AU2008203549A1 - Feline polynucleotide vaccine formula - Google Patents

Description

o0 0

AUSTRALIA

FB RICE CO Parent and Trade Mark Attorneys Patents Act 1990 MERIAL LTD COMPLETE SPECIFICATION STANDARD PATENT Invention Title: Feline polynucleotide vaccine formula The following statement is a full description of this invention including the best method of performing it known to us:- 00 la

O

CN FELINE POLYNUCLEOTIDE VACCINE FORMULA This is a divisional of AU2004205140, the entire contents of which are incorporated 00 herein by reference.

O

The present invention relates to a vaccine formula allowing the vaccination of cats against a number of pathologies. It also relates to a corresponding method of Svaccination.

C(f Associations of vaccines against certain canine viruses have already been Sproposed in the past.

0 10 The associations developed so far were prepared from inactivated vaccines or Slive vaccines and, option ally, mixtures of such vaccines. Their development poses problems of compatibility between valencies and of stability. It is indeed necessary to ensure both the compatibility between the different vaccine valencies, whether from the point of view of the different antigens used or from the point of view of the formulations themselves, especially in the case where both inactivated vaccines and live vaccines are combined. The problem of the conservation of such combined vaccines and of their safety especially in the presence of an adjuvant also exists. These vaccines are in general quite expensive.

Patent ApplicationsWO-A-90 11092, WO-A-93 19183, WO-A-94 21797 and WO-A-95 20660 have made use of the recently developed technique of polynucleotide vaccines. It is known that these vaccines use a plasmid capable of expressing, in the host cells, the antigen inserted into the plasmid. All the routes of administration have been proposed (intraperitoneal, intravenous, intramuscular, transcutaneous, intradermal, mucosal and the like). Various vaccination means can also be used, such as DNA deposited at the surface of gold particles and projected so as to penetrate into the animals' skin (Tang et al., Nature 356, 152-154, 1992) and liquid jet injectors which make it possible to transfect at the same time the skin, the muscle, the fatty tissues and the mammary tissues (Furth et al., Analytical Biochemistry, 205, 365-368, 1992).

The polynucleotide vaccines may also use both naked DNAs and DNAs formulated, for example, inside 40 cationic lipids or liposomes.

208206 1.doc 00 O0 S-2- SIn a first aspect, the invention resides in a vaccine 00 formula for cats comprising a plasmid containing env and/or gag/pol gene from feline leukaemia virus (FeLV), or a fragment of such gene retaining the capacity to induce a C 5 protective response, and a suitable vehicle. The plasmid may M contain both env and gag/pol genes.

00 SThe plasmid may contain the env gene and the vaccine may comprise another plasmid containing the gag/pol gene. The plasmid may contain a CMV-IE promoter.

The plasmid may contain a promoter chosen among the group consisting of early SV40 virus promoter, late virus promoter and Rous sarcoma LTR promoter.

The plasmid may contain a promoter of a cytoskeleton gene, e.g. the desmin promoter or the actin promoter.

The vaccine formula may comprise from 10 ng to 1 mg, preferably 100 ng to 500 pg and more preferably 1 pg to 250 pg of plasmid.

In a further aspect, the invention may provide a vaccine formula combining different valencies while exhibiting all the criteria required for mutual compatibility and stability of the valencies.

In yet a further aspect, the vaccine formula may make it possible to combine different valencies in the same vehicle.

00 D -2A-

(N

SPreferably the vaccine is easy and inexpensive to 00 use.

h A preferred embodiment may provide a method for vaccinating cats which makes it possible to obtain Sprotection, perhaps even multivalent protection, with a high 00 level of efficiency and of long duration, as well as good 9 safety.

In one aspect of the present invention there is provided a vaccine formula intended for cats comprising at least three polynucleotide vaccine valencies each comprising a plasmid integrating, so as to express it in vivo in the host cells, a gene with one feline pathogen valency, these valencies being selected from those of the group consisting of feline leukaemia virus (FeLV), panleukopenia virus (FPV), infectious peritonitis virus (FIPV), coryza virus

(FHV),

calicivirosis virus (FCV), feline immunodeficiency virus (FIV) and possibly rabies virus (rhabdovirus). the plasmids comprising, for each valency, one or more of the genes selected from the group consisting of env and gag/pol for the feline leukaemia, VP2 for the panleukopenia, modified

S

(or and M for the infectious peritonitis, gB and gD for the coryza, capsid for the calicivirosis, env and gag/pro for the feline immunodeficiency and G for the rabies.

Valency in the present invention is understood to mean at least one antigen providing protection 3- 00 against the virus for the pathogen considered, it being possible for the valency to contain, as subvalency one SOr more modified a s s u b v a l e n c y o n e or more modified or natural genes from one or more strains of the pathogen considered.

at hogen coniiered Pathogenic agent gene is understood to mean not 00only the complete gene but also the various nucleotide sequences, including fragments which retain the capacity to induce a protective response. The notion of a g gene covers the nucleotide sequences equivalent to those described precisely in the examples that is to 00 say the sequences which are different but which encode Sthe same protein. It also covers the nucleotide Ssequences of other strains of the pathogen considered, which provide cross-protection or a protection specific for a strain or for a strain group. It also covers the nucleotide sequences which have been modified in order to facilitate the in vive been odified in order to facilitate the in vivo expression by the host animal but encoding the same protein.

Preferably, the vaccine formula according to the invention comprises the panleukopenia, coryza and calicivirosis valencies.

It will be possible to add the feline leukaemia, feline immunodeficiency and/or infectious peritonitis valencies.

As regards the coryza valency, it is preferable to use the two genes coding for gB and gD, in different plasmids or in one and the same plasmid, or to use either of these genes.

For the feline leukaemia valency, use is prefnto30 erably made of the two env and gag/pol genes integrated into two different plasmids or into one and the same plasmid, or the env gene alone.

For the feline immunodeficiency valency, use will preferably be made of the two env and gag/pro genes in different plasmids or in one and the same plasmid, or only one of these genes. Still more preferably, the FeLV-A env gene and the FeLV-A and FeLV-B env genes are used.

00 For the infectious peritonitis valency, use is Spreferably made of the two M and modified S genes together in two different plasmids or in one and the Ssame plasmid, or either of these genes. S will be modified in order to make the major facilitating 0 epitopes inactive, preferably according to the teaching of Patent PCT/FR95/01128.

C The vaccine formula according to the invention q 1 can be presented in a dose volume of between 0.1 and M 10 3 ml and in particular between 0.5 and 1 ml.

00 The dose will be generally between 10 ng and 1 mg, preferably between 100 ng and 500 gg and still more (C preferably between 1 ig and 250 pg per plasmid type.

Use will preferably be made of naked plasmids simply placed in the vaccination vehicle which will be in general physiological saline NaC1), ultrapure water, TE buffer and the like. All the polynucleotide vaccine forms described in the prior art can of course be used.

Each plasmid comprises a promoter capable of ensuring the expression of the gene inserted, under its control, into the host cells. This will be in general a strong eukaryotic promoter and in particular a cytomegalovirus early CMV-IE promoter of human or murine origin, or optionally of another origin such as rats, pigs and guinea pigs.

More generally, the promoter may be either of viral origin or of cellular origin. As viral promoter, there may be mentioned the SV40 virus early or late promoter or the Rous sarcoma virus LTR promoter. It may also be a promoter from the virus from which the gene is derived, for example the gene's own promoter.

As cellular promoter, there may be mentioned the promoter of a cytoskeleton gene, such as for example the desmin promoter (Bolmont et al., Journal of Submicroscopic Cytology and Pathology, 1990, 22, 117-122; and Zhenlin et al., Gene, 1989, 78, 243-254), or alternatively the actin promoter.

S00 When several genes are present in the same plasmid, these may be presented in the same transcription C1 unit or in two different units.

The combination of the different vaccine valencies according to the invention may be preferably 00 achieved by mixing the polynucleotide plasmids expressing the antigen(s) of each valency, but it is also possible to envisage causing antigens of several valencies to be expressed by the same plasmid.

M 1 0 The subject of the invention is also monovalent N vaccine formulae comprising one or more plasmids encod- 0 ing one or more genes from one of the viruses above, the genes being those described above. Besides their monovalent character, these formulae may possess the characteristics stated above as regards the choice of the genes, their combinations, the composition of the plasmids, the dose volumes, the doses and the like.

The monovalent vaccine formulae may also be used for the preparation of a polyvalent vaccine formula as described above, (ii) individually against the actual pathology, (iii) combined with a vaccine of another type (live or inactivated whole, recombinant, subunit) against another pathology, or (iv) as booster for a vaccine as described below.

The subject of the present invention is in fact also the use of one or more plasmids according to the invention for the manufacture of a vaccine intended to vaccinate cats first vaccinated by means of a first conventional vaccine (monovalent or multivalent) of the type in the prior art, in particular, selected from the group consisting of a live whole vaccine, an inactivated whole vaccine, a subunit vaccine, a recombinant vaccine, this first vaccine having (that is to say containing or capable of expressing) the antigen(s) encoded by the plasmid(s) or antigen(s) providing cross-protection.

Remarkably, the polynucleotide vaccine has a potent booster effect which results in an amplification of the immune response and the acquisition of a longlasting immunity.

00 In general, the first-vaccination vaccines can be selected from commercial vaccines available from various veterinary vaccine producers.

.The subject of the invention is also a vaccination kit grouping together a first-vaccination vaccine 0as described above and a vaccine formula according to the invention for the booster. It also relates to a vaccine formula according to the invention accompanied by a I 0 leaflet indicating the use of this formula as a booster for a first vaccination as described above.

0' The subject of the present invention is also a Smethod for vaccinating cats, comprising the administra- (N tion of an effective vaccine formula as described above.

This vaccination method comprises the administration of one or more doses of the vaccine formula, it being possible for these doses to be administered in succession over a short period of time and/or in succession at widely spaced intervals.

The vaccine formulae according to the invention can be administered in the context of this method of vaccination, by the different routes of administration proposed in the prior art for polynucleotide vaccination and by means of known techniques of administration.

The subject of the invention is also the method of vaccination consisting in making a first vaccination as described above and a booster with a vaccine formula according to the invention.

In a preferred embodiment of the process according to the invention, there is administered in a first instance, to the animal, an effective dose of the vaccine of the conventional, especially inactivated, live, attenuated or recombinant, type, or alternatively a subunit vaccine, so as to provide a first vaccination, and, after a period preferably of 2 to 6 weeks, the polyvalent or monovalent vaccine according to the invention is administered.

The efficiency of presentation of the antigens to the immune system varies according to the tissues.

In particular, the mucous membranes of the respiratory 00 00

CA

0 in Cm 0g -7 tree serve as barrier to the entry of pathogens and ar associated with lymphoid tissues which support local immunity. The administration of a vaccine by contact with the mucous membranes, in particular the buccal mucous membrane, the pharyngeal mucous membrane and the mucous membrane of the bronchial region is certainly of interest for vaccination against respiratory and digestive pathologies.

Consequently, the mucosal routes of administra- 10 tion form part of a preferred mode of administration for the invention, using in particular nebulization or spray or drinking water. It will be possible to apply the vaccine formulae and the vaccination methods according to the invention in this context.

The invention also relates to the method of preparing the vaccine formulae, namely the preparation of the valencies and mixtures thereof, as evident from this description.

The invention will now be described in greater detail with the aid of the embodiments of the invention taken with reference to the accompanying drawings.

List of figures Figure No.

Figure No.

Figure No.

Figure No.

Figure No.

Figure No. 6: Figure No. 7: Figure No. 8: Figure No. 9: Figure No. 10: Figure No. 11: Figure No. 12: Figure No. 13: Figure No. 14: Figure No. 15: Plasmid pVR1012 Plasmid pPB179 Sequence of the FeLV-B env gene Plasmid pPB180 Sequence of the FeLV-A virus gag/pol gene (Glasgow-i strain) Plasmid pPB181 Plasmid pAB009 Plasmid pAB053 Plasmid pAB052 Plasmid pAB056 Plasmid pAB028 Plasmid pAB029 Plasmid Plasmid pAB030 Plasmid pAB083 00 00 -8- Figure No. 16: Plasmid PABO41 Sequence listing SEQ ID) No.

SEQ -ID No.

SEQ ID No.

SEQ ID No.

SEQ ID No.

SEQ ID No.

SEQ ID No.

SEQ ID No.

SEQ ID No.

1 2 3: 4: 5: 6: 7: 8: Oligonucleotide PB247 Oligonucleotide PB249 Oligonucleotide PB281 Oligonucleotide PB282 Sequence of the FeLV-B virus env gene Oligonucleotide PB283 Oligonucleotide PB284 Sequence of the FeLV-A virus gag/pol gene (Glasgow-1 strain) Oligonucleotide AB021.

Oligonucleotide A3024 Oligonucleotide AB103 Oli.gonucleotide AB112 Oligonuclebtide AB113 Oligonucleotide AB104 Oligonucleotide AB101 Oligonucleotide AB102 Oligonucleotide AB106

SEQ

SEQ

SEQ

SEQ

SEQ

SEQ

SEQ

SEQ

SEQ

II

it

ID

ID

ID

ID

ID

ED

)No.

No.

No.

No.

No.

No.

No.

No.

No.

9: 10: 11: 12: 13: 14: 15: 16: SEQ ID No.

18: Oligonucaeotide ABI07

SEQ

SEQ

SEQ

SEQ

SEQ

SEQ

SEQ

sEQ:

SEQ

SEQ3 SEQ I SEQ Iz

ID

ID

ID

ID

ID

ED

rD No No.

No.

No.

No.

No.

No.

No.

No.

No.

*19: 20: 21: 22: 23: 24: 25: 26: 27: 28: 29: 30: Oligonucleo tide Oligonucleotide Oligonucleotide Oligonucleotide Oligonucleotide Oligonucleotide Oligonucleotide Oligonucleotjde Oligonucleotide Oligonucleotide AB 061 AB 064 AB065 AB 066 ABO2 ABO 26 AB 067 AJ3070 kB 154 ~D No.

D No.

Oligonucleotide ABOll Oligonucleotide AB012 9

EXAMPLES

00 D Example 1: Culture of the viruses The viruses are cultured on the appropriate cellular system until a cytopathic effect is obtained. The Scellular systems to be used for each virus are well Sknown to persons skilled in the art. Briefly, the cells sensitive to the virus used, which are cultured in Eagle's minimum essential medium (MEM medium) or another appropriate medium, are inoculated with the viral strain Sstudied using a multiplicity of infection of 1. The in- 00 fected cells are then incubated at 37 0 C for the time necessary for the appearance of a complete cytopathic effect (on average 36 hours).

Example 2: Extraction of the viral genomic DNAs: After culturing, the supernatant and the lysed cells are harvested and the entire viral suspension is centrifuged at 1000 g for 10 minutes at +4 0 C so as to remove the cellular debris. The viral particles are then harvested by ultracentrifugation at 400,000 g for 1 hour at +4 0 C. The pellet is taken up in a minimum volume of buffer (10 mM Tris, 1 mM EDTA). This concentrated viral suspension is treated with proteinase K (100 pg/ml final) in the presence of sodium dodecyl sulphate

(SDS)

final) for 2 hours at 37 0 C. The viral DNA is then extracted with a phenol/chloroform mixture and then precipitated with 2 volumes of absolute ethanol. After leaving overnight at -20°C, the DNA is centrifuged at 10,000 g for 15 minutes at +4 0 C. The DNA pellet is dried and then taken up in a minimum volume of sterile ultrapure water. It can then be digested with restriction enzymes.

Example 3: Isolation of the viral genomic RNAs The RNA viruses were purified according to techniques well known to persons skilled in the art. The genomic viral RNA of each virus was then isolated using the "guanidium thiocyanate/phenol-chloroform" extraction 10 technique described by P. Chomczynski and N. Sacchi 00 (Anal. Biochem., 1987, 162, 156-159) 0 b Example 4: Molecular biology techniques

S

All the constructions of plasmids were carried out using the standard molecular biology techniques Sdescribed by J. Sambrook et al. (Molecular Cloning:

A

Laboratory Manual, 2nd Edition, Cold Spring Harbor SLaboratory, Cold Spring Harbor, New York, 1989). All the 3 10 restriction fragments used for the present invention Swere isolated using the "Geneclean" kit (BIO 101 Inc. La 00 Jolla, CA). 0 (c Example 5: RT-PCR technique Specific oligonucleotides (comprising restriction sites at their 5' ends to facilitate the cloning of the amplified fragments) were synthesized such that they completely cover the coding regions of the genes which are to be amplified (see specific examples). The reverse transcription (RT) reaction and the polymerase chain reaction (PCR) were carried out according to standard techniques (Sambrook J. et al., 1989). Each RT-PCR reaction was performed with a pair of specific amplimers and taking, as template, the viral genomic RNA extracted.

The complementary DNA amplified was extracted with phenol/chloroform/isoamyl alcohol (25:24:1) before being digested with restriction enzymes.

Example 6: plasmid pVR1012 The plasmid pVR 1 012 (Figure No. 1) was obtained from Vical Inc., San Diego, CA, USA. Its construction has been described in J. Hartikka et al. (Human Gene Therapy, 1996, 7, 1205-1217).

Example 7: Construction of the plasmid pPB179 (FeLV-A virus env gene) An RT-PCR reaction according to the technique of Example 5 was carried out with feline leukaemia virus (FeLV-A) (Glasgow-1 strain) genomic RNA Stewart et 11 al.: J. Virol. 1986. 58. 825-834), prepared according to 00 th prepared according t the technique of Example 3, and with the following oligonucleotides: DD PB247 (29 mer) (SEQ ID No. 1) 5'TTTGTCGACCATGGAAAGTCCAACGCACC3' OO PB249 (28 mer) (SEQ ID No. 2) 5'TTTGGATCCTCATGGTCGGTCCGGATCG3' so as to amplify a 1947 bp fragment containing the gene Sencoding the Env glycoprotein from the FeLV-A virus (Glasgow-i strain) in the form of a SalI-BamHI frag- Sment. After purification, the RT-PR product was 00 digested with SalIl and BamHI in order to give a 1935 bp SalI-BamHI fragment.

This fragment was ligated with the vector pVR1012 (Example previously digested with Sall and BamHI, to give the plasmid pPB179 (6804 bp) (Figure No. 2).

Example 8: Construction of the plasmid pPB180 (FeLV-B virus env gene) An RT-PCR reaction according to the technique of Example 5 was carried out with feline leukaemia virus (FeLV-B subtype) genomic RNA, prepared according to the technique of Example 3, and with the following oligonucleotides: PB281 (29 mer) (SEQ ID No. 3) 5'TTTGTCGACATGGAAGGTCCAACGCACCC3' PB282 (32 mer) (SEQ ID No. 4) S'TTGGATCCTCATGGTCGGTCCGGATCATATTG3' so as to amplify a 2005 bp fragment containing the gene encoding the Env glycoprotein from the FeLV-B virus (Figure No. 3 and SEQ ID No. 5) in the form of a SalI- BamHI fragment. After purification, the RT-PCR product was digested with Sall and BamHI in order to give a 1995 bp SalI-BamHI fragment.

This fragment was ligated with the vector pVR1012 (Example previously digested with Sall and BamHI, to give the plasmid pPB180 (6863 bp) (Figure No. 4).

12 Example 9: Construction of the plasmid pPB181 (FeLV 00 gag/pol gene) An RT-PCR reaction according to the technique of Example 5 was carried out with the feline leukaemia virus (FeLV-A subtype) (Glasgow-l strain) genomic

RNA,

OO prepared according to the technique of Example 3, and with the following oligonucleotides: PB283 (33 mer) (SEQ ID No. 6) RT 5'TTGTCGACATGTCTGGAGCCTCTAGTGGGACAG3' 10 PB284 (42 mer) (SEQ ID No. 7) 0 5'TTGGATCCTTATTTAATTACTGCAGTTCCAAGGAACTCTC3' 00 so as to amplify a 3049 bp fragment containing the Ssequence encoding the Gag protein and the 5' part of the sequence encoding the Pol protein from the FeLV-A virus (Glasgow-i strain) (Figure No. 5 and SEQ ID No.

8) in the form of a SalI-BamHI fragment. After purification, the RT-PCR product was digested with Sall and BamHI to give a 3039 bp SalI-BamHI fragment.

This fragment was ligated with the vector pVR1012 (Example previously digested with SalI and BamHI, to give the plasmid pPB181 (7908 bp) (Figure No. 6).

Example 10: Construction of the plasmid pAB009 (FPV VP2 gene) A PCR reaction was carried out with the feline panleukopaenia virus (193 strain) genomic

DNA

Martyn et al., J. Gen. Virol. 1990, 71. 2747- 2753), prepared according to the technique of Example 2, and with the following oligonucleotides: AB021 (34 mer) (SEQ ID No. 9) 5'TGCTCTAGAGCAATGAGTGATGGAAGCAGTTCAAC3' AB024 (33 mer) (SEQ ID No. 5'CGCGGATCCATTAATATAATTTTCTAGGTGCTA3' so as to amplify a 1776 bp fragment containing the gene encoding the FPV VP2 capsid protein. After purification, the PCR product was digested with XbaI and BgmeamHI in order to give a 1764 bp XbaI-BamHI fragment.

13 0 This fragment was ligated with the vector pVR1012 (Example previously digested with Xbal and BamHI, to give the plasmid pAB009 (6664 bp) (Figure 0 No:- 7) 00 Example 11: Construction of the plasmid pAB053 (FIPV S* gene) An RT-PCR reaction according to the technique of Example 5 was carried out with the feline infectious peritonitis (FIP) virus (79-1146 strain) genomic

RNA

de Groot et al., J. Gen. Virol. 1987. 68. 2639- 00 2646), prepared according to the technique of Example S3, and with the following oligonucleotides: AB103 (38 mer) (SEQ ID No. 11) 5'ATAAGAATGCGGCCGCATGATTGTGCTCGTAACTTGCC3' AB112 (25 mer) (SEQ ID No. 12) 5'CGTACATGTGGAATTCCACTGGTTG3' so as to amplify the sequence of the 5' part of the gene encoding the virus S glycoprotein in the form of an NotI-EcoRI fragment. After purification, the 492 bp RT-PCR product was digested with NotI and EcoRI in order to liberate a 467 bp NotI-EcoRI fragment (fragment

A).

The plasmid pJCA089 (Patent Application PCT/FR95/01128) was digested with EcoRI and Spel in order to liberate a 3378 bp fragment containing the central part of the gene encoding the FIP virus modified S glycoprotein (fragment

B).

An RT-PCR reaction according to the technique of Example 5 was carried out with the FIP virus (79-1146 strain) genomic RNA, prepared according to the technique of Example 3, and with the following oligonucleotides: AB113 (25 mer) (SEQ ID No. 13) 5'AGAGTTGCAACTAGTTCTGATTTTG 3 AB104 (37 mer) (SEQ ID No. 14) 5'ATAAGAATGCGGCCGCTTAGTGGACATGCACTTTTTC3, so as to amplify the sequence of the 3' part of the gene encoding the FIP virus S glycoprotein in the form 14 of an Spel-NotI fragment. After purification the 00 543 bp RT-PCR product was digested with Spel and NotlI in order to liberate a 519 bp Spel-NotI fragme t b (fragment C).

The fragments A, B and C were then ligated 0O together into the vector pVR1012 (Example 6) p0 reviously digested with NotI, to give the plasmid pAB053 (9282 bp), which contains the modified S gene in the correct orientation relative to the promoter 13 0 (Figure No. 8).

Example 12: Construction of the plasmid pAB052 (FIV

M

gene) oAn RT-PCR reaction according to the technique of Example 5 was carried out with the feline infectious peritonitis (FIP) virus (79-1146 strain) genomic

RNA

Vennema et al., Virology. 1991, 181. 327-335), prepared according to the technique of Example 3, and with the following oligonucleotides: ABI01 (37 mer) (SEQ ID No. 5'ACGCGTCGACCCACCATGAAGTACATTTTGCTAATAC3' AB102 (36 mer) (SEQ ID No. 16) 5'CGCGGATCCTTACACCATATGTAATAATTTTTCATG31 so as to precisely isolate the gene encoding the FIP virus M glycoprotein in the form of a SalI-BamHI fragment. After purification, the 812 bp RT-PCR product was digested with Sail and BamHI in order to liberate a 799 bp SalI-BamHI fragment. This fragment was then ligated into the vector pVR1012 (Example previously digested with Sall and BamHI, to give the plasmid pAB052 (5668 bp) (Figure No. 9).

Example 13: Construction of the plasmid pAB056 (FIPV

N

gene) An RT-PCR reaction according to the technique of Example 5 was carried out with the feline infectious peritonitis (FIP) virus (79-1146 strain) genomic

RNA

Vennema et al., Virology. 1991, 181. 327-335), prepared according to the technique of Example 3, and with the following oligonucleotides: 15 AB106 (35 mer) (SEQ ID No. 17) 00 5S'ACGCGTCGACGCCATGGCCACACAGGGACAACGCG3' AB107 (36 mer) (SEQ ID No. 18) CGCGGATCCTTAGTTCGTACCTCATCATCATCTC31 ;Z 5 so as to precisely isolate the gene encoding the

FIP

00virus N protein in the form of a SalI-BamHI fragment.

After purification, the 1156 bp RT-PCp product was digested with Sail and BarnHI in order to liberate a 1143 bp SalI-BamHI fragment. This fragment was then V) 10 ligated into the vector pVRI12 (Example previously digested with SaII and BamHI, to give the plasmid 00 pABO56 (6011 bp) (iueN.1) Example 14: Construction of the plasmid pABO28 (FHV gE gene) A PCR reaction was carried out with the feline herpesvirus; (FHV-1) (C27 strain) genomic DNA Spatz et al. Virology. 1993. 197. 125-36) prepared according to the technique of Example 2, and with the following oligonucleotides: ABO61 (36 mer) (SEQ ID No. 19) S'AAAACTGCAGAATCATGTCCACTCGTGGCGACT3 AB064 (40 mer) (SEQ ID No. 5'ATAAGAATGCGGCCGCTTAGACAAGATTTGTTTCATC3 so as to amplify a 2856 bp fragment containing the gene encoding the FHV-1 virus gB glycoprotein in the form of a PstI-NotI fragment. After purification, the

PCR

product was digested with -PstI and NotI to give a 2823 bp PstI-NotI fragment.

This fragment was ligated with the vector pVR1O12 (Example previously digested with PstI and NotI, to give the plasmid pABO28 (7720 bp) (Figure No. 11).

Example 15: Construction of the plasmid pABO29 (FEy gD gene) A PCR reaction was carried out with the feline herpesvirus (C-27 strain) genomic DNA Spatz et al. J. Gen. Virol. 1994. 75. 1235-1244), prepared 16 according to the technique of Example 2 and with the 0 following oligonucleotides: AB065 (36 mer) (SEQ ID No. 21) 5'AAAACTGCAGCCAATGATGACACGTCTACATTTTTG3' AB066 (33 mer) (SEQ ID No. 22) 00 5'GGAAGATCTTTAAGGATGGTGAGTTGTATGTAT3' so as to amplify the gene encoding the FHV-1 virus gD glycoprotein in the form of a PstI-BglII fragment After purification, the 1147 bp PCR product was digested with PstI and BglII in order to isolate a S1129 bp PstI-BglII fragment. This fragment was ligated OO with the vector PVRI012 (Example Previously Sdigested with PstI and BglII, to give the plasmid c-i pAB029 (5982 bp) (Figure No. 12).

Example 16: Construction of the plasmid pABO10 (FCV C gene) An RT-PCR reaction according to the technique of Example 5 was carried out with the feline calicivirus (FCV) (F9 strain) genomic RNA Carter et al. Virology. 1992. 190. 443-448), prepared according to the technique of Example 3, and with the following oligonucleotides: AB025 (33 mer) (SEQ ID No. 23) 5'ACGCGTCGACGCATGTGCTCAACCTGCGCTAAC3' AB026 (31 mer) (SEQ ID No. 24) 5'CGCGGATCCTCATAACTTAGTCATGGGACTC3' so as to isolate the gene encoding the FCV virus capsid protein in the form of a SalI-BamHI fragment. After purification, the 2042 bp RT-PCR product was digested with Sal and BamHI in order to isolate a 2029 bp SalI-BamHI fragment. This fragment was ligated with the vector PVRI012 (Example previously digested with SalI and BamHI, to give the plasmid pAB010 (6892 bp) (Figure No. 13).

19 Manual, 2nd edition, Cold Spring Harbor Laboratory, Cold Spring Harbor, Ne Y, ri s aereorr L a b o r a t o r y, Cold Spring Harbor New York 1989) Reference may also be made to Patent Applications PCT WO 95/21250 and PCT

WO

96/02658 which describe methods for producing, on an industrial scale, plasmids which can be used for Svaccination For the purposes of the manufacture of 0 vaccines (see Example 17), the purified plasids are resuspended so as to obtain solutions at a high concentration 2 mg/ml) which are compatible with V3 10 storage. To do this the plasmids arresuspended either Sin ultrapure water or in TE buffer (10 mM Tris-HCi; 1 mM 00 EDTA, pH 8.0).

O0 SExample 21: Manufacture of the associated vaccines The various plasmids necessary for the manufacture of an associated vaccine are mixed starting with their concentrated solutions (Example 16). The mixtures are prepared such that the final concentration of each plasmid corresponds to the effective dose of each plasmid. The solutions which can be used to adjust the final concentration of the vaccine may be either a 0.9% NaCI solution, or PBS buffer.

Specific formulations such as liposomes, cationic lipids, may also be used for the manufacture of the vaccines.

Example 22: Vaccination of cats The cats are vaccinated with doses of 10 pg, jg or 250 4g per plasmid.

The injections are performed with a needle by the intramuscular route. In this case, the vaccinal doses are administered in a volume of 1 ml.

The injections can also be performed with a needle by the intradermal route. In this case, the vaccinal doses are administered in a total volume of 1 ml administered at 10 points of 0.1 ml or at points of 0.05 ml. The intradermal administrations are performed after shaving the skin (thoracic flank in general) or at the level of a relatively glabrous 20 anatomical region, for example the inner surface of the 00 thigh.

0 -A liquid jet injection apparatus (with no needle) can also be used for the intradermal injections.

0 0 00 Throughout this specification, unless the context requires otherwise, the word "comprise", or Svariations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated element or integer or group of elements or integers 00 but not the exclusion of any other element or integer (C or group of elements or integers.

Reference to any prior art in this specification is not, and should not be taken as, an acknowledgment or any form of suggestion that this prior art forms part of the common general knowledge in Australia or any other country.

Claims (9)

1. 2. Vaccine according to claim 1, wherein said plasmid contains both env and gag/pro genes. (N
2. 3. Vaccine according to claim 1, wherein said plasmid contains the env gene and wherein the vaccine comprises another plasmid containing the gag/pro gene.
3. 4. Vaccine for cats comprising a plasmid containing the G gene from rabies virus, and a suitable vehicle. Use of a plasmid containing the G gene from rabies virus to produce a vaccine designed for vaccination of cats.
4. 6. Vaccine for cats comprising a plasmid containing env and/or gag gene from feline leulemia virus FeLV, and a suitable vehicle.
5. 7. Vaccine according to claim 6, wherein said plasmid contains both env and gag genes.
6. 8. Vaccine according to claim 6, wherein said plasmid contains the env gene and wherein the vaccine comprises another plasmid containing the gag gene.
7. 9. Vaccine according to any one of claims 6 to 8, using the FeLV-A env and/or FeLV-B env gene. 00 0 00 (N tW Vaccine for cats containing a plasmid containing FHV gB and/or gD gene, and a suitable vehicle.
8. 11. genes. Vaccine according to claim 10, wherein said plasmid contains both gB and gD
9. 12. Vaccine according to claim 10, wherein said plasmid contains the gB gene and wherein the vaccine comprises another plasmid which contains the gD gene. 10 13. Vaccine for cats comprising a plasmid containing the FCV capside gene, and a suitable vehicle. Merial Ltd Patent Attorneys for the Applicant: F B RICE CO m:\mjc\letters\2004\1. aug 0 4 \502743cmpmjc.doc