AU2009304572B2

AU2009304572B2 - Hybrid plant cell

Info

Publication number: AU2009304572B2
Application number: AU2009304572A
Authority: AU
Inventors: Andrew Easton; Chloe Fourquin; Emi Kawanishi; Ekaterina Nowak; Peer Schenk
Original assignee: Advanta Seeds Pty Ltd
Current assignee: Advanta Seeds Pty Ltd
Priority date: 2008-10-17
Filing date: 2009-10-06
Publication date: 2015-04-09
Anticipated expiration: 2029-10-06
Also published as: AU2009304572A1; WO2010042974A1; AR075094A1; UY32182A

Abstract

The present invention is concerned with a hybrid plant cell resulting from protoplast fusion of a first plant cell with a first characteristic encoded by a mitochondrial gene and a second plant cell with a second characteristic encoded by a chloroplastic gene, wherein the nucleus of one of said first or second cell is inactivated prior to the protoplast fusion.

Description

WO 20101042974 PCT/AU2009/001324 HYBRID PLANT CELL Technical Field The present invention is concerned with a hybrid plant cell resulting from protoplast fusion of a first 5 plant cell with a first characteristic and a second plant cell with a second characteristic, plants comprising the plant cell, seed from and the progeny of such plants. In particular the present invention is concerned with the introduction of a chloroplast-encoded trait such as 10 triazine tolerance and a mitochondrial-encoded trait such as cytoplasmic male sterility (CMS) to a plant cell, although it is not so limited. Further, while the invention is described primarily with reference to Brassica napus hybrid varieties it is not so limited and 15 will have application to other plants and, more particularly, to other members of the Brassicaceae family. Background Art The Ogura cytoplasmic male sterility (CMS) system was 20 introduced to canola (Brassica napus) from radish (Raphanus sativus) by intergeneric hybridization and cell fusion. CMS is caused by the aberrant mitochondrial gene Orf138 that prevents the production of functional pollen without affecting female fertility (Desloire et al. 2003). 25 Rfo is a nuclear gene that restores male fertility by altering the expression of Orf138. at the post transcriptional level. The cytoplasmic male sterility system is important for the production of Fl hybrids where all genes are present in the heterozygous state. These 30 plants often have a greater vigour and disease resistance and generally display a greater adaptability to varying environmental conditions. The cytoplasmic male sterility system provides the breeder with an ideal tool to produce F1 hybrids with the male parent of choice. 35 Herbicide resistance is required to effectively control weeds in canola cultivation. TT canola - a conventionally bred strain of canola is resistant to the WO 2010/042974 PCT/AU2009/001324 -2 Triazine family of herbicides. It is grown extensively in Australia, for example, in Western Australia where it contributes to approximately 90% of the total canola production. TT canola was bred by using resistant genes 5 that were already present in the Brassica gene pool. Triazine tolerance is mediated by an A to G mutation at position +790 of the chloroplast gene psbA which encodes a 32kD herbicide binding protein (Reith and Strauss, 1987). To make Triazine tolerance accessible to the current main 10 hybrid breeding systems, it needs to be integrated into a functional cytoplasmic male.sterility system, such as the INRA CMS Ogura line. The technique of protoplast fusion offers the possibility of combining the chloroplastic Triazine 15 tolerance with the existing Ogura CMS system. When two or more isolated protoplasts fuse together, there is a coalescence of the cytoplasm. The nuclei of the fused protoplasts may fuse together (somatic hybrid or synkaryocyte), or they may remain separate containing 20 nonidentical nuclei (heterokaryons). Kao et al. (1991) described efforts to combine the mitochondrion-encoded Ogura CMS and chloroplast-encoded triazine tolerance in oilseed species of Brassica napus but indicate that flower malformations and pod distortions 25 had occurred in previous efforts. In their own experiments Ogura CMS Westar mesophyll protoplasts and TT Westar hypcotyl protoplasts were, fused without selection pressure and without further treatment. Isolation of a single, morphologically normal, resistant plant line, the 30 NFP26 regenerant, was asserted but the R 1 plants showed variability in morphology and maturity. It is suggested that the NFP26 regenerant was derived from the fusion of two B.napus genomes followed by chromosome segregation and elimination during backcrossing to result in some progeny 35 with the normal 2n=38 chromosome constitution. The remaining Ri progeny lines had various numbers of chromosomes from 38 to 76. Additionally, the non-recovery -3 of plants exhibiting the male-fertile, TT parental combination is said to indicate that the TT chloroplasts, whether within a fused cell or a parental escape, were selected against in their protoplast culture system. Additionally, it is well known that 5 somaclonal variation can occur during tissue culture and may lead to infertility in a proportion of the regenerated plants. Summary of the Invention Herein disclosed is a hybrid plant cell resulting from protoplast fusion of a protoplast derived from a first plant cell 10 with a first characteristic encoded by a mitochondrial gene and a second plant cell with a second characteristic encoded by a chloroplastic gene, wherein the nucleus of one of said first or second cell is inactivated prior to the protoplast fusion. Thus, according to an embodiment of the invention, there is 15 provided a male sterile hybrid plant cell from the family Brassicaceae resulting from protoplast fusion of a protoplast derived from a first plant cell with a first characteristic encoded by a mitochondrial gene, said first characteristic being cytoplasmic male sterility, with a protoplast derived from a 20 second plant cell with a second characteristic encoded by a chloroplastic gene, wherein prior to the protoplast fusion: (i) chloroplasts are eliminated from the protoplast derived from the first plant cell; and (ii) the nucleus of said second cell is inactivated. 25 Also herein disclosed is a process for preparing a hybrid plant cell comprising the steps of: (i) providing a protoplast derived from a first cell with a first characteristic encoded by a mitochondrial gene; (ii) providing a protoplast derived from a second cell with 30 a second characteristic encoded by a chloroplastic gene; (iii) treating the protoplast derived from one of said first cell or said second cell to inactive the nucleus; -4 (iv) inducing protoplast fusion; and (v) selecting a protoplast which possesses said first characteristic and said second characteristic and regenerating the plant cell therefrom. 5 Thus, according to another embodiment of the invention, there is provided a process for preparing a male sterile hybrid plant cell from the family Brassicaceae comprising the steps of: (i) providing a protoplast derived from a first plant cell with a first characteristic encoded by a mitochondrial gene, said 10 first characteristic being cytoplasmic male sterility; (ii) treating the protoplast derived from said first plant cell to eliminate chloroplasts from said protoplast; (iii) providing a protoplast derived from a second cell with the second characteristic encoded by a chloroplastic gene; 15 (iv) treating the protoplast derived from said second plant cell to inactivate the nucleus; (v) inducing protoplast fusion to produce a cytoplasmic hybrid; and (vi) regenerating the hybrid plant cell from the cytoplasmic 20 hybrid. According to another embodiment of the invention, there is provided a male sterile hybrid plant cell from the family Brassicaceae prepared by a process as described immediately above. According to another embodiment of the invention, there is 25 provided a process for generating a male sterile hybrid plant from the family Brassicaceae comprising preparing a male sterile hybrid plant cell by a process as described above, and regenerating a plant from said plant cell. Plants generated by this process are also hereby provided. 30 According to a still further aspect of the present invention there is provided a plant comprising a plant cell according to the invention.

-4a According to yet another aspect of the present invention there is provided the progeny of such a plant. According to yet another aspect of the present invention there is provided seed from such a plant. 5 Also herein disclosed is a method of improving a plant cell comprising inducing protoplast fusion of a protoplast derived from a first plant cell with a first characteristic encoded by a mitochondrial gene and a second plant cell with a protoplast derived from a second characteristic encoded by a chloroplastic 10 gene, wherein the nucleus of one of said first or second cell is inactivated prior to the protoplast fusion. Detailed Description of the Invention The invention relates to a hybrid plant cell resulting from protoplast fusion of a protoplast derived from a first plant cell 15 with a first characteristic encoded by a mitochondrial gene and a second plant cell with a second characteristic encoded by a chloroplastic gene. According to the invention the nucleus of one of the first or second cell is inactivated prior to the protoplast fusion. In an 20 embodiment it is the nucleus of the second cell which is inactivated. It is envisaged that any advantageous mitochondrial trait may constitute the first characteristic according to the method of the invention. In an embodiment the first characteristic is male 25 sterility. In an embodiment the first plant cell comprises the Ogura CMS system. In this system CMS is caused by the aberrant mitochondrial gene Orf138 that prevents the production of functional pollen without affecting female fertility. 30 In an embodiment a root or hypcotyl protoplast is used. In an embodiment this is derived from INRA CMS line Fu58.

WO 20101042974 PCT/AU2009/001324 It is envisaged that any advantageous chloroplastic trait may constitute the second characteristic according to the method of the invention. In an embodiment the second characteristic is herbicide tolerance and, in 5 particular, triazine tolerance. In an embodiment triazine tolerance is mediated by a mutation in a chloroplast-encoded gene which defeats the action of triazine herbicides. In an embodiment the chloroplast-encoded gene product is component of 10 photosystem II, more particularly, psbA which encodes a protein designated the QB protein. The Q1 protein binds plastoquinone and, with plastoquinone bound, functions as a secondary electron acceptor on the reducing side of the photosystem II reaction centre. While not wishing to be 15 bound by theory, it is believed that mutations which prevent triazine herbicides displacing bound plastoquinone are responsible for herbicide resistance. In an embodiment the mutation is a point mutation. For example, an A to G mutation at position +790 of the 20 chloroplast gene psbA induces triazine resistance in Brassica napus and is responsible for triazine tolerance in Brassica napus cv Thunder TT. Sequence information for the triazine-resistance mutation in Brassica napus psbA is available under Genbank Accession No. M36720.1 and set 25 forth in SEQ ID NOs: 1 and 2. In an embodiment the plant cell is from a plant of the family Brassicaceae. The family Brassicaceae comprises the genera Acanthocardamum; Aethionema; Agallis; Alliaria; Alyssoides; Alysopsis; Alyssum; Ammosperma; 30 Anastatica; Anchonium; Andrzeiowskia; Anelsonia; Aphragmus; Aplanodes; Arabidella; Arabidopsis; Arabis; Arcyosperma; Armoracia; Aschersoniodoxa; Asperuginoides; Asta; Atelanthera; Athysanus; Aubrieta; Aurinia; Ballantinia; Barbarea; Beringia; Berteroa; Berteroella; 35 Biscutella; Bivonaea; Blennodia; Boleum; Boreava; Bornmuellera; Borodinia; Botscantzevia; Brachycarpaea; WO 20101042974 PCT/AU2009/001324 -6 Brassica; Braya; Brayopsis; Brossardia; Bunias; Cakile; Calepina; Calymmatium; Camelina; Camelinopsis; Capsella; Cardamine; Cardaminopsis; Cardaria; Carinavalva; Carrichtera; Catadysia; Catenulina; Caulanthus; 5 Caulostramina; Ceratocnemum; Ceriosperma; Chalcanthus; Chamira; Chartoloma; Cheesemania; Cheiranthus; Chlorocrambe; Chorispora; Christolea; Chrysobraya; Chrysochamela; Cithareloma; Clastopus; Clausia; Clypeola; Cochlearia; Coelonema; Coincya; Coluteocarpus; Conringia; 10 Cordylocarpus; Coronopus; Crambe; Crambe la; Cremolobus; Crucihimalaya; Cryptospora; Cuphonotus; Cusickiella; Cycloptychis; Cymatocarpus; Cyphocardamum; Dactylocardamum; Degenia; Delpinophytum; Descurainia; Diceratella; Dichasianthus; Dictyophragmus; Didesmus; 15 Didymophysa; Dielsiocharis; Dilophia; Dimorphocarpa; Diplotaxis; Dipoma; Diptychocarpus; Dithyrea; Dolichirhynchus; Dontostemon; Douepea; Draba; Drabastrum; Drabopsis; Dryopetalon; Eigia; Elburzia; Enarthrocarpus; Englerocharis; Eremobium; Eremoblastus; Eremodraba; 20 Eremophyton; Ermania; Ermaniopsis; Erophila; Eruca; Erucaria; Erucastrum; Erysimum; Euclidium; Eudema; Eutrema; Euzomodendron; Farsetia; Fezia; Fibigia; Foleyola; Fortuynia; Galitzkya; Geococcus; Glaribraya; Glastaria; Glaucocarpum; Goldbachia; Gorodkovia; 25 Graellsia; Grammosperma; Guillenia; Guiraoa; Gynophorea; Halimolobos; Harmsiodoxa; Hedinia; Heldreichia; Heliophila; Hemicrambe; Hemilophia; Hesperis; Heterodraba; Hirschfeldia; Hollermayera; Hormathophylla; Hornungia; Hornwoodia; Hugueninia; Hymenolobus; Ianhedgea; Iberis; 30 Idahoa; lodanthus; Ionopsidium; Irenepharsus; Isatis; lachnocarpus; Iskandera; Iti; Ivania; Kernera; Kremeriella; Lachnocapsa; Lachnoloma; Leavenworthia; Lepidium; Lepidostemon; Leptaleum; Lesquerella; Lignariella; Li thodraba; Lobularia ; Lonchophora; 35 Loxostemon; Lunaria; Lyocarpus; Lyrocarpa; Macropodium; Malcolmia; Mancoa; Maresia; Mathewsia; Matthiola; Megacarpaea; Megadenia; Menkea; Menonvillea; WO 2010/042974 PCT/AU2009/001324 -7 Microlepidium; Microsysymbrium; Microstigma; Morettia; Moricandia; Moriera; Morisia; Murbeckiella; Muricaria; Myagrum; Nasturtiopsis; Nasturtium; Neomartinella; Neotchihatchewia; Neotorularia; Nerisyrenia; Neslia; 5 Neuontobotrys; Notoceras; Notothlaspi; Ochthodium; Octoceras; Olimarabidopsis; Onuris; Oreoloma; Oreophyton; Ornithocarpa; Orychophragmus; Otocarpus; Oudneya; Pachycladon; Pachymitus; Pachyphragma; Pachypterygium; Parlatoria; Parodiodoxa; Parolinia; Parrya; Parryodea; 10 Pegaeophyton; Peltaria; Peltariopsis; Pennellia; Petiniotia; Petrocallis; Phaeonychium; Phlebolobium; Phlegmatospermum; Phoenicaulis; Physaria; Physocardamum; Physoptychis; Physorrhynchus; Platycraspedum; Polyctenium; Polypsecadium; Pringlea; Prionotrichon; Pritzelago; 15 Pseuderucaria; Pseudoarabidopsis; Pseudocamelina; Pseudoclausia; Pseudofortuynia; Pseudovesicaria; Psychine; Pterygiosperma; Pterygostemon; Pugionium; Pycnoplinthopsis; Pycnoplinthus; Pyramidium; Quezeliantha; Quidproquo; Raffenaldia; Raphanorhyncha; Raphanus; 20 Rapistrum; Reboudia; Redowskia; Rhizobotrya; Ricotia; Robeschia; Rollinsia; Romanschulzia; Roripella; Rorippa; Rytidocarpus; Sameraria; Sarcodraba; Savignya; Scambopus; Schimpera; Schivereckia; Schizopetal.on; Schlechteria; Schoenocrambe; Schouwia; Scoliaxon; Selenia; Sibara; 25 Silicularia; Sinapidendron; Sinapis; Sisymbrella; Sisymbriopsis; Sisymbrium; Smelowskia; Sobolewslia; Sohms Laubachia; Sophiopsis; Sphaerocardamum; Spirorhynchus; Spryginia; Staintoniella; Stanfordia; Stanleya; Stenopetalum; Sterigmostemum; Stevenia; Straussiella; 30 Streptanthella; Streptanthus; Streptoloma; Stroganowia; Stubebdorffia; Subularia; Succowia; Synstemon; Synthlipsis; Taphrospermum; Tauscheria; Teesdalia; Teesdaliopsis; Tetracme; Thelypodiopsis; Thelypodium; Thiaspeocarpa; Thlaspi; Thysanocarpus; Trachystoma; 35 Trichotolinum; Trochiscus; Tropidocarpum; Turritis; Vella (plant); Warea; Wasabia; Weberbauera; Werdermannia; Winklera; Xerodraba; Yinshania; Zerdana and Zilla WO 2010/042974 PCT/AU2009/001324 In an embodiment the plant cell is from a plant of the genus Arabidopsis, Armoracia, Brassica or Raphanus, more particularly Brassica or Raphanus, and more particularly still of the genus Brassica. The 5 Brassicaceae family contains well-known species such as Arabidopsis thaliana, Armoracia rusticana (horseradish), Brassica oleracea (cabbage, cauliflower, etc), Brassica rapa (turnip, Chinese cabbage, etc), Brassica napus (rapeseed or canola) and Raphanus sativus (common radish). 10 In an embodiment the plant cell is from Brassica napus cv Thunder TT. A hybrid plant cell according to the invention can be prepared by a process comprising the steps of: (i) providing a protoplast derived from a first 15 cell with a first characteristic encoded by a mitochondrial gene; (ii) providing a protoplast derived from a second cell with a second characteristic encoded by a chloroplastic gene; 20 (iii) treating the protoplast derived from one of said first cell or said second cell to inactive the nucleus; (iv) inducing protoplast fusion; and (v) selecting a protoplast which possesses said 25 first characteristic and said second characteristic and regenerating the plant cell therefrom. Protoplasts may be prepared by removing the plant cell wall by using standard technology employing either mechanical or enzymatic means. Typically cell walls are 30 removed enzymatically using cellulases, pectinases or xylanases, or combinations thereof. Protoplasts may be fused using any convenient methodology. Typically protoplasts are induced to fuse under the influence of an electric field or in the presence of ethylene glycol or 35 polymers of ethylene oxide. In an embodiment the process further comprises embedding the hybrid resulting from protoplast fusion in WO 2010/042974 PCT/AU2009/001324 an agarose bead and culturing in cell medium culture. In this embodiment a cell culture is mixed with warm agarose-containing medium and distributed in small droplets on the bottom of a culture vessel. The droplets 5 form beads when the mixture solidifies. Liquid culture medium is further added to the vessel containing beads with embedded fused protoplasts. In this way liquid medium' composition can be easily adjusted directly in the culture vessel throughout cultivation according to the 10 requirements of developing calli, without disturbing them. This allows for better nutrient flow leading to many more calli being formed compared to conventional culture techniques. Calli reaching approximately 2 mm in diameter can be transferred to a solid culture medium, with 15 lessened changes of physical disruption during transfer. Typically 1% agarose is mixed with a medium such as Kao's medium. In an embodiment the process further comprises selection by way of culture on a triazine-containing 20 medium. Additionally, the medium may be reduced in carbon, such as a low sucrose content to ensure that the cells cannot survive under heterotrophic conditions only and are required to actively use chloroplasts for photosynthesis 25 and carbon assimilation. As triazine is added in the selection/regeneration medium this technique ensures that TT chloroplasts are actively selected for during plant regeneration and that these are highly abundant. This process avoids the proliferation of cells with a low 30 content of triazine tolerant chloroplasts or of cells with a low number of chloroplasts or no chloroplasts and increases the efficiency of regeneration of plants that are 100% or near 100% positive for triazine tolerance of their chloroplasts. 35 It is advantageous to regenerate a large number of cybrid plants from several independent fusion events and then to eliminate cybrids without the desired WO 2010/042974 PCT/AU2009/001324 - 10 characteristics or with atypical phenotypes, thus minimizing the possibility of somaclonal variation. Screening for triazine tolerance in the cybrid plants may be accomplished by addition of a triazine herbicide to 5 the culture medium. It will be appreciated that calli which contain chloroplasts with the triazine tolerance characteristic will be selected for in this process and thereafter will be the calli used for regeneration of plantlets. 10 In a further embodiment chloroplast segregation can be avoided by elimination of the organelles which do not encode triazine tolerance. In an-embodiment germination of CMS seeds is carried out on a medium containing norflurazon followed by 15 cultivation under a light source, and then conducting a protoplast fusion with protoplasts derived from the norflurazon-treated CMS cells. -In particular, in this embodiment cotyledons from norflurazon-treated seedlings are used as a source of protoplasts and fused with 20 protoplasts isolated from TT line green leaves. In addition, this allows for a visual identification of CMS line parental escape products following a fusion event, as norflurazon leads to a bleaching of the plant. In-an embodiment the TT cells are grown under low 25 light to enhance chloroplast numbers. In this embodiment, absent destruction of chloroplasts in the CMS line, the higher number of chloroplasts from the TT line increases the prospect of triazine tolerance in the cybrid. Growth of the TT line under low light conditions may be combined 30 with norflurazon treatment of the CMS line if desired. Additionally, screening of the cybrids on triazine containing medium can ensure that only those cybrids containing the triazine-tolerant trait are used to produce plantlets. 35 In an embodiment gamma irradiation is used to inactivate the nucleus of a protoplast derived from the first plant cell or protoplast derived from the second WO 2010/042974 PCT/AU2009/001324 - 11 plant cell. Advantageously the nucleus of the second plant cell with a second characteristic encoded by a chloroplastic gene is the one which is inactivated. The optimal dose for enucleation is in the range of 200 to 600 5 Gy, advantageously 400 Gy. Where the first characteristic is male sterility a plant produced by cell culture from a plant cell of the invention will be male sterile and contain cytoplasmic triazine tolerance. In order to maintain the male sterile 10 plant, crosses are made with a fertile maintainer line, as is well understood by a person skilled in the art. The presence of the CMS trait in plants means that they fail to develop functional pollen or anthers. Flowers from plants according to the invention do not produce viable 15 pollen and cannot self-pollinate. This CMS characteristic is inherited maternally via mitochondria, therefore, when a CMS female is crossed with a genetically identical maintainer line that produces pollen, all the seed produced retains the CMS trait. This allows maintenance 20 of the lines. Additionally, plants derived from the invention may be crossed with a restorer line which contains the nuclear gene that compensates for the defect in the cytoplasm. The nuclear gene restores fertility to the hybrid cross which nevertheless contains the triazine 25 tolerance encoded by the chloroplasts. Therefore the introduction of male sterility allows crosses to be performed without risk of self-pollination and with the ability to restore fertility to the cross. In this way traits such as triazine tolerance may be introduced to 30 hybrid varieties in which natural tolerance does not exist. Means by which such crossbreeding experiments can be performed are well known to the person skilled in the art and described, for example, in Delourme et al. (1995) 35 Modes for Performing the Invention WO 20101042974 PCT/AU2009/001324 - 12 Preferred embodiments of the invention will now be described with reference to the accompanying drawings in which: FIG. 1 is a schematic illustration of a scheme for 5 preparing cybrids containing triazine tolerance and male sterility. These plants may serve as the starting material for breeding F1 hybrids with the restorer gene leading to elite canola hybrid varieties with Triazine tolerance. This was achieved by protoplast fusions of a Triazine 10 tolerant variety with the INRA Ogura CMS line followed by selective regeneration of Triazine tolerant Ogura CMS plants. Example 1 15 Isolation of Protoplasts The TT and CMS line are surface-sterilized by. vacuum infiltration containing sodium hypochlorite and germinated on V2 MS medium. For the TT line, 6 - 8 seeds per pot are the best conditions for leaf expansion, and - 50 seeds per 20 pot is the optimal density for CMS line seeds. 4-week-old TT line leaves and 4-day-old CMS line hypocotyls are used for isolation of protoplasts. Leaves are sliced into - 2 mm wide strips, and hypocotyls with root and cotyledons removed are sliced in 7 mm pieces. The tissues are 25 incubated in enzyme solution consisting of 1% Cellulase and 0.3% Macerozyme for 15-17 hours. Gamma Irradiation To ensure that only nuclei from the CMS line remain active in fusion products, TT protoplasts are gamma 30 irradiated prior to protoplast fusion, with 400 Gy being the optimal dose for enucleation. PEG-induced Fusion WO 2010/042974 PCT/AU2009/001324 - 13 PEG-induced fusion was performed by mixing protoplasts of donor and recipient in a 1:1 ratio on a millicell membrane and fusing in small droplets in the presence of PEG 6000 (a blend of high molecular weight polymers of 5 ethylene oxide with different degrees of polymerisation having an average molecular weight of 7000-9000) as described by Thomzik and Hain (1988). The process of Thomzik and Hain involves preparation of a fusion solution: (A) 1.5g polyethylene glycol (PEG 6,000), 88mg 10 CaC1 2 x H20 and 180mg mannitol (Serva, FRG) were dissolved in 8.Oml H 2 0; (B) 468 mg glycine was dissolved in 25ml H 2 0, adjusting the pH to 10.0 with 10 M NaOH. Prior to fusion, 800 pl of solution A and 100 pl of solution B were thoroughly mixed with 100 pl dimethylsulfoxide (DMSO) and 15 immediately used (final conc. 15% PEG 6,000, 60 mM CaC1 2 x 2H 2 0, 90 mM mannitol, 25 mM glycine and 10% DMSO). Equally sized drops of the fusion solution were arranged in pairs in a 5cm diameter plastic petri dish. One drop of the protoplast mixture was gently added to 20 each pair of drops so that the three drops coalesced. Two further drops of the fusion solution were added to both sides of each coalesced drop. After 10 min, 2 ml of W5 salt solution supplemented with 50 mM morpholinoethane sulfonic acid (MES), pH 5.5 was gradually added over a 25 period of 5 min. Subsequently, the whole petri dish was filled and stored at room temperature for 1.5h. Tissue Culture and Plant Regeneration Fused protoplasts were embedded and cultured in 30 agarose beads medium consisting of Kao's medium, 68 g/l glucose and 1% type VII agarose (SIGMA) . After trials of different medium (Kao's medium and Gamborg's medium) and different sugar sources and concentrations, Kao's medium with glucose was found to be the best nutrient source to 35 support long-term protoplast survival. The agarose beads technique was superior to any other embedding methods, such as using liquids or a hanging droplet method. This WO 2010/042974 PCT/AU2009/001324 - 14 agarose beads technique facilitates cell division and it does not require any nurse culture. No difference was found with different temperatures and 24 0 C was chosen. The density of protoplasts in each agarose bead was optimized 5 to 1 x 105 protoplasts/ml. After 4 weeks, the microcalli were separated and placed on CC solid medium (MS, sucrose 20g/l, NAA 0.1 mg/1, BAP 0.5mg/1, 2.4-D 0.1mg/l). When calli reached 3-7 mm in diameter and greened up, they were transferred on the optimal shoot inducing medium, MS IV 10 (MS with 20g/l sucrose, BAP 3mg/i, NAA 0.15mg/l, AgNO 3 solution 5 mg/1). About 15% of the calli develop shoots on this medium starting from 3 months after the protoplast fusion. Well developed shoots were then transferred on SMI 15 medium (MS salts, 15 g/l sucrose, NAA 0.1 mg/i, BAP 0.5 mg/i) for further growth and multiplication. After two or three weeks on this medium, the shoots are placed on RF medium for root formation: (M2 MS salts, 10 g/l sucrose, IBA 0.1 mg/l). 20 Once roots are formed on the RF medium, the plants are ready for acclimatization in a glasshouse. Example 2 Quantification of TT chloroplasts by real-time 25 quantitative PCR (qPCR) It is important for later applications of the TT CMS line that Triazine tolerance is stable.. Therefore only plantlets with the highest number of TT chloroplasts were selected. The relative number of TT chloroplasts can be 30 quantified by real-time quantitative PCR from small DNA preparations of plantlets by using primers within the chloroplast psbA gene that are specific for the mutation at position +790. This was compared to the relative number of wild-type chloroplast psbA genes using wild-type 35 specific primers It was demonstrated that quantitative real-time PCR using four different sets of primers was WO 2010/042974 PCT/AU2009/001324 - 15 suitable to quantify the psbA gene in the TT line. The psbA gene is encoded by the chloroplast genome and responsible for triazine resistance. Although all the TT lines have the triazine resistance phenotype, it was not 5 previously known whether all of their chloroplasts contain the mutant psbA gene or only some portion of the chloroplasts contain the mutant gene. Currently there is no report about how much mutant psbA gene is sufficient for triazine resistance. The result from qPCR is given in 10 Table 1. Wildtype primers detected the Wildtype psbA gene and the TT primers detected the mutated psbA gene. However, the use of this method to accurately quantify TT chloroplasts can be limited because TT primers could also weakly amplify the WT gene (approx. 10% unspecific 15 amplification). As an alternative SNP genotyping by MassARRAY analysis (Oeth et al, 2005) can be used. This technique gives the ratio of wildtype and mutant psbA gene in the TT line DNA (Table 2). The first step consists of amplification of approximately 100 bp by PCR of the 20 flanking regions around the mutation in the psbA gene (SEQ ID NO: 1) . This is followed by the use of an extension primer that is specific for the point mutation at its 3' end. The MassARRAY primers that were designed for amplification of the flanking region by PCR were 25 ACGTTGGATGCTGCTCACGGTTATTTTGGC (SEQ ID NO:3) and ACGTTGGATGCAAGCCGCTAAGAAGAAATG (SEQ ID NO:4). Extension primers specific for the point mutation were AGAACGAGAATTGTTGAAAC (SEQ ID NO: 5) and AGAACGAGAATTGTTGAAACT (SEQ ID NO: 6). 30 Table 1 qPCR result DNA Primer CT Act WT/TT WT WTF 19 -3.07 8.39773 35 WT WT R 18.68 -3.58 11.95879 WT TT F 22.07 WT TT R 22.26 - TT/WT TT WT F 32.25 3.86 14.52031 TT WT R 30.81 2.54 5.81589 TT TTF 28.39 T TTR 28.27_ WO 20101042974 PCT/AU2009/001324 - 16 Table 2 A ratio of the low and high mass peaks for the assay Allele I (Low mass) G Allele 2 (High Mass) A Assay ID Sample ID psbA mutant (TT) psbA wildtype 5 psbA.SNP cms 0 1 psbASNP cms 0.0013 0.9987 psbASNP tt 0.8607 0.1393 psbA.SNP tt 0.937 0.0622 This result indicates that the majority of 10 chloroplasts in the TT line contained a mutant gene conferring triazine tolerance, but about 10% of the chloroplasts may still be wildtype. This technique is reliable and has the application for the callus selection. Plantlets with the highest ratio of TT chloroplasts to 15 wild type chloroplasts can be selected for and grown for regeneration of plantlets. Example 3 Wildtype chloroplast inactivation 20 A high number of TT chloroplasts in the donor parent and a low number or even the elimination of chloroplasts in the recipient parent is desirable to achieve stable triazine tolerance. This can be achieved by different light conditions of the starting material (low light for 25 donor and darkness for the recipient). Furthermore recipient chloroplasts may be inactivated by application of norflurazon, salinity treatment, ABA/ethylene treatment and methyl jasmonate treatment (inducing senescence) . As the segregation and elimination of TT chloroplasts could 30 be caused by the transfer of wildtype plastids from the CMS hypocotyl protoplasts, it can be beneficial and possible to eliminate/ irreversibly destroy these organelles. Norflurazon is a herbicide that directly inhibits 35 carotenoid biosynthesis by inhibiting one of the desaturase enzymes, phytoene desaturase, a membrane-bound WO 20101042974 PCT/AU2009/001324 17 enzyme in the chloroplast thylakoids. The most striking symptom in treated plants is the white foliage produced following treatment, which is sometimes termed ''albino growth.'' The bleaching is the result of a primary 5 inhibition of carotenoid biosynthesis coupled to a secondary inhibition of chlorophyll biosynthesis and a destruction of existing chlorophyll by light (photooxidation) . Since one of the important roles of carotenoids is to protect chlorophyll from photooxidation, 10 when carotenoids are not present photooxidation products initiate degrading reactions, including chlorophyll and membrane destruction (Hess, 2000). Hilton et al. (1971) demonstrated that norflurazon interferes with chloroplast (lamellar) -membrane lipid 15 formation. Vaisberg and Schiff (1976) have concluded that "the formation of plastid thylakoid membranes requires the simultaneous. availability of the membrane components and that this is normally achieved by an elaborate co regulation of the biosynthesis of these components to 20 ensure that the correct amounts are usually present. When the synthesis of one set of components (in this case, the carotenoids) is inhibited, the synthesis of other components such as chlorophyll is stopped and membrane assembly is halted." Frosch et al (1979) demonstrated that 25 in the presence of norflurazon, white or red light at high fluence rate causes photodestruction of chlorophyll and photodecomposition of thylakoids, without significantly affecting growth and morphogenesis of seedlings that germinated in the presence of the herbicide. They also 30 noted that under intensive lighting the plastids of norflurazon-treated seedlings degenerate rapidly, including thylakoid and ribosome disappearance. Norflurazon treatment was used on the CMS line plant material to remove and/or reduce the number of wildtype 35 plastids. Norflurazon was used in the concentration of 8 WO 2010/042974 PCT/AU2009/001324 - 18 mg/L in the medium for germination in tissue culture of CMS line seedlings that were further grown under a bright white light source. Bleached leaf material from these seedlings was used for isolation of protoplasts. Several 5 successful protoplast fusions were performed, yielding a large number of microcalli. For control, unfused protoplasts from bleached CMS line material were cultivated in agarose beads to produce CMS-only callus for visual comparison. 10 While a number of the 7-8 week old fusion-derived calli started greening up at a very fast rate, some remained pale in colour. About 50% of the control CMS-only calli started developing a faint green colour at 8 weeks, which should mean that in some cells pro-plastids were 15 able to survive the bleaching treatment. This may be explained as possibly depending on the age of cells or the degree of exposure to light (e.g. some seedlings overshadowed by the neighbouring ones in a tissue culture container). It could be assumed that some wildtype plastid 20 transfer is possible through Norflurazon-treated CMS material during the fusion. However, TT testing of cybrid samples taken at different stages throughout cultivation demonstrated that the TT chloroplast content in them was generally very high. The all-green calli tested were all 25 100% TT and even the "paler" ones were 83-97%, which on average is a lot higher than is achieved without the inactivation of CMS cell chloroplasts. Based on these observations, the best cybrids selected for had well-developed green colour, and were 30 likely to be 100% TT. These were placed on a non-selective medium containing 2% sucrose, for fast shoot development. Triazine selection on the medium with lowered sucrose concentration WO 20101042974 PCT/AU2009/001324 - 19 The first approach of using lowered sucrose levels in the medium was tested on previously developed cybrids and proved effective. Several 100% TT calli were so obtained. A general observation was that the earlier this selection 5 step was applied to cybrids, the higher was their survival rate during later steps. However, cultivation on the selective medium with lowered sucrose (0.5-1% sucrose) tends to weaken the ability of calli to produce shoots. Thus the selection step using low sucrose levels should be 10 followed by cultivation on a regular, 2% sucrose medium to promote shoot production. This way several shoots have efficiently developed on calli previously tested at 100% TT. Interestingly, several 100% TT shoots/plantlets were 15 derived from a callus previously tested at only about 10% TT. This suggests that the 100% TT shoots were selected for while the callus with shoots was cultivated on the multiplication medium (SMI) normally containing 1% sucrose, with addition of Triazine. These plantlets were 20 re-tested for TT after -2 months, confirming that the chloroplast segregation was complete and the trait is stable. On-the-medium selection for Triazine tolerance in cybrids promoted by lowering of the carbon source (sucrose) 25 concentration This approach allows Triazine to take effect on cultivated calli as a photosystem II suppressor, giving advantage to cells containing TT chloroplasts and driving the TT/WT chloroplast segregation towards the enrichment 30 of the TT chloroplast population. Cybrid calli were typically subjected to 1-2 3-week periods of cultivation on the selective 0.5% sucrose and 5 mg/L Triazine medium, followed by the non-selective 2% sucrose medium for shoot promotion. When testing the WO 2010/042974 PCT/AU2009/001324 - 20 effect of lowered sucrose levels (in the absence of norflurazon) it was found that generally, the number of calli surviving selection increased considerably, from -20% to -65%. 5 Taken together, these examples have demonstrated that the addition of norflurazon, triazine and lowered sucrose levels enabled the efficient selection and regeneration of triazine-tolerant CMS plantlets. Example 4 10 MITOCHONDRIA SEGREGATION AND CMS GENOTYPING It was previously demonstrated that the segregation phenomenon affects not only chloroplasts, but also mitochondria (Walters and Earle, 1993; Landgren and Glimelius, 2004). In this light, it was considered 15 important to find a suitable marker for the mitochondrial mutation conferring the cytoplasmic male sterility trait, as some of the fusion-derived calli may lose CMS mitochondria leading to development of TT, but non-CMS plants. Early molecular identification of the CMS trait 20 allows a considerable reduction in.phenological testing. The CMS trait is conferred by a mitochondrial DNA rearrangement which leads to impaired microsporogenesis. The trait has been introduced into canola from Japanese radish Raphanus sativus by protoplast fusion (Pelletier et 25 al. 1983). The mutation, Orfl38, has been sequenced and characterized (Krishnasamy and Makaroff, 1992; Grelon et al. 1994) and PCR primers have been used for its detection (Sigareva and Earle, 1997). As the mutation is dominant, presence of even one copy of this gene should confer male 30 sterility. Thus a simple, non-quantitative PCR test should be sufficient to detect the likelihood of cybrids being male-sterile.

WO 20101042974 PCT/AU2009/001324 - 21 Using primer sequences as described by Sigareva and Earle (1997), several fusion-derived calli with a high TT proportion and over 30 plantlets with parental or 100% were tested for the presence of the Orfl38 mutation. DNA 5 of the fertile TT line was used as a negative control and the CMS line as a positive control Primer sequences to the Orfl38 region used were: forward: GTCGTTATCGACCTCGCAAGG (SEQ ID NO: 7); reverse: GTCAAAGCAATTGGGTTCAC (SEQ ID NO:8). Amplification conditions were further optimized as 10 follows: 20 ng of plant DNA, 2 pmoles of the primers, PCR buffer with 2.5 mM MgCl 2 , 1 mM dNTPs, 1.5 units Taq polymerase in a 20-1 reaction volume; five minutes of denaturation at 95 0 C were followed by 35 cycles of 30 sec 92*C, 30 sec 50 C, and 30 sec 72 0 C. PCR products were 15 separated on 2% agarose gels. The PCR analysis demonstrated that all of the fusion-derived calli and plantlets produced a correct-size (500 bp) PCR amplification product identical to the one from the CMS line sample. All the cybrids and 100% TT plantlets tested 20 had been positive for the Orfl38 mutation, giving a 500 bp in size amplification product. The testing results for two of the 100% TT plants were consistent with that their flowers were phenotypically male-sterile. Thus the method can be used to identify regenerated plants with the CMS 25 trait. In addition, a method of quantitative PCR can be used with the above forward and reverse primers and most accurately, massARRAY technology can be used as described above. As CMS/WT mitochondria ratios may be important for 30 the overall performance of the plants, a quantitative PCR can be developed utilizing the sequencing information on the Ogura mutation previously published (Krishnasamy and Makaroff, 1992). Plants with the higher CMS/WT proportion may potentially have a higher stability for the CMS 35 phenotype.

WO 20101042974 PCT/AU2009/001324 - 22 Example 5 IN-FIELD CONFIRMATION OF TRIAZINE RESISTANCE Plantlets which tested 100%TT positive . in Example 3 and also contained the Orf138 mutation described in 5 Example 4 were transferred to 150mm pots and grown to maturity. Prior to flowering, leaf tissue was sampled and tested with real-time quantitative PCR (qPCR) and reconfirmed as possessing . 100%TT chloroplasts and mitochondria with the Orfl38 mutation. The plants were 10 sprayed with Atrazine herbicide and no chlorosis or plant death was observed at any stage subsequent to spraying. Non-TT plants were grown as checks and also sprayed with Atrazine. These plants exhibited symptoms of chlorosis seven days after spraying and died approximately 21 days 15 after spraying. Example 6 IN-FIELD CONFIRMATION OF THE CMS TRAIT AND POLLINATION The plants from Example 5 were observed throughout the flowering period, and all flowers produced were male 20 sterile. The flowers had normal sepal, stigma and ovary structures. The anthers were slightly smaller than normal, had a papery appearance and produced no pollen. The petals were slightly smaller in size, but otherwise had a normal structure. 25 Individual racemes on these plants were pollinated with two different Canola lines. The first line was a Canola Restorer line homozygous for a nuclear restorer gene which overcomes the Orf138 mutation in the cytoplasm, and causes normal production of pollen in the subsequent 30 generation. The second line was a Canola maintainer line. This line does not possess the nuclear restorer gene and is WO 20101042974 PCT/AU2009/001324 - 23 used to maintain the TT CMS line. Seed set from both these types of cross pollination activities was observed and the number of seeds per pod and seed size appeared to be normal.

WO 20101042974 PCT/AU2009/001324 -24 Example 7 IN-FIELD TESTING OF FERTILITY RESTORATION AND TRIAZINE TOLERANCE Seeds from Example 6 which were produced by 5 pollination with the Restorer line were grown and sprayed at the two leaf stage with Atrazine. No chlorosis or plant death was observed at any stage subsequent to spraying. Non-TT plants were grown as checks and also sprayed with Atrazine. These plants exhibited symptoms of chlorosis 10 seven days after spraying and died approximately 21 days after spraying. Tissue from the TT CMS lines was sampled and tested with real-time quantitative PCR (qPCR) and reconfirmed as possessing 100%TT chloroplasts and mitochondria with the Orfl38 mutation. 15 The plants were observed throughout the flowering period, and all flowers produced appeared normal. The flowers had normal sized and sepals, petals, stigmas, ovary structures. Unlike the TT CMS lines in Example 6 the restored plants possessed normal sized anthers which 20 produced normal appearing pollen. Pollen viability was tested by self pollinating the plants. Seed set was observed on the self pollinated racemes and the number of seeds per pod and seed size appeared to be normal.

WO 20101042974 PCT/AU2009/001324 - 25 REFERENCES: The contents of the following documents are incorporated herein by reference: Cseplo A., Medgyesy P., Hideg I., Demeter S, Mfirton 5 L. and Maliga P. (1985) Triazine-resistant Nicotiana mutants from photomixotrophic cell cultures. Mol Gen Genet 200:508-510. Christey M.C., Makaroff C.A. and Earle E.D. (1991) Atrazine-resistant cytoplasmic male-sterile-nigra broccoli 10 obtained by protoplast fusion between cytoplasmic male sterile Brassica oleracea and atrazine-resistant Brassica campestris. Theor Appl Genet 83:201-208. Delourme R., Ebrer F. and Renard, M. (1995), Breeding double low restorer lines in radish cytoplasmic males 15 sterility of rapeseed (Brassica napus L.), Proc. 9 th It. Rapeseed Cong. Cambridge UK 1:6-8.Desloire, S., H. Gherbi, W. Laloui, S. Marhadour, V. Clouet, L. Cattolico, C. -Falentin, S. Giancola, M. Renard, F. Budar, I. Small, M. Caboche, R. Delourme and A. Bendahmane (2003). 20 Identification of the fertility restoration locus, Rfo, in radish, as a member of the pentatricopeptide-repeat protein family. EMBO Rep 4(6): 588-594. Frosch S., Jabben M., Bergfeld R., Kleinig H., Mohr H. (1979) Inhibition of carotenoid biosynthesis by the 25 herbicide SAN 9789 and its consequences for the action of phytochrome on plastogenesis. Planta 145:497-505 Grelon M., Budar F., Bonhomme S. and Pelletier G. (1994) Ogura cytoplasmic male-sterility (CMS)-associated orf138 is translated into a mitochondrial membrane 30 polypeptide in male-sterile Brassica cybrids. Molecular and General Genetics 243:540-547 Hess D. F. (2000) Light-dependent herbicides: an overview. Weed Science 48:160-170.

WO 2010/042974 PCT/AU2009/001324 - 26 Hilton J. L., St. John J. B. Christiansen M. N. and Norris K. H. (1971) Interactions of lipoidal materials and a pyridazinone inhibitor of chloroplast development. Plant Physiology 48:171-177. 5 Jain S.M., Shahin E.A. and Sun S. (1988) Interspecific protoplast fusion for the transfer of atrazine resistance from solanum nigrum to tomato (Lycopersicon esculentum.1) Plant Cell, Tissue and Organ Culture 12:189-192. 10 Kao, H.M., Brown, G.G., Scoles G. and Seguin-Swartz G. (1991) Ogura cytoplasmic male sterility and triazine tolerant Brassica napus cv Westar produced by protoplast fusion, Plant Science 475:63-72. Krishnasamy S. and Makaroff C. A. (1993) 15 Characterization of the radish mitochondrial orfB locus: possible relationship with male sterility in Ogura radish. Current Genetics 24:156-163 Landgren M. and Glimelius K. (2004) Analysis of 20 chloroplast and mitochondrial segregation in three different combinations of somatic hybrids produced within Brassicaceae. Theoretical and Applied Genetics 80:776 784.Oeth M., Beaulieu M., Park C., Kosman D., del Mistro G., van den Boom D., and Jurinke C. (2005) iPLEX" Assay: 25 Increased plexing efficiency and flexibility for MassARRAY system through single base primer extension with mass modified terminators; Sequenom application note April 28, (www. sequenom.com). Pelletier G., Primard C., Vedel F., Chetrit P., Remy 30 R., Rousselle, Renard M. (1983) Intergeneric Cytoplasmic Hybridization in Cruciferae by Protoplast Fusion. Molecular and General Genetics 191:244-250 Reith, M., and N.A. Strauss. 1987. Nucleotide sequence of the chloroplast genes responsible for triazine 35 resistance in Canola. Theor. Appl. Genet. 73:357-363 WO 2010/042974 PCT/AU2009/001324 - 27 Sigareva M. A. and Earle E. D. (1997) Direct transfer of a cold-tolerant Ogura male-sterile cytoplasm into cabbage (Brassica oleracea ssp. capitata) via protoplast fusion. Theoretical and Applied Genetics 94:213-220. 5 Thomzik J.E. and Hain R. (1988) Transfer and segregation of triazine tolerant chloroplasts in Brassica napus L. Theor Appl Genet 76:165-171. Vaisberg, A. J. and Schiff, J. A. (1976) Events surrounding the early development of Euglena chloroplasts. 10 7. Inhibition of carotenoid biosynthesis by the herbicide SAN 9789 (4-chloro-5- (methylamino) -2- (a,c,ca-trifluoro-m tolyl) -3 (2H) pyridazinone) and its developmental consequences. Plant Physiology 57:260-269. Venkataiah P., Christopher T., Karampuri S. (2005) 15 Selection of atrazine-resistant plants by in vitro mutagenesis in pepper (Capsicum annuum). Plant Cell, Tissue and Organ Culture 83:75-82. Walters T. W. and Earle E. D. (1993) Organellar segregation, rearrangement and recombination in protoplast 20 fusion-derived Brassica oleracea calli. Theoretical and Applied Genetics 85:761-769.

Claims

1. A male sterile hybrid plant cell from the family Brassicaceae resulting from protoplast fusion of a protoplast derived from a first plant cell with a first characteristic 5 encoded by a mitochondrial gene, said first characteristic being cytoplasmic male sterility, with a protoplast derived from a second plant cell with a second characteristic encoded by a chloroplastic gene, wherein prior to the protoplast fusion: (i) chloroplasts are eliminated from the protoplast derived 10 from the first plant cell; and (ii) the nucleus of said second cell is inactivated.

2. A plant cell as claimed in claim 1, wherein said first plant cell comprises the Ogura CMS system, optionally wherein said first plant cell is of the INRA CMS Ogura line, optionally INRA 15 CMS line Fu58.

3. A plant cell as claimed in either one of claims 1 or 2, wherein said second characteristic is triazine tolerance.

4. A plant cell as claimed in claim 3, wherein triazine tolerance is mediated by a mutation in the chloroplast gene psbA. 20

5. A plant cell as claimed in any one of claims 1 to 4 from the genus Brassica, optionally Brassica napus, or from the genus Raphanus.

6. A process for preparing a male sterile hybrid plant cell from the family Brassicaceae comprising the steps of: 25 (i) providing a protoplast derived from a first plant cell with a first characteristic encoded by a mitochondrial gene, said first characteristic being cytoplasmic male sterility; (ii) treating the protoplast derived from said first plant cell to eliminate chloroplasts from said protoplast; 30 (iii) providing a protoplast derived from a second cell with the second characteristic encoded by a chloroplastic gene; (iv) treating the protoplast derived from said second plant cell to inactivate the nucleus; (v) inducing protoplast fusion to produce a cytoplasmic 35 hybrid; and (vi) regenerating the hybrid plant cell from the cytoplasmic hybrid. -29

7. A process as claimed in claim 6, wherein chloroplasts are eliminated from the protoplast derived from said first plant cell by herbicide treatment.

8. A process as claimed in claim 7 wherein said herbicide 5 treatment comprises a norflurazon treatment.

9. A process as claimed in any one of claims 6 to 8 comprising taking the second plant cell from a plant grown in low light.

10. A process as claimed in any one of claims 6 to 9 10 wherein gamma-irradiation is used to inactivate the nucleus of said second cell.

11. A process as claimed in any one of claims 6 to 10 further comprising culturing the hybrid plant cell in cell culture medium. 15

12. A process as claimed in claim 11 comprising embedding the hybrid plant cell resulting from protoplast fusion in a porous bead and introducing the porous bead to a cell culture medium.

13. A process as claimed in claim 12 wherein the porous bead is an agarose bead. 20

14. A process as claimed in claim 13 wherein hybrid cells are mixed with a warm agarose-containing medium and distributed in droplets to form agarose beads upon cooling.

15. A process as claimed in any one of claims 6 to 14, wherein said first plant cell comprises the Ogura CMS system, 25 optionally wherein said first plant cell is of the INRA CMS Ogura line, optionally INRA CMS line Fu58.

16. A process as claimed in any one of claims 6 to 15, wherein said second characteristic is triazine tolerance.

17. A process as claimed in claim 16, wherein triazine 30 tolerance is mediated by a mutation in the chloroplast gene psbA.

18. A process as claimed in claim 16 or claim 17 comprising selection by way of culture on a triazine-containing medium.

19. A process as claimed in claim 18 wherein the triazine containing medium is depleted in carbon. 35

20. A process as claimed in any one of claims 6 to 19 wherein the plant is from the genus Brassica, optionally Brassica napus, or from the genus Raphanus. -30

21. A male sterile hybrid plant cell from the family Brassicaceae prepared by a process according to any one of claims 6 to 20.

22. A process for generating a male sterile hybrid plant 5 from the family Brassicaceae comprising preparing a male sterile hybrid plant cell by a process as claimed in any one of claims 6 to 20, and regenerating a plant from said plant cell.

23. A male sterile hybrid plant regenerated from a plant cell according to any one of claims 1 to 5 or 21. 10

24. A plant comprising a plant cell as claimed in any one claims 1 to 5 or 21.

25. A plant which is the progeny of a plant as claimed in claim 23 or claim 24.

26. The seed of a plant as claimed in claim 23 or claim 24. 15 Pacific Seeds Pty Ltd Patent Attorneys for the Applicant/Nominated Person SPRUSON & FERGUSON