AU2007242911A1 - Recombinational cloning using engineered recombination sites - Google Patents

Description

13Dec. 2007 15:43 BALDWINS 0064 4 4736712 No.6721 P. 5/50

AUSTRALIA

Patents Act 1990 COMPLETE

SPECIFICATION

FOR A DIVISIONAL

PATENT

ORIGINAL

Name of Applicant: Actual Inventor(s): Address for Service: Address for Correspondence: Invention Title: INVITROGEN

CORPORATION

James L. HARTLEY Michael A. BRASCH Baldwins Intellectual Property 16 Chisholm Street North Ryde Sydney NSW 2113 Baldwins PO Box 852 Wellington New Zealand RECOMBINATIONAL CLONING USING ENGINEERED RECOMBINATION

SITES

The following statement is a full description of this invention, including the best method of performing it known to us;- 101097560_1 .DOC:.1(:web COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec. 2007 15:43 BALDWINS 0064 4 4736712 No.6721 P. 6/50 0 Recombinational Cloning Using Engineered Recombination Sites

C)

C)

c Background of the Invention 0 ci f1eld of the Invenwion The present invention relates to recombinant DNA technology. DNA and vectors having engineered recombination sites are provided for use in a recombinaional cloning method that enables efficient and specific recombination of DNA segments using recombination proteins. The DNAs, vectors and methods are useful for a variety of DNA exchanges, such as subclning of DNA, in vitro or in vivo.a, ReatedAr Site spedCjfc recombnrae. Site specific recombinases are enzymes that are present in some viruses and bacteria and have been characterized to have both enlonuclease and ligase properties. These recombinases (along with associated proteins in some cases) recognize specific sequences of bases in DNA and exchange the DNA segments flanking those segments. The recombinases and associated proteins are collectively referred to as "recombination proteins" (see, Landy, Current Opinion in Biotechnology 3:699-707 (1993)).

Numerous recombination systems .from various organisms have been described. See, eg., Hoess t at, Nucleic Acids Research 14(6)2287 (1986); Abremsld et al, J Biot Chemn261(1):391 (1986); Campbell, J COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec. 2007 15:43 BALDWINS 0064 4 4736712 No.6721 P. 7/50 -2- SBacteri L 174(23):7495 (1992); Qian a al.,J Bio Chem. 267(11):7794 (1992); Arakie at, J MoL Bil. 225(I):25 (1992); Macser and Kahnmna (1991) Ml.

Gen Genet. 230:170-176).

0 Many of these belong to the integrase family of recombinases (Argos otat EMBOJ 5:433440 Perhaps the be st udied of these are the Integrase/at system from bacteriophage A (Landy, A. Cwrent Opinions in Geneic andDevel. 3:699-707 (1993)), the Crc/loxP system from bacteriophage P1 (oess and Abremki (1990) In NucleeAc idi and Molecular Biology, vol. 4.

Eds.: Eckstein and Lilley, Baerin-Heidelberg: SpringerVerag pp. 90-109), and the PLP/FRT system from the Saccharomyces cerevisiae 2 p circle plasmid mBmach e al. &Cell 29:227-234 (1982)).

W the e recombination systems have been characterizd for particular organim the related art has only taught using recombinant DNA flanked by recambination sites, for in vYa recombination.

Bacdman Patent No. 4,673,640) discloses the in vive use of I recombinase to recombine a protein producing DNA segment by enzymatic site specific recombination using wild-type recombination sites attB and attP.

Hlasa and Szybaiski (Gen 56:145.151 (1987)) discloses the use of A nt recombinase in vive for intramolecuar recombination between wild type atiP and arB sites which flank a promoter. Because the orientations ofthese sites are inverted relative to each other, this causes an irreversible flipping ofthe promoter region relative to the gene ofiaterest Palarolo e al. Gene 8825-36 (1990), discloses phage lambda vectors having bacteriophage 3 arms that contain restriction sites positioned outside a cloned DNA sequence and between wild-type tap sites. Infection ofA coli cells that express the Cre recombinas with these phage vectors results in recombinadon between the loxP sites and the in viva excision of the plasmid replicon, including the cloned cDNA.

Psfai et al (Auc Acids Res,. 222392-2398 (1994)) discloses a method for inserting into genomic DNA partial exession vectors having a selectable marker, flanked by two wild-type FRT recognition sequences. FLP site-specific recombinase as present in the cells is used to integrate the vectors into the COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec. 2007 15:44 BALDWINS 0064 4 4736712 No.6721 P. 8/50 -3- Sgenome at predetermined sites. Under conditions where the replicon is funtional, this cloned genomic DNA can be amplified.

0 Bebee etda Patent No, 5,434,066) discloses the use of site-specific C recombinases such as Cr for DNA containing two laxP sites is used for in vivo recombination between the sites.

Boyd (Nucl Acids Res. 21:817-821 (1993)) discloses a method to facilitate the cloning of blunt-ended DNA using conditions that encourage Sintermolecular ligation to a dephosphorylated vector that contains a wild-type loxP site acted upon by a Crc site-specific recombinase present in E coli host cells.

0 Waterhouse et al (PCTNo. 93/19172 andNuleicAcids Res. 21 (9):2265 (1993)) disclose an in vivO method where light and heavy chains of a particular antibody were cloned in different phage vectors between la P and loxP 511 sites and used to transfect new coli cells. Cre, acting in the host cells on the two parental molecules (one plasmid, one phage), produced four products in equilibrium two different cointegrates (produced by recombination at either lazP or laxP 511 sites), and two daughter molecules, one of which was the desired product In contrast to the other related art, Schlake Bode (Biochemistry 33:12746-12751 (1994)) discloses an in vivo method to exchange expression cassettes at defined chromosomal locations, each flanked by a wild type and a spacer-mutated FRT recombination site. A double-reciprocal crossover was mediated in cultured mammalian cells by using this FLP/FRT system for sitespecific recombination.

Trwasposase. The family of enzymes, the transpbsases, has also been used to transfer genetic information between replicons. Transposons are structurally variable, being described as simple or compound, but typically encode the recombinase gene flanked by DNA sequences organized in inverted orientations. Integration of ransposons can be random or highly specific.

Representatives such as Tn7, which are highly site-specific, have been applied to the In vio movement of DNA segments betwee replicons (Lucklow et at, J Virol. 67:4566-4579 (1993)).

COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec. 2007 15:44 BALDWINS 0064 4 4736712 No.6721 P. 9/50 -4- 0 Devine and Boeke Nucl Acids Res. 22:3765-3772 (1994), discloses the o constrction of artificial transposons for the insertion of DNA segments, in vitro, Sinto recipient DNA molecules. The system makes use of the integrase of yeast C TYI vims-like particles. The DNA segment of interest is cloned, using standard methods, between the ends of the ansposon-like element TY1. In the presence of the TYI integrase, the resulting element integrates randomly into a second target DNA molecule.

DNA cloming. The cloning ofDNA segments currently ous as a daily routine in many research labs and as a prerequisite step in many genetic analyses.

The pupoe of these clonings is various, however, two general purposes can be o considered: the initial cloning of DNA from large DNA or RNA segments (chromosomes, YACs, PCR fragments, mRNA, etc.), done in a relative handful of known vectors such as pUC, pGem, pBlueScript, and the subcloning of these DNA segments into specialized vect for fr untional analysis. A great deal of time and effort is expended both in the initial cloning of DNA segments andin the transf of DNA segmts from the initial cloning vectors to the more specialized vectors. This transfer is called subcloning.

The basic methods for cloning have been known for many years and have changed little during that time. A typical cloning protocol is as follows: digest the DNA of interest with one or two restriction enzymes; gel purify the DNA segment of interest when known; prepar the vector by cutting with appropriate restriction enzymes, treating with alkaline phosphatase, gel purify etc., as appropriate; ligate the DNA segment to vector, with appropriate controls to estimate background of uncut and self-ligated vector; introduce the resulting vector into an coli host cell; pick selected colonies and grow small cultures overnight make DNA minipreps; and analyze the isolated plasmid on agarose gels (often after diagnostic restriction enzyme digestions) or by PCR.

COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec. 2007 15:44 BALDWINS 0064 4 4736712 No.6721 P. 10/50 0 o The specialized vectors used for subcloning DNA segments are Sfunctionally diverse. These include but are not limited to: vectors for expressing Sgenes in various organiss; for regulating gene expression; for providing tags to aid in protein prification or to allow tracking of proteins in cells; for modifying the cloned DNA segment generating deletions); for the synthesis of probes niboprobes); for the preparation of templates for DNA sequencing; for the identification of protein coding regions; for the fusion of various protein-coding C regions; to provide large amounts of the DNA of interest, etc. It is common that a particular investigation will involve subcloning the DNA segment of interest into several different specialized vectors.

O As inown in the art, simple subclonings can be done in one day the DNA segment is not large and the restriction sites are compatible with those of the subcloning vector). However, many other subelonings can take several weeks, especially those involving unknown sequences, long fagments, toxic genes, unsuitable placement of restriction sites, high backgrounds, impure enzymes, etc. Subdconing DNA fragments is thus often viewed as a chore to be done as few times as possible.

Several mtchods far facilitating the cloning of DNA segments have been described, as in the following references.

Ferguson, et al Gene 16:191 (1981), discloses a family of vectors for subeloning fragments of yeast DNA. The vectors encode kanamycin reistance.

Clones of longer yeast DNA segments can be partially digested and ligated into the subcloning vectors. If the original cloning vector conveys resistance to ampicillin, no purification is necessary prior to transformation, since the selection will be for kanamycin.

Hashioto-otoh, et at Gen 41:125 (1986), discloses a subeloning vector with unique- cloning sites within a streptomycin sensitivity gene; in a streptomycin-resistant host, only plasmids with inserts or deletions in the dominant sensitivity gene will survive streptomycin selection.

Accordingly, traditional subcloning methods, using restriction enzymes and ligase, are time consuming and relatively unreliable. Considerable labor is expended, and if two or more days later the desired subclone can not be found COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec. 2007 15:45 BALDWINS 0064 4 4736712 No,6721 P. 11/50 -6- 0 0 among the candidate plasmids, the entire process must then be repeated with alternative conditions attempted. Although site specific recombinases have been used to recombine DNA 0 in vivo, the successful use of such enzymes in vitro was expected to suffer from several problems. For example, the site specificities and efficiencies were expected to differ in vitro; topologically-linked products were expected; and the topology of the DNA substrates and recombination proteins was expected to differ significantly in vitro (see, Adams et al, J.

MoL Biol 226:661-73 (1992)). Reactions that could go on for many hours in viva were expected to occur in significantly less time in vitro before the enzymes became inactive.

c,1 Multiple DNA recombination products were expected in the biological host used, resulting in 10 unsatisfactory reliability, specificity or efficiency of subeloning. In vio recombination o reactions were not expected to be sufficiently efficient to yield the desired levels of product.

Accordingly, there is a long felt need to provide an alternative subcloning system that provides advantages over the known use of restriction enzymes and ligases.

The present application is a divisional application of Australian Patent Application No.

10062/01 (the "parent" application), the specification of which is herein incorporated by reference. The parent application is itself a divisional application of Australian Patent No.

724922. The present application claims priority from both Application No. 10062/01 and Patent No. 724922.

Summary of the Invention The present invention provides nucleic acid, vectors and methods for obtaining chimeric nucleic acid using recombination proteins and engineered recombination sites, in vitro or in vivo. These methods are highly specific, rapid, and less labor intensive than what is disclosed or suggested in the related background art. The improved specificity, speed and yields of the present invention facilitates DNA or RNA subeloning, regulation or exchange useful for any related purpose. Such purposes include in vitro recombination of DNA segments and in vitro or in vivo insertion or modification of transcribed, replicated, isolated or genomic DNA or RNA.

The present invention relates to nucleic acids, vectors and methods for moving or exchanging segments of DNA using at least one engineered recombination site and at least one recombination protein to provide chimeric DNA molecules which have the desired characteristic(s) and/or DNA segment(s).

07104/04.atl I 1797.specipg COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec. 2007 15:45 BALDWINS 0064 4 4736712 No.6721 P. 12/50 -7- 0 0~ Generally, one or more parent DNA molecules are recombined to give one or 0 more daughter molecules, at least one of which is the desired Product DNA

C)

0 segment or vector. The invention thus relates to DNA, RNA, vectors and Smethods to effct the exchange and/or to select for ne or moe desired products.

One embodiment of the present invention relates to a method of making chimeric DNA, which comprises combining in vitro or in vivo an Insert Donor DNA molece, cmprising a desired DNA segment flanked by a first recombination site and a second recombination site, wherein the first and second recombination sites do not recombine with each Sother, (ii) a Vector Donor DNA molecule containing a third recombination site and a fourth recombination site, wherein the third and fourth recombination sites do not recombine with each other and (ii) one or more site specific recombination proteins capable of recombining the first and third recombinational sites and/or the second and fourth recombinational sites; thereby allowing recombination to occur, so as to produce at least one Cointegrate DNA molecule, at least one desired Product DNA molecule which comprises said desired DNA segment, and optionally a Byproduct DNA molecule; and then, optionally, selecting for the Product or Byproduct DNA molecule.

Another embodiment of the present invention relates to a kit comprising a carrier or receptacle being compartmentalized to receive and hold therein at least one container, wherein a first container contains a DNA molecule comprising a vector having at least two recombination sites flanking a cloning site or a Selectable marker, as described herein. The kit optionally further comprises; a second container containing a Vector Donor plasmid comprising a subeloning vector and/or a Selectable marker of which one or both are flanked by one or more engineered recombination sites; and/or COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec. 2007 15:45 BALDWINS 0064 4 4736712 No.6721 P. 13/50 -8- SC() a third container containing at least one recombination protein o which recognizes and is capable of recombining at least one of said Srecombination sites.

c Other embodiments include DNA and vectors useful in the methods of the present invention. In particular, Vector Donor molecules are provided in one embodiment, wherein DNA segments within the Vector Donor are separated either by, in a circular Vector Donor, at least two recombination sites, or (ii) in a linar Vector Donor, at least one nwombination site, where the recombination sites are preferably engineered to enhance specificity or effiiency of 10 recombination.

0 One Vector Donor embodiment comprises a first DNA segment and a second DNA. segment, the first or second segment comprising a Selectable marker. A second Vector Donor embodiment comprises a first DNA segment and a second DNA segment, the first or second DNA segment comprising a toxic gene. A third Vector Donor embodiment comprises a first DNA segment and a second DNA segment, the first or second DNA segment comprising an inactive fragment of at least one Selectable marker, wherein the inactive fragment of the Selectable marker is capable of reconstituting a functional Selectable marker when recombined across the first or second recombination site with another inactive fiagment of at least one Selectable marker.

The presentrecombntional cloning method possesses several advantages overprevious in vivo methods. Since single molecules of recombination products can be introduced into a biological host, propagation of the desired Product DNA in the absence of other DNA molecules starting molecules, intermediates, and by-products) is more readily realized Reaction coiditions can be freely adjusted in vitro to optimize enzyme activities. DNA molecules can be incompatible with the desired biological host YACs, genomic DNA, etc.), can be used. Recombination proteins from diverse sorces can be employed, together or sequentially.

Other embodiments will be evident to those of ordinary skill in the art from the teachings contained herein in combination with what is known to the art.

COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec. 2007 15:45 BALDWINS 0064 4 4736712 No.6721 P. 14/50 -9-

O

Brief Description of the Figures Figure 1 depicts one general method of the present invention, wherein the starting (parent) DNA molecules cman be circular or linear. The goal is to exchange the new suboloning vector D for the original cloning vector B. It is desirable in one embodiment to select for AD and against all the other molecules, incuding the Cointegrate. The square and cirle are sites of recombination: e.g., lcP sites, aft sites, etc For example, segment D can contain expression signals, C new drug markers, new origins of replication, or specialized functions for mapping or sequencing DNA.

O 10 Figure 2A depicts an in vitro method of recombining an Insert Donor plasmid (here, pEZC705) with a Vector Donor plasmid (here, pEZC726), and obtaining Product DNA and Byproduct daughter molecules. The two recombination sites are atIP and loP on the Vector Donor. On one segment defined by these sites is a kanamycin resistance gene whose pramoter has been replaced by the tetOP operator/pronoter from transposon T10O. See Sizemore et al., Nucl. Acids Res. 18(10):2875 (1990). In the absence of tet repressor protein, E coli RNA polymerase transcribes the kanamycin resistance gene from the terOP. If tet repressor is preset, it binds to tetOP and blocks transcription of the kanamycin resistance gone. The other segment of pEZC726 has the tet repressor gene expressed by a consitutive promoter. Thus cells transformed by pEZC726 are resistant to chloamphenicol, because of the chloramphenicol acetyl transferase gene on the same segment as tR, but are sensitive to kanamycin.

The recombinasemcdiated reactions result in separation of the retR gene from the regulated kanamycin resistance gene. This separation results in kanamycin resistance in cells receiving only the desired recombination products. The first recombination reaction is driven by the addition of the recombinase called Integrase. The second recombination reaction is driven by adding the recombinase Cre to the Cointegrate (here, pEZC7 Cointegrate).

Figure 2B depicts a restriction map of pEZC705.

Figure 2C depicts a restriction map of pEZC726.

Figure 2D depicts a restriction map of pEZC7 Cointegrate COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec. 2007 15:46 BALDWINS 0064 4 4736712 No.6721 P. 15/50 0 Figure 2E depicts a restriction map of Inprod.

o Figure 2F depicts a restriction map of Intbypro.

Figure 3A depicts an in vitro method of recombining an Insert Donor plasmid (here, pEZC602) with a Vector Donor plasmid (here, pEZC629), and obtaining Product (here, EZC6prod) and Byproduct (here, EZC6Bypr) daughter molecules. The two recombinatian sites are lp and larP 511. One segment of pEZC629 defined by these sites is a kanamycin resistance gene whose promoter has been replaced by the rteOP opeto*rarp oter from tranposon Th10. In the absence of tet repressor protein, E coli RNA polymerase transcribes the kanmycin resistance gene from the retmP. If tet repressor is present, it binds to o rMOP and blocks ftranscription of the kanamycin resistance gene. The other segment of pEZC629 has the tet repressor gone expressed by a constitutive prmoter. Thus cells transformed by pEZC629 are resistant to blocamphenicol, because of the chloramphenicol acetyl transferase gene on the same segment as trtR, but are sensitive to kanamycin. The reactions resut in separation of the tetR gene from the regulated kanamycin resistance gene. This separation results in knamycin resistance in cells receiving the desired reocombination product. The first and the second recombination events are driven by the addition of the same recombinase, Cre.

Figure 3B depicts a resriction map of EZC6Bypr.

Figure 3C depicts a restriction map of BZC6prod.

Figure 3D depicts a restriction map ofpEZC602.

Figure 3E depicts a restriction map of pEZC629.

Figure 3F depicts a restriction map ofEZC6coint.

Figure 4A depicts an application of the in vitro method of recombinational cloning to subolone the ehloramphenicol acetyl tmnsferase gene into a vector for expression in cukaryotic cells. The Insert Donor plasmid, pEZC843, is comprised of the chloramphenicol acetyl transferase gene of coli4 cloned between taP and OB sites such that the laPox site is positioned at the 5'-end of the gene. The Vector Daonor plasmid, pEZC003, contains the cytomegalovirus eukaryotic promoter apposed to a larP site. The supercoiled plasmids were combined with lambda Integrase and Cre recombinase in vitro.

COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec. 2007 15:46 BALDWINS 0064 4 4736712 No.6721 P. 16/50 0 -1II 0 C' After inubation, competent K coli cells were transformed with the Srecombinatonal reaction solution. Aliquots of transformations were spread on Sagar plates containing kanamyoin to select for the Product molecule (here MCf CMVProd).

Figure 4B depicts a restriction map of pEZC843.

SFigure 4C depicts a restriction map ofpEZC1003.

Figure 4D depicts a restriction map of CMVBypro.

C Figure 4E depicts a restriction map of CMVProd.

Figure 4F depicts a restriction map of CMVcoint Figure SA depicts a vector diagram of pEC130I.

o Figure 5B depicts a vector diagram ofpEZC1305.

Figure SC depicts a vector diagram ofpEZC309.

Figure 5D depicts a vector diagram ofpEZC313.

Figure SE depicts a vector diagram ofpEZC1317.

Figre SF depicts a vector diagram ofpEZC1321.

Figure SG depicts a vector diagram ofpEZC1405.

Figure 5H depicts a vector diagram ofpEZC1502.

Figure 6A depicts a vector diagram ofpEZC1603.

Figure 6B depicts a vector diagram ofpEZCl706.

Figure 7A depicts a vector diagram of pEZC2901.

Figure 7B depicts a vector diagram of pEZC2913 Figure 7C depicts a vector diagram ofpEZC3101.

Figure 7D depicts a vector diagram of pEZC 802.

Figure 8A depicts a vector diagram ofpGEX-ZTK.

Figure 8B depicts a vector diagram of pEZC3501: Figure 8C depicts a vector diagram ofpEZC3601.

Figure SD depicts a vector diagram of pEZC3609.

Figure 8E depicts a vector diagram ofpEZC3617.

Figure 8S depicts a vector diagram ofpEZC3606.

Figure 8G depicts a vector diagram of pEZC3613.

Figure 8H depicts a vector diagram ofpEZC3621.

Figure 81 depicts a vector diagram of GST-CAT.

COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec. 2007 15:46 BALDWINS 0064 4 4736712 No.6721 P. 17/50 S-12- 0 Figure SJ depicts a vector diagram of GST-ph oA.

o Figure 8K depicts a vector diagram ofpEZC3201.

C)

r Detailed Description of the Preferred Embodiments It is unexpectdly discovered in the present invention that subcloning reactions can be provided using recombinational cloning. Recombination cloning according to the present invetion uses DNAs, vectors and methods, in vitro and Ci in vivo, for moving or exchanging segments of DNA molecules using engineered recombinatiou sites andrecombinationproteins These methods provide chimeic DNA molecules that have the desired characteristic(s) and/or DNA segment(s).

The present invention thus provides nucleic acid, vectors and methods for obtaining chimeric nucleic acid using recombination proteins and engineered recombinaion sites, in vto or in vivo. These methods are highly specific, rapid, and less labor intensive than what is disclosed or suggested in the related background art The improved specificity, speed and yields of the present invention facilitates DNA or RNA surbcloning, regulation or exchange useful for any related purpose. Such purposes include In viho recombination of DNA segments and in vitro or in vive insertion or modification of transcribed, replicated, isolated or genomic DNA or RNA.

Dejinitios In the description that follows, a number of terms used in recombinant DNA technology are utilized extensively. In order to provide a clear and consistent understanding of the specification and claims, includingthe scope to be given such terms, the following definitions are provided.

Byproduct is a daughter molecule (a new dlone produced after the second recombination event during the recombinational cloning process) lacking the DNA which is desired to be subloned.

COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec. 2007 15:46 BALDWINS 0064 4 4736712 No.6721 P. 18/50 -13- 0 SCointegrate: is at least one recombination intermediate DNA molecule Sof the present invention that contains both parental (starting) DNA molecules.

It will usually be circular. In some embodiments it can be linear.

Cn Host: is any prokaryotic or eukaryotic organism that can be a recipient of the recombinatinal cloning Product. A "host," as the term is used herein, includes prokaryotic or eukaryoti organisms that can be genetically engineered.

For examples of such hosts, see Maniis et al., Molecular Cloning: A Laboratory c Manual, Cold Spring Harbor Laboratory, Cold Spring Harbr, New York (1982).

Insert is the desired DNA segment (segment A of Figure 1) which one 10 wishes to manipulate by the metid of the present invention. Th insert can have o one or more genes.

Insert Donor; is one oftbe two parental DNA molecules of the present invention which caies the Insert. The Insert Donor DNA molecule comprises the Insert flanked on both sides with recombination signals. The Insert Donor can be liear or circular. In one embodiment of the invention, the Insert Donor is a circular DNA molecule and further comprises a cloning vector sequence outside of the recombination signals (see Figure 1).

Product: is one or both the desired daughter molecules comprising the A and D or B and C sequences which are produced after the second recombination event during the recombinational cloning process (see Figure The Product contains the DNA which was to be cloned or subcloned.

Promoter is a DNA sequence generally described as the 5-region of a gene, located proximal to the start codon. The transcription of an adjacent DNA segment is initiated at the promoter region. A repressible promoters rate of transcription decreases in response to a repressing agent Ah inducible promote's rate of transcription increases in response to an inducing agent A-constitutive promoters rate oftranscription is not specifically regulated, though it can vary under the influence of general metabolic conditions.

COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec. 2007 15:47 BALDWINS 0064 4 4736712 No.6721 P. 19/50 -14o Recognition sequence: Recognition sequences are particular DNA o sequences which a protein, DNA, or RNA molecule restriction 0^ endonuclease, a modification methylase, or arecombinase) recognizes and binds.

SFor example, the recognition sequence for Ce recombinase is azP which is a 34 base pair sequence comprised of two 13 base pair inverted repeats (seving as th recombinase binding sites) flanking an 8 base pair core sequence. See Figure 1 of Saner, B, Current Opinion in Biotechnology 5:521-527 (1994). Other ci examples of recognition sequences are the atB, attP, attL, and attR sequences which are recognized by the recombinse enzyme I Integrase. atB is an 1 10 approximately 25 base pair sequence containing two 9 base pair core-type Int binding sites and a 7 base pair overlap region. af is an approximately 240 base pair sequence coaining coe-type Int binding sites and ann-type Int binding sites as well as sites for auxiliary proteins IF, FIS, and Xis. See Landy, Crrent "Opinion in Biotechnology 3:699-707 (1993). Such sites are also engineered according to the present invention to enhance methods and products.

Recombinase: is an enzyme which catalyzes the exchange of DNA segments at specific recombination sites.

Recombinational Cloning: is a method described herein, whereby segments of DNA molecules are exchanged, inserted, replaced, substituted or modified, in vitro or in vivo.

Recombination proteins: include excisive or integrative proteins, enzymes, co-factors or associated proteins that are involved in recombination reactions involving one or more recombination sites. See, Landy (1994), infra.

Repression cassette: is a DNA segment that contains a repressor of a Selectable marker present in the subloning vector.

Selectable marker is a DNA segment that allows one to select for or against a molecule or a cell that contains t, often under particular conditions.

These markers can encode an activity, such as, but not limited to, production of RNA, peptide, or protein, or can provide a binding site for RNA, peptides, proteins, inorganic and organic compounds or compositions and the like.

Examples of Selectable markers include but are not limited to: DNA segments that encode products which provide resistance against otherwise toxic COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13Dec. 2007 15:47 BALDWINS 0064 4 4736712 No.6721 P. 20/50 compounds antibiotics); DNA segments that encode products which are o o.avise lacking in the recipient cell tRNA genes, anxotrophic markers); DNA segments that encode products which suppress the activity of a gene en product; DNA segments that encode products which can be readily identified phenotypic markers such as p-galactoidase green fuorescent protein (GFP), and cell surface protens); DNA segments that bind products which are otrwMso dime=tal to cell survival andlor ftnction DNA segments that otherwise inhibit the activity of any of the DNA segments described in Nos. above antisense oligonmaeotides) DNA segments that bind products that modify a substrate (ag. restriction endonucleases); DNA segments that o can be used to isolt a desired molecule (e.g specific protein binding sites); (9) DNA segments that encode a specific nucleotide secquence which can be otherwise non-functional for PCR amplification of subpopulations of molecules); and/oar (10) DNA segments, which when absent, directly or indirectly confer sensitivity to particular compounds.

Selection scheme: is any method which allows selection, enrichment, or identification of a desired Product or Product(s) from a mixtne cotainng the Insert Donor, Vector Donor, and/or any intermediates, a Cointegrate) Byproducts. The selection schemes of one preferred embodiment have at least two components that are either linked or aunlinked during recombinational cloning One component is a Selectable marker. The other component controls toe expression in vhro or in vivo of the Selectable marker, or survival of the cell harbaig the plasmid oaying the Selectable marker. Generally, this controlling element will be a repressor or inducer of the Selectable marker, but other means for controlling expression of the Selectable marker can'be used- Whether a repressor or activator is used will depend on whether the marker is for a positive or negative selection, and the exact arrangement of the various DNA segments, as will be readily apparent to those skilled in the art. A preferred requiremnt is that the selection scheme results in selection of or enrichment for only one or more desired Products. As defined herein, to select for aDNA molecule includes selecing or enriching for the presence of the desired DNA molecule, and (b) COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec. 2007 15:47 BALDWINS 0064 4 4736712 No.6721 P. 21/50 0 -16- 0 selecting or enriching against the presence of DNA molecules that are not the desired DNA molecule.

SIn one embodiment, the selection schemes (which can be arried out Sreversed) will take one of three forms, which will be diussed in tems of Figure 1. The firs exemplfied herein with a Selectable marker and a repressor therefor, selects for molecules having segment eand lacking segment C. The second selects against molecules having segment C and for molecules having ,N segment D. Possible embodiments of the second form would have a DNA N segment carying a gene toxic to cells into which the in vitro reaction products areto be introded. A toxic gene can be aDNA that is expressed asa toxi gen o product (a toxic protein or RNA), or can be toxic in and of itself (In the latter case, the toxic gene is understood to carry its classical definition of "heritable trait".) Examples of such toxic gene products are well known in the art, and include, but are not limited to, restriction endonucleases Dpn) and genes that kill hosts in the absnce of a suppressing function, kicB. A toxic gene can altenatively be selectable in vitro, a restriction site.

In the second form, segment D carries a Selectable marker. The toxic gene would elima t foants harboring the Vector Donor, Coinegrate, and Byproduct molecules, while the Selectable marker can be used to select for cells containing the Product and against cells harboring only the Insert Donor.

The third form selects for cells that have both segments A and D in ci on the same molecule, but not for cells that have both segments in trans on different molecules. This could be embodied by a Selectable marker that is split into two inactive fragments, one each on segments A and D.

The fragments are so rranged relative to the recombination sites that when the segments are brought together by the recombination event, they reconstitute a functional Selectable marker. For example, the recombinational event can link a promoter with a structural gene, can link two fragments of a structural gene, or can link genes that encode a heterodimeric gene product needed for survival, or can link portions of a replicon.

COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec. 2007 15:48 BALDWINS 0064 4 4736712 No.6721 P. 22/50 S-17.

C Site-specific recombinase: is a type of recombinase which typically has Sat least the following four activities: recognition of one or two specific DNA Ssequences; cleavage of said DNA sequence or sequences; DNA Stopoisomerae activity involved in strand exchange; and DNA ligase activity to reseal the cleaved strands of DNA. See Saner, Current Opinions in Biotechnology 5:521-527 (1994). Conservative site-specific recombination is distinguished fom homologous recombination and transposition by ahigh degree C- of specificity for both partners. The strand exchange mechanism involves the C cleavage and rejoining of specific DNA sequences in the absence of DNA synthesis (Landy, A. (1989) Ann. Rev. Biochem. 58:913-949).

SSubaloning vector: is a cloning vector comprising a circular or linear DNA molecule which includes an appropriate replicon. In the preset invention, the subcloning vector (segment D in Figure 1) can also contain functional and/or regulatory elements that are desired to be incorporated into the final product to act upon or with the cloned DNA Insert (segmentA in Figure The subdloning vector can also contain a Selectable marker (contained in segment C in Figure 1).

Vector: is a DNA that provides a useful biological or biochemical property to an Insert. Examples include plasmids, phages, and other DNA sequences which are able to replicate or be replicated in vitro or in a host cell, or to convey a desired DNA segment to a desired location within a host cell. A Vector can have one or more restriction endonuclease recognition sites at which the DNA sequences can be cut in a determinable fashion without loss of an essential biological function of the vector, and into which a DNA fragment can be spliced in order to bring about its replication and cloning. Vectors can further provide primer sites, eg., far PCR, transcriptional and/or translational initiation and/or regulation sites, recombinational signals, replicons, Selectable markers, etc. Clearly, methods of inserting a desired DNA fragment which do not require the use of homologous recombination or restriction enzymes (such as, but not limited to, UDG cloning of PCR fragments Patent No. 5,334,575, entirely incorporaed herein by reference), TA cloning, and the like) can also be applied to clone a fragment of DNA'into a cloning vector to be used according to the COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec. 2007 15:48 BALDWINS 0064 4 4736712 No.6721 P. 23/50 0 -18- 0 C- present invention. The cloning vector can further contain a Selectable marker suitable fbr use in the identification of cells tansfrmed with the cloning vector.

SVector Donar is one of the two parental DNA molecules of the present Sinvention which caries the DNA segments encoding the DNA vector which is to become part of the desired Product The Vector Donor comprises a subcloning vector D (or it can be called the cloning vector if the Insert Donor does not already contain a cloning vector) and a segment Cflank by recombination sites C (see Figure Segments C and/or D can contain elements that contribute to C selection for the desired Product daughter molecule, as described above for selection schemes. The recombination signals can be the same or different, and can be acted upon by the same or different recombinases. In addition, the Vector Donor can be linear or circular.

Description One general scheme for an in vitro or in viv method ofthe invention is shown in Figure 1, where the Insert Donor and the Vector Donor can be either circular or linear DNA, but is shown as circular. Vector D is exchanged for the original cloning vector A. It is desirable to select for the daughter vector containing elements A and D and against other molecules, including one or more Cointegrate(s). The square and circle are different sets ofrecombinaion sites lox sites or ft sites). Segment A or D can contain at least one Selection Marker, expression signals, origins of replication, or specialized functions for detecting, selecting, expressing, mapping or sequencing DNA, whereD is used in this example.

Examples of desired DNA segments hat can be part of ElenentA or D include, but are not limited to, PCR products, large DNA segments, genomic clones or iagments, cDNA clones, functional elements, etc., and genes or partial genes, which encode useful nucleic acids or proteins. Moreover, the recombinational cloning of the present invention can be used to make ae vive and in vivo gene transfer vehicles for protein expressi6n and/or gene therapy.

COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec. 2007 15:48 BALDWINS 0064 4 4736712 No.6721 P. 24/50 0 19- 0 In Figure 1, the scheme provides the desired Product as containing o vectors D and A, as follows. The Insert Donor (containing A and B) is first 0 recombined at the square recombination sites by recombination proteins, with the cn Vector Donor (containing C andD), to form a Co-integrate having each of A-D- C-B. Next, recombination occrs at the circle recombination sites to form Product DNA (A andD) and Byproduct DNA (Cand However, if desired, two or more different Co-integrates can be formnned to generate two or more SProducts.

In one embodiment of the present in vitro or in viv recombinational cloning method, a method for selecting at least one desired Product DNA is O provided. This can be understood by consideration of the map of plasmid pEZC726 depicted in Figure 2. The two exemplary recombination sites are attP and loxP. On one segment defined by these sites is a kanamycin resistance gene whose promoter has been replaced by the tetOP oprator/promotcr from transposon Tnl0. In the absence of tet repressor protein, E coli RNA polymerase transcribes the kanamycin resistance gene from the tetOP. If tet repressor is present, it binds to tetOP and blocks transcription of the kanamycin resistance gene. The other segment of pEZC726 has the tet repressor gene expressed by a constitutive promoter. Thus cells transformed by pEZC726 aere sistant to chlramphenicol, because of the chloramphenicol acetyl transferase gene on the same segment as teR, but are sensitive to kanamycin. The recombination reactions result in separation of the tetR gene from the regulated kanamycin resistance gene. This separation results in kanamycin resistance in cells receiving the desired recombination Product.

Two different sets of plasmids were constructed to demonstrate the in vitro method. One set, for use with Car recombinase only (cloning vector 602 and subcloning vector 629 (Figure contained laxP and loxP 511 sites. A second set, for use with Cre and integrase (cloning vector 705 and subcloning vector 726 (Figure contained loxP and art sites. The efficiency of production of the desired daughter plasmid was about 60 fold higher using both enzymes than using Cre alone. Nineteen of twenty four colonies from the Cre-oly COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec. 2007 15:49 BALDWINS 0064 4 4736712 No.6721 P. 25/50 0 0 N reaction contained the desied product, while thirty eight of thirty eight colonies from the integrase plus Cre reaction contained the desired product plasmid.

SOther Selecton Schems A variety of selection schemes can be used that C are known in the art as they can suit a particular purpose for which the recombinational cloning is carried out Depending upon individual preferences and needs, a number of different types of selection schemes can be used in the recombinational cloning method of the present invention. The skilled artisan can N- take advantage of the availability of the many DNA segments or methods for Smaking them and the differnt methods of selection that are routinely used in the art. Such DNA segmets include but ar not limited to those which ¢acodes an Sactivity such as, but not limited to, production of RNA, peptide, or protein, or providing a binding site for such RNA, peptide, or protein. Examples of DNA molecules used in devising a selection scheme are given above, under the definition of"selection scheme" Additional examples include but re not limited to: Generation ofnew primer sites for PCR juxtaposition oftwo DNA sequences that were not previously juxtaposed); (ii) Inclusion of a DNA sequence acted upon by a restriction endonuclease or other DNA modifying enzyme, chemical, ribozyme, etc.; (ii) Inclusion of a DNA sequence recognized by a DNA binding protein, RNA, DNA, chemical, etc) for use as an affinity tag for selecting for or excluding from a population) (Davis, Nuc Acids es. 24:702-706(1996); J YiroL 69: 8027-8034 (1995)); (iv) In vitro selection of RNA ligands for the ribosomal L22 protein associated with Epstein-Barr virus-expressed RNA by using randomized and cDNA-derived RNA libraries; (vi) The positioning of functional elements whose activity requires a specific orientation or juxtaposition a recombination site which reacts poorly in trans, but when placed in cis, in the presence of the appropriate proteins, results in recombination that destroys certain populations of molecules; reconstitution of COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec. 2007 15:49 BALDWINS 0064 4 4736712 No.6721 P. 26/50 0 -21.

C-i a promoter sequence that allows in vitro RNA synthesis). The SRNA can be used directly, or can be reverse transcribed to obtain Sthe desired DNA construct M (vii) Selection of the desired product by size factionation) or other physical property of the molecule(s); and S(viii) Inclusion ofa DNA sequee required for a specific modification methylation) that allows its identification.

After formation of the Product and Byproduct in the method ofthe present Sinvention, te selection step can be carried out either in vtr or in vivo depending upon the particular selection scheme which has been optionally devised in the Sparticulr rn mbinational cloning procedure.

For eample, an in viro method of selection can be devised for the Insert Donor and Vector Donor DNA molecules. Such scheme can involve engineering a rare restriction site in the starting circular vectors in such a way that after the recombination event the rare cutting sites end up in the Byproduct Hence, when the restriction enzyme which binds and cuts at the rar restriction site is added to the reaction mixture in vitro, all of the DNA molecules carrying the are cutting site, Le., the starting DNA molecules, the Cointgrate and the Byproduct, will be cut and rendered nonreplicable in the intended host cell. For example, cutting sites in segments B and C (see Figure 1) can be used to select against all molecules except the Product Alternatively, only a cutting site in C is needed if one is able to select for segment D, by a drug resistance gene not found on B.

Similarly, an in vtro selection method can be devised when dealing with linear DNA molecules. DNA sequences complementary to a PCR primer sequence can be so engineered that they are tansfrred, through the recombinational cloning method, only to the Product molecule. After the reactions are completed, the appropriate primers ar added to the reaction solution and the sample is subjected to PCR Hence, all or part of the Product molecule is amplified.

Other in vivo selection schemes can be used with a variety of E colt cell lines. One is to put a repressor gene on one segment of the subcloning plasmid, and a drug marker controlled by that repressor on the other segment of the same COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Deo. 2007 15:49 BALDWINS 0064 4 4736712 No.6721 P. 27/50 -22plasmid. Another is to put a killer gene on segment C of the subcloning plasmid o (Figure Of course a way must exist for growing such a plamid, there must exist circumstances under which the killer gene will not kill. There are a C) number of these genes kown which requite particular strains of K coil. One such schemc is to use the restriction enzyme DpnI, which will not cleave unless its recognition sequence GATC is methylated. Many popular common E colt strains methylato GATC sequences, but there are mutants in which cloned DpnI c can be expressed without harm.

Of caourse analogous selection schemes can be devised for other host rganisms. For example, the tet repressor/operator of TlO has been adapted to conl gene expression in eukaryotes (Gossen, and Bujard, H, Proc. NatL Acrd &ci UA 89:5547-5551 (1992)). Thus the same control of drug resistance by the tet repressor exemplified herein can be applied to select for Product in eukaryatic cells.

A*Ohbinadon Proteins In the present invention, the exchange of DNA segments is achieved by the use of recombination proteins, including recombinases and associated co-factors and proteins. Various recombination proteins are described in the art.

Examples of such recombinases include: Ore A protein from bactriophage P1 (Abremski and Hoess, J Biol.

Chen. 259(3):1509-1514 (1984)) catalyzes the exchange causes recombination) between 34 bp DNA sequences called loxP (locus of crossover) sites (See Hoess et at, Nuc. Acids Res. 14(5)2287 (1986)). Cre is available commercially (Novagen, CatalogNo. 69247-1). Recombination mediated by Cre is freely revesible. From thermodynamic considerations it is not surprising that C-remediated integration (recombination between two molecules to form one molecule) is much less efficient than Cr-mediated excision (recombination between two loxrP sites in the same molecule to form two daughter molecules).

Cre works in simple buffrs with either magnesium or spermidine as a cofactor, as is well known in the art. The DNA substrates can be either linear or COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec. 2007 15:49 BALDWINS 0064 4 4736712 No.6721 P. 28/50 23 C supercoiled. A number of mutant loxP sites have been described (Hoesset al., Ssupra). One of these, loxP 511, recombines with another laxP 511 site, but will 0 not recombine with a loxP site.

Integrare: A protein fiom bacteiophage lambda that mediates the integration of the lambda genome into the E colt chromosome. The bacteiophage I Int recombinational proteins promote irrevese recombiation between its substrate anf sites as part of the formation or induction of a lysogenic Cr state. Reersibility of the recombiationl reactions results from two independent ^C pathways for integrative and excisive recombination. Each pathway uses a unique but overlapping set of the 15 protein binding sites that comprise ar site SDNAs. Cooperative and competitive interactions involving four proteins (nt, Xis, IHF and FIS) determine the direction of recombination.

Integrative rcombination involves the Int and IHF poteins and sites aftP (240 bp) and attB (25 bp). Reeombination results in the formation of two new sites: attL and attR Excisive recombination requires Int, F, and Xis, and sites atL and attR to generate P and attB. Under certain conditions, FIS stimulates excisive recombination. In addition to these normal reactions, it should be appreciated that atrP and artB, when placed on the same molecule, can promote ecisive recombination to generate two excision products, one with attL and one with attR. Similarly, intennolecular recombination between molecules containing attL and anR, in the presence of nt, IHF and Xis, can result in integrative recombination and the generation attP and atB. Hence, by flanking DNA segments with appropriate combinations of engineered att sites, in the presence of the appropriate recombination proteins, one can direct excisive or integrative recombination, as reverse reactions of each other.

Each of the at sites contains a 15 bp core sequence; individual sequence elements of functional significance lie within, outside, and across the boundaries of this common core (Landy, A, Ann Rev. Biochen. 58:913 (1989)). Efficient recombination between the various att sites requires that the sequence of the central common region be identical between the recombining partners, however, the exact sequence is now found to be modifiable. Consequently, derivatives of COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Doe 2007 15:50 BALDWINS 0064 4 4736712 No-6721 P. 29/50 o -24- CA the all site With changes within the core arm now discovered to recomnh as least as efficiently as the native core sequences.

0 lntegrase acts to recombine the alt? site on bactediophage Lambda (about en 240 bp) with the anDB site onthe E. coil genorre (about 25 bp) (Weisbcrg, R.A and landy, A. inLambdaff, p. 211 (1983), Cold Spdng Harbor Laboratory)), to produce the integrated lambda genome flanked by attL (about 100 bp) and atta (about 160 bp) sites. In the absence of xis (see below), this reation is essentialy CA ~irversible. The lintegration reaction mediated by integine and IHU works CA in yin, wit simple buffer containing spernme Tntegnwe ean be obtained as o 10 described by Nash HA, Methodt ofBnzymalog 10&.210-216 (1933). 11fF can 0be obtained as described by Filutowiicz, elat., Gene 147:149-150 (1994).

In the presence of the I Protein )Gs (excise) integrase catalyzes the reaction of ca and afl& to form at& arnd aBlm.&. it promotes the reverse of the reaction described above. Tis reaction can also be applied in t present invention.

Other Raem6* ion Syutenz Numerous recombination systems from vatious organisims can also be used, based on the teaching and guidanc proidcd herein. Sec. acg., Hoess e: Nucleic Acids Research 14(6):2287 (1936); Abreniskd at at, J~ DioL Chent26l(1)391 (1986); Campbell, BacteriaL 174(23):7495 (1992); Qian etlt, J Riot Chzen 267(11X-7794 (1992); Araki t, l Mol Riot 225(l):25 (1992)). Many of these belong to the intes famly of recomnbinases (Argos etal. EMBOJJ 5:433-440 (1936)). Perhaps the best studied of thes =r the Integrase/att system from bacteriophagexA (Landy, A. (1993) Current Opinions in Genetics and beveL 3:699-707), the CrefloxP system f-rm bactcriothagc P1 (Hess and Abremsld (1990J In Nude/cAcids and Molecular Biology, vol. 4. Ed&: Eckatei and ULley, Berlin-Heidelberg: Spdinga-Vcrlag; pp. 90-109), and the FLPIFRT system fivm the Sacchsomyces cerevisiae 2 p circle plasmid (Broach et at. Cell 292n7-234 (1992)).

Memlns of a second family of site-specific recombinases, the resovase family y5, Tn3 resolvase, Hin, Gin, and Gin.) ae also known. members of this ighly related family of recombinases are typically constlraind to intramolecular reactions inversions and excisions) and can require host- COMS ID No: ARCS-i 72228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec. 2007 15:50 BALDWINS 0064 4 4736712 No.6721 P. 30/50 o encoded factors. Mutants have been isolated that relieve some of the I) requirements for host factors (Maeser and Kahnnann (1991) Mo. Gen. Genet.

230: 170-176), as well as some of the constraints ofintramolecularrecambinaton.

SOther site-specific recmbinases siilar to 2 Int and similar to P Cre can be substituted for It and Cre. Such recombinases are kown. In many cases the purification of such other recombinases has been described in the art In cases when they are not known, cell extrac can be used or the enzymes can be partially purified using procedures described for Cre and Int.

SWhile Cre and Int are described in detail for reasons of example, many o 10 related recombinase syst exist andtheir application to the descibed invention C is also provided according to the present invention. The integrase family of sitespecific recombinases can be used to provide alternative recombination proteins and recombination sites for the present invention, as sit-speitfic recombination proteins encoded by bacteriophage lambda, phi 80, P2,2, 86, P4 and Pl. This group ofproteins exhibits an unexpectedly large diversity of sequences. Despite this diversity, all of the recombinases can be aligned in their C-terminal halves.

A 40-residue region near the C tennins is particularly well conserved in all the proteins and is homologous to a region near the C terminus of the yeast 2 mu plasmid Flp protein. Three positions are perfectly conserved within this family; histidine, arginine and tyrosine are found at respective alignment positions 396, 399 and 433 within the well-conserved C-terminal region. These residues contribute to the active site of this family of recombinases, and suggest that tyrosine-433 forms a transient covalent linkage to DNA during strand cleavage and rejbining. See, Argos, P. et at, EMBOJ. 5:433-40 (1986).

Alternatively, IS231 and other Bacillus thurngiensis transposable elements could be used as recombination proteins and recombifation sites.

Bacillus thuringiensis is an entomopathogenic bacterium whose toxicity is due to the presence in the sporangia of delta-endotoxin crystals active against agricultural pests and vectors of human and animal diseases. Most of the genes coding for these toxin proteins are plasmid-borne and are generally structurally associated with insertion sequences (IS231, IS232, IS240, ISBTI and ISBT2) and tansposons (Tn4430 and Tn540I). Several of these mobile elements have been COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec. 2007 15:50 BALDWINS 0064 4 4736712 No.6721 P. 31/50 -26shown to be active and participate in the crystal gene mobility, thereby contributing to the variation of bacterial toxicity.

Structural analysis ofthe iso-IS231 elements indicates that they are related to IS151 from Clo1idiumwn perfringet and distantly related to IS4 and IS186 from Echerichia coli. Like the other IS4 family members, they contain a conserved transposase-ategrae motiffound in other IS families and retrovinruses.

Moreover, functional data gathered from IS231A in Escherichia coli indicate a non-replicative mode of tanspositioq with a preference for specific targets. Similar results were also obtained in Bacills sublis and B.

o 10 thwtrngienis, See, Maillon, J. ei aLt, Geneica 93:13-26 (1994); Campbell, 0 J Bacterial. 7495-7499 (1992).

The amount of recombinese which is added to drive the recombination reaction can be determined by using known assays. Specifically, titation assay is used to determine the appropriate amount ofa purified recombinase enzyme, or the appropriate amount of an exiract.

Engineered Recomnation Siter. The above recombinases and corresponding recombinase sites are suitable for use in recombination cloning according to the present invention. However, wild-type recombination sites contain sequences that reduce the efficiency or specificity of recombination reactions as applied in methods of the present invention. For example, multiple stop codons in attB, attR, attP, attL and loxP recombination sites occur in multiple reading frames on both strands, so recombination efficiencies arc reductd, e.g, where the coding sequence must cross the recombination sites, (only one reading frame is available on each strand of loxP and attB sites) or impossible (in attP, attR or attL).

Accordihgly, the present invention also provides engineered recombination sites that overcome these problems. For example, ati sites can be engineered to have one or multiple mutations to enhance specificity or efficiency ofthe recombination reaction and the properties ofProduct DNAs attl, att2, and att3 sites); to decrease reverse reaction (e.g removing P1 and HI from attB).

The testing of these mutants determines which mutants yield sufficient COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec. 2007 15:51 BALDWINS 0064 4 4736712 No.6721 P. 32/50 o -27c recombinational activity to be suitable for recombination subcloning according U) to the present invention.

0 Mutations can therefore be introduced into recombination sites for enhancing site specific recombination. Such mutations include, but are not limited to: recombination sites without translation stop codons that allow fusion proteins to be encoded recombination sites recognized by the same proteins but differing in base sequence such that they react largly or exclusively with their Shomologous partners allow multiple reactions to be contemplated. Which particular reactions take place can be specified by which particular partners are o 10 present in the reaction mixture. For example, a tripartite protein fusion could be C accomplished with parental plasmids containing recombination sites attR and attR2; attL1 and attL3; and/or attR3 and att2.

There are well known procedres for introducing specific mutations into nucleic acid sequences. A number of thse are described inAusubel, F.M et at, Current Protocols in Molecular Biology, Wiley Interscience, New York (1989- 1996). Mutations can be designed into oligonuclootides, which can be used to modify existing cloned sequences, or in amplification reactions. Random mtagenesis can also be employed if appropriate selection methods are available to isolate the desired mutant DNA or RNA. The presence of the desired mutations can be confirmed by sequencing the nucleic acid by well. known methods.

The following non-limiting methods can be used to engineer a core region of a given recombination site to provide mutated sites suitable for use in the present invention: 1. By recombination of two parental DNA sequences by site-specific (eg.

attL and attR to give attS) or other homologous) recombination mechanisms. The DNA parental DNA segments containing one or more base alterations resulting in the final core sequence; 2 By mutation or mutagenesis (site-specific, PCR, random, spontaneous, etc) directly ofthe desired core sequence; COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec. 2007 15:51 BALDWINS 0064 4 4736712 No.6721 P. 33/50 o -28cN 3. By mutagenesis (site-specific, PCR, random, spontanteous, et) of d) parental DNA sequences, which are recombined to generate a 0 desired core sequence; and ,3 4. By reverse transcription of an RNA encoding the desired core sequence.

The functionality ofthe mutat recombination sites can be demonstrated in ways that depend on he particular chaacterisic that is desired For example, the lack of translation stop codons in a recombination site can be demonstrated C-i by expressing the appropriate fusion proteins. Specificity of recombination o 10 betwee homologous partners c be demonstrated by introducing the appropriate Smolecules into in vitro reactions, and assaying for recombination products as described herein or known in the art Other desired mutations in recombination sites might include the presence or absence of restriction sites, translation or nscription start signals protein binding sites, and other known functionalities of nucleic acid base sequences. Genetic selection schemes for particular fimctional attributes in the recombination sites can be used according to known method steps. For example, the modification of sites to provide (fiom a pair of sites that do not interact) partners that do interact could be achieved by requiring deletion, via recombination between the sites, of a DNA sequence encoding a toxic substance. Similarly, selection for sites that remove translation stop sequences, the presence or absence of protein binding sites, etc, can be easily devised by those skilled in the art.

Accordingly, the present invention provides a nucleic acid molecule, comprising at least one DNA segment having at least two engineered recombination sites flanking a Selectable marker and/or a desired DNA segment, wVetin at least one of said recombination sites comprises a core region having at least one engineered mutation that enhances recombination in vitro in the formation of a Cointegrate DNA or a Product DNA.

The nucleic acid molecule can have at least one mutation that confers at least one enhancement of said recombination, said enhancement selected from the group consisting of substantially favoring excisive integration; favoring excisive recombination; (ii) relieving the requirement for host factors; (iii) COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13ec. 2607 15:51 BALDWINS 0064 4 4736712 No.6721 P. 34/56 -29increasing the efficiency of said Cointegrate DNA or Product DNA formation; C) and (iv) increasing the specificity of said Cointgrae DNA or Product DNA formation.

The nucleic acid molecule preferably comprises at least one S reownbiaaio site derived from atiB, attP, attL or attR. More preferably the att site is selected from atti, auZ, or att3, as described herein.

hI a preferred embodiment, the care region comprises a DNA sequence selected from the group consisting of: RXCCWGCTT YKTRTACNAASTSGB (r-ott) (SEQ IDNO:I); ACCCWGCTTTYKTRTACNAACTSGB (rm-aB) (SEQ ID 0 140:2); GflCAGCTCKTRTACNAALCTSGB (rn-aUR.) (SEQ ID NO:3);.

ACCCWGCflTCKTRTACNAAOTSOB (m-sft) (SEQ II) NO:4); GflCAGCfTYTRTACNAAGTSOB(m-attPl) (SEQ ID or a corresponding or complementary DNA or RNA sequence, wherein R=A or 0; K=G or TIU; Y=C or T; W=A or N=A or C or 0 or T; S-Cor O and B=Cor G or T, as presented in 37 CFX§L f22, which is entirely incorporated herein by refeence 4 wherein the core region does not contain a stop codon in one or more reading frames.

The core region also preferably comprises aDNA sequence selected from the group consisting of.

AGOCTCCTITTGTACAAACfT(dttBl)(SEQIDNO:6); AGCTi rutT iGTACAAACflUT(attB2)(SEQIDNO:7); ACOCAGClMTT TGACAAAC GT (artB3) (SEQ ID NO:8); GrECAGCTITTGTACAAACTGTM(at-l) (SEQ ID NO:9); OTE CAGC1TICTTGTACAAAC IT (aufr) (SEQID NO:! 0); GTCAOCTT=COTACAAAGITGG (SEQ ID NO:I1); COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec. 2007 15:51 BALDWINS 0064 4 4736712 No.6721 P. 35/50 o AGCCTGCTTTTGTACAAAGTGCG (attLl) (SEQ ID NO:12); AGCCTOCTTCfGlTACAAAOTGG (atL2) (SEQ ID NO:13); ACCCAGCTITCTTGTACAAAGTTGG (attL3) (SEQ ID NO:14); GrTTCAGCTTrrrrt ACAAAGIGG(adP1) (SEQ GTTCACTTTC1TOTACAAAGTrGG (attP2,P3) (SEQ ID N NO:16); or a corresponding or complementary DNA or RNA sequence.

The present invention thus also provides a method for making a nucleic N acid molecul; comprising providing a nucleic acid molecule having at least one engineered recombination site comprising at least one DNA sequence having at least 80-99% homology (or any range or value therein) to at least one of SEQ ID NOS:1-16, or any suitable recombination site, or which hybridizes under stringent conditions thereto, as known in the art.

Clearly, the are various types and permutations of such well-known in vitro and in vive selection methods, each of which are not described herein for the sake of brevity. However, such variations and permutations are contemplated and considered to be the different embodiments of the present invention.

It is important to note that as a result of the preferred embodiment being in vitro recombination reactions, non-biological molecules such as PCR products can be manipulated via the piesent recombinational cloning method. In one example, it is possible to clone linear molecules into circular vectors.

There arc a number of applications for the present invention. These uses include, but are not limited to, changing vectors, apposing piromoters with genes, constructing genes for fusion proteins, changing copy number, changing replicons, cloning into phages, and cloning, eg., PCR products (with an lttB site at one end and a loxP site at the other end), genomic DNAs, and cDNAs.

COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec. 2007 15:52 BALDWINS 0064 4 4736712 No.6721 P. 36/50 o -31 The following examples are intended to further illustrate certain preferred n embodiments of the invention and are not intended to be limiting in nature.

Examples The present recombinational cloning method accomplishes the exchange ofnucleic acid segments to reader something useful to the user, such as a change of cloning vectors. These segments must be flanked on both sides by recombination signals that are in the proper orientation with respect to one Sanother. In the examples below the two parental nucleic acid molecules plasmids) are called the Insert Donor and the Vector Donor. The Insert Donor contains a segment that will become joined to a new vector contributed by the Vector Donor. The recombination intermediate(s) that contain(s) both starting molecules is called the Cointegrate(s). The second recombination event produces two daughter molecules, called the Product (the desired new cone) and the Byproduct Buffers Various known buffers can be used in the reactions of the present invention. For restriction enzymes, it is advisable to use the buffers recommended by the manufacturer. Alternative buffers can be readily found in the literature or can be devised by those of ordinary skill in the art.

Eramples 13. One exemplary bnffer for lambda integrase is comprised of 50 mM Tris-HCI, at pH 7.5-7.8, 70 mM KCI, 5 mM spermidine, 0.5 mM EDTA, and 0.25 mg/ml bovine serum albumin, and optionally, 10% glycerol.

One preferred buffer for PI Cre recombinase is comprised of 50 mM Tris-HCI at pH 7.5, 33 mM NaCI, 5 mM spermidine, and 0.5 mg/ml bovine serum albumin.

The buffer for other site-specific recombinases which are similar to lambda Int and P1 Cre are either known in the art or can be determined COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec. 2007 15:52 BALDWINS 0064 4 4736712 No.6721 P. 37/50 o -32-

O

Sempirically by the skilled artisans, particularly in light of the above-described

C)

C) buff=rs.

Example 1: Recombinuional Cloning Using Cre and Ce Int Two pairs ofplasmids were conslcted to do the in vitro recombinational cloning method in two different ways, One pair, pEZC705 and pEZC726 (Figure 2A), was constructed with toXP and art sites, to be used with Cre and A integrasc. The other pair, pEZC602 and pEZC629 (Figure 3A), contained the o lorP (wild type) site for Crie, and a second mutant lox site, lorIP 511, which diffeMrs from loxP in one base (out of 34 total). The minimnum requirement for recombinational cloning of the present invention is two recombination sites in eachplasmid, in generlXand Y, andr and 7. Reombinational cloning takes place if either or both types of site can recombine to form a Cointegrate (eg. X and and if either or both (but necessarily a site diffeent from the type forming the Cointegrate) can recombine to excise the Product and Byproduct plasmids from the Cointegrate Y and It is important that the recombination sites on the same plasmid do not recombine, It was found that the present recomnbinational cloning could be done with Crc alone.

Cre-OnIy Two plasmids were constructed to demonstrate this conception (see Figure 3A). pEZC629 was the Vector Donor plasmid. It contained a constitutive drug marker (chlorampbenicol resistance), a origin of ieplication, loxP and ioxP 511 sites, a conditional drug marker (kanamycin resistance whose expression is controlled by the operator/promoter of the tetracycline resistance operon of traisposon 710), and a constitutively expressed gene for the tet repressor protein, retR. E. col cells containing pEZC629 were resistant to cblorampbenicol at 30 pg/mL, but sensitive to kanamycin at 100 pg/l pEZC602 was the Insert Donor plasmid, which contained a different drug marker COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13-Dec. 2007 15:52 BALDWINS 0064 4 4736712 No.6721 P. 38/50 -33-

O

(ampicillin resistance), an origin, and larP and loxP 511 sites flanking a multiple cloning site.

This experiment was comprised of two parts as follows: M Part I: About 75 ng each of pFZC602 and pEZC629 were mixed in a total volume of 30 pl of Cre buffer (50 mM Tris-HCI pH 7.5, 33 mM NaC, mM spermidine-HCI, 500 pg/ml bovine serum albumin). Two 10 pl atiquots were transfened to new tubes. One tube received 0.5 pl of Crc protein (approx.

4 units per pl; partially purified according to Abremski and Hoess, J Biotl. Chem C 259:1509 (1984)). Both tubes were incubated at 37"C for 30 minutes, then for 10 minutes. Aliquots of each reaction were diluted and ransformed into SDHSa. Following axprssion, aliquots were plated on 30 pg/ml chlramphenicol 100 pg/il ampicillin plus 200 pg/ml methicillin; or 100 pg/ml kanamycin. Resulst: See Table 1. The reaction without Cke gave 1.11x ampicillin resistant colonies (from the Insert Donor plasmid pEZC602); 7.Sx1W obloramphenicol resistant colonies (from the Vector Donor plasmid pEZC629); and 140 kanamycin resistant colonies (background). The reaction with added Ce gave 7.5x0' ampicillin resistant colonies (fiom the Insert Donor plasmid pEZC602); 6.Jxl( chloramphenicol resistant colonies (from the Vector Donor plasmid pEZC629); and 760 kanamycin resistant colonies (mixture of background colonies and colonies from the recombinational cloning Product plasmid). Analysir: Because the number of colonies on the kanamycin plates was much higher in the presec of Cre, many or most of them were predicted to contain the desired Product plasmid.

Table 1 Enzyme Ampicilin Chloramphenicol Kmnamycin Efficiency None 1.1x10' 7.xlo 5 140 140l.8x05- 0.02% Cre 7.5x10' 6.1x10' 760 760/6.lx10'= 0.12% Part H.l Twenty four colonies from the Cre" knamyin plates were picked and inoculated into medium containing 100 pg/nl kanamycin. Minipreps were done, and the miniprep DNAs, uncut or cut with Smal or HindiI, were COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec. 2007 15:52 BALDWINS 0064 4 4736712 No.6721 P. 39/50 -34- 0 olectrophresed. Resulft 19 of the 24 minipreps showed suprcoiled plasmid of the size predicted for the Product plasmid. All 19 showed the predicted SnTal and find restriction fagments. Analysis: The Cre only scheme was demonstrated. Specifically, it was determined to have yielded about 70% (19 of 24) Product clones. The efficiency was about 0.1% (760 kanamycin resistant clones resulted from 6.lx10' chloramphonicol resistant colonie).

Crn PIn Iutegrase The plasmids used to demonstrate this method ar exactly analogous to Sthose used above, except that pEZC726, the Vector Donor plasmid, contained an aP site in place ofloxP 511, and pEZC705, the Insert Donor plasid, contained an aitl site in place of laxP 511 (Figure 2A).

This experiment was comprised of three parts as follows: Pari:- About 500 ng of pEZC705 (the Insert Donor plasmid) was cut with Sca4 which linearized the plasmid within the ampicillin resistance gene.

(This was done because the I integrase reaction bas been historically done with the artB plasmid in a linear state (aL Nash, personal communication). However, it was found later that the integase reaction proceeds well with both plasmids supercoiled.) Then, the linear plasmid was ethanol precipitated and dissolved in pl offl integrase buffer (50 mM Tris-HCI, about pH 7.8, 70 mM KCI, 5 mM spemidine-HCI, 0.5 mrM EDTA, 250 pg/ml bovine serum albumin). Also about 500 ng of the Vector Donor plasmid pEZC726 was ethanol precipitated and dissolved in 20 p1 X integrase buffer. Just before use, 1 integrase (2 pl, 393 pg/mi) was thawed and diluted by adding 18 p1 cold A integrase buffer.

One p1 IHF (integration host factor, 2.4 mg/ml, an accessory protein) was diluted into 150 p cold I integrase buffer. Aliquots (2 p1) of each DNA were mixed with A integrase buffer, with or without pil each 1integrase and 11, in a total of 10 p. The mixure was incubated at 25C for 45 minutes, then at 70C for minutes. Halfof each reaction was applied to an agarose gel. Reltr: In the presence of integrase and IfF, about 5% of the total DNA was converted to a linear Cointegrate form. Analysir: Activity of integrase and WF was confinred COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec. 2607 15:53 BALDWINS 0064 4 4736712 No.6721 P. 40/56 Pari Three microlitr of each reaction 'itb or without integmac U and IM) were diluted into 27 Wd of Cre buffer (above), then each reaction was split into two 10 pl aliquots (four altogethe). To two of these reations, 0.5 gI Cl of Cr protemn (above) were added, and all reactions were incubated at 3rC far 30 minutes, then at 70-C for 10 mihntes. TE buffer (90 gI; TE: 10 mM Tris-HCl, pH 7-5. 1 mM EDTA) was added to each reaction, and I gl each was tmsfrmed into E coli DHSa. The franfamation mixtrs we plated on 100 pg/mI ampiciUin plus 200 pg/nl mctbiciilin 30 g/zn cdmviupbeniowI; or 100 g/mI kanam ycin. Reult: See Table 2.

010 Table 2 Eanie Ampiciffin Chlaoipeniol Kanmycin Efficiency None 990 20000 4 4/2x10 4 =0.02% Creonly 280 3640 0 0 lnicgrasr* 1040 27000 9 9/2.7xW4-O.03% 11e10se' 10 1110 76 761 I.lxl'- 6.9% +t Cre lntweagra aeains also contained WI.

Aalxyist The Crc protein impaired raasfxratio When adjusted for this effect, the nnber of kanamycin resistant colonies, compared to the control reactions, increased mare than 100 fold when both Cre and Integrase wre used.

This suggests a specifcity of greater than 99/ Part 111: 38 colonies were picked fro the Inteflre plus Crc plates, miniprep DRAs were made and cut with HtndI to give diagnostic mapping information. Result All 3S had precisely the expected fravgment size.

Analysis: The Cre plus A integrase method was oberved to have much higher specificity than Crc-alone. Condusion; The Cre plus I integrase method was demonstrated. Efficiency and specificity were much higher than for Cre only.

COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec. 2007 15:53 BALDWINS 0064 4 4736712 No.6721 P. 41/50 -36- 0 N Example 2: Using in vitro Recombinaional Cloning to Subclone the O Chloramphenicol Aeayl Transferase Gene into a Vector for rExpression in Eakaryote CeHs (Figure 4A) An Insert Donor plasmid, pEZCS43, was construcd, comprising the chloramphenicol acetyl transferase gene of E coi, cloned between loxP and arnB sites sch that the laP site was positioned at the 5'-end of the gene (Figure 4B).

A Vector Donor plasmid, pEZC1003, was construceted, which contained the cytomegalovirns eukaryotic promoter apposed to a laxP site (Figure 4C). One microlitcr aliquots of each supercoiled plasmid (about 50 zig crude miniprep DNA) were combined in a ten microliter reaction containing equal parts of Ci lambda integrase buffer (50 mM Tzis-HCl, pH 7.8, 70 mM KCI, 5 mM spermidine, 0.5 mM EDTA, 0.25 mg/mI bovine serum albumin) and Cre recombinase buffer (50 mM Tris-HCI, pH 7.5,33 mM NaC, 5 mM spermidine.

g/nil bovine serum albumin), two units of Crt recmbinase, 16 ng integration host factor, and 32 ng lambda integrase. After incubation at 30'C for minutes and 75"C for 10 minutes, one microliter was transformed into competent K cali strain DH5a (Life Technologies, Inc.). Aliquots of transformations were spread on ager plates containing 200 pg/mI kanamycin and incubated at 37*C overnight An otherwise identical control reaction contained thc Vector Donor plasmid only. The plate receiving 10% of the control reaction transformation gave one colony-, the plate receiving 10% of the recombinational cloning reaction gave 144 colonies. These numbers suggested that greater than 99% of the recombinational cloning colonies contained the desired product plasmid. Miniprep DNA made from six recombinational cloning colonies gave the predicted size plasmid (5026 base pairs), CMVProd. Restriction digestion withNcol gave the fragments predicted for the chloamphenicol acet1transferase cloned downstream of the CMV promoter for all six plasmids.

COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec. 2007 15:53 BALDWINS 0064 4 4736712 No.6721 P. 42/50 0-37c N Example 3: Sbdoned DNA Segments Flanked by attB Sites Wrhout Stop Codons

C)

Cc PartI: Background The above examples are suitable for transcriptional fusions, in which transcription crosses recombination sites. However, both attR and loxP sites C- contain multiple stop codons on both strands, so translational fusions can be Sdifficult, where thecoding sequence must cross the recombination sites, (only one reading fiame is available on each strand of loxP sites) or impossible (m attR or 0 atrL).

A principal reason for subloning is to fuse protein domains. For example, fusion of the glutatlione S-transferase (GST) domain to a protein of interest allows the fusion protein to be purified by affinity chromatography on glutathione agarose (Phanacia, Inc., 1995 catalog). If the protein of interest is fused to runs of consecutive histidines (for example Hs6), the fusion protein can be purified by affinity chromatography on chelating resins containing metal ions (Qiagen, Inc.). It is often desirable to compare amino terminal and carboxy terminal fusions for activity, solubility, stability, and the like.

The attB sites of the bacteriophage integration system were examined as an alternative to loxP sites, because they are small (25 bp) and have some sequence flexibility (Nash, HA. et Proc. Nat Acad Sci USA 84:4049-4053 (1987). It was not previously suggested that multiple mutations to remove all stop codes would result in useful recombination sites for recombinational subcloning.

Using standard nomenclaure for site specific recombination in lambda bacteriophage (Weisber, in Lambda L, Hendrix, etaL, eds., Cold Spring Harbor COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13iDec. 2007 15:53 BALDWINS 0064 4 4736712 No.6721 P. 43/50 0 -38- Laboratory, Cold Spring Harbor, NY (1989)), the nuoleotide regions that U participate in the recombinatan reaction in an E coli host cell are represented 0 as follows: att -al- o rptp 4 tnt, IXr II Xis, Int, x1v attR o 10 attL wle O represents the 1S bp core DNA sequence found in both the phage and R coli genomes; B and B' represent approdmately 5 bases adjacent to the core inthE coi gcnome; andPI, HI, P2, XH2, C, P2 and P3 represent kownDNA sequences encoding protein binding domains in the bacteriophage 1 genome.

The reaction is reversible in the presence of the protein Xis (excisinase); recombination between attL and attR precisely ecise the A, genme from its itegrated stat; regenerating the circular genome containing t attP nd the linear E. coil gennome containing attB.

PVtH. Construcioa oand Teting of Masidms ContainWngMWn atir SrS 'Mutant attL and attR sites were constructed. Importantly, Landy er o (An. Rev. Biochetn 58:913 (1989)) observed that deletion of the pl and H1 domains of aP facilitated the excision reaction and eliminated the integration reaction, thereby making the excision reaction irreversible. Therefore, as mutations were introduced in attR the P1 and HI domains were also deleted.

attR sites in the present example lack the P1 and HI regions and have the Ndel site removed (base 27630 changed from C to and contain sequences COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec. 2001 15:54 BALDWINS 0064 4 4736112 No.6721 P. 44/50 o 39..

corresponding to bacteriophage X coordinates 276 19-27738 (GenBmnk release 92.0, bg-IAMCG, "Complete Sequence of Bacteriophage Lambda").

0I The sequence of nuB produced by recombinution of wild type attL and attR sites is: attlwt: 5' AGCCT GrrkhTACn& CTfl 3' (SEQ. ID C~M: 31) 3' TOGA C AAAfh&= fl= GA&CT The to dons are italicized and rmderline& Note that sequences of tt.attR.

and aftP can be derived from the attB sequence and the boundaries of bacteriophge A contained within attL and attR (coordinates 27619 to 27818).

When mtant attRl and attLl sites were recombined the sequence attBI was produed (mutations in bold, large font): S a 3* att8l: 5' ArccT =rr~r G wCA AA cnrrT 3 (SE. TD NQ 6) 31 TCOQ co CnTrr oncA s, Note that the four stop codons are gone.

When an additional mutation was introduced in the attRA and attLl sequences (bold), aftR2 and attL2 sites resulted. Recombination of atR2 and attL2 produced the attB2 site: B 0 3 attE2z 5' ASCC? 3cTrfTT TACAAA CTTGT 3' (SEQ. ID SIOO) 3' OGk ceAAGr GAACA S' The recombination activities of the above attL and attR sites ware assayed as follows. The sUlB site of pasnid pEZC705 (Figure 2B) was replaced with COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13-Dec. 2007 15:54 13.Dec 200715:54 BALDWJNS 6064 4 4136712 N.71 P No-6721 P. 45/50 attLw, atLI, or attL-2, The attP site of plasinid pEZC72G (Figure 2C) was replaced with attRwz (lacdg regions Pi and attRl, or attR2 Thus, the rsudng plasmids could recombine ia thei loiP sit, mediated by Cre, and via their attR, and attL site, mediated by Int, nl, and IH. Pairs of plasmids were mixed and reacted with Cre, hIt Ms, and WE, krzsffbrmed into A- oilcompetent cells, and plated on agar containing kanamyci. The results are presented in Table 3± Table 3 Vecto donor mU site Gente donor alt ute #f of kmnycin resistant colouieu,* uftRwt (pEZCI3Ol) Non. 1 (bacgroud) attfwt (pEZ 1313) 147 attLl (pEZC13l7) 47 a nUl pZClJ 21) 0 aftKI (p=W1305) None 1 (background) attLwt 0=Z 1313) 4 aal (pEZC1JI7) 121 *a at~(pEZCI32I) a aft-l (pEZ13O9) None 9 (background) NAttLwt.(pEZCX3I3) 0 II ttL fjEZC13I7) 0 tU~ (pEZCI132I0 209 of each tansfonnation was spread on a kanamycin plate.) The above data show that whereas the wild type att and atti sites recombine to a small extent, the aft! and att2 sites do not recombine deaably with each other.

Pant IlL Recombinaton was demonstated When th core region of both sUB sites flanking the DNA segment of interest did not contain stop cbdont The physical state of the participating plasmnids was discovered to influence recomnbination efficiency.

The appropriate aft sites were moved into pEZC75 and pEZC7Z6 to make the plasreids pEZCI4OS (Figure 5G) (atali and atR 2) and pEZClSO2 (Figure Sf (aLl and af±L2). The desired DNA segmn~t in this experiment was a copy of the chioramphenicol resistance gene cloned betwee the two attL sites COMS ID No: ARCS-i 72228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec. 2007 15:54 BALDWINS 0064 4 4736712 No.6721 P. 46/50 o -41- 0 N of pEZC1502. Pairs of plasmids were recombined in vitro using Int, Xis, and IHF(no Cr becaus no loxP sites w present). The yield of desired kanamnycin resistant colonies was detennrm ined when both parental plasmids were circular, or M when one plasmid was circular and the other linear as presented in Table 4: Table 4 Vector donor Gene donor' Kanamycin resistant colonies Circular pEZC1405 None Circular pEZCl405 Circular pEZC1502 2680 Linear pEZC1405 None Linear pEZC1405 Circular pEZCISO02 172000 CircularpEZCI405 Linear pEZC1502 73000 I DNAs were purified with Qiagen columns, concentrations determined by A260, and linearized with Xba I (pEZC1405) or AlwN I (pEZC1502). Each reaction contained 100 ng of the indicated DNA. All reactions (10 pl total) contained 3 1I of azyme mix (Xis, In and HIF). After incubation (45 minutes at 25*, 10 minutes at one p] was used to tmasformnn E. colh DHS5 cells.

'Number of colonies expected if the entire trnsformation reaction (1 ml) had been plated. Either 100 pl or 1 pl ofthe transformations were actually plated.

Analysis Reombinational cloning using mutant attR and attL sites was confirmed. The desired DNA segment is subeloned between attB sites that do not contain any stop codons in either strand. The enhanced yield of Product DNA (when one parent was linear) was unexpected because of earlier observations that the excision reaction was more efficient when both participating molecules were supereofled and proteins were limiting (Nunes-Duby et al, Cell 50.779-788 (1987).

Examnple 4: Denwmonstration of Recombinational Cloning Without Inverted Repeats Part I Rationale The above Example 3 showed that plasmids containing inverted repeats of the approipriate recombination sites (for example, attL1 and attL2 in plasmid pEZC1502) (Figure SH) could recombine to give the desired DNA segment COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec. 2001 15:54 BAIDWINS 6064 4 4136112 No.6721 P. 41150 o -42 (N flan~~Rked by iftB sntes withiout stop COdOJI, also iniverted orientaioL Acoer was the in vivo and in vitro influence of the inverted repeat. For example, 0 transcription of a desird DNA segment flanked by atD sites in inverted Ct orientaion could yield a single stiunded RNA molecule that might fb= a hairpin structure thereby inhibiting translaton.

Inverted orientation of similar recombination sites can be avoided by placing the sites in direct repeat frirngement an stesIf Wparetai plasiks each hav a wild type attL and wild type attR site, in direct repeat the tt mls, ad 1W proteins will simply remove the DNA segment flanked by those sites in ani intramolecl~xar reation. However, the mutlant sites deibed in the above o Example 3 suggested that it migh be possible to inhibit the intrmoeCular reactin while allowing the intennolecular recombination to proceed as desired.

The attR2 sequence in plasmid pEZCl4OS (Figure: 50) was replaced with attL2. in the opposite orientation, to make pEZC 1603 (Figure 6A). The attL2 sequence of pEZCI5O2 (Figure 5H1) was replced with uttR2, in the opposite orietation, to make pEWC 1706 (Figure 6B). Each of these plasmids contained mutations in the core region that make. intramolecular reactions between ad! and att2 cores vetY inefficient (see Example 3, above).

PlAsraids pEZCI4OS. pEZC 1502, pEZCI6O3 and pEZCI7O6 were purifed onQiaSenlcoluns(Qiagen, Aliquotsof plasruids pEZCl 603 wer linearized with Xba 1. AliquOof plsmds pEZC 1502 and pEZOI 706 were linearized with AlwN I. One hundred ng of pl~swids were mindin bUfr (equzdvoumo 0 mM ris HCI pH 75,5 M rtsHC l 70 mM 10, 5 mM speruzidine, 03: mM ESDTA, 250j1tglrn BSA, glycerol) containing Tnt (43.5 ig), 30s (4.3 ng) and IHF (8.1 ng) in a final volumne of 10 di. Reactions were incubated for 45 minutes at 25c, 10 minutes at 65 C, and I PIl was Umasformed into K coi DRkz After expression, aliquots were spread on agar plates containin 200 49g/ml kanamnycin and incubated at 370C.

COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec. 2007 15:55 BALDWINS 0064 4 4736712 No,6721 P. 48/50 -43- Results, expressed as the number of colonies per 1 pl of recombination reaction are presented in Table Table Vector Donor Gene Donor Colonies Predicted product Circular 1405 100 Circular 1405 Circular 1502 3740 3640/3740= 97% Linear 1405 Linear 1405 Circular 1502 172,000 171,910/172,000 =99.9% Circular 1405 Linear 1502 73,000 72,900/73,000 99.9% Circular 1603 Circular 1603 Circular 1706 410 330/410 Linear 1603 270 Linear 1603 Circular 1706 7000 6730/7000 96% Circular 1603 Linear 1706 10,800 10,530/10,800 =97% Analysi. In all configurations, circular or linear, the pEZCl405 x pEZC1502 pair (with att sites in inverted repeat configuration) was more efficient than pEZC1603 x pEZC1706 pair (with att sites mutated to avoid hairpin formation). The pEZC1603 x pEZCI706 pair gave higher backgrounds and lower efficiencies than the pEZC1405 x pEZC1502 pair. While less efficient, or more of the colonies from the pEZC1603 x pEZC1706 reactions were expected to contain the desired plasmid product. Making one partner linear stimulated the reactions in all cases.

Part i: Confrmation ofProduct Plasmnds'Structure Six colonies each from the linear pEZC1405 (Figure 5G) x circular pEZC1502 (Figure 5H), circular pEZC1405 x linear pEZC1502, linear pEZC1603 (Figure 6A) x circular pEZCI706 (Figure 6B), and circular pEZC1603 x linear pEZCI706 reactions were picked into rich medium and COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec. 2007 15:55 BALDWINS 0064 4 4736712 No.6721 P. 49/50 -44- 0 miniprep DNAs were prepared. Diagnostic cuts with Ssp I gave the predicted O restriction fragments for all 24 colonies.

0 Anabyi. Recombination reactions between plasmids with mutant attL M and attR sites n the same molecules gave the desired plasmid products with a high degree of specificity.

Example S Recombinaional Cloning with a Txic Gene Pantl: Backgroand 0 O Restriction enzyme Dpn I recognizes the sequence GATC and tSM that sequence only if the A is methylated by the dam methylase. Most commonly used E colt strains are dam. Expression of Dpn I in dam' strains of .p coli is lethal because the chromosome of the cell is chopped into many pieces.

However, in daw- cells expression of Dpn I is innocuous because the chromosome is immune to Dpn I cutting.

In the general recambinational cloning scheme, in which the vector donor contains two segments C and D separated by recombination sites, selection for the desired product depends upon selection for the presence of segment D, and the absence of segment C. In the original Example segment D contained a drug vsistance gene (Kim) that was negatively cntrolled by a repressor gene found on segment C. When C was present, cells containing D were not resistant to kanamycin because the resistance gene was turned off.

The Dpn I gene is an example of a toxic gene that can replace the repressor gene of the.above embodiment If segment C exprbsses the DpnI gene product, transforming plasmid CD into a dam+ host kills the cell. Ifsegment D is transffered to a new plasmid, for example by recombinational cloning, then selecting for the drug marker will be successful because the txi gne is no longer present COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec. 2007 15:55 BALDWINS 0064 4 4736712 No.6721 P. 50/50 0 Ci Part H: Construction of a Vector Donor Using Dpn I as a Toic Gene SThe gene encoding Dpn I endonuclease was amplified by PCR using Me1 primers 5'CCA CCA CAA ACG CGT CCA TGG AAT TAC ACT TTA ATT TAG3' (SEQ. ID NO: 17) and 5'CCA CCA CAA GTC GAC OCA TGC CGA CAG CCT TCC AAA TGT3' (SQ. IDNO: 8 and aplasmid containing the Dpn I gene (derived from plasmids obtained from Sanford A. Lacks, Brookhaven Ci National Laboratory, Upton, New York; also available from American Type Ci Culture Collection as ATCC 67494) as the template.

o Additional mutations were introduced into the B and B' regions of attL att, respectively, by amplifying eisting attt and aR domains withprims containing the desired base changes. Recombination of the mutant attL3 (made with oligo Xis1 15) and attR3 (made with oligo Xis 12) yielded attB3 with the following sequence (differences from attBl in bold): B 0 B' ACCCA GCTTTCTG TACAAA OTGGT (SEQ. ID NO; 8) TGGCT CGAAGAACATGTTT CACCA The attL3 sequence was cloned in place of anL2 of an existing Gene Donor plasmid to give the plasmid pEZC2901 (Figure 7A). The attR3 sequence was cloned in place of attR2 in an existing Vector Donor plasmid to give plasmid pEZC2913 (Figure 7B) Dpn I gene was cloned into plasmidpEZC2913 to replace the tet repressor gene. The resulting Vector Donor plasmid was named pEZC3101 (Figure 7C). When pEZC3101 was transformed into the dam- strain SCS110 (Stratagene), hundreds ofcolonies resulted. When the same plasmid was transformed into the dam+ strain DHSc, only one colony was produced, even though the DH5a cells were about 20 fold more competent than the SCSI cells. When a related plasmid that did not contain the Dpn I gene was transformed into the same two cell lines, 28 colonies were produced from the SCSI 10 cells, while 448 colonies resulted from the DH5m cells. This is evidence COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec. 2007 15:55 BALDWINS 0064 4 4736712 No.6724 P. 2/51 -46- 0 that the Dpn I gene is being expressed on plasmid pEZC3101 (Figure 7C), and o that it is killing the dan DH5a cells but not the dam7 SCSI 10 cells.

C)

CM Part lk: Demonstration ofRecombinaonal Cloning Using Dpi I Selection A pair of plasmids was used to demonstrate recombinational cloning with selection for product dependent upon the toxic gene Dpn I. Plasmid pEZC3101 Ci (Figure 7C) was linearized with Mlu I and reacted with circular plasmid Ci pEZC2901 (Figwe 7A). A second pair of plasmids using selection based on control of drug resistance by a repressor gene was used as a control: plasmid pEZC1802 (Figure 7D) was linearized with Xba I and reacted with circular plasmid pEZC1502 (Figure S9). Eight miacoliter reactions containing the same buffer and proteins Xis, Int, and IF as in previous examples were incubated for minutes at 25 C, then 10 minutes at 75 C, and 1i 1 aliquots were transformed into DH5a dam+) competent cells, as presented in Table 6.

Tabe 6 Raction Vector donor Basis of selection Gene donor Colonies 1 pEZC31OIMlu Dpn [toxicity 3 2 pEZC 3101MIu Dpn I txicity Circular pEZO901 4000 3 pEZC1802/Xba Totrepresor 0 4 p jZCl802/Xba Tot represor Circular pEZC1502 12100 Mfiniprep DNAs were prepared from four colonies from reaction and cut with restriction enzyme Sp I. All gave the predicted fragments.

Analtysis: Subcloning using selection with -a toxic gene was demonstrated. Plasmids of the predicted structure were produced.

COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec. 2007 15:56 BALDWINS 0064 4 4736712 No.6724 P. 3/51 -47- 0 C Erample 6: Cloning of Genes wih Uraci DNA Glycosylase ad Sabeloning of the Genes with Recombinaronal Coning to Make Fusion Proteins Part I: Converting an Erinbng Epression Vector to a Vector Donor for zRecnmbinationa Cloning A cassette useful for converting existing vectors into functional Vector Donors was made asfallowt Plasmid pEZC3 103 (Figure 70) was digested with Apa I and Kpn I, teated with T4 DNA polymerase and dNTPs to render the ends blunt, further digested with Sma I, Hpa I, and AiwN I to render the undesirable o DNA fragments small, and the 26 kb cassette containng the attRl Cm Dpn I Ci 10 attR-3 domains was gel purified. The concenatilon of the purified cassette was estimated to be about 75 ng DNA/pl.

Plasmid pGEK-2TK (Figure SA) (Pharmacia) allows fusions between the protein glutathione S transferase and any second coding sequence that can be inserted in its multiple cloning site. pGEX-2TK DNA was digested with Sma I and teated with alkaline pbosphatase. About 75 ng ofthe above purified DNA cassette was ligated with about 100 ng of the pGEX-2TK vector for 2.5 hours in a 5 p ligation, then I pl was transformed into competent BRL 3056 cells (a dazw derivative of DHIOB; danr strains commercially available include DM1 from Life Technologies, Inc, and SCS 110 from Stratagene). Aliquots of the transformation mixture were plated on LB agar containing 100 igmil ampicillin (resistance gene present on pGEX-2TK) and 30 pg/mi chloramphenicol (resistance gene present on the DNA cassette). Colonies were picked and miniprep DNAs were made. The orientation of the cassette in pGEX-2TK was determined by diagnostic cuts with EcoR L A plasmid with the desired orientation was named pEZC3501 (Figure SB).

COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec. 2007 15:56 BALDWINS 0064 4 4736712 No.6724 P. 4/51 -48- 0 Part A Coning Reporter Genesr Into an Recobinational Cloning Gene Donor Plarmid in Three Reading Frames Uracil DNA glycosylase (UDG) cloning is a method for cloning PCR aplification products into cloning vectors patent No. 5,334,515, entirely incorporated herein by reference). Briefly, PCR amplification of the desired DNA segment is performed with primers that contain uacil bases in place of thymidine bases in their ends. When such PCR products are incubated with the enzyme UDG, the muracil bases are specifically removed. The loss of these bases weakens base pairing in the ends ofthe PCR product DNA, and when incubated at a suitable temperature 37C), the ends of such products are largely single stranded. If such incubations are done in the presence of linear cloning vectors containing protruding 3' tails that are complementary to the 3' ends of the PCR products, base pairing efficiently anneals the PCR products to the cloning vector.

When the annealed product is introduced into coli cells by transformation, in vivo processes efficiently convert it into a recombinant plasmid.

UDO cloning vectors that enable cloning of any PCR product in all three reading frames were prepared from pEZC3201 (Figur K) as follows. Eight oliganucleotides were obtained from Life Technologies, Inc. (all written 5' 3': rfl top (GGCC GAT TAC GAT ATC CCA ACO ACC GAA AAC CTG TAT TIT CAG GGT) (SEQ. ID NO:19), rfl bottom (CAG oTT TTC GOT COT TGG GAT ATC OTA ATCX)(SEQ. ID NO:20), rf2 top (GGCCA GAT TAC GAT ATC CCA ACG ACC GAA AAC CTG TAT TTT CAG GGT)(SEQ. ID NO:21). rf2 bottom (CAG GTT TTC GOT COT TOO GAT ATC GTA ATC T)(SEQ. ID NO:22), rf3 top (GGCCAA GAT TAC OAT ATC CCA ACG ACC GAA AAC CTG TAT TTT CAG GGT)(SEQ. ID NO:23, rf3 bottom (CAG GTT TITC GT COT TOG GAT ATC GTA ATC TI)(SEQ. ID NO:24), carboxy top (ACC GTT TAC GTO GACXSEQ. ID NO:25) and carboxy bottom (TCOA OTC CAC GTA AAC GGT TCC CAC TTA TTAX(SEQ. ID NO26). The rfl, 2, and 3 top strands and the carboxy bottom strand were phoSphorylated on their 5' ends with T4 polynucleotide kinase, and then the complementary strands of each pair were hybridized. Plasmid pEZC3201 COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec. 2007 15:56 BALDWINS 0064 4 4736712 No.6724 P. 5/51 o -49-

O

(Figure 8K) was out with Not I and Sal 1, and aliquots of cut plasmid were mixed U with the carboxy-oligo duplex (Sal I and) and either the rfl, rf2,or rf3 duplexes (Not I ends) (10 pg cut plasmid (about 5 pmol) mixed with 250 pmol carboxy oligo duplex, split into three 20 p1 volumes, added 5 pI (250 pmol) ofrfl, rf2, or rf3 duplex and 2 p1l 2 units T4 DNA ligase to each reaction). After 90 minutes of ligation at room temperature, each reaction was applied to a preparative agarose gel and the 2.1 kb vector bands were tluted and dissolved in 50 p! of TE.

Ci Part M: PCR of CAT and phaA Genes Primers were obtained from Life Technologies, Inc., to amplif* the chlorampenicol acetyl transferase (CAT) gene from plasmid pACYCI 84, and phoA, the alkaline phosphatase gene from K coli. The primers had 12-base extensions containing wacil bases, so that treatment of PCR products with uracil UNA glycosylase (UDG) would weaken base pairing at each end of the DNAs and allow the 3' stands to anneal with theproiruding 3' ends of the rfl, 2, and 3 vectors described above. The sequences of the primers (all written 5' 3) were: CAT left, UAU UUU CAG GGU ATG GAG AAA AAA ATC ACT GGA TAT ACC (SEQ. ID N027); CAT right, UCC CAC UUA JUA CGC CCC GCC CTO CCA CTC ATC (SEQ. IDNO:28); pheA left, UAU UUU CAG GCiU ATG CCT GTT CTG GAAAAC COO (SEQ. ID NO29); and phoA righ4 UCC CAC UUA UUA TTT CAG CCC CAG GGC CGC TIT C (SEQ. ID The primers were then used for PCR reactions using known method steps (see, U.S. patent No. 5,334,515, entirely incorporated herein by reference), and the polymerase chain reaction amplification products obtained with these primers comprised the CAT or phoA genes with the initiating ATGs but Yithout any transcriptional signals. In addition, the uracil-containing sequences on the amino termini encoded the cleavage site for TEV protease (Life Technologies, Ic), and those on the carboxy tenninal encoded consecutive TAA nonsense codons.

Unpurified PCR products (about 30 ng) were mixed with the gel purified, linear rfl, rf2. or f3 cloning vectors (about 50 ng) in a 10 p1 reaction containing lX REact 4 buffer (LTI) and I unit UDG (LTI). After 30 minutes at 37-C, 1 p1 COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec. 2001 15:51 BALDWINS 0064 4 4736112 No.6724 P. 6/51 0~ aliquots of each reamtion were tansformed into competent t col DHSa cells o (ZL) and plated on ag ontaining 50 g/zn knammycin. Colonies were picked and aalysis of miniprep DNA showed that the CAT gene had been cloned In reading frame 1 (pEZC36I)(Figure SC), reading fram 2 (pEZC3609)(Figure SD) and reading frame 3 (pEZC361 XFigure SEX and that the phoA gene had been cloned in reading flame 1 (pEZC36OG)Figre SF) reading frame 2 (pEZC36l3XFigue 80) and reading frame 3 (pEC3621)(Figure SM1).

Part Ifl Subdonag of CAT arpIfrovm UDG loning Vectrs into a GST Felon Vector Ci 10 Fauids encoding fuions between OST and either CAT or phoA in all three reading fames were consucted by recombinational cloning as follows.

Miniprep DNA of GST vector donor pEZC3SOl(Figure SB) (derived from Pharmacia plasmid pOEX-2T1 as described above) was linearized with Cia 1.

About 5 ng of vector donor were mixed with abot 10 ng each of the appropriate circular gene donor vctors containing CAT orphoA in S II reactions containing buffer end recombination proteins Tlt Xis, and IHF (above). Afer incubation, 1 p1 of each reaction was transformed into col strin DUSts and plated on ampicillin, as presented in Table 7.

Table 7 DNA Colonies (10% of each tansrmntt ion) Linear vector donor (pEZC350 1/Cia) 0 Vectordonor+CAT rf 110 Vector donor+ CAT rf 71 Vectordonor+CATr3 148 Veordonor+ phoA rfl 121 Vectordo+phaArf 128 Vectordonor+pboAr 3 31 COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec. 2007 15:57 BALDWINS 0064 4 4736712 No.6724 P. 7/51 0 -51-

O

"1 Part V Expression of Fusion Proteins 0 Two colonies from each transformation were picked into 2 ml of rich Cn medium (Circlerow, BiolOl Inc.) in 17 x 100 mm plastic tubes (Falcon 2059, Becton Dickinson) containing 100 g/hml ampicllin and shaken vigorously for about 4 hours at 37C, at whichtime the cltures were visibly turbid. One ml of each cultue was transfered to a new tube containing 10 pl of 10% IPTG N to induce expression ofGST. Aftr 2 hours additional incubation, all cultures had (N about the same turbidity; the A600 of one culture was 1.5. Cells from 0.35 mI o each culture were harvested and treated with sample buffer (cotaining SDS and p-mercaptoethanol) and aliquots equivalent to about 0.15 A600 units of cells were applied to a Novex 4-20% gradient polyacrylamide gel. Following electrophoresis the gel was stained with Coomassie blue.

Ruesul Enhanced expression of single protein bands was seen for all 12 cultures. The observed sizes of these proteins correlated well with the sizes predicted for GST being fused (through attB recombination sites without stop codons) to CAT or phoA in three reading frames: CAT rfl 269 amino acids; CAT rf2 303 amino acids; CAT rf3 478 amino acids; phoA rfl 282 amino acids; phoA rf2 280 amino acids; and phoA rf3 705 amino acids.

Analyis: Both CAT and phoA genes were subcloned into a GST fusion vector in all three reading frames, and expression of the six fusion proteins was demonstrated While the foregoing invention has been described in some detail for purposes of clarity and udrsandig, it will be appreciated by one skilled in the art from a reading of this disclosure that various changes in form and detail can be made without departing from the true scope of the invention and appended claims. All patents and publications cited herein are entirely incorporated herein by reference.

COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.ec. 2007 15:57 BALOWINS 0064 4 4736712 No.6724 P. 8/51 Cl nquENCE LISTING 0 GENERAL INFoRMATION: APPLICANT: Life TechnolOqics,LDMC: Gaithlersburg. M' 20004-9980 united states of America AppLICAlTffqVRNTORS: artley, James L.

Cl Brauch, Michael A.

Cl(ii) TITLE OF INVENTION-- Recombiflat tonal clonuing Usng Engineered Recomubination Sites o(i L t) NUTMBER OF SEQUENCES: 331 (iv) CORRESPONDENCE

ADDRESS.

ADDPLESSEE: STERNlE, KEssLER, GOLDSTEIN Ce FOX, P.L.L.C STREET: 1100 New York Ave., N. W. Suite 600 CITY: Washington STATE: DC COUNTR.Y: USA ZIP: 20005-3934 COMPUTR READABLE FORM: MEDIUM TYPE: Floppy dis)c COMPTER.: IBM PC compatible OPERATING SYSTEM: SOFTWARE: Patentln ReleaSe version #1.30 (v)CURfRENT APPLICATION

DATA:

APPLICATION NUMBER: Pa/IUs96/10082 FILING DATE' 07-jUN-1996

CLASSIFICATION!

(ix) TELEOCb4UNICATION INrOQRM6ATIONT: TELSPHONE: 202-371-2600 TELEFAX: 202-371-2540 INFORMATION FOR SEQ Ifl NO:1; (i SEQUENCE. CHARACTERISTICS- LENGTH: 25 base pairs TYPE: nucleic acid STRANDEDNESS: both TOPOLOGY: both Iii) M4OLECUL7~E TYPE: eDmA COMS ID No: ARCS-172228 Received by IP3 Australia: Time 14:20 Date 2007-12-13 13-Dec. 2001 15:51 BALOWINS 0064 4 4736112 No.6124 P. 9/51 o (xi) SEQUENCE DESCRIPTIQN; SEQ ID 1O:20 0 PXcwG3CfT YrIMTACINA S'rSGD INFORMATION FOR SEQ ID 9Ot2: SEQUCE CKAflCTERZSTICS1 LENGTH- 2S base pairs TYPE. nucleic acid STRANDEDNES. both TOLtK]Y: both (ii) MOLECULE TYPE: cDNA (Xi) SrQUENCE DESCIPTIONT; SEQ 1tDN 102 pGCCWIGCVTT yKTRTAtNAAL CTSGB TLFl4RATION 1FOR SEQ ID NO! 3 (SSEQUEN;CE CIIAtACTERIS TICS: LENGTH: 25 banf puirfl TYPE:- nucleic acid STRAHDEDNBSS:. both TOPOLOG3Y: both (ii) MOLECULE TYPE., aDNA (xi) sEQUKUCE D)ESCRIPTION. SEQ II) NO: 3 QTTCAGCTT CtTRTACINhA CTSGB INFORtMATION 4 FOR SEQ 'n NO:4: SEQUENCE

CHARACTRISTICS:

LENGTH 2S base pairS TYPE: nucleic acid STEMIDMEDWEsSS- both TOPOL~OGY; both ii) MOLECULE TYPE; CMi4 (xi) SEQUENCE DESCRIPTION: SE.Q ID NO: Aq,(~WGCTfl CITRTACNAA GTSGS 2 COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec. 2007 15:57 BALDW[NS 0964 4 4736712 No.6724 P. 10/51 o -5 13- INFRMATION FOR SEQ I11N: sEQuE9cE o Anan-ZISICS: 0 LENGTH: 25 base pairs rn TYPE! nuacleic acid sTRAW9DMLS both TOPOLOGY: both (ii) MOLECULE TYPE: cDNA ci (xi) SEQUENCE D)ESCRIPTIOt SEQ ID 140:5: o G2TCA.CTTT YKTRTACNAA GTSGB INFORMAXTION VOl SEQ ID NO'S: (W SEQUENCE CHARhCTERISTICS: LEGTgH! 2S barse pairs T Yl: miol-eic acid sTRAMEflSS: both TOPOLOGY. both (i)MOLECULE TYPE: oDM (xi) SEQUENCE DESCRIPTION: SEQ ID 140:6: AGC-CTGCTrT TTTGTACAAA INFOOMXTION FOR SEQ ID 110:7: Wi SEQUENCE CHARACTEISTICS: LEN§?H: 25 base pairs TYPE: nucleic acitd STRANDRUNSS: both TOPOLOGY: both (ii) M4OLECULE TYPE: CRM (xi) SaQUECE DESCRIPTION: S3Q ID NO±:7: AGCCTGCTT CTTOTACAAA CTC INFORMATION ?OR SEQ ED NO:S: Wi SEQUENCE CHARACTERISTICS; LENGTH: 23 base pairs COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec. 2607 15:58 BALDWJNS 6064 4 4736712 No.6724 P. 11/51 CM) TYPE: nucleic acid U f C) STRMA=t1ES! both 0 TOPOLOGY: both CC) (ii) MOLECUL TYPE: -DIIA (xi) SEQUENCE DESCRIPTION; SEQ ID o1:S: Cl ACCCAGCTT CTGTACAPAt CTTUT Cl rNFO2IATIOX FOR SEQ ID 110:9" O smouw=c cKAPACTERISTICS: (A 1 Nfl: 25 base pairs Cl TypE: nUCleic acid STRAMED~fss. both 0r) TopoLOGY; both (iMOLJECULE TYPE: eDNA (xi) SEQUENCE DESCRIP3TION: SEQ ID NOiS:- GTDCAQCTTT TT=TACAAA CTTGT INpORjMflO FOR SEQ ID NO0:,~: SEQUENO!g CxARACTERISTICS.

.EIGTK: 25 base pairs TYPE nucleic acid ST-ANDZDNESS both ToPoLOGYtboth (ii) MOLECULE TYPE: cDNA (xi) SEQUENOS DESCRIPTION: SEQ ID V10210: QTTCAGCT17 CTIGTACAAA CTTGT 2 iWmVOfTION FOR SEQ ID 14O:11; sEQUENCE CHAPACTERXSTICS: LENGTH; 25 b&50 Pairs TYPE; nucleic acid STRANDUDNESS±- both TOPOLOGY; both COMS ID No: ARCS-i 72228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec. 2007 15:58 BALDWINS 0064 4 4736112 No.6724 P. 12/51 o iii) MOLECrJLI TYPE: cfla

C)

(xi) SEQUENCE DESCRIPTION; SEQ ID NO:1; GTTCAcTrI,1 CTTGTACAA.A QflGG INpVRMNTION FOR SEQ ID M3:-2: cl SEQUENCE

CARACTERISTICS:

LENGTH: 25 bass pairs TYPE: nucleic acid flRplDEa=SS: both TOPOLOGY: both (ii) MOLECULE TYPE: oDNA (xi) SQUENCE DESCRIPTION; SEQ ID NO,:12, AGCCTGCTTT TTTGTACAAA GTTGG INPORMATZON. FOR SEQ ID 0:13: SEQUENCE

CNAIACI'ERISTICS!

LENGTH: 25 base pairs TYPE: nucleic acid STRAMiEDNESB both TOPOLOGY: both (ii) 14LEZLE TYPE. Oflfl (xi) SEQUIENC DESCRIPTION: SEQ ID NO: 13: ACCTGCTTT CTTGTACAAA GTYGG INFORMATIDN FOR SEQ ID.WO:.4: SEQUENCE

CHARACTSRISTICS;

LENGTH: 25 bass pairs TYPE! nucleic acid STRANDSpNESS: both TOPOLOGY: both (ii) MOLECULE TYPE: cottA COMS ID No: ARCS-i72228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Deo. 2007 15:58 BALOWENS 0064 4 4736712 No.6724 P. 13/51 o(xi) SnQUENCE DZSCflPTION* SEQ ID M 0:14: ACCCAGCTTT CTTGTACA GTTG2 tNPORNATI0N FOR SEQ ID NO: SEQUENCE CHARAkCTERISTICS: LENGTH: 25 base pairs TYPE; nucleic acid STRAMWESS: both TOPOLOGY: both (ii) MOLECULE TYPE; CDNA (xi) SEQ7ENCE IDESCRIPTION: SEQ ID NO:LS;' G-TCAGCTfl TTL'GTACAALA OTTO 2S INFRMATION FOR SEQ ID NQ:1S: (ii SEQUENaCE CifRACTERISTICS: LENGTH:. 25 base pairs TYPE: nucleic acid STRANDEDNSS: both TOPOLOGY: both (ii) MOLECUE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID 14:16; QTTCAGCTTT CTEGTACAAA OTTOG 2S INFORMATION FOR SEQ =D 14017: SEQUENCE CHUAATRISTICS:.

LENGTH: 39 base pairs TYPE: nucleic acid CC) STRANDEDNESS:, both TOPOLOGY; both (ii) MOLECULE TYPE: eDNA (xi) SEQUE.NCE DESCRIPTION: SEQ 113 140:17:t*ACCACAAA COCGTCCATG GAATTACAC-T TTAATTTAG 39 COMS ID No: ARCS-i 72228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec. 2007 15:58 BALOWINS 0064 4 4736712 No.6724 P. 14/51 INFORMATION FOR SEQ ID liO:i8; SEQUENCE CHARACTEISTICS:- 0 LENGTH- 39 base pa-irs TYPE: nucleic acid STRA24DEDflSS: both TOPOLOGY; both (iMOLECULE TYPE: oDNA C(xi) SEQUENCE DESCRIPTrIONt SWQ ID NO:1R: oCCACCACAAG TCGACGJCATG CCGACAGCCT TCCAAA#rGT 39 INFORMATION FVYR SEQ ID NO.-19. SEQUENCE CHARACTERISTICS- LENGTH 46 base pairs WB TYPE. nmucleic acid STRA1IEDNESS: both TOPOLOGY! both (iMOLECUE TYPE: aDNA NOi SEQUENCE DESCRIPTION: SEQ ID NQ.t19: GGCCG-ATTAC GATATCCCAA CO;ACOGAXLA CCTGTATT"P CAGUST 46 INFORMTION FOR SEQ ID SEQUENCE CHARACTERISTICS, LENGTH; 30 base pairs TYPE: nucleic acid STfliNDEfNESS. both TOPOLOGY: both (ii) MOLECULE TYPE: CDNA (X0) SEQUENCE DESCRIPTION: SEQ ID CAGGTTTTCG GTCGTTGGGA TATCOTAATC InFORM4ATION FOR SEQ TD NO.2I: Mi SEQUENCE CHLARACTER ISfl CS: WA LENGTH: base pairs COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Deo. 2067 15:58 BALDWLNS 0064 4 4736712 No.6724 P. 15/51 o TyPEI± nucleic acid C) TC) STflEMEDflSS! both 0 TOPOLOGY both Cr) (ii) MOLECULE TYPIR t oDXX (xi) SrLQUENCE DESCRIPTIONI: SEQ 1ID NO:21: CGCCAGATTA CGATATCCA AC;ACQA.AA ACCTGTAVTT TCAGGGT 47 INFORMATION FOR SEQ ID, NO: 22: o SEQUENCE CVJRACTflISTICS: o LENGTH! 31 base pairs TYPE; nucleic acid SThAIIDEDNESS: both TOPOLOGY: both MOLECULE TYPE:- cx)SA (xi) SEQUENCE DESCRIPTION: SEQ ID 11:22: CAGVI'TTCGr GTCGTTGGGA TA.TCGTAATC T 31.

INFORMLATZOK FOR SEQ TD NO:23! SEQUENCE CEACTEflSTICS: LEW=T: 43 base pairs TYPE: nucleic acid BTR-ANDDNESSi both TOPOLOGY: both (ii) MOLECULE TYPE:- c33NA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:23 t GGCCAAGATT ACGATATCCC AACGACCGAA AACCTGTATT 11CA000? 48 INFORMATION FORL SEQ TD N#O: 2 4: SEQUENCE CHARACTERISTICS: LENGTH: 32 bane pairs TYPE: nucleic acid STRAIDDESS: both TOPOLOGY: both COMB ID No: ARCS-i 72228 Received by IP Australia: lime 14:20 Date 2007-12-13 13.0ecv 2607 15:58 BALOWINS 6064 4 4736712 No.6724 P. 16/51 o -51.9o (ii) MOLECULE TYPEt cDNA (xi) SEQUENCE DESCRIPTION: SBQ ID NO:24: CAGGTTTFCG GTCG3TTGOGL TATCGTAATC TT 32 INFOR.MATION FOR SEQ -ID Cl Ci.) SEQUENCE CHARACTERISTICS- Cl LENGTH: 1.5 base pairs (W TYPE: Dueic acid o STRANDEDNESS: both o (fl)TOPOLOGY: both Cl(1±) MOLECULE TYPE: CDNA (xi) SEQUENCE DESCRIPTION: SEQ TD ACCQTflACG TOGAC INFORMATION FOR SEQ It) NO:,26: (ii SEQUENCE CHARACTERISTIC$: LENGTH! 31- base pairs TYPE: nucleic acid STPAMEDNESS: both TOPOLOGY: both (ajii"vIDZCUtH TYPE: oDKA (xi) SZQUENCE DRESCRIPTION: SEQ ID NO:26:.

TCGAGTCCAC GTAAACGGTT CCCACTATT A 3L INFORMATION FOR SEQ ID NO:27r SEQUENCE CHAACTERISTICS! LENGTH: 39 base pairs TYPE: nucleic acid STRAIIDEDNESS: both TOPOLOGY: both (ii) MOLECULE TYPE: CDNA COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec. 2007 15:58 BALOWINS 0064 4 4736712 No.6724 P. 17/51 U(xi) SEQt]NcE DECIPIN SEQ ID NO0:27: 0UAUDUUCAG CUATGQAOAA AAAAA.TCACT GGATATACC 39 INYORmATioK FOR SEQ ID 90!29: ()SEQUEIICE CHARACTERISTICS, LENOTU:- 33 base pa-irs TYPE: nucleic acid STRANDEpNI3S8: both TOPOLOGY: both (1i) MOLECUL TYPE; CL)NA Cl (Xi) SEQUENCE DESCRIPTION,~ SEQ I0 N10:29; UCCCACEUAU- UACGCCCCOC CCTGCCACTC ATC 33 INFOyM2PLTION FOR SQ ID NO0:29:.

SEQUEUCE CHARACTERISTICS: LMflff 13 base pairsz TYPE: nucleic acid STRAIWEPNSt both TOPOLOGY: bath (ii) MOLECETLS TYPE: CUNA (xi) SEQUENCE DESCRIPTION. SEQ ID NO.2fl: UAUUUlUCAGG GTXATQCCTGT TCTGGAAAAC 0(34 33 INFORM.TIO# POR. SEQ ID 110:30:- SEQUENCE CHARACTERISTICS- CM LENGTH:- 34 base pairs TYPE' nucleic acid MC STRtANDEDflSS: both TOPOLOGY: both (ii) MOLECULE TYPE: cflA (xi) SEQUENCE fESCRIPTIOI± SEQ ID JC;,CACtUA-U UATI CAOCC CCAGGOCOOC TTTC 34 COMS ID No: ARCS-172228 Received by IP Australia: Time (Him) 14:20 Date 2007-12-13 13.Dec. 2007 15:59 BALDWJNS 0064 4 4736712 No.6724 P. 18/51 INFORMATION FOR SEQ ID HO:J31: Wi SEQUENCS CHARAcTRISTICS: LEN4GTH. 25 base pairs flpE' nucleic acid sTRANDEDUESS: both (Dl) TOPOLOGY: both (ii) MOLECU7LE TYPE., cDNA (Xi) qSQtE=CE DErSCRIpTZON SEQ ID NO:21: AGC=TGCTTT TTCATACTAA CflGA COMS ID No: ARCS-i 72228 Received by IP Australia: Time 14:20 Date 2007-12-13 ]M ec- 2007 15:59 BALDWINS 0064 4 4736712 No.6724 P. 19/51 51.12- Where the terms "comprise", "comprises", "comprised" or "comprising" are used in this specification, they are to be interpreted as specifying the presence of the stated features, integers, steps or components referred to, but not to preclude the presence or addition of one or more other feature, integer, step, component or group thereof.

3111 297GV9634.BPE.1 COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13

Claims (504)

13.Dec. 2007 15:59 BALDWINS 0064 4 4736712 No.6724 P. 20/51

52- SThe claims defining the invention are as follows: 0 SI1. An isolated nucleic acid molecule comprising at least a first art Srecombination site comprising at least one mutation that enhances recombination C 5 specificity. 2. The isolated nucleic acid molecule of claim I, further comprising at least a second recombination site selected from the group consisting of an att site and a lox site. (N C 10 3. A nucleic acid molecule comprising at least a first lox site flanked by at o least one promoter and at least one antibiotic resistance gene. 4. The nucleic acid molecule of claim 3, wherein said lox site is a loxP site. 5. The nucleic acid molecule of claim 3, wherein said lox site is a loxP site and wherein said promoter and said antibiotic resistance gene are operably linked. 6. The nucleic acid molecule of claim 5, wherein said nucleic acid molecule is a vector. 7. A nucleic acid molecule comprising at least one promoter operably linked to at least one antibiotic resistance gene, wherein said promoter and said antibiotic resistance gene are separated by at least one recombination site. 8. The nucleic acid molecule of claim 7, wherein said first recombination site is selected from the group consisting of a lox site, an att site, and mutants thereof. 9. The nucleic acid molecule of claim 7, wherein said first recombination site is a lox site. The nucleic acid molecule of claim 10, wherein said lox site is a loxP site. 11. The nucleic acid molecule of claim 7, wherein said nucleic acid molecule further comprises at least one additional recombination site. 04/07J13,sw I 17?sp.dA ,S2 COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 ]ec- 2007 15:59 BALDWINS 0064 4 4736712 No.6724 P. 21/51 -53- 12. The nucleic acid molecule of claim 11, wherein said at least one additional recombination site is selected from the group consisting of lox sites and att sites. 13. The nucleic acid molecule of claim 11, wherein said at least one additional recombination site is a lox site. 14. The nucleic acid molecule of claim 13, wherein said lox site is a loxP site. 15. The nucleic acid molecule of claim 7, wherein said nucleic acid molecule comprises at least one cloning site. 16. The nucleic acid molecule of claim 7, wherein said nucleic acid molecule is a vector. 17. The nucleic acid molecule of claim 16, wherein said vector is an expression vector. 18. The nucleic acid molecule of claim 7, wherein said antibiotic resistance gene is selected from the group consisting of a chloramphenicol resistance gene, an ampicillin resistance gene, a methicillin resistance gene, a tetracycline resistance gene and a kanamycin resistance gene. 19. The nucleic acid molecule of claim 7, wherein said antibiotic resistance gene is a chloramphenicol resistance gene. A nucleic acid molecule comprising a functional antibiotic resistance gene, wherein a first portion of said antibiotic resistance gene and a second portion of said antibiotic resistance gene are separated by at least a first recombination site. 21. The nucleic acid molecule of claim 20, wherein said first and second portions of said antibiotic resistance gene are operably linked. 04/0710.nwI 1797spaloc,53 COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13-Dec. 2007 15:59 BALDWINS 0064 4 4736712 No.6724 P. 22/51 -54- S22. The nucleic acid molecule of claim 20, wherein said first portion of said O o antibiotic resistance gene is a promoter. O 23. The nucleic acid molecule of claim 20, wherein said first recombination site is selected from the group consisting of a lox site, an att site, and mutants thereof. 24. The nucleic acid molecule of claim 20, wherein said first recombination site _is a lox site. ON 10 25. The nucleic acid molecule of claim 24, wherein said lox site is a loxP site. S26. The nucleic acid molecule of claim 20, wherein said nucleic acid molecule further comprises at least one additional recombination site. 27. The nucleic acid molecule of claim 26, wherein said at least one additional recombination site is selected from the group consisting of lox sites and art sites. 28. The nucleic acid molecule of claim 26, wherein said at least one additional recombination site is a lax site. 29. The nucleic acid molecule of claim 28, wherein said lox site is a loxP site. The nucleic acid molecule of claim 20, wherein said nucleic acid molecule comprises at least one cloning site. 31. The nucleic acid molecule of claim 20, wherein said nucleic acid molecule is a vector. 32. The nucleic acid molecule of claim 31, wherein said vector is an expression vector. 33. The nucleic acid molecule of claim 20, wherein said antibiotic resistance gene is selected from the group consisting of a chloramphenicol resistance gene, an O4M07m/0Iw I 1797pt.oc.54 COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec. 2007 16:00 BALDWINS 0064 4 4736712 No.6724 P. 23/51 55 ampicillin resistance gene, a methicillin resistance gene, a tetracycline resistance gene and O O a kanamycin resistance gene. 34. The nucleic acid molecule of claim 20, wherein said antibiotic resistance gene is a chloramphenicol resistance gene. The nucleic acid molecule of claim 20, wherein said first portion of said gene is located adjacent to said recombination site. ON to 36. The nucleic acid molecule of claim 20, wherein said second portion of said gene is located adjacent to said recombination site. 0 37. A nucleic acid molecule comprising at least one promoter operably linked to at least one antibiotic resistance gene, wherein said promoter and said antibiotic resistance gene are separated by at least one laxP site. 38. The nucleic acid molecule of claim 37, wherein said antibiotic resistance gene is selected from the group consisting of a chloramphenicol resistance gene, an ampicillin resistance gene, a methicillin resistance gene, a tetracycline resistance gene and a kanamycin resistance gene. 39. The nucleic acid molecule of claim 37, wherein said antibiotic resistance gene is a chloramphenicol resistance gene. 40. A nucleic acid molecule comprising at least one functional antibiotic resistance gene, wherein said functional gene comprises a promoter and an antibiotic resistance gene separated from each other by at least one loxP site. 41. The nucleic acid molecule of claim 40, wherein said antibiotic resistance gene is selected from the group consisting of a chloramphenicol resistance gene, an ampicillin resistance gene, a methicillin resistance gene, a tetracycline resistance gene and a kanamycin resistance gene. 04107/3,s J 797spa.doc,S5 COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13-Dec. 2007 16:00 BALDWINS 0064 4 4736712 No-6724 P. 24/51 -56- 42. The nucleic acid molecule of claim 40, wherein said antibiotic resistance gene is a chloramphenicol resistance gene. 43. A host cell comprising the nucleic acid molecule according to claim 3 or claim 44. The host cell according to claim 43, wherein said host cell is an Escherichia coli cell. claims 7, 10, A host cell comprising the nucleic acid molecule according to any one of 11, 14, 20, 21, 25, 26, 29, 37 or 46. The host cell according to claim 45, wherein said host cell is an Escherichia colt cell. 47. A polypeptide encoded by a nucleic acid molecule, wherein said nucleic acid molecule comprises at least a first recombination site comprising at least one mutation which enhances recombination specificity, and wherein said polypeptide comprises amino acids encoded by said first recombination site. 48. The polypeptide of claim 47, wherein said nucleic acid molecule further comprises at least one additional nucleic acid sequence selected from the group consisting of a selectable marker, a cloning site, a restriction site, a promoter, an operon, an origin of replication, and a gene or partial gene. 49. The polypeptide of claim 47, wherein said nucleic acid molecule further comprises a second recombination site. The polypeptide of claim 48, wherein said gene or partial gene comprises a nucleic acid sequence encoding a tag sequence. 51. The polypeptide of claim 50, wherein said tag sequence is selected from the group consisting of a GST tag and a His tag. 04/07/I3 .swI 797sp..doc.56 COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec. 2007 16:00 BALDWINS 0064 4 4736712 No.6724 P. 25/51 -57- 52. The polypeptide according to any one of claims 47-49, wherein said o polypeptide is a fusion polypeptide. C) S53. The polypeptide of claim 52, wherein said fusion polypeptide comprises an amino terminal tag sequence.

54. The fusion polypeptide of claim 53, wherein said tag sequence is encoded by a gene or partial gene. ON Ci 10 55. The fusion polypeptide of claim 53, wherein said tag sequence is selected Sfrom the group consisting of a GST tag and a His tag. 0

56. The fusion polypeptide of claim 53, wherein said fusion polypeptide comprises a carboxy terminal tag sequence.

57. The fusion polypeptide of claim 56, wherein said tag sequence is encoded by a gene or partial gene.

58. The fusion polypeptide of claim 56, wherein said tag sequence is selected from the group consisting of a GST tag and a His tag.

59. A polypeptide encoded by a nucleic acid molecule, wherein said nucleic acid molecule comprises at least a first nucleic acid sequence selected from the group consisting a DNA sequence having at least 80% homology to any one of SEQ ID NOs:1- 16, a complementary DNA sequence thereto, and an RNA sequence corresponding any of these sequences, and wherein said polypeptide comprises amino acids encoded by said first nucleic acid sequence. The polypeptide of claim 59, wherein said nucleic acid molecule further comprises at least one additional nucleic acid sequence selected from the group consisting of a selectable marker, a cloning site, a restriction site, a promoter, an operon, an origin of replication, and a gene or partial gene. 94AO7103.wl 1797spa.docJ,7 COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec. 2007 16:00 BALDWINS 0064 4 4736712 No.6724 P. 26/51 58 o 61- The polypeptide of claim 59, wherein said nucleic acid molecule further Scomprises at least a second nucleic acid sequence selected from the group consisting of 0 SEQ ID NOs:1-16, a complementary DNA sequence thereto, and an RNA sequence Scorresponding thereto_ m,

62. The polypeptide of claim 60, wherein said gene or partial gene comprises a nucleic acid sequence encoding a tag sequence. Cl 63. The polypeptide of claim 62, wherein said tag sequence is selected from the Cl 1o group consisting of a GST tag and a His tag. 0 0 64. The polypeptide according to any one of claims 59-61, wherein said polypeptide is a fusion polypeptide.

65. The fusion polypeptide of claim 64, wherein said fusion polypeptide comprises an amino terminal tag sequence.

66. The fusion polypeptide of claim 65, wherein said tag sequence is encoded by a gene or partial gene.

67. The fusion polypeptide of claim 65, wherein said tag sequence is selected from the group consisting of a GST tag and a His tag.

68- The fusion polypeptide of claim 64, wherein said fusion protein comprises a carboxy terminal tag sequence.

69. The fusion polypeptide of claim 68, wherein said tag sequence is encoded by a gene or partial gene.

70. The fusion polypeptide of claim 68, wherein said tag sequence is selected from the group consisting of a GST tag and a His tag.

71. A polypeptide encoded by a nucleic acid molecule, wherein said nucleic acid molecule comprises at least a first mutated recombination site wherein said mutation 04071H 3.wl l 7 97p.oC,l COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec. 2007 16:00 BALDWINS 0064 4 4736712 No.6724 P. 27/51 -59- removes one or more stop codons from said recombination site, and wherein said 0 polypeptide comprises amino acids encoded by said first mutated recombination site.

72. The polypeptide of claim 71, wherein said nucleic acid molecule further comprises a least one additional nucleic acid sequence selected from the group consisting of a selectable marker, a cloning site, a restriction site, a promoter, an operon, an origin of replication, and a gene or partial gene.

73. The polypeptide of claim 71, wherein said nucleic acid molecule further comprises a second recombination site. 0

74. The polypeptide of claim 72, wherein said gene or partial gene comprises a nucleic acid sequence encoding a tag sequence.

75. The polypeptide of claim 74, wherein said tag sequence is selected from the group consisting of a GST tag and a His tag.

76. The polypeptide according to any one of claims 71-73, wherein said polypeptide is a fusion polypeptide.

77. The fusion polypeptide of claim 76, wherein said fusion polypeptide comprises an amino terminal tag sequence.

78. The fusion polypeptide of claim 77, wherein said tag sequence is encoded by a gene or partial gene.

79. The fusion polypeptide of claim 77, wherein said tag sequence is selected from the group consisting of a GST tag and a His tag.

80. The fusion polypeptide of claim 76, wherein said fusion polypeptide comprises a carboxy terminal tag sequence.

81. The fusion polypeptide of claim 80, wherein said tag sequence is encoded by a gene or partial gene. U41M03wl !797spA.doc59 COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec. 2007 16:01 BALDWINS 0064 4 4736712 No.6724 P. 28/51 0 S82. The fusion polypeptide of claim 80, wherein.said tag sequence is selected Sfrom the group consisting of a GST tag and a His tag. C) M 5 83. A polypeptide encoded by a nucleic acid molecule, wherein said nucleic acid molecule comprises at least a first mutated recombination site wherein said mutation avoids hairpin formation, and wherein said polypeptide comprises amino acids encoded by said first mutated recombination site. c, 10 84. The polypeptide of claim 83, wherein said nucleic acid molecule further Scomprises at least one additional nucleic acid sequence selected from the group consisting Sof a selectable marker, a cloning site, a restriction site, a promoter, an operon, an origin of replication, and a gene or partial gene.

85. The polypeptide of claim 83, wherein said nucleic acid molecule further comprises a second recombination site.

86. The polypeptide of claim 84, wherein said gene or partial gene comprises a nucleic acid sequence encoding a tag sequence.

87. The polypeptide of claim 85, wherein said tag sequence is selected from the group consisting of a GST tag and a His tag.

88. The polypeptide according to any one of claims 83-85, wherein said polypeptide is a fusion polypeptide.

89. The fusion polypeptide of claim 88, wherein said fusion polypeptide comprises an amino terminal tag sequence.

90. The fusion polypeptide of claim 89, wherein said tag sequence is encoded by a gene or partial gene.

91. The fusion polypeptide of claim 89, wherein said tag sequence is selected from the group consisting of a GST tag and a His tag. 04/7 13.'wl I7971*ph s.W6 COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13,Dec. 2007 16:01 BALDWINS 0064 4 4736712 No.6724 P. 29/51 -61 0 S92. The fusion polypeptide of claim 88, wherein said fusion polypeptide Scomprises a carboxy terminal tag sequence. C) 0

93. The fusion polypeptide of claim 92, wherein said tag sequence is encoded by a gene or partial gene.

94. The fusion polypeptide of claim 92, wherein said tag sequence is selected C'l from the group consisting of a GST tag and a His tag. A polypeptide encoded by a nucleic acid molecule, wherein said nucleic 0. acid molecule comprises at least a first nucleic acid sequence selected from the group consisting of SEQ ID NOs:1-16, a complementary DNA sequence thereto, and an RNA sequence corresponding any of these sequences, and wherein said polypeptide comprises amino acids encoded by said first nucleic acid sequence.

96. A composition comprising at least one isolated recombination protein and at least one isolated nucleic acid molecule comprising at least a first recombination site containing at least one oucleic acid sequence selected from the group consisting of a nucleic acid sequence that is 80-99% homologous to one or more of SEQ ID NOs: 1-16, a complementary DNA sequence thereto, and an RNA sequence corresponding thereto.

97. A composition comprising at least one isolated recombination protein and at least one isolated nucleic acid molecule comprising at least a first recombination site containing at least one nucleic acid sequence selected from the group consisting of a nucleic acid sequence that hybridizes under stringent conditions to one or more of SEQ ID NOs: 1-16, a complementary DNA sequence thereto, and an RNA sequence corresponding thereto.

98. A composition comprising at least one isolated recombination protein and at least one isolated nucleic acid molecule comprising at least a first recombination site containing at least one nucleic acid sequence selected from the group consisting of a mutated att recombination site containing at least one mutation that enhances 041/7D3.swl 177lp.doc.61 COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 i3Dec. 2007 16:01 BALDWINS 0064 4 4736712 No.6724 P. 30/51 62 recombinational specificity, a complementary DNA sequence thereto, and an RNA osequence corresponding thereto.

99. The composition of claim 98, wherein said mutated art site comprises at least one nucleic acid sequence as set forth in SEQ ID NOs.: 1-16.

100. The composition of claim 98, wherein said mutated at site comprises at least one nucleic acid sequence that is 80-99% homologous to at least one nucleic acid c, sequence as set forth in SEQ ID NOs.: 1-16.

101. The composition of claim 98, wherein said mutated ait site comprises at least one nucleic acid sequence that hybridizes under stringent conditions to at least one nucleic acid sequence as-set forth in SEQ ID NOs.: 1-16. is 102. A composition comprising: a first nucleic acid molecule comprising a first portion of a gene and at least a first recombination site; a second nucleic acid molecule comprising a second portion of said gene and at least a second recombination site; and at least one recombination protein capable of causing recombination between said first and second recombination sites.

103. A composition comprising: a first nucleic acid molecule comprising a first portion of an antibiotic resistance gene and at least a first recombination site; a second nucleic acid molecule comprising a second portion of said antibiotic resistance gene and at least a second recombination site; and at least one recombination protein capable of causing recombination between said first and second recombination sites.

104. A composition comprising: a first nucleic acid molecule comprising at least one promoter and at least a first recombination site; JS.W If l 7 MUVd.62 COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13-Dec, 2007 16:01 13.De 200716:01 BALDWINS 0064 4 4736712 N.74 P No-6724 P. 31/51 -63- o(b) a second nucleic acid molecule comprising at least one antibiotic resistance 0 gene and at least a second recombination site; and o at least one recombination protein capable of causing reonibination 0 between said first and second recombination sites.

105. The composition of claim 102, wherein said first and second recombination sites are selected from the group consisting of lox si tes, art sites, and mutants thereof. Cl106. The composition of claim 102, wherein said first and second recombination sites are lox sites. 0 107. The composition of claim 106, wherein said lox sites are loxP sites.

108. The composition of claim 103, wherein said first and second recombination sites are selected from the group consisting of lax sites, ati sites, and mutants thereof.

109.. The composition of claim 103, wherein said first and second recombination sites are lox sites.

110- The composition of claim 109, wherein said lox sites are loxP sites. 1.ll. The composition of claim 104, wherein said first and second recombination sites are selected from the group consisting of lox sites, att sites, and mutants thereof.

112. The composition of claim 104, wherein said first and second reconmbination sites are lox sites.

113. The composition of claim 112) wherein said lox sites are loxP sites.

114. The composition of claim 102, wherein said first nucleic acid molecule or said second nucleic acid molecule further comprises at least one additional recomnbination site. COMS ID No: ARCS-i 72228 Received by IP Australia: lime 14:20 Date 2007-12-13 13i Dec. 2007 16:02 BALDWINS 0064 4 4736712 No.6724 P. 32/51 -64-

115. The composition of claim 114, wherein said at least one additional O recombination site is selected from the group consisting of lox sites and att sites- ci

116. The composition of claim 105, wherein said first nucleic acid molecule or said second nucleic acid molecule further comprises at least one additional recombination Ssite. S117. The composition of claim 116, wherein said at least one additional recombination site is selected from the group consisting oflox sites and art sites. ciir o 118. The composition of claim 104, wherein said first nucleic acid molecule or O said second nucleic acid molecule further comprises at least one additional recombination site.

119. The composition of claim 118, wherein said at least one additional recombination site is selected from the group consisting of lox sites and aft sites.

120. The composition of claim 102, wherein said at least one recombination protein is selected from the group consisting of Cre, Int, ITHF, Xis, FLP, y8, Tn3 resolvase, Hin, Gin, Cin and combinations thereof.

121. The composition of claim 102, wherein said at least one recombination protein is Cre.

122. The composition of claim 102, wherein said at least one recombination protein is selected from the group consisting of lnt, IHF and Xis.

123. The composition of claim 103, wherein said at least one recombination protein is selected from the group consisting of Cre, Int, IHF, Xis, FLP, y5, Tn3 resolvase, Hin, Gin, Cin and combinations thereof.

124. The composition of claim 103, wherein said at least one recombination protein is Cre. Q4,7l3,lSw I 1797,pa.doc,64 COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec. 2007 16:02 BALDWINS 0064 4 4736712 No.6724 P. 33/51

125. The composition of claim 103, wherein said at least one recombination protein is selected from the group consisting of Int, IHF and Xis.

126. The composition of claim 104, wherein said at least one recombination protein is selected from the group consisting of Cre, Int, IHF, Xis, FLP, 78, Tn3 resolvase, Hin, Gin, Cin and combinations thereof

127. The composition of claim 104, wherein said at least one recombination protein is Cre.

128. The composition of claim 104, wherein said at least one recombination protein is selected from the group consisting of Int, IHIF and Xis.

129. The composition of claim 102, wherein said first nucleic acid molecule and said second nucleic acid molecule is a vector.

130. The composition of claim 103, wherein said first nucleic acid molecule and said second nucleic acid molecule is a vector.

131. The composition of claim 104, wherein said first nucleic, acid molecule and said second nucleic acid molecule is a vector.

132. The composition of claim 102, wherein said first or said second portions of said gene are PCR products.

133. The composition according to any one of claims 102, 103 or 104, further comprising at least one host cell. 1 34. The composition of claim 133, wherein said host cell is an Escherichia cQUli cell.

135. A composition comprising at least one isolated Int protein and at least one isolated IHF protein. O04A7Al.3w 1 7 laoo. o COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec. 2007 16:02 BALDWINS 0064 4 4736712 No.6724 P. 34/51 -66-

136. A composition comprising at least one isolated Int protein, at least one 0 Sisolated HF protein and at least one isolated Xis protein. C)l

137. The composition according to any one of claims 135 or 136, further 0 5 comprising at least one vector comprising at least one recombination site.

138. The composition of claim 137, wherein said at least one recombination site Sis at least one ant recombination site or a mutant or variant thereof ci

139. The composition of claim 137, wherein said at least one recombination site (is at least one att recombination site. 0 0

140. The composition according to any one of claims 138 or 139, wherein said at least one att recombination site is selected from the group consisting of an attB site, an attP site, an attL site, an atiR site, and a mutant or variant thereof.

141. The composition according to any one of claims 135 or 136, further comprising at least one vector comprising at least two recombination sites.

142. The composition of claim 141, wherein said at least one of said recombination sites is an att recombination site or a mutant or variant thereof.

143. The composition of claim 141, wherein said at least one of said recombination sites is an at recombination site.

144. Tbhe composition according to any one of claims 142 or 143, wherein said att recombination site is selected from the group consisting of an atB site, an atP site, an alL site, an attR site, and a mutant or variant thereof.

145. The composition according to any one of claims 135 or 136, further comprising at least one isolated FIS protein.

146. The composition according to any one of claims 135 or 136, further comprising spermidine. D4/7/D3.sw I 1797spai.doc.66 COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec. 2007 16:02 BALDWINS 0064 4 4736712 No.6724 P. 35/51 67 0 0 147. The composition according to any one of claims 135 or 136, further comprising Tris-HCL.

148. The composition according to any one of claims 135 or claim 136, further comprising ethylenediamine tetraacetic acid (EDTA).

149. The composition according to any one of claims 135 or 136, further comprising bovine serum albumin (BSA).

150. The composition according to any one of claims 135 or 136, further o comprising at least one additional isolated recombination protein selected from the group consisting of a Cre protein, an FLP protein, a y5 protein, a Tn3 resolvase protein, a Hin protein, a Gin protein, and a Cin protein.

151. The composition according to any one of claims 135 or 136, further comprising at least one isolated Cre recombination protein.

152. A composition comprising at least one isolated Int protein, at. least one isolated IHF protein, spermidine, Tris-HCI, EDTA and BSA.

153. A composition comprising at least one isolated Int protein, at least one isolated IHF protein, at least one isolated Xis protein, spermidine, Tris-HC1, EDTA and BSA.

154. A composition comprising at least one isolated Int protein, at least one isolated IHF protein and spermidine.

155. A composition comprising at least one isolated Int protein, at least one isolated IHF protein, at least one isolated Xis protein and spermidine.

156. The composition according to any one of claims 152-155, further comprising at least one vector comprising at least one recombination site. 0427/)O jw 1797pS.doc,67 COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec. 2007 16:03 BALDWINS 0064 4 4736712 No.6724 P. 36/51 68

157. The composition of claim 156, wherein said at least one recombination site ois at least one att recombination site or a mutant or variant thereof.

158. The composition of claim 156, wherein -said at least one recombination site is at least one att recombination site.

159. The composition according to any one of claims 157 or 158, wherein said at least one all recombination site is selected from the group consisting of an attB site, an c,1 attP site, an attL site, an auR site, and a mutant or variant thereof

160. The composition according to any one of claims 352-155, further 0comprising at least one vector comprising at least two recombination sites.

161. The composition of claim 160, wherein said at least one of said recombination sites is an art recombination site or a mutant or variant thereof.

162. The composition of claim 160, wherein said at least one of said recombination sites is an att recombination site.

163. The composition according to any one of claims 161 or 162, wherein said art recombination site is selected from the group consisting of an attB site, an aFtP site, an attL site, an atR site, and a mutant or variant thereof.

164. The composition according to any one of claims 152-155, further comprising at least one isolated FIS protein.

165. The composition according to any one of claims 152-155, further comprising at least one additional isolated recombination protein selected from the group consisting of a Cre protein, an FLP protein, a y& protein, a Tn3 resolvase protein, a Hin protein, a Gin protein, and a Cin protein.

166. The composition according to any one of claims 152-155, further comprising at least one isolated Cre recombination protein. COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec. 2007 16:D3 BALDWINS 0064 4 4736712 No.6724 P. 37/51 69 o 167. A kit comprising at least one container containing the composition according to any one of claims 135-137, 141,145-156, 160, or 164-166.

168. A method for in vitro cloning of a nucleic acid of interest, comprising: mixing in vitro a first vector comprising at least a first recombination site and a second vector comprising at least a second recombination site, wherein said first and/or second vector further comprises a nucleic acid of interest; incubating said mixture in the presence of at least one recombination protein under conditions sufficient to cause recombination of at least said first and second C 10 recombination sites, thereby producing a chimeric nucleic acid molecule comprising said onucleic acid of interest; C contacting one or more hosts with said mixtuie; and selecting for a host comprising said chimeric nucleic acid molecule, and selecting against a host comprising said first vector and against a host comprising said second vector, thereby cloning said nucleic acid of interest, wherein said first and/or said second recombination site contains one or more mutations.

169. The method of claim 168, wherein said first and/or second recombination site contains at least one mutation that removes one or more stop codons.

170. The method of claim 168, wherein said first and/or second recombination site contains at least one mutation that avoids hairpin formation.

171. The method of claim 168, wherein said first and/or second recombination site comprises at least a first nucleic acid sequence selected from the group consisting of SEQ ID NOs:1-16, a complementary DNA sequence thereto, and an RNA sequence corresponding thereto.

172. The method of claim 168, wherein said first and/or second recombination site comprises at least a first nucleic acid sequence selected from the group consisting of a mutated att recombination site containing at least one mutation that enhances recombinational specificity, a complementary DNA sequence thereto, and an RNA sequence corresponding thereto. 04U7JQ3,pwl 1797spa.ioe.69 COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec. 2007 16:03 BALDWINS 0064 4 4736712 No.6724 P. 38/51 0

173. The method of claim 172, wherein said mutated att site comprises at least O one nucleic acid sequence as set forth in SEQ ID NOs.: 1-16. C) C 5 174. A method of making a reaction mixture, comprising mixing at least one isolated recombination protein and at least one isolated nucleic acid molecule comprising at least a first nucleic acid sequence selected from the group consisting of SEQ ID NOs:1- 16, a complementary DNA sequence thereto, and an RNA sequence corresponding thereto. ON C 10 175. A reaction mixture made by the method of claim 174. 0 ,1 176- A method for apposing an expression signal and a gene or partial gene comprising: mixing a first nucleic acid molecule comprising said expression signal and at least a first recombination site, and a second nucleic acid molecule comprising said gene or partial gene and at least a second recombination site; and contacting said mixture with at least one recombination protein under conditions sufficient to cause recombination of at least said first and second recombination sites thereby apposing said expression signal and said gene or partial gene, wherein at least one of said recombination sites comprises at least one nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-16, or a nucleic acid sequence complementary thereto.

177. A method for apposing an expression signal and a gene or partial gene comprising: mixing a first nucleic acid molecule comprising said expression signal and at least a first recombination site, and a second nucleic acid molecule comprising said gene or partial gene and at least a second recombination site; and contacting said mixture with at least one recombination protein under conditions sufficient to cause recombination of at least said first and second recombination sites thereby apposing said expression signal and said gene or partial gene, wherein at least one of said recombination sites comprises a mutation which removes one or more stop codons from said recombination site. B047103. I l?97 t COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13 Dec, 2097 16:03 BALDWLNS 0064 4 4736712 No-6724 P. 39/51 -71

178. A method for apposing an expression signal and a gene or partial gene o comprising: o mixing a first nucleic acid molecule comprising said expression signal and at least a furst recomnbination site, and a second nucleic acid molecule comprising said gene or partial gene and at least a second recombination site; and contacting said mixture with at least one recombination protein under conditions sufficient to cause recombination of at least said first and second recombination sites thereby apposing said expression signal and said gene or partial gene, ci wherein at least one of said recombination sites comprises a mutation which avoids hairpin formation.

0179. The method of any one of claims 176-178, Wherein said recombination occurs in vivo. is 180. The method of any one of claims 176-178, wherein said recombination occurs in vitro.

181. An in vitro method for apposing an expression signal and a gene or partial gene comprising: mixing in vitro a first nucleic acid molecule comprising said expression signal, and at least a first recombination site and at least a second recomnbination site, 'wherein said first and second recombination sites do not recombine with each other; and (ii) a second nucleic acid molecule comprising said gene or partial gene, and at least a third recombination site and at least a fourth recombination site, wherein said third and fourth recombination sites do not recombine with each other, and contacting said mixture in vitro with at least one recombination protein under conditions sufficient to cause recombination of said first and third recombination sites and/or said second and fourth recombination sites, thereby apposing said expression signal and said gene or partial gene such that expression of said gene or partial gene can be controlled by said expression signal and such that a single protein is expressed upon expression of said gene or partial gene. 04M7/83.,w 3 1797.p. 4t.71I COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.De. 2007 16:04 BALDWINS 0064 4 4736712 No.6724 P. 40/51 72-

182. An in vitro method for apposing an expression signal and a gene or partial o gene comprising: o mixing in vitro a first nucleic acid molecule comprising said expression signal, and at least a first recombination site and at least a second recombination site, wherein said first and second recombination sites do not recombine with each other, and (ii) a second nucleic acid molecule comprising said gene or partial gene, and at least a third recombination site and at least a fourth recombination site, wherein said third and fourth recombination sites do not recombine with each other; and o contacting said mixture in vitro with at least one recombination protein under 0 conditions sufficient to cause recombination of said first and third recombination sites and/or said second and fourth recombination sites, thereby apposing said expression signal and said gene or partial gene.

183. The method of any one of claims 176-178, 181, and 182, wherein said recombination produces a third nucleic acid molecule in which said expression signal and said gene or partial gene are apposed, and further comprisirig introducing said third nucleic acid molecule into a cell.

184. The method of any one of claims 176-178, 181, and 182, wherein said first nucleic acid molecule and/or said second nucleic acid molecule firther comprises at least one Selectable marker.

185. The method of claim 184, wherein said at least one Selectable marker is a toxic gene.

186. The method of any one of claims 176-178, 181, and 182, wherein said expression signal is a promoter.

187. The method of claim 186, wherein said promoter is selected from the group consisting of a repressible promoter, an inducible promoter and a constitutive promoter. 04iO jw I 1 7 9 7 pwo.dec.72 COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec. 2007 16:04 BALDWINS 0064 4 4736712 No.6724 P. 41/51 73 188, The method of claim 186, wherein said promoter is selected from the group 0 consisting of a CMV promoter and a tac promoter. C) S189. The method of any one of claims 176-178, 181, and 182, wherein said gene or partial gene comprises a nucleic acid sequence encoding a tag sequence.

190. The method of claim 189, wherein said tag sequence is selected from the group consisting of a GST tag and a His tag. C 10 191. The method of any one of claims 176-178, 181, and 182, wherein said first Snucleic acid molecule and/or said second nucleic acid molecule further comprises at least 0 one additional nucleic acid sequence selected from the group consisting of a cloning site, a restriction site, an operon, and an origin of replication.

192. The method of any one of claims 176-178, 181, and 182, further comprising expressing said gene or partial gene to produce a protein.

193. The method of claim 192, wherein said protein is a fusion protein.

194. The method of claim 193, wherein said fusion protein comprises a tag sequence.

195. The method of claim 194, wherein said tag sequence is selected from the group consisting of a GST tag and a His tag.

196. The method of claim 192, wherein said fusion protein comprises an amino terminal tag sequence.

197. The method of claim 192, wherein said fusion protein comprises a carboxy terminal tag sequence.

198. The method of any one of claims 176-178, 181, and 182, wherein said at least one recombination protein is encoded by a bacteriophage selected from the group consisting of bacteriophage lambda, phiS0, P22, P2, 186, P4 and PI. 04/07/3.swl i797s p .dne.73 COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13,Dec. 2007 16:04 BALDWINS 0064 4 4736712 No,6724 P. 42/51 74

199. The method of any one of claims 176-178, 181, and 182, wherein said at least one recombination protein is encoded by bacteriophage lambda.

200. The method of any one of claims 176-178, 181, and 182, wherein said at least one recombination protein is selected from the group consisting of hIt, IHF, Xis, and Cre.

201. The method of any one of claims 176-178, 181, and 182, wherein said at tO least one recombination protein is selected from the group consisting of Int, IHF, and Xis.

202. The method of any one of claims 176-178, 181, and 182, wherein said at least one recombination protein is selected from the group consisting of(, Tn3 resolvase, Hin, Gin, Cin, and Flp.

203. The method of any one of claims 176-178, 181, and 182, wherein said at least one recombination protein is Cre.

204. The method of any one of claims 1.76-178, 181, and 182, wherein at least one of said recombination sites is selected from the group consisting of art sites and lox sites.

205. The method of any one of claims 176-178, 181, and 182, wherein at least one of said recombination sites is an att site.

206. The method of any one of claims 176-178, 18 I, and 182, wherein at least one of said recombination sites is a lox site.

207. The method of any one of claims 176-178, 181, and 182, wherein said first nucleic acid molecule is a vector.

208. The method of any one of claims 176-i78, 181, and 182, wherein said second nucleic acid molecule is a vector. 04U7113,sw I 1 7 9 7 opp.dvc.74 COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec. 2007 16:04 BALDWINS 0064 4 4736712 No,6724 P. 43/51 75

209. The method of any one of claims 176-178, 181, and 182, wherein said first oand second nucleic acid molecules are vectors.

210. An in vitro method for apposing an expression signal and a gene or partial gene, comprising: inserting, by T:A cloning, a DNA segment comprising said gene or partial gene into a first nucleic acid molecule comprising at least a first recombination site, thereby producing a second nucleic acid molecule comprising said gene or partial gene and at least said first recombination site; mixing in vitro said second nucleic acid molecule with a third nucleic acid molecule comprising said expression signal and at least a second recombination site; and incubating said mixture in vitro in the presence of at least one recombination protein under conditions sufficient to cause recombination of at least said first and said second recombination sites, thereby producing a fourth nucleic acid molecule wherein said expression signal and said gene or patial gene have been apposed such that expression of said gene or partial gene can be controlled by said expression signal.

211. The method of claim 210, wherein said at least one recombination protein is selected from the group consisting of Int, fl-IF, Xis, and Cre.

212. The method of claim 210, wherein said at least one recombination protein is Ore.

213. The method of claim 210, wherein said first or second recombination sites are selected from the group consisting of att sites and lox sites.

214. The method of claim 210, wherein said first or second recombination site is a lox site.

215. The method of claire 210, wherein said second nucleic acid molecule is a vector.

216. The method of claim 210, wherein said third nucleic acid molecule is a vector. 04/0713.st 1 17 9 7 COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13-Doo. 2007 16:05 BALDWINS 0064 4 4736712 No.6724 P. 44/51 -76-

217. The method of claim 210, wherein said second and third nucleic acid molecules are vectors.

218. The method of claim 210, wherein said expression signal is a promoter.

219. The method of claim 210, wherein said second nucleic acid molecule further comprises at least one additional nucleic acid sequence selected from the group consisting of a Selectable marker, a cloning site, a restriction site, an operon, and an origin of replication.

220. The method of claim 210, wherein said third nucleic acid molecule further comprises at least one additional nucleic acid sequence selected from the group consisting of a Selectable marker, a cloning site, a restriction site, an operon, and an origin of replication.

221. The method of claim 210, further comprising expressing said gene or partial gene to produce a protein.

222. The method of claim 221, wherein said protein is a fusion protein.

223. The method of claim 222, wherein said fusion protein comprises a tag sequence.

224. The method of claim 223, wherein said tag sequence is selected from the group consisting of a GST tag and a His tag.

225. The method of claim 210, wherein at least one of said recombination sites comprises a mutation which removes one or more stop codons from said recombination site.

226. The method of claim 210, wherein at least one of said recombination sites comprises a mutation which avoids hairpin formation. 04M07/j3,w 17lp. dea,76 COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13-Dec. 2007 16:05 BALOWINS 0064 4 4736712 No.6724 P. 45/51 77

227. The method of claim 210, fuirther comprising introducing said fourth O nucleic acid molecule into a cell.

228. The method of claim 227, further comprising expressing said gene or partial gene to produce a protein.

229. The method of claimn 228, wherein said protein is a fusion protein. ON 230. The method of claim 229, wherein said fusion protein comprises a tag sequence. O231. The method of claim 230, wherein said tag- sequence is selected from the group consisting of a GST tag and a His tag. is 232. The method of claim 227, wherein at least one of said recombination sites compnises a mutation which removes one or more stop codons from said recombination site.

233. The metbod of claim 227, wherein at least one of said recombination sites comprises a mutation which avoids hairpin formation.

234. The method of claim 182, further comprising: contacting one or more hosts with said mixture; and selecting for a host comprising a nucleic acid molecule in which said expression signal and said gene or partial gene have been apposed, and selecting against a host comprising said first nucleic acid molecule and against a host comprising said second nucleic acid molecule.

235. The method of claim 234, wherein said selection is accomplished using at least one Selectable marker.

236. The method of claim 234, wherein said Selectable marker is selected from the group consisting of an antibiotic resistance gene and a toxic gene. COMS ID No: ARCS-i 72228 Received by iP Australia: lime 14:20 Date 2007-12-13 13.Dec. 2007 16:05 BALDWINS 0064 4 4736712 No.6724 P. 46/51 -78-

237. The method of claim 234, wherein said host is E. coli. O

238. The method of claim 234, further comprising expressing said gene or partial gene to produce a protein.

239. The method of claim 210, further comprising: contacting one or more hosts with said mixture; and selecting for a host comprising a nucleic acid molecule in which said Sexpression signal and said gene or partial gene have been apposed, and selecting against a host comprising said second nucleic acid molecule and against a host comprising said third Snucleic acid molecule.

240. The method of claim 239, wherein said selection is accomplished using at least one Selectable marker.

241. The method of claim 240, wherein said Selectable marker is selected from the group consisting of an antibiotic resistance gene and a toxic gene.

242. A method for in vitro cloning comprising: mixing in vitro a first vector comprising at least a first recombination site and a second vector comprising at least a second recombination site; and incubating said mixture in the presence of at least one recombination protein under conditions sufficient to cause recombination of at least said first and second recombination sites, wherein said first and/or second recombination site comprises at least a first nucleic acid sequence selected from the group consisting of a nucleic acid sequence that is 80-99% homologous to one or more of SEQ ID NOs:1-16, a complementary DNA sequence thereto, and an RNA sequence corresponding thereto.

243. A method for in vitro cloning comprising: mixing in vitro a first vector comprising at least a first recombination site and a second vector comprising at least a second recombination site; and 04" 3jsw I 7?9?sp.dec.7T COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 I 13.Dec, 2007 16:05 BALDWINS 0064 4 4736712 No,6724 P. 47/51 79 incubating said mixture in the presence of at least one recombination oprotein under conditions sufficient to cause recombination of at least said first and second orecombination sites, wherein said first and/or second recombination site comprises at least a first nucleic acid sequence selected from the group consisting of a nucleic acid sequence that hybridizes under stringent conditions to one or more of SEQ ID NOs:1-16, a complementary DNA sequence thereto, and an RNA sequence corresponding thereto. O, 244. A method for in vitro cloning comprising: mixing in vitro a first vector comprising at least a first recombination site oand a second vector comprising at least a second recombination site; and 0 incubating said mixture in the presence of at least one recombination protein under conditions sufficient to cause recombination of at least said first and second recombination sites, wherein said first and/or second recombination site comprises at least a first nucleic acid sequence selected from the group consisting of a mutated atr recombination site containing at least one mutation that enhances recombinational specificity, a complementary DNA sequence thereto, and an RNA sequence corresponding thereto.

245. The method of claim 244, wherein said mutated aft site comprises at least one nucleic acid sequence that is 80-99% homologous to at least one nucleic acid sequence as set forth in SEQ ID NOs.: 1-16.

246. The method of claim 244, wherein said mutated att site comprises at least one nucleic acid sequence that hybridizes under stringent conditions to at least one nucleic acid sequence as set forth in SEQ ID NOs.: 1-16.

247. A method of maling a reaction mixture, comprising mixing at least one isolated recombination protein and at least one isolated nucleic acid molecule comprising at least a first recombination site containing at least one mutation, wherein said mutation removes one or more stop codons from said recombination site.

248. A method of making a reaction mixture, comprising mixing at least one isolated recombination protein and at least one isolated nucleic acid molecule comprising 04M7JD03w I 1797Spi.de.79 COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec. 2007 16:06 BALDWINS 0064 4 4736712 No.6724 P. 48/51 80 at least a first recombination site containing at least one mutation, wherein said mutation 0 oavoids hairpin formation.

249. A method of making a reaction mixture, comprising mixing at least one isolated recombination protein and at least one isolated nucleic acid molecule comprising at least a first recombination site containing a nucleic acid sequence that is 80-99% homologous to one or more of SEQ ID NOs:l-16, a complementary DNA sequence thereto, and an RNA sequence corresponding thereto.

250. A method of making a reaction mixture, comprising. mixiqrg at least one isolated recombination protein and at least one isolated nucleic acid molecule comprising oat least a first recombination site containing a nucleic acid sequence that hybridizes under stringent conditions to one or more of SEQ ID NOs: 1-16, a complementary DNA sequence thereto, and an RNA sequence corresponding thereto.

251. A method of making a reaction mixture, comprising mixing at least one isolated recombination protein and at least one isolated nucleic acid molecule comprising at least a first mutated alt recombination site containing at least one mutation that enhances recombination specificity.

252. The method of claim 251, wherein said mutated att site comprises at least one nucleic acid sequence as set forth in SEQ ID NOs.: 1-16.

253. The method of claim 251, wherein said mutated att site comprises at least one nucleic acid sequence that is 80-99% homologous to at least one nucleic acid sequence as set forth in SEQ D NOs.: 1-16.

254. The method of claim 251, wherein said mutated art site comprises at least one nucleic acid sequence that hybridizes under stringent conditions to at least one nucleic acid sequence as set forth in SEQ ID NOs.: 1-16.

255. A reaction mixture made by the method of any one of claims 247-25 1.

256. A method for in vitro cloning of a nucleic acid molecule, comprising: O4O7af3,r. I T 771psya.So, COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec. 2007 16:06 BALDWINS 0064 4 4736712 No.6724 P. 49/51 -81 mixing in vitro a first vector comprising at least a first and second orecombination sites, and a second vector comprising at least a third and fourth ,i recombination sites, wherein said first and/or second vector further comprises a nucleic acid molecule to be cloned, and wherein said first and second recombination sites do not recombine with each other and said third and fourth recombination sites do not recombine with each other; incubating said mixture in the presence of at least one recombination protein under conditions sufficient to cause recombination of at least said first and third and/or said second and fourth recombination sites, thereby producing a product molecule comprising said nucleic acid molecule; contacting one or more hosts with said mixture; and selecting for a host comprising said product molecule, and against a host comprising said first vector and against a host comprising said second vector.

257. The method of claim 256, wherein said at least one recombination protein is selected from the group consisting of Int, IHF, Xis and Cre.

258. The method of claim 256, wherein said at least one recombination protein is selected from the group consisting of Int, IHF and Xis.

259. The method of claim 256, wherein said at least one recombination protein is selected from the group consisting of, TnO, Tn7, resolvase, Hin, Gin, Cin and Flp.

260. The method of claim 256, wherein said at least one recombination protein is Cre.

261. The method of claim 256, wherein said first, second, third and/or fourth recombination sites are selected from the group consisting of alt and lox P sites.

262. The method of claim 256, wherein said first, second, third and/or fourth recombination sites are att sites.

263. The method of claim 256, wherein said first, second, third and/or fourth recombination sites are lox P sites. 04/7A3,., I 1797 'pM .J I COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Deo. 2007 16:06 BALDW'INS 0064 4 4736712 No.6724 P. 50/51 82 o264. The method of claim 256, wherein said selection is accomplished using at least one Selectable marker. 0 s265. The method of claim 264, wherein said Selectable marker is selected from the group consisting of an antibiotic resistance gene and a toxic gene, __266. The method of claim 256, wherein said host is coi.

267. An in vitro method of cloning a PCR product comprising: S las a(a) obtaining a PCR product comprising at least a first recombination site and at latasecond recomnbination site which do not recombine with each other;'anid combining said ?CR product in vitro with a vector comprising at least a third, recombination site and at least a fourth recombination site which do not recombine with each other, under conditions such that recombination occurs between said first and third and/or said second and fourth recombination sites, thereby producing a product vector. 268, The method of claim 267, further comprising inserting said product vector into a host cel.

269. The method of claim 267, wherein said vector is an expression Vector.

270. The method of claim 267, wherein said vector comprises at least one additional nucleic acid sequence selected from the group consisting of a selectable marker, a cloning site, a restriction site, a promoter, an operon, an origin of replication, and a gene or partial gene.

271. The method of claim 267, wherein said vector comprises at least one origin of replication.

272. The method of claim 267, wherein said vector comprises at least one promoter. O"flf/03,-9..w w. 9 YsaMc COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec. 2007 16:06 BALDWINS 0064 4 4736712 No.6724 P. 51/51 83- Ss ta273. The method of claim 267, wherein said vector comprises at least one selectable marker.

274. The method of claim 267, wherein said PCR product is linear.

275. The method of claim 267, wherein said first, second, third or fourth recombination sites are lox sites or mutants thereof.

276. The method of claim 275, wherein said lox sites are selected from the group consisting of loxP sites and IoxP511 sites.

277. The method of claim 267, wherein said first, second, third or fourth recombination sites are alt sites or mutants .thereof.

278. The method of claim 277, wherein said art sites are selected from the group consisting of atB sites, attP sites, attL sites and attR sites.

279. The method of claim 267, wherein said first, second, third or fourth recombination sites are selected from the group consisting of a lox site, an at site, an FRT site, and mutants thereof.

280. The method of claim 267, wherein said product nucleic acid molecule and said vector are combined in the presence of at least one recombination protein.

281. The method of claim 280, wherein said recombination protein is Cre.

282. The method of claim 280, wherein said recombination protein is selected from the group consisting of Int, Xis and IHF.

283. A method of producing a nucleic acid molecule comprising: providing a first nucleic acid molecule comprising at least one portion of a first gene and at least a first recombination site; providing a second nucleic acid molecule comprising at least one portion of a second gene and at least a second recombination site; and 84MI/Oni,1 I 1 ?epii.4.j3 COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec. 2007 16:07 BALDWINS 0064 4 4736712 No.6725 P. 2/79 84- o forming a mixture between said first and second nucleic acid molecules and o at least one recombination protein, under conditions sufficient to cause recombination o between said first and second recombination sites, thereby producing a third nucleic acid Smolecule in which said portions of said first and second genes are operably linked to form a functional gene.

284. The method of claim 283, wherein said first gene and said second gene are the same. 0 S o10 285. The method of claim 283, wherein said first gene or said second gene O encodes a selectable marker. 0

286. The method of claim 283, wherein said first gene or said second gene is an antibiotic resistance gene..

287. The method of claim 286, wherein said antibiotic resistance gene is selected from the group consisting of a chloramphenicol resistance gene, an ampicillin resistance gene, a methicillin resistance gene, a tetracycline resistance gene and a kanamycin resistance gene.

288. The method of claim 286, wherein said antibiotic resistance gene is a chloramphenicol resistance gene.

289. The method of claim 283, wherein said at least one portion of said first gene or said at least one portion of said second gene comprises a promoter.

290. The method of claim 283, wherein said at least one portion of said first gene and said at least one portion of said second gene are fragments of one or more structural genes.

291. The method of claim 283, wherein said first gene or said second gene encodes a heterodimeric gene product. D4/07I03.sw I 1797p.doc.84 COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13-Dec. 2007 16:07 13.0e 200716:07 BALDWINS 0064 4 4736712 N.75 P 37 No-6725 P. 3/79 85

292. The method of claim 283, wherein said first and second recombination sites o are selected from the group consisting of lox sites, at t sites, and mutants thereof. C.)293. The method of claim 283, wherein said first and second recombination sites are selected from the group consisting of lox sites and ott sites.

294. The method of claim 283, wherein said first and second recormbination sites are lox sites,

295. The method of claim 294, wherein said lox sites are lox? sites. o 296. The method of claim 283, wherein said first Mnd second recombination sites are att sites. is 297. The method of claim 296, wherein said all sites are selected from the group consisting of atIB sites, all? sites, intL sites and aIuR sites.

298. The method of claim 283, wherein said first nucleic acid molecule or said second nucleic acid molecule Rfturthr comprises at least one additional recombination site.

299. The method of claim 298, wherein said at least one additional recombination site is selected from the group consisting of lox sites and att sites.

300. The method of claim 298, wherein said at least one additional 2$ recombination site is at least one lox site or a mutant thereof.

301. The method of claim 298, whercin said at least one additional recombination site is a lox site.

302. The method of claim 301, wherein said lox site is a lox? site.

303. The method of claim 298, wherein said at least one additional recombination site is at least one at site or a mutant thereof. COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13,Dec, 2007 16:07 BALDWINS 0064 4 4736712 No,6725 P. 4/79 86

304. The method of claim 298, wherein said at least one additional recombination site is an att site.

305. The method of claim 304, wherein said att site is selected from the group consisting of an attB site, an attP site, an arrL site and an attR site.

306. The method of claim 283, wherein said at least one portion of said first gene is located adjacent to said first recombination site.

307. The method of claim 283, wherein said at least one portion of said second gene is located adjacent to said second recombination site.

308. The method of claim 283, wherein said first nucleic acid molecule or said second nucleic acid molecule comprises at least one cloning site.

309. The method of claim 283, wherein said at least one recombination protein is selected from the group consisting of Cre, Int, TF, Xis, FLP, y8, Tn3 resolvase, Hin, Gin, Cin and combinations thereof.

310. The method of claim 283, wherein said at least one recombination protein is Cre.

311. The method of claim 283, wherein said at least one recombination protein is selected from the group consisting of nt, IHF and Xis.

312. The method of claim 283, wherein said at least one recombination protein is

313. The method of claim 283, wherein said at least one recombination protein is IHF.

314. The method of claim 283, wherein said at least one recombination protein is Xis. 84M'.O3,i- I I -p .tle COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 12-Dec. 2007 16:07 BALDWINS 0064 4 4736712 No.6725 P. 5/79 -87-

315. The method of claim 283, wherein said first nucleic acid molecule or said O second nucleic acid molecule or said third nucleic acid molecule is a vector. C-)

316. The method of claim 315, wherein said vector is an expression vector. 0

317. The method of claim 283, wherein said first nucleic acid molecule or said second nucleic acid molecule is linear. C 318. The method of claim 283, wherein said at least one portion of said first gene C 10 or of said second gene is a PCR product. oe a p. O 319. The method of claim 283, further comprising expressing said functional gene.

320. The method of claim 283, further comprising contacting at least one host cell with said mixture, and selecting for a host cell comprising said third nucleic acid molecule.

321. The method of claim 320, further comprising selecting against a host cell comprising said first or said second nucleic acid molecule.

322. The method of claim 320, further comprising selecting against a host cell comprising said first and said second nucleic acid molecules.

323. The method of claim 320, further comprising expressing said functional gene in said selected host cell.

324. The method of claim 320, wherein said host cell is a prokaryotic cell.

325. The method of claim 320, wherein said host cell is a bacterial cell.

326. The method of claim 320, wherein said host cell is an Escherichia coli cell.

327. A method of producing a nucleic acid molecule comprising: 04107/10sw r 97,w.doc.7 COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec. 2007 16:08 BALDWINS 0064 4 4736712 No.6725 P. 6/79 88 providing a first nucleic acid molecule comprising a first portion of an antibiotic resistance gene and at least a first recombination site; providing a second nucleic acid molecule comprising a second portion of said antibiotic resistance gene and at least a second recombination site; and S forming a mixture between said first and second nucleic acid molecules and at least one recombination protein, under conditions sufficient to cause recombination between said first and second recombination sites, thereby producing a third nucleic acid _molecule in which said first and second portions of said gene are operably linked to form a flnctional antibiotic resistance geme.

328. The method of claim 327, wherein said antibiotic resistance gene is selected o from the group consisting of a chloraznphenicol resistance gene, an, ampicillin resistance gene, a methicillin resistance gene, a tetracycline resistance gene and a kanamycin resistance gene.

329. The method of claim 327, wherein said antibiotic resistance gene is a chloramphenicol resistance gene.

330. The method of claim 327, wherein said first or second portion of said gene comprises a promoter.

331. The method of claim 327, wherein said first and second recombination sites are selected from the group consisting of lox sites, att sites, and mutants thereof

332. The method of clair 327, wherein said first and second recombination sites are selected from the group consisting of lox sites and att sites.

333. The method of claim 327, wherein said first and second recombination sites are lox sites.

334. The method of claim 333, wherein said lox sites arc loxP sites-

335. The method of claim 327, wherein said first and second recombination sites are art sites. 04)/03j' 7 9 7 6nlt,4q,SL COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec. 2007 16:08 BALDWINS 0064 4 4736712 No.6725 P. 7/79 89 0 o336. The method of claim 335, wherein said art sites are selected from the group consisting of attB sites, attP sites, atL sites and attR sites.

337. The method of claim 327, wherein said first nucleic acid molecule or said second nucleic acid molecule further comprises at least one additional recombination site.

338. The method of claim 337, wherein said at least one additional O',N recombination site is selected from the group consisting of lox sites and at sites.

339. The method of claim 337, wherein said at least one additional orecombination site is at least one lox site or a mutant thereof:

340. The method of claim 337, wherein said at least one additional recombination site is a lox site.

341. The method of claim 340, wherein said lox site is a loxP site.

342. The method of claim 337, wherein said at least one additional recombination site is at least one art site or a mutant thereof.

343. The method of claim 337, wherein said at least one additional recombination site is an art site.

344. The method of claim 343, wherein said art site is selected from the group consisting of an attB site, an attP site, an attL site and an attR site.

345. The method of claim 327, wherein said first portion of said gene is located adjacent to said first recombination site.

346. The method of claim 327, wherein said second portion of said gene is located adjacent to said second recombination site. 94,IQ7do0,. I 7 9 7 COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13Dec. 2007 16:08 BALDWINS 0064 4 4736712 No.6725 P. 8/79

347. The method of claim 327, wherein said first nucleic acid molecule or said second nucleic acid molecule comprises at least one cloning site.

348. The method of claim 327, wherein said at least one recombination protein is selected from the group consisting of Cre, Int, IF, Xis, FLP, yS, Tn3 resolvase, Hin, Gin, Cin and combinations thereof.

349. The method of claim 327, wherein said at least one recombination protein is Cre.

350. The method of claim 327, wherein said at least one recombination protein is selected from the group consisting of Int, IHF and Xis.

351. The method of claim 327, wherein said first nucleic acid molecule or said second nucleic acid molecule or said third nucleic acid molecule is a vector.

352. The method of claim 351, wherein said vector is an expression vector.

353. The method of claim 327, wherein said first nucleic acid molecule or said second nucleic acid molecule is linear.

354. The method of claim 327, wherein said first or said second portions of said gene are PCR products.

355. The method of claim 327, further comprising contacting at least one host cell with said mixture, and selecting for a host cell comprising said third nucleic acid molecule.

356. The method of claim 355, further comprising selecting comprising said first or said second nucleic acid molecule.

357. The method of claim 355, further comprising selecting comprising said first and said second nucleic acid molecule. against a host cell against a host cell 04mo,07w 17 9 7 'pl.d ,o COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec. 2007 16:08 BALDWINS 0064 4 4736712 No.6725 P. 9/79 -91

358. The method of claim 355, wherein said host cell is a prokaryotic cell. O S359. The method of claim 355, wherein said host cell is a bacterial cell.

360. The method of claim 355, wherein said host cell is an Escherichia coli cell.

361. The method of claim 327, further comprising introducing said third nucleic acid molecule into a host cell. 10 362. The method of claim 327, further comprising introducing said third nucleic acid molecule into a host cell and expressing said antibiotic resistance gene. 0

363. The method of claim 362, wherein said host cell is an Escherichia coli cell.

364. A method of producing a nucleic acid molecule comprising: providing a first nucleic acid molecule comprising at least one promoter and at least a first recombination site; providing a second nucleic acid molecule comprising at least one antibiotic resistance gene and at least a second recombination site; and forming a mixture between said first and second nucleic acid molecules and at least one recombination protein, under conditions sufficient to cause recombination between said first and second recombination sites, thereby producing a third nucleic acid molecule in which said promoter and said antibiotic resistance gene are operably linked.

365. The method of claim 364, wherein said antibiotic resistance gene is selected from the group consisting of a chloramphenicol resistance gene, an ampicillin resistance gene, a methicillin resistance gene, a tetracycline resistance gene and a kanamycin resistance gene.

366. The method of claim 364, wherein said antibiotic resistance gene is a chloramphenicol resistance gene.

367. The method of claim 364, wherein said first and second recombination sites are selected from the group consisting of lox sites, att sites, and mutants thereof. c4 oi03,swI ll 7pa.doce. COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec. 2007 16:09 BALDWINS 0064 4 4736712 N0.6725 P. 10/79 92 o 368. The method of claim 364, wherein said first and second recombination sites are selected from the group consisting of lox sites and all sites.

369. The method of claim 364, wherein said first and second recombination sites are lox sites.

370. The method of claim 369, wherein said lox sites are loxP sites.

371. The method of claim 364, wherein said first and second recombination sites S are art sites.

372. The method of claim 371, wherein said att sites are selected from the group consisting of art sites, attP sites, attL sites and attR sites.

373. The method of claim 364, wherein said first nucleic acid molecule or said second nucleic acid molecule further comprises at least one additional recombination site.

374. The method of claim 373, wherein said at least one additional recombination site is selected from the group consisting of lox sites and att sites.

375. The method of claim 373, wherein said at least one additional recombination site is at least one lox site or a mutant thereof.

376. The method of claim 373, wherein said at least one additional recombination site is a lox site.

377. The method of claim 376, wherein said lox site is a loxP site.

378. The method of claim 373, wherein said at least one additional recombination site is at least one aft site or a mutant thereof.

379. The method of claim 373, wherein said at least one additional recombination site is an art site. QO7I Jw I 17?spLdoc.fl COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec. 2007 16:09 BALDWINS 0064 4 4736712 No.6725 P. 11/79 -93-

380. The method of claim 379, wherein said all site is selected from the group consisting of an aatB site, an atffP site, an ailL site and an atR site.

381. The method of claim 364, wherein said promoter is located adjacent to said first recombination site.

382. The method of claim 364, wherein said antibiotic resistance gene is located adjacent to said second recombination site.

383. The method of claim 364, wherein said first nucleic acid molecule or said second nucleic acid molecule comprises at least one cloning-site.

384. The method of claim 364, wherein said at least one recombination protein is selected from the group consisting of Cre, Int, IIHF, Xis, FLP, y8, Tn3 resolvase, Hin, Gin, Cin and combinations thereof.

385. The method of claim 364, wherein said at least one recombination protein is

386. The method of claim 364, wherein said at least one recombination protein is selected from the group consisting of Int, IHF and Xis.

387. The method of claim 364, wherein said first nucleic acid molecule or said second nucleic acid molecule or said third nucleic acid molecule is a vector.

388. The method of claim 387, wherein said vector is an expression vector.

389. The method of claim 364, wherein said first nucleic acid molecule or said second nucleic acid molecule is linear.

390. The method of claim 364, wherein said first or said second portions of said gene are PCR products. 041M7/Q.3, I179 7 ,pa.do,.)Y COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec. 2007 16:09 BALDWINS 0064 4 4736712 No.6725 P. 12/79 -94-

391. The method of claim 364, further comprising contacting at least one host o cell with said mixture, and selecting for a host cell comprising said third nucleic acid molecule. 0 5

392. The method of claim 391, further comprising selecting against a host cell comprising said first or said second nucleic acid molecule.

393. The method of claim 391, further comprising selecting against a host cell Scomprising said first and said second nucleic acid molecule. 8 394. The method of claim 391, wherein said host cell is a prokaryotic cell.

395. The method of claim 391, wherein said host cell is a bacterial cell.

396. The method of claim 391, wherein said host cell is an Escherichia coli cell.

397. The method of claim 364, further comprising introducing said third nucleic acid molecule into a host cell.

398. The method of claim 364, further comprising introducing said nucleic acid molecule into a host cell and expressing said antibiotic iesistance gene.

399. The method of claim 398, wherein said host cell is an Escherichia coli cell.

400. A method of producing a nucleic acid molecule comprising: providing a first nucleic acid molecule comprising at least one promoter and at least a first loxP site; providing a second nucleic acid molecule comprising at least one antibiotic resistance gene and at least a second loxP site; and forming a mixture between said first and second nucleic acid molecules and at least one Cre recombination protein, under conditions sufficient to cause recombination between said first and second loxP sites, thereby producing a third nucleic acid molecule in which said promoter and said antibiotic resistance gene are operably linked. 0 4 /710J3.I 7 9 7 spa.dow.94 COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec. 2007 16:09 BALDWINS 0064 4 4736712 No.6725 P. W3/79 95

401. The method of claim 400, wherein said antibiotic resistance gene is selected 0 ofrom the group consisting of a chloramphenicol resistance gene, an ampicillin resistance gene, a methicillin resistance gene, a tetracycline resistance gene and a kanamycin resistance gene.

402. The method of 400, wherein said antibiotic resistance gene is a chloramphenicol resistance gene.

403- The method of claim 400, further comprising ititroducing said third nucleic acid molecule into a host cell.

404. The method of claim 400, further comprising introducing said third nucleic acid molecule into a host cell and expressing said antibiotic resistance gene.

405. The method according to any one of claims 403 or 404, wherein said host cell is an Escherichia coli cell.

406. A method of producing a nucleic acid molecule comprising: providing a first nucleic acid molecule comprising at least one portion of a first gene and at least a first recombination site; providing a second nucleic acid molecule comprising at least one portion of a second gene and at least a second recombination site; and forming a mixture in vitro between said first and second nucleic acid molecules and at least one recombination protein, under conditions sufficient to cause recombination in vitro between said first and second recombination sites, thereby producing a third nucleic acid molecule in which said portions of said first and second genes are operably linked to form a functional gene. 407, The method of claim 406, wherein said first gene and said second gene are the same.

408. The method of claim 406, wherein said first gene or said second gene encodes a selectable marker. COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec, 2007 16:10 BALDWINS 0064 4 4736712 No.6725 P. 14,/79 96-

409. The method of claim 406, wherein said first gene or said second gene is an antibiotic resistance gene.

410. The method of claim 409, wherein said antibiotic resistance gene is selected from the group consisting of a chloramphenicol resistance gene, an ampicillin resistance gene, a methicillin resistance gene, a tetracycline resistance gene and a kanamycin resistance gene.

411. The method of claim 409, wherein said antibiotic resistance gene .is a chloramphenicol resistance gene.

412. The method of claim 406, wherein said at least one portion of said first gene or of said second gene comprises a promoter.

413. The method of claim 406, wherein said at least one portion of said first gene or of said second gene is a fragment of a structural gene.

414. The method of claim 406, wherein said first gene or said second gene encodes a heterodimeric gene product.

415. The method of claim 406, wherein said first and second recombination sites are selected from the group consisting of lox sites, alt sites, and mutants thereof.

416. The method of claim 406, wherein said first and second recombination sites are selected from the group consisting of lox sites and au sites.

417. are lox sites. The method of claim 406, wherein said first and second recombination sites

418. The method of claim 417, wherein said lox sites are loxP sites.

419. are att sites. The method of claim 406, wherein said first and second recombination sites 04,OTID3.,w 1797wam.,96 COMS ID No: ARCS-172228 Received by IP Australia: lime 14:20 Date 2007-12-13 13,Dec, 2007 16:10 BALDWINS 0064 4 4736712 No,6725 P. 15/79 -97

420. The method of claim 419, wherein said att sites are selected from the group consisting of attB sites, attP sites, aWtL sites and attR sites.

421. The method of claim 406, wherein said first nucleic acid molecule or said second nucleic acid molecule further comprises at least one additional recombination site.

422. The method of claim 421, wherein said at least one additional recombination site is selected from the group consisting of lax sites and art sites. 0 423. The method of claim 421, wherein said at least one additional recombination site is at least one lox site or a mutant thereof

424. The method of claim 421, wherein said at least one additional recombination site is a lox site.

425. The method of claim 424, wherein said lox site is a loxP site.

426. The method of claim 421, wherein said at least one recombination site is at least one art site or a mutant thereof.

427. The method of claim 421, wherein said at least one recombination site is an at site. additional additional

428. The method of claim 427, wherein said att site is selected from the group consisting of an attB site, an attP site, an attL site and an attR site.

429. The method of claim 406, wherein said at least one portion of said first gene is located adjacent to said first recombination site.

430. The method of claim 406, wherein said at least one portion of said second gene is located adjacent to said second recombination site.

431. The method of claim 406, wherein said first nucleic acid molecule or said second nucleic acid molecule comprises at least one cloning site. Q4/07/tf.w I '17".p4dv97 COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13,Dec. 2007 16:10 BALDWINS 0064 4 4736712 No,6725 P. 16/79 -98-

432. The method of claim 406, wherein said at least one recombination protein is selected from the group consisting of Cre, Int, IHF, Xis, FLP,, Tn3 resolvase, Hin, Gin, Cin and combinations thereof.

433. The method of claim 406, wherein said at least one recombination protein is Cre.

434. The method of claim 406, wherein said at least one recombination protein is selected from the group consisting of Int, IHF and Xis.

435. The method of claim 406, wherein said at least one recombination protein is

436. The method of claim 406, wherein said at least one recombination protein is IHF.

437. The method of claim 406, wherein said at least one recomrbination protein is Xis.

438. The method of claim 406, wherein said first nucleic acid molecule or said second nucleic acid molecule or said third nucleic acid molecule is a vector.

439. The method of claim 438, wherein said vector is an expression vector.

440. The method of claim 406, wherein said first nucleic acid molecule or said second nucleic acid molecule is linear.

441. The method of claim 406, wherein said at least one portion of said first gene or of said second gene is a PCR product.

442. The method of claim 406, further comprising expressing said functional gene. 041/0710 jwl I 797lspal.doc.91 COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec. 2007 16:10 BALDWINS 0064 4 4736712 No.6725 P. 17/79 -99-

443. The method of claim 406, further comprising contacting at least one host Scell with said mixture, and selecting for a host cell comprising said third nucleic acid molecule. C) 0 5 444. The method of claim 443, further comprising selecting against a host cell comprising said first or said second nucleic acid molecule. S445. The method of claim 443, further comprising selecting against a host cell comprising said first and said second nucleic acid molecules. S446. The method of claim 443, further comprising expressing said functional 0 gene in said selected host cell.

447. The method of claim 443, wherein said host cell is a prokaryotic cell.

448. The method of claim 443, wherein said host cell is a bacterial cell.

449. The method of claim 443, wherein said host cell is an Escherichia coli cell.

450. A method of producing a nucleic acid molecule comprising: providing a first nucleic acid molecule comprising a first portion of an antibiotic resistance gene and at least a first recombination site; providing a second nucleic acid molecule comprising a second portion of said antibiotic resistance gene and at least a second recombination site; and forming a mixture in vitro between said first and second nucleic acid molecules and at least one recombination protein, under conditions sufficient to cause recombination in vitro between said first and second recombination sites, thereby producing a third nucleic acid molecule in which said first and second portions of said gene are operably linked to form a functional antibiotic resistance gene.

451. The method of claim 450, wherein said antibiotic resistance gene is selected from the group consisting of a chloramphenicol resistance gene, an ampicillin resistance gene, a methicillin resistance gene, a tetracycline resistance gene and a kanamycin resistance gene. 04/07/03,l 1797.sp.doe.99 COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13-Dec, 2007 16:10 BALDWINS 0064 4 4736712 No,6725 P. 18/79 100- o 452. The method of claim 450, wherein said antibiotic resistance gene is a chloramphericol resistance gene.

453. The method of claim 450, wherein said first or second portion of said gene comprises a promoter.

454. The method of claim 450, wherein said first and second recombination sites are selected from the group consisting of lox sites, at sites, and mutants thereof.

455. The method of claim 450, wherein said first and second recombination sites oare selected from the group consisting of lox sites and at sites.

456. The method of claim 450, wherein said first and second recombination sites are lox sites.

457. The method of claim 456, wherein said lox sites are toxP sites.

458. The method of claim 450, wherein said first and second recombination sites are an sites.

459. The method of claim 458, wherein said at sites are selected from the group consisting of attB sites, attP sites, attL sites and attR sites.

460. The method of claim 450, wherein said first nucleic acid molecule or said second nucleic acid molecule further comprises at least one additional recombination site.

461. The method of claim 460, wherein said at least one additional recombination site is selected from the group consisting of lox sites and att sites.

462- The method of claim 460, wherein said at least one additional recombination site is at least one lox site or a mutant thereof. 04/U7/ U.wI 1 7 9 7 vP..dw.IO0 COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13Dec, 2007 16:11 BALDWINS 0064 4 4736712 No.6725 P. 19/79 101

463. The method of claim 460, wherein said at least one additional recombination site is a lox site.

464. The method of claim 463, wherein said lox site is a loxP site.

465. The method of claim 460, wherein said at least one additional recombination site is at least one alt site or a mutant thereof.

466. The method of claim 460, wherein said at least one additional recombination site is an att site.

467. The method of claim 466, wherein said att site is selected from the group consisting of an auB site, an aIP site, an attL site and an atR site,

468. The method of claim 450, wherein said first portion of said gene is located adjacent to said first recombination site.

469. The method of claim 450, wherein said second portion of said gene is located adjacent to said second recombination site.

470. The method of claim 450, wherein said first nucleic acid molecule or said second nucleic acid molecule comprises at least one cloning site.

471. The method of claim 450, wherein said at least one recombination protein is selected from the group consisting of Cre, Int, IHF, Xis, FLP,, Tn3 resolvase, Hin, Gin, Cin and combinations thereof

472. The method of claim 450, wherein said at least one recombination protein is

473. The method of claim 450, wherein said at least one recombination protein is selected from the group consisting of It, IHF and Xis. Oi71I0D3w 1797Sto. Ina I COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec. 2007 16:11 BALDWINS 0064 4 4736712 No.6725 P. 2 -102-

474. The method of claim 450, wherein said first nucleic acid molecule or said second nucleic acid molecule or said third nucleic acid molecule is a vector.

475. The method of claim 474, wherein said vector is an expression vector.

476. The method of claim 450, wherein said first nucleic acid molecule or said second nucleic acid molecule is linear.

477. The method of claim 450, wherein said first or said second portions of said gene are PCR products.

478. The method of claim 450, further comprising contacting at least one host cell with said mixture, and selecting for a host cell comprising said third nucleic acid molecule.

479. The method of claim 478, further comprising selecting against a host cell comprising said first or said second nucleic acid molecule.

480. The method of claim 478, further comprising selecting against a host cell comprising said first and said second nucleic acid molecule.

481. The method of claim 478, wherein said host cell is a prokaryotic cell.

482. The method of claim 478, wherein said host cell is a bacterial cell.

483. The method of claim 478, wherein said host cell is an Escherichia coli cell.

484. The method of claim 450, further comprising introducing said third nucleic acid molecule into a host cell.

485. The method of claim 450, further comprising introducing said third nucleic acid molecule into a host cell and expressing said antibiotic resistance gene.

486. The method of claim 485, wherein said host cell is an Escherichia coli cell. 0/79 P4IQ7/03.tw I17 9 7 «paoc.J02 COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13,Dec. 2007 16:11 BALDWINS 0064 4 4736712 No.6725 P. 21/79 -103 o487. A method of producing a nucleic acid molecule comprising: providing a first nucleic acid molecule comprising at least one promoter and Cat least a first recombination site; 0 providing a second nucleic acid molecule comprising at least one antibiotic resistance gene and at least a second recombination site; and forming a mixture in vitro between said first and second nucleic acid _molecules and at least one recombination protein, under conditions sufficient to cause recombination in vitro between said first and second recombination sites, thereby i0 producing a third nucleic acid molecule in which said promoter and said antibiotic resistance gene are operably linked.

488. The method of claim 487, wherein said antibiotic resistance gene is selected from the group consisting of a chloramphenicol resistance gene, an ampicillin resistance gene, a methicillin resistance gene, a tetracycline resistance gene and a kanamycin resistance gene.

489. The method of claim 487, wherein said antibiotic resistance gene is a chloramphenicol resistance gene.

490. The method of claim 487, wherein said first and second recombination sites are selected from the group consisting oflox sites, att sites, and mutants thereof.

491. The method of claim 487, wherein said first and second recombination sites are selected from the group consisting of lox sites and art sites.

492. The method of claim 487, wherein said first and second recombination sites are lox sites.

493. The method of claim 492, wherein said lox sites are loxP sites.

494. The method of claim 487, wherein said first and second recombination sites are art sites. O /7O&.swt I spo.24,303 COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec, 2007 16:11 BALDWINS 0064 4 4736712 No,6725 P. 22/79 104-

495. The method of claim 494, wherein said all sites are selected from the group 0 oconsisting of atB sites, attP sites, attL sites and attR sites.

496. The method of claim 487, wherein said first nucleic acid molecule or said second nucleic acid molecule further comprises at least one additional recombination site.

497. The method of claim 496, wherein said at least one additional _recombination site is selected from the group consisting of lox sites and art sites.

498. The method of claim 496, wherein said at least one additional recombination site is at least one lox site or a mutant thereof

499. The method of claim 496, wherein said at least one additional recombination site is a lox site.

500. The method of claim 499, wherein said lox site is a loxP site.

501. The method of claim 496, wherein said at least one additional recombination site is at least one art site or a mutant thereof

502. The method of claim 496, wherein said at least one additional recombination site is an art site.

503. The method of claim 502, wherein said aut site is selected from the group consisting of an attB site, an attP site, an attL site and an attR site.

504. The method of claim 487, wherein said promoter is located adjacent to said first recombination site.

505. The method of claim 487, wherein said antibiotic resistance gene is located adjacent to said second recombination site.

506. The method of claim 487, wherein said first nucleic acid molecule or said second nucleic acid molecule comprises at least one cloning site. I 1797srp .d.JO4 COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13-Doo. 2007 16:12 BALDWINS 0064 4 4736712 No.6725 P. 23/79 105-

507. The method of claim 487, wherein said at least one recombination protein is selected from the group consisting of Cre, Int, IHF, Xis, FLP,., Tn3 resolvase, Hin, Gin, Cin and combinations thereof.

508. The method of claim 487, wherein said at least one recombination protein is Cre.

509. The method of claim 487, wherein said at least one recombination protein is selected from the group consisting of Int, IHF and Xis.

510. The method of claim 487, wherein said first nucleic acid molecule or said second nucleic acid molecule or said third nucleic acid molecule is a vector.

511. The method of claim 510, wherein said vector is an expression vector.

512. The method of claim 487, wherein said first nucleic acid molecule or said second nucleic acid molecule is linear.

513. The method of claim 487, wherein said first or said second portions of said gene are PCR products.

514. The method of claim 487, further comprising contacting at least one host cell with said mixture, and selecting for a host cell comprising said third nucleic acid molecule.

515. The method of claim 514, further comprising selecting against a host cell comprising said first or said second nucleic acid molecule.

516. The method of claim 514, further comprising selecting against a host cell comprising said first and said second nucleic acid molecule.

517. The method of claim 514, wherein said host cell is a prokaryotic cell. 04/07/M ,sw3 7 9 7 sp COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec. 2007 16:12 BALDWINS 0064 4 4736712 No.6725 P. 24/79 -106-

518. The method of claim 514, wherein said host cell is a bacterial cell. O 0

519. The method of claim 514, wberein said host cell is an Escherichia coli cell. U C)

520. The method of claim 487, further comprising introducing said third nucleic Ce acid molecule into a host cell.

521. The method of claim 487, further comprising introducing said nucleic acid molecule into a host cell and expressing said antibiotic resistance gene.

522. The method of claim 521, wherein said host cell is an Escherichia coli cell. 0

523. A method of producing a nucleic acid molecule comprising: providing a first nucleic acid molecule comprising at least one promoter and at least a first loxP site; providing a second nucleic acid molecule comprising at least one antibiotic resistance gene and at least a second loxP site; and forming a mixture in vitro between said first and second nucleic acid molecules and at least one Cre recombination protein, under conditions sufficient to cause recombination in vitro between said first and second loxP sites, thereby producing a third nucleic acid molecule in which said promoter and said antibiotic resistance gene are operably linked.

524. The method of claim 523, wherein said antibiotic resistance gene is selected from the group consisting of a chloramphenicol resistance gene, an ampicillin resistance gene, a methicillin resistance gene, a tetracycline resistance gene and a kanamycin resistance gene.

525. The method of claim 523, wherein said antibiotic resistance gene is a chloramphenicol resistance gene.

526. The method of claim 523, further comprising introducing said third nucleic acid molecule into a host cell. 04/T .swi tI 197lsp.at I 6 COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13 Dec. 2007 16:12 BALDWINS 0064 4 4736712 No.6725 P. 25/79 107-

527- The method of claim 523, further comprising introducing said third nucleic acid molecule into a host cell and expressing said antibiotic resistance gene. 0

528. The method of claim 527, wherein said host cell is an Escherichia coli cell.

529. The method of claim 528, wherein said host cell is an Escherichia coli cell.

530. A kit for in vitro cloning of nucleic acid segments comprising at least one Sisolated recombination protein and at least one isolated nucleic acid molecule comprising at least a first recombination site containing at least one nucleic acid sequence selected Sfrom the group consisting of a nucleic acid sequence that is 80-99% homologous to one or Smore of SEQ ID NOs:I-16, a complementary DNA sequence thereto, and an RNA sequence corresponding thereto.

531. A kit for in vitro cloning of nucleic acid segments comprising at least one isolated recombination protein and at least one isolated nucleic acid molecule comprising at least a first recombination site containing at least one nucleic acid sequence selected from the group consisting of a nucleic acid sequence that hybridizes under stringent conditions to one or more of SEQ ID NOs: 1-16, a complementary DNA sequence thereto, and an RNA sequence corresponding thereto.

532. A kit for in vitro cloning of DNA segments comprising at least one isolated recombination protein and at least one isolated nucleic acid molecule comprising at least a first recombination site containing at least one nucleic acid sequence selected from the group consisting of a mutated att recombination site containing at least one mutation that enhances recombinational specificity, a complementary DNA sequence thereto, and an RNA sequence corresponding thereto.

533. The kit according to any one of claims 530-532, wherein the nucleic acid molecule comprises at least a first and a second recombination site.

534. The kit of claim 532, wherein said mutated att site comprises at least one nucleic acid sequence as set forth in SEQ ID NOs.: 1-16. 041/07M3,w 1i77 ps. ,j 7 COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec, 2007 16:12 BALDWINS 0064 4 4736712 No,6725 P. 26/79 108-

535. The kit of claim 532, wherein said mutated att site comprises at least one nucleic acid sequence that is 80-99% homologous to at least one nucleic acid sequence as set forth in SEQ ID NOs.: 1-16. C-) 0 536. The kit according to any one of claims 530-533, wherein said'recombination proteins are selected from the group consisting of y8, Tn3 resolvase, Hin, Gin, Cin, and Fip.

537. The kit according to any one of claims 530-533, wherein said recombination proteins are selected from the group consisting of Int, IHF, Xis and Cre. o538. The kit according to any one of claims 530-533, wherein said recombination proteins are selected from the group consisting of Int, [F and Xis.

539. The kit according to any one of claims 530-533, wherein at least one of said recombination proteins is Int.

540. The kit according to any one of claims 530-533, wherein at least one of said recombination proteins is encoded by an organism selected from the group consisting of bacteriophage lambda, phi 80, P22, P2, 186, P4 and P1.

541. The kit according to any one of claims 530-533, wherein at least one of said recombination proteins is encoded by bacteriophage lambda.

542. The kit according to any one of claims 530-533, wherein at least one of said recombination proteins is encoded by Bacillus thuringlensis.

543. The kit according to any one of claims 530-533, wherein said kit comprises Tnt and IHF.

544. The kit of claim 543, wherein said kit further comprises Xis.

545. The kit of any one of claims 530-533, wherein said kit comprises at least two recombination proteins that are different from each other. 84,/i17JO'ls l 9 "'pa'd 4 0 ol COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Deac. 2007 16:13 BALDWINS 0064 4 4736712 No,6725 P. 27/79 -109-

546. The kit of any one of claims 530-533, wherein said kit comprises at least three recombination proteins that are different from each other.

547. The kit according to claim 533, wherein said first and second recombination sites have been engineered to enhance recombination efficiency.

548. A kit comprising at least one nucleic acid molecule, wherein said nucleic acid molecule comprises at least a first lox site flanked by at least one promoter and at least one antibiotic resistance gene.

549. The kit of claim 548, wherein said lox site is a JoxP site.

550. The kit of claim 548, wherein said lox site is a loxP site and wherein said promoter and said antibiotic resistance gene are operably linked.

551. The kit of claim 548, wherein said nucleic acid molecule is a vector.

552. The kit of claim 548, wherein said kit further comprises one or more components selected from the group consisting of at least one recombination protein and at least one host cell.

553. The kit of claim 552, wherein said at least one recombination protein is selected from the group consisting of Cre, Int, HE, Xis, FLP, 75, TN3 resolvase, Hin, Gin, Cin and combinations thereof.

554. The kit of claim 552, wherein said at least one recombination protein is Cre.

555. The kit of claim 552, wherein said at least one recombination protein is selected from the group consisting of Int, IHF, Xis and combinations thereof

556. The kit of claim 552, wherein said host cell is an Escherichia coli cell. COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13Dec. 2007 16:13 BALDWINS 0064 4 4736712 No.6725 P. 28/79 -110-

557. A kit comprising at least one nucleic acid molecule, wherein said nucleic 8 acid molecule comprises at least one promoter operably linked to at least one antibiotic C resistance gene, wherein said promoter and said antibiotic resistance gene are separated by 0 at least one recombination site.

558. The kit of claim 557, wherein said first recombination site is selected from the group consisting of a lox site, an att site, and mutants thereof. S559. The kit of claim 557, wherein said first recombination site is a lox site:- Co

560. The kit of claim 559, wherein said lox site is a loxP site. 0

561. The kit of claim 557, wherein said nucleic acid mblecule further comprises at least one additional recombination site.

562. The kit of claim 561, wherein said at least one additional recombination site is selected from the group consisting of lox sites and att sites.

563. The kit of claim 561, wherein said at least one additional recombination site is a lox site.

564. The kit of claim 563, wherein said lox site is a loxP site.

565. The kit of claim 557, wherein said nucleic acid molecule comprises at least one cloning site.

566. The kit of claim 557, wherein said nucleic acid molecule is a vector.

567. The kit of claim 566, wherein said vector is an expression vector.

568. The kit of claim 557, wherein said antibiotic resistance gene is selected from the group consisting of a chloramphenicol resistance gene, an ampicillin resistance gene, a methicillin resistance gene, a tetracycline resistance gene and a kanamycin resistance gene. 04/07/03,swi 179#lp..oe6 I COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec. 2007 16:13 BALDWINS 0064 4 4736712 No.6725 P. 29/79 -lll- o 569. The kit of claim 557, wherein said antibiotic resistance gene is a C, chloramphenicol resistance gene.

570. The kit of claim 557, wherein said kit further comprises one or more components selected from the group consisting of at least one recombination protein and at least one host cell. O571. The kit of claim 570, wherein said at least one recombination protein is selected from the group consisting of Cre, Int, IHF, Xis, FLP, 7y, TN3 resolvase, Hin, Gin, Cin and combinations thereof

572. The kit of claim 570, wherein said at least one recombination protein is Cre.

573. The kit of claim 570, wherein said at least one recombination protein is selected from the group consisting of Int, IHF, Xis and combinations thereof.

574. The kit of claim 570, wherein said host cell is an Esoherichia coli cell.

575. A kit comprising at least one nucleic acid molecule, wherein said nucleic acid molecule comprises a functional antibiotic resistance gene, wherein a first portion of said antibiotic resistance gene and a second portion of said antibiotic resistance gene are separated by at least a first recombination site.

576. The kit of claim 575, wherein said first and second portions of said antibiotic resistance gene are operably linked.

577. The kit of claim 575, wherein said first portion of said antibiotic resistance gene is a promoter.

578. The kit of claim 575, wherein said first recombination site is selected from the group consisting of a lox site, an art site, and mutants thereof

579. The kit of claim 575, wherein said first recombination site is a lox site. 04i0fl62.WI 17 9 7 pa.doc, I a I COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec, 2007 16:13 BALDWINS 0064 4 4736712 No6725 P. 30/79 -112-

580. The kit of claim 579, wherein said lax site is a loxP site.

581. The kit of claim 575, wherein said nucleic acid molecule further comprises 0 5 at least one additional recombination site.

582. The kit of claim 581, wherein said at least one additional recombination site 4 is selected from the group consisting of lax sites and an sites. 1i

583. The kit of claim 581, wherein said at least one additional recombination site is a lox site.

584. The kit of claim 583, wherein said lax site is a loxP site.

585. The kit of claim 575, wherein said nucleic aoid molecule comprises at least one cloning site.

586. The kit of claim 575, wherein said nucleic acid molecule is a vector.

587. The kit of claim 586, wherein said vector is an expression vector.

588. The kit of claim 575, wherein said antibiotic resistance gene is selected from the group consisting of a chloramphenicol resistance gene, an ampicillin resistance gene, a methicillin resistance gene, a tetracycline resistance gene and a kanamycin resistance gene.

589. The kit of claim 575, wherein said antibiotic resistance gene is a chloramphenicol resistance gene.

590. The kit of claim 575, wherein said first portion of said gene is located adjacent to said reconbination site.

591. The kit of claim 575, wherein said second portion of said gene is located adjacent to said recombination site. 0417/O.sw I 1797ai.doe.[ J 2 COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec. 2007 16:13 BALDWINS 0064 4 4736712 No.6725 P. 31/79 -113- 8 592. The kit of claim 575, wherein said kit further comprises one or more c components selected from the group consisting of at least one recombination protein and at d least one host cell.

593. The kit of claim 592, wherein said at least one recombination protein is selected from the group consisting of Cre, Int, IHF, Xis, FLP, 76, TN3 resolvase, Hin, Gin, Cin and combinations thereof. 10 594. The kit of claim 592, wherein said at least one recombination protein is Cre. S595. The kit of claim 592, wherein said at least one recombination protein is selected from the group consisting of Int, IHF, Xis and combinations thereof.

596. The kit of claim 592, wherein said host cell is an Escherichia coli cell.

597. A kit comprising at least one nucleic acid molecule, wherein said nucleic acid molecule comprises at least one promoter operably linked to at least one antibiotic resistance gene, wherein said promoter and said antibiotic resistance gene are separated by at least one loxP site.

598. The kit of claim 597, wherein said antibiotic resistance gene is selected from the group consisting of a chloramphenicol resistance gene, an ampicillin resistance gene, a methicillin resistance gene, a tetracycline resistance gene and a kanamycin resistance gene.

599. The kit of claim 597, wherein said antibiotic resistance gene is a chloramphenicol resistance gene.

600. The kit of claim 597, wherein said kit further comprises one or more components selected from the group consisting of at least one recombination protein and at least one host cell. 04/07/03.ll I 7971sp.do 13 COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec. 2007 16:14 BALDWINS 0064 4 4736712 No.6725 P. 32/79 -114-

601. The kit of claim 600, wherein said at least one recombination protein is o selected from the group consisting of Cre, Int, IHF, Xis, FLP, S7, TN3 resolvase, Hin, Gin, l Cin and combinations thereof. C)

602. The kit of claim 600, wherein said at least one recombination protein is Cre.

603. The kit of claim 600, wherein said at least one recombination protein is selected from the group consisting of Int, IHF, Xis and combinations thereof.

604. The kit of claim 600, wherein said host cell is an Escherichia coli cell. a 605. A kit comprising at least one nucleic acid molecule, wherein said nucleic l acid molecule comprises at least one functional antibiotic resistance gene, wherein said functional gene comprises a promoter and an antibiotic resistance gene separated from each other by at least one loxP site.

606. The kit of claim 605, wherein said antibiotic resistance gene is selected from the group consisting of a chlorampbenicol resistance gene, an ampicillin resistance gene, a methicillin resistance gene, a tetracycline resistance gene and a kanamycin resistance gene.

607. The kit of claim 605, wherein said antibiotic resistance gene is a chloramphenicol resistance gene.

608. The kit of claim 605, wherein said kit further comprises one or more components selected from the group consisting of at least one recombination protein and at least one host cell.

609. The kit of claim 608, wherein said at least one recombination protein is selected from the group consisting of Cre, Int, IHF, Xis, FLP, yS, TN3 resolvase, Hin, Gin, Cin and combinations thereof.

610. The kit of claim 608, wherein said at least one recombination protein is Cre. 047O'l 3.wl ]797spa.d.Cl 14 COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13.Dec. 2007 16:14 BALDWINS 0064 4 4736712 No.6725 P. 33/79 115-

611. The kit of claim 608, wherein said at least one recombination protein is selected from the group consisting of Int, IHF, Xis and combinations thereof. C

612. The kit of claim 608, wherein said host cell is an Escherichia coli cell. 0

613. The kit according to any one of claims 552, 570, 592, or 600, wherein said nucleic acid molecule is a vector.

614. A kit comprising at least one isolated recombination protein and at least one isolated nucleic acid molecule, said nucleic acid molecule comprising at least a first att Srecombination site which comprises a core region having at least one mutation that enhances recombination efficiency or specificity in vitro in-the formation of a cointegrate 1 DNA or a product DNA molecule.

615. The kit of claim 614, wherein said recombination site confers at least one enhancement selected from the group consisting of enhancing excisive recombination; (ii) enhancing integrative recombination; (iii) decreasing the requirement for host factors; (iv) increasing the efficiency of the formation reaction by recombination of said cointegrate DNA or of said product DNA; increasing the specificity of the formation reaction by recombination of said cointegrate DNA or of said product DNA; and (vi) increasing the specificity or yield of a subsequent recombination reaction of, or subsequent isolation of, the product DNA.

616. The kit of claim 614, wherein said core region comprises a nucleic acid sequence selected from the group consisting of: a) RKYCWGCTTTYKTRTACNAASTSGB (m-att) (SEQ ID NO:I); b) AGCCWGCTTTYKTRTACNAACTSGB (m-attB) (SEQ ID NO:2); c) GTTCAGCTTTCKTRTACNAACTSGB (m-attR) (SEQ ID NO:3); d) AGCCWGCTTTCKTRTACNAAGTSGB (m-attL) (SEQ ID NO:4); c) GTTCAGCTTTYKTRTACNAAGTSGB (m-attPI) (SEQ ID and a corresponding or complementary DNA or RNA sequence, wherein R=A or G; K-G or T/U; Y=C or T/U; W=A or T/U; N=A or C or G or T/U; S=C or G; and B=C or G or T/U. 04o7JD3.l- I1797 p.d4, S1 COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13 13-Dec. 2007 16:14 13.0e 200716:14 BALDWLNS 0064 4 4736112 N.75P 41 No-6725 P. 34/79 -116-

617. Thie kit of claim 614. wherein said core regio~n comprises a nucleic acid sequence selected from the group consisting of: a) AGCCTGCrITTTGTACAAACTTGT (attJ3l) (SEQ MD NO:6); b) AOCCTGCTTYGTACAAACTTGT (attB2) (SEQ ID NO:7); c) ACCCAGCMTCTGTACAAACLTGT (atflJ3) (SEQ ID NO:8); d) GYTCAGCrrrI7rGTACAAAC1TGT (attkl) (SEQ ID NO:-9); e) GTTCAGCTrCTTOTACAAAC ITGT (attR2) (SEQ ID NO: 0) G3TCAGCTITCTTrGTACAAJLGTTGG (attR3) (SEQ ID NO: 11); g) AGCCTGCrrnTTGTACAAAGTTGQ (att, 1) (SEQ ID NO.:12); h) AGCCTOC-FFICrFGTACAAAGIrTOO (attL2) (SEQ ID) NO: 13); i) ACGCAGCTTTCITGTACAAAGTTOG (attL3) (SEQ ID NO: 14); j) GTAGCnTIIII GTACAAAGTTGG (atPl) (SEQ ID NO: k) GITCAGCTTTCTTGTACAAAGTTGG (attP2, F3) (SEQ ID NO:l16); and. a corresponding or complementary DNA or RNA sequence. DATED is 1Ith day of December 2007 INVITROGEN CORPORATION By their Patent Attorneys: BALDWINS 07 J04W4,sw327fl~j16G COMS ID No: ARCS-172228 Received by IP Australia: Time 14:20 Date 2007-12-13