg, at least 4 mg/kg, at least 5 mg/kg or at least 10 mg/kg) of SYNAGIS@ or an antigen binding fragment thereof. In another embodiment, a first dose of a prophylactically or therapeutically effective 5 amount of a composition comprising one or more antibodies or fragments thereof which immunospecifically bind to one or more RSV antigens with higher affinity and/or higher avidity than known antibodies such as, e.g., SYNAGIS@, (e.g., antibodies or antibody fragments having an affinity of at least 2X10' M', at least 2.5X10' M', at least 5X10 8 M-, at least 10 9 M, at least 5 X 10' M, at least 10'0 M, at least 5 X 10'" M-1, at least 10" M-, 10 at least 5 X 10" M, at least 10" M', or at least 5 X 1012 M for one or more RSV antigens) is administered to the lungs of a mammal, preferably a human and results in an antibody concentration of 20 ng per mg of lung protein (preferably at least 40 ng/mg, at least 60 ng/mg, at least 80 ng/mg, at least 50 ng/mg, at least 75 ng/mg, at least 100 ng/mg, or at least 150 ng/mg) , at least 200 ng/mg, at least 250 ng/mg, at least 500 ng/mg, at 15 least 750 ng/mg, at least I pg/mg, at least 2 pig/mg, at least 5 pig/mg, at least 10 pig/mg, at least 15 pg/mg, or at least 25 pg/mg) at least 20 days (preferably at least 25, 30, 35 or 40 days) at least 20 days (preferably at least 25, at least 30, at least 35 or at least 40 days after the administration of the first dose and prior to the administration of a subsequent dose. Preferably, the prophylactically effective amount is a dose of approximately 0.00 1 mg/kg, 20 (preferably at least 0.005 mg/kg, at least 0.01 mg/kg, at least 0.05 mg/kg, at least 0.1 mg/kg, at least 1 mg/kg, at least 2 mg/kg, at least 4 mg/kg, at least 5 mg/kg or at least 10 mg/kg) of said antibodies or antibody fragments. The present invention further provides detectable or diagnostic compositions comprising using antibodies or fragments thereof that imrnunospecifically bind to a RSV 25 antigen, and methods for detecting or diagnosing a RSV infection utilizing said composifions. 3.1. DEFINITIONS The term "analog" as used herein refers to a polypeptide that possesses a similar or 30 identical function as a RSV polypeptide, a fragment of a RSV polypeptide, an antibody, or antibody fragment but does not necessarily comprise a similar or identical amino acid sequence of a RSV polypeptide, a fragment of a RSV polypeptide, an antibody, or antibody fragment, or possess a similar or identical structure of a RSV polypeptide, a fragment of a RSV polypeptide, an antibody, or antibody fragment. A polypeptide that has a similar 35 amino acid sequence refers to a polypeptide that satisfies at least one of the following: (a) a -26polypeptide having an amino acid sequence that is at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 99% identical to the amino acid sequence of a RSV polypeptide, a fragment of a RSV polypeptide, an antibody, 5 or antibody fragment described herein; (b) a polypeptide encoded by a nucleotide sequence that hybridizes under stringent conditions to a nucleotide sequence encoding a RSV polypeptide, a fragment of a RSV polypeptide, an antibody, or antibody fragment described herein of at least 5 amino acid residues, at least 10 amino acid residues, at least 15 amino acid residues, at least 20 amino acid residues, at least 25 amino acid residues, at least 40 10 amino acid residues, at least 50 amino acid residues, at least 60 amino residues, at least 70 amino acid residues, at least 80 amino acid residues, at least 90 amino acid residues, at least 100 amino acid residues, at least 125 amino acid residues, or at least 150 amino acid residues; and (c) a polypeptide encoded by a nucleotide sequence that is at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, 15 at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 99% identical to the nucleotide sequence encoding a RSV polypeptide, a fragment of a RSV polypeptide, an antibody, or antibody fragment described herein. A polypeptide with similar structure to a RSV polypeptide, a fragment of a RSV polypeptide, an antibody, or antibody fragment described herein refers to a polypeptide that has a similar secondary, 20 tertiary or quaternary structure of a RSV polypeptide, a fragment of a RSV, an antibody, or antibody fragment described herein. The structure of a polypeptide can determined by methods known to those skilled in the art, including but not limited to, X-ray crystallography, nuclear magnetic resonance, and crystallographic electron microscopy. The term "derivative" as used herein refers to a polypeptide that comprises an amino 25 acid.seguence of a RSV polypeptide, a fragment of a RSV po1ypeptide, an antibody that immunospecifically binds to a RSV polypeptide, or an antibody fragment that immunospecifically binds to a RSV polypeptide which has been altered by the introduction of amino acid residue substitutions, deletions or additions. The term "derivative" as used herein also refers to a RSV polypeptide, a fragment of a RSV polypeptide, an antibody that 30 immunospecifically binds to a RSV polypeptide, or an antibody fragment that irmmunospecifically binds to a RSV polypeptide which has been modified, i.e, by the covalent attachment of any type of molecule to the polypeptide. For example, but not by way of limitation, a RSV polypeptide, a fragment of a RSV polypeptide, an antibody, or antibody fragment may be modified, e.g., by glycosylation, acetylation, pegylation, 35 phosphorylation, amidation, derivatization by known protecting/blocking groups, - 27 proteolytic cleavage, linkage to a cellular ligand or other protein, etc. A derivative of a RSV polypeptide, a fragment of a RSV polypeptide, an antibody, or antibody fragment may be modified by chemical modifications using techniques known to those of skill in the art, including, but not limited to specific chemical cleavage, acetylation, formylation, metabolic 5 synthesis of tunicamycin, etc. Further, a derivative of a RSV polypeptide, a fragment of a RSV polypeptide, an antibody, or antibody fragment may contain one or more non-classical amino acids. A polypeptide derivative possesses a similar or identical function as a RSV polypeptide, a fragment of a RSV polypeptide, an antibody, or antibody fragment described herein. 10 The term "effective neutralizing titer" as used herein refers to the amount of antibody which corresponds to the amount present in the serum of animals (human or cotton rat) that has been shown to be either clinically efficacious (in humans) or to reduce virus by 99% in, for example, cotton rats. The 99% reduction is defined by a specific challenge of, e.g., 101 pfu, 101 pfu, 10 5 pfu, 10' pfu, 10' pfu, 10 8 pfu, or 109 pfu) of RSV. 15 The term "epitopes" as used herein refers to portions of a RSV polypeptide having antigenic or inmunogenic activity in an animal, preferably a mammal, and most preferably in a human. An epitope having immunogenic activity is a portion of a RSV polypeptide that elicits an antibody response in an animal. An eptiope having antigenic activity is a portion of a RSV polypeptide to which an antibody immunospecifically binds as determined by any 20 method well known in the art, for example, by the immunoassays described herein. Antigenic epitopes need not necessarily be immunogenic. The term "fragment" as used herein refers to a peptide or polypeptide comprising an amino acid sequence of at least 5 contiguous amino acid residues, at least 10 contiguous amino acid residues, at least 15 contiguous amino acid residues, at least 20 contiguous 25 amino acid residues, at least 25 contiguous amino acid residues, at least 40 contiguous aniino adid resihues, 't'ieast '5) contiguous aniino adid residues, afleast130 ctnitiguous aniino reTdues, at'Ieasl"YO contiguus arninu acd itfidues, least configuousto arriino acid residues, at least contiguous 90 amino acid residues, at least contiguous 100 amino acid residues, at least contiguous 125 amino acid residues, at least 150 contiguous amino acid 30 residues, at least contiguous 175 amino acid residues, at least contiguous 200 amino acid residues, or at least contiguous 250 amino acid residues of the amino acid sequence of a RSV polypeptide or an antibody that immunospecifically binds to a RSV polypeptide. The term "human infant" as used herein refers to a human less than 24 months, preferably less than 16 months, less than 12 months, less than 6 months, less than 3 months, 35 less than 2 months, or less than I month of age. -28- The term " human infant born prematurely" as used herein refers to a human born at less than 40 weeks gestational age, preferably less than 35 weeks gestational age, who is less than 6 months old, preferably less than 3 months old, more preferably less than 2 months old, and most preferably less than 1 month old. 5 An "isolated" or "purified" antibody or fragment thereof is substantially free of cellular material or other contaminating proteins from the cell or tissue source from which the protein is derived, or substantially free of chemical precursors or other chemicals when chemically synthesized. The language "substantially free of cellular material" includes preparations of an antibody or antibody fragment in which the antibody or antibody 10 fragment is separated from cellular components of the cells from which it is isolated or recombinantly produced. Thus, an antibody or antibody fragment that is substantially free of cellular material includes preparations of antibody or antibody fragment having less than about 30%, 20%, 10%, or 5% (by dry weight) of heterologous protein (also referred to herein as a "contaminating protein"). When the antibody or antibody fragment is 15 recombinantly produced, it is also preferably substantially free of culture medium, i.e., culture medium represents less than about 20%, 10%, or 5% of the volume of the protein preparation. When the antibody or antibody fragment is produced by chemical synthesis, it is preferably substantially free of chemical precursors or other chemicals, i.e., it is separated from chemical precursors or other chemicals which are involved in the synthesis of the 20 protein. Accordingly such preparations of the antibody or antibody fragment have less than about 30%, 20%, 10%, 5% (by dry weight) of chemical precursors or compounds other than the antibody or antibody fragment of interest. In a preferred embodiment, antibodies of the invention or fragments thereof are isolated or purified. An "isolated" nucleic acid molecule is one which is separated from other nucleic 25 acid molecules wehichare.present.intha..natual surceofthenucleicacid m.LQacuk Moreover, an "isolated" nucleic acid molecule, such as a cDNA molecule, can be substantially free of other cellular material, or culture medium when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized. In a preferred embodiment, nucleic acid molecules encoding 30 antibodies of the invention or fragments thereof are isolated or purified. The term "fusion protein" as used herein refers to a polypeptide that comprises an amino acid sequence of an antibody or fragment thereof and an amino acid sequence of a heterologous polypeptide (e.g., a non-anti-RSV antigen antibody). The term "high potency" as used herein refers to antibodies or fragments thereof that 35 exhibit high potency as determined in various assays for biological activity (e.g., - 29 neutralization of RSV) such as those described herein. For example, high potency antibodies of the present invention or fragments thereof have an EC 5 0 value less than 0.01 nM, less than 0.025 niM, less than 0.05 nM, less than 0.1 nM, less than 0.25 nM, less than 0.5 nM, less than 0.75 nM, less than I nM, less than 1.25 nM, less than 1.5 nM, less than 5 1.75 nM, or less than 2 nM as measured by a microneutralization assay described herein. Further, high potency antibodies of the present invention or fragments thereof result in at least a 75%, preferably at least a 95% and more preferably a 99% lower RSV titer in a cotton rat 5 days after challenge with 10' pfu relative to a cotton rat not administered said antibodies or antibody fragments. In certain embodiments of the invention, high potency 10 antibodies of the present invention or fragments thereof exhibit a high affinity and/or high avidity for one or more RSV antigens (e.g., antibodies or antibody fragments having an affinity of at least 2Xl10 M-, at least 2.5X10' M', at least 5X108 M-, at least 109 M-, at least 5 X 109 M', at least 10'* M', at least 5 X 10'* M', at least 10" M-, at least 5 X 10"' M, at least 10 " M', or at least 5 X 10" M" for one or more RSV antigens). 15 The tenn "host" as used herein refers to a mammal, preferably a human. The term "host cell" as used herein refers to the particular subject cell transfected with a nucleic acid molecule and the progeny or potential progeny of such a cell. Progeny of such a cell may not be identical to the parent cell transfected with the nucleic acid molecule due to mutations or environmental influences that may occur in succeeding 20 generations or integration of the nucleic acid molecule into the host cell genome. In certain embodiments of the invention, a "prophylactically effective serum titer" is the serum titer in a mammal, preferably a human, that reduces the incidence of a RSV infection in said mammal. Preferably, the prophylactically effective serum titer reduces the incidence of RSV infections in humans with the greatest probability of complications 25 resulting from RSV infection (e.g., a human with cystic fibrosis, bronchopulmonary dysplasia, congenital heart disease, congeriital inununodificiency or acquired immunodeficiency, a human who-has bad a'bone marrow transplant, human infhnt, or an elderly human). In certain other embodiments of the invention, a "prophylactically effective serun titer" is the serum titer in a cotton rat that results in a RSV titer 5 days after challenge 30 with 101 pfu that is 99% lower than the RSV titer 5 days after challenge with 10' pfu of RSV in a cotton rat not administered an antibody or antibody fragment that inimunospecifically binds to a RSV antigen. In certain embodiments of the invention, a "therapeutically effective serum titer" is the serum titer in a mammal, preferably a human, that reduces the severity, the duration 35 and/or the symptoms associated with a RSV infection in said mammal. Preferably, the -30therapeutically effective serumr titer reduces the severity, the duration and/or the number symptoms associated with RSV infections in humans with the greatest probability of complications resulting from a RSV infection (e.g., a human with cystic fibrosis, bronchopulmonary dysplasia, congenital heart disease, congenital immunodeficiency or 5 acquired immunodeficiency, a human who has had a bone marrow transplant, a human infant, or an elderly human). In certain other embodiments of the invention, a "therapeutically effective serum titer" is the serum titer in a cotton rat that results in a RSV titer 5 days after challenge with 10' pfu that is 99% lower than the RSV titer 5 days after challenge with 10' pfu of RSV in a cotton rat not administered an antibody or antibody 10 fragment that immunospecifically binds to a RSV antigen. As used herein, "HL-SYNAGIS" is SYNAGIS@ with one or more modifications in amino acid residues identified to be involved in the interaction between the Fc domain of SYNAGIS@ and the FcRn receptor which results in an increase in the in vivo half-life of SYNAGIS@ to greater than 21 days. An antigen-binding fragment of HL-SYNAGIS is a 15 fragment of SYNAGIS® which immunospecifically binds to RSV F glycoprotein and has one or more modifications in amino acid residues identified to be involved in the interaction between the Fc domain of SYNAGIS@ and the FcRn receptor, wherein said modifications result in an increase in the in vivo half-life of the antigen-binding fragment. In accordance with the invention, HL-SYNAGIS or an antigen-binding fragment thereof has an in vivo 20 half-life of at least 25 days, preferably at least 30 days, more preferably at least 35 days, and most preferably at least 40 days. The term "RSV antigen" refers to a RSV polypeptide or fragment thereof to which an antibody or antibody fragment immunospecifically binds. An RSV antigen also refers to an analog or derivative of a RSV polypeptide or fragment thereof to which an antibody or 25 antibody fragment immunospecifically binds. The term "serum titer" as used herein refers to an average serum titer in a population of least 10, preferably at least 20, and most preferably at-least 40 stibjects. The term "antibodies or fragments that inununospecifically bind to a RSV antigen" as used herein refers to antibodies or fragments thereof that specifically bind to a RSV 30 polypeptide or a fragment of a RSV polypeptide and do not non-specifically bind to other polypeptides. Antibodies or fragments that immunospecifically bind to a RSV polypeptide or fragment thereof may have cross-reactivity with other antigens. Preferably, antibodies or fragments that immunospecifically bind to a RSV polypeptide or fragment thereof do not cross-react with other antigens. Antibodies or fragments that immunospecifically bind to a 35 -31 - RSV polypeptide can be identified, for example, by immunoassays or other techniques known to those of skill in the art. To determine the percent identity of two amino acid sequences or of two nucleic acid sequences, the sequences are aligned for optimal comparison purposes (e.g., gaps can be 5 introduced in the sequence of a first amino acid or nucleic acid sequence for optimal alignment with a second amino acid or nucleic acid sequence). The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the 10 molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences (i.e., % identity number of identical overlapping positions/total number of positions x 100%). In one embodiment, the two sequences are the same length. The determination of percent identity between two sequences can also be 15 accomplished using a mathematical algorithm. A preferred, non-limiting example of a mathematical algorithm utilized for the comparison of two sequences is the algorithm of Karlin and Altschul, 1990, Proc. Natl. Acad. Sci. U.S.A. 87:2264-2268, modified as in Karlin and Altschul, 1993, Proc. Natl. Acad. Sci. U.S.A. 90:5873-5877. Such an algorithm is incorporated into the NBLAST and XBLAST programs of Altschul et al., 1990, J. Mol. 20 Biol. 215:403. BLAST nucleotide searches can be performed with the NBLAST nucleotide program parameters set, e.g., for score=100, wordlength=12 to obtain nucleotide sequences homologous to a nucleic acid molecules of the present invention. BLAST protein searches can be performed with the XBLAST program parameters set, e.g., to score-50, wordlength=3 to obtain amino acid sequences homologous to a protein molecule of the 25 present invention. To obtain gapped alignments for comparison purposes, Gapped BLAST -n ti d-eribe in Mtshu et-&a., ~4997;Naleir Acidsmes.'25:3M9- 3142. relationships between molecules (Id.). When utilizing BLAST, Gapped BLAST, and PSI-Blast programs, the default parameters of the respective programs (e.g., of XBLAST 30 and NBLAST) can be used (see, e.g., http://www.ncbi.nlm.nih.gov). Another preferred, non-limiting example of a mathematical algorithm utilized for the comparison of sequences is the algorithm of Myers and Miller, 1988, CABIOS 4:11-17. Such an algorithm is incorporated in the ALIGN program (version 2.0) which is part of the GCG sequence alignment software package. When utilizing the ALIGN program for comparing amino acid 35 -32sequences, a PAM 120 weight residue table, a gap length penalty of 12, and a gap penalty of 4 can be used. The percent identity between two sequences can be determined using techniques similar to those described above, with or without allowing gaps. In calculating percent 5 identity, typically only exact matches are counted. 4. DESCRIPTION OF THE FIGURES Figures 1 A-i B show the amino acid sequences of the (A) light chain variable region and (B) heavy chain variable region of a high affinity monoclonal antibody that binds to a 10 RSV antigen the potency of which can be increased by methods described herein or in Applicants' copending applications Serial Nos. 60/168,426 and 60/186,252. For reference purposes, this is the amino acid sequence of the SYNAGIS@ antibody disclosed in Johnson et al., 1997, J. Infect. Dis. 176:1215-1224 and U.S. Patent No. 5,824,307. Here, the CDR regions are underlined while non-underlined residues form the framework regions of the 15 variable regions of each antibody. In this antibody, the CDRs are derived from a mouse antibody while the framework regions are derived from a human antibody. The constant regions (not shown) are also derived from a human antibody. Figures 2A-2B show the (A) light chain variable region and (B) heavy light chain variable region for an antibody sequence. CDR regions are underlined. This sequence 20 differs from the sequence disclosed in Figures IA-lB in the first 4 residues of VH CDR1 of the light chain, residue 103 of the light chain and residue 112 of the heavy chain. 5. DETAILED DESCRIPTION OF THE INVENTION The present invention provides methods of preventing, neutralizing, treating and 25 ameliorating one or more symptoms associated with a RSV infection in a subject compfising adxniifistefing to sad sd~ject one or more antfb6dies wiidh'immunospedificdYly 6ind to one or more RSV antigens with'high affinity and/or high avidity and/orhave a longer serum half-life. The high affinity and/or high avidity of the antibodies of the invention enable the use of lower doses of said antibodies than previously thought to be 30 effective for the prevention, neutralization, treatment and the amelioration of symptoms associated with RSV infection. The use of lower doses of antibodies which immunospecifically bind to one or more RSV antigens reduces the likelihood of adverse effects, as well as providing a more effective prophylaxis. Further, the high affinity and/or high avidity of the antibodies of the invention enable less frequent administration of said 35 - 33 antibodies than previously thought to be necessary for the prevention, neutralization, treatment and the amelioration of symptoms associated with RSV infection. The present invention also provides methods of preventing, neutralizing, treating and ameliorating one or more symptoms associated with a RSV infection in a subject 5 comprising administering to said subject one or more antibodies which immunospecifically bind to one or more RSV antigens, said antibodies having a longer half-life than other previously known antibodies. The present invention also provides improved methods of administering one or more antibodies which immunospecifically bind to one or more RSV antigens to a subject, said 10 methods enable lower doses of said antibodies to be administered to the subject while achieving serum titers effective for the prevention, neutralization, treatment and amelioration of one or more symptoms associated with RSV infection. The present invention encompasses methods of delivering one or more antibodies which immunospecifically bind to one or more RSV antigens directly to the site of RSV infection. 15 In particular, the invention encompasses pulmonary delivery of one or more antibodies which immunospecifically bind to one or more RSV antigens. The improved methods of delivering of one or more antibodies which immunospecifically bind to one or more RSV antigens reduces the dosage and frequency of administration of said antibodies to a subject. The present invention is based, in part, upon achieving or inducing a serum titer of 1 20 pg/ml or less, preferably 2 jig/ml or less, 5 pg/ml or less, 6 ptg/ml or less, 10 ptg/mil or less, 15 pig/ml or less, 20 pg/mI or less, or 25 pg/nil or less of an antibody or fragment thereof that immunospecifically binds to a respiratory syncytial virus (RSV) antigen in a mammal with higher affinity and/or higher avidity than previously known antibodies, while reducing or avoiding adverse affects. Preferably a serum titer or serum titer of 1 pg/ml or less, 25 preferably 2 pg/ml or less, 5 pg/ml or less, 6 pg/ml or less, 10 pg/nl or less, 15 pg/mI or less, 20 pgnil or'less, or 25 pg7nil or'less'is adlieved approximately'20 days (prererably 25, 30,~35 or 40 6.ays) after a*&niristraton of a Tirst dose danti'oodies or'ragments theredf which imniunospecifically bind to a RSV antigen and without administration of any other doses of said antibodies or fragments thereof. 30 The present invention provides methods of achieving or inducing a serum titer of at least 30 pg/ml, at least 40 pg/ml, at least 50 pg/ml, at least 75 pg/ml, at least 100 pg/ml, at least 125 pg/ml, at least 150 pg/ml, at least 175 pg/ml, at least 200 pg/ml, at least 225 pg/ml, at least 250 pg/ml, at least 275 pg/ml, at least 300 pg/ml, at least 325 pg/ml, at least 350 pg/ml, at least 375 pg/ml, or at least 400 pg/nil of an antibody or fragment thereof that 35 immunospecifically binds to a respiratory syncytial virus (RSV) antigen in a mammal, while - 34 reducing or avoiding adverse affects. Preferably a serum titer or serum titer of at least 30 jig/ml, preferably at least 40 ig/ml, at least 50 ig/mil, at least 75 jig/ml, at least 100 pg/ml, at least 125 jig/ml, at least 150 jig/ml, at least 175 jig/ml, at least 200 [ig/ml, at least 225 jig/ml, at least 250 jig/ml, at least 275 jig/ml, at least 300 pg/ml, at least 325 jig/ml, at least 5 350 pg/ml, at least 375 jig/mil, or at least 400 pg/ml is achieved approximately 30 days after administration of a first dose of antibodies or fragments thereof which immunospecifically bind to a RSV antigen and without administration of any other doses of said antibodies or fragments thereof. In a specific embodiment, a serum titer in a non-primate mammal of at least 40 10 jig/ml, preferably at least 80 jig/ml, at least 100 pg/rnl, at least 120 pg/ml, at least 150 jig/mil, at least 200 jig/ml, at least 250 pg/ml, or at least 300 jig/ml, of one or more antibodies or fragments thereof that immunospecifically bind to one or more RSV antigens is achieved at least 1 day after administering a dose of less than 2.5 mg/kg, preferably less than 1 mg/kg, or less than 0.5 mg/kg of the antibodies or antibody fragments to the non 15 primate manunal. In another embodiment, a serum titer in a non-primate mammal of at least 150 jig/ml, preferably at least 200 jig/ml, at least 250 jig/ml, at least 300 jig/ml, at least 350 jig/ml, or at least 400 pg/ml of one or more antibodies or fragments thereof that immunospecifically bind to one or more RSV antigens is achieved at least I day after administering a dose of approximately 5 mg/kg of the antibodies or antibody fragments to 20 the non-primate mammal. In another embodiment, a serum titer in a primate of at least 40 jig/ml, preferably at least 80 jig/ml, at least 100 jig/ml, at least 120 jig/ml, at least 150 jig/ml, at least 200 jig/ml, at least 250 jig/ml, or at least 300 jig/mI of one or more antibodies or fragments thereof that immunospecifically bind to one or more RSV antigens is achieved at least 30 days after 25 administering a first dose of less than 5 mg/kg, preferably less than 3 mg/kg, less than 1 mg/kg, or less than 0.5 mg/kg of the antibodies or fragments thereof to the primate. In yet another enibodiment, a serum fiter in a primate 01 afleast 200 pg/nil, atleast*250 pg/nil, at least 300 jig/mil, at least 350 pg/mil, or at least 400 pg/ml of one or more antibodies or fragments thereof that immunospecifically bind to one or more RSV antigens is achieved at 30 least 30 days after administering a first dose of approximately 15 mg/kg of the antibodies or fragments thereof to the primate. In accordance with these embodiments, the primate is preferably a human. The present invention provides methods for preventing, treating, or ameliorating one or more symptoms associated with a RSV infection in a mammal, preferably a human, 35 said methods comprising administering a first dose to said mammal of a prophylactically or - 35 therapeutically effective amount of one or more antibodies or fragments thereof that immunospecifically bind to one or more RSV antigens, wherein said effective amount is less than 15 mg/kg of said antibodies or fragments thereof and which results in a serum titer of greater than 40 pg/ml 30 days after the first administration and prior to any subsequent 5 administration. In one embodiment, RSV infection in a human subject is prevented or treated, or one or more symptoms associated with RSV infection is ameliorated by administering a first dose of less than 10 mg/kg, preferably less than 5 mg/kg, less than 3 mg/kg, or less than 1 mg/kg of one or more antibodies or fragments thereof that immunospecifically bind to one or more RSV antigens so that a serun antibody titer of at 10 least 40 ig/ml, preferably at least 80 pg/ml, or at least 120 pg/ml, at least 150 pig/ml, at least 200 pg/mil, at least 250 pg/ml, or at least 300 jig/inl is achieved 30 days after the administration of the first dose of the antibodies or antibody fragments and prior to the administration of a subsequent dose. In another embodiment, RSV infection in a human subject is prevented or treated, or one or more symptoms associated with a RSV infection is 15 ameliorated by administering a first dose of approximately 15 mg/kg of one or more antibodies or fragments thereof that immunospecifically bind to one or more RSV antigens so that a serun antibody titer of at least 75 pg/ml, preferably at least 100 pg/ml, at least 200 pg/mi, at least 250 ig/mI, at least 300 pg/ml, at least 350 pg/ml, or at least 400 pg/ml is achieved 30 days after the administration of the first dose of the antibodies or antibody 20 fragments and prior to the administration of a subsequent dose. In yet another embodiment, RSV infection in a human subject is prevented or treated, or one or more symptoms associated with a RSV infection is ameliorated by administering a first dose of one or more antibodies or fragments thereof that immunospecifically bind to one or more RSV antigens such that a prophylactically or therapeutically effective serum titer of less than 10 pg/ml, 25 preferably less than 5 pg/ml, less than 3 pg/ml, less than 1 pg/ml, or less than 0.5 pg/ml is achieved no more than 30 days after administering the antibodies or antibody fragments. In accordance with this embodiment, the first dose of one or more antibodies or fragments thereof is less than 10 mg/kg, preferably less than 5 mg/kg, less than 1 mg/kg, or less than 0.5 mg/kg. 30 The present invention provides antibodies or fragments thereof which imnmunospecifically bind to a RSV antigen with an affinity constant of at least 2 X 10' M-, at least 2.5 X 10' M', at least 5 X 10' M', at least 10' M', at least 5 X 10' M', at least 10" M', at least 5 X 10' M4', at least 10" M', at least 5 X 10" M, at least 10" M', at least 5 X 10' 2 M', at least 10" M', at least 5 X 10" M', at least 10" M', at least 5 X 10" M', at 35 least 10" M', or at least 5 X 10" M'. Preferably, the antibodies or antibody fragments have -36a higher affinity for a RSV antigen than SYNAGIS@ does for the RSV F glycoprotein. The present invention also provides pharmaceutical compositions comprising one or more antibodies which immunospecifically bind to a RSV antigen with an affinity constant of at least 2 X 10' M', at least 2.5 X 108 M-, at least 5 X 10' M-', at least 109 M-, at least 5 X 109 5 M', at least 10'0 M', at least 5 X 10'0 M', at least 10" M', at least 5 X 10" M', at least 10" M', at least 5 X 10" M', at least 10" M', at least 5 X 10" M', at least 10" M', at least 5 X 10 " M', at least 10 " M', or at least 5 X 10M" M. The present invention also provides antibodies or fragments thereof which immunospecifically bind to a RSV antigen with a higher avidity than any previously known 10 antibodies or fragments thereof. Preferably, the antibodies or antibody fragments have higher avidity for a RSV antigen than SYNAGIS@ has for the RSV F glycoprotein. The present invention also provides antibodies or fragments thereof that immunospecifically bind to a RSV antigen which have a higher affinity for a RSV antigen than any previously known antibodies or fragments thereof. The present invention also provides pharmaceutical 15 compositions comprising one or more antibodies or fragments thereof which immunospecifically bind to a RSV antigen with a higher avidity than any previously known antibodies or fragments thereof. The present invention also provides for antibodies or fragments thereof which immunospecifically bind to one or more RSV antigens with an affinity constant of at least 2 20 X 108 M-', at least 2.5 X 10' M', at least 5 X 108 M-1, at least 109 M', at least 5 X 10' M-', at least 10'" M-', at least 5 X 101" M', at least 10" M', at least 5 X 10'" M', at least 10" M-, at least 5 X 1012 M, at least 10" M', at least 5 X 10" M-', at least 10" M-', at least 5 X 10" M-', at least 10" M-', or at least 5 X 10 " M and which have a higher avidity for one or more RSV antigens than any previously known antibodies or fragments thereof such as, e.g., 25 SYNAGIS@. The present invention further provides pharmaceutical compositions corprisig o2ne orrntre-atitifbtidies oriragmenxts~theref 'fiiuri'nunospe~ificili'y"65id 'to one or more'RS' antigens vih an allinhy cntantif t east2 , latest' O" M, at least 5 X 108 M', at least 10' M-', at least 5 X 10' M', at least 1010 1\4', at least 5 X 10 M-1, at least 10" MW, at least 5 X 10" M', at least 10" MW, at least 5 X 10" M', at 30 least 10" M', at least 5 X 10'" M', at least 10" M', at least 5 X 10" M', at least 10" M', or at least 5 X 10"5 M' and which have a higher avidity for one or more RSV antigens than any previously known antibodies or fragments thereof such as, e.g., SYNAGIS@. The present invention provides methods of achieving a certain serum titer (preferably a serum titer 1 jig/ml or less, 2 jig/ml or less, 5 jig/ml or less, 6 ig/mI or less, 10 35 ig/ml or less, 15 pg/nl or less, 20 ig/n-l or less, or 25 pig/ml or less) of antibodies or - 37 fragments thereof that immunospecifically bind to one or more RSV antigens in a mammal, said methods comprising administering to said mammal one or more antibodies or fragments thereof that have an affinity constant of at least 2 X 10' M', at least 2.5 X 108 M ,at least 5 X 10' M', at least 10' M', at least 5 X 10' M', at least 10'0 M', at least 5 X 1010 5 M", at least 10" M', at least 5 X 10" M", at least 1012 M-, at least 5 X 1012 M', at least 1013 M-, at least 5 X 10" M', at least 10" M', at least 5 X 10" M', at least 10" M-', or at least 5 X 10" M' for said RSV antigens. Preferably, the antibodies or antibody fragments have a higher affinity for a RSV antigen than SYNAGIS@ does for the RSV F glycoprotein. The present invention also provides methods of achieving a certain serum titer of 10 antibodies or fragments thereof that immunospecifically bind to one or more RSV antigens in a mammal, said methods comprising administering to said manmnal one or more antibodies or fragments thereof that have a higher avidity for said RSV antigens than any previously known antibodies or antibody fragments. Preferably, the antibodies or antibody fragments have higher avidity for a RSV antigen than SYNAGIS@ has for the RSV F 15 glycoprotein. The present invention also provides methods of achieving a certain serum titer of antibodies or fragments thereof that immunospecifically bind to one or more RSV antigens in mammal, said methods comprising administering to said mammal one or more antibodies or fragments thereof that have an affinity constant of at least 2 X 108 M-', at least 2.5 X 108 20 M', at least 5 X 10' M', at least 10' M-', at least 5 X 10' M', at least 10' M, at least 5 X 10'0 M', at least 10" M', at least 5 X 10" M, at least 1012 M", at least 5 X 1012 M4, at least 10"3 M4, at least 5 X 10" M', at least 10" M4, at least 5 X 10" M', at least 10" MW, or at least 5 X 10" M" for one or more RSV antigens and have a higher avidity than any previously known antibodies or antibody fragments for said RSV antigens. 25 The present invention also provides methods of neutralizing RSV using antibodies orragments t'hereofthat imun pecfio on-j-nrfore'RSV -antigens'ardidwhiCh 'imve an afnnhfy constant or'arleas'2 Y&0 M4, ateast2:5 X P 'I M', a'eal5 'X WM at least 10' M', at least 5 X 10' M, at least 10'" M', at least 5 X 1010 M', at least 10" M', at least 5 X 10" M-', at least 1012 M', at least 5 X 1012 M', at least 10 " M', at least 5 X 10" 30 M-', at least 10' M', at least 5 X 10" M-, at least 10" M-, or at least 5 X 10" M4 for said RSV antigens. Preferably, the antibodies or antibody fragments have a higher affinity for a RSV antigen than SYNAGIS@ does for the RSV F glycoprotein. The present invention also provides methods of neutralizing RSV using antibodies or fragments thereof that immunospecifically bind to one or more RSV antigens and which have a higher avidity for 35 said RSV antigens than any previously known antibodies or antibody fragments. Preferably, -38 the antibodies or antibody fragments have a higher avidity for a RSV antigen than SYNAGIS@ does for the RSV F glycoprotein. The present invention also provides methods of neutralizing RSV using antibodies or fragments thereof that immunospecifically bind to one or more RSV antigens with an affinity constant of at least 2 X 108 M, at least 2.5 X 10' 5 M', at least 5 X 108 M, at least 10' M, at least 5 X 109 M, at least 10'* M 1 , at least 5 X 10'0 M', at least 10" M', at least 5 X 10" M', at least 1012 M, at least 5 X 1012 M', at least 10" M-, at least 5 X 10" M4, at least 10" M4, at least 5 X 10" M", at least 10" M4, or at least S X 10" M4 and which have a higher avidity for said RSV antigens than any previously known antibodies or antibody fragments. The higher affinity and/or higher 10 avidity that these antibodies or antibody fragments have for a RSV antigen results in a lower concentration of these antibodies or antibody fragments necessary to achieve neutralization of RSV than previously known. The present invention also provides methods for preventing, treating or ameliorating one or more symptoms of RSV infection in a mammal, said methods comprising 15 administering to said mammal one or more antibodies or fragments thereof that immunospecifically bind to one or more RSV antigens and which have an affinity constant of at least 2 X 10 M4', at least 2.5 X 10' M4, at least 5 X 10' M4, at least 10' M', at least 5 X 109 M, at least 101* M, at least 5 X 10'* M, at least 10" M, at least 5 X 10" M', at least 1012 M, at least 5 X 1012 M-1, at least 10" M, at least 5 X 10" M, at least 10" M, at 20 least 5 X 10"4 M-1, at least 10" M4, or at least 5 X 10" M' for said RSV antigens. Preferably, the antibodies or antibody fragments have a higher affinity for a RSV antigen than SYNAGIS@ does for the RSV F glycoprotein. The present invention also provides of methods preventing, treating or ameliorating one or more symptoms of RSV infection in a mammal, said methods comprising administering to said mammal one or more antibodies or 25 fragments thereof that immunospecifically bind to one or more RSV antigen and which have aliigher a4dity Tor ssid'RSV antigen fhan any previouly-known antibodies or anfibody 'fragments. Preftrdb'ly, the antibodies or anfibodyfragmen'tshave alifher avidity for a RSV antigen than SYNAGIS@ does for the RST F glycoprotein. The present invention further provides methods of preventing, treating or ameliorating one or more 30 symptoms of RSV infection in a mammal, said methods comprising administering to said mammal one or more antibodies or fragments thereof that immunospecifically bind to one or more RSV antigens with an affinity constant of at least 2 X 108 M4, at least 2.5 X 10 8

M

1, at least 5 X 108 M-, at least 10' M, at least 5 X 10' M, at least 10'* M', at least 5 X 10'* M', at least 10" M4, at least 5 X 10" M', at least 10" M-, at least 5 X 102 M, at least 35 10" M', at least 5 X 10"3 M-, at least 10" M, at least 5 X 1014 M, at least 10" M, or at -39least 5 X 10" M' for said RSV antigen and which have a higher avidi -r said RSV antigens than any previously known antibodies or antibody fragments. he higher affinity and/or higher avidity that these antibodies or antibody fragments have for a RSV antigen results in lower and/or less frequent doses of these antibodies or antibody fragments to 5 achieve a prophylactic or therapeutic effect in a mammal, preferably a human, than previously known. The present invention provides methods for preventing, treating, or ameliorating one or more symptoms associated with a RSV infection in a mammal, preferably a human, said methods comprising administering a first dose to said mammal of a prophylactically or 10 therapeutically effective amount of one or more antibodies or fragments thereof which immunospecifically bind to one or more RSV antigens with a higher avidity and/or affinity than previously known antibodies such as SYNAGIS@, wherein said effective amount is less than 15 mg/kg of said antibodies or fragments thereof and which results in a serum titer less than 30 pg/ml (which is preferably at least 2 pg/mil, more preferably at least 4 pg/mI, 15 and most preferably at least 6 pg/ml) 30 days after the first administration and prior to any subsequent administration. In one embodiment, RSV infection in a human subject is prevented or treated, or one or more symptoms in a human subject is ameliorated by administering a first dose of less than 10 mg/kg, preferably less than 5 mg/kg, less than 3 mg/kg, less than 1 mg/kg, or less than 0.5 mg/kg of one or more antibodies or fragments 20 thereof that immunospecifically bind to one or more RSV antigens with a higher avidity and/or affinity than previously known antibodies such as SYNAGIS@ so that a serum antibody titer of at least 6 pg/ml, preferably at least 10 pg/ml, at least 25 pg/ml, at least 30 pg/ml, at least 40 pg/ml at least 80 pg/ml, or at least 120 pg/ml, at least 150 ig/ml, at least 200 pg/ml, at least 250 pg/ml, or at least 300 pg/ml is achieved 30 days after the 25 administration of the first dose of the antibodies or antibody fragments and prior to the administration of a subsequent dose. The present invention provides antibodies or fragments thereof comprising a variable heavy ("VH") domain having an amino acid sequence of any VH domain listed in Table 2, and pharmaceutical compositions comprising said antibodies or antibody 30 fragments. The present invention also provides antibodies or fragments thereof comprising one or more VH CDRs having the amino acid sequence of one or more VH CDRs listed in Table 2 and/or Table 3, and pharmaceutical compositions comprising said antibodies or antibody fragments. The present invention also provides antibodies or fragments thereof comprising a variable light ("VL") domain having the amino acid sequence of any VL 35 domain listed in Table 2, and pharmaceutical compositions comprising said antibodies or - 40 antibody fragments. The present invention also provides antibodies or fragments thereof comprising one or more VL CDRs having the amino acid sequence of one or more VL CDRs listed in Table 2 and/or Table 3, and pharmaceutical compositions comprising said antibodies or antibody fragments. The present invention also provides antibodies or 5 fragments thereof comprising a VH domain having the amino acid sequence any VH domain listed in Table 2 and a VL domain having the amino acid sequence of any VL domain listed in Table 2, and pharmaceutical compositions comprising said antibodies or antibody fragments. The present invention provides antibodies or fragments thereof comprising one or more VH CDRs having the amino acid sequence one or more VH CDRs 10 listed in Table 2 and/or Table 3 and one or more VL CDRs having the amino acid sequence of one or more VL CDRs listed in Table 2 and/or Table 3. The present invention encompasses pharmaceutical compositions comprising said antibodies or antibody fragments. Preferably, said antibodies or antibody fragments immunospecifically bind to one or more RSV antigens. 15 The present invention encompasses methods for preventing, treating, neutralizing and ameliorating one or more symptoms using one or more antibodies comprising a variable heavy ("VH") domain having an amino acid sequence of any VH domain listed in Table 2. The present invention also encompasses methods for preventing, treating, neutralizing and ameliorating one or more symptoms using one or more antibodies comprising one or more 20 VH CDRs having the amino acid sequence of one or more VH CDRs listed in Table 2 and/or Table 3. The present invention also encompasses methods for preventing, treating, neutralizing and ameliorating one or more symptoms using one or more antibodies comprising a variable light ("VL") domain having the amino acid sequence of any VL domain listed in Table 2. The present invention also encompasses methods for preventing, 25 treating, neutralizing and ameliorating one or more symptoms using one or more antibodies -CDRs siste1i-a Tabk 2-ndAe Tak 3. T for preventing, treating, neutralizing and ameliorating one or more symptoms using one or more antibodies comprising a VH domain having the amino acid sequence any VH domain 30 listed in Table 2 and a VL domain having the amino acid sequence of any VL domain listed in Table 2. The present invention further encompasses methods for preventing, treating, neutralizing and ameliorating one or more symptoms using one or more antibodies comprising one or more VH CDRs having the amino acid sequence one or more VH CDRs listed in Table 2 and/or Table 3 and one or more VL CDRs having the amino acid sequence 35 -41 of one or more VL CDRs listed in Table 2 and/or Table 3. Preferably, said antibodies or antibody fragments immunospecifically bind to one or more RSV antigens. The present invention encompasses antibodies or fragments thereof that immunospecifically bind to one or more RSV antigens with increased in vivo half-lives. In 5 particular, the present invention encompasses HL-SYNAGIS and antigen-binding fragments thereof. The present invention also encompasses novel antibodies or fragments thereof described herein which immunospecifically bind to one or more RSV antigens and have an Fc domain with a higher affinity for the FcRn receptor than the Fc domain of SYNAGIS@. The present invention also encompasses methods for the prevention, neutralization, 10 treatment or amelioration of one or more symptoms associated with a RSV infection using antibodies or fragments thereof that inununospecifically bind to one or more RSV antigens with increased in vivo half-lives. In particular, the invention encompasses methods for the prevention, neutralization, treatment or amelioration of one or more symptoms associated with a RSV infection using HL-SYNAGIS or an antigen-binding fragment thereof The 15 invention also encompasses methods for the prevention, neutralization, treatment or amelioration of one or more symptoms associated with a RSV infection using novel antibodies or fragments thereof described herein which immunospecifically bind to one or more RSV antigens and have an Fc domain with a higher affinity for the FcRn receptor than the Fe domain of SYNAGIS@. 20 The present invention provides sustained release formulations of antibodies or fragments thereof that immunospecifically bind to one or more RSV antigens for the prevention, neutralization, treatment or amelioration of one or more symptoms associated with a RSV infection. In particular, the present invention provides sustained release formulations of SYNAGIS@ or fragments thereof for the prevention, neutralization, 25 treatment or amelioration of one or more symptoms associated with a RSV infection. The present'invenfion Aiso provides sustained release formdiaf ions 6f one or more nov6I antibodies or fragments fhereof desciibed heroin vAiidh'immunospecificifly"bina to one or more RSV antigens for the prevention, neutralization, treatment or amelioration of one or more symptoms associated with a RSV infection. 30 The present invention also provides methods of administering compositions comprising antibodies or fragments thereof which immunospecifically bind to one or more RSV antigens to the site of a RSV infection in a subject. In particular, the present invention provides compositions comprising one or more antibodies or fragments thereof for pulmonary delivery to a subject. 35 - 42 - The present invention provides compositions comprising one or more antibodies or fragments thereof that immunospecifically bind to one or more RSV antigens, and methods for detecting or diagnosing a RSV infection utilizing said antibodies or antibody fragments. 5 5.1. Antibodies It should be recognized that antibodies that immunospecifically bind to a RSV antigen are known in the art. For example, SYNAGIS@ is a humanized monoclonal antibody presently used for the prevention of RSV infection in pediatric patients. The present invention encompasses novel formulations for administration of SYNAGIS@ and 10 other known anti-RSV antibodies and novel doses of SYNAGIS@ and other known anti RSV antibodies, as discussed herein. In addition, the invention encompasses novel antibodies, fragments and other biological or macromolecules which immunospecifically bind to one or more RSV antigens. With respect to these novel agents, the invention further encompasses novel modes of 15 administration, doses, dosing and uses based, in part, upon their unique therapeutic profiles and potency. Set forth below, is a more detailed description of the antibodies encompassed within the various aspects of the invention. The present invention provides antibodies or fragments thereof that 20 immunospecifically bind to one or more RSV antigens. The present invention provides antibodies or fragments thereof that immunospecifically bind to one or more RSV antigens. Preferably, the antibodies of the invention or fragments thereof innunospecifically bind to one or more RSV antigens regardless of the strain of RSV. The present invention also provides antibodies or fragments thereof that differentially or preferentially bind to RSV 25 antigens from one strain of RSV versus another RSV strain. In a specific embodiment, the antibodies of the invention or fragments thereof immunospecifically'bind to the'RSV'F glycoprotein, G glycoprotein or SH protein. *In a preferred enibodiment, the antibodies present invention or fragments thereof immunospecifically bind to the RSV F glycoprotein. In another preferred embodiment, the antibodies of the present invention or fragments 30 thereof bind to the A, B, or C antigenic sites of the RSV F glycoprotein. Antibodies of the invention include, but are not limited to, monoclonal antibodies, multispecific antibodies, human antibodies, humanized antibodies, chimeric antibodies, single-chain Fvs (scFv), single chain antibodies, Fab fragments, F(ab') fragments, disulfide linked Fvs (sdFv), and anti-idiotypic (anti-Id) antibodies (including, e.g., anti-Id antibodies 35 to antibodies of the invention), and epitope-binding fragments of any of the above. In - 43 particular, antibodies of the present invention include immunoglobulin molecules and immunologically active portions of immunoglobulin molecules, i.e., molecules that contain an antigen binding site that immunospecifically binds to a RSV antigen. The immunoglobulin molecules of the invention can be of any type (e.g., IgG, IgE, IgM, IgD, 5 IgA and IgY), class (e.g., IgGj, IgG 2 , IgG 3 , IgG 4 , IgA, and IgA 2 ) or subclass of immunoglobulin molecule. The antibodies of the invention may be from any animal origin including birds and mammals (e.g., human, murine, donkey, sheep, rabbit, goat, guinea pig, camel, horse, or chicken). Preferably, the antibodies of the invention are human or humanized nionoclonal 10 antibodies. As used herein, "human" antibodies include antibodies having the amino acid sequence of a human immunoglobulin and include antibodies isolated from human immunoglobulin libraries or from mice that express antibodies from human genes. The antibodies of the present invention may be monospecific, bispecific, trispecific or of greater multispecificity. Multispecific antibodies may be specific for different 15 epitopes of a RSV polypeptide or may be specific for both a RSV polypeptide as well as for a heterologous epitope, such as a heterologous polypeptide or solid support material. See, e.g., PCT publications WO 93/17715, WO 92/08802, WO 91/00360, and WO 92/05793; Tutt, et al., J. Immunol. 147:60-69(1991); U.S. Patent Nos. 4,474,893, 4,714,681, 4,925,648, 5,573,920, and 5,601,819; and Kostelny et al., J. Immunol. 148:1547-1553 20 (1992). The present invention provides for antibodies or fragments thereof that exhibit a high potency in an assay described herein. High potency antibodies or fragments thereof can be produced by methods disclosed in copending U.S. patent application Serial Nos. 60/168,426 and 60/186,252 and methods described herein. For example, high potency 25 antibodies can be produced by genetically engineering appropriate antibody gene sequences ~ndsexpressin'g the-antibe'dysequiences-ir-asit-ble'hst "Pe-mfidoies-protcet~i carf'be screeotdeall~jjy uif bodies wt'n, e.g., ih'kvainenn a'l3Acore assay. The present invention provides for antibodies or fragments thereof that have a high binding affinity for one or more RSV antigens. In a specific embodiment, an antibody of 30 the present invention or fragment thereof has an association rate constant or k,, rate (antibody (Ab) + antigen (Ag) Ab -Ag)of at least I0'M's', at least 5 X I0 'M's', at least 10 6 M's', at least 5 X 10 6 M's', at least 10 M's', at least 5 X 107 M's', or at least 10 M s-. In a preferred embodiment, an antibody of the present invention or fragment thereof has a ko of at least 2 X 10 'M's", at least 5 X 10 'M's', at least 10 6 M-'s, at least 5 X 106 35 M-s 1 , at least 10' M's-, at least 5 X 107 M's 1 , or at least 10' M's'. - 44 - In another embodiment, an antibody of the present invention or fragment thereof has K~f a kff rate (antibody (Ab) + antigen (Ag)*Ab -Ag) of less than 10' s', less than 5 X 10 s ', less than 10 2 s", less than 5 X 10 s', less than 10' s', less than 5 X 10-34, less than 10 s', less than 5 X 104s-, less than 10 s', less than 5 X 10- s', less than 106s-', less than 5 5 X 10-'s-, less than 104 s-, less than 5 X 10~'s', less than 10-'s-, less than 5 X 10 s-', less than 10's', less than 5 X 10s', or less than 1010 s-. In a preferred embodiment, an antibody of the present invention or fragment thereof has a k." of less than 5 X 104 s-', less than 10' s-, less than 5 X 10' s', less than 10' s', less than 5 X 10' s-, less than 10-' s', less than 5 X 107s, less than 10-'s-, less than 5 X 104s', less than 10-9s1, less than 5 X 10-s', 10 or less than 10 0 s-. In another embodiment, an antibody of the present invention or fragment thereof has an affinity constant or K, (kon/korf) of at least 102 M', at least 5 X 102 M-, at least 10' M', at least 5 X 103 M', at least 10' M', at least 5 X 104 M-, at least 10 5 M', at least 5 X 105 M', at least 106 M', at least 5 X 106 M-, at least 10' M-', at least 5 X 107 M', at least 1 0 S M-', at 15 least 5 X 10' M', at least 10' M', at least 5 X 109 M, at least 1010 M', at least 5 X 10'0 M, at least 10" M', at least 5 X 10" M', at least 1012 M', at least 5 X 1012 M', at least 10" M , at least 5 X 10" M', at least 1014 M', at least 5 X 10" M', at least 10" M", or at least 5 X 10" M. In yet another embodiment, an antibody or fragment thereof has a dissociation constant or Kd (kor/k 0 ,) of less than 102 M, less than 5 X 10-2 M, less than 10- M, less than-5 20 X 10- M, less than 10' M, less than 5 X 10' M, less than 10-5 M, less than 5 X 10' M, less than 10- M, less than 5 X 10-' M, less than 10" M, less than 5 X 104 M, less than 10-' M, less than 5 X 10s M, less than 10' M, less than 5 X 10-9 M, less than 10'* M, less than 5 X 10" M, less than 10-" M, less than 5 X 10-" M, less than 10 M, less than 5 X 10-12 M, less than 10" M, less than 5 X 10-" M, less than 10-" M, less than 5 X 10-' M, less than 10 25 " M, or less than 5 X 10-" M. "The present'invei'ion proVides aritibodies orffragment theredithaf have a median effYecfive concGentrafron (EC5)d'es hn:' i;esa12 iiesat5i, less than 0.1 nM, less than 0.25 nM, less than 0.5 nM, less than 0.75 nM, less than I nM, less than 1.25 nM, less than 1.5 nM, less than 1.75 nM, or less than 2 nM, in an in vitro 30 microneutralization assay The median effective concentration is the concentration of antibody or antibody fragments that neutralizes 50% of the RSV in an in vitro microneutralization assay. In a preferred embodiment, antibody of the invention or fragment thereof has an EC 50 of less than 0.01 nM, less than 0.025 nM, less than 0.05 nM, less than 0.1 nM, less than 0.25 nM, less than 0.5 nM, less than 0.75 nM, less than I nM, 35 - 45 less than 1.25 nM, less than 1.5 nM, less than 1.75 nM, or less than 2 nM, in an in vitro microneutralization assay In a specific embodiment, an antibody of the present invention is SYNAGIS@ or an antibody-binding fragment thereof (e.g., one or more complementarity determining regions 5 (CDRs) of SYNAGIS@). The amino acid sequence of SYNAGIS@ is disclosed, e.g., in Johnson et al., 1997, J. Infectious Disease 176:1215-1224, and U.S. Patent No. 5,824,307, each of which is incorporated herein by reference in its entirety. In alternative embodiment, an antibody of the present invention or fragment thereof is not SYNAGIS@ or a fragment of SYNAGIS@, i.e., is not an antibody comprising a VH domain of SEQ ID NO:7 and/or a VL 10 domain of SEQ ID NO:8. The present invention provides for antibodies or fragments thereof that inununospecifically bind to one or more RSV antigens, said antibodies or antibody fragments comprising the amino acid sequence of SYNAGIS@ with one or more amino acid residue substitutions in the variable light (VL) domain and/or variable heavy (VH) domain 15 depicted in Figure 1. The present invention also provides for antibodies or fragments thereof that immunospecifically bind to one or more RSV antigens, said antibodies or antibody fragments comprising the amino acid sequence of SYNAGIS@ with one or more amino acid residue substitutions in one or more VL CDRs and/or one or more VH CDRs. In a specific embodiment, an antibody or fragment thereof comprises the amino acid 20 sequence of SYNAGIS@ with one or more amino acid residue substitutions of the amino acid residues indicated in bold face and underlining in Table 1. In accordance with this embodiment, the amino acid residue substitutions can be conservative or non-conservative. The antibody or antibody fragment generated by introducing substitutions in the VH domain, VH CDRs, VL domain and/or VL CDRs of SYNAGIS@ can be tested in vitro and 25 in vivo, for example, for its ability to bind to RSV F antigen, for its ability to neutralize RSV, orTbrits abilityto prevent, treat or amnEiorate one or more symptoms assodiate'd viith a'RSV'irifecthon. 30 35 -46- Table 1. CDR Sequences Of SYNAGIS@ CDR Sequence SEQ ID NO: VH1 TSGMSVG 1 VH2 DIWWDDKKDYNPSLKS 2 5 VH3 SMITNWYFDV 3 VL1 KCQLSVGYMH 4 VL2 DTSKLAS 5 VL3 FQGSGYPFT 6 10 Bold faced & underlined amino acid residues are preferred residues which should be substituted. In a specific embodiment, an antibody of the present invention is SYNAGIS@, AFFF, Pfl2, P12f4, P1l d4, Ale9, A12a6, A13c4, A17d4, A4B4, A8c7, 1X-493LIFR, H3 3F4, M3H9, Y10H6, DG, AFFF(1), 6H8, L1-7E5, L2-15B10, Al3aI 1, Alh5, A4B4(1), 15 A4B4L1FR-S28R, or A4B4-F52S. Preferably, an antibody of the present invention is AFFF, Pfl2, P12f4, P1 1d4, Ale9, A12a6, A13c4, A17d4, A4B4, Ac7, 1X-493L1FR, H3 3F4, M31-19, Y10H6, DG, AFFF(1), 6H8, L1-7E5, L2-15B10, A13al1, Alh5, A4B4(l), A4B4LIFR-S28R, or A4B4-F52S. In another embodiment, an antibody is a Fab fragment of SYNAGIS@, AFFF, Pfl2, P12f4, P1 1d4, Ae9, A12a6, A13c4, A17d4, A4B4, A8c7, 20 A4B4(1), A4B4L1FR-S28R, or A4B4-F52S. AFFF, Pfl2, P12f4, P1 1d4, Ale9, A12a6, A13c4, A17d4, A8C7, lX-493L1FR, H3 3F4, M3H9, Y10H6, DG, AFFF(1), 6H8, LI-7E5, L2-15B10, A13al 1, and Alh5 comprise the framework region and constant regions of SYNAGIS@. A4B4, A4B4(1), A4B4L1FR S28R, and A4B4-F52S comprise the framework region and constant regions of SYNAGIS* with the 25 exception that there is a valine at position 103, numbered as shown in Figure 2A, and a glutamine at position 112, numbered as shown in Figure 2B. In certain embodiments, A4B4, A4B4(l), A4B4L IFR S28R, and A4B4-F52S comprise the framework region and constant regions of SYNAGIS*. In another embodiment, the present invention provides for an antigen-binding fragment of AFFF, Pfl2. P12f4, P1 1d4, Ale9. A12a6, A13c4, A17d4, A4B4, A8c7, IX 30 493L1FR, H3-3F4, M3H9, Y10H6, DG, AFFF(1), 6H8, LI-7E5, L2-15B10, A13al l, Alh5, A4B4(1), A4B4LIFR-S28R, or A4B4-F52S. In another embodiment, the present invention provides for one or more antibodies or fragments thereof that immunospecifically bind to one or more RSV antigens, said antibodies or antibody fragments comprising a VH chain and/or V L chain having the amino acid sequence of a VH chain and/or VL chain of AFFF, Pfl2, P12f4, P11d4, Ale9, A12a6, A13c4, AI7d4, A4B4, A8c7, IX-493L1FR, H3-3F4, M3H9, Y10H6, DG, AFFF(1), 6H8, L1-7E5, L2-15B10, A13al 1, Alh5, A4B4(1), - 47 - A4B4LIFR-S28R, or A4B4-F52S. In another embodiment, the present invention provides for one or more antibodies or fragments thereof that immunospecifically bind to one or more RSV antigens, said anubodies or antibody fragments comprising a VH domain and/or VL domain having the amino acid sequence of a VH domain and/or VL domain of AFFF, 5 Pfl2, P12f4, PI 1d4, Ale9, Al2a6, A13c4, A17d4, A4B4, A8c7, IX-493LIFR, H3-3F4, M3H9, Y101-16, DG, AFFF(l), 6H8, L1-7E5, L2-15B10, A13al 1, Alh5, A4B4(1), A4B4L]FR-S28R, or A4B4-F52S. In another embodiment, the present invention provides for antibodies or fragments thereof that immunospecifically bind to one or more RSV antigens, said antibodies or antibody fragments comprising one or more CDRs having the 10 amino acid sequence of one or more CDRs of AFFF, Pfl2, P12f4, P1 d4, Ale9, A12a6, A13c4, A17d4, A4B4, A8c7, IX-493LIFR, H3-3F4, M3H9, YlOH6, DG, AFFF(1), 6H8, LI-7E5, L2-15B10, Al3al 1, Alh5, A4B4(l), A4B4LIFR-S28R, or A4B4-F52S. In yet another embodiment, the present invention provides for one or more antibodies or fragments thereof that immunospecifically bind to one or more RSV antigens, said 15 antibodies or antibody fragments comprising a combination of VH CDRs and/or VL CDRs having the amino acid sequence of VH CDRs and/or VL CDRs of AFFF, Pfl2, P12f4, P1 1d4, Ale9, A12a6, Al3c4, Al 7d4, A4B4, A8c7, I X-493L1FR, H3-3F4, M3H9, YlO16, DG, AFFF(l), 6H8, L1-7E5, L2-15B10, Al3al 1, Alh5, A4B4(1), A4B4LlFR-S28R, and/or A4B4-F52S. 20 The present invention provides antibodies or fragments thereof that immunospecifically bind to one or more RSV antigens, said antibodies or antibody fragments comprising a variable heavy ("VH") chain having an amino acid sequence of any one of the VL domains listed in Table 2. The present invention also provides antibodies or fragments thereof that immunospecifically bind to one or more RSV antig said 25 antibodies or antibody fragments comprising a VH domain having an amin cid sequence an antibody or fragment thereof comprising aVH domain'having an anino a'id of any of one of the VH1 domains listed in Table 2 is not SYNAGIS@. The present invention also provides antibodies or fragments thereof that inmunospecifically bind to one or more RSV 30 antigens, said antibodies or fragments comprising a VH complementarity determining region ("CDR") having an amino acid sequence of any one of the VH CDRs listed in Table 2 and/or Table 3. In certain embodiments of the invention, an antibody or fragment thereof comprising a VH CDR having an amino acid of any of one of the VH CDRs listed in Table 2 and/or Table 3 is not SYNAGIS@. 35 -48z z zz :z ~z u ~~ ~ ~ Q 0 ) m a2 )a 0 r ) c) ) < )C) Ul) V) -u (-:y -u -U- I;"nzy Q) 7-'0' 0 > Z Z 0Z 0 z U)~ >C > >z >z > > (3 ci<I V Lo V)VI"jV V) 00n _) 0.. V) V) t V) cU) U)) Go z V) I) * >.= w en > ~ E ~ > 0CY C 0,6 0Y ( wW Z V) V C)I ~ C C" WU. Z (S wZ WZ;' -Z 7 >) C/) C) 'n 0 w o -) a V) 0 0 ' GO 0 0) U Z 0) 0~ >o)C c'U V) 0 Cco 0* 7- __ __ __ __ _ __ _ __ __ ___ 0 0 0 0 0I z z HCI Z -r E~ -Z HZ V) C/) V) U) V 0'6 -I In Cy6 C'6 cr6 (De *:! O'5 LL)~ 0 wow 0 0 .0 I C)~ 0 00 -0 -c : 0z 0 ce ~ > 2 > C~ ) -q 'oCNc>0 a 0 , y00y0( 0 0r 0rc o' 0 06 06 7- i: z z ,z ~ z U - ) g-l C/ ClC a- Co Li-. LI-.: 0 C q~j% * * * * G, ftI *Y C,~ *4 z z z :z P. 0 0Q 02 0 C 0O~ C,0 0c () 0c cc 0 0' 0 (y EnV U.~ V) w C cw CV Ol ( V)~.~ LLLV E wd o t 0 ' ) CdTw) C d) o d F- OZ (JZ -V- 0Z QZ V)z V) -) >O -> >O ( V)~ o' V)z V)2 zL 0 C) C4~ 0 z C)Nl 00C 0c ;ZO W.. 7 cy F(y 6 E6 y6 y C) C)C 0, C C ) C,4) , 9o 0 9 a ~ a co Cxl cy E' 'o c6 ' 0 cx0V co 0 c .

0 ~ Co 2 )6 ) i C A. ~ A. . C - Z-C .a w w - LO A rn */ 0 Ol w 0 C/) 0 a~ .0 z0 0) z > ~I. 0 < 0 0) 00 . 0 2 CCl woc (Y 0 z ~z c3C13 'c-Cl) C '4 4)~ <"'b cc * U-. j 0. CO 0 % >d C/) Cd) Lo) Cd(C) 0 Cdo C/)V) E ) c" ) '< o . A0 0 c )Io01( e 4 V) (n.- -. 91 2 ./2 Cd c., 9 .R d 2 3el O) d (Y a -0 , 4o .0 Cd 0 >0 0 0 0oo cl CdZ 0 Z 0 0 0 ( -Cr) w 4) >. z > >C > > > 00C4 00 l ~ V) V ) 2-0C) ) C) )U or Co '- .4 ,) <- , 0 6 <16 = 9Z al0 C0 Cd)h GOo QI 0

QJ

V) V) C/) c z z z z Z Ol C t CyF- o' o' ' 7:A R 2 '0 0' 0 C CY ~ ~ -S o,1 , y CY Nc /)V )- CA ' 0 '0 0 0 N 1:4 ,. C, C ) R, ri) p Cl) U) C w c c) C -'V toII 00 z~ oa ~ Cf V))~ ~ Ch A - ' 5,, 10 1 0 QO 0 0 0 0 0 0 >z~ 090 C C) (N Al 0 0 0 0 z .1 (D; z CI (Y O , Y O In one embodiment of the present invention, antibodies or fragments thereof comprise a VH CDR1 having the amino acid sequence of SEQ ID NO:1, SEQ ID NO:10 or SEQ ID NO:18. In another embodiment, antibodies or fragments thereof comprise a VH CDR2 having the amino acid sequence of SEQ ID NO:2, SEQ ID NO: 19, SEQ ID NO:25, 5 SEQ ID NO:37, SEQ ID NO:41 or SEQ ID NO:45. In another embodiment, antibodies comprise a VH CDR3 having the amino acid sequence of SEQ ID NO:3, SEQ ID NO:12, SEQ ID NO:20, SEQ ID NO:29 or SEQ ID NO:79. In a preferred embodiment, antibodies or fragments thereof comprise a VH CDRI having the anino acid sequence of SEQ ID NO:1, SEQ ID NO: 10 or SEQ ID NO: 18, a VH CDR2 having the amino acid sequence of 10 SEQ ID NO:2, SEQ ID NO:19, SEQ ID NO:25, SEQ ID NO:37 or SEQ ID NO:41. SEQ ID NO:45, and a VH CDR3 having the amino acid sequence of SEQ ID NO:3, SEQ ID NO:12, SEQ ID NO:20, SEQ ID NO:29 or SEQ ID NO:79. The present invention also provides antibodies or fragments thereof that immunospecifically bind to one or more RSV antigens, said antibodies or antibody 15 fragments comprising a variable light ("VL") domain having an amino acid sequence of any one of the VL domains listed in Table 2. The present invention also provides antibodies or fragments thereof that inmunospecifically bind to one or more RSV antigens, said antibodies or fragments comprising a VL CDR having an amino acid sequence of any one of the VL CDRs listed in Table 2 and/or Table 3. 20 In one embodiment of the present invention, antibodies or fragments thereof comprise a VL CDRI having the amino acid sequence of SEQ ID NO:4, SEQ ID NO:14, SEQ ID NO:22, SEQ ID NO:3 1, SEQ ID NO:39, or SEQ ID NO:47. In another embodiment, antibodies or fragments thereof comprise a VL CDR2 having the amino acid sequence of SEQ ID NO:5, SEQ ID NO: 15, SEQ ID NO:23, SEQ ID NO:27, SEQ ID 25 NO:32, SEQ ID NO:35, SEQ ID NO:43, SEQ ID NO:50, SEQ ID NO:53, SEQ ID NO:57, -SEQ ID NOd,"SQ'I'NO:63 SEQ1D-NO:66,SEQIDNO:59,SEQ'TD-N73, SEQ ID N TYPSr SEQ TD"NO:7). "In another eninodiment, antibodies or Tragments thereof comprise a VL CDR3 having the amino acid sequence of SEQ ID NO:6, SEQ ID NO:16 or SEQ ID NO:61. In a preferred embodiment, antibodies or fragments thereof comprise a VL 30 CDRI having the amino acid sequence of SEQ ID NO:4, SEQ ID NO:14, SEQ ID NO:22, SEQ ID NO:3 1, SEQ ID NO:39, or SEQ ID NO:47, a VL CDR2 having the amino acid sequence of SEQ ID NO:5, SEQ ID NO: 15, SEQ ID NO:23, SEQ ID NO:27, SEQ ID NO:32, SEQ ID NO:35, SEQ ID NO:43, SEQ ID NO:50, SEQ ID NO:53, SEQ ID NO:57, SEQ ID NO:59, SEQ ID NO:63, SEQ ID NO:66, SEQ ID NO:69, SEQ ID NO:73, SEQ ID 35 -60- NO:75 or SEQ ID NO:77, and a VL CDR3 having the amino acid sequence of SEQ ID NO:6, SEQ ID NO:16 or SEQ ID NO:61. The present invention also provides antibodies or fragments thereof that immunospecifically bind to one or more RSV antigens, said antibodies or antibody 5 fragments comprising a VH domain disclosed herein combined with a VL domain disclosed herein, or other VL domain. The present invention further provides antibodies or fragments thereof that immunospecifically bind to one or more RSV antigens, said antibodies or fragments comprising a VL domain disclosed herein combined with a VH domain disclosed herein, or other VH domain. In a preferred embodiment, antibodies or fragments thereof 10 that immunospecifically bind to a RSV antigen comprise a VH domain having the amino acid sequence of SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:17, SEQ ID NO:24, SEQ ID NO:2S, SEQ ID NO:33, SEQ ID NO:36, SEQ ID NO:40, SEQ ID NO:44, SEQ ID NO:48, SEQ ID NO:5 1, SEQ ID NO:55, SEQ ID NO:67 or SEQ ID NO:78 and a VL domain having the amino acid sequence of SEQ ID NO:8, SEQ ID NO:13, SEQ ID NO:21, SEQ ID 15 NO:26, SEQ ID NO:30, SEQ ID NO:34, SEQ ID NO:38, SEQ ID NO:42, SEQ ID NO:46, SEQ ID NO:49, SEQ ID NO:52, SEQ ID NO:54, SEQ ID NO:56, SEQ ID NO:58, SEQ ID NO:60, SEQ ID NO:62, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:68, SEQ ID NO:70, SEQ ID NO:7 1, SEQ ID NO:74 or SEQ ID NO:76. The present invention also provides antibodies or fragments thereof comprising one 20 or more VH CDRs and one or more VL CDRs listed in Table 2 and/or Table 3. In particular, the invention provides for an antibody or fragment thereof comprising a VH CDR1 and a VL CDRl, a VH CDR1 and a VL CDR2, a VH CDRI and a VL CDR3, a VH CDR2 and a VL CDR1, VIH CDR2 and VL CDR2, a VH CDR2 and a VL CDR3, a VH CDR3 and a VH CDRI, a VH CDR3 and a VL CDR2, a VH CDR3 and a VL CDR3, or any 25 combination thereof of the VH CDRs and VL CDRs listed in Table 2. The invention also p.rovides'6fr -an-anfib odiy -r fragmnthmtjf'c pagaRD'--and-a V IMMR', -a 'VPPCDRA arida'%PL CDR2, a'VH CDRI' -and a VLCDR3, -- a iCR-ard a VL C'lM, VH CDR2 and V'L CDR2, a VH CDR2 and a VL CDR3, a VH CDR3 and a VH CDR1, a VH CDR3 and a VL CDR2, a VH CDR3 and a VL CDR3, or any combination thereof of 30 the VH CDRs and VL CDRs listed in Table 3. The invention also provides for an antibody or fragment thereof comprising a VH CDRl and a VL CDRI, a VH CDR1 and a VL CDR2, a VH CDR1 and a VL CDR3, a VH CDR2 and a VL CDR1, VH CDR2 and VL CDR2, a VH CDR2 and a VL CDR3, a VH CDR3 and a VH CDR1, a VH.CDR3 and a VL CDR2, a VH CDR3 and a VL CDR3, or any combination thereof of the VH CDRs and VL CDRs 35 listed in Table 2 and Table 3. -61- In one embodiment, an antibody or fragment thereof comprises a VH CDRI having the amino acid sequence of SEQ ID NO:1, SEQ ID NO:10 or SEQ ID NO:18 and a VL CDRI having the amino acid sequence of SEQ ID NO:4, SEQ ID NO:14, SEQ ID NO:22, SEQ ID NO:31, SEQ ID NO:39, or SEQ ID NO:47. In another embodiment, an antibody of 5 the present invention or fragment thereof comprises a VH CDRI having the amino acid sequence of SEQ ID NO:1, SEQ ID NO:10 or SEQ ID NO:18 and a VL CDR2 having the amino acid sequence of SEQ ID NO:5, SEQ ID NO:15, SEQ ID NO:23, SEQ ID NO:27, SEQ ID NO:32, SEQ ID NO:35, SEQ ID NO:43, SEQ ID NO:50, SEQ ID NO:53, SEQ ID NO:57, SEQ ID NO:59, SEQ ID NO:63, SEQ ID NO:66, SEQ ID NO:69, SEQ ID NO:73, 10 SEQ ID NO:75, or SEQ ID NO:77. In another embodiment, an antibody of the present invention or fragment thereof comprises a VH CDR1 having the amino acid sequence of SEQ ID NO:1, SEQ ID NO:10 or SEQ ID NO:18 and a VL CDR3 having the amino acid sequence of SEQ ID NO:6, SEQ ID NO: 16 or SEQ ID NO:61. In another embodiment, an antibody of the present invention or fragment thereof 15 comprises a VI CDR2 having the amino acid sequence of SEQ ID NO:2, SEQ ID NO:19, SEQ ID NO:25, SEQ ID NO:37, SEQ ID NO:41 or SEQ ID NO:45 and a VL CDR1 having the amino acid sequence of SEQ ID NO:4, SEQ ID NO:14, SEQ ID NO:22, SEQ ID NO:31, SEQ ID NO:39 or SEQ ID NO:47. In another embodiment, an antibody of the present invention or fragment thereof comprises a VH CDR2 having the amino acid sequence of 20 SEQ ID NO:2, SEQ ID NO: 19, SEQ ID NO:25, SEQ ID NO:37, SEQ ID NO:41 or SEQ ID NO:45 and a VL CDR2 having the amino acid sequence of SEQ ID NO:5, SEQ ID NO:15, SEQ ID NO:23, SEQ ID NO:27, SEQ ID NO:32, SEQ ID NO:35, SEQ ID NO:43, SEQ ID NO:50, SEQ ID NO:53, SEQ ID NO:57, SEQ ID NO:59, SEQ ID NO:63, SEQ ID NO:66, SEQ ID NO:69, SEQ ID NO:73, SEQ ID NO:75, or SEQ ID NO:77. In another 25 embodiment, an antibody of the present invention or fragment thereof comprises a VH CDR2 haqrg thie anino.,acidaeguee.,SEQJD.NO,:2 SEQ.D .:9,SEQ I :4 SEQ M NG3 37, SEQ .I NO Av' -3 -BQ -M N01- :4- widP 3C havingthe mawiro-wei sequence of SEQ ID NO:6, SEQ ID NO:16, or SEQ ID NO:61. In another embodiment, an antibody of the present invention or fragment thereof 30 comprises a VH CDR3 having the amino acid sequence of SEQ ID NO:3, SEQ ID NO: 12, SEQ ID NO:20, SEQ ID NO:29 or SEQ ID NO:79 and a VL CDR1 having the amino acid sequence of SEQ ID NO:4, SEQ ID NO:14, SEQ ID NO:22, SEQ ID NO:31, SEQ ID NO:39 or SEQ ID NO:47. In another embodiment, an antibody of the present invention or fragment thereof comprises a VH CDR3 having the amino acid sequence of SEQ ID NO:3, 35 SEQ ID NO:12, SEQ ID NO:20, SEQ ID NO:29 or SEQ ID NO:79 and aVL CDR2 having - 62 the amino acid sequence of SEQ ID NO:5, SEQ ID NO:15, SEQ ID NO:23, SEQ ID NO:27, SEQ ID NO:32, SEQ ID NO:35, SEQ D NO:43, SEQ ID NO:50, SEQ ID NO:53, SEQ ID NO:57. SEQ ID NO:59, SEQ ID NO:63, SEQ ID NO:66., SEQ ID NO:69, SEQ ID NO:73, SEQ ID NO:75, or SEQ ID NO:77. In a preferred embodiment, an antibody of the present 5 invention or fragment thereof comprises a VH CDR3 having the amino acid sequence of SEQ ID NO:3, SEQ ID NO:12, SEQ ID NO:20, SEQ ID NO:29 or SEQ HD NO:79 and a VL CDR3 having the amino acid sequence of SEQ ID NO:6, SEQ ID NO: 16, or SEQ ID NO:61. The present invention also provides for nucleic acid molecules, generally 10 isolated, encoding an antibody of the invention or fragment thereof. In a specific embodiment, isolated nucleic acid molecules of the invention encode for SYNAGIS@, AFFF, Pfl2, PI2f4, PIId4, Ale9, Al2a6, Al3c4, A17d4, A4B4, A8C7, IX-493L1FR, H3 3F4, M3H9, YOH6, DG, AFFF(1), 6H8, LI-7E5, L2-lSB10, AI3al 1, Alh5, A4B4(1), A4B4LIFR-S28R, or A4B4-F52S. Preferably, isolated nucleic acid molecules of the 15 invention encode for AFFF, Pfl2, P12f4, P1 1d4, Ale9, A12a6, AI3c4, Al7d4, A4B4, A8C7, IX-493LIFR, H3-3F4, M3H9, YIOH6, DG, AFFF(l), 6H8, LI-7E5, L2-15BIO, A13al I, Alh5, A4B4(1), A4B4LIFR-S28R, or A4B4-F52S. In another embodiment, isolated nucleic acid molecules of the invention encode for an antigen-binding fragment of SYNAGIS@, AFFF, Pfl2, P12f4, P1 Id4, Ale9, Al2a6, A13c4, A17d4, A4B4, A8C7, IX 20 493L1FR, H3-3F4, M3H9, Y1OH6, DG, AFFF(l), 6H8, LI-7E5, L2-15B10, Al3all, Alh5, A4B4(l), A4B4LIFR-S28R, or A4B4-F52S. In another embodiment, an isolated nucleic acid molecule(s) of the invention encodes an antibody or fragment thereof comprising a VH domain having an amino acid sequence of anyone of the VH domains listed in Table 2. In another embodiment, an 25 isolated nucleic acid molecule(s) of the invention encodes an antibody or fragment thereof in lTadie 2 a'Mbie'3. An ancither eibodirriet, an-isorted-redieiacid mrdwlecnle(d) rifite invention encodes an antibody or fragment thereof comprising a VH CDR2 having an amino acid sequence of any one of the VH CDR2s listed in Table 2 or Table 3. In yet 30 another embodiment, an isolated nucleic acid molecule(s) of the invention encodes an antibody or fragment thereof comprising a VH CDR3 having an amino acid sequence of any one of the VH CDR3s listed in Table 2 or Table 3. In another embodiment, an isolated nucleic acid molecule(s) of the invention encodes an antibody or fragment thereof comprising a VL domain having an amino acid 35 sequence of any one of the VL domains listed in Table 2. In another embodiment, an - 63 isolated nucleic acid molecule(s) of the present invention encodes an antibody or fragment thereof comprising a VL CDR1 having amino acid sequence of any one of the VL CDR1s listed in Table 2 or Table 3. In another embodiment, an isolated nucleic acid molecule(s) of the present invention encodes an antibody or fragment thereof comprising a VL CDR2 5 having an amino acid sequence of any one of the VL CDR2s listed in Table 2 or Table 3. In yet another embodiment, an isolated nucleic acid molecule(s) of the present invention encodes an antibody or fragment thereof comprising a VL CDR3 having an amino acid sequence of any one of the VL CDR3s listed in Table 2 or Table 3. In another embodiment, a nucleic acid molecule(s) of the invention encodes an 10 antibody or fragment thereof comprising a VH domain having an amino acid sequence of any one of the VH domains listed in Table 2 and a VL domain having an amino acid sequence of any one of the VL domains listed in Table 2. In another embodiment, a nucleic acid molecule(s) of the invention encodes an antibody or fragment thereof comprising a VH CDR1, a VL CDR1, a VH CDR2, a VL CDR2, a VH CDR3, a VL CDR3, or any 15 combination thereof having an amino acid sequence listed in Table 2. In another embodiment, a nucleic acid molecule(s) of the invention encodes an antibody or fragment thereof comprising a VH CDFI, a VL CDRI, a VH CDR2, a VL CDR2, a VH CDR3, a VL CDR3, or any combination thereof having an amino acid sequence listed in Table 3. In another embodiment, a nucleic acid molecule(s) of the invention encodes an antibody or 20 fragment thereof comprising a VH CDRI, a VL CDR1, a VH CDR2, a VL CDR2, a VH CDR3, a VL CDR3, or any combination thereof having an amino acid sequence listed in Table 2 and Table 3. The present invention also provides antibodies or fragments thereof comprising derivatives of the VH domains, VH CDRs, VL domains, and VL CDRs described herein 25 that immunospecifically bind to an RSV antigen. The present invention also provides P1Id4, Ae9, A12a6, A13c4, AT7d4, A41B4, A8C7, 1X-493'11R,H3-3F4,'M3H9,YTOH6, DG, AFFF(1), 6H8, LI-7E5, L2-15B10, Al3al 1, Alh5, A4B4(1), A4B4LIFR-S28R, or A4B4-F52S, wherein said antibodies or fragments thereof immunospecifically bind to one 30 or more RSV antigens. Standard techniques known to those of skill in the art can be used to introduce mutations in the nucleotide sequence encoding a molecule of the invention, including, for example, site-directed mutagenesis and PCR-mediated mutagenesis which results in amino acid substitutions. Preferably, the derivatives include less than 25 amino acid substitutions, less than 20 amino acid substitutions, less than 15 amino acid 35 substitutions, less than 10 amino acid substitutions, less than 5 amino acid substitutions, -64less than 4 amino acid substitutions, less than 3 amino acid substitutions, or less than 2 amino acid substitutions relative to the original molecule. In a preferred embodiment, the derivatives have conservative amino acid substitutions are made at one or more predicted non-essential amino acid residues. A "conservative amino acid substitution" is one in which 5 the amino acid residue is replaced with an amino acid residue having a side chain with a similar charge. Families of amino acid residues having side chains with similar charges have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycirie, asparagine, glutamine, serine, threonine, tyrosine, 10 cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains ( e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Alternatively, mutations can be introduced randomly along all or part of the coding sequence, such as by saturation mutagenesis, and the resultant mutants can be screened for 15 biological activity to identify mutants that retain activity. Following mutagenesis, the encoded protein can be expressed and the activity of the protein can be determined. In a specific embodiment, an antibody or fragment thereof that imimunospecifically binds to a RSV antigen comprises a nucleotide sequence that hybridizes to the nucleotide sequence(s) encoding SYNAGIS@, AFFF, Pfl2, P12f4, P1 1d4, Ale9, A12a6, Al3c4, 20 Al7d4, A4B4, A8C7, 1X-493L1FR, H3-3F4, M3H9, Y10H6, DG, AFFF(1), 6118, L1-7E5, L2-15B10, A13al 1, AlhS, A4B4(1), A4B4L1FR-S28R, or A4B4-F52S under stringent conditions, e.g., hybridization to filter-bound DNA in 6x sodium chloride/sodium citrate (SSC) at about 45 *C followed by one or more washes in 0.2xSSC/0.1% SDS at about 50 65 * C, under highly stringent conditions, e.g., hybridization to filter-bound nucleic acid in 25 6xSSC at about 45 *C followed by one or more washes in 0.1xSSC/0.2% SDS at about 68'"C, orMer rsther stfngenf'hybiidizatiori con-ilionnviith reknownoThose 0Ts'117in the art (see, for example, Ausub&l,'F.M. et al., eds. ,1989,CurrentProtocols in Molecd~ar Biology, Vol. 1, Green Publishing Associates, Inc. and John Wiley & Sons, Inc., New York at pages 6.3.1-6.3.6 and 2.10.3). 30 In another embodiment, an antibody or fragment thereof that immunospecifically binds to a RSV antigen comprises an amino acid sequence that is at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to the amino acid sequence of SYNAGIS@, AFFF, Pfl2, P12f4, PIld4, Ale9, A12a6, A13c4, 35 - 65 - A17d4, A4B4, A8C7, 1X-493LIFR, H3-3F4, M3H9, YlOH6, DG, AFFF(1), 6H8, L1-7E5, L2-15B10, Al3al 1, AlhI, A4B4(1), A4B4LIFR-S28R, or A4B4-F52S. In a specific embodiment, an antibody or fragment thereof that immunospecifically binds to a RSV antigen comprises an amino acid sequence of a VH domain or an amino 5 acid sequence a VL domain encoded by a nucleotide sequence that hybridizes to the nucleotide sequence encoding any one of the VH or VL domains listed in Table 2 under stringent conditions, e.g., hybridization to filter-bound DNA in 6x sodium chloride/sodium citrate (SSC) at about 45 *C followed by one or more washes in 0.2xSSC/0.1% SDS at about 50-65 * C, under highly stringent conditions, e.g., hybridization to filter-bound nucleic 10 acid in 6xSSC at about 45 *C followed by one or more washes in 0.IxSSC/0.2% SDS at about 68 "C, or under other stringent hybridization conditions which are known to those of skill in the art (see, for example, Ausubel, F.M. et al., eds. , 1989, Current Protocols in Molecular Biology, Vol. I, Green Publishing Associates, Inc. and John Wiley & Sons, Inc., New York at pages 6.3.1-6.3.6 and 2.10.3). In another embodiment, an antibody or 15 fragment thereof that immunospecifically binds to a RSV antigen comprises an amino acid sequence of a VII CDR or an amino acid sequence of a VL CDRs encoded by a nucleotide sequence that hybridizes to the nucleotide sequence encoding any one of the VH CDRs or VL CDRs listed in Table 2 or Table 3 under stringent conditions e.g., hybridization to filter bound DNA in 6x sodium chloride/sodium citrate (SSC) at about 45 *C followed by one or 20 more washes in 0.2xSSC/0.1% SDS at about 50-65 * C, under highly stringent conditions, e.g., hybridization to filter-bound nucleic acid in 6xSSC at about 45 *C followed by one or more washes in 0.1xSSC/0.2% SDS at about 68 *C, or under other stringent hybridization conditions which are known to those of skill in the art. In yet another embodiment, an antibody or fragment thereof that immunospecifically binds to a RSV antigen comprises an 25 amino acid sequence of a VH CDR and an amino acid sequence of a VL CDR encoded by VHR CDs and"VL Ct)Rs, respectiv61y,'listed -in'T able'2 or*'I1*a1e"3 under stringent conditions, e.g., hybridization to filter-bound DNA in 6x sodium chloride/sodium citrate (SSC) at about 45 "C followed by one or more washes in 0.2xSSC/0.1% SDS at about 50 30 65 * C, under highly stringent conditions, e.g., hybridization to filter-bound nucleic acid in 6xSSC at about 45 *C followed by one or more washes in 0.1xSSC/0.2% SDS at about 68 "C, or under other stringent hybridization conditions which are known to those of skill in the art . In another embodiment, an antibody or fragment thereof that immunospecifically 35 binds to a RSV antigen comprises an amino acid sequence of a VH domain that is at least - 66 - 35%, at least 40%, at least 45%, at least 50%, at least 55%., at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to any one of the VH domains listed in Table 2. In another embodiment, an antibody or fragment thereof that immunospecifically binds to a RSV antigen comprises an 5 amino acid sequence of one or more VH CDRs that are at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to any of the VH CDRs listed in Table 2 or Table 3. In another embodiment, an antibody or fragment thereof that immunospecifically 10 binds to a RSV antigen comprises an amino acid sequence of a VL domain that is at least 35%., at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to any one of the VL domains listed in Table 2. In another embodiment, an antibody or fragment thereof that immunospecifically binds to a RSV antigen comprises an 15 amino acid sequence of one or more VL CDRs that are at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to any of the VL CDRs listed in Table 2 or Table 3. In another embodiment, an antibody or fragment thereof that inmunospecifically 20 binds to a RSV antigen comprises an amino acid sequence that is at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to an amino acid sequence of SYNAQIS@, AFFF, Pfl2, P12f4, P1 1d4, Ale9, A12a6, A13c4, A17d4, A4B4, A8C7, IX-493L1FR, H3-3F4, M3H9, Y1OH6, DG, AFFF(1), 6H8, L1-7E5, 25 L2-15B10, Al3al1, Alh5, A4B4(1), A4B4LIFR-S28R, orA4B4-F52S ' he present'invention also encompasses antibodies or fragments thereof that compete with an antibody or Fab fragment listed in Table 2 for binding to a RSV antigen. In particular, the present invention encompasses antibodies or fragments thereof that compete with SYNAGIS@ or an antigen-binding fragment thereof for binding to the RSV F 30 glycoprotein. The present invention also encompasses VL domains, VH domains, VL. CDRs, and VH CDRs that compete with a VL domain, VH domain, VL CDR, or VH CDR listed in Table 2 for binding to a RSV antigen. Further, the present invention encompasses VL CDRs and VL CDRs that compete with a VL CDR or VH CDR listed in Table 3 for binding to a RSV antigen. 35 - 67 - The antibodies of the invention include derivatives that are modified, i.e, by the covalent attachment of any type of molecule to the antibody such that covalent attachment. For example, but not by way of limitation, the antibody derivatives include antibodies that have been modified, e.g., by glycosylation, acetylation, pegylation, phosphorylation, 5 amidation, derivatization by known protecting/blocking groups, proteolytic cleavage, linkage to a cellular ligand or other protein, etc. Any of numerous chemical modifications may be carried out by known techniques, including, but not limited to specific chemical cleavage, acetylation, formylation, metabolic synthesis of tunicamycin, etc. Additionally, the derivative may contain one or more non-classical amino acids. 10 The present invention also provides antibodies of the invention or fragments thereof that comprise a framework region known to those of skill in the art. Preferably, the framework region of an antibody of the invention or fragment thereof is human. In a specific embodiment, an antibody of the invention or fragment thereof comprises the framework region of SYNAGIS@. 15 The present invention also provides antibodies of the invention or fragments thereof that comprise constant regions known to those of skill in the art. Preferably, the constant regions of an antibody of the invention or fragment thereof are human. In a specific embodiment, an antibody of the invention or fragment thereof comprises the constant regions of SYNAGIS@. 20 The present invention also provides for antibodies or fragments thereof that have half-lives in a mammal, preferably a human, of greater than 15 days, preferably greater than 20 days, greater than 25 days, greater than 30 days, greater than 35 days, greater than 40 days, greater than 45 days, greater than 2 months, greater than 3 months, greater than 4 months, or greater than 5 months. The increased half-lives of the antibodies of the present 25 invention or fragments thereof in a mammal, preferably a human, results in a higher serum titerufsstaatbcdit&or'awtiod~yfrgmaeri1nf'e mammdrtl;arandfhus;'reduces'thre 'frequency of ne aamiriistration of sai anfibodfies or antiboay"fragments ana;or re'uces fhe concentration of said antibodies or antibody fragments to be administered. Antibodies or fragments thereof having increased in vivo half-lives can be generated by techniques known 30 to those of skill in the art. For example, antibodies or fragments thereof with increased in vivo half-lives can be generated by modifying (e.g., substituting, deleting or adding) amino acid residues identified as involved in the interaction between the Fe domain and the FcRn receptor (see, e.g., PCT Publication No. WO 97/34631, which is incorporated herein by reference in its entirety). Such antibodies or fragments thereof can be tested for binding 35 -68activity to RSV antigens as well as for in vivo efficacy using methods known to those skilled in the art, for example, by immunoassays described herein. Further, antibodies or fragments thereof with increased in vivo half-lives can be generated by attaching to said antibodies or antibody fragments polymer molecules such as 5 high molecular weight polyethyleneglycol (PEG). PEG can be attached to said antibodies or antibody fragments with or without a multifunctional linker either through site-specific conjugation of the PEG to the N- or C- terminus of said antibodies or antibody fragments or via epsilon-amino groups present on lysine residues. Linear or branched polymer derivatization that results in minimal loss of biological activity will be used. The degree of 10 conjugation will be closely monitored by SDS-PAGE and mass spectrometry to ensure proper conjugation of PEG molecules to the antibodies. Unreacted PEG can be separated from antibody-PEG conjugates by, e.g., size exclusion or ion-exchange chromatography. PEG-derivatizated antibodies or fragments thereof can be tested for binding activity to RSV antigens as well as for in vivo efficacy using methods known to those skilled in the art, for 15 example, by immunoassays described herein. The present invention also encompasses antibodies or fragments thereof which immunospecifically bind to one or more RSV antigens, said antibodies or antibody fragments comprising the amino acid sequence of SYNAGIS@ with mutations (e.g., one or more amino acid substitutions) in the framework regions. In certain embodiments, 20 antibodies or fragments thereof which immunospecifically bind to one or more RSV antigens comprise the amino acid sequence of SYNAGIS@ with one or more amino acid residue substitutions in the framework regions of the VH and/or VL domains depicted in Figure 1. In a specific embodiment, antibodies or fragments thereof which immunospecifically bind to one or more RSV antigens comprise the framework regions 25 depicted in Figure 2. 'The present invention also encompasses antibodies of fragments fhere6f vilidh 'imiunospecicafcly bind to one or more RSV antigens, said antibodies orf-agments thereof comprising the amino acid sequence of SYNAGIS@ with mutations (e.g., one or more amino acid residue substitutions) in the variable and framework regions. 30 The present invention also provides for fusion proteins comprising an antibody or fragment thereof that immunospecifically binds to a RSV antigen and a heterologous polypeptide. Preferably, the heterologous polypeptide that the antibody or antibody fragment is fused to is useful for targeting the antibody to respiratory epithelial cells. The present invention also provides for panels of antibodies or fragments thereof 35 that immunospecifically bind to an RSV antigen. In specific embodiments, the invention - 69 provides for panels of antibodies or fragments thereof having different affinities for an RSV antigen, different specificities for an RSV antigen, or different dissociation rates. The invention provides panels of at least 10, preferably at least 25, at least 50, at least 75, at least 100, at least 125, at least 150, at least 175, at least 200, at least 250, at least 300, at least 5 350, at least 400, at least 450, at least 500, at least 550, at least 600, at least 650, at least 700, at least 750, at least 800, at least 850, at least 900, at least 950, or at least 1000 antibodies or fragments thereof. Panels of antibodies can be used, for example, in 96 well plates for assays such as ELISAs. The present invention further provides for compositions comprising one or more 10 antibodies of the invention or fragments thereof. In a specific embodiment, a composition of the present invention comprises SYNAGIS@, AFFF, Pfl2, P12f4, P1 Id4, Ale9, Al2a6, Al3c4, Al7d4, A4B4, A8C7, IX-493L1FR, H3-3F4, M3H9, YlOH6, DG, AFFF(1), 6H8, L1-7E5, L2-15B10, Al3al 1, Alh5, A4B4(1), A4B4LIFR-S28R, and/or A4B4-F52S. In another specific embodiment, a composition of the present invention comprises an antigen 15 binding fragment of SYNAGIS@, AFFF, Pfl2, P12f4, PI1 d4, Ale9, A12a6, A13c4, Al7d4, A4B4, A8C7, IX-493LIFR, H3-3F4, M3H9, YOH6, DG, AFFF(1), 61-18, LI-7E5, L2 15B10, A13al 1, Alh5, A4B4(1), A4B4LLFR-S28R, or A4B4-F528. In another embodiment, a composition of the present invention comprises one or more antibodies or fragments thereof comprising one or more VH domains having an amino 20 acid sequence of any one of the VH domains listed in Table 2. In another embodiment, a composition of the present invention comprises one or more antibodies or fragments thereof comprising one or more VH CDRLs having an amino acid sequence of any one of the VH CDRIs listed in Table 2 or Table 3. In another embodiment, a composition of the present invention comprises one or more antibodies or fragments thereof comprising one or more 25 VH CDR2s having an amino acid sequence of any one of the VH CDR2s listed in Table 2 ar T~a~ 3...apf d baata putm tepstm ti mpis amino acid sequence of any one of the VH CDR3s listed in Table 2 or Table 3. In another embodiment, a composition of the present invention comprises one or 30 more antibodies or fragments thereof comprising one or more VL domains having an amino acid sequence of any one of the VL domains listed in Table 2. In another embodiment, a composition of the present invention comprises one or more antibodies or fragments thereof comprising one or more VL CDRls having an amino acid sequence of any one of the VH CDRLs listed in Table 2 or Table 3. In another embodiment, a composition of the present 35 invention comprises one or more antibodies or fragments thereof comprising one or more - 70 - VL CDR2s having an amino acid sequence of any one of the VL CDR2s listed in Table 2 or Table 3. In a preferred embodiment, a composition of the present invention comprises one or more antibodies or fragments thereof comprising one or more VL CDR3s having an amino acid sequence of any one of the VL CDR3s listed in Table 2 or Table 3. 5 In another embodiment, a composition of the present invention comprises one or more antibodies or fragments thereof comprising one or more VH domains having an amino acid sequence of any one of the VH domains listed in Table 2 and one or more VL domains having an amino acid sequence of any one of the VL domains listed in Table 2. In another embodiment, a composition of the present invention comprises one or more antibodies or 10 fragments thereof comprising one or more VH CDRIs having an amino acid sequence of any one of the VH CDRIs listed in Table 2 or Table 3 and one or more VL CDRls having an amino acid sequence of any one of the VL CDRls listed in Table 2 or Table 3. In another embodiment, a composition of the present invention comprises one or more antibodies or fragments thereof comprising one or more VH CDRIs having an amino acid 15 sequence of any one of the VH CDRls listed in Table 2 or Table 3 and one or more VL CDR2s having an amino acid sequence of any one of the VL CDR2s listed in Table 2 or Table 3. In another embodiment, a composition of the present invention comprises one or more antibodies or fragments thereof comprising one or more VH CDRIs having an amino acid sequence of any one of the VH CDRIs listed in Table 2 or Table 3 and one or more VL 20 CDR3s having an amino acid sequence of any one of the VL CDR3s listed in Table 2 or Table 3. In another embodiment, a composition of the present invention comprises one or more antibodies or fragments thereof comprising one or more VH CDR2s having an amino acid sequence of any one of the VH CDR2s listed in Table 2 or Table 3 and one or more VL 25 CDRls having an amino acid sequence of any one of the VL CDRls listed in Table 2 or Table 3. In another embodiment, a composition of the presentinvention comprises one or more antibodies or fragments thereof comprising one or more VH CDR2s having an amino acid sequence of any one of the VH CDR2s listed in Table 2 or Table 3 and one or more VL CDR2s having an amino acid sequence of any one of the VL CDR2s listed in Table 2 or 30 Table 3. In another embodiment, a composition of the present invention comprises one or more antibodies or fragments thereof comprising one or more VH CDR2s having an amino acid sequence of any one of the VH CDR2s listed in Table 2 or Table 3 and one or more VL CDR3s having an amino acid sequence of any one of the VL CDR3s listed in Table 2 or Table 3. 35 -71 - In another embodiment, a composition of the present invention comprises one or more antibodies or fragments thereof comprising one or more VH CDR3s having an amino acid sequence of any one of the VH CDR3s listed in Table 2 or Table 3 and one or more VL CDRIs having an amino acid sequence of any one of the VL CDRIs listed in Table 2 or 5 Table 3. In another embodiment, a composition of the present invention comprises one or more antibodies or fragments thereof comprising one or more VH CDR3s having an amino acid sequence of any one of the VH CDR3s listed in Table 2 or Table 3 and one or more VL CDR2s having an amino acid sequence of any one of the VL CDR2s listed in Table 2 or Table 3. In a preferred embodiment, a composition of the present invention comprises one 10 or more antibodies or fragments thereof comprising one or more VH CDR3s having an amino acid sequence of any one of the VH CDR3s listed in Table 2 or Table 3 and one or more VL CDR3s having an amino acid sequence of any one of the VL CDR3s listed in Table 2 or Table 3. In yet another embodiment, a composition of the present invention comprises one or more fusion proteins of the invention. 15 As discussed in more detail below, a composition of the invention may be used either alone or in combination with other compositions. The antibodies or fragments thereof may further be recombinantly fused to a heterologous polypeptide at the N - or C terminus or chemically conjugated (including covalently and non-covalently conjugations) to polypeptides or other compositions. For example, antibodies of the present invention 20 may be recombinantly fused or conjugated to molecules useful as labels in detection assays and effector molecules such as heterologous polypeptides, drugs, radionuclides, or toxins. See, e.g., PCT publications WO 92/08495; WO 91/14438; WO 89/12624; U.S. Patent No. 5,314,995; and EP 396,387. Antibodies of the present invention or fragments thereof may be used, for example, 25 to purify, detect, and target RSV antigens, in both in vitro and in vivo diagnostic and iteapeutimebes. irrexanle,4e artbde rrgettv siinnasy 'for qualitativ~ly and quanfitafively measuring lev61s drthe'RSV'in'bi6og'ici samples sudh as sputum. See, e.g., Harlow et al., Antibodies: A Laboratory Manual, (Cold Spring Harbor Laboratory Press, 2nd ed. 1988) (incorporated by reference herein in its entirety). 30 5.1.1. Antibody Conjugates The present invention encompasses antibodies or fragments thereof recombinantly fused or chemically conjugated (including both covalently and non-covalently conjugations) to a heterologous polypeptide (or portion thereof, preferably at least 10, at least 20, at least 35 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90 or at least 100 amino - 72 acids of the polypeptide) to generate fusion proteins. The fusion does not necessarily need to be direct, but may occur through linker sequences. For example, antibodies may be used to target heterologous polypeptides to particular cell types (e.g., respiratory epithelial cells), either in vitro or in vivo, by fusing or conjugating the antibodies to antibodies specific for 5 particular cell surface receptors. Antibodies fused or conjugated to heterologous polypeptides may also be used in in vitro immunoassays and purification methods using methods known in the art. See e.g., PCT publication WO 93/21232; EP 439,095; Naramura et al., Immunol. Lett. 39:91-99 (1994); U.S. Patent 5,474,981; Gillies et al., PNAS 89:1428 1432 (1992); and Fell et al., J. Immunol. 146:2446-2452(1991), which are incorporated by 10 reference in their entireties. In one embodiment, a fusion protein of the invention comprises SYNAGIS@, AFFF, Pfl2, P12f4, P1 1d4, Ale9, Al2a6, A13c4, A17d4, A4B4, A8C7, IX-493L1FR, H3-3F4, M3H9, Y10H6, DG, AFFF(1), 6H8, Ll-7E5, L2-15B10, Al3al 1, Alh5, A4B4(1), A4B4LlFR-S28R, or A4B4-F52S and a heterologous polypeptide. In another embodiment, 15 a fusion protein of the invention comprises an antigen-binding fragment of SYNAGIS@, AFFF, Pfl2, P12f4, P1 1d4, Ale9, Al2a6, Al3c4, Al7d4, A4B4, A8C7, IX-493LIFR,*H3 3F4, M3H9, YIOH6, DG, AFFF(l), 6H8, LI-7E5, L2-15B10. Al3al 1, Alh5, A4B4(1), A4B4LIFR-S28R, or A4B4-FS2S and a heterologous polypeptide. In another embodiment, a fusion protein of the invention comprises one or more VH domains having the amino acid -20 sequence of any one of the VH domains listed in Table 2 or one or more VL domains having the amino acid sequence of any one of the VL domains listed in Table 2 and a heterologous polypeptide. In another embodiment, a fusion protein of the present invention comprises one or more VH CDRs having the amino acid sequence of any one of the VH CDRs listed in Table 2 or Table 3 and a heterologous polypeptide. In another embodiment, 25 a fusion protein comprises one or more VL CDRs having the amino acid sequence of any one of the VL CDRs listed in Table 2 or Table 3 and a heterologous polypeptide. In another embodiment, a fusion protein of the invention comprises at least one VH domain and at least one VL domain listed in Table 2 and a heterologous polypeptide. In yet another embodiment, a fusion protein of the invention comprises at least one VH CDR and at least 30 one VL CDR domain listed in Table 2 or Table 3 and a heterologous polypeptide. The present invention further includes compositions comprising heterologous polypeptides fused or conjugated to antibody fragments. For example, the heterologous polypeptides may be fused or conjugated to a Fab fragment, Fd fragment, Fv fragment, F(ab) 2 fragment, or portion thereof. Methods for fusing or conjugating polypeptides to 35 antibody portions are known in the art. See, e.g., U.S. Patent Nos. 5,336,603, 5,622,929, - 73 - 5,359,046. 5,349,053, 5,447,851, and 5,112,946; EP 307,434; EP 367,166; PCT publication Nos. WO 96/04388 and WO 91/06570; Ashkenazi et al., Proc. NatI. Acad. Sci. USA 88: 10535-10539 (1991); Zheng et al., J. linmunol. 154:5590-5600 (1995); and Vil et al., Proc. Natl. Acad. Sci. USA 89:11337- 11341(1992) (said references incorporated by reference in 5 their entireties). Additional fusion proteins of the invention may be generated through the techniques of gene-shuffling, motif-shuffling, exon-shuffling, and/or codon-shuffling (collectively referred to as "DNA shuffling"). DNA shuffling may be employed to alter the activities of antibodies of the invention or fragments thereof (e.g., antibodies or fragments thereof with 10 higher affinities and lower dissociation rates). See, generally, U.S. Patent Nos. 5,605,793; 5,811,238; 5,830,721; 5,834,252; and 5,837,458, and Patten et al., Curr. Opinion Biotechnol. 8:724-33 (1997); Harayama, Trends Biotechnol. 16(2):76-82 (1998); Hansson, et al., J. Mol. Biol. 287:265-76 (1999); and Lorenzo and Blasco, Biotechniques 24(2):308 13 (1998) (each of these patents and publications are hereby incorporated by reference in its 15 entirety). In one embodiment, antibodies or fragments thereof, or the encoded antibodies or fragments thereof, may be altered by being subjected to random mutagenesis by error-prone PCR, random nucleotide insertion or other methods prior to recombination. In another embodiment, one or more portions of a polynucleotide encoding an antibody or antibody fragment, which portions immunospecifically bind to a RSV antigen may be recombined 20 with one or more components, motifs, sections, parts, domains, fragments, etc. of one or more heterologous molecules. Moreover, the antibodies of the present invention or fragments thereof can be fused to marker sequences, such as a peptide to facilitate purification. In preferred embodiments, the marker amino acid sequence is a hexa-histidine peptide, such as the tag provided in a 25 pQE vector (QIAGEN, Inc., 9259 Eton Avenue, Chatsworth, CA, 91311), among others, mnran'y f ommerciael'y ~aviThb1e. As describd'Gentzet1.'l9g99;Proe. Atcad."Sti.UM$A' W2'i-:824, forinstance, iexa-fistidine provides for cornverierit purification of the fusion protein. Other peptide tags useful for purification include, but are not limited to, the hemagglutinin"HA" tag, which corresponds to an epitope derived from 30 the influenza hemagglutinin protein (Wilson et al., 1984, Cell 37:767) and the "flag" tag. The present invention further encompasses antibodies or fragments thereof conjugated to a diagnostic or therapeutic agent. The antibodies can be used diagnostically to, for example, monitor the development or progression of a RSV infection as part of a clinical testing procedure to, e.g., determine the efficacy of a given treatment regimen. 35 Detection can be facilitated by coupling the antibody or fragment thereof to a detectable - 74 substance. Examples of detectable substances include various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, radioactive materials, positron emitting metals, and nonradioactive paramagnetic metal ions. The detectable substance may be coupled or conjugated either directly to the antibody (or 5 fragment thereof) or indirectly, through an intermediate (such as, for example, a linker known in the art) using techniques known in the art. See, for example, U.S. Patent No. 4,741,900 for metal ions which can be conjugated to antibodies for use as diagnostics according to the present invention. Examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, beta-galactosidase, or acetylcholinesterase; examples of 10 suitable prosthetic group complexes include streptavidin/biotin and avidin/biotin; examples of suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or phycoerythrin; an example of a luminescent material includes luminol; examples of bioluminescent materials include luciferase, luciferin, and aequorin; and examples of 15 suitable radioactive material include 1211, 11, "'In or 9 Tc. An antibody or fragment thereof may be conjugated to a therapeutic moiety such as a cytotoxin, e.g., a cytostatic or cytocidal agent, a therapeutic agent or a radioactive metal ion, e.g., alpha-emitters. A cytotoxin or cytotoxic agent includes any agent that is detrimental to cells. Examples include paclitaxol, cytochalasin B, gramicidin D,. ethidium bromide, 20 emetine, mitomycin, etoposide, tenoposide, vincristine, vinblastine, colchicin, doxorubicin, daunorubicin, dihydroxy anthracin dione, mitoxantrone, mithramycin, actinomycin D, 1 dehydrotestosterone, glucocorticoids, procaine, tetracaine, lidocaine, propranolol, and puromycin and analogs or homologs thereof. Therapeutic agents include, but are not limited to, antimetabolites (e.g., methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine, 25 5-fluorouracil decarbazine), alkylating agents (e.g., mechlorethamine, thioepa chlorambucil, melphahan, carmustine (BSNU) and lomustine (CCNU), cyclothosphamide, busulfan, dibromomannitol, streptozotocin, mitomycin C, and cisdichlorodiamine platinum (11) (DDP) cisplatin), anthracyclines (e.g., daunorubicin (formerly daunomycin) and doxorubicin), antibiotics (e.g., dactinomycin (formerly actinomycin), bleomycin, 30 mithramycin, and anthramycin (AMC)), and anti-mitotic agents (e.g., vincristine and vinblastine). Further, an antibody or fragment thereof may be conjugated to a therapeutic agent or drug moiety that modifies a given biological response. Therapeutic agents or drug moieties are not to be construed as limited to classical chemical therapeutic agents. For example, the 35 drug moiety may be a protein or polypeptide possessing a desired biological activity. Such - 7S proteins may include, for example, a toxin such as abrin, ricin A, pseudomonas exotoxin, or diphtheria toxin; a protein such as tumor necrosis factor, a-interferon, p-interferon, nerve growth factor, platelet derived growth factor, tissue plasminogen activator, an apoptotic agent, e.g., TNF-a, TNF-p, AIM I (see, International Publication No. WO 97/33899), AIM 5 II (see., International Publication No. WO 97/34911), Fas Ligand (Takahashi et al., 1994, J. Iminunol., 6:1567-1574), and VEGI (see, International Publication No. WO 99/23105), a thrombotic agent or an anti-angiogenic agent, e.g., angiostatin or endostatin; or, a biological response modifier such as, for example, a lymphokine (e.g., interleukin- 1 ("IL- l"), interleukin-2 ("IL-2"), interleukin-6 ("IL-6"), granulocyte macrophage colony stimulating 10 factor ("GM-CSF"), and granulocyte colony stimulating factor ("G-CSF")), or a growth factor (e.g., growth hormone ("GH")). Techniques for conjugating such therapeutic moieties to antibodies are well known, see, e.g., Arnon et al., "Monoclonal Antibodies For Immunotargeting Of Drugs In Cancer Therapy", in Monoclonal Antibodies And Cancer Therapy, Reisfeld et al. (eds.), pp. 243-56 15 (Alan R. Liss, Inc. 1985); Hellstrom et al:, "Antibodies For Drug Delivery", in Controlled Drug Delivery (2nd Ed.), Robinson et al. (eds.), pp. 623-53 (Marcel Dekker, Inc. 1987); Thorpe, "Antibody Carriers Of Cytotoxic Agents In Cancer Therapy: A Review", in Monoclonal Antibodies '84: Biological And Clinical Applications, Pinchera et al. (eds.), pp. 475-506 (1985); "Analysis, Results, And Future Prospective Of The Therapeutic Use Of 20 Radiolabeled Antibody In Cancer Therapy", in Monoclonal Antibodies For Cancer Detection And Therapy, Baldwin et al. (eds.), pp. 303-16 (Academic Press 1985), and Thorpe et al., 1982, Immunol. Rev. 62:119-58. An antibody or fragment thereof, with or without a therapeutic moiety conjugated to it, administered alone or in combination with cytotoxic factor(s) and/or cytoidne(s) can be 25 used as a therapeutic. anti6oy'heterocorijugate as desc~i'bed'by'Segdl in"U.S.'PatentN o. 4'6,9m, iwiidh'is incorporated herein by reference in its entirety. Antibodies may also be attached to solid supports, which are particularly useful for 30 immunoassays or purification of the target antigen. Such solid supports include, but are not limited to, glass, cellulose, polyacrylamide, nylon, polystyrene, polyvinyl chloride or polypropylene. 35 - 76 - 5.2. Prophylactic and Therapeutic Uses of Antibodies The present invention is directed to antibody-based therapies which involve administering antibodies of the invention or fragments thereof to a mammal, preferably a human, for preventing, treating, or ameliorating one or more symptoms associated with a 5 RSV infection. Prophylactic and therapeutic compounds of the invention include, but are not limited to, antibodies of the invention (including fragments, analogs and derivatives thereof as described herein) and nucleic acids encoding antibodies of the invention (including fragments, analogs and derivatives thereof and anti-idiotypic antibodies as described herein). Antibodies of the invention or fragments thereof may be provided in 10 pharmaceutically acceptable compositions as known in the art or as described herein. Antibodies of the present invention or fragments thereof that function as antagonists of a RSV infection can be administered to a mammal, preferably a human, to treat, prevent or ameliorate one or more symptoms associated with a RSV infection. For example, antibodies or fragments thereof which disrupt or prevent the interaction between a RSV 15 antigen and its host cell receptor may be administered to a mammal, preferably a human, to treat, prevent or ameliorate one or more symptoms associated with a RSV infection. In a specific embodiment, an antibody or fragment thereof prevents RSV from binding to its host cell receptor by at least 99%, at least 95%, at least 90%, at least 85%, at least 80%, at least 75%, at least 70%, at least 60%, at least 50%, at least 45%, at least 40%, 20 at least 45%, at least 35%, at least 30%, at least 25%, at least 20%, or at least 10% relative to RSV binding to its host cell receptor in the absence of said antibodies or antibody fragments. In another embodiment, a combination of antibodies, a combination of antibody fragments, or a combination of antibodies and antibody fragments prevent RSV from binding to its host cell receptor by at least 99%, at least 95%, at least 90%, at least 85%, at 25 least 80%, at least 75%, at least 70%, at least 60%, at least 50%, at least 45%, at least 40%, at'least 45%, atleast~35%, at'least30%, afleast 25%, af least-20%, or afleast -tJ% relative to RSV binding to its host cell receptor in the absence of said antibodies and/or antibody fragments. Antibodies or fragments thereof which do not prevent RSV from binding its host 30 cell receptor but inhibit or downregulate RSV replication can also be administered to a mammal to treat, prevent or ameliorate one or more symptoms associated with a RSV infection. The ability of an antibody or fragment thereof to inhibit or downregulate RSV replication may be detennined by techniques described herein or otherwise known in the art. For example, the inhibition or downregulation of RSV replication can be determined by 35 detecting the RSV titer in the lungs of a mammal, preferably a human. - 77 - In a specific embodiment, an antibody of the present invention or fragment thereof inhibits or downregulates RSV replication by at least 99%, at least 95%, at least 90%, at least 85%, at least 80%, at least 75%, at least 70%, at least 60%, at least 50%, at least 45%, at least 40%, at least 45%, at least 35%, at least 30%, at least 25%, at least 20%, or at least 5 10% relative to RSV replication in absence of said antibodies or antibody fragments. In another embodiment, a combination of antibodies, a combination of antibody fragments, or a combination of antibodies and antibody fragments inhibit or downregulate RSV replication by at least 99%, at least 95%, at least 90%, at least 85%, at least 80%, at least 75%, at least 70%, at least 60%, at least 50%, at least 45%, at least 40%, at least 45%, at 10 least 35%, at least 30%, at least 25%, at least 20%, or at least 10% relative to RSV replication in absence of said antibodies and/or antibody fragments. One or more antibodies of the present invention or fragments thereof that immunospecifically bind to one or more RSV antigens may be used locally or systemically in the body as a therapeutic. The antibodies of this invention or fragments thereof may also 15 be advantageously utilized in combination with other monoclonal or chimeric antibodies, or with lymphokines or hematopoietic growth factors (such as, e.g., IL-2, IL-3 and IL-7), which, for example, serve to increase the number or activity of effector cells which interact with the antibodies. The antibodies of this invention or fragments thereof may also be advantageously utilized in combination with other monoclonal or chimeric antibodies, or 20 with lymphokines or hematopoietic growth factors (such as, e.g., IL-2, IL-3 and IL-7), which, for example, serve to increase the immune response. The antibodies of this invention or fragments thereof may also be advantageously utilized in combination with one or more drugs used to treat RSV infection such as, for example anti-viral agents. Antibodies of the invention or fragments may be used in combination with one or more of 25 the following drugs: NIH-351 (Gemini Technologies), recombinant RSV vaccine (Aviron), 'Rb"M Tntrue\,'FJS04TiFier2Fbre;T76'(fTne)"'VP~.Y66'76'T(Viro'Pharma'),*'RF1 634'1 (AecnRm'rdcs) 'V'3"i If'VrdPharnra);V'PP ani'PFP 2 2'(Ameri can Home Products), RSV vaccine (Avant Immunotherapeutics), and F-50077 (Pierre Fabre). The antibodies of the invention may be administered alone or in combination with 30 other types of treatments (e.g., hormonal therapy, immunotherapy, and anti-inflammatory agents). Generally, administration of products of a species origin or species reactivity (in the case of antibodies) that is the same species as that of the patient is preferred. Thus, in a preferred embodiment, human or humanized antibodies, fragments derivatives, analogs, or nucleic acids, are administered to a human patient for therapy or prophylaxis. 35 -78- It is preferred to use high affmity and/or potent in vivo inhibiting antibodies and/or neutralizing antibodies that immunospecifically bind to a RSV antigen, for both immunoassays directed to RSV, prevention of RSV infection and therapy for RSV infection. It is also preferred to use polynucleotides encoding high affinity and/or potent in 5 vivo inhibiting antibodies and/or neutralizing antibodies that immunospecifically bind to a RSV antigen, for both immunoassays directed to RSV and therapy for RSV infection. Such antibodies or fragments thereof will preferably have an affinity for the RSV F glycoprotein and/or fragments of the F glycoprotein. In one embodiment, therapeutic or pharmaceutical compositions comprising 10 antibodies of the invention or fragments thereof are administered to a mammal, preferably a human, to treat, prevent or ameliorate one or more symptoms associated with RSV infection. In another embodiment, therapeutic or pharmaceutical compositions comprising antibodies of the invention or fragments thereof are administered to a human with cystic fibrosis, bronchopulmonary dysplasia, congenital heart disease, congenital 15 immunodeficiency or acquired immunodeficiency, or to a human who has had a bone marrow transplant to treat, prevent or ameliorate one or more symptoms associated with RSV infection. In another embodiment, therapeutic or pharmaceutical compositions comprising antibodies of the invention or fragments thereof are administered to a human infant, preferably a human infant born prematurely or a human infant at risk of 20 hospitalization for RSV infection to treat, prevent or ameliorate one or more symptoms associated with RSV infection. In yet another embodiment, therapeutic or pharmaceutical compositions comprising antibodies of the invention or fragments thereof are administered to the elderly or people in group homes (e.g., nursing homes or rehabilitation centers). In a specific embodiment, a mammal, preferably a human, is administered a 25 therapeutic or pharmaceutical composition comprising one or more antibodies of the present invention or fragments thereof for the treatment, prevention or amelioration of one or more symptoms associated with a RSV infection in an amount effective for decreasing RSV titers. In accordance with this embodiment, an effective amount of antibodies or antibody fragments reduces the RSV titers in the lung as measured, for example, by the concentration 30 of RSV in sputum samples or a lavage from the lungs from a mammal. In another embodiment, a mammal, preferably a human, is administered a therapeutic or pharmaceutical composition comprising one or more antibodies of the present invention or fragments thereof for the treatment, prevention or amelioration of symptoms associated with a RSV infection in an amount effective for inducing an immune response in the mammal. 35 -79- In another embodiment, a mammal, preferably a human, is administered a first dose of a therapeutic or pharmaceutical composition comprising less than 15 mg/kg, preferably less than 10 mg/kg, less than 5 mg/kg, less than 3 mg/kg, less than 1 mg/kg or less than 0.5 mg/kg of one or more antibodies or fragments thereof that immunospecifically bind to one 5 or more RSV antigens with higher affinity and/or higher avidity than previously known antibodies (e.g., SYNAGIS@) for the prevention, treatment or amelioration of one or more symptoms associated with a RSV infection in an amount effective to induce a serum titer of at least I jig/ml.. preferably at least 2 Ag/mI, at least 5 jg/ml, at least 10 jig/ml, at least 15 jig/ml, at least 20 pg/ml, or at least 25 jig/ml 20 days (preferably 25, 30, 35, 40 days) after 10 the administration of the first dose and prior to the administration of a subsequent dose. Preferably, the serum titer of said antibodies or antibody fragments is less than 30 jg/ml 30 days after the administration of the first dose and prior to the administration of a subsequent dose. Preferably, said antibodies are AFFF, Pf12, P12f4, PI 1d4, Ale9, Al2a6, A13c4, A17d4, A4B4, A8C7, IX-493LIFR, H3-3F4, M3H9, YIOH6, DG, AFFF(I), 6H8, Ll-7E5, 15 L2-15B10, Ai3al 1, Alh5, A4B4(1), A4B4LIFR-S28R, and A4B4-F52S In another embodiment, a mammal, preferably a human, is administered a first dose of a therapeutic or pharmaceutical composition comprising less than 15 mg/kg, preferably less than 5 mg/kg, less than 3 mg/kg, less than 1 mg/kg or less than 0.5 mg/kg of one or more antibodies or fragments thereof which have increased in vivo half-lives and which 20 immunospecifically bind to one or more RSV antigens with higher affinity and/or higher avidity than previously known antibodies (e.g., SYNAGIS@) for the prevention, treatment or amelioration of one or more symptoms associated with a RSV infection in an amount effective to induce a serum titer of at least 1 jig/nil, preferably at least 2 pg/ml, at least 5 jig/ml, at least 10 jig/nil, at least 15 jig/ml, at least 20 jig/nl, or at least 25 pg/ml 25 days 25 (preferably 30, 35, or 40 days) after the administration of the first dose and prior to the a~ in a z M.Pre'fermbly,-thie-serunrTiiter Ofsdiid antib'ddies or ant(ibodIy-idgme1ts'isfess fnan"3) pg/niT3'O days after the adnirinistration o'f he first dose and prior to the administration of a subsequent dose. Preferably, the novel antibodies are AFFF, Pfl2, P12f4, P1 1d4, Ale9, Al2a6, Al3c4, A17d4, A4B4, A8C7, 1X-493LIFR, H3 30 3F4, M3H9, YlOH6, DG, AFFF(l), 6H8, Ll-7E5, L2-15B10, Al3al l, Alh5, A4B4(1), A4B4LIFR-S28R, and A4B4-F52S. In another embodiment, a mammal, preferably a human, is administered a first dose of a therapeutic or pharmaceutical composition comprising approximately 15 mg/kg of HL SYNAGIS or antigen-binding fragments thereof for the prevention, treatment or 35 amelioration of one or more symptoms associated with a RSV infection in an amount -80effective to induce a serum titer of at least I pg/ml, preferably at least 30 jg/ml, at least 35 pg/ml, at least 40 ptg/ml, or at least 50 pg/mil 25 days (preferably 30, 35, or 40 days) after the administration of the first dose and prior to the administration of a subsequent dose. In another embodiment, a mammal, preferably a human, is administered a first dose of a 5 therapeutic or pharmaceutical composition comprising less than 15 mg/kg (preferably 10 mg/kg or less, 5 mg/kg or less, 3 mg/kg or less, I mg/kg or less, or 0.5 mg/kg or less) of HL-S YNAGIS or antigen-binding fragments thereof for the prevention, treatment or amelioration of one or more symptoms associated with a RSV infection in an amount effective to induce a serum titer of at least 1 pg/ml, preferably at least 30 pg/ml, at least 35 10 pg/ml, at least 40 pg/ml, or at least 50 pg/ml 25 days (preferably 30, 35, or 40 days) after the administration of the first dose and prior to the administration of a subsequent dose. The present invention encompasses therapeutic or pharmaceutical compositions for pulmonary delivery comprising one or more antibodies or fragments thereof which inmunospecifically bind to one or more RSV antigens with a higher affinity and/or a higher 15 avidity than previously known antibodies (e.g., SYNAGIS@). The present invention also encompasses therapeutic or pharmaceutical compositions for pulmonary delivery comprising SYNAGIS@ or an antigen-binding fragment thereof. In one embodiment, a mammal, preferably a human, is administered a first dose of a therapeutic or pharmaceutical composition for pulmonary delivery comprising less than 15 20 mg/kg, preferably less than 5 mg/kg, less than 3 mg/kg, less than 1 mg/kg or less than 0.5 mg/kg, or less than 0.01 mg/kg of one or more antibodies or fragments thereof which immunospecifically bind to one or more RSV antigens with higher affinity and/or higher avidity than previously known antibodies (e.g., SYNAGIS@) for the prevention, treatment or amelioration of one or more symptoms associated with a RSV infection in an amount 25 effective to induce a titer of 20 ng per mg of lung protein (preferably at least 40 ng/mg, * ease6 ag/mg;&lwt3wrigmgatAeasv5'3ng/r at leas'7-n/mraless10 ng)mg, or aft'east'5'O ngimjin an'mutnbafion samf:e or1avageYrom fhe''iungs df said mammal 20 days (preferably 25, 30, 35, or 40 days) after the administration of the first dose and prior to the administration of a subsequent dose. Preferably, the serum titer of said 30 antibodies or antibody fragments is less than 100 ng/ml of protein 30 days after the administration of the first dose and prior to the administration of a subsequent dose. Preferably, the novel antibodies are AFFF, Pfl2, P12f4, P1 d4, Ale9, Al2a6, A13c4, A17d4, A4B4, A8C7, lX-493LIFR, H3-3F4, M3H9, Y1OH6, DG, AFFF(I), 6H8, L1-7E5, L2-15B10, Al3al 1, Alh5, A4B4(1), A4B4LIFR-S28R, and A4B4-F52S. 35 - 81 - In another embodiment, a mammal, preferably a human, is administered a first dose of a therapeutic or pharmaceutical composition for pulmonary delivery comprising approximately 15 mg/kg of SYNAGIS@ or fragments thereof for the prevention, treatment or amelioration of one or more symptoms associated with a RSV infection in an amount 5 effective to induce a titer of 20 ng per mg of lung protein (preferably at least 40 ng/mg, at least 60 ng/mg, at least 80 ng/mg, at least 50 ng/mg, at least 75 ng/mg, at least 100 ng/mg, or at least 150 ng/mg) an intubation sample or lavage from the lungs of said mammal 30 days (preferably 35 or 40 days) after the administration of the first dose and prior to the administration of a subsequent dose. In another embodiment, a mammal, 10 preferably a human, is administered a first dose of a therapeutic or pharmaceutical composition for pulmonary delivery comprising less than 15 mg/kg (preferably 10 mg/kg or less, 5 mg/kg or less, 3 mg/kg or less, I mg/kg or less, or 0.5 mg/kg or less) of SYNAGIS@ or fragments thereof for the prevention of a RSV infection in an amount effective to induce a titer of 20 ng per mg of lung protein (preferably at least 40 ng/mg, 15 at least 60 ng/mg, at least 80 ng/mg, at least 50 ng/mg, at least 75 ng/mg, at least 100 ng/mg, or at least 150 ng/mg) in an intubation sample or lavage from the lungs of said mammal 30 days (preferably 35 or 40 days) after the administration of the first dose and prior to the administration of a subsequent dose. The present invention encompasses therapeutic or pharmaceutical compositions for 20 pulmonary delivery comprising one or more antibodies or fragments thereof which have increased in vivo half-lives and which immunospecifically bind to one or more RSV antigens with a higher affinity and/or a higher avidity than previously known antibodies (e.g., SYNAGIS@). The present invention also encompasses therapeutic or pharmaceutical compositions for pulmonary delivery comprising HL-SYNAGIS or an antigen-binding 25 fragment thereof. The-preserttin venni enc(mnpasses-strstainTeflese-cmposhioritstonrinsing e-one or more antibodies or'fragments theredY v7 6 dh havemcreased in i'o"hif-'fives aria Wffieh immunospecifically bind to one or more RSV antigens with a higher affinity and/or a higher avidity than previously known antibodies (e.g., SYNAGIS@). The present invention also 30 encompasses sustained release compositions comprising SYNAGIS@ or an antigen-binding fragment thereof. In one embodiment, a mammal, preferably a human, is administered a first dose of a sustained release formulation comprising less than 15 mg/kg, preferably less than 5 mg/kg, less than 3 mg/kg, less than 1 mg/kg or less than 0.5 mg/kg of one or more antibodies or 35 fragments thereof which immunospecifically bind to one or more RSV antigens with higher -82affinity and/or higher avidity than previously known antibodies (e.g., SYNAGIS@) for the prevention, treatment or amelioration of one or more symptoms associated with a RSV infection in an amount effective to induce a serum titer of at least I pg/ml, preferably at least 2 jig/ml, at least 5 pg/ml, at least 10 pg/ml, at least 15 pg/ml, at least 20 pg/ml, or at 5 least 25 pg/ml for at least 10 days (preferably at least 15, at least 20, at least 25, at least 30, at least 35, or at least 40 days) after the administration of the first dose and prior to the administration of a subsequent dose. Preferably, the serum titer of said antibodies or antibody fragments is less than 30 pg/ml 30 days after the administration of the first dose and prior to the administration of a subsequent dose. Preferably, the novel antibodies are 10 AFFF, Pfl2, P12f4, PI1 d4, Ale9, Al2a6, Al3c4, Al7d4, A4B4, A8C7, IX-493LIFR, H3 3F4, M3H9, YlOH6, DG, AFFF(l), 6H8, Ll-7E5, L2-15B10, Al3al 1, Alh5, A4B4(l), A4B4LlFR-S28R, or A4B4-F52S. In another embodiment, a mammal, preferably a human, is administered a first dose of a sustained release formulation comprising less than 15 mg/kg, preferably less than 5 15 mg/kg, less than 3 mg/kg, less than 1 mg/kg or less than 0.5 mg/kg of one or more antibodies or fragments thereof which immunospecifically bind to one or more RSV antigens with higher affinity and/or higher avidity than previously known antibodies (e.g., SYNAGIS@) for the prevention, treatment, or amelioration of one or more symptoms associated with a RSV infection in an amount effective to induce a serum titer of I pg/ml, 20 preferably 2 pg/ml, 5 pg/ml, 10 pg/mil, 15 pg/ml, 20 pg/ml, or 25 pg/ml that is maintained for at least 10 days (preferably at least 15, at least 20, at least 25, at least 30, at least 35, or at least 40 days) after the administration of the first dose and prior to the administration of a subsequent dose without exceeding a serum titer of 30 pg/ml. In another embodiment, a mammal, preferably a human, is administered a first dose 25 of a sustained release formulation comprising approximately 15 mg/kg of SYNAGIS@ or fragmrsheod Trthe prevefion, 'treatinent or amslioration of one or more symptoms associated with a*RSV infection -in an amount effective to induce a titer of at least'30 pg/mi, preferably at least 35 pg/ml, at least 40 pg/ml, or at least 50 pg/ml 25 days (preferably 30, 35, or 40 days) after the administration of the first dose and prior to the administration of a 30 subsequent dose. In another embodiment, a mammal, preferably a human, is administered a first dose of a sustained release formulation comprising less than 15 mg/kg (preferably 10 mg/kg or less, 5 mg/kg or less, 3 mg/kg or less, 1 mg/kg or less, or 0.5 mg/kg or less) of SYNAGIS@ or fragments thereof for the prevention of a RSV infection in an amount effective to induce at least 30 pg/ml, preferably at least 35 pg/ml, at least 40 pg/mil, or at 35 - 83 least 50 pg/ml 25 days (preferably 30, 35, or 40 days) after the administration of the first dose and prior to the administration of a subsequent dose. In another embodiment, a mammal, preferably a human, is administered a first dose of a sustained release formulation comprising less than 15 mg/kg, preferably less than 5 5 mg/kg, less than 3 mg/kg, less than 1 mg/kg or less than 0.5 mg/kg of SYNAGIS@ or an antigen-binding fragment thereof for the prevention, treatment, or amelioration of one or more symptoms associated with a RSV infection in an amount effective to induce a serum titer of I ig/ml, preferably 2 ptg/ml, 5 ig/ml, 10 pg/ml, 15 ptg/ml, 20 pg/ml, or 25 pg/mI that is maintained for at least 10 days (preferably at least 15, at least 20, at least 25, at least 10 30, at least 35, or at least 40 days) after the administration of the first dose and prior to the administration of a subsequent dose without exceeding a serum titer of 30 pg/ml. The present invention encompasses sustained release formulations comprising one or more antibodies or fragments thereof which have increased in vivo half-lives and which inununospecifically bind to one or more RSV antigens with a higher affinity and/or a higher 15 avidity than previously known antibodies such as, e.g., SYNAGIS@. The present invention also encompasses sustained release formulations comprising HL-SYNAGIS or an antigen binding fragment thereof. The present invention encompasses sustained release formulations for pulmonary delivery comprising one or more antibodies or fragments thereof which immunospecifically 20 bind to one or more RSV antigens with a higher affinity and/or a higher avidity than previously known antibodies (e.g., SYNAGIS@). The present invention also encompasses sustained release formulations for pulmonary delivery comprising one or more antibodies or fragments thereof which have increased in vivo half-lives and which immunospecifically bind to one or more RSV antigens with a higher affinity and/or a higher avidity than 25 previously known antibodies (e.g., SYNAGIS@). The present invention also encompasses sustained-uiet foptmonay aeivery compfising'SYNAOG13@ orfTragmrents (hereof. 'The present invenfion furfher encompasses sustained release formulations for pulmonary delivery comprising HL-SYNAGIS or an antigen-binding fragment thereof. In another embodiment, a mammal, preferably a human, is administered a first dose 30 of a therapeutic or pharmaceutical composition comprising less than 10 mg/kg, less than 5 mg/kg, less than 3 mg/kg, less than 1 mg/kg or less than 0.5 mg/kg of one or more antibodies of the present invention or fTagments thereof for the prevention, treatment or amelioration of one or more symptoms associated with a RSV infection in an amount effective to induce a serum titer of at least 35 pg/ml, at least 40 pg/nil, at least 50 ptg/ml, at 35 least 80 pg/ml, at least 100 pg/ml, at least 120 jig/ml, at least 150 jig/ml, at least 200 pg/mIl, - 84 at least 250 ig/ml, or at least 300 ig/ml 20 days (preferably 25, 30, 35 or 40 days) after the administration of the first dose. In another embodiment, a mammal, preferably a human, is administered a first dose of a therapeutic or phannaceutical composition comprising approximately 15 mg/kg of one or more antibodies of the present invention or fragments 5 thereof for the prevention, treatment or amelioration of one or more symptoms associated with a RSV infection in an amount effective to induce a serum titer of at least 100 jig/ml, at least 125 jg/ml, at least 150 jig/ml, at least 200 pg/mI, at least 250 jig/ml, at least 300 jig/ml, at least 350 pg/ml, at least 400 jig/ml, or at least 450 jig/ml 20 days (preferably 25, 30, 35 or 40 days) after the administration of the first dose. The term "approximately 15 10 mg/kg" as used herein refers to a range of between 14 mg/kg and 16 mg/kg. In another embodiment, a mammal, preferably a human, is administered a dose of a phanraceutical composition comprising one or more antibodies of the present invention or fragments thereof for the prevention a RSV infection in an amount effective to induce a prophylactically effective serum titer of less than 10 jig/ml, less than 8 jig/ml, less than 5 15 pg/ml, less than 3 pg/ml, less than I jig/ml, or less than 0.5 jig/ml 30 days after the administration of the dose, wherein said prophylactically effective serum titer is the serum titer that reduces the incidence of RSV infection in the human or the serum titer in a cotton rat that results in a RSV titer 5 days after challenge with 10' pfu RSV that is 99% lower than the RSV titer in the cotton rat 5 days after challenge with 10' pfu of RSV in a cotton rat 20 not administered the dose prior to challenge. Preferably, the dose of the pharmaceutical composition comprises less than 10 mg/kg, less than 5 mg/kg, less than 3 mg/kg, less than 1 mg/kg, or less than 0.5 mg/kg of one or more antibodies of the present invention or fragments thereof. In yet another embodiment, a mammal, preferably a human, is administered a dose of 25 a therapeutic or pharmaceutical composition comprising one or more antibodies of the symptoms associated vith a RSV 'in'fecnonin an amount effecfive to'induce a therapeutically effective serum titer of less than 10 jig/ml, less than 8 jig/mil, less than 5 ig/ml, less than 3 pg/ml, less than I pg/ml, or less than 0.5 pg/ml 30 days after the 30 administration of the dose, wherein said therapeutically effective serum titer is the serum titer that reduces the severity or length of RSV infection or is the serum titer in a cotton rat that results in a RSV titer in the rat 5 days after challenge with 10' pfu RSV that is 99% lower than the RSV titer 5 days after challenge with 10' pfu of RSV in a cotton rat not administered the dose prior to challenge. Preferably, the dose of the therapeutic or 35 pharmaceutical composition comprises less than 12 mg/kg, less than 10 mg/kg, less than 5 - 85 mg/kg, less than 3 mg/kg, less than 1 mg/kg, or less than 0.5 mg/kg of one or more antibodies of the present invention or fragments thereof. 5.3. Methods of Administration of Antibodies 5 The invention provides methods of treatment, prophylaxis, and amelioration of one or more symptoms associated with RSV infection by administrating to a subject of an effective amount of antibody or fragment thereof, or pharmaceutical composition comprising an antibody of the invention or fragment thereof. In a preferred aspect, an antibody or fragment thereof is substantially purified (i.e., substantially free from substances 10 that limit its effect or produce undesired side-effects). The subject is preferably a mammal such as non-primate (e.g., cows, pigs, horses, cats, dogs, rats etc.) and a primate (e.g., monkey such as a cynomolgous monkey and a human). In a preferred embodiment, the subject is a human. In another preferred embodiment, the subject is a human infant or a human infant born prematurely. In another embodiment, the subject is a human with cystic 15 fibrosis, bronchopulmonary dysplasia, congenital heart disease, congenital immunodeficiency or acquired immunodeficiency, a human who has had a bone marrow transplant, or an elderly human Various delivery systems are known and can be used to administer an antibody of the invention or a fragment thereof, e.g., encapsulation in liposomes, microparticles, 20 microcapsules, recombinant cells capable of expressing the antibody or antibody fragment, receptor-mediated endocytosis (see, e.g., Wu and Wu, J. Biol. Chem. 262:4429-4432 (1987)), construction of a nucleic acid as part of a retroviral or other vector, etc. Methods of administering an antibody or fragment thereof, or pharmaceutical composition include, but are not limited to, parenteral administration (e.g., intradermal, intramuscular, 25 intraperitoneal, intravenous and subcutaneous), epidural, and mucosal (e.g., intranasal and tettuf, or Jh'mmacmidea'i ~omnpo'xsinymt S'i~hdlrihiistereni nrsdal~iirvnuy or subcutaneously. The compositions may be administered by any convenient route, for example by infusion or bolus injection, by absorption through epithelial or mucocutaneous 30 linings (e.g., oral mucosa, rectal and intestinal mucosa, etc.) and may be administered together with other biologically active agents. Administration can be systemic or local. In addition, pulmonary administration can also be employed, e.g., by use of an inhaler or nebulizer, and formulation with an aerosolizing agent. See, e.g., U.S. Patent Nos. 6,019,968, 5,985, 320, 5,985,309, 5,934,272, 5,874,064, 5,855,913, 5,290,540, and 35 4,880,078; and PCT Publication Nos. WO 92/19244, WO 97/32572, WO 97/44013, WO - 86 - 98/31346, and WO 99/66903, each of which is incorporated herein by reference their entirety. In a preferred embodiment, an antibody of the invention or fragment thereof, or composition of the invention is administered using Alkermes AIRTM pulmonary drug delivery technology (Alkermes, Inc., Cambridge, MA). 5 The invention provides for any method of administrating lower doses of known antibodies or fragments thereof which inmunospecifically bind to one or more RSV antigens than previously thought to be effective for the prevention, treatment or amelioration of one or more symptoms associated with a RSV infection. Preferably, lower doses of known antibodies or fragments thereof which immunospecifically bind to one or 10 more RSV antigens are administered by pulmonary administration. The present invention also provides for any method of administering a novel antibody of the invention or fragment thereof for the prevention, treatment or amelioration of one or more symptoms associated with a RSV infection. Preferably, novel antibodies of the invention or fragments thereof are administered by pulmonary administration. 15 The invention also provides that an antibody or fragment thereof is packaged in a hermetically sealed container such as an ampoule or sachette indicating the quantity of antibody or antibody fragment. In one embodiment, the antibody or antibody fragment is supplied as a dry sterilized lyophilized powder or water free concentrate in a hermetically sealed container and can be reconstituted, e.g., with water or saline to the appropriate 20 concentration for administration to a subject. Preferably, the antibody or antibody fragment is supplied as a dry sterile lyophilized powder in a hermetically sealed container at a unit dosage of at least 5 mg, more preferably at least 10 mg, at least 15 mg, at least 25 mg, at least 35 mg, at least 45 mg, at least 50 mg, or at least 75 mg. The lyophilized antibody or antibody fragment should be stored at between 2 and 8*C in its original container and the 25 antibody or antibody fragment should be administered within 12 hours, preferably within 6 .hours whia.5.douxs, .withinahaur.or within..r.aaer aeingeonstiated..a hennetically sealed container indicating the quantity and concentration of the antibody or antibody fragment. Preferably, the liquid form of the antibody or fragment thereof is 30 supplied in a hermetically sealed container at least I mg/ml, more preferably at least 2.5 mg/ml, at least 5 mg/ml, at least 8 mg/ml, at least 10 mg/ml, at least 15 mg/kg, or at least 25 mg/ml. In a specific embodiment, it may be desirable to administer the pharmaceutical compositions of the invention locally to the area in need of treatment; this may be achieved 35 by, for example, and not by way of limitation, local infusion, by injection, or by means of an - 87 implant, said implant being of a porous, non-porous, or gelatinous material, including membranes, such as sialastic membranes, or fibers. Preferably, when administering a an antibody of the invention or fragment thereof, care must be taken to use materials to which the antibody or antibody fragment does not absorb. 5 In another embodiment, the composition can be delivered in a vesicle, in particular a liposome (see Langer, Science 249:1527-1533 (1990); Treat et al., in Liposomes in the Therapy of Infectious Disease and Cancer, Lopez-Berestein and Fidler (eds.), Liss, New York, pp. 353- 365 (1989); Lopez-Berestein, ibid., pp. 3 17-327; see generally ibid.). In yet another embodiment, the composition can be delivered in a controlled release 10 or sustained release system. In one embodiment, a pump may be used to achieve controlled or sustained release (see Langer, supra; Sefton, 1987, CRC Crit. Ref. Biomed. Eng. 14:20; Buchwald et al., 1980, Surgery 88:507; Saudek et al., 1989, N. Engl. J. Med. 321:574). In another embodiment, polymeric materials can be used to achieve controlled or sustained release of the antibodies of the invention or fragments thereof (see e.g., Medical 15 Applications of Controlled Release, Langer and Wise (eds.), CRC Pres., Boca Raton, Florida (1974); Controlled Drug Bioavailability, Drug Product Design and Perfornance, Smolen and Ball (eds.), Wiley, New York (1984); Ranger and Peppas, 1983, J., Macromol. Sci. Rev. Macromol. Chem. 23:61; see also Levy et al., 1985, Science 228:190; During et al., 1989, Ann. Neurol. 25:351; Howard et al., 1989, J. Neurosurg. 7 1:105); U.S. Patent No. 20 5,679,377; U.S. Patent No. 5,916,597; U.S. Patent No. 5,912,015; U.S. Patent No. 5,989,463; U.S. Patent No. 5,128,326; PCT Publication No. WO 99/15154; and PCT Publication No. WO 99/20253. Examples of polymers used in sustained release formulations include, but are not limited to, poly(2-hydroxy ethyl methacrylate), poly(methyl methacrylate), poly(acrylic acid), poly(ethylene-co-vinyl acetate), 25 poly(methacrylic acid), polyglycolides (PLG), polyanhydrides, poly(N-vinyl pyrrolidone), p6iy(viiiYl Nic6dl), p6iyacrylaiiide, p6df(6thilene glyc6l), polylacfides (PLA), p6i(lacfide co-glycolides) (PLGA), and polyorthoesters. In a preferred embodiment, the polymer used in a sustained release formulation is inert, free of leachable impurities, stable on storage, sterile, and biodegradable. In yet another embodiment, a controlled or sustained release 30 system can be placed in proximity of the therapeutic target, i.e., the lungs, thus requiring only a fraction of the systemic dose (see, e.g., Goodson, in Medical Applications of Controlled Release, supra, vol. 2, pp. 115-138 (1984)). Controlled release systems are discussed in the review by Langer (1990, Science 249:1527-1533). Any technique known to one of skill in the art can be used to produce 35 sustained release formulations comprising one or more antibodies of the invention or -88fragments thereof. See, e.g.,.U.S. Patent No. 4,526,938, .PCT publication WO 91/05548, PCT publication WO 96/20698,.Ning et al., 1996, "Intratumoral Radioimmunotheraphy of a Human Colon Cancer Xenograft Using a Sustained-Release Gel," Radiotherapy & Oncology 39:179-189,.Song el al., 1995, "Antibody Mediated Lung Targeting of 5 Long-Circulating Emulsions," PDA Journal of Pharmaceutical Science & Technology 50:372-397, Cleek et al., 1997, "Biodegradable Polymeric Carriers for a bFGF Antibody for Cardiovascular Application," Pro. Int'l. Symp. Control. Rel. Bioact. Mater. 24:853-854, and Lam et al., 1997, "Microencapsulation of Recombinant Humanized Monoclonal Antibody for Local Delivery," Proc. Int'l. Symp. Control Rel. Bioact. Mater. 24:759-760, each of 10 which is incorporated herein by reference in their entirety. In a specific embodiment where the composition of the invention is a nucleic acid encoding an antibody or antibody fragment, the nucleic acid can be administered in vivo to promote expression of its encoded antibody or antibody fragment, by constructing it as part of an appropriate nucleic acid expression vector and administering it so that it becomes 15 intracellular, e.g., by use of a retroviral vector (see U.S. Patent No. 4,980,286), or by direct injection, or by use of microparticle bombardment (e.g., a gene gun; Biolistic, Dupont), or coating with lipids or cell-surface receptors or transfecting agents, or by administering it in linkage to a homeobox- like peptide which is known to enter the nucleus (see e.g., Joliot et al., 1991, Proc. NatI. Acad. Sci. USA 88:1864-1868), etc. Alternatively, a nucleic acid can 20 'be introduced intracellularly and incorporated within host cell DNA for expression by homologous recombination. The present invention also provides pharmaceutical compositions. Such compositions comprise a prophylactically or therapeutically effective amount of an antibody or a fragment thereof, and a pharmaceutically acceptable carrier. In a specific embodiment, 25 the term pharmaceuticallyy acceptable" means approved by a regulatory agency of the recognized pharmacopsia for use*in ariimsis, ant more particla'ly in'humnris. "Tie"tern "carrier" refers to a diluent, adjuvant (e.g., Freund's adjuvant (complete and incomplete)), excipient, or vehicle with which the therapeutic is administered. Such pharmaceutical 30 carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water is a preferred carrier when the pharmaceutical composition is administered intravenously. Saline solutions and aqueous dex-trose and glycerol solutions can also be employed as liquid carriers, particularly for injectable solutions. Suitable pharmaceutical 35 excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica -89gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol and the like. The composition, if desired, can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents. These compositions can take the fonn of solutions, suspensions, emulsion, tablets, pills, capsules, 5 powders, sustained-release formulations and the like. Oral formulation can include standard carriers such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, etc. Examples of suitable pharmaceutical carriers are described in "Remington's Pharmaceutical Sciences" by E.W. Martin. Such compositions will contain a prophylactically or therapeutically effective 10 amount of the antibody or fragment thereof, preferably in purified form, together with a suitable amount of carrier so as to provide the form for proper administration to the patient. The formulation should suit the mode of administration. In a preferred embodiment, the composition is formulated in accordance with routine procedures as a pharmaceutical composition adapted for intravenous administration to 15 human beings. Typically, compositions for intravenous administration are solutions in sterile isotonic aqueous buffer. Where necessary, the composition may also include a solubilizing agent and a local anesthetic such as lignocamne to ease pain at the site of the injection. Generally, the ingredients of compositions of the invention are supplied either 20 separately or mixed together in unit dosage form, for example, as a dry lyophilized powder or water free concentrate in a hermetically sealed container such as an ampoule or sachette indicating the quantity of active agent. Where the composition is to be administered by infusion, it can be dispensed with an infusion bottle containing sterile pharmaceutical grade water or saline. Where the composition is administered by injection, an ampoule of sterile 25 water for injection or saline can be provided so that the ingredients may be mixed prior to 'The compositions o'he'invenfion can'be formilated as neutrii or silt'forms. Pharmaceutically acceptable salts include those fonned with anions such as those derived from hydrochloric, phosphoric, acetic, oxalic, tartaric acids, etc., and those formed with 30 cations such as those derived from sodium, potassium, ammonium, calcium, ferric hydroxides, isopropylamine, triethylamine, 2-ethylamino ethanol, histidine, procaine, etc. The amount of the composition of the invention which will be effective in the treatment, prevention or amelioration of one or more symptoms associated with a RSV infection can be determined by standard clinical techniques. For example, the dosage of the 35 composition which will be effective in the treatment, prevention or amelioration of one or - 90 more symptoms associated with a RSV infection can be determined by administering the composition to a cotton rat, measuring the RSV titer after challenging the cotton rat with 101 pfu of RSV and comparing the RSV titer to that obtain for a cotton rat not administered the composition. Accordingly, a dosage that results in a 2 log decrease or a 99% reduction 5 in RSV titer in the cotton rat challenged with 10' pfu of RSV relative to the cotton rat challenged with 10' pfu of RSV but not administered the composition is the dosage of the composition that can be administered to a human for the treatment, prevention or amelioration of symptoms associated with RSV infection. The dosage of the composition which will be effective in the treatment, prevention or amelioration of one or more 10 symptoms associated with a RSV infection can be determined by administering the composition to an animal model (e.g., a cotton rat or money) and measuring the serum titer of antibodies or fragments thereof that immunospecifically bind to a RSV antigen. Accordingly, a dosage of the composition that results in a serum titer of at least 1 jig/ml, preferably 2 pg/ml, 5 pg/mI, 10 [ig/mt, 20 ig/ml, 25 jig/ml, at least 35 pg/ml, at least 40 15 gg/ml, at least 50 pg/ml, at least 75 jig/ml, at least 100 pg/ml, at least 125 pg/ml, at least 150 pg/ml, at least 200 pg/ml, at least 250 jg/ml, at least 300 jg/ml, at least 350 pg/ml, at least 400 pg/ml, or at least 450 pg/mI can be administered to a human for the treatment, prevention or amelioration of one or more symptoms associated with RSV infection. In addition, in vitro assays may optionally be employed to help identify optimal dosage ranges. 20 The precise dose to be employed in the formulation will also depend on the route of administration, and the seriousness of the RSV infection, and should be decided according to the judgment of the practitioner and each patient's circumstances. Effective doses may be extrapolated from dose-response curves derived from in vitro or animal model (e.g., the cotton rat or Cynomolgous monkey) test systems. 25 For antibodies, the dosage administered to a patient is typically 0.1 mg/kg to 100 between 'G.' lYrg)kga '2&mgU g -f the-patiergs b-ody-p 'l -mgikg 10 mg/kg of the patient's body weight. Generally, human antibodies have a longer half-life within the human body than antibodies from other species due to the immune response to 30 the foreign polypeptides. Thus, lower dosages of human antibodies and less frequent administration is often possible. Further, the dosage and frequency of administration of antibodies of the invention or fragments thereof may be reduced by enhancing uptake and tissue penetration (e.g., into the lung) of the antibodies by modifications such as, for example, lipidation. 35 -91 - In a specific embodiment, antibodies of the invention or fragments thereof, or compositions comprising antibodies of the invention or fragments thereof are administered once a month just prior to or during the RSV season. In another embodiment, antibodies of the invention or fragments thereof, or compositions comprising antibodies of the invention 5 or fragments thereof are administered every two months just prior to or during the RSV season. In yet another embodiment, antibodies of the invention or fragments thereof, or compositions comprising antibodies of the invention or fragments thereof are administered once just prior to or during the RSV season. The term "RSV season" refers to the season when RSV infection is most likely to occur. Typically, the RSV season in the northern 10 hemisphere commences in November and lasts through April. In one embodiment, approximately 5 mg/kg or less (preferably 1.5 mg/kg or less) of an antibody or fragment thereof which immunospecifically binds to a RSV antigen with a higher avidity and/or higher affinity than previously known antibodies such as, e.g., SYNAGIS@, is administered five times, 3 times, or I to 2 times during a RSV season to a 15 mammal, preferably a human. In another embodiment, approximately 1.5 mg/kg of an antibody or a fragment thereof which immunospecifically binds to a RSV antigen with a higher avidity and/or a higher affinity than known antibodies such as, e.g., SYNAGIS@, is administered monthly five times during an RSV season to a mammal, preferably a human, intramuscularly. In another embodiment, 3 mg/kg of an antibody or a fragment thereof 20 which immunospecifically binds to a RSV antigen with a higher avidity and/or a higher affinity than known antibodies such as, e.g., SYNAGIS@ is administered monthly three times during an RSV season to a mammal, preferably a human, intramuscularly. In yet another embodiment, 5 mg/kg of an antibody or a fragment thereof which immunospecifically binds to a RSV antigen with a higher avidity and/or a higher affinity 25 than known antibodies such as, e.g., SYNAGIS@ is administered monthly one to two times during ari'RSY season'to a mammal, prefterily A'human, 'iritramusciniafiy. In a specific embodiment, 15 mg/kg of HL-SYNAGIS or an antigen-binding fragment thereof is administered to a mammal, preferably a human, intramuscularly five times during an RSV season. In another embodiment, approximately 5 mg/kg or less 30 (preferably 1.5 mg/kg or less) of an antibody or fragment thereof which immunospecifically binds to a RSV antigen with a higher avidity and/or higher affinity than previously known antibodies such as, e.g., SYNAGIS@, is administered five times, 3 times, or I to 2 times during a RSV season to a mammal, preferably a human. In another embodiment, 3 mg/kg of antibody or a fragment thereof which immunospecifically binds to a RSV antigen with a 35 higher avidity and/or a higher affinity known antibodies such as, e.g., SYNAGIS@ and - 92 which has an increased in vivo half-life is administered monthly three times during an RSV season to a mammal, preferably a human, intramuscularly. In another embodiment, 5 mg/kg of antibody or a fragment thereof which immunospecifically binds to a RSV antigen with a higher avidity and/or a higher affinity than known antibodies such as, e.g., SYNAGIS@ and 5 which has an increased in vivo half-life is administered to a mammal, preferably a human, intramuscularly twice times during an RSV season. In a specific embodiment, an approximately 15 mg/kg bolus of SYNAGIS@ or an antigen-binding fragment thereof not in a sustained release formulation is administered to a manual, preferably a human, and after a certain period of time less than 15 mg/kg 10 (preferably 5 mg/kg or less, more preferably 3 mg/kg or less, and most preferably 1.5 mg/kg or less) of SYNAGIS@ or an antibody fragment in a sustained release is administered to said mammal intramuscularly two, three or four times during an RSV season. In accordance with this embodiment, a certain period of time can be 1 to 5 days, a week, two weeks, or a month. In another embodiment, approximately 15 mg/kg or less (preferably at least 2 15 mg/kg, at least 5 mg/kg, or at least 10 mg/kg) of SYNAGIS@ or an antigen-binding fragment thereof in a sustained release formulation is administered to a mammal, preferably a human, intramuscularly two, three or four times during an RSV season. In another embodiment, approximately 15 mg/kg or less (preferably at least 2 mg/kg, at least 5 mg/kg, or at least 10 mg/kg) of one or more antibodies or fragments thereof which 20 immunospecifically bind to one or more RSV antigens is administered to the lungs of a mammal by pulmonary delivery and then after a certain period of time (e.g., 15 minutes, 30 minutes, 45 minutes, I hour, 6 hours, 12 hours, 1 day, 5 days, 10 days, 20 days, 25 days, 30 days, or 40 days) approximately 15 mg/kg or less of one or more said antibodies or antibody fragments is administered intramusclarly said mammal. In another embodiment, 25 approximately 15 mg/kg or less (preferably at least 2 mg/kg, at least 5 mg/kg, or at least 10 ng/kg) of. nesr xmore.antibo.dies. r.fragmnts.thenmf which-immunosprcifally.hind.lo .3U0r'm RS V aig e s admi niend Ia-m ammii itru mui yad-han-.m certain period of time (e.g., 15 minutes, 30 minutes, 45 minutes, 1 hour, 6 hours, 12 hours, 1 day, 5 days, 10 days, 20 days, 25 days, 30 days, or 40 days) approximately 15 mg/kg or less 30 of one or more said antibodies or antibody fragments is administered to the lungs of said manual. 5.3.1. Gene Therapy In a specific embodiment, nucleic acids comprising sequences encoding antibodies 35 or functional derivatives thereof, are administered to treat, prevent or ameliorate one or - 93 more symptoms associated with RSV infection, by way of gene therapy. Gene therapy refers to therapy performed by the administration to a subject of an expressed or expressible nucleic acid. In this embodiment of the invention, the nucleic acids produce their encoded antibody or antibody fragment that mediates a prophylactic or therapeutic effect. 5 Any of the methods for gene therapy available in the art can be used according to the present invention. Exemplary methods are described below. For general reviews of the methods of gene therapy, see Goldspiel et al., 1993, Clinical Pharmacy 12:488-505; Wu and Wu, 1991, Biotherapy 3:87-95; Tolstoshev, 1993, Ann. Rev. Pharmacol. Toxicol. 32:573-596; Mulligan, Science 260:926-932 (1993); and 10 Morgan and Anderson, 1993, Ann. Rev. Biochem. 62:191-217; May, 1993, TIBTECH 11(5):155-215. Methods counonly known in the art of recombinant DNA technology which can be used are described in Ausubel et al. (eds.), Current Protocols in Molecular Biology, John Wiley & Sons, NY (1993); and Kriegler, Gene Transfer and Expression, A Laboratory Manual, Stockton Press, NY (1990). 15 In a preferred aspect, a composition of the invention comprises nucleic acids encoding an antibody, said nucleic acids being part of an expression vector that expresses the antibody or fragments or chimeric proteins or heavy or light chains thereof in a suitable host. In particular, such nucleic acids have promoters, preferably heterologous promoters, operably linked to the antibody coding region, said promoter being inducible or constitutive, 20 and, optionally, tissue- specific. In another particular embodiment, nucleic acid molecules are used in which the antibody coding sequences and any other desired sequences are flanked by regions that promote homologous recombination at a desired site in the genome, thus providing for intrachromosomal expression of the antibody encoding nucleic acids (Koller and Smithies, 1989, Proc. Natl. Acad. Sci. USA 86:8932-8935; ZijIstra et al., 1989, 25 Nature 342:435-438). In specific embodiments, the expressed antibody molecule is a single ine'neavy and'iight endins, or fragments theredf, ofne anti'oody. Delivery of the nucleic acids into a subject may be either direct, in which case the subject is directly exposed to the nucleic acid or nucleic acid-carrying vectors, or indirect, in 30 which case, cells are first transformed with the nucleic acids in vitro, then transplanted into the subject. These two approaches are known, respectively, as in vivo or ex vivo gene therapy. In a specific embodiment, the nucleic acid sequences are directly administered in vivo, where it is expressed to produce the encoded product. This can be accomplished by 35 any of numerous methods known in the art, e.g., by constructing them as part of an - 94 appropriate nucleic acid expression vector and administering it so that they become intracellular, e.g., by infection using defective or attenuated retrovirals or other viral vectors (see U.S. Patent No. 4,980,286), or by direct injection of naked DNA, or by use of microparticle bombardment (e.g., a gene gun; Biolistic, Dupont), or coating with lipids or 5 cell-surface receptors or transfecting agents, encapsulation in liposomes, microparticles, or microcapsules, or by administering them in linkage to a peptide which is known to enter the nucleus, by administering it in linkage to a ligand subject to receptor-mediated endocytosis (see, e.g., Wu and Wu, 1987, J. Biol. Chem. 262:4429-4432) (which can be used to target cell types specifically expressing the receptors), etc. In another embodiment, nucleic acid 10 ligand complexes can be formed in which the ligand comprises a fusogenic viral peptide to disrupt endosomes, allowing the nucleic acid to avoid lysosomal degradation. In yet another embodiment, the nucleic acid can be targeted in vivo for cell specific uptake and expression, by targeting a specific receptor (see, e.g., PCT Publications WO 92/06180; WO 92/22635; W092/203 16; W093/14188, WO 93/20221). Alternatively, the nucleic acid can be 15 introduced intracellularly and incorporated within host cell DNA for expression, by homologous recombination (Koller and Smithies, 1989, Proc. Natl. Acad. Sci. USA 86:8932-8935; and Zijlstra et al., 1989, Nature 342:435-438). In a specific embodiment, viral vectors that contains nucleic acid sequences encoding an antibody of the invention or fragments thereof are used. For example, a retroviral vector .20 can be used (see Miller et al., 1993, Meth. Enzymol. 217:581-599). These retroviral vectors contain the components necessary for the correct packaging of the viral genome and integration into the host cell DNA. The nucleic acid sequences encoding the antibody to be used in gene therapy are cloned into one or more vectors, which facilitates delivery of the gene into a subject. More detail about retroviral vectors can be found in Boesen et al., 1994, 25 Biotherapy 6:291-302, which describes the use of a retroviral vector to deliver the mdr 1 e.e .ta.b rats.paietic.te.w.ells.in rer.to .make.the.stb amcells.more.resist.antto Clowes et al., 1994, J. Clin. Invest. 93:644-65 1; Klein et al., 1994, Blood 83:1467-1473; Salmons and Gunzberg, 1993, Human Gene Therapy 4:129-141; and Grossman and Wilson, 30 1993, Curr. Opin. in Genetics and Devel. 3:110-114. Adenoviruses are other viral vectors that can be used in gene therapy. Adenoviruses are especially attractive vehicles for delivering genes to respiratory epithelia. Adenoviruses naturally infect respiratory epithelia where they cause a mild disease. Other targets for adenovirus-based delivery systems are liver, the central nervous system, endothelial cells, 35 and muscle. Adenoviruses have the advantage of being capable of infecting non-dividing - 95 cells. Kozarsky and Wilson, 1993, Current Opinion in Genetics and Development 3:499 503 present a review of adenovirus-based gene therapy. Bout et al., 1994, Human Gene Therapy 5:3-10 demonstrated the use of adenovirus vectors to transfer genes to the respiratory epithelia of rhesus monkeys. Other instances of the use of adenoviruses in gene 5 therapy can be found in Rosenfeld et al., 1991, Science 252:431-434; Rosenfeld et al., 1992, Cell 68:143-155; Mastrangeli et al., 1993, J. Clin. Invest. 91:225-234; PCT Publication W094/12649; and Wang et al., 1995, Gene Therapy 2:775-783. In a preferred embodiment, adenovirus vectors are used. Adeno-associated virus (AAV) has also been proposed for use in gene therapy 10 (Walsh et al., 1993, Proc. Soc. Exp. Biol. Med. 204:289-300; and U.S. Patent No. 5,436,146). Another approach to gene therapy involves transferring a gene to cells in tissue culture by such methods as electroporation, lipofection, calcium phosphate mediated transfection, or viral infection. Usually, the method of transfer includes the transfer of a 15 selectable marker to the cells. The cells are then placed under selection to isolate those cells that have taken up and are expressing the transferred gene. Those cells are then delivered to a subject. In this embodiment, the nucleic acid is introduced into a cell prior to administration in vivo of the resulting recombinant cell. Such introduction can be carried out by any 20 method known in the art, including but not limited to transfection, electroporation, microinjection, infection with a viral or bacteriophage vector containing the nucleic acid sequences, cell fusion, chromosome-mediated gene transfer, microcellmediated gene transfer, spheroplast fusion, etc. Numerous techniques are known in the art for the introduction of foreign genes into cells (see, e.g., Loeffler and Behr, 1993, Meth. Enzymol. 25 217:599-618; Cohen et al., 1993, Meth. Enzymol. 217:618-644; Clin. Pharma. Ther. 29:69 (921985)yandmnay'b-usedi irrac-codance v/ith Vne presenftinvenfion, proilided that the necessary developmental and physiological functions of the recipient cells are not disrupted. The technique should provide for the stable transfer of the nucleic acid to the cell, so that the nucleic acid is expressible by the cell and preferably heritable and expressible by its cell 30 progeny. The resulting recombinant cells can be delivered to a subject by various methods known in the art. Recombinant blood cells (e.g., hematopoietic stem or progenitor cells) are preferably administered intravenously. The amount of cells envisioned for use depends on the desired effect, patient state, etc., and can be determined by one skilled in the art. 35 - 96 - Cells into which a nucleic acid can be introduced for purposes of gene therapy encompass any desired, available cell type, and include but are not limited to epithelial cells, endothelial cells, keratinocytes, fibroblasts, muscle cells, hepatocytes; blood cells such as T lymphocytes, B lymphocytes, monocytes, macrophages, neutrophils, eosinophils, 5 megakaryocytes, granulocytes; various stem or progenitor cells, in particular hematopoietic stem or progenitor cells, e.g., as obtained from bone marrow, umbilical cord blood, peripheral blood, fetal liver, etc. In a preferred embodiment, the cell used for gene therapy is autologous to the subject. 10 In an embodiment in which recombinant cells are used in gene therapy, nucleic acid sequences encoding an antibody or fragment thereof are introduced into the cells such that they are expressible by the cells or their progeny, and the recombinant cells are then administered in vivo for therapeutic effect. In a specific embodiment, stein or progenitor cells are used. Any stein and/or progenitor cells which can be isolated and maintained in 15 vitro can potentially be used in accordance with this embodiment of the present invention (see e.g., PCT Publication WO 94/08598; Stemple and Anderson, 1992, Cell 7 1:973-985; Rheinwald, 1980, Meth. Cell Bio. 21A:229; and Pittelkow and Scott, 1986, Mayo Clinic Proc. 61:771). In a specific embodiment, the nucleic acid to be introduced for purposes of gene 20 therapy comprises an inducible promoter operably linked to the coding region, such that expression of the nucleic acid is controllable by controlling the presence or absence of the appropriate inducer of transcription. 5.4. Antibody Characterization and Demonstration 25 of Therapeutic or Prophylactic Utility Antibodies of the present invention or fragments thereof may be characterized in a v.etv Cf ways. lupaicur..ani.hdies.l hbe.inventian at.fagment.teof.may he assayed for the ability to immunospecifically bind to a RSV antigen. Such an assay may be performed in solution (e.g., Houghten, 1992, Bio/Techniques 13:412-421), on beads (Lam, 30 1991, Nature 354:82-84), on chips (Fodor, 1993, Nature 364:555-556), on bacteria (U.S. Patent No. 5,223,409), on spores (U.S. Patent Nos. 5,571,698; 5,403,484; and 5,223,409), on plasmids (Cull et al., 1992, Proc. Nati. Acad. Sci. USA 89:1865-1869) or on phage (Scott and Smith, 1990, Science 249:386-390; Devlin, 1990, Science 249:404-406; Cwirla et al., 1990, Proc. Natl. Acad. Sci. USA 87:6378-6382; and Felici, 1991, J. Mol. Biol. 35 222:301-310) (each of these references is incorporated herein in its entirety by reference). Antibodies or fiagments thereof that have been identified to immunospecifically bind to a - 97 - RSV antigen or a fragment thereof can then be assayed for their specificity and affinity for a RSV antigen. The antibodies of the invention or fragments thereof may be assayed for immunospecific binding to a RSV antigen and cross-reactivity with other antigens by any 5 method known in the art. Immunoassays which can be used to analyze inmunospecific binding and cross-reactivity include, but are not limited to, competitive and non-competitive assay systems using techniques such as western blots, radioimmunoassays, ELISA (enzyme linked imrmunosorbent assay), "sandwich" inmunoassays, immunoprecipitation assays, precipitin reactions, gel diffusion precipitin reactions, immunodiffusion assays, 10 agglutination assays, complement-fixation assays, inununoradiometric assays, fluorescent imnunoassays, protein A immunoassays, to name but a few. Such assays are routine and well known in the art (see, e.g., Ausubel et al, eds, 1994, Current Protocols in Molecular Biology, Vol. 1, John Wiley & Sons, Inc., New York, which is incorporated by reference herein in its entirety). Exemplary imnunoassays are described briefly below (but are not 15 intended by way of limitation). Immunoprecipitation protocols generally comprise lysing a population of cells in a lysis buffer such as RIPA buffer (1% NP-40 or Triton X-100, 1% sodium deoxycholate, 0.1% SDS, 0.15 M NaCl, 0.01 M sodium phosphate at pH 7.2, 1% Trasylol) supplemented with protein phosphatase and/or protease inhibitors (e.g., EDTA, PMSF, aprotinin, sodium 20 vanadate), adding the antibody of interest to the cell lysate, incubating for a period of time (e.g., I to 4 hours) at 40" C, adding protein A and/or protein G sepharose beads to the cell lysate, incubating for about an hour or more at 40* C, washing the beads in lysis buffer and resuspending the beads in SDS/sample buffer. The ability of the antibody of interest to imnunoprecipitate a particular antigen can be assessed by, e.g., western blot analysis. One 25 of skill in the art would be knowledgeable as to the parameters that can be modified to - Siexae-th-bidin-f the wntibod-yu -a'rr arfdigen -anidcraeiadgnn=7 g,-8 cieaing ie c&1iysate -iiin sepharose'beads). -For fudffher &scussion regarding immunoprecipitation protocols see, e.g., Ausubel et al, eds, 1994, Current Protocols in Molecular Biology, Vol. 1, John Wiley & Sons, Inc., New York at 10.16.1. 30 Western blot analysis generally comprises preparing protein samples, electrophoresis of the protein samples in a polyacrylaniide gel (e.g., 8%- 20% SDS-PAGE depending on the molecular weight of the antigen), transferring the protein sample from the polyacrylamide gel to a membrane such as nitrocellulose, PVDF or nylon, blocking the membrane in blocking solution (e.g., PBS with 3% BSA or non-fat milk), washing the membrane in 35 washing buffer (e.g., PBS-Tween 20), blocking the membrane with primary antibody (the -98antibody of interest) diluted in blocking buffer, washing the membrane in washing buffer, blocking the membrane with a secondary antibody (which recognizes the primary antibody, e.g., an anti-human antibody) conjugated to an enzymatic substrate (e.g., horseradish peroxidase or alkaline phosphatase) or radioactive molecule (e.g., "P or "I) diluted in 5 blocking buffer, washing the membrane in wash buffer, and detecting the presence of the antigen. One of skill in the art would be knowledgeable as to the parameters that can be modified to increase the signal detected and to reduce the background noise. For further discussion regarding western blot protocols see, e.g., Ausubel et al, eds, 1994, Current Protocols in Molecular Biology, Vol. 1, John Wiley & Sons, Inc., New York at 10.8.1. 10 ELISAs comprise preparing antigen, coating the well of a 96 well microtiter plate with the antigen, adding the antibody of interest conjugated to a detectable compound such as an enzymatic substrate (e.g., horseradish peroxidase or alkaline phosphatase) to the well and incubating for a period of time, and detecting the presence of the antigen. In ELISAs the antibody of interest does not have to be conjugated to a detectable compound; instead, a 15 second antibody (which recognizes the antibody of interest) conjugated to a detectable compound may be added to the well. Further, instead of coating the well with the antigen, the antibody may be coated to the well. In this case, a second antibody conjugated to a detectable compound may be added following the addition of the antigen of interest to the coated well. One of skill in the art would be knowledgeable as to the parameters that can be 20 modified to increase the signal detected as well as other variations of ELISAs known in the art. For further discussion regarding ELISAs see, e.g., Ausubel et al, eds, 1994, Current Protocols in Molecular Biology, Vol. 1, John Wiley & Sons, Inc., New York at 11.2.1. The binding affinity of an antibody to an antigen and the off-rate of an antibody antigen interaction can be determined by competitive binding assays. One example of a 25 competitive binding assay is a radioimmunoassay comprising the incubation of labeled -antigen'te.g., -r-wh th atbdy Miiee~rh-rsaeisnrain-aou of unlabeled antigen, and the detection of the antibody bound to the labeled antigen. Ihe affinity of the antibody of the present invention or a fragment thereof for a RSV antigen and the binding off-rates can be determined from the data by scatchard plot analysis. 30 Competition with a second antibody can also be determined using radioimmunoassays. In this case, a RSV antigen is incubated with an antibody of the present invention or a fragment thereof conjugated to a labeled compound (e.g., 3 H or ") in the presence of increasing amounts of an unlabeled second antibody. In a preferred embodiment, BlAcore kinetic analysis is used to determine the binding 35 on and off rates of antibodies or fragments thereof to a RSV antigen. BlAcore kinetic - 99 analysis comprises analyzing the binding and dissociation of a RSV antigen from chips with immobilized antibodies or fragments thereof on their surface (see the Example section infra). The antibodies of the invention or fragments thereof can also be assayed for their 5 ability to inhibit the binding of RSV to its host cell receptor using techniques known to those of skill in the art. For example, cells expressing the receptor for RSV can be contacted with RSV in the presence or absence of an antibody or fragment thereof and the ability of the antibody or fragment thereof to inhibit RSV's binding can measured by, for example, flow cytometry or a scintillation assay. RSV (e.g., a RSV antigen such as F 10 glycoprotein or G glycoprotein) or the antibody or antibody fragment can be labeled with a detectable compound such as a radioactive label (e.g., 3 2 p, 3 5 S, and 1251) or a fluorescent label (e.g., fluorescein isothiocyanate, rhodamine, phycoerythrin, phycocyanin, allophycocyanin, 9-phthaldehyde and fluorescamine) to enable detection of an interaction between RSV and its host cell receptor. Alternatively, the ability of antibodies or fragments 15 thereof to inhibit RSV from binding to its receptor can be determined in cell-free assays. For example, RSV or a RSV antigen such as G glycoprotein can be contacted with an antibody or fragment thereof and the ability of the antibody or antibody fragment to inhibit RSV or the RSV antigen from binding to its host cell receptor can be determined. Preferably, the antibody or the antibody fragment is immobilized on a solid support and 20 RSV or a RSV antigen is labeled with a detectable compound. Alternatively, RSV or a RSV antigen is immobilized on a solid support and the antibody or fragment thereof is labeled with a detectable compound. RSV or a RSV antigen may be partially or completely purified (e.g., partially or completely free of other polypeptides) or part of a cell lysate. Further, an RSV antigen may be a fusion protein comprising the RSV antigen and a domain 25 such as glutathionine-S-transferase. Alternatively, an RSV antigen can be biotinylated Cheniics;kRodkfbrd'). The antibodies of the invention or fragments thereof can also be assayed for their ability to inhibit or downregulate RSV replication using techniques known to those of skill 30 in the art. For example, RSV replication can be assayed by a plaque assay such as described, e.g., by Johnson et al., 1997, Journal of Infectious Diseases 176:1215-1224. The antibodies of the invention or fragments thereof can also be assayed for their ability to inhibit or downregulate the expression of RSV polypeptides. Techniques known to those of skill in the art, including, but not limited to, Western blot analysis, Northern blot analysis, 35 and RT-PCR can be used to measure the expression of RSV polypeptides. Further, the - 100antibodies of the invention or fragments thereof can be assayed for their ability to prevent the formation of syncytia. The antibodies of the invention or fragments thereof are preferably tested in vitro, and then in vivo for the desired therapeutic or prophylactic activity, prior to use in humans. 5 For example, in vitro assays which can be used to determine whether administration of a specific antibody or composition of the present invention is indicated, include in vitro cell culture assays in which a subject tissue sample is grown in culture, and exposed to or otherwise administered an antibody or composition of the present invention, and the effect of such an antibody or composition of the present invention upon the tissue sample is 10 observed. In various specific embodiments, in vitro assays can be carried out with representative cells of cell types involved in a RSV infection (e.g., respiratory epithelial cells), to determine if an antibody or composition of the present invention has a desired effect upon such cell types. Preferably, the antibodies or compositions of the invention are also tested in in vitro assays and animal model systems prior to administration to humans. 15 In a specific embodiment, cotton rats are administered an antibody the invention or fragment thereof, or a composition of the invention, challenged with 10' pfu of RSV, and four or more days later the rats are sacrificed and RSV titer and anti-RSV antibody serum titer is determined. Further, in accordance with this embodiment, the tissues (e.g., the lung tissues) from the sacrificed rats can be examined for histological changes. .20 In accordance with the invention, clinical trials with human subjects need not be perfonned in order to demonstrate the prophylactic and/or therapeutic efficacy of antibodies of the invention or fragments thereof. In vitro and animal model studies using the antibodies or fragments thereof can be extrapolated to humans and are sufficient for demonstrating the prophylactic and/or therapeutic utility of said antibodies or antibody 25 fragments. .Antihadimacnampasitinsa f.the seat .inetianfarmein .thwe y caa .e.tested fo'hitxct in sviitablye'ardmrahnovdel -systemrs,'icldigbuty",-nt-kl -o-rats ;mUioe, cows, monkeys, and rabbits. For in vivo testing of an antibody or composition's toxicity any animal model system known in the art may be used. 30 Efficacy in treating or preventing viral infection may be demonstrated by detecting the ability of an antibody or composition of the invention to inhibit the replication of the virus, to inhibit transmission or prevent the virus from establishing itself in its host, to reduce the incidence of RSV infection, or to prevent, ameliorate or alleviate one or more symptoms associated with RSV infection. The treatment is considered therapeutic if there 35 is, for example, a reduction is viral load, amelioration of one or more symptoms, a reduction - 101 in the duration of a RSV infection, or a decrease in mortality and/or morbidity following administration of an antibody or composition of the invention. Further, the treatment is considered therapeutic if there is an increase in the immune response following the administration of one or more antibodies or fragments thereof which immunospecifically 5 bind to one or more RSV antigens. Antibodies or compositions of the invention can be tested in vitro and in vivo for the ability to induce the expression of cytokines such as IFN-cc, IFN-P, IFN-y, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-12 and IL-15. Techniques known to those of skill in the art can be used to measure the level of expression of cytokines. For example, the level 10 of expression of cytokines can be measured by analyzing the level of RNA of cytokines by, for example, RT-PCR and Northern blot analysis, and by analyzing the level of cytokines by, for example, imnunoprecipitation followed by westem blot analysis and ELISA. In a preferred embodiment, an antibody or composition of the invention is tested for its ability to induce the expression of IFN-y. 15 Antibodies or compositions of the invention can be tested in vitro and in vivo for their ability to modulate the biological activity of immune cells, preferably human immune cells (e.g., T-cells, B-cells, and Natural Killer cells). The ability of an antibody or composition of the invention to modulate the biological activity of immune cells can be assessed by detecting the expression of antigens, detecting the proliferation of immune 20 cells, detecting the activation of signaling molecules, detecting the effector function of immune cells, or detecting the differentiation of immune cells. Techniques known to those of skill in the art can be used for measuring these activities. For example, cellular proliferation can be assayed by 3 H-thymidine incorporation assays and trypan blue cell counts. Antigen expression can be assayed, for example, by immunoassays including, but 25 are not limited to, competitive and non-competitive assay systems using techniques such as "WestenJthisi nximmnscfoeraassay), '"SxiWLsandridi' irnmnassays,munop1cipatn assays,- i reactions, gel diffusion precipitin reactions, immunodiffusion assays, agglutination assays, complement-fixation assays, immunoradiometric assays, fluorescent immunoassays, 30 protein A immunoassays and FACS analysis. The activation of signaling molecules can be assayed, for example, by kinase assays and electrophoretic shift assays (EMSAs). Antibodies or compositions of the invention can also be tested for their ability to inhibit viral replication or reduce viral load in in vitro, ex vivo and in vivo assays. Antibodies or compositions of the invention can also be tested for their ability to decrease 35 the time course of RSV infection. Antibodies or compositions of the invention can also be -102tested for their ability to increase the survival period of humans suffering from RSV infection by at least 25%, preferably at least 50%, at least 60%, at least 75%, at least 85%, at least 95%, or at least 99%. Further, antibodies or compositions of the invention can be tested for their ability reduce the hospitalization period of humans suffering from RSV 5 infection by at least 60%, preferably at least 75%, at least 85%, at least 95%, or at least 99%. Techniques known to those of skill in the art can be used to analyze the function of the antibodies or compositions of the invention in vivo. 5.5. Diagnostic Uses of Antibodies 10 Labeled antibodies, fragments and derivatives and analogs thereof, which immunospecifically bind to a RSV antigen can be used for diagnostic purposes to detect, diagnose, or monitor a RSV infection. The invention provides for the detection of a RSV infection, comprising: (a) assaying the expression of a RSV antigen in cells or a tissue sample of a subject using one or more antibodies or fragments thereof that 15 immunospecifically bind to the RSV antigen; and (b) comparing the level of the RSV antigen with a control level, e.g., levels in normal tissue samples not infected with RSV, whereby an increase in the assayed level of RSV antigen compared to the control level of the RSV antigen is indicative of a RSV infection. The invention provides a diagnostic assay for diagnosing a RSV infection, 20 comprising: (a) assaying for the level of a RSV antigen in cells or a tissue sample of an individual using one or more antibodies or fragments thereof that immunospecifically bind to a RSV antigen; and (b) comparing the level of the RSV antigen with a control level, e.g., levels in normal tissue samples not infected with RSV, whereby an increase in the assayed RSV antigen level compared to the control level of the RSV antigen is indicative of a RSV 25 infection. A more definitive diagnosis of RSV infection may allow health professionals to Antibodies of the invention or fragments thereof can be used to assay RSV antigen levels in a biological sample using classical inmmunohistological methods as described 30 herein or as known to those of skill in the art (e.g., see Jalkanen et al., 1985, J. Cell. Biol. 101:976-985; and Jalkanen et al., 1987, J. Cell . Biol. 105:3087-3096). Other antibody based methods useful for detecting protein gene expression include imrmunoassays, such as the enzyme linked immunosorbent assay (ELISA) and the radioinununoassay (RIA). Suitable antibody assay labels are known in the art and include enzyme labels, such as, 35 glucose oxidase; radioisotopes, such as iodine (1S, 1211), carbon ("C), sulfur (3S), tritium -103- (3H), indium (1' 1 n), and technetium C 9 Tc); luminescent labels, such as luminol; and fluorescent labels, such as fluorescein and rhodamine, and biotin. One aspect of the invention is the detection and diagnosis of a RSV infection in a human. In one embodiment, diagnosis comprises: a) administering (for example, 5 parenterally, subcutaneously, or intraperitoneally) to a subject an effective amount of a labeled antibody or fragment thereof that immunospecifically binds to a RSV antigen; b) waiting for a time interval following the administering for permitting the labeled antibody or fragment thereof to preferentially concentrate at sites in the subject (e.g., the lungs) where the RSV antigen is expressed (and for unbound labeled molecule to be cleared to 10 background level); c) determining background level; and d) detecting the labeled antibody or fragment thereof in the subject, such that detection of labeled antibody or fragment thereof above the background level indicates that the subject has a RSV infection. Background level can be determined by various methods including, comparing the amount of labeled molecule detected to a standard value previously determined for a particular 15 system. It will be understood in the art that the size of the subject and the imaging system used will determine the quantity of imaging moiety needed to produce diagnostic images. In the case of a radioisotope moiety, for a human subject, the quantity of radioactivity injected will normally range from about 5 to 20 millicuries of "Tc. The labeled antibody or 20 antibody fragment will then preferentially accumulate at the location of cells which contain the specific protein. In vivo tumor imaging is described in S.W. Burchiel et al., "Immunopharmacokinetics of Radiolabeled Antibodies and Their Fragments." (Chapter 13 in Tumor Imaging: The Radiochenical Detection of Cancer, S.W. Burchiel and B. A. Rhodes, eds., Masson Publishing Inc. (1982). 25 Depending on several variables, including the type of label used and the mode of ainiiistration, 'the ime'intervadT6'fTosing'the adnfiiiistrafion Tor perniltfing thelsbdied molecule to preferentially concentrate at sites in the subject and for unbound labeled molecule to be cleared to background level is 6 to 48 hours or 6 to 24 hours or 6 to 12 hours. In another embodiment the time interval following administration is 5 to 20 days or 30 5 to 10 days. In one embodiment, monitoring of a RSV infection is carried out by repeating the method for diagnosing the RSV infection, for example, one month after initial diagnosis, six months after initial diagnosis, one year after initial diagnosis, etc. Presence of the labeled molecule can be detected in the subject using methods known 35 in the art for in vivo scanning. These methods depend upon the type of label used. Skilled - 104 artisans will be able to determine the appropriate method for detecting a particular label. Methods and devices that may be used in the diagnostic methods of the invention include, but are not limited to, computed tomography (CT), whole body scan such as position emission tomography (PET), magnetic resonance imaging (MRI), and sonography. 5 In a specific embodiment, the molecule is labeled with a radioisotope and is detected in the patient using a radiation responsive surgical instrument (Thurston et al., U.S. Patent No. 5,441,050). In another embodiment, the molecule is labeled with a fluorescent compound and is detected in the patient using a fluorescence responsive scanning instrument. In another embodiment, the molecule is labeled with a positron emitting metal 10 and is detected in the patient using positron emission-tomography. In yet another embodiment, the molecule is labeled with a paramagnetic label and is detected in a patient using magnetic resonance imaging (MRI). 5.6. Methods Producing Antibodies 15 The antibodies of the invention or fragments thereof can be produced by any method known in the art for the synthesis of antibodies, in particular, by chemical synthesis or preferably, by recombinant expression techniques. Polyclonal antibodies to a RSV antigen can be produced by various procedures well known in the art. For example, a RSV antigen can be administered to various host animals 20 including, but not limited to, rabbits, mice, rats, etc. to induce the production of sera containing polyclonal antibodies specific for the RSV antigen. Various adjuvants may be used to increase the immunological response, depending on the host species, and include but are not limited to, Freund's (complete and incomplete), mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, 25 peptides, oil emulsions, keyhole limpet hemocyanins, dinitrophenol, and potentially useful Sudh adjuvantcs are aiso weilrauwn In ne an1. Monoclonal antibodies can be prepared using a wide variety of techniques known in the art including the use of hybridoma, recombinant, and phage display technologies, or a 30 combination thereof. For example, monoclonal antibodies can be produced using hybridoina techniques including those known in the art and taught, for example, in Harlow et al., Antibodies: A Laboratory Manual, (Cold Spring Harbor Laboratory Press, 2nd ed. 1988); Hammerling, et al., in: Monoclonal Antibodies and T-Cell Hybridomas 563-681 (Elsevier, N.Y., 1981) (said references incorporated by reference in their entireties). The 35 term "monoclonal antibody" as used herein is not limited to antibodies produced through - 105 hybridoma technology. The term "monoclonal antibody" refers to an antibody that is derived from a single clone, including any eukaryotic, prokaryotic, or phage clone, and not the method by which it is produced. Methods for producing and screening for specific antibodies using hybridoma S technology are routine and well known in the art. Briefly, mice can be immunized with a RSV antigen and once an immune response is detected, e.g., antibodies specific for the RSV antigen are detected in the mouse serum, the mouse spleen is harvested and splenocytes isolated. The splenocytes are then fused by well known techniques to any suitable myeloma cells, for example cells from cell line SP20 available from the ATCC. Hybridomas are 10 selected and cloned by limited dilution. The hybridoma clones are then assayed by methods known in the art for cells that secrete antibodies capable of binding a polypeptide of the invention. Ascites fluid, which generally contains high levels of antibodies, can be generated by inimunizing mice with positive hybridoma clones. Accordingly, the present invention provides methods of generating monoclonal 15 antibodies as well as antibodies produced by the method comprising culturing a hybridoma cell secreting an antibody of the invention wherein, preferably, the hybridoma is generated by fusing splenocytes isolated from a mouse inununized with a RSV antigen with myeloma cells and then screening the hybridomas resulting from the fusion for hybridoma clones that secrete an antibody able to bind a RSV antigen. 20 Antibody fragments which recognize specific RSV epitopes may be generated by any technique known to those of skill in the art. For example, Fab and F(ab')2 fragments of the invention may be produced by proteolytic cleavage of immunoglobulin molecules, using enzymes such as papain (to produce Fab fragments) or pepsin (to produce F(ab')2 fragments). F(ab')2 fragments contain the variable region, the light chain constant region 25 and the CHI domain of the heavy chain. Further, the antibodies of the present invention can also be generated using various phage display methods known in the art. In phage display methods, functional antibody domains are displayed on the surface of phage particles which carry the polynucleotide sequences encoding them. In particular, DNA sequences encoding VH and VL domains are amplified from animal cDNA libraries 30 (e.g., human or murine cDNA libraries of lymphoid tissues). The DNA encoding the VH and VL domains are recombined together with an scFv linker by PCR and cloned into a phagemid vector (e.g., p CANTAB 6 or pComb 3 HSS). The vector is electroporated in E. coli and the E. coli is infected with helper phage. Phage used in these methods are typically filamentous phage including fd and M13 and the VH and VL domains are usually 35 recombinantly fused to either the phage gene III or gene VIII. Phage expressing an antigen - 106 binding domain that binds to a RSV antigen of interest can be selected or identified with antigen, e.g., using labeled antigen or antigen bound or captured to a solid surface or bead. Examples of phage display methods that can be used to make the antibodies of the present invention include those disclosed in Brinkman et al., 1995, J. Immunol. Methods 182:41 5 50; Ames et al., 1995, J. Irmunol. Methods 184:177-186; Kettleborough et al., 1994, Eur. J. Immuriol. 24:952-958; Persic et al., 1997, Gene 187:9-18; Burton et al., 1994, Advances in Immunology 57:191-280; PCT application No, PCT/GB91/O1 134; PCT publication Nos. WO 90/02809, WO 91/10737, WO 92/01047, WO 92/18619, WO 93/1 1236, WO 95/15982, WO 95/20401, and W097/13844; and U.S. Patent Nos. 5,698,426, 5,223,409, 10 5,403,484, 5,580,717, 5,427,908, 5,750,753, 5,821,047, 5,571,698, 5,427,908, 5,516,637, 5,780,225, 5,658,727, 5,733,743 and 5,969,108; each of which is incorporated herein by reference in its entirety. As described in the above references, after phage selection, the antibody coding regions from the phage can be isolated and used to generate whole antibodies, including 15 human antibodies, or any other desired antigen binding fragment, and expressed in any desired host, including mammalian cells, insect cells, plant cells, yeast, and bacteria, e.g., as described below. Techniques to recombinantly produce Fab, Fab' and F(ab')2 fragments can also be employed using methods known in the art such as those disclosed in PCT publication No. WO 92/22324; Mullinax et al., 1992, BioTechniques 12(6):864-869; Sawai 20 et al., 1995, AJRI 34:26-34; and Better et al., 1988, Science 240:1041-1043 (said references incorporated by reference in their entireties). To generate whole antibodies, PCR primers including VH or VL nucleotide sequences, a restriction site, and a flanking sequence to protect the restriction site can be used to amplify the VH or VL sequences in scFv clones. Utilizing cloning techniques 25 known to those of skill in the art, the PCR amplified VH domains can be cloned into vectors expressing a'V constant region, e.g., the'human gamma '4 constant region, and'the'19CR amplified VL domains can be ownedd into vectors expressing a~V L constant region, e.g., human kappa or lamba constant regions. Preferably, the vectors for expressing the VH or VL domains comprise an EF- 1 x promoter, a secretion signal, a cloning site for the variable 30 domain, constant domains, and a selection marker such as neomycin. The VH and VL domains may also cloned into one vector expressing the necessary constant regions. The heavy chain conversion vectors and light chain conversion vectors are then co-transfected into cell lines to generate stable or transient cell lines that express full-length antibodies, e.g., IgG, using techniques known to those of skill in the art. 35 - 107 - For some uses, including in vivo use of antibodies in humans and in vitro detection assays, it may be preferable to use human or chimeric antibodies. Completely human antibodies are particularly desirable for therapeutic treatment of human subjects. Human antibodies can be made by a variety of methods known in the art including phage display 5 methods described above using antibody libraries derived from human immunoglobulin sequences. See also U.S. Patent Nos. 4,444,887 and 4,716,111; and PCT publications WO 98/46645, WO 98/50433, WO 98/24893, W098/16654, WO 96/34096, WO 96/33735, and WO 91/10741; each of which is incorporated herein by reference in its entirety. Human antibodies can also be produced using transgenic mice which are incapable 10 of expressing functional endogenous immunoglobulins, but which can express human ininunoglobulin genes. For example, the human heavy and light chain immunoglobulin gene complexes may be introduced randomly or by homologous recombination into mouse embryonic stem cells. Alternatively, the human variable region, constant region, and diversity region may be introduced into mouse embryonic stem cells in addition to the 15 human heavy and light chain genes. The mouse heavy and light chain immunoglobulin genes may be rendered non-functional separately or simultaneously with the introduction of human immunoglobulin loci by homologous recombination. In particular, homozygous deletion of the JH region prevents endogenous antibody production. The modified embryonic stem cells are expanded and microinjected into blastocysts to produce chimeric 20 mice. The chimeric mice are then be bred to produce homozygous offspring which express human antibodies. The transgenic mice are immunized in the normal fashion with a selected antigen, e.g., all or a portion of a polypeptide of the invention. Monoclonal antibodies directed against the antigen can be obtained from the immunized, transgenic mice using conventional hybridoma technology. The human immunoglobulin transgenes 25 harbored by the transgenic mice rearrange during B cell differentiation, and subsequently uriaergo .ehass sw/itdhiing aiA somatic mutation. Thus, using such a technique, it is possible to produce therapeutically useful IgG, IgA, IgM and IgE antibodies. For an overview of this technology for producing human antibodies, see Lonberg and Huszar (1995, Int. Rev. Innunol. 13:65-93). For a detailed discussion of this technology for producing human 30 antibodies and human monoclonal antibodies and protocols for producing such antibodies, see, e.g., PCT publication Nos. WO 98/24893, WO 96/34096, and WO 96/33735; and U.S. Patent Nos. 5,413,923, 5,625,126, 5,633,425, 5,569,825, 5,661,016, 5,545,806, 5,814,318, and 5,939,598, which are incorporated by reference herein in their entirety. In addition, companies such as Abgenix, Inc. (Freemont, CA) and Genpharm (San Jose, CA) can be 35 - 108 engaged to provide human antibodies directed against a selected antigen using technology similar to that described above. A chimeric antibody is a molecule in which different portions of the antibody are derived from different immunoglobulin molecules such as antibodies having a variable 5 region derived from a human antibody and a non-human inmunoglobulin constant region. Methods for producing chimeric antibodies are known in the art. See e.g., Morrison, 1985, Science 229:1202; Oi et al., 1986, BioTechniques 4:214; Gillies et al., 1989, J. Immunol. Methods 125:191-202; and U.S. Patent Nos. 5,807,715, 4,816,567, and 4,8 16397, which are incorporated herein by reference in their entirety. Chimeric antibodies comprising one 10 or more CDRs from human species and framework regions from a non-human immunoglobulin molecule can be produced using a variety of techniques known in the art including, for example, CDR-grafting (EP 239,400; PCT publication No. WO 91/09967; and U.S. Patent Nos. 5,225,539, 5,530,101, and 5,585,089), veneering or resurfacing (EP 592,106; EP 519,596; Padlan, 1991, Molecular Immunology 28(4/5):489-498; Studnicka et 15 al., 1994, Protein Engineering 7(6):805-814; and Roguska et al., 1994, PNAS 91:969-973), and chain shuffling (U.S. Patent No. 5,565,332). In a preferred embodiment, chimeric antibodies comprise a human CDR3 having an amino acid sequence of any one of the CDR3 listed in Table 2 and non-human framework regions. Often, framework residues in the framework regions will be substituted with the corresponding residue from the CDR 20 donor antibody to alter, preferably improve, antigen binding. These framework substitutions are identified by methods well known in the art, e.g., by modeling of the interactions of the CDR and framework residues to identify framework residues important for antigen binding and sequence comparison to identify unusual framework residues at particular positions. (See, e.g., Queen et al., U.S. Patent No. 5,585,089; and Riechmann et 25 al., 1988, Nature 332:323, which are incorporated herein by reference in their entireties.) Further,'the anti'bodies ohthe-invention can, 'in tumbe uil'ized to generate arii idiotype antibodies that "niimic"SV antigens usig techiuiques wall'known to those skilled in the art. (See, e.g., Greenspan & Bona, 1989, FASEB J. 7(5):437-444; and Nissinoff, 1991, J. Immunol. 147(8):2429-2438). For example, antibodies of the invention 30 which bind to and competitively inhibit the binding of RSV (as determined by assays well known in the art and disclosed in supra) to its host cell receptor can be used to generate anti-idiotypes that "mimic" a RSV antigen binding domain and, as a consequence, bind to and neutralize RSV and/or its host cell receptor. Such neutralizing anti-idiotypes or Fab fragments of such anti-idiotypes can be used in therapeutic regimens to neutralize RSV. For 35 - 109 example, such anti-idiotypic antibodies can be used to bind RSV and/or to bind its host cell receptors, and thereby block infection. 5.6.1. Polynucleotides Encoding an Antibody 5 The invention provides polynucleotides comprising a nucleotide sequence encoding an antibody of the invention or a fragment thereof. The invention also encompasses polynucleotides that hybridize under high stringency, intermediate or lower stringency hybridization conditions, e.g., as defined supra, to polynucleotides that encode an antibody of the invention. 10 The polynucleotides may be obtained, and the nucleotide sequence of the polynucleotides determined, by any method known in the art. Since the amino acid sequences of the antibodies are known (as described in Table 2), nucleotide sequences encoding these antibodies can be determined using methods well known in the art, i.e., nucleotide codons known to encode particular amino acids are assembled in such a way to 15 generate a nucleic acid that encodes the antibody or fragment thereof of the invention. Such a polynucleotide encoding the antibody may be assembled from chemically synthesized oligonucleotides (e.g., as described in Kutmeier et al., 1994, BioTechniques 17:242), which, briefly, involves the synthesis of overlapping oligonucleotides containing portions of the sequence encoding the antibody, annealing and ligating of those oligonucleotides, and then 20 amplification of the ligated oligonucleotides by PCR. Alternatively, a polynucleotide encoding an antibody may be generated from nucleic acid from a suitable source. If a clone containing a nucleic acid encoding a particular antibody is not available, but the sequence of the antibody molecule is known, a nucleic acid encoding'the immiunoglobulin may be chemically synthesized or obtained from a 25 suitable source (e.g., an antibody cDNA library, or a cDNA library generated from, or anfibody, sudn asI'yofiioma cens seiecte18 -t express an antibody 6Y'VnemIrveniori)by'PCR amplification using synthetic primers hybridizable to the 3' and 5'ends of the sequence or by cloning using an oligonucleotide probe specific for the particular gene sequence to 30 identify, e.g., a cDNA clone from a cDNA library that encodes the antibody. Amplified nucleic acids generated by PCR may then be cloned into replicable cloning vectors using any method well known in the art. Once the nucleotide sequence of the antibody is determined, the nucleotide sequence of the antibody may be manipulated using methods well known in the art for the 35 manipulation of nucleotide sequences, e.g., recombinant DNA techniques, site directed - 110mutagenesis, PCR, etc. (see, for example, the techniques described in Sambrook et al., 1990, Molecular Cloning, A Laboratory Manual, 2d Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY and Ausubel et al., eds., 1998, Current Protocols in Molecular Biology, John Wiley & Sons, NY, which are both incorporated by reference herein in their 5 entireties), to generate antibodies having a different amino acid sequence, for example to create amino acid substitutions, deletions, and/or insertions. In a specific embodiment, one or more of the CDRs is inserted within framework regions using routine recombinant DNA techniques. The framework regions may be naturally occurring or consensus framework regions, and preferably human framework 10 regions (see, e.g., Chothia et al., 1998, J. Mol. Biol. 278: 457-479 for a listing of human framework regions). Preferably, the polynucleotide generated by the combination of the framework regions and CDRs encodes an antibody that specifically binds to a RSV antigen. Preferably, as discussed supra, one or more amino acid substitutions may be made within the framework regions, and, preferably, the amino acid substitutions improve binding of the 15 antibody to its antigen. Additionally, such methods may be used to make amino acid substitutions or deletions of one or more variable region cysteine residues participating in an intrachain disulfide bond to generate antibody molecules lacking one or more intrachain disulfide bonds. Other alterations to the polynucleotide are encompassed by the present invention and within the skill of the art. 20 5.6.2. Recombinant Expression of an Antibody Recombinant expression of an antibody of the invention, derivative or analog thereof, (e.g., a heavy or light chain of an antibody of the invention or a portion thereof or a single chain antibody of the invention), requires construction of an expression vector 25 containing a polynucleotide that encodes the antibody. Once a polynucleotide encoding an * iba b Au Didheu-y EriG!a iaf a ntibe ,.r prtio h fp r out noL nccessaiiky, contaimiig 1he-heavy or'light 6iamin variable domain), o ine invention has been obtained, the vector for the production of the antibody molecule may be produced by recombinant DNA technology using techniques well known in the art. Thus, methods 30 for preparing a protein by expressing a polynucleotide containing an antibody encoding nucleotide sequence are described herein. Methods which are well known to those skilled in the art can be used to construct expression vectors containing antibody coding sequences and appropriate transcriptional and translational control signals. These methods include, for example, in vitro recombinant DNA techniques, synthetic techniques, and in vivo genetic 35 recombination. The invention, thus, provides replicable vectors comprising a nucleotide - 111 sequence encoding an antibody molecule of the invention, a heavy or light chain of an antibody, a heavy or light chain variable domain of an antibody or a portion thereof, or a heavy or light chain CDR, operably linked to a promoter. Such vectors may include the nucleotide sequence encoding the constant region of the antibody molecule (see, e.g., PCT 5 Publication WO 86/05807; PCT Publication WO 89/01036; and U.S. Patent No. 5,122,464) and the variable domain of the antibody may be cloned into such a vector for expression of the entire heavy, the entire light chain, or both the entire heavy and light chains. The expression vector is transferred to a host cell by conventional techniques and the transfected cells are then cultured by conventional techniques to produce an antibody of the 10 invention. Thus, the invention includes host cells containing a polynucleotide encoding an antibody of the invention or fragments thereof, or a heavy or light chain thereof, or portion thereof, or a single chain antibody of the invention, operably linked to a heterologous promoter. In preferred embodiments for the expression of double-chained antibodies, vectors encoding both the heavy and light chains may be co-expressed in the host cell for 15 expression of the entire immunoglobulin molecule, as detailed below. A variety of host-expression vector systems may be utilized to express the antibody molecules of the invention (see, e.g., U.S. Patent No. 5,807,715). Such host-expression systems represent vehicles by which the coding sequences of interest may be produced and subsequently purified, but also represent cells which may, when transformed or transfected 20 with the appropriate nucleotide coding sequences, express an antibody molecule of the invention in situ. These include but are not limited to microorganisms such as bacteria (e.g., E. coli and B. subtilis) transformed with recombinant bacteriophage DNA, plasmid DNA or cosmid DNA expression vectors containing antibody coding sequences; yeast (e.g., Saccharomyces Pichia) transformed with recombinant yeast expression vectors containing 25 antibody coding sequences; insect cell systems infected with recombinant virus expression vectors (e.g.,'bacu'logIni.) contii'ing anibodly coding sequences; plant c611 systemsinfected with recombinant virus expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or transformed with recombinant plasmid expression vectors (e.g., Ti plasmid) containing antibody coding sequences; or mammalian cell systems (e.g., COS, 30 CHO, BHK, 293, NSO, and 3T3 cells) harboring recombinant expression constructs containing promoters derived from the genome of mammalian cells (e.g., metallothionein promoter) or from mammalian viruses (e.g., the adenovirus late promoter; the vaccinia virus 7.5K promoter). Preferably, bacterial cells such as Escherichia coli, and more preferably, eukaryotic cells, especially for the expression of whole recombinant antibody molecule, are 35 used for the expression of a recombinant antibody molecule. For example, mammalian - 112cells such as Chinese hamster ovary cells (CHO), in conjunction with a vector such as the major intermediate early gene promoter element from human cytomegalovirus is an effective expression system for antibodies (Foecking et al., 1986, Gene 45:101; and Cockett et al., 1990, Bio/Technology 8:2). In a specific embodiment, the expression of nucleotide 5 sequences encoding antibodies or fragments thereof which immunospecifically bind to one or more RSV antigens is regulated by a constitutive promoter, inducible promoter or tissue specific promoter. In bacterial systems, a number of expression vectors may be advantageously selected depending upon the use intended for the antibody molecule being expressed. For example, 10 when a large quantity of such a protein is to be produced, for the generation of pharmaceutical compositions of an antibody molecule, vectors which direct the expression of high levels of fusion protein products that are readily purified may be desirable. Such vectors include, but are not limited to, the E. coli expression vector pUR278 (Ruther et al., 1983, EMBO 12:1791), in which the antibody coding sequence may be ligated individually 15 into the vector in frame with the lac Z coding region so that a fusion protein is produced; pIN vectors (Inouye & Inouye, 1985, Nucleic Acids Res. 13:3101-3109; Van Heeke & Schuster, 1989, J. Biol. Chem. 24:5503-5509); and the like. pGEX vectors may also be used to express foreign polypeptides as fusion proteins with glutathione 5-transferase (GST). In general, such fusion proteins are soluble and can easily be purified from lysed cells by 20 adsorption and binding to matrix glutathione agarose beads followed by elution in the presence of free glutathione. The pGEX vectors are designed to include thrombin or factor Xa protease cleavage sites so that the cloned target gene product can be released from the GST moiety. In an insect system, Autographa californica nuclear polyhedrosis virus (AcNPV) is 25 used as a vector to express foreign genes. The virus grows in Spodopterafugiperda cells. e±xamrp'ie ie polyh~ednin gene' onthe virs an~. piacetiunder con~tidnif anj A1'MP"~Jvooer (for example the polyhedrin promoter). In mammalian host cells, a number of viral-based expression systems may be 30 utilized. In cases where an adenovirus is used as an expression vector, the antibody coding sequence of interest may be ligated to an adenovirus transcription/translation control complex, e.g., the late promoter and tripartite leader sequence. This chimeric gene may then be inserted in the adenovirus genome by in vitro or in vivo recombination. Insertion in a non-essential region of the viral genome (e.g., region El or E3) will result in a 35 recombinant virus that is viable and capable of expressing the antibody molecule in infected - 113 hosts (e.g., see Logan & Shenk, 1984, Proc. Natl. Acad. Sci. USA 8 1:355-359). Specific initiation signals may also be required for efficient translation of inserted antibody coding sequences. These signals include the ATG initiation codon and adjacent sequences. Furthermore, the initiation codon must be in phase with the reading frame of the desired 5 coding sequence to ensure translation of the entire insert. These exogenous translational control signals and initiation codons can be of a variety of origins, both natural and synthetic. The efficiency of expression may be enhanced by the inclusion of appropriate transcription enhancer elements, transcription terminators, etc. (see, e.g., Bittner et al., 1987, Methods in Enzymol. 153:51-544). 10 In addition, a host cell strain may be chosen which modulates the expression of the inserted sequences, or modifies and processes the gene product in the specific fashion desired. Such modifications (e.g., glycosylation) and processing (e.g., cleavage) of protein products may be important for the function of the protein. Different host cells have characteristic and specific mechanisms for the post-translational processing and 15 modification of proteins and gene products. Appropriate cell lines or host systems can be chosen to ensure the correct modification and processing of the foreign protein expressed. To this end, eukaryotic host cells which possess the cellular machinery for proper processing of the primary transcript, glycosylation, and phosphorylation of the gene product may be used. Such mammalian host cells inchide but are not limited to CHO, VERY, BIK, 20 Hela, COS, MDCK, 293, 3T3, W138, BT483, Hs578T, HTB2, BT20 and T47D, NSO (a murine myeloma cell line that does not endogenously produce any immunoglobulin chains), CRL7030 and HsS78Bst cells. For long-tenn, high-yield production of recombinant proteins, stable expression is preferred. For example, cell lines which stably express the antibody molecule may be 25 engineered. Rather than using expression vectors which contain viral origins of replication, sites, etc.), and a selectable marker. Following the introduction of the foreign DNA, engineered cells may be allowed to grow for 1-2 days in an enriched media, and then are 30 switched to a selective media. The selectable marker in the recombinant plasmid confers resistance to the selection and allows cells to stably integrate the plasmid into their chromosomes and grow to form foci which in turn can be cloned and expanded into cell lines. This method may advantageously be used to engineer cell lines which express the antibody molecule. Such engineered cell lines may be particularly useful in screening and 35 evaluation of compositions that interact directly or indirectly with the antibody molecule. -114- A number of selection systems may be used, including but not limited to, the herpes simplex virus thymidine kinase (Wigler et al., 1977, Cell 11:223), hypoxanthineguanine phosphoribosyltransferase (Szybalska & Szybalski, 1992, Proc. Natl. Acad. Sci. USA 48:202), and adenine phosphoribosyltransferase (Lowy et al., 1980, Cell 22:8-17) genes can 5 be employed in tk-, hgprt- or aprt- cells, respectively. Also, antimetabolite resistance can be used as the basis of selection for the following genes: dhfi-, which confers resistance to methotrexate (Wigler et al., 1980, Natl. Acad. Sci. USA 77:357; O'Hare et al., 1981, Proc. Natl. Acad. Sci. USA 78:1527); gpt, which confers resistance to mycophenolic acid (Mulligan & Berg, 1981, Proc. Natl. Acad. Sci. USA 78:2072); neo, which confers 10 resistance to the aminoglycoside G-418 (Wu and Wu, 1991, Biotherapy 3:87-95; Tolstoshev, 1993, Ann. Rev. Pharmacol. Toxicol. 32:573-596; Mulligan, 1993, Science 260:926-932; and Morgan and Anderson, 1993, Ann. Rev. Biochem. 62: 191-217; May, 1993, TIB TECH 1 l(5):155-2 15); and hygro, which confers resistance to hygromycin (Santerre et al., 1984, Gene 30:147). Methods commonly known in the art of recombinant 15 DNA technology may be routinely applied to select the desired recombinant clone, and such methods are described, for example, in Ausubel et aL. (eds.), Current Protocols in Molecular Biology, John Wiley & Sons, NY (1993); Kriegler, Gene Transfer and Expression, A Laboratory Manual, Stockton Press, NY (1990); and in Chapters 12 and 13, Dracopoli et a. (eds), Current Protocols in Human Genetics, John Wiley & Sons, NY (1994); Colberre 20 Garapin et al., 1981, J. Mol. Biol. 150:1, which are incorporated by reference herein in their entireties. The expression levels of an antibody molecule can be increased by vector amplification (for a review, see Bebbington and Hentschel, The use of vectors based on gene amplification for the expression of cloned genes in mammalian cells in DNA cloning, 25 Vol.3. (Academic Press, New York, 1987)). When a marker in the vector system is associated with the antibody gene, production of the antibody will also increase (Crouse et al., 1983, Mol. Cell. Biol. 3:257). 30 The host cell may be co-transfected with two expression vectors of the invention, the first vector encoding a heavy chain derived polypeptide and the second vector encoding a light chain derived polypeptide. The two vectors may contain identical selectable markers which enable equal expression of heavy and light chain polypeptides. Alternatively, a single vector may be used which encodes, and is capable of expressing, both heavy and light 35 chain polypeptides. In such situations, the light chain should be placed before the heavy - 115chain to avoid an excess of toxic free heavy chain (Proudfoot, 1986, Nature 322:52; and Kohler, 1980, Proc. Natl. Acad. Sci. USA 77:2 197). The coding sequences for the heavy and light chains may comprise cDNA or genomic DNA. Once an antibody molecule of the invention has been produced by recombinant 5 expression, it may be purified by any method known in the art for purification of an immunoglobulin molecule, for example, by chromatography (e.g., ion exchange, affinity, particularly by affinity for the specific antigen after Protein A, and sizing column chromatography), centrifugation, differential solubility, or by any other standard technique for the purification of proteins. Further, the antibodies of the present invention or fragments 10 thereof may be fused to heterologous polypeptide sequences described herein or otherwise known in the art to facilitate purification. 5.7. Kits The invention also provides a pharmaceutical pack or kit comprising one or more 15 containers filled with one or more of the ingredients of the pharmaceutical compositions of the invention. Optionally associated with such container(s) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human administration. 20 The present invention provides kits that can be used in the above methods. In one embodiment, a kit comprises an antibody of the invention, preferably a purified antibody, in one or more containers. In an alterative embodiment, a kit comprises an antibody fragment that immunospecifically binds to a RSV antigen. In a specific embodiment, the kits of the present invention contain a substantially isolated RSV antigen as a control. Preferably, the 25 kits of the present invention further comprise a control antibody which does not react with tit'RSV- antigen. Th atrot'her sp-ed'fie erfiifhndmrt, rts 6' The preserfitinverifion contain a means'lor detecting the''inding o'an antibody to a{S.V antigen (e.g., fhe antibody may be conjugated to a detectable substrate such as a fluorescent compound, an enzymatic substrate, a radioactive compound or a luminescent compound, or a second antibody which 30 recognizes the first antibody may be conjugated to a detectable substrate). In specific embodiments, the kit may include a recombinantly produced or chemically synthesized RSV antigen. The RSV antigen provided in the kit may also be attached to a solid support. In a more specific embodiment the detecting means of the above-described kit includes a solid support to which RSV antigen is attached. Such a kit may also include a non-attached 35 -116reporter-labeled anti-human antibody. In this embodiment, binding of the antibody to the RSV antigen can be detected by binding of the said reporter-labeled antibody. In an additional embodiment, the invention includes a diagnostic kit for use in screening serum containing RSV antigens. The diagnostic kit includes a substantially 5 isolated antibody specifically immunoreactive with a RSV antigen, and means for detecting the binding of the RSV antigen to the antibody. In one embodiment, the antibody is attached to a solid support. In a specific embodiment, the antibody may be a monoclonal antibody. The detecting means of the kit may include a second, labeled monoclonal antibody. Alternatively, or in addition, the detecting means may include a labeled, 10 competing antigen. In one diagnostic configuration, test serum is reacted with a solid phase reagent having a surface-bound RSV antigen obtained by the methods of the present invention. After the RSV antigen binds to a specific antibody, the unbound serum components are removed by washing, reporter-labeled anti-human antibody is added, unbound anti-human 15 antibody is removed by washing, and a reagent is reacted with reporter-labeled anti-human antibody to bind reporter to the reagent in proportion to the amount of bound anti-RSV antigen antibody on the solid support. Typically, the reporter is an enzyme which is detected by incubating the solid phase in the presence of a suitable fluorometric, luminescent or colorimetric substrate (Sigma, St. Louis, MO). 20 The solid surface reagent in the above assay is prepared by known techniques for attaching protein material to solid support material, such as polymeric beads, dip sticks, 96 well plate or filter material. These attachment methods generally include non-specific adsorption of the protein to the support or covalent attachment of the protein, typically through a free amine group, to a chemically reactive group on the solid support, such as an 25 activated carboxyl, hydroxyl, or aldehyde group. Alternatively, streptavidin coated plates -ca e used-ireconjtcreeitrtibitnjiydartigen',). Inus, tneinvention provides an assay system orkitTor carrying out tfis diagnostic method. The kit generally includes a support with surface-bound recombinant RSV antigen, and a reporter-labeled anti-human antibody for detecting surface-bound anti-RSV antigen 30 antibody. 6. EXAMPLE: KINETIC ANALYSIS OF HUMANIZED RSV MABS BY BIACORETM A typical kinetic study involved the injection of 250 p of monoclonal antibody 35 ("Mab") at varying concentrations (25-300 nM) in PBS buffer containing 0.05% Tween-20 -117- (PBS/Tween). The flow rate was maintained at 75 pl/min, giving a 15 minute dissociation time. Following the injection of Mab, the flow was exchanged with PBS/Tween buffer for 30 min for determining the rate of dissociation. The sensor chip was regenerated between cycles with a 1 min pulse of 100 mM HCL. The regeneration step caused a minimal loss of 5 binding capacity of the immobilized F-protein (4% loss per cycle). This small decrease did not change the calculated values of the rate constants for binding and dissociation (also called the k 0 and kff, respectively). More specifically, for measurement of kassoc (or kon), F protein was directly immobilized by the EDC/NHS method (EDC = N-ethyl-N'-[3-diethylaminopropyl) 10 carbodiimide). Briefly, 25 mg/mi of F protein in 10 mM NaoAc, pH 5.0 was prepared and about a 5-10 pl injection gives about 30-50 RU (response units) of immobilized F protein under the above referenced conditions. The blank was subtracted for kinetic analysis. The column could be regenerated using 100 mM HCI (with 60 seconds of contact time being required for full regeneration). This treatment removed bound Fab completely without 15 damaging the immobilized antigen and could be used for over 40 regenerations. For kon measurements, Fab concentrations were 0.39 nM, .75 nM, 1.56 nM, 3.13 nM, 12.5 nM, 25 nM, 50 nM, and 100 nM. The dissociation phase was analyzed for approximately 900 seconds. Kinetics were analyzed by 1:1 Langmuir fitting (global fitting). Measurements were done in HBS-EP buffer (10 mM HEPES, pH 7.4, 150 nM NaCl, 3 mM EDTA, 20 0.005% (v/v) Surfactant P20. For measurements of combinatorial clones, as disclosed herein, the k.,, and kff were measured separately. The k., was measured at conditions that were the same as those for the single mutation clones and was analyzed similarly. For measuring koff, the following conditions were employed. Briefly, 4100 RU of F 25 protein were immobilized (as above) with CM-dextran used as the blank. Here, 3000 RU of 45 TUM Fpmin (a''oondS6~ - 2000timesigherintan thTe' &d e &issoeitfr -ettd~ibdamI constant) was used as buffer. The dissociation phase was 6 - 15 hours at a flow rate of 5 ml/min. Under the conditions used herein, re-binding of the dissociated Fab was minimal. 30 For further details, see the manual with the biosensor. The binding of the high affinity anti-RSV antibodies to the F protein, or other epitopic sites on RSV, disclosed herein was calculated from the ratio of the first order rate constant for dissociation to the second order rate constant for binding or association (Kd =kff /kw). The value for k, was calculated based on the following rate equation: 35 -118dR/dt=k..[Mab]R.,, - (k 0 ,[Mab]+kq,)R where R and R,. are the response units at time t and infinity, respectively. A plot of dr/dt as a function of R gives a slope of (ka [Mab]+kd)--since these slopes are linearly related to 5 the [Mab], the value k., can be derived from a replot of the slopes versus [Mab]. The slope of the new line is equal to k,. Although the value of kff can be extrapolated from the Y intercept, a more accurate value was determined by direct measurement of koa. Following the injection phase of the Mab, PBS/Tween buffer flows across the sensor chip. From this point, [Mab]=0. The above stated equation for dR/dt thus reduces to: 10 dr/dt=k or dR/R=kffdt Integration of this equation then gives: 15 ln(R 0 /.)= kff t where R 0 1) are the response units at time 0 (start of dissociation phase) and t, respectively. Lastly, plotting In(R, /R.) as a function of t gives a slope of kf. The numerical values from such antibody variants were as shown in Tables 4-7 20 below. Table 4. Sunmary of Kinetic Constants for High Potency Antibodies. ANTIBODY K.,, x 10' (M-'s-') K., x 10' (s-') ECs 0 (nM) 25 *1X-493LIFR 1.85 6.5 *H3-3F4 4.59; 4.67; 5.72; 4.45; 4.02 30 6.25; 5.33 *M3H9 6.05 3.38 *Y10H6 7.57 4.62 *DG 2.65; 2.83; 4.16; 1.67; 4.44 35 3.18; 2.88 - 119- *AFFF 2.12; 1.56; 1.86 2.45; 4.46; 2.68 *6H8 3.14; 4.44 1.78; 4.73 *L1-7E5 3.29; 3.57; 4.05; 1.92; 3.31; 2.29 5 3.35; 4.26 *L2-15B10 3.69; 2.82; 3.12; 1.34; 4.16; 2.70 5.33; 3.78 *P12f2 6.63 2.82 0.65 *P12f4 5.27 2.99 0.70 10 *Pl1d4 5.70; 5.72 7.17 >20 *Ale9 7.9 4.53 2.5 *A12a6 7.43 2.30 0.62 *A13a ll 7.35 2.50 2.04 15 15 *A13c4 7.81; 7.35 2.80 0.52 Table 5. Monoclonal Antibodies vs Bac-F(I:1) 20 Kon (x E+5) Koff(x E-5) KD (nM) Chi2 PI2f2 4.07 12.8 0.31 (13) 0.9 Pl2f4 4.95 5.55 0.11 (35) 0.6 Al3c4 3.00 3.96 0.13 (30) 1.2 Al2a6 4.60 1.65 0.04 (98) 1.2 25 Ale9 4.33 14.3 0.33 (12) 2.5 A8c7 4.17 8.75 0.21 (19) 1.8 Pl1d4 4.66 28.9 0.62(6) 1.0 A17d4 4.56 4.07 0.09 (43) 0.5 30 A4B4 4.34 1.06 0.02 (195) 1.5 SYNAGIS@ 1.32 51.5 3.90 (1) 0.6 35 -120- Table 6. Monoclonal Antibodies vs NUF4 (1:1) Kon (x E+5) Koff(x E-5) KD (nM) Chi2 P1212 5.41 17.8 0.33 (26) 1.2 5 P12f4 9.43 22.9 0.24 (36) 0.9 A13c4 3.65 27.2 0.75 (12) 1.8 A12a6 4.00 29.1 0.73 (12) 1.9 Ale9 8.43 58.4 0.69 (13) 0.9 A8c7 8.25 53.5 0.65 (13) 0.7 10 P11d4 9.04 76.6 0.85 (10) 2.5 A]7d4 4.99 36.2 0.73 (12) 2.0 A4B4 4.96 28.2 0.57 (15) 1.9 SYNAGIS@ 3.04 265. 8.70 (1) 0.4 15 Table 7. Monoclonal Antibodies vs NUF4 (2:1) Kon (x E+5) Koff(x E-5) KD (nM) Chi2 P12f2 2.82 23.6 0.84 (371) 1.5 P12f4 2.73 63.6 2.33 (134) 4.9 20 A13c4 3.20 22.5 0.70 (446) 1.7 A 12a6 2.18 40.8 1.87 (167) 1.9 Ale9 3.29 139 4.22 (74) 2.8 A8c7 4.30 114 2.65 (118) 2.0 25 Pld4 3.66 313 8.55 (36) 3.6 A17d4 2.64 29.2 1.11(281) 1.7 A4B4 2.03 40.06 2.00 (156) 1.4 SYNAGIS@ 0.7S 2420 312 (1) 1.3 1X-493L1FR, H3-3F4, M3H9, Y1OH6, DG, AFFF, 6H8, L1-7E5, L2-15B10, P12f2, 30 P12f4, P1 1d4, Ale9, A12a6, A13al 1, and A13c4 are Fab fragments having the framework sequences of Figure 2 and the indicated CDR sequences indicated listed in Table 2. SYNAGIS@ is a monoclonal antibody with the framework sequences of Figure 2 and constant regions as described in Johnson et al. (1997, Journal of Infectious Diseases 176:1215-1224) and U.S. Patent No. 5,824,307. The framework sequences of 35 these antibodies may differ slightly from those of the Fab fragments. - 121 - The amino acid sequences of the indicated CDRs in Table I represent the amino acid residues located at the key locations within the CDRs of the high potency antibodies produced by the methods described herein and in copending applications Serial Nos. 60/168,426 and 60/186,252. For example, to increase the potency of an antibody by 5 producing a higher k, value, the amino acids located at the key positions as taught herein by the bold and underlined residues in Table I for the reference antibody would be replaced by the amino acids listed under CDRs in Table 2 (and also bold and underlined). Thus, these one letter codes represent the amino acids replacing the reference amino acids at the key positions (or critical positions) of the CDRs shown in Figure 2 (residues in bold in the 10 sequences of Table 2) for a reference antibody whose potency is to be increased. 7. EXAMPLE: MICRONEUTRALIZATION ASSAY Neutralization of the antibodies of the present invention were determined by microneutralization assay. This microneutralization assay is a modification of the 15 procedures described by Anderson et al. (1985, J. Clin. Microbiol. 22:1050-1052, the disclosure of which is hereby incorporated by reference in its entirety). The procedure used here is described in Johnson et al., 1999, J. Infectious Diseases 180:35-40, the disclosure of which is hereby incorporated by reference in its entirety. Antibody dilutions were made in triplicate using a 96-well plate. Ten TCID 50 of respiratory syncytial virus (RSV - Long 20 strain) were incubated with serial dilutions of the antibody (or Fabs) to be tested for 2 hours at 37*C in the wells of a 96-well plate. RSV susceptible H{Ep-2 cells (2.5 x 104) were then added to each well and cultured for 5 days at 37*C in 5% CO 2 . After 5 days, the medium was aspirated and cells were washed and fixed to the plates with 80% methanol and 20% PBS. RSV replication was then determined by F protein expression. Fixed cells were 25 incubated with a biotin-conjugated anti-F protein monoclonal antibody (pan F protein, C sisspeifieMAbe13Q aldkusrds'eoiaecruae-vdra 'ade ete-d is.Teweils werewa~ne8 agrn -and'turniover o' sd s'ute TMBP (thionitrobenzoic acid) was measured at 450 nm. The neutralizing titer was expressed as the antibody concentration that caused at least 50% reduction in absorbency at 450 nm (the 30 OD, 50 ) from virus-only control cells. The results from the assay for the monoclonal antibodies and Fab fragments listed in Table 2 are shown in Table 4 supra and Table 8 infi-a. 35 -122- Table S. End Point RSV Microneutralization Titer Of High On Rate Mutant IgG and Fab Molecule Mean STDEV Fold Mean STDEV Fold n IC50 Curve Difference IC50 Control Difference (assay (Curv IC50 (Curve (Control) ICS0 (Control repeat) 5 e) ICX50) pg/ml IC50) pg/ml **SYNAGIS@ 0.4527 0.208 - 0.5351 0.238 - 8 **Ale9 0.0625 0.0268 7 0.0645 0.0223 8 3 10 **A17d4 0.0342 0.022 13 0.0354 0.0187 15 4 **PIld4 0.0217 0.0331 21 0.0289 0.0110 19 5 **Pl2f2 0.0231 0.0141 20 0.0223 0.0083 24 6 15 **A8c7 0.0337 0.0309 13 0.03S3 0.0283 14 5 **Al 2 a6 0.0357 0.0316 13 0.0354 0.0261 15 7 **Pl2f4 0.0242 0.0163 19 0.0235 0.0076 23 7 20 **A13c4 0.0376 0.0268 12 0.0375 0.0213 14 6 **A4B4 0.0171 0.0018 27 0.0154 0.00417 35 2 25 *Ale9 0.157 - 3 0.125 - 4 1 *Al7d4 0.0179 - 25 0.0171 - 31 1 *P l I d4 >1.00 - - >1.00 - 30 ____ *P12f2 0.0407 0.0112 11 0.0326 0.00905 16 2 *A8c7 0.177 - 3 0.157 - 34 1 *A12a6 0.0287 0.00417 16 0.0310 0.00982 17 2 35 - 123 - *P12f4 0.0464 0.00791 10 0.0351 0.0126 15 2 *Al3c4 0.0264 0.00141 17 0.0258 0.00071 21 2 5 *A4B4 0.0414 - 11 0.0411 - 13 1 *Al3al 1 0.120 0.0222 4 0.1022 0.0260 5 2 *Alh5 0.194 0.462 2 0.176 0.0625 3 2 10 ** Monoclonal Antibody * Fab Fragment 8. EXAMPLE: RSV FUSION INHIBITION ASSAY The ability of the antibodies of the invention or fragments thereof to block RSV 15 induced fusion after viral attachment to the cells is determined in a fusion inhibition assay. This assay is identical to the microneutralization assay, except that the cells were infected with RSV (Long) for four hours prior to addition of antibody (Taylor et al,1992, J. Gen. Virol. 73:2217-2223). 20 9. EXAMPLE: ISOTHERMAL TITRATION CALORIMETRY Thermodynamic binding affinities and enthalpies were determined from isothermal titration calorimetry (ITC) measurements on the interaction of antibodies with RSV F glycoprotein (NUF4), an antigen which mimics the binding site of the RSV virus. 25 Methods & Materials Anfibodfies & Anfigen A13c4, A17d4, A4B4, and SYNAGIS@ were diluted in dialysate and the concentrations were determined by UV spectroscopic absorption measurements with a Perkin-Elmer Lambda 4B Spectrophotometer using an extinction coefficient of 217,000 M 30 cm- at the peak maximum at 280 nm. The diluted NUF4 concentrations were calculated from the ratio of the mass of the original sample to that of the diluted sample since its extinction coefficient was too low to determine an accurate concentration without employing and losing a large amount of sample. 35 -124- ITC Measurements The binding thermodynamics of the antibodies were determined from ITC measurements using a Microcal, Inc. VP Titration Calorimeter. The VP titration calorimeter consists of a matched pair of sample and reference vessels (1.409 ml) enclosed 5 in an adiabatic enclosure and a rotating stirrer-syringe for titrating ligand solutions into the sample vessel. The ITC measurements were performed at 25*C and 35'C. The sample vessel contained the antibody in the phosphate buffer while the reference vessel contained just the buffer solution. The phosphate buffer solution was saline 67 mM P0 4 at pH 7.4 from HyClone, Inc. Five or ten p1 aliquots of the 0.05 to 0.1 mM NUF4 solution were 10 titrated 3 to 4 minutes apart into the antibody sample solution until the binding was saturated as evident by the lack of a heat exchange signal. With some antibody sample solutions, additional constant amounts of heat with the addition of each aliquot were observed following binding saturation of the antibody. This was attributed to a heat of dilution of the NUF4 titrant and was subtracted from the titrant heats obtained during the 15 titration prior to analysis of the data. A non-linear, least square minimization software program from Microcal, Inc., Origin 5.0, was used to fit the incremental heat of the ith titration (AQ (i)) of the total heat,

Q

1 , to the total titrant concentration, Xp, according to the following equations (1), 20 Q = nCAH,'V{ I + X/nC, + 1/nK6C, -[(1 + Xl/nCl + 1/nKbCj 2 - 4X/nCJ' }/2 (1 a) AQ(i) = Q(i) + dVi/2V {Q(i) + Q(i-1)} - Q(i-1) (1b) where C, is the initial antibody concentration in the sample vessel, V is the volume of the 25 sample vessel, and n is the stoichiometry of the binding reaction, to yield values of Kb, AH , an-n. "''he optimum range of sample concentrations for the determination ofKb depends on the value of Kb and is defined by the following relationship. C, Kbn 500 (2) 30 so that at 1 pM the maximum Kb that can be determined is less than 2.5 X 10' M'. If the first titrant addition did not fit the binding isotherm, it was neglected in the final analysis since it may reflect release of an air bubble at the syringe opening-solution interface. 35 - 125 - Results The ITC results are summarized in Table 9. The higher than 2 stoichiometries in Table 9 indicate that either the concentration determination of the antibody or NUF4 was incorrect. Since the same NUF4 sample was used as a titrant with antibodies having the 5 amino acid sequence of Al3c4 at 35*C and A17d4 at 35*C, which exhibit in at least one of the titrations the correct stoichiometry of 2, it is assumed that the titrant concentration was correct and that the large values of n result from incorrectly determined antibody concentrations. However, it can be shown that the binding constants are critically dependent on the titrant concentration and, thus, despite the 2-3 disparity in n, the binding 10 constants are correct. Since the binding constants of antibodies having the amino acid sequence of A4B4 and A13c4 at 25*C were near the upper determination limit by ITC (equation 2) and with the limited amount of available NUF4, it was decided to use 35*C as the reference temperature for comprising the binding affinities. The results summarized in Table 9 show that the binding affinities to NUF4 are in the order A4B4 > Al3c4 > Al7d4 > 15 'SYNAGIS@. Table 9. Average Binding Constants and Enthalpies of N1UF4 to Antibodies 20 Antibody Kb AHr in kJ mol' A4B4 269 74 X 10 6 Mv[or ~3.7 nM* 92.8+ 1.0 Al3c4 1 07 ± 28 X 10 6 Mor 9 nM 67 17 Al7d4 7 5 14 X 10 6 ' or 13 nM 68 10 SYNAGIS@ 1.23 0.17 X 10 6 M- or 810 nm 71 5 25 * Based only on the best titration run at 35 0 C. *i^'hio imt wuhoedy -ard fanibdyris enentraion ofth~e antibody'iniTne c6f). 10. EXAMPLE: COTTON RAT PROPHYLAXIS 30 To determine the ability of SYNAGIS@ to prevent lower respiratory tract RSV infection in cotton rats when administered by and intravenous (IV) route and to correlate the serum concentration of SYNAGIS@ with a reduction in lung RSV titer. 35 - 126 - Materials & Methods SYNAGIS@ lot L94H048 was used for studies 11-47 and II-47A. SYNAGIS@ lot L95 K016 was used for study 111-58. Bovine serum albumin (BSA) (fraction V, Sigma Chemicals). RSV-Long (A subtype) was propagated in Hep-2 cells. 5 On day 0, to groups of cotton rats (Sigmnodon hispidis, average weight 100 g) were administered SYNAGIS@, RSV-IGIV or BSA was administered by intramuscular injection. Twenty-four hours post administration, the animals were bled and infected intranasally with 105 pfu of RSV. Twenty-four hours later, the animals were bled and infected intranasally with 105 PFU or RSV (Long Strain). Four days after the infection, animals were sacrificed, 10 and their lung tissue was harvested and pulmonary virus titers were determined by plaque titration. For studies 111-47 and I1I-47A, the doses of monoclonal antibody ("MAb") consisted of 0.31, 0.63, 1.25, 2.5, 5.5 and 10 mg/kg (body weight). For studies 111-58, the doses of MAb consisted of 0.63, 1.25, 2.5, 5.5 and 10 mg/kg (body weight). In all three studies bovine serum albumin (BSA) 10 mg/kg was used as a negative control. Human 15 antibody concentrations in the serum at the time of challenge are determined using a sandwich ELISA. Results The results of the individual experiments are presented in Tables 10-12. The results 20 of all of the experiments combined is shown in Table 13. All three studies show a significant reduction of pulmonary virus titers in animals treated with SYNAGIS@. A clear dose-response effect was observed in the animals. The combined data indicated that a dose of 2.5 mg/kg results in a greater than 99% reduction in lung RSV titer. The mean serum concentration of SYNAGIS@ for this dose at the time of viral challenge was 28.6 ptg/ml. 25 Td.TU S...... 'EXl,.En7 . Compound Number of Dose Mean+Std Error Lung Viral Titer Animals Concentration of Geometric Mean Human IgG ±Std Error (Ig/ml) (log1 pfu/gm) 30 BSA 4 0 1.4x10 5 ±1.7 SYNAGIS® 3 0.312mg/kg 3.83i1.1 2.1x10 4 ±2.1 SYNAGIS@ 3 0.6 2 5mg/kg 5.27±0.37 7.7x10 4 ±1.6 SYNAGIS@ 4 1.25mg/kg 9.15±0.16 3.4x10 4 ±1.3 SYNAGIS@ 3 2 .50mg/kg 23.4±2.8 1.4x10 3 ±1.7 SYNAGIS@ 2 5.0mg/kg 42.4±13.4 4.6x10 2 ±4.6 SYNAGIS@ 4 1O.0mg&kg 141.1±14.4 I.0X10 2 ±l.0 - 127- Table 11. EXPERIMENT II-47A Compound Number of Dose Mean±Std Error Lung Viral Titer Animals Concentration of Geometric Mean Human [gG ±Std Error (jig/ml) (loglO pfu/gm) 5 BSA 4 0 1.9x10±'l.2 SYNAGIS@ 4 0.312mg/kg 1.8±0.12 8.5x10 4 ±1.2 SYNAGIS@ 4 0.625mg/kg 4.010.19 5.0x10 4 ±1.6 SYNAGIS@ 4 1.25mg/kg 11.8±0.68 1.9x10 3 ±1.4 SYNAGIS@ 4 2.50mg/kg 18.912.0 5.3x10 3 ±1.6 SYNAGIS@ 3 5.0mg/kg 55.6±2.3 1.6x10 2 ±l.3 SYNAGIS@ 4 10.Omg/kg 109.7±5.22 1.0x10 2 ±1.0 10 Table 12. EXPERIMENT 111-58 Compound Number of Dose Mean±Std Error Lung Viral Titer Animals Concentration of Geometric Mean Human IgG ±Std Error (pig/mi) (log10 pfu/gm) 15 BSA 4 0 1.1x10 5 ±1.2 SYNAGIS@ 4 0.625mg/kg 5.78±0.32 1.6x10 4 ±1.2 SYNAGIS@ 4 1.25mg/kg 9.82±0.23 1.6x10 3 ±1.3 SYNAGIS@ 4 2.50ng/kg 34.1L2.11 4.3x10 2 ±1.6 SYNAGIS@ 3 5.0mg/kg 58.3±4.48 1.0x10 2 ±l.0 SYNAGIS@ 4 10.0mg/kg 111.5±5.04 1.0x10 2 ±1.0 20 Table 13. 111-47. 1I-47A and 111-58 COMBINED Compound Number of Dose Mean+Std Error Lung Viral Titer Animals Concentration of Geometric Mean Human IgG (jg/mil) ±Std Error (log10 pfu/gm) BSA 18 0 1.3x10'±1.2 25 SYNAGIS® 7 0.

3 1 2 mg/kg 2.67±0.60 4.6x10 4 ±1.5 .,SXNAGi1S@i .3 .3.25=g&E .J.0JAA029 .31.1101'A0 SYNAGIS@ 17 2 .50mg/kg 28.6±2.15 9.6x10 2 ±1.5 SYNAGIS@ 15 5.0mg/kg 55.6t3.43 1.3x10 2 l±1.2 SYNAGIS@ 18 10.0mg/kg 117.6+5.09 1.0x10 2 ±1.0 30 11. EXAMPLE: INTRAMUSCULAR COTTON RAT STUDIES This experiment demonstrates that a greater reduction in RSV titer is achieved when A4b4, A4b4-F52S or A4b4/LIFR-S28R is administered intramuscularly to a cotton rat than when the same concentration of SYNAGIS@ is administered intramuscularly to a cotton rat. 35 - 128- Materials & Methods Intramuscular Cotton Rat Prophylaxis Cotton rats (S. hispidus, average weight 100 grams) were anesthetized with methoxyflurane and dosed with 0.1 ml of purified monoclonal antibody (MAb) or BSA 5 control by intramuscular (i.m.) injection. Twenty-four hours later animals were again anesthetized, bled for serum MAb concentration determination, and challenged with 10' PFU RSV long by intranasal (i.n.) instillation. Four days later animals were sacrificed, serum samples were obtained, and their lungs were harvested. Lungs were homogenized in 10 parts (wt/vol) of Hanks Balanced Salt solution and the resultant suspension was used to 10 determine pulmonary viral titers by plaque assay. Intramuscular Cotton Rat Pharmacokinetics Cotton rats (S. hispidus, average weight 100 grams) were anesthetized with methoxyflurane and dosed with 0.1 ml of purified MAb or BSA control by intramuscular 15 (i.m) injection. Twenty-four hours later all of the animals were bled for serum MAb concentration determination, and half of the animals from each group were sacrificed to perform bronchoalveolar lavage (BAL). Four days later the remaining animals were sacrificed, serum samples were obtained and BAL performed. 20 Results As shown in Tables 14-16, a greater reduction in RSV titer is achieved with equivalent or lower lung levels of A4b4, A4b4-F52S, or A4b4/LIFR-S28R as with SYNAGIS@. 25 Table 14: Intramuscular Cotton Rat Prophylaxis Data g kgU2 m g kg IgG IgG Virus igG Virus (pg/ml) (pg/ml) (pfu/gm) Titer (pg/ml) (pg/ml) (pfu/gm) Titer ynagis 3.4 0.099 7.3x10 3 3.9 0.893 0.024 3.1x10 4 4.5 30 4b4-F52S 2.9 0.089 7.3x10 2 2.9 0.781 0.020 8.6x10 3 3.9 A4b4/L1FR-S28R 3.3 0.093 6.1x10 2 2.8 0.748 0.016 2.3x10 4 4.4 BSA 5.9x10 4 4.8 35 - 129- Table 15: Intramuscular Cotton Rat Prophylaxis Data 0.5mg/kg log(10) 1mg/kg log(10) Molecule Serum IgG Lung IgG Lung Virus Serum igG Lung IgG Lung pg/ml pg/ml 4g/ml jIg/ml Virus A4b4 2.4 0.013 4.3 3.1 0.094 3.4 5 Synagis 1.9 0.038 4.4 4.2 0.212 3.3 BSA 4.4 Table 16: Intramuscular Cotton Rat Pharmacokinetics Data 24 Hours 96 hours 10 Serum 1gG BAL igG Serum IgG BAL IgG Molecule (pg/ml) (ng/ml) (pg/ml) (ng/ml) A4b4 3.4 2.2 2.6 1.4 Synagis 4.1 5.3 2.8 3.5 15 12. EXAMPLE: IN VITRO ISOLATION OF SYNAGIS* SPECIFIC MONOCLONAL ANTIBODY RESISTANT MUTA\ TS(MARM) OF RSV STRAIN A/ LONG This example demonstrates that MARMs can be isolated from RSV laboratory strain A/ Long upon multiple rounds of selection in the presence of SYNAGIS@. 20 IMaterials: SYNAGIS* (formulated product: ref RN1002.148), Control Pan RSV MAb Pool (Chemicon MAB858-4, a blend of three MAbs anti-F, G, and N proteins), anti-RSV Type A MAb (Chemicon MAB858-1), and anti-RSV Type B MAb (Chemicon MAB858-2) were used in this study. Secondary detecting reagents were either AlexaTM488 conjugated Goat 25 F(ab') anti- Mouse or Human IgG (H+L). RSV A/ Long strain (5x107TCID50/ml) was propagateM 'fromM aster-Virus"BaiffUkT31797.' 1HEp'2 cefls were propagateadin'EMEM supplemented with 10% FBS and 2 mM L-Gln in a 37"C, 5% CO 2 environment. Total cellular RNAs were isolated from infected HEp-2 cells with the Promega RNAgents Kit. cDNAs were synthesized with the Boehringer Mannheim 1" Strand cDNA Synthesis Kit, 30 using Oligo- (dT) primer. Amplification of a fragment of the F protein for DNA sequencing was performed by Polymerase Chain Reaction (PCR), using gene-specific oligonucleotides (MR-120 and MR-122) and the Boehringer Mannheim High Fidelity PCR Kit. 35 - 130 - Methods: Selection of MARMs: 4 x 105 HEp-2 cells were seeded per well of a 24-well plate in growth medium (EMEM, 10% FBS, 2 mM L-Gln) and incubated overnight in growth conditions (37*C, 5% 5 C0 2 ). 40 wells were seeded for individual MARM selection. Prior to infection, a fresh vial of master virus bank RSV A/ Long was thawed rapidly at 37*C and the virus titer adjusted to 4x 106 pfu/ml in HEp-2 growth medium. SYNAGIS* was added to the virus inoculum at a final concentration of 30 pg/ml, and the mixture was incubated at 37*C for one hour. An aliquot of RSV was incubated with an irrelevant Human IgGl Mab (MEDI-507) and was 10 used as a negative control. An uninfected control well was also set up for each plate. Cells were washed once with fresh medium and were overlayed with 100 lil of RSV A/ Long virus stock/MAb mixture (multiplicity of infection [m.o.i.]= 4). Cells were incubated for four hours in growth conditions followed by addition of 1 ml of growth medium to each well. Cytopathic effect (CPE) was monitored on a daily basis by light microscopy. 15 Following seven days of selection the contents of each well were supplemented with a further 30 pg/ml of SYNAGIS* or irrelevant Human IgGI Mab, and were used to infect freshly seeded HEp-2 cells (4x105 cells/ well of 24-well plate). After a further seven days of selection the process was repeated one more time for a total of three rounds of selection. 20 Plaque Purification of MARMs: After the third round of selection, the contents of ten independent wells were chosen at random and used for plaque purification of MARMs. The remaining supernatants were mixed 1:1 with 50% sucrose solution and immediately frozen at -80"C. Supernatants were diluted 1:10, 1:100, and 1:1000 in growth medium and incubated with 30 ptg/ml of 25 SYNAGIS* for one hour prior to infection. I ml of virus inoculum was overlayed on monolayers of HEp-2 cells in 60mm round culture dishes (1x105 cells/ dish) and incubated for 4 hours in growth conditions. Following infection the inoculum was carefully aspirated and cells were overlayed with 3 ml growth medium supplemented with 0.8% low melting temperature agarose (Gibco BRL), and containing 30 pg/ml of SYNAGIS*. Dishes were 30 returned to the incubator after complete solidification of agarose and monitored daily for plaque formation. Uninfected controls and wild type RSV control plates were set up for comparison. After five to six days, each plate was overlayed with an additional 2 ml of 0.8% agarose in growth medium supplemented with 50 pg/ml neutral red. Following an overnight incubation in growth conditions, plaques were scored and picked for a second 35 round of purification. -131 - Amplification of clonal MARMs: Following a second round of plaque purification two clones from each isolate were expanded for production of high titer viral stocks. Individual plaques were picked with the aid of a pipet tip and incubated in 0.1 ml of fresh medium at 4*C overnight to elute the 5 virus. Each aliquot was used to infect HEp-2 cells in flat bottom 96-well plates (lx104 cells/ well) in the presence of 30 pg/ml SYNAGIS*. After five days the entire well content was used to infect HEp-2 cells in the presence of 30 ig/ml of SYNAGISOin 24-well plates. Each inoculum was subsequently expanded in the presence of 30 pg/ml of SYNAGIS'to a T-25 flask (x 106 cells/ flask) and 5 mis of high titer virus stock were produced. MARM 10 stocks were frozen as described above. F protein cDNA synthesis and DNA sequencing: In order to determine the nucleotide sequence of an approximately 400 nucleotide region of the F protein gene thought to contain the epitope for SYNAGIS*, First strand 15 cDNA synthesis was performed with total cellular RNAs isolated from MARM-infected HEp-2 cells at 4 days post-infection. Amplification of a fragment of the F protein for DNA sequencing was performed as described in Materials section. Amplified MARM F-protein cDNAs were purified by phenol/chloroform extraction and ethanol precipitation, and used in a PCR sequencing reaction with gene-specific oligos and Perkin-Elmer Cetus Big-Dye 20 Terminator reaction mix to sequence the relevant region. Immunofluorescence Assay (IFA): Cells infected with RSV isolates were tested for anti-RSV binding by SYNAGIS* and Control Pan RSV MAb Pool, as follows. Four to five day RSV-infected HEp-2 cultures 25 were mixed with PBS and centrifuged at 300xg for 5 minutes at room temperature. Pellets were resuspenadeain a sm~iil vdIume 6FoTPS Tor anIysis.~Five to ten niicrdliters d'fea6h cell suspension were spotted per 5 mm well on acetone washed 12-well HTC super cured glass slides and allowed to air dry. Slides were fixed in cold (-20*C) acetone for 10 minutes. Reactions were blocked by spotting 10 [l of 1% BSA in PBS into each well and incubating 30 for 10 minutes at room temperature. Slides were washed three times in IX PBS/ 0.1% Tween-20 and air-dried. Ten microliters of each primary antibody reagent diluted to 250 ng/ml in blocking buffer were spotted per well and reactions were incubated in a humidified 37"C environment for 30 minutes. Slides were then washed for 1 minute in three changes of IX PBS/ 0.1% Tween-20 and were air-dried. Ten microliters of appropriate secondary 35 conjugated antibody reagent diluted to 250 ng/ml in blocking buffer were added to each - 132respective well and reactions were incubated in a humidified 37*C environment for an additional 30 minutes. Slides were then washed for 1 minute in three changes of IX PBS/ 0.1% Tween-20. Five micro liters of 50% glycerol in PBS, 10 mM Tris, pH 8.0, 1 mM EDTA were spotted in each reaction well, and slides were mounted with cover slips. Each 5 reaction well was subsequently analyzed by fluorescence microscopy at 200X power using a B-2A filter (EX 450-490 nm). Positive reactions were scored against an auto-fluorescent background obtained with unstained cells or cells stained with secondary reagent alone. RSV positive reactions were characterized by bright fluorescence punctuated with small inclusions in the cytoplasm of infected cells. 10 Microneutralization Assay: The procedure used here is described in Johnson et al., 1999, J. Infectious Diseases 180:35-40, the disclosure of which is hereby incorporated by reference in its entirety. Briefly, antibody dilutions were made in triplicate using a 96-well plate. Ten TCID 5 0 of 15 RSV A MARMS were incubated with serial dilutions of the antibody to be tested for 2 hours at 37*C in the wells of a 96-well plate. The antibodies used in the assay comprised the heavy chain of SYNAGIS@, the heavy chain of SYNAGIS@ with a point mutation or the heavy chain of A4B4, and the light chain of SYNAGIS@, the light chain of SYNAGIS@ with point mutations, the light chain of A4B4 with point mutations, the light chain of A4B4 20 with point mutations, the light chain of LlFR (a.k.a. IX-493L1FR) or the light chain of LIFR with point mutations. Mab 13/19 was used in the assay as a positive control. RSV susceptible HEp-2 cells (2.5 x 104) were then added to each well and cultured for 5 days at 37'C in 5% CO 2 . After 5 days, the medium was aspirated and cells were washed and fixed to the plates with 80% methanol and 20% PBS. RSV replication was then determined by F 25 protein expression. Fixed cells were incubated with a biotin-conjugated anti-F protein monodlondl antibody (pan' protein, C-site-specificMAbT33-1H) washed and-horseradish peroxidase conjugated avidin was added to the wells. The wells were washed again and tumover of substrate TMB (thionitrobenzoic acid) was measured at 450 nm. The-results from the assay for the monoclonal antibodies are shown in Table 19 infra. 30 Results and Discussion: The binding activity of SYNAGIS* was tested by IFA against a panel of 20 RSV A/ Long MARMs obtained by three rounds of selection on HEp-2 cells in the presence of SYNAGIS*. A pool of monoclonal antibodies against the fusion, glycoprotein, and nuclear 35 proteins of RSV (Control Pan RSV MAb Pool) was used as a positive control for detection - 133 of RSV. Subtyping of RSV MARMs was performed with two monoclonal antibodies that distinguish type A and type B glycoproteins. As summarized in Table 17, lack of binding activity by SYNAGIS* was demonstrated in all 20 MARMs. Contrasting with lack of binding by SYNAGIS*, binding of the Control Pan RSV MAb Pool was demonstrated for 5 all MARMs tested. All 20 MARMs were classified as RSV type A. Wild type RSV A/ Long infected HEp-2 cells bound SYNAGIS*, Pan RSV MAb Pool, and RSV Type A MAb, but failed to react with RSV Type B MAb, as expected. DNA sequencing analysis of an approximately 400-nucleotide region of the RSV F protein cDNA encompassing the proposed SYNAGIS* epitope revealed a single mutation at 10 the amino-acid level at position 272. Table 18 shows the amino acid change at position 272 in twelve isolates sequenced to date. Although the entire nucleotide sequence of RSV MARMs F protein has not been determined, these results suggest that amino acid 272 is a critical residue in modulating the binding of SYNAGIS* to its epitope. The ability of various monoclonal antibodies to neutralize the replication of RSV A 15 MARMs was determined. As shown in Table 19, the ability of the monoclonal antibodies to neutralize the replication of RSV MARMs varied depending upon the amino acid sequence of the heavy chain (HC) and light chain (LC) of the antibody. Table 17. Characterization of anti-RSV Binding Activity by SYNAGIS*, Control Pan 20 RSV MAb Pool (anti-F, G, N proteins), anti-RSV Type A MAb, and anti RSV Type B MAb by Immunofluorescence Assay (IFA) on RSV A/ Long MARMs. Reactivity w/ Reactivity w/ Reactivity w/ Reactivity w/ RSV MARM SYNAGIS* anti-RSV MAb Pool anti-RSV type A MAb Anti-RSV type B MAb BI - + + 25 B2 - + + B3 - + + '94 + ____ B6 - + + B7 - + + B8 - + + 30 B9

-

+ + BIO - + + B11 - + + B12 - + + B13 - + + B14 - + + B15 - + + B16 - + + 35 B17 - + + Bi8 - + + -134- B19 -+ + . B20 - + + Wt RSV A/ + + + 5 Table 18. Amino acid sequence of a region of the wild type RSV A/ Long and MARMs F Protein encompassing the proposed SYNAGIS* epitope. Isolate Anino Acid Sequence (Position number) Wild type 266 267 268 269 270 271 272 273 274 275 276 277 278 279 10 I T N D Q K _ K L M S N N V Q MARM I T N D Q K N L M S N N V Q BI MARM I TN D Q K M L MS N NV Q B2 MARM I TN D Q K M LM S N N V Q 15 B3 MARM I T ND Q K M LM S N N V Q B4 MARM IT ND Q K M L M SN N V Q B6 MARM I TN D Q K TL MS N N V Q 20 B7 MARM N D Q M LMS N NV Q B8 MARM I T N DQ K Q L M SN N V Q B9 MARA I TN DQ K T LMSN N V Q 25 B10 MARM I T N DQ K Q L M SN N V Q B14 30 MARM I T N D Q KM L SN N V Q B1S 35 - 135 - -0 -ID -0 X) -0 .0 .0 -0 -0 -0 -0 0 4) 4.) 0 ) 0 In w V on M) 4 ) ( 1 ) 4 ) 4 )) m) 4 ) .0 0 1 : + , ± + + I I I I ca) CIO- ~ +< + I + + + + + ± I I I I I ~~ ~ + ± I + + + ± I I I I I S oA

-------------------------

0 '-.0 L k777 +. g +) Q* I

C--------------------------

(. ) .0 C l 3c ) .- C-) co0 00L 0 U3 V) V) co C4IV V H - -*- - - - - - - c n ) V. W~~ V) 0 ON ) a\C) Cl C) C' C/.) 0 C/ ) Co ~ ~ k Co C CD C C/ - -) Co Co C ~ Co 13. EXAMPLE: IN VITRO ISOLATION OF A4B4 SPECIFIC MONOCLONAL ANTIBODY RESISTANT MUTANTS (IARM) OF RSV STRAIN A/ LONG This example demonstrates that MARMs can be isolated from RSV laboratory strain A/ Long upon multiple rounds of selection in the presence of A4B4 5 Materials: A4B4 (Lot # 524-9, 3.57 mg /nl), Control Pan RSV MAb Pool (Chemicon MAB858-4, a blend of three MAbs anti-F, G, and N proteins), anti-RSV Type A MAb (Chemicon MA1858-1), and anti-RSV Type B MAb (Chemicon MAB858-2) were used in 10 this study. Secondary detecting reagents were either AlexaTM488 conjugated Goat F (ab'). anti- Mouse or Human IgG (H+L). Virus bank of RSV A/ Long strain NWVB020500 (2.38x10i

TCID

5 /ml) propagated from Master Virus Bank 031797. HEp-2 cells were propagated in EMEM supplemented with 10% FBS and 2 mM L-Gln in a 37*C, 5% CO 2 environment. Messanger RNA was purified from the infected cells using the mRNA Capture Kit (Roche). The mRNA samples were used to make cDNA using the reagents from the cDNA First Strand Reacition Kit (Roche), followed by amplification of the RSV F protein gene by the Polymerase Chain Reaction (PCR) using gene specific primers. Methods: Selection of MARMs: 4 x 10' HEp-2 cells were seeded per well of a 24-well plate in growth medium (EMEM, 10% FBS, 2 mM L-Gln) and incubated overnight in growth conditions (37"C, 5% CO,). 44 wells were seeded for individual MARM selection. Prior to infection, a fresh vial of virus bank RSV A/ Long was thawed rapidly at 37*C and the virus titer adjusted to 4x1 06 25 pfu/il in HEp-2 growth medium. A4B4 was added to the virus inoculum at a final concentration of 2 .t/ml. and the mixture was incubaf.cl 137C for oehwnu1.r..a of RSV was incubated with an irrelevant Human IgGI Mab (MEDI-507) and was used as a negative control. An uninfected control well was also set up for each plate. Cells were washed once with fresh medium and were overlayed with 100 pl. of RSV A/ Long virus 30 stock/MAb mixture. Cells were incubated for four hours in growth conditions followed by addition of 1 ml of growth medium to each well. Cytopathic effect (CPE) was monitored on a daily basis by light microscopy. Following seven days of selection the contents of each well were supplemented with a further 4 jig/mil of A4B4 or irrelevant Human IgG 1 Mab, 35 and were used to infect freshly seeded HEp-2 cells (4x 10' cells/ well of 24-well plate). After a further seven days of selection the process was repeated one more time for a total of - 138 three rounds of selection. The contents of wells showing clear CPE were mixed 1:1 with 50% sucrose solution and immediately frozen at -80*C Plaque Purification of MARMs: 5 After the third round of selection, the contents of two independent wells were chosen at random and used for plaque purification of MARMs. A fresh vial of MARM stock (was frozen after third round of selection) was thawed at room temperature and was diluted 1:10, 1:100, and 1:1000 in growth medium and incubated with 4 pg/ml of A4B4 for one hour prior to infection. 0.5 ml of virus inoculum was overlayed on monolayers of HEp 10 2 cells in 6 well plates (5x 10' cells/ well) and incubated for 4 hours in growth conditions. Following infection the inoculum was carefully aspirated and cells were overlayed with 2 ml growth medium supplemented with 0.8% low melting temperature agarose (Gibco BRL), and containing 4 pig/ml of A4B4. Dishes were returned to the incubator after complete solidification of agarose and monitored daily for plaque formation. Uninfected controls and 15 wild type RSV control plates were set up for comparison. After five to six days, each plate was overlayed with an additional 2 ml of 0.8% agarose in growth medium supplemented with 50 pg/ml neutral red. Following an overnight incubation in growth conditions, plaques were scored and picked for a second round of purification. 20 Amplification of clonal MARMs: Following a second round of plaque purification three clones from each isolate were expanded for production of high titer viral stocks. Individual plaques were picked with the aid of a pipet tip and incubated in 0.2 ml of fresh medium at 4*C overnight to elute the virus. Each aliquot was used to infect HEp-2 cells in flat bottom 24-well plates (2.5x 10' 25 cells/ well- seeded day before) in the presence of 4 ig/ml A4B4. After five days the entire we'l content was used to"infectiFiEp"2 cils-in (he presence of 4 jg/nil of A4b4'in24-wIll plates. Each inoculum was subsequently expanded in the presence of 4 pg/ml of A4b4 to a T-25 flask (6.5x10 5 cells/ flask - seeded day before) and 5 mls of high titer virus stock were produced. MARM stocks were frozen as described above. 30 F protein cDNA synthesis and DNA sequencmg: In order to determine the nucleotide sequence of an approximately 800 nucleotide region of the F protein gene thought to contain the epitope for SYNAGIS*, First strand cDNA synthesis was performed with mRNAs isolated from MARM-infected HEp-2 cells at 35 4 days post-infection. RSV infected Hep2 cells were lysed in 150 p 1 of lysis buffer - 139provided with the mRNA capture kit. Biotinylated oligo dT was diluted 1:10 with nuclease free H 2 0 and 4 p1 was added to each lysate. Samples were incubated 10 minutes at 42*C to allow the oligo dT to anneal to the mRNA. A 50 pl aliquot of the lysate was transferred to a streptavidin coated PCR tube and incubated for three minutes at 37*C. The lysates were 5 removed from the PCR tubes and discarded. The RNA captured in the tubes was washed three times with 200 lI of wash buffer. RT reactions were performed using reagents from the First Strand cDNA kit (Roche Molecular Biochemicals). A master mix was prepared so that each reaction contained 5 p1 10 X buffer, 5 p1 dNTPs, 10 il MgCl 2 , IpI gelatin, 2 p1 RNase Inhibitor, 2 V1 AMV-RT, in 10 a final volume of 50 pl. Fifty microliter aliquots of the master mix were transferred to the PCR tubes containing the captured mRNA. Samples were placed in a thermalcycler and incubated for two hours at 42 "C. The cDNA reaction mix was then removed from the PCR tubes and discarded. The cDNA captured in the PCR tubes was washed with 200 [1 of wash buffer To obtain enough of the RSV F protein gene for sequence analysis, the cDNA 15 was subjected to PCR using gene specific primers. Each reactions contained 10 mM Tris HCI, pH 8.3, 50 mM KCI, 2.5 mM MgCl,, 200 VM dNTPs, 125 ng of each forward (5'AGTGTCTTAACCAGCAAAGTGTTAGA 3'; SEQ ID NO:258) and reverse (5' TCATTGACTTGAGATATTGATGCATC 3'; SEQ ID NO:259) primer, and 2.5 units of Taq polymerase (PE Biosystems) in a final volume of 50 1g. The temperature profile for all 20 reactions was 95*C for 2 min, followed by 40 cycles of 95*C for 30 sec., 55*C for 45 sec, 72*C for 45 sec, with a final extension at 72*C for 10 minutes. All PCR products were separated by electrophoresis on a 2% agarose gel in IX TBE and visualized by ethidiurn bromide fluorescence. PCR products were purified using Qiaquick spin columns (Qiagen and sequenced 25 using the Big Dye-terminator PRISM kit (Applied Biosystems (ABI)). The reactions contined'7 ng of'CR product as template, 3 pmois of pimer, and 8.0 il of the'PRIS-M dye-tenninator reaction mix in a final volume of 20 pl. The reactions were subjected to thermal cycling according to ABI's dye-tenninator sequencing instructions. Unincorporated dyes were removed from the extension products using Centri-Sep spin columns (Princeton 30 Separations). Extension products were .ried in a Savant Speed Vac and then dissolved in 10 ul HiDi Formamide (ABI) loading buffer. Samples were applied by electrophoresis in an ABI 3100 automated sequencer. Sequence data collected by the sequencer was analyzed using Lasargene (DNA Star). 35 - 140- Immunofluorescence Assay (IFA): Cells infected with RSV isolates were tested for anti-RSV binding by A4B4, SYNAGIS* and Control Pan RSV MAb Pool, as follows. Four to five day RSV-infected HEp-2 cultures were mixed with PBS and centrifuged at 300xg for 5 minutes at room 5 temperature. Pellets were resuspended in a small volume of PBS for analysis. Five to ten micro liters of each cell suspension were spotted per 5 nun well on acetone washed 12-well HTC supercured glass slides and allowed to air dry. Slides were fixed in cold (-20*C) acetone for 10 minutes. Reactions were blocked by spotting 10 pd of 1% BSA in PBS into each well and incubating for 10 minutes at room temperature. Slides were washed 10 three times in IX PBS/ 0.1% Tween-20 and air-dried. Ten micro liters of each primary antibody reagent diluted to 250 ng/ml in blocking buffer were spotted per well and reactions were incubated in a humidified 37*C environment for 30 minutes. Slides were then washed for I minute in three changes of IX PBS/ 0.1% Tween-20 and were air-dried. Ten micro liters of appropriate secondary conjugated antibody reagent diluted to 250 ng/ml in blocking 15 buffer were added to each respective well and reactions were incubated in a humidified 37"C environment for an additional 30 minutes. Slides were then washed for 1 minute in three changes of IX PBS/ 0.1% Tween-20. Five micro liters of 50% glycerol in PBS, 10 m\4 Tris, pH 8.0, 1 mM EDTA were spotted in each reaction well, and slides were mounted with cover slips. Each reaction well was subsequently analyzed by fluorescence microscopy 20 at 200X power using a B-2A filter (EX 450-490 nm). Positive reactions were scored against an auto fluorescent background obtained with unstained cells or cells stained with secondary reagent alone. RSV positive reactions were characterized by bright fluorescence punctuated with small inclusions in the cytoplasm of infected cells. 25 "Microneutralization Assay: The procedure used here is described in Johnson et al., 1999, J. hifectious Diseases 180:35-40, the disclosure of which is hereby incorporated by reference in its entirety. Briefly, antibody dilutions were made in triplicate using a 96-well plate. Ten TCID 5 of 30 RSV A MARMS were incubated with serial dilutions of the antibody to be tested for 2 hours at 37*C in the wells of a 96-well plate. The antibodies used in the assay comprised the heavy and light chain of SYNAGIS@, the heavy and light chain of A4b4, the combination of the heavy and light chain of SYNAGIS@ and A4b4, the SYNAGIS@ heavy chain or light chain with a point mutation in light chain or heavy chain, or A4b4 heavy 35 chain with point mutations in light chain. Mab 13/19 was used as a positive control in the - 141 assay. RSV susceptible HEp-2 cells (2.5 x 10') were then added to each well and cultured for 5 days at 37*C in 5% CO. After 5 days, the medium was aspirated and cells were washed and fixed to the plates with 80% methanol and 20% PBS. RSV replication was then detennined by F protein expression. Fixed cells were incubated with a biotin-conjugated 5 anti-F protein monoclonal antibody (pan F protein, C-site-specific MAb 133-1H1) washed and horseradish peroxidase conjugated avidin was added to the wells. The wells were washed again and turnover of substrate TMB (thionitrobenzoic acid) was measured at 450 run. The results from the assay for the monoclonal antibodies are shown in Table 22 infra. 10 Results and Discussion: The binding activity of A4B4 was tested by IFA against a panel of RSV A/ Long MARMs obtained by three rounds of selection on HEp-2 cells in the presence of SYNAGIS*. A pool of monoclonal antibodies against the fusion, glycoprotein, and nuclear proteins of RSV (Control Pan RSV MAb Pool) was used as a positive control for detection 15 of RSV. Subtyping of RSV MARMs was performed with two monoclonal antibodies that distinguish type A and type B glycoproteins. As summarized in Table 20, lack of binding activity by A4B4 and SYNAGIS* was demonstrated in MARMs. Contrasting with lack of binding by A4B4 and SYNAGIS*, binding of the Control Pan RSV MAb Pool was demonstrated for all MARMs tested. Both MARMs were classified as RSV type A. Wild 20 type RSV A/ Long infected HEp-2 cells bound to A4B4 and SYNAGIS*, Pan RSV MAb Pool, and RSV Type A MAb, but failed to react with RSV Type B MAb, as expected. DNA sequencing analysis of an approximately 800-nucleotide region of the RSV F protein cDNA encompassing the proposed A4B4 epitope revealed mutation at the amino acid level at position 272 and 276. Table 21 shows the amino acid change in isolates 25 sequenced to date. Although the entire nucleotide sequence of RSV MARMs F protein has o1t"tee ;irn esi'riow '272 1W17% is a iieO rre~idue imodulannrg the 'mmg ofi A4IS4 'toits epitope. The ability of various monoclonal antibodies to neutralize the replication of a RSV A MARM was detennined. As shown in Table 22, the ability of the monoclonal antibodies 30 to neutralize the replication of a RSV MARM varied depending upon the amino acid sequence of the heavy chain (HC) and light chain (LC) of the antibody. 35 - 142 - OS CI a +Y Co CC t~-Z Z z z C14 <. - r-~ t-C/C) ) C) > C2 C - - - CfjLL. ~ . U2 0 .Zi.L, . +~~o + +C) CA4 ~ 4 0 cn ct1)nd .. r o V, 0~ C- - -Z_ 6 21) H / :I -* - Table 22. MARM analysis by Microneutralization Assay RSV Microneutralization Assay On RSV A MARMs to A4B4 with RSV Monoclonal Antibody 5 K_(272E, N276Y Antibody . ARM to Note HiC/LC MARM 10 SYNAGIS®/SYNAGIS@

-

urified Al A4B4/A4B4 - Purified At A4b4/SYNAGIS@ - Purified At 10 SYNAGIS@/A4B4 - urified Ab A4B4/LIFR Purified At A4B4/L1FR S28R - Purified A A4B4/LIFR S28R, S52F - purified At A4B4/LIFR-28R, 52F, 93F

-

urified A 15 A4B4/A4B428S - urified A A4B4/A4B452S - urified At Mab 3/19 + urified At = neutralization detected; - no neutralization detected 20 14. EXAMPLE: IN VITRO ISOLATION OF A4B4 SPECIFIC ~ MONOCLONAL ANTIBODY RESISTANT MUTANTS (MARM) OF MARM B9( MARM OF RSV STRAIN A/ LONG TO SYNAGIS) This example demonstrates that MARMs can be isolated from MARM of RSVA long to Synagis (MARM B9) upon multiple rounds of selection in the presence of A4B4 25 .A 4B34 (Edo~ #I.524 -9,.3.. 57mg. /xv 1 Contm1 .Pm~iSV MAb .P,\ [(shtme MAB858-4, a blend of three MAbs anti-F, G, and N proteins), anti-RSV Type A MAb (Chemicon MAB85S-1), and anti-RSV Type B MAb (Chemicon MABS58-2) were used in 3 this study. Secondary detecting reagents were either AlexaTMl488 conjugated Goat F (ab'), anti- Mouse or Human IgG (H+L). MARM B9 (1.78x10 6 TCID /ml) was used here. HEp 2 cells were propagated in EMEM supplemented with 10% FBS and 2 mM L-Gln in a 37*C, 5% CO 2 environment. Messanger RNA was purified from the infected cells using the mRNA Capture Kit (Roche). The mRNA samples were used to make cDNA using the reagents from the cDNA First Strand Reacition Kit (Roche), followed by amplification of 35 -144the RSV F protein gene by the Polymerase Chain Reaction (PCR) using gene specific primers. Methods: 5 Selection of MARMs: 4 x 10' HEp-2 cells were seeded per well of a 24-well plate in growth medium (EMN4EM, 10% FBS, 2 mM L-Gln) and incubated overnight in growth conditions (37"C, 5% C0 2 ). 44 wells were seeded for individual MARM selection. Prior to infection, a fresh vial of virus bank MARM B9 was thawed rapidly at 37"C and the virus titer adjusted to 6x10 5 10 pfulnl in HEp-2 growth medium. A4B4 was added to the virus inoculum at a final concentration of 2 g/mil, and the mixture was incubated at 37"C for one hour. An aliquot of RSV was incubated with an irrelevant Human IgGI Mab (MEDI-507) and was used as a negative control. An uninfected control well was also set up for each plate. Cells were washed once with fresh medium and were overlayed with 100 il of RSV A/ Long virus 15 stock/MAb mixture. Cells were incubated for four hours in growth conditions followed by addition of I ml of growth medium to each well. Cytopathic effect (CPE) was monitored on a daily basis by light microscopy. Following seven days of selection the contents of each well were supplemented with a further 4 pg/ml of A4B4 or irrelevant Human IgGI Mab, and were used to infect freshly seeded HEp-2 cells (4x 10' cells/ well of 24-well plate). 20 After a further seven days of selection the process was repeated one more time for a total of three rounds of selection. The contents of wells showing clear CPE were mixed 1:1 with 50% sucrose solution and immediately frozen at -80"C Plaque Purification of MARMs: 25 After the third round of selection, the contents of independent wells were used for P'iaque puffficafion o' M WRMs. A"fresh Viil o'fMARM stoek'was'rozen dfter tuirii rowfn of selection) was thawed at room temperature and was diluted 1:10, 1:100, and 1:1000 in growth medium and incubated with 4 pg/il of A4B4 for one hour prior to infection. 0.5 ml of virus inoculum was overlayed on monolayers of HEp-2 cells in 6 well plates (5x10 5 cells/ 30 well) and incubated for 4 hours in growth conditions. Following infection the inoculum was carefully aspirated and cells were overlayed with 2 ml growth medium supplemented with 0.8% low melting temperature agarose (Gibco BRL), and containing 4 ptg/ml of A4B4. Dishes were returned to the incubator after complete solidification of agarose and monitored daily for plaque fonnation. Uninfected controls and MARM B9 RSV control plates were 35 set up for comparison. After five to six days, each plate was overlayed with an additional 2 - 145 ml of 0.8% agarose in growth medium supplemented with 50 pg/ml neutral red. Following an overnight incubation in growth conditions, plaques were scored and picked for a second round of purification. 5 Amplification of clonal MARMs: Following a second round of plaque purification three clones from isolate were expanded for production of high titer viral stocks. Individual plaques were picked with the aid of a pipet tip and incubated in 0.2 ml of fresh medium at 4*C overnight to elute the virus. Each aliquot was used to infect HEp-2 cells in flat bottom 24-well plates (2.5x105 10 cells/ well- seeded day before) in the presence of 4 pg/ml A4B4. After five days the entire well content was used to infect HEp-2 cells in the presence of 4 tg/lml of A4B4 in 24-well plates. Each inoculum was subsequently expanded in the presence of 4 ptg/ml of A4B4 to a T-25 flask (6.5x I05 cells/ flask - seeded day before) and 5 mls of high titer virus stock were produced. MARMA stocks were frozen as described above. 15 F protein cDNA synthesis and DNA sequencing: In order to determine the nucleotide sequence of an approximately 800 nucleotide region of the F protein gene thought to contain the epitope for SYNAGIS*, First strand cDNA synthesis was performed with mRNAs isolated from MARM-infected HEp-2 cells at 20 4 days post-infection. RSV infected Hep2 cells were lysed in 150 pl of lysis buffer provided with the mRNA capture kit. Biotinylated oligo dT was diluted 1:10 with nuclease free HO and 4 p1 was added to each lysate. Samples were incubated 10 minutes at 42*C to allow the oligo dT to anneal to the mRNA. A 50 pl aliquot of the lysate was transferred to a streptavidin coated PCR tube and incubated for three minutes at 37*C. The lysates were 25 removed from the PCR tubes and discarded. The RNA captured in the tubes was washed three irmes vith"200 li of wash'bfifer. 'l reactions were performed using reagents from the First Strand cDNA kit (Roche Molecular Biochemicals). A master mix was prepared so that each reaction contained 5 1 10 X buffer, 5 V1 dNTPs, 10 pl MgCl 2 , I pl gelatin, 2 il RNase Inhibitor, 2 p] AMV-RT, in 30 a final volume of 50 pl. Fifty microliter aliquots of the master mix were transferred to the PCR tubes containing the captured mRNA. Samples were placed in a thermalcycler and incubated for two hours at 42'C. The cDNA reaction mix was then removed from the PCR tubes and discarded. The cDNA captured in the PCR tubes was washed with 200 p1l of wash buffer To obtain enough of the RSV F protein gene for sequence analysis, the cDNA 35 was subjected to PCR using gene specific primers. Each reactions contained 10 mM Tris - 146 - HCl, pH 8.3, 50 mM KCI, 2.5 mM MgCl 2 , 200 ptM dNTPs, 125 ng of each forward (5'AGTGTCTTAACCAGCAAAGTGTTAGA 3'; SEQ ID NO:258) and reverse (5' TCATTGACTTGAGATATTGATGCATC 3'; SEQ ID NO:259) primer, and 2.5 units of Taq polymerase (PE Biosystems) in a final volume of 50 pl. The temperature profile for all 5 reactions was 95'C for 2 min, followed by 40 cycles of 95 C for 30 sec., 55'C for 45 sec, 72'C for 45 see, with a final extension at 72'C for 10 minutes. Al PCR products were separated by electrophoresis on a 2% agarose gel in IX TBE and visualized by ethidiui bromide fluorescence. PCR products were purified using Qiaquick spin columns (Qiagen and sequenced 10 using the Big Dye-terminator PRISM kit (Applied Biosystenis (ABI)). The reactions contained 70 ng of PCR product as template, 3 pmols of primer, and 8.0 pl of the PRISM dye-terminator reaction mix in a final volume of 20 pl. The reactions were subjected to thermal cycling according to ABI's dye-terninator sequencing instructions. Unincorporated dyes were removed from the extension products using Centri-Sep spin columns (Princeton 15 Separations). Extension products were dried in a Savant Speed Vac and then dissolved in 10 pl HiDi Fornamide (ABI) loading buffer. Samples were applied by electrophoresis in an ABI 3100 automated sequencer. Sequence data collected by the sequencer was analyzed using Lasargene (DNA Star). 20 Immunofluorescence Assav (IFA): Cells infected with RSV isolates were tested for anti-RSV binding by A4B4, SYNAGIS*. and Control Pan RSV MAb Pool, as follows. Four to five day RSV-infected HEp-2 cultures were mixed with PBS and centrifuged at 300xg for 5 minutes at room temperature. Pellets were resuspended in a small volume of PBS for analysis. Five to ten 25 micro liters of each cell suspension were spotted per 5 mm well on acetone washed 12-well p o r ii d a lw e a r d y . S li 'd e r e e r e d n -cC acetone Yor I'O ninites. 'Rcactions were'biodked by spotting 1 jll of 1% B'SA'inTFBS'imto each well and incubating for 10 minutes at room temperature. Slides were washed three times in IX PBS/ 0.1% Tween-20 and air-dried. Ten micro liters of each primary antibody 30 reagent diluted to 250 ng/ml in blocking buffer were spotted per well and reactions were incubated in a humidified 37*C environment for 30 minutes. Slides were then washed for 1 minute in three changes of IX PBS/ 0.1% Tween-20 and were air-dried. Ten micro liters of appropriate secondary conjugated antibody reagent diluted to 250 ng/ml in blocking buffer were added to each respective well and reactions were incubated in a humidified 37*C 35 envirorunent for an additional 30 minutes. Slides were then washed for 1 minute in three - 147changes of IX PBS/ 0.1% Tween-20. Five micro liters of 50% glycerol in PBS, 10 mM Tris, pH 8.0, 1 mM EDTA were spotted in each reaction well, and slides were mounted with cover slips. Each reaction well was subsequently analyzed by fluorescence microscopy at 200X power using a B-2A filter (EX 450-490 nm). Positive reactions were scored against 5 an auto fluorescent background obtained with unstained cells or cells stained with secondan reagent alone. RSV positive reactions were characterized by bright fluorescence punctuated with small inclusions in the cytoplasm of infected cells. 10 Microneutralization Assay: The procedure used here is described in Johnson et al., 1999, J. Infectious Diseases 180:35-40, the disclosure of which is hereby incorporated by reference in its entirety. Briefly, antibody dilutions were made in triplicate using a 96-well plate. Ten TCID, 0 of RSV A MARMS were incubated with serial dilutions of the antibody to be tested for 2 15 hours at 37*C in the wells of a 96-well plate. The antibodies used in the assay comprised the heavy chain of SYNAGIS@ or the heavy chain of A4B4, and the light chain of SYNAGIS@, the light chain of A4B4, the light chain of A4B4 with a point mutation, the light chain of LIFR or the light chain of LIFR with point mutations. Mab 13/19 was used as a positive control in the assays. RSV susceptible HEp-2 cells (2.5 x 104) were then added 20 to each well and cultured for 5 days at 37'C in 5% CO 2 . After 5 days, the medium was aspirated and cells were washed and fixed to the plates with 80% methanol and 20% PBS. RSV replication was then determined by F protein expression. Fixed cells were incubated with a biotin-conjugated anti-F protein monoclonal antibody (pan F protein, C-site-specific MAb 133-1H) washed and horseradish peroxidase conjugated avidin was added to the 25 wells. The wells were washed again and turnover of substrate TMB (thionitrobenzoic acid) snown in'T fole25 mp-ra. Results and Discussion: 30 The binding activity of A4B4 was tested by IFA against a MARM obtained by three rounds of selection on HEp-2 cells in the presence of A4B4. A pool of monoclonal antibodies against the fusion, glycoprotein, and nuclear proteins of RSV (Control Pan RSV MAb Pool) was used as a positive control for detection of RSV. Subtyping of RSV MARMs was performed with two monoclonal antibodies that distinguish type A and type B 35 glycoproteins. As summarized in Table 23, lack of binding activity by A4B4 and - 148 - SYNAGIS* was demonstrated in both MARMs. Contrasting with lack of binding by A4B4 and SYNAGIS*, binding of the Control Pan RSV MiAb Pool was demonstrated for all MARMs tested. Both MARMs were classified as RSV type A. Wild type RSV A/ Long infected HEp-2 cells bound to A4B4 and SYNAGIS*, Pan RSV MAb Pool, and RSV Type 5 A MAb. but failed to react with RSV Type B MAb, as expected. DNA sequencing analysis of an approximately 800 nucleotide region of the RSV F protein cDNA encompassing the proposed A4B4 epitope revealed mutation at the amino acid level at position 272 and 262. Table 24 shows the amino acid change in isolates sequenced to date. Although the entire nucleotide sequence of RSV MARMs F protein has 10 not been determined, these results suggest that amino acid 272 and 262 is a critical residue in modulating the binding of A4B4 to its epitope. The ability of various monoclonal antibodies to neutralize the replication of RSV A MARMs was determined. As shown in Table 25, the ability of the monoclonal antibodies to neutralize the replication of RSV MARMs varied depending upon the amino acid 15 sequence of the heavy chain (HC) and light chain (LC) of the antibody. Table 23. Characterization of anti-RSV Binding Activity by A4B4, SYNAGIS*, Control Pan RSV MAb Pool (anti-F, G, N proteins), anti-RSV Type A MAb, and anti-RSV Type B MAb by Immunofluorescence Assay (IFA) on RSV A/ Long MARMs. 20 Reactivity w/ Reactivity w/ R i Reactivity w/ Reactit RSV MARM sample synagis* Anti-RSVMAb Pool Anti-RSV type A MAb Anti-RSV type B MAb A MARM #13 -+ ~ + B9 + + 25 30 35 - 149 - 00 00 >- r-> > r-4 -- * 0 ~ ~ 0 r- C/ t- V) 0 NtI 1 2 .) 4 ) 4 ) 0 0 r0 00 U)CIN U C/) C.N(NC 00A C14 C.N L) m a C .- ....-.....

5~4 LO) 0 Cf cu 0. (14) *-u(N -le CN (N <1' to~ o 0 cz 15. EXAMPLE: CLINICAL TRIALS Antibodies of the invention or fragments thereof tested in in vitro assays and animal models may be further evaluated for safety, tolerance and pharmacokinetics in groups of normal healthy adult volunteers. The volunteers are administered intramuscularly, 5 intravenously or by a pulmonary delivery system a single dose of 0.5 mg/kg, 3 mg/kg, 5 mg/kg, 10 mg/kg or 15 mg/kg of an antibody or fragment thereof which immunospecifically binds to a RSV antigen. Each volunteer is monitored at least 24 hours prior to receiving the single dose of the antibody or fragment thereof and each volunteer will be monitored for at least 48 hours after receiving the dose at a clinical site. Then volunteers are monitored as 10 outpatients on days 3, 7, 14, 21, 28, 35. 42, 49, and 56 postdose. Blood samples are collected via an indwelling catheter or direct venipuncture using 10 ml red-top Vacutainer tubes at the following intervals: (1) prior to administering the dose of the antibody or antibody fragment; (2) during the administration of the dose of the antibody or antibody fragment; (3) 5 minutes, 10 minutes, 15 minutes. 20 minutes, 30 15 minutes, 1 hour, 2 hours, 4 hours, 8 hours, 12 hours, 24 hours, and 48 hours after administering the dose of the antibody or antibody fragment; and (4) 3 days, 7 days 14 days, 21 days, 2S days, 35 days, 42 days, 49 days, and 56 days after administering the dose of the antibody or antibody fragment. Samples are allowed to clot at room temperature and serum will be collected after centrifugation. 20 The antibody or antibody fragment is partially purified from the serum samples and the amount of antibody or antibody fragment in the samples will be quantitated by ELISA. Briefly, the ELISA consists of coating microtiter plates overnight at 4 C with an antibody that recognizes the antibody or antibody fragment administered to the volunteer. The plates are then blocked for approximately 30 minutes at room temperate with PBS-Tween-0.5% 25 BSA. Standard curves are constructed using purified antibody or antibody fragment, not hniinist-r&'to a vdoriteer. '-ampes -are dilute&~m'F2Tween:'SA. The rarnple and standards are incubated for approximately 1 hour at room temperature. Next, the bound antibody is treated with a labeled antibody (e.g., horseradish peroxidase conjugated goat anti-human IgG) for approximately 1 hour at room temperature. Binding of the labeled 30 antibody is detected, e.g., by a spectrophotometer. The concentration of antibody or antibody fragment levels in the serum of volunteers are corrected by subtracting the predose serum level (background level) from the serum levels at each collection interval after administration of the dose. For each volunteer the pharmacokinetic parameters are computed according to the model-independent approach 35 -151 - (Gibaldi et al., eds., 1982, Pharinacokinetics, 2 "d edition, Marcel Dekker, New York) from the corrected serum antibody or antibody fragment concentrations. Equivalents 5 Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims. All publications, patents and patent applications mentioned in this specification are 1 0 herein incorporated by reference into the specification to the same extent as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated herein by reference. 15 20 -5 30 35 - 152 -

Claims (188)

1. An antibody comprising a variable heavy (VIH) domain having an amino acid sequence of SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:17, SEQ ID NO:24, SEQ ID NO:28, 5 SEQ ID NO:33, SEQ ID NO:36, SEQ ID NO:40, SEQ FD NO:44, SEQ ID NO:48, SEQ ID NO:51, SEQ ID NO:55, SEQ ID NO:67, or SEQ ID NO:78, wherein said antibody imnunospecifically binds to a respiratory syncytial virus (RSV) antigen and said antibody is not SYNAGIS@. 10 2. An antibody comprising a variable light (VL) domain having an amino acid sequence of SEQ ID NO:8, SEQ ID NO:] 3, SEQ ID NO:2 1, SEQ ID NO:26, SEQ ID NO:30. SEQ ID NO:34, SEQ ID NO:38, SEQ ID NO:42, SEQ ID NO:46, SEQ ID NO:49, SEQ ID NO:52, SEQ ID NO:54, SEQ ID NO:56, SEQ ID NO:58, SEQ ID NO:60, SEQ ID NO:62, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:68, SEQ ID NO: 70, SEQ ID NO:71, 15 SEQ ID NO:74 or SEQ ID NO:76, wherein said antibody inununospecifically binds to a RSV antigen and said antibody is not SYNAGIS@.

3. The antibody of claim I which also comprises a VL domain having an amino acid sequence of SEQ ID NO:8, SEQ ID NO:13, SEQ ID NO:21. SEQ ID NO:26, SEQ ID 20 NO:30. SEQ ID NO:34, SEQ ID NO:38, SEQ ID NO:42, SEQ ID NO:46, SEQ ID NO:49, SEQ ID NO:52, SEQ ID NO:54, SEQ ID NO:56, SEQ ID NO:58, SEQ ID NO:60, SEQ ID NO:62, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:68, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:74 or SEQ ID NO:76. 25 4. An antibody comprising a VH complementarity determining region (CDR)1 t afin -anino acid-sequienve )Yf't3EW~'lN&. ,SEQ? ~ TBO1'0, SEQ TIN&' 1 ,-wrinm said antibodyi mnospecificaYiy"6inds to aRSV antigen and'is noT'S'fqAGYS@.

5. An antibody comprising a VH CDR2 having an amino acid sequence of SEQ 30 ID NO:2, SEQ ID NO:19, SEQ ID NO:25, SEQ ID NO:37, SEQ ID NO:41, SEQ ID NO:45, SEQ fD NO:82, SEQ ID NO:86, SEQ ID NO:91, SEQ ID NO:93, SEQ ID NO:100, SEQIDNO:103, SEQlDNO:105,SEQIDNO:109,SEQ DNO:111,orSEQIDNO:114, wherein said antibody irmunospecifically binds to a RSV antigen and is not SYNAGIS@. 35 -153 -

6. An antibody comprising a VH CDR3 having an amino acid sequence of SEQ ID NO:3, SEQ ID NO:12, SEQ ID NO:20, SEQ ID NO:29, SEQ ID NO:79, SEQ ID NO:83, SEQ ID NO:94 or SEQ ID NO:97, wherein said antibody immunospecifically binds to a RSV antigen and is not SYNAGIS®. 5

7. An antibody comprising a VL CDRI having an amino acid sequence of SEQ ID NO:4, SEQ ID NO:14, SEQ ID NO:22, SEQ ID NO:31, SEQ ID NO:39 or SEQ ID NO:47, SEQ ID NO:80, SEQ ID NO:84, SEQ ID NO:87, SEQ ID NO:89, SEQ ID NO:92, SEQ ID NO:95, SEQ ID NO:98, SEQ ID NO:101, SEQ ID NO:104, SEQ ID NO:107, SEQ 10 ID NO:I10, SEQ ID NO:112, SEQ ID NO:115, SEQ ID NO:117, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:122, SEQ ID NO:125, SEQ ID NO:127, SEQ ID NO:129, SEQ ID NO: 130, SEQ ID NO:132, SEQ ID NO:134, SEQ ID NO:136, SEQ ID NO:138, SEQ ID NO:140, SEQ ID NO:142, SEQ ID NO:144, SEQ ID NO:146, SEQ ID NO:148, SEQ ID NO:150, SEQ ID NO:152, SEQ ID NO:153, SEQ ID NO:155, SEQ ID NO:157, SEQ ID 15 NO:159, SEQ ID NO:161, SEQ ID NO:163, SEQ ID NO:166, SEQ ID NO:168, SEQ ID NO:169., SEQ ID NO:171. SEQ ID NO:173, SEQ ID NO:175, SEQ ID NO:177, SEQ ID NO:179, SEQ ID NO:180, SEQ ID NO:181, SEQ ID NO:182, SEQ ID NO:183, SEQ ID NO:184, SEQ ID NO:185, SEQ ID NO:186, SEQ ID NO:187, SEQ FD NO:188, SEQ ID NO:189. SEQ ID NO:190, SEQ ID NO:191, SEQ ID NO:192, SEQ ID NO:193, SEQ ID 20 NO:194, SEQ ID NO:195, SEQ ID NO:196, SEQ ID NO:197, SEQ ID NO:198, SEQ ID NO:199, SEQ ID NO:200, SEQ ID NO:201, SEQ ID NO:202, SEQ ID NO:203, SEQ ID NO:204, SEQ ID NO:205, SEQ ID NO:206, or SEQ ID NO:207, wherein said antibody immunospecifically binds to a RSV antigen and is not SYNAGIS®. 25

8. An antibody comprising a VL CDR2 having an arnino acid sequence of SEQ 'ID N':,"SBQ ID 'N MS;SEQ TD"NG023,'BEQ ID'NG27,"SEQ lD'NGO32,"'EQ'1D NO:35, SEQ ID NO:43, SEQ ID NO:50, SEQ ID NO:53, SEQ ID NO:57, SEQ ID NO:59, SEQ ID NO:63, SEQ ID NO:66, SEQ ID NO:69, SEQ ID NO:73, SEQ ID NO:75, SEQ ID NO:77, SEQ ID NO:81, SEQ ID NO:85, SEQ ID NO:88, SEQ ID NO:90, SEQ ID NO:96, 30 SEQ ID NO:99, SEQ ID NO:102, SEQ ID NO:105, SEQ ID NO:108, SEQ ID NO:113, SEQ ID NO: 116, SEQ ID NO: 118, SEQ ID NO:121, SEQ ID NO:123, SEQ ID NO:124, SEQ ID NO:126, SEQ ID NO:128, SEQ ID NO:131, SEQ ID NO:133, SEQ ID NO:135, SEQ ID NO:137, SEQ ID NO:139, SEQ ID NO:141, SEQ ID NO:143, SEQ ID NO:145, SEQ ID NO:147, SEQ ID NO:149, SEQ ID NO:151, SEQ ID NO:154, SEQ ID NO:156, 35 SEQ ID NO:158, SEQ ID NO:160, SEQ ID NO:162, SEQ ID NO:164, SEQ ID NO:165, - 154- SEQ ID NO: 167, SEQ ID NO: 170, SEQ ID NO: 172, SEQ ID NO: 174, SEQ ID NO: 176, or SEQ ID NO: 178, wherein said antibody immunospecifically binds to a RSV antigen and is not SYNAGIS@. 5 9. An antibody comprising a VL CDR3 having an amino acid sequence of SEQ ID NO:6, SEQ ID NO: 16, or SEQ ID NO:61, wherein said antibody iimmunospecifically binds to a RSV antigen and is not SYNAGIS@.

10. The antibody of claim 4 further comprising a VH CDR2 having an amino 10 acid sequence of SEQ ID NO:2, SEQ ID NO:19. SEQ ID NO:25, SEQ ID NO:37, SEQ ID NO:4 1, SEQ ID NO:45, SEQ ID NO:82, SEQ ID NO:86, SEQ ID NO:91, SEQ ID NO:93, SEQ ID NO:100, SEQ ID NO:103, SEQ ID NO:105, SEQ ID NO:109, SEQ ID NO:1 11, or SEQ ID NO:1 14. 15 11. The antibody of claim 4 further comprising a VH CDR3 having an amino acid sequence of SEQ ID NO:3, SEQ ID NO:12. SEQ ID NO:20, SEQ ID NO:29, SEQ ID NO:79, SEQ ID NO:83. SEQ ID NO:94 or SEQ ID NO:97.

12. The antibody of claim 4 further comprising a VI-I CDR2 having an amino 20 acid sequence of SEQ ID NO:2, SEQ ID NO:19, SEQ ID NO:25, SEQ ID NO:37, SEQ ID NO:4 1, SEQ ID NO:45, SEQ ID NO:82, SEQ ID NO:86, SEQ ID NO:91, SEQ ID NO:93, SEQ ID NO:100, SEQ ID NO:103, SEQ ID NO:105, SEQ [D NO:109, SEQ ID NO:1 11, or SEQ ID NO: 114, and a VH CDR3 having an amino acid sequence of SEQ ID NO:3, SEQ ID NO:12, SEQ ID NO:20, SEQ ID NO:29, SEQ ID NO:79, SEQ ID NO:83, SEQ ID 25 NO:94 or SEQ ID NO:97. G. he usiuy~fcanm. fu ,r m~iega VL CDR2i havingL am zmrm acid sequence of SEQ ID NO:4, SEQ [D NO:14, SEQ TD NO:22, SEQ ID NO:31, SEQ ID NO:39 or SEQ ID NO:47, SEQ ID NO:80, SEQ ID NO:84, SEQ ID NO:87, SEQ ID 30 NO:89, SEQ ID NO:92, SEQ ID NO:95, SEQ ID NO:98, SEQ ID NO:101, SEQ ID NO:104, SEQ ID NO:107, SEQ ID NO:1 10, SEQ ID NO: 112, SEQ ID NO: 115, SEQ ID NO:117, SEQ ID NO:119, SEQ fD NO:120, SEQ ID NO:122, SEQ ID NO:125, SEQ ID NO: 127, SEQ ID NO:129, SEQ ID NO:130, SEQ ID NO:132, SEQ ID NO:134, SEQ ID NO:136, SEQ ID NO:138, SEQ ID NO:140, SEQ ID NO:142, SEQ ID NO:144, SEQ ID 35 NO:146, SEQ ID NO:148, SEQ ID NO:150, SEQ ID NO:152, SEQ ID NO:153, SEQ ID - 155 - NO: 155, SEQ ID NO: 157, SEQ ID NO: 159, SEQ ID NO: 161, SEQ ID NO:1 63, SEQ ID NO:166., SEQ ID NO:168, SEQ ID NO:169, SEQ ID NO:171, SEQ ID NO:173, SEQ ID NO:175, SEQ ID NO:177, SEQ ID NO:179, SEQ ID NO:180, SEQ ID NO:181, SEQ ID NO:182, SEQ ID NO:183, SEQ ID NO:184, SEQ ID NO: 185, SEQ ID NO:186, SEQ ID 5 NO:IS7, SEQ ID NO:188, SEQ ID NO:189, SEQ ID NO:190, SEQ ID NO:191, SEQ ID NO:192, SEQ ID NO:193, SEQ ID NO:194, SEQ ID NO:195, SEQ ID NO:196, SEQ ID NO:197, SEQ ID NO:198, SEQ ID NO:199, SEQ ID NO:200, SEQ ID NO:201, SEQ ID NO:202, SEQ ID NO:203, SEQ ID NO:204, SEQ ID NO:205, SEQ ID NO:206, or SEQ ID NO:207. 10

14. The antibody of claim 4 further comprising a VL CDR2 having an amino acid sequence of SEQ ID NO:5, SEQ ID NO: 15, SEQ ID NO:23, SEQ ID NO:27, SEQ ID NO:32, SEQ D NO:35. SEQ ID NO:43, SEQ ID NO:50, SEQ ID NO:53, SEQ ID NO:57, SEQ ID NO:59, SEQ ID NO:63, SEQ ID NO:66, SEQ ID NO:69, SEQ ID NO:73, SEQ ID 15 NO:75, SEQ ID NO:77, SEQ ID NO:81, SEQ ID NO:85, SEQ ID NO:88, SEQ ID NO:90, SEQ ID NO:96, SEQ ID NO:99, SEQ ID NO:102, SEQ ID NO:105, SEQ ID NO:108, SEQ ID NO:113, SEQ ID NO:116, SEQ ID NO:118, SEQ ID NO:121, SEQ ID NO:123, SEQ fD NO:124, SEQ ID NO:126., SEQ ID NO:128, SEQ ID NO:131, SEQ ID NO:133, SEQ ID NO:135, SEQ ID NO:137, SEQ ID NO:139, SEQ ID NO:141, SEQ ID NO:143, SEQ ID 20 NO:145, SEQ ID NO:147, SEQ ID NO:149, SEQ ID NO:151, SEQ ID NO:154, SEQ ID NO:156, SEQ ID NO:158, SEQ ID NO:160, SEQ ID NO:162, SEQ ID NO:164, SEQ ID NO:165, SEQ ID NO:167, SEQ ID NO:170, SEQ ID NO:172, SEQ ID NO:174, SEQ ID NO:176, or SEQ ID NO:178. 25 15. The antibody of claim 4 further comprising a VL CDR3 having an amino adia sequIce f'SEQID'N'O:6,~SEQ'IDNO:16 or*SEQ*fD-NO':6~1.

16. The antibody of claim 4 further comprising a VL CDRI having an amino acid sequence of SEQ ID NO:4, SEQ ID NO:14, SEQ ID NO:22. SEQ ID NO:3 1, SEQ ID 30 NO:39 or SEQ ID NO:47, SEQ ID NO:80, SEQ ID NO:84, SEQ ID NO:87, SEQ ID NO:89, SEQ ID NO:92, SEQ ID NO:95, SEQ ID NO:98, SEQ ID NO:101, SEQ ID NO:104, SEQ ID NO:107, SEQ ID NO:110, SEQ ID NO:112, SEQ ID NO:l15, SEQ ID NO: 117, SEQ ID NO.119, SEQ ID NO:120, SEQ ID NO:122, SEQ ID NO:125, SEQ ID NO:127, SEQ ID NO:129, SEQ ID NO:130, SEQ ID NO:132, SEQ LD NO:134, SEQ ID 35 NO:136, SEQ ID NO:138, SEQ ID NO:140, SEQ ID NO:142, SEQ ID NO:144, SEQ ID - 156- NO: 146, SEQ ID NO: 148, SEQ ID NO: 150, SEQ ID NO:152, SEQ ID NO: 153, SEQ ID NO:155, SEQ ID NO:157, SEQ ID NO:159, SEQ ID NO:161, SEQ ID NO:163, SEQ ID NO:166, SEQ ID NO:168, SEQ ID NO:169, SEQ ID NO:171, SEQ ID NO:173, SEQ ID NO:175, SEQ ID NO:177, SEQ ID NO:179, SEQ ID NO:180, SEQ ID NO:181, SEQ ID 5 NO:182. SEQ ID NO:183, SEQ ID NO:184, SEQ ID NO:185, SEQ ID NO:186, SEQ ID NO:187, SEQ ID NO:188, SEQ ID NO:189, SEQ ID NO:190, SEQ ID NO:191, SEQ ID NO:192, SEQ ID NO:193, SEQ ID NO:1 94, SEQ ID NO:195, SEQ ID NO:196, SEQ ID NO:197, SEQ ID NO:198, SEQ ID NO:199, SEQ ID NO:200, SEQ ID NO:201, SEQ ID NO:202, SEQ ID NO:203, SEQ ID NO:204, SEQ ID NO:205, SEQ ID NO:206, or SEQ ID 10 NO:207. a VL CDR2 having an amino acid sequence of SEQ ID NO:5, SEQ ID NO: 15, SEQ ID NO:23, SEQ ID NO:27, SEQ ID NO:32, SEQ ID NO:35, SEQ ID NO:43, SEQ ID NO:50, SEQ ID NO:53. SEQ ID NO:57, SEQ ID NO:59, SEQ ID NO:63, SEQ ID NO:66, SEQ ID NO:69, SEQ ID NO:73, SEQ ID NO:75, SEQ ID NO:77, SEQ ID NO:8 1,-SEQ ID NO:85, SEQ ID NO:88, SEQ ID NO:90, SEQ ID NO:96, SEQ ID NO:99, SEQ ID NO: 102, 15 SEQ ID NO:105. SEQ ID NO:108, SEQ ID NO:113, SEQ ID NO:116, SEQ ID NO:118, SEQ ID NO:121, SEQ ID NO:123, SEQ ID NO:124, SEQ ID NO:126, SEQ ID NO:128, SEQ ID NO:13 1, SEQ ID NO:133, SEQ ID NO:135, SEQ ID NO:137, SEQ ID NO:139, SEQ ID NO:141, SEQ ID NO:143, SEQ ID NO:145, SEQ ID NO:147, SEQ ID NO:149, SEQ ID NO:15 1, SEQ ID NO:154, SEQ ID NO:156, SEQ ID NO:158, SEQ ID NO:160, 20 SEQ ID NO:162, SEQ ID NO:164, SEQ ID NO:165, SEQ ID NO:167, SEQ ID NO:170, SEQ ID NO:172. SEQ ID NO:174, SEQ ID NO:176, or SEQ ID NO:178, and a VL CDR3 having an amino acid sequence of SEQ ID NO:6, SEQ ID NO:16 or SEQ ID NO:61.

17. The antibody of claim 10, 11 or 12 further comprising a VL CDR1 having an 25 amino acid sequence of SEQ ID NO:4, SEQ ID NO:14, SEQ ID NO:22, SEQ ID NO:31, .S:EQ ID .N:39 . : SEQ.I.Na4.LSEQ JD.NO:8Q.SEQ [M. ,D N$', SEQ ID N432, SEQ I' NO.'95, zEQ la N9, GEQ EB NO:-l'l, SEQ B NO:104, SEQ ID NO:107, SEQ fD NO:110, SEQ ID NO:112, SEQ ID NO:115, SEQ ID NO:117, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:122, SEQ ID NO:125, SEQ ID 30 NO:127, SEQ ID NO:129, SEQ ID NO:130, SEQ ID NO:132, SEQ ID NO:134, SEQ ID NO:136, SEQ ID NO:138, SEQ ID NO:140, SEQ ID NO:142, SEQ ID NO:144, SEQ ID NO:146, SEQ ID NO:148, SEQ ID NO:150, SEQ ID NO:152, SEQ ID NO:153, SEQ ID NO:155, SEQ ID NO:157, SEQ ID NO:159, SEQ ID NO:161, SEQ ID NO:163, SEQ ID NO:166, SEQ IDNO:168, SEQ IDNO:169, SEQ IDNO:171, SEQ ID NO:173, SEQ ID 35 NO:175,SEQIDNO:177,SEQIDNO:179,SEQIDNO:180,SEQIDNO:181,SEQID - 157- NO:182, SEQ ID NO:183, SEQ ID NO:184, SEQ IDNO:185, SEQ ID NO:186, SEQ ID NO:187, SEQ ID NO:188, SEQ ID NO:189, SEQ ID NO:190, SEQ ID NO:191, SEQ ID NO:192, SEQ ID NO:193, SEQ ID NO:194, SEQ ID NO:195, SEQ ID NO:196, SEQ ID NO:197 SEQ ID NO:198, SEQ M NO:199, SEQ IDNO:200, SEQ IDNO:201, SEQID 5 NO:202. SEQ ID NO:203, SEQ ID NO:204, SEQ ID NO:205, SEQ ID NO:206, or SEQ ID NO:207.

18. The antibody of claim 10, 11 or 12 further comprising a VL CDR2 having an amino acid sequence of SEQ ID NO:5, SEQ ID NO:15, SEQ ID NO:23, SEQ ID NO:27, 10 SEQ ID NO:32, SEQ ID NO:35, SEQ ID NO:43, SEQ ID NO:50, SEQ ID NO:53, SEQ ID NO:57, SEQ ID NO:59, SEQ ID NO:63, SEQ ID NO:66, SEQ ID NO:69, SEQ ID NO:73, SEQ ID NO:75, SEQ ID NO:77, SEQ ID NO:8 1, SEQ ID NO:85, SEQ ID NO:88, SEQ ID NO:90, SEQ ID NO:96, SEQ ID NO:99, SEQ ID NO:102, SEQ ID NO:105, SEQ ID NO:108, SEQ ID NO: 113, SEQ ID NO: 116, SEQ ID NO: 118, SEQ ID NO:121, SEQ ID 15 NO:123, SEQ ID NO:124, SEQ ID NO:126, SEQ ID NO:128, SEQ ID NO:131, SEQ ID NO:133, SEQ ID NO:135. SEQ ID NO:137, SEQ ID NO:139, SEQ ID NO:141, SEQ ID NO:143. SEQ ID NO:145, SEQ ID NO:147, SEQ ID NO:149, SEQ ID NO:151, SEQ ID NO:154, SEQ ID NO:156, SEQ ID NO:158, SEQ ID NO:160, SEQ ID NO:162, SEQ ID NO:164, SEQ ID NO:165, SEQ ID NO:167, SEQ ID NO:170, SEQ ID NO:172, SEQ ID 20 NO:174, SEQ ID NO:176, or SEQ ID NO:178.

19. The antibody of claim 10, 11 or 12 further comprising a VL CDR3 having an amino acid sequence of SEQ ID NO:6, SEQ ID NO: 16, or SEQ ID NO:61. 25 20. The antibody of claim 10 or 11 further comprising a VL CDR1 having an enaunao ani eueinne.aOGiQ ID NOA, SSQ <ID Ni4 ;Q IN:2, SB Q(DNG-3'I, SEQ DNYO:3' or-SQ NT :4"i SEQTD'NO:'8, SEQ'IDND'84, SEQblDNO:'87;SEQ ID NO:89, SEQ ID NO:92, SEQ ID NO:95, SEQ ID NO:98, SEQ D NO:101, SEQ ID NO:104, SEQ ID NO:107, SEQ ID NO:110, SEQ ID NO:112, SEQ ID NO:115, SEQ ID 30 NO:117, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:122, SEQ D NO:125, SEQ ID NO:127, SEQ ID NO:129, SEQ ID NO:130, SEQ ID NO:132, SEQ ID NO:134, SEQ ID NO:136, SEQ ID NO:138, SEQ ID NO:140, SEQ ID NO:142, SEQ ID NO:144, SEQ ID NO:146, SEQ ID NO: 148, SEQ ID NO:150, SEQ ID NO:152, SEQ ID NO:153, SEQ ID NO:155, SEQ ID NO:157, SEQ ID NO:159, SEQ ID NO:161, SEQ ID NO:163, SEQ ID 35 NO:16 6 ,SEQIDNO:168,SEQIDNO:169,SEQ IDNO:171,SEQIDNO:173,SEQID - 158 - NO:175, SEQ ID NO:177, SEQ ID NO:179, SEQ ID NO:180, SEQ ID NO:181, SEQ ID NO:182, SEQ ID NO:183, SEQ ID NO:184, SEQ ID NO:185, SEQ ID NO:186, SEQ ID NO:187, SEQ ID NO:188, SEQ IDNO:189, SEQ IDNO:190, SEQ ID NO:191, SEQ ID NO:192, SEQ ID NO:193, SEQ ID NO:194, SEQ ID NO:195, SEQ ID NO:196, SEQ ID 5 NO:197, SEQ ID NO:198., SEQ ID NO: 199, SEQ ID NO:200, SEQ ID NO:201, SEQ ID NO:202. SEQ ID NO:203, SEQ ID NO:204, SEQ ID NO:205, SEQ ID NO:206, or SEQ ID NO:207, a VL CDR2 having an amino acid sequence of SEQ ID NO:5, SEQ ID NO:15, SEQ ID NO:23, SEQ ID NO:27, SEQ ID NO:32, SEQ ID NO:35, SEQ ID NO:43, SEQ ID NO:50, SEQ ID N4O:53, SEQ ID NO:57, SEQ ID NO:59, SEQ ID NO:63, SEQ ID NO:66, 10 SEQ ID NO:69, SEQ ID NO:73, SEQ ID NO:75, SEQ ID NO:77, SEQ ID NO:81, SEQ ID NO:85. SEQ ID NO:88, SEQ ID NO:90, SEQ ID 140:96, SEQ ID NO:99, SEQ ID NO:102, SEQ ID NO:105, SEQ ID NO:108, SEQ ID NO:113, SEQ ID NO:116, SEQ ID NO:118, SEQ ID NO:121, SEQ ID NO:123, SEQ ID NO:124, SEQ ID NO:126, SEQ ID NO:128, SEQ ID NO:131, SEQ ID NO:133, SEQ ID 10:135, SEQ ID NO:137, SEQ ID NO:139, 15 SEQ ID NO:141, SEQ ID NO:143, SEQ ID NO:145, SEQ ID NO:147, SEQ ID NO. 149 , SEQ ID NO:151, SEQ ID NO:154, SEQ ID NO:156, SEQ ID NO:158, SEQ ID NO:160, SEQ ID NO:162, SEQ ID NO:164, SEQ ID NO:165, SEQ ID NO:167, SEQ ID NO:170, -SEQ ID NO: 172, SEQ ID NO: 174, SEQ ID NO: 176, or SEQ ID NO: 178, and a VL CDR3 having an amino acid sequence of SEQ ID NO:6, SEQ ID NO:16, or SEQ ID NO:61. 20

21. The antibody of claim 12 further comprising a VL CDRI having an amino acid sequence of SEQ ID NO:4, SEQ. ID NO:14, SEQ ID NO:22, SEQ ID NO:3 1, SEQ ID NO:39 or SEQ ID NO:47, SEQ ID NO:80, SEQ ID N0:84, SEQ ID NO:87, SEQ ID NO:89, SEQ ID NO:92. SEQ ID NO:95, SEQ ID NO:98, SEQ ID NO:101, SEQ ID 25 NO:104, S E Q ID NO:107, SEQ ID NO:110, SEQ ID NO:I12, SEQ ID NO:115, SEQ ID NO: 117, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:122, SEQ ID NO:125, SEQ ID 14136,SEQIDNO:13,SEQDNO:140, SEQ ID NO:142,SEQID NO:144, SEQ D NO:146, SEQ ID NO:148, SEQ ID NO:150, SEQ ID NO:152, SEQ ID NO:153, SEQ ID 30 NO:146, SEQ ID NO:157, SEQ ID NO:159, SEQ ID NO:161, SEQ ID NO:163, SEQ ID NO: 6 6 , SEQ ID NO: 168, SEQ ID NO:169, SEQ ID NO:171, SEQ ID NO:173, SEQ ID NO:17, SEQ ID NO:177, SEQ ID NO:179, SEQ D NO:180, SEQ ID NO:181, SEQ ID NO:182, SEQ ID NO:183, SEQ ID NO:184, SEQ ID NO:185, SEQ ID NO:186, SEQ ID NO: 187, SEQ ID NO:188, SEQ ID NO: 189, SEQ ID NO:190, SEQ ID NO:191, SEQ ID 35 N0:192, SEQIDNO:193, SEQ IDNO:194, SEQ IDNO:195, SEQIDNO:196, SEQ ID -159- NO:197, SEQ ID NO:198, SEQ ID NO:199, SEQ ID NO:200, SEQ ID NO:201, SEQ ID NO:202, SEQ ID NO:203, SEQ ID NO:204, SEQ ID NO:205, SEQ ID NO:206, or SEQ ID NO:207, a VL CDR2 having an amino acid sequence of SEQ ID NO:5, SEQ ID NO:15, SEQ ID NO:23, SEQ ID NO:27, SEQ ID NO:32, SEQ ID NO:35, SEQ ID NO:43, SEQ ID 5 NO:50, SEQ ID NO:53, SEQ ID NO:57, SEQ ID NO:59, SEQ ID NO:63, SEQ ID NO:66, SEQ ID NO:69, SEQ D NO:73, SEQ ID NO:75, SEQ ID NO:77, SEQ ID NO:81, SEQ ID NO:85, SEQ ID NO:88, SEQ ID NO:90, SEQ ID NO:96, SEQ ID NO:99, SEQ ID NO:102, SEQ ID NO:105, SEQ ID NO:108, SEQ ID NO:113, SEQ ID NO: 116, SEQ ID NO:118, SEQ ID NO:121, SEQ ID NO:123, SEQ ID NO:124, SEQ ID NO:126, SEQ ID NO:128, 10 SEQ ID NO:I 3 1, SEQ ID NO:133, SEQ ID NO:135, SEQ ID NO:137, SEQ ID NO: 13 9 , SEQ ID NO:141; SEQ ID NO:143, SEQ ID NO:145, SEQ ID NO:147, SEQ ID NO:149, SEQ ID NO:151, SEQ ID NO:154, SEQ ID NO:156, SEQ ID NO:158, SEQ ID NO:160, SEQ ID NO:162, SEQ ID NO:164, SEQ ID NO:165, SEQ ID NO:167, SEQ ID NO:170, SEQ ID NO: 172, SEQ ID NO:174, SEQ ID NO: 176, or SEQ ID NO:178, and a VL CDR3 15 having an amino acid sequence of SEQ ID NO:6, SEQ IDNO:16, or SEQ ID NO:61.

22. The antibody of claim 5 further comprising a VH CDR3 having an amino acid sequence of SEQ ID NO:3, SEQ ID NO: 12, SEQ ID NO:20, SEQ ID NO:29, SEQ ID NO:79, SEQ ID NO:83, SEQ ID NO:94 or SEQ ID NO:97. 20

23. The antibody of claim 5 further comprising a VL CDRI having an amino acid sequence of SEQ ID NO:4, SEQ ID NO:14, SEQ ID NO:22, SEQ ID NO:31, SEQ ID NO:39 or SEQ ID NO:47, SEQ ID NO:80, SEQ ID NO:84, SEQ ID NO:87, SEQ ID NO:89, SEQ ID NO:92, SEQ ID NO:95, SEQ ID NO:98, SEQ ID NO:101, SEQ ID 25 NO:10 4 ,SEQIDNO:107,SEQIDNO:110,SEQIDNO:112,SEQIDNO:115,SEQID NO: 117, SEQ ID NO: 119, SEQ ID.NO:.120.,SEQ..D1 NO:.22.,SEQJDNO:2,3EglD NO:T27,SEQBfDNO:129, SEQTDNO:T30, SEQ ID NO:132, SEQ TDNO:134, SEQID NO:136, SEQ ID NO:138, SEQ ID NO:140, SEQ ID NO:142, SEQ ID NO:144, SEQ ID NO:146, SEQ ID NO:148, SEQ ID NO:150, SEQ ID NO:152, SEQ ID NO:153, SEQ ID 30 NO:155, SEQ ID NO:157, SEQ ID NO:159, SEQ ID NO:161, SEQ ID NO:163, SEQ ID NO:166, SEQ ID NO:168, SEQ ID NO:169, SEQ ID NO:171, SEQ ID NO:173, SEQ ID NO:175, SEQ ID NO:177, SEQ ID NO:179, SEQ ID NO:180, SEQ ID NO:186, SEQ ID NO:182, SEQ ID NO:183, SEQ ID NO:184, SEQ ID NO:185, SEQ ID NO:186, SEQ ID NO:187, SEQ ID NO:188, SEQ ID NO:189, SEQ ID NO:190, SEQ ID NO:191, SEQ ID 35 NO:192, SEQ ID NO:193, SEQ ID NO:194, SEQ ID NO:195, SEQ ID NO:196, SEQ ID - 160- NO:197, SEQ ID NO:198, SEQ ID NO:199, SEQ ID NO:200, SEQ ID NO:201, SEQ ID NO:202, SEQ ID NO:203, SEQ ID NO:204, SEQ ID NO:205, SEQ ID NO:206, or SEQ ID NO:207.

24. The antibody of claim 5 further comprising a VL CDR2 having an amino acid sequence of SEQ ID NO:5, SEQ ID NO:15, SEQ ID NO:23, SEQ ID NO:27, SEQ ID NO:32, SEQ ID NO:35, SEQ ID NO:43, SEQ ID NO:50, SEQ ID NO:53, SEQ ID NO:57, SEQ ID NO:59, SEQ ID NO:63, SEQ ID NO:66, SEQ ID NO:69, SEQ ID NO:73, SEQ ID NO:75, SEQ ID NO:77, SEQ ID NO:81. SEQ ID NO:85, SEQ ID NO:88, SEQ ID NO:90, 10 SEQ ID NO:96, SEQ ID NO:99, SEQ ID NO:102, SEQ ID NO:105, SEQ ID NO:108, SEQ ID NO:1 13, SEQ ID NO: 16, SEQ ID NO: 118, SEQ ID NO:121, SEQ ID NO:123, SEQ ID NO:124, SEQ ID NO:126, SEQ ID NO:128, SEQ ID NO:131, SEQ ID NO:133, SEQ ID NO:135, SEQ ID NO:137, SEQ ID NO:139, SEQ ID NO:141, SEQ ID NO:143, SEQ ID NO:145, SEQ ID NO:147, SEQ ID NO:149, SEQ ID NO:151, SEQ ID NO:154, SEQ ID 15 NO:156, SEQ ID NO:158, SEQ ID NO:160, SEQ ID NO:162, SEQ ID NO:164, SEQ ID NO:165, SEQ ID NO:167, SEQ ID NO:170, SEQ ID NO:172, SEQ ID NO:174, SEQ ID NO:176. or SEQ ID NO:178.

25. The antibody of claim 5 further comprising a VL CDR3 having an amino 20 acid sequence of SEQ ID NO:6, SEQ ID NO:16, or SEQ ID NO:61.

26. The antibody of claim 5 or 22 further comprising a VL CDRL having an amino acid sequence of SEQ ID NO:4, SEQ ID NO:14, SEQ ID NO:22, SEQ ID NO:3 1, SEQ ID NO:39 or SEQ ID NO:47, SEQ ID NO:80, SEQ ID NO:84, SEQ ID NO:87, SEQ 25 ID NO:89, SEQ ID NO:92, SEQ ID NO:95, SEQ ID NO:98, SEQ ID NO:101, SEQ ID NO:104, SEQ ID NO:107, SEQ ID NO:110, SEQ ID NO:112, SEQ ID NO:115, SEQ ID NG.H 4, DEQ I' N&."19, 'BD fD Na:DS, -SQ MB N3:2 ,0EQ -I N&.12-5, -SB 3 NO.127, SEQ ID NO:129, SEQ ID NO:130, SEQ ID NO:132, SEQ ID NO:134, SEQ ID NO: 136, SEQ ID NO:138, SEQ ID NO: 140, SEQ ID NO:142, SEQ ID NO:144, SEQ ID 30 NO: 14 6 , SEQ ID NO:148, SEQ ID NO:150, SEQ ID NO:152, SEQ ID NO: 15 3 , SEQ ID NO:155, SEQ ID NO:157, SEQ ID NO:159, SEQ ID NO:161, SEQ ID NO:163, SEQ ID NO:166, SEQ ID NO:168, SEQ ID NO:169, SEQ ID NO:171, SEQ ID NO:173, SEQ ID NO:175, SEQ ID NO:177, SEQ ID NO:179, SEQ ID NO:180, SEQ ID NO:181, SEQ ID NO:182, SEQ ID NO:183, SEQ ID NO:184, SEQ ID NO:185, SEQ ID NO:186, SEQ ID 35 NO:187, SEQIDNO:188, SEQ IDNO:189, SEQ IDNO:190, SEQ IDNO:191, SEQ ID - 161 - NO:1 9 2 ,SEQIDNO:193,SEQIDNO:194SEQIDNO:195SEQIDNO: 19 6 , SEQID NO: 197, SEQ ID NO:198, SEQ ID NO: 199, SEQ ID NO:200, SEQ ID NO:201, SEQ ID NO:202, SEQ ID NO:203, SEQ ID NO:204, SEQ ID NO:205, SEQ ID NO:206, or SEQ ID NO:207., a VL CDR2 having an amino acid sequence of SEQ ID NO:5, SEQ ID NO:15, 5 SEQ ID NO:23, SEQ ID NO:27, SEQ ID NO:32, SEQ ID NO:35, SEQ ID NO:43, SEQ ID NO:50, SEQ ID NO:53, SEQ ID NO:57, SEQ ID NO:59, SEQ ID NO:63, SEQ ID NO:66, SEQ ID NO:69, SEQ ID NO:73, SEQ ID NO:75, SEQ ID NO:77, SEQ ID NO:8 1, SEQ ID NO:85, SEQ ID NO:88, SEQ ID NO:90, SEQ ID NO:96, SEQ ID NO:99, SEQ ID NO:102, SEQ ID NO:105, SEQ ID NO:108, SEQ ID NO: 113, SEQ ID NO: 116, SEQ ID NO: 118, 10 SEQ ID NO: 12 1, SEQ ID NO:123, SEQ ID NO:124, SEQ ID NO:126, SEQ ID NO:128, SEQ ID NO: 131 , SEQ ID NO:133, SEQ ID NO:135, SEQ ID NO:137, SEQ ID NO:1 39 , SEQ ID NO:141, SEQ ID NO:143, SEQ ID NO:145, SEQ ID NO:147, SEQ ID NO:149, SEQ ID NO:151, SEQ ID NO:154, SEQ ID NO:156, SEQ ID NO:158, SEQ ID NO:160, SEQ ID NO:162, SEQ ID NO:164, SEQ ID NO: 165, SEQ ID NO:167, SEQ ID NO:170, 15 SEQ ID NO:172, SEQ ID NO:174, SEQ ID NO:176, or SEQ ID NO:178, and a VL CDR3 having an amino acid sequence of SEQ ID NO:6. SEQ ID NO:16, or SEQ ID NO:61.

27. The antibody of claim 6 further comprising a VL CDR1 having an amino acid sequence of SEQ ID NO:4, SEQ ID NO:14, SEQ ID NO:22, SEQ ID NO:3 1, SEQ ID 20 NO:39 or SEQ ID NO:47, SEQ ID NO:80, SEQ ID NO:84, SEQ ID NO:87, SEQ ID NO:89, SEQ ID NO:92. SEQ ID NO:95, SEQ ID NO:98, SEQ ID NO:101, SEQ ID NO:104, SEQ ID NO:107, SEQ ID NO:I 10, SEQ ID NO: 112, SEQ ID NO:1 15, SEQ ID NO:117, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:122, SEQ ID NO:125, SEQ ID NO:127, SEQ ID NO: 129, SEQ ID NO:130, SEQ ID NO:132, SEQ ID NO:134, SEQ ID 25 NO:136, SEQ ID NO:138, SEQ ID NO:140, SEQ ID NO:142, SEQ ID NO:144, SEQ ID NO:146, SEQ ID NO:148, SEQ ID NO:150, SEQ ID NO:152, SEQ ID NO:153, SEQ ID NO:166, SEQ ID NO:168, SEQ ID NO:169, SEQ ID NO:171, SEQ ID NO:173, SEQ ID NO:175, SEQ ID NO:177, SEQ ID NO:179, SEQ ID NO:180, SEQ ID NO:181, SEQ ID 30 NO:182, SEQ ID NO:183, SEQ ID NO:184, SEQ ID NO:185, SEQ ID NO:186, SEQ ID NO:187, SEQ ID NO:188, SEQ ID NO:189, SEQ ID NO:190, SEQ ID NO:191, SEQ ID NO:1 92, SEQ ID NO:193, SEQ ID NO:194, SEQ ID NO:195, SEQ ID NO:196, SEQ ID NO:197, SEQ ID NO:198, SEQ ID NO:199, SEQ ID NO:200, SEQ ID NO:201, SEQ ID NO:202, SEQ ID NO:203, SEQ ID NO:204, SEQ ID NO:205, SEQ ID NO:206, or SEQ ID 35 NO:207. - 162-

28. The antibody of claim 6 further comprising a VL CDR2 having an amino acid sequence of SEQ ID NO:5, SEQ ID NO:15, SEQ ID NO:23, SEQ ID NO:27, SEQ ID NO:32, SEQ ID NO:35, SEQ ID NO:43, SEQ ID NO:50, SEQ ID NO:53, SEQ ID NO:57, SEQ ID NO:59, SEQ ID NO:63, SEQ ID NO:66, SEQ ID NO:69, SEQ ID NO:73, SEQ ID 5 NO:75, SEQ ID NO:77, SEQ ID NO:81, SEQ ID NO:85, SEQ ID NO:88, SEQ ID NO:90, SEQ ID NO:96, SEQ ID NO:99, SEQ ID NO:102, SEQ ID NO:105, SEQ ID NO:108, SEQ ID NO: 113, SEQ ID NO: 116, SEQ ID NO:1 18, SEQ ID NO:121, SEQ ID NO:123, SEQ ID NO:124, SEQ ID NO:126, SEQ ID NO:128, SEQ ID NO: 131, SEQ ID NO:133, SEQ [D NO: 135, SEQ ID NO:137, SEQ ID NO:139, SEQ ID NO: 141, SEQ ID NO:143, SEQ ID 10 NO:1 4 5,SEQIDNO:147,SEQIDNO:149,SEQIDNO:151,SEQIDNO:154,SEQID NO:156, SEQ ID NO:158, SEQ ID NO:160, SEQ ID NO:162, SEQ ID NO:164, SEQ ID NO: 165, SEQ ID NO: 167, SEQ ID NO: 170, SEQ ID NO: 172, SEQ ID NO: 174, SEQ ID NO:176, or SEQ ID NO:178. i5 29. The antibody of claim 6 further comprising a VL CDR3 having an amino acid sequence of SEQ ID NO:6, SEQ ID NO:16, or SEQ ID NO:61.

30. The antibody of claim 6 further comprising a VL CDR1 having an amino acid sequence of SEQ ID NO:4, SEQ ID NO:14, SEQ ID NO:22, SEQ [D NO:31, SEQ ID 20 NO:39 or SEQ ID NO:47, SEQ ID NO:80. SEQ ID NO:84, SEQ ID NO:87, SEQ ID NO:89, SEQ ID NO:92, SEQ ID NO:95, SEQ ID NO:98, SEQ ID NO:101, SEQ ID NO:104, SEQ ID NO:107, SEQ ID NO:1 10, SEQ ID NO: 112, SEQ ID NO:1 15, SEQ ID NO: 117, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 122, SEQ ID NO: 125, SEQ ID NO:127, SEQ ID NO:129, SEQ ID NO:130, SEQ ID NO:132, SEQ ID NO:134, SEQ ID 25 NO: 136, SEQ ID NO:138, SEQ ID NO:140, SEQ ID NO:142, SEQ ID NO:144, SEQ ID NO:146, SEQ ID NO:148, SEQ ID NO:150, SEQ ID NO:152, SEQ ID NO:153, SEQ ID NZd 55, BQ ID NO: 157, Q I NG: 1S9, SEQ .ID NG:161, CBQ ID N06-3,CQ IE NO:166, SEQ ID NO:168, SEQ ID NO:169, SEQ ID NO:171, SEQ ID NO:173, SEQ ID NO:175, SEQ ID NO:177, SEQ ID NO:179, SEQ ID NO:180, SEQ ID NO:181, SEQ ID 30 NO:182, SEQ ID NO:183, SEQ ID NO:184, SEQ ID NO:185, SEQ LD NO:186, SEQ ID NO:187, SEQ ID NO:188, SEQ ID NO:189, SEQ ID NO:190, SEQ ID NO:191, SEQ ID NO: 192, SEQ ID NO: 193, SEQ ID NO:194, SEQ ID NO: 195, SEQ ID NO:196, SEQ ID NO:197, SEQ ID NO: 198, SEQ ID NO:199, SEQ ID NO:200, SEQ ID NO:201, SEQ ID NO:202, SEQ ID NO:203, SEQ ID NO:204, SEQ ID NO:205, SEQ ID NO:206, or SEQ ID 35 NO:207, a VL CDR2 having an amino acid sequence of SEQ ID NO:5, SEQ ID NO:15, - 163 - SEQ ID NO:23, SEQ ID NO:27, SEQ ID NO:32, SEQ ID NO:35, SEQ ID NO:43, SEQ ID NO:50, SEQ ID NO:53, SEQ ED NO:57, SEQ ID NO:59, SEQ ID NO:63, SEQ ID NO:66, SEQ ID NO:69, SEQ ID NO:73, SEQ ID NO:75, SEQ ID NO:77, SEQ ID NO:81, SEQ ID NO:85, SEQ ID NO:88, SEQ ID NO:90. SEQ ID NO:96, SEQ ID NO:99, SEQ ID NO:102, 5 SEQ ID NO:105, SEQ ID NO:108, SEQ ID NO: 113, SEQ ID NO: 116, SEQ ID NO: 118, SEQ ID NO:121, SEQ ID NO:123, SEQ ID NO:124, SEQ ID NO:126, SEQ ID NO:128, SEQ ID NO:131, SEQ ID NO:133, SEQ ID NO:135, SEQ ID NO:137, SEQ ID NO:139, SEQ ID NO:141, SEQ ID NO:143, SEQ ID NO:145, SEQ ID NO:147, SEQ ID NO:149, SEQ ID NO:15 1, SEQ ID NO:154, SEQ ID NO:156, SEQ ID NO:158, SEQ ID NO:160, 10 SEQ IDNO:162, SEQ IDNO:164, SEQ ID NO:165, SEQ ID NO:167, SEQ ID NO:170, SEQ ID NO:172, SEQ ID NO:174, SEQ ID NO:176, or SEQ ID NO:178, and a VL CDR3 having an amino acid sequence of SEQ ID NO:6, SEQ ID NO:16, or SEQ ID NO:61.

31. The antibody of claim 7 further comprising a VL CDR2 having an amino 15 acid sequence of SEQ ID NO:5, SEQ ID NO:15, SEQ ID NO:23, SEQ ID NO:27, SEQ ID NO:32, SEQ ID NO:35, SEQ ID NO:43, SEQ ID NO:50, SEQ ID NO:53, SEQ ID NO:57, SEQ ID NO:59, SEQ ID NO:63, SEQ ID NO:66, SEQ ID NO:69, SEQ ID NO:73, SEQ ID NO:75, SEQ ID NO:77, SEQ ID NO:81, SEQ ID NO:85, SEQ ID NO:88, SEQ ID NO:90, SEQ ID NO:96, SEQ ID NO:99. SEQ ID NO:102, SEQ ID NO:105, SEQ ID NO:108, SEQ 20 ID NO:113, SEQ ID NO:116, SEQ ID NO:18, SEQ ID NO:21, SEQ ID NO:123, SEQ ID NO:124, SEQ ID NO:126, SEQ ID NO:128, SEQ ID NO:131, SEQ ID NO:133, SEQ ID NO:135, SEQ ID NO:137, SEQ ID NO:139, SEQ ID NO:141, SEQ ID NO:143, SEQ ID NO:145, SEQ ID NO:147, SEQ ID NO:149, SEQ ID NO:151, SEQ ID NO:154, SEQ ID NO:156, SEQ ID NO:158, SEQ ID NO:160, SEQ ID NO:162, SEQ ID NO:164, SEQ ID 25 NO:165, SEQ ID NO:167, SEQ ID NO:170, SEQ ID NO:172, SEQ ID NO:174, SEQ ID .NO:. 76,ar ,SEQliD.NO.JJ71

32. The antibody of claim 7 further comprising a VL CDR3 having an amino acid sequence of SEQ ID NO:6, SEQ ID NO:16, or SEQ ID NO:61. 30

33. The antibody of claim 8 further comprising a VL CDRI having an amino acid sequence of SEQ ID NO:4, SEQ ID NO:14, SEQ ID NO:22, SEQ ID NO:31, SEQ ID NO:39 or SEQ ID NO:47, SEQ ID NO:80, SEQ ID NO:84, SEQ ID NO:87, SEQ ID NO:89, SEQ ID NO:92, SEQ ID NO:95, SEQ ID NO:98, SEQ ID NO:10I, SEQ ID 35 NO:10 4 ,SEQIDNO:107,SEQIDNO:110,SEQIDNO:112,SEQIDNO:115,SEQID - 164- NO: 117, SEQ ID NO: 119, SEQ ID NO:120, SEQ ID NO:122, SEQ ID NO:125, SEQ ID NO:127, SEQ ID NO:129, SEQ ID NO:130, SEQ ID NO:132, SEQ ID NO:134, SEQ ID NO:136. SEQ ID NO:138, SEQ ID NO:140, SEQ ID NO:142, SEQ ID NO:144, SEQ ID NO:146. SEQ ID NO:148, SEQ ID NO:150, SEQ ID NO:152, SEQ ID NO:1S3, SEQ ID 5 NO:155, SEQ ID NO:157, SEQ ID NO:159, SEQ IDNO:161, SEQ ID NO:163, SEQ ID NO:166, SEQ ID NO:168, SEQ ID NO:169, SEQ ID NO:171, SEQ ID NO:173, SEQ ID NO:175. SEQ ID NO:177, SEQ ID NO:179, SEQ ID NO:180, SEQ ID NO:181, SEQ ID NO:182, SEQ ID NO:183, SEQ ID NO:184, SEQ ID NO:185, SEQ ID NO:186, SEQ ID NO:187, SEQ ID NO:188, SEQ ID NO:189, SEQ ID NO:190, SEQ ID NO:191, SEQ ID 10 NO:192, SEQ ID NO:193., SEQ ID NO:194, SEQ ID NO:195, SEQ ID NO:196, SEQ ID NO: 197, SEQ ID NO: 198, SEQ ID NO:199, SEQ ID NO:200, SEQ ID NO:201, SEQ ID NO:202, SEQ ID NO:203, SEQ ID NO:204, SEQ ID NO:205, SEQ ID NO:206, or SEQ ID NO:207. 15 34. The antibody of claim 8 further comprising a VL CDR3 having an amino acid sequence of SEQ ID NO:6, SEQ ID NO:16, or SEQ ID NO:61. 5. The antibody of claim 7 further comprising a VL CDR2 having an amino acid sequence of SEQ ID NO:5, SEQ ID NO:15, SEQ ID NO:23, SEQ ID NO:27, SEQ ID 20 NO:32, SEQ ID NO:35, SEQ ID NO:43, SEQ LID NO:50, SEQ ID NO:53, SEQ ID NO:57, SEQ ID NO:59. SEQ ID NO:63, SEQ ID NO:66, SEQ ID NO:69, SEQ ID NO:73, SEQ ID NO:75, SEQ ID NO:77, SEQ ID NO:81, SEQ ID NO:85. SEQ ID NO:88, SEQ ID NO:90, SEQ ID NO:96, SEQ ID NO:99, SEQ ID NO:102, SEQ ID NO:105, SEQ ID NO:108, SEQ ID NO:113, SEQ ID NO:116, SEQ ID NO:118, SEQ ID NO:121, SEQ ID NO:123, SEQ ID 25 NO:1 2 4, SEQ ID NO:126, SEQ ID NO:128, SEQ ID NO:131, SEQ ID NO:133, SEQ ID NO:135, SEQ ID NO:137, SEQ ID NO:139, SEQ ID NO:141., SEQ ID NO:143, SEQ ID NO: 1 4, -SEQ ID N1 I 4T,-SEQ ID 14A49,'SEQ *D NPT0'iS, SE Q 1D NO :T54, SEQ ib NO:156, SEQ ID NO:158, SEQ ID NO:160, SEQ ID NO:162, SEQ ID NO:164, SEQ ID NO:165., SEQ ID NO:167, SEQ ID NO:170, SEQ ID NO:172, SEQ ID NO:174, SEQ ID 30 NO:176, or SEQ ID NO:178, and a VL CDR3 having an amino acid sequence of SEQ ID NO:6, SEQ ID NO: 16, or SEQ ID NO:61.

36. A Fab fragment comprising a VH domain having an amino acid sequence of SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:17, SEQ ID NO:24, SEQ ID NO:28, SEQ ID 35 NO:33, SEQ ID NO:36, SEQ ID NO:40, SEQ ID NO:44, SEQ ID NO:48, SEQ ID NO:51, - 165 - SEQ ID NO:55, SEQ ID NO:67, or SEQ ID NO:78 and a VL domain having an amino acid sequence of SEQ ID NO:8, SEQ ID NO: 13, SEQ ID NO:21, SEQ ID NO:26, SEQ ID NO:30, SEQ ID NO:34, SEQ ID NO:38, SEQ ID NO:42, SEQ ID NO:46, SEQ ID NO:49, SEQ ID NO:52, SEQ ID NO:54, SEQ ID NO:56, SEQ ID NO:58, SEQ ID NO:60, SEQ ID 5 N'O:62, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:68, SEQ ID NO:70, SEQ ID NO:7 1, SEQ ID NO:74 or SEQ ID NO:76, wherein the Fab fragment imnunospecifically binds to a RSV antigen and is not a Fab fragment of SYNAGIS@.

37. A fusion protein comprising the antibody of any one of claims 1-9 covalently 10 linked to a heterologous polypeptide.

38. A composition comprising one or more species of antibodies, each species of antibody comprising a VH domain having an amino acid sequence of SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO: 17, SEQ ID NO:24, SEQ ID NO:28, SEQ ID NO:33, SEQ ID 15 NO:36, SEQ ID NO:40, SEQ ID NO:44, SEQ ID NO:48, SEQ ID NO:51, SEQ ID NO:55, SEQ ID NO:67, or SEQ ID NO:78, wherein each species of antibody immunospecifically binds to a RSV antigen and none of the species of antibodies is SYNAGIS@.

39. A composition comprising one or more species of antibodies, each species of 20 antibody comprising a VL domain having an amino acid sequence of SEQ ID NO:8, SEQ ID NO:13, SEQ ID NO:21, SEQ ID NO:26, SEQ ID NO:30, SEQ ID NO:34, SEQ ID NO:38, SEQ ID NO:42, SEQ ID NO:46, SEQ ID NO:49, SEQ ID NO:52, SEQ ID NO:54, SEQ ID NO:56, SEQ ID NO:58, SEQ ID NO:60, SEQ ID NO:62, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:68, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:74 or SEQ ID 25 NO:76, wherein each species of antibody immunospecifically binds to a RSV antigen and none of the species of antibodies is SYNAGIS@.

40. A composition comprising two or more species of antibodies, each species of antibody comprising a VH domain having an amino acid sequence of SEQ ID NO:7, SEQ 30 ID NO:9, SEQ ID NO: 17, SEQ ID NO:24, SEQ ID NO:28, SEQ ID NO:33, SEQ ID NO:36, SEQ ID NO:40, SEQ ID NO:44, SEQ ID NO:48, SEQ ID NO:51, SEQ ID NO:55, SEQ ID NO:67, or SEQ ID NO:78, wherein each species of antibody imnmunospecifically binds to a RSV antigen. 35 -166-

41. A composition comprising two or more species of antibodies, each species of antibody comprising a VL domain having an amino acid sequence of SEQ ID NO:8, SEQ ID NO: 13, SEQ ID NO:2 1, SEQ ID NO:26, SEQ ID NO:30, SEQ ID NO:34, SEQ ID NO:38, SEQ ID NO:42, SEQ ID NO:46, SEQ ID NO:49, SEQ ID NO:52, SEQ ID NO:54, 5 SEQ ID NO:56, SEQ ID NO:58, SEQ ID NO:60., SEQ ID NO:62, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:68, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:74 or SEQ ID NO:76, wherein each species of antibody immunospecifically binds to a RSV antigen.

42. The composition of claim 39 or 41, wherein each species of antibody further 10 comprises a VH domain havingii an amino acid sequence of SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:17, SEQ ID NO:24, SEQ ID NO:28, SEQ IDNO:33, SEQ IDNO:36, SEQ ID NO:40. SEQ ID NO:44, SEQ ID NO:48, SEQ ID NO:5 1, SEQ ID NO:55, SEQ ID NO:67, or SEQ ID NO:78. 15 43. A composition comprising one or more species of antibodies, each species of antibody comprising a VH CDRI having an amino acid sequence of SEQ ID NO:1, SEQ ID NO: 10, SEQ ID NO: 18, wherein each species of antibody irrununospecifically binds to a RSV antigen and none of the species of antibodies is SYNAGIS@. 20 44. A composition comprising two or more species of antibodies, each species of antibody comprising a VH CDRl having an amino acid sequence of SEQ ID NO:1, SEQ ID NO: 10, SEQ ID NO: 18, wherein each species of antibody immunospecifically binds to a RSV antigen. 25 45. A composition comprising one or more species of antibodies, each species of antibody comprising a VH CDR2 having an amino acid sequence of SEQ ID NO:2, SEQ ID NM 9., SEQ IL NO:25., SEQ .M N:.37, SEQ ID NG-4A, SEQ JD N., A NO:,82., SEQ ID NO:86, SEQ ID NO:9 1, SEQ ID NO:93, SEQ ID NO: 100, SEQ ID NO: 103, SEQ ID NO:105, SEQ ID NO:109, SEQ ID NO:l 11, or SEQ ID NO: 114, wherein each species 30 of antibody iimiunospecifically binds to a RSV antigen and none of the species of antibodies is SYNAGlS@.

46. A composition comprising two or more species of antibodies, each species of antibody comprising a VH CDR2 having an amino acid sequence of SEQ ID NO:2, SEQ ID 35 NO:19, SEQ ID NO:25, SEQ ID NO:37, SEQ ID NO:41, SEQ ID NO:45, SEQ ID NO:82, - 167- SEQ ID NO:86, SEQ ID NO:91, SEQ ID NO:93, SEQ ID NO:100, SEQ ID NO:103, SEQ ID NO:105, SEQ ID NO:109, SEQ ID NO: 11. or SEQ ID NO: 114, wherein each species of antibody immunospecifically binds to a RSV antigen. 5 47. A composition comprising one or more species of antibodies, each species of antibody comprising a VH CDR3 having an amino acid sequence of SEQ ID NO:3, SEQ ID NO: 12, SEQ ID NO:20, SEQ ID NO:29, SEQ ID NO:79, SEQ ID NO:83, SEQ ID NO:94 or SEQ ID NO:97, wherein each species of antibody immunospecifically binds to a RSV antigen and none of the species of antibodies is SYNAGIS@. 10

48. A composition comprising two or more species of antibodies, each species of antibody comprising a VH CDR3 having an amino acid sequence of SEQ ID NO:3, SEQ ID NO:12, SEQ ID NO:20, SEQ ID NO:29, SEQ ID NO:79, SEQ ID NO:83, SEQ ID NO:94 or SEQ ID NO:97, wherein each species of antibody immunospecifically binds to a RSV 15 antigen.

49. A composition comprising one or more species of antibodies, each species of antibody comprising a VL CDR1 having an amino acid sequence of SEQ ID NO:4, SEQ ID NO: 14. SEQ ID NO:22, SEQ ID NO:3 1, SEQ ID NO:39 or SEQ ID NO:47, SEQ ID 20 NO:80, SEQ ID NO:84, SEQ ID NO:87, SEQ ID NO:89, SEQ ID NO:92, SEQ ID NO:95, SEQ ID NO:98, SEQ ID NO:101, SEQ ID NO:104, SEQ ID NO:107, SEQ ID NO:1 10, SEQ ID NO: 112, SEQ ID NO:115, SEQ ID NO:117, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:122, SEQ ID NO:125, SEQ ID NO:127, SEQ ID NO:129, SEQ ID NO:130, SEQ ID NO: 132, SEQ ID NO:134, SEQ ID NO:136, SEQ ID NO:138, SEQ ID NO:140, 25 SEQ ID NO: 142, SEQ ID NO: 144, SEQ ID NO: 146, SEQ ID NO:148, SEQ ID NO: 150, SEQ ID NO: 152., SEQ.ID NO: 153, SEQ.ID.NO.:15.5-.SFQ.JD.NO:.1.57,SEQID.NO.159, SEQ ID NO:161, SEQ ID NO:163, SEQ ID NO:166, SEQ ID NO:168, SEQ ID NO:169, SEQ [D NO:171, SEQ ID NO:173, SEQ ID NO:175, SEQ ID NO:177, SEQ ID NO:179, SEQ ID NO:180, SEQ ID NO:181, SEQ ID NO:182, SEQ ID NO:183, SEQ ID NO:184, 30 SEQ ID NO:185, SEQ ID NO:186, SEQ ID NO:187, SEQ ID NO:188, SEQ ID NO:189, SEQ ID NO:190, SEQ ID NO: 191, SEQ ID NO:192, SEQ ID NO:193, SEQ ID NO:194, SEQ ID NO:195, SEQ ID NO:196, SEQ LD NO:197, SEQ ID NO:198, SEQ ID NO:199, SEQ ID NO:200, SEQ ID NO:201, SEQ ID NO:202, SEQ ID NO:203, SEQ ID NO:204, SEQ ID NO:205, SEQ ID NO:206, or SEQ ID NO:207, wherein each species of antibody 35 - 168 - immunospecifically binds to a RSV antigen and none of the species of antibodies is SYNAGIS@.

50. A composition comprising two or more species of antibodies, each species of 5 antibody comprising a VL CDR1 having an amino acid sequence of SEQ ID NO:4, SEQ ID NO:14. SEQ ID NO:22, SEQ ID NO:3 1, SEQ ID NO:39 or SEQ ID NO:47, SEQ ID NO:80., SEQ ID NO:84, SEQ ID NO:87, SEQ ID NO:89, SEQ ID NO:92, SEQ ID NO:95, SEQ ID NO:98, SEQ ID NO:101, SEQ ID NO:104, SEQ ID NO:107, SEQ ID NO:1 10, SEQ ID NO: 112, SEQ ID NO: 115, SEQ ID NO: 117, SEQ ID NO: 119, SEQ ID NO:120, 10 SEQ ID NO:122, SEQ ID NO:125. SEQ ID NO:127, SEQ ID NO:129, SEQ ID NO:130, SEQ ID NO:13 SEQ ID NO:134, SEQ ID NO:136, SEQ ID NO:I38, SEQ ID NO: 140, SEQ ID NO:142, SEQ ID NO:144, SEQ ID NO:146, SEQ ID NO:148, SEQ ID NO:150, SEQ ID NO:152, SEQ ID NO:153, SEQ ID NO:155, SEQ ID NO:157, SEQ ID NO:159, SEQ ID NO:161, SEQ ID NO:163., SEQ ID NO:166, SEQ ID O:168, SEQ ID NO: 169, 15 SEQ ID NO:171, SEQ ID NO:173, SEQ ID NO:175, SEQ ID NO:177, SEQ ID NO:179, SEQ ID NO:180, SEQ ID NO:181, SEQ ID NO:182, SEQ ID NO:183, SEQ ID NO:184. SEQ ID NO: 185, SEQ ID NO: 186, SEQ ID NO: 187, SEQ ID NO: 188, SEQ ID NO: 189, SEQ ID NO:190, SEQ ID NO:191, SEQ ID NO:192, SEQ ID NO:193, SEQ ID NO:194, SEQ ID NO:195, SEQ ID NO:196, SEQ ID NO:197, SEQ ID NO:198, SEQ ID NO:199, 20 SEQ ID NO:200, SEQ ID NO:201, SEQ ID NO:202, SEQ ID NO:203, SEQ ID NO:204, SEQ ID NO:205, SEQ ID NO:206, or SEQ ID NO:207, wherein each species of antibody immnrnospecifically binds to a RSV antigen.

51. A composition comprising one or more species of antibodies, each species of 25 antibody comprising a VL CDR2 having an amino acid sequence of SEQ ID NO:5, SEQ ID NO:1 5, SEQ ID NO:23, SEQ ID NO:27, SEQ ID NO:32, SEQ ID NO:35, SEQ ID NO:43, 'SEBQ -G M,",43: 50, SE CQ 'IG' N&5 -, EQ -10 NG:5''7, -GEQ M -NG:.5 9, .- EQ ID NG0-. 3, -SjQ -TB NO:66, SEQ ID NO:69, SEQ ID NO:73, SEQ ID NO:75, SEQ ID NO:77, SEQ ID NO:81, SEQ ID NO:85, SEQ ID NO:88, SEQ ID NO:90, SEQ ID NO:96, SEQ ID NO:99, SEQ ID 30 NO:102, SEQ IDNO:105, SEQ ID NO:108, SEQ IDNO:113, SEQ IDNO:116, SEQ ID NO:118, SEQ ID NO:121, SEQ ID NO:123, SEQ ID NO:124, SEQ ID NO:126, SEQ ID NO:128. SEQ ID NO:131, SEQ ID NO:133, SEQ ID NO:135, SEQ ID NO:137, SEQ ID NO:139, SEQ ID NO:141, SEQ ID NO:143, SEQ ID NO:145, SEQ ID NO:147, SEQ ID NO:149, SEQ ID NO:151, SEQ ID NO:154, SEQ ID NO:156, SEQ ID NO:158, SEQ ID 35 NO:160, SEQ ID NO:162, SEQ ID NO:164, SEQ ID NO:165, SEQ ID NO:167, SEQ ID - 169 - NO:170, SEQ ID NO:172, SEQ ID NO:174, SEQ ID NO:176, or SEQ ID NO:l178, wherein each species of antibody immunospecifically binds to a RSV antigen and none of the species of antibodies is SYNAGIS@. 5 52. A composition comprising two or more species of antibodies, each species of antibody comprising a VL CDR2 having an amino acid sequence of SEQ ID NO:5, SEQ ID NO:15, SEQ ID NO:23, SEQ ID NO:27, SEQ ID NO:32, SEQ ID NO:35, SEQ ID NO:43, SEQ ID NO:50, SEQ ID NO:53, SEQ ID NO:57, SEQ ID NO:59, SEQ ID NO:63, SEQ ID NO:66, SEQ ID NO:69, SEQ ID NO:73, SEQ ID NO:75, SEQ ID NO:77, SEQ ID NO:81, 10 SEQ ID NO:85, SEQ ID NO:88, SEQ ID NO:90. SEQ ID NO:96, SEQ ID NO:99, SEQ ID NO:102, SEQ ID NO:105, SEQ ID NO:108, SEQ ID NO:l 13, SEQ ID NO:116, SEQ ID NO:1 18, SEQ ID NO:121, SEQ ID NO:123, SEQ ID NO:124, SEQ ID NO:126, SEQ ID NO:128, SEQ ID NO:131, SEQ ID NO:133, SEQ ID NO:135, SEQ ID NO:137, SEQ ID NO:139, SEQ ID NO:141, SEQ ID NO:143, SEQ ID NO:145, SEQ ID NO:147, SEQ ID 15 NO:149, SEQ ID NO:151, SEQ ID NO:154, SEQ ID NO:156, SEQ ID NO:158, SEQ ID NO:160, SEQ ID NO:162, SEQ ID NO:164, SEQ ID NO:165, SEQ ID NO:167, SEQ ID NO:170, SEQ ID NO:172, SEQ ID NO:174, SEQ ID NO:176, or SEQ ID NO:178, wherein each species of antibody iumunospecifically binds to a RSV antigen. 20 53. A composition comprising one or more species of antibodies, each species of antibody comprising a VL CDR3 having an amino acid sequence of SEQ ID NO:6, SEQ ID NO:16, or SEQ ID NO:61, wherein each species of antibody irnmunospecifically binds to a RSV antigen and none of the species of antibodies is SYNAGIS@. 25 54. A composition comprising two or more species of antibodies, each species of antiodynnising.a KL CDR3..aving .aminoacid.sequee.af.SEQ.D.N:4,.SEQ.JD *NO:16, or SEQ ID NO:61, wherein each species of antibody inmunospecifically binds to a RSV antigen. 30 55. A composition comprising one or more of AFFF, Pfl2, P12f4, P1 1d4, Ale9, A12a6, A13c4, A17d4, A4B4, A8C7, 1X-493L1FR, H3-3F4, M3H9, Y1OH6, DG, AFFF(1), 6H8, LI-7E5, L2-15B10, Al3al1, Alh5, A4B4(1), A4B4LIFR-S28R, or A4B4 F52S. 35 -170 -

56. An isolated nucleic acid molecule comprising a nucleotide sequence encoding an antibody comprising a VH domain having an amino acid sequence of SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO: 17, SEQ ID NO:24, SEQ ID NO:28, SEQ ID NO:33, SEQ ID NO:36, SEQ ID NO:40, SEQ ID NO:44, SEQ ID NO:48, SEQ ID NO:51, SEQ ID 5 NO:55, SEQ ID NO:67, or SEQ ID NO:78, wherein said antibody immunospecifically binds to a RSV antigen and said antibody is not SYNAGIS@.

57. An isolated nucleic acid molecule comprising a nucleotide sequence encoding an antibody comprising a VL domain having an amino acid sequence of SEQ ID 10 NO:8, SEQ ID NO:13, SEQ ID NO:21, SEQ ID NO:26, SEQ ID NO:30, SEQ ID NO:34, SEQ ID NO:38, SEQ ID NO:42, SEQ ID NO:46, SEQ ID NO:49, SEQ ID NO:52, SEQ ID NO:54, SEQ ID NO:56, SEQ ID NO:5S, SEQ ID NO:60, SEQ D NO:62, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:68, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:74 or SEQ ID NO:76, wherein said antibody inumunospecifically binds to a RSV antigen and said 15 antibody is not SYNAGIS@.

58. The isolated nucleic acid molecule of claim 57, wherein the nucleotide sequence encoding the antibody further comprises a VH domain having an amino acid sequence of SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO: 17, SEQ ID NO:24, SEQ ID NO:28, 20 SEQ ID NO:33, SEQ ID NO:36, SEQ ID NO:40, SEQ ID NO:44, SEQ ID NO:48, SEQ ID NO:51. SEQ ID NO:55, SEQ ID NO:67, or SEQ ID NO:78.

59. An isolated nucleic acid molecule comprising a nucleotide sequence encoding an antibody comprising a VH CDR1 having an amino acid sequence of SEQ ID 25 NO:1, SEQ ID NO:10, SEQ ID NO:18, wherein said antibody immunospecifically binds to a RSV antigen.

60. An isolated nucleic acid molecule comprising a nucleotide sequence encoding an antibody comprising a VH CDR2 having an amino acid sequence of SEQ ID 30 NO:2, SEQ ID NO:19, SEQ ID NO:25, SEQ ID NO:37, SEQ ID NO:41, SEQ ID NO:45, SEQ ID NO:82, SEQ ID NO:86, SEQ ID NO:91, SEQ ID NO:93, SEQ LID NO:100, SEQ ID NO:103, SEQ ID NO:105, SEQ ID NO:109, SEQ ID NO:1 11, or SEQ ID NO: 114, wherein said antibody imunospecifically binds to a RSV antigen and said antibody is not SYNAGIS@. 35 - 171 -

61. An isolated nucleic acid molecule comprising a nucleotide sequence encoding an antibody comprising a VH CDR3 having an amino acid sequence of SEQ ID NO:3, SEQ ID NO:12, SEQ ID NO:20, SEQ ID NO:29, SEQ ID NO:79, SEQ ID NO:83, SEQ ID N1O:94 or SEQ ID NO:97, wherein said antibody immunospecifically binds to a 5 RSV antigen and said antibody is not SYNAGIS@.

62. An isolated nucleic acid molecule comprising a nucleotide sequence encoding an antibody comprising a VL CDRI having an amino acid sequence of SEQ ID NO:4, SEQ ID NO: 14, SEQ ID NO:22, SEQ ID NO:3 1, SEQ ID NO:39 or SEQ ID NO:47, 10 SEQ ID 10:80. SEQ ID NO:84, SEQ ID NO:87, SEQ ID NO:89, SEQ ID NO:92, SEQ ID N10:95, SEQ ID NO:98. SEQ ID NO:101, SEQ ID NO:104, SEQ ID NO:107, SEQ ID NO:1 10, SEQ ID NO:112, SEQ ID NO:115, SEQ ID NO:117, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:122, SEQ ID NO:125, SEQ ID NO:127, SEQ ID NO:129, SEQ ID NO:130, SEQ ID NO:132, SEQ ID NO:134, SEQ ID NO: 136, SEQ ID NO:138, SEQ ID 15 NO: 140, SEQ ID NO:142, SEQ ID NO:144, SEQ ID NO: 146, SEQ ID NO:148, SEQ ID 10:150, SEQ ID NO:152, SEQ ID NO:153, SEQ ID NO: 155, SEQ ID NO:157, SEQ ID NO:159, SEQ ID NO:161, SEQ ID NO:163, SEQ ID NO:166, SEQ ID NO:168, SEQ ID NO:169, SEQ ID NO:171, SEQ ID NO:173, SEQ ID NO: 175, SEQ ID NO:177, SEQ ID 110:179, SEQ ID NO:180, SEQ ID NO:181, SEQ ID NO:182, SEQ ID NO:183, SEQ ID 20 NO:184, SEQ ID NO:185. SEQ ID NO:186, SEQ ID NO:187, SEQ D NO:188, SEQ ID NO:189, SEQ ID NO:190, SEQ ID NO:191, SEQ ID NO:192, SEQ ID NO:193, SEQ ID NO:194, SEQ ID NO:195, SEQ ID 10:196, SEQ ID NO:197, SEQ ID NO:198, SEQ ID NO:199, SEQ ID NO:200, SEQ ID NO:201. SEQ ID NO:202, SEQ ID NO:203, SEQ ID NO:204, SEQ ID NO:205, SEQ ID NO:206, or SEQ ID NO:207, wherein said antibody 25 immunospecifically binds to a RSV antigen and said antibody is not SYNAGIS@.

63. An isolated nucleic acid mo'lecule comprising a nucleotide sequence encoding an antibody comprising a VL CDR2 having an amino acid sequence of SEQ ID NO:5, SEQ ID NO:15, SEQ ID NO:23, SEQ ID NO:27, SEQ ID NO:32, SEQ ID NO:35, 30 SEQ ID NO:43, SEQ ID NO:50, SEQ ID NO:53, SEQ ID NO:57, SEQ ID NO:59, SEQ ID NO:63, SEQ ID NO:66, SEQ ID NO:69, SEQ ID NO:73, SEQ ID NO:75, SEQ ID NO:77, SEQ ID NO:81, SEQ ID NO:85, SEQ ID NO:88, SEQ ID NO:90, SEQ ID NO:96, SEQ ID NO:99, SEQ ID NO:102, SEQ ID NO:105, SEQ ID NO:108, SEQ ID NO:113, SEQ ID NO:116, SEQ ID NO:118, SEQ ID NO:121, SEQ ID NO:123, SEQ ID NO:124, SEQ ID 35 NO:126, SEQ ID NO:128, SEQ ID NO:131, SEQ ID NO:133, SEQ ID NO:135, SEQ ID - 172- NO:137, SEQ ID NO:139, SEQ D NO:141, SEQ ID NO:143, SEQ ID NO:145, SEQ ID NO:147, SEQ ID NO:149, SEQ ID NO:151, SEQ ID NO:154, SEQ ID NO:156, SEQ ID NO:158, SEQ ID NO:160, SEQ ID NO:162, SEQ ID NO:164, SEQ ID NO:165, SEQ ID NO:167, SEQ ID NO:170, SEQ ID NO:172, SEQ ID NO:174, SEQ ID NO:176, or SEQ fD 5 NO:178. wherein said antibody immunospecifically binds to a RSV antigen and said antibody is not SYNAGIS@.

64. An isolated nucleic acid molecule comprising a nucleotide sequence encoding an antibody comprising a VL CDR3 having an amino acid sequence of SEQ ID 10 NO:6, SEQ ID NO:16. or SEQ ID NO:61, wherein said antibody immunospecifically binds to a RSV antigen and said antibody is not SYNAGIS®.

65. A vector comprising the nucleic acid molecule as in any one of claims 56-64. 15 66. The vector of claim 65 further comprising a nucleotide sequence which regulates the expression of the antibody encoded by the nucleic acid molecule.

67. A host cell genetically engineered to express the nucleic acid molecule as in any of claims 56-64. 20

68. A host cell comprising the vector of claim 65.

69. A mammalian host cell comprising the nucleic acid molecule as in any of claims 56-64. 25

70. A muamrnalian host cell.cotmprising the vec.torof.claim..65..

71. A method for producing an antibody comprising culturing the host cell of claim 67 under conditions in which the nucleic acid molecule is expressed. 30

72. A method for producing an antibody comprising culturing the host cell of claim 68 under conditions in which the nucleic acid molecule is expressed.

73. A pharmaceutical composition comprising at least one antibody as in any of 35 claims 1-9 and a carrier or excipient. - 173 -

74. The pharmaceutical composition of claim 73 formulated for pulmonary administration.

75. The pharmaceutical composition of claim 73, which is a sustained release 5 formulation.

76. A method of preventing, treating or ameliorating a RSV infection, comprising administering to a mammal in need thereof the pharmaceutical composition of claim 73 in an amount effective to treat, prevent or ameliorate the RSV infection. 10

77. A method of preventing, treating or ameliorating a RSV infection, comprising administering to a mammal in need thereof the pharmaceutical composition of claim 75 in an amount effective to treat, prevent or ameliorate the RSV infection. 15 78. The method of claim 76, wherein the pharmaceutical composition is administered once a month just prior to or during the RSV season.

79. The method of claim 76, wherein the pharmaceutical composition is administered every two months during the RSV season. 20

80. The method of claim 76, wherein the pharmaceutical composition is administered intramuscularly, intravaneously or subcutaneously.

81. The method of claim 76, wherein the pharmaceutical composition is 25 administered by pulmonary administration.

83. The method of claim 76, wherein the mammal is a human infant. 30

84. The method of claim 76, wherein the mammal is a human infant born prematurely or a human infant at risk of hospitalization for a RSV infection. 35 -174-

85. The method of claim 82, wherein the human has cystic fibrosis, bronchopulmonary dysplasia, congenital heard disease, congenital immunodeficiency, or acquired immunodeficiency, has had a bone marrow transplant, or is elderly. 5 86. A method for detecting a RSV infection, comprising: (a) assaying the level of a RSV antigen in cells or a tissue sample of a subject using one or more species of antibodies that inimunospecifically bind to said RSV antigen, wherein each species of antibody comprises a VH domain having the amino acid sequence 10 of SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:17, SEQ [D NO:24, SEQ ID NO:28, SEQ ID NO:33, SEQ ID NO:36, SEQ ID NO:40, SEQ ID NO:44, SEQ ID NO:48, SEQ ID NO:51, SEQ ID NO:55, SEQ ID NO:67, or SEQ ID NO:78 and none of the species of antibodies is SYNAGIS@; and I5 (b) comparing the assayed level of the RSV antigen vith a control level, whereby an increase in the assayed level of RSV antigen compared to the control level of the RSV antigen is indicative of a RSV infection.

87. A method for detecting a RSV infection, comprising: 20 (a) assaying the level of a RSV antigen in cells or a tissue sample of a subject using one or more species of antibodies that immunospecifically bind to said RSV antigen, wherein each species of antibody comprises a VL domain having the amino acid sequence of SEQ ID NO:8, SEQ ID NO:13, SEQ ID NO:21, SEQ ID NO:26, 25 SEQ ID NO:30, SEQ ID NO:34, SEQ ID NO:38, SEQ ID NO:42, SEQ ID NO:46, SEQ ID NO:49, SEQ ID NO:52, SEQ ID NO:54, ISE Q -1D NG3: 5, -Q,,D N M: 5-E, ISGQ T' N9, 0- EQ -I N Z, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:68, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:74 or SEQ ID NO:76 and none of the 30 species of antibodies is SYNAGIS@; and (b) comparing the assayed level of the RSV antigen with a control level, whereby an increase in the assayed level of RSV antigen compared to the control level of the RSV antigen is indicative of a RSV infection. 35 88. A method for detecting a RSV infection, comprising: - 175 - (a) assaying the level of a RSV antigen in cells or a tissue sample of a subject using two or more species of antibodies that immunospecifically bind to said RSV antigen, wherein each species of antibody comprises a VH domain having the amino acid sequence 5 of SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:17, SEQ ID NO:24, SEQ ID NO:28, SEQ ID NO:33, SEQ ID NO:36, SEQ ID NO:40, SEQ ID NO:44, SEQ ID NO:48, SEQ ID NO:5 1, SEQ ID NO:55, SEQ ID NO:67, or SEQ ID NO:78; and (b) comparing the assayed level of the RSV antigen with a control level, 10 whereby an increase in the assayed level of RSV antigen compared to the control level of the RSV antigen is indicative of a RSV infection.

89. A method for detecting a RSV infection, comprising: (a) assaying the level of a RSV antigen in cells or a tissue sarmple of 15 a subject using two or more species of antibodies that immunospecifically bind to said RSV antigen, wherein each species of antibody comprises a VL domain having the amino acid sequence of SEQ ID NO:8, SEQ ID NO:13, SEQ ID NO:2 1, SEQ ID NO:26, SEQ ID NO:30, SEQ ID NO:34, SEQ ID NO:38, SEQ ID NO:42, 20 SEQ ID NO:46, SEQ ID NO:49, SEQ ID NO:52, SEQ ID NO:54, SEQ ID NO:56, SEQ ID NO:58, SEQ ID NO:60, SEQ ID NO:62, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:68, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:74 or SEQ ID NO:76; and (b) comparing the assayed level of the RSV antigen with a control level, 25 whereby an increase in the assayed level of RSV antigen compared to the control level of the RSV antigen is indicative of a RSV infection.

90. A method for detecting a RSV infection, comprising: (a) assaying the level of a RSV antigen in cells or a tissue sample of 30 a subject using one or more species of antibodies that immunospecifically bind to said RSV antigen, wherein each species of antibody comprises a VH CDRl having the amino acid sequence of SEQ IfD NO:1, SEQ ID NO:10, SEQ ID NO:18 and none of the species of antibodies is SYNAGIS@; and 35 -176- (b) comparing the assayed level of the RSV antigen with a control level, whereby an increase in the assayed level of RSV antigen compared to the control level of the RSV antigen is indicative of a RSV infection. 5 91. A method for detecting a RSV infection, comprising: (a) assaying the level of a RSV antigen in cells or a tissue sample of a subject using one or more species of antibodies that immunospecifically bind to said RSV antigen, wherein each species of antibody comprises a VH CDR2 having the amino acid sequence 10 of SEQ ID NO:2, SEQ ID NO:19, SEQ ID NO:25, SEQ ID NO:37, SEQ ID NO:41, SEQ ID NO:45, SEQ ID NO:82, SEQ ID NO:86, SEQ ID NO:91, SEQ ID NO:93, SEQ ID NO:100, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 109, SEQ ID NO: I I, or SEQ ID NO: 114 and none of the species of antibodies is SYNAGIS@; and 15 (b) comparing the assayed level of the RSV antigen with a control level, whereby an increase in the assayed level of RSV antigen compared to the control level of the RSV antigen is indicative of a RSV infection.

92. A method for detecting a RSV infection, comprising: 20 (a) assaying the level of a RSV antigen in cells or a tissue sample of a subject using one or more species of antibodies that immunospecifically bind to said RSV antigen, wherein each species of antibody comprises a VH CDR3 having the amino acid sequence of SEQ ID NO:3, SEQ ID NO:12, SEQ ID NO:20, SEQ ID NO:29, 25 SEQ ID NO:79, SEQ ID NO:83, SEQ ID NO:94 or SEQ ID NO:97 .adnane afthe p~ ieaatibodies.,is..SYNAdSaand (b) coinpafing the assayeievdI f fnekSV antigen vitn a contrcillevsi, whereby an increase in the assayed level of RSV antigen compared to the control level of the RSV antigen is indicative of a RSV infection. 30

93. A method for detecting a RSV infection, comprising: (a) assaying the level of a RSV antigen in cells or a tissue sample of a subject using one or more species of antibodies that irmmunospecifically bind to said RSV antigen, wherein each species 35 of antibody comprises a VL CDRI having the amino acid sequence of - 177 - SEQ ID NO:4, SEQ ID NO:14, SEQ ID NO:22, SEQ ID NO:31, SEQ ID NO:39 or SEQ ID NO:47, SEQ ID NO:80, SEQ ID NO:84, SEQ ID NO:87, SEQ ID NO:89, SEQ ID NO:92, SEQ ID NO:95, SEQ ID NO:98, SEQ ID NO:101, SEQ ID NO:104, SEQ ID NO:107, SEQ ID 5 NO:110, SEQ ID NO:112, SEQ ID NO:115, SEQ ID NO:117, SEQ ID NO: 119, SEQ ID NO:120, SEQ ID NO:122, SEQ ID NO:125, SEQ ID NO: 127, SEQ ID NO: 129, SEQ ID NO:130, SEQ ID NO:132, SEQ ID NO:134, SEQ ID NO:136, SEQ ID NO:138, SEQ ID NO:140, SEQ ID NO:142, SEQ ID NO:144, SEQ ID NO:146, 10 SEQ ID NO: 148, SEQ ID NO: 150, SEQ ID NO: 152, SEQ ID NO:153, SEQ ID NO:155, SEQ ID NO:157, SEQ ID NO:159, SEQ ID NO:161, SEQ ID NO:163, SEQ ID NO:166, SEQ ID NO:168, SEQ ID NO:169, SEQ ID NO:171, SEQ ID NO: 173, SEQ ID NO:175, SEQ ID NO:177, SEQ ID NO:179, SEQ ID NO:180, SEQ 15 ID NO:181, SEQ ID NO:182, SEQ ID NO:183, SEQ ID NO:I84, SEQ ID NO: 185, SEQ ID NO: 186, SEQ ID NO:187, SEQ ID NO:188, SEQ ID NO:189, SEQ ID NO:190, SEQ ID NO:191, SEQ ID NO:192, SEQ ID NO:193, SEQ ID NO:194, SEQ ID NO:195, SEQ ID NO:196, SEQ ID NO:197, SEQ ID NO:198, SEQ ID 20 NO:199, SEQ ID NO:200, SEQ ID NO:201, SEQ ID NO:202, SEQ ID NO:203, SEQ ID NO:204, SEQ ID NO:205, SEQ ID NO:206, or SEQ ID NO:207 and none of the species of antibodies is SYNAGIS@; and (b) comparing the assayed level of the RSV antigen with a control level, 25 whereby an increase in the assayed level of RSV antigen compared to the control level of the RSV antigen is indicative of a RSV infection.

94. A method for detecting a RSV infection, comprising: (a) assaying the level of a RSV antigen in cells or a tissue sample of 30 a subject using one or more species of antibodies that immunospecifically bind to said RSV antigen, wherein each species of antibody comprises a VL CDR2 having the amino acid sequence of SEQ ID NO:5, SEQ ID NO:15, SEQ ID NO:23, SEQ ID NO:27, SEQ ID NO:32, SEQ ID NO:35, SEQ ID NO:43, SEQ ID NO:50, SEQ ID 35 NO:53, SEQ ID NO:57, SEQ ID NO:59, SEQ ID NO:63, SEQ ID - 178 - NO:66, SEQ ID NO:69, SEQ ID NO:73, SEQ ID NO:75, SEQ ID NO:77, SEQ ID NO:81, SEQ ID NO:85, SEQ ID NO:88, SEQ ID NO:90, SEQ ID NO:96, SEQ ID NO:99, SEQ ID NO:102, SEQ ID NO:105, SEQ ID NO:108, SEQ ID NO: 113, SEQ ID NO: 116, SEQ 5 ID NO:1 18, SEQ ID NO:121, SEQ ID NO:123, SEQ ID NO:124, SEQ ID NO:126, SEQ ID NO:128, SEQ ID NO:131, SEQ ID NO:133, SEQ ID NO:135, SEQ ID NO:137, SEQ ID NO:139, SEQ ID NO:141, SEQ ID NO:143, SEQ ID NO:145, SEQ ID NO:147, SEQ ID NO:149, SEQ ID NO:1Sl, SEQ ID NO:154, SEQ ID 10 NO:156, SEQ ID NO:158, SEQ ID NO:160, SEQ ID NO:162, SEQ ID NO:164, SEQ ID NO:165, SEQ ID NO:167, SEQ ID NO:170, SEQ ID NO:172, SEQ ID NO:174, SEQ ID NO:176, or SEQ ID NO:178 and none of the species of antibodies is SYNAGIS@; and (b) comparing the assayed level of the RSV antigen with a control level, 15 whereby an increase in the assayed level of RSV antigen compared to the control level of the RSV antigen is indicative of a RSV infection.

95. A method for detecting a RSV infection, comprising: (a) assaying the level of a RSV antigen in cells or a tissue sample of 20 a subject using one or more species of antibodies that iinmunospecifically bind to said RSV antigen, wherein each species of antibody comprises a VL CDR3 having the amino acid sequence of SEQ ID NO:6, SEQ ID NO:16, or SEQ ID NO:61 and none of the species of antibodies is SYNAGIS@; and 25 (b) comparing the assayed level of the RSV antigen with a control level, whereby an increase in the assayed level of RSV antigen compared to ; mati kvel of-he RSV mat-i-go 6s.indioDattve of[a RSV iifoiarr.

96. A method of preventing treating or ameliorating one or more symptoms 30 associated with a RSV infection in a mammal, said method comprising administering to said rnamnial a dose of an effective amount of one or more antibodies or fragments thereof that immunospecifically bind to one or more RSV antigens, wherein said effective amount is less than 15 mg/kg of said antibodies or antibody fragments. - 179 -

97. The method of claim 96, wherein said antibodies or antibody fragments have an affinity of at least 2 X 10' M for said one or more RSV antigens.

98. The method of claim 96 or 97, wherein the dose is less than 5 mg/kg or less. 5

99. The method of claim 96 or 97, wherein the dose is 3 mg/kg or less, or 1.5 mg/kg or less.

100. The method of claim 96, wherein said antibodies or antibody fragments are 10 administered by a nebulizer or inhaler.

101. The method of claim 96, wherein said antibodies or antibody fragments are administered intramuscularly, intravaneously or subcutaneously. 15 102. The method of claim 96, wherein said antibodies or antibody fragments administered 1, 2, 3. 4 or 5 times during the RSV season.

103. The method of claim 96, wherein at least one of the antibodies is a human or humanized monoclonal antibody. 20

104. The method of claim 96, wherein the mammal is a human subject, a human subject which has had a bone marrow transplant, an elderly human subject, or a human subject which has cystic fibrosis, bronchopulmonary dysplasia, congenital heart disease, congenital immunodeficiency or acquired immunodeficiency. 25

105. The method of claim 96, wherein the mammal is a human infant.

106. The method of claim 96, wherein the mammal is a human infant born prematurely or is at risk of hospitalization for a RSV infection. 30

107. The method of claim 96, wherein at least one of the antibodies is SYNAGIS@, AFFF, Pl2f2, P12f4, P1 ld4, Ale9, A 12a6, A13c4, A17d4, A4B4, ASC7, IX 493LIFR, H3-3F4, M3H9, Y10H6, DG, AFFF(1), 6H8, LI-7E5, L2-15B10, A13al 1, AIh5, A4B4(l), A4B4-Ll FR-S28R, or A4B4-F52S. 35 - 180-

108. A method of preventing, treating or ameliorating one or more symptoms associated with a RSV infection in a manmmal, comprising administering to said mammal a first dose of an effective amount of one or more antibodies that immunospecifically bind to one or more RSV antigens, wherein said effective amount is a dose of less than 15 mg/kg of 5 said antibodies or antibody fragments, wherein said administration results in an effective serum titer of said antibodies or antibody fragments that is less than 30 pg/ml at least 20 days after the administration of said first dose and prior to the administration of a subsequent dose. 10 109. The method of claim 108, wherein said antibodies or antibody fragments bind to said one or more RSV antigens with an affinity constant of at least 2 X 108M'.

110. The method of claim 108 or 109, wherein the dose is less than 5 mg/kg or less. 15

111. The method of claim 108 or 109, wherein the dose is 3 mg/kg or less, or 1.5 mg/kg or less.

112. The method of claim 108, wherein said effective serum titer is at least 2 20 pg/ ml. -1-tt. The method of claim 108, wherein said effective serum titer is less than 30 pg/ml at least 30 days after the administration of said first dose and prior to the administration of a subsequent dose. 25

114. The method of claim 108, wherein.the.dnse.is.1.5.m/kg.or lessand.said ctive srum ci'er is at 6east 2 pg/nt at leask t31 days after Vie wdmiriislraioi of -s-id firm dose and prior to the administration ofa subsequent dose. 30 115. The method of claim 108, wherein said antibodies or antibody fragments are administered by a nebulizer or inhaler.

116. The method of claim 108, wherein said antibodies or antibody fragments are administered intramuscularly, intravaneously or subcutaneously. 35 - 181 -

117. The method of claim 108, wherein said antibodies or antibody fragments have half-lives in said human subject of greater than 25 days.

118. The method of claim 108, wherein at least one of the antibodies is a human 5 or humanized monoclonal antibody.

119. The method of claim 108, wherein the mammal is a human subject, a human subject which has had a bone marrow transplant, an elderly human subject, or a human subject which has cystic fibrosis, bronchopulmonary dysplasia, congenital heart disease, 10 congenital innunodeficiency or acquired immunodeficiency.

120. The method of claim 108, wherein the manual is a human infant.

121. The method of claim 108, wherein the mammal is a human infant born 15 prematurely or is at risk of hospitalization for a RSV infection.

122. The method of claim 108, wherein at least one of the antibodies is SYNAGIS@, AFFF, Pl2f2, P12f4, P1 ld4, Ale9, Al2a6, A13c4, Al7d4, A4B4, ASC7, IX 493LI FR. H3-3F4, M3H9, YlOH6, DG, AFFF(1), 6H8, LI-7E5, L2-15B10, Al3al 1, Alh5, 20 A4B4(1), A4B4-Ll FR-S28R, or A4B4-F52S.

123. A method of preventing, treating or ameliorating one or more symptoms associated with a RSV infection in a manual, said method comprising administering to said mammal a first dose of an effective amount of one or more antibodies or fragments thereof 25 that immunospecifically bind to one or more RSV antigens, wherein said effective amount is approximately 15 rmg/kg or less of said antibodies or antibody fragments and an effective -amntiie- iriairnaiedit! for a- least2a -days arthe - dse -aridjpriolr to the administration of a subsequent dose. 30 124. The method of claim 123, wherein the antibodies or antibody fragments have an affinity of at least 2 X 108 M- for said one or more RSV antigens.

125. The method of claim 123, wherein said effective serum titer is at least 30 35 pig/ml of said antibodies or antibody fragments. - 182 -

126. The method of claim 123, wherein said effective serum titer is at least 2 pg/mi of said antibodies or antibody fragments.

127. The method of claim 123, wherein the effective serum titer is maintained for 5 at least 25 days or at least 30 days.

128. The method of claim 123, wherein said antibodies or antibody fragments are administered by a nebulizer or inhaler. 10 129. The method of claim 123, wherein said antibodies or antibody fragments are administered intramuscularly, intravaneously or subcutaneously.

130. The method of claim 123, wherein said antibodies or antibody fragments have half-lives in said human subject of greater than 25 days. 15

131. The method of claim 123, wherein at least one of the antibodies is a human or humanized monoclonal antibody.

132. The method of claim 123, wherein the mammal is a human subject, a human 20 subject which has had a bone marrow transplant, an elderly human subject, or a human subject which has cystic fibrosis, bronchopulmonary dysplasia, congenital heart disease, congenital inununodeficiency or acquired immunodeficiency.

133. The method of claim 123, wherein the mammal is a human infant. 25

134. The method of claim 123, wherein the manual is a human infant born .pamaturdr i s~.at fisk ,olfhlospt~alz.afi.on for.a RV.' idifacf.o

135. The method of claim 123, wherein at least one of the antibodies is 30 SYNAGIS@, AFFF, Pl2f2, Pl2f4, P11d4, Ale9, Al2a6, A13c4, A17d4, A4B4, A8C7, 1X 493LIFR, H3-3F4, M3H9, Y1OH6, DG, AFFF(l), 6H8, LI-7E5, L2-15B10, Al3al1, Alh5, A4B4(l), A4B4-LlFR-S28R, or A4B4-F52S.

136. A sustained release formulation comprising one or more antibodies or 35 fragments thereof that immunospecifically bind to one or more RSV antigens. -183 -

137. A pharmaceutical composition comprising one or more antibodies or fragments thereof that immunospecifically bind to one or more RSV antigens formulated for pulmonary delivery. 5 138. The sustained release formulation of claim 136. wherein the antibodies or antibody fragments have an affinity of at least 2 X 10 M' for said one or more RSV antigens.

139. The pharmaceutical composition of claim 137, wherein the antibodies or 10 antibody fragments have an affinity of at least 2 X 10' M for said one or more RSV antigens.

140. The sustained release formulation of claim 136, wherein at least one of the antibodies or antibody fragments is SYNAGIS® or an antigen-binding fragment thereof. 15

141. The pharmaceutical composition of claim 137, wherein at least one of the antibodies or antibody fragments is SYNAGIS@ or an antigen-binding fragment thereof.

142. The sustained release formulation of claim 136, wherein at least one of said 20 antibodies or antibody fragments is a human or humanized antibody or antibody fragment.

143. The pharmaceutical composition of claim 137, wherein at least one of said antibodies or antibody fragments is a human or humanized antibody or antibody fragment. 25

144. The sustained release formulation of claim 136, wherein at least one of said ,antibhodies.isSNACdS@,AEFEi, .. 1.2D L.El.2f4,..J1Id4,3Ae9 AJ2a64..All44244, A4B4, A8C7, IX-493LTFR,fH3-3F4, M3H9, YI UH6, DG, kFFF(l), 6148, L-7E5, L2 15B 10, A 13al 1, Al h5, A4B4(l), A4B4-LlFR-S28R, or A4B4-F52S. 30

145. The pharmaceutical composition of claim 137, wherein at least one of said antibodies at least one of the antibodies is SYNAGIS@, AFFF, P12f2, P12f4, P I1d4, Ale9, A12a6, A13c4, AI7d4, A4B4, A8C7, 1X-493L IFR, H3-3F4, M3H9, YIOH6, DG, AFFF(l), 6H8, LI-7E5, L2-15B10, A13al 1, Alh5, A4B4(1), A4B4-L1FR-S28R, or A4B4 F52S. 35 - 184-

146. The sustained release formulation of claim 136, wherein at least one of said antibodies or antibody fragments has an increased in vivo half-life.

147. The pharmaceutical composition of claim 137, wherein at least one of said 5 antibodies or antibody fragments has an increased in vivo half-life.

148. A method of preventing, treating or ameliorating one or more symptoms associated with a RSV infection in a mammal, said method comprising administering to said mammal an effective amount of the sustained release formulation of claim 136. 10

149. A rnethod of preventing, treating or ameliorating one or more symptoms associated with a RSV infection in a manmmal, said method comprising administering to the lungs of said mammal an effective amount of the pharmaceutical composition of claim 137. 15

150. The method of claim 148, wherein the sustained release formulation is administered intramuscularly, intravaneously or subcutaneously.

151. The method of claim 148, wherein the sustained release formulation is administered by a nebulizer or inhaler. 20

152. The method of claim 149, wherein the pharmaceutical composition is administered intramuscularly. intravaneously or subcutaneously.

153. The method of claim 149, wherein the pharmaceutical composition is 25 administered by a nebulizer or inhaler.

154. "The method ofclaim'l45, vherein (he marnm"Cis ahurnan subject.

155. The method of claim 149, wherein the mammal is a human subject. 30

156. The method of claim 154, wherein the human subject has had a bone marrow transplant, is elderly. or has cystic fibrosis, bronchopulmonary dysplasia, congenital heart disease, congenital immunodeficiency or acquired inmunodeficiency. 35 - 185 -

157. The method of claim 155, wherein the human subject has had a bone marrow transplant, is elderly, or has cystic fibrosis, bronchopulmonary dysplasia, congenital heart disease, congenital inununodeficiency or acquired immunodeficiency. 5

158. The method of claim 154, wherein the human subject is an infant.

159. The method of claim 154, wherein the human subject is an infant born prematurely or is at risk of hospitalization for a RSV infection. 10

160. The method of claim 155, wherein the human subject is an infant.

161. The method of claim 155, wherein the human subject is an infant born prematurely or is at risk of hospitalization for a RSV infection. 15

162. A method of preventing, treating or ameliorating one or more symptoms associated with a RSV infection in a mammal, said method comprising administering to said mammal a first dose of an effective dose of SYNAGIS@ or an antigen-binding fragment thereof in a sustained release formulation, wherein said effective dose is approximately 15 mg/kg or less of SYNAGIS® or an antigen-binding fragment thereof and an effective serum 20 titer of at least 30 pg/mil is maintained for at least 20 days after the administration said first dose and prior to the administration of a subsequent dose.

163. The method of claim 162, wherein said effective serum titer is maintained for at least 25 days or at least 30 days after the administration of the first dose and prior to the 25 administration of a subsequent dose. T64. ahemete fozla imII, i62,whe ent-SVNAG11@'om -an, -a t igef ibindahygit fragment thereof is administered by a nebulizer or inhaler. 30

165. The method of claim 162, wherein SYNAGIS® or an antigen-binding fragment thereof is administered intramuscularly, intravaneously or subcutaneously.

166. The method of claim 162, wherein SYNAGIS@ or an antigen-binding fragment thereof is administered 1, 2, 3, 4, or 5 times during the RSV season. 35 - 186 -

167. The method of claim 162, wherein the mammal is a human subject, a human subject which has had a bone marrow transplant, an elderly human subject, or a human subject which has cystic fibrosis, bronchopulmonary dysplasia, congenital heart disease, congenital immunodeficiency or acquired immunodeficiency.

168. The method of claim 162, wherein the mammal is a human infant.

169. The method of claim 162, wherein the mammal is a human infant born prematurely or is at risk of hospitalization for a RSV infection. 10

170. A method of preventing, treating or ameliorating one or more symptoms associated with a RSV infection in a manual, said method comprising administering to said mammal a first dose of an effective dose of one or more antibodies or fragments thereof that inununospecifically bind to one or more RSV antigens with an affinity of at least 2 X 10' 15 M'~ in a sustained release formulation, wherein said effective dose is approximately 15 mg/kg or less of said antibodies or antibody fragments and an effective serum titer of less than 30 pg/ml is maintained for at least 20 days after the administration said first dose and prior to the administration of a subsequent dose. 20 171. The method of claim 170. wherein said effective serum titer is at least 2 pg/ml.

172. The method of claim 170, wherein said effective serum titer is maintained for at least 25 days or at least 30 days after the administration of the first dose and prior to the 25 administration of a subsequent dose.

173. The method of claim 170, wherein said antibodies or antibody fragments are administered by a nebulizer or inhaler. 30 174. The method of claim 170, wherein said antibodies or antibody fragments are administered intramuscularly, intravaneously or subcutaneously.

175. The method of claim 170, wherein said antibodies or antibody fragments are administered 1, 2, 3, 4, or 5 times during the RSV season. 35 - 187 -

176. The method of claim 170, wherein said antibodies or antibody fragments have half-lives in said human subject of greater than 25 days.

177. The method of claim 170, wherein at least one of the antibodies is a human 5 or humanized monoclonal antibody.

178. The method of claim 170, wherein the mammal is a human subject, a human subject which has had a bone marrow transplant, an elderly human subject, or a human subject which has cystic fibrosis, bronchopulmonary dysplasia, congenital heart disease, 10 congenital inununodeficiency or acquired inmunodeficiency.

179. The method of claim 170, wherein the manual is a human infant.

180. The method of claim 170, wherein the maiimal is a human infant born 15 prematurely or is at risk of hospitalization for a RSV infection. .

181. The method of claim 170, wherein at least one of the antibodies is AFFF, P12f2, P12f4, P1 1d4, Ale9, AI2a6, A13c4, A17d4, A4B4, A8C7, IX-493LIFR, H3-3F4, M3H9, YIOH6. DG, AFFF(I), 6H8, LI-7E5, L2-l 5B10, Al3al 1., Alh5, A4B4(1), A4B4 20 LIFR-S28R, or A4B4-F52S.

182. A method of preventing, treating or ameliorating one or more symptoms associated with a RSV infection in a mammal, said method comprising administering to said marmal a dose of an effective amount of one or more antibodies or fragments thereof that 25 immunospecifically bind to one or more RSV antigens and have increased in vivo half-lives, wherein said effective amount is a dose approximately 15 mg/kg or less of said antibodies ox antibody fragments.

183. The method of claim 182, wherein said antibodies or antibody fragments 30 have an affinity of at least 2 X 108 M' for said one or more RSV antigens.

184. The method of claim 182, wherein the dose is less than 5 mg/kg or less, 3 mg/kg or less, or 1.5 mg/kg or less. 35 - 188 -

185. The method of claim 182, wherein the increase in in vivo half-life is from 21 days to at least 25 days or from 21 days to at least 30 days.

186. A method of preventing, treating or ameliorating one or more symptoms 5 associated with a RSV infection in a mammal, said method comprising administering to said manunal a dose of an effective amount of HL-SYNAGIS or an antigen-binding fragment thereof, wherein said effective amount is a dose of approximately 15 mg/kg or less of HL SYNAGIS@ or an antigen-binding fragment thereof which results in an effective serum titer that is at least 30 pg/mil at least 30 days after the administration of said first dose and prior 10 to the administration of a subsequent dose.

187. The method of claim 186, wherein said antibodies or antibody fragments are administered by a nebulizer or inhaler. 15

188. The method of claim 186, wherein said antibodies or antibody fragments are administered intramuscularly, intravaneously or subcutaneously.

189. The method of claim 186, wherein the mammal is a human subject, a human subject which has had a bone maITow transplant, an elderly human subject, or a human 20 subject which has cystic fibrosis. bronchopulmonary dysplasia, congenital heart disease, congenital inununodeficiency or acquired inununodeficiency.

190. The method of claim 186, wherein the manunal is a human infant. 25

191. The method of claim 186, wherein the mammal is a human infant born prematurely or is at risk of hospitalization for a RSV infection.

192. A method of preventing, treating or ameliorating one or more symptoms associated with a RSV infection in a mammal, said method comprising administering to said 30 niammal a dose of an effective amount of one or more antibodies or fragments thereof, wherein said antibodies or fragments thereof iununospecifically bind to one or more RSV antigens and have increased in vivo half-lives, and wherein said effective amount is a dose of approximately 15 mg/kg or less of said antibodies or antibody fragments which results in an effective serwi titer of less than 30 pg/ml at least 30 days after the administration of said 35 first dose and prior to the administration of a subsequent dose. - 189 -

193. The method of claim 192, wherein said antibodies or antibody fragments have an affinity of at least 2 X 10 8 M-' for said one or more RSV antigens. 5

194. The method of claim 192, wherein the effective serum titer is at least 2 pg/mi, at least 40 pg/ml, or at least 50 pg/nl.

195. The method of claim 192, wherein the effective serum titer is at least 30 pg/il at least 35 days after the administration of said first dose and prior to the 10 administration of a subsequent dose.

196. The method of claim 192, wherein the effective serum titer is at least 2 Vg/ml at least 35 days after the administration of said first dose and prior to the administrator of a subsequent dose. 15

197. The method of claim I86, wherein HL-SYNAGIS or an antigen-binding fragment thereof is formulated in a sustained release formulation.

198. The method of claim 192, wherein said antibodies or fragments thereof are 20 formulated in a sustained release fornulation.

199. The method of claim 192, wherein said antibodies or fragments thereof are administered by a nebulizer or inhaler. 25

200. The method of claim 192, wherein said antibodies or fragments thereof are administered intramuscularly, intravaneously or subcutaneously.

201. The method of claim 186, wherein HL-SYNAGIS or an antigen-binding fragment thereof has a half-life in said mammalian subject of greater than 25 days. 30

202. The method of claim 192, wherein said antibodies or fragments thereof have half-lives in said mam-nalian subject of greater than 25 days.

203. The method of claim 192, wherein at least one of the antibodies is a human 35 or humanized monoclonal antibody. - 190-

204. The method of claim 192, wherein the mammal is a human subject, a human subject which has had a bone marrow transplant, an elderly human subject, or a human subject which has cystic fibrosis, bronchopuImonary dysplasia, congenital heart disease, congenital imniuiiodeficiency or acquired innunodeficiency. 5

205. The method of claim 192, wherein the manunal is a human infant.

206. The method of claim 192, wherein the mammal is a human infant born prematurely or is at risk of hospitalization for a RSV infection. 10

207. The method of claim 192, wherein at least one of said antibodies comprises a VI CDRI having the amino acid sequence of SEQ ID NO:1, SEQ ID NO:10, SEQ ID NO: 18, a VH CDR2 having the amino acid sequence of SEQ ID NO:2, SEQ ID NO: 19, SEQ ID NO:25, SEQ ID NO:37, SEQ ID NO:41, SEQ ID NO:45, SEQ ID NO:82, SEQ ID 15 NO:86, SEQ ID NO:91, SEQ ID NO:93, SEQ ID NO: 100, SEQ ID NO:103, SEQ ID NO:105, SEQ ID NO: 109, SEQ ID NO: 111, or SEQ ID NO: 114, a VH CDR3 having the amino acid sequence of SEQ ID NO:3, SEQ ID NO:12, SEQ ID NO:20, SEQ ID NO:29, SEQ ID NO:79, SEQ ID NO:83, SEQ ID NO:94 or SEQ ID NO:97, a VL CDRI having the amino acid sequence of SEQ ID NO:4, SEQ ID NO:14, SEQ ID NO:22, SEQ ID NO:31, 20 SEQ ID NO:39 or SEQ ID NO:47, SEQ ID NO:80. SEQ ID NO:84, SEQ ID NO:87, SEQ ID NO:89. SEQ ID NO:92. SEQ ID NO:95, SEQ ID NO:98, SEQ ID NO:101, SEQ ID NO:104., SEQ ID NO: 107, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 115, SEQ ID NO: 117, SEQ ID NO: 119, SEQ ID NO:120, SEQ ID NO:122, SEQ ID NO:125, SEQ ID NO:127, SEQ ID NO:129, SEQ ID NO:130, SEQ ID NO:132, SEQ ID NO:134, SEQ ID 25 NO:136, SEQ ID NO:138, SEQ ID NO:140, SEQ ID NO:142, SEQ ID NO:144, SEQ ID NO: 146, SEQ ID NO: 148, SEQ ID NO:1 SO, SEQ ID NO: 152, SEQ ID NO: 153., SEQ ID NO:166, SEQ ID NO:168, SEQ ID NO:169, SEQ ID NO:171, SEQ ID NO:173, SEQ ID NO:175, SEQ ID NO:177, SEQ ID NO: 179, SEQ ID NO:180, SEQ ID NO:181, SEQ ID 30 NO:1 8 2 , SEQ ID NO:183, SEQ ID NO:184, SEQ ID NO: 185, SEQ ID NO:186, SEQ ID NO: 187, SEQ ID NO:188, SEQ ID NO:189, SEQ ID NO:190, SEQ ID NO:191, SEQ ID NO: 192, SEQ ID NO:193, SEQ ID NO:194, SEQ ID NO:195, SEQ ID NO:196, SEQ ID NO: 197, SEQ ID NO: 198, SEQ ID NO:199, SEQ ID NO:200, SEQ ID NO:201, SEQ ID NO:202, SEQ ID NO:203, SEQ ID NO:204, SEQ ID NO:205, SEQ ID NO:206, or SEQ ID 35 NO:207, a VL CDR2 having the amino acid sequence of SEQ ID NO:5, SEQ ID NO:15, - 191 - SEQ ID NO:23, SEQ ID NO:27, SEQ rD NO:32, SEQ ID NO:35, SEQ ID NO:43, SEQ ID NO:50, SEQ ID NO:53, SEQ ID NO:57, SEQ ID NO:59, SEQ ID NO:63, SEQ ID NO:66, SEQ ID NO:69, SEQ ID NO:73, SEQ ID NO:75, SEQ ID NO:77, SEQ ID NO:81, SEQ ID NO:85, SEQ ID NO:88, SEQ ID NO:90, SEQ ID NO:96, SEQ ID NO:99, SEQ ID NO:102, 5 SEQ ID NO:105, SEQ ID NO:108, SEQ ID NO:113, SEQ ID NO:116, SEQ ID NO:118 SEQ ID NO:121, SEQ ID NO:123, SEQ ID NO:124, SEQ ID NO:126, SEQ ID NO:128, SEQ ID NO:131, SEQ ID NO:133, SEQ ID NO:135, SEQ ID NO:137, SEQ ID NO:139, SEQ ID NO: 141, SEQ ID NO:143, SEQ ID NO:145, SEQ ID NO:147, SEQ ID NO:149, SEQ ID NO:151, SEQ ID NO:154, SEQ ID NO:156, SEQ ID NO:158, SEQ ID NO:160, 10 SEQIDNO:162,SEQIDNO:164,SEQIDNO:1 6 5 , SEQIDNO:167,SEQ IDNO:170 SEQ ID NO: 172, SEQ ID NO: 174, SEQ ID NO: 176, or SEQ ID NO: 178, or a VL CDR3 having the amino acid sequence of SEQ ID NO:6, SEQ ID NO:16, or SEQ ID NO:61.

208. A method of preventing, treating or ameliorating one or more symptoms 15 associated with a RSV infection in a mammal, said method comprising administering to the lungs of said marmal a first dose of an effective amount of a composition comprising one or more antibodies or fragments thereof that immunospecifically bind to one or more RSV antigens, wherein said effective amount results in an effective concentration of at least 20 ng per mg of lung protein at least 20 days after the administration said first dose and prior to 20 the administration of a subsequent dose.

209. The method of claim 208, wherein said antibodies or antibody fragments have an affinity of at least 2 X10'M ' for said one or more RSV antigens. 25

210. The method of claim 208, wherein said antibodies or antibody fragments

211. The method of claim 208, wherein said antibodies or antibody fragments are administered by a nebulizer or inhaler. 30

212. The method of claim 208, wherein said antibodies or antibody fragments are administered intramuscularly, intravaneously or subcutaneously.

213. The method of claim 208, wherein at least one of said antibodies is a human 35 or humanized monoclonal antibody. -192-

214. The method of claim 208, wherein the manmmal is a human subject, a human subject which has had a bone marrow transplant, an elderly human subject, or a human subject which has cystic fibrosis, bronchopulmonary dysplasia, congenital heart disease, congenital immunodeficiency or acquired immunodeficiency. 5

215. The method of claim 208, wherein the mammal is a human infant.

216. The method of claim 208, wherein the mammal is a human infant born prematurely or is at risk of hospitalization for a RSV infection. 1 0

217. The method of claim 208, wherein at least one of the antibodies is AFFF, Pl2f2, P1 2f4. P1 Id4, Ale9, A l2a6, Al3c4, A17d4., A4B4, A8C7, lX-493L1FR, H3-3F4, M3H9, Y1OH6, DG, AFFF(l), 6H8, Ll -7E5, L2-15B10, Al3al 1. Alh5, A4B4(1), A4B4 Ll FR-S28R, or A4B4-F52S. 15 21S. A method of preventing, treating or ameliorating one or more symptoms associated with a RSV infection in a mammal, said method comprising administering to the lungs of said mam-mal a first dose of an effective amount of a composition comprising SYNAGIS@ or a fragment thereof, wherein said effective amount results in an effective 20 concentration of at least 20 ng per mg of lung protein at least 20 days after the administration said first dose and prior to the administration of a subsequent dose.

219. The method of claim 218, wherein SYNAGIS® or an antigen-binding fragment thereof is administered by a nebulizer or inhaler. 25

220. The method of claim 218, wherein SYNAGIS@ or an antigen-binding n g methef- riris stee itramftusk'cla -iaI-a'O ivU' us'iy Vi.

221. The method of claim 218, wherein the mammal is a human subject, a human 30 subject which has had a bone marrow transplant, an elderly human subject, or a human subject which has cystic fibrosis, bronchopulmonary dysplasia, congenital heart disease, congenital inumunodeficiency or acquired immunodeficiency.

222. The method of claim 218, wherein the mammal is a human infant.. 35 - 193 -

223. The method of claim 218, wherein the mammal is a human infant born Prematurely or is at risk of hospitalization for a RSV infection. 5 Dated 15 August, 2012 MedImmune, LLC Patent Attorneys for the Applicant/Nominated Person 10 SPRUSON & FERGUSON 15 20 25 30 35 - 194 -