AU2008200910A1 - Methods for producing hyaluronan in a recombinant host cell - Google Patents

Description

S&F Ref: 678831D1

AUSTRALIA

PATENTS ACT 1990 COMPLETE SPECIFICATION FOR A STANDARD PATENT Name and Address of Applicant: Actual Inventor(s): Address for Service: Invention Title: Novozymes Biopolymer A/S, of Krogshoejvej 36, DK- 2880, Bagsvaerd, Denmark SRegine Behr Stephen Brown Alan Sloma David Sternberg Maria Tang William Widner Spruson Ferguson St Martins Tower Level 31 Market Street Sydney NSW 2000 (CCN 3710000177) Methods for producing hyaluronan in a recombinant host cell The following statement is a full description of this invention, including the best method of performing it known to me/us: 5845c(1145838_1) 00

O

O

METHODS FOR PRODUCING HYALURONAN IN A RECOMBINANT HOST CELL Background of the Invention Field of the Invention C The present invention relates to methods for producing a hyaluronan in a recombinant host cell.

Description of the Related Art The most abundant heteropolysaccharides of the body are the glycosaminoglycans. Glycosaminoglycans are unbranched carbohydrate polymers, is consisting of repeating disaccharide units (only keratan sulphate is branched in the core region of the carbohydrate). The disaccharide units generally comprise, as a first saccharide unit, one of two modified sugars N-acetylgalactosamine (GalNAc) or Nacetylglucosamine (GlcNAc). The second unit is usually an uronic acid, such as glucuronic acid (GIcUA) or iduronate.

Glycosaminoglycans are negatively charged molecules, and have an extended conformation that imparts high viscosity when in solution. Glycosaminoglycans are located primarily on the surface of cells or in the extracellular matrix.

Glycosaminoglycans also have low compressibility in solution and, as a result, are ideal as a physiological lubricating fluid, joints. The rigidity of glycosaminoglycans provides structural integrity to cells and provides passageways between cells, allowing for cell migration. The glycosaminoglycans of highest physiological importance are hyaluronan, chondroitin sulfate, heparin, heparan sulfate, dermatan sulfate, and keratan sulfate. Most glycosaminoglycans bind covalently to a proteoglycan core protein through specific oligosaccharide structures. Hyaluronan forms large aggregates with certain proteoglycans, but is an exception as free carbohydrate chains form noncovalent complexes with proteoglycans.

Numerous roles of hyaluronan in the body have been identified (see, Laurent T.

C. and Fraser J. R. 1992, FASEB J. 6: 2397-2404; and Toole 1991, "Proteoglycans and hyaluronan in morphogenesis and differentiation." In: Cell Biology of the Extracellular Matrix, pp. 305-341, Hay E. ed., Plenum, New York).

Hyaluronan is present in hyaline cartilage, synovial joint fluid, and skin tissue, both dermis and epidermis. Hyaluronan is also suspected of having a role in numerous 00 CO physiological functions, such as adhesion, development, cell motility, cancer, angiogenesis, and wound healing. Due to the unique physical and biological properties of hyaluronan, it is employed in eye and joint surgery and is being evaluated in other C medical procedures. Products of hyaluronan have also been developed for use in s orthopaedics, rheumatology, and dermatology.

Rooster combs are a significant commercial source for hyaluronan.

Microorganisms are an alternative source. U.S. Patent No. 4,801,539 discloses a Sfermentation method for preparing hyaluronic acid involving a strain of Streptococcus C zooepidemicus with reported yields of about 3.6 g of hyaluronic acid per liter. European 00 Sto Patent No. EP0694616 discloses fermentation processes using an improved strain of SStreptococcus zooepidemicus with reported yields of about 3.5 g of hyaluronic acid per liter.

The microorganisms used for production of hyaluronic acid by fermentation are strains of pathogenic bacteria, foremost among them being several Streptococcus spp.

is The group A and group C streptococci surround themselves with a nonantigenic capsule composed of hyaluronan, which is identical in composition to that found in connective tissue and joints. Pasteurella multocida, another pathogenic encapsulating bacteria, also surrounds its cells with hyaluronan.

Hyaluronan synthases have been described from vertebrates, bacterial pathogens, and algal viruses (DeAngelis, P. 1999, Cell. Mol. Life Sci. 56: 670-682).

WO 99/23227 discloses a Group I hyaluronate synthase from Streptococcus equisimilis.

WO 99/51265 and WO 00/27437 describe a Group II hyaluronate synthase from Pasturella multocida. Ferretti et al. disclose the hyaluronan synthase operon of Streptococcus pyogenes, which is composed of three genes, hasA, hasB, and hasC, that encode hyaluronate synthase, UDP glucose dehydrogenase, and UDP-glucose pyrophosphorylase, respectively (Proc. Natl. Acad. Scl. USA. 98, 4658-4663, 2001).

WO 99/51265 describes a nucleic acid segment having a coding region for a Streptococcus equisimilis hyaluronan synthase.

Bacilli are well established as host cell systems for the production of native and recombinant proteins. It is an object of the present invention to provide methods for producing a hyaluronan in a recombinant Bacillus host cell.

Brief Summary of the Invention The present invention relates to methods for producing a hyaluronic acid, comprising: cultivating a Bacillus host cell under conditions suitable for production of the hyaluronic acid, wherein the Bacillus host cell comprises a nucleic acid construct 00

O

O

comprising a hyaluronan synthase encoding sequence operably linked to a promoter sequence foreign to the hyaluronan synthase encoding sequence; and recovering the hyaluronic acid from the cultivation medium.

SIn preferred embodiments, the nucleic acid construct further comprises one or more genes encoding enzymes in the biosynthesis of a precursor sugar of the hyaluronic acid or the Bacillus host cell further comprises one or more second nucleic acid constructs comprising one or more genes encoding enzymes in the biosynthesis of Sthe precursor sugar.

SIn another preferred embodiment, the one or more genes encoding a precursor 0 0 10 sugar are under the control of the same or a different promoter(s) as the hyaluronan 0synthase encoding sequence.

The present invention also relates to Bacillus host cells comprising a nucleic acid construct comprising a hyaluronan synthase encoding sequence operably linked to a promoter sequence foreign to the hyaluronan synthase encoding sequence, and to such is nucleic acid constructs.

The present invention also relates to an isolated nucleic acid sequence encoding a hyaluronan synthase operon comprising a hyaluronan synthase gene or a portion thereof and a UDP-glucose 6-dehydrogenase gene, and optionally one or more genes selected from the group consisting of a UDP-glucose pyrophosphorylase gene, UDP-Nacetylglucosamine pyrophosphorylase gene, and glucose-6-phosphate isomerase gene.

The present invention also relates to isolated nucleic acid sequences encoding a UDP-glucose 6-dehydrogenase selected from the group consisting of: a nucleic acid sequence encoding a polypeptide having an amino acid sequence which has at least about 75%, about 80%, about 85%, about 90%, or about 95% identity to SEQ ID NO: 41; a nucleic acid sequence having at least about 75%, about 80%, about about 90%, or about 95% homology to SEQ ID NO: 40; a nucleic acid sequence which hybridizes under medium or high stringency conditions with the nucleic acid sequence of SEQ ID NO: 40, (ii) the cDNA sequence contained in SEQ ID NO: 40, or (iii) a complementary strand of or and a subsequence of or wherein the subsequence encodes a polypeptide fragment which has UDP-glucose 6dehydrogenase activity.

The present invention also relates to isolated nucleic acid sequences encoding a UDP-glucose pyrophosphorylase selected from the group consisting of: a nucleic acid sequence encoding a polypeptide having an amino acid sequence which has at least about 90%, about 95%, or about 97% identity to SEQ ID NO: 43; a nucleic acid sequence having at least about 90%, about 95%, or about 97% homology to SEQ ID NO: 42; a nucleic acid sequence which hybridizes under low, medium, or high 00

O

O

stringency conditions with the nucleic acid sequence of SEQ ID NO: 42, (ii) the cDNA sequence contained in SEQ ID NO: 42, or (iii) a complementary strand of or and a subsequence of or wherein the subsequence encodes a polypeptide Sfragment which has UDP-N-acetylglucosamine pyrophosphorylase activity.

s The present invention also relates to isolated nucleic acid sequences encoding a UDP-N-acetylglucosamine pyrophosphorylase selected from the group consisting of: (a) a nucleic acid sequence encoding a polypeptide having an amino acid sequence which Shas at least about 75%, about 80%, about 85%, about 90%, or about 95% identity to S SEQ ID NO: 45; a nucleic acid sequence having at least about 75%, about to 0 about 85%, about 90%, or about 95% homology to SEQ ID NO: 44; a nucleic acid 0 sequence which hybridizes under low, medium, or high stringency conditions with the nucleic acid sequence of SEQ ID NO: 44, (ii) the cDNA sequence contained in SEQ ID NO: 44, or (iii) a complementary strand of or and a subsequence of or wherein the subsequence encodes a polypeptide fragment which has UDP-Nacetylglucosarine pyrophosphorylase activity.

Brief Description of the Figures Figure 1 shows the chemical structure of hyaluronan.

Figure 2 shows the biosynthetic pathway for hyaluronan synthesis.

Figure 3 shows a restriction map of pCR2.1-sehasA.

Figure 4 shows a restriction map of pCR2.1-tuaD.

Figure 5 shows a restriction map of pCR2.1-gtaB.

Figure 6 shows a restriction map of pCR2.1-gcaD.

Figure 7 shows a restriction map of pHA1.

Figure 8 shows a restriction map of pHA2.

Figure 9 shows a restriction map of pHA3.

Figure 10 shows a restriction map of pHA4.

Figure 11 shows a restriction map of Figure 12 shows a restriction map of pHA6.

Figure 13 shows a restriction map of pHA7.

Figure 14 shows a restriction map of pMRT106.

Figure 15 shows a restriction map of pHA8.

Figure 16 shows a restriction map of pHA9.

Figure 17 shows a restriction map of Figure 18 shows a restriction map of pRB157.

00

O

O

Figure 19 shows a restriction map of pMRT084.

Figure 20 shows a restriction map of pMRT086.

SFigure 21 shows a restriction map of pCJ791.

Figure 22 shows a restriction map of pMRCJ2.

sC Figure 22 shows a restriction map of pMRT932.

s Figure 23 shows a restriction map of pNNB194neo.

Figure 24 shows a restriction map of pNNB194neo-T.

O Figure 25 shows a restriction map of pShV3.1- E.

OFigure 26 shows a restriction map of pShV2.1-ayEB.

0 Figure 27 shows a restriction map of pShV3A.

0O Figure 28 shows a restriction map of pMRT036.

O Figure 29 shows a restriction map of pMRT037.

Figure 30 shows a restriction map of pMRT041.

Figure 31 shows a restriction map of pMRT064.1.

Figure 32 shows a restriction map of pMRT068.

is Figure 33 shows a restriction map of pMRT069.

Figure 34 shows a restriction map of pMRT071.

Figure 35 shows a restriction map of pMRT074.

Figure 36 shows a restriction map of pMRT120.

Figure 37 shows a restriction map of pMRT122.

Figure 38 shows a restriction map of pCR2.1-pel5'.

Figure 39 shows a restriction map of pCR2.1-pel3'.

Figure 40 shows a restriction map of pRB161.

Figure 41 shows a restriction map of pRB162.

Figure 42 shows a restriction map of pRB156.

Figure 43 shows a restriction map of pRB164.

Figure 44 shows a summary of fermentations of various hyaluronic acid producing Bacillus subtilis strains run under fed batch at approximately 2 g sucrose/Lohr, 37"C.

Figure 45 shows a summary of peak hyaluronic acid weight average molecular weights (MDa) obtained from fermentations of various hyaluronic acid producing Bacillus subtilis strains run under fed batch at approximately 2 g sucrose/Lo-hr, 37 0

C.

Detailed Description of the Invention The present invention relates to methods for producing a hyaluronan, comprising: cultivating a Bacillus host cell under conditions suitable for production of the hyaluronan, wherein the Bacillus host cell comprises a nucleic acid construct 00

O

O

comprising a hyaluronan synthase encoding sequence operably linked to a promoter sequence foreign to the hyaluronan synthase encoding sequence; and recovering the hyaluronan from the cultivation medium.

Cl The methods of the present invention represent an improvement over the production of hyaluronan from pathogenic, encapsulating bacteria. In encapsulating 0 bacteria, a large quantity of the hyaluronan is produced in the capsule. In processing and purifying hyaluronan from such sources, it is first necessary to remove the Shyaluronan from the capsule, such as by the use of a surfactant, or detergent, such as C' SDS. This creates a complicating step in commercial production of hyaluronan, as the 00 surfactant must be added in order to liberate a large portion of the hyaluronan, and Ssubsequently the surfactant must be removed prior to final purification.

The present invention allows the production of a large quantity of a hyaluronan, which is produced in a non-encapsulating host cell, as free hyaluronan. When viewed under the microscope, there is no visible capsule associated with the recombinant is strains of Bacillus, whereas the pathogenic strains traditionally used in hyaluronan production comprise a capsule of hyaluronan that is at least twice the diameter of the cell itself.

Since the hyaluronan of the recombinant Bacillus cell is expressed directly to the culture medium, a simple process may be used to isolate the hyaluronan from the culture medium. First, the Bacillus cells and cellular debris are physically removed from the culture medium. The culture medium may be diluted first, if desired, to reduce the viscosity of the medium. Many methods are known to those skilled in the art for removing cells from culture medium, such as centrifugation or microfiltration. If desired, the remaining supernatant may then be filtered, such as by ultrafiltration, to concentrate and remove small molecule contaminants from the hyaluronan. Following removal of the cells and cellular debris, a simple precipitation of the hyaluronan from the medium is performed by known mechanisms. Salt, alcohol, or combinations of salt and alcohol may be used to precipitate the hyaluronan from the filtrate. Once reduced to a precipitate, the hyaluronan can be easily isolated from the solution by physical means.

Alternatively, the hyaluronan may be dried or concentrated from the filtrate solution by using evaporative techniques known to the art, such as spray drying.

The methods of the present invention thus represent an improvement over existing techniques for commercially producing hyaluronan by fermentation, in not requiring the use of a surfactant in the purification of hyaluronan from cells in culture.

Hyaluronic Acid "Hyaluronic acid" is defined herein as an unsulphated glycosaminoglycan 00

O

O

composed of repeating disaccharide units of N-acetylglucosamine (GlcNAc) and d) glucuronic acid (GlcUA) linked together by alternating beta-1,4 and beta-1,3 glycosidic bonds (Figure Hyaluronic acid is also known as hyaluronan, hyaluronate, or HA.

SThe terms hyaluronan and hyaluronic acid are used interchangeably herein.

s In a preferred embodiment, the hyaluronic acid obtained by the methods of the present invention has a molecular weight of about 10,000 to about 10,000,000 Da. In a more preferred embodiment, the hyaluronic acid obtained by the methods of the present invention has a molecular weight of about 25,000 to about 5,000,000 Da. In a most preferred embodiment, the hyaluronic acid obtained by the methods of the present 0 0 to invention has a molecular weight of about 50,000 to about 3,000,000 Da.

SThe level of hyaluronic acid produced by a Bacillus host cell of the present invention may be determined according to the modified carbazole method (Bitter and Muir, 1962, Anal Biochem. 4: 330-334). Moreover, the average molecular weight of the hyaluronic acid may be determined using standard methods in the art, such as those is described by Ueno et 1988, Chem. Pharm. Bull. 36, 4971-4975; Wyatt, 1993, Anal.

Chim. Acta 272: 1-40; and Wyatt Technologies, 1999, "Light Scattering University DAWN Course Manual" and "DAWN EOS Manual" Wyatt Technology Corporation, Santa Barbara, California.

The hyaluronic acid obtained by the methods of the present invention may be subjected to various techniques known in the art to modify the hyaluronic acid, such as crosslinking as described, for example, in U.S. Patent Nos. 5,616,568, 5,652,347, and 5,874,417. Moreover, the molecular weight of the hyaluronic acid may be altered using techniques known in the art.

Host Cells In the methods of the present invention, the Bacillus host cell may be any Bacillus cell suitable for recombinant production of hyaluronic acid. The Bacillus host cell may be a wild-type Bacillus cell or a mutant thereof. Bacillus cells useful in the practice of the present invention include, but are not limited to, Bacillus agaraderhens, Bacillus alkalophilus, Bacillus amyloliquefaciens, Bacillus brevis, Bacillus circulans, Bacillus clausii, Bacillus coagulans, Bacillus firmus, Bacillus lautus, Bacillus lentus, Bacillus licheniformis, Bacillus megaterium, Bacillus pumilus, Bacillus stearothermophilus, Bacillus subtilis, and Bacillus thuringiensis cells. Mutant Bacillus subtilis cells particularly adapted for recombinant expression are described in WO 98/22598. Non-encapsulating Bacillus cells are particularly useful in the present invention.

In a preferred embodiment, the Bacillus host cell is a Bacillus amyloliquefaciens, 00 Bacillus clausii, Bacillus lentus, Bacillus licheniformis, Bacillus stearothermophilus or Bacillus subtills cell. In a more preferred embodiment, the Bacillus cell is a Bacillus uamyloliquefaciens cell. In another more preferred embodiment, the Bacillus cell is a NBacillus clausii cell. In another more preferred embodiment, the Bacillus cell is a Bacillus lentus cell. In another more preferred embodiment, the Bacillus cell is a 0 Bacillus licheniformis cell. In another more preferred embodiment, the Bacillus cell is a Bacillus subtilis cell. In a most preferred embodiment, the Bacillus host cell is Bacillus O subtilis A164A5 (see U.S. Patent No. 5,891,701) or Bacillus subtilis 168A4.

CLN Transformation of the Bacillus host cell with a nucleic acid construct of the 00 present invention may, for instance, be effected by protoplast transformation (see, e.g., SChang and Cohen, 1979, Molecular General Genetics 168: 111-115), by using competent cells (see, Young and Spizizen, 1961, Journal of Bacteriology 81: 823- 829, or Dubnau and Davidoff-Abelson, 1971, Journal of Molecular Biology 56: 209-221), by electroporation (see, Shigekawa and Dower, 1988, Biotechniques 6: 742-751), or by conjugation (see, Koehler and Thome, 1987, Journal of Bacteriology 169: 5271-5278).

Nucleic Acid Constructs "Nucleic acid construct" is defined herein as a nucleic acid molecule, either single- or double-stranded, which is isolated from a naturally occurring gene or which has been modified to contain segments of nucleic acid which are combined and juxtaposed in a manner which would not otherwise exist in nature. The term nucleic acid construct may be synonymous with the term expression cassette when the nucleic acid construct contains all the control sequences required for expression of a coding sequence. The term "coding sequence" is defined herein as a sequence which is transcribed into mRNA and translated into an enzyme of interest when placed under the control of the below mentioned control sequences. The boundaries of the coding sequence are generally determined by a ribosome binding site located just upstream of the open reading frame at the 5' end of the mRNA and a transcription terminator sequence located just downstream of the open reading frame at the 3' end of the mRNA. A coding sequence can include, but is not limited to, DNA, cDNA, and recombinant nucleic acid sequences.

The techniques used to isolate or clone a nucleic acid sequence encoding a polypeptide are well known in the art and include, for example, isolation from genomic s3 DNA, preparation from cDNA, or a combination thereof. The cloning of the nucleic acid sequences from such genomic DNA can be effected, by using antibody screening of expression libraries to detect cloned DNA fragments with shared structural features or 00

O

O

the well known polymerase chain reaction (PCR). See, for example, Innis et al., 1990, qJ PCR Protocols: A Guide to Methods and Application, Academic Press, New York. Other nucleic acid amplification procedures such as ligase chain reaction, ligated activated Stranscription, and nucleic acid sequence-based amplification may be used. The cloning s procedures may involve excision and isolation of a desired nucleic acid fragment comprising the nucleic acid sequence encoding the polypeptide, insertion of the fragment into a vector molecule, and incorporation of the recombinant vector into a 0Bacillus cell where clones of the nucleic acid sequence will be replicated. The nucleic C) acid sequence may be of genomic, cDNA, RNA, semi-synthetic, synthetic origin, or any 0 0 10 combinations thereof.

SAn isolated nucleic acid sequence encoding an enzyme may be manipulated in a variety of ways to provide for expression of the enzyme. Manipulation of the nucleic acid sequence prior to its insertion into a construct or vector may be desirable or necessary depending on the expression vector or Bacillus host cell. The techniques for is modifying nucleic acid sequences utilizing cloning methods are well known in the art. It will be understood that the nucleic acid sequence may also be manipulated in vivo in the host cell using methods well known in the art.

A number of enzymes are involved in the biosynthesis of hyaluronic acid. These enzymes include hyaluronan synthase, UDP-glucose 6-dehydrogenase, UDP-glucose pyrophosphorylase, UDP-N-acetylglucosamine pyrophosphorylase, glucose-6phosphate isomerase, hexokinase, phosphoglucomutase, amidotransferase, mutase, and acetyl transferase. Hyaluronan synthase is the key enzyme in the production of hyaluronic acid.

"Hyaluronan synthase" is defined herein as a synthase that catalyzes the elongation of a hyaluronan chain by the addition of GIcUA and GIcNAc sugar precursors. The amino acid sequences of streptococcal hyaluronan synthases, vertebrate hyaluronan synthases, and the viral hyaluronan synthase are distinct from the Pasteurella hyaluronan synthase, and have been proposed for classification as Group I and Group II hyaluronan synthases, the Group I hyaluronan synthases including Streptococcal hyaluronan synthases (DeAngelis, 1999). For production of hyaluronan in Bacillus host cells, hyaluronan synthases of a eukaryotic origin, such as mammalian hyaluronan synthases, are less preferred.

The hyaluronan synthase encoding sequence may be any nucleic acid sequence capable of being expressed in a Bacillus host cell. The nucleic acid sequence may be of s3 any origin. Preferred hyaluronan synthase genes include any of either Group I or Group II, such as the Group I hyaluronan synthase genes from Streptococcus equisimilis, Streptococcus pyogenes, Streptococcus uberis, and Streptococcus equi subsp.

00 zooepidemicus, or the Group II hyaluronan synthase genes of Pasturella multocida.

T In a preferred embodiment, the hyaluronan synthase encoding sequence is selected from the group consisting of a nucleic acid sequence encoding a polypeptide with an amino acid sequence having at least about 70%, about 75%, about s 80%, about 85%, about 90%, or about 95% identity to SEQ ID NO: 2, SEQ ID NO: 93, or O SEQ ID NO: 103; a nucleic acid sequence which hybridizes under low, medium, or 0high stringency conditions with SEQ ID NO: 1, SEQ ID NO: 92, or SEQ ID NO: 102; and 0(c) a complementary strand of or 00 In a more preferred embodiment, the hyaluronan synthase encoding sequence encodes a polypeptide having the amino acid sequence of SEQ ID NO: 2, SEQ ID NO: rC 93, or SEQ ID NO: 103; or a fragment thereof having hyaluronan synthase activity.

In another preferred embodiment, the hyaluronan synthase encoding sequence is selected from the group consisting of a nucleic acid sequence encoding a polypeptide with an amino acid sequence having at least about 70%, about 75%, about 80%, about 85%, about 90%, or about 95% identity to SEQ ID NO: 95; a nucleic acid sequence which hybridizes under low, medium, or high stringency conditions with SEQ ID NO: 94; and a complementary strand of or In another more preferred embodiment, the hyaluronan synthase encoding sequence encodes a polypeptide having the amino acid sequence of SEQ ID NO: 95, or a fragment thereof having hyaluronan synthase activity.

The methods of the present invention also include constructs whereby precursor sugars of hyaluronan are supplied to the host cell, either to the culture medium, or by being encoded by endogenous genes, by non-endogenous genes, or by a combination of endogenous and non-endogenous genes in the Bacillus host cell. The precursor sugar may be D-glucuronic acid or N-acetyl-glucosamine.

In the methods of the present invention, the nucleic acid construct may further comprise one or more genes encoding enzymes in the biosynthesis of a precursor sugar of a hyaluronan. Alternatively, the Bacillus host cell may further comprise one or more second nucleic acid constructs comprising one or more genes encoding enzymes in the biosynthesis of the precursor sugar. Hyaluronan production is improved by the use of constructs with a nucleic acid sequence or sequences encoding a gene or genes directing a step in the synthesis pathway of the precursor sugar of hyaluronan. By, "directing a step in the synthesis pathway of a precursor sugar of hyaluronan" is meant that the expressed protein of the gene is active in the formation of N-acetyl-glucosamine s3 or D-glucuronic acid, or a sugar that is a precursor of either of N-acetyl-glucosamine and D-glucuronic acid (Figure 2).

In a preferred method for supplying precursor sugars, constructs are provided for 00 Simproving hyaluronan production in a host cell having a hyaluronan synthase, by Sculturing a host cell having a recombinant construct with a heterologous promoter region operably linked to a nucleic acid sequence encoding a gene directing a step in the (CK synthesis pathway of a precursor sugar of hyaluronan. In a preferred method the host cell also comprises a recombinant construct having a promoter region operably linked to O a hyaluronan synthase, which may use the same or a different promoter region than the nucleic acid sequence to a synthase involved in the biosynthesis of N-acetyl- Sglucosamine. In a further preferred embodiment, the host cell may have a recombinant 1N construct with a promoter region operably linked to different nucleic acid sequences

OO

0 10 encoding a second gene involved in the synthesis of a precursor sugar of hyaluronan.

SThus, the present invention also relates to constructs for improving hyaluronan production by the use of constructs with a nucleic acid sequence encoding a gene directing a step in the synthesis pathway of a precursor sugar of hyaluronan. The nucleic acid sequence to the precursor sugar may be expressed from the same or a different promoter as the nucleic acid sequence encoding the hyaluronan synthase.

The genes involved in the biosynthesis of precursor sugars for the production of hyaluronic acid include a UDP-glucose 6-dehydrogenase gene, UDP-glucose pyrophosphorylase gene, UDP-N-acetylglucosamine pyrophosphorylase gene, glucose- 6-phosphate isomerase gene, hexokinase gene, phosphoglucomutase gene, amidotransferase gene, mutase gene, and acetyl transferase gene.

In a cell containing a hyaluronan synthase, any one or combination of two or more of hasB, hasC and hasD, or the homologs thereof, such as the Bacillus subtilis tuaD, gtaB, and gcaD, respectively, as well as hasE, may be expressed to increase the pools of precursor sugars available to the hyaluronan synthase. The Bacillus genome is described in Kunst, et al., Nature 390, 249-256, "The complete genome sequence of the Gram-positive bacterium Bacillus subtilis" (20 November 1997). In some instances, such as where the host cell does not have a native hyaluronan synthase activity, the construct may include the hasA gene.

The nucleic acid sequence encoding the biosynthetic enzymes may be native to the host cell, while in other cases heterologous sequence may be utilized. If two or more genes are expressed they may be genes that are associated with one another in a native operon, such as the genes of the HAS operon of Streptococcus equisimilis, which comprises hasA, hasB, hasC and hasD. In other instances, the use of some combination of the precursor gene sequences may be desired, without each element of the operon included. The use of some genes native to the host cell, and others which are exogenous may also be preferred in other cases. The choice will depend on the available pools of sugars in a given host cell, the ability of the cell to accommodate 00 Soverproduction without interfering with other functions of the host cell, and whether the cell regulates expression from its native genes differently than exogenous genes.

As one example, depending on the metabolic requirements and growth C conditions of the cell, and the available precursor sugar pools, it may be desirable to s increase the production of N-acetyl-glucosamine by expression of a nucleic acid sequence encoding UDP-N-acetylglucosamine pyrophosphorylase, such as the hasD gene, the Bacillus gcaD gene, and homologs thereof. Alternatively, the precursor sugar Smay be D-glucuronic acid. In one such embodiment, the nucleic acid sequence C encodes UDP-glucose 6-dehydrogenase. Such nucleic acid sequences include the 00 Bacillus tuaD gene, the hasB gene of Streptococcus, and homologs thereof. The S nucleic acid sequence may also encode UDP-glucose pyrophosphorylase, such as in the Bacillus gtaB gene, the hasC gene of Streptococcus, and homologs thereof.

In the methods of the present invention, the UDP-glucose 6-dehydrogenase gene may be a hasB gene or tuaD gene; or homologs thereof.

In a preferred embodiment, the hasB gene is selected from the group consisting of a nucleic acid sequence encoding a polypeptide with an amino acid sequence having at least about 70%, about 75%, about 80%, about 85%, about 90%, or about identity to SEQ ID NO: 41, SEQ ID NO: 97, or SEQ ID NO: 105; a nucleic acid sequence which hybridizes under low, medium, or high stringency conditions with SEQ ID NO: 40, SEQ ID NO: 96, or SEQ ID NO: 104; and a complementary strand of (a) or In a more preferred embodiment, the hasB gene encodes a polypeptide having the amino acid sequence of SEQ ID NO: 41, SEQ ID NO: 97, or SEQ ID NO: 105; or a fragment thereof having UDP-glucose 6-dehydrogenase activity.

In another preferred embodiment, the tuaD gene is selected from the group consisting of a nucleic acid sequence encoding a polypeptide with an amino acid sequence having at least about 70%, about,75%, about 80%, about 85%, about 90%, or about 95% Identity to SEQ ID NO: 12; a nucleic acid sequence which hybridizes under low, medium, or high stringency conditions with SEQ ID NO: 11; and a complementary strand of or In another more preferred embodiment, the tuaD gene encodes a polypeptide having the amino acid sequence of SEQ ID NO: 12, or a fragment thereof having UDPglucose 6-dehydrogenase activity.

In the methods of the present invention, the UDP-glucose pyrophosphorylase gene may be a hasC gene or gtaB gene; or homologs thereof.

In a preferred embodiment, the hasC gene is selected from the group consisting of a nucleic acid sequence encoding a polypeptide with an amino acid sequence 00

O

O

Shaving at least about 70%, about 75%, about 80%, about 85%, about 90%, or about 0) 95% identity to SEQ ID NO: 43, SEQ ID NO: 99, or SEQ ID NO: 107; a nucleic acid sequence which hybridizes under low, medium, or high stringency conditions with SEQ N ID NO: 42 or SEQ ID NO: 98, or SEQ ID NO: 106; and a complementary strand of (a) or O In another more preferred embodiment, the hasC gene encodes a polypeptide having the amino acid sequence of SEQ ID NO: 43 or SEQ ID NO: 99, or SEQ ID NO: S107; or a fragment thereof having UDP-glucose pyrophosphorylase activity.

In another preferred embodiment, the gtaB gene is selected from the group 00 10 consisting of a nucleic acid sequence encoding a polypeptide with an amino acid sequence having at least about 70%, about 75%, about 80%, about 85%, about 90%, or about 95% identity to SEQ ID NO: 22; a nucleic acid sequence which hybridizes under low, medium, or high stringency conditions with SEQ ID NO: 21; and a complementary strand of or In another more preferred embodiment, the gtaB gene encodes a polypeptide having the amino acid sequence of SEQ ID NO: 22, or a fragment thereof having UDPglucose pyrophosphorylase activity.

In the methods of the present invention, the UDP-N-acetylglucosamine pyrophosphorylase gene may be a hasD or gcaD gene; or homologs thereof.

In a preferred embodiment, the hasD gene is selected from the group consisting of a nucleic acid sequence encoding a polypeptide with an amino acid sequence having at least about 75%, about 80%, about 85%, about 90%, or about 95% identity to SEQ ID NO: 45; a nucleic acid sequence which hybridizes under low, medium, or high stringency conditions with SEQ ID NO: 44; and a complementary strand of or In another more preferred embodiment, the hasD gene encodes a polypeptide having the amino acid sequence of SEQ ID NO: 45, or a fragment thereof having UDP- N-acetylglucosamine pyrophosphorylase activity.

In another preferred embodiment, the gcaD gene is selected from the group consisting of a nucleic acid sequence encoding a polypeptide with an amino acid sequence having at least about 70%, about 75%, about 80%, about 85%, about 90%, or about 95% identity to SEQ ID NO: 30; a nucleic acid sequence which hybridizes under low, medium, or high stringency conditions with SEQ ID NO: 29; and a complementary strand of or In another more preferred embodiment, the gcaD gene encodes a polypeptide having the amino acid sequence of SEQ ID NO: 30, or a fragment thereof having UDP- N-acetylglucosamine pyrophosphorylase activity.

00

O

O

In the methods of the present invention, the glucose-6-phosphate isomerase L gene may be a hasE or homolog thereof.

In a preferred embodiment, the hasE gene is selected from the group consisting C of a nucleic acid sequence encoding a polypeptide with an amino acid sequence s having at least about 70%, about 75%, about 80%, about 85%, about 90%, or about identity to SEQ ID NO: 101; a nucleic acid sequence which hybridizes under low, medium, or high stringency conditions with SEQ ID NO: 100; and a Scomplementary strand of or Cl In another more preferred embodiment, the hasE gene encodes a polypeptide 00 10 having the amino acid sequence of SEQ ID NO: 101, or a fragment thereof having Sglucose-6-phosphate isomerase activity.

In the methods of the present invention, the hyaluronan synthase gene and the one or more genes encoding a precursor sugar are under the control of the same promoter. Alternatively, the one or more genes encoding a precursor sugar are under the control of the same promoter but a different promoter driving the hyaluronan synthase gene. A further alternative is that the hyaluronan synthase gene and each of the genes encoding a precursor sugar are under the control of different promoters. In a preferred embodiment, the hyaluronan synthase gene and the one or more genes encoding a precursor sugar are under the control of the same promoter.

The present invention also relates to a nucleic acid construct comprising an isolated nucleic acid sequence encoding a hyaluronan synthase operon comprising a hyaluronan synthase gene and a UDP-glucose 6-dehydrogenase gene, and optionally one or more genes selected from the group consisting of a UDP-glucose pyrophosphorylase gene, UDP-N-acetylglucosamine pyrophosphorylase gene, and glucose-6-phosphate isomerase gene. A nucleic acid sequence encoding most of the hyaluronan synthase operon of Streptococcus equisimilis is found in SEQ ID NO: 108.

This sequence contains the hasB (SEQ ID NO: 40) and hasC (SEQ ID nO: 42) homologs of the Bacillus subtilis tuaD gene (SEQ ID NO: 11) and gtaB gene (SEQ ID NO: 21), respectively, as is the case for Streptococcus pyogenes, as well as a homolog of the gcaD gene (SEQ ID NO: 29), which has been designated hasD (SEQ ID NO: 44).

The Bacillus subtilis gcaD encodes UDP-N-acetylglucosamine pyrophosphorylase, which is involved in the synthesis of N-acetyl-glucosamine, one of the two sugars of hyaluronan. The Streptococcus equisimilis homolog of gcaD, hasD, is arranged by Streptococcus equisimilis on the hyaluronan synthase operon. The nucleic aci sequence also contains a portion of the hasA gene (the last 1156 bp of SEQ ID NO: 1).

In some cases the host cell will have a recombinant construct with a heterologous promoter region operably linked to a nucleic acid sequence encoding a 00

O

O

Sgene directing a step in the synthesis pathway of a precursor sugar of hyaluronan, which d may be in concert with the expression of hyaluronan synthase from a recombinant construct. The hyaluronan synthase may be expressed from the same or a different rC promoter region than the nucleic acid sequence encoding an enzyme involved in the s biosynthesis of the precursor. In another preferred embodiment, the host cell may have 0 a recombinant construct with a promoter region operably linked to a different nucleic acid sequence encoding a second gene involved in the synthesis of a precursor sugar of Shyaluronan.

CN The nucleic acid sequence encoding the enzymes involved in the biosynthesis of 00 0 10 the precursor sugar(s) may be expressed from the same or a different promoter as the Snucleic acid sequence encoding the hyaluronan synthase. In the former sense, "artificial operons" are constructed, which may mimic the operon of Streptococcus equisimilis in having each hasA, hasB, hasC and hasD, or homologs thereof, or, alternatively, may utilize less than the full complement present in the Streptococcus equisimilis operon. The artificial operons" may also comprise a glucose-6-phosphate isomerase gene (hasE) as well as one or more genes selected from the group consisting of a hexokinase gene, phosphoglucomutase gene, amidotransferase gene, mutase gene, and acetyl transferase gene. In the artificial operon, at least one of the elements is heterologous to one other of the elements, such as the promoter region being heterologous to the encoding sequences.

In a preferred embodiment, the nucleic acid construct comprises hasA, tuaD, and gtaB. In another preferred embodiment, the nucleic acid construct comprises hasA, tuaD, gtaB, and gcaD. In another preferred embodiment, the nucleic acid construct comprises hasA and tuaD. In another preferred embodiment, the nucleic acid construct comprises hasA. In another preferred embodiment, the nucleic acid construct comprises hasA, tuaD, gtaB, gcaD, and hasE. In another preferred embodiment, the nucleic acid construct comprises hasA, hasB, hasC, and hasD. In another preferred embodiment, the nucleic acid construct comprises hasA, hasB, hasC, hasD, and hasE.

Based on the above preferred embodiments, the genes noted can be replaced with homologs thereof.

In the methods of the present invention, the nucleic acid constructs comprise a hyaluronan synthase encoding sequence operably linked to a promoter sequence foreign to the hyaluronan synthase encoding sequence. The promoter sequence may be, for example, a single promoter or a tandem promoter.

"Promoter" is defined herein as a nucleic acid sequence involved in the binding of RNA polymerase to initiate transcription of a gene. "Tandem promoter" is defined herein as two or more promoter sequences each of which is operably linked to a coding 00

O

O

Ssequence and mediates the transcription of the coding sequence into mRNA. "Operably r linked" is defined herein as a configuration in which a control sequence, a promoter sequence, is appropriately placed at a position relative to a coding sequence such that C1 the control sequence directs the production of a polypeptide encoded by the coding s sequence. As noted earlier, a "coding sequence" is defined herein as a nucleic acid O sequence which is transcribed into mRNA and translated into a polypeptide when placed under the control of the appropriate control sequences. The boundaries of the coding sequence are generally determined by a ribosome binding site located just upstream of C1 the open reading frame at the 5' end of the mRNA and a transcription terminator sequence located just downstream of the open reading frame at the 3' end of the SmRNA. A coding sequence can include, but is not limited to, genomic DNA, cDNA, semisynthetic, synthetic, and recombinant nucleic acid sequences.

In a preferred embodiment, the promoter sequences may be obtained from a bacterial source. In a more preferred embodiment, the promoter sequences may be obtained from a gram positive bacterium such as a Bacillus strain, Bacillus agaradherens, Bacillus alkalophilus, Bacillus amyloliquefaciens, Bacillus brevis, Bacillus circulans, Bacillus clausil, Bacillus coagulans, Bacillus firmus, Bacillus lautus, Bacillus lentus, Bacillus licheniformis, Bacillus megaterium, Bacillus pumilus, Bacillus stearothermophilus, Bacillus subtilis, or Bacillus thuringiensis; or a Streptomyces strain, Streptomyces lividans or Streptomyces murinus; or from a gram negative bacterium, E. coli or Pseudomonas sp.

Examples of suitable promoters for directing the transcription of a nucleic acid sequence in the methods of the present invention are the promoters obtained from the E. coil lac operon, Streptomyces coelicolor agarase gene (dagA), Bacillus lentus or Bacillus clausii alkaline protease gene (aprH), Bacillus licheniformis alkaline protease gene (subtilisin Carlsberg gene), Bacillus subtilis levansucrase gene (sacB), Bacillus subtilis alpha-amylase gene (amyE), Bacillus licheniformis alpha-amylase gene (amyL), Bacillus stearothermophilus maltogenic amylase gene (amyM), Bacillus amyloliquefaciens alpha-amylase gene (amyQ), Bacillus licheniformis penicillinase gene (penP), Bacillus subtilis xylA and xylB genes, Bacillus thuringiensis subsp. tenebrionis CrylllA gene (crylllA) or portions thereof, prokaryotic beta-lactamase gene (Villa- Kamaroff et al., 1978, Proceedings of the National Academy of Sciences USA 75:3727- 3731). Other examples are the promoter of the spol bacterial phage promoter and the tac promoter (DeBoer et al., 1983, Proceedings of the National Academy of Sciences USA 80:21-25). Further promoters are described in "Useful proteins from recombinant bacteria" in Scientific American, 1980, 242:74-94; and in Sambrook, Fritsch, and 00

O

Maniatus, 1989, Molecular Cloning, A Laboratory Manual, 2d edition, Cold Spring Harbor, New York.

The promoter may also be a "consensus" promoter having the sequence rC TTGACA for the region and TATAAT for the region. The consensus s promoter may be obtained from any promoter which can function in a Bacillus host cell.

O The construction of a "consensus" promoter may be accomplished by site-directed mutagenesis to create a promoter which conforms more perfectly to the established Sconsensus sequences for the and regions of the vegetative "sigma A-type" rc promoters for Bacillus subtilis (Voskuil et al., 1995, Molecular Microbiology 17: 271-279).

00 0 10 In a preferred embodiment, the "consensus" promoter is obtained from a Spromoter obtained from the E. coli lac operon, Streptomyces coelicolor agarase gene (dagA), Bacillus clausii or Bacillus lentus alkaline protease gene (aprH), Bacillus licheniformis alkaline protease gene (subtilisin Carlsberg gene), Bacillus subtilis levansucrase gene (sacB), Bacillus subtilis alpha-amylase gene (amyE), Bacillus licheniformis alpha-amylase gene (amyL), Bacillus stearothermophilus maltogenic amylase gene (amyM), Bacillus amyloliquefaciens alpha-amylase gene (amyQ), Bacillus licheniformis penicillinase gene (penP), Bacillus subtilis xylA and xylB genes, Bacillus thuringiensis subsp. tenebrionis CrylllA gene (crylllA) or portions thereof, or prokaryotic beta-lactamase gene spol bacterial phage promoter. In a more preferred embodiment, the "consensus" promoter is obtained from Bacillus amyloliquefaciens alpha-amylase gene (amyQ).

Widner, et al., United States Patent Nos. 6,255,076 and 5,955,310, describe tandem promoters and constructs and methods for use in expression in Bacillus cells, including the short consensus amyQ promoter (also called scBAN). The use of the crylllA stabilizer sequence, and constructs using the sequence, for improved production in Bacillus are also described therein.

Each promoter sequence of the tandem promoter may be any nucleic acid sequence which shows transcriptional activity in the Bacillus cell of choice including a mutant, truncated, and hybrid promoter, and may be obtained from genes encoding extracellular or intracellular polypeptides either homologous or heterologous to the Bacillus cell. Each promoter sequence may be native or foreign to the nucleic acid sequence encoding the polypeptide and native or foreign to the Bacillus cell. The promoter sequences may be the same promoter sequence or different promoter sequences.

The two or more promoter sequences of the tandem promoter may simultaneously promote the transcription of the nucleic acid sequence. Alternatively, one or more of the promoter sequences of the tandem promoter may promote the 00

O

O

(N

D transcription of the nucleic acid sequence at different stages of growth of the Bacillus T cell.

In a preferred embodiment, the tandem promoter contains at least the amyQ c promoter of the Bacillus amyloliquefaciens alpha-amylase gene. In another preferred embodiment, the tandem promoter contains at least a "consensus" promoter having the sequence TTGACA for the region and TATAAT for the region. In another preferred embodiment, the tandem promoter contains at least the amyL promoter of the Bacillus licheniformis alpha-amylase gene. In another preferred embodiment, the 00 tandem promoter contains at least the crylllA promoter or portions thereof (Agaisse and Lereclus, 1994, Molecular Microbiology 13: 97-107).

CN In a more preferred embodiment, the tandem promoter contains at least the amyL promoter and the crylllA promoter. In another more preferred embodiment, the tandem promoter contains at least the amyQ promoter and the crylllA promoter. In another more preferred embodiment, the tandem promoter contains at least a is "consensus" promoter having the sequence TTGACA for the region and TATAAT for the region and the crylllA promoter. In another more preferred embodiment, the tandem promoter contains at least two copies of the amyL promoter. In another more preferred embodiment, the tandem promoter contains at least two copies of the amyQ promoter. In another more preferred embodiment, the tandem promoter contains at least two copies of a "consensus" promoter having the sequence TTGACA for the region and TATAAT for the region. In another more preferred embodiment, the tandem promoter contains at least two copies of the crylllA promoter.

"An mRNA processing/stabilizing sequence" is defined herein as a sequence located downstream of one or more promoter sequences and upstream of a coding sequence to which each of the one or more promoter sequences are operably linked such that all mRNAs synthesized from each promoter sequence may be processed to generate mRNA transcripts with a stabilizer sequence at the 5' end of the transcripts.

The presence of such a stabilizer sequence at the 5' end of the mRNA transcripts increases their half-life (Agaisse and Lereclus, 1994, supra, Hue et al., 1995, Journal of Bacteriology 177: 3465-3471). The mRNA processing/stabilizing sequence is complementary to the 3' extremity of a bacterial 16S ribosomal RNA. In a preferred embodiment, the mRNA processing/stabilizing sequence generates essentially singlesize transcripts with a stabilizing sequence at the 5' end of the transcripts. The mRNA processing/stabilizing sequence is preferably one, which is complementary to the 3' extremity of a bacterial 16S ribosomal RNA. See, U.S. Patent Nos. 6,255,076 and 5,955,310.

00 SIn a more preferred embodiment, the mRNA processing/stabilizing sequence is a the Bacillus thuringiensis crylllA mRNA processing/stabilizing sequence disclosed in WO 94/25612 and Agaisse and Lereclus, 1994, supra, or portions thereof which retain C the mRNA processing/stabilizing function. In another more preferred embodiment, the mRNA processing/stabilizing sequence is the Bacillus subtilis SP82 mRNA O processing/stabilizing sequence disclosed in Hue et aL., 1995, supra, or portions thereof which retain the mRNA processing/stabilizing function.

When the crylllA promoter and its mRNA processing/stabilizing sequence are C employed in the methods of the present invention, a DNA fragment containing the 00 io sequence disclosed in WO 94/25612 and Agaisse and Lereclus, 1994, supra, or portions thereof which retain the promoter and mRNA processing/stabilizing functions, may be used. Furthermore, DNA fragments containing only the crylllA promoter or only the crylllA mRNA processing/stabilizing sequence may be prepared using methods well known in the art to construct various tandem promoter and mRNA processing/stabilizing is sequence combinations. In this embodiment, the cryllA promoter and its mRNA processing/stabilizing sequence are preferably placed downstream of the other promoter sequence(s) constituting the tandem promoter and upstream of the coding sequence of the gene of interest.

The isolated nucleic acid sequence encoding the desired enzyme(s) involved in hyaluronic acid production may then be further manipulated to improve expression of the nucleic acid sequence. Expression will be understood to include any step involved in the production of the polypeptide including, but not limited to, transcription, posttranscriptional modification, translation, post-translational modification, and secretion.

The techniques for modifying nucleic acid sequences utilizing cloning methods are well known in the art.

A nucleic acid construct comprising a nucleic acid sequence encoding an enzyme may be operably linked to one or more control sequences capable of directing the expression of the coding sequence in a Bacillus cell under conditions compatible with the control sequences.

The term "control sequences" is defined herein to include all components which are necessary or advantageous for expression of the coding sequence of a nucleic acid sequence. Each control sequence may be native or foreign to the nucleic acid sequence encoding the enzyme. In addition to promoter sequences described above, such control sequences include, but are not limited to, a leader, a signal sequence, and a transcription terminator. At a minimum, the control sequences include a promoter, and transcriptional and translational stop signals. The control sequences may be provided with linkers for the purpose of introducing specific restriction sites facilitating ligation of 00

O

O

o the control sequences with the coding region of the nucleic acid sequence encoding an T enzyme.

The control sequence may also be a suitable transcription terminator sequence, a sequence recognized by a Bacillus cell to terminate transcription. The terminator sequence is operably linked to the 3' terminus of the nucleic acid sequence encoding O the enzyme or the last enzyme of an operon. Any terminator which is functional in the 0Bacillus cell of choice may be used in the present invention.

The control sequence may also be a suitable leader sequence, a nontranslated c region of a mRNA which is important for translation by the Bacillus cell. The leader 00 sequence is operably linked to the 5' terminus of the nucleic acid sequence encoding N the enzyme. Any leader sequence which is functional in the Bacillus cell of choice may be used in the present invention.

The control sequence may also be a signal peptide coding region, which codes for an amino acid sequence linked to the amino terminus of a polypeptide which can is direct the expressed polypeptide into the cell's secretory pathway. The signal peptide coding region may be native to the polypeptide or may be obtained from foreign sources. The 5' end of the coding sequence of the nucleic acid sequence may inherently contain a signal peptide coding region naturally linked in translation reading frame with the segment of the coding region which encodes the secreted polypeptide.

Alternatively, the 5' end of the coding sequence may contain a signal peptide coding region which is foreign to that portion of the coding sequence which encodes the secreted polypeptide. The foreign signal peptide coding region may be required where the coding sequence does not normally contain a signal peptide coding region.

Alternatively, the foreign signal peptide coding region may simply replace the natural signal peptide coding region in order to obtain enhanced secretion of the polypeptide relative to the natural signal peptide coding region normally associated with the coding sequence. The signal peptide coding region may be obtained from an amylase or a protease gene from a Bacillus species. However, any signal peptide coding region capable of directing the expressed polypeptide into the secretory pathway of a Bacillus 3o cell of choice may be used in the present invention.

An effective signal peptide coding region for Bacillus cells is the signal peptide coding region obtained from the maltogenic amylase gene from Bacillus NCIB 11837, the Bacillus stearothermophilus alpha-amylase gene, the Bacillus licheniformis subtilisin gene, the Bacillus licheniformis beta-lactamase gene, the Bacillus stearothermophilus neutral proteases genes (nprT, nprS, nprM), and the Bacillus subtilis prsA gene. Further signal peptides are described by Simonen and Palva, 1993, Microbiological Reviews 57:109-137.

00

O

O

The control sequence may also be a propeptide coding region that codes for an amino acid sequence positioned at the amino terminus of a polypeptide. The resultant polypeptide is known as a proenzyme or propolypeptide (or a zymogen in some cases).

N A propolypeptide is generally inactive and can be converted to a mature active s polypeptide by catalytic or autocatalytic cleavage of the propeptide from the 0 propolypeptide. The propeptide coding region may be obtained from the genes for Bacillus subtilis alkaline protease (aprE) and Bacillus subtilis neutral protease (nprT).

SWhere both signal peptide and propeptide regions are present at the amino terminus of a polypeptide, the propeptide region is positioned next to the amino terminus

OO

0 10 of a polypeptide and the signal peptide region is positioned next to the amino terminus Sof the propeptide region.

It may also be desirable to add regulatory sequences which allow the regulation of the expression of the polypeptide relative to the growth of the host cell. Examples of regulatory systems are those which cause the expression of the gene to be turned on or is off in response to a chemical or physical stimulus, including the presence of a regulatory compound. Regulatory systems in prokaryotic systems include the lac, tac, and trp operator systems.

Expression Vectors In the methods of the present invention, a recombinant expression vector comprising a nucleic acid sequence, a promoter, and transcriptional and translational stop signals may be used for the recombinant production of an enzyme involved in hyaluronic acid production. The various nucleic acid and control sequences described above may be joined together to produce a recombinant expression vector which may include one or more convenient restriction sites to allow for insertion or substitution of the nucleic acid sequence encoding the polypeptide or enzyme at such sites.

Alternatively, the nucleic acid sequence may be expressed by inserting the nucleic acid sequence or a nucleic acid construct comprising the sequence into an appropriate vector for expression. In creating the expression vector, the coding sequence is located in the vector so that the coding sequence is operably linked with the appropriate control sequences for expression, and possibly secretion.

The recombinant expression vector may be any vector which can be conveniently subjected to recombinant DNA procedures and can bring about the expression of the nucleic acid sequence. The choice of the vector will typically depend on the compatibility of the vector with the Bacillus cell into which the vector is to be introduced. The vectors may be linear or closed circular plasmids. The vector may be an autonomously replicating vector, a vector which exists as an extrachromosomal 00

O

O

Sentity, the replication of which is independent of chromosomal replication, a plasmid, an extrachromosomal element, a minichromosome, or an artificial chromosome. The vector may contain any means for assuring self-replication.

N Alternatively, the vector may be one which, when introduced into the Bacillus cell, is integrated into the genome and replicated together with the chromosome(s) into which it O has been integrated. The vector system may be a single vector or plasmid or two or 0more vectors or plasmids which together contain the total DNA to be introduced into the genome of the Bacillus cell, or a transposon may be used.

The vectors of the present invention preferably contain an element(s) that permits integration of the vector into the Bacillus host cell's genome or autonomous replication of the vector in the cell independent of the genome.

For integration into the host cell genome, the vector may rely on the nucleic acid sequence encoding the polypeptide or any other element of the vector for integration of the vector into the genome by homologous or nonhomologous recombination.

Altematively, the vector may contain additional nucleic acid sequences for directing integration by homologous recombination into the genome of the Bacillus cell. The additional nucleic acid sequences enable the vector to be integrated into the Bacillus cell genome at a precise location in the chromosome. To increase the likelihood of integration at a precise location, the integrational elements should preferably contain a sufficient number of nucleic acids, such as 100 to 1,500 base pairs, preferably 400 to 1,500 base pairs, and most preferably 800 to 1,500 base pairs, which are highly homologous with the corresponding target sequence to enhance the probability of homologous recombination. The integrational elements may be any sequence that is homologous with the target sequence in the genome of the Bacillus cell. Furthermore, the integrational elements may be non-encoding or encoding nucleic acid sequences.

On the other hand, the vector may be integrated into the genome of the host cell by nonhomologous recombination.

For autonomous replication, the vector may further comprise an origin of replication enabling the vector to replicate autonomously in the Bacillus cell in question.

Examples of bacterial origins of replication are the origins of replication of plasmids pUB110, pE194, pTA1060, and pAMIIl permitting replication in Bacillus. The origin of replication may be one having a mutation to make its function temperature-sensitive in the Bacillus cell (see, Ehrlich, 1978, Proceedings of the National Academy of Sciences USA 75:1433).

as The vectors preferably contain one or more selectable markers which permit easy selection of transformed cells. A selectable marker is a gene the product of which provides for biocide resistance, resistance to heavy metals, prototrophy to auxotrophs, 00

O

O

and the like. Examples of bacterial selectable markers are the dal genes from Bacillus (d subtilis or Bacillus licheniformis, or markers which confer antibiotic resistance such as ampicillin, kanamycin, chloramphenicol or tetracycline resistance. Furthermore, Sselection may be accomplished by co-transformation, as described in WO 91/09129, where the selectable marker is on a separate vector.

More than one copy of a nucleic acid sequence may be inserted into the host cell to increase production of the gene product. An increase in the copy number of the O nucleic acid sequence can be obtained by integrating at least one additional copy of the Ssequence into the host cell genome or by including an amplifiable selectable marker 0 to gene with the nucleic acid sequence where cells containing amplified copies of the 0 selectable marker gene, and thereby additional copies of the nucleic acid sequence, can be selected for by cultivating the cells in the presence of the appropriate selectable agent. A convenient method for achieving amplification of genomic DNA sequences is described in WO 94/14968.

The procedures used to ligate the elements described above to construct the recombinant expression vectors are well known to one skilled in the art (see, e.g., Sambrook et al., 1989, supra).

Production In the methods of the present invention, the Bacillus host cells are cultivated in a nutrient medium suitable for production of the hyaluronic acid using methods known in the art. For example, the cell may be cultivated by shake flask cultivation, small-scale or large-scale fermentation (including continuous, batch, fed-batch, or solid state fermentations) in laboratory or industrial fermentors performed in a suitable medium and under conditions allowing the enzymes involved in hyaluronic acid synthesis to be expressed and the hyaluronic acid to be isolated. The cultivation takes place in a suitable nutrient medium comprising carbon and nitrogen sources and inorganic salts, using procedures known in the art. Suitable media are available from commercial suppliers or may be prepared according to published compositions in catalogues of the American Type Culture Collection). The secreted hyaluronic acid can be recovered directly from the medium.

The resulting hyaluronic acid may be isolated by methods known in the art. For example, the hyaluronic acid may be isolated from the nutrient medium by conventional procedures including, but not limited to, centrifugation, filtration, extraction, spray-drying, evaporation, or precipitation. The isolated hyaluronic acid may then be further purified by a variety of procedures known in the art including, but not limited to, chromatography ion exchange, affinity, hydrophobic, chromatofocusing, and size exclusion), 00

O

O

electrophoretic procedures preparative isoelectric focusing), differential solubility r. ammonium sulfate precipitation), or extraction (see, Protein Purification, J.-C.

SJanson and Lars Ryden, editors, VCH Publishers, New York, 1989).

In the methods of the present invention, the Bacillus host cells produce greater than about 4 g, preferably greater than about 6 g, more preferably greater than about 8 O g, even more preferably greater than about 10 g, and most preferably greater than about 012 g of hyaluronic acid per liter.

00 Gene deletion or replacement techniques may be used for the complete removal Sof a selectable marker gene or other undesirable gene. In such methods, the deletion of the selectable marker gene may be accomplished by homologous recombination using a plasmid that has been constructed to contiguously contain the 5' and 3' regions flanking the selectable marker gene. The contiguous 5' and 3' regions may be introduced into a is Bacillus cell on a temperature-sensitive plasmid, pE194, in association with a second selectable marker at a permissive temperature to allow the plasmid to become established in the cell. The cell is then shifted to a non-permissive temperature to select for cells that have the plasmid integrated into the chromosome at one of the homologous flanking regions. Selection for integration of the plasmid is effected by selection for the second selectable marker. After integration, a recombination event at the second homologous flanking region is stimulated by shifting the cells to the permissive temperature for several generations without selection. The cells are plated to obtain single colonies and the colonies are examined for loss of both selectable markers (see, for example, Perego, 1993, In A.L. Sonneshein, J.A. Hoch, and R. Losick, editors, Bacillus subtilis and Other Gram-Positive Bacteria, Chapter 42, American Society of Microbiology, Washington, 1993).

A selectable marker gene may also be removed by homologous recombination by introducing into the mutant cell a nucleic acid fragment comprising 5' and 3' regions of the defective gene, but lacking the selectable marker gene, followed by selecting on the counter-selection medium. By homologous recombination, the defective gene containing the selectable marker gene is replaced with the nucleic acid fragment lacking the selectable marker gene. Other methods known in the art may also be used.

U.S. Patent No. 5,891,701 discloses techniques for deleting several genes including spollAC, aprE, nprE, and amyE.

Other undesirable biological compounds may also be removed by the above described methods such as the red pigment synthesized by cypX (accession no.

BG12580) and/or yvmC (accession no. BG14121).

00

O

O

(N

In a preferred embodiment, the Bacillus host cell is unmarked with any 1 heterologous or exogenous selectable markers. In another preferred embodiment, the Bacillus host cell does not produce any red pigment synthesized by cypX and yvmC.

Isolated Nucleic Acid Sequences Encoding Polypeptides Having UDP-Glucose 6- Dehydrogenase Activity, UDP-Glucose Pyrophosphorylase Activity, or UDP-N- Acetylglucosamine Pyrophosphorylase Activity O The term "UDP-glucose 6-dehydrogenase activity" is defined herein as a UDP OC glucose:NAD 6-oxidoreductase activity which catalyzes the conversion of UDP-glucose 00 ito in the presence of 2NAD' and water to UDP-glucuronate and 2NADH. For purposes of Sthe present invention UDP-glucose 6-dehydrogenase activity is determined according to the procedure described by Jaenicke and Rudolph, 1986, Biochemistry 25: 7283-7287.

One unit of UDP-glucose 6-dehydrogenase activity is defined as 1.0 pmole of UDPglucuronate produced per minute at 25°C, pH 7.

is The term "UDP-glucose pyrophosphorylase activity" is defined herein as a UTP:O-D-glucose-1-phosphate uridylyltransferase activity which catalyzes the conversion of glucose-1-phosphate in the presence of UTP to diphosphate and UDPglucose. For purposes of the present invention UDP-glucose pyrophosphorylase activity activity is determined according to the procedure described by Kamogawa et al., 1965, J. Biochem. (Tokyo) 57: 758-765 or Hansen et al., 1966, Method Enzymol. 8: 248-253.

One unit of UDP-glucose pyrophosphorylase activity is defined as 1.0 pmole of UDPglucose produced per minute at 25 0 C, pH 7.

The term "UDP-N-acetylglucosamine pyrophosphorylase activity" is defined herein as a UTP:N-acetyl-alpha-D-glucoamine-1-phosphate uridyltransferase activity which catalyzes the conversion of N-acetyl-alpha-D-glucosamine-1-phosphate in the presence of UTP to diphosphate and UDP-N-acetyl-alpha-D-glucoamine. For purposes of the present invention, UDP-N-acetylglucosamine pyrophosphorylase activity is determined according to the procedure described by Mangin-Lecreuix et al., 1994, J.

Bacteriology 176: 5788-5795. One unit of UDP-N-acetylglucosamine pyrophosphorylase activity is defined as 1.0 pmole of UDP-N-acetyl-alpha-Dglucoamine produced per minute at 25 0 C, pH 7.

The term isolated nucleic acid sequence" as used herein refers to a nucleic acid sequence which is essentially free of other nucleic acid sequences, at least about pure, preferably at least about 40% pure, more preferably at least about 60% pure, even more preferably at least about 80% pure, and most preferably at least about pure as determined by agarose electrophoresis. For example, an isolated nucleic acid sequence can be obtained by standard cloning procedures used in genetic engineering 00

O

to relocate the nucleic acid sequence from its natural location to a different site where it L will be reproduced. The cloning procedures may involve excision and isolation of a desired nucleic acid fragment comprising the nucleic acid sequence encoding the C1 polypeptide, insertion of the fragment into a vector molecule, and incorporation of the recombinant vector into a host cell where multiple copies or clones of the nucleic acid O sequence will be replicated. The nucleic acid sequence may be of genomic, cDNA, RNA, semisynthetic, synthetic origin, or any combinations thereof.

SIn a first embodiment, the present invention relates to isolated nucleic acid C1 sequences encoding polypeptides having an amino acid sequence which has a degree 00 of identity to SEQ ID NO: 41 of at least about 75%, preferably at least about 80%, more Spreferably at least about 85%, even more preferably at least about 90%, most preferably at least about 95%, and even most preferably at least about 97%, which have UDPglucose 6-dehydrogenase activity (hereinafter "homologous polypeptides"). In a preferred embodiment, the homologous polypeptides have an amino acid sequence is which differs by five amino acids, preferably by four amino acids, more preferably by three amino acids, even more preferably by two amino acids, and most preferably by one amino acid from SEQ ID NO: 41.

In another first embodiment, the present invention relates to isolated nucleic acid sequences encoding polypeptides having an amino acid sequence which has a degree of identity to SEQ ID NO: 43 of at least about 90%, preferably at least about 95%, and more preferably at least about 97%, which have UDP-glucose pyrophosphorylase activity (hereinafter "homologous polypeptides"). In a preferred embodiment, the homologous polypeptides have an amino acid sequence which differs by five amino acids, preferably by four amino acids, more preferably by three amino acids, even more preferably by two amino acids, and most preferably by one amino acid from SEQ ID NO: 43.

In another first embodiment, the present invention relates to isolated nucleic acid sequences encoding polypeptides having an amino acid sequence which has a degree of identity to SEQ ID NO: 45 of at least about 75%, preferably at least about 80%, more preferably at least about 85%, even more preferably at least about 90%, most preferably at least about 95%, and even most preferably at least about 97%, which have UDP-Nacetylglucosamine pyrophosphorylase activity (hereinafter "homologous polypeptides").

In a preferred embodiment, the homologous polypeptides have an amino acid sequence which differs by five amino acids, preferably by four amino acids, more preferably by three amino acids, even more preferably by two amino acids, and most preferably by one amino acid from SEQ ID NO: For purposes of the present invention, the degree of identity between two amino 00

O

O

acid sequences is determined by the Clustal method (Higgins, 1989, CABIOS 5: 151d 153) using the Vector NTI AlignX software package (Informax Inc., Bethesda, MD) with the following defaults: pairwise alignment, gap opening penalty of 10, gap extension C penalty of 0.1, and score matrix: blosum62mt2.

Preferably, the nucleic acid sequences of the present invention encode polypeptides that comprise the amino acid sequence of SEQ ID NO: 41, SEQ ID NO: 43, or SEQ ID NO: 45; or an allelic variant thereof; or a fragment thereof that has UDP- Sglucose 6-dehydrogenase, UDP-glucose pyrophosphorylase, or UDP-N- C acetylglucosamine pyrophosphorylase activity, respectively. In a more preferred 00 embodiment, the nucleic acid sequence of the present invention encodes a polypeptide Sthat comprises the amino acid sequence of SEQ ID NO: 41, SEQ ID NO: 43, or SEQ ID NO: 45. In another preferred embodiment, the nucleic acid sequence of the present invention encodes a polypeptide that consists of the amino acid sequence of SEQ ID NO: 41, SEQ ID NO: 43, or SEQ ID NO: 45; or an allelic variant thereof; or a fragment thereof, wherein the polypeptide fragment has UDP-glucose 6-dehydrogenase, UDPglucose pyrophosphorylase, or UDP-N-acetylglucosamine pyrophosphorylase activity, respectively. In another preferred embodiment, the nucleic acid sequence of the present invention encodes a polypeptide that consists of the amino acid sequence of SEQ ID NO: 41, SEQ ID NO: 43, or SEQ ID NO: The present invention also encompasses nucleic acid sequences which encode a polypeptide having the amino acid sequence of SEQ ID NO: 41, SEQ ID NO: 43, or SEQ ID NO: 45, which differ from SEQ ID NO: 40, SEQ ID NO: 42, or SEQ ID NO: 44 by virtue of the degeneracy of the genetic code. The present invention also relates to subsequences of SEQ ID NO: 40, SEQ ID NO: 42, or SEQ ID NO: 44 which encode fragments of SEQ ID NO: 41, SEQ ID NO: 43, or SEQ ID NO: 45, respectively, which have UDP-glucose 6-dehydrogenase, UDP-glucose pyrophosphorylase, or UDP-Nacetylglucosamine pyrophosphorylase activity, respectively.

A subsequence of SEQ ID NO: 40 is a nucleic acid sequence encompassed by SEQ ID NO: 40 except that one or more nucleotides from the 5' and/or 3' end have been deleted. Preferably, a subsequence contains at least 1020 nucleotides, more preferably at least 1080 nucleotides, and most preferably at least 1140 nucleotides. A fragment of SEQ ID NO: 41 is a polypeptide having one or more amino acids deleted from the amino and/or carboxy terminus of this amino acid sequence. Preferably, a fragment contains at least 340 amino acid residues, more preferably at least 360 amino acid residues, and most preferably at least 380 amino acid residues.

A subsequence of SEQ ID NO: 42 is a nucleic acid sequence encompassed by SEQ ID NO: 42 except that one or more nucleotides from the 5' and/or 3' end have been 00 Sdeleted. Preferably, a subsequence contains at least 765 nucleotides, more preferably at least 810 nucleotides, and most preferably at least 855 nucleotides. A fragment of SEQ ID NO: 43 is a polypeptide having one or more amino acids deleted from the amino c l and/or carboxy terminus of this amino acid sequence. Preferably, a fragment contains at least 255 amino acid residues, more preferably at least 270 amino acid residues, and O most preferably at least 285 amino acid residues.

A subsequence of SEQ ID NO: 44 is a nucleic acid sequence encompassed by SEQ ID NO: 44 except that one or more nucleotides from the 5' and/or 3' end have been 00 deleted. Preferably, a subsequence contains at least 1110 nucleotides, more preferably at least 1200 nucleotides, and most preferably at least 1290 nucleotides. A fragment of C^ SEQ ID NO: 45 is a polypeptide having one or more amino acids deleted from the amino and/or carboxy terminus of this amino acid sequence. Preferably, a fragment contains at least 370 amino acid residues, more preferably at least 400 amino acid residues, and most preferably at least 430 amino acid residues.

is An allelic variant denotes any of two or more alternative forms of a gene occupying the same chromosomal locus. Allelic variation arises naturally through mutation, and may result in polymorphism within populations. Gene mutations can be silent (no change in the encoded polypeptide) or may encode polypeptides having altered amino acid sequences. The allelic variant of a polypeptide Is a polypeptide encoded by an allelic variant of a gene.

In a second embodiment, the present invention relates to isolated nucleic acid sequences which have a degree of homology to SEQ ID NO: 40 of at least about preferably at least about 80%, more preferably at least about 85%, even more preferably at least about 90%, most preferably at least about 95%, and even most preferably at least about 97%.

In another second embodiment, the present invention relates to isolated nucleic acid sequences which have a degree of homology to SEQ ID NO: 42 of at least about preferably at least about 95%, and more preferably at least about 97%.

In another second embodiment, the present invention relates to isolated nucleic acid sequences which have a degree of homology to SEQ ID NO: 44 of at least about preferably at least about 80%, more preferably at least about 85%, even more preferably at least about 90%, most preferably at least about 95%, and even most preferably at least about 97%.

For purposes of the present invention, the degree of homology between two nucleic acid sequences is determined by the Vector NTI AlignX software package (Informax Inc., Bethesda, MD) using the following defaults: pairwise alignment, gap opening penalty of 15, gap extension penalty of 6.6, and score matrix: swgapdnamt.

00

O

0 In a third embodiment, the present invention relates to isolated nucleic acid T sequences encoding polypeptides having UDP-glucose 6-dehydrogenase, UDP-glucose pyrophosphorylase, or UDP-N-acetylglucosamine pyrophosphorylase activity, which hybridize under very low stringency conditions, preferably low stringency conditions, more preferably medium stringency conditions, more preferably medium-high stringency Sconditions, even more preferably high stringency conditions, and most preferably very 0high stringency conditions with the nucleic acid sequence of SEQ ID NO: 40, SEQ ID NO: 42, or SEQ ID NO: 44, (ii) the cDNA sequence contained in SEQ ID NO: 40, SEQ C ID NO: 42, or SEQ ID NO: 44, or (iii) a complementary strand of or (ii) Sambrook, 00 E.F. Fritsch, and T. Maniatus, 1989, Molecular Cloning, A Laboratory Manual, 2d ,S edition, Cold Spring Harbor, New York). The subsequence of SEQ ID NO: 40, SEQ ID NO: 42, or SEQ ID NO: 44 may be at least 100 nucleotides or preferably at least 200 nucleotides. Moreover, the respective subsequence may encode a polypeptide fragment which has UDP-glucose 6-dehydrogenase, UDP-glucose pyrophosphorylase, s1 or UDP-N-acetylglucosamine pyrophosphorylase activity.

The nucleic acid sequence of SEQ ID NO: 40, SEQ ID NO: 42, or SEQ ID NO: 44, or subsequences thereof, as well as the amino acid sequence of SEQ ID NO: 41, SEQ ID NO: 43, or SEQ ID NO: 45, or a fragment thereof, may be used to design nucleic acid probes to identify and clone DNA encoding polypeptides having UDPglucose 6-dehydrogenase, UDP-glucose pyrophosphorylase, or UDP-Nacetylglucosamine pyrophosphorylase activity, respectively, from strains of different genera or species according to methods well known in the art. In particular, such probes can be used for hybridization with the genomic or cDNA of the genus or species of interest, following standard Southern blotting procedures, in order to identify and isolate the corresponding gene therein. Such probes can be considerably shorter than the entire sequence, but should be at least 15, preferably at least 25, and more preferably at least 35 nucleotides in length. Longer probes can also be used. Both DNA and RNA probes can be used. The probes are typically labeled for detecting the corresponding gene (for example, with 32 p, 3 H, 5S, biotin, or avidin). Such probes are 3o encompassed by the present invention.

Thus, a genomic DNA or cDNA library prepared from such other organisms may be screened for DNA which hybridizes with the probes described above and which encodes a polypeptide having UDP-glucose 6-dehydrogenase, UDP-glucose pyrophosphorylase, or UDP-N-acetylglucosamine pyrophosphorylase activity. Genomic or other DNA from such other organisms may be separated by agarose or polyacrylamide gel electrophoresis, or other separation techniques. DNA from the libraries or the separated DNA may be transferred to and immobilized on nitrocellulose 00 or other suitable carrier material. In order to identify a clone or DNA which is homologous with SEQ ID NO: 40, SEQ ID NO: 42, or SEQ ID NO: 44, or a subsequence thereof, the carrier material is used in a Southern blot. For purposes of the present N invention, hybridization indicates that the nucleic acid sequence hybridizes to a labeled s nucleic acid probe corresponding to the nucleic acid sequence shown in SEQ ID NO: _O 40, SEQ ID NO: 42, or SEQ ID NO: 44, its complementary strand, or a subsequence 0thereof, under very low to very high stringency conditions. Molecules to which the 0nucleic acid probe hybridizes under these conditions are detected using X-ray film.

00 In a preferred embodiment, the nucleic acid probe is a nucleic acid sequence 0to which encodes the polypeptide of SEQ ID NO: 41, SEQ ID NO: 43, or SEQ ID NO: C or a subsequence thereof. In another preferred embodiment, the nucleic acid probe is SEQ ID NO: 40, SEQ ID NO: 42, or SEQ ID NO: 44. In another preferred embodiment, the nucleic acid probe is the nucleic acid sequence contained in plasmid pMRT106 which is contained in Escherichia coil NRRL B-30536, wherein the nucleic acid is sequence encodes polypeptides having UDP-glucose 6-dehydrogenase, UDP-glucose pyrophosphorylase, and UDP-N-acetylglucosamine pyrophosphorylase activity.

For long probes of at least 100 nucleotides in length, very low to very high stringency conditions are defined as prehybridization and hybridization at 42*C in SSPE, 0.3% SDS, 200 pig/ml sheared and denatured salmon sperm DNA, and either 25% formamide for very low and low stringencies, 35% formamide for medium and ,medium-high stringencies, or 50% formamide for high and very high stringencies, following standard Southern blotting procedures.

For long probes of at least 100 nucleotides in length, the carrier material is finally washed three times each for 15 minutes using 2 x SSC, 0.2% SDS preferably at least at 45°C (very low stringency), more preferably at least at 50C (low stringency), more preferably at least at 55°C (medium stringency), more preferably at least at (medium-high stringency), even more preferably at least at 65*C (high stringency), and most preferably at least at 70 0 C (very high stringency).

For short probes which are about 15 nucleotides to about 70 nucleotides in length, stringency conditions are defined as prehybridization, hybridization, and washing post-hybridization at 5 0 C to 10°C below the calculated Tm using the calculation according to Bolton and McCarthy (1962, Proceedings of the National Academy of Sciences USA 48:1390) in 0.9 M NaCI, 0.09 M Tris-HCI pH 7.6, 6 mM EDTA, 0.5% NP- 1X Denhardt's solution, 1 mM sodium pyrophosphate, 1 mM sodium monobasic phosphate, 0.1 mM ATP, and 0.2 mg of yeast RNA per ml following standard Southern blotting procedures.

For short probes which are about 15 nucleotides to about 70 nucleotides in 00 length, the carrier material is washed once in 6X SCC plus 0.1% SDS for 15 minutes and twice each for 15 minutes using 6X SSC at 5°C to 10"C below the calculated Tm.

In a fourth embodiment, the present invention relates to isolated nucleic acid C sequences which encode variants of the polypeptide having an amino acid sequence of s SEQ ID NO: 41, SEQ ID NO: 43, or SEQ ID NO: 45 comprising a substitution, deletion, and/or insertion of one or more amino acids.

The amino acid sequences of the variant polypeptides may differ from the amino Sacid sequence of SEQ ID NO: 41, SEQ ID NO: 43, or SEQ ID NO: 45, by an insertion or CN deletion of one or more amino acid residues and/or the substitution of one or more 00 0 o amino acid residues by different amino acid residues. Preferably, amino acid changes are of a minor nature, that is conservative amino acid substitutions that do not significantly affect the folding and/or activity of the protein; small deletions, typically of one to about 30 amino acids; small amino- or carboxyl-terminal extensions, such as an amino-terminal methionine residue; a small linker peptide of up to about 20-25 residues; is or a small extension that facilitates purification by changing net charge or another function, such as a poly-histidine tract, an antigenic epitope or a binding domain.

Examples of conservative substitutions are within the group of basic amino acids (arginine, lysine and histidine), acidic amino acids (glutamic acid and aspartic acid), polar amino acids (glutamine and asparagine), hydrophobic amino acids (leucine, isoleucine and valine), aromatic amino acids (phenylalanine, tryptophan and tyrosine), and small amino acids (glycine, alanine, serine, threonine and methionine). Amino acid substitutions which do not generally alter the specific activity are known in the art and are described, for example, by H. Neurath and R.L. Hill, 1979, In, The Proteins, Academic Press, New York. The most commonly occurring exchanges are Ala/Ser, Val/lle, Asp/Glu, Thr/Ser, Ala/Gly, Ala/Thr, Ser/Asn, AlaNal, Ser/Gly, Tyr/Phe, Ala/Pro, Lys/Arg, Asp/Asn, Leu/lle, Leu/Val, Ala/Glu, and Asp/Gly as well as these in reverse.

Modification of a nucleic acid sequence of the present invention may be necessary for the synthesis of polypeptides substantially similar to the polypeptide. The term "substantially similar" to the polypeptide refers to non-naturally occurring forms of the polypeptide. These polypeptides may differ in some engineered way from the polypeptide isolated from its native source, variants that differ in specific activity, thermostability, pH optimum, or the like. The variant sequence may be constructed on the basis of the nucleic acid sequence presented as the polypeptide encoding part of SEQ ID NO: 40, SEQ ID NO: 42, or SEQ ID NO: 44, a subsequence thereof, and/or by introduction of nucleotide substitutions which do not give rise to another amino acid sequence of the polypeptide encoded by the nucleic acid sequence, but which corresponds to the codon usage of the host organism intended for production of the Senzyme, or by introduction of nucleotide substitutions which may give rise to a different T amino acid sequence. For a general description of nucleotide substitution, see, e.g., Ford et al., 1991, Protein Expression and Purification 2: 95-107.

It will be apparent to those skilled in the art that such substitutions can be made s outside the regions critical to the function of the molecule and still result in an active polypeptide. Amino acid residues essential to the activity of the polypeptide encoded by the isolated nucleic acid sequence of the invention, and therefore preferably not subject Sto substitution, may be identified according to procedures known in the art, such as site- 00 directed mutagenesis or alanine-scanning mutagenesis (see, Cunningham and Wells, 1989, Science 244: 1081-1085). In the latter technique, mutations are introduced C at every positively charged residue in the molecule, and the resultant mutant molecules are tested for enzyme activity to identify amino acid residues that are critical to the activity of the molecule. Sites of substrate-enzyme interaction can also be determined by analysis of the three-dimensional structure as determined by such techniques as is nuclear magnetic resonance analysis, crystallography or photoaffinity labelling (see, de Vos et 1992, Science 255: 306-312; Smith et al., 1992, Journal of Molecular Biology 224: 899-904; Wlodaver et al., 1992, FEBS Letters 309: 59-64).

The polypeptides encoded by the isolated nucleic acid sequences of the present invention have at least 20%, preferably at least 40%, more preferably at least 60%, even more preferably at least 80%, even more preferably at least 90%, and most preferably at least 100% of the UDP-glucose 6-dehydrogenase activity of the polypeptide of SEQ ID NO: 41, the UDP-glucose pyrophosphorylase activity of the polypeptide of SEQ ID NO: 43, or the UDP-N-acetylglucosamine pyrophosphorylase activity of the polypeptide of SEQ ID NO: The nucleic acid sequences of the present invention may be obtained from microorganisms of any genus. For purposes of the present invention, the term "obtained from" as used herein in connection with a given source shall mean that the polypeptide encoded by the nucleic acid sequence is produced by the source or by a cell in which the nucleic acid sequence from the source has been inserted. In a preferred embodiment, the polypeptide encoded by a nucleic acid sequence of the present invention is secreted extracellularly.

The nucleic acid sequences may be obtained from a bacterial source. For example, these polypeptides may be obtained from a gram positive bacterium such as a Bacillus strain, Bacillus agaradherens, Bacillus alkalophilus, Bacillus amyloliquefaciens, Bacillus brevis, Bacillus circulahs, Bacillus clausii, Bacillus coagulans, Bacillus lautus, Bacillus lentus, Bacillus licheniformis, Bacillus megaterium, Bacillus stearothermophilus, Bacillus subtilis, or Bacillus thuringiensis; or a 00 0 Streptomyces strain, Streptomyces lividans or Streptomyces murinus; or from a gram negative bacterium, E. coli or Pseudomonas sp.

In a preferred embodiment, the nucleic acid sequences are obtained from a NC Streptococcus or Pastuerella strain.

In a more preferred embodiment, the nucleic acid sequences are obtained from a 0 Streptococcus equisimilis, Streptococcus pyogenes, Streptococcus uberis, or Streptococcus equi subs. zooepidemicus strain, or a Pasteurella multocida strain.

SIn a most preferred embodiment, the nucleic acid sequences are obtained from SStreptococcus equisimilis, the nucleic acid sequence set forth in SEQ ID NO:

OO

0 10 SEQ ID NO: 42, or SEQ ID NO: 44. In another most preferred embodiment, the nucleic Sacid sequence is the sequence contained in plasmid pMRT106 which is contained in Escherichia coli NRRL B-30536. In further most preferred embodiment, the nucleic acid sequence is SEQ ID NO: 40, SEQ ID NO: 42, or SEQ ID NO: 44.

Strains of these species are readily accessible to the public in a number of culture collections, such as the American Type Culture Collection (ATCC), Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (DSM), Centraalbureau Voor Schimmelcultures (CBS), and Agricultural Research Service Patent Culture Collection, Northern Regional Research Center (NRRL).

Furthermore, such nucleic acid sequences may be identified and obtained from other sources including microorganisms isolated from nature soil, composts, water, etc.) using the above-mentioned probes. Techniques for isolating microorganisms from natural habitats are well known in the art. The nucleic acid sequence may then be derived by similarly screening a genomic or cDNA library of another microorganism. Once a nucleic acid sequence encoding a polypeptide has been detected with the probe(s), the sequence may be isolated or cloned by utilizing techniques which are known to those of ordinary skill in the art (see, Sambrook et al., 1989, supra).

The present invention also relates to mutant nucleic acid sequences comprising at least one mutation in the polypeptide coding sequence of SEQ ID NO: 40, SEQ ID NO: 42, and SEQ ID NO: 44, in which the mutant nucleic acid sequence encodes a polypeptide which consists of SEQ ID NO: 42, SEQ ID NO: 43, and SEQ ID NO: respectively.

The techniques used to isolate or clone a nucleic acid sequence encoding a polypeptide are known in the art and include isolation from genomic DNA, preparation from cDNA, or a combination thereof. The cloning of the nucleic acid sequences of the present invention from such genomic DNA can be effected, by using the well known polymerase chain reaction (PCR) or antibody screening of expression libraries to 00

O

O

Sdetect cloned DNA fragments with shared structural features. See, Innis et al., 1990, PCR: A Guide to Methods and Application, Academic Press, New York. Other nucleic acid amplification procedures such as ligase chain reaction (LCR), ligated

C

activated transcription (LAT) and nucleic acid sequence-based amplification (NASBA) s may be used. The nucleic acid sequence may be cloned from a strain of Streptococcus, O or another or related organism and thus, for example, may be an allelic or species 0variant of the polypeptide encoding region of the nucleic acid sequence.

The present invention also relates to nucleic acid constructs comprising a nucleic "0 acid sequence of the present invention operably linked to one or more control to sequences which direct the expression of the coding sequence in a suitable host cell CN under conditions compatible with the control sequences.

The present invention also relates to recombinant expression vectors comprising a nucleic acid sequence of the present invention, a promoter, and transcriptional and translational stop signals.

The present invention also relates to recombinant host cells, comprising a nucleic acid sequence of the invention, which are advantageously used in the recombinant production of the polypeptides.

The present invention also relates to methods for producing a polypeptide having UDP-N-acetylglucosamine pyrophosphorylase activity comprising cultivating a host cell under conditions suitable for production of the polypeptide; and recovering the polypeptide.

In the production methods of the present invention, the cells are cultivated in a nutrient medium suitable for production of the polypeptide using methods known in the art. For example, the cell may be cultivated by shake flask cultivation, and small-scale or large-scale fermentation (including continuous, batch, fed-batch, or solid state fermentations) in laboratory or industrial fermentors performed in a suitable medium and under conditions allowing the polypeptide to be expressed and/or isolated. The cultivation takes place in a suitable nutrient medium comprising carbon and nitrogen sources and inorganic salts, using procedures known in the art. Suitable media are available from commercial suppliers or may be prepared according to published compositions in catalogues of the American Type Culture Collection). If the polypeptide is secreted into the nutrient medium, the polypeptide can be recovered directly from the medium. If the polypeptide is not secreted, it can be recovered from cell lysates.

The polypeptides may be detected using methods known in the art that are specific for the polypeptides. These detection methods may include use of specific antibodies, formation of an enzyme product, or disappearance of an enzyme substrate.

00

O

O

(N

For example, an enzyme assay may be used to determine the activity of the polypeptide as described herein.

The resulting polypeptide may be recovered by methods known in the art. For C example, the polypeptide may be recovered from the nutrient medium by conventional s procedures including, but not limited to, centrifugation, filtration, extraction, spray-drying, evaporation, or precipitation.

The polypeptides may be purified by a variety of procedures known in the art Sincluding, but not limited to, chromatography ion exchange, affinity, hydrophobic, c chromatofocusing, and size exclusion), electrophoretic procedures preparative

OO

isoelectric focusing), differential solubility ammonium sulfate precipitation), SDS- SPAGE, or extraction (see, Protein Purification, Janson and Lars Ryden, editors, VCH Publishers, New York, 1989).

The presentinvention further relates to the isolated polypeptides having UDPglucose 6-dehydrogenase, UDP-glucose pyrophosphorylase, or UDP-Nacetylglucosamine pyrophosphorylase activity encoded by the nucleic acid sequences described above.

The present invention is further described by the following examples which should not be construed as limiting the scope of the invention.

Examples Primers and Oligos All primers and oligos were purchased (MWG Biotech Inc., High Point, NC) Example 1: PCR amplification and cloning of the Streptococcus equisimilis hasA gene and the Bacillus subtilis tuaD, gtaB, and gcaD genes The Streptococcus equisimilis hyaluronan synthase gene (hasA, accession number AF023876, SEQ ID NOs: 1 [DNA sequence] and 2 [deduced amino acid sequence]) was PCR amplified from plasmid pKKseD (Weigel, 1997, Journal of Biological Chemistry 272: 32539-32546) using primers 1 and 2: Primer 1: 5'-GAGCTCTATAAAAATGAGGAGGGAACCGAATGAGAACATTAAAAAACCT-3'(SEQ ID NO: 3) Primer 2: 5'-GTTAACGAATTCAGCTATGTAGGTACCTTATATAATTTTTTACGTGT-3' (SEQ ID NO: 4) 00

O

PCR amplifications were conducted in triplicate in 50 pl reactions composed of 1 ng of pKKseD DNA, 0.4 pM each of primers 1 and 2, 200 pM each of dATP, dCTP, dGTP, and dTTP, 1X PCR Buffer II (Applied Biosystems, Inc., Foster City, CA) with l mM MgCl 2 and 2.5 units of AmpliTaq Gold" T DNA polymerase (Applied Biosystems, s Inc., Foster City, CA). The reactions were performed in a RoboCycler 40 thermacycler (Stratagene, Inc., La Jolla, CA) programmed for 1 cycle at 95°C for 9 minutes; 3 cycles each at 95°C for 1 minute, 52°C for 1 minute, and 72"C for 1 minute; 27 cycles each at for 1 minute, 55°C for 1 minute, and 72°C for 1 minute; and 1 cycle at 72 0 C for minutes. The PCR product was visualized using a 0.8% agarose gel with 44 mM Tris 00 Base, 44 mM boric acid, 0.5 mM EDTA buffer (0.5X TBE). The expected fragment was approximately 1200 bp.

The 1200 bp PCR fragment was cloned into pCR2.1 using the TA-TOPO Cloning Kit (Stratagene, Inc., La Jolla, CA) and transformed into E. coli OneShotTM competent cells according to the manufacturers' instructions (Stratagene, Inc., La Jolla, CA).

Is Transformants were selected at 370C after 16 hours of growth on 2X yeast-tryptone (YT) agar plates supplemented with 100 jig of ampicillin per ml. Plasmid DNA from these transformants was purified using a QIAGEN robot (QIAGEN, Valencia, CA) according to the manufacturer's instructions and the DNA sequence of the inserts confirmed by DNA sequencing using M13 forward and M13 reverse primers (Invitrogen, Inc, Carlsbad, CA) and the following internal primers. The plasmid harboring the 1200 bp PCR fragment was designated pCR2.1-sehasA (Figure 3).

Primer 3: 5'-GTTGACGATGGAAGTGCTGA-3' (SEQ ID NO: Primer 4: 5'-ATCCGTTACAGGTAATATCC-3' (SEQ ID NO: 6) Primer 5'-TCCTTTTGTAGCCCTATGGA-3' (SEQ ID NO: 7) Primer 6: 5'-TCAGCACTTCCATCGTCAAC-3' (SEQ ID NO: 8) Primer 7: 5'-GGATATTACCTGTAACGGAT-3' (SEQ ID NO: 9) Primer 8: 5'-TCCATAGGGCTACAAAAGGA-3' (SEQ ID NO: The Bacillus subtilis UDP-glucose-6-dehydrogenase gene (tuaD, accession 3s number BG12691, SEQ ID NOs: 11 [DNA sequence] and 12 [deduced amino acid sequence]) was PCR amplified from Bacillus subtilis 168 (BGSC 1A1, Bacillus Genetic Stock Center, Columbus, OH) using primers 9 and 00

O

O

SPrimer 9: rT 5'-GGTACCGACACTGCGACCATTATAAA-3' (SEQ ID NO: 13) Primer C 5'-GTTAACGAATTCCAGCTATGTATCTAGACAGCTTCAACCAAGTAACACT-3' (SEQ ID NO: 14) O PCR amplifications were carried out in triplicate in 30 pl reactions composed of O 50 ng of Bacillus subtilis 168 chromosomal DNA, 0.3 pM each of primers 9 and 10, 200 SpM each of dATP, dCTP, dGTP, and dTTP, 1X PCR Buffer II with 2.5 mM MgCI 2 and 00 2.5 units of AmpliTaq GoldTM DNA polymerase. The reactions were performed in a RoboCycler 40 programmed for 1 cycle at 95 0 C for 9 minutes; 5 cycles each at 95*C for NC 1 minute, 50*C for 1 minute, and 72°C for 1.5 minutes; 32 cycles each at 95*C for 1 minute, 54*C for 1 minute, and 72*C for 1.5 minute; and 1 cycle at 72 0 C for 7 minutes.

The PCR product was visualized in a 0.8% agarose gel using 0.5X TBE buffer. The expected fragment was approximately 1400 bp.

is The 1400 bp PCR fragment was cloned into pCR2.1 using the TA-TOPO Cloning Kit and transformed into E. coli OneShot T competent cells according to the manufacturers' instructions. Plasmid DNA was purified using a QIAGEN robot according to the manufacturer's instructions and the DNA sequence of the inserts confirmed by DNA sequencing using M13 forward and M13 reverse primers and the following intemal primers. The plasmid harboring the 1400 bp PCR fragment was designated pCR2.1-tuaD (Figure 4).

Primer 11: 5'-AGCATCTTAACGGCTACAAA-3' (SEQ ID NO: Primer 12: 5'-TGTGAGCGAGTCGGCGCAGA-3' (SEQ ID NO: 16) Primer 13: 5'-GGGCGCCCATGTAAAAGCAT-3' (SEQ ID NO: 17) Primer 14: 5'-TTTGTAGCCGTrAAGATGCT-3' (SEQ ID NO: 18) Primer 5'-TCTGCGCCGACTCGCTCACA-3' (SEQ ID NO: 19) Primer 16: 5'-ATGCTTTTACATGGGCGCCC-3' (SEQ ID NO: The Bacillus subtilis UTP-glucose-1-phosphate uridylyltransferase gene (gtaB, accession number BG10402, SEQ ID NOs: 21 [DNA sequence] and 22 [deduced amino acid sequence]) was PCR amplified from Bacillus subtilis 168 using primers 17 and 18: Primer 17: 5'-TCTAGATTTTTCGATCATAAGGAAGGT-3' (SEQ ID NO: 23) 00

O

O

Primer 18: T GTTAACGAATTCCAGCTATGTAGGATCCAATGTCCAATAGCCTTTTTGT-3' (SEQ ID NO: 24) PCR amplifications were carried out in triplicate in 30 pl reactions composed of 50 ng of Bacillus subtilis 168 chromosomal DNA, 0.3 pM each of primers 17 and 18, 200 AM each of dATP, dCTP, dGTP, and dTTP, 1X PCR Buffer II with 2.5 mM MgCl 2 and units of AmpliTaq Gold T DNA polymerase. The reactions were performed in a 0RoboCycler 40 programmed for 1 cycle at 95°C for 9 minutes; 5 cycles each at 95 0 C for 00 1 minute, 50 0 C for 1 minute, and 72*C for 1.5 minutes; 32 cycles each at 95 0 C for 1 minute, 54 0 C for 1 minute, and 72 0 C for 1.5 minute; and 1 cycle at 72 0 C for 7 minutes.

C The PCR product was visualized in a 0.8% agarose-0.5X TBE gel. The expected fragment was approximately 900 bp.

The 900 bp PCR fragment was cloned into pCR2.1 using the TA-TOPO cloning kit and transformed into E. coli OneShot T competent cells according to the manufacturer's instructions. Plasmid DNA was purified using a QIAGEN robot according to the manufacturer's instructions and the DNA sequence of the inserts confirmed by DNA sequencing using M13 forward and M13 reverse primers and the following internal primers. The plasmid harboring the 900 bp PCR fragment was designated pCR2.1-gtaB (Figure Primer 19: 5'-AAAAAGGCTTCTAACCTGGC-3' (SEQ ID NO: Primer 5'-AAACCGCCTAAAGGCACAGC-3' (SEQ ID NO: 26) Primer 21: 5'-GCCAGGTTAGAAGCCTTTTT-3' (SEQ ID NO: 27) Primer 22: 5'-GCTGTGCCTTTAGGCGGTTT-3' (SEQ ID NO: 28) The Bacillus subtilis UDP-N-acetylglucosamine pyrophosphorylase gene (gcaD, accession number BG10113, SEQ ID NOs: 29 [DNA sequence] and 30 [deduced amino acid sequence]) was PCR amplified from Bacillus subtilis 168 using primers 23 and 24: Primer 23: 5'-GGATCCTTTCTATGGATAAAAGGGAT-3' (SEQ ID NO: 31) Primer 24: 5'-GTTAACAGGATTATTTTTTATGAATATTTTT-3' (SEQ ID NO: 32) PCR amplifications were carried out in triplicate in 30 pl reactions composed of ng of Bacillus subtilis 168 chromosomal DNA, 0.3 AM each of primers 23 and 24, 200 .M each of dATP, dCTP, dGTP, and dTTP, 1X PCR Buffer II with 2.5 mM MgCI 2 and units of AmpliTaq Gold T DNA polymerase. The reactions were performed in a RoboCycler 40 programmed for 1 cycle at 95 0 C for 9 minutes; 5 cycles each at 95°C for 00

O

O

1 minute, 50 0 C for 1 minute, and 72*C for 1.5 minutes; 32 cycles each at 95C for 1 D minute, 54°C for 1 minute, and 72"C for 1.5 minute; and 1 cycle at 72°C for 7 minutes.

The PCR product was visualized in a 0.8% agarose-0.5X TBE gel. The expected C fragment was approximately 1500 bp.

s The 1500 bp PCR fragment was cloned into pCR2.1 using the TA-TOPO cloning kit and transformed into E. coli OneShotTM competent cells according to the manufacturer's instructions. Plasmid DNA was purified using a QIAGEN robot Saccording to the manufacturer's instructions and the DNA sequence of the inserts Ci confirmed by DNA sequencing using M13 forward and M13 reverse primers and 00 the following internal primers. The plasmid harboring the 900 bp PCR fragment was Sdesignated pCR2.1-gcaD (Figure 6).

Primer 5'-CAGAGACGATGGAACAGATG-3' (SEQ ID NO: 33) Primer 26: 5'-GGAGTTAATGATAGAGTTGC-3' (SEQ ID NO: 34) Primer 27: 5'-GAAGATCGGGAATTTTGTAG-3' (SEQ ID NO: Primer 28: 5'-CATCTGTTCCATCGTTCTCG-3' (SEQ ID NO: 36) Primer 29: 5'-GCAACTCTATCATTAACTCC-3' (SEQ ID NO: 37) Primer CTACAAAATTCCCGATCT-3' (SEQ ID NO: 38) Example 2: Construction of the hasA/tuaD/gtaB operon Plasmids pDG268Aneo-crylllAstab/Sav Patent No. 5,955,310) and pCR2.1-tuaD (Example 1, Figure 4) were digested with KpnI and Hpal. The digestions were resolved on a 0.8% agarose gel using 0.5X TBE buffer and the larger vector fragment (approximately 7700 bp) from pDG268Aneo-crylllAstablSav and the smaller tuaD fragment (approximately 1500 bp) from pCR2.1-tuaD were gel-purified using the QIAquick DNA Extraction kit according to the manufacturer's instructions (QIAGEN, Valencia, CA). The two purified fragments were ligated together with T4 DNA ligase according to the manufacturer's instructions (Roche Applied Science; Indianapolis, IN) and the ligation mix was transformed into E. coli SURE competent cells (Stratagene, Inc., La Jolla, CA). Transformants were selected on 2X YT agar plates supplemented with 100 pg of ampicillin per ml.

Plasmid DNA was purified from several transformants using a QIAGEN robot 00

O

according to the manufacturer's instructions and analyzed by Kpnl plus Hpal digestion CT on a 0.8% agarose gel using 0.5X TBE buffer. The correct plasmid was identified by the presence of an approximately 1500 bp KpnllHpal tuaD fragment and was designated pHA1 (Figure 7).

s Plasmids pHA1 and pCR2.1-gtaB (Example 1, Figure 5) were digested with Xbal and Hpal. The digestions were resolved on a 0.8% agarose gel using 0.5X TBE buffer and the larger vector fragment from pHA1 (approximately 9200 bp) and the smaller gtaB Sfragment (approximately 900 bp) from pCR2.1-gtaB were gel-purified from a 0.8% 00 agarose-0.5X TBE buffer gel using the QIAquick DNA Extraction Kit according to the manufacturer's instructions. These two purified fragments were ligated together with T4 CN DNA ligase and the ligation mix was used to transform E. coli SURE competent cells.

Transformants were selected on 2X YT agar plates supplemented with 100 pg of ampicillin per ml at 37°C Plasmids were purified from several transformants using a QIAGEN robot is according to the manufacturer's instructions and analyzed by Xbal plus Hpal digestion.

The digestions were resolved on a 0.8% agarose-0.5X TBE buffer gel. The correct plasmid was identified by the presence of an approximately 900 bp XballHpal gtaB fragment and was designated pHA2 (Figure 8).

Plasmids pHA2 and pCR2.1-sehasA (Example 1, Figure 3) were digested with Sad plus Kpnl. The digestions were resolved on a 0.8% agarose-0.5X TBE buffer gel.

The larger vector fragment (approximately 10000 bp) from pHA2 and the smaller hasA fragment (approximately 1300 bp) from pCR2.1-sehasA were gel-purified from a 0.8% TBE buffer gel using the QIAquick DNA Extraction kit according to the manufacturer's instructions. The two purified fragments were ligated together with T4 DNA ligase and the ligation mix was used to transform E. coli SURE competent cells.

Transformants were selected on 2X YT agar plates supplemented with 100 pg of ampicillin per ml at 37"C. Plasmids were purified from several transformants using a QIAGEN robot according to the manufacturer's instructions and analyzed by Sad plus Kpnl digestion. The digestions were resolved on a 0.8% agarose-0.5X TBE buffer gel.

3o The correct plasmid was identified by the presence of an approximately 1300 bp SacllKpnl hasA fragment and was designated pHA3 (Figure 9).

Example 3: Construction of the hasAltuaD/gtaBlgcaD operon Plasmids pHA2 (Example 2, Figure 8) and pCR2.1-gcaD (Example 1, Figure 6) were digested with BamHI and Hpal. The digestions were resolved on a 0.8% agarose gel using 0.5X TBE buffer and the larger vector fragment (approximately 10,000 bp) from pHA2 and the smaller gcaD fragment (approximately 1,400 bp) from pCR2.1-gcaD 00

O

O

were gel-purified from a 0.8% agarose-0.5X TBE buffer gel using the QIAquick DNA 1^ Extraction Kit according to the manufacturers instructions. These two purified fragments were ligated together with T4 DNA ligase and the ligation mix was used to CN transform E. coli SURE competent cells. Transformants were selected on 2X YT agar plates supplemented with 100 pg of ampicillin per ml at 37*C.

O Plasmids were purified from several transformants using a QIAGEN robot according to the manufacturers instructions and analyzed by Xbal plus Hpal digestion.

The digestions were resolved on a 0.8% agarose-0.5X TBE buffer gel. The correct C plasmid was identified by the presence of an approximately 1400 bp BamHIIHpal gcaD 00 0to fragment and was designated pHA4 (Figure ,j Plasmids pHA4 and pCR2.1-sehasA (Example 1, Figure 3) were digested with Sad and Kpnl. The digestions were resolved on a 0.8% agarose-0.5X TBE buffer gel.

The larger vector fragment (approximately 11,000 bp) from pHA4 and the smaller hasA fragment (approximately 1,300 bp) from pCR2.1-sehasA were gel-purified from a 0.8% is agarose-0.5X TBE buffer gel using the QIAquick DNA Extraction kit according to the manufacturer's instructions. The two purified fragments were ligated together with T4 DNA ligase and the ligation mix was used to transform E. coli SURE competent cells.

Transformants were selected on 2X YT agar plates supplemented with 100 ptg of ampicillin per ml at 37"C. Plasmids were purified from several transformants using a QIAGEN robot according to the manufacturer's instructions and analyzed by Sad plus Kpnl digestion. The digestions were resolved on a 0.8% agarose-0.5X TBE buffer gel.

The correct plasmid was identified by the presence of an approximately 1,300 bp SacllKpnl hasA fragment and was designated pHA5 (Figure 11).

Example 4: Construction of the hasAltuaD/gcaD operon Plasmids pHA1 (Example 2, Figure 7) and pCR2.1-gcaD (Example 1, Figure 6) were digested with BamHI and Hpal. The digestions were resolved on a 0.8% agarose gel using 0.5X TBE buffer and the larger vector fragment from pHA1 (approximately 9,200 bp) and the smaller gcaD fragment (approximately 1400 bp) from pCR2.1-gcaD were gel-purified from a 0.8% agarose-0.5X TBE buffer gel using the QIAquick DNA Extraction Kit according to the manufacturer's instructions. These two purified fragments were ligated together with T4 DNA ligase and the ligation mix was used to transform E. coi SURE competent cells. Transformants were selected on 2X YT agar plates supplemented with 100 pg of ampicillin per ml at 37*C.

Plasmids were purified from several transformants using a QIAGEN robot according to the manufacturer's instructions and analyzed by BamHI plus Hpal digestion. The digestions were resolved on a 0.8% agarose-0.5X TBE buffer gel. The 00

O

correct plasmid was identified by the presence of an approximately 1400 bp BamHI/Hpal T igtaB fragment and was designated pHA6 (Figure 12).

Plasmids pHA6 and pCR2.1-sehasA (Example 1, Figure 3) were digested with Sad plus Kpnl. The digestions were resolved on a 0.8% agarose-0.5X TBE buffer gel.

s The larger vector fragment (approximately 10,200 bp) from pHA6 and the smaller hasA fragment (approximately 1,300 bp) from pCR2.1-sehasA were gel-purified from a 0.8% TBE buffer gel using the QIAquick DNA Extraction kit according to the Smanufacturer's instructions. The two purified fragments were ligated together with T4 00 DNA ligase and the ligation mix was used to transform E. coli SURE competent cells.

Transformants were selected on 2X YT agar plates supplemented with 100 p.g of CN ampicillin per ml. Plasmids were purified from several transformants using a QIAGEN robot according to the manufacturer's instructions and analyzed by Sad plus Kpnl digestion. The digestions were resolved on a 0.8% agarose-0.5X TBE buffer gel. The correct plasmid was identified by the presence of an approximately 1300 bp SacllKpnl hasA fragment and was designated pHA7 (Figure 13).

Example 5: Construction of Bacillus subtilis RB161 Plasmid pDG268MCSAneo/scBAN/Sav Patent No. 5,955,310) was digested with Sad. The digested plasmid was then purified using a QIAquick DNA Purification Kit according to the manufacturer's instructions, and finally digested with Notl. The largest plasmid fragment of approximately 6800 bp was gel-purified using a QIAquick DNA Gel Extraction Kit from a 0.8% agarose-0.5X TBE gel according to the manufacturer's instructions (QIAGEN, Valencia, CA). The recovered vector DNA was then ligated with the DNA insert described below.

Plasmid pHA3 (Example 2, Figure 9) was digested with Sad. The digested plasmid was then purified as described above, and finally digested with Notl. The smallest plasmid fragment of approximately 3800 bp was gel-purified as described above. The recovered vector and DNA insert were ligated using the Rapid DNA Cloning Kit (Roche Applied Science; Indianapolis, IN) according to the manufacturer's instructions. Prior to transformation in Bacillus subtilis, the ligation described above was linearized using Scal to ensure double cross-over integration in the chromosome rather than single cross-over integration in the chromosome. Competent cells of Bacillus subtilis 168A4 were transformed with the ligation products digested with Scal. Bacillus subtilis 168A4 is derived from the Bacillus subtilis type strain 168 (BGSC 1A1, Bacillus Genetic Stock Center, Columbus, OH) and has deletions in the spollAC, aprE, nprE, and amyE genes. The deletion of these four genes was performed essentially as described for Bacillus subtilis A164A5, which is described in detail in U.S. Patent No.

00

O

S5,891,701.

Bacillus subtilis chloramphenicol-resistant transformants were selected at 34°C after 16 hours of growth on Tryptose blood agar base (TBAB) plates supplemented with pg of chloramphenicol per ml. To screen for integration of the plasmid by double cross-over at the amyE locus, Bacillus subtilis primary transformants were patched on TBAB plates supplemented with 6 pg of neomycin per ml and on TBAB plates supplemented with 5 pg of chloramphenicol per ml. Integration of the plasmid by double cross-over at the amyE locus does not incorporate the neomycin resistance gene and N therefore renders the strain neomycin sensitive. Isolates were also patched onto 00 0to minimal plates to visualize whether or not these were producing hyaluronic acid.

Hyaluronic acid producing isolates have a "wet" phenotype on minimal plates. Using this plate screen, chloramphenicol resistant and neomycin sensitive "wet" transformants (due to hyaluronic acid production) were isolated at 37"C.

Genomic DNA was isolated from the "wet", chloramphenicol resistant, and neomycin sensitive Bacillus subtilis 168A4 transformants using a QIAGEN tip-20 column (QIAGEN, Valencia, CA) according to the manufacturer's instructions. PCR amplifications were performed on these transformants using the synthetic oligonucleotides below, which are based on the hasA, tuaD, and gtaB gene sequences, to confirm the presence and integrity of these genes in the operon of the Bacillus subtilis transformants.

The amplification reactions (25 pl) were composed of approximately 50 ng of genomic DNA of the Bacillus subtilis 168A4 transformants, 0.5 pM of each primer, 200 pM each of dATP, dCTP, dGTP, and dTTP, 1X PCR Buffer II, 3 mM MgCI 2 and 0.625 units of AmpliTaq Gold T DNA polymerase. The reactions were incubated in a RoboCycler 40 Temperature Cycler programmed for one cycle at 95°C for 9 minutes; cycles each at 95C for 1 minute, 55°C for 1 minute, and 72°C for 2 minutes; and a final cycle at 72°C for 7 minutes.

Primers 3 and 8 were used to confirm the presence of the hasA gene, primers 3 and 16 to confirm the presence of the tuaD gene, and primers 3 and 22 to confirm the presence of the gtaB gene. The Bacillus subtilis 168A4 hasA/tuaD/gtaB integrant was designated Bacillus subtilis RB158.

Genomic DNA was isolated from Bacillus subtilis RB158 using a QIAGEN column according to the manufacturer's instructions, and was used to transform competent Bacillus subtilis A164A5 (deleted at the spollAC, aprE, nprE, amyE, and srfC genes; see U.S. Patent No. 5,891,701). Transformants were selected on TBAB plates supplemented with 5 g of chloramphenicol per ml at 37°C. A Bacillus subtilis A164A5 hasA/tuaD/gtaB integrant was identified by its "wet" phenotype and-designated Bacillus 00

O

O

subtilis RB161.

Example 6: Construction of Bacillus subtilis RB163 Plasmid pDG268MCSAneo/scBAN/Sav Patent No. 5,955,310) was s digested with Sad. The digested plasmid was then purified using a QIAquick DNA Purification Kit according to the manufacturer's instructions, and finally digested with Notl. The largest plasmid fragment of approximately 6,800 bp was gel-purified using a SQIAquick DNA Gel Extraction Kit from a 0.8% agarose-0.5X TBE gel according to the 00 manufacturer's instructions. The recovered vector DNA was then ligated with the DNA insert described below.

C Plasmid pHA7 (Example 4, Figure 13) was digested with Sad. The digested plasmid was then purified as described above, and finally digested with Notl. The smallest plasmid fragment of approximately 4,300 bp was gel-purified as described above. The recovered vector and DNA insert were ligated using the Rapid DNA Cloning is Kit according to the manufacturer's instructions. Prior to transformation in Bacillus subtilis, the ligation described above was linearized using Scal to ensure double crossover integration in the chromosome rather than single cross-over integration in the chromosome. Bacillus subtilis 168A4 competent cells were transformed with the ligation digested with the restriction enzyme Scal.

Bacillus subtilis chloramphenicol-resistant transformants were selected on TBAB plates supplemented with 5 pg of chloramphenicol per ml at 37°C. To screen for integration of the plasmid by double cross-over at the amyE locus, Bacillus subtilis primary transformants were patched on TBAB plates supplemented with 6 pg of neomycin per ml and on TBAB plates supplemented with 5 pg of chloramphenicol per ml to isolate chloramphenicol resistant and neomycin sensitive "wet" transformants (due to hyaluronic acid production).

Genomic DNA was isolated from the "wet", chloramphenicol resistant, and neomycin sensitive Bacillus subtilis 168A4 transformants using a QIAGEN tip-20 column according to the manufacturer's instructions. PCR amplifications were performed on these transformants using primers 3, 8, 16, 22 and primer 30 (Example 1) to confirm the presence and integrity of these genes in the operon of the Bacillus subtilis transformants. The amplification reactions (25 pl) were composed of approximately ng of genomic DNA of the Bacillus subtilis 168A4 transformants, 0.5 pM of each primer, 200 pM each of dATP, dCTP, dGTP, and dTTP, 1X PCR buffer, 3 mM MgCI 2 and 0.625 units of AmpliTaq Gold T DNA polymerase. The reactions were incubated in a RoboCycler 40 Temperature Cycler programmed for one cycle at 95°C for 9 minutes; cycles each at 95°C for 1 minute, 55°C for 1 minute, and 720C for 2 minutes; and a final 00

O

Scycle at 72"C for 7 minutes.

SPrimers 3 and 8 were used to confirm the presence of the hasA gene, primers 3 and 16 to confirm the presence of the tuaD gene, primers 3 and 22 to confirm the C presence of the gtaB gene, and primers 3 and 30 to confirm the presence of the gcaD gene. The Bacillus subtilis 168A4 hasA/tuaD/gcaD integrant was designated Bacillus subtilis RB160.

SGenomic DNA was isolated from Bacillus subtilis RB160 using a QIAGEN column according to the manufacturer's instructions, and was used to transform c competent Bacillus subtilis A164A5. Transformants were selected on TBAB plates 00 containing 5 ig of chloramphenicol per ml, and grown at 37 0 C for 16 hours. The CN Bacillus subtilis A164A5 hasA/tuaD/gcaD integrant was identified by its "wet" phenotype and designated Bacillus subtilis RB163.

Example 7: Construction of Bacillus subtilis TH-1 The hyaluronan synthase (has) operon was obtained from Streptococcus equisimilis using the following procedure. The has operon is composed of the hasA, hasB, hasC, and hasD genes. Approximately 20 pg of Streptococcus equisimilis D181 (Kumari and Weigel, 1997, Journal of Biological Chemistry 272: 32539-32546) chromosomal DNA was digested with Hindlll and resolved on a 0.8% agarose-0.5X TBE gel. DNA in the 3-6 kb range was excised from the gel and purified using the QIAquick DNA Gel Extraction Kit according to the manufacturer's instructions. The recovered DNA insert was then ligated with the vector DNA described below.

Plasmid pUC18 (2 pg) was digested with Hindlll and the 5' protruding ends were dephosphorylated with shrimp alkaline phospatase according to the manufacturers instructions (Roche Applied Science; Indianapolis, IN). The dephosphorylated vector and DNA insert were ligated using the Rapid DNA Cloning Kit according to the manufacturer's instructions. The ligation was used to transform E. coli XL10 Gold Kan competent cells (Stratagene, Inc., La Jolla, CA). Cells were plated onto Luria broth plates (100 pg/ml ampicillin) and incubated overnight at 37°C. Five plates containing approximately 500 colonies/plate were probed with oligo 952-55-1, shown below, which is a 54 bp sequence identical to the coding strand near the 3' end of the Streptococcus equisimilis D181 hasA gene (nucleotides 1098-1151 with respect to the A residue of the ATG translation start codon).

Primer 31: 5'-GTGTCGGAACATTCATTACATGCTTAAGCACCCGCTGTCCTTCTTGT'ATCTCC-3' (SEQ ID NO: 39) The oligonucleotide probe was DIG-labeled using the DIG Oligonucleotide 3'-end 00 SLabeling Kit according to the manufacturer's instructions (Roche Applied Science; [T Indianapolis, IN). Colony hybridization and chemiluminescent detection were performed as described in "THE DIG SYSTEM USER'S GUIDE FOR FILTER HYBRIDIZATION", Boehringer

L

C Mannheim GmbH.

s Seven colonies were identified that hybridized to the probe. Plasmid DNA from one of these transformants was purified using a QIAGEN robot (QIAGEN, Valencia, CA) 0according to the manufacturer's instructions, digested with Hindlll, and resolved on a 0.8% agarose gel using 0.5X TBE buffer. The DNA insert was shown to be 00 approximately 5 kb in size. This plasmid was designated pMRT106 (Figure 14).

O 10 The DNA sequence of the cloned fragment was determined using the EZ::TN

T

NC <TET-1> Insertion Kit according to the manufacturer's instructions (Epicenter Technologies, Madison, WI). The sequencing revealed that the cloned DNA insert contained the last 1156 bp of the Streptococcus equisimilis hasA gene followed by three other genes designated hasB, hasC, and hasD; presumably all four genes are contained is within a single operon and are therefore co-transcribed. The Streptococcus equisimilis hasB gene is contained in nucleotides 1411-2613 (SEQ ID NOs: 40 [DNA sequence] and 41 [deduced amino acid sequence]) of the fragment, and Streptococcus equisimilis hasC gene in nucleotides 2666-3565 (SEQ ID NOs: 42 [DNA sequence] and 43 [deduced amino acid sequence]) of the fragment, and Streptococcus equisimilis hasD gene in nucleotides 3735-5114 (SEQ ID NOs: 44 [DNA sequence] and 45 [deduced amino acid sequence]) of the fragment.

The polypeptides encoded by the Streptococcus equisimilis hasB and hasC genes show some homology to those encoded by the hasB and hasC genes, respectively, from the Streptococcus pyogenes has operon sequence (Ferretti et al., 2001, Proc. Natl. Acad. Sci. U.S.A. 98 4658-4663). The degree of identity was determined by the Clustal method (Higgins, 1989, CABIOS 5: 151-153) using using the Vector NTI AlignX software (Informax Inc., Bethesda, MD) with the following defaults: pairwise alignment, gap opening penalty of 10, gap extension penalty of 0.1, and score matrix: blosum62mt2.

Amino acid sequence comparisons showed that the Streptococcus equisimilis HasB protein has 70% identity to the HasB protein from Streptococcus uberis (SEQ ID NO: 105); the Streptococcus equisimilis HasC protein has 91% identity to the HasC protein from Streptococcus pyogenes (SEQ ID NO: 99); and the Streptococcus equisimilis HasD protein has 73% identity to the GImU protein (a putative UDP-Nacetylglucosamine pyrophosphorylase) of Streptococcus pyogenes (accession Q8P286). The Streptococcus equisimilis hasD gene encodes a polypeptide that shows 50.7% identity to the UDP-N-acetyl-glucosamine pyrophosphorylase enzyme encoded 00

O

O

Sby the gcaD gene of Bacillus subtilis.

Plasmid pHA5 (Example 3, Figure 11) was digested with Hpal and BamHI. The Sdigestion was resolved on a 0.8% agarose gel using 0.5X TBE buffer and the larger Svector fragment (approximately 11,000 bp) was gel-purified using the QIAquick DNA s Extraction Kit according to the manufacturer's instructions. Plasmid pMRT106 was digested with Hindlll, the sticky ends were filled in with Klenow fragment, and the DNA was digested with BamHI. The digestion was resolved on a 0.8% agarose gel using TBE buffer and the smaller insert fragment (approximately 1000 bp, the last 2/3 of the Streptococcus equisimilis hasD gene) was gel-purified using the QIAquick DNA 00 Extraction kit according to the manufacturer's instructions.

The two purified fragments were ligated together with T4 DNA ligase and the ligation mix was transformed into E. coli SURE competent cells. Transformants were selected on 2X YT agar plates supplemented with 100 p.g of ampicillin per ml at 37*C.

Plasmid DNA was purified from several transformants using a QIAGEN robot is according to the manufacturer's instructions and analyzed by BamHI plus Nott digestion on a 0.8% agarose gel using 0.5X TBE buffer. The correct plasmid was identified by the presence of an approximately 1,100 bp BamHI/Notl hasD fragment and was designated pHA8 (Figure 15). This plasmid was digested with Hindlll and ligated together with T4 DNA ligase and the ligation mix was transformed into E. coli SURE competent cells.

Transformants were selected on 2X YT agar plates supplemented with 100 pig of ampicillin per ml. Plasmid DNA was purified from several transformants using a QIAGEN robot according to the manufacturer's instructions and analyzed by Hindlll digestion on a 0.8% agarose gel using 0.5X TBE buffer. The correct plasmid was identified by the presence of a single band of approximately 9,700 bp and was designated pHA9 (Figure 16).

Plasmid pHA9 was digested with Sad and Notl. The digestion was resolved on a 0.8% agarose gel using 0.5X TBE buffer and the smaller fragment of approximately 2,500 bp was gel-purified using the QIAquick DNA Extraction kit according to the manufacturer's instructions. Plasmid pDG268MCSAneo/scBAN/Sav Patent No.

5,955,310) was digested with Sad and Notl. The digestion was resolved on a 0.8% agarose gel using 0.5X TBE buffer and the larger vector fragment of approximately 6,800 bp was gel-purified using the QIAquick DNA Extraction kit according to the manufacturer's instructions. The two purified fragments were ligated together with T4 DNA ligase and the ligation mix was transformed into E coli SURE competent cells (Stratagene, Inc., La Jolla, CA). Transformants were selected on 2X YT agar plates supplemented with 100 pg of ampicillin per ml.

Plasmid DNA was purified from several transformants using a QIAGEN robot 00 Saccording to the manufacturers instructions and analyzed by Sail plus Hindlll digestion r on a 0.8% agarose gel using 0.5X TBE buffer. The correct plasmid was identified by the presence of an approximately 1600 bp Sall/Hindlll fragment and was designated rC (Figure 17).

s Plasmid pHA10 was digested with Hindlll and BamHI. The digestion was O resolved on a 0.8% agarose gel using 0.5X TBE buffer and the larger vector fragment (approximately 8100 bp) was gel-purified using the QIAquick DNA Extraction kit according to the manufacturer's instructions. Plasmid pMRT106 was digested with r Hindlll and BamHI. The digestion was resolved on a 0.8% agarose gel using 0.5X TBE 00 buffer and the larger insert fragment of approximately 4,100 bp was gel-purified using the QIAquick DNA Extraction kit according to the manufacturers instructions. The two purified fragments were ligated together with T4 DNA ligase and the ligation mix was used to transform Bacillus subtilis 168A4. Transformants were selected on TBAB agar plates supplemented with 5 pg of chloramphenicol per ml at 37°C. Approximately 100 transformants were patched onto TBAB supplemented with chloramphenicol (5 pg/ml) and TBAB supplemented with neomycin (10 pg/ml) to score chloramphenicol resistant, neomycin sensitive colonies; this phenotype is indicative of a double crossover into the amyE locus. A few such colonies were identified, all of which exhibited a "wet" phenotype indicating that hyaluronic acid was being produced. One colony was chosen and designated Bacillus subtilis 168A4::scBAN/se hasA/hasB/hasC/hasD.

Genomic DNA was isolated from Bacillus subtilis 168A4::scBAN/se hasA/hasB/hasC/hasD using a QIAGEN tip-20 column according to the manufacturer's instructions, and used to transform competent Bacillus subtilis A164A5. Transformants were selected on TBAB plates containing 5 ig of chloramphenicol per ml, and grown at 37 0 C for 16 hours. The Bacillus subtilis A164A5 hasA/hasB/hasC/hasD integrant was identified by its "wet" phenotype and designated Bacillus subtilis TH-1.

Example 8: Construction of Bacillus subtilis RB184 The hasA gene from Streptococcus equisimilis (Example 1) and tuaD gene (a Bacillus subtilis hasB homologue) (Example 1) were cloned to be under the control of a short "consensus" amyQ (scBAN) promoter Patent No. 5,955,310).

Plasmid pDG268MCSAneo/scBAN/Sav Patent No. 5,955,310) was digested with Sacl. The digested plasmid was then purified using a QIAquick DNA Purification Kit according to the manufacturer's instructions, and finally digested with Notl. The largest plasmid fragment of approximately 6,800 bp was gel-purified from a 0.8% agarose-0.5X TBE gel using a QIAquick DNA Gel Extraction Kit according to the manufacturer's instructions. The recovered vector DNA was then ligated with the DNA 00

O

O

insert described below.

Plasmid pHA5 (Example 3, Figure 11) was digested with Hpal. The digested plasmid was then purified as described above, and finally digested with Xbal. The C'1 double-digested plasmid was then blunted by first inactivating Xbal at 85"C for minutes. Blunting was performed by adding 0.5 pl of 10 mM each dNTPs, 1 pi of 1 U/pl 0 T4 DNA polymerase (Roche Applied Science; Indianapolis, IN) and incubating at 11*C for 10 minutes. Finally the polymerase was inactivated by incubating the reaction at for 10 minutes. The largest plasmid fragment of approximately 11,000 bp was C'1 then gel-purified as described above and religated using the Rapid DNA Cloning Kit

OO

0 10 according to the manufacturer's instructions. The ligation mix was transformed into E.

Scoli SURE competent cells. Transformants were selected on 2X YT agar plates supplemented with 100 Rig of ampicillin per ml at 37°C. Plasmid DNA was purified from several transformants using a QIAGEN robot according to the manufacturer's instructions and analyzed by Scal digestion on a 0.8% agarose gel using 0.5X TBE is buffer. The correct plasmid was identified by the presence of an approximately 11 kb fragment and was designated pRB157 (Figure 18).

pRB157 was digested with Sacl. The digested plasmid was then purified using a QIAquick DNA Purification Kit according to the manufacturer's instructions, and finally digested with Notl. The smallest plasmid fragment of approximately 2,632 bp was gelpurified using a QIAquick DNA Gel Extraction Kit from a 0.8% agarose-0.5X TBE gel according to the manufacturer's instructions. The recovered DNA insert was then ligated with the vector DNA described above.

Prior to transformation in Bacillus subtilis, the ligation described above was linearized using Scal to ensure double cross-over integration in the chromosome rather than single cross-over integration in the chromosome. Bacillus subtilis 168A4 competent cells were transformed with the ligation digested with the restriction enzyme Scal.

Bacillus subtilis chloramphenicol-resistant transformants were selected on TBAB plates supplemented with 5 pg of chloramphenicol per ml. To screen for integration of the plasmid by double cross-over at the amyE locus, Bacillus subtilis primary transformants were patched on TBAB plates supplemented with 6 pg of neomycin per ml and on TBAB plates supplemented with 5 pg of chloramphenicol per ml to isolate chloramphenicol resistant and neomycin sensitive "wet" transformants (due to hyaluronic acid production).

Genomic DNA was isolated from the "wet", chloramphenicol resistant, and neomycin sensitive Bacillus subtilis 168A4 transformants using a QIAGEN tip-20 column according to the manufacturer's instructions. PCR amplifications were performed on 00

O

O

these transformants using primers 3, 8, and 16 (Example 1) to confirm the presence and T integrity of hasA and tuaD in the operon of the Bacillus subtilis transformants. The amplification reactions (25 pl) were composed of approximately 50 ng of genomic DNA of the Bacillus subtilis 168A4 transformants, 0.5 pM of each primer, 200 pM each of dATP, dCTP, dGTP, and dTTP, 1X PCR buffer, 3 mM MgCl2, and 0.625 units of AmpliTaq Gold T DNA polymerase. The reactions were incubated in a RoboCycler Temperature Cycler programmed for one cycle at 95*C for 9 minutes; 30 cycles each at for 1 minute, 55°C for 1 minute, and 72°C for 2 minutes; and a final cycle at 72°C 00 for 7 minutes.

Primers 3 and 8 were used to confirm the presence of the hasA gene and c primers 3 and 16 to confirm the presence of the tuaD gene. A Bacillus subtilis 168A4 hasA/tuaD integrant was designated Bacillus subtilis RB183.

Bacillus subtilis RB183 genomic DNA was also used to transform competent Bacillus subtilis A164A5. Transformants were selected on TBAB plates containing 5 pg is of chloramphenicol per ml, and grown at 370C for 16 hours. The Bacillus subtilis A164A5 hasA/tuaD integrant was identified by its "wet" phenotype and designated Bacillus subtilis RB184.

Example 9: Construction of Bacillus subtilis RB187 Bacillus subtilis RB161 was made competent and transformed with the cat deletion plasmid pRB115 (Widner et al., 2000, Journal of Industrial Microbiology Biotechnology 25: 204-212). Selection for direct integration into the chromosome was performed at the non-permissive temperature of 450C using erythromycin (5 pg/ml) selection. At this temperature, the pE194 origin of replication is inactive. Cells are able to maintain erythromycin resistance only by integration of the plasmid into the cat gene on the bacterial chromosome. These so-called "integrants" were maintained at 450C to ensure growth at this temperature with selection. To allow for loss or "looping out" of the plasmid, which will result in the deletion of most of the cat gene from the chromosome, the integrants were grown in Luria-Bertani (LB) medium without selection at the permissive temperature of 34°C for many generations. At this temperature the pE194 origin of replication is active and promotes excision of the plasmid from the genome (Molecular Biological Methods for Bacillus, edited by C.R. Harwood and S.M. Cutting, 1990, John Wiley and Sons Ltd.).

The cells were then plated on non-selective LB agar plates and colonies which contained deletions in the cat gene and loss of the pE194-based replicon were identified by the following criteria: chloramphenicol sensitivity indicated the presence of the cat deletion; erythromycin sensitivity indicated the absence of the erythromycin 00

O

O

resistance gene encoded by the vector pRB115; and PCR confirmed the presence of the cat deletion in the strain of interest. PCR was performed to confirm deletion of the cat gene at the amyE locus by using primers 32 and 33: t'- S Primer 32: 5'-GCGGCCGCGGTACCTGTGTTACACCTGTT-3' (SEQ ID NO: 46) s Primer 33: 5'-GTCAAGCTTAATTCTCATGTTTGACAGCTTATCATCGG-3' (SEQ ID NO: 47) Chromosomal DNA from potential deletants was isolated using the REDextract- O N-Amp T Plant PCR kits (Sigma Chemical Company, St. Louis, MO) as follows: Single N Bacillus colonies were inoculated into 100 pil of Extraction Solution (Sigma Chemical 00 Company, St. Louis, MO), incubated at 95°C for 10 minutes, and then diluted with an Sequal volume of Dilution Solution (Sigma Chemical Company, St. Louis, MO). PCR was performed using 4 p1 of extracted DNA in conjunction with the REDextract-N-Amp PCR Reaction Mix and the desired primers according to the manufacturer's instructions, with PCR cycling conditions described in Example 5. PCR reaction products were visualized is in a 0.8% agarose-0.5X TBE gel. The verified strain was named Bacillus subtilis RB187.

Example 10: Construction of Bacillus subtilis RB192 Bacillus subtilis RB184 was made unmarked by deleting the chloramphenicol resistance gene (cat gene). This was accomplished using the method described previously in Example 9. The resultant strain was designated Bacillus subtilis RB192.

Example 11: Construction of Bacillus subtilis RB194 Bacillus subtilis RB194 was constructed by deleting the cypX region of the chromosome of Bacillus subtilis RB187 (Example The cypX region includes the cypX gene which encodes a cytochrome P450-like enzyme that is involved in the synthesis of a red pigment during fermentation. In order to delete this region of the chromosome plasmid pMRT086 was constructed.

The region of the chromosome which harbors the cypX-yvmC and yvmB-yvmA operons was PCR amplified from Bacillus subtilis BRG-1 as a single fragment using primers 34 and 35. Bacillus subtilis BRG1 is essentially a chemically mutagenized isolate of an amylase-producing strain of Bacillus subtilis which is based on the Bacillus subtilis A164A5 genetic background that was described in Example 5. The sequence of this region is identical to the published sequence for the Bacillus subtilis 168 type strain.

Primer 34: 5'-CATGGGAGAGACCTTTGG-3' (SEQ ID NO: 48) Primer 35: 5'-GTCGGTCTTCCATTTGC-3' (SEQ ID NO: 49) The amplification reactions (50 Al) were composed of 200 ng of Bacillus subtilis BRG-1 chromosomal DNA, 0.4 piM each of primers 34 and 35, 200 pM each of dATP, SdCTP, dGTP, and dTTP, 1X Expand T High Fidelity buffer (Roche Applied Science; T Indianapolis, IN) with 1.5 mM MgCl2, and 2.6 units of Expand T M High Fidelity PCR System enzyme mix (Roche Applied Science; Indianapolis, IN). Bacillus subtilis BRG-1 c l chromosomal DNA was obtained using a QIAGEN tip-20 column according to the s manufacturer's instructions. Amplification reactions were performed in a RoboCycler 0 thermacycler (Stratagene, Inc, La Jolla, CA) programmed for 1 cycle at 95*C for 3 minutes; 10 cycles each at 95 0 C for 1 minute, 58 0 C for 1 minute, and 680C for 4 minutes; 20 cycles each at 95 0 C for 1 minute, 58 0 C for 1 minute, 68 0 C for 4 minutes 0 N plus 20 seconds per cycle, followed by 1 cycle at 72°C for 7 minutes. Reaction products So were analyzed by agarose gel electrophoresis using a 0.8% agarose gel using 0.5X TBE C buffer.

The resulting fragment comprising the cypX-yvmC and yvmB-yvmA operons was cloned into pCR2.1 using the TA-TOPO Cloning Kit and transformed into E. coli OneShot T M cells according to the manufacturer's instructions (Invitrogen, Inc., Carlsbad, is CA). Transformants were selected on 2X YT agar plates supplemented with 100 Ag of ampicillin per ml. Plasmid DNA from several transformants was isolated using QIAGEN columns according to the manufacturer's instructions and verified by DNA sequencing with M13 forward, M13 reverse and primers 36 to 51 shown below.

The resulting plasmid was designated pMRT084 (Figure 19).

Primer 36: 5'-CGACCACTGTATCTTGG-3' (SEQ ID NO: Primer 37: 5'-GAGATGCCAAACAGTGC-3' (SEQ ID NO: 51) Primer 38: 5'-CATGTCCATCGTGACG-3' (SEQ ID NO: 52) Primer 39: 5'-CAGGAGCATTTGATACG-3' (SEQ ID NO: 53) Primer 40: 5'-CCTTCAGATGTGATCC-3' (SEQ ID NO: 54) Primer 41: 5'-GTGTTGACGTCAACTGC-3' (SEQ ID NO: Primer 42: 5'-GTTCAGCCTTTCCTCTCG-3' (SEQ ID NO: 56) Primer 43: 5'-GCTACCTTCTTTCTTAGG-3' (SEQ ID NO: 57) Primer 44: 5'-CGTCAATATGATCTGTGC-3' (SEQ ID NO: 58) Primer 45: 5'-GGAAAGAAGGTCTGTGC-3' (SEQ ID NO: 59) 3o Primer 46: 5'-CAGCTATCAGCTGACAG-3' (SEQ ID NO: Primer 47: 5'-GCTCAGCTATGACATATTCC-3' (SEQ ID NO: 61) Primer 48: 5'-GATCGTCTTGATTACCG-3' (SEQ ID NO: 62) Primer 49: 5'-AGCTTTATCGGTGACG-3' (SEQ ID NO: 63) Primer 50: 5'-TGAGCACGATTGCAGG-3' (SEQ ID NO: 64) Primer 51: 5'-CATTGCGGAGACATTGC-3' (SEQ ID NO: Plasmid pMRT084 was digested with Bsgl to delete most of the cypX-yvmC and yvmB-yvmA operons, leaving about 500 bases at each end. The digested Bsgl DNA 00

O

O

was treated with T4 DNA polymerase. Plasmid pECC1 (Youngman et al., 1984, d Plasmid 12: 1-9) was digested with Smal. A fragment of approximately 5,100 bp from pMRT084 and a fragment of approximately 1,600 bp fragment from pECC1 were C isolated from a 0.8% agarose-0.5X TBE gel using the QIAquick DNA Extraction Kit s according to the manufacturer's instructions, ligated together, and transformed into E.

coli XL1 Blue cells according to the manufacturer's instructions (Stratagene, Inc., La Jolla, CA). Transformants were selected on 2X YT agar plates supplemented with 100 Spg of ampicillin per ml. Transformants carrying the correct plasmid with most of the c cypX-yvmC and yvmB-yvmA operons deleted were identified by PCR amplification using 00 So0 primers 52 and 53. PCR amplification was conducted in 50 pl reactions composed of 1 Sng of plasmid DNA, 0.4 jM of each primer, 200 pM each of dATP, dCTP, dGTP, and dTTP, 1X PCR Buffer II with 2.5 mM MgCl2, and 2.5 units of AmpliTaq Gold T M

DNA

polymerase. The reactions were performed in a RoboCycler 40 thermacycler programmed for 1 cycle at 95C for 10 minutes; 25 cycles each at 95°C for 1 minute, 55 0 C for 1 minute, and 72°C for 1 minute; and 1 cycle at 72°C for 7 minutes. The PCR product was visualized using a 0.8% agarose-0.5X TBE gel. This construct was designated pMRT086 (Figure Primer 52: 5'-TAGACAATTGGAAGAGAAAAGAGATA-3' (SEQ ID NO: 66) Primer 53: 5'-CCGTCGCTATTGTAACCAGT-3' (SEQ ID NO: 67) Plasmid pMRT086 was linearized with Scal and transformed into Bacillus subtilis RB128 competent cells in the presence of 0.2 pLg of chloramphenicol per ml.

Transformants were selected on TBAB plates containing 5 pg of chloramphenicol per ml after incubation at 370C for 16 hours. Chromosomal DNA was prepared from several transformants using a QIAGEN tip-20 column according to the manufacturer's instructions. Chloramphenicol resistant colonies were screened by PCR for deletion of the cypX-yvmC and yvmB-yvmA operons via PCR using primers 36 and 52, 36 and 53, 37 and 52, and 37 and 53. PCR amplification was conducted in 50 pl reactions composed of 50 ng of chromosomal DNA, 0.4 pM of each primer, 200 IM each of dATP, dCTP, dGTP, and dTTP, 1X PCR Buffer II with 2.5 mM MgCI 2 and 2.5 units of AmpliTaq Gold T DNA polymerase. The reactions were performed in a RoboCycler thermacycler programmed for 1 cycle at 95C for 10 minutes; 25 cycles each at 95°C for 1 minute, 55C for 1 minute, and 72°C for 1 minute; and 1 cycle at 72 0 C for 7 minutes.

The PCR products were visualized using a 0.8% agarose-0.5X TBE gel. The resulting Bacillus subtilis RB128 cypX-yvmC and yvmB-yvmA deleted strain was designated Bacillus subtilis MaTa 17.

Competent cells of Bacillus subtilis RB187 (Example 9) were transformed with genomic DNA from Bacillus subtilis MaTal7. Genomic DNA was obtained from this 00

O

O

Ic strain using a QIAGEN tip-20 column according to the manufacturer's instructions.

Bacillus subtilis chloramphenicol resistant transformants were selected on TBAB plates supplemented with 5 ig of chloramphenicol per ml at 37 0 C. Primary transformants were streaked for single colony isolations on TBAB plates containing 5 pig of chloramphenicol per ml at 37 0 C. The resulting cypX-yvmC and yvmB-yvmA deleted strain was designated Bacillus subtilis RB194.

SExample 12: Construction of Bacillus subtilis RB197 O0 Bacillus subtilis RB197 is very similar to Bacillus subtilis RB194, the only difference being that RB197 contains a smaller deletion in the cypX region: only a ri portion of the cypX gene is deleted in this strain to generate a cypX minus phenotype.

In order to accomplish this task a plasmid, pMRT122, was constructed as described below.

Plasmid pCJ791 (Figure 21) was constructed by digestion of plasmid pSJ2739 s1 (WO 96/23073) with EcoRIIHindlll and ligation to a fragment containing a deleted form of the wprA gene (cell wall serine protease) from Bacillus subtilis. The 5' region of wprA was amplified using primers 54 and 55 see below, and the 3' region was amplified using primers 56 and 57 shown below from chromosomal DNA obtained from Bacillus subtilis DN1885 (Diderichsen et al., 1990, Journal of Bacteriology 172: 4315-4321). PCR amplification was conducted in 50 pl reactions composed of 1 ng of Bacillus subtilis DN1885 chromosomal DNA, 0.4 M each of primers 39 and 40, 200 jiM each of dATP, dCTP, dGTP, and dTTP, 1X PCR Buffer II with 2.5 mM MgCI 2 and 2.5 units of AmpliTaq GoldTM DNA polymerase. The reactions were performed in a RoboCycler thermacycler programmed for 1 cycle at 95 0 C for 10 minutes; 25 cycles each at 95*C for 1 minute, 55 0 C for 1 minute, and 72 0 C for 1 minute; and 1 cycle at 72*C for 7 minutes.

The 5' and 3' wprA PCR fragments were linked by digestion with Bglll followed by ligation, and PCR amplification was performed on the ligation mixture fragments using primers 54 and 57. PCR amplification was conducted in 50 pl reactions composed of 1 ng of the ligated fragment, 0.4 pM of each primer, 200 JpM each of dATP, dCTP, dGTP, and dTTP, 1X PCR Buffer II with 2.5 mM MgCl2, and 2.5 units of AmpliTaq Gold T DNA polymerase. The reactions were performed in a RoboCycler thermacycler programmed for 1 cycle at 95 0 C for 10 minutes; 25 cycles each at 95 0 C for 1 minute, 55 0 C for 1 minute, and 72*C for 1 minute; and 1 cycle at 72 0 C for 7 minutes.

The PCR product was visualized using a 0.8% agarose-0.5X TBE gel. The resulting PCR fragment was cloned into pSJ2739 as an EcoRI/Hindlll fragment, resulting in plasmid pCJ791 (Figure 21). Transformants were selected on TBAB-agar plates supplemented with 1 jig of erythromycin and 25 pg of kanamycin per ml after incubation 54 00 at 28 0 C for 24-48 hours. Plasmid DNA from several transformants was isolated using ^d QIAGEN tip-20 columns according to the manufacturer's instructions and verified by PCR amplification with primers 54 and 57 using the conditions above.

CN Primer 54: 5'-GGAATTCCAAAGCTGCAGCGGCCGGCGCG-3' (SEQ ID NO: 68) Primer 55: 5'-GAAGATCTCGTATACTTGGCTTCTGCAGCTGC-3' (SEQ ID NO: 69) O Primer 56: 5'-GAAGATCTGGTCAACAAGCTGGAAAGCACTC-3' (SEQ ID NO: Primer 57: 5'-CCCAAGCTTCGTGACGTACAGCACCGTTCCGGC-3' (SEQ ID NO: 71) SThe amyL upstream sequence and 5' coding region from plasmid pDN1981 (U.S.

NC Patent No. 5,698,415) were fused together by SOE using the primer pairs 58/59 and 00 60/61 shown below. The resulting fragment was cloned into vector pCR2.1 to generate plasmid pMRT032 as follows. PCR amplifications were conducted in triplicate in 50 pl reactions composed of 1 ng of pDN1981 DNA, 0.4 p.M each of appropriate primers, 200 pM each of dATP, dCTP, dGTP, and dTTP, 1X PCR Buffer II with 2.5 mM MgCI 2 and units of AmpliTaq Gold" T DNA polymerase. The reactions were performed in a RoboCycler 40 thermacycler programmed for 1 cycle at 95 0 C for 9 minutes; 3 cycles each at 95°C for 1 minute, 52*C for 1 minute, and 72°C for 1 minute; 27 cycles each at for 1 minute, 55°C for 1 minute, and 72°C for 1 minute; and 1 cycle at 72°C for minutes. The PCR product was visualized in a 0.8% agarose-0.5X TBE gel. The expected fragments were approximately 530 and 466 bp, respectively. The final SOE fragment was generated using primer pair 59/60 and cloned into pCR2.1 vector using the TA-TOPO Cloning Kit. Transformants were selected on 2X YT agar plates supplemented with 100 jpg/ml ampicillin after incubation at 37 0 C for 16 hours. Plasmid DNA from several transformants was isolated using QIAGEN tip-20 columns according to the manufacturer's instructions and verified by DNA sequencing with M13 forward and M13 reverse primers. The plasmid harboring the amyL upstream sequence fusion fragment was designated pMRT032 (Figure 22).

Primer 58: 5'-CCTTAAGGGCCGAATATTATACGGAGCTCCCTGAAACAACAAAAACGGC-3' (SEQ ID NO: 72) Primer 59: 5'-GGTGTTCTCTAGAGCGGCCGCGGTTGCGGTCAGC-3' (SEQ ID NO: 73) Primer 60: 5'-GTCCTTCTTGGTACCTGGAAGCAGAGC-3' (SEQ ID NO: 74) Primer 61: 5'-GTATAAATATTCGGCCCTTAAGGCCAGTACCATTTTCCC-3' (SEQ ID NO: Plasmid pNNB194 (pSK*/pE194; U.S. Patent No. 5,958,728) was digested with Nsil and Notl, and plasmid pBEST501 (Itaya et al. 1989 Nucleic Acids Research 17: 4410) was digested with Pstl and Notl. The 5,193 bp vector fragment from pNNB194 00

O

O

Sand the 1,306 bp fragment bearing the neo gene from pBEST501 were isolated from a T 0.8% agarose-0.5X TBE gel using a QIAquick DNA Purification Kit according to the manufacturer's instructions. The isolated fragments were ligated together and used to [C transform E. coli SURE competent cells according to the manufacturer's instructions.

s Ampicillin-resistant transformants were selected on 2X YT plates supplemented with 100 O I.g of ampicillin per ml. Plasmid DNA was isolated from one such transformant using the 0QIAGEN Plasmid Kit (QIAGEN Inc., Valencia, CA), and the plasmid was verified by 0digestion with Nsil and Notl. This plasmid was designated pNNB194neo (Figure 23).

00 Plasmid pNNB194neo was digested with SacllNotl and treated with T4 DNA polymerase and dNTPs to generate blunt ends using standard protocols. Plasmid C pPL2419 Patent No. 5,958,728) was digested with Ec/13611. The 6,478 bp vector fragment from pNNB194neo and the 562 bp fragment bearing orT from pPL2419 were isolated from a 0.8% agarose-0.5X TBE gel using a QIAquick DNA Purification Kit according to the manufacturer's instructions. The gel-purified fragments were ligated is together and used to transform E. coli SURE cells according to the manufacturer's instructions. Ampicillin-resistant transformants were selected on 2X YT plates supplemented with 100 pg of ampicillin per ml at 37°C. Plasmid DNA was isolated from one such transformant using the QIAGEN Plasmid Kit, and the plasmid was verified by digestion with NSil, Sad, and Bscl. This plasmid was designated pNNB194neo-oriT (Figure 24).

Plasmid pNNB194neo-oriT was digested with BamHI and treated with T4 DNA polymerase and dNTPs to generate blunt ends using standard protocols. The digested plasmid was gel-purified from a 0.8% agarose-0.5X TBE gel using a QIAquick DNA Purification Kit according to the manufacturer's instructions. The purified plasmid was treated with T4 DNA ligase and used to transform E. coli SURE cells according to the manufacturer's instructions. Ampicillin-resistant transformants were selected on 2X YT plates supplemented with 100 4g of ampicillin per ml at 37*C. Plasmid DNA was isolated from one such transformant using the QIAGEN Plasmid Kit, and disruption of the BamHI site was confirmed by digestion with BamHI and Scal. The resulting plasmid was designated pShV3 (Figure Plasmid pShV2.1-amyEA Patent No. 5,958,728) was digested with Sfil and Nott, and the 8696 bp vector fragment was gel-purified from a 0.8% agarose-0.5X TBE gel using a QIAquick DNA Purification Kit according to the manufacturer's instructions.

In order to insert a BamHI site between the Sfil and Not sites of pShV2.1-amyEA, a synthetic linker was constructed as follows: primers 62 and 63 were annealed by mixing pM of each, boiling the mixture, and allowing the mixture to cool slowly.

Primer 62: 5'-GGGCCGGATCCGC-3' (SEQ ID NO: 76) 00

O

O

SPrimer 63: 3'-ATTCCCGGCCTAGGCGCCGG-5' (SEQ ID NO: 77) T The purified pShV2.1-amyEA vector and annealed oligonucleotides were ligated together and used to transform E. coli SURE competent cells according to the manufacturer's instructions. Chloramphenicol-resistant transformants were selected on LB plates supplemented with 30 gig of chloramphenicol per ml at 37°C. Plasmid DNA Swas isolated from one such transformant using the QIAGEN Plasmid Kit, and insertion of the BamHI site was confirmed by digestion with BamHI. This plasmid was designated 0 pShV2.1-amyEAB (Figure 26).

00 Plasmids pShV3 and pShV2.1-amyEAB were digested with Sall/Hindlll. A 7033 bp vector fragment from pShV3 and a 1031 bp fragment bearing amyEA from pShV2.1- SamyEA were gel-purified from a 0.8% agarose-0.5X TBE gel using a QIAquick DNA Purification Kit according to the manufacturer's instructions. The gel-purified fragments were ligated together and used to transform E. coli SURE cells according to the manufacturer's instructions. Ampicillin-resistant transformants were selected on 2X YT is plates supplemented with 100 jg of ampicillin per ml. Plasmid DNA was isolated from one such transformant using the QIAGEN Plasmid Kit, and the plasmid was verified by digestion with Sail and Hindll. This plasmid was designated pShV3A (Figure 27).

Plasmid pMRT032 was digested with KpnllXbal, filled with Klenow fragment DNA polymerase in the presence of dNTPs, and a fragment of approximately 1000 bp was isolated from a 0.8% agarose-0.5X TBE gel using a QIAquick DNA Purification Kit according to the manufacturers instructions. This fragment was cloned into plasmid pShV3a digested with EcoRV, and transformed into E. coli XL1 Blue cells according to the manufacturer's instructions. Transformants were selected on 2X YT agar plates supplemented with 100 pig of ampicillin per ml after incubation at 37 0 C for 16 hours.

Plasmid DNA from several transformants was isolated using QIAGEN tip-20 columns according to the manufacturer's instructions and verified on a 0.8% agarose-0.5X TBE gel by restriction analysis with Sacl/Sphl. The resulting plasmid was designated pMRT036 (Figure 28).

Plasmid pMRT036 was digested with SalllHindlll, filled with Klenow fragment DNA polymerase in the presence of dNTPs, ligated and transformed into E. coli XL1 Blue cells according to the manufacturer's instructions. Transformants were selected on 2X YT-agar plates supplemented with 100 ig/ml ampicillin after incubation at 370C for 16 hours. Plasmid DNA from several transformants was isolated using QIAGEN columns according to the manufacturer's instructions and verified on a 0.8% agarose- 0.5X TBE gel by restriction analysis with SacllXbal, Pstl and Ndel. The resulting plasmid was designated pMRT037 (Figure 29).

The scBAN/crylllA stabilizer fragment from plasmid pDG268Aneo- 00

O

O

ScrylllAstab/Sav Patent No. 5,955,310) was isolated from a 2% agarose-0.5X TBE L gel as a Sfil/Sacl fragment using a QIAquick DNA Purification Kit according to the manufacturer's instructions, ligated to plasmid pMRT037 digested with Sfil/Sacl, and transformed into E. coli XL1 Blue cells. Transformants were selected on 2X YT agar s plates supplemented with 100 pg of ampicillin per ml after incubation at 370C for 16 Shours. Plasmid DNA from several transformants was isolated using QIAGEN columns according to the manufacturer's instructions and verified on a 0.8% agarose- TBE gel by restriction analysis with Pstl. The resulting plasmid was designated 00 pMRT041 (Figure Plasmids pMRT041 and pCJ791 were digested with EcoRI/Hindlll. A fragment C1 of approximately 1300 bp from pMRT041 and a fragment of approximately 4500 bp from pCJ791 were isolated from a 0.8% agarose-0.5X TBE gel using a QIAquick DNA Purification Kit according to the manufacturer's instructions, ligated, and transformed into Bacillus subtilis 168A4 competent cells. Transformants were selected on TBABagar plates supplemented with 1 pg of erythromycin and 25 p.g of lincomycin per ml after incubation at 30'C for 24-48 hours. Plasmid DNA from several transformants was isolated using QIAGEN tip-20 columns according to the manufacturer's instructions and verified on a 0.8% agarose-0.5X TBE gel by restriction analysis with Sad and EcoRI/Hindlll. The resulting plasmid was designated pMRT064.1 (Figure 31).

The Sad site at position 2666 in plasmid pMRT064.1 was deleted by SOE using primer pairs 64 and 65, and primer pairs 66 and 67 shown below. PCR amplification was conducted in 50 pl reactions composed of 1 ng of pMRT064.1 DNA, 0.4 MIM of each primer, 200 pM each of dATP, dCTP, dGTP, and dTTP, 1X PCR Buffer II with 2.5 mM MgCl2, and 2.5 units of AmpliTaq Gold T M DNA polymerase. The reactions were performed in a RoboCycler 40 thermacycler programmed for 1 cycle at 95*C for minutes; 25 cycles each at 95*C for 1 minute, 52 0 C for 1 minute, and 72 0 C for 1 minute; and 1 cycle at 72 0 C for 7 minutes. The PCR product was visualized in a 0.8% agarose- TBE gel. The expected fragments were approximately 400 and 800 bp, respectively. The final fragment for cloning back into pMRT064.1 was amplified using primers 64 and 67. This fragment was cloned into pCR2.1 vector using the TA-TOPO Cloning Kit. Transformants were selected on 2X YT agar plates supplemented with 100 gg/ml ampicillin after incubation at 37"C for 16 hours. Transformants carrying the correct plasmid were verified by DNA sequencing using M13 forward and reverse primers, and primers 65, 67, and 68. This plasmid was designated pMRT068 (Figure 32), and was further transformed into E. coli DM1 cells (Stratagene, Inc., La Jolla, CA) according to the manufacturer's instructions. Transformants were selected on 2X YT agar plates supplemented with 100 Mpg of ampicillin per ml.

58 00

O

O

SPrimer 64: 5'-GGAAATTATCGTGATCAAC-3' (SEQ ID NO: 78) T Primer 65: 5'-GCACGAGCACTGATAAATATG-3' (SEQ ID NO: 79) Primer 66: 5'-CATATTTATCAGTGCTCGTGC (SEQ ID NO: C Primer 67: 5'-TCGTAGACCTCATATGC-3' (SEQ ID NO: 81) s Primer 68: 5'-GTCGTTAAACCGTGTGC-3' (SEQ ID NO: 82) O The Sad sites at positions 5463 and 6025 in plasmid pMRT064.1 were deleted 01 using PCR amplification with primers 69 and 70, and using the PCR conditions described above. The resulting fragment was cloned into pCR2.1 vector using the TAc TOPO Cloning Kit (Invitrogen, Inc., Carlsbad, CA). Transformants were selected on 2X 00 YT-agar plates supplemented with 100 pg of ampicillin per ml after incubation at 37 0

C

C for 16 hours. Transformants carrying the correct plasmid were verified by DNA sequencing using M13 forward and reverse primers. This construct was designated pMRT069 (Figure 33).

Primer 69: 5'-CTAGAGGATCCCCGGGTACCGTGCTCTGCCTTTTAGTCC-3' (SEQ ID NO: 83) Primer 70: 5'-GTACATCGAATTCGTGCTCATTATTAATCTGTTCAGC-3' (SEQ ID NO: 84) Plasmids pMRT068 and pMRT064.1 were digested with BclllAccl. A fragment of approximately 1300 bp from pMRT068 and a fragment of approximately 3800 bp from pMRT064.1 were isolated from a 0.8% agarose-0.5X TBE gel using a QIAquick DNA Purification Kit according to the manufacturer's instructions, ligated, and transformed into Bacillus subtilis 168A4 competent cells. Transformants were selected on TBABagar plates supplemented with 1 jag of erythromycin and 25 ig of lincomycin per ml after incubation at 30 0 C for 24-48 hours. Transformants carrying the correct plasmid were identified on a 0.8% agarose-0.5X TBE gel by restriction analysis with Sad and EcoRlIAval. The resulting construct was designated pMRT071 (Figure 34).

Plasmids pMRT071 and pMRT069 were digested with AvallEcoRI. The 578 bp fragment from pMRT069 and the 4510 bp fragment from pMRT071 were isolated from a 0.8% agarose-0.5X TBE gel using a QIAquick DNA Purification Kit according to the manufacturer's instructions, ligated, and transformed into Bacillus subtilis 168A4 competent cells. Transformants were selected on TBAB-agar plates supplemented with 1 Aig of erythromycin and 25 lg of lincomycin per ml after incubation at 30 0 C for 24-48 hours. Transformants carrying the correct plasmid were identified on a 0.8% agarose- TBE gel by restriction analysis with Sad. The resulting construct was designated pMRT074 (Figure Plasmid pMRT084 described in Example 11 was digested with SaclllNdel, treated with T4 DNA polymerase, ligated, and transformed into E. coli XL1 Blue cells 00

O

O

according to the manufacturer's instructions. Transformants were selected on 2X YT LT agar plates supplemented with 100 pg of ampicillin per ml after incubation at 37 0 C for 16 Shours. Transformants carrying the correct plasmid were identified on a 0.8% agarose- TBE gel by restriction analysis with Dral. The resulting plasmid was named pMRT120 (Figure 36).

Plasmid pMRT074 was digested with Hindlll, treated with Klenow fragment DNA polymerase, and digested with EcoRI. Plasmid pMRT120 was digested with O EcoRI/Ec/13611. A fragment of approximately 600 bp from pMRT120 and a fragment of OO approximately 4300 bp from pMRT074 were isolated from a 0.8% agarose-0.5X TBE gel using a QIAquick DNA Purification Kit according to the manufacturer's instructions, CK' ligated, and transformed into Bacillus subtilis 168A4 competent cells. Transformants were selected on TBAB-agar plates supplemented with 1 pg of erythromycin and 25 pg of lincomycin per ml after incubation at 30 0 C for 24-48 hours. Transformants carrying the correct plasmid were identified on a 0.8% agarose-0.5X TBE gel by restriction analysis with Sspl. The resulting construct was designated pMRT122 (Figure 37).

Plasmid pMRT122 was transformed into Bacillus subtilis A164A5 competent cells. Transformants were selected on TBAB-agar plates supplemented with 1 pg of erythromycin and 25 pg of lincomycin per ml after incubation at 30 0 C for 24-48 hours.

The plasmid was introduced into the chromosome of Bacillus subtilis A164A5 via homologous recombination into the cypX locus by incubating a freshly streaked plate of Bacillus subtilis A164A5 (pMRT086) cells at 45 0 C for 16 hours and selecting for healthy growing colonies. Genomic DNA was isolated from this strain using a QIAGEN column according to the manufacturer's instructions and used to transform Bacillus subtilis RB187 (Example Transformants were selected on TBAB plates supplemented with 1 pg of erythromycin and 25 pg of lincomycin per ml after incubation at 45 0 C for 16 hours. At this temperature, the pE194 replicon is unable to replicate.

Cells are able to maintain erythromycin resistance only by maintaining the plasmid in the bacterial chromosome.

The plasmid was removed from the chromosome via homologous recombination resulting in the deletion of a portion of the cypX gene on the chromosome by growing the transformants in Luria-Bertani (LB) medium without selection at the permissive temperature of 34 0 C for many generations. At this temperature the pE194 origin of replication is active and actually promotes the excision of the plasmid from the chromosome (Molecular Biological Methods for Bacillus, edited by C.R. Harwood and S.M. Cutting, 1990, John Wiley and Sons Ltd.).

After several generations of outgrowth the cells were plated on non-selective LB agar plates and colonies which had lost the plasmid and were now cypX-deleted and 00

O

O

Sproducing hyaluronic acid were identified as follows: cell patches were "wet" when plated on minimal plates indicating production of hyaluronic acid, erythromycin .sensitivity indicated loss of the pE194-based plasmid, and PCR confirmed the Spresence of the 800 bp cypX deletion in the strain of interest by using primers 34 and Chromosomal DNA from potential cypX deletants was isolated using the REDextract-N-Amp T Plant PCR kits as follows: Single Bacillus colonies were inoculated into 100 pjl of Extraction Solution, incubated at 95 0 C for 10 minutes, and then 00 diluted with an equal volume of Dilution Solution. PCR was performed using 4 pil of 0 10 extracted DNA in conjunction with the REDextract-N-Amp T PCR Reaction Mix and the CN desired primers according to the manufacturer's instructions, using PCR cycling conditions as described in Example 5. PCR reaction products were visualized using a 0.8% agarose-0.5X TBE gel. The verified strain was designated Bacillus subtilis RB197.

is Example 13: Construction of Bacillus subtilis RB200 The cypX gene of Bacillus subtilis RB192 was deleted using the same methods described in Example 9 for Bacillus subtilis RB187. The resultant strain was designated Bacillus subtilis RB200.

Example 14: Construction of Bacillus subtilis RB202 Bacillus subtilis A164A5AcypX was constructed as follows: Plasmid pMRT122 (Example 12) was transformed into Bacillus subtilis A164A5 competent cells.

Transformants were selected on TBAB-agar plates supplemented with 1 pIg of erythromycin and 25 ig of lincomycin per ml after incubation at 30 0 C for 24-48 hours.

The plasmid was introduced into the chromosome of Bacillus subtilis A164A5 via homologous recombination into the cypX locus by incubating a freshly streaked plate of Bacillus subtilis A164A5 (pMRT086) cells at 45 0 C for 16 hours and selecting for healthy growing colonies. The plasmid was removed from the chromosome via homologous recombination resulting in the deletion of a portion of the cypX gene on the chromosome by growing the transformants in Luria-Bertani (LB) medium without selection at the permissive temperature of 34°C for many generations. At this temperature the pE194 origin of replication is active and actually promotes the excision of the plasmid from the chromosome (Molecular Biological Methods for Bacillus, edited by C.R. Harwood and S.M. Cutting, 1990, John Wiley and Sons Ltd.). After several generations of outgrowth the cells were plated on non-selective LB agar plates and colonies which had lost the plasmid and were now cypX-deleted were identified as follows: erythromycin sensitivity indicated loss of the pE194-based plasmid, and PCR confirmed the 00

O

O

presence of the 800 bp cypX deletion in the strain of interest by using primers 34 and as described above. The verified strain was designated Bacillus subtilis A164050cypX.

Bacillus subtilis A164A5AcypX was made competent and transformed with Bacillus subtilis TH1 genomic DNA (Example 7) isolated using a QIAGEN tip-20 column s according to the manufacturer's instructions. Transformants were selected on TBAB plates containing 5 lg of chloramphenicol per ml at 37 0 C. The Bacillus subtilis A164A5AcypX hasA/hasB/hasC/hasD integrant was identified by its "wet" phenotype Sand designated Bacillus subtilis RB201. The cat gene was deleted from Bacillus subtilis 00 RB201using the same method described in Example 9. The resultant strain was to designated Bacillus subtilis RB202.

Example 15: Construction of Bacillus subtilis MF002 (tuaD/gtaB) Plasmid pHA3 (Example 2, Figure 9) was digested with Asp718. The digested plasmid was then blunted by first inactivating the restriction enzyme at 85°C for is minutes. Blunting was performed by adding 0.5 pl of 10 mM each dNTPs, 1 pl of 1 U/lJ T4 polymerase and incubating at 11"C for 10 minutes. Finally the polymerase was inactivated by incubating the reaction at 75C for 10 minutes. The digested plasmid was then purified using a QIAquick DNA Purification Kit according to the manufacturer's instructions and finally digested with Not. The smallest plasmid fragment of approximately 2522 bp was then gel-purified using a QIAquick DNA Gel Extraction Kit from a 0.8% agarose-0.5X TBE gel according to the manufacturer's instructions. The recovered DNA insert (tuaD/gtaB) was then ligated with the vector DNA described below.

Plasmid pDG268MCSAneo/scBAN/Sav Patent No. 5,955,310) was digested with Ecl13611. The digested plasmid was then purified using a QIAquick DNA Purification Kit according to the manufacturer's instructions, and finally digested with Nod. The largest plasmid fragment of approximately 6800 bp was gel-purified from a 0.8% agarose-0.5X TBE gel using a QIAquick DNA Gel Extraction Kit according to the manufacturer's instructions.

The recovered vector and DNA insert were ligated using the Rapid DNA Cloning Kit according to the manufacturers instructions. Prior to transformation in Bacillus subtilis, the ligation described above was linearized using Scal to ensure double crossover integration in the chromosome rather than single cross-over integration in the chromosome. Bacillus subtilis 168A4 competent cells were transformed with the ligation 3s digested with the restriction enzyme Scal.

Bacillus subtilis chloramphenicol-resistant transformants were selected on TBAB plates supplemented with 5 pg of chloramphenicol per ml. To screen for integration of 00

O

O

Sthe plasmid by double cross-over at the amyE locus, Bacillus subtilis primary rT transformants were patched on TBAB plates supplemented with 6 pg of neomycin per ml and on TBAB plates supplemented with 5 pg of chloramphenicol per ml to isolate

C

chloramphenicol resistant and neomycin sensitive transformants were isolated.

s Chromosomal DNA from chloramphenicol resistant and neomycin sensitive Bacillus subtilis 168A4 transformants was isolated using the REDextract-N-Amp T Plant 0PCR kits (Sigma Chemical Company, St. Louis, MO) as follows: Single Bacillus 0 colonies were inoculated into 100 .l of Extraction Solution, incubated at 95°C for OO minutes, and then diluted with an equal volume of Dilution Solution. PCR was performed using 4 il of extracted DNA in conjunction with the REDextract-N-Amp PCR CKl Reaction Mix and the desired primers according to the manufacturer's instructions, with PCR cycling conditions described in Example PCR amplifications were performed on these transformants using the synthetic oligonucleotides described below to confirm the absence/presence and integrity of the is genes hasA, gtaB, and tuaD of the operon of the Bacillus subtilis transformants.

Primers 3 and 8 were used to confirm the absence of the hasA gene, primer 71 and primer 15 to confirm the presence of the tuaD gene, and primers 20 and 71 to confirm the presence of the gtaB gene. PCR reaction products were visualized in a 0.8% TBE gel. The verified strain, a Bacillus subtilis 168A4 hasA/tuaD/gtaB integrant, was designated Bacillus subtilis RB176.

Primer 71: 5'-AACTATTGCCGATGATAAGC-3' (binds upstream of tuaD) (SEQ ID NO: Genomic DNA was isolated from the chloramphenicol resistant, and neomycin sensitive Bacillus subtilis RB176 transformants using a QIAGEN tip-20 column according to the manufacturer's instructions. The Bacillus subtilis RB176 genomic DNA was used to transform competent Bacillus subtilis A164A5. Transformants were selected on TBAB plates containing 5 pg of chloramphenicol per ml, and grown at 370C.

A Bacillus subtilis A164A5 tuaD/gtaB integrant was designated Bacillus subtilis RB177.

The cat gene was deleted in strain Bacillus subtilis RB177 using the method described in Example 9. The resultant strain was designated Bacillus subtilis MF002.

Example 16: Construction of the pelintegration plasmid pRB162 Plasmid pDG268MCSAneo/scBAN/Sav Patent No. 5,955,310) was doubledigested with Sad and Aatll. The largest plasmid fragment of approximately 6193bp was gel-purified using a QIAquick DNA Gel Extraction Kit from a 0.8% TBE gel according to the manufacturer's instructions. The recovered vector DNA was then ligated with the DNA insert described below.

63 00

O

The 5' and 3' fragments of a Bacillus subtilis pectate lyase gene (pel, accession number BG10840, SEQ ID NOs. 86 [DNA sequence] and 87 [deduced amino acid sequence]) was PCR amplified from Bacillus subtilis 168 (BGSC 1A1, Bacillus Genetic N Stock Center, Columbus, OH) using primers 72 (introduces 5' Spel restriction site) and s 73 (introduces 3' Sall restriction site) for the 5' pel fragment and primers 74 (introduces O 5' SacllBamHI restriction sites) and 75 (introduces 3' NotllAatll restriction sites) for the S3' pel fragment: Primer 72: C 5'-ACTAGTAATGATGGCTGGGGCGCGTA-3' (SEQ ID NO: 88) S0o Primer 73: C 5'-GTCGACATGTTGTCGTATTGTGAGTT-3' (SEQ ID NO: 89) Primer 74: 5'-GAGCTCTACAACGCTTATGGATCCGCGGCCGCGGCGGCACACACATCTGGAT-3' (SEQ ID NO: is Primer 5'-GACGTCAGCCCGTTTGCAGCCGATGC-3' (SEQ ID NO: 91) PCR amplifications were carried out in triplicate in 30 pl reactions composed of ng of Bacillus subtilis 168 chromosomal DNA, 0.4 pM each of primer pair 72/73 for the 5' pel fragment or primer pair 74/75 for the 3' pel fragment, 200 pM each of dATP, dCTP, dGTP, and dTTP, 1X PCR Buffer II with 2.5 mM MgCI 2 and 2.5 units of AmpliTaq Gold T DNA polymerase. The reactions were performed in a RoboCycler thermacycler programmed for 1 cycle at 95 0 C for 9 minutes; 3 cycles each at 95*C for 1 minute, 52 0 C for 1 minute, and 72*C for 1 minute; 27 cycles each at 95°C for 1 minute, 0 C for 1 minute, and 72 0 C for 1 minute; and 1 cycle at 72 0 C for 5 minutes. The PCR products were visualized using a 0.8% agarose-0.5X TBE gel. The expected fragments were approximately 530 bp for the 5' pel fragment and 530 bp for the 3' pel fragment.

The 530 bp 5' pel and 530 bp 3' pel PCR fragments were cloned into pCR2.1 using the TA-TOPO Cloning Kit and transformed into E. coli OneShotM competent cells according to the manufacturers' instructions. Transformants were selected on 2X YT agar plates supplemented with 100 pg of ampicillin per ml incubated at 37°C. Plasmid DNA from these transformants was purified using a QIAGEN robot according to the manufacturer's instructions and the DNA sequence of the inserts confirmed by DNA sequencing using the primers described above (primers 72 and 73 for 5' pel and primers 74 and 75 for 3' pel). The plasmids harboring the 530 bp and the 530 bp PCR fragments were designated pCR2.1-pel 5' and pCR2.1-pel3', respectively (Figures 38 and 39, respectively).

Plasmid pCR2.1-pel3' was double-digested with Sad and Aatll. The smallest 00

(NO

Splasmid fragment of approximately 530 bp was gel-purified using a QIAquick DNA Gel Extraction Kit from a 0.8% agarose-0.5X TBE gel according to the manufacturers instructions.

The recovered vector (pDG268MCSAneo/scBAN) and DNA insert pel) were s ligated using the Rapid DNA Cloning Kit according to the manufacturer's instructions.

The ligation mix was transformed into E. coli SURE competent cells (Stratagene, Inc., 0 La Jolla, CA). Transformants were selected on 2X YT agar plates supplemented with S100 pg of ampicillin per ml at 37*C.

00 Plasmid DNA was purified from several transformants using a QIAGEN robot Sto according to the manufacturer's instructions and analyzed by Sad and Aatll digestion on NC a 0.8% agarose gel using 0.5X TBE buffer. The correct plasmid was identified by the presence of an approximately 530 bp Sacl/Aatll 3' pel fragment and was designated pRB161 (Figure Plasmid pRB161 was double-digested with Spel and Sail. The largest plasmid fragment of approximately 5346 bp was gel-purified using a QIAquick DNA Gel Extraction Kit from a 0.8% agarose-0.5X TBE gel according to the manufacturer's instructions. The recovered vector DNA was then ligated with the DNA insert described below.

Plasmid pCR2.1-pel5' was double-digested with Spel and Sail. The smallest plasmid fragment of approximately 530 bp was gel-purified using a QIAquick DNA Gel Extraction Kit from a 0.8% agarose-0.5X TBE gel according to the manufacturer's instructions.

The recovered vector (pDG268MCSAneo/scBAN/pel and insert (pel DNA were ligated using the Rapid DNA Cloning Kit according to the manufacturer's instructions. The ligation mix was transformed into E. coli SURE competent cells (Stratagene, Inc., La Jolla, CA). Transformants were selected on 2X YT agar plates supplemented with 100 tpg of ampicillin per ml.

Plasmid DNA was purified from several transformants using a QIAGEN robot according to the manufacturer's instructions and analyzed by Spel and Sail digestion on a 0.8% agarose gel using 0.5X TBE buffer. The correct plasmid was identified by the presence of an approximately 530 bp SpellSall pel 5' fragment and was designated pRB162 (Figure 41).

Example 17: Construction of pRB156 Plasmid pHA7 (Example 4, Figure 13) was digested with Hpal. The digested plasmid was then purified using a QIAquick DNA Purification Kit according to the manufacturer's instructions and finally digested with Asp718. The double-digested 00

O

Splasmid was then blunted by first inactivating the restriction enzyme at 85°C for minutes. Blunting was performed by adding 0.5 pi of 10 mM each dNTPs and 1 pl of 1 U/pl of T4 polymerase and incubating at 11°C for 10 minutes. The polymerase was then

C

inactivated by incubating the reaction at 75°C for 10 minutes. The largest plasmid fragment of approximately 8600 bp was then gel-purified using a QIAquick DNA Gel O Extraction Kit from a 0.8% agarose-0.5X TBE gel according to the manufacturer's 0instructions. The recovered DNA insert (pDG268Aneo-crylllAstab/sehasA) was then re- Sligated using the Rapid DNA Cloning Kit according to the manufacturer's instructions.

c The ligation mix was transformed into E. coli SURE competent cells (Stratagene, 010 Inc., La Jolla, CA). Transformants were selected on 2X YT agar plates supplemented CN with 100 p.g of ampicillin per ml at 37 0 C. Plasmid DNA was purified from several transformants using a QIAGEN robot according to the manufacturers instructions and analyzed by Scal digestion on a 0.8% agarose gel using 0.5X TBE buffer. The correct plasmid was identified by the presence of an approximately 8,755 bp fragment and was designated pRB156 (Figure 42).

Example 18: Construction of Bacillus subtilis MF009 The hasA gene under control of the scBAN promoter was introduced into the pectate lyase gene (pel) locus of Bacillus subtilis MF002 to generate Bacillus subtilis MF009.

Plasmid pRB156 was digested with Sacl. The digested plasmid was then purified using a QlAquick DNA Purification Kit according to the manufacturer's instructions, and finally digested with Notl. The smallest plasmid fragment of approximately 1,377 bp was gel-purified using a QIAquick DNA Gel Extraction Kit from a 0.8% agarose-0.5X TBE gel according to the manufacturers instructions. The recovered DNA insert was then ligated with the vector DNA described below.

Plasmid pRB162 (Example 16, Figure 41) was digested with Notl. The digested plasmid was then purified using a QIAquick DNA Purification Kit according to the manufacturer's instructions, and finally digested with Sad. The largest plasmid fragment of approximately 5850 bp was gel-purified using a QlAquick DNA Gel Extraction Kit from a 0.8% agarose-0.5X TBE gel according to the manufacturer's instructions. The recovered vector DNA was then ligated with the DNA insert described above.

The ligation mixture was transformed directly in Bacillus subtilis 168A4 competent cells. Bacillus subtilis chloramphenicol-resistant transformants were selected on TBAB plates supplemented with 5 pg of chloramphenicol per ml at 37 0 C. To screen for integration of the plasmid by double cross-over at the pel locus, Bacillus subtilis 00

O

O

primary transformants were patched on TBAB plates supplemented with 6 pg of neomycin per ml and on TBAB plates supplemented with 5 pg of chloramphenicol per ml. Integration of the plasmid by double cross-over at the pel locus does not incorporate the neomycin resistance gene and therefore renders the strain neomycin sensitive.

Using this plate screen, chloramphenicol resistant and neomycin sensitive transformants were isolated.

Genomic DNA was isolated from the chloramphenicol resistant and neomycin Ssensitive Bacillus subtilis 168A4 transformants using a QIAGEN tip-20 column according to the manufacturer's instructions. This genomic DNA was used to transform competent 00 Bacillus subtilis MF002 (Example 15). Transformants were selected on TBAB plates containing 5 jg of chloramphenicol per ml and grown at 37 0 C. The Bacillus subtilis A164A5 hasA and tuaD/gtaB integrant was identified by its "wet" phenotype and designated Bacillus subtilis MF009.

is Example 19: Construction of Bacillus subtilis MF010 Plasmid pDG268MCSAneo/BAN/Sav Patent No. 5,955,310) was digested with Notl. The digested plasmid was then purified using a QIAquick DNA Purification Kit according to the manufacturer's instructions, and finally digested with Sfil. The smallest plasmid fragment of approximately 185 bp was gel-purified using a QIAquick DNA Gel Extraction Kit from a 0.8% agarose-0.5X TBE gel according to the manufacturer's instructions. The recovered DNA insert was then ligated with the vector DNA described below.

Plasmid pRB162 (Example 16, Figure 41) was digested with Notl. The digested plasmid was then purified using a QIAquick DNA Purification Kit according to the manufacturer's instructions, and finally digested with Sfil. The largest plasmid fragment of approximately 5747 bp was gel-purified using a QIAquick DNA Gel Extraction Kit from a 0.8% agarose-0.5X TBE gel according to the manufacturer's instructions. The recovered vector DNA was then ligated with the DNA insert described above.

The recovered vector and DNA insert were ligated using the Rapid DNA Cloning Kit according to the manufacturer's instructions. The ligation mix was transformed into E. coli XLI Blue competent cells. Transformants were selected on 2X YT agar plates supplemented with 100 lig of ampicillin per ml.

Plasmid DNA was purified from several transformants using a QIAGEN robot according to the manufacturer's instructions and analyzed by BamHI digestion on a 0.8% agarose gel using 0.5X TBE buffer. The correct plasmid was identified by the linearization of the plasmid which provides an approximately 7,156 bp fragment and was designated pRB164 (Figure 43).

00

O

O

SPlasmid pRB156 (Example 17, Figure 42) was digested with Sacl. The digested T plasmid was then purified using a QIAquick DNA Purification Kit according to the manufacturer's instructions, and finally digested with Notl. The smallest plasmid fragment of approximately 1377 bp was gel-purified using a QIAquick DNA Gel s Extraction Kit from a 0.8% agarose-0.5X TBE gel according to the manufacturer's Sinstructions. The recovered DNA insert was then ligated with the vector DNA described below.

SPlasmid pRB164 was digested with Notl. The digested plasmid was then 00 purified using a QIAquick DNA Purification Kit according to the manufacturer's instructions, and finally digested with Sad. The largest plasmid fragment of C1 approximately 5922 bp was gel-purified using a QIAquick DNA Gel Extraction Kit from a 0.8% agarose-0.5X TBE gel according to the manufacturer's instructions. The recovered vector DNA was then ligated with the DNA insert described above.

This ligation mix was transformed directly in Bacillus subtilis 168A4 competent is cells. Bacillus subtilis chloramphenicol-resistant transformants were selected on TBAB plates supplemented with 5 pg of chloramphenicol per ml at 37°C. To screen for integration of the plasmid by double cross-over at the amyE locus, Bacillus subtilis primary transformants were patched on TBAB plates supplemented with 6 pg of neomycin per ml and on TBAB plates supplemented with 5 pg of chloramphenicol per ml. Integration of the plasmid by double cross-over at the amyE locus does not incorporate the neomycin resistance gene and therefore renders the strain neomycin sensitive. Using this plate screen, chloramphenicol resistant and neomycin sensitive transformants were isolated.

Genomic DNA was isolated from the chloramphenicol resistant and neomycin sensitive Bacillus subtilis 168A4 transformants using a QIAGEN tip-20 column according to the manufacturer's instructions. This genomic DNA was used to transform competent Bacillus subtilis MF002 (Example 15). Transformants were selected on minimal plates containing 5 .g of chloramphenicol per ml and grown at 37 0 C for 16 hours. A Bacillus subtilis A164A5 BANIhasA and scBAN/tuaD/gtaB integrant was identified by its "wet" phenotype and designated Bacillus subtilis MF010.

Example 20: Fermentations The ability of the Bacillus subtilis strains listed In Table 1 to produce hyaluronic acid was evaluated under various growth conditions.

Table 1 B. subtilis Strain promoter/qene complement catA rn-nYA 00

O

O

RB161 scBAN/hasA/tuaD/gtaB no D no [T RB163 scBAN/hasA/tuaD/gcaD no no S s TH-1 scBANhasA/hasB/hasC/hasD no no RB184 scBAN/hasAltuaD no no RB187 scBAN/hasAltuaD/gtaB yes no RB192 scBAN/hasA/tuaD yes no RB194 scBAN/hasA/tuaD/gtaB yes yes C RB197 scBAN/hasA/tuaD/gtaB yes 0yes is RB200 scBAN/hasA/tuaD yes yes Cr RB202 scBAN/hasA/hasB/hasC/hasD yes yes MF009 scBAN/tuaD/gtaB no no scBAN/hasA MF010 scBAN/tuaD/gtaB no no BAN/hasA The Bacillus subtilis strains were fermented in standard small fermenters in a medium composed per liter of 6.5 g of KH 2

PO

4 4.5 g of Na 2

HPO

4 3.0 g of (NH4) 2

SO

4 g of Na 3 -citrate-2H 2 0, 3.0 g of MgSO 4 -7H 2 0, 6.0 ml of Mikrosoy-2, 0.15 mg of biotin (1 ml of 0.15 mg/ml ethanol), 15.0 g of sucrose, 1.0 ml of SB 2066, 2.0 ml of P2000, g of CaCl2-2H 2 0. The medium was pH 6.3 to 6.4 (unadjusted) prior to autoclaving. The CaCl2"2H 2 0 was added after autoclaving.

The seed medium used was B-3, Agar-3 without agar, or medium.

The Agar-3 medium was composed per liter of 4.0 g of nutrient broth, 7.5 g of hydrolyzed protein, 3.0 g of yeast extract, 1.0 g of glucose, and 2% agar. The pH was not adjusted; pH before autoclaving was approximately 6.8; after autoclaving approximately pH 7.7.

The sucrose/soy seed flask medium was composed per liter of 65 g of sucrose, 35 g of soy flour, 2 g of Na 3 -citrate-2H 2 O, 4 g of KH 2

PO

4 5 g of Na 2

HPO

4 and 6 ml of trace elements. The medium was adjusted pH to about 7 with NaOH; after dispensing the medium to flasks, 0.2% vegetable oil was added to suppress foaming.

Trace elements was composed per liter of 100 g of citric acid-H 2 0, 20 g of FeS04-7H 2 0, g of MnSO 4

-H

2 0, 2 g of CuSO45H 2 O, and 2 g of ZnCl 2 The pH was adjusted to 6.8 7.0 with ammonia before inoculation, and controlled thereafter at pH 7.0 0.2 with ammonia and H 3

PO

4 The temperature was maintained at 37'C. Agitation was at a maximum of 1300 RPM using two 6-bladed rushton impellers of 6 cm diameter in 3 liter tank with initial volume of 1.5 liters. The 00

O

aeration had a maximum of 1.5 WM.

T For feed, a simple sucrose solution was used. Feed started at about 4 hours after inoculation, when dissolved oxygen was still being driven down before sucrose depletion). The feed rate was ramped linearly from 0 to approximately 6 g sucrose/Lo-hr over a 7 hour time span. A lower feed rate, ramped linearly from 0 to approximately 2 g sucrose/Lo-hr, was also used in some fermentations.

O Viscosity was noticeable by about 10 hours and by 24 hours viscosity was very 0high, causing the D.O. to bottom-out. End-point viscosity reached 3,220 cP. Cell mass 00 development reached a near maximum (12 to 15 g/liter) by 20 hours. Cells were Sto removed by diluting 1 part culture with 3 parts water, mixing well and centrifuging at Sabout 30,000 x g to produce a clear supernatant and cell pellet, which can be washed and dried.

Assays of hyaluronic acid concentration were performed using the ELISA method, based on a hyaluronan binding protein (protein and kits commercially available is from Seikagaku America, Falmouth, MA).

Bacillus subtilis RB 161 and RB163 were cultured in batch and fed-batch fermentations. In the fed-batch processes, the feed rate was varied between cultures of Bacillus subtilis strains RB163 and RB161. Assays of hyaluronic acid concentrations were again performed using the ELISA method. The results are provided in Table 2.

Table 2 Strain and Growth HA (relative Conditions yield)

ELISA

method RB-161 (hasA/tuaD/gtaB) 0.7±0.1 simple batch RB-163 (hasA/tuaD/gcaD) fed batch 6 g 0.9 0.1 sucrose/Lo-hr RB161 (hasA/tuaD/gtaB) fed batch 6 g 0.9 0.1 sucrose/Lo-hr RB-163 (hasA/tuaD/gcaD) fed batch 2 g 1.0 0..2 sucrose/Lo-hr 00

O

RB161 (hasAltuaD/gtaB) 1.0 0..1 F fed batch 2 g sucrose/Lo-hr The results of the culture assays for the same strain at a fed batch rate of 2 gfL sucrose/Lo-hr compared to 6 g/L sucrose/Lo-hr demonstrated that a faster sucrose feed rate did not significantly improve titers.

s A summary of the Bacillus strains run under same conditions (fed batch at 00 approximately 2 g sucrose/Lo-hr, 37°C) is shown in Figure 44. In Figure 44, values indicate standard deviation of data from multiple runs under the same conditions. Data r C without values are from single runs. Hyaluronic acid concentrations were determined using the modified carbazole method (Bitter and Muir, 1962, Anal Biochem. 4: 330-334).

A summary of peak hyaluronic acid weight average molecular weights (MDa) obtained from fermentation of the recombinant Bacillus subtilis strains under the same conditions (fed batch at approximately 2 g sucrose/Lo-hr, 370C) is shown in Figure Molecular weights were determined using a GPC MALLS assay. Data was gathered from GPC MALLS assays using the following procedure. GPC-MALLS (gel permeation is or size-exclusion) chromatography coupled with multi-angle laser light scattering) is widely used to characterize high molecular weight (MW) polymers. Separation of polymers is achieved by GPC, based on the differential partitioning of molecules of different MW between eluent and resin. The average molecular weight of an individual polymer is determined by MALLS based the differential scattering extent/angle of molecules of different MW. Principles of GPC-MALLS and protocols suited for hyaluronic acid are described by Ueno et al., 1988, Chem. Pharm. Bull. 36, 4971-4975; Wyatt, 1993, Anal. Chim. Acta 272: 1-40; and Wyatt Technologies, 1999, "Light Scattering University DAWN Course Manual" and "DAWN EOS Manual" Wyatt Technology Corporation, Santa Barbara, California). An Agilent 1100 isocratic HPLC, a Tosoh Biosep G6000 PWxl column for the GPC, and a Wyatt Down EOS for the MALLS were used. An Agilent G1362A refractive index detector was linked downstream from the MALLS for eluate concentrationr determination. Various commercial hyaluronic acid products with known molecular weights served as standards.

Deposit of Biological Material The following biological material has been deposited under the terms of the Budapest Treaty with the Agricultural Research Service Patent Culture Collection, Northern Regional Research Center, 1815 University Street, Peoria, Illinois, 61604, and 00 Sgiven the following accession number: Deposit Accession Number Date of Deposit E. coliXL10 Gold kan (pMRT106) NRRL B-30536 December 12, 2001 The strain has been deposited under conditions that assure that access to the O culture will be available during the pendency of this patent application to one determined by the Commissioner of Patents and Trademarks to be entitled thereto under 37 C.F.R.

§1.14 and 35 U.S.C. §122. The deposit represents a substantially pure culture of the 00 deposited strain. The deposit is available as required by foreign patent laws in countries wherein counterparts of the subject application, or its progeny are filed. However, it should be understood that the availability of a deposit does not constitute a license to practice the subject invention in derogation of patent rights granted by govemmental action.

The invention described and claimed herein is not to be limited in scope by the specific embodiments herein disclosed, since these embodiments are intended as illustrations of several aspects of the invention. Any equivalent embodiments are intended to be within the scope of this invention. Indeed, various modifications of the invention in addition to those shown and described herein will become apparent to those skilled in the art from the foregoing description. Such modifications are also intended to fall within the scope of the appended claims. In the case of conflict, the present disclosure including definitions will control.

Various references are cited herein, the disclosures of which are incorporated by reference in their entireties.

00 [Applicant's or agents file International application N 4 reference number 1O24l.2O4-WP) To be asqA'!'je tj S L 4J.OaIS 7' INDICATIONS RELATING TO A DEPOSITED MICROORGANISM (PCT Rule 13 bis) A. The indications made below relate to the microorganism referred to in the description on page 72 ,line 3 B. IDENTIFICATION OF Further deposits are identified on an additional sheet L 11 Name of depository institution Agricultural Research Service Patent Culture Collection (NRRL) Address of depository institution (Including postal code and country) Northern Regional Research Center 1815 University Street Peoria, IL 61604, US Date of deposit Accession Number December 12, 2001 B-30536 C. ADDIT IONAL INDICATIONS (leave blank (fot applicable) This information is continued on an additional sheet 1100 In respect of those designations in which a European and/or Australia Patent is sought during the pendency of the patent application, a sample of the deposited microorganism is only to be provided to an independent expert nominated by the person requesting the sample (Rule 2 8(4) EPC/Regulation 3.25 of Australia Statutory Rule 1991 No. 7 1).

D. DESIGNATED STATES FOR WHICH INDICATIONS ARE MADE (fthe indications are not for all designated States) The indication listed below will be submitted to the International Bureau Later (specify' the general nature of the idications eag.

"Accession Nwnber of Deposit') For receiving Office use only LO0 ibis sbeetc was received with the international application Authorized officer Form PCI*/RO/134 (July 1992) For International Bureau use only L] 0 This sheet was rceived with the International Bureau on; Authorized officer

Claims (145)

1. 2. The method of claim 1, wherein the hyaluronan synthase encoding sequence encodes a Group I hyaluronan synthase. is 3. The method of claim 2, wherein the Group I hyaluronan synthase encoding sequence is obtained from a Streptococcus strain.
2. 4. The method of claim 3, wherein the Streptococcus strain is Streptococcus equisimilis, Streptococcus pyogenes, Streptococcus uberis, or Streptococcus equi subsp. zooepidemicus. The method of claim 1, wherein the hyaluronan synthase encoding sequence is selected from the group consisting of a nucleic acid sequence encoding a polypeptide with an amino acid sequence having at least about 70%, about 75%, about 80%, about 85%, about 90%, or about 95% identity to SEQ ID NO: 2, SEQ ID NO: 93, or SEQ ID NO: 103; a nucleic acid sequence which hybridizes under low, medium, or high stringency conditions with SEQ ID NO: 1, SEQ ID NO: 92, or SEQ ID NO: 102; and a complementary strand of or
3. 6. The method of claim 5, wherein the hyaluronan synthase encoding sequence encodes a polypeptide having the amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 93, or SEQ ID NO: 103; or a fragment thereof having hyaluronan synthase activity.
4. 7. The method of claim 1, wherein the hyaluronan synthase encoding sequence encodes a Group II hyaluronan synthase.
5. 8. The method of claim 7, wherein the Group II hyaluronan synthase encoding 00 O O Ssequence is obtained from a Pasteurella strain.
6. 9. The method of claim 8, wherein the Pasteurella strain is Pasteurella multocida. s 10. The method of claim 1, wherein the hyaluronan synthase encoding sequence is _O selected from the group consisting of a nucleic acid sequence encoding a Spolypeptide with an amino acid sequence having at least about 70%, about 75%, about about 85%, about 90%, or about 95% identity to SEQ ID NO: 95; a nucleic acid sequence which hybridizes under low, medium, or high stringency conditions with SEQ ID NO: 94; and a complementary strand of or
7. 11. The method of claim 10, wherein the hyaluronan synthase encoding sequence encodes a polypeptide having the amino acid sequence of SEQ ID NO: 95, or a fragment thereof having hyaluronan synthase activity.
8. 12. The method of claim 1, wherein a precursor sugar of the hyaluronic acid is supplied to or produced by the Bacillus host cell.
9. 13. The method of claim 12, wherein the precursor sugar is D-glucuronic acid or N- acetyl-glucosamine.
10. 14. The method of claim 12, wherein the precursor sugar is encoded by endogenous genes, by non-endogenous genes, or by a combination of endogenous and non- endogenous genes in the Bacillus host cell. The method of claim 1, wherein the nucleic acid construct further comprises one or more genes encoding enzymes in the biosynthesis of a precursor sugar of the hyaluronic acid or the Bacillus host cell further comprises one or more second nucleic acid constructs comprising one or more genes encoding enzymes in the biosynthesis of a precursor sugar of the hyaluronic acid.
11. 16. The method of claim 15, wherein the one or more genes is selected from the group consisting of a UDP-glucose 6-dehydrogenase gene, UDP-glucose pyrophosphorylase gene, UDP-N-acetylglucosamine pyrophosphorylase gene, glucose- 6-phosphate isomerase gene, hexokinase gene, phosphoglucomutase gene, amidotransferase gene, mutase gene, and acetyl transferase gene. 00 O O
12. 17. The method of claim 16, wherein the UDP-glucose 6-dehydrogenase gene is a hasB gene or tuaD gene; or homologs thereof.
13. 18. The method of claim 17, wherein the hasB gene is selected from the group s consisting of a nucleic acid sequence encoding a polypeptide with an amino acid sequence having at least about 70%, about 75%, about 80%, about 85%, about 90%, or about 95% identity to SEQ ID NO: 41, SEQ ID NO: 97, or SEQ ID NO: 105; a nucleic Sacid sequence which hybridizes under low, medium, or high stringency conditions with 00 SEQ ID NO: 40, SEQ ID NO: 96, or SEQ ID NO: 104; and a complementary strand of or
14. 19. The method of claim 18, wherein the hasB gene encodes a polypeptide having the amino acid sequence of SEQ ID NO: 41, SEQ ID NO: 97, or SEQ ID NO: 105; or a fragment thereof having UDP-glucose 6-dehydrogenase activity. The method of claim 17, wherein the tuaD gene is selected from the group consisting of a nucleic acid sequence encoding a polypeptide with an amino acid sequence having at least about 70%, about 75%, about 80%, about 85%, about 90%, or about 95% identity to SEQ ID NO: 12; a nucleic acid sequence which hybridizes under low, medium, or high stringency conditions with SEQ ID NO: 11; and a complementary strand of or
15. 21. The method of claim 20, wherein the tuaD gene encodes a polypeptide having the amino acid sequence of SEQ ID NO: 12, or a fragment thereof having UDP-glucose 6-dehydrogenase activity.
16. 22. The method of claim 16, wherein the UDP-glucose pyrophosphorylase gene is a hasC gene or gtaB gene; or homologs thereof.
17. 23. The method of claim 22, wherein the hasC gene is selected from the group consisting of a nucleic acid sequence encoding a polypeptide with an amino acid sequence having at least about 70%, about 75%, about 80%, about 85%, about 90%, or about 95% identity to SEQ ID NO: 43, SEQ ID NO: 99, or SEQ ID NO: 107; a nucleic acid sequence which hybridizes under low, medium, or high stringency conditions with SEQ ID NO: 42 or SEQ ID NO: 98, or SEQ ID NO: 106; and a complementary strand of or 00 O (N
18. 24. The method of claim 23, wherein the hasC gene encodes a polypeptide having Sthe amino acid sequence of SEQ ID NO: 43 or SEQ ID NO: 99, or SEQ ID NO: 107; or a fragment thereof having UDP-glucose pyrophosphorylase activity.
19. 25. The method of claim 22, wherein the gtaB gene is selected from the group consisting of a nucleic acid sequence encoding a polypeptide with an amino acid sequence having at least about 70%, about 75%, about 80%, about 85%, about 90%, or Sabout 95% identity to SEQ ID NO: 22; a nucleic acid sequence which hybridizes cN under low, medium, or high stringency conditions with SEQ ID NO: 21; and a 00 complementary strand of or
20. 26. The method of claim 25, wherein the gtaB gene encodes a polypeptide having the amino acid sequence of SEQ ID NO: 22, or a fragment thereof having UDP-glucose pyrophosphorylase activity.
21. 27. The method of claim 16, wherein the UDP-N-acetylglucosamine pyrophosphorylase gene is a hasD or gcaD gene; or homologs thereof.
22. 28. The method of claim 27, wherein the hasD gene is selected from the group consisting of a nucleic acid sequence encoding a polypeptide with an amino acid sequence having at least about 70%, about 75%, about 80%, about 85%, about 90%, or about 95% identity to SEQ ID NO: 45; a nucleic acid sequence which hybridizes under low, medium, or high stringency, conditions with SEQ ID NO: 44; and a complementary strand of or
23. 29. The method of claim 28, wherein the hasD gene encodes a polypeptide having the amino acid sequence of SEQ ID NO: 45, or a fragment thereof having UDP-N- acetylglucosamine pyrophosphorylase activity.
24. 30. The method of claim 27, wherein the gcaD gene is selected from the group consisting of a nucleic acid sequence encoding a polypeptide with an amino acid sequence having at least about 70%, about 75%, about 80%, about 85%, about 90%, or about 95% identity to SEQ ID NO: 30; a nucleic acid sequence which hybridizes under low, medium, or high stringency conditions with SEQ ID NO: 29; and a complementary strand of or
25. 31. The method of claim 30, wherein the gcaD gene encodes a polypeptide having 00 O O the amino acid sequence of SEQ ID NO: 30, or a fragment thereof having UDP-N- T acetylglucosamine pyrophosphorylase activity. (N-
26. 32. The method of claim 16, wherein the glucose-6-phosphate isomerase gene is a s hasE or homolog thereof.
27. 33. The method of claim 32, wherein the hasE gene is selected from the group consisting of a nucleic acid sequence encoding a polypeptide with an amino acid 00 sequence having at least about 70%, about 75%, about 80%, about 85%, about 90%, or about 95% identity to SEQ ID NO: 101; a nucleic acid sequence which hybridizes Sunder low, medium, or high stringency conditions with SEQ ID NO: 100; and a complementary strand of or
28. 34. The method of claim 33, wherein the hasE gene encodes a polypeptide having is the amino acid sequence of SEQ ID NO: 101, or a fragment thereof having glucose-6- phosphate isomerase activity. The method of claim 15, wherein the one or more genes encoding a precursor sugar is under the control of the same or a different promoter(s) as the hyaluronan synthase encoding sequence.
29. 36. The method of claim 35, wherein the same or the different promoter sequence comprises a "consensus" promoter having the sequence TTGACA for the region and TATAAT for the region.
30. 37. The method of claim 35, wherein the same or the different promoter sequence(s) is a tandem promoter in which each promoter of the tandem promoter is operably linked to the hyaluronan synthase encoding sequence.
31. 38. The method of claim 1, wherein the nucleic acid construct further comprises an mRNA processing/stabilizing sequence located downstream of the promoter sequence and upstream of the hyaluronan synthase encoding sequence.
32. 39. The method of claim 15, wherein the nucleic acid construct further comprises an mRNA processing/stabilizing sequence located downstream of a different promoter or different promoters of the one or more genes encoding enzymes in the biosynthesis of the precursor sugar and upstream of the one or more genes. 00 O O T 40. The method of claim 1, wherein the nucleic acid construct further comprises a selectable marker gene. s 41. The method of claim 1, wherein the Bacillus host cell is selected from the group o consisting of Bacillus agaradherens, Bacillus alkalophilus, Bacillus amyloliquefaciens, 01 Bacillus brevis, Bacillus circulans, Bacillus clausii, Bacillus coagulans, Bacillus firmus, SBacillus lautus, Bacillus lentus, Bacillus licheniformis, Bacillus megaterium, Bacillus 00 pumilus, Bacillus stearothermophilus, Bacillus subtilis, and Bacillus thuringiensis. 0io S42. The method of claim 1, wherein the Bacillus host cell is Bacillus subtilis.
33. 43. The method of claim 1, wherein the Bacillus host cell is Bacillus licheniformis.
34. 44. The method of claim 1, wherein the Bacillus host cell is unmarked with a selectable marker. The method of claim 1, wherein the nucleic acid construct comprises a hyaluronan synthase gene, UDP-glucose 6-dehydrogenase gene, and UDP-glucose pyrophosphorylase gene operably linked to a short "consensus" promoter of amyQ having the sequence TTGACA for the region and TATAAT for the region.
35. 46. A Bacillus host cell comprising a nucleic acid construct comprising a hyaluronan synthase encoding sequence operably linked to a promoter sequence foreign to the hyaluronan synthase encoding sequence.
36. 47. The Bacillus host cell of claim 46, wherein the hyaluronan synthase encoding sequence encodes a Group I hyaluronan synthase.
37. 48. The Bacillus host cell of claim 47, wherein the Group I hyaluronan synthase encoding sequence is obtained from a Streptococcus strain.
38. 49. The Bacillus host cell of claim 48, wherein the Streptococcus strain is Streptococcus equisimilis, Streptococcus pyogenes, Streptococcus uberis, or Streptococcus equi subsp. zooepidemicus. The Bacillus host cell of claim 46, wherein the hyaluronan synthase encoding 00 O O sequence is selected from the group consisting of a nucleic acid sequence encoding Sa polypeptide with an amino acid sequence having at least about 70%, about about 80%, about 85%, about 90%, or about 95% identity to SEQ ID NO: 2, SEQ ID NO: 93, or SEQ ID NO: 103; a nucleic acid sequence which hybridizes under low, medium, or high stringency conditions with SEQ ID NO: 1, SEQ ID NO: 92, or SEQ ID SNO: 102; and a complementary strand of or S51. The Bacillus host cell of claim 50, wherein the hyaluronan synthase encoding 00 sequence encodes a polypeptide with the amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 93, or SEQ ID NO: 103; or a fragment thereof encoding a polypeptide having Cl hyaluronan synthase activity.
39. 52. The Bacillus host cell of claim 46, wherein the hyaluronan synthase encoding sequence encodes a Group II hyaluronan synthase.
40. 53. The Bacillus host cell of claim 52, wherein the Group II hyaluronan synthase encoding sequence is obtained from a Pasteurella strain.
41. 54. The Bacillus host cell of claim 53, wherein the Pasteurella strain is Pasteurella multocida. The Bacillus host cell of claim 46, wherein the hyaluronan synthase encoding sequence is selected from the group consisting of a nucleic acid sequence encoding a polypeptide with an amino acid sequence having at least about 70%, about about 80%, about 85%, about 90%, or about 95% identity to SEQ ID NO: 95; a nucleic acid sequence which hybridizes under low, medium, or high stringency conditions with SEQ ID NO: 94; and a complementary strand of or
42. 56. The Bacillus host cell of claim 55, wherein the hyaluronan synthase encoding sequence encodes a polypeptide with the amino acid sequence of SEQ ID NO: 95, or a fragment thereof encoding a polypeptide having hyaluronan synthase activity.
43. 57. The Bacillus host cell of claim 46, wherein a precursor sugar of the hyaluronic acid is supplied to or produced by the Bacillus host cell.
44. 58. The Bacillus host cell of claim 57, wherein the precursor sugar is D-glucuronic acid or N-acetyl-glucosamine. 00 O O
45. 59. The Bacillus host cell of claim 57, wherein the precursor sugar is encoded by endogenous genes, by non-endogenous genes, or by a combination of endogenous and non-endogenous genes in the Bacillus host cell. The Bacillus host cell of claim 46, wherein the nucleic acid construct further comprises one or more genes encoding enzymes in the biosynthesis of a precursor sugar of the hyaluronic acid or the Bacillus host cell comprises one or more second 00 nucleic acid constructs comprising one or more genes encoding enzymes in the biosynthesis of a precursor sugar of the hyaluronic acid.
46. 61. The Bacillus host cell of claim 60, wherein the one or more genes is selected from the group consisting of a UDP-glucose 6-dehydrogenase gene, UDP-glucose pyrophosphorylase gene, UDP-N-acetylglucosamine pyrophosphorylase gene, glucose- is 6-phosphate isomerase gene, hexokinase gene, phosphoglucomutase gene, amidotransferase gene, mutase gene, and acetyl transferase gene.
47. 62. The Bacillus host cell of claim 61, wherein the UDP-glucose 6-dehydrogenase gene is a hasB gene or tuaD gene; or homologs thereof.
48. 63. The Bacillus host cell of claim 62, wherein the hasB gene is selected from the group consisting of a nucleic acid sequence encoding a polypeptide with an amino acid sequence having at least about 70%, about 75%, about 80%, about 85%, about or about 95% identity to SEQ ID NO: 41, SEQ ID NO: 97, or SEQ ID NO: 105; (b) a nucleic acid sequence which hybridizes under low, medium, or high stringency conditions with SEQ ID NO: 40, SEQ ID NO: 96, or SEQ ID NO: 104; and a complementary strand of or
49. 64. The Bacillus host cell of claim 63, wherein the hasB gene encodes a polypeptide having the amino acid sequence SEQ ID NO: 41, SEQ ID NO: 97, or SEQ ID NO: 105; or a fragment thereof having UDP-glucose 6-dehydrogenase activity. The Bacillus host cell of claim 62, wherein the tuaD gene is selected from the group consisting of a nucleic acid sequence encoding a polypeptide with an amino acid sequence having at least about 70%, about 75%, about 80%, about 85%, about or about 95% identity to SEQ ID NO: 12; a nucleic acid sequence which hybridizes under low, medium, or high stringency conditions with SEQ ID NO: 11; and 00 O O S(c) a complementary strand of or CD
50. 66. The Bacillus host cell of claim 65, wherein the tuaD gene encodes a polypeptide C having the amino acid sequence SEQ ID NO: 12, or a fragment thereof having UDP- s glucose 6-dehydrogenase activity.
51. 67. The Bacillus host cell of claim 61, wherein the UDP-glucose pyrophosphorylase Sgene is a hasC gene or gtaB gene; or homologs thereof. 00
52. 68. The Bacillus host cell of claim 67, wherein the hasC gene is selected from the NC< group consisting of a nucleic acid sequence encoding a polypeptide with an amino acid sequence having at least about 70%, about 75%, about 80%, about 85%, about or about 95% identity to SEQ ID NO: 43, SEQ ID NO: 99, or SEQ ID NO: 107; (b) a nucleic acid sequence which hybridizes under low, medium, or high stringency is conditions with SEQ ID NO: 42 or SEQ ID NO: 98, or SEQ ID NO: 106; and a complementary strand of or
53. 69. The Bacillus host cell of claim 68, wherein the hasC gene encodes a polypeptide having the amino acid sequence SEQ ID NO: 43, SEQ ID NO: 99, or SEQ ID NO: 107; or a fragment thereof having UDP-glucose pyrophosphorylase activity. The Bacillus host cell of claim 61, wherein the gtaB gene is selected from the group consisting of a nucleic acid sequence encoding a polypeptide with an amino acid sequence having at least about 70%, about 75%, about 80%, about 85%, about 90%, or about 95% identity to SEQ ID NO: 22; a nucleic acid sequence which hybridizes under low, medium, or high stringency conditions with SEQ ID NO: 21; and a complementary strand of or
54. 71. The Bacillus host cell of claim 70, wherein the gtaB gene encodes a polypeptide having the amino acid sequence SEQ ID NO: 22, or a fragment thereof having UDP- glucose pyrophosphorylase activity.
55. 72. The Bacillus host cell of claim 61, wherein the UDP-N-acetylglucosamine pyrophosphorylase gene is a hasD or gcaD gene; or homologs thereof.
56. 73. The Bacillus host cell of claim 72, wherein the hasD gene is selected from the group consisting of a nucleic acid sequence encoding a polypeptide with an amino 00 O O acid sequence having at least about 70%, about 75%, about 80%, about 85%, about or about 95% identity to SEQ ID NO: 45; a nucleic acid sequence which Shybridizes under low, medium, or high stringency conditions with SEQ ID NO: 44; and a complementary strand of or O 74. The Bacillus host cell of claim 73, wherein the hasD gene encodes a polypeptide 0having the amino acid sequence SEQ ID NO: 45, or a fragment thereof having UDP-N- acetylglucosamine pyrophosphorylase activity. 00 0o 75. The Bacillus host cell of claim 72, wherein the gcaD gene is selected from the C group consisting of a nucleic acid sequence encoding a polypeptide with an amino acid sequence having at least about 70%, about 75%, about 80%, about 85%, about or about 95%identity to SEQ ID NO: 30; a nucleic acid sequence which hybridizes under low, medium, or high stringency conditions with SEQ ID NO: 29; and a complementary strand of or
57. 76. The Bacillus host cell of claim 75, wherein the gcaD gene encodes a polypeptide having the amino acid sequence of SEQ ID NO: 30, or a fragment thereof having UDP- N-acetylglucosamine pyrophosphorylase activity.
58. 77. The Bacillus host cell of claim 61, wherein the glucose-6-phosphate isomerase gene is a hasE or homolog thereof.
59. 78. The Bacillus host cell of claim 77, wherein the hasE gene is selected from the group consisting of a nucleic acid sequence encoding a polypeptide with an amino acid sequence having at least about 70%, about 75%, about 80%, about 85%, about or about 95% identity to SEQ ID NO: 101; a nucleic acid sequence which hybridizes under low, medium, or high stringency conditions with SEQ ID NO: 100; and a complementary strand of or
60. 79. The Bacillus host cell of claim 78, wherein the hasE gene encodes a polypeptide having the amino acid sequence SEQ ID NO: 101, or a fragment thereof having glucose-6-phosphate isomerase activity.
61. 80. The Bacillus host cell of claim 60, wherein the one or more genes encoding a precursor sugar are under the control of the same or a different promoter(s) as the hyaluronan synthase encoding sequence. 00 O O T 81. The Bacillus host cell of claim 80, wherein the same or the different promoter sequence(s) comprises a "consensus" promoter having the sequence TTGACA for the region and TATAAT for the region. S
62. 82. The Bacillus host cell of claim 80, wherein the same or the different promoter or the different promoters is a tandem promoter in which each promoter of the tandem Spromoter is operably linked to the hyaluronan synthase encoding sequence. 00
63. 83. The Bacillus host cell of claim 46, wherein the nucleic acid construct further CN comprises an mRNA processing/stabilizing sequence located downstream of the promoter sequence and upstream of the hyaluronan synthase encoding sequence.
64. 84. The Bacillus host cell of claim 60, wherein the nucleic acid construct further comprises an mRNA processing/stabilizing sequence located downstream of the different promoter sequence(s) of the one or more genes encoding enzymes in the biosynthesis of a precursor sugar of the hyaluronic acid and upstream of the one or more genes.
65. 85. The Bacillus host cell of claim 46, wherein the nucleic acid construct further comprises a selectable marker gene.
66. 86. The Bacillus host cell of claim 47, wherein the Bacillus host cell is selected from the group consisting of Bacillus agaradherens, Bacillus alkalophilus, Bacillus amyloliquefaciens, Bacillus brevis, Bacillus circulans, Bacillus clausii, Bacillus coagulans, Bacillus firmus, Bacillus lautus, Bacillus lentus, Bacillus licheniformis, Bacillus megaterium, Bacillus pumilus, Bacillus stearothermophilus, Bacillus subtilis, and Bacillus thuringiensis.
67. 87. The Bacillus host cell of claim 46, wherein the Bacillus host cell is Bacillus subtilis.
68. 88. The Bacillus host cell of claim 46, wherein the Bacillus host cell is Bacillus licheniformis.
69. 89. The Bacillus host cell of claim 46, which is unmarked with a selectable marker. 00 O The Bacillus host cell of claim 46, wherein the nucleic acid construct comprises a T. hyaluronan synthase gene, UDP-glucose 6-dehydrogenase gene, and UDP-glucose pyrophosphorylase gene operably linked to a short "consensus" promoter of amyQ having the sequence TTGACA for the region and TATAAT for the region. O 91. A nucleic acid construct comprising a hyaluronan synthase encoding sequence 0operably linked to a promoter sequence foreign to the hyaluronan synthase encoding 0sequence. 00
70. 92. The construct of claim 91, wherein the gene for precursor sugar is expressed rC, from the same promoter as the promoter of the hyaluronan synthase encoding sequence.
71. 93. The construct of claim 91, wherein the gene for precursor sugar is expressed is from a different promoter as the promoter of the hyaluronan synthase encoding sequence.
72. 94. The construct of claim 91, wherein the hyaluronan synthase encoding sequence encodes a Group I hyaluronan synthase. The construct of claim 94, wherein the Group I hyaluronan synthase encoding sequence is obtained from a Streptococcus strain.
73. 96. The construct of claim 95, wherein the Streptococcus strain is Streptococcus equisimilis, Streptococcus pyogenes, Streptococcus uberis, or Streptococcus equi subsp. zooepidemicus.
74. 97. The construct of claim 91, wherein the hyaluronan synthase encoding sequence is selected from the group consisting of a nucleic acid sequence encoding a polypeptide with an amino acid sequence having at least about 70%, about 75%, about about 85%, about 90%, or about 95%identity to SEQ ID NO: 2, SEQ ID NO: 93, or SEQ ID NO: 103; a nucleic acid sequence which hybridizes under low, medium, or high stringency conditions with SEQ ID NO: 1, SEQ ID NO: 92, or SEQ ID NO: 102; and a complementary strand of or
75. 98. The construct of claim 97, wherein the hyaluronan synthase encoding sequence encodes a polypeptide having the amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 00 O O S93, or SEQ ID NO: 103; or a fragment thereof having hyaluronan synthase activity.
76. 99. The construct of claim 91, wherein the hyaluronan synthase encoding sequence encodes a Group II hyaluronan synthase. S100. The construct of claim 99, wherein the Group II hyaluronan synthase encoding Ssequence is obtained from a Pasteurella strain. 00 101. The construct of claim 100, wherein the Pasteurella strain is Pasteurella multocida.
77. 102. The construct of claim 91, wherein the hyaluronan synthase encoding sequence is selected from the group consisting of a nucleic acid sequence encoding a polypeptide with an amino acid sequence having at least about 70%, about 75%, about 80%, about 85%, about 90%, or about 95% identity to SEQ ID NO: 95; a nucleic acid sequence which hybridizes under low, medium, or high stringency conditions with SEQ ID NO: 94; and a complementary strand of or
78. 103. The construct of claim 102, wherein the hyaluronan synthase encoding sequence encodes a polypeptide having the amino acid sequence of SEQ ID NO: 95, or a fragment thereof having hyaluronan synthase activity.
79. 104. The construct of claim 91, wherein the nucleic acid construct further comprises one or more genes encoding enzymes in the biosynthesis of a precursor sugar of the hyaluronic acid or the Bacillus host cell further comprises one or more second nucleic acid constructs comprising one or more genes encoding enzymes in the biosynthesis of a precursor sugar of the hyaluronic acid.
80. 105. The construct of claim 104, wherein the one or more genes is selected from the group consisting of a UDP-glucose 6-dehydrogenase gene, UDP-glucose pyrophosphorylase gene, UDP-N-acetylglucosamine pyrophosphorylase gene, glucose- 6-phosphate isomerase gene, hexokinase gene, phosphoglucomutase gene, amidotransferase gene, mutase gene, and acetyl transferase gene.
81. 106. The construct of claim 105, wherein the UDP-glucose 6-dehydrogenase gene is a hasB gene or tuaD gene; or homologs thereof. 00 O O S107. The construct of claim 106, wherein the hasB gene is selected from the group c consisting of a nucleic acid sequence encoding a polypeptide with an amino acid sequence having at least about 70%, about 75%, about 80%, about 85%, about 90%, or C about 95% identity to SEQ ID NO: 97 or SEQ ID NO: 99; a nucleic acid sequence s which hybridizes under low, medium, or high stringency conditions with SEQ ID NO: 96 O or SEQ ID NO: 98; and a complementary strand of or
82. 108. The construct of claim 107, wherein the hasB gene encodes a polypeptide 00 having the amino acid sequence of SEQ ID NO: 97 or SEQ ID NO: 99, or a fragment thereof having UDP-glucose 6-dehydrogenase activity.
83. 109. The construct of claim 106, wherein the tuaD gene is selected from the group consisting of a nucleic acid sequence encoding a polypeptide with an amino acid sequence having at least about 70%, about 75%, about 80%, about 85%, about 90%, or is about 95% identity to SEQ ID NO: 12; a nucleic acid sequence which hybridizes under low, medium, or high stringency conditions with SEQ ID NO: 11; and a complementary strand of or
84. 110. The construct of claim 109, wherein the tuaD gene encodes a polypeptide having the amino acid sequence of SEQ ID NO: 12, or a fragment thereof having UDP-glucose 6-dehydrogenase activity.
85. 111. The construct of claim 105, wherein the UDP-glucose pyrophosphorylase gene is a hasC gene or gtaB gene; or homologs thereof.
86. 112. The construct of claim 111, wherein the hasC gene is selected from the group consisting of a nucleic acid sequence encoding a polypeptide with an amino acid sequence having at least about 70%, about 75%, about 80%, about 85%, about 90%, or about 95% identity to SEQ ID NO: 43, SEQ ID NO: 99, or SEQ ID NO: 107; a nucleic acid sequence which hybridizes under low, medium, or high stringency conditions with SEQ ID NO: 42 or SEQ ID NO: 98, or SEQ ID NO: 106; and a complementary strand of or
87. 113. The construct of claim 112, wherein the hasC gene encodes a polypeptide having the amino acid sequence of SEQ ID NO: 43, SEQ ID NO: 99, or SEQ ID NO: 107; or a fragment thereof having UDP-glucose pyrophosphorylase activity. 00 O O f 114. The construct of claim 111, wherein the gtaB gene is selected from the group Ti consisting of a nucleic acid sequence encoding a polypeptide with an amino acid sequence having at least about 70%, about 75%, about 80%, about 85%, about 90%, or about 95% identity to SEQ ID NO: 22; a nucleic acid sequence which hybridizes under low, medium, or high stringency conditions with SEQ ID NO: 21; and a complementary strand of or
88. 115. The construct of claim 1124, wherein the gtaB gene encodes a polypeptide 00 having the amino acid sequence of SEQ ID NO: 22, or a fragment thereof having UDP- glucose pyrophosphorylase activity.
89. 116. The construct of claim 105, wherein the UDP-N-acetylglucosamine pyrophosphorylase gene is a hasD or gcaD gene; or homologs thereof.
90. 117. The construct of claim 116, wherein the hasD gene is selected from the group consisting of a nucleic acid sequence encoding a polypeptide with an amino acid sequence having at least about 70%, about 75%, about 80%, about 85%, about 90%, or about 95% identity to SEQ ID NO: 105; a nucleic acid sequence which hybridizes under low, medium, or high stringency conditions with SEQ ID NO: 104; and a complementary strand of or
91. 118. The construct of claim 117, wherein the hasD gene encodes a polypeptide having the amino acid sequence of SEQ ID NO: 105, or a fragment thereof having UDP- N-acetylglucosamine pyrophosphorylase activity.
92. 119. The construct of claim 116, wherein the gcaD gene is selected from the group consisting of a nucleic acid sequence encoding a polypeptide with an amino acid sequence having at least about 70%, about 75%, about 80%, about 85%, about 90%, or about 95% identity to SEQ ID NO: 30; a nucleic acid sequence which hybridizes under low, medium, or high stringency conditions with SEQ ID NO: 29; and a complementary strand of or
93. 120. The construct of claim 119, wherein the gcaD gene encodes a polypeptide having the amino acid sequence of SEQ ID NO: 30, or a fragment thereof having UDP- N-acetylglucosamine pyrophosphorylase activity.
94. 121. The construct of claim 105, wherein the glucose-6-phosphate isomerase gene is 00 O O Sa hasE or homolog thereof.
95. 122. The construct of claim 121, wherein the hasE gene is selected from the group CK consisting of a nucleic acid sequence encoding a polypeptide with an amino acid s sequence having at least about 70%, about 75%, about 80%, about 85%, about 90%, or O about 95% identity to SEQ ID NO: 101; a nucleic acid sequence which hybridizes 0 under low, medium, or high stringency conditions with SEQ ID NO: 100; and a complementary strand of or 00 Sio 123. The construct of claim 122, wherein the hasE gene encodes a polypeptide having the amino acid sequence SEQ ID NO: 101, or a fragment thereof having glucose-6-phosphate isomerase activity.
96. 124. The construct of claim 104, wherein the one or more genes encoding a precursor is sugar is under the control of the same or a different promoter or different promoters as the hyaluronan synthase encoding sequence.
97. 125. The construct of claim 124, wherein the same or the different promoter(s) comprises a "consensus" promoter having the sequence TTGACA for the region and TATAAT for the region.
98. 126. The construct of claim 130, wherein the same or the different promoter sequence is a tandem promoter in which each promoter of the tandem promoter is operably linked to the hyaluronan synthase encoding sequence..
99. 127. The construct of claim 91, which further comprises an mRNA processing/stabilizing sequence located downstream of the promoter sequence and upstream of the hyaluronan synthase encoding sequence.
100. 128. The construct of claim 124, which further comprises an mRNA processing/stabilizing sequence located downstream of the different promoter or each of the different promoters of the one or more genes encoding enzymes in the biosynthesis of a precursor sugar of the hyaluronan and upstream of the one or more genes.
101. 129. The construct of claim 91, which further comprises a selectable marker gene.
102. 130. The construct of claim 91, which comprises a hyaluronan synthase gene, UDP- 00 O O Sglucose 6-dehydrogenase gene, and UDP-glucose pyrophosphorylase gene operably linked to a short "consensus" promoter of amyQ having the sequence TTGACA for the region and TATAAT for the region. s 131. An isolated nucleic acid sequence encoding a hyaluronan synthase operon comprising a hyaluronan synthase gene or portion thereof and a UDP-glucose 6- dehydrogenase gene, and optionally one or more genes selected from the group Sconsisting of a UDP-glucose pyrophosphorylase gene, UDP-N-acetylglucosamine 00 pyrophosphorylase gene, and glucose-6-phosphate isomerase gene. C 132. The isolated nucleic acid sequence of claim 131, wherein the hyaluronan synthase gene is SEQ ID NO: 1, SEQ ID NO: 92, SEQ ID NO: 94, or SEQ ID NO: 102; or fragments thereof that encode a polypeptide having hyaluronan synthase activity. is 133. The isolated nucleic acid sequence of claim 131, wherein the UDP-glucose 6- dehydrogenase gene is SEQ ID NO: 11, SEQ ID NO: 40, or SEQ ID NO: 96, or SEQ ID NO: 104; or fragments thereof that encode a polypeptide having UDP-glucose 6- dehydrogenase activity.
103. 134. The isolated nucleic acid sequence of claim 131, wherein the UDP-glucose pyrophosphorylase gene is SEQ ID NO: 21, SEQ ID NO: 42, or SEQ ID NO: 98, SEQ ID NO: 106; or fragments thereof that encode a polypeptide having UDP-glucose pyrophosphorylase activity.
104. 135. The isolated nucleic acid sequence of claim 131, wherein the UDP-N- acetylglucosamine pyrophosphorylase gene is SEQ ID NO: 29 or SEQ ID NO: 44; or fragments thereof that encode a polypeptide having UDP-N-acetylglucosamine pyrophosphorylase activity
105. 136. The isolated nucleic acid sequence of claim 131, wherein the glucose-6- phosphate isomerase gene is SEQ ID NO: 100; or fragments thereof that encode a polypeptide having glucose-6-phosphate isomerase activity.
106. 137. The isolated nucleic acid sequence of claim 131, which further comprises one or more genes selected from the group consisting of a hexokinase gene, phosphoglucomutase gene, amidotransferase gene, mutase gene, and acetyl transferase gene. 00 O O d 138. The isolated nucleic acid sequence of claim 131, which comprises a hyaluronan synthase gene, UDP-glucose 6-dehydrogenase gene, and UDP-glucose rC pyrophosphorylase gene. O 139. The isolated nucleic acid sequence of claim 131, having the nucleic acid sequence of SEQ ID NO: 108. 00 C"N 140. A nucleic acid construct comprising the nucleic acid sequence of claim 131.
107. 141. An expression vector comprising the nucleic acid construct of claim 139.
108. 142. An isolated nucleic acid sequence encoding a UDP-glucose 6-dehydrogenase selected from the group consisting of: is a nucleic acid sequence encoding a polypeptide having an amino acid sequence which has at least about 75%, about 80%, about 85%, about 90%, or about identity to SEQ ID NO: 41; a nucleic acid sequence having at least 75%, 80%, 85%, 90%, or homology to SEQ ID NO: a nucleic acid sequence which hybridizes under medium or high stringency conditions with the nucleic acid sequence of SEQ ID NO: 40, (ii) the cDNA sequence contained in SEQ ID NO: 40, or (iii) a complementary strand of or and a subsequence of or wherein the subsequence encodes a polypeptide fragment which has UDP-glucose 6-dehydrogenase activity.
109. 143. The nucleic acid sequence of claim 142, which encodes a polypeptide having an amino acid sequence which has at least about 75%, about 80%, about 85%, about or about 95% identity the amino acid sequence of SEQ ID NO: 41.
110. 144. The nucleic acid sequence of claim 142, which encodes a polypeptide comprising the amino acid sequence of SEQ ID NO: 41.
111. 145. The nucleic acid sequence of claim 142, which encodes a polypeptide consisting of the amino acid sequence of SEQ ID NO: 41, or a fragment thereof which has UDP- glucose 6-dehydrogenase activity.
112. 146. The nucleic acid sequence of claim 145, which encodes a polypeptide consisting 00 O O Sof the amino acid sequence of SEQ ID NO: 41.
113. 147. The nucleic acid sequence of claim 142, which has the nucleic acid sequence of C SEQ ID NO:
114. 148. The nucleic acid sequence of claim 142, wherein the nucleic acid sequence hybridizes under medium or high stringency conditions with the nucleic acid sequence of SEQ ID NO: 40, (ii) the cDNA sequence contained in SEQ ID NO: 40, or (iii) a 00 complementary strand of or (ii). 00
115. 149. The nucleic acid sequence of claim 142, which is contained in the plasmid pMRT106 which is contained in Escherichia coli NRRL B-30536.
116. 150. A nucleic acid construct comprising the nucleic acid sequence of claim 142 operably linked to one or more control sequences which direct the production of the polypeptide in a suitable expression host.
117. 151. A recombinant expression vector comprising the nucleic acid construct of claim 150.
118. 152. A recombinant host cell comprising the nucleic acid construct of claim 150.
119. 153. A method for producing a polypeptide having UDP-glucose 6-dehydrogenase activity comprising cultivating the host cell of claim 152 under conditions suitable for production of the polypeptide; and recovering the polypeptide.
120. 154. An isolated polypeptide having UDP-glucose 6-dehydrogenase activity encoded by the nucleic acid sequence of claim 142.
121. 155. An isolated nucleic acid sequence encoding a UDP-glucose pyrophosphorylase selected from the group consisting of a nucleic acid sequence encoding a polypeptide having an amino acid sequence which has at least about 90%, 95%, or 97% identity to SEQ ID NO: 43; a nucleic acid sequence having at least about 90%, about 95%, or about 97% homology to SEQ ID NO: 42; a nucleic acid sequence which hybridizes under high or very high stringency conditions with the nucleic acid sequence of SEQ ID NO: 42, (ii) the cDNA 00 O O Ssequence contained in SEQ ID NO: 42, or (iii) a complementary strand of or and a subsequence of or wherein the subsequence encodes a polypeptide fragment which has UDP-glucose pyrophosphorylase activity.
122. 156. The nucleic acid sequence of claim 155, which encodes a polypeptide having an O amino acid sequence which has at least about 90%, about 95%, or about 97% identity the amino acid sequence of SEQ ID NO: 43. ri 157. The nucleic acid sequence of claim 155, which encodes a polypeptide 0 10 comprising the amino acid sequence of SEQ ID NO: 43.
123. 158. The nucleic acid sequence of claim 155, which encodes a polypeptide consisting of the amino acid sequence of SEQ ID NO: 43, or a fragment thereof which has UDP- glucose pyrophosphorylase activity.
124. 159. The nucleic acid sequence of claim 158, which encodes a polypeptide consisting of the amino acid sequence of SEQ ID NO: 43.
125. 160. The nucleic acid sequence of claim 155, which has the nucleic acid sequence of SEQ ID NO: 42.
126. 161. The nucleic acid sequence of claim 155, wherein the nucleic acid sequence hybridizes under high stringency or very high conditions with the nucleic acid sequence of SEQ ID NO: 42, (ii) the cDNA sequence contained in SEQ ID NO: 42, or (iii) a complementary strand of or (ii).
127. 162. The nucleic acid sequence of claim 155, which is contained in the plasmid pMRT106 which is contained in Escherichia coli NRRL B-30536.
128. 163. A nucleic acid construct comprising the nucleic acid sequence of claim 155 operably linked to one or more control sequences which direct the production of the polypeptide in a suitable expression host.
129. 164. A recombinant expression vector comprising the nucleic acid construct of claim 163.
130. 165. A recombinant host cell comprising the nucleic acid construct of claim 163. 00 O O T 166. A method for producing a polypeptide having UDP-glucose pyrophosphorylase Sactivity comprising cultivating the host cell of claim 165 under conditions suitable for production of the polypeptide; and recovering the polypeptide.
131. 167. An isolated polypeptide having UDP-glucose 6-dehydrogenase activity encoded by the nucleic acid sequence of claim 155. 0 00 168. An isolated nucleic acid sequence encoding a UDP-N-acetylglucosamine 0o pyrophosphorylase selected from the group consisting of: CK a nucleic acid sequence encoding a polypeptide having an amino acid sequence which has at least about 75%, about 80%, about 85%, about 90%, or about identity to SEQ ID NO: a nucleic acid sequence having at least 75%, 80%, 85%, 90%, or s1 homology to SEQ ID NO: 44; a nucleic acid sequence which hybridizes under low, medium, or high stringency conditions with the nucleic acid sequence of SEQ ID NO: 44, (ii) the cDNA sequence contained in SEQ ID NO: 44, or (iii) a complementary strand of or and a subsequence of or wherein the subsequence encodes a polypeptide fragment which has UDP-N-acetylglucosamine pyrophosphorylase activity.
132. 169. The nucleic acid sequence of claim 168, which encodes a polypeptide having an amino acid sequence which has at least about 75%, about 80%, about 85%, about or about 95% identity the amino acid sequence of SEQ ID NO:
133. 170. The nucleic acid sequence of claim 168, which encodes a polypeptide comprising the amino acid sequence of SEQ ID NO:
134. 171. The nucleic acid sequence of claim 168, which encodes a polypeptide consisting of the amino acid sequence of SEQ ID NO: 45, or a fragment thereof which has UDP-N- acetylglucosamine pyrophosphorylase activity.
135. 172. The nucleic acid sequence of claim 171, which encodes a polypeptide consisting of the amino acid sequence of SEQ ID NO:
136. 173. The nucleic acid sequence of claim 168, which has the nucleic acid sequence of SEQ ID NO: 44. 00 O O
137. 174. The nucleic acid sequence of claim 168, wherein the nucleic acid sequence L hybridizes under low, medium, or high stringency conditions with the nucleic acid Ssequence of SEQ ID NO: 44, (ii) the cDNA sequence contained in SEQ ID NO: 44, or (iii) a complementary strand of or (ii). O
138. 175. The nucleic acid sequence of claim 168, which is contained in the plasmid SpMRT106 which is contained in Escherichia coli NRRL B-30536. O o0 176. A nucleic acid construct comprising the nucleic acid sequence of claim 168 Soperably linked to one or more control sequences which direct the production of the polypeptide in a suitable expression host.
139. 177. A recombinant expression vector comprising the nucleic acid construct of claim 176.
140. 178. A recombinant host cell comprising the nucleic acid construct of claim 176.
141. 179. A method for producing a polypeptide having UDP-N-acetylglucosamine pyrophosphorylase activity comprising cultivating the host cell of claim 178 under conditions suitable for production of the polypeptide; and recovering the polypeptide.
142. 180. An isolated polypeptide having UDP-glucose 6-dehydrogenase activity encoded by the nucleic acid sequence of claim 168.
143. 181. An isolated polypeptide having UDP-glucose 6-dehydrogenase activity encoded by the nucleic acid sequence of claim 168.
144. 182. The method of claim 1, wherein the Bacillus host cell contains a disrupted or deleted cypX and/or yvmC gene.
145. 183. The Bacillus host cell of claim 46, which contains a disrupted or deleted cypX and/or yvmC gene. Dated 25 February, 2008 Novozymes Biopolymer A/S Patent Attorneys for the Applicant/Nominated Person SPRUSON FERGUSON