AU2011258249B2 - Improved methods of screening embryonic progenitor cell lines - Google Patents

Abstract

Aspects of the present invention include methods and compositions related to the production and use of numerous clonal lineages of embryonic progenitor cell lines derived from differentiating cultures of primordial stem cells with diverse molecular markers and having been cultured for > 21 doublings of clonal expansion. The robustness of these clonally-purified lines, their ability to expand for >40 passages while maintaining their pattern of gene expression, lack of tumorigenicity, and their embryonic pattern of gene expression offers novel compositions and methods for modeling numerous differentiation pathways for the first time in vitro, and for the manufacture of purified product not existing in such a purified state in nature or using other manufacturing modalities. Representative progenitor cell lines described herein are capable of development into cutaneous adipocytes, blood-brain barrier cells, neuronal cells, or smooth muscle cells each with therapeutic potential.

Description

WO 2011/150105 PCT/US2011/037969 IMPROVED METHODS OF SCREENING EMBRYONIC PROGENITOR CELL LINES BACKGROUND Advances in stem cell technology, such as the isolation and propagation in vitro of 5 primordial stem cells, including embryonic stem cells ("ES" cells including human ES cells ("hES" cells)) and related primordial stem cells including but not limited to, iPS, EG, EC, ICM, epiblast, or ED cells (including human iPS, EG, EC, ICM, epiblast, or ED cells), constitute an important new area of medical research. hES cells have a demonstrated potential to be propagated in the undifferentiated state and then to be induced subsequently to differentiate into likely any and all of 10 the cell types in the human body, including complex tissues. In addition, many of these primordial stem cells are naturally telomerase positive in the undifferentiated state, thereby allowing the cells to be expanded indefinately. This expansion potential allows these primordial cells to be genetically modified followed by clonal expansion, thus permittting the production of numerous homogeneous populations of genetically modified primordial stem cells. Since the telomere length of many of 15 these cells is comparable to that observed in sperm DNA (approximately 10-18 kb TRF length), differentiated cells derived from these immortal lines once they begin differentiation (generally associated with the repression of the expression of the catalytic component of telomerase (TER7T)) display a long initial telomere length providing the cells with a long replicative capacity compared to fetal or adult-derived tissue. This has led to the suggestion that many diseases resulting from the 20 dysfunction of cells may be amenable to treatment by the administration of hES-derived cells of various differentiated types (Thomson et al., Science 282:1145-1147 (1998)). Nuclear transfer studies have demonstrated that it is possible to transform a somatic differentiated cell back to a primordial stem cell state such as that of embryonic stem ("ES") cells (Cibelli et al., Nature Biotech 16:642-646 (1998)) or embryo-derived ("ED") cells. The development of technologies to reprogram 25 somatic cells back to a totipotent ES cell state, such as by the transfer of the genome of the somatic cell to an enucleated oocyte and the subsequent culture of the reconstructed embryo to yield ES cells, often referred to as somatic cell nuclear transfer ("SCNT") or through analytical reprogramming technology, offers methods to transplant ES-derived somatic cells with a nuclear genotype of the patient (Lanza et al., Nature Medicine 5:975-977 (1999)). 30 In addition to SCNT, other techniques exist to address the problem of transplant rejection, including the use of gynogenesis and androgenesis (see U.S. application nos. 60/161,987, filed October 28, 1999; 09/697,297, filed October 27, 2000; 09/995,659, filed November 29, 2001; 10/374,512, filed February 27, 2003; PCT application no. PCT/US00/29551, filed October 27, 2000; the disclosures of which are incorporated by reference in their entirety). In the case of a type of 35 gynogenesis designated parthenogenesis, pluripotent stem cells may be manufactured without antigens foreign to the gamete donor and therefore useful in manufacturin g cells that can be 1 WO 2011/150105 PCT/US2011/037969 transplanted without rejection. In addition, parthenogenic stem cell lines can be assembled into a bank of cell lines homozygous in the HLA region (or corresponding MHC region of nonhuman animals) to reduce the complexity of a stem cell bank in regard to HLA haplotypes. In addition, cell lines or a bank of said cell lines can be produced that are hemizygous in the 5 HLA region (or corresponding MHC region of nonhuman animals; see PCT application Ser. No. PCT/US2006/040985 filed October 20, 2006 entitled "Totipotent, Nearly Totipotent or Pluripotent Mammalian Cells Homozygous or Hemizygous for One or More Histocompatibility Antigen Genes", incorporated herein by reference). A bank of hemizygous cell lines provides the advantage of not only reducing the complexity inherent in the normal mammalian MHC gene pool, but it also reduces 10 the gene dosage of the antigens to reduce the expression of said antigens without eliminating their expression entirely, thereby not stimulating a natural killer response. In addition to SCNT, parthenogenesis, and the construction of banks of cells with homozygous or hemizygous HLA alleles, other techniques exist to address the problem of transplant rejection, including the use of technologies to reprogram somatic cells using transcriptional 15 regulators (see PCT application Ser. No. PCT/US2006/030632 filed on August 3, 2006 and titled "Improved Methods of Reprogramming Animal Somatic Cells", incorporated herein by reference). In regard to differentiating primordial stem cells into desired cell types, the potential to clonally isolate lines of human embryonic progenitor (hEP) cell lines provides a means to propagate novel highly purified cell lineages useful in the production of diverse secreted factors, for research, 20 and for the manufacture of cell-based therapies (see PCT application Ser. No. PCT/US2006/013519 filed on April 11, 2006 and titled "Novel Uses of Cells With Prenatal Patterns of Gene Expression"; U.S. patent application Ser. No. 11/604,047 filed on November 21, 2006 and titled "Methods to Accelerate the Isolation of Novel Cell Strains from Pluripotent Stem Cells and Cells Obtained Thereby"; and U.S. patent application Ser. No. 12/504,630 filed on July 16, 2009 and titled "Methods 25 to Accelerate the Isolation of Novel Cell Strains from Pluripotent Stem Cells and Cells Obtained Thereby", each incorporated herein by reference). Nevertheless, there remains a need for improved methods to discover the differentiation potential of said hEP cell lines when exposed to diverse differentiation-inducing factors or other differentiation conditions that induce such differentiation under conditions which are compatible in 30 either a general laboratory setting or in a good manufacturing processes ("GMP") cell manufacturing facility where there is adequate documentation as to the purity and genetic normality of the cells at advanced passages (>18-21 doublings of clonal expansion). SUMMARY OF THE INVENTION 35 We have previously demonstrated that the long initial telomere length of hES cells, together with the unexpected robust proliferative capacity of primitive hES-derived progenitor cell types, 2 facilitates the industrial expansion and characterization of > 140 diverse and scalable clonal lineages with diverse defined homeobox gene expression as well as diverse transcriptional regulators (West et al., 2008, Regenerative Medicine vol. 3(3) pp. 287 308, incorporated herein by reference, including supplemental information; and U.S. 5 patent application Ser. No. 12/504,630 filed on July 16, 2009 and titled "Methods to Accelerate the Isolation of Novel Cell Strains from Pluripotent Stem Cells and Cells Obtained Thereby", incorporated herein by reference in its entirety). The robustness of these clonally-purified lines, their ability to expand for >40 passages while maintaining their pattern of gene expression, lack of tumorigenicity, and their embryonic pattern of 10 gene expression offers novel compositions and methods for modeling numerous differentiation pathways for the first time in vitro, and for the manufacture of purified product not existing in such a purified state in nature or using other manufacturing modalities. We disclose novel compositions and methods related to these cells, including novel screening methods and conditions that differentiate human embryonic 15 progenitors into numerous terminally-differentiated cell types of use in medical research and therapy. The present invention also provides an isolated clonal progenitor cell line expressing EYA4, wherein the clonal progenitor cell line is an embryonic cutaneous progenitor cell and is encapsulated in a biomaterial. 20 The present invention also provides a method of differentiating a clonal progenitor cell line into cutaneous adipocytes comprising 1) obtaining a clonal progenitor cell line of claim 1; 2) contacting the clonal progenitor cell line with MDI Induction Media; and 3) contacting the clonal progenitor cell line of 2) with Insulin Media thereby differentiating a clonal progenitor cell line into a cutaneous adipocyte. 25 The present invention also provides a method of differentiating a clonal progenitor cell line into cutaneous adipocytes comprising 1) obtaining a clonal progenitor cell line of claim 1; 2) contacting the clonal progenitor cell line with serum free differentiation media; and 3) contacting the clonal progenitor cell line of 2) with a differentiation media without rosiglitazone thereby differentiating a clonal progenitor 30 cell line into a cutaneous adipocyte. BRIEF DESCRIPTION OF THE DRAWINGS Figure 1: Levels of induction of COL2A1 in assayed lines before and after 14 days of chondrogenic micromass conditions. 35 Figure 2: An example of the Safranin 0 staining of adipose tissue stem cells compared to the lines 4D20.8 at passage 14 compared to MSCs at passage 6 all at day 3 21 of differentiation as a pellet and immunostaining with isotype controls in day 14 pellets of the line 4D20.8 and MSCs. Figure 3: Comparison of endothelial tubes formed by HUVECs and the line W10. 5 DETAILED DESCRIPTION OF THE INVENTION Abbreviations AFP - Alpha fetoprotein BMP - Bone Morphogenic Protein 10 BRL - Buffalo rat liver BSA - Bovine serum albumin CD - Cluster Designation cGMP - Current Good Manufacturing Processes CNS - Central Nervous System 15 DMEM - Dulbecco's modified Eagle's medium DMSO - Dimethyl sulphoxide DPBS - Dulbecco's Phosphate Buffered Saline EC - Embryonal carcinoma EC Cells - Embryonal carcinoma cells; hEC cells are human embryonal 20 carcinoma cells ECAPCs - Embryonic cutaneous adipocyte progenitor cells 3A WO 2011/150105 PCT/US2011/037969 ECM - Extracellular Matrix ED Cells - Embryo-derived cells; hED cells are human ED cells EDTA - Ethylenediamine tetraacetic acid EG Cells - Embryonic germ cells; hEG cells are human EG cells 5 EP Cells - Embryonic progenitor cells are cells derived from primordial stem cells that are more differentiated than primordial stem cells, in that they no longer display markers such as SSEA4, TRA1-60 or TRA-1-81 seropositivity in the case of the human species, but have not fully differentiated. Embryonic progenitor cells correspond to the embryonic stages as opposed to the postnatal stage of development. ES Cells - Embryonic stem cells; hES cells are human ES cells 10 FACS - Fluorescence activated cell sorting FBS - Fetal bovine serum GFP - Green Fluorescent Protein GMP - Good Manufacturing Practices hED Cells - Human embryo-derived cells 15 hEG Cells - Human embryonic germ cells are stem cells derived from the primordial germ cells of fetal tissue. hEP Cells - Human embryonic progenitor cells are embryonic progenitor cells from the human species. hiPS Cells - Human induced pluripotent stem cells are cells with properties similar to hES cells 20 obtained from somatic cells after exposure to hES-specific transcription factors such as SOX2, KLF4, OCT4, MYC, or NANOG, LIN28, OCT4, and SOX2, HSE - Human skin equivalents are mixtures of cells and biological or synthetic matrices manufactured for testing purposes or for therapeutic application in promoting wound repair. HUVEC - Human umbilical vein endothelial cell 25 ICM - Inner cell mass of the mammalian blastocyst-stage embryo. iPS Cells - Induced pluripotent stem cells are cells with properties similar to hES cells obtained from somatic cells after exposure to ES-specific transcription factors such as SOX2, KLF4, OCT4, MYC, or NANOG, LIN28, OCT4, and SOX2. LOH - Loss of Heterozygosity 30 MEM - Minimal essential medium miRNA - Micro RNA NT - Nuclear Transfer PBS - Phosphate buffered saline PS fibroblasts - Pre-scarring fibroblasts are fibroblasts derived from the skin of early gestational skin 35 or derived from ED cells that display a prenatal pattern of gene expression in that they promote the rapid healing of dermal wounds without scar formation. RA - Retinoic acid RFU - Relative Fluorescence Units SCNT - Somatic Cell Nuclear Transfer 40 SFM - Serum-Free Medium SPF - Specific Pathogen-Free 4 WO 2011/150105 PCT/US2011/037969 SV40 - Simian Virus 40 Tag - Large T-antigen T-EDTA - Trypsin EDTA 5 Definitions The term "analytical reprogramming technology" refers to a variety of methods to reprogram the pattern of gene expression of a somatic cell to that of a more pluripotent state, such as that of an iPS, ES, ED, EC or EG cell, wherein the reprogramming occurs in multiple and discrete steps and does not rely simply on the transfer of a somatic cell into an oocyte and the activation of that oocyte 10 (see U.S. application nos. 60/332,510, filed November 26, 2001; 10/304,020, filed November 26, 2002; PCT application no. PCT/US02/37899, filed November 26, 2003; U.S. application no. 60/705625, filed August 3, 2005; U.S. application no. 60/729173, filed August 20, 2005; U.S. application no. 60/818813, filed July 5, 2006, PCT/US06/30632, filed August 3, 2006, the disclosure of each of which is incorporated by reference herein). 15 The term "blastomere/morula cells" refers to blastomere or morula cells in a mammalian embryo or blastomere or morula cells cultured in vitro with or without additional cells including differentiated derivatives of those cells. The term "cell expressing gene X", "gene X is expressed in a cell" (or cell population), or equivalents thereof, means that analysis of the cell using a specific assay platform provided a positive 20 result. The converse is also true (i.e., by a cell not expressing gene X, or equivalents, is meant that analysis of the cell using a specific assay platform provided a negative result). Thus, any gene expression result described herein is tied to the specific probe or probes employed in the assay platform (or platforms) for the gene indicated. The term "cell line" refers to a mortal or immortal population of cells that is capable of 25 propagation and expansion in vitro. The term "cellular reconstitution" refers to the transfer of a nucleus of chromatin to cellular cytoplasm so as to obtain a functional cell. The term "clonal" refers to a population of cells obtained the expansion of a single cell into a population of cells all derived from that original single cells and not containing other cells. 30 The term "colony in situ differentiation" refers to the differentiation of colonies of cells (e.g., hES, hEG, hiPS, hEC or hED) in situ without removing or disaggregating the colonies from the culture vessel in which the colonies were propagated as undifferentiated stem cell lines. Colony in situ differentiation does not utilize the intermediate step of forming embryoid bodies, though embryoid body formation or other aggregation techniques such as the use of spinner culture may 35 nevertheless follow a period of colony in situ differentiation. The term "cytoplasmic bleb" refers to the cytoplasm of a cell bound by an intact or permeabilized but otherwise intact plasma membrane, but lacking a nucleus. 5 WO 2011/150105 PCT/US2011/037969 The term "differentiated cells" when used in reference to cells made by methods of this invention from pluripotent stem cells refer to cells having reduced potential to differentiate when compared to the parent pluripotent stem cells. The differentiated cells of this invention comprise cells that could differentiate further (i.e., they may not be terminally differentiated). 5 The term "direct differentiation" refers to process of differentiating: blastomere cells, morula cells, ICM cells, ED cells, or somatic cells reprogrammed to an undifferentiated state (such as in the process of making iPS cells but before such cells have been purified in an undifferentiated state) directly without the intermediate state of propagating isolated undifferentiated stem cells such as hES cells as undifferentiated cell lines. A nonlimiting example of direct differentiation would be the 10 culture of an intact human blastocyst into culture and the derivation of ED cells without the generation of a human ES cell line as was described (Bongso et al, 1994. Human Reproduction 9:2110). The term "embryonic stem cells" (ES cells) refers to cells derived from the inner cell mass of blastocysts, blastomeres, or morulae that have been serially passaged as cell lines while maintaining 15 an undifferentiated state (e.g. expressing TERT, OCT4, and SSEA and TRA antigens specific for ES cells of the species). The ES cells may be derived from fertilization of an egg cell with sperm or DNA, nuclear transfer, parthenogenesis, or by means to generate hES cells with hemizygosity or homozygosity in the MHC region. While ES cells have historically been defined as cells capable of differentiating into all of the somatic cell types as well as germ line when transplanted into a 20 preimplantation embryo, candidate ES cultures from many species, including human, have a more flattened appearance in culture and typically do not contribute to germ line differentiation, and are therefore called "ES-like cells." It is commonly believed that human ES cells are in reality "ES-like", however, in this application we will use the term ES cells to refer to both ES and ES-like cell lines. The term "histotypic culture" refers to cultured cells that are aggregated to create a three 25 dimensional structure with tissue-like cell density such as occurs in the culture of some cells over a layer of agar or such as occurs when cells are cultured in three dimensions in a collagen gel, sponge, or other polymers such as are commonly used in tissue engineering. The term "human embryo-derived" ("hED") cells refers to blastomere-derived cells, morula derived cells, blastocyst-derived cells including those of the inner cell mass, embryonic shield, or 30 epiblast, or other totipotent or pluripotent stem cells of the early embryo, including primitive endoderm, ectoderm, mesoderm, and neural crest and their derivatives up to a state of differentiation correlating to the equivalent of the first eight weeks of normal human development, but excluding cells derived from hES cells that have been passaged as cell lines (see, e.g., U.S. Patents 7,582,479; 7,217,569; 6,887,706; 6,602,711; 6,280,718; and 5,843,780 to Thomson, incorporated herein by 35 reference). The hED cells may be derived from preimplantation embryos produced by fertilization of an egg cell with sperm or DNA, nuclear transfer, or chromatin transfer, an egg cell induced to form a 6 WO 2011/150105 PCT/US2011/037969 parthenote through parthenogenesis, analytical reprogranmming technology, or by means to generate hES cells with hemizygosity or homozygosity in the HLA region. The term "human embryonic germ cells" (hEG cells) refer to pluripotent stem cells derived from the primordial germ cells of fetal tissue or maturing or mature germ cells such as oocytes and 5 spermatogonial cells, that can differentiate into various tissues in the body. The hEG cells may also be derived from pluripotent stem cells produced by gynogenetic or androgenetic means, i.e., methods wherein the pluripotent cells are derived from oocytes containing only DNA of male or female origin and therefore will comprise all female-derived or male-derived DNA (see U.S. application nos. 60/161,987, filed October 28, 1999; 09/697,297, filed October 27, 2000; 09/995,659, filed November 10 29,2001; 10/374,512, filed February 27, 2003; PCT application no. PCT/US/00/29551, filed October 27, 2000; the disclosures of which are incorporated herein in their entirety). The term "human embryonic stem cells" (hES cells) refers to human ES cells. The term "human iPS cells" refers to cells with properties similar to hES cells, including the ability to form all three germ layers when transplanted into immunocompromised mice wherein said 15 iPS cells are derived from cells of varied somatic cell lineages following exposure to de differentiation factors, for example hES cell-specific transcription factor combinations: KLF4, SOX2, MYC, and OCT4 or SOX2, OCT4, NANOG, and LIN28. Any convenient combination of de differentiation factors may be used to produce iPS cells. Said iPS cells may be produced by the expression of these genes through vectors such as retroviral, lentiviral or adenoviral vectors as is 20 known in the art, or through the introduction of the factors as proteins, e.g., by permeabilization or other technologies. For descriptions of such exemplary methods see: PCT application number PCT/US2006/030632, filed on August 3, 2006; U.S. Application Ser. No. 11/989,988; PCT Application PCT/US2000/018063, filed on June 30, 2000; U.S. Applciation Ser. No. 09,736,268 filed on December 15, 2000; U.S. Applciation Ser. No. 10/831,599, filed April 23, 2004; and U.S. 25 Patent Publication 20020142397 (App. Ser. No. 10/015,824, entitled "Methods for Altering Cell Fate"); U.S. Patent Publication 20050014258 (App. Ser. No. 10/910,156, entitled "Methods for Altering Cell Fate"); U.S. Patent Publication 20030046722 (App. Ser. No. 10/032,191, entitled "Methods for cloning mammals using reprogrammed donor chromatin or donor cells"); and U.S. Patent Publication 20060212952 (App. Ser. No. 11/439,788, entitled "Methods for cloning mammals 30 using reprogrammed donor chromatin or donor cells") all of which are incorporated herein by reference in their entirety. The term "ICM cells" refers to the cells of the inner cell mass of a mammalian embryo or the cells of the inner cell mass cultured in vitro with or without the surrounding trophectodermal cells. The term "oligoclonal" refers to a population of cells that originated from a small population 35 of cells, typically 2-1000 cells, that appear to share similar characteristics such as morphology or the presence or absence of markers of differentiation that differ from those of other cells in the same culture. Oligoclonal cells are isolated from cells that do not share these common characteristics, and 7 WO 2011/150105 PCT/US2011/037969 are allowed to proliferate, generating a population of cells that are essentially entirely derived from the original population of similar cells. The term "organotypic culture" refers to cultured cells that are aggregated to create a three dimensional structure with tissue-like cell density such as occurs in the culture of some cells over a 5 layer of agar, cultured as teratomas in an animal, otherwise grown in a three dimensional culture system but wherein said aggregated cells contain cells of different cell lineages, such as, by way of nonlimiting examples, the combination of epidermal keratinocytes and dermal fibroblasts, or the combination of parenchymal cells with their corresponding tissue stroma, or epithelial cells with mesenchymal cells. 10 The term "pluripotent stem cells" refers to animal cells capable of differentiating into more than one differentiated cell type. Such cells include hES cells, blastomere/morula cells and their derived hED cells, hiPS cells, hEG cells, hEC cells, and adult-derived cells including mesenchymal stem cells, neuronal stem cells, and bone marrow-derived stem cells. Pluripotent stem cells may be genetically modified or not genetically modified. Genetically modified cells may include markers 15 such as fluorescent proteins to facilitate their identification within the egg. The term "pooled clonal" refers to a population of cells obtained by combining two or more clonal populations to generate a population of cells with a uniformity of markers such as markers of gene expression, similar to a clonal population, but not a population wherein all the cells were derived from the same original clone. Said pooled clonal lines may include cells of a single or mixed 20 genotypes. Pooled clonal lines are especially useful in the cases where clonal lines differentiate relatively early or alter in an undesirable way early in their proliferative lifespan. The term "primordial stem cells" refers to animal cells capable of differentiating into more than one differentiated cell type. Such cells include hES cells, blastomere/morula cells and their derived hED cells, hiPS cells, hEG cells, hEC cells, and adult-derived cells including mesenchymal 25 stem cells, neuronal stem cells, and bone marrow-derived stem cells. Primordial stem cells may be genetically modified or not genetically modified. Genetically modified cells may include markers such as fluorescent proteins to facilitate their identification in vitro or in vivo. Before the present invention is described in greater detail, it is to be understood that this invention is not limited to particular embodiments described, as such may, of course, vary. It is also 30 to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention will be limited only by the appended claims. Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and 35 lower limit of that range and any other stated or intervening value in that stated range, is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges and are also encompassed within the invention, 8 WO 2011/150105 PCT/US2011/037969 subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention. Certain ranges are presented herein with numerical values being preceded by the term 5 "about." The term "about" is used herein to provide literal support for the exact number that it precedes, as well as a number that is near to or approximately the number that the term precedes. In determining whether a number is near to or approximately a specifically recited number, the near or approximating unrecited number may be a number which, in the context in which it is presented, provides the substantial equivalent of the specifically recited number. 10 Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present invention, representative illustrative methods and materials are now described. 15 All publications and patents cited in this specification are herein incorporated by reference as if each individual publication or patent were specifically and individually indicated to be incorporated by reference and are incorporated herein by reference to disclose and describe the methods and/or materials in connection with which the publications are cited. The citation of any publication is for its disclosure prior to the filing date and should not be construed as an admission 20 that the present invention is not entitled to antedate such publication by virtue of prior invention. Further, the dates of publication provided may be different from the actual publication dates which may need to be independently confirmed. It is noted that, as used herein and in the appended claims, the singular forms a "an", and "the" include plural referents unless the context clearly dictates otherwise. It is further noted that the 25 claims may be drafted to exclude any optional element. As such, this statement is intended to serve as antecedent basis for use of such exclusive terminology as "solely," "only" and the like in connection with the recitation of claim elements, or use of a "negative" limitation. As will be apparent to those of skill in the art upon reading this disclosure, each of the individual embodiments described and illustrated herein has discrete components and features which 30 may be readily separated from or combined with the features of any of the other several embodiments without departing from the scope or spirit of the present invention. Any recited method can be carried out in the order of events recited or in any other order which is logically possible. METHODS 35 In addition to the methods described below, methods that find use in the production and use of the cell lines described herein can be found in the following: U.S. Patent Publication 20080070303, entitled "Methods to accelerate the isolation of novel cell strains from pluripotent stem 9 WO 2011/150105 PCT/US2011/037969 cells and cells obtained thereby"; U.S. patent application Ser. No. 12/504,630 filed on July 16, 2009 and titled "Methods to Accelerate the Isolation of Novel Cell Strains from Pluripotent Stem Cells and Cells Obtained Thereby"; U.S. provisional application Ser. No. 61/226,237 filed on July 16, 2009 and titled "Methods and Compositions Useful for In Vitro and In Vivo Chondrogenesis Using 5 Embryonic Progenitor Cell Lines"; and PCT Application PCT/US2006/013519, filed on April 11, 2006, entitled "NOVEL USES OF CELLS WITH PRENATAL PATTERNS OF GENE EXPRESSION", each of which is incorporated by reference herein in its entirety. hES cell culture and generation of candidate cultures. 10 The hES cell lines used were previously described H9 (National Institutes of Health registered as WA09) and the line (MA03) derived at Advanced Cell Technology (West et al., 2008, Regenerative Medicine vol. 3(3) pp. 287-308). hES cells were routinely cultured in hES medium (KO-DMEM (Invitrogen, Carlsbad, CA), IX nonessential amino acids (Invitrogen, Carlsbad, CA), IX Glutamax-1 (Invitrogen, Carlsbad, CA), 55 uM beta-mercaptoethanol (Invitrogen, Carlsbad, CA), 15 8% Knock-Out Serum Replacement (Invitrogen, Carlsbad, CA), 8% Plasmanate, 10 ng/ml LIF (Millipore, Billerica, MA), 4 ng/ml bFGF (Millipore, Billerica, MA), 50 unit/ml Penicillin - 50 units/ml Streptomycin (Invitrogen, Carlsbad, CA). The hES cell lines were maintained at 37deg C in an atmosphere of 10% C02 and 5% 02 on Mitomycin-C treated mouse embryonic fibroblasts (MEFs) and passaged by trypsinization or periodic manual selection of colonies. For the production 20 of clonal embryonic progenitors, hES cells were plated at 500-10,000 cells per 15 cm dish and then differentiated under a two-step protocol, the first step being the differentiation of hES cells under an array of conditions to yield diverse heterogeneous cultures of cells called "candidate cultures." The generation of candidate cultures was performed with either adherent hES cells grown on MEFs (colony in situ differentiation) or with hES-derived embryoid bodies (EB). For colony in situ 25 differentiation experiments, hES cells were allowed to grow to confluence and differentiated by a variety of methods (as described in Supplementary Table I from West et al., 2008, Regenerative Medicine vol. 3(3) pp. 287-308, which is incorporated by reference herein in its entirety). By way of nonlimiting example, in the case of colony in situ differentiation in DMEM with 10% FCS, culture medium was aspirated from cultures of hES cell colonies on mouse feeders, and the media was 30 replaced with DMEM medium containing 10% FBS for differentiation and after various time periods (1, 2, 3, 4, 5, 7, and 9 days in differentiation medium). The cells were then dissociated with 0.25% trypsin (Invitrogen, Carlsbad, CA) and plated in 150 cm 2 flasks for expansion. The candidate cells from each time point in the 150 cm 2 flasks were plated out for cloning and expansion as described below. For EB differentiation experiments, confluent hES cultures were treated for 15 minutes at 37 35 deg C with 1 mg/ml Collagenase IV (in DMEM, Invitrogen, Carlsbad, CA) to release the colonies. The detached, intact colonies were scraped and collected by centrifugation (150xg for 5 minutes), resuspended in differentiation medium described in Supplementary Table I (from West et al., 2008, 10 WO 2011/150105 PCT/US2011/037969 Regenerative Medicine vol. 3(3) pp. 287-308, which is incorporated by reference herein in its entirety) and transferred to a single well of a 6-well Ultra-Low Binding plate (Corning, distributed by Fisher Scientific, Pittsburgh, PA) containing the same differentiation medium. The Ebs were allowed to differentiate, depending on the experiment, from 4-7 days and the differentiated Ebs dissociated 5 with 0.25% trypsin, plated in 6-well plates containing various expansion medium. The candidate cultures in the 6 well plates are allowed to grow to confluence and plated out for cloning and expansion as described below. Isolation and expansion of clonal cell lines. 10 The partially differentiated candidate cell cultures described above were dissociated with 0.25% trypsin to single cells and plated onto duplicate 15 cm gelatin coated plates at cloning densities of approximately 500 and/or 1,000 and/or 2,000 and/or 5,000 cells per plate for further differentiation and expansion in a variety of growth media shown in Supplementary Table I (from West et al., 2008, Regenerative Medicine vol. 3(3) pp. 287-308, which is incorporated by reference 15 herein in its entirety). The clonal density cells were allowed to grow, undisturbed, for 10-14 days and colonies that develop were identified and collected with cloning cylinders and trypsin using standard techniques. The cloned colonies were transferred onto gelatin-coated 24 well plates for expansion. As the clones become confluent in the 24 well plates (but without letting the cells remain confluent for more than 2 days), they were sequentially expanded to 12 well, 6 well, T-25 flask, T-75 flask, T 20 150 or T-225 flasks and, finally, roller bottles. Clonal cell lines that expand to the roller bottle stage are assigned a unique ACTC identification number, photographed and cryopreserved in aliquots for later use. Once cells reached a confluent 6 well dish, they were passaged to a T-25 flask and a fraction of the cells (5 x 105) were removed for plating in a gelatinized 6 cm dish for gene expression profile analysis. Alternatively, some cells were first passaged to T-225 flasks, then a fraction of the 25 cells (5 x 105) were removed for plating in a gelatinized 6 cm dish for gene expression profile analysis. The population doublings that the cells had undergone were therefore determined to be 18 21 PDs. Following removal of the cell clones from the cloning plates, remaining colonies were visualized by Crystal violet staining (Sigma HT9132-IL) in 100% ethanol per manufacturer's instructions. Cell Culture media utilized in experiments and described in text and Table III: Smooth 30 muscle cell basal medium (Cat# C-22062B) and growth supplement (Cat# C-39267), Skeletal muscle basal medium (Cat# C-22060B) and growth supplement (Cat# C-39365), Endothelial cell basal medium (Cat# C-22221) and growth supplement (Cat# C-39221), Melanocyte cell basal medium (Cat# C-24010B) and growth supplement (Cat# C-39415) were obtained from PromoCell GmbH (Heidelberg, Germany). Epi-Life, calcium free/phenol red free medium (Cat# M-EPIcf/PRF-500) and 35 low serum growth supplement (Cat# S-003-10) were purchased from Cascade Biologics (Portland, Oregon). Mesencult basal medium (Cat# 05041) and supplement (Cat# 5402) were obtained from Stem Cell Technologies (Vancouver, BC). Dulbecco's modified Eagle's medium (Cat# 11960-069) 11 WO 2011/150105 PCT/US2011/037969 and Fetal bovine serum (Cat# SH30070-03) were purchased from Invitrogen (Carlsbad, CA) and Hyclone (Logan, UT) respectively. Medium and supplements were combined according to manufacturer's instructions. 5 Clonal Embryonic Progenitor Line Nomenclature: The cell lines of the present invention along with their alternative designations are listed in Table VI along with synonyms that represent minor modifications that result from the manipulation of the names resulting from bioinformatics analysis, including the substitution of "-" for "." and vice versa, the inclusion of an "x" before cell line names beginning with an arabic number, and suffixes 10 such as "biol" or "bio2" that indicate biological replicates of the same line which are examples of cases where a frozen ampule of the same line was thawed, propagated, and used in a parallel analysis and "Rep1" or "Rep2" which indicate technical replicates wherein RNA isolated from a given cell line is utilized a second time for a repeat analysis without thawing or otherwise beginning with a new culture of cells. Passage number (which is the number of times the cells have been trypsinized and 15 replated) for the cell lines is usually designated by the letter "P" followed by an arabic number, and in contrast, the population doubling number (which refers to the number of estimated doublings the cell lines have undergone in clonal expansion from one cell) is designated by the letters "PD" followed by an arabic number. The number of PDs in a passage varied from experiment to experiment but generally each trypsinization and replating was at a 1:3 to 1:4 ratio (corresponding to 20 an increase of PDs of 1.5 and 2 respectively). In the expansion of clones, the original colonies were removed from tissue culture plates with cloning cylinders, and transferred to 24-well plates, then 12 well, and 6-well as described above. First confluent 24 well is designated P1, the first confluent 12 well culture is P2, the first 6-well culture is P3, then the six well culture was then split into a second 6 well plate (P4) and a T25 (P4). The second 6 well at P4 is utilized for RNA extraction (see U.S. 25 patent application Ser. No. 12/504,630 filed on July 16, 2009 and titled "Methods to Accelerate the Isolation of Novel Cell Strains from Pluripotent Stem Cells and Cells Obtained Thereby", incorporated herein by reference in its entirety) and represents about 18-21 PD of clonal expansion. Typical estimated subsequent passages and PDs are the following split to a T75 flask (19.5-22.5 PD), the P6 passage of the cells to a T225 flask (21-24 PD), then P7 being the transfer of the cells to a 30 roller bottle (850cm 2 , 23-26 PD), and P8 the split into 4 rollers (25-28 PD). The ranges shown above in parenthesis represent estimated ranges in cell counts due to cell sizes, attachment efficiency, and counting error. Propagation of Clonal, Pooled Clonal, Oligoclonal, and Pooled Oligoclonal Cell Lines. 35 Aspects of the invention provide methods for identifying and differentiating embryonic progenitor cell lines that are derived from a single cell (clonal) or cell lines that are "pooled clonal" meaning that cell lines cloned have indistinguishable markers, such as gene expression markers, and 12 WO 2011/150105 PCT/US2011/037969 are combined to produce a single cell culture often for the purpose of increasing the number of cells in a culture, or are oligoclonal wherein a line is produced from a small number, typically 2-1,000 similar cells and expanded as a cell line, or "pooled oligoclonal" lines which are lines produced by combining two or more oligoclonal cell lines that have indistinguishable markers such as patterns of 5 gene expression. Said clonal, pooled clonal, oligoclonal, or pooled oligoclonal cell lines are then propagated in vitro through removal of the cells from the substrate to which they are affixed, and the re-plating of the cells at a reduced density of typically 1/3 to 1/4 of the original number of cells, to facilitate further proliferation. Examples of said cell lines and their associated cell culture media is disclosed in U.S. patent application Ser. No. 12/504,630 filed on July 16, 2009 and titled "Methods 10 to Accelerate the Isolation of Novel Cell Strains from Pluripotent Stem Cells and Cells Obtained Thereby"; and West et al., 2008, Regenerative Medicine vol. 3(3) pp. 287-308, both of which aree incorporated herein by reference, including supplemental information. The compositions and methods of the present invention relate to said cell lines cultured as described but for greater than 21 doublings of clonal expansion. 15 Gene Expression Analysis To reduce variations in gene expression due to cell cycle artifacts, and to capture an early gene expression profile of the cells, upon being expanded to six well plates, on the day the cells reached confluence, the cells were placed in media with a reduction of serum to 0.5% in the case 20 where the original serum concentration was >5%. In all other cases, serum and/or other growth factors was reduced to 10% of their original values. These quiescence conditions were imposed for five days and all cultures were re-fed two days prior to harvest to reduce feeding difference artifacts. So, by way of example, if the original media was DMEM medium with 10% FCS, then the quiescence synchronization media was DMEM with 0.5% FCS. Total RNA was extracted directly 25 from cells growing in 6-well or 6 cm tissue culture plates using Qiagen Rneasy mini kits according to the manufacturer's instructions. RNA concentrations were measured using a Beckman DU530 or Nanodrop spectrophotometer and RNA quality determined by denaturing agarose gel electrophoresis or an Agilent 2100 bioanalyzer. Whole-genome expression analysis was carried out using Affymetrix Human Genome U133 Plus 2.0 GeneChip® system, Illumina Human-6 vI and HumanRef-8 vi 30 Beadchips (Illumina 1), and Illumina Human-6 v2 Beadchips (Illumina 2), and RNA levels for certain genes were confirmed by quantitative PCR. For Illumina BeadArrays, total RNA was linearly amplified and biotin-labeled using Illumina TotalPrep kits (Ambion), and cRNA was quality controlled using an Agilent 2100 Bioanalyzer. cRNA was hybridized to Illumina BeadChips, processed, and read using a BeadStation array reader according to the manufacturer's instructions 35 (Illumina). Relative Fluorescence Unit (RFU) values for all of the cell lines with common probe sets were quantile normalized. In Supplementary Tables II-IV (from West et al., 2008, Regenerative Medicine vol. 3(3) pp. 287-308, which are incorporated by reference herein in their entirety) the 13 WO 2011/150105 PCT/US2011/037969 genes are displayed in rank order (highest-lowest) for the ratio of (highest RFU value observed for the gene in the entire set of cell lines - Average RFU value)/Ave RFU value. In Supplementary Table V (from West et al., 2008, Regenerative Medicine vol. 3(3) pp. 287-308, which is incorporated by reference herein in its entirety) the top 45 differentially expressed genes rank ordered (highest 5 lowest) for the ratio of (highest RFU value observed for the gene in the individual cell line/Ave RFU value for all cell lines. In Supplementary Table VI (from West et al., 2008, Regenerative Medicine vol. 3(3) pp. 287-308, which is incorporated by reference herein in its entirety) the genes corresponding to recognized CD antigens are displayed in rank order (highest-lowest) and also (lowest to highest) for the ratio of highest RFU value observed for the gene in the entire set of cell 10 lines/Ave RFU value and lowest RFU value observed for the gene in the entire set of cell lines/Ave RFU value respectively. In Supplementary Table VII (from West et al., 2008, Regenerative Medicine vol. 3(3) pp. 287-308, which is incorporated by reference herein in its entirety) the genes corresponding to secreted proteins are displayed in rank order (highest-lowest) for the ratio of highest RFU value observed for the gene in the entire set of cell lines/Ave RFU value. 15 Low Throughput Screening and qPCR The clonal, oligoclonal, or pooled clonal or pooled oligoclonal embryonic progenitor cell lines of the present invention at either <21 or preferably >21 doublings of clonal or oligoclonal expansion, most preferably at 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 20 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, or 70 doublings of clonal expansion (since before 29 doublings of clonal expansion the cells are available only in limited quantities, and beyond 70 doublings the cells normally approach senescence) are screened simultaneously in 1, 2, 3, 4, 5, or preferably 10 or more diverse differentiation conditions. Said differentiation conditions may include without limitation, all combinations of the human embryonic 25 progenitor cell lines listed in Table I (showing gene expression markers at 18-21 doublings of clonal expansion), together with culture conditions as listed in Table II, exposed to the culture media listed in Table III, and supplemented factors listed in Table IV. The cells are cultured in said differentiation conditions for 1-6 weeks, most preferably two to four weeks. The readout of the assay can be mRNA markers of differentiation such as those listed in 30 Table V and measured by hybridization to arrayed target sequences, including but not limited to microarrays or by PCR. Detection can also be at the level of peptides or proteins that may be detected through the use of specific antibodies, through the use of enzyme assays, mass spectroscopy, or other similar means well known in the art. In the case of qPCR, protocols may vary and are well-known in the art. By way of 35 nonlimiting example, samples for testing are prepared in standard Optical 96-well reaction plates (Applied Biosystems Carlsbad, CA, PN 4306737) consisting of 30ng of RNA equivalent of cDNA, 0.4uM per primer, Ultra-Pure distilled water (Invitrogen), diluted 1:1 with 12.5ul of Power SYBR 14 WO 2011/150105 PCT/US2011/037969 Green PCR Master Mix (Applied Biosystems Carlsbad, CA, Cat# 4367659) incorporating AmpliTaq Gold DNA polymerase in a total reaction volume of 25ul. Real-Time qPCR is run using Applied Biosystems 7500 Real-Time PCR System employing SDSv1.2 software. Amplification conditions are set at 50'C for 2 min. (stage 1), 95'C for 10 min. (stage 2), 40 cycles of 95'C for 15 see then 5 60'C for 1 min (stage 3), with a dissociation stage at 95'C for 15 sec, 60'C for 1 min, and 95'C for 15 sec (stage 4). Ct values for amplification products of genes of interest are normalized to the average Ct value of 3 housekeeping genes (GAPD, RPS 10, and GUSB). Medium Throughput Screen of the Fate Space of Clonal or Oligoclonal Embryonic Progenitors. 10 The clonal, oligoclonal, or pooled clonal or pooled oligoclonal embryonic progenitor cell lines of the present invention at either <21 or preferably >21 doublings of clonal or oligoclonal expansion, most preferably at 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, or 70 doublings of clonal expansion (since before 29 doublings of clonal expansion the cells are available only in 15 limited quantities, and beyond 70 doublings the cells normally approach senescence) are screened simultaneously in 10, 20, 30, 40, 50, or preferably 100 or more diverse differentiation conditions. Said differentiation conditions may include without limitation, all combinations of the human embryonic progenitor cell lines listed in Table I (showing gene expression markers at 18-21 doublings of clonal expansion), together with culture conditions as listed in Table II, exposed to the 20 culture media listed in Table III, and supplemented factors listed in Table IV. The cells are cultured in said differentiation conditions for 1-6 weeks, most preferably four weeks. The readout of the assay can be mRNA markers of differentiation such as those listed in Table V and measured by hybridization to arrayed target sequences, including but not limited to microarrays or PCR. Detection can also be at the level of peptides or proteins that may be detected 25 through the use of specific antibodies, through the use of enzyme assays, mass spectroscopy, or other similar means well known in the art. Medium Throughput qPCR Screen of hEP Cell Differentiation The clonal, oligoclonal, or pooled clonal or pooled oligoclonal embryonic progenitor cell 30 lines of the present invention, including but not limited to those shown in Table I, at either <21 or preferably >21 doublings of clonal or oligoclonal expansion, most preferably at 29, 30, 31, 32, 33, 34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60, 61, 62, 63, 64, 65, 66, 67, 68, 69, or 70 doublings of clonal expansion are plated in 6 well culture plates with each well having 10 micromasses of 250,000 cells (i.e. 2.5 million cells per well). 35 Alternatively the cells are treated with other culture conditions as listed in Table II using the same number of cells, exposed to any combination of the culture media listed in Table III, and 15 WO 2011/150105 PCT/US2011/037969 supplemented factors listed in Table IV or detailed protocols listed in Table VIII. The cells are cultured in said differentiation conditions for 1-6 weeks, most preferably four weeks. RNA is prepared from cell lysates using the Rneasy mini kits (Qiagen) according to the manufacturer's instructions. Briefly, cell cultures (micromasses) are rinsed in PBS, then lysed in a 5 minimal volume of the RLT lysis buffer. After incubation on ice, the cell debris is removed by centrifugation and the lysate is mixed with RLT buffer, after which ethanol is added to the mixture. The combined mixture is then loaded onto the Rneasy spin column and centrifuged; the loaded column is then washed and the purified RNA is released from the column with a minimal volume of DEPC-treated water (typically 30 ul or less). The concentration of RNA in the final eluate is 10 determined by absorbance at 260 nm. cDNA synthesis is performed using the SuperScript First Strand cDNA kit (InVitrogen; Carlsbad, CA). Briefly, 2.5 ug of purified RNA is heat denatured in the presence of random hexamers. After cooling, the first strand reaction is completed using SuperSript reverse transcriptase enzyme and associated reagents from the kit. The resulting product is further purified using 15 QlAquick PCR Purification kits (Qiagen) according to the manufacturer's instructions. Briefly, PB buffer is added to the first strand cDNA reaction products, then the mixture is loaded onto the QlAquick spin column and centrifuged. The column is washed with PE buffer and the purified cDNA is eluted from the column using a minimal volume of water (20 ul). qPCR primer pairs are synthesized for each target gene. Briefly, primer pairs for a target 20 gene are designed to amplify only the target mRNA sequence and optimally have annealing temperatures for their target sequences that lie in the range of 65-80 'C and unique amplification products in the size range of 100-500 bp. Primer pairs are supplied at working concentrations (10 uM) to BioTrove, Inc. (Woburn, MA) for production of a custom qPCR Open Array plate. OpenArray plates are designed to accommodate 56-336 primer pairs and the final manufactured plate 25 with dried down primer pairs is provided to the service provider. Purified cDNA reaction products (2.) and Syber green master mix are loaded into individual wells of the OpenArray plate using OpenArray autolader device (BioTrove). The plate is sealed and the qPCR and loaded into the NT Imager/Cycler device (BioTrove) for amplification. Ct values for each sample are calculated using the OpenArray application software. 30 Markers of differentiation are not those present in embryonic progenitor cell lines, but are present in later stages of differentiation. It is not obvious to what an effective array of such markers would be. For example, COL2A1 is not expressed in the clonal embryonic progenitor cell lines, but is markedly induced >100-fold in a subset of the cell lines of the present invention. Previous attempts to invent an array of differentiation markers were not useful in the context of the present invention 35 because they included a majority of markers that were expressed in both embryonic progenitor cell types and in terminally-differentiated cell types (Luo, Y., Cai, J., Ginis, I., Sun, Y., Lee, S., Yu, S.X., Hoke, A., and Rao, M. 2003. Designing, testing, and validating a focused stem cell microarray for 16 WO 2011/150105 PCT/US2011/037969 characterization of neural stem cells and progenitor cells. Stem Cells, 21:575-587). An example of a list of said markers useful in determining that a particular differentiation condition induced terminal differentiation in embryonic progenitor cell lines a majority of which are not expressed in embryonic progenitor cell lines are shown in Table VI. 5 Isolation of secreted or extracellular matrix proteins Secreted Protein Isolation Protocol 1 - Conditioned medium Cells were grown in either their normal propagation medium (West et al., 2008, Regen Med vol. 3(3) pp. 287-308) or the differentiation conditions described herein. To obtain conditioned medium on a 10 smaller scale (typically 1-2 L or less), the cells were grown in monolayer cultures in T150, T175 or T225 flasks (Corning or BD Falcon) in a 37 0 C incubator with 10% CO 2 atmosphere. For larger volume medium collections, the cells were typically grown either in 2 L roller bottles, on microcarrier suspensions (porous such as Cytodex varieties from Sigma-Aldrich, St. Louis, MO, or non-porous such as from SoloHill Engineering, Ann Arbor, MI) in spinner flasks or other bioreactors, or in hollow fiber cartridge 15 bioreactors (GE Healthcare, Piscataway, NJ). Prior to conditioned medium collection, the cultures were rinsed twice with PBS and then incubated for 2 hours at 37 0 C in the presence of serum-free medium wherein the medium is the same basal medium as described herein for the propagation or differentiation of the cells, in order to remove fetal serum proteins. The serum-free medium was then removed and replaced with fresh medium, followed by continued as described herein at 37 0 C for 24-48 hours. 20 The culture-conditioned medium was then collected by separation from the cell-bound vessel surface or matrix (e.g., by pouring off directly or after sedimentation) and processed further for secreted protein concentration, enrichment or purification. As deemed appropriate for the collection volume, the culture medium was first centrifuged at 500 to 10,000 xg to remove residual cells and cellular debris in 15 or 50 ml centrifuge tubes or 250 ml bottles. It was then passaged through successive 1 Pm or 0.45 Pm 25 and 0.2 pm filter units (Coming) to remove additional debris, and then concentrated using 10,000 MW cutoff ultrafiltration in a stirred cell or Centricon centrifuge filter (Amicon-Millipore) for smaller volumes, or using a tangential flow ultrafiltration unit (Amicon-Millipore) for larger volumes. The retained protein concentrate was then dialyzed into an appropriate buffer for subsequent purification of specific proteins, and further purified using a combination of isoelectric focusing, size exclusion 30 chromatography, ion exchange chromatography, hydrophobic or reverse phase chromatography, antibody affinity chromatography or other well-known methods appropriate for the specific proteins. During the various steps in the purification process, collection fractions were tested for the presence and quantity of the specific secreted protein by ELISA (e.g., using BMP-2 or BMP-7 ELISA kits from R&D Systems, Minneapolis, MN). The purified proteins were then kept in solution or lyophilized and then stored at 4 or 35 minus 20-80'C. 17 WO 2011/150105 PCT/US2011/037969 Secreted Protein Isolation Protocol 2 - Urea-mediated protein extraction In the case of some secreted proteins, interactions with the cell or ECM components may reduce the simple diffusion of factors into the medium as described above in Secreted Protein Isolation Protocol 1. A simple comparison of the yield in the two protocols will suffice to determine 5 which protocol provides the highest yield of the desired factors. In the case of Secreted Protein Isolation Protocol 2, a low concentration of urea is added to facilitate the removal of factors. In the case of the examples provided, all urea extractions were performed two days subsequent to feeding. On the second day, cell monolayers in T-150 cell culture flasks were rinsed twice with CMF-PBS and then incubated for two hours at 37 0 C in the presence of serum-free medium. The rinse with 10 CMF-PBS and the incubation in serum-free medium together aid in the removal of fetal serum proteins from the surface of the cells. The serum-free medium was then removed and 10 ml /T150 of freshly made 200 mM urea in CMF-PBS was added. The flasks were then placed on a rocker at 37 0 C. for 6.0 hours. The urea solution was then removed and immediately frozen at -70 0 C. 15 Extracellular Matrix Isolation Protocol 1 - DOC-Mediated Preparation Extracellular matrix proteins can be extracted using the method of Hedman et al, 1979 (Isolation of the pericellular matrix of human fibroblast cultures. J. Cell Biol. 81: 83-91). Cell layers are rinsed three times with CMF-PBS buffer at ambient temperature and then washed with 30 mL of 0.5% sodium deoxycholate (DOC), 1 mM phenylmethylsulfonylfluride (PMSF, from 0.4M solution 20 in EtOH), CMF-PBS buffer 3 X 10 min. on ice while on a rocking platform. The flasks were then washed in the same manner with 2mM Tris-HCI, pH 8.0 and 1 mM PMSF 3 X 5 min. The protein remaining attached to the flask was then removed in 2 mL of gel loading buffer with a rubber policeman. 25 Screening of secreted or extracellular matrix proteins for biological activity The cell lines of the present invention are also useful as a means of screening diverse embryonic secretomes for varied biological activities. The cell lines of the present invention cultured at 18-21 doublings of clonal expansion express a wide array of secreted soluble and extracellular matrix genes (see US Patent Application Publication 2010/0184033 entitled "METHODS TO 30 ACCELERATE THE ISOLATION OF NOVEL CELL STRAINS FROM PLURIPOTENT STEM CELLS AND CELLS OBTAINED THEREBY" filed on July 16, 2009, incorporated herein by reference). At 21 or more doublings of clonal expansion, the cells of the present invention differentially express secreted soluble and extracellular matrix genes shown in Table IX. These proteins, proteoglycans, cytokines, and growth factors may be harvested from the cell lines of the 35 present invention by various techniques known in the art including but not limited to Secreted Protein Isolation Protocol 1 or 2. These pools of secreted and extracellular matrix proteins may be further purified or used as mixtures of factors and used in varied in vitro or in vivo assays of biological 18 WO 2011/150105 PCT/US2011/037969 activity as is known in the art. Applications The disclosed methods for the culture of animal cells and tissues are useful in generating 5 cells or progeny thereof in mammalian and human cell therapy, such as, but not limited to, generating human cells useful in treating dermatological, retinal, cardiac, neurological, endocrinological, muscular, skeletal, articular, hepatic, neurological, renal, gastrointestinal, pulmonary, and blood and vascular cell disorders in humans and nonhuman animals. In certain embodiments of the invention, single cell-derived and oligoclonal cell-derived 10 cells derived by methods of this invention, are utilized in research and treatment of disorders relating to cell biology, cell-based drug discovery and in cell therapy. The single cell-derived cell populations derived using the methods of the present invention may already have received the requisite signals to be directed down a differentiation pathway. For example, some paraxial or somatopleuric single cell-derived populations of cells may express genes consistent with dermal 15 fibroblast gene expression, in particular, a prenatal pattern of gene expression useful in promoting scarless wound repair and in promoting elastogenesis. Such cells include, for example, including but not limited to: cells of the heart; cells of the musculo-skeletal system; cells of the nervous tissue; cells of the respiratory system; cells of the endocrine system including preadipocytes or adipocytes including but not limited to cutaneous white and brown preadipocytes or adipocytes capable of 20 causing weight loss, increasing insulin sensitivity, lowering blood glucose, and thereby reducing the risk of vascular disease a other symptoms of Type II diabetes, in a human or nonhuman mammal; cells of the vascular system; cells of the hematopoietic system; cells of the integumentary system; cells of the urinary system; cells of the joint such as articular chondrocytes, tendons, synovial membrane, and meniscus; or cells of the gastrointestinal system. Such cells may be stably grafted in 25 a histocompatible host when the cells are grafted into the tissue into which the cells would normally differentiate. Such tissues include, but are not limited to: endoderm-embryonic tissues; mesoderm embryonic tissues; ectoderm-embryonic tissues; or extraembryonic cells. In certain embodiments of the invention, single cell-derived and oligoclonal cell-derived cells are introduced into the tissues in which they normally reside in order to exhibit therapeutic 30 utility. In certain embodiments of the invention, single cell-derived and oligoclonal cell-derived cells, derived by methods of this invention, are utilized in inducing the differentiation of other pluripotent stem cells. The generation of single cell-derived populations of cells capable of being propagated in vitro while maintaining an embryonic pattern of gene expression is useful in inducing the differentiation of other pluripotent stem cells. Cell-cell induction is a common means of directing 35 differentiation in the early embryo. Many potentially medically-useful cell types are influenced by inductive signals during normal embryonic development, including spinal cord neurons, cardiac cells, pancreatic beta cells, and definitive hematopoietic cells. Single cell-derived populations of cells 19 WO 2011/150105 PCT/US2011/037969 capable of being propagated in vitro while maintaining an embryonic pattern of gene expression can be cultured in a variety of in vitro, in ovo, or in vivo culture conditions to induce the differentiation of other pluripotent stem cells to become desired cell or tissue types. Induction may be carried out in a variety of methods that juxtapose the inducer cell with the target cell. By way of nonlimiting 5 examples, the inducer cells may be plated in tissue culture and treated with mitomycin C or radiation to prevent the cells from replicating further. The target cells are then plated on top of the mitotically inactivated inducer cells. Alternatively, single cell-derived inducer cells may be cultured on a removable membrane from a larger culture of cells or from an original single cell-derived colony and the target cells may be plated on top of the inducer cells or a separate membrane covered with target 10 cells may be juxtaposed so as to sandwich the two cell layers in direct contact. The resulting bilayer of cells may be cultured in vitro, transplanted into a SPF avian egg, or cultured in conditions to allow growth in three dimensions while being provided vascular support (see, for example, international patent publication number WO/2005/068610, published July 28, 2005, the disclosure of which is hereby incorporated by reference). The inducer cells may also be from a source of pluripotent stem 15 cells, including hES or hED cells, in which a suicide construct has been introduced such that the inducer cells can be removed at will. Cell types useful in single cell-derived and oligoclonal cell derived induction may include cases of induction well known in the art to occur naturally in normal embryonic development. In certain embodiments of the invention, single cell-derived cells and oligoclonal cell-derived cells, derived by methods of this invention, are used as "feeder cells" to 20 support the growth of other cell types, including pluripotent stem cells. The use of single cell derived cells and oligoclonal cell-derived cells of the present invention as feeder cells alleviates the potential risk of transmitting pathogens from feeder cells derived from other mammalian sources to the target cells. The feeder cells may be inactivated, for example, by gamma ray irradiation or by treatment with mitomycin C, to limit replication and then co-cultured with the pluripotent stem cells. 25 In certain embodiments of the invention, the extracellular matrix (ECM) of single cell derived and oligoclonal cell-derived cells, derived by methods of this invention, may be used to support less differentiated cells (see Stojkovic et al., Stem Cells (2005) 23(3):306-14). Certain cell types that normally require a feeder layer can be supported in feeder-free culture on a matrix (Rosler et al., Dev Dyn. (2004) 229(2):259-74). The matrix can be deposited by preculturing and lysing a 30 matrix-forming cell line (see WO 99/20741), such as the STO mouse fibroblast line (ATCC Accession No. CRL-1503), or human placental fibroblasts. In certain embodiments of the invention, the conditioned media of single cell-derived and oligoclonal cell-derived cell cultures may be collected, pooled, filtered and stored as conditioned medium. This conditioned medium may be formulated and used for research and therapy. Such 35 conditioned medium may contribute to maintaining a less differentiated state and allow propagation of cells such as pluripotent stem cells. In certain embodiments of the invention, conditioned medium of single cell-derived and oligoclonal cell-derived cell cultures derived by the methods of this 20 WO 2011/150105 PCT/US2011/037969 invention can be used to induce differentiation of other cell types, including pluripotent stem cells. The use of conditioned medium of single cell-derived and oligoclonal cell-derived cell cultures may be advantageous in reducing the potential risk of exposing cultured cells to non-human animal pathogens derived from other mammalian sources (i.e. xenogeneic free). 5 In another embodiment of the invention, single cell-derived and oligoclonal cell-derived paraxial mesoderm, neural crest mesenchyme, or somatopleuric mesoderm, derived by methods of this invention, can be used to induce embryonic ectoderm or single cell-derived embryonic ectoderm into keratinocytes for use in skin research and grafting for burns, wound repair, and drug discovery. In another embodiment of the invention, the use of single cell-derived and oligoclonal cell-derived 10 prechordal plate mesoderm, derived by methods of this invention, to induce embryonic ectoderm or single cell-derived or oligoclonal cell-derived embryonic ectoderm into neuroectodermal cells capable of generating CNS cells, may be useful in neuron research and grafting for neurodegenerative diseases, as well as drug discovery. The single cell-derived and oligoclonal cell derived prechordal plate mesoderm can be identified by transcript analysis as described herein 15 through the expression of, for example, lim-1. In another embodiment of the invention, the single cell-derived and oligoclonal cell-derived notochord mesodermal cells, derived by methods of this invention, are identified by their expression of brachyury. In normal development, notochordal cells induce the floor of the neural plate mesoderm (which induces the spinal chord) to make sonic hedgehog ("SHH"), a ventralizing signal, that induces the floor of the neural tube to express SHH as 20 well, which induces the expression of FP1, FP2, and SCI by the floor plate of the neural tube. Therefore, notochordal mesodermal cells can be used to induce neural plate ectodermal cells or neural tube neuroepithelial cells to differentiate into spinal cord neurons. Such neurons may be identified and confirmed by assaying the gene expression assays described herein for cells expressing FP1, FP2, or SC1. These cells expressing one or more of these markers could be useful in spinal 25 cord regeneration. Our discovery that various single cell-derived and oligoclonal cell-derived cells in early embryonic lineages may be propagated without the loss of their embryonic phenotype allows numerous types of mesodermal inducer cells to induce differentiation in embryonic ectoderm or endoderm. However, single cell-derived and oligoclonal cell-derived cells from endoderm and 30 ectodermal lineages, derived by methods of this invention, may be useful in induction as well. For example, surface ectoderm and notochord express Shh and thereby induce somites to become sclerotome mesodermal cells that express M-twist and Pax-] and surface ectoderm. Also, as another example, notochord expresses extracellular proteins of the Wnt family and thereby induces other somite mesodermal cells to become dermatome mesodermal cells that express gMHox, and dermo-1. 35 The juxtaposition of the inducer and target cells provides a useful in vitro model of differentiation that can be used for research into early embryonic differentiation, for drug screening, and for studies 21 WO 2011/150105 PCT/US2011/037969 of teratology. The target cells differentiated by the single cell-derived inducer cells may also be used for research, drug discovery, and cell-based therapy. In certain embodiments of the invention, the single cell-derived and oligoclonal cell-derived cells, derived by methods of this invention, may be used to generate skin equivalents, as well as to 5 reconstitute full-thickness human skin, according to the methods described in U.S. application nos. 09/037,191, filed March 9, 1998 (U.S. publication no. 2001/0048917, published December 6, 2001); 10/013124, filed December 7, 2001 (U.S. publication no. 2002/0120950, published August 29, 2002); 10/982,186, filed November 5, 2004 (U.S. publication no. 2005/0118146, published June 2, 2005); the disclosure of each of which is incorporated herein by reference. For example, the single 10 cell-derived and oligoclonal cell-derived cells may be incorporated into a layered cell sorted tissue that includes a discrete first cell layer and a discrete second cell layer that are formed in vitro by the spontaneous sorting of cells from a homogenous cell mixture. The first cell layer may include any cell type, but preferably includes epithelial cells, in particular, keratinocytes. Other cell types that may be used in the first cell layer are CaCo2 cells, A431 cells, and HUC18 cells. The second cell 15 layer may also include cells of any type, but preferably includes mesenchymal cells, in particular, fibroblasts. The layered cell sorted tissue possesses an epidermal-dermal junction that is substantially similar in structure and function to its native counterpart. That is, the tissue expresses the necessary integral proteins such as hemidesmosomes and collagen I, collagen IV, and collagen VII, to attach the epidermal and dermal layers with the proper basement membrane morphology. The 20 single cell-derived and oligoclonal cell-derived cells may then sort to form an epidermal layer that contacts the connective tissue component. The layered cell sorted tissues comprising the single cell derived and oligoclonal cell-derived cells may be used as a skin graft that could be used on graft sites such as traumatic wounds and burn injury. In another embodiment of the invention, single cell-derived and oligoclonal cell-derived cells 25 of this invention may be used as a means to identify and characterize genes that are transcriptionally activated or repressed as the cells undergo differentiation. For example, libraries of gene trap single cell-derived or oligoclonal cell-derived cells may be made by methods of this invention, and assayed to detect changes in the level of expression of the gene trap markers as the cells differentiate in vitro and in vivo. The methods for making gene trap cells and for detecting changes in the expression of 30 the gene trap markers as the cells differentiate are reviewed in Durick et al. (Genome Res. (1999) 9:1019-25), the disclosure of which is incorporated herein by reference). The vectors and methods useful for making gene trap cells and for detecting changes in the expression of the gene trap markers as the cells differentiate are also described in U.S. pat. no. 5,922,601 (Baetscher et al.), U.S. pat. no. 6,248,934 (Tessier-Lavigne) and in U.S. patent publication No. 2004/0219563 (West et al.), the 35 disclosures of which are also incorporated herein by reference. Methods for genetically modifying cells, inducing their differentiation in vitro, and using them to generate chimeric or nuclear-transfer cloned embryos and cloned mice are developed and known in the art. To facilitate the identification 22 WO 2011/150105 PCT/US2011/037969 of genes and the characterization of their physiological activities, large libraries of gene trap cells having gene trap DNA markers randomly inserted in their genomes may be prepared. Efficient methods have been developed to screen and detect changes in the level of expression of the gene trap markers as the cells differentiate in vitro or in vivo. In vivo methods for inducing single cell-derived 5 or oligoclonal cell-derived cells to differentiate further include injecting one or more cells into a blastocyst to form a chimeric embryo that is allowed to develop; fusing a stem cell with an enucleated oocyte to form a nuclear transfer unit (NTU), and culturing the NTU under conditions that result in generation of an embryo that is allowed to develop; and implanting one or more clonogenic differentiated cells into an immune-compromised or a histocompatible host animal (e.g., a SCID 10 mouse, or a syngeneic nuclear donor) and allowing teratomas comprising differentiated cells to form. In vitro methods for inducing single cell-derived or oligoclonal cell-derived cells to differentiate further include culturing the cells in a monolayer, in suspension, or in three-dimensional matrices, alone or in co-culture with cells of a different type, and exposing them to one of many combinations of chemical, biological, and physical agents, including co-culture with one or more different types of 15 cells, that are known to capable of induce or allow differentiation. In another embodiment of the invention, cell types that do not proliferate well under any known cell culture conditions may be induced to proliferate such that they can be isolated clonally or oligoclonally according to the methods of this invention through the regulated expression of factors that overcome inhibition of the cell cycle, such as regulated expression of SV40 virus large T-antigen 20 (Tag), or regulated Ela and/or Elb, or papillomavirus E6 and/or E7, or CDK4 (see, e.g., U.S. patent application Ser. No. 11/604,047 filed on November 21, 2006 and titled "Methods to Accelerate the Isolation of Novel Cell Strains from Pluripotent Stem Cells and Cells Obtained Thereby", incorporated herein by reference). In another embodiment of the invention, the factors that override cell cycle arrest may be 25 fused with additional proteins or protein domains and delivered to the cells. For example, factors that override cell cycle arrest may be joined to a protein transduction domain (PTD). Protein transduction domains, covalently or non-covalently linked to factors that override cell cycle arrest, allow the translocation of said factors across the cell membranes so the protein may ultimately reach the nuclear compartments of the cells. PTDs that may be fused with factors that override cell cycle arrest 30 include the PTD of the HIV transactivating protein (TAT) (Tat 47-57) (Schwarze and Dowdy 2000 Trends Pharmacol. Sci. 21: 45-48; Krosl et al. 2003 Nature Medicine (9): 1428-1432). For the HIV TAT protein, the amino acid sequence conferring membrane translocation activity corresponds to residues 47-57 (Ho et al., 2001, Cancer Research 61: 473-477; Vives et al., 1997, J. Biol. Chem. 272: 16010-16017). These residues alone can confer protein translocation activity. 35 In another embodiment of the invention, the PTD and the cycle cycle arrest factor may be conjugated via a linker. The exact length and sequence of the linker and its orientation relative to the 23 WO 2011/150105 PCT/US2011/037969 linked sequences may vary. The linker may comprise, for example, 2, 10, 20, 30, or more amino acids and may be selected based on desired properties such as solubility, length, steric separation, etc. In particular embodiments, the linker may comprise a functional sequence useful for the purification, detection, or modification, for example, of the fusion protein. 5 In another embodiment of the invention, single cell-derived or oligoclonal cell-derived cells of this invention may be reprogrammed to an undifferentiated state through novel reprogranmming technique, as described in U.S. application no. 60/705,625, filed August 3, 2005, U.S. application no. 60/729,173, filed October 20, 2005; U.S. application no. 60/818,813, filed July 5, 2006, the disclosures of which are incorporated herein by reference. Briefly, the cells may reprogrammed to an 10 undifferentiated state using at least a two, preferably three-step process involving a first nuclear remodeling step, a second cellular reconstitution step, and finally, a third step in which the resulting colonies of cells arising from step two are characterized for the extent of reprogramming and for the normality of the karyotype and quality. In certain embodiments, the single cell-derived or oligoclonal cell-derived cells of this invention may be reprogrammed in the first nuclear remodeling 15 step of the reprogramming process by remodeling the nuclear envelope and the chromatin of a differentiated cell to more closely resemble the molecular composition of an undifferentiated or a germ-line cell. In the second cellular reconstitution step of the reprogramming process, the nucleus, containing the remodeled nuclear envelope of step one, is then fused with a cytoplasmic bleb containing requisite mitotic apparatus which is capable, together with the transferred nucleus, of 20 producing a population of undifferentiated stem cells such as ES or ED-like cells capable of proliferation. In the third step of the reprogramming process, colonies of cells arising from one or a number of cells resulting from step two are characterized for the extent of reprogramming and for the normality of the karyotype and colonies of a high quality are selected. While this third step is not required to successfully reprogram cells and is not necessary in some applications, the inclusion of 25 the third quality control step is preferred when reprogrammed cells are used in certain applications such as human transplantation. Finally, colonies of reprogrammed cells that have a normal karyotype but not sufficient degree of programming may be recycled by repeating steps one and two or steps one through three. In another embodiment of the invention, the single cell-derived and oligoclonal cell-derived 30 cells may be used to generate ligands using phage display technology (see U.S. application no. 60/685,758, filed May 27, 2005, and PCT US2006/020552, filed May 26, 2006, the disclosures of which are hereby incorporated by reference). In another embodiment of the invention, the single cell-derived or oligoclonal cell-derived cells of this invention may exhibit unique patterns of gene expression such as high levels of factors, 35 e.g. secreted factors, that promote the development or formation of specific tissue types either in vitro or in vivo (e.g., angiogenic factors, neurotrophic factors, etc). Such cells may be useful for the delivery of these factors to tissues to promote the formation of specific cell/tissue types where those 24 WO 2011/150105 PCT/US2011/037969 cells/tissues are therapeutic. For example, in the case of the angiogenic factors, cell lines that express high levels of such factors including VEGFA, B, C, or D or angiopoietin- 1 or -2 can be transplanted using delivery technologies appropriate to the target tissue to deliver cells that express said angiogenic factor(s) to induce angiogenesis for therapeutic effect. In another embodiment of the 5 invention, cells may produce large quantities of PTN (Accession number NM_002825.5), MDK (Accession number NM_002391.2), or ANGPT2 (Accession number NM_001147.1), or other angiogenesis factors and therefore may be useful in inducing angiogenesis when injected in vivo as cell therapy, when mitotically inactivated and then injected in vivo, or when combined with a matrix in either a mitotically-inactivated or native state for use in inducing angiogenesis. PTN-producing 10 cells described in the present invention are also useful when implanted in vivo in either a native or mitotically-inactivated state for delivering neuro-active factors, such as in preventing the apoptosis of neurons following injury to said neurons. As another example, a cell produced by the methods of this invention could produce large amounts of BMP2, BMP7, BMP3b or other members of the BMP family, and this cell could 15 therefore be useful in inducing bone formation (as described below). The expression of genes of the cells of this invention may be determined. Measurement of the gene expression levels may be performed by any known methods in the art, including but not limited to, microarray gene expression analysis, bead array gene expression analysis and Northern analysis. The gene expression levels may be represented as relative expression normalized to the 20 ADPRT (Accession number NM_001618.2), GAPD (Accession number NM_002046.2), or other housekeeping genes known in the art. The gene expression data may also be normalized by a median of medians method. In this method, each array gives a different total intensity. Using the median value is a robust way of comparing cell lines (arrays) in an experiment. As an example, the median was found for each cell line and then the median of those medians became the value for 25 normalization. The signal from the each cell line was made relative to each of the other cell lines. Based on the gene expression levels, one would expect the expression of the corresponding proteins by the cells of the invention. For example, in the case of cell clone ACTC60 (or B-28) of Series 1, relatively high levels of DKK1, VEGFC and ILIRI were observed. Therefore, the ability to measure the bioactive or growth factors produced by said cells may be useful in research and in the treatment 30 of disease. In the case of neutrophic factors, the cells made by the methods of this invention may be used to induce the innervation of tissue such as to improve the sensory innervation of the skin in wound repair or regeneration, or other sensory or motor innervation. For example, the cell clone number 1 (ACTC61/B30) displays a high level of expression of pleiotrophin (PTN) and may 35 therefore be formulated for this use using delivery and formulation technologies well known in the art including by way of nonlimiting example, humans and veterinary animal applications where the dosage will be between 102 - 106 cells and the formulation can be, by way of nonlimiting example, a 25 WO 2011/150105 PCT/US2011/037969 cell suspension in isosmotic buffer or a monolayer of cells attached to an layer of extracellular matrix such as contracted gelatin. Such use of cells that promote angiogenesis or neurite outgrowth may further be combined with an adjunct therapy that includes young hemangioblasts or angioblasts in the case of angiogenesis or neuronal precursors of various kinds in the case of neurite outgrowth. Such 5 combined therapy may have particular utility where the mere administration of angiogenic factors or neurite outgrowth promoting factors by themselves are not sufficient to generate a response due to the fact that there is a paucity of cells capable of responding to the stimulus. In the case of angiogenesis, the senescence of the vascular endothelium or circulating endothelial precursor cells such as hemangioblasts may blunt the response to angiogenic stimulus. 10 The co-administration of young hemangioblasts by various modalities known in the art based on the size of the animal and the target tissue along with cells capable of delivering an angiogenic stimulus will provide an improved angiogenic response. Such an induction of angiogenesis can be useful in promoting wound healing, the vascularization of tissues prone to ischemia such as aged myocardium, skeletal, or smooth muscle, skin (as in the case of nonhealing skin ulcers such as decubitus or stasis 15 ulcers), intestine, kidney, liver, bone, or brain. Measurement of the gene expression levels may be performed by any known methods in the art, including but not limited to, microarray gene expression analysis, bead array gene expression analysis and Northern analysis. The gene expression levels may be represented as relative expression normalized to the ADPRT (Accession number NM_001618.2), GAPD (Accession number NM_002046.2), or other housekeeping genes known in the art. The gene 20 expression data may also be normalized by a median of medians method. In this method, each array gives a different total intensity. Using the median value is a robust way of comparing cell lines (arrays) in an experiment. As an example, the median was found for each cell line and then the median of those medians became the value for normalization. The signal from the each cell line was made relative to each of the other cell lines. 25 In another embodiment of the invention, the single cell-derived or oligoclonal cell-derived cells of this invention may express unique patterns of CD antigen gene expression, which are cell surface antigens. The differential expression of CD antigens on the cell surface may be useful as a tool, for example, for sorting cells using commerically available antibodies, based upon which CD antigens are expressed by the cells. The expression profiles of CD antigens of some cells of this 30 invention are shown in West et al., 2008, Regene Med vol. 3(3) pp. 287-308, incorporated herein by reference, including supplemental information. For example, there are CD antigens that are expressed in ES cells and not (or in some cases, at reduced levels) in the relatively more differentiated cell lines of this invention. This could be a very useful tool for selecting, sorting, purifying and/or characterizing ES cells. Since the CD antigens are expressed on the cell surface and 35 antibodies to them are, generally speaking, commercially available, antibodies (or specific combinations of them) can be used to purify pure populations of ES cells or cells of this invention out of a heterogeneous mixture of cells. This could be useful in various strategies to grow ES cells or 26 WO 2011/150105 PCT/US2011/037969 cells of this invention, or prepare these cells for various commercial purposes. There are several CD antigens that are robustly expressed in the relative more differentiated cells of this invention, but are not expressed in ES cells (or in some cases at markedly reduced levels). The antigens that fall into this category include: CD73, CD97, CD140B, CD151, CD172A, CD230, CD280, CDw2lOb. These 5 antigens may be useful in a negative selection strategy to grow ES cells. In another embodiment of the invention, the single cell-derived and oligoclonal cell-derived cells, derived by methods of this invention, may be injected into mice to raise antibodies to differentiation antigens. Antibodies to differentiation antigens would be useful for both identifying the cells to document the purity of populations for cell therapies, for research in cell differentiation, 10 as well as for documenting the presence and fate of the cells following transplantation. In general, the techniques for raising antibodies are well known in the art. In another embodiment of the invention, the single cell-derived and oligoclonal cell-derived cells may be used for the purpose of generating increased quantities of diverse cell types with less pluripotentiality than the original stem cell type, but not yet fully differentiated cells. mRNA or 15 miRNA can then be prepared from these cell lines and microarrays of their relative gene expression can be performed as described herein. In another embodiment of the invention, the single cell derived and oligoclonal cell-derived cells may be used in animal transplant models, e.g. transplanting escalating doses of the cells with or without other molecules, such as ECM components, to determine whether the cells proliferate after transplantation, where they migrate to, and their long-term 20 differentiated fate in safety studies. In another embodiment of the invention, the single cell-derived and oligoclonal cell-derived cells generated according to the methods of the present invention are useful for harvesting mRNA, microRNA, and cDNA from either single cells or a small number of cells (i.e., clones) to generate a database of gene expression information. This database allows researchers to identify the identity of 25 cell types by searching for which cell types in the database express or do not express genes at comparable levels of the cell type or cell types under investigation. For example, the relative expression of mRNA may be determined using microarray analysis as is well known in the art. The relative values may be imported into a software such as Microsoft Excel and gene expression values from the different cell lines normalized using various techniques well known in the art such as mean, 30 mode, median, and quantile normalization. Hierarchical clustering with the single linkage method may be performed with the software such as The R Projectfor Statistical Computing as is well known in the art. An example of such documentation may be found at http(colon)//sekhon(dot)berkeley(dot)edu/stats/html/hclust.html. A hierarchical clustering analysis can then be performed as is well known in the art. These software programs perform a hierarchical 35 cluster analysis using a group of dissimilarities for the number of objects being clustered. At first, each object is put in its own cluster, then iteratively, each similar cluster is joined until there is one cluster. Distances between clusters are computed by Lance-Williams dissimilarity update formula 27 WO 2011/150105 PCT/US2011/037969 (Becker, R. A., Chambers, J. M. and Wilks, A. R. (1988) The New S Language. Wadsworth & Brooks/Cole. (S version.); Everitt, B. (1974). Cluster Analysis. London: Heinemann Educ. Books). Typically the vertical axis of the dendograms displays the extent of similarity of the gene expression profiles of the cell clones. That is, the farther down they branch apart, the more similar they are. The 5 verticle axis is a set of n-I non-decreasing real values. The clustering height is the value of the criterion associated with the clustering method for the particular agglomeration. In order to determine if a new cell line is identical to existing cell lines, two types of replicates are performed: biological and technical replicates. Biological replicates require that new cell lines be grown, mRNA harvested, and then the analysis compared. Technical replicates, on the other hand, analyze the same 10 RNA twice. A line cutoff is then drawn just above where the replicates branch such that cells branching below the cutoff line are considered the same cell type. Another source of data for the database described above may be microRNA profiles of the single cell-derived and oligoclonal cell-derived cells generated according to the methods of the present invention. MicroRNAs (miRNA) are endogenous RNAs of -22 nucleotides that play important regulatory roles in animals & 15 plants by targeting mRNAs for cleavage or translational repression. More than 700 miRNAs have been identified across species. Their expression levels vary among species and tissues. Low abundant miRNAs have been difficult to detect based on current technologies such as cloning, Northern hybridization, and the modified Invader® assay. In the present invention, an alternative approach using a new real-time quantitation method termed looped-primer RT-PCR was used for 20 accurate and sensitive detection of miRNAs as well as other non-coding RNA (ncRNA) molecules present in human embryonic stem cells and in cell lines differentiated from human embryonic stem cells. In another embodiment of the invention, gene expression analysis may be used to identify the developmental pathways and cell types for in vitro differentiated hES cells. Gene expression 25 analysis of single cells or a small number of cells from human or nonhuman embryonic or fetal tissues provides another means to generate a database of unique gene expression profiles for distinct populations of cells at different stages of differentiation. Gene expression analysis on single cells isolated from specific tissues may be performed as previously described by Kurimoto et al., Nucleic Acids Research (2006) Vol. 34, No. 5, e42. Thus, cellular miRNA profiles on their own or in 30 conjunction with gene expression profiles, immunocytochemistry, and proteomics provide molecular signatures that can be used to identify the tissue and developmental stage of differentiating cell lines. This technique illustrates that the database may be used to accurately identify cell types and distinguish them from other cell types. The cells of the present invention are also useful in providing a subset of gene expression 35 markers that are expressed at relatively high levels in some cell lines while not be expressed at all in other cell lines as opposed to genes expressed in all cell lines but at different levels of expression. This subset of "all-or none" markers can be easily identified by comparing the levels of expression as 28 WO 2011/150105 PCT/US2011/037969 measured for instance through the use of oligonucleotide probes or other means know in the art, and comparing the level of a gene's expression in one line compared to all the other lines of the present invention. Those genes that are expressed at relatively high levels in a subset of lines, and not at all in other lines, are used to generate a short list of gene expression markers. When applied to the cells and 5 gene expression data described herein, where negative expression in Illumina 1 is <170RFU and positive expression is >500RFU, negative expression in Illumina 2 is <160RFU and positive expression is >300RFU, and negative expression in Affy is <50RFU and positive expression is >250RFU, a nonlimiting example of such genes is ACTC, AGC1, AKR1C1, ALDH1A1, ANXA8, APCDD1, AQP1, AREG, ATP8B4, BEXI, CFB, BMP4, C3, C6, C7, PRSS35, C20orfl03, CCDC3, 10 CD24, CDH3, CDH6, CLDN11, CNTNAP2, COL15A1, COL21A1, COMP, COPI, CRIPI, CRLF1, CRYAB, CXADR, D102, METTL7A, DKK2, DLK1, DPT, EGR2, EMIDI, FGFR3, TMEM100, FMO1, FMO3, FOXF1, FOXF2, FST, GABRB1, GAP43, GDF5, GDF1O, GJB2, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, HSPB3, HTRA3, ICAM5, ID4, IF127, IFIT3, IGF2, IGFBP5, ILIRI, INA, KCNMB1, KIAA0644, KRT14, KRT17, KRT19, KRT34, LAMC2, TMEM 119, IGFL3, 15 LOC92196, MFAP5, MASPI, MEOXI, MEOX2, MGP, MMP1, MSX1, MSX2, MX1, MYBPH, MYH3, MYHI1, MYL4, IL32, NLGN4X, TAGLN3, NPAS1, NPPB, OGN, OLR1, OSR2, PAX2, PAX9, PDE1A, PENK, PITX2, PODN, POSTN, PRELP, PRG4, PROMI, PRRX1, PRRX2, PTGS2, PTN, PTPRN, RARRESI, RASD1, RELN, RGMA, RGS1, RPS4Y2, S100A4, SERPINA3, SFRP2, SLITRK6, SMOCI, SMOC2, SNAP25, SOD3, SOXI1, SRCRB4D, STMN2, SYT12, TAC1, TFPI2, 20 RSPO3, THY1, TNFSF7, TNNT2, TRH, TSLP, TUBB4, UGT2B7, WISP2, ZD52F10, ZICI, and ZIC2. Neural Differentiation Medium 2 The cell line to be tested is plated in six well plates at two different densities 5x10 5 25 cells/well. The cells are grown under standard growth conditions until they reach confluence. The media is then replaced with 50% DMEM 50% F12 media supplemented with N2 containing and MEM-NEAA, 2 mg/ml heparin, 1 mM cAMP, 200 ng/ml ascorbic acid, 50 ng/ml IGF-1, 10 ng/ml GDNF, 10 ng/ml BDNF). 30 Safranin 0 Staining Assay The well-known techniques of staining of formalin-fixed, paraffin-embedded tissue sections with Safranin 0 are commonly used in the detection of cartilage-related proteoglycans, however, the assay is not absolutely specific to cartilage since it also stains mucin, mast cell granules, and likely other substances in other cell types. A nonlimiting example of the protocol where cartilage and mucin 35 will be stained orange to red, and the nuclei will be stained black and the background stained green uses formalin-fixed micromasses, pellets, or similar aggregations of cells. Reagents used include Weigert's Iron Hematoxylin Solution: in which Stock Solution A composed of 1 gram of 29 WO 2011/150105 PCT/US2011/037969 Hematoxylin in 100 ml of 95% Alcohol; Stock Solution B composed of 4 ml of 29% Ferric chloride in water diluted in 95 ml of Distilled water and 1.0 ml of concentrated Hydrochloric acid; Weigert's Iron Hematoxylin Working Solution composed of equal parts of stock solution A and B and used within four weeks; 0.001% Fast Green (FCF) Solution composed of 0.01 gram of Fast green, FCF, 5 C.I. 42053 in 1000 ml Distilled water; 1% Acetic Acid Solution composed of 1.0 ml glacial acetic acid in 99 ml Distilled water; and 0.1% Safranin 0 Solution composed of 0.1 gram Safranin 0, C.I. 50240 in 100 ml Distilled water. Samples are Deparaffinized and hydrated with distilled water. They are stained with Weigert's iron hematoxylin working solution for 10 minutes, then washed in running tap water for 10 minutes, stained with fast green (FCF) solution for 5 minutes, rinsed quickly with 10 1% acetic acid solution for no more than 10 -15 seconds, stained in 0.1% safranin 0 solution for 5 minutes, dehydrated and cleared with 95% ethyl alcohol, absolute ethyl alcohol, and xylene, using 2 changes each, 2 minutes each, mounted using resinous medium, and imaged and analyzed for stains as described above. Cartilage-related proteoglycan stains dark red-orange. 15 Human Embryonic Chondrogenic Progenitor Line Markers The gene expression markers of the human embryonic progenitor cell lines capable of differentiating into chondroblasts and then chondrocytes expressing higher levels of COL2A] than normal early passage cultured human articular chondrocytes when said human embryonic progenitor cell lines have undergone 18-21 doublings of clonal expansion following isolation from human ES or 20 similar human primordial stem cell-derived cells are: The cell line SM30 is positive for the markers: COL15A1, CRYAB, DYSF, FST, GDF5, HTRA3, TMEM1 19, MMP1, MSX1, MSX2, MYL4, POSTN, SERPINA3, SRCRB4D and ZIC2 and is negative for the markers: ACTC, AGC1, AKR1C1, ALDH1A1, ANXA8, APCDD1, AQP1, 25 ATP8B4, CFB, C3, C6, C7, C20orflO3, CD24, CDH3, CLDN11, CNTNAP2, COMP, D102, METTL7A, DKK2, DLK1, DPT, FGFR3, TMEM100, FMO1, FMO3, FOXF2, GABRB1, GJB2, GSC, HOXA5, HSD11B2, HSPA6, ID4, IF127, IL1R1, KCNMB1, KIAA0644, KRT14, KRT17, KRT34, IGFL3, LOC92196, MEOX1, MEOX2, MGP, MYBPH, MYH3, MYH11, NLGN4X, NPPB, OGN, OLR1, OSR2, PAX2, PAX9, PDE1A, PENK, PRG4, PROMi, PRRX1, PTN, 30 RARRES1, RASD1, RELN, RGS1, SLITRK6, SMOC1, SMOC2, SNAP25, STMN2, TAC1, RSPO3, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7 and WISP2. The cell line X4D20.8 is positive for the markers: BEXi, CDH6, CNTNAP2, COL21A1, CRIPi, CRYAB, D102, DKK2, GAP43, ID4, LAMC2, LHX8, MMP1, MSX2, S100A4, SOXi1 and THY1 35 and is negative for the markers: AGC1, ALDH1A1, AREG, ATP8B4, CFB, C3, C7, C20orflO3, CDH3, CLDN11, COPi, CRLF1, DLK1, DPT, FMO1, FMO3, GDF1O, GJB2, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, HSPB3, ICAM5, IF127, IGF2, KRT14, KRT17, KRT34, MASPi, 30 WO 2011/150105 PCT/US2011/037969 MEOX2, MSX1, MX1, MYBPH, MYH3, MYH11, TAGLN3, NPAS1, NPPB, OGN, OLR1, PAX2, PDE1A, PRG4, PROMI, PTN, PTPRN, RARRESI, RGS1, SNAP25, STMN2, TAC1, TNNT2, TRH, TUBB4, WISP2, ZICI and ZIC2. 5 The group of cell lines SKI1, SK44, SK50 and SK52 are positive for the markers: BEXI, COL21A1, FST, ICAM5, ILIR1, TMEM 119, PTPRN, SERPINA3, SFRP2 and ZICI and are negative for the markers: ACTC, AGC1, ALDH1A1, AQP1, ATP8B4, C6, C20orflO3, CCDC3, CDH3, CLDN11, CNTNAP2, D102, DKK2, EMIDI, GABRB1, GSC, HOXA5, HSPA6, IFI27, INA, KRT14, KRT34, IGFL3, LOC92196, MEOX1, MEOX2, MMP1, MX1, MYH3, MYH11, IL32, NLGN4X, NPPB, 10 OLR1, PAX2, PAX9, PDE1A, PENK, PROMI, PTN, RARRESI, RASD1, RELN, RGS1, SMOCI, SMOC2, STMN2, TAC1, TFPI2, RSPO3, TNFSF7, TNNT2, TRH and TUBB4. The cell line MEL2 is positive for the markers: AKR1C1, AQP1, COL21A1, CRYAB, CXADR, D102, METTL7A, DKK2, DLK1, DLX5, HAND2, HSD17B2, HSPB3, MGP, MMP1, MSX2, 15 PENK, PRRX1, PRRX2, S100A4, SERPINA3, SFRP2, SNAP25, SOXI1, TFPI2 and THY1 and is negative for the markers: ACTC, ALDH1A1, AREG, CFB, C3, C20orfl03, CD24, CDH3, CDH6, CNTNAP2, COL15A1, COMP, COPI, CRLF1, FGFR3, FMO1, FMO3, FOXF2, FST, GABRB1, GAP43, GDF5, GDF1O, GJB2, GSC, HOXA5, HSD11B2, HSPA6, ICAM5, KCNMB1, KRT14, KRT17, KRT19, KRT34, MASPI, MEOXI, MEOX2, MYBPH, MYH3, MYHI1, TAGLN3, 20 NPAS1, NPPB, OLR1, PAX2, PDE1A, PITX2, PRG4, PTN, PTPRN, RASD1, RELN, RGS1, SMOCI, STMN2, TAC1, TNFSF7, TRH, TUBB4, WISP2, ZICI and ZIC2. The cell line X7SMOO32 is positive for the markers: ACTC, BEXI, CDH6, COL21A1, CRIPI, CRLF1, D102, DLK1, EGR2, FGFR3, FOXF1, FOXF2, FST, GABRB1, IGFBP5, KIAA0644, 25 KRT19, LAMC2, TMEM119, MGP, MMP1, MSX1, MSX2, PODN, POSTN, PRG4, PRRX2, PTN, RGMA, Si 00A4, SERPINA3, SOX 11 and SRCRB4D and is negative for the markers: AGC 1, AKR1C1, ALDH1A1, ANXA8, APCDD1, AREG, ATP8B4, BMP4, C3, C6, C7, PRSS35, C20orflO3, CCDC3, CD24, CLDN11, CNTNAP2, COL15A1, COPI, CXADR, METTL7A, DKK2, DPT, EMIDI, TMEM100, FMO1, FMO3, GDF5, GDF1O, GJB2, GSC, HOXA5, HSD11B2, 30 HSD17B2, HSPA6, HSPB3, HTRA3, ICAM5, ID4, IFI27, ILIRI, INA, KCNMB1, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MASP1, MEOX1, MEOX2, MYBPH, MYH3, MYH11, MYL4, IL32, NLGN4X, NPPB, OGN, OLR1, OSR2, PAX2, PAX9, PDE1A, PITX2, PRELP, PROMI, PTPRN, RASD1, RGS1, SFRP2, SMOCI, SMOC2, SOD3, STMN2, SYT12, TAC1, RSPO3, TNFSF7, TNNT2, TRH, TSLP, TUBB4, UGT2B7, WISP2, ZD52F1O, ZICI and ZIC2. 35 The cell line E15 is positive for the markers: ACTC, BEXI, PRSS35, CRIPI, CRYAB, GAP43, GDF5, HTRA3, KRT19, MGP, MMP1, POSTN, PRRX1, S100A4, SOXI1, SRCRB4D and THY1 31 WO 2011/150105 PCT/US2011/037969 and are negative for the markers: AGC1, AKR1C1, ALDH1A1, ANXA8, APCDD1, AQP1, AREG, ATP8B4, CFB, C3, C6, C7, C20orf103, CDH3, CNTNAP2, COPi, CXADR, METTL7A, DLK1, DPT, EGR2, EMIDi, TMEM100, FMO1, FMO3, FOXF1, FOXF2, GABRB1, GDF10, GJB2, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, HSPB3, IFI27, IFIT3, IGF2, INA, KRT14, TMEM119, 5 IGFL3, LOC92196, MFAP5, MASPI, MEOXi, MEOX2, MSX1, MX1, MYBPH, MYH3, MYL4, NLGN4X, TAGLN3, NPAS1, NPPB, OGN, OLR1, PAX2, PAX9, PDE1A, PENK, PITX2, PRG4, PROMi, PTPRN, RARRESI, RASD1, RELN, RGS1, SLITRK6, SMOCi, SMOC2, SNAP25, STMN2, TAC1, TFPI2, RSPO3, TNFSF7, TNNT2, TRH, TSLP, TUBB4, UGT2B7, WISP2, ZD52F10 and ZICi. 10 Tissue Engineered Constructs In certain embodiments, cells of the present invention are employed in therapeutic applications to repair, replace, or enhance tissue function in a subject (e.g, a mammal, e.g., a human patient). A number of therapies that employ cells incorporated in engineered matrices have been 15 described, a few of which are summarized below. The cells of the present invention may be embedded in such matrices to prvide form and function as is well-known in the art. In certain embodiments, synthetic matrices or biological resorbable immobilization vehicles (sometimes referred to as "scaffolds") may be impregnated with cells of the present invention. A variety of synthetic carrier matrices have been used to date and include: three-dimensional collagen 20 gels (U.S. Pat. No. 4,846,835; Nishimoto (1990) Med. J. Kinki University 15; 75-86; Nixon et al. (1993) Am. J. Vet. Res. 54:349-356; Wakitani et al. (1989) J. Bone Joint Surg. 71B:74-80; Yasui (1989) J. Jpn. Ortho. Assoc. 63:529-538); reconstituted fibrin-thrombin gels (U.S. Pat. Nos. 4,642,120; 5,053,050 and 4,904,259); synthetic polymer matrices containing polyanhydride, polyorthoester, polyglycolic acid and copolymers thereof (U.S. Pat. No. 5,041,138); and hyaluronic 25 acid-based polymers (Robinson et al. (1990) Calcif. Tissue Int. 46:246-253). For example, the cells of the present invention may be employed in tissue reconstruction as described in Methods of Tissue Engineering (2002), edited by Anthony Atala and Robert P. Lanza and published by Academic Press (London), incorporated by reference herein for its description of tissue reconstruction (see, e.g, pages 1027 to 1039). As described therein, cells may be placed into a 30 molded structure (e.g., by injection molding) and transplanted into an animal. Over time, tissue produced by the cells of the present invention will replace the molded structure, thereby producing a formed structure (i.e., in the shape of the initial molded structure). Exemplary mold materials for the molded structure include hydrogels (e.g., alginate, agarose, polaxomers (Pluronics)) and natural materials (e.g., type I collagen, type II collagen, and fibrin). 35 In certain embodiments, cells of the present invention may be cultured in vitro to form a synthetic tissue-like material. The resulting tissue may be implanted subsequently into a subject at the site of the defect. This type of approach has the advantage that the development of the synthetic 32 WO 2011/150105 PCT/US2011/037969 tissue may be monitored prior to implantation. In addition, the resulting tissue may be characterized biochemically and morphologically prior to implantation. Numerous different procedures have been developed for growing synthetic tissue in vitro, including growing cells in an anchorage-dependent or an anchorage-independent manner. 5 In the anchorage-independent manner, cells may be cultured as colonies within an agarose gel. See for example: Benya et al. (1982) Cell 30:215-224; Aydlotte et al. (1990) in Methods and Cartilage Research Chapter 23:pp. 90-92; Aulthouse et al. (1989) In Vitro Cellular and Developmental Biology 25:659-668; Delbruck et al. (1986) Connective Tissue Res. 15:1550-172; and Bohme et al. (1992) J. Cell Biol. 116:1035-1042. Alternatively, in another anchorage 10 independent method, cells may be cultured as colonies in suspension culture. See for example, Franchimont et al. (1989) J. Rheumatol. 16:5-9; and Bassleer et al. (1990) in "Methods and Cartilage Research", Academic Press Ltd., Chapter 24. In the anchorage-dependent method, primary cultures of cells may be grown as monolayers attached to the surface of a cell culture flask. See for example: Yoshihashi (1983) J. Jpn. Ortho. 15 Assoc. 58:629-641; and U.S. Pat. No. 4,356,261, incorporated by reference herein in its entirety. In certain embodiments, a cartilage therapy of the invention includes those described in U.S. Patents 5,723,331 and 5,786,217 (entitled "Methods and compositions for the repair of articular cartilage defects in mammals", both of which are incorporated by reference herein in their entirety). These patents describe methods for preparing in vitro a synthetic cartilage patch for the repair of a 20 cartilage defect. When the cartilage-producing cells of the present invention are employed, the methods include the steps of: (1) seeding cartilage-producing cells of the present invention into a pre shaped well having a cell contacting, cell adhesive surface; and (2) culturing the cartilage-producing cells of the present invention in the well for a time sufficient to permit the cells to secrete an extracellular matrix, thereby to form a three-dimensional, multi cell-layered patch of synthetic 25 cartilage. The resulting synthetic cartilage (e.g., synthetic articular cartilage), contains cartilage producing cells of the present invention dispersed within an endogenously produced and secreted extracellular matrix. The resulting synthetic cartilage patch may be used subsequently for the repair (or replacement) of a cartilage defect in a subject (e.g., a mammal). The cells of the present invention thus find use in numerous therapeutic applications for 30 treating diseases or conditions characterized by tissue damage or degeneration as well as for complete replacement of those tissues. Diseases and conditions include, but are not limited to :osteoarthritis, chondromalacia, chondromalacia patella, hallux rigidus, hip labral tear, torn meniscus, cartilage replacement (ear, nose), nervous disorders, endocrine disorders, muscle disease, injuries to tendons and ligaments, etc. 35 Direct injection of cells to impart tissue regeneration Direct injection of cells, such as the cell lines of the present invention are also of therapeutic 33 WO 2011/150105 PCT/US2011/037969 utility. Doses and formulation will vary depending on the route of administration, tissue type, and nature of the pathology to be treated as is known in the art, but in the case of humans and most veterinary animals species, the dosage will be between 102 - 106 cells and the formulation can be, by way of nonlimiting example, a cell suspension in isosmotic buffer or a monolayer of cells attached to 5 an layer of extracellular matrix such as contracted gelatin. Cellular compositions of the present invention may further comprise an acceptable carrier, such as a hydrophilic, e.g., pharmaceutically acceptable, carrier. SYSTEMS AND KITS 10 Also provided by the subject invention are systems and kits that include the cells of the invention for use in various applications, as described herein. The systems and kits may further include reagents and materials for the propagation and use of the cells for research and/or therapeutic applications as described herein. 15 Biological Deposits Cell lines described in this application have been deposited with the American Type Culture Collection ("ATCC"; P.O. Box 1549, Manassas, VA 20108, USA) under the Budapest Treaty. The cell line 4D20.8 (also known as ACTC84) was deposited at the ATCC at passage 11 on July 23, 2009 and has ATCC Accession No. PTA-10231. The cell line SM30 (also known as ACTC256) was 20 deposited at the ATCC on July 23, 2009 at passage 12 and has ATCC Accession No. PTA-10232. The cell line 7SM0032 (also known as ACTC278) was deposited at the ATCC at passage 12 on July 23, 2009 and has ATCC Accession No. PTA-10233. The cell line E15 (also known as ACTC98) was deposited at the ATCC at passage number 20 on September 15, 2009 and has ATCC Accession No. PTA-10341. The cell line MEL2 (also known as ACTC268) was deposited at the ATCC at passage 25 number 22 on July 1, 2010 and has ATCC Accession No. PTA-1 1150. The cell line SK 11 (also known as ACTC250) was deposited at the ATCC at passage number 13 on July 1, 2010 and has ATCC Accession No. PTA-1 1152. The cell line 7PEND24 (also known as ACTC283) was deposited at the ATCC at passage number 11 on July 1, 2010 and has ATCC Accession No. PTA- 11149. 30 EXAMPLES The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the present invention, and are not intended to limit the scope of what the inventors regard as their invention nor are they intended to represent that the experiments below are all or the only experiments performed. Efforts have been 35 made to ensure accuracy with respect to numbers used (e.g. amounts, temperature, etc.) but some experimental errors and deviations should be accounted for. Unless indicated otherwise, parts are 34 WO 2011/150105 PCT/US2011/037969 parts by weight, molecular weight is weight average molecular weight, temperature is in degrees Centigrade, and pressure is at or near atmospheric. Example 1 5 As described in U.S. patent application Ser. No. 12/504,630 filed on July 16, 2009 and titled "Methods to Accelerate the Isolation of Novel Cell Strains from Pluripotent Stem Cells and Cells Obtained Thereby" (incorporated herein by reference in its entirety), the gene expression markers of cell lines cultured as described show evidence of marked diversity. Also described in U.S. patent application Ser. No. 12/504,630 filed on July 16, 2009 and titled "Methods 10 to Accelerate the Isolation of Novel Cell Strains from Pluripotent Stem Cells and Cells Obtained Thereby", incorporated herein by reference in its entirety, is the observation that said gene expression markers vary with cell culture passage. Therefore the markers were described as useful in identifying said cell lines at the point in clonal or oligoclonal passage described, specifically, the markers shown in Table I herein were taught as useful markers when the cell lines were at 18-21 population 15 doublings of clonal expansion (i.e. the first cell being doubling zero, the first doubling being two cells, the second doubling being four cells, the twentieth doubling being approximately one million cells). The cell line Z 11 (also known as ACTC 194) described in U.S. patent application Ser. No. 12/504,630 filed on July 16, 2009 and titled "Methods to Accelerate the Isolation of Novel Cell 20 Strains from Pluripotent Stem Cells and Cells Obtained Thereby", incorporated herein by reference in its entirety, and whose gene expression markers are disclosed in Table 1 as being positive for ATP8B4, CD24, DLK1, FOXF1, FST (NM_013409.1), HTRA3, IGF2 (Illumina probe ID 2413956), IGFBP5, ILIRI, MSX1, NLGN4X (NM_181332.1), OSR2 (NM_053001.1), PODN, PROMI, PRRX2, PTN, SOD3, SOXI 1, SRCRB4D, STMN2 and TFPI2 and negative for the markers: ACTC, 25 AGC1, AKR1C1, ALDH1A1, ANXA8, APCDD1, AREG, CFB, C6, C7, PRSS35, CCDC3, CDH3, CLDN1 1, CNTNAP2, COMP, CRIPI, CRLF1, DIO2 (NM_000793.2), DKK2, DPT, EMIDI, FMO1, FMO3 (NM_006894.3), GAP43, GDF10, GJB2, GSC, HOXA5, HSD11B2, HSPA6, HSPB3, IF127, INA, KCNMB1, KIAA0644, KRT14, KRT17, KRT34, LAMC2 (NM_005562.1), IGFL3, LOC92196, MFAP5, MEOXI, MEOX2, MX1, MYBPH, MYH3, MYHI1, MYL4 (NM_002476.2), 30 IL32, NPPB, OLR1, PAX2, PITX2, RARRESI, RASD1, RGS1, SMOCI, SMOC2, SNAP25, TACI, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, WISP2, ZICI and ZIC2 at 18-21 doublings of clonal expansion was passaged in Promocell Smooth Muscle medium (Cat# C-22062B) with supplements as per manufacturer's instructions. At passage 18 (corresponding to a total of approximately 45 doublings of clonal expansion) the cells were plated in conditions to synchronize in quiescence as 35 described herein, and microarray analysis of gene expression was performed as described herein. At this number of doublings, the line expressed similar markers, being positive for ATP8B4, CD24, DLK1, FOXF1, FST (NM_013409.1), IGF2 (Illumina probe ID 2413956), IGFBP5, ILIRI, MSX1, 35 WO 2011/150105 PCT/US2011/037969 PODN, PROMI, PRRX2, PTN, SOD3, SOXI 1, STMN2 and TFPI2 and negative for the markers: ACTC, AGC1, AKR1C1, ALDH1A1, ANXA8, APCDD1, AREG, CFB, C6, C7, PRSS35, CCDC3, CLDN11, CNTNAP2, COMP, CRIPI, CRLF1, D102, DKK2, EMIDI, GAP43, GDF10, GJB2, GSC, HOXA5, HSD11B2, HSPB3, IFI27, INA, KCNMB1, KIAA0644, KRT14, KRT17, KRT34, 5 LAMC2 (NM_005562.1), IGFL3, LOC92196, MFAP5, MEOXI, MEOX2, MX1, MYBPH, MYH3, MYH11, IL32, NPPB, PAX2, PITX2, RARRES1, RASD1, RGS1, SMOC1, SMOC2, SNAP25, TACI, TRH, TUBB4, UGT2B7, WISP2, ZICI, ZIC2, and little to no expression of PRSS35, but unlike the cells at 18-21 doublings, the cells at P18 (45-50 doublings of clonal expansion) lost expression of HTRA3, NLGN4X (NM_181332.1) and little to no detectible OSR2 (NM_053001.1) 10 and SRCRB4D and were positive for the expression of CDH3, DPT, OLR1, TNNT2, they were positive for FMO3 accession numbers NM_001002294.1 and NM_006894.4 and showed a low but positive expression of FMO1 and MYL4 (NM_002476.2). The cells were FST positive for NM_013409.1 but low or negative for NM_006350.2, not inconsistent with earlier findings. 15 Example 2. The discovery of muscle progenitors. The cell line Z 11 (also known as ACTC 194) described in U.S. patent application Ser. No. 12/504,630 filed on July 16, 2009 and titled "Methods to Accelerate the Isolation of Novel Cell Strains from Pluripotent Stem Cells and Cells Obtained Thereby", incorporated herein by reference in its entirety, and whose gene expression markers at 18-21 doublings of clonal expansion are 20 disclosed in Table 1 and in Example 3 (where markers at both 18-21 and 45-50 doublings of clonal expansion are disclosed), was passaged in Promocell Smooth Muscle medium (Cat# C-22062B) with supplements as per manufacturer's instructions. At passage 18 (corresponding to a total of approximately 45-50 doublings of clonal expansion) the cells were plated as micromasses of approximately 250,000 cells for 14 days under conditions described as In vitro conditions to induce 25 chondrogenenesis - Micromass Culture in Table VIII, that are expected to cause chondrogenic differentiation in cells capable of such differentiation. Despite the expression of markers such as DLX5 and MSX 1 (markers of mandibular mesenchyme), Z 11 did not differentiate into chondrocytes, instead, surprisingly, such conditions induced the cell line Z 11 to differentiate into cells with markers of muscle cells, including the up-regulation of MYH1I (106RFUs (background levels and consistent 30 with them being negative for this marker at 18-21 doublings of clonal expansion) in control cultures to 9067 RFUs at day 14), (DES from RFU value of 104 (background level) to RFU of 824), and (ACTA1 from 103 (background level) to 202). Example 3. Low Throughput screen for chondrogenic progenitors Scoring by qPCR 35 The cell lines of the present invention designated 7SMOO32, W10, 7PEND24, 7SMOO7, 4D20.8, SM28, EN2, Zi1,EN13, EN31, EN47, EN55, MW1, Wi1, E44, E68, E111, MEL2, ENI, EN26, ZI, Z2, EN4, RAPEND18, 7PEND30, E33, SM2, SM30, EN7, EN42, T14, U31, F15, W8, 36 WO 2011/150105 PCT/US2011/037969 E164, T43, 7PEND9, RAD20.16, T44, EN51, RAPEND15, EN16, B16, 7SMOO25, RAD20.6, E69, SM33, SKI, EN18, SK25, SM35, 7PEND12, SK47, CMO2, SK17, 7SKEL4, SK49, SK46, RASKEL18, E15, RASMO19, T7, SM8, SM22, SK18, SK31, Z3, T42, 7SMOO9, 10RPE8, RAD20.24, 7SMOO7, RASMO12, T36, RAD20.5, T20, E120, 4D20.9, E85, C4ELSR10, 5 C4ELSR5.1, C4ELS5.6, RAD20.19, and 4.4 were expanded in vitro > 21 doublings of clonal expansion since they were isolated from hES-derived cells, synchronized in quiescence by growing to confluence and replacing the media with media supplemented with a 10-fold reduction in serum or other mitogens as described herein. RNA was extracted from these cells as a control. In a low throughput screen for cells capable of chondogenesis in vitro, cells were cultured in micromass 10 conditions to induce chondrogenesis as described herein for 14 days. RNA from each of these two conditions was converted to cDNA and then examined for expression of genes commonly associated with chondrogenesis (i.e. COL2A], COMP, CILP, SCX, CRTL], SOX9, BARX2). Gene-specific primer pair probes were obtained from Invitrogen. Samples for testing were prepared in standard Optical 96-well reaction plates (Applied Biosystems Carlsbad, CA, PN 4306737) consisting of 30ng 15 of RNA equivalent of cDNA, 0.4uM per primer, Ultra-Pure distilled water (Invitrogen), diluted 1:1 with 12.5ul of Power SYBR Green PCR Master Mix (Applied Biosystems Carlsbad, CA, Cat# 4367659) incorporating AmpliTaq Gold DNA polymerase in a total reaction volume of 25ul. Real Time qPCR was run using Applied Biosystems 7500 Real-Time PCR System employing SDSv1.2 software. Amplification conditions were set at 50'C for 2 min. (stage 1), 95'C for 10 min. (stage 2), 20 40 cycles of 95'C for 15 see then 60'C for 1 min (stage 3), with a dissociation stage at 95'C for 15 sec, 60'C for 1 min, and 95'C for 15 sec (stage 4). Ct values for amplification products of genes of interest were normalized to the average Ct value of 3 housekeeping genes (GAPD, RPS 10, and GUSB), and gene expression analyzed relative to that of early passage knee-Normal Human Articular Chondrocytes (Lonza) and cultured human bone marrow mesenchymal stem cells. 25 The primer sets used to detect chondrogenic genes were ("f" is forward primer; "r" is reverse primer): Gene symbol Sequence 5' -> 3' SEQ ID NO COMP f2 CCGACAGCAACGTGGTCTT 1 COMP r2 CAGGTTGGCCCAGATGATG 2 CRTL1 fi TGCTCAGATTGCAAAAGTGG 3 CRTL1 rl TATCTGGGAAACCCACGAAG 4 CILP fi CCTGGTCCTGGAAGTCACAT 5 CILP rl CCATGTTGTCCACTCACCAG 6 CEP68 fi ATCCGTAGAGAGCACGGAGA 7 CEP68 rl GGACTCTCCATGGGACAAGA 8 COL2A1 f3 GGCAATAGCAGGTTCACGTACA 9 37 WO 2011/150105 PCT/US2011/037969 COL2A1 r3 CGATAACAGTCTTGCCCCACTT 10 COL2A1 f4 TGGCCTGAGACAGCATGA 11 COL2A1 r4 AGTGTTGGGAGCCAGATTG 12 CEP68 f1 ATCCGTAGAGAGCACGGAGA 13 CEP68 rl GGACTCTCCATGGGACAAGA 14 SOX9 f1 TACGACTACACCGACCACCA 15 SOX9 rl TCAAGGTCGAGTGAGCTGTG 16 SCXA fi TCCAGCTACATCTCGCACCT 17 SCXA r1 CGGTCCTTGCTCAACTTTCT 18 BARX2 fl GGACTTGGCTCAGTCTCTGG 19 BARX2 rl TGGGGATGGAGTTCTTCTTG 20 GAPDH f2 GGCCTCCAAGGAGTAAGACC 21 GAPDH r2 AGGGGTCTACATGGCAACTG 22 RPS10 fi ATTTGGTCGTGGACGTGGT 23 RPS10 rl TTTGGCTGTAAGTTTATTCAATGC 24 GUSB fi AAACGATTGCAGGGTTTCAC 25 GUSB rl CTCTCGTCGGTGACTGTTCA 26 COL2A1 f1 TCTACCCCAATCCAGCAAAC 27 COL2A1 rl GTTGGGAGCCAGATTGTCAT 28 COL2A1 f2 CACACTGGTAAGTGGGGCAAGACCG 29 COL2A1 r2 ACGAGGTCCTCACTGGTGAA 30 ACAN fi TGAGTCCTCAAGCCTCCTGT 31 ACAN rl TGGTCTGCAGCAGTTGATTC 32 ACAN f2 ACAGCTGGGGACATTAGTGG 33 ACAN r2 GTGGAATGCAGAGGTGGTTT 34 COL1OA1 fl GCTAAGGGTGAAAGGGGTTC 35 COL 0A1 rl CTCCAGGATCACCTTTTGGA 36 BGN fl GGACTCTGTCACACCCACCT 37 BGN rl AGCTCGGAGATGTCGTTGTT 38 COL9A2 f1 AGCATCATTCGGCTGTTACC 39 COL9A2 rl CTGAGGGGTGGAACTGTAGC 40 CDMP1 fi CCCATCAGCATCCTCTTCAT 41 CDMP1 rl TGTAGATGCTCCTGCCACAG 42 VERSICAN fi ACCACGCTTCCTATGTGACC 43 VERSICAN rl TGTTGTAACTGGGTGGCAAA 44 COL 1 Al fi TCGAGGGTTTGATGGACTTC 45 COL 1 Al rl CATCTTCTCCCCTCATTCCA 46 DCN fi TGGCAACAAAATCAGCAGAG 47 DCN r1 GCCATTGTCAACAGCAGAGA 48 38 WO 2011/150105 PCT/US2011/037969 FMOD fi CCTCCAAGGCAATAGGATCA 49 FMOD r1 GCTGCGCTTGATCTCGTTC 50 LUM fi TGATCTGCAGTGGCTCATTC 51 LUM rl AAAAGAGCCCAGCTTTGTGA 52 COL1Al fl GTGCTAAAGGTGCCAATGGT 53 COL1Al rl ACCAGGTTCACCGCTGTTAC 54 COL1Al f2 GTGCTAAAGGTGCCAATGGT 55 COL1Al r2 CTCCTCGCTTTCCTTCCTCT 56 PRELP fi TCCCAATCTTGCCTTCATTC 57 PRELP r1 GTCATGGAACGCCACTAGGT 58 ACAN f3 TCGAGGACAGCGAGGCC 59 ACAN r3 TCGAGGGTGTAGCGTGTAGAGA 60 COL 0A1 f2 CAAGGCACCATCTCCAGGAA 61 COL 0A1 r2 AAAGGGTATTTGTGGCAGCATATT 62 CRTL1 f2 TTCCACAAGCACAAACTTTACACAT 63 CRTL1 r2 GTGAAACTGAGTTTTGTATAACCTCTCAGT 64 LUM f2 ACCAGATTGACCATATTGATGA 65 LUM r2 GGACAGATCCAGCTCAACC 66 SOX9 f2 AGGCAAGCAAAGGAGATGAA 67 SOX9 r2 TGGTGTTCTGAGAGGCACAG 68 SOX9 f3 ACTGAGTCATTTGCAGTGTTTTCTGCC 69 SOX9 r3 GTGGGCTGATCCCCTCCAGGT 70 SOX5 fi TGGCACTGCACTGGGTAGGA 71 SOX5 rl AAGGCTGGGAGCCCGTCACT 72 AGC1/ACAN f4 TGAGTCCTCAAGCCTCCTGT 73 AGC1/ACAN r4 CCTCTGTCTCCTTGCAGGTC 74 IHH fl GGCCGGGAGACCGTGTGTTG 75 IHH r1 TGGGGCTCGCGGTCCAGTAA 76 IHH f2 TACGCCTGGAGAGTGGGGCG 77 IHH r2 TGGGGCTCGCGGTCCAGTAA 78 COL2A1 f5 TCGTGGGTCCCAGGGGTGAA 79 COL2A1 r5 GACCTGGAGGGCCCTGTGCG 80 COL2A1 f6 TGCTGCCCCATCTGCCCAAC 81 COL2A1 r6 CCTGCAGGTCCCTGAGGCCC 82 COL2A1 f7 AGGGCCAGGATGTCCGGCAA 83 COL2A1 r7 TCTGCCACGAGGTCCAGGGG 84 CRTAC1 (CEP-68) f2 CGGGGCGATGGCACCTTTGT 85 CRTAC1 (CEP-68) r2 GATAGAGGCGGTGGGGGCCA 86 COMP f1 ACAATGACGGAGTCCCTGAC 87 39 WO 2011/150105 PCT/US2011/037969 COMP rl TCTGCATCAAAGTCGTCCTG 88 BARX2 f2 GAGTCAGAGACGGAACAGCC 89 BARX2 r2 AGTCCCAGAGACTGAGCCAA 90 CHM1 (LECT1) fi GCGCAAGTGAAGGCTCGTAT 91 CHM1 (LECT1) rl GTTTGGAGGAGATGCTCTGTTTG 92 Col2A] expression expressed as fold-expression compared to cultured early passage normal human articular chondrocytes for the lines screened is shown in Figure 1. Early passage normal human articular chondrocytes (NHAC) set as 1.0 in value. The expression level of COL2A], 5 quantified as fold-induction compared to NHACs, was not markedly elevated in the majority of the cell lines but strikingly elevated in a small subset of the lines, namely, 7SM0032 technical replicate 2 (154x NHAC expression), 7SM0032 biological replicate 2 (137x NHAC expression), 4D20.8 biological replicate 2 (130x NHAC expression), SM30 (1287x NHAC expression), SM30 biological replicate 2 (13,494x NHAC expression), SM30 technical replicate 2 (1168x NHAC expression), E15 10 (10,809x NHAC expression), E15 technical replicate 2 (9810x NHAC expression), MEL2 (22x NHAC expression), and SK 11 (4x NHAC expression). Surprisingly, there was little if any correlation of COL2A] induction with commonly-used markers for chondrogenic mesenchyme such as SOX9. Similarly, markers such as AQP1 speculated to be a marker of chondrogenic mesenchymal cells was present at an RFU value of foreskin dermal 15 fibroblasts that did not induce COL2A] in micromass chondrogenic conditions and was absent in the cell lines of the present invention prior to and after differentiation. For instance, prior to differentiation, AQP1 expression was absent (RFU 135 which is background) in the line SM30, absent (RFU of 126) in SKI 1, and absent (RFU 139) in the line El5, at 18-21 doublings of clonal expansion (West et al., 2008, Regenerative Medicine vol. 3(3) pp. 287-308, supplementary Table II). 20 Neither was the level of expression of SOX9 in the undifferentiated cell lines of the present invention of predictive value in forecasting whether a cell line of the present invention was capable of chondrogenesis. Indeed, no genes could be found in the undifferentiated lines prior to differentiation that correlated sufficiently with the potential of these lines to become chondrocytes to predict such an outcome. The diversity of gene expression markers within the group of SKI 1, 7SM0032, 4D20.8, 25 MEL2, SM30, and E15 including site-specific homeobox gene expression, suggest that each line represents a unique and distinguishable type of chondrogenic progenitor. Also surprising was that many of the genes commonly used as markers of in vitro chrondrogenesis such as COMP and CILP were induced in the culture conditions in a nonspecific manner in virtually any cell type including cultured dermal fibroblasts, regardless of whether said dermal fibroblast, for instance, was capable of 30 undergoing true chondrogenesis under the same conditions as evidenced by the expression of COL2A] and showing histological evidence of cartilage formation. In addition, the cell lines SKI 1, 7SM0032, 4D20.8, MEL2, SM30, and E15 were clearly distinguishable from cultured bone marrow 40 WO 2011/150105 PCT/US2011/037969 MSCs in regard to gene expression markers both before and after differentiation. While the bone marrow MSC is commonly described as ALCAM (CD]66) positive, the cell lines of the present invention in the undifferentiated state such as SKI 1, 7SM0032, 4D20.8, MEL2, SM30, and E15 showed CD166 expression was absent (RFU 125 which is background) in the line SM30, absent 5 (RFU of 164) in SKI1 (West et al., 2008, Regenerative Medicine vol. 3(3) pp. 287-308, supplementary Table II). Additional differences of the cell lines of the present invention when compared to MSCs, by way of nonlimiting example, is the expression of CD74 that has been demonstrated to be a more precise marker of MSCs than many of the commonly-used markers that are actually not specific (Ishii et al, 2005 BBRC 332:297-303). As shown in Table VII, 10 undifferentiated MSCs indeed expressed very high levels of CD74 transcript, adipocyte stem cells expressed CD74 as well at lower levels, dental pulp stem cells expressed CD74 at the limits of detection, but the transcript was not detected at all in undifferentiated cells of the present invention capable of inducing COL2A] including SKI 1, 7SM0032, 4D20.8, MEL2, SM30, and E15, nor in cultured dermal fibroblasts or in the nonchondrogenic embryonic progenitor line 7SM007. An 15 additional nonlimiting example demonstrating the diversity of the lines and the striking differences with the adult stem cell types studied herein, is the expression of the developmental gene NNAT (NM_181689.1) expressed at high levels in the cell line E15, but not in adult stem cells such as MSCs, adipocyte stem cells, dental pulp stem cells, or dermal fibroblasts. Yet another nonlimiting example of the salient differences of the cell lines of the present invention capable of inducing 20 COL2A] expression from stem cell types in the art, can be seen by measuring the expression of the gene KCNK2 (NM_001017425.2) known to be a marker of MSCs. As shown in Table VII, KCNK2 is expressed at high levels in MSCs, adipocyte stem cells, and dental pulp stem cells, but was not detectible in several of the lines of the present invention capable of inducing the expression of COL2A] such as SM30, E15, 4D20.8, MEL2, and SKI1. A striking difference of the cell lines of the 25 present invention and bone marrow-derived MSCs is also seen in genes that indicate important therapeutic differences in the cell types. MSCs suffer from undergoing transformation into hypertrophic chondrocytes when they differentiate in vitro. Hypertrophic chondrocytes express genes useful in inducing angiogenesis and provide a temporary matrix that is later invaded by osteoblasts to make bone. Therefore, MSCs do not perform well when injected into the joint, or otherwise 30 transplanted into articular cartilage, in an effort to regenerate that tissue for the treatment of joint cartilage trauma, arthritis, or related uses. The cell lines of the present invention when induced by the chondrogenic conditions herein, induced very little if any expression of IHH, a marker of hypertrophic chondrocytes, while MSCs expressed very high levels of IHH transcript. Similarly, the line 4D20.8 did not express detectable levels of COL1OA1, another marker of hypertrophic 35 condrocytes, while MSCs expressed very high levels of the transcript. Therefore, the cell lines of the present invention such as 7SM0032, 4D20.8, SM30, and E15 show markers that they are superior to MSCs in their ability to differentiate into permanent cartilage for the repair of joint cartilage 41 WO 2011/150105 PCT/US2011/037969 pathology. Further nonlimiting examples of the differences in the lines SKI 1, 7SMOO32, 4D20.8, MEL2, SM30, and E15 compared with cultured human bone marrow MSCs, adipocyte stem cells, adult dental pulp stem cells is, is shown in Table VII or can be seen by comparing the gene expression markers of the cells with those described herein such as in Table I. Therefore, these 5 results suggest that the cell lines identified in this screen are novel, that the markers commonly used to identify MSCs are not predictive of chondrogenic capacity in human embryonic progenitor cell lines, and that there currently exists no markers that would have predicted that said cell lines would have been the small subset of lines that would respond to chrondrogenic stimuli in expressing true markers of chondrogenesis. Evidence is provided in Example 7 of histological evidence of cartilage 10 formation. Example 4. Histological and Immunochemical Confirmation of Cartilage Formation. Cell lines of the present invention, such as those discovered in the low throughput screen in Example 6 above as showing moderate to robust induction of COL2A] such as 7PEND24, 15 7SMOO32, MEL2, SM30, El5, SKI1, and 4D20.8 as well as controls such as MSCs, adipocyte stem cells, and other cell lines such as foreskin dermal fibroblasts, ZI 1, dental pulp stem cells, 7SMOO7, E44 and others were exposed to micromass and pellet chondrogenic conditions as described herein for varying times including 1,8,14, and 21 days, and a subset of said pellets when transferred into the kidney capsule of SCID mice to promote extended differentiation. Said micromasses and pellets were 20 fixed in formalin and analyzed histologically with H&E stains, Safranin 0 staining of proteoglycans as described herein, and for immunoreactive COL2A1 using specific antibody and nonspecific antibody as a control. Strong reactivity to Safranin 0 and/or COL2A1 immunoreactivity was observed in day 14 and 21 pellets of the line 4D20.8 and strong Safranin 0 staining in day 14 micromasses of the line E15. Surprisingly, the cell line RAD20.6 showed immunoreactivity to 25 COL2A1 and Safranin 0 staining in a day 14 pellet. Figure 2 shows an example of the Safranin 0 staining of adipose tissue stem cells compared to the lines 4D20.8 at passage 14 compared to MSCs at passage 6 all at day 21 of differentiation as a pellet and immunostaining with isotype controls in day 14 pellets of the line 4D20.8 and MSCs. 30 Example 5. Cell lines of the present invention capable of chondrogenesis are tested for capacity to repair articular cartilage as follows: donated human articular tissue is explanted. 5 X 105 cells of the lines 7PEND24, 7SMOO32, MEL2, SM30, E15, SKI1, and 4D20.8 were spun down in 15 ml conical tube at 400 X g for 5 min in 10% FBS/DMEM/F12, and incubated overnight to generate cell aggregates. 35 Six mm diameter cylindrical plugs were cored out from the articular explants with Arthrex Single Use OATS System (Naples, Fl). A surgical curette was used to make partial thickness defects approximately 2 mm in size in the articular surface. The defects were filled with cell aggregates of 42 WO 2011/150105 PCT/US2011/037969 7PEND24, 7SMOO32, MEL2, SM30, E15, SKI1, and 4D20.8. The cartilage explants were incubated in 10% FBS/DMEM/F12, in the presence or absence of TGFP3. After 4 weeks, explants were fixed, paraffin-embedded, sectioned, and stained with Safranin 0 for scoring. 5 Example 6. The discovery of neural crest cells capable of differentiation into dopaminergic cells. The regulator of G-protein signaling 5 (RGS5) accession number NM_003617.2, UDP-N acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 14 (GALNT14) accession number NM_024572.2, hairy/enhancer-of-split related with YRPW motif 2 (HEY2) accession number NM_012259.1, EPH receptor A5 (EPHA5) accession number NM_004439.4, 10 ankyrin 1, erythrocytic (ANK1) accession number NM_020478.3, cAMP-regulated phosphoprotein, 21kDa (ARPP21) accession number NM_016300.4, and neurotrophic tyrosine kinase, receptor, type 2 (NTRK2) accession number NM_001007097.1 positive cell line U31 (also known as ACTC236), which is described in U.S. patent application Ser. No. 12/504,630 filed on July 16, 2009 and titled "Methods to Accelerate the Isolation of Novel Cell Strains from Pluripotent Stem Cells and Cells 15 Obtained Thereby", incorporated herein by reference in its entirety, and whose additional gene expression markers at 18-21 doublings of clonal expansion are disclosed in Table 1. The line is distinguishable from fetal neuronal stem cells in that fetal neuronal stem cells did not express GALNT14, RGS5, EPHA5, or NTRK2. To determine the differentiation potential of the line U3 1, the line was passaged to P17 and P18. The cells were plated as micromasses of approximately 250,000 20 cells for 14 days in the presence of the conditions described as In vitro conditions to induce chondrogenenesis - Micromass Culture in Table VIII. Surprisingly, the line U31 did not differentiate into chondrocytes under these culture conditions but instead differentiated into cells with markers of dopaminergic cells with GABA transporters. Said dopaminergic markers include the markers protein phosphatase 1, regulatory (inhibitor) subunit lB (PPP1R1B aka DARPP-32 accession number 25 NM_181505.1, cAMP-regulated phosphoprotein, 21kDa (ARPP21) accession number NM_016300.4, and tyrosine hydroxylase (TH) accession number NM_199293.2, as well as other markers of the nervous system such as the neuropeptide galanin (GAL) accession number NM_015973.3. Said GABA transporters include: solute carrier family 6 (neurotransmitter transporter, GABA), member 1 (SLC6A]) also known as GAT-] accession number NM_003042.2, 30 solute carrier family 6 (neurotransmitter transporter, GABA), member 13 (SLC6A]3) also known as GAT-2 accession number NM_016615.2, solute carrier family 6 (neurotransmitter transporter, betaine/GABA), member 12 (SLC6A]2) also known as BGT-1 accession number NM_003044.2. Clonal, oligoclonal, or polyclonal embryonic progenitors with a pattern of gene expression of the cell line of the present invention U31 are useful in screening for pharmaceutically-active agents targeting 35 transporters such as SLC6A] useful in the treatment of anxiety (Thoeringer CK, et al, 2009 The GABA transporter 1 (SLC6A]): a novel candidate gene for affective disorders including anxiety (J Neural Transm. Jun; 116(6):649-57. Epub 2008 Jul 8), neuropathic pain (Gosselin RD et al, 2010. 43 WO 2011/150105 PCT/US2011/037969 Upregulation of the GABA transporter GAT-] in the gracile nucleus in the spared nerve injury model of neuropathic pain, Neurosci. Lett. 480:132), and SLC6A]3, and SLC6A]2 for agents useful in the treatment of epilepsy, stroke, schizophrenia, Huntington's disease Parkinson's disease (Madsen KK et al, 2009 Synaptic and extrasynaptic GABA transporters as targets for anti-epileptic drugs. J 5 Neurochem. 109: Suppl 1: 139-144.; Clarkson AN et al, 2010 Reducing excessive GABA-mediated tonic inhibition promotes functional recovery after stroke. Nature 468:305; Kleppner, SR and Tobin, AJ 2001 GABA signalling: therapeutic targets for epilepsy, Parkinson's disease and Huntington's disease Expert Opinion on Therapeutic Targets April 2001, Vol. 5, No. 2 : Pages 219-239). Said hES or hiPS-derived clonal, oligoclonal, or polyclonal cultured embryonic progenitor cells where the 10 culture is assayed positive for a pattern of gene expression of: NTRK2, RGS5, ANK1, GALNT14, HEY2, EPHA5, and ARPP21 can be formulated for therapeutic use such as by injection into the brain, peripheral nervous system, or spinal cord as cells in an saline, or other solutions well known in the art. In the case of ischemic disease such as stroke, the cells may be injected directly into the stroke cavity where the cells and the trophic effects of the cells can be used to improve 15 neuroplasticity and clinical outcome in peri-infarct tissue. Specifically, the cells may by combined with biopolymer hydrogels designed to increased stability and survival during transport and engraftment, thereby reducing the need for multiple injections, and reduce the distribution of the cells to peripheral organs. Hyaluronan gels have mechanical properties similar to brain tissue and do not promote local scarring or tissue reaction. including but not limited to Zhong J, et al, 2010 Hydrogel 20 matrix to support stem cell survival after brain transplantation in stroke (Neurorehabil Neural Repair. 24(7):636-44. Epub 2010 Apr 27) incorporated herein by reference. In brief, A hyaluronan heparin-collagen hydrogel (HyStem-HP, Glycosan, Salt Lake City, UT) is polymerized with thiol-modified sodium hyaluronate, heparin sulfate, and gelatin that is cross-linked with polyethylene glycol diacrylate. Therapeutically-useful doses of cells with a pattern of gene expression of the cell 25 line of the present invention U31 such as100,000, 500,000, 1 million, 5 million, 10 million, 50 million, 100 million, or 500 million cells are mixed in 1, 5, 10, 20, 30, 40, or 50 mL volume respectively of hyaluronan/heparin sulfate, gelatin, and cross-linker to form a stem-cell-hydrogel formulation. 30 Example 7. The discovery of additional cells capable of differentiation into smooth muscle cells. The HAND2 and SCARA5 positive cell line W10 (also known as ACTC196) whose most distal HOX gene expression was HOXA4, B7, which is described in U.S. patent application Ser. No. 12/504,630 filed on July 16, 2009 and titled "Methods to Accelerate the Isolation of Novel Cell Strains from Pluripotent Stem Cells and Cells Obtained Thereby", incorporated herein by reference 35 in its entirety, and whose gene expression markers at 18-21 doublings of clonal expansion are disclosed in Table 1, was passaged to P14. The cells were plated as micromasses of approximately 250,000 cells for 14 days under conditions described as In vitro conditions to induce 44 WO 2011/150105 PCT/US2011/037969 chondrogenenesis - Micromass Culture in Table VIII, that are expected to cause chondrogenic differentiation in cells capable of such differentiation. Surprisingly, the line W10 did not differentiate into chondrocytes under these conditions but instead differentiated into cells with markers of smooth muscle cells, including the markers MYH1I and GNA14. The presence of MYH1I was confirmed by 5 immunocytochemistry. A comparison of alternative differentiation conditions including two weeks of culture in the presence of 1.0 uM all trans retinoic acid also showed an induction of MYH1I in the W10 cell line. Example 8. The discovery of cells capable of differentiation into derivatives of intermediate 10 mesoderm. The WT1 and NPNT positive cell line RASMO12 (also known as ACTC 154), which displayed distal HOX gene expression of HOXA4, HOXB8, and HOXC8 as a result of differentiation in the presence of retinoic acid as described in U.S. patent application Ser. No. 12/504,630 filed on July 16, 2009 and titled "Methods to Accelerate the Isolation of Novel Cell Strains from Pluripotent 15 Stem Cells and Cells Obtained Thereby", incorporated herein by reference in its entirety, and whose gene expression markers at 18-21 doublings of clonal expansion are disclosed in Table 1, was passaged to P14. The cells were plated as micromasses of approximately 250,000 cells for 14 days under conditions described as In vitro conditions to induce chondrogenenesis - Micromass Culture in Table VIII, expected to cause chondrogenic differentiation in cells capable of such differentiation. 20 Surprisingly, the line RASMO12 did not differentiate into chondrocytes under these conditions but instead differentiated into cells with markers of nephrogenic mesenchyme, including an induction of MSX1 and SALL]. Example 9. The discovery of cells capable of expressing EGFL6.The secreted protein encoded by the 25 gene EGF-like-domain, multiple 6 (EGFL6) also known as MAEG, is a member of the epidermal growth factor (EGF) repeat superfamily. It is expressed in fetal tissues and numerous tumors including those of the lung and meninges. It has also been shown to promote adipogenesis and hair follicle growth in normal tissues. The ability of Egfl6 to promote mitogenesis in meningeal and epidermal cell types and to promote adipogenesis makes a source of the factor useful as a means to 30 promote epithelial tissue growth, e.g., skin keratinocyte regeneration and hair follicle growth stimulation, repair of meninges resulting from trauma or CNS surgery, and to promote adipogenesis such as in the case of age-related atrophy of subcutaneous fat, such as commonly occurs on the dorsal aspect of the hands and if the tissue surrounding the globe of the eye. Cell lines naturally producing the factor can be used to manufacture the protein in vitro wherein the protein is extracted by means 35 known in the art such as Secreted Protein Extraction Method 1 or Extracellular Matrix Extraction Methods 1 and 2 and purified for research or therapeutic use or the cells could be transplanted at the site of injury or disease to produce the factor in vivo. Such in vivo use may utilize cells in a variety of 45 WO 2011/150105 PCT/US2011/037969 formulations described herein including engineered matrices combined with the cells that are viable or cells that have been mitotically inactivated in order to allow the cells to produce the factor for a limited duration. Research uses of the factor include the use of the factor to enhance proliferation of varied 5 cells in vitro including epithelial and meningeal cells, and to promote adipocyte differentiation in vitro. The protein can be purified by Secreted Protein Extraction Methodx 1 or 2 or Extracellular Matrix Extraction Method 1 (as described hereinabove) or left as an intact ECM on tissue culture plastic for use in cell culture. To identify cells of the present invention useful in producing EGFL6, the lines of the present 10 invention were exposed to diverse differentiation conditions as described herein and the levels of EGFL6 expression by microarray analysis was scored. The clonal human embryonic progenitor cell line 7SM0032 which was observed to expresses the metabotropic glutamate receptor GRMI, the nicotinic cholinergic receptor CHRNA3, the transcription factors LHX1 and MSX2, and the genes BBOXI, DLK1, and BMP3, expressed EGFL6 in both the 15 undifferentiated state as well as most differentiation conditions, such as Micromass 1. Example 10. In vitro model of stabilization using mural cells of the present invention. Cell lines expressing RGS5 are detected by microarray, PCR, immunocytochemistry, or other means known in the art (see, e.g., Uemura AK, Kusuhara S et al (2006) Angiogenesis in the 20 mouse retina: a model system for experimental manipulation. Exp Cell Res 312(5):676-683). For example, the cell lines CMO2, E33, E 111 (which express the gene expression markers MAL, EYA4, RGS5, MEOX], CLDN2, UGT2B7, ELF3, ANKRD34B, and ZBED2), E164, SM28, and U31 express RGS5 (relative fluorescence values of >150 being considered positive). Additional markers for these cell lines can be found in Table I. 25 Example 11. Embryonic progenitors to the blood brain barrier Aspects of the rpesent invention include embryonic progenitors of blood brain barrier cells. These cells find use in numerous therapeutic applications, e.g., repair of blood brain barrier cells, as well as in drug screening asays. 30 The blood-brain barrier is formed by the brain capillary endothelium and excludes from the brain -100% of large-molecule neurotherapeutics and more than 98% of all small-molecule drugs, thus making it a bottleneck in brain drug development that limits the growth of neurotherapeutics (see, e.g., Pardridge, NeuroRx. 2005 January; 2(1): 3-14 entitled "The Blood-Brain Barrier: Bottleneck in Brain Drug Development"; incorporated herein by reference in its entirety). In view of 35 this bottle-neck, the development of in vitro assays for screening therapeutic agents that can cross the blood brain barrier, or agents that can facilitate the crossing of other therepeutic agents that cannot 46 WO 2011/150105 PCT/US2011/037969 themselves cross the blood breain barrier, is needed. A number of different genes have been identified that play a role in transport of molecules, including therapeutic agents, across cells, incuding cells of the blood brain barrier. These genes include those that encode so called transporters, e.g., eflux and uptake (or influx) transporters. 5 Exemplary transporter genes include efflux trasnporters ABCB], ABCG2 and ABCC2, as well as uptake (or influx) transporters SLCO1B1, SLCO2B] and SLC22A] (the organic anion transporting polypeptides (OATP) family of influx transporters). (For further description of transporters, see the following exemplary references, which are incorporated herein by reference: Rodrigues et al., Acta Pharmacol Sin. 2009 Jul;30(7):956-64 "The expression of efflux and uptake transporters are 10 regulated by statins in Caco-2 and HepG2 cells."; Luo et al., Amino Acids. 2010 Apr 11. "Design and recombinant expression of insulin-like peptide 5 precursors and the preparation of mature human INSL5."; and Kalliokoski, et al., Br J Pharmacol. 2009 Oct;158(3):693-705 "Impact of OATP transporters on pharmacokinetics.") 15 Example 12. Preadipocytes and their uses. At least three distinct types of adipocytes are known in mammals; namely, visceral white adipocytes, and subcutaneous white and brown adipocytes. While an increased mass of visceral white adipocytes is thought to play a role in type 2 diabetes mellitus, dyslipidemia, cholesterol gallstones, hypertension, atherosclerosis, and hepatic steatosis, an increased number of subcutaneous white and 20 brown adipocytes is thought to lead to improved glucose metabolism and energy consumption potentially leading to overall loss of body fat. Brown fat is a source of heat through uncoupling reactions. It has recently been speculated that the transplantation of certain non-visceral white or brown adipocytes, preadipocytes, or similar adipocyte progenitor cells could be useful in improving insulin sensitivity, and decreasing body fat with numerous potential health benefits (Tran and Kahn, 25 2010. Nat. Rev. Endocrinol. 6(4): 195-213). However, said cell-based therapies require a robust source of purified and specific cells useful in supplying such activity. Markers known in the art as useful in identifying adipocyte progenitors include PPARG. MYF5 has been reported to be a marker of brown adipocyte progenitors with PRDM16 and CEBPB being critical transcription factors in brown adipocyte differentiation (Seale P, et al. PRDM16 controls a brown fat/ skeletal muscle 30 switch. Nature 2008;454:961-8). However, many cell types express these factors and therefore one skilled in the art would not be able to identify primordial stem cell-derived clonal embryonic progenitors capable of differentiating into visceral white, cutaneous white, or brown adipocyte based on markers known in the art. To obtain hES-derived clonal progenitor lines of the present invention capable of 35 differentiating into cutaneous white and brown adipocytes, designated herein as clonal embryonic 47 WO 2011/150105 PCT/US2011/037969 cutaneous adipocyte progenitor cells (ECAPCs), progenitor lines expressing EYA4 were identified. Among other differentiated cell types, EYA4 is expressed in primitive dermatome progenitors. The cell lines of the present invention designated C4ELSR2, C4ELS5.1, E11, E120, J16 (expressing ADHiA, ADHiB, EYA4, FABP4, CD36, PPARG, ANGPT2, EBF2, and DBC]), and 5 RAD20.5 are differentiated according to adipogenesis protocols 1 and 2 (Table VIII), RNA is harvested after 3, 5, 7, and 14 days, and gene expression is analyzed as described herein to detect EYA4 positive embryonic progenitors capable of undergoing differentiation into cutaneous adipocytes and useful for the study of adipocyte differentiation, in transplantation for cosmetic surgery, for imparting weight loss, and for alleviating the symptoms of Type II diabetes as described 10 herein. Preadipocytes (ECAPC) and their differentiated progeny (e.g., cutaneous adipocytes) are useful in numerous autologous and allogeneic transplantation into an animal for both comsmetic and therepeutic purposes. For ECAPCs, differentiation takes place in vivo by means of factors either naturally in the environment and/or introduced factors. In certain embodiments, the site of 15 transplantation is a diseased organ or tissue in need of cosmesis. In other embodiments the site of transplantation is subcutaneous, intraperitoneal, topical, intrasynovial, vaginal, rectal, or intrathecal. Preferably, the subject is mammalian, more preferably, the subject is human. The cell of the invention can be induced to differentiate in vitro or after implantation into a patient. In certain aspects of the invention, the ECAPCs are introduced along with support cells that 20 provide an environment suitable for the in vivo differentiation of the ECAPCs. The support cells can be derived from any source, e.g., from primary cultures and/or cell lines. In some embodiments, the support cells are obtained autologously. In other embodiments, the support cells are obtained allogeneically. In certain embodiments, an ECAPC is provided to a subject in combination with a 25 pharmaceutically acceptable carrier for a therapeutic application to an animal, including but not limited to imparting weight loss, for alleviating the symptoms of Type II diabetes, tissue repair, regeneration, reconstruction or enhancement, and the like. The ECAPC can, in an alternative embodiment, be administered to a host in a two- or three-dimensional matrix for a desired therapeutic purpose. 30 In certain embdoiments, the ECAPCs are encapsulated in a biomaterial compatible with transplantation into a mammal, preferably a human and then transplanting the encapsulated cells into an animal. The encapsulation material should be selected not hinder the release of desired proteins secreted by the cells. The materials used include but are not limited to collagen derivatives, hydrogels, calcium alginate, agarose, hyaluronic acid, poly-lactic acid/poly-glycolic acid derivatives 35 and fibrin. In certain embodiments, transplanted cells and/or their progeny are evaluated histologically for evidence of rejection, teratoma formation, and efficacy. 48 WO 2011/150105 PCT/US2011/037969 Example 13. Discovery of embryonic progenitor cell lines expressing BMP2 and BMP7. Loss of bone mass such as occurs in age-related osteoporosis or osteonecrosis is a large and growing health care problem despite the availability of recombinant growth factors such as BMP2 and BMP7 (also known as osteogenic protein-i (OP-1)) that are capable of inducing new bone 5 formation. Cell lines of the present invention capable of expressing relatively high levels of these factors could provide novel therapies wherein these and other useful osteogenic factors are administered through cell transplantaion where the cell lines of the present invention continuously secrete osteogenic factors over an extended period of time. The cell line Z2 (P12) was differentiated for 14 days in the presence of recombinant human EGF (100ng/ml). The expression of BMP2 by 10 microarray showed a RFU value of 1015, and BMP an RFU value of 1084 where an RFU value >150 was considered positive. The cell lines of the present invention 7SM007 (also designated ACTC298 and used at PI8), C4.4 (also designated ACTC87 and used at P14), E44 (also designated ACTC170 and used at P18), E69 (also designated ACTCiOi and used at P15), SK17 (also designated ACTC162 and used at 15 P14), SK31 (also designated ACTC164 used at P15), SM35 (also designated ACTC260 used at P12), T36 (also designated ACTC198 used at P19), T43 (also designated ACTC120 used at P17), WI I (also designated ACTC197 used at P12), and Z2 (also designated ACTC255 used at P12), are cultured to five day quiescence as described herein or alternatively exposed to differentiation conditions of Differentiation Factor Protocol I in Table VIII. Individual differentiation factors from 20 Table III tested in this example included 1.0 uM all-trans retinoic acid (Sigma R2625), iong/mL SCF, iong/mL bFGF, 100 ng/mL Activin, 100 ng/mL Noggin, 20 ng/mL HGF, 100 ng/mL EGF, or 100 ng/mL NGF for 7 days in the case of 7SM007, E44, and T43, and 14 days in the case of C4.4SK17 E69, SK17, SK31, SM35, T36, WI1, and Z2. RNA was isolated as described herein and analyzed by Illumina microarrays. 25 At five days of quiescence, the line Z2 differentially expressed gene expression markers such as UGT2B]7 (Illumina probe ID 6860392, accession number NM_001077.2), copy-number variation of which is associated with susceptibility to osteoporosis, UGT2B1O, MASPI, Amelotin (AMTN) which is specifically expressed in maturation-stage ameloblasts, and FOXQ1. The most distal HOX gene expression is HOXC6, these markers being rarely observed in the other cell clonal embryonic 30 progenitor cell lines of the present invention. Surprisingly, in the case of the cell line Z2 (P12) differentiation for 14 days in the presence of recombinant human EGF (100ng/ml) led to marked expression of both BMP2 and BMP7 transcripts where BMP2 by microarray showed a RFU value of 1015, and BMP7 an RFU value of 1084 where an RFU value >150 was considered positive. Still significant, though lower amounts of BMP7 expression were observed with cells treated for 14 days 35 in i.OuM retinoic acid (271 RFU) and 10 ng/mL of bFGF (196 RFU). While BMP2 transcript was seen in several lines, BMP7 was not previously observed in the cell lines of the present invention, not even in numerous adult-derived cells such as osteoblasts, bone marrow mesenchymal stem cells, 49 WO 2011/150105 PCT/US2011/037969 dermal fibroblasts, or articular chondrocytes. This is also surprising since there is no knowledge in the art that cells hES-derived clonal progenitors with the gene expression markers of the line Z2 would be capable of expressing these two genes at such relatively high levels. Such cells can be useful in the treatment of disorders associated with poor bone formation, 5 poor repair of fractures, osteonecrosis, or spinal trauma wherein fusion of vertebrae would stabilize the spinal cord. Treatments include the use of the cells of the present invention as transplant therapy into the site requiring osteogenesis, or the use of the cells in vitro as a means of manufacturing the factors, such as the use of Secreted Protein Isolation Protocol 1 or Secreted Protein Isolation Protocol 2 described herein. 10 Example 14. Renin-expressing cell lines. Renin is a regulatory component of the renin-angiotensin system. It plays an important role in the regulation of blood pressure and fluid balance. Renin is expressed in the juxtaglomerular cells (JG cells, also known as granular cells) of the kidney which synthesize, store, and secrete the 15 enzyme. It is also occasionally expressed in interlobular and perinrenal arteries. When released, renin cleaves angioteninogen to produce angiotensin I which may be further processed by angiotensin converting enzyme (ACE) to produce angiotensin II that has multiple activities that ultimately elevate systemic blood pressure and electrolyte retention by the kidney. Juxtaglomerular cells are specialized smooth muscle cells in the wall of afferent renal arterioles that deliver blood to the 20 glomerulus. The cell lines of the present invention 7SM007 (also designated ACTC298 and used at P18), C4.4 (also designated ACTC87 and used at P14), E44 (also designated ACTC170 and used at P18), E69 (also designated ACTC101 and used at P15), SK17 (also designated ACTC162 and used at P14), SK31 (also designated ACTC164 used at P15), SM35 (also designated ACTC260 used at P12), T36 (also designated ACTC198 used at P19), T43 (also designated ACTC120 used at P17), WI 1 25 (also designated ACTC197 used at P12), and Z2 (also designated ACTC255 used at P12), and cultured to five day quiescence as described herein or alternatively exposed to differentiation conditions of Differentiation Factor Protocol I in Table VIII. Individual differentiation factors from Table III tested in this example included 1.0 uM all-trans retinoic acid (Sigma R2625), lOng/mL SCF, lOng/mL bFGF, 100 ng/mL Activin, 100 ng/mL Noggin, 20 ng/mL HGF, 100 ng/mL EGF, or 30 100 ng/mL NGF for 7 days in the case of 7SM007, E44, and T43, and 14 days in the case of C4.4SK17 E69, SK17, SK31, SM35, T36, WI 1, and Z2. RNA was isolated as described herein and analyzed by Illumina microarrays. At five days of quiescence, the line SK17 differentially expressed skeletal muscle markers such as MYOD] (Illumina probe ID 5570307, accession number NM_002478.4), MYOG (Illumina 35 probe ID 4200224, accession number NM_002479.4), CDH15 (Illumina probe ID 5090195, accession number NM_004933.2), MYLPF (Illumina probe ID 6840092, accession number NM_013292.3), ART3 (Illumina probe ID 7040497, accession number NM_001179.3), SHD 50 WO 2011/150105 PCT/US2011/037969 (Illumina probe ID 730093, accession number NM_020209.2), JPH1 (Illumina probe ID 5490025, accession number NM_020647.2), and MYH3 (Illumina probe ID 1070541, accession number NM_002470.2) rarely observed in the other cell clonal embryonic progenitor cell lines of the present invention. Surprisingly, after day 14 the addition of retinoic acid to SK17 markedly upregulated the 5 smooth muscle marker MYH1I (Illumina probe ID6280133, accession numberNM_002474.2) to 1715 RFUs as well as renin (REN; Illumina probe ID 780768, accession number NM_000537.2) not previously observed in the cell lines of the present invention. This is also surprising since while the embryological origins of renin-expressing cells is a matter of dispute, it is generally believed that they arise from metanephric blastema (Maria Luisa S. et al, 2001. Embryonic origin and lineage of 10 juxtaglomerular cells Am J Physiol Renal Physiol 281: F345-F356), and therefore would not be expected to differentiate from a clonal embryonic progenitor cell line expressing skeletal muscle progenitor markers. Such cells can be useful in the treatment of disorders associated with low or dysfunction renin expression including but not limited to renal tubular dysgenesis. Treatments include the use of 15 the cells of the present invention as transplant therapy into dysfunctional kidney or elsewhere in the body to replace lost or dysfunctional renin-secreting cells, or the use of the cells in vitro as a means of manufacturing renin. Example 15 - Unique fate space of WI 1 20 The clonal human embryonic progenitor cell line W 11 was derived from the registered parental hES cell line H9 (WA09) as described (West et al., 2008, Regenerative Medicine vol. 3(3) pp. 287-308). It expresses killer cell lectin-like receptor subfamily C, member 2 and 3 (KLRC2, KLRC3), and Sulfotransferase 1C2 (SULT1C4) that Catalyzes the sulfate conjugation of many drugs and therefore useful in drug discovery. It also expresses BMP5. The most distal HOX gene 25 expression is HOXB2, C6. Upon differentiation under conditions described as In vitro conditions to induce chondrogenenesis - Micromass Culture in Table VIII, the line up-regulates smooth muscle markers such as MYH11. Example 16 - Unique fate space of SK31 30 The clonal human embryonic progenitor cell line SK31 was derived from the registered parental hES cell line H9 (WA09) as described (West et al., 2008, Regenerative Medicine vol. 3(3) pp. 287-308). It expresses ART3, CSAG3A, CSAG3B and oculocutaneous albinism II (OCA2). The most distal HOX gene expression is HOXA5, HOXB8, HOXD13. Upon differentiation under conditions described as In vitro conditions to induce chondrogenenesis - Micromass Culture in Table 35 VIII, the line up-regulates tyrosinase-related protein 1 (TYRPi). 51 WO 2011/150105 PCT/US2011/037969 Example 17 - Unique fate space of SM35 The clonal human embryonic progenitor cell line SM35 was derived from the registered parental hES cell line H9 (WA09) as described (West et al., 2008, Regenerative Medicine vol. 3(3) pp. 287-308). It expresses KLF5, CCDC3, NCAM1, and AMTN. The most distal HOX gene 5 expression is HOXC6. Upon differentiation under conditions described as In vitro conditions to induce chondrogenenesis - Micromass Culture in Table VIII. The line up-regulates LAIR2 implicated in the modulation of mucosal tolerance. Example 18 - The discovery of novel endothelial progenitors 10 There is a widespread interest in understanding the biology of angiogenesis and the invention of means to induce vasculogenesis, neoangiogenesis, and vascular repair in vivo for therapeutic effect. To discover which of the cell lines of the present invention are capable of differentiation into vascular endothelium, As described in Example 10, the cell line W1O (also known as ACTC196) which when cultured > 21 doublings of clonal expansion since derivation expresses the differential 15 markers: HAND2 (Illumina probe ID 4640563, accession number NM_021973.2), GPR44 (Illumina probe ID 940519, accession number NM_004778.2), SLC7A]4 (Illumina probe ID 6100717, accession number NM_020949.1), ACTN3 (Illumina probe ID 830348, accession number NM_001104.1), SULT1C4 (Illumina probe ID 4610593, accession number NM_006588.2), AMOT (Illumina probe ID 3290646, accession number NM_133265.2), FOXF] (Illumina probe ID 20 3800554, accession number NM_001451.2), NOVA] (Illumina probe ID 3780402, accession number NM_006491.2), and SCARA5 (Illumina probe ID 1030477, accession number NM_173833.4), positive cell line W1O whose most distal HOX gene expression was HOXA4, B7, which is described in U.S. patent application Ser. No. 12/504,630 filed on July 16, 2009 and titled "Methods to Accelerate the Isolation of Novel Cell Strains from Pluripotent Stem Cells and Cells Obtained 25 Thereby", incorporated herein by reference in its entirety, and whose gene expression markers at 18 21 doublings of clonal expansion are disclosed in Table 1, and which is capable of differentiation into smooth muscle cells expressing MYH11, was assayed for capacity to differentiate into endothelial cells using the Endothelial Formation Protocol (Tube Formation) described in Table VIII, using HUVECs as a positive control. In brief, W1O and HUVEC cells were cultured in 12 wells 30 (24well plate) coated with 250 ml of matrigel for each cell line. 1x105 cells wwere plated per well (12 wells per cell line). The cells were cultured in EGM2 medium (containing VEGF, IGF and EGF as growth factors), as well as in their corresponding growth media lacking endothelial growth factors. The cell lines W10 and were routinely grown in endothelial medium with no VWF or CHD5 expression while in the undifferentiated state. One of the differential markers of this cell line is 35 HAND2 generally thought to be a marker of neural crest lineages that are believed to be incapable of endothelial differentiation. The cell W1O also did not express KDR as judged by microarray expression using Ilumina probe ID 5270452 (accession number NM_002253.1) which is 52 WO 2011/150105 PCT/US2011/037969 known in the art as one of the earliest markers of endothelial cell fate. However, surprisingly, when incubated 16 hours at 37 0 C. using the Endothelial Formation Protocol (Tube Formation), W10 cells formed endothelial tubes similar to that of HUVECs (see Figure 3). Cell lines with markers of cell line W10 allow a direct scalability of vascular progenitors and 5 are therefore useful in the scale up of cells for research and therapy. They are also useful as cells delivered intraveneously to induce angiogenesis in tissues such as ischemic myocatdial or other tissues as occurs in aging or peripheral artery disease, or non healing cutaneous ulcers. The cells can be enhanced to target particular tissues when administered intraveneously through the addition of cell surface associated antibodies or peptides such as peptides designed to target diseased or ischemic 10 tissue such as those described in US Patents 6,180,084 and 6,491,894; both to Rouslahti Erkki, et al. and titled "NGR receptor and methods of identifying tumor homing molecules that home to angiogenic vasculature using same" and US Patent 6,576,239, to Rouslahti Erkki, et al. and titled "Angiogenic homing molecules and conjugates derived therefrom" each of which is incorporated herein by reference. In addition, the cells are useful in targeting tumor vascualture to deliver suicide 15 constructs to destroy tumors as described in W02003/061591 to West entitled "Stem Cell-Derived Endothelial Cells Modified to Disrupt Tumor Angiogenesis" and incorporated herein by reference. Cell lines with the differential markers of the line W10 as described herein are also useful for research in angiogenesis including the study of alterations in gene expression, miRNA expression, and protein composition in cells during the differentiation of cells into varied types of endothelial 20 cells. One skilled in the art would also understand that such cells may be transfected with promoter constructs including CDH5 or other endothelial-specific genes driving the expression of a marker gene or constitutively expressing a marker genes including but not limited to GFP, luciferase, beta galactosidase, or other similar markers in order to track the integration of said cells into the tissues or vascularization of animals, including humans for basic research and for the diagnosis of vascular 25 disorders and cancer wherein cancers display an enhanced vascular turnover. One skilled in the art would also understand that said cells expressing the molecular markers of the cell line W10 capable of undergoing endothelial differentiation can also be generated from pluripotent stem cells such as hES, hiPS, and other primordial stem cells including but not limited to cell banks made under GMP conditions or cells engineered to excape immune surveillance such as by the modification of 30 placental HLA genes such as HLAG or HLAH as described in W02008/121894 to Hantash entitled "Endogenous expression of HLA-G and/or HLA-E by Mesenchymal Cells" incorporate herein by reference for the purpose of making said cells more suitable of transplant therapy in humans. Example 19 - The discovery of novel bioactive secreted protein formulations 35 The cell lines 7SMOO32, WIO, 7PEND24, 7SM007, 4D20.8, SM28, EN2, ZI1,EN13, EN31, EN47, EN55, MWi, Wi1, E44, E68, Ei1, MEL2, ENi, EN26, Zi, Z2, EN4, RAPEND18, 7PEND30, E33, SM2, SM30, EN7, EN42, T14, U31, F15, W8, E164, T43, 7PEND9, RAD20.16, 53 WO 2011/150105 PCT/US2011/037969 T44, EN51, RAPEND15, EN16, B16, 7SM0025, RAD20.6, E69, SM33, SKI, EN18, SK25, SM35, 7PEND12, SK47, CMO2, SK17, 7SKEL4, SK49, SK46, RASKEL18, E15, RASMO19, T7, SM8, SM22, SK18, SK31, Z3, T42, 7SM009, 10RPE8, RAD20.24, 7SM007, RASMO12, T36, RAD20.5, T20, E120, 4D20.9, E85, C4ELSR10, C4ELSR5.1, C4ELS5.6, RAD20.19, and 4.4 are 5 expanded in vitro > 21 doublings of clonal expansion since they were isolated from hES-derived cells, synchronized in quiescence by growing to confluence and replacing the media with media supplemented with a 10-fold reduction in serum or other mitogens as described herein. Secreted and extracellular matrix pooled proteins from the cell lines are prepared and screened as described in the method titled Screening of secreted or extracellular matrix proteins for biological activity above. 10 Pooled proteins are mixed with HyStem matrix as described herein and screened for the ability of reducing scarring and improving healing in murine models of wound repair. Example 20. Screening for cells with osteogenic potential. The cells of the present invention are screened for osteogenic potential by means known in 15 the art, or means simulating conditions leading to bone in normal embryogenesis. By way of nonlimiting example, tissue culture plates were exposed to 12ug/mL of Type I collagen (gelatin) and 12 ug/mL of vitronectin for 24 hours. This gelatin/vitronectin solution was then aspirated and the cell lines of the present invention: CM02, E15, E33, E68, SKI1, 4SKEL20, 4D20.8, SM30, J16, and mesenchymal stem cells were plated to confluence and exposed to osteogenic media as described in 20 Table VIII Osteogenic Protocol 1 for 15-21 days. Osteogenesis was scored based on the intensity of calcium deposit staining by Alizarin Red and visualized by phase contrast as described in Table VIII. The cell lines E15, SKI 1, 4D20.8, showed strong staining, providing evidence that they are capable of producing bone. Such bone-forming cells are useful in research in the embryological origins of diverse types of bone and for therapy, such as in the repair of fractured or otherwise injured bone 25 resulting from trauma or surgery, or from bone forming disorders including age-related osteoporosis. Example 21. Discovery of the differentiation potential of cells with the pattern of gene expression of the cell line B 16. The cell line of the present invention designated B 16 (ACTC59) that expresses the unique 30 pattern of markers MKX (accession number NM_173576.1), CDH1O (accession number NM_006727.2), MEG3 (accession number NR_002766.1), SCUBE3 (accession number NM_152753.2), and distal HOX genes HOXA11 (accession number NM_000522.3), and HOXD11 (accession number NM_021192.2) when synchronized at quiescence as described herein by culturing 5 days at confluence in DMEM medium with 0.5% serum at passage 16-19 was differentiated in 35 micromass conditions and in a hydrogel containing crosslinked hyaluronic acid and gelatin with supplemented growth factors from Table III as described in Table VIII under the headings "In vitro conditions to induce chondrogenenesis - Micromass Culture" and "Differentiation in gels containing 54 WO 2011/150105 PCT/US2011/037969 crosslinked hyaluronic acid and gelatin" in the presence of TGFP3 and retinoic acid as also described in Table VIII under the subheadings "Differentiation in Hydrogels Containing Crosslinked Hyaluronic Acid and Gelatin to Induce Chondrogenesis" and "Retinoic acid and EGF-Containing HyStem-CSS" respectively. Differentiation under conditions described in Table VIII under the 5 headings "In vitro conditions to induce chondrogenenesis - Micromass Culture" led to a profound upregulation of ANGPTL7 (accession number NM_021146.2), INSL5 (accession number NM_005478.3), the tendon marker TNMD (accession number NM_022144.1), and the tendon marker THBS4 (accession number NM_003248.3). The resulting cells are therefore useful in the treatment of tendon injuries and tendonitis, or inhibit angiogenesis in a given tissue, such as to prevent 10 neovascularization in the cornea, retina, and to inhibit angiogenesis and thereby the growth of malignant tumors. In the differentiation conditions described in Table VIII as "Differentiation in gels containing crosslinked hyaluronic acid and gelatin" in the presence of TGF3 led to a similar upregulation of ANGPTL7 (accession number NM_021146.2), INSL5 (accession number NM_005478.3), and the tendon marker TNMD (accession number NM_022144.1). In the 15 differentiation conditions described in Table VIII as "Differentiation in gels containing crosslinked hyaluronic acid and gelatin" in the presence of retinoic acid led to a marked upregulation of natriuretic peptide precursor B (NPPB, accession number NM_002521.2) to 11,851 RFUs of expression. The natriuretic protein encoded by NPPB would be useful in the treatment of heart failure in a manner similar to the exogenous, often intravenous administration of the recombinant protein 20 Nesiritide (Scios) encoded by NPPB is useful for the treatment of heart failure by causing vasodilation and reducing blood pressure and the load on the heart. Unlike the intravenous administration of the natriuretic protein encoded by NPPB, stable engraftment of cells expressing the protein can be utilized to provide a more stable level of expression of the protein over time. Table I: Exemplary progenitor cell lines and associated gene expression markers at 18-21 doublings of clonal expansion The group of cell lines X2.1 (also known as 2.1 and ACTC63), X2.2 (also known as X2.2Repl and X2.2Rep2 and 2.2 and ACTC62) are positive for the markers: CFB, CLDN11, COMP, CRLF1, EGR2, FST, KRT14, KRT19, KRT34, MFAP5, MGP, PENK, PITX2, POSTN, PTGS2, RARRESI, S100A4, SOD3, TFPJ2, THY1 and ZICI and are negative for the markers: AGC1, ALDH1A1, APCDD1, AREG, ATP8B4, C6, C7, C20orf103, CCDC3, CDH3, CDH6, CNTNAP2, COPI, CXADR, D102, METTL7A, DKK2, DLK1, EMIDI, FGFR3, FMO3, FOXF1, FOXF2, GABRB1, GDF10, GSC, HSDI1B2, HSD17B2, HSPA6, HSPB3, ID4, IGF2, IGFBP5, INA, KCNMB1, IGFL3, LOC92196, MEOXI, MSX2, MX1, MYBPH, MYH11, MYL4, NLGN4X, NPPB, PAX2, PAX9, PDE1A, PRELP, PROMI, RASDI, RELN, RGS1, RPS4Y2, SFRP2, SMOCI, SMOC2, SNAP25, SYT12, TAC1, RSPO3, TUBB4, UGT2B7, WISP2, ZD52F1O and ZIC2. 55 WO 2011/150105 PCT/US2011/037969 The cell line BI is positive for the markers: CD24, CDH6, HTRA3, INA, KRT17, KRT19, LAMC2, MMP1, 1L32, TAGLN3, PAX2, RELN, UGT2B7 and ZIC2 and is negative for the markers: ACTC, AGC1, ALDH1A1, APCDD1, ATP8B4, BEXI, CFB, C3, C6, C7, PRSS35, C20orflO3, CCDC3, CDH3, CNTNAP2, COL15A1, COL21A1, COPI, CRLF1, D102, METTL7A, DKK2, DLK1, DPT, EGR2, EMIDI, FGFR3, TMEM100, FMO1, FM03, FOXF1, FOXF2, FST, GABRB1, GAP43, GDF1O, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, ID4, IFI27, IGF2, KCNMB1, KIAA0644, KRT14, TMEM119, IGFL3, LOC92196, MFAP5, MASP1, MEOX2, MGP, MYBPH, MYH3, MYH11, MYL4, NPAS1, OGN, OLR1, OSR2, PAX9, PDE1A, PENK, POSTN, PRELP, PRG4, PROMI, PRRX1, PRRX2, PTN, PTPRN, RARRES1, RASDI, RGMA, RGSI, SERPINA3, SLITRK6, SMOCI, SMOC2, SNAP25, SOD3, STMN2, TAC1, RSPO3, TNNT2, TRH, TSLP, TUBB4, WISP2 and ZIC1. The group of cell lines X4.1, X4.3 and B1O are positive for the markers: MMP1, AQP1, CDH6, HTRA3, INA, KRT19, LAMC2, 1L32, TAGLN3, NPPB and UGT2B7 and are negative for the markers: AGC1, ALDH1A1, APCDD1, AREG, ATP8B4, CFB, C3, C6, C7, C20orflO3, CNTNAP2, COL21A1, COMP, COPI, CRLF1, D102, METTL7A, DKK2, DLK1, DPT, EMIDI, TMEM100, FMO1, FM03, FOXF1, FOXF2, GABRB1, GAP43, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, ID4, IFI27, IFIT3, IGF2, KRT14, TMEM119, LOC92196, MASPI, MEOX2, MGP, MYBPH, MYH3, MYL4, OGN, OSR2, PAX9, PDE1A, PENK, PRELP, PRRX2, PTN, RARRES1, RGMA, RGSI, RPS4Y2, SERPINA3, SLITRK6, SMOCI, SMOC2, TAC1, RSP03, TNNT2, TRH, TUBB4 and WISP2. The group of cell lines B1, B25, B26 and B3 are positive for the markers: AKR1C1, CFB, BMP4, CLDN11, FST, GDF5, HTRA3, ILIRI, KRT14, KRT19, KRT34, MGP, MMP1, PODN, POSTN, PRG4, RARRESI, S100A4, THY1 and ZICI and are negative for the markers: ACTC, ALDH1A1, APCDD1, C6, C7, C20orfl03, CCDC3, CD24, CXADR, D102, DKK2, DLK1, EMIDI, FGFR3, FMO1, FM03, FOXF1, FOXF2, GABRB1, GDF1O, HSD11B2, HSD17B2, HSPA6, HSPB3, ID4, IGF2, INA, KCNMB1, IGFL3, LOC92196, MEOXI, MSX1, MYBPH, MYH3, MYH11, MYL4, NLGN4X, TAGLN3, NPPB, OLR1, PAX2, PAX9, PROMI, RASDI, RGSI, RPS4Y2, SLITRK6, SMOCI, SMOC2, SNAP25, TAC1, RSP03, TUBB4, UGT2B7, ZD52F1O and ZIC2. The group of cell lines B12 and B4 are positive for the markers: CLDN11, FST, GDF5, HTRA3, KRT19, KRT34, MFAP5, MGP, MMP1, POSTN, PTGS2, S100A4, THYl and ZICI and are negative for the markers: AGC1, ALDH1A1, APCDD1, AREG, ATP8B4, C3, C6, C7, C20orflO3, CCDC3, CDH3, CNTNAP2, COPI, CXADR, D102, DKK2, DLK1, DPT, EMIDI, FMO1, FM03, FOXF1, FOXF2, GABRB1, GDF1O, HOXA5, HSD11B2, HSD17B2, HSPA6, HSPB3, IGFBP5, IGFL3, LOC92196, MEOXI, MYBPH, MYH3, MYHl1, MYL4, NPAS1, NPPB, OLR1, PAX2, PAX9, PITX2, PROMI, RGSI, SLITRK6, SMOCI, SMOC2, SNAP25, TAC1, RSP03, TNNT2, TRH, TUBB4, ZD52F1O and ZIC2. The group of cell lines B20 and B15 are positive for the markers: BMP4, CD24, CRIPI, HTRA3, KRT19, LAMC2, MGP, MMP1, POSTN, RELN, S100A4, THYl and UGT2B7 and are negative for the markers: AGC1, ALDH1A1, ANXA8, AREG, ATP8B4, CFB, C6, C7, C20orflO3, CNTNAP2, D102, METTL7A, DLK1, DPT, EMIDI, TMEM100, FMO1, FM03, FOXF2, GABRB1, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, ID4, IFI27, KRT14, KRT34, IGFL3, MASPI, MEOXI, MEOX2, MYBPH, MYH3, MYL4, NPAS1, NPPB, OGN, OLR1, OSR2, PAX9, PDE1A, PENK, PROMI, PRRX2, RGSI, SLITRK6, SMOCI, SMOC2, STMN2, TAC1, TNNT2, TRH, TUBB4, WISP2 and ZIC1. The group of cell lines B16Biolb, B16Bio2b, E72 and E75 are positive for the markers: AKR1C1, BMP4, CLDN11, FST, GDF5, HTRA3, ILIRI, KRT19, KRT34, MFAP5, MGP, MMP1, OSR2, PODN, POSTN, PRG4, PRRX1, RARRES1, S100A4, SOD3, THYl and ZICI and are negative for the markers: ACTC, AGC1, ALDH1A1, AREG, C6, C7, C20orflO3, CCDC3, CDH3, CNTNAP2, DKK2, EMIDI, FGFR3, FMO3, FOXF1, FOXF2, GABRB1, GDF10, HSD11B2, HSD17B2, HSPA6, ID4, IGF2, INA, LAMC2, IGFL3, LOC92196, MEOXI, MSX1, MYBPH, MYH11, MYL4, NLGN4X, NPAS1, NPPB, OLR1, PAX2, PAX9, PROMI, PTPRN, RASDI, RGSI, SLITRK6, SMOCI, SMOC2, SNAP25, TACI, RSPO3, TNNT2, TUBB4, ZD52F1O and ZIC2. The group of cell lines B17Biolb, B17Bio2c and B17Bio3c are positive for the markers: BEXI, COL15A1, CRIPI, CRYAB, HTRA3, KCNMB1, KRT19, MGP, POSTN, S100A4, SFRP2, THYl and TNFSF7 and are negative for the markers: , AGC1, ALDH1A1, APCDD1, AREG, ATP8B4, C6, C7, CNTNAP2, METTL7A, DLK1, DPT, EMIDI, FMO1, FMO3, FOXF1, GABRB1, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, IFI27, KRT14, KRT34, IGFL3, MASPI, MEOXI, MEOX2, MYBPH, MYH3, MYL4, NPPB, OGN, PAX9, PDE1A, PENK, PROMI, RASDI, RGSI, SLITRK6, SMOCI, SMOC2, STMN2, TACI, TRH, TSLP, TUBB4 and ZICI. 56 WO 2011/150105 PCT/US2011/037969 The group of cell lines B2, B7 and X6.1 are positive for the markers: AKR1C1, CFB, BMP4, C3, CLDN11, COL21A1, FST, GDF5, HTRA3, ICAM5, ILIRI, KRT19, MGP, MMP1, PENK, PODN, POSTN, PRG4, RARRES1, RGMA, S100A4, SERPINA3, SOD3, STMN2, THYl and WISP2 and are negative for the markers: ACTC, AGC1, ALDH1A1, C6, C7, C20orflO3, CCDC3, CD24, CDH3, CXADR, D102, DLK1, EMIDI, FGFR3, FMO3, FOXF1, FOXF2, GABRB1, GDF1O, HSD11B2, HSD17B2, HSPA6, HSPB3, ID4, IGF2, INA, IGFL3, LOC92196, MEOXI, MYH11, MYL4, NLGN4X, TAGLN3, NPAS1, NPPB, OLR1, PAX2, PAX9, PITX2, PROMI, PTPRN, RASD1, RGS1, RPS4Y2, SLITRK6, SMOCI, SMOC2, SNAP25, SOXI1, TAC1, RSPO3, TUBB4, UGT2B7, ZD52F1O and ZIC2. The group of cell lines B22, CM30.2 and X6 are positive for the markers: BMP4, CLDN11, CRIPI, CRYAB, HTRA3, KRT19, S100A4, SFRP2, SRCRB4D, THYl and UGT2B7 and are negative for the markers: AGC1, ALDH1A1, APCDD1, AREG, ATP8B4, C3, C6, C7, C20orflO3, CDH3, CNTNAP2, COL21A1, COPI, D102, METTL7A, DKK2, DLK1, DPT, FMO1, FMO3, FOXF1, FOXF2, GABRB1, GSC, HOXA5, HSD11B2, HSPA6, IFI27, IFIT3, IGF2, KRT14, MASPI, MEOX2, MYBPH, MYH3, MYH11, NPPB, OGN, OLR1, OSR2, PAX9, PDE1A, PENK, PROMI, RGS1, SMOCI, SNAP25, STMN2, TACI, TRH, TSLP, TUBB4 and WISP2. The group of cell lines B27, B9, CM10.1, X2, X4.2 and X4.4 are positive for the markers: HTRA3, KRT19, LAMC2, 1L32, TAGLN3, PAX2, RELN and UGT2B7 and are negative for the markers: AGC1, ALDH1A1, APCDD1, AREG, ATP8B4, CFB, C3, C6, C7, C20orflO3, CCDC3, CDH3, CNTNAP2, COL21A1, COPI, CRLF1, D102, METTL7A, DLK1, DPT, EMIDI, TMEM100, FMO1, FMO3, FOXF1, FOXF2, GABRB1, GAP43, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, IFI27, IGF2, KIAA0644, KRT14, IGFL3, LOC92196, MASPI, MEOX2, MGP, MYH3, MYH1l, MYL4, NPAS1, OGN, OLR1, OSR2, PAX9, PDE1A, PENK, PRELP, PTN, RARRESI, RGMA, RGS1, SERPINA3, SLITRK6, SMOCI, SMOC2, SNAP25, SOD3, STMN2, TACI, RSPO3, TNNT2, TRH, TUBB4 and WISP2. The cell line B28 is positive for the markers: CFB, BMP4, COL15A1, CRIPI, CRYAB, FST, GAP43, ILIRI, KCNMB1, KRT14, KRT19, KRT34, MFAP5, MGP, MMP1, 1L32, PODN, POSTN, S100A4, THYl and ZICI and are negative for the markers: ACTC, ALDH1A1, ANXA8, AREG, ATP8B4, BEXI, C3, C6, C7, C20orflO3, CCDC3, CNTNAP2, CXADR, D102, METTL7A, DKK2, DLK1, EMIDI, FGFR3, FMO1, FMO3, FOXF1, FOXF2, GABRB1, GDF10, HOXA5, HSD11B2, HSD17B2, HSPA6, ID4, IFI27, IGF2, IGFBP5, INA, IGFL3, LOC92196, MASPI, MEOXI, MYBPH, MYH3, MYL4, NLGN4X, NPAS1, NPPB, OLR1, PAX9, PDE1A, PITX2, PROMI, PTPRN, RASD1, RGS1, RPS4Y2, SLITRK6, SMOCI, SMOC2, SNAP25, STMN2, TACI, TRH, TSLP, TUBB4, ZD52F1O and ZIC2. The cell line B29 is positive for the markers: ANXA8, AQP1, CD24, CDH6, CRIPI, GJB2, HTRA3, KRT17, KRT19, LAMC2, 1L32, TAGLN3, PAX2, RELN, S100A4, SFRP2, SRCRB4D, THY1, TNFSF7, UGT2B7, ZD52F1O and ZIC2 and are negative for the markers: AGC1, ALDH1A1, APCDD1, AREG, ATP8B4, BEXI, C3, C6, C7, C20orflO3, CCDC3, CLDN11, CNTNAP2, COL21A1, COPI, CRLF1, D102, METTL7A, DLK1, DPT, EMIDI, TMEM100, FMO1, FMO3, FOXF1, FOXF2, GABRB1, GAP43, GDF1O, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, HSPB3, IFI27, IFIT3, IGF2, KRT14, KRT34, IGFL3, MFAP5, MASPI, MEOX2, MMP1, MSX1, MYBPH, MYH3, MYL4, NPAS1, NPPB, OGN, OLR1, OSR2, PAX9, PDE1A, PENK, PITX2, POSTN, PRG4, PROMI, PRRX2, PTPRN, RARRES1, RASD1, RGS1, RPS4Y2, SERPINA3, SLITRK6, SMOCI, SMOC2, SNAP25, SOD3, STMN2, TACI, RSPO3, TRH, TSLP, TUBB4, WISP2 and ZIC1. The cell line B30 is positive for the markers: PRSS35, CDH6, COL21A1, CRIPI, CRYAB, DKK2, GAP43, KCNMB1, KRT17, KRT19, PRRX1, PTN, RGMA, S100A4, SOXI and ZIC2 and are negative for the markers: ACTC, AGC1, AKR1C1, ALDH1A1, ANXA8, APCDD1, AQP1, AREG, ATP8B4, CFB, C3, C6, C7, C20orflO3, CD24, CDH3, CLDN11, CNTNAP2, COL15A1, COMP, COPI, CRLF1, METTL7A, DPT, EGR2, EMIDI, TMEM100, FMO1, FMO3, FOXF1, FOXF2, GABRB1, GDF1O, GJB2, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, HSPB3, IFI27, IFIT3, IGF2, KRT34, LAMC2, IGFL3, LOC92196, MFAP5, MASPI, MEOXI, MEOX2, MSX1, MYBPH, MYH3, MYL4, NLGN4X, NPPB, OGN, OLR1, PAX2, PAX9, PDE1A, PENK, PITX2, PRG4, PROMI, PTPRN, RARRESI, RASD1, RELN, RGS1, RPS4Y2, SFRP2, SLITRK6, SMOCI, SNAP25, STMN2, TACI, TFPI2, TNFSF7, TNNT2, TRH, TSLP, TUBB4, UGT2B7, WISP2, ZD52F1O and ZIC1. 57 WO 2011/150105 PCT/US2011/037969 The cell line B6 is positive for the markers: CCDC3, CDH6, COL15A1, CRIPI, DKK2, FST, GDF1O, HTRA3, KRT19, LOC92196, MYL4, NLGN4X, S100A4, SOXI1, SRCRB4D, THY1, ZICI and ZIC2 and are negative for the markers: AGC1, AKR1C1, ALDH1A1, AREG, ATP8B4, BEXI, CFB, C3, C6, C7, CNTNAP2, COMP, COPI, D102, METTL7A, DLK1, DPT, EMIDI, TMEM100, FMO3, FOXF1, FOXF2, GABRB1, GSC, HOXA5, HSD11B2, HSPA6, HSPB3, ID4, IFI27, IFIT3, KRT14, TMEM119, MFAP5, MASPI, MEOXI, MEOX2, MGP, MMP1, MSX2, MYBPH, MYH3, NPAS1, NPPB, OGN, OLR1, OSR2, PAX2, PAX9, PDE1A, PENK, PRG4, PROMI, PTPRN, RASDI, RGSI, RPS4Y2, SLITRK6, SMOCI, SNAP25, STMN2, TAC1, TRH, TSLP, TUBB4, UGT2B7, WISP2 and ZD52F1O. The cell line C4ELS5.1 is positive for the markers: AKR1C1, C7, CDH6, COL15A1, D102, FMO1, FMO3, FOXF2, IGF2, ILIRI, KRT19, LAMC2, TMEM119, PODN, PRRX1, PRRX2, RGMA, SFRP2, TAC1, TFPJ2 and RSPO3 and are negative for the markers: ACTC, AGC1, ALDH1A1, ANXA8, APCDD1, AQP1, AREG, ATP8B4, BEXI, CFB, BMP4, C3, C20orflO3, CCDC3, CDH3, CLDN11, CNTNAP2, COMP, COPI, CRLF1, CRYAB, CXADR, DKK2, DLK1, EGR2, EMIDI, FGFR3, FOXF1, GABRB1, GAP43, GDF1O, GJB2, HOXA5, HSD17B2, HSPA6, HSPB3, ICAM5, ID4, IFI27, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MEOXI, MEOX2, MGP, MMP1, MSX1, MSX2, MX1, MYBPH, MYH3, MYH11, MYL4, 1L32, NLGN4X, TAGLN3, NPAS1, NPPB, OLR1, PAX2, PAX9, PENK, PITX2, POSTN, PRELP, PROMI, PTPRN, RARRESI, RELN, RGSI, RPS4Y2, SMOCI, SMOC2, STMN2, THY1, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, ZD52F1O, ZICI and ZIC2. The cell line C4ELS5.5 is positive for the markers: BEXI, BMP4, C7, PRSS35, CDH6, DKK2, FMO3, FOXF2, FST, GDF1O, HSD17B2, IGF2, TMEM119, PITX2, PODN, PRRX1, SERPINA3, SFRP2, TFPJ2 and ZIC2 and are negative for the markers: AGC1, ALDH1A1, APCDD1, AQP1, AREG, ATP8B4, C3, C6, C20orflO3, CD24, CDH3, CNTNAP2, COMP, COPI, CRLF1, CXADR, DLK1, DPT, EMIDI, FGFR3, TMEM100, FOXF1, GJB2, HOXA5, HSD11B2, HSPA6, HSPB3, ID4, IFI27, KCNMB1, KRT14, KRT17, KRT34, IGFL3, MFAP5, MEOXI, MEOX2, MGP, MMP1, MSX2, MX1, MYBPH, MYH3, MYH11, 1L32, NLGN4X, TAGLN3, NPPB, OGN, OLR1, OSR2, PAX2, PAX9, PDE1A, PENK, PRELP, PRG4, PTPRN, RARRES1, RASDI, RELN, RGSI, SMOC2, STMN2, TACI, THY1, TNFSF7, TNNT2, TRH, TSLP, TUBB4, WISP2, ZD52F1O and ZIC1. The cell line C4ELSR.12 is positive for the markers: C7, CDH6, COL21A1, D102, FMO1, FMO3, FOXF2, FST, IGF2, ILIRI, TMEM119, PRRX1, PRRX2, PTN, RGMA, SFRP2, SRCRB4D, TACI, TFPJ2, RSPO3, UGT2B7 and ZIC2 and are negative for the markers: ACTC, AGC1, ALDH1A1, ANXA8, APCDD1, AQP1, ATP8B4, C3, C20orflO3, CD24, CDH3, CNTNAP2, COMP, COPI, CRLF1, CXADR, DPT, EMIDI, FGFR3, TMEM100, FOXF1, GABRB1, GAP43, GJB2, HOXA5, HSPA6, HSPB3, ICAM5, IFI27, INA, KRT14, KRT17, KRT34, IGFL3, MFAP5, MEOXI, MEOX2, MGP, MMP1, MX1, MYBPH, MYH11, MYL4, 1L32, NLGN4X, NPAS1, NPPB, OLR1, OSR2, PAX2, PAX9, PENK, POSTN, PRELP, PROMI, PTPRN, RARRES1, RASD1, RELN, RGSI, SLITRK6, SMOC2, STMN2, SYT12, THY1, TNFSF7, TNNT2, TRH, TSLP, TUBB4, WISP2, ZD52F1O and ZIC1. The group of cell lines C4ELSR2, C4ELSR2Bio2 and C4ELSR2Bio2.1 are positive for the markers: C7, CDH6, COL21A1, DKK2, FMO3, FST, GSC, IGF2, TMEM119, PITX2, SFRP2, TFPI2 and ZIC2 and are negative for the markers: ACTC, AGC1, ALDH1A1, APCDD1, AQP1, ATP8B4, CFB, C3, C6, CCDC3, CD24, CDH3, CLDN11, CNTNAP2, COMP, COPI, CRLF1, CRYAB, DLK1, DPT, EMIDI, FGFR3, TMEM100, FOXF1, GABRB1, GJB2, HOXA5, HSD11B2, HSD17B2, HSPA6, HSPB3, ID4, IFI27, KIAA0644, KRT14, KRT17, KRT34, IGFL3, MFAP5, MEOXI, MGP, MSX2, MX1, MYBPH, MYH3, MYH11, 1L32, NLGN4X, NPAS1, NPPB, OLR1, PAX2, PAX9, PDE1A, PENK, POSTN, PRELP, PROMI, PTPRN, RARRESI, RASDI, RELN, RGSI, SMOCI, SMOC2, STMN2, THY1, TNFSF7, TRH, TSLP, TUBB4, ZD52F1O and ZIC1. The group of cell lines CMO.2 and E31 are positive for the markers: AQP1, CD24, CDH6, HTRA3, KRT19, KRT34, TAGLN3, RELN, S100A4, SFRP2, SRCRB4D and UGT2B7 and are negative for the markers: AGC1, ALDH1A1, APCDD1, AREG, ATP8B4, CFB, C3, C6, C7, C20orflO3, CDH3, CNTNAP2, COMP, COPI, CRLF1, D102, METTL7A, DLK1, DPT, EMIDI, TMEM100, FMO1, FMO3, FOXF1, FOXF2, GABRB1, GAP43, GSC, HOXA5, HSD11B2, HSPA6, HSPB3, IFI27, IFIT3, IGF2, KRT14, MFAP5, MASPI, MEOX2, MYH3, NPAS1, OGN, OLR1, OSR2, PAX9, PDE1A, PENK, PRG4, PROMI, PTPRN, RARRESI, RASDI, RGSI, SERPINA3, SLITRK6, SMOCI, SMOC2, SNAP25, SOD3, STMN2, TACI, TRH, TSLP, TUBB4 and WISP2. 58 WO 2011/150105 PCT/US2011/037969 The group of cell lines CMO.2, CMO.5 and CM50.5 are positive for the markers: PRSS35, CLDN11, CRIPI, CRYAB, FST, KRT19, KRT34, MFAP5, MEOX2, MGP, MMP1, PODN, POSTN, PRRX1, S100A4, THYl and ZICI and are negative for the markers: ACTC, ALDH1A1, APCDD1, AREG, ATP8B4, BEXI, C3, C6, C7, C20orflO3, CCDC3, CDH3, CNTNAP2, CXADR, D102, DKK2, DLKl, EMIDI, TMEM100, FMO1, FM03, FOXF1, FOXF2, GABRB1, GDFl0, GJB2, GSC, HSD11B2, HSD17B2, HSPA6, IGF2, IGFBP5, INA, LAMC2, IGFL3, LOC92196, MEOXI, MXl, MYBPH, MYL4, NLGN4X, TAGLN3, NPAS1, NPPB, PAX2, PAX9, PDE1A, PENK, PITX2, PROMI, PTPRN, RASDI, RGSI, SLITRK6, SMOCI, SMOC2, SNAP25, STMN2, TAC1, RSP03, TRH, TSLP, TUBB4, ZD52F1O and ZIC2. The group of cell lines CM10.4, CM20.4, CM30.5 and X2.3 are positive for the markers: CLDN11, COMP, CRIPI, FST, KRT19, KRT34, MFAP5, MGP, PITX2, POSTN, S100A4 and THYl and are negative for the markers: ACTC, ALDHlAl, AQP1, ATP8B4, C6, C7, C20orfl03, CCDC3, CDH3, CNTNAP2, COPI, CXADR, METTL7A, DLKl, DPT, EMIDI, FGFR3, TMEM100, FMO1, FM03, FOXF1, FOXF2, GABRB1, GDF1O, HSD11B2, HSD17B2, HSPA6, HSPB3, IGF2, IGFL3, LOC92196, MEOXI, MX1, MYBPH, MYH3, MYH1l, MYL4, NLGN4X, TAGLN3, NPPB, PAX2, PAX9, PDE1A, PRELP, PROMI, PTPRN, RASDI, RELN, RGSI, SLITRK6, SMOC2, SNAP25, STMN2, TACI, RSP03, TUBB4, UGT2B7, WISP2, ZD52Fl0 and ZIC2. The group of cell lines E1l1 and El1lBio2 are positive for the markers: CD24, CDH6, CRIPI, HTRA3, INA, TAGLN3, SFRP2, SRCRB4D, UGT2B7 and ZIC2 and are negative for the markers: AGCl, AKRlCl, ALDHlAl, APCDDl, AREG, ATP8B4, CFB, C3, C6, C7, C20orf103, CDH3, CNTNAP2, COPI, CRLF1, D102, METTL7A, DLKl, DPT, EMIDI, TMEM100, FMO1, FM03, FOXF1, FOXF2, GABRB1, GAP43, GSC, HOXA5, HSDllB2, HSD17B2, HSPA6, HSPB3, ID4, IFI27, IFIT3, IGF2, KRT14, LAMC2, MASPI, MEOX2, MXl, MYBPH, MYH3, MYH1l, NPAS1, OGN, OLRl, PAX9, PDE1A, PENK, PRG4, PROMI, PRRX2, PTPRN, RARRESI, RASDI, RGMA, RGSI, SLITRK6, SMOCI, SMOC2, SNAP25, STMN2, TACI, TNNT2, TRH, TUBB4 and WISP2. The cell line E120 is positive for the markers: ACTC, BEXI, CLDN1l, COL15Al, CRIPI, CRYAB, FST, GDF1O, GJB2, HTRA3, IGFL3, MGP, MXl, 1L32, POSTN, S100A4, SFRP2, THYl, TNFSF7, ZD52F10 and ZIC2 and are negative for the markers: AGCl, AKRlCl, ALDHlAl, APCDDl, AQPl, AREG, ATP8B4, BMP4, C3, C6, C7, PRSS35, C20orf103, CD24, CDH3, CNTNAP2, COL21Al, COMP, COPI, CRLF1, CXADR, D102, METTL7A, DKK2, DLKl, EMIDI, FGFR3, FMO1, FM03, FOXF1, FOXF2, GABRB1, GAP43, GDF5, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, HSPB3, IFI27, IGF2, INA, KRT14, LAMC2, TMEM119, MASPI, MEOX2, MMPl, MSX2, MYBPH, MYH3, MYH1l, NLGN4X, TAGLN3, NPAS1, NPPB, OGN, OLRl, OSR2, PAX2, PAX9, PDE1A, PENK, PITX2, PODN, PRG4, PROMI, RASDI, RELN, RGMA, RGSI, SLITRK6, SMOCI, SMOC2, SNAP25, STMN2, SYT12, TACI, RSP03, TNNT2, TRH, TUBB4, UGT2B7 and WISP2. The cell line E15 is positive for the markers: ACTC, BEXI, PRSS35, CRIPI, CRYAB, GAP43, GDF5, HTRA3, KRT19, MGP, MMPl, POSTN, PRRX1, S100A4, SOXI1, SRCRB4D and THYl and are negative for the markers: AGCl, AKRlCl, ALDHlAl, ANXA8, APCDD1, AQPl, AREG, ATP8B4, CFB, C3, C6, C7, C20orf103, CDH3, CNTNAP2, COPI, CXADR, METTL7A, DLKl, DPT, EGR2, EMIDI, TMEM100, FMO1, FM03, FOXF1, FOXF2, GABRB1, GDF1O, GJB2, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, HSPB3, IFI27, IFIT3, IGF2, INA, KRT14, TMEM1l9, IGFL3, LOC92196, MFAP5, MASPI, MEOXI, MEOX2, MSXl, MXl, MYBPH, MYH3, MYL4, NLGN4X, TAGLN3, NPAS1, NPPB, OGN, OLRl, PAX2, PAX9, PDE1A, PENK, PITX2, PRG4, PROMI, PTPRN, RARRESI, RASDI, RELN, RGSl, SLITRK6, SMOCI, SMOC2, SNAP25, STMN2, TACI, TFPI2, RSP03, TNFSF7, TNNT2, TRH, TSLP, TUBB4, UGT2B7, WISP2, ZD52F10 and ZIC1. The cell line E164 is positive for the markers: AQPl, CD24, CDH6, CRIPI, HTRA3, KRT17, KRT19, 1L32, TAGLN3, PAX2, RELN, S100A4, SFRP2, SRCRB4D, THYl, TNFSF7, UGT2B7, ZD52F10 and ZIC2 and are negative for the markers: ACTC, AGCl, ALDHlAl, ANXA8, APCDD1, AREG, ATP8B4, C3, C6, C7, C20orf103, CCDC3, CDH3, CLDNll, CNTNAP2, COL15Al, COL21Al, COMP, COPI, CRLF1, D102, METTL7A, DKK2, DLKl, DPT, EGR2, EMIDI, TMEM100, FMO1, FM03, FOXF1, FOXF2, GABRB1, GAP43, GDF5, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, HSPB3, ID4, IFI27, KCNMB1, KRT14, KRT34, TMEM1l9, MFAP5, MASPI, MEOX2, MGP, MSX2, MYBPH, MYH3, MYH1l, MYL4, NPAS1, NPPB, OGN, OLRl, PAX9, PDE1A, PENK, PITX2, POSTN, PRELP, PRG4, PRRX1, PRRX2, PTGS2, PTPRN, RARRESI, RASDI, RGMA, RGSI, SERPINA3, SLITRK6, SMOCI, SMOC2, SNAP25, SOD3, STMN2, TACI, TNNT2, TRH, TUBB4 and WISP2. 59 WO 2011/150105 PCT/US2011/037969 The group of cell lines E69 and E169 are positive for the markers: BEXI, CDH6, CRIPI, FST, GDF5, HTRA3, MMP1, POSTN, PTN, S100A4 and ZIC2 and are negative for the markers: AGC1, ALDH1A1, APCDD1, AQP1, AREG, ATP8B4, BMP4, C3, C6, C7, C20orflO3, CDH3, CNTNAP2, COMP, CRLF1, CXADR, DLK1, DPT, EGR2, EMIDI, FMO1, FMO3, FOXF1, FOXF2, GABRB1, GJB2, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, HSPB3, IFI27, IGF2, INA, KRT14, IGFL3, LOC92196, MASPI, MEOXI, MEOX2, MYBPH, MYH3, MYH11, MYL4, NLGN4X, TAGLN3, NPAS1, NPPB, OGN, OLR1, PAX2, PAX9, PDE1A, PENK, PITX2, PROMI, RARRES1, RASD1, RELN, RGS1, SLITRK6, SMOCI, SMOC2, SNAP25, STMN2, SYT12, TAC1, RSPO3, TNNT2, TRH, TUBB4, UGT2B7 and ZD52F1O. The cell line E19 is positive for the markers: ACTC, BEXI, PRSS35, CLDN11, CRIPI, CRYAB, DKK2, HTRA3, ICAM5, KRT17, KRT19, KRT34, MX1, POSTN, THY1, ZICI and ZIC2 and are negative for the markers: AGC1, AKR1C1, ALDH1A1, APCDD1, AQP1, AREG, ATP8B4, CFB, BMP4, C3, C6, C7, C20orflO3, CDH3, CNTNAP2, COL21A1, COPI, CXADR, METTL7A, DLK1, DPT, EGR2, EMIDI, TMEM100, FMO1, FMO3, FOXF1, FOXF2, GABRB1, GAP43, GDF1O, GJB2, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, IGF2, ILIRI, KIAA0644, TMEM119, IGFL3, LOC92196, MASPI, MEOXI, MEOX2, MGP, MYBPH, MYH3, NLGN4X, TAGLN3, OGN, PAX2, PAX9, PDE1A, PENK, PRG4, PROMI, PRRX2, RARRES1, RASD1, RELN, RGMA, RGS1, SFRP2, SLITRK6, SMOCI, SMOC2, SNAP25, SOD3, STMN2, SYT12, TAC1, TFPI2, RSPO3, TNFSF7, TNNT2, TRH, TSLP, TUBB4, UGT2B7, WISP2 and ZD52F1O. The group of cell lines E3, E30, E20Bio2, E67, E73, E57 and E84 are positive for the markers: KRT19, KRT34, MFAP5, MGP, MMP1, S100A4, THYl and ZICI and are negative for the markers: ALDH1A1, AREG, ATP8B4, C7, C20orflO3, CDH3, CNTNAP2, DKK2, DLK1, DPT, FMO1, FMO3, FOXF1, FOXF2, GDF1O, GSC, HOXA5, HSD17B2, IGF2, MEOXI, TAGLN3, NPPB, PAX9, PROMI, PTPRN, RGS1, SMOCI, SNAP25, STMN2, TAC1, TUBB4 and ZIC2. The cell line E33 is positive for the markers: AQP1, PRSS35, CD24, CDH6, CLDN11, CRIPI, CRYAB, DKK2, HTRA3, KRT17, KRT19, KRT34, LOC92196, MFAP5, MGP, MYH1l, TAGLN3, POSTN, S100A4, SRCRB4D, UGT2B7, ZICI and ZIC2 and are negative for the markers: AGC1, AKR1C1, ALDH1A1, APCDD1, AREG, ATP8B4, CFB, C3, C6, C7, C20orflO3, CDH3, CNTNAP2, COMP, COPI, CRLF1, D102, METTL7A, DLK1, DPT, EMIDI, TMEM100, FMO1, FMO3, FOXF1, FOXF2, GABRB1, GDF5, GJB2, GSC, HOXA5, HSD11B2, HSPA6, HSPB3, IFI27, IFIT3, IGF2, TMEM119, IGFL3, MASPI, MX1, MYBPH, NPAS1, NPPB, OGN, OLR1, OSR2, PAX9, PDE1A, PENK, PITX2, PRG4, PROMI, PTPRN, RARRESI, RASD1, RGMA, RGS1, SERPINA3, SFRP2, SLITRK6, SMOCI, SMOC2, SNAP25, STMN2, TAC1, RSPO3, TRH, TSLP, TUBB4, WISP2 and ZD52F1O. The cell line E40 is positive for the markers: BEXI, CDH6, CLDN11, CRIPI, CRYAB, DKK2, FST, HTRA3, KRT17, KRT19, MMP1, POSTN, S100A4, SRCRB4D and ZIC2 and are negative for the markers: AGC1, AKR1C1, ALDH1A1, APCDD1, AQP1, AREG, ATP8B4, CFB, BMP4, C3, C6, C7, C20orflO3, CDH3, CNTNAP2, COMP, COPI, CRLF1, CXADR, METTL7A, DLK1, DPT, EGR2, EMIDI, TMEM100, FMO1, FMO3, FOXF1, FOXF2, GABRB1, GJB2, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, HSPB3, IFI27, IFIT3, IGF2, KIAA0644, KRT14, IGFL3, LOC92196, MASPI, MEOXI, MEOX2, MGP, MX1, MYBPH, MYH3, NLGN4X, TAGLN3, NPAS1, NPPB, OGN, OLR1, OSR2, PAX2, PAX9, PDE1A, PENK, PITX2, PRG4, PROMI, PRRX2, PTPRN, RARRESI, RASD1, RELN, RGS1, SLITRK6, SMOCI, SMOC2, SNAP25, STMN2, SYT12, TACI, TFPI2, RSPO3, TNFSF7, TNNT2, TRH, TSLP, TUBB4, WISP2, ZD52F1O and ZIC1. The cell line E44 is positive for the markers: BEXI, CLDN11, CRIPI, FST, GDF5, HTRA3, IF127, IFIT3, MGP, MMP1, MSX1, MX1, IL32, PRRX2, PTN, S100A4, SOD3 and ZIC2 and are negative for the markers: ACTC, AGC1, ALDH1A1, AQP1, AREG, ATP8B4, BMP4, C6, C7, C20orflO3, CDH3, CDH6, CNTNAP2, COL21A1, COMP, CRLF1, DKK2, DPT, EGR2, EMIDI, FGFR3, FMO1, FMO3, FOXF2, GABRB1, GDF1O, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, HSPB3, IGF2, INA, KCNMB1, KRT14, KRT34, TMEM119, IGFL3, LOC92196, MFAP5, MEOXI, MEOX2, MYBPH, MYH3, MYH11, MYL4, NLGN4X, NPAS1, NPPB, OGN, OLR1, PAX2, PAX9, PDE1A, PENK, PITX2, POSTN, PRELP, PRG4, PROMI, RASD1, RELN, RGMA, RGS1, RPS4Y2, SFRP2, SLITRK6, SMOCI, SMOC2, SNAP25, SRCRB4D, STMN2, SYT12, TACI, RSPO3, TNNT2, TRH, TUBB4, UGT2B7, ZD52F1O and ZIC1. 60 WO 2011/150105 PCT/US2011/037969 The cell line E45 is positive for the markers: AQP1, CD24, CDH6, COL21A1, CRIPI, DKK2, HTRA3, KRT17, KRT19, MGP, TAGLN3, PRRX1, S100A4, SOXI1, UGT2B7, ZICI and ZIC2 and are negative for the markers: AGC1, ALDH1A1, ANXA8, APCDD1, AREG, ATP8B4, BEXI, BMP4, C3, C6, C7, C20orflO3, CDH3, CNTNAP2, COL15A1, COMP, COPI, CRLF1, METTL7A, DLK1, DPT, EMIDI, TMEM100, FMO1, FMO3, FOXF1, FOXF2, GABRB1, GAP43, GJB2, GSC, HOXA5, HSD11B2, HSPA6, HSPB3, ID4, IFI27, KRT14, LAMC2, IGFL3, MFAP5, MASPI, MEOXI, MEOX2, MMP1, MYBPH, MYH3, MYH11, NPAS1, NPPB, OGN, OLR1, OSR2, PAX9, PDE1A, PENK, PITX2, PRG4, PROMI, PTPRN, RARRESI, RASDI, RELN, RGSI, SERPINA3, SFRP2, SLITRK6, SMOCI, SMOC2, SNAP25, STMN2, TAC1, RSPO3, TRH, TSLP, TUBB4, WISP2 and ZD52F1O. The cell line E50 is positive for the markers: ACTC, BEXI, CD24, CDH6, COL21A1, CRIPI, CRYAB, DKK2, FST, KRT17, KRT19, LOC92196, POSTN, PTN, S100A4, SFRP2, SRCRB4D, ZICI and ZIC2 and are negative for the markers: AGC1, AKR1C1, ALDH1A1, APCDD1, AQP1, AREG, ATP8B4, CFB, BMP4, C6, C7, CDH3, CLDN11, CNTNAP2, COMP, COPI, CRLF1, METTL7A, DLK1, DPT, EMIDI, TMEM100, FMO3, FOXF1, FOXF2, GABRB1, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, HSPB3, IFI27, IFIT3, KRT14, KRT34, LAMC2, TMEM119, IGFL3, MFAP5, MASPI, MEOXI, MEOX2, MMP1, MYH3, NLGN4X, NPAS1, NPPB, OGN, OLR1, PAX2, PAX9, PENK, PRG4, PROMI, PTGS2, PTPRN, RARRES1, RASDI, RELN, RGSI, SERPINA3, SLITRK6, SMOCI, SMOC2, STMN2, SYT12, TAC1, TFPJ2, RSPO3, TRH, TSLP, TUBB4, UGT2B7, WISP2 and ZD52F1O. The cell line E51 is positive for the markers: PRSS35, CCDC3, CDH6, CRIPI, CRYAB, D102, DKK2, HTRA3, ID4, KCNMB1, KRT17, KRT19, KRT34, MGP, MYH11, POSTN, PRRX1, S100A4, SOXI1 and ZIC2 and are negative for the markers: AGC1, AKR1C1, ALDH1A1, APCDD1, AREG, ATP8B4, BMP4, C3, C6, C7, C20orflO3, CDH3, CNTNAP2, COPI, CRLF1, CXADR, METTL7A, DLK1, DPT, EMIDI, FMO1, FMO3, FOXF1, FOXF2, GABRB1, GSC, HOXA5, HSD17B2, HSPA6, HSPB3, IFI27, IFIT3, IGF2, IGFBP5, TMEM119, IGFL3, LOC92196, MASPI, MEOXI, MEOX2, MX1, MYBPH, MYH3, MYL4, NLGN4X, TAGLN3, NPAS1, NPPB, OGN, OLR1, PAX2, PAX9, PDE1A, PENK, PRG4, PROMI, PTPRN, RARRES1, RASDI, RELN, RGSI, SFRP2, SMOCI, SMOC2, SNAP25, STMN2, SYT12, TACI, TFPJ2, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, WISP2 and ZD52F1O. The group of cell lines E68 and E68Bio2 are positive for the markers: CD24, CRIPI, CRYAB, HTRA3, KRT17, KRT19, TAGLN3, UGT2B7, ZICI and ZIC2 and are negative for the markers: AGC1, AREG, ATP8B4, C6, C7, CDH3, COPI, CRLF1, DLK1, DPT, TMEM100, FMO1, FMO3, FOXF1, FOXF2, GSC, HOXA5, HSD11B2, HSPA6, HSPB3, IGF2, LAMC2, IGFL3, MEOXI, MEOX2, MMP1, MYBPH, MYH3, NPAS1, OGN, PAX9, PITX2, PRG4, PROMI, RARRES1, RGSI, SMOC2, TACI, RSPO3, TRH, TSLP and WISP2. The group of cell lines C4ELS5.6 and C4ELS5.6Bio2 are positive for the markers: BMP4, COPI, METTL7A, TMEM100, FOXF1, HSD17B2, HTRA3, IGF2, IGFBP5, ILIRI, KRT19, MASPI, OLR1, PITX2, PODN and TSLP and are negative for the markers: ACTC, AGC1, ALDH1A1, AQP1, CFB, C6, C7, C20orflO3, CDH3, CDH6, CLDN11, CNTNAP2, COL21A1, COMP, CRLF1, DKK2, DPT, EGR2, EMIDI, FMO3, FOXF2, GABRB1, GAP43, GDF1O, GSC, HOXA5, HSPA6, HSPB3, ID4, IFI27, INA, KRT17, KRT34, LAMC2, TMEM119, IGFL3, LOC92196, MFAP5, MEOXI, MEOX2, MGP, MSX1, MYH3, MYH11, MYL4, 1L32, NLGN4X, TAGLN3, NPAS1, NPPB, OGN, PAX2, PAX9, PDE1A, PENK, PRG4, PROMI, PRRX1, PRRX2, PTPRN, RARRESI, RASDI, RELN, RGMA, RGSI, SFRP2, SMOCI, SMOC2, SNAP25, SOD3, SYT12, TACi, RSPO3, THY1, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, WISP2, ZD52F1O, ZICi and ZIC2. The cell line C4ELS5.8 is positive for the markers: AKR1C1, ALDH1A1, BMP4, C3, COPI, METTL7A, TMEM100, FOXF1, HSD17B2, HTRA3, ICAM5, IFIT3, IGF2, IGFBP5, ILIRI, KRT19, MASPI, MX1, OLR1, PODN, STMN2, TFPJ2 and THYl and are negative for the markers: ACTC, AGC1, APCDD1, BEXI, C6, C7, PRSS35, C20orflO3, CCDC3, CD24, CDH3, CLDN11, CNTNAP2, COL21A1, COMP, CRIPI, CRLF1, DKK2, DLK1, DPT, EMIDI, FGFR3, FMO3, FOXF2, GABRB1, GAP43, GDF1O, GSC, HOXA5, HSD11B2, HSPA6, HSPB3, ID4, INA, KCNMB1, KRT14, KRT17, TMEM119, IGFL3, LOC92196, MFAP5, MEOXI, MEOX2, MGP, MSX2, MYH3, MYH11, MYL4, 1L32, NLGN4X, TAGLN3, NPPB, OGN, PAX2, PAX9, PDE1A, PENK, POSTN, PRRX1, PRRX2, PTPRN, RARRESI, RASDI, RELN, RGMA, RGSI, SLITRK6, SMOCI, SMOC2, SOD3, SOXI1, SYT12, TACI, RSPO3, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, WISP2, ZD52F1O, ZICI and ZIC2. 61 WO 2011/150105 PCT/US2011/037969 The cell line C4ELSR13 is positive for the markers: AKR1C1, ANXA8, AREG, BMP4, C3, COPI, METTL7A, FMO3, FOXF1, HTRA3, IFI27, IFIT3, IGF2, ILIRI, KRT19, MASPI, MX1, MYBPH, OLR1, PITX2, PODN, S100A4 and TFPI2 and are negative for the markers: AGC1, APCDD1, AQP1, ATP8B4, C6, C20orflO3, CD24, CDH3, CDH6, CLDN11, CNTNAP2, COL15A1, COL21A1, COMP, CRIPI, CRLF1, CRYAB, DKK2, DLK1, DPT, EGR2, EMIDI, FGFR3, TMEM100, FMO1, FOXF2, GABRB1, GAP43, GDF1O, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, HSPB3, ID4, INA, KIAA0644, KRT14, KRT17, IGFL3, LOC92196, MFAP5, MEOXI, MEOX2, MGP, MSX1, MSX2, MYH3, MYH11, MYL4, 1L32, NLGN4X, TAGLN3, NPAS1, NPPB, OGN, OSR2, PAX2, PAX9, PDE1A, PENK, POSTN, PROMI, PRRX1, PTPRN, RARRESI, RASDI, RELN, RGMA, RGSI, RPS4Y2, SERPINA3, SLITRK6, SMOC2, SNAP25, SOD3, SOXI1, STMN2, SYT12, TAC1, RSPO3, THY1, TNNT2, TRH, TUBB4, UGT2B7, ZD52F1O, ZICI and ZIC2. The cell line C4ELSR18 is positive for the markers: AQP1, BEXI, BMP4, C20orflO3, CDH6, FST, HOXA5, IGF2, IGFBP5, OLR1, OSR2, PDE1A, PRRX2, S100A4, SFRP2, SLITRK6, TFPI2 and ZIC2 and are negative for the markers: AGC1, ALDH1A1, ANXA8, APCDD1, ATP8B4, CFB, C6, CCDC3, CD24, CDH3, CLDN11, CNTNAP2, COL15A1, COMP, COPI, CRLF1, CRYAB, DLK1, DPT, EGR2, EMIDI, TMEM100, FOXF1, GABRB1, GAP43, GDF1O, GSC, HSD11B2, HSD17B2, HSPA6, HSPB3, ID4, IF127, IFIT3, KCNMB1, KRT14, KRT17, KRT34, TMEM119, IGFL3, LOC92196, MFAP5, MASPI, MEOXI, MEOX2, MSX1, MSX2, MX1, MYH3, MYH11, MYL4, 1L32, NPAS1, NPPB, OGN, PAX2, PAX9, PENK, PITX2, PODN, PRG4, PTPRN, RARRESI, RASDI, RELN, RGSI, SERPINA3, SMOCI, SMOC2, SOD3, SOXI, STMN2, SYT12, TAC1, THY1, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, ZD52F1O and ZIC1. The group of cell lines EN1I and W10 are positive for the markers: DLK1, FOXF1, FST, GABRB1, GDF5, HTRA3, IGF2, IGFBP5, ILIRI, POSTN, PTN, SOXI1, SRCRB4D and TFPI2 and are negative for the markers: ACTC, AGC1, ALDH1A1, ANXA8, APCDD1, AQP1, AREG, CFB, BMP4, C3, C6, C7, CCDC3, CD24, CDH6, CLDN11, CNTNAP2, COL15A1, COMP, COPI, CRYAB, DKK2, DPT, EGR2, EMIDI, FGFR3, FMO1, FMO3, FOXF2, GAP43, GDF1O, GSC, HSD11B2, HSD17B2, HSPA6, HSPB3, ID4, IFI27, INA, KCNMB1, KRT14, KRT17, KRT34, IGFL3, LOC92196, MEOXI, MEOX2, MX1, MYBPH, MYH3, MYH11, MYL4, 1L32, NLGN4X, NPAS1, NPPB, OLR1, PAX2, PAX9, PENK, PITX2, PRELP, PROMI, RARRESI, RASDI, RELN, RGSI, SMOCI, SMOC2, STMN2, SYT12, TAC1, THY1, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, WISP2, ZICI and ZIC2. The group of cell lines EN7, EN13Biolb, EN13Bio2c and EN13Bio3c are positive for the markers: CDH6, DLK1, FOXF1, FST, HTRA3, IGF2, ILIRI, MSX1, POSTN, SOD3, ZICI and ZIC2 and are negative for the markers: ACTC, ALDH1A1, ANXA8, ATP8B4, BMP4, C3, C20orflO3, CCDC3, CD24, CDH3, CLDN11, CNTNAP2, COMP, CRYAB, D102, DKK2, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, HSPB3, IFI27, INA, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MEOXI, MEOX2, MGP, MMP1, MX1, MYH3, MYH11, MYL4, 1L32, NPAS1, NPPB, OLR1, PAX2, PAX9, PDE1A, PENK, PITX2, PROMI, RELN, SFRP2, SMOC2, STMN2, TAC1, RSPO3, THY1, TNFSF7, TNNT2, TRH, TUBB4 and ZD52F1O. The cell line EN16 is positive for the markers: COL15A1, D102, DPT, FMO3, FOXF1, FOXF2, FST, HSPB3, HTRA3, IGF2, ILIRI, TMEM119, MGP, MMP1, PODN and PRRX2 and are negative for the markers: ACTC, AGC1, AKR1C1, ALDH1A1, ANXA8, AQP1,, AREG, ATP8B4, BEXI, CFB, C3, C6, C7, C20orflO3, CCDC3, CD24, CDH3, CLDN11, CNTNAP2, COMP, CRIPI, CRLF1, DKK2, EMIDI, FGFR3, TMEM100, GABRB1, GAP43, GDF5, GDF1O, GJB2, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, ID4, IF127, KCNMB1, KRT14, KRT17, KRT34, LAMC2, IGFL3, LOC92196, MFAP5, MEOXI, MEOX2, MYBPH, MYH3, MYH11, MYL4, 1L32, NLGN4X, TAGLN3, NPAS1, NPPB, PAX2, PAX9, PENK, PITX2, POSTN, PTGS2, PTPRN, RARRESI, RASD1, RGSI, SMOCI, SMOC2, SNAP25, STMN2, TACI, RSPO3, THY1, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, ZD52F1O, ZICI and ZIC2. The group of cell lines ENI, EN1Bio2 and EN18 are positive for the markers: D102, DLK1, FOXF1, GDF5, HTRA3, IGF2, ILIRI, MGP, POSTN, PRRX2 and SRCRB4D and are negative for the markers: ACTC, AGC1, ALDH1A1, ANXA8, AQP1, CFB, C20orflO3, CCDC3, CD24, CLDN11, CNTNAP2, CRYAB, CXADR, DKK2, GABRB1, GAP43, GDF10, GSC, HSD11B2, HSD17B2, HSPA6, IFI27, INA, KCNMB1, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MEOXI, MEOX2, MX1, MYH3, MYH11, MYL4, NPAS1, NPPB, PAX2, PAX9, PENK, PITX2, PROMI, RASDI, RGSI, SMOCI, SMOC2, STMN2, TACI, RSPO3, THY1, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, ZD52F1O, ZICI and ZIC2. 62 WO 2011/150105 PCT/US2011/037969 The cell line EN19 is positive for the markers: CDH6, COL15A1, COL21A1, DLK1, FOXF1, FST, GDF5, IGF2, TMEM119, MSX1, RGMA, SERPINA3, SOD3, ZICI and ZIC2 and are negative for the markers: ACTC, AGC1, ANXA8, AQP1, ATP8B4, C3, C6, C7, C20orf1O3, CD24, CDH3, CLDN11, CNTNAP2, CRIP1, CXADR, D102, DKK2, EMID1, TMEM100, GABRB1, GAP43, GJB2, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, HSPB3, IFI27, INA, KCNMB1, KRT14, KRT17, KRT19, KRT34, IGFL3, LOC92196, MFAP5, MEOXI, MEOX2, MGP, MX1, MYH3, MYHI1, MYL4, 1L32, NLGN4X, NPPB, OLR1, OSR2, PAX2, PAX9, PDE1A, PENK, PROMI, RARRESI, RASD1, RELN, RGS1, SLITRK6, SMOCI, SMOC2, SNAP25, STMN2, SYT12, TAC1, RSPO3, THY1, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7 and ZD52F1O. The cell line EN2 is positive for the markers: FST, GDF5, HTRA3, IGF2, IGFBP5, ILIRI, PRRX2, PTN, SFRP2, SOXI1, SRCRB4D, TFPI2 and RSPO3 and are negative for the markers: ACTC, AGC1, AKR1C1, ALDH1A1, ANXA8, APCDD1, AREG, ATP8B4, CFB, C3, C6, C7, PRSS35, C20orf1O3, CCDC3, CD24, CDH6, CLDN11, COMP, COPI, CRLF1, CXADR, DKK2, DPT, EGR2, EMIDI, TMEM100, FMO1, FOXF2, GAP43, GDF1O, GJB2, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, HSPB3, ICAM5, IFI27, INA, KRT14, KRT17, KRT19, KRT34, TMEM119, IGFL3, LOC92196, MFAP5, MEOXI, MEOX2, MX1, MYBPH, MYH3, MYHI1, MYL4, NLGN4X, TAGLN3, NPAS1, NPPB, OGN, OLR1, PAX2, PAX9, PDE1A, PENK, PITX2, POSTN, PRELP, PRG4, PTGS2, RARRESI, RASD1, RELN, RGS1, SMOCI, SMOC2, SNAP25, STMN2, SYT12, TAC1, THY1, TNFSF7, TNNT2, TRH, TSLP, TUBB4, UGT2B7, ZD52F1O, ZICI and ZIC2. The cell line EN25 is positive for the markers: CDH6, CNTNAP2, COL15A1, COL21A1, DLK1, FOXF1, FST, HTRA3, IGF2, SERPINA3, SRCRB4D, TFPI2, ZICI and ZIC2 and are negative for the markers: ACTC, AGC1, AKR1C1, ALDH1A1, AQP1, ATP8B4, C3, C6, C7, C20orf1O3, CCDC3, CD24, CDH3, CLDN11, CRIPI, D102, DKK2, EMIDI, FOXF2, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, HSPB3, IFI27, IFIT3, INA, KCNMB1, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MEOXI, MEOX2, MGP, MMP1, MX1, MYBPH, MYH3, MYHI1, MYL4, 1L32, NLGN4X, NPPB, OLR1, PAX2, PAX9, PENK, PITX2, PRELP, PROMI, PRRX1, PTN, RARRESI, RASD1, RELN, SFRP2, SLITRK6, SMOC2, STMN2, TAC1, RSPO3, THY1, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7 and ZD52F1O. The cell line EN26 is positive for the markers: D102, DPT, FMO3, FOXF1, FOXF2, FST, GDF5, HTRA3, IGF2, ILIRI, TMEM119, PODN, PRRX1, PRRX2, SFRP2, SOD3 and SRCRB4D and are negative for the markers: ACTC, AGC1, AKR1C1, ALDH1A1, ANXA8, AQP1, ATP8B4, BEXI, C3, C6, C7, C20orf1O3, CCDC3, CD24, CLDN11, CNTNAP2, COL21A1, COMP, CRIPI, CXADR, DKK2, GABRB1, GAP43, GDF1O, GJB2, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, ID4, IFI27, INA, KCNMB1, KRT14, KRT17, KRT19, KRT34, LAMC2, IGFL3, LOC92196, MFAP5, MEOXI, MEOX2, MMP1, MX1, MYBPH, MYH3, MYHI1, MYL4, NLGN4X, NPAS1, NPPB, PAX2, PAX9, PENK, PITX2, PROMI, PTGS2, PTPRN, RARRES1, RASD1, RELN, RGS1, SLITRK6, SMOCI, SMOC2, STMN2, TAC1, RSPO3, THY1, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, ZD52F1O, ZICI and ZIC2. The cell line EN27 is positive for the markers: D102, FMO3, FOXF1, FOXF2, FST, HSPB3, HTRA3, IGF2, ILIRI, TMEM1 19, MSX2, OGN, PODN, PRELP, PRRX2, SERPINA3 and SLITRK6 and are negative for the markers: , ACTC, AGC1, ALDH1A1, ANXA8, AQP1, AREG, ATP8B4, CFB, C3, C6, C7, C20orf1O3, CCDC3, CD24, CDH3, CDH6, CLDN11, CNTNAP2, CRIPI, CRLF1, DKK2, EMIDI, FGFR3, TMEM100, GABRB1, GAP43, GDF10, GJB2, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, ICAM5, ID4, IFI27, IFIT3, IGFBP5, INA, KCNMB1, KRT14, KRT17, KRT19, KRT34, LAMC2, IGFL3, LOC92196, MFAP5, MASPI, MEOXI, MEOX2, MMP1, MX1, MYBPH, MYH3, MYHI1, MYL4, 1L32, NLGN4X, NPAS1, NPPB, OLR1, PAX2, PAX9, PENK, PITX2, PROMI, RARRESI, RASD1, RELN, RGS1, SFRP2, SMOCI, SMOC2, STMN2, TAC1, RSPO3, THY1, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, ZD52F1O, ZICI and ZIC2. The cell line EN28 is positive for the markers: COL15A1, COL21A1, D102, FOXF1, FOXF2, FST, HSPB3, HTRA3, IGF2, IGFBP5, ILIRI, TMEM1 19, PODN, PRRX1, PTN, SFRP2 and SOXI1 and are negative for the markers: ACTC, AGC1, AKR1C1, ALDH1A1, ANXA8, AQP1, AREG, ATP8B4, CFB, BMP4, C3, C6, C7, C20orfl03, CCDC3, CD24, CDH3, CDH6, CLDN11, CNTNAP2, COP1, CRIP1, DKK2, EMID1, TMEM100, GAP43, GDF1O, GJB2, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, ID4, IF127, INA, KCNMB1, KIAA0644, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MEOXI, MEOX2, MGP, MMP1, MX1, MYBPH, MYH3, MYHI1, MYL4, 1L32, NLGN4X, NPPB, OLR1, OSR2, PAX2, PAX9, PDE1A, PENK, PITX2, POSTN, PRELP, PRG4, PROMI, PTGS2, RARRESI, RELN, RGS1, SLITRK6, SMOCI, SMOC2, STMN2, SYT12, TACI, RSPO3, TNFSF7, TNNT2, TRH, TSLP, TUBB4, UGT2B7, ZD52F1O, ZICI and ZIC2. 63 WO 2011/150105 PCT/US2011/037969 The cell line EN31 is positive for the markers: CDH6, COL21A1, DLK1, FM03, FOXF1, FST, GDF5, HTRA3, IGF2, ILIRI, MSX1, MSX2, OGN, OSR2, PRRX2, SERPINA3, SLITRK6, SOD3, TSLP, ZICI and ZIC2 and are negative for the markers: ACTC, AGC1, ALDH1A1, ANXA8, AQP1, ATP8B4, BEXI, BMP4, C3, C6, C7, PRSS35, C20orflO3, CCDC3, CD24, CDH3, CLDN11, CNTNAP2, COMP, CRIPI, CRLF1, CRYAB, CXADR, D102, DKK2, EMIDI, TMEM100, GAP43, GDF1O, GJB2, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, HSPB3, ICAM5, ID4, IFI27, INA, KRT14, KRT17, KRT19, KRT34, LAMC2, IGFL3, LOC92196, MFAP5, MEOXI, MEOX2, MGP, MMP1, MX1, MYBPH, MYH3, MYH11, MYL4, IL32, NLGN4X, TAGLN3, NPAS1, NPPB, OLR1, PAX2, PAX9, PENK, PITX2, PROMI, PTGS2, RARRES1, RASDI, RELN, SFRP2, SMOC2, SNAP25, STMN2, SYT12, TAC1, RSPO3, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7 and ZD52F1O. The cell line EN38 is positive for the markers: BEXI, CDH6, COL21A1, DLK1, FOXF1, FST, GDF5, HTRA3, IGF2, ILIRI, TMEM119, MGP, MSX1, OGN, PODN, POSTN, PRRX1, PRRX2, RGMA, SERPINA3, SOD3 and TSLP and are negative for the markers: ACTC, AGC1, AKR1C1, ALDH1A1, ANXA8, AQP1, AREG, ATP8B4, BMP4, C3, C6, C7, C20orflO3, CCDC3, CD24, CDH3, CLDN11, CNTNAP2, CRIPI, D102, DKK2, DPT, GABRB1, GAP43, GDF1O, GJB2, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, HSPB3, ID4, IFI27, INA, KCNMB1, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MEOXI, MEOX2, MX1, MYBPH, MYH3, MYH11, MYL4, 1L32, NLGN4X, NPPB, OLR1, PAX2, PAX9, PDE1A, PENK, PITX2, PRELP, PRG4, PROMI, RASDI, RELN, RGSI, SFRP2, SLITRK6, SMOCI, SMOC2, SNAP25, STMN2, SYT12, TAC1, RSP03, THY1, TNFSF7, TNNT2, TRH, TUBB4, ZD52F1O, ZICI and ZIC2. The cell line EN4 is positive for the markers: COL21A1, DLK1, FMO1, FM03, FOXF1, FOXF2, FST, GDF5, HTRA3, IGF2, IGFBP5, ILIRI, TMEM1 19, MGP, MSX1, OGN, PODN, PRRX1, PRRX2, PTN, RGMA, SOD3 and TSLP and are negative for the markers: ACTC, AGC1, AKR1C1, ALDH1A1, ANXA8, AQP1, AREG, CFB, BMP4, C3, C6, C7, C20orfl03, CCDC3, CD24, CDH3, CLDN11, CNTNAP2, CRIP1, D102, DKK2, DPT, EMIDI, FGFR3, TMEM100, GABRB1, GAP43, GDF1O, GJB2, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, HSPB3, ID4, IFI27, INA, KCNMB1, KRT14, KRT17, KRT34, LAMC2, IGFL3, LOC92196, MFAP5, MASPI, MEOXI, MEOX2, MX1, MYBPH, MYH3, MYH11, MYL4, IL32, NLGN4X, NPAS1, NPPB, OLR1, PAX2, PAX9, PENK, PROMI, PTGS2, RARRES1, RASD1, RGSI, SFRP2, SMOCI, SMOC2, SNAP25, STMN2, TAC1, RSP03, THY1, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7 and ZD52F1O. The cell line EN42 is positive for the markers: COL15A1, COL21A1, FM03, FOXF1, FST, GDF5, HTRA3, IGF2, ILIRI, TMEM119, MGP, OGN, PODN, PRRX1, PRRX2, PTN, RGMA, SERPINA3, SNAP25 and SOD3 and are negative for the markers: ACTC, AGC1, AKR1C1, ALDH1A1, ANXA8, AQP1, ATP8B4, BMP4, C3, C6, C7, C20orflO3, CCDC3, CD24, CDH3, CLDN11, CNTNAP2, COMP, CXADR, D102, DKK2, DPT, EMIDI, FGFR3, TMEM100, GAP43, GDF1O, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, HSPB3, ID4, IFI27, INA, KCNMB1, KRT14, KRT17, KRT19, KRT34, LAMC2, IGFL3, LOC92196, MFAP5, MASPI, MEOXI, MEOX2, MMP1, MX1, MYBPH, MYH3, MYH1l, MYL4, IL32, NLGN4X, NPAS1, NPPB, OLR1, PAX9, PENK, PITX2, PRG4, PROMI, RARRESI, RASDI, RELN, RGSI, SMOCI, SMOC2, STMN2, RSP03, THY1, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, ZD52F1O, ZICI and ZIC2. The cell line EN47 is positive for the markers: CDH6, COPI, DLK1, FM03, FOXF1, FST, HTRA3, IGF2, ILIRI, MSX1, POSTN, PTPRN, RGSI, SOD3, TFPI2, TSLP, ZICI and ZIC2 and are negative for the markers: AGCl, ALDH1A1, APCDD1, BMP4, C3, C20orflO3, CCDC3, CD24, CDH3, D102, DKK2, FOXF2, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, HSPB3, IFI27, INA, KCNMB1, KRT14, KRT17, KRT34, LAMC2, TMEM119, IGFL3, LOC92196, MFAP5, MEOXI, MEOX2, MX1, MYH3, MYHl1, MYL4, IL32, NLGN4X, NPAS1, NPPB, OLR1, PAX2, PAX9, PENK, PITX2, PRELP, PROMI, RARRES1, SFRP2, SMOC2, STMN2, TACI, RSP03, THY1, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7 and ZD52F1O. The cell line EN5 is positive for the markers: COL21A1, DLK1, FM03, FOXF1, FOXF2, FST, HTRA3, IGF2, ILIRI, KIAA0644, TMEM119, MGP, MSX1, MSX2, OGN, PRRX1 and PRRX2 and are negative for the markers: ACTC, AGC1, AKR1C1, ALDH1A1, ANXA8, AQP1, AREG, BMP4, C3, C6, C7, C20orflO3, CCDC3, CD24, CDH3, CLDN11, CNTNAP2, COMP, CRIPI, CRLF1, CRYAB, CXADR, DKK2, GABRB1, GAP43, GDF1O, GJB2, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, HSPB3, ID4, IFI27, INA, KCNMB1, KRT14, KRT17, KRT34, LAMC2, IGFL3, LOC92196, MFAP5, MEOXI, MEOX2, MMP1, MX1, MYH3, MYH11, MYL4, 1L32, NLGN4X, NPAS1, NPPB, PAX2, PAX9, PENK, PITX2, PRELP, PRG4, PROMI, RASDI, RELN, RGSI, SMOCI, SMOC2, STMN2, SYT12, TACI, TFPI2, RSPO3, THY1, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, ZD52F1O and ZIC1. 64 WO 2011/150105 PCT/US2011/037969 The cell line EN50 is positive for the markers: BEXI, CDH6, COL21A1, D102, FMO1, FOXF1, FOXF2, FST, GDF5, HTRA3, IGF2, IGFBP5, ILIRI, KRT19, TMEM119, MASPI, MGP, MSX1, PODN, PRRX2, PTPRN, SERPINA3, SOD3, WISP2, ZICI and ZIC2 and are negative for the markers: ACTC, AGC1, ALDH1A1, APCDD1, AQP1, BMP4, C3, C6, C20orfl03, CDH3, CLDN11, CNTNAP2, COMP, DKK2, DPT, EGR2, EMIDI, TMEM100, GABRB1, GAP43, GDF1O, GSC, HOXA5, HSD11B2, HSPA6, HSPB3, IFI27, KIAA0644, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MEOXI, MEOX2, MX1, MYBPH, MYH3, MYH11, NLGN4X, NPPB, OGN, OSR2, PAX2, PAX9, PDE1A, PENK, PITX2, PRELP, PROMI, PRRX1, RARRES1, RASD1, RGS1, SMOC2, SNAP25, STMN2, SYT12, TAC1, RSPO3, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7 and ZD52F1O. The cell line EN51 is positive for the markers: CDH6, DLK1, FMO1, FMO3, FOXF1, FST, HTRA3, IGF2, ILIRI, MSX1, MSX2, OGN, SERPINA3, SOD3, TSLP, ZICI and ZIC2 and are negative for the markers: ACTC, AGC1, AKR1C1, ALDH1A1, ANXA8, APCDD1, AQP1, ATP8B4, CFB, C3, C6, C20orflO3, CCDC3, CD24, CDH3, CLDN11, CRIPI, CRYAB, CXADR, D102, DKK2, DPT, EMIDI, TMEM100, FOXF2, GABRB1, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, HSPB3, ID4, IFI27, INA, KCNMB1, KRT14, KRT17, KRT19, KRT34, LAMC2, IGFL3, LOC92196, MFAP5, MEOXI, MEOX2, MGP, MMP1, MX1, MYH3, MYH11, MYL4, 1L32, NLGN4X, NPAS1, NPPB, OLR1, PAX2, PAX9, PDE1A, PENK, PITX2, PRELP, PROMI, PTGS2, RARRESI, RASD1, RELN, RGS1, SFRP2, SMOC2, STMN2, TAC1, RSPO3, THY1, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7 and ZD52F1O. The cell line EN53 is positive for the markers: BEXI, COL21A1, FST, GDF5, HTRA3, ICAM5, KRT19, TMEM119, PTPRN, SERPINA3, SOD3 and ZIC2 and are negative for the markers: ACTC, AGC1, ALDH1A1, APCDD1, AQP1, ATP8B4, BMP4, C3, C6, C7, C20orflO3, CCDC3, CDH3, CLDN11, CNTNAP2, COPI, CRYAB, D102, DKK2, DPT, EMIDI, FGFR3, TMEM100, FMO3, FOXF2, GABRB1, GAP43, GJB2, GSC, HOXA5, HSPA6, HSPB3, ID4, IFI27, INA, KCNMB1, KIAA0644, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MEOXI, MEOX2, MGP, MMP1, MX1, MYBPH, MYH3, MYHl1, MYL4, 1L32, NLGN4X, NPPB, OGN, OLR1, OSR2, PAX2, PAX9, PDE1A, PENK, PITX2, POSTN, PRELP, PROMI, PTN, RASD1, RELN, RGS1, SLITRK6, SMOC2, STMN2, SYT12, TAC1, RSPO3, THY1, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, ZD52F1O and ZIC1. The cell line EN55 is positive for the markers: D102, FOXF1, FOXF2, FST, GDF5, HTRA3, IGF2, ILIRI, KIAA0644, MGP, MSX2, PODN, PRRX2, PTN, SLITRK6 and SRCRB4D and are negative for the markers: ACTC, AGC1, AKR1C1, ALDH1A1, ANXA8, AQP1, ATP8B4, CFB, BMP4, C6, C7, C20orflO3, CCDC3, CD24, CDH3, CLDN11, CNTNAP2, CRIPI, CRYAB, DKK2, FGFR3, FMO1, GABRB1, GAP43, GDF1O, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, HSPB3, ICAM5, ID4, IFI27, INA, KCNMB1, KRT14, KRT17, KRT34, LAMC2, IGFL3, LOC92196, MFAP5, MEOXI, MEOX2, MX1, MYBPH, MYH3, MYHl1, MYL4, 1L32, NLGN4X, NPAS1, NPPB, OLR1, PAX2, PAX9, PENK, PITX2, POSTN, PROMI, PRRX1, PTGS2, RARRESI, RASD1, RELN, RGS1, SFRP2, SMOCI, SMOC2, SOD3, STMN2, SYT12, TAC1, RSPO3, THY1, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, ZD52F1O, ZICI and ZIC2. The group of cell lines H9.Biol and H9.Bio2 are positive for the markers: ACTC, BEXI, CD24, CDH3, CNTNAP2, CXADR, METTL7A, FGFR3, FST, GAP43, INA, KRT19, NLGN4X, PROMI, PTN, PTPRN, RGMA, SFRP2, SOXI1, SRCRB4D, ZD52F1O and ZIC2 and are negative for the markers: AGC1, ALDH1A1, ANXA8, APCDD1, AQP1, AREG, ATP8B4, CFB, C6, C7, PRSS35, C20orflO3, CDH6, CLDN11, COL15A1, COL21A1, COPI, D102, DKK2, DPT, EGR2, TMEM100, FMO1, FMO3, FOXF1, FOXF2, GABRB1, GDF1O, GJB2, HSD17B2, HSPA6, HSPB3, IF127, IFIT3, IGF2, ILIRI, KRT14, KRT17, KRT34, TMEM119, IGFL3, LOC92196, MEOXI, MEOX2, MGP, MMP1, MSX1, MSX2, MX1, MYBPH, MYH3, MYH11, OGN, OLR1, OSR2, PAX2, PAX9, PDE1A, PENK, POSTN, PRELP, PRG4, PRRX1, PTGS2, RARRES1, RELN, RGS1, SERPINA3, SLITRK6, SMOCI, SNAP25, RSPO3, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7 and WISP2. The cell line J13 is positive for the markers: CDH6, CLDN11, FST, GDF5, IGF2, MMP1, PRRX1, PRRX2, RGMA, SLITRK6, TFPI2 and ZIC2 and are negative for the markers: ACTC, AGC1, ALDH1A1, ANXA8, AQP1, AREG, ATP8B4, CFB, C3, C6, PRSS35, C20orflO3, CCDC3, CD24, CDH3, CNTNAP2, COL15A1, COMP, COPI, CRLF1, CRYAB, D102, METTL7A, DKK2, DLK1, DPT, EGR2, EMIDI, FGFR3, TMEM100, FMO1, FOXF1, GABRB1, GAP43, GDF1O, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, HSPB3, ID4, IFI27, IGFBP5, KCNMB1, KIAA0644, KRT14, KRT17, KRT34, LAMC2, IGFL3, LOC92196, MFAP5, MEOXI, MEOX2, MGP, MYBPH, MYH3, MYH11, MYL4, 1L32, NPAS1, NPPB, OGN, OLR1, PAX2, PAX9, PENK, PITX2, POSTN, PRELP, PRG4, PROMI, PTGS2, PTPRN, RARRESI, RASD1, RELN, RGS1, RPS4Y2, SFRP2, SMOCI, SMOC2, SRCRB4D, STMN2, TAC1, RSPO3, THY1, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, ZD52F1O and ZIC1. 65 WO 2011/150105 PCT/US2011/037969 The cell line J16Bio2 is positive for the markers: BEXI, BMP4, CCDC3, CDH6, CLDN11, COL21A1, CRYAB, FMO3, FST, ICAM5, IGF2, KRT17, TMEM119, POSTN, SERPINA3, SFRP2, SYT12, TFPI2, UGT2B7 and ZIC2 and are negative for the markers: AGC1, ALDH1A1, APCDD1, AQP1, AREG, ATP8B4, C3, C6, C20orflO3, CD24, CDH3, CNTNAP2, COMP, CRLF1, METTL7A, DLK1, DPT, EMIDI, FGFR3, TMEM100, FMO1, FOXF1, FOXF2, GABRB1, GAP43, GDF1O, GJB2, GSC, HOXA5, HSD11B2, HSPA6, HSPB3, HTRA3, ID4, IFI27, KIAA0644, KRT14, KRT34, IGFL3, LOC92196, MEOXI, MEOX2, MSX1, MYBPH, MYH3, NLGN4X, NPPB, OGN, PAX2, PAX9, PDE1A, PENK, PITX2, PRELP, PRG4, PROMI, PTPRN, RARRES1, RASD1, RELN, RGS1, SMOCI, SMOC2, STMN2, TAC1, THY1, TNFSF7, TRH, TUBB4, WISP2 and ZD52F1O. The cell line J8 is positive for the markers: BEXI, BMP4, CLDN11, CRYAB, IGF2, INA, KRT19, MX1, 1L32, TAGLN3, SFRP2, TSLP and UGT2B7 and is negative for the markers: AGC1, ALDH1A1, ANXA8, APCDD1, ATP8B4, CFB, C3, C6, C7, C20orflO3, CCDC3, CDH3, CNTNAP2, COL15A1, COL21A1, COMP, COPI, CRLF1, D102, METTL7A, DKK2, DLK1, DPT, EGR2, EMIDI, FGFR3, TMEM100, FMO1, FMO3, FOXF1, FOXF2, GABRB1, GAP43, GSC, HOXA5, HSD11B2, HSPA6, HSPB3, ID4, IFI27, IGFBP5, KCNMB1, KIAA0644, KRT14, KRT34, IGFL3, LOC92196, MFAP5, MASPI, MEOXI, MEOX2, MGP, MMP1, MSX1, MYH3, MYH11, MYL4, NPAS1, NPPB, OGN, OLR1, OSR2, PAX2, PAX9, PENK, PITX2, PRELP, PROMI, PRRX1, PTGS2, PTN, PTPRN, RARRES1, RGMA, RGS1, SLITRK6, SMOCI, SMOC2, SNAP25, STMN2, TAC1, TNNT2, TRH, TUBB4, WISP2 and ZD52F1O. The cell line MW1 is positive for the markers: APCDD1, BEXI, BMP4, C3, CD24, CDH3, CRLF1, CRYAB, D102, METTL7A, TMEM100, FOXF1, FST, GJB2, IGF2, IGFBP5, ILIRI, KIAA0644, KRT19, TMEM119, OLR1, PODN, PROMI, SERPINA3, SNAP25, SRCRB4D, STMN2, TFPI2 and THYl and are negative for the markers: ACTC, AGC1, AKR1C1, ALDH1A1, AQP1, AREG, ATP8B4, C6, C7, PRSS35, C20orflO3, CCDC3, CDH6, CLDN11, CNTNAP2, COL15A1, COL21A1, COMP, COPI, CXADR, DKK2, DLK1, DPT, EGR2, EMIDI, FGFR3, FMO1, FMO3, FOXF2, GABRB1, GAP43, GDF5, GDF1O, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, HSPB3, HTRA3, ICAM5, ID4, IFI27, INA, KCNMB1, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MASPI, MEOXI, MEOX2, MGP, MMP1, MSX2, MYBPH, MYH3, MYH11, MYL4, 1L32, NLGN4X, TAGLN3, NPAS1, NPPB, OGN, OSR2, PAX2, PAX9, PENK, POSTN, PRELP, PRG4, PRRX1, PRRX2, PTGS2, PTPRN, RARRES1, RELN, RGS1, SFRP2, SLITRK6, SMOCI, SMOC2, SOD3, SYT12, TAC1, RSPO3, TNFSF7, TNNT2, TRH, TSLP, TUBB4, UGT2B7, WISP2, ZD52F1O, ZICI and ZIC2. The cell line MW2 is positive for the markers: C6, C7, CRLF1, D102, METTL7A, FMO1, FMO3, FOXF1, FOXF2, HTRA3, IGF2, ILIRI, TMEM119, MGP, OGN, PRRX2, RGMA, SFRP2, SYT12 and TFPI2 and are negative for the markers: ACTC, AGC1, AKR1C1, ALDH1A1, ANXA8, AQP1, AREG, CFB, C3, C20orflO3, CCDC3, CD24, CDH3, CNTNAP2, COMP, COPI, CRYAB, CXADR, DKK2, DLK1, EMIDI, FGFR3, GABRB1, GAP43, GDF5, GDF1O, GSC, HOXA5, HSD17B2, HSPA6, HSPB3, ICAM5, ID4, IFI27, INA, KCNMB1, KRT14, KRT17, KRT34, LAMC2, IGFL3, LOC92196, MFAP5, MEOXI, MEOX2, MMP1, MSX1, MX1, MYBPH, MYH3, MYH11, MYL4, 1L32, NPAS1, NPPB, OLR1, OSR2, PAX2, PAX9, PENK, PITX2, POSTN, PROMI, PRRX1, PTPRN, RASD1, RELN, RGS1, SMOCI, SMOC2, STMN2, THY1, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, ZD52F1O, ZICI and ZIC2. The cell line MW6 is positive for the markers: BEXI, C6, C7, D102, DPT, FOXF1, FST, HTRA3, IGF2, ILIRI, TMEM119, PITX2, POSTN, PRRX2, SERPINA3, SFRP2, SRCRB4D and SYT12 and are negative for the markers: AGCl, ALDH1A1, ANXA8, AQP1, ATP8B4, CFB, BMP4, C20orflO3, CCDC3, CDH3, CNTNAP2, COPI, CXADR, DKK2, DLK1, EMIDI, FGFR3, TMEM100, GABRB1, GDF1O, GSC, HSD11B2, HSD17B2, HSPA6, HSPB3, ID4, IFI27, IFIT3, INA, KCNMB1, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MEOXI, MEOX2, MMP1, MSX1, MX1, MYH3, MYH11, MYL4, 1L32, NLGN4X, NPPB, OLR1, PAX2, PAX9, PENK, PRELP, PROMI, PRRX1, RARRES1, RASD1, RELN, RGS1, SLITRK6, SMOCI, SMOC2, SNAP25, TAC1, TFPI2, THY1, TNFSF7, TNNT2, TRH, TSLP, TUBB4, UGT2B7, ZICI and ZIC2. The cell line Q4 is positive for the markers: AREG, BEXI, CRYAB, FMO1, FST, HTRA3, ICAM5, IGF2, ILIRI, KRT19, TMEM119, PTPRN, SERPINA3, SOD3, SRCRB4D, ZD52F1O and ZIC2 and are negative for the markers: ACTC, AGC1, ALDH1A1, ANXA8, APCDD1, ATP8B4, CFB, BMP4, C20orflO3, CCDC3, CDH3, CDH6, CLDN11, CNTNAP2, COL15A1, COMP, COPI, D102, DKK2, DPT, EGR2, EMIDI, FMO3, GAP43, GDF1O, GJB2, GSC, HOXA5, HSD17B2, HSPA6, HSPB3, ID4, IFIT3, INA, KCNMB1, KIAA0644, KRT17, KRT34, IGFL3, LOC92196, MEOXI, MEOX2, MGP, MMP1, MSX2, MX1, MYBPH, MYH3, MYH11, NLGN4X, NPPB, OGN, OLR1, OSR2, PAX2, PAX9, PENK, PROMI, PRRX2, PTGS2, RARRES1, RELN, RGMA, RGS1, SLITRK6, SMOCI, SMOC2, STMN2, SYT12, TACI, RSPO3, THY1, TNFSF7, TNNT2, TRH, TSLP, TUBB4 and UGT2B7. 66 WO 2011/150105 PCT/US2011/037969 The cell line Q6 is positive for the markers: AREG, BEXI, COL21A1, DLK1, FMO1, FST, GDF1O, ICAM5, ILIRI, TMEM119, MYL4, OGN, POSTN, SERPINA3, SFRP2, SOD3, SRCRB4D, ZICI and ZIC2 and are negative for the markers: AGC1, ALDH1A1, ANXA8, AQP1, ATP8B4, CFB, C3, C6, C20orflO3, CD24, CDH3, CDH6, CLDN11, CNTNAP2, COMP, COPI, CXADR, D102, DKK2, DPT, EMIDI, FGFR3, FMO3, FOXF1, FOXF2, GABRB1, GJB2, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, IFI27, INA, KCNMB1, KIAA0644, KRT17, KRT19, KRT34, IGFL3, LOC92196, MFAP5, MASPI, MEOXI, MEOX2, MMP1, MX1, MYBPH, MYH3, MYH11, 1L32, NLGN4X, NPPB, OLR1, OSR2, PAX2, PAX9, PENK, PITX2, PRELP, PROMI, PTN, PTPRN, RARRES1, RASD1, RELN, RGS1, SMOCI, SMOC2, SYT12, TAC1, TFPI2, RSPO3, THY1, TNFSF7, TNNT2, TRH, TUBB4 and WISP2. The cell line Q7 is positive for the markers: AREG, BEXI, COL15A1, COL21A1, COMP, EGR2, FST, GDF1O, HSD17B2, IGF2, SERPINA3, ZICI and ZIC2 and is negative for the markers: ACTC, AGC1, AKR1C1, ALDH1A1, AQP1, ATP8B4, CFB, C3, C6, C7, PRSS35, C20orflO3, CCDC3, CD24, CDH3, CLDN11, CNTNAP2, D102, DKK2, DLK1, EMIDI, FGFR3, TMEM100, FMO1, FMO3, GABRB1, GDF5, GJB2, GSC, HOXA5, HSD11B2, HSPA6, HSPB3, ID4, IFI27, KCNMB1, KIAA0644, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MASPI, MEOXI, MEOX2, MGP, MMP1, MSX2, MX1, MYBPH, MYH3, MYH11, 1L32, NLGN4X, NPAS1, NPPB, OGN, OLR1, OSR2, PAX2, PAX9, PDE1A, PENK, PITX2, PODN, POSTN, PRELP, PROMI, PRRX2, PTGS2, PTN, RARRES1, RASD1, RELN, RGMA, RGS1, SLITRK6, SMOC2, SNAP25, STMN2, TAC1, RSPO3, THY1, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7 and WISP2. The cell line RAD20.16 is positive for the markers: ACTC, CD24, CRIPI, CRYAB, FST, HOXA5, HTRA3, KRT19, LAMC2, MFAP5, MASPI, MGP, MMP1, MSX1, POSTN, S100A4, SRCRB4D and THYl and is negative for the markers: AGC1, ALDH1A1, AQP1, AREG, ATP8B4, CFB, C6, C7, C20orflO3, CCDC3, CDH3, CLDN11, CNTNAP2, COL15A1, COL21A1, CRLF1, DLK1, DPT, TMEM100, FMO1, FMO3, FOXF2, GABRB1, GDF1O, GJB2, GSC, HSD11B2, HSD17B2, HSPA6, HSPB3, IFI27, IGF2, KCNMB1, KRT14, TMEM119, IGFL3, LOC92196, MEOXI, MEOX2, MSX2, MX1, MYH3, MYH11, NLGN4X, NPPB, OGN, OSR2, PAX2, PAX9, PDE1A, PENK, PRG4, PROMI, PRRX1, RARRES1, RASD1, RGS1, SFRP2, SMOCI, SMOC2, SOD3, STMN2, TAC1, TFPI2, RSPO3, TRH, TSLP, TUBB4, UGT2B7, WISP2, ZICI and ZIC2. The cell line RAD20.19 is positive for the markers: ACTC, BEXI, CD24, CRIPI, CRYAB, FST, HOXA5, INA, KRT19, KRT34, LAMC2, MFAP5, MASPI, MMP1, MSX1, NPPB, PTPRN and THYl and is negative for the markers: AGC1, ALDH1A1, APCDD1, AQP1, AREG, ATP8B4, CFB, C6, C7, C20orflO3, CDH3, CNTNAP2, COL15A1, COL21A1, COPI, CRLF1, D102, METTL7A, DKK2, DLK1, DPT, EGR2, EMIDI, TMEM100, FMO1, FMO3, FOXF2, GABRB1, GDF1O, GJB2, GSC, HSD11B2, HSD17B2, HSPA6, HSPB3, ID4, IFI27, IGF2, KIAA0644, KRT14, KRT17, IGFL3, LOC92196, MEOXI, MEOX2, MGP, MX1, MYBPH, MYH3, NLGN4X, OGN, OSR2, PAX2, PAX9, PDE1A, PENK, PROMI, PRRX1, PTN, RARRESI, RASD1, RGMA, RGS1, SFRP2, SLITRK6, SMOCI, SMOC2, SNAP25, STMN2, SYT12, TAC1, RSPO3, TNFSF7, TRH, TSLP, TUBB4, WISP2, ZICI and ZIC2. The cell line RAD20.5 is positive for the markers: AKR1C1, CRIPI, METTL7A, FOXF1, HOXA5, HTRA3, KIAA0644, KRT19, MASPI, MMP1, MSX1, POSTN, PTPRN, S100A4, SRCRB4D and THYl and is negative for the markers: AGC1, ALDH1A1, ANXA8, APCDD1, AQP1, AREG, ATP8B4, BEXI, CFB, C6, C7, PRSS35, C20orflO3, CCDC3, CDH3, CLDN11, CNTNAP2, COL15A1, COL21A1, COMP, CRLF1, CNTNAP2, DKK2, DLK1, DPT, EGR2, EMIDI, TMEM100, FMO1, FMO3, FOXF2, GAP43, GDF1O, GSC, HSD11B2, HSD17B2, HSPA6, HSPB3, ID4, IGF2, KCNMB1, KRT14, KRT34, IGFL3, LOC92196, MEOXI, MEOX2, MGP, MSX2, MYBPH, MYH3, MYH11, MYL4, 1L32, NLGN4X, NPAS1, NPPB, OGN, PAX2, PAX9, PDE1A, PENK, PRELP, PRG4, PROMI, RARRESI, RGMA, RGS1, SFRP2, SLITRK6, SMOCI, SMOC2, SOD3, STMN2, SYT12, TACI, TRH, TSLP, TUBB4, UGT2B7, WISP2, ZICI and ZIC2. The cell line RAPEND17 is positive for the markers: ANXA8, BEXI, C3, CD24, CRIPI, CRYAB, METTL7A, FST, HOXA5, HTRA3, ICAM5, IFIT3, IGF2, ILIRI, KRT19, LAMC2, MFAP5, MASPI, OLR1, POSTN, PTN, PTPRN and TFPI2 and is negative for the markers: ACTC, AGC1, APCDD1, AQP1, ATP8B4, CFB, C6, C7, PRSS35, C20orflO3, CCDC3, CDH3, CDH6, CLDN11, CNTNAP2, COL15A1, COL21A1, DKK2, DLK1, DPT, EGR2, EMIDI, TMEM100, FMO1, FMO3, FOXF2, GABRB1, GAP43, GDF1O, GSC, HSD11B2, HSD17B2, HSPA6, HSPB3, ID4, KCNMB1, KRT14, KRT17, IGFL3, LOC92196, MEOXI, MEOX2, MGP, MSX2, MYH3, MYH11, NLGN4X, OGN, OSR2, PAX2, PAX9, PDE1A, PENK, PRELP, PROMI, PRRX1, PRRX2, RARRES1, RELN, RGMA, RGS1, SFRP2, SLITRK6, SMOCI, SMOC2, SOD3, SYT12, TACI, RSPO3, THY1, TNFSF7, TNNT2, TRH, TSLP, TUBB4, UGT2B7, WISP2, ZD52F1O, ZICI and ZIC2. 67 WO 2011/150105 PCT/US2011/037969 The cell line RASKEL18 is positive for the markers: AREG, CD24, CRYAB, METTL7A, DPT, FST, GJB2, HTRA3, IGF2, IGFBP5, ILIRI, PTN, PTPRN, SERPINA3, SOXI1, SRCRB4D and RSPO3 and is negative for the markers: ACTC, AKR1C1, ALDH1A1, ANXA8, AQP1, CFB, C7, PRSS35, C20orflO3, CDH6, CLDN11, CNTNAP2, COMP, COPI, D102, DKK2, DLK1, EGR2, EMIDI, FGFR3, FMO1, FMO3, GAP43, GDF1O, GSC, HSD11B2, HSD17B2, HSPA6, HSPB3, IFI27, INA, KCNMB1, KRT14, KRT17, KRT34, TMEM119, IGFL3, LOC92196, MFAP5, MASPI, MEOXI, MEOX2, MMP1, MSX2, MYBPH, MYH3, MYHI1, MYL4, 1L32, NLGN4X, TAGLN3, NPAS1, NPPB, OGN, OLR1, PAX2, PAX9, PENK, PRELP, PRG4, PROMI, PRRX1, PRRX2, PTGS2, RARRES1, RASDI, RELN, RGMA, RGSI, SLITRK6, SMOCI, SMOC2, STMN2, SYT12, TAC1, TFPJ2, THY1, TNFSF7, TNNT2, TRH, TSLP, TUBB4, WISP2, ZICI and ZIC2. The cell line RASKEL6 is positive for the markers: AREG, BEXI, C3, CRLF1, CRYAB, METTL7A, FST, HTRA3, IGF2, ILIRI, TMEM1 19, PITX2, SERPINA3 and TFPJ2 and is negative for the markers: ACTC, AKR1C1, ALDH1A1, ANXA8, AQP1, CFB, BMP4, C6, CCDC3, CDH3, CDH6, CLDN11, CNTNAP2, COL15A1, COMP, COPI, CXADR, DKK2, DLK1, EGR2, EMIDI, FMO1, FMO3, FOXF2, GAP43, GDF1O, GSC, HSD17B2, HSPA6, ID4, IFI27, IFIT3, IGFBP5, INA, KIAA0644, KRT17, KRT34, LAMC2, IGFL3, LOC92196, MFAP5, MASPI, MEOXI, MEOX2, MMP1, MSX2, MYBPH, MYH3, MYHI1, 1L32, NLGN4X, TAGLN3, NPAS1, NPPB, OGN, OLR1, OSR2, PAX2, PAX9, PENK, POSTN, PRELP, PROMI, PRRX1, PRRX2, RARRESI, RELN, RGMA, RGSI, SLITRK6, SMOCI, SMOC2, STMN2, SYT12, TAC1, RSPO3, THY1, TNFSF7, TRH, TUBB4, UGT2B7, WISP2, ZICI and ZIC2. The cell line RASKEL8 is positive for the markers: AREG, BEXI, C7, CRIPI, CRLF1, CRYAB, FST, HOXA5, HTRA3, ICAM5, IGF2, ILIRI, KRT19, LAMC2, PITX2, POSTN, PTPRN, SERPINA3 and TFPJ2 and is negative for the markers: ACTC, AGC1, ALDH1A1, AQP1, ATP8B4, CFB, C6, PRSS35, C20orf1O3, CCDC3, CDH3, CDH6, CLDN11, CNTNAP2, COMP, COPI, DKK2, DLK1, DPT, EMIDI, FMO1, FMO3, FOXF2, GABRB1, GAP43, GDF1O, GSC, HSD11B2, HSD17B2, HSPA6, HSPB3, IFI27, IGFBP5, KCNMB1, KIAA0644, KRT14, KRT17, KRT34, IGFL3, LOC92196, MEOXI, MEOX2, MGP, MMP1, MSX2, MX1, MYH3, MYHI1, NLGN4X, TAGLN3, NPPB, OGN, OSR2, PAX2, PAX9, PDE1A, PENK, PRELP, PRG4, PROMI, PRRX1, PRRX2, PTN, RARRESI, RELN, RGMA, RGSI, SFRP2, SLITRK6, SMOCI, SMOC2, SNAP25, STMN2, SYT12, TACI, RSPO3, TNFSF7, TNNT2, TRH, TSLP, TUBB4, WISP2, ZICI and ZIC2. The cell line SKI is positive for the markers: AKR1C1, BEXI, C6, C7, COL21A1, CRIPI, METTL7A, DLK1, TMEM100, FMO1, FMO3, FOXF2, FST, HSD11B2, HTRA3, ICAM5, IGF2, ILIRI, TMEM119, MGP, MSX1, PRG4, PTN, PTPRN, S100A4, SERPINA3, SFRP2, SOD3, SOXI1, WISP2 and ZICI and is negative for the markers: AGC1, ALDH1A1, ANXA8, AQP1, ATP8B4, BMP4, C20orf1O3, CD24, CDH3, CDH6, CLDN11, CNTNAP2, COMP, COPI, CRLF1, DKK2, EGR2, EMIDI, FGFR3, GABRB1, GAP43, GDF1O, GJB2, GSC, HOXA5, HSD17B2, HSPA6, ID4, IFI27, IFIT3, INA, KCNMB1, KRT14, KRT17, KRT19, KRT34, LAMC2, IGFL3, LOC92196, MFAP5, MASPI, MEOXI, MEOX2, MMP1, MSX2, MX1, MYBPH, MYHI1, 1L32, NLGN4X, NPAS1, NPPB, OLR1, PAX2, PAX9, PENK, PITX2, POSTN, PRELP, PROMI, RARRES1, RGSI, SMOC2, SYT12, TFPJ2, RSPO3, THY1, TNNT2, TRH, TSLP, TUBB4 and ZIC2. The group of cell lines SKIOBiol and SK1OBio2 are positive for the markers: BEXI, COL21A1, FST, ICAM5, ILIRI, TMEM119, SERPINA3 and ZIC2 and are negative for the markers: ACTC, AGC1, ALDH1A1, AQP1, CFB, BMP4, C3, C6, C20orf1O3, CDH3, CLDN11, CNTNAP2, DKK2, DPT, EMIDI, TMEM100, FMO3, GABRB1, GAP43, GSC, HOXA5, HSPA6, ID4, IF127, KIAA0644, KRT14, KRT34, IGFL3, LOC92196, MFAP5, MEOXI, MEOX2, MX1, MYBPH, MYH3, MYHI1, NLGN4X, NPPB, OLR1, PAX2, PAX9, PDE1A, PENK, PROMI, RARRES1, RASDI, RELN, RGSI, SLITRK6, SMOCI, SMOC2, STMN2, SYT12, TACI, RSPO3, THY1, TNNT2 and TUBB4. The group of cell lines SKI1, SK44, SK50 and SK52 are positive for the markers: BEXI, COL21A1, FST, ICAM5, ILIRI, TMEM1 19, PTPRN, SERPINA3, SFRP2 and ZICI and are negative for the markers: ACTC, AGC1, ALDH1A1, AQP1, ATP8B4, C6, C20orf1O3, CCDC3, CDH3, CLDN11, CNTNAP2, D102, DKK2, EMIDI, GABRB1, GSC, HOXA5, HSPA6, IFI27, INA, KRT14, KRT34, IGFL3, LOC92196, MEOXI, MEOX2, MMP1, MX1, MYH3, MYHI1, 1L32, NLGN4X, NPPB, OLR1, PAX2, PAX9, PDE1A, PENK, PROMI, PTN, RARRESI, RASDI, RELN, RGSI, SMOCI, SMOC2, STMN2, TACI, TFPJ2, RSPO3, TNFSF7, TNNT2, TRH and TUBB4. 68 WO 2011/150105 PCT/US2011/037969 The group of cell lines SK14, SK53, SK60 and SK61 are positive for the markers: C7, COL21A1, CRYAB, HTRA3, ILIRI, MGP, PTPRN, RGMA, SERPINA3 and SFRP2 and are negative for the markers: ACTC, AGC1, ALDH1A1, ANXA8, AQP1, ATP8B4, CFB, BMP4, CCDC3, CDH3, CNTNAP2, COPI, CXADR, DKK2, GABRB1, GAP43, GDF1O, GJB2, GSC, HOXA5, HSD17B2, IFI27, IFIT3, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MEOXI, MEOX2, MMP1, MX1, MYBPH, MYH3, MYH11, 1L32, NLGN4X, NPPB, OLR1, PAX2, PAX9, PENK, PROMI, RASDI, RELN, RGSI, SLITRK6, SMOCI, SMOC2, STMN2, TAC1, RSPO3, TNNT2, TRH, TUBB4, UGT2B7, ZICI and ZIC2. The cell line SK17 is positive for the markers: ACTC, APCDD1, BEXI, COL21A1, METTL7A, DLK1, FST, HOXA5, HSPB3, HTRA3, IGF2, ILIRI, KIAA0644, MASPI, MGP, MYBPH, MYH3, NLGN4X, PDE1A, PTN, RGMA, SRCRB4D, STMN2, RSPO3 and TNNT2 and is negative for the markers: AGC1, AKR1C1, ALDH1A1, ANXA8, AQP1, CFB, C6, C20orflO3, CCDC3, CDH3, CDH6, CLDN11, CNTNAP2, COL15A1, COMP, COPI, CRLF1, DKK2, DPT, TMEM100, FMO1, FMO3, FOXF2, GABRB1, GDF1O, GSC, HSD17B2, HSPA6, ID4, IFI27, INA, KCNMB1, KRT14, KRT34, LAMC2, TMEM119, IGFL3, LOC92196, MFAP5, MEOXI, MEOX2, MMP1, MX1, MYH1l, 1L32, NPAS1, NPPB, OLR1, PAX2, PAX9, PENK, PITX2, PRELP, RASDI, RELN, RGSI, S100A4, SLITRK6, SMOCI, SMOC2, TAC1, THY1, TNFSF7, TRH, TSLP, TUBB4, UGT2B7, WISP2, ZICI and ZIC2. The cell line SK18 is positive for the markers: APCDD1, COL21A1, METTL7A, FMO1, FOXF1, FST, HTRA3, IGF2, ILIRI, TMEM119, OGN, PITX2, PRRX1, RGMA, SERPINA3, SFRP2, SOD3 and TSLP and is negative for the markers: ACTC, AGC1, AKR1C1, ALDH1A1, ANXA8, AQP1, AREG, ATP8B4, CFB, BMP4, C3, C6, C7, C20orflO3, CCDC3, CD24, CDH3, CNTNAP2, COPI, CXADR, D102, DKK2, DLK1, DPT, EMIDI, TMEM100, GABRB1, GAP43, GDF5, GDF1O, GJB2, GSC, HOXA5, HSD17B2, HSPA6, HSPB3, ID4, IFI27, INA, KIAA0644, KRT14, KRT17, KRT19, KRT34, LAMC2, IGFL3, LOC92196, MFAP5, MEOXI, MEOX2, MMP1, MSX1, MX1, MYBPH, MYH3, MYH11, MYL4, IL32, NLGN4X, NPPB, OLR1, OSR2, PAX2, PAX9, PDE1A, PENK, PRELP, PROMI, RARRES1, RASD1, RELN, RGSI, SLITRK6, SMOCI, SMOC2, STMN2, TAC1, TFPJ2, RSPO3, THY1, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, ZICI and ZIC2. The cell line SK26 is positive for the markers: APCDD1, BEXI, COL21A1, CRYAB, FMO1, FOXF2, FST, HTRA3, ICAM5, ILIRI, TMEM119, PRRX1, PTPRN, SERPINA3 and SFRP2 and is negative for the markers: ACTC, AGC1, ALDH1A1, ANXA8, AQP1, AREG, ATP8B4, CFB, BMP4, C3, C6, C7, C20orflO3, CCDC3, CD24, CDH3, CLDN11, CNTNAP2, COPI, CXADR, DKK2, DLK1, DPT, EGR2, EMIDI, FGFR3, GABRB1, GAP43, GDF1O, GJB2, GSC, HOXA5, HSD17B2, HSPA6, IFI27, IFIT3, KIAA0644, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MEOXI, MEOX2, MMP1, MX1, MYBPH, MYH3, MYHl1, MYL4, 1L32, NLGN4X, NPPB, OLR1, OSR2, PAX2, PAX9, PDE1A, PENK, PITX2, POSTN, PROMI, PTN, RARRESI, RASDI, RELN, RGSI, SLITRK6, SMOCI, SMOC2, SNAP25, STMN2, TAC1, TFPJ2, RSPO3, THY1, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7 and ZIC1. The group of cell lines SK27 and T7 are positive for the markers: BEXI, PRSS35, CCDC3, CDH6, COL21A1, CRIPI, CRYAB, GAP43, IGF2, KRT19, LAMC2, POSTN, S100A4, SFRP2, SOXI1 and ZIC2 and are negative for the markers: AGC1, ALDH1A1, APCDD1, AREG, ATP8B4, CFB, C3, C7, C20orflO3, CDH3, CLDN11, CNTNAP2, COPI, CXADR, DLK1, DPT, EGR2, EMIDI, GDF1O, GJB2, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, HSPB3, IFI27, INA, KRT14, IGFL3, LOC92196, MFAP5, MEOXI, MEOX2, MMP1, MYBPH, MYH3, MYL4, NLGN4X, NPPB, OLR1, PAX2, PAX9, PDE1A, PENK, PRG4, PROMI, RARRESI, RASDi, RELN, RGS1, SLITRK6, SMOCi, SMOC2, SNAP25, STMN2, TACi, TFPJ2, RSPO3, TNNT2, TRH, TUBB4 and ZIC1. The group of cell lines SK28 and SK57 are positive for the markers: BEXI, COL21A1, CRYAB, HTRA3, ICAM5, IGF2, ILIRI, PTPRN and SERPINA3 and are negative for the markers: AGC1, ALDH1A1, AQP1, ATP8B4, CFB, BMP4, C20orflO3, CCDC3, CDH3, CDH6, CLDN11, CNTNAP2, COPI, CXADR, D102, DKK2, EMIDI, GABRB1, GAP43, GDF1O, GSC, HOXA5, HSD17B2, HSPA6, HSPB3, ID4, IFI27, KCNMB1, KIAA0644, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MEOXI, MEOX2, MMP1, MSX2, MX1, MYH3, MYH11, MYL4, 1L32, NLGN4X, NPPB, OLR1, OSR2, PAX2, PAX9, PENK, PROMI, PTN, RARRESI, RASDI, RELN, RGSI, SLITRK6, SMOCI, SMOC2, STMN2, TACI, TFPJ2, RSPO3, TNFSF7, TNNT2, TRH, TUBB4 and UGT2B7. The group of cell lines SK30 and W4 are positive for the markers:BEX1, FST, HTRA3, IGF2, TMEM119, POSTN, SOXI1, SRCRB4D, ZICI and ZIC2 and are negative for the markers: AGC1, ALDH1A1, ANXA8, AQP1, ATP8B4, C3, C6, C7, C20orflO3, CCDC3, CDH3, CLDN11, CRYAB, D102, METTL7A, EGR2, EMIDI, FMO3, FOXF2, GABRB1, GSC, HOXA5, HSD11B2, HSPA6, HSPB3, ID4, IFI27, INA, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MASPI, MEOXI, MEOX2, MMP1, MX1, MYH3, MYH1l, NPPB, OLR1, OSR2, PAX2, PAX9, PDE1A, PENK, PRELP, PROMI, RARRESI, RASD1, RELN, SMOC2, STMN2, SYT12, TACI, RSPO3, TNFSF7, TNNT2 and TUBB4. 69 WO 2011/150105 PCT/US2011/037969 The group of cell lines SK31 and SK54 are positive for the markers: BEXI, COL21A1, CRIPI, CRYAB, TMEM100, FMO1, FM03, FOXF1, FOXF2, IGF2, IGFBP5, ILIRI, KRT19, LAMC2, TMEM119, NPAS1, PDE1A, PRRX2, S100A4, SERPINA3, SNAP25, SOXI1, SRCRB4D and WISP2 and are negative for the markers: ACTC, AGC1, AKR1C1, ALDH1A1, ANXA8, AQP1, AREG, ATP8B4, CFB, BMP4, C3, CCDC3, CD24, CDH3, CLDN11, CNTNAP2, COMP, COPI, CXADR, DKK2, DLK1, DPT, EMIDI, FGFR3, GABRB1, GAP43, GDF1O, GSC, HSD17B2, HSPA6, HTRA3, ID4, IFI27, INA, KCNMB1, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MASPI, MEOXI, MEOX2, MMP1, MYH3, MYH1l, MYL4, 1L32, NLGN4X, NPPB, OGN, OLR1, OSR2, PAX2, PAX9, PENK, PITX2, PRELP, PROMI, PRRX1, RELN, RGSI, SLITRK6, SMOCI, SMOC2, SOD3, STMN2, SYT12, TAC1, TFPI2, RSP03, TNFSF7, TNNT2, TRH, TSLP, TUBB4, ZICI and ZIC2. The cell line SK32 is positive for the markers: AKR1C1, BEXI, C6, C7, C20orflO3, COL21A1, CRYAB, METTL7A, DPT, GDF5, HTRA3, ICAM5, ILIRI, TMEM119, MGP, OGN, POSTN, PTPRN, RGMA, SERPINA3, SFRP2, SOD3, WISP2 and ZICI and is negative for the markers: ACTC, AGC1, ALDH1A1, ANXA8, AQP1, AREG, ATP8B4, CFB, BMP4, C3, CCDC3, CD24, CDH3, CDH6, CLDN11, CNTNAP2, COL15A1, COMP, COPI, CXADR, D102, DKK2, EGR2, EMIDI, FGFR3, FM03, FOXF1, FOXF2, GABRB1, GAP43, GDF1O, GSC, HOXA5, HSD17B2, HSPA6, HSPB3, ID4, IFI27, IFIT3, INA, KIAA0644, KRT14, KRT17, KRT19, KRT34, IGFL3, LOC92196, MFAP5, MASPI, MEOXI, MEOX2, MMP1, MX1, MYBPH, MYH3, MYH11, MYL4, 1L32, NLGN4X, NPPB, OLR1, OSR2, PAX2, PAX9, PENK, PITX2, PRELP, PROMI, PTGS2, RASDI, RELN, RGSI, SLITRK6, SMOCI, SMOC2, STMN2, SYT12, TFPJ2, RSP03, THY1, TNFSF7, TNNT2, TRH, TSLP, TUBB4 and ZIC2. The group of cell lines SK40 and SK4OBio2 are positive for the markers: BEXI, COL21A1, CRYAB, FMO1, FST, ICAM5, IGFBP5, TMEM119, MSX1, MYL4, PTPRN, SERPINA3, SOD3, ZICI and ZIC2 and are negative for the markers: AGC1, AKR1C1, ALDH1A1, AQP1, ATP8B4, BMP4, C3, C20orflO3, CCDC3, CD24, CDH3, CLDN11, CNTNAP2, COPI, D102, DKK2, DPT, TMEM100, FM03, GABRB1, GAP43, GSC, HOXA5, HSPA6, HSPB3, ID4, IFI27, INA, KCNMB1, KIAA0644, KRT14, KRT17, KRT34, IGFL3, LOC92196, MEOXI, MEOX2, MX1, MYBPH, MYH11, NLGN4X, NPPB, OGN, OLR1, PAX2, PAX9, PDE1A, PENK, PITX2, PRELP, PROMI, RARRESI, RASDI, RELN, RGSI, SMOC2, SNAP25, SYT12, TAC1, TFPJ2, RSP03, THY1, TNFSF7, TRH, TSLP and TUBB4 The cell line SK46 is positive for the markers: APCDD1, COL21A1, D102, METTL7A, FMO1, FM03, FOXF1, FOXF2, FST, HTRA3, IGF2, ILIRI, TMEM119, OGN, PRRX1, PRRX2, SERPINA3, SFRP2, SLITRK6, TSLP and ZIC2 and is negative for the markers: ACTC, AGC1, ALDH1A1, ANXA8, AQP1, ATP8B4, CFB, BMP4, C3, C6, C7, C20orflO3, CCDC3, CD24, CDH3, CLDN11, CNTNAP2, COPI, CRIPI, CXADR, DKK2, DPT, EMIDI, FGFR3, GABRB1, GAP43, GDF5, GDF1O, GJB2, GSC, HOXA5, HSD17B2, HSPA6, HSPB3, IFI27, INA, KRT14, KRT17, KRT19, KRT34, LAMC2, IGFL3, LOC92196, MFAP5, MEOXI, MEOX2, MMP1, MX1, MYBPH, MYH3, MYH11, MYL4, 1L32, NLGN4X, TAGLN3, NPAS1, NPPB, OLR1, OSR2, PAX2, PAX9, PDE1A, PENK, PITX2, POSTN, PRELP, PROMI, RARRES1, RASDI, RELN, RGSI, SMOCI, SMOC2, STMN2, TFPI2, RSP03, THY1, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7 and ZICI. The cell line SK47 is positive for the markers: BEXI, COL21A1, METTL7A, FMO1, FOXF1, FOXF2, FST, HTRA3, ICAM5, IGF2, ILIRI, KRT19, TMEM119, MSX1, PRRX2, PTPRN, SERPINA3, SOD3 and ZICI and is negative for the markers: AGC1, ALDH1A1, AQP1, ATP8B4, CFB, BMP4, C3, C6, C7, C20orflO3, CCDC3, CD24, CDH3, CLDN11, CNTNAP2, COL15A1, COPi, CRLF1, DKK2, DPT, EGR2, EMIDI, FGFR3, GABRB1, GAP43, GDF1O, GJB2, GSC, HOXA5, HSD17B2, HSPA6, HSPB3, ID4, IFI27, INA, KCNMB1, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MEOXI, MEOX2, MGP, MMP1, MX1, MYBPH, MYH3, MYH11, 1L32, NLGN4X, NPPB, OLR1, PAX2, PAX9, PDE1A, PENK, PITX2, POSTN, PRELP, PROMI, RARRESI, RASDI, RELN, RGSI, SLITRK6, SMOCI, SMOC2, STMN2, SYT12, TACI, TFPI2, RSP03, THY1, TNFSF7, TNNT2, TRH, TUBB4 and ZD52F1O. The group of cell lines SK5.Bio1, SK5.Bio2, SK5Bio3 and SK5BioUT are positive for the markers: ACTC, C7, CRLF1, CRYAB, FST, HTRA3, ILIRI, TMEM1 19, MGP, PTPRN, SERPINA3, SFRP2 and ZICI and are negative for the markers: ALDH1A1, ANXA8, CFB, BMP4, C3, C20orflO3, CDH3, CLDN11, CNTNAP2, COPI, DKK2, EMIDI, FM03, GABRB1, GDF1O, GSC, HSD17B2, HSPB3, IFI27, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MEOXI, MEOX2, MYH11, 1L32, NPPB, OLR1, OSR2, PAX2, PAX9, PENK, PRELP, PROMI, RARRESI, RELN, RGSI, SLITRK6, SMOCI, SMOC2, STMN2, RSP03, TNFSF7, TNNT2, TRH, TUBB4 and ZIC2. 70 WO 2011/150105 PCT/US2011/037969 The cell line SK8 is positive for the markers: APCDD1, BEXI, COL21A1, CRLF1, FMO1, FMO3, FOXF2, FST, HTRA3, ICAM5, IGF2, ILIRI, TMEM119, MASPI, PTPRN, SERPINA3 and SFRP2 and is negative for the markers: ACTC, AGC1, ALDH1A1, ANXA8, AQP1, ATP8B4, CFB, BMP4, C7, PRSS35, C20orflO3, CD24, CDH3, CDH6, CLDN11, CNTNAP2, COPI, DKK2, EMIDI, GABRB1, GAP43, GDF1O, GJB2, GSC, HOXA5, HSD17B2, HSPA6, HSPB3, IFI27, IFIT3, INA, KIAA0644, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MEOXI, MEOX2, MMP1, MX1, MYBPH, MYH3, MYH11, MYL4, 1L32, NLGN4X, NPPB, OLR1, OSR2, PAX2, PAX9, PDE1A, PENK, PRELP, PROMI, PTN, RARRES1, RASD1, RELN, RGS1, SMOCI, SMOC2, STMN2, TAC1, RSPO3, THY1, TNFSF7, TNNT2, TRH, TUBB4, ZICI and ZIC2. The cell line SM17 is positive for the markers: BEXI, CD24, CRYAB, EGR2, FOXF1, FST, GDF5, HTRA3, IGFBP5, KRT19, MMP1, MSX1, MSX2, 1L32, PODN, POSTN, PRELP, PRRX2, SRCRB4D, TFPI2, TSLP and ZICI and is negative for the markers: AGC1, AKR1C1, ALDH1A1, ANXA8, APCDD1, AQP1, AREG, ATP8B4, CFB, BMP4, C6, C7, C20orflO3, CCDC3, CDH3, CLDN11, CNTNAP2, COL15A1, D102, METTL7A, DKK2, DLK1, DPT, FGFR3, TMEM100, FMO1, FMO3, GABRB1, GAP43, GDF1O, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, IFI27, IGF2, KCNMB1, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MEOXI, MEOX2, MYBPH, MYH3, MYH11, NLGN4X, NPPB, OLR1, OSR2, PAX2, PAX9, PDE1A, PENK, PRG4, PROMI, RARRESI, RASD1, RELN, RGS1, SMOCI, SMOC2, SNAP25, STMN2, TAC1, RSPO3, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, WISP2 and ZIC2. The cell line SM19 is positive for the markers: BEXI, CNTNAP2, CRYAB, FST, GDF5, MMP1, POSTN, PRRX2, SERPINA3 and SFRP2 and is negative for the markers: ACTC, AGC1, AKR1C1, ALDH1A1, ANXA8, AQP1, AREG, ATP8B4, CFB, BMP4, C3, C6, C7, C20orflO3, CDH3, CDH6, CLDN11, COL21A1, COMP, COPI, CRLF1, D102, METTL7A, DKK2, DLK1, DPT, EMIDI, FGFR3, TMEM100, FMO1, FMO3, FOXF2, GABRB1, GDF10, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, ID4, IFI27, IGF2, IGFBP5, ILIRI, KCNMB1, KIAA0644, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MASPI, MEOXI, MEOX2, MGP, MX1, MYBPH, MYH3, MYH11, NLGN4X, NPPB, OGN, OLR1, OSR2, PAX2, PAX9, PDE1A, PENK, PITX2, PRG4, PROMI, RARRES1, RASD1, RGS1, SLITRK6, SMOCI, SMOC2, SNAP25, STMN2, SYT12, TAC1, TFPI2, RSPO3, THY1, TNFSF7, TNNT2, TRH, UGT2B7, WISP2, ZICI and ZIC2. The cell line SM2 is positive for the markers: CDH6, CNTNAP2, COL15A1, COL21A1, FST, GDF5, TMEM119, MMP1, MSX1, POSTN, PRRX1, SOD3, ZICI and ZIC2 and is negative for the markers: ACTC, AGC1, AKR1C1, ALDH1A1, ANXA8, APCDD1, AQP1, AREG, ATP8B4, BEXI, BMP4, C3, C6, C7, PRSS35, C20orflO3, CCDC3, CD24, CDH3, CLDN11, COMP, CRIPI, CRYAB, D102, DPT, EMIDI, FGFR3, TMEM100, FMO3, GDF1O, GJB2, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, HSPB3, ID4, IFI27, INA, KCNMB1, KIAA0644, KRT14, KRT17, KRT19, KRT34, IGFL3, LOC92196, MFAP5, MASP1, MEOXI, MEOX2, MGP, MX1, MYBPH, MYH3, MYH11, MYL4, 1L32, NLGN4X, NPAS1, NPPB, OLR1, OSR2, PAX2, PAX9, PDE1A, PENK, PITX2, PROMI, RARRES1, RASD1, RELN, RGS1, SFRP2, SLITRK6, SMOCI, SMOC2, STMN2, SYT12, TAC1, TFPI2, RSPO3, TNFSF7, TNNT2, TRH, TUBB4 and UGT2B7. The cell line SM22 is positive for the markers: CDH6, CRLF1, DLK1, FOXF1, FST, GDF5, HTRA3, IGFBP5, ILIRI, MGP, MMP1, MSX1, MSX2, OGN, POSTN, PRRX2, PTN, RGMA, SOD3, SRCRB4D, STMN2, TSLP, ZD52F1O and ZICI and is negative for the markers: AGC1, ALDH1A1, ANXA8, APCDD1, AQP1, AREG, BMP4, C3, C6, C7, C20orflO3, CCDC3, CDH3, CLDN11, CNTNAP2, COL15A1, CRIPI, CXADR, D102, DKK2, DPT, TMEM100, FMO1, FOXF2, GDF1O, GJB2, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, HSPB3, ICAM5, IFI27, INA, KRT14, KRT17, KRT34, LAMC2, TMEM119, IGFL3, LOC92196, MFAP5, MASPI, MEOXI, MEOX2, MX1, MYBPH, MYH3, MYH11, MYL4, 1L32, NLGN4X, NPAS1, NPPB, OLR1, OSR2, PAX2, PAX9, PENK, PITX2, PRG4, PROMI, PTPRN, RARRESI, RASD1, RELN, RGS1, SFRP2, SMOCI, SMOC2, SNAP25, TAC1, RSPO3, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7 and ZIC2. The group of cell lines SM25 and Z8 are positive for the markers: FOXF1, FST, GDF5, HTRA3, MSX1, MSX2, PRRX2 and SRCRB4D and are negative for the markers: ACTC, AGC1, AKR1C1, ALDH1A1, ANXA8, AQP1, AREG, ATP8B4, BMP4, C6, C7, C20orflO3, CD24, CDH3, CLDN11, CNTNAP2, METTL7A, DKK2, EMIDI, TMEM100, FMO1, GABRB1, GDF1O, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, ID4, IFI27, KCNMB1, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MEOXI, MEOX2, MYBPH, MYH3, MYH11, MYL4, NLGN4X, NPPB, OLR1, OSR2, PAX2, PAX9, PDE1A, PENK, PITX2, PROMI, RARRES1, RASD1, RGS1, RPS4Y2, SFRP2, SLITRK6, SMOCI, SMOC2, TAC1, RSPO3, TNFSF7, TNNT2, TRH, TUBB4 and UGT2B7. 71 WO 2011/150105 PCT/US2011/037969 The cell line SM28 is positive for the markers: COMP, CRLF1, D102, EGR2, FOXF1, FOXF2, FST, HSPB3, INA, TMEM119, MGP, MMP1, MSX2, POSTN, PRELP, PRRX2, PTN and SYT12 and is negative for the markers: ACTC, AGC1, AKR1C1, ALDH1A1, ANXA8, APCDD1, AQP1, AREG, ATP8B4, BEXI, CFB, C3, C6, C7, C20orflO3, CD24, CDH6, CLDN11, CNTNAP2, COL21A1, CXADR, METTL7A, DKK2, DLK1, FGFR3, TMEM100, FMO1, GABRB1, GAP43, GDF1O, GJB2, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, ID4, IFI27, IFIT3, KCNMB1, KRT14, KRT17, KRT19, KRT34, LAMC2, IGFL3, LOC92196, MFAP5, MEOXI, MEOX2, MX1, MYBPH, MYH3, MYH11, 1L32, NLGN4X, TAGLN3, NPPB, OGN, OLR1, OSR2, PAX2, PAX9, PDE1A, PENK, PITX2, PRG4, PROMI, PTGS2, PTPRN, RARRES1, RASD1, RGS1, RPS4Y2, SERPINA3, SFRP2, SMOCI, SMOC2, SNAP25, STMN2, TAC1, RSPO3, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, WISP2, ZD52F1O, ZICI and ZIC2. The cell line SM29 is positive for the markers: FOXF1, FOXF2, FST, HTRA3, IGF2, IGFBP5, ILIRI, MASPI, MGP, MMP1, MSX2, OGN, PODN, POSTN, PRELP, PRRX2, PTN, SRCRB4D and TSLP and is negative for the markers: ACTC, AKR1C1, ALDH1A1, ANXA8, APCDD1, AQP1, CFB, C6, C7, CCDC3, CDH3, CLDN11, CNTNAP2, COL15A1, COL21A1, CRIPI, CRLF1, CRYAB, DKK2, DPT, FGFR3, TMEM100, GDF1O, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, ID4, IFI27, INA, KCNMB1, KRT14, KRT17, KRT34, LAMC2, IGFL3, LOC92196, MFAP5, MEOXI, MEOX2, MX1, MYBPH, MYH3, MYHl1, MYL4, 1L32, NLGN4X, NPPB, OLR1, OSR2, PAX9, PDE1A, PENK, PITX2, PROMI, RARRES1, RASD1, RELN, RGS1, S100A4, SMOCI, SMOC2, SNAP25, TAC1, RSPO3, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, WISP2, ZICI and ZIC2. The cell line SM30 is positive for the markers: COL15A1, CRYAB, DYSF, FST, GDF5, HTRA3, TMEM119, MMP1, MSX1, MSX2, MYL4, POSTN, SERPINA3, SRCRB4D and ZIC2 and is negative for the markers: ACTC, AGC1, AKR1C1, ALDH1A1, ANXA8, APCDD1, AQP1, ATP8B4, CFB, C3, C6, C7, C20orflO3, CD24, CDH3, CLDN11, CNTNAP2, COMP, D102, METTL7A, DKK2, DLK1, DPT, FGFR3, TMEM100, FMO1, FMO3, FOXF2, GABRB1, GJB2, GSC, HOXA5, HSD11B2, HSPA6, ID4, IFI27, ILIRI, KCNMB1, KIAA0644, KRT14, KRT17, KRT34, IGFL3, LOC92196, MEOXI, MEOX2, MGP, MYBPH, MYH3, MYH11, NLGN4X, NPPB, OGN, OLR1, OSR2, PAX2, PAX9, PDE1A, PENK, PRG4, PROMI, PRRX1, PTN, RARRESI, RASD1, RELN, RGS1, SLITRK6, SMOCI, SMOC2, SNAP25, STMN2, TAC1, RSPO3, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7 and WISP2. The cell line SM33 is positive for the markers: BEXI, CDH6, CRLF1, EGR2, FOXF1, FST, IGFBP5, MSX1, MSX2, PRELP, SERPINA3, SRCRB4D, SYT12, TSLP and ZIC2 and is negative for the markers: ACTC, AGC1, AKR1C1, ALDH1A1, ANXA8, APCDD1, AQP1, AREG, ATP8B4, CFB, BMP4, C3, C6, C7, C20orflO3, CD24, CDH3, CLDN11, CNTNAP2, COL21A1, CRIPI, D102, METTL7A, DLK1, DPT, EMIDI, FGFR3, TMEM100, FMO1, GABRB1, GAP43, GSC, HOXA5, HSD11B2, HSPA6, HSPB3, ID4, IFI27, ILIRI, KCNMB1, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MEOXI, MEOX2, MX1, MYBPH, MYH3, MYH11, NLGN4X, NPPB, OGN, OSR2, PAX2, PAX9, PDE1A, PENK, PRG4, PROMI, PTGS2, RARRESI, RASD1, RELN, RGS1, RPS4Y2, SFRP2, SMOCI, SMOC2, SNAP25, STMN2, TAC1, RSPO3, THY1, TNFSF7, TRH, TUBB4, UGT2B7, WISP2 and ZIC1. The cell line SM4 is positive for the markers: BEXI, CCDC3, CDH6, CRLF1, EGR2, FST, GABRB1, GAP43, GDF5, HSPB3, HTRA3, MMP1, MSX1, MSX2, PRELP, PRRX1, PRRX2 and SRCRB4D and is negative for the markers: AGC1, ALDH1A1, ANXA8, APCDD1, AQP1, AREG, ATP8B4, CFB, BMP4, C3, C6, C7, PRSS35, C20orflO3, CD24, CDH3, CLDN11, CNTNAP2, COL15A1, COL21A1, COPI, CXADR, METTL7A, DKK2, DLK1, DPT, EMIDI, FGFR3, TMEM100, FMO1, FMO3, GDF1O, GJB2, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, ICAM5, ID4, IFI27, IGF2, KRT14, KRT17, KRT19, KRT34, IGFL3, LOC92196, MFAP5, MASPI, MEOXI, MEOX2, MX1, MYBPH, MYH3, MYH11, MYL4, 1L32, NLGN4X, TAGLN3, NPAS1, NPPB, OLR1, OSR2, PAX2, PAX9, PDE1A, PENK, PITX2, PRG4, PROMI, RARRESI, RASD1, RELN, RGS1, SFRP2, SLITRK6, SMOCI, SMOC2, SNAP25, STMN2, TAC1, RSPO3, TNFSF7, TNNT2, TRH, TSLP, TUBB4, UGT2B7, WISP2, ZD52F1O and ZIC1. The cell line SM40 is positive for the markers: BEXI, CD24, CRYAB, FST, HSPB3, IGFBP5, KRT19, MMP1, MYL4, POSTN, PRELP, SRCRB4D and ZD52F1O and is negative for the markers: AGC1, AKR1C1, ALDH1A1, ANXA8, APCDD1, AQP1, AREG, CFB, C6, C7, CDH3, CDH6, CLDN11, CNTNAP2, COL15A1, COL21A1, COMP, CRLF1, D102, METTL7A, DKK2, DLK1, DPT, EMIDI, FGFR3, TMEM100, FMO1, FMO3, GABRB1, GAP43, GDF1O, GJB2, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, ID4, IFI27, IGF2, KRT14, KRT17, KRT34, IGFL3, LOC92196, MEOXI, MEOX2, MGP, MX1, MYBPH, MYH3, MYH11, NLGN4X, NPPB, OGN, OSR2, PAX2, PAX9, PDE1A, PENK, PITX2, PROMI, PRRX1, RARRESI, RASD1, RELN, RGMA, RGS1, RPS4Y2, SFRP2, SLITRK6, SMOCI, SMOC2, SOXI, STMN2, TACI, RSPO3, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, WISP2, ZICI and ZIC2. 72 WO 2011/150105 PCT/US2011/037969 The cell line SM42 is positive for the markers: COL15A1, EGR2, FST, GDF5, TMEM119, MMP1, MSX1, MSX2, PRELP, PRRX1, PRRX2, SFRP2, SRCRB4D, ZICI and ZIC2 and is negative for the markers: ACTC, AGC1, AKR1C1, ALDH1A1, ANXA8, APCDD1, AQP1, ATP8B4, CFB, BMP4, C3, C6, C7, C20orf1O3, CCDC3, CD24, CDH3, CLDN11, CNTNAP2, CRIPI, CRYAB, D102, METTL7A, DKK2, DLK1, DPT, EMIDI, FGFR3, TMEM100, FOXF2, GABRB1, GAP43, GJB2, GSC, HOXA5, HSD11B2, HSPA6, ID4, IF127, KIAA0644, KRT14, KRT17, KRT19, KRT34, IGFL3, LOC92196, MFAP5, MEOXI, MEOX2, MGP, MX1, MYBPH, MYH3, MYH11, NLGN4X, NPPB, OGN, OLR1, PAX2, PAX9, PDE1A, PENK, PITX2, PRG4, PROMI, RARRESI, RASD1, RELN, RGS1, SLITRK6, SMOCI, SMOC2, SNAP25, STMN2, TAC1, RSPO3, TNFSF7, TNNT2, TRH, TUBB4 and UGT2B7. The cell line SM44 is positive for the markers: CDH6, COMP, CRLF1, CRYAB, EGR2, FOXF1, FST, GDF5, HTRA3, MGP, MMP1, MSX2, POSTN, PRELP, PRRX2, SYT12 and TSLP and is negative for the markers: ACTC, AGC1, AKR1C1, ALDH1A1, ANXA8, APCDD1, AQP1, AREG, ATP8B4, CFB, BMP4, C3, C6, C7, C20orf1O3, CD24, CDH3, CLDN11, CNTNAP2, COL15A1, COL21A1, COPI, CXADR, METTL7A, DKK2, DLK1, DPT, EMIDI, FGFR3, TMEM100, FMO1, FMO3, FOXF2, GABRB1, GDF1O, GJB2, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, ID4, IF127, IFIT3, IGF2, KRT14, KRT17, KRT19, KRT34, IGFL3, LOC92196, MFAP5, MEOXI, MEOX2, MX1, MYBPH, MYH3, MYH11, MYL4, NLGN4X, NPPB, OGN, OLR1, OSR2, PAX2, PAX9, PDE1A, PENK, PRG4, PROMI, PTN, PTPRN, RARRES1, RASD1, RELN, RGS1, SFRP2, SLITRK6, SMOCI, SMOC2, SNAP25, STMN2, TAC1, RSPO3, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, WISP2, ZD52F1O, ZICI and ZIC2. The cell line SM49 is positive for the markers: FOXF1, FOXF2, FST, GAP43, GDF5, HSPB3, HTRA3, IGFBP5, MGP, MMP1, MSX2, POSTN, PRELP, PRRX2, PTN, RGMA, SOD3, SRCRB4D and SYT12 and is negative for the markers: ACTC, AGC1, AKR1C1, ALDH1A1, ANXA8, APCDD1, AQP1, AREG, CFB, BMP4, C6, C7, C20orf1O3, CD24, CDH3, CLDN11, CNTNAP2, COL15A1, COL21A1, D102, METTL7A, DPT, EMIDI, FGFR3, TMEM100, FMO1, GABRB1, GDF1O, GJB2, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, ID4, IF127, IFIT3, KIAA0644, KRT14, KRT17, KRT19, KRT34, LAMC2, IGFL3, LOC92196, MFAP5, MEOXI, MEOX2, MYBPH, MYH3, MYH11, MYL4, NLGN4X, TAGLN3, NPAS1, NPPB, OGN, OLR1, OSR2, PAX2, PAX9, PDE1A, PENK, PITX2, PRG4, PROMI, RARRESI, RELN, RGS1, SMOCI, SMOC2, SNAP25, TAC1, RSPO3, THY1, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, WISP2, ZICI and ZIC2 The cell line SM8 is positive for the markers: BEXI, CDH6, FOXF1, FST, GDF5, GDF1O, IGF2, IGFBP5, MMP1, MSX1, TFPI2, TSLP and ZIC2 and is negative for the markers: ACTC, AGC1, AKR1C1, ALDH1A1, ANXA8, APCDD1, AQP1, ATP8B4, CFB, BMP4, C3, C6, C7, PRSS35, C20orf1O3, CCDC3, CDH3, CLDN11, COL21A1, COMP, CRYAB, D102, METTL7A, DKK2, DLK1, DPT, EMIDI, FGFR3, TMEM100, FMO1, FMO3, FOXF2, GABRB1, GJB2, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, HSPB3, ICAM5, ID4, IF127, KCNMB1, KIAA0644, KRT14, KRT17, KRT34, TMEM119, IGFL3, LOC92196, MFAP5, MASPI, MEOXI, MEOX2, MGP, MX1, MYBPH, MYH3, MYH11, MYL4, NLGN4X, NPAS1, NPPB, OGN, OLR1, OSR2, PAX2, PAX9, PDE1A, PENK, PITX2, POSTN, PRELP, PRG4, PROMI, PRRX1, PTGS2, RGMA, RGS1, S100A4, SFRP2, SLITRK6, SMOC2, STMN2, TAC1, RSPO3, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, WISP2 and ZD52F1O. The cell line T14 is positive for the markers: BEXI, PRSS35, CCDC3, COL15A1, CRIPI, CRYAB, FST, HTRA3, IGF2, KCNMB1, KRT17, KRT19, LAMC2, PITX2, POSTN, S100A4, SOXI1, THYl and TNNT2 and is negative for the markers: AGCl, ALDH1A1, AQP1, AREG, ATP8B4, CFB, C3, C6, C7, C20orflO3, CDH3, CLDN11, CNTNAP2, COPI, CXADR, METTL7A, DLK1, DPT, EGR2, EMIDI, TMEM100, FMO1, FMO3, FOXF1, FOXF2, GABRB1, GDF1O, GJB2, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, HSPB3, IF127, IGFBP5, KIAA0644, KRT14, IGFL3, LOC92196, MASPI, MEOXI, MEOX2, MGP, MX1, MYH3, 1L32, NLGN4X, TAGLN3, NPPB, OGN, OLR1, OSR2, PAX2, PAX9, PDE1A, PENK, PRG4, PROMI, PTGS2, PTPRN, RARRESI, RASD1, RELN, RGS1, SLITRK6, SMOCI, SMOC2, SNAP25, SOD3, STMN2, TAC1, TFPI2, RSPO3, TNFSF7, TRH, TUBB4, WISP2, ZD52F1O, ZICI and ZIC2. The group of cell lines T4 and T23 are positive for the markers: BEXI, CCDC3, DKK2, KRT19 and LAMC2 and are negative for the markers: ALDH1A1, APCDD1, AQP1, CFB, C3, C6, C20orf1O3, CDH3, CLDN11, CNTNAP2, COL15A1, COMP, CRLF1, METTL7A, DPT, EMIDI, TMEM100, FMO3, FOXF2, GDF1O, GJB2, GSC, HOXA5, HSD11B2, HSPA6, IF127, ILIRI, KRT14, IGFL3, LOC92196, MASPI, MEOXI, MEOX2, MGP, MX1, MYBPH, MYH3, MYH11, NLGN4X, NPAS1, OGN, OLR1, PAX2, PAX9, PDE1A, PENK, PROMI, PRRX2, PTPRN, RARRESI, RASD1, RGMA, RGS1, RPS4Y2, SFRP2, SLITRK6, SMOCI, SMOC2, SNAP25, STMN2, SYT12, TACI, RSPO3, TNFSF7, TRH, WISP2, ZD52F1O and ZICI. 73 WO 2011/150105 PCT/US2011/037969 The group of cell lines T36 and T42 are positive for the markers: BEXI, CCDC3, CDH6, CRIPI, FST, HTRA3, KRT17, PTN, S100A4, SRCRB4D, THY1 and ZIC2 and are negative for the markers: AGC1, ALDH1A1, APCDD1, AREG, ATP8B4, C3, C6, C7, PRSS35, C20orf1O3, CDH3, CLDN11, CNTNAP2, CRLF1, METTL7A, DLK1, DPT, EMIDI, FMO1, FMO3, FOXF2, GJB2, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, HSPB3, IFI27, KRT14, IGFL3, LOC92196, MFAP5, MASPI, MEOXI, MEOX2, MGP, MMP1, MYBPH, MYH3, NLGN4X, TAGLN3, NPAS1, NPPB, OGN, OLR1, PAX9, PDE1A, PENK, PRG4, PROMI, PTPRN, RARRESI, RASD1, RELN, RGS1, SLITRK6, SMOC2, SNAP25, STMN2, TAC1, RSPO3, TRH, TUBB4 and WISP2. The group of cell lines T43 and T44 are positive for the markers: BEXI, PRSS35, CCDC3, CDH6, COL21A1, CRIPI, CRYAB, ICAM5, KRT17, LAMC2, POSTN, S100A4, SFRP2 and THY1 and are negative for the markers: AGC1, ALDH1A1, APCDD1, AQP1, AREG, ATP8B4, C3, C6, C7, C20orf1O3, CDH3, CNTNAP2, COPI, METTL7A, DLK1, DPT, EMIDI, FMO1, FMO3, FOXF1, FOXF2, GABRB1, GDF1O, GJB2, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, IFI27, IGFBP5, IGFL3, LOC92196, MEOXI, MEOX2, MGP, NLGN4X, TAGLN3, NPPB, OGN, OLR1, OSR2, PAX2, PAX9, PDE1A, PRG4, PROMI, RARRESI, RASD1, RELN, RGS1, SLITRK6, SMOCI, SMOC2, SNAP25, STMN2, TAC1, TRH, TUBB4, UGT2B7, WISP2, ZD52F1O and ZIC2. The cell line U18 is positive for the markers: ANXA8, BEXI, PRSS35, CCDC3, CDH6, CRYAB, DKK2, KRT19, MYH11, NPPB, TNNT2 and ZIC2 and is negative for the markers: ACTC, AGC1, ALDH1A1, APCDD1, AQP1, AREG, ATP8B4, CFB, C3, C6, C7, C20orf1O3, CD24, CDH3, CLDN11, CNTNAP2, COL15A1, COPI, CRLF1, D102, METTL7A, DPT, EGR2, EMIDI, TMEM100, FMO1, FMO3, FOXF1, FOXF2, GABRB1, GDF1O, GJB2, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, HSPB3, IFI27, IGF2, IGFBP5, KIAA0644, KRT14, TMEM119, IGFL3, LOC92196, MEOXI, MEOX2, MGP, MX1, MYBPH, MYH3, NLGN4X, OGN, OLR1, PAX2, PAX9, PDE1A, PENK, PROMI, PTPRN, RARRESI, RASD1, RELN, RGS1, SFRP2, SLITRK6, SMOCI, SMOC2, SNAP25, SOD3, STMN2, TAC1, TFPI2, RSPO3, THY1, TNFSF7, TRH, TUBB4, WISP2 and ZICI. The group of cell lines U30, U30 and U31 are positive for the markers: BEXI, CDH6, CRYAB, KCNMB1, KRT17, MYHI1, ZICI and ZIC2 and are negative for the markers: ALDH1A1, ATP8B4, C3, C7, C20orf1O3, CD24, CDH3, CLDN11, CNTNAP2, COPI, CRLF1, METTL7A, DPT, FMO1, FMO3, FOXF1, FOXF2, GABRB1, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, IFI27, KIAA0644, KRT14, MEOX2, MGP, MYH3, OGN, OLR1, PAX2, PAX9, PDE1A, PROMI, PTPRN, RASD1, RGS1, SFRP2, SMOCI, SNAP25, TAC1, TNNT2, TRH, TUBB4 and WISP2. The cell line WI1 is positive for the markers: COL15A1, COL21A1, D102, DLK1, FMO1, FOXF1, FOXF2, FST, HTRA3, IGF2, ILIRI, TMEM119, OGN, PRRX2, PTN, SERPINA3, SLITRK6, SOD3, TFPI2 and WISP2 and is negative for the markers: ACTC, AGC1, AKR1C1, ALDH1A1, ANXA8, APCDD1, AQP1, ATP8B4, CFB, C3, C6, C7, C20orf1O3, CCDC3, CD24, CDH3, CLDN11, CNTNAP2, CRIPI, CRYAB, CXADR, DKK2, EMID1, FGFR3, GAP43, GDF10, GJB2, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, HSPB3, ID4, IFI27, INA, KRT14, KRT17, KRT19, KRT34, LAMC2, IGFL3, LOC92196, MFAP5, MEOXI, MEOX2, MGP, MMP1, MX1, MYBPH, MYH3, MYHI1, MYL4, 1L32, NLGN4X, NPAS1, NPPB, OLR1, PAX2, PAX9, PENK, PITX2, POSTN, PRG4, PROMI, RASD1, RELN, RGS1, SMOCI, SMOC2, STMN2, TAC1, RSPO3, THY1, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, ZD52F1O, ZICI and ZIC2. The cell line W2 is positive for the markers: BEXI, CD24, COL21A1, FST, HTRA3, ICAM5, IGF2, IGFBP5, ILIRI, KRT19, LAMC2, TMEM119, MSX1, MSX2, PTN, SERPINA3, SFRP2, SOD3, SOXI1, SRCRB4D and ZIC2 and is negative for the markers: AGC1, AKR1C1, ALDH1A1, APCDD1, ATP8B4, BMP4, C6, C7, C20orf1O3, CCDC3, CDH3, CLDN11, CNTNAP2, COL15A1, COMP, COPI, CRLF1, DKK2, DLK1, DPT, EGR2, EMIDI, TMEM100, FMO3, FOXF2, GAP43, GDF1O, GSC, HOXA5, HSD11B2, HSPA6, ID4, IFI27, INA, KCNMB1, KIAA0644, KRT14, KRT17, IGFL3, LOC92196, MEOXI, MEOX2, MGP, MYBPH, MYH3, MYHI1, NLGN4X, NPPB, OGN, OLR1, OSR2, PAX2, PAX9, PDE1A, PENK, PITX2, PRG4, PROMI, PTGS2, RARRESI, RASD1, RELN, RGMA, RGS1, SLITRK6, SMOCI, SMOC2, STMN2, SYT12, TACI, TNFSF7, TNNT2, TRH, TSLP, TUBB4 and ZICI. 74 WO 2011/150105 PCT/US2011/037969 The cell line W3 is positive for the markers: BEXI, CRIPI, FOXF1, FST, GDF5, HSPA6, HTRA3, IGF2, IGFBP5, KRT19, LAMC2, MMP1, MSX1, POSTN, PTPRN and TFPI2 and is negative for the markers: ACTC, AGC1, ALDH1A1, ANXA8, APCDD1, AQP1, ATP8B4, CFB, BMP4, C6, C7, PRSS35, C20orflO3, CCDC3, CDH3, CLDN11, CNTNAP2, COL15A1, COL21A1, COMP, D102, METTL7A, DKK2, DLK1, DPT, EGR2, EMIDI, FGFR3, FMO1, FMO3, FOXF2, GAP43, GDF1O, GJB2, GSC, HOXA5, HSD11B2, HSD17B2, IFI27, IFIT3, INA, KIAA0644, KRT14, KRT17, IGFL3, LOC92196, MEOXI, MEOX2, MGP, MX1, MYBPH, MYH3, MYH11, MYL4, 1L32, NLGN4X, NPPB, OGN, OSR2, PAX2, PAX9, PDE1A, PENK, PRELP, PRG4, PROMI, PRRX1, RARRES1, RELN, RGMA, RGS1, SLITRK6, SMOCI, SMOC2, SOXI1, SYT12, TAC1, RSPO3, THY1, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, ZICI and ZIC2. The cell line W8 is positive for the markers: AQP1, CDH6, D102, DLK1, EMIDI, FOXF1, FOXF2, FST, HTRA3, ILIRI, MSX1, MSX2, PRRX2, PTN, SLITRK6, SRCRB4D, TSLP and ZIC2 and is negative for the markers: ACTC, AGC1, AKR1C1, ALDH1A1, ANXA8, APCDD1, BMP4, C6, C7, C20orflO3, CCDC3, CD24, CDH3, CLDN11, CNTNAP2, CRLF1, CRYAB, CXADR, DKK2, DPT, EGR2, FGFR3, TMEM100, GABRB1, GAP43, GDF1O, GJB2, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, HSPB3, ID4, IFI27, IFIT3, INA, KCNMB1, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MEOXI, MEOX2, MX1, MYBPH, MYH3, MYH11, MYL4, NLGN4X, NPPB, OLR1, PAX2, PAX9, PENK, PITX2, POSTN, PRELP, PROMI, PRRX1, RARRESI, RASD1, RGMA, RGS1, SMOCI, SMOC2, STMN2, SYT12, TAC1, RSPO3, THY1, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, WISP2, ZD52F1O and ZIC1. The cell line X4 is positive for the markers: ACTC, AQP1, BEXI, BMP4, CD24, CDH6, CLDN11 CRYAB, CXADR, HTRA3, INA, KRT17, KRT19, LAMC2, MMP1, 1L32, NLGN4X, TAGLN3, NPPB, PAX2, PROMI, RASD1, RELN and UGT2B7 and is negative for the markers: AGC1, ALDH1A1, APCDD1, ATP8B4, CFB, C3, C6, C7, C20orflO3, CCDC3, CDH3, CNTNAP2, COL15A1, COL21A1, COMP, COPI, CRLF1, D102, METTL7A, DKK2, DLK1, DPT, EGR2, EMIDI, TMEM100, FMO1, FMO3, FOXF1, FOXF2, FST, GABRB1, GAP43, GDF1O, GJB2, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, ID4, IFI27, IFIT3, IGF2, ILIRI, KCNMB1, KIAA0644, TMEM119, IGFL3, LOC92196, MFAP5, MASPI, MEOXI, MEOX2, MGP, MX1, MYBPH, MYH3, MYL4, OGN, OSR2, PAX9, PDE1A, PENK, PITX2, PRELP, PRRX1, PRRX2, PTGS2, PTN, RARRESI, RGMA, RGS1, SERPINA3, SLITRK6, SMOCI, SMOC2, SOD3, TAC1, RSPO3, TNNT2, TRH, TUBB4, WISP2, ZD52F1O, ZICI and ZIC2. The cell line X5.4 is positive for the markers: ACTC, CD24, CLDN11, CRIPI, CRYAB, HTRA3, KRT19, KRT34, LAMC2, MMP1, 1L32, NLGN4X, TAGLN3, NPPB, PAX2, POSTN, RELN, S100A4, SFRP2, SRCRB4D, THYl and UGT2B7 and is negative for the markers: AGC1, ALDH1A1, APCDD1, AREG, ATP8B4, CFB, C3, C6, C7, C20orflO3, CNTNAP2, COL21A1, COMP, COPI, CRLF1, D102, METTL7A, DKK2, DLK1, DPT, EMIDI, TMEM100, FMO1, FMO3, FOXF1, FOXF2, GABRB1, GAP43, GDF1O, GJB2, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, ID4, IFI27, IFIT3, IGF2, KIAA0644, TMEM119, IGFL3, MASPI, MEOX2, MSX1, MX1, MYBPH, MYH3, MYL4, NPAS1, OGN, OSR2, PAX9, PDE1A, PENK, PRELP, PRRX1, PRRX2, PTPRN, RARRES1, RGMA, RGS1, SLITRK6, SMOCI, SMOC2, SNAP25, SOD3, TAC1, RSPO3, TNNT2, TRH, TUBB4, WISP2, ZD52F1O, ZICI and ZIC2. The cell line X5 is positive for the markers: ACTC, AKR1C1, BEXI, CLDN11, COMP, CRIPI, CRYAB, GDF5, HTRA3, KIAA0644, KRT14, KRT19, KRT34, LAMC2, MFAP5, MEOX2, MGP, MMP1, PENK, PITX2, POSTN, PTGS2, S100A4 and THYl and is negative for the markers: AGC1, ALDH1A1, ANXA8, APCDD1, AQP1, AREG, ATP8B4, C6, C7, C20orflO3, CCDC3, CDH6, CNTNAP2, COL15A1, COL21A1, COPI, CXADR, D102, DKK2, DLK1, DPT, EMIDI, FGFR3, TMEM100, FMO1, FMO3, FOXF1, FOXF2, GAP43, GDF1O, HSD11B2, HSD17B2, HSPA6, IFI27, IFIT3, IGF2, IGFL3, LOC92196, MEOXI, MSX1, MSX2, MYBPH, MYH3, MYH11, MYL4, NLGN4X, NPPB, OGN, OLR1, PAX2, PAX9, PDE1A, PROMI, PTPRN, RASD1, RELN, RGS1, SERPINA3, SFRP2, SMOC2, SNAP25, STMN2, SYT12, TACI, RSPO3, TNNT2, TRH, TUBB4, UGT2B7, WISP2, ZD52F1O, ZICI and ZIC2. The group of cell lines X7PEND12 and X7PEND24 are positive for the markers: AQP1, BEXI, CDH3, D102, DLK1, FOXF1, FST, GABRB1, IGF2, IGFBP5, ILIRI, KIAA0644, MSX1, PODN, PRRX2, SERPINA3, SOXI1, SRCRB4D and TFPI2 and are negative for the markers: ACTC, AGC1, AKR1C1, ALDH1A1, ANXA8, APCDD1, AREG, CFB, C3, C6, C7, PRSS35, CCDC3, CD24, CLDN11, COMP, COPI, CXADR, DKK2, EMIDI, FGFR3, FMO1, FMO3, GAP43, GDF1O, GSC, HOXA5, HSD11B2, HSPA6, HTRA3, ICAM5, ID4, IFI27, IFIT3, INA, KCNMB1, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MASPI, MEOXI, MEOX2, MMP1, MX1, MYBPH, MYH3, MYH11, MYL4, 1L32, NLGN4X, NPPB, OGN, OSR2, PAX2, PAX9, PENK, PITX2, PRELP, PRG4, PRRX1, RARRES1, RELN, RGMA, SFRP2, SMOCI, SMOC2, SOD3, SYT12, TACI, TNFSF7, TRH, TSLP, TUBB4, UGT2B7, WISP2, ZD52F1O, ZICI and ZIC2. 75 WO 2011/150105 PCT/US2011/037969 The group of cell lines X7PEND9 and X7PEND16 are positive for the markers: BEXI, CDH6, DLK1, TMEM100, FOXF1, FOXF2, IGF2, IGFBP5, ILIRI, KIAA0644, TMEM119, MGP, MSX1, MSX2, PDE1A, PODN, PRRX2, PTN, S100A4, SERPINA3, SNAP25, SOXI1 and SRCRB4D and are negative for the markers: ACTC, AGC1, AKR1C1, ALDH1A1, ANXA8, AREG, ATP8B4, BMP4, C3, C20orflO3, CCDC3, CD24, CDH3, CNTNAP2, COPI, CRYAB, CXADR, METTL7A, DKK2, EMIDI, FGFR3, FMO1, GDF1O, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, HSPB3, ICAM5, ID4, IFI27, INA, KCNMB1, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MASPI, MEOXI, MEOX2, MMP1, MYBPH, MYH3, MYH11, MYL4, 1L32, NLGN4X, NPAS1, NPPB, OLR1, OSR2, PAX2, PAX9, PENK, PITX2, PRELP, PRG4, PROMI, PTPRN, RASDI, RELN, RGSI, SFRP2, SMOCI, SMOC2, SOD3, SYT12, TAC1, RSPO3, THY1, TNFSF7, TNNT2, TRH, TSLP, TUBB4, UGT2B7, ZD52F1O, ZICI and ZIC2. The cell line X7PEND30 is positive for the markers: BEXI, PRSS35, CDH6, COL15A1, D102, DLK1, DPT, TMEM100, FMO1, FMO3, FOXF1, FOXF2, FST, HSPB3, IGF2, IGFBP5, ILIRI, KIAA0644, KRT19, LAMC2, TMEM119, MGP, MSX1, PDE1A, PODN, PRRX2, S100A4, SERPINA3, SOXI and SRCRB4D and is negative for the markers: ACTC, AGC1, AKR1C1, ALDH1A1, ANXA8, APCDD1, AQP1, AREG, ATP8B4, C3, C7, C20orflO3, CCDC3, CD24, CDH3, CLDN11, CNTNAP2, COPI, CXADR, DKK2, EMIDI, FGFR3, GAP43, GDF5, GDF1O, GJB2, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, HTRA3, ICAM5, ID4, IFI27, INA, KCNMB1, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MASPI, MEOXI, MEOX2, MMP1, MYBPH, MYH3, MYH11, MYL4, 1L32, NLGN4X, NPPB, OSR2, PAX2, PAX9, PENK, PITX2, PRELP, PRRX1, PTGS2, PTPRN, RELN, RGSI, SFRP2, SMOCI, SMOC2, SOD3, STMN2, SYT12, TAC1, RSPO3, THY1, TNFSF7, TNNT2, TRH, TSLP, TUBB4, UGT2B7, WISP2, ZD52F1O, ZICI and ZIC2. The cell line X7SKEL2 is positive for the markers: APCDD1, BEXI, C6, C7, PRSS35, COL21A1, CRIPI, CRLF1, CRYAB, DLK1, TMEM100, FMO1, FOXF2, GDF5, HSD11B2, IGF2, IGFBP5, KRT19, LAMC2, TMEM119, MGP, NPAS1, PRRX2, PTPRN, RGMA, S100A4, SERPINA3, SNAP25 and SOXI and is negative for the markers: ACTC, AGC1, AKR1C1, ALDH1A1, ANXA8, AQP1, AREG, ATP8B4, CFB, BMP4, C3, C20orflO3, CCDC3, CD24, CDH3, CDH6, CLDN11, CNTNAP2, COMP, COPI, CXADR, D102, METTL7A, DKK2, DPT, EGR2, EMIDI, FGFR3, FOXF1, GABRB1, GDF1O, GJB2, GSC, HOXA5, HSD17B2, HSPA6, HTRA3, ID4, IFI27, IFIT3, KCNMB1, KIAA0644, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MASPI, MEOXI, MEOX2, MMP1, MSX2, MX1, MYBPH, MYH3, MYH11, MYL4, 1L32, NLGN4X, NPPB, OGN, OLR1, OSR2, PAX2, PAX9, PENK, PITX2, POSTN, PRELP, PROMI, PRRX1, PTGS2, PTN, RARRESI, RELN, RGSI, SLITRK6, SMOCI, SMOC2, SOD3, STMN2, SYT12, TAC1, TFPJ2, RSPO3, THY1, TNFSF7, TRH, TSLP, TUBB4, UGT2B7, ZICI and ZIC2. The cell line X7SKEL22 is positive for the markers: ACTC, BEXI, C7, PRSS35, COL21A1, CRIPI, CRYAB, D102, DPT, EGR2, FMO3, FOXF1, FOXF2, FST, GJB2, HSPB3, IGF2, IGFBP5, ILIRI, KRT19, LAMC2, TMEM119, MGP, NPAS1, PODN, PRRX2, SERPINA3, SOXI and SRCRB4D and is negative for the markers: AGC1, AKR1C1, ALDH1A1, ANXA8, AQP1, AREG, ATP8B4, CFB, BMP4, C3, C20orflO3, CCDC3, CD24, CDH3, CDH6, CLDN11, CNTNAP2, COL15A1, COMP, COPI, CXADR, METTL7A, DKK2, DLK1, EMIDI, FGFR3, TMEM100, GABRB1, GAP43, GDF5, GDF1O, GSC, HOXA5, HSD17B2, HSPA6, HTRA3, ICAM5, ID4, IFI27, IFIT3, KCNMB1, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MASPI, MEOXI, MEOX2, MMP1, MSX1, MSX2, MX1, MYBPH, MYH3, MYH11, 1L32, NLGN4X, NPPB, OGN, OLR1, OSR2, PAX2, PAX9, PENK, PITX2, POSTN, PRELP, PRG4, PROMI, PRRX1, PTN, RARRES1, RASDI, RELN, RGSI, SFRP2, SLITRK6, SMOCI, SMOC2, SOD3, STMN2, SYT12, TAC1, TFPJ2, RSPO3, TNFSF7, TNNT2, TRH, TSLP, TUBB4, UGT2B7, ZD52F1O, ZICi and ZIC2. The group of cell lines X7SKEL4, X7SKEL6 and X7SKEL7 are positive for the markers: BEXI, COL21A1, CRLF1, DLK1, FMO1, FMO3, FOXF1, FOXF2, HSD11B2, IGF2, IGFBP5, ILIRI, TMEM119, PRRX2, RGMA, SERPINA3, SNAP25, SOXI1 and SRCRB4D and are negative for the markers: ACTC, AGC1, AKR1C1, ALDH1A1, ANXA8, AQP1, AREG, ATP8B4, CFB, BMP4, C3, C20orflO3, CCDC3, CD24, CDH3, CLDN11, CNTNAP2, COL15A1, COMP, COPI, CXADR, DKK2, EMIDI, FGFR3, GDF1O, GJB2, GSC, HOXA5, HSD17B2, HSPA6, HTRA3, ID4, IFI27, IFIT3, INA, KCNMB1, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MASPI, MEOXI, MEOX2, MMP1, MYBPH, MYH3, MYH1l, MYL4, 1L32, NLGN4X, NPPB, OLR1, OSR2, PAX2, PENK, PITX2, POSTN, PRELP, PROMI, RELN, RGSI, SFRP2, SLITRK6, SMOCI, SMOC2, SOD3, STMN2, SYT12, TACI, TFPI2, RSPO3, THY1, TNFSF7, TNNT2, TRH, TSLP, TUBB4 and ZIC1. 76 WO 2011/150105 PCT/US2011/037969 The cell line X7SMOO12 is positive for the markers: BEXI, CDH6, COL21A1, CRIPI, D102, DLK1, EGR2, FOXF1, FOXF2, FST, IGF2, IGFBP5, TMEM119, MSX1, MSX2, MX1, PODN, POSTN, PRRX2, PTN, S100A4, SERPINA3, SOXI1, TFPI2, WISP2 and ZIC2 and is negative for the markers: ACTC, AGC1, AKR1C1, ALDH1A1, ANXA8, APCDD1, AQP1, AREG, CFB, C3, C6, C7, C20orfl03, CCDC3, CD24, CLDN11, CNTNAP2, COMP, COPI, CRYAB, CXADR, METTL7A, DKK2, EMIDI, FGFR3, TMEM100, GABRB1, GAP43, GDF10, GJB2, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, HSPB3, HTRA3, ICAM5, ID4, IFI27, ILIRI, KCNMB1, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MASPI, MEOXI, MEOX2, MGP, MMP1, MYBPH, MYH3, MYH11, MYL4, 1L32, NLGN4X, NPPB, OGN, OSR2, PAX2, PAX9, PDE1A, PENK, PITX2, PRELP, PRG4, PTGS2, RARRESI, RGS1, SFRP2, SMOCI, SMOC2, SOD3, SYT12, TAC1, RSPO3, TNFSF7, TRH, TSLP, TUBB4, UGT2B7, ZD52F1O and ZIC1. The cell line X7SMOO19 is positive for the markers: BEXI, CDH6, COL15A1, COL21A1, COMP, CRIPI, DLK1, EGR2, FMO1, FMO3, FOXF1, FOXF2, FST, HSPA6, IGF2, IGFBP5, KIAA0644, KRT19, LAMC2, TMEM119, MSX1, MSX2, OGN, PODN, PRRX2, RGMA, S100A4, SERPINA3, SNAP25, SOXI1, SRCRB4D, TNNT2 and ZIC2 and is negative for the markers: ACTC, AGC1, AKR1C1, ALDH1A1, ANXA8, APCDD1, AREG, ATP8B4, C3, C6, C7, C20orfl03, CCDC3, CD24, CLDN11, COPI, CXADR, D102, METTL7A, DKK2, DPT, EMIDI, TMEM100, GABRB1, GJB2, GSC, HOXA5, HSD11B2, HSD17B2, HTRA3, ICAM5, ID4, IFI27, ILIRI, INA, KCNMB1, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MASPI, MEOXI, MEOX2, MMP1, MYBPH, MYH3, MYH1l, MYL4, 1L32, NLGN4X, NPPB, OLR1, OSR2, PAX2, PAX9, PENK, PITX2, PRG4, PROMI, PTPRN, RARRESI, RELN, RGS1, SFRP2, SLITRK6, SMOCI, SMOC2, SOD3, STMN2, SYT12, TAC1, RSPO3, TNFSF7, TRH, TSLP, TUBB4, UGT2B7, WISP2, ZD52F1O and ZIC1. The cell line X7SMOO25 is positive for the markers: AQP1, ATP8B4, BEXI, CDH3, COL21A1, CRIPI, DLK1, FOXF1, FOXF2, FST, GABRB1, HSPB3, IGF2, IGFBP5, ILIRI, KRT19, LAMC2, TMEM119, MSX1, MSX2, PODN, POSTN, PRRX2, PTN, RGMA, S100A4, SERPINA3, SLITRK6, SOXI1, SRCRB4D, TFPI2, RSPO3 and THYl and is negative for the markers: ACTC, AGC1, AKR1C1, ANXA8, APCDD1, AREG, CFB, BMP4, C3, C6, C7, PRSS35, C20orfl03, CCDC3, CLDN11, COL15A1, COPI, CXADR, METTL7A, DKK2, EGR2, EMIDI, FGFR3, TMEM100, FMO1, FMO3, GDF10, GJB2, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, HTRA3, ICAM5, ID4, IFI27, INA, KCNMB1, KRT14, KRT17, KRT34, IGFL3, LOC92196, MASPI, MEOXI, MEOX2, MGP, MYBPH, MYH3, MYH1l, MYL4, 1L32, NLGN4X, NPPB, OGN, OLR1, OSR2, PAX2, PAX9, PDE1A, PENK, PITX2, PRELP, PRG4, PROMI, PRRX1, PTPRN, RASD1, RELN, RGS1, SFRP2, SMOCI, SMOC2, SOD3, SYT12, TAC1, TNFSF7, TRH, TSLP, TUBB4, UGT2B7, WISP2, ZD52F10, ZICI and ZIC2. The cell line X7SMOO26 is positive for the markers: BEXI, CCDC3, CDH6, COL15A1, COL21A1, COMP, CRIPI, CRLF1, CRYAB, D102, EGR2, FOXF1, FOXF2, FST, GDF10, HSPB3, IGF2, IGFBP5, KRT19, LAMC2, TMEM119, MSX1, MSX2, NPAS1, PODN, POSTN, PRRX2, S100A4, SERPINA3, SOXI, SRCRB4D, TNNT2 and ZIC2 and is negative for the markers: ACTC, AGC1, AKR1C1, ALDH1A1, ANXA8, APCDD1, AREG, ATP8B4, CFB, BMP4, C3, C6, C7, C20orfl03, CD24, CDH3, CLDN11, COP1, METTL7A, DLK1, DPT, EMIDI, FGFR3, TMEM100, FMO1, FMO3, GJB2, GSC, HOXA5, HSD11B2, HSPA6, HTRA3, ICAM5, ID4, IFI27, ILIRI, KCNMB1, KIAA0644, KRT14, KRT34, IGFL3, LOC92196, MFAP5, MASPI, MEOXI, MEOX2, MGP, MMP1, MX1, MYBPH, MYH3, 1L32, NLGN4X, OGN, OLR1, OSR2, PAX2, PAX9, PDE1A, PENK, PITX2, PRELP, PRG4, PROMI, PTGS2, PTN, PTPRN, RARRES1, RASD1, RELN, RGS1, SFRP2, SLITRK6, SMOCI, SMOC2, SNAP25, SOD3, STMN2, SYT12, TAC1, TFPI2, RSPO3, THY1, TNFSF7, TRH, TSLP, TUBB4, UGT2B7, WISP2, ZD52F1O and ZIC1. The group of cell lines X7SMOO9 and X7SMOO29 are positive for the markers: BEXI, COL21A1, CRIPI, CRLF1, D102, DLK1, FOXF1, FOXF2, FST, IGF2, IGFBP5, KIAA0644, TMEM119, MSX1, PODN, POSTN, PRRX2, RGMA, S100A4, SERPINA3, SNAP25, SOXI1 and SRCRB4D and are negative for the markers: ACTC, AGC1, AKR1C1, ALDH1A1, ANXA8, APCDD1, AQP1, AREG, ATP8B4, C3, C6, C7, PRSS35, C20orfl03, CCDC3, CD24, CDH3, CLDN11, COPI, CXADR, METTL7A, DKK2, EMIDI, GDF10, GJB2, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, HTRA3, ICAM5, ID4, IFI27, ILIRI, INA, KCNMB1, KRT14, KRT17, KRT19, KRT34, IGFL3, LOC92196, MFAP5, MASPI, MEOXI, MEOX2, MYH3, MYHl1, MYL4, 1L32, NLGN4X, NPPB, OLR1, OSR2, PAX2, PAX9, PENK, PITX2, PRELP, PROMI, PTPRN, RASD1, RELN, RGS1, SMOCI, SMOC2, SYT12, TACI, TNFSF7, TRH, TSLP, TUBB4, UGT2B7, ZD52F1O and ZIC1. 77 WO 2011/150105 PCT/US2011/037969 The cell line X7SM0032 is positive for the markers: ACTC, BEXI, CDH6, COL21A1, CRIPI, CRLF1, D102, DLK1, EGR2, FGFR3, FOXF1, FOXF2, FST, GABRB1, IGFBP5, KIAA0644, KRT19, LAMC2, TMEM119, MGP, MMP1, MSX1, MSX2, PODN, POSTN, PRG4, PRRX2, PTN, RGMA, S100A4, SERPINA3, SOXI1 and SRCRB4D and is negative for the markers: AGC1, AKR1C1, ALDH1A1, ANXA8, APCDD1, AREG, ATP8B4, BMP4, C3, C6, C7, PRSS35, C20orflO3, CCDC3, CD24, CLDN11, CNTNAP2, COL15A1, COPI, CXADR, METTL7A, DKK2, DPT, EMIDI, TMEM100, FMO1, FMO3, GDF5, GDF1O, GJB2, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, HSPB3, HTRA3, ICAM5, ID4, IFI27, ILIRI, INA, KCNMB1, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MASPI, MEOXI, MEOX2, MYBPH, MYH3, MYH11, MYL4, 1L32, NLGN4X, NPPB, OGN, OLR1, OSR2, PAX2, PAX9, PDE1A, PITX2, PRELP, PROMI, PTPRN, RASD1, RGS1, SFRP2, SMOCI, SMOC2, SOD3, STMN2, SYT12, TAC1, RSPO3, TNFSF7, TNNT2, TRH, TSLP, TUBB4, UGT2B7, WISP2, ZD52F1O, ZICI and ZIC2. The cell line X7SMOO6 is positive for the markers: ACTC, BEXI, CNTNAP2, COL15A1, COL21A1, CRIPI, CRLF1, CRYAB, DLK1, EGR2, FMO1, FMO3, FOXF1, FOXF2, FST, HSPB3, IGF2, IGFBP5, KRT19, LAMC2, TMEM119, MGP, MSX1, MSX2, NPAS1, OGN, PODN, POSTN, PRRX2, RGMA, S100A4, SERPINA3, SNAP25, SOXI1, SRCRB4D, STMN2 and TNNT2 and is negative for the markers: AGC1, AKR1C1, ALDH1A1, ANXA8, APCDD1, AQP1, AREG, ATP8B4, C3, C6, C7, C20orflO3, CCDC3, CD24, CLDN11, COPI, CXADR, D102, METTL7A, DKK2, EMIDI, TMEM100, GAP43, GDF1O, GJB2, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, HTRA3, ICAM5, ID4, IFI27, ILIRI, INA, KCNMB1, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MASPI, MEOXI, MEOX2, MYBPH, MYH3, MYH11, MYL4, 1L32, NLGN4X, TAGLN3, NPPB, OSR2, PAX2, PAX9, PDE1A, PENK, PITX2, PRG4, PRRX1, PTGS2, PTPRN, RASD1, RELN, RGS1, SFRP2, SMOCI, SMOC2, SYT12, TAC1, RSPO3, TNFSF7, TRH, TSLP, TUBB4, UGT2B7, ZD52F1O, ZICI and ZIC2. The cell line X7SMOO7 is positive for the markers: ACTC, BEXI, CDH6, CRIPI, CRLF1, CRYAB, DLK1, EGR2, FOXF1, FOXF2, FST, HSPA6, IGF2, IGFBP5, INA, LAMC2, MMP1, MSX1, MSX2, TAGLN3, POSTN, PRRX2, PTGS2, PTPRN, RASD1, RELN, S100A4, SNAP25, SOXI1, SRCRB4D, TAC1, TFPI2 and RSPO3 and is negative for the markers: AGC1, AKR1C1, ALDH1A1, ANXA8, APCDD1, AQP1, AREG, CFB, BMP4, C3, C6, C7, C20orflO3, CCDC3, CDH3, CLDN11, CNTNAP2, COL15A1, COL21A1, COPI, CXADR, METTL7A, DKK2, DPT, EMID1, FMO3, GAP43, GDF5, GDF10, GSC, HOXA5, HSD11B2, HSD17B2, HSPB3, HTRA3, ID4, IFI27, IFIT3, KCNMB1, KIAA0644, KRT14, KRT17, IGFL3, LOC92196, MFAP5, MASPI, MEOXI, MEOX2, MGP, MYBPH, MYH3, MYH11, MYL4, 1L32, NLGN4X, NPPB, OGN, OLR1, OSR2, PAX2, PAX9, PDE1A, PENK, PITX2, PRELP, PRG4, PROMI, PRRX1, PTN, RGMA, RGS1, SFRP2, SLITRK6, SMOC2, SOD3, STMN2, SYT12, TNNT2, TRH, TSLP, TUBB4, WISP2 and ZIC1. The group of cell lines Z1, Z6 and Z7 are positive for the markers: FST, GDF5, MMP1, MSX1, SRCRB4D, ZICI and ZIC2 and are negative for the markers: ACTC, AGC1, AKR1C1, ALDH1A1, ANXA8, APCDD1, AQP1, AREG, ATP8B4, CFB, BMP4, C3, C6, C7, C20orflO3, CDH3, CLDN11, CNTNAP2, CRLF1, D102, METTL7A, DKK2, DLK1, DPT, EMIDI, FGFR3, TMEM100, FMO1, FMO3, FOXF2, GABRB1, GJB2, GSC, HOXA5, HSD11B2, HSPA6, HSPB3, ID4, IFI27, IGF2, KCNMB1, KIAA0644, KRT14, IGFL3, LOC92196, MFAP5, MASPI, MEOXI, MEOX2, MGP, MYBPH, MYH3, MYH11, NLGN4X, NPPB, OGN, OLR1, PAX2, PAX9, PDE1A, PENK, PITX2, PRG4, PROMI, RARRESI, RASD1, RELN, RGS1, SFRP2, SMOCI, SMOC2, SNAP25, STMN2, SYT12, TAC1, RSPO3, TNFSF7, TNNT2, TRH, TUBB4 and WISP2. The cell line Z 11 (also known as ZI Rep1 and ZI lRep2 and ACTC194) is positive for the markers: ATP8B4, CD24, DLK1, FOXF1, FST, HTRA3, IGF2, IGFBP5, ILIRI, MSX1, NLGN4X, OSR2, PODN, PROMI, PRRX2, PTN, SOD3, SOXI1, SRCRB4D, STMN2 and TFPI2 and are negative for the markers: ACTC, AGC1, AKR1C1, ALDH1A1, ANXA8, APCDD1, AREG, CFB, C6, C7, PRSS35, CCDC3, CDH3, CLDN11, CNTNAP2, COMP, CRIPI, CRLF1, D102, DKK2, DPT, EMIDI, FMO1, FMO3, GAP43, GDF1O, GJB2, GSC, HOXA5, HSD11B2, HSPA6, HSPB3, IFI27, INA, KCNMB1, KIAA0644, KRT14, KRT17, KRT34, LAMC2, IGFL3, LOC92196, MFAP5, MEOXI, MEOX2, MX1, MYBPH, MYH3, MYH11, MYL4, 1L32, NPPB, OLR1, PAX2, PITX2, RARRESI, RASD1, RGS1, SMOCI, SMOC2, SNAP25, TACI, TNFSF7, TNNT2, TRH, TUBB4, UGT2B7, WISP2, ZICI and ZIC2. The cell line Z2 is positive for the markers: BEXI, CCDC3, EGR2, FOXF1, FOXF2, FST, GDF5, HSPB3, IGFBP5, INA, TMEM119, MASPI, MMP1, MSX2, POSTN, PRELP, PRRX2, PTN, SRCRB4D, TFPI2 and TSLP and is negative for the markers: ACTC, AGC1, AKR1C1, ALDH1A1, ANXA8, APCDD1, AQP1, AREG, CFB, BMP4, C3, C6, C7, C20orfl03, CD24, CDH3, CLDN11, CNTNAP2, COL21A1, D102, DKK2, DLK1, DPT, FGFR3, TMEM100, FMO1, FMO3, GABRB1, GAP43, GDF1O, GJB2, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, ID4, IFI27, KCNMB1, KIAA0644, KRT14, KRT17, KRT34, IGFL3, LOC92196, MFAP5, MEOXI, MEOX2, MYBPH, MYH3, MYH11, NLGN4X, NPPB, OGN, OSR2, PAX2, PAX9, PDE1A, PENK, PITX2, PRG4, PROMI, RARRESI, RASD1, RGS1, SMOCI, SMOC2, SNAP25, STMN2, TACI, RSPO3, TNFSF7, TNNT2, TRH, TUBB4, WISP2, ZICI and ZIC2. 78 WO 2011/150105 PCT/US2011/037969 The cell line MEL2 is positive for the markers: AKR1C1, AQP1, COL21A1, CRYAB, CXADR, D102, METTL7A, DKK2, DLK1, HSD17B2, HSPB3, MGP, MMP1, MSX2, PENK, PRRX1, PRRX2, S100A4, SERPINA3, SFRP2, SNAP25, SOXI1, TFPI2 and THYl and is negative for the markers: ACTC, ALDH1A1, AREG, CFB, C3, C20orflO3, CD24, CDH3, CDH6, CNTNAP2, COL15A1, COMP, COPI, CRLF1, FGFR3, FMO1, FMO3, FOXF2, FST, GABRB1, GAP43, GDF5, GDF1O, GJB2, GSC, HOXA5, HSD11B2, HSPA6, ICAM5, KCNMB1, KRT14, KRT17, KRT19, KRT34, MASPI, MEOXI, MEOX2, MYBPH, MYH3, MYH1l, TAGLN3, NPAS1, NPPB, OLR1, PAX2, PDE1A, PITX2, PRG4, PTN, PTPRN, RASDI, RELN, RGSI, SMOCI, STMN2, TAC1, TNFSF7, TRH, TUBB4, WISP2, ZICI and ZIC2. The cell line C4ELSR1O is positive for the markers: AKR1C1, ALDH1A1, ANXA8, AREG, CDH6, COPI, D102, METTL7A, EGR2, FOXF1, HSD17B2, IGFBP5, KIAA0644, KRT19, KRT34, OLR1, PITX2, S100A4, STMN2 and TFPJ2 and is negative for the markers: ACTC, AQP1, C7, C20orflO3, CD24, CDH3, CLDN11, CNTNAP2, COMP, CRIPI, CRLF1, DKK2, DLK1, DPT, FGFR3, FMO1, GABRB1, GAP43, GDF1O, GJB2, GSC, HSD11B2, HSPA6, HSPB3, ICAM5, ID4, KRT14, KRT17, LAMC2, MFAP5, MASPI, MEOXI, MEOX2, MGP, MMP1, MSX1, MYBPH, MYH3, MYH11, TAGLN3, NPAS1, NPPB, OGN, PAX2, PAX9, PENK, PRELP, PRG4, PRRX1, PRRX2, PTN, RELN, RGS1, SERPINA3, SFRP2, SMOC1, SNAP25, SOXI1, TAC1, TNNT2, TUBB4, WISP2, ZICI and ZIC2. The cell line Z3 is positive for the markers: BEXI, CDH6, COL21A1, CXADR, EGR2, FOXF1, FST, HSD17B2, LAMC2, MMP1, MSX1, MSX2, SERPINA3, ZICi and ZIC2 and is negative for the markers: ACTC, ALDH1A1, AQP1, ATP8B4, CFB, C3, C7, C20orflO3, CDH3, CLDN11, CNTNAP2, COMP, CRIPI, CRLF1, D102, METTL7A, DKK2, DLK1, DPT, FGFR3, FMO1, FM03, GABRB1, GJB2, GSC, HOXA5, HSD11B2, HSPA6, HSPB3, ICAM5, ID4, IF127, IGF2, KCNMB1, KIAA0644, KRT14, KRT17, MFAP5, MASPI, MEOXI, MEOX2, MGP, MX1, MYBPH, MYH3, MYH11, NPAS1, OGN, OLR1, PAX2, PAX9, PDE1A, PRG4, PROMI, PRRX2, PTN, PTPRN, RARRESI, RASDI, RGSI, S100A4, SFRP2, SMOCI, SNAP25, STMN2, TAC1, TNFSF7, TUBB4 and WISP2. The cell line SK15 is positive for the markers: AREG, BEXI, FOXF1, KRT19, LAMC2, MSX1, PITX2, S100A4, SERPINA3 and THYl and is negative for the markers: AGC1, ALDH1A1, AQP1, ATP8B4, CFB, C3, C7, C20orflO3, CD24, CDH3, CDH6, CLDN11, CNTNAP2, COL15A1, COMP, CRIPI, CRLF1, DLK1, DPT, FMO1, FM03, GABRB1, GDF1O, GJB2, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, HSPB3, ICAM5, ID4, IGF2, IGFBP5, KCNMB1, KIAA0644, KRT14, KRT17, MFAP5, MASPI, MEOXI, MEOX2, MGP, MSX2, MX1, MYBPH, MYH3, MYH11, OGN, OLR1, PAX2, PAX9, PDE1A, PRG4, PROMI, PRRX2, PTN, RARRESI, RGSI, SFRP2, SMOCI, SNAP25, STMN2, TACI, TNNT2, TRH, TUBB4, WISP2, ZICI and ZIC2. The cell line W8Rep2a is positive for the markers: AQP1, AREG, BEXI, CDH6, COL21A1, COPI, D102, METTL7A, DLK1, FMO1, FM03, FOXF1, FOXF2, MMP1, MSX1, MSX2, PDE1A, PRRX2, SERPINA3, SNAP25, SOXI, TFPJ2 and ZIC2 and is negative for the markers: ALDH1A1, ATP8B4, C3, C7, C20orflO3, CD24, CLDN11, CNTNAP2, COMP, CRIPI, CRLF1, CXADR, DKK2, DPT, EGR2, GAP43, GDF1O, GJB2, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, HSPB3, ICAM5, ID4, IF127, KCNMB1, KRT14, KRT17, KRT34, MFAP5, MASPI, MEOXi, MEOX2, MGP, MX1, MYBPH, MYH3, MYH11, NPAS1, NPPB, OLR1, PAX2, PAX9, PITX2, PRG4, PROMI, PRRX1, PTGS2, PTN, PTPRN, RGSI, SFRP2, STMN2, TACI, THY1, TNNT2, TRH, TUBB4 and ZICI. The cell line E55 is positive for the markers: AKR1C1, BEXI, CDH6, COL21A1, D102, DKK2, EGR2, GAP43, KRT19, MSX2, PRRX1, S100A4, SOXI1, THY1, TNNT2 and ZIC2 and is negative for the markers: ALDH1A1, AQP1, AREG, ATP8B4, C3, C7, C20orflO3, CLDN11, CNTNAP2, COMP, CRLF1, CXADR, DLK1, DPT, FMO1, FM03, FOXF2, GABRB1, GDF1O, GJB2, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, HSPB3, IF127, IGF2, KRT14, KRT34, LAMC2, MFAP5, MASPI, MEOXI, MEOX2, MGP, MYBPH, MYH3, NPAS1, NPPB, OGN, OLR1, PAX2, PAX9, PDE1A, PENK, PITX2, PRG4, PROMI, PRRX2, PTN, PTPRN, RARRESI, RGSI, SFRP2, SMOCI, SNAP25, STMN2, TACI, TRH, TUBB4, WISP2 and ZICI. The cell line T20 is positive for the markers: ACTC, AKR1C1, BEXI, CDH6, COL21A1, CRYAB, DKK2, EGR2, GAP43, LAMC2, MMP1, MSX2, PITX2, SOXI1, THYl and ZIC2 and is negative for the markers: ALDH1A1, AREG, ATP8B4, CFB, C3, C7, C20orflO3, CD24, CDH3, CLDN11, CNTNAP2, COMP, CRLF1, METTL7A, DPT, FMO1, FMO3, FOXF2, GDF1O, GJB2, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, HSPB3, ICAM5, IF127, IGF2, KIAA0644, KRT14, MASPI, MEOX2, MGP, MX1, MYBPH, MYH3, TAGLN3, NPAS1, NPPB, OGN, OLR1, PAX2, PDE1A, PRG4, PROMI, PRRX2, PTN, PTPRN, RARRESI, RASDI, RGSI, SFRP2, SMOCI, SNAP25, STMN2, TACI, TFPI2, TNFSF7, TRH, TUBB4, WISP2 and, ZIC1. 79 WO 2011/150105 PCT/US2011/037969 The cell line X4D20.8 is positive for the markers: BEXI, CDH6, CNTNAP2, COL21A1, CRIPI, CRYAB, D102, DKK2, GAP43, ID4, LAMC2, MMP1, MSX2, S100A4, SOXI1 and THYl and is negative for the markers: AGC1, ALDH1A1, AREG, ATP8B4, CFB, C3, C7, C20orf1O3, CDH3, CLDN11, COPI, CRLF1, DLK1, DPT, FMO1, FMO3, GDF1O, GJB2, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, HSPB3, ICAM5, IF127, IGF2, KRT14, KRT17, KRT34, MASPI, MEOX2, MSX1, MX1, MYBPH, MYH3, MYH1l, TAGLN3, NPAS1, NPPB, OGN, OLR1, PAX2, PDE1A, PRG4, PROMI, PTN, PTPRN, RARRES1, RGS1, SNAP25, STMN2, TAC1, TNNT2, TRH, TUBB4, WISP2, ZICI and ZIC2. The cell line X4D20.3 is positive for the markers: ACTC, AKR1C1, AQP1, BEXI, CDH6, COL21A1, CRYAB, DKK2, DLK1, GJB2, HSD17B2, KRT17, LAMC2, MYL4, PITX2, S100A4, SOXI1, THY1, TNNT2, ZICI and ZIC2 and is negative for the markers: AGC1, ALDH1A1, AREG, ATP8B4, CFB, C3, C7, C20orf1O3, CDH3, CLDN11, CNTNAP2, COMP, COPI, CRLF1, METTL7A, DPT, FGFR3, FMO1, FMO3, FOXF1, GABRB1, GSC, HOXA5, HSD11B2, HSPA6, HSPB3, ICAM5, ID4, IF127, IGF2, IGFBP5, KIAA0644, KRT14, KRT34, MASPI, MEOX2, MGP, MSX2, MX1, MYBPH, MYH3, MYH11, NPAS1, OGN, OLR1, PAX9, PDE1A, PENK, PRG4, PROMI, PRRX2, PTN, RARRES1, RGS1, SFRP2, SNAP25, STMN2, TAC1, TRH, TUBB4 and WISP2. The cell line E132 is positive for the markers: ACTC, AKR1C1, AQP1, CD24, CDH6, COL21A1, CRYAB, DKK2, KRT19, TAGLN3, RELN, S100A4, SFRP2, SOXI1, THYl and ZIC2 and is negative for the markers: AGC1, ALDH1A1, AREG, ATP8B4, CFB, C3, C7, C20orf1O3, CLDN11, CNTNAP2, COL15A1, COMP, COPI, CRLF1, D102, METTL7A, DLK1, DPT, FMO1, FMO3, FOXF1, FOXF2, FST, GABRB1, GDF1O, GJB2, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, HSPB3, ID4, IF127, IGF2, KCNMB1, KRT14, MFAP5, MASPI, MEOX2, MGP, MYBPH, MYH3, MYHI, NPAS1, NPPB, OGN, OLR1, PDE1A, PRG4, PROMI, PRRX2, PTGS2, PTN, PTPRN, RARRES1, RASD1, RGS1, SERPINA3, SMOCI, SNAP25, STMN2, TAC1, TRH, TUBB4, WISP2 and ZICI. The cell line M13 is positive for the markers: ACTC, ANXA8, BEXI, CDH6, COL15A1, EGR2, GDF1O, GJB2, KRT19, LAMC2, MYL4, TAGLN3, S100A4, SFRP2, SOXI1, THY1, ZICI and ZIC2 and is negative for the markers: ALDH1A1, AREG, ATP8B4, CFB, C3, C7, C20orf1O3, CDH3, CLDN11, CNTNAP2, COMP, COPI, CRLF1, D102, DLK1, DPT, FGFR3, FMO1, FMO3, FOXF1, GABRB1, GAP43, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, HSPB3, ICAM5, ID4, IF127, IGF2, KIAA0644, KRT14, MFAP5, MEOX2, MGP, MMP1, MSX2, MYBPH, MYH3, NPAS1, OGN, OLR1, PDE1A, PRELP, PRG4, PROMI, PRRX2, PTN, PTPRN, RARRES1, RASD1, RELN, RGS1, SMOCI, SNAP25, STMN2, TAC1, TRH, TUBB4 and WISP2. The cell line M1O is positive for the markers: ACTC, BEXI, CDH6, COL21A1, D102, DKK2, EGR2, IGFBP5, PRRX1, S100A4, SFRP2, THYl and ZIC2 and is negative for the markers: AKR1C1, ALDH1A1, AQP1, AREG, ATP8B4, CFB, C3, C7, C20orf1O3, CD24, CDH3, CLDN11, CNTNAP2, COMP, COPI, CRLF1, CXADR, METTL7A, DPT, FMO1, FMO3, FOXF1, GABRB1, GJB2, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, HSPB3, ICAM5, IF127, IGF2, KIAA0644, KRT14, MEOXI, MEOX2, MGP, MYBPH, MYH3, MYH11, TAGLN3, NPAS1, OGN, OLR1, PAX2, PAX9, PDE1A, PITX2, PRG4, PROMI, PRRX2, PTN, PTPRN, RELN, RGS1, SERPINA3, SMOCI, SNAP25, STMN2, TACI, TNFSF7, TNNT2, TRH, TUBB4, WISP2 and ZICI. The cell line E109 is positive for the markers: ACTC, AKR1C1, BEXI, CDH6, COL15A1, COL21A1, CRIPI, CRYAB, D102, DKK2, GAP43, GDF5, ID4, KRT14, KRT19, KRT34, MFAP5, MEOX2, MGP, MMP1, MYHI, S100A4, TFPI2, THYl and ZICI and is negative for the markers: ALDH1A1, AQP1, AREG, ATP8B4, C3, C7, C20orf1O3, CD24, CDH3, CLDN11, CNTNAP2, COMP, CRLF1, CXADR, METTL7A, DLK1, DPT, FMO1, FMO3, FOXF1, FOXF2, GDF1O, GJB2, GSC, HSD11B2, HSD17B2, HSPA6, ICAM5, IGF2, KIAA0644, MASPI, MEOXI, MYBPH, MYH3, TAGLN3, NPAS1, NPPB, OGN, PAX2, PAX9, PDE1A, PITX2, PRG4, PROMI, PRRX2, PTN, RARRESI, RASD1, RGS1, SFRP2, SMOCI, SNAP25, STMN2, TACI, TRH, TUBB4 and WISP2. The cell line E34 is positive for the markers: ACTC, AGC1, AQP1, CDH6, COL15A1, COL21A1, CRYAB, DKK2, GAP43, KRT14, KRT17, KRT19, KRT34, MFAP5, MEOXI, MEOX2, MGP, MYH1l, TAGLN3, S100A4, THY1, TNNT2, ZICI and ZIC2 and is negative for the markers: ALDH1A1, AREG, ATP8B4, C3, C7, C20orfl03, CDH3, CLDN11, CNTNAP2, COMP, COP1, CRLF1, CXADR, D102, METTL7A, DPT, FMO1, FMO3, FOXF1, FOXF2, FST, GABRB1, GDF1O, GJB2, GSC, HOXA5, HSD11B2, HSPA6, IF127, IGF2, KIAA0644, LAMC2, MASPI, MSX2, MX1, MYBPH, MYH3, NPAS1, OLR1, PAX9, PDE1A, PRG4, PROMI, PRRX2, PTN, RARRES1, RASD1, RGS1, SERPINA3, SFRP2, SMOCI, SNAP25, STMN2, TACI, TFPI2, TRH, TUBB4 and WISP2. 80 WO 2011/150105 PCT/US2011/037969 The cell line E122 is positive for the markers: ACTC, AGCI, AKR1C1, BEXI, CDH6, COL21A1, CRIPI, CRYAB, D102, DKK2, GAP43, ID4, KRT19, MFAP5, MYH11, MYL4, OGN, PRRX1, PTGS2, S100A4, SOXI1 and THYl and is negative for the markers: ALDH1A1, AREG, ATP8B4, CFB, C3, C7, C20orflO3, CD24, CDH3, CLDN11, CNTNAP2, COL15A1, COPI, CRLF1, METTL7A, DLK1, DPT, FMO1, FMO3, FOXF2, GABRB1, GDF1O, GJB2, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, HSPB3, ICAM5, IF127, IGF2, KIAA0644, KRT14, KRT17, KRT34, LAMC2, MASPI, MEOXI, MEOX2, MYBPH, NPAS1, NPPB, OLR1, PAX2, PAX9, PDE1A, PRG4, PROMI, RARRES1, RASD1, RGSI, SERPINA3, SFRP2, SMOCI, SNAP25, STMN2, TAC1, TUBB4, WISP2 and ZIC2. The cell line E65 is positive for the markers: ACTC, AKR1C1, AQP1, BEXI, CD24, CDH6, COL21A1, CRYAB, DKK2, GAP43, KRT17, KRT19, KRT34, TAGLN3, RELN, S100A4, SFRP2, SOXI1, THYl and ZIC2 and is negative for the markers: AGCi, ALDH1A1, ATP8B4, CFB, C3, C7, C20orflO3, CDH3, CLDN11, CNTNAP2, COMP, COPI, CRIPI, CRLF1, CXADR, METTL7A, DLK1, DPT, FMO1, FM03, FOXF2, FST, GABRB1, GDF1O, GJB2, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, HSPB3, ICAM5, IF127, IGF2, KIAA0644, KRT14, MFAP5, MASPI, MEOX2, MGP, MYBPH, MYH3, NPAS1, OGN, OLR1, PAX9, PDE1A, PITX2, PRG4, PROMI, PRRX2, PTGS2, PTN, RARRES1, RASD1, RGSI, SMOCI, SNAP25, STMN2, TACI, TRH, TUBB4, WISP2 and ZICI. The cell line E76 is positive for the markers: ACTC, BEXI, COL21A1, CRIPI, CRYAB, D102, DKK2, EGR2, GAP43, KRT17, KRT19, MMP1, MSX2, PTGS2, S100A4 and THY1 and is negative for the markers: ALDH1A1, AREG, ATP8B4, CFB, C3, C7, C20orflO3, CDH3, CLDN11, CNTNAP2, COPI, CRLF1, METTL7A, DPT, FMO1, FM03, FOXF1, GABRB1, GDF1O, GJB2, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, ICAM5, IF127, IGF2, KRT14, MEOX2, MGP, MYBPH, MYH3, NPAS1, NPPB, OGN, OLR1, PAX2, PAX9, PDE1A, PENK, PITX2, PRG4, PROMI, PRRX2, PTN, PTPRN, RARRESI, RGSI, SFRP2, SMOCI, SNAP25, STMN2, TACI, TFPI2, TNNT2, TRH, TUBB4, WISP2 and ZICI. The cell line E108 is positive for the markers: ACTC, BEXI, CDH6, COL21A1, CRIPI, CRYAB, D102, DKK2, IGFBP5, KRT17, KRT19, MYH11, S100A4, SOXI1, THYl and ZIC2 and is negative for the markers: ALDH1A1, AQP1, AREG, ATP8B4, CFB, C3, C7, C20orflO3, CD24, CDH3, CLDN11, CNTNAP2, COMP, COPI, CRLF1, CXADR, METTL7A, DLK1, DPT, FMO1, FM03, FOXF1, FOXF2, GABRB1, GDF1O, GJB2, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, ICAM5, IF127, IGF2, KRT14, KRT34, MASPI, MEOXI, MEOX2, MGP, MYBPH, MYH3, NPAS1, NPPB, OGN, OLR1, PAX2, PAX9, PDE1A, PRG4, PROMI, PTN, PTPRN, RARRES1, RASDI, RGSI, SERPINA3, SFRP2, SMOCI, SNAP25, STMN2, TACI, TFPI2, TNNT2, TRH, TUBB4 and WISP2. The cell line E85 is positive for the markers: ACTC, BEXI, CDH6, COL21A1, CRYAB, D102, DKK2, EGR2, FGFR3, ID4, KRT17, KRT19, MFAP5, MGP, MMP1, MYH1l, PRELP, S100A4, SOXI1, THY1, TNNT2, ZICI and ZIC2 and is negative for the markers: ALDH1A1, AQP1, AREG, ATP8B4, CFB, C3, C7, C20orflO3, CD24, CDH3, CNTNAP2, COMP, COPI, CRLF1, METTL7A, DPT, FMO1, FM03, GABRB1, GDF5, GDF1O, GJB2, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, ICAM5, IF127, IGF2, KRT14, MASPI, MEOXI, MEOX2, MYBPH, MYH3, NPAS1, OGN, OLR1, PAX9, PDE1A, PITX2, PRG4, PROMI, PRRX2, PTN, RARRESI, RASD1, RGSI, SFRP2, SMOCI, STMN2, TACI, TFPI2, TRH, TUBB4 and WISP2. The cell line M11 is positive for the markers: BEXI, CDH6, COL21A1, CRYAB, DKK2, GAP43, ID4, MMP1, MYH11, SOXI1, THYl and ZICI and is negative for the markers: AGC1, ALDH1A1, AREG, ATP8B4, C3, C7, C20orflO3, CD24, CDH3, CLDN11, CNTNAP2, COMP, COPI, CRLF1, CXADR, METTL7A, DLK1, DPT, FMO1, FM03, FOXF2, FST, GABRB1, GDF1O, GJB2, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, ICAM5, IGF2, IGFBP5, KCNMB1, KIAA0644, KRT14, MASPI, MEOXI, MEOX2, MSX2, MX1, MYBPH, MYH3, TAGLN3, NPAS1, OLR1, PAX2, PAX9, PDE1A, PENK, PITX2, PRG4, PROMI, PRRX2, PTN, PTPRN, RARRESI, RELN, RGSI, SFRP2, SMOCI, SNAP25, STMN2, TACI, TFPI2, TNFSF7, TNNT2, TRH, TUBB4, WISP2 and ZIC2. The cell line E8 is positive for the markers: ACTC, BEXI, CDH6, COL21A1, CRIPI, CRYAB, D102, DKK2, ID4, KCNMB1, KRT14, KRT17, KRT19, KRT34, MFAP5, MGP, MYHI, PTGS2, S100A4, SOXI and THYl and is negative for the markers: ALDH1A1, AREG, ATP8B4, C3, C7, C20orflO3, CDH3, CNTNAP2, COMP, COPI, CXADR, METTL7A, DPT, FMO1, FM03, FOXF1, FOXF2, GABRB1, GDF1O, GJB2, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, HSPB3, ICAM5, IF127, IGF2, IGFBP5, KIAA0644, LAMC2, MASPI, MEOXI, MSX2, MX1, MYBPH, TAGLN3, NPAS1, NPPB, OLR1, PAX2, PAX9, PDE1A, PRELP, PRG4, PROMI, PRRX2, PTN, PTPRN, RARRES1, RASDI, RGSI, SFRP2, SMOCI, SNAP25, STMN2, TACI, TFPI2, TNFSF7, TRH, WISP2, ZICI and ZIC2. 81 WO 2011/150105 PCT/US2011/037969 The cell line E80 is positive for the markers: ACTC, BEXI, CDH6, COL21A1, CRYAB, DKK2, ID4, KRT19, MMP1, MYH11, TAGLN3, SOXI1 and THYl and is negative for the markers: ALDH1A1, AQP1, AREG, ATP8B4, CFB, C3, C7, C20orf1O3, CDH3, CLDN11, CNTNAP2, COMP, CRIPI, CRLF1, METTL7A, DLK1, DPT, FMO1, FMO3, FOXF1, FOXF2, GABRB1, GDF1O, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, ICAM5, IF127, IGF2, KIAA0644, KRT14, KRT34, MASPI, MEOX2, MGP, MYBPH, MYH3, NPAS1, OGN, OLR1, PAX9, PDE1A, PRELP, PRG4, PROMI, PRRX2, PTN, RARRESI, RASD1, RGS1, SERPINA3, SMOCI, SNAP25, STMN2, TAC1, TNNT2, TRH, WISP2, ZICI and ZIC2. The cell line RA.D20.24 is positive for the markers: ACTC, BEXI, CRYAB, CXADR, DKK2, FOXF1, GAP43, HOXA5, IGFBP5, KRT19, LAMC2, MFAP5, MMP1, MSX1, MYL4, PITX2, PTGS2, RELN, THYl and TNNT2 and is negative for the markers: AGC1, ALDH1A1, AQP1, AREG, ATP8B4, CFB, C7, C20orf1O3, CDH3, CNTNAP2, COL15A1, COMP, COPI, CRLF1, DLK1, DPT, FGFR3, FMO1, FMO3, FOXF2, GDF10, GJB2, GSC, HSD11B2, HSD17B2, HSPA6, HSPB3, ICAM5, ID4, IF127, IGF2, KCNMB1, KRT14, MASP1, MEOX1, MEOX2, MGP, MSX2, MX1, MYBPH, MYH3, MYH11, NPAS1, OGN, PAX2, PAX9, PDE1A, PRG4, PROMI, PRRX2, PTN, PTPRN, RARRESI, RGS1, SFRP2, SMOCI, SNAP25, STMN2, TAC1, TUBB4, WISP2, ZICI and ZIC2. The cell line RA.D20.6 is positive for the markers: ACTC, CRYAB, CXADR, DKK2, FOXF1, GAP43, HOXA5, IGFBP5, KRT19, LAMC2, MFAP5, MMP1, MSX1, PITX2, PTGS2, SOXI1 and THYl and is negative for the markers: ALDH1A1, ATP8B4, CFB, C3, C7, C20orf1O3, CDH3, CNTNAP2, COL15A1, COMP, COPI, CRLF1, D102, DLK1, DPT, FMO1, FMO3, FOXF2, GDF1O, GSC, HSD11B2, HSD17B2, HSPA6, HSPB3, ICAM5, ID4, IGF2, KRT14, MASPI, MEOXI, MEOX2, MGP, MSX2, MX1, MYBPH, MYH3, MYH1l, NPAS1, OGN, PAX2, PAX9, PDE1A, PRG4, PROMI, PRRX2, PTN, PTPRN, RARRES1, RGS1, SERPINA3, SFRP2, SMOCI, STMN2, TAC1, TRH, TUBB4, WISP2, ZICI and ZIC2. The cell line RA.SMOlO is positive for the markers: ALDH1A1, BEXI, C3, CDH3, COL21A1, CXADR, METTL7A, EGR2, FMO3, FOXF1, HOXA5, KIAA0644, MGP, RARRES1, SOXI1 and STMN2 and is negative for the markers: ACTC, AGC1, ANXA8, AQP1, CFB, C7, C20orf1O3, CD24, CDH6, CNTNAP2, COL15A1, COMP, COPI, CRIPI, CRLF1, DPT, FOXF2, GAP43, GDF1O, GSC, HSD11B2, HSD17B2, HSPA6, HSPB3, ICAM5, ID4, IF127, KRT14, KRT17, KRT34, MASPI, MEOXI, MEOX2, MMP1, MSX2, MYBPH, MYH3, MYH11, TAGLN3, NPAS1, NPPB, OGN, PAX2, PAX9, PDE1A, PITX2, PRELP, PRG4, PROMI, PRRX2, PTN, PTPRN, RGS1, S100A4, SERPINA3, SFRP2, SMOCI, TACI, TFPI2, THY1, TNFSF7, TRH, TUBB4, WISP2, ZICI and ZIC2. The cell line RA.SMO14 is positive for the markers: ACTC, BEXI, CD24, CXADR, FOXF1, GDF5, GJB2, HOXA5, IGFBP5, KRT19, LAMC2, MFAP5, MMP1, RELN, SOXI1 and STMN2 and is negative for the markers: AGC1, ALDH1A1, AQP1, ATP8B4, CFB, C3, C7, CDH6, CLDN11, CNTNAP2, COL15A1, COL21A1, COMP, COPI, CRIPI, CRLF1, D102, DLK1, DPT, FGFR3, FMO1, FMO3, FOXF2, GABRB1, GDF1O, GSC, HSD11B2, HSD17B2, HSPA6, HSPB3, ICAM5, ID4, IF127, IGF2, KCNMB1, KRT14, KRT17, KRT34, MASPI, MEOXI, MEOX2, MGP, MSX2, MYBPH, MYH3, MYH11, NPAS1, NPPB, OGN, PAX2, PAX9, PDE1A, PITX2, PRELP, PRG4, PROMI, PRRX1, PRRX2, PTN, PTPRN, RGS1, SERPINA3, SFRP2, SMOCI, TACI, TNFSF7, TUBB4, WISP2, ZICI and ZIC2. The cell line RA.PEND18 is positive for the markers: C3, CDH3, COL21A1, METTL7A, DLK1, EGR2, FOXF1, GABRB1, HOXA5, IGF2, KIAA0644, KRT19, MSX1, PITX2, PROMI, PTGS2, SNAP25 and SOXI1 and is negative for the markers: ACTC, AGC1, ALDH1A1, AQP1, BEXI, CFB, C20orf1O3, CDH6, CNTNAP2, COL15A1, COMP, CRIPI, CRLF1, CXADR, DPT, FMO1, FOXF2, GAP43, GDF1O, GSC, HSD11B2, HSD17B2, HSPA6, HSPB3, ICAM5, ID4, IF127, KCNMB1, KRT14, KRT34, MFAP5, MASPI, MEOXI, MEOX2, MGP, MMP1, MSX2, MYBPH, MYH3, MYH11, TAGLN3, NPAS1, NPPB, PAX2, PAX9, PENK, PRELP, PRG4, PRRX2, PTN, PTPRN, RARRESI, RELN, RGS1, SFRP2, SMOCI, STMN2, TACI, TNFSF7, TRH, TUBB4, WISP2, ZICI and ZIC2. The cell line RAPEND1O is positive for the markers: AREG, C3, CDH3, CDH6, COL21A1, METTL7A, DLK1, EGR2, FOXF1, FST, GDF5, HOXA5, IGF2, IGFBP5, KRT19, PDE1A, PITX2, RELN and SOXI1 and is negative for the markers: ACTC, AGC1, ALDH1A1, ATP8B4, CFB, C7, C20orf1O3, CLDN11, CNTNAP2, COL15A1, COMP, CRIPI, CRLF1, CRYAB, DPT, FOXF2, GAP43, GDF1O, GSC, HSD11B2, HSD17B2, HSPA6, HSPB3, ICAM5, ID4, IF127, KCNMB1, KRT14, KRT17, KRT34, MASPI, MEOXI, MEOX2, MMP1, MSX2, MYBPH, MYH3, MYH11, TAGLN3, NPAS1, NPPB, OGN, PAX2, PAX9, PRELP, PRG4, PROMI, PRRX1, PRRX2, PTN, PTPRN, RGS1, S100A4, SERPINA3, SFRP2, SMOCI, STMN2, TACI, THY1, TNFSF7, TRH, TUBB4, WISP2, ZICI and ZIC2. 82 WO 2011/150105 PCT/US2011/037969 The cell line RA.SKEL21 is positive for the markers: AREG, BEXI, C3, CD24, COL21A1, COPI, METTL7A, FOXF1, KRT19, MSX1, PITX2, SERPINA3, SOXI1 and THYl and is negative for the markers: ACTC, AGC1, ALDH1A1, AQP1, ATP8B4, CFB, C7, C20orflO3, CDH6, CLDN11, CNTNAP2, COL15A1, COMP, CRIPI, CRLF1, DKK2, DPT, FGFR3, FMO1, FM03, FOXF2, GAP43, GDF1O, GSC, HSD11B2, HSD17B2, HSPA6, HSPB3, ICAM5, ID4, IF127, KCNMB1, KRT14, KRT17, KRT34, MASPI, MEOXI, MEOX2, MGP, MMP1, MSX2, MX1, MYBPH, MYH3, TAGLN3, NPAS1, NPPB, OGN, OLR1, PAX2, PAX9, PDE1A, PENK, PRELP, PRG4, PRRX2, PTGS2, PTN, PTPRN, RARRESI, RASDI, RELN, RGSI, SFRP2, SMOCI, STMN2, TAC1, TNFSF7, TRH, TUBB4 and ZIC2. The cell line RA.SKEL18Rep2a is positive for the markers: AREG, C3, CD24, CDH3, COL21A1, METTL7A, DPT, GJB2, SERPINA3, SNAP25 and SOXI1 and is negative for the markers: ALDH1A1, ATP8B4, CFB, C7, C20orflO3, CDH6, CLDN11, CNTNAP2, COMP, COPI, CRIPI, D102, DKK2, DLK1, FGFR3, FMO1, FMO3, GDF1O, GSC, HSD11B2, HSD17B2, HSPA6, HSPB3, ICAM5, ID4, IF127, IGF2, KCNMB1, KRT14, KRT17, KRT19, KRT34, MASPI, MEOXI, MEOX2, MGP, MMP1, MSX2, MYBPH, MYH3, MYH1l, TAGLN3, NPAS1, NPPB, OGN, OLR1, PAX2, PAX9, PRELP, PRG4, PROMI, PRRX1, PRRX2, PTGS2, PTN, PTPRN, RARRES1, RELN, RGSI, SFRP2, SMOCI, STMN2, TAC1, THY1, TNFSF7, TNNT2, TRH, WISP2, ZICI and ZIC2. The cell line C4.4 is positive for the markers: AKR1C1, BEXI, CDH6, COPI, D102, METTL7A, DKK2, DPT, EGR2, FOXF1, FST, KIAA0644, MMP1, MSX1, RELN, S100A4, TACi and THY1 and is negative for the markers: AGC1, ALDH1A1, ANXA8, AQP1, AREG, ATP8B4, CFB, C3, C7, C20orflO3, CD24, CDH3, CLDN11, CNTNAP2, COL21A1, COMP, CRIPI, CRLF1, CXADR, FGFR3, FMO1, GAP43, GDF1O, GJB2, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, HSPB3, ICAM5, ID4, IF127, IGF2, KCNMB1, KRT14, KRT17, KRT19, KRT34, LAMC2, MFAP5, MASPI, MEOXI, MEOX2, MGP, MYBPH, MYH3, MYH1l, TAGLN3, NPAS1, NPPB, OGN, PAX2, PAX9, PDE1A, PENK, PITX2, PRG4, PROMI, PTGS2, PTN, PTPRN, RARRESI, RASDI, RGSI, SERPINA3, SFRP2, SMOCI, SNAP25, STMN2, TNFSF7, TNNT2, TRH, TUBB4, ZICI and ZIC2. The cell line W7 is positive for the markers: AREG, C3, COL15A1, COL21A1, COPI, CXADR, D102, DLK1, EGR2, FMO1, FOXF1, GDF5, HOXA5, KIAA0644, METTL7A, PITX2, PROMI, S100A4, SERPINA3 and SOXI and is negative for the markers: AGC1, ALDH1A1, AQP1, ATP8B4, C20orflO3, C7, CD24, CDH3, CDH6, CFB, CLDN11, CNTNAP2, COMP, CRIPI, DKK2, DPT, FM03, GABRB1, GAP43, GDF1O, GSC, HSD11B2, HSD17B2, HSPA6, ICAM5, ID4, IF127, KCNMB1, KRT14, KRT17, KRT19, KRT34, MASPI, MEOXI, MEOX2, MGP, MMP1, MYBPH, MYH11, MYH3, NPAS1, NPPB, OGN, PAX2, PAX9, PRG4, PRRX2, PTN, PTPRN, RARRES1, RASDI, RELN, RGSI, SFRP2, SMOCI, STMN2, TACI, TNFSF7, TRH, TUBB4, ZICI and ZIC2. The cell line X4SKEL20 is positive for the markers: AREG, BEXI, C3, C7, COP1, CXADR, FOXF1, FST, KRT19, METTL7A, MGP, MSX1, PITX2, SERPINA3 and TFPI2 and is negative for the markers: ALDH1A1, AQP1, ATP8B4, C20orflO3, CD24, CDH3, CDH6, CFB, CLDN11, CNTNAP2, COL15A1, COMP, DKK2, DLK1, DPT, EGR2, FGFR3, FMO1, FOXF2, GABRB1, GAP43, GDF1O, GDF5, GJB2, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, HSPB3, ICAM5, ID4, IF127, IGF2, IGFBP5, KCNMB1, KRT14, KRT34, MASPI, MEOXI, MEOX2, MFAP5, MMP1, MSX2, MX1, MYBPH, MYHI, MYH3, NPAS1, NPPB, OGN, OLR1, PAX2, PENK, PRG4, PROMI, PRRX1, PRRX2, PTN, PTPRN, RARRES1, RELN, RGSI, SFRP2, SMOCI, SOXI1, STMN2, TACI, TAGLN3, THY1, TNFSF7, TNNT2, TRH, WISP2, ZICI and ZIC2. The cell line C4ELSR6 is positive for the markers: ACTC, BEXI, C7, CDH6, COL21A1, D102, METTL7A, DKK2, FOXF1, FOXF2, LAMC2, PITX2, PRRX1, S100A4, SFRP2, SNAP25, SOXI1, TACI and TFPI2 and is negative for the markers: AGC1, ALDH1A1, AREG, ATP8B4, CFB, C3, C20orflO3, CD24, CLDN11, CNTNAP2, COMP, CRIPI, CRLF1, CRYAB, DLK1, DPT, FGFR3, FM03, GAP43, GDF5, GDF1O, GJB2, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, HSPB3, ICAM5, ID4, IF127, IGF2, KCNMB1, KRT14, KRT17, KRT34, MFAP5, MASPI, MEOXI, MEOX2, MGP, MMP1, MYBPH, MYH3, MYH11, NPAS1, NPPB, PAX2, PAX9, PENK, PRG4, PTN, PTPRN, RARRES1, RASDI, RGSI, SMOCI, STMN2, TNFSF7, TRH, TUBB4, WISP2 and ZICI. The cell line J2 is positive for the markers: ACTC, AKR1C1, BEXI, CDH6, COL15A1, COL21A1, D102, METTL7A, DKK2, DLK1, FOXF1, KIAA0644, MGP, PDE1A, PRRX1, SFRP2, SNAP25, TNNT2 and ZIC2 and is negative for the markers: AGC1, ALDH1A1, ATP8B4, CFB, C3, C20orflO3, CD24, CNTNAP2, COMP, CRIPI, CRLF1, DPT, FGFR3, GABRB1, GDF1O, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, ICAM5, ID4, IFI27, KCNMB1, KRT14, KRT17, KRT19, KRT34, LAMC2, MFAP5, MASPI, MEOXI, MMP1, MSX1, MYBPH, MYH3, MYH11, NPAS1, NPPB, OGN, OLR1, PAX2, PAX9, PENK, PROMI, PRRX2, PTN, PTPRN, RARRESI, RGSI, SMOCI, STMN2, TACI, TNFSF7, TRH and TUBB4. 83 WO 2011/150105 PCT/US2011/037969 The cell line F15 is positive for the markers: BEXI, CDH6, COL15A1, COL21A1, DKK2, DLK1, FOXF1, FST, GDF5, KRT19, MGP, MMP1, PRRX1, SERPINA3, SNAP25, SOXI1, ZICI and ZIC2 and is negative for the markers: ACTC, AGC1, ALDH1A1, AQP1, AREG, ATP8B4, CFB, C3, C7, C20orflO3, CD24, CDH3, CNTNAP2, COMP, CRLF1, D102, DPT, FGFR3, FMO1, FMO3, FOXF2, GABRB1, GDF1O, GJB2, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, HSPB3, ICAM5, ID4, IF127, IGF2, KCNMB1, KIAA0644, KRT14, KRT17, MASPI, MEOXI, MEOX2, MYBPH, MYH3, MYH11, NPAS1, NPPB, OGN, OLR1, PAX2, PDE1A, PENK, PITX2, PRG4, PROMI, PRRX2, PTN, PTPRN, RGSI, SFRP2, SMOCI, STMN2, TFPJ2, TNNT2, TRH and TUBB4. The cell line X4SKEL4 is positive for the markers: ANXA8, AREG, BEXI, C3, COL21A1, COPI, CXADR, METTL7A, EGR2, FOXF1, FST, KRT19, LAMC2, MYL4, PITX2 and SERPINA3 and is negative for the markers: ALDH1A1, AQP1, ATP8B4, CFB, C7, C20orflO3, CD24, CDH3, CDH6, CLDN11, CNTNAP2, COL15A1, COMP, CRLF1, DKK2, DLK1, DPT, FGFR3, FMO3, FOXF2, GABRB1, GAP43, GDF5, GDF1O, GJB2, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, HSPB3, ICAM5, ID4, IF127, IGF2, IGFBP5, KIAA0644, KRT14, KRT17, KRT34, MASPI, MEOXI, MEOX2, MGP, MMP1, MSX2, MX1, MYBPH, MYH3, NPAS1, NPPB, OGN, OLR1, PAX2, PAX9, PDE1A, PENK, PRELP, PRG4, PROMI, PRRX2, PTN, PTPRN, RARRES1, RASDI, RGSI, SFRP2, SMOCI, SOXI1, STMN2, TAC1, TNNT2, TRH, TUBB4, WISP2 and ZICI. The cell line X4SKEL19 is positive for the markers: AREG, COL21A1, COPi, D102, METTL7A, EGR2, FOXF1, FST, KIAA0644, KRT19, MGP, PDE1A, PITX2, SERPINA3 and TFPJ2 and is negative for the markers: ACTC, AGC1, ALDH1A1, AQP1, ATP8B4, CFB, C20orflO3, CD24, CDH3, CDH6, CLDN11, CNTNAP2, COL15A1, COMP, CRIPI, CRLF1, CXADR, DKK2, DLK1, DPT, FGFR3, FMO1, FOXF2, GABRB1, GAP43, GDF5, GDF10, GJB2, GSC, HOXA5, HSDI1B2, HSD17B2, HSPA6, HSPB3, ICAM5, ID4, IF127, IGF2, KCNMB1, KRT14, KRT17, KRT34, MFAP5, MASPI, MEOXI, MEOX2, MMP1, MSX2, MX1, MYBPH, MYH3, MYH11, TAGLN3, NPAS1, NPPB, OGN, OLR1, PAX2, PAX9, PRELP, PRG4, PRRX2, PTN, PTPRN, RELN, SFRP2, SMOCI, SOXI1, STMN2, TAC1, THY1, TRH, WISP2, ZICI and ZIC2. The cell line X4SKEL8 is positive for the markers: AREG, BEXI, COL21A1, D102, METTL7A, DKK2, EGR2, FMO3, FOXF1, FST, MYL4, PITX2, PTGS2, S100A4 and SERPINA3 and is negative for the markers: ALDH1A1, AQP1, ATP8B4, CFB, C3, C20orflO3, CD24, CDH3, CLDN11, CNTNAP2, COMP, CRIPI, CRLF1, DLK1, DPT, FGFR3, FOXF2, GABRB1, GDF5, GDF10, GJB2, GSC, HOXA5, HSDI1B2, HSD17B2, HSPA6, HSPB3, ICAM5, ID4, IF127, IGF2, KRT14, KRT17, KRT34, MFAP5, MASPI, MEOXI, MEOX2, MGP, MMP1, MSX2, MX1, MYBPH, MYH3, MYH11, TAGLN3, NPAS1, NPPB, OGN, OLR1, PAX2, PAX9, PDE1A, PENK, PRG4, PRRX1, PRRX2, PTN, PTPRN, RARRESI, RASDI, RELN, RGSI, SFRP2, SMOCI, STMN2, TAC1, THY1, TNFSF7, TNNT2, TRH, TUBB4, ZICI and ZIC2. The cell line RA.PEND17Bio2a is positive for the markers: AREG, BEXI, CDH6, COL15A1, COL21A1, COPI, METTL7A, DPT, EGR2, FOXF1, FST, GJB2, LAMC2, MSX2, PTGS2, SERPINA3 and SFRP2 and is negative for the markers: ACTC, ALDH1A1, AQP1, ATP8B4, CFB, C20orflO3, CD24, CDH3, CNTNAP2, COMP, CRIPI, CXADR, FGFR3, FMO1, GABRB1, GAP43, GDF1O, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, HSPB3, ID4, IF127, IGF2, KCNMB1, KRT14, KRT17, KRT34, MFAP5, MASPI, MEOXI, MEOX2, MGP, MMP1, MX1, MYBPH, MYH3, MYH11, NPAS1, NPPB, OLR1, PAX2, PAX9, PDE1A, PRELP, PRG4, PROMI, PRRX2, PTN, PTPRN, RELN, RGSI, SMOCI, STMN2, TACI, THY1, TNFSF7, TNNT2, TRH, TUBB4, ZICi and ZIC2. The cell line W9 is positive for the markers: AKR1C1, C7, CDH6, COL21A1, METTL7A, DLK1, EGR2, FOXF1, GDF5, GJB2, HOXA5, IGFBP5, KIAA0644, KRT19, MGP, OGN, PITX2, SERPINA3, SOXI1, TFPJ2 and ZIC2 and is negative for the markers: AGC1, ALDH1A1, AQP1, CFB, C3, C20orflO3, CD24, CDH3, CLDN11, CNTNAP2, COL15A1, COMP, CRIPI, CRLF1, CRYAB, DKK2, FGFR3, FMO1, FMO3, FOXF2, GDF1O, GSC, HSD11B2, HSD17B2, HSPA6, HSPB3, ICAM5, ID4, IF127, IGF2, KCNMB1, KRT14, KRT17, KRT34, MFAP5, MASPI, MEOXI, MEOX2, MSX2, MX1, MYBPH, MYH3, MYHl1, NPAS1, NPPB, OLR1, PAX2, PAX9, PDE1A, PENK, PRG4, PROMI, PRRX2, PTN, PTPRN, RARRES1, RASDI, RGSI, SFRP2, SNAP25, STMN2, TACI, THY1, TNFSF7, TNNT2, TRH, TUBB4 and ZICI. The cell line MW4 is positive for the markers: AKR1C1, AREG, BEXI, C7, COL15A1, COL21A1, D102, METTL7A, DKK2, EGR2, FMO3, FOXF1, FOXF2, PITX2, PRELP, SERPINA3, SFRP2 and TFPJ2 and is negative for the markers: ALDH1A1, AQP1, ATP8B4, CFB, C3, C20orflO3, CD24, CDH3, CLDN11, CNTNAP2, CRIPI, CXADR, DLK1, GABRB1, GDF5, GDF1O, GJB2, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, HSPB3, ICAM5, ID4, IF127, IGF2, KCNMB1, KRT14, KRT17, KRT19, KRT34, MFAP5, MASPI, MEOXI, MEOX2, MGP, MMP1, MSX1, MX1, MYBPH, MYH3, MYHI, NPAS1, NPPB, OLR1, PAX2, PAX9, PDE1A, PENK, PRG4, PROMI, PRRX1, PTN, PTPRN, RARRESI, RELN, RGSI, SMOCI, STMN2, TACI, TNNT2, TUBB4, ZICI and ZIC2,. 84 WO 2011/150105 PCT/US2011/037969 The cell line SK58 is positive for the markers: AKR1C1, AREG, BEXI, C7, COL15A1, COL21A1, METTL7A, EGR2, FMO1, FOXF1, PTGS2, SERPINA3, SFRP2, TACI and TFPI2 and is negative for the markers: ACTC, AGC1, ALDH1A1, AQP1, ATP8B4, CFB, C3, C20orflO3, CD24, CDH3, CDH6, CLDN11, CNTNAP2, COPI, CRIPI, D102, DLK1, DPT, GABRB1, GDF5, GDF1O, GSC, HOXA5, HSD11B2, HSD17B2, HSPB3, ID4, IFI27, IGF2, KCNMB1, KRT14, KRT17, KRT19, KRT34, MFAP5, MASPI, MEOXI, MEOX2, MMP1, MSX2, MX1, MYBPH, MYH3, MYH11, NPAS1, NPPB, OLR1, PAX2, PAX9, PDE1A, PRG4, PROMI, PRRX2, PTN, PTPRN, RARRES1, RELN, RGS1, SMOCI, STMN2, TNNT2, TRH, TUBB4, ZICI and ZIC2,. The cell line SK25 is positive for the markers: BEXI, COL21A1, METTL7A, FMO1, FOXF1, LAMC2, SERPINA3, SFRP2 and WISP2 and is negative for the markers: ACTC, ALDH1A1, ANXA8, AQP1, ATP8B4, CFB, C3, C20orflO3, CD24, CDH3, CLDN11, CNTNAP2, COMP, CRIPI, CRLF1, CXADR, D102, DKK2, DPT, EGR2, FGFR3, GABRB1, GAP43, GDF1O, GJB2, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, HSPB3, ICAM5, ID4, IFI27, IGF2, KCNMB1, KIAA0644, KRT14, KRT17, KRT34, MFAP5, MASPI, MEOXI, MEOX2, MGP, MMP1, MSX2, MYBPH, MYH3, MYH11, NPAS1, NPPB, OGN, OLR1, PAX2, PAX9, PDE1A, PITX2, PRELP, PRG4, PROMI, PTN, RARRESI, RASD1, RGS1, SMOCI, STMN2, TACI, TFPI2, TNFSF7, TNNT2, TRH, ZICI and ZIC2. The cell line SK16 is positive for the markers: AREG, BEXI, COL15A1, COL21A1, METTL7A, EGR2, FMO1, FOXF1, LAMC2, MSX1, PITX2, SERPINA3, ZICI and ZIC2 and is negative for the markers: AGC1, ALDH1A1, AQP1, ATP8B4, CFB, C3, C20orflO3, CD24, CDH3, CLDN11, CNTNAP2, COMP, CRIPI, CXADR, D102, DKK2, DPT, FGFR3, GABRB1, GDF1O, GSC, HSD11B2, HSD17B2, HSPA6, HSPB3, ID4, IFI27, IGF2, KIAA0644, KRT14, KRT17, KRT19, KRT34, MFAP5, MASPI, MEOXI, MEOX2, MGP, MMP1, MSX2, MX1, MYBPH, MYH3, MYH11, TAGLN3, NPAS1, NPPB, OLR1, PAX2, PAX9, PENK, PRELP, PRG4, PROMI, PRRX2, PTN, RARRESI, RELN, RGS1, STMN2, TACI, TFPI2, THY1, TNFSF7, TNNT2, TRH and TUBB4,. The cell line EN20 is positive for the markers: BEXI, COL21A1, METTL7A, DLK1, FMO1, FOXF1, FST, GDF5, LAMC2, MGP, PRRX1, S100A4, SERPINA3, SOXI1, TFPI2 and WISP2 and is negative for the markers: ALDH1A1, AQP1, ATP8B4, C3, C7, C20orflO3, CD24, CDH3, CNTNAP2, COL15A1, COMP, CRIP1, CXADR, D102, DKK2, FGFR3, GABRB1, GAP43, GDF10, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, HSPB3, ICAM5, ID4, IFI27, KCNMB1, KRT14, KRT17, KRT34, MFAP5, MASPI, MEOXI, MEOX2, MMP1, MX1, MYBPH, MYH3, MYH11, NPAS1, NPPB, OLR1, PAX2, PDE1A, PITX2, PRELP, PRG4, PROMI, PTN, PTPRN, RASD1, RGS1, SFRP2, SMOCI, SNAP25, STMN2, TACI, TNFSF7, TNNT2, TRH, TUBB4, ZICI and ZIC2,. The cell line EN43 is positive for the markers: AKR1C1, BEXI, C7, CDH6, COL21A1, D102, METTL7A, DLK1, FMO1, FMO3, FOXF1, FOXF2, FST, GDF5, MMP1, MSX1, OGN, PRRX1, S100A4, SERPINA3 and SOXI1 and is negative for the markers: ALDH1A1, ANXA8, AQP1, ATP8B4, C3, C20orflO3, CD24, CDH3, CLDN11, CNTNAP2, COMP, CRIPI, CRLF1, DKK2, DPT, GABRB1, GAP43, GDF1O, GJB2, GSC, HOXA5, HSD11B2, HSD17B2, HSPA6, ID4, IFI27, IGF2, KCNMB1, KRT14, KRT17, KRT19, KRT34, MFAP5, MASPI, MEOXI, MEOX2, MGP, MYBPH, MYH3, MYH11, NPAS1, NPPB, OLR1, PAX2, PAX9, PDE1A, PITX2, PRG4, PROMI, PTN, PTPRN, RASD1, RGS1, SFRP2, SMOCI, STMN2, THY1, TNNT2, TRH, TUBB4, ZICI and ZIC2. Table II Culture Conditions 1. Subconfluent Monolayer Culture: Cells are plated and exposed to combinations of the conditions 5 listed in Tables I-IV herein while said cells are in a subconcluent state. 2. Confluent Monolayer Culture: Cells are plated and exposed to combinations of the conditions listed in Tables I-IV herein while said cells are in a confluent monolayer state. 3. Micromass Culture: Cells are plated and exposed to combinations of the conditions listed in Tables I IV herein while said cells are in a highly dense micromass state as described herein. 10 4. Subconfluent Mixed Culture: Cells are plated and exposed to combinations of the conditions listed in Tables I-IV herein while said cells are in a subconfluent state and juxtasposed (co-cultured) potentially 85 WO 2011/150105 PCT/US2011/037969 in physical contact with cells of another differentiated state or another distinguishable cell line of the present invention. 5. Subconfluent Transwell Culture: Cells are plated and exposed to combinations of the conditions listed in Tables I-IV herein while said cells are in transwell vessels or tissue cultureware of similar design 5 that allows the physical separation of diverse cell types but allowing a sharing of their media. Such subconfluent transwell culture is where the cell lines of the present invention are subconfluent and share culture media with a cell type of a different differentiated state wherein the cells of a different differentiated state may be themselves in a subconfluent or confluent state. 6. Confluent Mixed Culture: Cells are plated and exposed to combinations of the conditions listed in 10 Tables I-IV herein while said cells are in a confluent state and juxtasposed (co-cultured) potentially in physical contact with cells of another differentiated state or another distinguishable cell line of the present invention. 7. Confluent Transwell Culture: Cells are plated and exposed to combinations of the conditions listed in Tables I-IV herein while said cells are in transwell vessels or tissue cultureware of similar design that 15 allows the physical separation of diverse cell types but allowing a sharing of their media. Such subconfluent transwell culture is where the cell lines of the present invention are confluent and share culture media with a cell type of a different differentiated state wherein the cells of a different differentiated state may be themselves in a subconfluent or confluent state. 8. Micromass Mixed Culture: Cells are plated and exposed to combinations of the conditions listed in 20 Tables I-IV herein while said cells are in a highly dense micromass state as described herein and juxtasposed (co-cultured) potentially in physical contact with cells of another differentiated state or another distinguishable cell line of the present invention. 9. Micromass Transwell Culture: Cells are plated and exposed to combinations of the conditions listed in Tables I-IV herein while said cells are in transwell vessels or tissue cultureware of similar design that 25 allows the physical separation of diverse cell types but allowing a sharing of their media while said cells are in a highly dense micromass state as described herein. Such subconfluent transwell culture is where the cell lines of the present invention are confluent and share culture media with a cell type of a different differentiated state wherein the cells of a different differentiated state may be themselves in a subconfluent or confluent state. 30 Culture Exposed to Cell Extracts of Cells of a Different Differentiated State: Target cells are plated and exposed to combinations of the conditions listed in Tables I-IV herein while said cells are in a subconfluent state and wherein the media for said cells contains extracts of cells of a differing differentiated state and wherein said target cells are exposed to conditions that facilitate the intracellular trafficking of molecules such as described in U.S. patent application Ser. No. 10/910,156 filed on August 2, 2004 and titled "Methods for 35 Altering Cell Fate", and U.S. patent application Ser. No. 10/015,824 filed on December 10, 2001 and titled "Methods for Altering Cell Fate", both incorporated herein by reference in their entirety. 86 WO 2011/150105 PCT/US2011/037969 Table III Culture Media and Related Culture Variables Culture Media 1) DMEM (Dulbecco's Modified Eagle's Medium). HyClone Cat. No. SH30285.03 5 2) Airway Epithelial Growth Medium (PromoCell Cat. No. C-21260 with supplement Cat No. C-39160) 3) Epi-Life (LSGS) Medium (Cascade Cat. No. M-EPlcf/PRF-500 with supplement Cat. No. S-003-10) 4) Neural Basal Medium B-27 (Gibco Cat. No. 12348-017 with B-27 supplement Cat. No. 12587-010) 5) Neural Basal Medium N-2 (Gibco Cat. No. 12348-017 with N-2 supplement Cat. No. 17502-048) 6) HepatoZyme-SFM (Gibco Cat. No. 17705-021) 10 7) Epi-Life (HKGS) Medium (Cascade Cat. No. M EPlcf/PRF-500 with supplement Cat. No. S-001-5) 8) Endothelial Cell Growth Medium (PromoCell Cat. No. C-22221 with supplement Cat No. C-39221) 9) Endothelial Cell SFM (Gibco Cat. No. 11111-044 with basic fibroblast growth factor Cat. No. 13256 029, epidermal growth factor Cat. No. 13247-051 and fibronectin Cat. No. 33016-015) 10) Skeletal Muscle Medium (PromoCell Cat. No. C-23260 with supplement Cat. No. C-39360) 15 11) Smooth Muscle Basal Medium (PromoCell Cat. No. C-22262 with supplement Cat. No. C-39262) 12) MesenCult Medium (Stem Cell Technologies Cat. No. 05041 with supplement Cat. No. 05402) 13) Melanocyte Growth Medium (PromoCell Cat. No. C 24010 with supplement Cat. No. C-39410) 14) Ham's F-10 Medium 15) Ham's F-12 Medium 20 16) DMEM/Ham's F-12 50/50 mix 17) Iscove's Modified Dulbecco's Medium (IMDM) 18) Leibovitz's L-15 Medium 19) McCoy's 5A Medium Modified 20) RPMI 1640 Medium 25 21) Glasgow's MEM (GMEM) 22) Eagle's Medium 23) Medium 199 24) MEM Eagle-Earle's 30 Antibiotics 25) Penicillin 26) Streptomycin 27) Gentamycin 28) Neomycin 35 29) G418 Other Factors 30) Human plasma 31) Chick embryo extract 40 32) Human plasmanate 87 WO 2011/150105 PCT/US2011/037969 Table IV Supplemented Factors EGF Ligands 1) Amphiregulin 5 2) Betacellulin 3) EGF 4) Epigen 5) Epiregulin 6) HB-EGF 10 7) Neuregulin-3 8) NRG1 isoform GGF2 9) NRG1 Isoform SMDF 10) NRG1 -alpha/HRG1 -alpha 11) TGF-alpha 15 12) TMEFF1/Tomoregulin-1 13) TMEFF2 14) EGF Ligands pooled (1-13 above) EGF R/ErbB Receptor Family 15) EGF Receptor 20 16) ErbB2 17) ErbB3 18) ErbB4 19) EGF/ErbB Receptors pooled (15-18 above) FGF Ligands 25 20) FGF acidic 21) FGF basic 22) FGF-3 23) FGF-4 24) FGF-5 30 25) FGF-6 26) KGF/FGF-7 27) FGF-8 28) FGF-9 29) FGF-10 35 30) FGF-11 31) FGF-12 32) FGF-13 33) FGF-14 88 WO 2011/150105 PCT/US2011/037969 34) FGF-15 35) FGF-16 36) FGF-17 37) FGF-18 5 38) FGF-19 39) FGF-20 40) FGF-21 41) FGF-22 42) FGF-23 10 43) FGF Ligands pooled (20-38 above) FGF Receptors 40) FGF RI 41) FGF R2 42) FGF R3 15 43) FGF R4 44) FGF R5 45) FGF Receptors pooled (40-44 above) FGF Regulators 46) FGF-BP 20 Hedgehogs 47) Desert Hedgehog 48) Sonic Hedgehog 49) Indian Hedgehog 50) Hedgehogs pooled (47-49 above) 25 Hedgehog Regulators 51) Gas1 52) Hip 53) Hedgehog Regulators pooled (51-52 above) IGF Ligands 30 54) IGF-I 55) IGF-II 56) IGF Ligands pooled (54-55 above) IGF-I Receptor (CD221) 89 WO 2011/150105 PCT/US2011/037969 57) IGF-I R GF Binding Protein (IGFBP) Family 58) ALS 59 IGFBP-4 5 60) CTGF/CCN2 61) IGFBP-5 62) Endocan 63) IGFBP-6 64) IGFBP-1 10 65) IGFBP-rpl/IGFBP-7 66) IGFBP-2 67) NOV/CCN3 68) IGFBP-3 69) GF Binding Protein Family pooled (58-68 above) 15 Receptor Tyrosine Kinases 70) Axl 71) Clq R1/CD93 72) DDR1 73) Flt-3 20 74) DDR2 75) HGF R 76) Dtk 77) IGF-II R 78) Eph 25 79) Insulin R/CD220 80) EphAl 81) M-CSF R 82) EphA2 83) Mer 30 84) EphA3 85) MSP R/Ron 86) EphA4 87) MuSK 88) EphA5 35 89) PDGF R alpha 90) EphA6 91) PDGF R beta 92) EphA7 90 WO 2011/150105 PCT/US2011/037969 93) Ret 94) EphA8 95) RORI 96) EphB1 5 97) ROR2 98) EphB2 99) SCF R/c-kit 100) EphB3 101) Tie-i 10 102) EphB4 103) Tie-2 104) EphB6 105) TrkA 106) TrkB 15 107) TrkC 108) VEGF Ri/Flt-i 109) VEGF R2/Flk-1 110) VEGF R3/Flt-4 111) Receptor Tyrosine Kinases pooled (70-110 above) 20 Proteoglycans 112) Aggrecan 113) Lumican 114) Biglycan 115) Mimecan 25 116) Decorin 117) NG2/MCSP 118) Endocan 119) Osteoadherin 120) Endorepellin 30 121) Syndecan-i/CD138 122) Glypican 2 123) Syndecan-3 124) Glypican 3 125) Testican 1/SPOCKI 35 126) Glypican 5 127) Testican 2/SPOCK2 128) Glypican 6 129) Testican 3/SPOCK3 130) Heparan sulfate proteoglycan 91 WO 2011/150105 PCT/US2011/037969 131) Heparin 132) Chondroitin sulfate proteoglycan 133) Hyaluronic acid 134) Dermatan sulfate proteoglycan 5 Proteoglycan Regulators 135) Arylsulfatase A/ARSA 136) HAPLN1 137) Exostosin-like 2 138) HS6ST2 10 139) Exostosin-like 3 140) IDS 141) Proteoglycan Regulators pooled (135-140 above) SCF, Flt-3 Ligand & M-CSF 142) Flt-3 15 143) M-CSF R 144) Flt-3 Ligand 145) SCF 146) M-CSF 147) SCF R/c-kit 20 148) Pooled factors (142-147 above) Activins 149) Activin A 150) Activin B 151) Activin AB 25 152) Activin C 153) Pooled Activins (149-152 above) BMPs (Bone Morphogenetic Proteins) 154) BMP-2 30 155) BMP-3 156) BMP-3b/GDF-10 157) BMP-4 158) BMP-5 159) BMP-6 35 160) BMP-7 92 WO 2011/150105 PCT/US2011/037969 161) BMP-8 162) Decapentaplegic 163) Pooled BMPs (154-162 above) GDFs (Growth Differentiation Factors) 5 164) GDF-1 165) GDF-2 166) GDF-3 167) GDF-4 168) GDF-5 10 169) GDF-6 170) GDF-7 171) GDF-8 172) GDF-9 173) GDF-10 15 174) GDF-11 175) GDF-12 176) GDF-13 177) GDF-14 178) GDF-15 20 179) GDFs pooled (164-178 above) GDNF Family Ligands 180) Artemin 181) Neurturin 182) GDNF 25 183) Persephin 184) GDNF Ligands pooled (180-183 above) TGF-beta 185) TGF-beta 186) TGF-beta 1 30 187) TGF-beta 1.2 188) TGF-beta 2 189) TGF-beta 3 190) TGF-beta 4 191) TGF-beta 5 35 192) LAP (TGF-beta 1) 193) Latent TGF-beta 1 93 WO 2011/150105 PCT/US2011/037969 194) TGF-beta pooled (185-193 above) Other TGF-beta Superfamily Ligands 195) Lefty 196) Nodal 5 197) MIS/AMH 198) Other TGF-beta Ligands pooled (195-197 above) TGF-beta Superfamily Receptors 199) Activin RIA/ALK-2 200) GFR alpha-i 10 201) Activin RIB/ALK-4 202) GFR alpha-2 203) Activin RIIA 204) GFR alpha-3 205) Activin RIIB 15 206) GFR alpha-4 207) ALK-1 208) MIS RII 209) ALK-7 210) Ret 20 211) BMPR-IA/ALK-3 212) TGF-beta RI/ALK-5 213) BMPR-IB/ALK-6 214) TGF-beta RII 215) BMPR-II 25 216) TGF-beta RIIb 217) Endoglin/CD105 218) TGF-beta RIII 219) TGF-beta family receptors pooled (199-218 above) TGF-beta Superfamily Modulators 30 220) Amnionless 221) GASP-2/WFIKKN 222) BAMBI/NMA 223) Gremlin 224) Caronte 35 225) NCAM-1/CD56 226) Cerberus 1 94 WO 2011/150105 PCT/US2011/037969 227) Noggin 228) Chordin 229) PRDC 230) Chordin-Like 1 5 231) Chordin-Like 2 232) Smad1 233) Smad4 234) Smad5 235) Smad7 10 236) Smad8 237) CRIMI 238) Cripto 239) Crossveinless-2 240) Cryptic 15 241) SOST 242) DAN 243) Latent TGF-beta bp1 244) TMEFF1/Tomoregulin-1 245) FLRG 20 246) TMEFF2 247) Follistatin 248) TSG 249) Follistatin-like 1 250) Vasorin 25 251) GASP-1IWFIKKNRP 252) TGF Modulators pooled (220-251 above) VEGF/PDGF Family 253) Neuropilin-1 254) PlGF 30 255) PlGF-2 256) Neuropilin-2 257) PDGF 258) VEGF R1I/Flt-1 259) PDGF R alpha 35 260) VEGF R2/Flk-1 261) PDGF R beta 262) VEGF R3/Flt-4 263) PDGF-A 264) VEGF 95 WO 2011/150105 PCT/US2011/037969 265) PDGF-B 266) VEGF-B 267) PDGF-C 268) VEGF-C 5 269) PDGF-D 270) VEGF-D 271) PDGF-AB 272) VEGF/PDGF Family pooled (253-271 above) Dickkopf Proteins & Wnt Inhibitors 10 273) Dkk-1 274) Dkk-2 275) Dkk-3 276) Dkk-4 277) Soggy-1 15 278) WIF-1 279) Pooled factors (273-278 above) Frizzled & Related Proteins 280) Frizzled-i 281) Frizzled-2 20 282) Frizzled-3 283) Frizzled-4 284) Frizzled-5 285) Frizzled-6 286) Frizzled-7 25 287) Frizzled-8 288) Frizzled-9 289) sFRP-1 290) sFRP-2 291) sFRP-3 30 292) sFRP-4 293) MFRP 294) Factors pooled (280-293 above) Wnt Ligands 295) Wnt-1 35 296) Wnt-2 297) Wnt-3 96 WO 2011/150105 PCT/US2011/037969 298) Wnt-3a 299) Wnt-4 300) Wnt-5 301) Wnt-5a 5 302) Wnt-6 303) Wnt-7 304) Wnt-8 305) Wnt-8a 306) Wnt-9 10 307) Wnt-10a 308) Wnt-10b 309) Wnt-1 1 310 Wnt Ligands pooled (295-309 above) Other Wnt-related Molecules 15 311) beta-Catenin 312) LRP-6 313) GSK-3 314) RORI 315) Kremen-1 20 316) ROR2 317) Kremen-2 318) WISP-1/CCN4 319) LRP-1 320) Pooled factors (311-319 above) 25 Other Growth Factors 321) CTGF/CCN2 322) NOV/CCN3 323) EG-VEGF/PK1 324) Osteocrin 30 325) Hepassocin 326) PD-ECGF 327) HGF 328) Progranulin 329) beta-NGF 35 330) Thrombopoietin 331) Pooled factors (321-330 above) 97 WO 2011/150105 PCT/US2011/037969 Steroid Hormones 332) l7beta-Estradiol 333) Testosterone 334) Cortisone 5 335) Dexamethasone Extracellular/Membrane Proteins 336) Plasma Fibronectin 337) Tissue Fibronectin 338) Fibronectin fragments 10 339) Collagen Type I (gelatin) 340) Collagen Type II 341) Collagen Type III 342) Tenascin 343) Matrix Metalloproteinase 1 15 344) Matrix Metalloproteinase 2 345) Matrix Metalloproteinase 3 346) Matrix Metalloproteinase 4 347) Matrix Metalloproteinase 5 348) Matrix Metalloproteinase 6 20 349) Matrix Metalloproteinase 7 350) Matrix Metalloproteinase 8 351) Matrix Metalloproteinase 9 352) Matrix Metalloproteinase 10 353) Matrix Metalloproteinase 11 25 354) Matrix Metalloproteinase 12 355) Matrix Metalloproteinase 13 356) ADAM-1 357) ADAM-2 358) ADAM-3 30 359) ADAM-4 360) ADAM-5 361) ADAM-6 362) ADAM-7 363) ADAM-8 35 364) ADAM-9 365) ADAM-10 366) ADAM-11 367) ADAM-12 98 WO 2011/150105 PCT/US2011/037969 368) ADAM-13 369) ADAM-14 370) ADAM-15 371) ADAM-16 5 372) ADAM-17 373) ADAM-18 374) ADAM-19 375) ADAM-20 376) ADAM-21 10 377) ADAM-22 378) ADAM-23 379) ADAM-24 380) ADAM-25 381) ADAM-26 15 382) ADAM-27 383) ADAM-28 384) ADAM-29 385) ADAM-30 386) ADAM-31 20 387) ADAM-32 388) ADAM-33 389) ADAMTS-1 390) ADAMTS-2 391) ADAMTS-3 25 392) ADAMTS-4 393) ADAMTS-5 394) ADAMTS-6 395) ADAMTS-7 396) ADAMTS-8 30 397) ADAMTS-9 398) ADAMTS-10 399) ADAMTS-1 1 400) ADAMTS-12 401) ADAMTS-13 35 402) ADAMTS-14 403) ADAMTS-15 404) ADAMTS-16 405) ADAMTS-17 406) ADAMTS-18 40 407) ADAMTS-19 408) ADAMTS-20 99 WO 2011/150105 PCT/US2011/037969 409) Arg-Gly-Asp 410) Arg-Gly-Asp-Ser 411) Arg-Gly-Asp-Ser-Pro-Ala-Ser-Ser-Lys-Pro 412) Arg-Gly-Glu-Ser 5 413) Arg-Phe-Asp-Ser 414) SPARC 415) Cys-Asp-Pro-Gly-Tyr-Ile-Gly-Ser-Arg 416) Cys-Ser-Arg-Ala-Arg-Lys-Gln-Ala-Ala-Ser-Ile-Lys-Val-Ser-Ala-Asp-Arg 417) Elastin 10 418) Tropelastin 419) Gly-Arg-Gly-Asp-Ser-Pro-Lys 420) Gly-Arg-Gly-Asp-Thr-Pro 421) Laminin 422) Leu-Gly-Thr-Ile-Pro-Gly 15 423) Ser-Asp-Gly-Arg-Gly 424) Vitronectin 425) Superfibronectin 426) Thrombospondin 427) TIMP-1 20 428) TIMP-2 429) TIMP-3 430) TIMP-4 431) Fibromodulin 432) Flavoridin 25 433) Collagen IV 434) Collagen V 435) Collagen VI 436) Collagen VII 437) Collagen VIII 30 438) Collagen IX 439) Collagen X 440) Collagen XI 441) Collagen XII 442) Entactin 35 443) Fibrillin 444) Syndecan-1 445) Keratan sulfate proteoglycan Ambient Oxygen 446) 0.1-0.5% Oxygen 100 WO 2011/150105 PCT/US2011/037969 447) 0.5-1% Oxygen 448) 1-2% Oxygen 449) 2-5% Oxygen 450) 5-10% Oxygen 5 451) 10-20% Oxygen Animal Serum 452) 0.1% Bovine Serum 453) 0.5% Bovine Serum 454) 1.0% Bovine Serum 10 455) 5.0% Bovine Serum 456) 10% Bovine Serum 457) 20% Bovine Serum 458) 10% Horse Serum Interleukins 15 459) IL-i 460) IL-2 461) IL-3 462) IL-4 463) IL-5 20 464) IL-6 465) IL-7 466) IL-8 467) IL-9 468) IL-10 25 469) IL-11 470) IL-12 471) IL-13 472) IL-14 473) IL-15 30 474) IL-16 475) IL-17 476) IL-18 Proteases 477) MMP-i 35 478) MMP-2 479) MMP-3 101 WO 2011/150105 PCT/US2011/037969 480) MMP-4 481) MMP-5 482) MMP-6 483) MMP-7 5 484) MMP-8 485) MMP-9 486) MMP-10 487) MMP-11 488) MMP-12 10 489) MMP-13 490) MMP-14 491) MMP-15 492) MMP-16 493) MMP-17 15 494) MMP-18 495) MMP-19 496) MMP-20 497) MMP-21 498) MMP-22 20 499) MMP-23 500) MMP-24 501) Cathepsin B 501) Cathepsin C 503) Cathepsin D 25 504) Cathepsin G 505) Cathepsin H 506) Cathepsin L 507) Trypsin 508) Pepsin 30 509) Elastase 510) Carboxypeptidase A 511) Carboxypeptidase B 512) Carboxypeptidase G 513) Carboxypeptidase P 35 514) Carboxypeptidase W 515) Carboxypeptidase Y 516) Chymotrypsin 517) Plasminogen 518) Plasmin 40 519) u-type Plasminogen activator 520) t-type Plasminogen activator 102 WO 2011/150105 PCT/US2011/037969 521) Plasminogen activator inhibitor-i 522) Carboxypeptidase Z Amino Acids 522) Alanine 5 523) Arginine 524) Asparagine 525) Aspartic acid 526) Cysteine 527) Glutamine 10 528) Glutamic acid 529) Glycine 530) Histidine 531) Isoleucine 532) Leucine 15 533) Lysine 534) Methionine 535) Phenylalanine 536) Proline 537) Serine 20 538) Threonine 539) Tryptophan 540) Tyrosine 541) Valine Prostaglandins 25 542) Prostaglandin Al 543) Prostaglandin A2 544) Prostaglandin BI 545) Prostaglandin B2 546) Prostaglandin D2 30 547) Prostaglandin El 548) Prostaglandin E2 549) Prostaglandin Fl alpha 550) Prostaglandin F2alpha 551) Prostaglandin H 35 552) Prostaglandin 12 553) Prostaglandin J2 554) 6-Keto-Prostaglandin Fla 555) 16,16-Dimethyl-Prostaglandin E2 103 WO 2011/150105 PCT/US2011/037969 556) 15d-Prostaglandin J2 557) Prostaglandins pooled (542-556 above) Retinoid receptor agonists/Antagonists 558) Methoprene Acid 5 559) All trans retinoic acid 560) 9-Cis Retinoic Acid 561) 13-Cis Retinoic Acid 562) Retinoid agonists pooled (558-561 above) 563) Retinoid antagonists 10 564) Retinoic acid receptor isotype RARalpha 565) Retinoic acid receptor isotype RARbeta 566) Retinoic acid receptor isotype RARgamma 567) Retinoic X receptor isotype RXRalpha 568) Retinoic X receptor isotype RXRbeta 15 569) Retinoic X receptor isotype RARgamma Miscellaneous Inducers 570) Plant lectins 571) Bacterial lectins 572) forskolin 20 573) Phorbol myristate acetate 574) Poly-D-lysine 575) 1,25-dihydroxyvitamin D 576) Inhibin 577) Heregulin 25 578) Glycogen 579) Progesterone 580) IL-1 581) Serotonin 582) Fibronectin - 45kDa Fragment 30 583) Fibronectin - 70kDa Fragment 584) glucose 585) beta mercaptoethanol 586) heparinase 587) pituitary extract 35 588) chorionic gonadotropin 589) adrenocorticotropic hormone 590) thyroxin 591) Bombesin 104 WO 2011/150105 PCT/US2011/037969 592) Neuromedin B 593) Gastrin-Releasing Peptide 594) Epinephrine 595) Isoproterenol 5 596) Ethanol 597) DHEA 598) Nicotinic Acid 599) NADH 600) Oxytocin 10 601) Vasopressin 602) Vasotocin 603) Angiotensin I 604) Angiotensin II 605) Angiotensin I Converting Enzyme 15 606) Angiotensin I Converting Enzyme Inhibitor 607) Chondroitinase AB 608) Chondroitinase C 609) Brain natriuretic peptide 610) Calcitonin 20 611) Calcium ionophore I 612) Calcium ionophore II 613) Calcium ionophore III 614) Calcium ionophore IV 615) Bradykinin 25 616) Albumin 617) Plasmonate 618) LIF 619) PARP inhibitors 620) Lysophosphatidic acid 30 621) (R)-METHANANDAMIDE 622) 1,25-DIHYDROXYVITAMIN D3 623) 1,2-DIDECANOYL-GLYCEROL (10:0) 624) 1,2-DIOCTANOYL-SN-GLYCEROL 625) 1,2-DIOLEOYL-GLYCEROL (18:1) 35 626) 10-hydroxycamptothecin 627) 11,12-EPOXYEICOSATRIENOIC ACID 628) 12(R)-HETE 629) 12(S)-HETE 630) 12(S)-HPETE 40 631) 12-METHOXYDODECANOIC ACID 632) 13(S)-HODE 105 WO 2011/150105 PCT/US2011/037969 633) 13(S)-HPODE 634) 13,14-DIHYDRO-PGE1 635) 13-KETOOCTADECADIENOIC ACID 636) 14,15-EPOXYEICOSATRIENOIC ACID 5 637) 1400W 638) 15(S)-HETE 639) 15(S)-HPETE 640) 15-KETOEICOSATETRAENOIC ACID 641) 17-Allylamino-geldanamycin 10 642) 17-OCTADECYNOIC ACID 643) 17-PHENYL-TRINOR-PGE2 644) 1-ACYL-PAF 645) 1-HEXADECYL-2-ARACHIDONOYL-522) 646) GLYCEROL 647) 1-HEXADECYL-2-METHYLGLYCERO-3 PC 15 648) 1-HEXADECYL-2-0-ACETYL-GLYCEROL 649) 1-HEXADECYL-2-0-METHYL-GLYCEROL 650) 1-OCTADECYL-2-METHYLGLYCERO-3 PC 651) 1-OLEOYL-2-ACETYL-GLYCEROL 652) 1-STEAROYL- 2-LINOLEOYL-GLYCEROL 20 653) 1-STEAROYL-2-ARACHIDONOYL-GLYCEROL 654) 2,5-ditertbutylhydroquinone 655) 24(S)-hydroxycholesterol 656) 24,25-DIHYDROXYVITAMIN D3 657) 25-HYDROXYVITAMIN D3 25 658) 2-ARACHIDONOYLGLYCEROL 659) 2-FLUOROPALMITIC ACID 660) 2-HYDROXYMYRISTIC ACID 661) 2-methoxyantimycin A3 662) 3,4-dichloroisocoumarin 30 663) granzyme B inhibitor 664) 4-AMINOPYRIDINE 665) 4-HYDROXYPHENYLRETINAMIDE 666) 4-OXATETRADECANOIC ACID 667) 5(S)-HETE 35 668) 5(S)-HPETE 669) 5,6-EPOXYEICOSATRIENOIC ACID 670) 5,8,11,14-EICOSATETRAYNOIC ACID 671) 5,8,11-EICOSATRIYNOIC ACID 672) 5-HYDROXYDECANOATE 40 673) 5-iodotubercidin 674) 5-KETOEICOSATETRAENOIC ACID 106 WO 2011/150105 PCT/US2011/037969 675) 5'-N-Ethylcarboxamidoadenosine (NECA) 676) 6,7-ADTN HBr 677) 6-FORMYLINDOLO [3,2-B] CARBAZOLE 678) 7,7-DIMETHYLEICOSADIENOIC ACID 5 679) 8,9-EPOXYEICOSATRIENOIC ACID 680) 8-methoxymethyl-IBMX 681) 9(S)-HODE 682) 9(S)-HPODE 683) 9,10-OCTADECENOAMIDE 10 684) A-3 685) AA-861 686) acetyl (N)-s-farnesyl-1-cysteine 687) ACETYL-FARNESYL-CYSTEINE 688) Ac-Leu-Leu-Nle-CHO 15 689) ACONITINE 690) actinomycin D 691) ADRENIC ACID (22:4, n-6) 692) ImM 693) AG-1296 20 694) AG1478 695) AG213 (Tyrphostin 47) 696) AG-370 697) AG-490 698) AG-879 25 699) AGC 700) AGGC 701) Ala-Ala-Phe-CMK 702) alamethicin 703) Alrestatin 30 704) AM 92016 704) AM-251 706) AM-580 707) AMANTIDINE 708) AMILORIDE 35 709) Amino-1,8-naphthalimide [4-Amino-1,8-522] naphthalimide] 710) Aminobenzamide (3-ABA) [3-522] aminobenzamide (3-ABA)] 711) AMIODARONE 712) ANANDAMIDE (18:2,n-6) 713) ANANDAMIDE (20:3,n-6) 40 714) ANANDAMIDE (20:4, n-6) 715) ANANDAMIDE (22:4,n-6) 107 WO 2011/150105 PCT/US2011/037969 716) anisomycin 717) aphidicolin 718) ARACHIDONAMIDE 719) ARACHIDONIC ACID (20:4, n-6) 5 720) ARACHIDONOYL-PAF 721) aristolochic acid 722) Arvanil 723) ascomycin (FK-520) 724) B581 10 725) BADGE 726) bafilomycin Al 727) BAPTA-AM 728) BAY 11-7082 729) BAY K-8644 15 730) BENZAMIL 731) BEPRIDIL 732) Bestatin 733) beta-lapachone 734) Betulinic acid 20 735) bezafibrate 736) Blebbistatin 737) BML-190 738) Boc-GVV-CHO 739) bongkrekic acid 25 740) brefeldin A 741) Bromo-7-nitroindazole [3-Bromo-7-nitroindazole] 742) Bromo-cAMP [8-Bromo-cAMP] 743) Bromo-cGMP [8-Bromo-cGMP] 744) bumetanide 30 745) BW-B 70C 746) C16 CERAMIDE 747) C2 CERAMIDE 748) C2 DIHYDROCERAMIDE 749) C8 CERAMIDE 35 750) C8 CERAMINE 750) C8 DIHYDROCERAMIDE 751) CA-074-Me 753) calpeptin 754) calphostin C 40 755) calyculin A 756) camptothecin 108 WO 2011/150105 PCT/US2011/037969 757) cantharidin 758) CAPE 759) capsacin(E) 760) capsazepine 5 761) CARBACYCLIN 762) castanospermine 763) CDC 764) Cerulenin 765) CGP-37157 10 766) chelerythrine 767) CIGLITAZONE 768) CIMATEROL 769) CinnGEL 2Me 770) CIRAZOLINE 15 771) CITCO 772) CLOFIBRATE 773) clonidine 774) CLOPROSTENOL Na 775) clozapine 20 776) C-PAF 777) Curcumin 778) Cyclo [Arg-Gly-Asp-D-Phe-Val] 779) cycloheximide 780) protein synthesis inhibitor 25 781) cycloheximide-N-ethylethanoate 782) cyclopamine 783) CYCLOPIAZONIC ACID 784) cyclosporin A 785) cypermethrin 30 786) cytochalasin B 787) cytochalasin D 788) D12-PROSTAGLANDIN J2 789) D609 790) damnacanthal 35 791) DANTROLENE 792) decoyinine 793) Decylubiquinone 794) deoxymannojirimycin(1) 795) deoxynorjrimycin(1) 40 796) Deprenyl 797) DIAZOXIDE 109 WO 2011/150105 PCT/US2011/037969 798) dibutyrylcyclic AMP 799) dibutyrylcyclic GMP 800) DICHLOROBENZAMIL 801) DIHOMO-GAMMA-LINOLENIC ACID 5 802) DIHYDROSPHINGOSINE 803) DIINDOLYLMETHANE 804) DILTIAZEM 805) diphenyleneiodonium Cl 806) dipyridamole 10 807) DL-DIHYDROSPHINGOSINE 808) DL-PDMP 809) DL-PPMP 810) DOCOSAHEXAENOIC ACID (22:6 n-3) 811) DOCOSAPENTAENOIC ACID 15 812) DOCOSATRIENOIC ACID (22:3 n-3) 813) doxorubicin 814) DRB 815) E-4031 816) E6 berbamine 20 817) E-64-d 818) Ebselen 819) EHNA HCl 820) EICOSA-5,8-DIENOIC ACID (20:2 n-12) 821) EICOSADIENOIC ACID (20:2 n-6) 25 822) EICOSAPENTAENOIC ACID (20:5 n-3) 823) EICOSATRIENOIC ACID (20:3 n-3) 824) ENANTIO-PAF C16 825) epibatidine (+/-) 826) etoposide 30 827) FARNESYLTHIOACETIC ACID 828) FCCP 829) FIPRONIL 830) FK-506 831) FLECAINIDE 35 832) FLUFENAMIC ACID 833) FLUNARIZINE 834) FLUPROSTENOL 835) FLUSPIRILINE 836) FPL-64176 40 837) Fumonisin BI 838) Furoxan 110 WO 2011/150105 PCT/US2011/037969 839) GAMMA-LINOLENIC ACID (18:3 n-6) 840) geldanamycin 841) genistein 842) GF-109203X 5 843) GINGEROL 844) Gliotoxin 845) GLIPIZIDE 846) GLYBURIDE 847) GM6001 10 848) Go6976 849) GRAYANOTOXIN III 850) GW-5074 851) GW-9662 852) H7] 15 853) H-89 854) H9 855) HA-1004 856) HA1077 857) HA14-1 20 858) HBDDE 859) Helenalin 860) Hinokitiol 861) HISTAMINE 862) HNMPA-(AM)3 25 863) Hoechst 33342 (cell permeable) (BisBenzimide) 864) Huperzine A [(-)-Huperzine A] 865) IAA-94 866) IB-MECA 867) IBMX 30 868) ICRF-193 869) Ikarugamyin 870) Indirubin 871) Indirubin-3'-monoxime 872) indomethacin 35 873) juglone 874) K252A 875) Kavain (+/-) 876) KN-62 877) KT-5720 40 878) L-744,832 879) Latrunculin B 111 WO 2011/150105 PCT/US2011/037969 880) Lavendustin A 881) L-cis-DILTIAZEM 882) LEUKOTOXIN A (9,10-EODE) 883) LEUKOTOXIN B (12,13-EODE) 5 884) LEUKOTRIENE B4 885) LEUKOTRIENE C4 886) LEUKOTRIENE D4 887) LEUKOTRIENE E4 888) Leupeptin 10 889) LFM-A13 890) LIDOCAINE 891) LINOLEAMIDE 892) LINOLEIC ACID 893) LINOLENIC ACID (18:3 n-3) 15 894) LIPOXIN A4 895) L-NAME 896) L-NASPA 897) LOPERAMIDE 898) LY-171883 20 899) LY-294002 900) LY-83583 901) Lycorine 902) LYSO-PAF C16 903) Manoalide 25 904) manumycin A 905) MAPP, D-erythro 906) MAPP, L-erythro 907) mastoparan 908) MBCQ 30 909) MCI-186 910) MDL-28170 911) MEAD ACID (20:3 n-9) 912) MEAD ETHANOLAMIDE 913) methotrexate 35 914) METHOXY VERAPAMIL 915) Mevinolin (lovastatin) 916) MG-132 917) Milrinone 918) MINOXIDIL 40 919) MINOXIDIL SULFATE 920) MISOPROSTOL, FREE ACID 112 WO 2011/150105 PCT/US2011/037969 921) mitomycin C 922) ML7 923) ML9 924) MnTBAP 5 925) Monastrol 926) monensin 927) MY-5445 928) Mycophenolic acid 929) N,N-DIMETHYLSPHINGOSINE 10 930) N9-Isopropylolomoucine 931) N-ACETYL-LEUKOTRIENE E4 932) NapSul-Ile-Trp-CHO 933) N-ARACHIDONOYLGLYCINE 934) NICARDIPINE 15 935) NIFEDIPINE 936) NIFLUMIC ACID 937) Nigericin 938) NIGULDIPINE 939) Nimesulide 20 940) NIMODIPINE 941) NITRENDIPINE 942) N-LINOLEOYLGLYCINE 943) nocodazole 944) N-PHENYLANTHRANILIC (CL) 25 945) NPPB 946) NS-1619 947) NS-398 948) NSC-95397 949) OBAA 30 950) okadaic acid 951) oligomycin A 952) olomoucine 953) ouabain 954) PAF C16 35 955) PAF C18 956) PAF C18:1 957) PALMITYLETHANOLAMIDE 958) Parthenolide 959) PAXILLINE 40 960) PCA 4248 961) PCO-400 113 WO 2011/150105 PCT/US2011/037969 962) PD 98059 963) PENITREM A 964) pepstatin 965) PHENAMIL 5 966) Phenanthridinone [6(5H)-Phenanthridinone] 967) Phenoxybenzamine 968) PHENTOLAMINE 969) PHENYTOIN 970) PHOSPHATIDIC ACID, DIPALMITOYL 10 971) Piceatannol 972) pifithrin 973) PIMOZIDE 974) PINACIDIL 975) piroxicam 15 976) PP1 977) PP2 978) prazocin 979) Pregnenolone l6alpha carbonitrile 980) PRIMA-1 20 981) PROCAINAMIDE 982) PROPAFENONE 983) propidium iodide 984) propranolol (S-) 985) puromycin 25 986) quercetin 987) QUINIDINE 988) QUININE 989) QX-314 990) rapamycin 30 991) resveratrol 992) RETINOIC ACID, ALL TRANS 993) REV-5901 994) RG-14620 995) RHC-80267 35 996) RK-682 997) Ro 20-1724 998) Ro 31-8220 999) Rolipram 1000) roscovitine 40 1001) Rottlerin 1002) RWJ-60475-(AM)3 114 WO 2011/150105 PCT/US2011/037969 1003) RYANODINE 1004) SB 202190 1005) SB 203580 1006) SB-415286 5 1007) SB-431542 1008) SDZ-201106 1009) S-FARNESYL-L-CYSTEINE ME 1010) Shikonin 1011) siguazodan 10 1012) SKF-96365 1013) SP-600125 1014) SPHINGOSINE 1015) Splitomycin 1016) SQ22536 15 1017) SQ-29548 1018) staurosporine 1019) SU-4312 1020) Suramin 1021) swainsonine 20 1022) tamoxifen 1023) Tanshinone IIA 1024) taxol = paclitaxel 1025) TETRAHYDROCANNABINOL-7-OIC ACID 1026) TETRANDRINE 25 1027) thalidomide 1028) THAPSIGARGIN 1029) Thiocitrulline [L-Thiocitrulline HCl] 1030) Thiorphan 1031) TMB-8 30 1032) TOLAZAMIDE 1033) TOLBUTAMIDE 1034) Tosyl-Phe-CMK (TPCK) 1035) TPEN 1036) Trequinsin 35 1037) trichostatin-A 1038) trifluoperazine 1039) TRIM 1040) Triptolide 1041) TTNPB 40 1042) Tunicamycin 1043) tyrphostin 1 115 WO 2011/150105 PCT/US2011/037969 1044) tyrphostin 9 1045) tyrphostin AG-126 1046) tyrphostin AG-370 1047) tyrphostin AG-825 5 1048) Tyrphostin-8 1049) U-0126 1050) U-37883A 1051) U-46619 1052) U-50488 10 1053) U73122 1054) U-74389G 1055) U-75302 1056) valinomycin 1057) Valproic acid 15 1058) VERAPAMIL 1059) VERATRIDINE 1060) vinblastine 1061) vinpocetine 1062) W7 20 1063) WIN 55,212-2 1064) Wiskostatin 1065) Wortmannin 1066) WY-14643 1067) Xestospongin C 25 1068) Y-27632 1069) YC-1 1070) Yohimbine 1071) Zaprinast 1072) Zardaverine 30 1073) ZL3VS 1074) ZM226600 1075) ZM336372 1076) Z-prolyl-prolinal 1077) zVAD-FMK 35 1078) Ascorbate 1079) 5-azacytidine 1080) 5-azadeoxycytidine 1081) Hexamethylene bisacetamide (HMBA) 1082) Sodium butyrate 40 1083) Dimethyl sulfoxide. 1084) Goosecoid 116 WO 2011/150105 PCT/US2011/037969 1085) Glycogen synthase kinase-3 1086) Galectin-1 1087) Galectin-3 Cell Adhesion Molecules 5 1086) Cadherin 1 (E-Cadherin) 1087) Cadherin 2 (N-Cadherin) 1088) Cadherin 3 (P-Cadherin) 1089) Cadherin 4 (R-Cadherin) 1090) Cadherin 5 (VE-Cadherin) 10 1091) Cadherin 6 (K-Cadherin) 1092) Cadherin 7 1093) Cadherin 8 1094) Cadherin 9 1095) Cadherin 10 15 1096) Cadherin 11 (OB-Cadherin) 1097) Cadherin 12 (BR-Cadherin) 1098) Cadherin 13 (H-Cadherin) 1099) Cadherin 14 (same as Cadherin 18) 1100) Cadherin 15 (M-Cadherin) 20 1101) Cadherin 16 (KSP-Cadherin) 1102) LI Cadherin Table V A set of gene expression markers useful screening for terminal differentiation in human embryonic progenitor 25 cell lines Gene Accession No. Cell Type Present(+)/Absent(-) in hEP Cell Lines COL2A1 NM_001844.3 Chondrocytes COL24A1 NM_152890.4 Osteoblasts low GFAP NM_002055.2 Astrocytes 30 OLIG2 NM_005806.1 Oligodendrocytes PLP1 NM_000533.3 Oligodendrocytes & Schwann cells low PRPH NM_006262.2 Peripheral Neurons low ACTA1 NM_001100.3 Skeletal Myocytes MYF5 NM_005593.1 Skeletal Myocytes 35 DES NM_001927.3 Skeletal Muscle low-med MYHI1 NM_002474.2 Smooth Muscle low-med GCM2 NM_004752.2 Parathyroid VWF NM_000552.2 Endothelial low PECAM1 NM_000442.2 Endothelial low 117 WO 2011/150105 PCT/US2011/037969 LY75 NM_002349.1 Thymus TNMD NM_022144.1 Tendon/Ligament low SCXA NM_001008271 Tendon med 5 TABLE VI Parental hES ACTC No. Cell Line Cell Line Microarray NMF Group NMF Order Cell Lines Synonyms Group Number (WA09 or MA03) MA03 50 B-26 B26 lilumina 1 4 71 MA03 51 B-2 62 lilumina 1 9 69 MA03 52 B-29 B-29 lilumina 1 13 52 MA03 53 B-7 67 lilumina 1 9 68 MA03 54 B-17 B17 lilumina 1 8 54 MA03 55 B-3 63 lilumina 1 4 74 MA03 56 B-6 66 lilumina 1 15 55 MA03 57 B-25 B25 lilumina 1 4 73 MA03 58 B-11 611 lilumina 1 4 72 MA03 59 B-16 B16 lilumina 1 7 65 MA03 60 B-28 B28 lilumina 1 12 84 MA03 61 B-30 B30 lilumina 1 14 25 MA03 62 2-2 2-2 (Rep1), 2-2 lilumina 1 1 89 (Rep1), 90 (Rep2), 2.2 (Rep2) MA03 63 2-1 2.1 lilumina 1 1 88 MA03 64 6-1 6.1 lilumina 1 9 70 MA03 65 B-12 B12 lilumina 1 12 82 MA03 66 B-4 64 lilumina 1 5 83 MA03 67 B-14 B14 lilumina 1 NA NA MA03 68 5-4 5.4 lilumina 1 122 32 MA03 69 4-2 4.2 lilumina 1 11 37 MA03 70 2-3 2.3 lilumina 1 23 94 MA03 71 B-15 B15 lilumina 1 6 22 MA03 72 CM50-4 CM50.4 lilumina 1 NA NA MA03 73 CM0-3 CM0.3 lilumina 1 22 85 MA03 74 CM0-5 CM0.5 lilumina 1 22 86 MA03 75 CM50-5 CM50.5 lilumina 1 22 87 MA03 76 CM50-2 CM50.2 lilumina 1 NA NA MA03 77 CM0-2 CMO.2 lilumina 1 21 49 MA03 78 CM30-2 CM30.2 lilumina 1 10 42 MA03 79 CM20-4 CM20.4 lilumina 1 23 93 MA03 80 E26 E26 lilumina 1 NA NA MA03 81 E71 E71 lilumina 1 NA NA WA09 82 4-D20-9 4-D20-9 lilumina 1 NA NA WA09 83 4-SKEL-19 4-SKEL-19 Affymetrix NA NA WA09 84 4-D20-8 4-D20-8 Affymetrix NA NA MA03 85 E34 E34 Affymetrix NA NA 118 WO 2011/150105 PCT/US2011/037969 MA03 86 E51 E51 Illumina 1 36 24 WA09 87 C4.4 C4.4 Affymetrix NA NA MA03 88 E3 E3 Illumina 1 30 75 MA03 89 E73 E73 Illumina 1 30 80 MA03 90 E93 E93 Illumina 1 NA NA MA03 91 E57 E57 Illumina 1 30 79 WA09 92 C4 ELSR #14 C4 ELSR #14 Illumina 1 NA NA MA03 93 E76 E76 Affymetrix NA NA MA03 94 E17 E17 Illumina 1 NA NA MA03 95 E40 E40 Illumina 1 32 28 MA03 96 E8 E8 Affymetrix NA NA MA03 97 E67 E67 Illumina 1 30 76 MA03 98 E15 E15 Illumina 1 26 26 MA03 99 E45 E45 Illumina 1 34 47 MA03 100 E72 E72 Illumina 1 7 66 MA03 101 E69 E69 Illumina 1 28 16 MA03 102 E75 E75 Illumina 1 7 67 MA03 103 M1o M1o Affymetrix NA NA MA03 104 M13 M13 Affymetrix NA NA MA03 105 E19 E19 Illumina 1 29 27 WA09 106 T44 T44 Illumina1 114 18 MA03 107 E61 E61 Illumina 1 NA NA WA09 108 C4 ELSR #18 C4 ELSR #18 Illumina 1 41 97 WA09 109 RA-SKEL-8 RA-SKEL-8 Illumina 1 78 147 WA09 110 4-SKEL-8 4-SKEL-8 Affymetrix NA NA WA09 111 RA-PEND-15 RA-PEND-15 Illumina 1 NA NA MA03 112 E108 E108 Affymetrix NA NA MA03 113 E35 E35 Illumina 1 NA NA MA03 114 E33 E33 Illumina 1 31 46 MA03 115 E80 E80 Affymetrix NA NA MA03 116 E84 E84 Illumina1 30 78 MA03 117 E109 E109 Affymetrix NA NA WA09 118 C4 ELS5 #6 C4 ELS5 #6 Illumina 1 38 9 MA03 119 J8 J8 Illumina1 65 96 WA09 120 T43 T43 Illumina1 114 17 MA03 121 E10 E10 Illumina 1 NA NA WA09 122 RA-PEND-6 RA-PEND-6 Illumina 1 NA NA WA09 123 RA-PEND-10 RA-PEND-10 Affymetrix NA NA WA09 124 RA-SKEL-3 RA-SKEL-3 Illumina 1 NA NA WA09 125 RA-SKEL-21 RA-SKEL-21 Affymetrix NA NA WA09 126 4-SKEL-4 4-SKEL-4 Affymetrix NA NA WA09 127 4-SKEL-20 4-SKEL-20 Affymetrix NA NA WA09 128 RA-PEND-4 RA-PEND-4 Illumina 1 NA NA WA09 129 RA-PEND-18 RA-PEND-18 Affymetrix NA NA WA09 130 C4 ELS5 #1 C4 ELS5 #1 Illumina 1 16 98 WA09 131 C4 ELSR #12 C4 ELSR #12 Illumina 1 18 99 MA03 132 E163 E163 Illumina 1 NA NA WA09 133 C4 Mesen. #3 C4 Mesen. #3 Illumina 1 20 45 119 WO 2011/150105 PCT/US2011/037969 MA03 134 G6 G6 Illumina 1 NA NA WA09 135 C4 ELS5 #5 C4 ELS5 #5 Illumina 1 17 100 MA03 136 J16 J16 Illumina 1 64 95 WA09 137 SK46 SK46 Illumina1 92 186 WA09 138 SK47 SK47 Illumina1 93 184 WA09 139 EN2 EN2 Illumina 1 47 167 WA09 140 EN26 EN26 Illumina 1 49 160 WA09 141 EN31 EN31 Illumina 1 52 172 WA09 142 SM2 SM2 Illumina 1 98 115 WA09 143 SM4 SM4 Illumina 1 105 109 WA09 144 EN4 EN4 Illumina 1 54 163 WA09 145 ENS ENS Illumina 1 57 162 WA09 146 SK52 SK52 Illumina 1 81 203 WA09 147 SK43 SK43 Illumina 1 81 202 WA09 148 SK30 SK30 Illumina1 88 176 WA09 149 SM42 SM42 Illumina 1 107 116 WA09 150 SM28 SM28 Illumina 1 101 112 WA09 151 SM49 SM49 Illumina 1 109 114 WA09 152 C4 ELSR #10 C4 ELSR #10 Affymetrix NA NA WA09 153 RA-SKEL-11 RA-SKEL-11 Illumina 1 NA NA WA09 154 RA-SMO-12 RA-SMO-12 Illumina 1 NA NA WA09 155 RA-D20-16 RA-D20-16 Illumina 1 72 58 WA09 156 SM22 SM22 Illumina 1 99 110 WA09 157 SK5 SK5 Illumina1 94 148 WA09 158 SK18 SK18 Illumina 1 84 185 WA09 159 SK50 SK50 Illumina 1 81 199 WA09 160 SK54 SK54 Illumina 2 89 135 MA03 161 J4 J4 Illumina 1 NA NA WA09 162 SK17 SK17 Illumina 1 83 3 WA09 163 SK26 SK26 Illumina1 85 198 WA09 164 SK31 SK31 Illumina 2 89 134 WA09 165 SK32 SK32 Illumina1 90 189 WA09 166 SM25 SM25 Illumina 1 100 107 WA09 167 C4 ELSR #2 C4 ELSR #2 Illumina 1 19 102 (Bio 1) (Bio 1) WA09 167 C4 ELSR #2 C4 ELSR #2 Illumina 1 19 103 (Bio 2) (Bio 2) WA09 167 C4 ELSR #2 C4 ELSR #2 Illumina 1 19 101 (Bio 3) (Bio 3) WA09 168 SK3 SK3 Illumina 1 NA NA WA09 169 SK53 SK53 Illumina1 82 193 MA03 170 E44 E44 Illumina 1 33 12 MA03 171 E65 E65 Affymetrix NA NA MA03 172 J13 J13 Illumina 1 63 5 WA09 173 EN1 EN1 Illumina 1 45 154 WA09 174 EN13 EN13 Illumina 1 43 149 WA09 175 EN42 EN42 Illumina 1 55 164 WA09 176 EN47 EN47 Illumina 1 56 152 120 WO 2011/150105 PCT/US2011/037969 WA09 177 SM27 SM27 Illumina 1 NA NA MA03 178 E50 E50 Illumina 1 35 56 MA03 179 E30 (Biol) E30 (Biol) Affymetrix NA NA MA03 179 E30 (Bio2) E30 (Bio2) Illumina 1 30 77 MA03 180 E122 E122 Affymetrix NA NA WA09 181 SK61 SK61 Illumina 1 82 190 WA09 182 SM17 SM17 Illumina 1 96 122 WA09 183 SM33 SM33 Illumina 1 104 125 WA09 184 EN7 EN7 Illumina 1 43 150 WA09 185 EN55 EN55 Illumina 1 61 161 WA09 186 T7 T7 Illumina 2 86 14 WA09 187 EN22 EN22 Illumina 1 NA NA WA09 188 SK58 SK58 Affymetrix NA NA WA09 189 MW2 MW2 Illumina 1 67 187 WA09 190 SK8 SK8 Illumina1 95 195 WA09 191 SK20 SK20 Illumina 1 NA NA WA09 192 SK60 SK60 Illumina 1 82 191 WA09 193 MW6 MW6 Illumina 1 68 188 WA09 194 Z11 (Rep 1) Z11 (Rep 1) Illumina 1 139 104 WA09 194 Zl1 (Rep 2) Zl1 (Rep 2) Illumina 1 139 105 WA09 195 Z6 Z6 Illumina1 138 120 WA09 196 W10 W10 Illumina1 42 166 WA09 197 Wil Wil Illumina1 117 157 WA09 198 T36 T36 Illumina1 113 20 WA09 199 EN27 EN27 Illumina 1 50 159 WA09 200 Z7 Z7 Illumina1 138 118 WA09 201 SM44 SM44 Illumina 1 108 113 WA09 202 EN38 EN38 Illumina 1 53 171 WA09 203 SK1 SK1 Illumina 1 79 182 WA09 204 SK44 SK44 Illumina 1 81 201 WA09 205 SK57 SK57 Illumina1 87 197 MA03 206 J2 J2 Affymetrix NA NA MA03 207 E68 E68 Illumina 1 37 11 MA03 208 E169 E169 Illumina1 28 15 MA03 209 E164 E164 Illumina1 27 53 WA09 210 T42 T42 Illumina1 113 21 WA09 211 T14 T14 Illumina1 111 19 WA09 212 RA-D20-6 RA-D20-6 Affymetrix NA NA WA09 213 Z8 Z8 Illumina1 100 108 WA09 214 SK40 SK40 Illumina 1 91 183 WA09 215 EN1 EN11 Illumina 1 42 165 WA09 216 EN18 EN18 Illumina 1 45 153 WA09 217 EN23 EN23 Illumina 1 NA NA WA09 218 SK14 SK14 Illumina 1 82 192 WA09 219 SK10 SK10 Illumina 1 80 181 WA09 220 EN51 EN51 Illumina 1 59 173 WA09 221 EN16 EN16 Illumina 1 44 158 121 WO 2011/150105 PCT/US2011/037969 MA03 222 E53 E53 Illumina 1 NA NA MA03 223 Ell Ell Illumina1 24 48 WA09 224 SK49 SK49 Illumina 1 NA NA WA09 225 SM8 SM8 Illumina 1 110 106 WA09 226 RA-D20-5 RA-D20-5 Illumina 1 74 57 WA09 227 RA-D20-24 RA-D20-24 Affymetrix NA NA WA09 228 W7 W7 Affymetrix NA NA WA09 229 4-D20-14 4-D20-14 Illumina 1 NA NA WA09 230 RA-D20-19 RA-D20-19 Illumina 1 73 59 WA09 231 T20 T20 Affymetrix NA NA WA09 232 RA-SMO-19 RA-SMO-19 Illumina 1 NA NA MA03 233 M11 M11 Affymetrix NA NA WA09 234 EN9 EN9 Illumina 1 NA NA WA09 235 07 07 Illumina 1 71 194 WA09 236 U31 U31 Illumina 1 116 64 WA09 237 EN19 EN19 Illumina 1 46 175 WA09 238 C4 ELS5 #8 C4 ELS5 #8 Illumina 1 39 8 WA09 239 08 08 Illumina 1 NA NA WA09 240 SK25 SK25 Affymetrix NA NA WA09 241 EN20 EN20 Affymetrix NA NA WA09 242 MW1 MW1 Illumina 2 66 4 WA09 243 C4 ELSR #13 C4 ELSR #13 Illumina 1 40 10 WA09 244 Z3 Z3 Affymetrix NA NA WA09 245 W8 (Rep 1) W8 (Rep 1) Illumina 1 120 151 WA09 245 W8 (Rep 2) W8 (Rep 2) Affymetrix NA NA WA09 246 SK28 SK28 Illumina1 87 196 MA03 247 E120 E120 Illumina1 25 44 WA09 248 SM51 SM51 Illumina 1 NA NA WA09 249 EN8 EN8 Illumina 1 NA NA WA09 250 SK11 SK11 Illumina 1 81 200 WA09 251 EN43 EN43 Affymetrix WA09 252 4-D20-3 4-D20-3 Affymetrix NA NA WA09 253 EN44 EN44 Illumina 1 NA NA WA09 254 EN50 EN50 Illumina 1 58 178 WA09 255 Z2 Z2 Illumina1 140 117 WA09 256 SM30 SM30 Illumina 1 103 124 WA09 257 EN53 EN53 Illumina 1 60 179 WA09 258 SK27 SK27 Illumina 1 86 13 WA09 259 U18 U18 Illumina1 115 62 WA09 260 SM35 SM35 Illumina 1 NA NA WA09 261 EN25 EN25 Illumina 1 48 174 WA09 262 C4 ELSR 6 C4 ELSR 6 Affymetrix NA NA WA09 263 Zi Zi Illumina 1 138 119 MA03 264 F15 F15 Affymetrix NA NA WA09 265 RA-SKEL-9 RA-SKEL-9 Illumina 1 NA NA MA03 266 E85 E85 Affymetrix NA NA WA09 267 W4 W4 Illumina 1 88 177 122 WO 2011/150105 PCT/US2011/037969 WA09 268 MEL-2 MEL-2 Affymetrix NA NA WA09 269 LS2 LS2 Illumina 1 NA NA WA09 270 7-SKEL-4 7-SKEL-4 Illumina 2 129 130 WA09 271 7-SKEL-7 7-SKEL-7 Illumina 2 129 132 WA09 272 7-PEND-9 7-PEND-9 Illumina 2 125 128 WA09 273 7-PEND-16 7-PEND-16 Illumina 2 125 127 WA09 274 7-SKEL-6 7-SKEL-6 Illumina 2 129 131 WA09 275 LS3 LS3 Illumina 1 WA09 276 7-SMOO-19 7-SMOO-19 Illumina 2 131 140 WA09 277 7-SMOO-29 7-SMOO-29 Illumina 2 134 141 WA09 278 7-SMOO-32 7-SMOO-32 Illumina 2 135 136 WA09 279 7-SMOO-33 7-SMOO-33 Illumina 1 NA NA WA09 280 7-SMOO-4 7-SMOO-4 Illumina 1 NA NA WA09 281 7-SMOO-9 7-SMOO-9 Illumina 2 134 142 WA09 282 7-SMOO-17 7-SMOO-17 Illumina 1 NA NA WA09 283 7-PEND-24 7-PEND-24 Illumina 2 124 156 WA09 284 7-SKEL-32 7-SKEL-32 Illumina 1 NA NA WA09 285 7-SMOO-13 7-SMOO-13 Illumina 1 NA NA WA09 286 7-SMOO-25 7-SMOO-25 Illumina 2 132 168 WA09 287 7-SMOO-12 7-SMOO-12 Illumina 2 130 138 WA09 288 7-PEND-30 7-PEND-30 Illumina 2 126 126 WA09 289 7-SKEL-25 7-SKEL-25 Illumina 1 WA09 290 7-SMOO-6 7-SMOO-6 Illumina 2 136 139 WA09 291 7-SMOO-26 7-SMOO-26 Illumina 2 133 137 WA09 292 7-SMOO-22 7-SMOO-22 Illumina 1 NA NA WA09 293 7-SMOO-8 7-SMOO-8 Illumina 1 NA NA WA09 294 7-SKEL-14 7-SKEL-14 Illumina 1 NA NA WA09 295 7-SKEL-11 7-SKEL-11 Illumina 1 NA NA WA09 296 7-SKEL-2 7-SKEL-2 Illumina 2 127 129 WA09 297 7-SKEL-22 7-SKEL-22 Illumina 2 128 133 WA09 298 7-SMOO-7 7-SMOO-7 Illumina 2 137 1 WA09 299 7-PEND-12 7-PEND-12 Illumina 2 124 155 WA09 300 7-SMOO-27 7-SMOO-27 NA NA NA WA09 301 7-PEND-13 7-PEND-13 NA NA NA WA09 302 7-PEND-11 7-PEND-11 NA NA NA WA09 303 7-PEND-15 7-PEND-15 NA NA NA WA09 304 7-PEND-32 7-PEND-32 NA NA NA WA09 305 7-PEND-26 7-PEND-26 NA NA NA WA09 306 7-SKEL-24 7-SKEL-24 NA NA NA WA09 307 7-PEND-10 7-PEND-10 NA NA NA WA09 308 7-PEND-23 7-PEND-23 NA NA NA 309 10-RPE-9 10-RPE-9 NA NA NA 310 10-RPE-8 10-RPE-8 NA NA NA WA09 311 RA-PEND-19 RA-PEND-19 NA NA NA MA03 NA X4.1 X4.1 Illumina 1 3 29 MA03 NA X4.3 X4.3 Illumina 1 3 31 MA03 NA B-10 B-10 Illumina 1 3 30 123 WO 2011/150105 PCT/US2011/037969 MA03 NA B-1 B-1 Illumina 1 2 39 MA03 NA X4 X4 Illumina 1 121 40 MA03 NA X5 X5 Illumina 1 123 81 MA03 NA B-20 B-20 Illumina 1 6 23 MA03 NA B-22 B-22 Illumina 1 10 41 MA03 NA X6 X6 Illumina1 10 43 MA03 NA CM10.1 CM10.1 Illumina 1 11 33 MA03 NA X2 X2 Illumina1 11 34 MA03 NA B-27 B-27 Illumina 1 11 35 MA03 NA B-9 B-9 Illumina 1 11 36 MA03 NA X4.4 X4.4 Illumina 1 11 38 MA03 NA E31 E31 Illumina 1 21 51 MA03 NA CM10-4 CM10-4 Illumina 1 23 91 MA03 NA CM30-5 CM30-5 Illumina 1 23 92 MA03 NA EN28 EN28 Illumina 1 51 170 WA09 NA 04 04 Illumina 1 69 143 WA09 NA 06 06 Illumina 1 70 180 WA09 NA RA-PEND-17 RA-PEND-17 Illumina 1 75 146 (Bio 1) (Bio 1) WA09 NA RA-PEND-17 RA-PEND-17 Affymetrix (Bio 2) (Bio 2) WA09 NA RA-SKEL-18 RA-SKEL-18 Illumina 1 76 144 (Rep 1) (Rep 1) WA09 NA RA-SKEL-18 RA-SKEL-18 Affymetrix NA NA (Rep 2) (Rep 2) WA09 NA RA-SKEL-6 RA-SKEL-6 Illumina 1 77 145 WA09 NA SM19 SM-19 Illumina 1 97 121 WA09 NA SM29 SM-29 Illumina 1 102 111 WA09 NA SM40 SM-40 Illumina 1 106 123 WA09 NA T23 T-23 Illumina 1 112 60 WA09 NA T4 T-4 Illumina 1 112 61 WA09 NA U30 U-30 Affymetrix 116 63 WA09 NA W2 W-2 Illumina 1 118 169 WA09 NA W3 W-3 Illumina 1 119 2 MA03 NA Eli E-11 Illumina 1 21 50 WA09 NA SKi5 SKi5 Affymetrix NA NA MA03 NA E55 E55 Affymetrix NA NA MA03 NA E132 E132 Affymetrix NA NA WA09 NA RA-SMO-10 RASMO10 Affymetrix NA NA WA09 NA RA-SMO-14 RASMO14 Affymetrix NA NA WA09 NA W9 W9 Affymetrix NA NA WA09 NA MW4 MW4 Affymetrix NA NA WA09 NA SK16 SK16 Affymetrix NA NA 124 WO 2011/150105 PCT/US2011/037969 Table VII A comparison of gene expression markers in human adipocyte stem cells (ACSs), human bone marrow mesenchymal stem cells (MSCs), human adult dental pulp stem cells (DPSCs), cultured human foreskin fibroblasts (Fibro), a clonal hEP line not capable of COL2A] induction 7SM007, 5 and the human embryonic progenitors SM30, El5, 4D20.8, 7SM0032, MEL2 and SK 11 each capable of induced COL2A] Expression. Numbers in parenthesis are RFU values. Negative expression indicated by shaded boxes. (ND means No Data) M LO 0 7 0 Gene U) Q) 0 ~ N ** 0 Cj. U) a. .Ir2z SOX9 + (717) + (1128) + (639) +/- (214 + (452) + (250) + (1397) + (269) + (386) + (559) + (322) + (731) LHX8 -(81) - (76) + (987) (84) ND + (1194) -(81) - (73) (79) - (156) - (80) -(93) AQP1 - (108) - (102) - (105) - (105) - (139) - (97) - (106) - (104) - (109) - (97) - (96) - (99) CD1 66 + (1410) + (2901) + (4031) - (125) + (341) + (2921) + (3265) + (2633) + (1852) + (2261) + (1733) + (2315) ENG + (3497) + (5521) + (1296) + (2369) + (453) + (2798) + (2302) + (1856) + (820) + (726) + (1729) + (1026) CD90 + (4739) + (6659) + 16270 +/- (282 + (742) + (3589) + (902) + (788) + (617) - (100) + 13439 + (2801) ITGA2 + (563) + (970) +/- (216) -(131) - (176) -(140) + (426) - (52) - (184) + (505) +/- (280) +/- (276) CD74 + (990) + (5093) +/- (220) (131) - (135) -(88) -(97) -(36) -(108) -(125) - (117) - (150) KCNK2 + (1707) + (2025) + (470) - (107) - (139) - (193) + (382) - (39) - (106) - (108) + (833) + (280) NNAT - (133) - (93) - (166) -(105) + (1090) -(94) -(117) -(100) - (99) -(134) - (101) - (93) 10 Table VIII Exemplary Differentiation Protocols Adipogenesis Protocol 1 Reagents 1. DMEM (GibcoBRL-Cat# 11965-084) 2. Calf Serum (GibcoBRL-Cat#16170-078) 3. Fetal Bovine Serum (GibcoBRL-Cat# 10437-028) 4. Isobutylmethylxanthine (IBMX; Sigma 1-7018) 5. Dexamethasone (Sigma D-4902) 6. Insulin (Bovine; Sigma 1-5500) 7. MEM Sodium Pyruvate (100mM; GibcoBRL Cat#1 1360-070) 8. Pen/Strep/Glutamine (100x P/S/G; GibcoBRL Cat#10378-016) 125 WO 2011/150105 PCT/US2011/037969 Preparation of solutions 1. 10% Calf Serum/DMEM: 60 mL Calf Serum; 6 mL 100 mM MEM Sodium Pyruvate; 6 mL 100x P/S/G; 500 mL DMEM. 2. 10% FBS/DMEM: 60 mL Fetal Bovine Serum (Filter Sterilized); 6 mL 100 mM MEM Sodium Pyruvate; 6 mL 100x P/S/G; 500 mL DMEM. 3. IBMX Solution (make fresh): Dissolve IBMX in a solution made of 0.5N KOH to a final concentration of 0.0115 g/mL; filter sterilize through a 0.22 mm syringe filter. 4. Insulin Stock Solution: 167 iM (1 mg/mL) in 0.02 M HCl; Filter sterilized through 0.22 mm filter; Can store at -20 0 C for long term, 4 0 C short term. 5. Dexamethasone Stock Solutions: Freezer Stock 10 mM of Dex in 100% ethanol (store at -20 0 C); Working Stock: Dilute Freezer stock to 1mM in PBS; Filter sterilize and store at 4 0 C. 6. MDI Induction Media (10 mL/ 10cm plate; 5 mL/ 6 cm plate); To required volume of 10% FBS/DMEM add: 1:100 IBMX; 1:1000 Insulin; 1:1000 Dexamethasone working stock. 7. Insulin Media (10 mL/ 10 cm plate; 5 mL /6 cm plate); To required volume of 10% FBS/DMEM add: 1:100 Insulin (final concentration 10.0 ug/mL). 8. Oil red 0 stock solution (0.5 g/ 100 ml isopropanol); Just before staining: mix 60 ml of stock with 40 ml of H 2 0, let it sit for 1 hr at RT; filter through whatman paper 3MM. Procedures Clonal embryonic Cells are plated in their standard growth media (West et al., 2008, preadipocyte maintenance Regenerative Medicine vol. 3(3) pp. 287-308; see Supplementary and passage Table I) and incubated 37 0 C in 10% CO 2 and preferable in 5% ambient oxygen. Cells are frequently observed to prevent them from becoming too confluent (>70%), until differentiation is induced. Adipocyte Differentiation 1. Grow embryonic preadipocytes to confluency in their standard Protocol growth media (West et al., 2008, Regenerative Medicine vol. 3(3) pp. 287-308). 2. After two days of post confluency (which is counted as day 0), stimulate the cells with MDI induction media. 3. After two days of MDI an induction medium (which is called as day 2) replace the MDI induction media with Insulin Media and feed every two days. Staining procedure 1. Aspirate media, add formaldehyde slowly and let sit for 30 min. 2. Aspirate formaldehyde and add oil red 0 solution to cover the well, leave 1 hr at RT. 3. Remove the stain and wash with distilled water twice. Photograph. 126 WO 2011/150105 PCT/US2011/037969 Adipogenesis Protocol 2 Cells are grown to confluence in their standard growth medium (West et al., 2008, Regenerative Medicine vol. 3(3) pp. 287-308), medium is removed and replaced by serum-free differentiation medium (DMEM/ F12 containing 1 pM bovine insulin, 100 nM hydrocortisone, 10 P g of transferrin/mL, 1 nM thyronine, 1 pM rosiglitazone, 33 pM biotin, and 17 pM pantothenic acid) to induce adipocyte differentiation for 3 d. After 3 d of culture, the medium is changed to differentiation medium without rosiglitazone for another 5 d. The mRNA from cultured cells was extracted at 0, 2, 5, 7 and 14 d of incubation for transcript analysis as described herein. Differentiation Factor Protocol 1 Cells are seeded in a 12 well plate precoated with fibronectin (Gibco) at a high density (1.5 x 106 cells/well). Cells are fed three times per week for 14 days with a basal media of knock out DMEM with penicillin/streptomycin and 16% knock out serum replacement. Individual differentiation factors added to this basal medium chosen from Table III. Control five day quiescent cells are plated at 3.0 x 105 cells/well and at confluence fed media with serum or other growth supplements reduced to 10% of normal values. The cells are refed two days prior to harvest. Angiogenesis Protocols Endothelial Formation The tube formation assay is carried out on 24-well plates previously Protocol (Tube Formation) coated with 250 l of matrigel per well (BD Biosciences, cat. # 356237). The plates are pre-incubated for 30 minutes at 37 0 C before seeding the cells. Subsequently, the cells to be differentiated are seeded at a density of 5x10 4 cells/well in 1 ml of EGM2 media (LONZA cat. # CC-3162). The tube formation assays were analyzed at 24 and 96 hours. Cells are photographed for scoring of the quantity and quality of tube formation as is well-known in the art. RNA is harvested for Q-PCR and microarray analysis of gene expression and markers of endothelial cell differentiation such as the up-regulation of VWF, CDH5 (VE-Cadherin), CD31, KDR, is assayed. Mural Cell Integration into Endothelial tubes are generated as described in Endothelial Endothelial Tube Protocol Formation Protocol (Tube Formation)Above. To measure tube stability and cell integration, 5x10 4 HUVEC or cells of the present invention including but not limited to the cell line W10 or cells with markers thereof, are mixed with 1x10 4 cells that are to be assayed. 127 WO 2011/150105 PCT/US2011/037969 HUVEC or similar cells capable of tube formation are labeled with the red dye PKH26 (Sigma, cat. # MIN126); all other cell lines to be tested for mural cell capacity in this assay are labeled with the green dye PKH2 (Sigma, cat. # PKH2GL-1KT). The cell labeling was performed according to the manufacture's protocol. ). The tube formation and mural integration assays are analyzed at 24 and 96 hours. Fluorescence and transmitted light images were taken at a magnification of 4x using a Nikon Eclipse TE 2000-U microscope equipped with an EXFO X-Cite 120 illumination system. Osteogenic Protocol 1 Tissue culture plates are exposed to 12ug/mL of Type I collagen (gelatin) and 12 ug/mL of vitronectin for 24 hours. This gelatin/vitronectin solution is then aspirated and the cell lines of the present invention are added at confluent density. Osteogenic media comprising: DMEM (low glucose) with L-Glutamine, 10% fetal bovine serum, 0.1 uM dexamethasone, 0.2 mM ascorbic acid 2-phosphate, 10 mM glycerol 2-phosphate, and 100 nM BMP7 is added for 15-21 days. The degree of steogenesis is scored by relative staining with Alizarin red S performed as follows: Alizarin red S (Sigma) (40mM) is prepared in dH 2 0 and the pH is adjusted to 4.1 using 10% (v/v) ammonium hydroxide. Monolayers in 6-well plates (10 cm2/well) are washed with PBS and fixed in 10% (v/v) formaldehyde (Sigma-Aldrich) at room temperature for 15min. The monolayers are then washed twice with excess dH 2 0 prior to addition of 1 mL of 40 mM Alizarin red S (pH 4.1) per well. The plates are incubated at room temperature for 20 min with gentle shaking. After aspiration of the unincorporated dye, the wells are washed four times with 4 mL dH 2 0 while shaking for 5 min. The plates are then left at an angle for 2min to facilitate removal of excess water, reaspirated, and then stored at -20'C prior to dye extraction. Stained monolayers are visual-ized by phase microscopy using an inverted microscope (Nikon). For quantification of staining, 800 uL 10% (v/v) acetic acid is added to each well, and the plate is incubated at room temperature for 30 min with shaking. The monolayer (loosely attached to the plate) is scraped from the plate with a cell scraper (Fisher Lifesciences) and transferred with 10% (v/v) acetic acid to a 1.5-mL microcentrifuge tube with a wide-mouth pipette. After vortexing for 30 s, the slurry is overlaid with 500uL mineral oil (Sigma-Aldrich), heated to exactly 85'C for 10 min, and transferred to ice for 5 min. Care should be taken at this point to avoid opening of the tubes until fully cooled. The slurry is then centrifuged at 20,000g for 15 min and 500 uL of the supernatant is removed to a new 1.5-mL microcentrifuge tube. 200 uL of 10% (v/v) ammonium hydroxide is added to neutralize the acid. The pH can be measured at this point to ensure that it is between 4.1 and 4.5. Aliquots (150 uL) of the supernatant are read in triplicate at 405nm in 96-well format using opaque walled, transparent-bottomed plates (Fisher Lifesciences) as described (Gregory, CA et al, An 128 WO 2011/150105 PCT/US2011/037969 Alizarin red-based assay of mineralization by adherent cells in culture: comparison with cetylpyridinium chloride extraction, Analytical Biochemistry 329 (2004) 77-84). In vitro conditions to induce chondrogenenesis - Pellet Culture. Functional differentiation assays utilizing the cells of the present invention can employ micromass and pellet protocols that are well known in the art as capable of causing bone marrow, adipose, and tooth-derived mesenchymal stem cells to differentiate into chondrogenic lineages. To demonstrate that individual cell lines are capable of differentiating into chondrogenic lineages we assayed by qPCR transcript levels for COL2A1, ACAN, CRTL1, CILP, BGN, and CRTAC1 (CEP-68). In the case of the Chondrogenic Pellet Protocol: 1. Cells are cultured in gelatin (0.1%) coated Corning tissue culture treated cultureware and detached with 0.25% trypsin/EDTA (Invitrogen, Carlsbad, CA, Gibco) diluted 1:3 with PBS (Ca,Mg free). After detachment and addition of growth medium cells are counted using a Coulter counter and appropriate number of cells needed for experiment (e.g. 10x106 or more) are transferred into a sterile polyproylene tube and spun at 150g for 5 min at room temperature. 2. The supernatant is aspirated and discarded. The cells are washed with the addition of Incomplete Chondrogenic Medium consisting of hMSC Chondro BulletKit (PT-3925) to which is added supplements (Lonza, Basel, Switzerland, Poietics Single-Quots, Cat. # PT-4121). Supplements added to prepare Incomplete Chondrogenic Medium are: Dexamethasone (PT-4130G), Ascorbate (PT-4131G), ITS + supplements (4113G), Pyruvate (4114G), Proline (4115G), Gentamicin (4505G), Glutamine (PT-4140G). 3. Cells are spun at 150g at room temperature, the supernatant is aspirated and cell the pellet is resuspended (once more) with 1.0 ml Incomplete Chondrogenic Medium per 7.5 x 1Oe5 cells, and spun at 150 x g for 5 minutes. The supernatant is aspirated and discarded. The Chondrogenesis culture protocol as described by Lonza is followed with some modifications (as written below). 4. Cell pellets are resuspended in Complete Chondrogenic medium to a concentration of 5.0 x 1Oe5 cells per ml. Complete Chondrogenic Medium consists of Lonza Incomplete Medium plus TGFD 3 (Lonza, PT-4124). Sterile lyophilized TGFP3 is reconstituted with the addition of sterile 4mM HCl containing 1mg/ml BSA to a concentration of 20ug/ml and is stored after aliquoting at 80'C. Complete Chondrogenic medium is prepared just before use by the addition of lul of TGFP3 for each 2 ml of Incomplete Chondrogenic medium (final TGFP3 concentration is 1Ong/ml). 5. An aliquot of 0.5 ml (2.5 x 105 cells) of the cell suspension is placed into sterile 15 ml polypropylene culture tubes. Cells are spun at 150 x g for 5 minutes at room temperature. 6. Following centrifugation the caps of the tubes are loosened one half turn to allow gas exchange. The tubes are placed in an incubator at 37'C, in a humidified atmosphere of 10% CO 2 and 5%02. Pellets are not disturbed for 24 hours. 7. Cell pellets are fed every 2-3 days by completely replacing the medium in each tube by 129 WO 2011/150105 PCT/US2011/037969 aspirating the old medium with sterile 1-200 ul pipette tip and adding 0.5 ml of freshly prepared Complete Chondrogenic Medium to each tube. 8. After replacing the medium and ensuring that the pellet is free-floating, caps are loosened and tubes returned to the incubator. 9. Pellets are harvested after varying time points in chondrogenic medium and prepared for histology by fixation with Neutral Buffered Formalin and/or the pellets are combined and prepared for RNA extraction using Rneasy mini Kits (Qiagen, Germantown, MD, Cat. No. 74104). The protocol for RNA extraction is followed as described by the Qiagen Handbook. RNA yield is maximized by using Qiagen's QiaShredder (Cat. # 79654) to homogenize samples following lysis of cell pellets with RLT buffer (provided in Rneasy mini kits) prior to RNA extraction. In vitro conditions to induce chondrogenenesis - Micromass Culture. 1. Cells are cultured in gelatin (0.1%) coated Corning tissue culture treated cultureware and detached with 0.25% trypsin/EDTA (Gibco) diluted 1:3 with PBS (Gibco Ca,Mg free). After detachment and addition of growth medium cells are counted using a Coulter counter and appropriate number of cells needed for experiment (e.g. 10 x106 cells or more) are resuspended at a cell density of 20x 106 cells/ml in growth medium. 2. 1Oul aliquots are seeded onto Corning Tissue Culture Treated Polystyrene plates or dishes. Twenty five or more micromass aliqouts (200,000 cells/lOul aliquot) are seeded. 3. The seeded micromasses are placed in a humidified incubator at 37'C with 5% 02 and 10% CO 2 for 90 minutes to 2 hours for attachment. 4. Growth medium is added and the following morning is replaced, after aspiration and washing with PBS (Ca, Mg free), with Complete Chondrogenic Medium (prepared as described above for the pellet micromasses). For example 6 ml Complete Chondrogenic medium/ 10cm dish is added. Cells are maintainied in a humidified incubator at 37'C with 5% 02, 10% CO 2 and chondrogenic medium replaced with freshly prepared medium every 2-3 days. 5. After varying periods of time in chondrogenic medium RNA is extracted using Qiagen Rneasy kits (Qiagen Cat. No. 74104) as described in the Qiagen Handbook. RNA yield is maximized by using Qiagen's QiaShredder (Cat. # 79654 to homogenize samples following lysis of micromasses with RLT buffer, (which is provided with the Rneasy mini kits) prior to RNA extraction. An alternative to Lonza Chondrogenic medium is CellGro (Cat. No. 15-013-CV) from Media Tech. To each 500ml, the following supplements are added: 5.0 ml Pen/Strep (Gibco Cat. No. 15140), 5.Oml Glutamax (Gibco Cat. No. 35050), Dexamethasone (Sigma, St. Louis, MO, Cat. No.D1756-100) - 500ul of 0.1mM for a final concentration of 0.1 uM; L-Proline (Sigma Cat. No. D49752) -500ul 0.35M for a final concentration of 0.35mM; Ascorbic Acid-2-phosphate (Sigma, Cat. No. 49792, Fluka) -500ul 0.17M for a final concentration 0.17mM; ITS Premix (BD, Franklin Lakes, NJ, sterile Cat. No. 47743-628) -500ul of 1000x concentrate for a final concentration of 130 WO 2011/150105 PCT/US2011/037969 6.25ug/ml insulin, 6.25ug/ml transferrin, 6.25ng/ml selenious acid, serum albumin 1.25mg/mil, 5.35 ug/ml linoleic acid. Following addition of constituents above the media is filtered through a 500 ml Corning 0.2 micron filter unit. As an alternative to Lonza TGFP3 descibed above we use TGFP3 (R&D Systems, Minneapolis MN, Cat. No. 243-B3-010). It is prepared, aliquoted and stored and used similarly to that purchased from Lonza. Differentiation in gels containing crosslinked hyaluronic acid and gelatin The cell lines of the present invention may also be differentiated within hydrogels, including crosslinked gels containing hyaluronic acid and gelatin with or without added factors listed in Table III. Cells are trypsinized and suspended at 1-30 x 10e6 cells/ml HyStem-CSS (Glycosan Hydrogel Kit GS319) according to manufacturers directions. 1. Preparation of HyStem-CSS: HyStem (thiol-modified hyaluranan) is dissolved in 1 ml degassed deionized water (taking about 20 minutes). Gelin-S (thiol modified gelatin) is dissolved in 1 ml degassed deionized water and PEGSSDA (disulfide-containing PEG diacrylate) is dissolved in 0.5 ml degassed deionized water (designated herein as "PEGSSDA solution"). Then HyStem (Imil) is mixed with Gelin-S (Imil) without creating air bubbles, immediately before use (designated herein as "HyStem:Gelin-S mix"). 2. Retinoic acid and EGF-Containing HyStem-CSS: In the case of differentiation in HyStem hydrogel containing RA and EGF, 17 million cells are pelleted and resuspended in 1.4 ml Hystem:Gelin-S mix. Then 0.35ml of PEGSSDA solution is added, pipetted up and down, without creating air bubbles, and 100ul aliquots are quickly placed onto multiple 24 well inserts (Corning Cat #3413). After gelation, in 20 minutes, encapsulated cells are fed 2ml growth media with trans-RA (luM) (Sigma, Cat # 2625) or 2ml growth media with EGF 1Ong/ml (R&D systems Cat# 236-EG). Cells are fed three times weekly. After 28 days, cells are lysed and RNA harvested using RNeasy micro kits (Qiagen Cat # 74004) for qPCR or microarray analysis as described herein. 3. Differentiation in Hydrogels Containing Crosslinked Hyaluronic Acid and Gelatin to Induce Chondrogenesis: Cells are suspended at a density of 20 x 10e6 cells/ml in 1.4 ml Hystem:Gelin-S mix. Then 0.35ml of PEGSSDA solution is added, pipetted up and down, without creating air bubbles, and 100ul aliquots are quickly placed onto multiple 24 well inserts (Corning Cat #3413). After gelation, in 20 minutes, encapsulated cells are fed 2ml Complete Chondrogenic Medium which consists of Lonza Incomplete 131 WO 2011/150105 PCT/US2011/037969 Medium plus TGFP3 (Lonza, PT-4124). Incomplete Chondrogenic Medium consisting of hMSC Chondro BulletKit (PT-3925) to which is added supplements (Lonza, Basel, Switzerland, Poietics Single-Quots, Cat. # PT-4121). Supplements added to prepare Incomplete Chondrogenic Medium are: Dexamethasone (PT-4130G), Ascorbate (PT-4131G), ITS + supplements (4113G), Pyruvate (4114G), Proline (4115G), Gentamicin (4505G), Glutamine (PT-4140G). Sterile lyophilized TGFP3 is reconstituted with the addition of sterile 4mM HCl containing 1mg/nl BSA to a concentration of 20ug/ml and is stored after aliquoting at -80'C. Complete Chondrogenic medium is prepared just before use by the addition of lul of TGFP3 for each 2 ml of Incomplete Chondrogenic medium (final TGFP3 concentration is 1Ong/ml). Cells are refed three times a week and cultured for a total of 14 days. Cells are then lysed and RNA harvested using RNeasy micro kits (Qiagen Cat # 74004). Differentiation of confluent cultures in the presence of EGF Cell of the present invention are grown to confluence in a 10 cm cell culture dish which may take 0.5-2 weeks depending upon the initial seeding density and the rate of growth of the cell line. Cells are fed growth media plus 1OOng/ml EGF when they reach confluence and are fed three times a week. After 28 days, cells are lysed and RNA prepared using RNeasy mini kits (Qiagen Cat #71404). Table IX NHEK Neonatal human epidermal keratinocytes ProbelD RefSeqID Symbol Definition RFU Fold over Homo sapiens kallikrein-related 3170687 NM_012427.4 KLK5 peptidase 5 (KLK5), transcript variant 28663.545 272.19068 1, mRNA. Homo sapiens kallikrein-related 6660274 NM_001077491.1 KLK5 peptidase 5 (KLK5), transcript variant 25306.47 269.60378 2, mRNA. 1050168 NM_002638.2 P13 Homo sapiens peptidase inhibitor 3, 23635.518 207.1987 1 skin-derived (SKALP) (P13), mRNA. 4390398 NM_005564.3 LCN2 Homo sapiens lipocalin 2 (LCN2), 29174.567 201.61773 IIRNA. Homo sapiens kallikrein-related 6020139 NM_005046.2 KLK7 peptidase 7 (KLK7), transcript variant 24452.144 190.39384 1, mRNA. 2140707 NM_003064.2 SLPI Homo sapiens secretory leukocyte 25684.391 175.717 peptidase inhibitor (SLPJ), mRNA. Homo sapiens kallikrein-related 5900008 NM_144947.1 KLK11 peptidase 11 (KLK11), transcript 13663.985 147.80048 variant 2, mRNA. 3710040 NM_006142.3 SFN Homo sapiens stratifin (SFN), mRNA. 14997.135 142.86249 Homo sapiens lectin, galactoside 4220463 NM_002307.1 LGALS7 binding, soluble, 7 (galectin 7) 13794.697 126.36607 (LGALS7), mRNA. 4920040 NM_005218.3 DEFB1 Homo sapiens defensin, beta 1 9942.0035 112.70932 (DEFB3 1), mRNA. Homo sapiens kallikrein-related 2970154 NM_001012964.1 KLK6 peptidase 6 (KLK6), transcript variant 7000.5994 99.983682 B, mRNA. 132 WO 2011/150105 PCT/US2011/037969 Homo sapiens serpin peptidase 6290707 NM_002639.3 SERPINB5 inhibitor, clade B (ovalbumin), 9337.8811 97.442505 member 5 (SERPIINB5), mRNA. Homo sapiens interleukin 1 receptor 7510386 NM_173843.1 ILIRN antagonist (IL1RN), transcript variant 8983.3292 95.20599 4, mRNA. 1170349 NM_005558.3 LADI Homo sapiens ladinin 1 (LADI), 14006.772 78.260091 mRNA. 1190131 NM_032572.2 RNASE7 Homo sapiens ribonuclease, RNase A 4305.8224 71.751095 family, 7 (RNASE7), mRNA. 5080139 NM_002771.2 PRSS3 Homo sapiens protease, series, 3 5908.2373 63.615992 (mesotrypsin) (PRSS3), mRNA. Homo sapiens kallikrein-related 6620427 NM_012427.4 KLK5 peptidase 5 (KLK5), transcript variant 3863.586 61.158976 1, mRNA. 2140131 NM_001264.3 CDSN Homo sapiens corneodesmosin 4052.9354 59.87187 (CDSN), inRNA. Homo sapiens serpin peptidase 6350209 NM_002575.1 SERPINB2 inhibitor, clade B (ovalbumin), 7188.0348 59.432694 member 2 (SERPINB2), mRNA. 6940598 NM_145652.2 WFDC5 Homo sapiens WAP four-disulfide 3367.8413 58.521206 core domain 5 (WFDCS), mRNA. 4010491 XM_001129442.1 CST6 PREDICTED: Homo sapiens cystatin 5190.7212 56.762909 E/M (CST6), mRNA. Homo sapiens kallikrein-related 3840010 NM_007196.2 KLK8 peptidase 8 (KLK8), transcript variant 3624.6171 54.699877 1, mRNA. Homo sapiens kallikrein-related 5960192 NM_002776.4 KLK1O peptidase 10 (KLK1O), transcript 3802.9105 51.608777 variant 1, mRNA. 1070333 NM_001323.2 CST6 Homo sapiens cystatin E/M (CST6), 4175.0556 47.073488 IIRNA. 990372 NM_000494.3 COL17A1 Homo sapiens collagen, type XVII, 4509.0335 43.308003 alpha 1 (COL17A1), mRNA. 6480592 NM_198129.1 LAMA3 Homo sapiens laminin, alpha 3 4031.9264 41.333333 (LAMA3), transcript variant 1, mRNA. 43196 1333 Homo sapiens crumbs homolog 3 7400524 NM_139161.2 CRB3 (Drosophila) (CRB3), transcript 4001.037 38.696075 variant 2, mRNA. 1230228 NM_013404.3 MSLN Homo sapiens mesothelin (MSLN), 4084.0186 37.970319 transcript variant 2, mRNA. Homo sapiens interleukin 1 family, 1240528 NM_173170.1 IL1F5 member 5 (delta) (IL1F5), transcript 2208.6037 37.242107 variant 2, mRNA. 5870136 NM_004669.2 CLIC3 Homo sapiens chloride intracellular 9848.3735 32.907079 1 channel 3 (CLIC3), mRNA. 4010181 NM_000804.2 FOLR3 Homo sapiens folate receptor 3 2257.6414 28.518472 (gamma) (FOLR3), mRNA. Homo sapiens Ly6/neurotoxin 1 1850541 NM_177458.1 LYNX1 (LYNX1), transcript variant SLURP2, 1801.1529 26.887828 mRNA. 2120270 NM_000494.3 COL17A1 Homo sapiens collagen, type XVII, 1788.1525 25.425555 alpha 1 (COL17A1), mRNA. Homo sapiens crumbs homolog 3 4670402 NM_174881.2 CRB3 (Drosophila) (CRB3), transcript 2293.9631 24.958006 variant 3, mRNA. Homo sapiens seine peptidase 6380707 NM_006846.2 SPINK5 inhibitor, Kazal type 5 (SPINK5), 1972.9324 24.836288 mRNA. 133 WO 2011/150105 PCT/US2011/037969 Homo sapiens proline-rich protein 4010224 NM_199353.1 PRB1 BstNI subfamily 1 (PRB1), transcript 1602.4678 23.346259 variant 2, mRNA. 2650612 NM_198129.1 LAMA3 Homo sapiens laminin, alpha 3 1631.0776 21.589169 (LAMA3), transcript variant 1, mRNA. 1430477 NM_001333.2 CTSL2 Homo sapiens cathepsin L2 (CTSL2), 4608.6774 21.247247 mRNA. 7210139 NM_002773.3 PRSS8 Homo sapiens protease, serine, 8 2764.6522 20.363669 (PRSS8), mRNA. 2710070 NM_024794.1 ABHD9 Homo sapiens abhydrolase domain 2162.0329 19.770411 containing 9 (ABHD9), mRNA. 730040 NM_000228.2 LAMB3 Homo sapiens laminin, beta 358.04 1.962 (LAMB3), transcript variant 1, mRNA. 5875.8047 18.916112 6660435 NM_003236.1 TGFA Homo sapiens transforming growth 2152.4698 18.323993 factor, alpha (TGFA), mRNA. 4250259 NM_001942.2 DSG1 Homo sapiens desmoglein 1 (DSG1), 1048.5971 16.008546 IIRNA. 7200324 NM_001185.2 AZGP1 Homo sapiens alpha-2-glycoprotein 1, 1297.5647 15.382046 zinc-binding (AZGP1), mRNA. 580324 NM_080869.1 WFDC12 Homo sapiens WAP four-disulfide 780.23083 15.156245 core domain 12 (WFDC12), mRNA. 78.33 15564 Homo sapiens 4010392 NM_174932.1 BPIL2 bactericidal/permeability-increasing 799.18584 14.42805 protein-like 2 (BPIL2), mRNA. 3710397 NM_004428.2 EFNA1 Homo sapiens ephrin-Al (EFNA1), 4294.1202 14.364293 transcript variant 1, mRNA. Homo sapiens regulator of G-protein 6400403 NM_170587.1 RGS20 signaling 20 (RGS20), transcript 2529.0429 13.796543 variant 1, mRNA. Homo sapiens 1070400 NM_153282.1 HYAL1 hyaluronoglucosaminidase 1 1425.6857 13.47488 (HYAL1), transcript variant 2, mRNA. 3940132 NM_001005619.1 ITGB4 Homo sapiens integrin, beta 4 2193.146 12.971441 (ITGB4), transcript variant 2, mRNA. 3390187 NM_004428.2 EFNA1 Homo sapiens ephrin-Al (EFNA1), 1184.2015 12.859628 transcript variant 1, mRNA. 3190121 NM_177964.3 LOC130576 Homo sapiens hypothetical protein 1476.9865 12.512142 L0C130576 (L0C130576), mRNA. 14695 12112 6840154 NM_002407.1 SCGB2A1 Homo sapiens secretoglobin, family 665.3208 12.368277 2A, member 1 (SCGB2A1), mRNA. Homo sapiens kallikrein-related 1430603 NM_144505.1 KLK8 peptidase 8 (KLK8), transcript variant 726.70029 12.24871 2, mRNA. Homo sapiens proline-rich protein 1660358 NM_199354.1 PRB1 BstNI subfamily 1 (PRB1), transcript 762.35634 11.975599 variant 3, mRNA. Homo sapiens 630315 NM_005771.3 DHRS9 dehydrogenase/reductase (SDR family) 1390.9754 11.737302 member 9 (DHRS9), transcript variant 1, mRNA. Homo sapiens FXYD domain 5390240 NM_021910.1 FXYD3 containing ion transport regulator 3 631.69543 11.304237 (FXYD3), transcript variant 2, mRNA. Homo sapiens Cas-Br-M (murine) 3870471 NM_012116.2 CBLC ecotropic retroviral transforming 745.09897 10.534748 sequence c (CBLC), mRNA. Homo sapiens seine peptidase 5860767 NM_003710.3 SPINTI inhibitor, Kunitz type 1 (SPINTI), 946.79631 10.212331 transcript variant 2, mRNA. 134 WO 2011/150105 PCT/US2011/037969 Homo sapiens interleukin 1 receptor 6020300 NM_003856.2 ILIRLI like 1 (ILIRLI), transcript variant 2, 1014.0296 9.7860641 mRNA. 940327 NM_015596.1 KLK13 Homo sapiens kallikrein-related 492.47743 9.6861549 peptidase 13 (KILK13), mRNA. 1300187 NM_138412.2 RDH13 13 sapiens rtino RehydrogenAse 1757.0146 9.5424634 5910528 NM_001374.2 DNASE1L2 Homo sapiens deoxyribonuclease I- 668.81844 9.4568415 like 2 (DNASE1L2), mRNA. 5490019 NM_002084.3 GPX3 Homo sapiens glutathione peroxidase 3 3220.0619 9.2529103 (plasma) (GPX3), mRNA. 3850451 NM_145650.2 MUC15 Homo sapiens mucin 15, cell surface 548.46991 9.212607 associated (MUC 15), mRNA. 1570598 NM_001005731.1 ITGB4 Homo sapiens integrin, beta 4 1108.6476 8.9029207 (ITGB4), transcript variant 3, mRNA. Homo sapiens FXYD domain 2060687 NM_005971.2 FXYD3 containing ion transport regulator 3 506.43046 8.8231949 (FXYD3), transcript variant 1, mRNA. 4290397 NM_031246.1 PSG2 Homo sapiens pregnancy specific beta- 479.43555 8.7505164 1-glycoprotein 2 (PSG2), mRNA. 4120243 NM_002784.2 PSG9 Homo sapiens pregnancy specific beta- 775.82183 8.4022808 1-glycoprotein 9 (PSG9), mRNA. Homo sapiens pregnancy specific beta 1690095 NM_002782.3 PSG6 1-glycoprotein 6 (PSG6), transcript 564.29535 8.1573247 variant 1, mRNA. Homo sapiens kallikrein-related 4230221 NM_005046.2 KLK7 peptidase 7 (KLK7), transcript variant 492.3118 8.0260751 1, mRNA. Homo sapiens pregnancy specific beta 5960392 NM_001031850.2 PSG6 1-glycoprotein 6 (PSG6), transcript 614.23894 7.9743613 variant 2, mRNA. 6550500 NM_002963.3 S100A7 Homo sapiens S100 calcium binding 401.84779 7.9518312 protein A7 (S1I00A7), mRNA. 3850561 NM_144504.1 F11R Homo sapiens F1I receptor (F11R), 868.04351 7.735802 transcript variant 5, mRNA. Homo sapiens carboxylesterase 2 3520372 NM_003869.4 CES2 (intestine, liver) (CES2), transcript 6596.8294 7.7330167 variant 1, mRNA. 6400598 NM_001956.2 EDN2 Homo sapiens endothelin 2 (EDN2), 475.54233 7.6745046 mRNA. 7210681 NM_006033.2 LIPG Homo sapiens lipase, endothelial 1527.1653 7.5692932 1 - (LJPG), mRNA. 2640307 NM_006249.4 PRB3 Homo sapiens proline-rich protein 460.39757 7.2568842 BstNJ subfamily 3 (PRB33), mRNA. Homo sapiens v-erb-b2 erythroblastic 4560288 NM_001982.2 ERBB3 leukemia viral oncogene homolog 3 704.98584 7.1608589 (avian) (ERBB3), transcript variant 1, mRNA. 5890689 NM_019618.2 IL1F9 Homo sapiens interleukin 1 family, 396.16062 7.0293322 member 9 (W1IF9), mRNA. Homo sapiens 7160468 NM_005771.3 DHRS9 dehydrogenase/reductase (SDR family) 473.19521 6.83716 member 9 (DHRS9), transcript variant 1, mRNA. Homo sapiens 5'-nucleotidase, 3940520 NM_001002010.1 NT5C3 cytosolic III (NT5C3), transcript 7749.8165 6.8368492 variant 1, mRNA. Homo sapiens lymphocyte antigen 6 1690685 NM_025261.1 LY6G6C complex, locus G6C (LY6G6C), 494.74499 6.8048958 mRNA. 135 WO 2011/150105 PCT/US2011/037969 Homo sapiens FXYD domain 6760440 NM_005971.2 FXYD3 containing ion transport regulator 3 363.5073 6.6373909 (FXYD3), transcript variant 1, mRNA. Homo sapiens prostaglandin 1820632 NM_000963.1 PTGS2 endoperoxide synthase 2 4874.8898 6.4245455 (prostaglandin G/H synthase and cyclooxygenase) (PTGS2), mRNA. 1430332 NM_030916.1 PVRL4 Homo sapiens poliovirus receptor- 373.17198 6.4136268 143032 M_009161 PRL4related 4 (PVRL4), mRNA. Homo sapiens interleukin 1 receptor 5420754 NM_003856.2 ILIRLI like 1 (ILIRLI), transcript variant 2, 615.42168 6.3531476 mRNA. 5220035 NM_020127.1 TUFTI Homo sapiens tuftelin 1 (TUFTI), 4515.7484 6.319479 mRNA. 4480292 NM_002781.2 PSG5 Homo sapiens pregnancy specific beta- 342.71991 6.2678036 1-glycoprotein 5 (PSGS), mRNA. Homo sapiens wingless-type MMTV 3870131 NM_004625.3 WNT7A integration site family, member 7A 376.31785 6.2310202 (WNT7A), mRNA. Homo sapiens protease, seine, 2 2690452 NM_002770.2 PRSS2 (trypsin 2) (PRSS2), transcript variant 430.51372 6.1914702 1, mRNA. Homo sapiens pregnancy specific beta 3400474 NM_002780.3 PSG4 1-glycoprotein 4 (PSG4), transcript 842.09041 6.1522266 variant 1, mRNA. 630619 NM_006665.3 HPSE Homo sapiens heparanase (HPSE), 397.3691 6.0446929 mRNA. Homo sapiens 1980300 NM_153283.1 HYAL1 hyaluronoglucosaminidase 1 354.27094 5.7228221 (HYAL1), transcript variant 3, mRNA. 6590592 NM_001006946.1 SDC1 Homo sapiens syndecan 1 (SDC1), 5016.3389 5.6975523 transcript variant 1, mRNA. 2810673 NM_152739.3 HOXA9 Homo sapiens homeobox A9 801.17065 5.6618673 (HOXA9), mRNA. 2510152 NM_001005502.1 CPM Homo sapiens carboxypeptidase M 409.40487 5.6290324 (CPM), transcript variant 3, mRNA. Homo sapiens coxsackie virus and 870161 NM_001338.3 CXADR adenovirus receptor (CXADR), 1820.0662 5.6028145 mRNA. Homo sapiens interleukin 1 family, 6350593 NM_173161.1 ILIF1O member 10 (theta) (ILIF1O), transcript 302.65428 5.5769102 variant 2, mRNA. 4640133 NM_014069.1 PSORS1C2 Homo sapiens psoriasis susceptibility 1 317.78658 5.2369797 candidate 2 (PSORS1C2), mnRNA. Homo sapiens seine peptidase 1710468 NM_003710.3 SPINTI inhibitor, Kunitz type 1 (SPINTI), 339.47227 5.0491224 transcript variant 2, mRNA. Homo sapiens epidermal growth factor 1050671 NM_005228.3 EGFR receptor (erythroblastic leukemia viral 1858.5518 5.0279033 (v-erb-b) oncogene homolog, avian) (EGFR), transcript variant 1, mRNA. 5390128 NM_018176.2 LGI2 Homo sapiens leucine-rich repeat LGI 402.46372 5.0008655 family, member 2 (LGJ2), mRNA. 5090671 NM_004864.1 GDF15 Homo sapiens growth differentiation 3936.2158 4.7575265 factor 15 (GDF1S), mRNA. Homo sapiens phospholipase A2, 3390438 NM_005084.2 PLA2G7 group VII (platelet-activating 267.32869 4.6208078 acetylhydrolase, plasma) (PLA2G7), 26.8946007 mRNA. 136 WO 2011/150105 PCT/US2011/037969 1980288 NM_004390.2 CTSH Homo sapiens cathepsin H (CTSH), 1793.3344 4.6033965 transcript variant 1, mRNA. Homo sapiens mitogen-activated 1440440 NM_004635.3 MAPKAPK3 protein kinase-activated protein kinase 4829.81 4.4954061 3 (MAPKAPK3), mRNA. 2140678 NM_000210.2 ITGA6 Homo sapiens integrin, alpha 6 515.05841 4.2262846 (ITGA6), transcript variant 2, mRNA. 7040386 NM_001955.2 EDNI Homo sapiens endothelin 1 (EDNI), 2196.218 4.1448561 mRNA. Homo sapiens poliovirus receptor 1740592 NM_203286.1 PVRL1 related 1 (herpesvirus entry mediator 326.87891 4.0056079 C) (PVRL1), transcript variant 3, mRNA. 3840240 NM_012315.1 KLK9 Homo sapiens kallikrein-related 198.54432 3.9491432 peptidase 9 (KLK9), mRNA. 4390100 NM_005562.1 LAMC2 Homo sapiens laminin, gamma 2 4169.3878 3.919975 (LAMC2), transcript variant 1, mRNA. Homo sapiens interleukin 18 4810474 NM_001562.2 IL18 (interferon-gamma-inducing factor) 13462.134 3.9103414 (IL18), mRNA. 2030524 NM_000729.3 CCK Homo sapiens cholecystokinin (CCK), 209.99358 3.8949141 mRNA. 6370369 NM_001040021.1 CD14 Homo sapiens CD14 molecule (CD14), 414.6233 3.8449218 transcript variant 2, mRNA. Homo sapiens pregnancy specific beta 4210500 NM_002780.3 PSG4 1-glycoprotein 4 (PSG4), transcript 1020.3574 3.8278737 variant 1, mRNA. 4280273 NM_000405.3 GM2A Homo sapiens GM2 ganglioside 714.49233 3.8263768 activator (GM2A), mRNA. Homo sapiens interleukin 28 receptor, 3520398 NM_170743.2 IL28RA alpha (interferon, lambda receptor) 276.63097 3.8208917 (IL28RA), transcript variant 1, mRNA. Homo sapiens hydroxysteroid (17 1450397 NM_014234.3 HSD17B8 beta) dehydrogenase 8 (HSD17B8), 826.85339 3.7801423 mRNA. 50626 NM_015715.3 PLA2G3 Homo sapiens phospholipase A2, 365.78075 3.7626423 group III (PLA2G3), mRNA. Homo sapiens crumbs homolog 3 3130561 NM_139161.2 CRB3 (Drosophila) (CRB3), transcript 202.48038 3.7330275 variant 2, mRNA. 4730242 NM_175885.3 MGC33846 Homo sapiens hypothetical protein 213.96829 3.630171 MGC33846 (MGC33846), mRNA. Homo sapiens pregnancy specific beta 5690681 NM_002780.3 PSG4 1-glycoprotein 4 (PSG4), transcript 310.65487 3.6227549 variant 1, mRNA. Homo sapiens 4490079 NM_005771.3 DHRS9 dehydrogenase/reductase (SDR family) 195.25649 3.5837297 member 9 (DHRS9), transcript variant 1, mRNA. Homo sapiens CUB domain containing 5260367 NM_022842.3 CDCP1 protein 1 (CDCP1), transcript variant 1374.6552 3.5723506 1, mRNA. 1940128 NM_013962.2 NRG1 Homo sapiens neuregulin 1 (NRG1)' 506.69233 3.5582575 _________________________________transcript variant GGF2, mRNA. Homo sapiens chromosome Y open 7150066 NR_001544.1 CYorfl4 reading frame 14 (CYorfl4) on 256.42832 3.5369683 chromosome Y. 137 WO 2011/150105 PCT/US2011/037969 Homo sapiens Notch homolog 1, 5080167 NM_017617.3 NOTCHI translocation-associated (Drosophila) 1370.5479 3.5347199 (NOTCH1), mRNA. Homo sapiens CUB domain containing 60215 NM_178181.1 CDCP1 protein 1 (CDCP1), transcript variant 1075.0832 3.5264342 2, mRNA. Homo sapiens tweety homolog 1 50719 NM_020659.2 TTYH1 (Drosophila) (TTYH1), transcript 315.92581 3.5211346 variant 1, mRNA. 4850762 NM_153714.1 Cl0orf67 Homo sapiens chromosome 10 open 323.14594 3.4799814 reading frame 67 (C100rf67), mRNA. 4540215 NM_012168.4 FBXO2 Homo sapiens F-box protein 2 583.28097 3.4631581 (FBXO2), mRNA. 1940438 NM_002632.4 PGF Homo sapiens placental growth factor 449.79513 3.4264269 (PGF), mRNA. 4920121 NM_024712.3 ELMO3 Homo sapiens engulfment and cell 275.83451 3.4077981 motility 3 (ELMO3), mRNA. Homo sapiens sema domain, 5690167 NM_004186.2 SEMA3F immunoglobulin domain (Ig), short 471.75723 3.3938822 basic domain, secreted, (semaphorin) 3F (SEMA3F), mRNA. Homo sapiens ADAM 3440452 NM_207195.1 ADAM15 metallopeptidase domain 15 8679.3746 3.3868082 (ADAM15), transcript variant 4, mRNA. Homo sapiens pregnancy specific beta 6550563 NM_002782.3 PSG6 1-glycoprotein 6 (PSG6), transcript 175.48407 3.3554821 variant 1, mRNA. 7050220 NM_006681.1 NMU Homo sapiens neuromedin U (NMU), 407.96062 3.26015 IIRNA. Homo sapiens tweety homolog 1 3170047 NM_001005367.1 TTYH1 (Drosophila) (TTYH1), transcript 210.40088 3.2447942 variant 2, mRNA. 4280577 NM_001200.2 BMP2 Homo sapiens bone morphogenetic 729.95236 3.2353662 protein 2 (BMP2), mRNA. Homo sapiens Rho guanine nucleotide 3850333 NM_015320.2 ARHGEF4 exchange factor (GEF) 4 (ARHGEF4), 355.34558 3.2107065 transcript variant 1, mRNA. Homo sapiens ADAM 1980553 NM_003815.3 ADAM15 metallopeptidase domain 15 840.11549 3.1858186 (ADAM15), transcript variant 2, mRNA. 520682 NM_016352.2 CPA4 Homo sapiens carboxypeptidase A4 4628.5878 3.1759943 (CPA4), mRNA. Homo sapiens biliverdin reductase B 6620521 NM_000713.1 BLVRB (flavin reductase (NADPH)) 790.616 3.1588873 (BLVRB), mRNA. Homo sapiens carboxyl ester lipase 6650593 NM_001807.3 CEL (bile salt-stimulated lipase) (CEL), 373.00619 3.1211058 mRNA. 4280131 NM_001729.1 BTC Homo sapiens betacellulin (BTC), 189.31534 3.1120787 IIRNA. Homo sapiens immunoglobulin 7650767 NM_020789.2 IGSF9 superfamily, member 9 (IGSF9), 202.2823 3.1003966 mRNA. Homo sapiens parathyroid hormone 6900414 NM_198965.1 PTHLH like hormone (PTHLH), transcript 942.50546 3.0657657 variant 1, mRNA. 138 WO 2011/150105 PCT/US2011/037969 Homo sapiens cytochrome P450, 4860307 NM_000772.1 CYP2C18 family 2, subfamily C, polypeptide 18 176.96593 3.0527722 (CYP2C18), mRNA. Homo sapiens carboxylesterase 2 3850471 NM_003869.4 CES2 (intestine, liver) (CES2), transcript 435.27006 3.0349374 variant 1, mRNA. 5670162 NM_153324.2 DEFB123 Homo sapiens defensin, beta 123 206.6056 2.9983718 (DEFB 123), mRNA. Homo sapiens v-erb-b2 erythroblastic 3120608 NM_001005915.1 ERBB3 leukemia viral oncogene homolog3 250.07257 2.9969139 (avian) (ERBB3), transcript variant s, mRNA. 650561 NM_002257.2 KLK1 Homo sapiens kallikrein 1 (KLK1), 248.40885 2.9878114 mRNA. Homo sapiens glucosidase, beta; acid 4780133 NM_001005742.1 GBA (includes glucosylceramidase) (GBA), 3486.8534 2.9846767 transcript variant 3, mRNA. 50307 NM_016946.3 F11R Homo sapiens F1I receptor (F11R), 207.25634 2.9839633 transcript variant 1, mRNA. 3440630 NM_031475.1 ESPN Homo sapiens espin (ESPN), mRNA. 211.08673 2.9583995 Homo sapiens UDP-N-acetyl-alpha-D 4490164 NM_007210.3 GALNT6 galactosamine:polypeptide N- 384.36667 2.8941383 acetylgalactosaminyltransferase 6 (GalNAc-T6) (GALNT6), mRNA. 2120091 NM_004942.2 DEFB4 Homo sapiens defensin, beta 4 159.8674 2.8626171 (DEFB4), mRNA. Homo sapiens regulator of G-protein 4070215 NM_002926.3 RGS12 signaling 12 (RGS12), transcript 1167.2288 2.85851 variant 2, mRNA. Homo sapiens endoplasmic reticulum 3290008 NM_152461.2 ERNI to nucleus signalling 1 (ERNI), 543.32979 2.8553203 transcript variant 2, mRNA. Homo sapiens lymphotoxin beta 4640064 NM_002342.1 LTBR receptor (TNFR superfamily, member 1767.2189 2.8522127 3) (LTBR), mRNA. 6450482 NM_014432.2 IL20RA Homo sapiens interleukin 20 receptor, 218.07345 2.8459077 alpha (JL2ORA), mRNA. 610291 NM_005577.2 LPA Homo sapiens lipoprotein, Lp(a) 170.23024 2.8406176 (LPA), mRNA. 5570053 NM_002587.3 PCDH1 Homo sapiens protocadherin1 179.30553 2.8107571 (PCDH1), transcript variant 1, mRNA. 17.05 28051 Homo sapiens extracellular matrix 3450521 NM_022664.1 ECM1 protein 1 (ECM1), transcript variant 2, 1510.2886 2.8080108 mRNA. 3130082 NM_005558.3 LADI Homo sapiens ladinin 1 (LADI), 146.85383 2.779581 IIRNA. Homo sapiens parathyroid hormone 1980593 NM_198964.1 PTHLH like hormone (PTHLH), transcript 510.18584 2.7723514 variant 3, mRNA. Homo sapiens kallikrein-related 2690647 NM_144947.1 KLK11 peptidase 11 (KLK11), transcript 188.84189 2.7562149 variant 2, mRNA. Homo sapiens transmembrane 5960091 NM_019894.2 TMPRSS4 protease, seine 4 (TMPRSS4), 220.58953 2.7496886 transcript variant 1, mRNA. Homo sapiens ADAM 1570435 NM_139057.2 ADAMTS17 metallopeptidase with thrombospondin 191.56401 2.710937 type 1 motif, 17 (ADAMTS 17), mRNA. 139 WO 2011/150105 PCT/US2011/037969 6760253 NM_002783.1 PSG7 Homo sapiens pregnancy specific beta- 175.48407 2.6863148 1-glycoprotein 7 (PSG7), mRNA. 3180195 NM_023004.5 RTN4R Homo sapiens reticulon 4 receptor 226.35295 2.658603 (RTN4R), mRNA. Homo sapiens wingless-type MMTV 2710343 NM_025216.2 WNT1OA integration site family, member 1OA 170.23024 2.6245784 (WNT1OA), mRNA. 4290201 NM_006850.2 IL24 Homo sapiens interleukin 24 (IL24), 161.39528 2.6219705 transcript variant 1, mRNA. Homo sapiens peptidoglycan 730167 NM_020393.2 PGLYRP4 recognition protein 4 (PGLYRP4), 204.78805 2.6085906 mRNA. Homo sapiens acyl-CoA synthetase 1030431 NM_001995.2 ACSL1 long-chain family member 1 (ACSL1), 883.53392 2.6017885 mRNA. Homo sapiens interleukin 1 receptor 1260747 NM_173843.1 ILIRN antagonist (ILIRN), transcript variant 171.47478 2.6000966 4, mRNA. Homo sapiens ribosomal protein S6 2350538 NM_003952.2 RPS6KB2 kinase, 70kDa, polypeptide 2 3950.827 2.5939383 (RPS6KB2), mRNA. 5870685 NM_000565.2 IL6R Homo sapiens interleukin 6 receptor 140.42906 2.5340564 (IL6R), transcript variant 1, mRNA. 2600170 NM_003561.1 PLA2G1O Homo sapiens phospholipase A2, 166.30302 2.5071143 group X (PLA2G 10), mRNA. Homo sapiens interleukin 1 family, 6660537 NM_173204.1 IL1F7 member 7 (zeta) (IL1F7), transcript 124.75192 2.5009563 variant 4, mRNA. 5420343 NM_007348.2 ATF6 Homo sapiens activating transcription 2288.9096 2.4486524 factor 6 (ATF6), mRNA. 5870639 NM_014907.1 FRMPD1 Homo sapiens FERM and PDZ domain 204.04587 2.4290953 containing 1 (FRMPD1), mRNA. Homo sapiens nudix (nucleoside 110092 NM_177533.2 NUDT14 diphosphate linked moiety X)-type 1653.8395 2.4229472 motif 14 (NUDT14), mRNA. 430768 NM_005865.2 PRSS16 Homo sapiens protease, shrine, 16 165.19145 2.4110484 (thymus) (PRSS 16), mRNA. Homo sapiens ClpX caseinolytic 6760050 NM_006660.3 CLPX peptidase X homolog (E. coli) (CLPX), 1323.6066 2.4027719 mRNA. Homo sapiens chromosome 6 open 1190082 NM_001040437.1 C6orf48 reading frame 48 (C6orf48), transcript 259.94263 2.3866145 variant 1, mRNA. Homo sapiens SLIT-ROBO Rho 2470220 NM_020762.1 SRGAP1 GTPase activating protein 1 781.21453 2.3759958 (SRGAP1), mRNA. Homo sapiens kallikrein-related 460202 NM_001030050.1 KLK3 peptidase 3 (KLK3), transcript variant 473.19521 2.3711219 6, mRNA. Homo sapiens cathelicidin 5860075 NM_004345.3 CAMP antimicrobial peptide (CAMP), 141.83355 2.3611294 mRNA. Homo sapiens sterol regulatory 3390343 NM_001005291.1 SREBF1 element binding transcription factor 1 661.60678 2.3524284 (SREBF1), transcript variant 1, mRNA. Homo sapiens v-maf 3610440 NM_005360.3 MAF musculoaponeurotic fibrosarcoma 853.16799 2.3400224 oncogene homolog (avian) (MAF), transcript variant 1, mRNA. 140 WO 2011/150105 PCT/US2011/037969 Homo sapiens sema domain, immunoglobulin domain (Ig), 5080280 NM_198925.1 SEMA4B transmembrane domain (TM) and short 1298.8016 2.3271338 cytoplasmic domain, (semaphorin) 4B (SEMA4B), transcript variant 2, mRNA. 2230594 NM_005562.1 LAMC2 Homo sapiens laminin, gamma 2 845.37758 2.279901 (LAMC2), transcript variant 1, mRNA. 4780671 NM_014584.1 ERO1L Homo sapiens EROl-like (S. 1742.7711 2.219169 cerevisiae) (ERO1L), mRNA. Homo sapiens Rho GTPase activating 6760482 NM_001017526.1 ARHGAP8 protein 8 (ARHGAP8), transcript 133.3205 2.1977826 variant 1, mRNA. Homo sapiens serpin peptidase 3310201 NM_006919.1 SERPINB3 inhibitor, clade B (ovalbumin), 119.73525 2.1943393 member 3 (SERPINB3), mRNA. 7570608 NM_000210.2 ITGA6 Homo sapiens integrin, alpha 6 129.3205 2.1896498 (ITGA6), transcript variant 2, mRNA. 1570725 NM_144772.1 APOA1BP Homo sapiens apolipoprotein A-1 3378.2842 2.1818843 binding protein (APOA1BP), mRNA. 37.82 21 84 1980474 NM_178836.2 LOC201164 Homo sapiens similar to CG12314 137.58842 2.1773234 gene product (L0C201164), mRNA. 13.84 21724 780524 NM_006505.2 PVR Homo sapiens poliovirus receptor 503.12876 2.1511911 (PVR), inRNA. Homo sapiens interleukin 16 5080615 NM_172217.2 IL16 (lymphocyte chemoattractant factor) 184.95619 2.1385315 (IL16), transcript variant 2, mRNA. 4830010 NM_032663.2 USP30 Homo sapiens ubiquitin specific 247.31401 2.1120353 peptidase 30 (USP3O), mRNA. 2490170 NM_017910.2 FLJ20628 Homo sapiens hypothetical protein 470.7177 2.1103134 FLJ20628 (FLJ20628), mRNA. Homo sapiens palmitoyl-protein 1660575 NM_138717.1 PPT2 thioesterase 2 (PPT2), transcript 269.19248 2.0992385 variant 2, mRNA. Homo sapiens DnaJ (Hsp40) homolog, 6560445 NM_005147.3 DNAJA3 subfamily A, member 3 (DNAJA3), 2825.2081 2.0858595 mRNA. Homo sapiens cytochrome P450, 6200068 NM_000786.2 CYP51A1 family 51, subfamily A, polypeptide 1 441.06755 2.0832069 (CYP51A1), mRNA. Homo sapiens CD59 molecule, 1410201 NM_000611.4 CD59 complement regulatory protein 1343.6472 2.081539 (CD59), transcript variant 2, mRNA. Homo sapiens SRY (sex determining 1300445 NM_178424.1 SOX30 region Y)-box 30 (SOX30), transcript 137.40642 2.0755213 variant 1, mRNA. 4730019 NM_004429.3 EFNB1 Homo sapiens ephrin-B1 (EFNB1), 438.1441 2.0714489 mRNA. Homo sapiens proprotein convertase 4070619 NM_174936.2 PCSK9 subtilisin/kexin type 9 (PCSK9), 196.39351 2.0590305 mRNA. 1340626 NM_002989.2 CCL21 Homo sapiens chemokine (C-C motif) 128.46932 2.053963 ligand 21 (CCL2 1), mRNA. Homo sapiens core 1 synthase, 580066 NM_020156.1 CIGALTI glycoprotein-N-acetylgalactosamine 3- 322.35737 2.042385 beta-galactosyltransferase, 1 (CIGALTI), mRNA. 141 WO 2011/150105 PCT/US2011/037969 Homo sapiens protein tyrosine 5870553 NM_130440.1 PTPRF phosphatase, receptor type, F (PTPRF), 1568.1714 2.0298879 transcript variant 2, mRNA. 1780603 NM_000565.2 IL6R Homo sapiens interleukin 6 receptor 115.19189 2.013546 (IL6R), transcript variant 1, mRNA. CASM P5 Coronary artery smooth muscle ProbelD RefSeqID Symbol Definition RFU Fold over 4290040 NM_002521.2 NPPB Homo sapiens natriuretic peptide 7171.9072 66.838889 precursor B (NPPB), mRNA. 6370369 NM_001040021.1 CD14 Homo sapiens CD14 molecule (CD14), 4047.7358 37.535825 transcript variant 2, mRNA. 7000369 NM_000591.2 CD14 Homo sapiens CD14 molecule (CD14), 1269.9537 20.016624 transcript variant 1, mRNA. 4040576 NM_000600.1 IL6 Homo sapiens interleukin 6 (interferon, 10988.747 13.128694 beta 2) (1L6), mRNA. 6370017 NM_025237.2 SOST Homo sapiens sclerosteosis (SOST), 672.22434 12.124005 mRNA. Homo sapiens chemokine (C-X-C 60192 NM_002993.2 CXCL6 motif) ligand 6 (granulocyte 7236.6257 12.061634 chemotactic protein 2) (CXCL6), mRNA. 1690563 NM_199161.1 SAA1 Homo sapiens serum amyloid Al 6744 1608 (SAA1), transcript variant 2, mRNA. 1627.414 11.690382 Homo sapiens osteoclast-associated 1820450 NM_133169.2 OSCAR receptor (OSCAR), transcript variant 984.05671 9.3842671 4, mRNA. Homo sapiens transmembrane 6 240653 NM_023003.2 TM6SF1 superfamily member 1 (TM6SF1), 1296.8947 8.0591586 mRNA. 6980064 NM_001718.4 BMP6 Homo sapiens bone morphogenetic 827.93569 7.8599384 protein 6 (BMP6), mRNA. Homo sapiens protocadherin 10 5910093 NM_032961.1 PCDH1O (PCDH1O), transcript variant 1, 1520.6078 7.6643879 mRNA. 6620121 NM_005623.2 CCL8 Homo sapiens chemokine (C-C motif) 589.73289 7.6413288 ligand 8 (CCL8), mRNA. 2600424 NM_000331.3 SAA1 Homo sapiens serum amyloid Al 506.69233 6.8864166 (SAA1), transcript variant 1, mRNA. 1030333 NM_002982.3 CCL2 Homo sapiens chemokine (C-C motif) 16553.6 6.7384504 ligand 2 (CCL2), mRNA. 2940441 NM_002527.3 NTF3 Homo sapiens neurotrophin 3 (NTF3), 1323.291 6.5009977 IIRNA. Homo sapiens protocadherin 10 1580753 NM_020815.1 PCDH1O (PCDH1O), transcript variant 2, 904.20575 6.3474139 mRNA. 70167 NM_015364.2 LY96 Homo sapiens lymphocyte antigen 96 1755.4426 6.1674067 (LY96), mRNA. Homo sapiens osteoclast associated, 150762 NM_130771.3 OSCAR immunoglobulin-like receptor 528.47773 6.0612187 (OSCAR), transcript variant 3, mRNA. Homo sapiens Clq and tumor necrosis 5090079 NM_198594.1 C1QTNF1 factor related protein 1 (C1QTNF1), 5173.7581 6.0603968 mRNA. Homo sapiens prostaglandin 12 7150762 NM_000961.3 PTGIS (prostacyclin) synthase (PTGIS), 4792.7671 5.3887829 mRNA. 142 WO 2011/150105 PCT/US2011/037969 Homo sapiens prostaglandin endoperoxide synthase 1 1070450 NM_080591.1 PTGS1 (prostaglandin G/H synthase and 5129.8789 5.258241 cyclooxygenase) (PTGS 1), transcript variant 2, mRNA. 1410278 NM_002620.2 PF4V1 Homo sapiens platelet factor 4 variant 414.56165 5.1132604 1 1 (PF4V1), mRNA. 870603 NM_002986.2 CCL11 Homo sapiens chemokine (C-C motif) 260.53466 4.7094757 ligand 11I (CCL1 1), mRNA. Homo sapiens prostaglandin endoperoxide synthase 1 6840626 NM_000962.2 PTGS1 (prostaglandin G/H synthase and 851.06298 4.6545708 cyclooxygenase) (PTGS 1), transcript variant 1, mRNA. Homo sapiens N-acetylated alpha 4120626 NM_005468.2 NAALADL1 linked acidic dipeptidase-like 1 423.13525 4.6164035 (NAALADL1), mRNA. 5080543 NM_006528.2 TFPI2 Homo sapiens tissue factor pathway 1583.3354 4.3554027 inhibitor 2 (TFPJ2), mRNA. 4860494 NM_000064.1 C3 Homo sapiens complement component 322.91608 4.3444371 3 (C3), mRNA. 4560592 NM_004787.1 SLIT2 Homo sapiens slit homolog 2 1529.623 4.2177148 (Drosophila) (SLJT2), mRNA. 4610364 NM_006273.2 CCL7 Homo sapiens chemokine (C-C motif) 241.14137 4.1008237 ligand 7 (CCL7), mRNA. 5080139 NM_002771.2 PRSS3 Homo sapiens protease, seine, 3 376.31785 4.0519417 (mesotrypsin) (PRSS3), mRNA. 1110048 NM_007281.1 SCRG1 Homo sapiens scrapie responsive 5268.8103 3.9821835 protein 1 (SCRG1), mRNA. 6020286 NM_013409.1 FST Homo sapiens follistatin (FST), 10564.173 3.9463366 transcript variant FST344, mRNA. 6270681 NM_004334.1 BST1 Homo sapiens bone marrow stromal 481.6823 3.901307 cell antigen 1 (BST1), mRNA. Homo sapiens complement component 7400707 NM_001734.2 CiS 1, s subcomponent (CIS), transcript 4042.2758 3.8441608 variant 1, mRNA. Homo sapiens serpin peptidase 770408 NM_000602.1 SERPINE1 inhibitor, eade E (nexin, plasminogen 18155.869 3.796504 activator inhibitor type 1), member 1 (SERPINE1), mRNA. Homo sapiens EGF-containing fibulin 1260040 NM_004105.3 EFEMPI like extracellular matrix protein 1 4859.9181 3.7883149 (EFEMPI), transcript variant 1, mRNA. Homo sapiens beta-site APP-cleaving 1240201 NM_138991.1 BACE2 enzyme 2 (BACE2), transcript variant 830.06947 3.7868062 c, mRNA. Homo sapiens chemokine (C-X-C 3400292 NM_001511.1 CXCL1 motif) ligand 1 (melanoma growth 74776 3763 stimulating activity, alpha) (CXCL1), 754.78776 3.786732 mRNA. 1510382 XM_938935.2 NXPH4 PREDICTED: Homo sapiens 728.59779 3.7805663 neurexophilin 4 (NXPH4), mRNA. Homo sapiens dipeptidyl-peptidase 4 4830255 NM_001935.3 DPP4 (CD26, adenosine deaminase 393.72566 3.7520284 complexing protein 2) (DPP4), mRNA. 1340743 NM_000584.2 IL8 Homo sapiens interleukin 8 (1L8), 11954.262 3.6881556 3RNA. 143 WO 2011/150105 PCT/US2011/037969 Homo sapiens EGF-containing fibulin 6250563 NM_004105.3 EFEMPI like extracellular matrix protein 1 2834.9114 3.5692958 (EFEMPI), transcript variant 1, mRNA. Homo sapiens Clq and tumor necrosis 6180719 NM_198593.1 C1QTNF1 factor related protein 1 (C1QTNF1), 277.04056 3.5089605 transcript variant 2, mRNA. 540377 NM_002994.3 CXCL5 Homo sapiens chemokine (C-X-C 332.25841 3.4298634 motif) ligand 5 (CXCL5), mRNA. Homo sapiens chromosome Y open 7150066 NR_001544.1 CYorfl4 reading frame 14 (CYorfl4) on 243.18201 3.3542592 chromosome Y. 7040386 NM_001955.2 EDNI Homo sapiens endothelin 1 (EDNI), 1750.8726 3.3043691 mRNA. 630521 NM_002996.3 CX3CL1 Homo sapiens chemokine (C-X3-C 379.59336 3.2628767 1 - motif) ligand 1 (CX3CL1), mRNA. 5090026 NM_001855.3 COL15A1 Homo sapiens collagen, type XV, 2151.7122 3.1968777 alpha 1 (COLiSAl), mRNA. Homo sapiens procollagen C 4810445 NM_013363.2 PCOLCE2 endopeptidase enhancer 2 1757.9959 3.1531174 (PCOLCE2), mRNA. 4570364 NM_000039.1 APOAl Homo sapiens apolipoprotein A-I 235.86932 3.1344836 (APOAl), mRNA. 990458 NM_003062.1 SLIT3 Homo sapiens slit homolog 3 839.94292 3.1191764 (Drosophila) (SLIT3), mRNA. 110181 NM_018689.1 KIAA1199 Homo sapiens KIAA 1199 6307.2208 3.1002318 (KIAA1 199), mRNA. 1430487 NM_000900.2 MGP Homo sapiens matrix Gla protein 11189.599 3.0892282 (MGP), mRNA. Homo sapiens collagen, type IV, alpha 6380066 NM_031365.2 COL4A3 3 (Goodpasture antigen) (COL4A3), 211.14189 3.0622325 transcript variant 5, mRNA. 6480040 NM_153703.3 PODN Homo sapiens podocan (PODN), 1128.9621 3.0125347 mRNA. 4670390 NM_002089.3 CXCL2 Homo sapiens chemokine (C-X-C 264.18392 3.0039371 motif) ligand 2 (CXCL2), mRNA. Homo sapiens protein tyrosine 5870553 NM_130440.1 PTPRF phosphatase, receptor type, F (PTPRF), 2317.8257 3.0002627 transcript variant 2, mRNA. 1430170 NM_006682.1 FGL2 Homo sapiens fibrinogen-like 2 723.01357 2.9725884 (FGL2), mRNA. 4120019 NM_020353.1 PLSCR4 Homo sapiens phospholipid 1755.4426 2.9190657 scramblase 4 (PLSCR4), mRNA. Homo sapiens tumor necrosis factor 2370132 NM_002546.3 TNFRSF11B receptor superfamily, member 1lb 2369.7824 2.9162255 (osteoprotegerin) (TNFRSF1IB), mRNA. Homo sapiens prostaglandin 1820632 NM_000963.1 PTGS2 endoperoxide synthase 2 2190.0962 2.8862955 (prostaglandin G/H synthase and cyclooxygenase) (PTGS2), mRNA. Homo sapiens collagen, type VI, alpha 2470114 NM_004369.2 COL6A3 3 (COL6A3), transcript variant 1, 9483.5714 2.8089647 mRNA. 5090671 NM_004864.1 GDF15 Homo sapiens growth differentiation 2303.9519 2.7846828 factor 15 (GDF1S), mRNA. 7510079 NM_000078.1 CETP Homo sapiens cholesteryl ester transfer 322.59617 2.776744 protein, plasma (CETP), mRNA. 7330035 NM_003014.2 SFRP4 Homo sapiens secreted frizzled-related 156.50133 2.7761552 protein 4 (SFRP4), mRNA. 144 WO 2011/150105 PCT/US2011/037969 Homo sapiens EGF-containing fibulin 6900408 NM_001039348.1 EFEMP1 like extracellular matrix protein 1 12522.001 2.7400003 (EFEMPI), transcript variant 2, mRNA. Homo sapiens oxidized low density 7510132 NM_002543.3 OLR1 lipoprotein (lectin-like) receptor 1 443.44779 2.6774002 (OLR1), mRNA. Homo sapiens lymphotoxin beta 4640064 NM_002342.1 LTBR receptor (TNFR superfamily, member 1658.4625 2.6766848 3) (LTBR), mRNA. 6980129 NM_153370.2 P116 Homo sapiens peptidase inhibitor 16 539.25553 2.6593803 (P116), mRNA. Homo sapiens beta-site APP-cleaving 2230731 NM_138992.1 BACE2 enzyme 2 (BACE2), transcript variant 540.45206 2.6428336 b, mRNA. 3890095 NM_003102.2 SOD3 Homo sapiens superoxide dismutase 3' 290.19749 2.61239 extracellular (SOD3), mRNA. Homo sapiens jumonji, AT rich 5870739 NM_004653.3 JARIDID interactive domain ID (JARIDID), 172.60155 2.5680662 mRNA. 5870136 NM_004669.2 CLIC3 Homo sapiens chloride intracellular 767.44602 2.5643226 channel 3 (CLJC3), mRNA. Homo sapiens collagen, type VI, alpha 6250192 NM_057165.2 COL6A3 3 (COL6A3), transcript variant 3, 13933.806 2.5487765 mRNA. Homo sapiens CUG triplet repeat, 5390575 NM_006561.2 CUGBP2 RNA binding protein 2 (CUGBP2), 170.90627 2.5032647 transcript variant 2, mRNA. 3930020 NM_003793.2 CTSF Homo sapiens cathepsin F (CTSF), 410.66327 2.4706681 mRNA. 5820563 NM_001257.3 CDH13 Homo sapiens cadherin 13, H-cadherin 1633.3558 2.469738 (heart) (CDH13), mRNA. Homo sapiens pentraxin-related gene, 3460682 NM_002852.2 PTX3 rapidly induced by IL-I beta (PTX3), 390.4528 2.459789 mRNA. 5900594 NM_001779.1 CD58 Homo sapiens CD58 molecule (CD58), 1275.4841 2.4408937 mRNA. 7100646 NM_006274.2 CCL19 Homo sapiens chemokine (C-C motif) 164.13968 2.4227724 ligand 19 (CCL19), mRNA. Homo sapiens serpin peptidase 5080192 NM_006216.2 SERPINE2 inhibitor, eade E (nexin, plasminogen 28908.1 2.416744 activator inhibitor type 1), member 2 (SERPINE2), mRNA. 780524 NM_006505.2 PVR Homo sapiens poliovirus receptor 557.64395 2.3842777 (PVR), inRNA. 2940435 NM_003234.1 TFRC Homo sapiens transferring receptor 4535.774 2.3773135 (p90, CD71) (TFRC), mRNA. 4220246 NM_004591.1 CCL20 Homo sapiens chemokine (C-C motif) 496.38451 2.364148 ligand 20 (CCL2O), mRNA. Homo sapiens laminin, alpha 2 1470296 NM_000426.3 LAMA2 (merosin, congenital muscular 455.83997 2.3582423 dystrophy) (LAMA2), transcript variant 1, mRNA. Homo sapiens ADAM 6900086 NM_006988.3 ADAMTS1 metallopeptidase with thrombospondin 1385.4235 2.350567 type 1 motif, 1 (ADAMTS 1), mRNA. 1190367 NM_003897.3 IER3 Homo sapiens immediate early 9694.0142 2.3504632 response 3 ER3), mRNA. 145 WO 2011/150105 PCT/US2011/037969 4540458 NM_007224.1 NXPH4 Homo sapiens neurexophilin 4 225.17552 2.3489836 (NXPH4), mRNA. Homo sapiens endoplasmic reticulum 3290008 NM_152461.2 ERNI to nucleus signalling 1 (ERNI), 445.53938 2.3414097 transcript variant 2, mRNA. Homo sapiens Clq and tumor necrosis 7320204 NM_015645.2 C1QTNF5 factor related protein 5 (C1QTNF5), 998.93658 2.3350266 mRNA. Homo sapiens insulin-like growth 7380719 NM_002178.2 IGFBP6 factor binding protein 6 (IGFBP6), 8218.4366 2.2860013 mRNA. 60427 NM 005013.2 NUCB2 Homo sapiens nucleobindin 2 2400.2919 2.2420287 (NUCB32), mRNA. Homo sapiens carboxylesterase 2 3520372 NM_003869.4 CES2 (intestine, liver) (CES2), transcript 1907.9462 2.2365562 variant 1, mRNA. 6900309 NM_000046.2 ARSB Homo sapiens arylsulfatase B (ARSB), 272.84897 2.2303231 transcript variant 1, mRNA. Homo sapiens TIMP metallopeptidase 2030577 NM_000362.4 TIMP3 inhibitor 3 (Sorsby fundus dystrophy, 9818.0367 2.1498827 pseudoinflammatory) (TJIP3), mRNA. Homo sapiens very low density 5390661 NM_001018056.1 VLDLR lipoprotein receptor (VLDLR), 1079.3475 2.1093104 transcript variant 2, mRNA. 620255 NM_012193.2 FZD4 Homo sapiens frizzled homolog 4 1040.4938 2.1010062 (Drosophila) (FZD4), mRNA. 1090008 NM_000638.3 VTN Homo sapiens vitronectin (VTN), 125.18717 2.0974243 mRNA. Homo sapiens protein tyrosine 160711 NM_002837.2 PTPRB phosphatase, receptor type, B 253.35 2.0933499 (PTPRB), mRNA. 510136 NM_147157.1 OPRS1 Homo sapiens opioid receptor, sigma 1 364.4694 2.0795481 (OPRS1I), transcript variant 2, mRNA. 3830075 NM_001218.3 CA12 Homo sapiens carbonic anhydrase XII 655.4205 2.067209 (CA12), transcript variant 1, mRNA. Homo sapiens pregnancy-associated 730754 NM_002581.3 PAPPA plasma protein A, pappalysin 1 5678.9069 2.0578772 (PAPPA), mRNA. 2600215 NM_002297.2 LCN1 Homo sapiens lipocalin 1 (tear 138.31704 2.0440487 prealbumin) (LCN1), mRNA. Homo sapiens brain-derived 7330241 NM_001709.3 BDNF neurotrophic factor (BDNF), transcript 1118.7529 2.0177256 variant 4, mRNA. Homo sapiens UDP-Gal:betaGlcNAc 2000646 NM_003778.3 B4GALT4 beta 1,4- galactosyltransferase, 1340.3479 2.016149 polypeptide 4 (B4GALT4), transcript variant 2, mRNA. 4280301 NM_006072.4 CCL26 Homo sapiens chemokine (C-C motif) 228.5323 2.0138542 __________________________ligand 26 (CCL26), mRNA. NHEM P5 Neonatal normal human epidermal melanocytes ProbelD RefSeqID Symbol Definition RFU Fold over 2320373 NM_006928.3 SILV Homo sapiens silver homolog (mouse) 30909.262 150.42945 __________________________(SJLV), mRNA. 2100446 NM_021948.3 BCAN Homo sapiens brevican (BCAN), 6319.9429 88.835615 transcript variant 1, mRNA. 146 WO 2011/150105 PCT/US2011/037969 Homo sapiens dopachrome 1440682 NM_001922.2 DCT tautomerase (dopachrome delta- 4670.8501 71.506236 isomerase, tyrosine-related protein 2) (DCT), mRNA. 1090246 NM_198427.1 BCAN Homo sapiens brevican (BCAN), 2877.7108 46.433964 transcript variant 2, mRNA. 3930020 NM_003793.2 CTSF Homo sapiens cathepsin F (CTSF), 4084.0186 24.570627 mRNA. 2480746 NM_139278.2 LGI3 Homo sapiens leucine-rich repeat LGI 1292.7883 22.989819 family, member 3 (LGJ3), mRNA. Homo sapiens regulator of G-protein 6400403 NM_170587.1 RGS20 signaling 20 (RGS20), transcript 3950.827 21.55272 variant 1, mRNA. 2370438 NM_000014.4 A2M Homo sapiens alpha-2-macroglobulin 2119.8106 21.098427 (A2M), mRNA. Homo sapiens v-erb-b2 erythroblastic 4560288 NM_001982.2 ERBB3 leukemia viral oncogene homolog 3 1757.9959 17.856756 (avian) (ERBB3), transcript variant 1, mRNA. 7050082 NM_001611.2 ACP5 Homo sapiens acid phosphatase 5' 1666.883 16.833046 tartrate resistant (ACP5), mRNA. Homo sapiens CUG triplet repeat, 5390575 NM_006561.2 CUGBP2 RNA binding protein 2 (CUGBP2), 935.14233 13.697033 transcript variant 2, mRNA. 6510519 NM_138284.1 IL17D Homo sapiens interleukin 17D 6849.601 12.585612 (JL17D), mRNA. 6840639 NM_152890.4 COL24A1 Homo sapiens collagen, type XXIV, 1196.1487 11.203304 alpha 1 (COL24A1), mRNA. Homo sapiens sarcoglycan, delta 70088 NM_000337.4 SGCD (35kDa dystrophin-associated 804.9292 10.957717 glycoprotein) (SGCD), transcript variant 1, mRNA. 4290037 NM_002514.2 NOV Homo sapiens nephroblastoma 2338.5609 10.651808 overexpressed gene (NOV), mRNA. 23850 1.688 Homo sapiens v-erb-b2 erythroblastic 3120608 NM_001005915.1 ERBB3 leukemia viral oncogene homolog 3 888.80118 10.651551 (avian) (ERBB3), transcript variant s, mRNA. Homo sapiens immunoglobulin 2900674 NM_001542.2 IGSF3 superfamily, member 3 (IGSF3), 4464.2305 10.351572 transcript variant 1, mRNA. Homo sapiens sarcoglycan, delta 2450327 NM_172244.2 SGCD (35kDa dystrophin-associated 1098.2599 9.2192342 glycoprotein) (SGCD), transcript variant 2, mRNA. Homo sapiens glucosaminyl (N-acetyl) 6660369 NM_001491.2 GCNT2 transferase 2, I-branching enzyme (I 997.27817 8.98858 blood group) (GCNT2), transcript variant 2, mRNA. Homo sapiens dipeptidyl-peptidase 4 4830255 NM_001935.3 DPP4 (CD26, adenosine deaminase 799.98525 7.6234995 complexing protein 2) (DPP4), mRNA. 1430278 NM_000396.2 CTSK Homo sapiens cathepsin K (CTSK), 6443.4355 7.368326 IIRNA. Homo sapiens regulator of G-protein 4070215 NM_002926.3 RGS12 signaling 12 (RGS12), transcript 2940.8578 7.202077 variant 2, mRNA. 2030414 NM_000055.1 BCHE Homo sapiens butyrylcholinesterase 1259.5227 7.2003791 (BCHE), mRNA. 147 WO 2011/150105 PCT/US2011/037969 Homo sapiens guanine nucleotide 1300139 NM_052847.2 GNG7 binding protein (G protein), gamma 7 946.02758 7.0752501 (GNG7), mRNA. Homo sapiens immunoglobulin 4230608 NM_001542.2 IGSF3 superfamily, member 3 (IGSF3), 683.24971 6.2657874 transcript variant 1, mRNA. 7150634 NM_001647.2 APOD Homo sapiens apolipoprotein D 4762.4075 6.0440149 (APOD), mRNA. Homo sapiens N-acetylated alpha 4120626 NM_005468.2 NAALADL1 linked acidic dipeptidase-like 1 524.93038 5.7269879 (NAALADL1), mRNA. 510561 NM_003018.2 SFTPC Homo sapiens surfactant, pulmonary- 322.49993 5.7052711 associated protein C (SFTPC), mRNA. Homo sapiens serpin peptidase 6290356 NM_002615.4 SERPINFI inhibitor, clade F (alpha-2 antiplasmin, 3985.9645 5.3450073 pigment epithelium derived factor), member 1 (SERPINFI), mRNA. 6330438 NM_002673.3 PLXNB1 Homo sapiens plexin BI (PLXNB1), 1364.4086 5.247092 mRNA. Homo sapiens jumonji, AT rich 5870739 NM_004653.3 JARIDID interactive domain ID (JARIDID), 348.94499 5.1918064 mRNA. 730414 NM_000041.2 APOE Homo sapiens apolipoprotein E 12862.586 5.1810702 (APOE), inRNA. Homo sapiens delta-like 3 4210382 NM_016941.2 DLL3 (Drosophila) (DLL3), transcript variant 1055.9224 5.1619079 1, mRNA. Homo sapiens spectrin repeat 160121 NM_015180.4 SYNE2 containing, nuclear envelope 2 469.45133 4.9545167 (SYNE2), transcript variant 1, mRNA. 70167 NM_015364.2 LY96 Homo sapiens lymphocyte antigen 96 1380.69 4.8507863 (LY96), mRNA. 2680072 NM_014279.4 OLFM1 Homo sapiens olfactomedin 1 696.6056 4.4546941 (OLFM1), transcript variant 1, mRNA. 6665 .564 4070241 NM_003918.2 GYG2 Homo sapiens glycogenin 2 (GYG2), 2366.3355 4.3869918 transcript variant 2, mRNA. 3400307 NM_015900.1 PLA1A Homo sapiens phospholipase Al 295.42788 4.2126015 member A (PLAl A), mRNA. Homo sapiens beta-site APP-cleaving 1240201 NM_138991.1 BACE2 enzyme 2 (BACE2), transcript variant 920.10059 4.1975314 c, mRNA. 2940441 NM_002527.3 NTF3 Homo sapiens neurotrophin 3 (NTF3), 846.04351 4.1564001 IIRNA. Homo sapiens CUG triplet repeat, 2320162 NM_001025076.2 CUGBP2 RNA binding protein 2 (CUGBP2), 284.99779 4.1462103 transcript variant 1, mRNA. 7570484 NM_003226.2 TFF3 Homo sapiens trefoil factor 3 504.98643 4.0401524 (intestinal) (TFF3), mRNA. Homo sapiens v-erb-b2 erythroblastic 4260482 NM_001005915.1 ERBB3 leukemia viral oncogene homolog3 235.1823 3.9782157 (avian) (ERBB3), transcript variant s, mRNA. 770156 NM_203422.1 LOC221091 Homo sapiens similar to hypothetical 292.46873 3.8925174 protein (L0C221091), mRNA. Homo sapiens interleukin 16 5080615 NM_172217.2 IL16 (lymphocyte chemoattractant factor) 325.37153 3.7620653 (IL16), transcript variant 2, mRNA. 148 WO 2011/150105 PCT/US2011/037969 Homo sapiens beta-site APP-cleaving 2230731 NM_138992.1 BACE2 enzyme 2 (BACE2), transcript variant 678.91667 3.3199315 b, mRNA. Homo sapiens ninein (GSK3B 5310717 NM_020921.3 NIN interacting protein) (NIN), transcript 1250.9555 3.2820163 variant 2, mRNA. 5890288 NM_003377.3 VEGFB Homo sapiens vascular endothelial 1397.3209 3.1681328 growth factor B (VEGFB), mRNA. 3800204 NM_006334.3 OLFM1 Homo sapiens olfactomedin 1 290.11726 3.1654109 (OLFM1), transcript variant 2, mRNA. Homo sapiens sarcoglycan, delta 4490563 NM_172244.2 SGCD (35kDa dystrophin-associated 219.77353 3.0547634 glycoprotein) (SGCD), transcript variant 2, mRNA. Homo sapiens tumor necrosis factor 1090747 NM_003809.2 TNFSF12 (ligand) superfamily, member 12 1062.1873 2.9912465 (TNFSF12), mRNA. Homo sapiens CD59 molecule, 1410201 NM_000611.4 CD59 complement regulatory protein 1921.326 2.976462 (CD59), transcript variant 2, mRNA. Homo sapiens pyrophosphatase 770356 NM_006903.4 PPA2 (inorganic) 2 (PPA2), nuclear gene 4147.5046 2.9252434 encoding mitochondrial protein, transcript variant 2, mRNA. 3390372 NM_001843.2 CNTN1 Homo sapiens contactin 1 (CNTN1), 194.33791 2.9043831 transcript variant 1, mRNA. Homo sapiens wingless-type MMTV 6840202 NM_030761.3 WNT4 integration site family, member 4 164.41283 2.8908547 (WNT4), mRNA. 3990703 NM_000572.2 IL1O Homo sapiens interleukin 10 (IL1O), 2257.6414 2.833801 IIRNA. 4280487 NM_003296.1 CRISP2 Homo sapiens cysteine-rich secretory 193.03702 2.7950272 protein 2 (CRJSP2), mRNA. Homo sapiens family with sequence 1940274 NM_032036.2 FAM14A similarity 14, member A (FAM14A), 2162.0329 2.7861786 mRNA. 5900468 NM_006037.3 HDAC4 Homo sapiens histone deacetylase 4 404.07242 2.7820335 (HDAC4), inRNA. 4540215 NM_012168.4 FBXO2 Homo sapiens F-box protein 2 461.65619 2.7410261 (FBXO2), mRNA. Homo sapiens FXYD domain 160270 NM_022003.1 FXYD6 containing ion transport regulator 6 535.00398 2.7380186 (FXYD6), mRNA. 3710397 NM_004428.2 EFNA1 Homo sapiens ephrin-Al (EFNA1), 817.92478 2.7360462 transcript variant 1, mRNA. Homo sapiens baculoviral IAP repeat 3060255 NM_182962.1 BIRC3 containing 3 (BIRC3), transcript 1474.1922 2.7345404 variant 2, mRNA. Homo sapiens phosphoinositide-3 3360717 NM_005026.2 PIK3CD kinase, catalytic, delta polypeptide 459.73156 2.7235201 (PIK3CD), mRNA. 4890048 NM_001081.3 CUBN Homo sapiens cubilin (intrinsic factor- 197.87168 2.7024812 cobalamin receptor) (CUBN), mRNA. Homo sapiens glucosaminyl (N-acetyl) 3130753 NM_145649.2 GCNT2 transferase 2, I-branching enzyme 144.26401 2.6906392 (GCNT2), transcript variant 1, mRNA. Homo sapiens chromosome 6 open 7150017 NM_001040437.1 C6orf48 reading frame 48 (C6orf48), transcript 22398.308 2.6719144 variant 1, mRNA. 149 WO 2011/150105 PCT/US2011/037969 2320377 NM_001622.1 AHSG Homo sapiens alpha-2-HS- 231.33282 2.661872 glycoprotein (AHSG), mRNA. Homo sapiens interleukin 17 receptor 4060017 NM_001080973.1 IL17RD D (IL17RD), transcript variant 1, 1157.0389 2.655526 mRNA. 4830451 NM_003918.1 GYG2 Homo sapiens glycogenin 2 (GYG2), 311.13304 2.640645 mRNA. Homo sapiens CD44 molecule (Indian 360719 NM_000610.3 CD44 blood group) (CD44), transcript variant 204.51527 2.6222939 1, mRNA. Homo sapiens golgi associated, gamma 2190121 NM_015044.3 GGA2 adaptin ear containing, ARF binding 1019.0553 2.6140341 protein 2 (GGA2), mRNA. 5310468 NM_004558.2 NRTN Homo sapiens neurturin (NRTN), 169.68186 2.5557544 mRNA. 4150753 NM_017946.2 FKBP14 Homo sapiens FK506 binding protein 2487.3723 2.5307646 14, 22 kDa (FKBP14), mRNA. Homo sapiens leucine rich repeat (in 3400754 NM_004735.2 LRRFIP1 FLII) interacting protein 1 (LRRFIP1), 3093.5619 2.4633343 mRNA. 2810255 NM_015989.3 CSAD Homo sapiens cysteine sulfinic acid 830.39808 2.460291 decarboxylase (CSAD), mRNA. Homo sapiens CUG triplet repeat, 7400133 NM_001025077.2 CUGBP2 RNA binding protein 2 (CUGBP2), 158.5559 2.4542622 transcript variant 3, mRNA. 1410091 NM_000060.2 BTD Homo sapiens biotinidase (BTD), 709.80885 2.4514681 mRNA. 1780673 NM_003864.3 SAP30 Homo sapiens Sin3A-associated 1432.9788 2.4478544 protein, 3OkDa (SAP3O), mRNA. Homo sapiens CD44 molecule (Indian 4560193 NM_001001392.1 CD44 blood group) (CD44), transcript variant 3170.1951 2.4334635 5, mRNA. Homo sapiens ATP-binding cassette, 4890609 NM_000033.2 ABCD1 sub-family D (ALD), member 1 422.92965 2.4137489 (ABCD1), mRNA. Homo sapiens Fc fragment of IgA, 4250193 NM_133279.1 FCAR receptor for (FCAR), transcript variant 1177.0888 2.3899655 9, mRNA. Homo sapiens spectrin repeat 10634 NM_015180.4 SYNE2 containing, nuclear envelope 2 159.94351 2.3885935 (SYNE2), transcript variant 1, mRNA. 6770168 NM_006371.3 CRTAP Homo sapiens cartilage associated 870.78068 2.3866975 protein (CRTAP), mRNA. 670608 NM_013379.2 DPP7 Homo sapiens dipeptidyl-peptidase 7 815.57035 2.3850756 (DPP7), mRNA. Homo sapiens AU RNA binding 7330180 NM_001698.1 AUH protein/enoyl-Coenzyme A hydratase 630.57788 2.3818598 (AUH), nuclear gene encoding mitochondrial protein, mRNA. 7160707 NM_020773.1 TBC1D14 Homo sapiens TBC1 domain family, 1876.8382 2.3649594 member 14 (TBC1D14), mRNA. Homo sapiens chromosome Y open 7150066 NR_001544.1 CYorfl4 reading frame 14 (CYorfl4) on 170.41187 2.3505258 chromosome Y. 7550022 NM_139244.2 STXBP5 Homo sapiens syntaxin binding protein 873.16386 2.3344232 5 (tomosyn) (STXBPS), mRNA.' I 1660075 NM_018058.4 CRTAC1 Homo sapiens cartilage acidic protein 321.2017 2.3307691 1 (CRTAC1), mRNA. 150 WO 2011/150105 PCT/US2011/037969 Homo sapiens N-acetylglucosamine-1 6400630 NM_016256.2 NAGPA phosphodiester alpha-N- 732.31681 2.3306161 acetylglucosaminidase (NAGPA), mRNA. 5570070 NM_012400.2 PLA2G2D Homo sapiens phospholipase A2, 311.26504 2.3196272 group HID (PLA2G2D), mRNA. Homo sapiens interleukin 18 4810474 NM_001562.2 IL18 (interferon-gamma-inducing factor) 7964.1763 2.3133515 (IL18), mRNA. 2480364 NM_013379.2 DPP7 Homo sapiens dipeptidyl-peptidase 7 1222.628 2.3012887 (DPP7), mRNA. 5670162 NM_153324.2 DEFB 123 Homo sapiens defensin, beta 123 158.1149 2.2946485 (DEFB 123), mRNA. Homo sapiens single-strand-selective 1050386 NM_014311.1 SMUGI monofunctional uracil-DNA 1882.5021 2.2713292 glycosylase 1 (SMUGI), mRNA. Homo sapiens paired immunoglobin 1570039 NM_013440.3 PILRB like type 2 receptor beta (PILRB), 677.42286 2.2478591 transcript variant 1, mRNA. 1570725 NM_144772.1 APOA1BP Homo sapiens apolipoprotein A-I 3468.2566 2.2399935 binding protein (APOA1BP), mRNA. 34826 2.995 Homo sapiens dolichyl-phosphate 7320435 NM_153741.1 DPM3 mannosyltransferase polypeptide 3 2616.2982 2.2382562 (DPM3), transcript variant 2, mRNA. Homo sapiens dolichyl-phosphate 2850520 NM_018973.3 DPM3 mannosyltransferase polypeptide 3 2054.4563 2.2319447 (DPM3), transcript variant 1, mRNA. Homo sapiens Clq and tumor necrosis 7320204 NM_015645.2 C1QTNF5 factor related protein 5 (C1QTNF5), 954.08665 2.2301893 mRNA. 1340626 NM_002989.2 CCL21 Homo sapiens chemokine (C-C motif) 139.19336 2.2254185 ligand 21 (CCL2 1), mRNA. 650020 NM_203446.1 SYNJI Homo sapiens synaptojanin 1 366.60959 2.2237533 (SYNJI), transcript variant 2, mRNA. Homo sapiens bruno-like 6, RNA 7040296 NM_052840.3 BRUNOL6 binding protein (Drosophila) 140.26106 2.1469412 (BRUNOL6), mRNA. Homo sapiens tumor necrosis factor 1170673 NM_172014.1 TNFSF14 (ligand) superfamily, member 14 519.14307 2.1345871 (TNFSF14), transcript variant 2, mRNA. 6420008 NM_000313.1 PROSI Homo sapiens protein S (alpha) 1860.7193 2.1263522 (PROS I), mnRNA. Homo sapiens lipase A, lysosomal 5360148 NM_000235.2 LIPA acid, cholesterol esterase (Wolman 2582.1072 2.117538 disease) (LIPA), mRNA. 5670100 NM_000355.2 TCN2 Homo sapiens transcobalamin II; 466.72507 2.1009648 macrocytic anemia (TCN2), mRNA. Homo sapiens dystrophin (muscular 270520 NM_004006.1 DMD dystrophy, Duchenne and Becker 162.19366 2.0797897 types) (DMD), transcript variant Dp427m, mRNA. Homo sapiens interleukin 1 receptor 2470601 NM_173842.1 ILIRN antagonist (ILIRN), transcript variant 125.61976 2.0766857 1, mRNA. Homo sapiens gamma-glutamyl 160615 NM_003878.1 GGH hydrolase (conjugase, 353.06018 2.0677388 folylpolygammaglutamyl hydrolase) 35.61 20738 (GGH), mRNA. 151 WO 2011/150105 PCT/US2011/037969 1980288 NM_004390.2 CTSH Homo sapiens cathepsin H (CTSH), 804.9292 2.0662116 transcript variant 1, mRNA. Homo sapiens CD59 molecule, 1430240 NM_203331.1 CD59 complement regulatory protein 234.99218 2.0657562 (CD59), transcript variant 4, mRNA. 840309 NM_000230.1 LEP Homo sapiens leptin (obesity homolog, 379.03112 2.0643368 mouse) (LEP), mRNA. 2070543 NM_025258.2 C6orf27 Homo sapiens chromosome 6 open 133.65546 2.0453351 reading frame 27 (C6orf27), mRNA. 13656 2053 Homo sapiens angiogenin, 3930392 NM_001097577.1 ANG ribonuclease, RNase A family, 5 1872.2652 2.0292354 (ANG), transcript variant 2, mRNA. Homo sapiens CD44 molecule (Indian 5860152 NM_001001391.1 CD44 blood group) (CD44), transcript variant 15513.492 2.0056941 4, mRNA. NHBE Normal human bronchial epithelial cells ProbelD RefSeqjID Symbol Definition RFU Fold over Ave 4390398 NM_005564.3 LCN2 Homo sapiens lipocalin 2 (LCN2), 26475.669 182.96636 mRNA. Homo sapiens lectin, galactoside 4220463 NM_002307.1 LGALS7 binding, soluble, 7 (galectin 7) 17105.808 156.69745 (LGALS7), mRNA. 2140707 NM_003064.2 SLPI Homo sapiens secretory leukocyte 21045.352 143.97952 peptidase inhibitor (SLPI), mRNA. 3710040 NM_006142.3 SFN Homo sapiens stratifin (SFN), mRNA. 14006.772 133.42831 Homo sapiens kallikrein-related 5900008 NM_144947.1 KLK11 peptidase 11 (KLK11), transcript 11766.594 127.27679 variant 2, mRNA. 1050168 NM_002638.2 P13 Homo sapiens peptidase inhibitor 3 13663.985 119.78412 skin-derived (SKALP) (P13), mRNA Homo sapiens serpin peptidase 6290707 NM_002639.3 SERPINB5 inhibitor, clade B (ovalbumin), 11067.226 115.48853 member 5 (SERPINB5), mRNA. Homo sapiens Ly6/neurotoxin 1 1850541 NM_177458.1 LYNX1 (LYNX1), transcript variant SLURP2, 5428.6664 81.039785 mRNA. 990372 NM_000494.3 COL17A1 Homo sapiens collagen, type XVII, 7866.0223 75.55094 alpha 1 (COL17A1), mRNA. 1170349 NM_005558.3 LADI Homo sapiens ladinin 1 (LADI), 12210.763 68.225242 IIRNA. Homo sapiens interleukin 1 receptor 7510386 NM_173843.1 ILIRN antagonist (IL1RN), transcript variant 5811.9761 61.595754 4, mRNA. Homo sapiens kallikrein-related 6020139 NM_005046.2 KLK7 peptidase 7 (KLK7), transcript variant 7601.3891 59.187353 1, mRNA. Homo sapiens kallikrein-related 4050398 NM_019598.2 KLK12 peptidase 12 (KLK12), transcript 4136.5906 59.161367 variant 1, mRNA. 1230228 NM_013404.3 MSLN Homo sapiens mesothelin (MSLN), 5728.7796 53.262145 transcript variant 2, mRNA. Homo sapiens kallikrein-related 3170687 NM_012427.4 KLK5 peptidase 5 (KLK5), transcript variant 4608.6774 43.764268 1, mRNA. 6480592 NM_198129.1 LAMA3 Homo sapiens laminin, alpha 3 3945.9257 40.451696 (LAMA3), transcript variant 1, mRNA. 2120270 NM_000494.3 COL17A1 Homo sapiens collagen, type XVII, 2563.1639 36.44536 alpha 1 (COL17A1), mRNA. 152 WO 2011/150105 PCT/US2011/037969 5080139 NM_002771.2 PRSS3 Homo sapiens protease, serine, 3 3229.3389 34.771386 (mesotrypsin) (PRSS3), mRNA. Homo sapiens kallikrein-related 3840010 NM_007196.2 KLK8 peptidase 8 (KLK8), transcript variant 1932.1664 29.158738 1, mRNA. Homo sapiens kallikrein-related 5960192 NM_002776.4 KLK1O peptidase 10 (KLK1O), transcript 2131.2603 28.923042 variant 1, mRNA. Homo sapiens family with sequence 6100537 NM_138805.2 FAM3D similarity 3, member D (FAM3D), 1667.773 27.278098 mRNA. Homo sapiens transcobalamin I 1770603 NM_001062.3 TCN1 (vitamin B12 binding protein, R binder 4991.946 27.192111 family) (TCN1), mRNA. 5870136 NM_004669.2 CLIC3 Homo sapiens chloride intracellular 7712.591 25.770635 channel 3 (CLJC3), mRNA. 1190131 NM_032572.2 RNASE7 Homo sapiens ribonuclease, RNase A 1532.7547 25.541422 family, 7 (RNASE7), mRNA. Homo sapiens cytochrome P450, 4860307 NM_000772.1 CYP2C18 family 2, subfamily C, polypeptide 18 1413.946 24.391447 (CYP2C18), mRNA. Homo sapiens kallikrein-related 6660274 NM_001077491.1 KLK5 peptidase 5 (KLK5), transcript variant 2170.667 23.125312 2, mRNA. 7210139 NM_002773.3 PRSS8 Homo sapiens protease, seine, 8 3029.3926 22.313674 (PRSS8), mRNA. 730040 NM_000228.2 LAMB3 Homo sapiens laminin, beta 3 6691.4562 21.541957 (LAMB3), transcript variant 1, mRNA. Homo sapiens parathyroid hormone 6900414 NM_198965.1 PTHLH like hormone (PTHLH), transcript 6282.8029 20.436594 variant 1, mRNA. Homo sapiens seine peptidase 6380707 NM_006846.2 SPINK5 inhibitor, Kazal type 5 (SPINK5), 1604.7544 20.201474 mRNA. 5490019 NM_002084.3 GPX3 Homo sapiens glutathione peroxidase 3 6940.3176 19.943137 (plasma) (GPX3), mRNA. 2650612 NM_198129.1 LAMA3 Homo sapiens lamiin, alpha 3 1435.9038 19.005823 (LAMA3), transcript variant 1, mRNA. Homo sapiens crumbs homolog 3 7400524 NM_139161.2 CRB3 (Drosophila) (CRB3), transcript 1933.3575 18.698489 variant 2, mRNA. Homo sapiens carcinoembryonic 5700753 NM_001024912.1 CEACAMI antigen-related cell adhesion molecule 1162.8928 18.228723 1 (biliary glycoprotein) (CEACAMI), transcript variant 2, mRNA. Homo sapiens parathyroid hormone 1980593 NM_198964.1 PTHLH like hormone (PTHLH), transcript 3271.4245 17.77693 variant 3, mRNA. 4010181 NM_000804.2 FOLR3 Homo sapiens folate receptor 3 1346.1904 17.005044 (gamma) (FOLR3), mRNA. Homo sapiens kallikrein-related 7050047 NM_019598.2 KLK12 peptidase 12 (KLK12), transcript 896.58274 16.498271 variant 1, mRNA. Homo sapiens FXYD domain 5390240 NM_021910.1 FXYD3 containing ion transport regulator 3 919.36047 16.452024 (FXYD3), transcript variant 2, mRNA. 3710397 NM_004428.2 EFNA1 Homo sapiens ephrin-Al (EFNA1), 4792.7671 16.032321 transcript variant 1, mRNA. 153 WO 2011/150105 PCT/US2011/037969 Homo sapiens serine peptidase 5860767 NM_003710.3 SPINTI inhibitor, Kunitz type 1 (SPINTI), 1430.4366 15.42897 transcript variant 2, mRNA. Homo sapiens interleukin 1 receptor 6020300 NM_003856.2 ILIRLI like 1 (ILIRLI), transcript variant 2, 1540.5871 14.867696 mRNA. Homo sapiens cathelicidin 5860075 NM_004345.3 CAMP antimicrobial peptide (CAMP), 806.75243 13.430157 mRNA. 6660435 NM_003236.1 TGFA Homo sapiens transforming growth 1548.2112 13.179935 factor, alpha (TGFA), mRNA. Homo sapiens carboxylesterase 2 3520372 NM_003869.4 CES2 (intestine, liver) (CES2), transcript 11148.021 13.06807 variant 1, mRNA. Homo sapiens wingless-type MMTV 3870131 NM_004625.3 WNT7A integration site family, member 7A 768.44609 12.723827 (WNT7A), mRNA. Homo sapiens serpin peptidase 6350209 NM_002575.1 SERPINB2 inhibitor, clade B (ovalbumin), 1526.7754 12.623808 member 2 (SERPINB2), mRNA. Homo sapiens transmembrane 5960091 NM_019894.2 TMPRSS4 protease, seine 4 (TMPRSS4), 1010.7487 12.599166 transcript variant 1, mRNA. 3940132 NM_001005619.1 ITGB4 Homo sapiens integrin, beta 4 2032.2955 12.020085 (ITGB4), transcript variant 2, mRNA. Homo sapiens fibroblast growth factor 6520139 NM_022965.1 FGFR3 receptor 3 (achondroplasia, 4509.0335 11.895289 thanatophoric dwarfism) (FGFR3), transcript variant 2, mRNA. 1570598 NM 001005731.1 ITGB4 Homo sapiens integrin, beta 4 1480.5074 11.889115 (ITGB4), transcript variant 3, mRNA. 6940598 NM_145652.2 WFDC5 Homo sapiens WAP four-disulfide 662.66615 11.514801 core domain 5 (WFDCS), mRNA. 3390187 NM_004428.2 EFNA1 Homo sapiens ephrin-Al (EFNA1), 1026.799 11.150343 transcript variant 1, mRNA. 1430477 NM_001333.2 CTSL2 Homo sapiens cathepsin L2 (CTSL2), 2402.232 11.074938 mRNA. 3850561 NM 144504.1 F11R Homo sapiens F1I receptor (F11R), 1233.7055 10.994496 transcript variant 5, mRNA. Homo sapiens mucin 20, cell surface 3400097 NM_001098516.1 MUC20 associated (MUC20), transcript variant 767.15472 10.900319 S, mRNA. 6590592 NM_001006946.1 SDC1 Homo sapiens syndecan 1 (SDC1), 9143.5302 10.385212 transcript variant 1, mRNA. Homo sapiens crumbs homolog 3 4670402 NM_174881.2 CRB3 (Drosophila) (CRB3), transcript 947.59425 10.309696 variant 3, mRNA. 4920040 NM_005218.3 DEFB1 Homo sapiens defensin, beta 1 871.13717 9.8758036 (DEFB 1), mRNA. Homo sapiens Rho guanine nucleotide 3850333 NM_015320.2 ARHGEF4 exchange factor (GEF) 4 (ARHGEF4), 1082.178 9.7779634 transcript variant 1, mRNA. 7050220 NM_006681.1 NMU Homo sapiens neuromedin U (NMU), 1191.4291 9.5211089 mRNA. 1440377 NM_014375.2 FETUB Homo sapiens fetuin B (FETUB), 660.79204 9.3939386 1 ~mRNA.1 4010519 NM_002652.2 PIP Homo sapiens prolactin-induced 805.55317 8.9686593 protein (PIP), mRNA. 154 WO 2011/150105 PCT/US2011/037969 Homo sapiens regulator of G-protein 4070215 NM_002926.3 RGS12 signaling 12 (RGS12), transcript 3603.6146 8.8251495 variant 2, mRNA. Homo sapiens Cas-Br-M marinee) 3870471 NM_012116.2 CBLC ecotropic retroviral transforming 620.28496 8.7700374 sequence c (CBLC), mRNA. 4390100 NM_005562.1 LAMC2 Homo sapiens laminin, gamma 2 9064.792 8.5225361 (LAMC2), transcript variant 1, mRNA. Homo sapiens v-erb-b2 erythroblastic 4560288 NM_001982.2 ERBB3 leukemia viral oncogene homolog 3 836.81445 8.4999016 (avian) (ERBB3), transcript variant 1, mRNA. 1070333 NM_001323.2 CST6 Homo sapiens cystatin E/M (CST6), 735.59639 8.2938028 mRNA. Homo sapiens 630315 NM_005771.3 DHRS9 dehydrogenase/reductase (SDR family) 922.00929 7.7800814 member 9 (DHRS9), transcript variant 1, mRNA. Homo sapiens immunoglobulin 7650767 NM_020789.2 IGSF9 superfamily, member 9 (IGSF9), 486.33142 7.4540396 mRNA. Homo sapiens kallikrein-related 1430603 NM_144505.1 KLK8 peptidase 8 (KLK8), transcript variant 437.67714 7.3771544 2, mRNA. 1980288 NM_004390.2 CTSH Homo sapiens cathepsin H (CTSH), 2865.1271 7.354633 transcript variant 1, mRNA. Homo sapiens interleukin 1 receptor 5420754 NM_003856.2 ILIRLI like 1 (ILIRLI), transcript variant 2, 693.99889 7.1643193 mRNA. 4010491 XM_001129442.1 CST6 PREDICTED: Homo sapiens cystatin 654.39322 7.1560889 E/M (CST6), mRNA. Homo sapiens carboxylesterase 2 3850471 NM_003869.4 CES2 (intestine, liver) (CES2), transcript 1022.2979 7.1280121 variant 1, mRNA. Homo sapiens kallikrein-related 6620427 NM_012427.4 KLK5 peptidase 5 (KLK5), transcript variant 449.79513 7.1200718 1, mRNA. 5090671 NM_004864.1 GDF15 Homo sapiens growth differentiation 5769.5931 6.973447 factor 15 (GDF1S), mRNA. 2140678 NM_000210.2 ITGA6 Homo sapiens integrin, alpha 6 840.11549 6.8935233 (ITGA6), transcript variant 2, mRNA. 6400598 NM_001956.2 EDN2 Homo sapiens endothelin 2 (EDN2), 413.72788 6.6769166 mRNA. Homo sapiens mucin 1, cell surface 7650026 NM_001044391.1 MUCI associated (MUCI), transcript variant 4852.0339 6.6129665 6, mRNA. 630619 NM_006665.3 HPSE Homo sapiens heparanase (HPSE), 427.81637 6.5078502 IIRNA. 3440630 NM_031475.1 ESPN Homo sapiens espin (ESPN), mRNA. 454.19041 6.3655196 Homo sapiens sema domain, 5690167 NM_004186.2 SEMA3F immunoglobulin domain (Ig), short 878.6823 6.3213536 basic domain, secreted, (semaphorin) 3F (SEMA3F), mRNA. Homo sapiens mucin 1, cell surface 7200601 NM_001044390.1 MUCI associated (MUCI), transcript variant 1993.9407 6.1415164 5, mRNA. 4540215 NM_012168.4 FBXO2 Homo sapiens F-box protein 2 1028.0779 6.1040847 (FBXO2), mRNA. 2710070 NM_024794.1 ABHD9 Homo sapiens abhydrolase domain 658.51143 6.0216668 containing 9 (ABHD9), mRNA. 155 WO 2011/150105 PCT/US2011/037969 Homo sapiens carboxyl ester lipase 6650593 NM_001807.3 CEL (bile salt-stimulated lipase) (CEL), 706.34469 5.9102946 mRNA. Homo sapiens wingless-type MMTV 6840202 NM_030761.3 WNT4 integration site family, member 4 334.0042 5.8727631 (WNT4), mRNA. 2230594 NM_005562.1 LAMC2 Homo sapiens laminin, gamma 2 2121.2653 5.7208461 (LAMC2), transcript variant 1, mRNA.21.65 57081 Homo sapiens sema domain, immunoglobulin domain (Ig), 5080280 NM_198925.1 SEMA4B transmembrane domain (TM) and short 3141.171 5.6282076 cytoplasmic domain, (semaphorin) 4B (SEMA4B), transcript variant 2, mRNA. Homo sapiens carcinoembryonic 2970286 NM_001024912.1 CEACAMI antigen-related cell adhesion molecule 772.18097 5.6125613 1 (biliary glycoprotein) (CEACAMI), transcript variant 2, mRNA. Homo sapiens biliverdin reductase B 6620521 NM_000713.1 BLVRB (flavin reductase (NADPH)) 1378.2183 5.5066382 (BLVRB), mRNA. 1430332 NM_030916.1 PVRL4 Homo sapiens poliovirus receptor- 318.89358 5.4807557 related 4 (PVRL4), mRNA. Homo sapiens serine peptidase 1710468 NM_003710.3 SPINTI inhibitor, Kunitz type 1 (SPINTI), 364.68577 5.4241339 transcript variant 2, mRNA. 1940438 NM_002632.4 PGF Homo sapiens placental growth factor 680.15295 5.1812351 (PGF), mRNA. Homo sapiens wingless-type MMTV 1500500 NM_058238.1 WNT7B integration site family, member 7B 380.79314 5.0519515 (WNT7B), mRNA. Homo sapiens serpin peptidase 6860424 NM_002974.2 SERPINB4 inhibitor, clade B (ovalbumin), 252.81549 5.0127363 member 4 (SERPINB4), mRNA. Homo sapiens Notch homolog 1, 5080167 NM_017617.3 NOTCHI translocation-associated (Drosophila) 1939.6904 5.0025702 (NOTCH1), mRNA. 3190121 NM_177964.3 LOC130576 Homo sapiens hypothetical protein 579.1413 4.9061371 LOC130576 (L0C130576), mRNA. 5911 .017 3850451 NM_145650.2 MUC15 Homo sapiens mucin 15, cell surface 286.43466 4.811221 associated (MUC 15), mRNA. Homo sapiens regulator of G-protein 6400403 NM_170587.1 RGS20 signaling 20 (RGS20), transcript 868.04351 4.735388 variant 1, mRNA. Homo sapiens epidermal growth factor 1050671 NM_005228.3 EGFR receptor (erythroblastic leukemia viral 1735.7001 4.6955552 (v-erb-b) oncogene homolog, avian) (EGFR), transcript variant 1, mRNA. Homo sapiens ADAM 3440452 NM_207195.1 ADAM15 metallopeptidase domain 15 11906.849 4.6462117 (ADAM15), transcript variant 4, mRNA. Homo sapiens 7160468 NM_005771.3 DHRS9 dehydrogenase/reductase (SDR family) 320.33835 4.6285434 member 9 (DHRS9), transcript variant 1, mRNA. Homo sapiens extracellular matrix 3450521 NM_022664.1 ECM1 protein 1 (ECM1), transcript variant 2, 2471.569 4.5952756 mRNA. 156 WO 2011/150105 PCT/US2011/037969 Homo sapiens FXYD domain 2060687 NM_005971.2 FXYD3 containing ion transport regulator 3 261.91431 4.5631556 (FXYD3), transcript variant 1, mRNA. 4920121 NM_024712.3 ELMO3 Homo sapiens engulfment and cell 365.12117 4.5108903 motility 3 (ELMO3), mRNA. Homo sapiens poliovirus receptor 1740592 NM_203286.1 PVRL1 related 1 (herpesvirus entry mediator 366.3205 4.4889293 C) (PVRL1), transcript variant 3, mRNA. Homo sapiens immunoglobulin 2900674 NM_001542.2 IGSF3 superfamily, member 3 (IGSF3), 1926.0969 4.4661966 transcript variant 1, mRNA. Homo sapiens 1070400 NM_153282.1 HYAL1 hyaluronoglucosaminidase 1 470.08156 4.4429797 (HYAL1), transcript variant 2, mRNA. Homo sapiens serpin peptidase 3310201 NM_006919.1 SERPINB3 inhibitor, clade B (ovalbumin), 239.49889 4.389199 member 3 (SERPINB3), mRNA. 70167 NM_015364.2 LY96 Homo sapiens lymphocyte antigen 96 1222.628 4.2954661 (LY96), mRNA. 1300187 NM_138412.2 RDH13 13 a1-sapiens rtino RehydrogenAse 789.74639 4.2891653 2600170 NM_003561.1 PLA2G1O Homo sapiens phospholipase A2, 284.14086 4.2835877 group X (PLA2G 10), mRNA. Homo sapiens ADAM 1980553 NM_003815.3 ADAM15 metallopeptidase domain 15 1106.6904 4.1967026 (ADAM15), transcript variant 2, mRNA. 4280273 NM_000405.3 GM2A Homo sapiens GM2 ganglioside 782.23171 4.1891468 activator (GM2A), mRNA. Homo sapiens matrix metallopeptidase 7100338 NM_001032278.1 MMP28 28 (MMP28), transcript variant 3, 649.84513 4.109251 mRNA. Homo sapiens seine peptidase 2260326 NM_003122.2 SPINKI inhibitor, Kazal type 1 (SPINKI), 334.0042 4.0439376 mRNA. Homo sapiens sterol regulatory 3390343 NM_001005291.1 SREBF1 element binding transcription factor 1 1090.0174 3.8756978 (SREBF1), transcript variant 1, mRNA. Homo sapiens sulfide quinone 6770707 NM_021199.2 SQRDL reductase-like (yeast) (SQRDL), 1104.6907 3.870897 mRNA. Homo sapiens protein tyrosine 5870553 NM_130440.1 PTPRF phosphatase, receptor type, F (PTPRF), 2962.891 3.8352546 transcript variant 2, mRNA. 6370369 NM_001040021.1 CD14 Homo sapiens CD14 molecule (CD14), 405.43186 3.7596869 transcript variant 2, mRNA. 4730242 NM_175885.3 MGC33846 Homo sapiens hypothetical protein 217.29742 3.6866528 MGC33846 (MGC33846), mRNA. 5670162 NM_153324.2 DEFB123 Homo sapiens defensin, beta 123 245.27869 3.5596164 (DEFB 123), mRNA. Homo sapiens coxsackie virus and 870161 NM_001338.3 CXADR adenovirus receptor (CXADR), 1144.927 3.5244946 mRNA. 2510152 NM_001005502.1 CPM Homo sapiens carboxypeptidase M 255.74749 3.5163503 (CPM), transcript variant 3, mRNA. Homo sapiens beta-site APP-cleaving 1240201 NM_138991.1 BACE2 enzyme 2 (BACE2), transcript variant 760.63805 3.4700577 c, mRNA. 157 WO 2011/150105 PCT/US2011/037969 Homo sapiens v-erb-b2 erythroblastic 3120608 NM_001005915.1 ERBB3 leukemia viral oncogene homolog 3 288.79919 3.4610206 (avian) (ERBB3), transcript variant s, mRNA. Homo sapiens transmembrane 7320753 NM_183247.1 TMPRSS4 protease, serine 4 (TMPRSS4), 205.75177 3.4509611 transcript variant 2, mRNA. 5870685 NM_000565.2 IL6R Homo sapiens interleukin 6 receptor 190.38142 3.4354518 (JL6R), transcript variant 1, mRNA. 150474 NM_001218.3 CA12 Homo sapiens carbonic anhydrase XII 4329.1768 3.406555 (CA12), transcript variant 1, mRNA. Homo sapiens interleukin 1 family, 1240528 NM_173170.1 IL1F5 member 5 (delta) (IL1F5), transcript 200.87109 3.3871458 variant 2, mRNA. 7050082 NM_001611.2 ACP5 Homo sapiens acid phosphatase 5' 332.06077 3.3533212 tartrate resistant (ACP5), mRNA. Homo sapiens protease, seine, 2 2690452 NM_002770.2 PRSS2 (trypsin 2) (PRSS2), transcript variant 232.92065 3.3497684 1, nRNA. 4480341 NM_014762.3 DHCR24 Homo sapiens 24-dehydrocholesterol 1309.6802 3.3345305 reductase (DHCR24), mRNA. Homo sapiens microseminoprotein, 5900368 NM_002443.2 MSMB beta- (MSMB), transcript variant 172.45634 3.3170342 PSP94, mRNA. Homo sapiens gelsolin (amyloidosis, 3940204 NM_000177.3 GSN Finnish type) (GSN), transcript variant 313.71232 3.2572461 1, mRNA. Homo sapiens D site of albumin 7050458 NM_001352.2 DBP promoter (albumin D-box) binding 412.89292 3.2551438 protein (DBP), mRNA. Homo sapiens kallikrein-related 2970154 NM_001012964.1 KLK6 peptidase 6 (KLK6), transcript variant 227.67743 3.2517256 B, mRNA. Homo sapiens hydroxysteroid (17 1450397 NM_014234.3 HSD17B8 beta) dehydrogenase 8 (HSD17B8), 703.41047 3.2157958 mRNA. Homo sapiens interleukin 28 receptor, 3520398 NM_170743.2 IL28RA alpha (interferon, lambda receptor) 230.63717 3.1856145 (IL28RA), transcript variant 1, mRNA. Homo sapiens immunoglobulin 4230608 NM_001542.2 IGSF3 superfamily, member 3 (IGSF3), 343.22714 3.1475876 transcript variant 1, mRNA. Homo sapiens protein tyrosine 3060398 NM_002840.3 PTPRF phosphatase, receptor type, F (PTPRF), 5598.9233 3.142478 transcript variant 1, mRNA. Homo sapiens transmembrane 130324 NM_005656.2 TMPRSS2 protease, seine 2 (TMPRSS2), 207.65324 3.1137628 mRNA. 1780603 NM_000565.2 IL6R Homo sapiens interleukin 6 receptor 177.97522 3.1109942 (IL6R), transcript variant 1, mRNA. Homo sapiens wingless-type MMTV 2710343 NM_025216.2 WNT1OA integration site family, member 10A 201.64358 3.1089036 (WNT1OA), mRNA. 7210681 NM_006033.2 LIPG Homo sapiens lipase, endothelial 626.37611 3.1045914 (LJPG), mRNA. Homo sapiens CD44 molecule (Indian 360719 NM_000610.3 CD44 blood group) (CD44), transcript variant 238.459 3.0575203 1, mRNA. 460575 NM_080647.1 TBX1 Homo sapiens T-box 1 (TBX1), 263.86335 3.0454555 transcript variant C, mRNA. 158 WO 2011/150105 PCT/US2011/037969 5910491 NM_004466.3 GPC5 Homo sapiens glypican 5 (GPC5), 234.99218 3.0242297 mRNA. 7570608 NM_000210.2 ITGA6 Homo sapiens integrin, alpha 6 177.97522 3.0134697 (JTGA6), transcript variant 2, mRNA. Homo sapiens chromosome Y open 7150066 NR_001544.1 CYorfl4 reading frame 14 (CYorfl4) on 217.52824 3.0004116 chromosome Y. Homo sapiens mucin 1, cell surface 520128 NM_002456.4 MUCi associated (MUCI), transcript variant 234.15715 2.9594641 1, mRNA. Homo sapiens nudix (nucleoside 110092 NM_177533.2 NUDT14 diphosphate linked moiety X)-type 2006.7158 2.9399264 motif 14 (NUDT14), mRNA. 2680725 NM_001099.2 ACPP Homo sapiens acid phosphatase, 210.51711 2.9313669 prostate (ACPP), mRNA. 4900561 NM_006905.2 PSG1 Homo sapiens pregnancy specific beta- 222.1236 2.9110926 1-glycoprotein 1 (PSG1), mRNA. 3710022 NM_006512.1 SAA4 Homo sapiens serum amyloid A4, 180.40177 2.8710248 constitutive (SAA4), mRNA. 4780671 NM_014584.1 ERO1L Homo sapiens ERO1-like (S. 2254.5395 2.8708328 cerevisiae) (ERO1L), mRNA. 6510270 NM_003019.4 SFTPD Homo sapiens surfactant, pulmonary- 231.95664 2.8684039 associated protein D (SFTPD), mRNA. 4670162 NM_004390.3 CTSH Homo sapiens cathepsin H (CTSH), 232.66445 2.8446854 transcript variant 1, mRNA. Homo sapiens calcium/calmodulin 940747 NM_020439.2 CAMK1G dependent protein kinase IG 283.93909 2.8270591 (CAMK1G), mRNA. Homo sapiens pregnancy specific beta 4210500 NM_002780.3 PSG4 1-glycoprotein 4 (PSG4), transcript 739.46873 2.7741191 variant 1, mRNA. 3830075 NM_001218.3 CA12 Homo sapiens carbonic anhydrase XII 878.3208 2.7702408 (CA12), transcript variant 1, mRNA. 6840154 NM_002407.1 SCGB2A1 Homo sapiens secretoglobin, family 148.89506 2.7679509 2A, member 1 (SCGB2A1), mRNA. 2340692 NM_000435.1 NOTCH3 Homo sapiens Notch homolog 3 1597.322 2.7182867 (Drosophila) (NOTCH3), mRNA. 7040100 NM_014420.2 DKK4 Homo sapiens dickkopf homolog 4 150.53901 2.686976 (Xenopus laevis) (DKK4), mRNA. Homo sapiens spectrin repeat 160121 NM_015180.4 SYNE2 containing, nuclear envelope 2 254.49204 2.6858696 (SYNE2), transcript variant 1, mRNA. 50307 NM_016946.3 F11R Homo sapiens F1I receptor (F11R), 182.75361 2.6311864 transcript variant 1, mRNA. 4150725 NM_018891.1 LAMC2 Homo sapiens laminin, gamma 2 236.3733 2.6278956 (LAMC2), transcript variant 2, mRNA. Homo sapiens very low density 5390661 NM_001018056.1 VLDLR lipoprotein receptor (VLDLR), 1341.6586 2.6219307 transcript variant 2, mRNA. Homo sapiens protein phosphatase 1, 1230068 NM_006242.3 PPP1R3D regulatory (inhibitor) subunit 3D 408.21608 2.5704246 (PPP1R3D), mRNA. 150180 NM_002425.1 MMP1O Homo sapiens matrix metallopeptidase 595.2028 2.5680915 10 (stromelysin 2) (MMP1O), mRNA. Homo sapiens sterol regulatory 6840044 NM_004176.3 SREBF1 element binding transcription factor 1 337.45649 2.5586771 (SREBF1), transcript variant 2, mRNA. 159 WO 2011/150105 PCT/US2011/037969 2000292 NM_052863.2 SCGB3A1 Homo sapiens secretoglobin, family 154.27456 2.5540489 3A, member 1 (SCGB3A1), mRNA. Homo sapiens jumonji, AT rich 5870739 NM_004653.3 JARIDID interactive domain ID (JARIDID), 170.08982 2.5306953 mRNA. Homo sapiens lymphotoxin beta 4640064 NM_002342.1 LTBR receptor (TNFR superfamily, member 1567.2895 2.5295356 3) (LTBR), mRNA. Homo sapiens endoplasmic reticulum 3290008 NM_152461.2 ERNI to nucleus signalling 1 (ERNI), 478.42906 2.5142523 transcript variant 2, mRNA. Homo sapiens tumor necrosis factor 3990224 NM_148973.1 TNFRSF25 receptor superfamily, member 25 1037.6814 2.5077172 (TNFRSF25), transcript variant 10, mRNA. Homo sapiens collagen, type XXV, 3180035 NM_032518.2 COL25A1 alpha 1 (COL25A1), transcript variant 134.88658 2.5027769 2, mRNA. 4730019 NM_004429.3 EFNB1 Homo sapiens ephrin-B1 (EFNB 1), 526.71991 2.4902158 IIRNA. Homo sapiens beta-site APP-cleaving 2230731 NM_138992.1 BACE2 enzyme 2 (BACE2), transcript variant 506.17021 2.4751939 b, mRNA. Homo sapiens extracellular matrix 3440386 NM_004425.2 ECM1 protein 1 (ECM1), transcript variant 1, 1155.933 2.4687599 mRNA. Homo sapiens palmitoyl-protein 1660575 NM_138717.1 PPT2 thioesterase 2 (PPT2), transcript 315.47979 2.4602 variant 2, mRNA. 6350243 NM_000228.2 LAMB3 Homo sapiens pt va 3 139.59808 2.453857 (LAMB3), transcript variant 1, mRNA. 19588 2435 4040176 NM_005560.3 LAMA5 Homo sapiens lamnin, alpha 5 7219.8583 2.4510366 (LAMAS), inRNA. 4280487 NM_003296.1 CRISP2 Homo sapiens cysteine-rich secretory 168.93599 2.4460628 protein 2 (CRJSP2), mRNA. 6840184 NM_002087.2 GRN Homo sapiens granulin (GRN), 4120.6518 2.4418368 mRNA. Homo sapiens ficolin 1170274 NM_003665.2 FCN3 (collagen/fibrinogen domain 151.5559 2.4264796 containing) 3 (Hakata antigen) (FCN3), transcript variant 1, mRNA. 1940021 NM_002087.2 GRN Homo sapiens granulin (GRN), 5512.9174 2.4177893 mRNA. Homo sapiens CUB domain containing 5260367 NM_022842.3 CDCP1 protein 1 (CDCP1), transcript variant 930.27419 2.4175267 1, mRNA. Homo sapiens ADAM 6480131 NM_207195.1 ADAM15 metallopeptidase domain 15 586.26239 2.413113 (ADAMi15), transcript variant 4, mRNA. Homo sapiens Rho guanine nucleotide 6250370 NM_032995.1 ARHGEF4 exchange factor (GEF) 4 (ARHGEF4), 155.01003 2.404487 transcript variant 2, mRNA. Homo sapiens kallikrein-related 2690647 NM_144947.1 KLK11 peptidase 11 (KLK11), transcript 164.67109 2.4034335 variant 2, mRNA. Homo sapiens interleukin 16 5080615 NM_172217.2 IL16 (lymphocyte chemoattractant factor) 207.52463 2.3994761 (IL16), transcript variant 2, mRNA. 160 WO 2011/150105 PCT/US2011/037969 Homo sapiens intercellular adhesion 730554 NM_001544.2 ICAM4 molecule 4, Landsteiner-Wiener blood 160.64528 2.3948233 group (ICAM4), transcript variant 1, mRNA. Homo sapiens iduronate 2-sulfatase 2600138 NM_006123.2 IDS (Hunter syndrome) (IDS), transcript 275.57603 2.3871655 variant 2, mRNA. 6330438 NM_002673.3 PLXNB1 Homo sapiens plexin BI (PLXNB 1), 617.03555 2.3729273 mRNA. Homo sapiens Rho GTPase activating 6760482 NM_001017526.1 ARHGAP8 protein 8 (ARHGAP8), transcript 143.1233 2.3593814 variant 1, mRNA. Homo sapiens pregnancy specific beta 5690681 NM_002780.3 PSG4 1-glycoprotein 4 (PSG4), transcript 201.99808 2.3556352 variant 1, mRNA. Homo sapiens chromosome 7 open 2900504 NM_015949.2 C7orf2O reading frame 20 (C7orf2O), mRNA. 914.8587 2.3298429 XM_946081 XM_946082 XM_946083 780341 NM_031455.2 CCDC3 Homo sapiens coiled-coil domain 397.2472 2.3289683 containing 3 (CCDC3), mRNA. 4880730 NM_005992.1 TBX1 Homo sapiens T-box 1 (TBX1)' 224.51755 2.3209074 transcript variant B, mRNA. 5570053 NM_002587.3 PCDH1 Homo sapiens protocadherin 1 145.52227 2.2811776 (PCDH1), transcript variant 1, mRNA. Homo sapiens mitogen-activated 1440440 NM_004635.3 MAPKAPK3 protein kinase-activated protein kinase 2444.995 2.2757096 3 (MAPKAPK3), mRNA. Homo sapiens matrix metallopeptidase 4810477 NM_024302.3 MMP28 28 (MMP28), transcript variant 1, 153.45627 2.2704749 mRNA. 6450482 NM_014432.2 IL20RA Homo sapiens interleukin 20 receptor, 173.97367 2.2703956 alpha (JL2ORA), mRNA. Homo sapiens CUB domain containing 60215 NM_178181.1 CDCP1 protein 1 (CDCP1), transcript variant 680.15295 2.2310038 2, mRNA. Homo sapiens heparan sulfate 6-0 830491 NM_001077188.1 HS6ST2 sulfotransferase 2 (HS6ST2), transcript 183.07035 2.2194489 variant L, mRNA. 430768 NM_005865.2 PRSS16 Homo sapiens protease, seine, 16 151.91047 2.2172063 (thymus) (PRSS16), mRNA. Homo sapiens chromosome 7 open 6560608 NM_015949.2 C7orf2O reading frame 20 (C7orf2O), mRNA. 351.15973 2.2124788 XM 946081 XM_946082 XM_946083 1570725 NM_144772.1 APOA1BP Homo sapiens apolipoprotein A-I 3413.7013 2.2047586 binding protein (APOA1BP), mRNA. 34.71 22058 6510332 NM_004431.2 EPHA2 Homo sapiens EPH receptor A2 684.48171 2.2033049 (EPHA2), mRNA. 2070543 NM_025258.2 C6orf27 Homo sapiens chromosome 6 open 143.31785 2.193199 reading frame 27 (C6orf27), mRNA. 13375 2139 3180195 NM_023004.5 RTN4R Homo sapiens reticulon 4 receptor 185.99749 2.1846125 (RTN4R), mRNA. 1340626 NM_002989.2 CCL21 Homo sapiens chemokine (C-C motif) 136.5076 2.1824786 ligand 21 (CCL2 1), mRNA. 3840240 NM_012315.1 KLK9 Homo sapiens kallikrein-related 109.68798 2.1817473 peptidase 9 (KLK9), mRNA. 161 WO 2011/150105 PCT/US2011/037969 Homo sapiens MAM domain 5690445 NM_153487.3 MDGA1 containing 243.82847 2.1679732 glycosylphosphatidylinositol anchor 1 (MDGA1), mRNA. 510546 NM_022119.3 PRSS22 Homo sapiens protease, serine, 22 134.75516 2.1658848 (PRSS22), mRNA. 6180427 NM_015714.2 GOS2 Homo sapiens GO/Glswitch 2 (GOS2), 358.82876 2.1530806 mRNA. 5220035 NM_020127.1 TUFTI Homo sapiens tuftelin 1 (TUFTI), 1518.1202 2.1245047 mRNA. Homo sapiens interleukin 17 receptor 4060017 NM_001080973.1 IL17RD D (IL17RD), transcript variant 1, 921.43628 2.1147931 mRNA. 940327 NM_015596.1 KLK13 Homo sapiens kallikrein-related 107.40553 2.1124757 peptidase 13 (KLK13), mRNA. Homo sapiens lymphocyte antigen 6 1690685 NM_025261.1 LY6G6C complex, locus G6C (LY6G6C), 152.816 2.1018848 mRNA. Homo sapiens chromosome 20 open 1990142 NM_033197.2 C20orf114 reading frame 114 (C20orf114), 116.48938 2.0997688 mRNA. Homo sapiens hypoxia-inducible 7320441 NM_013332.3 HIG2 protein 2 (HIG2), transcript variant 1, 724.30398 2.0952597 mRNA. 3610735 NM_000505.3 F12 Homo sapiens coagulation factor XII 550.67802 2.0847369 (Hageman factor) (F12), mRNA. 1190367 NM_003897.3 IER3 Homo sapiens immediate early 8554.2779 2.0741166 response 3 (JER3), mRNA. Homo sapiens cysteine-rich with EGF 2940561 NM_001031717.1 CRELDI like domains 1 (CRELDI), transcript 176.98717 2.072973 variant 1, mRNA. 4280577 NM_001200.2 BMP2 Homo sapiens bone morphogenetic 464.94661 2.0607818 protein 2 (BMP2), mRNA. Homo sapiens bromodomain adjacent 940288 NM_182648.1 BAZIA to zinc finger domain, 1A (BAZIA), 1002.2842 2.047449 transcript variant 2, mRNA. Homo sapiens tafazzin (cardiomyopathy, dilated 3A (X 2140736 NM_181314.1 TAZ linked); endocardial fibroelastosis 2; 159.53407 2.0305812 Barth syndrome) (TAZ), transcript variant 5, mRNA. Homo sapiens v-maf 3610440 NM_005360.3 MAF musculoaponeurotic fibrosarcoma 739.72684 2.0288822 oncogene homolog (avian) (MAF), transcript variant 1, mRNA. Homo sapiens SRY (sex determining 1300445 NM_178424.1 SOX30 region Y)-box 30 (SOX30), transcript 134.29897 2.0285834 variant 1, mRNA. Homo sapiens leucine rich repeat (in 3400754 NM_004735.2 LRRFIP1 FLII) interacting protein 1 (LRRFIP1), 2534.8991 2.0184836 mRNA. 3180672 NM_004862.2 LITAF Homo sapiens lipopolysaccharide- 9426.0345 2.0055994 induced TNF factor (LITAF), mRNA. 94605 2.594 NHAC P4 Normal human articular chondrocytes ProbelD RefSeqID Symbol Definition RFU Fold over Homo sapiens phospholipase A2, 4860152 NM_000300.2 PLA2G2A group HA (platelets, synovial fluid) 8779.2857 89.756445 (PLA2G2A), mRNA. 162 WO 2011/150105 PCT/US2011/037969 610598 NM_004000.2 CHI3L2 Homo sapiens chitinase 3-like 2 11489.875 62.89519 (CHJ3L2), transcript variant 1, mRNA. Homo sapiens WNT1 inducible 3310333 NM_003880.2 WISP3 signaling pathway protein 3 (WISP3), 3566.9065 56.609756 transcript variant 1, mRNA. Homo sapiens collagen, type IX, alpha 6940114 NM_001851.3 COL9A1 1 (COL9A1), transcript variant 1, 8047.6049 54.287425 mRNA. 6980767 NM_006533.2 MIA Homo sapiens melanoma inhibitory 3449.8634 36.632168 activity (MIA), mRNA. Homo sapiens collagen, type II, alpha 1 (primary osteoarthritis, 4010136 NM_001844.3 COL2A1 spondyloepiphyseal dysplasia, 19047.355 33.211937 congenital) (COL2A1), transcript variant 1, mRNA. 2370438 NM_000014.4 A2M Homo sapiens alpha-2-macroglobulin 3092.1437 30.776036 (A2M), mRNA. Homo sapiens serpin peptidase inhibitor, clade A (alpha-i 6380484 NM_001002235.1 SERPINAl antiproteinase, antitrypsin), member 1 3695.9956 30.468528 (SERPINA1), transcript variant 3, mRNA. 1110048 NM_007281.1 SCRG1 Homo sapiens scrapie responsive 37477.52 28.325628 protein 1 (SCRG1), mRNA. Homo sapiens matrix metallopeptidase 7400400 NM_002422.3 MMP3 3 (stromelysin 1, progelatinase) 5549.446 26.001629 (MMP3), mRNA. Homo sapiens procollagen C 4810445 NM_013363.2 PCOLCE2 endopeptidase enhancer 2 14298.298 25.645233 (PCOLCE2), mRNA. Homo sapiens leukocyte cell derived 4560626 NM_007015.2 LECTI chemotaxin 1 (LECTi), transcript 6418.5507 24.925612 variant 1, mRNA. 2360066 NM_178127.2 ANGPTL5 Homo sapiens angiopoietin-like 5 1800.5978 24.861459 (ANGPTLS), mRNA. 2630437 NM_022138.1 SMOC2 Homo sapiens SPARC related modular 2359.2687 23.476162 calcium binding 2 (SMOC2), mRNA. 5690095 NM_004962.2 GDF1O Homo sapiens growth differentiation 3388.6546 21.60137 factor 10 (GDF1O), mRNA. Homo sapiens serpin peptidase inhibitor, clade A (alpha-i 730047 NM_001002236.1 SERPINAl antiproteinase, antitrypsin), member 1 4016.6404 20.407282 (SERPINA1), transcript variant 2, mRNA. Homo sapiens collagen, type XI, alpha 1450392 NM_080681.2 COL11A2 2 (COL11A2), transcript variant 2, 2293.9631 19.024155 mRNA. 3890095 NM_003102.2 SOD3 Homo sapiens superoxide dismutase 3' 2057.2196 18.519319 extracellular (SOD3), mRNA. Homo sapiens SPARC related modular 840008 NM_001034852.1 SMOCi calcium binding 1 (SMOCi), transcript 2036.9855 17.6638 variant 1, mRNA. 1710484 NM_002023.3 FMOD Homo sapiens fibromodulin (FMOD), 4152.8251 17.324867 IIRNA. 6220019 NM_006211.2 PENK Homo sapiens proenkephalin (PENK), 17105.808 16.751489 mRNA. Homo sapiens serpin peptidase 6280168 NM_001085.4 SERPINA3 inhibitor, clade A (alpha-i 23635.518 16.04099 antiproteinase, antitrypsin), member 3 (SERPINA3), mRNA. 163 WO 2011/150105 PCT/US2011/037969 Homo sapiens WNT1 inducible 520717 NM_198239.1 WISP3 signaling pathway protein 3 (WISP3), 865.64985 15.797566 transcript variant 3, mRNA. 5490019 NM_002084.3 GPX3 Homo sapiens glutathione peroxidase 3 5321.2028 15.290579 (plasma) (GPX3), mRNA. 2320767 NM_002381.4 MATN3 Homo sapiens matrilin 3 (MATN3), 6733.5934 15.155547 mRNA. Homo sapiens proprotein convertase 520176 NM_000439.3 PCSK1 subtilisin/kexin type 1 (PCSK1), 991.76991 14.504901 mRNA. 3370113 NM_001463.2 FRZB Homo sapiens frizzled-related protein 11107.818 14.180284 (FRZB), mRNA. 6380040 NM_001852.3 COL9A2 Homo sapiens collagen, type IX, alpha 8605.1021 14.048448 1 - 2 (COL9A2), mRNA. 7400735 NM_002345.3 LUM Homo sapiens lumican (LUM), 6307.2208 13.824817 IIRNA. Homo sapiens ectonucleotide 2490152 NM_001040092.1 ENPP2 pyrophosphatase/phosphodiesterase 2 3157.8524 13.819855 (autotaxin) (ENPP2), transcript variant 2, mRNA. Homo sapiens 1070400 NM_153282.1 HYAL1 hyaluronoglucosaminidase 1 1445.3923 13.661137 (HYAL1), transcript variant 2, mRNA. Homo sapiens ectonucleotide 840678 NM_001040092.1 ENPP2 pyrophosphatase/phosphodiesterase 2 4084.0186 13.477384 (autotaxin) (ENPP2), transcript variant 2, mRNA. 270470 NM_030592.1 MATN4 Homo sapiens matrilin 4 (MATN4), 1651.9142 13.414078 transcript variant 3, mRNA. Homo sapiens Clq and tumor necrosis 5220639 NM_030945.2 C1QTNF3 factor related protein 3 (C1QTNF3), 1433.6951 12.91175 transcript variant 1, mRNA. Homo sapiens serpin peptidase inhibitor, clade A (alpha-i 6770333 NM_000295.3 SERPINAl antiproteinase, antitrypsin), member 1 805.70796 12.402276 (SERPINA1), transcript variant 1, mRNA. Homo sapiens chitinase 3-like 1 1780014 NM_001276.1 CHI3L1 (cartilage glycoprotein-39) (CHJ3L1), 668.69543 12.143267 mRNA. 7380246 NM_030592.1 MATN4 Homo sapiens matrilin 4 (MATN4), 1316.7864 11.875961 transcript variant 3, mRNA. 4540215 NM_012168.4 FBXO2 Homo sapiens F-box protein 2 1979.8718 11.755242 (FBXO2), inRNA. Homo sapiens N-acetylated alpha 4120626 NM_005468.2 NAALADL1 linked acidic dipeptidase-like 1 1049.9822 11.4553 (NAALADL1), mRNA. Homo sapiens hyaluronan and 1850397 NM_001884.2 HAPLN1 proteoglycan link protein 1 3403.187 10.890613 (HAPLN1), mRNA. 5290333 NM_152520.3 ZNF533 Homo sapiens zinc finger protein 533 949.57493 10.805817 (ZNFS33), mRNA. 4480152 NM 014057.3 OGN Homo sapiens osteoglycin (OGN), 2791.0782 10.516614 - - transcript variant 3, mRNA. 4610424 NM_006744.3 RBP4 Homo sapiens retinol binding protein 700.27117 10.152378 4, plasma (RBP4), mRNA. Homo sapiens EGF-containing fibulin 6250563 NM_004105.3 EFEMPI like extracellular matrix protein 1 7944.7305 10.002815 (EFEMPI), transcript variant 1, mRNA. 164 WO 2011/150105 PCT/US2011/037969 3930020 NM_003793.2 CTSF Homo sapiens cathepsin F (CTSF), 1626.0508 9.7827882 mRNA. 1070333 NM_001323.2 CST6 Homo sapiens cystatin E/M (CST6), 856.8146 9.6605305 IIRNA. Homo sapiens tumor necrosis factor 6840020 NM_006573.3 TNFSF13B (ligand) superfamily, member 13b 902.01062 9.6224695 (TNFSF13B), mRNA. Homo sapiens FXYD domain 5860022 NM_021902.2 FXYD1 containing ion transport regulator 1 835.18702 9.0987967 (phospholemman) (FXYD1), transcript variant b, mRNA. 3520634 NM_001853.3 COL9A3 Homo sapiens collagen, type IX, alpha 943.4604 9.0596246 3 (COL9A3), mRNA. Homo sapiens fibroblast growth factor 6520139 NM_022965.1 FGFR3 receptor 3 (achondroplasia, 3378.2842 8.9122574 thanatophoric dwarfism) (FGFR3), transcript variant 2, mRNA. Homo sapiens fibroblast growth factor 4480220 NM_021923.3 FGFRL1 receptor-like 1 (FGFRL1), transcript 7637.206 8.0829194 variant 3, mRNA. Homo sapiens extracellular matrix 6840192 NM_001393.2 ECM2 protein 2, female organ and adipocyte 2316.0611 8.0783431 specific (ECM2), mRNA. Homo sapiens FXYD domain 3850500 NM_005031.3 FXYD1 containing ion transport regulator 1 753.68186 8.0200986 (phospholemman) (FXYD1), transcript variant a, mRNA. 2370593 NM_005708.2 GPC6 Homo sapiens glypican 6 (GPC6), 3674.3805 7.944592 mRNA. 2710735 NM_016084.3 RASD1 Homo sapiens RAS, dexamethasone- 2264.1571 7.8967225 induced 1 (RASD1), mRNA. 2140707 NM_003064.2 SLPI Homo sapiens secretory leukocyte 1133.559 7.7551223 peptidase inhibitor (SLPI), mRNA. 5810746 NM_002380.3 MATN2 Homo sapiens matrilin 2 (MATN2), 5908.2373 7.4627802 transcript variant 1, mRNA. 4010491 XM_001129442.1 CST6 PREDICTED: Homo sapiens cystatin 679.40236 7.4295754 E/M (CST6), mRNA. Homo sapiens 1980300 NM_153283.1 HYALl hyaluronoglucosaminidase 1 456.05811 7.3670716 (HYAL1), transcript variant 3, mRNA. 6510270 NM_003019.4 SFTPD Homo sapiens surfactant, pulmonary- 593.17906 7.3353242 associated protein D (SFTPD), mRNA. 6900170 NM_003833.2 MATN4 Homo sapiens matrilin 4 (MATN4), 569.7292 7.2945742 transcript variant 1, mRNA. 5550719 NM_133503.2 DCN Homo sapiens decorin (DCN), 9253.463 7.2718427 transcript variant A2, mRNA. Homo sapiens vitamin K epoxide 6450546 NM_024006.4 VKORC1 reductase complex, subunit 1 9604.3245 7.2169837 (VKORC1), transcript variant 1, mRNA. 2940280 NM_014057.3 OGN Homo sapiens osteoglycin (OGN), 3583.3531 7.1712864 transcript variant 3, mRNA. Homo sapiens fibroblast growth factor 5860112 NM_001004358.1 FGFRL1 receptor-like 1 (FGFRL1), transcript 1619.3007 7.0615987 variant 2, mRNA. Homo sapiens sarcoglycan, delta 2450327 NM_172244.2 SGCD (35kDa dystrophin-associated 840.94565 7.0592353 glycoprotein) (SGCD), transcript variant 2, mRNA. 165 WO 2011/150105 PCT/US2011/037969 670215 NM_002380.3 MATN2 Homo sapiens matrilin 2 (MATN2), 670.20723 7.0358357 transcript variant 1, mRNA. Homo sapiens serpin peptidase 520240 NM_005025.2 SERPINI1 inhibitor, clade I (neuroserpin), 425.76128 6.9151931 member 1 (SERPINII), mRNA. 2810673 NM_152739.3 HOXA9 Homo sapiens homeobox A9 928.70708 6.5631663 (HOXA9), mRNA. Homo sapiens Ciq and tumor necrosis 1500373 NM_181435.4 C1QTNF3 factor related protein 3 (CiQTNF3), 602.76711 6.4782214 transcript variant 2, mRNA. 6370369 NM_001040021.1 CD14 Homo sapiens CD14 molecule (CD14), 689.38186 6.3928374 transcript variant 2, mRNA. 7200427 NM_017413.3 APLN Homo sapiens apelin (APLN), mRNA. 615.64174 6.1866017 Homo sapiens serpin peptidase 3290630 NM_000624.3 SERPINA5 inhibitor, clade A (alpha-i 1067.5804 6.1073543 antiproteinase, antitrypsin), member 5 (SERPINA5), mRNA. 6590538 NM_001063.2 TF Homo sapiens transferrin (TF), 485.39794 6.0782396 mRNA. 1660075 NM_018058.4 CRTAC1 Homo sapiens cartilage acidic protein 834.70177 6.0569329 1 (CRTACi), mRNA. Homo sapiens complement component 7400707 NM_001734.2 CiS 1, s subcomponent (CIS), transcript 6258.5251 5.9517899 variant 1, mRNA. 1090326 NM_003256.2 TIMP4 Homo sapiens TIMP metallopeptidase 2260.9788 5.8941899 inhibitor 4 (TJIP4), mRNA. 7510113 NM_033254.2 BOC Homo sapiens Boc homolog (mouse) 510.18584 5.8693384 (BOC), mRNA. Homo sapiens proline/arginine-rich 7000446 NM_201348.1 PRELP end leucine-rich repeat protein 604.05192 5.6477861 (PRELP), transcript variant 2, mRNA. 1230228 NM_013404.3 MSLN Homo sapiens mesothelin (MSLN), 574.87655 5.3447959 transcript variant 2, mRNA. Homo sapiens G protein-coupled 7510634 NM_018653.3 GPRC5C receptor, family C, group 5, member C 1342.9789 5.3175636 (GPRCSC), transcript variant 2, 13298 5.766 mRNA. 6480204 NM_006288.2 THY1 Homo sapiens Thy-i cell surface 12522.001 5.256422 antigen (THY1), mRNA. 1430487 NM_000900.2 MGP Homo sapiens matrix Gla protein 18783.155 5.1856597 (MGP), mRNA. 3450066 NM_001147.1 ANGPT2 Homo sapiens angiopoietin 2 454.61814 5.1411334 (ANGPT2), mRNA. 1780673 NM_003864.3 SAP30 Homo sapiens Sin3A-associated 2968.1676 5.0703069 protein, 3OkDa (SAP3O), mRNA. 3800204 NM_006334.3 OLFMI Homo sapiens olfactomedin 1 459.58599 5.01445 (OLFMi), transcript variant 2, mRNA.45.89 5015 Homo sapiens angiotensinogen (serpin 2850301 NM_000029.2 AGT peptidase inhibitor, clade A, member 468.13606 4.9875887 8) (AGT), mRNA. 60427 NM_005013.2 NUCB2 Homo sapiens nucleobindin 2 5311.9878 4.961742 (NUCB2), mRNA. 7150634 NM_001647.2 APOD Homo sapiens apolipoprotein D 3902.136 4.9522364 (APOD), mRNA. Homo sapiens EGF-containing fibulin 1260040 NM_004105.3 EFEMPI like extracellular matrix protein 1 6332.4214 4.9361338 (EFEMPI), transcript variant 1, mRNA. 166 WO 2011/150105 PCT/US2011/037969 Homo sapiens G protein-coupled 1170477 NM_022036.2 GPRC5C receptor, family C, group 5, member C 557.64395 4.9097257 (GPRC5C), transcript variant 1, mRNA. Homo sapiens SPARC related modular 4260097 NM_001034852.1 SMOCI calcium binding 1 (SMOCI), transcript 325.23628 4.7811294 variant 1, mRNA. Homo sapiens ribonuclease, RNase A 6590041 NM_194431.1 RNASE4 family, 4 (RNASE4), transcript variant 7787.6016 4.7624431 3, mRNA. 6620121 NM_005623.2 CCL8 Homo sapiens chemokine (C-C motif) 365.43503 4.7350407 ligand 8 (CCL8), mRNA. Homo sapiens peptidylprolyl 7000114 NM_000943.4 PPIC isomerase C (cyclophilin C) (PPIC), 8068.5353 4.698989 mRNA. 2680072 NM_014279.4 OLFM1 Homo sapiens olfactomedin 1 732.82006 4.6862804 (OLFM1), transcript variant 1, mRNA. 2320598 NM_000266.1 NDP Homo sapiens Noraie disease 951.73636 4.5901015 (pseudoglioma) (NDP), mRNA. 4390193 NM_001014447.1 CPZ Homo sapiens carboxypeptidase Z 1460.4976 4.5743623 (CPZ), transcript variant 1, mRNA. Homo sapiens ADAM 6900086 NM_006988.3 ADAMTS1 metallopeptidase with thrombospondin 2690.5128 4.5648358 type 1 motif, 1 (ADAMTS 1), mRNA. 5340064 NM_001014447.1 CPZ Homo sapiens carboxypeptidase Z 656.79764 4.5007851 (CPZ), transcript variant 1, mRNA. Homo sapiens cytochrome P450, 3290048 NM_178033.1 CYP4X1 family 4, subfamily X, polypeptide 1 315.7944 4.4115026 (CYP4X1), mRNA. 4390398 NM_005564.3 LCN2 Homo sapiens lipocalin 2 (LCN2), 635.03997 4.3885936 IIRNA. Homo sapiens EGF-containing fibulin 6900408 NM_001039348.1 EFEMPI like extracellular matrix protein 1 20016.516 4.3799117 (EFEMPI), transcript variant 2, mRNA. 1580709 NM_007361.3 NID2 Homo sapiens nidogen 2 650.39926 4.3438832 (osteonidogen) (NJD2), mRNA. Homo sapiens cysteine-rich with EGF 3400619 NM_001031717.2 CRELDI like domains 1 (CRELDI), transcript 4477.0171 4.307634 variant 1, mRNA. 1510382 XM_938935.2 NXPH4 PREDICTED: Homo sapiens 810.2528 4.2042598 neurexophilin 4 (NXPH4), mRNA. Homo sapiens deleted in lymphocytic 5490053 NR_002605.1 DLEU1 leukemia, 1 (DLEU1) on chromosome 1713.1847 4.1908968 13. 5390687 NM_001873.1 CPE Homo sapiens carboxypeptidase E 3739.6668 4.1785551 (CPE), mRNA. Homo sapiens interleukin 11 receptor, 2570646 NM_004512.3 ILIRA alpha (ILIRA), transcript variant 1, 891.76445 3.9638057 mRNA. 6980064 NM_001718.4 BMP6 Homo sapiens bone morphogenetic 412.30944 3.9142253 protein 6 (BMP6), mRNA. Homo sapiens ribonuclease, RNase A 7040333 NM_194430.1 RNASE4 family, 4 (RNASE4), transcript variant 1612.176 3.8705513 1, mRNA. 7650497 NM_001972.2 ELA2 Homo sapiens elastase 2, neutrophil 260.53466 3.8609629 (ELA2), mRNA. 70167 NM_015364.2 LY96 Homo sapiens lymphocyte antigen 96 1098.7479 3.8602375 (LY96), mRNA. 167 WO 2011/150105 PCT/US2011/037969 Homo sapiens sarcoglycan, delta 70088 NM_000337.4 SGCD (35kDa dystrophin-associated 283.009 3.8526774 glycoprotein) (SGCD), transcript variant 1, mRNA. Homo sapiens ribonuclease, RNase A 5910382 NM_194430.1 RNASE4 family, 4 (RNASE4), transcript variant 2769.2712 3.8480607 1, mRNA. Homo sapiens core 1 synthase, 580066 NM_020156.1 CIGALTI glycoprotein-N-acetylgalactosamine 3- 599.67832 3.7994292 beta-galactosyltransferase, 1 (CIGALTI), mRNA. 1820300 NM_001334.2 CTSO Homo sapiens cathepsin 0 (CTSO), 1545.0075 3.7547142 mRNA. Homo sapiens angiogenin, 3930392 NM_001097577.1 ANG ribonuclease, RNase A family, 5 3406.7434 3.6923637 (ANG), transcript variant 2, mRNA. 7000369 NM_000591.2 CD14 Homo sapiens CD14 molecule (CD14), 233.78156 3.684794 transcript variant 1, mRNA. Homo sapiens sphingomyelin 1500193 NM_001007593.1 SMPD1 phosphodiesterase 1, acid lysosomal 877.27434 3.6212878 (SMPD1), transcript variant 2, mRNA. Homo sapiens collagen, type IX, alpha 1340671 NM_001851.3 COL9A1 1 (COL9A1), transcript variant 1, 232.44145 3.5423557 mRNA. 670608 NM_013379.2 DPP7 Homo sapiens dipeptidyl-peptidase 7 1194.2086 3.4923752 (DPP7), mRNA. Homo sapiens low density lipoprotein 2650521 NM_002337.1 LRPAP1 receptor-related protein associated 2312.5721 3.4855679 protein 1 (LRPAP1), mRNA. Homo sapiens sarcoglycan, delta 4490563 NM_172244.2 SGCD (35kDa dystrophin-associated 250.47699 3.4815292 glycoprotein) (SGCD), transcript variant 2, mRNA. Homo sapiens ectonucleotide 3420553 NM_006208.1 ENPP1 pyrophosphatase/phosphodiesterase 1 649.95221 3.4699321 (ENPP1), mRNA. 7200706 NM_032603.2 LOXL3 Homo sapiens lysyl oxidase-like 3 2450.7037 3.4541647 (LOXL3), mRNA. 5260474 NM_001733.4 CIR Homo sapiens complement component 2867.8385 3.4502058 1, rsubcomponent (C1R), mRNA. Homo sapiens sema domain, 6900114 NM_006080.2 SEMA3A immunoglobulin domain (Ig), short 1823.2389 3.2885058 basic domain, secreted, (semaphorin) 3A (SEMA3A), mRNA. Homo sapiens deleted in lymphocytic 1260612 NR_002605.1 DLEU1 leukemia, 1 (DLEU1) on chromosome 328.53097 3.2876487 13. Homo sapiens Clq and tumor necrosis 7320204 NM_015645.2 C1QTNF5 factor related protein 5 (C1QTNF5), 1398.6718 3.2694126 mRNA. Homo sapiens antigen p97 (melanoma 1240435 NM_033316.2 MFI2 associated) identified by monoclonal 246.85538 3.2126801 antibodies 133.2 and 96.5 (MFJ2), transcript variant 2, mRNA. 3370162 NM_006108.2 SPONI Homo sapiens spondin 1, extracellular 444.41814 3.1895833 matrix protein (SPONI), mRNA. Homo sapiens complement component 1300327 NM_201442.1 CiS 1, s subcomponent (CIS), transcript 544.9736 3.1684019 variant 2, mRNA. 168 WO 2011/150105 PCT/US2011/037969 Homo sapiens gamma-glutamyl 160615 NM_003878.1 GGH hydrolase (conjugase, 537.14749 3.145868 folylpolygammaglutamyl hydrolase) (GGH), mRNA. 6400358 NM_001766.3 CD1D Homo sapiens CD1d molecule 289.07994 3.1395112 (CD1D), mRNA. Homo sapiens reversion-inducing 3390487 NM_021111.1 RECK cysteine-rich protein with kazal motifs 1276.7519 3.114557 (RECK), mRNA. 3710397 NM_004428.2 EFNA1 Homo sapiens ephrin-Al (EFNA1), 923.4826 3.0891485 transcript variant 1, mRNA. 6020682 NM_020211.1 RGMA Homo sapiens RGM domain family, 881.97117 3.0817433 member A (RGMA), inRNA. Homo sapiens sulfatase modifying 2680474 NM_001042470.1 SUMF2 factor 2 (SUMF2), transcript variant 4, 1974.8375 3.0332946 mRNA. 2060121 NM_000147.3 FUCAl Homo sapiens fucosidase, alpha-L- 1, 2014.6226 3.0220155 tissue (FUCAl), mRNA. Homo sapiens interleukin 1 receptor 6020300 NM_003856.2 ILIRLI like 1 (ILIRLI), transcript variant 2, 311.08923 3.0022191 mRNA. 4280577 NM_001200.2 BMP2 Homo sapiens bone morphogenetic 674.23525 2.9884114 protein 2 (BMP2), mRNA. Homo sapiens insulin-like growth 7380719 NM_002178.2 IGFBP6 factor binding protein 6 (IGFBP6), 10679.388 2.9705278 mRNA. 6940364 NM_000096.1 CP Homo sapiens ceruloplasmin 169.51925 2.9701827 (ferroxidase) (CP), mRNA. Homo sapiens ADAM 6180332 NM_007038.2 ADAMTS5 metallopeptidase with thrombospondin 706.88068 2.8998334 type 1 motif, 5 (aggrecanase-2) (ADAMTS5), mRNA. Homo sapiens beta-site APP-cleaving 1240201 NM_138991.1 BACE2 enzyme 2 (BACE2), transcript variant 626.26844 2.8570587 c, mRNA. Homo sapiens carboxylesterase 2 3520372 NM_003869.4 CES2 (intestine, liver) (CES2), transcript 2427.8897 2.8460508 variant 1, mRNA. Homo sapiens ADAMTS-like 1 5890326 NM_052866.3 ADAMTSL1 (ADAMTSL1), transcript variant 2, 400.55288 2.8324079 mRNA. Homo sapiens EGF-like repeats and 130524 NM_005711.3 EDIL3 discoidin I-like domains 3 (EDIL3), 1109.6516 2.8303417 mRNA. Homo sapiens collagen, type VI, alpha 2470114 NM_004369.2 COL6A3 3 (COL6A3), transcript variant 1, 9544.9412 2.8271419 mRNA. Homo sapiens FXYD domain 160270 NM_022003.1 FXYD6 containing ion transport regulator 6 551.21018 2.8209579 (FXYD6), mRNA. 2690168 NM_000557.2 GDF5 Homo sapiens growth differentiation 377.44248 2.8097021 factor 5 (GDFS), mRNA. Homo sapiens platelet-derived growth 7200168 NM_006207.1 PDGFRL factor receptor-like (PDGFRL), 3616.1996 2.7762875 mRNA. 4890270 NM_002346.1 LY6E Homo sapiens lymphocyte antigen 6 6223.7752 2.7713844 complex, locus E (LY6E), mRNA. 50368 NM_001920.3 DCN Homo sapiens decorin (DCN), 6557.7971 2.7149719 transcript variant Al, mRNA. Homo sapiens lymphotoxin beta 4640064 NM_002342.1 LTBR receptor (TNFR superfamily, member 1671.3999 2.6975651 3) (LTBR), mRNA. 169 WO 2011/150105 PCT/US2011/037969 1660538 NM_199167.1 CLUL1 Homo sapiens clusterin-like 1 (retinal) 140.13171 2.6863524 (CLUL1), transcript variant 2, mRNA. Homo sapiens interleukin 11 receptor, 2760148 NM_004512.3 ILIRA alpha (ILIRA), transcript variant 1, 3839.536 2.6855869 mRNA. Homo sapiens dipeptidyl-peptidase 4 4830255 NM_001935.3 DPP4 (CD26, adenosine deaminase 280.41165 2.6721969 complexing protein 2) (DPP4), mRNA. Homo sapiens collagen, type IX, alpha 5340402 NM_001851.3 COL9A1 1 (COL9A1), transcript variant 1, 211.50133 2.6627693 mRNA. Homo sapiens jumonji, AT rich 5870739 NM_004653.3 JARIDID interactive domain ID (JARIDID), 177.77375 2.6450212 mRNA. 5870221 NM_014498.2 GOLPH4 Homo sapiens golgi phosphoprotein 4 3226.2173 2.6328773 (GOLPH4), mRNA. 5670228 NM_054034.2 FN1 Homo sapiens fibronectin 1 (FN1), 339.76999 2.6173101 transcript variant 7, mRNA. Homo sapiens hematopoietic cell 1580088 NM_001007469.1 HCST signal transducer (HCST), transcript 544.43112 2.6024053 variant 2, mRNA. 1410091 NM_000060.2 BTD Homo sapiens biotinidase (BTD), 752.00472 2.5972001 mRNA. 6760673 NM_006455.2 SC65 Homo sapiens synaptonemal complex 5512.9174 2.5632849 protein SC65 (SC6S), mRNA. Homo sapiens asparagine-linked 6370113 NM_013338.3 ALG5 glycosylation 5 homolog (S. 2407.6805 2.5383803 cerevisiae, dolichyl-phosphate beta glucosyltransferase) (ALG5), mRNA. 5960398 NM 002526.1 NT5E Homo sapiens 5-nucleotidase, ecto 2105.9115 2.5351517 1 - (CD73) (NTSE), mRNA. 1510564 NM_014255.3 TMEM4 Homo sapiens transmembrane protein 3678.6683 2.5311218 4 (TMEM4), mRNA. Homo sapiens family with sequence 1940274 NM_032036.2 FAM14A similarity 14, member A (FAM14A), 1956.2917 2.5210431 mRNA. 6510519 NM_138284.1 IL17D Homo sapiens interleukin 17D 1365.0811 2.508231 (JL17D), mRNA. 2850184 NM_004388.1 CTBS Homo sapiens chitobiase, di-N-acetyl- 1871.1417 2.4913472 (CTBS), mRNA. Homo sapiens signal sequence 7570243 NM_006280.1 SSR4 receptor, delta (translocon-associated 18527.698 2.4839159 protein delta) (SSR4), mRNA. Homo sapiens tumor necrosis factor 1090747 NM_003809.2 TNFSF12 (ligand) superfamily, member 12 879.03761 2.475475 (TNFSF12), mRNA. Homo sapiens calcitonin-related 6110242 NM_001033953.1 CALCA polypeptide alpha (CALCA), transcript 165.5326 2.4688061 variant 3, mRNA. 7650189 NM_002292.3 LAMB2 Homo sapiens lamminin, beta 2 (laminin 2460.2854 2.468241 S) (LAMB32), mRNA. Homo sapiens reticulocalbin 3, EF 2100431 NM_020650.2 RCN3 hand calcium binding domain (RCN3), 3931.4018 2.4639072 mRNA. 1430170 NM_006682.1 FGL2 Homo sapiens fibrinogen-like 2 599.27965 2.4638704 (FGL2), mRNA. Homo sapiens collagen, type VI, alpha 6250192 NM_057165.2 COL6A3 3 (COL6A3), transcript variant 3, 13462.134 2.4624981 mRNA. 170 WO 2011/150105 PCT/US2011/037969 Homo sapiens FK506 binding protein 1010068 NM_004470.2 FKBP2 2, 13kDa (FKBP2), transcript variant 2605.3624 2.452121 1, mRNA. Homo sapiens SILl homolog, 6560603 NM_001037633.1 SILl endoplasmic reticulum chaperone (S. 4968.3212 2.4378064 cerevisiae) (SILl), transcript variant 1, mRNA. 4850450 NM_014618.2 DBC1 Homo sapiens deleted in bladder 377.44248 2.4301379 cancer 1 (DBC1), mRNA. Homo sapiens heparan sulfate 1500139 NM_006042.1 HS3ST3A1 (glucosamine) 3-0-sulfotransferase 3888.0326 2.4176597 3A1 (HS3ST3A1), mRNA. 3390187 NM_004428.2 EFNA1 Homo sapiens ephrin-Al (EFNA1), 222.61239 2.4174201 transcript variant 1, mRNA. Homo sapiens glucosidase, alpha; acid 1190634 NM_001079804.1 GAA (Pompe disease, glycogen storage 856.15973 2.4045426 disease type II) (GAA), transcript variant 3, mRNA. 6660435 NM_003236.1 TGFA Homo sapiens transforming growth 281.57161 2.3970214 factor, alpha (TGFA), mRNA. 4540458 NM_007224.1 NXPH4 Homo sapiens neurexophilin 4 227.20251 2.3701287 (NXPH4), mRNA. Homo sapiens Rho guanine nucleotide 3850333 NM_015320.2 ARHGEF4 exchange factor (GEF) 4 (ARHGEF4), 262.26519 2.3696835 transcript variant 1, mRNA. 2120670 NM_203339.1 CLU Homo sapiens clusterin (CLU), 145.3795 2.3688643 transcript variant 2, mRNA. 130064 NM_000027.2 AGA Homo sapiens aspartylglucosaminidase 1127.3873 2.347397 (AGA), mRNA. Homo sapiens vitamin K epoxide 1770703 NM_024006.4 VKORC1 reductase complex, subunit 1 30293.717 2.34388 (VKORC 1), transcript variant 1, mRNA. 4610246 NM_005014.1 OMD Homo sapiens osteomodulin (OMD), 963.53127 2.3380731 mRNA. Homo sapiens chromosome Y open 7150066 NR_001544.1 CYorfl4 reading frame 14 (CYorfl4) on 168.78304 2.328059 chromosome Y. Homo sapiens complement component 2000128 NM_000715.3 C4BPA 4 binding protein, alpha (C4BPA), 129.39617 2.3250417 mRNA. Homo sapiens chromosome 6 open 1190082 NM_001040437.1 C6orf48 reading frame 48 (C6orf48), transcript 251.94417 2.3131782 variant 1, mRNA. Homo sapiens serpin peptidase 5080192 NM_006216.2 SERPINE2 inhibitor, clade E (nexin, plasminogen 27548.738 2.3031002 activator inhibitor type 1), member 2 (SERPINE2), mRNA. Homo sapiens tumor necrosis factor 2370132 NM_002546.3 TNFRSF11B receptor superfamily, member ib 1859.6239 2.2884306 (osteoprotegenin) (TNFRSF1IIB), mRNA. Homo sapiens cysteine-rich with EGF 2940561 NM_001031717.1 CRELDI like domains 1 (CRELDI), transcript 195.01209 2.2840911 variant 1, mRNA. Homo sapiens palmitoyl-protein 7200041 NM_000310.2 PPT1 thioesterase 1 (ceroid-lipofuscinosis, 3858.9091 2.2828625 neuronal 1, infantile) (PPT1), mRNA. 5890619 NM_004318.2 ASPH Homo sapiens aspartate beta- 386.46077 2.2659785 hydroxylase (ASPH), transcript variant 171 WO 2011/150105 PCT/US2011/037969 1, mRNA. 7330477 NM_173078.2 SLITRK4 Homo sapiens SLIT and NTRK-like 281.96121 2.2654655 family, member 4 (SLJTRK4), mRNA. 6040465 NM_015681.2 EPPB9 Homo sapiens B9 protein (EPPB9), 301.43687 2.2314581 mRNA. Homo sapiens SILl homolog, 3130228 NM001037633.1 SILl endoplasmic reticulum chaperone (S. 2148.8673 2.2221763 cerevisiae) (SILl), transcript variant 1, mRNA. Homo sapiens sulfatase modifying 6110253 NM_001042470.1 SUMF2 factor 2 (SUMF2), transcript variant 4, 12159.015 2.2026098 mRNA. 6650240 NM_000520.3 HEXA Homo sapiens hexosamiidase A 512.78569 2.1966375 (alpha polypeptide) (HEXA), mRNA. 51.86 .967 1430521 NM_053276.2 VIT Homo sapiens vitrin (VIT), mRNA. 209.20782 2.1925009 7650296 NM_133505.2 DCN Homo sapiens decorin (DCN), 27991.695 2.1923075 transcript variant C, mRNA. Homo sapiens procollagen-lysine, 2 160630 NM_001084.4 PLOD3 oxoglutarate 5-dioxygenase 3 7219.8583 2.1422168 (PLOD3), mRNA. Homo sapiens tumor necrosis factor 650328 NM_003327.2 TNFRSF4 receptor superfamily, member 4 124.76423 2.1380512 (TNFRSF4), mRNA. 670594 NM_000063.3 C2 Homo sapiens complement component 170.26932 2.1366336 2 (C2), mRNA. Homo sapiens interleukin 18 binding 2190717 NM_173042.2 IL18BP protein (IL18BP), transcript variant A, 374.7267 2.1291724 mRNA. Homo sapiens myeloproliferative 5050086 NM_005373.1 MPL leukemia virus oncogene (MPL), 196.54631 2.1197222 mRNA. 3420605 NM_007036.3 ESMI Homo sapiens endothelial cell-specific 294.84912 2.1131431 1 molecule 1 (ESMI), mRNA. 2570068 NM_145267.2 C6orf57 Homo sapiens chromosome 6 open 534.8295 2.1047099 reading frame 57 (C6orfS7), mRNA. 5489 .079 Homo sapiens serpin peptidase inhibitor, clade G (Cl inhibitor), 2030309 NM_001032295.1 SERPING1 member 1, (angioedema, hereditary) 947.59425 2.0922123 (SERPINGI), transcript variant 2, mRNA. 4760095 NM_004750.2 CRLF1 Homo sapiens cytokine receptor-like 1185.0564 2.0854573 factor 1 (CRLF1), mRNA. Homo sapiens v-maf 3610440 NM_005360.3 MAF musculoaponeurotic fibrosarcoma 758.93142 2.0815555 oncogene homolog (avian) (MAF), transcript variant 1, mRNA. 1030458 NM_019107.3 Cl9orflO Homo sapiens chromosome 19 open 4581.7084 2.0758843 reading frame 10 (Cl9orflO), mRNA. 1070471 NM_203339.1 CLU Homo sapiens clusterin (CLU), 133.36386 2.0658142 transcript variant 2, mRNA. 2480364 NM_013379.2 DPP7 Homo sapiens dipeptidyl-peptidase 7 1095.8869 2.0627304 (DPP7), mRNA. 2120181 NM_032888.2 COL27A1 Homo sapiens collagen, type XXVII, 322.87139 2.0626708 alpha 1 (COL27Al), mRNA. 7570598 NM_001848.2 COL6A1 Homo sapiens collagen, type VI, alpha 13153.34 2.0600884 1 (COL6Al), mRNA. 172 WO 2011/150105 PCT/US2011/037969 Homo sapiens sema domain, immunoglobulin domain (Ig), short 4220433 NM_001005914.1 SEMA3B basic domain, secreted, (semaphorin) 211.66401 2.059615 3B (SEMA3B), transcript variant 2, mRNA. 4890167 NM_001267.2 CHAD Homo sapiens chondroadherin 164.47212 2.0518242 1 (CHAD), mRNA. 6760632 NM_014262.2 LEPREL2 Homo sapiens leprecan-like 2 1829.5866 2.0471642 (LEPREL2), mRNA. 4610364 NM_006273.2 CCL7 Homo sapiens chemokine (C-C motif) 119.44631 2.0312909 ligand 7 (CCL7), mRNA. 630521 NM_002996.3 CX3CL1 Homo sapiens chemokine (C-X3-C 235.99602 2.0285547 motif) ligand 1 (CX3CL1), mRNA. Homo sapiens wingless-type MMTV 4730176 NM_004626.2 WNT11 integration site family, member 11 179.41519 2.0281034 (WNT11), mRNA. 6940102 NM_002160.1 TNC Homo sapiens tenascin C 2052.4955 2.0271147 (hexabrachion) (TNC), mRNA. 1430278 NM_000396.2 CTSK Homo sapiens cathepsin K (CTSK), 1772.4016 2.0268121 mRNA. Homo sapiens multiple inositol 6370639 NM_004897.2 MINPP1 polyphosphate histidine phosphatase, 1 507.01401 2.026353 (MINPP1), mRNA. Homo sapiens UDP-Gal:betaGlcNAc 6220672 NM_003778.3 B4GALT4 beta 1,4- galactosyltransferase, 396.75715 2.0261184 polypeptide 4 (B4GALT4), transcript variant 2, mRNA. Homo sapiens protein kinase C 630280 NM_001001329.1 PRKCSH substrate 80K-H (PRKCSH), transcript 2951.7027 2.0240619 variant 2, mRNA. Homo sapiens collagen, type II, alpha 650113 NM_001844.4 COL2A1 1 (COL2A1), transcript variant 1, 204.1469 2.0232304 mRNA. Homo sapiens transforming growth 3190379 NM_003243.2 TGFBR3 factor, beta receptor III (TGFBR3), 1000.4092 2.0194283 mRNA. 3060128 NM_014918.3 CHSY1 Homo sapiens chondroitin sulfate 4359.3979 2.0098463 synthase 1 (CHSY1), mRNA. NHAC P8 prep3 ProbelD RefSeq_ID Symbol Definition RFU Fold over Homo sapiens phospholipase A2, 4860152 NM_000300.2 PLA2G2A group IIA (platelets, synovial fluid) 12976.429 132.66661 (PLA2G2A), mRNA. Homo sapiens proline/arginine-rich 7000446 NM_201348.1 PRELP end leucine-rich repeat protein 7203.8627 67.354931 (PRELP), transcript variant 2, mRNA. 1710484 NM_002023.3 FMOD Homo sapiens fibromodulin (FMOD), 14914.677 62.221447 mRNA. 610598 NM_004000.2 CHI3L2 Homo sapiens chitinase 3-like 2 9498.6695 51.995398 (CHJ3L2), transcript variant 1, mRNA. 99.65 51959 Homo sapiens serpin peptidase inhibitor, clade A (alpha-i 730047 NM_001002236.1 SERPINAl antiproteinase, antitrypsin), member 1 9426.0345 47.890706 (SERPINA1), transcript variant 2, mRNA. 4920040 NM_005218.3 DEFB1 Homo sapiens defensin, beta 1 3730.8357 42.295292 (DEFB 1), mRNA. 173 WO 2011/150105 PCT/US2011/037969 1660075 NM_018058.4 CRTAC1 Homo sapiens cartilage acidic protein 4615.4847 33.491819 1 (CRTAC1), mRNA. 6220019 NM_006211.2 PENK Homo sapiens proenkephalin (PENK), 33906.985 33.204658 IIRNA. Homo sapiens serpin peptidase inhibitor, clade A (alpha-i 6380484 NM_001002235.1 SERPINA1 antiproteinase, antitrypsin), member 1 4006.333 33.026844 (SERPINA1), transcript variant 3, mRNA. Homo sapiens serpin peptidase 3290630 NM_000624.3 SERPINA5 inhibitor, clade A (alpha-i 5063.6932 28.968093 antiproteinase, antitrypsin), member 5 (SERPINA5), mRNA. 840114 NM_000641.2 IL1i Homo sapiens interleukin 11 (ILI1), 7371.1814 24.891658 mRNA. Homo sapiens 1070400 NM_153282.1 HYAL1 hyaluronoglucosaminidase 1 2454.4735 23.198476 (HYAL1), transcript variant 2, mRNA. Homo sapiens SPARC related modular 840008 NM_001034852.1 SMOCi calcium binding 1 (SMOCi), transcript 2573.9904 22.320459 variant 1, mRNA. 2360066 NM_178127.2 ANGPTL5 Homo sapiens angiopoietin-like 5 1462.741 20.196557 (ANGPTL5), mRNA. Homo sapiens procollagen C 4810445 NM_013363.2 PCOLCE2 endopeptidase enhancer 2 11067.226 19.850025 (PCOLCE2), mRNA. Homo sapiens serpin peptidase 6280168 NM_001085.4 SERPINA3 inhibitor, clade A (alpha-i 28908.1 19.619394 antiproteinase, antitrypsin), member 3 (SERPINA3), mRNA. 1110048 NM_007281.1 SCRG1 Homo sapiens scrapie responsive 22099.182 16.702632 protein 1 (SCRG1), mRNA. Homo sapiens serpin peptidase inhibitor, clade A (alpha-i 6770333 NM_000295.3 SERPINA1 antiproteinase, antitrypsin), member 1 1016.008 15.639428 (SERPINA1), transcript variant 1, mRNA. Homo sapiens matrix metallopeptidase 7400400 NM_002422.3 MMP3 3 (stromelysin 1, progelatinase) 3164.3146 14.826225 (MMP3), mRNA. Homo sapiens sarcoglycan, delta 2450327 NM_172244.2 SGCD (35kDa dystrophin-associated 1741.7254 14.620742 glycoprotein) (SGCD), transcript variant 2, mRNA. 5490019 NM_002084.3 GPX3 Homo sapiens glutathione peroxidase 3 5056.0653 14.528702 (plasma) (GPX3), mRNA. Homo sapiens collagen, type II, alpha 1 (primary osteoarthritis, 4010136 NM_001844.3 COL2A1 spondyloepiphyseal dysplasia, 7171.9072 12.505302 congenital) (COL2A1), transcript variant 1, mRNA. 5090026 NM_001855.3 COL15A1 Homo sapiens collagen, type XV, 7924.8209 11.774197 alpha 1 (COLiSAl), mRNA. Homo sapiens cartilage intermediate 6400427 NM_003613.2 CILP layer protein, nucleotide 4264.5345 11.741143 pyrophosphohydrolase (CILP), mRNA. 2630437 NM_022138.1 SMOC2 Homo sapiens SPARC related modular 1173.8012 11.680037 calcium binding 2 (SMOC2), mRNA. 4890167 NM_001267.2 CHAD Homo sapiens chondroadherin 934.36519 11.656401 (CHAD), mRNA. 174 WO 2011/150105 PCT/US2011/037969 Homo sapiens WNT1 inducible 3310333 NM_003880.2 WISP3 signaling pathway protein 3 (WISP3), 733.07094 11.634442 transcript variant 1, mRNA. 2360148 NM_000095.2 COMP Homo sapiens cartilage oligomeric 31253.086 11.099088 matrix protein (COMP), mRNA. Homo sapiens SPARC related modular 4260097 NM_001034852.1 SMOCI calcium binding 1 (SMOCI), transcript 715.00177 10.510869 variant 1, mRNA. Homo sapiens fibroblast growth factor 5860112 NM_001004358.1 FGFRL1 receptor-like 1 (FGFRL1), transcript 2183.9094 9.5237974 variant 2, mRNA. Homo sapiens WNT1 inducible 520717 NM_198239.1 WISP3 signaling pathway protein 3 (WISP3), 497.94211 9.0871307 transcript variant 3, mRNA. Homo sapiens ectonucleotide 3420553 NM_006208.1 ENPP1 pyrophosphatase/phosphodiesterase 1 1673.3205 8.9334391 (ENPP1), mRNA. 4010491 XM_001129442.1 CST6 PREDICTED: Homo sapiens cystatin 813.91283 8.9005089 E/M (CST6), mRNA. 2600397 NM_153225.2 RPESP Homo sapiens RPE-spondin (RPESP), 742.93864 8.6204651 mRNA. 4760095 NM_004750.2 CRLF1 Homo sapiens cytokine receptor-like 4769.535 8.3934074 factor 1 (CRLF1), mRNA. 7200706 NM_032603.2 LOXL3 Homo sapiens lysyl oxidase-like 3 5908.2373 8.3274143 (LOXL3), mRNA. 1940438 NM_002632.4 PGF Homo sapiens placental growth factor 1079.3475 8.2221993 (PGF), mRNA. 1070333 NM_001323.2 CST6 Homo sapiens cystatin E/M (CST6), 695.59336 7.8427712 IIRNA. Homo sapiens fibroblast growth factor 4480220 NM_021923.3 FGFRL1 receptor-like 1 (FGFRL1), transcript 7236.6257 7.6589608 variant 3, mRNA. Homo sapiens 1980300 NM_153283.1 HYALl hyaluronoglucosaminidase 1 437.26615 7.06351 (HYAL1), transcript variant 3, mRNA. 6980767 NM_006533.2 MIA Homo sapiens melanoma inhibitory 660.45531 7.0130051 activity (MIA), mRNA. 1430487 NM_000900.2 MGP Homo sapiens matrix Gla protein 24283.161 6.7041033 (MGP), mRNA. Homo sapiens fibroblast growth factor 6520139 NM_022965.1 FGFR3 receptor 3 (achondroplasia, 2520.9232 6.6504517 thanatophoric dwarfism) (FGFR3), transcript variant 2, mRNA. Homo sapiens jumonji, AT rich 5870739 NM_004653.3 JARIDID interactive domain ID (JARIDID), 400.13732 5.9534757 mRNA. Homo sapiens tumor necrosis factor 2370132 NM_002546.3 TNFRSF11B receptor superfamily, member 1 lb 4515.7484 5.5570251 (osteoprotegerin) (TNFRSF1IIB), mRNA. 2940280 NM_014057.3 OGN Homo sapiens osteoglycin (OGN), 2485.4027 4.9739821 transcript variant 3, mRNA. 2120670 NM_203339.1 CLU Homo sapiens clusterin (CLU), 298.00398 4.855781 transcript variant 2, mRNA. Homo sapiens low density lipoprotein 4780411 NM_017522.3 LRP8 receptor-related protein 8, 1221.5493 4.7955148 apolipoprotein e receptor (LRP8), transcript variant 3, mRNA. 175 WO 2011/150105 PCT/US2011/037969 Homo sapiens WNT1 inducible 2320564 NM_003882.2 WISPI signaling pathway protein 1 (WISPI), 1137.6612 4.7475545 transcript variant 1, mRNA. Homo sapiens FXYD domain 160270 NM_022003.1 FXYD6 containing ion transport regulator 6 909.56844 4.6549472 (FXYD6), mRNA. 3420605 NM_007036.3 ESMI Homo sapiens endothelial cell-specific 647.87434 4.6432263 molecule 1 (ESMI), mRNA. Homo sapiens inhibitor of DNA 7570324 NM_002167.2 ID3 binding 3, dominant negative helix- 11148.021 4.6122155 loop-helix protein (ID3), mRNA. Homo sapiens alanyl (membrane) aminopeptidase (aminopeptidase N, 5810612 NM_001150.1 ANPEP aminopeptidase M, microsomal 3844.1298 4.5926911 aminopeptidase, CD13, p150) (ANPEP), mRNA. 2190097 NM_153221.2 CILP2 Homo sapiens cartilage intermediate 717.82375 4.5194695 layer protein 2 (CILP2), mRNA. Homo sapiens carbohydrate (N 20445 NM_021615.4 CHST6 acetylglucosamine 6-0) 589.53097 4.4940866 sulfotransferase 6 (CHST6), mRNA. 10397 NM_014310.3 RASD2 Homo sapiens RASD family, member 1195.2953 4.4116166 2 (RASD2), mRNA. 2810673 NM_152739.3 HOXA9 Homo sapiens homeobox A9 615.20103 4.3476213 (HOXA9), inRNA. 1190367 NM_003897.3 IER3 Homo sapiens immediate early 17681.797 4.2872243 response 3 (JER3), mRNA. Homo sapiens amine oxidase, copper 4290180 NM_001158.3 AOC2 containing 2 (retina-specific) (AOC2), 270.79572 4.1655252 transcript variant 1, mRNA. 1510181 NM_004878.3 PTGES Homo sapiens prostaglandin E 2536.8431 4.0579927 synthase (PTGES), mRNA. 4540215 NM_012168.4 FBXO2 Homo sapiens F-box protein 2 655.30811 3.8908102 (FBXO2), mRNA. 5870136 NM_004669.2 CLIC3 Homo sapiens chloride intracellular 1158.6235 3.8713919 channel 3 (CLJC3), mRNA. 2690168 NM_000557.2 GDF5 Homo sapiens growth differentiation 500.64218 3.7268073 factor S (GDFS), mRNA. Homo sapiens wingless-type MMTV 4850370 NM_032642.2 WNT5B integration site family, member 5B 2832.5817 3.7074202 (WNT5B), transcript variant 1, mRNA. Homo sapiens sarcoglycan, delta 4490563 NM_172244.2 SGCD (35kDa dystrophin-associated 260.81866 3.6252742 glycoprotein) (SGCD), transcript variant 2, mRNA. 4570397 NM_178491.2 R3HDML Homo sapiens R3H domain 230.91224 3.6115389 containing-like (R3HDML), mRNA. 23.14 36158 Homo sapiens cysteine-rich, 3930605 NM_001554.3 CYR61 angiogenic inducer, 61 (CYR61), 22701.323 3.5193915 mRNA. 7320039 NM_005429.2 VEGFC Homo sapiens vascular endothelial 3092.1437 3.4929422 growth factor C (VEGFC), mRNA. Homo sapiens amine oxidase, copper 4230307 NM_001158.3 AOC2 containing 2 (retina-specific) (AOC2), 219.97552 3.4761291 transcript variant 1, mRNA. 2320598 NM_000266.1 NDP Homo sapiens Norrie disease 713.73909 3.4422714 (pseudoglioma) (NDP), mRNA. 176 WO 2011/150105 PCT/US2011/037969 Homo sapiens latent transforming 1170239 NM_000627.2 LTBP1 growth factor beta binding protein 1 783.98348 3.4240182 (LTBP1), transcript variant 2, mRNA. Homo sapiens rabphilin 3A-like 5260408 NM_006987.2 RPH3AL (without C2 domains) (RPH3AL), 292.06431 3.4182427 mRNA. 6480204 NM_006288.2 THYl Homo sapiens Thy-i cell surface 8047.6049 3.3781827 antigen (THYl), mRNA. 2480195 NM_000603.3 NOS3 Homo sapiens nitric oxide synthase 3 240.75664 3.3490786 (endothelial cell) (NOS3), mRNA. 6370369 NM_001040021.1 CD14 Homo sapiens CD14 molecule (CD14), 358.87994 3.3279975 transcript variant 2, mRNA. Homo sapiens insulin-like growth 6840372 NM_001013398.1 IGFBP3 factor binding protein 3 (IGFBP3), 24958.137 3.3270497 transcript variant 1, mRNA. Homo sapiens family with sequence 1260767 NM_001040020.1 FAM3C similarity 3, member C (FAM3C), 1466.1754 3.2052616 transcript variant 2, mRNA. 5810746 NM_002380.3 MATN2 Homo sapiens matrilin 2 (MATN2), 2522.9792 3.1868116 transcript variant 1, mRNA. Homo sapiens WNT1 inducible 870431 NM_080838.1 WISPI signaling pathway protein 1 (WISPI), 237.93746 3.1817192 transcript variant 2, mRNA. 780524 NM_006505.2 PVR Homo sapiens poliovirus receptor 740.6792 3.1668683 (PVR), inRNA. 4280577 NM_001200.2 BMP2 Homo sapiens bone morphogenetic 713.48289 3.1623686 protein 2 (BMP2), mRNA. Homo sapiens antigen p97 (melanoma 1240435 NM_033316.2 MFI2 associated) identified by monoclonal 242.61785 3.157531 antibodies 133.2 and 96.5 (MF2), transcript variant 2, mRNA. Homo sapiens erythrocyte membrane 1510538 NM_012307.2 EPB41L3 protein band 4.1-like 3 (EPB41L3), 2359.2687 3.1494182 mRNA. Homo sapiens family with sequence 780332 NM_001040020.1 FAM3C similarity 3, member C (FAM3C), 1329.8792 3.1459546 transcript variant 2, mRNA. 5550719 NM_133503.2 DCN Homo sapiens decorin (DCN), 3955.7942 3.1086647 transcript variant A2, mRNA. 7650672 NM_012098.2 ANGPTL2 Homo sapiens angiopoietin-like 2 3197.4559 3.1018306 (ANGPTL2), mRNA. 2680072 NM_014279.4 OLFM1 Homo sapiens olfactomedin 1 471.90383 3.0177581 (OLFM1), transcript variant 1, mRNA. Homo sapiens plasminogen activator, 360475 NM_001005376.1 PLAUR urokinase receptor (PLAUR), 1617.9619 3.0063615 transcript variant 2, mRNA. Homo sapiens collagen, type VI, alpha 6250192 NM_057165.2 COL6A3 3 (COL6A3), transcript variant 3, 16350.645 2.9908655 mRNA. Homo sapiens plasminogen activator, 730528 NM_002659.2 PLAUR urokinase receptor (PLAUR), 1471.9015 2.9479179 transcript variant 1, mRNA. Homo sapiens apolipoprotein B 3170068 NM_004900.3 APOBEC3B mRNA editing enzyme, catalytic 386.6306 2.9420652 polypeptide-like 3B (APOBEC3B), mRNA. 6940102 NM_002160.1 TNC Homo sapiens tenascin C 2960.1136 2.9235093 (hexabrachion) (TNC), mRNA. 177 WO 2011/150105 PCT/US2011/037969 Homo sapiens ADAM 20100 NM_197941.2 ADAMTS6 metallopeptidase with thrombospondin 543.06571 2.89745 type 1 motif, 6 (ADAMTS6), mRNA. Homo sapiens serpin peptidase 5080192 NM_006216.2 SERPINE2 inhibitor, clade E (nexin, plasminogen 34487.975 2.8832268 activator inhibitor type 1), member 2 (SERPINE2), mRNA. 5050707 NM_031917.2 ANGPTL6 Homo sapiens angiopoietin-like 6 176.68702 2.8757224 (ANGPTL6), mRNA. Homo sapiens signal recognition 6290112 NM_003139.2 SRPR particle receptor ('docking protein') 2825.2081 2.8450926 (SRPR), mRNA. 5090626 NM_004460.2 FAP Homo sapiens fibroblast activation 4414.6049 2.8106656 protein, alpha (FAP), mRNA. Homo sapiens lymphotoxin beta 4640064 NM_002342.1 LTBR receptor (TNFR superfamily, member 1695.9016 2.7371098 3) (LTBR), mRNA. 6980064 NM_001718.4 BMP6 Homo sapiens bone morphogenetic 284.95885 2.7052331 protein 6 (BMP6), mRNA. Homo sapiens arginine-rich, mutated 4560110 NM_006010.2 ARMET in early stage tumors (ARMET), 13333.931 2.7027192 mRNA. 6590592 NM_001006946.1 SDC1 Homo sapiens syndecan 1 (SDC1), 2376.9322 2.699717 transcript variant 1, mRNA. Homo sapiens chromosome 10 open 1110201 NM_001031746.2 ClOorf72 reading frame 72 (ClOorf72), 317.82979 2.6912259 transcript variant 1, mRNA. 7570408 NM_002985.2 CCL5 Homo sapiens chemokine (C-C motif) 432.8146 2.6904995 ligand 5 (CCLS), mRNA. Homo sapiens DnaJ (Hsp40) homolog, 3190452 NM_016306.4 DNAJB11 subfamily B, member l l(DNAJB11), 10347.894 2.6841231 mRNA. Homo sapiens N-acetylated alpha 4120626 NM_005468.2 NAALADL1 linked acidic dipeptidase-like 1 245.54432 2.6788873 (NAALADL1), mRNA. Homo sapiens insulin-like growth 6590132 NM_000598.4 IGFBP3 factor binding protein 3 (IGFBP3), 28218.8 2.6710947 transcript variant 2, mRNA. Homo sapiens limb bud and heart 840369 NM_030915.1 LBH development homolog (mouse) (LBH), 457.67507 2.6355629 mRNA. Homo sapiens plasminogen activator, 6220671 NM_001005376.1 PLAUR urokinase receptor (PLAUR), 3326.0655 2.6351432 transcript variant 2, mRNA. Homo sapiens regulator of G-protein 6350050 NM_144489.2 RGS3 signaling 3 (RGS3), transcript variant 285.78097 2.6312566 5, mRNA. Homo sapiens collagen, type VI, alpha 2470114 NM_004369.2 COL6A3 3 (COL6A3), transcript variant 1, 8876.2204 2.6290717 mRNA. Homo sapiens G protein-coupled 7510634 NM_018653.3 GPRC5C receptor, family C, group 5, member C 663.26283 2.6262083 (GPRC5C), transcript variant 2, mRNA. Homo sapiens Fc fragment of IgE, 3850440 NM_004106.1 FCER1G high affinity I, receptor for; gamma 164.06364 2.5936278 polypeptide (FCER1G), mRNA. 5960398 NM_002526.1 NT5E Homo sapiens 5-nucleotidase, ecto 2150.2996 2.5885872 (CD73) (NTE), mRNA. 178 WO 2011/150105 PCT/US2011/037969 3930020 NM_003793.2 CTSF Homo sapiens cathepsin F (CTSF), 429.62478 2.5847459 mRNA. 3400630 NM_003276.1 TMPO Homo sapiens thymopoietin (TMPO), 637.01667 2.5585497 transcript variant 1, mRNA. Homo sapiens ADAM 6900086 NM_006988.3 ADAMTS1 metallopeptidase with thrombospondin 1505.5186 2.5543253 type 1 motif, 1 (ADAMTS 1), mRNA. Homo sapiens ADAM 6420692 NM_003474.3 ADAM12 metallopeptidase domain 12 (meltrin 200.1382 2.5223117 alpha) (ADAMVI12), transcript variant 1, mRNA. Homo sapiens cysteine-rich with EGF 3400619 NM_001031717.2 CRELDI like domains 1 (CRELDI), transcript 2620.4959 2.5213522 variant 1, mRNA. 4610424 NM_006744.3 RBP4 Homo sapiens retinol binding protein 173.82684 2.5201036 4, plasma (RBP4), mRNA. 5690095 NM_004962.2 GDF1O Homo sapiens growth differentiation 392.36652 2.5011857 factor 10 (GDF1O), mRNA. Homo sapiens serpin peptidase 770408 NM_000602.1 SERPINE1 inhibitor, eade E (nexin, plasminogen 11954.262 2.4997098 activator inhibitor type 1), member 1 (SERPINE1), mRNA. Homo sapiens syntrophin, beta 1 3420739 NM_021021.2 SNTB1 (dystrophin-associated protein Al, 851.93488 2.4934409 S9kDa, basic component 1) (SNTB 1), mRNA. Homo sapiens sema domain, 6900114 NM_006080.2 SEMA3A immunoglobulin domain (Ig), short 1380.3444 2.489674 basic domain, secreted, (semaphorin) 3A (SEMA3A), mRNA. Homo sapiens follistatin-like 3 2360356 NM_005860.2 FSTL3 (secreted glycoprotein) (FSTL3), 3945.9257 2.4010776 mRNA. 6580711 NM_001129.3 AEBP1 Homo sapiens AE binding protein 1 6519.4003 2.3822849 (AEBP1), mRNA. Homo sapiens DnaJ (Hsp40) homolog, 7000630 NM_006260.2 DNAJC3 subfamily C, member 3 (DNAJC3), 338.69786 2.3727795 mRNA. 3890095 NM_003102.2 SOD3 Homo sapiens superoxide dismutase 3' 263.28643 2.3701336 extracellular (SOD3), mRNA. 5570592 NM_003741.2 CHRD Homo sapiens chordin (CHRD), 182.04395 2.3646764 mRNA. 5290333 NM_152520.3 ZNF533 Homo sapiens zinc finger protein 533 207.14794 2.3572682 (ZNF533), mRNA. 6660435 NM_003236.1 TGFA Homo sapiens transforming growth 276.40501 2.3530382 factor, alpha (TGFA), mRNA. 1030333 NM_002982.3 CCL2 Homo sapiens chemokine (C-C motif) 5780.0239 2.3528662 ligand 2 (CCL2), mRNA. 1030458 NM_019107.3 Cl9orflO Homo sapiens chromosome 19 open 5138.4521 2.3281342 reading frame 10 (Cl9orflO), mRNA. Homo sapiens collagen, type XI, alpha 1450392 NM_080681.2 COL11A2 2 (COL11A2), transcript variant 2, 278.44403 2.309175 mRNA. 6860446 NM_000737.2 CGB Homo sapiens chorionic gonadotropin, 191.68142 2.3017555 beta polypeptide (CGB), mRNA. Homo sapiens p21(CDKN1A) 4490632 NM_001014832.1 PAK4 activated kinase 4 (PAK4), transcript 737.60708 2.2744605 variant 3, mRNA. 4200152 NM_006764.3 IFRD2 Homo sapiens interferon-related 667.07662 2.2715949 developmental regulator 2 (FRD2), 179 WO 2011/150105 PCT/US2011/037969 mRNA. Homo sapiens sarcoglycan, delta 70088 NM_000337.4 SGCD (35kDa dystrophin-associated 166.78119 2.2704371 glycoprotein) (SGCD), transcript variant 1, mRNA. Homo sapiens amine oxidase, copper 580736 NM_009590.2 AOC2 containing 2 (retina-specific) (AOC2), 148.18968 2.2580318 transcript variant 2, mRNA. Homo sapiens paired immunoglobin 1570039 NM_013440.3 PILRB like type 2 receptor beta (PILRB), 677.5413 2.2482521 transcript variant 1, mRNA. 2640292 NM_001901.2 CTGF Homo sapiens connective tissue 29174.567 2.2441358 264092 N_00101.2 CTGFgrowth factor (CTGF), mRNA. Homo sapiens G protein-coupled 1170477 NM_022036.2 GPRC5C receptor, family C, group 5, member C 253.59543 2.232758 (GPRC5C), transcript variant 1, mRNA. Homo sapiens sema domain, immunoglobulin domain (Ig), short 4220433 NM_001005914.1 SEMA3B basic domain, secreted, (semaphorin) 229.20096 2.2302598 3B (SEMA3B), transcript variant 2, mRNA. 3130541 NM_001761.1 CCNF Homo sapiens cyclin F (CCNF), 918.97006 2.2283186 mRNA. 7650296 NM_133505.2 DCN Homo sapiens decorin (DCN), 28435.106 2.2270354 transcript variant C, mRNA. 1260039 NM_007112.3 THBS3 Homo sapiens thrombospondin 3 724.18016 2.2181205 (THBS3), mRNA. Homo sapiens ADAM 3440452 NM_207195.1 ADAM15 metallopeptidase domain 15 5629.508 2.1967094 (ADAM15), transcript variant 4, mRNA. 5870221 NM_014498.2 GOLPH4 Homo sapiens golgi phosphoprotein 4 2659.1804 2.1701253 (GOLPH4), mRNA. 2640195 NM_130830.2 LRRC15 Homo sapiens leucine rich repeat 630.47212 2.1626272 containing 15 (LRRC1S), mRNA. Homo sapiens angiopoietin-like 4 4610433 NM_139314.1 ANGPTL4 (ANGPTL4), transcript variant 1, 3940.8705 2.1516309 mRNA. 2940435 NM_003234.1 TFRC Homo sapiens transferring receptor 4099.7111 2.1487619 (p90, CD71) (TFRC), mRNA. 3710161 NM_000894.2 LHB Homo sapiens luteinizing hormone 161.37588 2.1468809 beta polypeptide (LHB), mRNA. Homo sapiens cysteine-rich with EGF 2940561 NM_001031717.1 CRELDI like domains 1 (CRELDI), transcript 182.50147 2.1375597 variant 1, mRNA. 3060767 NM_024641.2 MANEA Homo sapiens mannosidase, endo- 235.27529 2.0728576 alpha (MANEA), mRNA. Homo sapiens latent transforming 3520093 NM_021070.2 LTBP3 growth factor beta binding protein 3 2650.5397 2.0549422 (LTBP3), mRNA. 4610753 NM_000118.1 ENG Homo sapiens endoglin (Osler-Rendu- 2191.6243 2.0547489 Weber syndrome 1) (ENG), mRNA. 5810528 NM_003862.1 FGF18 Homo sapiens fibroblast growth factor 260.67412 2.0540926 18 (FGF18), mRNA. 6900309 NM_000046.2 ARSB Homo sapiens arylsulfatase B (ARSB), 251.22404 2.0535565 transcript variant 1, mRNA. 2650021 NM_018534.3 NRP2 Homo sapiens neuropilin 2 (NRP2), 275.23776 2.051099 transcript variant 4, mRNA. 180 WO 2011/150105 PCT/US2011/037969 5690112 NM_019891.2 ERO1LB Homo sapiens ERO1-like beta (S. 140.00959 2.0504641 cerevisiae) (ERO1LB), mRNA. 1230615 NM_021197.2 WFDC1 Homo sapiens WAP four-disulfide 231.98953 2.0432368 core domain 1 (WFDC1), mRNA. 2120181 NM032888.2 COL27A Homo sapiens collagen, type XXVII, 319.08333 2.0384707 212081 N_03888. COL7A1alpha 1 (COL27A1), mRNA. Homo sapiens ADAM 1980553 NM_003815.3 ADAM15 metallopeptidase domain 15 535.80354 2.0318312 (ADAMiS), transcript variant 2, mRNA. 630041 NM_002170.3 IFNA8 Homo sapiens interferon, alpha 8 1264.3609 2.0257977 (JFNA8), IIRNA. Homo sapiens leucyl/cystinyl 2690544 NM_175920.3 LNPEP aminopeptidase (LNPEP), transcript 401.97257 2.0234448 variant 2, mRNA. 6180528 NM_212474.1 FN1 Homo sapiens fibronectin 1 (FN1), 1721.9358 2.0221719 transcript variant 6, mRNA. Homo sapiens extracellular matrix 6840192 NM_001393.2 ECM2 protein 2, female organ and adipocyte 576.24469 2.0099221 specific (ECM2), mRNA. Homo sapiens limb bud and heart 2810246 NM_030915.1 LBH development homolog (mouse) (LBH), 2375.1634 2.0089707 mRNA. RTPEC P3 Human renal proximal tubule cells ProbelD RefSeqID Symbol Definition RFU Fold over Homo sapiens matrix metallopeptidase 3800088 NM_002423.3 MMP7 7 (matrilysin, uterine) (MMP7), 16159.754 89.53144 mRNA. Homo sapiens serpin peptidase inhibitor, clade A (alpha-i 6380484 NM_001002235.1 SERPINA1 antiproteinase, antitrypsin), member 1 8240.4817 67.931723 (SERPINA1), transcript variant 3, mRNA. Homo sapiens serpin peptidase inhibitor, clade A (alpha-i 730047 NM_001002236.1 SERPINA1 antiproteinase, antitrypsin), member 1 10457.711 53.132329 (SERPINA1), transcript variant 2, mRNA. Homo sapiens secreted phosphoprotein 3840154 NM_001040058.1 SPP1 1 (osteopontin, bone sialoprotein I, 28908.1 41.044692 early T-lymphocyte activation 1) (SPP1), transcript variant 1, mRNA. 3400307 NM_015900.1 PLA1A Homo sapiens phospholipase Al 2153.2273 30.703563 member A (PLAl A), mRNA. 4060427 NM_004132.2 HABP2 Homo sapiens hyaluronan binding 1677.0404 28.889498 protein 2 (HABP2), mRNA. 4920040 NM_005218.3 DEFB1 Homo sapiens defensin, beta 1 2532.7889 28.713419 (DEFB 1), mRNA. 1690563 NM_199161.1 SAA1 Homo sapiens serum amyloid Al 3985.9645 28.632816 (SAA1), transcript variant 2, mRNA. 39564 28381 1170349 NM_005558.3 LADi Homo sapiens ladinin 1 (LADi), 5048.6329 28.208247 mRNA. Homo sapiens secreted phosphoprotein 3460070 NM_000582.2 SPP1 1 (osteopontin, bone sialoprotein I, 22701.323 26.251332 early T-lymphocyte activation 1) (SPP1), transcript variant 2, mRNA. 181 WO 2011/150105 PCT/US2011/037969 Homo sapiens major histocompatibility 2570564 NM_019111.3 HLA-DRA complex, class II, DR alpha (HLA- 2520.9232 25.761009 DRA), mRNA. 2600397 NM_153225.2 RPESP Homo sapiens RPE-spondin (RPESP), 2010.6385 23.329839 IIRNA. Homo sapiens 1070400 NM_153282.1 HYAL1 hyaluronoglucosaminidase 1 2413.1291 22.807709 (HYAL1), transcript variant 2, mRNA. Homo sapiens carboxypeptidase, 60136 NM_031311.3 CPVL vitellogenic-like (CPVL), transcript 3520.8968 21.599522 variant 1, mRNA. 5220093 NM_032782.3 HAVCR2 Homo sapiens hepatitis A virus cellular 2375.1634 21.572775 receptor 2 (HAVCR2), mRNA. 1070152 NM_018725.3 IL17RB Homo sapiens interleukin 17 receptor 1483.5671 21.138316 B (IL17RB), mRNA. Homo sapiens carboxypeptidase, 1400703 NM_019029.2 CPVL vitellogenic-like (CPVL), transcript 1883.6353 16.384909 variant 2, mRNA. 2140707 NM_003064.2 SLPI Homo sapiens secretory leukocyte 2298.804 15.727021 1 peptidase inhibitor (SLPJ), mRNA. 5900376 NM_022843.2 PCDH20 Homo sapiens protocadherin 20 905.84882 14.776712 (PCDH2O), mRNA. 1850564 NM_004139.2 LBP Homo sapiens lipopolysaccharide 1196.9959 14.711144 binding protein (LBP), mRNA. 1980288 NM_004390.2 CTSH Homo sapiens cathepsin H (CTSH), 5688.735 14.602688 transcript variant 1, mRNA. Homo sapiens G protein-coupled 7510634 NM_018653.3 GPRC5C receptor, family C, group 5, member C 3645.3774 14.433977 (GPRCSC), transcript variant 2, 36574 1.397 mRNA. Homo sapiens G protein-coupled 1170477 NM_022036.2 GPRC5C receptor, family C, group 5, member C 1620.2254 14.265128 (GPRC5C), transcript variant 1, mRNA. Homo sapiens dipeptidyl-peptidase 4 4830255 NM_001935.3 DPP4 (CD26, adenosine deaminase 1455.8878 13.873955 complexing protein 2) (DPP4), mRNA. 5550367 NM_002343.2 LTF Homo sapiens lactotransferrin (LTF), 808.1354 13.152757 IIRNA. 2810673 NM_152739.3 HOXA9 Homo sapiens homeobox A9 1859.6239 13.141949 (HOXA9), mRNA. 5490019 NM_002084.3 GPX3 Homo sapiens glutathione peroxidase 3 4323.2369 12.422905 (plasma) (GPX3), mRNA. 3710397 NM_004428.2 EFNA1 Homo sapiens ephrin-Al (EFNA1), 3599.6814 12.041321 transcript variant 1, mRNA. 6370369 NM_001040021.1 CD14 Homo sapiens CD14 molecule (CD14), 1203.7532 11.162752 transcript variant 2, mRNA. Homo sapiens 1980300 NM_153283.1 HYAL1 hyaluronoglucosaminidase 1 678.45693 10.959658 (HYAL1), transcript variant 3, mRNA. 5670100 NM_000355.2 TCN2 Homo sapiens transcobalamin II; 2405.8639 10.830006 macrocytic anemia (TCN2), mRNA. 4050291 NM_030754.2 SAA2 Homo sapiens serum amyloid A2 619.00664 10.180572 (SAA2), mRNA. 5090671 NM_004864.1 GDF15 Homo sapiens growth differentiation 8218.4366 9.9332537 factor 1S (GDF1S), mRNA. 3390187 NM_004428.2 EFNA1 Homo sapiens ephrin-Al (EFNA1), 892.31032 9.6898869 transcript variant 1, mRNA. 182 WO 2011/150105 PCT/US2011/037969 Homo sapiens crumbs homolog 3 7400524 NM_139161.2 CRB3 (Drosophila) (CRB3), transcript 986.70192 9.5428987 variant 2, mRNA. Homo sapiens mucin 1, cell surface 7650026 NM_001044391.1 MUCI associated (MUCI), transcript variant 6835.1305 9.3157818 6, mRNA. Homo sapiens mucin 1, cell surface 7200601 NM_001044390.1 MUCI associated (MUCI), transcript variant 3023.8209 9.31364 5, mRNA. 2510152 NM_001005502.1 CPM Homo sapiens carboxypeptidase M 587.10413 8.0722737 (CPM), transcript variant 3, mRNA. Homo sapiens kallikrein-related 2970154 NM_001012964.1 KLK6 peptidase 6 (KLK6), transcript variant 559.68909 7.9935692 B, mRNA. 4390398 NM_005564.3 LCN2 Homo sapiens lipocalin 2 (LCN2), 1145.9794 7.9195608 mRNA. Homo sapiens UDP 1070088 NM_019075.2 UGT1A1O glucuronosyltransferase 1 family, 397.06726 7.7032079 polypeptide AlO (UGT1A1O), mRNA. Homo sapiens retinoic acid receptor 5290608 NM_002889.2 RARRES2 responder (tazarotene induced) 2 8803.474 7.4264518 (RARRES2), mRNA. Homo sapiens amiloride binding 5420440 NM_001091.2 ABP1 protein 1 (amine oxidase (copper- 442.74484 7.297426 containing)) (ABP1), mRNA. Homo sapiens serpin peptidase 3710296 NM_000934.3 SERPINF2 inhibitor, clade F (alpha-2 antiplasmin, 450.75398 7.1669789 pigment epithelium derived factor), member 2 (SERPINF2), mRNA. 2600424 NM_000331.3 SAA1 Homo sapiens serum amyloid Al 524.31453 7.1259185 (SAA1), transcript variant 1, mRNA. 1500113 NM_001048.3 SST Homo sapiens somatostatin (SST), 318.93879 6.2743295 mRNA. Homo sapiens carbohydrate (N 4760390 NM_031422.2 CHST9 acetylgalactosamine 4-0) 376.37087 6.0445355 sulfotransferase 9 (CHST9), mRNA. 7210139 NM_002773.3 PRSS8 Homo sapiens protease, seine, 8 808.42448 5.9546328 (PRSS8), mRNA. 4010181 NM_000804.2 FOLR3 Homo sapiens folate receptor 3 471.30324 5.9534911 (gamma) (FOLR3), mRNA. 7000369 NM_000591.2 CD14 Homo sapiens CD14 molecule (CD14), 368.96121 5.8154545 transcript variant 1, mRNA. 2060121 NM_000147.3 FUCAl Homo sapiens fucosidase, alpha-L- 1, 3620.2491 5.4305204 tissue (FUCAl), mRNA. 3850561 NM_144504.1 F11R Homo sapiens F1I receptor (F11R), 606.13997 5.4017786 transcript variant 5, mRNA. 4670162 NM_004390.3 CTSH Homo sapiens cathepsin H (CTSH), 431.66962 5.2778335 transcript variant 1, mRNA. Homo sapiens crumbs homolog 3 4670402 NM_174881.2 CRB3 (Drosophila) (CRB3), transcript 477.61681 5.1964059 variant 3, mRNA. 7050082 NM_001611.2 ACP5 Homo sapiens acid phosphatase 5 500.48289 5.0541349 tartrate resistant (ACPS), mIRNA. 3710022 NM_006512.1 SAA4 Homo sapiens serum amyloid A4, 310.13038 4.9356058 constitutive (SAA4), mRNA. 3610735 NM_000505.3 F12 Homo sapiens coagulation factor XII 1281.132 4.850063 (Hageman factor) (F12), mRNA. 183 WO 2011/150105 PCT/US2011/037969 6660435 NM_003236.1 TGFA Homo sapiens transforming growth 568.00044 4.8353925 factor, alpha (TGFA), mRNA. 7330477 NM_173078.2 SLITRK4 Homo sapiens SLIT and NTRK-like 581.30516 4.6705956 family, member 4 (SLJTRK4), mRNA. Homo sapiens serine peptidase 5860767 NM_003710.3 SPINTI inhibitor, Kunitz type 1 (SPINTI), 432.20147 4.66181 transcript variant 2, mRNA. 3710040 NM_006142.3 SFN Homo sapiens stratifin (SFN), mRNA. 486.5677 4.635037 Homo sapiens fibroblast growth factor 6420746 NM_002010.1 FGF9 9 (glia-activating factor) (FGF9), 275.9851 4.629416 mRNA. Homo sapiens acyl-CoA synthetase 1030431 NM_001995.2 ACSL1 long-chain family member 1 (ACSL1), 1541.3904 4.5390129 mRNA. Homo sapiens AU RNA binding 7330180 NM_001698.1 AUH protein/enoyl-Coenzyme A hydratase 1189.8499 4.4943783 (AUH), nuclear gene encoding mitochondrial protein, mRNA. 2850100 NM_003730.3 RNASET2 Homo sapiens ribonuclease T2 12976.429 4.4322267 (RNASET2), mRNA. Homo sapiens grancalcin, EF-hand 4230619 NM_012198.2 GCA calcium binding protein (GCA), 1225.646 4.3027994 mRNA. 3930020 NM_003793.2 CTSF Homo sapiens cathepsin F (CTSF), 703.90103 4.2348705 IIRNA. Homo sapiens angiotensinogen (serpin 2850301 NM_000029.2 AGT peptidase inhibitor, clade A, member 394.83341 4.2066117 8) (AGT), mRNA. 730414 NM_000041.2 APOE Homo sapiens apolipoprotein E 10419.73 4.197084 (APOE), mRNA. 6940053 NM_014917.2 NTNG1 Homo sapiens netrin GI (NTNG1), 499.25789 4.1228388 transcript variant 3, mRNA. Homo sapiens sema domain, immunoglobulin domain (Ig), 5080280 NM_198925.1 SEMA4B transmembrane domain (TM) and short 2284.6277 4.0934921 cytoplasmic domain, (semaphorin) 4B (SEMA4B), transcript variant 2, mRNA. 3520246 NM_004887.3 CXCL14 Homo sapiens chemokine (C-X-C 656.55059 4.0064929 motif) ligand 14 (CXCL14), mRNA. Homo sapiens baculoviral IAP repeat 5080021 NM_001165.3 BIRC3 containing 3 (BIRC3), transcript 577.20531 3.9522091 variant 1, mRNA. Homo sapiens agouti signaling protein, 3460474 NM_001672.2 ASIP nonagouti homolog (mouse) (ASIP), 271.93621 3.9045583 mRNA. Homo sapiens carbohydrate 4050768 NM_152889.1 CHST13 (chondroitin 4) sulfotransferase 13 260.77994 3.883172 (CHST13), mRNA. 5290333 NM_152520.3 ZNF533 Homo sapiens zinc finger protein 533 339.33009 3.861453 (ZNFS33), mRNA. Homo sapiens carboxylesterase 2 3520372 NM_003869.4 CES2 (intestine, liver) (CES2), transcript 3271.4245 3.8348696 variant 1, mRNA. Homo sapiens wingless-type MMTV 3870131 NM_004625.3 WNT7A integration site family, member 7A 231.54248 3.8338492 (WNT7A), mRNA. 540670 NM_172374.1 IL4Il Homo sapiens interleukin 4 induced 1 213.57345 3.8125457 (1L411), transcript variant 2, mRNA. 184 WO 2011/150105 PCT/US2011/037969 Homo sapiens nudix (nucleoside 110092 NM_177533.2 NUDT14 diphosphate linked moiety X)-type 2580.0512 3.7798878 motif 14 (NUDT14), mRNA. 5220482 NM_001217.3 CAll Homo sapiens carbonic anhydrase XI 883.19218 3.7650016 (CAll1), mRNA. 3450138 NM_001814.2 CTSC Homo sapiens cathepsin C (CTSC), 3312.0873 3.7407762 transcript variant 1, mRNA. Homo sapiens v-maf 3610440 NM_005360.3 MAF musculoaponeurotic fibrosarcoma 1337.6701 3.6688881 oncogene homolog (avian) (MAF), transcript variant 1, mRNA. Homo sapiens mucin 1, cell surface 520128 NM_002456.4 MUCi associated (MUC1), transcript variant 287.9674 3.6395608 1, mRNA. 2350044 NM_000236.1 LIPC Homo sapiens lipase, hepatic (LIPC), 186.866 3.6371542 mRNA. Homo sapiens regulator of G-protein 6400403 NM_170587.1 RGS20 signaling 20 (RGS20), transcript 654.04351 3.567966 variant 1, mRNA. 4830592 NM_173619.2 MGC34761 Homo sapiens hypothetical protein 336.03097 3.5364005 MGC34761 (MGC34761), mRNA. Homo sapiens glucosaminyl (N-acetyl) 6660369 NM_001491.2 GCNT2 transferase 2, I-branching enzyme (I 391.1177 3.5251877 blood group) (GCNT2), transcript variant 2, mRNA. Homo sapiens serpin peptidase inhibitor, clade A (alpha-i 6770333 NM_000295.3 SERPINAl antiproteinase, antitrypsin), member 1 226.84366 3.4918082 (SERPINAl), transcript variant 1, mRNA. 4810273 NM_015464.2 SOSTDC1 Homo sapiens sclerostin domain 349.92699 3.4893224 containing 1 (SOSTDC1), mRNA. 6420008 NM_000313.1 PROSI Homo sapiens protein S (alpha) 3015.2937 3.4457515 (PROS I), mRNA. Homo sapiens transmembrane 5960091 NM_019894.2 TMPRSS4 protease, seine 4 (TMPRSS4), 266.31091 3.319614 transcript variant 1, mRNA. 3140390 NM_000305.2 PON2 Homo sapiens paraoxonase 2 (PON2), 8196.2295 3.2784906 transcript variant 1, mRNA. Homo sapiens collagen, type IV, alpha 6380066 NM_031365.2 COL4A3 3 (Goodpasture antigen) (COL4A3), 224.48717 3.2557817 transcript variant 5, mRNA. 1230228 NM_013404.3 MSLN Homo sapiens mesothelin (MSLN), 341.25981 3.1727925 transcript variant 2, mRNA. Homo sapiens WNT1 inducible 3310333 NM_003880.2 WISP3 signaling pathway protein 3 (WISP3), 199.84056 3.171635 transcript variant 1, mRNA. 130338 NM_000331.3 SAA1 Homo sapiens serum amyloid A. 229.93083 3.1645365 (SAA1), transcript variant 1, mRNA. 29.38 31655 Homo sapiens thromboxane A 3940390 NM_001061.2 TBXAS1 synthase 1 (platelet, cytochrome P450, 369.67552 3.1360295 family 5, subfamily A) (TBXAS 1), transcript variant TXS-I, mRNA. 830563 NM_001001567.1 PDE9A Homo sapiens phosphodiesterase 9A 454.25914 3.0974864 (PDE9A), transcript variant 2, mRNA. Homo sapiens coxsackie virus and 870161 NM_001338.3 CXADR adenovirus receptor (CXADR), 1003.5876 3.0894015 mRNA. 185 WO 2011/150105 PCT/US2011/037969 Homo sapiens hypothetical protein 2030672 NM_001031744.1 LOC158160 LOC158160 (LOC158160), transcript 496.46497 3.0890248 variant 1, mRNA. Homo sapiens serpin peptidase inhibitor, clade G (Cl inhibitor), 2030309 NM_001032295.1 SERPING1 member 1, (angioedema, hereditary) 1398.6718 3.0881556 (SERPINGI), transcript variant 2, mRNA. Homo sapiens beta-site APP-cleaving 1240201 NM_138991.1 BACE2 enzyme 2 (BACE2), transcript variant 672.10664 3.0661742 c, mRNA. 4280131 NM_001729.1 BTC Homo sapiens betacellulin (BTC), 180.13724 2.9612037 mRNA. Homo sapiens wingless-type MMTV 2710343 NM_025216.2 WNT1OA integration site family, member 10A 189.95177 2.9286413 (WNT1OA), mRNA. 1410278 NM_002620.2 PF4V1 Homo sapiens platelet factor 4 variant 236.64963 2.9188691 1 (PFV1), mRNA. Homo sapiens gamma-glutamyl 160615 NM_003878.1 GGH hydrolase (conjugase, 493.05199 2.8876174 folylpolygammaglutamyl hydrolase) 49059 28764 (GGH), mRNA. Homo sapiens ectonucleotide 3060471 NM_014936.3 ENPP4 pyrophosphatase/phosphodiesterase 4 217.61858 2.8508109 (putative function) (ENPP4), mRNA. 1070333 NM_001323.2 CST6 Homo sapiens cystatin E/M (CST6), 252.51165 2.8470529 mRNA. 1030333 NM_002982.3 CCL2 Homo sapiens chemokine (C-C motif) 6909.8689 2.8127906 ligand 2 (CCL2), mRNA. Homo sapiens cytochrome P450, 6200068 NM_000786.2 CYP51A1 family 51, subfamily A, polypeptide 1 593.49956 2.8031588 (CYP51A1), mRNA. 7160598 NM_031889.1 ENAM Homo sapiens enamelin (ENAM), 145.32876 2.7977471 mRNA. 5570592 NM_003741.2 CHRD Homo sapiens chordin (CHRD), 214.77559 2.789847 mRNA. 670594 NM_000063.3 C2 Homo sapiens complement component 221.80546 2.7833375 2 (C2), mRNA. PREDICTED: Homo sapiens 2470132 XM_942072.2 CPN2 carboxypeptidase N, polypeptide 2, 215.25162 2.7818954 83kD (CPN2), mRNA. Homo sapiens biliverdin reductase B 6620521 NM_000713.1 BLVRB (flavin reductase (NADPH)) 689.8764 2.7563847 (BLVRB), mRNA. Homo sapiens proteasome (prosome, 7210326 NM_004159.4 PSMB8 macropain) subunit, beta type, 8 (large 2300.5422 2.7209601 multifunctional peptidase 7) (PSMB38), transcript variant 1, mRNA. Homo sapiens seine peptidase 1710468 NM_003710.3 SPINTI inhibitor, Kunitz type 1 (SPINTI), 182.37153 2.7124931 transcript variant 2, mRNA. Homo sapiens seine peptidase 2260326 NM_003122.2 SPINKI inhibitor, Kazal type 1 (SPINKI), 222.4441 2.6932298 mRNA. 4860494 NM_000064.1 C3 Homo sapiens complement component 199.54277 2.6846016 1 3 (C3), mRNA. 6660162 NM_052972.2 LRG1 Homo sapiens leucine-rich alpha-2- 178.16822 2.6769127 glycoprotein 1 (LRG1), mRNA. 6040270 NM_005059.2 RLN2 Homo sapiens relaxin 2 (RLN2), 159.56932 2.6660582 transcript variant 2, mRNA. 186 WO 2011/150105 PCT/US2011/037969 6480088 NM_007260.2 LYPLA2 Homo sapiens lysophospholipase II 833.2115 2.6539349 (LYPLA2), mRNA. Homo sapiens solute carrier family 27 6250646 NM_012254.1 SLC27A5 (fatty acid transporter), member 5 431.66962 2.6149472 (SLC27A5), mRNA. PREDICTED: Homo sapiens major 780403 XM_936128.2 HLA-DQA1 histocompatibility complex, class II, 130.81084 2.5988017 DQ alpha 1, transcript variant 10 (HLA-DQA1), mRNA. 6330438 NM_002673.3 PLXNB1 Homo sapiens plexin BI (PLXNB 1), 666.96062 2.5649236 mRNA. Homo sapiens lymphotoxin beta 4640064 NM_002342.1 LTBR receptor (TNFR superfamily, member 1583.3354 2.5554329 3) (LTBR), mRNA. Homo sapiens jumonji, AT rich 5870739 NM_004653.3 JARIDID interactive domain ID (JARIDID), 171.24299 2.5478529 mRNA. Homo sapiens hydroxysteroid (17 1450397 NM_014234.3 HSD17B8 beta) dehydrogenase 8 (HSD17B8), 556.59882 2.544614 mRNA. 6330270 NM_001448.2 GPC4 Homo sapiens glypican 4 (GPC4), 1806.0094 2.5442574 mRNA. Homo sapiens v-erb-b2 erythroblastic 4560288 NM_001982.2 ERBB3 leukemia viral oncogene homolog 3 248.16704 2.5207444 (avian) (ERBB3), transcript variant 1, mRNA. Homo sapiens UDP-N-acetyl-alpha-D 5310270 NM_024572.2 GALNT14 galactosamine:polypeptide N- 377.83311 2.5174213 acetylgalactosaminyltransferase 14 (GalNAc-T14) (GALNT14), mRNA. Homo sapiens histidine triad 1570370 NM_032593.2 HINT2 nucleotide binding protein 2 (HINT2), 2148.8673 2.5172379 mRNA. 2640025 NM_005143.2 HP Homo sapiens haptoglobin (HP), 151.64513 2.4910905 mRNA. Homo sapiens proteasome (prosome, 3420632 NM_148919.3 PSMB8 macropain) subunit, beta type, 8 (large 514.70782 2.4514365 multifunctional peptidase 7) (PSMB8), transcript variant 2, mRNA. 6840154 NM_002407.1 SCGB2A1 Homo sapiens secretoglobin, family 130.97478 2.4348138 1 - 2A, member 1 (SCGB2A1), mRNA. 6280097 NM_000933.2 PLCB4 Homo sapiens phospholipase C, beta 4 333.30029 2.423837 (PLCB4), transcript variant 1, mRNA. 1300187 NM_138412.2 RDH13 13 sapiens rtino RehydrogenAse 441.14049 2.3958634 4480341 NM_014762.3 DHCR24 Homo sapiens 24-dehydrocholesterol 940.33739 2.3941598 reductase (DHCR24), mRNA. 5670594 NM_021077.3 NMB Homo sapiens neuromedin B (NMB), 1157.5674 2.3821228 transcript variant 1, mRNA. 2190113 NM_005559.2 LAMA1 Homo sapiens laminin, alpha 1 329.1 2.3788761 (LAMAl), inRNA. Homo sapiens sulfide quinone 6770707 NM_021199.2 SQRDL reductase-like (yeast) (SQRDL), 675.4056 2.3666584 mRNA. Homo sapiens tumor necrosis factor 6350184 NM_032945.2 TNFRSF6B receptor superfamily, member 6b' 1083.6358 2.3574439 decoy (TNFRSF6B), transcript vacant M68C, mRNA. 3830022 NM_019101.2 APOM Homo sapiens apolipoprotein M 334.58614 2.3493486 (APOM), mRNA. 187 WO 2011/150105 PCT/US2011/037969 Homo sapiens heparan sulfate 6-0 6100494 NM_147175.3 HS6ST2 sulfotransferase 2 (HS6ST2), transcript 176.75081 2.3488259 variant S, mRNA. Homo sapiens pyrophosphatase 460630 NM_176866.2 PPA2 (inorganic) 2 (PPA2), nuclear gene 2575.9605 2.3357054 encoding mitochondrial protein, transcript variant 3, mRNA. 6510270 NM_003019.4 SFTPD Homo sapiens surfactant, pulmonary- 188.18201 2.3270815 associated protein D (SFTPD), mRNA. 6590592 NM_001006946.1 SDC1 Homo sapiens syndecan 1 (SDC1), 2035.5823 2.3120122 transcript variant 1, mRNA. 780524 NM_006505.2 PVR Homo sapiens poliovirus receptor 538.80354 2.3037232 (PVR), mRNA. Homo sapiens crumbs homolog 3 3130561 NM_139161.2 CRB3 (Drosophila) (CRB3), transcript 123.6267 2.2792423 variant 2, mRNA. 630521 NM_002996.3 CX3CL1 Homo sapiens chemokine (C-X3-C 264.61195 2.2745291 motif) ligand 1 (CX3CL1), mRNA. 1110092 NM_001909.3 CTSD Homo sapiens cathepsin D (CTSD), 4991.946 2.2716362 mRNA. Homo sapiens polymeric 50600 NM_002644.2 PIGR immunoglobulin receptor (PIGR), 131.57397 2.2663052 mRNA. Homo sapiens acyl-CoA synthetase 7040286 NM_016234.3 ACSL5 long-chain family member 5 (ACSL5), 214.49366 2.2652025 transcript variant 1, mRNA. Homo sapiens pantothenate kinase 1 6620133 NM_138316.2 PANKI (PANKI), transcript variant gamma, 703.65796 2.2568443 mRNA. 6040465 NM_015681.2 EPPB9 Homo sapiens B9 protein (EPPB9), 302.40841 2.2386501 IIRNA. Homo sapiens v-erb-b2 erythroblastic 3120608 NM_001005915.1 ERBB3 leukemia viral oncogene homolog 3 186.35767 2.2333433 (avian) (ERBB3), transcript variant s, mRNA. 2710735 NM_016084.3 RASD1 Homo sapiens RAS, dexamethasone- 640.1292 2.2325848 induced 1 (RASD1), mRNA. Homo sapiens carcinoembryonic 5700753 NM_001024912.1 CEACAMI antigen-related cell adhesion molecule 141.05206 2.211037 1 (biliary glycoprotein) (CEACAMI), transcript variant 2, mRNA. Homo sapiens chromosome Y open 7150066 NR_001544.1 CYorfl4 reading frame 14 (CYorfl4) on 159.94351 2.2061336 chromosome Y. 1820300 NM_001334.2 CTSO Homo sapiens cathepsin 0 (CTSO), 894.7826 2.1745221 IIRNA. Homo sapiens retinol dehydrogenase 2340494 NM_016026.2 RDH11 11 (all-trans/9-cis/11-cis) (RDH11), 1153.2917 2.1690928 mRNA. Homo sapiens family with sequence 1940274 NM_032036.2 FAM14A similarity 14, member A (FAM14A), 1668.6619 2.150379 mRNA. Homo sapiens mitochondrial ribosomal 6940521 NM_032112.2 MRPL43 protein L43 (MRPL43), nuclear gene 1141.281 2.1306801 encoding mitochondrial protein, transcript variant 1, mRNA. 2900139 NM_017842.1 FLJ20489 Homo sapiens hypothetical protein 524.31453 2.1301484 FLJ20489 (FLJ20489), mRNA. 1570725 NM_144772.1 APOA1BP Homo sapiens apolipoprotein A-I 3295.0063 2.1280988 binding protein (APOA1BP), mRNA. 188 WO 2011/150105 PCT/US2011/037969 50307 NM_016946.3 F11R Homo sapiens F1I receptor (F11R), 147.22935 2.1197276 transcript variant 1, mRNA. 7000754 NM_020978.3 AMY2B Homo sapiens amylase, alpha 2B 124.40767 2.09341 (pancreatic) (AIVY2B3), mRNA. 4920121 NM_024712.3 ELMO3 Homo sapiens engulfment and cell 169.38496 2.0926668 motility 3 (ELMO3), mRNA. 2570068 NM_145267.2 C6orf57 Homo sapiens chromosome 6 open 531.23201 2.0905527 reading frame 57 (C6orf57), mRNA. 5 .30 .952 5900594 NM_001779.1 CD58 Homo sapiens CD58 molecule (CD58), 1084.1274 2.0746945 mRNA. 630619 NM_006665.3 HPSE Homo sapiens heparanase (HPSE), 136.38591 2.0746731 IIRNA. Homo sapiens proteasome (prosome, 3180026 NM_148919.3 PSMB8 macropain) subunit, beta type, 8 (large 740.26445 2.0683234 multifunctional peptidase 7) (PSMB38), transcript variant 2, mRNA. 60121 NM 001908.3 CTSB Homo sapiens cathepsin B (CTSB), 10828.476 2.0676763 transcript variant 1, mRNA. 3830075 NM_001218.3 CA12 Homo sapiens carbonic anhydrase XII 654.39322 2.0639689 (CA12), transcript variant 1, mRNA. Homo sapiens proteasome (prosome, 4210706 NM_004159.4 PSMB8 macropain) subunit, beta type, 8 (large 167.93289 2.0615701 multifunctional peptidase 7) (PSMB 8), transcript variant 1, mRNA. 4280204 NM_002634.2 PHB Homo sapiens prohibitin (PHB), 2098.8739 2.0544072 mRNA. Homo sapiens NADH dehydrogenase 1070538 NM_002496.1 NDUFS8 (ubiquinone) Fe-S protein 8, 23kDa 10528.006 2.0463324 (NADH-coenzyme Q reductase) (NDUFS8), mRNA. 6420020 NM_152739.3 HOXA9 Homo sapiens homeobox A9 109.00767 2.0432491 (HOXA9), inRNA. 2690168 NM_000557.2 GDF5 Homo sapiens growth differentiation 269.84395 2.0087329 factor 5 (GDFS), mRNA. Homo sapiens chromosome 20 open 5550204 NM_023935.1 C20orf116 reading frame 116 (C20orf116), 2473.5302 2.0079934 mRNA. 4010491 XM_001129442.1 CST6 PREDICTED: Homo sapiens cystatin 182.95737 2.0007225 E/M (CST6), mRNA. NHA P3 Normal human astrocytes ProbelD RefSeqjID Symbol Definition RFU Fold over -- Ave. 1110048 NM_007281.1 SCRG1 Homo sapiens scrapie responsive 15425.628 11.658739 protein 1 (SCRG1), mRNA. 3450066 NM_001147.1 ANGPT2 Homo sapiens angiopoietin 2 643.93451 7.2820526 (ANGPT2), mRNA. 3060639 NM_003013.2 SFRP2 Homo sapiens secreted frizzled-related 7077.169 7.086917 protein 2 (SFRP2), mRNA. Homo sapiens 630315 NM_005771.3 DHRS9 dergenasuctas sr faily) 774.95413 6.5392033 1, mRNA. 1030333 NM_002982.3 CCL2 Homo sapiens chemokine (C-C motif) 14079.27 5.7312287 ligand 2 (CCL2), mRNA. 6400598 NM_001956.2 EDN2 Homo sapiens endothelin 2 (EDN2), 302.48746 4.8816715 mRNA. 6620008 NM_000216.2 KAL1 Homo sapiens Kallmann syndrome 1 2333.3537 4.8662503 sequence (KAL1), mRNA. 189 WO 2011/150105 PCT/US2011/037969 Homo sapiens bone morphogenetic 990075 NM_130851.1 BMP4 protein 4 (BMP4), transcript variant 3, 2118.3938 4.7111499 mRNA. 5690095 NM_004962.2 GDF10 Homo sapiens growth differentiation 734.56077 4.6825425 factor 10 (GDF10), mRNA. 2320598 NM_000266.1 NDP Homo sapiens Noraie disease 970.10568 4.6786944 (pseudoglioma) (NDP), mRNA. Homo sapiens beta-site APP-cleaving 1240201 NM_138991.1 BACE2 enzyme 2 (BACE2), transcript variant 1018.4325 4.6461251 c, mRNA. 6330270 NM_001448.2 GPC4 Homo sapiens glypican 4 (GPC4), 3291.7606 4.6373436 mRNA. 1940128 NM_013962.2 NRG1 Homo sapiens neuregulin 1 (NRG1)' 654.27537 4.5946624 transcript variant GGF2, mRNA. 10768 NM_004737.3 LARGE Homo sapiens like-glycosyltransferase 2224.1767 4.4321434 (LARGE), transcript variant 1, mRNA. 6510762 NM_020873.5 LRRN1 Homo sapiens leucine rich repeat 673.17397 4.2988461 neuronal 1 (LRRN1), mRNA. Homo sapiens myosin light chain 1300286 NM_053026.3 MYLK kinase (MYLK), transcript variant 2, 961.11637 4.288721 mRNA. 6380040 NM_001852.3 COL9A2 Homo sapiens collagen, type IX, alpha 2592.795 4.2329242 2 (COL9A2), mRNA. 4830592 NM_173619.2 MGC34761 Homo sapiens hypothetical protein 397.90678 4.1875834 MGC34761 (MGC34761), mRNA. Homo sapiens Clq and tumor necrosis 7320204 NM_015645.2 C1QTNF5 factor related protein 5 (C1QTNF5), 1733.7705 4.0527099 mRNA. 520682 NM_016352.2 CPA4 Homo sapiens carboxypeptidase A4 5875.8047 4.0317962 (CPA4), mRNA. 5090671 NM_004864.1 GDF15 Homo sapiens growth differentiation 3322.6796 4.0159731 factor 15 (GDF1S), mRNA. Homo sapiens carboxylesterase 1 2680056 NM_001025195.1 CESI (monocyte/macrophage serine esterase 245.18496 3.9602813 1) (CES 1), transcript variant 1, mRNA. 1260039 NM_007112.3 THBS3 Homo sapiens thrombospondin 3 1245.4686 3.8147958 (THBS3), mRNA. 2710315 NM 006786.2 UTS2 Homo sapiens urotensin 2 (UTS2), 216.9295 3.720322 transcript variant 2, mRNA. 6980064 NM_001718.4 BMP6 Homo sapiens bone morphogenetic 366.97965 3.4838907 protein 6 (BMP6), mRNA. 1070333 NM_001323.2 CST6 Homo sapiens cystatin E/M (CST6), 308.56504 3.4790514 IIRNA. Homo sapiens beta-site APP-cleaving 2230731 NM_138992.1 BACE2 enzyme 2 (BACE2), transcript variant 704.15074 3.4433271 b, mRNA. 270201 NM_032446.1 MEGF1O Homo sapiens multiple EGF-like- 612.23687 3.3443404 domains 10 (MEGF1O), mRNA. Homo sapiens proprotein convertase 4210678 NM_013271.2 PCSK1N subtilisin/kexin type 1 inhibitor 934.77965 3.3223148 (PCSK1N), mRNA. 6020682 NM_020211.1 RGMA Homo sapiens RGM domain family, 945.64558 3.3042315 member A (RGMA), inRNA. 7210681 NM_006033.2 LIPG Homo sapiens lipase, endothelial 656.10295 3.2519305 (LJPG), mRNA. Homo sapiens midkine (neurite 4560717 NM_001012334.1 MDK growth-promoting factor 2) (MDK), 12690.348 3.2362673 transcript variant 1, mRNA. 190 WO 2011/150105 PCT/US2011/037969 Homo sapiens wingless-type MMTV 4640386 NM_024494.1 WNT2B3 integration site family, member 2B 253.66563 3.0366928 (WNT2B), transcript variant WNT 2B2, mRNA. 3930020 NM_003793.2 CTSF Homo sapiens cathepsin F (CTSF), 489.57773 2.9454401 mRNA. Homo sapiens EGF-containing fibulin 1260040 NM_004105.3 EFEMPI like extracellular matrix protein 1 3757.6047 2.9290596 (EFEMPI), transcript variant 1, mRNA. Homo sapiens FXYD domain 160270 NM_022003.1 FXYD6 containing ion transport regulator 6 564.95693 2.8913104 (FXYD6), mRNA. Homo sapiens 7160468 NM_005771.3 DHRS9 dehydrogenase/reductase (SDR family) 198.46799 2.8676483 member 9 (DHRS9), transcript variant 1, mRNA. Homo sapiens inhibitor of DNA 7570324 NM_002167.2 ID3 binding 3, dominant negative helix- 6925.3973 2.8652104 loop-helix protein (ID3), mRNA. 2370041 NM_018334.3 LRRN3 Homo sapiens leucine rich repeat 229.20096 2.8308413 neuronal 3 (LRRN3), mRNA. 6480204 NM_006288.2 THYl Homo sapiens Thy-1 cell surface 6719.8552 2.8208267 antigen (THY1), mRNA. 4010491 XM_001129442.1 CST6 PREDICTED: Homo sapiens cystatin 257.5674 2.8166173 E/M (CST6), mRNA. Homo sapiens carboxypeptidase, 60136 NM_031311.3 CPVL vitellogenic-like (CPVL), transcript 449.59322 2.7581038 variant 1, mRNA. Homo sapiens ADAM 1570382 NM_182920.1 ADAMTS9 metallopeptidase with thrombospondin 523.70516 2.7482922 type 1 motif, 9 (ADAMTS9), mRNA. Homo sapiens dystrophin (muscular 6290129 NM_004019.1 DMD dystrophy, Duchenne and Becker 417.80236 2.7475886 types) (DMD), transcript variant Dp40, mRNA. 4570242 NM_133642.2 LARGE Homo sapiens like-glycosyltransferase 444.76128 2.7205019 (LARGE), transcript variant 2, mRNA. 6330438 NM_002673.3 PLXNB1 Homo sapiens plexin BI (PLXNB 1), 680.63304 2.6175035 mRNA. Homo sapiens very low density 5390661 NM_001018056.1 VLDLR lipoprotein receptor (VLDLR), 1306.4966 2.5532156 transcript variant 2, mRNA. 4490626 NM_015886.3 P115 Homo sapiens peptidase inhibitor 15 414.91755 2.5525598 (P115), mIRNA. 1030008 NM_003239.1 TGFB3 Homo sapiens transforming growth 1071.3677 2.545012 factor, beta 3 (TGFB3), mRNA. Homo sapiens carboxyl ester lipase 6650593 NM_001807.3 CEL (bile salt-stimulated lipase) (CEL), 303.2441 2.5373759 mRNA. Homo sapiens myosin light chain 7160343 NM_053032.2 MYLK kinase (MYLK), transcript variant 8, 2885.7686 2.5302625 mRNA. Homo sapiens latent transforming 3520093 NM_021070.2 LTBP3 growth factor beta binding protein 3 3136.7959 2.4319328 (LTBP3), mRNA. 4150477 NM_032211.6 LOXL4 Homo sapiens lysyl oxidase-like 4 2943.5117 2.427555 (LOXL4), mRNA. Homo sapiens deleted in lymphocytic 5490053 NR_002605.1 DLEU1 leukemia, 1 (DLEU1) on chromosome 979.26726 2.3955433 13. 191 WO 2011/150105 PCT/US2011/037969 Homo sapiens midkine (neurite 150458 NM_001012334.1 MDK growth-promoting factor 2) (MDK), 244.93348 2.3751858 transcript variant 1, mRNA. 6100487 NM_133455.2 EMIDI Homo sapiens EMI domain containing 141.71091 2.3517902 1 (EMIDI), mRNA. Homo sapiens EGF-containing fibulin 6250563 NM_004105.3 EFEMPI like extracellular matrix protein 1 1864.7771 2.3478481 (EFEMPI), transcript variant 1, mRNA. 4250408 NM_152888.1 COL22A1 Homo sapiens collagen, type XXII, 274.42596 2.3147391 alpha 1 (COL22A1), mRNA. 1770224 NM_153026.1 PRICKLE1 Homo sapiens prickle homolog 1 4944.818 2.3105679 (Drosophila) (PRICKLEl), mRNA. 5900376 NM_022843.2 PCDH20 Homo sapiens protocadherin 20 141.44882 2.3073921 (PCDH2O), mRNA. 4040544 NM_005233.3 EPHA3 Homo sapiens EPH receptor A3 145.23156 2.3052959 (EPHA3), transcript variant 1, mRNA. Homo sapiens sema domain, 5690167 NM_004186.2 SEMA3F immunoglobulin domain (Ig), short 319.87537 2.3012246 basic domain, secreted, (semaphorin) 3F (SEMA3F), mRNA. 4540215 NM_012168.4 FBXO2 Homo sapiens F-box protein 2 386.57773 2.2952571 (FBXO2), mRNA. 5290762 NM_006786.2 UTS2 Homo sapiens urotensin 2 (UTS2), 137.97994 2.2679028 transcript variant 2, mRNA. 360025 NM_198186.2 ASTN2 Homo sapiens astrotactin 2 (ASTN2), 343.48201 2.2595224 transcript variant 2, mRNA. 2350278 NM_006228.3 PNOC Homo sapiens prepronociceptin 117.69159 2.2549228 (PNOC), mRNA. Homo sapiens fibroblast growth factor 4480220 NM_021923.3 FGFRL1 receptor-like 1 (FGFRL1), transcript 2126.9951 2.2511282 variant 3, mRNA. 1230228 NM_013404.3 MSLN Homo sapiens mesothelin (MSLN), 241.14137 2.2419621 transcript variant 2, mRNA. Homo sapiens UDP-N-acetyl-alpha-D galactosamine:polypeptide N 3610202 NM_017540.3 GALNT1O acetylgalactosaminyltransferase 10 2032.9091 2.2322257 (GalNAc-T1O) (GALNT1O), transcript variant 2, mRNA. 3450091 NM_017563.1 IL17RD Homo sapiens interleukin 17 receptor 140.82935 2.2048431 D (IIL17RD), mRNA. 6940053 NM_014917.2 NTNG1 Homo sapiens netrin GI (NTNG1), 266.70885 2.2024641 transcript variant 3, mRNA. 2370593 NM_005708.2 GPC6 Homo sapiens glypican 6 (GPC6), 1016.4631 2.1977541 IIRNA. 650561 NM_002257.2 KLK1 Homo sapiens kallikrein 1 (KLK1), 182.32035 2.1929123 1 mRNA. 2900139 NM_017842.1 FLJ20489 Homo sapiens hypothetical protein 536.43289 2.1793821 FLJ20489 (FLJ20489), mRNA. Homo sapiens retinoic acid receptor 5290608 NM_002889.2 RARRES2 responder (tazarotene induced) 2 2571.7521 2.1694836 (RARRES2), mRNA. 130064 NM_000027.2 AGA Homo sapiens aspartylglucosaminidase 1035.0035 2.1550395 (AGA), mRNA. Homo sapiens EGF-containing fibulin 6900408 NM_001039348.1 EFEMPI like extracellular matrix protein 1 9787.0721 2.1415571 (EFEMPI), transcript variant 2, mRNA. 192 WO 2011/150105 PCT/US2011/037969 Homo sapiens carboxypeptidase, 1400703 NM_019029.2 CPVL vitellogenic-like (CPVL), transcript 242.67876 2.110955 variant 2, mRNA. 1780673 NM_003864.3 SAP30 Homo sapiens Sin3A-associated 1232.8431 2.1059772 protein, 3OkDa (SAP3O), mRNA. Homo sapiens fibrillin 2 (congenital 3440204 NM_001999.3 FBN2 contractural arachnodactyly) (FBN2), 3950.827 2.0921053 mRNA. Homo sapiens nudix (nucleoside 110092 NM_177533.2 NUDT14 diphosphate linked moiety X)-type 1422.4233 2.0839123 motif 14 (NUDT14), mRNA. 2810255 NM_015989.3 CSAD Homo sapiens cysteine sulfinic acid 702.78466 2.0821998 decarboxylase (CSAD), mRNA. Homo sapiens regulator of G-protein 6400403 NM_170587.1 RGS20 signaling 20 (RGS20), transcript 381.46593 2.0809892 variant 1, mRNA. Homo sapiens dystrophin (muscular 3870598 NM_004019.1 DMD dystrophy, Duchenne and Becker 154.83215 2.079479 types) (DMD), transcript variant Dp40, mRNA. 2060121 NM_000147.3 FUCAl Homo sapiens fucosidase, alpha-L- 1, 1344.276 2.0164684 tissue (FUCAl), mRNA. Homo sapiens ADAMTS-like 1 5890326 NM_052866.3 ADAMTSL1 (ADAMTSL1), transcript variant 2, 283.55133 2.0050612 mRNA. REM RPE ProbelD RefSeqjID Symbol Definition RFU Fold over -- Ave. 5690095 NM_004962.2 GDF1O Homo sapiens growth differentiation 8152.2937 51.967738 factor 10 (GDF1O), mRNA. 2370438 NM_000014.4 A2M Homo sapiens alpha-2-macroglobulin 3336.4183 33.207296 (A2M), mRNA. 2140113 NM_004352.1 CBLN1 Homo sapiens cerebellin 1 precursor 1141.7858 19.909772 (CBLN1), mRNA. 4040544 NM_005233.3 EPHA3 Homo sapiens EPH receptor A3 809.96578 12.856784 (EPHA3), transcript variant 1, mRNA. 6330079 NM_015507.2 EGFL6 Homo sapiens EGF-like-domain, 1924.9196 10.908357 multiple 6 (EGFL6), mRNA. 6180706 NM_002347.2 LY6H Homo sapiens lymphocyte antigen 6 662.1854 10.146478 complex, locus H (LY6H), mRNA. 6510762 NM_020873.5 LRRN1 Homo sapiens leucine rich repeat 1474.1922 9.4140974 neuronal 1 (LRRN1), mRNA. 3990561 NM_002347.2 LY6H Homo sapiens lymphocyte antigen 6 823.72699 7.4429921 complex, locus H (LY6H), mRNA. Homo sapiens major histocompatibility 2570564 NM_019111.3 HLA-DRA complex, class II, DR alpha (HLA- 666.73776 6.8133126 DRA), mRNA. 1030008 NM_003239.1 TGFB3 Homo sapiens transforming growth 2437.3795 5.7899451 factor, beta 3 (TGFB3), mRNA. 6330270 NM_001448.2 GPC4 Homo sapiens glypican 4 (GPC4), 4021.6108 5.6655368 mRNA. Homo sapiens proprotein convertase 4210678 NM_013271.2 PCSK1N subtilisin/kexin type 1 inhibitor 1414.6617 5.0278709 (PCSK1N), mRNA. Homo sapiens tweety homolog 1 50719 NM_020659.2 TTYH1 (Drosophila) (TTYH1), transcript 431.46106 4.8088267 variant 1, mRNA. 193 WO 2011/150105 PCT/US2011/037969 7550358 NM_006159.1 NELL2 Homo sapiens NEL-like 2 (chicken) 553.46667 4.4697237 (NELL2), mRNA. Homo sapiens FXYD domain 160270 NM_022003.1 FXYD6 containing ion transport regulator 6 793.48569 4.0608643 (FXYD6), mRNA. Homo sapiens Clq and tumor necrosis 1010446 NM_031910.3 C1QTNF6 factor related protein 6 (C1QTNF6), 1938.3504 3.6605835 transcript variant 1, mRNA. 4880446 NM_177400.2 NKX6-2 Homo sapiens NK6 homeobox 2 195.65007 3.4888276 (NKX6-2), mRNA. 7510113 NM_033254.2 BOC Homo sapiens Boc homolog (mouse) 287.47448 3.3071969 (BOC), mRNA. 270201 NM_032446.1 MEGF1O Homo sapiens multiple EGF-like- 588.29558 3.2135612 domains 10 (MEGF1O), mRNA. 3060639 NM_003013.2 SFRP2 Homo sapiens secreted frizzled-related 3167.286 3.1716485 protein 2 (SFRP2), mRNA. Homo sapiens heparan sulfate 6-0 830491 NM_001077188.1 HS6ST2 sulfotransferase 2 (HS6ST2), transcript 258.02102 3.1281114 variant L, mRNA. Homo sapiens regulator of G-protein 6400403 NM_170587.1 RGS20 signaling 20 (RGS20), transcript 571.46209 3.1174644 variant 1, mRNA. Homo sapiens tumor necrosis factor 3990224 NM_148973.1 TNFRSF25 receptor superfamily, member 25 1266.214 3.0600015 (TNFRSF2S), transcript variant 10, mRNA. 4070241 NM_003918.2 GYG2 Homo sapiens glycogenin 2 (GYG2), 1623.8111 3.0104124 transcript variant 2, mRNA. Homo sapiens retinoic acid receptor, 5720441 NM_000965.2 RARB beta (RARB), transcript variant 1, 636.23945 2.9832717 mRNA. Homo sapiens bone morphogenetic 3170100 NM_001719.1 BMP7 protein 7 (osteogenic protein 1) 222.06504 2.960819 (BMP7), mRNA. 130537 NM_182644.1 EPHA3 Homo sapiens EPH receptor nN 168.33481 2.887485 (EPHA3), transcript variant 2, mRNA. 18341 2878 3440630 NM_031475.1 ESPN Homo sapiens espin (ESPN), mRNA. 205.41608 2.8789249 Homo sapiens inhibitor of DNA 7570324 NM_002167.2 ID3 binding 3, dominant negative helix- 6835.1305 2.8278648 loop-helix protein (ID3), mRNA. 4830592 NM_173619.2 MGC34761 Homo sapiens hypothetical protein 267.14912 2.8114856 MGC34761 (MGC34761), mRNA. Homo sapiens retinoic acid receptor, 6270487 NM_016152.2 RARB beta (RARB), transcript variant 2, 342.46372 2.7850255 mRNA. 3940132 NM_001005619.1 ITGB4 Homo sapiens rii t 2 451.1236 2.6681868 (JTGB4), transcript variant 2, mRNA. 4113 .616 1010333 NM_002448.3 MSX1 Homo sapiens msh homeobox 1 3739.6668 2.6593782 (MSX1), mRNA. 3360066 NM_001146.3 ANGPT1 Homo sapiens angiopoietin 1 1039.0886 2.6247849 (ANGPT1), mRNA. 4850450 NM_014618.2 DBC1 Homo sapiens deleted in bladder 404.00996 2.6011908 1 cancer 1 (DBC1), mRNA. 6020682 NM_020211.1 RGMA Homo sapiens RGM domain family, 732.57242 2.5597211 member A (RGMA), inRNA. 4810273 NM_015464.2 SOSTDC1 Homo sapiens sclerostin domain 255.26209 2.5453645 containing 1 (SOSTDC1), mRNA.1 3140390 NM_000305.2 PON2 Homo sapiens paraoxonase 2 (PON2), 6235.0178 2.4940062 transcript variant 1, mRNA. 194 WO 2011/150105 PCT/US2011/037969 Homo sapiens collagen, type VI, alpha 2470114 NM_004369.2 COL6A3 3 (COL6A3), transcript variant 1, 8283.9748 2.4536529 mRNA. Homo sapiens Nedd4 family 60553 NM_030571.2 NDFIP1 interacting protein 1 (NDFIP1), 812.07035 2.4449195 mRNA. 1580195 NM_024888.1 PRG2 Homo sapiens plasticity-related gene 2 227.11165 2.438097 (PRG2), inRNA. 2100767 NM_130386.1 COLEC12 Homo sapiens collectin sub-family 3726.6323 2.4329691 member 12 (COLEC12), mRNA. 5390687 NM_001873.1 CPE Homo sapiens carboxypeptidase E 2148.8673 2.4010589 (CPE), mRNA. 2370041 NM_018334.3 LRRN3 Homo sapiens leucine rich repeat 193.11608 2.38516 neuronal 3 (LRRN3), mRNA. Homo sapiens heparan sulfate 6-0 6100494 NM_147175.3 HS6ST2 sulfotransferase 2 (HS6ST2), transcript 179.10752 2.380144 variant S, mRNA. Homo sapiens immunoglobulin 2900674 NM_001542.2 IGSF3 superfamily, member 3 (IGSF3), 1025.8981 2.3788328 transcript variant 1, mRNA. Homo sapiens pleiotrophin (heparin 4920576 NM_002825.5 PTN binding growth factor 8, neurite 2287.2013 2.3700464 growth-promoting factor 1) (PTN), mRNA. Homo sapiens collagen, type VI, alpha 6250192 NM_057165.2 COL6A3 3 (COL6A3), transcript variant 3, 12690.348 2.3213228 mRNA. Homo sapiens retinoic acid receptor, 830736 NM_000965.2 RARB beta (RARB), transcript variant 1, 271.82463 2.319575 mRNA. Homo sapiens protein tyrosine 3940541 NM_030671.1 PTPRO phosphatase, receptor type, 0 189.31534 2.3112173 (PTPRO), transcript variant 5, mRNA. Homo sapiens protein tyrosine 1660386 NM_030667.1 PTPRO phosphatase, receptor type, 0 162.76711 2.3055103 (PTPRO), transcript variant 1, mRNA. 5900376 NM_022843.2 PCDH20 Homo sapiens protocadherin 20 141.0205 2.3004052 (PCDH2O), mRNA. 1030333 NM_002982.3 CCL2 Homo sapiens chemokine (C-C motif) 5609.1248 2.2832985 ligand 2 (CCL2), mRNA. Homo sapiens erythrocyte membrane 1510538 NM_012307.2 EPB41L3 protein band 4.1-like 3 (EPB41L3), 1696.8497 2.2651465 mRNA. 4670671 NM_016361.2 ACP6 Homo sapiens acid phosphatase 6 380.90494 2.226162 467071 N 01661.2 ACP6lysophosphatidic (ACP6), mRNA. 430079 NM_002310.3 LIFR Homo sapiens leukemia inhibitory 218.24381 2.1967118 1 factor receptor alpha (LW R), mRNA. 10768 NM_004737.3 LARGE Homo sapiens like-glycosyltransferase 1097.2763 2.1865555 (LARGE), transcript variant 1, mRNA. 1770224 NM_153026.1 PRICKLE1 Homo sapiens prickle homolog 1 4635.09 2.1658412 (Drosophila) (PRICKLEl), mRNA. 4830451 NM_003918.1 GYG2 Homo sapiens glycogenin 2 (GYG2), 253.45324 2.1511057 IIRNA. Homo sapiens very low density 5390661 NM_001018056.1 VLDLR lipoprotein receptor (VLDLR), 1099.9468 2.1495664 transcript variant 2, mRNA. 2370593 NM_005708.2 GPC6 Homo sapiens glypican 6 (GPC6), 993.46047 2.1480187 mRNA. 1050008 NM_007351.2 MMRN1 Homo sapiens multimerin 1 139.82109 2.1469649 (MMRN1), mRNA. 195 WO 2011/150105 PCT/US2011/037969 3390328 NM_152742.1 GPC2 Homo sapiens glypican 2 (GPC2), 297.49646 2.1424426 mRNA. 4490626 NM_015886.3 P115 Homo sapiens peptidase inhibitor 15 347.59735 2.138408 (PI15), mIRNA. 7570484 NM_003226.2 TFF3 Homo sapiens trefoil factor 3 266.45479 2.131776 (intestinal) (TFF3), mRNA. Homo sapiens calcium/calmodulin 4210022 NM_153498.2 CAMK1D dependent protein kinase ID 523.19454 2.1195312 (CAMK1D), transcript variant 2, mRNA. 5670594 NM_021077.3 NMB Homo sapiens neuromedin B (NMB), 1019.702 2.0984137 transcript variant 1, mRNA. 1570598 NM_001005731.1 ITGB4 Homo sapiens integrin, beta 4 259.97795 2.0877355 (ITGB4), transcript variant 3, mRNA. 3370113 NM_001463.2 FRZB Homo sapiens frizzled-related protein 1595.4962 2.0368166 (FRZB), mRNA. Homo sapiens ciliary neurotrophic 6560487 NM_001842.3 CNTFR factor receptor (CNTFR), transcript 135.29041 2.0342232 variant 2, mRNA. 6420050 NM_002523.1 NPTX2 Homo sapiens neuronal pentraxin II 365.54801 2.0282033 (NPTX2), mRNA. Homo sapiens G protein-coupled 7510634 NM_018653.3 GPRC5C receptor, family C, group 5, member C 507.92706 2.0111518 (GPRCSC), transcript variant 2, mRNA. HSMM P3 Human skeletal muscle myoblasts ProbelD RefSeqjID Symbol Definition RFU Fold over -- Ave. 6620035 NM_001232.2 CASQ2 Homo sapiens calsequestrin 2 (cardiac 16447.124 209.70312 muscle) (CASQ2), mRNA. 1580037 NM_002152.2 HRC Homo sapiens histidine rich calcium 9787.0721 128.44443 binding protein (HRC), mRNA. Homo sapiens cytochrome c oxidase 1990437 NM_005205.2 COX6A2 subunit VIa polypeptide 2 (COX6A2), 3950.827 70.141859 nuclear gene encoding mitochondrial protein, mRNA. 780341 NM 031455.2 CCDC3 Homo sapiens coiled-coil domain 5639.4535 33.062809 containing 3 (CCDC3), mRNA. 4760040 NM_004543.3 NEB Homo sapiens nebulin (NEB), mRNA. 2249.532 30.957561 Homo sapiens receptor-associated 4780370 NM_005055.3 RAPSN protein of the synapse (RAPSN), 4712.6193 28.339276 transcript variant 1, mRNA. 2230241 NM_000129.3 F13A1 Homo sapiens coagulation factor XIII, 1531.1832 25.573257 Al polypeptide (F13A1), mRNA. 1170349 NM_005558.3 LADI Homo sapiens ladinin 1 (LADI), 4052.9354 22.644982 mRNA. Homo sapiens calcium/calmodulin 5130593 NM_172080.1 CAMK2B dependent protein kinase (CaM kinase) 1943.1158 21.721035 11 beta (CAIVK2B3), transcript variant 4, mRNA. 6420050 NM_002523.1 NPTX2 Homo sapiens neuronal pentraxin II 3775.3412 20.947069 (NPTX2), mRNA. 3830465 NM_001645.3 APOCI Homo sapiens apolipoprotein C-I 4264.5345 20.72523 (APOCI), mRNA. Homo sapiens Ras association 10639 NM_032023.3 RASSF4 (RalGDS/AF-6) domain family 3350.2642 19.105764 member 4 (RASSF4), mRNA. 196 WO 2011/150105 PCT/US2011/037969 Homo sapiens myosin, heavy chain 1, 110768 NM_005963.3 MYH1 skeletal muscle, adult (MYH1), 891.25472 15.527401 mRNA. Homo sapiens receptor-associated 6370035 NM_005055.3 RAPSN protein of the synapse (RAPSN), 825.9309 12.545667 transcript variant 1, mRNA. 2370022 NM_001080554.1 GSG1 Homo sapiens germ cell associated 1 571.26416 10.862769 (GSG1), transcript variant 3, mRNA. Homo sapiens ADP-ribosylhydrolase 3390735 NM_199162.1 ADPRHL1 like 1 (ADPRHL1), transcript variant 966.3233 10.235037 2, mRNA. 270201 NM_032446.1 MEGF1O Homo sapiens multiple EGF-like- 1838.3919 10.042205 domains 10 (MEGF1O), mRNA. 7330477 NM_173078.2 SLITRK4 Homo sapiens SLIT and NTRK-like 1230.8966 9.8898491 family, member 4 (SLITRK4), mRNA. Homo sapiens v-erb-b2 erythroblastic 4560288 NM_001982.2 ERBB3 leukemia viral oncogene homolog 3 841.11785 8.5436131 (avian) (ERBB3), transcript variant 1, mRNA. Homo sapiens sarcoglycan, delta 2450327 NM_172244.2 SGCD (35kDa dystrophin-associated 996.85029 8.3679615 glycoprotein) (SGCD), transcript variant 2, mRNA. 1980288 NM_004390.2 CTSH Homo sapiens cathepsin H (CTSH), 3080.2386 7.9068131 transcript variant 1, mRNA. Homo sapiens calcium/calmodulin 1710131 NM_172078.1 CAMK2B dependent protein kinase (CaM k inase) 469.14056 7.821982 11 beta (CAIVK2B), transcript variant 2, mRNA. Homo sapiens sarcoglycan, delta 70088 NM_000337.4 SGCD (35kDa dystrophin-associated 570.30059 7.7636549 glycoprotein) (SGCD), transcript variant 1, mRNA. Homo sapiens fibroblast growth factor 6420746 NM_002010.1 FGF9 9 (glia-activating factor) (FGF9), 453.2368 7.6026629 mRNA. 2140678 NM_000210.2 ITGA6 Homo sapiens integrin, alpha 6 911.89159 7.4824783 (ITGA6), transcript variant 2, mRNA. 91.15 74873 5820189 NM_002256.3 KISS1 Homo sapiens KiSS-1 metastasis- 1193.6432 7.1409067 suppressor (KISS 1), mRNA. Homo sapiens G protein-coupled 7510634 NM_018653.3 GPRC5C receptor, family C, group 5, member C 1658.4625 6.5667301 (GPRC5C), transcript variant 2, mRNA. Homo sapiens nudix (nucleoside 110092 NM_177533.2 NUDT14 diphosphate linked moiety X)-type 4458.1727 6.5314179 motif 14 (NUDT14), mRNA. Homo sapiens v-erb-b2 erythroblastic 3120608 NM_001005915.1 ERBB3 leukemia viral oncogene homolog 3 526.99543 6.3156066 (avian) (ERBB3), transcript variant s, mRNA. 4150626 NM_007041.2 ATE1 Homo sapiens arginyltransferase 1 382.15236 6.1976782 (ATE1), transcript variant 2, mRNA. Homo sapiens Ras association 540564 NM_032023.3 RASSF4 (RalGDS/AF-6) domain family 509.75723 6.1681629 member 4 (RASSF4), mRNA. 2810192 NM_170678.2 ITGB1BP3 Homo sapiens integrin beta 1 binding 943.65413 6.1463138 protein 3 (ITGB1BP3), mRNA 197 WO 2011/150105 PCT/US2011/037969 Homo sapiens calcium/calmodulin 6220484 NM_172081.1 CAMK2B dependent protein kinase (CaM kinase) 387.13805 6.0672788 II beta (CAMK2B), transcript variant 5, mRNA. Homo sapiens G protein-coupled 1170477 NM_022036.2 GPRC5C receptor, family C, group 5, member C 657.60406 5.7898154 (GPRC5C), transcript variant 1, mRNA. 5290333 NM_152520.3 ZNF533 Homo sapiens zinc finger protein 533 508.1674 5.7827603 (ZNF533), mRNA. Homo sapiens syntrophin, beta 1 3420739 NM_021021.2 SNTB1 (dystrophin-associated protein Al, 1973.5556 5.7761976 59kDa, basic component 1) (SNTB 1), mRNA. Homo sapiens CUG triplet repeat, 5390575 NM_006561.2 CUGBP2 RNA binding protein 2 (CUGBP2), 391.89779 5.7401282 transcript variant 2, mRNA. Homo sapiens CUG triplet repeat, 7400133 NM_001025077.2 CUGBP2 RNA binding protein 2 (CUGBP2), 363.17861 5.6215856 transcript variant 3, mRNA. 460575 NM_080647.1 TBX1 Homo sapiens T-box 1 (TBX1), 478.13186 5.5184978 transcript variant C, mRNA. 6270739 NM_006172.2 NPPA Homo sapiens natriuretic peptide 316.78407 5.4456892 precursor A (NPPA), mRNA. Homo sapiens heparan sulfate 6-0 830491 NM_001077188.1 HS6ST2 sulfotransferase 2 (HS6ST2), transcript 439.52537 5.3285749 variant L, mRNA. 6960148 NM_004684.2 SPARCL1 Homo sapiens SPARC-like 1 (mast9, 603.1854 5.1089633 hevin) (SPARCL1), mRNA. Homo sapiens serpin peptidase 6280168 NM_001085.4 SERPINA3 inhibitor, clade A (alpha-i 7509.4586 5.096531 antiproteinase, antitrypsin), member 3 (SERPINA3), mRNA. Homo sapiens angiotensinogen (serpin 2850301 NM_000029.2 AGT peptidase inhibitor, clade A, member 466.87183 4.9741194 8) (AGT), mRNA. 5570592 NM_003741.2 CHRD Homo sapiens chordin (CHRD), 377.88968 4.9086322 IIRNA. 3390328 NM_152742.1 GPC2 Homo sapiens glypican 2 (GPC2), 657.02493 4.7316133 mRNA. Homo sapiens inter-alpha (globulin) 3710343 NM_002218.3 ITIH4 inhibitor H4 (plasma Kallikrein- 249.32861 4.5132118 sensitive glycoprotein) (ITIH4), mRNA. Homo sapiens ectonucleotide 3060471 NM_014936.3 ENPP4 pyrophosphatase/phosphodiesterase 4 341.66394 4.4758093 (putative function) (ENPP4), mRNA. 2690524 NM_006698.2 BLCAP Homo sapiens bladder cancer 3115.8347 4.4514933 associated protein (BLCAP), mRNA. 31584745193 7400598 NM_006237.3 POU4F1 Homo sapiens POU class 4 homeobox 240.55929 4.4135184 1 (POU4F1), mRNA. 5570270 NM_002103.3 GYSI Homo sapiens glycogen synthase 1 1253.3695 4.3309008 (muscle) (GYS I), mRNA. Homo sapiens prostaglandin D2 1820379 NM_000954.5 PTGDS synthase 21kDa (brain) (PTGDS), 9282.15 4.3170627 mRNA. 4880730 NM_005992.1 TBX1 Homo sapiens T-box 1 (TBX1), 406.58289 4.2029731 transcript variant B, mRNA. 198 WO 2011/150105 PCT/US2011/037969 Homo sapiens insulin-like growth 3420682 NM_001007139.3 IGF2 factor 2 (somatomedin A) (JGF2), 975.15988 4.145659 transcript variant 2, mRNA. Homo sapiens heparan sulfate 6-0 6100494 NM_147175.3 HS6ST2 sulfotransferase 2 (HS6ST2), transcript 310.61386 4.1277202 variant S, mRNA. Homo sapiens rabphilin 3A-like 5260408 NM_006987.2 RPH3AL (without C2 domains) (RPH3AL), 349.04757 4.0851595 mRNA. 1190102 NM_014443.2 IL17B Homo sapiens interleukin 17B 244.73348 4.0812304 (JL17B), mRNA. 1030008 NM_003239.1 TGFB3 Homo sapiens transforming growth 1710.2 4.0625451 factor, beta 3 (TGFB3), mRNA. Homo sapiens cytochrome P450, 1770484 NM_006668.1 CYP46A1 family 46, subfamily A, polypeptide 1 272.84897 4.0623487 (CYP46A1), mRNA. 4280487 NM_003296.1 CRISP2 Homo sapiens cysteine-rich secretory 279.01814 4.0399675 protein 2 (CRJSP2), mRNA. 1170524 NM_032319.1 C2orf7 Homo sapiens chromosome 2 open 1493.5263 4.008076 reading frame 7 (C2orf7), mRNA. Homo sapiens FXYD domain 3850500 NM_005031.3 FXYD1 containing ion transport regulator 1 374.9556 3.9899871 (phospholemman) (FXYD1), transcript variant a, mRNA. Homo sapiens potassium intermediate/small conductance 1570184 NM_002249.4 KCNN3 calcium-activated channel, subfamily 317.52117 3.9007313 N, member 3 (KCNN3), transcript variant 1, mRNA. Homo sapiens laminin, alpha 2 1470296 NM_000426.3 LAMA2 (merosin, congenital muscular 750.81136 3.8842471 dystrophy) (LAMA2), transcript variant 1, mRNA. 6250541 NM_170678.2 ITGB1BP3 Homo sapiens integrin beta 1 binding 303.74336 3.8792727 protein 3 (JTGB1BP3), mRNA. 1690563 NM_199161.1 SAA1 Homo sapiens serum amyloid Al 539.16018 3.8730085 (SAA1), transcript variant 2, mRNA. Homo sapiens kringle containing 1690360 NM_024507.2 KREMEN2 transmembrane protein 2 316.1531 3.8409825 (KREMEN2), transcript variant 2, mRNA. Homo sapiens integrin, beta 2 3890373 NM_000211.2 ITGB2 (complement component 3 receptor 3 570.67743 3.8400949 and 4 subunit) (ITGB2), mRNA. 6510673 NM_001858.4 COL19A1 Homo sapiens collagen, type XIX, 193.11608 3.8156345 alpha 1 (COL19A1), mRNA. 3060056 NM_021920.2 SCT Homo sapiens secretin (SCT), mRNA. 312.4486 3.7400055 Homo sapiens sema domain, 3120750 NM_030913.3 SEMA6C transmembrane domain (TM), and 309.31099 3.5549052 cytoplasmic domain, (semaphorin) 6C (SEMA6C), mRNA. 5900468 NM_006037.3 HDAC4 Homo sapiens histone deacetylase 4 504.63407 3.4743991 (HDAC4), inRNA. Homo sapiens serpin peptidase 6290356 NM_002615.4 SERPINFI inhibitor, clade F (alpha-2 antiplasmin, 2569.4426 3.4455123 pigment epithelium derived factor), member 1 (SERPINFI), mRNA. 199 WO 2011/150105 PCT/US2011/037969 Homo sapiens arginine vasopressin 580397 NM_000490.3 AVP (neurophysin II, antidiuretic hormone, 208.20752 3.4254674 diabetes insipidus, neurohypophyseal) (AVP), mRNA. 2810673 NM_152739.3 HOXA9 Homo sapiens homeobox A9 481.21504 3.4007433 (HOXA9), mRNA. 7160504 NM_002081.1 GPC1 Homo sapiens glypican 1 (GPC1), 2154.6999 3.3830495 mRNA. Homo sapiens sema domain, 160368 NM_032108.2 SEMA6B transmembrane domain (TM), and 495.57124 3.3176696 cytoplasmic domain, (semaphorin) 6B (SEMA6B), mRNA. Homo sapiens ubiquitin-conjugating 6220168 NM_182688.1 UBE2G2 enzyme E2G 2 (UBC7 homolog, yeast) 205.46829 3.3143993 (UBE2G2), transcript variant 2, mRNA. 1070333 NM_001323.2 CST6 Homo sapiens cystatin E/M (CST6), 291.45184 3.2861011 IIRNA. 7570608 NM_000210.2 ITGA6 Homo sapiens integrin, alpha 6 192.15147 3.2535015 (ITGA6), transcript variant 2, mRNA. 730414 NM_000041.2 APOE Homo sapiens apolipoprotein E 8004.4267 3.224196 (APOE), mRNA. 4010041 NM_002435.1 MPI Homo sapiens mannose phosphate 622.88083 3.1948056 isomerase (MPI), mRNA. 770156 NM_203422.1 LOC221091 Homo sapiens similar to hypothetical 238.96195 3.1803863 protein (L0C221091), mRNA. 5310458 NM_014284.2 NCDN Homo sapiens neurochondrin (NCDN), 480.9236 3.164394 transcript variant 3, mRNA. Homo sapiens non-metastatic cells 1, 3060440 NM_198175.1 NME1 protein (NM23A) expressed in 664.97854 3.1296238 (NME1), transcript variant 1, mRNA. Homo sapiens pregnancy specific beta 3290707 NM_203287.1 PSG11 1-glycoprotein 11 (PSG11), transcript 166.40118 3.0784424 variant 2, mRNA. 2370438 NM_000014.4 A2M Homo sapiens alpha-2-macroglobulin 308.29646 3.0684677 (A2M), mRNA. 4880138 NM_000905.2 NPY Homo sapiens neuropeptide Y (NPY), 320.00804 3.0451085 IIRNA. Homo sapiens pre-B-cell leukemia 6650605 NM_020524.2 PBXIP1 homeobox interacting protein 1 394.58569 3.043971 (PBXIP1), mRNA. Homo sapiens v-erb-b2 erythroblastic 4260482 NM_001005915.1 ERBB3 leukemia viral oncogene homolog3 177.70708 3.0059962 (avian) (ERBB3), transcript variant s, mRNA. 4670162 NM_004390.3 CTSH Homo sapiens cathepsin H (CTSH), 244.99602 2.9954579 transcript variant 1, mRNA. Homo sapiens calcium binding atopy 1010465 NM_006077.2 CBARA1 related autoantigen 1 (CBARA1), 1263.7268 2.9922969 mRNA. Homo sapiens dystroglycan 1 2060091 NM_004393.2 DAGI (dystrophin-associated glycoprotein 1) 3807.4345 2.954041 (DAG1), mRNA. 10768 NM_004737.3 LARGE Homo sapiens like-glycosyltransferase 1480.5074 2.9502247 (LARGE), transcript variant 1, mRNA. Homo sapiens glyoxylate 7650615 NM_012203.1 GRHPR reductase/hydroxypyruvate reductase 1923.6373 2.943872 (GRHPR), mRNA. 200 WO 2011/150105 PCT/US2011/037969 Homo sapiens FXYD domain 5860022 NM_021902.2 FXYD1 containing ion transport regulator 1 270.17471 2.9433703 (phospholemman) (FXYD1), transcript variant b, mRNA. 2940441 NM_002527.3 NTF3 Homo sapiens neurotrophin 3 (NTF3), 599.05811 2.9430227 mRNA. 780524 NM006505.2 PVR Homo sapiens poliovirus receptor 674.80383 2.8852097 78054 NM00605.2 PVR(PVR), mRNA. Homo sapiens acetylcholinesterase (Yt 1170594 NM_000665.3 ACHE blood group) (ACHE), transcript 175.69602 2.8740884 variant E4-E6, mRNA. Homo sapiens SRY (sex determining 1300445 NM_178424.1 SOX30 region Y)-box 30 (SOX30), transcript 189.76283 2.866364 variant 1, mRNA. Homo sapiens RGM domain family, 840553 NM_001012761.1 RGMB member B (RGMB), transcript variant 1219.7878 2.8650747 1, mRNA. 1980474 NM_178836.2 LOC201164 Homo sapiens similar to CG12314 180.99189 2.864179 gene product (LOC201164), mRNA. 4640768 NM_013378.1 VPREB3 Homo sapiens pre-B lymphocyte gene 196.36637 2.8526578 3 (VPREB3), mRNA. Homo sapiens UDP-Gal:betaGlcNAc 4590008 NM_003783.2 B3GALT2 beta 1,3-galactosyltransferase, 262.78149 2.8232733 polypeptide 2 (B3GALT2), mRNA. 2350441 NM_173465.2 COL23A1 Homo sapiens collagen, type XXIII, 216.30811 2.7951188 alpha 1 (COL23A1), mRNA. Homo sapiens collagen, type XXV, 3180035 NM_032518.2 COL25A1 alpha 1 (COL25A1), transcript variant 149.11357 2.7667541 2, mRNA. Homo sapiens sparc/osteonectin, cwcv 3840554 NM_014767.1 SPOCK2 and kazal-like domains proteoglycan 309.69985 2.7552065 (testican) 2 (SPOCK2), mRNA. Homo sapiens chromosome 10 open 1110201 NM_001031746.2 ClOorf72 reading frame 72 (ClOorf72), 324.61423 2.7486732 transcript variant 1, mRNA. Homo sapiens sarcoglycan, delta 4490563 NM_172244.2 SGCD (35kDa dystrophin-associated 194.14572 2.6985473 glycoprotein) (SGCD), transcript variant 2, mRNA. 5870639 NM_014907.1 FRMPD1 Homo sapiens FERM and PDZ domain 223.77736 2.6639918 containing 1 (FRMPD1), mRNA. 3710022 NM_006512.1 SAA4 Homo sapiens serum amyloid A4, 165.94572 2.6409623 constitutive (SAA4), mRNA . 2600170 NM_003561.1 PLA2G1O Homo sapiens phospholipase A2, 172.39469 2.5989497 group X (PLA2G 10), mRNA. 2570068 NM_145267.2 C6orf57 Homo sapiens chromosome 6 open 656.10295 2.5819562 reading frame 57 (C6orfS7), mRNA. 65.09 25852 Homo sapiens mitochondrial ribosomal 4210762 NM_022163.2 MRPL46 protein L46 (MRPL46), nuclear gene 2345.1658 2.5481442 encoding mitochondrial protein, mRNA. 6420356 NM_001819.1 CHGB Homo sapiens chromogranin B 178.16822 2.5028726 (secretogranin 1) (CHGB), mRNA. 6450482 NM_014432.2 IL20RA Homo sapiens interleukin 20 receptor, 190.30752 2.4835561 alpha (IL2ORA), mRNA. 4010491 XM_001129442.1 CST6 PREDICTED: Homo sapiens cystatin 225.83923 2.4696552 E/M (CST6), mRNA. 5360064 NM_012483.1 GNLY Homo sapiens granulysin (GNLY), 162.57286 2.4527946 transcript variant 519, mRNA. 201 WO 2011/150105 PCT/US2011/037969 Homo sapiens chromosome 7 open 2900504 NM_015949.2 C7orf2O reading frame 20 (C7orf2O), mRNA. 957.5028 2.4384433 XM_946081 XM_946082 XM 946083 Homo sapiens non-metastatic cells 1, 7560673 NM_000269.2 NME1 protein (NM23A) expressed in 636.47094 2.4067983 (NME1), transcript variant 2, mRNA. Homo sapiens mitochondrial ribosomal 10343 NM_031902.3 MRPS5 protein S5 (MRPS5), nuclear gene 1631.0776 2.3944407 encoding mitochondrial protein, mRNA. Homo sapiens ADP-ribosylhydrolase 5570446 NM_138430.3 ADPRHL1 like 1 (ADPRHL1), transcript variant 169.34366 2.3693007 1, mRNA. Homo sapiens mitogen-activated 1440440 NM_004635.3 MAPKAPK3 protein kinase-activated protein kinase 2543.8603 2.3677297 3 (MAPKAPK3), mRNA. Homo sapiens translocase of outer mitochondrial membrane 70 homolog 1400435 NM_014820.3 TOMM70A A (S. cerevisiae) (TOMM70A), 4104.5745 2.3670914 nuclear gene encoding mitochondrial protein, mRNA. Homo sapiens wingless-type MMTV 6840202 NM_030761.3 WNT4 integration site family, member 4 134.51866 2.3652283 (WNT4), mRNA. 6220685 NM_016589.3 C3orfl Homo sapiens chromosome 3 open 325.74676 2.3637212 reading frame 1 (C3orfl), mRNA. 5820025 NM_001426.3 ENI Homo sapiens engrailed homeobox 1 161.01342 2.3573674 (ENI), mRNA. 6580400 NM_018215.2 FLJ10781 Homo sapiens hypothetical protein 604.91062 2.3501226 FLJ1O781 (FLJ1O781), mRNA. 3930341 NM_001080554.1 GSG1 Homo sapiens germ cell associated 1 141.69558 2.341356 (GSG1), transcript variant 3, mRNA. 7650497 NM_001972.2 ELA2 Homo sapiens elastase 2, neutrophil 156.07345 2.3129122 (ELA2), mRNA. Homo sapiens mitochondrial ribosomal 4480327 NM_031903.1 MRPL32 protein L32 (MRPL32), nuclear gene 2505.0665 2.2701862 encoding mitochondrial protein, mRNA. Homo sapiens myeloperoxidase 3520601 NM_000250.1 MPO (MPO), nuclear gene encoding 120.59543 2.2570238 mitochondrial protein, mRNA. Homo sapiens protein tyrosine 1110561 NM_007079.2 PTP4A3 phosphatase type IVA, member 3 253.77028 2.2478194 (PTP4A3), transcript variant 2, mRNA. Homo sapiens glycine cleavage system 60196 NM_004483.3 GCSH protein H (aminomethyl carrier) 594.60221 2.2292727 (GCSH), mRNA. 6510762 NM_020873.5 LRRN1 Homo sapiens leucine rich repeat 348.79853 2.2274052 neuronal 1 (LRRN1), mRNA. Homo sapiens protein tyrosine 5910594 NM_007079.2 PTP4A3 phosphatase type IVA, member 3 264.2528 2.2120379 (PTP4A3), transcript variant 2, mRNA. Homo sapiens mitochondrial ribosomal 6620181 NM_176792.1 MRPL43 protein L43 (MRPL43), nuclear gene 190.07153 2.2038651 encoding mitochondrial protein, transcript variant 2, mRNA. Homo sapiens hydroxysteroid (17 1450397 NM_014234.3 HSD17B8 beta) dehydrogenase 8 (HSD17B8), 477.39558 2.1825189 mRNA. 202 WO 2011/150105 PCT/US2011/037969 Homo sapiens acyl-CoA synthetase 1030431 NM_001995.2 ACSL1 long-chain family member 1 (ACSL1), 737.88392 2.1728853 mRNA. Homo sapiens cysteine-rich with EGF 3400619 NM_001031717.2 CRELDI like domains 1 (CRELDI), transcript 2247.9388 2.1628905 variant 1, mRNA. 360025 NM_198186.2 ASTN2 Homo sapiens astrotactin 2 (ASTN2), 327.97507 2.1575134 transcript variant 2, mRNA. Homo sapiens nudix (nucleoside 5220132 NM_198038.1 NUDT9 diphosphate linked moiety X)-type 2298.804 2.1227096 motif 9 (NUDT9), transcript variant 3, mRNA. Homo sapiens Clq and tumor necrosis 7320204 NM_015645.2 C1QTNF5 factor related protein 5 (C1QTNF5), 904.95634 2.1153466 mRNA. 3930020 NM_003793.2 CTSF Homo sapiens cathepsin F (CTSF), 349.41445 2.1021776 mRNA. Homo sapiens enoyl Coenzyme A 7650053 NM_018479.2 ECHDC1 hydratase domain containing 1 412.43591 2.0885585 (ECHDC1), mRNA. 1440725 NM_182516.1 FLJ32011 Homo sapiens hypothetical protein 163.67456 2.0562869 FLJ32O11 (FLJ32O11), mRNA. 6520347 NM_006850.2 IL24 Homo sapiens interleukin 24 (IL24), 123.53791 2.0527705 transcript variant 1, mRNA. Homo sapiens DnaJ (Hsp40) homolog, 6560445 NM_005147.3 DNAJA3 subfamily A, member 3 (DNAJA3), 2762.2621 2.0393863 mRNA. Homo sapiens heterogeneous nuclear 6860678 NR_003249.1 HNRPDL ribonucleoprotein D-like (HNRPDL), 2350.3668 2.0310688 transcript variant 3, transcribed RNA. 2570162 NM_001631.2 ALPI Homo sapiens alkaline phosphatase, 138.02404 2.03093 intestinal (ALPI), mRNA. Homo sapiens mitochondria-associated protein involved in granulocyte 6380220 NM_016069.8 Magmas macrophage colony-stimulating factor 2244.6937 2.0244019 signal transduction (Magmas), nuclear gene encoding mitochondrial protein, mRNA. 5670162 NM_153324.2 DEFB123 Homo sapiens defensin, beta 123 139.4115 2.0232148 (DEFB 123), mRNA. Homo sapiens deleted in lymphocytic 5490053 NR_002605.1 DLEU1 leukemia, 1 (DLEU1) on chromosome 826.39277 2.0215724 13. Homo sapiens growth factor receptor 7380725 NM_002086.3 GRB2 bound protein 2 (GRB2), transcript 1111.1767 2.0191536 variant 1, mRNA. HAEC P5 Human Aortic Endothelial cells ProbelD RefSeqID Symbol Definition RFU Fold over 5870138 NM_000552.3 VWF Homo sapiens von Willebrand factor 19047.355 153.42421 (VWF), mRNA. 1050008 NM_007351.2 MMRN1 Homo sapiens multimerin 1 4690.8808 72.028879 (MMRN1I), mRNA. Homo sapiens MFNG 0 2000438 NM_002405.2 MFNG fucosylpeptide 3-beta-N- 3524.7068 44.63644 acetylglucosaminyltransferase (MFNG), mRNA. 7200427 NM_017413.3 APLN Homo sapiens apelin (APLN), mRNA. 3735.2176 37.535309 3800402 NM_138961.1 ESAM Homo sapiens endothelial cell 2524.9596 33.726816 adhesion molecule (ESA), mRNA. 203 WO 2011/150105 PCT/US2011/037969 3420605 NM_007036.3 ESMI Homo sapiens endothelial cell-specific 3902.136 27.966072 molecule 1 (ESMI), mRNA. 3450066 NM_001147.1 ANGPT2 Homo sapiens angiopoietin 2 1812.5466 20.497519 (ANGPT2), mRNA. Homo sapiens ribonuclease, RNase A 4010296 NM_198235.1 RNASE1 family, 1 (pancreatic) (RNASE1), 2708.4059 20.234876 transcript variant 1, mRNA. 7040386 NM_001955.2 EDNI Homo sapiens endothelin 1 (EDNI), 10311.808 19.461166 mRNA. Homo sapiens interleukin 1 receptor 6020300 NM_003856.2 ILIRLI like 1 (ILIRLI), transcript variant 2, 1932.1664 18.646697 mRNA. 1940438 NM_002632.4 PGF Homo sapiens placental growth factor 2394.9184 18.24389 (PGF), mRNA. 6980064 NM_001718.4 BMP6 Homo sapiens bone morphogenetic 1825.3409 17.328721 protein 6 (BMP6), mRNA. 1470446 NM_016242.2 EMCN Homo sapiens endomucin (EMCN), 1064.0687 15.356161 IIRNA. Homo sapiens interleukin 1 receptor 5420754 NM_003856.2 ILIRLI like 1 (ILIRLI), transcript variant 2, 1379.6024 14.241971 mRNA. Homo sapiens ribonuclease, RNase A 1090307 NM_198232.1 RNASE1 family, 1 (pancreatic) (RNASE1), 942.9 11.104712 transcript variant 3, mRNA. 70167 NM_015364.2 LY96 Homo sapiens lymphocyte antigen 96 3127.6966 10.988555 (LY96), mRNA. Homo sapiens Clq and tumor necrosis 7320204 NM_015645.2 C1QTNF5 factor related protein 5 (C1QTNF5), 4094.5137 9.5709763 mRNA. 3710397 NM_004428.2 EFNA1 Homo sapiens ephrin-Al (EFNA1), 2857.6183 9.5590401 transcript variant 1, mRNA. Homo sapiens roundabout homolog 4, 150612 NM_019055.4 ROBO4 magic roundabout (Drosophila) 586.16254 9.2226641 (ROBO4), mRNA. 7330477 NM_173078.2 SLITRK4 Homo sapiens SLIT and NTRK-like 1147.0065 9.2158196 family, member 4 (SLJTRK4), mRNA. 2480195 NM_000603.3 NOS3 Homo sapiens nitric oxide synthase 3 656.55059 9.133038 (endothelial cell) (NOS3), mRNA. Homo sapiens tumor necrosis factor 650328 NM_003327.2 TNFRSF4 receptor superfamily, member 4 521.02574 8.9286781 (TNFRSF4), mRNA. 150180 NM_002425.1 MMP1O Homo sapiens matrix metallopeptidase 2016.6382 8.701087 10 (stromelysin 2) (MMP1O), mRNA. 6040053 NM_015136.2 STAB1 Homo sapiens stabilin 1 (STAB1), 449.52419 8.6470507 IIRNA. Homo sapiens platelet-derived growth factor beta polypeptide (simian 4040397 NM_002608.1 PDGFB sarcoma viral (v-sis) oncogene 946.21711 8.6026583 homolog) (PDGFB), transcript variant 1, mRNA. Homo sapiens EGF-containing fibulin 6250563 NM_004105.3 EFEMPI like extracellular matrix protein 1 6691.4562 8.4248795 (EFEMPI), transcript variant 1, mRNA. Homo sapiens matrix metallopeptidase 3360224 NM_002421.2 MMP1 1 (interstitial collagenase) (MMP1), 3392.2383 8.3183845 mRNA. 5080543 NM_006528.2 TFPI2 Homo sapiens tissue factor pathway 2995.7808 8.2407252 inhibitor 2 (TFPJ2), mRNA. 204 WO 2011/150105 PCT/US2011/037969 7160390 NM_004557.3 NOTCH4 Homo sapiens Notch homolog 4 563.62168 7.9201168 (Drosophila) (NOTCH4), mRNA. 5080139 NM_002771.2 PRSS3 Homo sapiens protease, serine, 708.13289 7.6247067 (mesotrypsin) (PRSS3), mRNA. 3850561 NM144504.1 F11R Homo sapiens F1I receptor (F11R), 846.3587 7.5425521 transcript variant 5, mRNA. Homo sapiens bone morphogenetic 990075 NM_130851.1 BMP4 protein 4 (BMP4), transcript variant 3, 3170.1951 7.0502776 mRNA. Homo sapiens transmembrane 6 240653 NM_023003.2 TM6SF1 superfamily member 1 (TM6SF1), 1131.9739 7.0343084 mRNA. 5090671 NM_004864.1 GDF15 Homo sapiens growth differentiation 5484.1111 6.6283978 1 factor 15 (GDF15), mRNA. 2340743 NM_001870.1 CPA3 Homo sapiens carboxypeptidase A3 522.68569 6.6129944 (mast cell) (CPA3), mRNA. Homo sapiens EGF-containing fibulin 1260040 NM_004105.3 EFEMPI like extracellular matrix protein 1 8088.404 6.3049253 (EFEMPI), transcript variant 1, mRNA. 7210681 NM_006033.2 LIPG Homo sapiens lipase, endothelial 1258.3413 6.2368848 (LJPG), mRNA. 620255 NM_012193.2 FZD4 Homo sapiens frizzled homolog 4 3074.5159 6.2081842 (Drosophila) (FZD4), mRNA. Homo sapiens carbohydrate (keratan 5720451 NM_003654.3 CHST1 sulfate Gal-6) sulfotransferase 1 826.39277 6.2035277 (CHST1), mRNA. Homo sapiens 4120133 NM_003773.2 HYAL2 hyaluronoglucosaminidase 2 3981.0552 5.9995696 (HYAL2), transcript variant 1, mRNA. Homo sapiens sema domain, 160368 NM_032108.2 SEMA6B transmembrane domain (TM), and 894.43997 5.987951 cytoplasmic domain, (semaphorin) 6B (SEMA6B), mRNA. Homo sapiens nudix (nucleoside 110092 NM_177533.2 NUDT14 diphosphate linked moiety X)-type 3985.9645 5.8396122 motif 14 (NUDT14), mRNA. Homo sapiens protein tyrosine 160711 NM_002837.2 PTPRB phosphatase, receptor type, B 688.63319 5.6899555 (PTPRB), mRNA. Homo sapiens platelet-derived growth factor beta polypeptide (simian 5390615 NM_033016.1 PDGFB sarcoma viral (v-sis) oncogene 550.76851 5.5561589 homolog) (PDGFB), transcript variant 2, mRNA. 6290706 NM_025107.1 MYCTI Homo sapiens myc target 1 (MYCTI), 380.85015 5.4283093 IIRNA. Homo sapiens guanine nucleotide 1580025 NM_004126.3 GNG11 binding protein (G protein), gamma 11 15246.368 5.4196045 (GNG11), mRNA. Homo sapiens beta-site APP-cleaving 1240201 NM_138991.1 BACE2 enzyme 2 (BACE2), transcript variant 1175.9764 5.3648459 c, mRNA. 3390187 NM_004428.2 EFNA1 Homo sapiens ephrin-Al (EFNA1), 482.47566 5.2393596 transcript variant 1, mRNA. Homo sapiens sema domain, 5690167 NM_004186.2 SEMA3F immunoglobulin domain (Ig), short 713.48289 5.1328878 basic domain, secreted, (semaphorin) 3F (SEMA3F), mRNA. 205 WO 2011/150105 PCT/US2011/037969 Homo sapiens EGF-containing fibulin 6900408 NM_001039348.1 EFEMP1 like extracellular matrix protein 1 22849.356 4.9997794 (EFEMPI), transcript variant 2, mRNA. 7400598 NM_006237.3 POU4F1 Homo sapiens POU class 4 homeobox 255.44078 4.6865477 1 (POU4F1), mRNA. Homo sapiens calcium/calmodulin 5130593 NM_172080.1 CAMK2B dependent protein kinase (CaM k nase) 407.4559 4.554728 11 beta (CAIVK2B), transcript variant 4, mRNA. 1030333 NM 002982.3 CCL2 Homo sapiens chemokine (C-C motif) 10948.097 4.4566264 ligand 2 (CCL2), mRNA. Homo sapiens ADAM 1980553 NM_003815.3 ADAM15 metallopeptidase domain 15 1159.632 4.3974635 (ADAM15), transcript variant 2, mRNA. Homo sapiens beta-site APP-cleaving 2230731 NM_138992.1 BACE2 enzyme 2 (BACE2), transcript variant 884.95074 4.3274468 b, mRNA. Homo sapiens pentraxin-related gene, 3460682 NM_002852.2 PTX3 rapidly induced by IL-I beta (PTX3), 613.29277 3.8636445 mRNA. Homo sapiens interleukin 18 binding 2190717 NM_173042.2 IL18BP protein (IL18BP), transcript variant A, 672.81814 3.8229084 mRNA. 630619 NM_006665.3 HPSE Homo sapiens heparanase (HPSE), 250.77596 3.8147497 1 mRNA. 2030161 NM_001134.1 AFP Homo sapiens alpha-fetoprotein 579.1413 3.7949647 (AFP), mRNA. 4890048 NM_001081.3 CUBN Homo sapiens cubilin (intrinsic factor- 276.40501 3.7750695 cobalamin receptor) (CUBN), mRNA. Homo sapiens ADAM 6480131 NM_207195.1 ADAM15 metallopeptidase domain 15 915.4264 3.7679841 (ADAMi15), transcript variant 4, mRNA. 7510743 NM_022475.1 HHIP Homo sapiens hedgehog interacting 198.34476 3.7246482 protein (HHIP), mRNA. 4280577 NM_001200.2 BMP2 Homo sapiens bone morphogenetic 832.27552 3.6888929 protein 2 (BMP2), mRNA. 460575 NM 080647.1 TBX1 Homo sapiens T-box 1 (TBX1), 316.69617 3.6552408 transcript variant C, mRNA. Homo sapiens ADAM 3440452 NM_207195.1 ADAM15 metallopeptidase domain 15 9199.7754 3.5898755 (ADAM15), transcript variant 4, mRNA. Homo sapiens CD59 molecule, 1410201 NM_000611.4 CD59 complement regulatory protein 2288.9096 3.5459118 (CD59), transcript variant 2, mRNA. Homo sapiens regulator of G-protein 6400403 NM_170587.1 RGS20 signaling 20 (RGS20), transcript 627.68805 3.4241906 variant 1, mRNA. Homo sapiens caspase-1 dominant 2030170 NM_052889.2 COPI negative inhibitor pseudo-ICE (COPI), 268.56173 3.4145343 transcript variant 2, mRNA. 4610753 NM_000118.1 ENG Homo sapiens endoglin (Osler-Rendu- 3505.7251 3.2867789 Weber syndrome 1) (ENG), mRNA. 2140678 NM_000210.2 ITGA6 Homo sapiens integrin, alpha 6 388.42847 3.1872293 (ITGA6), transcript variant 2, mRNA. 7050291 NM_024756.1 MMRN2 Homo sapiens multimerin 2 209.82412 3.137681 (MMRN2), mRNA. 206 WO 2011/150105 PCT/US2011/037969 Homo sapiens serpin peptidase 770408 NM_000602.1 SERPINE1 inhibitor, clade E (nexin, plasminogen 14997.135 3.1359933 activator inhibitor type 1), member 1 (SERPINE1), mRNA. Homo sapiens bone morphogenetic 5490035 NM_130851.1 BMP4 protein 4 (BMP4), transcript variant 3, 175.69602 3.0579029 mRNA. Homo sapiens cytochrome P450, 3290048 NM_178033.1 CYP4X1 family 4, subfamily X, polypeptide 1 217.67242 3.0407837 (CYP4X1), mRNA. Homo sapiens prolylcarboxypeptidase 6110386 NM_005040.2 PRCP (angiotensinase C) (PRCP), transcript 4120.6518 3.0386567 variant 1, mRNA. 780524 NM_006505.2 PVR Homo sapiens poliovirus receptor 707.62139 3.0255254 78054 NM00605.2 PVR(PVR), mRNA. 7550066 NM_006343.2 MERTK Homo sapiens c-mer proto-oncogene 867.71563 3.0237252 tyrosine kinase (MERTK), mRNA. Homo sapiens chemokine (C-C motif) 6110343 NM_145898.1 CCL23 ligand 23 (CCL23), transcript variant 346.6795 2.9478542 CKbeta8, mRNA. Homo sapiens thrombospondin, type I, 290091 NM_018676.2 THSD1 domain containing 1 (THSD1), 243.275 2.8984295 transcript variant 1, mRNA. Homo sapiens carcinoembryonic 5700753 NM_001024912.1 CEACAMI antigen-related cell adhesion molecule 183.00501 2.8686632 1 (biliary glycoprotein) (CEACAMI), transcript variant 2, mRNA. Homo sapiens serpin peptidase 1440270 NM_000185.3 SERPINDI inhibitor, clade D (heparin cofactor), 204.33319 2.8675743 member 1 (SERPINDI), mRNA. 5050706 NM_005529.5 HSPG2 Homo sapiens heparan sulfate 274.50162 2.8455701 proteoglycan 2 (HSPG2), mRNA. 3930750 NM_001570.3 IRAK2 Homo sapiens interleukin-1 receptor- 790.18053 2.8000038 associated kinase 2 (JRAK2), mRNA. Homo sapiens protocadherin 10 5910093 NM_032961.1 PCDH1O (PCDH1O), transcript variant 1, 551.21018 2.7782894 mRNA. Homo sapiens CD59 molecule, 1430240 NM_203331.1 CD59 complement regulatory protein 312.85457 2.7502246 (CD59), transcript variant 4, mRNA. Homo sapiens nuclear factor 5820035 NM_004289.5 NFE2L3 (erythroid-derived 2)-like 3 (NFE2L3), 1912.8499 2.748456 mRNA. Homo sapiens membrane protein, 830452 NM_033066.1 MPP4 palmitoylated 4 (MAGUK p55 304.96622 2.7472807 subfamily member 4) (MPP4), mRNA. 2710735 NM_016084.3 RASD1 Homo sapiens RAS, dexamethasone- 779.32522 2.7180601 induced 1 (RASD1), mRNA. 4120019 NM_020353.1 PLSCR4 Homo sapiens phospholipid 1625.5836 2.7031276 scramblase 4 (PLSCR4), mRNA. 4880730 NM_005992.1 TBX1 Homo sapiens T-box 1 (TBX1), 259.13636 2.6787727 transcript variant B, mRNA. Homo sapiens lymphotoxin beta 4640064 NM_002342.1 LTBR receptor (TNFR superfamily, member 1631.0776 2.6324867 3) (LTBR), mRNA. 5420343 NM_007348.2 ATF6 Homo sapiens activating transcription 2400.2919 2.567808 factor 6 (ATF6), mRNA. 207 WO 2011/150105 PCT/US2011/037969 6510519 NM_138284.1 IL17D Homo sapiens interleukin 17D 1392.801 2.5591642 (JL17D), mRNA. 1850092 NM_001018111.1 PODXL Homo sapiens podocalyxin-like 2715.2746 2.5492663 (PODXL), transcript variant 1, mRNA. 1570725 NM_144772.1 APOA1BP Homo sapiens apolipoprotein A-I 3868.2496 2.4983312 binding protein (APOA1BP), mRNA. Homo sapiens prolylcarboxypeptidase 1660300 NM_199418.2 PRCP (angiotensinase C) (PRCP), transcript 11535.916 2.4669379 variant 2, mRNA. 5570053 NM_002587.3 PCDH1 Homo sapiens protocadherin 1 157.3205 2.4661242 (PCDH1), transcript variant 1, mRNA. 50307 NM_016946.3 F11R Homo sapiens F1I receptor (F11R), 170.51534 2.4549865 transcript variant 1, mRNA. 1340743 NM_000584.2 IL8 Homo sapiens interleukin 8 (1L8), 7924.8209 2.4449836 mRNA. Homo sapiens regulator of G-protein 6040717 NM_017790.3 RGS3 signaling 3 (RGS3), transcript variant 143.93215 2.4088075 3, mRNA. 540670 NM_172374.1 IL4Il Homo sapiens interleukin 4 induced 1 134.45804 2.4002394 (IL411), transcript variant 2, mRNA. Homo sapiens protein tyrosine 5870553 NM_130440.1 PTPRF phosphatase, receptor type, F (PTPRF), 1811.5058 2.3448671 transcript variant 2, mRNA. Homo sapiens gamma-glutamyl 160615 NM_003878.1 GGH hydrolase (conjugase, 399.13953 2.337608 folylpolygammaglutamyl hydrolase) 39193 2370 (GGH), mRNA. Homo sapiens N-acetylated alpha 4120626 NM_005468.2 NAALADL1 linked acidic dipeptidase-like 1 213.85265 2.3331314 (NAALADL1), mRNA. Homo sapiens protocadherin 10 1580753 NM_020815.1 PCDH1O (PCDH1O), transcript variant 2, 330.05192 2.3169241 mRNA. Homo sapiens bone morphogenetic 4200491 NM_001202.2 BMP4 protein 4 (BMP4), transcript variant 1, 171.55162 2.2956704 mRNA. Homo sapiens CUG triplet repeat, 5390575 NM_006561.2 CUGBP2 RNA binding protein 2 (CUGBP2), 155.06195 2.2711929 transcript variant 2, mRNA. Homo sapiens tissue factor pathway 4280674 NM_001032281.2 TFPI inhibitor (lipoprotein-associated 314.76106 2.2378342 coagulation inhibitor) (TFPJ), transcript variant 2, mRNA. Homo sapiens thromboxane A 3940390 NM_001061.2 TBXAS1 synthase 1 (platelet, cytochrome P450, 259.52168 2.201573 family 5, subfamily A) (TBXAS 1), transcript variant TXS-, mRNA. Homo sapiens RAP 1, GTP-GDP 5560139 NM_021159.3 RAP1GDS1 dissociation stimulator 1 623.92198 2.1594748 (RAP1GDS1), mRNA. 1430487 NM_000900.2 MGP Homo sapiens matrix Gla protein 7807.0711 2.1553788 (MGP), mRNA. Homo sapiens non-metastatic cells 1, 7560673 NM_000269.2 NME1 protein (NM23A) expressed in 567.81696 2.147185 (NME1), transcript variant 2, mRNA. 630521 NM_002996.3 CX3CL1 Homo sapiens chemokine (C-X3-C 249.73805 2.1466773 motif) ligand 1 (CX3CL1), mRNA. 3930703 NM_033661.3 WDR4 Homo sapiens WD repeat domain 4 1355.7823 2.1383004 (WDR4), transcript variant 2, mRNA. 208 WO 2011/150105 PCT/US2011/037969 Homo sapiens sema domain, 3120750 NM_030913.3 SEMA6C transmembrane domain (TM), and 184.66062 2.1223009 cytoplasmic domain, (semaphorin) 6C (SEMA6C), mRNA. 5810196 NM_015395.1 DKFZP434B0335 Homo sapiens DKFZP434B0335 378.92552 2.1186106 protein (DKFZP434B0335), mRNA. 37.25 21860 Homo sapiens lymphocyte antigen 6 3520647 NM_025262.2 LY6G5C complex, locus G5C (LY6G5C), 262.95737 2.1136667 mRNA. Homo sapiens chemokine (C-C motif) 5360048 NM_005064.3 CCL23 ligand 23 (CCL23), transcript variant 109.60782 2.1078468 CKbeta8-1, mRNA. Homo sapiens scavenger receptor class 5390204 NM_145350.1 SCARFI F, member 1 (SCARFI), transcript 136.28407 2.0915511 variant 3, mRNA. 1660075 NM_018058.4 CRTAC1 Homo sapiens cartilage acidic protein 287.88599 2.0890169 1 (CRTAC1), mRNA. Homo sapiens ADAM 1570382 NM_182920.1 ADAMTS9 metallopeptidase with thrombospondin 395.36681 2.0748002 type 1 motif, 9 (ADAMTS9), mRNA. 6330576 NM-00 1018111.2 PODXL Homo sapiens podocalyxin-like39214 2.698 (PODXL), transcript variant 1, mRNA. 390.21342 2.0636948 Homo sapiens Notch homolog 1, 5080167 NM_017617.3 NOTCHI translocation-associated (Drosophila) 794.74602 2.0496945 (NOTCH1), mRNA. 3930020 NM_003793.2 CTSF Homo sapiens cathepsin F (CTSF), 340.56018 2.0489077 mRNA. Homo sapiens midkine (neurite 150458 NM_001012334.1 MDK growth-promoting factor 2) (MDK), 209.82412 2.0347208 transcript variant 1, mRNA. 6480088 NM_007260.2 LYPLA2 Homo sapiens lysophospholipase II 633.62869 2.0182262 (LYPLA2), mRNA. Homo sapiens calcium/calmodulin 1710131 NM_172078.1 CAMK2B dependent protein kinase (CaM kinase) 120.24351 2.0048204 II beta (CAMK2B), transcript variant 2, mRNA. Homo sapiens cysteine rich 3930040 NM_016441.1 CRIMI transmembrane BMP regulator 1 1412.5153 2.0043381 (chordin-like) (CRIMI), mRNA. Homo sapiens tumor necrosis factor 6350184 NM_032945.2 TNFRSF6B receptor superfamily, member 6b' 921.24823 2.0041705 decoy (TNFRSF6B), transcript variant M68C, mRNA. NHOST Normal human osteoblasts ProbelD RefSeqID Symbol Definition RFU Fold over Homo sapiens integrin, beta 2 3890373 NM_000211.2 ITGB2 (complement component 3 receptor 3 2391.4133 16.091847 and 4 subunit) (JTGB2), mRNA. 6370369 NM_001040021.1 CD14 Homo sapiens CD14 molecule (CD14), 1495.9673 13.872537 transcript variant 2, mRNA. Homo sapiens ectonucleotide 2490152 NM_001040092.1 ENPP2 pyrophosphatase/phosphodiesterase 2 1867.6103 8.1733092 (autotaxin) (ENPP2), transcript variant 2, mRNA. 70167 NM_015364.2 LY96 Homo sapiens lymphocyte antigen 96 2211.6603 7.770239 (LY96), mRNA. 209 WO 2011/150105 PCT/US2011/037969 4850450 NM_014618.2 DBC1 Homo sapiens deleted in bladder 1186.982 7.6423034 cancer 1 (DBC1), mRNA. 990458 NM_003062.1 SLIT3 Homo sapiens slit homolog 3 2047.8322 7.6047425 (Drosophila) (SLJT3), mRNA. 1070333 NM_001323.2 CST6 Homo sapiens cystatin E/M (CST6), 628.51416 7.0864574 mRNA. Homo sapiens ectonucleotide 840678 NM001040092.1 ENPP2 pyrophosphatase/phosphodiesterase 2 2097.356 6.9213379 (autotaxin) (ENPP2), transcript variant 2, mRNA. 4010491 XM_001129442.1 CST6 PREDICTED: Homo sapiens cystatin 627.68805 6.8640558 E/M (CST6), mRNA. 7000369 NM_000591.2 CD14 Homo sapiens CD14 molecule (CD14), 434.11718 6.8424232 transcript variant 1, mRNA. 6480040 NM_153703.3 PODN Homo sapiens podocan (PODN), 2491.3919 6.6480572 IIRNA. Homo sapiens extracellular matrix 6840192 NM_001393.2 ECM2 protein 2, female organ and adipocyte 1792.8196 6.2532946 specific (ECM2), mRNA. Homo sapiens pentraxin-related gene, 3460682 NM_002852.2 PTX3 rapidly induced by IL-I beta (PTX3), 909.91829 5.7323369 mRNA. 160382 NM_007117.1 TRH Homo sapiens thyrotropin-releasing 548.08319 5.6178669 hormone (TRH), mRNA. Homo sapiens WNT1 inducible 3310333 NM_003880.2 WISP3 signaling pathway protein 3 (WISP3), 337.79934 5.3611548 transcript variant 1, mRNA. Homo sapiens WNT1 inducible 4120553 NM_003881.2 WISP2 signaling pathway protein 2 (WISP2), 1496.7437 5.2665377 mRNA. 110181 NM_018689.1 KIAA1199 Homo sapiens KIAA 1199 10493.166 5.1577782 (KIAA1 199), mRNA. Homo sapiens sarcoglycan, delta 2450327 NM_172244.2 SGCD (35kDa dystrophin-associated 532.08754 4.4665563 glycoprotein) (SGCD), transcript variant 2, mRNA. Homo sapiens EGF-containing fibulin 1260040 NM_004105.3 EFEMPI like extracellular matrix protein 1 5669.5187 4.4194 (EFEMPI), transcript variant 1, mRNA. 1110048 NM_007281.1 SCRG1 Homo sapiens scrapie responsive 5811.9761 4.3927099 protein 1 (SCRG1), mRNA. Homo sapiens serpin peptidase inhibitor, clade G (C1 inhibitor), 2030309 NM_001032295.1 SERPINGI member 1, (angioedema, hereditary) 1976.0737 4.3630129 (SERPINGI), transcript variant 2, mRNA. 6020286 NM_013409.1 FST Homo sapiens follistatin (FST), 11675.871 4.3616208 transcript variant FST344, mRNA. Homo sapiens complement component 7400707 NM_001734.2 CiS 1, s subcomponent (CIS), transcript 4483.3193 4.2635884 variant 1, mRNA. 3190121 NM_177964.3 LOC130576 Homo sapiens hypothetical protein 48.76 40723 LOC130576 (LOC130576), mRNA. 482.47566 4.0872439 Homo sapiens EGF-containing fibulin 6250563 NM_004105.3 EFEMPI like extracellular matrix protein 1 3179.1444 4.0027025 (EFEMPI), transcript variant 1, mRNA. 2810673 NM_152739.3 HOXA9 Homo sapiens homeobox A9 554.01637 3.9152298 (HOXA9), mRNA. 210 WO 2011/150105 PCT/US2011/037969 3930020 NM_003793.2 CTSF Homo sapiens cathepsin F (CTSF), 617.35015 3.7141556 mRNA. Homo sapiens prostaglandin 12 7150762 NM_000961.3 PTGIS (prostacyclin) synthase (PTGIS), 3298.5431 3.7087411 mRNA. 1430278 NM_000396.2 CTSK Homo sapiens cathepsin K (CTSK), 3213.7676 3.6750716 mRNA. Homo sapiens insulin-like growth 7380719 NM_002178.2 IGFBP6 factor binding protein 6 (IGFBP6), 13034.169 3.6255226 mRNA. 2340692 NM_000435.1 NOTCH3 Homo sapiens Notch homolog 3 2126.9951 3.6196726 (Drosophila) (NOTCH3), mRNA. 5080139 NM_002771.2 PRSS3 Homo sapiens protease, serine, 330.05192 3.5537808 (mesotrypsin) (PRSS3), mRNA. Homo sapiens N-acetylated alpha 4120626 NM_005468.2 NAALADL1 linked acidic dipeptidase-like 1 322.59617 3.5195226 (NAALADL1), mRNA. Homo sapiens family with sequence 2810373 NM_017565.2 FAM20A similarity 20, member A (FAM20A), 276.95914 3.3647017 mRNA. 6270681 NM_004334.1 BST1 Homo sapiens bone marrow stromal 405.43186 3.283729 cell antigen 1 (BST1), mRNA. 5260474 NM_001733.4 CIR Homo sapiens complement component 2720.0167 3.272366 1, r subcomponent (C1R), mRNA. 6480204 NM 006288.2 THYl Homo sapiens Thy-i cell surface 7712.591 3.2375523 antigen (THY1), mRNA. Homo sapiens dipeptidyl-peptidase 4 4830255 NM_001935.3 DPP4 (CD26, adenosine deaminase 338.54779 3.2262081 complexing protein 2) (DPP4), mRNA. 5550719 NM_133503.2 DCN Homo sapiens decorin (DCN), 4016.6404 3.1564807 transcript variant A2, mRNA. 2690168 NM_000557.2 GDF5 Homo sapiens growth differentiation 422.99875 3.1488254 factor 5 (GDFS), mRNA. Homo sapiens insulin-like growth 7510414 NM_001552.2 IGFBP4 factor binding protein 4 (IGFBP4), 21483.882 3.0731243 mRNA. Homo sapiens collagen, type VI, alpha 2470114 NM_004369.2 COL6A3 3 (COL6A3), transcript variant 1, 10206.614 3.0231246 mRNA. Homo sapiens sulfide quinone 6770707 NM_021199.2 SQRDL reductase-like (yeast) (SQRDL), 857.16504 3.0035534 mRNA. Homo sapiens EGF-containing fibulin 6900408 NM_001039348.1 EFEMPI like extracellular matrix protein 1 13595.27 2.9748474 (EFEMPI), transcript variant 2, mRNA. Homo sapiens lymphotoxin beta 4640064 NM_002342.1 LTBR receptor (TNFR superfamily, member 1841.6086 2.9722743 3) (LTBR), mRNA. 4150477 NM_032211.6 LOXL4 Homo sapiens lysyl oxidase-like 4 3555.1139 2.9319519 (LOXL4), mRNA. 3440747 NM_030820.2 COL21A1 Homo sapiens collagen, type XXI, 250.13953 2.8822874 alpha 1 (COL21A1), mRNA. Homo sapiens sarcoglycan, delta 70088 NM_000337.4 SGCD (35kDa dystrophin-associated 210.31593 2.8630872 glycoprotein) (SGCD), transcript variant 1, mRNA. Homo sapiens protease, seine, 12 2480692 NM_003619.2 PRSS12 (neurotrypsin, motopsin) (PRSS12), 467.76077 2.8471737 mRNA. 211 WO 2011/150105 PCT/US2011/037969 Homo sapiens ADAM 6900086 NM_006988.3 ADAMTS1 metallopeptidase with thrombospondin 1676.5737 2.8445445 type 1 motif, 1 (ADAMTS 1), mRNA. 770156 NM_203422.1 LOC221091 Homo sapiens similar to hypothetical 209.20782 2.7843834 protein (L0C221091), mRNA. 1510181 NM_004878.3 PTGES Homo sapiens prostaglandin E 1717.0746 2.7466722 synthase (PTGES), mRNA. 5560300 NM_015719.3 COL5A3 Homo sapiens collagen, type V, alpha 372.23791 2.7210905 3 (COL5A3), mRNA. Homo sapiens reversion-inducing 3390487 NM_021111.1 RECK cysteine-rich protein with kazal motifs 1092.9658 2.6662222 (RECK), mRNA. Homo sapiens ADAM 3400600 NM_014244.2 ADAMTS2 tallopeptidase wi hS ) tranip 288.75752 2.6560028 type 1 motif, 2 (ADAVTS2), transcript variant 1, mRNA. Homo sapiens ADAMTS-like 1 5890326 NM_052866.3 ADAMTSL1 (ADAMTSL1), transcript variant 2, 371.44882 2.626606 mIRNA. 830324 NM_001459.2 FLT3LG Homo sapiens fins-related tyrosine 329.68142 2.6163785 kinase 3 ligand (FLT3LG), mRNA. 2360066 NM_178127.2 ANGPTL5 Homo sapiens angiopoietin-like 5 187.87434 2.5940441 (ANGPTL5), mRNA. 1260068 NM_006350.2 FST Homo sapiens follistatin (FST), 581.69499 2.5918436 transcript variant FST3 17, mRNA. Homo sapiens syntrophin, beta 1 3420739 NM_021021.2 SNTB1 (dystrophin-associated protein Al, 884.95074 2.5900716 59kDa, basic component 1) (SNTB 1), mRNA. Homo sapiens collagen, type VI, alpha 6250192 NM_057165.2 COL6A3 3 (COL6A3), transcript variant 3, 13933.806 2.5487765 mRNA. Homo sapiens RGM domain family, 840553 NM_001012761.1 RGMB member B (RGMB), transcript variant 1082.6854 2.5430445 1, mRNA. 7570598 NM_001848.2 COL6A1 Homo sapiens collagen, type VI, alpha 16159.754 2.5309557 1 (COL6A1), mRNA. 7320039 NM_005429.2 VEGFC Homo sapiens vascular endothelial 2236.8167 2.5267491 growth factor C (VEGFC), mRNA. 3190021 NM_021229.3 NTN4 Homo sapiens netrin 4 (NTN4), 2752.9059 2.502953 mRNA. Homo sapiens interleukin 16 5080615 NM_172217.2 IL16 (lymphocyte chemoattractant factor) 211.71755 2.4479562 (IL16), transcript variant 2, mRNA. Homo sapiens sarcoglycan, delta 4490563 NM_172244.2 SGCD (35kDa dystrophin-associated 175.9059 2.4450211 glycoprotein) (SGCD), transcript variant 2, mRNA. Homo sapiens similar to common 4590438 NM_145252.1 LOC124220 salivary protein 1 (LOC124220), 191.97802 2.4274359 mRNA. Homo sapiens sema domain, 5690167 NM_004186.2 SEMA3F immunoglobulin domain (Ig), short 337.21143 2.4259425 basic domain, secreted, (semaphorin) 3F (SEMA3F), mRNA. Homo sapiens thrombospondin, type I, 290091 NM_018676.2 THSD1 domain containing 1 (THSD1), 201.46209 2.4002618 transcript variant 1, mRNA. 212 WO 2011/150105 PCT/US2011/037969 Homo sapiens family with sequence 1940274 NM_032036.2 FAM14A similarity 14, member A (FAM14A), 1855.3173 2.3909189 mRNA. Homo sapiens integrin, beta-like 1 5570129 NM_004791.1 ITGBL1 (with EGF-like repeat domains) 381.01622 2.3840953 (ITGBL1), mRNA. Homo sapiens tyrosylprotein 5690347 NM_001008566.1 TPST2 sulfotransferase 2 (TPST2), transcript 4131.6522 2.3608107 variant 1, mRNA. 4560592 NM_004787.1 SLIT2 Homo sapiens slit homolog 2 854.82153 2.3570471 (Drosophila) (SLJT2), mRNA. Homo sapiens low density lipoprotein 2710286 NM_002332.2 LRP1 related protein 1 (alpha-2- 569.24956 2.3364678 macroglobulin receptor) (LRP1), mRNA. 7400735 NM_002345.3 LUM Homo sapiens lumican (LUM), 1058.2519 2.3195857 IIRNA. Homo sapiens WNT1 inducible 520717 NM_198239.1 WISP3 signaling pathway protein 3 (WISP3), 121.91401 2.2248541 transcript variant 3, mRNA. Homo sapiens beta-site APP-cleaving 1240201 NM_138991.1 BACE2 enzyme 2 (BACE2), transcript variant 486.5677 2.219739 c, mRNA. Homo sapiens serpin peptidase 5080192 NM_006216.2 SERPINE2 inhibitor, eade E (nexin, plasminogen 26475.669 2.2133905 activator inhibitor type 1), member 2 (SERPINE2), mRNA. Homo sapiens sema domain, 5670246 NM_006379.2 SEMA3C immunoglobulin domain (Ig), short 1135.1422 2.2087534 basic domain, secreted, (semaphorin) 3C (SEMA3C), mRNA. Homo sapiens FXYD domain 5860022 NM_021902.2 FXYD1 containing ion transport regulator 1 201.92389 2.199824 (phospholemman) (FXYD1), transcript variant b, mRNA. 4610753 NM_000118.1 ENG Homo sapiens endoglin (Osler-Rendu- 2340.1873 2.1940335 Weber syndrome 1) (ENG), mRNA. Homo sapiens regeneration associated 7320669 NM_015430.2 DKFZP586H2123 muscle protease (DKFZP586H2123), 4852.0339 2.1842653 transcript variant 1, mRNA. 6550008 NM_018402.1 IL26 Homo sapiens interleukin 26 (IL26), 132.05516 2.1767105 mRNA. Homo sapiens glutathione peroxidase 4 6520128 NM_001039847.1 GPX4 (phospholipid hydroperoxidase) 22246.979 2.1757187 (GPX4), transcript variant 2, mRNA. 1820300 NM_001334.2 CTSO Homo sapiens cathepsin 0 (CTSO), 889.50737 2.1617021 mRNA. Homo sapiens bone gamma 4830356 NM_199173.2 BGLAP carboxyglutamate (gla) protein 295.76991 2.1510376 (osteocalcin) (BGLAP), mRNA. Homo sapiens chemokine (C-X-C 4560020 NM_199168.2 CXCL12 mtif) ligan 2 strotanseltderi 12002.959 2.1398385 factor 1) (CXCL12), transcript variant 1, mRNA. Homo sapiens fibroblast growth factor 5560138 NM_002009.2 FGF7 7 (keratinocyte growth factor) (FGF7), 125.93628 2.1313451 mRNA. 2600170 NM_003561.1 PLA2G1O Homo sapiens phospholipase A2, 140.08473 2.1118584 group X (PLA2G23), mRNA. 213 WO 2011/150105 PCT/US2011/037969 Homo sapiens 6 4640079 NM_012088.2 PGLS phosphogluconolactonase (PGLS), 4299.9885 2.1047891 mRNA. 1090008 NM_000638.3 VTN Homo sapiens vitronectin (VTN), 124.36858 2.0837095 mRNA. 3360066 NM_001146.3 ANGPT1 Homo sapiens angiopoietin 1 824.21136 2.0819952 336066 M_001463 ANPT1(ANGPT1), mRNA. Homo sapiens granzyme H (cathepsin 2370010 NM_033423.3 GZMH G-like 2, protein h-CCPX) (GZMH), 174.14646 2.0806282 mRNA. Homo sapiens FXYD domain 3850500 NM_005031.3 FXYD1 containing ion transport regulator 1 194.19344 2.0664561 (phospholemman) (FXYD1), transcript variant a, mRNA. Homo sapiens rabphilin 3A-like 5260408 NM_006987.2 RPH3AL (without C2 domains) (RPH3AL), 176.47065 2.0653654 mRNA. Homo sapiens tumor necrosis factor 1090747 NM_003809.2 TNFSF12 (ligand) superfamily, member 12 733.20656 2.0647974 (TNFSF12), mRNA. Homo sapiens core 1 synthase, 580066 NM_020156.1 CIGALTI glycoprotein-N-acetylgalactosamine 3- 325.55509 2.062645 beta-galactosyltransferase, 1 (CIGALTI), mRNA. Homo sapiens natriuretic peptide 2120048 NM_000908.2 NPR3 receptor C/guanylate cyclase C 428.35 2.0451071 (atrionatriuretic peptide receptor C) (NPR3), mRNA. 7650296 NM_133505.2 DCN Homo sapiens decorin (DCN), 25684.391 2.0115996 transcript variant C, mRNA. Homo sapiens anthrax toxin receptor 1 60255 NM_018153.2 ANTXR1 (ANTXR1), transcript variant 3, 947.59425 2.0044347 mRNA. Homo sapiens collagen, type VI, alpha 3390458 NM_001849.3 COL6A2 2 (COL6A2), transcript variant 2C2, 8983.3292 2.0031836 mRNA. Xgene FB P9 Chondro ctri ProbelD RefSeqjID Symbol Definition RFU Fold over -- Ave Homo sapiens fibroblast growth factor 6420746 NM_002010.1 FGF9 9 (glia-activating factor) (FGF9), 1173.2413 19.680128 mRNA. 6480040 NM_153703.3 PODN Homo sapiens podocan (PODN), 7353.7748 19.622892 mRNA. Homo sapiens wingless-type MMTV 50634 NM_003391.1 WNT2 integration site family member 2 3350.2642 13.440289 (WNT2), mRNA. Homo sapiens pregnancy specific beta 5960392 NM_001031850.2 PSG6 1-glycoprotein 6 (PSG6), transcript 914.14469 11.86789 variant 2, mRNA. 4290037 NM_002514.2 NOV Homo sapiens nephroblastoma 2592.795 11.809808 overexpressed gene (NOV), mRNA. 4120243 NM_002784.2 PSG9 Homo sapiens pregnancy specific beta- 1050.4379 11.376419 1-glycoprotein 9 (PSG9), mRNA. Homo sapiens pregnancy specific beta 3400474 NM_002780.3 PSG4 1-glycoprotein 4 (PSG4), transcript 1481.2975 10.822208 variant 1, mRNA. 2940441 NM_002527.3 NTF3 Homo sapiens neurotrophin 3 (NTF3), 1928.5344 9.474407 mRNA. 214 WO 2011/150105 PCT/US2011/037969 990458 NM_003062.1 SLIT3 Homo sapiens slit homolog 3 2511.0521 9.3249363 (Drosophila) (SLIT3), mRNA. Homo sapiens tumor necrosis factor 2370132 NM_002546.3 TNFRSF11B receptor superfamily, member Ib 7047.5294 8.672604 (osteoprotegerin) (TNFRSF1IIB), mRNA. Homo sapiens sarcoglycan, delta 2450327 NM_172244.2 SGCD (35kDa dystrophin-associated 1013.6066 8.5086209 glycoprotein) (SGCD), transcript variant 2, mRNA. 6040494 NM_006487.2 FBLN1 Homo sapiens fibulin 1 (FBLN1), 10988.747 8.4606882 transcript variant A, mRNA. Homo sapiens mannan-binding lectin 4050326 NM_139125.2 MASPI seine peptidase 1 (C4/C2 activating 982.61814 8.3198373 component of Ra-reactive factor) (MASP1), transcript variant 2, mRNA. Homo sapiens reversion-inducing 3390487 NM_021111.1 RECK cysteine-rich protein with kazal motifs 3388.6546 8.2664125 (RECK), mRNA. 5340358 NM_000504.3 F1O Homo sapiens coagulation factor X 837.31438 7.9973211 (FlO), mRNA. Homo sapiens pregnancy specific beta 1690095 NM_002782.3 PSG6 1-glycoprotein 6 (PSG6), transcript 541.72153 7.8310027 variant 1, mRNA. 6330079 NM_015507.2 EGFL6 Homo sapiens EGF-like-domain, 1263.0988 7.1578744 multiple 6 (EGFL6), mRNA. 4150477 NM_032211.6 LOXL4 Homo sapiens lysyl oxidase-like 4 8605.1021 7.0967475 (LOXL4), mRNA. 580739 NM_001996.2 FBLN1 Homo sapiens fibulin 1 (FBLN1), 16258.189 7.0128853 transcript variant C, mRNA. 5870136 NM_004669.2 CLIC3 Homo sapiens chloride intracellular 2088.9037 6.9798042 channel 3 (CLJC3), mRNA. 7400735 NM_002345.3 LUM Homo sapiens lumican (LUM), 3083.3575 6.7584211 mRNA. 110181 NM_018689.1 KIAA1199 Homo sapiens KJAA1199 13275.365 6.5253319 (KJAA 199), mRNA. Homo sapiens ectonucleotide 840678 NM_001040092.1 ENPP2 pyrophosphatase/phosphodiesterase 2 1976.0737 6.5211026 (autotaxin) (ENPP2), transcript variant 2, mRNA. 4560592 NM_004787.1 SLIT2 Homo sapiens slit homolog 2 2191.6243 6.043088 (Drosophila) (SLJT2), mRNA. Homo sapiens ectonucleotide 2490152 NM_001040092.1 ENPP2 pyrophosphatase/phosphodiesterase 2 1364.4086 5.9711241 (autotaxin) (ENPP2), transcript variant 2, mRNA. Homo sapiens inhibin, beta B (activin 50446 NM_002193.1 INHBB AB beta polypeptide) (INHBB), 2041.0838 5.9707503 mRNA. Homo sapiens N-acetylated alpha 4120626 NM_005468.2 NAALADL1 linked acidic dipeptidase-like 1 532.17507 5.8060274 (NAALADL1), mRNA. 4850450 NM_014618.2 DBC1 Homo sapiens deleted in bladder 898.42847 5.784471 cancer 1 (DBC1), mRNA. Homo sapiens sarcoglycan, delta 70088 NM_000337.4 SGCD (35kDa dystrophin-associated 420.58687 5.7255619 glycoprotein) (SGCD), transcript variant 1, mRNA. 215 WO 2011/150105 PCT/US2011/037969 Homo sapiens prostaglandin 12 7150762 NM_000961.3 PTGIS (prostacyclin) synthase (PTGIS), 5032.2968 5.6580999 mRNA. Homo sapiens complement component 7400707 NM_001734.2 CiS 1, s subcomponent (CIS), transcript 5896.5647 5.6075696 variant 1, mRNA. 70167 NM_015364.2 LY96 Homo sapiens lymphocyte antigen 96 1590.2804 5.5871412 (LY96), mRNA. 7150634 NM_001647.2 APOD Homo sapiens apolipoprotein D 4390.26 5.5717191 (APOD), inRNA. Homo sapiens mannan-binding lectin 580360 NM_001031849.1 MASPI serine peptidase 1 (C4/C2 activating 498.17094 5.4473155 component of Ra-reactive factor) (MASP1), transcript variant 3, mRNA. 5550719 NM_133503.2 DCN Homo sapiens decorin (DCN), 6864.4329 5.3944211 transcript variant A2, mRNA. 5090026 NM_001855.3 COL15A1 Homo sapiens collagen, type XV, 3616.1996 5.3727201 alpha 1 (COLiSAl), mRNA. Homo sapiens jumonji, AT rich 5870739 NM_004653.3 JARIDID interactive domain ID (JARIDID), 349.92699 5.2064173 mRNA. 3930020 NM_003793.2 CTSF Homo sapiens cathepsin F (CTSF), 864.28923 5.199812 mRNA. Homo sapiens dipeptidyl-peptidase 4 4830255 NM_001935.3 DPP4 (CD26, adenosine deaminase 534.03702 5.0891325 complexing protein 2) (DPP4), mRNA. Homo sapiens RGM domain family, 840553 NM_001012761.1 RGMB member B (RGMB), transcript variant 2151.0059 5.0523482 1, mRNA. 6480204 NM_006288.2 THY1 Homo sapiens Thy-i cell surface 11721.186 4.9202597 antigen (THY1), mRNA. Homo sapiens protease, seine, 12 2480692 NM_003619.2 PRSS12 (neurotrypsin, motopsin) (PRSS12), 792.86888 4.826047 mRNA. 4830685 NM_006486.2 FBLN1 Homo sapiens fibulin 1 (FBLN1), 25880.203 4.8182009 transcript variant D, mRNA. 3190121 NM_177964.3 LOC130576 Homo sapiens hypothetical protein 563.81814 4.7763286 LOC130576 (L0C130576), mRNA. 1230615 NM_021197.2 WFDC1 Homo sapiens WAP four-disulfide 523.37139 4.6095686 core domain 1 (WFDC1), mRNA. 5570682 NM_024769.2 ASAM Homo sapiens adipocyte- specific 2764.6522 4.4121527 adhesion molecule (AS AM), mRNA. Homo sapiens serpin peptidase inhibitor, clade G (C1 inhibitor), 2030309 NM_001032295.1 SERPINGI member 1, (angioedema, hereditary) 1973.5556 4.357453 (SERPINGI), transcript variant 2, mRNA. Homo sapiens transforming growth 3190379 NM_003243.2 TGFBR3 factor, beta receptor III (TGFBR3), 2128.3813 4.2963553 mRNA. 5260474 NM_001733.4 CIR Homo sapiens complement component 3547.5987 4.2680037 1, r subcomponent (CIR), mRNA. Homo sapiens extracellular matrix 6840192 NM_001393.2 ECM2 protein 2, female organ and adipocyte 1222.1199 4.2627132 specific (ECM2), mRNA. Homo sapiens wingless-type MMTV 6840202 NM_030761.3 WNT4 integration site family, member 4 241.04853 4.2383325 (WNT4), mRNA. 216 WO 2011/150105 PCT/US2011/037969 Homo sapiens mannan-binding lectin 5960438 NM_139125.2 MASPI serine peptidase 1 (C4/C2 activating 361.45524 4.2069571 component of Ra-reactive factor) (MASP1), transcript variant 2, mRNA. 770156 NM_203422.1 LOC221091 Homo sapiens similar to hypothetical 310.61386 4.1340142 protein (L0C221091), mRNA. Homo sapiens pregnancy specific beta 4210500 NM_002780.3 PSG4 1-glycoprotein 4 (PSG4), transcript 1082.4317 4.0607458 variant 1, mRNA. Homo sapiens insulin-like growth 7380719 NM_002178.2 IGFBP6 factor binding protein 6 (IGFBP6), 13794.697 3.8370673 mRNA. Homo sapiens wingless-type MMTV 1820343 NM_003392.3 WNT5A integration site family, member 5A 5294.9046 3.7817475 (WNT5A), mRNA. 4390193 NM_001014447.1 CPZ Homo sapiens carboxypeptidase Z 1171.0612 3.6678308 (CPZ), transcript variant 1, mRNA. 1430278 NM_000396.2 CTSK Homo sapiens cathepsin K (CTSK), 3188.3801 3.64604 IIRNA. Homo sapiens EGF-containing fibulin 1260040 NM_004105.3 EFEMPI like extracellular matrix protein 1 4598.9417 3.5848832 (EFEMPI), transcript variant 1, mRNA. Homo sapiens procollagen C 4810445 NM_013363.2 PCOLCE2 endopeptidase enhancer 2 1921.326 3.446064 (PCOLCE2), mRNA. 4480292 NM_002781.2 PSG5 Homo sapiens pregnancy specific beta- 186.18473 3.4050235 1-glycoprotein 5 (PSG5), mRNA. Homo sapiens fibrillin 2 (congenital 3440204 NM_001999.3 FBN2 contractural arachnodactyly) (FBN2), 6418.5507 3.398854 mRNA. Homo sapiens pregnancy specific beta 5690681 NM_002780.3 PSG4 1-glycoprotein 4 (PSG4), transcript 285.11667 3.3249368 variant 1, mRNA. Homo sapiens sema domain, immunoglobulin domain (Ig), short 4220433 NM_001005914.1 SEMA3B basic domain, secreted, (semaphorin) 338.15605 3.2904567 3B (SEMA3B), transcript variant 2, mRNA. Homo sapiens lymphotoxin beta 4640064 NM_002342.1 LTBR receptor (TNFR superfamily, member 2015.301 3.2526063 3) (LTBR), mRNA. Homo sapiens proline/arginine-rich 7000446 NM_201348.1 PRELP end leucine-rich repeat protein 333.16091 3.1149997 (PRELP), transcript variant 2, mRNA. Homo sapiens limb bud and heart 2810246 NM_030915.1 LBH development homolog (mouse) (LBH), 3678.6683 3.1115066 mRNA. Homo sapiens T-box 3 (ulnar 7200195 NM_005996.3 TBX3 mammary syndrome) (TBX3), 691.35959 3.0925982 transcript variant 1, mRNA. 7320039 NM_005429.2 VEGFC Homo sapiens vascular endothelial 2734.1034 3.0884933 growth factor C (VEGFC), mRNA. Homo sapiens complement component 1300327 NM_201442.1 CiS 1, s subcomponent (CIS), transcript 526.62957 3.0617522 variant 2, mRNA. Homo sapiens EGF-containing fibulin 6900408 NM_001039348.1 EFEMPI like extracellular matrix protein 1 13933.806 3.0489242 (EFEMPI), transcript variant 2, mRNA. 217 WO 2011/150105 PCT/US2011/037969 2600397 NM_153225.2 RPESP Homo sapiens RPE-spondin (RPESP), 261.78038 3.0374899 mRNA. 4890270 NM_002346.1 LY6E Homo sapiens lymphocyte antigen 6 6806.1903 3.0307279 complex, locus E (LY6E), mRNA. Homo sapiens alanyl (membrane) aminopeptidase (aminopeptidase N, 5810612 NM_001150.1 ANPEP aminopeptidase M, microsomal 2505.0665 2.9928741 aminopeptidase, CD13, p150) (ANPEP), mRNA. 1190142 NM_032048.2 EMILIN2 Homo sapiens elastin microfibril 927.23112 2.9554533 1 interfacer 2 (EMEIIN2), mRNA. 5340064 NM_001014447.1 CPZ Homo sapiens carboxypeptidase Z 426.35634 2.9216583 (CPZ), transcript variant 1, mRNA. Homo sapiens pentraxin-related gene, 3460682 NM_002852.2 PTX3 rapidly induced by IL-I beta (PTX3), 460.60959 2.9017653 mRNA. 5050131 NM_006485.3 FBLN1 Homo sapiens fibulin 1 (FBLN1), 196.90339 2.8861509 transcript variant B, mRNA. Homo sapiens SLIT-ROBO Rho 2470220 NM_020762.1 SRGAP1 GTPase activating protein 1 947.59425 2.8820252 (SRGAP1), mRNA. Homo sapiens short stature homeobox 2000739 NM_006884.2 SHOX2 2 (SHOX2), transcript variant 273.11091 2.8525462 SHOX2a, mRNA. Homo sapiens EGF-containing fibulin 6250563 NM_004105.3 EFEMPI like extracellular matrix protein 1 2254.5395 2.8385785 (EFEMPI), transcript variant 1, mRNA. Homo sapiens laminin, alpha 2 1470296 NM_000426.3 LAMA2 (merosin, congenital muscular 548.46991 2.837454 dystrophy) (LAMA2), transcript variant 1, mRNA. 1850372 NM_000915.2 OXT Homo sapiens oxytocin, prepro- 197.72301 2.8302173 (neurophysin I) (OXT), mRNA. 7650296 NM_133505.2 DCN Homo sapiens decorin (DCN), 36044.084 2.82297 transcript variant C, mRNA. 5670465 NM_001124.1 ADM Homo sapiens adrenomedullin (ADM), 20167.417 2.7664714 IIRNA. Homo sapiens ADAM 3420025 NM_153202.1 ADAM33 metallopeptidase domain 33 199.62094 2.7268123 (ADAM33), transcript variant 2, mRNA. Homo sapiens serpin peptidase 5080192 NM_006216.2 SERPINE2 inhibitor, clade E (nexin, plasminogen 32458.718 2.713579 activator inhibitor type 1), member 2 (SERPINE2), mRNA. 1710484 NM_002023.3 FMOD Homo sapiens fibromodulin (FMOD), 649.73805 2.7105946 mRNA. 4880609 NM_012242.2 DKK1 Homo sapiens dickkopf homolog 1 172.80442 2.6759062 (Xenopus laevis) (DKK1), mRNA. Homo sapiens sarcoglycan, delta 4490563 NM_172244.2 SGCD (35kDa dystrophin-associated 192.48171 2.6754182 glycoprotein) (SGCD), transcript variant 2, mRNA. Homo sapiens ADAM 1440224 NM_025220.2 ADAM33 metallopeptidase domain 33 213.33112 2.6728722 (ADAM33), transcript variant 1, mRNA. 7510113 NM_033254.2 BOC Homo sapiens Boc homolog (mouse) 228.47375 2.6284338 (BOC), mRNA. 218 WO 2011/150105 PCT/US2011/037969 2630437 NM_022138.1 SMOC2 Homo sapiens SPARC related modular 264.03968 2.6273557 calcium binding 2 (SMOC2), mRNA. 7330292 NM_001998.2 FBLN2 Homo sapiens fibulin 2 (FBLN2), 5243.1438 2.5769384 transcript variant 2, mRNA. Homo sapiens chromosome 10 open 1110201 NM_001031746.2 ClOorf72 reading frame 72 (ClOorf72), 304.27839 2.5764793 transcript variant 1, mRNA. 4230750 NM_023067.2 FOXL2 Homo sapiens forkhead box L2 208.75642 2.5043306 (FOXL2), mRNA. 1070333 NM_001323.2 CST6 Homo sapiens cystatin E/M (CST6), 222.00782 2.5031241 IIRNA. 2810673 NM_152739.3 HOXA9 Homo sapiens homeobox A9 352.74145 2.4928213 (HOXA9), mRNA. 830324 NM_001459.2 FLT3LG Homo sapiens fins-related tyrosine 311.13304 2.4691771 kinase 3 ligand (FLT3LG), mRNA. 2570240 NM_015170.1 SULF1 Homo sapiens sulfatase 1 (SULFI), 6636.9991 2.4426691 IIRNA. 7510551 NM_024913.3 FLJ21986 Homo sapiens hypothetical protein 1058.4771 2.4030942 1 FLJ2 1986 (FLJ2 1986), mRNA. 5080139 NM_002771.2 PRSS3 Homo sapiens protease, serine, 220.67729 2.3761071 (mesotrypsin) (PRSS3), mRNA. 4120019 NM_020353.1 PLSCR4 Homo sapiens phospholipid 1422.0497 2.364678 scramblase 4 (PLSCR4), mRNA. 5960398 NM_002526.1 NT5E Homo sapiens 5-nucleotidase, ecto 1956.2917 2.3550354 (CD73) (NTSE), mRNA. 6020286 NM_013409.1 FST Homo sapiens follistatin (FST), 6246.1385 2.3332981 transcript variant FST344, mRNA. Homo sapiens sema domain, immunoglobulin domain (Ig), short 430181 NM_001005914.1 SEMA3B basic domain, secreted, (semaphorin) 300.95074 2.3248369 3B (SEMA3B), transcript variant 2, mRNA. Homo sapiens wingless-type MMTV 4640386 NM_024494.1 NT2B3 integration site family, member 2B 194.19344 2.3247367 (WNT2B), transcript variant WNT 2B2, mRNA. Homo sapiens laminin, alpha 2 360181 NM_001079823.1 LAMA2 (merosin, congenital muscular 471.60221 2.3055525 dystrophy) (LAMA2), transcript variant 2, mRNA. Homo sapiens proopiomelanocortin (adrenocorticotropin/ beta-lipotropin/ 5080072 NM_001035256.1 POMC alpha-melanocyte stimulating 156.62198 2.3046575 hormone/ beta-melanocyte stimulating hormone/ beta-endorphin) (POMC), transcript variant 1, mRNA. Homo sapiens collagen, type VI, alpha 6250192 NM_057165.2 COL6A3 3 (COL6A3), transcript variant 3, 12576.657 2.3005263 mRNA. 5090500 NM_000899.3 KITLG Homo sapiens KIT ligand (KITLG), 795.36755 2.2952673 transcript variant b, mRNA. Homo sapiens suppression of 5270563 NM_021908.2 ST7 tumorigenicity 7 (ST7), transcript 1122.3127 2.28248 variant b, mRNA. Homo sapiens interleukin 11 receptor, 2760148 NM_004512.3 ILIRA alpha (ILIRA), transcript variant 1, 3252.2406 2.2747995 mRNA. 2370041 NM_018334.3 LRRN3 Homo sapiens leucine rich repeat 182.22817 2.2506844 neuronal 3 (LRRN3), mRNA. 219 WO 2011/150105 PCT/US2011/037969 Homo sapiens chromosome Y open 7150066 NR_001544.1 CYorfl4 reading frame 14 (CYorfl4) on 161.52618 2.2279636 chromosome Y. Homo sapiens phosphoprotein 3610228 NM_003768.2 PEA15 enriched in astrocytes 15 (PEA15), 10828.476 2.2227647 mRNA. 2100767 NM_130386.1 COLEC12 Homo sapiens collectin sub-family 3392.2383 2.2146566 member 12 (COLEC12), mRNA. 2340743 NM_001870.1 CPA3 Homo sapiens carboxypeptidase A3 173.38555 2.1936656 (mast cell) (CPA3), mRNA. 5130435 NM_002290.2 LAMA4 Homo sapiens laminin, alpha 4 824.82773 2.1792115 (LAMA4), inRNA. Homo sapiens FXYD domain 5860022 NM_021902.2 FXYD1 containing ion transport regulator 1 199.89189 2.1776867 (phospholemman) (FXYD1), transcript variant b, mRNA. Homo sapiens inter-alpha (globulin) 770193 NM_030569.4 ITIH5 inhibitor H5 (JTJH5), transcript variant 129.12625 2.1655328 1, mRNA. Homo sapiens peptidylprolyl 7000114 NM_000943.4 PPIC isomerase C (cyclophilin C) (PPIC), 3708.8383 2.1599696 mRNA. Homo sapiens collagen, type VI, alpha 2470114 NM_004369.2 COL6A3 3 (COL6A3), transcript variant 1, 7286.5743 2.1582302 mRNA. 70730 NM_000820.1 GAS6 Homo sapiens growth arrest-specific 6 8579.1652 2.1561314 (GAS6), mRNA. 7570598 NM_001848.2 COL6A1 Homo sapiens collagen, type VI, alpha 13663.985 2.140066 1 (COL6A1), mRNA. 4280632 NM_000820.1 GAS6 Homo sapiens growth arrest-specific 6 8283.9748 2.1303316 (GAS6), mRNA. Homo sapiens chromosome 5 open 1690240 NM_032385.3 C5orf4 reading frame 4 (C5orf4), transcript 454.32788 2.1249724 variant 2, mRNA. Homo sapiens collagen, type VI, alpha 2750356 NM_001849.3 COL6A2 2 (COL6A2), transcript variant 2C2, 5790.7678 2.1210633 mRNA. 7650672 NM_012098.2 ANGPTL2 Homo sapiens angiopoietin-like 2 2178.0894 2.1129499 (ANGPTL2), mRNA. Homo sapiens collagen, type VI, alpha 3390458 NM_001849.3 COL6A2 2 (COL6A2), transcript variant 2C2, 9395.8299 2.0951668 mRNA. Homo sapiens carboxyl ester lipase 6650593 NM_001807.3 CEL (bile salt-stimulated lipase) (CEL), 249.13201 2.0845963 mRNA. 1070152 NM_018725.3 IL17RB Homo sapiens interleukin 17 receptor 143.72131 2.047785 B (WL17RB), mRNA. 3190021 NM_021229.3 NTN4 Homo sapiens netrin 4 (NTN4), 2233.7621 2.0309454 mRNA. 1260068 NM_006350.2 FST Homo sapiens follistatin (FST), 455.04912 2.0275508 transcript variant FST317, mRNA. 7650189 NM_002292.3 LAMB2 Homo sapiens lamminin, beta 2 (laminin 2015.301 2.0218177 S) (LAMB2), mRNA. 50368 NM_001920.3 DCN Homo sapiens decorin (DCN), 4859.9181 2.0120387 transcript variant Al, mRNA. Homo sapiens hematopoietic cell 1580088 NM_001007469.1 HCST signal transducer (HCST), transcript 420.46401 2.0098369 variant 2, mRNA. Homo sapiens insulin-like growth 3420682 NM_001007139.3 IGF2 factor 2 (somatomedin A) (JGF2), 470.78776 2.0014415 transcript variant 2, mRNA. 220 WO 2011/150105 PCT/US2011/037969 Xgene FB P9 D1 Chondro Pellet ProbelD RefSeqID Symbol Definition RFU Fold over Ave Homo sapiens serpin peptidase 3290630 NM_000624.3 SERPINA5 inhibitor, clade A (alpha-i 2992.7693 17.120868 antiproteinase, antitrypsin), member 5 (SERPINA5), mRNA. 2710735 NM_016084.3 RASD1 Homo sapiens RAS, dexamethasone- 3991.0041 13.919464 induced 1 (RASD1), mRNA. Homo sapiens transforming growth 3190379 NM_003243.2 TGFBR3 factor, beta receptor III (TGFBR3), 6650.5519 13.424819 mRNA. 5340358 NM_000504.3 FlO Homo sapiens coagulation factor X 1279.2183 12.218015 (FlO), mRNA. Homo sapiens matrix metallopeptidase 7400400 NM_002422.3 MMP3 3 (stromelysin 1, progelatinase) 2577.9833 12.079001 (MMP3), mRNA. Homo sapiens ectonucleotide 840678 NM_001040092.1 ENPP2 pyrophosphatase/phosphodiesterase 2 3194.6006 10.542278 (autotaxin) (ENPP2), transcript variant 2, mRNA. Homo sapiens ectonucleotide 2490152 NM_001040092.1 ENPP2 pyrophosphatase/phosphodiesterase 2 2191.6243 9.5913066 (autotaxin) (ENPP2), transcript variant 2, mRNA. 6040494 NM_006487.2 FBLN1 Homo sapiens fibulin 1 (FBLN1), 11862.233 9.1332211 transcript variant A, mRNA. 10397 NM_014310.3 RASD2 Homo sapiens RASD family, member 2435.3712 8.9885106 2 (RASD2), mRNA. Homo sapiens ADAM 7150609 NM_021599.1 ADAMTS2 tallopeptidase wi TS ) tranip 844.22419 8.7944456 type 1 motif, 2 (ADAVTS2), transcript variant 2, mRNA. Homo sapiens prostaglandin endoperoxide synthase 1 1070450 NM_080591.1 PTGS1 (prostaglandin G/H synthase and 7286.5743 7.4689023 cyclooxygenase) (PTGS 1), transcript variant 2, mRNA. Homo sapiens collagen, type VI, alpha 2470114 NM_004369.2 COL6A3 3 (COL6A3), transcript variant 1, 25120.052 7.4403762 mRNA. Homo sapiens alanyl (membrane) aminopeptidase (aminopeptidase N, 5810612 NM_001150.1 ANPEP aminopeptidase M, microsomal 5844.3211 6.9823764 aminopeptidase, CD13, p150) (ANPEP), mRNA. Homo sapiens ADAM 6900086 NM_006988.3 ADAMTS1 metallopeptidase with thrombospondin 3965.9333 6.7287672 type 1 motif, 1 (ADAMTS 1), mRNA. Homo sapiens ADP-ribosylhydrolase 3390735 NM_199162.1 ADPRHL1 like 1 (ADPRHL1), transcript variant 634.93451 6.7250559 2, mRNA. 5550719 NM_133503.2 DCN Homo sapiens decorin (DCN), 8508.4919 6.6864064 transcript variant A2, mRNA. Homo sapiens thrombospondin, type I, 2370056 NM_199296.1 THSD3 domain containing 3 (THSD3), 416.77065 6.4393187 transcript variant 1, mRNA. 221 WO 2011/150105 PCT/US2011/037969 Homo sapiens N-acetylated alpha 4120626 NM_005468.2 NAALADL1 linked acidic dipeptidase-like 1 584.36298 6.3753972 (NAALADL1), mRNA. 2340692 NM_000435.1 NOTCH3 Homo sapiens Notch homolog 3 3599.6814 6.1258572 (Drosophila) (NOTCH3), mRNA. 3830075 NM_001218.3 CA12 Homo sapiens carbonic anhydrase XII 1938.3504 6.1135949 (CA12), transcript variant 1, mRNA. 150474 NM_001218.3 CA12 Homo sapiens carbonic anhydrase XII 7712.591 6.0689057 (CA12), transcript variant 1, mRNA. 580739 NM_001996.2 FBLN1 Homo sapiens fibulin 1 (FBLN1), 13864.881 5.9805445 transcript variant C, mRNA. 240274 NM_000877.2 ILIRI Homo sapiens interleukin 1 receptor, 1009.0606 5.827361 type I (RLIRI), mRNA. Homo sapiens pregnancy specific beta 3400474 NM_002780.3 PSG4 1-glycoprotein 4 (PSG4), transcript 797.22847 5.8244698 variant 1, mRNA. Homo sapiens prostaglandin endoperoxide synthase 1 6840626 NM_000962.2 PTGS1 (prostaglandin G/H synthase and 1058.4771 5.7889445 cyclooxygenase) (PTGS 1), transcript variant 1, mRNA. 4120243 NM_002784.2 PSG9 Homo sapiens pregnancy specific beta- 531.66283 5.7579978 1-glycoprotein 9 (PSG9), mRNA. Homo sapiens pregnancy specific beta 5960392 NM_001031850.2 PSG6 1-glycoprotein 6 (PSG6), transcript 441.06755 5.7261625 variant 2, mRNA. Homo sapiens ADAM 3400600 NM_014244.2 ADAMTS2 metallopeptidase with thrombospondin 612.55229 5.6342794 type 1 motif, 2 (ADAVTS2), transcript variant 1, mRNA. Homo sapiens serpin peptidase 6280168 NM_001085.4 SERPINA3 inhibitor, clade A (alpha-i 8283.9748 5.6221809 antiproteinase, antitrypsin), member 3 (SERPINA3), mRNA. Homo sapiens mannan-binding lectin 4050326 NM_139125.2 MASPI seine peptidase 1 (C4/C2 activating 663.83923 5.6207332 component of Ra-reactive factor) (MASP1), transcript variant 2, mRNA. Homo sapiens collagen, type VI, alpha 6250192 NM_057165.2 COL6A3 3 (COL6A3), transcript variant 3, 30012.06 5.4898161 mRNA. 4780671 NM_014584.1 ERO1L Homo sapiens ERO-like (S. 4282.2642 5.4528493 cerevisiae) (EROlL), mnRNA. Homo sapiens T-box 3 (ulnar 7200195 NM_005996.3 TBX3 mammary syndrome) (TBX3), 1215.1339 5.4355519 transcript variant 1, mRNA. 5260474 NM_001733.4 CIR Homo sapiens complement component 4502.4693 5.4167784 1, r subcomponent (C1R), mRNA. 110181 NM_018689.1 KIAA1199 Homo sapiens KIAA 1199 10753.486 5.2857351 (KIAA1 199), mRNA. 6420050 NM_002523.1 NPTX2 Homo sapiens neuronal pentraxin II 903.45059 5.0126971 (NPTX2), inRNA. 4760095 NM_004750.2 CRLF1 Homo sapiens cytokine receptor-like 2847.6606 5.0113011 factor 1 (CRLF1), mRNA. 5670594 NM_021077.3 NMB Homo sapiens neuromedin B (NMB), 2322.9397 4.780307 transcript variant 1, mRNA. Homo sapiens ribonuclease, RNase A 6590041 NM_194431.1 RNASE4 family, 4 (RNASE4), transcript variant 7582.6208 4.6370887 3, mRNA. 222 WO 2011/150105 PCT/US2011/037969 5050131 NM_006485.3 FBLN1 Homo sapiens fibulin 1 (FBLN1), 313.08223 4.5890654 transcript variant B, mRNA. 7330292 NM_001998.2 FBLN2 Homo sapiens fibulin 2 (FBLN2), 9090.7962 4.4680105 transcript variant 2, mRNA. Homo sapiens angiogenin, 3930392 NM_001097577.1 ANG ribonuclease, RNase A family, 5 4112.7127 4.4575213 (ANG), transcript variant 2, mRNA. 430088 NM 006487.2 FBLN1 Homo sapiens fibulin 1 (FBLN1), 272.52581 4.4264786 transcript variant A, mRNA. Homo sapiens very low density 5390661 NM_001018056.1 VLDLR lipoprotein receptor (VLDLR), 2252.8875 4.402696 transcript variant 2, mRNA. Homo sapiens ribonuclease, RNase A 5910382 NM_194430.1 RNASE4 family, 4 (RNASE4), transcript variant 3164.3146 4.3969961 1, mRNA. 5570270 NM_002103.3 GYSI Homo sapiens glycogen synthase 1 1268.0798 4.3817309 (muscle) (GYS 1), mRNA. Homo sapiens ribonuclease, RNase A 7040333 NM_194430.1 RNASE4 family, 4 (RNASE4), transcript variant 1817.95 4.3645786 1, mRNA. Homo sapiens pregnancy specific beta 1690095 NM_002782.3 PSG6 1-glycoprotein 6 (PSG6), transcript 300.24049 4.3402079 variant 1, mRNA. Homo sapiens hypoxia-inducible 7320441 NM_013332.3 HIG2 protein 2 (HIG2), transcript variant 1, 1486.2841 4.2995085 mRNA. Homo sapiens mannan-binding lectin 5960438 NM_139125.2 MASPI seine peptidase 1 (C4/C2 activating 366.4972 4.2656402 component of Ra-reactive factor) (MASP1), transcript variant 2, mRNA. 6480040 NM_153703.3 PODN Homo sapiens podocan (PODN), 1566.5006 4.1800672 IIRNA. 7200706 NM_032603.2 LOXL3 Homo sapiens lysyl oxidase-like 3 2965.5537 4.1798243 (LOXL3), mRNA. Homo sapiens jumonji, AT rich 5870739 NM_004653.3 JARIDID interactive domain ID (JARIDID), 279.27928 4.1552795 mRNA. Homo sapiens sarcoglycan, delta 2450327 NM_172244.2 SGCD (35kDa dystrophin-associated 489.09971 4.1056992 glycoprotein) (SGCD), transcript variant 2, mRNA. 4830685 NM_006486.2 FBLN1 Homo sapiens fibulin 1 (FBLN1), 21951.868 4.08685 transcript variant D, mRNA. Homo sapiens reversion-inducing 3390487 NM_021111.1 RECK cysteine-rich protein with kazal motifs 1666.883 4.0662577 (RECK), mRNA. Homo sapiens procollagen-proline, 2 7570379 NM_001017974.1 P4HA2 oxoglutarate 4-dioxygenase (proline 4- 2014.6226 4.0634659 hydroxylase), alpha polypeptide II (P4HA2), transcript variant 3, mRNA. Homo sapiens angiopoietin-like 4 4610433 NM_139314.1 ANGPTL4 (ANGPTL4), transcript variant 1, 7271.1268 3.9698796 mRNA. Homo sapiens serpin peptidase 770408 NM_000602.1 SERPINE1 inhibitor, eade E (nexin, plasminogen 18911.169 3.9544419 activator inhibitor type 1), member 1 (SERPINE1), mRNA. 223 WO 2011/150105 PCT/US2011/037969 Homo sapiens serpin peptidase inhibitor, clade G (C1 inhibitor), 2030309 NM_001032295.1 SERPINGI member 1, (angioedema, hereditary) 1788.1525 3.9480978 (SERPINGI), transcript variant 2, mRNA. 1940438 NM_002632.4 PGF Homo sapiens placental growth factor 491.52743 3.7443331 (PGF), mRNA. Homo sapiens proline/arginine-rich 7000446 NM_201348.1 PRELP end leucine-rich repeat protein 394.27832 3.6864374 (PRELP), transcript variant 2, mRNA. Homo sapiens protein tyrosine 3850603 NM_002846.2 PTPRN phosphatase, receptor type, N 512.19469 3.6437958 (PTPRN), mRNA. Homo sapiens collagen, type VI, alpha 2750356 NM_001849.3 COL6A2 2 (COL6A2), transcript variant 2C2, 9848.3735 3.6072976 mRNA. Homo sapiens complement component 1300327 NM_201442.1 CiS 1, s subcomponent (CIS), transcript 613.9146 3.5692154 variant 2, mRNA. Homo sapiens laminin, alpha 2 360181 NM_001079823.1 LAMA2 (merosin, congenital muscular 727.11091 3.5546745 dystrophy) (LAMA2), transcript variant 2, mRNA. 5570682 NM_024769.2 ASAM Homo sapiens adipocyte- specific 2225.8603 3.5522861 adhesion molecule (AS AMV), mRNA. Homo sapiens thrombospondin, type I, 1010327 NM_199296.1 THSD3 domain containing 3 (THSD3), 246.49292 3.5279505 transcript variant 1, mRNA. 780025 NM_001004019.1 FBLN2 Homo sapiens fibulin 2 (FBLN2), 203.88525 3.5099134 transcript variant 1, mRNA. 1710484 NM_002023.3 FMOD Homo sapiens fibromodulin (FMOD), 835.18702 3.4842555 IIRNA. Homo sapiens collagen, type VI, alpha 3390458 NM_001849.3 COL6A2 2 (COL6A2), transcript variant 2C2, 15335.1 3.4195586 mRNA. Homo sapiens laminin, alpha 2 1470296 NM_000426.3 LAMA2 (merosin, congenital muscular 651.99631 3.3730374 dystrophy) (LAMA2), transcript variant 1, mRNA. 4670441 NM_006329.2 FBLN5 Homo sapiens fibulin 5 (FBLN5), 6835.1305 3.3708742 mRNA. Homo sapiens sarcoglycan, delta 70088 NM_000337.4 SGCD (35kDa dystrophin-associated 245.74558 3.3454004 glycoprotein) (SGCD), transcript variant 1, mRNA. 5670465 NM_001124.1 ADM Homo sapiens adrenomedullin (ADM), 23961.696 3.2869527 IIRNA. 6940102 NM_002160.1 TNC Homo sapiens tenascin C 3326.0655 3.284936 (hexabrachion) (TNC), mRNA. 3940017 NM_002317.3 LOX Homo sapiens lysyl oxidase (LOX), 17451.02 3.2800486 mRNA. Homo sapiens mannan-binding lectin 580360 NM_001031849.1 MASPI seine peptidase 1 (C4/C2 activating 299.08879 3.2704256 component of Ra-reactive factor) (MASP1), transcript variant 3, mRNA. Homo sapiens collagen, type VII, 2490593 NM_000094.2 COL7A1 alpha 1 (epidermolysis bullosa, 12054.09 3.1962272 dystrophic, dominant and recessive) (COL7A1), mRNA. 224 WO 2011/150105 PCT/US2011/037969 Homo sapiens complement component 7400707 NM_001734.2 CiS 1, s subcomponent (CIS), transcript 3350.2642 3.1860651 variant 1, mRNA. 6480204 NM_006288.2 THY1 Homo sapiens Thy-i cell surface 7475.5754 3.138059 antigen (THY1), mRNA. Homo sapiens lymphotoxin beta 4640064 NM_002342.1 LTBR receptor (TNFR superfamily, member 1940.8714 3.1324801 3) (LTBR), mRNA. Homo sapiens wingless-type MMTV 50634 NM_003391.1 WNT2 integration site family member 2 776.7 3.1158954 (WNT2), mRNA. 3930020 NM_003793.2 CTSF Homo sapiens cathepsin F (CTSF), 508.50973 3.0593404 mRNA. 2940441 NM_002527.3 NTF3 Homo sapiens neurotrophin 3 (NTF3), 621.78805 3.0546892 1 mRNA. 1190142 NM_032048.2 EMILIN2 Homo sapiens elastin microfibril 952.9115 3.0373069 interfacer 2 (EMEIIN2), mRNA. Homo sapiens fibroblast growth factor 6450471 NM_023107.2 FGFR1 receptor 1 (fins-related tyrosine kinase 458.41401 3.0145507 2, Pfeiffer syndrome) (FGFR1), transcript variant 5, mRNA. Homo sapiens short stature homeobox 2000739 NM_006884.2 SHOX2 2 (SHOX2), transcript variant 287.47448 3.0025686 SHOX2a, mRNA. 5870136 NM_004669.2 CLIC3 Homo sapiens chloride intracellular 889.67529 2.9727361 channel 3 (CLJC3), mRNA. 1500725 NM_001765.2 CD1C Homo sapiens CD1c molecule 563.62168 2.9570954 (CD1C), mRNA. Homo sapiens limb bud and heart 2810246 NM_030915.1 LBH development homolog (mouse) (LBH), 3488.6454 2.9507807 mRNA. 6550762 NM_001998.2 FBLN2 Homo sapiens fibulin 2 (FBLN2), 5619.4093 2.9465823 transcript variant 2, mRNA. Homo sapiens elastin (supravalvular 6130577 NM_001081754.1 ELN aortic stenosis, Williams-Beuren 5759.3587 2.9404635 syndrome) (ELN), transcript variant 4, mRNA. Homo sapiens chromosome 5 open 1690240 NM_032385.3 C5orf4 reading frame 4 (C5orf4), transcript 616.93068 2.8854946 variant 2, mRNA. Homo sapiens RAP 1, GTP-GDP 5560139 NM_021159.3 RAP1GDS1 dissociation stimulator 1 827.61696 2.8644895 (RAP1GDS1), mRNA. Homo sapiens dickkopf homolog 3 5270408 NM_013253.4 DKK3 (Xenopus laevis) (DKK3), transcript 576.99749 2.8535391 variant 2, mRNA. 990458 NM_003062.1 SLIT3 Homo sapiens slit homolog A 764.89587 2.8404848 (Drosophila) (SLJT3), mRNA. Homo sapiens insulin-like growth 7380719 NM_002178.2 IGFBP6 factor binding protein 6 (IGFBP6), 10039.543 2.7925517 mRNA. 3780670 NM_018297.2 NGLY1 Homo sapiens N-glycanase 1 1139.1673 2.7890254 (NGLY1), mRNA. Homo sapiens procollagen-proline, 2 270408 NM_001017974.1 P4HA2 oxoglutarate 4-dioxygenase (proline 4- 10275.846 2.7772864 hydroxylase), alpha polypeptide II (P4HA2), transcript variant 3, mRNA. 225 WO 2011/150105 PCT/US2011/037969 7650296 NM_133505.2 DCN Homo sapiens decorin (DCN), 35201.542 2.7569822 transcript variant C, mRNA. Homo sapiens neuroblastoma, 5090156 NM_182744.1 NBL1 suppression of tumorigenicity 1 14526.596 2.7560544 (NBL1), transcript variant 1, mRNA. Homo sapiens natriuretic peptide 2810372 NM_003995.3 NPR2 receptor B/guanylate cyclase B 1231.4267 2.7497869 (atrionatriuretic peptide receptor B) (NPR2), mRNA. 1780673 NM_003864.3 SAP30 Homo sapiens Sin3A-associated 1581.6991 2.7019027 protein, 30kDa (SAP30), mRNA. 2650730 NM_003155.2 STC1 Homo sapiens stanniocalcin 1 (STC1), 4219.122 2.6850606 mRNA. 7570598 NM_001848.2 COL6A1 Homo sapiens collagen, type VI, alpha 17105.808 2.6791275 1 (COL6A1), mRNA. Homo sapiens neuroblastoma, 7100010 NM_005380.4 NBL1 suppression of tumorigenicity 1 7526.9794 2.6774062 (NBL1), transcript variant 2, mRNA. Homo sapiens follistatin-like 3 2360356 NM_005860.2 FSTL3 (secreted glycoprotein) (FSTL3), 4377.7947 2.663868 mRNA. 6040736 NM_032777.6 GPR124 Homo sapiens G protein-coupled 1736.6329 2.6344972 receptor 124 (GPR124), mRNA. Homo sapiens limb bud and heart 840369 NM_030915.1 LBH development homolog (mouse) (LBH), 457.39897 2.6339729 mRNA. Homo sapiens procollagen C 4810445 NM_013363.2 PCOLCE2 endopeptidase enhancer 2 1458.2134 2.6154317 (PCOLCE2), mRNA. 5080139 NM_002771.2 PRSS3 Homo sapiens protease, seine, 3 242.3708 2.6096885 (mesotrypsin) (PRSS3), mRNA. Homo sapiens glutamate receptor, 1030240 NM_021956.2 GRIK2 ionotropic, kainate 2 (GRIK2), 180.87906 2.590111 transcript variant 1, mRNA. Homo sapiens cartilage intermediate 6400427 NM_003613.2 CILP layer protein, nucleotide 940.33739 2.5889428 pyrophosphohydrolase (CILP), mRNA. 1230615 NM_021197.2 WFDC1 Homo sapiens WAP four-disulfide 293.60973 2.5859538 core domain 1 (WFDC1), mRNA. Homo sapiens wingless-type MMTV 1820343 NM_003392.3 WNT5A integration site family, member 5A 3607.7851 2.5767664 (WNT5A), mRNA. Homo sapiens angiopoietin-like 4 990092 NM_139314.1 ANGPTL4 (ANGPTL4), transcript variant 1, 315.39956 2.5506814 mRNA. Homo sapiens epidermal growth factor 1050671 NM_005228.3 EGFR receptor (erythroblastic leukemia viral 938.60177 2.5391808 (v-erb-b) oncogene homolog, avian) (EGFR), transcript variant 1, mRNA. 7400735 NM_002345.3 LUM Homo sapiens lumican (LUM), 1157.5674 2.5372756 1IIIRNA. 6480592 NM_198129.1 LAMA3 Homo sapiens laminin, alpha 3 247.4149 2.5363762 (LAMA3), transcript variant 1, mRNA. 1510181 NM_004878.3 PTGES Homo sapiens prostaglandin E 1577.5245 2.5234446 synthase (PTGES), mRNA. 1170170 NM_003714.2 STC2 Homo sapiens stanniocalcin 2 (STC2), 11189.599 2.5188425 mRNA. 7650497 NM_001972.2 ELA2 Homo sapiens elastase 2, neutrophil 169.80546 2.5164121 (ELA2), mRNA. 226 WO 2011/150105 PCT/US2011/037969 Homo sapiens inhibitor of growth 5090040 NM_198219.1 INGI family, member 1 (INGI), transcript 546.45782 2.5061253 variant 1, mRNA. Homo sapiens procollagen-lysine, 2 4640187 NM_000935.2 PLOD2 oxoglutarate 5-dioxygenase 2 3255.3316 2.5031863 (PLOD2), transcript variant 2, mRNA. 1510392 NM_002291.1 LAMBI Homo sapiens laminin, beta 1 1718.977 2.4968164 (LAMB 1), mRNA. Homo sapiens sema domain, immunoglobulin domain (Ig), 5080280 NM_198925.1 SEMA4B transmembrane domain (TM) and short 1391.7149 2.4936116 cytoplasmic domain, (semaphorin) 4B (SEMA4B), transcript variant 2, mRNA. Homo sapiens SLIT-ROBO Rho 2470220 NM_020762.1 SRGAP1 GTPase activating protein 1 819.16711 2.4914253 (SRGAP1), mRNA. Homo sapiens procollagen-proline, 2 4220731 NM_000917.2 P4HA1 oxoglutarate 4-dioxygenase (proline 4- 5447.5102 2.4781465 hydroxylase), alpha polypeptide I (P4HA1), transcript variant 1, mRNA. Homo sapiens proteinase 3 (serine 1770731 NM 002777.3 PRTN3 proteinase, neutrophil, Wegener 153.88341 2.4337024 -- 2Pgranulomatosis autoantigen) (PRTN3), mRNA. 4060703 NM_053044.2 HTRA3 Homo sapiens HtrA seine peptidase 3 193.90413 2.4308237 (HTRA3), mRNA. Homo sapiens lipase A, lysosomal 5360148 NM_000235.2 LIPA acid, cholesterol esterase (Wolman 2960.1136 2.427534 disease) (LIPA), mRNA. 1450678 NM_015540.2 RPAP1 Homo sapiens RNA polymerase II 475.00015 2.4231192 associated protein 1 (RPAP 1), mRNA. 60452 NM_015973.3 GAL Homo sapiens galanin prepropeptide 923.85103 2.4145611 (GAL), mRNA. Homo sapiens T-box 3 (ulnar 5560619 NM_016569.3 TBX3 mammary syndrome) (TBX3), 161.43245 2.4066549 transcript variant 2, mRNA. 1770730 NM_003971.3 SPAG9 Homo sapiens sperm associated 2027.6386 2.3953381 antigen 9 (SPAG9), mRNA. Homo sapiens CD44 molecule (Indian 4560193 NM_001001392.1 CD44 blood group) (CD44), transcript variant 3098.0882 2.3781137 5, mRNA. Homo sapiens chromosome 10 open 1110201 NM_001031746.2 ClOorf72 reading frame 72 (ClOorf72), 279.3885 2.3657239 transcript variant 1, mRNA. 3370632 NM_003999.1 OSMR Homo sapiens oncostatin M receptor 799.98525 2.3597131 (OSMR), mRNA. Homo sapiens angiopoietin-like 4 2450592 NM_001039667.1 ANGPTL4 (ANGPTL4), transcript variant 3, 340.0705 2.3571408 mRNA. Homo sapiens WNT1 inducible 2320564 NM_003882.2 WISPI signaling pathway protein 1 (WISPI), 562.88009 2.3489453 transcript variant 1, mRNA. Homo sapiens ADAMTS-like 1 5890326 NM_052866.3 ADAMTSL1 (ADAMTSL1), transcript variant 2, 327.68201 2.3171201 mRNA. 130164 NM_003971.3 SPAG9 Homo sapiens sperm associated 602.55678 2.3069303 1 antigen 9 (SPAG9), mRNA. 5890619 NM_004318.2 ASPH Homo sapiens aspartate beta- 389.79535 2.2855305 hydroxylase (ASPH), transcript variant 227 WO 2011/150105 PCT/US2011/037969 1, mRNA. Homo sapiens Rho GTPase activating 6760482 NM_001017526.1 ARHGAP8 protein 8 (ARHGAP8), transcript 136.64174 2.2525331 variant 1, mRNA. 1580709 NM_007361.3 NID2 Homo sapiens nidogen 2 336.48142 2.2472903 (osteonidogen) (NID2), mRNA. 70167 NM_015364.2 LY96 Homo sapiens lymphocyte antigen 96 636.82242 2.2373519 (LY96), mRNA. 7650189 NM_002292.3 LAMB2 Homo sapiens lamminin, beta 2 (laminin 2219.5117 2.2266886 S) (LAM12), mRNA. Homo sapiens elastin (supravalvular 1300156 NM_001081754.1 ELN aortic stenosis, Williams-Beuren 307.24336 2.2208143 syndrome) (ELN), transcript variant 4, mRNA. Homo sapiens protein tyrosine 5870553 NM_130440.1 PTPRF phosphatase, receptor type, F (PTPRF), 1715.1529 2.2201452 transcript variant 2, mRNA. 4290201 NM_006850.2 IL24 Homo sapiens interleukin 24 (IL24), 135.92596 2.2082049 transcript variant 1, mRNA. 2640195 NM_130830.2 LRRC15 Homo sapiens leucine rich repeat 643.69572 2.2079864 containing 15 (LRRC15), mRNA. Homo sapiens interleukin 11 receptor, 2570646 NM_004512.3 ILIRA alpha (ILIRA), transcript variant 1, 492.72021 2.1900931 mRNA. 4900133 NM_006307.3 SRPX Homo sapiens sushi-repeat-containing 11766.594 2.1866456 protein, X-linked (SRPX), mRNA. Homo sapiens bone morphogenetic 5570324 NM_006129.2 BMP1 protein 1 (BMP1), transcript variant 2467.8597 2.1830292 BMP1-3, mRNA. 3990561 NM_002347.2 LY6H Homo sapiens lymphocyte antigen 6 241.54145 2.1825084 complex, locus H (LY6H), mRNA. Homo sapiens prostaglandin 1820632 NM_000963.1 PTGS2 endoperoxide synthase 2 1635.568 2.155491 (prostaglandin G/H synthase and cyclooxygenase) (PTGS2), mRNA. 7380148 NM_182484.1 BAGE5 Homo sapiens B melanoma antigen 193.5413 2.1382672 family, memberS5 (BAGES), mRNA. 1351 .327 Homo sapiens RAP 1, GTP-GDP 730035 NM_021159.3 RAP1GDS1 dissociation stimulator 1 456.43282 2.1229103 (RAP1GDS1), mRNA. 4150132 NM_017514.2 PLXNA3 Homo sapiens plexin A3 (PLXNA3), 1525.5528 2.1183917 mRNA. Homo sapiens ADP-ribosylhydrolase 1990070 NM_138430.3 ADPRHL1 like 1 (ADPRHL1), transcript variant 119.42006 2.113932 1, mRNA. Homo sapiens chemokine (C-X-C 4610615 NM_000609.4 CXCL12 mtif) ligan 2 strotanseltderi 5780.0239 2.1124224 factor 1) (CXCL12), transcript variant 2, mRNA. 2570240 NM_015170.1 SULF1 Homo sapiens sulfatase 1 (SULFI), 5739.405 2.1123202 IIRNA. Homo sapiens protease, seine, 12 2480692 NM_003619.2 PRSS12 (neurotrypsin, motopsin) (PRSS12), 343.88466 2.0931627 mRNA. 2100228 NM_001937.3 DPT Homo sapiens dermatopontin (DPT), 3226.2173 2.090314 mRNA. Homo sapiens SEC24 related gene 4880463 NM_021982.1 SEC24A family, member A (S. cerevisiae) 451.85885 2.0819561 (SEC24A), mRNA. 228 WO 2011/150105 PCT/US2011/037969 Homo sapiens sema domain, immunoglobulin domain (Ig), short 4220433 NM_001005914.1 SEMA3B basic domain, secreted, (semaphorin) 213.4615 2.0771057 3B (SEMA3B), transcript variant 2, mRNA. 4230292 NM_133493.2 CD109 Homo sapiens CD109 molecule 384.36667 2.0749106 (CD1O9), mRNA. Homo sapiens phosphofructokinase, 5570242 NM_002626.4 PFKL liver (PFKL), transcript variant 2, 2081.8504 2.0461755 mRNA. PREDICTED: Homo sapiens inositol 510739 XM_001133189.1 INPP5A polyphosphate-5-phosphatase, 40kDa 1574.0158 2.0379823 (INPP5A), mRNA. Homo sapiens procollagen-lysine, 2 160630 NM_001084.4 PLOD3 oxoglutarate 5-dioxygenase 3 6849.601 2.0323571 (PLOD3), mRNA. 4570181 NM_000820.1 GAS6 Homo sapiens growth arrest-specific 6 751.60125 2.0294128 1 (GAS6), mRNA. 2810673 NM_152739.3 HOXA9 Homo sapiens homeobox A9 286.5542 2.0250765 (HOXA9), mRNA. 5360743 NM_001856.3 COL16A1 Homo sapiens collagen, type XVI, 2569.4426 2.016659 alpha 1 (COL16A1), mRNA. Homo sapiens guanine nucleotide 5890025 NM_018841.4 GNG12 binding protein (G protein), gamma 12 1816.9028 2.0007556 (GNG12), mRNA. Xgene FB P9 D1 Chondro MM ProbelD RefSeqjID Symbol Definition RFU Fold over -- Ave 5340358 NM_000504.3 FlO Homo sapiens coagulation factor X 1215.1339 11.605935 (FlO), mRNA. Homo sapiens protein tyrosine 3850603 NM_002846.2 PTPRN phosphatase, receptor type, N 1371.5616 9.7574035 (PTPRN), mRNA. Homo sapiens serpin peptidase 3290630 NM_000624.3 SERPINA5 inhibitor, clade A (alpha-i 1645.4088 9.4129631 antiproteinase, antitrypsin), member 5 (SERPINA5), mRNA. 1230615 NM_021197.2 WFDC1 Homo sapiens WAP four-disulfide 1028.3012 9.0567138 core domain 1 (WFDC1), mRNA. Homo sapiens N-acetylated alpha 4120626 NM_005468.2 NAALADL1 linked acidic dipeptidase-like 1 791.62581 8.6366336 (NAALADL1), mRNA. 2710735 NM_016084.3 RASD1 Homo sapiens RAS, dexamethasone- 2336.9326 8.1505424 induced 1 (RASD1), mRNA. Homo sapiens sarcoglycan, delta 2450327 NM_172244.2 SGCD (35kDa dystrophin-associated 961.31637 8.0696754 glycoprotein) (SGCD), transcript variant 2, mRNA. 7150634 NM_001647.2 APOD Homo sapiens apolipoprotein D 6008.4678 7.6254014 (APOD), inRNA. Homo sapiens elastin (supravalvular 6130577 NM_001081754.1 ELN aortic stenosis, Williams-Beuren 14604.974 7.4566276 syndrome) (ELN), transcript variant 4, mRNA. 5550719 NM_133503.2 DCN Homo sapiens decorin (DCN), 9253.463 7.2718427 transcript variant A2, mRNA. 2100228 NM_001937.3 DPT Homo sapiens dermatopontin (DPT), 10828.476 7.0159302 9RNA. 229 WO 2011/150105 PCT/US2011/037969 6040494 NM_006487.2 FBLN1 Homo sapiens fibulin 1 (FBLN1), 8371.1493 6.445292 transcript variant A, mRNA. Homo sapiens reversion-inducing 3390487 NM_021111.1 RECK cysteine-rich protein with kazal motifs 2557.0417 6.2377446 (RECK), mRNA. 580739 NM_001996.2 FBLN1 Homo sapiens fibulin 1 (FBLN1), 14371.405 6.1990309 transcript variant C, mRNA. 4760095 NM_004750.2 CRLF1 Homo sapiens cytokine receptor-like 3453.4966 6.0774487 factor 1 (CRLF1), mRNA. Homo sapiens complement component 7400707 NM_001734.2 CiS 1, s subcomponent (CIS), transcript 5995.9971 5.7021286 variant 1, mRNA. 7650497 NM_001972.2 ELA2 Homo sapiens elastase 2, neutrophil 380.62389 5.6406112 (ELA2), mRNA. Homo sapiens inhibin, beta B (activin 50446 NM_002193.1 INHBB AB beta polypeptide) (INHBB), 1885.855 5.516662 mRNA. 6480040 NM_153703.3 PODN Homo sapiens podocan (PODN), 2032.9091 5.4246368 mRNA. 4880609 NM_012242.2 DKK1 Homo sapiens dickkopf homolog 1 345.3941 5.348487 (Xenopus laevis) (DKK1), mRNA. 3930020 NM_003793.2 CTSF Homo sapiens cathepsin F (CTSF), 871.13717 5.2410111 IIRNA. Homo sapiens serpin peptidase inhibitor, clade G (C1 inhibitor), 2030309 NM_001032295.1 SERPINGI member 1, (angioedema, hereditary) 2362.8305 5.2169409 (SERPINGI), transcript variant 2, mRNA. 5870136 NM_004669.2 CLIC3 Homo sapiens chloride intracellular 1553.906 5.1921781 channel 3 (CLJC3), mRNA. Homo sapiens alanyl (membrane) aminopeptidase (aminopeptidase N, 5810612 NM_001150.1 ANPEP aminopeptidase M, microsomal 4047.7358 4.835945 aminopeptidase, CD13, p150) (ANPEP), mRNA. 70167 NM_015364.2 LY96 Homo sapiens lymphocyte antigen 96 1357.131 4.7680161 (LY96), mRNA. Homo sapiens interleukin 11 receptor, 2570646 NM_004512.3 ILIRA alpha (ILIRA), transcript variant 1, 1051.5746 4.6741462 mRNA. Homo sapiens cartilage intermediate 6400427 NM_003613.2 CILP layer protein, nucleotide 1689.1541 4.6505898 pyrophosphohydrolase (CILP), mRNA. Homo sapiens matrix metallopeptidase 7400400 NM_002422.3 MMP3 3 (stromelysin 1, progelatinase) 991.12168 4.643847 (MMP3), mRNA. Homo sapiens vitamin K epoxide 6450546 NM_024006.4 VKORC1 reductase complex, subunit 1 6165.504 4.6329486 (VKORC1), transcript variant 1, mRNA. 1850372 NM_000915.2 OXT Homo sapiens oxytocin, prepro- 309.83075 4.4349333 (neurophysin I) (OXT), mRNA. Homo sapiens family with sequence 1940274 NM_032036.2 FAM14A similarity 14, member A (FAM14A), 3438.749 4.431463 mRNA. Homo sapiens WNT1 inducible 2320564 NM_003882.2 WISPI signaling pathway protein 1 (WISPI), 1017.3243 4.2453788 transcript variant 1, mRNA. 230 WO 2011/150105 PCT/US2011/037969 Homo sapiens laminin, alpha 2 1470296 NM_000426.3 LAMA2 (merosin, congenital muscular 808.89646 4.1847445 dystrophy) (LAMA2), transcript variant 1, mRNA. 7400735 NM_002345.3 LUM Homo sapiens lumican (LUM), 1906.8108 4.1795445 mRNA. 6220019 NM_006211.2 PENK Homo sapiens proenkephalin (PENK), 4185.8173 4.0991149 IIRNA. 5050131 NM_006485.3 FBLN1 Homo sapiens fibulin 1 (FBLN1), 277.64676 4.0696629 transcript variant B, mRNA. Homo sapiens proline/arginine-rich 7000446 NM_201348.1 PRELP end leucine-rich repeat protein 425.42788 3.9776807 (PRELP), transcript variant 2, mRNA. Homo sapiens sarcoglycan, delta 70088 NM_000337.4 SGCD (35kDa dystrophin-associated 291.0851 3.9626196 glycoprotein) (SGCD), transcript variant 1, mRNA. Homo sapiens ADAM 3400600 NM_014244.2 ADAMTS2 metallopeptidase with thrombospondin 428.21165 3.9387072 type 1 motif, 2 (ADAMTS2), transcript variant 1, mRNA. 240274 NM_000877.2 ILIRI Homo sapiens interleukin 1 receptor, 681.59705 3.9362472 type I (RLIRI), mRNA. 6480204 NM_006288.2 THYl Homo sapiens Thy-1 cell surface 9367.4991 3.9322412 antigen (THYl), mRNA. 990458 NM_003062.1 SLIT3 Homo sapiens slit homolog A 1044.6251 3.8792753 (Drosophila) (SLJT3), mRNA. Homo sapiens FXYD domain 3850500 NM_005031.3 FXYD1 containing ion transport regulator 1 363.4528 3.8675832 (phospholemman) (FXYD1), transcript variant a, mRNA. Homo sapiens collagen, type VI, alpha 2470114 NM_004369.2 COL6A3 3 (COL6A3), transcript variant 1, 12576.657 3.7251139 mRNA. Homo sapiens wingless-type MMTV 50634 NM_003391.1 WNT2 integration site family member 2 928.33968 3.7242298 (WNT2), mRNA. 5260474 NM_001733.4 CIR Homo sapiens complement component 3046.295 3.6649011 1, r subcomponent (CIR), mRNA. Homo sapiens FXYD domain 5860022 NM_021902.2 FXYD1 containing ion transport regulator 1 334.63348 3.645605 (phospholemman) (FXYD1), transcript variant b, mRNA. 7330292 NM_001998.2 FBLN2 Homo sapiens fibulin 2 (FBLN2), 7406.5817 3.6402405 transcript variant 2, mRNA. Homo sapiens jumonji, AT rich 5870739 NM_004653.3 JARIDID interactive domain ID (JARIDID), 236.21888 3.5146019 mRNA. Homo sapiens elastin (supravalvular 1300156 NM_001081754.1 ELN aortic stenosis, Williams-Beuren 483.50796 3.4948888 syndrome) (ELN), transcript variant 4, mRNA. Homo sapiens transforming growth 3190379 NM_003243.2 TGFBR3 factor, beta receptor III (TGFBR3), 1727.773 3.4876865 mRNA. 1500725 NM_001765.2 CD1C Homo sapiens CD1c molecule 660.67847 3.4663132 1(CDC), mRNA. 231 WO 2011/150105 PCT/US2011/037969 Homo sapiens proopiomelanocortin (adrenocorticotropin/ beta-lipotropin/ 5080072 NM_001035256.1 POMC alpha-melanocyte stimulating 235.27529 3.4620236 hormone/ beta-melanocyte stimulating hormone/ beta-endorphin) (POMC), transcript variant 1, mRNA. Homo sapiens ADAM 7150609 NM_021599.1 ADAMTS2 tallopeptidase wi MStnip 325.93252 3.3953017 type 1 motif, 2 (ADAVTS2), transcript variant 2, mRNA. Homo sapiens extracellular matrix 6840192 NM_001393.2 ECM2 protein 2, female organ and adipocyte 964.50811 3.3641719 specific (ECM2), mRNA. Homo sapiens interleukin 11 receptor, 2760148 NM_004512.3 ILIRA alpha (ILIRA), transcript variant 1, 4741.4609 3.3164438 mRNA. 4230750 NM_023067.2 FOXL2 Homo sapiens forkhead box L2 269.37596 3.2315484 (FOXL2), inRNA. Homo sapiens ribonuclease, RNase A 7040333 NM_194430.1 RNASE4 family, 4 (RNASE4), transcript variant 1324.5671 3.180053 1, mRNA. Homo sapiens collagen, type VI, alpha 6250192 NM_057165.2 COL6A3 3 (COL6A3), transcript variant 3, 17220.099 3.1499063 mRNA. Homo sapiens neuroblastoma, 7100010 NM_005380.4 NBL1 suppression of tumorigenicity 1 8679.3746 3.0873224 (NBL1), transcript variant 2, mRNA. 360025 NM_198186.2 ASTN2 Homo sapiens astrotactin 2 (ASTN2), 465.46497 3.0619611 transcript variant 2, mRNA. 6040736 NM_032777.6 GPR124 Homo sapiens G protein-coupled 1996.5041 3.0287257 receptor 124 (GPR124), mRNA. 3830465 NM_001645.3 APOCI Homo sapiens apolipoprotein C-I 622.45059 3.0250503 (APOCI), inRNA. 4670441 NM_006329.2 FBLN5 Homo sapiens fibulin 5 (FBLN5), 6084.4535 3.0006636 mRNA. Homo sapiens mannan-binding lectin 4050326 NM_139125.2 MASPI seine peptidase 1 (C4/C2 activating 351.56224 2.9766809 component of Ra-reactive factor) (MASP1), transcript variant 2, mRNA. Homo sapiens ADAM 6900086 NM_006988.3 ADAMTS1 metallopeptidase with thrombospondin 1739.6913 2.9516325 type 1 motif, 1 (ADAMTS 1), mRNA. Homo sapiens 2680202 NM_003549.2 HYAL3 hyaluronoglucosaminidase 3 690.86431 2.9174865 (HYAL3), mRNA. Homo sapiens T-box 3 (ulnar 7200195 NM_005996.3 TBX3 mammary syndrome) (TBX3), 645.03422 2.8853749 transcript variant 1, mRNA. 2940441 NM_002527.3 NTF3 Homo sapiens neurotrophin 3 (NTF3), 587.10413 2.8842957 mRNA. 510246 NM_006475.1 POSTN Homo sapiens periostin, osteoblast 2193.146 2.8460279 specific factor (POSTN), mRNA. 4830685 NM_006486.2 FBLN1 Homo sapiens fibulin 1 (FBLN1), 15246.368 2.8384655 transcript variant D, mRNA. Homo sapiens pregnancy specific beta 5960392 NM_001031850.2 PSG6 1-glycoprotein 6 (PSG6), transcript 217.38068 2.8221462 variant 2, mRNA. 1710484 NM_002023.3 FMOD Homo sapiens fibromodulin (FMOD), 665.80354 2.777617 mRNA. 232 WO 2011/150105 PCT/US2011/037969 Homo sapiens laminin, alpha 2 360181 NM_001079823.1 LAMA2 (merosin, congenital muscular 565.80295 2.7660778 dystrophy) (LAMA2), transcript variant 2, mRNA. 3990561 NM_002347.2 LY6H Homo sapiens lymphocyte antigen 6 306.12434 2.7660633 complex, locus H (LY6H), mRNA. Homo sapiens angiogenin, 3930392 NM_001097577.1 ANG ribonuclease, RNase A family, 5 2514.9283 2.7257792 (ANG), transcript variant 2, mRNA. Homo sapiens prostaglandin endoperoxide synthase 1 1070450 NM_080591.1 PTGS1 (prostaglandin G/H synthase and 2635.163 2.7011012 cyclooxygenase) (PTGS 1), transcript variant 2, mRNA. Homo sapiens lymphotoxin beta 4640064 NM_002342.1 LTBR receptor (TNFR superfamily, member 1663.174 2.684289 3) (LTBR), mRNA. 6550762 NM_001998.2 FBLN2 Homo sapiens fibulin 2 (FBLN2), 5113.3521 2.6812272 transcript variant 2, mRNA. 1500113 NM_001048.3 SST Homo sapiens somatostatin (SST), 134.38643 2.6437196 mRNA. _____ Homo sapiens dolichyl-phosphate 2850520 NM_018973.3 DPM3 mannosyltransferase polypeptide 3 2385.932 2.5920572 (DPM3), transcript variant 1, mRNA. 580475 NM_058164.1 OLFM2 Homo sapiens olfactomedin 2 246.82271 2.5803176 (OLFM2), inRNA. Homo sapiens dolichyl-phosphate 7320435 NM_153741.1 DPM3 mannosyltransferase polypeptide 3 3015.2937 2.5795988 (DPM3), transcript variant 2, mRNA. Homo sapiens short stature homeobox 2000739 NM_006884.2 SHOX2 2 (SHOX2), transcript variant 245.74558 2.566725 SHOX2a, mRNA. Homo sapiens ADP-ribosylhydrolase 3390735 NM_199162.1 ADPRHL1 like 1 (ADPRHL1), transcript variant 241.80206 2.5611025 2, mRNA. 6980541 NM_003255.4 TIMP2 Homo sapiens TIMP metallopeptidase 1344.8529 2.5158798 inhibitor 2 (TJIP2), mRNA. 1940438 NM_002632.4 PGF Homo sapiens placental growth factor 329.85693 2.5127676 (PGF), inRNA. 1430278 NM_000396.2 CTSK Homo sapiens cathepsin K (CTSK), 2145.8987 2.4539209 mRNA. Homo sapiens insulin-like growth 3310400 NM_000618.2 IGF1 factor 1 (somatomedin C) (JGF1), 203.01726 2.4399726 mRNA. Homo sapiens sarcoglycan, delta 4490563 NM_172244.2 SGCD (35kDa dystrophin-associated 175.46291 2.4388637 glycoprotein) (SGCD), transcript variant 2, mRNA. Homo sapiens thrombospondin, type I, 2370056 NM_199296.1 THSD3 domain containing 3 (THSD3), 156.92257 2.4245336 transcript variant 1, mRNA. Homo sapiens protease, seine, 12 2480692 NM_003619.2 PRSS12 (neurotrypsin, motopsin) (PRSS12), 394.40295 2.4006582 mRNA. Homo sapiens WNT1 inducible 870431 NM_080838.1 WISPI signaling pathway protein 1 (WISPI), 179.15192 2.3956341 transcript variant 2, mRNA. Homo sapiens ribonuclease, RNase A 6590041 NM_194431.1 RNASE4 family, 4 (RNASE4), transcript variant 3883.068 2.374658 3, mRNA. 233 WO 2011/150105 PCT/US2011/037969 Homo sapiens proteinase 3 (serine 1770731 NM_002777.3 PRTN3 proteinase, neutrophil, Wegener 150.13909 2.374485 granulomatosis autoantigen) (PRTN3), mRNA. 2630437 NM_022138.1 SMOC2 Homo sapiens SPARC related modular 238.55324 2.3737502 calcium binding 2 (SMOC2), mRNA. Homo sapiens fibroblast growth factor 6420746 NM_002010.1 FGF9 9 (glia-activating factor) (FGF9), 141.3233 2.3705785 mRNA. Homo sapiens collagen, type VI, alpha 2750356 NM_001849.3 COL6A2 2 (COL6A2), transcript variant 2C2, 6418.5507 2.3510098 mRNA. 5360743 NM_001856.3 COL16A1 Homo sapiens collagen, type XVI, 2992.7693 2.3489123 alpha 1 (COL16A1), mRNA. Homo sapiens deleted in lymphocytic 5490053 NR_002605.1 DLEU1 leukemia, 1 (DLEU1) on chromosome 959.1118 2.3462378 13. Homo sapiens chemokine (C-X-C 4610615 NM_000609.4 CXCL12 motif) ligand 12 (stromal cell-derived 6406.0473 2.3412149 factor 1) (CXCL12), transcript variant 2, mRNA. Homo sapiens peptidylprolyl 7000114 NM_000943.4 PPIC isomerase C (cyclophilin C) (PPIC), 4001.037 2.3301415 mRNA. 5080139 NM_002771.2 PRSS3 Homo sapiens protease, serine, 3 216.25398 2.3284799 (mesotrypsin) (PRSS3), mRNA. 4200543 NM_015696.3 GPX7 Homo sapiens glutathione peroxidase 7 4477.0171 2.3035524 (GPX7), mRNA. 6940102 NM_002160.1 TNC Homo sapiens tenascin C 2329.9013 2.3010902 (hexabrachion) (TNC), mRNA. 7650189 NM_002292.3 LAMB2 Homo sapiens lamminin, beta 2 (laminin 2290.5117 2.2979182 S) (LAM132), mRNA. Homo sapiens mucin 1, cell surface 7650026 NM_001044391.1 MUCI associated (MUCI), transcript variant 1682.6323 2.2933045 6, mRNA. Homo sapiens matrix metallopeptidase 7150551 NM_001032360.1 MMP19 19 (MMP19), transcript variant 2, 225.59646 2.2819046 mRNA. Homo sapiens chromosome Y open 7150066 NR_001544.1 CYorfl4 reading frame 14 (CYorfl4) on 165.33437 2.2804907 chromosome Y. Homo sapiens matrix metallopeptidase 730372 NM_002429.4 MMP19 19 (MMP19), transcript variant 1, 204.1205 2.2753403 mRNA. Homo sapiens myosin light chain 1300286 NM_053026.3 MYLK kinase (MYLK), transcript variant 2, 509.3264 2.2727309 mRNA. 430088 NM_006487.2 FBLN1 Homo sapiens fibulin 1 (FBLN1), 139.82109 2.2710328 transcript variant A, mRNA. 6420050 NM_002523.1 NPTX2 Homo sapiens neuronal pentraxin II 409.27736 2.2708308 (NPTX2), mRNA. Homo sapiens matrix metallopeptidase 510736 NM_004530.2 MMP2 2 (gelatinase A, 72kDa gelatinase, 978.4649 2.2694158 72kDa type IV collagenase) (MMP2), mRNA. Homo sapiens wingless-type MMTV 4850370 NM_032642.2 WNT5B integration site family, member 5B 1726.8608 2.260199 (WNT5B), transcript variant 1, mRNA. 234 WO 2011/150105 PCT/US2011/037969 Homo sapiens sema domain, immunoglobulin domain (Ig), short 4220433 NM_001005914.1 SEMA3B basic domain, secreted, (semaphorin) 231.42271 2.2518788 3B (SEMA3B), transcript variant 2, mRNA. 5570270 NM_002103.3 GYSI Homo sapiens glycogen synthase 1 651.53437 2.251316 (muscle) (GYS 1), mRNA. Homo sapiens Clq and tumor necrosis 7320204 NM_015645.2 C1QTNF5 factor related protein 5 (C1QTNF5), 961.31637 2.2470889 mRNA. Homo sapiens collagen, type VI, alpha 3390458 NM_001849.3 COL6A2 2 (COL6A2), transcript variant 2C2, 10072.375 2.2460288 mRNA. 2370041 NM_018334.3 LRRN3 Homo sapiens leucine rich repeat 180.74086 2.2323147 neuronal 3 (LRRN3), mRNA. Homo sapiens hypoxia-inducible 7320441 NM_013332.3 HIG2 protein 2 (HIG2), transcript variant 1, 771.30052 2.2312109 mRNA. Homo sapiens mannan-binding lectin 580360 NM_001031849.1 MASPI seine peptidase 1 (C4/C2 activating 204.02168 2.2309018 component of Ra-reactive factor) (MASP1), transcript variant 3, mRNA. Homo sapiens complement component 1300327 NM_201442.1 CiS 1, s subcomponent (CIS), transcript 382.99248 2.2266658 variant 2, mRNA. 7650296 NM_133505.2 DCN Homo sapiens decorin (DCN), 28218.8 2.2100944 transcript variant C, mRNA. Homo sapiens prostaglandin 12 7150762 NM_000961.3 PTGIS (prostacyclin) synthase (PTGIS), 1961.1237 2.2050039 mRNA. Homo sapiens collagen, type VII, 2490593 NM_000094.2 COL7A1 alpha 1 (epidermolysis bullosa, 8305.0555 2.2021442 dystrophic, dominant and recessive) (COL7A1), mRNA. 1430487 NM_000900.2 MGP Homo sapiens matrix Gla protein 7924.8209 2.1878872 (MGP), mRNA. Homo sapiens blocked early in 3130672 NM_016526.3 BETIL transport 1 homolog (S. cerevisiae)- 497.86254 2.186778 like (BETIL), mRNA. Homo sapiens bone morphogenetic 5570324 NM_006129.2 BMP1 protein 1 (BMP1), transcript variant 2471.569 2.1863104 BMP1-3, mRNA. Homo sapiens mitochondrial ribosomal 6940521 NM_032112.2 MRPL43 protein L43 (MRPL43), nuclear gene 1170.4839 2.1851996 encoding mitochondrial protein, transcript variant 1, mRNA. Homo sapiens inhibitor of DNA 7570324 NM_002167.2 ID3 binding 3, dominant negative helix- 5268.8103 2.1798388 loop-helix protein (ID3), mRNA. 7320494 NM_153813.2 ZFPM1 Homo sapiens zinc finger protein, 1410.2732 2.1794268 multitype 1 (ZFPM1), mRNA. Homo sapiens limb bud and heart 2810246 NM_030915.1 LBH development homolog (mouse) (LBH), 2563.1639 2.167986 mRNA. Homo sapiens deleted in lymphocytic 1260612 NR_002605.1 DLEU1 leukemia, 1 (DLEU1) on chromosome 216.00465 2.1615843 13. 235 WO 2011/150105 PCT/US2011/037969 Homo sapiens mannan-binding lectin 5960438 NM_139125.2 MASPI serine peptidase 1 (C4/C2 activating 185.69484 2.1612917 component of Ra-reactive factor) (MASP1), transcript variant 2, mRNA. Homo sapiens collagen, type IX, alpha 5270279 NM_078485.2 COL9A1 1 (COL9A1), transcript variant 2, 144.72743 2.1538595 mRNA. Homo sapiens sema domain, immunoglobulin domain (Ig), short 430181 NM_001005914.1 SEMA3B basic domain, secreted, (semaphorin) 277.37294 2.142699 3B (SEMA3B), transcript variant 2, mRNA. 1780673 NM_003864.3 SAP30 Homo sapiens Sin3A-associated 1252.7802 2.1400343 protein, 30kDa (SAP30), mRNA. Homo sapiens insulin-like growth 7380719 NM_002178.2 IGFBP6 factor binding protein 6 (IGFBP6), 7675.1468 2.1348824 mRNA. 6550392 NM_004123.2 GIP Homo sapiens gastric inhibitory 144.29602 2.1278243 polypeptide (GIP), mRNA. Homo sapiens SLIT-ROBO Rho 2470220 NM_020762.1 SRGAP1 GTPase activating protein 1 696.98068 2.1198059 (SRGAP1), mRNA. 5550369 NM_001125.2 ADPRH Homo sapiens ADP-ribosylarginine 171.11844 2.1176264 hydrolase (ADPRH), mRNA. 6760673 NM_006455.2 SC65 Homo sapiens synaptonemal complex 4542.0963 2.1118921 protein SC65 (SC65), mRNA. Homo sapiens Clq and tumor necrosis 1510092 NM_182486.1 C1QTNF6 factor related protein 6 (C1QTNF6), 192.72389 2.0938316 transcript variant 2, mRNA. 6760647 NM_025076.3 UXS1 Homo sapiens UDP-glucuronate 183.02692 2.0917044 decarboxylase 1 (UXS 1), mRNA. 60681 NM_021939.2 FKBP1O Homo sapiens FK06 binding protein 1369.8597 2.0900764 10, 65 kDa (FKBP1O), mRNA. Homo sapiens asparagine-linked 6370113 NM_013338.3 ALG5 glycosylation c homolog (S. 1964.749 2.0714044 cerevisiae, dolichyl-phosphate beta glucosyltransferase) (ALG5), mRNA. Homo sapiens single-strand-selective 1050386 NM_014311.1 SMUGI monofunctional uracil-DNA 1713.1847 2.0670396 glycosylase 1 (SMUGI), mRNA. Homo sapiens cytochrome P450, 6200068 NM_000786.2 CYP51A1 family 51, subfamily A, polypeptide 1 436.71976 2.0626719 (CYP51A1), mRNA. 130338 NM_000331.3 SAA1 Homo sapiens serum amyloid Al 149.56313 2.0584364 (SAA1), transcript variant 1, mRNA. 1170524 NM_032319.1 C2orf7 Homo sapiens chromosome 2 open 765.19145 2.0534928 reading frame 7 (C2orf7), mRNA. 840309 NM_000230.1 LEP Homo sapiens leptin (obesity homolog, 376.25472 2.0492156 mouse) (LEP), mRNA. Homo sapiens mucin 1, cell surface 7200601 NM_001044390.1 MUCI associated (MUCI), transcript variant 664.52301 2.0467905 5, mRNA. Homo sapiens sema domain, 1580608 NM_012431.1 SEMA3E immunoglobulin domain (Ig), short 1555.5459 2.0442434 basic domain, secreted, (semaphorin) 3E (SEMA3E), mRNA. Homo sapiens natriuretic peptide 2810372 NM_003995.3 NPR2 receptor B/guanylate cyclase B 914.14469 2.0412933 (atrionatriuretic peptide receptor B) (NPR2), mRNA. 236 WO 2011/150105 PCT/US2011/037969 Homo sapiens myosin light chain 7160343 NM_053032.2 MYLK kinase (MYLK), transcript variant 8, 2324.6993 2.0383129 mRNA. Homo sapiens proopiomelanocortin (adrenocorticotropin/ beta-lipotropin/ 5260291 NM_001035256.1 POMC alpha-melanocyte stimulating 121.43997 2.0297385 hormone/ beta-melanocyte stimulating hormone/ beta-endorphin) (POMC), transcript variant 1, mRNA. Homo sapiens wingless-type MMTV 1820343 NM_003392.3 WNT5A integration site family, member 5A 2837.3991 2.0265383 (WNT5A), mRNA. 4890270 NM_002346.1 LY6E Homo sapiens lymphocyte antigen 6 4529.2319 2.0168213 complex, locus E (LYE), mRNA. Homo sapiens low density lipoprotein 2710286 NM_002332.2 LRP1 related protein 1 (alpha-2- 490.0646 2.0114555 macroglobulin receptor) (LRP 1), mRNA. 3370162 NM_006108.2 SPONI Homo sapiens spondin 1, extracellular 278.78746 2.000854 matrix protein (SPONI), mRNA. Xgene FB P9 D2 Chondro MM ProbelD RefSeq_ID Symbol Definition RFU Fold over 1230615 NM_021197.2 WFDC1 Homo sapiens WAP four-disulfide 1308.6939 11.526259 core domain 1 (WFDC1), mRNA. 2100228 NM_001937.3 DPT Homo sapiens dermatopontin (DPT), 17333.96 11.23093 mRNA. 5340358 NM_000504.3 F1O Homo sapiens coagulation factor X 860.72655 8.2209344 (FlO), mRNA. Homo sapiens N-acetylated alpha 4120626 NM_005468.2 NAALADL1 linked acidic dipeptidase-like 1 725.7486 7.9179136 (NAALADL1), mRNA. Homo sapiens sarcoglycan, delta 2450327 NM_172244.2 SGCD (35kDa dystrophin-associated 907.13215 7.6148314 glycoprotein) (SGCD), transcript variant 2, mRNA. 5550719 NM_133503.2 DCN Homo sapiens decorin (DCN), 8779.2857 6.89921 transcript variant A2, mRNA. 6480040 NM_153703.3 PODN Homo sapiens podocan (PODN), 2544.8822 6.7907912 1 mRNA. 7150634 NM_001647.2 APOD Homo sapiens apolipoprotein D 5096.5381 6.468063 (APOD), mnRNA. 5870136 NM_004669.2 CLIC3 Homo sapiens chloride intracellular 1912.8499 6.3915429 channel 3 (CLJC3), mRNA. 6040494 NM_006487.2 FBLN1 Homo sapiens fibulin 1 (FBLN1), 8130.96 6.2603605 transcript variant A, mRNA. Homo sapiens serpin peptidase 3290630 NM_000624.3 SERPINA5 inhibitor, clade A (alpha-i 1090.9681 6.2411496 antiproteinase, antitrypsin), member 5 (SERPINA5), mRNA. Homo sapiens elastin (supravalvular 6130577 NM_001081754.1 ELN aortic stenosis, Williams-Beuren 12054.09 6.1542633 syndrome) (ELN), transcript variant 4, mRNA. Homo sapiens reversion-inducing 3390487 NM_021111.1 RECK cysteine-rich protein with kazal motifs 2493.3482 6.0823682 (RECK), mRNA. 237 WO 2011/150105 PCT/US2011/037969 2710735 NM_016084.3 RASD1 Homo sapiens RAS, dexamethasone- 1731.7909 6.0399837 induced 1 (RASD1), mRNA. Homo sapiens protein tyrosine 3850603 NM_002846.2 PTPRN phosphatase, receptor type, N 832.11431 5.9197306 (PTPRN), mRNA. 580739 NM_001996.2 FBLN1 Homo sapiens fibulin 1 (FBLN1), 13663.985 5.8938889 transcript variant C, mRNA. 4880609 NM_012242.2 DKK1 Homo sapiens dickkopf homolog 1 369.19233 5.7170067 (Xenopus laevis) (DKK1), mRNA. 4760095 NM_004750.2 CRLF1 Homo sapiens cytokine receptor-like 3112.9574 5.4781692 factor 1 (CRLF1), mRNA. 2940441 NM_002527.3 NTF3 Homo sapiens neurotrophin 3 (NTF3), 1043.9115 5.1284761 mRNA. Homo sapiens complement component 7400707 NM_001734.2 CiS 1, s subcomponent (CIS), transcript 5260.306 5.0024944 variant 1, mRNA. Homo sapiens vitamin K epoxide 6450546 NM_024006.4 VKORC1 reductase complex, subunit 1 6295.2746 4.7304623 (VKORC1), transcript variant 1, mRNA. Homo sapiens inhibin, beta B (activin 50446 NM_002193.1 INHBB AB beta polypeptide) (INHBB), 1582.5139 4.6293029 mRNA. Homo sapiens serpin peptidase inhibitor, clade G (C1 inhibitor), 2030309 NM_001032295.1 SERPINGI member 1, (angioedema, hereditary) 2081.8504 4.5965594 (SERPINGI), transcript variant 2, mRNA. 2630437 NM_022138.1 SMOC2 Homo sapiens SPARC related modular 460.60959 4.5833462 calcium binding 2 (SMOC2), mRNA. 7400735 NM_002345.3 LUM Homo sapiens lumican (LUM), 2055.86 4.5062461 IIRNA. 70167 NM_015364.2 LY96 Homo sapiens lymphocyte antigen 96 1223.2373 4.2976067 (LY96), mRNA. 6480204 NM_006288.2 THY1 Homo sapiens Thy-i cell surface 10105.223 4.2419192 antigen (THY1), mRNA. 240274 NM_000877.2 ILIRI Homo sapiens interleukin 1 receptor, 733.9 4.2382986 type I (RLIRI), mRNA. Homo sapiens jumonji, AT rich 5870739 NM_004653.3 JARIDID interactive domain ID (JARIDID), 273.9385 4.0758163 mRNA. 3930020 NM_003793.2 CTSF Homo sapiens cathepsin F (CTSF), 677.30442 4.0748577 mRNA. Homo sapiens laminin, alpha 2 1470296 NM_000426.3 LAMA2 (merosin, congenital muscular 786.61622 4.06948 dystrophy) (LAMA2), transcript variant 1, mRNA. 1500725 NM_001765.2 CD1C Homo sapiens CD1c molecule 774.50819 4.0635318 (CD1C), mRNA. 1850372 NM_000915.2 OXT Homo sapiens oxytocin, prepro- 282.77876 4.0477097 (neurophysin 1) (OXT), mRNA. Homo sapiens interleukin 11 receptor, 2570646 NM_004512.3 ILIRA alpha (ILIRA), transcript variant 1, 908.62271 4.038739 mRNA. Homo sapiens FXYD domain 3850500 NM_005031.3 FXYD1 containing ion transport regulator 1 375.17611 3.9923335 (phospholemman) (FXYD1), transcript variant a, mRNA. Homo sapiens sarcoglycan, delta 70088 NM_000337.4 SGCD (35kDa dystrophin-associated 292.63392 3.9837041 glycoprotein) (SGCD), transcript variant 1, mRNA. 238 WO 2011/150105 PCT/US2011/037969 Homo sapiens extracellular matrix 6840192 NM_001393.2 ECM2 protein 2, female organ and adipocyte 1134.6221 3.9575238 specific (ECM2), mRNA. Homo sapiens family with sequence 1940274 NM_032036.2 FAM14A similarity 14, member A (FAM14A), 3049.1192 3.9293531 mRNA. Homo sapiens cartilage intermediate 6400427 NM_003613.2 CILP layer protein, nucleotide 1400.8435 3.8568112 pyrophosphohydrolase (CILP), mRNA. 510246 NM_006475.1 POSTN Homo sapiens periostin, osteoblast 2951.7027 3.8304008 specific factor (POSTN), mRNA. 5260474 NM_001733.4 CIR Homo sapiens complement component 3121.7596 3.7556902 1, r subcomponent (C1R), mRNA. Homo sapiens alanyl (membrane) aminopeptidase (aminopeptidase N, 5810612 NM_001150.1 ANPEP aminopeptidase M, microsomal 3133.7056 3.7439271 aminopeptidase, CD13, p150) (ANPEP), nRNA. Homo sapiens WNT1 inducible 2320564 NM_003882.2 WISPI signaling pathway protein 1 (WISPI), 893.00723 3.7265932 transcript variant 1, mRNA. Homo sapiens ADAM 6900086 NM_006988.3 ADAMTS1 metallopeptidase with thrombospondin 2183.9094 3.7053114 type 1 motif, 1 (ADAMTS 1), mRNA. Homo sapiens FXYD domain 5860022 NM_021902.2 FXYD1 containing ion transport regulator 1 337.94897 3.681725 (phospholemman) (FXYD1), transcript variant b, mRNA. Homo sapiens proline/arginine-rich 7000446 NM_201348.1 PRELP end leucine-rich repeat protein 386.79779 3.6164957 (PRELP), transcript variant 2, mRNA. 5050131 NM_006485.3 FBLN1 Homo sapiens fibulin 1 (FBLN1), 243.43186 3.5681512 transcript variant B, mRNA. Homo sapiens matrix metallopeptidase 7400400 NM_002422.3 MMP3 3 (stromelysin 1, progelatinase) 747.30177 3.501442 (MMP3), mRNA. 7330292 NM_001998.2 FBLN2 Homo sapiens fibulin 2 (FBLN2), 7077.169 3.4783384 transcript variant 2, mRNA. Homo sapiens wingless-type MMTV 50634 NM_003391.1 WNT2 integration site family member 2 865.98142 3.4740666 (WNT2), mRNA. 990458 NM_003062.1 SLIT3 Homo sapiens slit homolog A 934.36519 3.4698189 (Drosophila) (SLJT3), mRNA. 7650497 NM_001972.2 ELA2 Homo sapiens elastase 2, neutrophil 226.58732 3.3578842 (ELA2), mRNA. Homo sapiens ADAM 3400600 NM_014244.2 ADAMTS2 tallopeptidase wi MS nip 357.34056 3.2868322 type 1 motif, 2 (ADAVTS2), transcript variant 1, mRNA. 4670441 NM_006329.2 FBLN5 Homo sapiens fibulin 5 (FBLN5), 6519.4003 3.2151658 IIRNA. Homo sapiens interleukin 11 receptor, 2760148 NM_004512.3 ILIRA alpha (ILIRA), transcript variant 1, 4568.4569 3.1954351 mRNA. 3990561 NM_002347.2 LY6H Homo sapiens lymphocyte antigen 6 350.95914 3.1711795 complex, locus H (LY6H1), mRNA. 4230750 NM_023067.2 FOXL2 Homo sapiens forkhead box L2 262.08709 3.1441081 (FOXL2), mRNA. 239 WO 2011/150105 PCT/US2011/037969 Homo sapiens limb bud and heart 2810246 NM_030915.1 LBH development homolog (mouse) (LBH), 3713.0861 3.1406181 mRNA. Homo sapiens collagen, type VI, alpha 2470114 NM_004369.2 COL6A3 3 (COL6A3), transcript variant 1, 10311.808 3.0542824 mRNA. Homo sapiens insulin-like growth 3310400 NM_000618.2 IGF1 factor 1 (somatomedin C) (JGF1), 252.6118 3.036027 mRNA. Homo sapiens myosin light chain 1300286 NM_053026.3 MYLK kinase (MYLK), transcript variant 2, 679.16667 3.030597 mRNA. Homo sapiens laminin, alpha 2 360181 NM_001079823.1 LAMA2 (merosin, congenital muscular 609.30369 2.9787426 dystrophy) (LAMA2), transcript variant 2, mRNA. 3370162 NM 006108.2 SPONI Homo sapiens spondin 1, extracellular 411.22817 2.9513793 matrix protein (SPONI), mRNA. Homo sapiens proopiomelanocortin (adrenocorticotropin/ beta-lipotropin/ 5080072 NM_001035256.1 POMC alpha-melanocyte stimulating 194.43178 2.8610204 hormone/ beta-melanocyte stimulating hormone/ beta-endorphin) (POMC), transcript variant 1, mRNA. Homo sapiens sarcoglycan, delta 4490563 NM_172244.2 SGCD (35kDa dystrophin-associated 204.78805 2.8464714 glycoprotein) (SGCD), transcript variant 2, mRNA. 840309 NM_000230.1 LEP Homo sapiens leptin (obesity homolog, 519.77028 2.8308518 mouse) (LEP), mRNA. Homo sapiens transforming growth 3190379 NM_003243.2 TGFBR3 factor, beta receptor III (TGFBR3), 1384.7013 2.7951612 mRNA. Homo sapiens peptidylprolyl 7000114 NM_000943.4 PPIC isomerase C (cyclophilin C) (PPIC), 4784.469 2.7864001 mRNA. 1710484 NM_002023.3 FMOD Homo sapiens fibromodulin (FMOD), 667.65251 2.7853306 mRNA. Homo sapiens elastin (supravalvular 1300156 NM_001081754.1 ELN aortic stenosis, Williams-Beuren 385.3028 2.7850429 syndrome) (ELN), transcript variant 4, mRNA. Homo sapiens Clq and tumor necrosis 7320204 NM_015645.2 C1QTNF5 factor related protein 5 (C1QTNF5), 1169.3833 2.733448 mRNA. 5360743 NM_001856.3 COL16A1 Homo sapiens collagen, type XVI, 3434.8845 2.6959119 alpha 1 (COL16A1), mRNA. 6940102 NM_002160.1 TNC Homo sapiens tenascin C 2724.6339 2.6909416 (hexabrachion) (TNC), mRNA. 1430278 NM_000396.2 CTSK Homo sapiens cathepsin K (CTSK), 2324.6993 2.6583865 mRNA. Homo sapiens fibroblast growth factor 6420746 NM_002010.1 FGF9 9 (glia-activating factor) (FGF9), 158.42891 2.6575106 mRNA. Homo sapiens collagen, type VI, alpha 6250192 NM_057165.2 COL6A3 3 (COL6A3), transcript variant 3, 14526.596 2.6572098 mRNA. 4830685 NM_006486.2 FBLN1 Homo sapiens fibulin 1 (FBLN1), 14079.27 2.6211832 transcript variant D, mRNA. Homo sapiens dolichyl-phosphate 2850520 NM_018973.3 DPM3 mannosyltransferase polypeptide 3 2385.932 2.5920572 (DPM3), transcript variant 1, mRNA. 240 WO 2011/150105 PCT/US2011/037969 4490241 NM_080879.2 RAB40A Homo sapiens RAB4OA, member RAS 152.70686 2.5711303 oncogene family (RAB4OA), mRNA. 7650189 NM_002292.3 LAMB2 Homo sapiens lamminin, beta 2 (laminin 2554.8858 2.5631473 S) (LAMB2), mRNA. Homo sapiens neuroblastoma, 7100010 NM_005380.4 NBL1 suppression of tumorigenicity 1 7188.0348 2.556841 (NBL1), transcript variant 2, mRNA. Homo sapiens cytochrome P450, 6200068 NM_000786.2 CYP51A1 family 51, subfamily A, polypeptide 1 529.72994 2.5019684 (CYP51A1), mRNA. Homo sapiens baculoviral IAP repeat 3060255 NM_182962.1 BIRC3 containing 3 (BIRC3), transcript 1342.3386 2.4899597 variant 2, mRNA. 360025 NM_198186.2 ASTN2 Homo sapiens astrotactin 2 (ASTN2), 377.44248 2.4829241 transcript variant 2, mRNA. Homo sapiens inhibitor of DNA 7570324 NM_002167.2 ID3 binding 3, dominant negative helix- 5995.9971 2.4806942 loop-helix protein (ID3), mRNA. Homo sapiens mucin 1, cell surface 7650026 NM_001044391.1 MUCI associated (MUCI), transcript variant 1812.5466 2.4703681 6, mRNA. Homo sapiens collagen, type VII, 2490593 NM_000094.2 COL7A1 alpha 1 (epidermolysis bullosa, 9199.7754 2.4393856 dystrophic, dominant and recessive) (COL7A1), mRNA. Homo sapiens 2680202 NM_003549.2 HYAL3 hyaluronoglucosaminidase 3 576.0618 2.4326811 (HYAL3), mRNA. Homo sapiens protease, serine, 12 2480692 NM_003619.2 PRSS12 (neurotrypsin, motopsin) (PRSS12), 399.32279 2.4306044 mRNA. Homo sapiens dolichyl-phosphate 7320435 NM_153741.1 DPM3 mannosyltransferase polypeptide 3 2832.5817 2.4232878 (DPM3), transcript variant 2, mRNA. Homo sapiens carboxylesterase 1 2680056 NM_001025195.1 CESI (monocyte/macrophage serine esterase 149.69941 2.4179778 1) (CES 1), transcript variant 1, mRNA. Homo sapiens ATP-binding cassette, 3990441 NR_003087.1 ABCC13 sub-family C (CFTR/MRP), member 173.11976 2.4031914 13 (ABCC13) on chromosome 21. XR_017987 XR_017988 XR_017989 3990703 NM_000572.2 IL1O Homo sapiens interleukin 10 (IL1O), 1906.8108 2.3934369 IIRNA. 4200543 NM_015696.3 GPX7 Homo sapiens glutathione peroxidase 7 4642.2637 2.3885765 (GPX7), mRNA. Homo sapiens prostaglandin endoperoxide synthase 1 1070450 NM_080591.1 PTGS1 (prostaglandin G/H synthase and 2319.5664 2.3776076 cyclooxygenase) (PTGS 1), transcript variant 2, mRNA. Homo sapiens lymphotoxin beta 4640064 NM_002342.1 LTBR receptor (TNFR superfamily, member 1456.2657 2.3503481 3) (LTBR), mRNA. Homo sapiens interleukin 17 receptor 4060017 NM_001080973.1 IL17RD D (IL17RD), transcript variant 1, 1023.886 2.349926 mRNA. Homo sapiens T-box 3 (ulnar 7200195 NM_005996.3 TBX3 mammary syndrome) (TBX3), 524.759 2.3473584 transcript variant 1, mRNA. 241 WO 2011/150105 PCT/US2011/037969 Homo sapiens Fc fragment of IgA, 4250193 NM_133279.1 FCAR receptor for (FCAR), transcript variant 1152.7709 2.3405904 9, mRNA. 6550762 NM_001998.2 FBLN2 Homo sapiens fibulin 2 (FBLN2), 4452.0853 2.3344866 transcript variant 2, mRNA. Homo sapiens sema domain, 1580608 NM_012431.1 SEMA3E immunoglobulin domain (Ig), short 1771.3469 2.3278415 basic domain, secreted, (semaphorin) 3E (SEMA3E), mRNA. 1170170 NM_003714.2 STC2 Homo sapiens stanniocalcin 2 (STC2), 10171.846 2.2897404 IIRNA. Homo sapiens angiogenin, 3930392 NM_001097577.1 ANG ribonuclease, RNase A family, 5 2107.3842 2.2840667 (ANG), transcript variant 2, mRNA. Homo sapiens chromosome Y open 7150066 NR_001544.1 CYorfl4 reading frame 14 (CYorfl4) on 165.51313 2.2829564 chromosome Y. 1170524 NM_032319.1 C2orf7 Homo sapiens chromosome 2 open 843.70015 2.2641814 reading frame 7 (C2orf7), mRNA. 2370041 NM_018334.3 LRRN3 Homo sapiens leucine rich repeat 182.47906 2.2537831 1 ~neuronal 3 (LRRN3), mRNA . 50368 NM_001920.3 DCN Homo sapiens decorin (DCN), 5419.1733 2.2435741 transcript variant Al, mRNA. Homo sapiens tumor necrosis factor 1170673 NM_172014.1 TNFSF14 (ligand) superfamily, member 14 538.14985 2.2127382 (TNFSF14), transcript variant 2, mRNA. Homo sapiens collagen, type VI, alpha 2750356 NM_001849.3 COL6A2 2 (COL6A2), transcript variant 2C2, 6019.119 2.2047046 mRNA. Homo sapiens ADAM 7150609 NM_021599.1 ADAMTS2 mtallopeptidase wi MStnip 211.63547 2.2046474 type 1 motif, 2 (ADAVTS2), transcript variant 2, mRNA. Homo sapiens mannan-binding lectin 4050326 NM_139125.2 MASPI seine peptidase 1 (C4/C2 activating 259.309 2.1955718 component of Ra-reactive factor) (MASP1), transcript variant 2, mRNA. Homo sapiens ribonuclease, RNase A 7040333 NM_194430.1 RNASE4 family, 4 (RNASE4), transcript variant 912.65516 2.1911247 1, mRNA. 3990563 NM_002171.1 IFNA1O Homo sapiens interferon, alpha 10 156.42758 2.1888069 (JFNA1O), mRNA. 4150753 NM_017946.2 FKBP14 Homo sapiens FK06 binding protein 2151.0059 2.1885303 14, 22 kDa (FKBP14), mRNA. Homo sapiens complement component 1300327 NM_201442.1 CiS 1, s subcomponent (CIS), transcript 375.8587 2.185191 variant 2, mRNA. Homo sapiens proteinase 3 (serine 1770731 NM_002777.3 PRTN3 proteinase, neutrophil, Wegener 137.39086 2.1728688 granulomatosis autoantigen) (PRTN3), mRNA. Homo sapiens pyrophosphatase 770356 NM 006903.4 PPA2 (inorganic) 2 (PPA2), nuclear gene 3080.2386 2.1724985 -M .encoding mitochondrial protein, transcript variant 2, mRNA. 2360148 NM_000095.2 COMP Homo sapiens cartilage oligomeric 6039.8732 2.144975 matrix protein compP), mRNA. 242 WO 2011/150105 PCT/US2011/037969 6420050 NM_002523.1 NPTX2 Homo sapiens neuronal pentraxin II 386.11593 2.1423221 642050 M_025231 NTX2(NPTX2), mRNA. 6760673 NM_006455.2 SC65 Homo sapiens synaptonemal complex 4595.7758 2.1368509 protein SC65 (SC65), mRNA. Homo sapiens short stature homeobox 2000739 NM_006884.2 SHOX2 2 (SHOX2), transcript variant 204.30848 2.1339293 SHOX2a, mRNA. 6330079 NM_015507.2 EGFL6 Homo sapiens EGF-like-domain, 372.56748 2.1113084 multiple 6 (EGFL6), mRNA. Homo sapiens proopiomelanocortin (adrenocorticotropin/ beta-lipotropin/ 5260291 NM_001035256.1 POMC alpha-melanocyte stimulating 125.68407 2.100674 hormone/ beta-melanocyte stimulating hormone/ beta-endorphin) (POMC), transcript variant 1, mRNA. Homo sapiens asparagine-linked 6370113 NM_013338.3 ALG5 glycosylation chomolog (S. 1991.3366 2.0994353 cerevisiae, dolichyl-phosphate beta glucosyltransferase) (ALG5), mRNA. 60427 NM_005013.2 NUCB2 Homo sapiens nucleobindin 2 2240.0342 2.0923376 (NUCB32), mRNA. Homo sapiens myosin light chain 7160343 NM_053032.2 MYLK kinase (MYLK), transcript variant 8, 2314.2883 2.0291845 mRNA. 60681 NM_021939.2 FKBP1O Homo sapiens FK06 binding protein 1329.8792 2.0290758 10, 65 kDa (FKBP1O), mRNA. 7650296 NM_133505.2 DCN Homo sapiens decorin (DCN), 25880.203 2.0269356 transcript variant C, mRNA. Homo sapiens deleted in lymphocytic 5490053 NR_002605.1 DLEU1 leukemia, 1 (DLEU1) on chromosome 827.93569 2.0253468 13. Homo sapiens collagen, type VI, alpha 3390458 NM_001849.3 COL6A2 2 (COL6A2), transcript variant 2C2, 9009.6538 2.0090537 mRNA. Xgene FB P9 D14 Chondro Pellet ProbelD RefSeqjID Symbol Definition RFU Fold over -- Ave 6420050 NM_002523.1 NPTX2 Homo sapiens neuronal pentraxin II 3636.9572 20.179261 (NPTX2), mRNA. 7150634 NM_001647.2 APOD Homo sapiens apolipoprotein D 15425.628 19.576806 (APOD), mRNA. Homo sapiens serpin peptidase 3290630 NM_000624.3 SERPINA5 inhibitor, clade A (alpha-i 3385.2972 19.366419 antiproteinase, antitrypsin), member 5 (SERPINA5), mRNA. 6960148 NM_004684.2 SPARCL1 Homo sapiens SPARC-like 1 (mast9, 2273.9765 19.260517 hevin) (SPARCL1), mRNA. Homo sapiens matrix metallopeptidase 3800088 NM_002423.3 MMP7 7 (matrilysin, uterine) (MMP7), 2922.415 16.191337 mRNA. Homo sapiens interleukin 1 receptor 6020300 NM_003856.2 ILIRLI like 1 (ILIRLI), transcript variant 2, 1667.773 16.095125 mRNA. 6620121 NM_005623.2 CCL8 Homo sapiens chemokine (C-C motif) 969.51136 12.562221 ligand 8 (CCL8), mRNA.11 2100228 NM_001937.3 DPT Homo sapiens dermatopontin (DPT), 17451.02 11.306774 mRNA. 243 WO 2011/150105 PCT/US2011/037969 5550719 NM_133503.2 DCN Homo sapiens decorin (DCN), 12919.429 10.152746 transcript variant A2, mRNA. 5340358 NM_000504.3 FlO Homo sapiens coagulation factor X 1025.0364 9.7902832 (FlO), mRNA. Homo sapiens cartilage intermediate 6400427 NM_003613.2 CILP layer protein, nucleotide 2930.2319 8.0675329 pyrophosphohydrolase (CILP), mRNA. Homo sapiens interleukin 1 receptor 5420754 NM_003856.2 ILIRLI like 1 (ILIRLI), transcript variant 2, 762.91814 7.8757894 mRNA. Homo sapiens laminin, alpha 2 1470296 NM_000426.3 LAMA2 (merosin, congenital muscular 1376.0522 7.1188678 dystrophy) (LAMA2), transcript variant 1, mRNA. 2710735 NM_016084.3 RASD1 Homo sapiens RAS, dexamethasone- 1905.7044 6.6465438 induced 1 (RASD1), mRNA. Homo sapiens sarcoglycan, delta 2450327 NM_172244.2 SGCD (35kDa dystrophin-associated 749.28658 6.2898123 glycoprotein) (SGCD), transcript variant 2, mRNA. 2630437 NM_022138.1 SMOC2 Homo sapiens SPARC related modular 609.73658 6.0672506 calcium binding 2 (SMOC2), mRNA. Homo sapiens extracellular matrix 6840192 NM_001393.2 ECM2 protein 2, female organ and adipocyte 1720.0053 5.9993207 specific (ECM2), mRNA. Homo sapiens laminin, alpha 2 360181 NM_001079823.1 LAMA2 (merosin, congenital muscular 1225.646 5.9918956 dystrophy) (LAMA2), transcript variant 2, mRNA. Homo sapiens N-acetylated alpha 4120626 NM_005468.2 NAALADL1 linked acidic dipeptidase-like 1 518.9736 5.6619994 (NAALADL1), mRNA. 70167 NM_015364.2 LY96 Homo sapiens lymphocyte antigen 96 1611.2522 5.6608217 (LY96), mRNA. Homo sapiens cathelicidin 5860075 NM_004345.3 CAMP antimicrobial peptide (CAMP), 335.49897 5.5851133 mRNA. Homo sapiens transforming growth 3190379 NM_003243.2 TGFBR3 factor, beta receptor III (TGFBR3), 2734.1034 5.5190673 mRNA. 4760095 NM_004750.2 CRLF1 Homo sapiens cytokine receptor-like 2820.5214 4.9635416 1 factor 1 (CRLF1), mRNA. 580739 NM_001996.2 FBLN1 Homo sapiens fibulin 1 (FBLN1), 9910.1417 4.2746882 transcript variant C, mRNA. Homo sapiens serpin peptidase 6280168 NM_001085.4 SERPINA3 inhibitor, clade A (alpha-i 6295.2746 4.2724868 antiproteinase, antitrypsin), member 3 (SERPINA3), mRNA. 730414 NM_000041.2 APOE Homo sapiens apolipoprotein E 10564.173 4.255266 (APOE), mRNA. Homo sapiens ADP-ribosylhydrolase 3390735 NM_199162.1 ADPRHL1 like 1 (ADPRHL1), transcript variant 391.2969 4.1445117 2, mRNA. 4490241 NM_080879.2 RAB40A Homo sapiens RAB40A, member RAS 240.11785 4.0428719 oncogene family (RAB4OA), mRNA. Homo sapiens Clq and tumor necrosis 5220639 NM_030945.2 C1QTNF3 factor related protein 3 (C1QTNF3), 446.4087 4.0203229 transcript variant 1, mRNA. 3370162 NM_006108.2 SPONI Homo sapiens spondin 1, extracellular 557.81976 4.0034653 matrix protein (SPONI), mRNA. 244 WO 2011/150105 PCT/US2011/037969 2360148 NM_000095.2 COMP Homo sapiens cartilage oligomeric 10753.486 3.8189473 matrix protein (COMP), mRNA. 780341 NM_031455.2 CCDC3 Homo sapiens coiled-coil domain 650.0674 3.8111946 containing 3 (CCDC3), mRNA. Homo sapiens inhibitor of DNA 7570324 NM_002167.2 ID3 binding 3, dominant negative helix- 9090.7962 3.7610901 loop-helix protein (ID3), mRNA. Homo sapiens WNT1 inducible 2320564 NM_003882.2 WISPI signaling pathway protein 1 (WISPI), 899.86519 3.755212 transcript variant 1, mRNA. Homo sapiens jumonji, AT rich 5870739 NM_004653.3 JARIDID interactive domain ID (JARIDID), 251.87375 3.7475241 mRNA. Homo sapiens interleukin 11 receptor, 2570646 NM_004512.3 ILIRA alpha (ILIRA), transcript variant 1, 833.86593 3.7064524 mRNA. 7400735 NM_002345.3 LUM Homo sapiens lumican (LUM), 1663.174 3.6455164 IIRNA. 5050131 NM_006485.3 FBLN1 Homo sapiens fibulin 1 (FBLN1), 247.24786 3.624085 transcript variant B, mRNA. Homo sapiens complement component 7400707 NM_001734.2 CiS 1, s subcomponent (CIS), transcript 3757.6047 3.5734416 variant 1, mRNA. Homo sapiens insulin-like growth 3310400 NM_000618.2 IGF1 factor 1 (somatomedin C) (JGF1), 295.76991 3.5547248 mRNA. 3830465 NM_001645.3 APOCI Homo sapiens apolipoprotein C-I 726.97419 3.533025 (APOCI), mRNA. 50368 NM_001920.3 DCN Homo sapiens decorin (DCN), 8531.2376 3.5319895 transcript variant Al, mRNA. Homo sapiens collagen, type VI, alpha 2470114 NM_004369.2 COL6A3 3 (COL6A3), transcript variant 1, 11675.871 3.4583078 mRNA. 1430278 NM_000396.2 CTSK Homo sapiens cathepsin K (CTSK), 2978.8617 3.4064473 mRNA. Homo sapiens ADAM 6900086 NM_006988.3 ADAMTS1 metallopeptidase with thrombospondin 1995.2286 3.3851877 type 1 motif, 1 (ADAMTS 1), mRNA. Homo sapiens interleukin 11 receptor, 2760148 NM_004512.3 ILIRA alpha (ILIRA), transcript variant 1, 4822.3853 3.3730468 mRNA. 5860041 NM_000948.3 PRL Homo sapiens prolactin (PRL), 198.3924 3.3354795 mRNA. 5260474 NM_001733.4 CIR Homo sapiens complement component 2747.9712 3.3059973 1, r subcomponent (CIR), mRNA. Homo sapiens T-box 3 (ulnar 7200195 NM_005996.3 TBX3 mammary syndrome) (TBX3), 737.88392 3.3007114 transcript variant 1, mRNA. Homo sapiens collagen, type VI, alpha 6250192 NM_057165.2 COL6A3 3 (COL6A3), transcript variant 3, 18038.537 3.2996153 mRNA. Homo sapiens reversion-inducing 3390487 NM_021111.1 RECK cysteine-rich protein with kazal motifs 1332.523 3.2506072 (RECK), mRNA. 7550131 NM_032414.2 PROKI Homo sapiens prokineticin 1 201.28178 3.2414343 (PROKI), mRNA. 1230615 NM_021197.2 WFDC1 Homo sapiens WAP four-disulfide 367.67994 3.2383236 core domain 1 (WFDC1), mRNA. 245 WO 2011/150105 PCT/US2011/037969 Homo sapiens Clq and tumor necrosis 1500373 NM_181435.4 C1QTNF3 factor related protein 3 (C1QTNF3), 301.2146 3.2372949 transcript variant 2, mRNA. Homo sapiens cytochrome P450, 4250575 NM_000779.2 CYP4B1 family 4, subfamily B, polypeptide 1 192.15147 3.0882268 (CYP4B 1), mRNA. 4830685 NM_006486.2 FBLN1 Homo sapiens fibulin 1 (FBLN1), 16553.6 3.081837 transcript variant D, mRNA. 4880609 NM_012242.2 DKK1 Homo sapiens dickkopf homolog 1 197.77257 3.0625422 (Xenopus laevis) (DKK1), mRNA. Homo sapiens sarcoglycan, delta 70088 NM_000337.4 SGCD (35kDa dystrophin-associated 223.95745 3.0487928 glycoprotein) (SGCD), transcript variant 1, mRNA. Homo sapiens lipase A, lysosomal 5360148 NM_000235.2 LIPA acid, cholesterol esterase (Wolman 3563.0409 2.9219834 disease) (LIPA), mRNA. 6040494 NM_006487.2 FBLN1 Homo sapiens fibulin 1 (FBLN1), 3713.0861 2.8588577 transcript variant A, mRNA. 3180605 NM_005478.3 INSL5 Homo sapiens insulin-like 5 (INSL5), 204.30848 2.8138357 mRNA. 4610246 NM_005014.1 OMD Homo sapiens osteomodulin (OMD), 1143.3712 2.7744668 mRNA. 4200543 NM_015696.3 GPX7 Homo sapiens glutathione peroxidase 7 5383.4422 2.7699339 (GPX7), inRNA. Homo sapiens proopiomelanocortin (adrenocorticotropin/ beta-lipotropin/ 5080072 NM_001035256.1 POMC alpha-melanocyte stimulating 187.91917 2.7651888 hormone/ beta-melanocyte stimulating hormone/ beta-endorphin) (POMC), transcript variant 1, mRNA. Homo sapiens ADAM 3400600 NM_014244.2 ADAMTS2 metallopeptidase with thrombospondin 299.34218 2.7533609 type 1 motif, 2 (ADAVTS2), transcript variant 1, mRNA. 6480592 NM_198129.1 LAMA3 Homo sapiens laminin, alpha 3 265.84012 2.7252626 (LAMA3), transcript variant 1, mRNA. Homo sapiens ribonuclease, RNase A 7040333 NM_194430.1 RNASE4 family, 4 (RNASE4), transcript variant 1133.0381 2.7202253 1, mRNA. 7330292 NM_001998.2 FBLN2 Homo sapiens fibulin 2 (FBLN2), 5512.9174 2.7095287 transcript variant 2, mRNA. 4480152 NM 014057.3 OGN Homo sapiens osteoglycin (OGN), 717.31504 2.7027998 transcript variant 3, mRNA. 1710484 NM_002023.3 FMOD Homo sapiens fibromodulin (FMOD), 647.64867 2.701878 mRNA. Homo sapiens wingless-type MMTV 50634 NM_003391.1 WNT2 integration site family member 2 670.70457 2.6906724 (WNT2), mRNA. Homo sapiens X-prolyl 4780544 NM_003399.5 XPNPEP2 aminopeptidase (amnopeptidase P) 2, 243.3708 2.6491577 membrane-bound (XPNPEP2), mRNA. 6480040 NM_153703.3 PODN Homo sapiens podocan (PODN), 988.40472 2.6374699 mRNA. Homo sapiens complement component 1300327 NM_201442.1 CiS 1, s subcomponent (CIS), transcript 450.89978 2.6214696 variant 2, mRNA. 246 WO 2011/150105 PCT/US2011/037969 Homo sapiens peptidylprolyl 7000114 NM_000943.4 PPIC isomerase C (cyclophilin C) (PPIC), 4414.6049 2.570997 mRNA. 1090326 NM_003256.2 TIMP4 Homo sapiens TIMP metallopeptidase 961.51637 2.5065959 inhibitor 4 (TJIP4), mRNA. 6480204 NM_006288.2 THYl Homo sapiens Thy-i cell surface 5952.7799 2.4988277 antigen (THYl), mRNA. 5290333 NM_152520.3 ZNF533 Homo sapiens zinc finger protein 533 218.87699 2.4907406 (ZNF533), mRNA. 2940280 NM_014057.3 OGN Homo sapiens osteoglycin (OGN), 1226.7959 2.4551598 transcript variant 3, mRNA. 7650296 NM_133505.2 DCN Homo sapiens decorin (DCN), 31253.086 2.4477394 transcript variant C, mRNA. Homo sapiens mitochondrial ribosomal 6940521 NM_032112.2 MRPL43 protein L43 (MRPL43), nuclear gene 1306.4966 2.4391244 encoding mitochondrial protein, transcript variant 1, mRNA. Homo sapiens proprotein convertase 520176 NM_000439.3 PCSK1 subtilisin/kexin type 1 (PCSK1), 165.7455 2.4240724 mRNA. Homo sapiens protein tyrosine 3850603 NM_002846.2 PTPRN phosphatase, receptor type, N 337.65855 2.4021311 (PTPRN), mRNA. 1430487 NM_000900.2 MGP Homo sapiens matrix Gla protein 8654.8028 2.3894208 (MGP), mRNA. Homo sapiens ectonucleotide 2490152 NM_001040092.1 ENPP2 pyrophosphatase/phosphodiesterase 2 543.41755 2.3781833 (autotaxin) (ENPP2), transcript variant 2, mRNA. Homo sapiens serpin peptidase inhibitor, clade G (Cl inhibitor), 2030309 NM_001032295.1 SERPINGI member 1, (angioedema, hereditary) 1075.5087 2.3746372 (SERPINGI), transcript variant 2, mRNA. Homo sapiens agouti signaling protein, 3460474 NM_001672.2 ASIP nonagouti homolog (mouse) (ASIP), 165.05708 2.3699492 mRNA. Homo sapiens angiogenin, 3930392 NM_001097577.1 ANG ribonuclease, RNase A family, 5 2169.2099 2.3510758 (ANG), transcript variant 2, mRNA. Homo sapiens ribonuclease, RNase A 6590041 NM_194431.1 RNASE4 family, 4 (RNASE4), transcript variant 3844.1298 2.3508456 3, mRNA. Homo sapiens ADAM 7150609 NM_021599.1 ADAMTS2 metallopeptidase with thrombospondin 224.84727 2.3422772 type 1 motif, 2 (ADAMTS2), transcript variant 2, mRNA. 510246 NM_006475.1 POSTN Hoo sapiens periostin, osteoblast 1800.5978 2.3366212 specific factor (POSTN), mRNA. 1340593 NM_004484.2 GPC3 Homo sapiens glypican 3 (GPC3), 356.34617 2.3245768 mRNA. Homo sapiens gelsolin (amyloidosis, 3940204 NM_000177.3 GSN Finnish type) (GSN), transcript variant 222.9017 2.3143678 1, mRNA. Homo sapiens vitamin K epoxide 6450546 NM_024006.4 VKORC1 reductase complex, subunit 1 3077.4853 2.3125167 (VKORC1), transcript variant 1, mRNA. 247 WO 2011/150105 PCT/US2011/037969 Homo sapiens tissue factor pathway 4280674 NM_001032281.2 TFPI inhibitor (lipoprotein-associated 316.24145 2.2483592 coagulation inhibitor) (TFPI), transcript variant 2, mRNA. 2810673 NM_152739.3 HOXA9 Homo sapiens homeobox A9 314.80701 2.2247389 (HOXA9), mRNA. Homo sapiens short stature homeobox 2000739 NM_006884.2 SHOX2 2 (SHOX2), transcript variant 212.71608 2.2217437 SHOX2a, mRNA. Homo sapiens asparagine-linked 6370113 NM_013338.3 ALG5 glycosylation 5 homolog (S. 2080.3737 2.1933058 cerevisiae, dolichyl-phosphate beta glucosyltransferase) (ALG5), mRNA. Homo sapiens alanyl (membrane) aminopeptidase (aminopeptidase N, 5810612 NM_001150.1 ANPEP aminopeptidase M, microsomal 1824.2199 2.1794473 aminopeptidase, CD13, p150) (ANPEP), mRNA. 430088 NM_006487.2 FBLN1 Homo sapiens fibulin 1 (FBLN1), 133.55295 2.1692231 transcript variant A, mRNA. Homo sapiens carboxylesterase 1 2680056 NM_001025195.1 CESI (monocyte/macrophage serine esterase 134.11032 2.1661794 1) (CES 1), transcript variant 1, mRNA. 5900594 NM_001779.1 CD58 Homo sapiens CD58 molecule (CD58), 1118.2471 2.1399892 mRNA. Homo sapiens ribonuclease, RNase A 5910382 NM_194430.1 RNASE4 family, 4 (RNASE4), transcript variant 1536.5372 2.1351064 1, mRNA. 1110048 NM_007281.1 SCRG1 Homo sapiens scrapie responsive 2822.9493 2.133594 protein 1 (SCRG1), mRNA. Homo sapiens SWISNF related, 1580327 NM_003077.2 SMARCD2 matrix associated, actin dependent 801.17065 2.1125656 regulator of chromatin, subfamily d, member 2 (SMARCD2), mRNA. Homo sapiens FXYD domain 5860022 NM_021902.2 FXYD1 containing ion transport regulator 1 191.68142 2.0882391 (phospholemman) (FXYD1), transcript variant b, mRNA. Homo sapiens FXYD domain 3850500 NM_005031.3 FXYD1 containing ion transport regulator 1 195.06143 2.0756927 (phospholemman) (FXYD1), transcript variant a, mRNA. Homo sapiens chromosome 6 open 1190082 NM_001040437.1 C6orf48 reading frame 48 (C6orf48), transcript 225.98709 2.0748582 variant 1, mRNA. 3990561 NM_002347.2 LY6H Homo sapiens lymphocyte antigen 6 225.98709 2.0419631 complex, locus H (LY6H), mRNA. 2940441 NM_002527.3 NTF3 Homo sapiens neurotrophin 3 (NTF3), 413.79779 2.032885 mRNA. Homo sapiens Clq and tumor necrosis 7320204 NM_015645.2 C1QTNF5 factor related protein 5 (C1QTNF5), 861.21962 2.0131115 mRNA. 3930020 NM_003793.2 CTSF Homo sapiens cathepsin F (CTSF), 333.96003 2.0091993 ________________________mRNA. Xgene FB P9 D14 Chondro MM ProbelD RefSeq ID Symbol Definition RFU Fold over

--

2 Ave 248 WO 2011/150105 PCT/US2011/037969 2630437 NM_022138.1 SMOC2 Homo sapiens SPARC related modular 2292.1658 22.808447 calcium binding 2 (SMOC2), mRNA. 1230615 NM_021197.2 WFDC1 Homo sapiens WAP four-disulfide 2062.6271 18.166491 core domain 1 (WFDC1), mRNA. 3370162 NM_006108.2 SPONI Homo sapiens spondin 1, extracellular 2298.804 16.498487 matrix protein (SPONI), mRNA. 2100228 NM_001937.3 DPT Homo sapiens dermatopontin (DPT), 23004.187 14.904754 mRNA. Homo sapiens sarcoglycan, delta 70088 NM_000337.4 SGCD (35kDa dystrophin-associated 932.11165 12.689086 glycoprotein) (SGCD), transcript variant 1, mRNA. 6960148 NM_004684.2 SPARCL1 Homo sapiens SPARC-like 1 (mast9, 1471.9015 12.466964 hevin) (SPARCL1), mRNA. Homo sapiens laminin, alpha 2 1470296 NM_000426.3 LAMA2 (merosin, congenital muscular 2124.8319 10.992604 dystrophy) (LAMA2), transcript variant 1, mRNA. Homo sapiens laminin, alpha 2 360181 NM_001079823.1 LAMA2 (merosin, congenital muscular 2079.6658 10.166998 dystrophy) (LAMA2), transcript variant 2, mRNA. Homo sapiens Clq and tumor necrosis 1500373 NM_181435.4 C1QTNF3 factor related protein 3 (C1QTNF3), 924.61342 9.937255 transcript variant 2, mRNA. Homo sapiens sarcoglycan, delta 2450327 NM_172244.2 SGCD (35kDa dystrophin-associated 1149.0929 9.6459472 glycoprotein) (SGCD), transcript variant 2, mRNA. 2360148 NM_000095.2 COMP Homo sapiens cartilage oligomeric 27098.344 9.623591 matrix protein (COMP), mRNA. Homo sapiens reversion-inducing 3390487 NM_021111.1 RECK cysteine-rich protein with kazal motifs 3906.8519 9.5305227 (RECK), mRNA. Homo sapiens cartilage intermediate 6400427 NM_003613.2 CILP layer protein, nucleotide 3410.2531 9.3891304 pyrophosphohydrolase (CILP), mRNA. Homo sapiens Clq and tumor necrosis 5220639 NM_030945.2 C1QTNF3 factor related protein 3 (C1QTNF3), 994.30133 8.9546023 transcript variant 1, mRNA. 6040494 NM_006487.2 FBLN1 Homo sapiens fibulin 1 (FBLN1), 11489.875 8.8465273 transcript variant A, mRNA. 5550719 NM_133503.2 DCN Homo sapiens decorin (DCN), 10679.388 8.392407 transcript variant A2, mRNA. 1500725 NM_001765.2 CD1C Homo sapiens CD1c molecule 1505.5186 7.8988483 (CD1C), mRNA. 6480040 NM_153703.3 PODN Homo sapiens podocan (PODN), 2766.9904 7.3834673 mRNA. 4560592 NM_004787.1 SLIT2 Homo sapiens slit homolog 2 2628.9071 7.2488321 (Drosophila) (SLJT2), mRNA. Homo sapiens fibrillin 2 (congenital 3440204 NM_001999.3 FBN2 contractural arachnodactyly) (FBN2), 13397.483 7.09445 mRNA. Homo sapiens extracellular matrix 6840192 NM_001393.2 ECM2 protein 2, female organ and adipocyte 1929.7683 6.7309669 specific (ECM2), mRNA. 510246 NM_006475.1 POSTN Homo sapiens periostin, osteoblast 5182.6953 6.7255419 specific factor (POSTN), mRNA. 249 WO 2011/150105 PCT/US2011/037969 Homo sapiens ADAM 3400600 NM_014244.2 ADAMTS2 metallopeptidase with thrombospondin 719.39838 6.6170539 type 1 motif, 2 (ADAMTS2), transcript variant 1, mRNA. 4570181 NM_000820.1 GAS6 Homo sapiens growth arrest-specific 6 2429.8056 6.5607641 (GAS6), mRNA. Homo sapiens myosin light chain 7160343 NM_053032.2 MYLK kinase (MYLK), transcript variant 8, 7406.5817 6.4941437 mRNA. Homo sapiens very low density 5390661 NM_001018056.1 VLDLR lipoprotein receptor (VLDLR), 3124.5562 6.1061511 transcript variant 2, mRNA. 780341 NM_031455.2 CCDC3 Homo sapiens coiled-coil domain 1019.9208 5.9795593 containing 3 (CCDC3), mRNA. 3360066 NM_001146.3 ANGPT1 Homo sapiens angiopoietin 1 2353.86 5.9459569 (ANGPT1), mRNA. 4670441 NM_006329.2 FBLN5 Homo sapiens fibulin 5 (FBLN5), 12054.09 5.9447028 IIRNA. Homo sapiens serpin peptidase 3290630 NM_000624.3 SERPINA5 inhibitor, clade A (alpha-i 1015.3279 5.8084315 antiproteinase, antitrypsin), member 5 (SERPINA5), mRNA. 1170170 NM_003714.2 STC2 Homo sapiens stanniocalcin 2 (STC2), 25684.391 5.7817026 IIRNA. Homo sapiens limb bud and heart 2810246 NM_030915.1 LBH development homolog (mouse) (LBH), 6691.4562 5.6597956 mRNA. 4610246 NM_005014.1 OMD Homo sapiens osteomodulin (OMD), 2309.0232 5.6029991 mRNA. Homo sapiens WNT1 inducible 2320564 NM_003882.2 WISPi signaling pathway protein 1 (WISPi), 1326.5611 5.5358493 transcript variant 1, mRNA. Homo sapiens matrix metallopeptidase 3800088 NM_002423.3 MMP7 7 (matrilysin, uterine) (MMP7), 990.90959 5.4900317 mRNA. Homo sapiens limb bud and heart 840369 NM_030915.1 LBH development homolog (mouse) (LBH), 944.66232 5.4399225 mRNA. Homo sapiens elastin (supravalvular 6130577 NM_001081754.1 ELN aortic stenosis, Williams-Beuren 10493.166 5.3573274 syndrome) (ELN), transcript variant 4, mRNA. Homo sapiens ADAM 6900086 NM_006988.3 ADAMTS1 metallopeptidase with thrombospondin 3121.7596 5.2965069 type 1 motif, 1 (ADAMTS 1), mRNA. Homo sapiens insulin-like growth 3310400 NM_000618.2 IGF1 factor 1 (somatomedin C) (JGF1), 436.43761 5.2453463 mRNA. 990458 NM_003062.1 SLIT3 Homo sapiens slit homolog A 1412.1392 5.24406 (Drosophila) (SLJT3), mRNA. Homo sapiens jumonji, AT rich 5870739 NM_004653.3 JARIDiD interactive domain ID (JARIDiD), 348.34299 5.1828497 mRNA. 1710484 NM_002023.3 FMOD Homo sapiens fibromodulin (FMOD), 1224.45 5.1081932 mRNA. 6480204 NM_006288.2 THYl Homo sapiens Thy-i cell surface 12159.015 5.1040495 antigen (THYl), mRNA. 5260474 NM_001733.4 CIR Homo sapiens complement component 4230.1569 5.089168 2,rsubcomponent(CIR),mRNA. 250 WO 2011/150105 PCT/US2011/037969 Homo sapiens complement component 1300327 NM_201442.1 CiS 1, s subcomponent (CIS), transcript 865.64985 5.0327697 variant 2, mRNA. Homo sapiens elastin (supravalvular 1300156 NM_001081754.1 ELN aortic stenosis, Williams-Beuren 695.84882 5.0297294 syndrome) (ELN), transcript variant 4, mRNA. 7550022 NM_139244.2 STXBP5 Homo sapiens syntaxin binding protein 1880.2898 5.026997 5 (tomosyn) (STXBPS), mRNA. 4760095 NM_004750.2 CRLF1 Homo sapiens cytokine receptor-like 2798.517 4.9248183 factor 1 (CRLF1), mRNA. 580739 NM_001996.2 FBLN1 Homo sapiens fibulin 1 (FBLN1), 11027.86 4.7568101 transcript variant C, mRNA. Homo sapiens protease, serine, 12 2480692 NM_003619.2 PRSS12 (neurotrypsin, motopsin) (PRSS12), 773.64395 4.7090284 mRNA. 7330292 NM_001998.2 FBLN2 Homo sapiens fibulin 2 (FBLN2), 9483.5714 4.6610545 transcript variant 2, mRNA. Homo sapiens transforming growth 3190379 NM_003243.2 TGFBR3 factor, beta receptor III (TGFBR3), 2302.2323 4.6472914 mRNA. 4830685 NM_006486.2 FBLN1 Homo sapiens fibulin 1 (FBLN1), 24958.137 4.6465368 transcript variant D, mRNA. Homo sapiens myosin light chain 1300286 NM_053026.3 MYLK kinase (MYLK), transcript variant 2, 1040.7369 4.6440059 mRNA. Homo sapiens ADAM 7150609 NM_021599.1 ADAMTS2 metallopeptidase with thrombospondin 443.78982 4.6230439 type 1 motif, 2 (ADAMTS2), transcript variant 2, mRNA. 5870136 NM_004669.2 CLIC3 Homo sapiens chloride intracellular 1314.458 4.392093 channel 3 (CLJC3), mRNA. 3060639 NM 003013.2 SFRP2 Homo sapiens secreted frizzled-related 4359.3979 4.3654025 protein 2 (SFRP2), mRNA. Homo sapiens alanyl (membrane) aminopeptidase (aminopeptidase N, 5810612 NM_001150.1 ANPEP aminopeptidase M, microsomal 3539.94 4.2292668 aminopeptidase, CD13, p150) (ANPEP), mRNA. Homo sapiens complement component 7400707 NM_001734.2 CiS 1, s subcomponent (CIS), transcript 4326.2069 4.1141761 variant 1, mRNA. Homo sapiens collagen, type VI, alpha 2470114 NM_004369.2 COL6A3 3 (COL6A3), transcript variant 1, 13595.27 4.0268197 mRNA. Homo sapiens proline/arginine-rich 7000446 NM_201348.1 PRELP end leucine-rich repeat protein 429.96696 4.0201204 (PRELP), transcript variant 2, mRNA. 4900050 NM_014421.2 DKK2 Homo sapiens dickkopf homolog 2 1011.6097 4.0057294 (Xenopus laevis) (DKK2), mRNA. 70730 NM_000820.1 GAS6 Homo sapiens growth arrest-specific 6 15873.563 3.9893726 (GAS6), mRNA. 2940441 NM_002527.3 NTF3 Homo sapiens neurotrophin 3 (NTF3), 797.83009 3.9195397 mRNA. 840309 NM_000230.1 LEP Homo sapiens leptin (obesity homolog, 698.11962 3.802205 mouse) (LEP), mRNA. Homo sapiens SLIT-ROBO Rho 2470220 NM_020762.1 SRGAP1 GTPase activating protein 1 1216.3071 3.6992919 (SRGAP1), mRNA. 251 WO 2011/150105 PCT/US2011/037969 Homo sapiens WNT1 inducible 870431 NM_080838.1 WISPI signaling pathway protein 1 (WISPI), 273.86254 3.6621122 transcript variant 2, mRNA. Homo sapiens collagen, type VI, alpha 6250192 NM_057165.2 COL6A3 3 (COL6A3), transcript variant 3, 20016.516 3.6614278 mRNA. 4120019 NM_020353.1 PLSCR4 Homo saens psp lip RNA. 2190.0962 3.6418362 5360743 NM_001856.3 COL16A1 Homo sapiens collagen, type XVI, 4595.7758 3.6070518 alpha 1 (COL16A1), mRNA. Homo sapiens wingless-type MMTV 1820343 NM_003392.3 WNT5A integration site family, member 5A 4991.946 3.5653672 (WNT5A), mRNA. 4480152 NM_014057.3 OGN Homo sapiens osteoglycin (OGN), 934.36519 3.5206316 transcript variant 3, mRNA. 1340593 NM_004484.2 GPC3 Homo sapiens glypican 3 (GPC3), 534.38024 3.4859584 IIRNA. 5340358 NM_000504.3 F1O Homo sapiens coagulation factor X 364.04698 3.4770698 (FlO), mRNA. Homo sapiens interleukin 11 receptor, 2760148 NM_004512.3 ILIRA alpha (ILIRA), transcript variant 1, 4960.8145 3.469872 mRNA. 7400735 NM_002345.3 LUM Homo sapiens lumican (LUM), 1565.6111 3.4316678 mRNA. 4280632 NM_000820.1 GAS6 Homo sapiens growth arrest-specific 6 12976.429 3.337057 (GAS6), mRNA. Homo sapiens peptidylprolyl 7000114 NM_000943.4 PPIC isomerase C (cyclophilin C) (PPIC), 5649.8456 3.2903819 mRNA. Homo sapiens collagen, type XII, 3060095 NM_080645.2 COL12A1 alpha 1 (COL12A1), transcript variant 9879.3788 3.1900801 short, mRNA. 6420050 NM_002523.1 NPTX2 Homo sapiens neuronal pentraxin II 574.37773 3.1868722 (NPTX2), mRNA. 6940102 NM_002160.1 TNC Homo sapiens tenascin C 3220.0619 3.1802433 (hexabrachion) (TNC), mRNA. Homo sapiens lymphotoxin beta 4640064 NM_002342.1 LTBR receptor (TNFR superfamily, member 1969.1799 3.1781688 3) (LTBR), mRNA. 5050131 NM_006485.3 FBLN1 Homo sapiens fibulin 1 (FBLN1), 216.81681 3.1780359 transcript variant B, mRNA. Homo sapiens T-box 3 (ulnar 7200195 NM_005996.3 TBX3 mammary syndrome) (TBX3), 708.27139 3.1682482 transcript variant 1, mRNA. 1430278 NM_000396.2 CTSK Homo sapiens cathepsin K (CTSK), 2757.585 3.1534086 mRNA. Homo sapiens interleukin 6 signal 3830048 NM_002184.2 IL6ST transducer (gp130, oncostatin M 272.04499 3.1465176 receptor) (IL6ST), transcript variant 1, mRNA. 2600397 NM_153225.2 RPESP Homo sapiens RPE-spondin (RPESP), 264.39602 3.0678397 IIRNA. 2940280 NM_014057.3 OGN Homo sapiens osteoglycin (OGN), 1530.3845 3.0627251 transcript variant 3, mRNA. Homo sapiens lipase A, lysosomal 5360148 NM_000235.2 LIPA acid, cholesterol esterase (Wolman 3722.3932 3.0526654 disease) (LIPA), mRNA. 2650220 NM_007085.3 FSTL1 Homo sapiens follistatin-like 1 21186.499 3.0381817 (FSTL1), RNA. 252 WO 2011/150105 PCT/US2011/037969 Homo sapiens interleukin 11 receptor, 2570646 NM_004512.3 ILIRA alpha (ILIRA), transcript variant 1, 678.22478 3.0146427 mRNA. 6020286 NM_013409.1 FST Homo sapiens follistatin (FST), 7984.5058 2.9826799 transcript variant FST344, mRNA. 2370041 NM_018334.3 LRRN3 Homo sapiens leucine rich repeat 240.65413 2.9722984 neuronal 3 (LRRN3), mRNA. 4490241 NM_080879.2 RAB40A Homo sapiens RAB4OA, member RAS 175.40059 2.9532254 oncogene family (RAB4OA), mRNA. Homo sapiens procollagen-lysine, 2 4640187 NM_000935.2 PLOD2 oxoglutarate 5-dioxygenase 2 3835.0556 2.9489649 (PLOD2), transcript variant 2, mRNA. 6480592 NM_198129.1 LAMA3 Homo sapiens laminin, alpha 3 283.19904 2.9032178 (LAMA3), transcript variant 1, mRNA. Homo sapiens myeloid cell leukemia 7380100 NM_021960.3 MCL1 sequence 1 (BCL2-related) (MCL1), 1268.3892 2.8962699 transcript variant 1, mRNA. Homo sapiens kallikrein-related 460202 NM_001030050.1 KLK3 peptidase 3 (KLK3), transcript variant 577.60531 2.8943079 6, mRNA. Homo sapiens interleukin 6 signal 4260333 NM_002184.2 IL6ST transducer (gp130, oncostatin M 529.20428 2.8521194 receptor) (JL6ST), transcript variant 1, mRNA. Homo sapiens N-acetylated alpha 4120626 NM_005468.2 NAALADL1 linked acidic dipeptidase-like 1 259.59086 2.8321349 (NAALADL1), mRNA. Homo sapiens cysteine-rich, 3930605 NM_001554.3 CYR61 angiogenic inducer, 61 (CYR61), 18155.869 2.8147086 mRNA. Homo sapiens inhibitor of DNA 7570324 NM_002167.2 ID3 binding 3, dominant negative helix- 6791.0518 2.8096283 loop-helix protein (ID3), mRNA. Homo sapiens aspartate beta 5890619 NM_004318.2 ASPH hydroxylase (ASPH), transcript variant 478.96851 2.8083894 1, mRNA. Homo sapiens guanine nucleotide 5890025 NM_018841.4 GNG12 binding protein (G protein), gamma 12 2529.0429 2.7849573 (GNG12), mRNA. 1260068 NM_006350.2 FST Homo sapiens follistatin (FST), 620.80863 2.7661213 transcript variant FST317, mRNA. Homo sapiens glutamate receptor, 1030240 NM_021956.2 GRIK2 ionotropic, kainate 2 (GRIK2), 189.19602 2.7092064 transcript variant 1, mRNA. 940471 NM_004772.1 C5orf13 Homo sapiens chromosome 5 open 24452.144 2.6901332 reading frame 13 (C~orfl3), mRNA. Homo sapiens insulin-like growth 6840372 NM_001013398.1 IGFBP3 factor binding protein 3 (IGFBP3), 20167.417 2.6884219 transcript variant 1, mRNA. Homo sapiens procollagen-proline, 2 7570379 NM_001017974.1 P4HA2 oxoglutarate 4-dioxygenase (proline 4- 1331.8667 2.6863567 hydroxylase), alpha polypeptide II (P4HA2), transcript variant 3, mRNA. 5560075 NM_005928.1 MFGE8 Homo sapiens milk fat globule-EGF 27548.738 2.6668105 1 - factor 8 protein (MFGE8), mRNA. 6280097 NM_000933.2 PLCB4 Homo sapiens phospholipase C beta 4 360.49912 2.6216331 (PLCB4), transcript variant 1, mRNA. Homo sapiens follistatin-like 3 2360356 NM_005860.2 FSTL3 (secreted glycoprotein) (FSTL3), 4299.9885 2.6165233 mRNA. 253 WO 2011/150105 PCT/US2011/037969 780025 NM_001004019.1 FBLN2 Homo sapiens fibulin 2 (FBLN2), 148.89506 2.5632495 transcript variant 1, mRNA. 6760719 NM_007046.1 EMILINI Homo sapiens elastin microfibril 2341.8403 2.5630313 interfacer 1 (EMIILINI), mIRNA. 4480341 NM_014762.3 DHCR24 Homo sapiens 24-dehydrocholesterol 1005.6569 2.5604675 reductase (DHCR24), mRNA. Homo sapiens short stature homeobox 2000739 NM_006884.2 SHOX2 2 (SHOX2), transcript variant 243.99226 2.5484122 SHOX2a, mRNA. Homo sapiens protein tyrosine 3940541 NM_030671.1 PTPRO phosphatase, receptor type, 0 207.30782 2.5308748 (PTPRO), transcript variant 5, mRNA. Homo sapiens wingless-type MMTV 50634 NM_003391.1 WNT2 integration site family member 2 627.78953 2.5185097 (WNT2), mRNA. 6110209 NM_012425.3 RSU1 Homo sapiens Ras suppressor protein 1 1319.342 2.5150778 (RSU1), transcript variant 1, mRNA. 50368 NM_001920.3 DCN Homo sapiens decorin (DCN), 6073.0357 2.5142775 transcript variant Al, mRNA. 3190121 NM_177964.3 LOC130576 Homo sapiens hypothetical protein 295.59897 2.5041369 LOC130576 (L0C130576), mRNA. 29.87 25016 Homo sapiens RAP 1, GTP-GDP 5560139 NM_021159.3 RAP1GDS1 dissociation stimulator 1 721.69218 2.4978702 (RAP1GDS1), mRNA. Homo sapiens fibroblast growth factor 6420746 NM_002010.1 FGF9 9 (glia-activating factor) (FGF9), 148.45509 2.4902082 mRNA. Homo sapiens sarcoglycan, delta 4490563 NM_172244.2 SGCD (35kDa dystrophin-associated 178.27802 2.4779927 glycoprotein) (SGCD), transcript variant 2, mRNA. 6550762 NM_001998.2 FBLN2 Homo sapiens fibulin 2 (FBLN2), 4719.7603 2.4748442 transcript variant 2, mRNA. Homo sapiens collagen, type VIII, 3360452 NM_020351.2 COL8A1 alpha 1 (COL8A1), transcript variant 9009.6538 2.4698095 2, mRNA. Homo sapiens insulin-like growth 6590132 NM_000598.4 IGFBP3 factor binding protein 3 (IGFBP3), 26070.535 2.4677473 transcript variant 2, mRNA. Homo sapiens carboxylesterase 1 2680056 NM_001025195.1 CESI (monocyte/macrophage serine esterase 152.42478 2.4619985 1) (CES 1), transcript variant 1, mRNA. Homo sapiens collagen, type VI, alpha 2750356 NM_001849.3 COL6A2 2 (COL6A2), transcript variant 2C2, 6663.6869 2.4407992 mRNA. Homo sapiens serpin peptidase 770408 NM_000602.1 SERPINE1 inhibitor, clade E (nexin, plasminogen 11627.675 2.4314185 activator inhibitor type 1), member 1 (SERPINE1), mRNA. Homo sapiens fibroblast growth factor 6450471 NM_023107.2 FGFR1 receptor 1 (fins-related tyrosine kinase 369.19233 2.427825 2, Pfeiffer syndrome) (FGFR1), transcript variant 5, mRNA. 2710735 NM_016084.3 RASD1 Homo sapiens RAS, dexamethasone- 687.01246 2.3961 1 - induced 1 (RASD1), mRNA. 4200543 NM_015696.3 GPX7 Homo sapiens glutathione peroxidase 7 4608.6774 2.3712954 (GPX7), mRNA. 7650189 NM_002292.3 LAMB2 Homo sapiens laminin, beta 2 (laminin 2360.9204 2.3685546 S) (LAMB2), mRNA. 254 WO 2011/150105 PCT/US2011/037969 5570682 NM_024769.2 ASAM Homo sapiens adipocyte- specific 1468.1515 2.3430465 adhesion molecule (AS AMV), mRNA. 2650612 NM_198129.1 LAMA3 Homo sapiens laminin, alpha 3 176.92353 2.3417843 (LAMA3), transcript variant 1, mRNA. Homo sapiens serpin peptidase 7650017 NM_001235.2 SERPINHI inhibitor, clade H (heat shock protein 19881.979 2.332411 47), member 1, (collagen binding protein 1) (SERPINHI), mRNA. Homo sapiens serpin peptidase 5080192 NM_006216.2 SERPINE2 inhibitor, clade E (nexin, plasminogen 27760.729 2.3208228 activator inhibitor type 1), member 2 (SERPINE2), mRNA. Homo sapiens collagen, type VIII, 2510091 NM_020351.2 COL8A1 alpha 1 (COL8A1), transcript variant 22542.571 2.3204069 2, mRNA. Homo sapiens Nedd4 family 60553 NM_030571.2 NDFIP1 interacting protein 1 (NDFIP1), 769.43304 2.3165503 mRNA. Homo sapiens chloride intracellular 270653 NM_013943.1 CLIC4 channel 4 (CLIC4), nuclear gene 1201.4714 2.3078664 encoding mitochondrial protein, mRNA. 7650296 NM_133505.2 DCN Homo sapiens decorin (DCN), 29441.861 2.3058844 transcript variant C, mRNA. 2710307 NM_005927.3 MFAP3 Homo sapiens microfibrillar-associated 662.4281 2.3056768 protein 3 (MFAP3), mRNA. Homo sapiens UDP-N-acetyl-alpha-D galactosamine:polypeptide N 3610202 NM_017540.3 GALNT1O acetylgalactosaminyltransferase 10 2097.356 2.3029913 (GalNAc-T1O) (GALNT1O), transcript variant 2, mRNA. Homo sapiens ectonucleotide 2490152 NM_001040092.1 ENPP2 pyrophosphatase/phosphodiesterase 2 526.1646 2.3026784 (autotaxin) (ENPP2), transcript variant 2, mRNA. Homo sapiens UDP-N-acetyl-alpha-D galactosamine:polypeptide N 2060301 NM_198321.2 GALNT1O acetylgalactosaminyltransferase 10 260.53466 2.2879932 (GalNAc-T1O) (GALNT1O), transcript variant 1, mRNA. Homo sapiens integrin, beta 5 2650114 NM_002213.3 ITGB5 (ITGB5), mRNA. XM_944688 19599.502 2.2846037 XM_944693 3930020 NM_003793.2 CTSF Homo sapiens cathepsin F (CTSF), 379.26136 2.2817451 IIRNA. Homo sapiens prostaglandin endoperoxide synthase 1 6840626 NM_000962.2 PTGS1 (prostaglandin G/H synthase and 412.82655 2.2578005 cyclooxygenase) (PTGS 1), transcript variant 1, mRNA. Homo sapiens wingless-type MMTV 4850370 NM_032642.2 WNT5B integration site family, member 5B 1707.3892 2.2347138 (WNT5B), transcript variant 1, mRNA. Homo sapiens ectonucleotide 840678 NM_001040092.1 ENPP2 pyrophosphatase/phosphodiesterase 2 676.70398 2.2331434 (autotaxin) (ENPP2), transcript variant 2, mRNA. 255 WO 2011/150105 PCT/US2011/037969 Homo sapiens sema domain, 5670246 NM_006379.2 SEMA3C immunoglobulin domain (Ig), short 1145.9794 2.2298403 basic domain, secreted, (semaphorin) 3C (SEMA3C), mRNA. Homo sapiens integrin, beta 5 2490411 NM_002213.3 ITGB5 (ITGB5), mRNA. XM_944688 7712.591 2.2218721 XM_944693 1030008 NM_003239.1 TGFB3 Homo sapiens transforming growth 933.23864 2.2168893 factor, beta 3 (TGFB3), mRNA. Homo sapiens CD99 molecule-like 2 1780079 NM_134445.2 CD99L2 (CD99L2), transcript variant 3, 1952.6108 2.2165474 mRNA. 3940017 NM_002317.3 LOX Homo sapiens lysyl oxidase (LOX), 11721.186 2.2030837 mRNA. 4150132 NM_017514.2 PLXNA3 Homo sapiens plexin A3 (PLXNA3), 1577.9237 2.1911142 mRNA. Homo sapiens 3-phosphoinositide 5270768 NM_031268.4 PDPK1 dependent protein kinase-1 (PDPK1), 1790.2314 2.1897889 transcript variant 2, mRNA. Homo sapiens leucine rich repeat (in 3400754 NM_004735.2 LRRFIP1 FLII) interacting protein 1 (LRRFIP1), 2743.3283 2.1844511 mRNA. Homo sapiens integrin, beta-like 1 5570129 NM_004791.1 ITGBL1 (with EGF-like repeat domains) 347.2882 2.1730523 (ITGBL1), mRNA. Homo sapiens Clq and tumor necrosis 7320204 NM_015645.2 C1QTNF5 factor related protein 5 (C1QTNF5), 927.60708 2.168293 mRNA. Homo sapiens protocadherin 10 5910093 NM_032961.1 PCDH1O (PCDH1O), transcript variant 1, 429.02094 2.1624135 mRNA. Homo sapiens natriuretic peptide 2810372 NM_003995.3 NPR2 receptor B/guanylate cyclase B 968.27168 2.1621594 (atrionatriuretic peptide receptor B) (NPR2), mRNA. 6900309 NM_000046.2 ARSB Homo sapiens arylsulfatase B (ARSB), 264.03968 2.1583141 transcript variant 1, mRNA. Homo sapiens Down syndrome cell 1300202 NM_001389.3 DSCAM adhesion molecule (DSCAM), 314.16652 2.1501805 transcript variant 1, mRNA. Homo sapiens platelet derived growth 4480445 NM_025208.4 PDGFD factor D (PDGFD), transcript variant 1, 940.92316 2.1302121 mRNA. 2650523 NM_004969.1 IDE Homo sapiens insulin-degrading 598.35605 2.1196517 enzyme (IDE), mRNA. Homo sapiens thyroid adenoma 1580719 NM_022065.4 THADA associated (THADA), transcript 689.99653 2.1165729 variant 1, mRNA. 2640292 NM_001901.2 CTGF Homo sapiens connective tissue 27308.196 2.1005726 growth factor (CTGF), mRNA. Homo sapiens receptor tyrosine 6060333 NM_005012.2 RORI kinase-like orphan receptor 1 (RORI), 591.25789 2.0855696 transcript variant 1, mRNA. Homo sapiens chloride intracellular 3890193 NM_013943.1 CLIC4 channel 4 (CLIC4), nuclear gene 10603.246 2.0823507 encoding mitochondrial protein, mRNA. 1770730 NM_003971.3 SPAG9 Homo sapiens sperm associated 1762.6332 2.0822756 antigen 9 (SPAG9), mRNA. 256 WO 2011/150105 PCT/US2011/037969 Homo sapiens scavenger receptor class 7570692 NM_153334.3 SCARF2 F, member 2 (SCARF2), transcript 187.0531 2.0801762 variant 1, mRNA. Homo sapiens Rho guanine nucleotide 3850333 NM_015320.2 ARHGEF4 exchange factor (GEF) 4 (ARHGEF4), 229.93083 2.077528 transcript variant 1, mRNA. Homo sapiens scavenger receptor class 5390703 NM_153334.3 SCARF2 F, member 2 (SCARF2), transcript 1439.5319 2.0626291 variant 1, mRNA. 7570598 NM_001848.2 COL6A1 Homo sapiens collagen, type VI, alpha 13094.317 2.050844 1 1 (COL6A1), mRNA. 3120132 NM_198188.1 ASTN2 Homo sapiens astrotactin 2 (ASTN2), 194.45413 2.0038667 transcript variant 4, mRNA. Homo sapiens protocadherin 10 1580753 NM_020815.1 PCDH1O (PCDH1O), transcript variant 2, 285.19071 2.0020039 mRNA. ASC-2 P4 ProbelD RefSeqjID Symbol Definition RFU Fold over -- Ave Homo sapiens WNT1 inducible 4120553 NM_003881.2 WISP2 signaling pathway protein 2 (WISP2), 23476.049 82.604321 mRNA. 7150634 NM_001647.2 APOD Homo sapiens apolipoprotein D 19047.355 24.173172 (APOD), mRNA. 1430278 NM_000396.2 CTSK Homo sapiens cathepsin K (CTSK), 20167.417 23.062247 mRNA. 6480040 NM_153703.3 PODN Homo sapiens podocan (PODN), 7475.5754 19.947907 IIRNA. 3830465 NM_001645.3 APOCI Homo sapiens apolipoprotein C-I 3367.8413 16.367387 (APOCI), mRNA. Homo sapiens major histocompatibility 2570564 NM_019111.3 HLA-DRA complex, class II, DR alpha (HLA- 1591.126 16.259524 DRA), mRNA. 770156 NM_203422.1 LOC221091 Homo sapiens similar to hypothetical 1201.4714 15.990593 protein (L0C221091), mRNA. Homo sapiens dipeptidyl-peptidase 4 4830255 NM_001935.3 DPP4 (CD26, adenosine deaminase 1403.7066 13.376693 complexing protein 2) (DPP4), mRNA. Homo sapiens serpin peptidase inhibitor, clade G (Cl inhibitor), 2030309 NM_001032295.1 SERPINGI member 1, (angioedema, hereditary) 5330.0074 11.76823 (SERPINGI), transcript variant 2, mRNA. Homo sapiens ectonucleotide 2490152 NM_001040092.1 ENPP2 pyrophosphatase/phosphodiesterase 2 2611.9798 11.430928 (autotaxin) (ENPP2), transcript variant 2, mRNA. 70167 NM_015364.2 LY96 Homo sapiens lymphocyte antigen 96 3235.8125 11.368399 (LY96), mRNA. 2710735 NM_016084.3 RASD1 Homo sapiens RAS, dexamethasone- 3248.9969 11.331558 induced 1 (RASD1), mRNA. 3370162 NM_006108.2 SPONI Homo sapiens spondin 1, extracellular 1506.3317 10.810923 matrix protein (SPONI), mRNA. Homo sapiens ectonucleotide 840678 NM_001040092.1 ENPP2 pyrophosphatase/phosphodiesterase 2 3161.2938 10.432364 (autotaxin) (ENPP2), transcript variant 2, mRNA. 257 WO 2011/150105 PCT/US2011/037969 Homo sapiens CUG triplet repeat, 5390575 NM_006561.2 CUGBP2 RNA binding protein 2 (CUGBP2), 697.7365 10.219749 transcript variant 2, mRNA. 3930020 NM_003793.2 CTSF Homo sapiens cathepsin F (CTSF), 1693.9279 10.191156 mRNA. Homo sapiens family with sequence 2810373 NM_017565.2 FAM20A similarity 20, member A (FAM20A), 819.16711 9.9518396 mRNA. 6940053 NM_014917.2 NTNG1 Homo sapiens netrin GI (NTNG1), 1158.6235 9.5678363 transcript variant 3, mRNA. Homo sapiens transforming growth 3190379 NM_003243.2 TGFBR3 factor, beta receptor III (TGFBR3), 4734.0848 9.5562344 mRNA. 1510181 NM_004878.3 PTGES Homo sapiens prostaglandin E 5718.701 9.1477662 synthase (PTGES), mRNA. 5490019 NM_002084.3 GPX3 Homo sapiens glutathione peroxidase 3 3106.8338 8.9275469 (plasma) (GPX3), mRNA. Homo sapiens complement component 7400707 NM_001734.2 CiS 1, s subcomponent (CIS), transcript 9009.6538 8.5680837 variant 1, mRNA. 5340358 NM_000504.3 F1O Homo sapiens coagulation factor X 871.63112 8.3250857 (FlO), mRNA. Homo sapiens carboxylesterase 1 2680056 NM_001025195.1 CESI (monocyte/macrophage serine esterase 501.80221 8.1052196 1) (CES 1), transcript variant 1, mRNA. 3890095 NM_003102.2 SOD3 Homo sapiens superoxide dismutase 3' 877.9674 7.9035598 extracellular (SOD3), mRNA. 730414 NM_000041.2 APOE Homo sapiens apolipoprotein E 19176.664 7.7243913 (APOE), inRNA. Homo sapiens X-prolyl 4780544 NM_003399.5 XPNPEP2 aminopeptidase (aminopeptidase P) 2, 705.60826 7.6807391 membrane-bound (XPNPEP2), mRNA. 5260474 NM_001733.4 CIR Homo sapiens complement component 6019.119 7.2414117 1, r subcomponent (C1R), mRNA. Homo sapiens chromosome 20 open 1690201 NM_182519.1 C20orf186 reading frame 186 (C20orf186), 390.27176 7.2188172 mRNA. Homo sapiens FXYD domain 5860022 NM_021902.2 FXYD1 containing ion transport regulator 1 646.16962 7.0395801 (phospholemman) (FXYD1), transcript variant b, mRNA. Homo sapiens prostaglandin 12 7150762 NM_000961.3 PTGIS (prostacyclin) synthase (PTGIS), 5886.2299 6.6182259 mRNA. 4010181 NM_000804.2 FOLR3 Homo sapiens folate receptor 3 514.8826 6.5039844 (gamma) (FOLR3), mRNA. 4480468 NM_000929.2 PLA2G5 Homo sapiens phospholipase A2, 353.4264 6.3114421 group V (PLA2GS), mRNA. 670594 NM_000063.3 C2 Homo sapiens complement component 493.28614 6.1900272 2 (C2), mRNA. 5550719 NM_133503.2 DCN Homo sapiens decorin (DCN), 7846.1456 6.165901 transcript variant A2, mRNA. Homo sapiens complement component 1300327 NM_201442.1 CiS 1, s subcomponent (CIS), transcript 1049.5171 6.1017488 variant 2, mRNA. Homo sapiens N-acetylated alpha 4120626 NM_005468.2 NAALADL1 linked acidic dipeptidase-like 1 549.42434 5.9942168 (NAALADL1), mRNA. 258 WO 2011/150105 PCT/US2011/037969 150474 NM_001218.3 CA12 Homo sapiens carbonic anhydrase XII 7509.4586 5.9090642 (CA12), transcript variant 1, mRNA. 1190142 NM_032048.2 EMILIN2 Homo sapiens elastin microfibril 1847.2586 5.8879456 interfacer 2 (EMIILIN2), mRNA. Homo sapiens FXYD domain 3850500 NM_005031.3 FXYD1 containing ion transport regulator 1 535.53333 5.6987309 (phospholemman) (FXYD1), transcript variant a, mRNA. 7330477 NM_173078.2 SLITRK4 Homo sapiens SLIT and NTRK-like 707.62139 5.6855049 family, member 4 (SLITRK4), mRNA. 580739 NM_001996.2 FBLN1 Homo sapiens fibulin 1 (FBLN1), 12976.429 5.5973152 transcript variant C, mRNA. 7650672 NM_012098.2 ANGPTL2 Homo sapiens angiopoietin-like 2 5669.5187 5.4999622 (ANGPTL2), mRNA. Homo sapiens proteoglycan 2, bone 3840072 NM_002728.4 PRG2 marrow (natural killer cell activator, 373.33555 5.3370873 eosinophil granule major basic protein) (PRG2), mRNA. 3830075 NM_001218.3 CA12 Homo sapiens carbonic anhydrase XII 1691.9584 5.3364696 (CA12), transcript variant 1, mRNA. 610598 NM_004000.2 CHI3L2 Homo sapiens chitinase 3-like 2 895.14572 4.8999976 (CHI3L2), transcript variant 1, mRNA. 6040494 NM_006487.2 FBLN1 Homo sapiens fibulin 1 (FBLN1), 6332.4214 4.8755916 transcript variant A, mRNA. 2360020 NM_013402.3 FADS1 Homo sapiens fatty acid desaturase 1 5438.1055 4.8477567 (FADS 1), mRNA. 2810673 NM_152739.3 HOXA9 Homo sapiens homeobox A9 684.35907 4.8363607 (HOXA9), mRNA. 2100767 NM_130386.1 COLEC12 Homo sapiens collectin sub-family 7371.1814 4.8123493 member 12 (COLEC12), mRNA. Homo sapiens lymphotoxin beta 4640064 NM_002342.1 LTBR receptor (TNFR superfamily, member 2973.404 4.7989418 3) (LTBR), mRNA. Homo sapiens serpin peptidase 6290356 NM_002615.4 SERPINF1 inhibitor, clade F (alpha-2 antiplasmin, 3434.8845 4.6060327 pigment epithelium derived factor), member 1 (SERPINFI), mRNA. 830324 NM_001459.2 FLT3LG Homo sapiens fins-related tyrosine 554.96873 4.4042769 kinase 3 ligand (FLT3LG), mRNA. Homo sapiens insulin-like growth 7380719 NM_002178.2 IGFBP6 factor binding protein 6 (IGFBP6), 15335.1 4.2655386 mIRNA. Homo sapiens mannan-binding lectin 4050326 NM_139125.2 MASPI seine peptidase 1 (C4/C2 activating 482.63407 4.0864673 component of Ra-reactive factor) (MASP1), transcript variant 2, mRNA. 2680072 NM_014279.4 OLFM1 Homo sapiens olfactomedin 1 637.01667 4.0736313 (OLFM1), transcript variant 1, mRNA.63.1740333 Homo sapiens collagen, type VI, alpha 6250192 NM_057165.2 COL6A3 3 (COL6A3), transcript variant 3, 21951.868 4.015443 mRNA. 4890270 NM_002346.1 LY6E Homo sapiens lymphocyte antigen 6 8983.3292 4.0001859 complex, locus E (LY6E), mRNA. Homo sapiens collagen, type VI, alpha 2470114 NM_004369.2 COL6A3 3 (COL6A3), transcript variant 1, 13397.483 3.9682366 mRNA. Homo sapiens chemokine (C-X-C 4610615 NM_000609.4 CXCL12 motif) ligand 12 (stromal cell-derived 10717.151 3.9167919 factor 1) (CXCL12), transcript variant 259 WO 2011/150105 PCT/US2011/037969 2, mRNA. 6020682 NM_020211.1 RGMA Homo sapiens RGM domain family, 1120.7732 3.9161543 member A (RGMA), inRNA. Homo sapiens ADAMTS-like 1 5890326 NM_052866.3 ADAMTSL1 (ADAMTSL1), transcript variant 2, 544.43112 3.8498064 mRNA. Homo sapiens serpin peptidase inhibitor, clade G (Cl inhibitor), 3450538 NM_000062.2 SERPING1 member 1, (angioedema, hereditary) 304.48658 3.7717254 (SERPINGI), transcript variant 1, mRNA. Homo sapiens sulfide quinone 6770707 NM_021199.2 SQRDL reductase-like (yeast) (SQRDL), 1041.2077 3.6484489 mRNA. Homo sapiens phospholipase A2, 4860152 NM_000300.2 PLA2G2A group IIA (platelets, synovial fluid) 348.64668 3.5644456 (PLA2G2A), mRNA. 1010333 NM_002448.3 MSX1 Homo sapiens msh homeobox 1 4991.946 3.5499078 (MSX1), mRNA. Homo sapiens parathyroid hormone 6900414 NM_198965.1 PTHLH like hormone (PTHLH), transcript 1083.3996 3.5240639 variant 1, mRNA. Homo sapiens chemokine (C-X-C 4560020 NM_199168.2 CXCL12 motif) ligand 12 (stromal cell-derived 19736.908 3.5186153 factor 1) (CXCL12), transcript variant 1, mRNA. Homo sapiens matrix metallopeptidase 510736 NM_004530.2 MMP2 2 (gelatinase A, 72kDa gelatinase, 1505.5186 3.4918449 72kDa type IV collagenase) (MMP2), mRNA. Homo sapiens sarcoglycan, delta 2450327 NM_172244.2 SGCD (35kDa dystrophin-associated 413.2854 3.4692835 glycoprotein) (SGCD), transcript variant 2, mRNA. 10768 NM_004737.3 LARGE Homo sapiens like-glycosyltransferase 1706.4448 3.400453 (LARGE), transcript variant 1, mRNA. 4230343 NM_001871.2 CPB1 Homo sapiens carboxypeptidase B1 247.2149 3.3591443 (tissue) (CPB 1), mRNA. 6550762 NM_001998.2 FBLN2 Homo sapiens fibulin 2 (FBLN2), 6406.0473 3.3590623 transcript variant 2, mRNA. Homo sapiens SLIT-ROBO Rho 2470220 NM_020762.1 SRGAP1 GTPase activating protein 1 1089.0429 3.312229 (SRGAP1), mRNA. Homo sapiens regeneration associated 7320669 NM_015430.2 DKFZP586H2123 muscle protease (DKFZP586H2123), 7188.0348 3.2358749 transcript variant 1, mRNA. 6370369 NM_001040021.1 CD14 Homo sapiens CD14 molecule (CD14), 344.75133 3.1969788 transcript variant 2, mRNA. Homo sapiens ribonuclease, RNase A 6590041 NM_194431.1 RNASE4 family, 4 (RNASE4), transcript variant 5216.8513 3.1903221 3, mRNA. 6420008 NM_000313.1 PROSI Homo sapiens protein S (alpha) 2788.7059 3.1868165 (PROS I), mRNA. 7650497 NM_001972.2 ELA2 Homo sapiens elastase 2, neutrophil 211.28127 3.131058 (ELA2), mRNA. 2190113 NM_005559.2 LAMA1 Homo sapiens lamnin, alpha 1 432.8146 3.1285697 (LAMA), mRNA. 260 WO 2011/150105 PCT/US2011/037969 Homo sapiens lipase A, lysosomal 5360148 NM_000235.2 LIPA acid, cholesterol esterase (Wolman 3762.0058 3.0851509 disease) (LIPA), mRNA. Homo sapiens phospholipid transfer 5690519 NM_182676.1 PLTP protein (PLTP), transcript variant 2, 8027.5717 3.0337069 mRNA. Homo sapiens collagen, type VI, alpha 2750356 NM_001849.3 COL6A2 2 (COL6A2), transcript variant 2C2, 8262.2099 3.026312 mRNA. 4290037 NM_002514.2 NOV Homo sapiens nephroblastoma 663.94661 3.0241811 overexpressed gene (NOV), mRNA. 7330292 NM_001998.2 FBLN2 Homo sapiens fibulin 2 (FBLN2), 6106.4316 3.0012333 transcript variant 2, mRNA. Homo sapiens low density lipoprotein 2710286 NM_002332.2 LRP1 related protein 1 (alpha-2- 730.8674 2.9998234 macroglobulin receptor) (LRP1), mRNA. 990458 NM_003062.1 SLIT3 Homo sapiens slit homolog A 806.29543 2.9942245 (Drosophila) (SLJT3), mRNA. 5220093 NM_032782.3 HAVCR2 Homo sapiens hepatitis A virus cellular 328.38746 2.9826279 receptor 2 (HAVCR2), mRNA. Homo sapiens fibroblast growth factor 5560138 NM_002009.2 FGF7 7 (keratinocyte growth factor) (FGF7), 175.65251 2.9727422 mRNA. 4280577 NM_001200.2 BMP2 Homo sapiens bone morphogenetic 661.60678 2.9324383 protein 2 (BMP2), mRNA. Homo sapiens ADP-ribosylhydrolase 3390735 NM_199162.1 ADPRHL1 like 1 (ADPRHL1), transcript variant 276.77736 2.9315515 2, mRNA. 5670594 NM_021077.3 NMB Homo sapiens neuromedin B (NMB), 1423.549 2.9294782 transcript variant 1, mRNA. 7510113 NM 033254.2 BOC Homo sapiens Boc homolog (mouse) 254.52729 2.928162 (BOC), inRNA. Homo sapiens ribonuclease, RNase A 5910382 NM_194430.1 RNASE4 family, 4 (RNASE4), transcript variant 2095.9606 2.9124571 1, mRNA. Homo sapiens alanyl (membrane) aminopeptidase (aminopeptidase N, 5810612 NM_001150.1 ANPEP aminopeptidase M, microsomal 2429.8056 2.9029578 aminopeptidase, CD13, p150) (ANPEP), mRNA. Homo sapiens erythrocyte membrane 1510538 NM_012307.2 EPB41L3 protein band 4.1-like 3 (EPB41L3), 2166.4069 2.8919645 mRNA. Homo sapiens sterol regulatory 3390343 NM_001005291.1 SREBF1 element binding transcription factor 1 812.38024 2.8885229 (SREBF1), transcript variant 1, mRNA. 5090626 NM_004460.2 FAP Homo sapiens fibroblast activation 4535.774 2.8878109 protein, alpha (FAP), mRNA. 670608 NM_013379.2 DPP7 Homo sapiens dipeptidyl-peptidase 7 985.09705 2.8808439 (DPP7), mRNA. 5670100 NM 000355.2 TCN2 Homo sapiens transcobalamin II; 634.19322 2.8548233 macrocytic anemia (TCN2), mRNA. 1980288 NM_004390.2 CTSH Homo sapiens cathepsin H (CTSH), 1094.9552 2.8106932 transcript variant 1, mRNA. Homo sapiens 6 4640079 NM_012088.2 PGLS phosphogluconolactonase (PGLS), 5728.7796 2.8041639 mRNA. 261 WO 2011/150105 PCT/US2011/037969 4900133 NM_006307.3 SRPX Homo sapiens sushi-repeat-containing 14914.677 2.7716698 protein, X-linked (SRPX), mRNA. Homo sapiens collagen, type VI, alpha 3390458 NM_001849.3 COL6A2 2 (COL6A2), transcript variant 2C2, 12312.358 2.7455204 mRNA. Homo sapiens syntrophin, beta 1 3420739 NM_021021.2 SNTB1 (dystrophin-associated protein Al, 935.54971 2.7381646 59kDa, basic component 1) (SNTB 1), mRNA. Homo sapiens angiogenin, 3930392 NM_001097577.1 ANG ribonuclease, RNase A family, 5 2524.9596 2.7366515 (ANG), transcript variant 2, mRNA. Homo sapiens sterol regulatory 6840044 NM_004176.3 SREBF1 element binding transcription factor 1 359.24764 2.7239029 (SREBF1), transcript variant 2, mRNA. 4830685 NM_006486.2 FBLN1 Homo sapiens fibulin 1 (FBLN1), 14604.974 2.7190552 transcript variant D, mRNA. Homo sapiens extracellular matrix 6840192 NM_001393.2 ECM2 protein 2, female organ and adipocyte 769.86202 2.6852528 specific (ECM2), mRNA. Homo sapiens ribonuclease, RNase A 7040333 NM_194430.1 RNASE4 family, 4 (RNASE4), transcript variant 1118.2471 2.6847147 1, mRNA. 60121 NM_001908.3 CTSB Homo sapiens cathepsin B (CTSB), 14006.772 2.6745656 transcript variant 1, mRNA. Homo sapiens extracellular matrix 3440386 NM_004425.2 ECM1 protein 1 (ECM1), transcript variant 1, 1240.6128 2.649613 mRNA. 5890288 NM_003377.3 VEGFB Homo sapiens vascular endothelial 1166.958 2.6458331 growth factor B (VEGFB), mRNA. Homo sapiens parathyroid hormone 1980593 NM_198964.1 PTHLH like hormone (PTHLH), transcript 476.77094 2.5907747 variant 3, mRNA. 6980541 NM_003255.4 TIMP2 Homo sapiens TIMP metallopeptidase 1384.7013 2.590426 inhibitor 2 (TJIP2), mRNA. Homo sapiens bone morphogenetic 990075 NM_130851.1 BMP4 protein 4 (BMP4), transcript variant 3, 1164.5298 2.5898274 mRNA. Homo sapiens N-sulfoglucosamine 1340538 NM_000199.2 SGSH sulfohydrolase (sulfamidase) (SGSH), 3381.8953 2.5807282 mRNA. Homo sapiens neuroblastoma, 5090156 NM_182744.1 NBL1 suppression of tumorigenicity 1 13275.365 2.518665 (NBL1), transcript variant 1, mRNA. Homo sapiens agouti signaling protein, 3460474 NM_001672.2 ASIP nonagouti homolog (mouse) (ASIP), 175.13879 2.514706 mRNA. 620255 NM_012193.2 FZD4 Homo sapiens frizzled homolog 4 1238.2525 2.5003284 (Drosophila) (FZD4), mRNA. 1850564 NM_004139.2 LBP Homo sapiens lipopolysaccharide 202.86032 2.4931644 binding protein (LBP), mRNA. 4210228 NM_000940.1 PON3 Homo sapiens paraoxonase 3 (PON3), 140.50103 2.4886608 mRNA. Homo sapiens complement component 5810424 NM_016546.1 CIRL 1, r subcomponent-like (C1RL), 1076.4614 2.4629412 mRNA. 3800204 NM_006334.3 OLFM1 Homo sapiens olfactomedin 1 224.66844 2.451312 (OLFM1), transcript variant 2, mRNA. 262 WO 2011/150105 PCT/US2011/037969 Homo sapiens CUG triplet repeat, 7400133 NM_001025077.2 CUGBP2 RNA binding protein 2 (CUGBP2), 157.85811 2.4434613 transcript variant 3, mRNA. Homo sapiens tumor necrosis factor 1090747 NM_003809.2 TNFSF12 (ligand) superfamily, member 12 865.98142 2.4387072 (TNFSF12), mRNA. 270575 NR_003276.1 CES4 Homo sapiens carboxylesterase 4-like 136.29948 2.4288707 (CES4) on chromosome 16. Homo sapiens mannan-binding lectin 580360 NM_001031849.1 MASPI serine peptidase 1 (C4/C2 activating 221.37227 2.4206241 component of Ra-reactive factor) (MASP1), transcript variant 3, mRNA. Homo sapiens carboxylesterase 2 3520372 NM_003869.4 CES2 (intestine, liver) (CES2), transcript 2059.8953 2.4146759 variant 1, mRNA. Homo sapiens glutathione peroxidase 4 6520128 NM_001039847.1 GPX4 (phospholipid hydroperoxidase) 24616.781 2.4074815 (GPX4), transcript variant 2, mRNA. Homo sapiens chromosome 5 open 1690240 NM_032385.3 C5orf4 reading frame 4 (C5orf4), transcript 511.77699 2.3936721 variant 2, mRNA. Homo sapiens major histocompatibility 2470553 NM_002119.3 HLA-DOA complex, class II, DO alpha (HLA- 168.74115 2.3762247 DOA), mRNA. 3830022 NM_019101.2 APOM Homo sapiens apolipoprotein M 338.29956 2.3754229 (APOM), mRNA. Homo sapiens procollagen C 4810445 NM_013363.2 PCOLCE2 endopeptidase enhancer 2 1320.641 2.3686837 (PCOLCE2), mRNA. Homo sapiens follicular lymphoma 160537 NM_002035.1 FVT1 variant translocation 1 (FVT1), 1613.9291 2.3465605 mRNA. Homo sapiens N-acetylglucosamine-1 6400630 NM_016256.2 NAGPA phosphodiester alpha-N- 736.8031 2.3448938 acetylglucosaminidase (NAGPA), mRNA. Homo sapiens Clq and tumor necrosis 7320204 NM_015645.2 C1QTNF5 factor related protein 5 (C1QTNF5), 995.99012 2.3281392 mRNA. 1710484 NM_002023.3 FMOD Homo sapiens fibromodulin (FMOD), 557.73186 2.3267607 mRNA. Homo sapiens FXYD domain 1400091 NM_005031.3 FXYD1 containing ion transport regulator 1 173.74145 2.3255421 (phospholemman) (FXYD1), transcript variant a, mRNA. 2510441 NM_024682.1 TBC1D17 Homo sapiens TBC1 domain family, 440.36932 2.2934781 member 17 (TBC1D17), mRNA. Homo sapiens AU RNA binding 7330180 NM_001698.1 AUH protein/enoyl-Coenzyme A hydratase 605.73289 2.2880137 (AUH), nuclear gene encoding mitochondrial protein, mRNA. Homo sapiens family with sequence 4860646 NM_020223.2 FAM20C similarity 20, member C (FAM20C), 2791.0782 2.2858576 mRNA. Homo sapiens retinoic acid receptor 2340681 NM_206963.1 RARRESI responder (tazarotene induced) 1 978.04543 2.2822457 (RARRESI), transcript variant 1, mRNA. 5820025 NM_001426.3 ENI Homo sapiens engrailed homeobox 1 155.67249 2.2791719 (ENI), mRNA. 263 WO 2011/150105 PCT/US2011/037969 Homo sapiens ST6 (alpha-N-acetyl neuraminyl-2,3-beta-galactosyl-1, 3) 3780608 NM_013443.3 ST6GALNAC6 N-acetylgalactosaminide alpha-2,6- 1597.322 2.2712315 sialyltransferase 6 (ST6GALNAC6), mRNA. 7570598 NM_001848.2 COL6A1 Homo sapiens collagen, type VI, alpha 14371.405 2.2508628 1 1 (COL6A1), mRNA. 50368 NM_001920.3 DCN Homo sapiens decorin (DCN), 5428.6664 2.2475042 transcript variant A1, mRNA. Homo sapiens neuroblastoma, 7100010 NM_005380.4 NBL1 suppression of tumorigenicity 1 6295.2746 2.2392791 (NBL1), transcript variant 2, mRNA. 7650296 NM_133505.2 DCN Homo sapiens decorin (DCN), 28435.106 2.2270354 transcript variant C, mRNA. Homo sapiens laminin, alpha 2 1470296 NM_000426.3 LAMA2 (merosin, congenital muscular 426.89543 2.2085006 dystrophy) (LAMA2), transcript variant 1, mRNA. 780025 NM_001004019.1 FBLN2 Homo sapiens fibulin 2 (FBLN2), 128.06999 2.2047429 transcript variant 1, mRNA. Homo sapiens reversion-inducing 3390487 NM_021111.1 RECK cysteine-rich protein with kazal motifs 900.38215 2.1964264 (RECK), mRNA. Homo sapiens glucosidase, beta; acid 4780133 NM_001005742.1 GBA (includes glucosylceramidase) (GBA), 2565.2454 2.1957987 transcript variant 3, mRNA. 2370438 NM_000014.4 A2M Homo sapiens alpha-2-macroglobulin 220.53274 2.1949574 (A2M), mRNA. 4850450 NM_014618.2 DBC1 Homo sapiens deleted in bladder 339.97124 2.1888818 cancer 1 (DBC1), mRNA. 6650482 NM_004438.3 EPHA4 Homo sapiens EPH receptor A4 376.07906 2.1882828 (EPHA4), mRNA. Homo sapiens phospholipid transfer 4260215 NM_006227.2 PLTP protein (PLTP), transcript variant 1, 1312.8142 2.1802159 mRNA. Homo sapiens D site of albumin 7050458 NM_001352.2 DBP promoter (albumin D-box) binding 274.8646 2.1669633 protein (DBP), mRNA. 7320494 NM_153813.2 ZFPM1 Homo sapiens zinc finger protein, 1399.4174 2.1626504 multitype 1 (ZFPM1), mRNA. 6100468 NM_002522.2 NPTX1 Homo sapiens neuronal pentraxin I 1317.4451 2.1541729 (NPTX1), mRNA. 60452 NM_015973.3 GAL Homo sapiens galanin prepropeptide 823.87847 2.1532746 (GAL), inRNA. 2900139 NM_017842.1 FLJ20489 Homo sapiens hypothetical protein 529.91165 2.152888 FLJ20489 (FLJ20489), mRNA. 3990561 NM_002347.2 LY6H Homo sapiens lymphocyte antigen 6 237.51681 2.1461428 complex, locus H (LY6H), mRNA. Homo sapiens heart and neural crest 4640563 NM_021973.2 HAND2 derivatives expressed 2 (HAND2), 265.44882 2.1457284 mRNA. Homo sapiens mitochondrial ribosomal 6940521 NM_032112.2 MRPL43 protein L43 (MRPL43), nuclear gene 1148.5529 2.1442563 encoding mitochondrial protein, transcript variant 1, mRNA. Homo sapiens SPARC related modular 840008 NM_001034852.1 SMOCI calcium binding 1 (SMOCI), transcript 246.98503 2.1417404 variant 1, mRNA. 264 WO 2011/150105 PCT/US2011/037969 Homo sapiens glutathione peroxidase 4 2600382 NM_001039847.1 GPX4 (phospholipid hydroperoxidase) 10679.388 2.1408968 (GPX4), transcript variant 2, mRNA. Homo sapiens retinoic acid receptor 1010132 NM_002888.2 RARRESI responder (tazarotene induced) 1 516.06165 2.1328194 (RARRES 1), transcript variant 2, mRNA. Homo sapiens angiotensin I converting 3830398 NM_000789.2 ACE enzyme (peptidyl-dipeptidase A) 1 122.39248 2.1267258 (ACE), transcript variant 1, mRNA. Homo sapiens ADAM 1440224 NM_025220.2 ADAM33 metallopeptidase domain 33 168.1132 2.106327 (ADAM33), transcript variant 1, mRNA. 5670465 NM_001124.1 ADM Homo sapiens adrenomedullin (ADM), 15246.368 2.091425 mRNA. Homo sapiens proteasome (prosome, 7210326 NM_004159.4 PSMB8 macropain) subunit, beta type, 8 (large 1757.9959 2.0792649 multifunctional peptidase 7) (PSMB38), transcript variant 1, mRNA. 1820300 NM_001334.2 CTSO Homo sapiens cathepsin 0 (CTSO), 847.01106 2.0584265 mRNA. Homo sapiens sarcoglycan, delta 4490563 NM_172244.2 SGCD (35kDa dystrophin-associated 148.03643 2.0576467 glycoprotein) (SGCD), transcript variant 2, mRNA. 7510551 NM_024913.3 FLJ21986 Homo sapiens hypothetical protein 899.86519 2.0429926 FLJ2 1986 (FLJ2 1986), mRNA. 2480364 NM_013379.2 DPP7 Homo sapiens dipeptidyl-peptidase 7 1082.178 2.036927 (DPP7), mRNA. Homo sapiens tumor necrosis factor 6840020 NM_006573.3 TNFSF13B (ligand) superfamily, member 13b 190.87861 2.036255 (TNFSF13B), mRNA. Homo sapiens insulin-like growth 7510414 NM_001552.2 IGFBP4 factor binding protein 4 (IGFBP4), 14152.081 2.0243596 mRNA. 6620121 NM_005623.2 CCL8 Homo sapiens chemokine (C-C motif) 156.07345 2.022286 ligand 8 (CCL8), mRNA. Homo sapiens Clq and tumor necrosis 5090079 NM_198594.1 C1QTNF1 factor related protein 1 (C1QTNF1), 1723.9373 2.0193724 mRNA. Homo sapiens ADAMTS-like 1 6180209 NM_052866.3 ADAMTSL1 (ADAMTSL1), transcript variant 2, 147.55206 2.0136186 mRNA. 2350044 NM_000236.1 LIPC Homo sapiens lipase, hepatic (LIPC), 103.39897 2.0125544 IIRNA. Homo sapiens dullard homolog 3290672 NM_015343.3 DULLARD (Xenopus laevis) (DULLARD), 724.30398 2.0119449 mRNA. 540075 NM_006432.3 NPC2 Homo sapiens Niemann-Pick disease, 25120.052 2.0111172 type C2 (NPC2), mRNA. Homo sapiens colony stimulating 4640048 NM_172212.1 CSF1 factor 1 (macrophage) (CSF1), 134.28459 2.0086846 transcript variant 4, mRNA. Homo sapiens platelet-derived growth 7200168 NM_006207.1 PDGFRL factor receptor-like (PDGFRL), 2609.8069 2.0036434 mRNA. ASC-1 P4 Adipose derived mesenchymal stem cells ProbelD RefSeqjID Symbol Definition RFU Fold over -- Ave 265 WO 2011/150105 PCT/US2011/037969 Homo sapiens WNT1 inducible 4120553 NM_003881.2 WISP2 signaling pathway protein 2 (WISP2), 21642.052 76.151105 mRNA. 1430278 NM_000396.2 CTSK Homo sapiens cathepsin K (CTSK), 21334.193 24.396502 IIRNA. 7150634 NM_001647.2 APOD Homo sapiens apolipoprotein D 18527.698 23.513671 (APOD), mRNA. Homo sapiens dipeptidyl-peptidase 4 4830255 NM_001935.3 DPP4 (CD26, adenosine deaminase 1896.4149 18.071981 complexing protein 2) (DPP4), mRNA. 770156 NM_203422.1 LOC221091 Homo sapiens similar to hypothetical 1309.0147 17.421906 protein (L0C221091), mRNA. 6480040 NM_153703.3 PODN Homo sapiens podocan (PODN), 5392.0814 14.388289 mRNA. Homo sapiens serpin peptidase inhibitor, clade G (C1 inhibitor), 2030309 NM_001032295.1 SERPINGI member 1, (angioedema, hereditary) 6141.2795 13.559454 (SERPINGI), transcript variant 2, mRNA. 70167 NM_015364.2 LY96 Homo sapiens lymphocyte antigen 96 3722.3932 13.077906 (LY96), mRNA. Homo sapiens chromosome 20 open 1690201 NM_182519.1 C20orf186 reading frame 186 (C20orf186), 602.34189 11.141457 mRNA. 3830465 NM_001645.3 APOCI Homo sapiens apolipoprotein C-I 2269.0869 11.027545 (APOCI), inRNA. Homo sapiens ectonucleotide 2490152 NM_001040092.1 ENPP2 pyrophosphatase/phosphodiesterase 2 2355.6105 10.308967 (autotaxin) (ENPP2), transcript variant 2, mRNA. 3930020 NM_003793.2 CTSF Homo sapiens cathepsin F (CTSF), 1645.4088 9.8992517 IIRNA. Homo sapiens ectonucleotide 840678 NM_001040092.1 ENPP2 pyrophosphatase/phosphodiesterase 2 2946.2733 9.7227903 (autotaxin) (ENPP2), transcript variant 2, mRNA. 3890095 NM_003102.2 SOD3 Homo sapiens superoxide dismutase 3' 1069.0412 9.6236269 extracellular (SOD3), mRNA. 5340358 NM_000504.3 F1O Homo sapiens coagulation factor X 991.12168 9.4663588 (FlO), mRNA. Homo sapiens FXYD domain 5860022 NM_021902.2 FXYD1 containing ion transport regulator 1 762.35634 8.3053558 (phospholemman) (FXYD1), transcript variant b, mRNA. Homo sapiens family with sequence 2810373 NM_017565.2 FAM20A similarity 20, member A (FAM20A), 681.47891 8.2791029 mRNA. 5490019 NM_002084.3 GPX3 Homo sapiens glutathione peroxidase 3 2825.2081 8.1182901 (plasma) (GPX3), mRNA. Homo sapiens complement component 7400707 NM_001734.2 CiS 1, s subcomponent (CIS), transcript 8283.9748 7.8779708 variant 1, mRNA. 2710735 NM_016084.3 RASD1 Homo sapiens RAS, dexamethasone- 2167.7979 7.5606498 induced 1 (RASD1), mRNA. Homo sapiens CUG triplet repeat, 5390575 NM_006561.2 CUGBP2 RNA binding protein 2 (CUGBP2), 482.87087 7.0726113 transcript variant 2, mRNA. Homo sapiens transforming growth 3190379 NM_003243.2 TGFBR3 factor, beta receptor III (TGFBR3), 3427.7982 6.9193613 mRNA. 266 WO 2011/150105 PCT/US2011/037969 7650672 NM_012098.2 ANGPTL2 Homo sapiens angiopoietin-like 2 7062.4838 6.8512682 (ANGPTL2), mRNA. 5260474 NM_001733.4 CIR Homo sapiens complement component 5688.735 6.8439371 1, r subcomponent (CIR), mRNA. Homo sapiens FXYD domain 3850500 NM_005031.3 FXYD1 containing ion transport regulator 1 641.20413 6.8231977 (phospholemman) (FXYD1), transcript variant a, mRNA. 5550719 NM_133503.2 DCN Homo sapiens decorin (DCN), 8485.8577 6.6686193 transcript variant A2, mRNA. Homo sapiens N-acetylated alpha 4120626 NM_005468.2 NAALADL1 linked acidic dipeptidase-like 1 586.88024 6.4028604 (NAALADL1), mRNA. 6940053 NM_014917.2 NTNG1 Homo sapiens netrin GI (NTNG1), 762.91814 6.3001278 transcript variant 3, mRNA. 3370162 NM 006108.2 SPONI Homo sapiens spondin 1, extracellular 863.75627 6.1991677 matrix protein (SPONI), mRNA. 1510181 NM_004878.3 PTGES Homo sapiens prostaglandin E 3849.0354 6.1570059 synthase (PTGES), mRNA. Homo sapiens complement component 1300327 NM_201442.1 CiS 1, s subcomponent (CIS), transcript 1057.7951 6.149876 variant 2, mRNA. Homo sapiens prostaglandin 12 7150762 NM_000961.3 PTGIS (prostacyclin) synthase (PTGIS), 4944.818 5.5597425 mRNA. Homo sapiens phospholipase A2, 4860152 NM_000300.2 PLA2G2A group HA (platelets, synovial fluid) 541.90324 5.5402353 (PLA2G2A), mRNA. 3060639 NM_003013.2 SFRP2 Homo sapiens secreted frizzled-related 5419.1733 5.4266376 protein 2 (SFRP2), mRNA. 1190142 NM_032048.2 EMILIN2 Homo sapiens elastin microfibril 1660.2335 5.2918225 interfacer 2 (EMEIIN2), mRNA. Homo sapiens serpin peptidase inhibitor, clade G (C1 inhibitor), 3450538 NM_000062.2 SERPINGI member 1, (angioedema, hereditary) 404.94912 5.0161714 (SERPINGI), transcript variant 1, mRNA. Homo sapiens X-prolyl 4780544 NM_003399.5 XPNPEP2 aminopeptidase (aminopeptidase P) 2, 459.00265 4.9963695 membrane-bound (XPNPEP2), mRNA. 670594 NM_000063.3 C2 Homo sapiens complement component 391.23709 4.9094594 2 (C2), mRNA. Homo sapiens lymphotoxin beta 4640064 NM_002342.1 LTBR receptor (TNFR superfamily, member 2973.404 4.7989418 3) (LTBR), mRNA. 580739 NM_001996.2 FBLN1 Homo sapiens fibulin 1 (FBLN1), 11107.818 4.7912997 transcript variant C, mRNA. Homo sapiens serpin peptidase 6290356 NM_002615.4 SERPINFI inhibitor, clade F (alpha-2 antiplasmin, 3536.0537 4.7416963 pigment epithelium derived factor), member 1 (SERPINFI), mRNA. Homo sapiens proteoglycan 2, bone 3840072 NM_002728.4 PRG2 marrow (natural killer cell activator, 326.35059 4.6654051 eosinophil granule major basic protein) (PRG2), mRNA. 2810673 NM_152739.3 HOXA9 Homo sapiens homeobox A9 657.02493 4.6431905 (HOXA9), mRNA. 267 WO 2011/150105 PCT/US2011/037969 6040494 NM_006487.2 FBLN1 Homo sapiens fibulin 1 (FBLN1), 5832.8319 4.4909371 transcript variant A, mRNA. Homo sapiens retinoic acid receptor 5290608 NM_002889.2 RARRES2 responder (tazarotene induced) 2 5199.3549 4.3860819 (RARRES2), mRNA. 7330477 NM_173078.2 SLITRK4 Homo sapiens SLIT and NTRK-like 537.24122 4.3165564 family, member 4 (SLJTRK4), mRNA. 1980288 NM_004390.2 CTSH Homo sapiens cathepsin H (CTSH), 1654.7553 4.2476712 transcript variant 1, mRNA. Homo sapiens insulin-like growth 7380719 NM_002178.2 IGFBP6 factor binding protein 6 (IGFBP6), 15078.149 4.1940663 mRNA. 4290037 NM_002514.2 NOV Homo sapiens nephroblastoma 912.84027 4.1578559 overexpressed gene (NOV), mRNA. 6100468 NM_002522.2 NPTX1 Homo sapiens neuronal pentraxin I 2520.9232 4.1219967 (NPTX1), mRNA. 4010181 NM_000804.2 FOLR3 Homo sapiens folate receptor 3 324.24779 4.0958902 (gamma) (FOLR3), mRNA. Homo sapiens Clq and tumor necrosis 7320204 NM_015645.2 C1QTNF5 factor related protein 5 (C1QTNF5), 1728.7556 4.0409875 mRNA. 2100767 NM_130386.1 COLEC12 Homo sapiens collectin sub-family 6061.4093 3.9572515 member 12 (COLEC12), mRNA. 830324 NM_001459.2 FLT3LG Homo sapiens fins-related tyrosine 495.57124 3.9328936 kinase 3 ligand (FLT3LG), mRNA. Homo sapiens matrix metallopeptidase 510736 NM_004530.2 MMP2 2 (gelatinase A, 72kDa gelatinase, 1690.9984 3.92204 72kDa type IV collagenase) (MMP2), mRNA. 6020682 NM_020211.1 RGMA Homo sapiens RGM domain family, 1121.2869 3.9179493 member A (RGMA), inRNA. 4480468 NM_000929.2 PLA2G5 Homo sapiens phospholipase A2, 217.20767 3.878866 group V (PLA2GS), mRNA. 2360020 NM_013402.3 FADS1 Homo sapiens fatty acid desaturase 1 4305.8224 3.8383918 (FADS 1), mRNA. 6550762 NM_001998.2 FBLN2 Homo sapiens fibulin 2 (FBLN2), 7286.5743 3.8207737 transcript variant 2, mRNA. 4890270 NM_002346.1 LY6E Homo sapiens lymphocyte antigen 6 8579.1652 3.8202158 complex, locus E (LY6E), mRNA. Homo sapiens regeneration associated 7320669 NM_015430.2 DKFZP586H2123 muscle protease (DKFZP586H2123), 8371.1493 3.7684837 transcript variant 1, mRNA. Homo sapiens ADAMTS-like 1 5890326 NM_052866.3 ADAMTSL1 (ADAMTSL1), transcript variant 2, 530.33953 3.7501613 mRNA. Homo sapiens collagen, type VI, alpha 2470114 NM_004369.2 COL6A3 3 (COL6A3), transcript variant 1, 12634.643 3.7422891 mRNA. 990458 NM_003062.1 SLIT3 Homo sapiens slit homolog 3 1003.8014 3.7276743 1 (Drosophila) (SLIT3), mRNA. 3830075 NM_001218.3 CA12 Homo sapiens carbonic anhydrase XII 1180.4296 3.723098 (CA12), transcript variant 1, mRNA. 2370438 NM_000014.4 A2M Homo sapiens alpha-2-macroglobulin 373.38584 3.7163008 (A2M), mRNA. 7650497 NM_001972.2 ELA2 Homo sapiens elastase 2, neutrophil 250.37404 3.7103888 (ELA2), mRNA. 7510113 NM_033254.2 BOC Homo sapiens Boc homolog (mouse) 312.01298 3.5894955 (BOC), mRNA. 268 WO 2011/150105 PCT/US2011/037969 Homo sapiens sulfide quinone 6770707 NM_021199.2 SQRDL reductase-like (yeast) (SQRDL), 1016.9034 3.5632854 mRNA. Homo sapiens collagen, type VI, alpha 6250192 NM_057165.2 COL6A3 3 (COL6A3), transcript variant 3, 19176.664 3.5078019 mRNA. 730414 NM_000041.2 APOE Homo sapiens apolipoprotein E 8508.4919 3.4272343 (APOE), mRNA. Homo sapiens reversion-inducing 3390487 NM_021111.1 RECK cysteine-rich protein with kazal motifs 1396.6311 3.4069949 (RECK), mRNA. 6420008 NM_000313.1 PROSI Homo sapiens protein S (alpha) 2919.6888 3.3364982 (PROS I), mRNA. 150474 NM_001218.3 CA12 Homo sapiens carbonic anhydrase XII 4216.406 3.3178176 (CA12), transcript variant 1, mRNA. Homo sapiens ADP-ribosylhydrolase 3390735 NM_199162.1 ADPRHL1 like 1 (ADPRHL1), transcript variant 309.95531 3.2829634 2, mRNA. 7330292 NM_001998.2 FBLN2 Homo sapiens fibulin 2 (FBLN2), 6650.5519 3.2686615 transcript variant 2, mRNA. Homo sapiens agouti signaling protein, 3460474 NM_001672.2 ASIP nonagouti homolog (mouse) (ASIP), 225.32264 3.2352639 mRNA. Homo sapiens acyl-CoA synthetase 7040286 NM_016234.3 ACSL5 long-chain family member 5 (ACSL5), 304.27839 3.2133919 transcript variant 1, mRNA. Homo sapiens sterol regulatory 3390343 NM_001005291.1 SREBF1 element binding transcription factor 1 896.9767 3.1893166 (SREBF1), transcript variant 1, mRNA. Homo sapiens chemokine (C-X-C 4610615 NM_000609.4 CXCL12 motif) ligand 12 (stromal cell-derived 8702.0709 3.1803415 factor 1) (CXCL12), transcript variant 2, mRNA. 2680072 NM_014279.4 OLFM1 Homo sapiens olfactomedin 1 492.79971 3.1513843 (OLFM1), transcript variant 1, mRNA.49.97 31583 Homo sapiens ribonuclease, RNase A 6590041 NM_194431.1 RNASE4 family, 4 (RNASE4), transcript variant 5056.0653 3.0919947 3, mRNA. 4480292 NM_002781.2 PSG5 Homo sapiens pregnancy specific beta- 169.01755 3.0910629 1-glycoprotein S (PSGS), mRNA. 5890288 NM_003377.3 VEGFB Homo sapiens vascular endothelial 1346.5192 3.0529504 growth factor B (VEGFB), mRNA. Homo sapiens sarcoglycan, delta 2450327 NM_172244.2 SGCD (35kDa dystrophin-associated 359.30229 3.0161276 glycoprotein) (SGCD), transcript variant 2, mRNA. 6980541 NM_003255.4 TIMP2 Homo sapiens TIMP metallopeptidase 1592.892 2.9798982 inhibitor 2 (TJIP2), mRNA. Homo sapiens alanyl (membrane) aminopeptidase (aminopeptidase N, 5810612 NM_001150.1 ANPEP aminopeptidase M, microsomal 2493.3482 2.978874 aminopeptidase, CD13, p150) (ANPEP), mRNA. 10768 NM_004737.3 LARGE Homo sapiens like-glycosyltransferase 1471.9015 2.9330756 (LARGE), transcript variant 1, mRNA. Homo sapiens D site of albumin 7050458 NM_001352.2 DBP promoter (albumin D-box) binding 370.96327 2.9245811 protein (DBP), mRNA. 269 WO 2011/150105 PCT/US2011/037969 Homo sapiens procollagen C 4810445 NM_013363.2 PCOLCE2 endopeptidase enhancer 2 1622.9176 2.9108428 (PCOLCE2), mRNA. Homo sapiens extracellular matrix 3440386 NM_004425.2 ECM1 protein 1 (ECM1), transcript variant 1, 1349.1923 2.8815094 mRNA. Homo sapiens ribonuclease, RNase A 7040333 NM_194430.1 RNASE4 family, 4 (RNASE4), transcript variant 1195.2953 2.869694 1, mRNA. Homo sapiens chemokine (C-X-C 4560020 NM_199168.2 CXCL12 motif) ligand 12 (stromal cell-derived 15965.421 2.84625 factor 1) (CXCL12), transcript variant 1, mRNA. 5090626 NM_004460.2 FAP Homo sapiens fibroblast activation 4458.1727 2.8384041 protein, alpha (FAP), mRNA. Homo sapiens fibroblast growth factor 5560138 NM_002009.2 FGF7 7 (keratinocyte growth factor) (FGF7), 164.41283 2.782522 mRNA. 5690095 NM_004962.2 GDF1O Homo sapiens growth differentiation 433.91372 2.7660331 factor 10 (GDF1O), mRNA. 3990561 NM_002347.2 LY6H Homo sapiens lymphocyte antigen 6 302.89823 2.736913 complex, locus H (LY6H), mRNA. Homo sapiens follicular lymphoma 160537 NM_002035.1 FVT1 variant translocation 1 (FVT1), 1874.505 2.725423 mRNA. 4830685 NM_006486.2 FBLN1 Homo sapiens fibulin 1 (FBLN1), 14371.405 2.6755708 transcript variant D, mRNA. Homo sapiens interleukin 15 receptor, 940356 NM_002189.2 IL15RA alpha (IL15RA), transcript variant 1, 175.65251 2.652823 mRNA. Homo sapiens laminin, alpha 2 1470296 NM_000426.3 LAMA2 (merosin, congenital muscular 510.69292 2.6420185 dystrophy) (LAMA2), transcript variant 1, mRNA. Homo sapiens mannan-binding lectin 4050326 NM_139125.2 MASPI seine peptidase 1 (C4/C2 activating 311.08923 2.6339955 component of Ra-reactive factor) (MASP1), transcript variant 2, mRNA. Homo sapiens retinoic acid receptor 2340681 NM_206963.1 RARRESI responder (tazarotene induced) 1 1127.9347 2.6320087 (RARRESI), transcript variant 1, mRNA. Homo sapiens sterol regulatory 6840044 NM_004176.3 SREBF1 element binding transcription factor 1 346.0646 2.6239459 (SREBF1), transcript variant 2, mRNA. Homo sapiens ribonuclease, RNase A 5910382 NM_194430.1 RNASE4 family, 4 (RNASE4), transcript variant 1888.2673 2.6238553 1, mRNA. 7400735 NM_002345.3 LUM Homo sapiens lumican (LUM), 1196.7127 2.6230783 mRNA. Homo sapiens complement component 5810424 NM_016546.1 CIRL 1, r subcomponent-like (C1RL), 1141.281 2.6112483 mRNA. 2190113 NM_005559.2 LAMA1 Homo sapiens lamnin, alpha 1 357.87375 2.5868651 (LAMAl), mRNA. Homo sapiens collagen, type VI, alpha 3390458 NM_001849.3 COL6A2 2 (COL6A2), transcript variant 2C2, 11581.945 2.5826464 mRNA. Homo sapiens collagen, type VI, alpha 2750356 NM_001849.3 COL6A2 2 (COL6A2), transcript variant 2C2, 7000.5994 2.5642047 mRNA. 270 WO 2011/150105 PCT/US2011/037969 4900133 NM_006307.3 SRPX Homo sapiens sushi-repeat-containing 13794.697 2.5635383 protein, X-linked (SRPX), mRNA. Homo sapiens extracellular matrix 6840192 NM_001393.2 ECM2 protein 2, female organ and adipocyte 734.69086 2.562577 specific (ECM2), mRNA. Homo sapiens lipase A, lysosomal 5360148 NM_000235.2 LIPA acid, cholesterol esterase (Wolman 3124.5562 2.5623903 disease) (LIPA), mRNA. Homo sapiens 6 4640079 NM_012088.2 PGLS phosphogluconolactonase (PGLS), 5216.8513 2.5535816 mRNA. Homo sapiens tumor necrosis factor 1090747 NM_003809.2 TNFSF12 (ligand) superfamily, member 12 904.39646 2.5468886 (TNFSF12), mRNA. 240274 NM_000877.2 ILIRI Homo sapiens interleukin 1 receptor, 439.38584 2.5374689 type I (RLIRI), mRNA. 3800204 NM_006334.3 OLFM1 Homo sapiens olfactomedin 1 231.95664 2.5308321 (OLFM1), transcript variant 2, mRNA. 50368 NM_001920.3 DCN Homo sapiens decorin (DCN), 6106.4316 2.5281036 transcript variant Al, mRNA. 2510441 NM_024682.1 TBC1D17 Homo sapiens TBC1 domain family, 483.66586 2.5189698 member 17 (TBC1D17), mRNA. Homo sapiens regeneration associated 5670543 NM_015430.2 DKFZP586H2123 muscle protease (DKFZP586H2123), 225.32264 2.5159215 transcript variant 1, mRNA. 3830022 NM_019101.2 APOM Homo sapiens apolipoprotein M 357.50361 2.5102672 (APOM), mRNA. Homo sapiens angiogenin, 3930392 NM_001097577.1 ANG ribonuclease, RNase A family, 5 2311.6676 2.5054772 (ANG), transcript variant 2, mRNA. 670608 NM_013379.2 DPP7 Homo sapiens dipeptidyl-peptidase 7 843.53945 2.4668691 (DPP7), mRNA. 4230343 NM_001871.2 CPB1 Homo sapiens carboxypeptidase B1 180.96888 2.4589965 (tissue) (CPB 1), mRNA. Homo sapiens cytochrome P450, 6200068 NM_000786.2 CYP51A1 family 51, subfamily A, polypeptide 1 518.45914 2.4487353 (CYP51A1), mRNA. 60452 NM_015973.3 GAL Homo sapiens galanin prepropeptide 936.32906 2.4471735 (GAL), mRNA. Homo sapiens glutathione peroxidase 4 2600382 NM_001039847.1 GPX4 (phospholipid hydroperoxidase) 12107.229 2.4271361 (GPX4), transcript variant 2, mRNA. Homo sapiens ADAM 1440224 NM_025220.2 ADAM33 metallopeptidase domain 33 191.93068 2.4047414 (ADAM33), transcript variant 1, mRNA. Homo sapiens dolichyl-phosphate 2850520 NM_018973.3 DPM3 mannosyltransferase polypeptide 3 2213.2993 2.4045104 (DPM3), transcript variant 1, mRNA. 7510551 NM_024913.3 FLJ21986 Homo sapiens hypothetical protein 1046.4021 2.37568 FLJ2 1986 (FLJ2 1986), mRNA. 6370369 NM_001040021.1 CD14 Homo sapiens CD14 molecule (CD14), 256.01888 2.3741371 transcript variant 2, mRNA. Homo sapiens ST6 (alpha-N-acetyl neuraminyl-2,3-beta-galactosyl-1, 3) 3780608 NM_013443.3 ST6GALNAC6 N-acetylgalactosaminide alpha-2,6- 1665.9712 2.3688438 sialyltransferase 6 (ST6GALNAC6), mRNA. 271 WO 2011/150105 PCT/US2011/037969 Homo sapiens extracellular matrix 3450521 NM_022664.1 ECM1 protein 1 (ECM1), transcript variant 2, 1272.9947 2.366821 mRNA. 1710484 NM_002023.3 FMOD Homo sapiens fibromodulin (FMOD), 566.56925 2.3636287 mRNA. 5130435 NM_002290.2 LAMA4 Homo sapiens laminin, alpha 4 894.43997 2.3631285 (LAMA4), mRNA. Homo sapiens SLIT-ROBO Rho 2470220 NM_020762.1 SRGAP1 GTPase activating protein 1 776.40324 2.3613627 (SRGAP1), mRNA. Homo sapiens chromosome 5 open 1690240 NM_032385.3 C5orf4 reading frame 4 (C5orf4), transcript 500.64218 2.3415926 variant 2, mRNA. 5670594 NM_021077.3 NMB Homo sapiens neuromedin B (NMB), 1133.0381 2.3316446 transcript variant 1, mRNA. 7650296 NM_133505.2 DCN Homo sapiens decorin (DCN), 29729.883 2.3284422 transcript variant C, mRNA. Homo sapiens glutathione peroxidase 4 6520128 NM_001039847.1 GPX4 (phospholipid hydroperoxidase) 23635.518 2.3115156 (GPX4), transcript variant 2, mRNA. 5090671 NM_004864.1 GDF15 Homo sapiens growth differentiation 1907.9462 2.3060485 1 factor 15 (GDF1S), mRNA. 5960398 NM_002526.1 NT5E Homo sapiens 5-nucleotidase, ecto 1900.9569 2.2884219 (CD73) (NTSE), mRNA. Homo sapiens FXYD domain 1400091 NM_005031.3 FXYD1 containing ion transport regulator 1 169.21976 2.265019 (phospholemman) (FXYD1), transcript variant a, mRNA. Homo sapiens parathyroid hormone 6900414 NM_198965.1 PTHLH like hormone (PTHLH), transcript 689.50568 2.2428123 variant 1, mRNA. Homo sapiens syntrophin, beta 1 3420739 NM_021021.2 SNTB1 (dystrophin-associated protein Al, 761.64491 2.2291804 S9kDa, basic component 1) (SNTB 1), mRNA. 780025 NM_001004019.1 FBLN2 Homo sapiens fibulin 2 (FBLN2), 128.34646 2.2095025 transcript variant 1, mRNA. Homo sapiens AU RNA binding 7330180 NM_001698.1 AUH protein/enoyl-Coenzyme A hydratase 584.86519 2.2091909 (AUH), nuclear gene encoding mitochondrial protein, mRNA. 6650482 NM_004438.3 EPHA4 Homo sapiens EPH receptor A4 379.48112 2.2080783 (EPHA4), mnRNA. Homo sapiens family with sequence 1940274 NM_032036.2 FAM14A similarity 14, member A (FAM14A), 1711.1811 2.2051728 mRNA. 3990563 NM_002171.1 IFNA1O Homo sapiens interferon, alpha 10 157.19683 2.1995706 (JFNA1O), mRNA. Homo sapiens dolichyl-phosphate 7320435 NM_153741.1 DPM3 mannosyltransferase polypeptide 3 2561.1535 2.1910796 (DPM3), transcript variant 2, mRNA. Homo sapiens retinoic acid receptor 1010132 NM_002888.2 RARRESI responder (tazarotene induced) 1 528.65369 2.1848607 (RARRES 1), transcript variant 2, mRNA. Homo sapiens N-sulfoglucosamine 1340538 NM_000199.2 SGSH sulfohydrolase (sulfamidase) (SGSH), 2855.0425 2.1786862 mRNA. 2480364 NM_013379.2 DPP7 Homo sapiens dipeptidyl-peptidase 7 1146.4945 2.1579866 (DPP7), mRNA. 272 WO 2011/150105 PCT/US2011/037969 1820300 NM_001334.2 CTSO Homo sapiens cathepsin 0 (CTSO), 887.74425 2.1574173 mRNA. Homo sapiens ADAM 3420025 NM_153202.1 ADAM33 metallopeptidase domain 33 155.63555 2.1259739 (ADAM33), transcript variant 2, mRNA. Homo sapiens major histocompatibility 2570564 NM_019111.3 HLA-DRA complex, class II, DR alpha (HLA- 207.06283 2.1159501 DRA), mRNA. Homo sapiens mannan-binding lectin 580360 NM_001031849.1 MASPI serine peptidase 1 (C4/C2 activating 192.53451 2.1052939 component of Ra-reactive factor) (MASP1), transcript variant 3, mRNA. Homo sapiens ATP-binding cassette, 3990441 NR_003087.1 ABCC13 sub-family C (CFTR/MRP), member 151.38319 2.1014514 13 (ABCC13) on chromosome 21. XR_017987 XR_017988 XR_017989 4570242 NM_133642.2 LARGE Homo sapiens like-glycosyltransferase 339.37625 2.075886 (LARGE), transcript variant 2, mRNA. 4850450 NM_014618.2 DBC1 Homo sapiens deleted in bladder 322.31106 2.075178 cancer 1 (DBC1), mRNA. Homo sapiens laminin, alpha 2 360181 NM_001079823.1 LAMA2 stroph ) eal )str 424.2323 2.0739721 dystrophy) (LAMA2), transcript variant 2, mRNA. Homo sapiens beta-site APP-cleaving 1240201 NM_138991.1 BACE2 enzyme 2 (BACE2), transcript variant 452.80059 2.0656923 c, mRNA. Homo sapiens phospholipid transfer 5690519 NM_182676.1 PLTP protein (PLTP), transcript variant 2, 5456.904 2.0622235 mRNA. Homo sapiens CUG triplet repeat, 2320162 NM_001025076.2 CUGBP2 RNA binding protein 2 (CUGBP2), 141.21335 2.0544027 transcript variant 1, mRNA. Homo sapiens dullard homolog 3290672 NM_015343.3 DULLARD (Xenopus laevis) (DULLARD), 729.68496 2.0268919 mRNA. Homo sapiens low density lipoprotein 2710286 NM_002332.2 LRP1 related protein 1 (alpha-2- 492.3118 2.020679 macroglobulin receptor) (LRP1), mRNA. 1850372 NM_000915.2 OXT Homo sapiens oxytocin, prepro- 140.96003 2.0177091 (neurophysin 1) (OXT), mRNA. Homo sapiens carboxylesterase 2 3520372 NM_003869.4 CES2 (intestine, liver) (CES2), transcript 1720.9615 2.0173667 variant 1, mRNA. 4060333 NM_003377.3 VEGFB Homo sapiens vascular endothelial 12210.763 2.0144895 growth factor B (VEGFB), mRNA. 4210228 NM_000940.1 PON3 Homo sapiens paraoxonase 3 (PON3), 113.41814 2.0089481 mRNA. Homo sapiens CUG triplet repeat, 7400133 NM_001025077.2 CUGBP2 RNA binding protein 2 (CUGBP2), 129.70966 2.0077558 transcript variant 3, mRNA. ASCi P8 Chondro ctri ProbelD RefSeq_ID Symbol Definition RFU Fold over Homo sapiens WNT1 inducible 4120553 NM_003881.2 WISP2 signaling pathway protein 2 (WISP2), 10419.73 36.663526 mRNA. 273 WO 2011/150105 PCT/US2011/037969 Homo sapiens dipeptidyl-peptidase 4 4830255 NM_001935.3 DPP4 (CD26, adenosine deaminase 2062.6271 19.655909 complexing protein 2) (DPP4), mRNA. 3890095 NM_003102.2 SOD3 Homo sapiens superoxide dismutase 3' 1892.8861 17.039971 extracellular (SOD3), mRNA. 1430278 NM_000396.2 CTSK Homo sapiens cathepsin K (CTSK), 13529.286 15.471279 mRNA. 70167 NM_015364.2 LY96 Homo sapiens lymphocyte antigen 96 4305.8224 15.127671 (LY96), mRNA. Homo sapiens family with sequence 2810373 NM_017565.2 FAM20A similarity 20, member A (FAM20A), 1101.6819 13.384035 mRNA. 7150634 NM_001647.2 APOD Homo sapiens apolipoprotein D 9575.8774 12.152834 (APOD), mRNA. Homo sapiens ectonucleotide 2490152 NM_001040092.1 ENPP2 pyrophosphatase/phosphodiesterase 2 2757.585 12.068146 (autotaxin) (ENPP2), transcript variant 2, mRNA. Homo sapiens ectonucleotide 840678 NM_001040092.1 ENPP2 pyrophosphatase/phosphodiesterase 2 3536.0537 11.669083 (autotaxin) (ENPP2), transcript variant 2, mRNA. 3930020 NM_003793.2 CTSF Homo sapiens cathepsin F (CTSF), 1727.773 10.394778 IIRNA. 6940053 NM 014917.2 NTNG1 Homo sapiens netrin GI (NTNG1), 1175.1836 9.7045891 transcript variant 3, mRNA. Homo sapiens serpin peptidase inhibitor, clade G (C1 inhibitor), 2030309 NM_001032295.1 SERPINGI member 1, (angioedema, hereditary) 4317.4003 9.5324747 (SERPINGI), transcript variant 2, mRNA. 770156 NM_203422.1 LOC221091 Homo sapiens similar to hypothetical 706.34469 9.4008649 1 protein (L0C221091), mRNA. 2810673 NM_152739.3 HOXA9 Homo sapiens homeobox A9 1166.6873 8.244971 (HOXA9), mRNA. 3370162 NM 006108.2 SPONI Homo sapiens spondin 1, extracellular 1064.7677 7.6418241 matrix protein (SPONI), mRNA. Homo sapiens complement component 7400707 NM_001734.2 CiS 1, s subcomponent (CIS), transcript 7964.1763 7.5738458 variant 1, mRNA. 2710735 NM_016084.3 RASD1 Homo sapiens RAS, dexamethasone- 2135.6245 7.4484382 induced 1 (RASD1), mRNA. 5340358 NM_000504.3 F1O Homo sapiens coagulation factor X 753.68186 7.1985338 (FlO), mRNA. 3830075 NM_001218.3 CA12 Homo sapiens carbonic anhydrase XII 2128.3813 6.7129558 (CA12), transcript variant 1, mRNA. Homo sapiens transforming growth 3190379 NM_003243.2 TGFBR3 factor, beta receptor III (TGFBR3), 3273.137 6.6071618 mRNA. 5260474 NM_001733.4 CIR Homo sapiens complement component 5339.0529 6.4232457 1, r subcomponent (CIR), mRNA. 4280577 NM_001200.2 BMP2 Homo sapiens bone morphogenetic 1383.5751 6.1324167 protein 2 (BMP2), mRNA. 5550719 NM_133503.2 DCN Homo sapiens decorin (DCN), 7712.591 6.060947 transcript variant A2, mRNA. Homo sapiens procollagen C 4810445 NM_013363.2 PCOLCE2 endopeptidase enhancer 2 3265.1431 5.8563161 (PCOLCE2), mRNA. 274 WO 2011/150105 PCT/US2011/037969 Homo sapiens mannan-binding lectin 580360 NM_001031849.1 MASPI serine peptidase 1 (C4/C2 activating 519.86401 5.6845212 component of Ra-reactive factor) (MASP1), transcript variant 3, mRNA. 990458 NM_003062.1 SLIT3 Homo sapiens slit homolog 3 1506.3317 5.5938495 (Drosophila) (SLJT3), mRNA. Homo sapiens complement component 1300327 NM_201442.1 CiS 1, s subcomponent (CIS), transcript 942.50546 5.4795977 variant 2, mRNA. 1510181 NM_004878.3 PTGES Homo sapiens prostaglandin E 3315.4509 5.3034718 synthase (PTGES), mRNA. Homo sapiens reversion-inducing 3390487 NM_021111.1 RECK cysteine-rich protein with kazal motifs 2172.9114 5.3006825 (RECK), mRNA. Homo sapiens serpin peptidase 6290356 NM_002615.4 SERPINFI inhibitor, clade F (alpha-2 antiplasmin, 3916.6706 5.2520873 pigment epithelium derived factor), member 1 (SERPINFI), mRNA. Homo sapiens serpin peptidase inhibitor, clade G (C1 inhibitor), 3450538 NM_000062.2 SERPINGI member 1, (angioedema, hereditary) 420.64948 5.2106544 (SERPINGI), transcript variant 1, mRNA. Homo sapiens extracellular matrix 3440386 NM_004425.2 ECM1 protein 1 (ECM1), transcript variant 1, 2439.2568 5.2095919 mRNA. Homo sapiens fibroblast growth factor 5560138 NM_002009.2 FGF7 7 (keratinocyte growth factor) (FGF7), 300.07198 5.0784167 mRNA. Homo sapiens retinoic acid receptor 2340681 NM_206963.1 RARRESI responder (tazarotene induced) 1 2156.2206 5.0314895 (RARRES 1), transcript variant 1, mRNA. Homo sapiens retinoic acid receptor 1010132 NM_002888.2 RARRESI responder (tazarotene induced) 1 1198.1003 4.9516013 (RARRES 1), transcript variant 2, mRNA. Homo sapiens major histocompatibility 2570564 NM_019111.3 HLA-DRA complex, class II, DR alpha (HLA- 481.60273 4.9214401 DRA), mRNA. Homo sapiens matrix metallopeptidase 510736 NM_004530.2 MMP2 2 (gelatinase A, 72kDa gelatinase, 2097.356 4.8645311 72kDa type IV collagenase) (MMP2), mRNA. 240274 NM_000877.2 ILIRI Homo sapiens interleukin 1 receptor, 807.83982 4.6653037 type I (RLIRI), mRNA. 5130435 NM_002290.2 LAMA4 Homo sapiens lamnin, alpha 4 1754.9236 4.6365436 (LAMA4), mRNA. 6040494 NM_006487.2 FBLN1 Homo sapiens fibulin 1 (FBLN1), 5995.9971 4.6165647 transcript variant A, mRNA. Homo sapiens lymphotoxin beta 4640064 NM_002342.1 LTBR receptor (TNFR superfamily, member 2820.5214 4.5521961 3) (LTBR), mRNA. 2100767 NM_130386.1 COLEC12 Homo sapiens collectin sub-family 6970.2916 4.5506244 member 12 (COLEC12), mRNA. 7400735 NM_002345.3 LUM Homo sapiens lumican (LUM), 2074.8298 4.547826 mRNA. Homo sapiens prostaglandin 12 7150762 NM_000961.3 PTGIS (prostacyclin) synthase (PTGIS), 4006.333 4.50455 mRNA. 275 WO 2011/150105 PCT/US2011/037969 Homo sapiens insulin-like growth 7380719 NM_002178.2 IGFBP6 factor binding protein 6 (IGFBP6), 16065.361 4.4686646 mRNA. Homo sapiens ADAMTS-like 1 5890326 NM_052866.3 ADAMTSL1 (ADAMTSL1), transcript variant 2, 624.77507 4.4179382 mRNA. Homo sapiens N-acetylated alpha 4120626 NM_005468.2 NAALADL1 linked acidic dipeptidase-like 1 398.5208 4.3478599 (NAALADL1), mRNA. Homo sapiens D site of albumin 7050458 NM_001352.2 DBP promoter (albumin D-box) binding 546.36438 4.3073992 protein (DBP), mRNA. 150474 NM_001218.3 CA12 Homo sapiens carbonic anhydrase XII 5330.0074 4.1940914 (CA12), transcript variant 1, mRNA. 4890270 NM_002346.1 LY6E Homo sapiens lymphocyte antigen 6 9225.5096 4.1080264 complex, locus E (LY6E), mRNA. 3830465 NM_001645.3 APOCI Homo sapiens apolipoprotein C-I 844.04366 4.1019715 (APOCI), inRNA. 6980541 NM_003255.4 TIMP2 Homo sapiens TIMP metallopeptidase 2159.1524 4.039228 inhibitor 2 (TJIP2), mRNA. 5890288 NM_003377.3 VEGFB Homo sapiens vascular endothelial 1772.4016 4.0185497 growth factor B (VEGFB), mRNA. 5080543 NM_006528.2 TFPI2 Homo sapiens tissue factor pathway 1449.059 3.9860383 inhibitor 2 (TFPI2), mRNA. Homo sapiens FXYD domain 3850500 NM_005031.3 FXYD1 containing ion transport regulator 1 370.69167 3.9446136 (phospholemman) (FXYD1), transcript variant a, mRNA. Homo sapiens protein tyrosine 3850603 NM_002846.2 PTPRN phosphatase, receptor type, N 554.11571 3.9420254 (PTPRN), mRNA. Homo sapiens collagen, type VI, alpha 2470114 NM_004369.2 COL6A3 3 (COL6A3), transcript variant 1, 13094.317 3.878441 mRNA. Homo sapiens mannan-binding lectin 4050326 NM_139125.2 MASPI seine peptidase 1 (C4/C2 activating 453.16077 3.8369166 component of Ra-reactive factor) (MASP1), transcript variant 2, mRNA. Homo sapiens CD44 molecule (Indian 4560193 NM_001001392.1 CD44 blood group) (CD44), transcript variant 4952.8723 3.8018586 5, mRNA. Homo sapiens phospholipase A2, 4860152 NM_000300.2 PLA2G2A group IIA (platelets, synovial fluid) 368.69041 3.769366 (PLA2G2A), mRNA. Homo sapiens FXYD domain 5860022 NM_021902.2 FXYD1 containing ion transport regulator 1 344.13643 3.7491332 (phospholemman) (FXYD1), transcript variant b, mRNA. 4900133 NM_006307.3 SRPX Homo sapiens sushi-repeat-containing 20167.417 3.7478132 protein, X-linked (SRPX), mRNA. 2510441 NM_024682.1 TBC1D17 Homo sapiens TBC1 domain family, 715.25413 3.7250998 member 17 (TBC1D17), mRNA. 780025 NM_001004019.1 FBLN2 Homo sapiens fibulin 2 (FBLN2), 215.55914 3.7108812 transcript variant 1, mRNA. 6480040 NM_153703.3 PODN Homo sapiens podocan (PODN), 1387.5391 3.7025244 mRNA. 4010181 NM_000804.2 FOLR3 Homo sapiens folate receptor 3 292.59292 3.6960266 (gamma) (FOLR3), mRNA 276 WO 2011/150105 PCT/US2011/037969 Homo sapiens vitamin K epoxide 6450546 NM_024006.4 VKORC1 reductase complex, subunit 1 4867.6444 3.6576972 (VKORC1), transcript variant 1, mRNA. 5700201 NM_003377.3 VEGFB Homo sapiens vascular endothelial 330.58473 3.5658593 growth factor B (VEGFB), mRNA. Homo sapiens collagen, type VI, alpha 6250192 NM_057165.2 COL6A3 3 (COL6A3), transcript variant 3, 19176.664 3.5078019 mRNA. Homo sapiens core 1 synthase, 580066 NM_020156.1 CIGALTI glycoprotein-N-acetylgalactosamine 3- 552.2323 3.4988217 beta-galactosyltransferase, 1 (CIGALTI), mRNA. Homo sapiens sarcoglycan, delta 2450327 NM_172244.2 SGCD (35kDa dystrophin-associated 412.37375 3.4616307 glycoprotein) (SGCD), transcript variant 2, mRNA. 5960398 NM_002526.1 NT5E Homo sapiens 5-nucleotidase, ecto 2875.3429 3.4614134 (CD73) (NT5E), mRNA. 6100468 NM_002522.2 NPTX1 Homo sapiens neuronal pentraxin I 2061.2785 3.3704252 (NPTX1), mRNA. Homo sapiens T-box 3 (ulnar 7200195 NM_005996.3 TBX3 mammary syndrome) (TBX3), 748.70088 3.3490979 transcript variant 1, mRNA. Homo sapiens SLIT-ROBO Rho 2470220 NM_020762.1 SRGAP1 GTPase activating protein 1 1081.2357 3.288484 (SRGAP1), mRNA. 6620121 NM_005623.2 CCL8 Homo sapiens chemokine (C-C motif) 249.80516 3.2367932 ligand 8 (CCL8), mRNA. Homo sapiens regeneration associated 7320669 NM_015430.2 DKFZP586H2123 muscle protease (DKFZP586H2123), 7188.0348 3.2358749 transcript variant 1, mRNA. 2810255 NM_015989.3 CSAD Homo sapiens cysteine sulfinic acid 1090.4855 3.2308742 decarboxylase (CSAD), mRNA. 4290037 NM_002514.2 NOV Homo sapiens nephroblastoma 703.17168 3.2028457 overexpressed gene (NOV), mRNA. 70.16 32285 Homo sapiens alanyl (membrane) aminopeptidase (aminopeptidase N, 5810612 NM_001150.1 ANPEP aminopeptidase M, microsomal 2646.1994 3.1614896 aminopeptidase, CD13, p150) (ANPEP), mRNA. Homo sapiens low density lipoprotein 2710286 NM_002332.2 LRP1 related protein 1 (alpha-2- 766.73643 3.1470467 macroglobulin receptor) (LRP 1), mRNA. Homo sapiens parathyroid hormone 6900414 NM_198965.1 PTHLH like hormone (PTHLH), transcript 961.91209 3.1288913 variant 1, mRNA. Homo sapiens carboxylesterase 2 3850471 NM_003869.4 CES2 (intestine, liver) (CES2), transcript 446.19624 3.1111206 variant 1, mRNA. Homo sapiens ADAM 1440224 NM_025220.2 ADAM33 metallopeptidase domain 33 246.78997 3.0920855 (ADAM33), transcript variant 1, mRNA. Homo sapiens sema domain, 1580608 NM_012431.1 SEMA3E immunoglobulin domain (Ig), short 2317.8257 3.0460046 basic domain, secreted, (semaphorin) 3E (SEMA3E), mRNA. 277 WO 2011/150105 PCT/US2011/037969 Homo sapiens laminin, alpha 2 1470296 NM_000426.3 LAMA2 (merosin, congenital muscular 582.39041 3.0129383 dystrophy) (LAMA2), transcript variant 1, mRNA. 840392 NM_016297.2 PCYOX1 Homo sapiens prenylcysteine oxidase 3955.7942 3.0114146 1 (PCYOX1), mRNA. 4850450 NM_014618.2 DBC1 Homo sapiens deleted in bladder 465.76386 2.9987892 cancer 1 (DBC1), mRNA. 6550762 NM_001998.2 FBLN2 Homo sapiens fibulin 2 (FBLN2), 5718.701 2.9986467 transcript variant 2, mRNA. 580739 NM_001996.2 FBLN1 Homo sapiens fibulin 1 (FBLN1), 6925.3973 2.9872342 transcript variant C, mRNA. 10142 NM_006016.3 CD164 Homo sapiens CD164 molecule, 524.67205 2.9704992 sialomucin (CD164), mRNA. 5690095 NM_004962.2 GDF1O Homo sapiens growth differentiation 460.68886 2.9367144 factor 10 (GDF1O), mRNA. Homo sapiens angiotensin I converting 3830398 NM_000789.2 ACE enzyme (peptidyl-dipeptidase A) 1 168.09469 2.9208602 (ACE), transcript variant 1, mRNA. Homo sapiens AU RNA binding 7330180 NM_001698.1 AUH protein/enoyl-Coenzyme A hydratase 772.46903 2.9178203 (AUH), nuclear gene encoding mitochondrial protein, mRNA. 7650672 NM_012098.2 ANGPTL2 Homo sapiens angiopoietin-like 2 2984.4357 2.8951811 (ANGPTL2), mRNA. 4830685 NM_006486.2 FBLN1 Homo sapiens fibulin 1 (FBLN1), 15425.628 2.871839 transcript variant D, mRNA. 3990561 NM_002347.2 LY6H Homo sapiens lymphocyte antigen 6 317.10413 2.865274 complex, locus H (LY6H), mRNA. Homo sapiens erythrocyte membrane 1510538 NM_012307.2 EPB41L3 protein band 4.1-like 3 (EPB41L3), 2140.0109 2.8567281 mRNA. 50368 NM_001920.3 DCN Homo sapiens decorin (DCN), 6775.5385 2.8051183 transcript variant Al, mRNA. 670594 NM_000063.3 C2 Homo sapiens complement component 223.05354 2.7989992 2 (C2), mRNA. Homo sapiens hepatocyte growth 3130451 NM_000601.4 HGF factor (hepapoietin A; scatter factor) 242.40162 2.7554355 (HGF), transcript variant 1, mRNA. Homo sapiens mannan-binding lectin 5960438 NM_139125.2 MASPI seine peptidase 1 (C4/C2 activating 236.71394 2.7551001 component of Ra-reactive factor) (MASP1), transcript variant 2, mRNA. Homo sapiens extracellular matrix 3450521 NM_022664.1 ECM1 protein 1 (ECM1), transcript variant 2, 1476.5799 2.7453378 mRNA. 4610753 NM_000118.1 ENG Homo sapiens endoglin (Osler-Rendu- 2922.415 2.7398989 Weber syndrome 1) (ENG), mRNA. Homo sapiens collagen, type VI, alpha 2750356 NM_001849.3 COL6A2 2 (COL6A2), transcript variant 2C2, 7475.5754 2.7381806 mRNA. Homo sapiens baculoviral IAP repeat 3060255 NM_182962.1 BIRC3 containing 3 (BIRC3), transcript 1474.1922 2.7345404 variant 2, mRNA. 5490019 NM_002084.3 GPX3 Homo sapiens glutathione peroxidase 3 944.46519 2.713939 (plasma) (GPX3), mRNA. 7400259 NM_000203.3 IDUA Homo sapiens iduronidase, alpha-L- 1460.4976 2.6909509 (IDUA), mRNA. 278 WO 2011/150105 PCT/US2011/037969 Homo sapiens family with sequence 4830059 NM_020223.2 FAM20C similarity 20, member C (FAM20C), 375.28791 2.6637403 mRNA. 7650296 NM_133505.2 DCN Homo sapiens decorin (DCN), 33906.985 2.6555926 transcript variant C, mRNA. 5820025 NM_001426.3 ENI Homo sapiens engrailed homeobox 1 181.33024 2.6548221 (ENI), mRNA. Homo sapiens family with sequence 5960376 NM_020223.2 FAM20C similarity 20, member C (FAM20C), 480.76932 2.6438522 mRNA. 2680072 NM_014279.4 OLFM1 Homo sapiens olfactomedin 1 411.98658 2.6345958 (OLFM1), transcript variant 1, mRNA.41985 26398 4150753 NM_017946.2 FKBP14 Homo sapiens FK506 binding protein 2557.0417 2.6016495 14, 22 kDa (FKBP14), mRNA. 6420008 NM_000313.1 PROSI Homo sapiens protein S (alpha) 2275.6465 2.6005136 (PROS I), inRNA. Homo sapiens family with sequence 4860646 NM_020223.2 FAM20C similarity 20, member C (FAM20C), 3170.1951 2.5963496 mRNA. Homo sapiens interleukin 17 receptor 4060017 NM_001080973.1 IL17RD D (IL17RD), transcript variant 1, 1119.2699 2.5688421 mRNA. 4480468 NM_000929.2 PLA2G5 Homo sapiens phospholipase A2, 143.53968 2.5633126 group V (PLA2GS), mRNA. Homo sapiens FK506 binding protein 1010068 NM_004470.2 FKBP2 2, 13kDa (FKBP2), transcript variant 2715.2746 2.5555685 1, mRNA. Homo sapiens chemokine (C-X-C 4610615 NM_000609.4 CXCL12 mtif) ligan 2 strotanservr 6985.1221 2.5528491 factor 1) (CXCL 12), transcript variant 2, mRNA. 4480292 NM_002781.2 PSG5 Homo sapiens pregnancy specific beta- 139.48909 2.5510341 1-glycoprotein 5 (PSG5), mRNA. Homo sapiens regeneration associated 5670543 NM_015430.2 DKFZP586H2123 muscle protease (DKFZP586H2123), 228.32876 2.5494875 transcript variant 1, mRNA. 5090671 NM_004864.1 GDF15 Homo sapiens growth differentiation 2085.4076 2.5205381 factor 15 (GDF1S), mRNA. 5050131 NM_006485.3 FBLN1 Homo sapiens fibulin 1 (FBLN1), 170.86416 2.5044756 transcript variant B, mRNA. 5080139 NM_002771.2 PRSS3 Homo sapiens protease, seine, 3 232.57183 2.5041797 (mesotrypsin) (PRSS3), mRNA. 3060639 NM_003013.2 SFRP2 Homo sapiens secreted frizzled-related 2444.995 2.4483627 protein 2 (SFRP2), mRNA. 830324 NM_001459.2 FLT3LG Homo sapiens fins-related tyrosine 305.30229 2.4229037 kinase 3 ligand (FLT3LG), mRNA. Homo sapiens family with sequence 1940274 NM_032036.2 FAM14A similarity 14, member A (FAM14A), 1853.0636 2.3880146 mRNA. Homo sapiens interleukin 6 signal 4260333 NM_002184.2 IL6ST transducer (gpl30, oncostatin M 443.01637 2.3876141 receptor) (JL6ST), transcript variant 1, mRNA. 5090626 NM_004460.2 FAP Homo sapiens fibroblast activation 3713.0861 2.3640266 protein, alpha (FAP), mRNA. 7510551 NM_024913.3 FLJ21986 Homo sapiens hypothetical protein 1033.5914 2.3465956 FLJ2 1986 (FLJ2 1986), mRNA. 2190113 NM_005559.2 LAMA1 Homo sapiens lamnin, alpha 1 318.43075 2.3017542 (LAMA), mRNA. 279 WO 2011/150105 PCT/US2011/037969 Homo sapiens CD44 molecule (Indian 5860152 NM_001001391.1 CD44 blood group) (CD44), transcript variant 17797.649 2.301006 4, mRNA. Homo sapiens chemokine (C-X-C 4560020 NM_199168.2 CXCL12 mtif) ligan 2 strotanseltderi 12803.772 2.2826041 factor 1) (CXCL12), transcript variant 1, mRNA. Homo sapiens chromosome 5 open 1690240 NM_032385.3 C5orf4 reading frame 4 (C5orf4), transcript 487.90627 2.2820245 variant 2, mRNA. 7570598 NM_001848.2 COL6A1 Homo sapiens collagen, type VI, alpha 14526.596 2.2751689 1 (COL6A1), mRNA. 10685 NM_058172.3 ANTXR2 Homo sapiens anthrax toxin receptor 2 4748.3382 2.2672626 (ANTXR2), mRNA. Homo sapiens protein kinase C 2850639 NM_001001329.1 PRKCSH substrate 80K-H (PRKCSH), transcript 635.03997 2.2505033 variant 2, mRNA. Homo sapiens cytochrome P450, 6200068 NM_000786.2 CYP51A1 family 51, subfamily A, polypeptide 1 476.46608 2.2503978 (CYP51A1), mRNA. 2370593 NM_005708.2 GPC6 Homo sapiens glypican 6 (GPC6), 1040.4938 2.2497122 mRNA. Homo sapiens ST6 (alpha-N-acetyl neuraminyl-2,3-beta-galactosyl-1, 3) 3780608 NM_013443.3 ST6GALNAC6 N-acetylgalactosaminide alpha-2,6- 1581.6991 2.2490173 sialyltransferase 6 (ST6GALNAC6), mRNA. 5570682 NM_024769.2 ASAM Homo sapiens adipocyte- specific 1407.3236 2.2459703 adhesion molecule (AS AMV), mRNA. 14736 2.590 Homo sapiens neuroblastoma, 7100010 NM_005380.4 NBL1 suppression of tumorigenicity 1 6307.2208 2.2435284 (NBL1), transcript variant 2, mRNA. 4560592 NM_004787.1 SLIT2 Homo sapiens slit homolog 2 812.07035 2.2391669 (Drosophila) (SLJT2), mRNA. Homo sapiens serpin peptidase 5080192 NM_006216.2 SERPINE2 inhibitor, clade E (nexin, plasminogen 26691.038 2.2313956 activator inhibitor type 1), member 2 (SERPINE2), mRNA. 4610674 NM_007047.3 BTN3A2 Homo sapiens butyrophilin, subfamily 543.41755 2.2292557 3, member A2 (BTN3A2), mRNA. 6020682 NM_020211.1 RGMA Homo sapiens RGM domain family, 635.46726 2.2204206 member A (RGMA), inRNA. Homo sapiens collagen, type VI, alpha 3390458 NM_001849.3 COL6A2 2 (COL6A2), transcript variant 2C2, 9910.1417 2.2098526 mRNA. Homo sapiens follicular lymphoma 160537 NM_002035.1 FVT1 variant translocation 1 (FVT1), 1519.7494 2.2096287 mRNA. Homo sapiens sulfide quinone 6770707 NM_021199.2 SQRDL reductase-like (yeast) (SQRDL), 630.15723 2.2081056 mRNA. Homo sapiens ADAMTS-like 1 6180209 NM_052866.3 ADAMTSL1 (ADAMTSL1), transcript variant 2, 161.54558 2.2045857 mRNA. Homo sapiens ribonuclease, RNase A 6590041 NM_194431.1 RNASE4 family, 4 (RNASE4), transcript variant 3595.6016 2.1988603 3, mRNA. 3800204 NM_006334.3 OLFM1 Homo sapiens olfactomedin 1 201.41106 2.1975555 (OLFM1), transcript variant 2, mRNA. 280 WO 2011/150105 PCT/US2011/037969 Homo sapiens beta-site APP-cleaving 2230731 NM_138992.1 BACE2 enzyme 2 (BACE2), transcript variant 449.08628 2.1960511 b, mRNA. Homo sapiens dullard homolog 3290672 NM_015343.3 DULLARD (Xenopus laevis) (DULLARD), 790.0354 2.1945312 mRNA. Homo sapiens Fc fragment of IgA, 4250193 NM_133279.1 FCAR receptor for (FCAR), transcript variant 1074.624 2.1819207 9, mRNA. Homo sapiens chromosome 1 open 4180132 NM_198264.1 Clorf2 reading frame 2 (Clorf2), transcript 308.06777 2.1704522 variant 2, mRNA. Homo sapiens ADP-ribosylhydrolase 5570446 NM_138430.3 ADPRHL1 like 1 (ADPRHL1), transcript variant 154.97478 2.1682646 1, mRNA. Homo sapiens laminin, alpha 2 360181 NM_001079823.1 LAMA2 (merosin, congenital muscular 440.43827 2.1531993 dystrophy) (LAMA2), transcript variant 2, mRNA. Homo sapiens colony stimulating 4640048 NM_172212.1 CSF1 factor 1 (macrophage) (CSF1), 143.53968 2.147126 transcript variant 4, mRNA. 240195 NM_004048.2 B2M Homo sapiens beta-2-microglobulin 12054.09 2.1294427 (B2M), mRNA. Homo sapiens chemokine (C-X-C 60192 NM_002993.2 CXCL6 motif) ligand 6 (granulocyte 1276.7519 2.1280242 chemotactic protein 2) (CXCL6), mRNA. 3990703 NM_000572.2 IL1O Homo sapiens interleukin 10 (IL1O), 1685.483 2.1156254 mRNA. Homo sapiens colony stimulating 2900093 NM_172212.1 CSF1 factor 1 (macrophage) (CSF1), 156.03665 2.0971862 transcript variant 4, mRNA. Homo sapiens 6 4640079 NM_012088.2 PGLS phosphogluconolactonase (PGLS), 4264.5345 2.0874348 mRNA. Homo sapiens dolichyl-phosphate 2850520 NM_018973.3 DPM3 mannosyltransferase polypeptide 3 1917.81 2.0834933 (DPM3), transcript variant 1, mRNA. Homo sapiens leucine rich repeat (in 3400754 NM_004735.2 LRRFIP1 FLII) interacting protein 1 (LRRFIP1), 2616.2982 2.0832999 mRNA. 2940450 NM_138995.1 MYO3B Homo sapiens myosin IIIB (MYO3B), 228.184 2.0773329 mRNA. Homo sapiens leukocyte receptor 2000142 NM_052925.1 LENG8 cluster (LRC) member 8 (LENG8), 201.89845 2.0677592 mRNA. Homo sapiens ADAM 7150609 NM_021599.1 ADAMTS2 metallopeptidase with thrombospondin 198.24698 2.0651768 type 1 motif, 2 (ADAMTS2), transcript variant 2, mRNA. 6330672 NM_139279.3 MCFD2 Homo sapiens multiple coagulation 222.84476 2.053578 factor deficiency 2 (MCFD2), mRNA. 730414 NM_000041.2 APOE Homo sapiens apolipoprotein E 5079.7496 2.0461313 (APOE), mRNA. Homo sapiens hepatocyte growth 2340292 NM_001010932.1 HGF factor (hepapoietin A; scatter factor) 215.3941 2.0405989 (HGF), transcript variant 3, mRNA. Homo sapiens syntrophin, beta 1 3420739 NM_021021.2 SNTB1 (dystrophin-associated protein Al, 695.84882 2.0366086 59kDa, basic component 1) (SNTB 1), mRNA. 281 WO 2011/150105 PCT/US2011/037969 7330292 NM_001998.2 FBLN2 Homo sapiens fibulin 2 (FBLN2), 4126.0963 2.0279238 transcript variant 2, mRNA. Homo sapiens lipase A, lysosomal 5360148 NM_000235.2 LIPA acid, cholesterol esterase (Wolman 2469.7686 2.0254112 disease) (LIPA), mRNA. Homo sapiens ADP-ribosylhydrolase 3390735 NM_199162.1 ADPRHL1 like 1 (ADPRHL1), transcript variant 190.71136 2.0199635 2, mRNA. Homo sapiens AT rich interactive 6510553 NM_005224.2 ARID3A domain 3A (BRIGHT-like) (ARID3A), 1548.6169 2.0101974 mRNA. ASCi P8 D1 Chondro MM ProbelD RefSeqjID Symbol Definition RFU Fold over -- Ave Homo sapiens matrix metallopeptidase 7400400 NM_002422.3 MMP3 3 (stromelysin 1, progelatinase) 7964.1763 37.315717 (MMP3), mRNA. 5080543 NM_006528.2 TFPI2 Homo sapiens tissue factor pathway 4928.7565 13.55791 inhibitor 2 (TFPJ2), mRNA. Homo sapiens WNT1 inducible 2320564 NM_003882.2 WISPI signaling pathway protein 1 (WISPI), 2616.2982 10.918029 transcript variant 1, mRNA. 3370162 NM_006108.2 SPONI Homo sapiens spondin 1, extracellular 1507.9124 10.822268 matrix protein (SPONI), mRNA. Homo sapiens WNT1 inducible 4120553 NM_003881.2 WISP2 signaling pathway protein 2 (WISP2), 2948.8968 10.376176 mRNA. 290739 NM_004944.2 DNASE1L3 Homo sapiens deoxyribonuclease I- 484.67537 8.807931 like 3 (DNASE1L3), mRNA. Homo sapiens reversion-inducing 3390487 NM_021111.1 RECK cysteine-rich protein with kazal motifs 3051.8251 7.4447378 (RECK), mRNA. Homo sapiens laminin, alpha 2 1470296 NM_000426.3 LAMA2 stroph ) eal )str 1418.6827 7.3394122 dystrophy) (LAMA2), transcript variant 1, mRNA. 4480292 NM_002781.2 PSG5 Homo sapiens pregnancy specific beta- 366.60959 6.7047079 1-glycoprotein 5 (PSG5), mRNA. Homo sapiens acyl-CoA synthetase 1030431 NM_001995.2 ACSL1 long-chain family member 1 (ACSL1), 2224.1767 6.5496493 mRNA. 1430278 NM_000396.2 CTSK Homo sapiens cathepsin K (CTSK), 5484.1111 6.2713001 IIRNA. Homo sapiens alanyl (membrane) aminopeptidase (aminopeptidase N, 5810612 NM_001150.1 ANPEP aminopeptidase M, microsomal 5216.8513 6.2327205 aminopeptidase, CD13, p150) (ANPEP), mRNA. 5550719 NM_133503.2 DCN Homo sapiens decorin (DCN), 7769.0105 6.1052843 transcript variant A2, mRNA. 240274 NM_000877.2 ILIRI Homo sapiens interleukin 1 receptor, 1026.1274 5.9259224 type I (RLIRI), mRNA. Homo sapiens mannan-binding lectin 580360 NM_001031849.1 MASPI seine peptidase 1 (C4/C2 activating 531.82773 5.8153401 component of Ra-reactive factor) (MASP1), transcript variant 3, mRNA. 1430487 NM_000900.2 MGP Homo sapiens matrix Gla protein 19736.908 5.448972 (MGP), mRNA. 282 WO 2011/150105 PCT/US2011/037969 4880609 NM_012242.2 DKK1 Homo sapiens dickkopf homolog 1 345.04366 5.3430603 (Xenopus laevis) (DKK1), mRNA. Homo sapiens laminin, alpha 2 360181 NM_001079823.1 LAMA2 (merosin, congenital muscular 1080.274 5.2812061 dystrophy) (LAMA2), transcript variant 2, mRNA. 70167 NM_015364.2 LY96 Homo sapiens lymphocyte antigen 96 1487.4189 5.2257573 (LY96), mRNA. 2810673 NM_152739.3 HOXA9 Homo sapiens homeobox A9 732.31681 5.1752777 (HOXA9), inRNA. Homo sapiens N-acetylated alpha 4120626 NM_005468.2 NAALADL1 linked acidic dipeptidase-like 1 459.58599 5.0140808 (NAALADL1), mRNA. Homo sapiens WNT1 inducible 870431 NM_080838.1 WISPI signaling pathway protein 1 (WISPI), 373.94307 5.0003973 transcript variant 2, mRNA. Homo sapiens pentraxin-related gene, 3460682 NM_002852.2 PTX3 rapidly induced by IL-I beta (PTX3), 778.75251 4.9060139 mRNA. 5340358 NM_000504.3 FlO Homo sapiens coagulation factor X 494.74499 4.725387 (FlO), mRNA. Homo sapiens transforming growth 3190379 NM_003243.2 TGFBR3 factor, beta receptor III (TGFBR3), 2173.6863 4.3878081 mRNA. 2370041 NM_018334.3 LRRN3 Homo sapiens leucine rich repeat 353.47559 4.3657465 neuronal 3 (LRRN3), mRNA. 3990561 NM_002347.2 LY6H Homo sapiens lymphocyte antigen 6 479.51504 4.3327786 complex, locus H (LY6H1), mRNA. Homo sapiens ectonucleotide 2490152 NM_001040092.1 ENPP2 pyrophosphatase/phosphodiesterase 2 961.11637 4.2061779 (autotaxin) (ENPP2), transcript variant 2, mRNA. Homo sapiens sema domain, 1580608 NM_012431.1 SEMA3E immunoglobulin domain (Ig), short 3155.027 4.146225 basic domain, secreted, (semaphorin) 3E (SEMA3E), mRNA. 4760095 NM_004750.2 CRLF1 Homo sapiens cytokine receptor-like 2333.3537 4.1062259 factor 1 (CRLF1), mRNA. Homo sapiens dipeptidyl-peptidase 4 4830255 NM_001935.3 DPP4 (CD26, adenosine deaminase 426.63156 4.0656068 complexing protein 2) (DPP4), mRNA. Homo sapiens matrix metallopeptidase 4760626 NM_002426.2 MMP12 12 (macrophage elastase) (MMP12), 233.8149 4.0563988 mRNA. Homo sapiens prostaglandin endoperoxide synthase 1 6840626 NM_000962.2 PTGS1 (prostaglandin G/H synthase and 718.88746 3.9316862 cyclooxygenase) (PTGS 1), transcript variant 1, mRNA. Homo sapiens cytochrome P450, 6200068 NM_000786.2 CYP51A1 family 51, subfamily A, polypeptide 1 827.30988 3.9074687 (CYP51A1), mRNA. Homo sapiens sarcoglycan, delta 2450327 NM_172244.2 SGCD (35kDa dystrophin-associated 455.34351 3.8223362 glycoprotein) (SGCD), transcript variant 2, mRNA. Homo sapiens ectonucleotide 840678 NM001040092.1 ENPP2 pyrophosphatase/phosphodiesterase 2 1133.559 3.7407787 (autotaxin) (ENPP2), transcript variant 2, mRNA. 283 WO 2011/150105 PCT/US2011/037969 Homo sapiens major histocompatibility 2570564 NM_019111.3 HLA-DRA complex, class II, DR alpha (HLA- 364.96313 3.7295141 DRA), mRNA. 2710735 NM_016084.3 RASD1 Homo sapiens RAS, dexamethasone- 1063.3442 3.708636 induced 1 (RASD1), mRNA. 3930020 NM_003793.2 CTSF Homo sapiens cathepsin F (CTSF), 607.10568 3.6525219 mRNA. Homo sapiens lymphotoxin beta 4640064 NM_002342.1 LTBR receptor (TNFR superfamily, member 2222.5757 3.5871383 3) (LTBR), mRNA. 4670441 NM_006329.2 FBLN5 Homo sapiens fibulin 5 (FBLN5), 7123.9139 3.5132932 mRNA. Homo sapiens serpin peptidase inhibitor, clade G (C1 inhibitor), 2030309 NM_001032295.1 SERPINGI member 1, (angioedema, hereditary) 1537.7015 3.3951219 (SERPINGI), transcript variant 2, mRNA. Homo sapiens gamma-glutamyl 160615 NM_003878.1 GGH hydrolase (conjugase, 576.15324 3.3743098 folylpolygammaglutamyl hydrolase) (GGH), mRNA. Homo sapiens family with sequence 2810373 NM_017565.2 FAM20A similarity 20, member A (FAM20A), 271.74484 3.3013545 mRNA. 7150634 NM_001647.2 APOD Homo sapiens apolipoprotein D 2573.9904 3.2666747 (APOD), inRNA. Homo sapiens procollagen C 4810445 NM_013363.2 PCOLCE2 endopeptidase enhancer 2 1821.0839 3.2662713 (PCOLCE2), mRNA. Homo sapiens family with sequence 1940274 NM_032036.2 FAM14A similarity 14, member A (FAM14A), 2518.9251 3.2461001 mRNA. Homo sapiens prostaglandin 12 7150762 NM_000961.3 PTGIS (prostacyclin) synthase (PTGIS), 2827.5901 3.1792217 mRNA. 6980541 NM_003255.4 TIMP2 Homo sapiens TIMP metallopeptidase 1684.5292 3.1513281 inhibitor 2 (TJIP2), mRNA. 6940053 NM_014917.2 NTNG1 Homo sapiens netrin GI (NTNG1), 379.89388 3.1371387 transcript variant 3, mRNA. 5670594 NM_021077.3 NMB Homo sapiens neuromedin B (NMB), 1513.2934 3.1141604 transcript variant 1, mRNA. 5820025 NM_001426.3 ENI Homo sapiens engrailed homeobox 1 211.11342 3.0908721 (ENI), mRNA. Homo sapiens heart and neural crest 4640563 NM_021973.2 HAND2 derivatives expressed 2 (HAND2), 379.36917 3.0665919 mRNA. Homo sapiens collagen, type VI, alpha 2470114 NM_004369.2 COL6A3 3 (COL6A3), transcript variant 1, 10275.846 3.0436308 mRNA. Homo sapiens complement component 7400707 NM_001734.2 CiS 1, s subcomponent (CIS), transcript 3185.3192 3.0292042 variant 1, mRNA. Homo sapiens SLIT-ROBO Rho 2470220 NM_020762.1 SRGAP1 GTPase activating protein 1 995.13451 3.0266148 (SRGAP1), mRNA. Homo sapiens cartilage intermediate 6400427 NM_003613.2 CILP layer protein, nucleotide 1095.4167 3.0159081 pyrophosphohydrolase (CILP), mRNA. 3990563 NM_002171.1 IFNA1O Homo sapiens interferon, alpha 10 213.7677 2.9911363 (JFNAO), mRNA. 284 WO 2011/150105 PCT/US2011/037969 Homo sapiens ADAM 6900086 NM_006988.3 ADAMTS1 metallopeptidase with thrombospondin 1757.0146 2.9810239 type 1 motif, 1 (ADAMTS 1), mRNA. Homo sapiens ATP-binding cassette, 3990441 NR_003087.1 ABCC13 sub-family C (CFTR/MRP), member 214.6604 2.9798448 13 (ABCC13) on chromosome 21. XR_017987 XR_017988 XR_017989 Homo sapiens protein tyrosine 3850603 NM_002846.2 PTPRN phosphatase, receptor type, N 418.0559 2.9740846 (PTPRN), mRNA. Homo sapiens baculoviral IAP repeat 3060255 NM_182962.1 BIRC3 containing 3 (BIRC3), transcript 1594.6568 2.9579952 variant 2, mRNA. Homo sapiens retinol dehydrogenase 2340494 NM_016026.2 RDH11 11 (all-trans/9-cis/11-cis) (RDH11), 1566.5006 2.9462495 mRNA. 6370541 NM_001898.2 CST1 Homo sapiens cystatin SN (CST1), 790.46917 2.8356689 IIRNA. 1500725 NM_001765.2 CD1C Homo sapiens CD1c molecule 539.16018 2.8287558 (CD1C), mRNA. Homo sapiens interleukin 17 receptor 4060017 NM_001080973.1 IL17RD D (IL17RD), transcript variant 1, 1228.5353 2.8196176 mRNA. 6960148 NM_004684.2 SPARCL1 Homo sapiens SPARC-like 1 (mast9, 330.77802 2.8016805 hevin) (SPARCL1), mRNA. Homo sapiens extracellular matrix 3440386 NM_004425.2 ECM1 protein 1 (ECM1), transcript variant 1, 1309.6802 2.7971223 mRNA. 2940450 NM_138995.1 MYO3B Homo sapiens myosin IIIB (MYO3B), 304.44653 2.7716089 mRNA. Homo sapiens prostaglandin endoperoxide synthase 1 1070450 NM_080591.1 PTGS1 (prostaglandin G/H synthase and 2690.5128 2.7578361 cyclooxygenase) (PTGS 1), transcript variant 2, mRNA. Homo sapiens core 1 synthase, 580066 NM_020156.1 CIGALTI glycoprotein-N-acetylgalactosamine 3- 434.73968 2.7544144 beta-galactosyltransferase, 1 (CIGALTI), mRNA. 3060639 NM_003013.2 SFRP2 Homo sapiens secreted frizzled-related 2738.6683 2.7424405 protein 2 (SFRP2), mRNA. Homo sapiens Fc fragment of IgA, 4250193 NM_133279.1 FCAR receptor for (FCAR), transcript variant 1348.8577 2.7387256 9, mRNA. Homo sapiens gonadotropin-releasing 5080017 NM_001501.1 GNRH2 hormone 2 (GNRH2), transcript 223.13658 2.7256134 variant 1, mRNA. Homo sapiens mannan-binding lectin 4050326 NM_139125.2 MASPI seine peptidase 1 (C4/C2 activating 317.69845 2.6899559 component of Ra-reactive factor) (MASP1), transcript variant 2, mRNA. 10142 NM_006016.3 CD164 Homo sapiens CD164 molecule, 473.87271 2.6828921 sialomucin (CD164), mRNA. 5260474 NM_001733.4 CIR Homo sapiens complement component 2208.6037 2.6571012 1, r subcomponent (C1R), mRNA. 4890270 NM_002346.1 LY6E Homo sapiens lymphocyte antigen 6 5963.4501 2.6554642 complex, locus E (LY6E), mRNA. Homo sapiens vitamin K epoxide 6450546 NM_024006.4 VKORC1 reductase complex, subunit 1 3517.0867 2.6428467 (VKORC1), transcript variant 1, 285 WO 2011/150105 PCT/US2011/037969 mRNA. 4280301 NM_006072.4 CCL26 Homo sapiens chemokine (C-C motif) 297.33112 2.6201177 ligand 26 (CCL26), mRNA. 5700201 NM_003377.3 VEGFB Homo sapiens vascular endothelial 242.77353 2.6186818 growth factor B (VEGFB), mRNA. Homo sapiens SWI/SNF related, 1580327 NM_003077.2 SMARCD2 matrix associated, actin dependent 992.83215 2.6179479 regulator of chromatin, subfamily d, member 2 (SMARCD2), mRNA. 4150753 NM_017946.2 FKBP14 Homo sapiens FK506 binding protein 2548.7735 2.5932369 14, 22 kDa (FKBP14), mRNA. Homo sapiens interleukin 17 receptor 1500411 NM_032732.3 IL17RC C (IL17RC), transcript variant 3, 237.6733 2.5923851 mRNA. 2360020 NM_013402.3 FADS1 Homo sapiens fatty acid desaturase 1 2888.4212 2.5748606 (FADS 1), mRNA. Homo sapiens ribosome binding 4540327 NM_001042576.1 RRBP1 protein 1 homolog 180kDa (dog) 1189.8499 2.5647928 (RRBP1), transcript variant 1, mRNA. Homo sapiens interleukin 11 receptor, 2570646 NM_004512.3 ILIRA alpha (ILIRA), transcript variant 1, 576.71394 2.563437 mRNA. 4900133 NM_006307.3 SRPX Homo sapiens sushi-repeat-containing 13732.304 2.5519435 protein, X-linked (SRPX), mRNA. Homo sapiens neuroblastoma, 7100010 NM_005380.4 NBL1 suppression of tumorigenicity 1 7171.9072 2.5511043 (NBL1), transcript variant 2, mRNA. Homo sapiens insulin-like growth 7380719 NM_002178.2 IGFBP6 factor binding protein 6 (IGFBP6), 9171.2147 2.5510216 mRNA. 1510564 NM_014255.3 TMEM4 Homo sapiens transmembrane protein 3691.6471 2.5400519 4 (TMEM4), mRNA. Homo sapiens serpin peptidase 6290356 NM_002615.4 SERPINF1 inhibitor, clade F (alpha-2 antiplasmin' 1876.8382 2.5167595 pigment epithelium derived factor), member 1 (SERPINFI), mRNA. Homo sapiens mannan-binding lectin 5960438 NM_139125.2 MASPI seine peptidase 1 (C4/C2 activating 216.08953 2.5150538 component of Ra-reactive factor) (MASP1), transcript variant 2, mRNA. Homo sapiens complement component 1300327 NM_201442.1 CiS 1, s subcomponent (CIS), transcript 428.9545 2.4938827 variant 2, mRNA. Homo sapiens FK506 binding protein 1010068 NM_004470.2 FKBP2 2, 13kDa (FKBP2), transcript variant 2648.324 2.4925558 1, mRNA. Homo sapiens peptidylprolyl 7000114 NM_000943.4 PPIC isomerase C (cyclophilin C) (PPIC), 4276.1642 2.4903713 mRNA. Homo sapiens pregnancy specific beta 5960392 NM_001031850.2 PSG6 1-glycoprotein 6 (PSG6), transcript 190.52419 2.4734816 variant 2, mRNA. Homo sapiens collagen, type VI, alpha 6250192 NM_057165.2 COL6A3 3 (COL6A3), transcript variant 3, 13462.134 2.4624981 mRNA. 2680072 NM_014279.4 OLFM1 Homo sapiens olfactomedin 1 (OLFM1), transcript variant , mRNA. 286 WO 2011/150105 PCT/US2011/037969 7650296 NM_133505.2 DCN Homo sapiens decorin (DCN), 31253.086 2.4477394 transcript variant C, mRNA. Homo sapiens ADAM 7150609 NM_021599.1 ADAMTS2 tallopeptidase wi MStnip 234.59403 2.4438111 type 1 motif, 2 (ADAVTS2), transcript variant 2, mRNA. Homo sapiens leucine rich repeat (in 3400754 NM_004735.2 LRRFIP1 FLII) interacting protein 1 (LRRFIP1), 3068.7876 2.4436071 mRNA. Homo sapiens hepatocyte growth 3130451 NM_000601.4 HGF factor (hepapoietin A; scatter factor) 213.18658 2.4233413 (HGF), transcript variant 1, mRNA. 840309 NM_000230.1 LEP Homo sapiens leptin (obesity homolog, 443.29764 2.4143549 mouse) (LEP), mRNA. 4220259 NM_001336.2 CTSZ Homo sapiens cathepsin Z (CTSZ), 2639.5761 2.4126224 mRNA. Homo sapiens interleukin 17 receptor 3450228 NM_153461.1 IL17RC C (IL17RC), transcript variant 1, 466.94152 2.4112196 mRNA. Homo sapiens ADAM 3400600 NM_014244.2 ADAMTS2 metallopeptidase with thrombospondin 261.52802 2.4055448 type 1 motif, 2 (ADAMTS2), transcript variant 1, mRNA. Homo sapiens hypothetical protein 2030672 NM_001031744.1 LOC158160 LOC158160 (LOC158160), transcript 386.34985 2.4038842 variant 1, mRNA. Homo sapiens dolichyl-phosphate 2850520 NM_018973.3 DPM3 mannosyltransferase polypeptide 3 2211.6603 2.4027299 (DPM3), transcript variant 1, mRNA. Homo sapiens matrix metallopeptidase 510736 NM_004530.2 MMP2 2 (gelatinase A, 72kDa gelatinase, 1032.259 2.3941839 72kDa type IV collagenase) (MMP2), mRNA. 5560300 NM_015719.3 COL5A3 Homo sapiens collagen, type V, alpha 325.79292 2.3815737 3 (COLSA3), mRNA. 5890288 NM_003377.3 VEGFB Homo sapiens vascular endothelial 1046.6157 2.3729821 growth factor B (VEGFB), mRNA. 1510392 NM_002291.1 LAMBI Homo sapiens lamnin, beta 1 1630.2111 2.3678838 (LAMB 1), mRNA. Homo sapiens MYC-associated zinc 4830689 NM_001042539.1 MAZ finger protein (purine-binding 657.02493 2.3666616 transcription factor) (MAZ), transcript variant 2, mRNA. Homo sapiens ADAMTS-like 1 5890326 NM_052866.3 ADAMTSL1 (ADAMTSL1), transcript variant 2, 333.72094 2.3598229 mRNA. 6550762 NM_001998.2 FBLN2 Homo sapiens fibulin 2 (FBLN2), 4495.9982 2.3575127 transcript variant 2, mRNA. Homo sapiens pleiotrophin (heparin 4920576 NM_002825.5 PTN binding growth factor 8, neurite 2273.9765 2.3563426 growth-promoting factor 1) (PTN), mRNA. 5670228 NM 054034.2 FN1 Homo sapiens fibronectin 1 (FN1), 305.56468 2.3538203 transcript variant 7, mRNA. Homo sapiens interleukin 17 receptor 3120368 NM_153480.1 IL17RE E (IL17RE), transcript variant 1, 152.97153 2.3515812 mRNA. Homo sapiens angiotensin I converting 3830398 NM_000789.2 ACE enzyme (peptidyl-dipeptidase A) 1 134.8233 2.3427273 (ACE), transcript variant 1, mRNA. 6330672 NM_139279.3 MCFD2 Homo sapiens multiple coagulation 252.78097 2.3294486 factor deficiency 2 (MCFD2), mRNA. 287 WO 2011/150105 PCT/US2011/037969 7570598 NM_001848.2 COL6A1 Homo sapiens collagen, type VI, alpha 14680.028 2.2991996 1 (COL6A1), mRNA. Homo sapiens jumonji, AT rich 1660546 NM_004187.2 JARIDIC interactive domain IC (JARIDIC), 258.71969 2.2903786 mRNA. Homo sapiens deleted in lymphocytic 1260612 NR_002605.1 DLEU1 leukemia, 1 (DLEU1) on chromosome 227.5854 2.2774742 13. 510246 NM_006475.1 POSTN Homo sapiens periostin, osteoblast 1746.81 2.2668213 1 specific factor (POSTN), mRNA. 2640195 NM_130830.2 LRRC15 Homo sapiens leucine rich repeat 658.84823 2.2599621 containing 15 (LRRC15), mRNA. Homo sapiens elastin (supravalvular 6130577 NM_001081754.1 ELN aortic stenosis, Williams-Beuren 4420.5171 2.2569126 syndrome) (ELN), transcript variant 4, mRNA. Homo sapiens integrin, beta-like 1 5570129 NM_004791.1 ITGBL1 (with EGF-like repeat domains) 359.7823 2.2512304 (ITGBL1), mRNA. 3890095 NM_003102.2 SOD3 Homo sapiens superoxide dismutase 3' 249.80516 2.2487737 extracellular (SOD3), mRNA. 5080139 NM_002771.2 PRSS3 Homo sapiens protease, seine, 3 207.55015 2.2347627 (mesotrypsin) (PRSS3), mRNA. Homo sapiens carboxylesterase 2 3850471 NM_003869.4 CES2 (intestine, liver) (CES2), transcript 316.65413 2.2078832 variant 1, mRNA. 2100228 NM_001937.3 DPT Homo sapiens dermatopontin (DPT), 3403.187 2.2049753 mRNA. 7400735 NM_002345.3 LUM Homo sapiens lumican (LUM), 997.68968 2.1868391 mRNA. 3990703 NM_000572.2 IL1O Homo sapiens interleukin 10 (IL1O), 1740.1982 2.1843041 IIRNA. 6480204 NM 006288.2 THYl Homo sapiens Thy-i cell surface 5182.6953 2.1755655 antigen (THY1), mRNA. Homo sapiens asparagine-linked 6370113 NM_013338.3 ALG5 glycosylation 5 homolog (S. 2061.2785 2.1731739 cerevisiae, dolichyl-phosphate beta glucosyltransferase) (ALG5), mRNA. Homo sapiens erythrocyte membrane 1510538 NM_012307.2 EPB41L3 protein band 4.1-like 3 (EPB41L3), 1623.8111 2.1676463 mRNA. Homo sapiens sarcoglycan, delta 70088 NM_000337.4 SGCD (35kDa dystrophin-associated 158.60737 2.1591647 glycoprotein) (SGCD), transcript variant 1, mRNA. Homo sapiens proopiomelanocortin (adrenocorticotropin/ beta-lipotropin/ 5080072 NM_001035256.1 POMC alpha-melanocyte stimulating 146.66866 2.1581967 hormone/ beta-melanocyte stimulating hormone/ beta-endorphin) (POMC), transcript variant 1, mRNA. 2810255 NM_015989.3 CSAD Homo sapiens cysteine sulfinic acid 723.40206 2.1432848 decarboxylase (CSAD), mRNA. Homo sapiens serpin peptidase 770408 NM_000602.1 SERPINE1 inhibitor, eade E (nexin, plasminogen 10206.614 2.1342659 activator inhibitor type 1), member 1 (SERPINE1), mRNA. Homo sapiens Clq and tumor necrosis 7320204 NM_015645.2 C1QTNF5 factor related protein 5 (C1QTNF5), 909.91829 2.1269452 mRNA. 288 WO 2011/150105 PCT/US2011/037969 Homo sapiens lipase A, lysosomal 5360148 NM_000235.2 LIPA acid, cholesterol esterase (Wolman 2584.1923 2.119248 disease) (LIPA), mRNA. Homo sapiens collagen, type VI, alpha 2750356 NM_001849.3 COL6A2 2 (COL6A2), transcript variant 2C2, 5749.4299 2.1059219 mRNA. Homo sapiens serpin peptidase 5080192 NM_006216.2 SERPINE2 inhibitor, eade E (nexin, plasminogen 24787.53 2.0722606 activator inhibitor type 1), member 2 (SERPINE2), mRNA. 5490019 NM_002084.3 GPX3 Homo sapiens glutathione peroxidase 3 715.25413 2.0552966 (plasma) (GPX3), mRNA. Homo sapiens pyrophosphatase 770356 NM_006903.4 PPA2 (inorganic) 2 (PPA2), nuclear gene 2891.0987 2.0390977 encoding mitochondrial protein, transcript variant 2, mRNA. Homo sapiens mitochondrial ribosomal 3830671 NM_018997.1 MRPS21 protein S21 (MRPS21), nuclear gene 7807.0711 2.0330028 encoding mitochondrial protein, transcript variant 2, mRNA. 2940528 NM_005866.2 OPRS1 Homo sapiens opioid receptor, sigma 1 1507.1599 2.0252971 (OPRS 1), transcript variant 1, mRNA. 2640768 NM 001814.2 CTSC Homo sapiens cathepsin C (CTSC), 1751.8841 2.0193393 transcript variant 1, mRNA. Homo sapiens serpin peptidase inhibitor, clade G (Cl inhibitor), 3450538 NM_000062.2 SERPINGI member 1, (angioedema, hereditary) 162.30708 2.0105245 (SERPINGI), transcript variant 1, mRNA. ASCI P8 D2 Chondro MM ProbelD RefSeqjID Symbol Definition RFU Fold over - Ave Homo sapiens matrix metallopeptidase 7400400 NM_002422.3 MMP3 3 (stromelysin 1, progelatinase) 6806.1903 31.890036 (MMP3), mRNA. Homo sapiens WNT1 inducible 4120553 NM_003881.2 WISP2 signaling pathway protein 2 (WISP2), 6493.396 22.848077 mRNA. 3370162 NM_006108.2 SPONI Homo sapiens spondin 1, extracellular 2507.1158 17.993538 matrix protein (SPONI), mRNA. Homo sapiens laminin, alpha 2 1470296 NM_000426.3 LAMA2 (merosin, congenital muscular 2415.0167 12.493846 dystrophy) (LAMA2), transcript variant 1, mRNA. 2370041 NM_018334.3 LRRN3 Homo sapiens leucine rich repeat 817.92478 10.102118 neuronal 3 (LRRN3), mRNA. Homo sapiens Clq and tumor necrosis 5220639 NM_030945.2 C1QTNF3 factor related protein 3 (C1QTNF3), 1030.7128 9.2825215 transcript variant 1, mRNA. 5290707 NM_004917.3 KLK4 Homo sapiens kallikrein-related 1414.6617 9.2605828 peptidase 4 (KLK4), mRNA. Homo sapiens laminin, alpha 2 360181 NM_001079823.1 LAMA2 (merosin, congenital muscular 1785.0743 8.7268093 dystrophy) (LAMA2), transcript variant 2, mRNA. 1500725 NM_001765.2 CD1C Homo sapiens CD1c molecule 1605.6167 8.4240225 (CD1C), mRNA. 5550719 NM_133503.2 DCN Homo sapiens decorin (DCN), 10564.173 8.3018655 transcript variant A2, mRNA. 289 WO 2011/150105 PCT/US2011/037969 1430278 NM_000396.2 CTSK Homo sapiens cathepsin K (CTSK), 6940.3176 7.9365304 mRNA. Homo sapiens mannan-binding lectin 580360 NM_001031849.1 MASPI serine peptidase 1 (C4/C2 activating 674.46313 7.3750056 component of Ra-reactive factor) (MASP1), transcript variant 3, mRNA. 5340358 NM_000504.3 F1O Homo sapiens coagulation factor X 735.7264 7.0270384 (FlO), mRNA. 1430487 NM_000900.2 MGP Homo sapiens matrix Gla protein 24787.53 6.8433496 (MGP), mRNA. Homo sapiens WNT1 inducible 2320564 NM_003882.2 WISPI signaling pathway protein 1 (WISPI), 1638.2027 6.8363555 transcript variant 1, mRNA. 6940053 NM_014917.2 NTNG1 Homo sapiens netrin GI (NTNG1), 824.52065 6.8088373 transcript variant 3, mRNA. Homo sapiens C1q and tumor necrosis 1500373 NM_181435.4 C1QTNF3 factor related protein 3 (C1QTNF3), 623.08658 6.6966043 transcript variant 2, mRNA. Homo sapiens reversion-inducing 3390487 NM_021111.1 RECK cysteine-rich protein with kazal motifs 2694.8009 6.5737995 (RECK), mRNA. Homo sapiens Clq and tumor necrosis 7320204 NM_015645.2 C1QTNF5 factor related protein 5 (C1QTNF5), 2710.6993 6.336293 mRNA. 7150634 NM_001647.2 APOD Homo sapiens apolipoprotein D 4991.946 6.3353243 (APOD), mRNA. 3060639 NM_003013.2 SFRP2 Homo sapiens secreted frizzled-related 6153.1031 6.1615783 protein 2 (SFRP2), mRNA. Homo sapiens cartilage intermediate 6400427 NM_003613.2 CILP layer protein, nucleotide 2187.7521 6.023333 pyrophosphohydrolase (CILP), mRNA. Homo sapiens serpin peptidase inhibitor, clade G (C1 inhibitor), 2030309 NM_001032295.1 SERPINGI member 1, (angioedema, hereditary) 2624.6886 5.7951027 (SERPINGI), transcript variant 2, mRNA. Homo sapiens N-acetylated alpha 4120626 NM_005468.2 NAALADL1 linked acidic dipeptidase-like 1 521.11254 5.6853352 (NAALADL1), mRNA. 3930020 NM_003793.2 CTSF Homo sapiens cathepsin F (CTSF), 922.55074 5.5503299 mRNA. 1110048 NM_007281.1 SCRG Homo sapiens scrapie responsive 7337.5677 5.5457568 111048 M_072811 SRG1protein 1 (SCRG1), mRNA. 2100228 NM_001937.3 DPT Homo sapiens dermatopontin (DPT), 8463.3285 5.4835159 IIRNA. 4760095 NM_004750.2 CRLF1 Homo sapiens cytokine receptor-like 3015.2937 5.306301 factor 1 (CRLF1), mRNA. Homo sapiens heart and neural crest 4640563 NM_021973.2 HAND2 derivatives expressed 2 (HAND2), 635.25959 5.1350559 mRNA. 4480292 NM_002781.2 PSG5 Homo sapiens pregnancy specific beta- 280.17795 5.1240103 1-glycoprotein 5 (PSGS), mRNA. 2810673 NM_152739.3 HOXA9 Homo sapiens homeobox A9 670.9326 4.7414759 (HOXA9), mRNA. Homo sapiens complement component 7400707 NM_001734.2 CiS 1, s subcomponent (CIS), transcript 4944.818 4.7024686 variant 1, mRNA. 290 WO 2011/150105 PCT/US2011/037969 5260474 NM_001733.4 C1R Homo sapiens complement component 3880.5912 4.6686165 1, r subcomponent (C1R), mRNA. 70167 NM_015364.2 LY96 Homo sapiens lymphocyte antigen 96 1307.7577 4.5945526 (LY96), mRNA. Homo sapiens retinoic acid receptor 5290608 NM_002889.2 RARRES2 responder (tazarotene induced) 2 5357.031 4.5190946 (RARRES2), mRNA. 4670441 NM_006329.2 FBLN5 Homo sapiens fibulin 5 (FBLN5), 9064.792 4.470474 mRNA. Homo sapiens transforming growth 3190379 NM_003243.2 TGFBR3 factor, beta receptor III (TGFBR3), 2180.9981 4.4025677 mRNA. Homo sapiens sarcoglycan, delta 2450327 NM_172244.2 SGCD (35kDa dystrophin-associated 522.85236 4.3890326 glycoprotein) (SGCD), transcript variant 2, mRNA. Homo sapiens ADAM 3400600 NM_014244.2 ADAMTS2 metallopeptidase with thrombospondin 473.55988 4.355822 type 1 motif, 2 (ADAMTS2), transcript variant 1, mRNA. Homo sapiens FXYD domain 5860022 NM_021902.2 FXYD1 containing ion transport regulator 1 397.06726 4.3257787 (phospholemman) (FXYD1), transcript variant b, mRNA. Homo sapiens mannan-binding lectin 4050326 NM_139125.2 MASPI seine peptidase 1 (C4/C2 activating 507.35413 4.2957723 component of Ra-reactive factor) (MASP1), transcript variant 2, mRNA. Homo sapiens elastin (supravalvular 6130577 NM_001081754.1 ELN aortic stenosis, Williams-Beuren 8262.2099 4.2183041 syndrome) (ELN), transcript variant 4, mRNA. 6980541 NM_003255.4 TIMP2 Homo sapiens TIMP metallopeptidase 2241.5409 4.1933561 inhibitor 2 (TJIP2), mRNA. 5080543 NM_006528.2 TFPI2 Homo sapiens tissue factor pathway 1516.4777 4.1714922 inhibitor 2 (TFPJ2), mRNA. Homo sapiens FXYD domain 3850500 NM_005031.3 FXYD1 containing ion transport regulator 1 379.09181 4.0340015 (phospholemman) (FXYD1), transcript variant a, mRNA. Homo sapiens elastin (supravalvular 1300156 NM_001081754.1 ELN aortic stenosis, Williams-Beuren 553.73724 4.0025196 syndrome) (ELN), transcript variant 4, mRNA. Homo sapiens extracellular matrix 6840192 NM_001393.2 ECM2 protein 2, female organ and adipocyte 1121.8139 3.912849 specific (ECM2), mRNA. Homo sapiens serpin peptidase 6290356 NM_002615.4 SERPINFI inhibitor, clade F (alpha-2 antiplasmin, 2904.0591 3.8942187 pigment epithelium derived factor), member 1 (SERPINFI), mRNA. Homo sapiens prostaglandin endoperoxide synthase 1 6840626 NM_000962.2 PTGS1 (prostaglandin G/H synthase and 703.90103 3.8497235 cyclooxygenase) (PTGS 1), transcript variant 1, mRNA. 5080139 NM_002771.2 PRSS3 Homo sapiens protease, seine, 3 356.97765 3.8436993 (mesotrypsin) (PRSS3), mRNA. Homo sapiens acyl-CoA synthetase 1030431 NM_001995.2 ACSL1 long-chain family member 1 (ACSL1), 1303.3388 3.8380098 mRNA. 1430521 NM_053276.2 VIT Homo sapiens vitrin (VIT), mRNA. 362.8056 3.8022078 291 WO 2011/150105 PCT/US2011/037969 290739 NM_004944.2 DNASE1L3 Homo sapiens deoxyribonuclease I- 208.85833 3.7955504 like 3 (DNASE1L3), mRNA. Homo sapiens matrix metallopeptidase 510736 NM_004530.2 MMP2 2 (gelatinase A, 72kDa gelatinase, 1630.6443 3.782057 72kDa type IV collagenase) (MMP2), mRNA. Homo sapiens dipeptidyl-peptidase 4 4830255 NM_001935.3 DPP4 (CD26, adenosine deaminase 395.66748 3.770533 complexing protein 2) (DPP4), mRNA. 6480040 NM_153703.3 PODN Homo sapiens podocan (PODN), 1409.9098 3.7622186 IIRNA. Homo sapiens extracellular matrix 3440386 NM_004425.2 ECM1 protein 1 (ECM1), transcript variant 1, 1751.8841 3.7415499 mRNA. 6370541 NM_001898.2 CST1 Homo sapiens cystatin SN (CST1), 1037.4619 3.7217119 mRNA. 5490019 NM_002084.3 GPX3 Homo sapiens glutathione peroxidase 3 1278.5968 3.6740725 (plasma) (GPX3), mRNA. 3890095 NM_003102.2 SOD3 Homo sapiens superoxide dismutase 3' 407.70649 3.670219 extracellular (SOD3), mRNA. Homo sapiens ADAM 7150609 NM_021599.1 ADAMTS2 metallopeptidase with thrombospondin 346.73134 3.611967 type 1 motif, 2 (ADAMTS2), transcript variant 2, mRNA. 4480152 NM_014057.3 OGN Homo sapiens osteoglycin (OGN), 938.04152 3.5344838 transcript variant 3, mRNA. Homo sapiens major histocompatibility 2570564 NM_019111.3 HLA-DRA complex, class II, DR alpha (HLA- 341.06298 3.4852814 DRA), mRNA. Homo sapiens interleukin 11 receptor, 2570646 NM_004512.3 ILIRA alpha (ILIRA), transcript variant 1, 756.57382 3.3628965 mRNA. Homo sapiens mannan-binding lectin 5960438 NM_139125.2 MASPI seine peptidase 1 (C4/C2 activating 288.32463 3.3557941 component of Ra-reactive factor) (MASP1), transcript variant 2, mRNA. Homo sapiens alanyl (membrane) aminopeptidase (aminopeptidase N, 5810612 NM_001150.1 ANPEP aminopeptidase M, microsomal 2720.0167 3.2496812 aminopeptidase, CD13, p150) (ANPEP), mRNA. 1710484 NM_002023.3 FMOD Homo sapiens fibromodulin (FMOD), 774.21497 3.2298907 mRNA. Homo sapiens lymphotoxin beta 4640064 NM_002342.1 LTBR receptor (TNFR superfamily, member 1988.5909 3.2094972 3) (LTBR), mRNA. Homo sapiens interleukin 17 receptor 3120368 NM_153480.1 IL17RE E (IL17RE), transcript variant 1, 208.64978 3.2075046 mRNA. Homo sapiens collagen, type VI, alpha 2470114 NM_004369.2 COL6A3 3 (COL6A3), transcript variant 1, 10828.476 3.2073157 mRNA. Homo sapiens prostaglandin endoperoxide synthase 1 1070450 NM_080591.1 PTGS1 (prostaglandin G/H synthase and 3098.0882 3.17561 cyclooxygenase) (PTGS 1), transcript variant 2, mRNA. Homo sapiens complement component 1300327 NM_201442.1 CiS 1, s subcomponent (CIS), transcript 545.16357 3.1695063 variant 2, mRNA. 292 WO 2011/150105 PCT/US2011/037969 Homo sapiens prostaglandin 12 7150762 NM_000961.3 PTGIS (prostacyclin) synthase (PTGIS), 2815.7177 3.1658729 mRNA. 2360148 NM_000095.2 COMP Homo sapiens cartilage oligomeric 8902.9174 3.1617443 236048 N_00095.2 COMPmatrix protein (COMP), mRNA. Homo sapiens peptidylprolyl 7000114 NM_000943.4 PPIC isomerase C (cyclophilin C) (PPIC), 5428.6664 3.1615706 mRNA. 5820025 NM_001426.3 ENI Homo sapiens engrailed homeobox 1 214.7472 3.1440736 1 (ENI), mRNA. 3990561 NM_002347.2 LY6H Homo sapiens lymphocyte antigen 6 344.84543 3.1159375 complex, locus H (LY6H), mRNA. Homo sapiens ectonucleotide 2490152 NM_001040092.1 ENPP2 pyrophosphatase/phosphodiesterase 2 711.93451 3.1156718 (autotaxin) (ENPP2), transcript variant 2, mRNA. 240274 NM_000877.2 ILIRI Homo sapiens interleukin 1 receptor, 539.16018 3.1136692 type I (WLIRI), mRNA. 1850372 NM_000915.2 OXT Homo sapiens oXytocin, prepro 213.96829 3.0627531 185072 N 00015.2 OXT(neurophysin 1) (OXT), mRNA. Homo sapiens insulin-like growth 7380719 NM_002178.2 IGFBP6 factor binding protein 6 (IGFBP6), 10948.097 3.0452707 mRNA. 6550762 NM_001998.2 FBLN2 Homo sapiens fibulin 2 (FBLN2), 5709.1668 2.9936474 transcript variant 2, mRNA. Homo sapiens gonadotropin-releasing 5080017 NM_001501.1 GNRH2 hormone 2 (GNRH2), transcript 243.3708 2.9727743 variant 1, mRNA. Homo sapiens serpin peptidase inhibitor, clade G (Cl inhibitor), 3450538 NM_000062.2 SERPINGI member 1, (angioedema, hereditary) 237.45708 2.94142 (SERPINGI), transcript variant 1, mRNA. Homo sapiens ectonucleotide 840678 NM_001040092.1 ENPP2 pyrophosphatase/phosphodiesterase 2 878.6823 2.8996779 (autotaxin) (ENPP2), transcript variant 2, mRNA. Homo sapiens interleukin 17 receptor 3450228 NM_153461.1 IL17RC C (IL17RC), transcript variant 1, 561.09712 2.8974257 mRNA. 6650482 NM_004438.3 EPHA4 Homo sapiens EPH receptor A4 492.55907 2.8660425 (EPHA4), mRNA. Homo sapiens interleukin 17 receptor 1500411 NM_032732.3 IL17RC C (IL17RC), transcript variant 3, 261.27183 2.8497824 mRNA. Homo sapiens vitamin K epoxide 6450546 NM_024006.4 VKORC1 reductase complex, subunit 1 3788.9917 2.8471645 (VKORC1), transcript variant 1, mRNA. Homo sapiens WNT1 inducible 870431 NM_080838.1 WISPI signaling pathway protein 1 (WISPI), 212.4708 2.8411769 transcript variant 2, mRNA. Homo sapiens SWISNF related, 1580327 NM_003077.2 SMARCD2 matrix associated, actin dependent 1074.8536 2.8342261 regulator of chromatin, subfamily d, member 2 (SMARCD2), mRNA. 4490241 NM_080879.2 RAB40A Homo sapiens RAB40A, member RAS 168.1132 2.8305274 oncogene family (RAB4OA), mRNA. 293 WO 2011/150105 PCT/US2011/037969 Homo sapiens sema domain, 1580608 NM_012431.1 SEMA3E immunoglobulin domain (Ig), short 2147.377 2.822007 basic domain, secreted, (semaphorin) 3E (SEMA3E), mRNA. 50368 NM_001920.3 DCN Homo sapiens decorin (DCN), 6775.5385 2.8051183 transcript variant A1, mRNA. Homo sapiens protein tyrosine 3850603 NM_002846.2 PTPRN phosphatase, receptor type, N 392.76976 2.7941969 (PTPRN), mRNA. Homo sapiens SLIT-ROBO Rho 2470220 NM_020762.1 SRGAP1 GTPase activating protein 1 913.02537 2.776887 (SRGAP1), mRNA. 6960148 NM_004684.2 SPARCL1 Homo sapiens SPARC-like 1 (mast9, 326.53437 2.7657368 hevin) (SPARCL1), mRNA. 6940102 NM_002160.1 TNC C aac 0 1) mRNA 2774.1647 2.7398599 694002 N_00260.1 TNC(hexabrachion) (TNC), mRNA. Homo sapiens neuroblastoma, 7100010 NM_005380.4 NBL1 suppression of tumorigenicity 1 7693.5345 2.7366512 (NBL1), transcript variant 2, mRNA. Homo sapiens insulin-like growth 3310400 NM_000618.2 IGF1 factor 1 (somatomedin C) (JGF1), 227.44115 2.7335123 mRNA. Homo sapiens collagen, type VI, alpha 2750356 NM_001849.3 COL6A2 2 (COL6A2), transcript variant 2C2, 7406.5817 2.7129094 mRNA. Homo sapiens ADAM 6900086 NM_006988.3 ADAMTS1 metallopeptidase with thrombospondin 1590.2804 2.6981357 type 1 motif, 1 (ADAMTS 1), mRNA. 4610246 NM_005014.1 OMD Homo sapiens osteomodulin (OMD), 1111.6476 2.6974873 mRNA. Homo sapiens pleiotrophin (heparin 4920576 NM_002825.5 PTN binding growth factor 8, neurite 2592.795 2.686709 growth-promoting factor 1) (PTN), mRNA. 6040736 NM_032777.6 GPR124 Homo sapiens G protein-coupled 1757.0146 2.6654166 receptor 124 (GPR124), mRNA. 6480204 NM_006288.2 THY1 Homo sapiens Thy-i cell surface 6176.5406 2.5927568 antigen (THYl), mRNA. 4900133 NM_006307.3 SRPX Homo sapiens sushi-repeat-containing 13933.806 2.5893897 protein, X-linked (SRPX), mRNA. Homo sapiens interleukin 11 receptor, 2760148 NM_004512.3 ILIRA alpha (ILIRA), transcript variant 1, 3700.132 2.58808 mRNA. Homo sapiens jumonji, AT rich 1660546 NM_004187.2 JARIDIC interactive domain IC (JARIDIC), 291.57611 2.581248 mRNA. 7570598 NM_001848.2 COL6A1 Homo sapiens collagen, type VI, alpha 16447.124 2.5759639 1 (COL6A1), mRNA. Homo sapiens collagen, type VI, alpha 6250192 NM_057165.2 COL6A3 3 (COL6A3), transcript variant 3, 14079.27 2.5753849 mRNA. Homo sapiens ADAMTS-like 1 5890326 NM_052866.3 ADAMTSL1 (ADAMTSL1), transcript variant 2, 361.45524 2.5559389 mRNA. 5560300 NM_015719.3 COL5A3 Homo sapiens collagen, type V, alpha 348.89558 2.5504561 1 1 3 (COLSA3), mRNA.1 7650296 NM_133505.2 DCN Homo sapiens decorin (DCN), 32458.718 2.5421644 transcript variant C, mRNA. 294 WO 2011/150105 PCT/US2011/037969 Homo sapiens X-prolyl 4780544 NM_003399.5 XPNPEP2 aminopeptidase (aminopeptidase P) 2, 232.95383 2.5357663 membrane-bound (XPNPEP2), mRNA. 4200543 NM_015696.3 GPX7 Homo sapiens glutathione peroxidase 7 4897.5056 2.5199057 (GPX7), mRNA. Homo sapiens sarcoglycan, delta 70088 NM_000337.4 SGCD (35kDa dystrophin-associated 183.18525 2.49375 glycoprotein) (SGCD), transcript variant 1, mRNA. 4220259 NM_001336.2 CTSZ Homo sapiens cathepsin Z (CTSZ), 2717.5947 2.4839328 IIRNA. 2640195 NM_130830.2 LRRC15 Homo sapiens leucine rich repeat 717.82375 2.4622582 containing 15 (LRRC1S), mRNA. Homo sapiens family with sequence 1940274 NM_032036.2 FAM14A similarity 14, member A (FAM14A), 1894.1037 2.4409024 mRNA. Homo sapiens ADAM 1440224 NM_025220.2 ADAM33 metallopeptidase domain 33 194.67271 2.439097 (ADAM33), transcript variant 1, mRNA. 4890270 NM_002346.1 LY6E Homo sapiens lymphocyte antigen 6 5456.904 2.4299043 complex, locus E (LY6E), mRNA. 5360743 NM_001856.3 COL16A1 Homo sapiens collagen, type XVI, 3080.2386 2.4175636 1 alpha 1 (COL16A1), mRNA. 4290037 NM_002514.2 NOV Homo sapiens nephroblastoma 524.22522 2.3877704 overexpressed gene (NOV), mRNA. 52.52 23870 Homo sapiens serpin peptidase 3290630 NM_000624.3 SERPINA5 inhibitor, clade A (alpha-i 416.13525 2.3806033 antiproteinase, antitrypsin), member 5 (SERPINA5), mRNA. Homo sapiens inhibitor of DNA 7570324 NM_002167.2 ID3 binding 3, dominant negative helix- 5739.405 2.3745357 loop-helix protein (ID3), mRNA. 7400735 NM_002345.3 LUM Homo sapiens lumican (LUM), 1065.6829 2.3358737 mRNA. 1190025 NM 001330.2 CTF1 Homo sapiens cardiotrophin 1 (CTF1), 389.14071 2.3308377 1IIIRNA. 6980129 NM_153370.2 P116 Homo sapiens peptidase inhibitor 16 472.04838 2.327943 (P116), mRNA. Homo sapiens low density lipoprotein 2710286 NM_002332.2 LRP1 related protein 1 (alpha-2- 564.38776 2.3165126 macroglobulin receptor) (LRP1), mRNA. Homo sapiens matrix metallopeptidase 7150551 NM_001032360.1 MMP19 19 (MMP19), transcript variant 2, 228.77353 2.3140406 mRNA. Homo sapiens erythrocyte membrane 1510538 NM_012307.2 EPB41L3 protein band 4.1-like 3 (EPB41L3), 1731.7909 2.3117899 mRNA. Homo sapiens heparan sulfate 1500139 NM_006042.1 HS3ST3A1 (glucosamine) 3-0-sulfotransferase 3661.8096 2.2769896 3A1 (HS3ST3A1), mRNA. Homo sapiens extracellular matrix 3450521 NM_022664.1 ECM1 protein 1 (ECM1), transcript variant 2, 1221.5493 2.2711708 mRNA. Homo sapiens angiotensin I converting 3830398 NM_000789.2 ACE enzyme (peptidyl-dipeptidase A) 1 130.47994 2.2672559 (ACE), transcript variant 1, mRNA. 2940280 NM_014057.3 OGN Homo sapiens osteoglycin (OGN), 1125.5703 2.2525792 transcript variant 3, mRNA. 295 WO 2011/150105 PCT/US2011/037969 Homo sapiens collagen, type VI, alpha 3390458 NM_001849.3 COL6A2 2 (COL6A2), transcript variant 2C2, 9972.642 2.2237895 mRNA. 7400259 NM_000203.3 IDUA Homo sapiens iduronidase, alpha-L- 1203.2155 2.2169114 (JDUA), mRNA. Homo sapiens solute carrier family 1 7610433 NM_005628.1 SLC1A5 (neutral amino acid transporter), 2380.5841 2.197802 member 5 (SLC1A5), mRNA. 6040494 NM_006487.2 FBLN1 Homo sapiens fibulin 1 (FBLN1), 2839.9069 2.1865611 transcript variant A, mRNA. Homo sapiens ribonuclease, RNase A 6590041 NM_194431.1 RNASE4 family, 4 (RNASE4), transcript variant 3559.0261 2.1764928 3, mRNA. 780025 NM_001004019.1 FBLN2 Homo sapiens fibulin 2 (FBLN2), 126.30383 2.1743384 transcript variant 1, mRNA. 2810255 NM_015989.3 CSAD Homo sapiens cysteine sulfinic acid 733.76202 2.1739791 decarboxylase (CSAD), mRNA. Homo sapiens Fc fragment of IgA, 4250193 NM_133279.1 FCAR receptor for (FCAR), transcript variant 1070.4357 2.1734166 9, mRNA. Homo sapiens ribosome binding 4540327 NM_001042576.1 RRBP1 protein 1 homolog 180kDa (dog) 1004.4283 2.1651055 (RRBP1), transcript variant 1, mRNA. 6980064 NM_001718.4 BMP6 Homo sapiens bone morphogenetic 226.75524 2.1526819 protein 6 (BMP6), mRNA. 2510441 NM_024682.1 TBC1D17 Homo sapiens TBC1 domain family, 412.37375 2.1476749 member 17 (TBC1D17), mRNA. Homo sapiens myosin light chain 7160343 NM_053032.2 MYLK kinase (MYLK), transcript variant 8, 2447.908 2.1463432 mRNA. 7330292 NM_001998.2 FBLN2 Homo sapiens fibulin 2 (FBLN2), 4365.4193 2.145548 transcript variant 2, mRNA. Homo sapiens matrix metallopeptidase 4760626 NM_002426.2 MMP12 12 (macrophage elastase) (MMP12), 123.66018 2.1453509 mRNA. 3990563 NM_002171.1 IFNA1O Homo sapiens interferon, alpha 10 153.16947 2.1432179 (JFNA1O), mRNA. Homo sapiens procollagen C 4810445 NM_013363.2 PCOLCE2 endopeptidase enhancer 2 1192.2636 2.1384277 (PCOLCE2), mRNA. Homo sapiens retinol dehydrogenase 2340494 NM_016026.2 RDH11 11 (all-trans/9-cis/11-cis) (RDH11), 1134.6221 2.1339793 mRNA. Homo sapiens ADP-ribosylhydrolase 3390735 NM_199162.1 ADPRHL1 like 1 (ADPRHL1), transcript variant 201.35973 2.1327482 2, mRNA. 840309 NM_000230.1 LEP Homo sapiens leptin (obesity homolog, 391.5326 2.1324242 1 mouse) (LEP), mRNA. 60427 NM_005013.2 NUCB2 Homo sapiens nucleobindin 2 2275.6465 2.1256018 (NUCB2), mRNA. Homo sapiens dolichyl-phosphate 2850520 NM_018973.3 DPM3 mannosyltransferase polypeptide 3 1955.0771 2.12398 (DPM3), transcript variant 1, mRNA. Homo sapiens ATP-binding cassette, 3990441 NR_003087.1 ABCC13 sub-family C (CFTR/MRP), member 152.28097 2.1139142 13 (ABCC13) on chromosome 21. XR_017987 XR_017988 XR_017989 Homo sapiens amylase, alpha 1A 1740220 NM_004038.3 AMYlA (salivary) (AMY1A), transcript variant 2341.8403 2.1082485 1, mRNA. 296 WO 2011/150105 PCT/US2011/037969 Homo sapiens sphingomyelin 1500193 NM_001007593.1 SMPD1 phosphodiesterase 1, acid lysosomal 505.82493 2.0879872 (SMPD1), transcript variant 2, mRNA. Homo sapiens cAMP responsive 3060326 NM_052854.2 CREB3L1 element binding protein 3-like 1 166.58385 2.0704775 (CREB3L1), mRNA. 4120243 NM_002784.2 PSG9 Homo sapiens pregnancy specific beta- 190.71136 2.065436 1-glycoprotein 9 (PSG9), mRNA. 60681 NM_021939.2 FKBP1O Homo sapiens FK506 binding protein 1351.2798 2.0617279 10, 65 kDa (FKBP1O), mRNA. 4150753 NM_017946.2 FKBP14 Homo sapiens FK506 binding protein 2023.715 2.0590188 14, 22 kDa (FKBP14), mRNA. 6220019 NM_006211.2 PENK Homo sapiens proenkephalin (PENK), 2097.356 2.0539128 mRNA. Homo sapiens Clq and tumor necrosis 1510092 NM_182486.1 C1QTNF6 factor related protein 6 (C1QTNF6), 188.82065 2.0514252 transcript variant 2, mRNA. 6450543 NM_000099.2 CST3 Homo sapiens cystatin C (CST3), 23004.187 2.0506108 mRNA. Homo sapiens blocked early in 3130672 NM_016526.3 BETIL transport 1 homolog (S. cerevisiae)- 465.84189 2.0461326 like (BETIL), mRNA. Homo sapiens protein kinase C 2850639 NM_001001329.1 PRKCSH substrate 80K-H (PRKCSH), transcript 571.36313 2.0248404 variant 2, mRNA. 1780673 NM_003864.3 SAP30 Homo sapiens Sin3A-associated 1185.3361 2.0248244 protein, 3OkDa (SAP3O), mRNA. Homo sapiens MYC-associated zinc 4830689 NM_001042539.1 MAZ finger protein (purine-binding 560.62788 2.019431 transcription factor) (MAZ), transcript variant 2, mRNA. Homo sapiens ribonuclease, RNase A 7040333 NM_194430.1 RNASE4 family, 4 (RNASE4), transcript variant 837.14322 2.0098338 1, mRNA. Homo sapiens beta-site APP-cleaving 1240201 NM_138991.1 BACE2 enzyme 2 (BACE2), transcript variant 440.09484 2.0077282 c, mRNA. Homo sapiens proline/arginine-rich 7000446 NM_201348.1 PRELP end leucine-rich repeat protein 214.38178 2.0044344 (PRELP), transcript variant 2, mRNA. Homo sapiens FK506 binding protein 1010068 NM_004470.2 FKBP2 2, l3kDa (FKBP2), transcript variant 2125.5403 2.0005209 1, mRNA. ASCi P8 D14 Chondro Pellet ProbelD RefSeqjID Symbol Definition RFU Fold over -- Ave Homo sapiens carboxylesterase 1 2680056 NM_001025195.1 CESI (monocyte/macrophage serine esterase 1279.2183 20.662215 1) (CES 1), transcript variant 1, mRNA. Homo sapiens serpin peptidase 3290630 NM_000624.3 SERPINA5 inhibitor, clade A (alpha-i 3139.7591 17.961759 antiproteinase, antitrypsin), member 5 (SERPINA5), mRNA. Homo sapiens interleukin 1 receptor 6020300 NM_003856.2 ILIRLI like 1 (ILIRLI), transcript variant 2, 1753.8156 16.925494 mRNA. 297 WO 2011/150105 PCT/US2011/037969 Homo sapiens laminin, alpha 2 1470296 NM_000426.3 LAMA2 (merosin, congenital muscular 2862.6472 14.809618 dystrophy) (LAMA2), transcript variant 1, mRNA. 3370162 NM_006108.2 SPONI Homo sapiens spondin 1, extracellular 2023.715 14.524177 matrix protein (SPONI), mRNA. 2710735 NM_016084.3 RASD1 Homo sapiens RAS, dexamethasone- 3687.3715 12.860481 induced 1 (RASD1), mRNA. Homo sapiens laminin, alpha 2 360181 NM_001079823.1 LAMA2 (merosin, congenital muscular 2367.9966 11.576579 dystrophy) (LAMA2), transcript variant 2, mRNA. 5550719 NM_133503.2 DCN Homo sapiens decorin (DCN), 13153.34 10.336565 transcript variant A2, mRNA. Homo sapiens serpin peptidase inhibitor, clade G (Cl inhibitor), 2030309 NM_001032295.1 SERPINGI member 1, (angioedema, hereditary) 4656.3031 10.280745 (SERPINGI), transcript variant 2, mRNA. Homo sapiens WNT1 inducible 4120553 NM_003881.2 WISP2 signaling pathway protein 2 (WISP2), 2813.1919 9.8986763 mRNA. Homo sapiens hypoxia-inducible 7320441 NM_013332.3 HIG2 protein 2 (HIG2), transcript variant 1, 3374.7597 9.7624731 mRNA. 7150634 NM_001647.2 APOD Homo sapiens apolipoprotein D 7271.1268 9.2278535 (APOD), inRNA. 840309 NM_000230.1 LEP Homo sapiens leptin (obesity homolog, 1626.518 8.8585892 mouse) (LEP), mRNA. 2810673 NM_152739.3 HOXA9 Homo sapiens homeobox A9 1192.5484 8.4277309 (HOXA9), mRNA. 4760095 NM_004750.2 CRLF1 Homo sapiens cytokine receptor-like 4548.4928 8.0044183 factor 1 (CRLF1), mRNA. Homo sapiens matrix metallopeptidase 3800088 NM_002423.3 MMP7 7 (matrilysin, uterine) (MMP7), 1401.5296 7.7650296 mRNA. 1510181 NM_004878.3 PTGES Homo sapiens prostaglandin E 4852.0339 7.7614255 synthase (PTGES), mRNA. 2100228 NM_001937.3 DPT Homo sapiens dermatopontin (DPT), 11721.186 7.5943298 IIRNA. 3830075 NM_001218.3 CA12 Homo sapiens carbonic anhydrase XII 2404.0568 7.5824417 (CA12), transcript variant 1, mRNA. 6960148 NM_004684.2 SPARCL1 Homo sapiens SPARC-like 1 (mast9, 863.5826 7.3145202 hevin) (SPARCL1), mRNA. Homo sapiens protein tyrosine 3850603 NM_002846.2 PTPRN phosphatase, receptor type, N 1006.0832 7.1573597 (PTPRN), mRNA. 5260474 NM_001733.4 CIR Homo sapiens complement component 5908.2373 7.1080134 1, r subcomponent (C1R), mRNA. 1110048 NM_007281.1 SCRG1 Homo sapiens scrapie responsive 9395.8299 7.1013979 protein 1 (SCRG1), mRNA. 1780673 NM_003864.3 SAP30 Homo sapiens Sin3A-associated 4057.9473 6.9318992 protein, 3OkDa (SAP3O), mRNA. Homo sapiens acyl-CoA synthetase 1030431 NM_001995.2 ACSL1 long-chain family member 1 (ACSL1), 2321.2472 6.8354979 mRNA. 5290707 NM_004917.3 KLK4 Homo sapiens kallikrein-related 1010.7487 6.6165091 peptidase 4 (KLK4), mRNA. 240274 NM_000877.2 ILIRI Homo sapiens interleukin 1 receptor, 1143.8901 6.6060061 type I (IRI), mRNA. 298 WO 2011/150105 PCT/US2011/037969 Homo sapiens transforming growth 3190379 NM_003243.2 TGFBR3 factor, beta receptor III (TGFBR3), 3226.2173 6.5124495 mRNA. Homo sapiens WNT1 inducible 2320564 NM_003882.2 WISPI signaling pathway protein 1 (WISPI), 1559.7164 6.5088257 transcript variant 1, mRNA. Homo sapiens complement component 7400707 NM_001734.2 CiS 1, s subcomponent (CIS), transcript 6733.5934 6.4035748 variant 1, mRNA. Homo sapiens Clq and tumor necrosis 5220639 NM_030945.2 C1QTNF3 factor related protein 3 (C1QTNF3), 694.85265 6.2577903 transcript variant 1, mRNA. 70167 NM_015364.2 LY96 Homo sapiens lymphocyte antigen 96 1720.9615 6.046264 (LY96), mRNA. 5390687 NM_001873.1 CPE Homo sapiens carboxypeptidase E 5260.306 5.8776569 (CPE), mRNA. Homo sapiens N-acetylated alpha 4120626 NM_005468.2 NAALADL1 linked acidic dipeptidase-like 1 528.65369 5.7676091 (NAALADL1), mRNA. 3830465 NM_001645.3 APOCI Homo sapiens apolipoprotein C-I 1160.4304 5.6395807 (APOCI), mRNA. 2360148 NM_000095.2 COMP Homo sapiens cartilage oligomeric 15780.728 5.6043009 matrix protein (COMP), mRNA. Homo sapiens insulin-like growth 3310400 NM_000618.2 IGF1 factor 1 (somatomedin C) (JGF1), 457.67507 5.5005898 mRNA. Homo sapiens matrix metallopeptidase 7400400 NM_002422.3 MMP3 3 (stromelysin 1, progelatinase) 1150.6465 5.3912917 (MMP3), mRNA. Homo sapiens X-prolyl 4780544 NM_003399.5 XPNPEP2 aminopeptidase (aminopeptidase P) 2, 481.75833 5.2440713 membrane-bound (XPNPEP2), mRNA. Homo sapiens retinoic acid receptor 5290608 NM_002889.2 RARRES2 responder (tazarotene induced) 2 6200.4392 5.2305786 (RARRES2), mRNA. Homo sapiens interleukin 1 receptor 5420754 NM_003856.2 ILIRLI like 1 (ILIRLI), transcript variant 2, 492.00914 5.07913 mRNA. Homo sapiens gonadotropin-releasing 5080017 NM_001501.1 GNRH2 hormone 2 (GNRH2), transcript 406.13997 4.9609999 variant 1, mRNA. Homo sapiens ADAM 6900086 NM_006988.3 ADAMTS1 metallopeptidase with thrombospondin 2909.3212 4.9360752 type 1 motif, 1 (ADAMTS 1), mRNA. 5290333 NM_152520.3 ZNF533 Homo sapiens zinc finger protein 533 431.19012 4.9067868 (ZNFS33), mRNA. Homo sapiens reversion-inducing 3390487 NM_021111.1 RECK cysteine-rich protein with kazal motifs 1992.6388 4.8609186 (RECK), mRNA. Homo sapiens serpin peptidase 6290356 NM_002615.4 SERPINFI inhibitor, clade F (alpha-2 antiplasmin, 3603.6146 4.8322926 pigment epithelium derived factor), member 1 (SERPINF1), mRNA. Homo sapiens mannan-binding lectin 580360 NM_001031849.1 MASPI seine peptidase 1 (C4/C2 activating 432.40664 4.7282071 component of Ra-reactive factor) (MASP1), transcript variant 3, mRNA. 299 WO 2011/150105 PCT/US2011/037969 Homo sapiens procollagen-lysine, 2 4640187 NM_000935.2 PLOD2 oxoglutarate 5-dioxygenase 2 5985.4358 4.6024992 (PLOD2), transcript variant 2, mRNA. 1510392 NM_002291.1 LAMBI Homo sapiens laminin, beta 1 3094.9801 4.4954627 (LAMB 1), mRNA. Homo sapiens ADAM 7150609 NM_021599.1 ADAMTS2 tallopeptidase wi MStnip 431.46106 4.4946128 type 1 motif, 2 (ADAVTS2), transcript variant 2, mRNA. Homo sapiens ribonuclease, RNase A 7040333 NM_194430.1 RNASE4 family, 4 (RNASE4), transcript variant 1843.8252 4.4267005 1, mRNA. 1710484 NM_002023.3 FMOD Homo sapiens fibromodulin (FMOD), 1056.1743 4.406176 mRNA. 1430487 NM_000900.2 MGP Homo sapiens matrix Gla protein 15873.563 4.3823785 (MGP), mRNA. 3930020 NM_003793.2 CTSF Homo sapiens cathepsin F (CTSF), 710.31785 4.2734759 IIRNA. 6350367 NM_006551.3 SCGB1D2 Homo sapiens secretoglobin, family 225.59646 4.2644554 ID, member 2 (SCGB1ID2), mRNA. 6180427 NM_015714.2 GOS2 Homo sapiens GO/Glswitch 2 (GOS2), 702.16445 4.2131981 mRNA. Homo sapiens serpin peptidase 6280168 NM_001085.4 SERPINA3 inhibitor, clade A (alpha-i 6141.2795 4.1679731 antiproteinase, antitrypsin), member 3 (SERPINA3), mRNA. Homo sapiens matrix metallopeptidase 510736 NM_004530.2 MMP2 2 (gelatinase A, 72kDa gelatinase, 1747.8246 4.0538407 72kDa type IV collagenase) (MMP2), mRNA. 5340358 NM_000504.3 F1O Homo sapiens coagulation factor X 423.3292 4.0432837 (FlO), mRNA. 1090326 NM_003256.2 TIMP4 Homo sapiens TIMP metallopeptidase 1533.6102 3.9979985 inhibitor 4 (TJIP4), mRNA. Homo sapiens complement component 1300327 NM_201442.1 CiS 1, s subcomponent (CIS), transcript 676.82286 3.9349554 variant 2, mRNA. Homo sapiens collagen, type VI, alpha 2470114 NM_004369.2 COL6A3 3 (COL6A3), transcript variant 1, 13217.852 3.9150313 mRNA. 7200427 NM_017413.3 APLN Homo sapiens apelin (APLN), mRNA. 386.6306 3.8852622 Homo sapiens ADAM 3400600 NM_014244.2 ADAMTS2 metallopeptidase with thrombospondin 419.61807 3.8596631 type 1 motif, 2 (ADAMTS2), transcript variant 1, mRNA. 150474 NM_001218.3 CA12 Homo sapiens carbonic anhydrase XII 4889.6842 3.8476087 (CA12), transcript variant 1, mRNA. 1430278 NM_000396.2 CTSK Homo sapiens cathepsin K (CTSK), 3284.7252 3.7562145 mRNA. 730414 NM_000041.2 APOE Homo sapiens apolipoprotein E 9309.5316 3.7498944 (APOE), inRNA. Homo sapiens prostaglandin endoperoxide synthase 1 1070450 NM_080591.1 PTGS1 (prostaglandin G/H synthase and 3611.9826 3.7023632 cyclooxygenase) (PTGS 1), transcript variant 2, mRNA. 5050131 NM_006485.3 FBLN1 Homo sapiens fibulin 1 (FBLN1), 246.85538 3.6183322 transcript variant B, mRNA. 270575 NR_003276.1 CES4 Homo sapiens carboxylesterase 4-like 200.76984 3.5777391 (CES4) on chromosome 16. 300 WO 2011/150105 PCT/US2011/037969 Homo sapiens fibroblast growth factor 5560138 NM_002009.2 FGF7 7 (keratinocyte growth factor) (FGF7), 207.3646 3.5094375 mRNA. Homo sapiens proline/arginine-rich 7000446 NM_201348.1 PRELP end leucine-rich repeat protein 373.28525 3.4901557 (PRELP), transcript variant 2, mRNA. 4860494 NM000064.1 C3 Homo sapiens complement component 258.12802 3.4727939 486094 N_00064. C33 (C3), mRNA. 1690563 NM_199161.1 SAA1 Homo sapiens serum amyloid Al 481.75833 3.4606675 (SAA1), transcript variant 2, mRNA. Homo sapiens lymphotoxin beta 4640064 NM_002342.1 LTBR receptor (TNFR superfamily, member 2131.2603 3.4397594 3) (LTBR), mRNA. Homo sapiens ribonuclease, RNase A 6590041 NM_194431.1 RNASE4 family, 4 (RNASE4), transcript variant 5609.1248 3.4302137 3, mRNA. Homo sapiens angiogenin, 3930392 NM_001097577.1 ANG ribonuclease, RNase A family, 5 3155.027 3.4195435 (ANG), transcript variant 2, mRNA. 5490019 NM_002084.3 GPX3 Homo sapiens glutathione peroxidase 3 1183.637 3.4012039 (plasma) (GPX3), mRNA. Homo sapiens alanyl (membrane) aminopeptidase (aminopeptidase N, 5810612 NM_001150.1 ANPEP aminopeptidase M, microsomal 2786.331 3.3289088 aminopeptidase, CD13, p150) (ANPEP), mRNA. Homo sapiens collagen, type VI, alpha 6250192 NM_057165.2 COL6A3 3 (COL6A3), transcript variant 3, 18155.869 3.3210776 mRNA. Homo sapiens sarcoglycan, delta 2450327 NM_172244.2 SGCD (35kDa dystrophin-associated 392.01652 3.290744 glycoprotein) (SGCD), transcript variant 2, mRNA. Homo sapiens serpin peptidase inhibitor, clade G (Cl inhibitor), 3450538 NM_000062.2 SERPINGI member 1, (angioedema, hereditary) 263.02847 3.2581769 (SERPINGI), transcript variant 1, mRNA. Homo sapiens procollagen-proline, 2 4220731 NM_000917.2 P4HA1 oxoglutarate 4-dioxygenase (proline 4- 7123.9139 3.2407653 hydroxylase), alpha polypeptide I (P4HA1), transcript variant 1, mRNA. 5560674 NM_000237.2 LPL Homo sapiens lipoprotein lipase 266.31091 3.2036576 (LPL), mRNA. 7400735 NM_002345.3 LUM Homo sapiens lumican (LUM), 1459.3704 3.1987986 IIRNA. 5820025 NM_001426.3 ENI Homo sapiens engrailed homeobox 1 214.21445 3.1362738 (ENI), mRNA. Homo sapiens procollagen C 4810445 NM_013363.2 PCOLCE2 endopeptidase enhancer 2 1736.6329 3.1148011 (PCOLCE2), mRNA. 1500725 NM_001765.2 CD1C Homo sapiens CD1c molecule 591.15428 3.1015479 (CD1C), mRNA. 5670594 NM_021077.3 NMB Homo sapiens neuromedin B (NMB), 1495.0994 3.0767196 transcript variant 1, mRNA. 3990561 NM_002347.2 LY6H Homo sapiens lymphocyte antigen 6 339.57308 3.0682979 complex, locus H (LY6H), mRNA. 780025 NM_001004019.1 FBLN2 Homo sapiens fibulin 2 (FBLN2), 178.16822 3.067191 transcript variant 1, mRNA. 301 WO 2011/150105 PCT/US2011/037969 Homo sapiens matrix metallopeptidase 7100338 NM_001032278.1 MMP28 28 (MMP28), transcript variant 3, 483.42463 3.0569024 mRNA. Homo sapiens WNT1 inducible 870431 NM_080838.1 WISPI signaling pathway protein 1 (WISPI), 227.38201 3.0405708 transcript variant 2, mRNA. 2370593 NM_005708.2 GPC6 Homo sapiens glypican 6 (GPC6), 1379.6024 2.9829186 mRNA. Homo sapiens vitamin K epoxide 6450546 NM_024006.4 VKORC1 reductase complex, subunit 1 3960.6569 2.976159 (VKORC1), transcript variant 1, mRNA. 5890288 NM_003377.3 VEGFB Homo sapiens vascular endothelial 1310.9029 2.9721981 growth factor B (VEGFB), mRNA. 6040494 NM_006487.2 FBLN1 Homo sapiens fibulin 1 (FBLN1), 3835.0556 2.952767 transcript variant A, mRNA. 6550762 NM_001998.2 FBLN2 Homo sapiens fibulin 2 (FBLN2), 5578.7437 2.925259 transcript variant 2, mRNA. Homo sapiens extracellular matrix 3440386 NM_004425.2 ECM1 protein 1 (ECM1), transcript variant 1, 1362.4117 2.9097423 mRNA. 5700201 NM_003377.3 VEGFB Homo sapiens vascular endothelial 266.41888 2.8737329 growth factor B (VEGFB), mRNA. 50368 NM_001920.3 DCN Homo sapiens decorin (DCN), 6849.601 2.8357807 transcript variant Al, mRNA. 4230343 NM_001871.2 CPB1 Homo sapiens carboxypeptidase B 1 207.94027 2.8254825 (tissue) (CPB 1), mRNA. Homo sapiens wingless-type MMTV 4730176 NM_004626.2 WNT11 integration site family, member 11 248.09985 2.8045125 (WNT11), mRNA. Homo sapiens proprotein convertase 520176 NM_000439.3 PCSK1 subtilisin/kexin type 1 (PCSK1), 191.68142 2.8033921 mRNA. Homo sapiens low density lipoprotein 2710286 NM_002332.2 LRP1 related protein 1 (alpha-2- 675.1677 2.7712056 macroglobulin receptor) (LRP1), mRNA. Homo sapiens FXYD domain 3850500 NM_005031.3 FXYD1 containing ion transport regulator 1 260.32603 2.770188 (phospholemman) (FXYD1), transcript variant a, mRNA. Homo sapiens chromosome 6 open 1190082 NM_001040437.1 C6orf48 reading frame 48 (C6orf48), transcript 301.30531 2.7663783 variant 1, mRNA. Homo sapiens inhibitor of DNA 7570324 NM_002167.2 ID3 binding 3, dominant negative helix- 6650.5519 2.7515 loop-helix protein (ID3), mRNA. 620255 NM_012193.2 FZD4 Homo sapiens frizzled homolog 4 1360.4313 2.7470366 (Drosophila) (FZD4), mRNA. Homo sapiens ectonucleotide 840678 NM_001040092.1 ENPP2 pyrophosphatase/phosphodiesterase 2 830.71431 2.7413821 (autotaxin) (ENPP2), transcript variant 2, mRNA. Homo sapiens jumonji, AT rich 1660546 NM_004187.2 JARIDIC interactive domain IC (JARIDIC), 303.86586 2.690046 mRNA. Homo sapiens neuroblastoma, 7100010 NM_005380.4 NBL1 suppression of tumorigenicity 1 7526.9794 2.6774062 (NBL1), transcript variant 2, mRNA. 5570270 NM_002103.3 GYS1 Homo sapiens glycogen synthase 1 769.14145 2.6576962 (muscle) (GYS 1), mRNA. 302 WO 2011/150105 PCT/US2011/037969 4900133 NM_006307.3 SRPX Homo sapiens sushi-repeat-containing 14223.845 2.6432891 protein, X-linked (SRPX), mRNA. Homo sapiens Clq and tumor necrosis 1500373 NM_181435.4 C1QTNF3 factor related protein 3 (C1QTNF3), 242.27662 2.6038607 transcript variant 2, mRNA. 6940053 NM_014917.2 NTNG1 Homo sapiens netrin GI (NTNG1), 312.90022 2.5839095 transcript variant 3, mRNA. Homo sapiens extracellular matrix 6840192 NM_001393.2 ECM2 protein 2, female organ and adipocyte 738.12316 2.5745488 specific (ECM2), mRNA. 2370438 NM_000014.4 A2M Homo sapiens alpha-2-macroglobulin 257.71077 2.5649894 (A2M), mRNA. 3890095 NM_003102.2 SOD3 Homo sapiens superoxide dismutase 3' 284.80664 2.5638609 extracellular (SOD3), mRNA. Homo sapiens sema domain, 1580608 NM_012431.1 SEMA3E immunoglobulin domain (Ig), short 1946.6975 2.5582811 basic domain, secreted, (semaphorin) 3E (SEMA3E), mRNA. 10142 NM_006016.3 CD164 Homo sapiens CD164 molecule, 449.01608 2.542163 sialomucin (CD164), mRNA. Homo sapiens prostaglandin endoperoxide synthase 1 6840626 NM_000962.2 PTGS1 (prostaglandin G/H synthase and 462.54735 2.5297298 cyclooxygenase) (PTGS 1), transcript variant 1, mRNA. Homo sapiens family with sequence 1940274 NM_032036.2 FAM14A similarity 14, member A (FAM14A), 1953.8538 2.5179014 mRNA. Homo sapiens cysteine-rich with EGF 2940561 NM_001031717.1 CRELDI like domains 1 (CRELDI), transcript 214.88842 2.5168938 variant 1, mRNA. Homo sapiens ATP-binding cassette, 3990441 NR_003087.1 ABCC13 sub-family C (CFTR/MRP), member 179.4382 2.4909019 13 (ABCC13) on chromosome 21. XR_017987 XR_017988 XR_017989 Homo sapiens SWI/SNF related, 1580327 NM_003077.2 SMARCD2 matrix associated, actin dependent 941.7056 2.4831349 regulator of chromatin, subfamily d, member 2 (SMARCD2), mRNA. Homo sapiens Fc fragment of IgA, 4250193 NM_133279.1 FCAR receptor for (FCAR), transcript variant 1216.8699 2.4707372 9, mRNA. Homo sapiens dipeptidyl-peptidase 4 4830255 NM_001935.3 DPP4 (CD26, adenosine deaminase 258.39985 2.4624343 complexing protein 2) (DPP4), mRNA. Homo sapiens epidermal growth factor 1050671 NM_005228.3 EGFR receptor (erythroblastic leukemia viral 906.39543 2.4520536 (v-erb-b) oncogene homolog, avian) (EGFR), transcript variant 1, mRNA. Homo sapiens interleukin 17 receptor 4060017 NM_001080973.1 IL17RD D (IL17RD), transcript variant 1, 1066.1392 2.4469016 mRNA. Homo sapiens carboxylesterase 2 3850471 NM_003869.4 CES2 (intestine, liver) (CES2), transcript 350.90878 2.4467251 variant 1, mRNA. Homo sapiens ribonuclease, RNase A 5910382 NM_194430.1 RNASE4 family, 4 (RNASE4), transcript variant 1755.9617 2.4400091 1, mRNA. 303 WO 2011/150105 PCT/US2011/037969 2810255 NM_015989.3 CSAD Homo sapiens cysteine sulfinic acid 822.28392 2.4362505 decarboxylase (CSAD), mRNA. Homo sapiens biliverdin reductase B 6620521 NM_000713.1 BLVRB (flavin reductase (NADPH)) 608.88186 2.4327729 (BLVRB), mRNA. Homo sapiens ADP-ribosylhydrolase 3390735 NM_199162.1 ADPRHL1 like 1 (ADPRHL1), transcript variant 229.59233 2.4317803 2, mRNA. Homo sapiens baculoviral IAP repeat 3060255 NM_182962.1 BIRC3 containing 3 (BIRC3), transcript 1286.0277 2.3855063 variant 2, mRNA. 3060639 NM_003013.2 SFRP2 Homo sapiens secreted frizzled-related 2364.5975 2.3678544 protein 2 (SFRP2), mRNA. Homo sapiens short stature homeobox 2000739 NM_006884.2 SHOX2 2 (SHOX2), transcript variant 226.64285 2.3672038 SHOX2a, mRNA. 4150753 NM_017946.2 FKBP14 Homo sapiens FK506 binding protein 2326.433 2.3670178 14, 22 kDa (FKBP14), mRNA. 5570682 NM_024769.2 ASAM Homo sapiens adipocyte- specific 1482.786 2.3664019 adhesion molecule (AS AMV), mRNA. 18.8 .641 Homo sapiens ectonucleotide 2490152 NM_001040092.1 ENPP2 pyrophosphatase/phosphodiesterase 2 540.53982 2.3655894 (autotaxin) (ENPP2), transcript variant 2, mRNA. 580739 NM_001996.2 FBLN1 Homo sapiens fibulin 1 (FBLN1), 5474.6211 2.3614494 transcript variant C, mRNA. Homo sapiens fibroblast growth factor 6770128 NM_023106.2 FGFR1 receptor 1 (fins-related tyrosine kinase 262.57279 2.3525859 2, Pfeiffer syndrome) (FGFR1), transcript variant 4, mRNA. 6400358 NM 001766.3 CD1D Homo sapiens CD1d molecule 213.60177 2.3197914 1 - (CD1D), inRNA. 3990563 NM_002171.1 IFNA1O Homo sapiens interferon, alpha 10 165.57286 2.3167719 (JFNA1O), mRNA. Homo sapiens FXYD domain 5860022 NM_021902.2 FXYD1 containing ion transport regulator 1 211.66401 2.305936 (phospholemman) (FXYD1), transcript variant b, mRNA. Homo sapiens FK506 binding protein 1010068 NM_004470.2 FKBP2 2, 13kDa (FKBP2), transcript variant 2444.995 2.3011861 1, mRNA. 2680072 NM_014279.4 OLFM1 Homo sapiens olfactomedin 1 355.76563 2.2750708 (OLFM1), transcript variant 1, mRNA. 4830685 NM_006486.2 FBLN1 Homo sapiens fibulin 1 (FBLN1), 12107.229 2.2540418 transcript variant D, mRNA. 7330292 NM_001998.2 FBLN2 Homo sapiens fibulin 2 (FBLN2), 4581.7084 2.2518513 transcript variant 2, mRNA. 5080139 NM_002771.2 PRSS3 Homo sapiens protease, seine, 3 208.64978 2.2466028 (mesotrypsin) (PRSS3), mRNA. Homo sapiens AT rich interactive 6510553 NM_005224.2 ARID3A domain 3A (BRIGHT-like) (ARID3A), 1726.8608 2.2415686 mRNA. Homo sapiens leucine rich repeat (in 3400754 NM_004735.2 LRRFIP1 FLII) interacting protein 1 (LRRFIP1), 2793.5261 2.2244225 mRNA. Homo sapiens prostaglandin 12 7150762 NM_000961.3 PTGIS (prostacyclin) synthase (PTGIS), 1963.5723 2.2077569 mRNA. 304 WO 2011/150105 PCT/US2011/037969 Homo sapiens asparagine-linked 6370113 NM_013338.3 ALG5 glycosylation 5 homolog (S. 2084.7261 2.1978944 cerevisiae, dolichyl-phosphate beta glucosyltransferase) (ALG5), mRNA. 6040736 NM_032777.6 GPR124 Homo sapiens G protein-coupled 1448.328 2.1971346 receptor 124 (GPR124), mRNA. Homo sapiens hypothetical protein 520403 NM_144736.3 PRO1853 PRO1853 (PRO1853), transcript 319.83075 2.1967374 variant 1, mRNA. 3360066 NM_001146.3 ANGPT1 Homo sapiens angiopoietin 1 869.06032 2.1952857 (ANGPT 1), mRNA. Homo sapiens serpin peptidase 3710296 NM_000934.3 SERPINF2 inhibitor, clade F (alpha-2 antiplasmin, 137.71814 2.1897156 pigment epithelium derived factor), member 2 (SERPINF2), mRNA. 4890270 NM_002346.1 LY6E Homo sapiens lymphocyte antigen 6 4913.3296 2.1878562 complex, locus E (LYE), mRNA. Homo sapiens elastin (supravalvular 6130577 NM_001081754.1 ELN aortic stenosis, Williams-Beuren 4282.2642 2.186327 syndrome) (ELN), transcript variant 4, mRNA. Homo sapiens follicular lymphoma 160537 NM_002035.1 FVT1 variant translocation 1 (FVT1), 1499.8892 2.1807531 mRNA. 7650296 NM_133505.2 DCN Homo sapiens decorin (DCN), 27760.729 2.1742183 transcript variant C, mRNA. Homo sapiens collagen, type X, alpha 4730324 NM_000493.3 COL1OA1 1(Schld metaphyseal 1098.2599 2.1653446 chondrodysplasia) (COLlOAl),10829 2.636 mRNA. Homo sapiens heart and neural crest 4640563 NM_021973.2 HAND2 derivatives expressed 2 (HAND2), 267.25457 2.160325 mRNA. Homo sapiens erythrocyte membrane 1510538 NM_012307.2 EPB41L3 protein band 4.1-like 3 (EPB41L3), 1612.176 2.1521144 mRNA. 2940450 NM_138995.1 MYO3B Homo sapiens myosin IIIB (MYO3B), 233.91018 2.1294627 1 mRNA. 4880609 NM_012242.2 DKK1 Homo sapiens dickkopf homolog 1 136.83591 2.1189277 (Xenopus laevis) (DKK1), mRNA. 770156 NM_203422.1 LOC221091 Homo sapiens similar to hypothetical 159.05 2.1168242 protein (L0C221091), mRNA. Homo sapiens deleted in lymphocytic 1260612 NR_002605.1 DLEU1 leukemia, 1 (DLEU1) on chromosome 210.84631 2.1099642 13. Homo sapiens collagen, type VI, alpha 2750356 NM_001849.3 COL6A2 2 (COL6A2), transcript variant 2C2, 5709.1668 2.0911742 mRNA. 3990703 NM_000572.2 IL1O Homo sapiens interleukin 10 (IL1O), 1659.324 2.0827905 mRNA. 430088 NM_006487.2 FBLN1 Homo sapiens fibulin 1 (FBLN1), 127.03746 2.0633958 transcript variant A, mRNA. Homo sapiens gelsolin (amyloidosis, 3940204 NM_000177.3 GSN Finnish type) (GSN), transcript variant 198.09373 2.056789 1, mRNA. Homo sapiens fucosyltransferase 11 1710181 NM_173540.2 FUT1I (alpha (1,3) fucosyltransferase) 179.74528 2.0461989 (FUT11), mRNA. Homo sapiens complement component 5810424 NM_016546.1 CIRL 1, r subcomponent-like (C1RL), 891.25472 2.0391888 mRNA. 305 WO 2011/150105 PCT/US2011/037969 840392 NM_016297.2 PCYOX1 Homo sapiens prenylcysteine oxidase 2661.3662 2.0260096 1 (PCYOX1), mRNA. Homo sapiens tissue factor pathway 4280674 NM_001032281.2 TFPI inhibitor (lipoprotein-associated 284.02021 2.0192782 coagulation inhibitor) (TFPI), transcript variant 2, mRNA. Homo sapiens gonadotropin-releasing 2340553 NM_000825.3 GNRH1 hormone 1 (luteinizing-releasing 269.04897 2.009401 hormone) (GNRH1), transcript vacant 1, mRNA. 4060139 NM_005393.1 PLXNB3 Homo sapiens plexin B3 (PLXNB3), 160.16283 2.0087789 IIRNA. Homo sapiens C1q and tumor necrosis 6180719 NM_198593.1 C1QTNF1 factor related protein 1 (C1QTNF1), 158.5559 2.0082489 transcript variant 2, mRNA. Homo sapiens cartilage intermediate 6400427 NM_003613.2 CILP layer protein, nucleotide 727.80265 2.0037909 pyrophosphohydrolase (CILP), mRNA. ASCi P81D14 Chondro MM ProbelD RefSeq_ID Symbol Definition RFU Fold over Homo sapiens matrix metallopeptidase 7400400 NM_002422.3 MMP3 3 (stromelysin 1, progelatinase) 7108.8637 33.308196 (MMP3), mRNA. 5490019 NM_002084.3 GPX3 Homo sapiens glutathione peroxidase 3 8262.2099 23.74162 (plasma) (GPX3), mRNA. 2630437 NM_022138.1 SMOC2 Homo sapiens SPARC related modular 2316.0611 23.046219 calcium binding 2 (SMOC2), mRNA. Homo sapiens cartilage intermediate 6400427 NM_003613.2 CILP layer protein, nucleotide 7526.9794 20.723327 pyrophosphohydrolase (CILP), mRNA. Homo sapiens WNT1 inducible 4120553 NM_003881.2 WISP2 signaling pathway protein 2 (WISP2), 5832.8319 20.523774 mRNA. 3370162 NM 006108.2 SPONI Homo sapiens spondin 1, extracellular 2573.9904 18.473496 matrix protein (SPONI), mRNA. 2100228 NM_001937.3 DPT Homo sapiens dermatopontin (DPT), 25120.052 16.275654 mRNA. Homo sapiens laminin, alpha 2 1470296 NM_000426.3 LAMA2 (merosin, congenital muscular 2793.5261 14.452027 dystrophy) (LAMA2), transcript variant 1, mRNA. Homo sapiens insulin-like growth 3310400 NM_000618.2 IGF1 factor 1 (somatomedin C) (JGF1), 1181.2435 14.196832 mRNA. 7150634 NM_001647.2 APOD Homo sapiens apolipoprotein D 10564.173 13.407089 (APOD), mRNA. Homo sapiens serpin peptidase inhibitor, clade G (Cl inhibitor), 2030309 NM_001032295.1 SERPINGI member 1, (angioedema, hereditary) 5619.4093 12.407206 (SERPINGI), transcript variant 2, mRNA. Homo sapiens laminin, alpha 2 360181 NM_001079823.1 LAMA2 (merosin, congenital muscular 2516.9678 12.304865 dystrophy) (LAMA2), transcript variant 2, mRNA. 4920221 NM_000587.2 C7 Homo sapiens complement component 1388.2357 11.719473 7 (C7), mRNA. 306 WO 2011/150105 PCT/US2011/037969 3060639 NM_003013.2 SFRP2 Homo sapiens secreted frizzled-related 10528.006 10.542508 protein 2 (SFRP2), mRNA. 1110048 NM_007281.1 SCRG1 Homo sapiens scrapie responsive 13864.881 10.479121 protein 1 (SCRG1), mRNA. 3890095 NM_003102.2 SOD3 Homo sapiens superoxide dismutase 3' 1162.3444 10.463553 extracellular (SOD3), mRNA. Homo sapiens matrix metallopeptidase 3800088 NM_002423.3 MMP7 7 (matrilysin, uterine) (MMP7), 1824.2199 10.106901 mRNA. 6960148 NM_004684.2 SPARCL1 Homo sapiens SPARC-like 1 (mast9, 1175.4553 9.9560732 1 hevin) (SPARCL1), mRNA. 6940053 NM_014917.2 NTNG1 Homo sapiens netrin GI (NTNG1), 1171.0612 9.6705465 transcript variant 3, mRNA. 4480152 NM_014057.3 OGN Homo sapiens osteoglycin (OGN), 2487.3723 9.3722685 transcript variant 3, mRNA. 840309 NM_000230.1 LEP Homo sapiens leptin (obesity homolog, 1696.8497 9.2416404 mouse) (LEP), mRNA. 5260474 NM_001733.4 CIR Homo sapiens complement component 7475.5754 8.9936282 1, r subcomponent (C1R), mRNA. 5550719 NM_133503.2 DCN Homo sapiens decorin (DCN), 11313.736 8.8909102 transcript variant A2, mRNA. 5290707 NM_004917.3 KLK4 Homo sapiens kallikrein-related 1356.4662 8.879627 peptidase 4 (KLK4), mRNA. 2360148 NM_000095.2 COMP Homo sapiens cartilage oligomeric 24958.137 8.8635268 matrix protein (COMP), mRNA. Homo sapiens reversion-inducing 3390487 NM_021111.1 RECK cysteine-rich protein with kazal motifs 3460.3842 8.4413925 (RECK), mRNA. 1430487 NM_000900.2 MGP Homo sapiens matrix Gla protein 28663.545 7.9134409 (MGP), mRNA. 2370041 NM_018334.3 LRRN3 Homo sapiens leucine rich repeat 601.53289 7.4294809 neuronal 3 (LRRN3), mRNA. Homo sapiens extracellular matrix 6840192 NM_001393.2 ECM2 protein 2, female organ and adipocyte 2081.8504 7.2614244 specific (ECM2), mRNA. Homo sapiens Clq and tumor necrosis 5220639 NM_030945.2 C1QTNF3 factor related protein 3 (C1QTNF3), 805.39838 7.2533567 transcript variant 1, mRNA. Homo sapiens elastin (supravalvular 6130577 NM_001081754.1 ELN aortic stenosis, Williams-Beuren 13933.806 7.11396 syndrome) (ELN), transcript variant 4, mRNA. Homo sapiens elastin (supravalvular 1300156 NM_001081754.1 ELN aortic stenosis, Williams-Beuren 968.27168 6.9988544 syndrome) (ELN), transcript variant 4, mRNA. Homo sapiens retinoic acid receptor 5290608 NM_002889.2 RARRES2 responder (tazarotene induced) 2 8152.2937 6.8771278 (RARRES2), mRNA. Homo sapiens complement component 7400707 NM_001734.2 CiS 1, s subcomponent (CIS), transcript 7047.5294 6.7021245 variant 1, mRNA. 1430278 NM_000396.2 CTSK Homo sapiens cathepsin K (CTSK), 5855.7001 6.696227 mRNA. 2810673 NM_152739.3 HOXA9 Homo sapiens homeobox A9 940.13805 6.6439489 I - (HOXA9), mRNA. 1340593 NM_004484.2 GPC3 Homo sapiens glypican 3 (GPC3), 964.70664 6.2931355 mRNA. 307 WO 2011/150105 PCT/US2011/037969 Homo sapiens proline/arginine-rich 7000446 NM_201348.1 PRELP end leucine-rich repeat protein 671.62832 6.2796143 (PRELP), transcript variant 2, mRNA. Homo sapiens acyl-CoA synthetase 1030431 NM_001995.2 ACSL1 long-chain family member 1 (ACSL1), 2125.5403 6.2591895 mRNA. Homo sapiens transforming growth 3190379 NM_003243.2 TGFBR3 factor, beta receptor III (TGFBR3), 2928.9726 5.9124307 mRNA. 70167 NM_015364.2 LY96 Homo sapiens lymphocyte antigen 96 1661.1791 5.83623 (LY96), mRNA. Homo sapiens interleukin 1 receptor 6020300 NM_003856.2 ILIRLI like 1 (ILIRLI), transcript variant 2, 588.40369 5.678489 mRNA. 3930020 NM_003793.2 CTSF Homo sapiens cathepsin F (CTSF), 929.48555 5.5920517 mRNA. 4230343 NM_001871.2 CPB1 Homo sapiens carboxypeptidase B1 411.29174 5.5886126 (tissue) (CPB 1), mRNA. Homo sapiens serpin peptidase 6290356 NM_002615.4 SERPINFI inhibitor, clade F (alpha-2 antiplasmin, 4147.5046 5.5616257 pigment epithelium derived factor), member 1 (SERPINFI), mRNA. Homo sapiens heart and neural crest 4640563 NM_021973.2 HAND2 derivatives expressed 2 (HAND2), 666.05855 5.3840162 mRNA. Homo sapiens serpin peptidase inhibitor, clade G (C1 inhibitor), 3450538 NM_000062.2 SERPINGI member 1, (angioedema, hereditary) 429.76268 5.3235412 (SERPINGI), transcript variant 1, mRNA. Homo sapiens complement component 1300327 NM_201442.1 CiS 1, s subcomponent (CIS), transcript 915.61386 5.3232536 variant 2, mRNA. Homo sapiens FXYD domain 5860022 NM_021902.2 FXYD1 containing ion transport regulator 1 483.98333 5.2726705 (phospholemman) (FXYD1), transcript variant b, mRNA. 990458 NM_003062.1 SLIT3 Homo sapiens slit homolog A 1393.1774 5.1736446 (Drosophila) (SLJT3), mRNA. Homo sapiens ADAM 6900086 NM_006988.3 ADAMTS1 metallopeptidase with thrombospondin 3037.6749 5.1538454 type 1 motif, 1 (ADAMTS 1), mRNA. Homo sapiens pentraxin-related gene, 3460682 NM_002852.2 PTX3 rapidly induced by IL-I beta (PTX3), 808.58267 5.093939 mRNA. 780025 NM_001004019.1 FBLN2 Homo sapiens fibulin 2 (FBLN2), 293.07242 5.0452832 transcript variant 1, mRNA. Homo sapiens Clq and tumor necrosis 1500373 NM_181435.4 C1QTNF3 factor related protein 3 (C1QTNF3), 465.84189 5.0066217 transcript variant 2, mRNA. 1500725 NM_001765.2 CD1C Homo sapiens CD1c molecule 951.16903 4.9903999 (CD1C), mRNA. Homo sapiens FXYD domain 3850500 NM_005031.3 FXYD1 containing ion transport regulator 1 460.54115 4.9007222 (phospholemman) (FXYD1), transcript variant a, mRNA. 2940280 NM_014057.3 OGN Homo sapiens osteoglycin (OGN), 2405.8639 4.8148029 transcript variant 3, mRNA. 1710484 NM_002023.3 FMOD Homo sapiens fibromodulin (FMOD), 1141.281 4.7612265 mRNA. 308 WO 2011/150105 PCT/US2011/037969 4560592 NM_004787.1 SLIT2 Homo sapiens slit homolog 2 1714.6506 4.7279017 (Drosophila) (SLJT2), mRNA. Homo sapiens interleukin 11 receptor, 2570646 NM_004512.3 ILIRA alpha (ILIRA), transcript variant 1, 1063.3442 4.726461 mRNA. 1430521 NM_053276.2 VIT Homo sapiens vitrin (VIT), mRNA. 447.24985 4.6871847 Homo sapiens N-acetylated alpha 4120626 NM_005468.2 NAALADL1 linked acidic dipeptidase-like 1 420.32861 4.5857831 (NAALADL1), mRNA. Homo sapiens sarcoglycan, delta 2450327 NM_172244.2 SGCD (35kDa dystrophin-associated 517.3104 4.3425111 glycoprotein) (SGCD), transcript variant 2, mRNA. 4610246 NM_005014.1 OMD Homo sapiens osteomodulin (OMD), 1732.7583 4.2046538 mRNA. 2640025 NM_005143.2 HP Homo sapiens haptoglobin (HP), 255.71445 4.2006481 IIRNA. Homo sapiens mannan-binding lectin 580360 NM_001031849.1 MASPI seine peptidase 1 (C4/C2 activating 378.40347 4.1377023 component of Ra-reactive factor) (MASP1), transcript variant 3, mRNA. Homo sapiens X-prolyl 4780544 NM_003399.5 XPNPEP2 aminopeptidase (aminopeptidase P) 2, 377.77655 4.1122011 membrane-bound (XPNPEP2), mRNA. 6480592 NM_198129.1 LAMA3 Homo sapiens pt va 399.44838 4.094949 (LAMA3), transcript variant 1, mRNA. 39488 4044 4760095 NM_004750.2 CRLF1 Homo sapiens cytokine receptor-like 2302.2323 4.0514587 factor 1 (CRLF1), mRNA. 5290333 NM_152520.3 ZNF533 Homo sapiens zinc finger protein 533 353.85162 4.0267028 (ZNFS33), mRNA. Homo sapiens WNT1 inducible 2320564 NM_003882.2 WISPI signaling pathway protein 1 (WISPI), 964.30959 4.0241438 transcript variant 1, mRNA. 7510113 NM_033254.2 BOC Homo sapiens Boc homolog (mouse) 349.04757 4.015553 (BO0C), mRNA. Homo sapiens platelet derived growth 5690139 NM_033135.3 PDGFD factor D (PDGFD), transcript variant 2, 2233.7621 3.9147582 mRNA. 1260068 NM_006350.2 FST Homo sapiens follistatin (FST), 869.23134 3.873012 transcript variant FST317, mRNA. Homo sapiens interleukin 11 receptor, 2760148 NM_004512.3 ILIRA alpha (ILIRA), transcript variant 1, 5521.4304 3.8619982 mRNA. 3360066 NM_001146.3 ANGPT1 Homo sapiens angiopoietin 1 1494.2975 3.7746631 (ANGPT 1), mRNA. 5340358 NM_000504.3 F1O Homo sapiens coagulation factor X 379.31527 3.6228997 (FlO), mRNA. Homo sapiens serpin peptidase 3290630 NM_000624.3 SERPINA5 inhibitor, clade A (alpha-i 629.9382 3.6037153 antiproteinase, antitrypsin), member 5 (SERPINA5), mRNA. Homo sapiens SWISNF related, 1580327 NM_003077.2 SMARCD2 matrix associated, actin dependent 1361.7698 3.5907805 regulator of chromatin, subfamily d, member 2 (SMARCD2), mRNA. 6040494 NM_006487.2 FBLN1 Homo sapiens fibulin 1 (FBLN1), 4595.7758 3.5384768 transcript variant A, mRNA. 309 WO 2011/150105 PCT/US2011/037969 Homo sapiens sema domain, 1580608 NM_012431.1 SEMA3E immunoglobulin domain (Ig), short 2679.2959 3.521036 basic domain, secreted, (semaphorin) 3E (SEMA3E), mRNA. Homo sapiens lymphotoxin beta 4640064 NM_002342.1 LTBR receptor (TNFR superfamily, member 2105.9115 3.3988475 3) (LTBR), mRNA. 5560300 NM_015719.3 COL5A3 Homo sapiens collagen, type V, alpha 464.79705 3.3977056 3 (COL5A3), mRNA. Homo sapiens prostaglandin endoperoxide synthase 1 6840626 NM_000962.2 PTGS1 (prostaglandin G/H synthase and 621.13156 3.3970468 cyclooxygenase) (PTGS 1), transcript variant 1, mRNA. 50368 NM_001920.3 DCN Homo sapiens decorin (DCN), 8173.1729 3.3837483 transcript variant Al, mRNA. 6650482 NM_004438.3 EPHA4 Homo sapiens EPH receptor A4 581.30516 3.3824274 (EPHA4), inRNA. Homo sapiens ADAM 7150609 NM_021599.1 ADAMTS2 tallopeptidase wi MStnip 324.15442 3.3767789 type 1 motif, 2 (ADAVTS2), transcript variant 2, mRNA. 2450110 NM_006983.1 MMP23B Homo sapiens matrix metallopeptidase 2471.569 3.3247587 23B (MMP23B), mRNA. 6940102 NM_002160.1 TNC Homo sapiens tenascin C 3315.4509 3.2744526 (hexabrachion) (TNC), mRNA. Homo sapiens pleiotrophin (heparin 4920576 NM_002825.5 PTN binding growth factor 8, neurite 3139.7591 3.2534849 growth-promoting factor 1) (PTN), mRNA. 1820300 NM_001334.2 CTSO Homo sapiens cathepsin 0 (CTSO), 1304.9395 3.1712952 IIRNA. Homo sapiens myosin light chain 7160343 NM_053032.2 MYLK kinase (MYLK), transcript variant 8, 3607.7851 3.1633317 mRNA. Homo sapiens ADAM 3400600 NM_014244.2 ADAMTS2 tallopeptidase wi MStnip 337.11401 3.1007876 type 1 motif, 2 (ADAVTS2), transcript variant 1, mRNA. 4670441 NM_006329.2 FBLN5 Homo sapiens fibulin 5 (FBLN5), 6223.7752 3.0693727 IIRNA. 6020286 NM_013409.1 FST Homo sapiens follistatin (FST), 8196.2295 3.0617711 transcript variant FST344, mRNA. Homo sapiens platelet derived growth 4480445 NM_025208.4 PDGFD factor D (PDGFD), transcript variant 1, 1339.346 3.0322254 mRNA. Homo sapiens dipeptidyl-peptidase 4 4830255 NM_001935.3 DPP4 (CD26, adenosine deaminase 317.28599 3.0235927 complexing protein 2) (DPP4), mRNA. Homo sapiens acyl-CoA synthetase 7040286 NM_016234.3 ACSL5 long-chain family member 5 (ACSL5), 285.66032 3.0167721 transcript variant 1, mRNA. Homo sapiens integrin, beta-like 1 5570129 NM_004791.1 ITGBL1 (with EGF-like repeat domains) 480.53761 3.0068207 (ITGBL1), mRNA. 7400735 NM_002345.3 LUM Homo sapiens lumican (LUM), 1367.8171 2.9981226 mRNA. Homo sapiens Clq and tumor necrosis 7320204 NM_015645.2 C1QTNF5 factor related protein 5 (C1QTNF5), 1268.6987 2.9655988 mRNA. 310 WO 2011/150105 PCT/US2011/037969 4830685 NM_006486.2 FBLN1 Homo sapiens fibulin 1 (FBLN1), 15162.419 2.8228365 transcript variant D, mRNA. 4860494 NM_000064.1 C3 Homo sapiens complement component 209.26254 2.8153691 3 (C3), mRNA. Homo sapiens jumonji, AT rich 1660546 NM_004187.2 JARIDIC interactive domain IC (JARIDIC), 314.66799 2.7856745 mRNA. Homo sapiens core 1 synthase, 580066 NM_020156.1 CIGALTI glycoprotein-N-acetylgalactosamine 3- 439.10118 2.782048 beta-galactosyltransferase, 1 (CIGALTI), mRNA. 4900133 NM_006307.3 SRPX Homo sapiens sushi-repeat-containing 14914.677 2.7716698 protein, X-linked (SRPX), mRNA. Homo sapiens Nedd4 family 60553 NM_030571.2 NDFIP1 interacting protein 1 (NDFIP1), 904.20575 2.7223137 mRNA. 240274 NM_000877.2 ILIRI Homo sapiens interleukin 1 receptor, 470.7177 2.7184115 type I (RLIRI), mRNA. 4150753 NM_017946.2 FKBP14 Homo sapiens FK506 binding protein 2663.567 2.710033 1 14, 22 kDa (FKBP14), mRNA. 2650612 NM_198129.1 LAMA3 Homo sapiens laminin, alpha 3 204.25664 2.7035692 (LAMA3), transcript variant 1, mRNA.20.56 27369 Homo sapiens ADAM 1440224 NM_025220.2 ADAM33 metallopeptidase domain 33 213.10406 2.6700273 (ADAM33), transcript variant 1, mRNA. 1690563 NM_199161.1 SAA1 Homo sapiens serum amyloid Al 370.74764 2.6632322 (SAA1), transcript variant 2, mRNA. 1510392 NM_002291.1 LAMBI Homo sapiens laminin, beta 1 1830.6968 2.6590895 (LAMB 1), inRNA. Homo sapiens prostaglandin endoperoxide synthase 1 1070450 NM_080591.1 PTGS1 (prostaglandin G/H synthase and 2584.1923 2.6488551 cyclooxygenase) (PTGS 1), transcript variant 2, mRNA. 6550762 NM_001998.2 FBLN2 Homo sapiens fibulin 2 (FBLN2), 5040.2081 2.6428735 transcript variant 2, mRNA. 6980064 NM_001718.4 BMP6 Homo sapiens bone morphogenetic 277.98569 2.639034 protein 6 (BMP6), mRNA. Homo sapiens colony stimulating 4640048 NM_172212.1 CSF1 factor 1 (macrophage) (CSF1), 175.9059 2.6312735 transcript variant 4, mRNA. Homo sapiens Fc fragment of IgA, 4250193 NM_133279.1 FCAR receptor for (FCAR), transcript variant 1293.737 2.6268085 9, mRNA. Homo sapiens peptidylprolyl 7000114 NM_000943.4 PPIC isomerase C (cyclophilin C) (PPIC), 4470.1937 2.603371 mRNA. 5360743 NM_001856.3 COL16A1 Homo sapiens collagen, type XVI, 3298.5431 2.5889026 1 ~alpha 1 (COL16A1), mRNA. 7550131 NM_032414.2 PROKI Homo sapiens prokineticin 1 158.18923 2.5474735 (PROKI), inRNA. Homo sapiens serpin peptidase 6280168 NM_001085.4 SERPINA3 inhibitor, clade A (alpha-i 3753.0189 2.5471047 antiproteinase, antitrypsin), member 3 (SERPINA3), mRNA. 2320767 NM_002381.4 MATN3 Homo sapiens matrilin 3 (MATN3), 1122.3127 2.5260306 mRNA. 6480040 NM_153703.3 PODN Homo sapiens podocan (PODN), 938.2118 2.5035346 mRNA. 311 WO 2011/150105 PCT/US2011/037969 10685 NM_058172.3 ANTXR2 Homo sapiens anthrax toxin receptor 2 5216.8513 2.4909708 (ANTXR2), mRNA. 7650296 NM_133505.2 DCN Homo sapiens decorin (DCN), 31632.622 2.4774646 transcript variant C, mRNA. 770156 NM_203422.1 LOC221091 Homo sapiens similar to hypothetical 185.16018 2.4643291 protein (L0C221091), mRNA. Homo sapiens gonadotropin-releasing 5080017 NM_001501.1 GNRH2 hormone 2 (GNRH2), transcript 200.59749 2.4502984 variant 1, mRNA. 1780673 NM_003864.3 SAP30 Homo sapiens Sin3A-associated 1427.142 2.437884 protein, 3OkDa (SAP3O), mRNA. Homo sapiens interleukin 17 receptor 4060017 NM_001080973.1 IL17RD D (IL17RD), transcript variant 1, 1060.825 2.4347049 mRNA. Homo sapiens SLIT-ROBO Rho 2470220 NM_020762.1 SRGAP1 GTPase activating protein 1 795.05649 2.4180949 (SRGAP1), mRNA. Homo sapiens MYC-associated zinc 4830689 NM_001042539.1 MAZ finger protein (purine-binding 669.85583 2.4128797 transcription factor) (MAZ), transcript variant 2, mRNA. 2810255 NM_015989.3 CSAD Homo sapiens cysteine sulfinic acid 807.52714 2.3925293 decarboxylase (CSAD), mRNA. 4490241 NM_080879.2 RAB40A Homo sapiens RAB40A, member RAS 141.96667 2.3902973 oncogene family (RAB4OA), mRNA. Homo sapiens sarcoglycan, delta 70088 NM_000337.4 SGCD (35kDa dystrophin-associated 174.29263 2.3726923 glycoprotein) (SGCD), transcript variant 1, mRNA. Homo sapiens matrix metallopeptidase 510736 NM_004530.2 MMP2 2 (gelatinase A, 72kDa gelatinase, 1018.2142 2.3616088 72kDa type IV collagenase) (MMP2), mRNA. 5820025 NM_001426.3 ENI Homo sapiens engrailed homeobox 1 160.61003 2.3514614 (ENI), mRNA. Homo sapiens asparagine-linked 6370113 NM_013338.3 ALG5 glycosylation 5 homolog (S. 2225.0185 2.3458025 cerevisiae, dolichyl-phosphate beta glucosyltransferase) (ALG5), mRNA. Homo sapiens FK506 binding protein 1010068 NM_004470.2 FKBP2 2, 13kDa (FKBP2), transcript variant 2492.3701 2.3457747 1, mRNA. Homo sapiens interleukin 1 receptor 5420754 NM_003856.2 ILIRLI like 1 (ILIRLI), transcript variant 2, 224.69912 2.3196236 mRNA. 5390687 NM_001873.1 CPE Homo sapiens carboxypeptidase E 2065.1832 2.3075536 (CPE), mRNA. Homo sapiens collagen, type VI, alpha 2470114 NM_004369.2 COL6A3 3 (COL6A3), transcript variant 1, 7731.2385 2.2899364 mRNA. 5570682 NM_024769.2 ASAM Homo sapiens adipocyte- specific 1425.3473 2.2747345 adhesion molecule (AS AM), mRNA. Homo sapiens procollagen-lysine, 2 4640187 NM_000935.2 PLOD2 oxoglutarate 5-dioxygenase 2 2919.6888 2.2450939 (PLOD2), transcript variant 2, mRNA. 1090326 NM_003256.2 TIMP4 Homo sapiens TIMP metallopeptidase 856.48776 2.2327947 inhibitor 4 (TJIP4), mRNA. Homo sapiens protein 0 290348 NM_015352.1 POFUTI fucosyltransferase 1 (POFUTI), 4477.0171 2.2322299 transcript variant 1, mRNA. 312 WO 2011/150105 PCT/US2011/037969 5050131 NM_006485.3 FBLN1 Homo sapiens fibulin 1 (FBLN1), 152.12434 2.2297929 transcript variant B, mRNA. Homo sapiens fibroblast growth factor 6770128 NM_023106.2 FGFR1 receptor 1 (fins-related tyrosine kinase 248.76298 2.2288535 2, Pfeiffer syndrome) (FGFR1), transcript variant 4, mRNA. 2940450 NM_138995.1 MYO3B Homo sapiens myosin IIIB (MYO3B), 244.02522 2.2215476 1 mRNA. 5560674 NM_000237.2 LPL Homo sapiens lipoprotein lipase 182.54617 2.1959874 556074 N 00037.2 LPL(LPL), mRNA. 6450543 NM_000099.2 CST3 Homo sapiens cystatin C (CST3), 24616.781 2.1943587 IIRNA. 10142 NM_006016.3 CD164 Homo sapiens CD164 molecule, 385.01895 2.179835 sialomucin (CD164), mRNA. Homo sapiens prostaglandin 12 7150762 NM_000961.3 PTGIS (prostacyclin) synthase (PTGIS), 1927.294 2.1669671 mRNA. Homo sapiens limb bud and heart 2810246 NM_030915.1 LBH development homolog (mouse) (LBH), 2540.8603 2.1491211 mRNA. Homo sapiens carboxylesterase 2 3850471 NM_003869.4 CES2 (intestine, liver) (CES2), transcript 308.20841 2.1489951 variant 1, mRNA. Homo sapiens collagen, type VI, alpha 2750356 NM_001849.3 COL6A2 2 (COL6A2), transcript variant 2C2, 5865.4063 2.1484021 mRNA. 5890288 NM_003377.3 VEGFB Homo sapiens vascular endothelial 944.03555 2.140403 growth factor B (VEGFB), mRNA. Homo sapiens alanyl (membrane) aminopeptidase (aminopeptidase N, 5810612 NM_001150.1 ANPEP aminopeptidase M, microsomal 1786.0841 2.1338854 aminopeptidase, CD13, p150) (ANPEP), mRNA. Homo sapiens matrix metallopeptidase 730372 NM_002429.4 MMP19 19 (MMP19), transcript variant 1, 191.21062 2.1314333 mRNA. Homo sapiens c-fos induced growth 4640672 NM_004469.2 FIGF factor (vascular endothelial growth 151.66136 2.127942 factor D) (FIGF), mRNA. Homo sapiens WNT1 inducible 870431 NM_080838.1 WISPI signaling pathway protein 1 (WISPI), 158.77375 2.1231355 transcript variant 2, mRNA. 5700201 NM_003377.3 VEGFB Homo sapiens vascular endothelial 195.28245 2.1064183 growth factor B (VEGFB), mRNA. Homo sapiens ATP-binding cassette, 4890609 NM_000033.2 ABCD1 sub-family D (ALD), member 1 368.0767 2.1006915 (ABCD1), mRNA. 4200543 NM_015696.3 GPX7 Homo sapiens glutathione peroxidase 7 4078.8431 2.0986806 (GPX7), mRNA. Homo sapiens ADP-ribosylhydrolase 3390735 NM_199162.1 ADPRHL1 like 1 (ADPRHL1), transcript variant 196.82861 2.0847558 2, mRNA. 3990561 NM_002347.2 LY6H Homo sapiens lymphocyte antigen 6 230.45265 2.0823128 complex, locus H (LY6H), mRNA. 580739 NM_001996.2 FBLN1 Homo sapiens fibulin 1 (FBLN1), 4807.2606 2.0735869 transcript variant C, mRNA. Homo sapiens acyl-CoA synthetase 620577 NM_203379.1 ACSL5 long-chain family member 5 (ACSL5), 117.6809 2.0638646 transcript variant 2, mRNA. 313 I Hono sapiens libroblast growth factor 5560138 NN_002009.2 FG F7 7 (keralinocyte growth factor) (1GF7). 121 66128 21.058995 nRNA. 61)0736 NM_(32777.6 GPR 124 Horn1o pienis G fltiniCoupled 344.8529 2001614 ________ _______________recceptor 124 (GPR 124). miRNA. Homo sapiens matrix metalopCptidase 7150551 NM001032300.1 MMP19 19 (MMI'19). transcript variant 2. 200.92419 2.032345 mRNA. I lono sapiens neuroblastoma. 7100010 NM_005380.4 NBLI suppression of tunorigcnicitv I 5669.5187 2.0166928 (N[I 1), transcript variant 2, mRNA. Homo sapiens Icucine rich repeat (in 3400754 NM_004735.2 LRRFIP1 F11l interacting protein I (LRRFIPI). 2526.9444 2,0121494 mRNA. Homo sapiens helerogencous nuclear 2570358 NN_031372.1 HNRPD1, rihnucleoprolein D-like (HINRPDI, 755.06844 2.0102774 transcripi variant 2, mR NA. I I Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it is readily apparent to those of ordinary skill in the art in light of the teachings of this invention that certain 5 changes and modifications may be made thereto without departing from the spirit or scope of the appended claims. Accordingly, the preceding merely illustrates the principles of the invention. It will be appreciated that those skilled in the art will be able to devise various arrangements which, although not explicitly described or shown herein, embody the 10 principles of the invention and are included within its spirit and scope. Furthermore, all examples and conditional language recited herein are principally intended to aid the reader in understanding the principles of the invention and the concepts contributed by the inventors to furthering the art, and are to be construed as being without limitation to such specifically recited examples and conditions. Moreover, all statements herein 15 reciting principles, aspects, and embodiments of the invention as well as specific examples thereof, are intended to encompass both structural and functional equivalents thereof. Additionally, it is intended that such equivalents include both currently known equivalents and equivalents developed in the future, i.e., any elements developed that perform the same function, regardless of structure. The scope of the present invention, 20 therefore, is not intended to be limited to the exemplary embodiments shown and described herein. Rather, the scope and spirit of present invention is embodied by the appended claims. Throughout this specification the word "comprise", or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated 25 element, integer or step, or group of elements, integers or steps, but not the exclusion of any other element, integer or step, or group of elements, integers or steps. 314 Any discussion of documents, acts, materials, devices, articles or the like which has been included in the present specification is not to be taken as an admission that any or all of these matters form part of the prior art base or were common general knowledge in the field relevant to the present disclosure as it existed before the priority 5 date of each claim of this application. 314A

Claims (21)

1. An isolated clonal progenitor cell line expressing EYA4, wherein the clonal progenitor cell line is an embryonic cutaneous progenitor cell and is encapsulated in a 5 biomaterial.

2. The isolated clonal progenitor cell line of claim 1, wherein the cell line also expresses ADHIA, ADH1B, FABP4, CD36, PPARG, ANGPT2, EBF2 AND DBC1. 10

3. The isolated clonal progenitor cell line of claim 1 or 2, wherein the biomaterial comprises a hydrogel.

4. The isolated clonal progenitor cell line of any one of claims 1 to 3, wherein the biomaterial comprises hyaluronic acid. 15

5. The isolated clonal progenitor cell line of any one of claims 1 to 4, wherein the biomaterial is chosen from calcium alginate, agarose, polylactic acid/poly-glycolic acid derivatives, and fibrin. 20

6. A kit comprising the cell line of any one of claims I to 5.

7. A method of differentiating a clonal progenitor cell line into cutaneous adipocytes comprising 1) obtaining a clonal progenitor cell line of claim 1; 2) contacting the clonal progenitor cell line with MDI Induction Media; and 3) contacting 25 the clonal progenitor cell line of 2) with Insulin Media thereby differentiating a clonal progenitor cell line into a cutaneous adipocyte.

8. The method of claim 7, wherein the cell line also expresses ADHIA, ADHIB, FABP4, CD36, PPARG, ANGPT2, EBF2 AND DBC1. 30

9. The method of claim 7 or 8, wherein the cell line is grown to confluence prior to step 2).

10. The method of any one of claims 7 to 9, wherein the cells are contacted with the 35 MDI Induction Media with for two days. 315

11. The method of any one of claims 7 to 10, further comprising encapsulating the cutaneous adipocyte in a biomaterial.

12. The method of claim 11, wherein the biomaterial comprises a hydrogel. 5

13. The method of claim 11 or 12, wherein the biomaterial comprises hyaluronic acid.

14. A method of differentiating a clonal progenitor cell line into cutaneous 10 adipocytes comprising 1) obtaining a clonal progenitor cell line of claim 1; 2) contacting the clonal progenitor cell line with serum free differentiation media; and 3) contacting the clonal progenitor cell line of 2) with a differentiation media without rosiglitazone thereby differentiating a clonal progenitor cell line into a cutaneous adipocyte. 15

15. The method of claim 14, wherein the cell line also expresses ADHIA, ADHIB, FABP4, CD36, PPARG, ANGPT2, EBF2 AND DBCI.

16. The method of claim 14 or 15, further comprising encapsulating the cutaneous 20 adipocyte in a biomaterial.

17. The method of claim 16, wherein the biomaterial comprises a hydrogel.

18. The method of claim 16 or 17, wherein the biomaterial comprises hyaluronic 25 acid.

19. The method of any one of claims 14 to 18, wherein the clonal progenitor cell line in step 2 is cultured in a serum free differentiation media for 3 days and the clonal progenitor cell line in step 3 is cultured in differentiation media without rosiglitazone 30 for 5 days.

20. The isolated cell of claim 1 substantially as hereinbefore described with reference to any of the Examples and/or Figures. 35

21. The method of claim 7 or 14 substantially as hereinbefore described with reference to any of the Examples and/or Figures. 316