AU2008255131B2 - Modification of plant responses to salt (2) - Google Patents

Description

1 MODIFICATION TO PLANT RESPONSES TO SALT (2) The present invention relates to nucleic acids and nucleic acid fragments encoding amino acid sequences for salt stress-inducible proteins, protein phosphatases mediating salt adaptation in plants, plasma membrane 5 sodium/proton antiporters, salt-associated proteins, glutathione peroxidase homologs associated with response to saline stress in plants, and early salt responding enzymes such as glucose 6-phosphate 1 dehydrogenase and fructose-biphosphate aldolase in plants and the use thereof for, inter alia, modification of plant tolerance to environmental stresses and osmotic stresses 10 such as salt stress; modification of plant capacity to survive salt shocks, modification of compartmentalization of sodium in plants, for example into the plant cell vacuole, modification of sodium ion influx and/or efflux, modification of plant recovery after exposure to salt stress, and modification of plant metabolism under salt stress. 15 Soil salinity is a major environmental stress that is a substantial constraint to crop production both for dryland and irrigated agriculture. Approximately 10% of the world's arable land and 23% of the cultivated land is covered with various types of salt-affected soils and this situation will worsen due to the continuous build-up of salt in cultivated soils as a result of irrigation. 20 Sodium ions in saline soils are toxic to plants because of their adverse effects on potassium nutrition, cytosolic enzyme activities, photosynthesis, and metabolism. The negative effects on plant performance caused by salt stress arise from the disruption of cellular aqueous and ionic equilibria. Tolerance determinants thus include effectors that function to restore cellular homeostasis. 25 Different mechanisms function cooperatively to prevent accumulation of sodium ions (Na*) in the cytoplasm of plant cells, namely restriction of Na' influx, active Na* efflux, and compartmentalization of Na* in the vacuole. Salt tolerance is mediated by multiple determinants, such as those that are intrinsically cellular and function to restrict Na* uptake across the plasma 2 membrane, facilitate Na* sequestration into the vacuole, and mediate compatible osmolyte and osmoprotectant production and accumulation. In addition, a coordinated control of several effectors through the modulation of signal-regulatory cascades or transcriptional activation of multiple genes may have the greatest 5 impact on salt tolerance. Genes that are involved in response of plants to salt stress and in salt tolerance in plants include salt-inducible proteins (ESI3), glutathione peroxidase homologs (CSA), low-temperature-inducible proteins (LT16), salt stress-induced proteins (SALT), early salt-responding glucose-6 phosphate 1-dehydrogenase (WESR5) and plastidic fructose-1,6-biphosphate 10 aldolase homologs (ALDP). While nucleic acid sequences encoding some salt-inducible and salt responsive proteins ES13, CSA, LT16, SALT, WESR5 and ALDP have been isolated for certain species of plants, there remains a need for materials useful in modifying plant tolerance to environmental stresses and osmotic stresses such as 15 salt stress; modifying the plant capacity to survive salt shocks, modifying the compartmentalization of sodium in plants, for example into the plant cell vacuole, modifying sodium ion influx and/or efflux, modifying the plant recovery after exposure to salt stress, and modifying plant metabolism under salt stress, in a wide range of plants, particularly in forage and turf grasses and legumes, including 20 ryegrasses, fescues and clovers, and for methods for their use. It is an object of the present invention to overcome, or at least alleviate, one or more of the difficulties or deficiencies associated with the prior art. In one aspect, the present invention provides substantially purified or isolated nucleic acids or nucleic acid fragments encoding salt-inducible and salt 25 responsive proteins ESI3, CSA, LT16, SALT, WESR5 and ALDP from a ryegrass (Lolium) or fescue (Festuca) species, and functionally active fragments and variants thereof. The present invention also provides substantially purified or isolated nucleic acids or nucleic acid fragments encoding amino acid sequences for a class of 30 proteins which are related to ES13, CSA, LT16, SALT, WESR5 and ALDP, and 7294133 3 functionally active fragments and variants thereof. Such proteins are referred to herein as ES13-like, CSA-like, LT16-like, SALT-like, WESR5-like and ALDP-like, respectively. In a preferred embodiment, the present invention provides a substantially 5 purified or isolated nucleic acid or nucleic acid fragment encoding an early salt responding glucose-6-phosphate 1-dehydrogenase (WESR5) from a Lolium species. Preferably, said Lolium species is Lolium perenne or Lolium arundinaceum. In a further preferred embodiment, the present invention provides a 10 substantially purified or isolated nucleic acid or nucleic acid fragment encoding a WESR5 protein, or complementary or antisense to a nucleic acid or nucleic acid fragment encoding a WESR5 protein, and including a nucleotide sequence selected from the group consisting of (a) sequence shown in Figure 52 hereto (Sequence ID No: 126); (b) complement of the sequence recited in (a); (c) 15 sequences antisense to the sequences recited in (a) and (b); and (d) functionally active fragments and variants of the sequences recited in (a), (b) and (c). Preferably, said functionally active fragment or variant has a sequence having at least 90% identity to the relevant part of the sequence on which the fragment or variant is based and has a size of at least 20 nucleotides. 20 The individual or simultaneous enhancement or otherwise manipulation of ES13, CSA, LT16, SALT, WESR5 and/or ALDP or like gene activities in plants may enhance or otherwise alter plant tolerance to environmental and osmotic stresses such as salt stress; may enhance or otherwise alter the plant capacity to survive salt shocks; may enhance or reduce or otherwise alter the 25 compartmentalization of sodium in plants, for example into the plant cell vacuole; may enhance or reduce or otherwise alter sodium ion influx and/or efflux; may enhance or otherwise alter plant recovery after exposure to salt stress; and/or may alter plant metabolism under salt stress. The individual or simultaneous enhancement or otherwise manipulation of 30 ES13, CSA, LT16, SALT, WESR5 and/or ALDP or like gene activities in plants 7294133 3a has significant consequences for a range of applications in, for example, plant production and plant protection. For example, it has applications in increasing plant tolerance to osmotic stresses such as salt stress; in increasing the spectrum of abiotic stress tolerance to a wide range of environmental stresses; in 5 reducing plant damage caused by environmental stresses such as salinity, sodicity, dehydration and cold; in improving biomass productivity under conditions of abiotic environmental stress such as salinity, sodicity and water deficient conditions; in helping to protect plant cells against salinity, sodicity, dehydration; in altering metabolism by increasing synthesis of new proteins in response to salt 10 stress or for osmotic adjustment; and in altering plant recovery from salt stress shocks. Methods for the manipulation of ES13, CSA, LT16, SALT, WESR5 and/or ALDP or like gene activities in plants, including grass species such as ryegrasses (Lolium species) and fescues (Festuca species), and legumes such as clovers 15 (Trifolium species) may facilitate the production of, for example, pasture and turf grasses and pasture legumes and other crops with enhanced tolerance to salt stress, or enhanced tolerance to sodicity, or modified recovery from salt stress, or 4 modified metabolism after exposure to salinity, sodicity and/or dehydration stresses. The ryegrass (Lolium) or fescue (Festuca) species may be of any suitable type, including Italian or annual ryegrass, perennial ryegrass, tall fescue, meadow 5 fescue and red fescue. Preferably the species is a ryegrass, more preferably perennial ryegrass (L. perenne). Perennial ryegrass (Lolium perenne L.) is a key pasture grass in temperate climates throughout the world. Perennial ryegrass is also an important turf grass. The nucleic acid or nucleic acid fragment may be of any suitable type and 10 includes DNA (such as cDNA or genomic DNA) and RNA (such as mRNA) that is single- or double-stranded, optionally containing synthetic, non-natural or altered nucleotide bases, and combinations thereof. The term "isolated" means that the material is removed from its original environment (eg. the natural environment if it is naturally occurring). For example, 15 a naturally occurring nucleic acid present in a living plant is not isolated, but the same nucleic acid separated from some or all of the coexisting materials in the natural system, is isolated. Such nucleic acids could be part of a vector and/or such nucleic acids could be part of a composition, and still be isolated in that such a vector or composition is not part of its natural environment. 20 Such nucleic acids or nucleic acid fragments could be assembled to form a consensus contig. As used herein, the term "consensus contig" refers to a nucleotide sequence that is assembled from two or more constituent nucleotide sequences that share common or overlapping regions of sequence homology. For example, the nucleotide sequence of two or more nucleic acids or nucleic acid 25 fragments can be compared and aligned in order to identify common or overlapping sequences. Where common or overlapping sequences exist between two or more nucleic acids or nucleic acid fragments, the sequences (and thus their corresponding nucleic acids or nucleic acid fragments) can be assembled into a single contiguous nucleotide sequence.

5 In a preferred embodiment of this aspect of the invention, the substantially purified or isolated nucleic acid or nucleic acid fragment encoding an ES13 or ES13-like protein includes a nucleotide sequence selected from the group consisting of (a) sequences shown in Figures 1, 3, 4, 6, 7, 9, 10, 12, 13, 15, 16, 5 18, 19, 21, 22, 24, 70 and 76 hereto (Sequence ID Nos: 1, 3 to 11, 12, 14 to 20, 21,23 to 27,28,30 and 31, 32, 34to 36,37,39 and 40, 41,43 and 44,45,47 and 48, 136, and 138, respectively); (b) complements of the sequences recited in (a); (c) sequences antisense to the sequences recited in (a) and (b); and (d) functionally active fragments and variants of the sequences recited in (a), (b) and 10 (c). In a further preferred embodiment of this aspect of the invention, the substantially purified or isolated nucleic acid or nucleic acid fragment encoding a CSA or CSA-like protein includes a nucleotide sequence selected from the group consisting of (a) sequences shown in Figures 25, 27, 28, 30, 31, 33, 58 and 64 15 hereto (Sequence ID Nos: 49, 51 to 57, 58, 60 to 62, 63, 65 to 67, 132, and 134, respectively); (b) complements of the sequences recited in (a); (c) sequences antisense to the sequences recited in (a) and (b); and (d) functionally active fragments and variants of the sequences recited in (a), (b) and (c). In a further preferred embodiment of this aspect of the invention, the 20 substantially purified or isolated nucleic acid or nucleic acid fragment encoding an LT16 or LT16-like protein includes a nucleotide sequence selected from the group consisting of (a) sequences shown in Figures 34, 36, 37, 39, 40, 42, 43, 45, 82 and 88 hereto (Sequence ID Nos: 68, 70 to 74, 75, 77 to 85, 86, 88 to 91, 92, 94 to 105, 140, and 142, respectively); (b) complements of the sequences recited in (a); 25 (c) sequences antisense to the sequences recited in (a) and (b); and (d) functionally active fragments and variants of the sequences recited in (a), (b) and (c). In a further preferred embodiment of this aspect of the invention, the substantially purified or isolated nucleic acid or nucleic acid fragment encoding a 30 SALT or SALT-like protein includes a nucleotide sequence selected from the group consisting of (a) sequences shown in Figures 46, 48, 49 51 and 94 hereto 6 (Sequence ID Nos: 106, 108 to 119, 120, 122 to 125, and 144, respectively); (b) complements of the sequences recited in (a); (c) sequences antisense to the sequences recited in (a) and (b); and (d) functionally active fragments and variants of the sequences recited in (a), (b) and (c). 5 In a further preferred embodiment of this aspect of the invention, the substantially purified or isolated nucleic acid or nucleic acid fragment encoding a WESR5 or WESR5-like protein includes a nucleotide sequence selected from the group consisting of (a) sequence shown in Figure 52 hereto (Sequence ID No: 126); (b) complements of the sequence recited in (a); (c) sequences antisense to 10 the sequences recited in (a) and (b); and (d) functionally active fragments and variants of the sequences recited in (a), (b) and (c). In a still further preferred embodiment of this aspect of the invention, the substantially purified or isolated nucleic acid or nucleic acid fragment encoding a ALDP or ALDP-like protein includes a nucleotide sequence selected from the 15 group consisting of (a) sequences shown in Figures 54 and 56 hereto (Sequence ID Nos: 128, and 130 and 131, respectively); (b) complements of the sequences recited in (a); (c) sequences antisense to the sequences recited in (a) and (b); and (d) functionally active fragments and variants of the sequences recited in (a), (b) and (c). 20 By "functionally active" in relation to nucleic acids it is meant that the fragment or variant (such as an analogue, derivative or mutant) encodes a polypeptide which is capable of modifying plant tolerance to environmental stresses and osmotic stresses such as salt stress, modifying the plant capacity to survive salt shocks, modifying the compartmentalization of sodium in plants, for 25 example into the plant cell vacuole, modifying sodium ion influx and/or efflux, modifying the plant recovery after exposure to salt stress, and/or modifying plant metabolism under salt stress, in a plant. Such variants include naturally occurring allelic variants and non-naturally occurring variants. Additions, deletions, substitutions and derivatizations of one or more of the nucleotides are 30 contemplated so long as the modifications do not result in loss of functional activity of the fragment or variant. Preferably the functionally active fragment or variant 7 has at least approximately 80% identity to the relevant part of the above mentioned nucleotide sequence, more preferably at least approximately 90% identity, even more preferably at least approximately 95% identity, most preferably at least approximately 98% homology. Such functionally active variants and 5 fragments include, for example, those having nucleic acid changes which result in conservative amino acid substitutions of one or more residues in the corresponding amino acid sequence. Preferably the fragment has a size of at least 10 nucleotides, more preferably at least 15 nucleotides, most preferably at least 20 nucleotides. 10 Nucleic acids or nucleic acid fragments encoding at least a portion of several ESI3, CSA, LT16, SALT, WESR5 and ALDP have been isolated and identified. The nucleic acids or nucleic acid fragments of the present invention may be used to isolate cDNAs and genes encoding homologous proteins from the same or other plant species. Isolation of homologous genes using sequence 15 dependent protocols, such as methods of nucleic acid hybridisation, and methods of DNA and RNA amplification as exemplified by various uses of nucleic acid amplification technologies (e.g. polymerase chain reaction, ligase chain reaction), is well known in the art. For example, genes encoding other ESl3 or ES13-like, CSA or CSA-like, 20 LT16 or LT16-like, SALT or SALT-like, WESR5 or WESR5-like and ALDP or ALDP-like proteins, either as cDNAs or genomic DNAs, may be isolated directly by using all or a portion of the nucleic acids or nucleic acid fragments of the present invention as hybridisation probes to screen libraries from the desired plant employing the methodology well known to those skilled in the art. Specific 25 oligonucleotide probes based upon the nucleic acid sequences of the present invention may be designed and synthesized by methods known in the art. Moreover, the entire sequences may be used directly to synthesize DNA probes by methods known to the skilled artisan such as random primer DNA labelling, nick translation, or end-labelling techniques, or RNA probes using available in vitro 30 transcription systems. In addition, specific primers may be designed and used to amplify a part or all of the sequences of the present invention. The resulting amplification products may be labelled directly during amplification reactions or 8 labelled after amplification reactions, and used as probes to isolate full length cDNA or genomic fragments under conditions of appropriate stringency. In addition, short segments of the nucleic acids or nucleic acid fragments of the present invention may be used in amplification protocols to amplify longer 5 nucleic acids or nucleic acid fragments encoding homologous genes from DNA or RNA. For example, polymerase chain reaction may be performed on a library of cloned nucleic acid fragments wherein the sequence of one primer is derived from the nucleic acid sequences of the present invention, and the sequence of the other primer takes advantage of the presence of the polyadenylic acid tracts to the 3' 10 end of the mRNA precursor encoding plant genes. Alternatively, the second primer sequence may be based upon sequences derived from the cloning vector. For example, those skilled in the art can follow the RACE protocol [Frohman et al. (1988) Proc. Natl. Acad Sci. USA 85:8998, the entire disclosure of which is incorporated herein by reference] to generate cDNAs by using PCR to amplify 15 copies of the region between a single point in the transcript and the 3' or 5' end. Using commercially available 3' RACE and 5' RACE systems (BRL), specific 3' or 5' cDNA fragments may be isolated [Ohara et al. (1989) Proc. Natl. Acad Sci USA 86:5673; Loh et al. (1989) Science 243:217, the entire disclosures of which are incorporated herein by reference]. Products generated by the 3' and 5' RACE 20 procedures may be combined to generate full-length cDNAs. In a second aspect of the present invention there is provided a substantially purified or isolated polypeptide from a ryegrass (Lolium) or fescue (Festuca) species, selected from the group consisting of ES13 and ES13-like, CSA and CSA like, LT16 and LT16-like, SALT and SALT-like, WESR5 and WESR5-like, ALDP 25 and ALDP-like; and functionally active fragments and variants thereof. The ryegrass (Lolium) or fescue (Festuca) species may be of any suitable type, including Italian or annual ryegrass, perennial ryegrass, tall fescue, meadow fescue and red fescue. Preferably the species is a ryegrass, more preferably perennial ryegrass (L. perenne).

9 In a preferred embodiment of this aspect of the invention, the substantially purified or isolated ES13 or ES13-like polypeptide includes an amino acid sequence selected from the group consisting of the sequences shown in Figures 2, 5, 8, 11, 14, 17, 20, 23, 71 and 77 hereto (Sequence ID Nos: 2, 13, 22, 29, 33, 38, 42, 46, 5 137, and 139, respectively), and functionally active fragments and variants thereof. In a further preferred embodiment of this aspect of the invention, the substantially purified or isolated CSA or CSA-like polypeptide includes an amino acid sequence selected from the group consisting of sequences shown in Figures 26, 29, 32, 59 and 65 hereto (Sequence ID Nos: 50, 59, 64, 133, and 135, 10 respectively), and functionally active fragments and variants thereof. In a further preferred embodiment of this aspect of the invention, the substantially purified or isolated LT16 or LT16-like polypeptide includes an amino acid sequence selected from the group consisting of the sequences shown in Figures 35, 38, 41, 44, 83 and 89 hereto (Sequence ID Nos: 69, 76, 87, 93, 141, 15 and 143, respectively), and functionally active fragments and variants thereof. In a still further preferred embodiment of this aspect of the invention, the substantially purified or isolated SALT or SALT-like polypeptide includes an amino acid sequence selected from the group consisting of the sequences shown in Figures 47, 50 and 95 hereto (Sequence ID Nos: 107, 121, and 145, respectively), 20 and functionally active fragments and variants thereof. In a still further preferred embodiment of this aspect of the invention, the substantially purified or isolated WESR5 or WESR5-like polypeptide includes an amino acid sequence shown in Figure 53 hereto (Sequence ID No: 127), and functionally active fragments and variants thereof. 25 In a still further preferred embodiment of this aspect of the invention, the substantially purified or isolated ALDP or ALDP-like polypeptide includes an amino acid sequence shown in Figure 55 hereto (Sequence ID No: 129), and functionally active fragments and variants thereof.

7294133 10 In a preferred embodiment the present invention provides a substantially purified or isolated WESR5 polypeptide from a Lolium species. Preferably, said Lolium species is Lolium perenne or Lolium arundinaceum. In a further preferred embodiment the present invention provides a 5 substantially purified or isolated WESR5 polypeptide including an amino acid sequence shown in Figure 53 hereto (Sequence ID No: 127); or a functionally active fragment or variant thereof. Preferably, said functionally active fragment or variant has a sequence having at least 90% identity to the relevant part of the sequence upon which the 10 fragment or variant is based and has a size of at least 20 amino acids. By "functionally active" in relation to polypeptides it is meant that the fragment or variant has one or more of the biological properties of the proteins ES13, ES13-like, CSA, CSA-like, LT16, LT16-iike, SALT, SALT-like, WESR5, WESR5-like, ALDP and ALDP-like, respectively. Additions, deletions, substitutions 15 and derivatizations of one or more of the amino acids are contemplated so long as the modifications do not result in loss of functional activity of the fragment or variant. Preferably the functionally active fragment or variant has at least approximately 60% identity to the relevant part of the above mentioned amino acid sequence, more preferably at least approximately 80% identity, even more 20 preferably at least approximately 90% identity, most preferably at least approximately 95% homology. Such functionally active variants and fragments include, for example, those having conservative amino acid substitutions of one or more residues in the corresponding amino acid sequence. Preferably the fragment has a size of at least 10 amino acids, more preferably at least 15 amino acids, 25 most preferably at least 20 amino acids. In a further embodiment of this aspect of the invention, there is provided a polypeptide recombinantly produced from a nucleic acid or nucleic acid fragment according to the present invention. Techniques for recombinantly producing polypeptides are well known to those skilled in the art.

7294133 10a Availability of the nucleotide sequences of the present invention and deduced amino acid sequences facilitates immunological screening of cDNA expression libraries. Synthetic peptides representing portions of the instant amino acid sequences may be synthesized. These peptides may be used to immunise 5 animals to produce polyclonal or monoclonal antibodies with specificity for peptides and/or proteins including the amino acid sequences. These antibodies may be then used to screen cDNA expression libraries to isolate full-length cDNA clones of interest. A genotype is the genetic constitution of an individual or group. Variations in 10 genotype are important in commercial breeding programs, in determining parentage, in diagnostics and fingerprinting, and the like. Genotypes can be readily described in term of genetic markers. A genetic marker identifies a 11 specific region or locus in the genome. The more genetic markers, the finer defined is the genotype. A genetic marker becomes particularly useful when it is allelic between organisms because it then may serve to unambiguously identify an individual. Furthermore, a genetic marker becomes particularly useful when it is 5 based on nucleic acid sequence information that can unambiguously establish a genotype of an individual and when the function encoded by such nucleic acid is known and is associated with a specific trait. Such nucleic acids and/or nucleotide sequence information including single nucleotide polymorphisms (SNPs), variations in single nucleotides between allelic forms of such nucleotide sequence, 10 may be used as perfect markers or candidate genes for the given trait. Applicants have identified a number of SNPs of the nucleic acids or nucleic acid fragments of the present invention. These are indicated (marked with grey on the black background) in the figures that show multiple alignments of nucleotide sequences of nucleic acid fragments contributing to consensus contig sequences. 15 See for example, Figures 3, 6, 9, 12, 15, 18, 24, 27, 30, 33, 36, 39, 42, 45, 48 and 51 hereto (Sequence ID Nos: 3 to 11, 14 to 20, 23 to 27, 30 and 31, 34 to 36, 39 and 40, 47 and 48, 51 to 57, 60 to 62, 65 to 67, 70 to 74, 77 to 85, 88 to 91, 94 to 105, 108 to 119, and 122 to 125, respectively). Accordingly, in a further aspect of the present invention, there is provided a 20 substantially purified or isolated nucleic acid or nucleic acid fragment including a single nucleotide polymorphism (SNP) from a nucleic acid or nucleic acid fragment according to the present invention or complements or sequences antisense thereto, and functionally active fragments and variants thereof. In a still further aspect of the present invention there is provided a method 25 of isolating a nucleic acid or nucleic acid fragment of the present invention including a SNP, said method including sequencing nucleic acid fragments from a nucleic acid library. The nucleic acid library may be of any suitable type and is preferably a cDNA library.

12 The nucleic acid or nucleic acid fragments may be isolated from a recombinant plasmid or may be amplified, for example using polymerase chain reaction. The sequencing may be performed by techniques known to those skilled in 5 the art. In a still further aspect of the present invention, there is provided use of the nucleic acids or nucleic acid fragments of the present invention including SNPs, and/or nucleotide sequence information thereof, as molecular genetic markers. In a still further aspect of the present invention there is provided use of a 10 nucleic acid or nucleic acid fragment of the present invention, and/or nucleotide sequence information thereof, as a molecular genetic marker. More particularly, nucleic acids or nucleic acid fragments according to the present invention and/or nucleotide sequence information thereof may be used as a molecular genetic marker for quantitative trait loci (QTL) tagging, QTL mapping, 15 DNA fingerprinting and in marker assisted selection, particularly in ryegrasses and fescues. Even more particularly, nucleic acids or nucleic acid fragments according to the present invention and/or nucleotide sequence information thereof may be used as molecular genetic markers in plant improvement in relation to plant tolerance to environmental stresses and osmotic stresses such as salt stress, to 20 the plant capacity to survive salt shocks, the plant recovery after exposure to salt stress, e.g. tagging QTLs for tolerance to salinity, for tolerance to sodicity, and for tolerance to drought. Even more particularly, sequence information revealing SNPs in allelic variants of the nucleic acids or nucleic acid fragments of the present invention and/or nucleotide sequence information thereof may be used as 25 molecular genetic markers for QTL tagging and mapping and in marker assisted selection, particularly in ryegrasses and fescues. In a still further aspect of the present invention there is provided a construct including a nucleic acid or nucleic acid fragment according to the present invention.

13 The term "construct" as used herein refers to an artificially assembled or isolated nucleic acid molecule which includes the gene of interest. In general a construct may include the gene or genes of interest, a marker gene which in some cases can also be the gene of interest and appropriate regulatory sequences. It 5 should be appreciated that the inclusion of regulatory sequences in a construct is optional, for example, such sequences may not be required in situations where the regulatory sequences of a host cell are to be used. The term construct includes vectors but should not be seen as being limited thereto. In a still further aspect of the present invention there is provided a vector 10 including a nucleic acid or nucleic acid fragment according to the present invention. The term "vector" as used herein encompasses both cloning and expression vectors. Vectors are often recombinant molecules containing nucleic acid molecules from several sources. 15 In a preferred embodiment of this aspect of the invention, the vector may include a regulatory element such as a promoter, a nucleic acid or nucleic acid fragment according to the present invention and a terminator; said regulatory element, nucleic acid or nucleic acid fragment and terminator being operatively linked. 20 By "operatively linked" is meant that said regulatory element is capable of causing expression of said nucleic acid or nucleic acid fragment in a plant cell and said terminator is capable of terminating expression of said nucleic acid or nucleic acid fragment in a plant cell. Preferably, said regulatory element is upstream of said nucleic acid or nucleic acid fragment and said terminator is downstream of 25 said nucleic acid or nucleic acid fragment. The vector may be of any suitable type and may be viral or non-viral. The vector may be an expression vector. Such vectors include chromosomal, non chromosomal and synthetic nucleic acid sequences, eg. derivatives of plant viruses; bacterial plasmids; derivatives of the Ti plasmid from Agrobacterium 14 tumefaciens, derivatives of the Ri plasmid from Agrobacterium rhizogenes; phage DNA; yeast artificial chromosomes; bacterial artificial chromosomes; binary bacterial artificial chromosomes; vectors derived from combinations of plasmids and phage DNA. However, any other vector may be used as long as it is 5 replicable, integrative or viable in the plant cell. The regulatory element and terminator may be of any suitable type and may be endogenous to the target plant cell or may be exogenous, provided that they are functional in the target plant cell. Preferably the regulatory element is a promoter. A variety of promoters 10 which may be employed in the vectors of the present invention are well known to those skilled in the art. Factors influencing the choice of promoter include the desired tissue specificity of the vector, and whether constitutive or inducible expression is desired and the nature of the plant cell to be transformed (eg. monocotyledon or dicotyledon). Particularly suitable constitutive promoters include 15 the Cauliflower Mosaic Virus 35S (CaMV 35S) promoter and derivatives thereof, the maize Ubiquitin promoter, and the rice Actin promoter. A variety of terminators which may be employed in the vectors of the present invention are also well known to those skilled in the art. The terminator may be from the same gene as the promoter sequence or a different gene. 20 Particularly suitable terminators are polyadenylation signals, such as the CaMV 35S polyA and other terminators from the nopaline synthase (nos), the octopine synthase (ocs) and the rbcS genes. The vector, in addition to the regulatory element, the nucleic acid or nucleic acid fragment of the present invention and the terminator, may include further 25 elements necessary for expression of the nucleic acid or nucleic acid fragment, in different combinations, for example vector backbone, origin of replication (ori), multiple cloning sites, spacer sequences, enhancers, introns (such as the maize Ubiquitin Ubi intron), antibiotic resistance genes and other selectable marker genes [such as the neomycin phosphotransferase (npt2) gene, the hygromycin 30 phosphotransferase (hph) gene, the phosphinothricin acetyltransferase (bar or pat) 15 gene and the gentamycin acetyl transferase (aacC1) gene], and reporter genes [such as beta-glucuronidase (GUS) gene (gusA) and green fluorescent protein (gfp)]. The vector may also contain a ribosome binding site for translation initiation. The vector may also include appropriate sequences for amplifying expression. 5 As an alternative to use of a selectable marker gene to provide a phenotypic trait for selection of transformed host cells, the presence of the vector in transformed cells may be determined by other techniques well known in the art, such as PCR (polymerase chain reaction), Southern blot hybridisation analysis, histochemical GUS assays, northem and Western blot hybridisation analyses. 10 Those skilled in the art will appreciate that the various components of the vector are operatively linked, so as to result in expression of said nucleic acid or nucleic acid fragment. Techniques for operatively linking the components of the vector of the present invention are well known to those skilled in the art. Such techniques include the use of linkers, such as synthetic linkers, for example 15 including one or more restriction enzyme sites. The constructs and vectors of the present invention may be incorporated into a variety of plants, including monocotyledons (such as grasses from the genera Lolium, Festuca, Paspalum, Pennisetum, Panicum and other forage and turfgrasses, corn, oat, sugarcane, wheat and barley), dicotyledons (such as 20 Arabidopsis, tobacco, clovers, medics, eucalyptus, potato, sugarbeet, canola, soybean, chickpea) and gymnosperms. In a preferred embodiment, the constructs and vectors may be used to transform monocotyledons, preferably grass species such as ryegrasses (Lolium species) and fescues (Festuca species), more preferably perennial ryegrass, including forage- and turf-type cultivars. In an 25 alternate preferred embodiment, the constructs and vectors may be used to transform dicotyledons, preferably forage legume species such as clovers (Trifolium species) and medics (Medicago species), more preferably white clover (Trifolium repens), red clover (Trifolium pratense), subterranean clover (Trifolium subterraneum) and lucerne (Medicago sativa). Clovers, lucerne and medics are 30 key pasture legumes in temperate climates throughout the world.

16 Techniques for incorporating the constructs and vectors of the present invention into plant cells (for example by transduction, transfection or transformation) are well known to those skilled in the art. Such techniques include Agrobacterium-mediated introduction, electroporation to tissues, cells and 5 protoplasts, protoplast fusion, injection into reproductive organs, injection into immature embryos and high velocity projectile introduction to cells, tissues, calli, immature and mature embryos. The choice of technique will depend largely on the type of plant to be transformed. Cells incorporating the constructs and vectors of the present invention may 10 be selected, as described above, and then cultured in an appropriate medium to regenerate transformed plants, using techniques well known in the art. The culture conditions, such as temperature, pH and the like, will be apparent to the person skilled in the art. The resulting plants may be reproduced, either sexually or asexually, using methods well known in the art, to produce successive generations 15 of transformed plants. In a further aspect of the present invention there is provided a plant cell, plant, plant seed or other plant part, including, e.g. transformed with, a construct, vector, nucleic acid or nucleic acid fragment of the present invention. The plant cell, plant, plant seed or other plant part may be from any suitable 20 species, including monocotyledons, dicotyledons and gymnosperms. In a preferred embodiment the plant cell, plant, plant seed or other plant part may be from a monocotyledon, preferably a grass species, more preferably a ryegrass (Lolium species) or fescue (Festuca species), even more preferably perennial ryegrass, including both forage- and turf-type cultivars. In an alternate preferred 25 embodiment the plant cell, plant, plant seed or other plant part may be from a dicotyledon, preferably forage legume species such as clovers (Trifolium species) and medics (Medicago species), more preferably white clover (Trifolium repens), red clover (Trifolium pratense), subterranean clover (Trifolium subterraneum) and lucerne (Medicago sativa).

17 The present invention also provides a plant, plant seed or other plant part derived from a plant cell of the present invention. The present invention also provides a plant, plant seed or other plant part derived from a plant of the present invention. 5 In a further aspect of the present invention there is provided a method of modifying plant tolerance to environmental stress and/or osmotic stress such as salt stress, said method including introducing into said plant an effective amount of a nucleic acid or nucleic acid fragment, construct and/or a vector according to the present invention. 10 In a further aspect of the present invention there is provided a method of modifying plant capacity to survive salt shock, said method including introducing into said plant an effective amount of a nucleic acid or nucleic acid fragment, construct and/or a vector according to the present invention. In a further aspect of the present invention there is provided a method of 15 modifying compartmentalization of sodium in a plant, for example into the plant cell vacuole, said method including introducing into said plant an effective amount of a nucleic acid or nucleic acid fragment, construct and/or a vector according to the present invention. In a further aspect of the present invention there is provided a method of 20 modifying sodium ion influx and/or efflux in a plant, said method including introducing into said plant an effective amount of a nucleic acid or nucleic acid fragment, construct and/or a vector according to the present invention. In a further aspect of the present invention there is provided a method of modifying plant recovery after exposure to salt stress, said method including 25 introducing into said plant an effective amount of a nucleic acid or nucleic acid fragment, construct and/or a vector according to the present invention. In a further aspect of the present invention there is provided a method of modifying plant metabolism under salt stress, said method including introducing 18 into said plant an effective amount of a nucleic acid or nucleic acid fragment, construct and/or a vector according to the present invention. By "an effective amount" it is meant an amount sufficient to result in an identifiable phenotypic trait in said plant, or a plant, plant seed or other plant part 5 derived therefrom. Such amounts can be readily determined by an appropriately skilled person, taking into account the type of plant, the route of administration and other relevant factors. Such a person will readily be able to determine a suitable amount and method of administration. See, for example, Maniatis et al, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring 10 Harbor, the entire disclosure of which is incorporated herein by reference. Using the methods and materials of the present invention, plant tolerance to environmental stresses and osmotic stresses such as salt stress; plant capacity to survive salt shocks, compartmentalization of sodium in plants, for example into the plant cell vacuole, sodium ion influx and/or efflux, plant recovery after exposure to 15 salt stress, and/or plant metabolism under salt stress, may be increased or otherwise modified, for example by incorporating additional copies of a sense nucleic acid or nucleic acid fragment of the present invention. They may be decreased or otherwise modified, for example by incorporating an antisense nucleic acid or nucleic acid fragment of the present invention. 20 The present invention will now be more fully described with reference to the accompanying Examples and drawings. It should be understood, however, that the description following is illustrative only and should not be taken in any way as a restriction on the generality of the invention described above. In the Figures 25 Figure 1 shows the consensus contig nucleotide sequence of LpES13a (Sequence ID No: 1). Figure 2 shows the deduced amino acid sequence of LpES13a (Sequence ID No: 2).

19 Figure 3 shows the nucleotide sequences of the nucleic acid fragments contributing to the consensus contig sequence LpES13a (Sequence ID Nos: 3 to 11). Figure 4 shows the consensus contig nucleotide sequence of LpESl3b (Sequence 5 ID No: 12). Figure 5 shows the deduced amino acid sequence of LpES13b (Sequence ID No: 13). Figure 6 shows the nucleotide sequences of the nucleic acid fragments contributing to the consensus contig sequence LpES13b (Sequence ID Nos: 14 to 10 20). Figure 7 shows the consensus contig nucleotide sequence of LpES13c (Sequence ID No: 21). Figure 8 shows the deduced amino acid sequence of LpESl3c (Sequence ID No: 22). 15 Figure 9 shows the nucleotide sequences of the nucleic acid fragments contributing to the consensus contig sequence LpES13c (Sequence ID Nos: 23 to 27). Figure 10 shows the consensus contig nucleotide sequence of LpES13d (Sequence ID No: 28). 20 Figure 11 shows the deduced amino acid sequence of LpESI3d (Sequence ID No: 29). Figure 12 shows the nucleotide sequences of the nucleic acid fragments contributing to the consensus contig sequence LpESI3d (Sequence ID Nos: 30 and 31).

20 Figure 13 shows the consensus contig nucleotide sequence of LpES13e (Sequence ID No: 32). Figure 14 shows the deduced amino acid sequence of LpES13e (Sequence ID No: 33). 5 Figure 15 shows the nucleotide sequences of the nucleic acid fragments contributing to the consensus contig sequence LpESI3e (Sequence ID Nos: 34 to 36). Figure 16 shows the consensus contig nucleotide sequence of LpES13f (Sequence ID No: 37). 10 Figure 17 shows the deduced amino acid sequence of LpES13f (Sequence ID No: 38). Figure 18 shows the nucleotide sequences of the nucleic acid fragments contributing to the consensus contig sequence LpES13f (Sequence ID Nos: 39 and 40). 15 Figure 19 shows the consensus contig nucleotide sequence of LpES13g (Sequence lD No: 41). Figure 20 shows the deduced amino acid sequence of LpES13g (Sequence ID No: 42). Figure 21 shows the nucleotide sequences of the nucleic acid fragments 20 contributing to the consensus contig sequence LpES13g (Sequence ID Nos: 43 and 44). Figure 22 shows the consensus contig nucleotide sequence of LpES13h (Sequence ID No: 45). Figure 23 shows the deduced amino acid sequence of LpESl3h (Sequence ID No: 25 46).

21 Figure 24 shows the nucleotide sequences of the nucleic acid fragments contributing to the consensus contig sequence LpES13h (Sequence ID Nos: 47 and 48). Figure 25 shows the consensus contig nucleotide sequence of LpCSAa 5 (Sequence ID No: 49). Figure 26 shows the deduced amino acid sequence of LpCSAa (Sequence ID No: 50). Figure 27 shows the nucleotide sequences of the nucleic acid fragments contributing to the consensus contig sequence LpCSAa (Sequence ID Nos: 51 to 10 57). Figure 28 shows the consensus contig nucleotide sequence of LpCSAb (Sequence ID No: 58). Figure 29 shows the deduced amino acid sequence of LpCSAb (Sequence ID No: 59). 15 Figure 30 shows the nucleotide sequences of the nucleic acid fragments contributing to the consensus contig sequence LpCSAb (Sequence ID Nos: 60 to 62). Figure 31 shows the consensus contig nucleotide sequence of LpCSAc (Sequence ID No: 63). 20 Figure 32 shows the deduced amino acid sequence of LpCSAc (Sequence ID No: 64). Figure 33 shows the nucleotide sequences of the nucleic acid fragments contributing to the consensus contig sequence LpCSAc (Sequence ID Nos: 65 to 67).

22 Figure 34 shows the consensus contig nucleotide sequence of LpLT16Aa (Sequence ID No: 68). Figure 35 shows the deduced amino acid sequence of LpLT16Aa (Sequence ID No: 69). 5 Figure 36 shows the nucleotide sequences of the nucleic acid fragments contributing to the consensus contig sequence LpLT16Aa (Sequence ID Nos: 70 to 74). Figure 37 shows the consensus contig nucleotide sequence of LpLT16Ab (Sequence ID No: 75). 10 Figure 38 shows the deduced amino acid sequence of LpLT16Ab (Sequence ID No: 76). Figure 39 shows the nucleotide sequences of the nucleic acid fragments contributing to the consensus contig sequence LpLT16Ab (Sequence ID Nos: 77 to 85). 15 Figure 40 shows the consensus contig nucleotide sequence of LpLT16Ba (Sequence ID No: 86). Figure 41 shows the deduced amino acid sequence of LpLT16Ba (Sequence ID No: 87). Figure 42 shows the nucleotide sequences of the nucleic acid fragments 20 contributing to the consensus contig sequence LpLT16Ba (Sequence ID Nos: 88 to 91). Figure 43 shows the consensus contig nucleotide sequence of LpLT16Bb (Sequence ID No: 92). Figure 44 shows the deduced amino acid sequence of LpLT16Bb (Sequence ID 25 No: 93).

23 Figure 45 shows the nucleotide sequences of the nucleic acid fragments contributing to the consensus contig sequence LpLT16Bb (Sequence ID Nos: 94 to 105). Figure 46 shows the consensus contig nucleotide sequence of LpSALTa 5 (Sequence ID No: 106). Figure 47 shows the deduced amino acid sequence of LpSALTa (Sequence ID No: 107). Figure 48 shows the nucleotide sequences of the nucleic acid fragments contributing to the consensus contig sequence LpSALTa (Sequence ID Nos: 108 10 to 119). Figure 49 shows the consensus contig nucleotide sequence of LpSALTb (Sequence ID No: 120). Figure 50 shows the deduced amino acid sequence of LpSALTb (Sequence ID No: 121). 15 Figure 51 shows the nucleotide sequences of the nucleic acid fragments contributing to the consensus contig sequence LpSALTb (Sequence ID Nos: 122 to 125). Figure 52 shows the nucleotide sequence of LpWESR5a (Sequence ID No: 126). Figure 53 shows the deduced amino acid sequence of LpWESR5a (Sequence ID 20 No: 127). Figure 54 shows the consensus contig nucleotide sequence of LpALDPa (Sequence ID No: 128). Figure 55 shows the deduced amino acid sequence of LpALDPa (Sequence ID No: 129).

24 Figure 56 shows the nucleotide sequences of the nucleic acid fragments contributing to the consensus contig sequence LpALDPa (Sequence ID Nos: 130 and 131). Figure 57 shows a plasmid map of the cDNA encoding perennial ryegrass CSAa. 5 Figure 58 shows the full nucleotide sequence of perennial ryegrass CSAa cDNA (Sequence ID No: 132). Figure 59 shows the deduced amino acid sequence of perennial ryegrass CSAa cDNA (Sequence ID No: 133). Figure 60 shows plasmid maps of sense and antisense constructs of LpCSAa in 10 pDH51 transformation vector. Figure 61 shows plasmid maps of sense and antisense constructs of LpCSAa in pPZP221:35S 2 binary transformation vector. Figure 62 shows screening by Southern hybridisation for RFLPs using LpCSAa as a probe. 15 Figure 63 shows a plasmid map of the cDNA encoding perennial ryegrass CSAb. Figure 64 shows the full nucleotide sequence of perennial ryegrass CSAb cDNA (Sequence ID No: 134). Figure 65 shows the deduced amino acid sequence of perennial ryegrass CSAb cDNA (Sequence ID No: 135). 20 Figure 66 shows plasmid maps of sense and antisense constructs of LpCSAb in pDH51 transformation vector. Figure 67 shows plasmid maps of sense and antisense constructs of LpCSAb in pPZP221:35S 2 binary transformation vector.

25 Figure 68 shows screening by Southern hybridisation for RFLPs using LpCSAb as a probe. Figure 69 shows a plasmid map of the cDNA encoding perennial ryegrass ES13a. Figure 70 shows the full nucleotide sequence of perennial ryegrass ES13a cDNA 5 (Sequence ID No: 136). Figure 71 shows the deduced amino acid sequence of perennial ryegrass ESI3a cDNA (Sequence ID No: 137). Figure 72 shows plasmid maps of sense and antisense constructs of LpES13a in pDH51 transformation vector. 10 Figure 73 shows plasmid maps of sense and antisense constructs of LpES13a in pPZP221:35S 2 binary transformation vector. Figure 74 shows screening by Southern hybridisation for RFLPs using LpES13a as a probe. Figure 75 shows a plasmid map of the cDNA encoding perennial ryegrass ESI3b. 15 Figure 76 shows the full nucleotide sequence of perennial ryegrass ES13b cDNA (Sequence ID No: 138). Figure 77 shows the deduced amino acid sequence of perennial ryegrass ES13b cDNA (Sequence ID No: 139). Figure 78 shows plasmid maps of sense and antisense constructs of LpESl3b in 20 pDH51 transformation vector. Figure 79 shows plasmid maps of sense and antisense constructs of LpESl3b in pPZP221:35S 2 binary transformation vector.

26 Figure 80 shows screening by Southern hybridisation for RFLPs using LpESI3b as a probe. Figure 81 shows a plasmid map of the cDNA encoding perennial ryegrass LT1 6Aa. 5 Figure 82 shows the full nucleotide sequence of perennial ryegrass LT16Aa cDNA (Sequence ID No: 140). Figure 83 shows the deduced amino acid sequence of perennial ryegrass LT16Aa cDNA (Sequence ID No: 141). Figure 84 shows plasmid maps of sense and antisense constructs of LpLT16Aa in 10 pDH51 transformation vector. Figure 85 shows plasmid maps of sense and antisense constructs of LpLT16Aa in pPZP221:35S 2 binary transformation vector. Figure 86 shows screening by Southern hybridisation for RFLPs using LpLT16Aa as a probe. 15 Figure 87 shows a plasmid map of the cDNA encoding perennial ryegrass LT1 6Ba. Figure 88 shows the full nucleotide sequence of perennial ryegrass LT16Ba cDNA (Sequence ID No: 142). Figure 89 shows the deduced amino acid sequence of perennial ryegrass LT16Ba 20 cDNA (Sequence ID No: 143). Figure 90 shows plasmid maps of sense and antisense constructs of LpLT16Ba in pDH51 transformation vector. Figure 91 shows plasmid maps of sense and antisense constructs of LpLT16Ba in pPZP221:35S 2 binary transformation vector.

27 Figure 92 shows screening by Southern hybridisation for RFLPs using LpLT16Ba as a probe. Figure 93 shows a plasmid map of the cDNA encoding perennial ryegrass SALTb. Figure 94 shows the full nucleotide sequence of perennial ryegrass SALTb cDNA 5 (Sequence ID No: 144). Figure 95 shows the deduced amino acid sequence of perennial ryegrass SALTb cDNA (Sequence ID No: 145). Figure 96 shows plasmid maps of sense and antisense constructs of LpSALTb in pDH51 transformation vector. 10 Figure 97 shows plasmid maps of sense and antisense constructs of LpSALTb in pPZP221:35S 2 binary transformation vector. Figure 98 shows screening by Southern hybridisation for RFLPs using LpSALTb as a probe. Figure 99 shows A, infiltration of Arabidopsis plants; B, selection of transgenic 15 Arabidopsis plants on medium containing 75 pg/mI gentamycin; C, young transgenic Arabidopsis plants; D, E, two representative results of real-time PCR analysis of Arabidopsis transformed with chimeric genes involved in salt stress protection. Figure 100 shows the genetic map detailing the relation of perennial ryegrass 20 genes involved in salt stress protection with the linkage groups in perennial ryegrass. Figure 101 shows a subgrid of a microarray for the expression profiling of perennial ryegrass genes involved in salt stress protection.

28 EXAMPLE 1 Preparation of cDNA libraries, isolation and sequencing of cDNAs coding for ES13, ES13-like, CSA, CSA-like, LT16, LT16-like, SALT, SALT-like, WESR5, WESR5-like, ALDP and ALDP-like proteins from perennial ryegrass (Lo/ium 5 perenne) cDNA libraries representing mRNAs from various organs and tissues of perennial ryegrass (Lolium perenne) were prepared. The characteristics of the libraries are described below (Table 1). TABLE 1 10 cDNA libraries from perennial ryegrass (Lolum perenne) Library Organ/Tissue 01 rg Roots from 3-4 day old light-grown seedlings 02rg Leaves from 3-4 day old light-grown seedlings 03rg Etiolated 3-4 day old dark-grown seedlings 04rg Whole etiolated seedlings (1-5 day old and 17 days old) 05rg Senescing leaves from mature plants 06rg Whole etiolated seedlings (1-5 day old and 17 days old) 07rg Roots from mature plants grown in hydroponic culture 08rg Senescent leaf tissue 09rg Whole tillers and sliced leaves (0, 1, 3, 6, 12 and 24 h after harvesting) 1Org Embryogenic suspension-cultured cells 11rg Non-embryogenic suspension-cultured cells 12rg Whole tillers and sliced leaves (0, 1, 3, 6, 12 and 24 h after harvesting) 13rg Shoot apices including vegetative apical meristems 14rg Immature inflorescences including different stages of inflorescence meristem and inflorescence development 15rg Defatted pollen 29 Library Organ/Tissue 16rg Leaf blades and leaf sheaths (rbcL, rbcS, cab, wir2A subtracted) 17rg Senescing leaves and tillers 18rg Drought-stressed tillers (pseudostems from plants subjected to PEG simulated drought stress) 19rg Non-embryogenic suspension-cultured cells subjected to osmotic stress (grown in media with half-strength salts) (1, 2, 3, 4, 5, 6, 24 and 48 h after transfer) 20rg Non-embryogenic suspension-cultured cells subjected to osmotic stress (grown in media with double-strength salts) (1, 2, 3, 4, 5, 6, 24 and 48 h after transfer) 21 rg Drought-stressed tillers (pseudostems from plants subjected to PEG simulated drought stress) 22rg Spikelets with open and maturing florets 23rg Mature roots (specific subtraction with leaf tissue) The cDNA libraries may be prepared by any of many methods available. For example, total RNA may be isolated using the Trizol method (Gibco-BRL, USA) or the RNeasy Plant Mini kit (Qiagen, Germany), following the 5 manufacturers' instructions. cDNAs may be generated using the SMART PCR cDNA synthesis kit (Clontech, USA), cDNAs may be amplified by long distance polymerase chain reaction using the Advantage 2 PCR Enzyme system (Clontech, USA), cDNAs may be cleaned using the GeneClean spin column (Bio 101, USA), tailed and size fractionated, according to the protocol provided by Clontech. The 10 cDNAs may be introduced into the pGEM-T Easy Vector system 1 (Promega, USA) according to the protocol provided by Promega. The cDNAs in the pGEM-T Easy plasmid vector are transfected into Escherichia coli Epicurian coli XL10-Gold ultra competent cells (Stratagene, USA) according to the protocol provided by Stratagene. 15 Alternatively, the cDNAs may be introduced into plasmid vectors for first preparing the cDNA libraries in Uni-ZAP XR vectors according to the manufacturer's protocol (Stratagene Cloning Systems, La Jolla, CA, USA). The Uni-ZAP XR libraries are converted into plasmid libraries according to the protocol 30 provided by Stratagene. Upon conversion, cDNA inserts will be contained in the plasmid vector pBluescript. In addition, the cDNAs may be introduced directly into precut pBluescript 11 SK(+) vectors (Stratagene) using T4 DNA ligase (New England Biolabs), followed by transfection into E. coli DH10B cells according to 5 the manufacturer's protocol (GIBCO BRL Products). Once the cDNA inserts are in plasmid vectors, plasmid DNAs are prepared from randomly picked bacterial colonies containing recombinant plasmids, or the insert cDNA sequences are amplified via polymerase chain reaction using primers specific for vector sequences flanking the inserted cDNA sequences. Plasmid 10 DNA preparation may be performed robotically using the Qiagen QiaPrep Turbo kit (Qiagen, Germany) according to the protocol provided by Qiagen. Amplified insert DNAs are sequenced in dye-terminator sequencing reactions to generate partial cDNA sequences (expressed sequence tags or "ESTs"). The resulting ESTs are analyzed using an Applied Biosystems ABI 3700 sequence analyser. 15 EXAMPLE2 DNA sequence analyses The cDNA clones encoding ES13, ES13-like, CSA, CSA-like, LT16, LT16 like, SALT, SALT-like, WESR5, WESR5-like, ALDP and ALDP-like proteins were identified by conducting BLAST (Basic Local Alignment Search Tool; Altschul et al. 20 (1993) J. Mo/. Biol. 215:403-410) searches. The cDNA sequences obtained were analysed for similarity to all publicly available DNA sequences contained in the eBioinformatics nucleotide database using the BLASTN algorithm provided by the National Center for Biotechnology Information (NCBI). The DNA sequences were translated in all reading frames and compared for similarity to all publicly available 25 protein sequences contained in the SWISS-PROT protein sequence database using BLASTx algorithm (v 2.0.1) (Gish and States (1993) Nature Genetics 3:266 272) provided by the NCBl. The cDNA sequences obtained and identified were then used to identify additional identical and/or overlapping cDNA sequences generated using the 31 BLASTN algorithm. The identical and/or overlapping sequences were subjected to a multiple alignment using the CLUSTALw algorithm, and to generate a consensus contig sequence derived from this multiple sequence alignment. The consensus contig sequence was then used as a query for a search against the SWISS-PROT 5 protein sequence database using the BLASTx algorithm to confirm the initial identification. EXAMPLE 3 Identification and full-length sequencing of cDNAs encoding perennial ryegrass CSAa, CSAb, ESI3a, ESI3b, LT16Aa, LT16Ba and SALTb proteins 10 To fully characterise for the purposes of the generation of probes for hybridisation experiments and the generation of transformation vectors, a set of perennial ryegrass cDNAs encoding CSAa, CSAb, ES13a, ES13b, LT16Aa, LT16Ba and SALTb proteins was identified and fully sequenced. Full-length cDNAs were identified from our EST sequence database using 15 relevant published sequences (NCBI databank) as queries for BLAST searches. Full-length cDNAs were identified by alignment of the query and hit sequences using Sequencher (Gene Codes Corp., Ann Arbor, MI 48108, USA). The original plasmid was then used to transform chemically competent XL-1 cells (prepared in house, CaCl 2 protocol). After colony PCR (using HotStarTaq, Qiagen) a minimum 20 of three PCR-positive colonies per transformation were picked for initial sequencing with M13F and M13R primers. The resulting sequences were aligned with the original EST sequence using Sequencher to confirm identity and one of the three clones was picked for full-length sequencing, usually the one with the best initial sequencing result. 25 Sequencing was completed by primer walking, i.e. oligonucleotide primers were designed to the initial sequence and used for further sequencing. In most cases the sequencing could be done from both 5' and 3' end. The sequences of the oligonucleotide primers are shown in Table 2. In some instances, however, an extended poly-A tail necessitated the sequencing of the cDNA to be completed 30 from the 5' end.

32 Contigs were then assembled in Sequencher. The contigs include the sequences of the SMART primers used to generate the initial cDNA library as well as pGEM-T Easy vector sequence up to the EcoRi cut site both at the 5' and 3' end. 5 Plasmid maps and the full cDNA sequences of perennial ryegrass cDNAs encoding CSAa, CSAb, ES13a, ES13b, LT16Aa, LT16Ba and SALTb proteins were obtained (Figures 57, 63, 69, 75, 81, 87 and 93). TABLE 2 List of primers used for sequencing of the full-length cDNAs gene name clone ID sequencing primer primer sequence (5'>3') LpCSAa 06rg2HsFO2 06rg2HsFO2.fl AATGGATGGCGCTGAAGC 06rg2HsFO2.r1 AGGGTTGAAGCTTCAGG LpCSAb 01rglQsE08 01rglQsEO8.fl TGTTGCATCTCGATGTGG 01 rg1 QsE08.f2 AGACACCTCAAACCTCC LpESI3b 07rglKsBO4 07rglKsBO4.fl TCATCTGGATTATTTGGC LpLT16Ba 06rg2DsDl1 06rg2DsD11.fl ATCTGTTCGTTTGAGACG 10 EXAMPLE 4 Development of transformation vectors containing chimeric genes with CSAa, CSAb, ESI3a, ESI3b, LT16Aa, LT16Ba and SALTb cDNA sequences from perennial ryegrass 15 To alter the expression of the proteins involved in salt stress protection CSAa, CSAb, ES13a, ES13b, LT16Aa, LT16Ba and SALTb, through antisense and/or sense suppression technology and for over-expression of these key enzymes in transgenic plants, a set of sense and antisense transformation vectors was produced.

33 cDNA fragments were generated by high fidelity PCR using the original pGEM-T Easy plasmid cDNA as a template. The primers used (Table 3) contained recognition sites for appropriate restriction enzymes, for example EcoRI and Xbal, for directional and non-directional cloning into the target vector. After PCR 5 amplification and restriction digest with the appropriate restriction enzyme (usually Xbal), the cDNA fragments were cloned into the corresponding site in pDH51, a pUC18-based transformation vector containing a CaMV 35S expression cassette. The orientation of the constructs (sense or antisense) was checked by DNA sequencing through the multi-cloning site of the vector. Transformation vectors 10 containing chimeric genes using full-length open reading frame cDNAs encoding perennial ryegrass CSAa, CSAb, ES13a, ES13b, LT16Aa, LT16Ba and SALTb proteins in sense and antisense orientations under the control of the CaMV 35S promoter were generated (Figures 60, 66, 72, 78, 84, 90 and 96). TABLE 3 15 List of primers used to PCR-amplify the open reading frames gene name clone ID primer primer sequence (5'->3') LpCSAa 06rg2HsFO2 06rg2HsFO2.f GAATTCTAGATTCGCGCACTTCAGCATGG 06rg2HsF2.rl GAATTCTAGATAAGATTTAAGAGCTCGC LpCSAb 01rglQsEO8 01rglQsEO8.f GAATTCTAGATCAGACTTCAGAGTATTGCC 01rg1QsEO8.r GAATTCTAGAACACCATACACACGACACACC LpES13a 20rg1 EsA09 20rg1 EsA09.f GAATTCTAGAACACAACTGAGCTAGCCATG 20rg 1 EsA09. r GAATTCTAGAATGAACTCAAGCTCTCTTAACC LpES13b 07rgl KsB04 07rg1 KsB04.f GAATTCTAGAAAGAGACAGATTCTCCCTCC 07rg1 KsB04.r GAATTCTAGAAGATATTACAGAGTTACACTGG LpLT16Aa 11 rg1 SsC09 11 rg1 SsC09.f GAATTCTAGAAAGAAAGGAGACCGATCATG 11 rg1SsC09.r GAATTCTAGAGAACACATGCGACGATTTGG LpLT16Ba 06rg2DsDl 1 06rg2DsDl 1.f GAATTCTAGAAACCCTTTCCTCTCCCTAGC 06rg2DsDl 1.r GAATTCTAGAAGGGCGCAGAACAGGATGG LpSALTb 1 Org2LsBO3 1 Org2LsBO3.f GAATTCTAGATGCGTGAGTTAGATAGAC;CC 1Org2LsBO3.r GAATTCTAGATAGGTGGCCGGAGAAGTCCC 34 EXAMPLE Development of binary transformation vectors containing chimeric genes with CSAa, CSAb, ESI3a, ESI3b, LT16Aa, LT16Ba and SALTb cDNA sequences from perennial ryegrass 5 To alter the expression of the proteins involved in salt stress protection CSAa, CSAb, ESI3a, ESI3b, LT16Aa, LT16Ba and SALTb, through antisense and/or sense suppression technology and for over-expression of these key proteins in transgenic plants, a set of sense and antisense binary transformation vectors was produced. 10 cDNA fragments were generated by high fidelity PCR using the original pGEM-T Easy plasmid cDNA as a template. The primers used (Table 3) contained recognition sites for appropriate restriction enzymes, for example EcoRI and Xbal, for directional and non-directional cloning into the target vector. After PCR amplification and restriction digest with the appropriate restriction enzyme (usually 15 Xbal), the cDNA fragments were cloned into the corresponding site in a modified pPZP binary vector (Hajdukiewicz et al., 1994). The pPZP221 vector was modified to contain the 35S 2 cassette from pKYLX71:35S 2 as follows. pKYLX71:35S 2 was cut with Clal. The 5' overhang was filled in using Klenow and the blunt end was A tailed with Taq polymerase. After cutting with EcoRI, the 2kb fragment with an 20 EcoRI-compatible and a 3'-A tail was gel-purified. pPZP221 was cut with Hindlli and the resulting 5' overhang filled in and T-tailed with Taq polymerase. The remainder of the original pPZP221 multi-cloning site was removed by digestion with EcoRI, and the expression cassette cloned into the EcoRI site and the 3' T overhang restoring the Hindlll site. This binary vector contains between the left 25 and right border the plant selectable marker gene aaaC1 under the control of the 35S promoter and 35S terminator and the pKYLX71:35S 2 -derived expression cassette with a CaMV 35S promoter with a duplicated enhancer region and an rbcS terminator. The orientation of the constructs (sense or antisense) was checked by 30 restriction enzyme digest. Transformation vectors containing chimeric genes using full-length open reading frame cDNAs of perennial ryegrass CSAa, CSAb, ES13a, 35 ES13b, LT16Aa, LT16Ba and SALTb in sense and antisense orientations under the control of the CaMV 35S2 promoter were generated (Figures 61, 67, 73, 79, 85, 91 and 97). EXAMPLE 6 5 Production and analysis of transgenic Arabidopsis plants carrying chimeric perennial ryegrass genes CSAa, CSAb, ES13a, ESl3b, LT16Aa, LT16Ba and SALTb involved in salt stress protection A set of transgenic Arabidopsis plants carrying chimeric perennial ryegrass genes involved in salt stress protection were produced. 10 pPZP221-based transformation vectors with LpCSAa, LpCSAb, LpES13a, LpES13b, LpLT16Aa, LpLT16Ba and LpSALTb cDNAs comprising the full open reading frame sequences in sense and antisense orientations under the control of the CaMV 35S promoter with duplicated enhancer region (35S2) were generated as detailed in Example 6. 15 Agrobacterium-mediated gene transfer experiments were performed using these transformation vectors. The production of transgenic Arabidopsis plants carrying the perennial ryegrass CSAa, CSAb, ES13a, ES13b, LT16Aa, LT16Ba and SALTb cDNAs under the control of the CaMV 35S promoter with duplicated enhancer region (35S 2 ) is 20 described here in detail. Preparation of Arabidopsis plants Seedling punnets were filled with Debco seed raising mixture (Debco Pty. Ltd.) to form a mound. The mound was covered with two layers of anti-bird netting secured with rubber bands on each side. The soil was saturated with water and 25 enough seeds (Arabidopsis thaliana ecotype Columbia, Lehle Seeds #WT-02) sown to obtain approximately 15 plants per punnet. The seeds were then vernalised by placing the punnets at 4 0 C. After 48 hours the punnets were 36 transferred to a growth room at 220C under fluorescent light (constant illumination, 55 pmolm- 2 s-1) and fed with Miracle-Gro (Scotts Australia Pty. Ltd.) once a week. Primary bolts were removed as soon as they appeared. After 4 - 6 days the secondary bolts were approximately 6 cm tall, and the plants were ready for 5 vacuum infiltration. Preparation of Agrobacterium Agrobacterium tumefaciens strain AGL-1 were streaked on LB medium containing 50 pg/ml rifampicin and 50 pg/ml kanamycin and grown at 27*C for 48 hours. A single colony was used to inoculate 5 ml of LB medium containing 50 10 pg/ml rifampicin and 50 pg/ml kanamycin and grown over night at 270C and 250 rpm on an orbital shaker. The overnight culture was used as an inoculum for 500 ml of LB medium containing 50 pg/ml kanamycin only. Incubation was over night at 270C and 250 rpm on an orbital shaker in a 2 1 Erlenmeyer flask. The overnight cultures were centrifuged for 15 min at 5500 xg and the 15 supernatant discarded. The cells were resuspended in 1 1 of infiltration medium [5% (w/v) sucrose, 0.03% (v/v) Silwet-L77 (Vac-In-Stuff, Lehle Seeds #VIS-01)] and immediately used for infiltration. Vacuum infiltration The Agrobacterium suspension was poured into a container (D6cor 20 Tellfresh storer, #024) and the container placed inside the vacuum desiccator (Bel Art, #42020-0000). A punnet with Arabidopsis plants was inverted and dipped into the Agrobacterium suspension and a gentle vacuum (250 mm Hg) was applied for 2 min. After infiltration, the plants were returned to the growth room where they were kept away from direct light overnight. The next day the plants were returned 25 to full direct light and allowed to grow until the siliques were fully developed. The plants were then allowed to dry out, the seed collected from the siliques and either stored at room temperature in a dry container or used for selection of transformants.

37 Selection of transformants Prior to plating the seeds were sterilised as follows. Sufficient seeds for one 150 mm petri dish (approximately 40 mg or 2000 seeds) were placed in a 1.5 ml microfuge tube. 500 pl 70% ethanol were added for 2 min and replaced by 500 pl 5 sterilisation solution (H 2 0:4% chlorine:5% SDS, 15:8:1). After vigorous shaking, the tube was left for 10 min after which time the sterilisation solution was replaced with 500 pl sterile water. The tube was shaken and spun for 5 sec to sediment the seeds. The washing step was repeated 3 times and the seeds were left covered with approximately 200 pl sterile water. 10 The seeds were then evenly spread on 150 mm petri dishes containing germination medium (4.61 g Murashige & Skoog salts, 10 g sucrose, 1 ml 1 M KOH, 2 g Phytagel, 0.5 g MES and 1 ml 1000x Gamborg's B-5 vitamins per litre) supplemented with 250 pg/ml timetin and 75 pg/ml gentamycin. After vernalisation for 48 hours at 40C the plants were grown under continuous fluorescent light (55 15 pmol m-2s-1) at 220C to the 6 - 8 leaf stage and transferred to soil. Preparation of genomic DNA 3 - 4 leaves of Arabidopsis plants regenerated on selective medium were harvested and freeze-dried. The tissue was homogenised on a Retsch MM300 mixer mill, then centrifuged for 10 min at 1700xg to collect cell debris. Genomic 20 DNA was isolated from the supernatant using Wizard Magnetic 96 DNA Plant System kits (Promega) on a Biomek FX (Beckman Coulter). 5 pl of the sample (50 pl) were then analysed on an agarose gel to check the yield and the quality of the genomic DNA. Analysis of DNA using real-time PCR 25 Genomic DNA was analysed for the presence of the transgene by real-time PCR using SYBR Green chemistry. PCR primer pairs (Table 4) were designed using MacVector (Accelrys). The forward primer was located within the 35S 2 promoter region and the reverse primer within the transgene to amplify products of approximately 150 - 250 bp as recommended. The positioning of the forward 38 primer within the 35S 2 promoter region guaranteed that homologous genes in Arabidopsis were not detected. 5 pl of each genomic DNA sample was run in a 50 pl PCR reaction including SYBR Green on an ABI (Applied Biosystems) together with samples 5 containing DNA isolated from wild type Arabidopsis plants (negative control), samples containing buffer instead of DNA (buffer control) and samples containing the plasmid used for transformation (positive plasmid control). Plants were obtained after transformation with all chimeric constructs and selection on medium containing gentamycin. The selection process and two 10 representative real-time PCR analyses are shown in Figure xx. TABLE 4 List of primers used for Real-time PCR analysis of Arabidopsis plants transformed with chimeric perennial ryegrass genes involved in salt stress protection construct primer 1 (forward) primer 2 (reverse) pPZP221 LpCSAasense CATTTCATTTGGAGAGGACACGC AGGTCAACATCTTTCCCACTTGC pPZP221 LpCSAanti TCATTTGGAGAGGACACGCTG TCGGAGACAACATCAAGTGGAAC pPZP221 LpCSAbsense CGCACAATCCCACTATCCTTCG GCTCCCATCTTTGCTTTCAGTAGC pPZP221 LpCSAbanti CTATCCTTCGCAAGACCCTTCC GCTGTTGGAGGTTTGAGGTGTC pPZP221LpESl3asense TTGGAGAGGACACGCTGAAATC CGAGAATGGTGAGCAAGAGACAG pPZP221LpES3aanti GCACAATCCCACTATCCTTCGC CTGTCTCTTGCTCACCATTCTCG pPZP221LpESl3bsense CATTTCATTTGGAGAGGACACGC GCTGGATCTCGGGGATTCC pPZP221LpES13banti CCACTATCCTTCGCAAGACCC ATCCTCGGCTACATCCCCG pPZP221LpLT16Aasense CATTTCATTTGGAGAGGACACGC AACCGAACTTGAGGAAGACGCC pPZP221LpLT16Aaanti CGCACAATCCCACTATCCTTCG CGTCTTCCTCAAGTTCGGTTGC pPZP221 LpLT1 6Basense GGAGAGGACACGCTGAAATCAC CGAACTTGAAGAAGACCCCGAG pPZP221LpLT1 6Baanti GCACAATCCCACTATCCTTCGC TTGCTGCTCACCTTCTTCGG pPZP221LpSALTbsense CCCACTATCCTTCGCAAGACC CATTTCTCTCATCGCCACCG pPZP221 LpSALTbanti CATTTCATTTGGAGAGGACACGC AAGGTTGTCGGGTTCTTCGG 15 39 EXAMPLE 7 Genetic mapping of perennial ryegrass genes involved in salt stress protection The cDNAs representing genes involved in salt stress protection were 5 amplified by PCR from their respective plasmids, gel-purified and radio-labelled for use as probes to detect restriction fragment length polymorphisms (RFLPs). RFLPs were mapped in the F 1 (first generation) population, NA 6 x AU 6 . This population was made by crossing an individual (NA 6 ) from a North African ecotype with an individual (AU 6 ) from the cultivar Aurora, which is derived from a Swiss 10 ecotype. Genomic DNA of the 2 parents and 114 progeny was extracted using the 1 x CTAB method of Fulton et al. (1995). Probes were screened for their ability to detect polymorphism using the DNA (10 pg) of both parents and 5 F 1 progeny restricted with the enzymes Dral, EcoRI, EcoRV or Hindlll. Hybridisations were carried out using the method of 15 Sharp et al. (1988). Polymorphic probes were screened on a progeny set of 114 individuals restricted with the appropriate enzyme (Figures 62, 68, 74, 80, 86, 92 and 98). RFLP bands segregating within the population were scored and the data was entered into an Excel spreadsheet. Alleles showing the expected 1:1 ratio 20 were mapped using MAPMAKER 3.0 (Lander et al. 1987). Alleles segregating from, and unique to, each parent, were mapped separately to give two different linkage maps. Markers were grouped into linkage groups at a LOD of 5.0 and ordered within each linkage group using a LOD threshold of 2.0. Loci representing genes encoding salt stress-inducible proteins, protein 25 phosphatases mediating salt adaptation in plants, plasma membrane sodium/proton antiporters, salt-associated proteins, glutathione peroxidase homologs associated with response to saline stress in plants, and early salt responding enzymes mapped to the linkage groups as indicated in Table 5 and in Figure 100. These gene locations can now be used as candidate genes for 30 quantitative trait loci associated with plant tolerance to environmental stresses and 40 osmotic stresses such as salt stress; modification of plant capacity to survive salt shocks, modification of compartmentalization of sodium in plants, for example into the plant cell vacuole, modification of sodium ion influx and/or efflux, modification of plant recovery after exposure to salt stress, and modification of plant 5 metabolism under salt stress. TABLE 5 Map locations of ryegrass genes involved in salt stress protection across two genetic linkage maps of perennial ryegrass Probe Polymorphic Mapped Locus Linkage with group

NA

6

AU

6 LpSALTa Y Dra I LpSALTa. 1 6 1 LpSALTa.2 1 LpSALTb Y Hind Ill LpSALTb 5 LpES13a Y Eco RI LpES13a LpES13b Y Eco RI LpES13b 5 LpES3d Y Hind Ill LpES3d LpES13e Y Hind Ill LpES13e 1 1 LpES13f Y Eco RV LpESl3f 1 1 LpES13g Y Eco RI LpES13g 5 5 LpESI3h Y Dra I LpES13h 5 LpLT16Aa Y Dra I LpLT16Aa 1 1 LpLT16Ab Y Hind Ill LpLT16Ab 1 1 LpLT16Ba Y Eco RV LpLT16Ba 2 LpLT16Bb Y Eco RV LpLT16Bb 2 LpWESR5a Y Eco RI LpWESR5a 2 2 LpALDPa Y Eco RI LpALDPa 4 10 41 EXAMPLE 8 Expression profiling of cDNAs encoding proteins involved in salt stress protection using microarray technology cDNAs encoding proteins involved in salt stress protection were PCR 5 amplified and purified. The amplified products were spotted on each amino-silane coated glass slide (CMT-GAPS, Corning, USA) using a microarrayer MicroGrid (BioRobotics, UK). Spotting solution was also spotted in every subgrid of the microarray as negative and background controls. Table 6 gives details on the tissues used to extract total RNA. Fluorescence 10 labelled probes were synthesis by reversed transcribing RNA and incorporating Cyanine 3 or 5 labelled dCTP. The probes were hybridised onto microarrays. In each case the experiment was repeated on two microarrays. After hybridisation for 16 hours (overnight), the microarrays were washed and scanned using a confocal laser scanner (ScanArray 3000, Packard, USA). The images obtained were 15 quantified using Imagene 4.1 (BioDiscovery, USA). Data were judged as not present (-), low expression (+), medium expression (++), high expression (+++) and highly expression (++++) (Table 7).

42 TABLE 6 List of hybridisation probes used in expression profiling of perennial ryegrass genes encoding proteins involved in salt stress protection Hybridisation probe for microarrays Organ specificity (3-months old plants Leaf blade grown hydroponically) Sheath Root Seed Seedling grown under light condition 5-day old shoot (5LS) 7-day old shoot (7LS) 10-day old shoot (1OLS) 5-day old root (5LR) 7-day old root (7LR) 10-day old root (1OLR) Seedling grown under dark condition 5-day old shoot (5DS) 7-day old shoot (7DS) 10-day old shoot (1ODS) 5-day old root (51DR) 7-day old root (7DR) 10-day old root (10DR) o + + + + + + + + + + o + + + + I + + + + + + + + ! + + + + + + + + + + + + + + + + + + + Of+ + + + C + + , + + + + , + U) + .. + + + + + UO + + + + r) + + ++ + + to a :4: + I + +::4 + to I-+ + + + + + + a~~ ++- 4 4 : 4 + + + + . to n + + ++ + + + e + + + + + + + + . + + + + + : : + + + 4 + + + a)+ + + + + : + + + + + + + -- . . . . . . . . . . . - - - -+ + - + In+ + ++ 4 + + + I + + C+ + + + + + 0 + + S++ + + + -0 Ia. i + + + + +. + + + N + + + + + + + + + + + + + + + : +ir +1 + + + + +.:4 4 + @3 + I - o + 0 0)e + : + + S + +: + +: +S + to * + + + t + + + + + + + o (5 @3 ++ + + + 4: 4 4 : + + + + + 1 cc toc < C\ C) NC, m C 'a en r- - -n0 U)C 5 Z C) 0 -~ g0 <D 0 c' , to @3 E- <fii c Ni~ - 04 > 6. ) 2) ) 0 2 2) 20 2 0 Q 0 j 10 0 4 0 = of a m C < C ) CO 0 a o a' CO) CO 0) ) - N r eco0 n - (J , 0 w) ni < mo 010 -iU .CoW 10 1- ln U -, (Dw > w 44 REFERENCES An, G., Watson, B.D., Stachel, S., Gordon, M.P., Nester, E.W. (1985) New cloning vehicles for transformation of higher plants. The EMBO Journal 4, 227-284 Feinberg, A.P., Vogelstein, B. (1984). A technique for radiolabelling DNA 5 restriction endonuclease fragments to high specific activity. Anal. Biochem. 132: 6-13. Frohman et al. (1988) Rapid production of full-length cDNAs from rare transcripts: amplification using a single gene-specific oligonucleotide primer. Proc. Natl. Acad Sci. USA 85:8998 10 Gish and States (1993) Identification of protein coding regions by database similarity search. Nature Genetics 3:266-272 Lander, E.S., Green P., Abrahamson, J., Barlow, A., Daly, M.J., Lincoln, S.E., Newburg, L. (1987). MAPMAKER: an interactive computer package for constructing primary linkage maps of experimental and natural populations. 15 Genomics 1: 174-181. Loh, E.Y., Elliott, J.F., Cwirla, S., Lanier, L.L., Davis, M.M. (1989). Polymerase chain reaction with single-sided specificity: Analysis of T-cell receptor delta chain. Science 243:217-220 Ohara, 0., Dorit, R.L., Gilbert, W. (1989). One-sided polymerase chain reaction: 20 The amplification of cDNA. Proc. Natl. Acad Sci USA 86:5673-5677 Sambrook, J., Fritsch, E.F., Maniatis, T. (1989). Molecular Cloning. A Laboratory Manual. Cold Spring Harbour Laboratory Press Schardl, C.L., Byrd, A.D., Benzion, G., Altschuler, M.A., Hildebrand, D.F., Hunt, A.G. (1987) Design and construction of a versatile system for the expression 25 of foreign genes in plants. Gene 61, 1-11 45 Sharp, P.J., Kreis, M., Shewry, P.R., Gale, M.D. (1988). Location of a-amylase sequences in wheat and its relatives. Theor. Apple. Genet. 75: 286-290. Finally, it is to be understood that various alterations, modifications and/or additions may be made without departing from the spirit of the present invention as 5 outlined herein. It will also be understood that the term "comprises" (or its grammatical variants) as used in this specification is equivalent to the term "includes" and should not be taken as excluding the presence of other elements or features. Documents cited in this specification are for reference purposes only and 10 their inclusion is not an acknowledgment that they form part of the common general knowledge in the relevant art.

Claims (25)

1. A substantially purified or isolated nucleic acid or nucleic acid fragment encoding an early salt-responding glucose-6-phosphate 1 dehydrogenase (WESR5) from a Lolium species. 5

2. A nucleic acid or nucleic acid fragment according to Claim 1, wherein said Lolium species is Lolium perenne or Lolium arundinaceum.

3. A substantially purified or isolated nucleic acid or nucleic acid fragment encoding a WESR5 protein, or complementary or antisense to a nucleic acid or nucleic acid fragment encoding a WESR5 protein, and including a 10 nucleotide sequence selected from the group consisting of (a) sequence shown in Figure 52 hereto (Sequence ID No: 126); (b) complement of the sequence recited in (a); (c) sequences antisense to the sequences recited in (a) and (b); and (d) functionally active fragments and variants of the sequences recited in (a), (b) and (c). 15

4. A nucleic acid or nucleic acid fragment according to Claim 3 wherein said functionally active fragment or variant has a sequence having at least 90% identity to the relevant part of the sequence on which the fragment or variant is based and has a size of at least 20 nucleotides.

5. A nucleic acid or nucleic acid fragment according to claim 3, wherein 20 said nucleic acid or nucleic acid fragment includes a nucleotide sequence shown in Figure 52 hereto (Sequence ID No: 126).

6. A nucleic acid or nucleic acid fragment according to any one Claims 3 to 5, wherein said nucleic acid or nucleic acid fragments is from a Lolium species. 25

7. A polypeptide encoded by a nucleic acid or nucleic acid fragment according to any one of Claims 1 to 6. 47

8. A construct including a nucleic acid or nucleic acid fragment according to any one of Claims 1 to 6.

9. A vector including a nucleic acid or nucleic acid fragment according to any one of Claims 1 to 6. 5

10. A vector according to Claim 9, further including a promoter and a terminator, said promoter, nucleic acid or nucleic acid fragment and terminator being operatively linked.

11. A plant cell, plant, plant seed or other plant part, including a construct according to Claim 8 or a vector according to Claim 9 or 10. 10

12. A plant, plant seed or other plant part derived from a plant cell or plant according to Claim 11 and including a construct according to Claim 8 or a vector according to Claim 9 or 10.

13. A method of modifying (a) plant tolerance to environmental stress and/or osmotic stress, 15 (b) plant capacity to survive salt shock, (c) compartmentalization of sodium in a plant, (d) sodium ion influx and/or efflux in a plant, (e) plant recovery after exposure to salt stress, or (f) plant metabolism under salt stress, 20 said method including introducing into said plant an effective amount of a nucleic acid or nucleic acid fragment according to any one of Claims 1 to 6, a construct according to Claim 8 and/or a vector according to Claim 9 or 10. 48

14. A method according to Claim 13, wherein said method is modifying plant tolerance to environmental stress and/or osmotic stress and said environmental stress and/or osmotic stress includes salt stress.

15. A method according to Claim 13 wherein said method is modifying 5 compartmentalization of sodium in a plant and said sodium is compartmentalized in the plant cell vacuole.

16. Use of a nucleic acid or nucleic acid fragment according to any one of Claims 1 to 6, and/or nucleotide sequence information thereof, and/or single nucleotide polymorphisms thereof as a molecular genetic marker. 10

17. A substantially purified or isolated nucleic acid or nucleic acid fragment including a single nucleotide polymorphism (SNP), from a nucleic acid or nucleic acid fragment according to any one of Claims 1 to 6.

18. A substantially purified or isolated WESR5 polypeptide from a Lolium species. 15

19. A polypeptide according to Claim 18, wherein said Lolium species is Lolium perenne or Lolium arundinaceum.

20. A substantially purified or isolated WESR5 polypeptide including an amino acid sequence shown in Figure 53 hereto (Sequence ID No: 127); or a functionally active fragment or variant thereof. 20

21. A polypeptide according to Claim 20 wherein said functionally active fragment or variant has a sequence having at least 90% identity to the relevant part of the sequence upon which the fragment or variant is based and has a size of at least 20 amino acids.

22. A polypeptide according to claim 20 wherein said polypeptide 25 includes an amino acid sequence shown in Figure 53 hereto (Sequence ID No: 127). 49

23. A polypeptide according to any one of Claims 20 to 22 wherein said polypeptide is from a Lolium species.

24. A nucleic acid or nucleic acid fragment according to Claim 1 substantially as hereinbefore described with reference to any one of the examples 5 or figures.

25. A polypeptide according to Claim 18 substantially as hereinbefore described with reference to any one of the examples or figures.