AU2009284691A1 - Seed active transcriptional control sequences - Google Patents

Description

WO 2010/019996 PCT/AU2009/001059 - 1 SEED ACTIVE TRANSCRIPTIONAL CONTROL SEQUENCES PRIORITY CLAIM 5 This patent application claims priority to Australian provisional patent application 2008904229, filed 18 August 2008, the contents of which is hereby incorporated by reference. FIELD 10 The present invention relates generally to transcriptional control sequences for effecting expression of a nucleotide sequence of interest in a plant. More particularly, the present invention relates to transcriptional control sequences that direct specific or preferential expression of an operably connected nucleotide sequence of interest in one 15 or more parts of a plant seed. BACKGROUND The primary emphasis in genetic modification has been directed to prokaryotes and 20 mammalian cells. For a variety of reasons, plants have proven more intransigent than other eukaryotic cells to genetically manipulate. However, in many instances, it is desirable to effect transcription of an introduced nucleotide sequence of interest in a plant. 25 Expression of a DNA sequence in a plant is dependent, in part, upon the presence of an operably linked transcriptional control sequence, such as a promoter or enhancer, which is functional within the plant. The transcriptional control sequence determines when and where within the plant the DNA sequence is expressed. For example, where continuous expression is desired throughout the cells of a plant, constitutive promoters 30 are utilised. in contrast, where gene expression in response to a stimulus is desired, an WO 2010/019996 PCT/AU2009/001059 -2 inducible promoter may be used. Where expression in specific tissues or organs is desired, a tissue-specific promoter may be used. Accordingly, there is a substantial interest in identifying transcriptional control 5 sequences, such as promoters or enhancers, which are active in plants. Frequently, it is also desirable to specifically or preferentially direct transcription in particular plant organs, tissues or cell types, or at particular developmental stages of plant growth. Thus, isolation and characterisation of transcriptional control sequences, which can serve as regulatory regions for the expression of nucleotide sequences of interest in 10 particular cells, tissues or organs of a plant, would be desirable for use in the genetic manipulation of plants. Reference to any prior art in this specification is not, and should not be taken as, an acknowledgment or any form of suggestion that this prior art forms part of the 15 common general knowledge in any country. SUMMARY OF THE INVENTION The present invention is predicated, in part, on the identification and functional 20 characterisation of transcriptional control sequences which specifically or preferentially direct expression of an operably connected nucleotide sequence in one or more parts of a plant seed. Thus, in a first aspect, the present invention provides an isolated nucleic acid 25 comprising: (i) a nucleotide sequence defining a transcriptional control sequence which specifically or preferentially directs expression of an operably connected nucleotide sequence in one or more parts of a plant seed, wherein said transcriptional control sequence is derived from a GL7 gene; and/or WO 2010/019996 PCT/AU2009/001059 - 3 (ii) a nucleotide sequence defining a functionally active fragment or variant of the nucleotide sequence defined at (i). In some embodiments, the GL7 gene encodes a polypeptide comprising the amino acid 5 sequence set forth in SEQ ID NO: I or a homolog thereof. In some embodiments, the transcriptional control sequence comprises the nucleotide sequence set forth in SEQ ID NO: 3 or a functionally active fragment or variant thereof. 10 In a second aspect, the present invention also provides a nucleic acid construct comprising an isolated nucleic acid according to the first aspect of the invention. In a third aspect, the present invention provides a cell comprising a nucleic acid construct according to the second aspect of the invention. 15 In a fourth aspect, the present invention contemplates a multicellular structure comprising one or more cells according to the third aspect of the invention. In some embodiments, the multicellular structure comprises a plant or a part, organ or 20 tissue thereof. In some embodiments of the fourth aspect of the invention, the plant or part, organ or tissue thereof comprises a seed. In some embodiments of the fourth aspect of the invention, a nucleotide sequence of interest may be operably connected to the transcriptional control sequence or the 25 functionally active fragment or variant thereof, such that the nucleotide sequence of interest is specifically or preferentially expressed in a seed, or in a particular cell or tissue type thereof, and optionally at a particular developmental stage of the seed. In a fifth aspect, the present invention provides a method for specifically or 30 preferentially expressing a nucleotide sequence of interest in one or more parts of a WO 2010/019996 PCT/AU2009/001059 -4 plant seed, the method comprising effecting transcription of the nucleotide sequence of interest in a plant under the transcriptional control of a nucleic acid according to the first aspect of the invention. 5 Nucleotide and amino acid sequences are referred to herein by a sequence identifier number (SEQ ID NO:). A sunmmary of the sequence identifiers is provided in Table 1. A sequence listing is provided at the end of the specification. Table I - Summary of Sequence Identifiers SEQ ID NO: 1 TdGL7 protein anino acid sequence SEQ ID NO: 2 T1dGL7 cDNA nucleotide sequence SEQ ID NO: 3 TdGL7 prornoter nucleoide sequence SEQ ID NO: 4 TdGL7 gene nucleotide sequence SEQ ID) NO: 5 TdGL'7 promoter and gene nucleotide sequence SEQ ID NO: 6 TaGL7 protein amnino acid sequence SEQ ID NO: 7 TaGL7 cDNA nucleotide sequence SEQ ID NO: 8 TaGAPdH (Q-PCR) forward primer SEQ ID NO: 9 TaGAPdH (Q-PCR) reverse primer SEQ ID NO: 10 TaGL7 (Q-PCR) forward primer SEQ ID NO: 11 TaGL7 (Q-PCR) reverse primer SEQ ID NO: 12 TdGL7_promoter forward primer SEQ ID NO: 13 'dGL7_promoter reverse primer SEQ ID NO: 14 GUS (RT-PCR) forward primer SEQ ID NO: 15 GUS (RT-PCR) reverse primer 10 DESCRIPTION OF EXEMPLA RY EMBODIMENTS It is to be understood that the following description is for the purpose of describing particular embodiments only and is not intended to be limiting with respect to the 15 above description.

WO 2010/019996 PCT/AU2009/001059 -5 In some embodiments the present invention is predicated, in part, on the cloning of the gene and promoter of a GL7 gene from wheat. Wheat, barley and rice were stably transformed with promoter-GUS fusion constructs and spatial and temporal activity of 5 the promoter was studied using whole-mont and histological assays. It was demonstrated that TaGL7 promoter is preferentially active in the seed. As used herein, the term "transcriptional control sequence" should be understood as a nucleotide sequence that modulates at least the transcription of an operably connected 10 nucleotide sequence. As such, the transcriptional control sequences of the present invention may comprise any one or more of, for example, a leader, promoter, enhancer or upstream activating sequence. As referred to herein, the term "transcriptional control sequence" preferably at least includes a promoter. A "promoter" as referred to herein, encompasses any nucleic acid that confers, activates or enhances expression of 15 an operably connected nucleotide sequence in a cell. As used herein, the term "operably connected" refers to the connection of a transcriptional control sequence, such as a promoter, and a nucleotide sequence of interest in such a way as to bring the nucleotide sequence of interest under the 20 transcriptional control of the transcriptional control sequence. For example, promoters are generally positioned 5' (upstream) of a nucleotide sequence to be operably connected to the promoter. In the construction of heterologous transcriptional control sequence/nucleotide sequence of interest combinations, it is generally preferred to position the promoter at a distance from the transcription start site that is 25 approximately the same as the distance between that promoter and the gene it controls in its natural setting, i.e. the gene from which the promoter is derived. As is known in the art, some variation in this distance can be accommodated without loss of promoter function.

WO 2010/019996 PCT/AU2009/001059 -6 Thus, in a first aspect, the present invention provides an isolated nucleic acid comprising: (i) a nucleotide sequence defining a transcriptional control sequence which specifically or preferentially directs expression of an operably connected nucleotide 5 sequence in one or more parts of a plant seed, wherein said transcriptional control sequence is derived from a GL7 gene; and/or (ii) a nucleotide sequence defining a functionally active fragment or variant of the nucleotide sequence defined at (i). 10 In the present invention, "isolated" refers to material removed from its original environment (e.g. the natural environment if it is naturally occurring), and thus is altered "by the hand of man" from its natural state. For example, an isolated polynucleotide could be part of a vector or a composition of matter, or could be contained within a cell, and still be "isolated" because that vector, composition of 15 matter, or particular cell is not the original environment of the polynucleotide. An "isolated" nucleic acid molecule should also be understood to include a synthetic nucleic acid molecule, including those produced by chemical synthesis using known methods in the art or by in-vitro amplification (e.g. polymerase chain reaction and the like). 20 The isolated nucleic acid of the present invention may comprise any polyribonucleotide or polydeoxyribonucleotide, which may be urunodified RNA or DNA or modified RNA or DNA. For example, the isolated nucleic acid molecules of the invention may comprise single- and double-stranded DNA, DNA that is a mixture 25 of single- and double-stranded regions, single- and double-stranded RNA, and RNA that is mixture of single- and double-stranded regions, hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically, double-stranded or a mixture of single- and double-stranded regions. In addition, the isolated nucleic acid molecules may comprise triple-stranded regions comprising RNA or DNA or both 30 RNA and DNA. The isolated nucleic acid molecules may also contain one or more WO 2010/019996 PCT/AU2009/001059 modified bases or DNA or RNA backbones modified for stability or for other reasons. "Modified" bases include, for example, tritylated bases and unusual bases such as inosine. A variety of modifications can be made to DNA and RNA; thus the term "nucleic acid" also embraces chemically, enzymatically, or metabolically modified 5 forms of DNA and RNA. As set out above, the method of the present invention contemplates a transcriptional control sequence which specifically or preferentially directs expression of an operably connected nucleotide sequence in one or more parts of a plant seed. 10 As referred to herein, a plant "seed" should be understood to refer to a mature or immature plant seed. As such, the term "seed" includes, for example, immature seed carried by a maternal plant or seed released from the maternal plant. In some embodiments, the term "seed" may encompass any seed plant sporophyte between the 15 developmental stages of fertilisation and germination. As would be appreciated, the term "seed" may also encompass the various cells and tissues that make up the mature or immature seed. For example, mature seeds may include tissue types such as the embryo, embryo surrounding region, endospern 20 transfer laver, starchy endosperm, aleurone laver, pericarp and the like. Mean while, immature seeds may include, for example, fertilised egg cells, zygotes, fertilised central cells, embryos, the endosperm coenocyte, the endosperm syncytium and the like. In some embodiments, the term "seed" may also extend to floral and/or maternal 25 gametophyte tissues. For example., the term "seed" may include floral arid/or maternal gametophyte structures that are precursors to, andl/or ultimately develop into, a seed or an associated structure. An example of such a structure may include an ovary or embryo sac in a plant flower. Thus, in some embodiments of the invention, the present invention relates to expression in such tissues. 30 WO 2010/019996 PCT/AU2009/001059 -8 It should be understood that reference herein to expression in a plant seed refers to the transcription and/or translation of a nucleotide sequence in one or more cells or tissues of a plant seed and/or at one or more developmental stages of the plant seed. This definition in no way implies that expression of the nucleotide sequence must occur in 5 all cells of the plant seed or at all developmental stages of the seed. As set out later, the nucleic acids of the present invention may direct expression in particular parts of a seed and/or at particular developmental stages of a seed. As set out above, the transcriptional control sequences contend plated by the present 10 invention "specifically or preferentially" direct expression of an operably connected nucleotide sequence in a plant seed. As used herein, "specifically expressing" means that the nucleotide sequence of interest is expressed substantially only in a plant seed (or a particular tissue or cell type therein). "Preferentially expressing" should be understood to mean that the nucleotide sequence of interest is expressed at a higher 15 level in a plant seed (or tissue or cell type therein) than in one or more other tissues of the plant, e.g. leaf tissue or root tissue. In some embodiments "preferential" expression in a plant flower includes expression of a nucleotide sequence of interest in a plant seed (or a tissue or cell type therein) at a level of, for example, at least twice, at least 5 times or at least 10 times the level of expression seen in at least one other non-seed 20 tissue of the plant. The transcriptional control sequence or functionally active fragment or variant thereof may effect specific or preferential expression in a seed from at least one seed plant species, including monocotyledonous angiosperm plants ("monocots"), 25 dicotvledorous angiosperm plants ("dicots") or gy-mn osperm plants. For clarity, this should be understood as the transcriptional control sequence or functionally active fragment or variant thereof being able to effect specific or preferential expression in a seed in at least one plant species. The transcriptional control sequence may or may not effect expression in one or more other plant species, and this expression may or may 30 riot be specific or preferential to the seed. Thus, the transcriptional control sequences of WO 2010/019996 PCT/AU2009/001059 -9 the present invention need not be active in all plant species, and need not necessarily direct specific or preferential expression in the seed in all plants in which they are active. 5 In some embodiments, the transcriptional control sequence directs expression of an operably connected nucleotide sequence in a seed of a monocotyledonous plant. In some embodiments, the transcriptional control sequence directs expression of an operably connected nucleotide sequence in a seed of a plant in the family Poaceae. 10 In some embodiments, the transcriptional control sequence directs expression of an operably connected nucleotide sequence in a seed of a cereal crop plant. As used herein, the term "cereal crop plant" may be a member of the Poaceae (grass 15 family) that produces grain. Examples of Poaceae cereal crop plants include wheat, rice, maize, millets, sorghum, rye, triticale, oats, barley, teff, wild rice, spelt and the like. The term cereal crop plant should also be understood to include a number of non Poaceae plant species that also produce edible grain, which are known as the pseudocereals and include, for example, amaranth, buckwheat and quinoa. 20 In some embodiments, the transcriptional control sequence directs expression of an operably connected nucleotide sequence in a seed of a wheat plant. As referred to herein, "wheat" should be understood as a plant of the genus 7riticum. 25 Thus, the term "wheat" encompasses diploid wheat, tetraploid wheat and hexaploid wheat. In some embodiments, the wheat plant may be a cultivated species of wheat including, for example, T. aestivum, T. durum, T. monococcum or T. selta. In some embodiments, the term "wheat" refers to wheat of the species Triticum aestivum.

WO 2010/019996 PCT/AU2009/001059 -10 In some embodiments, the transcriptional control sequence directs expression of an operably connected nucleotide sequence in a seed of a barley plant. As referred to herein, "barley" includes several members of the genus Hordeum. The 5 term "barley" encompasses cultivated barley including two-row barley (Hordeum distichutn), four-row barley (Hordeui tetrastichuni) and six-row barley (Hordeunm vulgare). In some embodiments, barley may also refer to wild barley, (Hordevui spontaneur). In some embodiments, the term "barley" refers to barley of the species Hordeum vulgare. 10 In some embodiments, the transcriptional control sequence directs expression of an operably connected nucleotide sequence in a seed of a rice plant. As referred to herein, "rice" includes several members of the genus Oryza including the 15 species Oryza sativa and Oryza glaberrina. The term "rice" thus encompasses rice cultivars such as japonica or sinica varieties, indica varieties and javonica varieties. In some embodiments, the term "rice" refers to rice of the species Oryza sativa. As set out above, the nucleic acid of the first aspect of the present invention may also 20 specifically or preferentially direct expression in a particular cell or tissue of a plant seed and/or specifically or preferentially direct expression at a particular developmental stage of a plant seed. In some embodiments, the transcriptional control sequence directs expression of an 25 operably connected nucleotide sequence in the endosperm, or a part thereof, in the seed, The tissues of a plant encompassed by the term "endosperm" would be readily understood by one of skill in the art. However, this term should be understood to 30 encompass at least the nutritive tissue, characteristic of flowering plants, which WO 2010/019996 PCT/AU2009/001059 - 11 nourishes the embryo. The endosperm is typically formed after the fertilisation of the polar nuclei of the central cell by a sperm nucleus. In most plants the endosperm is a transient tissue absorbed by the embryo before maturity, whereas in cereals and grasses it contains storage reserves in the mature grain and is not absorbed until after 5 germination. Typically, the "endosperm" includes at least five cell types, namely, the central starchy endosperm (CSE), the sub-aleurone layer (SAL), the aleurone layer (AL), the endosperm transfer laver (ETL) and the embryo-surrounding region (ESR). The 10 characteristics of each of these cell types are described in detail in the review of Olsen et al. (Trends in Plant Science 4(7): 253-257, 1999). In some embodiments, the transcriptional control sequence directs expression of an operably connected nucleotide sequence in the aleurone layer, or a part thereof, in the 15 seed. In some embodiments, the transcriptional control sequence directs expression of an operably connected nucleotide sequence in the embyro, or a part thereof, in the seed. 20 As referred to herein, the "embryo" of a plant seed refers to the part of a seed that comprises the precursor tissues of the leaves, stem (ie. hypocotvl), and root (ie. radicle), as well as one or more cotyledons. The number of cotyledons comprised within the embryo can vary according to the plant taxon. For example, dicotyledonous angiosperm embryos comprise two cotyledons, monocotyledonous angiosperm 25 embryos comprise a single cotyledon (also referred to as the scutellum), while gymnosperm embryos may comprise a variable number of cotyledons, typically ranging from 2 to 24. In light of the above, reference herein to an "embryo", particularly in the context of specific or preferential expression within an embryo (see later), may include expression in all of the embryo or expression in one or more cells, 30 tissues or parts of the embryo.

WO 2010/019996 PCT/AU2009/001059 -12 In some embodiments, the transcriptional control sequence directs expression of an operable connected nucleotide sequence in a maternal gametophyte tissue. In some embodiments, the maternal gametophyte tissue comprises an ovary or embryo sac. 5 As set out above, the present invention contemplates a transcriptional control sequence which specifically or preferentially directs expression of an operably connected nucleotide sequence in one or more parts of a plant seed, wherein said transcriptional control sequence is derived from a GL7 gene. 10 The term "derived from", as used herein, refers to a source or origin for the transcriptional control sequence. For example, a transcriptional control sequence "derived from a GL7 gene" refers to a transcriptional control sequence which, in its native state, exerts at least some transcriptional control over a GL7 gene. The term 15 "derived from" should also be understood to refer to the source of the sequence information for a transcriptional control sequence and not be limited to the source of a nucleic acid itself. Thus, a transcriptional control sequence derived from a GL7 gene need not necessarily be directly isolated from the gene. For example, a synthetic nucleic acid having a sequence that is determined with reference to a transcriptional control 20 sequence which, in its native state, exerts at least some transcriptional control over a GL7 gene should be considered derived from a GL7 gene. A "GL7 aene" as referred to herein encompasses any nucleotide sequence which encodes a GL7 polypeptide. As described later, GL7 polypeptides may be characterised 25 as members of the class IV of homeodomain leucine zipper family of transcription factors. Transcription factors containing a homeodomain (HD) together with a leucine zipper (ZIP) motif constitute a large family of plant specific transcription factors (ITFs). These 30 factors may be classified into four classes. The class IV is also known as I--ID-CL2 after WO 2010/019996 PCT/AU2009/001059 -13 the first identified gene from Arabidopsis GLABR A2 (GL2). In some embodiments, GL7 polypeptides may also be characterised by the presence of a STeroidogenic Acute Regulatory (STAR) related lipid transfer domain. The most 5 striking feature of the STAR domain structure is a predominantly hydrophobic tunnel extending nearly the entire protein and used to binding a single molecule of large lipophilic compounds, like cholesterol. In some embodiments, the GL7 polypeptide encoded by the GL7 gene contemplated in 10 accordance with the present invention comprises the amino acid sequence set forth in SEQ ID NO: 1 or a homolog thereof. The term "homolog", as used herein with reference to homologs of polypeptides comprising the amino acid sequence set forth in SEQ ID NO: 1, should be understood 15 to include, for example, homologs, orth ologs, paralogs, mutants and variants of polypeptides comprising the amino acid sequence set forth in SEQ ID NO: 1. In some embodiments, the homolog, ortholog, paralog, mutant or variant of a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: I comprises an amino acid sequence which comprises at least 35% sequence identity, at least 40% sequence 20 identity, at least 45% sequence identity, at least 50% sequence identity, at least 55% sequence identity, at least 60% sequence identity, at least 65% sequence identity, at least 70% sequence identity, at least 75% sequence identity, at least 80% sequence identity, at least 85% sequence identity, at least 90% sequence identity or at least 95% sequence identity to the amino acid sequence set forth in SEQ ID NO: 1. 25 When comparing amino acid sequences to calculate a percentage identity, the compared sequences should be compared over a comparison window of at least 100 amino acid residues, at least 200 amino acid residues, at least 400 amino acid residues, at least 800 amino acid residues,. or over the full length of SEQ ID NO: . The 30 comparison window may comprise additions or deletions (i.e. gaps) of about 20% or WO 2010/019996 PCT/AU2009/001059 -14 less as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. Optimal alignment of sequences for aligning a comparison window may be conducted by computerised implementations of algorithms such the BLAST family of programs as., for example, 5 disclosed by Altschul et at. (Nu'. Acids Res. 29: 3389-3402, 1997). A detailed discussion of sequence analysis can be found in Unit 19.3 of Ausubel et al. (Current Protocols in Molecular Biology, John Wiley & Sons Inc, 1994-1998, Chapter 15, 1998). The transcriptional control sequences of the present invention may be derived from 10 any source, including isolated from any suitable organism or they may be synthetic nucleic acid molecules. In some embodiments the transcriptional control sequences contemplated herein are derived from a plant. In some embodiments, the transcriptional control sequences of 15 the present invention are derived from a monocot plant species. In some embodiments the transcriptional control sequences of the present invention are derived from a plant in the family Poaceae. In some embodiments, the transcriptional control sequences of the present invention are derived from a cereal crop plant species. 20 in some embodiments, the transcriptional control sequence is derived from a Triticumn species (for example T. aestivun, T. durum, T. mwnococcui, T. dicoccon,, T. speita or T. polonicuni). In some embodiments, the transcriptional control sequence is derived from a tetraploid wheat (for example T. durui, T. dicoccon, or '. polonicumi). In some embodiments, the transcriptional control sequence is derived from a durum wheat, 25 and in some embodiments, the transcriptional control sequence is derived from Triticun durum. In some embodiments, the transcriptional control sequence is derived from a gene which comprises an open reading frame comprising the nucleotide sequence set forth 30 in SEQ ID NO: 2 or a homolog thereof.

WO 2010/019996 PCT/AU2009/001059 -15 One example of a gene which comprises art open reading frame comprising the nucleotide sequence set forth in SEQ ID NO: 2 is a gene comprising the nucleotide sequence set forth in SEQ ID NO: 4. 5 The term "homolog", as used herein with reference to homologs of genes comprising an open reading frame comprising the nucleotide sequence set forth in SEQ ID NO: 2, should be understood to include, for example,. homologs, orthologs, paralogs, mutants and variants of genes comprising an open reading frame which comprises the 10 nucleotide sequence set forth in SEQ ID NO: 2. In some embodiments, the homolog, ortholog, paralog, mutant or variant of a polypeptide comprising an open reading frame which comprises the nucleotide sequence set forth in SEQ ID NO: 2 comprises a nucleotide sequence which comprises at least 35% sequence identity, at least 40% sequence identity, at least 45% sequence identity, at least 50% sequence identity, at 15 least 55% sequence identity, at least 60% sequence identity, at least 65% sequence identity, at least 70% sequence identity, at least 75% sequence identity, at least 80% sequence identity, at least 85% sequence identity, at least 90% sequence identity or at least 95% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 2. 20 When comparing nucleotide sequences to calculate a percentage identity, the compared sequences should be compared over a comparison window of at least 500 nucleotide residues, at least 1000 nucleotide residues, at least 1500 nucleotide residues, at least 2000 nucleotide residues, at least 2500 nucleotide residues or over the full length of SEQ ID NO: 2. The comparison window may comprise additions or deletions 25 (i.e. gaps) of about 20% or less as compared to the reference sequence (which does riot comprise additions or deletions) for optimal alignment of the two sequences. Optimal alignment of sequences for aligning a comparison window may be conducted by computerised implementations of algorithms such the BLAST family of programs as, for example, disclosed by Altschul et a!. (NucL Acids Res. 25: 3389-3402, 1997). A 30 detailed discussion of sequence analysis cart be found in Unit 19.3 of Ausubel et at.

WO 2010/019996 PCT/AU2009/001059 -16 (Current Protocols in Molecular Biology, John Wiley & Sons Inc, 1994-1998, Chapter 15, 1998). In some embodiments, the transcriptional control sequence contemplated by the first 5 aspect of the invention comprises the nucleotide sequence set forth in SEQ ID NO: 3 or a functionally active fragment or variant thereof. As set out above, the present invention also contemplates "functionally active fragments or variants" of the transcriptional control sequences of the present 10 invention, including (but not limited to) functionally active fragments or variants of a transcriptional control sequence comprising the nucleotide sequence set forth in SEQ ID NO: 3. "Functionally active fragments" of the transcriptional control sequence of the invention 15 include fragments of a transcriptional control sequence which retain the capability to specifically or preferentially direct expression of an operably connected nucleotide sequence in a plant seed (or a particular cell or tissue type thereof as hereinbefore described) in at least one plant type. In some embodiments of the invention the functionally active fragment is at least 200 nucleotides (nt), at least 500 nt, at least 1000 20 nt, at least 1500 nt, at least 2000 nt or at least 2500 nt in length. In further embodiments, the fragment comprises at least 200 nt, at least 500 nt, at least 1000 nt, at least 1500 nt, at least 2000 nt or at least 2500 nt contiguous bases from the nucleotide sequence set forth in SEQ ID NO: 3. 25 "Functionally active variants" of the transcriptional control sequence of the invention include orthologs, mutants, synthetic variants, analogs and the like which are capable of effecting transcriptional control of an operably connected nucleotide sequence in a plant seed (or a particular cell or tissue type thereof as hereinbefore described) in at least one plant type. The term "variant" should be considered to specifically include, 30 for example, orthologous transcriptional control sequences from other organisms; WO 2010/019996 PCT/AU2009/001059 -17 mutants of the transcriptional control sequence; variants of the transcriptional control sequence wherein one or more of the nucleotides within the sequence has been substituted, added or deleted; and analogs that contain one or more modified bases or DNA or RNA backbones modified for stability or for other reasons. "Modified" bases 5 include, for example, tritylated bases and unusual bases such as inosine. In some embodiments, the functionally active fragment or variant comprises at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 82%, at least 85%, at least 87%, at least 90%, at least 92%, at least 95%, at least 96%, 10 at least 97%, at least 98% or at least 99% nucleotide sequence identity to the nucleotide sequence set forth in SEQ ID NO: 3. When comparing nucleic acid sequences to calculate a percentage identity, the compared nucleotide sequences should be compared over a comparison window of at 15 least 500 nucleotide residues, at least 1000 nucleotide residues, at least 1500 nucleotide residues, at least 2000 nucleotide residues, at least 2500 nucleotide residues, or over the full length of SEQ ID NO: 3. The comparison window may comprise additions or deletions (i.e. gaps) of about 20% or less as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. 20 Optimal alignment of sequences for aligning a comparison window may be conducted by computerised implementations of algorithms such the BLAST family of programs as, for example, disclosed by Altschul et ad. (1997, supra). A detailed discussion of sequence analysis can be found in Unit 19.3 of Ausubel et al. (1998, supra). 25 in some embodiments, the functionally active fragment or variant comprises a nucleic acid molecule which hybridises to a nucleic acid molecule defining a transcriptional control sequence of the present invention under stringent conditions. In some embodiments, the ftuctionally active fragment or variant comprises a nucleic acid molecule which hybridises to a nucleic acid molecule comprising the nucleotide 30 sequence set forth in SEQ ID NO: 3 under stringent conditions.

WO 2010/019996 PCT/AU2009/001059 -18 As used herein, "stringent" hybridisation conditions will be those in which the salt concentration is less than about L5 M Na ion, typically about 0.01 to 1.0 M Na ion concentration (or other salts) at p- 1 7.0 to 8.3 and the temperature is at least 30'C. 5 Stringent conditions may also be achieved with the addition of destabilising agents such as formamide. In some embodiments, stringent hybridisation conditions may be low stringency conditions, medium stringency conditions or high stringency conditions. Exemplary low stringency conditions include hybridisation with a buffer solution of 30 to 35% formamide, I M NaCI, 1% SDS (sodium dodecyl sulphate) at 10 37 0 C, and a wash in lx to 2xSSC (20xSSC=3.0 M NaCl/0.3 M trisodium citrate) at 50 to 55'C. Exemplary moderate stringency conditions include hybridisation in 40 to 4.5% formamide, 1.0 M NaCi, 1% SDS at 37 0 C., and a wash in 0.5x to 1xSSC at 55 to 60'C. Exemplary high stringency conditions include hybridisation in 50% formamrdde, 1 M NaCI, 1% SDS at 37 0 C.., and a wash in 0.1xSSC at 60 to 65 0 C. Optionally, wash buffers 15 may comprise about 0.1% to about 1% SDS. Duration of hybridisation is generally less than 24 hours, usually 4 to 12 hours. Specificity of hybridisation is also a function of post-hybridisation washes, with the critical factors being the ionic strength and temperature of the final wash solution. For 20 DNA-DNA hybrids, the Tm can be approximated from the equation of Meinkoth and Wahl (Anal. Biochem. 138: 267-284, 1984), i.e, Tm, =81.5 C +16.6 (log M)+0.41 (% GC)-0.61 (% form)-500/L; where M is the molarity of monovalent cations, % GC is the percentage of guanosine and cytosine nucleotides in the DNA, % form is the percentage of fornamide in the hybridisation solution, and L is the length of the hybrid in base pairs. 25 The Tm is the temperature (under defined ionic strength and pH) at which 50% of a complementary target sequence hybridises to a perfectly matched probe. Tm is reduced by about 1C for each 1% of mismatching; thus, Tm, hybridisation, and/or wash conditions can be adjusted to hybridise to sequences of different degrees of complementarity. For example, sequences with 90% identity can be hybridised by 30 decreasing the Tm by about 10CC. Generally, stringent conditions are selected to be WO 2010/019996 PCT/AU2009/001059 -19 about 5 0 C lower than the thermal melting point (Tm) for the specific sequence and its complement at a defined ionic strength and pH. However, high stringency conditions can utilise a hybridisation and/or wash at, for example, 1, 2, 3, or 4 0 C lower than the thermal melting point (Tm); medium stringency conditions can utilise a hybridisation 5 and/or wash at, for example, 6, 7, 8, 9, or 10'C lower than the thermal melting point (Tm); low stringency conditions can utilise a hybridisation and/or wash at, for example, 11, 12, 13, 14, 15, or 2 0 'C lower than the thermal melting point (Tm). Using the equation, hybridisation and wash compositions, and desired I'm, those of ordinary skill will understand that variations in the stringency of hybridisation and/or wash solutions are 10 inherently described. If the desired degree of mismatching results in a TT. of less than 45 0 C (aqueous solution) or 32 0 C (formamide solution), it is preferred to increase the SSC concentration so that a higher temperature can be used. An extensive guide to the hybridisation of nucleic acids is found in Tijssen (Laboratory fTechniques in Biochemistru and Molecular Biology-Hybridisation witi Nucleic Acid Probes, Pt 1, Chapter 2, Elsevier, 15 New York, 1993), Ausubel et aL, eds. (Current Protocols in Molecular Biology, Chapter 2, Greene Publishing and Wiley-Interscience, New York, 1995) and Sambrook et at. (Molecular Cloning: A Laboratory Manual, 2 ed., Cold Spring Harbor Laboratory Press, Plainview, NY, 1989). 20 In a second aspect., the present invention also provides a nucleic acid construct comprising an isolated nucleic acid according to the first aspect of the invention. The nucleic acid construct of the second aspect of the present invention may comprise any polyribonucleotide or polydeoxvribonu cleotide, which may be unmodified RNA 25 or DNA or modified RNA or DNA. For example, the nucleic acid construct of the invention may comprise single- and/or double-stranded DNA, DNA that is a mixture of single- and double-stranded regions, single- and double-stranded RNA, and RNA that is mixture of single- and double-stranded regions, hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically, double-stranded or a 30 mixture of single- and double-stranded regions. In addition, the nucleic acid construct WO 2010/019996 PCT/AU2009/001059 -20 may comprise triple-stranded regions comprising RNA or DNA or both RNA and DNA. The nucleic acid construct may also comprise one or more modified bases or DNA or RNA backbones modified for stability or for other reasons. "Modified" bases include, for example, tritylated bases and unusual bases such as inosine. A variety of 5 modifications can be made to DNA and RNA; thus the term "nucleic acid construct" embraces chemically, enzymatically, or metabolically modified forms. In some embodiments, the nucleic acid construct comprises DNA. Accordingly, the nucleic acid construct of the present invention may comprise, for example, a linear 10 DNA molecule, a plasmid, a transposon, a cosmid, an artificial chromosome or the like. Furthermore, the nucleic acid construct of the present invention may be a separate nucleic acid molecule or may be a part of a larger nucleic acid molecule. In some embodiments, the nucleic acid construct further comprises a nucleotide 15 sequence of interest that is heterologous with respect to the transcriptional control sequence or the functionally active fragment or variant thereof; wherein the nucleotide sequence of interest is operably connected to the transcriptional control sequence or functionally active fragment or variant thereof. 20 The term "heterologous with respect to the transcriptional control sequence" refers to the nucleotide sequence of interest being any nucleotide sequence other than that which the transcriptional control sequence (or functionally active fragment or variant thereof) is operably connected to in its natural state. For example, in its natural state, SEQ ID NO: 3 is operably connected to the nucleotide sequence set forth in SEQ ID 25 NO: 4. Accordingly, in this example, any nucleotide sequence other than a nucleotide sequence consisting of the nucleotide sequence set forth in SEQ ID NO: 4 should be considered heterologous with respect to SEQ ID NO: 3, In accordance with the definition above, it would be recognised that a nucleotide 30 sequence of interest which is heterologois to a transcriptional control sequence (or WO 2010/019996 PCT/AU2009/001059 -21 functionally active fragment or variant thereof) may be derived from an organism of a different taxon to the transcriptional control sequence (or functionally active fragment or variant thereof) or the nucleotide sequence of interest may be a heterologous sequence fromt an organism of the same taxon. 5 In some embodiments, the nucleic acid construct may further comprise a nucleotide sequence defining a transcription terminator. The term "transcription terminator" or "terminator" refers to a DNA sequence at the end of a transcriptional unit which signals termination of transcription. Terminators are generally 3-non-translated DNA 10 sequences and may contain a polyadenylation signal, which facilitates the addition of polyadenylate sequences to the 3end of a primary transcript. As with promoter sequences, the terminator may be any terminator sequence which is operable in the cells, tissues or organs in which it is intended to be used. Examples of suitable terimnator sequences which may be useful in plant cells include: the nopaline synthase 15 (nos) terminator, the CaMV 353 terminator, the octopine synthase (ocs) terminator, potato proteinase inhibitor gene (pin) terminators, such as the pin!! and pinilI terminators and the like. In some embodiments the nucleic acid construct comprises an expression cassette 20 comprising the structure: ([N], - TCS - IN]I - Sol - [Nly - TT - [NJ 1 ) wherein: 25 [N]> comprises one or more nucleotide residues, or is absent; TCS comprises a nucleic acid according to any one of the first aspect of the invention; [N]x comprises one or more nucleotide residues, or is absent; Sol comprises a nucleotide sequence of interest which is operably connected to TCS; [N1y comprises one or more nucleotide residues, or is absent; 30 TT comprises a nucleotide sequence defining a transcription terminator; WO 2010/019996 PCT/AU2009/001059 -22 [N] comprises one or more nucleotide residues, or is absent. The nucleic acid constructs of the present invention may further comprise other nulcleotide sequences as desired. For example, the nucleic acid construct may include 5 an origin of replication for one or more hosts; a selectable marker gene which is active in one or more hosts or the like. As used herein, [he term selectablee marker gene" includes any gene that confers a phenotype on a cell, in which it is expressed, to facilitate the identification and/or 10 selection of cells which are transformed with a nucleic acid construct of the invention. A range of nucleotide sequences encoding suitable selectable markers are known in the art. Exemplary nucleotide sequences that encode selectable markers include: antibiotic resistance genes such as ampicillin-resistance genes, tetracycline-resistance genes, kanamycin-resistance genes, the AUR-C gene which confers resistance to the antibiotic 15 aureobasidin A, neomycin phosphotransferase genes (e.g. npt! and aptil) and hygromycin phosphotransferase genes (e.g. hpl); herbicide resistance genes including giufosinate, phosphinothricin or bialaphos resistance genes such as phosphinothricin acetyl transferase-encoding genes (e.g. bar), glyphosate resistance genes including 3 enoyl pyruvyl shikimate 5--phosphate synthase-encoding genes (e.g. aroA), bromyxnil 20 resistance genes including bromyxnil nitril ase-enco ding genes, sulfonamide resistance genes including dihydropterate synthase-encoding genes (e.g. sul) and sulfonylurea resistance genes including acetolactate synthase-encoding genes; enzyme-encoding reporter genes such as GUS-encoding and chloramphenicolacetyltransferase (CAT) encoding genes; fluorescent reporter genes such as the green fluorescent protein 25 encoding gene; and luminescence-based reporter genes such as the luciferase gene, amongst others. The constructs described herein may further include nucleotide sequences intended for the maintenance and/or replication of the construct in prokaryotes or eukaryotes WO 2010/019996 PCT/AU2009/001059 - 23 and/or the integration of the construct or a part thereof into the genome of a eukaryotic or prokaryotic cell. In some embodiments, the construct of the invention is adapted to be at least partially 5 transferred into a plant cell via Agrobacterinum-ediated transformation. Accordingly, in some embodiments, the nucleic acid construct of the present invention comprises left and/or right T-DNA border sequences. Suitable T-DNA border sequences would be readily ascertained by one of skill in the art. However, the term "T-DNA border sequences" should be understood to at least include, for example , ay substantially 10 homologous and substantially directly repeated nucleotide sequences that delimit a nucleic acid molecule that is transferred from an Agrobacterium sp. cell into a plant cell susceptible to Agrobacteriun-mediated transformation. By way of example, reference is made to the paper of Peralta and Ream (Proc. Nat!. Acad. Sci. USA, 82(15): 5112-5116, 1985) and the review of Gelvin (Microbiology and Molecular Biology Reviews, 67(1): 16-37, 15 2003). In some embodiments, the present invention also contemplates any suitable modifications to the construct which facilitate bacterial mediated insertion into a plant cell via bacteria other than Agrobacteriuni sp., for example, as described in Broothaerts et 20 al. (Nature 433: 629-633, 2005). In some embodiments, the constructs of the second aspect of the invention may also comprise nucleotide sequences that encode regulatory microRNAs ("miRNA") and/or a target sequence for an miRNA, which may further modulate the expression pattern 25 determined by the nucleotide sequence of the first aspect of the invention. A discussion of the regulatory activity of microRNAs in plants may be found in the review of Jones Rhoades et al. (VAnnual Review of Plant Biology 57:19-53, 2006) Those skilled in the art will be aware of how to produce the constructs described 30 herein, and of the requirements for obtaining the expression thereof, when so desired, WO 2010/019996 PCT/AU2009/001059 -24 in a specific cell or cell-type under the conditions desired. In particular, it will be known to those skilled in the art that the genetic manipulations required to perform the present invention may require the propagation of a construct described herein or a derivative thereof in a prokaryotic cell such as an E. coli cell or a plant cell or an animal 5 cell. Exemplary methods for cloning nucleic acid molecules are described in Sambrook et a!. (Molecular Cloning: A Laboratory Manua, Cold Spring Harbor Laboratory Press, New York, 2000). In a third aspect, the present invention provides a cell comprising a nucleic acid 10 construct according to the second aspect of the invention. The nucleic acid construct may be maintained in the cell as a nucleic acid molecule, as an autonomously replicating genetic element (e.g. a plasmid, cosmid, artificial chromosome or the like) or it may be integrated into the genomic DNA of the cell. 15 As used herein, the term genomicc DNA" should be understood in its broadest context to include any and all endogenous DNA that makes up the genetic complement of a cell. As such, the genomic DNA of a cell should be understood to include chromosomes, mitochondrial DNA, plastid DNA, chloroplast DNA, endogenous 20 plasmid DNA and the like. As such, the term "genomically integrated" contemplates any of chromosomal integration, mitochondrial DNA integration, plastid DNA integration, chloroplast DNA integration, endogenous plasmid integration, or the like. A "genomically integrated form" of the construct may be all or part of the construct. However, in some embodiments the genomically integrated form of the construct at 25 least includes the nucleic acid molecule of the first aspect of the invention. The cells contemplated by the third aspect of the invention include any prokaryotic or eukaryotic cell. In some embodiments, the cell is a plant cell. In some embodiments the cell is a monocot plant cell. In some embodiments the cell is a cell from a plant in the 30 family Poaceae. In some embodiments the cell is a cereal crop plant cell. In some WO 2010/019996 PCT/AU2009/001059 -25 embodiments the cell is a wheat cell, a barley cell or a rice cell. In some embodiments, the cell may also comprise a prokaryotic cell. For example, the prokaryotic cell may include an Agrobacterium sp. cell (or other bacterial cell), which 5 carries the nucleic acid construct and whicli may, for example, be used to transform a plant. In some embodiments, the prokarvotic cell may be a cell used in the construction or cloning of the nucleic acid construct (e.g. an E. coli cell). In a fourth aspect, the present invention contemplates a multicellular structure 10 comprising one or more cells according to the third aspect of the invention. In some embodiments, the multicellular structure comprises a plant or a part, organ or tissue thereof. As referred to herein, "a plant or a part, organ or tissue thereof" should be understood to specifically include a whole plant; a plant tissue; a plant organ; a 15 plant part; a plant embryo; and cultured plant tissue such as a callus or suspension culture. In some embodiments of the fourth aspect of the invention, the plant or part, organ or tissue thereof comprises reproductive material for a plant including, for example, 20 seeds, flowers, vegetative plant material, explants, plant tissue in culture including callus or suspension culture and the like. As would be appreciated from the remainder of the specification the plant or a part, organ or tissue thereof contemplated in the fourth aspect of the invention may include, 25 for example, any of a monocot, a plant in the family Poaceae, a cereal crop plant, a wheat plant, a barley plant, or a rice plant or a part, organ or tissue of any of the foregoing. In some embodiments of the fourth aspect of the invention, the plant or part, organ or 30 tissue thereof comprises a seed as hereinbefore defined.

WO 2010/019996 PCT/AU2009/001059 -26 In some embodiments of the fourth aspect of the invention, a nucleotide sequence of interest may be operably connected to the transcriptional control sequence or the functionally active fragment or variant thereof, such that the nucleotide sequence of 5 interest is specifically or preferentially expressed in a seed, or in a particular cell or tissue type thereof, and optionally at a particular developmental stage, as described above with respect to the first aspect of the invention. In a fifth aspect, the present invention provides a method for specifically or 10 preferentially expressing a nucleotide sequence of interest in one or more parts of a plant seed, the method comprising effecting transcription of the nucleotide sequence of interest in a plant under the transcriptional control of a nucleic acid according to the first aspect of the invention. 15 As set out above, in its fifth aspect, the present invention is predicated, in part, on effecting transcription of the nucleotide sequence of interest under the transcriptional control of a transcriptional control sequence of the first aspect of the invention. In some embodiments, this is effected by introducing a nucleic acid molecule comprising the transcriptional control sequence, or a functionally active fragment or variant thereof, 20 into a cell of the plant, such that the nucleotide sequence of interest is operable connected to the transcriptional control sequence. The nucleic acid molecule may be introduced into the plant via any method known in the art. For example, an explant or cultured plant tissue may be transformed with a nucleic acid molecule, wherein the explant or cultured plant tissue is subsequently regenerated into a mature plant 25 including the nucleic acid molecule; a nucleic acid may be directly transformed into a plant, either stable or transiently; a nucleic acid may be introduced into a plant via plant breeding using a parent plant that carries the nucleic acid molecule; and the like. In some embodiments, the nucleic acid molecule is introduced into a plant cell via 30 transformation. Plants may be transformed using any method known in the art that is WO 2010/019996 PCT/AU2009/001059 - 27 appropriate for the particular plant species. Common methods include Agrobacteriumi mediated transformation, microprojectile bombardment based transformation methods and direct DNA uptake based methods. Roa-Rodriguez et al. (Agrobacterium-niediated transformation of plants, 3' Ed. CAMBIA Intellectual Property Resource, Canberra, 5 Australia, 2003) review a wide array of suitable Agrobacterium-mediated plant transformation methods for a wide range of plant species. Other bacterial-mediated plant transformation methods may also be utilised, for example, see Broothaerts et al. (2005, supra). Microprojectile bombardment may also be used to transform plant tissue and methods for the transformation of plants, particularly cereal plants, reviewed by 10 Casas et al. (Plant Breeding Rev. 13: 235-264, 1995). Direct DNA uptake transformation protocols such as protoplast transformation and electroporation are described in detail in Galbraith et al. (eds.), Methods in Cell Biology Vol. 50, Academic Press, San Diego, 1995). In addition to the methods mentioned above, a range of other transformation protocols may also be used. These include infiltration, electroporation of cells and 15 tissues, electroporation of embryos, microinjection, pollen-tube pathway-, silicon carbide- and liposome mediated transformation. Methods sucl as these are reviewed by Rakoczy-Trojanowska (Cell. Mol. Biol. Lett. 7: 849-858, 2002). A range of other plant transformation methods may also be evident to those of skill in the art and, accordingly, the present invention should not be considered in any way limited to the 20 particular plant transformation methods exemplified above. As set out above, the transcriptional control sequence of the present invention is introduced into a plant cell such that the nucleotide sequence of interest is operably connected to the transcriptional control sequence and the present invention 25 contemplates any method to effect this. For example, the subject transcriptional control sequence and a nucleotide sequence of interest may be incorporated into a nucleic acid molecule such that they are operably connected, and this construct may be introduced into the target cell. In another example, the nucleic acid sequence of the present invention may be inserted into the genome of a target cell such that it is placed in 30 operable connection with an endogenous nucleic acid sequence. As would be WO 2010/019996 PCT/AU2009/001059 -28 recognised by one of skill in the art, the insertion of the transcriptional control sequence into the genome of a target cell may be either by non-site specific insertion using standard transformation vectors and protocols or by site-specific insertion, for example, as described in Terada et al. (Nat Biotechnol 20: 1030-1034, 2002). 5 The nucleotide sequence of interest, which is placed under the regulatory control of the transcriptional control sequence of the present invention, may be any nucleotide sequence of interest. General categories of nucleotide sequences of interest include nucleotide sequences which encode, for example: reporter proteins, such as, GUS, GFP 10 and the like; proteins involved in cellular metabolism such as Zinc finger proteins, kinases, heat shock proteins and the like; proteins involved in agronomic traits such as disease or pest resistance or herbicide resistance; proteins involved in grain characteristics such as grain biomass, nutritional value, post--harvest characteristics and the like; heterologous proteins, such as proteins encoding heterologous enzymes or 15 structural proteins or proteins involved in biosynthetic pathways for heterologous products; "terminator" associated proteins such as barnase, barstar or diphtheria toxin. Furthermore, the nucleotide sequence of interest may alternatively encode a non translated RNA, for example an siRNA, miRNA, antisense RNA and the like. 20 in some embodiments, the nucleotide sequence of interest may comprise, for example, a pathogen responsive (PR) gene, a resistance (R) gene or a defensin gene, In some embodiments, the nucleotide sequence of interest may encode a protein such as PDR5 or TRI1. Such proteins may be expressed in a seed-specific manner in crop plants, such as wheat, in order to lower the incidence of diseases such as head blight (caused 25 by Fusarium graminearum or Gibberella zeac) and/or reduce mycotoxin levels within the seed. The method of the present invention may be applicable to effect specific or preferential expression of a nucleotide sequence of interest in a range of different plant seeds. For 30 example, in some embodiments, the plant may be a monocotyledonous plant. In some WO 2010/019996 PCT/AU2009/001059 -29 embodiments, the plant may be a plant in the family Poaceae. In some embodiments, the plant may be a cereal crop plant. In some embodiments the method of the present invention may be applicable to effect specific or preferential expression of a nucleotide sequence of interest in a wheat seed, a barley seed and/or a rice seed. 5 As set out above, the method of the fifth aspect of the present invention may also be used to specifically or preferentially direct expression of a nucleotide sequence of interest in a particular cell or tissue of a plant seed and/or specifically or preferentially direct expression at a particular developmental stage of a plant seed. 10 In some embodiments, the transcriptional control sequence directs expression of an operably connected nucleotide sequence in the endosperm, or a part thereof, in the seed. 15 In some embodiments, the transcriptional control sequence directs expression of an operably connected nucleotide sequence in the aleurone layer, or a part thereof, in the seed. In some embodiments, the transcriptional control sequence directs expression of an 20 operable connected nucleotide sequence in the ernbyro, or a part thereof, in the seed. In some emibodiments, the transcriptional control sequence directs expression of an operably connected nucleotide sequence in a maternal ganetophyte. 25 In further embodiments of the method of the fifth aspect of the invention, the nucleotide sequence of interest is heterologous with respect to the transcriptional control sequence, as defined supra. Finally, reference is made to standard textbooks of molecular biology that contain 30 methods for carrying out basic techniques encompassed by the present invention, WO 2010/019996 PCT/AU2009/001059 -30 including DNA restriction and ligation for the generation of the various constructs described herein. See, for example, Maniatis et al., Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Laboratory Press, New York, 1982) and Sambrook et a. (2000, supra). 5 The present invention is further described by the following non-limiting examples: BRIEF DESCRIPTION OF THE FIG URES 10 Figure 1 shows (A) an alignment of protein sequences of TaGL7 and TdGL7 to protein sequences of closest homologues from other plants. Identical amino acids are in black boxes, similar amino acids are in grey boxes. (B) shows a broader alignment of TaGL7 and TdGL7 with closest homologues and proteins from the same subfamily of H D-Zip transcription factors presented in the form of a phylogenetic tree. 15 Figure 2 shows the results of Q-PCR analysis of TaGL7 expression in different wheat tissues, at different stages of grain development and in several grain fractions. Figure 3 shows the spatial and temporal GUS expression in wheat directed by the 20 Td(L7 promoter. Strong (Al, A2) GUS expression in the Ti grain from the same transgenic line at 5 DAP: A1 - crease up, A2 - crease down. TdGL7 promoter activity in the whole T1 grain of the same transgenic line at the 6 DAP (A3). Hand cut longitudinal section at 11 DAP (A4). Two cross sections, the whole grain and longitudinal section at 12 DAP (A5 - A8). Longitudinal sections at 14 DAP. 25 Figure 4 shows spatial and temporal GUS expression in the un-cut (All and A16), hand-cut (A12 and A22) and 10 ulm thick sections (histochemical GUS assay counterstained with Safranin Orange) (A13-A15, A17-A21, A23-A30) of wheat grain at 2 (All-A15), 5 (A16-A20), 10 (A21-23, 25, and A26), 11 (A24 and A27), and 14 (A28 30 A30) DAP. At 2 and 5 DAP GUS activity was observed in pericarp (Al3-A15, A19-A20) WO 2010/019996 PCT/AU2009/001059 -31 and liquid and partially cellularized endosperm (A12, A19). At 10-15 DAP GUS activity in seed coat became faint, but it was detected throughout the starchy endosperm, it was stronger in endosperm transfer cell layer (A22 and A25) and in aleurone (A21-A23, A28-A30). At 10 DAP GUS activity was also observed in the main vascular bundle of 5 the grain (A25 and A26). Figure 5 shows the spatial and temporal GUS expression in barley directed by the TdGL7 promoter. GUS expression in barley flowers before anthesis (BI) and at anthesis (132-B3). GUS expression is observed in the ovary and in the stigma. Strong GUS 10 expression was observed in the embryo sac, but no expression in the pericarp and flower tissue was observed at I DAP (B4, 135). Strong expression was observed in partially cellularized endosperm at 5 DAP, demonstrated in the longitudinal section (136) and cross sections (B7, 138). Strong GUS expression was observed in the embryo and moderate expression was observed in the endosperm at 10 DAP, as shown in the 15 longitudinal (139) and cross (B10) section of grain at 10 DAP. Longitudinal sections are also shown at 15 DAP (B11, B12), 20 DAP (1313, B14) and 30 DAP (B15, 1316). Figure 6 shows the spatial and temporal expression in rice directed by the TdGL,7 promoter. GUS expression was detected in grain and vascular tissue of palea at 2 DAP 20 (C1). Strong GUS expression was detected in all grain tissues at 2 (C2), 10 (C3), 15 (C4), 25 (C5), 35 (C6), 45 (C7), and 56 (C8) DAP. Figure 7 shows a close-up view of GUS expression directed by the TdGL7 promoter in un-cut rice grain at 2 DAP. 25 EXAMPLE 1 Cloning of the TdGL-7 gene The full length cDNA of TaGL-7 was isolated using a yeast one-hybrid (YIH) screen 30 from a cDNA library prepared from the whole grain of Triticumi aestivit at 0-6 Days WO 2010/019996 PCT/AU2009/001059 -32 After Pollination ("DAP"). A quadruple repeat of the cis-element 5'-TAAATGCA-3', which is specific for HDZip IV transcription factors, was used as a bait. Three clones containing the same length of the insert were selected in the screen. The 5 size of the cloned cDNA was 3281 bp. It contained the full length open reading frame for the 883 aa long protein. A search through the databases using the TaGL7 protein sequence identified this protein as a member of the class IV of homeodomain leucine zipper family of transcription factors. Besides the homeodonain and leucine zipper, responsible for homo- and hetero-dirnerization and DNA binding, TaGL7 contains a 10 STeroidogenic Acute Regulatory (STAR) related lipid transfer domain. The most striking feature of the STAR domain structure is a predominantly hydrophobic tunnel extending nearly the entire protein and used to bind a single molecule of a large lipophilic compound, for example, cholesterol. 15 The expression of the TaGL7 in different plant tissues and grain at different stages ot development was demonstrated by quantitative PCR (Figure 2). Weak expression was found in all tested tissues. It was slightly higher in shoots of seedlings and in flowers during rmeiosis. Strong expression was detected in the liquid fraction of the syncytial 20 endosperm at 5 DAP, but gene expression in pericarp at the same time was very low. The 3' untranslated region (3'-UTR) of TaGL7 was used as a probe to screen a bacterial artificial chromosome (BAC) library prepared from genonic DNA of Triticum durim cv. Langdon (Cenci et al., 'Th'or Appl Genetics 107: 931-939, 2003) using Southern blot 25 hybridisation. Three BAC clones were selected for further analysis on the basis of the strength of the hybridisation signals. BAC DNA was isolated and used as a template for PCR with several primer pairs derived from the coding region of TaGL7. Two BAC clones gave the same predicted PCR product and one of them was used in a further work. The whole selected BAC clone was sequenced using 454 sequencing technology 30 (Life Sciences) and the full length genomic clone (5370 kb) plus more than 4 kb of WO 2010/019996 PCT/AU2009/001059 - 33 promoter sequence of the TaGL7 orthologue from T. d'urum was obtained as a non interrupted contig. The cloned gene was designated TdGL7. The coding region of TdGL7 contains 9 introns. Alignment of the protein sequences of 5 TaGL7 and TdGL7, deduced from the genomic sequence, shows 96.7% identity of protein sequences (Figure 1A). The alignment of the protein sequence of TaGL7 to TdGL7 and closest the homologues derived from databases are shown in Figures 1A and B. The protein domains of the TaGL7 and TdGL7 proteins are underlined in the protein alignment in Figure IA. 10 EXAMPLE 2 Spatial and temporal activity of the TdGL7 promoter in wheat, barley and rice The 454 sequencing data for the selected BAC clone were used to design forward and 15 reverse primers for the amplification from BAC DNA of a promoter fragment corresponding to 3046 bp upstream of the translational start of TdGL7 (Table 2). Subsequently, the promoter fragment was cloned into the plant transformation vector pMDC164 (Curtis and Grossniklaus, Plant Pusiol. 133: 462-9, 2003), which harbours a 20 hygromnycin resistance marker gene for selection of transgenic plants, to provide the transcriptional GUS fusion promoter construct designated pTdGL7. For stable transformation experiments, the pTdGL7construct was transformed into the Agrobacterium tInifaciens strain AGL1 and the presence of plasmid in selected colonies 25 was confirmed by PCR using specific primers. Transformed Agrobacteri.un was subsequently used to introduce constructs into barley and rice. The sarne plasmid was linearized with PmeI and co-transformed together with a plant selectable marker cassette (Ubi-hpt-Nos) into wheat using microprojectile 30 bombardment.

WO 2010/019996 PCT/AU2009/001059 -34 The integration of promoter:GUS fusions in transgenic plants was confirmed by PCR using primers derived from promoter and GUS sequences. 5 Forty five confirmed transgenic To wheat lines were analysed. Twenty five To wheat lines were selected using the GUS staining assay, from which fifteen demonstrated strong GUS expression, four had moderate expression and six showed weak expression of the reporter gene. Four lines were sterile and analysis of these lanes was not performed. Three lines, two with strong transgene expression and one with 10 moderate expression were selected for further analysis. All positive lines demonstrated the same pattern of GUS expression. Sixteen To lines of transgenic barley were analysed for GUS activity. Eleven lines demonstrated strong promoter activity and one showed weak GUS activity. All lines 15 had the same pattern of gene expression. No expression was found in one line and one line was sterile and has not been analysed. Wild type plants and/or plants transformed with a vector containing only the selectable marker cassette were used as negative controls. No differences were found between wild type plants and plants transformed with the control vector. 20 Thirty one To lines of transgenic rice were analysed for GUS activity. Twenty one lines exhibited strong promoter activity, four lines exhibited relatively strong promoter activity and three lines exhibited weak promoter activity. Three lines were sterile and were not analysed. All positive plants showed similar pattern of expression. Wild type 25 plants and/or plants transformed with a vector containing only the selectable marker cassette were used as negative controls. No differences were found between wild type plants and plants transformed with the control vector. In barley, wheat and rice the promoter starts to work before fertilisation in the embryo 30 sac (Figure 5). In rice, promoter activity was detected in the same tissue at the second WO 2010/019996 PCT/AU2009/001059 -35 day after fertilisation (Figure 7). Later in seed development, strong expression was detected in t-he syncytium and [he celularised endosperm of wheat and barley (Figures 3-5). These data correlate with Q-PCR data obtained for wheat grain fractions: the strongest expression of TaGL7 was detected in the liquid fraction of endosperm (Figure 5 2). On the fifth day strong expression was also observed in the aleurone and embryo (Figure 4). In rice, polarised expression in both ends of grain was observed at 4-5 DAP. However, starting from 8 DAB, GUS activity was detected in the endosperm and embryo. At the end of cellularization, GUS expression in the endosperm of both wheat and barley declines, but appears again at approximately 10 DAB in wheat and 15 DAP 10 in barley. Expression in both the endosperm and embryo was observed until at least 30 DAP and until 56 DAP for rice (Figure 6). However, at 30 DAP GUS expression in the wheat and barley embryo declined and could be seen only in some regions, while in rice it remained in the entire embryo. 15 In addition, as shown in Figure 5, expression was also observed in barley flowers prior to fertilisation. In particular, expression was observed in the ovary of the flower. GUS expression was also detected in the ovaries of transgenic rice plants before fertilization (data not shown). In rice, GUS expression was observed in vascular bundles of the lemnna and palea before (and for a short time after) fertilisation (Figure 7), but was not 20 detected in other flower tissues. Although a low level of TaGL7 expression was demonstrated by Q-PCR in other wheat tissues, GUS activity was not detectable in leaves and stems of wheat, barley and rice. Also, no GUS activity was detected in any other tissues. This discrepancy in results of 25 Q-PCR and promoter-GUS activity assay can be explained by possible simultaneous detection of expression of two or three homeologues and/or close homologues, the promoter activities of which may be different. Another possible explanation for the difference in results could be the selected length of the promoter; that is the promoter may contain cis-elements for grain--specific expression, but not contain elements for the 30 weak constitutive expression in other tissues.

WO 2010/019996 PCT/AU2009/001059 -36 EXAMPLE 3 Materials and Methods 5 (i) Gene cloningz and plasmuid construction The full length cDNA of TdGL7 was isolated in the YIH screen of the cDNA library from wheat grain at 0-6 DAP (Lopato et al., Plant Mal Biol 62: 637-53, 2006). The sequence derived from 3'UTR of TdGL7 cDNA was used to probe a BAC library prepared from the genomic DNA of Triticun. durun cv. Langdon (Cenci et al., 2003, 10 supra) using Southern blot hybridisation as described elsewhere (Sambrook and Russell, Molecular Cloning: A Laboratory Manual, 3rd Edition. Cold Spring Harbour Laboratory Press, Cold Spring Harbour, New York, 2001). Plasmid DNA from three BAC clones, which strongly hybridised with the probe, was isolated using a Large Construct Kit (QIAGEN). The T. durun homolog of TaGL7 was identified by PCR using 15 BAC DNA as template and primers derived from the coding region of TaGL7 cDNA. The gene and TdGL7 promoter sequence were obtained using 454 sequencing technology (454 Life Sciences, Branford, USA; Margulies et al., Nature 437: 376-380, 2005). In this manner, the sequence of the full length genomic clone (5562 bp) and more than 4000 bp of sequence upstream from the TdGL--7 translation start codon were 20 obtained. This sequence was subsequently used to design forward and reverse primers for the isolation of the promoter segment. A 3046 bp fragment of promoter with a full length 5'-Untranslated region of TdGL7 was amplified by PCR using AccuPrimeTM Pfx DNA polymerase (Invitrogen) from DNA of BAC clone #1094 M11 as a template. The fragment was cloned into the pENTR--D-TOPO vector (Invitrogen) and the cloned 25 insert was verified by sequencing before being subcloned into the pMDC164 vector (Curtis and Grossniklaus, 2003, supra) using recombination cloning. The resulting construct was designated pTdGL7. Selectable marker genes in the construct conferred hygromycin resistance in plants and kanamycin resistance in bacteria. The resulting binary vector was introduced into Agrobacterium tumefaciens AGLi strain by 30 electroporation.

WO 2010/019996 PCT/AU2009/001059 -37 (i) Plant transformation and analysis The construct pTdGL7 was transformed into rice (Oryza sativa L. ssp. Japonica cv. Nipponbare) and barley (Hordeum vulgare cv. Golden Promise) using Agrobacterium 5 mediated transformation and the method developed by Tingay et a!. (Plant J 11: 1369 1376, 1997) and modified by Matthews el al. (Mot Breed. 7: 195-202, 2001). Wheat (Triticum aestivumn L. cv. Bobwhite) was transformed using biolistic bombardment according to the following protocol. Immature seeds of wheat were 10 surface-sterilized by immersing into 70% ethanol for 2 min, followed by incubation in 1% sodium hypochlorite solution with shaking at 125 rpm for 20 min and finally by three washes in sterile distilled water. Inunature embryos (1.0-1.5 mm in length, semitransparent) were isolated aseptically and were placed, with the scuteilum side up, on solid culture medium. Embryos developing compact nodular calli were selected 15 using a stereomicroscope and used for bombardment 7-21 days after isolation. The cultures were kept in the dark at 25C on solid MS (Duchefa, M0222; Murashige and Skoog, Physiologia Plantarun 15: 473-477, 1962) with 30 g/l sucrose and 2 mg/i 2,4-D (MS2). 20 The pTdGL7 construct was linearised with PmeI and co-transformed together with the Ubi-hpt-Nos cassette into wheat using microprojectile bombardment. A DNA-gold coating was prepared according to the protocol of Sanford et al. (Methods in Enzymology 217: 483-509, 1993). Microprojectile bombardment was performed 25 utilizing the Biolistic PDS-1000/-eI Particle Delivery System (Bio-Rad). Before bombardment, immature embryos were pre-treated for 4 hours on MS2 medium supplemented with 100 g/i sucrose. Embryos (50/plate) were then placed in the centre of a plate to form a circle with a diameter of 10 mm. Bombardment conditions were 900 or 1100 psi, with a 15 mm distance from the macrocarrier launch point to the stopping 30 screen and a 60 mm distance from the stopping screen to a target tissue. The distance WO 2010/019996 PCT/AU2009/001059 - 38 between the rupture disk and the launch point of the macrocarrier was 12 mm. 16 hours after bombardment, the calli were transferred to MS2 medium and grown in the dark for one week. Two days after bombardment the treated calli were transferred to MS selection medium supplemented with 2.0 mg/l 2,4-D and 150 mg/i hygromycin B. 5 After 3-6 selections (4-6 months) greening callus tissues were subcultured on MS regeneration medium supplemented with 1mg/i kinetin and 5-10 mg/i zeatin. Regenerating plantlets were then transferred to jars with half-strength hormone-free MS medium supplemented with 50 mg/l hygromycin B. The fully developed plantlets were acclimated for 7-10 days at room temperature in a liquid medium containing 10 four-fold diluted MS salts. Plants with strong roots were then transplanted into soil and grown under greenhouse conditions to maturity. Transgene integration was confirmed by PCR using GUS specific primers. Histochemical and histological GUS assays were performed as described by Li et al. 1 5 (Plant Biotech J, 6: 465-476, 2008). (iii) Quantitative PCR Q-PCR was carried out according to the method of Burton et al. (l1tant Phylsiol. 134: 224 236, 2004) using the primer combinations shown in Table 2. 20 (iv) Primers Table 2 below shows a list of primer sequences used in RT-PCR, Q-PCR and promoter cloning described herein. 25 Table 2 - Primers TaGAPdH (Q-PCR) TTCAAC.ATC'ATTCCALlAGCAGCA SEQ ID NO: 8 forward TaGAPd-l (Q-PCR) CGTAACCCAAAAT GCCCTTG SEQ ID NO: 9 reverse TaGL7 (Q-PCR) CCTGATGGT GCAAGCCTGG SEQ ID NO: 10

--

SEQ-ID-NO:-10 WO 2010/019996 PCT/AU2009/001059 -39 for ward TaGL7 (Q-PCR) TGCTACTGGTCGGAACCTGCAGG SEQ ID NO: 11 reverse TdGL7_promoter CACCT GAACTCTG GCAGAATT G G TG SEQ ID NO: 12 for ward TdGL7_promoter GGTTCTTCTTCCTTAACTCCTCGAC SEQ ID NO: 13 reverse GUS (RT-PCR) AGTGTACGT ATCACCGTTTGT TGAAC SEQ ID NO: 14 forward GUS (RT-PCR) TACGGATGGTATGTGTCCAAAGCGGCGAT SEQ ID NO: 15 reverse Those skilled in the art will appreciate that the invention described herein is susceptible to variations and modifications other than those specifically described. It is to be understood that the invention includes all such variations and modifications. The 5 invention also includes all of the steps, features, compositions and compounds referred to, or indicated in this specification, individually or collectively, and any and all combinations of any two or more of the steps or features. Also, it must be noted that, as used herein, the singular forms "a", "an" and "the" 10 include plural aspects unless the context already dictates otherwise. Thus, for example, reference to "a nucleotide sequence of interest" includes a single nucleotide sequence as well as two or more nucleotide sequences; "a plant cell" includes a single cell as well as two or more cells; and so forth. 15 Throughout this specification, unless the context requires otherwise, the word "comprise", or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated element or integer or group of elements or integers but not the exclusion of any other element or integer or group of elements or integers.

Claims (29)

1. An isolated nucleic acid comprising: (i) a nucleotide sequence defining a transcriptional control sequence which 5 specifically or preferentially directs expression of an operably connected nucleotide sequence in one or more parts of a plant seed, wherein said transcriptional control sequence is derived from a GL7 gene; and/or (ii) a nucleotide sequence defining a functionally active fragment or variant of the nucleotide sequence defined at (i). 10

2. The nucleic acid of claim I wherein the transcriptional control sequence directs expression of an operably connected nucleotide sequence in one or more parts of a monocotyledonous plant seed. 15 3. The nucleic acid of claim 2 wherein the monocotyledonous plant is a plant in the family Poaceae.

4. The nucleic acid of claim 2 or 3 wherein the monocotyledonous plant is a cereal crop plant. 20

5. The nucleic acid of any one of claims 2 to 4 wherein the cereal crop plant is a wheat plant, a barley plant or a rice plant.

6. The nucleic acid of any one of claims I to 5 wherein the transcriptional control 25 sequence directs expression of an operably connected nucleotide sequence in the endosperm, or a part thereof, in the seed.

7. The nucleic acid of any one of claims I to 6 wherein the transcriptional control sequence directs expression of an operably connected nucleotide sequence in the 30 embyro, or a part thereof, in the seed. WO 2010/019996 PCT/AU2009/001059 -41

8. The nucleic acid of any one of claims I to 7 wherein the transcriptional control sequence directs expression of an operably connected nucleotide sequence in the aleurone laver, or a part thereof, in the seed. 5

9. The nucleic acid of any one of claims I to 8 wherein the transcriptional control sequence directs expression of an operably connected nucleotide sequence in a maternal gametophyte. 10 10. The nucleic acid of any one of claims I to 9 wherein the transcriptional control sequence directs expression of an operably connected nucleotide sequence in an ovary.

11. The nucleic acid of any one of claims 1 to 10 wherein the transcriptional control sequence is derived from a monocotyledonous plant. 15

12. The nucleic acid of claim 11 wherein the transcriptional control sequence is derived from a plant in the family Poaceae.

13. The nucleic acid of claim 11 or 12 wherein the transcriptional control sequence 20 is derived from a cereal crop plant.

14. The nucleic acid of any one of claims 11 to 13 wherein the transcriptional control sequence is derived from a Triticum sp. plant. 25 15. The nucleic acid of any one of claims 11 to 14 wherein the transcriptional control sequence is derived from a Triticum durum plant.

16. The nucleic acid of any one of claims I to 15 wherein the GL7 gene encodes a protein which comprises the amino acid sequence set forth in SEQ ID NO: I or a 30 hoiolog thereof. WO 2010/019996 PCT/AU2009/001059 -42

17. The nucleic acid of any one of claims I to 16 wherein the transcriptional control sequence is derived from a gene which comprises an open reading frame comprising the nucleotide sequence set forth in SEQ ID NO: 2, or a homolog thereof. 5 is. The nucleic acid of any one of claims 1 to 17 wherein the transcriptional control sequence is derived from a gene which comprises the nucleotide sequence set forth in SEQ ID NO: 4, or a homology thereof. 10 19. The nucleic acid of any one of claims 1 to 18 wherein the transcriptional control sequence comprises the nucleotide sequence set forth in SEQ ID NO: 3 or a functionally active fragment or variant thereof.

20. A nucleic acid construct comprising the isolated nucleic acid of any one of 15 claims I to 19.

21. The construct of claim 20, wherein the nucleic acid construct further comprises a nucleotide sequence of interest operably connected to the nucleic acid of any one of claims I to 19. 20 21. The construct of claim 21, wherein the nucleotide sequence of interest is heterologous with respect to the nucleic acid of any one of claims 1 to 19.

23. The construct of any one of claims 20 to 22 wherein the nucleic acid construct 25 further comprises a nucleotide sequence defining a transcription tenninator.

24. A cell comprising a nucleic acid construct according to any one of claims 20 to 23. 30 25. The cell of claim 24 wherein the cell is a plant cell. WO 2010/019996 PCT/AU2009/001059 - 43 26. The cell of claim 25 wherein the plant is a monocotyledonous plant.

27. The cell of claim 25 or 26 wherein the plant is a plant in the family Poaceae. 5

28. The cell of any one of claims 25 to 27 wherein the plant is a cereal crop plant.

29. The cell of any one of claims 25 to 28 wherein the plant is a wheat plant, a barley plant or a rice plant. 10

30. A multicellular structure comprising one or more cells according to any one of claims 24 to 29.

31. The multicellular structure of claim 30 wherein the multicelhUlar structure 15 comprises a plant or a part, organ or tissue thereof.

32. 'The multicellular structure of claim 31 wherein the plant or a part, organ or tissue thereof comprises a seed or a part thereof. 20 33. A method for specifically or preferentially expressing a nucleotide sequence of interest in one or more parts of a plant seed, the method comprising effecting transcription of the nucleotide sequence of interest in a plant under the transcriptional control of a nucleic acid according to any one of claims I to 19. 25 34. The method of claim 33 wherein the plant is a monocotyledonous plant.

37. The method of claim 33 or 34 wherein the plant is a plant in the family Poaceae. 36. The method of any one of claims 33 to 35 wherein the plant is a cereal crop 30 plant. WO 2010/019996 PCT/AU2009/001059 -44 37. The method of any one of claims 33 to 36 wherein the plant is a wheat plant, a barley plant or a rice plant. 5 38. The method of any one of claims 33 to 37 wherein the transcriptional control sequence directs expression of an operably connected nucleotide sequence in the endosperm, or a part thereof, in the seed.

39. The method of any one of claims 33 to 38 wherein the transcriptional control 10 sequence directs expression of an operably connected nucleotide sequence in the embyro, or a part thereof, in the seed.

40. The method of any one of claims 33 to 39 wherein the transcriptional control sequence directs expression of an operable connected nucleotide sequence in the 15 aleurone layer, or a part thereof, in the seed. 41 The method of any one of claims 33 to 40 wherein the transcriptional control sequence directs expression of an operably connected nucCo tide sequence in a maternal gametophyte. 20

42. The method of any one of claims 33 to 41 wherein the transcriptional control sequence directs expression of an operably connected nucleotide sequence in an ovary.

43. The method of any one of claims 33 to 42 wherein the nucleotide sequence of 25 interest is heterologous with respect to the transcriptional control sequence.