AU2010200871B2 - Detection of pseudomonas strains - Google Patents

Abstract

The present invention relates to an isolated nucleic acid molecule comprising a nucleotide sequence selected from the group consisting of (a) 5 the nucleotide sequence of SEQ ID NO: 1, or variant thereof, (b) a nucleotide sequence which is capable of hybridizing under stringent conditions with the nucleotide sequence of SEQ ID NO: 1, (c) a fragment of (a) or (b) which is capable of hybridizing specifically with Pseucomonas aeruginosa strain AES-1, or (d) the complement of (a), (b) or (c). The 10 invention also relates to methods for determining whether Pseudomonas aeruginosa strains AES-1 is present in a sample using the isolated nucleic acid molecule, and to methods for reducing or preventing spread of Pseudomonas aeruginosa strains AES-1 infection using the isolated nucleic acid molecule.

Description

AUSTRALIA Patents Act 1990 COMPLETE SPECIFICATION Standard Patent Applicant(s): Cynthia WHITCHURCH Invention Title: DETECTION OF PSUEDOMONAS STRAINS The following statement is a full description of this invention, including the best method for performing it known to me/us: 2 Detection of Pseudomonas strains Field of the Invention The invention relates to nucleic acid molecules for the detection of 5 Pseudomonas aeruginosa AES-I and uses of such nucleic acid molecules in the detection of Pseudomonas aeruginosa AES-. Background of the Invention Lung disease is the major cause of morbidity and virtually all mortality in io cystic fibrosis (CF) patients. Lung infection with Pseudomonas aeruginosa is one of the hallmarks of CF and is associated with worsening of pulmonary function, increased hospitalisation and reduced life expectancy. Approximately 20% of CF children die from respiratory failure by the age of 20 years, and the median survival is approximately 37 years. 15 There has been an emergence of "epidemic" strains of P. aeruginosa in CF clinics in Australia, UK, Europe and Canada. Between 1991 and 1996, five unrelated children under 5 years of age attending a CF clinic at the Royal Children's Hospital, Melbourne died from rapidly fatal lung disease. All had recently acquired multiple antibiotic resistant mucoid strains of P. aeruginosa 20 which was determined to be genetically identical. Ensuing surveillance of the CF clinic in 1999 found that 55% of those infected with P. aeruginosa had an identical or closely related strain to that of the five young children. This strain appears to show increased virulence as it was associated with increased hospitalisation and poorer pulmonary function among the infected patients. The 25 strain has subsequently been identified in CF clinics in Sydney and Brisbane and must now be referred to as the Australian epidemic strain-1 (AES-1). This strain has previously been referred to as m16, pulsotype 1 or C3789. The AES-I strain is believed to be transmitted by person to person contact. This is supported by data which indicates that instituting strict cohort 30 segregation measures whereby children with AES-I infection are physically separated from other CF children in hospital wards and CF clinics, results in a significant decrease in incidence and prevalence of AES-I infections. In order to institute such segregation measures, it is important that patients infected with AES-I strains be identified. 35 AES-I strains are currently identified by pulsed field gel electrophoresis (PFGE). This technique involves the use of a "rare-cutting" restriction enzyme 7307326_1 3 to digest bacterial DNA into large fragments, which can be visualised on an agarose gel using a 2-dimensional "pulsed" electric field. Isolates showing identical or very similar restriction fragment profiles to AES-I are considered to be the same or a closely related strain. 5 However, PFGE is an expensive, time-consuming technique requiring highly skilled personnel and specialised equipment and therefore cannot be used as a means of routine surveillance for the presence of the AES-I strains in patients attending CF clinics. There is therefore a need for the development of a simple, rapid io diagnostic method that will enable routine surveillance for AES-I in, for example, CF clinics so that appropriate steps can be taken to limit the spread of infection by the AES-I strain. Summary of the Invention is In a first aspect, the invention provides an isolated nucleic acid molecule, comprising a nucleotide sequence selected from the group consisting of: (a) the nucleotide sequence of SEQ ID NO: 1 (HW2), or variant thereof; (b) a nucleotide sequence which is capable of hybridising under 20 stringent conditions with the nucleotide sequence of SEQ ID NO: 1; (c) a fragment of (a) or (b) which is capable of hybridizing specifically with Pseudomonas aeruginosa strain AES-1; and (d) the complement of (a), (b) or (c). 25 In one embodiment, the nucleic acid molecule comprises the nucleotide sequence of SEQ ID NO: 1. In one embodiment, the nucleic acid molecule comprises a nucleotide sequence which is capable of hybridising under stringent conditions with the nucleotide sequence of SEQ ID NO: 1. 30 In another embodiment, the nucleic acid molecule is a fragment of the nucleotide sequence of SEQ ID NO: 1 which is characteristic of Pseudomonas aeruginosa strain AES-. In another embodiment, the nucleic acid molecule is a fragment of a nucleotide sequence which is capable of hybridising under stringent conditions 7307326_1 4 with SEQ ID NO: 1, and therefore which is capable of binding specifically to DNA from Pseudomonas aeruginosa strain AES-. The fragment may be a primer or a probe. The inventor has found that the nucleotide sequence represented by 5 SEQ ID NO: 1 is unique to Pseudomonas aeruginosa strain AES-. Consequently, nucleic acid molecules having the nucleotide sequence of SEQ ID NO: 1, variants, or fragments thereof can be used to identify Pseudomonas aeruginosa strain AES-. Accordingly nucleic acid molecules which hybridise specifically to the sequence of SEQ ID NO: 1, or its complement, can be used 10 to demonstrate the presence of Pseudomonas aeruginosa strain AES-I in a sample. The invention therefore permits Pseudomonas aeruginosa strain AES I to be identified rapidly using well-established and efficient techniques which detect hybridisation of a nucleic acid molecule to a target sequence. The present invention therefore permits the rapid identification of Pseudomonas i5 aeruginosa strain AES-I by methods other than reliance on pulse field gel electrophoresis, which can take up to 8 days in order to obtain a result. Accordingly, in a second aspect, the invention provides a method of determining whether Pseudomonas aeruginosa strain AES-I is present in a sample, comprising establishing whether nucleic acid from the sample 20 comprises one or more of the following: (a) the nucleotide sequence of SEQ ID NO: 1 or variant thereof; (b) a fragment of (a) which is characteristic of Pseudomonas aeruginosa strain AES-1; (c) the complement of (a) or (b), 25 wherein the presence of (a), (b) or (c), indicates that Pseudomonas aeruginosa strain AES-I is present in the sample. In one embodiment, establishing whether nucleic acid from the sample comprises one or more of (a), (b) or (c), comprises the steps of: (i) contacting under hybridizing conditions nucleic acid from the 30 sample with a nucleic acid molecule which is capable of hybridising under stringent conditions with the nucleotide sequence of SEQ ID NO: 1 or its complement; (ii) determining whether the nucleic acid molecule hybridises with the nucleic acid from the sample, 7307326_1 5 wherein hydridization of the nucleic acid molecule with nucleic acid from the sample indicates that Pseudomonas aeruginosa strain AES-I is present in the sample. In one embodiment, the method comprises establishing whether nucleic 5 acid from the sample comprises the nucleotide sequence of SEQ ID NO: 1 or variant thereof. In another embodiment, the method comprises establishing whether nucleic acid from the sample comprises a fragment of the nucleotide sequence of SEQ ID NO: 1 which is characteristic of Pseudomonas aeruginosa strain io AES-l. In one embodiment, the method comprises the further step of establishing whether nucleic acid from the sample comprises the oprL gene. This demonstrates the presence of Pseudomonas aeruginosa in the sample. The sample may be any sample from which nucleic acid can be is obtained. Examples of samples include sputum, blood, aspirate, swab, tissue, saliva, serum, pleural fluid, lavage. In a third aspect, the invention provides a method of diagnosing a Pseudomonas aeruginosa strain AES-I infection, comprising: (a) providing a sample from a subject; 20 (b) determining whether Pseudomonas aeruginosa strain AES-I is present in the sample by establishing whether nucleic acid from the sample comprises one or more of the following: (i) the nucleotide sequence of SEQ ID NO: 1, or variant thereof; 25 (ii) a fragment of (i) which is characteristic of Pseudomonas aeruginosa strain AES-1; (iii) the complement of (i) or (ii), wherein the presence of (i), (ii) or (iii), indicates that the subject has a Pseudomonas aeruginosa strain AES-I infection. 30 The subject may be any subject that is susceptible to infection from Pseudomonas aeruginosa strain AES-l. Subjects include, for example, CF patients, elderly, immunocomprised, smokers, emphysema patients, intensive care patients, COPD patients, bronchiectasis patients. Typically, the subject is a CF patient. 35 In a fourth aspect, the invention provides a method of reducing or preventing spread of Pseudomonas aeruginosa strain AES-I infection in a 7307326_1 6 group of subjects susceptible to infection from Pseudomonas aeruginosa strain AES-1, comprising: (a) providing a sample from each subject of the group; (b) determining whether Pseudomonas aeruginosa strain AES-I is 5 present in the sample in accordance with the method of the second aspect; and (c) segregating those subjects of the group whose sample contains Pseudomonas aeruginosa strain AES-I from those subjects of the group whose sample does not contain Pseudomonas aeruginosa 1o strain AES-l. The group of subjects may be any group that is susceptible to infection from Pseudomonas aeruginosa strain AES-. The group of subjects may include, for example, CF patients, elderly, immunocomprised, smokers, emphysema patients, intensive care patients, COPD patients, bronchiectasis is patients. Typically, the group of subjects are CF patients. In a fifth aspect, the invention provides a kit for detecting the presence of Pseudomonas aeruginosa strain AES-1, comprising the nucleic acid molecule according to the first aspect. In a sixth aspect, the invention provides a kit comprising the nucleic acid 20 molecule of the first aspect. In a seventh aspect, the invention provides an isolated nucleic acid molecule comprising a nucleotide sequence selected from the group consisting of: (a) the nucleotide sequence of SEQ ID NO: 7 (HW1), or variant thereof; 25 (b) the nucleotide sequence of SEQ ID NO: 8 (HW3), or variant thereof; (c) the nucleotide sequence of SEQ ID NO: 9 (HW6), or variant thereof; (d) the nucleotide sequence of SEQ ID NO: 10 (HW8), or variant thereof; (e) the nucleotide sequence of SEQ ID NO: 11 (HW12), or variant thereof; 30 (f) the nucleotide sequence of SEQ ID NO: 12 (HW18), or variant thereof; (g) the nucleotide sequence of SEQ ID NO: 13 (HW23), or variant thereof; (h) a nucleotide sequence which is capable of hybridising under stringent 35 conditions with the nucleotide sequence of any one of (a) to (g); 7307326_1 7 (i) a fragment of any one of (a) to (h) comprising at least 10 nucleotides; and (j) the complement of any one of (a) to (i). In an eighth aspect, the invention provides a kit comprising the nucleic 5 acid molecule of the seventh aspect. The present invention as claimed herein is described in the following items 1 to 12: 10 1. A method of determining whether Pseudomonas aeruginosa strain AES-I is present in a sample, comprising establishing whether nucleic acid from the sample comprises one or more of the following: (a) the nucleotide sequence of SEQ ID NO: 1, or variant thereof; (b) a fragment of (a) which is capable of hybridizing specifically with 15 Pseudomonas aeruginosa strain AES-1; and (c) the complement of (a) or (b), wherein the presence of (a), (b) or (c) indicates that Pseudomonas aeruginosa strain AES-I is present in the sample. 2. The method according to item 1, wherein establishing whether nucleic 20 acid from the sample comprises one or more of (a), (b) or (c) comprises the steps of: (a) contacting under hybridizing conditions nucleic acid from the sample with a nucleic acid molecule comprising a nucleotide sequence selected from the group consisting of: 25 (i) the nucleotide sequence of SEQ ID NO: 1, or variant thereof; (ii) a nucleotide sequence which is capable of hybridizing under stringent conditions with the nucleotide sequence of SEQ ID NO: 1 30 (iii) a fragment of (a) or (b) which is capable of hybridizing specifically with Pseudomonas aeruginosa strain AES-1; and (iv)the complement of (i), (ii) or (iii); and (b) determining whether the nucleic acid molecule hybridises 35 with the nucleic acid from the sample, 7351106_1 (GHMatters) P83557.AU PETERB 8 whereby hydridisation of the nucleic acid molecule with nucleic acid from the sample indicates that Pseudomonas aeruginosa strain AES-I is present in the sample. 3. The method according to item 1 or 2, wherein the method comprises 5 establishing whether nucleic acid from the sample comprises the nucleotide sequence of SEQ ID NO: 1. 4. The method according to any one of items 1 to 3, wherein the nucleic acid molecule is at least one primer. 5. The method according to item 4, wherein hybridisation is determined by 10 amplification of a nucleotide sequence using the at least one primer. 6. The method according to any one of items 1 to 5, wherein the nucleic acid molecule is a probe. 7. The method according to any one of items 1 to 6, wherein the method comprises further determining whether nucleic acid from the sample 15 comprises the oprL gene. 8. The method according to any one of items 1 to 7, wherein the sample is selected from the group consisting of sputum, blood, aspirate, swab, tissue, saliva, serum, pleural fluid and lavage 9. A method of diagnosing a Pseudomonas aeruginosa strain AES-I 20 infection, comprising: (a)providing a sample from a subject; (b) determining whether Pseudomonas aeruginosa strain AES-I is present in the sample in accordance with the method of any one of items 1 to 8. 25 10. The method of item 9, wherein the subject is selected from the group consisting of a CF patient, a subject that is immunocompromised, a subject that is a smoker and elderly subjects. 11. A method of reducing or preventing spread of Pseudomonas aeruginosa strain AES-I infection in a group of subjects susceptible to 30 infection from Pseudomonas aeruginosa strain AES-1, comprising: (a) providing a sample from each subject of the group; (b) determining whether Pseudomonas aeruginosa strain AES-I is present in the sample in accordance with the method of any one of items 1 to 8; and 35 (c) segregating those subjects of the group whose sample contains Pseudomonas aeruginosa strain AES-I from those subjects of the 7351106_1 (GHMatters) P83557.AU PETERB 9 group whose sample does not contain Pseudomonas aeruginosa strain AES-. 12. The method of item 11, wherein the group of subjects comprises subjects selected from the group consisting of CF patients, subjects that 5 are immunocompromised, subjects that are smokers and elderly subjects. Brief Description of the Figures Figure 1 shows the nucleotide sequence of HW2 (SEQ ID NO: 1). io Figure 2 shows the results of PCR detection of the oprL and HW2 loci from sputum samples from CF patients. Sputum from 2 patients was swabbed onto Whatman FTA Elute cards, and the HW2 and oprL loci amplified from the samples (UCF-FTA, AES-I-FTA) or from chromosomal DNA isolated from Pseudomonas strains isolated from the same sputum samples (UCF-DNA, is AES-1-DNA). Figure 3 shows the nucleotide sequence of sequence HW1 (SEQ ID NO: 7). Figure 4 shows the nucleotide sequence of sequence HW3 (SEQ ID NO: 8). 20 Figure 5 shows the nucleotide sequence of sequence HW6 (SEQ ID NO: 9). Figure 6 shows the nucleotide sequence of sequence HW8 (SEQ ID NO: 10). Figure 7 shows the nucleotide sequence of sequence HW12 (SEQ ID 25 NO: 11). Figure 8 shows the nucleotide sequence of sequence HW18 (SEQ ID NO: 12). Figure 9 shows the nucleotide sequence of sequence HW23 (SEQ ID NO: 13). 30 35 7351106_1 (GHMatters) P83557.AU PETERB 10 Detailed Description of the Invention The practice of the present invention employs, unless otherwise indicated, conventional molecular biology and microbiology. Such techniques are known to the skilled worker, and are explained fully in the literature See, for 5 example, Sambrook and Russell "Molecular Cloning: A Laboratory Manual" (2001); Cloning: A Practical Approach," Volumes I and II (D.N. Glover, ed., 1985); "Oligonucleotide Synthesis" (M.J. Gait, ed., 1984); "Nucleic Acid Hybridisation" (B.D. Hames & S.J. Higgins, eds., 1985); Sambrook, et al., "Molecular Cloning: a Laboratory Manual" (1989). Ausubel, F. et al., 1989 1o 1999, "Current Protocols in Molecular Biology" (Green Publishing, New York). It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and it is not intended to limit the scope of the present invention which will be limited only by the appended claims. It must be noted that as used herein and in the appended claims, the is singular forms "a", "an", and "the" include plural reference unless the context clearly dictates otherwise. Thus, for example, a reference to "a nucleic acid molecule" includes a plurality of such nucleic acid molecules. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which 20 this invention belongs. Although any materials and methods similar or equivalent to those described herein can be used to practice or test the present invention, the preferred materials and methods are now described. All publications mentioned herein are cited for the purpose of describing and disclosing the protocols and reagents which are reported in the publications 25 and which might be used in connection with the invention. It is to be understood that a reference herein to a prior art document does not constitute an admission that the document forms part of the common general knowledge in the art in Australia or any other country. One aspect of the invention relates to a nucleic acid molecule which is 30 capable of specifically detecting Pseudomonas aeruginosa Australian Epidemic Strain -1 (AES-1) (referred to herein as AES-I or Pseudomonas aeruginosa strain AES-1). AES-I is also know as m16, pulsotype 1 and C3789. The nucleic acid molecules may be used as hybridisation probes or as PCR primers, to identify AES-I strains of Pseudomonas aeruginosa. Prior to 35 the present invention, the only way to identify AES-I strains of Pseudomonas aeruginosa was to isolate organisms from a sample taken from a patient, 7307326_1 11 culture the isolated organisms, isolate nucleic acid from the cultured organisms, digest the isolated nucleic acid with restriction enzymes and conduct pulse field gel electrophoresis on the digested nucleic acid. In contrast, the present invention provides for a much more rapid and convenient identification of AES-I 5 strains of Pseudomonas aeruginosa using nucleic acid molecules which hybridise specifically to AES-I strains of Pseudomonas aeruginosa. As used herein, the term "nucleic acid molecule" refers to DNA molecules, RNA molecules, analogs of DNA or RNA generated using nucleotide analogs. The nucleic acid molecule may be double stranded or 10 single stranded. In one form, the nucleic acid molecule comprises the nucleotide sequence of SEQ ID NO: 1, or variant thereof. As used herein, the term "variant" in relation to a particular nucleotide sequence refers to a nucleotide sequence which is of sufficient identity to the particular nucleotide sequence is such that the variant hybridises under stringent conditions to the complement of the particular nucleotide sequence. A sequence that is a variant of a particular nucleotide sequence is typically 80%, more typically 85%, still more typically 90%, still more typically 95%, even more typically 99%, identical to that particular nucleotide sequence. Thus, a nucleic acid molecule that comprises a 20 nucleotide sequence that is a variant of SEQ ID NO: 1 typically comprises nucleotide sequence which is at least 80%, more typically 85%, still more typically 90%, still more typically 95%, even more typically 99%, identical to SEQ ID NO: 1. In another form, the nucleic acid molecule comprises a nucleotide 25 sequence which is capable of hybridizing under stringent conditions with SEQ ID NO: 1. Stringent conditions are conditions at which a nucleic acid sequence which is substantially complementary to a target sequence hybridises to the target sequence and which nucleic acid sequences that are not substantially complementary do not hybridise. As used herein, "complementary" refers to a 30 nucleic acid sequence that comprises a base sequence that is capable of forming Watson-Crick base pairs with its complementary nucleic acid. A substantially complementary sequence may contain mismatches in the sequence, or may comprise ends which are added to assist in, for example, cloning of the sequence or for detection of hybridisation of the molecule. 35 Typically, a nucleotide sequence is substantially complementary to a target nucleic acid sequence, and is therefore capable of hybridising under stringent 7307326_1 12 conditions to a target sequence, if at least 80%, more typically at least 85%, still more typically at least 90%, still more typically at least 95%, even more typically at least 99%, of nucleotides are identical to the complement of the target nucleic acid sequence. A nucleic acid molecule that hybridises under stringent 5 conditions with SEQ ID NO: 1 with therefore have at least 85%, typically at least 90%, more typically 95%, still more typically 99% of nucleotides identical with the complement of SEQ ID NO: 1. Stringent conditions for hybridisation are known in the art and are described in, for example, Sambrook et al. , DNA Cloning, vol. 1, 11 and Ill. io Nucleic Acid Hybridisation. Typical stringent conditions are those that (1) employ during annealing a high annealing temperature, in for example, PCR, (2) employ low ionic strength and high temperature for washing following hybridisation, for example, 0.015M NaCI/0.0015M Sodium citrate/0.1% sodium dodecyl sulphate (SDS) at 500C, or (3) employ during hybridisation a is denaturing agent such as formamide, for example, 50% (vol/vol) formamide with 0.1% bovine serum albumin/0.1% Ficoll/0.1% polyvinylpyrrolidone/50mM sodium phosphate buffer at pH 6.5b with 750mM NaCI, & 5mM sodium citrate at 420C. An example of stringent conditions in PCR would be from 450 to 720C annealing temperature. 20 In another form, the nucleic acid molecule is a fragment of SEQ ID NO: 1, or a fragment of a nucleotide sequence which is capable of hybridizing under stringent conditions to SEQ ID NO: 1. Typically, the nucleic acid molecule is a fragment of SEQ ID NO: 1. The fragment is capable of hybridizing specifically with Pseudomonas aeruginosa strain AES-. A fragment 25 "capable of hybridizing specifically with Pseudomonas aeruginosa strain AES-I" is a fragment which hybridises under stringent conditions to complementary sequence contained in Pseudomonas aeruginosa strain AES-I but not to sequence contained in other strains of Pseudomonas or other organisms. The fragment must therefore be of sufficient length to provide specificity for 30 Pseudomonas aeruginosa strain AES-. Examples of suitable lengths for fragments include 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 200, 300 or 312 based pairs. A typical fragment is an oligonucleotide. An "oligonucleotide" is a 35 polymer of nucleotides wherein the nucleotide may be deoxyribonucleotide, ribonucleotide, dideoxyribonucleotide. It will be appreciated by those skilled in 7307326_1 13 the art that a primer is an oligonucleotide. Examples of suitable primers include HW2F (SEQ ID NO: 2), HW2R (SEQ ID NO: 3), RTHW2F (SEQ ID NO: 4), RTHW2R (SEQ ID NO: 5) or RTHW2-P (SEQ ID NO: 6). The nucleic acid molecule may be chemically modified, such as by 5 tagging or labelling, with for example, radioactive label, fluorescent dye, biotin, digoxigenin, fluorophore, an enzyme or molecular barcode. Methods for labelling or tagging nucleic acid molecules are known in the art and are described in, for example, Sambrook and Russell "Molecular Cloning: A Laboratory Manual" (2001); Cloning: A Practical Approach," Volumes I and II 1o (D.N. Glover, ed., 1985); Sambrook et al. "Molecular Cloning: A Laboratory Manual" (1989). Ausubel, F. et al. 1989-1999 "Current Protocols in Molecular Biology" (Green Publishing, New York). As mentioned above, the nucleic acid molecule of the invention is specific to Pseudomonas aeruginosa strain AES- and may therefore be used is for identifying Pseudomonas aeruginosa strain AES- in a sample. The present invention therefore also relates to a method of determining whether Pseudomonas aeruginosa AES-l is present in a sample. The sample may be any sample which is to be tested for the presence of Pseudomonas aeruginosa strain AES-l. The sample may be a clinical sample 20 taken from a subject, such as a sample from a person suffering from cystic fibrosis. Examples of suitable samples include sputum samples, tissue samples, aspirate samples, swab samples, body fluid samples including blood, CSF fluid, pleural fluid, lavage. The sample may be an environmental sample, such as a swab of bench, floor, wall, bedding, sink, showers, toys, hospital 25 workers, air sampling filters, equipment surfaces or other surfaces such as those found in a hospital environment. The sample may be an isolated or purified bacteria. In one form, nucleic acid is extracted from the sample to provide nucleic acid from the sample. Methods for extraction of nucleic acid from a sample is 30 known in the art and is described in, for example, Sambrook and Russell (2001); Sambrook et al. (1989); Ausubel et al. (1989-1999). Kits for extraction of nucleic acid from a sample are also available. Examples of kits suitable for isolation of nucleic acid from a sample include Masterpure DNA Purification Kit (Epicentre Technologies), DNeasy Tissue Purification Kit (Qiagen Sciences) or 35 Whatman FTA@ Elute cards. At least one primer may be used to determine whether Pseudomonas 7307326_1 14 aeruginosa AES-I is present in the sample. As used herein, the term "primer" refers to a short-length, single stranded oligonucleotide. The primer may be chemically synthesised by known methods involving, for example, triester, phosphoramidite, or phosphonate chemistry, such as described by Engels, et 5 al., Agnew. Chem. Int. Ed. Engl. 28: 716-734 (1989). The sequence of the primer is selected such that the primer is capable of hybridising specifically to SEQ ID NO: 1. Primer length is typically 10 to 50, more typically 10 to 40, still more typically 10 to 30 basepairs in length. Methods for selecting primer sequence that is capable of hybridising specifically to a target sequence are 10 described in, for example, Yurev ed, "PCR Primer Design (Methods in Molecular Biology) (2007). In addition, or alternatively, software may be used to design primers that are capable of hybridising specifically with a target sequence. Software suitable for designing primers that are capable of hybridising specifically to a target sequence includes MacVector 8.02 (Accelrys) is and Primer Express Software v1.0 program (Applied Biosystems). Once the primer is hybridised to the target it may be extended by the addition of deoxyribonucleotides to the end of the primer using a DNA polymerase, or by the addition of ribonucleotides using an RNA polymerase. As extension of the primer occurs only if the primer is hybridised to the target sequence, extension 20 of the primer is an indicator of hybridisation. Accordingly, techniques which are capable of extending the primer are suitable for detecting hybridisation of the primer. In one form, at least one first primer is provided that is complementary to a first strand of nucleic acid comprising the sequence of SEQ ID NO: 1. The 25 "first strand" is one strand of a double stranded nucleic acid target molecule. The complementary strand of the double stranded target molecule is referred to as the "second strand". Thus, a first primer that is complementary to a first strand will hybridise to the first strand by Watson-Crick base pairing, and extension of the primer will result in synthesis of a strand of nucleic acid that is 30 complementary to a first strand and substantially the same sequence as the second strand. Typically, at least one first and at least one second primer are used. The sequence of the second primer is complementary to the second strand of the double stranded nucleic acid target molecule. The term "second strand" is that 35 strand of a double stranded nucleic acid molecule that is complementary to the first strand and which is in the opposite direction to the first strand. As a 7307326_1 15 consequence, the second primer is oriented in the opposite direction to the first primer and consequently extension of the first and second primer using known polymerases results in extension of the primers in opposite directions. Thus, extension of the first and second primer results in the synthesis of 5 complementary strands. By using a first and second primer to amplify sequence, this provides a rapid and simple means to detect hybridisation of the primers. The first and second primers are referred to herein as "primer pairs". The primer, or primer pairs, are contacted under hybridising conditions with nucleic acid that has been extracted from the sample. As used herein, the 10 term "contacted under hybridising conditions" means incubating nucleic acid molecules in conditions which permit hybridisation or annealing of complementary sequences. The conditions which permit annealing of complementary sequences will depend on the sequence and length of the primer. For example, the temperature of annealing is affected by the GC is content of the primer. Typically, the primers are incubated with the extracted nucleic acid at a temperature between 300C and 720C to permit annealing of the primer(s). More typically, the primers are annealed at a temperature of between 450C and 720C. Most typically, the primers are annealed at a temperature of between 450C and 650C. Still more typically, the primers are 20 annealed at a temperature of between 500C and 650C. Once the primer(s) are contacted with the nucleic acid, annealing of the primer to the nucleic acid from the sample may be detected by amplification. As used herein, the term "amplification" refers to the synthesis of at least one nucleic acid strand that is complementary to a target nucleic acid strand by 25 extension of a primer hybridised to the target nucleic acid strand. A segment of sequence may be amplified by any methods known in the art. Typically, a primer pair is used in a Polymerase Chain Reaction amplification to amplify the sequence. "Polymerase chain reaction," or "PCR," as used herein generally refers to a method for amplification of a desired nucleotide sequence in vitro. 30 PCR involves repeated cycles of primer extension synthesis, using a primer pair capable of hybridizing specifically to a target nucleic acid. Typically, the primers used in the PCR method will be complementary to the nucleotide sequence to be amplified. Methods for PCR amplification are described in, for example, Wang, et al., in PCR Protocols, pp.70-75 (Academic Press, 1990); 35 Ochman, et al., in PCR Protocols, pp. 219-227; Triglia, et al., Nucl. Acids Res. 16:8186 (1988). A person skilled in the art will recognize, however, that 7307326_1 16 amplification of sequences in a sample may be accomplished by any known method using a primer, or a primer pair, where appropriate, and techniques such as primer extension, ligase chain reaction (LCR), Qp-replicase amplification, nucleic acid sequence based amplification (NASBA), rolling circle 5 amplification (RC), and simultaneous strand displacement amplification (SDA), each of which provides sufficient amplification, may be employed. The reaction conditions for the extension reaction such as annealing time and temperature and extension time and temperature will vary depending on the sequence of the primer or primer pair, and the nature of the enzyme used in 10 the extension reaction. The appropriate reaction conditions to be used may be determined as described in Wang, et al., in PCR Protocols, pp.70-75 (Academic Press, 1990); Ochman, et al., in PCR Protocols, pp. 219-227. Sequence may be amplified using real-time PCR assays using primers which are labeled with interactive fluorescent label pairs such as two 15 fluorophores or a fluorophore and a non-fluorescent quencher, such that a change in fluorescence signal indicates the presence of primers that have been extended and, thus, the presence of a target for the primers in a sample. The term "real-time analysis" refers to periodic monitoring during PCR. Certain systems such as the Eppendorf Realplex Mastercycler conduct monitoring 20 during each thermal cycle at a pre-determined or user-defined point. Interaction between labels may be by fluorescence resonance energy transfer (FRET), by touching, or both. The changes in fluorescence may be utilised to detect the presence of, and if desired quantitate, the number of AES-I strains in a sample. The fluorescent labelled primers may also function to label the probe 25 for detection following hybridisation. Fluorescence-based approaches to provide end-point or real-time measurements of PCR amplification products (amplicons) (Holland et al, (1991) Proc. Natl. Acad. Sci., 88:7276-80) may employ intercalating dyes, e.g. ethidium bromide, to indicate the amount of double stranded DNA present (U.S. Pat. No. 5,210,015) or probes containing 30 reporter-quencher pairs ("TaqMan.RTM.", 5' nuclease assay) that are cleaved during amplification to release a fluorescent signal proportional to the amount of double stranded DNA present (U.S. Pat. No. 5,538,848; U.S. Pat. No. 5,804,375). Fluorescent dyes useful for labelling primers and nucleotide 5' triphosphates may include, for example, fluoresceins, rhodamines (e.g., U.S. 35 Pat. Nos. 5,366,860; 5,936,087; 6,051,719), cyanines (U.S. Pat. No. 6,080,868 and WO 97/45539), and metal porphyrin complexes (WO 88/04777). Examples 7307326_1 17 of fluorescein dyes include 6-carboxyfluorescein (6-FAM) 1, 2',4',1,4, tetrachlorofluorescein (TET) 2 and 2',4',5',7',1,4-hexachlorofluorescein (HEX) 3 (U.S. Pat. No. 5,654,442), 2',7'-dimethoxy-4',5'-dichloro-6-carboxyrhodamine (JOE) 4, 2'-chloro-5'-fluoro-7',8'-fused phenyl-1,4-dichloro-6-carboxyfluorescein 5 5 (U.S. Pat. Nos. 5,188,934 and 5,885,778), 2'-chloro-7'-phenyl-1,4-dichloro-6 carboxyfluorescein 6 (U.S. Pat. No. 6,008,379). Quenchers may include, for example, rhodamine fluorescent dyes selected from the group consisting of tetramethyl-6-carboxyrhodamine (TAMRA) 7, tetrapropano-6-carboxyrhodamine (ROX) 8, diazo compounds, e.g. 10 9-11, and cyanine dyes including 11, anthraquinone, malachite green, nitrothiazoleand nitroimidazole compounds and the like. In another form, the nucleic acid molecule of the invention may be used as probe to determine whether Pseudomonas aeruginosa AES-I is present in a sample. Suitably, nucleic acid molecules comprising the nucleic acid sequence is of SEQ ID NO: 1, nucleic acid molecules which are capable of hybridising under stringent conditions to SEQ ID NO: 1, or fragments thereof which are capable of hybridising specifically to Pseudomonas aeruginosa strain AES-1, may be labelled with a detectable moiety for use as a probe. For example, it is envisaged that hybridisation of primers, including for example those referred to 20 above, could be detected without extending the first and/or second primer. This may be achieved, for example, by labelling the primer with a detectable moiety prior to hybridisation with the nucleic acid of the sample. Methods for labelling and detection of hybridisation of labelled primers and nucleic acid molecules to complementary nucleic acids are known in the art and are described above and 25 in, for example, Sambrook et al. "Molecular Cloning: A Laboratory Manual" (2001); Cloning: A Practical Approach," Volumes I and II. As used herein, the term "probe" refers to a nucleic acid having a nucleotide sequence that is substantially complementary to its target nucleic acid sequence to be able to form a detectable hybrid probe:target duplex under 30 stringent hybridisation conditions. A "probe:target' duplex" is a structure that is a double-stranded structure formed between two complementary or substantially complementary nucleic acid molecules. The probe is typically labelled to facilitate detection of hybridisation of the probe to target sequence. Nucleic acid probes can be labelled by any one of several methods 35 typically used to detect the presence of hybridised nucleic acids. One common method of labelling is using a radioactive isotope such as, for example, 35S, or 7307326_1 18 32, 33P, or the like. The choice of radioactive isotope depends on research preferences due to ease of synthesis, stability, and half lives of the selected isotopes. Other labels include compounds (e.g., biotin and digoxigenin), which bind to antiligands or antibodies labeled with fluorophores, chemiluminescent 5 agents, and enzymes. Alternatively, probes can be conjugated directly with labels such as fluorophores, chemiluminescent agents or enzymes. The choice of label depends on sensitivity required, ease of conjugation with the probe, stability requirements, and available instrumentation. Methods for the labelling and detection of probes are described above and in, for example, Sambrook et 10 al. The probe may be of any length that is sufficient to permit the probe to hybridise specifically to nucleic acid of the sample that is complementary to the probe sequence. Typically, the labelled probe is contacted with nucleic acid from the is sample in a hybridisation method. The term "hybridisation method" refers to a known method whereby under sufficiently stringent hybridisation conditions, the probe hybridises specifically only to substantially complementary sequences. Examples of hybridisation methods include Southern hybridisation, dot blot, in situ hybridisation, Northern hybridisation. Hybridisation methods are described 20 in, for example, Sambrook et al., DNA Cloning vols 1, 11 and III, Nucleic Acid Hybridisation. The probe is typically hybridised with the nucleic acid from the sample under stringent hybridisation conditions. An example of stringent hybridisation conditions suitable for hybridisation using a probe is incubation in 50% 25 formamide, 5 X SSC (0.75M NaCI, 0.075M sodium citrate), 50mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5 X Denhardt's solution, sonicated salmon sperm DNA (50ptg/mL), 0.1% SDS, and 10% dextran sulfate at 420C, followed by washes at 420C in 0.2 X SSC and 0.1% SDS. Following washing of the hybridisation complexes that are formed during 30 the hybridisation, the hybridisation complexes are detected according to well known techniques. The target or probe nucleic acid may be immobilized to a solid support. As used herein, the term "solid support" refers to any solid phase material irrespective of scale provided that a nucleic acid, once secured to the solid 35 support, may be removed or separated in some fashion from the solution. The solid support may be the side of a vessel or well within a vessel, a three 7307326_1 19 dimensional matrix through which the solution passes such as a cartridge or filter, a bead, a capsule, a sheet or membrane, a microparticle or any other material which may ultimately separated from the solution. In an embodiment, target or probe nucleic acids may be non-specifically 5 bound to a solid support. For example, physical absorption of nucleic acids to a solid surface may take place. Nucleic acids can be immobilized onto nitrocellulose or nylon membranes by simply air drying or baking the membrane. Techniques for immobilization of nucleic acids are described, for example, by Jones, KD "Membrane Immobilisation of Nucleic Acids, Part 2: 1o Probe Attachment Techniques", IVD Technology 2, No. 3 (2001), page 59. In one form, a nucleic acid molecule of the invention is immobilized to a dipstick to provide a simple on/off test. In this form, a colour change can be detected if binding of nucleic acid from a sample binds to the immobilized nucleic acid molecule. The nucleic acid molecule may be immobilized across a is large portion of the dipstick so as to create a distinctive symbol or message, for example by completing a line, so that a positive test can be easily visualized. Methods for detecting nucleic acid targets using dipstick technology are described in, for example, WO 00/29112. Methods for the immobilization of nucleic acid molecules on solid surfaces such as dipsticks and the like are 20 described in, for example, EP0455905. Also provided are kits for the detection of Pseudomonas aeruginosa AES-. Suitable kits contain the nucleic acid molecule of the invention. The nucleic acid molecule may be labelled as described above for use in, for example, PCR or hybridisation methods. The kit may comprise in addition, 25 suitable buffers, enzymes, reagents and/or instructions for use. The present invention also provides a method for reducing or preventing the spread of Pseudomonas aeruginosa strain AES-I infection in a group of subjects susceptible to infection from Pseudomonas aeruginosa strain AES-. Groups of subjects may be, for example, patients in a hospital ward, or a CF 30 clinic, that are susceptible to Pseudomonas aeruginosa strain AES-I infection. The invention therefore provides a means for managing Pseudomonas aeruginosa strain AES-I infection in areas such as CF clinics, hospital wards containing CF patients or other patients with lung disorders or other conditions which render the patients susceptible to infection from Pseudomonas 35 aeruginosa strain AES-. The present invention permits screening of patients for Pseudomonas aeruginosa strain AES-I infection, and if infected, 7307326_1 20 segregation measures can then be employed for those infected individuals to prevent or at least reduce spread of infection to the uninfected subjects of the group. The methods for identifying subjects infected with Pseudomonas aeruginosa strain AES-I are as described above. 5 The invention will now be further described by way of reference only to the following non-limiting examples. It should be understood, however, that the examples following are illustrative only, and should not be taken in any way as a restriction on the generality of the invention described above. 10 Examples A. Introduction 15 To identify genes unique to the genome of Pseudomonas aeruginosa AES-I strains, a suppression subtractive hybridisation (SSH) of DNA from Pseudomonas aeruginosa AES-I isolate 973 against PAO-1 was performed. PAO-1 is the sequenced reference strain of Pseudomonas aeruginosa. 20 B. Methods and Materials Bacterial strains. Pseudomonas aeruginosa strains used in this study included the laboratory strains PAO1 (ATCC 15693), PAK, PA103 and ATCC 27853; 55 CF isolates and 7 non-CF clinical isolates (urine, sputum, bronchial wash) from 25 the Monash Medical Centre, Melbourne, Australia; 52 non-CF clinical isolates kindly provided by Di Olden, Gribbles Pathology, Melbourne, Australia; 6 environmental isolates obtained from the Water Board Authority, Sydney, Australia; 56 CF isolates from the Royal Children's Hospital, Melbourne that had been previously typed by PFGE (Armstrong et al. (2002)); and 30 representative isolates of the Liverpool epidemic strain (LES), the Manchester epidemic strain (MA) and the Australian epidemic strain pulsotype II (AES-II) kindly provided by Claire Wainwright (Royal Children's Hospital, Brisbane, Australia). All strains were confirmed to be P. aeruginosa by selection on Pseudomonas Isolation agar and amplification of the oprL gene by PCR (Xu J 35 et al. Ann. Clin. Microbiol. Antimicrob. (2004) 3: 21). Escherichia coli strain 7307326_1 21 DH5a was used for transformation of the SSH library. Oligonucleotides used in this study are listed in Table 1. Table 1: Oligonucleotides used in this study Primer Sequence Target Amplicon Annealing sequence size (bp) Temp (*C) oprLF 5' ATGGAAATGCTGAAATTCGGC 3' oprLR 5' CTTCTTCAGCTCGACGCGACG 3' HW1/11/20 F 5'- CCCCGCCAGTAGACCGTGTAG-3' HW1, HW11 and 295 58 HW1 /11/20R 5'- AATCAACGCATTCCATCGCTC-3' HW20 HW2F 5'- CCCCGCAAGACCAAAAATG-3' HW2 (SEQ ID 153 54 HW2R 5'- GGTATTAGTGCTCCTCGCCTGTC-3' NO: 1) HW3F 5'- CAGACATTGCCTCCACCGAAG-3' HW3 283 55 HW3R 5'- GAAAGCCTGCCGAGTGACG-3' HW6F 5'- AAGATTCGTGGATACCTTGACCC-3' HW6 689 58 HW6R 5'- TGCTTACCCCCGATTGAGAAG-3' HW8F 5'- GACCAGGAGCGGGACATAGC-3' HW8 454 58 HW8R 5'- TGGCATTCAGGGGTGACAGG-3' HW12F 5'- CCAGTGTAGTAAATCGCATAGACGC-3' HW12 209 55.5 HW12R 5'- GTTGGCAGTTGCTGAAATCCTC-3' HW1 8F 5'- GCTTTTCGGTCATCAATGCCAG-3' HW18 338 59 HW18R 5'- TTTCGGAGAGACGCCCCC-3' HW22F 5'- ACCAACCTAAGAGCCCATCTGAG-3' HW22 417 57 HW22R 5'- ATAGCCGTAGCCTCCAAAACG-3' HW23F 5'- CCTTTCTTTAGTGCGGACGGTAAG-3' HW23 268 58 HW23R 5'- GCTCACCCTCCATTCCCTGG-3' Real time PCR primers RTHW2F 5'-AATCCCCGCAAGACCAAAA-3' RTHW2R 5'-GGGTTAAGGTTACATTGGTTGTTTGT-3' HW2 60 RTHW2-P 5'-TGCAGGCAGCGTTAACCGCAGA-3' RToprLF 5'-GAGTACGACAGCTCCGACCTG-3' RToprLR 5'-TCTTTCGCGTGTACGTCCAG-3' oprL 60 RToprL-P 5'-AGCCGGAAGCCATGCGCG-3' 5 Molecular techniques. Chromosomal DNA for SSH was isolated using the Masterpure DNA purification kit (Epicentre Technologies) according to manufacturer's instructions. Chromosomal DNA used for PCR was isolated using Masterpure DNA Purification Kit (Epicentre Technologies), DNeasy Tissue Purification Kit (Qiagen Sciences) or Whatman FTA@ Elute cards 10 according to manufacturer's instructions. Miniprep DNA of SSH clones was 7307326_1 22 prepared using the QiAprep Spin Miniprep Kit (Qiagen Sciences) according to manufacturer's instructions. Sequencing and PCR reactions were performed on a MasterCycler Thermal cycler (Eppendorf). Nucleotide sequences were determined by use of a PRISM Big Dye Terminator Cycle Sequencing Ready 5 Reaction kit (Applied Biosystems) according to the manufacturer's instructions. Sequences were analysed using MacVector 8.02 (Accelrys). Construction and screening of AES-I subtraction library. The AES-I isolate (strain 973) was used as the tester strain for SSH. This strain was chosen from a collection obtained from the Royal Children's Hospital, Melbourne that had 10 been previously identified as the clonal strain we now refer to as AES-I (Armstrong et al. (2002) Am. J. Resp. Crit. Care Med. 166: 983-987). The driver strain used for SSH was the sequenced reference strain PAO1. The Clontech PCR-Select Bacterial Genome Subtraction kit was used to generate the SSH library of Rsal fragments according to manufacturer's instructions but is with a hybridisation temperature of 73 0 C. The library of SSH PCR amplicons was cloned in pGEM-T Easy (Promega). Individual clones were miniprepped and sequenced using the M13 Forward universal sequencing primer. To determine the presence or absence of the SSH clone sequence in the PAO1 genome, sequences were used in BLASTN searches at the Pseudomonas 20 genome project web-site (http:/Pseudomonas.corn). AES-I sequences were further analysed using BLASTN and BLASTX searches (Altschul et al. (1997) Nucl. Acid Res. 25: 3389-3402) of the NCBI Genbank databases (http://wwv.ncbi.nlrmnihgov). PCR screening of strains. Oligonucleotides (Sigma Proligo) and annealing 25 temperatures used in the PCR assays are listed in Table 1. Primers to amplify AES-I genome sequences were designed using MacVector 8.02 (Accelrys). Primers to amplify the conserved oprL gene have been described previously (Xu et al. (2004)). PCR amplifications were performed in 50 mL reaction volumes containing either 1 mL of purified chromosomal DNA or 1 mL of 30 overnight broth culture, 1 x Taq DNA polymerase buffer (Roche Molecular Diagnostics), 100 nM each dATP, dTTP, dCTP, dGTP (Fisher Biotech), 5 mL DMSO, 200 nM each oligonucleotide primer and 2.5 U of Taq DNA polymerase (Roche Molecular Diagnostics). Amplifications were carried out with an initial denaturation of 94 0 C for 2 min followed by 40 cycles consisting of 94 0 C (1 min), 35 annealing temperature as outlined in Table 1 (1 min) and 72 0 C (1 min) with an additional extension at 72 0 C for 10 min following completion of the 40 cycles. 7307326_1 23 Reaction products were electrophoresed on 2% (wt/vol) agarose gels to determine the presence of the appropriately sized amplicon. Pulsed Field Gel Electrophoresis. Molecular typing by PFGE following digestion with Spel and Dral was performed as previously described 5 (Armstrong et al. (1996) Ped. Pulmonol. 21: 267-275)). An isolate was considered to be AES-I or closely related to AES-I if its PFGE patterns differed by no more than three bands from the P. aeruginosa strain 973 which had been previously determined to be AES-I by PFGE (Armstrong et al (2002)). PCR from sputum samples. Samples of sputum were swabbed onto 10 Whatman FTA@ Elute cards and allowed to air dry. DNA from each card were eluted according to manufacturer's instructions and added to PCR tubes containing reaction mixtures for the PCR amplification of either oprL or the HW2 locus. PCR reactions were electrophoresed on 2% (w/vol) agarose gels to determine the presence of the appropriately sized amplicon. P. aeruginosa 15 strains were also isolated from the sputum samples and typed by PFGE to validate the PCR diagnosis. Quantitative Real-time PCR. Primers and TaqMan@ MGB probes (Applied Biosystems) were designed from regions of the sequences of the HW2 locus and the oprL gene (RTHW2 and RToprL, Table 1) using the Primer Express@ 20 Software v1.0 program (Applied Biosystems). Probe RTHW2-P (Table 1) was labelled with fluorescent dye 6-FAM at the 5' end and nonfluorescent quencher BHQ1 at the 3' end (Sigma). Probe RToprL-P (Table 1) was labelled with fluorescent dye 6-TAMRA at the 5' end and nonfluorescent quencher BHQ2 at the 3' end (Sigma). Real-time PCR mixtures contained, 0.8 pM concentrations 25 of each primer, 0.6 pM concentration of the probe, ABsoluteTM QPCR ROX (500 nM) Mix (ABgene) and either 1 pl (genomic) or 5 pl (Whatman FTA@ Elute card) of template DNA. To monitor PCR inhibition the TaqMan@ Exogenous Internal Positive Control (IPC) (Applied Biosystems) was multiplexed in the HW2 assay in a total volume of 25 pl. The OprL assay was performed as a 30 singleplex 25 pl reaction. Amplification and detection were performed with the Eppendorf Realplex Mastercycler using the following program: 1 cycle of 950C for 15 min and 40 cycles of 950C for 15 sec and 600C for 1 min. Negative controls were included in each assay. Cycle thresholds (Ct) from experiments to determine method sensitivity were reported as the average and standard 35 deviation of three biological repeats. Correlation coefficients between Ct and 7307326_1 24 DNA template concentration for each TaqMan assay were calculated by regression analysis. Results 5 AES-I subtracted Library. To identify genes unique to the AES-I genome, we performed suppression subtractive hybridisation (SSH) of DNA from AES-I isolate 973 against PAO1, the sequenced reference strain. We sequenced 20 clones from the SSH clone library and identified 6 that contained PAO1 genome sequences. Of the remaining 14 clones, 12 contained AES-I sequences not io present in PAO1 (Table 2). BLASTX analysis of the 12 unique AES-I SSH sequences indicated that 3 (HW15, HW16, HW21) were 100% identical to genes located within the P. aeruginosa 06 antigen LPS biosynthetic gene cluster (Raymond et al (2002) J. Bacteriol. 184: 3614-3622) and thus identified AES-I as belonging to the 06 serotype, a widespread serotype and the same is as the LES and Midlands epidemic strains (Parsons et al. (2002) J. Clin. Microbiol. 40: 4607-4611) Other homologies identified using BLASTX searches include a probable bacteriophage tail protein (HW8), a very short mis-match repair protein (HW6), a DNA cytosine methyltransferase (HW6), a restriction endonuclease (HW12) and a dGTP triphosphohydrolase (HW22) (Table 2). 20 BLASTN and BLASTX searches with the remaining 4 AES-I SSH clones did not produce significant hits in the Genbank sequence databases (Table 2). 7307326_1 0j LO- I-- 0 0 r) 0) ( Cuw w w w w w w w w >C) C) C'J C) C ) CD - CD C CD CD C CD~ CDLf C) 0) C) 0) C(CNC C C) C)- CD C) CD 00~ 0' 0' 0)C0 4 0 -0) Cl) 0) I- ce) C) C) 0C C D 0 4-U') C0 U') U') U') Dt ) )- (N) 0e ) 0 4C 4- CD 00 r - 0) U') 04 CD CD Ou 0) -f CD Lf0 U) C0 0) C0 CC CD ob Ub ) 0 0 LI) A'j C 6 a' U). co 0 D~u) ( > N > ~ a) c co5 ~ j oo 14 c- 0o (n~ E - co E : Q' ) 0)0) a cc a) 0 ) U 0 C 0o 02 r- C0 o co 0o U. Q E )t C e o ,C -,4 0 04 c) ice c co&,~ C o 0o 0o -t : (t C) (n 0o o au C) Q ) C ~ Q ce LOL . ttn a)( of C) - C) a) ca) 0 0 .' ~ 0 :- D- 0 m -L) E CD -o- - " LL coJg~ - = -ce (n C:) C) Co co a) 2FJ0 CI4 L , fL C. 00 (n.-o 0~~v (n U) (n~.O /)~u D U) 0) N ~ co) N Zf- of( N~ t oo a) 1) Q) C _) 73 : a) >N a) -o a 0) V oo E of .n LM E x a) co CDo ~ -n cm - 0 0~~ ~ N DN0 ~ o > 0)~ ~~ N ~- - o Z 0 ~~( Q 1) U) U -t ce) 0: e) ce) 0) 0) 0 0D N 0CD 00 N0 ce) CD0 CD CD0 00 0CDe 0 umL) 00 C 0) um) ce) Lf) CD 0 CD0 00 UJ00 U) (N C (N ~) C CD ~CD M - 26 Distribution of AES-I sequences in P. aeruginosa isolates. We designed PCR primer pairs to amplify each of the 9 different AES-I genetic sequences that were not found in PAO1 and that did not localise to the 06 antigen gene cluster. We first performed PCR with each primer set using the AES-I SSH 5 driver strain (isolate 973) and PAO1 genomic DNA to confirm that the PCR reaction worked and was specific to AES-. One of the primers sets (HW1/1 1/20) amplified a non-specific product in PAO1 and was not used in further assays (data not shown). We next performed an initial PCR profiling with the remaining 8 AES-I PCR 10 primer sets on a collection of 9 AES-I strains (including driver strain), 9 non AES-I CF isolates, 7 non-CF clinical isolates, 6 environmental isolates and the common laboratory strains PAO1, PA103, PAK and ATCC 27853 (Table 3). Each of the CF isolates in this collection had been previously genotyped by PFGE and classified as AES-I or non-AES-I (Armstrong et al (2002). We also 15 performed PCR with primers that were designed to amplify the conserved oprL gene that is present in all P. aeruginosa strains (Xu et al (2004); De Vos et al (1997) J. Clin. Microbiol. 35: 1295-1299) to confirm that a negative PCR result was not due to failure of the PCR reaction. These PCR assays identified that only the SSH loci HW2, HW3 and HW8 were unique to all 9 AES-I strains 20 tested (Table3). The oprL, HW2, HW3 and HW8 PCR primer sets were then used to screen a larger collection of P. aeruginosa strains including a further 38 CF isolates that had been previously profiled by PFGE typing to be either AES-I (Pitt TL (2002) Thorax 57: 921) or non-AES-I (20) Armstrong et al (2003) J. Clin. Microbiol. 41: 25 2266-2267; Armstrong et al (2002). We also PCR-screened representatives of other epidemic CF P. aeruginosa strains including LES, MA and the Australian epidemic strain pulsotype II (AES-II) (Jones et al (2001) Lancet 358: 557-558; Anthony et al (2002) J. Clin. Microbiol. 40: 2772-2778; Chang et al (1996) Lancet 348: 639-642) as well as another 52 non-CF clinical isolates for the 30 presence of the HW2, HW3 and HW8 AES-I sequences (Table 3). These PCR profiling experiments revealed that the HW2 locus was present in all of the extra 18 AES-I isolates and none of the other 20 CF or 52 non-CF clinical P. aeruginosa strains tested. HW3 was found to be present in all but 4 AES-I strains and none of the other P. aeruginosa strains whereas HW8 was present 35 in all AES-I strains but was also present in 2 non-CF clinical isolates (Table 3). 7307326_1 - 27 In total then, of the 121 P. aeruginosa strains in this collection, the PCR assays identified the HW2 locus to be present in all 27 AES-I isolates and to be absent in all other P. aeruginosa strains; HW3 was identified to be present in 23/27 AES-I strains and to be absent in all others; and HW8 was identified to be 5 present in 27/27 AES-I strains and 2/94 non AES-I strains. We also performed BLASTN analyses of the genome sequences of the P. aeruginosa strains PA14, PA7, PACS2, PA2192, and PAC3719 to determine the presence of the HW2, HW3 and HW8 loci in these genomes. These bioinformatic analyses indicates that none of these loci are present in any of 10 these strains. Table 3: Distribution of SSH Sequences Isolates oprL HW2 HW3 HW6 HW8 HWI2 HWI8 HW22 HW23 Initial screeen AES-I (n=9) 9 9 9 9 9 9 9 9 9 non AES-I CF(n=9) 9 0 0 1 0 0 0 1 2 non-CF clinical (n=7) 7 0 0 1 1 1 5 0 2 Lab strains (n=4)a 4 0 0 0 0 0 2 1 2 Environmental (n=6) 6 0 0 0 1 0 2 0 0 Second screen AES-I (n=18) 18 18 14 ND 18 ND ND ND ND other epidemic CF (n=3)b 3 0 0 ND 0 ND ND non AES-I CF (n=20) 20 0 0 ND 0 ND ND ND ND non-CF clinical (n=52) 52 0 0 ND 2 ND ND ND ND CF clinic screen AES-I (n=8) 8 8 7 ND 8 ND ND ND ND non AES-I CF (n=46) 46 0 0 ND 2 ND ND ND ND TOTALS Total AES-I (n=35) 35 35 30 ND 35 ND ND ND ND Total non-AES-I (n=147) 147 0 0 ND 5 ND ND ND ND a PAO1, PAK, PA1 03 and ATCC 27853 b LES, MA and AES-II 15 7307326_1 - 28 Detection of AES-I in P. aeruginosa isolates from a CF clinic. In 2005 we commenced a study to determine the prevalence of the AES-I strain in patients attending the Monash Medical Centre CF clinic. Sputum was collected by spontaneous expectoration or hypertonic saline induction in patients 6 years or 5 older and plated onto selective media to detect P. aeruginosa by standard techniques (Armstrong et al. (1997) Am. J. Resp. Crit. Care Med. 156: 1197 1204). PFGE was used to identify the genotype of 54 P. aeruginosa isolates of which 8 were identified to be AES-l. PCR with the oprL, HW2, HW3 and HW8 primer sets was performed on DNA purified from the same set of P. aeruginosa 1o isolates (Table 3). These PCR assays showed that the HW2 and HW3 loci were absent in all 46 non-AES-I P. aeruginosa isolates obtained in this study whereas HW8 was found to be present in 2 non-AES-I isolate. Each of the 8 AES-I strains possessed the HW2 and HW8 loci whereas the HW3 locus was present in 7 of the 8 AES-I isolates (Table 3). is Development of a diagnostic PCR protocol to detect AES-I in CF sputum. As the HW2 locus appears to highly conserved and unique to AES-I isolates, we have used PCR for the oprL and HW2 loci to develop a diagnostic assay to rapidly detect the presence of P. aeruginosa and AES-I directly from sputum samples. Sputum from Monash Medical Centre CF clinic patients that were 20 determined by PFGE to either harbour the AES-I strain or not was swabbed onto Whatman FTA@ Elute cards, DNA eluted and used in the oprL PCR assay to determine the presence of P. aeruginosa in the sputum sample and in a 2 nd PCR assay with the HW2 AES-I primers to determine if the P. aeruginosa present in the sputum was AES-I (Fig 2). The results of these PCR assays 25 showed that whilst both sputum samples were positive for the presence of P. aeruginosa as determined by the oprL PCR, only the sputum from the patient harbouring AES-I was positive with the HW2 PCR assay. These results demonstrate the utility of this diagnostic PCR assay to rapidly determine the presence of P. aeruginosa and AES-I directly from CF sputum. 30 Development of a diagnostic real-time PCR protocol to detect AES-I in CF sputum. To improve the diagnostic utility of the HW2 PCR we then developed real-time PCR TaqMan assays for HW2 and oprL. Detection sensitivity of the HW2/IPC multiplex and oprL TaqMan assays was assessed by performing real time PCR on dilutions of purified P. aeruginosa genomic DNA from an AES-I 35 strain. The standard curves obtained with 10-fold serially diluted genomic DNA preparations were linear over seven orders of magnitude for HW2 and five 7307326_1 - 29 orders for oprL (Table 4). Based on the complete DNA sequence, the predicted mass of a single copy of the P. aeruginosa PAO1 6,264,404 bp genome is 4.5 fg. Assuming a single copy of the target in the P. aeruginosa AES-I genome, the HW2 assay detected at least 220 genome copies. The oprL assay was less 5 sensitive, with a detection limit of 2.2 x10 4 genomes. The HW2/IPC and oprL assays were also evaluated as a triplex reaction but detection sensitivity was reduced (data not shown). Next, the specificity of the two TaqMan assays was tested against purified DNA from P. aeruginosa PAO1, P. putida and P. fluorescens. The HW2 TaqMan io assay was negative for these samples while oprL was positive for both P. aeruginosa and P. putida. DNA was then extracted from Whatman FTA@ Elute cards spiked with AES-I positive and unique strains of P. aeruginosa. As predicted, all extracts were oprL positive and only extracts from P. aeruginosa AES-I strains were HW2 and oprL positive. The same pattern of results was is obtained with DNA extracted from the AES-I positive and negative sputum samples used in the traditional PCR assay (see Fig 2 and Table 5). These data suggest that the HW2 and oprL TaqMan assays have sufficient sensitivity and specificity for screening clinical samples using sputum collected on Whatman FTA@ Elute cards. 20 7307326_1 ~t Cl \O c> 00 ZT Cl 00 Cuq 7C) 7 C) clC>-00C 00 7o 7 00 l 0 czH 000 -C 4-. 4oz 0~Zs CAu CU ~ Cu Im 0c u Ln4 31 In the claims which follow and in the preceding description of the invention, except where the context requires otherwise due to express language or necessary implication, the word "comprise" or variations such as 5 "comprises" or "comprising" is used in an inclusive sense, i.e. to specify the presence of the stated features but not to preclude the presence or addition of further features in various embodiments of the invention. It is to be understood that a reference herein to a prior art document does not constitute an admission that the document forms part of the common 10 general knowledge in the art in Australia or any other country. 15 7307326_1

Claims (12)

1. A method of determining whether Pseudomonas aeruginosa strain AES-I is present in a sample, comprising establishing whether nucleic acid from 5 the sample comprises one or more of the following: (a) the nucleotide sequence of SEQ ID NO: 1, or variant thereof; (b) a fragment of (a) which is capable of hybridizing specifically with Pseudomonas aeruginosa strain AES-1; and (c) the complement of (a) or (b), io wherein the presence of (a), (b) or (c) indicates that Pseudomonas aeruginosa strain AES-I is present in the sample.

2. The method according to claim 1, wherein establishing whether nucleic acid from the sample comprises one or more of (a), (b) or (c) comprises is the steps of: (a) contacting under hybridizing conditions nucleic acid from the sample with a nucleic acid molecule comprising a nucleotide sequence selected from the group consisting of: (i) the nucleotide sequence of SEQ ID NO: 1, or variant thereof; 20 (ii) a nucleotide sequence which is capable of hybridizing under stringent conditions with the nucleotide sequence of SEQ ID NO: 1; (iii) a fragment of (a) or (b) which is capable of hybridizing specifically with Pseudomonas aeruginosa strain AES-1; and 25 (iv) the complement of (i), (ii) or (iii); and (b) determining whether the nucleic acid molecule hybridises with the nucleic acid from the sample, whereby hydridisation of the nucleic acid molecule with nucleic acid from the sample indicates that Pseudomonas aeruginosa strain AES-I is 30 present in the sample.

3. The method according to claim 1 or 2, wherein the method comprises establishing whether nucleic acid from the sample comprises the nucleotide sequence of SEQ ID NO: 1. 35

4. The method according to any one of claims 1 to 3, wherein the nucleic acid molecule is at least one primer. 7351106_1 (GHMatters) P83557.AU PETERB 33

5. The method according to claim 4, wherein hybridisation is determined by amplification of a nucleotide sequence using the at least one primer. 5

6. The method according to any one of claims 1 to 5, wherein the nucleic acid molecule is a probe.

7. The method according to any one of claims 1 to 6, wherein the method comprises further determining whether nucleic acid from the sample 10 comprises the oprL gene.

8. The method according to any one of claims 1 to 7, wherein the sample is selected from the group consisting of sputum, blood, aspirate, swab, tissue, saliva, serum, pleural fluid and lavage. 15

9. A method of diagnosing a Pseudomonas aeruginosa strain AES-I infection, comprising: (a)providing a sample from a subject; (b) determining whether Pseudomonas aeruginosa strain AES-I is 20 present in the sample in accordance with the method of any one of claims 1 to 8.

10. The method of claim 9, wherein the subject is selected from the group consisting of a CF patient, a subject that is immunocompromised, a 25 subject that is a smoker and elderly subjects.

11. A method of reducing or preventing spread of Pseudomonas aeruginosa strain AES-I infection in a group of subjects susceptible to infection from Pseudomonas aeruginosa strain AES-1, comprising: 30 (a) providing a sample from each subject of the group; (b) determining whether Pseudomonas aeruginosa strain AES-I is present in the sample in accordance with the method of any one of claims 1 to 8; and (c) segregating those subjects of the group whose sample contains 35 Pseudomonas aeruginosa strain AES-I from those subjects of the group whose sample does not contain Pseudomonas aeruginosa strain AES-. 7351106_1 (GHMatters) P83557.AU PETERB 34

12. The method of claim 11, wherein the group of subjects comprises subjects selected from the group consisting of CF patients, subjects that are immunocompromised, subjects that are smokers and elderly 5 subjects. 7351106_1 (GHMatters) P83557.AU PETERB