AU2008229653A1 - Screening method - Google Patents

Description

P/00/01 1 Regulation 3.2 AUSTRALIA Patents Act 1990 ORIGINAL COMPLETE SPECIFICATION STANDARD PATENT Invention Title: SCREENING METHOD Applicant: Adelaide Research & Innovation Pty Ltd and AgResearch Limited The following statement is a full description of this invention, including the best method of performing it known to me: 1 2 SCREENING METHOD PRIORITY CLAIM 5 This patent application claims priority to Australian provisional patent application 2007905334 filed 28 September 2007, the contents of which are hereby incorporated by reference. 10 FIELD OF THE INVENTION The present invention relates generally to genetic methods for identifying traits in animals. More particularly, the present invention provides methods for 15 determining the propensity of an animal to develop yellowing in a fat containing tissue or fluid. The present invention also relates to selecting animals on the basis of the propensity of an animal to develop yellowing in a fat containing tissue or fluid. 20 BACKGROUND OF THE INVENTION There are many meat traits that are considered important for determining the quality of beef, in particular, tenderness, marbling (intramuscular fat) and meat 25 colour. However, several other traits are of similar importance, as they result in the downgrading of carcasses or the rejection of carcasses from lucrative export markets, and one such trait is fat colour. Yellow fat colour is considered 3 undesirable by consumers and, consequently, Australian beef producers lose approximately AUS$18M annually because yellow carcasses are rejected. Yellow fat is caused by the accumulation of carotenoids in adipose tissues and 5 other fat depots. Carotenoids are a group of plant pigments that generate yellow, orange and red colours. The primary carotenoid that is deposited in fat depots in cattle is p-carotene. p-carotene is the most important carotenoid in terms of animal and human nutrition and plays a role in protecting tissues from oxidative damage. However, the major function of p-carotene is as a precursor 10 to vitamin A. p-carotene is converted to vitamin A by either symmetric or asymmetric cleavage. Carotenoids are not synthesized by mammals and are obtained from the diet. Hence, cattle on green feed or pastures will accumulate more carotenoids in the 15 subcutaneous and intermuscular fat compared to cattle that are grain fed. However, there is also a genetic component to the accumulation of carotenoids in fat depots. For example, certain cattle breeds, such as Jersey, tend to have a higher incidence of yellow fat than other breeds, such as Limousin and Waygu. 20 It is also possible that yellow fat may have been inadvertently selected in dairy breeds as carotenoids can be also found in milk fat (in addition to accumulating in adipose tissues). Therefore, it is possible dairy animals that were selected to produce more creamy milk or more yellow butter have a higher p-carotene concentration in their milk fat and in other fat depots. 25 DNA markers that could be used to select for or against yellow fat would be of value for beef and dairy producers. Presently, selection for fat colour is very 4 difficult because fat colour is not measured until the animal is slaughtered and the carcass can be assessed. Therefore, a diagnostic test that could identify carriers of alleles resulting in yellow fat would be very advantageous for cattle selection and breeding programs. 5 Reference to any prior art in this specification is not, and should not be taken as, an acknowledgment or any form of suggestion that this prior art forms part of the common general knowledge in any country. 10 SUMMARY OF THE INVENTION In a first aspect, the present invention provides a method for determining the propensity of an animal to develop yellowing in a fat containing tissue or fluid, 15 the method comprising screening said animal for a nucleotide sequence within any of: (i) a BCDO2 gene; (ii) a gene which is functionally equivalent to the BCDO2 gene; (iii) a regulatory sequence associated with either (i) or (ii); 20 (iv) a genetic locus in linkage disequilibrium with any of (i), (ii) or (iii); and/or (v) a transcript of any of (i), (ii), (iii) or (iv). wherein said nucleotide sequence is associated with the propensity of the animal to develop yellowing in a fat containing tissue or fluid. 25 In one embodiment, the nucleotide sequence associated with the propensity of an animal to develop yellowing in a fat containing tissue or fluid comprises: 5 (i) a nucleotide sequence associated with one or more loss-of function mutations in any of a BCDO2 gene; a gene which is functionally equivalent to a BCDO2 gene; or a regulatory sequence associated with a BCDO2 gene or functionally 5 equivalent gene; (ii) a nucleotide sequence at a genetic locus which is in linkage disequilibrium with (i); and/or (iii) a transcript of (i) or (ii); wherein said nucleotide sequence is associated with an increased propensity of 10 the animal to develop yellowing in a fat containing tissue or fluid. The method of the present invention may be applied to, among other things, selecting animals for breeding programs. As such, in a second aspect, the present invention provides the use of the method of the first aspect of the 15 invention in selecting an animal for breeding. In one embodiment, the method of the present invention is particularly applicable to determining the propensity of a bovine animal to develop yellowing in a fat containing tissue or fluid and/or the selection of bovine 20 animals for breeding. Throughout this specification, unless the context requires otherwise, the word "comprise", or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated element or integer or group of 25 elements or integers but not the exclusion of any other element or integer or group of elements or integers.

6 Nucleotide and amino acid sequences are referred to herein by a sequence identifier number (SEQ ID NO:). A summary of the sequence identifiers is provided in Table 1. A sequence listing is provided at the end of the specification. 5 TABLE 1 - Summary of Sequence Identifiers SEQ ID NO: 1 Bos taurus beta,beta-carotene 9',10'- <400> 1 dioxygenase amino acid sequence SEQ ID NO: 2 Bos taurus BCDO2 gene open reading <400>2 frame nucleotide sequence SEQ ID NO: 3 Bos taurus BCDO2 gene exon 3 <400>3 nucleotide sequence SEQ ID NO: 4 Bos taurus BCDO2 gene promoter <400> 4 sequence SEQ ID NO: 5 RFLP-PCR forward primer <400>5 SEQ ID NO: 6 RFLP-PCR reverse primer <400>6 10 DESCRIPTION OF PREFERRED EMBODIMENTS It is to be understood that the following description is for the purpose of describing particular embodiments only, and is not intended to be limiting with respect to the above description. 15 7 A number of quantitative trait loci (QTL) were mapped for cattle production traits using a Jersey x Limousin backcross. Amongst these QTL were regions controlling various phenotypes associated with fat colour. These phenotypes included subcutaneous fat colour scores taken at weaning and slaughter as well 5 as p-carotene concentration measurements from the subcutaneous fat at weaning and slaughter. Comparative mapping of these QTL against the human genome map led to the identification of a candidate gene, the beta,beta-carotene 9',10'-dioxygenase or 10 p-carotene dioxygenase gene 2 (BCDO2). Accordingly, in a first aspect, the present invention provides a method for determining the propensity of an animal to develop yellowing in a fat containing tissue or fluid, the method comprising screening said animal for a 15 nucleotide sequence within any of: (i) a BCDO2 gene; (ii) a gene which is functionally equivalent to the BCDO2 gene; (iii) a regulatory sequence associated with either (i) or (ii); (iv) a genetic locus in linkage disequilibrium with any of (i), (ii) or (iii); 20 and/or (v) a transcript of any of (i), (ii), (iii) or (iv). wherein said nucleotide sequence is associated with the propensity of the animal to develop yellowing in a fat containing tissue or fluid. 25 As set out above, the present invention contemplates "screening" an animal for a nucleotide sequence associated with the propensity of the animal to develop yellowing in a fat containing tissue or fluid. As such, the term "screening" 8 should be understood to include determining the presence, absence or copy number of the subject nucleotide sequence in an animal. In one embodiment, "screening" should be understood to include determining if an animal is homozygous for an allele comprising the subject nucleotide sequence, 5 homozygous for an allele which does not comprise the subject nucleotide sequence, or is a heterozygote comprising an allele which comprises the subject nucleotide sequence and an allele which does not. As set out above, the method of the present invention comprises screening an 10 animal for a nucleotide sequence within, among other things, a BCDO2 gene or a functionally equivalent gene. As referred to herein a "gene" should be understood to include a segment of DNA that encodes an mRNA or non-translated RNA. In one embodiment, a 15 "gene" which encodes an mRNA (and thus a protein) may include one or more protein-encoding sequence regions (eg. exons) as well as one or more non protein encoding sequence regions (eg. introns). As referred to herein, a "BCDO2 gene", or a "p-carotene dioxygenase gene 2" 20 refers to any gene which encodes a beta,beta-carotene 9',10'-dioxygenase enzyme. This enzyme asymmetrically cleaves beta-carotene at the 9',10' double bond resulting in the formation of beta-apo-10'-carotenal and beta-ionone. Besides beta-carotene, lycopene may also be oxidatively cleaved by beta,beta carotene 9',10'-dioxygenase. The apocarotenals formed by this enzyme may be 25 the precursors for the biosynthesis of retinoic acid and vitamin A.

9 Exemplary amino acid sequences defining beta,beta-carotene 9',10' dioxygenases include sequences from cattle (Bos taurus), eg. SEQ ID NO: 1; human (Homo sapiens) eg. accession AAH41656; dog (Canis familiaris); mouse (Mus musculus) eg. accession AAI07008; rat (Rattus norvegicus) eg. accession 5 AAY85350; monkey (Macaca mulatta) eg. accession XP001100991; chimpanzee (Pan troglodytes); opossum (Monodelphis domestica); fugu (Takifugu rubripes); chicken (Gallus gallus); and frog (Xenopus tropicalis) eg. accession AAH75500 The present invention may also involve screening an animal for a nucleotide 10 sequence within, among other things, a gene which is "functionally equivalent" to a BCDO2 gene. As referred to herein, a gene which is "functionally equivalent" to a BCDO2 gene should be understood to encompass any gene which encodes an enzyme that can break down or modify p-carotene into one or more compounds which are associated with reduced or absent yellowing in 15 fat containing tissues or fluids in an animal. In some embodiments, the functionally equivalent gene encodes an enzyme which is functionally equivalent to the beta,beta-carotene 9',10'-dioxygenase enzyme. As set out above, the present invention may also involve screening an animal 20 for a nucleotide sequence within a regulatory sequence associated with a BCDO2 gene or a functionally equivalent gene. A "regulatory sequence" which is associated with a BCDO2 gene or a functionally equivalent gene should be understood to include any regulatory 25 sequence that modulates at least the transcription and/or translation of a BCDO2 gene, or a functionally equivalent gene, in an animal. As such a regulatory sequence, as contemplated herein, may comprise any one or more of, 10 for example, a leader, a promoter, an enhancer or an upstream activating sequence. In one embodiment a "regulatory sequence" at least includes a promoter. A 5 "promoter" as referred to herein, encompasses any nucleic acid that confers, activates or enhances expression of an operably connected nucleotide sequence in a cell. As such, in one embodiment, the present invention contemplates screening an animal for a nucleotide sequence associated with the propensity of the animal to develop yellowing in a fat containing tissue or fluid within a 10 promoter sequence associated with a BCDO2 gene or a functionally equivalent gene. The method of the present invention also contemplates, among other things, screening an animal for a nucleotide sequence within a genetic locus which is in 15 "linkage disequilibrium" with a BCDO2 gene, a functionally equivalent gene or an associated regulatory sequence. "Linkage disequilibrium" (LD) refers to the the non-random association of alleles at two or more loci. The loci in linkage disequlibrium may be on the 20 same chromosome, but are not necessarily on the same chromosome. LD describes a situation in which some combinations of alleles or genetic markers occur more or less frequently in a population than would be expected from a random formation of haplotypes from alleles based on their frequencies. 25 In one embodiment, a genetic locus which is in "linkage disequilibrium" with a BCDO2 gene, a functionally equivalent gene or an associated regulatory sequence includes any genetic locus which is more frequently associated with 11 the BCDO2 gene, a functionally equivalent gene or an associated regulatory sequence than would be expected from a random formation of haplotypes from alleles based on their frequencies. 5 The genetic locus in linkage disequilibrium with a BCDO2 gene, a functionally equivalent gene or an associated regulatory sequence includes any nucleotide sequence present at the locus and may include, for example, a gene, a pseudogene, a non-coding nucleotide sequence, a repetitive DNA sequence (eg. a microsatellite repeat), a transposon insertion, or the like. 10 As set out above, the present invention may also comprise screening a transcript from any of a BCDO2 gene, a functionally equivalent gene, an associated regulatory sequence or genetic locus which is in linkage disequilibrium with any of the foregoing. As such, the present invention 15 contemplates both screening genomic DNA in an animal as well as screening RNA, including messenger RNA in an animal, for a nucleotide sequence associated the propensity of the animal to develop yellowing in a fat containing tissue or fluid. 20 As set out above, the presence of yellow fat in beef is considered undesirable by consumers, and carcasses with yellow fat are often heavily discounted. Presumably, consumer aversion to yellow fat is associated with the consumption of meat from old, grass fed cows. In milk production, however, the presence of yellow fat may be desirable in that it provides a more creamy 25 (and desirable) appearance to milk and butter. As such, in one embodiment, the method of the present invention may be 12 applied to determining the determining the propensity of a bovine animal to develop yellowing in a fat containing tissue or fluid. As referred to herein, "a bovine animal" includes at least all species within the 5 genus Bos, including for example Bos taurus, Bos indicus, Bos frontalis, Bos grunniens, Bos javanicus, Bos mutus and Bos sauveli, as well as hybrids of any of these species. In one embodiment, a bovine animal refers to a member of the species Bos taurus or Bos indicus or a hybrid of these species. 10 The nucleotide sequence of the coding region of the Bos taurus BCDO2 gene is set out in SEQ ID NO: 2, while the associated promoter sequence is set out in SEQ ID NO: 4. Accordingly, in one embodiment, the present invention provides a method for 15 determining the propensity of a bovine animal to develop yellowing in a fat containing tissue or fluid, the method comprising screening said bovine animal for a nucleotide sequence within a gene comprising the nucleotide sequence set forth in SEQ ID NO: 2, a functionally equivalent gene, an associated regulatory sequence or a genetic locus which is in linkage disequilibrium with any of the 20 foregoing, wherein said nucleotide sequence is associated the propensity of the bovine animal to develop yellowing in a fat containing tissue or fluid. The BCDO2 gene, or functional equivalents thereof, may also be found in many other animal species, including, for example, mammalian animals (eg. humans, 25 mice, rats, primates, dogs, and the like), fish (eg. zebrafish), amphibians, avian species, and the like. As such, the method of the present invention may also be applied to determining the propensity of any suitable animal to develop 13 yellowing in a fat containing tissue or fluid. As referred to herein, the term "animal" (including bovine animals) should be understood to refer to an animal, or any part thereof. As such, the term animal 5 includes, for example, mature animals, immature animals, animal foetuses, animal embryos, animal zygotes, animal parts, animal organs, animal tissues, animal cells, animal sperm cells, animal egg cells and the like. As set out above, the present invention is predicated, in part, on screening an 10 animal for a "nucleotide sequence ... associated with the propensity of the animal to develop yellowing in a fat containing tissue or fluid". As referred to herein, a "nucleotide sequence ... associated with the propensity of the animal to develop yellowing in a fat containing tissue or fluid" may comprise any nucleotide sequence which is associated with a particular level of yellowing in a 15 fat containing tissue or fluid in the animal, or the propensity of the animal to develop yellowing in a fat containing tissue or fluid. As such, in various embodiments of the invention the nucleotide sequence may comprise, for example, all or part of a BCDO2 gene (or functionally equivalent gene) sequence, a mutant BCDO2 gene (or functionally equivalent gene) nucleotide 20 sequence, a Single Nucleotide Polymorphism (SNP) in the BCDO2 gene (or functionally equivalent gene) sequence, a promoter sequence derived from a BCDO2 gene or functionally equivalent gene which is associated with increased, decreased or eliminated activity, a nucleotide sequence at a genetic locus that is in linkage disequilibrium with any of the above and wherein the 25 nucleotide sequence at the locus is associated with the propensity of the animal to develop yellowing in a fat containing tissue or fluid; RNA transcripts from any of the preceding sequences, and the like.

14 Specific nucleotide sequences within the BCDO2 gene, a functionally equivalent gene, an associated regulatory sequence and/or a genetic locus which is in linkage disequilibrium with any of the foregoing, which are associated with the 5 propensity of the animal to develop yellowing in a fat containing tissue or fluid ('nucleotide sequences of interest'), may be identified using any standard methods in the art. For example, the presence or absence of a nucleotide sequence of interest in the BCDO2 gene, a functionally equivalent gene, an associated regulatory sequence, a transcript thereof and/or a genetic locus 10 which is in linkage disequilibrium with any of the foregoing may be identified by, for example: (i) sequencing of a BCDO2 gene, a functionally equivalent gene, an associated regulatory sequence and/or a genetic locus which is in linkage disequilibrium with any of the foregoing to directly identify 15 the presence or absence of a nucleotide sequence of interest; (ii) amplification of all or part of a BCDO2 gene, a functionally equivalent gene, an associated regulatory sequence and/or a genetic locus which is in linkage disequilibrium with any of the foregoing, wherein the presence or absence of an amplification product is 20 indicative of the presence or absence of a nucleotide sequence of interest; (iii) an amplified fragment length polymorphism in a BCDO2 gene, a functionally equivalent gene, an associated regulatory sequence and/or a genetic locus which is in linkage disequilibrium with any of 25 the foregoing, wherein the presence of a nucleotide sequence of interest is identified by the generation of an amplification product of 15 a different size to that generated in the absence of a nucleotide sequence of interest; (iv) restriction digestion of all or part of a BCDO2 gene, a functionally equivalent gene, an associated regulatory sequence and/or a genetic 5 locus which is in linkage disequilibrium with any of the foregoing, wherein the presence or absence of a digestion product is indicative of the presence or absence of a nucleotide sequence of interest; (v) a restriction fragment length polymorphism in a BCDO2 gene, a functionally equivalent gene, an associated regulatory sequence 10 and/or a genetic locus which is in linkage disequilibrium with any of the foregoing, wherein the presence of a nucleotide sequence of interest is identified by the generation of a restriction digestion product of a different size to that generated in the absence of a nucleotide sequence of interest; 15 (vi) hybridisation of one or more nucleic acid probes to the BCDO2 gene, a functionally equivalent gene, an associated regulatory sequence, a genetic locus which is in linkage disequilibrium with any of the foregoing and/or a transcript thereof, wherein the presence or absence of the nucleotide sequence of interest is identified by the 20 binding (or absence of binding) of the one or more probes; (vii) reverse transcription of a transcript derived from a BCDO2 gene, a functionally equivalent gene, an associated regulatory sequence and/or a genetic locus which is in linkage disequilibrium with any of the foregoing, followed by any one of (i) to (vi); 25 (viii) a combination of any one or more of the above methods.

16 Exemplary published methods for the identification of nucleotide sequence variants include, for example, the methods of Oefner (journal Of Chromatography B-Analytical Technologies In The Biomedical And Life Sciences 782: 3-25, 2002) and Taylor and Day (Guide to Mutation Detection Wiley-VCH, Hoboken, NJ, 2005). 5 As would be appreciated, a vast array of other methods known in the art may also be used to identify or determine a nucleotide sequence of interest in a BCDO2 gene, a functionally equivalent gene, an associated regulatory sequence, a genetic locus which is in linkage disequilibrium with any of the foregoing 10 and/or a transcript of any of the foregoing. The nucleotide sequence associated with the propensity of an animal to develop yellowing in a fat containing tissue or fluid may occur in one or both alleles of the BCDO2 gene, a functionally equivalent gene, an associated regulatory 15 sequence and/or a genetic locus which is in linkage disequilibrium with any of the foregoing, in a subject animal. As such, an animal may be homozygous for the presence of the subject nucleotide sequence; homozygous for the absence of the subject nucleotide sequence; or a heterozygote wherein the subject nucleotide sequence is present in one allele and absent in the other allele. 20 The method of the present invention may be used to select either for or against a nucleotide sequence associated with the propensity of the animal to develop yellowing in a fat containing tissue or fluid, thus enabling selection of animals on the basis of this characteristic. 25 However, in one embodiment, the nucleotide sequence associated with the propensity of an animal to develop yellowing in a fat containing tissue or fluid 17 comprises: (i) a nucleotide sequence associated with one or more loss-of-function mutations in any of a BCDO2 gene; a gene which is functionally equivalent to the BCDO2 gene; or a regulatory sequence associated 5 with a BCDO2 gene or functionally equivalent gene; (ii) a nucleotide sequence at a genetic locus which is in linkage disequilibrium with (i); and/or (iii) a transcript of (i) or (ii); wherein said nucleotide sequence is associated with an increased propensity of 10 the animal to develop yellowing in a fat containing tissue or fluid. A "loss-of-function mutation" may be any mutation in the coding sequence of a gene (eg. BCDO2) which causes the function of the gene product (eg. the beta,beta-carotene 9',10'-dioxygenase enzyme) to be either reduced or 15 completely absent. A "loss of function" mutation may also occur in an intron sequence or regulatory sequence associated with a gene (eg. an intron sequence of the BCDO2 gene or a regulatory sequence associated with the BCDO2 gene). For example, if a mutation occurs in the promoter sequence of a gene, then the expression of the gene may be reduced or eliminated. Also, if the mutation 20 occurs in the splicing seat of an intron, then this may interfere with correct splicing of the transcribed pre-mRNA and thus reduce or eliminate the expression of the gene. In this embodiment of the invention, "a nucleotide sequence at a genetic locus 25 which is in linkage disequilibrium with (i)" should be understood to include any nucleotide sequence which is in linkage disequilibrium with the loss of function mutation present in any of a BCDO2 gene; a gene which is functionally 18 equivalent to the BCDO2 gene; or a regulatory sequence associated with a BCDO2 gene or functionally equivalent gene. In one embodiment, however, the loss-of-function mutation is in the coding 5 sequence of the BCDO2 gene, the coding sequence of a functionally equivalent gene, or a genetic locus in linkage disequilibrium with either of the foregoing. In one embodiment, wherein the animal is a bovine animal, the coding sequence of the BCDO2 gene comprises the nucleotide sequence set forth in 10 SEQ ID NO: 1. In another embodiment, the loss-of-function mutation comprises a point mutation. 15 A "point mutation" refers to any replacement of a single nucleotide with another nucleotide, or the insertion or deletion of a single base pair. In coding sequences, point mutations may include, for example: a "nonsense mutation", which introduces a stop codon and, thus, can truncate the protein; a "missense mutation", which introduces an amino acid substitution in the protein; or a 20 "frameshift mutation" wherein a nucleotide insertion or deletion causes the codons to be read in a different frame. Point mutations may also occur in non-coding sequences. For example, if the mutated base pair is in the promoter sequence of a gene, then the activity of the 25 promoter (eg. the strength, tissue specificity, inducibility etc.) may change and thus, the expression level or expression pattern of an operably connected gene may also change. Also, if the mutation occurs in the splicing seat of an intron, 19 then this may interfere with correct splicing of a transcribed pre-mRNA from the gene and thus effect the ultimate expression of the gene. In one embodiment, the point mutation comprises a nonsense mutation. 5 In another embodiment, the nonsense mutation comprises a nonsense mutation in exon 3 of the BCDO2 gene. In one embodiment, wherein the animal is a bovine animal, exon 3 of the BCDO2 gene comprises the nucleotide sequence set forth in SEQ ID NO: 3. 10 In another embodiment wherein the animal is a bovine animal, the nonsense mutation occurs at the 79th codon in the BCDO2 gene. In another embodiment wherein the animal is a bovine animal, the nonsense mutation occurs at nucleotide residue 237 in the coding sequence of the BCDO2 gene. In yet 15 another embodiment wherein the animal is a bovine animal, the nonsense mutation comprises a guanine to adenine substitution at nucleotide residue 237 of the coding sequence of the BCDO2 gene. In accordance with one embodiment of the present invention, sequencing of the 20 BCDO2 gene in 3 cattle gene mapping sires detected a mutation likely to control fat colour in cattle. The mutation is a G to A transition in exon 3 (coding nt237). This base substitution results in a nonsense mutation, changing an amino acid (tryptophan 7 9 ) into a stop codon (TGA). Given that the p-carotene dioxygenase 2 will be no longer functional as a result of this mutation, -carotene cannot be 25 converted in vitamin A via this pathway. -carotene can still be converted to vitamin A by a second pathway using the beta,beta-carotene 15,15' monooxygenase or 1-carotene dioxygenase 1 enzyme (BCDO1). However, as a 20 consequence of the mutation in BCDO2, p-carotene accumulates in the fat and, consequently, the fat appears more yellow. This hypothesis is supported by a statistical analysis that examined the 5 phenotypic differences between the G/G, G/A and A/A genotypes. The genotype at this locus explains -80% of the variance in fat colour score and p carotene concentration (see examples). Moreover, estimates of the frequency of the "A" allele correspond with estimates of the frequency of the yellow fat phenotype in Jersey cattle (again see examples). 10 Accordingly, in one embodiment, the present invention provides a method for determining the propensity of a bovine animal to develop yellowing in a fat containing tissue or fluid, the method comprising screening said bovine animal for a guanine to adenine substitution at nucleotide residue 237 of the coding 15 sequence of the BCDO2 gene, wherein said nucleotide sequence substitution is associated with increased propensity of the animal to develop yellowing in a fat containing tissue or fluid. The present invention may be applied to determining the propensity of an 20 animal to develop yellowing in any fat containing tissue or fluid. However, in one embodiment the present invention may be applied to determining the propensity of an animal to develop yellowing in adipose tissue. In another embodiment, however, the present invention may be applied to 25 determining the propensity of an animal to develop yellowing in milk. In yet another embodiment, however, the present invention may be applied to determining the propensity of an animal to develop yellowing in blood.

21 As set out above, the method of the present invention may be applied to, among other things, selecting animals for breeding programs. For example, the method of the present invention may be applied to selecting animals having a 5 desired propensity to develop yellowing in a fat containing tissue or fluid, on the basis of the presence or absence of one or more subject nucleic acid sequences in the genome of the animal. For example, animals having a relatively higher or a relatively lower propensity to develop yellowing in a fat containing tissue or fluid may be selected for breeding. The selected animals 10 may be used for breeding to produce progeny having an increased increased propensity to produce the desired level of yellowing in a fat containing tissue or fluid. As such, in a second aspect, the present invention provides the use of the 15 method of the first aspect of the invention in selecting an animal for breeding. Finally, reference is made to standard textbooks of molecular biology that contain methods for carrying out basic techniques encompassed by the present invention, including DNA restriction and ligation for the generation of the 20 various genetic constructs described herein. See, for example, Maniatis et al., Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Laboratory Press, New York, 1982) and Sambrook et al. (2000, supra). The present invention is further described by the following non-limiting 25 examples: 22 BRIEF DESCRIPTION OF THE FIGURES Figure 1 is a photographic representation of an electrophoresis gel showing the DNA fragment sizes generated by RFLP of an amplified fragment -of the 5 BCDO2 gene in "normal" homozygote cattle (GG genotype), heterozygote cattle (GA genotype) and "mutant" homozygote cattle (AA genotype). EXAMPLE 1 10 General Trial Design The trial design involved two of the more extreme Bos taurus dam breeds, Jersey (J) and Limousin (L), mated to first cross (JxL or LxJ) sires to produce back-cross calves. A total of about 400 heifer and steer progeny were generated in 3 F1 sire 15 half-sib families and born as three calf crops (born 1996-98) with a total of 358 records available for analysis. EXAMPLE 2 20 Animal measurements Calves were weaned at approximately 8 months of age, and raised on pasture for a further 12 months. The animals were then transported to an intensive feeding facility and fed a grain ration for a minimum of 180 days. Live animal 25 measurements (eg. weight, height, girth, eye muscle area, fat depth) were taken every 30-50 days throughout their lifetime. Animals were slaughtered after 23 grain finishing, and various carcass and meat quality traits were measured (eg. carcass weight, fat depth, eye muscle area, fatty acid composition, tenderness). In addition, at weaning, a subcutaneous fat sample was removed from the eye 5 muscle area. The fat was scored for colour on a scale of 1-5 (where 1 is white fat and 5 is intense yellow fat). The p-carotene concentration of the fat was also determined (Rg/g fat) by extracting the carotenoids from the fat with hexane and quantifying the p-carotene spectrophotometrically or by high performance liquid chromatography. Fat colour score and p-carotene concentration were also 10 determined on subcutaneous fat samples taken from the carcasses after slaughter using the method of Kruk (University of Adelaide PhD thesis, 2001). EXAMPLE 3 15 Genotyping CRI-MAP (Version 2.4, Washington University School of Medicine, St. Louis MO) was used to detect any errors in the genotyping of the cattle and to confirm marker order in the linkage maps. Non-Mendelian inheritance is 20 detected when CRI-MAP analyses the pedigree and genotype data file (*.gen file). However, errors in genotyping do not always lead to non-Mendelian inheritance (the perceived error rate is less than the true error rate) so once the linkage map was built and confirmed with the published map (Bovine ArkDB; http://texas.thearkdb.org/browser?species=cow; accessed 20th January 2002), 25 the chrompic function of CRI-MAP was used. The chrompic function finds the maximum likelihood estimates of the recombination fractions of the specified locus order; these estimates are then used to find the particular phase for each 24 sire family and the grand-parental and grand-maternal phases. Chrompic also gives the number of recombination events. Any individuals with double or triple recombination events were carefully examined for genotyping or pedigree errors, as double recombinations are unlikely when markers are 5 spaced at 20cM intervals. Sire-derived alleles were determined for a total of 253 informative microsatellite loci (an average of 185 loci per sire group) spread across all bovine autosomes (BTA), using radioactive PAGE for each animal. Each gel was independently 10 scored twice. There were 3-9 markers typed per chromosome for the 29 autosomes, at approximately 20cM intervals. The 3 F1 sires were genotyped to ensure they were heterozygous with the alleles coded "A" and "B". Thus, progeny inherited either an "A" or "B" allele from their sire. The genotypes of the progeny were coded AA, AB, BB, AC, BC with the "C" representing any 15 other allele. In addition, 43 SNP markers in 22 candidate genes were genotyped by primer extension. The MARC97 marker locations were used for the linkage analysis and for candidate genes not on the MARC map, locations were based on CRIMAP analyses. 20 EXAMPLE 4 Statistical analysis Genotype probabilities were calculated using QTL Express (Seaton et al. 25 Bioinformatics 18: 339-340, 2002; http://qtl.cap.ed.ac.uk ; accessed November 2002 then regularly during 2004-5) for every 1cM on each chromosome. Animals were assigned a value of either 0 (which represents the "A" allele) or 1 ("B" 25 allele) or 0.5 if uninformative. The genotype probability was then calculated between 0.5 and 1, depending on the level of confidence. Phenotypes were regressed against the genotype probabilities for every chromosome using "Haley and Knott regression" (Haley and Knott, Heredity 69: 312-324, 1992). 5 Cohort (combination of sex and year) and breed of dam (Jersey or Limousin) were included as factors in the model and the regression was nested within sire. Additional models that included two QTL or QTL by breed of dam interactions were also tested for a number of traits. Experiment-wise threshold values were calculated according to Lander and Kruglyak (Nature Genetics 11: 241-247, 1995). 10 EXAMPLE 5 Comparative candidate gene mapping 15 Based on the location of the QTL and the known metabolism of carotenoids in cattle, several candidate genes were chosen for further study. One of these candidate genes was the beta,beta-carotene 9',10'-dioxygenase o.r p-carotene dioxygenase gene 2 (BCDO2). This gene is involved in a minor pathway in which p-carotene is cleaved to form vitamin A (retinoic acid). To identify any 20 DNA variants that might be present in this gene and thus, result in yellow fat colour, the genomic DNA from the gene mapping sires was sequenced using the method of Wang et al. (Science 260: 1077-1082, 1998). Primers were designed to amplify the coding regions (exons) of the BCD02 25 gene, the 5' and 3' untranslated regions, and part of the promoter of the BCDO2 gene using standard methodologies. The target regions were then PCR 26 amplified from the genomic DNA of the 3 F1 sires. The sequences of the amplified regions were then determined and analysed for DNA variants. 5 EXAMPLE 6 Genotyping DNA variants A DNA single base nucleotide variant (G to A substitution) was discovered at nucleotide residue 237 of the coding sequence of the BCDO2 gene, which 10 results in the conversion of a tryptophan codon to a stop codon. This nonsense mutation leads to the production of a non-functional BCDO2 protein and hence, the enzyme would be unable to cleave p-carotene. As a result, the P-carotene accumulates in at least the adipose tissue and the fat 15 would appear yellow in colour. To verify that this mutation was functional, the progeny and dams from the mapping herd with fat colour scores and. p-carotene measurements were genotyped for this base change. 20 The genotyping was performed by restriction-fragment length polymorphism polymerase chain reaction (RFLP-PCR) based on the method of Gu et al. (Biotech. 24: 836-837, 1998). A 500 base pair segment of DNA was amplified by PCR with the nonsense mutation located roughly in the middle of the segment. 25 The primers used for the RFLP-PCR are shown below: RFLP-PCR forward primer: 5' AACCCATCCCACTTCCTTATC 3' (SEQ ID NO: 5) 27 RFLP-PCR reverse primer: 5' GCTGAAATCAAACCCCAAAG 3' (SEQ ID NO: 6) The amplicons were digested with the restriction enzyme BsrI and resulting products separated by gel electrophoresis. An exemplary electrophoresis gel is 5 shown in Figure 1. Since the nonsense mutation removes the BsrI restriction site present in the normal sequence, the restriction pattern differs between the normal homozygote, the heterozygote and mutant homozygote genotypes. The fragments RFLP fragment sizes generated in this experiment for each of the genotypes are shown in Table 2. Thus, the genotypes can be readily 10 distinguished. There is a second BsrI restriction site present within all amplicons, and this was used as a positive control for the restriction digestion. Table 2 - RFLP fragment sizes 392bp* 392bp* 392bp* Fragments 112bp 133bp 133bp 21 bp 112bp 21 bp * The 392 bp band is a constant band that serves as a control. If the restriction 15 enzyme failed to cleave, then this band would be larger. EXAMPLE 7 Genotyping analysis 20 The genotypes were analysed statistically using analysis of variance to determine if there was a correlation between fat colour score and the mutation genotype and a correlation between p-carotene concentration and the mutant 28 genotype. In addition, statistical analysis was used to find any correlations between the mutant genotype and live animal traits, carcass traits and meat quality traits. 5 Table 3 - Frequency of genotypes in three breed combinations of cattle Purebred Jersey (100% Jersey) 6 40 78 124 Jersey backcross (75% Jersey) 4 55 142 201 Limousin backcross (25% Jersey) 0 31 130 161 Total 10 126 350 486 Purebred animals were mature cows whereas backcross animals were calves of approximately 250 days of age. As would be expected, the variation in p carotene values was much larger in the cows than in calves. Thus, they were 10 log-transformed before analysing. This transformation was not necessary for the fat colour score data. Results of the analysis including only the significant effects are presented in Tables 4 and 5 with least-squares means presented in Table 6. Median p-carotene concentrations for each group can be obtained by back-transforming the least squares means of log(P-carotene). 15 Table 4 - Analysis of variance of log(p-carotene concentration) + breed 2 355.7687 177.8843 566.39 <.001 + eno e 2 3.0160 1.5080 4.80 0.009 29 Residual 478 150.1249 0.3141 Total 482 508.9096 1.0558 Table 5 - Analysis of variance of fat colour + breed 2 324.8253 162.4127 289.73 <.001 + genotype 2 15.9445 7.9723 14.22 <.001 Residual 478 267.9547 0.5606 Total 482 608.7246 1.2629 Table 6 - Least squares means for breed and genotype effects Breed JJJJ 1.9723±0.0508 3.8007±0.0678 XJ 0.1242±0.0397 2.2300±0.0531 XL -0.0583±0.0447 1.8059±0.0597 Genotype AA 1.0593±0.1787 3.6203±0.2388 GA 0.5711±0.0301 2.6121±0.0676 GG 0.5116±0.0301 2.4180±0.0402 5 As shown above, Jersey cattle (which had the highest incidence of the "A" or mutant BCDO2 allele) had the highest fat colour score (most yellow). Furthermore, animals having the "AA" or mutant homozygote genotype had substantially higher fat colour score than animals having the "GA" or 30 heterozygote genotype, which in turn had higher fat colour score than animals having the "GG" or normal homozygote genotype. Those skilled in the art will appreciate that the invention described herein is 5 susceptible to variations and modifications other than those specifically described. It is to be understood that the invention includes all such variations and modifications. The invention also includes all of the steps, features, compositions and compounds referred to, or indicated in this specification, individually or collectively, and any and all combinations of any two or more of 10 the steps or features. Also, it must be noted that, as used herein, the singular forms "a", "an" and "the" include plural aspects unless the context already dictates otherwise. Thus, for example, reference to "a nucleotide sequence" includes a single nucleotide 15 sequence as well as two or more nucleotide sequences; "an animal" includes a single animal as well as two or more animals; and so forth.

Claims (16)

1. A method for determining the propensity of an animal to develop yellowing in a fat containing tissue or fluid, the method comprising screening 5 said animal for a nucleotide sequence within any of: (i) a BCDO2 gene; (ii) a gene which is functionally equivalent to the BCDO2 gene; (iii) a regulatory sequence associated with either (i) or (ii); (iv) a genetic locus in linkage disequilibrium with any of (i), (ii) or (iii); 10 and/or (v) a transcript of any of (i), (ii), (iii) or (iv). wherein said nucleotide sequence is associated with the propensity of the animal to develop yellowing in a fat containing tissue or fluid. 15

2. The method of claim 1 wherein the nucleotide sequence associated with the propensity of an animal to develop yellowing in a fat containing tissue or fluid comprises: (i) a nucleotide sequence associated with one or more loss-of-function mutations in any of a BCDO2 gene; a gene which is functionally 20 equivalent to the BCDO2 gene; or a regulatory sequence associated with a BCDO2 gene or functionally equivalent gene; (ii) a nucleotide sequence at a genetic locus which is in linkage disequilibrium with (i); and/or (iii) a transcript of (i) or (ii); 25 wherein said nucleotide sequence is associated with an increased propensity of the animal to develop yellowing in a fat containing tissue or fluid. 32

3. The method of claim 2 wherein said loss-of-function mutation comprises a point mutation. 5

4. The method of claim 3 wherein said point mutation comprises a nonsense mutation.

5. The method of any one of claims 1 to 4 wherein said animal is a bovine animal. 10

6. The method of claim 5 wherein said BCDO2 gene comprises the nucleotide sequence set forth in SEQ ID NO: 2.

7. The method of any one of claims 2 to 6 wherein said loss of function 15 mutation comprises a mutation in exon 3 of the BCDO2 gene.

8. The method of claim 7 wherein said loss of function mutation comprises a nonsense mutation at the 79th codon in the BCDO2 gene. 20

9. The method of claim 8 wherein said nonsense mutation occurs at nucleotide residue 237 in the coding sequence of the BCDO2 gene.

10. The method of claim 9 wherein said nonsense mutation comprises a guanine to adenine substitution at nucleotide residue 237 of the coding 25 sequence of the BCD02 gene.

11. A method for determining the propensity of a bovine animal to develop 33 yellowing in a fat containing tissue or fluid, the method comprising screening said bovine animal for a guanine to adenine substitution at nucleotide residue 237 of the coding sequence of the BCDO2 gene, wherein said nucleotide sequence substitution is associated with an increased propensity of the animal 5 to develop yellowing in a fat containing tissue or fluid.

12. The method of any one of claims 1 to 11 wherein said fat-containing tissue or fluid comprises adipose tissue. 10

13. The method of any one of claims 1 to 11 wherein said fat-containing tissue or fluid comprises milk.

14. The method of any one of claims 1 to 11 wherein said fat-containing tissue or fluid comprises blood. 15

15. Use of the method of any one of claims 1 to 14 in selecting an animal for breeding.

16. The method of any one of claims 1 to 14 or the use of claim 15, 20 substantially as described herein with reference to any of the figures or examples.