AU2012200976A1 - RNAI-Mediated inhibition of frizzled related protein-1 for treatment of gluacoma - Google Patents

Description

AUSTRALIA Patents Act COMPLETE SPECIFICATION (ORIGINAL) Class Int. Class Application Number: Lodged: Complete Specification Lodged: Accepted: Published: Priority Related Art: Name of Applicant: Alcon, Inc. Actual Inventor(s): Abbot F. Clark, Wan-Heng Wang, Loretta Graves McNatt, Jon E. Chatterton Address for Service and Correspondence: PHILLIPS ORMONDE FITZPATRICK Patent and Trade Mark Attorneys 367 Collins Street Melbourne 3000 AUSTRALIA Invention Title: RNAI-MEDIATED INHIBITION OF FRIZZLED RELATED PROTEIN-1 FOR TREATMENT OF GLUACOMA Our Ref: 935625 POF Code: 453863/459561 The following statement is a full description of this invention, including the best method of performing it known to applicant(s): 6- M RNAi-MEDIATED INHIBITION OF FRIZZLED RELATED PROTEIN-I FOR TREATMENT OF GLAUCOMA The present application is a divisional application from Australian patent application number 5 2006223131, the entire disclosure of which is incorporated herein by reference. FIELD OF THE INVENTION [00011 The present invention relates to the field of interfering RNA compositions for treatment of glaucoma by inhibition of expression of Frizzled Related Protein-I (FRP-l). 10 BACKGROUND OF THE INVENTION 100021 Glaucoma is a heterogeneous group of optic neuropathies that share certain clinical features. The loss of vision in glaucoma is due to the selective death of retinal ganglion cells in-the neural retina that is clinically diagnosed by characteristic changes in the visual field, nerve fiber layer defects, and a progressive cupping of the optic nerve head (ONH). One of the main risk factors for the development 15 of glaucoma is the presence of ocular hypertension (elevated intraocular pressure, IOP). An adequate intraocular pressure is needed to maintain the shape of the eye and to provide a pressure gradient to allow for the flow of aqueous humor to the avascular cornea and lens. IOP levels may also be involved in the pathogenesis of normal tension glaucoma (NTG), as evidenced by patients benefiting from IOP lowering medications. Once adjustments for central corneal thickness are made to IOP readings in 20 NTG patients, many of these patients may be found to be ocular hypertensive. 100031 The elevated IOP associated with glaucoma is due to elevated aqueous humor outflow resistance in the trabecular meshwork (TM), a small specialized tissue located in the iris-corneal angle of the ocular anterior chamber. Glaucomatous changes to the TM include a loss in TM cells and the deposition and accumulation of extracellular debris including proteinaceous plaque-like material. In 25 addition, there are also changes that occur in the glaucomatous ONH. In glaucomatous eyes, there are morphological and mobility changes in ONH glial cells. In response to elevated IOP and/or transient ischemic insults, there is a change in the composition of the ONH extracellular matrix and alterations in the glial cell and retinal ganglion cell axon morphologies. 100041 Primary glaucomas result from disturbances in the flow of intraocular fluid that has an 30 anatomical or physiological basis. Secondary glaucomas occur as a result of injury or trauma to the eye or a preexisting disease. Primary open angle glaucoma (POAG), also known as chronic or simple glaucoma, represents ninety percent of all primary glaucomas. POAG is characterized by the degeneration of the trabecular meshwork, resulting in abnormally high resistance to fluid drainage from the eye. A consequence of such resistance is an increase in the IOP that is required to drive the 35 fluid normally produced by the eye across the increased resistance. 100051 Current anti-glaucoma therapies include lowering IOP by the use of suppressants of aqueous humor formation or agents that enhance uveoscleral outflow, laser trabeculoplasty, or trabeculectomy, which is a filtration surgery to improve drainage. Pharmaceutical anti-glaucoma approaches have 1 A exhibited various undesirable side effects. For example, miotics such as pilocarpine can cause blurring of vision and other negative visual side effects. Systemically administered carbonic anhydrase inhibitors (CAIs) can also cause nausea, dyspepsia, fatigue, and metabolic acidosis. Further, certain beta-blockers have increasingly become associated with serious pulmonary side effects attributable to their effects on beta-2 receptors in pulmonary tissue. Sympathomimetics cause tachycardia, arrhythmia and hypertension. Such negative side effects may lead to decreased patient compliance or to termination of therapy. In addition, the efficacy of current IOP lowering therapies is relatively short lived requiring repeated dosing during each day and, in some ce, the efficacy decreases with time. [00061 In view of the importance of glaucoma, and the inadequacies of prior methods of treatment, it would be desirable to have an improved method of treatment. SUMMARY OF THE INVENTION [0007] The present invention overcomes these and other drawbacks of the prior art by providing highly potent and efficacious treatment, prevention or intervention of glaucoma and pre-glaucoma related conditions. In one aspect, the methods of the invention include treating a subject having glaucoma or at risk of developing glaucoma by administering interfering RNAs that silence expression of FRP-l mRNA, thus interfering with the Wnt signaling pathway and preventing a cascade of events related to glaucoma and pre-glaucoma cellular activity. 10008 The term "glaucoma" as used herein, includes ocular pre-glaucoma conditions, such as hypertension, and ocular glaucoma conditions, and includes those cellular changes resulting from the expression of FRP-l-mRNA that lead directly or indirectly to glaucoma and glaucoma-related conditions. The interfering RNA provided herein provides for such silencing while avoiding toxic side effects due to nonspecific agents. 10009] The present invention is directed to interfering RNAs that target FRP-l mRNA and thereby interfere with FRP.-l mRNA expression. The interfering RNAs of the invention are useful for treating patients with glaucoma or at risk for developing glaucoma. [0010) An embodiment of the Invention is a method of attenuating expression of Fri=led Related Protein-1 mRNA of a subject, the method comprising administering to the subject a composition comprising an effective amount of interfering RNA having a length of 19 to 49 nucleotides and a pharmaceutically acceptable carrier. The expression of Frizzled Related Protein-1 mRNA is attenuated thereby. 100111 Another embodiment of the invention is a method of treating glaucoma in a subject in need thereof is an embodiment of the -invention. The method comprises administering to an eye of the subject a composition comprising an effective amount of interfering RNA having a length of 19 to 49 nucleotides, and a pharmaceutically acceptable carrier. The glaucoma is treated thereby. The subject is 2 a human and the human has glaucoma in-one embodiment of the invention. In another embodiment, the subject is a human and the human is at risk of developing glaucom. [00121 For the above cited embodiments, the interfering RNA comprises a region of at least 13 contiguous nucleotides having at least 90% sequence complementarity to, or at least 90% sequence identity with, the penultimate 13 nucleotides of the 3' end of an mRNA corresponding to any one of SEQ ID NO:2, SEQ ID NO:8 - SEQ ID NO:190, and SEQ ID NO:192. 10013] In further embodiments of the above-cited methods, the composition further comprises a second interfering RNA having a length of 19 to 49 nucleotides and comprising a region of at least 13 contiguous nucleotides having at least 90% sequence complementarity to, or at least 90% sequence identity with, the penultimate 13 nucleotides of the 3' end of a second mRNA corresponding to any one of SEQ ID NO:2, SEQ ID NO:8 - SEQ ID NO:190, and SEQ ID NO:192. [00141 In yet another embodiment of the invention, a method of attenuating expression of Frizzled RelatedProtein-l mRNA of a subject comprises administering to the subject a composition comprising an effective amount of interfering RNA having a length of 19 to.49 nucleotides and a pharmaceutically acceptable carrier and the interfering RNA comprises a sense nucleotide strand, an antisense nucleotide strand, and a region of at least near-perfect contiguous complementarity of at least 19 nucleotides where the antisense strand hybridizes under physiological conditions to a portion of mRNA corresponding to SEQ ID NO:l or SEQ ID NO: 191, and has a region of at least near-perfect contiguous complementarity of at least 19 nucleotides with the hybridizing portion of mRNA corresponding to SEQ ID NO:1 or SEQ iD NO: 191, respectively. The expression of Frizzled Related Protein-i mRNA is attenuated thereby. 100151 A method of treating glaucoma in a subject in need thereof is an embodiment of the invention, the method comprising administering to an eye of the subject a composition comprising an effective amount of interfering RNA having a length of 19 to 49 nucleotides, and a pharmaceutically acceptable carrier, the interfering RNA comprising a sense nucleotide strand, an antisense nucleotide strand, and a region of at least near-perfect contiguous complementarity of at least 19 nucleotides; wherein the antisense strand hybridizes under physiological conditions to a portion of mRNA corresponding to SEQ ID NO:1 or SEQ ID NO:191 and has a region of at least near-perfect contiguous complementarity of at least 19 nucleotides with the hybridizing portion of mRNA corresponding to SEQ ID NO:1 or SEQ ID NO:191, respectively. The glaucoma is treated thereby. 10016] For the above-cited methods, the antisense strand of the interfering RNA is designed to target en mRNA corresponding to SEQ ID NO:I comprising nucleotide 509, 521, 524, 767, 818, 843, 850, 872, 881. 900, 959, 968, 971, 983, 986. 989. 1001, 1016, 1019, 1022. 1031. 1034, 1052, 1088, 1121, 1127, 1207, 1360, 1445, 1450, 1478, 1487, 1524, 1535, 1562, 1579, 1613, 1661, 1667, 1724, 1730, 1753, 1757, 1763, 1771, 1794, 1800, 1813, 1887, 1893, 1916, 2001, 2006, 2106, 2117,. 2135, 2142, 2152, 2200, 2203, 2206, 2241, 2263, 2276, 2279, 2389, 2410, 2430, 2464, 2468, 2482, 2502, 2506, 3 2572, 2645, 2666, 2681, 2697, 2715, 2734, 2760, 2770, 2783, 2797, 2807, 2844, 2917, 2937, 2961, 3005, 3010, 3080, 3130, 3150, 3156, 3179, 3185, 3196, 3244, 3281, 3345, 3350, 3365, 3372, 3403, 3410, 3424, 3428, 3450, 3453, 3460, 3596, 3668, 3672, 3746, 3762, 3776, 3786, 3789, 3826, 3835, 3844, 3847, 3867, 3912, 3924, 3958, 3976, 3981, 4012, 4022, 4071, 4089, 4154, 4157, 4208, 4369, 4375, 4441, 966, 408, 409,463, 754, 862, 863, 864, 868, 874, 909, 913, 915, 956, 1118, 1135, 1634, 1637, 1640, 1737, 1867, 1868, 2100, 2259, 2260, 2483, 2598, 2673, 2675, 2779, 2985, 2986, 2987, 2988, 3055, 3062, 3161, 3217, 3355, 3623, 3648, 3665, 3817, 4153, or 4252. In a further embodiment, the antinense trvan of the interfering RNA is designed to target an mRNA corresponding to SEQ ID NO:191 comprising nucleotide 3352. [0017] A second interfering RNA having a length of 19 to 49 nucleotides could also be administered to the subject; the second interfering RNA comprising a sense nucleotide strand, an antisense nucleotide strand, and a region of at least near-perfect complementarity of at least 19 nucleotides wherein the antisense strand of the second interfering RNA hybridizes under physiological conditions to a second portion of mRNA corresponding to SEQ ID NO:1 or SEQ ID NO:191, and the antisense strand has a region of at least near-perfect contiguous complementarity of at least 19 nmclootides with the second hybridizing portion of mRNA corresponding to SEQ ID NO:I or SEQ ID NO:191, respectively. [0018] A method of attenuating expression of Frizzled Related Protein-1 mRNA of a subject, comprising administering to the sulect a composition comprising an effective amount of a single stranded interfering RNA having a length of 19 to 49 nucleotides, and a pharmaceutically acceptable carrier, where the single-stranded interfering RNA hybridizes under physiological conditions to a portion of mRNA corresponding to SEQ ID NO: 1 or SEQ ID NO: 191 comprising the nucleotides identified above is a further embodiment of the invention. [00191 The invention includes as a further embodiment a composition comprising an interfering RNA having a length of 19 to 49 nucleotides, and comprising a nucleotide sequence corresponding to any one of SEQ ID NO:2, SEQ ID NO:8 - SEQ ID NO:190, and SEQ ID NO:192, or a complement thereof, and a pharmaceutically acceptable carier. [0020] Use. of any of the embodiments as described herein in the preparation of a medicament for attenuating expression of FRP-1 mRNA as set ,forth herein is also an embodiment of the present invention. BRIEF DESCRIPTION OF THE DRAWING 100211 The drawing shows the effect of an interfering RNA on the level of endogenous FRP1 mRNA in COS7 cells as messured by QPCR. Significant inhibition of FRP1 mRNA was observed at day 1 (22%, P-0.04) and day 3 (32%, P=0.002) after transfection compared to controls as described in Example 1. 4 DETTALD DESCRIPTION OF THE INVENTION [00221 RNA interference (RNAi) is a proccas by which double-stranded RNA (daRNA) is used to silence gene expression. While not wanting to be bound by theory, RNAi begins with the cleavage of longer dsRNAs into small interfering RNAs (siRNAs) by an RNaseiII-like enzyme, dicer. SiRNAs are dsRNAs that are usually about 19 to 28 nucleotides, or 20 to 25 nucleotides, or 21 to 22 nucleotides in length and often contain 2-nucleotide 3' overhangs, and 5' phosphate and 3' hydroxyl termini. One strand of the siRNA is incorporated into a ribonucleoprotein complex known as the RNA-induced silencing complex (RISC). RTISC usethis siRNA strand to identify mRNA molecules that are at least partially complementary to the Incorporated siRNA strand, and then cleaves these target mRNAs or inhibits their translation. Therefore, the siRNA strand that is incorporated into RISC is known as the guide strand or the antisense strand. The other siRNA strand, known as the passenger strand or the sense strand, is eliminated from the siRNA and is at least partially homologous to the target mRNA. Those of skill in the art will recognize that, in principle, either strand of an siRNA can be incorporated into RISC and function as a guide strand. However, siRNA design (e.g., decreased siRNA duplex stability at the 5' end of the antisense strand) can favor incorporation of the antisense strand into RISC. [00231 RISC-mediated cleavage of mRNAs having a sequence at least partially complementary to the guide strand leads to a decrease in the steady state level of that mRNA and of the corresponding protein encoded by this mRNA. Alternatively, RISC can also decrease expression of the corresponding protein via translational repression without cleavage of the target mRNA. Other RNA molecules and RNA-like molecules can also interact with RISC and silence gene expression. Examples of other RNA molecules that can interact with RISC include short hairpin RNAs (sbRNAs), sing e-stranded siRNAs, microRNAs (miRNAs), and dicer-substrate 27-mer duplexes. The term "siRNA" as used herein refers to a double-stranded interfering RNA unless otherwise noted. Examples of RNA-like molecules that can interact with RISC include RNA molecules containing one or more chemically modified nueleotides, one or more deoxyribonucleotides, and/or one or more non-phosphodiester linkages. For purposes of the present discussion, all RNA or RNA-like molecules that can interact with RISC and participate in RISC-mediated changes in gene expression will be referred to as "interfering RNAs." SiRNAs, shRNAs, miRNAs, and dicer-substrate 27-mer duplexes are, therefore, subsets of "interfering RNAs." [0024 Interfering RNA of embodiments of the invention appear to act in a catalytic manner for cleavage of target mRNA, i.e., interfering RNA is able to effect inhibition of target mRNA in substoichiometric amounts. As compared to antisense therapies, significantly less interfering RNA is required to provide a therapeutic effect under such clesvage conditions. [0025] The present invention relates to the use of interfering RNA to inhibit the expression of Frizzled Related Protein-1 (FRP-1) mRNA, thus interfering with the Wnt signaling pathway and preventing a cascade of events related to glaucoma and pre-glaucoma cellular activity. According to the present 5 invention, interfering RNAs provided exogenously or expressed endogenously are particularly effective at sileiWng Frizzled Related Protein-i (FRP-1) mRNA in ocular tissue(s). [0026 Frizzled Related Proteins (FRP) are a family of secreted proteins that antagonize the Wnt signaling, pathway by binding extracelluar Wnt and preventing it from interacting with membrane bound frizzled protein receptor .or by forming a nonfunctional complex with the frizzled receptor (Bafico, et al. J. Biol. Chem., 274(23):16180-16187 (1999)), thereby preventing a cascade of events related to differential adhesion of one cell to another as well as to an extraoellular matrix. [00271 The present inventors, together with others, as set forth by U.S. Published Patent Application No. 2004/0186159, Appl. No. 10/488,496, to Hellberg, et aL (hereby incorporated by reference herein in its entirety), have determined that frizzled related protein (FRP) is differentially expressed in a number of glaucoratous trabecular meshwork cell lines. Perfusion of FRP-1 through perused human ocular anterior segments maintained in culture resulted in a decrease in flow rate and a corresponding decrease in P-catenin protein levels in the ciliary body and the trabecular meshwork (M). The decreased flow rate in the cultured anterior segments models an increase in resistance to outflow (increase in intraocular pressure) in intact eye. [00281 Further, the present inventors, together with others, have shown that the expression of FRP-1 is upregulated in glaucomatous trabecular meshwork tissues and cells (U.S. Published Patent Application No. 2002/0049177, Appl. No. 09/796,008 to Clark et al., entitled "Diagnostics and Therapeutics for Glaucoma" filed February 28,2001, incorporated by reference in its entirety). [0029] These results show that there is an active Wnt signaling. pathway in the trabecular meshwork and ciliary body and suggest that this pathway is responsible at least in part for maintaining outflow through the TM and thereby controlling IOP. [0030] Nucleic acid sequences cited herein are written in a 5' to 3' direction unless indicated otherwise. The term "nucleic acid," as used herein, refers to either DNA or RNA or a modified form thereof comprising the purine or pyrimidine bases present in DNA (adenine "A," cytosine "C," guanine "G," thymine "T") or in RNA (adenine "A," cytosine "C," guanine "G," uracil "U"). Interfering RNAs provided herein may comprise "T' bases, particularly at 3' ends, even though "T bases do not naturally occur in RNA. "Nucleic acid" includes the terms "oligonucleotide" and "polynucleotide" and can refer to a single-stranded molecule or a double-stranded molecule. A double-stranded molecule is formed by Watson-Crick base pairing between A and T bases, C and G bases, and between A and U bases. The strands of a double-stranded molecule may have partial, substantial or full complementarity to each other and will form a duplex hybrid, the strength of bonding of which is dependent upon the nature and degree of complementarity of the sequence of bases. [0031] An mRNA sequence is readily deduced from the sequence of the corresponding DNA sequence. For example, SEQ ID NO:l provides the sense strand sequence of DNA corresponding to 6 the mRNA for FRP-1. The mRNA sequence is identical to the DNA sense strand sequence with the "T" bases replaced with "U" bases. [0032] Therefore, the mRNA sequence of FRP-1 is known fiom SEQ'ID NO:1, and the mRNA sequence of an equivalent of FR-1 is known from SEQ D NO:191. 100331 Frizzled Related Protein (FRP-1) mRNA: The GenBank database provides the DNA sequence for FRP-l as accession no. AF056087, provided in the "Sequence Listing" as SEQ ID NO:1. SEQ ID NO:1 provides the sense strand sequence of DNA that corresponds to the mRNA encoding FRP-1 (with the exception of "T' bases for "U" bases). The coding sequence for FRP-1 is from nuclcotidos 303 1244. [00341 Equivalents of the above cited FRP-1 mRNA sequence are alternative splice forms, allelic forms, isozymes, or a cognate thereof. A cognate is a Frizzled Related Protein-i mRNA from another mammalian species that is homologous to SEQ ID NO:1 (i.e., an ortholog). FRP-1 nucleic acid sequences related to SEQ ID NO:l include those having GenBank accession numbers NM_003012 (cited infra), BC036503, AF001900, BC004466, AF017987, and BT019677. [0035] The GenBank database provides a further DNA sequence for FRP-1 as accession no. NM_003012, provided in the "Sequence Listing" as SEQ ID NO:191, and considered an equivalent to SEQ ID NO:1. SEQ ID NO:191 provides the sense strand sequence of DNA that corresponds to the mRNA encoding FRP-1 (with the exception of 'T' bases for "U" bases). The coding sequence for secreted FRP-1 is from nucleotides 303-1247. [0036] Attenuating expression of an mRNA: The phrase, "attenuating expression of an mRNA," as used herein, means administering or expressing an amount of interfering RNA (e.g., an siRNA) to reduce translation of the target mRNA into protein, either through mRNA cleavage or through direct inhibition of translation. The reduction in expression of the target mRNA or the corresponding protein is commonly referred to as "knock-down" and is reported relative to levels present following administration or expression of a non-targeting control RNA (e.g., a non-targeting control siRNA). Knock-down of expression of an amount including and between 50% and 100% is contemplated by embudiments herein. However, It is not necessary that such knock-down levels be achieved for purposes of the present invention. In one embodiment a single interfering RNA targeting FRP-1 mRNA is administered. In other embodiments, two or more interfering RNAs targeting FRP-1 mRNA are administered. 100371 Knock-down is commonly assessed by measuring the mRNA levels using quantitative polymerase chain reaction (qPCR) amplification or by measuring protein levels by western blot or enzyme-linked immunosorbent assay (ELISA). Analyzing the protein icvcl provides an assessment of both mRNA cleavage as well as translation inhibition. Further techniques for measuring knock-down include RNA solution hybridization, nuclease protection, northern hybridization, gene expression 7 monitoring with a microarray, antibody binding, radiolmmoassay, and fluorescence activated cell analysis. [0038] Inhibition of FRP-l may also be determined in vitmby examining FRP-l level, p-catenin levels or outflow rate in perfused anterior segments of human eyes as set forth in U.S. published patent application 2004/0186159 previously incorporated by reference herein. Briefly, ocular anterior segments are perfused with Dulbecco's modified Eagle's medium (DMEM) at a constant pressure of 11 mm Hg. The outflow rate of each eye is measured by weighing its reservoir at specified periods. After a stabilization period, the cyce are perfused with either a vehicle control, a scrambled siRNA sequence control, or an siRNA as describe herein for attenuating FRP-1, and the outflow rates of the eyes monitored for 2-5 days. Aqueous humor outflow rate is measured by weighing its reservoir at specific periods. An increase in outflow as compared to the control values indicates that the siRNA is effective at attenuating FRP-1. [00391 Inhibition of FRP-l is also inferred in a human or mammal by observing an improvement in a glaucoma symptom such as improvement in intraocular pressure, improvement in visual field loss, or improvement in optic nerve head changes, for example. [0040] Interfering RNA: In one embodiment of the invention, interfering RNA (e.g., siRNA) has a sense strand and an antisense strand, and the sense and antisense strands comprise a region of at least near-perfect contiguous complementarity of at least 19 nucleotides. In a further embodiment of the invention, the interfering RNA comprises a region of at least 13, 14, 15, 16; 17, or 18 contiguous nucleotides having percentages of sequence complementarity to or, having percentages of sequence identity with, the penultimate 13, 14, 15, 16, 17, or 18 nucleotides, respectively, of the 3' end of the corresponding target sequence within an mRNA. [0041] The length of each strand of the interfering RNA comprises 19 to 49 nucleotides, and may comprise a length of 19, 20, 21, 22,23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, or 49 nucleotides. [00421 The antisense strand of an siRNA is the active guiding agent of the siRNA in that the antisense strand is incorporated into RISC, thus allowing RISC to identify target mRNAs with at least partial complementarity to the antisense siRNA strand for cleavage or translational repression. [0043] In embodiments of the present invention, interfering RNA target sequences (e.g., siRNA target sequences) within a target mRNA sequence are selected using available design tools. Interfering RNAs corresponding to an FRP-1 target sequence are then tested by transfection of cells expressing the target mRNA followed by assessment of knockdown as described above. [0044] Techniques for selecting target sequences for siRNAs am provided by Tuschl, T. ct al., "The siRNA User Guide," revised May 6, 2004, available on the Rockefeller University web site; by Technical Bulletin #506, "siRNA Design Guidelines," Ambion Inc. at Ambion's web site; and by other web-based design tools at, for example, the Invitrogen, Dharmaoon, Integrated DNA Technologies, 8 Genscript, or Proligo web sites. Initial search pammeters can include G/C contents between 35% and 55% and siRNA lengths between 19 and 27 nuclootides. The target sequence may be located in the coding region or in the 5' or 3'untranslated regions of the znRNAs. (00451 An embodiment of a 19-nucleotide DNA target sequence for FRP-l mRNA is present at nucleotides 509 to 527 of SEQ ID NO:1: 5' - CGTGGGCTACAAGAJGATG -3' SEQ ID NO:2. An siRNA of the invention for targeting a corresponding mRINA sequence nf SEQ ID NO:2 and having 21-nuclootide strands and a 2-nucleotide 3 overhang is: 5'- CGUGGGCUACAAGAAGAUGNN -3' SEO ID N03 3' -NNGCACCCGAUGWUCUCAC -5' SEQ ID NO 4. Each "N" residue can be any nucleotide (A. C, G, U, T) or modified nucleotide. The 3' end can have a number of "N" residues between and including 1, 2, 3, 4, 5, and 6. The "N" residues on either strand can be the same residue (e.g., UU, AA, CC, GO, or TT) or they can be different (e.g., AC, AG, AU, CA, CG, CU, GA, GC, GU, UA, UC, or UG). The 3' overhangs can be the same or they can be different. In one embodiment, both strands have a 3'UU overhang. 10046 An siRNA of the invention for targeting a corresponding mRNA sequence of SEQ ID NO:2 and having 21-nucleotide strands and a 3'UU overhang on each strand is: 5'- CGUGGGCUACAAGAAGAUGUU -3' SEQ ID NO:5 3' -UUGCACCCGAUGUUCUUCUAC -5' SEQ ID NO 6. 10047] The interfering RNA may also have a 5' overhang of nucleotides or it may have blunt ends. An siRNA of the invention for targeting a corresponding mRNA sequence of SEQ ID NO:2 and having 19 nucleotide strands and blunt ends is: 5'- CGUGGGCUACAAGAAGAUG -3' SEQ ID N1193 3'- GCACCCGAUJGUVCUCUAC -5' SEQ ID NO:194. [00481 The strands of a double-stranded interfering RNA (e.g., an siRNA) may be connected to form a hairpin or stem-loop structure (e.g., an shRNA). An sbRNA of the invention targeting a corresponding mRNA sequence of SEQ ID NO:2 and having a 19 bp double-stranded sten region and a 3'UU overhang is: 9 / \ 5' -CGUGGGCUACA&GAAGAUG N 3'--UUGCACCCGAUGUUCUUCUAC N SEQ ID NO:7 . \ / mN N is a nucleotide A, T, C, G, U, or a modified form known by one of ordinary skill in the art. The number of nucleotides N in the loop is a number between and including 3 to 23, or 5 to 15, or 7 to 13, or 4 to 9, or 9 to 11, or the number of nucleotides N is 9. Some of the nucleotides in the loop can be involved in base-pair interactions with other nuclootides in the loop. Examples of oligonuclcotide sequences that can be used to form the loop include 5'-UUCAAGAGA-3' (Brunmelkamp, T.R et al. (2002) Science 296: 550) and 5'-UUUGUGUAG-3' (Castanotto, D. et al. (2002) RNA 8:1454). It will be recognized by one of skill in the art that the resulting single chain oligonncleotide forms a stem-loop or hairpin stmcture. domprising a double-stranded region capable of interacting with the RNAi machinery. [0049] The siRNA target sequence identified above can be extended at the 3' end to facilitate the design of dicer-substrate 27-mer duplexes. Extension of the 19-nucleotide DNA target sequence (SEQ ID NO:2) identified in the FRP-1 DNA sequence (SEQ ID NO:1) by 6 nucleotides yields a 25 nucleotide DNA target sequence present at nucleotides 509 to 533 of SEQ ID NO: 1: 5'- CGTGGGCTACAAGAAGATGGTGCTG -3' SEQ ID NO:195. A dicer-substrate 27-mer duplex of the invention for targeting a corresponding mRNA sequence of SEQ ID NO:195 is: 5'- CGUGGGCUACAAGAAGAUGGUGCUG -3' EQ ID NO:196 3' -UUGCACCCGAUGUUCUUCUACCACQAC -5' SEQ XD NO:-197. The two nucleotides at the 3' end of the sense strand (ie., the UG nncleotides of SEQ ID NO:196) may be deoxynucleotides (i.e., TG) for enhanced processing. Design of dicer-substrate 27-mer duplexes from 19-21 nucleotide target sequences, such as provided herein, is further discussed by the Integrated DNA Technologies (IDT) website and by Kim, D.-H. et al., (February, 2005) Nature Biotechnology 23:2; 222-226. [00501 When interfering RNAs are produced by chemical synthesis, phosphorylation at the 5' position of the nucleotide at the 5' end of one or both strands (when present) can enhance siRNA efficacy and 10 specificity of the bound RISC complex but is not required since phosphorylation can occur 100511 Table I lists examples of FRPl DNA target sequences of SEQ M1 NO:l and SEQ II) NO:191 from which &iRNAs of the present invention are designed in a manner as set* forth above. FRP1 encodes Frizzled Related Protein-i, as noted above. Table 1. FMP Target Sequences for siRNAs FRP1 Target Sequence # of Starting SEQ ID IWO: Nualootide with reference to ___ ___ ___ __ ___ ___ __ SEQ ID NOs. CGTGQGCTACZ1LQAAd;ATG 509 2 GMO1;AQTGMCECCCA&C 521 8 Q&TGGTQ;CTGCCCA1LCCTG 524 9 GTTQACAkGTTCCCGGAG 767 10 TGCCACCGA&GCCTCCAAQ 818 11 GGC1AALCOTGTGTCCTC 343 12 CGGTGTCCTCCCTGTGA 850 13 CGAOTTGPJJATCTOAOCC 872 14 ATCTGAGGCCATCATTGAA 15 i CATCTCTGTGCCkGCQAGT 900 16 TGGCGACAAQAAGATTQTC 959 17 G;AAGATTGTCCCCAAQRAQ 968, 19 GATTOTCCCCAAGAAGAKO 971 '19 GA&AAAAAGCCCCTGA&Q 983, 20 GAArA&GCCCCTGAAGTTG 986 21, GAAGCCCCTGAGTTGG3G 989 22 GTTGGGGCCCATCAAQAAG 1001 23 G&AGPAGGACCTGAAQPAAG 1016 24 G;AAGQ&CCTQA6AGAAGCTT 1019 25 CQGACCTG1AAGAAGCTTGTG 1022 26 GAAGCTTGT9CTGTACCTG 1031 27 QCTTGTGCdTQTCCTGAAGt 1034 28 GhAT0GGG0GTOCTGTCCC 1052. 29 CCTCAGCCJLCCACTTCCTC 1088 30 GGTGAAGAGCCAGTACTTO 1121 31 QAGCCAGTACTTGCTQACG .1127 32 ACCPATGAGTOCCCCACCTT 1207 33 TCOAQTCGQCTTGTTCTTG 1360 34 AGCAILGGGCCATTTAGATT 1445 35 GCCATTTAGATTAGGAA 1450 36 QATCCGCAATQGGQACCAG 1478 3 TGTGGAGCAGCAGCCACTQ 1487 38 ACCATTTCCAIACAGCAACA 1524 39 CAGCAACACAGCCACTA.A 1535 40 AGGQGQATTGQGCG%"G 1562 41 AGTGAGAQCCAGCAGCAAA 11579 42 CTTGTTGGTGTGGATCTAT 1613 43 TTCTAATGATTGGCAAGTC 1661 44 TGATTGGCAAGTCACGTTG 1667 45 ATGGAAACAGACTCATACC 1724 46 ACAGACTCATACCACACTT 1730 47 TTAAGGTCAAGCCCAGAAA 1753 48 GGTCAAGCCCAGAAAGTGA 1757 49 GCCCAGAAAGTGATAAGTG 1763 50 AGTGATAAGTGCAGGGAGG 1771 51 GTGCAAGTCCATTATCTAA 1794 52 GTCCATTATCTAATAGTGA 1800 53 TAGTGACAGCAAAGGGACC 1813 54 TCTGAATCAGCCAGTCTCA 1987 55 TCAGCCAGTCTCAGATGCC 1893 56 AGTTTCGGTTCCTATGAGC 1916 57 AGGAAACCACAGTGAGCCT 2001 58 ACCACAGTGAGCCTGAGAG 2006 59 CAGTCCAGCAAATTGCTAG 2106 60 ATTGCTPGTCAGGGTGAAT 2117 61 TTGTGAAATTGGGTGAAGA 2135 62 ATTGGGTGAAGAGCTTAGG 2142 63 GAGCTTAGGATTCTAATCT 2152 64 GAACAATGACAAACACCCA 2200 65 CAATGACAAACACCCACTT 2203 66 TGACAAACACCCACTTATT 2206 67 CAGTCTACATTGAGCATTT 2241 68 AGGTGTGCTAGAACAAGGT 2263 69 CAAGGTCTCCTGATCCGTC 2276 70 GGTCTCCTGATCCGTCCGA 2279 7 GAOTCCGTOGTTOCCCTAG 2389 72 CCTAACACCCCCTAGCAAA 2410 73 CTCACAGAGCTTTCCGTTT 2430 74 AGAAACATTTCCTTTGAAC 2464 75 ACATTTCCTTTGAACTTGA 2468 76 CTTGATTGCCTATGGATCA 2482 77 AGAATTCAGAACAGCCTG 2502 70 ATTCAGAACAGCCTGCCTG 250q 79 AGTTGACATGGGTGGGGTG 2572 80 GTACCCTGAGATACTTCCC 2645 81 AGCCCTTATGTTTAATCAG 2666 82 TCAGCGATGTATATAAGCC 2681 83 GCCAGTTCACTTAGACAAC 2697 84 CTTTACCCTTCTTGTCCAA 2715 85 TGTACAGGAAGTAGTTCTA 2734 86 TGCATATTATTTCTTCCC 2760 87 TTTCTTCCCCCAAAGCCGG 2770 88 AGCCGGATTCTTAATTCTC 2783 89 TTCTCTGCAACACTTTGAG 2797 90 12 CACTTTGAGGACATTTATG 2807 91 TGCTTATACCCAGTGAGOA 2844 92. AGGATGGTAGATTCTCTTA 2917 93 CTCTTGAAGACTCCAGTAT 2937 94 TCAGCATGCCCGCCTAGTT 2961 95 ATTAACCTCTCACAGTTAG 3005 96 CCTCTCACAGTTAGTGATC 3010 97 AGTGCTGGGGACCTTAAGT 3080 98 TGTGTATATATATTAGCTA 3130 99 TTAGAAATATTCTACTTCT 3150 100 ATATTCTACTTCTCTGTTG 3156 101 ACTGAAATTCAGAGCAAGT 3179 102 ATTCAGAGCAAGTTCCTGA 3185 103 GTTCCTGAGTGCGTGGATC 3196 104 GAGTTCAGTGCTCATACGT 3244 105 AGTGCCTCATGCAACCGGG 3281 10 6 CATAAGTAGTTACCACAGA 3345 107 GTAGTTACCACAGAATACG 3350 108 TACGAAGACCAGGTGACT 3365 109 GAGCAGGTGACTGTGCTGT 3372 110 ATGGGAATTCTCAGGTAGG 3403 111 TTCTCAGGTAGGAAGCAAC 3410 112 GCAACAGCTTCAGAAAGAG 3424 113 CAGCTTCAGAAAGAGCTCA 3428 114 TAAATTGGAAATGTGAATC 3450 115 ATTGGAA&TGTGAATCGCA 3453 116 ATGTGAATCGCAGCTGTGG 3460 117 GGAGGCTCTCTGTAGGCA 3596 118 CCAATGTGCAGACTGATTG 3668 119 TGTGCAGACTGATTGGCCT 3672 120 TTATCGCTAGGGCCAAGGT 3746 121 GGTGOGATTTGTAAAGCTT 3762 122 AGCTTTACAATAATCATTC 3776 123 TAATCATTCTGGATAGAGT 3786 124 TCATTCTGGATAGAGTCCT 3789 125 CTCAGTTAAATCTTTGAAG 3826 126 ATCTTTGAAGALTATTTGT 3835 127 GAATATTTGTAGTTATCTT 3844 128 TATTTGTAGTTATCTTAGA 3847 129 GATAGCATGGGAGGTGAGG 3867 130 TATCCTGTGTAACACTTGG 3912 131 CACTTGGCTCTTGGTACCT 3924 132 GTTCTCCCCAGGGTAGAAT 3958 133 TTCAATCAGAGCTCCATT 3976 134 TCAGAGCTCCAGTTTGCAT 3981 135 ATTACAGTAATCCCATTTC 4012 136 TCCCATTTCCCAAACCTAA 4022 137 CTGTTGCTGTGTCATAAC 4071 138 13 WO 2006/099353 PCTIUS2006/009000 CTTCATAGATGCAGGAC 4089 139 TAACATACTGGCCGTTCTG 4154 140 CATACTGGCCGTTCTGACC 4157 141 ATTCCCGTTTCCTCTAGTT 4208 142 TAGTAATTCCCGTACGTGT 4369 143 TTCCCGTACGTGTTCATTT 4375 144 TCACTCAATTAATCAATGA 4441 145, AAGAAGATTGTCCCCAAGAAG (SEQ 966 146 ID NO:18 with added 5' AA) GTGAGCTTCCAGTCdGACA 408 147 TGAGCTTCCAGTCGGACAT 409 148 CACCTCAGTGCGTGGACAT 463 149 CCGAGATGCTTAAGTGTGA 754 150 CCTGTGACAACGAGTTGA 862 151 CTGTGACAACGAGTTGAAA 863 152 TGTGACAACGAGTTGAAAT 864 153 ACAACGAGTTGAALTCTGA 868 154 AGTTaAAATCTGAGGCCAT 874 155 GCCAGCGAQTTTQCACTGA 909 156 GCGAGTTTGCACTQAGGAT 913 157 GAGTTTGCACTGAGGATGA 915 158 AAATGGCGACAAGAAQATT 956 159 CAAGGTGAAGAGCCAGTAC 11i8 160 ACTTGCTGACGGCCATCCA 1135 161 GCTGATCTATGCCTTTCAA 1634 162, GATCTATGCCTTTCAACTA 1637 163 CTATGCCTTTCAACTAGAA .1640 164 CATACCACACTTACAATTA 1737 165 TCCGTGTGATTOTCTTTGA 1867 166 CCGTGTGATTGTCTTTGAA 1868 167 TTAGAACAGTCCAGCAAAT 2100 168 TGAAAGGTGTGCTAGAACA 2259 169 GAAAGGTOTGCTAGAACAA 2260 170 TTGATTGCCTATGGATCAA 2483 171, CCAGCGAGAOAGTTTCAAA 2598 172 ATGTTTAATCAGCGATGTA 2673 173 GTTTAATCAGCGATGTATA 2675 174 CCAAAGCCGGATTCTTAAT 2779 175 CCGGAGAGTTATCCTGATA 2985 176 CGGAGAGTTATCCTGATAA 2986 177 GGAGAGTTATCCTGATAAA 2987 178 GAGAGTTATCCTGATAAAT 2988 179 GGTTCTCTCTQACCTTTCA 3055 iso TCTGACCTTTCATCGTAAA 3062 181 CTACTTCTCTGTTGTCAAA 3161 182 GGTCTTAGTTCTGGTTGAT 3217 183 TACCACAGAATACGGAAGA 3355 184 14 CACTATCACGAGCCTTTGT 3623 185 CCACAAAGTATCTAACA&A 3648 186 AALCCAATGTGCAGACTGA 3665 187 TTGGCAGAACTCAGTTAA 3817 188 ATAACATACTGGCCGTTCT 4153 189 ATCCTAAGTCTCTTAAAA 4252 190 FRP1 Target Seqoence # of Starting BBQ ID NO: Nucleotide with reference to SEQ ID NO:191 CATTAGTAOTTACCACAGA '3352 192 [00521 As cited in the examples above, one of skill in the art is able to use the target sequence information provided in Table 1 to design interfering RNAs having a length shorter or longer than the sequences provided in Table 1 by referring to the sequence position in SEQ ID NO:1 or SEQ ID NO:191 and adding or deleting nucleotides complementary or near complementary to SEQ ID NO:1 or SEQ ID NO:191, respectively. [00531 The target RNA cleavage reaction guided by siRNAs and other forms of interfering RNA is highly sequence specific, In general, siRNA containing a sense nucleotide strand identical in sequence to a portion of the target mRNA and an antisense nucleotide strand exactly complementary to a portion of the target mRNA are siRNA embodiments for inhibition of mRNAs cited herein. However, 100% sequence complementarity between the antisense siRNA strand and the target mRNA, or between the Antisense siRNA stmnd and the sense giRNA stmnd, is not reqpired to practice the present invention. Thus, for example, the invention allows for sequence variations that might be expected due to genetic mutation, strain polymorphism, or evolutionary divergence. 10054] In one embodiment of the invention, the antisense strand of the siRNA has at least near-perfect contiguous complementarity of at least 19 nucleotides with the target mRNA. "Near-perfect," as used herein, means the antisense strand of the siRNA is "substantially complementary to," and the sense strand of the siRNA is "substantially identical" to at least a portion of the target mRNA. "Identity," as known by one of ordinary skill in the art, is the degree of sequence relatedness between nucleotide sequences as determined by matching the order and identity of nucleotides between the sequences. In one embodiment, the antisense strand of an siRNA having 80% and between 80% up to 100% complementarity, for example, 85%, 90% or 95% complementarity, to the target mRNA sequence are considered near-perfect complementarity and may be used in the present invention. "Perfect" contiguous complementarity is standard Watson-Crick base pairing of adjacent base pairs. "At least near-perfect" contiguous complementarity includes 'perfect" complementarity as used herein. Computer methods for determining identity or complementarity are designed to identify the greatest degree of matching of nucleotide sequences, for example,'BLASTN (Altschul, S.Y., et al. (1990) J. Mol. Biol. 215:403-410). 15 [00551 The term 'percent identity" describes the percentage of contiguous nucleotides in a first nucleic acid molecule that is the same as in a set of contiguous nucleotides of the same length in a second nucleic acid molecule. 'Ihe term "percent complementarity" describes the percentage of contiguous nucleotides in a first nucleic acid molecule that can base pair in the Watson-Crick sense with a set of contiguous nucleotides in a second nucleic acid molecule. [00561 The relationship between a target mRNA (sense strand) and one strand of an siRNA (the sense strand) is that of identity. The sense strand of an sIRNA is also called a passenger strand, if present. The relationship between a target mRNA (sense strand) and the other strand of an siRNA (the antisemnse strand) is that of complementarity. The antisense strand of an siRNA is also called a guide strand. 100571 The penultimate base in a nucleic acid sequence that is written in a 5' to 3' direction is the next to the last base, i.e., the base next to the 3' base. The penultimate 13 bases of a nucleic acid sequence written in a 5' to 3' direction are the last 13 bases of a sequence next to the 3' base and not including the 3' base. Similarly, the penultimate 14, 15, 16, 17, or 18 bases of a nucleic acid sequence written in a S' to 3' direction are the last 14, 15, 16, 17, or 18 bases of a sequence, respectively, next to the 3' base and not including the 3' base. 10058] The phrase "a region of at least 13 contiguous nucleotides having at least 90% sequence complementarity to, or at least 90% sequence identity with, the penultimate 13 nucleotides of the 3' end of an rnRNA corresponding to any one of (a sequence identifier)" allows a one nucleotide substitution. Two nucleotide substitutions (i.e., 11/13 = 85% identity/complenentarity) are not included in such a phrase. [00591 In one embodiment of the invention, the region of contiguous nucleotides is a region of at least 14 contiguous nucleotides having at least 85% sequence complementarity to, or at least 85% sequence identity with, the penultimate 14 nucleotides of the 3' end of an mRNA corresponding to the sequence identified by each sequence identifier. Two nucleotide substitutions (i.e., 12/14 = 86% identity/complementarity) are included in such a phrase. 10060] In a further embodiment of the invention, the region of contiguous nucleotides is a region of at least 15, 16, 17, or 18 contiguous nucleotides having at least 80% sequence complementarity to, or at least 80% sequence identity with, the penultimate 14 nucleotides of the 3' end of an mRNA corresponding to the sequence of the sequence identifier. Three nucleotide substitutions are included in such a phrase. [0061] The target sequence in the mRNAs corresponding to SEQ ID NO:1 or SEQ ID NO:191 may be in the 5' or 3' untranslated regions of the mRNA as well as in the coding region of the mRNA. 100621 One or both of the strands of double-stranded interfering RNA may have a 3' overhang of from 1 to 6 nucleotides, which may be ribonucleotides or deoxyribonucleotides or a mixture thereof. The nucleotides of the overhang are not base-paired. In one embodiment of the invention, the interfering RNA comprises a 3' overhang of TT or UU. In another embodiment of the invention, the interfering 16 RNA comprises at least one blunt end. The termini usually have a 5' phosphate group or a 3' hydroxyl group. In other embodiments, the antisense strand has a 5' phosphate group, and the sense strand has a 5' hydroxyl group. In still other embodiments, the termini are further modified by covalent addition of other molecules or functional groups. (0063] The sense and antisense strands of the double-stranded siRNA may be in a duplex formation of two single strands as described above or may be a single molecule where the regions of complementarity are base-paired and are covalently linked by a hairpin loop so as to form a single strand. It is believed that the hairpin is leaved intracellularly by a protin termed dicer to form an interfering RNA of two individual base-paired RNA molecules. 10064] Interfering RNAs may differ from naturally-occurring RNA by the addition, deletion, substitution or modification of one or more nucleotides. Non-nucleotide material may be bound to the interfering RNA, either at the 5' end, the 3' end, or internally. Such modifications are commonly designed to increase the nuclease resistance of the interfering RNAs, to improve cellular uptake, to enhance cellular targeting, to assist in tracing the interfering RNA, to further improve stability, or to reduce the potential for activation of the interferon pathway. For example, interfeing RNAs may comprise a purine nucleotide at the ends of overhangs. Conjugation of cholesterol to the 3' end of the sense strand of an siRNA molecule by means of a pyrrolidine linker, for example, also provides stability to an siRNA. (00651 Further modifications include a 3' terminal biotin molecule, a peptide known to have cell penetrating properties, a nanoparticle, a peptidomimetic, a fluorescent dye, or a dendrimer, for example. [0066] Nucleotides may be modified on their base portion, on their sugar portion, or on the phosphate portion of the molecule and function in embodiments of the present invention. Modifications include substitutions with alkyl, alkoxy, amino, deaza, halo, hydroxyl, thiol groups, or a combination thereof, for example. Nucleotides may be substituted with analogs with greater stability such as replacing a ribonucleotide with a deoxyribonucleotide, or having sugar modifications such as 2' OH groups replaced by 2' amino groups, 2' 0-methyl groups, 2' methoxyethyl groups, or a 2'-0, 4'-C methylene bridge, for example. Examples of a purine or pyrirnidine analog of nucleotides include a xanthine, a hypoxanthine, an azapurine, a methylthioadenine, 7-deaza-adenosine and 0- and N-modified nucleotides. The phosphate group of the nucleotide may be modified by substituting one or more of the oxygens of the phosphate group with nitrogen or with sulfur (phosphorothioates). Modifications are useful, for example, to enhance function, to improve stability or permeability, or to direct localization or targeting. [0067] There may be a region or regions of the antisense interfering RNA strand that is (are) not complementary to a portion of SEQ ID NO: 1 or SEQ ID NO: 191. Non-complementary regions may be at the 3', 5' or both ends of a complementary region or between two complementary regions. 17 [00681 Interfering RNAs may be generated exogenously by chemical synthesis, by in vitro transcription, or by cleavage of longer double-stranded RNA with dicer or another appropriate nucleasc with similar activity. Chemically synthesized interfering ,RNAs, produced from protected ribonucleoside phosphoramidites using a conventional DNA/RNA synthesizer, may be obtained from conmercial suppliers such as Ambion Inc. (Austin,. TX), Invitrogen (Carlsbad, CA), or Dharmacon (Lafayette, CO). Interfering RNAs are purified by extraction with a solvent or resin, precipitation, electrophoresis, chromatography, or a combination thereof, for example. Alternatively, interfering RNA may hemed with little if any purification to avoid losses due to sample processing. [00691 Interfering RNAs can also be expressed endogenously from plasmid or viral expression vectors or from minimal expression cassettes, for example, PCR generated fragments comprising one or more promoters and an appropriate template or .templates for the interfering RNA. Examples of commercially available plasmid-based expression vectors for sbRNA include members of the pSilencer series (Ambion, Austin, TX) and pCpG-siRNA (InvivoGen, San Diego, CA). Viral vectors for expression of interfering RNA may be derived from a variety of vimses including adenovirus, adeno associated virus, lentivirus (e.g., HIV, FIV, and EIAV), and herpes virus. Examples of commercially available viral vectors for shRNA expression include pSilencer adeno (Ambion, Austin, TX) and pLenti6BLOCK-i"f-DEST (Invitrogen, Carlsbad, CA). Selection of viral vectors, methods for expressing the interfering RNA from the vector and methods of delivering the viral vector are within the ordinary skill of one in the, art. Examples of kits for production of PCR-generated shRNA expression cassettes .include Silencer Express (Ambion, Austin, TX) and siXpress (Mirus, Madison, WI). A first interfering RNA may be administered via in vivo expression from a first expression vector capable of expressing the first interfering RNA and a second interfering RNA may be administered via in vivo expression from a second expression vector capable of expressing the second interfering RNA, or both interfering RNAs may be administered via In vivo expression from a single expression vector capable of expressing both interfering RNAs. [0070] Interfering RNAs may be expressed from a variety of eukaryotic promoters known to those of onlinary skill in the art, including pol III promoters, such as the U6 or I1 promotem, or pol I promoters, such as the cytomegalovirus promoter. Those of skill in the art will recognize that these promoters can also be adapted to allow inducible expression of the interfering RNA. 10071] Hybridization under Physiological Conditions: In certain embodiments of the present invention, an antisense strand of an interfering RNA hybridizes with an mRNA in vivo as part of the RISC complex. [0072] "HybridivAtion" refers to a prnes in which single-stranded nucleic acids with complementary or near-complementary base sequences interact to form hydrogen-bonded complexes called hybrids. Hybridization reactions are sensitive and selective. In vitro, the specificity of hybridization (i.e., stringency) is controlled by the concentrations of salt or fbrmamide in prehybridization and 18 hybridization solutions, for example, and by the hybridization temperature; such procedures are well knowa in the at. In particular, stringeny is inerceased by reducing the concentration of salt, increasing the concentration of formamide, or raising the hybridization temperature. [00731 For example, high stringency conditions could occur at about 50% formamnide at 37 *C to 42 "C. Reduced stringency conditions could occur at about 35% to 25% formamide at 30 C to 35 *C. Examples of stringency conditions for hybridization are provided in Sambrook, 1., 1989, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. Further examples of stringent hybridization conditions include 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50 *C or 70 *C for 12-16 hours followed by washing, or hybridization at 70 "C in IXSSC or 50 *C in IXSSC, 50% formamide followed by washing at 70 *C in 0.3XSSC, or hybridization at 70 *C in 4XSSC or 50 *C in 4XSSC, 50% formamide followed by washing at 67 *C in IXSSC. The temperature for hybridization is about 5-10 *C less than the melting temperature (T.) of the hybrid where T. is determined for hybrids between 19 and 49 base pairs in length using the following calculation- T,* C i 81.5 + 166(logjo[Na+]) + 0.41 (% G+C) - (600/N) where N is the number of bases in the hybrid, and [Na+] is the concentration of sodium ions in the hybridization buffer. [0074] The above-described in: vitro hybridization assay provides a method of predicting whether binding between a candidate siRNA and. a target will have specificity. However, in the context of the RISC complex, specific cleavage of a target can also occur with an antisense- strand that does not demonstrate high stringency for hybridization in vitro. [0075] Single-stranded interfering RNA: As cited above, interfering RNAs ultimately function as single strands. Single-stranded (ss) interfering RNA has been found to effect mRNA silencing, albeit less efficiently than double-stranded RNA. Therefore, embodiments of the present invention also provide for administration of a as interfering RNA that hybridizes under physiological conditions to a portion of SEQ ID NO:I or SEQ ID NO:191 and has a region of at least near-perfect contiguous complementarity of at least 19 nucleotides with the hybridizng portion of SEQ ID NO:l or SEQ ID NO:191, respectively. The ss interfering RNA has a length of 19 to 49 nucleotides as for the ds interfering RNA cited above. The ss interfering RNA has a 5' phosphate or is phosphorylated in situ or in vivo at the 5' position. The term "5' phosphorylated" is used 'to describe, for example, polynucleotides or oligonucleotides having a phosphate group attached via ester linkage to the C5 hydroxyl of the sugar (e.g., ribose, deoxyribose, or an analog of same) at the 5' end of the polynucleotide or oligonucleotide. 100761 SS interfering RNAs are synthesized chemically or by in vitro transcription or expressed endogenously ftom vectors or expression cassettes as for ds inerferiug RNAs. 5' Phosphate groups may be added via a kinase, or a 5' phosphate may be the result of nuclease cleavage of an RNA. Delivery is.as for ds interfering RNAs. In one embodiment, ss interfering RNAs having protected ends and nuclease resistant modifications-are administered for silencing. SS interfering RNAs may be dried 19 for storage or dissolved in an aqueous solution. The solution may contain buffers or salts to inhibit annealing or for stabilization. [0077] Hairpin interfering RM: A hairpin interfering RNA is a single molecule (e.g., a single oligonucleotide chain) that comprises both the sense and antisense strands of an interfering RNA in a stem-loop or hairpin structure (e.g., a shRNA). For example, shRNAs can be expressed from DNA vectors in which the DNA oligonucleotides encoding a sense interfering RNA strand are linked to the DNA oligonucleotides encoding the reverse complementary antisense interfering RNA strand by a short spacer: If needed for the chosen expression vector, 3' terminal T's and nucleotides forming restriction sites may be added. The resulting RNA transcript folds back onto itself to form a stem-loop structure. (0078] Mode of administration: Interfering RNA may be delivered directly to the eye by ocular tissue administration such as periocular, conjunctival, subtenon, intracameral, intravitreal, intraocular, subretinal, subconjunctival, retrobulbar, intracanalicular, or suprachoroidal administration; by injection, by direct application to the eye using a catheter or other placement device such as a retinal pellet, intraocular insert, suppository or an implant comprising a porous, non-porous, or gelatinous material; by topical ocular drops or ointments; or by a slow release device in the cul-de-sac or implanted adjacent to the sclera (transscleral) or within the eye. Intracameral injection may be through the cornea into the anterior chamber to allow the agent to reach the trabecular meshwork. Intracanalicular injection may be into the venous collector channels draining Schlemm's canal or into Schlemm's canal. Systemic or parenteral administration is contemplated including but not limited to intravenous, subcutaneous, transdermal, and oral delivery. [00791 Subject: A subject in need of treatment for glaucoma or at risk for developing glaucoma is a human or other mammal having glaucoma or at risk of developing a glaucoma-related condition, such as hypertension, associated with undesired or inappropriate expression or activity of FRP-1 as cited herein. Ocular structures associated with such disorders may include the eye, retina, choroid, lens, cornea, trabecular meshwork, iris, optic nerve, optic nerve head, sclera, aqueous chamber, vitreous chamber, ciliary body, or posterior segment, for example. A subject may also be an ocular cell, cell culture, organ or an ex vivo organ or tissue. [00801 Formulations and Dosage: Pharmaceutical formulations comprise interfering RNAs, or salts thereof of the invention up to 99% by weight mixed with a physiologically acceptable ophthalmic carrier medium such as water, buffer, saline, glycine, hyaluronic acid, mannitol, and the like. [00811 Interfering RNAs of the present invention are administered as solutions, suspensions, or emulsions. The following are examples of possible formulations embodied by this invention. 20 Amount in weight % Interfering RNA up to 99; 0.1-99; 0.1 - 50; 0.5 10.0 Hydroxypropylmethylcellulose 0.5 Sodium chloride 0.8 Benzalkonium Chloride 0.01 EDTA 0.01 NaOH/HCl qs pH 7.4 Purified water (RMase-free) gs 100 Ml Amount in weight % Interfering RNA up to 99; 0.1-99; 0.1 -50; 0.5 -10.0 Phosphate Buffered Saline 1.0 Benzalkonium Chloride 0.01 Polysorbate 80 0.5 Purified water (RNase-free) g.s. to 100% Amount in weight % Interfering RNA up to 99; 0. 1-99; 0.1-50; 0.5 -10.0 Monobasic sodium phosphate 0.05 Dibasic sodium phosphate 0.15 (anhydrous) Sodium chloride 0.75 Disodium EDTA 0.05 Cremophor EL 0.1 Benzalkonium chloride 0.01 HCI and/or NaOH pH 7.3-7.4 Purified water (RNase-freo) q.a. to 100% Amount in weight % Interfering RNA up to 99; 0.1-99; 0.1 -50; 0.5 - 10.0 Phosphate Buffered Saline 1.0 HydroxypmpylO-cyclodextrin 4.0 Purified water (RNase-free) q.s. to 100% [00821 Di general, the doses of combination compositions as provided herein will vary, but will be in an effective amount, which refers to an amount of a combination of interfering RNAs acting together during an ovedapping interval of time, that effectively inhibits or causes regression of neovascularization or angiogenesis, thereby preventing or treating retinal edema, AMD. DR, sequela associated with retinal ischemia, or PSNV. for example, in a human patient 100831 Generally, an effective amount of the interfering RNAs of embodiments of the invention results in an extracellular concentration at the surface of the target cell of from 100 pM to 100 nM, or from I nM to 50 nM, or from 5 nM to about 10 nM, or about 25 nM. The dose required to achieve this local concentration will vary depending on a number of factors including the delivery method, the site of delivery, the number of cell layers between the delivery site and the target cell or tissue, whether 21 delivery is local or systemic, etc. The concentration at the delivery site may be considerably higher than It Is at the surface of the target cull or tissu. Topical compositions are dolivcrod to the surface of the eye one to four times per day, or on an extended delivery schedule such as daily, weekly, bi-weekly, monthly, or longer, according to the routine discretion of a skilled clinician. The pH of the formulation is about pH 4-9, or pH 4.5 to pH 7.4. [0084] Therapeutic treatment of patients with siRNAs directed against FRP- 1 nRNA is expected to be beneficial over small molecule topical ocular drops by increasing the duration of action, thereby allowing less frequent doing and greater patient compliance. [00851 While the precise regimen is left to the discretion of the clinician, interfering RNAs may be administered by placing one drop in each eye as directed by the clinician. An effective amount of a formulation may depend on factors such as the age, race, and sex of the subject, the severity of the ocular hypertension, the rate of target gene transcript/protein turnover, the interfering RNA potency, and the interfering RNA stability, for example. In one embodiment, the interfering RNA is delivered topically to the eye and reaches the trabecular meshwork, retina, or optic nerve head at a therapeutic dose thereby ameliorating a glaucoma disease process. 100861 Acceptable carriers: An ophthalmically acceptable carrier refers to those carriers that cause at most, little to no ocular irritation, provide suitable preservation if needed, and deliver one or more interfering RNAs of the present invention in a homogenous dosage. An acceptable carrier for administration of interfering RNA of embodiments of the present invention include the cationic lipid based transfection reagents Trans1lT-TKO (Mirus Corporation, Madison, WI), LIPOFEC'IN@, Lipofectaine, OL1GOFBCTAMINm (Invitrogen, Carlsbad, CA), or I)HARMA1FECT"" (Dharmacon, Lafayette, CO); polycations such as polyethyleneimine; cationic peptides such as Tat, polyargininm, or Penetratin (Antp peptide); or liposomes. Liposomes are formed from standard vesicle forming lipids and a sterol, such as cholesterol, and may include a targeting molecule such as a monoclonal antibody having binding affinity for endothelial cell surface antigens, for example. Further,.the liposomes may be PEGylated liposomes. 10087] The interfering RNAs may be delivered in solution, in suspension, or in bioerodible or non biocrodible delivery devices. The interfering RNAs can be delivered alone or as components of defined, covalent conjugates. The interfering RNAs can also be complexed with cationic lipids, cationic peptides, or cationic polymers; complexed with proteins, fusion proteins, or protein domains with nucleic acid binding properties (e.g., protainine); or encapsulated in nanoparticles. Tissue- or cell specific delivery can be accomplished by the inclusion of an appropriate targeting moiety such as an antibody or antibody fragment. (00881 For ophthalmic delivery, an interfering RNA may be combined with ophthalmologically acceptable preservatives, co-solvents, surfactants, viscosity anbancers, penetration enhances, buffers, sodium chloride, or water to form an aqueous, sterile ophthalimic suspension or solution. Ophthialmic 22 solution formulations may be prepared by dissolving the interfering RNA in a physiologically acceptable isotonic aqueous buffer. Further, the ophthalmic solution may include an ophtaMnologically acceptable surfactant to assist in dissolving the inhibitor. Viscosity building agents, such as hydroxymethyl cellulose, hydroxyethyl cellulose, methylcellulose, polyvinylpyrrolidone, or the like may be added to the compositions of the present invention to improve the retention of the compound. [00891 In order to prepare a sterile ophthalmic ointment formulation, the interfering RNA is combined with a preservative in an appropriate vehicle, such as mineral oil, liquid lanolin, or white petrolatum. Serilc ophlhahuio gel fonnulations may bc prepared by suspending the interfering RNA in a hydrophilic base prepared from the combination of, for example, CARBOPOL-940 (BF Goodrich, Charlotte, NC), or the like, according to methods known in the art for other ophthalmic formulations. VISCOAT (Alcon Laboratories, Inc., Fort Worth, TX) may be used for intraocular injection, for example. Other compositions of the present invention may contain penetration enhancing agents such as cremephor and TWEBN* 80 (polyoxyethylene sorbitan monolaureate, Sigma Aldrich, St. Louis, MO), in the event the interfering RNA is less penetrating in the eye. [60901 Kits: Embodiments of the present invention provide a kit that includes reagents for attenuating the expression of an mRNA as cited herein in a cell. The kit contains an siRNA or an shRNA expression vector. For siRNAs and non-viral shRNA expression vectors the kit also may contain a transfection reagent or other suitable delivery vehicle. For viral shRNA expression vectors, the kit may contain the viral vector and/or the necessary components for viral vector production (e.g., a packaging cell line as well as a vector comprising the viral vector template and additional helper vectors for packaging). The kit may also contain positive and negative control siRNAs or shRNA expression vectors (e.g., a non-targeting control siRNA oran siRNA that targets an unrelated mRNA). The kit also may contain reagents for assessing knockdown of the intended target gene (e.g., primers and probes for quantitative PCR to detect the target mRNA and/or antibodies against the corresponding protein for western blots). Alternatively, the kit may comprise an siRNA sequence or an shRNA sequence and the instructions and materials necessary to generate the siRNA by in vitro transcription or to construct an shRNA expression vector. 100911 A pharmaceutical combination in kit form is futher provided that includes, in packaged combination, a carrier means adapted to receive a container mcans in close confinement therewith and a first container means including an interfering RNA composition and an ophthalmically acceptable carrier. Such kits can further include, if desired, one or more of various conventional pharmaceutical kit components, such as, for example, containers with one or more pharmaceutically acceptable carriers, additional containers, etc., as will be roadily apparent to those skilled in the art. Printed instructions, either as inserts or as labels, indicating quantities of the components to be administered, guidelines for administration, and/or guidelines for mixing the components, can also be included in the kit. 23 [00921 The ability of FRP-1 interfering RNA to knock-down the levels of endogenous FRP-l expression in, for example, human trabecular meshwork (TM) cells is carried out as follows. Transfection of a transformed human TM cell line designated GTM3 or HTM-3 (see Pang, I.H. et aL, 1994. Curr. Eye Rey. 13:51-63) is accomplished using standard in vitro concentrations of FRP-l interfering RNA (100 nM) as cited herein and LIPOFECTAM]NEr" 2000 (Invitrogen, Carlsbad, California) at a 1;1 (w/v) ratio. Scrambled and lamin A/C siRNA (Dharmacon) are used as controls. QPCR TAQMAN@ forward and reverse primers and a probe set that encompasses the target site are used to assess the degree of mRNA oleavage. Such primer/probe sets may be synthesized by ABI (Applied Biosystems, Foster City, CA), for example. To reduce the chance of non-specific, off-target effects, the lowest possible siRNA concentration for inhibiting FRP-1 mRNA expression is determined for a siRNA. FRP-1 mRNA knock-down is assessed by QPCR amplification using an appropriate primer/probe set. A dose response of FRP-1 siRNA in GTM3 cells is observed in GTM3 cells after 24 hour treatment with 0, 1, 3,10, 30, and 100 nM dose range of siRNA, for example. Data are fitted using GraphPad Prism 4 software (GraphPad Software, Inc., San Diego, CA) with a variable slope, sigmoidal dose response algorithm and a top constraint of 100%. An IC 50 is obtained for the particular siRNA tested. Example 1 Interfering RNA for Silencing FRP1 [00931 The present study examines the ability of FRP1 interfering RNA to knock-down the levels of endogenous FRP1 mRNA in COS cells. [0094] COS-7 cells were plated at -20% confluence in 12-well plates the day before transfection. At the time of transfection, the cells appeared to be 50-70% confluent. Cells were harvested 1 and 3 days after transfection. Transfection of a double-stranded FRPI-siRNA having a sense strand sequence 5' AAGAAGAUUGUCCCCAAGAAG 3' (SEQ ID NO:146, which is SEQ ID NO:18 with an added 5'AA; purchased from Dharmacon, Lafayette, Colorado) was carried out using OLIGOFECTAMINME (Invitrogen, Carlsbad, CA) and 100 nmole of siRNA for each well of 12-well plate in triplicate. The control is without siRNA. RNA extraction was by RNAqueousTM for PCR (Ambion, Austin, TX) and cDNA was synthesized with TAQMANrx reverse transcription agents (PB Biosystens (Applied Biosysteins, Foster City, CA)). The QPCR was performed using TAQMANrm universal PCR master mix and 7700 SDS (PE Biosystems) in triplicate. Ribosomal RNA (18s, PE Biosystems) was used as a normalization control in the multiplex QPCR. The QPCR data are provided in FIG. 1 and show eignifioant inhibition of FRPl mRNA at day 1 (22%, P"-.04) and at day 3 (32/6, P=0.002) after transfection as compared to controls. [0095) The references cited herein, to the extent that they provide -exemplary procedural or other details supplementary to those set forth herein, are specifically incorporated by reference. 24 [0096] Those of skill in the art, in light of the present disclosure, will appreciate that obvious modifications of the embodimentsdisclosed herein can be made without departing from the spirit and scope of the invention. All of the embodiments disclosed herein can be made and executed without undue experimentation in light of the present disclosure. The full scope of the invention is set out in the disclosure and equivalent embodiments thereof. The specification should not be construed to unduly narrow the full scope of protection to which the present invention is entitled. [0097] As Used herein and unless otherwise indicated, the terms "a" and "an" are taken to mea "one, "at least one" or "one or more". 25

Claims (21)

1. The use, in the preparation of a medicament for the treatment of glaucoma in a subject, of a composition comprising an effective amount of interfering RNA having a length of 19 to 49 5 nucleotides and a pharmaceutically acceptable carrier, the interfering RNA comprising: a sense nucleotide strand, an antisense nucleotide strand, and a region of at least 80% contiguous complementarity of at least 19 nucleotides; wherein the antisense strand hybridizes under physiological conditions to a portion of mRNA corresponding to SEQ ID NO: 1 or SEQ ID NO: 191 and has a region of at least 80% contiguous complementarity of at least 19 nucleotides with the hybridizing portion of 10 mRNA corresponding to SEQ ID NO:1 or SEQ ID NO : 191, respectively, and wherein the antisense strand of the interfering RNA is designed to target an mRNA corresponding to SEQ ID NO: I comprising nucleotide 509, 521, 524, 767, 818, 843, 850, 872, 881, 900, 959, 968, 971, 983, 986, 989. 1001, 1016,1019, 1022, 1031, 1034, 1052, 1088, 1121, 1127, 1207, 1360, 1445, 1450, 1478, 1487, 1524, 1535, 1562, 1579, 1613, 1661, 1667, 1724, 1730, 1753, 1757, 1763, 1771, 1794, 1800, 1813, 15 1887, 1893, 1916, 2001, 2006, 2106, 2117, 2135, 2142, 2152, 2200, 2203, 2206, 2241, 2263, 2276, 2279, 2389, 2410, 2430,2464, 2468, 2482, 2502, 2506, 2572, 2645, 2666, 2681, 2697,2715, 2734, 2760, 2770, 2783, 2797, 2807, 2844, 2917, 2937, 2961, 3005, 3010, 3080, 3130, 3150, 3156, 3179, 3185, 3196, 3244, 3281, 3345, 3350, 3365, 3372, 3403, 3410, 3424, 3428, 3450, 3453, 3460, 3596, 3668, 3672, 3746, 3762, 3776, 3786, 3789, 3826, 3835, 3844, 3847, 3867, 3912, 3924, 3958, 3976, 20 3981, 4012, 4022, 4071, 4089, 4154, 4157, 4208, 4369, 4375, 4441, 966, 408, 409, 463, 754, 862, 863, 864, 868, 874, 909, 913, 915, 956, 1118, 1135, 1634, 1637, 1640, 1737, 1867, 1868, 2100, 2259, 2260, 2483, 2598, 2673, 2675, 2779, 2985, 2986, 2987, 2988, 3055, 3062, 3161, 3217, 3355, 3623, 3648, 3665, 3817, 4153, or 4252; or wherein the antisense strand of the interfering RNA is designed to target an mRNA corresponding to SEQ ID NO: 191 comprising nucleotide 3352. 25

2. The use of Claim I wherein the antisense strand hybridizes under physiological conditions to a portion of mRNA corresponding to SEQ ID NO:1, and has a region of at least 80% contiguous complementarity of at least 19 nucleotides with the hybridizing portion of mRNA corresponding to SEQ ID NO: 1. 30

3. The use of Claim I wherein the antisense strand hybridizes under physiological conditions to a portion of mRNA corresponding to SEQ ID NO: 191, and has a region of at least 80%contiguous complementarity of at least 19 nucleotides with the hybridizing portion of mRNA corresponding to SEQ ID NO:191. 35

4. The use of Claim 1 wherein the antisense strand of the interfering RNA is designed to target an mRNA corresponding to SEQ ID NO:1 comprising nucleotide 509, 521, 524, 767, 818, 843, 850, 872, 881,900,959,971,983,986,989,1001,1016,1019,1022,1031,1034,1052, 1088, 1121, 1127, 1207, 26 1360, 1445, 1450, 1478, 1487, 1524, 1535, 1562, 1579, 1613, 1661, 1667, 1724, 1730, 1753, 1757, 1763, 1771, 1794, 1800, 1813, 1887, 1893, 1916, 2001, 2006, 2106, 2117, 2135, 2142, 2152, 2200, 2203, 2206, 2241, 2263, 2276, 2279, 2389, 2410, 2430, 2464, 2468, 2482, 2502, 2506, 2572, 2645, 2666, 2681, 2697, 2715, 2734, 2760, 2770, 2783, 2797, 2807, 2844, 2917, 2937, 2961, 3005, 3010, 5 3080, 3130, 3150, 3156, 3179, 3185, 3196, 3244, 3281, 3345, 3350, 3365, 3372, 3403, 3410, 3424, 3428, 3450, 3453, 3460, 3596, 3668, 3672, 3746, 3762, 3776, 3786, 3789, 3826, 3835, 3844, 3847, 3867, 3912, 3924, 3958, 3976, 3981, 4012, 4022, 4071, 4089, 4154, 4157, 4208, 4369, 4375, 4441, 408,409,463,754, 862, 863, 864, 868,874,909,913,915,956, 1118, 1135, 1634, 1637, 1640, 1737, 1867, 1868, 2100, 2259, 2260, 2483, 2598, 2673, 2675, 2779, 2985, 2986, 2987, 2988, 3055, 3062, 10 3161,3217,3355,3623,3648,3665,3817,4153,or4252.

5. The use of Claim I wherein the antisense strand of the interfering RNA is designed to target an rnRNA corresponding to SEQ ID NO: 191 comprising nucleotide 3352. 15

6. The use of Claim I further comprising administering to the subject a second interfering RNA having a length of 19 to 49 nucleotides and comprising: a sense nucleotide strand, an antisense nucleotide strand, and a region of at least 80% complementarity of at least 19 nucleotides; wherein the antisense strand of the second interfering RNA hybridizes under physiological conditions to a second portion of mRNA corresponding to SEQ ID NO: I or SEQ ID NO: 191, and the antisense strand has a region of at 20 least 80% contiguous complementarity of at least 19 nucleotides with the second hybridizing portion of mRNA corresponding to SEQ ID NO:1 or SEQ ID NO:191, respectively.

7. The use of Claim 1 wherein the sense nucleotide strand and the antisense nucleotide strand are connected by a loop nucleotide strand. 25

8. The use of Claim 1 wherein the composition is prepared for topical, intravitreal, transcleral, periocular, conjunctival, subtenon, intracameral, subretinal, subconjunctival, retrobulbar, intracanalicular or suprachoroidal administration. 30

9. The use of Claim I wherein the composition is prepared for administration via in vivo expression from an expression vector capable of expressing the interfering RNA.

10. A method of treating glaucoma in a subject, comprising: administering to the subject a composition comprising an effective amount of a single-stranded interfering RNA having a length of 19 to 49 35 nucleotides, and a pharmaceutically acceptable carrier, wherein the single-stranded interfering RNA hybridizes under physiological conditions to a portion of mRNA corresponding to SEQ ID NO:1 comprising nucleotide 509, 521, 524, 767, 818, 843, 850, 872, 881, 900, 959, 971, 983, 986, 989, 1001, 27 1016, 1019, 1022, 1031, 1034, 1052, 1088, 1121, 1127, 1207, 1360, 1445, 1450, 1478, 1487, 1524, 1535, 1562, 1579, 1613, 1661, 1667, 1724, 1730, 1753, 1757, 1763, 1771, 1794, 1800, 1813, 1887, 1893, 1916,2001, 2006, 2106, 2117, 2135, 2142, 2152, 2200, 2203, 2206, 2241, 2263, 2276, 2279, 2389, 2410, 2430, 2464, 2468, 2482, 2502, 2506, 2572, 2645, 2666, 2681, 2697, 2715, 2734, 2760, 5 2770, 2783, 2797, 2807, 2844, 2917, 2937, 2961, 3005, 3010, 3080, 3130, 3150, 3156, 3179, 3185, 3196, 3244, 3281, 3345, 3350, 3365, 3372, 3403, 3410, 3424, 3428, 3450, 3453, 3460, 3596, 3668, 3672, 3746, 3762, 3776, 3786, 3789, 3826, 3835, 3844, 3847, 3867, 3912, 3924, 3958, 3976, 3981, 4012, 4022, 4071, 4089, 4154, 4157, 4208, 4369, 4375, 4441, 408, 409, 463, 754, 862, 863, 864, 868, 874, 909, 913, 915, 956, 1118, 1135, 1634, 1637, 1640, 1737, 1867, 1868, 2100, 2259, 2260, 2483, 10 2598, 2673, 2675, 2779, 2985, 2986, 2987, 2988, 3055, 3062, 3161, 3217, 3355, 3623, 3648, 3665, 3817, 4153, or 4252, and the interfering RNA has a region of at least 80% contiguous complementarity with the hybridizingportion of mRNAcorresponding to SEQ ID NO: 1; or wherein the single-stranded interfering RNA hybridizes under physiological conditions to a portion of mRNA corresponding to SEQ ID NO:191 comprising nucleotide 3352, and the interfering RNA has a region of at least 80% 15 contiguous complementarity of at least 19 nucleotides with the hybridizing portion of mRNA corresponding to SEQ ID NO.191; wherein the expression of Frizzled Related Protein-i mRNA is thereby attenuated.

11. The method of Claim 10 wherein the composition is administered via a topical, intravitreal, 20 transcleral, periocular, conjunctival, subtenon, intracameral, subretinal, subconjunctival, retrobulbar, intracanalicular, or suprachoroidal route.

12. The method of Claim 10 wherein the interfering RNA is administered via in vivo expression from an expression vector capable of expressing the interfering RNA. 25

13. The method of Claim 10 wherein the interfering RNA is an miRNA.

14. The method of Claim 10 wherein the interfering RNA is an siRNA. 30

15. A composition when used for treating glaucoma, said composition comprising an interfering RNA having a length of 19 to 49 nucleotides, and comprising a nucleotide sequence corresponding to any one of SEQ ID NO: 2, SEQ ID NO: 8 SEQ ID NO: 17, SEQ ID NO: 19-145, SEQ ID NO: 147 - SEQ ID NO: 190, and SEQ ID NO: 192, or a complement thereof; and a pharmaceutically acceptable carrier. 35

16. The composition of Claim 15 wherein the interfering RNA is an shRNA.

17. The composition of Claim 15 wherein the interfering RNA is an siRNA. 28

18. The composition of Claim 15 wherein the interfering RNA is an miRNA.

19. A use of claim 1, substantially as hereinbefore described with reference to the Figures and/or Examples. 5

20. A method of claim 10, substantially as hereinbefore described with reference to the Figures and/or Examples.

21. A composition of claim 15, substantially as hereinbefore described with reference to 10 the Figures and/or Examples. 29