AU2008202023A1 - Phenyl - carboxamide compounds useful for treating pain - Google Patents

Description

00

O

0"-

(N

AUSTRALIA

C7 V V V FB RICE CO Patent and Trade Mark Attorneys Patents Act 1990 EURO-CELTIQUE S.A.

COMPLETE SPECIFICATION STANDARD PATENT Invention Title: Phenyl carboxamide compounds useful for treating pain The following statement is a full description of this invention including the best method of performing it known to us:- 00 PHENYL CARBOXAMIDE COMPOUNDS USEFUL FOR TREATING PAIN This application claims the benefit of U.S. provisional application no.

S60/504,679, filed September 22, 2003, the disclosure of the provisional application being incorporated by reference herein in its entirety.

1. Field of the Invention C The present invention relates to Phenylene Compounds, compositions comprising C an effective amount of a Phenylene Compound and methods for treating or preventing a 00 0Condition such as pain comprising administering to an animal in need thereof an C' 10 effective amount of a Phenylene Compound.

2. Background of the Invention Pain is the most common symptom for which patients seek medical advice and treatment. Pain can be acute or chronic. While acute pain is usually self-limited, chronic pain persists for 3 months or longer and can lead to significant changes in a patient's personality, lifestyle, functional ability and overall quality of life Foley, Pain, in Cecil Textbook of Medicine 100-107 Bennett and F. Plum eds., 20th ed. 1996)).

Moreover, chronic pain can be classified as either nociceptive or neuropathic.

Nociceptive pain includes tissue injury-induced pain and inflammatory pain such as that associated with arthritis. Neuropathic pain is caused by damage to the peripheral or cental nervous system and is maintained by aberrant somatosensory processing. There is a large body of evidence relating activity at both Group I xnGluRs (mGluR1 and Fundytus, CNS Drugs 15:29-58 (2001)) and vanilloid receptors (VR1) Di Marzo et al., Current Opinion in Neurobiology 12:372-379 (2002)) to pain processing. Inhibiting mGluR1 or mGluR5 reduces pain, as shown by in vivo treatment with antibodies selective for either mGluR1 or mGluR5, where neuropathic pain in rats was attenuated Fundytus et al., NeuroReport 9:731-735 (1998)). It has also been shown that antisense oligonucleotide knockdown of mGluR alleviates both neuropathic and inflammatory pain Fundytus et al., British Journal of Pharmacology 132:354- 367 (2001); M.E. Fundytus et al., Pharmacology, Biochernsitry Behavior 73:401-410 (2002)). Small molecule antagonists for mGluR5-attenuated pain in in vivo animal -1A- 00 models are disclosed in, K. Walker et al., Neuropharmacology 40:1-9 (2000) and A.

O

0 Dogrul et al., Neuroscience Letters 292:115-118 (2000)).

SNociceptive pain has been traditionally managed by administering non-opioid analgesics, such as acetylsalicylic acid, choline magnesium trisalicylate, acetaminophen, ibuprofen, fenoprofen, diflusinal, and naproxen; or opioid analgesics, including morphine, hydromorphone, methadone, levorphanol, fentanyl, oxycodone, and oxymorphone. Id. In addition to the above-listed treatments, neuropathic pain, which can be difficult to treat, has also been treated with anti-epileptics gabapentin, carbamazepine, valproic acid, topiramate, phenytoin), NMDA antagonists 00 10 ketamine, dextromethorphan), topical lidocaine (for post-herpetic neuralgia), and C tricyclic antidepressants fluoxetine, sertraline and amitriptyline).

Pain has been traditionally managed by administering non-opioid analgesics, such as acetylsalicylic acid, choline magnesium trisalicylate, acetaminophen, ibuprofen, fenoprofen, diflusinal, and naproxen; or opioid analgesics, including morphine, hydromorphone, methadone, levorphanol, fentanyl, oxycodone, and oxymorphone. Id.

Urinary incontinence is uncontrollable urination, generally caused by bladder-detrusor-muscle instability. UI affects people of all ages and levels of physical health, both in health care settings and in the community at large. Physiologic bladder contraction results in large part from acetylcholine-induced stimulation of postganglionic muscarinic-receptor sites on bladder smooth muscle. Treatments for UI include the administration of drugs having bladder-relaxant properties, which help to control bladder-detrusor-muscle overactivity. For example, anticholinergics such as propantheline bromide and glycopyrrolate, and combinations of smooth-muscle relaxants such as a combination of racemic oxybutynin and dicyclomine or an anticholinergic, have been used to treat UI (See, A.J. Wein, Urol. Clin. N. Am. 22:557-577 (1995); Levin et al., J. Urol. 128:396-398 (1982); Cooke et al., S. Afr. Med. J. 63:3 (1983); R.K.

Mirakhur et al., Anaesthesia 38:1195-1204 (1983)). These drugs are not effective, however, in all patients having uninhibited bladder contractions. Administration of anticholinergic medications represent the mainstay of this type of treatment.

None of the existing commercial drug treatments for UI has achieved complete success in all classes of UI patients, nor has treatment occurred without significant adverse side effects. For example, drowsiness, dry mouth, constipation, blurred vision, 00 headaches, tachycardia, and cardiac arrhythmia, which are related to the anticholinergic Sactivity of traditional anti-UI drugs, can occur frequently and adversely affect patient compliance. Yet despite the prevalence of unwanted anticholinergic effects in many Spatients, anticholinergic drugs are currently prescribed for patients having UI. The 5 Merck Manual of Medical Information 631-634 Berkow ed., 1997).

About 1 in 10 people develop an ulcer. Ulcers develop as a result of an imbalance between acid-secretory factors, also known as "aggressive factors," such as ,I stomach acid, pepsin, and Helicobacter pylori infection, and local mucosal-protective factors, such as secretion of bicarbonate, mucus, and prostaglandins.

00 O 10 Treatment of ulcers typically involves reducing or inhibiting the aggressive C factors. For example, antacids such as aluminum hydroxide, magnesium hydroxide, sodium bicarbonate, and calcium bicarbonate can be used to neutralize stomach acids.

Antacids, however, can cause alkalosis, leading to nausea, headache, and weakness.

Antacids can also interfere with the absorption of other drugs into the blood stream and cause diarrhea.

H

2 antagonists, such as cimetidine, ranitidine, famotidine, and nizatidine, are also used to treat ulcers. H2 antagonists promote ulcer healing by reducing gastric acid and digestive-enzyme secretion elicited by histamine and other H 2 agonists in the stomach and duodenum. H 2 antagonists, however, can cause breast enlargement and impotence in men, mental changes (especially in the elderly), headache, dizziness, nausea, myalgia, diarrhea, rash, and fever.

H K' ATPase inhibitors such as omeprazole and lansoprazole are also used to treat ulcers. II, K ATPase inhibitors inhibit the production of enzymes used by the stomach to secrete acid. Side effects associated with IH, K+ ATPase inhibitors include nausea, diarrhea, abdominal colic, headache, dizziness, somnolence, skin rashes, and transient elevations of plasma activities of aminotransferases.

Sucraflate is also used to treat ulcers. Sucraflate adheres to epithelial cells and is believed to form a protective coating at the base of an ulcer to promote healing.

Sucraflate, however, can cause constipation, dry mouth, and interfere with the absorption of other drugs.

00 Antibiotics are used when Helicobacterpylori is the underlying cause of the ulcer. Often antibiotic therapy is coupled with the administration of bismuth compounds such as bismuth subsalicylate and colloidal bismuth citrate. The bismuth compounds are Sbelieved to enhance secretion of mucous and HC0 3 inhibit pepsin activity, and act as an r- 5 antibacterial against H. pylori. Ingestion of bismuth compounds, however, can lead to elevated plasma concentrations of Bi+ 3 and can interfere with the absorption of other c drugs.

SProstaglandin analogues, such as misoprostal, inhibit secretion of acid and C stimulate the secretion of mucous and bicarbonate and are also used to treat ulcers, 00 C 10 especially ulcers in patients who require nonsteroidal anti-inflammatory drugs. Effective C' oral doses of prostaglandin analogues, however, can cause diarrhea and abdominal cramping. In addition, some prostaglandin analogues are abortifacients.

Carbenoxolone, a mineral corticoid, can also be used to treat ulcers.

Carbenoxolone appears to alter the composition and quantity of mucous, thereby enhancing the mucosal barrier. Carbenoxolone, however, can lead to Na 4 and fluid retention, hypertension, hypokalemia, and impaired glucose tolerance.

Muscarinic cholinergic antagonists such as pirenzapine and telenzapine can also be used to reduce acid secretion and treat ulcers. Side effects of muscarinic cholinergic antagonists include dry mouth, blurred vision, and constipation. The Merck Manual of Medical Information 496-500 Berkow ed., 1997) and Goodman and Gilman's The Pharmacological Basis of Therapeutics 901-915 Hardman and L. Limbird eds., 9 th ed.

1996).

Inflammatory-bowel disease is a chronic disorder in which the bowel becomes inflamed, often causing recurring abdominal cramps and diarrhea. The two types of IBD are Crohn's disease and ulcerative colitis.

Crohn's disease, which can include regional enteritis, granulomatous ileitis, and ileocolitis, is a chronic inflammation of the intestinal wall. Crohn's disease occurs equally in both sexes and is more common in Jews of eastern-European ancestry. Most cases of Crohn's disease begin before age 30 and the majority start between the ages of 14 and 24. The disease typically affects the full thickness of the intestinal wall.

-4- 0 Generally the disease affects the lowest portion of the small intestine (ileum) and the large intestine, but can occur in any part of the digestive tract.

c Early symptoms of Crohn's disease are chronic diarrhea, crampy abdominal pain, fever, loss of appetite, and weight loss. Complications associated with Crohn's disease 0 5 include the development of intestinal obstructions, abnormal connecting channels (fistulas), and abscesses. The risk of cancer of the large intestine is increased in people N, who have Crohn's disease. Often Crohn's disease is associated with other disorders such C as gallstones, inadequate absorption of nutrients, amyloidosis, arthritis, episcleritis, C aphthous stomatitis, erythema nodosum, pyoderma gangrenosum, ankylosing spondylitis, 00 0 10 sacroilitis, uveitis, and primary sclerosing cholangitis. There is no known cure for C, Crohn's disease.

Cramps and diarrhea, side effects associated with Crohn's disease, can be relieved by anticholinergic drugs, diphenoxylate, loperamide, deodorized opium tincture, or codeine. Generally, the drug is taken orally before a meal.

Broad-spectrum antibiotics are often administered to treat the symptoms of Crohn's disease. The antibiotic metronidazole is often administered when the disease affects the large intestine or causes abscesses and fistulas around the anus. Long-term use of metronidazole, however, can damage nerves, resulting in pins-and-needles sensations in the arms and legs. Sulfasalazine and chemically related drugs can suppress mild inflammation, especially in the large intestine. These drugs, however, are less effective in sudden, severe flare-ups. Corticosteroids, such as prednisone, reduce fever and diarrhea and relieve abdominal pain and tenderness. Long-term corticosteroid therapy, however, invariably results in serious side effects such as high blood-sugar levels, increased risk of infection, osteoporosis, water retention, and fragility of the skin.

Drugs such as azathioprine and mercaptourine can compromise the immune system and are often effective for Crohn's disease in patients that do not respond to other drugs.

These drugs, however, usually need 3 to 6 months before they produce benefits and can cause serious side effects such as allergy, pancreatitis, and low white-blood-cell count.

When Crohn's disease causes the intestine to be obstructed or when abscesses or fistulas do not heal, surgery can be necessary to remove diseased sections of the intestine. Surgery, however, does not cure the disease, and inflammation tends to recur 00 where the intestine is rejoined. In almost half of the cases a second operation is needed.

The Merck Manual of Medical Information 528-530 Berkow ed., 1997).

SUlcerative colitis is a chronic disease in which the large intestine becomes inflamed and ulcerated, leading to episodes of bloody diarrhea, abdominal cramps, and 0 5 fever. Ulcerative colitis usually begins between ages 15 and 30, however, a small group of people have their first attack between ages 50 and 70. Unlike Crohn's disease, C ulcerative colitis never affects the small intestine and does not affect the full thickness of the intestine. The disease usually begins in the rectum and the sigmoid colon and Ci eventually spreads partially or completely throughout the large intestine. The cause of 00 0 10 ulcerative colitis is unknown. Treatment of ulcerative colitis is directed to controlling CI inflammation, reducing symptoms, and replacing lost fluids and nutrients.

Irritable-bowel syndrome is a disorder of motility of the entire gastrointestinal tract, causing abdominal pain, constipation, and/or diarrhea. IBS affects three-times more women than men.

There are two major types of IBS. The first type, spastic-colon type, is commonly triggered by eating, and usually produces periodic constipation and diarrhea with pain. Mucous often appears in the stool. The pain can come in bouts of continuous dull aching pain or cramps, usually in the lower abdomen. The person suffering from spastic-colon type IBS can also experience bloating, gas, nausea, headache, fatigue, depression, anxiety, and difficulty concentrating. The second type of IBS usually produces painless diarrhea or constipation. The diarrhea can begin suddenly and with extreme urgency. Often the diarrhea occurs soon after a meal and can sometimes occur immediately upon awakening.

Treatment of IBS typically involves modification of an IBS-patient's diet. Often it is recommended that an IBS patient avoid beans, cabbage, sorbitol, and fructose. A low-fat, high-fiber diet can also help some IBS patients. Regular physical activity can also help keep the gastrointestinal tract functioning properly. Drugs such as propantheline that slow the function of the gastrointestinal tract are generally not effective for treating IBS. Antidiarrheal drugs, such as diphenoxylate and loperamide, help with diarrhea. The Merck Manual of Medical Information 525-526 Berkow ed., 1997).

0 Certain pharmaceutical agents have been administered for treating addiction.

SU.S. Patent No. 5,556,838 to Mayer et al. discloses the use of nontoxic NMDA-blocking agents co-administered with an addictive substance to prevent the development of tolerance or withdrawal symptoms. U.S. Patent No. 5,574,052 to Rose et al. discloses S 5 co-administration of an addictive substance with an antagonist to partially block the pharmacological effects of the addictive substance. U.S. Patent No. 5,075,341 to Cc Mendelson et al. discloses the use of a mixed opiate agonist/antagonist to treat cocaine and opiate addiction. U.S. Patent No. 5,232,934 to Downs discloses administration of 0 3-phenoxypyridine to treat addiction. U.S. Patents No. 5,039,680 and 5,198,459 to 00 10 Imperato et al. disclose using a serotonin antagonist to treat chemical addiction. U.S.

SPatent No. 5,556,837 to Nestler et. al. discloses infusing BDNF or NT-4 growth factors to inhibit or reverse neurological adaptive changes that correlate with behavioral changes in an addicted individual. U.S. Patent. No. 5,762,925 to Sagan discloses implanting encapsulated adrenal medullary cells into an animal's central nervous system to inhibit the development of opioid intolerance. U.S. Patent No. 6,204,284 to Beer et al. discloses racemic (±)-1-(3,4-dichlorophenyl)-3-azabicyclo[3.1.0]hexane for use in the prevention or relief of a withdrawal syndrome resulting from addiction to drugs and for the treatment of chemical dependencies.

Without treatment, Parkinson's disease progresses to a rigid akinetic state in which patients are incapable of caring for themselves. Death frequently results from complications of immobility, including aspiration pneumonia or pulmonary embolism.

Drugs commonly used for the treatment of Parkinson's disease include carbidopa/levodopa, pergolide, bromocriptine, selegiline, amantadine, and trihexyphenidyl hydrochloride. There remains, however, a need for drugs useful for the treatment of Parkinson's disease and having an improved therapeutic profile.

Anxiety is a fear, apprehension or dread of impending danger often accompanied by restlessness, tension, tachycardia and dyspnea. Currently, benzodiazepines are the most commonly used anti-anxiety agents for generalized anxiety disorder.

Benzodiazepines, however, carry the risk of producing impairment of cognition and skilled motor functions, particularly in the elderly, which can result in confusion, delerium, and falls with fractures. Sedatives are also commonly prescribed for treating anxiety. The azapirones, such as buspirone, are also used to treat moderate anxiety. The azapirones, however, are less useful for treating severe anxiety accompanied with panic attacks.

ct Epilepsy is a disorder characterized by the tendency to have recurring seizures.

Examples of drugs for treating a seizure and epilepsy include carbamazepine, 0 5 ethosuximide, gabapentin, lamotrigine, phenobarbital, phenytoin, primidone, valproic acid, trimethadione, benzodiazepines, y-vinyl GABA, acetazolamide, and felbamate.

rc N, Anti-seizure drugs, however, can have side effects such as drowsiness; hyperactivity; 0 CN hallucinations; inability to concentrate; central and peripheral nervous system toxicity, 0 CN such as nystagmus, ataxia, diplopia, and vertigo; gingival hyperplasia; gastrointestinal 00 0 10 disturbances such as nausea, vomiting, epigastric pain, and anorexia; endocrine effects CI such as inhibition of antidiuretic hormone, hyperglycemia, glycosuria, osteomalacia; and hypersensitivity such as scarlatiniform rash, morbilliform rash, Stevens-Johnson syndrome, systemic lupus erythematosus, and hepatic necrosis; and hematological reactions such as red-cell aplasia, agranulocytosis, thrombocytopenia, aplastic anemia, and megaloblastic anemia. The Merck Manual of Medical Information 345-350 (R.

Berkow ed., 1997).

Symptoms of strokes vary depending on what part of the brain is affected.

Symptoms include loss or abnormal sensations in an arm or leg or one side of the body, weakness or paralysis of an arm or leg or one side of the body, partial loss of vison or hearing, double vision, dizziness, slurred speech, difficulty in thinking of the appropriate word or saying it, inability to recognize parts of the body, unusual movements, loss of bladder control, imbalance, and falling, and fainting. The symptoms can be permanent and can be associated with coma or stupor. Examples of drugs for treating strokes include anticoagulants such as heparin, drugs that break up clots such as streptokinase or tissue plasminogen activator, and drugs that reduce swelling such as mannitol or corticosteroids. The Merck Manual of Medical Information 352-355 Berkow ed., 1997).

Pruritus is an unpleasant sensation that prompts scratching. Conventionally, pruritus is treated by phototherapy with ultraviolet B or PUVA or with therapeutic agents such as naltrexone, nalmefene, danazol, tricyclics, and antidepressants.

Selective antagonists of the metabotropic glutamate receptor 5 ("mGluR5") have been shown to exert analgesic activity in in vivo animal models Walker et al., -8- 00 Neuropharmacology 40:1-9 (2000) and A. Dogrul et al., Neuroscience Letters, S292(2):115-118 (2000)).

c3 Selective antagonists of the mGluR5 receptor have also been shown to exert Sanxiolytic and anti-depressant activity in in vivo animal models Tatarczynska et al., 0 5 Br. J. Pharmacol. 132(7):1423-1430 (2001) and P.J.M. Will etal., Trends in Pharmacological Sciences 22(7):331-37 (2001)).

SSelective antagonists of the mGluR5 receptor have also been shown to exert arti- Parkinson activity in vivo J. Ossowska et al., Neuropharmacology 41(4):413-20 o (2001) and P.J.M. Will et al., Trends in Pharmacological Sciences 22(7):331-37 (2001)).

O0 0 10 Selective antagonists of the mGluR5 receptor have also been shown to exert antidependence activity in vivo Chiamulera et al., Nature Neuroscience 4(9):873-74 (2001)).

U.S. Patent No. 6,495,550 to McNaughton-Smith et al. discloses pyridine substituted benzanilides useful as openers of potassium ion channels.

International publication no. WO 94/05153 discloses substituted benzene compounds useful as herbicides.

International publication no. WO 04/058762 discloses substituted 9-memberect bicyclic compounds useful as MK-2 inhibitors.

United Kingdom Application No. GB 2 276 162 discloses aniline and benzanilide compounds useful for treating disorders of the central nervous system, endocrine disorders, and sexual dysfunction.

United Kingdom Application No. GB 2 276 163 discloses pyridine compounds useful for treating disorders of the central nervous system, endocrine disorders, and sexual dysfunction.

European Application No. EP 533267 discloses benzanilide compounds useful as 5-HT1D antagonists.

U.S. published patent application no. US 2003/0153596 to Young Ger Suh discloses thiourea derivatives useful as a modulator for vanilloid receptors.

There is a need in the art for compounds that are useful for treating or preventing pain, UI, an ulcer, IBD, IBS, an addictive disorder, Parkinson's disease, parkinsonisnx, -9- 00

O

O

e--

O

anxiety, epilepsy, stroke, a seizure, a pruritic condition, psychosis, a cognitive disorder, a memory deficit, restricted brain function, Huntington's chorea, ALS, dementia, retinopathy, a muscle spasm, a migraine, vomiting, dyskinesia, or depression in an animal Citation of any reference in Section 2 of this application is not to be construed as an admission that such reference is prior art to the present application.

3. Summary of the Invention The present invention encompasses compounds of formula Arl

(I)

and pharmaceutically acceptable salts thereof, where Arl is R 2 (R2)pN

N-S

SN NN R W R, R, R Sior Ar 2 is 00 N NH N N;1 CJ (R8)o (R iiq (R ',or 11!5 00 X is 0or S; R, is -halo, -CH 3 -C(halo) 3 -CH(halo 2 or -CH 2 (halo); each R 2 is independently: -halo, -OH, -NH 2 -CN, or -NO 2

-(C

1 -C o)alkyl, -(C 2 -Cio)alkenyl, -(C 2 -Cio)alkynyl, -(C 3 CIO)cycloalkyl, -(C 8 -C 14 )bicycloalkcyl, -(CS-C, 4 )tricycloalkyl, -(C 5 -CIO)cycloallcenyl, -(Cg-C 14 )bicycloalkenyl, -(C8-C 1 4 )tricycloalkenyl, to 7-membered)heterocycle, or to 10-membered)bicycloheterocycle, each of which is unsubstituted. or substituted with one or more R 5 groups; or -phenyl, -naphthyl, -(C 1 4)aryl or to 10-membered)heteroaryl, each of which is unsubstituted or substituted with one or more R 6 groups; each R 3 is independently: -halo, -CN, -OH, -NO 2 or -NH 2 -(CI-Cio)alkyl, -(C 2 -Clo)alkenyl, -(C 2 -C1O)alkynyl, -(C 3

C

1 O)cycloalkyl, -(Cg-C 14 )bicycloalkyl, -(CB-C 14 )tricycloalkyl, -(C 5 -C io)cycloalkenyl,

-(C

8 -C 14 )bicycloalkenyl, (C8-C 14)tricycloalkenyl, to 7-membered)heterocycle, or to 10-membered)bicycloheterocycle, each of which is unsubstituted. or substituted with one or more R 5 groups; or -phenyl, -naphthyl, -(C 1 4)aryl or to lO-membered) heteroaryl, each of which is unsubstituted or substituted with one or more R 6 groups; 11 00 each R 5 is independently -CN, -OH, -(CI-C 6 )alkyl, -(C 2

-C

6 )alkenyl, -halo, -N 3

-NO

2

-N(R

7 2

-CH=NR

7

-NR

7 OH, -OR 7

-COR

7 -C(O)0R 7

-OC(O)R

7 -OC(O)0R 7

-SR

7

-S(O)R

7 or -S(O) 2

R

7 each R 6 is independently -(C 1

-C

6 )alkyl, -(C 2

-C

6 )alkenyl, -(C 2

-C

6 )alkynyl, -(C 3 C8)cycloalkyl, -(C 5 -CB)cycloallcenyl, -phenyl, to 5-membered)heterocycle, -C(halo) 3 -CH(halo) 2

-CH

2 (halo), -CN, -OH, -halo, -N 3

-NO

2

N(R

7 2

-CH=NR

7

-NR

7 OH, -OR 7

-COR

7 -C(O)0R 7

-OC(O)R

7 -OC(O)0R 7

-SR

7

-S(O)R

7 or -S(O) 2

R?;

c-i each R 7 is independently -(CI-C 6 )alkyl, -(C 2

-C

6 )allcenyl, -(C 2

-C

6 )alkynyl, c-i -(C 3 -C8)cycloalkyl, -(Cs-C8)cycloallcenyl, -phenyl, to 00 C) 10 -C(halo) 3 -CH(halo) 2 or CH1 2 (halo); c-i each R 8 is independently -(CI-C 6 )alkyl, -(C 2

-C

6 )alkenyl, -(C 2

-C

6 )alkynyl, -(C 3 CS)cycloalkyl, -(CS-C8)cycloalkenyl, -phenyl, -C(halo) 3 -CH(halo) 2

-CH

2 (halo), -CN, -OH, -halo, -N 3

-NO

2

-N(R

7 h2, -NR 7 OH, -OR 7

-COR

7 -C(O)0R 7

-OC(O)R

7 -OC(O)0R 7

-SR

7

-S(O)R

7 or -S(O) 2

R

7 each R, I is independently -(CI-C 6 )alkyl, -(C 2

-C

6 )alkenyl, -(C 2

-C

6 )alkynyl, (C 3 C8)cycloalkyl, -(C5-C8)cycloalcenyl, -phenyl, -C(halo) 3 -CH(halo) 2

-CH

2 (halo), -CN, -OH, -halo, -N 3

-NO

2

-N(R

7 2

-CH=NR

7

-NR

7 OH, -OR 7

-COR

7 -C(O)0R 7

-OC(O)R

7 -OC(O)0R 7

-SR

7

-S(O)R

7 Or S027 each halo is independently -Cl, -Br, or -1; m is an integer ranging from 0 to 4; o is an integer ranging from 0 to 4; p is an integer ranging from 0 to 2; q is an integer ranging from 0 to 6; r is an integer ranging from 0 to 5; and s is an integer ranging from 0 to 4.

The invention further encompasses compounds of formula (11): -12- 00 k\P2)n

R,

00

NH

Ar 2 and pharmaceutically acceptable salts thereof, where Ar 2 is ANH NS0 -(Rj 1 )q ,or X is 0or S; R, is -halo, -CH 3 -C(halo) 3 -CH(halo) 2 or -CH 2 (halo); each R 2 is independently: -halo, -OH, -NH 2 -CN, or -NO 2 -(Ci-Clo)alkyl, -(C 2 -CIO)alkenyl, -(C 2 -Clo)alkynyl, -(C 3 CIO)cycloalkyl, -(CB-C 14 )bicycloalkyl, -(C 8

-C

1 4 )tricycloallcyl, -(C 5 -Cio)cycloalkenyl, -(C8-C 14 )bicycloalkenyl, -(CB-C 14 )tricycloalkenyl, to 7-membered)heterocycle, or 13 00 to 1-membered)bicycloheterocycle, each of which is unsubstituted or substituted 0 with one or more R 5 groups; or -phenyl, -naphthyl, 4 )aryl or to 10-membered)heteroaryl, each of which is unsubstituted or substituted with one or more R 6 groups; each R 5 is independently -CN, -OH, -(CI-C 6 )alkyl, -(C 2

-C

6 )alkenyl, -halo, -N 3

-NO

2

-N(R

7 2

-CH=NR

7

-NR

7 OH, -OR 7

-COR

7

-OC(O)R

7

-OC(O)OR-,,

-SR

7

-S(O)R

7 or -S(O) 2

R

7 each R 6 is independently -(CI-C 6 )alkyl, -(C 2

-C

6 )allcenyl, -(C2-C 6 )alkynyl, -(C 3

C

8 )cycloalkyl, -(C 5

-C

8 )cycloalkenyl, -phenyl, to 5-membered)heterocycle, -C(halo) 3 S10 -CH(halo) 2

-CH

2 (halo), -CN, -OH, -halo, -N 3

-NO

2

N(R

7 2

-CH=NR

7

-NR

7 OH, -OR 7 00 0 -COR 7 -C(O)0R 7

-OC(O)R

7 -OC(O)0R 7

-SR

7

-S(O)R

7 or -S(O) 2

R

7 each R 7 is independently -(Ci-C 6 )alkyl, -(C 2

-C

6 )alkenyl, -(C 2

-C

6 )alkynyl,

-(C

3 -C8)cycloalkyl, -(C 5

-C

8 )cycloalkenyl, -phenyl, to -C(halo) 3 -CH(halo) 2 or CH 2 (halo); each R 8 is independently I-C 6 )alkyl, -(C 2

-C

6 )alkenyl, -(C 2

-C

6 )alkynYl, -(C 3 C8)cycloalkyl, -(C5-CB)cycloalkenyl, -phenyl, -C(halo) 3 -CH(halo) 2

-CH

2 (halo), -CN, -OH, -halo, -N 3

-NO

2

-N(R

7 2

-CH=NR

7

-NR

7 OH, -OR 7

-COR

7 -C(O)0R 7

-OC(O)R

7 -OC(O)0R 7

-SR

7

-S(O)R

7 or -S(O) 2

R

7 each R 11 is independently -(CI-C 6 )alkyl, -(C 2

-C

6 )alkenyl, -(C 2

-C

6 )alkynyl, (C 3 C8)cycloalkyl, -(C 5 -C8)cycloalkenyl, -phenyl, -C(halo) 3 -CH(halO) 2

-CH

2 (halo), -CN, -OH, -halo, -N 3

-NO

2

-N(R

7 2

-CH=NR

7

-NR

7 OH, -OR 7

-COR

7 -C(O)0R 7

-OC(O)R

7 -OC(O)0R 7

-SR

7

-S(O)R

7 or -S(O) 2

R

7 each halo is independently -Cl, -Br, or -I; n is an integer ranging from 0 to 3; o is an integer ranging from 0 to 4; q is an integer ranging from 0 to 6; r is an integer ranging from 0 to 5; and s is an integer ranging from 0 to 4.

A compound of formula or (1I) or a pharmaceutically acceptable salt thereof (a "Phenylene Compound") is useful for treating or preventing pain, U1, an ulcer, IBD, IBS, an addictive disorder, Parkinson's disease, parkinsonism, anxiety, epilepsy, stroke, a seizure, a pruritic condition, psychosis, a cognitive disorder, a memory deficit, restricted brain function, Huntington's chorea, ALS, dementia, retinopathy, a muscle spasm, a migraine, vomiting, dyskinesia, or depression (each being a "Condition") in an animal.

14 00 The invention also relates to compositions comprising an effective amount of a

O

0 Phenylene Compound and a pharmaceutically acceptable carrier or excipient. The compositions are useful for treating or preventing a Condition in an animal.

SThe invention further relates to methods for treating a Condition, comprising administering to an animal in need thereof an effective amount of a Phenylene Compound.

SiThe invention further relates to methods for preventing a Condition, comprising administering to an animal in need thereof an effective amount of a Phenylene Ci Compound.

00 0 10 The invention still further relates to methods for inhibiting Vanilloid Receptor 1

C

function in a cell, comprising contacting a cell capable of expressing VR1 with an effective amount of a Phenylene Compound.

The invention still further relates to methods for inhibiting mGluR5 function in a cell, comprising contacting a cell capable of expressing mGluR5 with an effective amount of a Phenylene Compound.

The invention still further relates to methods for inhibiting metabotropic glutamate receptor 1 ("mGluR1") function in a cell, comprising contacting a cell capable of expressing mGluR1 with an effective amount of a Phenylene Compound.

The invention still further relates to methods for preparing a composition, comprising the step of admixing a Phenylene Compound and a pharmaceutically acceptable carrier or excipient.

The invention still further relates to a kit comprising a container containing an effective amount of a Phenylene Compound.

The present invention can be understood more fully by reference to the following detailed description and illustrative examples, which are intended to exemplify nonlimiting embodiments of the invention.

00 4. Detailed Description of the Invention

O

C 4.1 Phenylene Compounds of Formula (I) SAs stated above, the present invention encompasses Phenylene Compounds of Formula (I) Arl 6 (R3)m 5 3 00 x

NH

Ar 2

(I)

where Ari, Ar 2

R

3 X, and m are defined above for the Phenylene Compounds of formula In one embodiment, Arl is a pyrimidyl group.

In another embodiment, Ari is a pyrazinyl group.

In another embodiment, Art is a pyridazinyl group.

In another embodiment, Arl is a thiadiazolyl group.

In another embodiment, X is O.

In another embodiment, X is S.

In another embodiment, Ar 2 is a benzoimidazolyl group.

In another embodiment, Ar 2 is a benzothiazolyl group.

In another embodiment, Ar 2 is a benzooxazolyl group.

In another embodiment, Ar 2 is -16- 00 O O

O

In another embodiment, Ar 2 is In another embodiment, Ar 2 is In another embodiment, Ar 2 is In another embodiment, m is 0.

In another embodiment, m is 1.

In another embodiment, m is 2.

In another embodiment, m is 3.

In another embodiment, m is 4.

In another embodiment, p is 0.

In another embodiment, p is 1.

In another embodiment, p is 2.

In another embodiment, o is 0.

In another embodiment, o is 1.

-17- 00 In another embodiment, o is 2.

In another embodiment, o is 3.

cIn another embodiment, o is 4.

In another embodiment, q is 0.

In another embodiment, q is 4.

In another embodiment, q is 0.

In In another embodiment, q is 1.

0 In another embodiment, q is 2.

In another embodiment, q is 3.

In another embodiment is In another embodiment, q is 4.

In another embodiment r is 0.

In another embodiment, r is In another embodiment, r is 6.

In another embodiment, r is 0.

In another embodiment, r is 1.

In another embodiment, r is 2.

In another embodiment, s is 3.

In another embodiment, s is 4.

In another embodiment, s is In another embodiment, s is 0.

In another embodiment, s is 1.

In another embodiment, s is 2.

2 In another embodiment, R 1 is -h.

In another embodiment, R 1 is In another embodiment, Ri is -Br.

In another embodiment, R 1 is -I.

-18- 00 In another embodiment, Ri is -F.

In another embodiment, RI is -CH 3 In another embodiment, R, is -C(halo) 3 In another embodiment, R, is -CH(halo) 2 In another embodiment, R 1 is -CH 2 (halo).

In another embodiment, p is 1 and R 2 is -halo, -OH, -NH 2 -CN, or -NO 2 In another embodiment, p is 1 and R 2 is -(CI-CIO)allcyl, -(C 2 -Cio)alkenyl, -(C 2 CIO)alkynyl, -(C 3 -CIc)cycloalcyl, -(C8-C 14 )bicycloalkyl, -(C8-C 14 )triCYCloalkyl, -(C 5 00 CIo)cycloalkenyl, -(C8-C 14 )bicycloalkenyl, -(C8-C 1 4tricycloatkenyl, to 7ri 10 membered)heterocycle, or to 10-membered)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R 5 groups.

In another embodiment, p is 1 and R 2 is -phenyl, -naphthyl, -(C 14 )aryl or to each of which is unsubstituted or substituted with one or more

R

6 groups.

In another embodiment, m is 1 and R 3 is -halo, -CN, -OH, -NO 2 or -NH 2 In another embodiment, m is 1 and R 3 is -(C 1 -CIa)allcyl, -(C 2 -CIO)alkenyl, -(C 2 C IO)alkynyl, -(C 3 -C io)cycloalkyl, -(C 8 -C 14 )bicycloalkyl, -(C8-C 14 )triCYClOalkYl, -(C 5 CIO)cycloalkenyl, -(C 8

-C

14 )bicycloalkenyl, -(C8-C 14 )tricycloalkenyl, to 7membered)heterocycle, or to 10-membered)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R 5 groups.

In another embodiment, m is I and R 3 is -phenyl, -naphthyl, -(Ci 4 )aryl or to each of which is unsubstituted or substituted with one or more

R

6 groups.

In another embodiment, m is 1 and R 3 is -(Ci-CIO)alkyl.

In another embodiment, m is 1 and R 3 is -Gil 3 In another embodiment, m is 1 and R 3 is -halo.

In another embodiment, mnis 1 and R 3 is -Cl.

In another embodiment, mn is 1 and R 3 is -Br.

In another embodiment, m is 1 and R 3 is -I.

-19- 00 In another embodiment, m is 1 and R 3 is -F.

In another embodiment, A is a benothiaolyl group and s is SIn another embodiment, Ar 2 is a benzothiazolyl group and s is 1.

In another embodiment, Ar 2 is a benzoimidazolyl group and s is 1.

another embodiment, Ar 2 is a benzooxazolyl group and s is 1.

0 and o is 1.

another embodiment, Ar 2 is r -(R 8 )o and o is 1.

In another embodiment, Ar 2 is 1 and o is 1.

In another embodiment, Ar 2 is l (R8)r and r is 1.

In another embodiment, Ar2 is 1 R-(R)q and q is 1.

and q is 1.

00 In another embodiment, Ar2 is a benzothiazolyl group, s is 1, and Rs is -halo or

O

0 -(CI-C 6 alkyl.

In another embodiment, Ar 2 is a benzoimidazolyl group, s is 1, and R 8 is -halo or

-(C

1

-C

6 alkyl.

0 5 In another embodiment, Ar 2 is a benzooxazolyl group, s is 1, and R 8 is -halo or -(Ci-C 6 alkyl.

C In another embodiment, Ar 2 is 00 O-(R8)o o is 1, and R 8 is -halo or -C 6 alkyl.

In another embodiment, Ar 2 is o is 1, and R 8 is -halo or -C 6 alkyl.

In another embodiment, Ar 2 is 6 R (R 8 )r r is 1, and R 8 is -halo or -C 6 alkyl.

In another embodiment, Ar 2 is -21- 00 q is 1, and RI is -halo or -(Ci-C 6 alkyl.

O

Ci In another embodiment, Ar 2 is 0

-(R

8 )r Sr is 1, and R 8 is at the para-position of the phenyl ring.

O 5 In another embodiment, Arl is a pyrazinyl group, X is O, m is 0, and Ar 2 is a 00 benzothiazolyl group.

CI In another embodiment, Ari is a pyrazinyl group, X is O, m is 0, and Ar 2 is a benzooxazolyl group.

In another embodiment, Arl is a pyrazinyl group, X is O, m is 0, and Ar 2 is a benzoimidazolyl group.

In another embodiment, Art is a pyrazinyl group, X is O, m is 0, and Ar 2 is i (R1)q In another embodiment, Art is a pyrazinyl group, X is O, m is 0, and Ar 2 is In another embodiment, Arm is a pyrazinyl group, X is O, m is 0, and Ar 2 is Sa (R8)o In another embodiment, Art is a pyrazinyl group, X is O, m is 0, and Ar2 is -22- 00 N SIn another embodiment, Art is a pyrazinyl group, X is O, r is 1, m is 0, Ar 2 is 6

(R

8 )r 00 and R 8 is a -(Ci-C 6 )alkyl. In another embodiment, the -(Ci-C 6 )alkyl is substituted at the O 5 phenyl group's para-position. In another embodiment, the -(Ci-C 6 )alkyl is a tert-butyl group. In another embodiment, the -(Ci-C 6 )alkyl is a tert-butyl group and is substituted at the phenyl group's para-position. In another embodiment, the -(Ci-C 6 )alkyl is an iso-propyl group. In another embodiment, the -(Ci-C 6 )alkyl is an iso-propyl group and is substituted at the phenyl group's para-position.

In another embodiment, Arl is a pyrazinyl group, X is O, r is 1, m is 0, Ar 2 is -(Rs)r and R 8 is -CF 3 In another embodiment, the -CF 3 is substituted at the phenyl group's 4-position.

In another embodiment, Art is a pyrazinyl group, X is O, r is 1, m is 0, Ar 2 is 6 (R8)r and R 8 is -halo. In another embodiment, the -halo is substituted at the phenyl group's para-position. In another embodiment, -halo is -Cl. In another embodiment, -halo is -Cl and is substituted at the phenyl group's para-position. In another embodiment, -halo is -23- 00 O O

(N

C-q O N-

O

O

O

0

-N

Br. In another embodiment, -halo is -Br and is substituted at the phenyl group's paraposition. In another embodiment, -halo is In another embodiment, -halo is -I and is substituted at the phenyl group's para-position. In another embodiment, -halo is In another embodiment, -halo is -F and is substituted at the phenyl group's para-position.

In another embodiment, Ari is a pyrimidinyl group, X is O, m is 0, and Ar 2 is a benzothiazolyl group.

In another embodiment, Ari is a pyrimidinyl group, X is O, m is 0, and Ar 2 is a benzooxazolyl group.

In another embodiment, Art is a pyrimidinyl group, X is O, m is 0, and Ar 2 is a 10 benzoimidazolyl group.

In another embodiment, Art is a pyrimidinyl group, X is O, m is 0, and Ar 2 is In another embodiment, Art is a pyrimidinyl group, X is O, m is 0, and Ar 2 is

'R

8 )r In another embodiment, Arl is a pyrimidinyl group, X is O, m is 0, and Ar 2 is In another embodiment, Art is a pyrimidinyl group, X is O, m is 0, and Ar 2 is -24- 00

O

j? 1-^ 0"- In? et,(R)o u In another embodiment, Arl is a pyrimidinyl group, X is O, r is 1, m is O, Ar2 is and R 8 is a -(Ci-C 6 )alkyl. In another embodiment, the -(Ci-C 6 )alkyl is substituted at the phenyl group's para-position. In another embodiment, the -(Ci-C 6 )alkyl is a tert-butyl group. In another embodiment, the -(C1-C 6 )alkyl is a tert-butyl group and is substituted at the phenyl group's para-position. In another embodiment, the -(Ci-C 6 )alkyl is an iso-propyl group. In another embodiment, the -(Ci-C 6 )alkyl is an iso-propyl group and is substituted at the phenyl group's para-position.

0 In another embodiment, Arl is a pyrimidinyl group, X is O, r is 1, m is 0, Ar 2 is and R 8 is -CF 3 In another embodiment, the -CF 3 is substituted at the phenyl group's 4-position In another embodiment, Arl is a pyrimidinyl group, X is O, r is 1, m is 0, Ar 2 is and R 8 is -halo. In another embodiment, the -halo is substituted at the phenyl group's para-position. In another embodiment, -halo is -Cl. In another embodiment, -halo is -Cl and is substituted at the phenyl group's para-position. In another embodiment, -halo is 00 O O Br. In another embodiment, -halo is -Br and is substituted at the phenyl group's para-position. In another embodiment, -halo is In another embodiment, -halo is -I and is substituted at the phenyl group's para-position. In another embodiment, -halo is F. In another embodiment, -halo is -F and is substituted at the phenyl group's para-position.

O

OO

0 0 0 In another embodiment, Ar benzothiazolyl group.

In another embodiment, Arl benzooxazolyl group.

In another embodiment, Arl benzoimidazolyl group.

is a pyridazinyl group, X is O, m is 0, and Ar 2 is a is a pyridazinyl group, X is O, m is 0, and Ar 2 is a is a pyridazinyl group, X is O, m is 0, and Ar 2 is a In another embodiment, Arl is a pyridazinyl group, X is O, m is 0, and Ar 2 is In another embodiment, Arl is a pyridazinyl group, X is O, m is 0, and Ar 2 is I-(Re)r In another embodiment, ArT is a pyridazinyl group, X is O, m is 0, and Ar 2 is n ai (R8)o In another embodiment, Arl is a pyridazinyl group, X is O, m is 0, and Ar2 is -26- 00

O

O

-In(R)o In another embodiment, Ar is a pyridazinyl group, X is O, r is 1, m is 0, Ar 2 is and R8 is a -(Ci-C 6 )alkyl. In another embodiment, the -(Ci-C 6 )alkyl is substituted at the phenyl group's para-position. In another embodiment, the -(Ci-C 6 )alkyl is a tert-butyl group. In another embodiment, the -(Ci-C 6 )alkyl is a tert-butyl group and is substituted at the phenyl group's para-position. In another embodiment, the -(Ci-C 6 )alkyl is an iso-propyl group. In another embodiment, the -(Ci-C 6 )alkyl is an iso-propyl group and is substituted at the phenyl group's para-position.

0 In another embodiment, Arl is a pyridazinyl group, X is O, r is 1, m is 0, Ar 2 is and R 8 is -CF 3 In another embodiment, the -CF 3 is substituted at the phenyl group's para-position.

In another embodiment, Arl is a pyridazinyl group, X is O, r is 1, m is 0, Ar 2 is and R 8 is -halo. In another embodiment, the -halo is substituted at the phenyl group's para-position. In another embodiment, -halo is -Cl. In another embodiment, -halo is -Cl and is substituted at the phenyl group's para-position. In another embodiment, -halo is -27- 00 O O 0

O

00

O

O

0 Br. In another embodiment, -halo is -Br and is substituted at the phenyl group's para-position. In another embodiment, -halo is In another embodiment, -halo is -I and is substituted at the phenyl group's para-position. In another embodiment, -halo is In another embodiment, -halo is -F and is substituted at the phenyl group's 5 para-position.

In another embodiment, Ar is a thiadiazolyl group, X is O, m is 0, and Ar 2 is a benzothiazolyl group.

In another embodiment, Arl is a thiadiazolyl group, X is O, m is 0, and Ar 2 is a benzooxazolyl group.

In another embodiment, Arl is a thiadiazolyl group, X is O, m is 0, and Ar 2 is a benzoimidazolyl group.

In another embodiment, Arl is a thiadiazolyl group, X is O, m is 0, and Ar 2 is In another embodiment, Arl is a thiadiazolyl group, X is O, m is 0, and Ar 2 is -(Rii)q In another embodiment, Arl is a thiadiazolyl group, X is O, m is 0, and Ar 2 is In another embodiment, ArT is a thiadiazolyl group, X is O, m is 0, and Ar 2 is -28i In another embodiment, Arl is a thiadiazolyl group, X is O, r is 1, m is 0, Ar 2 is g I (R 8 )r 0 0 and Rg is a -(Ci-C 6 )alkyl. In another embodiment, the -(Ci-C 6 )alkyl is substituted at the phenyl group's para-position. In another embodiment, the -(Ci-C 6 )alkyl is a tert-butyl group. In another embodiment, the -(Ci-C 6 )alkyl is a tert-butyl group and is substituted at the phenyl group's para-position. In another embodiment, the -(Ci-C 6 )alkyl is an iso-propyl group. In another embodiment, the -(Ci-C 6 )alkyl is an iso-propyl group and is substituted at the phenyl group's para-position.

In another embodiment, Arl is a thiadiazolyl group, X is O, r is 1, m is 0, Ar 2 is 1-(R8)r and R 8 is -CF 3 In another embodiment, the -CF 3 is substituted at the phenyl group's para-position.

In another embodiment, Art is a thiadiazolyl group, X is O, r is 1, m is 0, Ar 2 is I Rs r and R 8 is -halo. In another embodiment, the -halo is substituted at the phenyl group's para-position. In another embodiment, -halo is -Cl. In another embodiment, -halo is -Cl and is substituted at the phenyl group's para-position. In another embodiment, -halo is -Br. In another embodiment, -halo is -Br and is substituted at the phenyl group's -29- 00 para-position. In another embodiment, -halo is In another embodiment, -halo is -I

O

Sand is substituted at the phenyl group's para-position. In another embodiment, -halo is In another embodiment, -halo is -F and is substituted at the phenyl group's Spara-position.

In the Phenylene Compounds that have an R 3 group, the R 3 group can be attached to the carbon atom at the 5- and/or 6-position of the phenylene ring. In one c embodiment, an R 3 group is attached to the carbon at the 2-position of the phenylene Sring. In another embodiment, an R 3 group is attached to the carbon at the 3-position of Sthe phenylene ring. In another embodiment, an R 3 group is attached to the carbon at the 00 10 5-position of the phenylene ring. In another embodiment, an R 3 group is attached to the carbon at the 6-position of the phenylene ring.

In another embodiment, an R 3 group is a -(Ci-Co 1 )alkyl group and the R 3 group is attached to the carbon at the 2-position of the phenylene ring. In another embodiment, an R 3 group is a -(Ci-Clo)alkyl group and the R 3 group is attached to the carbon at the 3-position of the phenylene ring. In another embodiment, an R 3 group is a -(Ci-Cio)alkyl group and the R 3 group is attached to the carbon at the 5-position of the phenylene ring.

In another embodiment, an R 3 group is a -(Ci-Clo)alkyl group and the R 3 group is attached to the carbon at the 6-position of the phenylene ring.

In another embodiment, an R 3 group is -CH 3 and the R 3 group is attached to the carbon at the 2-position of the phenylene ring. In another embodiment, an R 3 group is

-CH

3 and the R 3 group is attached to the carbon at the 3-position of the phenylene ring.

In another embodiment, an R 3 group is -CH 3 and the R 3 group is attached to the carbon at the 5-position of the phenylene ring. In another embodiment, an R 3 group is -CH 3 and the R 3 group is attached to the carbon at the 6-position of the phenylene ring.

In another embodiment, an R 3 group is -halo and the R 3 group is attached to the carbon at the 2-position of the phenylene ring. In another embodiment, an R 3 group is -halo and the R 3 group is attached to the carbon at the 3-position of the phenylene ring.

In another embodiment, an R 3 group is -halo and the R 3 group is attached to the carbon at the 5-position of the phenylene ring. In another embodiment, an R 3 group is -halo and the R 3 group is attached to the carbon at the 6-position of the phenylene ring.

In another embodiment, an R 3 group is -Cl and the R 3 group is attached to the carbon at the 2-position of the phenylene ring. In another embodiment, an R 3 group is 0 -Cl and the R 3 group is attached to the carbon at the 3-position of the phenylene ring. In another embodiment, an R 3 group is -Cl and the R 3 group is attached to the carbon at the of the phenylene ring. In another embodiment, an R 3 group is -Cl and the R 3 Sgroup is attached to the carbon at the 6-position of the phenylene ring.

0 5 In another embodiment, an R 3 group is -Br and the R 3 group is attached to the carbon at the 2-position of the phenylene ring. In another embodiment, an R 3 group is -Br and the R 3 group is attached to the carbon at the 3-position of the phenylene ring. In CI another embodiment, an R 3 group is -Br and the R 3 group is attached to the carbon at the CI 5-position of the phenylene ring. In another embodiment, an R 3 group is -Br and the R 3 00 0 10 group is attached to the carbon at the 6-position of the phenylene ring.

In another embodiment, an R 3 group is -F and the R 3 group is attached to the carbon at the 2-position of the phenylene ring. In another embodiment, an R 3 group is -F and the R 3 group is attached to the carbon at the 3-position of the phenylene ring. In another embodiment, an R 3 group is -F and the R 3 group is attached to the carbon at the 5-position of the phenylene ring. In another embodiment, an R 3 group is -F and the R 3 group is attached to the carbon at the 6-position of the phenylene ring.

In another embodiment, an R 3 group is -I and the R 3 group is attached to the carbon at the 2-position of the phenylene ring. In another embodiment, an R 3 group is -I and the R 3 group is attached to the carbon at the 3-position of the phenylene ring. In another embodiment, an R 3 group is -I and the R 3 group is attached to the carbon at the of the phenylene ring. In another embodiment, an R 3 group is -I and the R 3 group is attached to the carbon at the 6-position of the phenylene ring.

In another embodiment, m is 1, the R 3 group is a -(Ci-Clo)alkyl group, and the R 3 group is attached to the carbon at the 2-position of the phenylene ring. In another embodiment, m is 1, the R 3 group is a -(Ci-Clo)alkyl group, and the R 3 group is attached to the carbon at the 3-position of the phenylene ring.

In another embodiment, m is 1, the R 3 group is -CH 3 and the R 3 group is attached to the carbon at the 2-position of the phenylene ring. In another embodiment, m is 1, the

R

3 group is -CH 3 and the R 3 group is attached to the carbon at the 3-position of the phenylene ring.

-31- 0 In another embodiment, m is 1, the R 3 group is -halo, and the R 3 group is attached to the carbon at the 2-position of the phenylene ring. In another embodiment, m is 1, the

R

3 group is -halo, and the R 3 group is attached to the carbon at the 3-position of the Sphenylene ring.

0 5 In another embodiment, m is 1, the R 3 group is -Cl, and the R 3 group is attached to the carbon at the 2-position of the phenylene ring. In another embodiment, m is 1, the C R 3 group is -Cl, and the R 3 group is attached to the carbon at the 3-position of the C phenylene ring.

0 In another embodiment, m is 1, the R 3 group is -Br, and the R 3 group is attached to the carbon at the 2-position of the phenylene ring. In another embodiment, m is 1, the

R

3 group is -Br, and the R 3 group is attached to the carbon at the 3-position of the phenylene ring.

In another embodiment, m is 1, the R 3 group is and the R 3 group is attached to the carbon at the 2-position of the phenylene ring. In another embodiment, m is 1, the R 3 group is and the R 3 group is attached to the carbon at the 3-position of the phenylene ring.

In another embodiment, m is 1, the R 3 group is and the R 3 group is attached to the carbon at the 2-position of the phenylene ring. In another embodiment, m is 1, the R 3 group is and the R 3 group is attached to the carbon at the 3-position of the phenylene ring.

4.2 Phenylene Compounds of Formula (H) The invention also relates to Phenylene Compounds of formula (II) -32- 00 "2)n

O

Ri 6 2 e¢3 00 NH

NH

Ar 2

(II)

where R 1

R

2 Ar 2 X, and n are defined above for the Phenylene Compounds of formula

(I.

In one embodiment, X is O.

In another embodiment, X is S.

In another embodiment, Ar 2 is a benzoimidazolyl group.

In another embodiment, Ar 2 is a benzothiazolyl group.

In another embodiment, Ar 2 is a benzooxazolyl group.

In another embodiment, Ar 2 is -(R)o In another embodiment, Ar 2 is -(R8)o -33- 00 In another embodiment, Ar 2 is In another embodiment, Ar 2 is 00 In another embodiment, n is 0.

In another embodiment, n is 1.

In another embodiment, n is 2.

In another embodiment, n is 3.

In another embodiment, o is 0.

In another embodiment, o is 1.

In another embodiment, o is 2.

In another embodiment, o is 3.

In another embodiment, o is 4.

In another embodiment, q is 0.

In another embodiment, q is 1.

In another embodiment, q is 2.

In another embodiment, q is 3.

In another embodiment, q is 4.

In another embodiment, q is In another embodiment, q is 6.

In another embodiment, r is 0.

-34- 00 In another embodiment, r is 1.

(N In another embodiment, r is 2.

In another embodiment, r is 3.

In another embodiment, r is 4.

In another embodiment, r is In another embodiment, s is 0.

(Ni In another embodiment, s is 1.

00 In another embodiment, s is 2.

In another embodiment, s is 3.

In another embodiment, s is 4.

In another embodiment, R, is -halo.

In another embodiment, R, is -Cl.

In another embodiment, R, is -Br.

In another embodiment, R, is -1.

In another embodiment, R, is -F.

In another embodiment, RI-is CH 3 In another embodiment, RI is -C(halo) 3 In another embodiment, R, is -CH(halo) 2 In another embodiment, R, is -CH 2 (halo).

In another embodiment, n is 1 and R 2 is -halo, -OH, -NH 2 -CN, or -NO 2 In another embodiment, n is 1 and R 2 is -(CI-CIO)alkyl, -(C 2 -CIO)alkenyl, -(C 2 C IO)alkynyl, -(C 3 -C IO)cycloalkyl, -(C 8

-C

14 )bicycloalkyl, -(C 8 -C 14 )tricycloalkyl, C io)cycloalkenyl, -(C 8 -C 14 )bicycloalkenyl, -(C 8 -C 1 4)tricycloalkenyl, to 7membered)heterocycle, or to 10-membered)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R 5 groups.

35 0 0 In another embodiment, n is 1 and R 2 is -phenyl, -naphthyl, -(Cl4)aryl or to each of which is unsubstituted or substituted with one or more

R

6 groups.

SIn another embodiment, Ar 2 is a benzothiazolyl group and s is 1.

S 5 In another embodiment, Ar 2 is a benzoimidazolyl group and s is 1.

0 5 In another embodiment, Ar 2 is a benzooxazolyl group and s is 1.

SIn another embodiment, Ar 2 is 00 C -(R8)o and 0 is 1.

In another embodiment, Ar 2 is S-(R)o and o is 1.

In another embodiment, Ar 2 is S(RI )q and q is 1.

In another embodiment, Ar 2 is -(R8)r and r is 1.

-36- 00 In another embodiment, Ar 2 is a benzothiazolyl group, s is 1, and R8 is -halo or

O

0 -(C 1

-C

6 alkyl.

In another embodiment, Ar 2 is a benzoimidazolyl group, s is 1, and R 8 is -halo or S-(CI-C 6 alkyl.

In another embodiment, Ar 2 is a benzooxazolyl group, s is 1, and R 8 is -halo or

-(C

1 alkyl.

C In another embodiment, Ar 2 is 00 '-(R8a)o o is 1, and Rg is -halo or -(C 1

-C

6 alkyl.

In another embodiment, Ar 2 is JjA(R)o o is 1, and R 8 is -halo or -(CI-C 6 alkyl.

In another embodiment, Ar 2 is l -(R8)r r is 1, and R 8 is -halo or -(C 1

-C

6 alkyl.

In another embodiment, Ar 2 is -37- 00 O O 0j? q is 1, and R 11 is -halo or -(Ci-C 6 alkyl.

In another embodiment, Ar 2 is r is 1, and R 8 is at the para-position of the phenyl ring.

In another embodiment, X is 0, and Ar 2 is a benzothiazolyl group.

In another embodiment, X is 0, and Ar 2 is a benzooxazolyl group.

In another embodiment, X is 0, and Ar 2 is a benzoimidazolyl group.

In another embodiment, X is 0, and Ar 2 is r (R11)q In another embodiment, X is 0, and Ar 2 is.

In another embodiment, X is 0, and Ar 2 is i -(R 8 )o In another embodiment, X is 0, and Ar 2 is -38- 00

O

j? 1-^ 0 In another embodiment, X is r is 1, A is In another embodiment, X is O, r is 1, Ar2 is and R 8 is a -(Ci-C 6 )alkyl. In another embodiment, the -(Ci-C 6 )alkyl is substituted at the phenyl group's para-position. In another embodiment, the -(Ci-C 6 )alkyl is a tert-butyl group. In another embodiment, the -C 6 )alkyl is a tert-butyl group and is substituted at the phenyl group's para-position. In another embodiment, the -(CI-C 6 )alkyl is an iso-propyl group. In another embodiment, the -(Ci-C 6 )alkyl is an iso-propyl group and is substituted at the phenyl group's para-position.

In another embodiment, X is O, r is 1, Ar 2 is and R 8 is -CF 3 In another embodiment, the -CF 3 is substituted at the phenyl group's para-position.

In another embodiment, X is O, r is 1, Ar 2 is and R 8 is -halo. In another embodiment, the -halo is substituted at the phenyl group's para-position. In another embodiment, -halo is -Cl. In another embodiment, -halo is -Cl and is substituted at the phenyl group's para-position. In another embodiment, -halo is -Br. In another embodiment, -halo is -Br and is substituted at the phenyl group's -39- 00 para-position. In another embodiment, -halo is In another embodiment, -halo is -I and is substituted at the phenyl group's para-position. In another embodiment, -halo is In another embodiment, -halo is -F and is substituted at the phenyl group's para-position.

O 5 Optical isomers of the Phenylene Compounds can be obtained by known techniques such as chiral chromatography or formation of diastereomeric salts from an C optically active acid or base.

In addition, one or more hydrogen, carbon or other atoms of a Phenylene 00 Compound can be replaced by an isotope of the hydrogen, carbon or other atoms. Such 0O compounds, which are encompassed by the present invention, are useful as research and diagnostic tools in metabolism pharmacokinetic studies and in binding assays.

4.3 Illustrative Phenylene Compounds illustrative Phenylene Compounds are listed below in Tables 1-10.

For the chemical structure depicted, at the head of each of Tables 1-5, a is independently 0 or 1. When a 0, the group at the position is When a 1, the group at the position (R8a) is other than is R 8 For the chemical structure depicted, at the head of each of Tables 6-10, a is independently 0 or 1. When a 0, the group at the position is When a 1, the group at the position is other than is Rg.

For the chemical structure depicted, at the head of each of Tables 6-10, b is independently 0 or 1. When b 0, the group at the position is When b 1, the group at the position is other than is R 8 00 00 Table 1 (la) and pharmaceutically acceptable salts thereof, where: Compound R8a Al c, d,e, and f) -Cl -HI A2 b, c, d, e, and f) -Cl -tert-butyl A3 b,c, d, e,and f) -Cl -iso-butyl A4 b, c, d, e, and f) -Cl -sec-butyl b, c, d, e, and f) -Cl -iso-propyl A6 b, c, d, e, and f) -Cl -n-propyl.

A7 b, c, d, e, and f) -Cl -cyclohexyl A8 b, c, d, e, and f) -Cl -tert-butoxy A9 b, c, d, e, and f) -Cl -iso-propoxy b, c, d, e, and f) -Cl -CF 3 All b, c, d, e, and f) -Cl -OCF 3 A 12 b, c, d, e, and f) -Cl -Cl A13 b, c, d, e, and f) -Cl -Br A14 b, c,d, e,and f) -Cl -1 b, c, d, e, and f) -Cl -n-butyl A16 b, c, d, e, and f) -Cl -n-propyl A 17 b, c,d,e, and f) -F -HI A18 b, c, d, e, and f) -F -tert-butyl A 19 b, c, d, e, and f) -F -iso-butyl b, c, d, e, and f) -F -sec-butyl A21 b, c, d, e, and 0) -F -iso-propyl A22 b, c, d, e, and f) -F -n-propyl A23 b, c, d, e, and f0 -F -cyclohexyl A24 b, c, d, e, and f0 -F -tert-butoxy b, c, d, e, and 0) -F -iso-propoxy -41- 00 00 A26 b, c, d, e, and f) -F -CF 3 A27 b, c, d, e, and f -F -OCF 3 A28 b, c, d, e, and f) -F -Cl A29 b, c, d, e, and f) -F -Br b, c, d, e, and f) -F -I A31 b, c, d, e, and f) -F -n-butyl A32 b, c, d, e, and f) -F -n-propyl A33 b, c, d, e, and f) -CH 3

-H

A34 b, c, d, e, and f) -CH 3 -iso-butyl b, c, d, e, and f) -CH 3 -tert-butyl A36 b, c, d, e, and f) -CH 3 -sec-butyl A37 b, c, d, e, and f) -CH 3 -iso-propyl A38 b, c, d, e, and f) -CH 3 -n-propyl A39 b, c, d, e, and f) -CH 3 -cyclohexyl b, c, d, e, and f) -CH 3 -tert-butoxy A41 b, c, d, e, and f) -CH 3 -iso-propoxy A42 b, c, d, e, and f) -CH 3

-CF

3 A43 b, c, d, e, and f) -CH 3

-OCF

3 A44 b, c, d, e, and f) -CH 3 -Cl b, c, d, e, and f) -CH 3 -Br A46 b, c, d, e, and f) -CH 3

-I

A47 b, c, d, e, and f) -CH 3 -n-butyl A48 b, c, d, e, and f) -CH 3 -n-propyl A49 b, c, d, e, and f) -CF 3

-H

b, c, d, e, and f) -CF 3 -tert-butyl A51 b, c, d, e, and f) -CF 3 -iso-butyl A52 b, c, d, e, and f) -CF 3 -sec-butyl A53 b, c, d, e, and f) -CF 3 -iso-propyl A54 b, c, d, e, and f) -CF 3 -n-propyl b, c, d, e, and f) -CF 3 -cyclohexyl A56 b, c, d, e, and f) -CF 3 -tert-butoxy A57 b, c, d, e, and f) -CF 3 -iso-propoxy A58 b, c, d, e, and f) -CF 3

-CF

3 A59 b, c, d, e, and f) -CF 3

-OCF

3 b, c, d, e, and f) -CF 3 -Cl A61 b, c, d, e, and f) -CF 3 -Br A62 b, c, d, e, and f) -CF 3

-I

A63 b, c, d, e, and f) -CF 3 -n-butyl A64 b, c, d, e, and f) -CF 3 -n-propyl b, c, d, e, and f) -CHF 2 -tert-butyl A66 b, c, d, e, and f) -CHF 2

-H

A67 b, c, d, e, and f) -CHF 2 -iso-butyl A68 b, c, d, e, and f) -CHF 2 -sec-butyl A69 b, c, d, e, and f -CHF 2 -iso-propyl b, c, d, e, and f) -CHF 2 -n-propyl A71 b, c, d, e, and f) -CHF 2 -cyclohexyl A72 b, c, d, e, and f) -CHF 2 -tert-butoxy A73 b, c, d, e, and f) -CHF 2 -iso-propoxy -42- 00 00 A74 b, c, d, e, and f) -CIHF 2

-CF

3 b, c, d, e, and f) -CHF 2

-OCF

3 A76 b, c, d, e, and f) -CHF 2 -Cl A77 b, c, d, e, and f) -CL-F 2 -Br A78 b, c, d, e, and f) -CI{F 2 -1 A79 b, c, d, e, and f) -CIF 2 -n-butyl b, c, d, e, and f) -CHF 2 -n-propyl A81 b, c,d, e,and f) -Br -H A82 b, c, d, e, and f) -Br -tert-butyl A83 b, c,d, e,and f) -Br -iso-butyl A84 b, c, d, e, and f) -Br -sec-butyl b, c, d, e, and f) -Br -iso-propyl A86 b, c, d, e, and f) -Br -n-propyl A87 b, c, d, e, and f) -Br -cyclohexyl A88 b, c, d,e,and f) -Br -tert-butoxy A89 b, c, d, e, and f) -Br -iso-propoxy b, c, d, e, and f) -Br -CF 3 A91 b, c, d, e, and f) -Br -OCF 3 A92 b, c,d, e,and f) -Br -CI A93 b, c, d, e, and f) -Br -Br A94 b, c,d,e, and f) -Br -1 b, c, d, e, and f) -Br -n-butyl A96 b, c, d, e, and f) -Br -n-propyl A97 b, c, d, e, and f) -1 -tert-butyl A98 b, c, d,e,and f) -1 -H A99 b, c, d,e,and f) -1 -iso-butyl A100 b, c, d, e, and f) -1 -sec-butyl AlOl b, c, d, e, and f) -I -iso-propyl A102 b, c, d, e, and f) -1 -n-propyl *A103 b, c, d, e, and f) -I -cyclohexyl *A104 b, c, d, e, and f) -1 -tert-butoxy A105 b, c, d, e, and f) -1 -iso-propoxy A 106 b, c, d, e, and f) -I -CF 3 A107 b, c, d, e, and f) -I -OCF 3 A108 b, c, d, e, and f) -1 -Cl A109 b, c, d, e, and f) -I -Br Al0(a, b, c,d, e,and f) -1 -1 Al 11 b, c, d, e, and f) -I -n-butyl Al 12 b, c, d, e, and f) -I -n-propyl In the column labeled "Compound": means that R 3 is -CH 3 means that R 3 is -Cl; means that R 3 is -Br; means that R 3 is -1; means that R 3 is and means that R 3 is in formula m 0.

-43 00 00 Table 2 (1b) and pharmaceutically acceptable salts thereof, where: Compound Rg.

Bi1 b,c, d, e,and f) -Cl -H B2 b, c, d, e, and f) -CI -tert-butyl B3 b,c, d.,e,and f) -CI -iso-butyl B4 b, c, d, e, and f) -Cl -sec-butyl B 5 b, c, d, e, and f) -Cl -iso-propyl B6 b, c, d, e, and f) -Cl -n-propYlI B7 b, c, d, e, and f) -Cl -cyclohexyl B 8(a, b,c, d, e,and f) -Cl -tert-butoxy B9 b, c, e, and f) -Cl -iso-propoxy b,c, d, e,and f) -Cl -CF 3 B 11 b, c, d, e, and f) -Cl -OCF 3 B 12 b, c,d, e,andtf) -Cl -Cl B 13 b, c, d, e, and f) -Cl -Br B 14 b,c, d, e,and f) -Cl -I B 15 b, c, d, e, and f) -Cl -n-butyl B 16 b,c, d, e,and f) -CI -n-propyl B 17 b, c,d,e, and f) -F -H B 18 b, c, d, e, and f) -F -tert-butyl B 19 b, c, d, e, and -F -iso-butyl b, c, d, e, and f) -F -sec-butyl B21 b, c, d, e, and f) -F 4-1so-propyl B22 b, c, d, e, and f) -F -n-propyl B23 d, e,and f) -Fclhey B24 b, c, d, e, and f7) -F -tert-butoxy -44- 00 00 B25 b, c, d, e, and f) -F -iso-propoxy B26 b, c, d, e, and f) -F -CF 3 B27 b, c, d, e, and f) -F -OCF 3 B28 b, c, d, e, and f) -F -Cl B29 b, c, d, e, and f) -F -Br b, c, d, e, and f) -F -I B31 b, c, d, e, and f) -F -n-butyl B32 b, c, d, e, and f) -F -n-propyl B33 b, c, d, e, and f) -CH 3

-H

B34 b, c, d, e, and f) -CH 3 -iso-butyl b, c, d, e, and f) -CH 3 -tert-butyl B36 b, c, d, e, and f) -CH 3 -sec-butyl B37 b, c, d, e, and f) -CH 3 -iso-propyl B38 b, c, d, e, and f) -CH 3 -n-propyl B39 b, c, d, e, and f) -CH 3 -cyclohexyl b, c, d, e, and f) -CH 3 -tert-butoxy B41 b, c, d, e, and f) -CH 3 -iso-propoxy B42 b, c, d, e, and f) -CH 3

-CF

3 B43 b, c, d, e, and f) -CH 3

-OCF

3 B44 b, c, d, e, and f) -CH 3 -Cl b, c, d, e, and f) -CH 3 -Br B46 b, c, d, e, and f) -CH 3

-I

B47 b, c, d, e, and f) -CH 3 -n-butyl 848 b, c, d, e, and f) -CH 3 -n-propyl B49 b, c, d, e, and f) -CF 3

-H

b, c, d, e, and f) -CF 3 -tert-butyl B51 b, c, d, e, and f) -CF 3 -iso-butyl B52 b, c, d, e, and f) -CF 3 -sec-butyl B53 b, c, d, e, and f) -CF 3 -iso-propyl B54 b, c, d, e, and f) -CF 3 -n-propyl b, c, d, e, and f) -CF 3 -cyclohexyl B56 b, c, d, e, and f) -CF 3 -tert-butoxy B57 b, c, d, e, and f) -CF 3 -iso-propoxy B58 b, c, d, e, and f) -CF 3

-CF

3 B59 b, c, d, e, and f) -CF 3

-OCF

3 b, c, d, e, and f) -CF 3 -Cl B61 b, c, d, e, and f) -CF 3 -Br B62 b, c, d, e, and f) -CF 3

-I

B63 b, c, d, e, and f) -CF 3 -n-butyl B64 b, c, d, e, and f) -CF 3 -n-propyl b, c, d, e, and f) -CLIP 2 -tert-butyl B66 b, c, d, e, and f) -CLI 2

-H

B67 b, c, d, e, and f) -CLIF2 -iso-butyl B68 b, c, d, e, and f) -CLI 2 -sec-butyl B69 b, c, d, e, and f) -CIP 2 -iso-propyl b, c, d, e, and f) -CIF2 -n-propyl B71 b, c, d, e, and f) -CHF 2 -cyclohexyl 872 b, c, d, e, and f) -CHF2 -tert-butoxy 00 00 B73 b, c, d, e, and f) -CLLF 2 -iso-propoxy B74 b, c, d, e, and f) -CHF 2

-CF

3 b, c, d, e, and f) -CHF 2

-OCF

3 B76 b, c, d, e, and f) -CHF 2 -Cl B77 b, c, d, e, and f) -CHrF 2 -Br B78 b, c, d, e, and f) -CHF 2

-I

B79 b, c, d, e, and f) -CHF 2 -n-butyl b, c, d, e, and f) -CHF 2 -n-propyl B81 b, c, d,e,and f) -Br -H B82 b, c, d, e, and f) -Br -tert-buty1 B83 b, c, d, e, and f) -Br -iso-butyl- B84 b, c, d, e, and f) -Br -sec-buty1 b, c, d, e, and f) -Br -iso-propyl B86 b, c, d, e, and f) -Br -n-propyl B87 b, c, d, e, and f) -Br -cyclohexyl B88 b, c, d, e, and f) -Br -tert-butoxy B89 b, c, d, e, and f) -Br -iso-propoxy b, c, d, e, and f) -Br -CF 3 B91 b, c, d, e, and f) -Br -OCF 3 B92 b, c, d, e, and f) -Br -CI B93 b, c, d, e, and f) -Br -Br B94 c, d,e, and f) -Br -1 b, c, d, e, and f) -Br -n-butyl B96 b, c, d, e, and f) -Br -n-propyl B97 b, c, d, e, and f) -1 -tert-butyl B98 c, d,e, and f) -1 -H B99 b, c, d, e, and f) -I -iso-butyl B 100 b, c, d, e, and fT) -1 -sec-butyl B 101 b, c, d, e, and fT) -1 -iso-propyl B 102 b, c, d, e, and fT) -1 -n-propyl B 103 b, c, d, e, and f) -1 -cyclohexyl B 104 b, c, d, e, and f) -I -tert-butoxy B 105 b, c, d, e, and f) -1 -iso-propoxy B 106 b, c,d, e,and f) -1 -CF 3 B 107 b, c, d, e, and f) -I -OCF 3 B 108 b, c, d, e, and f) -I -Cl B 109 b, c,d,e, and f) -I-Br B 110O(a,b, c, d,e, and f) -I BillI b, c, d, and fT) -1 -n-butyl B 112 b, c, d, e, and f) -1 I -n-propyl In the column labeled "Compound": means that R 3 is -CH 3 means that R 3 is -Cl; means that R 3 is -Br; means that R 3 is -I; means that R 3 is and means that R 3 is in formula m 0.

-46 Table 3 GOc and pharmaceutically acceptable salts thereof, where: Compound RI R8.

C1 b, c,d,e, andtf) -Cl -H C2 b, c, d, e, and f) -Cl -tert-butyl C3 b, c, d, e, and f) -Cl -iso-butyl C4 b, c, d, e, and f) -Cl -sec-butyl b, c, d, e, and f) -Cl -iso-propyl C6 b, c, d, e, and f) -Cl -n-propyl C7 b, c, d, e, and fT) -Cl -cyclohexyl C8 b, c, d, e, and f) -Cl -tert-butoxy C9 b, c, d, e, and f) -Cl -iso-propoxy CIO b, c,d, e,and f) -Cl -CF 3 C1l1 b, c, d, e, and fT) -Cl -OCF 3 C 12 b, c, d, e, and f) -Cl -Cl C13 b, c, d, e, and f) -Cl -Br C14 b,c, d, e,and f) -Cl -1 b, c, d,e,and f) -Cl -n-butyl C16 b, c, d, e, and f) -Cl -n-propyl C 17 b, c,d, e,and f) -F -H C18 b, c, d, e, and f) -F -tert-butyl C19 b, c, d, e, and fT) -F -iso-butyl b, c, d, e, and fT) -F -sec-butyl C21 b, c, d, e, and f) -F -iso-propyl C22 b, c, d, e, and f) -F -n-propyl C23 b, c, d, e, and f) -F -cyclohexyI C24 b, c, d, e, and f) -F -tert-butoxy b, c, d, e, and f) -F -iso-propoxy 47 00 00 C26 b, c, d, e, and f) -F -CF 3 C27 b, c, d, e, and f) -F -OCF 3 C28 b, c,d, e,and f) -F -Cl C29 b, c,d,e, and f) -F -Br b, c,d, e,andf) -F -I C31 b, c, d, e, and f) -F -n-butyl C32 b, c, d, e, and f) -F -n-propyl C33 b, c, d, e, and f) -Gil 3

-H

C34 b, c, d, e, and f) -CH- 3 -iso-butyl b, c, d, e, and f) -CH 3 -tert-butyl C36 b, c, d, e, and fT) -CH 3 -sec-butyl C37 b, c, d, e, and f) -CH 3 -iso-propyl C38 b, c, d e, and f) -CH 3 -n-propyl C39 b, c, d, e, and f) -CH 3 -cyclohexyl b, c, d, e, and f) -CH 3 -tert-butoxy C41 b, c, d, e, and f) -Cil 3 -iso-propoxy C42 b, c, d, e, and f) -CH 3

-CF

3 C43 b, c, d, e, and f) -CH 3

-OCF

3 C44 b, c, d,e,and f) -CH 3 -Cl b, c, d, e, and f) -CH 3 -Br C46 b, c, d, e, and f) -Cl! 3 C47 b, c, d, e, and f) -CH 3 -n-butyl C48 b, c, d, e, and f) -CH 3 -n-propyl C49 b, c, d, e, and f) -CF 3

-H

b, c, d, e, and f) -CF 3 -tert-butyl 1 b, c, d, e, and f) -CF 3 -iso-butyl C52 b, c, d, e, and f) -CF 3 -sec-butyl C53 b, c, d, e, and f) -CF 3 -iso-propy1 C54 b, c, d, e, and f) -CF 3 -n-propyl b, c, d, e, and f) -CF 3 -cyclohexyl C56 b, c, d, e, and Q) -CF 3 -tert-butoxy C57 b, c, d, e, and f) -CF 3 -iso-propoxy C58 b, c, d, e, and f) -CF 3

-CF

3 C59 b, c, d, e, and f) -CF 3

-OCF

3 b, c, d, e, and f) -CF 3 -Cl C61 b, c, d,e,and f) -CF 3 -Br C62 b, c, d, e, and f) -CF 3

-I

C63 b, c, d, e, and f) -CF 3 -n-butyl C64 b, c, d, e, and f) -CF 3 -n-propyl b, c, d, e, and f) -CHF 2 -tert-butyl C66 b, c, d, e, and f) -CHF 2

-H

C67 b, c, d, e, and f) -CHF 2 -iso-butyl C68 b, c, d, e, and f) -Cl-F 2 -sec-butyl C69 b, c, d, e, and f7) -CHF 2 -iso-propyl b, c, d, e, and f) -CHF 2 -il-propyl C7 1 b, c, d, e, and f) -ClIF 2 -cyclohexy IC72 b, c, d, e, and f) -CHF 2 -tert-butoxy IC73 b, c, d, e, and f) -CIHF 2 -iso-propoxy -48 00 00 C74 b, c, d, e, and f) -CHF 2

-CF

3 b, c, d, e, and f) -CHF 2

-OCF

3 C76 b, c, d, e, and f) -CHF 2

-CI

C77 b, c, d, e, and f) -CHF 2 -Br C7 8 b, c, d, e, and f) -CHF 2

-I

C79 b, c, d, e, and f) -CHF 2 -n-butyl b, c, d, e, and f) -CHF 2 -n-propyl C81 b, c,d, e,and f) -Br -H C82 b, c, d, e, and f) -Br -tert-butyl C83 b, c, d, e, and f) -Br -iso-butyl C84 b, c, d, e, and f) -Br -sec-butyl b, c, d, e, and f) -Br -iso-propyl C86 b, c, d, e, and f) -Br -n-propyl C87 b, c, d, e, and f) -Br -cyclohexyl C88 b, c, d, e, and 0) -Br -tert-butoxy C89 b, c, d, e, and f) -Br -iso-propoxy b, c, d, e, and f) -Br -CF 3 C91 b, c, d, e, and f) -Br -OCF 3 C92 b, c, d, e, and f) -Br -Cl C93 b, c, d, e, and f) -Br -Br C94 b, c,d, e,and f) -Br -1 b, c, d, e, and f) -Br -n-butyl C96 b, c, d, e, and f) -Br -n-propyl C97 b, c, d, e, and f) -1 -tert-butyl C98 c, d,e, and f) -1 -H C99 b, c, d, e, and f) -1 -iso-butyl C100 b, c, d, e, and f) -I-sec-butyl C101 b, c, d, e, and f) -I-iso-propyl C102 b, c, d, e, and f) -I-n-propyl C 103 b, c, d, e, and f) -I-cyclohexyl C 104 b, c, d, e, and -tert-butoxy C 105 b, c, d, e, and f) -so-propoxy C106 b, c, d, e, and f) -I-CF 3 C 107 b, c, d, e, and f) -I-OCF 3 C108 b, c, d, e, and f) -1-Cl C109 b, c, d, e, and f) -I-Br C 110(a, b, c,d, e,and f) -1 C11Ii b, c, d, e, and f) -I-n-butyl C 112 b, c, d, e, and f) -I-n-propyl In the column labeled "Compound": means that R 3 is -Gil 3 means that R 3 is -Cl; means that R 3 is -Br; means that R 3 is -1; means that R 3 is and means that R 3 is in formula m 0.

49- 00 00 Table 4 (Id) and pharmaceutically acceptable salts thereof, where: Compound D1 b,c, d, e,and f) -Cl -HI D2 b, c, d, e, and f) -CI -tert-butyI D3 b, c, d, e, and f) -Cl -iso-butyl D4 b, c, d, e, and f) -CI -sec-butyl b, c, d, e, and f) -Cl -iso-propyl D6 b, c, d, e, and f) -Cl -n-propyl D7 b, c, d, e, and f) -Cl -cyclohexYl D8 b, c, d, e, and f) -Cl -tert-butoxy D9 b, c, d, e, and f) -CI -iso-propoxy DLO b,c, d, e,and f) -Cl -CF 3 DlI1 b, c, d, e, and f) -Cl -OCF 3 D12 b, c, d, e, and f) -Cl -Cl D 13 b, c, d, e, and f) -Cl -Br D14 b,c, d, e,and f) -Cl -I b, c, d, e, and f) -Cl -n-butyl.

D16 b, c, d, e, and f) -Cl -n-propyl D17 c, d,e, andtf) -F -H D18 b, c, d, e, and f) -F -tert-butyl D 19 b, c, d, e, and f) -F -iso-butyl b, c, d, e, and f) -F -sec-butyl D21 b, c, d, e, and f) -F -iso-propyl D22 b, c, d, e, and f) -F -n-propyl D23 b, c, d, e, and f) -F -cyclohexyl D24 b, c, d, e, and f)-F -tert-butoxy b, c, d, e, and 0-F -iso-propoxy D26 b, c, d, e, and f) -F -CF 3 00 00 D27 b, c, d, e, and f) -F -OCF 3 D28 b, c, d, e, and f) -F -Cl D29 b, c, d, e, and f) -F -Br b, c, d, e, and f) -F -I D31 b, c, d, e, and f) -F -n-butyl D32 b, c, d, e, and f) -F -n-propyl D33 b, c, d, e, and f) -CH 3

-H

D34 b, c, d, e, and f) -CH 3 -iso-butyl b, c, d, e, and f) -CH 3 -tert-butyl D36 b, c, d, e, and f) -CH 3 -sec-butyl D37 b, c, d, e, and f) -CH 3 -iso-propyl D38 b, c, d, e, and f) -CH 3 -n-propyl D39 b, c, d, e, and f) -CH 3 -cyclohexyl D40 b, c, d, e, and f) -CH 3 -tert-butoxy D41 b, c, d, e, and f) -CH 3 -iso-propoxy D42 b, c, d, e, and f) -CH 3

-CF

3 D43 b, c, d, e, and f) -CH 3

-OCF

3 D44 b, c, d, e, and f) -CH 3 -Cl b, c, d, e, and f) -CH 3 -Br D46 b, c, d, e, and f) -CH 3

-I

D47 b, c, d, e, and f) -CH 3 -n-butyl D48 b, c, d, e, and f) -CR 3 -n-propyl D49 b, c, d, e, and f) -CF 3

-H

b, c, d, e, and f) -CF 3 -tert-butyl D51 b, c, d, e, and f) -CF 3 -iso-butyl D52 b, c, d, e, and f) -CF 3 -sec-butyl D53 b, c, d, e, and f) -CF 3 -iso-propyl D54 b, c, d, e, and f) -CF 3 -n-propyl b, c, d, e, and f) -CF 3 -cyclohexyl D56 b, c, d, e, and f) -CF 3 -tert-butoxy D57 b, c, d, e, and f) -CF 3 -iso-propoxy D58 b, c, d, e, and f) -CF 3

-CF

3 D59 b, c, d, e, and f) -CF 3

-OCF

3 b, c, d, e, and f) -CF 3 -Cl D61 b, c, d, e, and f) -CF 3 -Br D62 b, c, d, e, and f) -CF 3

-I

D63 b, c, d, e, and f) -CF 3 -n-butyl D64 b, c, d, e, and f) -CF 3 -n-propyl b, c, d, e, and f) -CHF 2 -tert-butyl D66 b, c, d, e, and f) -CHF 2

-H

D67 b, c, d, e, and f) -CBF 2 -iso-butyl D68 b, c, d, e, and f) -CHF 2 -sec-butyl D69 b, c, d, e, and f) -CBF 2 -iso-propyl b, c, d, e, and f) -ClF 2 -n-propyl D71 b, c, d, e, and f -ClF 2 -cyclohexyl D72 b, c, d, e, and f) -CHF 2 -tert-butoxy D73 b, c, d, e, and f) -CBlF 2 -iso-propoxy D74 b, c, d, e, and f) -CBF 2

-CF

3 -51- 00 00 D75 b, c, d, e, and f) -CHjF 2

-OCF

3 D76 b, c, d, e, and fT) -CHF 2

-CI

D77 b, c, d, e, and fT) -CHF 2 -Br D78 b, c, d, e, and IT) -ClHF 2 D79 b, c, d, e, and f) -CFiF 2 -n-butyl b, c, d, e, and

-CH-IF

2 -n-propy D81 b, c,d,e, andtf) -Br -H D82 b, c, d, e, and IT) -Br -tert-butyl D83 b, c, d, e, and f) -Br -iso-butyl D84 b, c, d, e, and f) -Br -sec-butyl b, c, d, e, and f) -Br -iso-propyl D86 b, c, d, e, and f) -Br -n-propyl D87 b, c, d, e, and f) -Br -cyclohexyl D88 b, c, d, e, and f) -Br -tert-butoxy D89 b, c, d, e, and f) -Br -iso-propoxy b, c, d, e, and IT) -Br -CF 3 D91 b, c, d, e, and f) -Br -OCF 3 D92 b, c, d, e, and IT) -Br -Cl D93 b, c, d, e, and IT) -Br -Br D94 b, c,d, e,and f) -Br -I b, c, d, e, and f) -Br -n-butyl D96 b, c, d, e, and f) -Br -n-propyl D97 b, c, d, e, and IT) -I-teit-butyl D98 c, d,e, and f) D99 b, c, d, e, and f) -i-iso-butyl D100 b, c, d, e, and f) -I-sec-butyl D101 b, c, d, e, and IT) -I-iso-propyl *102 b, c, d, e, and f) -I-n-propyl *D103 b, c, d, e, and f) -I-cyclohexyl *104 b, c, d, e, and IT) -I-tert-butoxy D105 b, c, d, e, and IT) -I-iso-propoxy *D106 b, c,d, e,and f) -I-CF 3 *D107 b, c, d, e, and fT) -I-OCF 3 D108 b, c,d, e, and f) -I-Cl D109 b, c, d, e, and f) -I-Br D1L10(a, b, c,d, e, and f) -1 *D111 b,c, d,"e,and f) -I-n-butyl *D112 b, c, d, e, and f) -I-n-prop 1_ In the column labeled "Compound": means that R 3 is -CH 3 means that R 3 is -Cl; means that R 3 is -Br; means that R 3 is -I; means that R 3 is and (IT) means that R 3 is in formula m =0.

52- Table (Ila) and pharmaceutically acceptable salts thereof, where: Compound R, R8.

El -Cl -H E2 -Cl -tert-butyl E3 -Cl -iso-butyl E4 -Cl -sec-butyl -Cl -iso-propyl E6 -Cl -n-propy1 E7 -Cl -cyclohexyl E8 -Cl -tert-butoxy E9 -Cl -iso-propoxy ElO -Cl -CF 3 Ell -Cl -OCF 3 E12 -Cl -Cl E13 -Cl -Br E14 -Cl -1 -Cl -n-butyl -Cl -n-prop 1 -F7 -H -F -tert-butyl E9-F -iso-butyl -F -sec-butyl -F -iso-propyl -F2 -n-propyl E23 -F -cyclohexyl E24 -F -tert-butoxy -F -zso-propoxy 53 00 00 E26 -F -CF 3 E27 -F -OCF 3 E28 -F -Cl E29 -F -Br -F -I E3 1 -F -n-butyl E32 -F -n-propyl E33 -Gil 3

-H

E34 -Gil 3 -iso-butyl -Gil 3 -tert-butyI E36 -GH 3 -sec-butyl E37 -CH 3 -iso-propyl E38 -CH 3 -n-propyl E39 -GH 3 -cyclohexyl

-GH

3 -tert-butoxy E41 -Gil 3 -iso-propoxy E42 -Gil 3

-CF

3 E43 -Gil 3

-OGF

3 E44 -Gil 3 -Cl -Gil 3 -Br E46 -Gil 3

-I

E47 -Gil 3 -n-butyl E48 -Gil 3 -n-propyl E49 -CF 3

-H

-CF

3 -tert-butyl E51 -CF 3 -iso-butyl E52 -CF 3 -sec-butyl E53 -CF 3 -iso-propyl E54 -CF 3 -n-propyl

-CF

3 -cyclohexyl E56 -CF 3 -tert-butoxy E57 -CF 3 -iso-propoxy E58 -CF 3

-CF

3 E59 -CF 3

-OCF

3

-CF

3 -Cl E61 -CF 3 -Br E62 -CF 3

-I

E63 -CF 3 -n-butyl E64 -CF 3 -n-propyl

-CHF

2 -tert-butyl E66 -CHF 2

-H

E67 -CHF 2 -iso-butyl E68 -Cl-F 2 -sec-butyl E69 -CHF 2 -iso-proyl

-CBF

2 -n-propyl E71 -CHF 2 -cyclohexyl E72 -CB-F 2 -tert-butoxy E73 -GIHF 2 -iso-propoxy 54- 00 00 E74 -CHF 2

-CF

3

-CHF

2

-OCF

3 E76 -CHF 2 -Cl E77 -CHF 2 -Br E78 -CHF 2 -1 E79 -CHF 2 -n-butyl

-CHF

2 -n-propyl E81 -Br -H E82 -Br -tert-butyl E83 -Br -iso-butyl E84 -Br -sec-butyl -Br -iso-propyl E86 -Br -n-propyl E87 -Br -cyclohexyl E88 -Br -tert-butoxy E89 -Br -iso-propoxy -Br -CF 3 E91 -Br -OCF 3 E92 -Br -Cl E93 -Br -Br E94 -Br -I -Br -n-butyl E96 -Br -n-propyl E97 -1 -tert-butyl E98 -I -H E99 -1 -iso-butyl E100 -1 -sec-butyl E101 -I -iso-propyl E102 -I-n-propyl E103 -I-cyclohexyl El104 -I-tert-butoxy E105 -1 -iso-propoxy E106 -1 -CF 3 E107 -1 -OCF 3 E108 -I -Cl E109 -1 -Br -1 -1 Elil -1 -n-butyl El 12 -1 -n-propyl 55 00 00 Table 6 (Ie) and pharmaceutically acceptable salts thereof, where: Compound Y- R, (R 8 (R8)b FlI b, c,d, e,andtf) S -Cl -Cl -H F2 b,c, d,e, and f) S -Cl -Br -H F3 b, c,d, e,and f) S -Cl -F -H F4 b,c, d, e,and f) S -CI -CH 3

-H

b, c,d, e,and f) S -Cl -CF 3

-H

P6 b, c, d, e, and f) S -Cl -OCH 3

-H

F7 b, c, d, e, and f) S -Cl -OCH 2

CH

3

-H

F8 b, c, d, e, and f) S -Cl -OCF 3

-H

F9 b, c, d, e, and f) S -Cl -tert-butyl -H FlO b, c, d, e, and f) S -Cl -iso-propyl -H Fl1 b, c, d, e, and f) S -Cl -CH 3

-CH

3 F12 b,c, d, e,and f) S -Cl -H -H F13 b,c, d, e,and f) S -Cl -H -Cl F14 b, c, d, e, and f) S -Cl -H -Br b, c, d,e,and f) S -Cl -H -F F16 b, c, d, e, and f) S -Cl -H -CH 3 F17 b, c, d, e, and f) S -Cl -H -CF 3 F18 b, c, d, e, and f) S -Cl -H -OCH 3 F19 b, c, d, e, and f) S -Cl -H -OCH 2

CH

3 b, c, d, e, and fT) S -Cl -H -OCF 3 P21 b, c, d, e, and f) S -Cl -H -tert-buty1 P22 b, c, d, e, and f) S -Cl -H -iso-propyl F23 b,c, d, e,andtf) S -Gil 3 -Cl -H F24 b, c, d, e, and f) S -Gil 3 -Br -H b, c,d, e,and f) S -CH 3 I -F -H 56 00 00 P26 b, c, d, e, and f) S -OH 3

-CH

3

-H

P27 b, c, d, e, and f) S -OH 3

-CF

3

-H

F28 b, c, d, e, and f) S -OH 3 -00H 3

-H

F29 b, c, d, e, and f) S -CH 3

-OCH

2

CH

3

-H

b, c, d, e, and f) S -CH 3 -00F 3

-H

F31 b, c, d, e, and f) S -OH 3 -tert-butyl -H F32 b, c, d, e, and f) S -CH 3 -iso-propyl -H F33 b, c, d, e, and f) S -0113 -OH 3

-CH

3 F34 b, c,d, e,and f) S -OH 3 -H -H F3 5 b, c, d, e, and f) S -CH 3 -H -Cl F36 b, c, d.,e,and f) S -CH 3 -H -Br F37 b,c, d, e,and f) S -OH 3 -H -F F38 b, c, d, e, and f) S -Cf! 3 -H -OH 3 F39 b, c, d, e, and f) S -OH 3 -H -CF 3 b, c, d, e, and f) S -OH 3 -H -OCH 3 P41 b, c, d, e, and f) S -OH 3 -H -OCH 2

CH

3 F42 b, c, d, e, and f) S -OH 3 -H -00F 3 F43 b, c, d, e, and f) S -OH 3 -H -tert-butyl F44 b, c, d, e, and f) S -OH 3 -H -iso-propyl c, d,e, and f) S -CF 3 -C1 -H F46 b, c, d, e, and f) s -CF 3 -Br -H P47 b, c, d,e,and f) S -OP 3 -F -H F48 b, c, d, e, and f) S -OF 3

-CH

3

-H

F49 b, c, d, e, and 0) S -OP 3

-OF

3

-H

b, c, d, e, and f) S -CF 3

-OCH

3

-H

F51 b, c, d, e, and f) S -OF 3 -00120113 -H F52 b, c, d, e, and f) s -CF 3 -00F 3

-H

F53 b, c, d, e, and f) S -CF 3 -tert-butyl -H F54 b, c, d, e, and f) S -CF 3 I -iso-propyl -H b, c, d, e, and 0) S -OF 3 -0113 -OH 3 F56 b, c, d,e,and f) S -CF 3 -H -H F57 b, c, d, e, and f) S -CF 3 -H -Cl F58 b, c, e, and f) S -CF 3 -H -Br F59 b, c, d.,e,and f) S -OF 3 -H -F b, c, d, e, and f) S- -OF 3 -H -OH 3 F61 b, c, d, e, and f) S -OP 3 -H -CF 3 P62 b, c, d, e, and f) S -OP 3 -H -OCH 3 F63 b, c, d, e, and f) S- -OF 3 -H -00120113 F64 b, c, d, e, and f) S -OP 3 -H -OCP 3 b, c, d, e, and f) S -OF 3 -H -tert-butyl F66 b, c, d, e, and f) S -CF 3 -H -iso-propyl F67 b, c, d, e, and f) S -OHF 2 01l -H P68 b, c, d, e, and f) S -OHP 2 -Br -H F69 b, c, d,e,and f) S -OHF 2 -F -H b, c, d, e, and 0) S -OH-F 2 -0113 -H P71 b, c, d, e, and f) S -CHF 2

-CF

3

-H

F72 b, c, d, e, and f) S -ClIP 2 -00113 -H P73 b, c, d, e, and f) S -OHIF 2 -001120113 -H 57 00 00 F74 b, c, d, e, and f) S -CHF 2

-OCF

3

-H

b, c, d, e, and f) S -CHF 2 -tert-butyl -H F76 b, c, d, e, and f) S -CHF 2 -iso-propyl -H F77 b, c, d, e, and f) S -CHF 2

-CH

3

-CH

3 F78 b, c, d, e, and f) S -CHF 2 -H -H F79 b, c, d, e, and f) S -CHF 2 -H -Cl b, c, d, e, and f) S -CHF 2 -H -Br F81 b, c, d, e, and f) S -CHF 2 -H -F F82 b, c, d, e, and f) S -CHF 2 -H -CH 3 F83 b, c, d, e, and f) S -CHF 2 -H -CF 3 F84 b, c, d, e, and f) S -CHF 2 -H -OCH 3 b, c, d, e, and f) S -CHF 2 -H -OCH 2

CH

3 F86 b, c, d, e, and f) S -CHF 2 -H -OCF 3 F87 b, c, d, e, and f) S -CHF 2 -H -tert-butyl F88 b, c, d, e, and f) S -CHF 2 -H -iso-propyl F89 b, c, d, e, and f) S -Br -Br -H b, c, d, e, and f) S -Br -Cl -H F91 b, c, d, e, and f) S -Br -F -H F92 b, c, d, e, and f) S -Br -CH 3

-H

F93 b, c, d, e, and f) S -Br -CF 3

-H

F94 b, c, d, e, and f) S -Br -OCH 3

-H

b, c, d, e, and f) S -Br -OCH 2

CH

3

-H

F96 b, c, d, e, and f) S -Br -OCF 3

-H

F97 b, c, d, e, and f) S -Br -tert-butyl -H F98 b, c, d, e, and f) S -Br -iso-propyl -H F99 b, c, d, e, and f) S -Br -CH 3

-CH

3 F100 b, c, d, e, andf) S -Br -H -H F101 b, c, d, e, and f) S -Br -H -Cl F102 b, c, d, e, and f) S -Br -H -Br F103 b, c, d, e, and f) S -Br -H -F F104 b, c, d, e, and f) S -Br -H -CH3 F105 b, c, d, e, and f) S -Br -H -CF 3 F106 b, c, d, e, and f) S -Br -H -OCH 3 F107 b, c, d, e, and f) S -Br -H -OCH 2

CH

3 F108 b, c, d, e, and f) S -Br -H -OCF 3 F109 b, c, d, e, and f) S -Br -H -tert-butyl F110 b, c, d, e, and f) S -Br -H -iso-propyl F111 b, c, d, e, and f) S -I -Cl -H F112 b, c, d, e, and f) S -I -Br -H F113 b, c, d, e, and f) S -I -F -H F114(a, b, c, d, e, and f) S -I -CH 3

-H

F115 b, c, d, e, and f) S -I -CF 3

-H

F116(a, b, c, d, e, and f) S -I -OCH 3

-H

F117(a, b, c, d, e, and f) S -I -OCH 2

CH

3

-H

F118 b, c, d, e, and f) S -I -OCF 3

-H

F119 b, c, d, e, and f) S -I -tert-butyl -H F120 b, c, d, e, and f) S -I -iso-propyl -H F121 b, c, d, e, and 1) S -I -CH 3 -CH3 -58- 00 00 F122 b, c,d, e,and f) S -I -H -H F123 b, c,d, e,and f) S -I -H -Cl F124 b, c,d, e,and f) S -1 -H -Br F125 b,c, d, e,and f) S -1 -H -F F126 b, c, d, e, and f) S -1 -H -CF! 3 F127 b, c, d, e, and f) S -1 -H -CF 3 F128 b, c, d, e, and f) S -I -H -OCH 3 F129 b, c,d, e,and f) S -1 -H -OCH 2

CH

3 F130 b, c, d, e, and f) S -I -H -OCF 3 F131 b, c, d, e, and f) S -1 -H -tert-butyl F132 b, c, d, e, and f) S -I -H -iso-propyl F133 b, c, d, e, and f) 0 -Cl -Cl -H F134 b, c,d, e,and f) 0 -Cl -Br -H F135 b, c,d, e,and f) 0 -Cl -F -H F136 b, c, d, e, and f) 0 -Cl -CF! 3

-H

F137 b, c, d, e, and f) 0 -Cl -CF 3

-H

F138 b,c, d, e,and f) 0 -Cl -0CH 3

-H

F139 b, c, d, e, and f) 0- -Cl -OCH 2

CH

3

-H

F 140 b, c, d, e, and f) 0 -Cl -OCF 3

-H

F141 b, c, d, e, and f) 0 -Cl -tert-butyl -H F142 b, c, d, e, and f) 0- -Cl -iso-propyl -H F143 b, c, d, e, and f) 0 -Cl -CF! 3

-CF!

3 F144 b, c,d, e,and f) 0 -Cl -H -H F145 b, c, d,e,and f) 0 -Cl -H -CH 3 F146 b, c, d, e, and f) 0 -Cl -H -Cl F147 b, c, d, e, and f) 0 -Cl -H -Br F148 c, d,e, and f) 0 -Cl -H -F F149 b, c, d, e, and f) 0 -Cl -H -CF 3 F150 b, c, d, e, and f) 0 -Cl -H -0CH 3 F151 b, c, d, e, and f) 0 -Cl -H -OCH 2

CH

3 F152 b, c, d, e, and f) 0 -Cl -H -OCF 3 F153 b, c, d, e, and f) 0 -Cl -H -tert-butyl F154 b, c, d, e, and f) 0 -Cl -H -iso-propyl F155 b, c, d, e, and f) 0 -CH 3 -Cl -H F156 b, e, e, and f) 0 -CF! 3 I -Br -H F157 b, c, d, e, and f) 0 -CH 3 -F -H F158 b, c, d, e, and f) 0 -CH 3

-CH

3

-H

F159 b, c, d, e, and f) 0 -CH 3

-CF

3

-H

F 160 b, c, d, e, and f) 0 -CH 3

-OCH

3

-H

F161 b, c, d, e, and f) 0 -CF! 3

-OCH

2

CH

3

-H

F162 b, c, d, e, and f) 0 -CH 3

-OCF

3

-H

F163 b, c, d, e, and f) 0 -CH 3 -tert-butyl -H F164 b, c, d, e, and f) 0 -CH 3 -iso-propyl -H F165 b, c, d, e, and f) 0 -CH 3

-CF!

3

-CF!

3 F166 b, c, d, e, and f) 0 -CH 3 -H -H F167 b, c, d, e, and f) 0 -CH 3 -H -Cl F168 b, c, d, e, and 0) 0 -CH 3 -H -Br F169 b, c, d, e, and f) 0 -CH 3 -H -F 59 00 00 F170 b, c, d, e, and f) 0 -CH 3 -H -CH3 F171 b, c, d, e, and f) 0 -CH 3 -H -CF 3 F 172 b, c, d, e, and f) O -CH 3 -H -OCH 3 F173 b, c, d, e, and f) 0 -CH 3 -H -OCH 2

CH

3 F174 b, c, d, e, and f) 0 -CH 3 -H -OCF 3 F175 b, c, d, e, and f) O -CH 3 -H -tert-butyl F176 b, c, d, e, and f) O -CH 3 -H -iso-propyl F177 b, c, d, e, and f) O -CF 3 -Cl -H F178 b, c, d, e, and f) O -CF 3 -Br -H F179 b, c, d, e, and f) O -CF 3 -F -H F180 b, c, d, e, and f) O -CF 3

-CH

3

-H

F181 b, c, d, e, and f) O -CF 3

-CF

3

-H

F182 b, c, d, e, and f) O -CF 3

-OCH

3

-H

F183 b, c, d, e, and f) O -CF 3

-OCH

2

CH

3

-H

F184 b, c, d, e, and f) O -CF 3

-OCF

3

-H

F185 b, c, d, e, and f) O -CF 3 -tert-butyl -H F186 b, c, d, e, and f) O -CF 3 -iso-propyl -H F187 b, c, d, e, and f) 0 -CF 3

-CH

3 -CH3 F188 b, c, d, e, and f) O -CF 3 -H -H F189 b, c, d, e, and f) 0 -CF 3 -H -Cl F190 b, c, d, e, and f) O -CF 3 -H -Br F191 b, c, d, e, and f) O -CF 3 -H -F F192 b, c, d, e, and f) 0 -CF 3 -H -CH3 F193 b, c, d, e, and f) 0 -CF 3 -H -CF 3 F194 b, c, d, e, and f) 0 -CF 3 -H -OCH 3 F195 b, c, d, e, and f) 0 -CF 3 -H -OCH 2

CH

3 F196 b, c, d, e, and f) 0 -CF 3 -H -OCF 3 F197 b, c, d, e, and f) 0 -CF 3 -H -tert-butyl F198 b, c, d, e, and f) O -CF 3 -H -iso-propyl F199 b, c, d, e, andf) O -CHF 2 -Cl -H F200 b, c, d, e, and f) O -CHF 2 -Br -H F201 b, c, d, e, and f) O -CHF 2 -F -H F202 b, c, d, e, and f) O -CHF 2

-CH

3

-H

F203 b, c, d, e, and f) O -CHF 2

-CF

3

-H

F204 b, c, d, e, and f) O -CIHF 2

-OCH

3

-H

F205 b, c, d, e, and f) O -CHF 2

-OCH

2

CH

3

-H

F206 b, c, d, e, and f) O -CHF 2

-OCF

3

-H

F207 b, c, d, e, and f) O -CHF 2 -tert-butyl -H F208 b, c, d, e, and f) O -CHF 2 -iso-propyl -H F209 b, c, d, e, and f) 0 -CHF 2

-CH

3 -CH3 F210 b, c, d, e, and f) O -CHF 2 -H -H F211 b, c, d, e, and f) 0 -CHF 2 -H -Cl F212 b, c, d, e, and f) O -CHF 2 -H -Br F213 b, c, d, e, and f) O -CHF 2 -H -F F214 b, c, d, e, and f) 0 -CHF 2 -H -CH3 F215 b, c, d, e, and f) 0 -CHF 2 -H -CF 3 F216 b, c, d, e, and f) 0 -CHF 2 -H -OCH 3 F217 b, c, d, e, and f) 0 -CHF 2 -H -OCH 2

CH

3 0 O 0

O

O

O

0

ON

0

(-N

F218 b, c, d, e, and f) 0 -CHF 2 -H -OCF 3 F219 b, c, d, e, and f) 0 -CHF 2 -H -tert-butyl F220 b, c, d, e, and f) 0 -CHF 2 -H -iso-propyl F221 b, c, d, e, and f) 0 -Br -Br -H F222 b, c, d, e, and f) 0 -Br -Cl -H F223 b, c, d, e, and f) 0 -Br -F -H F224 b, c, d, e, and f) 0 -Br -CH 3

-H

F225 b, c, d, e, and f) 0 -Br -CF 3

-H

F226 b, c, d, e, and f) 0 -Br -OCH 3

-H

F227 b, c, d, e, and f) 0 -Br -OCH2CH 3

-H

F228 b, c, d, e, and f) 0 -Br -OCF 3

-H

F229 b, c, d, e, and f) 0 -Br -tert-butyl -H F230 b, c, d, e, and f) 0 -Br -iso-propyl -H F231 b, c, d, e, and f) 0 -Br -CH 3

-CH

3 F232 b, c, d, e, and f) 0 -Br -H -H F233 b, c, d, e, and f) 0 -Br -H -Cl F234 b, c, d, e, and f) 0 -Br -H -Br F235 b, c, d, e, and f) 0 -Br -H -F F236 b, c, d, e, and f) 0 -Br -H -CH 3 F237 b, c, d, e, and f) 0 -Br -H -CF 3 F238 b, c, d, e, and f) 0 -Br -H -OCH3 F239 b, c, d, e, and f) 0 -Br -H -OCH 2

CH

3 F240 b, c, d, e, and f) 0 -Br -H -OCF 3 F241 b, c, d, e, and f) 0 -Br -H -tert-butyl F242 b, c, d, e, and f) 0 -Br -H -iso-propyl F243 b, c, d, e, and f) 0 -I -Cl -H F244 b, c, d, e, and f) 0 -I -Br -H F245 b, c, d, e, and f) 0 -I -F -H F246 b, c, d, e, and f) 0 -I -CH 3

-H

F247 b, c, d, e, and f) 0 -I -CF 3

-H

F248 b, c, d, e, and f) 0 -I -OCH 3

-H

F249 b, c, d, e, and f) 0 -I -OCH 2

CH

3

-H

F250 b, c, d, e, and f) 0 -I -OCF 3

-H

F251 b, c, d, e, and f) 0 -I -tert-butyl -H F252 b, c, d, e, and f) 0 -I -iso-propyl -H F253 b, c, d, e, and f) 0 -I -CH 3

-CH

3 F254 b, c, d, e, and f) 0 -I -H -H F255 b, c, d, e, and f) 0 -I -H -Cl F256 b, c, d, e, and f) 0 -I -H -Br F257 b, c, d, e, and f) 0 -I -H -F F258 b, c, d, e, and f) 0 -I -H -CH 3 F259 b, c, d, e, and f) 0 -I -H -CF 3 F260 b, c, d, e, and f) 0 -I -H -OCH 3 F261 b, c, d, e, and f) 0 -I -H -OCH 2

CH

3 F262 b, c, d, e, and f) 0 -I -H -OCF 3 F263 b, c, d, e, and f) 0 -I -H -tert-butyl F264 b, c, d, e, and f) 0 -I -H -iso-propyl F265 b, c, d, e, and f) NH -Cl -Cl -H -61- 00 00 F266 c, d,e,and f) NH -Cl -Br -H F267 b, c,d, e,and f) NIH -Cl -F -H F268 b, c, d, e, and f) NIH -Cl -CH 3

-H

F269 b, c, d, e, and f) NH -Cl -CF 3

-H

F270 b, c, d, e, and f) NIH -Cl -OCH 3

-H

F271 b, c, d, e, and f) NH -Cl -OCH 2

CH

3

-H

F272 b, c, d, e, and f) NH -Cl -OCF 3

-H

P273 b, c, d, e, and f) NH -Cl -tert-butyl -H F274 b, c, d, e, and Q) NH -Cl -iso-propyl -H P275 b, c, d, e, and f) NH -Cl -CH 3 -Gil 3 F276 b, c,d, e,and f) NH -Cl -H -H F277 b, c, d, e, and f) NH -Cl -H -CH 3 F278 b, c,d, e,and f) NH -Cl -H -Cl F279 b, c,d, e,and f) NH -Cl -H -Br F280 b,c, d, e,and f) NH -Cl -H -F P281 b, c, d, e, and f) NH -Cl -H -CF 3 P282 b, c, d, e, and f) NH -Cl -H -OCH 3 F283 b, c, d, e, and f) NH -Cl -H -OCH 2

CH

3 F284 b, c, d, e, and f) NH -Cl -H -OCF 3 F285 b, c, d, e, and f) NH -Cl -H -tert-butyl P286 b, c, d, e, and f7) NH -Cl -H -iso-propyl P287 b, c, d, e, and f) NH -Gil 3 -Cl -H F288 b, c, d, e, and f) NH -Gil 3 -Br -H P289 b,c, d, e,and f) NH -CH 3 -F -H P290 b, c, d, e, and f) NH -Gil 3

-CH

3

-H

P291 b, c, d, e, and f) NH -CH 3

-CF

3

-H

F292 b, c, d, e, and f) NH -CH 3

-OCH

3

-H

F293 b, c, d, e, and f) NH -Gil 3

-OCH

2

CH

3

-H

F294 b, c, d, e, and f) NH -Gil 3

-OCF

3

-H

F295 b, c, d, e, and f) NH -CH 3 -tert-butyl -H P296 b, c, d, e, and f) NH -Gil 3 -iso-propyl -H P297 b, c, d, e, and f) NH -CH 3 -Gil 3 -Gil 3 F298 b, c, d, e, and f) NH -CH 3 -H -H P299 b, c, d, e, and f) NH -Gil 3 -H -Cl P300 b, c, d, e, and f) NH I-Gil 3 -H -Br P301 b, c,d, e,and f) NH -Gil 3 -H -F F302 b, c, d, e, and f) NH -Gil 3 -H -Gil 3 P303 b, c, d, e, and f) NH -Gil 3 -H -CF 3 P304 b, c, d, e, and f) NH -Gil 3 -H -OGH 3 P305 b, c, d, e, and f) NH -Gil 3 -H -OCH 2

CHA

P306 b, c, d, e, and f) NH -CH 3 -H -OCF 3 P307 b, c, d, e, and f7) NH -Gil 3 -H -tert-butyl P308 b, c, d, e, and 0) NH -Gil 3 -H -iso-propyl P309 b, c, d, e, and f) NH -CF 3 -Cl -H P3 10 b, c,d, e,and f) NH -CF 3 -Br -H P3 11 b, c, d, e, and f) NH -CF 3 -F -H P312 b,c, d, e,and f) NIH -CF 3 -Cil 3

-H

F313 b, c,d, e,andtf) INH -CF 3

-CF

3

-H

-62- 00 00 F314 b, c, d, e, and f) Nil -CF 3 -0C1 3

-H

F315 b, c, d, e, and f) NiH -CF 3

-OCH

2

CH

3

-H

F316 b, c, d, e, and f) Nil -CF 3

-OCF

3

-H

F317 b, c, d, e, and f) NHl -CF 3 -tert-butyl -H F318 b, c, d, e, and f) NH -CF 3 -iso-propyl -H F319 b, c, d, e, and f) Nil -CF 3

-CH

3 -Gil 3 F320 b, c,d,e, and f) Nil -CF 3 -H -H F321 b, c, d, e, and f) NH -CF 3 -H -Cl F322 b, c, d, e, and f) NH -CF 3 -H -Br F323 b, c, d, e, and f) Nil -CF 3 -H -F F324 b, c, d, e, and f) Nil -CF 3 -H -CH 3 F325 b, c, d, e, and f) NH -CF 3 -H -CF 3 F326 b, c, d, e, and f) NH -CF 3 -H -OCH 3 F327 b, c, d, e, and f) NH -CF 3 -H -OCH 2

CH

3 F328 b, c,d, e,and f) NH -CF 3 -H -OCF 3 F329 b, c, d, e, and f) NH -CF 3 -H -tert-butyl F330 b, c, d, e, and f) NH -CF 3 -H -iso-propyl F3 31 b, c,d, e,andtf) NH -CHF 2 -Cl -H F332 b, c, d, e, and f) NH -CHF 2 -Br -H F333 b, c, d, e, and f) NH -CHF 2 -F -H F334 b, c, d, e, and f) NH -CHF 2

-CH

3

H

F335 b, c, d, e, and f) NH -CHF 2

-CF

3

-H

F336 b, c, d, e, and f) NH -CHF 2

-OCH

3

-H

F337 b, c, d, e, and f) NH -CHF 2

-OCH

2

CH

3

-H

F338 b, c, d, e, and f) NH -CI{F 2

-OCF

3

-H

F339 b, c, d, e, and f) NH -CI{F 2 -tert-butyl -H F340) b, c, d, e, and f) NH -CHF 2 -iso-propyl -H F341 b, c, d, e, and f) NH -CHF 2

-CH

3

-CH

3 F342 b, c,d, e,and f) NH -CHF 2 -H -H F343 b, c, d, e, and f) NH -CHF 2 -H -Cl F344 b,c, d, e,and f) NH -CLLF 2 -H -Br F345 b,c, d, e,and f) NH -CI{F 2 -H -F F346 b, c, d, e, and f) NH -CHF 2 -H -Gil 3 F347 b, c, d, e, and f) NH -CHF 2 -H -CF 3 F348 b, c, d, e, and fi) NH -CI{F 2 -H -OCH 3 F349 b, c, d, e, and f) NH -CHF 2 -H -OCH 2

CH

3 F350 b, c, d, e, and f) NH -CHF 2 -H -OCF 3 F351 b, c, d, e, and f) NH -CHF 2 -H -tert-butyl F352 b, c, d, e, and f) NH -CHF 2 -H -iso-propyl F353 b, c, d,e,and f) NH -Br -Br -H F354 b, c, d,e,and f) NH -Br -Cl -H F355 b, c,d,e, and f) NH -Br -F -H F356 b, c, d, e, and f) NH -Br -CH 3

-H

F357 b, c, d, e, and f) NH -Br -CF 3

-H

F358 b, c, d, e, and f) NH -Br -OCH 3

-H

F359 b, c, d, e, and f) NH- -Br -OCH 2

CH

3

-H

F360 b, c, d, e, and 0) NH -Br -OCF 3

-H

F361 b, c, d, e, and f) NH -Br -tert-btql -H 63 00 00 F362 b, c, d, e, and f) NH -Br -iso-propyl -H P363 b, c, d, e, and f) Nil -Br -CH 3

-CH

3 F3 64 b,c, d,e, and f) NH -Br -H -H F365 b, c,d, e,and f) NH -Br -H -Cl F3 66 b, c,d, e,and f) Nil -Br -H -Br F367 b, c,d, e,and f) Nil -Br -H -F P368 b, c, d, e, and f) NH -Br -H -CH 3 F369 b, c, d, e, and f) NH -Br -H -CF 3 F370 b, c, d, e, and f) NH- -Br -H -OCH 3 F371 b, c, d, e, and f) NH -Br -H -OCH 2

CH

3 F372 b, c, d, e, and f) NH -Br -H -OCF 3 F373 b, c, d, e, and f) NH -Br -H -tert-butyl F374 b, c, d, e, and f) NH -Br -H -iso-propyl F375 c, d,e, and f) NH -1 -Cl -H F376 b, c,d,e, and f) NH -I -Br -H F377 b, c,d, e,and f) NH -1 -F -H F378 b, c,d, e,and f) NH -1 -Cf! 3

-H

F379 b, c,d, e,and f) NH -I -CF 3

-H

F3 80(a, b, c,d,e, and f) NH -1 -OCH 3

-H

F381 b, c, d, e, and f) NH -I -OCH 2

CH

3

-H

F382 b,c, d, e,and f) NH -I -OCF 3

-H

F383 b, c, d, e, and f) NH -1 -tert-butyl -H F384 b, c, d, e, and f) NH -I -iso-propyl -H F385 b, c, d, e, and f) NH -I -Cf! 3 -Cf! 3 F386 c, d,e, and f) NH -1 -H -H F3 87(a, b, c,d, e,and f) NH -I -H -Cl F388 c, d,e, and f) NH -1 -H -Br F389 b, c, d,e,andtf) NH -I -H -F F390 b, c, d, e, and f) NH -I -H -CH 3 F391 b, c, d, e, and f) NH -1 -H -CF 3 F392 b, c, d, e, and f) NH -I -H -OCH 3 F393 b, c, d, e, and f) NH -1 -H -OCH 2

CH

3 F394 b, c, d, e, and f) NH -1 -H -OCF 3 F395 b, c, d, e, and f) NH -1 -H -tert-butyl F396 b,c, d, e,and f) NH -1 -H -iso-propyl Ila the column labeled "Compound": means that R 3 is -CH 3 means that R 3 is -Cl; means that R 3 is -Br; means that R 3 is -I; means that R 3 is and (0 means that R 3 is in formula m 0.

64 00 00 Table 7 (It) and pharmaceutically acceptable salts thereof, where: Cornpound Y 11(1) (R 8 (31 b, c, d,e,and f) S -Cl -Cl -H (32 b,c, d, e,and f) S -Cl -Br -H (33 b,c, d,e, and f) S -Cl -F -H G4 b, c, d, e, and f) S -Cl -CH 3

-H

b,c, d, e,and f) S -Cl -CF 3

-H

G6 b, c, d, e, and f) S -Cl -OCH 3

-H

G7 b, c, d, e, and f) S -Cl -OCH 2

CH

3

-H

G8 b, c, d, e, and f) S -Cl -OCF 3

-H

(39 b, c, d, e, and fT) S -Cl -tert-butyl -H (310 b, c, d, e, and f) S -Cl -iso-propyl -H Gil1 b, c, d, e, and f) S -Cl -CH 3

-CH

3 G12 b, c,d, e,and f) S -Cl -H -H (313 b,c, d, e,and f) S -Cl -H -Cl G14 b,c, d, e,and f) S -Cl -H -Br b,c, d, e,and f) S -Cl -H -F G16 b, c, d, e, and f) S -Cl -H G17 b, c, d, e, and f) S -Cl -H -CF 3 G18 b, c,d, e,and f) S -Cl -HI -OCH 3 G319 b, c, d, e, and f) S -Cl -H -OCH 2

CH

3 (320 b, c, d, e, and f) S -Cl -H -OCF 3 (321I b, c, d, e, and f) S -Cl -H -tert-butyl G22 b, c, d, e, and f) S -Cl -H -iso-propyl (323 b, c, d, e, and fT) I S -CH 3 -Cl -H 65 00 00 G24 b, c, d, e, and f) S -CH 3 -Br -H b, c, d, e, and f) S -CH 3 -F -H G26 b, c, d, e, and f) S -CH 3

-CH

3

-H

G27 b, c, d, e, and f) S -CH 3

-CF

3

-H

G28 b, c, d, e, and f) S -CH 3

-OCH

3

-H

G29 b, c, d, e, and f) S -CH 3

-OCH

2

CH

3

-H

b, c, d, e, and f) S -CH 3

-OCF

3

-H

G31 b, c, d, e, and f) S -CH 3 -tert-butyl -H G32 b, c, d, e, and f) S -CH 3 -iso-propyl -H G33 b, c, d, e, and f) S -CH 3

-CH

3

-CH

3 G34 b, c, d, e, and f) S -CH 3 -H -H b, c, d, e, and f) S -CH 3 -H -Cl G36 b, c, d, e, and f) S -CH 3 -H -Br G37 b, c, d, e, and f) S -CH 3 -H -F G38 b, c, d, e, and f) S -CH3 -H -CH3 G39 b, c, d, e, and f) S -CH 3 -H -CF 3 b, c, d, e, and f) S -CH 3 -H -OCH 3 G41 b, c, d, e, and f) S -CH 3 -H -OCH 2

CH

3 G42 b, c, d, e, and f) S -CH 3 -H -OCF 3 G43 b, c, d, e, and f) S -CH3 -H -tert-butyl G44 b, c, d, e, and f) S -CH 3 -H -iso-propyl b, c, d, e, and f) S -CF 3 -Cl -H G46 b, c, d, e, and f) S -CF 3 -Br -H G47 b, c, d, e, and f) S -CF 3 -F -H G48 b, c, d, e, and f) S -CF 3

-CH

3

-H

G49 b, c, d, e, and f) S -CF 3

-CF

3

-H

b, c, d, e, and f) S -CF 3

-OCH

3

-H

G51 b, c, d, e, and f) S -CF 3

-OCH

2

CH

3

-H

G52 b, c, d, e, and f) S -CF 3

-OCF

3

-H

G53 b, c, d, e, and f) S -CF 3 -tert-butyl -H G54 b, c, d, e, and f) S -CF 3 -iso-propyl -H 055 b, c, d, e, and f) S -CF 3

-CH

3 -CH3 G56 b, c, d, e, and f) S -CF 3 -H -H G57 b, c, d, e, and f) S -CF 3 -H -Cl G58 b, c, d, e, and f) S -CF 3 -H -Br G59 b, c, d, e, and f) S -CF 3 -H -F b, c, d, e, and f) S -CF 3 -H -CH3 G61 b, c, d, e, and f) S -CF 3 -H -CF 3 G62 b, c, d, e, and f) S -CF 3 -H -OCH 3 G63 b, c, d, e, and f) S -CF 3 -H -OCH 2

CH

3 G64 b, c, d, e, and f) S -CF 3 -H -OCF 3 b, c, d, e, and f) S -CF 3 -H -tert-butyl G66 b, c, d, e, and f) S -CF 3 -H -iso-propyl G67 b, c, d, e, and f) S -CHF 2 -Cl -H G68 b, c, d, e, and f) S -CHF 2 -Br -H G69 b, c, d, e, and f) S -CHF 2 -F -H b, c, d, e, and f) S -CHF 2

-CH

3

-H

G71 b, c, d, e, and f) S -CHF 2

-CF

3

-H

-66- 00 C00

N

G72 b, c, d, e, and f) S -CHF 2

-OCH

3

-H

G73 b, c, d, e, and f) S -CHF 2

-OCH

2

CH

3

-H

G74 b, c, d, e, and f) S -CHF 2

-OCF

3

-H

b, c, d, e, and f) S -CHF 2 -tert-butyl -H G76 b, c, d, e, and f) S -CHF 2 -iso-propyl -H G77 b, c, d, e, and f) S -CHF 2

-CH

3 -CH3 G78 b, c, d, e, and f) S -CHF 2 -H -H G79 b, c, d, e, and f) S -CHF 2 -H -Cl b, c, d, e, and f) S -CHF 2 -H -Br G81 b, c, d, e, and f) S -CHF 2 -H -F G82 b, c, d, e, and f) S -CHF 2 -H -CH 3 G83 b, c, d, e, and f) S -CHF 2 -H -CF 3 G84 b, c, d, e, and f) S -CHF 2 -H -OCH 3 b, c, d, e, and f) S -CHF 2 -H -OCH 2

CH

3 G86 b, c, d, e, and f) S -CHF 2 -H -OCF 3 G87 b, c, d, e, and f) S -CHF 2 -H -tert-butyl G88 b, c, d, e, and f) S -CHF 2 -H -iso-propyl G89 b, c, d, e, and f) S -Br -Br -H b, c, d, e, and f) S -Br -Cl -H G91 b, c, d, e, and f) S -Br -F -H G92 b, c, d, e, and f) S -Br -CH 3

-H

G93 b, c, d, e, and f) S -Br -CF 3

-H

G94 b, c, d, e, and f) S -Br -OCH 3

-H

b, c, d, e, and f) S -Br -OCH 2

CH

3

-H

G96 b, c, d, e, and f) S -Br -OCF 3

-H

G97 b, c, d, e, and f) S -Br -tert-butyl -H G98 b, c, d, e, and f) S -Br -iso-propyl -H G99 b, c, d, e, and f) S -Br -CH 3 -CH3 G100 b, c, d, e, and f) S -Br -H -H G101 b, c, d, e, and f) S -Br -H -Cl G102 b, c, d, e, and f) S -Br -H -Br G103 b, c, d, e, and f) S -Br -H -F G104 b, c, d, e, and f) S -Br -H -CH3 G105 b, c, d, e, and f) S -Br -H -CF 3 G106 b, c, d, e, and f) S -Br -H -OCH 3 G107 b, c, d, e, and f) S -Br -H -OCH 2

CH

3 G108 b, c, d, e, and f) S -Br -H -OCF 3 G109 b, c, d, e, and f) S -Br -H -tert-butyl G110 b, c, d, e, and f) S -Br -H -iso-propyl G111 b, c, d, e, and f) S -I -Cl -H G 12 b, c, d, e, and f) S -I -Br -H G113 b, c, d, e, and f) S -I -F -H G114 b, c, d, e, and f) S -I -CH 3

-H

G115 b, c, d, e, and f) S -I -CF 3

-H

G116 b, c, d, e, and f) S -I -OCH 3

-H

G1 17 b, c, d, e, and f) S -I -OCH 2

CH

3

-H

G1 18 b, c, d, e, and f) S -I -OCF 3

-H

01 19 b, c, d, e, and f) S -I -tert-butyl -H -67- 00 C00

O

G120 b, c, d, e, and f) S -I -iso-propyl -H G121 b, c, d, e, and f) S -I -CH 3 -CH3 G122 b, c, d, e, and f) S -I -H -H G123 b, c, d, e, and f) S -I -H -Cl G124 b, c, d, e, and f) S -I -H -Br G125 b, c, d, e, and f) S -I -H -F G126 b, c, d, e, and f) S -I -H -CH 3 G127 b, c, d, e, and f) S -I -H -CF 3 G128 b, c, d, e, and f) S -I -H -OCH 3 G129 b, c, d, e, and f) S -I -H -OCH 2

CH

3 G130 b, c, d, e, and f) S -I -H -OCF 3 G131 b, c, d, e, and f) S -I -H -tert-butyl G132 b, c, d, e, and f) S -I -H -iso-propyl G133 b, c, d, e, and f) O -Cl -Cl -H G134 b, c, d, e, and f) O -Cl -Br -H G135 b, c, d, e, and f) O -Cl -F -H G136 b, c, d, e, and f) O -Cl -CH 3

-H

G137 b, c, d, e, and f) O -Cl -CF 3

-H

G138 b, c, d, e, and f) O -Cl -OCH 3

-H

G139 b, c, d, e, and f) O -Cl -OCH 2

CH

3

-H

G140 b, c, d, e, and f) O -Cl -OCF 3

-H

G141 b, c, d, e, and f) O -Cl -tert-butyl -H G142 b, c, d, e, and f) O -Cl -iso-propyl -H G143 b, c, d, e, and f) 0 -Cl -CH 3

-CH

3 G144 b, c, d, e, andf) O -Cl -H -H G145 b, c, d, e, and f) 0 -Cl -H -CH3 G146 b, c, d, e, and f) 0 -Cl -H -Cl G147 b, c, d, e, and f) O -Cl -H -Br G148 b, c, d, e, and f) O -Cl -H -F G149 b, c, d, e, and f) 0 -Cl -H -CF 3 G150 b, c, d, e, and f) 0 -Cl -H -OCH 3 G151 b, c, d, e, and f) 0 -Cl -H -OCH 2

CH

3 G152 b, c, d, e, and f) 0 -Cl -H -OCF 3 G153 b, c, d, e, and f) 0 -Cl -H -tert-butyl G154 b, c, d, e, and f) O -Cl -H -iso-propyl G155 b, c, d, e, and f) O -CH 3 -Cl -H G156 b, c, d, e, and f) O -CH 3 -Br -H G157 b, c, d, e, and f) O -CH 3 -F -H G158 b, c, d, e, and f) O -CH 3

-CH

3

-H

G159 b, c, d, e, and f) O -CH 3

-CF

3

-H

G160 b, c, d, e, and f) O -CH 3

-OCH

3

-H

G161 b, c, d, e, and f) O -CH 3

-OCH

2

CH

3

-H

G162 b, c, d, e, and f) O -CH 3

-OCF

3

-H

G163 b, c, d, e, and f) O -CH 3 -tert-butyl -H G164 b, c, d, e, and f) O -CH 3 -iso-propyl -H G165 b, c, d, e, and f) 0 -CH 3 -CH3 -CH 3 G166 b, c, d, e, and f) O -CH3 -H -H G167 b, c, d, e, and f) 0 -CH 3 -H -Cl -68- 00 00 0 16 8 b, c, d, e, arnd f) 0 -CH 3 -H -Br G169 b, c, d, e, and f) 0 -Cl- 3 -H -F 0 170 b, c, d, e, and f) 0 -CH 3 -H -CH 3 G 17 1 b, c, d, e, and f) 0 -CH 3 -H -CF 3 G 17 2 b, c, d, e, and f) 0 -CH 3 -H -0CH 3 G017 3 b, c, d, e, and f) 0 -CH 3 -H -OCH 2

CH

3 0174 b, c, d, e, and f) 0 -CH 3 -H -OCF 3 G 17 5 b, c, d, e, and f) 0 -CH 3 -H -tert-butyl G176 b, c, d, e, and f) 0 -CH 3 -H -iso-propyl G177 b, c, d, e, and f) 0 -CF 3 -Cl -H G 17 8(a, b, c,d, e,and f) 0 -CF 3 -Br -H G179 b, c, d, e, and f) 0 -CF 3 -F -H G180 b, c,d, e,and f) 0 -CF 3

-CH

3

-H

G181 b, c,d, e,and f) 0 -CF 3

-CF

3

-H

0182 b, c, d, e, and f) 0 -CF 3 -0CH 3

-H

G183 b, c, d, e, and f) 0 -CF 3

-OCH

2

CH

3

-H

G184 b, c, d, e, and f) 0 -CF 3 -0CF 3

-H

0185 b, c, d, e, and f) 0 -CF 3 -tert-butyl -H G186 b, c, d, e, and f) 0 -CF 3 -iso-propyl -H G18 7 b, c, d, e, and f) 0 -CF 3

-CH

3

-CH

3 G188 b,c, d, e,and f) 0 -CF 3 -H -H G189 b, c,d, e,and f) 0 -CF 3 -H -Cl G190 b, c, d, e, and f) 0 -CF 3 -H -Br G191 b, c, d, e, and f) 0 -CF 3 -H -F G192 b, c, e, and f) 0 -CF 3 -H -CH 3 0193 b, c, d, e, and f) 0 -CF 3 -H -CF 3 0194 b, c, d, e, and f) 0 -CF 3 -H -OCH 3 0195 b, c, d, e, and f) 0 -CF 3 -H -0CH 2

CH

3 G196 b, c, d, e, and f) 0 -CF 3 -H -0CF 3 G197 b, c, d, e, and f) 0 -CF 3 -H -tert-butyl G198 b, c, d, e, and f) 0 -CF 3 -H -iso-propyl G199 b, c, d, e, and f) 0 -CHF 2 -Cl -H 0200 b, c, d, e, and f) 0 -CB-F 2 -Br -H 0201 b, c, d, e, and f) 0 -CHIF 2 -F -H 0202 b, c, d, e, and f) 0 -CHF 2

-CH

3

-H

0203 b, c, d, e, and f) 0 -CIHF 2

-CF

3

-H

0204 b, c, d, e, and f) 0 -CHF 2

-OCH

3

-H

G205 b, c, e, and f) 0 -CB-F 2

-OCH

2

CH

3

-H

0206 b, c, d, e, and f) 0 -CHF 2

-OCF

3

-H

0207 b, c, d, e, and f) 0 -CHF 2 -tert-butyl -H 0208 b, c, d, e, and f) 0 -CHF 2 -iso-propyl -H 0209 b, c, d, e, and f) 0 -CIHF 2

-CH

3

-CH

3 0210 b, c, d, e, and 0) 0 -CHF 2 -H -H G2 11 b, c,d, e,and f 0 -CHF 2 -H -Cl 02 12 b, c, d, e, and 0) 0 -CHF 2 -H -Br G2 13(a, b,c, d, e,and f 0 -Cl-f 2 -H -F 0214 b, c, d, e, and f) 0 -CB-F 2 -H -CH 3 G2 15(a, b, c, d,e,and0f 0 -CHF 2 -H -CF 3 69 00 00 G216 b, c, d, e, and f) 0 -CUE 2 -H -OCH 3 G217 b, c, d e, and f) 0 -CHF 2 -H -OCH 2

CH

3 G218 b, c, d, e, and f) 0 -CUE 2 -H -OCF 3 G219 b, c, d, e, and f) 0 -CHF 2 -H -tert-butyl G220 b, c, d, e, and f) 0 -CUE 2 -H -iso-propyl G221 b, c, d, e, and f) 0 -Br -Br -H G222 b, c, d, e, and f) 0 -Br -Cl -H G223 b, c, d ,e,and f) 0 -Br -F -H G224 b, c, d, e, and f) 0 -Br -CH 3

-H

G225 b, c, d, e, and f) 0 -Br -CF 3

-H

G226 b, c, d, e, and f) 0 -Br -OCH 3

-H

G227 b, c, d e, and f) 0 -Br -OCH 2

CH

3

-H

G228 b, c, d, e, and f) 0 -Br -0CF 3

-H

G229 b, c, d, e, and f) 0 -Br -tert-butyl -H G230 b, c, d, e, and f) 0 -Br -iso-propyl -H G23 1 b, c, d, e, and f) 0 -Br -CH 3

-CH

3 G232 b, c, d,e, andtf) 0 -Br -H -H G233 b, c, d, e, and f) 0 -Br -H -Cl G234 b, c, d, e, and f) 0 -Br -H -Br G235 b, c,d, e,andtf) 0 -Br -H -F G236 b, c, d, e, and f) 0 -Br -H -CH 3 G237 b, c, d, e, and f) 0 -Br -H -CF 3 G238 b, c, d, e, and f) 0 -Br -H -0CH 3 G239 b, c, d, e, and f) 0 -Br -H -OCH 2

CH

3 G240 b, c, d, e, and f) 0 -Br -H -0CF 3 G241 b, c, d, e,and f) 0 -Br -H -tert-butyl G242 b, c, d, e, and f) 0 -Br -H -iso-propyl G243 b, c,d, e,and f) 0 -1 -Cl -H G244 b, c, d,e, andtf) 0 -1 -Br -H G245 b, c,d, e,and f) 0 -1 -F -H G246 b, c, d, e, and f) 0 -1 -CH 3

-H

G247 b, c, d, e, and f) 0 -1 -CF 3

-H

G248 b, c, d, e, and f) 0 -1 -OCH 3

-H

G249 b, c, d, e, and f) 0 -1 -0CH 2

CH

3

-H

G250 b, c, d, e, and f) 0 -1 -OCF 3

-H

G251 b, c, d, e, and f) 0 -1 -tert-butyl -H G252 b, c, d, e, and f) 0 -1 -iso-propyl -H G253 b, c, d, e, and f) 0 -1 -CH 3

-CH

3 G254 b, c,d, e,and f 0 -1 -H -H G255 b, c, d, e,and f) 0 -1 -H -Cl G256 b,c, and f) 0 -1 -H -Br G257 b, c, d,e,and f) 0 -1 -H -F G258 b, c, d, e, and f) 0 -1 -H -CH 3 G259 b, c, d, e, and f) 0 -1 -H -CF 3 G260 b, c, d, e, and f) 0 -1 -H -0CH 3 G261 b, c, d, e, and f) 0 -1 -H -0CH 2

CH

3 G262 b, c, d, e, and 0) 0 -1 -H -0CF 3 G263 b, c, d, e, and 0) 0 -1 -H -tert-butyI 00 00 G264 b, c, d, e, and f) O -I -H -iso-propyl G265 b, c, d, e, and f) NH -Cl -Cl -H G266 b, c, d, e, and f) NH -Cl -Br -H G267 b, c, d, e, and f) NH -Cl -F -H G268 b, c, d, e, and f) NH -Cl -CH 3

-H

G269 b, c, d, e, and f) NH -Cl -CF 3

-H

G270 b, c, d, e, and f) NH -Cl -OCH 3

-H

G271 b, c, d, e, and f) NH -Cl -OCH 2

CH

3

-H

G272 b, c, d, e, and f) NH -Cl -OCF 3

-H

G273 b, c, d, e, and f) NH -Cl -tert-butyl -H G274 b, c, d, e, and f) NH -Cl -iso-propyl -H G275 b, c, d, e, and f) NH -Cl -CH 3

-CH

3 G276 b, c, d, e, and f) NH -Cl -H -H G277 b, c, d, e, and f) NH -Cl -H -CH3 G278 b, c, d, e, and f) NH -Cl -H -CI G279 b, c, d, e, and f) NH -Cl -H -Br G280 b, c, d, e, and f) NH -Cl -H -F G281(a, b, c, d, e, andf) NH -Cl -H -CF 3 G282 b, c, d, e, and f) NH -Cl -H -OCH3 G283 b, c, d, e, and f) NH -Cl -H -OCH 2

CH

3 G284 b, c, d, e, and f) NH -Cl -H -OCF 3 G285 b, c, d, e, and f) NH -Cl -H -tert-butyl G286 b, c, d, e, and f) NH -Cl -H -iso-propyl G287 b, c, d, e, and f) NH -CH 3 -Cl -H G288 b, c, d, e, and f) NH -CH 3 -Br -H G289 b, c, d, e, and f) NH -CH 3 -F -H G290 b, c, d, e, and f) NH -CH 3

-CH

3

-H

G291 b, c, d, e, and f) NH -CH 3

-CF

3

-H

G292 b, c, d, e, and f) NH -CH 3

-OCH

3

-H

G293 b, c, d, e, and f) NH -CH 3

-OCH

2

CH

3

-H

G294 b, c, d, e, and f) NH -CH 3

-OCF

3

-H

G295 b, c, d, e, and f) NH -CH3 -tert-butyl -H G296 b, c, d, e, and f) NH -CH3 -iso-propyl -H G297 b, c, d, e, and f) NH -CH 3

-CH

3 -CH3 G298 b, c, d, e, and f) NH -CH3 -H -H G299 b, c, d, e, and f) NH -CH 3 -H -Cl G300 b, c, d, e, and f) NH -CH3 -H -Br G301 b, c, d, e, and f) NH -CH3 -H -F G302 b, c, d, e, and f) NH -CH 3 -H -CH3 G303 b, c, d, e, and f) NH -CH 3 -H -CF 3 G304 b, c, d, e, and f) NH -CH 3 -H -OCH 3 G305 b, c, d, e, and f) NH -CH 3 -H -OCH 2 CH3 G306 b, c, d, e, and f) NH -CH3 -H -OCF 3 G307 b, c, d, e, and f) NH -CH 3 -H -tert-butyl G308 b, c, d, e, and f) NH -CH3 -H -iso-propyl G309 b, c, d, e, and f) NH -CF 3 -Cl -H G310 b, c, d, e, and f) NH -CF 3 -Br -H G311 b, c, d, e, and f) NH -CF 3 -F -H -71- 00 G3 12 b, c, d, e, and f) NH -CF 3

-CH

3

-H

G3 13 b, c, d, e, and f) NH -CF 3

-CF

3

-H

G314 b, c, d, e, and f) NH -CF 3

-OCH

3

-H

G315 b, c, d, e, and f) NH -CF 3

-OCH

2

CH

3

-H

G316 b, c,d, e,and f) NH -CF 3

-OCF

3

-H

G3 17 b, c, d, e, and f) NI- -CF 3 -tert-butyl -H G318 b, c, d, e, and f) NH -CF 3 -iso-propyl -H 0319 b, c, d, e, and f) NH -CF 3 -CH4 3

-CIT

3 G320 b, c, d, e, and f) NH -CF 3 -H -H 0321 b, c, d, e, and f) NH -CF 3 -H -Cl G322 b, c, d, e, and f) NH -CF 3 -H -Br G323 b, c, d, e, and f) NH -CF 3 -H -F G324 b, c, d, e, and NHT -CF 3 -H -CH 3 0325 b, c, d, e, and f) NH -CF 3 -H -CF 3 G326 b, c, d, e, and f) NH -CF 3 -H -OCT- 3 0327 b, c, d, e, and f) NH -CF 3 -H -OCH 2

CH

3 0328 b, c, d, e, and f) NH -CF 3 -H -OCF 3 G329 b, c, d, e, and fT) NH -CF 3 -H -tert-butyl 0330 b, c, d, e, and f) NH -CF 3 -H -iso-propyl G331 b, c,d, e, and f) NH -CHF 2 -Cl -H 0332 b, c, d, e, and f) NH -CBiP 2 -Br -H 0333 b, c, d, e, and f) NH -CIHI 2 -F -H G334 b, c, d, e, and f) NH -CLIP 2

-CIT

3

-H

G335 b, c, d, e, and f) NH -CH-F 2

-CF

3

-H

G336 b, c, d, e, and f) NH -CHF 2

-OCH

3

-H

0337 b, c, d, e, and fT) NH -ClIP 2

-OCH

2

CH

3

-H

0338 b, c, d, e, and f) NH -CHF 2

-OCF

3

-H

0339 b, c, d, e, and f) NH -CHF 2 -tert-butyl -H 0340 b, c, d, e, and f) NH -CHF 2 -iso-propyl -H 0341 b, c, d, e, and f) NH -CIHI 2

-CIT

3

-CIT

3 0342 b, c, d, e, and fT) NH -CIPF 2 -H -H 0343 b, c, d, e, and f) NH -CLIP 2 -H -Cl G344 b, c, d, e, and f) -NH -CIHF 2 -H -Br 0345 b, c, d, e, and f) NH -CIIF 2 -H -F G346 b, c, d, e, and f) NH -CLIP 2 -H -CH 3 0347 b, c, d, e, and f) NH -CHIF 2 -H -CF 3 0348 b, c, d, e, and f) NH -CHIP 2 -H -OCH 3 0349 b, c, d, e, and f) NH I-CH-F 2 -H -OCH 2

CH

3 0350 b, c, d, e, and f) NH -CT-F 2 -H -OCF 3 0351 b, c, d, e, and fT) NH -CT-F 2 -H -teii-butyl 0352 b, c, d, e, and fT) NH -CH-F 2 -H -iso-propyI 0353 b, c, d, e, and f) NH -Br -Br -H G354 b, c, d, e, and f) NH -Br -Cl -H G355 c, d,e, and f) NH -Br -F -H G356 b, c, d, e, and f) NH -Br -CIT 3

-H

0357 b, c, d, e, and 1)NH -Br -CF 3

-H

0358 b, c, d, e, and fT) NH -Br -OCH 3

-H

0359 b, c, d, e, and f) NH -Br -OCH 2

CH

3

-H

72 00 00 G360 b, c, d, e, and f) NH -Br -OCF 3

-H

G361 b, c, d, e, and f) NH -Br -tert-butyl -H G362 b, c, d, e, and f) NH -Br -iso-propyl -H G363 b, c, d, e, and f) NH -Br -CH 3

-CH

3 G364 b, c, d, e,and f) NH -Br -H -H G365 b, c, d, e, and f) NI- -Br -H -Cl G366 b, c, d, e,and f) NH -Br -H -Br G367 b, c, d, e,andtf) NH -Br -H -F G368 b, c, d, e, and f) NH -Br -H -Gil 3 G369 b, c, d, e, and f) NH -Br -H -CF 3 G370 b, c, d, e, and f) NH -Br -H -OCH 3 G371 b, c, d, e, and f) NH -Br -H -OCH 2

CH

3 G372 b, c, d, e, and f) NH -Br -H -OCF 3 G373 b, c, d, e, and f) NH -Br -H -tert-butyl G374 b, c, d, e, and f) NH -Br -H -iso-propyl G375 b, c, d, e,and f) NH -I -Cl -H G376 b, c, d,e, andtf) NH -I -Br -H G377 b, c, d,e, andtf) NH -I -F -H G378 b, c, d, e, and t) NH -1 -Gil 3

-H

G379 b, c, d,e, and f) NH -1 -CF 3

-H

G380 b, c, d, e, and f) NH -I -OCH 3

-H

G381 b, c, d, e, and f) NH -1 -OCH 2

CH

3

-H

G382 b, c, d, e, and f) NH -1 -OCF 3

-H

G383 b, c, d, e, and f) NH -1 -tert-butyl -H G384 b, c, d, e, and f) NH -1 -iso-propyl -H G385 b, c, d,e, and f) NHI -1 -Gil 3 -Gil 3 G386 b, c, d,e, and f) NH -I -H -H G387 b, c, d,e, andtf) NH -I -H -Cl G388 b, c, d,e, and f) NH -1 -H -Br G3 89 b, c, d,e, and f) NH -1 -H -F G390 b, c, d, e,and f) NH -I -H -CH- 3 G391 b, c, d, e, and f) NH -I -H -CF 3 G392 b, c, d, e, and f) NH -1 -H -0C11 3 G393 b, c, d, e, and f) NH -1 -H -OCH 2

CH

3 G394 b, c, d, e, and 1 NH -I -H -OCF 3 G395 b, c, d, e, and f) NH -I -H -tert-butyl G396 b, c, d, e, and f) NH -I I -H I -iso-propyl In the column labeled "Compound": means that R 3 is -Gil 3 means that R 3 is -Cl; means that R 3 is -Br; means that R 3 is -I; means that R 3 is and means that R 3 is in formula m 0.

73 00 00 Table 8 (R8)a' (Ig) and pharmaceutically acceptable salts thereof, where: Compound Y R,(R 8 (R8)b H1L(a, b,c, d,e, and f) S -Cl -Cl -H H2 b, c, d, e,and f) S -Cl -Br -H H3 b, c, d, e,and f) S -Cl -F -H H4 b, c,d, e,and f) S -Cl -CH 3

-H

b,c, d,e, and f) S -Cl -CF 3

-H

H6 b, c, d, e, and f) S -Cl -OCH 3

-H

117 b, c, d, e. and f) S -CI -OCH 2

CH

3

-H

118 b, c, d, e, and f) S -Cl -OCF 3

-H

H9 b, c, d, e, and f) S -Cl -tert-butyl -H b, c, d, e, and f) -S -Cl -iso-propyl -H HIl1 b, c, d, e, and f) S -Cl -Gil 3 -Gil 3 H12 b, c,d, e,andtf) S -Cl -H -H H13 b,c, d, e,and f) S -Cl -H -Cl H14 b, c,d,e, andDf S -Cl -H -Br b, c,d,e, and f) S -Cl -H -F H16 b, c, d, e, and f) S -Cl -H -CH 3 H17 b, c, d, e, and f) S -Cl -H -CF 3 H18 b, c,d, e,and f) -S -Cl -H -OCH 3 H 19 b, c, d, e, and f) S -Cl -H -OCH 2

CH

3 H120 b, c, d, e, and f) S -Cl -H -OCF 3 H121 b, c, d, e, and f) S -Cl -H -tert-butyl 74- 00 00 H22 b, c, d, e, and f) S -Cl -H -iso-propyl H23 b, c, d, e, and f) S -CH 3 -Cl -H H24 b, c, d, e, and f) S -CH 3 -Br -H b, c, d, e, and f) S -CH 3 -F -H H26 b, c, d, e, and f) S -CH 3

-CH

3

-H

H27 b, c, d, e, and f) S -CH 3

-CF

3

-H

H28 b, c, d, e, and f) S -CH 3

-OCH

3

-H

H29 b, c, d, e, and f) S -CH 3

-OCH

2

CH

3

-H

b, c, d, e, and f) S -CH 3

-OCF

3

-H

H31 b, c, d, e, and f) S -CH 3 -tert-butyl -H H32 b, c, d, e, and f) S -CH 3 -iso-propyl -H H33 b, c, d, e, and f) S -CH 3

-CH

3 -CH3 H34 b, c, d, e, andf) S -CH 3 -H -H H35 b, c, d, e, and f) S -CH 3 -H -Cl H36 b, c, d, e, and f) S -CH 3 -H -Br H37 b, c, d, e, and f) S -CH 3 -H -F H38 b, c, d, e, and f) S -CH 3 -H -CH 3 H39 b, c, d, e, and f) S -CH 3 -H -CF 3 b, c, d, e, and f) S -CH 3 -H -OCH 3 H41 b, c, d, e, and f) S -CH 3 -H -OCH 2

CH

3 H42 b, c, d, e, and f) S -CH 3 -H -OCF 3 H43 b, c, d, e, and f) S -CH3 -H -tert-butyl H44 b, c, d, e, and f) S -CH3 -H -iso-propyl b, c, d, e, and f) S -CF 3 -Cl -H H46 b, c, d, e, and f) S -CF 3 -Br -H H47 b, c, d, e, and f) S -CF 3 -F -H H48 b, c, d, e, and f) S -CF 3

-CH

3

-H

H49 b, c, d, e, and f) S -CF 3

-CF

3

-H

b, c, d, e, and f) S -CF 3

-OCH

3

-H

H51 b, c, c, e, and f) S -CF 3

-OCH

2

CH

3

-H

H52 b, c, d, e, and f) S -CF 3

-OCF

3

-H

H53 b, c, d, e, and f) S -CF 3 -tert-butyl -H H54 b, c, d, e, and f) S -CF 3 -iso-propyl -H b, c, d, e, and f) S -CF 3 -CH3 -CH 3 H56 b, c, d, e, and f) S -CF 3 -H -H H57 b, c, d, e, and f) S -CF 3 -H -Cl H58 b, c, d, e, and f) S -CF 3 -H -Br H59 b, c, d, e, and f) S -CF 3 -H -F b, c, d, e, and f) S -CF 3 -H -CH 3 H61 b, c, d, e, and f) S -CF 3 -H -CF 3 H62 b, c, d, e, and f) S -CF 3 -H -OCH 3 H63 b, c, d, e, and f) S -CF 3 -H -OCH 2

CH

3 H64 b, c, d, e, and f) S -CF 3 -H -OCF 3 b, c, d, e, and f) S -CF 3 -H -tert-but H66 b, c, d, e, and f) S -CF 3 -H -iso-propyl H67 b, c, d, e, and f) S -CHF2 -Cl -H H68 b, c, d, e, and f) S -CHF 2 -Br -H H69 b,c,d, e, and f) S -CHF 2 -F -H 00 00 H70 b, c, d, e, and f) S -CHF 2

-CH

3

-H

H71 b, c, d, e, and f) S -CHF 2

-CF

3

-H

H72 b, c, d, e, and f) S -CHF 2

-OCH

3

-H

H73 b, c, d, e, and f) S -CHF 2

-OCH

2

CH

3

-H

H74 b, c, d, e, and f) S -CHF 2

-OCF

3

-H

b, c, d, e, and f) S -CHF 2 -tert-butyl -H H76 b, c, d, e, and f) S -CHF 2 -iso-propyl -H H77 b, c, d, e, and f) S -CHF 2

-CH

3

-CH

3 H78 b, c, d, e, and f) S -CHF 2 -H -H H79 b, c, d, e, and f) S -CHLF 2 -H -Cl b, c, d, e, and f) S -CHLF 2 -H -Br H81 b, c, d, e, andf) S -CHlF 2 -H -F H82 b, c, d, e, and f) S -CBF 2 -H -CH3 H83 b, c, d, e, and f) S -CHF 2 -H -CF 3 H84 b, c, d, e, and f) S -CHF 2 -H -OCH 3 b, c, d, e, and f) S -CHF 2 -H -OCH 2

CH

3 H86 b, c, d, e, and f) S -CHF 2 -H -OCF 3 H87 b, c, d, e, and f) S -CRF 2 -H -tert-butyl H88 b, c, d, e, and f) S -CHF 2 -H -iso-propyl H89 b, c, d, e, and f) S -Br -Br -H b, c, d, e, and f) S -Br -Cl -H H91 b, c, d, e, and f) S -Br -F -H H92 b, c, d, e, and f) S -Br -CH 3

-H

H93 b, c, d, e, and f) S -Br -CF 3

-H

H94 b, c, d, e, and f) S -Br -OCH 3

-H

b, c, d, e, and f) S -Br -OCH2CH 3

-H

H96 b, c, d, e, and f) S -Br -OCF 3

-H

H97 b, c, d, e, and f) S -Br -tert-butyl -H H98 b, c, d, e, and f) S -Br -iso-propyl -H H99 b, c, d, e, and f) S -Br -CH 3 -CH3 H100 b, c, d, e, and f) S -Br -H -H H101 b, c, d, e, and f) S -Br -H -Cl H102 b, c, d, e, and f) S -Br -H -Br H103 b, c, d, e, and f) S -Br -H -F H104 b, c, d, e, and f) S -Br -H -CH 3 H105 b, c, d, e, and f) S -Br -H -CF 3 H106 b, c, d, e, and f) S -Br -H -OCH 3 H107 b, c, d, e, and f) S -Br -H -OCH2CH 3 H108 b, c, d, e, and f) S -Br -H -OCF 3 H109 b, c, d, e, and f) S -Br -H -tert-butyl H1l10 b, c, d, e, and f) S -Br -H -iso-propyl H11 b, c, d, e, and f) S -I -Cl -H H112 b, c, d, e, and f) S -I -Br -H H113 b, c, d, e, and f) S -I -F -H H114 b, c, d, e, and f) S -I -CH 3

-H

H115 b, c, d, e, and f) S -I -CF 3

-H

H116 b, c, d, e, andf) S -I -OCH 3

-H

H1 17 b, c, d, e, and f) S -I -OCH 2

CH

3

-H

-76- 00 C00 0 H118 b, c, d, e, and f) S -I -OCF 3

-H

H119 b, c, d, e, and f) S -I -tert-butyl -H H120 b, c, d, e, and f) S -I -iso-propyl -H H121 b, c, d, e, and f) S -I -CH 3

-CH

3 H122 b, c, d, e, andf) S -I -H -H H123 b, c, d, e, and f) S -I -H -Cl H124 b, c, d, e, and f) S -I -H -Br H125(a, b, c, d, e, and f) S -I -H -F H126 b, c, d, e, and f) S -I -H -CH3 H127 b, c, d, e, and f) S -I -H -CF 3 1128 b, c, d, e, and f) S -I -H -OCH3 1129 b, c, d, e, and f) S -I -H -OCH 2

CH

3 H130 b, c, d, e, and f) S -I -H -OCF 3 H131 b, c, d, e, and f) S -I -H -tert-butyl H132 b, c, d, e, and f) S -I -H -iso-propyl H133 b, c, d, e, and f) O -Cl -Cl -H 1134 b, c, d, e, and f) O -Cl -Br -H H135 b, c, d, e, and f) O -Cl -F -H 1H136 b, c, d, e, and f) O -Cl -CH 3

-H

H137 b, c, d, e, and f) O -Cl -CF 3

-H

H138 b, c, d, e, and f) O -Cl -OCH3 -H 1H1139 b, c, d, e, and f) O -Cl -OCH 2

CH

3

-H

H140 b, c, d, e, and f) O -Cl -OCF 3

-H

H141 b, c, d, e, and f) O -Cl -tert-butyl -H 1142 b, c, d, e, and f) O -Cl -iso-propyl -H 1H143 b, c, d, e, and f) 0 -Cl -CH 3 -CH3 H144 b, c, d, e, and f) O -Cl -H -H 1H1145 b, c, d, e, and f) 0 -Cl -H -CH 3 H146 b, c, d, e, andf) 0 -Cl -H -Cl 1H147 b, c, d, e, and f) O -Cl -H -Br H148 c, d, e, and f) O -Cl -H -F H149 b, c, d, e, and f) 0 -Cl -H -CF 3 1H150 b, c, d, e, and f) 0 -Cl -H -OCH3 H151 b, c, d, e, and f) 0 -Cl -H -OCH 2

CH

3 H152 b, c, d, e, and f) 0 -Cl -H -OCF 3 H153 b, c, d, e, and f) O -Cl -H -tert-butyl H154 b, c, d, e, and f) O -Cl -H -iso-propyl H155 b, c, d, e, and f) O -CH 3 -Cl -H H156 b, c, d, e, and f) O -CH 3 -Br -H 1H1157 b, c, d, e, and f) O -CH3 -F -H H158 b, c, d, e, and f) O -CH 3

-CH

3

-H

1H159 b, c, d, e, and f) O -CH 3

-CF

3

-H

H160 b, c, d, e, and f) O -CH 3

-OCH

3

-H

11161 b, c, d, e, and f) O -CH 3

-OCH

2

CH

3

-H

1H162 b, c, d, e, and f) O -CH 3

-OCF

3

-H

1163 b, c, d, e, and f) O -CH3 -tert-butyl -H H164 b, c, d, e, and f) O -CH 3 -iso-propyl -H H165 b, c, d, e, and f) 0 -CH3 -CH 3 -CH3 -77- 00 00 H166 b, c, d, e, and f) 0 -CH 3 -H -H H167 b, c, d, e, and f) 0 -CH 3 -H -CI H168 b, c, d, e, and f) 0 -CH 3 -H -Br H169 b, c, d, e, and f) 0 -Cl! 3 -H -F 11170 b, c, d, e, and f) 0 -CH 3 -H -CH 3 H1171 b, c, d, e, and f7) 0 -CH 3 -H -CF 3 H1172 b, c, d, e, and f) 0 -Cl! 3 -H -0CH 3 11173 b, c, d, e, and f) 0 -Cl! 3 -H -OCH 2

CH

3 H174 b, c, d, e, and f) 0 -CH 3 -H -0CF 3 H1175 b, c, d, e, and f7) 0 -Cl! 3 -H -tert-butyl 11176 b, c, d, e, and f) 0 -CH 3 -H -iso-propyl H177 b, c, d, e, and f) 0 -CF 3 -Cl -H H178 b, c, d, e, and f) 0 -CF 3 -Br -H H179 b, c, d, e, and f) 0 -CF 3 -F -H H180 b, c, d, e, and f7) 0 -CF 3 -Cl! 3

-H

H1181 b, c, d, e, and f) 0 -CF 3

-CF

3

-H

11182 b, c, d, e, and f7) 0 -CF 3

-OCH

3

-H

11183 b, c, d, e, and f) 0 -CF 3

-OCH

2

CH

3 -H4 Hl184 b, c, d, e, and f) 0 -CF 3

-OCF

3

-H

H185 b, c, d, e, and f) 0 -CF 3 -tert-butyl -H H 186 b, c, d, e, and f) 0 -CF 3 -iso-propyl -H H187 b, c, d, e, and f7) 0 -CF 3

-CH

3 -Cl! 3 H188 b, c, d, e, and f7) 0 -CF 3 -H -H H189 b, c, d, e, and f) 0 -CF 3 -H -Cl H190 b, c, d, e, and f) 0 -CF 3 -H -Br H191 b, c, d, e, and f) 0 -CF 3 -H -F 11192 b, c, d, e, and f) 0 -CF 3 -H -Cl! 3 H193 b, c, d, e, and f) 0 -CF 3 -H -CF 3 11194 b, c, d, e, and 0 -CF 3 -H -0CH 3 H195 b, c, d, e, and f) 0 -CF 3 -H -0CH 2

CH

3 H196 b, c, d, e, and f) 0 -CF 3 -H -OCF 3 H197 b, c, d, e, and f) 0 -CF 3 -tert-butyl H198 b, c, d, e, and f) 0 -CF 3 -H -iso-propyl 11199 b, c, d, e, and f) 0 -CHF 2 -Cl -H H200 b, c, d, e, and f) 0 -CHF 2 -Br -H H201 b, c, d, e, and f) 0 -CHF 2 -F -H 11202 b, c, d, e, and f) 0 -CHF 2

-CH

3

-H

11203 b, c, d, e, and f) 0 -CHF 2

-CF

3

-H

11204 b, c, d, e, and f) 0 -CHF 2

-OCH

3

-H

11205 b, c, d, e, and f) 0 -CHF 2

-OCH

2

CH

3

-H

11206 b, c, d, e, and f) 0 -CHF 2

-OCF

3

-H

11207 b, c, d, e, and f) 0 -CHF 2 -tert-butyl -H 11208 b, c, d, e, and f) 0 -CHIF 2 -iso-propyl -H H209 b, c, d, e, and f) 0 -CB1F 2 -Cl! 3 -Cl! 3 H21 0(a, b, c,d, e,and f) 0 -CHF 2 -H -H H211 b,c, d, e,and f) 0 -CHF 2 -H -Cl 11212 b, c, d, e, and f) 0 -CHF 2 -H -Br H213 b,c, d, e,and f) 10 1-CHF 2 -H -FT 78 00 0O 0

(N

(N O

O

0

(N

H214 b, c, d, e, and f) 0 -CHF 2 -H -CH 3 H215 b, c, d, e, and f) 0 -CHF 2 -H -CF 3 H216 b, c, d, e, and f) 0 -CHF 2 -H -OCH 3 H217 b, c, d, e, and f) 0 -CHF 2 -H -OCH 2

CH

3 H218 b, c, d, e, and f) 0 -CHF 2 -H -OCF 3 H219 b, c, d, e, and f) 0 -CHF 2 -H -tert-butyl H220 b, c, d, e, and f) 0 -CHF 2 -H -iso-propyl H221 b, c, d, e, and f) 0 -Br -Br -H H222 b, c, d, e, and f) 0 -Br -Cl -H H223 b, c, d, e, and f) 0 -Br -F -H H224 b, c, d, e, and f) 0 -Br -CH 3

-H

H225 b, c, d, e, and f) 0 -Br -CF 3

-H

H226 b, c, d, e, and f) 0 -Br -OCH 3

-H

H227 b, c, d, e, and f) 0 -Br -OCH 2

CH

3

-H

H228 b, c, d, e, and f) 0 -Br -OCF 3

-H

H229 b, c, d, e, and f) 0 -Br -tert-butyl -H H230 b, c, d, e, and f) 0 -Br -iso-propyl -H H231 b, c, d, e, and f) 0 -Br -CH 3 -CH3 H232 b, c, d, e, and f) 0 -Br -H -H H233 b, c, d, e, and f) 0 -Br -H -Cl H234 b, c, d, e, and f) 0 -Br -H -Br H235 b, c, d, e, and f) 0 -Br -H -F H236 b, c, d, e, and f) 0 -Br -H -CH 3 H237 b, c, d, e, and f) 0 -Br -H -CF 3 H238 b, c, d, e, and f) 0 -Br -H -OCH 3 H239 b, c, d, e, and f) 0 -Br -H -OCH2CH3 H240 b, c, d, e, and f) 0 -Br -H -OCF 3 H241 b, c, d, e, and f) 0 -Br -H -tert-butyl H242 b, c, d, e, and f) 0 -Br -H -iso-propyl H243 b, c, d, e, and f) 0 -I -Cl -H H244 b, c, d, e, and f) 0 -I -Br -H H245 b, c, d, e, and f) 0 -I -F -H H246 b, c, d, e, and f) 0 -I -CH 3

-H

H247 b, c, d, e, and f) 0 -I -CF 3

-H

H248 b, c, d, e, and f) 0 -I -OCH 3

-H

H249 b, c, d, e, and f) 0 -I -OCH 2

CH

3

-H

H250 b, c, d, e, and f) 0 -I -OCF 3

-H

H251 b, c, d, e, and f) 0 -I -tert-butyl -H H252 b, c, d, e, and f) 0 -I -iso-propyl -H H253 b, c, d, e, and f) 0 -I -CH 3

-CH

3 H254 b, c, d, e, and f) 0 -I -H -H H255 b, c, d, e, and f) 0 -I -H -Cl H256 b, c, d, e, and f) 0 -I -H -Br H257 b, c, d, e, and f) 0 -I -H -F H258 b, c, d, e, and f) 0 -I -H -CH 3 H259 b, c, d, e, and f) 0 -I -H -CF 3 H260 b, c, d, e, and f) 0 -I -H -OCH 3 H261 b, c, d, e, and f) 0 -I -H -OCH 2

CH

3 79 00 00 H262 b, c, d, e, and f) 0 -I -H -OCF 3 H263 b, c, d,e, and f) O -I -H -tert-butyl H264 b, c, d, e, and f) 0 -I -H -iso-propyl H265 b, c, d, e, and f) NH -Cl -Cl -H H266 b, c, d,e, and f) NH -Cl -Br -H H267 b, c, d, e, and f) NH -Cl -F -H H268 b, c, d, e, and f) NH -Cl -CH 3

-H

H269 b, c, d, e, and f) NH -Cl -CF 3

-H

H270 b, c, d, e, and f) NH -Cl -OCH 3

-H

H271 b, c, d, e, and f) NH -Cl -OCH 2

CH

3

-H

H272 b, c, d, e, and f) NH -Cl -OCF 3

-H

H273 b, c, d, e, and f) NH -Cl -tert-butyl -H H274 b, c, d, e, and f) NH -Cl -iso-propyl -H H275 b, c, d, e, and f) NH -Cl -CH 3

-CH

3 H276 b, c, d, e, and f) NH -Cl -H -H H277 b, c, d, e, and f) NH -Cl -H -CH 3 H278 b, c, d, e, and f) NH -Cl -H -Cl H279 b, c, d, e, and f) NH -Cl -H -Br H280 b, c, d, e, and f) NH -Cl -H -F H281 b, c, d, e, and f) NH -Cl -H -CF 3 H282 b, c, d, e, and f) NH -Cl -H -OCH 3 H283 b, c, d, e, and f) NH -Cl -H -OCH 2 CH3 H284 b, c, d, e, and f) NH -Cl -H -OCF 3 H285 b, c, d, e, and f) NH -Cl -H -tert-butyl H286 b, c, d, e, and f) NH -Cl -H -iso-propyl H287 b, c, d, e, and f) NH -CH 3 -Cl -H H288 b, c, d, e, and f) NH -CH 3 -Br -H H289 b, c, d, e, and f) NH -CH 3 -F -H H290 b, c, d, e, and f) NH -CH 3

-CH

3

-H

H291 b, c, d, e, and f) NH -CH3 -CF 3

-H

H292 b, c, d, e, and f) NH -CH 3

-OCH

3

-H

H293 b, c, d, e, and f) NH -CH 3

-OCH

2

CH

3

-H

H294 b, c, d, e, and f) NH -CH3 -OCF 3

-H

H295 b, c, d, e, and f) NH -CH 3 -tert-butyl -H H296 b, c, d, e, and f) NH -CH3 -iso-propyl -H H297 b, c, d, e, and f) NH -CH3 -CH 3

-CH

3 H298 b, c, d, e, and f) NH -CH 3 -H -H H299 b, c, d, e, and f) NH -CH3 -H -Cl H300 b, c, d, e, and f) NH -CH 3 -H -Br H301 b, c, d, e, and f) NH -CH 3 -H -F H302 b, c, d, e, and f) NH -CH 3 -H -CH3 H303 b, c, d, e, and f) NH -CH 3 -H -CF 3 H304 b, c, d, e, and f) NH -CH 3 -H -OCH 3 H305 b, c, d, e, and f) NH -CH 3 -H -OCH 2 CH3 H306 b, c, d, e, and f) NH -CH 3 -H -OCF 3 H307 b, c, d, e, and f) NH -CH 3 -H -tert-butyl H308 b, c, d, e, and f) NH -CH 3 -H -iso-propyl H309 b, c, d, e, and f) NH -CF 3 -Cl -H 00 00 H3 10(a, b,c, d, e,and f) NH -CF 3 -Br -H H311 b, c,d, e, andtf) Nil -CF 3 -F -H H312 d, e, and f) NH -CF 3

-CH-

3

-H

H3 13 b, c, d, e, and f) NH -CF 3

-CF

3

-H

H3 14 b, c, d, e, and f) NH -CF 3

-OCH

3

-H

H315 b, c, d, e, and f) NH -CF 3

-OCH

2

CH

3

-H

H316 b, c, d, e, and f) NIH -CF 3

-OCF

3

-H

H3 17 b, c, d, e, and f) NH -CF 3 -tert-butyl -H H318 b, c, d, e, and f) Nil -CF 3 -iso-propyl -H H3 19 b, c, d, e, and f) NH -CF 3

-CH

3

-CH

3 H320 b, c,d, e, andtf) NH -CF 3 -H -H H321 b, c, d, e, and f) NH -CF 3 -H -Cl H322 b, c, d, e, and f) NH -CF 3 -H -Br H323 b, c, d, e, and f) NH -CF 3 -H -F H324 b, c, d, e, and f) NH -CF 3 -H -CH 3 H325 b, c, d, e, and f) NH -CF 3 -H -CF 3 H326 b, c, d, e, and f) NIH -CF 3 -H -OCH 3 H327 b, c, d, e, and f) NH -CF 3 -H -OCH 2

CH

3 H328 b, c, d, e, and f) NH -CF 3 -H -OCF 3 H329 b, c, d, e, and f) NH -CF 3 -H -tert-butyl H330 b, c, d, e, and f) NH -CF 3 -H -iso-propyl H331 b, c, d, e, and f) NH -CHF 2 -Cl -H H332 b, c, d, e, and f) NH -CHF 2 -Br -H H333 b, c, d, e, and f) NH -Cl-I 2 -F -H H334 b, c, d, e, and f) NH -CHF 2

-CH

3

-H

H335 b, c, d, e, and fT) NH -CL-F 2

-CF

3

-H

H336 b, c, d, e, and f) NH -CHF 2

-OCH

3

-H

H337 b, c, d, e, and f) NH -CHF 2

-OCH

2

CH

3

-H

H3 38 b, c, d, e, and f) NH -CHF 2

-OCF

3

-H

H3 39 b, c, d, e, and f) NH -CB-F 2 -tert-butyl -H H340 b, c, d, e, and f) NH -CHF 2 -iso-propyl -H H341 b, c, d, e, and f) NH -CHF 2

-CH

3

-CH

3 H342 b, c, d, e, and f) NH -CL{F 2 -H -H H343 b, c, d, e, and f) NH -CBF 2 -H -Cl H344 b, c, d, e, and fT) NH -CIHF 2 -H -Br H345 b, c, d, e, and f) NH -CHF 2 -H -F H346 b, c, d, e, and fT) NH -CIHF 2 -H -CH 3 H347 b, c, d, e, and f) NH -Cl-F 2 -H -CF 3 H348 b, c, d, e, and f) NH -CHF 2 -H -OCH 3 H349 b, c, d, e, and f) NH -CHF 2 -H -OCH 2

CH

3 H350 b, c, d, e, and f) NH -CHF 2 -H -OCF 3 H351 b, c, d, e, and f) NH -CIHF 2 -H -tert-butyl H1352 b, c, d, e, and f) NH4 -Cl-F 2 -H -iso-propyl 11353 b, c, d, e, and IT) NH -Br -Br -H H1354 b, c, d, e, and f) NH -Br -Cl -H H355 b, c,d, e,and f) NH -Br -F -H 11356 b, c, d, e, and fT) NH -Br -CH- 3

-H

H1357 b, c, d, e, and f) NH -Br -CF 3

-H

81 00 00 14358 b, c, d, e, and f) NH -Br -OCH 3

-H

H359 b, c, d, e, and f) NH -Br -OCH 2

CH

3

-H

H360 b, c, d, e, and f) NH -Br -OCF 3

-H

H361 b, c, d, e, and f) NH -Br -tert-butyl -H H362 b, c, d, e, and f) NHl -Br -iso-propyl -H H363 b, c, d, e, anid f) NH -Br -CH 3

-CH

3 H364 b, c,d,e, and f) NH -Br -H -H H365 b, c, d, e, and fi) NH -Br -H -Cl H366 b, c, d, e, and f) NH -Br -H -Br H367 b, c,d, e,and f) NH -Br -H -F H368 b, c, d, e, and f) NH -Br -H -CH 3 H369 b, c, d, e, and f) NH -Br -H -CF 3 H1370 b, c, d, e, and f) NH -Br -H -OCH 3 H1371 b, c, d, e, and f) NH -Br -H -OCH 2

CH

3 H1372 b, c, d, e, and f) NH -Br -H -OCF 3 H373 b, c, d, e, and f) NH -Br -H -tert-butyl H1374 b, c, d, e, and f) NH -Br -H -iso-propyl H375 b, c,d, e,and f) NH -I -Cl -H H376 b, c,d, e, aadf) NH -1 -Br -H H377 b, c, d, e, adf) NH -I -F -H H378 b, c,d, e, andf) NH -1 -Gil 3

-H

H1379 b, c, d, e, an~d f) NH -I -CF 3

-H

11380 b, c, d, e, and f) NH -1 -OCT! 3

-H

H381 b, c, d, e, and f) NH -I -OCH 2

CH

3

-H

H1382 b, c, d, e, and f) NH -1 -OCF 3

-H

11383 b, c, d, e, and f) NH -1 -tert-butyl -H 11384 b, c, d, e, and f) NH -I -iso-propyl -H H1385 b, c, d, e, an~d fT) NH -1 -CH 3

-CT!

3 H386 b, c,d, e,and f) NH -1 -H -H H387 c, d,e,arid f) NH -I -H -Cl H3 88 b, c,d, e, aadf) NH -I -H -Br H389 b, c,d, e,and f) NH -1 -H -F 11390 b, c, d, e, and f) NH -I -H1 -Gil 3 H1391 b, c, d, e, antd f) NH -1 -H -CF 3 11392 b, c, d, e, and f) NH -I -H -OCT! 3 H393 b, c, d, e, and f) NH -I -H -OCH 2

CH

3 11394 b, c, d, e, and f) NH -I -H -OCF 3 H395 b, c, d, e, and f) NH! -I -H -tert-butyl H1396 b, c, d, e, and f) INH -1 -H -iso-propyl In the column labeled "Compound": means that R 3 is -Gil 3 means that R 3 is -Cl; means that R 3 is -Br; means that R- 3 is -1; means that R 3 is and means that R 3 is in formula m 0.

82- 00 Table 9 C~1

N-S

0

N

00N (R8)a (R8)b (1hi) and pharmaceutically acceptable salts thereof, where: Compound IY

R

1 R) (RS)b 11 b, c, d.e.and f S -Cl -CI

-H

12 b,c, d e~nd)A S -CI -Br

-H

112 (a b c d i, A S C l Fr

H

14 b, c, d Pe nd A S -CI Clb, c, d.e.and f S -Cl C3- 110 b, c, d. e. and f) S -Cl -oH -oH 19 b, c,d,e, and f S -C 1214 b, c, d, e, and f) S -Cl -H -tert-u 83 00 00 122 b, c, d, e, and 1) S -Cl -H -iso-propyl 123 b, c, d, e, and f) S -CH 3 -Cl -H 124 b, c,d, e,and f) S -CH 3 -Br -H 125 b, c,d, e,andf D S -CH 3 -F -H 126 b, c, d, e, and f) S -CH 3

-CH

3

-H

127 b, c, d, e, and f) s -CH 3

-CF

3

-H

128 b, c, d, e, and f) S -Gil 3

-OCH

3

-H

129 b, c, d, e, and f) S -CH 3

-OCH

2

CH

3

-H

130 b, c, d, e, and f) S -Gil 3

-OCF

3

-H

131 b, c, d, e, and f) S -Gil 3 -tert-butyl -H 132 b, c, d, e, and f) s -CH 3 -iso-propyl -H 133 b, c, d, e, and 0T S -CH 3

-CH-

3

-CH-

3 134 b, c,d,e, and f) S -CH 3 -H -H 135 b, c, d, e, and f) S -CH 3 -H -Cl 136 b, c, d, e, and f) S -CH 3 -H -Br 137 b,c, d, e,andtf) S -Gil 3 -H -F 138 b, c, d, e, and f) S -CH 3 -H -CH 3 139 b, c, d, e, and f) S -Gil 3 -H -CF 3 140 b, c, d, e, and f) S -Gil 3 -H -QCH 3 141 b, c, d, e, and f) S -Gil 3 -H -OCH 2

CH

3 142 b, c, d, e, and f) S -CH 3 -H -OCF 3 143 b, c, d, e, and fT) S -Gil 3 -H -tert-butyl 144 b, c, d, e, and f) S -CH 3 -H -iso-propyl 145 b, c,d, e,andtf) S -CF 3 -Cl -H 146 b, c, d, e, and f) S -CF 3 -Br -H 147 b,c, d, e,and f) S -CF 3 -F -H 148 b, c, d, e, and f) S -CF 3

-CH

3

-H

149 b, c, d, e, and f) S -CF 3

-CF

3

-H

150 b, c, d, e, and f) S -CF 3

-OCH

3

-H

151 b, c, d, e, and f) S -CF 3

-OCH

2

CH

3

-H

152 b, c, d, e, and f) S -CF 3

-OCF

3

-H

153 b, c, d, e, and f) S -CF 3 -tert-butyl -H 154 b, c, d, e, and f) S -CF 3 -iso-propyl -H 155 b, c, d, e, and f) S -CF 3

-CH

3

-CH

3 156 b, c,d, e,and f) S -CF 3 -H -H 157 b, c, d, e, and f) S -CF 3 -H -Cl 158 b, c, d, e, and f) S -CF 3 -H -Br 159 b,c, d, e,and f) S -CF 3 -H -F 160 b, c, d, e, and f) S -CF 3 -H -CH 3 161 b, c, and f) S -CF 3 -H -CF 3 162 b, c, d, e, and f) S -CF 3 -H -OCH 3 163 b, c, d, e, and f) S -CF 3 -H -OCH 2

GH

3 164 b, c, d, e, and f) S -CF 3 -H -OCF 3 165 b, c, d, e, and f) S -CF 3 -H -tert-butyl 166 b, c, d, e, and f) S -CF 3 -H -iso-propyl 167 b, c, d, e, and 0) S -CHF 2 -Cl -H 168 b, c, d, e, and f) S -GHF 2 -Br -H 169 b, c, d,e,and f S -Cl-F 2 -F -H 84- 00 00 170 b, c, d, e, and f) S -CHF 2

-CH

3

-H

171 b, c, d, e, and f) S -CHF 2

-CF

3

-H

172 b, c, d, e, and f) S -CHF 2

-OCH

3

-H

173 b, c, d, e, and f) S -CIHF 2

-OCH

2

CH

3

-H

174 b, c, d, e, and f) S -CIHF2 -OCF 3

-H

175 b, c, d, e, and f) S -CIHF2 -tert-butyl -H 176 b, c, d, e, and f) S -CHF 2 -iso-propyl -H 177 b, c, d, e, and f) S -CF2 -CH 3

-CH

3 178 b, c, d, e, and f) S -CHF2 -H -H 179 b, c, d, e, and f) S -CIHF2 -H -Cl 180 b, c, d, e, and f) S -CIF2 -H -Br 181 b, c, d, e,and f) S -CHF2 -H -F 182 b, c, d, e, and f) S -CIF2 -H -CH3 183 b, c, d, e, and f) S -CHF 2 -H -CF 3 184 b, c, d, e, and f) S -CHF 2 -H -OCH 3 185 b, c, d, e, and f) S -CIHF 2 -H -OCH 2

CH

3 186 b, c, d, e, and f) S -CHF 2 -H -OCF 3 187 b, c, d, e, and f) S -CHF 2 -H -tert-butyl 188 b, c, d, e, and f) S -CITHF 2 -H -iso-propyl 189 b, c, d, e, andf) S -Br -Br -H 190 b, c, d, e, and f) S -Br -Cl -H 191 b, c, d, e, and f) S -Br -F -H 192 b, c, d, e, and f) S -Br -CH 3

-H

193 b, c, d, e, and f) S -Br -CF 3

-H

194 b, c, d, e, and f) S -Br -OCH 3

-H

195 b, c, d, e, and f) S -Br -OCH 2

CH

3

-H

196 b, c, d, e, and f) S -Br -OCF 3

-H

197 b, c, d, e, and f) S -Br -tert-butyl -H 198 b, c, d, e, and f) S -Br -iso-propyl -H 199 b, c, d, e, and f) S -Br -CH 3 -CH3 1100 b, c, d, e, and f) S -Br -H -H 1101 b, c, d, e, and f) S -Br -H -Cl 1102 b, c, d, e, and f) S -Br -H -Br 1103 b, c, d, e, and f) S -Br -H -F 1104 b, c, d, e, and f) S -Br -H -CH3 1105 b, c, d, e, and f) S -Br -H -CF 3 1106 b, c, d, e, and f) S -Br -H -OCH 3 1107 b, c, d, e, and f) S -Br -H -OCH 2

CH

3 1108 b, c, d, e, and f) S -Br -H -OCF 3 1109 b, c, d, e, and f) S -Br -H -tert-butyl 1110 b, c, d, e, and f) S -Br -H -iso-propyl 1111 b, c, d, e, and f) S -I -Cl -H 1112 b, c, d, e, and f) S -I -Br -H 1113 b, c, d, e, and f) S -I -F -H 1114 b, c, d, e, and f) S -I -CH 3

-H

1115 b, c, d, e, and f) S -I -CF 3

-H

1116 b, c, d, e, and f) S -I -OCH 3

-H

1117 b, c, d, e, and f) S -I -OCH 2

CH

3

-H

00 00 00 1118 b, c,d, e, and f) S -I -OCF 3

-H

1119 b, c, d, e, and f) S -I -tert-butyl -H 1120 b, c, d, e, and f) S -I -iso-propyl -H 1121 b, c, d, e, and f) S -I -CH 3

-CH

3 1122 b, c, d, e,and f) S -I -H -H 1123 b, c, d, e,andf) S -I -H -Cl 1124 b, c, d, e,andf) S -I -H -Br 1125 b, c, d, e, and f) S -I -H -F 1126 b, c, d, e, and f) S -I -H -CH 3 1127 b, c, d, e, and f) S -I -H -CF 3 1128 b, c, d, e, and f) S -I -H -OCH 3 1129 b, c, d, e, and f) S -I -H -OCH 2

CH

3 1130 b, c, d, e, and f) S -I -H -OCF 3 1131 b, c, d, e, and f) S -I -H -tert-butyl 1132 b, c, d, e, and f) S -I -H -iso-propyl 1133 b, c, d, e, and f) O -Cl -Cl -H 1134 b, c, d, e, and f) O -Cl -Br -H 1135 b, c, d, e, and f) O -Cl -F -H 1136 b, c, d, e, and f) O -Cl -CH 3

-H

1137 b, c, d, e, and f) O -Cl -CF 3

-H

1138 b, c, d, e, and f) O -Cl -OCH 3

-H

1139 b, c, d, e, and f) O -Cl -OCH 2

CH

3

-H

1140 b, c, d, e, and f) O -Cl -OCF 3

-H

1141 b, c, d, e, and f) O -Cl -tert-butyl -H 1142 b, c, d, e, and f) O -Cl -iso-propyl -H 1143 b, c, d, e, and f) 0 -Cl -CH 3 -CH3 1144 b, c, d, e, and f) O -Cl -H -H 1145 b, c, d, e, and f) 0 -Cl -H -CH3 1146 b, c, d, e, and f) 0 -Cl -H -Cl 1147 b, c, d, e, and f) O -Cl -H -Br 1148 b, c, d, e, and f) O -Cl -H -F 1149 b, c, d, e, and f) 0 -Cl -H -CF 3 1150 b, c, d, e, and f) 0 -Cl -H -OCH 3 1151 b, c, d, e, and f) O -Cl -H -OCH 2

CH

3 1152 b, c, d, e, and f) 0 -Cl -H -OCF 3 1153 b, c, d, e, and f) 0 -Cl -H -tert-butyl 1154 b, c, d, e, and f) O -Cl -H -iso-propyl 1155 b, c, d, e, and f) O -CH 3 -Cl -H 1156 b, c, d, e, and f) O -CH 3 -Br -H 1157 b, c, d, e, and f) O -CH 3 -F -H 1158 b, c, d, e, and f) O -CH 3

-CH

3

-H

1159 b, c, d, e, and f) O -CH 3

-CF

3

-H

1160 b, c, d, e, and f) O -CH 3

-OCH

3

-H

1161 b, c, d, e, and f) O -CH 3

-OCH

2

CH

3

-H

1162 b, c, d, e, and f) O -CH 3

-OCF

3

-H

1163 b, c, d, e, and f) O -CH 3 -tert-butyl -H 1164 b, c, d, e, and f) O -CH 3 -iso-propyl -H 1165 b, c, d, e, and f) 0 -CH3 -CH 3 -CH3 -86- 00 00 Cc 00 1166 b, c, d, e, and f) O -CH3 -H -H 1167 b, c, d, e, and 0f) -CH143 -H -Cl 1168 b, cd, e,d and f) O -CH 3 -H -Br 1169 b, c, d, e, and f) O -CH3 -H -F 1170 b, c, d, e, and f) 0 -CH 3 -H -CH3 1171 b, c, d, e, and f) 0 -CH 3 -H -CF 3 1172 b, c, d, e, and f) 0 -CH 3 -H -OCH 3 1173 b, c, d, e, and f) O -CH 3 -H -OCH 2

CH

3 1174 b, c, d, e, and f) 0 -CH 3 -H -OCF 3 1175 b, c, d, e, and f) O -CH 3 -H -tert-butyl 1176 b, c, d, e, and f) O -CH 3 -H -iso-propyl 1177 b, c, d, e, and f) O -CF 3 -Cl -H 1178 b, c, d, e, and f) O -CF 3 -Br -H 1179 b, c, d, e, and f) O -CF 3 -F -H 1180 b, c, d, e, and f) O -CF 3

-CH

3

-H

1181 b, c, d, e, and f) O -CF 3

-CF

3

-H

1182 b, c, d, e, and f) O -CF 3

-OCH

3

-H

1183 b, c, d, e, and f) O -CF 3

-OCH

2

CH

3

-H

1184 b, c, d, e, and f) O -CF 3

-OCF

3

-H

1185 b, c, d, e, and f) O -CF 3 -tert-butyl -H 1186 b, c, d, e, and f) O -CF 3 -iso-propyl -H 1187 b, c, d, e, and f) 0 -CF 3

-CH

3

-CH

3 1188 b, c, d, e, and f) O -CF 3 -H -H 1189 b, c, d, e, and f) 0 -CF 3 -H -Cl 1190 b, c, d, e, and f) O -CF 3 -H -Br 1191 b, c, d, e, and f) O -CF 3 -H -F 1192 b, c, d, e, and f) 0 -CF 3 -H -CH3 1193 b, c, d, e, and f) 0 -CF 3 -H -CF 3 1194 b, c, d, e, and f) 0 -CF 3 -H -OCH 3 1195 b, c, d, e, and f) 0 -CF 3 -H -OCH 2

CH

3 1196 b, c, d, e, and f) 0 -CF 3 -H -OCF 3 1197 b, c, d, e, and f) O -CF 3 -H -tert-butyl 1198 b, c, d, e, and f) O -CF 3 -H -iso-propyl 1199 b, c, d, e, and f) O -CHF 2 -Cl -H 1200 b, c, d, e, and f) O -CUF2 -Br -H 1201 b, c, d, e, and f) O -CHF 2 -F -H 1202 b, c, d, e, and f) O -CHF 2

-CH

3

-H

1203 b, c, d, e, and f) O -CHF 2

-CF

3

-H

1204 b, c, d, e, and f) O -CUF 2

-OCH

3

-H

1205 b, c, d, e, and f) O -CHF 2

-OCH

2

CH

3

-H

1206 b, c, d, e, and f) O -CHF 2

-OCF

3

-H

1207 b, c, d, e, and f) O -CHlFz -tert-butyl -H 1208 b, c, d, e, and f) O -CHF2 -iso-propyl -H 1209 b, c, d, e, and f) 0 -CHF 2

-CH

3

-CH

3 1210 b, c, d, e, and f) O -CHF2 -H -H 1211 b, c, d, e, andf) 0 -CHF 2 -H -Cl 1212 b, c, d, e, and f) O -CUF 2 -H -Br 1213 b, c, d, e, and f) O -CHF 2 -H -F -87 00 00 1214 b, c, d, e, and f) 0 -CIF 2 -H -CH 3 1215_(a, b, c, d, e, and f) 0 -CL{F 2 -H -CF 3 1216 b, c, d, e, and f) 0 -CHF 2 -H -OCH 3 1217 b, c, d, e, and f) 0 -CI{F 2 -H -0CH 2

CH

3 1218 b, c, d, e, and f) 0 -CBiF 2 -H -OCF 3 1219 b, c, d, e, and f) 0 -CHIF 2 -H -tert-butyl 1220 b, c, d, e, and f) 0 -CHF 2 -H -iso-propyl 1221 b, c, d, e, and f) 0 -Br -Br -H 1222 b, c,d, e,and f) 0 -Br -Cl -H 1223 b, c,d, e,and f) 0 -Br -F -H 1224 b, c, d, e, and f) 0 -Br -CH 3

-H

1225 b, c, d, e, and f) 0 -Br -CF 3

-H

1226 b, c, d, e, and f) 0 -Br -OCH 3

-H

1227 b, c, d, e, and f) 0 -Br -0CH 2

CH

3

-H

1228 b, c, d, e, and f) 0 -Br -OCF 3

-H

1229 b, c, d, e, and f) 0 -Br -tert-butyl -H 1230 b, c, d, e, and f) 0 -Br -iso-propyl -H 1231 b, c, d, e, and f) 0 -Br -CH 3

-CH

3 1232 b, c,d, e,and f) 0 -Br -H -H 1233 b, c, d, e, and f) 0 -Br -H -Cl 1234 b, c, d, e, and f) 0 -Br -H -Br 1235 b, c,d, e,and f) 0 -Br -H -F 1236 b, c, d, e, and f) 0 -Br -H -CH 3 1237 b, c, d, e, and f) 0 -Br -H -CF 3 1238 b, c, d, e, and f) 0 -Br -H -OCH 3 1239 b, c, d, e, and f) 0 -Br -H -0CH 2

CH

3 1240 b, c, d, e, and f) 0 -Br -H-OCF 3 1241 b, c, d, e, and f) 0 -Br -H -tert-butyl 1242 b, c, d, e, and f) 0 -Br -H -iso-propyl 1243 b, c,d, e,and f) 0 -1 -Cl -H 1244 b,c, d, e,and f) 0 -1 -Br -H 1245 b,c, d, e,and f) 0 -1 -F -H 1246 b,c, d, e,and f) 0 -1 -CH 3

-H

1247 b, c, d, e, and f) 0 -1 -CF 3

-H

1248 b, c, d, e, and f7) 0 -1 -OCH 3

-H

1249 b, c, d, e, and f) 0 -1 -OCH 2

CH

3

-H

1250 b, c, d, e, and f) 0 -1 -0CF 3

-H

1251 b, c, d, e, and f) 0 -1 -tert-butyl -H 1252 b, c, d, e, and f7) 0 -1 -iso-p opyl -H 1253 b, c, d, e, and f) 0 -1 -CH 3

-CH

3 1254 b, c, d,e,and f) 0 -1 -H -H 1255 b, c,d, e,and f) 0 -I-H -Cl 1256 b, c,d, e,and f) 0 -I-H -Br 1257 b, c,d, e,and f) 0 -I-H -F 1258 b, c, d, e, and f) 0 -I-H -Gil 3 1259 b, c,d, e,and f) 0 -I-H -CF 3 1260 b, c, d, e, and f) 0 -I-H -OCH 3 1261 b, c, d, e, and 0) 0 -I-H -OCH 2

CH

3 -88- 00 1262 b, c, d, e, and f) 0 -I -H -OCF 3 S1263 b, c, d, e, and f) 0O -I -H -tert-butyl C 1264 b, c, d, e, and f) 0O -I -H -iso-propyl 1265 (a,b,c,d,e,andf) NH -Cl -Cl -H 1266(a,b,c,d,e,and f) NH -Cl -Br -H 1267 d, e,and f) NH -Cl -F -H 1268(a,b,c,d,e,and f) NHi -Cl -CH 3

-H

1269 b, c, d, e, and f) NH -Cl -CF 3

-H

1270 b, c, d, e, and f) NH -Cl -OCH 3

-H

1271 b, c, d, e, and f) NH -Cl -OCH 2

CH

3

-H

1272 b, c, d, e, and f) NHi -Cl -OCF 3

-H

(t 1273 b, c, d, e, and f) NH -Cl -tert-butyl -H 1274 b, c, d, e, and f) NHI -Cl -iso-propyl -H 00 1275 b, c, d, e, and f) NH -Cl -CH 3

-CH

3 O 1276 b, c, d,e, and f) NH -Cl -H -H 1277 b, c, d, e, and f) NH -Cl -H -CH 3 1278 b, c, d, e, and f) NH -Cl -H -Cl 1279 b, c, d, e, and f) NH -Cl -H -Br 1280 b, c, d, e, andf) NH -Cl -H -F 1281 b, c, d, e, and f) NH -Cl -H -CF 3 1282 b, c, d, e, and f) NH -Cl -H -OCH 3 1283 b, c, d, e, and f) NH -Cl -H -OCH 2

CH

3 1284 b, c, d, e, and f) NH -Cl -H -OCF 3 1285 b, c, d, e, and f) NH -Cl -H -tert-butyl 1286 b, c, d, e, and f) NH -Cl -H -iso-propyl 1287 b, c, d, e, and f) NH -CH 3 -Cl -H 1288 b, c, d, e, and f) NH -CH 3 -Br -H 1289 b, c, d, e, andf) NH -CH3 -F -H 1290 b, c, d, e, and f) NH -CH 3

-CH

3

-H

1291 b, c, d, e, and f) NH -CH 3

-CF

3

-H

1292 b, c, d, e, and f) NH -CH 3

-OCH

3

-H

1293 b, c, d, e, and f) NH -CH 3

-OCH

2

CH

3

-H

1294 b, c, d, e, and f) NH -CH 3

-OCF

3

-H

1295 b, c, d, e, and f) NH -CH 3 -tert-butyl -H 1296 b, c, d, e, and f) NH -CH 3 -iso-propyl -H 1297 b, c, d, e, and f) NH -CH 3

-CH

3

-CH

3 1298 b, c, d, e, and f) NH -CH 3 -H -H 1299 b, c, d, e, and f) NH -CH3 -H -Cl 1300 b, c, d, e, and f) NH -CH3 -H -Br 1301 b, c, d, e, and f) NH -CH 3 -H -F 1302 b, c, d, e, and f) NH -CH 3 -H -CH 3 1303 b, c, d, e, and f) NH -CH 3 -H -CF 3 1304 b, c, d, e, and f) NH -CH 3 -H -OCH 3 1305 b, c, d, e, and f) NH -CH 3 -H -OCH 2

CH

3 1306 b, c, d, e, and f) NH -CH 3 -H -OCF 3 1307 b, c, d, e, and f) NH -CH 3 -H -tert-butyl 1308 b, c, d, e, and f) NH -CH3 -H -iso-propyl 1309 b, c, d, e, and f) NH -CF 3 -Cl -H -89- 00 00 13 10 b, c,d,e, and f) NiH -CF 3 -Br -H 1311 b, c, d, e, and f) NiH -CF 3 -F -H 1312 b, c, d, e, and f) NH -CF 3

-CIT

3

-H

1313 b, c, d, e, and f) NH -CF 3

-CF

3

-H

1314 b, c, d, e, and fl NH -CF 3

-OCH

3

-H

1315 b, c, d, e, and f) NI- -CF 3

-OCH

2

CH

3

-H

1316 b, c, d, e, and t) NiH -CF 3

-OCF

3

-H

1317 b, c, d, e, and f) NH -CF 3 -tert-butyl -H 1318 b, c, d, e, and f) NI- -CF 3 -iso-propyl -H 1319 b, c, d, e, and f) NH -CF 3

-CIT

3

-CIT

3 1320 b, c, d, e, and fT) NH -CF 3 -H -H 1321 b, c, d, e, and f) NH -CF 3 -H -Cl 1322 b, c, d, e, and f) NH -CF 3 -H -Br 1323 b, c, d, e, and f) NIH -CF 3 -H -F 1324 b, c, d, e, and f) NH -CF 3 -H -CH 3 1325 b, c, d, e, and f) NH -CF 3 -H -CF 3 1326 b, c, d, e, and f) NH -CF 3 -H -OCH 3 1327 b, c, d, e, and f) NH -CF 3 -H -OCH 2

CH

3 1328 b, c, d, e, and f) NH -CF 3 -H -OCF 3 1329 b, c, d, e, and f) NH -CF 3 -H -tert-butyl 1330 b, c, d, e, and f) NH -CF 3 -H -iso-propyl 1331 b, c, d, e, and 1) NH -CHF 2 -Cl -H 1332 b, c, d, e, and f) NH -CHF 2 -Br -H 1333 b, c, d, e, and f) NH -CHF 2 -F -H 1334 b, c, d, e, and I) NH -CHF 2

-CH

3

-H

13 35 b, c, d, e, and f) NH -CHlF 2

-CF

3

-H

1336 b, c, d, e, and f) NH -CHF 2

-OCH

3

-H

1337 b, c, d, e, and f) NH -CHF 2

-OCH

2

CH

3

-H

1338 b, c, d, e, and f) NH -CHlF 2

-OCF

3

-H

1339 b, c, d, e, and f) NH -CHlF 2 -tert-butyl -H 1340 b, c, d, e, and f) NH -CHF 2 -iso-propyl -H 1341 b, c, d, e, and f) NH -CHF 2

-CIT

3

-CH

3 1342 b, c, d, e, and f) NH -CHlF 2 -H -H 1343 b, c, d, e, and f) NH -CHF 2 -H -Cl 1344 b, c, d, e, and f) NH -CHlF 2 -H -Br 1345 b, c, d, e, and f) NH -CHF 2 -H -F 1346 b, c, d, e, and f) NH -CHlF 2 -H -CH 3 1347 b, c, d, e, and f) NH -CHlF 2 -H -CF 3 1348 b, c, e, and f) NH -CHF 2 -H -OCH 3 1349 b, c, d, e, and f) NH -CI{F 2 -H -OCH 2

CH

3 1350 b, c, d, e, and f) NH -CHlF 2 -H -OCF 3 1351 b, c, d, e, and f) NH -CHlF 2 -H -tert-butyl 1352 b, c, d, e, and f) NH -CHF 2 -H -iso-propyl 1353 b, c, d, e, and f) NH -13r -Br -H 1354 b, c, d, e, and f) NH -Br -Cl -H 1355 b, c,d, e,and f) NH -Br -F -H 1356 b, c, d, e, and f) NH -Br -CIT 3

-H

1357 b, c, d, e, and f) NH -Br -CF 3

-H

00 00 1358 b, c, d, e, and f) NH -Br -OCH 3

-H

1359 b, c, d, e, and f) NH -Br -OCH 2

CH

3

-H

1360 b, c, d, e, and f) NH -Br -OCF 3

-H

1361 b, c, d, e, and f) NH -Br -tert-butyl -H 1362 b, c, d, e, and f) NH -Br -iso-propyl -H 1363 b, c, d, e, and f) NH -Br -CH 3

-CH

3 1364 b, c,d,e, and f) NH -Br -H -H 1365 b, c, d, e, and f) NH -Br -H -Cl 1366 b, c, d, e, and f) NH -Br -H -Br 1367 b, c,d,e, and f) NH -Br -H -F 1368 b, c, d, e, and f) NH -Br -H -CH 3 1369 b, c, d, e, and f) NH -Br -H -CF 3 1370 b, c, d, e, and f) NH -Br -H -OCH 3 1371 b, c, d, e, and f) NH -Br -H -OCH 2

CH

3 1372 b, c, d, e, and f) NH -Br -H -OCF 3 1373 b, c, d, e, and f) NH -Br -H -tert-butyl 1374 b, c, d, e, and f) NH -Br -H -iso-propyl 1375 b, c,d, e,and f) NH -1 -Cl -H 1376 c, d,e, and f) NH -I -Br -H 1377 b, c,d, e,and f) NH -1 -F -H 1378 b, c, d, e, and fT) NH -1 -CIT 3

-H

1379 b, c, d, e, and f) NH -1 -CF 3

-H

1380 b, c, d, e, and fT) NH -1 -0C11 3

-H

13 81 b, c, d, e, and f) NH -I -OCH 2

CH

3

-H

1382 b, c, d, e, and f) NI- -1 -OCF 3

-H

1383 b, c, d, e, and f) NH -I -tert-butyl -H 1384 b, c, d, e, and f) NH -I -iso-propyl -H 1385 b, c, d, e, and f) NH -1 -CIT 3

-CH

3 1386 b, c,d,e, andtf) NH -1 -H -H 1387 b, c,d,e, and f) NH -I -H -Cl 1388 c, d,e, and D NH -I -H -Br 1389 b, c, d,e,and f) NiH -1 -H -F 1390 b, c, d, e, and f) NH -I -H -CIT 3 1391 b, c, d, e, and f) NH -I -H -CF 3 1392 b, c, d, e, and f) NH -I -H -OCH 3 1393 b, c, d, e, and f) NH -I -H -OCH 2

CH

3 1394 b, c, d, e, and f) NH 4I -H -OCF 3 1395 b, c, d, e, and f) NH -1 -H -tert-butyl 1396 b, c, d, e, and f) NH -1 -H -iso-propyl In the colunmn labeled "Compound": means that R 3 is -CH 3 means that R 3 is -Cl; means that R 3 is -Br; means that R 3 is -I; means that R 3 is and means that R 3 is in formula m 0.

-91- 00 00 Table (Ilb) and pharmaceutically acceptable salts thereof, where: Compound Y Ri(8a(R8)b il S -C1 -Cl -H J2 S -Cl -Br -H B3 S -Cl -F -H J4 S -Cl -CH 3

-H

S -CI -CF 3

-H

J6 S -Cl -OCH 3

-H

P7 S -Cl -OCH 2

CH

3

-H

J8 S -Cl -OCF 3

-H

J9 S -Cl -tert-butyl -H S -Cl -iso-propyl -H il1 S -Cl -CH 3

-CH

3 J12 S -Cl -H -H J13 S -Cl -H -Cl J14 S -Cl -H -Br S -Cl -H -F J16 S -CI -H -CH 3 J17 S -Cl -H -CF 3 92 00 00 J18 s -Cl -H -OCH 3 J19. S -Cl -H -OCH 2

CH

3 S -Cl -H -OCF 3 J21 S -Cl -H -tert-butyl J22 S -Cl -H -iso-propyl J23 S -CH 3 -Cl -H J24 S -CH 3 -Br -H S -CH 3 -F -H- J26 S -CH 3

-CH

3

-H

J27 S -CH 3

-CF

3

-H

J28 S -CH 3 -0CH 3

-H

J29 S -Gil 3

-OCH

2

CH

3

-H

S -CH 3

-OCF

3

-H

J3 1 S -CH 3 -tert-butyl -H J32 S -CH 3 -iso-propyl -H.

J33 S -Gil 3

-CH

3

-CH

3 J34 S -CH 3 -H -H S -CH 3 -H -Cl J36 S -CH 3 -H -Br J37 S -Gil 3 -H -F J38 S -Gil 3 -H -Gil 3 J39 S -Gil 3 -H -CF 3 S -Cil 3 -H -OCH 3 J41 S -CH 3 -H -OCH 2

CH

3 J42 S -CH 3 -H -OCF 3 J43 S -Gil 3 -H -tert-butyl J44 S -CH 3 -H -iso-propyl S -CF 3 -Cl -H J46 S -CF 3 -Br -H J47 S -CF 3 -F -H J48 S -CF 3 -Gil 3

-H

J49 S -CF 3

-CF

3

-H

S -CF 3 -0CH 3

-H

J51 S -CF 3

-OCH

2

CH

3

-H

J52 S -CF 3

-OCF

3

-H

J53 S -CF 3 -tert-butyl -H J54 S -CF 3 -iso-propyl -H S -CF 3 -Gil 3 -Gil 3 J56 S -CF 3 -H -H J57 S -CF 3 -H -Cl J58 S -CF 3 -H -Br J59 S -CF 3 -H -F S -CF 3 -H -Gil 3 J61 s -CF 3 -H -CF 3 J62 S -CF 3 -H -OCH 3 J63 S -CF 3 -H -OCH 2

CH

3 J64 S -CF 3 -H -OCF 3 S -CF 3 -H -tert-butyl 93 00 00 J66 S -CF 3 -H -iso-propyl J67 S -CITE 2 -Cl -H J68 S -CIT 2 -Br -H J69 S -CITE 2 -F -H 170 S -CIT 2

-CH

3

-H

J71 S -CIEF 2

-CF

3

-H

J72 S -CIE 2

-OCH

3

-H

173 S -CIT 2

-OCH

2

CH

3

-H

174 S -CIE 2

-OCF

3

-H

175 S -CITE 2 -tert-butyl -H J76 S -CIT 2 -iso-propyl -H 177 S -CIT 2 -Gil 3

-CH

3 178 S -CITE 2 -H -H 179 S -CITE 2 -H -Cl S -CITE 2 -H -Br 181 S -CITE 2 -H -F J82 S -CITE 2 -H -Gil 3 J83 S -CIE 2 -H -CF 3 J84 S -CIE 2 -H -OCH 3 185 S -CITE 2 -H -OCH 2

CH

3 186 S -CITE 2 -H -OCF 3 J87 S -Cl-F 2 -H -tert-butyl J88 S -CITE 2 -H -iso-propyl J89 S -Br -Br -H 190 S -Br -Cl -H 191 S -Br -F -H J92 S -Br -CH 3

-H

J93 S -Br -CF 3

-H

194 S -Br -OCH 3

-H

S -Br -OCH 2

CH

3

-H

J96 S -B3r -OCF 3

-H

197 S -Br -tert-butyl -H J98 S -]Br -iso-propyl -H 199 S -B3r -Gil 3 -Gil 3 1100 S -Br -H -H 1101 S -B3r -H -Cl 1102 S -Br -H -Br 1103 S -Br -H -F 1104 S -Br -H -CH 3 J105 S -Br -H -CF 3 J106 S -Br -H -OCH 3 1107 S -Br -H -OCH 2

CH

3 1 108 S -Br -H -OCF 3 1109 S -Br -H -tert-butyl 1110 S -Br -H -iso-propy J111 S -1 -Cl -H 1112 S -1 -Br -H 1113 S -I -F -H -94 00 00 J114 S -I -CH 3

-H

J115 S -I -CF 3

-H

J116 S -I -OCH 3

-H

J117 S -1 -OCH 2

CH

3

-H

J118 S -1 -OCF 3

-H

J119 S- -1 -tert-butyl -H J120 S -1 -iso-propyl -H J121 S -1 -CH 3

-CH

3 J 122 S -1 -H -H J123 S -I -H -cI J 124 S -I -H -Br J125 S -I -H -F J126 S -1 -H -Gil 3 J 127 S -1 -H -CF 3 J128 S -1 -H -OCH 3 J129 S -I -H -OCH 2

CH

3 J130 S -1 -H -OCF 3 J131 S -1 -H -tert-butyl J132 S -I -H -iso-propyl J133 0 -Cl -Cl -H J134 0 -Cl -Br -H J135 0 -Cl -F -H J136 0 -Cl -Gil 3

-H

J137 0 -Cl -CF 3

-H

J138 0 -Cl -OCT! 3

-H

J139 0 -Cl -OCH 2

CH

3

-H

J140 0 -Cl -OCF 3

-H

J141 0 -Cl -tert-butyl -H J142 0 -Cl -iso-propyl -H J 143 0 -Cl -CT! 3

-CH

3 J144 0 -Cl -H -H J145 0 -Cl -H -CT! 3 J146 0 -Cl -H -Cl J147 0 -Cl -H -Br J148 0 -Cl -H -F J 149 0 -Cl -H -CF 3 J 150 0 -Cl -H -OCT! 3 J151 0 -Cl -H -OCH 2

CH

3 J152 0 -Cl -H -OCF 3 J153 0 -Cl -H -tert-buty1 J154 0 -Cl -H -iso-propyl J155 0 -CH 3 -Cl -H J156 0 -CT! 3 -Br -H J157 0 -CT! 3 -F -H J158 0 -CT! 3

-CT!

3

-H

J159 0 -CT! 3

-CF

3

-H

J160 0 -CT! 3

-OCH

3

-H

J161 0 -CT! 3 0OCH 2

CH

3

-H

00 00 J 162 J163 0 -CH 3 -tert-butyl J164 0 -CIT 3 -iso- rop -H J 165 J 166 J 167 J168 J 169 J 170 J171 J 1720 H3- O 3 J173 0 -CIT3 -H -OCH 2

CT

3 J 174 J175 0 -CH 3 -H -tert-butyl J176 0 -CH 3 -H -iso-propy1 1177 1178 J179 0 -CF 3 -F -H J180 0 -CF 3

-CIT

3

-IT

1181 0 -CF 3

-CF

3

-IT

J182 0 -CF 3

-OCH

3

-H

J183 0 -CF 3

-OCIT

2

CH

3

-H

1184 0 -CF 3

-OCF

3

-H

1185 0 -CF 3 -tert-butyl -IT J 186 0 -CF 3 -iso-propyl -IT J187 0 -CF 3

-CIT

3

-CH

3 1188 0 -CF 3 -IT -H J189 0 -CF 3 -H -CI J190 0 -CF 3 -H -Br J191 0 -CF 3 -H -F J 192 0 -CF 3 -HT -CIT 3 J193 0 -CF 3 -H -CF 3 J194 0 -CF 3 -IT -OCIT 3 0 -CF 3 -IT -OCH 2

CH

3 J196 0 -CF 3 -H -OCF 3 J 197 0 -CF 3 -IT -tert-butyl J198 0 -CF 3 -H -iso-propyl J199 0 -CH-F 2 -Cl -IT J200 0 -CHF 2 -Br -IT J201 0 -CHFM 2 -F -H J202 0 -CHF 2

-CH

3

-IT

J203 0 -CHF 2

-CF

3

-IT

J204 0 -CHF 2

-OCH

3

-H

J205 0 -ClIP 2 -0CH 2

CH

3

-H

J206 0 -ClIP 2

-OCF

3

-HT

J207 0 -CHF 2 -tert-butyl -IT J208 0 -CHF 2 -iso-propyl -IT J209 0 -ClIP 2

-CIT

3

-CIT

3 96 00 00 J210 0 -CHF 2 -H -H J211 0 -CHF 2 -H -Cl J212 0 -CUE 2 -H -Br J213 0 -CUE 2 -H -F J214 0 -CUE 2 -H -CH 3 J215 0 -CUE 2 -H -CF 3 J216 0 -CUE 2 -H -OCH 3 J217 0 -CUE 2 -H -OCH 2

CH

3 J218 0 -CUE 2 -H -0CF 3 J219 0 -CUE 2 -H -tert-butyl J220 0 -CUE 2 -H -iso-propyl J221 0 -Br -Br -H J222 0 -Br -Cl -H J223 0 -Br -F -H J224 0 -Br -CH 3

-H

J225 0 -Br -CF 3

-H

J226 0 -Br -OCH 3

-H

J227 0 -Br -OCH 2

CH

3

-H

J228 0 -Br -OCF 3

-H

J229 0 -Br -tert-butyl -H J230 0 -Br -iso-propyl -H J231 0 -Br -OH 3

-CH

3 J232 0 -Br -H -H J233 0 -Br -H -cl J234 0 -Br -H -Br J235 0 -Br -H -F J236 0 -Br -H -CH 3 J237 0 -Br -H -CF 3 J238 0 -Br -H -OCH 3 J239 0 -Br -H -OCH 2

CH

3 J240 0 -Br -H -OCF 3 J241 0 -Br -H -tert-butyl J242 0 -Br -H -iso-propyl J243 0 -1 -Cl -H J244 0 -1 -Br -H J245 0 -1 -F -H J246 0 -1 -OH 3

-H

J247 0 -1 -CF 3

-H

J248 0 -1 -OCT13 -H J249 0 -1 -OCH 2

CH

3

-H

J250 0 -1 -0CF 3

-H

J251 0 -1 teri-butyl -H J252 0 -1 -iso-propyl -H J253 0 -1 -OH 3

-CH

3 J254 0 -1 -H -H J255 0 -1 -H -Cl J256 0 -1 -H -Br tJ257 0 -1 -H -F 97 00 00 1258 0 -1 -H -CH 3 1259 0 -1 -H -CF 3 J260 0 -1 -H -OCH 3 J261 0 I-H -OCH 2

CH

3 J262 0 -1 -H -OCF 3 J263 0 -1 -H -tert-butyl J264 0 -1 -H -iso-propyl J265 NH -Cl -Cl -H J266 NH -Cl -Br -H J267 NHl -Cl -F -H J268 NH -Cl -CH 3

-H

3269 NH4 -Cl -CF 3

-H

1270 NH -Cl -OCH 3

-H

J271 NH -Cl -OCH 2

CH

3

-H

1272 NH -Cl -OCF 3

-H

1273 NH -Cl -tert-butyl -H 1274 NH -Cl -iso-propyl -H 1275 NH -Cl -CH 3

-CH

3 J276 NH -Cl -H -H 1277 NH -Cl -H -CH 3 1278 NH -Cl -H -Cl J279 NH -Cl -H -Br 1280 NH -Cl -H -F 1281 NH -Cl -H -CF 3 1282 NH -Cl -H -OCH 3 1283 NH -Cl -H -OCH 2

CH

3 J284 NH -Cl -H -OCF 3 J285 NH -Cl -H -tert-butyl J286 NH -Cl -H -iso-propyl 1287 NH -CF! 3 -Cl -H 1288 NH -CH 3 -Br -H J289 NH -CF! 3 -F -H 1290 NH -CF! 3

-CH

3

-H

J291 NH -CF!1 3

-CF

3

-H

J292 NH -CF! 3

-OCH

3

-H

1293 NH -CF! 3

-OCH

2

CH

3

-H

1294 NH -CF! 3

-OCF

3

-H

J295 NH -CF! 3 -tert-butyl -H 1296 NH -CF! 3 -iso-propyl -H 1297 NH -CF! 3

-CH

3

-CH

3 J298 NH -CF! 3 -H -H 1299 NH -CF! 3 -H -Cl 1300 NH -CF! 3 -H -Br 1301 NH -CF! 3 -H -F 1302 NH -CF! 3 -H -CH 3 1303 NH -CF! 3 -H -CF 3 1304 NH -CF! 3 -H -OCH 3 1305 NH -CF! 3 -H -OCH 2

CH

3 98 00 00 J306 NH -CH 3 -H -OCF 3 J307 NH -CH 3 -H -tert-butyl J308 NH -CH 3 -H -iso-propyl 1309 NH -CF 3 -Cl -H J3 10 NH -CF 3 -Br -H J311 NH -CF 3 -F -H J312 NH -CF 3

-CH

3

-H

J313 NH -CF 3

-CF

3

-H

J314 NH -CF 3

-OCH

3

-H

J315 NH -CF 3

-OCH

2

CH

3

-H

J316 NH -CF 3

-OCF

3

-H

1317 NH -CF 3 -tert-butyl -H 1318 NH -CF 3 -iso-propyl -H J319 NH -CF 3

-CH

3

-CH

3 J320 NH -CF 3 -H -H J321 NH -CF 3 -H -Cl J322 NH -CF 3 -H -Br 1323 NH -CF 3 -H -F J324 NH -CF 3 -H -CH 3 J325 NH -CF 3 -H -CF 3 J326 NH -CF 3 -H -OCH 3 1327 NH -CF 3 -H -OCH 2

CH

3 J328 NH -CF 3 -H -OCF 3 J329 NH -CF 3 -H -tert-butyl J330 NH -CF 3 -H -iso-propyl J331 NH -CHF 2 -Cl -H J332 NH -CHF 2 -Br -H 1333 NH -CHF 2 -F -H J334 NH -CHF 2

-CH

3

-H

J335 NH -CHF 2

-CF

3

-H

J336 NH -CHF 2

-OCH

3

-H

1337 NH -CHF 2

-OCH

2 CHl 3

-H

J338 NH -CHF 2

-OCF

3

-H

1339 NH -CHF 2 -tert-butyl -H 1340 NH -CHF 2 -iso-propyl -H J341 NH -CHF 2

-CH

3

-CH

3 J342 NH -CLJF 2 -H -H J343 NH -CHF 2 -H -Cl 1344 NH -CHF 2 -H -Br J345 NH -CHF 2 -H -F 1346 NH -CHF 2 -H -CH 3 1347 NH -ClIP 2 -H -CF 3 1348 NH -CHF 2 -H -OCH 3 1349 NH -CLIP 2 -H -OCH 2

CH

3 J350 NH -CLIP 2 -H -OCF 3 J351 NH -ClIP 2 -H -tert-butyl J352 NH -CHF 2 -H -iso-propyl 1353 NH I-Br -Br -H 99- 00 00 J354 NH -Br -Cl -H J355 NH -Br -F -H J356 Nil -Br -CH 3

-H

J357 NH -Br -CF 3

-H

J358 NH -Br -OCH 3

-H

J359 NH -Br -OCH 2

CH

3

-H

J360 Nil -Br -OCF 3

-H

J361 NI- -Br -tert-butyl -H J362 NH -Br -iso-propyl -H J363 NH -Br -CH 3 -Gil 3 J364 NH -Br -H -H 3365 NH -Br -H -Cl J366 NH -Br -H -Br J367 NH -Br -H -F J368 NH -Br -H -CH 3 J369 NH -Br -H -CF 3 J370 NH -Br -H -OCH 3 3371 NH -Br -H -OCH 2

CH

3 J372 NH -Br -H -OCF 3 1373 NH -Br -H -tert-butyl J374 NH -Br -H -iso-propyl J375 NH -I -Cl -H J376 NH -1 -Br -H 1377 NH I -F -H J378 NH -I -CH 3

-H

1379 NH -1 -CF 3

-H

J380 NH -I -OCH 3

-H

J381 NH -1 -OCH 2

CH

3

-H

J382 NH -1 -OCF 3

-H

3383 NH -1 -tert-butyl -H J384 NH -I -iso-propyl -H J385 NH -1 -Gil 3

-CH

3 J386 NHl -I -HI -H J387 NH -I -H -Cl J388 NH -1 -H -Br J3 89 NH -1 -H -F 3390 NH -1 -H -Gil 3 J391 NH -1 -H -CF 3 J392 NH -1 -H -OCH 3 J393 NH -1 -H -OCH 2

CH

3 J394 NH -1 -H -OCF 3 J395 NH -1 -H -tert-butyl J396 NH -I -H -iso-propyl -100- 00 4.4 Det'mitions As used in connection with the Phenylene Compounds herein, the terms used herein having following meaning: 0 5 "-(CI-CI o)allcyl" means a straight chain or branched non-cyclic hydrocarbon having from 1 to 10 carbon atoms. Representative straight chain -(CI-CIO)alkyls include -methyl, -ethyl, -il-propyl, -n-butyl, -n-pentyl, -n-hexyl, -n-heptyl, -n-octyl, -n-nonyl, and N -n-decyl. Representative branched -(C 1

-C

1 0 )alkyls include -iso-propyl, -sec-butyl, N- -iso-butyl, -tert-butyl, -iso-pentyl, -neopentyl, 1 -methylbutyl, 2-methylbutyl, 00 0 10 3-methylbutyl, 1,1 -dimethyipropyl, 1 ,2-dimethylpropyl, 1 -methylpentyl, 2-methylpentyl, N- 3-methylpentyl, 4-methylpentyl, 1 -ethylbutyl, 2-ethylbutyl, 3-ethylbutyl, 1, 1-dimethylbutyl, 1 ,2-dimethylbutyl, I ,3-diinethylbutyl, 2,2-dimethylbutyl, 2,3-dimethylbutyl, 3 ,3-dimethylbutyl, 1 -methyihexyl, 2-methylhexyl, 3-methyihexyl, 4-methyihexyl, 5-methyihexyl, I ,2-dimethylpentyl, 1 ,3-dimethylpentyl, 1 ,2-dimethylhexyl, 1 ,3-dimethylhexyl, 3 ,3-dirnethylhexyl, 1 ,2-dimethylheptyl, 1,3-dixnethylheptyl, and 3,3-dimethyiheptyl.

"-(CI-C

6 )allcyl" means a straight chain or branched non-cyclic hydrocarbon having from 1 to 6 carbon atoms. Representative straight chain -(C 1

-C

6 )alkyls include -methyl, -ethyl, -n-propyl, -n-butyl, -n-pentyl, and -n-hexyl. Representative branched 1

-C

6 )alkyls include -iso-propyl, -sec-butyl, -iso-butyl, -tert-butyl, -iso-pentyl, -neopentyl, 1 -methylbutyl, 2-methylbutyl, 3-inethylbutyl, 1,1 -dimethylpropyl, I ,2-dimethylpropyl, 1 -methylpentyl, 2-methylpentyl, 3-methylpentyl, 4-methylpentyl, 1-ethylbutyl, 2-ethylbutyl, 3-ethylbutyl, 1,1 -diinethtylbutyl, 1 ,2-dimethylbutyl, I ,3-dimethylbutyl, 2,2-dimethylbutyl, 2,3-diinethylbutyl, and 3 ,3-dimethylbutyl.

1

-C

4 )alkyl" means a straight chain or branched non-cyclic hydrocarbon having from 1 to 4 carbon atoms. Representative straight chain -(CI-C 4 )alkyls include -methyl, -ethyl, -n-propyl, and -n-butyl. Representative branched -(C 1

-C

4 )alkyls include -iso-propyl, -sec-butyl, -iso-butyl, and -tert-butyl.

2 -C 1O)alkenyl" means a straight chain or branched non-cyclic hydrocarbon having from 2 to 10 carbon atoms and including at least one carbon-carbon double bond.

Representative straight chain and branched (C 2 -CIO)alkenyls include -vinyl, -allyl, -1 -butenyl, -2-butenyl, -iso-butylenyl, -1 -pentenyl, -2-pentenyl, -3-methyl- 1-butenyl, 101 00 -2-methyl-2-butenyl, -2,3-dimethyl-2-butenyl, -1-hexenyl, -2-hexenyl, -3-hexenyl, N -1-heptenyl, -2-heptenyl, -3-heptenyl, -1-octenyl, -2-octenyl, -3-octenyl, -1-nonenyl, -2-nonenyl, -3-nonenyl, -1-decenyl, -2-decenyl, -3-decenyl and the like.

"-(C2-C 6 )alkenyl" means a straight chain or branched non-cyclic hydrocarbon S 5 having from 2 to 6 carbon atoms and including at least one carbon-carbon double bond.

Representative straight chain and branched (C 2

-C

6 )alkenyls include -vinyl, -allyl, -1-butenyl, -2-butenyl, -iso-butylenyl, -1-pentenyl, -2-pentenyl, -3-methyl-1-butenyl, C -2-methyl-2-butenyl, -2,3-dimethyl-2-butenyl, -1-hexenyl, 2-hexenyl, 3-hexenyl and the Ng like.

00 2 -Clo)alkynyl" means a straight chain or branched non-cyclic hydrocarbon having from 2 to 10 carbon atoms and including at least one carbon-carbon triple bond.

Representative straight chain and branched -(C 2 -Clo)alkynyls include -acetylenyl, -propynyl, -1-butynyl, -2-butynyl, -1-pentynyl, -2-pentynyl, -3-methyl-i-butynyl, -4-pentynyl, -1-hexynyl, -2-hexynyl, -5-hexynyl, -1-heptynyl, -2-heptynyl, -6-heptynyl, -1-octynyl, -2-octynyl, -7-octynyl, -1-nonynyl, -2-nonynyl, -8-nonynyl, -1-decynyl, -2-decynyl, -9-decynyl and the like.

2

-C

6 )alkynyl" means a straight chain or branched non-cyclic hydrocarbon having from 2 to 6 carbon atoms and including at least one carbon-carbon triple bond.

Representative straight chain and branched (C 2

-C

6 )alkynyls include -acetylenyl, -propynyl, -1-butynyl, -2-butynyl, -1-pentynyl, -2-pentynyl, -3-methyl-i -butynyl, -4-pentynyl, -1-hexynyl, -2-hexynyl, -5-hexynyl and the like.

3 -Clo)cycloalkyl" means a saturated cyclic hydrocarbon having from 3 to carbon atoms. Representative (C 3 -Clo)cycloalkyls are -cyclopropyl, -cyclobutyl, -cyclopentyl, -cyclohexyl, -cycloheptyl, -cyclooctyl, -cyclononyl, and -cyclodecyl.

3 -Cs)cycloalkyl" means a saturated cyclic hydrocarbon having from 3 to 8 carbon atoms. Representative (C3-Cs)cycloalkyls include -cyclopropyl, -cyclobutyl, -cyclopentyl, -cyclohexyl, -cycloheptyl, and -cyclooctyl.

1 4 )bicycloalkyl" means a bi-cyclic hydrocarbon ring system having from 8 to 14 carbon atoms and at least one saturated cyclic alkyl ring. Representative -(Cs-

C

14 )bicycloalkyls include -indanyl, -1,2,3,4-tetrahydronaphthyl, -5,6,7,8-tetrahydronaphthyl, -perhydronaphthyl and the like.

-102- 00 4 )tricycloalkyl" means a tri-cyclic hydrocarbon ring system having from N 8 to 14 carbon atoms and at least one saturated cyclic alkyl ring. Representative -(C 8 C 14)tricycloalkyls include -pyrenyl, -1,2,3,4-tetrahydroanthracenyl, -perhydroanthracenyl -aceanthreneyl, -1,2,3,4-tetrahydropenanthrenyl, -5,6,7,8-tetrahydrophenanthrenyl, -perhydrophenanthrenyl and the like.

"-(Cs-Clo)cycloalkenyl" means a cyclic non-aromatic hydrocarbon having at least C- one carbon-carbon double bond in the cyclic system and from 5 to 10 carbon atoms.

ri Representative (Cs-Clo)cycloalkenyls include -cyclopentenyl, -cyclopentadienyl, NC -cyclohexenyl, -cyclohexadienyl,-cycloheptenyl, -cycloheptadienyl, -cycloheptatrienyl, 00 O 10 -cyclooctenyl, -cyclooctadienyl, -cyclooctatrienyl, -cyclooctatetraenyl, -cyclononenyl, Ci -cyclononadienyl, -cyclodecenyl, -cyclodecadienyl and the like.

"-(Cs-Cs)cycloalkenyl" means a cyclic non-aromatic hydrocarbon having at least one carbon-carbon double bond in the cyclic system and from 5 to 8 carbon atoms.

Representative (Cs-Cs)cycloalkenyls include -cyclopentenyl, -cyclopentadienyl, -cyclohexenyl, -cyclohexadienyl, -cycloheptenyl, -cycloheptadienyl, -cycloheptatrienyl, -cyclooctenyl, -cyclooctadienyl, -cyclooctatrienyl, -cyclooctatetraenyl and the like.

"-(Cs-C 1 4 )bicycloalkenyl" means a bi-cyclic hydrocarbon ring system having at least one carbon-carbon double bond in each ring and from 8 to 14 carbon atoms.

Representative -(C 8

-C

1 4)bicycloalkenyls include -indenyl, -pentalenyl, -naphthalenyl, -azulenyl, -heptalenyl, -1,2,7,8-tetrahydronaphthalenyl and the like.

"-(Cs-C 1 4 )tricycloalkenyl" means a tri-cyclic hydrocarbon ring system having at least one carbon-carbon double bond in each ring and from 8 to 14 carbon atoms.

Representative -(C 8 -C 1 4)tricycloalkenyls include -anthracenyl, -phenanthrenyl, -phenalenyl, -acenaphthalenyl, as-indacenyl, s-indacenyl and the like.

to 7-membered)heterocycle" or to 7-membered)heterocyclo" means a 3- to 7-membered monocyclic heterocyclic ring which is either saturated, unsaturated non-aromatic, or aromatic. A 3- or a 4-membered heterocycle can contain up to 3 heteroatoms, a 5-membered heterocycle can contain up to 4 heteroatoms, a 6-membered heterocycle can contain up to 6 heteroatoms, and a 7-membered heterocycle can contain up to 7 heteroatoms. Each heteroatom is independently selected from nitrogen, which can be quaternized; oxygen; and sulfur, including sulfoxide and sulfone. The to 7- -103- 00 membered)heterocycle can be attached via a nitrogen or carbon atom. Representative to 7-membered)heterocycles include pyridyl, furyl, thiophenyl, pyrrolyl, oxazolyl, imidazolyl, thiazolyl, thiadiazolyl, isoxazolyl, pyrazolyl, isothiazolyl, pyridazinyl, pyrimidinyl, triazinyl, morpholinyl, pyrrolidinonyl, pyrrolidinyl, piperidinyl, piperazinyl, hydantoinyl, valerolactamyl, oxiranyl, oxetanyl, tetrahydrofuranyl, tetrahydropyranyl, tetrahydropyrindinyl, tetrahydropyrimidinyl, tetrahydrothiophenyl, tetrahydrothiopyranyl and the like.

ri to 5-membered)heterocycle" or to 5-membered)heterocyclo" means a Ni 3- to 5-membered monocyclic heterocyclic ring which is either saturated, unsaturated 00 0 10 non-aromatic, or aromatic. A 3- or a 4-membered heterocycle can contain up to 3 (7 heteroatoms, and a 5-membered heterocycle can contain up to 4 heteroatoms. Each heteroatom is independently selected from nitrogen, which can be quaternized; oxygen; and sulfur, including sulfoxide and sulfone. The to 5-membered)heterocycle can be attached via a nitrogen or carbon atom. Representative to include furyl, thiophenyl, pyrrolyl, oxazolyl, imidazolyl, thiazolyl, isoxazolyl, pyrazolyl, isothiazolyl, triazinyl, pyrrolidinonyl, pyrrolidinyl, hydantoinyl, oxiranyl, oxetanyl, tetrahydrofuranyl, tetrahydrothiophenyl and the like.

to 10-membered)bicycloheterocycle" or to membered)bicycloheterocyclo" means a 7- to lO-membered bicyclic, heterocyclic ring which is either saturated, unsaturated non-aromatic, or aromatic. A to membered)bicycloheterocycle contains from 1 to 4 heteroatoms independently selected from nitrogen, which can be quaternized; oxygen; and sulfur, including sulfoxide and sulfone. The to 1-membered)bicycloheterocycle can be attached via a nitrogen or carbon atom. Representative to 1-membered)bicycloheterocycles include -quinolinyl, -isoquinolinyl, -chromonyl, -coumarinyl, -indolyl, -indolizinyl, -benzo[b]furanyl, -benzo[b]thiophenyl, -indazolyl, -purinyl, -41-quinolizinyl, -isoquinolyl, -quinolyl, -phthalazinyl, -naphthyridinyl, -carbazolyl, -p-carbolinyl and the like.

"-(C1 4 )aryl" means a 14-membered aromatic carbocyclic moiety such as -anthryl or -phenanthryl.

to 1 0-membered)heteroaryl" means an aromatic heterocycle ring of 5 to members, including both mono- and bicyclic ring systems, where at least one carbon -104- 0 atom of one or both of the rings is replaced with a heteroatom independently selected Sfrom nitrogen, oxygen, and sulfur. In one embodiment, one of the to membered)heteroaryl's rings contain at least one carbon atom. In another embodiment, both of the to 10-membered)heteroaryl's rings contain at least one carbon atom.

Representative to 10-membered)heteroaryls include pyridyl, furyl, benzofuranyl, thiophenyl, benzothiophenyl, quinolinyl, pyrrolyl, indolyl, oxazolyl, benzoxazolyl, Cc imidazolyl, benzimidazolyl, thiazolyl, benzothiazolyl, isoxazolyl, pyrazolyl, isothiazolyl, Spyridazinyl, pyrimidyl, pyrimidinyl, thiadiazolyl, triazinyl, cinnolinyl, phthalazinyl, and quinazolinyl.

00 0 10 "-CH 2 (halo)" means a methyl group where one of the hydrogens of the methyl C1 group has been replaced with a halogen. Representative -CH 2 (halo) groups include

-CH

2 F, -CH 2 C1, -CH 2 Br, and -CH 2

I.

"-CH(halo) 2 means a methyl group where two of the hydrogens of the methyl group have been replaced with a halogen. Representative -CH(halo) 2 groups include

-CHF

2 -CHC1 2 -CHBr 2 -CHBrCI, -CHCI, and -CHI 2 "-C(halo) 3 "means a methyl group where each of the hydrogens of the methyl group has been replaced with a halogen. Representative -C(halo) 3 groups include -CF 3 -CC13, -CBr 3 and -CI3.

"-Halogen" or "-halo" means -Cl, -Br, or -I.

The phrase "pyridyl group" means (R2)n R1 where R 1

R

2 and n are defined above for the Phenylene Compounds of formula (II).

The phrase "pyrazinyl group" means, (R2)p, ed above for the Phenylene Compounds of formula where Ri, R2, and p are defined above for the Phenylene Compounds of formula -105- 00 The phrase "pyrimidinyl group" means

R

,(R2)p where RI, R 2 and p are defined above for the Phenylene Compounds of formula ec¢ The phrase "pyridazinyl group" means C- (R2)p

R

oC where RI, R 2 and p are defined above for the Phenylene Compounds of formula The phrase "thiadiazolyl group" means

N-S

RIN

where Ri is defined above for the Phenylene Compounds of formula The phrase "benzoimidiazolyl group means

N'NH

b 1-'(R8)s, where R 8 and s are defined above for the Phenylene Compounds of formula or (II).

The phrase "benzothiazolyl group" means /1w(Ree)s, where R8 and s are defined above for the Phenylene Compounds of formula or (II).

-106- 00 The phrase "benzooxazolyl group" means 0 t7

S(R

8 )s, where R 8 and s are defined above for the Phenylene Compounds of formula or (II).

SThe phrase "phenylene ring" means 0 5 2 O -(R3)m 4 3 %f, where R 3 and m are defined above for the Phenylene Compounds of formula and the numbers designate the position of each atom of the phenylene ring.

The term "animal" includes, but is not limited to, a cow, monkey, baboon, chimpanzee, horse, sheep, pig, chicken, turkey, quail, cat, dog, mouse, rat, rabbit, guinea pig, and human.

The phrase "pharmaceutically acceptable salt," as used herein, is any pharmaceutically acceptable salt that can be prepared from a Phenylene Compound including a salt formed from an acid and a basic functional group, such as a nitrogen group, of one of the Phenylene Compounds. Illustrative salts include, but are not limited, to sulfate, citrate, acetate, oxalate, chloride, bromide, iodide, nitrate, bisulfate, phosphate, acid phosphate, isonicotinate, lactate, salicylate, acid citrate, tartrate, oleate, tannate, pantothenate, bitartrate, ascorbate, succinate, maleate, gentisinate, fumarate, gluconate, glucoronate, saccharate, formate, benzoate, glutamate, methanesulfonate, ethanesulfonate, benzenesulfonate, p-toluenesulfonate, and pamoate 1,1'-methylene-bis-(2-hydroxy-3-naphthoate)) salts. The term "pharmaceutically acceptable salt" also includes a salt prepared from a Phenylene Compound having an acidic functional group, such as a carboxylic acid functional group, and a pharmaceutically acceptable inorganic or organic base. Suitable bases include, but are not limited to, hydroxides of alkali metals such as sodium, potassium, and lithium; hydroxides of alkaline earth metal such as calcium and magnesium; hydroxides of other -107metals, such as aluminum and zinc; ammonia and organic amines, such as unsubstituted or hydroxy-substituted mono-, di-, or trialkylamines; dicyclohexylamine; tributyl amine; pyridine; N-methyl,N-ethylamine; diethylamine; triethylamine; mono-, bis-, or Stris-(2-hydroxy-lower alkyl amines), such as mono-, bis-, or tris-(2-hydroxyethyl)amine, S 5 2-hydroxy-tert-butylamine, or tris-(hydroxymethyl)methylamine, N,N-di-lower alkyl-N-(hydroxy lower alkyl)-amines, such as N,N-dimethyl-N-(2-hydroxyethyl)amine, Sor tri-(2-hydroxyethyl)amine; N-methyl-D-glucamine; and amino acids such as arginine, 0 lysine and the like.

C The phrase "effective amount," when used in connection with a Phenylene 00 O 10 Compound means an amount effective for: treating or preventing a Condition; or (b) C- inhibiting VR1, mGluR1, or mGluR5 function in a cell.

The phrase "effective amount," when used in connection with another therapeutic agent means an amount for providing the therapeutic effect of the therapeutic agent.

When a first group is "substituted with one or more" second groups, one or more hydrogen atoms of the first group is replaced with a corresponding number of second groups. When the number of second groups is two or greater, each second group can be the same or different. In one embodiment, the number of second groups is one or two.

In another embodiment, the number of second groups is one.

The term "EtOAc" means ethyl acetate.

The term "THP' means tetrahydrofuran.

The term "DMF" means dimethylformamide.

The term "HOBT" means 1-hydroxybenzotriazole hydrate.

The term "EDCI" means 1-ethyl- 3 -[3-(dimethylamino)propyl]carbodiimide.

The term "IBD" means inflammatory-bowel disease.

The term "IBS" means irritable-bowel syndrome.

The term "ALS" means amyotrophic lateral sclerosis.

The phrases "treatment of," "treating" and the like include the amelioration or cessation of a Condition or a symptom thereof.

-108- 00 0 In one embodiment, treating includes inhibiting, for example, decreasing the N overall frequency of episodes of a Condition or a symptom thereof.

ct The phrases "prevention of," "preventing" and the like include the avoidance of the onset of a Condition or a symptom thereof.

l^- 0 c 4.5 Methods for Making the Phenylene Compounds SThe Phenylene Compounds can be made using conventional organic synthesis Sincluding the following illustrative methods shown in the schemes below.

00 0 4.5.1 Methods for Making the Phenylene Compounds where X is 0 The Phenylene Compounds where X is 0 can be obtained by the following illustrative method shown below in Scheme 1.

-109- Scheme 1 N. (R36m O OH

HOBT

EDGI

DMF

Ar 2

-NH

2

IN

N (R36m o NH Ar 2

(R

2 2 Rl-I N nBr

THE

Pd(PPh 3 4

(R

2 )n

N

O NH Ar 2

(R

2 )p 2 R. -N ZnBr 3b

(R

2 )p N 2 R

N

ZnBr 3c

THE

Pd(PPh 3 4

THE

Pd(PPh 3 4 N f(R3)m O NH

(R

2 )pxN.

O NH Ar 2 110- 00 .nl N i (R2) TRHF

N

2 SR1L Pd(PPh 3 4

(R)

m 3d 0 NH

ST

H

F

2

R

R

SnBr Pd(PPh 3 4 00 ZnBr (R)m 3e (M O NH Ar2 where Ar 2 RI, R 2

R

3 m, n and p are defined above and Y is a halogen.

To a solution of a 4-halobenzoic acid 1 in DMF (0.22 M) is added 1 equivalent of amine Ar 2

-NH

2 and the resulting solution is allowed to stir for about 5 min at a temperature of about 25 0 C. To the resulting solution is then added 1 equivalent of HOBT and 1 eq. of EDCI, and the resulting mixture is allowed to stir for about 6 h at a temperature of about 25 0 C. Typically, a solid forms during stirring and the reaction mixture is filtered to remove the resultant solid. If a solid does not form the reaction mixture is diluted with 2N aq. sodium hydroxide and extracted between 2 and 3 times with EtOAc, the organic layers are combined, dried (with NazSO 4 and the solvent removed under reduced pressure to provide a residue. The residue is then washed with methanol and dried under reduced pressure. The solid or residue is then suspended in THF (0.04 moles/liter) under an argon atmosphere and about 3 equivalent of zinc bromide 3a-e and about 0.05 equivalent of Pd(PPh 3 4 are added to the suspension. The suspension is allowed to stir for about 2 h at a temperature of about 70°C. The solvent is then removed under reduced pressure to provide a solid that is purified using a silica gel column eluted with an ethyl acetate/hexane gradient to provide the Phenylene Compound where X is O.

If the compound of formula 2 is substituted with a hydroxyl or amino group, the hydroxyl or amino group is protected using a suitable protecting group before being reacted with zinc bromide 3a-e. Similarly, if R 2 is a hydroxyl or amino group, the 111 00 hydroxyl or amino group is protected before forming the zinc bromide reagent. Suitable O protecting groups for hydroxyl group include, but are not limited to, methyl ether, methoxymethyl ether, methoxythiomethyl ether, 2-methoxyethoxymethyl ether, Sbis(2-chloroethoxy)ethyl ether, tetrahydropyranyl ether, tetrahydrothiopyranyl ether, >r 5 4-methoxytetrahydropyranyl ether, methoxytetrahydrothiopyranyl ether, tetrahydrofuranyl ether, tetrahydrothiofuranyl ether, 1-ethoxyethyl ether, 1-methyl-1-methoxyethyl ether, 2-(phenylselenyl ether), tert-butyl ether, allyl ether, Sbenzyl ether, o-nitrobenzyl ether, triphenylmethyl ether, o-napthyldiphenylmethyl ether, p-methoxydiphenylmethyl ether, 9-(9-phenyl-10-oxo)anthryl ether (tritylone), 0o 10 trimethylsilyl ether, iso-propyldimethylsilyl ether, tert-butyldimethylsilyl ether, Stert-butyldiphenylsilyl ether, tribenzylsilyl ether, tri-iso-propylsilyl ether, formate ester, acetate ester, trichloroacetate ester, phenoxyacetate ester, iso-butyrate ester, pivaloate ester, adamantoate ester, benzoate ester, 2,4,6-trimethyl (mesitoate) ester, methyl carbonate, 2,2,2-trichlorocarbonate, allyl carbonate, p-nitrophenyl carbonate, benzyl carbonate, p-nitrobenzyl carbonate, S-benzylthiocarbonate, N-phenylcarbamate, nitrate ester, and 2,4-dinitrophenylsulfenate ester (See, T.W. Greene, Protective Groups in Organic Synthesis, John Wiley-Interscience Publication, New York, (1981)). Suitable protecting groups for an amino group include, but are not limited to, 1,1-dimethyl- 2,2,2-trichloroethyl carbamate, 1-methyl-l-(4-biphenylyl)ethyl carbamate, 2-trimethylsilylethyl carbamate, and tert-butyl carbamate Greene et al., Protective Groups in Organic Synthesis, 309-405 (2d ed. 1991)).

The 4-halobenzoic acids 1 and the amines of formula Ar 2 NH2 are commercially available or can be prepared by methods known to those skilled in the art. Compounds of formula 3a-e can be prepared by methods known to those skilled in the art (See, M.B.

Smith and J. March, March's Advanced Organic Chemistry: Reaction Mechanisms and Structure, 805-807 (5 h ed. 2001); H. Fillon et al., Tett. Lett. 42:3843-46 (2001); M.

Amadji et al., Tettrahedron 9:1657-60 (1998); and S. Billotte, Synlett. 379-380 (1998)).

4.5.2 Methods for Making the Phenylene Compounds where X is S The Phenylene Compounds where X is S can be obtained by reacting a Phenylene Compound where X is O, prepared as described above in section 4.5.1, with Lawesson's reagent at a temperature of about 100°C. (See, M.B. Smith and J. March, March's -112- 00 Advanced Organic Chemistry: Reaction Mechanisms and Structure, 1184-1185 5 h ed.

S2001)).

4.6 Therapeutic Uses of the Phenylene Compounds In accordance with the invention, the Phenylene Compounds are administered to an animal in need of treatment or prevention of a Condition.

O In one embodiment, an effective amount of a Phenylene Compound can be used Sto treat or prevent any condition treatable or preventable by inhibiting VR1. Examples 00 of conditions that are treatable or preventable by inhibiting VR1 include, but are not 0 10 limited to, pain, UI, an ulcer, IBD, and IBS.

In another embodiment, an effective amount of a Phenylene Compound can be used to treat or prevent any condition treatable or preventable by inhibiting Examples of conditions that are treatable or preventable by inhibiting mGluR5 include, but are not limited to, pain, an addictive disorder, Parkinson's disease, parkinsonism, anxiety, a pruritic condition, and psychosis.

In another embodiment, an effective amount of a Phenylene Compound can be used to treat or prevent any condition treatable or preventable by inhibiting mGluR1.

Examples of conditions that are treatable or preventable by inhibiting mGluRl include, but are not limited to, pain, UI, an addictive disorder, Parkinson's disease, parkinsonism, anxiety, epilepsy, stroke, a seizure, a pruritic condition, psychosis, a cognitive disorder, a memory deficit, restricted brain function, Huntington's chorea, ALS, dementia, retinopathy, a muscle spasm, a migraine, vomiting, dyskinesia, and depression.

The Phenylene Compounds can be used to treat or prevent acute or chronic pain.

Examples of pain treatable or preventable using the Phenylene Compounds include, but are not limited to, cancer pain, labor pain, myocardial infarction pain, pancreatic pain, colic pain, post-operative pain, headache pain, muscle pain, arthritic pain, and pain associated with a periodontal disease, including gingivitis and periodontitis.

The Phenylene Compounds can also be used for treating or preventing pain associated with inflammation or with an inflammatory disease in an animal. Such pain can arise where there is an inflammation of the body tissue which can be a local inflammatory response and/or a systemic inflammation. For example, the Phenylene 113- 00 0 Compounds can be used to treat or prevent pain associated with inflammatory diseases 0 c-1 including, but not limited to: organ transplant rejection; reoxygenation injury resulting Sfrom organ transplantation (see Grupp et al., J. Mol, Cell Cardiol. 31:297-303 (1999)) including, but not limited to, transplantation of the heart, lung, liver, or kidney; chronic inflammatory diseases of the joints, including arthritis, rheumatoid arthritis, osteoarthritis and bone diseases associated with increased bone resorption; inflammatory bowel c diseases, such as ileitis, ulcerative colitis, Barrett's syndrome, and Crohn's disease; inflammatory lung diseases, such as asthma, adult respiratory distress syndrome, and chronic obstructive airway disease; inflammatory diseases of the eye, including corneal 00 dystrophy, trachoma, onchocerciasis, uveitis, sympathetic ophthalmitis and Sendophthalmitis; chronic inflammatory disease of the gum, including gingivitis and periodontitis; tuberculosis; leprosy; inflammatory diseases of the kidney, including uremic complications, glomerulonephritis and nephrosis; inflammatory disease of the skin, including sclerodermatitis, psoriasis and eczema; inflammatory diseases of the central nervous system, including chronic demyelinating diseases of the nervous system, multiple sclerosis, AIDS-related neurodegeneration and Alzheimer 's disease, infectious meningitis, encephalomyelitis, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis and viral or autoimmune encephalitis; autoimmune diseases, including Type I and Type II diabetes mellitus; diabetic complications, including, but not limited to, diabetic cataract, glaucoma, retinopathy, nephropathy (such as microaluminuria and progressive diabetic nephropathy), polyneuropathy, mononeuropathies, autonomic neuropathy, gangrene of the feet, atherosclerotic coronary arterial disease, peripheral arterial disease, nonketotic hyperglycemic-hyperosmolar coma, foot ulcers, joint problems, and a skin or mucous membrane complication (such as an infection, a shin spot, a candidal infection or necrobiosis lipoidica diabeticorum); immune-complex vasculitis, and systemic lupus erythematosus (SLE); inflammatory disease of the heart, such as cardiomyopathy, ischemic heart disease hypercholesterolemia, and artherosclerosis; as well as various other diseases that can have significant inflammatory components, including preeclampsia, chronic liver failure, brain and spinal cord trauma, and cancer. The Phenylene Compounds can also be used for treating or preventing pain associated with inflammatory disease that can, for example, be a systemic inflammation of the body, exemplified by gram-positive or gram negative shock, hemorrhagic or anaphylactic shock, or shock induced by cancer chemotherapy in response to pro- -114- 0 inflammatory cytokines, shock associated with pro-inflammatory cytokines. Such shock can be induced, by a chemotherapeutic agent that is administered as a treatment for cancer.

The Phenylene Compounds can be used to treat or prevent UI. Examples of UI 1treatable or preventable using the Phenylene Compounds include, but are not limited to, urge incontinence, stress incontinence, overflow incontinence, neurogenic incontinence, Sand total incontinence.

C

The Phenylene Compounds can be used to treat or prevent an ulcer. Examples of Sulcers treatable or preventable using the Phenylene Compounds include, but are not limited to, a duodenal ulcer, a gastric ulcer, a marginal ulcer, an esophageal ulcer, and a C stress ulcer.

The Phenylene Compounds can be used to treat or prevent IBD, including Crohn's disease and ulcerative colitis.

The Phenylene Compounds can be used to treat or prevent IBS. Examples of IBS treatable or preventable using the Phenylene Compounds include, but are not limited to, spastic-colon-type IBS and constipation-predominant IBS.

The Phenylene Compounds can be used to treat or prevent an addictive disorder, including but not limited to, an eating disorder, an impulse-control disorder, an alcoholrelated disorder, a nicotine-related disorder, an amphetamine-related disorder, a cannabis-related disorder, a cocaine-related disorder, an hallucinogen-related disorder, an inhalant-related disorders, and an opioid-related disorder, all of which are further subclassified as listed below.

Eating disorders include, but are not limited to, Bulimia Nervosa, Nonpurging Type; Bulimia Nervosa, Purging Type; Anorexia; and Eating Disorder not otherwise specified (NOS).

Impulse control disorders include, but are not limited to, Intermittent Explosive Disorder, Kleptomania, Pyromania, Pathological Gambling, Trichotillomania, and Impulse Control Disorder not otherwise specified (NOS).

Alcohol-related disorders include, but are not limited to, Alcohol-Induced Psychotic Disorder with delusions, Alcohol Abuse, Alcohol Intoxication, Alcohol -115- 0C) Withdrawal, Alcohol Intoxication Delirium, Alcohol Withdrawal Delirium, Alcohol-Induced Persisting Dementia, Alcohol-Induced Persisting Amnestic Disorder, Alcohol Dependence, Alcohol-Induced Psychotic Disorder with hallucinations, Alcohol-Induced Mood Disorder, Alcohol-induced Anxiety Disorder, Alcohol-Induced 5 Sexual Dysfunction, Alcohol-Induced Sleep Disorder, and Alcohol-Related Disorder not otherwise specified (NOS).

Nicotine-related disorders include, but are not limited to, Nicotine Dependence, Nicotine Withdrawal, and Nicotine-Related Disorder not otherwise specified (NOS).

OC) Amphetamine-related disorders include, but are not limited to, Amphetamine Dependence, Amphetamine Abuse, Amphetamine Intoxication, Amphetamine Withdrawal, Amphetamine Intoxication Delirium, Amphetamine-Induced Psychotic Disorder with delusions, Amfphetamine-Induced Psychotic Disorders with hallucinations, Amphetamine-Induced Mood Disorder, Amphetamine-Induced Anxiety Disorder, Amphetamine-Induced Sexual Dysfunction, Amphetamine-Induced Sleep Disorder, and Amphetamine Related Disorder not otherwise specified (NOS).

Cannabis-related disorders include, but are not limited to, Cannabis Dependence, Cannabis Abuse, Cannabis Intoxication, Cannabis Intoxication Delirium, Cannabis -Induced Psychotic Disorder with delusions, Cannabis-Induced Psychotic Disorder with hallucinations, Cannabis- Induced Anxiety Disorder, and Cannabis Related Disorder not otherwise specified (NOS).

Cocaine-related disorders include, but are not limited to, Cocaine Dependence, Cocaine Abuse, Cocaine Intoxication, Cocaine Withdrawal, Cocaine Intoxication Delirium, Cocaine-Induced Psychotic Disorder with delusions, Cocaine-Induced Psychotic Disorders with hallucinations, Cocaine-Induced Mood Disorder, Cocaine-Induced Anxiety Disorder, Cocaine-Induced Sexual Dysfunction, Cocaine-Induced Sleep Disorder, and Cocaine Related Disorder not otherwise specified

(NOS).

Hallucinogen-related disorders include, but are not limited to, Hallucinogen Dependence, Hallucinogen Abuse, Hallucinogen Intoxication, Hallucinogen Withdrawal, Hallucinogen Intoxication Delirium, Hallucinogen Persisting Perception Disorder (Flashbacks), Hallucinogen-Induced Psychotic Disorder with delusions, 116- SHallucinogen-Induced Psychotic Disorders with hallucinations, Hallucinogen-Induced SMood Disorder, Hallucinogen-Induced Anxiety Disorder, Hallucinogen-Induced Sexual Dysfunction, Hallucinogen-Induced Sleep Disorder, and Hallucinogen Related Disorder not otherwise specified (NOS).

0 5 Inhalant-related disorders include, but are not limited to, Inhalant Dependence, Inhalant Abuse, Inhalant Intoxication, Inhalant Intoxication Delirium, Inhalant-Induced C, Psychotic Disorder with delusions, Inhalant-Induced Psychotic Disorder with C, hallucinations, Inhalant-Induced Anxiety Disorder, and Inhalant Related Disorder not otherwise specified (NOS).

00 Opioid-related disorders include, but are not limited to, Opioid Dependence, Opioid Abuse, Opioid Withdrawal, Opioid Intoxication, Opioid Intoxication Delirium, Opioid-Induced Psychotic Disorder with delusions, Opioid-Induced Psychotic Disorder with hallucinations, Opioid-Induced Anxiety Disorder, and Opioid Related Disorder not otherwise specified (NOS).

The Phenylene Compounds can be used to treat or prevent Parkinson's disease and parkinsonism and the symptoms associated with Parkinson's disease and parkinsonism, including but not limited to, bradykinesia, muscular rigidity, resting tremor, and impairment of postural balance.

The Phenylene Compounds can be used to treat or prevent generalized anxiety or severe anxiety and the symptoms associated with anxiety, including but not limited to, restlessness; tension; tachycardia; dyspnea; depression, including chronic "neurotic" depression; panic disorder; agoraphobia and other specific phobias; eating disorders; and personality disorders.

The Phenylene Compounds can be used to treat or prevent epilepsy, including but not limited to, partial epilepsy, generalized epilepsy, and the symptoms associated with epilepsy, including but not limited to, simple partial seizures, jacksonian seizures, complex partial (psychomotor) seizures, convulsive seizures (grand mal or tonic-clonic seizures), petit mal (absence) seizures, and status epilepticus.

The Phenylene Compounds can be used to treat or prevent strokes, including but not limited to, ischemic strokes and hemorrhagic strokes.

117- 0 The Phenylene Compounds can be used to treat or prevent a seizure, including but not limited to, infantile spasms, febrile seizures, and epileptic seizures.

SThe Phenylene Compounds can be used to treat or prevent a pruritic condition, including but not limited to, pruritus caused by dry skin, scabies, dermatitis, herpetiformis, atopic dermatitis, pruritus vulvae et ani, miliaria, insect bites, pediculosis, contact dermatitis, drug reactions, urticaria, urticarial eruptions of pregnancy, psoriasis, lichen planus, lichen simplex chronicus, exfoliative dermatitis, folliculitis, bullous C pemphigoid, or fiberglass dermatitis.

00 The Phenylene Compounds can be used to treat or prevent psychosis, including but not limited to, schizophrenia, including paranoid schizophrenia, hebephrenic or disorganized schizophrenia, catatonic schizophrenia, undifferentiated schizophrenia, negative or deficit subtype schizophrenia, and non-deficit schizophrenia; a delusional disorder, including erotomanic subtype delusional disorder, grandiose subtype delusional disorder, jealous subtype delusional disorder, persecutory subtype delusional disorder, and somatic subtype delusional disorder; and brief psychosis.

The Phenylene Compounds can be used to treat or prevent a cognitive disorder, including but not limited to, delirium and dementia such as multi-infarct dementia, dementia pugilistica, dementia caused by AIDS, and dementia caused by Alzheimer's disease.

The Phenylene Compounds can be used to treat or prevent a memory deficiency, including but not limited to, dissociative amnesia and dissociative fugue.

The Phenylene Compounds can be used to treat or prevent restricted brain function, including but not limited to, that caused by surgery or an organ transplant, restricted blood supply to the brain, a spinal cord injury, a head injury, hypoxia, cardiac arrest, or hypoglycemia.

The Phenylene Compounds can be used to treat or prevent Huntington's chorea.

The Phenylene Compounds can be used to treat or prevent ALS.

The Phenylene Compounds can be used to treat or prevent retinopathy, including but not limited to, arteriosclerotic retinopathy, diabetic arteriosclerotic retinopathy, hypertensive retinopathy, non-proliferative retinopathy, and proliferative retinopathy.

-118- 00 The Phenylene Compounds can be used to treat or prevent a muscle spasm.

O

C1 The Phenylene Compounds can be used to treat or prevent a migraine including, c but not limited to, migraine without aura ("common migraine"), migraine with aura ("classic migraine"), migraine without headache, basilar migraine, familial hemiplegic C 5 migraine, migrainous infarction, and migraine with prolonged aura.

The Phenylene Compounds can be used to treat or prevent vomiting, including N but not limited to, nausea vomiting, dry vomiting (retching), and regurgitation.

0The Phenylene Compounds can be used to treat or prevent dyskinesia, including 00 but not limited to, tardive dyskinesia and biliary dyskinesia.

The Phenylene Compounds can be used to treat or prevent depression, including but not limited to, major depression and bipolar disorder.

Applicants believe that the Phenylene Compounds are antagonists for VR1.

The invention also relates to methods for inhibiting VR1 function in a cell comprising contacting a cell capable of expressing VR1 with an amount of a Phenylene Compound effective to inhibit VR1 function in the cell. This method can be used in vitro, for example, as an assay to select cells that express VR1 and, accordingly, are useful as part of an assay to select compounds useful for treating or preventing pain, UI, an ulcer, IBD, or IBS. The method is also useful for inhibiting VR1 function in a cell in vivo, in an animal a human), by contacting a cell in an animal with an effective amount of a Phenylene Compound. In one embodiment, the method is useful for treating or preventing pain in an animal in need thereof. In another embodiment, the method is useful for treating or preventing UI in an animal in need thereof. In another embodiment, the method is useful for treating or preventing an ulcer in an animal in need thereof. In another embodiment, the method is useful for treating or preventing IBD in an animal in need thereof. In another embodiment, the method is useful for treating or preventing IBS in an animal in need thereof.

Examples of tissue comprising cells capable of expressing VR1 include, but are not limited to, neuronal, brain, kidney, urothelium, and bladder tissue. Methods for assaying cells that express VR1 are known in the art.

Applicants believe that the Phenylene Compounds are antagonists for -119- The invention further relates to methods for inhibiting mGluR5 function in a cell comprising contacting a cell capable of expressing mGluR5 with an amount of a Phenylene Compound effective to inhibit mGluR5 function in the cell. This method can Sbe used in vitro, for example, as an assay to select cells that express mGluR5 and, S 5 accordingly, are useful as part of an assay to select compounds useful for treating or preventing pain, an addictive disorder, Parkinson's disease, parkinsonism, anxiety, a CM pruritic condition, or psychosis. The method is also useful for inhibiting 0 function in a cell in vivo, in an animal a human), by contacting a cell in an animal O with an amount of a Phenylene Compound effective to inhibit mGluR5 function in the 00 10 cell. In one embodiment, the method is useful for treating or preventing pain in an O animal in need thereof. In another embodiment, the method is useful for treating or preventing an addictive disorder in an animal in need thereof. In another embodiment, the method is useful for treating or preventing Parkinson's disease in an animal in need thereof. In another embodiment, the method is useful for treating or preventing parkinsonism in an animal in need thereof. In another embodiment, the method is useful for treating or preventing anxiety in an animal in need thereof. In another embodiment, the method is useful for treating or preventing a pruritic condition in an animal in need thereof. In another embodiment, the method is useful for treating or preventing psychosis in an animal in need thereof.

Examples of cells capable of expressing mGluR5 are neuronal and glial cells of the central nervous system, particularly the brain, especially in the nucleus accumbens.

Methods for assaying cells that express mGluR5 are known in the art.

Applicants believe that the Phenylene Compounds are antagonists for mGluR1.

The invention also relates to methods for inhibiting mGluR1 function in a cell comprising contacting a cell capable of expressing mGluR1 with an amount of a Phenylene Compound effective to inhibit mGluR1 function in the cell. This method can be used in vitro, for example, as an assay to select cells that express mGluR1 and, accordingly, are useful as part of an assay to select compounds useful for treating or preventing pain, UI, an addictive disorder, Parkinson's disease, parkinsonism, anxiety, epilepsy, stroke, a seizure, a pruritic condition, psychosis, a cognitive disorder, a memory deficit, restricted brain function, Huntington's chorea, ALS, dementia, retinopathy, a muscle spasm, a migraine, vomiting, dyskinesia, or depression. The -120- 00 method is also useful for inhibiting mGluR1 function in a cell in vivo, in an animal 0 0 a human), by contacting a cell in an animal with an effective amount of a Phenylene Compound. In one embodiment, the method is useful for treating or preventing pain in San animal in need thereof. In another embodiment, the method is useful for treating or 5 preventing UI in an animal in need thereof. In another embodiment, the method is useful for treating or preventing an addictive disorder in an animal in need thereof. In another Cc embodiment, the method is useful for treating or preventing Parkinson's disease in an animal in need thereof. In another embodiment, the method is useful for treating or preventing parkinsonism in an animal in need thereof. In another embodiment, the 00 10 method is useful for treating or preventing anxiety in an animal in need thereof. In O another embodiment, the method is useful for treating or preventing epilepsy in an animal in need thereof. In another embodiment, the method is useful for treating or preventing stroke in an animal in need thereof. In another embodiment, the method is useful for treating or preventing a seizure in an animal in need thereof. In another embodiment, the method is useful for treating or preventing a pruritic condition in an animal in need thereof. In another embodiment, the method is useful for treating or preventing psychosis in an animal in need thereof. In another embodiment, the method is useful for treating or preventing a cognitive disorder in an animal in need thereof. In another embodiment, the method is useful for treating or preventing a memory deficit in an animal in need thereof. In another embodiment, the method is useful for treating or preventing restricted brain function in an animal in need thereof. In another embodiment, the method is useful for treating or preventing Huntington's chorea in an animal in need thereof. In another embodiment, the method is useful for treating or preventing ALS in an animal in need thereof. In another embodiment, the method is useful for treating or preventing dementia in an animal in need thereof. In another embodiment, the method is useful for treating or preventing retinopathy in an animal in need thereof. In another embodiment, the method is useful for treating or preventing a muscle spasm in an animal in need thereof. In another embodiment, the method is useful for treating or preventing a migraine in an animal in need thereof. In another embodiment, the method is useful for treating or preventing vomiting in an animal in need thereof. In another embodiment, the method is useful for treating or preventing dyskinesia in an animal in need thereof. In another embodiment, the method is useful for treating or preventing depression in an animal in need thereof.

-121- 00 Examples of cells capable of expressing mGluR1 include, but are not limited to, Scerebellar Purkinje neuron cells, Purkinje cell bodies (punctate), cells of spine(s) of the cerebellum; neurons and neurophil cells of olfactory-bulb glomeruli; cells of the Ssuperficial layer of the cerebral cortex; hippocampus cells; thalamus cells; superior S 5 colliculus cells; and spinal trigeminal nucleus cells. Methods for assaying cells that express mGluR1 are known in the art.

S4.7 Therapeutic/Prophylactic Administration and SCompositions of the Invention Due to their activity, the Phenylene Compounds are advantageously useful in Sveterinary and human medicine. As described above, the Phenylene Compounds are useful for treating or preventing a Condition in an animal in need thereof.

When administered to an animal, the Phenylene Compounds can be administered as a component of a composition that comprises a pharmaceutically acceptable carrier or excipient. The present compositions, which comprise a Phenylene Compound, can be administered orally. The Phenylene Compounds of the invention can also be administered by any other convenient route, for example, by infusion or bolus injection, by absorption through epithelial or mucocutaneous linings oral, rectal, and intestinal mucosa, etc.) and can be administered together with another therapeutically active agent. Administration can be systemic or local. Various delivery systems are known, encapsulation in liposomes, microparticles, microcapsules, capsules, etc., and can be used to administer the Phenylene Compound.

Methods of administration include, but are not limited to, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, oral, sublingual, intracerebral, intravaginal, transdermal, rectal, by inhalation, or topical, particularly to the ears, nose, eyes, or skin. The mode of administration is left to the discretion of the practitioner. In most instances, administration will result in the release of the Phenylene Compounds into the bloodstream.

In specific embodiments, it can be desirable to administer the Phenylene Compounds locally. This can be achieved, for example, and not by way of limitation, by local infusion during surgery, topical application, in conjunction with a wound dressing after surgery, by injection, by means of a catheter, by means of a suppository or -122- 00 0 enema, or by means of an implant, said implant being of a porous, non-porous, or 0 N gelatinous material, including membranes, such as sialastic membranes, or fibers.

SIn certain embodiments, it can be desirable to introduce the Phenylene Compounds into the central nervous system or gastrointestinal tract by any suitable O 5 route, including intraventricular, intrathecal, and epidural injection, and enema.

Intraventricular injection can be facilitated by an intraventricular catheter, for example, N attached to a reservoir, such as an Ommaya reservoir.

SPulmonary administration can also be employed, by use of an inhaler or 00 nebulizer, and formulation with an aerosolizing agent, or via perfusion in a fluorocarbon 0 10 or synthetic pulmonary surfactant. In certain embodiments, the Phenylene Compounds can be formulated as a suppository, with traditional binders and excipients such as triglycerides.

In another embodiment, the Phenylene Compounds can be delivered in a vesicle, in particular a liposome (see Langer, Science 249:1527-1533 (1990); and Treat et al., Liposomes in the Therapy of Infectious Disease and Cancer 317-327 and 353-365 (1989)).

In yet another embodiment, the Phenylene Compounds can be delivered in a controlled-release system or sustained-release system (see, Goodson, in Medical Applications of Controlled Release, supra, vol. 2, pp. 115-138 (1984)). Other controlledor sustained-release systems discussed in the review by Langer, Science 249:1527-1533 (1990) can be used. In one embodiment, a pump can be used (Langer, Science 249:1527-1533 (1990); Sefton, CRC Crit. Ref Biomed. Eng. 14:201 (1987); Buchwald et al., Surgery 88:507 (1980); and Saudek et al., N. Engl. J. Med. 321:574 (1989)). In another embodiment, polymeric materials can be used (see Medical Applications of Controlled Release (Langer and Wise eds., 1974); Controlled Drug Bioavailability, Drug Product Design and Performance (Smolen and Ball eds., 1984); Ranger and Peppas, J.

Macromol. Sci. Rev. Macromol. Chem. 23:61 (1983); Levy et al., Science 228:190 (1985); During et al., Ann. Neurol. 25:351 (1989); and Howard et al., J. Neurosurg.

71:105 (1989)). In yet another embodiment, a controlled- or sustained-release system can be placed in proximity of a target of the Phenylene Compounds, the spinal column, brain, or gastrointestinal tract, thus requiring only a fraction of the systemic dose.

-123- 00 0 The present compositions can optionally comprise a suitable amount of a N, pharmaceutically acceptable excipient so as to provide the form for proper administration to the animal. Such a pharmaceutical excipient can be a liquid, such as water or an oil, Sincluding those of petroleum, animal, vegetable, or synthetic origin, such as peanut oil, S 5 soybean oil, mineral oil, sesame oil and the like. The pharmaceutical excipient can be saline, gum acacia, gelatin, starch paste, talc, keratin, colloidal silica, urea and the like.

In addition, auxiliary, stabilizing, thickening, lubricating, and coloring agents can be Sused. In one embodiment, the pharmaceutically acceptable excipient is sterile when Sadministered to an animal. Water is a particularly useful excipient when the Phenylene 00 10 Compound is administered intravenously. Saline solutions and aqueous dextrose and Sglycerol solutions can also be employed as liquid excipients, particularly for injectable solutions. Suitable pharmaceutical excipients also include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol and the like. The present compositions, if desired, can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents.

The present compositions can take the form of solutions, suspensions, emulsions, tablets, pills, pellets, capsules, capsules containing liquids, powders, sustained-release formulations, suppositories, emulsions, aerosols, sprays, suspensions, or any other form suitable for use. In one embodiment, the composition is in the form of a capsule (see, U.S. Patent No. 5,698,155). Other examples of suitable pharmaceutical excipients are described in Remington's Pharmaceutical Sciences 1447-1676 (Alfonso R. Gennaro ed., 19th ed. 1995), incorporated herein by reference.

In one embodiment, the Phenylene Compounds are formulated in accordance with routine procedures as a composition adapted for oral administration to human beings. Compositions for oral delivery can be in the form of tablets, lozenges, aqueous or oily suspensions, granules, powders, emulsions, capsules, syrups, or elixirs, for example. Orally administered compositions can contain one or more agents, for example, sweetening agents such as fructose, aspartame or saccharin; flavoring agents such as peppermint, oil of wintergreen, or cherry; coloring agents; and preserving agents, to provide a pharmaceutically palatable preparation. Moreover, where in tablet or pill form, the compositions can be coated to delay disintegration and absorption in the -124- 00 0 gastrointestinal tract thereby providing a sustained action over an extended period of time. Selectively permeable membranes surrounding an osmotically active driving c compound are also suitable for orally administered compositions. In these latter platforms, fluid from the environment surrounding the capsule is imbibed by the driving compound, which swells to displace the agent or agent composition through an aperture.

These delivery platforms can provide an essentially zero order delivery profile as Sopposed to the spiked profiles of immediate release formulations. A time-delay material such as glycerol monostearate or glycerol stearate can also be used. Oral compositions can include standard excipients such as mannitol, lactose, starch, magnesium stearate, 00 sodium saccharin, cellulose, and magnesium carbonate. In one embodiment, the C excipients are of pharmaceutical grade.

In another embodiment, the Phenylene Compounds can be formulated for intravenous administration. Typically, compositions for intravenous administration comprise sterile isotonic aqueous buffer. Where necessary, the compositions can also include a solubilizing agent. Compositions for intravenous administration can optionally include a local anesthetic such as lidocaine to lessen pain at the site of the injection.

Generally, the ingredients are supplied either separately or mixed together in unit dosage form, for example, as a dry lyophilized powder or water free concentrate in a hermetically sealed container such as an ampule or sachette indicating the quantity of active agent. Where the Phenylene Compounds are to be administered by infusion, they can be dispensed, for example, with an infusion bottle containing sterile pharmaceutical grade water or saline. Where the Phenylene Compounds are administered by injection, an ampule of sterile water for injection or saline can be provided so that the ingredients can be mixed prior to administration.

The Phenylene Compounds can be administered by controlled-release or sustained-release means or by delivery devices that are known to those in the art.

Examples include, but are not limited to, those described in U.S. Patent Nos.: 3,845,770; 3,916,899; 3,536,809; 3,598,123; 4,008,719; 5,674,533; 5,059,595; 5,591,767; 5,120,548; 5,073,543; 5,639,476; 5,354,556; and 5,733,566, each of which is incorporated herein by reference. Such dosage forms can be used to provide controlledor sustained-release of one or more active ingredients using, for example, hydropropylmethyl cellulose, other polymer matrices, gels, permeable membranes, -125- 00 osmotic systems, multilayer coatings, microparticles, liposomes, microspheres, or a C combination thereof to provide the desired release profile in varying proportions.

SSuitable controlled- or sustained-release formulations known to those in the art, including those described herein, can be readily selected for use with the active C 5 ingredients of the invention. The invention thus encompasses single unit dosage forms suitable for oral administration such as, but not limited to, tablets, capsules, gelcaps, and caplets that are adapted for controlled- or sustained-release.

Controlled- or sustained-release pharmaceutical compositions can have a N, common goal of improving drug therapy over that achieved by their non-controlled or 00 S 10 non-sustained-release counterparts. In one embodiment, a controlled- or sustainedc, release composition comprises a minimal amount of a Phenylene Compound to treat or prevent the Condition or a symptom thereof in a minimum amount of time. Advantages of controlled- or sustained-release compositions include extended activity of the drug, reduced dosage frequency, and increased patient compliance. In addition, controlled- or sustained-release compositions can favorably affect the time of onset of action or other characteristics, such as blood levels of the Phenylene Compound, and can thus reduce the occurrence of adverse side effects.

Controlled- or sustained-release compositions can initially release an amount of a Phenylene Compound that promptly produces the desired therapeutic or prophylactic effect, and gradually and continually release other amounts of the Phenylene Compound to maintain this level of therapeutic or prophylactic effect over an extended period of time. To maintain a constant level of the Phenylene Compound in the body, the Phenylene Compound can be released from the dosage form at a rate that will replace the amount of Phenylene Compound being metabolized and excreted from the body.

Controlled- or sustained-release of an active ingredient can be stimulated by various conditions, including but not limited to, changes in pH, changes in temperature, concentration or availability of enzymes, concentration or availability of water, or other physiological conditions or compounds.

The amount of the Phenylene Compound that is effective for the treatment or prevention of a condition can be determined by standard clinical techniques. In addition, in vitro or in vivo assays can optionally be employed to help identify optimal dosage ranges. The precise dose to be employed will also depend on the route of administration, -126- 0 and the seriousness of the Condition and can be decided according to the judgment of a practitioner and/or each animal's circumstances. Suitable effective dosage amounts, however, range from about 0.01 mg/kg of body weight to about 2500 mg/kg of body Sweight, although they are typically about 100 mg/kg of body weight or less. In one embodiment, the effective dosage amount ranges from about 0.01 mg/kg of body weight to about 100 mg/kg of body weight of a Phenylene Compound, in another embodiment, n about 0.02 mg/kg of body weight to about 50 mg/kg of body weight, and in another 0 embodiment, about 0.025 mg/kg of body weight to about 20 mg/kg of body weight. In 0 one embodiment, an effective dosage amount is administered about every 24 h until the 00 10 Condition is abated. In another embodiment, an effective dosage amount is administered Sabout every 12 h until the Condition is abated. In another embodiment, an effective dosage amount is administered about every 8 h until the Condition is abated. In another embodiment, an effective dosage amount is administered about every 6 h until the Condition is abated. In another embodiment, an effective dosage amount is administered about every 4 h until the Condition is abated. The effective dosage amounts described herein refer to total amounts administered; that is, if more than one Phenylene Compound is administered, the effective dosage amounts correspond to the total amount administered.

Where a cell capable of expressing VR1, mGluR5, or mGluR1 is contacted with a Phenylene Compound in vitro, the amount effective for inhibiting the VR1, mGluR5, or mGluR1 receptor function in a cell will typically range from about 0.01 tg/L to about mg/L, in one embodiment, from about 0.01 pg/L to about 2.5 mg/L, in another embodiment, from about 0.01 ig/L to about 0.5 mg/L, and in another embodiment, from about 0.01 ag/L to about 0.25 mg/L of a solution or suspension of a pharmaceutically acceptable carrier or excipient. In one embodiment, the volume of solution or suspension comprising the Phenylene Compound is from about 0.01 pL to about 1 mL.

In another embodiment, the volume of solution or suspension is about 200 pL.

Where a cell capable of expressing VR1, mGluR5, or mGluR1 is contacted with a Phenylene Compound in vivo, the amount effective for inhibiting the receptor function in a cell will typically range from about 0.01 mg/kg of body weight to about 2500 mg/kg of body weight, although it typically ranges from about 100 mg/kg of body weight or less.

In one embodiment, the effective dosage amount ranges from about 0.01 mg/kg of body -127- 0 weight to about 100 mg/kg of body weight of a Phenylene Compound, in another CI embodiment, about 0.02 mg/kg of body weight to about 50 mg/kg of body weight, and in another embodiment, about 0.025 mg/kg of body weight to about 20 mg/kg of body Sweight. In one embodiment, an effective dosage amount is administered about every 24 5 h. In another embodiment, an effective dosage amount is administered about every 12.

In another embodiment, an effective dosage amount is administered about every 8. In Cc another embodiment, an effective dosage amount is administered about every 6 h. In Sanother embodiment, an effective dosage amount is administered about every 4 h.

Ci The Phenylene Compounds can be assayed in vitro or in vivo for the desired oO 00 0 10 therapeutic or prophylactic activity prior to use in humans. Animal model systems can CI be used to demonstrate safety and efficacy.

The present methods for treating or preventing a Condition in an animal in need thereof can further comprise administering to the animal being administered a Phenylene Compound another therapeutic agent. In one embodiment, the other therapeutic agent is administered in an effective amount.

The present methods for inhibiting VR1 function in a cell capable of expressing VR1 can further comprise contacting the cell with an effective amount of another therapeutic agent that may or may not inhibit VR1.

The present methods for inhibiting mGluR5 function in a cell capable of expressing mGluR5 can further comprise contacting the cell with an effective amount of another therapeutic agent that may or may not inhibit The present methods for inhibiting mGluR1 function in a cell capable of expressing mGluR1 can further comprise contacting the cell with an effective amount of another therapeutic agent that may or may not inhibit mGluR1.

Effective amounts of the other therapeutic agents are known to those skilled in the art. However, it is well within the skilled artisan's purview to determine the other therapeutic agent's optimal effective-amount range. In one embodiment of the invention, where another therapeutic agent is administered to an animal, the minimal effective amount of the Phenylene Compound is less than its minimal effective amount would be where the other therapeutic agent is not administered. In this embodiment, without being -128- 00 0 bound by theory, it is believed that the Phenylene Compounds and the other therapeutic 0 CI agent act synergistically to treat or prevent a Condition.

c The other therapeutic agent can be, but is not limited to, an opioid agonist, a nonopioid analgesic, a non-steroidal anti-inflammatory agent, an antimigraine agent, a Cox- O 5 II inhibitor, an antiemetic, a P-adrenergic blocker, an anticonvulsant, an antidepressant, a Ca2+-channel blocker, an anticancer agent, an agent for treating or preventing UI, an C agent for treating or preventing an ulcer, an agent for treating or preventing IBD, an CI agent for treating or preventing IBS, an agent for treating addictive disorder, an agent for CN treating Parkinson's disease and parkinsonism, an agent for treating anxiety, an agent for 00 O 10 treating epilepsy, an agent for treating a stroke, an agent for treating a seizure, an agent

C

N for treating a pruritic condition, an agent for treating psychosis, an agent for treating Huntington's chorea, an agent for treating ALS, an agent for treating a cognitive disorder, an agent for treating a migraine, an agent for inhibiting vomiting, an agent for treating dyskinesia, or an agent for treating depression, and mixtures thereof.

Examples of useful opioid agonists include, but are not limited to, alfentanil, allylprodine, alphaprodine, anileridine, benzylmorphine, bezitramide, buprenorphine, butorphanol, clonitazene, codeine, desomorphine, dextromoramide, dezocine, diampromide, diamorphone, dihydrocodeine, dihydromorphine, dimenoxadol, dimepheptanol, dimethylthiambutene, dioxaphetyl butyrate, dipipanone, eptazocine, ethoheptazine, ethylmethylthiambutene, ethylmorphine, etonitazene fentanyl, heroin, hydrocodone, hydromorphone, hydroxypethidine, isomethadone, ketobemidone, levorphanol, levophenacylmorphan, lofentanil, meperidine, meptazinol, metazocine, methadone, metopon, morphine, myrophine, nalbuphine, narceine, nicomorphine, norlevorphanol, normethadone, nalorphine, normorphine, norpipanone, opium, oxycodone, oxymorphone, papaveretum, pentazocine, phenadoxone, phenomorphan, phenazocine, phenoperidine, piminodine, piritramide, proheptazine, promedol, properidine, propiram, propoxyphene, sufentanil, tilidine, tramadol, pharmaceutically acceptable salts thereof, and mixtures thereof.

In certain embodiments, the opioid agonist is selected from codeine, hydromorphone, hydrocodone, oxycodone, dihydrocodeine, dihydromorphine, morphine, tramadol, oxymorphone, pharmaceutically acceptable salts thereof, and mixtures thereof.

-129- 00 0 Examples of useful non-opioid analgesics include non-steroidal C anti-inflammatory agents, such as aspirin, ibuprofen, diclofenac, naproxen, benoxaprofen, flurbiprofen, fenoprofen, flubufen, ketoprofen, indoprofen, piroprofen, carprofen, oxaprozin, pramoprofen, muroprofen, trioxaprofen, suprofen, aminoprofen, S 5 tiaprofenic acid, fluprofen, bucloxic acid, indomethacin, sulindac, tolmetin, zomepirac, tiopinac, zidometacin, acemetacin, fentiazac, clidanac, oxpinac, mefenamic acid, c meclofenamic acid, flufenamic acid, niflumic acid, tolfenamic acid, diflurisal, flufenisal, Spiroxicam, sudoxicam, isoxicam, and pharmaceutically acceptable salts thereof, and Smixtures thereof. Other suitable non-opioid analgesics include the following, 0 10 non-limiting, chemical classes of analgesic, antipyretic, nonsteroidal anti-inflammatory Sdrugs: salicylic acid derivatives, including aspirin, sodium salicylate, choline magnesium trisalicylate, salsalate, diflunisal, salicylsalicylic acid, sulfasalazine, and olsalazin; para-aminophenol derivatives including acetaminophen and phenacetin; indole and indene acetic acids, including indomethacin, sulindac, and etodolac; heteroaryl acetic acids, including tolmetin, diclofenac, and ketorolac; anthranilic acids (fenamates), including mefenamic acid and meclofenamic acid; enolic acids, including oxicams (piroxicam, tenoxicam), and pyrazolidinediones (phenylbutazone, oxyphenthartazone); and alkanones, including nabumetone. For a more detailed description of the NSAIDs, see Paul A. Insel, Analgesic-Antipyretic and Antiinflammatory Agents and Drugs Employed in the Treatment of Gout, in Goodman Gilman's The Pharmacological Basis of Therapeutics 617-57 (Perry B. Molinhoff and Raymond W. Ruddon eds., 9 h ed 1996); and Glen R. Hanson, Analgesic, Antipyretic and Anti-Inflammatory Drugs in Remington: The Science and Practice of Pharmacy Vol II 1196-1221 Gennaro ed. 19 h ed. 1995), which are hereby incorporated by reference in their entireties.

Examples of useful Cox-II inhibitors and 5-lipoxygenase inhibitors, as well as combinations thereof, are described in U.S. Patent No. 6,136,839, which is hereby incorporated by reference in its entirety. Examples of useful Cox-II inhibitors include, but are not limited to, rofecoxib and celecoxib.

Examples of useful antimigraine agents include, but are not limited to, alpiropride, bromocriptine, dihydroergotamine, dolasetron, ergocornine, ergocorninine, ergocryptine, ergonovine, ergot, ergotamine, flumedroxone acetate, fonazine, ketanserin, -130- 00 lisuride, lomerizine, methylergonovine, methysergide, metoprolol, naratriptan, oxetorone, pizotyline, propranolol, risperidone, rizatriptan, sumatriptari, timolol, trazodone, zolmitriptan, and mixtures thereof.

The other therapeutic agent can also be an antiemetic agent. Examples of useful S 5 antiemnetic agents include, but are not limited to, metoclopromide, domperidone, prochiorperazine, promethazine, chlorpromazine, trimethobenzamide, odansteron, N- granisetron, hydroxyzine, acetylleucine monoethanolamine, alizapride, azasetron, c-i benzquinamide, bietanautine, bromopride, buclizine, clebopride, cyclizine, N- dimenhydrinate, diphenidol, dolasetron, meclizine, methallatal, metopimazine, nabilone, 00 oxyperndyl, pipamazine, scopolamidne, sulpiride, tetrahydrocannabinol, thiethylperazine, N- thioproperazine, tropisetron, and mixtures thereof.

Examples of useful J-adrenergic blockers include, but are not limited to, acebutolol, aiprenolol, amosulabol, arotinolol, atenolol, befunolol, betaxolol, bevantolol, bisoprolol, bopindolol, bucumolol, bufetolol, bufuralol, bunitrolol, bupranolol, butidrine hydrochloride, butofilolol, carazolol, carteolol, carvedilol, celiprolol, cetamolol, cloranolol, dilevalol, epanolol, esmolol, indenolol, labetalol, levobunolol, mepindolol, metipranolol, metoprolol, moprolol, nadolol, nadoxolol, nebivalol, nifenalol, nipradilol, oxprenolol, penbutolol, pindolol, practolol, pronethalol, propranolol, sotalol, sulfinalol, talinolol, tertatolol, tilisolol, tirnolol, toliprolol, and xibenolol.

Examples of useful anticonvulsants include, but are not limited to, acetylpheneturide, albutoin, aloxidone, aminoglutethimide, 4-amino-3-hydroxybutyric acid, atrolactamide, beclamide, buramate, calcium bromide, carbamazepine, cinromide, clomethiazole, clonazepam, decimemide, diethadione, dixuethadione, doxenitroin, eterobarb, ethadione, ethosuximide, ethotoin, felbamate, fluoresone, gabapentin, 5-hydroxytryptophan, lamotrigine, magnesium bromide, magnesium sulfate, mephenytoin, mephobarbital metharbital, methetoin, methsuximide, 5-methyl-5-(3-.phenanthryl)-hydantoin, 3-methyl-5-phenylhydantoin, narcobarbital, nimetazepam, nitrazepam, oxcarbazepine, paramethadione, phenacemide, phenetharbital, pheneturide, phenobarbital, phensuximide, phenylmethylbarbituric acid, phenytoin, phethenylate sodium, potassium bromide, pregabaline, primidone, progabide, sodium bromide, solanum, strontium bromide, suclofenide, sulthiame, tetrantoin, tiagabine, topiramate, trimethadione, valproic acid, valpromide, vigabatrin, and zonisamide.

131 00 Examples of useful antidepressants include, but are not limited to, binedaline, c-i caroxazone, citalopram, (S)-citalopram, dimethazan, fencamine, indalpine, indeloxazine hydrocholoride, nefopam, nomnifensine, oxitriptan, oxypertine, paroxetine, sertraline, thiazesim, trazodone, benmoxine, iproclozide, iproniazid, isocarboxazid, nialamide, octamoxin, pheneizine, cotinine, rolicyprine, rolipram, maprotiline, metralindole, mianserin, mirtazepine, adinazolam, amitriptyline, amitriptylinoxide, amoxapine, butriptyline, clomipramine, demexiptiline, desipramine, dibenzepin, dimetacrine, dothiepin, doxepin, fluacizine, imipramine, imipramine N-oxide, iprindole, lofepramine, melitracen, metaprammne, nortriptyline, noxiptilin, opipramol, pizotyline, propizepine, 00 protriptyline, quinupramine, tianeptine, trimidpramine, adrafinil, benactyzine, bupropion, butacetin, dioxadrol, duloxetine, etoperidone, febarbamate, femoxetine, fenpentadiol, fluoxetine, fluvoxamine, hematoporphyrin, hypericin, levophacetoperane, medifoxamine, milnacipran, minaprine, moclobemide, nefazodone, oxaflozane, piberaline, prolintane, pyrisuccideanol, ritanserin, roxindole, rubidium. chloride, sulpiride, tandospirone, thozalinone, tofenacin, toloxatone, tranylcypromine, L-tryptophan, venlafaxine, viloxazine, and zimelidmne.

Examples of useful Ca2+-channel blockers include, but are not limited to, bepridil, clentiazem, diltiazem, fendiline, gallopamil, mibefradil, prenylamine, semotiadil, terodiline, verapamil, amlodipine, aranidipine, barnidipine, benidipine, cilnidipine, efonidipine, elgodipine, felodipine, isradipine, lacidipine, lercanidipine, manidipine, nicardipine, nifedipine, nilvadipine, nimodipine, nisoldipine, nitrendipine, cmnnarizine, flunarizine, lidoflazine, lomerizine, bencyclane, etafenone, fantofarone, and perhexiline.

Examples of useful anticancer agents include, but are not limited to, acivicin, aclarubicin, acodazole hydrochloride, acronine, adozelesin, aldesleukin, altretamine, ambomycin, ametantrone acetate, aminoglutethimide, amsacrine, anastrozole, anthramycin, asparaginase, asperlin, azacitidine, azetepa, azotomycin, batimastat, benzodepa, bicalutamide, bisantrene hydrochloride, bisnafide dimesylate, bizelesin, bleomycin sulfate, brequinar sodium, bropirimine, busulfan, cactinomycin, calusterone, caracemide, carbetimer, carboplatin, carmustine, carubicin hydrochloride, carzelesin, cedefingol, chlorambucil, cirolemycin, cisplatin, cladribine, crisnatol mesylate, cyclophosphamide, cytarabine, dacarbazine, dactinomycin, daunorubicin hydrochloride, -132- 00 decitabine, dexormaplatin, dezaguanine, dezaguanine mesylate, diaziquone, docetaxel, c-i doxorubicin, doxorubicin hydrochloride, droloxifene, droloxifene citrate, dromostanolone propionate, duazomnycin, edatrexate, eflomnithine hydrochloride.

elsamitrucin, enloplatin, enpromnate, epipropidine, epirubicin hydrochloride, erbulozole, esorubicin hydrochloride, estramustine, estramustine phosphate sodium, etanidazole, etoposide, etoposide phosphate, etoprine, fadrozole hydrochloride, fazarabine, fenretinide, floxuridine, fludarabine phosphate, fluorouracil, flurocitabine, fosquidone, fostriecin sodium, gemcitabine, gemcitabine hydrochloride, hydroxyurea, idarubicin hydrochloride, ifosfamide, ilmofosine, interleukin HI (including recombinant interleukin 00 10 11 or rIL2), interferon alpha-2a, interferon alpha-2b, interferon alpha-ni, interferon alpha-n3, interferon beta-I a, interferon gamma-I b, iproplatin, irinotecan hydrochloride, lanreotide acetate, letrozole, leuprolide acetate, liarozole hydrochloride, lometrexol sodium, lomustine, losoxantrone hydrochloride, masoprocol, maytansine, mechiorethamine hydrochloride, megestrol acetate, melengestrol acetate, melphalan, menogaril, mercaptopurine, methotrexate, methotrexate sodium, metoprine, meturedepa, mitindomide, mitocarcin, mitocromin, mitogillin, mitomalcin, mitomycin, mitosper, mitotane, mitoxantrone hydrochloride, mycophenolic: acid, nocodazole, nogalamycin, ormaplatin, oxisuran, paclitaxel, pegaspargase, peliomycin, pentamnustine, peplomnycin sulfate, perfosfamide, pipobroman, piposulfan, piroxantrone hydrochloride, plicamycin, plomestane, porfimer sodium, porfiromycin, prednimnustine, procarbazine hydrochloride, puromycin, puromycin hydrochloride, pyrazofurin, riboprine, rogletimide, safmngol, safingol hydrochloride, semustine, simtrazene, sparfosate sodium, sparsomycin, spirogermanium hydrochloride, spiromustine, spiroplatin, streptonigrin, streptozotocmn, sulofenur, talisomycin, tecogalan sodium, tegafur, teloxantrone hydrochloride, temoporfin, teniposide, teroxirone, testolactone, thiamiprine, thioguanine, thiotepa, tiazofurin, tirapazamine, toremifene citrate, trestolone acetate, triciribine phosphate, tnimetrexate, trimetrexate glucuronate, triptorelin, tubulozole hydrochloride, uracil mustard, uredepa, vapreotide, verteporfin, vinbiastine sulfate, vincristine sulfate, vindesine, vindesine sulfate, vinepidine sulfate, vinglycinate sulfate, vinleurosine sulfate, vinorelbine tartrate, vinrosidine sulfate, vinzolidine sulfate, vorozole, zeniplatin, zmnostatin, zorubicin hydrochloride.

133 00 Examples of other anti-cancer drugs include, but are not limited to, 20-epi-1,25 dihydroxyvitamin D3; 5-ethynyluracil; abiraterone; aclarubicin; acylfulvene; adecypenol; adozelesin; aldesleukin; ALL-TK antagonists; altretamine; ambamustine; amidox; amifostine; aminolevulinic acid; amrubicin; amsacrine; anagrelide; anastrozole; andrographolide; angiogenesis inhibitors; antagonist D; antagonist G; antarelix; anti-dorsalizing morphogenetic protein-i1; antiandrogen, prostatic carcinoma; antiestrogen; antineoplaston; antisense oligonucleotides; aphidicolin glycinate; apoptosis gene modulators; apoptosis regulators; apurinic acid; ara-CDP-DL-PTBA; arginine dearninase; asulacrine; atamestane; atrimustine; axinastatin 1; axinastatin 2; axinastatin 00 10 3; azasetron; azatoxin; azatyrosine; baccatin 1HI derivatives; balanol; batimastat; BCRIABL antagonists; benzochlorins; benzoylstaurosporine; beta lactam derivatives; beta-alethine; betaclamycin B; betulinic acid; bFGF inhibitor; bicalutamide; bisantrene; bisaziridinyispermine; bisnafide; bistratene A; bizelesin; breflate; bropirimine; budotitane; buthionine sulfoximine; calcipotriol; caiphostin C; camptothecin derivatives; canarypox IL-2; capecitabine; carboxamide-amino-triazole; carboxyamidotriazole; CaRest M3; CARN 700; cartilage derived inhibitor; carzelesin; casein kinase inhibitors (ICOS); castanospermine; cecropin B; cetrorelix; chlorlns; chioroquinoxaline sulfonamide; cicaprost; cis-porphyrin; cladribine; clomnifene analogues; clotrimazole; collismycin A; collismycin B; combretastatin A4; comnbretastatin analogue; conagenin; cranabescidin 816; crisnatol; cryptophycin 8; cryptophycin. A derivatives; curacin A; cyclopentanthraquinones; cycloplatam; cypemycin; cytarabine ocfosfate; cytolytic factor; cytostatin; dacliximab; decitabine; dehydrodidemnin B; deslorelin; dexamethasone; dexifosfamide; dexrazoxane; dexverapamil; diaziquone; didemnin. B; didox; diethylnorspermine; dihydro-5-azacytidine; 9-dihydrotaxol; dioxamycin; diphenyl spiromustine; docetaxel; docosanol; dolasetron; doxifluridine; droloxifene; dronabinol; duocarmycin SA; ebselen; ecomustine; edelfosine; edrecolomnab; eflornithine; elemene; emitefur; epirubicin; epristeride; estramustine analogue; estrogen agonists; estrogen antagonists; etanidazole; etoposide phosphate; exemestane; fadrozole; fazarabine; fenretinide; filgrastim; finasteride; flavopiridol; flezelastine; fluasterone; fludarabine; fluorodaunorunicin hydrochloride; forfenimex; formestane; fostriecin; fotemustine; gadolinium texaphyrin; gallium nitrate; galocitabine; ganirelix; gelatinase inhibitors; gemcitabine; glutathione inhibitors; hepsulfam; heregulin; hexamethylene bisacetamnide; hypericin; ibandronic acid; idarubicin; idoxifene; idramantone; ilmofosine; ilomastat; -134- 00 imidazoacridones; iniquimod; immunostimulant peptides; insulin-like growth factor-i receptor inhibitor; interferon agonists; interferons; interleukins; iobenguane; iododoxorubicin; 4-ipomeanol; iroplact; irsogladine; isobengazole; isohomohalicondrin B; itasetron; jasplakinolide; kahalalide F; lanellarin-N triacetate; lanreotide; leinanycin; lenograstim; lentinan sulfate; leptoistatin; letrozole; leukemia inhibiting factor; leukocyte alpha interferon; leuprolide+estrogenprogesterone; leuprorelin; levamisole; liarozole; linear polyamine analogue; lipophilic disaccharide peptide; lipophilic platinum compounds; lissoclinaride 7; lobaplatin; lombricine; lometrexol; lonidamine; losoxantrone; lovastatin; loxoribine; lurtotecan; lutetium texaphyrin; lysofylline; lytic 00 10 peptides; maitansine; mannostatin A; marimastat; masoprocol; maspin; matrilysin inhibitors; matrix metalloproteinase inhibitors; menogaril; merbarone; meterelin; methioninase; metoclopramide; MEW inhibitor; mifepristone; miltefosine; mirimostim; mismatched double stranded RNA; mitoguazone; mitolactol; mitomycin analogues; mitonafide; mitotoxin fibroblast growth factor-saporin; mitoxantrone; mofarotene; molgramostim; monoclonal antibody, human chorionic gonadotrophin; monophosphoryl lipid A+myobacterium cell wall sk; mopidamol; multiple drug resistance gene inhibitor; multiple tumor suppressor 1-based therapy; mustard anticancer agent; mycaperoxide B; mycobacterial cell wall extract; myriaporone; N-acetyldinaline; N-substituted beuzamides; nafarelin; nagrestip; naloxone+pentazocine; napavin; naphterpin; nartograstim; nedaplatin; nemorubicin; neridronic acid; neutral endopeptidase; nilutamide; nisamycin; nitric oxide modulators; nitroxide antioxidant; nitrullyn; 06-benzylguanine; octreotide; okicenone; oligonucleotides; onapristone; odansteron; oracin; oral cytokine inducer; ormaplatin; osaterone; oxaliplatin; oxaunomycin; paclitaxel; paclitaxel analogues; paclitaxel derivatives; palauamine; palmitoylrhizoxin; pamidronic acid; panaxytriol; panomifene; parabactin; pazelliptine; pegaspargase; peldesine; pentosan polysulfate sodium; pentostatin; pentrozole; perfiubron; perfosfamide; perillyl alcohol; phenazinomycin; phenylacetate; phosphatase inhibitors; picibanil; pilocarpine hydrochloride; pirarubicin; piritrexim; placetin A; placetin B; plasminogen activator inhibitor; platinum complex; platinum compounds; platinum-triamine complex; porfimer sodium; porfiromycin; prednisone; propyl bis-acridone; prostaglandin J2; proteasome inhibitors; protein A-based immune modulator; protein kinase C inhibitor; protein kinase C inhibitors, microalgal; protein tyrosine phosphatase inhibitors; purine nucleoside phosphorylase inhibitors; purpurins; -135- 00 pyrazoloacridine; pyridoxylated hemoglobin polyoxyethylene conjugate; raf antagonists; N raltitrexed; ramosetron; ras farnesyl protein transferase inhibitors; ras inhibitors; ras-GAP inhibitor; retelliptine demethylated; rhenium Re 186 etidronate; rhizoxin; ribozymes; RH retinamide; rogletimide; rohitukine; romurtide; roquinimex; rubiginone S 5 Bl; ruboxyl; safingol; saintopin; SarCNU; sarcophytol A; sargramostim; Sdi 1 mimetics; semustine; senescence derived inhibitor 1; sense oligonucleotides; signal transduction inhibitors; signal transduction modulators; single chain antigen binding protein; 0 sizofiran; sobuzoxane; sodium borocaptate; sodium phenylacetate; solverol; somatomedin binding protein; sonermin; sparfosic acid; spicamycin D; spiromustine; 00 10 splenopentin; spongistatin 1; squalamine; stem cell inhibitor; stem-cell division inhibitors; stipiamide; stromelysin inhibitors; sulfinosine; superactive vasoactive intestinal peptide antagonist; suradista; suramin; swainsonine; synthetic glycosaminoglycans; tallimustine; tamoxifen methiodide; tauromustine; tazarotene; tecogalan sodium; tegafur; tellurapyrylium; telomerase inhibitors; temoporfin; temozolomide; teniposide; tetrachlorodecaoxide; tetrazomine; thaliblastine; thiocoraline; thrombopoietin; thrombopoietin mimetic; thymalfasin; thymopoietin receptor agonist; thymotrinan; thyroid stimulating hormone; tin ethyl etiopurpurin; tirapazamine; titanocene bichloride; topsentin; toremifene; totipotent stem cell factor; translation inhibitors; tretinoin; triacetyluridine; triciribine; trimetrexate; triptorelin; tropisetron; turosteride; tyrosine kinase inhibitors; tyrphostins; UBC inhibitors; ubenimex; urogenital sinus-derived growth inhibitory factor; urokinase receptor antagonists; vapreotide; variolin B; vector system, erythrocyte gene therapy; velaresol; veramine; verdins; verteporfin; vinorelbine; vinxaltine; vitaxin; vorozole; zanoterone; zeniplatin; zilascorb; and zinostatin stimalamer.

Examples of useful therapeutic agents for treating or preventing UI include, but are not limited to, propantheline, imipramine, hyoscyamine, oxybutynin, and dicyclomine.

Examples of useful therapeutic agents for treating or preventing an ulcer include, antacids such as aluminum hydroxide, magnesium hydroxide, sodium bicarbonate, and calcium bicarbonate; sucraflate; bismuth compounds such as bismuth subsalicylate and bismuth subcitrate; H 2 antagonists such as cimetidine, ranitidine, famotidine, and nizatidine; H, K+ ATPase inhibitors such as omeprazole, iansoprazole, and -136- 00lansoprazole; carbenoxolone; misprostol; and antibiotics such as tetracycline, metronidazole, timidazole, clarithromycin, and amoxicillin.

Examples of useful therapeutic agents for treating or preventing BD include, but are not limited to, anticholinergic drugs; diphenoxylate; loperamide; deodorized opium O 5 tincture; codeine; broad-spectrum antibiotics such as metronidazole; sulfasalazine; olsalazine; mesalamine; prednisone; azathioprine; mercaptopurine; and methotrexate.

N Examples of useful therapeutic agents for treating or preventing IBS include, but are not limited to, propantheline; muscarine receptor antogonists such as pirenzapine, 00 methoctramine, ipratropium, tiotropium, scopolamine, methscopolamine, homatropine, homatropine methylbromide, and methantheline; and antidiarrheal drugs such as diphenoxylate and loperamide.

Examples of useful therapeutic agents for treating or preventing an addictive disorder include, but are not limited to, methadone, desipramine, amantadine, fluoxetine, buprenorphine, an opiate agonist, 3-phenoxypyridine, levomethadyl acetate hydrochloride, and serotonin antagonists.

Examples of useful therapeutic agents for treating or preventing Parkinson's disease and parkinsonism include, but are not limited to, carbidopa/levodopa, pergolide, bromocriptine, ropinirole, pramipexole, entacapone, tolcapone, selegiline, amantadine, and trihexyphenidyl hydrochloride.

Examples of useful therapeutic agents for treating or preventing anxiety include, but are not limited to, benzodiazepines, such as alprazolam, brotizolam, chlordiazepoxide, clobazam, clonazepam, clorazepate, demoxepam, diazepam, estazolam, flumazenil, flurazepam, halazepam, lorazepam, midazolam, nitrazepam, nordazepam, oxazepam, prazepam, quazepam, temazepam, and triazolam; nonbenzodiazepine agents, such as buspirone, gepirone, ipsapirone, tiospirone, zolpicone, zolpidem, and zaleplon; tranquilizers, such as barbituates, amobarbital, aprobarbital, butabarbital, butalbital, mephobarbital, methohexital, pentobarbital, phenobarbital, secobarbital, and thiopental; and propanediol carbamates, such as meprobamate and tybamate.

Examples of useful therapeutic agents for treating or preventing epilepsy include, but are not limited to, carbamazepine, ethosuximide, gabapentin, lamotrigine, -137- 0 phenobarbital, phenytoin, primidone, valproic acid, trimethadione, benzodiazepines, N y-vinyl GABA, acetazolamide, and felbamate.

c Examples of useful therapeutic agents for treating or preventing stroke include, but are not limited to, anticoagulants such as heparin, agents that break up clots such as O 5 streptokinase or tissue plasminogen activator, agents that reduce swelling such as mannitol or corticosteroids, and acetylsalicylic acid.

SExamples of useful therapeutic agents for treating or preventing a seizure include, Sbut are not limited to, carbamazepine, ethosuximide, gabapentin, lamotrigine, 00 phenobarbital, phenytoin, primidone, valproic acid, trimethadione, benzodiazepines, 0 0 10 gabapentin, lamotrigine, y-vinyl GABA, acetazolamide, and felbamate.

Examples of useful therapeutic agents for treating or preventing a pruritic condition include, but are not limited to, naltrexone; nalmefene; danazol; tricyclics such as amitriptyline, imipramine, and doxepin; antidepressants such as those given below, menthol; camphor; phenol; pramoxine; capsaicin; tar; steroids; and antihistamines.

Examples of useful therapeutic agents for treating or preventing psychosis include, but are not limited to, phenothiazines such as chlorpromazine hydrochloride, mesoridazine besylate, and thoridazine hydrochloride; thioxanthenes such as chloroprothixene and thiothixene hydrochloride; clozapine; risperidone; olanzapine; quetiapine; quetiapine fumarate; haloperidol; haloperidol decanoate; loxapine succinate; molindone hydrochloride; pimozide; and ziprasidone.

Examples of useful therapeutic agents for treating or preventing Huntington's chorea include, but are not limited to, haloperidol and pimozide.

Examples of useful therapeutic agents for treating or preventing ALS include, but are not limited to, baclofen, neurotrophic factors, riluzole, tizanidine, benzodiazepines such as clonazepan and dantrolene.

Examples of useful therapeutic agents for treating or preventing cognitive disorders include, but are not limited to, agents for treating or preventing dementia such as tacrine; donepezil; ibuprofen; antipsychotic drugs such as thioridazine and haloperidol; and antidepressant drugs such as those given below.

-138- 00 0 Examples of useful therapeutic agents for treating or preventing a migraine C include, but are not limited to, sumatriptan; methysergide; ergotamine; caffeine; and Sbeta-blockers such as propranolol, verapamil, and divalproex.

Examples of useful therapeutic agents for treating, inhibiting, or preventing 0 5 vomiting include, but are not limited to, 5-HT 3 receptor antagonists such as odansteron, dolasetron, granisetron, and tropisetron; dopamine receptor antagonists such as C prochlorperazine, thiethylperazine, chlorpromazin, metoclopramide, and domperidone; CI glucocorticoids such as dexamethasone; and benzodiazepines such as lorazepam and CN alprazolam.

00 o 0 10 Examples of useful therapeutic agents for treating or preventing dyskinesia include, but are not limited to, reserpine and tetrabenazine.

Examples of useful therapeutic agents for treating or preventing depression include, but are not limited to, tricyclic antidepressants such as amitryptyline, amoxapine, bupropion, clomipramine, desipramine, doxepin, imipramine, maprotiline, nefazadone, nortriptyline, protriptyline, trazodone, trimipramine, and venlafaxine; selective serotonin reuptake inhibitors such as citalopram, (S)-citalopram, fluoxetine, fluvoxamine, paroxetine, and setraline; monoamine oxidase inhibitors such as isocarboxazid, pargyline, phenelzine, and tranylcypromine; and psychostimulants such as dextroamphetamine and methylphenidate.

A Phenylene Compound and the other therapeutic agent combined can act additively or, in one embodiment, synergistically. In one embodiment, a Phenylene Compound is administered concurrently with another therapeutic agent, for example, a composition comprising an effective amount of a Phenylene Compound and an effective amount of another therapeutic agent can be administered. Alternatively, a composition comprising an effective amount of a Phenylene Compound and a different composition comprising an effective amount of another therapeutic agent can be concurrently administered. In another embodiment, an effective amount of a Phenylene Compound is administered prior or subsequent to administration of an effective amount of another therapeutic agent. In this embodiment, the Phenylene Compound is administered while the other therapeutic agent exerts its therapeutic effect, or the other therapeutic agent is administered while the Phenylene Compound exerts its therapeutic effect for treating or preventing a Condition.

-139- 00 0A composition of the invention is prepared by a method comprising admixing a C Phenylene Compound or a pharmaceutically acceptable salt and a pharmaceutically acceptable carrier or excipient. Admixing can be accomplished using methods known for admixing a compound (or salt) and a pharmaceutically acceptable carrier or S 5 excipient. In one embodiment, the Phenylene Compound is present in the composition in an effective amount.

c 4.8 Kits 00 The invention encompasses kits that can simplify the administration of a Phenylene Compound to an animal.

A typical kit of the invention comprises a unit dosage form of a Phenylene Compound. In one embodiment, the unit dosage form is a container, which can be sterile, containing an effective amount of a Phenylene Compound and a pharmaceutically acceptable carrier or excipient. The kit can further comprise a label or printed instructions instructing the use of the Phenylene Compound to treat or prevent a Condition. The kit can also further comprise a unit dosage form of another therapeutic agent, for example, a second container containing an effective amount of the other therapeutic agent and a pharmaceutically acceptable carrier or excipient. In another embodiment, the kit comprises a container containing an effective amount of a Phenylene Compound, an effective amount of another therapeutic agent and a pharmaceutically acceptable carrier or excipient. Examples of other therapeutic agents include, but are not limited to, those listed above.

Kits of the invention can further comprise a device that is useful for administering the unit dosage forms. Examples of such a device include, but are not limited to, a syringe, a drip bag, a patch, an inhaler, and an enema bag.

The following examples are set forth to assist in understanding the invention and should not be construed as specifically limiting the invention described and claimed herein. Such variations of the invention, including the substitution of all equivalents now known or later developed, which would be within the purview of those skilled in the art, and changes in formulation or changes in experimental design, are to be considered to fall within the scope of the invention incorporated herein.

-140- Examples 5.1 Example 1: Synthesis of Compound 00

NH

2

HOBT

EDCI

DMF

C

I Pd(PPh 3 4

+N

C~a THF ZnBr 141 00 0 To a solution of 4-iodobenzoic acid A (commercially available from Sigma- CI Aldrich, St. Louis, MO) in DMF (0.22 M) was added 1 equivalent of 4-tert-butylaniline B (commercially available from Sigma-Aldrich), and the resulting solution was stirred C for about 5 min at a temperature of about 25°C. To the resulting reaction mixture was added about 1 equivalent of HOBT and about 1 equivalent of EDCI and the mixture was allowed to stir for about 6 h at a temperature of about 25 0 C. The reaction mixture was diluted with 2N aq. sodium hydroxide and extracted 3 times with EtOAc. The EtOAc Slayers were combined, dried (with Na 2

SO

4 and the solvent removed under reduced Spressure to provide a residue that was washed with methanol and dried under reduced pressure. The residue was then suspended in THF (0.04 moles/liter) under a nitrogen Satmosphere and 3 equivalent of Compound E (commercially available from Sigma- Aldrich) and 0.05 equivalent of Pd(PPh 3 4 (commercially available from Sigma-Aldrich) were added to the reaction mixture. The reaction mixture was then heated to about and stirred for about 2 h. The solvent was removed under reduced pressure to provide a residue that was purified using a silica gel column eluted with a gradient of 5:95 ethyl acetate:hexane to 50:50 ethyl acetate:hexane to provide Compound E35 as an off-white solid (28% yield).

The identity of Compound E35 was confirmed using 'H NMR.

Compound E35: 'H NMR (MeOD) 5 8.335 1H), 7.939 2H), 7.681 1H), 7.513 4H), 7.300 2H), 7.251 (dd, 1H), 2.230 3H), 1.227 9H) ppm.

5.2 Example 2: Synthesis of Compound E42 Compound E42 was made by a procedure that is analogous to the procedure used to make Compound E35 except that 4-trifluoromethylaniline (commercially available from Sigma-Aldrich) was used in place of 4-tert-butylaniline. Compound E42 was obtained as a white solid (80% yield).

The identity of Compound E42 was confirmed using 'H NMR.

Compound E42: 'H NMR(CDCI 3 8 8.560 1H), 8.138 1H), 7.954 2H), 7.813 2H), 7.684-7.604 5H), 7.267-7.223 1H CDCl 3 2.369 3H), 1.559 H20) ppm.

-142- 00 5.3 Example 3: Synthesis of Compound

O

C Compound J35 was made by a procedure that is analogous to the procedure used to make Compound E35 except that 6-chlorobenzothiazol-2-ylamine (commercially Savailable from Sigma-Aldrich) was used in place of 4-tert-butylaniline. Compound S 5 was obtained as a white solid.

The identity of Compound J35 was confirmed using IH NMR.

Compound J35: 'H NMR (DMS0 6 8 8.65-8.60 lh), 8.22-8.17 2h), f, 7.93-7.89 Ih), 7.86-7.84 IhO, 7.74-7.67 3H), 7.52-7.47 1H), 7.45-7.41 00 1H), 2.43 3H) ppm.

5.4 Example 4: Synthesis of Compound J37 Compound J37 was made by a procedure analogous to the procedure used to make Compound E35 except that 6-fluorobenzothiazol-2-ylamine (commercially available from Sigma-Aldrich) was used in place of 4-tert-butylaniline. Compound J37 was obtained as an off-white solid.

The identity of Compound J37 was confirmed using 'H NMR.

Compound J37: 'H NMR (DMSO-d 6 5 8.29-8.24 1H), 8.15-8.09 2H), 7.65-7.61 1H), 7.52-7.34 4H), 7.22-7.16 1H), 6.98-6.91 1H), 2.19 3H) ppm.

Example 5: Synthesis of Compound Compound 50 was made by a procedure that is analogous to the procedure used to make Compound E35 except that the following zinc bromide compound, prepared according to the procedure provided in M.B. Smith and J. March, March's Advanced Organic Chemistry: Reaction Mechanisms and Structure, 805-807 (5d ed. 2001); H.

Fillon et al., Tett. Lett. 42:3843-46 (2001); M. Amadji et al., Tettrahedron 9:1657-60 (1998); and S. Billotte, Synlett. 379-380 (1998), was used in place of Compound E: 143- 00N

,N

SF

3 ZnBr Compound E50 was obtained as a white solid.

The identity of Compound E50 was confirmed using 'H NMR.

m Compound E50: 'H NMR (CDC13) 8 8.87 (dd, 1H), 8.12 (dd, 1H), 7.96 2H), O 5 7.83 1H), 7.64 2H), 7.58 2H), 7.48 (dd, 1H), 7.41 2H), 1.33 9H) ppm.

00 O 5.6 Example 6: Binding of Phenylene Compounds to The following assay can be used to demonstrate that Phenylene Compounds bind to and modulate the activity of Cell Cultures: Primary glial cultures are prepared from cortices of Sprague- Dawley 18 days old embryos. The cortices are dissected and then dissociated by trituration. The resulting cell homogenate is plated onto poly-D-lysine precoated T175 flasks (BIOCOAT, commercially available from Becton Dickinson and Company Inc. of Franklin Lakes, NJ) in Dulbecco's Modified Eagle's Medium ("DMEM," pH 7.4), buffered with 25 mM HEPES, and supplemented with 15% fetal calf serum ("FCS," commercially available from Hyclone Laboratories Inc. of Omaha, NE), and incubated at 37 0 C and 5% CO 2 After 24 hours, FCS supplementation is reduced to 10%. On day six, oligodendrocytes and microglia are removed by strongly tapping the sides of the flasks. One day following this purification step, secondary astrocyte cultures are established by subplating onto 96 poly-D-lysine precoated T175 flasks (BIOCOAT) at a density of 65,000 cells/well in DMEM and 10% FCS. After 24 hours, the astrocytes are washed with serum free medium and then cultured in DMEM, without glutamate, supplemented with 0.5% FCS, 20 mM HEPES, 10 ng/mL epidermal growth factor 1 mM sodium pyruvate, and 1X penicillin/streptomycin at pH 7.5 for 3 to days at 37 0 C and 5% CO 2 The procedure allows the expression of the mGluR5 receptor by astrocytes, as demonstrated by S. Miller et al., J. Neuroscience 15(9):6103-6109 (1995).

Assay Protocol: After 3-5 days incubation with EGF, the astrocytes are washed with 127 mM NaC1, 5 mM KC1, 2 mM MgC1 2 700 mM NaH 2

PO

4 2 mM CaC12, 5 mM -144- 00 NaHC0 3 8 mM HEPES, 10 mM Glucose at pH 7.4 ("Assay Buffer") and loaded with the dye Fluo-4 (commercially available from Molecular Probes Inc. of Eugene, OR) using 0.1 mL of Assay Buffer containing Fluo-4 (3 mM final). After 90 minutes of dye Sloading, the cells are then washed twice with 0.2 mL Assay Buffer and resuspended in r- 5 0.1 mL of Assay Buffer. The plates containing the astrocytes are then transferred to a Fluorometric Imaging Plate reader ("FLIPR," commercially available from Molecular Cc, Devices Corporation of Sunnyvale, CA) for the assessment of calcium mobilization flux in the presence of glutamate and in the presence or absence of antagonist. After monitoring fluorescence for 15 seconds to establish a baseline, DMSO solutions 00 10 containing various concentrations of a Phenylene Compound diluted in Assay Buffer (0.05 mL of 4X dilutions for competition curves) are added to the cell plate and fluorescence is monitored for 2 minutes. 0.05 mL of a 4X glutamate solution (agonist) is then added to each well to provide a final glutamate concentration in each well of mM. Plate fluorescence is then monitored for an additional 60 seconds after agonist addition. The final DMSO concentration in the assay is In each experiment, fluorescence is monitored as a function of time and the data analyzed using Microsoft Excel and GraphPad Prism. Dose-response curves are fit using a non-linear regression to determine the IC 50 value. In each experiment, each data point is determined two times.

5.7 Example 7: In Vivo Assays for Prevention or Treatment of Pain Test Animals: Each experiment uses rats weighing between 200-260 g at the start of the experiment. The rats are group-housed and have free access to food and water at all times, except prior to oral administration of a Phenylene Compound when food is removed for 16 hours before dosing. A control group acts as a comparison to rats treated with a Phenylene Compound. The control group is administered the carrier for the Phenylene Compound. The volume of carrier administered to the control group is the same as the volume of carrier and Phenylene Compound administered to the test group.

Acute Pain: To assess the actions of the Phenylene Compounds for the treatment or prevention of acute pain, the rat tail flick test can be used. Rats are gently restrained by hand and the tail exposed to a focused beam of radiant heat at a point 5 cm from the tip using a tail flick unit (Model 7360, commercially available from Ugo Basile of Italy).

Tail flick latencies are defined as the interval between the onset of the thermal stimulus and the flick of the tail. Animals not responding within 20 seconds are removed from the -145- 00 0 tail flick unit and assigned a withdrawal latency of 20 seconds. Tail flick latencies are 0 Cl measured immediately before (pre-treatment) and 1, 3, and 5 hours following administration of a Phenylene Compound. Data are expressed as tail flick latency(s) and the percentage of the maximal possible effect MPE), 20 seconds, is calculated as follows: CN (post administration latency) (pre-administration latency)] 0 MPE x 100 s pre-administration latency) 00 0 The rat tail flick test is described in F.E. D'Amour et al., "A Method for Determining Loss of Pain Sensation," J. Pharmacol. Exp. Ther. 72:74-79 (1941).

Acute pain can also be assessed by measuring the animal's response to noxious mechanical stimuli by determining the paw withdrawal threshold as described below.

Inflammatory Pain: To assess the actions of the Phenylene Compounds for the treatment or prevention of inflammatory pain, the Freund's complete adjuvant ("FCA") model of inflammatory pain is used. FCA-induced inflammation of the rat hind paw is associated with the development of persistent inflammatory mechanical hyperalgesia and provides reliable prediction of the anti-hyperalgesic action of clinically useful analgesic drugs Bartho et al., "Involvement of Capsaicin-sensitive Neurones in Hyperalgesia and Enhanced Opioid Antinociception in Inflammation," Naunyn-Schmiedeberg's Archives ofPharmacol. 342:666-670 (1990)). The left hind paw of each animal is administered a 50 IpL intraplantar injection of 50% FCA. 24 hour post injection, the animal is assessed for response to noxious mechanical stimuli by determining the PWT, as described below. Rats are then administered a single injection of 1, 3, 10 or 30 mg/kg of either a Phenylene Compound; 30 mg/kg of a control selected from Celebrex, indomethacin or naproxen; or carrier. Responses to noxious mechanical stimuli are then determined 1, 3, 5 and 24 hours post administration. Percentage reversal of hyperalgesia for each animal is defined as: -146- 00 (post administration PWT) (pre-administration PWT) 0 Reversal x 100 (baseline PWT) (pre-administration PWT) O Neuropathic Pain: To assess the actions of the Phenylene Compounds for the treatment or prevention of neuropathic pain, either the Seltzer model or the Chung model C. can be used.

In the Seltzer model, the partial sciatic nerve ligation model of neuropathic pain 00 10 is used to produce neuropathic hyperalgesia in rats Seltzer et al., "A Novel Behavioral Model of Neuropathic Pain Disorders Produced in Rats by Partial Sciatic Nerve Injury," Pain 43:205-218 (1990)). Partial ligation of the left sciatic nerve is performed under isoflurane/0 2 inhalation anaesthesia. Following induction of anesthesia, the left thigh of the rat is shaved and the sciatic nerve exposed at high thigh level through a small incision and is carefully cleared of surrounding connective tissues at a site near the trocanther just distal to the point at which the posterior biceps semitendinosus nerve branches off of the common sciatic nerve. A 7-0 silk suture is inserted into the nerve with a 3/8 curved, reversed-cutting mini-needle and tightly ligated so that the dorsal 1/3 to /2 of the nerve thickness is held within the ligature. The wound is closed with a single muscle suture (4-0 nylon (Vicryl)) and vetbond tissue glue.

Following surgery, the wound area is dusted with antibiotic powder. Sham-treated rats undergo an identical surgical procedure except that the sciatic nerve is not manipulated.

Following surgery, animals are weighed and placed on a warm pad until they recover from anesthesia. Animals are then returned to their home cages until behavioral testing begins. The animal is assessed for response to noxious mechanical stimuli by determining PWT, as described below, prior to surgery (baseline), then immediately prior to and 1, 3, and 5 hours after drug administration for rear paw of the animal.

Percentage reversal of neuropathic hyperalgesia is defined as: -147- 00 (post administration PWT) (pre-administration PWT)

O

0% Reversal x 100 S[ (baseline PWT) (pre-administration PWT) In the Chung model, the spinal nerve ligation model of neuropathic pain is used to Cc< produce mechanical hyperalgesia, thermal hyperalgesia and tactile allodynia in rats.

SSurgery is performed under isoflurane/O2 inhalation anaesthesia. Following induction of Sanaesthesia, a 3 cm incision is made and the left paraspinal muscles are separated from 00 the spinous process at the L 4

S

2 levels. The Lg transverse process is carefully removed O 10 with a pair of small rongeurs to identify visually the L 4

L

6 spinal nerves. The left L 5 (or

L

5 and L 6 spinal nerve(s) is isolated and tightly ligated with silk thread. A complete hemostasis is confirmed and the wound is sutured using non-absorbable sutures, such as nylon sutures or stainless steel staples. Sham-treated rats undergo an identical surgical procedure except that the spinal nerve(s) is not manipulated. Following surgery animals are weighed, administered a subcutaneous injection of saline or ringers lactate, the wound area is dusted with antibiotic powder and they are kept on a warm pad until they recover from the anesthesia. Animals are then returned to their home cages until behavioral testing begins. The animals are assessed for response to noxious mechanical stimuli by determining PWT, as described below, prior to surgery (baseline), then immediately prior to and 1, 3, and 5 hours after being administered a Phenylene Compound for the left rear paw of the animal. The animal can also be assessed for response to noxious thermal stimuli or for tactile allodynia, as described below. The Chung model for neuropathic pain is described in S.H. Kim, "An Experimental Model for Peripheral Neuropathy Produced by Segmental Spinal Nerve Ligation in the Rat," Pain 50(3):355-363 (1992).

Response to Mechanical Stimuli as an Assessment of Mechanical Hyperalgesia: The paw pressure assay can be used to assess mechanical hyperalgesia. For this assay, hind paw withdrawal thresholds (PWT) to a noxious mechanical stimulus are determined using an analgesymeter (Model 7200, commercially available from Ugo Basile of Italy) as described in C. Stein, "Unilateral Inflammation of the Hindpaw in Rats as a Model of Prolonged Noxious Stimulation: Alterations in Behavior and Nociceptive Thresholds," Pharmacol. Biochem. and Behavior 31:451-455 (1988). The maximum weight that can -148- 0 be applied to the hind paw is set at 250 g and the end point is taken as complete withdrawal of the paw. PWT is determined once for each rat at each time point and only the affected (ipsilateral) paw is tested.

Response to Thermal Stimuli as an Assessment of Thermal Hvperalgesia: The 0 5 plantar test can be used to assess thermal hyperalgesia. For this test, hind paw withdrawal latencies to a noxious thermal stimulus are determined using a plantar test apparatus (commercially available from Ugo Basile of Italy) following the technique C described by K. Hargreaves et al., "A New and Sensitive Method for Measuring Thermal C Nociception in Cutaneous Hyperalgesia," Pain 32(1):77-88 (1988). The maximum 00 0 10 exposure time is set at 32 seconds to avoid tissue damage and any directed paw C, withdrawal from the heat source is taken as the end point. Three latencies are determined at each time point and averaged. Only the affected (ipsilateral) paw is tested.

Assessment of Tactile Allodynia: To assess tactile allodynia, rats are placed in clear, plexiglass compartments with a wire mesh floor and allowed to habituate for a period of at least 15 minutes. After habituation, a series of von Frey monofilaments are presented to the plantar surface of the left (operated) foot of each rat. The series of von Frey monofilaments consists of six monofilaments of increasing diameter, with the smallest diameter fiber presented first. Five trials are conducted with each filament with each trial separated by approximately 2 minutes. Each presentation lasts for a period of 4-8 seconds or until a nociceptive withdrawal behavior is observed. Flinching, paw withdrawal or licking of the paw are considered nociceptive behavioral responses.

5.8 Example 8: In Vivo Assays for Prevention or Treatment of Anxiety The elevated plus maze test or the shock-probe burying test can be used to assess the anxiolytic activity of Phenylene Compounds in rats or mice.

The Elevated Plus Maze Test: The elevated plus maze consists of a platform with 4 arms, two open and two closed (50 x 10 x 50 cm enclosed with an open roof).

Rats (or mice) are placed in the center of the platform, at the crossroad of the 4 arms, facing one of the closed arms. Time spent in the open arms vs the closed arms and number of open arm entries during the testing period are recorded. This test is conducted prior to drug administration and again after drug administration. Test results are expressed as the mean time spent in open arms and the mean number of entries into open -149- 00 arms. Known anxiolytic drugs increase both the time spent in open arms and number of 0 Sopen arm entries. The elevated plus maze test is described in D. Treit, "Animal Models for the Study of Anti-anxiety Agents: A Review," Neuroscience Biobehavioral Reviews 9(2):203-222 (1985).

5 The Shock-Probe Burying Test: For the shock-probe burying test the testing apparatus consists of a plexiglass box measuring 40 x 30 x 40 cm, evenly covered with approximately 5 cm of bedding material (odor absorbent kitty litter) with a small hole in Sone end through which a shock probe (6.5 cm long and 0.5 cm in diameter) is inserted.

SThe plexiglass shock probe is helically wrapped with two copper wires through which an 00 10 electric current is administered. The current is set at 2 mA. Rats are habituated to the Stesting apparatus for 30 min on 4 consecutive days without the shock probe in the box.

On test day, rats are placed in one corner of the test chamber following drug administration. The probe is not electrified until the rat touches it with its snout or fore paws, at which point the rat receives a brief 2 mA shock. The 15 min testing period begins once the rat receives its first shock and the probe remains electrified for the remainder of the testing period. The shock elicits burying behavior by the rat.

Following the first shock, the duration of time the rat spends spraying bedding material toward or over the probe with its snout or fore paws (burying behavior) is measured as well as the number of contact-induced shocks the rat receives from the probe. Known anxiolytic drugs reduce the amount of burying behavior. In addition, an index of the rat's reactivity to each shock is scored on a 4 point scale. The total time spent immobile during the 15 min testing period is used as an index of general activity. The shock-probe burying test is described in D. Treit, 1985, supra.

5.9 Example 9: In Vivo Assays for Prevention or Treatment of an Addictive Disorder The conditioned place preference test or drug self-administration test can be used to assess the ability of Phenylene Compounds to attenuate the rewarding properties of known drugs of abuse.

The Conditioned Place Preference Test: The apparatus for the conditioned place preference test consists of two large compartments (45 x 45 x 30 cm) made of wood with a plexiglass front wall. These two large compartments are distinctly different. Doors at the back of each large compartment lead to a smaller box (36 x 18 x 20 cm) made of -150- 00 Swood, painted grey, with a ceiling of wire mesh. The two large compartments differ in I terms of shading (white vs black), level of illumination (the plexiglass door of the white ct compartment is covered with aluminum foil except for a window of 7 x 7 cm), texture (the white compartment has a 3 cm thick floor board (40 x 40 cm) with nine equally C 5 spaced 5 cm diameter holes and the black has a wire mesh floor), and olfactory cues (saline in the white compartment and 1 mL of 10% acetic acid in the black compartment). On habituation and testing days, the doors to the small box remain open, giving the rat free access to both large compartments.

The first session that a rat is placed in the apparatus is a habituation session and 00oO entrances to the smaller grey compartment remain open giving the rat free access to both large compartments. During habituation, rats generally show no preference for either compartment. Following habituation, rats are given 6 conditioning sessions. Rats are divided into 4 groups: carrier pre-treatment carrier (control group), Phenylene Compound pre-treatment carrier, carrier pre-treatment morphine, Phenylene Compound pre-treatment morphine. During each conditioning session the rat is injected with one of the drug combinations and confined to one compartment for 30 min.

On the following day, the rat receives a carrier carrier treatment and is confined to the other large compartment. Each rat receives three conditioning sessions consisting of 3 drug combination-compartment and 3 carrier-compartment pairings. The order of injections and the drug/compartment pairings are counterbalanced within groups. On the test day, rats are injected prior to testing (30 min to 1 hour) with either morphine or carrier and the rat is placed in the apparatus, the doors to the grey compartment remain open and the rat is allowed to explore the entire apparatus for 20 min. The time spent in each compartment is recorded. Known drugs of abuse increase the time spent in the drug-paired compartment during the testing session. If the Phenylene Compound blocks or reduces the acquisition of morphine conditioned place preference (reward), there will be no difference or less of a difference in time spent in each side in rats pre-treated with a Phenylene Compound and the group will not be different from the group of rats that was given carrier carrier in both compartments. Data will be analyzed as time spent in each compartment (drug combination-paired vs carrier-paired). Generally, the experiment is repeated with a minimum of 3 doses of a Phenylene Compound.

151- 0 The Drug Self-Administration Test: The apparatus for the drug self- Cadministration test is a standard commercially available operant conditioning chamber.

Before drug trials begin rats are trained to press a lever for a food reward. After stable lever pressing behavior is acquired, rats are tested for acquisition of lever pressing for drug reward. Rats are implanted with chronically indwelling jugular catheters for i.v.

administration of compounds and are allowed to recover for 7 days before training c begins. Experimental sessions are conducted daily for 5 days in 3 hour sessions. Rats Sare trained to self-administer a known drug of abuse, such as morphine. Rats are then Spresented with two levers, an "active" lever and an "inactive" lever. Pressing of the 0 10 active lever results in drug infusion on a fixed ratio 1 (FR1) schedule one lever 0 press gives an infusion) followed by a 20 second time out period (signaled by illumination of a light above the levers). Pressing of the inactive lever results in infusion of excipient. Training continues until the total number of morphine infusions stabilizes to within 10% per session. Trained rats are then used to evaluate the effect of Phenylene Compounds pre-treatment on drug self-administration. On test day, rats are pre-treated with a Phenylene Compound or excipient and then are allowed to selfadminister drug as usual. If the Phenylene Compound blocks or reduces the rewarding effects of morphine, rats pre-treated with the Phenylene Compound will show a lower rate of responding compared to their previous rate of responding and compared to excipient pre-treated rats. Data are analyzed as the change in number of drug infusions per testing session (number of infusions during test session number of infusions during training session).

5.10 Example 10: Functional Assay for Characterizing mGluR1 Antagonistic Properties Functional assays for the characterization of mGluR 1 antagonistic properties are known in the art. For example, the following procedure can be used.

A CHO-rat mGluR1 cell line is generated using cDNA encoding rat mGluR1 receptor Masu and S. Nakanishi, Nature 349: 760-765 (1991)). The cDNA encoding rat mGluR1 receptor can be obtained from, Prof. S. Nakanishi (Kyoto, Japan).

40,000 CHO-rat mGluR1 cells/well are plated into a Costar 3409, black, clear bottom, 96 well, tissue culture treated plate (commercially available from Fisher -152- 00 0 Scientific of Chicago, IL) and are incubated in Dulbecco's Modified Eagle's Medium 0 C (DMEM, pH 7.4) supplemented with glutamine, 10% FBS, 1% Pen/Strep, and 500 c pg/mL Geneticin for about 12 h. The CHO-rat mGluR1 cells are then washed and treated with Optimem medium (commercially available from Invitrogen, Carlsbad, CA) and incubated for a time period ranging from 1 to 4 hours prior to loading the cells with the dye Fluo-4. After incubation, the cell plates are washed with loading buffer (127 r n mM NaCi, 5 mM KC1, 2 mM MgC12, 700 pM, NaH 2

PO

4 2 mM CaCl 2 5 mMNaHCO 3 8 mM HEPES, and 10 mM glucose, pH 7.4) and incubated with 3 VM Fluo-4 in 0.1 mL Sloading buffer for 90 min. The cells are then washed twice with 0.2 mL loading buffer, 00 10 resuspended in 0.1 mL of loading buffer, and transferred to a FLIPR for measurement of 1 calcium mobilization flux in the presence of glutamate and in the presence or absence of a Phenylene Compound.

To measure calcium mobilization flux, fluoresence is monitored for about 15 s to establish a baseline and DMSO solutions containing various concentrations of a Phenylene Compound ranging from about 50 pM to about 0.8 nM diluted in loading buffer (0.05 mL of a 4X dilution) are added to the cell plate and fluoresence is monitored for about 2 min. 0.05 mL of a 4X Glutamate solution (agonist) is then added to each well to provide a final glutamate concentration in each well of 10 pM and fluoresence is monitored for about 1 additional min. The final DMSO concentration in the assay is 1%.

In each experiment fluoresence is monitored as a function of time and the data is analyzed using a non-linear regression to determine the IC 5 o value. In each expereiment each data point is determined twice.

5.11 Example 11: Binding of Phenylene Compounds to VR1 Methods for assaying compounds capable of inhibiting VR1 are known to those skilled in the art, for example, those methods disclosed in U.S. Patent No. 6,239,267 to Duckworth et al.; U.S. Patent No. 6,406,908 to McIntyre et al.; or U.S. Patent No.

6,335,180 to Julius et al.

Binding of Compound E35 to VR1: Assay Protocol Human VR1 Cloning: Human spinal cord RNA (commercially available from Clontech, Palo Alto, CA) was used. Reverse transcription was conducted on 1.0 jig total -153- 00 SRNA using Thermoscript Reverse Transcriptase (commercially available from Cl Invitrogen) and oligo dT primers as detailed in its product description. Reverse j transcription reactions were incubated at 55 0 C for 1 h, heat-inactivated at 85 0 C for min, and RNase H-treated at 37 0 C for 20 min.

O 5 Human VR1 cDNA sequence was obtained by comparison of the human genomic sequence, prior to annotation, to the published rat sequence. Intron sequences were CI removed and flanking exonic sequences were joined to generate the hypothetical human CI cDNA. Primers flanking the coding region of human VR1 were designed as follows: C forward primer, GAAGATCTTCGCTGGTTGCACACTGGGCCACA; and reverse 00 primer, GAAGATCTTCGGGGACAGTGACGGTTGGATGT.

PCR of VRI was performed on one tenth of the Reverse transcription reaction mixture using Expand Long Template Polymerase and Expand Buffer 2 in a final volume of 50 tpL according to the manufacturer's instructions (Roche Applied Sciences, Indianapolis, IN). After denaturation at 94°C for 2 min, PCR amplification was performed for 25 cycles at 94 0 C for 15 sec, 58°C for 30 sec, and 68 0 C for 3 min followed by a final incubation at 72 0 C for 7 min to complete the amplification. A PCR product of -2.8 kb was gel-isolated using a 1.0% agarose, Tris-Acetate gel containing 1.6 pg/mL of crystal violet and purified with a S.N.A.P. UV-Free Gel Purification Kit (commercially available from Invitrogen). The VR1 PCR product was cloned into the pIND/V5-His-TOPO vector (commercially available from Invitrogen) according to the manufacturer's instructions. DNA preparations, restriction enzyme digestions, and preliminary DNA sequencing were performed according to standard protocols. Fulllength sequencing confirmed the identity of the human VR1.

Generation of Inducible Cell Lines: Unless noted otherwise, cell culture reagents were purchased from Life Technologies of Rockville, MD. HEK 293-EcR cells expressing the ecdysone receptor (commercially available from Invitrogen) were cultured in Growth Medium (Dulbecco's Modified Eagles Medium containing 10% fetal bovine serum (commercially available from HYCLONE, Logan, UT), lx penicillin/streptomycin, Ix glutamine, 1 mM sodium pyruvate and 400 pg/mL Zeocin (commercially available from Invitrogen)). The VRl-pIND constructs were transfected into the HEK293-EcR cell line using Fugene transfection reagent (commercially available from Roche Applied Sciences, Basel, Switzerland). After 48 h, cells were -154- 00 transferred to Selection Medium (Growth Medium containing 300 pg/mL G418 (commercially available from Invitrogen)). Approximately 3 weeks later, individual S Zeocin/G418 resistant colonies were isolated and expanded. To identify functional Sclones, multiple colonies were plated into 96-well plates and expression was induced for S 5 48 h using Selection Medium supplemented with 5 pM ponasterone A ("PonA") (commercially available from Invitrogen). On the day of assay, cells were loaded with C Fluo-4 (a calcium-sensitive dye that is commercially available from Molecular Probes) O and CAP-mediated calcium influx was measured using a FLIPR as described below.

O Functional clones were re-assayed, expanded, and cryopreserved.

00 0 10 pH-Based Assay: Two days prior to performing this assay, cells were seeded on CN poly-D-lysine-coated 96-well clear-bottom black plates (commercially available from Becton-Dickinson) at 75,000 cells/well in growth media containing 5 jtM PonA to induce expression. On the day of the assay, the plates were washed with 0.2 mL lx Hank's Balanced Salt Solution (commercially available from Life Technologies) containing 1.6 mM CaCl 2 and 20 mM HEPES, pH 7.4 ("wash buffer"), and loaded using 0.1 mL of wash buffer containing Fluo-4 (3 IM final concentration, commercially available from Molecular Probes). After 1 h, the cells were washed twice with 0.2 mL wash buffer and resuspended in 0.05 mL Ix Hank's Balanced Salt Solution containing mM CaC1 2 and 10 mM Citrate, pH 7.4 ("assay buffer"). Plates were then transferred to a FLIPR for assay. Compound E35 was diluted in assay buffer, and 50 mL of the resultant solution were added to the cell plates and the solution monitored for two minutes. The final concentration of Compound E35 ranged from about 50 pM to about 3 gM. Agonist buffer (wash buffer titrated with 1N HCI to provide a solution having a pH of 5.5 when mixed 1:1 with assay buffer) (0.1 mL) was then added to each well, and the plates were incubated for 1 additional minute. Data were collected over the entire time course and analyzed using Excel and Graph Pad Prism. Compound E35 when assayed according to this protocol had an IC 5 0 of 11.2 5.5 nM Capsaicin-Based Assay: Two days prior to performing this assay, cells were seeded in poly-D-lysine-coated 96-well clear-bottom black plates (50,000 cells/well) in growth media containing 5 jM PonA to induce expression. On the day of the assay, the plates were washed with 0.2 mL Ix Hank's Balanced Salt Solution containing 1 mM CaCl 2 and 20 mM HEPES, pH 7.4, and cells were loaded using 0.1 mL of wash buffer -155- 00 0 containing Fluo-4 (3 tM final). After one hour, the cells were washed twice with 0.2 mL C1 of wash buffer and resuspended in 0.1 mL of wash buffer. The plates were transferred to a FLIPR for assay. 50 gL of Compound E35 diluted with assay buffer were added to the cell plates and incubated for 2 min. The final concentration of Compound E35 ranged from about 50 pM to about 3 pM. Human VR1 was activated by the addition of 50 pL of capsaicin (400 nM), and the plates were incubated for an additional 3 min. Data were c collected over the entire time course and analyzed using Excel and GraphPad Prism.

SCompound E35 when assayed according to this protocol had an IC 50 of 128.1 26 nM S(n=4).

00 0 10 The results of the pH-based assay and the capsaicin-based assay demonstrate that CI Compound E35, an illustrative Phenylene Compound, binds to and modulates the activity of human VR1 and accordingly is useful for treating or preventing pain, UI, an ulcer, IBD or IBS in an animal.

The present invention is not to be limited in scope by the specific embodiments disclosed in the examples which are intended as illustrations of a few aspects of the invention and any embodiments that are functionally equivalent are within the scope of this invention. Indeed, various modifications of the invention in addition to those shown and described herein will become apparent to those skilled in the art and are intended to fall within the scope of the appended claims.

A number of references have been cited, the entire disclosures of which are incorporated herein by reference.

-156-

Claims (58)

1. A pound of formula: Arl NH t 2 (I) acceptable salt thereof, wherein: or a (R 2) P\XN (R 2 )p\N N-S I II I Rj AN R1 NR1 I I or ,or Xis( R, is each or S; -halo, -CH 3 C(halo) 3 -CH(haloh2, or -CH 2 (halo); Z2 is independently: -halo, -OH, -Nil 2 -CN, or -NO 2 -(C 1 -Clo)alkyl, -(C 2 -C IO)alkenyl, -(C 2 -Clo)alkynyl, -(C 3 C 1 4)bicycloaLlcyl, -(C8-C 14 )tricycloaLkyl, -(C 5 -C 1 o)cycloalkenyl, CIO)cycloallcyl, -(C 8 -157- 00-(C8-Cl 4 )bicycloa eY1, -(C 8 -C 14 )tiCYCloalkenyl, to 7-membered)heterocycle, or to 1-membered bicycloheterocycle, each of which is unsubstituted or substituted with one or more R 5 roups; or -phenyl, -naphthyl, -(C14)aryl or to r> 5 membered)heteroaryl, each of which is unsubstituted or substituted with one or more R 6 groups; each R 3 is independently: -halo, -CN, -OH, -NO 2 or -NH 2 I-Clo)alkyl, -(C 2 -C IO)alkenYl, -(C 2 -C io)alkynyl, -(C 3 00 10 C 1 O)cycloalkyl, -(C8-C 14 )bicycloalkyl, -(C 8 -C 1 4)tricycloalkyl, -(C 5 -C 1 o)cycloalkenyl, -(CS-C 14 )bicycloalkejiyl, (C8-C 14 )tricycloalkenyl, to 7-membered)heterocycle, or to 10-membered)bic cloheterocycle, each of which is unsubstituted or substituted with one or more R 5 grou~; or -phenyl, -naphthyl, -(C 14 )aryl or to lO-membered) heteroaryl, each of which is unsubstituted or substituted with one or more R 6 groups; each I It 5 is independently -CN, -OH, -(CI-C 6 )alkyl, -(C 2 -C 6 )alkenyl, -halo, -N 3 -NO 2 -N(R 7 2 -CH=NR 7 -NR 7 OH, -OR 7 -C(O)OR7, -OC(O)R, -OC(O)0R7, -SR7, or -S(O) 2 R7; each R 6 is independently -(Cl-C 6 )alkYl, -(C 2 -C 6 )alkenyl, -(C 2 -C 6 )alkynyl, -(C 3 C8)cycloalkyl, -(C5-C8)cycloalkenyl, -phenyl, to 5-membered)heterocycle, C(halo) 3 -CH(halo) 2 I -CH 2 (halo), -CN, -OH, -halo, -N 3 -NO 2 2 -CH=NR7, -NR7OH, -OR 7 -COR,. -C(O)0R 7 -OC(O)R7, -OC(O)0R7, -SR7, -S(O)R7, or -S(O) 2 R7; each 7 is independently -(CI-C 6 )alkYl, -(C 2 -C 6 )alkenyl, -(C 2 C 6 )atkynyl, -(C 3 -C 8 )(.ycloalkyl, -(C5-C8)cycloallcenyl, -phenyl, to membered)heterocy le, -C(halO) 3 -CH(halo) 2 or CH 2 (halo); each R 8 is independently I-C 6 )alkyl, -(C 2 -C 6 )alkenyl, -(C 2 -C 6 )allcynll -(C 3 -C8)cycloatkyl, -(C5-C 8 )cycloalkenyl, -phenyl, -C(halo) 3 -CH(halo) 2 -CH 2 (halo), -CN, -OH, -halo, -N. 3 -NO 2 2 -CH=NR7, -NRO0H, -C(O)OR, -OC(O)R7, -OC(0)0 7, -S(O)R7, or -S(O) 2 R7; each 1 is independently I-C 6 )alkyl, -(C 2 -C 6 )alkenyl, -(C 2 -C 6 )allcynyl, (C 3 -C8)cycloalkyl, -(Cs5-C)cycloalkenyl, -phenyl, -C(halo) 3 -CH(halo) 2 -CH 2 (halo), -CN, -OH, -halo, -N 3 -NO 2 -CH=NR7, -NR',OH, -OR7, -C(O)OR, -OC(O)R7, -OC(O)OR7, -SR7, or -S(O) 2 R,; each halo is independently -Cl, -Br, or -1; -158- 00 m is a o is aE p is ar q is ar r is an s is an

2. The c( Arl is Ar 2 is Xis R is m is 0 p is O risO.

3. The c Arl is 1 integer ranging from 0 to 4; integer ranging from 0 to 4; integer ranging from 0 to 2; integer ranging from 0 to 6; integer ranging from 0 to 5; and integer ranging from 0 to 4. impound of claim 1, wherein: CH 3 I; and ampound of claim 1, wherein: (R 2 )p N RI %/XvN -159- 00 00 Ar 2 is X isC R, is mis( p is 0 r is 1; R8 is

4. The c Theec 4-position of Ar 2

6. The c Ar 1 is Ar 2 h wV-LA -(R 8 )r CH 3 and (C 1 -C 6 )alklcyl )mpound of claim 3, wherein the -(CI-C 6 )alkyl is a tert-butyl group. )mpound of claim 4, wherein the -(CI-C 6 )alkyl is substituited at the )mpound of claim 1, wherein: (RO) Nt RIi X is(4 R, is -CH 3 -160- 00 00 misC p isO: r isi1; R8 is

7. The c Ar, is Ar 2 is and CF 3 )mpound of claim 1, wherein: (R2u, N s (RB)a (R8)b Gil 3 -CF 3 -Cl, -Br, or -F; .s and Is -CH 3 -CF 3 -OCH 2 CH 3 tert-butyl, -Cl, -Br, or -F. )mpound of claim 7, wherein R, is -Gil 3 and (R8)b is -Cl. )mpound of claim 7, wherein R, is -CH 3 and (R8)b is -F. )mpound of claim 7, wherein R, is -Gil 3 and (R8)b is -CF 3 161 XisC R, is m isC p is 0 (R 8 (R8)b The c The c The c 00

11. The c' mpound of claim 7, wherein RI is -CH 3 and (R8)b is tert-butyl.

12. The c pudof claim 7, wherein R, is -CF 3 and (R8)b is -Cl. I7-

13. The c~mpound of claim 7, wherein R, is -CF 3 and (R8)b is -F.

14. The compound of claim 7, wherein R, is -CF 3 and (R8)b is -CF 3 00 10 15. The cimpound of claim 7, wherein R, is -CF 3 and (R8)b is tert-butyl.

16. The c mpound of claim 7, wherein RI is -CI and (RA~ is -Cl.

17. The compound of claim 7, wherein R, is -Cl and (R8) is -F.

18. The c mpound of claim 7, wherein R, is -CI and (R8) is -CF 3

19. The compound of claim 7, wherein R, is -Cl and (RA) is tert-butyl.

20. The compound of claim 1, wherein: Ar, is (R 2 )P Ar 2 is X is I -162- 00 00 R, is m is 0 p isO0; r isO0. CH 3 and )mpound of claim 1, wherein: 21. The c Ar, is Ar 2 is X is R, is m is p is 0 r is 1; R 8 is I L(CI-C 6 )all.

22. Th group.

23. Th 4-position of Ar 2

24. Th e ompound of claim 21, wherein the -(CI-C 6 )alkyl is a tert-butyl e compound of claim 22, wherein the 1 -C 6 )alkyl is substituted at the e dompound of claim 1, wherein: 163 00 Ar, is Ar 2 is UjVwfV 00 X isO0; R, is C 3 M is 0~ p isO0; r is 1;'and R 8 is -CF. The c mpound of claim 1, wherein: Ar 1 is Ar 2 is 164 00 (R 8 )a (R8)b X is U. 00 1 R 1 is -CH 3 -CF 3 -Cl, -Br, JI, or -F; -m misO;.. p isO0; (R 8 )a s-H; and (R8)b Is -CH 3 -CF 3 -OCH 2 CH 3 tert-butyl, -Cl, -Br, or -F.

26. The c mpound of claim 25, wherein R, is -CH 3 and (R8)b is -Cl-

27. The cr)mpound of claim 25, wherein R I is -CH 3 and (R8)b is -F.

28. The compound of claim 25, wherein R, is -CH 3 and (R 8 is -CF 3

29. The compound of claim 25, wherein R, is -CH 3 and (R8)b is tert-butyl. The compound of claim 25, wherein R, is -CF 3 and (R8)b is -Cl.

31. The cmpound of claim 25, wherein R, is -CF 3 and (R8)b is -F.

32. The compound of claim 25, wherein R, is -CF 3 and (Rg)b is -CF 3

33. The cmpound of claim 25, wherein R, is -CF 3 and (R8)b is tert-butyl.

34. The compound of claim 25, wherein R, is -Cl and (R8)b is -Cl. 165 00 00 The cc The cc The c The c( Ar 1 is Ar 2 is, mound of claim 25, wherein R, is -Cl and (R8)b is -F. mpound of claim 25, wherein R, is -Cl and (R8)b is -CF 3 mpound of claim 25, wherein R, is -Cl and (R8)b is tert-butyl. )mpound of claim 1, wherein: -(RB)r X is R, is FCH3; mis f; p is 0; and r isOI The compound of claim 1, wherein: Ar 1 is NN I N Ar 2 is -166- 00 (R 8 )r x isO0' R, is -CH 3 51 m isO01 00psO r is 1; and N R 8 is i-C 6 )alkyl.

40. The comon ofcaim 39, wherein the -(CI-G 6 )alcyl is a tert-butyl group.

41. The compound of claim 40, wherein the I-C 6 )alkyl is substituted at the 4-position of Ar 2

42. The compound of claim 1, wherein: Ar 1 is NN Ar 2 is X is O; R, is -Gil 3 -167- 00 00 m isO0; p isO0; ris 1; R 8 is

43. The cc Ar, is Ar2 is ind mpound of claim 1, wherein: (ROP) Niv~ X isO0 RI is m is 0 p isO0; (R 8 )a i (R8)b The cc The cc The cc ::H 3 -CF 3 -Cl, -Br, or -F; and -CH 3 -CF 3 -OCH 2 CH 3 tert-butyl, -Cl, -Br, or -F. impound of claim 43, wherein R, is -CH 3 and (R8)b is -Cl. impound of claim 43, wherein R, is -CH 3 and (R8)b is -F. impound of claim 43, wherein R, is -CH 3 and (R8)b is -CF 3 -168- 00

47. The cpound of claim 43, wherein R is -CH and(R)b is er-buyl. 47. The compound of claim 43, wherein R 1 is -CF 3 and (R8)b is tert-butyl. 5 49. The c mpound of claim 43, wherein R 1 is -CF 3 and (Rs)b is -F. The compound of claim 43, wherein R 1 is -CF 3 and (R)b is -CF 3 00 10 51. The c mpound of claim 43, wherein RI is -CF 3 and (R)b is tert-butyl.

52. The c mpound of claim 43, wherein R 1 is -CI and (R)b is -Cl.

53. The c mpound of claim 43, wherein R 1 is -CI and (R8)b is -F.

54. The c mpound of claim 43, wherein R 1 is -Cl and (R)b is -CF 3 The compound of claim 43, wherein RI is -Cl and (R8)b is tert-butyl. N

56. The compound of claim 4, wherein: N(S Ar 2 is S(Rs)r X is 1; R 1 is CH 3 -169- 00 m isO0; r isO0.

57. The cc Ar 1 is Ar 2 is and rnpound of claim 1, wherein: N R1 X isO0. R, is -CH 3 m is 0O1 r is 1; md R8 is -C]-C 6 )alkyl.

58. Th group.

59. Th 4-position of Ar 2 Th e compound of claim 57, wherein the I-C 6 )alkyl is a tert-butyl e compound of claim 58, wherein the -(CI-C 6 )alkyl is substituted at the e compound of claim 1, wherein: Ar, is -170- 00 NN R1 7 Ar 2 is X is Oj R, is -C-1 3 m isOil r is 1; L R 8 is -CF 3

61. The cc Ar 1 is mpound of claim 1, wherein: N-S\ Ar 2 is (R 8 )a' X is 0 R, is I-CH 3 -CF 3 -Cl, -Br, or -F; 171 oO mis 0; S(R 8 )a is and S(Rs)b is -CH 3 -CF 3 -OCH 2 CH 3 tert-butyl, -Cl, -Br, or -F. 5 62. The co pound of claim 61, wherein R 1 is -CH 3 and (RB)b is -Cl.

63. The copound of claim 61, wherein R is -CH and (R)b is -F 63. The co pound of claim 61, wherein R 1 is -CH 3 and (R8)b is -F

68. The compound of claim 61, wherein R 1 is -CF 3 and (RS)b is -CF 3

69. The compound of claim 61, wherein R 1 is -CF 3 and (RS)b is tert-butyl.

70. The compound of claim 61, wherein RI is -Cl and (R)b is -Cl. 71 6. The compound of claim 61, wherein R 1 is -C3 and (Rs)b is -F.

72. The compound of claim 61, wherein R 1 is -CF and (R)b is -CF 3 69. The c mpound of claim 61, wherein Ri is -CF and (Ra)b is tert-butyl. 70. The cc mpound of claim 61, wherein Ri is -Cl and (Ra)b is -Cl. 71. The cc mpound of claim 61, wherein RI is -Cl and (Ra)b is -F. 72. The compound of claim 61, wherein Ri is -Cl and (Ra)b is -CF3.

73. The compound of claim 61, wherein Ri is -Cl and (Ra)b is tert-butyl.

74. A con pound of formula: -172- 00 00 (II) acceptable salt thereof, wherein: or a pharmaceutically Ar 2 is NH L(8, 'R1 1)q .or XisO R, is each F or S; alo, -CH 3 -C(hao) 3 -CH(halo) 2 or -CH 2 (halo); .2 is independently: -halo, -OH, -NH 2 -CN, or -NO 2 -(CI-CIO)alkyl, -(C 2 -CIO)alkenYl, -(C 2 -Clo)alkynyl, -(C 3 71 4 )bicycloalkyl, -(C 8 -C 1 4 tricycloalkyl, -(C 5 -C 1 )cycloalkenyl, LYl, -(C 8 -C 14 )tricycloalkenyl, to 7-memberedfheterocycle, or CIo)cycloalkyl, -(Cs-I -(C 8 -C i 4 )bicycloalkei 173 00 to 1O-membered) icycloheterocycle, each of which is unsubstituted or substituted with one or more R 5 goups; or -phenyl, -naphthyl, 1 4)aryl or to membered)heteroaryl, each of which is unsubstituted or substituted with one or more R 6 5 groups; each R' is independently -CN, -OH, -(Cl-C 6 )alcyl, -(C 2 -C 6 )alkenyl, -halo, -N 3 -NO 2 -N(R 7 2 -c H=NR 7 -NR 7 OH, -OR 7 -COR 7 -C(O)0R 7 -OC(O)R 7 -OC(O)OR 7 -SR 7 -S)Ro -S(O) 2 R 7 each R is independently -(CI-C 6 )alkyl, -(C 2 -C 6 )alkenyl, -(C 2 -C 6 )alkynyl, 00 10 -(C 3 C8)cycloalkyl, 5 -CsOCYCloalkenyl, -phenyl, to -C(halo) 3 -CH(halo) 2 -CH 2 (halo), -CN, -OH, -halo, -N 3 -NO 2 N(R 7 2 -CH=NR 7 -NR 7 OH, -OR 7 -COl 7 -C(O)OR 1 -SR 7 -S(O)R 7 or S027 each R7is independently -(CI-C 6 )alkyl, -(C 2 -C 6 )atkenyl, -(C 2 C 6 )allcYnyl, -(C 3 -Cg)C'vcloalky1, -(Cs-C8)cycloalkenyl, -phenyl, to membered)heterocycl, -C(halo) 3 -CH(haloh2, or C11 2 (halo); each RLis independently -(CI-C 6 )alkyl, -(C 2 -C 6 )alkenyl, -(C 2 -C 6 )allcynyl, -(C 3 -C8)cycloalkyl, 5 -C8 cyc oalkenyl, -phenyl, -C(halo) 3 -CH(halo) 2 -CH 2 (halo), -CN, -OH, -halo, -N 3 -NO 2 -N(R 7 2 -CH=NR 7 -NR 7 OH, -OR 7 -COR 7 -C(O)0R 7 -OC(O)R 7 -OC(O)OI 7 -SR 7 -S(O)R 7 or -S(O) 2 R 7 each RIis independently -(CI-C 6 )alkyl, -(C 2 -C 6 )alkenyl, -(C 2 -C 6 )alkynyl, (C 3 -C8)cycloalkyl, 5 -C8)cycloalkenyl, -phenyl, -C(halo) 3 -CH(halo) 2 -CH 2 (halo), -CN, -OH, -halo, -N 3 -NO 2 -N(R 7 2 -CH=NR 7 -NR 7 OH, -OR 7 -COR 7 -C(O)0R 7 -OC(O)R 7 -SR 7 -S(O)R 7 or -S(O) 2 R 7 each h ilo is independently -Cl, -Br, or -1; n is an integer ranging from 0 to 3; o is an integer ranging from 0 to 4; q is an integer ranging from 0 to 6; r is an integer ranging from 0 to 5; and s is an integer ranging from 0 to 4. The compound of claim 74, wherein: Ar2 is -174- 00 X is 0; R, is 'CH 3 n is 0; and r isO0. The c mpound of claim 74, wherein: Ar 2 isI X is R, is -,C13; n is 0 r is 1;1Iand R 8 is }(CI-C 6 )alkYl.

77. Th group.

78. Tb 4-position of Ar 2

79. Th ecpmpound of claim 76, wherein the I-C 6 )allcyl is a tert-butyl ecompound of claim 77, wherein the -(CI-C 6 )alkyl is substituted at the e d~ompound of claim 74, wherein: Ar 2 i -175- 00 00 X isO0 R, is n isO0; r is 1;; R 8 is The co Ar 2 is md LF 3 mpond f caim 74, wherein: 0- (R 8 8 (R8)b CH 3 -CF 3 -Cl, -Br, or -F; and s -Gil 3 -CF 3 -OCH 2 CH 3 tert-butyl, -Cl, -Br, or -F. mpound of claim 80, wherein R, is -Gil 3 and (R8)b is -Cl. mpound of claim 80, wherein R, is -Gil 3 and (R8)b is -F. ompound of claim 80, wherein R, is -GH 3 and (R8)b is -CF 3 X isOC R, is n isO0; (R 8 )a i (R8)b The c( The c( The c( -176- 00 O O Cc, O O O 0 m~ oo 0 (N 0~ The compound of claim 80, wherein R 1 is -CH 3 and (R8)b is tert-butyl. The co pound of claim 80, wherein R 1 is -CF 3 and (Rs)b is -Cl. The co npound of claim 80, wherein Ri is -CF 3 and (Rs)b is -F. The co npound of claim 80, wherein R 1 is -CF 3 and (R8)b is -CF 3 The compound of claim 80, wherein R 1 is -CF 3 and (Rs)b is tert-butyl. The compound of claim 80, wherein R 1 is -Cl and (R8)b is -Cl. The compound of claim 80, wherein Ri is -Cl and (RS)b is -F. The compound of claim 80, wherein RI is -Cl and (Rs)b is -CF 3

92. The cc

93. A cor pharmaceutically acc pharmaceutically acc

94. A met animal in need therec acceptable salt of the mpound of claim 80, wherein R 1 is -Cl and (Rs)b is tert-butyl. iposition comprising an effective amount of the compound or a Sptable salt of the compound of claim 1 or 74 and a eptable acceptable carrier or excipient. hod for treating pain in an animal, comprising administering to an f an effective amount of the compound or a pharmaceutically compound of claim 1 or 74. A met od for treating urinary incontinence in an animal, comprising administering to an animal in need thereof an effective amount of the compound or a pharmaceutically acceptable salt of the compound of claim 1 or 74.

96. A method for treating an ulcer in an animal, comprising administering to an animal in need th reof an effective amount of the compound or a pharmaceutically acceptable salt of the compound of claim 1 or 74. -177- 00 O O OO O O (-N o? 1^ 0 m-

97. A meth administering to an an pharmaceutically acce

98. A metl 5 comprising administel compound or a pharm od for treating irritable-bowel syndrome in an animal, comprising imal in need thereof an effective amount of the compound or a ptable salt of the compound of claim 1 or 74. od for treating inflammatory-bowel disease in an animal, ing to an animal in need thereof an effective amount of the iceutically acceptable salt of the compound of claim 1 or 74.

99. A method for inhibiting VR1 function in a cell, comprising contacting a cell capable of expres ing VR1 with an effective amount of the compound or a pharmaceutically acceptable salt of the compound of claim 1 or 74.

100. A kit comprising a container containing am effective amount of the compound or a pharmaceutically acceptable salt of the compound of claim 1 or 74.

101. Ametlh compound or a pharm pharmaceutically acce od for preparing a composition, comprising the step of admixing a iceutically acceptable salt of the compound of claim 1 or 74 and a ptable carrier or excipient. -178-