AU2007231821A1 - Porphyromonas gingivalis polypeptides and nucleotides - Google Patents

Description

P/00/011 Regulation 3.2

O

z

AUSTRALIA

Patents Act 1990 COMPLETE SPECIFICATION STANDARD PATENT

(ORIGINAL)

Name of Applicant(s): Actual Inventor(s): CSL Limited, of 45 Poplar Road, Parkville, Victoria 3052 Australia ROSS, Bruce Cater PATTERSON, Michelle Anne AGIUS, Catherine Therese ROTHEL, Linda Joy MARGETTS, Mai Brigid HOCKING, Dianna Margaret WEBB. Elizabeth Ann Address for Service: Davies Collison Cave 1 Nicholson Street Melbourne, Victoria, 3000 (GPO Box 4387) Telephone: +61 3 9254 2777 Facsimile: +61 3 9254 2770 Invention Title: Porphyromonas gingivalis polypeptides and nucleotides The following statement is a full description of this invention, including the best method of performing it known to us:- 1-- 0 Porphorymonas gingivalis polypeptides and nucleotides FIELD OF THE INVENTION The present invention relates to P. gingivalis nucledtide sequences, P. gingivalis polypeptides and probes for detection ofP. gingivalis. The 00 P. gingivalis polypeptides and nucleotides can be used in compositions for C use in raising an immune response in a subject against P. gingivalis and treating or preventing or reducing the severity of the condition known as periodontitis.

BACKGROUND OF THE INVENTION Periodontal diseases are bacterial-associated inflammatory diseases of the supporting tissues of the teeth and range from the relatively mild form of gingivitis, the non-specific, reversible inflammation of gingival tissue to the more aggressive forms of periodontitis which are characterised by the destruction of the tooth's supporting structures. Periodontitis is associated with a subgingival infection of a consortium of specific Gram-negative bacteria that leads to the destruction of the periodontium and is a major public health problem. One bacterium that has attracted considerable interest is P. gingivalis as the recovery of this microorganism from adult periodontitis lesions can be up to 50% of the subgingival anaerobically cultivable flora, whereas P. gingivalis is rarely recovered, and then in low numbers, from healthy sites. A proportional increase in the level of P. gingivalis in subgingival plaque has been associated with an increased severity of periodontitis and eradication of the microorganism from the cultivable subgingival microbial population is accompanied by resolution of the disease. The progression of periodontitis lesions in non-human primates has been demonstrated with the subgingival implantation of P. gingivalis.

These findings in both animals and humans suggest a major role for P. gingivalis in the development of adult periodontitis.

P. gingivalis is a black-pigmented, anaerobic, asaccharolytic, proteolytic Gram-negative rod that obtains energy from the metabolism of specific amino acids. The microorganism has an absolute growth requirement for iron, preferentially in the form of haeme or its Fe(III) O2 O 0 oxidation product haemin and when grown under conditions of excess Z haemin is highly virulent in experimental animals. A number of virulence 0 factors have been implicated in the pathogenicity ofP. gingivalis including the capsule, adhesins, cytotoxins and extracellular hydrolytic enzymes.

5 In order to develop an efficacious and safe vaccine to prevent, eliminate or reduce P. gingivalis colonisation it is necessary to identify and Sproduce antigens that are involved in virulence that have utility as Simmunogens possibly through the generation of specific antibodies. Whilst it is possible to attempt to isolate antigens directly from cultures ofP. gingivalis this is often difficult. For example as mentioned above, P. gingivalis is a N strict anaerobe and can be difficult to isolate and grow. It is also known that, for a number of organisms, when cultured in vitro that many virulence genes are down regulated and the encoded proteins are no longer expressed. If conventional chemistry techniques were applied to purify vaccine candidates potentially important (protective) molecules may not be identified. With DNA sequencing, as the gene is present (but not transcribed) even when the organism is grown in vitro it can be identified, cloned and produced as a recombinant DNA protein. Similarly, a protective antigen or therapeutic target may be transiently expressed by the organismin vitro or produced in low levels making the identification of these molecules extremely difficult by conventional methods.

With serological identification of therapeutic targets one is limited to those responses which are detectable using standard methods such as Western Blotting or ELISA. The limitation here is the both the level of response that is generated by the animal or human and determining whether this response is protective, damaging or irrelevant. No such limitation is present with a sequencing approach to the identification of potential therapeutic or prophylactic targets.

It is also well known that P. gingivalis produces a range of broadly active proteases (University of Melbourne International Patent Application No PCT /AU 96/00673, US Patent Nos 5,475,097 and 5,523,390), which make the identification of intact proteins difficult because of their degradation by these proteases.

S3 O SUMMARY OF THE INVENTION V The present inventors have attempted to isolate P. gingivalis nucleotide sequences which can be used for recombinant production of P. gingivalis polypeptides and to develop nucleotide probes specific for C P. gingivalis. The DNA sequences listed below have been selected from a 0_ large number of P. gingivalis sequences according to their indicative potential C as vaccine candidates. This intuitive step involved comparison of the deduced protein sequence from the P. gingivalis DNA sequences to the 0 10 known protein sequence databases. Some of the characteristics used to N select useful vaccine candidates include; the expected cellular location, such as outer membrane proteins or secreted proteins, particular functional activities of similar proteins such as those with an enzymatic or proteolytic activity, proteins involved in essential metabolic pathways that when inactivated or blocked may be deleterious or lethal to the organism, proteins that might be expected to play a role in the pathogenesis of the organism eg. red cell lysis, cell agglutination or cell receptors and proteins which are paralogues to proteins with proven vaccine efficacy.

In a first aspect the present invention consists an isolated antigenic Porphorymonas gingivalis polypeptide, the polypeptide comprising; an amino acid sequence selected from the group consisting of SEQ.

ID. NO. 265 to SEQ. ID. NO. 528, SEQ. ID. NO. 531 and SEQ. ID. NO.

532; or an amino acid sequence at least 85%, preferably at least identical to an amino acid sequence selected from the group consisting of SEQ. ID. NO. 265 to SEQ. ID. NO. 528, SEQ. ID. NO.

531 and SEQ. ID. NO. 532; or at least 40 amino acids having a contiguous sequence of at least amino acids identical to a contiguous amino acid sequence selected from the group consisting of SEQ. ID. NO. 265 to SEQ. ID. NO. 528, SEQ. ID. NO. 531 and SEQ. ID. NO. 532.

In an embodiment of the present invention the polypeptide comprises; an amino acid sequence selected from the group consisting of SEQ.

ID. NO. 386 to SEQ. ID. NO. 528 and SEQ. ID. NO. 532; or 0 Z an amino acid sequence at least 85%, preferably at least Sidentical to an amino acid sequence selected from the group O consisting of SEQ. ID. NO. 386 to SEQ. ID. NO. 528 and SEQ. ID. NO.

532; or at least 40 amino acids having a contiguous sequence of at least OC amino acids identical to a contiguous amino acid sequence selected from the group consisting of SEQ. ID. NO. 386 to SEQ. ID. NO. 528 Cand SEQ. ID. NO. 532.

As used herein identity for polypeptides is to be calculated using the 010 alignment algorithm of Needleman and Munsch using a standard protein scoring matrix (Blosum In a preferred embodiment of the present invention the polypeptide comprises an amino acid sequence selected from the group consisting of SEQ. ID, NO. 386, SEQ. ID. NO. 424, SEQ. ID. NO. 425, SEQ. ID. NO. 434, SEQ. ID. NO. 447, SEQ. ID. NO. 458, SEQ. ID. NO. 475, SEQ. ID. NO. 498, SEQ. ID. NO. 499, SEQ. ID. NO. 500, SEQ. ID. NO. 501, SEQ. ID. NO. 387, SEQ. ID. NO. 400, SEQ. ID. NO. 411, SEQ. ID. NO. 419, SEQ. ID. NO. 420, SEQ. ID. NO. 427, SEQ. ID. NO. 429, SEQ. ID. NO. 433, SEQ. ID. NO. 437, SEQ. ID. NO. 438, SEQ. ID. NO. 443, SEQ. ID. NO. 444, SEQ. ID. NO. 448, SEQ. ID. NO. 449, SEQ. ID. NO. 452, SEQ. ID. NO. 455, SEQ. ID. NO. 457, SEQ. ID. NO. 459, SEQ. ID. NO. 461, SEQ. ID. NO. 462, SEQ. ID. NO. 463, SEQ. ID. NO. 467, SEQ. ID. NO. 468, SEQ. ID. NO. 469, SEQ. ID. NO. 482, SEQ. ID. NO. 484, SEQ. ID. NO. 485, SEQ. ID. NO. 494, SEQ. ID. NO. 508, SEQ. ID. NO. 509, SEQ. ID. NO. 510, SEQ. ID. NO. 520, SEQ. ID. NO. 521, SEQ. ID. NO. 522, SEQ. ID. NO. 525, SEQ. ID. NO. 526, SEQ. ID. NO. 528, SEQ. ID. NO. 389, SEQ. ID. NO. 390 and SEQ. ID. NO. 391.

In another preferred embodiment of the present invention the polypeptide comprises an amino acid sequence selected from the group consisting of residue 422 to residue 531 of SEQ. ID. NO. 303, residue 534 to residue 582 of SEQ. ID. NO. 303, residue 127 to residue 232 of SEQ. ID. NO.

301, residue 240 to residue 259 of SEQ. ID. NO. 301, residue 139 to residue 156 of SEQ. ID. NO. 295, residue 160 to residue 178 of SEQ. ID. NO. 295, residue 180 to residue 207 of SEQ. ID. NO. 295, residue 221 to residue 257 of SEQ. ID. NO. 295, residue 259 to residue 323 of SEQ. ID. NO. 295, residue 885 to residue 985 of SEQ. ID. NO. 299, residue 147 to residue 259 of SEQ, ID. NO. 363, residue 140 to residue 252 of SEQ. ID. NO. 344, residue 247 to (Nj Z residue 356 of SEQ. IID. NO. 353, residue 359 to residue 391 of SEQ. ID. NO.

353, residue 120 to residue 254 of SEQ. 11D. NO. 300, residue 287 to residue 311 of SEQ. ID. NO. 286, residue 313 to residue 352 of SEQ. ID. NO. 286, residue 354 to residue 401 of SEQ. ED. NO. 286, residue 208 to residue 252 of SEQ. ID. NO. 287, residue 259 to residue 373 of SEQ. ID. NO. 287, residue to residue 120 of SEQ. IID. NO. 293, residue 123 to residue 139 of SEQ. ID.

NO. 293, residue 233 to residue 339 of SEQ. ED. NO. 265, residue 67 to residue 228 of SEQ. ED. NO. 278, residue 130 to residue 172 of SEQ. ID. NO.

274, residue 174 to residue 238 of SEQ. ID. NO. 274, residue 99 to residue 112 of SEQ. ID. NO. 274, residue 114 to residue 128 of SEQ. ID. NO. 274, CK1 residue 26 to residue 69 of SEQ. ID. NO. 285, residue 71 to residue 128 of SEQ. MD. NO. 285, residue 130 to residue 146 of SEQ. IID. NO. 285, residue 620 to residue 636 of SEQ. MD. NO. 327, residue 638 to residue 775 of SEQ.

ID. NO. 327, residue 397 to residue 505 of SEQ. ID. NO. 301, residue 528 to residue 545 of SEQ. MD. NO. 301, residue 556 to residue 612 of SEQ. ED. NO.

301, residue 614 to residue 631 of SEQ. MD. NO. 301, residue 633 to residue 650 of SEQ. ID. NO. 301, residue 553 to residue 687 of SEQ. MD. NO. 299, residue 305 to residue 447 of SEQ. ED. NO. 289, residue 1 to residue 52 of SEQ. ED. NO. 364, residue 65 to residue 74 of SEQ. MD. NO. 364, residue 486 to residue 604 of SEQ. ID. NO. 275, residue 158 to residue 267 of SEQ. ID.

NO. 272, residue 270 to residue 282 of SEQ. MD. NO. 272, residue 163 to residue 237 of SEQ. MD. NO. 273, residue 240 to residue 251 of SEQ. ID. NO.

273, residue 213 to residue 344 of SEQ. ID. NO. 282, residue 183 to residue 324 of SEQ. ID. NO. 292, residue 327 to residue 341 of SEQ. ID. NO. 292, residue 352 to residue 372 of SEQ. MD. NO. 292, residue 141 to residue 166 of SEQ. MD. NO. 271, residue 168 to residue 232 of SEQ. MD. NO. 271, residue 1 to residue 13 of SEQ. IM. NO. 302, residue 15 to residue 28 of SEQ. ID. NO.

302, residue 30 to residue 72 of SEQ. ID. NO. 302, residue 476 to residue 529 of SEQ. MD. NO. 277, residue 41 to residue 146 of SEQ. MD. NO. 299, residue 149 to residue 162 of SEQ. ID. NO. 299, residue 166 to residue 177 of SEQ.

ID. NO. 299, residue 192 to residue 203 of SEQ. ID. NO. 299, residue 71 to residue 343 of SEQ. ID. NO. 290, residue 346 to residue 363 of SEQ. I1D. NO.

290, residue 36 to residue 240 of SEQ. ID. NO. 331, residue 242 to residue 270 of SEQ. ID. NO. 331, residue 1 to residue 192 of SEQ. ID. NO. 375, residue 266 to residue 290 of SEQ. MD. NO. 375, residue 23 to residue 216 of SEQ. ID. NO. 279, residue 220 to residue 270 of SEQ. MD. NO. 279, residue 0 285 to residue 386 of SEQ. ED. NO. 279, residue 84 to residue 234 of SEQ. ID.

Z NO. 297, residue 248 to residue 259 of SEQ. ID. NO. 297, residue 261 to residue 269 of SEQ. ED. NO. 297, residue 275 to residue 402 of SEQ. ID. NO.

294, residue 1 to residue 171 of SEQ ED. NO. 298, residue 403 to residue 417 of SEQ. ID. NO. 307, residue 420 to residue 453 of SEQ. ED. NO. 307, residue 456 to residue 464 of SEQ. ID. NO. 307, residue 468 to residue 690 of SEQ.

00 ID. NO. 307, residue 1 to residue 285 of SEQ. I1D. NO. 304, residue 287 to residue 315 of SEQ. ID. NO. 304, residue 318 to residue 336 of SEQ. ID. NO.

304, residue 255 to residue 269 of SEQ. ED. NO. 342, residue 271 to residue 337 of SEQ. ID. NO. 342, residue 347 to residue 467 of SEQ. ED. NO. 281, residue 116 to residue 136 of SEQ. ID. NO. 375, residue 138 to residue 357 of SEQ. ID. NO. 375, residue 133 to residue 423 of SEQ. ID. NO. 364, residue 141 to residue 299 of SEQ. ID. NO. 305, residue 202 to residue 365 of SEQ.

ID. NO. 296, residue 134 to residue 426 of SEQ. ED. NO. 288, residue 1 to residue 218 of SEQ. ID. NO. 276, residue 1 to residue 246 of SEQ. ID. NO.

280, residue 444 to residue 608 of SEQ. ED. NO. 364, residue 10 to residue 686 of SEQ. I0D. NO. 283, residue 1 to residue 148 of SEQ. ID. NO. 296, residue 1 to residue 191 of SEQ. MD. NO. 287, residue 193 to residue 204 of SEQ. ID. NO. 287, residue 209 to residue 373 of SEQ. IID. NO. 287, residue 211 to residue 470 of SEQ. MD. NO. 284, residue 472 to residue 482 of SEQ.

ID. NO. 284, residue 133 to residue 144 of SEQ. MD. NO. 281, residue 146 to residue 336 of SEQ. MD. NO. 281, residue 1 to residue 264 of SEQ. ED. NO.

303, residue 265 to residue 295 of SEQ. ID. NO. 303, residue 297 to residue 326 of SEQ. MD. NO. 303, residue 328 to residue 338 of SEQ. MD. NO. 303, residue 247 to residue 356 of SEQ. ID. NO. 353, residue 358 to residue 391 of SEQ. ID. NO. 353, residue 257 to residue 288 of SEQ. MD. NO. 298, residue 290 to residue 385 of SEQ. ED. NO. 298, residue 245 to residue 256 of SEQ.

MD. NO. 298, residue 422 to residue 802 of SEQ. ED. NO. 303, residue 803 to residue 814 of SEQ. MD. NO. 303, residue 139 to residue 156 of SEQ. ID. NO.

295, residue 160 to residue 340 of SEQ. ID. NO. 295, residue 145 to residue 361 of SEQ. ED. NO. 282, residue 363 to residue 387 of SEQ. 1D. NO. 282, residue 398 to residue 471 of SEQ. ID. NO. 282, residue 573 to residue 679 of SEQ. 1D. NO. 320, residue 27 to residue 168 of SEQ. IM. NO. 291, residue 170 to residue 183 of SEQ. MD. NO. 291, residue 185 to residue 415 of SEQ. MD.

NO. 291, residue 1 to residue 301 of SEQ. MD. NO. 364, residue 114 to residue 702 of SEQ. ID. NO. 337, residue 377 to residue 412 of SEQ. ED. NO. 321, S7

O

0 residue 413 to residue 772 of SEQ. ID. NO. 321, residue 14 to residue 454 of SEQ. ID. NO. 265, residue 129 to residue 614 of SEQ. ID. NO. 268, residue 1 t to residue 930 of SEQ. ID. NO. 300, residue 932 to residue 1046 of SEQ. ID.

NO. 300, residue 1 to residue 301 of SEQ. ID. NO. 364, residue 1 to residue 42 of SEQ. ID. NO. 381, residue 44 to residue 973 of SEQ. ID. NO. 381, residue 1 to residue 93 of SEQ. ID. NO. 358, residue 95 to residue 179 of SEQ.

00 ID. NO. 358, residue 181 to residue 227 of SEQ. ID. NO. 358, residue 114 to Sresidue 702 of SEQ. ID. NO. 337, residue 1 to residue 659 of SEQ. ID. NO.

355, residue 661 to residue 907 of SEQ. ID. NO. 355, residue 1 to residue 131 of SEQ. ID. NO. 370, residue 133 to residue 601 of SEQ. ID. NO. 370, residue 1 to residue 813 of SEQ. ID. NO. 344, residue 377 to residue 412 of SEQ. ID.

NO. 321, residue 413 to residue 772 of SEQ. ID. NO. 321, and residue 189 to residue 614 of SEQ. ID. NO. 364, In a second aspect the present invention consists in a n isolated antigenic Porphorymonas gingivalis polypeptide, the polypeptide comprising an amino acid sequence selected from the group consisting of SEQ. ID. NO.

386 to SEQ. ID. NO. 528 and SEQ. ID. NO. 532 less the leader sequence set out in Table 3.

In a third aspect the present invention consists in an isolated DNA molecule, the DNA molecule comprising a nucleotide sequence which encodes the polypeptide of the first aspect the present invention or a sequence which hybridises thereto under stringent conditions.

It is preferred that the isolated DNA molecule comprises a nucleotide sequence selected from the group consisting of SEQ. ID. NO. 1 to SEQ. ID.

NO. 264, SEQ. ID. NO. 529 and SEQ. ID. NO. 530.

In a fourth aspect the present invention consists in a recombinant expression vector comprising the DNA molecule of the second aspect of the present invention operably linked to a transcription regulatory element.

The present invention also provides a cell comprising this recombinant expression vector.

In a further aspect the present invention consists in a method for producing a P. gingivalis polypeptide comprising culturing the cell under conditions that permit expression of the polypeptide.

In yet a further aspect the present invention provides a composition for use in raising an immune response directed against P. gingivalis in a subject, the composition comprising an effective amount of at least one S8

O

O polypeptide of the first aspect of the present invention, or at least one DNA Z molecule of the second aspect of the present invention, or both,and a pharmaceutically acceptable carrier. It is preferred that the pharmaceutically acceptable carrier is an adjuvant. In other aspects the present invention provides methods of treating P. gingivalis infection in subject comprising the administration of the composition to the subject such that treatment of P.

00 gingivalis infection occurs. The treatment may be prophylactic or Stherapeutic.

SIn yet another aspect the present invention provides an antibody raised against a polypeptide of the first aspect the invention. The antibody may be polyclonal or monoclonal. The present invention also provides compositions including these antibodies. It is preferred that these compositions are adapted for oral use and may be, for example, dentrifices, mouthwashes, etc.

In a still further aspect the present invention provides a nucleotide probe comprising at least 18 nucleotides and having a contiguous sequence of at least 18 nucleotides identical to a contiguous nucleotide sequence selected from the group consisting of SEQ. ID. NO. 1 to SEQ. ID. NO. 121, SEQ. ID. NO. 529, and sequences complementary thereto. It is preferred that the probe further comprises a detectable label.

The present invention also provides a method for detecting the presence of P. gingivalis nucleic acid in a sample comprising: contacting a sample with the nucleotide probe under conditions in which a hybrid can form between the probe and aP. gingivalis nucleic acid in the sample; and detecting the hybrid formed in step wherein detection of a hybrid indicates the presence of a P. gingivalis nucleic acid in the sample.

DETAILED

DESCRIPTION

Definitions A purified or isolated polypeptide or a substantially pure preparation of a polypeptide are used interchangeably herein and, as used herein, mean a polypeptide that has been separated from other proteins, lipids, and nucleic acids with which it naturally occurs. Preferably, the polypeptide is also 0 separated from substances, antibodies or gel matrix, e.g., polyacrylamide, which are used to purify it. Preferably, the polypeptide Sconstitutes at least 10, 20. 50 70, 80 or 95% dry weight of the purified preparation. Preferably, the preparation contains: sufficient polypeptide to allow protein sequencing; at least 1, 10, or 100 mg of the polypeptide.

cl A purified preparation of cells refers to, in the case of plant or animal 00 cells, an in vitro preparation of cells and not an entire intact plant or animal.

In the case of cultured cells or microbial cells, it consists of a preparation of at least 10% and more preferably 50% of the subject cells.

A purified or isolated or a substantially pure nucleic acid, a C' substantially pure DNA, (are terms used interchangeably herein) is a nucleic acid which is one or both of the following: not immediately contiguous with both of the coding sequences with which it is immediately contiguous one at the 5' end and one at the 3' end) in the naturally occurring genome of the organism from which the nucleic acid is derived; or which is substantially free of a nucleic acid with which it occurs in the organism from which the nucleic acid is derived. The term includes, for example, a recombinant DNA which is incorporated into a vector, into an autonomously replicating plasmid or virus, or into the genomic DNA of a prokaryote or eukaryote, or which exists as a separate molecule a cDNA or a genomic DNA fragment produced by PCR or restriction endonuclease treatment) independent of other DNA sequences. Substantially pure DNA also includes a recombinant DNA which is part of a hybrid gene encoding additional P. gingivalis DNA sequence.

A "contig" as used herein is a nucleic acid representing a continuous stretch of genomic sequence of an organism.

An "open reading frame", also referred to herein as ORF, is a region of nucleic acid which encodes a polypeptide. This region may represent a portion of a coding sequence or a total sequence and can be determined from a stop to stop codon or from a start to stop codon.

As used herein, a "coding sequence" is a nucleic acid which is transcribed into messenger RNA and/or translated into a polypeptide when placed under the control of appropriate regulatory sequences. The boundaries of the coding sequence are determined by a translation start codon at the five prime terminus and a translation stop code at the three prime terminus. A 0 0 Z coding sequence can include but is not limited to messenger RNA synthetic SDNA, and recombinant nucleic acid sequences.

A "complement" of a nucleic acid as used herein refers to an antiparallel or antisense sequence that participates in Watson-Crick base-pairing with the original sequence.

A "gene product" is a protein or structural RNA which is specifically encoded by a gene.

SAs used herein, the term "probe" refers to a nucleic acid, peptide or I other chemical entity which specifically binds to a molecule of interest.

Probes are often associated with or capable of associating with a label. A C1 label is a chemical moiety capable of detection. Typical labels comprise dyes, radioisotopes, luminescent and chemiluminescent moieties, fluorophores, enzymes, precipitating agents, amplification sequences, and the like. Similarly, a nucleic acid, peptide or other chemical entity which specifically binds to a molecule of interest and immobilizes such molecule is referred herein as a "capture ligand". Capture ligands are typically associated with or capable of associating with a support such as nitro-cellulose, glass, nylon membranes, beads, particles and the like. The specificity of hybridization is dependent on conditions such as the base pair composition of the nucleotides, and the temperature and salt concentration of the reaction. These conditions are readily discernible to one of ordinary skill in the art using routine experimentation.

Homologous refers to the sequence similarity or sequence identity between two polypeptides or between two nucleic acid molecules. When a position in both of the two compared sequences is occupied by the same base or amino acid monomer subunit, if a position in each of two DNA molecules is occupied by adenine, then the molecules are homologous at that position. The percent of homology between two sequences is a function of the number of matching or homologous positions shared by the two sequences divided by the number of positions compared x 100.

The terms peptides, proteins, and polypeptides are used interchangeably herein.

An "immunogenic component" as used herein is a moiety, such as an P. gingivalis polypeptide, analog or fragment thereof, that is capable of eliciting a humoral and/or cellular immune response in a host animal.

Z An "antigenic component" as used herein is a moiety, such as P. gingivalis polypeptide, analog or fragment thereof, that is capable of binding to a specific antibody with sufficiently high affinity to form a detectable antigen-antibody complex.

As used herein, the term "cell-specific promoter" means a DNA c sequence that serves as a promoter, regulates expression of a selected DNA sequence operably linked to the promoter, and which effects expression of the selected DNA sequence in specific cells of a tissue. The term also covers so-called "leaky" promoters, which regulate expression of a selected DNA primarily in one tissue, but cause expression in other tissues as well.

As used herein, the term "control sequence" refers to a nucleic acid having a base sequence which is recognized by the host organism to effect the expression of encoded sequences to which they are ligated. The nature of such control sequences differs depending upon the host organism; in prokaryotes, such control sequences generally include a promoter, ribosomal binding site, terminators, and in some cases operators; in eukaryotes, generally such control sequences include promoters, terminators and in some instances, enhancers. The term control sequence is intended to include at a minimum, all components whose presence is necessary for expression, and may also include additional components whose presence is advantageous, for example, leader sequences.

As used herein, the term "operably linked" refers to sequences joined or ligated to function in their intended manner. For example, a control sequence is operably linked to coding sequence by ligation in such a way that expression of the coding sequence is achieved under conditions compatible with the control sequence and host cell.

A "sample" as used herein refers to a biological sample, such as, for example, tissue or fluid isolated from an individual (including without limitation plasma. serum, cerebrospinal fluid, lymph, tears, saliva and tissue sections) or from in vitro cell culture constituents, as well as samples from the environment.

The practice of the invention will employ, unless otherwise indicated, conventional techniques of chemistry, molecular biology, microbiology, recombinant DNA, and immunology well known to those skilled in the art. Such techniques are described and explained throughout the literature in sources such as, J. Perbal, A Practical Guide to Molecular "12 0 Z Cloning, John Wiley and Sons (1984), J. Sambrook et al.. Molecular Cloning: tt A Laboratory Manual, Cold Spring Harbour Laboratory Press (1989), T.A.

O Brown (editor), Essential Molecular Biology: A Practical Approach, Volumes 1 and 2, IRL Press (1991), D.M. Glover and B.D. Hames (editors), DNA Cloning: A Practical Approach, Volumes 1-4, IRL Press (1995 and 1996), and O F.M. Ausubel et al. (Editors), Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley-Interscience (1988, including all updates until c" present). The disclosure of these texts are incorporated herein by reference.

Pharmaceutically Acceptable Carriers The antibodies, polypeptides and DNA of the present invention can be included in compositions which include a carrier or diluent. These compositions include pharmaceutical compositions where the carrier or diluent will be pharmaceutically acceptable. Pharmaceutically acceptable carriers or diluents include those used in compositions suitable for oral, rectal, nasal, topical (including buccal and sublingual), vaginal, parenteral (including subcutaneous, intramuscular, intravenous, intradermal, intrathecal and epidural) administration. They are non-toxic to recipients at the dosages and concentrations employed. Representative examples of pharmaceutically acceptable carriers or diluents include, but are not limited to; water, isotonic solutions which are preferably buffered at a physiological pH (such as phosphate-buffered saline or Tris-buffered saline) and can also contain one or more of, mannitol, lactose, trehalose, dextrose, glycerol, ethanol or polypeptides (such as human serum albumin). The compositions may conveniently be presented in unit dosage form and may be prepared by any of the methods well known in the art of pharmacy.

As will be well understood by those skilled in the art alterations may be made to the amino acid sequences set out in the Sequence Listings. These alterations may be deletions, insertions, or substitutions of amino acid residues. The altered polypeptides can be either naturally occurring (that is to say, purified or isolated from a natural source) or synthetic (for example, by performing site-directed metagenesis on the encoding DNA). It is intended that such altered polypeptides which have at least 85%, preferably at least 95% identity with the sequences set out in the Sequence Listing are 13 0 Z within the scope of the present invention. Antibodies raised against these altered polypeptides will also bind to the polypeptides having one of the sequences set out in the Sequence Listings. The level of identity is to be calculated as set out above.

Protein sequences are homologous if they are related by divergence from a common ancestor. Consequently, a species homologue of the protein will be the equivalent protein which occurs naturally in another species.

N, Within any one species a homologue may exist as numerous allelic variants, and these will be considered homologues of the protein. Allelic variants and species homologues can be obtained by following standard techniques known CK1 to those skilled in the art.

An allelic variant will be a variant that is naturally occurring within an individual organism.

Mutants, Variants and Homology Nucleic Acids Mutant polynucleotides will possess one or more mutations which are deletions, insertions, or substitutions of nucleotide residues. Mutants can be either naturally occurring (that is to say, isolated from a natural source) or synthetic (for example, by performing site-directed metagenesis on the DNA). It is thus apparent that polynucleotides of the invention can be either naturally occurring or recombinant (that is to say prepared using recombinant DNA techniques).

An allelic variant will be a variant that is naturally occurring within an individual organism.

Nucleotide sequences are homologous if they are related by divergence from a common ancestor. Consequently, a species homologue of the polynucleotide will be the equivalent polynucleotide which occurs naturally in another species. Within any one species a homologue may exist as numerous allelic variants, and these will be considered homologues of the polynucleotide. Allelic variants and species homologues can be obtained by following standard techniques known to those skilled in the art.

Antibody Production Antibodies, either polyclonal or monoclonal, which are specific for a polypeptide of the present invention can be produced by a person skilled in the art using standard techniques such as, but not limited to, those described O by Harlow et al. Antibodies: A Laboratory Manual, Cold Springs Harbor SLaboratory Press (1988), and D. Catty (editor), Antibodies: A Practical a Approach, IRL Press (1988).

Various procedures known in the art may be used for the production of polyclonal antibodies to epitopes of a protein. For the production of Spolyclonal antibodies, a number of host animals are acceptable for the 00 generation of antibodies by immunization with one or more injections of a Spolypeptide preparation, including but not limited to rabbits, mice, rats, etc.

N Various adjuvants may be used to increase the immunological response in the host animal, depending on the host species, including but not limited to Freund's (complete and incomplete), mineral gels such as aluminium hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, oil emulsions, keyhole lympet hemocyanins, dinitrophenol, and potentially useful human adjuvants such as BCG (bacille Calmette-Guerin) and Corynebacterium parvum.

A monoclonal antibody to an epitope of a protein may be prepared by using any technique which provides for the production of antibody molecules by continuous cell lines in culture. These include but are not limited to the hybridoma technique originally described by Kohler and Milstein (1975, Nature 256, 493-497), and the more recent human B-cell hybridoma technique (Kesber et al. 1983, Immunology Today 4:72) and EBVhybridoma technique (Cole et al. 1985, Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc. pp. 77-96). In addition, techniques developed for the production of "chimeric antibodies" by splicing the genes from antibody molecule of appropriate antigen specificity together with genes from a human antibody molecule of appropriate biological activity may be used (Morrison et al. 1984, Proc. Natl. Acad. Sci., 81:6851-6855; Neuberger et al.

1984 Nature 312:604-608; Takeda et al. 1985 Nature 31:452-454).

Alternatively, techniques described for the production of single chain antibodies Patent 4,946,778) can be adapted to produce 4-specific single chain antibodies.

Recombinant human or humanized versions of monoclonal antibodies are a preferred embodiment for human therapeutic applications.

Humanized antibodies may be prepared according to procedures in the literature Jones et al. 1986, Nature 321:522-25; Reichman et al. 1988 Nature 332:323-27; Verhoeyen et al. 1988, Science 239:1534-36). The Srecently described "gene conversion metagenesis" strategy for the production n of humanized monoclonal antibody may also be employed in the production Sof humanized antibodies (Carter et al. 1992 Proc. Natl. Acad. Sci. U.S.A.

89:4285-89). Alternatively, techniques for generating the recombinant phase library of random combinations of heavy and light regions may be used to CK prepare recombinant antibodies Huse et al. 1989 Science 246:1275-81).

00 Antibody fragments which contain the idiotype of the molecule such as Fu F(abl) and F(ab2) may be generated by known techniques. For example, such fragments include but are not limited to: the F(ab) E2 fragment which can be produced by pepsin digestion of the intact antibody 1 molecule; the Fab' fragments which can be generated by reducing the disulfide bridges of the F(ab')2 fragment, and the two Fab fragments which can be generated by treating the antibody molecule with papain and a reducing agent. Alternatively, Fab expression libraries may be constructed (Huse et al. 1989, Science 246:1275-1281) to allow rapid and easy identification of monoclonal Fab fragment with the desired specificity to a protein.

Adjuvants "Adjuvant" means a composition comprised of one or more substances that enhances the immunogenicity and efficacy of a vaccine composition. Non-limiting examples of suitable adjuvants include squalane and squalene (or other oils of animal origin); block copolymers; detergents such as Tween®-80; Quil@ A, mineral oils such as Drakeol or Marcol, vegetable oils such as peanut oil; Corynebacterium-derived adjuvants such as Corynebacterium parvum; Propionibacterium-derived adjuvants such as Propionibacterium acne; Mycobacterium bovis (Bacillus Calmetic and Guerinn or BCG); interleukins such as interleukin 2 and interleukin-12: monokines such as interleukin 1; tumour necrosis factor; interferons such as gamma interferon; combinations such as saponin-aluminium hydroxide or Quil-A aluminium hydroxide; liposomes; ISCOM adjuvant; mycobacterial cell wall extract; synthetic glycopeptides such as muramyl dipeptides or other derivatives; Avridine; Lipid A; dextran sulfate; DEAE-Dextran or DHAE- Dextran with aluminium phosphate; carboxypolymethylene such as Carbopol' EMA; acrylic copolymer emulsions such as Neocryl A640

U.S.

16 0 Z Pat. No. 5,047,238); vaccinia or animal posvirus proteins; sub-viral particle I adjuvants such as cholera toxin, or mixtures thereof.

As used herein, stringent conditions are those that employ low 5 ionic strength and high temperature for washing, for example, 0.015 M 00 NaCl/0.0015 M sodium citrate/0.1% NaDodSO4 at 50 0 C; employ during Shybridisation a denaturing agent such as formamide, for example, C (vol/vol) formamide with 0.1% bovine serum albumin, 0.1% Ficoll, 0.1% polyvinylpyrrolidone, 50 mM sodiumnphosphate buffer at pH 6.5 with 750 mM NaCI, 75 mM sodium citrate at 42 0 C; or employ 50% formamide, x SSC (0.75 MNaCI, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 0.1% sodium pyrophosphate, 5 x Denhardt's solution, sonicated salmon sperm DNA (50 ag/ml), 0.1% SDS and 10% dextran sulfate at 42"C in 0.2 x SSC and 0.1% SDS As will be understood the present invention includes within its scope DNA vaccination. Further information regarding DNA vaccination may be found in Donnelly et al, Journal of Immunological Methods 176(1994) 145- 152, the disclosure of which is incorporated herein by reference.

Throughout this specification the word "comprise", or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated element or integer or group of elements or integers but not the exclusion of any other element or integer, or group of elements or integers.

Preparation of the P. gingivalis library for sequencing.

To determine the DNA sequence of P. gingivalis genomic DNA was isolated from P. gingivalis strain W50 (ATCC 53978) essentially by the method described by Mamur J. Mol. Biol. 3, 208-218, 1961). Cloning of DNA fragments was performed essentially as described by Fleischmann et al., (Science; 269, 496-512, 1995)(2). Briefly, purified genomic DNA from P. gingivalis was nebulized to fragment the DNA and was treated with Bal31 nuclease to create blunt ends then run twice through preparative 1% agarose gels. DNA fragments of 1.6-2.0 kb were excised from the gel and the DNA recovered. This DNA was then ligated to the vector pUC18 (Smal digested and dephosphorylated; Pharmacia) and electrophoresed through a 1% 0 Z preparative agarose gel. The fragment comprising linear vector plus one Sinsert was excised, purified and this process repeated to reduce any vector without insert contamination. The recovered vector plus insert DNA was blunt-ended with T4 DNA polymerase, then a final ligation to produce circular DNA was performed. Aliquots ofEpicurian Coli Electroporation- 0 Competent Cells (Stratagene) were transformed with the ligated DNA and plated out on SOB agar antibiotic diffusion plates containing X-gal and NC incubated at 37"C overnight. Colonies with inserts appeared white and those without inserts (vector alone) appeared blue. Plates were stored at 4°C until the white clones were picked and expanded for the extraction of plasmid DNA for sequencing.

DNA sequencing Plasmid DNA was prepared by picking bacterial colonies into of LB, TB or SOB broth supplemented with 50-10ug/ml Ampicillin in 96 deep well plates. Plasmid DNA was isolated using the QIAprep Spin or QlAprep 96 Turbo miniprep kits (QIAGEN GmbH, Germany). DNA was eluted into a 96 well gridded array and stored at Sequencing reactions were performed using ABI PRISM Dye Terminator and ABI PRISM BIGDye Terminator Cycle Sequencing Ready Reaction kits with AmpliTaq DNA polymerase FS (PE Applied Biosystems, Foster City, CA) using the M13 Universal forward and reverse sequencing primers. Sequence reactions were conducted on either a Perkin-Elmer GeneAmp 9700 (PE Applied Biosystems) or Hybaid PCR Express (Hybaid, UK) thermal cyclers. Sequencing reactions were analysed on ABI PRISM 377 DNA sequencers (PE Applied Biosystems).

The sequences obtained are set out below. The relationship between these sequences is set out in Table 1. The initiation codon was calculated using a combination of sequence homology alignment [FASTA), signal sequence prediction (PSORT, SignalP) or ORF prediction (GeneMark).

Table 1: Reference table indicating the relationships of each sequence ID to the selected proteins.

Protein DNA Amino acid DNA sequence a Amino acid name sequence of sequence of protein sequence of complete complete ORF protein

ORF

PGI 1 265 122 386 2 266 123 387 PGIOO 3 267 124 388 PG101 4 268 PG102 5 269 125, 126 389, 390 PG104 6 270 127 391 PG105 7 271 128 392 PG106 8 272 129 393 PG107 9 273 130, 131, 132 394, 39 396 PG108 10 274 133 397 PG109 21 285 1413 4098,9 PG1 22 286 146 4100 PG1 23 287 147 411 PG129 24 288 148 412 19 Protein DNA Amino acid DNA sequence o Amino acid name sequence of sequence of protein sequence of complete complete OR.F protein

ORF

__PG121 25 289 149 413 c~1PG122 26 290 150 414 00 PG123 27 291 151 415 PG124 28 22152 416 PG125 29 293 153 417 PG126 30 294 154 418 c1PG13 31 295 155 419 PG14 32 296 156 420 33 297 157 421 PG16 34 298 158 422 PG4 50 34 15, 161 49, PG21 51 31 17 41 PG22 52 36 163 427 PG28 43 317 179680 443,24 546 318 181 445 Protein DNA Amino acid DNA sequence o Amino acid Zname sequence of sequence of protein sequence of complete complete ORF protein

ORF

00 58 32218 PG42 59 323 18645 PG43 60 324 187 PG44 1 32 18841 00 0 22 0 Protein DNA Amino acid DNA sequence o Amino acid name sequence of sequence of protein sequence of Scomplete complete ORF protein

ORF

PG92 114 378 257 521 PG93 115 379 258 OO 3--258 522 PG94 116 380 259 523 117 381 260 524 P 96 118 382 261 525 PG97 119 383 262 526 S1PG98 120 384 263 527 PG99 121 385 264 528 PG127 529 531 530 532 DNA sequence analysis DNA files in FASTA format were converted to GCG format files and imported into a database. The DNA files were translated into amino acid files using the program Flip obtained from ANGIS(Australian Genomic Information Service, University of Sydney, Australia). A series of bioinformatic analyses were performed on the proteins in order to select potential vaccine candidates. The programs used were FASTA homology searching PSORT SignalP TopPred and GeneMark The proteins and their bioinformatic results were stored in the custom written database for search and retrieval of proteins with the desired characteristics The FASTA homology results for these proteins were then examined for any alignment with a protein suggesting surface location or vaccine efficacy. All proteins were searched for homology against a non-redundant bacterial protein database compiled by ANGIS using the FASTA algorithm.

The settings used for the FASTA searches were Ktup 2, gap creation penalty -12, gap extension penalty width for deriving alignment in opt 16 and the Blosum 50 scoring matrix. Individual FASTA search results were examined for significant homology by statistical probability and amino acid alignments. The results are set out in Table 2.

Protein files were then trimmed to the first, second, third, fourth and z fifth methionine residues using a protein trimming program (ANGIS). The trimmed proteins were then subjected to PSORT analysis for the detection of O signal sequences and the prediction of cell location. Proteins exhibiting a PSORT probability of outer membrane >0.8 were considered to indicate surface localisation. A second signal sequence detection program SignalP was also performed and, in certain instances, this program detected signals not identified with PSORT. All proteins identified by other methods were C also analysed by PSORT and SignalP. Previously, the C-terminal amino acid of bacterial outer membrane proteins has been shown to be important for the Sassembly of the protein on the outer membrane A typical structure ri definition for outer membrane proteins has been determined as the presence of a signal sequence at the N-terminus and a tyrosine or phenylalanine at the C-terminus. A number of the selected proteins exhibit this characteristic structure. The program TopPred was used to determine the presence and number of membrane spanning domains (MSDs) and the presence of such sequences indicates a preference to be attached to membranes such as the outer membrane. The results of PSORT, SignalP and TopPred analyses with the C-terminal amino acids of the selected proteins are set out in Table 3.

The 70 amino acids from the C-terminus of a number of P. gingivalis outer membrane proteins share 50-100% protein sequence identity. These proteins included RGP1, RGP2, KGP, HagA, HagC, HagD, prtH and prtT. This conserved motif may be involved in the attachment or sorting of proteins to the outer membrane. The protein data set was searched using FASTA homology as described above and a number of novel proteins were identified which demonstrate similar motifs at their C-termini. The results are listed in Table 4 The TonBIII box is a 30 amino acid motif present within TonB outer membrane receptors in a wide variety of bacteria. The TonBm box of P. gingivalis was used to search the protein data set for homology by FASTA as described above. Those proteins demonstrating significant homology are listed in Table 2007231821 05 Nov 2007 Table 2: FASTA protein homology results of complete OR-Fs against a non-redundant protein database.

Prti ooogy description 'Genbank Length of Length of p. FASTA homology results name accession homolog gin giva[lis numberprei I poti Identity 'OverlapjE value iPGI :48MD outer mnerbrane protein, Actinobacillus J24 U242 ~449aa 145 1aa :32 1454aa ;1.40E-42 p sun R !4on a :PGZ :Outer membrane protein (susC), Bacterode iL93 a 2 19a 46E3 thetaotaommcron... I: G PG Iuter membrane porin Fadhesin, Pseudomonas 173 Ila 23a 5l~a~ E2 Ifluorescens

I

PG4 Outer memubran.eprotein A. Es-chaerichia ferurill M63352 2 0 3 l S.rto 423.. :PGS jAdhesmn ocspenna L15 a 1a 529a 94E 6 7 0 L 1 2 JPG7 ~inenalysn A hlA. Lyseri vsoncytoenie 'M674I j33 426 y 7 3 1 a a V 3 04 E 2 4 2007231821 05 Nov 2007 /Protein 1 =Homology description IGenbank Length of Legt of p. FSAhmlg name ~~~~~~accession homolog gingivalis ATho lgyrsts entity :6 OverlapI~au potentiator WI) Leinel,1U21 34aa llO5aa *o .si. :20 aa .4.70E.31 I A 1 p r v t i a i t r e j 4 aa P6 2 O trx ban iort ne mphi a 1 MAF 07 1 1 30 a 7a 6'2 4a 9A L2 'f en a 44: Z utrMe b an i.poti, a m p. ls P0 4 36~at~e. lcoate plo Mt 6 8502 :327aa 1 331aa !36 IZ36aa i OL3 17 5- !1.0E .1 or i .yo W 3.

-3.

P.2 37 a j?.I7 a2 1 302 5 I 5 sr pt c s u ~A OS1 5 4 a 4 7 a19 ~3 a 2007231821 05 Nov 2007 Protein Homology description G enbank Length of Length of P. FASTA homology results name accession bomolog gingivalis Identity 9/ J~verlap iE value 'Cvsteine Drotease, Porph%5To 123a i93a4 t in edahei. 7 IlE1 protB in eahs P r hen~ltno Porph vnua S 61 .P 3 ).Srp lnabvdsenrie...... .37a 20 1 PG 32 ~3 .2 a 1 8 E~ :aerugineoa m i. Pop... P633 $Maor ute memran prtei (opF).seuomoas IS75942 317aa '835aa ::35 6a .lo e c n I ,P E 483 a 2: 4 a 0 -1 'PGG Otermemran anige (oaO7. Pstere7a341 7891aa .ti9Iea 2 81 4aaI 8 E 0 I G3 me br n protein.. (om j i 0 8 4 1 8 5 i 126aa !38Oaa :340-0 I5 6 a43 C 2007231821 05 Nov 2007 ProeinHoology description 'Genbank Length of Length of P. FSAhmlg eut P homology results name accession homolog gingivalis ildentity 0/ .OverIap 1E value IPG3a :Cationic outer membrane protein (ompiJ. Yersinia M34854 i164aa 1 163aa j23 jua iOuter membrane protein (susC) Bacteroides jLA9338 iPO38aa J827aa 24 :347aa 1 1.SOE-oo L, Vbr4 chlr 693aa !772aa i2 372a !4qEo Heme recE pt o .a 0 IPG4 :-Quter utembrane prti 'tCL csrheric-hia coli !22 *436aa 14 PG 2 N euram inidase,.M c o o o p r ii ia in .rrd fa n .3 .I T 1 4 :'PG43 ~Immunoreactive outer membrane protein (ornp28). IU30B15 '20a i4a 24 l178aa 005 ;0.0I *B3rucella melitensis PG44 jMacrophage infectivity potentiator. Legionella IU92208 :242aa i276aa :35 j219ao

OE

.sa n l !Outer memnbrane protein, Neisseria meningitiis AF021245 1797an 75a2 age 0O3 P G G O t r8 .9 7 9 2 a a 2 1 J 9 a a 0 0 0 0 9 84 2007231821 05 Nov 2007 pProtai nHomology description Genbank Length ofLethoP. FTAoolgrsus ~nae Jaccession homolog gingivazlis Identity l vrapEvau :PG48 Jz-nmunoglobulin binding Surface protein (sir22). 'X55 365aa !425a 251a 1269aa .520E-05 EPG4O !Fimbrillinof.Prhr nvj D267 45230 O ue membrane protein (susC) Bacteroides El433 11038aa 1 6848aa 126 j 5 979aaS i .0- 1 6aI Prpyonns~igy~s

E~

JAlkaline protease sceinaprts(aprF) 1X64558 :41a 45 5aa .21427aa 113.50E-06 irseudo mnonas eruginosa 1 PG3 Poten eportpo IemroIC. Salmonella enteritds I 157 49e 46a 6.20E-11 TG54 Protease8 Acrmbcerltc653aa 24 :695a i 150E 22 1 PG5!5 !Fintrillin P rk Monas!gngialis D2 67 1 670aa :7Oa 3 38a 0.

S Cyste....e U646 364aa 122a1274aa !25 1 212aa .O00012 !i n.y n- 2 9 a 9 2 a 9 1a 11.4 a 1.0 Jie.aa :G I Terric pseudobactin M14receptor prtn(buA IX31 SBa 14a :2aa 1.0E-0 2007231821 05 Nov 2007 SProtein Homology description Genbank Length of Length of P. FASTA homology results t name accessio acesobomolog gmngivalis number protein .Identity 0/0 !Overlap iEvalue PGGti 'tahetand invasion protein (ail), Salmonella JAFOO738O 6I5aa :206aa :21 v14oaa r .s r u ci. Ta t r S t.tc c u p o e 1 U O 2 g i 2 2 5 a a 1 2 2 4 a a 2 4 1 7 a a 2 O E n ac. j licobacterpvlori U 36 I P G V a o a c -t o x n-U 3 61 6 aa 14 2 5 a a ~2I l a1 2 E O .ebr n .rten .es e i .oo rh e .U2 a 2 20E.0 t* :PG71 l~iigmotility prote in (gldA). Flavobacterium 1AF007381 :'78a 834aa .23 :572aa 13.9E-25

I'

:Cas3outer membrane porin (porB), Neisserla U79 13a 3aa2.3aa 46EO 1PG8i fOuter membranep Drtffli S aan3a 2 .es lJo TG82 lbuter membrane protein (kL Pseudomonas jX65936 23a 434sa :26 jI36aa '2.l9aE+oo ioleovorans

II

PGa3 idin- motility protein (gldA), Flavobacterium 1AF007381 1 578aa 1926aa ;21 i639aa :8.50E-09 Hvpthetca !jp1! L ein..Mvcobacgerium tuberculosis tAOlgaI77aa 1 781aa 12 .74i 2.20E-34> 2007231821 05 Nov 2007 0 name Ggydesripio Length of Length of P. FASTA homology results j umbe protei n.

Identity Oelp~ au 'PGsg INADH-ubiquinane oxidoreductase. Helicobactor 'SA.E000631 1 51224 E24 .186aa h39OE-oi p y l o n~ I .a 1544aa 54a .Nua iis~ai.atrje f 2 0 24 :251aa R -pthetlcaj ~protein. Mvcobacteim tubercuo ls IALo 4. .7a PG93~~~~ I~ c~ l m .nu. 02 19 2 2a. .i 7 a (OE3 1 7 7 1a 1 6 377 09 E .no e.ia e .op v r r o .l a 2 4. a a .30t) O s p p rCv o e n .sh r c i c l .l a 2n VIla 26E m a y 9 9 um a a a 4 4 95 a a 2~ 044 6 E 3 30 12 8a 17 22 iP G 1 O 6 e l o a n e t 0 2 9 5 a U G Cel diso n All' inin.E G pro! E a cobacte4008 1032883 Tqepp a 26 E 1 cl eo I id 02 .21 aa3 0 6 1 a O W2 2.3. :0 4 a T I0 e h c v t 7 7 5 5 7 a l 7 0 a 7 a o h e i a 7 0 EJye 2 1 1 .l c s l r n f r s S a 61 (e i a aba le z .3 1 H o u 3 2007231821 05 Nov 2007 Protein~ Homology description jGenbank Length of Length of P. FASTA homology results name j accession homolog gimgivalis *1 ~Identity% lo/ eia ~ali PG113 ffleat shock Proteina) Trpoem ,wqp iu AE001203 !035aa WU40aa'6 4aa 9W13 .:62 im (nPG115 bihmncroliadd e ydoease. Clostridium Qco2i :58783aa 9aa278aa 605 P1013 :624a P01 I~asr 069 P a r.u at r .e il u I44 a3 1 8 a 2 4 4 Ip .~~:ATP.4~~pendept q if x e lz. Irdrzo i n Eshrci l P0 3 ur1F3eatru 1 624aa:2a

L.

.P h.sis.p..te 3 6 a .2 0 E 3 7 :PGI2Z i1utr mebrane integrityg~ toL q 89a 045 1 aa 1 2.4013549 389a :PGiia..3 !B i tim raiIPi.Prphyromona!. ils _H7001_ :49 aa 59:518 !PGqZ .d~U iner~n A0?1 3~a j38aa 12 JOE-577 t'0 iP G 1 0 N trog n a si m lati n r g ul tory p ro ein 2007231821 05 Nov 2007 EProein Homology description Genbank Length of Length of P. FASTA homology results name accession bomolog gin givcilis 0 n number protein_ Identity Oelp1 value iCobalainin biosynthesis proten(CBIKJ. Salmoel IQ05592 1 264aa ~293aa37!5a 1.0E2 CAIG2 *BCtve permease. Pseudomonas aerugios 0 8 7 2 a 35 a 1 :333 a 1.303-0 1PG127 2007231821 05 Nov 2007 Table 3: Results of PSORT, SignaiP and TopPred analysis of the proteins. The signal present column indicates the presence of a signal sequence detected with either PSORT or SignalP. The terms in parentheses indicates the type of signal sequence as determined by PSORT. The cell location probability values are generated by PSORT and represent the probability of the protein being in the cell compartments outer membrane inner membrane periplasmnic space (PC) or cytoplasm The number of transmenabrane domains (TMvDs) was determined by TopPred and does not include uncleavable signal sequences.

L. L. I I r'ruen Protein Protein name fseqID jLength ~number I Signal Present jMethionine fin ORF SignalP? PSORT Cell Local] cleavage cleavage ion probability JC-terminal INunber1 jAmino Acid of ITAtLs

I

M M. F -*u t F IPG2 145 11014se 1 17 0.94 :0 1029 0 IF 7 43 23::YIE0.Z!LL Ij'8 09 0_76 :0 :03 4 .4 fyiPwte!!R) 22 .22 10 79 0 PGS :4 8 :3l~a Y 1 1 32 I. 00 i 0 .0 487.. .0 10.25 &O 3 j .0 IIPCR i475 550.&. IN ,21 o 05 N3 2007231821 05 Nov 2007 I 0 Protein Protein Protein Signal Present Methuonine SignalP PSORT C~ell Lcation &poaiiytrua ubr' nam sqi Legt in ORE cleavage cleavage locoTM~ nu ber site

I

IN io 4 INn A i IPg 15 *e !NI 17 10 IN *P C .1 7 3

~I-I

1P011 4 1313aa 2 6 0 3 0I I 2 1 .1 2 97 90 0' II 232 1 0 02.93 0 1 5 :0 0o KR T 079.07... .0.fI P0 8 23231a !2Y 1.

05.~ ;PC 14 1420 jB3aa .I iy i 2..24. i21 !o.29 01 981. ly 2007231821 05 Nov 2007 lProtein JProtein Protein jSignal Present Methionine SignaiP PSORT Cell Location &probability lC-erminal Number name seqlD jLength in ORF cleavago cleavage lAmino Acidl I(IrMD' I number I site 0 OM IM PS C ;PG24 1429 :47aal .1li 19 .4 tO3 :3 2 *1 2 R1 43 1 1 *27 .2 024.. :PG.9 113a a:.2 10. 064 [PG34~~ 1. 2. .P 3 .44 .UD 400 !03 io 10.3 43.. v e 28 035..

0 2007231821 05 Nov 2007 Protein Protein JProtein JSignal Present Methionine SignaIP PSORT Cell Location probability C-terminal Numbe~r ~name seqI) JLength j in QRF cleavage cleavage Amidno Acid OnTmIus l Jumber J siteJ OM IM PS C JPG38 445 1163.. 1 3 0 9 1 0.5 0I s.i .7 02 -0.54 2 3 P02 45 92a Y !3 10.9 :.0300 01 .24 a. .Yt ce h 28 IG :o .444 42 i72&a iY !22 05 0 09I .4.3 a 123 W0794 0 1 :PG41 455 62an :Y I*4 :45 :5 P -4 45 33 1492a&j 2 1 0 02 !0.000 .2 02 45aa ~e 1222is F I 0 '0 0La

CD

2007231821 05 Nov 2007 Protein Protein Protein Signal Present Methionine SignaiP PSORT Cell Location probability C-tnrmunal Number nmen seql1) Length j in ORIF ~cleavage cleavage Amino Acid of TMI's ~n be js si__ i OM IM PS C.

0 '0 '0 '0 00

-I

0 !P054 ;463 i940aa i 1 17 120 0.8 100.

025 o! 146 Oaa.. 1 ilpprvte~I il 123 .23 i0_79 :0.

45 11282 IYj[..clenv21 1 v 2 0 10.04 0 1274,a IN 2 !d P057 46 925... ly 1 28 :24 53 :0.2 :0 iP 5 P~e Y 4 24 :0.53 .0 J0. io o 473... 11Z2. 36 154. 0.2 0101 0 F1 .s .47 3. 2 .41 0.830221 477 l 7 49 ad ly 21 .2 .09 F :1 1.2 121 0.93 EO 10245 2007231821 05 Nov 2007 Protein 'Protein Protein Signal Present Metijionine SignaiP PSORT Cell Location probability C-termninal Number namne JseqID Length ~in ORF cleavage cleavage Armino Acid of TMD's ~number sto fsite P -7 1'C3 49 !24 Y3 1 10.24 :0 FI :PC84 1.8o !204aa ~Y -2 02 120 !0.93 0 io.19 F1 0 go -0 C0 E.2 3P 6 Y Il i .3 i. 2 .y 3 o 3. PG68 3484 3122aa 12 :30 30.317 Y .8 .2 3 02 F0 0. 3488 i !0 24 TP07 :489 j1225. 1:Y 2 2 0 09 00.31 10 IN L 24 i39 2 i I t Y P0G75 :493 ::34&a Y 2 !20 28 094 0 10 N 2 :P077 1490 i3gga Y 2:8 2 0.94 30 .038 *0 HK: 2007231821 05 Nov 2007 Protein jProtein jProtein Signal Present Methionine SignaiP? PSORT Cell Location probability C-terminal Numbenr name seqIl JLength in ORF cleavage cleavage Amino Acid of TMD's number J site site M IM P 1495:

I

4a 2 3 3123 109 0 J.9 lo M 497 1285a IYit32 0 10 10.25 0fGl *502-.4. a 1 i .19 :.0.93 G0 10.22.!0 N 2 .366 Y !02 093..

!P083 :504 '926aa :Y 123 :57 0.93 0 0.21.0 11S II 8 .o a 23. :23 U-J.93 :0 :0.25 !0 1P8. !23 iP8 507 !saad .Y 20 09 10.40 o 00 :P087 .508 fl39aa 26:Y0: 4 0.P:0 1513 ~27a l 4 11 0. 120I 2PG 7 51023 :7 0.88 10 214 9 N 0 '3 '0 00 2007231821 05 Nov 2007 Protein Protein Protein Signal Present Methianine jSignalP? PSORT Cell Location probability C-terminal Number name seqiD jlength ~in ORE ~cleavage cleavage Arnino Acid nf TMD's number __site site 0 '0 '0 -4 0 Ii~ K_ 228&a 2 22 !20 8 -o 0.44 t01 i 1 5 2 0 !4a a.I (n1 :s a a 2 .2 10 L :D~I 3 IG9 52 a .Y !25 !25 :0.8503 .15 c 3. 2. .o 0 25- 0 !R .P 9 526 -47c I 23 230.2 J oe 18 0.25 0Q H ii lO .26 5 c .n 0 P a 1 i2 31 52 23.

32 0 !o? I~ 6.5 L P 5 1 0.2 .a !PG99 1528 M I! 0 0 2007231821 05 Nov 2007 0 I I

R

SProtein Protein Protein Signal Present MeLhiuwune SignaiP PSORT Cell Location probability C-terminal Number name seqiD Length in ORF cleavage cleavage 0mn0cd fT~ r number site Amn cdoIM~ 92-- 4 2 .O3m0 9 J IM PS 1 in .3 0.9 10Z :P I. O ,24 i l :49j !03 i z 0 3 ID IO !39 46398IN .PGl07 1435 >52 3aa 1N 1038nc m ei 0 2 7 2 a G137 i 04 107 21 INI jP II I 07 6 5 Y .N 12L 2 109 >53a Ia .4 0 M 18 e 0 2007231821 05 Nov 2007 Proei Potin Prlen igalPresent Methionine SgaP PSORT Je octo probability IC-emnlN br name seq1fD Lngth in ORF cleavage cleavage jAmino Acid of TND's .O .01

MI

:PC118 409 t 2~a IN i1 P1P19 1410 4la N102 04 a N 10 0E2 I 1 PC121 :413 5a N 10 0 :0 02 13 P0122 J414 f443aa :N 0 a04 Q P0123 41!Y212 2 '2 9 1 P 14 :1 iA 1 7 02 D- 2 1 1 1 9 a .1 a0 .L: I :P0126 148 356a&.iN 1~.

IID1 P012. .66a 1 .0 2 :A 0 00

CD

WO 99/29870 WO 9929870PCT/AU98/01 023 Table 4: Percentage identity and percentage similarity of various proteins with the 70 amino acids from the C-terminal of the P. gin givalis arginine protease 1 (RGPi), arginine protease 2 (RGP2), and the cysteine protease/hemagglutinin (prtT).

[name Percent identity Li Percent similarity j :RGPI JRGP2 iuprtT IRcPI PCP9g ,r TG21 117 :29 121 140 5 14 141 19 64 7:1 ,PG2-7 33 17 73 :74 1 1G821 :26 :34 :49 157 74 iPrGS4 :19 :1 640 :43 :33 TG7:1 :4 119 i20 124 :34 'PG9I :31 121 139 157 :53__74 139 3 2 0 0 124 43 :PG97 1 10 :26 r33 ':14 j7 161 IPG98 :116 '20 0o 4 7 154 !0 P699~ IPGIOO _0i26 1PIO 120 i2i 124 1..:39 i57 141 1310 16 :7 1117 3 161 LIO 11126 146 Table 5: Percentage identity and percentage simailarity of various proteins with the TonBflI box of P. gin givalis.

Protein name PG2 PG13 PG47 0 IPercent identity .57 39 54 Percent similarity 71 93 93 WO 99/29870 PCT/AU98/01023 (44 Z Cloning, expression and purification of recombinant P. gingivalis genes.

PG1 Oligonucleotides to the 5' and 3' regions of the deduced protein were c-I used to amplify the gene of interest from a preparation ofP. gingivalis 0- genomic DNA using the TaqPlus Precision PCR System Stratagene) and a C PTC-100 (MJ Research) thermal cycler or similar device. The oligonucleotide primer sequence was GCGCCATATGCTGGCCGAACCGGCC, O 10 the 3' oligonucleotide primer sequence was GCGCCTCGAGTCAATTCATTTCCTTATAGAG. The PCR fragment was purified, digested with Nde I, Xho I restriction enzymes (Promega) and ligated into the corresponding sites of the plasmid pProEx-1 (Gibco-BRL) and transformed into E. coli ER1793 cells (a gift from Elizabeth Raleigh, New England Biolabs). A resulting clone expressing the correct insert was selected and induced with or without 0.1mM IPTG (Promega) for expression of the recombinant protein. Expression of the recombinant protein was determined by SDS-PAGE analysis and Western Blot using the one of the rabbit antisera described above or an anti-hexahistidine antibody (Clontech) that detects the hexahistidine tag that was fused to the P. gingivalis recombinant protein. PG1 was purified by disruption of the E. coli cells by sonication in binding buffer (Novagen) and solubilisation by the addition of sarkosyl (N-Lauroyl sarcosine) to a 1% final concentration. There after the preparation was diluted to 0.1% sarkosyl in binding buffer, bound to a Nickel-nitrilotriacetic acid column (Ni-NTA; Qiagen), after washing bound proteins were eluted with 1M imidazole in elution buffer (Novagen) according to the Qiagen recommendations with 0.1% sarkosyl added to all buffers. Following purification samples were dialysed against 500mM NaC1, Tris, 0.1% sarkosyl at pH7.4 to remove the imidazole, concentrated as required and stored at 4 0 C until used. Purity and antigenicity were assessed by SDS-PAGE and Western blot using selected antisera (from those described above) and the protein concentration was determined by the BCA assay (Pierce).

WO 99/29870 PCT/AU98/01023 0 PG2 SP The methods used for PG2 were essentially the same as for PG1 with the following exceptions. The 5' oligonucleotide primer sequence was CGCGGTATACATGAAAAGAATGACGC, the 3' oligonucleotide primer sequence was CGCGAGATCTGAAAGACAACTGAATACC and the PCR product was cloned into pGex-stop RBS(IV) (Patent application W09619496, OO JC Cox, SE Edwards, I Frazer and EA Webb. Variants of human papilloma Svirus antigens) using the BstZ 171 and Bgl II restriction sites. 2% sarkosyl Swas used to solubilise PG2 and 8M urea was added to the solublisation buffer and to all other buffers. Urea was removed from the purified protein by Ssequential dialysis (4M then 2M then 1M then 0.5M then OM urea all in Tris, 500mM NaCI, 0.1% sarkosyl, pH7.4). Purified protein was stored at 4 0 C until required.

PG3 The methods used for PG3 were essentially the same as for PG1 with the following exceptions. The 5' oligonucleotide primer sequence was GCGCGTATACATGAAGAAATCAAGTGTAG, the 3' oligonucleotide primer sequence was GCGCAGATCTCTTCAGCGTACCTTGCTGTG and DNA was amplified with Pfu DNA polymerase (Stratagene). The PCR product was cloned directly into pCR-Blunt and transformed into E. coli ToplOF'(InVitrogen) before subcloning into the expression plasmid pGexstop RBS(IV) using the Bst Z171 and Bgl II restriction sites and transformed into E. coli BL21DE3 (Pharmacia Biotech). The following modifications were made to the purification of PG3 from the PG1 method. Cells expressing the recombinant protein were disrupted by sonication in binding buffer and the insoluble inclusion bodies concentrated by centrifugation. Inclusion bodies were then solubilised in 6M urea (Sigma) in binding buffer and eluted with 6M urea added to the elution buffer. In some instances 6M guanidine hydrochloride (Sigma) was used instead of urea for these steps. Urea (or guanidine hydrochloride when it was substituted) was removed from the purified protein by sequential dialysis against reducing levels of urea (3M then 1.5M then 0.5M then OM urea all in 50mM Tris, 500mM NaC1, 8% glycerol, pH7.4). Purified protein was stored frozen at -8(fC until required.

Protein concentration was determined by the Coomassie Plus protein assay (Pierce).

WO 99/29870 PCT/AU98/01023 C 46 0 PG4 The methods used for PG4 were essentially the same as for PG3 with the following exceptions. The 5' oligonucleotide primer sequence was CTTCTGTATACTTACAGCGGACATCATAAAATC, the 3' oligonucleotide primer sequence was TTCCAGGAGGGTACCACGCAACTTTCTTCGAT and DNA was amplified with the Tth XL PCR kit (Perkin Elmer). The PCR 00 product was cloned into the expression plasmid pGex-stop RBS(IV) using the SBst Z171 and Kpn I restriction sites and transformed intoE. coli ER1793.

The methods used for PG5 were essentially the same as for PG3 with the following exceptions. The 5' oligonucleotide primer sequence was TTGCAACATATGATCAGAACGATACTTTCA, the 3' oligonucleotide primer sequence was AGCAATCTCGAGCGGTTCATGAGCCAAAGC and DNA was amplified with the Tth XL PCR kit. The PCR product was cloned into the expression plasmid pET24 (Novagen) using the Nde I and Xho I restriction sites and transformed into E. coli BL21 (Pharmacia Biotech). Removal of urea was not proceeded past 1M urea as the protein was insoluble at lower concentrations of urea. Purified protein was stored at 4 0 C until required.

PG6 The methods used for PG6 were essentially the same as for PG3 with the following exceptions. The 5' oligonucleotide primer sequence was TAAACATATGTGCCTCGAACCCATAATTGCTCCG, the 3' oligonucleotide primer sequence was CGTCCGCGGAAGCTTTGATCGGCCATTGCTACT and DNA was amplified with the Tth XL PCR kit. The PCR product was cloned into the expression plasmid pET24a using the Nde I and Hind Ill restriction sites and transformed into E. coli BL21.

PG8 The methods used for PG8 were essentially the same as for PG3 with the following exceptions. The 5' oligonucleotide primer sequence was CGCGGTATACATGGAGTTCAAGATTGTG, the 3' oligonucleotide primer sequence was CGCGAGATCTGTTITCTGAAAGCT'ITC and DNA was amplified with the TaqPlus Precision PCR System. The PCR product was WO 99/29870 PCT/AU98/01023 N47 0 cloned into the expression plasmid pProEx-1 using the Nde I and Xho I restriction sites and transformed into E. coli ER1793.

PG8A PG8A is a shortened version of PG8 and has the first 173 amino acids N removed. The methods used for PG8A were essentially the same as for PG3 00 with the following exceptions. The 5' oligonucleotide primer sequence was CGCGGTATACATGGAAAACTTAAAGAAC, the 3' oligonucleotide primer sequence was CGCGAGATCTGIT CTGAAAGCTTTC and DNA was amplified with the TaqPlus Precision PCR System. The PCR product was g cloned into the expression plasmid pGex-stop RBS(IV) using the Bst Z171 and Bgl II restriction sites and transformed into E. coli ER1793. Prior to dialysis of the purified protein EDTA (Sigma) was added to a final concentration of The methods used for PG10 were essentially the same as for PG3 with the following exceptions. The 5' oligonucleotide primer sequence was CGCGGATATCATGGATAAAGTGAGCTATGC, the 3' oligonucleotide primer sequence was CGCGAGATCTTTGTTGATACTCAATAATTC and DNA was amplified with the TaqPlus Precision PCR System. The PCR product was digested with Eco RV and Bgl II and ligated into the expression plasmid pGex-stop RBS(IV) using the Bst 2171 and Bgl II restriction sites and transformed into E. coli ER1793.

PG11 The methods used for PG11 were essentially the same as for PG1 with the following exceptions. The 5' oligonucleotide primer sequence was GCGCGTATACATGAGAGCAAACATTGGCACGATACTTTCCG, the 3' oligonucleotide primer sequence was GCGCAGATCTGCGCAAGCGCAGTATATCGCC and DNA was amplified with Tli DNA polymerase (Promega). The PCR product was cloned intopCR-Blunt and transformed into E. coli ToplOF'before subcloning into the expression plasmid pGex-stop RBS(IV) using the Bst Z171 and Bgl 1l restriction sites and transformed into E. coli ER1793. PG11 was purified by solubilisation of E.

coli cells with 2% sarkosyl in binding buffer (Qiagen) which was diluted to WO 99/29870 PCT/AU98/01023 C 48 0 0.1% sarkosyl in binding buffer, bound to a Nickel-nitrilotriacetic acid n column (Ni-NTA; Qiagen), after washing bound proteins were eluted with IM imidazole CHAPS (Sigma) in elution buffer; Qiagen) according to the Qiagen recommendations. Following purification samples were dialysed 5 against 500mM NaCI, 20mM Tris, 0.7% CHAPS, 20% glycerol (Sigma) at N pH7.4 to remove the imidazole, concentrated as required and stored at 4'C 00 until used.

PG12 The methods used for PG12 were essentially the same as for PG1 with the following exceptions. The 5' oligonucleotide primer sequence was

GCGCGTATACATGAATAGCAGACATCTGACAATCACAATCATTGCCGG,

the 3' oligonucleotide primer sequence was GCGCAGATCTGCTGTTCTGTGAGTGCAGTTGTTTAAGTG and DNA was amplified with Tli DNA polymerase. The PCR product was cloned into pCR- Blunt and transformed into E. coli ToplOF'cells before subcloning into the expression plasmid pGex-stop RBS(IV) using the Bst Z171 and Bgl II restriction sites and transformed into E. coli BL21. Purification of the recombinant protein was essentially the same as PG11 except 0.5% DHPC (1, 2 -Diheptanoyl-sn-glycero-3-phosphocholine; Avanti) in 50mM Tris, NaCI, pHB.0 was used to solubilise the inclusion bodies instead of sarkosyl and the DHPC was diluted to 0.1% before addition to the Ni-NTA and 0.1% DHPC was added to all buffers.

PG13 The methods used for PG13 were essentially the same as for PG3 with the following exceptions. The 5' oligonucleotide primer sequence was GCGCCATATGCGGACAAAAACTATCTTIT-' GCG, the 3' oligonucleotide primer sequence was GCGCCTCGAGGTTGTTGAATCGAATCGCTATTTGAGC and DNA was amplified with Tli DNA polymerase, The PCR product was cloned the expression plasmid pET24b using the Nde I and Xho I restriction sites and transformed into E. coli BL21. Purification of the recombinant protein was essentially the same as PG3 using 6M urea and 1% NOG (n-octyl glucoside; Sigma) was added to the dialysis buffer. Removal of urea was not proceeded WO 99/29870 PCT/AU98/01023 49 O past 2M urea as the protein was insoluble at lower concentrations of urea.

SPurified protein was stored at 4°C until required.

PG14 The methods used for PG12 were essentially the same as for PG1 with the following exceptions. The 5' oligonucleotide primer sequence was 00 GCGCGGCGCCATGACGGACAACAAACAACGTAATATCG, the 3' Soligonucleotide primer sequence was GCGCCTCGAGTTACTTGCGTATGATCACGGACATACCC and DNA was amplified with Tli DNA polymerase. The PCR product was cloned the expression plasmid pProEx-1 using the Ehe I and Xho I restriction sites and transformed into E. coli BL21. Purification of the recombinant protein was essentially the same as PG12.

The methods used for PG15 were essentially the same as for PG3 with the following exceptions. The 5' oligonucleotide primer sequence was CAAAAGTATACTAATAAATATCATTCTCAA, the 3' oligonucleotide primer sequence was GCTTATGGTACCTTTGGTCTrATCTATTAT and DNA was amplified with the Tth XL PCR kit. The PCR product was cloned into the expression plasmid pGex-stop RBS(IV) using the Bst Z171 and Kpn I restriction sites and transformed into E. coli ER1793.

PG22 The methods used for PG22 were essentially the same as for PG1 with the following exceptions. The 5' oligonucleotide primer sequence was CCCCGGATCCGATGCGACTGATCAAGGC, the 3' oligonucleotide primer sequence was CCCCCTCGAGCGGAACGGGGTCATAGCC and DNA was amplified with the TaqPlus Precision PCR System. The PCR product was cloned into the expression plasmid pET24b using the Bam HI and Xho I restriction sites and transformed into E. coli BL21DE3. Once PG22 was purified dialysis was performed in the same manner as for PG1 but in the presence of 1M imidazole.

WO 99/29870 PCT/AU98/01023 0 PG24 Z The methods used for PG24 were essentially the same as for PG3 with the following exceptions. The 5' oligonucleotide primer sequence was CGCGGTATACATGAATTACCTGTACATAC, the 3' oligonucleotide primer sequence was CGCGGGATCCGTICGATTGGTCGTCGATGG and DNA was C amplified with the TaqPlus Precision PCR System. The PCR product was 00 digested with Bst 2171 and Barn HI and ligated into the expression plasmid OC pGex-stop RBS(IV) using the Bst Z171 and Bgl II restriction sites and Stransformed into E. coli ER1793. Due to the low level of expression of PG24 O 10 purification was not proceeded with except on small scale.

PG24A A modified version of PG24 was also cloned and expressed. PG24A is the same as PG24 with the predicted N-terminal sequence removed. The methods used for PG24A were essentially the same as for PG3 with the following exceptions. The 5' oligonucleotide primer sequence was CGCGCATATGGAGATTGCITTCCTTTCTIrCG, the 3' oligonucleotide primer sequence was CGCGCTCGAGTTAGTTCGATTGGTCGTCG and DNA was amplified with the TaqPlus Precision PCR System. The PCR product was cloned into the expression plasmid pProEx-1 using the Nde I and Xho I restriction sites and transformed into E. coli ER1793. Purification of the recombinant protein was essentially the same as PG3 except 8M urea was used to solubilise the inclusion bodies and in the buffers used for the Ni-NTA column purification. Urea was removed by sequential dialysis (4M then 2M, then 1M then 0.5M then OM urea all in 50mM Tris, 500mM NaC1, 8% glycerol, pH7.4). Purified protein was stored frozen at -80°C until required.

PG29 The methods used for PG29 were essentially the same as for PG3 with the following exceptions. The 5' oligonucleotide primer sequence was GCGCGATATCGCTAGCATGAAAAAGCTATITCTC, the 3' oligonucleotide primer sequence was GCGCAGATCTCTCGAGTTTGCCATCGGATTGCGGATTG and DNA was amplified with Pfu DNA polymerase being used. The PCR product was cloned into pCR-Blunt (InVitrogen) and transformed into E. coli ToplOF'before subcloning into the expression plasmid pGex-stop RBS(IV) WO 99/29870 PCT/AU98/01023 (NM 51 0 using the EcoR V and Bgl II restriction sites and transformed into E. coli BL21. 6M urea was used throughout the purification process.

5 The methods used for PG30 were essentially the same as for PG3 with Cl the following exceptions. The predicted N-terminal signal sequence was removed from the recombinant protein. The 5' oligonucleotide primer m sequence was TACGGAAITCGTGACCCCCGTCAGAAATGTGCGC, the 3' oligonucleotide primer sequence was CTATGCGGCCGCTTGATCCTCAAGGCTTTGCCCGG and DNA was NC amplified with the Tth XL PCR kit. The PCR product was cloned into the expression plasmid pET24a using the Eco RI and Not I restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates of PG30. 10ml cultures of recombinant E. coli were grown to an OD of 2.0 (Aoon0 in terrific broth and the cells were induced with 0.5mM IPTG and samples taken for analysis at 4 hours post induction. Purification was not done for these studies.

PG31 The methods used for PG31 were essentially the same as for with the following exceptions. The 5' oligonucleotide primer sequence was CGGGGAATTCGCAAAAATCAATTTCTATGCTGAA, the 3' oligonucleotide primer sequence was CTATGCGGCCGCTGTATGCAATAGGGAAAGCTCCGA and DNA was amplified with the Tth XL PCR kit. The PCR product was cloned into the expression plasmid pET24a using the Eco RI and Not I restriction sites and transformed into E.coli BL21DE3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates.

Purification was not done for these studies.

PG32 The methods used for PG32 were essentially the same as for with the following exceptions. The predicted N-terminal signal sequence was removed from the recombinant protein. The 5' oligonucleotide primer sequence was CGCAGAATCCAGGAGAATACTGTACCGGCAACG, the 3' oligonucleotide primer sequence was CTATGCGGCCGCCTTGGAGCGAACGA'TTACAACAC and DNA was WO 99/29870 PCT/AU98/01023 (N 52 z amplified with the Tth XL PCR kit. The PCR product was cloned into the expression plasmid pET24a using the Eco RI and Not I restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates. Purification was not done for these studies.

OO

0 PG33 SThe methods used for PG33 were essentially the same as for with the following exceptions. The predicted N-terminal signal sequence was removed from the recombinant protein.

C The 5' oligonucleotide primer sequence was TGCAGAAITCCAAGAAGCTACTACACAGAACAAA, the 3' oligonucleotide primer sequence was CTATGCGGCCGCTrCCGCTGCAGTCATTACTACAA and DNA was amplified with the Tth XL PCR kit. The PCR product was cloned into the expression plasmid pET24a using the Eco RI and Not I restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates.

Purification was not done for these studies.

The methods used for PG35 were essentially the same as for with the following exceptions. The 5' oligonucleotide primer sequence was GCGCGAATrCATGAAACAACTAAACATTATCAGC, the 3' oligonucleotide primer sequence was GCGTGCGGCCGCGAAATTGATCTTTGTACCGACGA and DNA was amplified with the Tth XL PCR kit. The PCR product was cloned into the expression plasmid pET24a using the Eco RI and Not I restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates.

Purification was not done for these studies.

PG36 The methods used for PG36 were essentially the same as for with the following exceptions. The 5' oligonucleotide primer sequence was AAAGGAATTCTACAAAAAGATTATTGCCGTAGCA, the 3' oligonucleotide primer sequence was CTATGCGGCCGCGAACTCCTGTCCGAGCACAAAGT and DNA was amplified with the Tth XL PCR kit. The PCR product was WO 99/29870 PCT/AU98/01023 S53 0 cloned into the expression plasmid pET24a using theEco RI and Not I Z restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates.

Purification was not done for these studies.

SPG37 OO The methods used for PG37 were essentially the same as for with the following exceptions. The 5' oligonucleotide primer sequence was TGGCGAATTCAAACGGITITTGAITT GATCGGC, the 3' oligonucleotide primer sequence was CTATGCGGCCGCCTTGCTAAAGCCCATCTTGCTCAG Sand DNA was amplified with the Tth XL PCR kit. The PCR product was cloned into the expression plasmid pET24a using the Eco RI and Not I restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates.

Purification was not done for these studies.

PG38 The methods used for PG38 were essentially the same as for with the following exceptions. The predicted N-terminal signal sequence was removed from the recombinant protein. The 5' oligonucleotide primer sequence was CCTCGAATTCCAAAAGGTGGCAGTGGTAAACACT, the 3' oligonucleotide primer sequence was CTATGCGGCCGCCTTGATTCCGAGTTTCGCTTTTAC and DNA was amplified with the Tth XL PCR kit. The PCR product was cloned into the expression plasmid pET24a using the Eco RI and Not I restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates. Purification was not done for these studies.

PG39 The methods used for PG39 were essentially the same as for with the following exceptions. The predicted N-terminal signal sequence was removed from the recombinant protein. The 5' oligonucleotide primer sequence was AGCTGGATCCCAAGGCGTCAGGGTATCGGGCTAT, the 3' oligonucleotide primer sequence was CTATGCGGCCGCGAATTCGACGAGGAGACGCAGGT and DNA was WO 99/29870 PCT/AU98/01023 S54 0 amplified with the Tth XL PCR kit. The PCR product was cloned into the Z expression plasmid pET24a using the Bar HI and Not I restriction sites and I transformed into E. coli BL21DE3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates. Purification was not done for these studies.

00 The methods used for PG40 were essentially the same as for Cwith the following exceptions. The predicted N-terminal signal sequence was removed from the recombinant protein. The 5' oligonucleotide primer Ssequence was GGCTGAATTCAAGACGGACAACGTCCCGACAGAT, the 3' oligonucleotide primer sequence was CTATGCGGCCGCGAAGTTGACCATAACCTTACCCA and DNA was amplified with the Tth XL PCR kit. The PCR product was cloned into the expression plasmid pET24a using the Eco RI and Not I restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates. Purification was not done for these studies.

PG41 The methods used for PG41 were essentially the same as for with the following exceptions. The predicted N-terminal signal sequence was removed from the recombinant protein. The 5' oligonucleotide primer sequence was GACTGAATTCCAAAACGCCTCCGAAACGACGGTA, the 3' oligonucleotide primer sequence was CTATGCGGCCGCTTGTTCGGGAATCCCCATGCCGTT and DNA was amplified with the Tth XL PCR kit. The PCR product was cloned into the expression plasmid pET24a using the Eco RI and Not I restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates. Purification was not done for these studies.

PG42 The methods used for PG42 were essentially the same as for with the following exceptions. The 5' oligonucleotide primer sequence was GTFTGAATTCGCAAATAATACTCTTTGGCGAAG, the 3' oligonucleotide WO 99/29870 PCT/AU98/01023 0 primer sequence was GAGTGCGGCCGCTTTGCCGGACATCGAAGAGATCGTC and DNA was amplified with the Tth XL PCR kit. The PCR product was cloned into the expression plasmid pET24a using the Eco RI and Not I restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity Sstudies were carried out on whole E. coli lysates. Purification was not done 00 for these studies.

PG43 The methods used for PG43 were essentially the same as for Swith the following exceptions. The 5' oligonucleotide primer sequence was GCGCGAATITCAAAAAAGAAAAACTIGGGATTGCG, the 3' oligonucleotide primer sequence was CTATGCGGCCGCCTTCAAAGCGAAAGAAGCCTTAAC and DNA was amplified with the Tth XL PCR kit. The PCR product was cloned into the expression plasmid pET24a using the Eco RI and Not I restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates.

Purification was not done for these studies.

PG44 The methods used for PG44 were essentially the same as for with the following exceptions. The predicted N-terminal signal sequence was removed from the recombinant protein. The 5' oligonucleotide primer sequence was AGCCGAATTCTGTAAGAAAAATGCTGACACTACC, the 3' oligonucleotide primer sequence was CTATGCGGCCGCCTTTITCCCGGGCTTGATCCCGAT and DNA was amplified with the Tth XL PCR kit. The PCR product was cloned into the expression plasmid pET24a using the Eco RI and Not I restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates. Purification was not done for these studies.

The methods used for PG45 were essentially the same as for with the following exceptions. The predicted N-terminal signal sequence was removed from the recombinant protein. The 5' oligonucleotide primer WO 99/29870 PCT/AU98/01023 N 56 0 sequence was GACAGGATCCTGCTCCACCACAAAGAATCTGCCG, the 3' oligonucleotide primer sequence was CTATGCGGCCGCGAAGGGATAGCCGACAGCCAAAT and DNA was amplified with the Tth XL PCR kit. The PCR product was cloned into the expression plasmid pET24a using the Bar HI and Not I restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity 00 studies were carried out on whole E. coli lysates. Purification was not done for these studies.

PG46 N The methods used for PG46 were essentially the same as for with the following exceptions. The predicted N-terminal signal sequence was removed from the recombinant protein. The 5' oligonucleotide primer sequence was CTCGGAATTCCGTATGTGCCGGACGGTAGCAGA, the 3' oligonucleotide primer sequence was CTATGCGGCCGCGAACGGATAGCCTACTGCAATGT and DNA was amplified with the Tth XL PCR kit. The PCR product was cloned into the expression plasmid pET24a using the Eco RI and Not I restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates. Purification was not done for these studies.

PG47 The methods used for PG47 were essentially the same as for with the following exceptions. The predicted N-terminal signal sequence was removed from the recombinant protein. The 5' oligonucleotide primer sequence was CGCCGAATTCCAAACAGTGGTGACCGGTAAGGTGATCGATTCAGAA, the 3' oligonucleotide primer sequence was

CTATGCGGCCGCGAAGTITACACGAATACCGGTAGACCAAGTGCGGCC

and DNA was amplified with the Tth XL PCR kit. The PCR product was cloned into the expression plasmid pET24a using the Eco RI and Not I restriction sites and transformed into E. coli BL21DE3, Expression studies and immunoreactivity studies were carried out on whole E. coli lysates.

Purification was not done for these studies.

WO 99/29870 PCT/AU98/01023 57 0 PG48 SP The methods used for PG48 were essentially the same as for In with the following exceptions. The predicted N-terminal signal sequence was removed from the recombinant protein. The 5' oligonucleotide primer sequence was TGCTGAATCCAAAAATCCAAGCAGGTACAGCGA, the 3' Soligonucleotide primer sequence was OO CTATGCGGCCGCTCGTAACCATAGTCTTGGGTTFTG and DNA was Samplified with the Tth XL PCR kit. The PCR product was cloned into the expression plasmid pET24a using the Eco RI and Not I restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates. Purification was not done for these studies.

PG49 The methods used for PG49 were essentially the same as for with the following exceptions. The predicted N-terminal signal sequence was removed from the recombinant protein. The 5' oligonucleotide primer sequence was GAACGGATCCAACGAGCCGGTGGAAGACAGATCC, the 3' oligonucleotide primer sequence was GAGTGCGGCCGCTAATCTCGACTTCATACTTGTACCA and DNA was amplified with the Tth XL PCR kit. The PCR product was cloned into the expression plasmid pET24a using the Barn HI and Not I restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates. Purification was not done for these studies.

The methods used for PG50 were essentially the same as for with the following exceptions. The predicted N-terminal signal sequence was removed from the recombinant protein. The 5' oligonucleotide primer sequence was GCTGGGATCCGCGACAGACACTGAGTTCAAGTAC, the 3' oligonucleotide primer sequence was CTATGCGGCCGCGAACTTCACTACCAAGCCCATGT and DNA was amplified with the Tth XL PCR kit. The PCR product was cloned into the expression plasmid pET24a using the Barn HI and Not I restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity WO 99/29870 PCT/AU98/01023 58 O studies were carried out on whole E. coli lysates. Purification was not done 4 for these studies.

PG51 The methods used for PG51 were essentially the same as for with the following exceptions. The predicted N-terminal signal sequence was OO removed from the recombinant protein. The 5' oligonucleotide primer m sequence was TCTIGAATTCGCGCAAAGTCTTTTCAGCACCGAA, the 3' oligonucleotide primer sequence was CTATGCGGCCGCACTITTCGTGGGATCACTCTCTT and DNA was Samplified with the Tth XL PCR kit. The PCR product was cloned into the expression plasmid pET24a using the Eco RI and Not I restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates. Purification was not done for these studies.

PG52 The methods used for PG52 were essentially the same as for with the following exceptions. The 5' oligonucleotide primer sequence was AGAAGAATTCAAACGGACAATCCTCCTGACGGCA, the 3' oligonucleotide primer sequence was CTATGCGGCCGCGAAGTCTTGCCCTGATAGAAATC and DNA was amplified with the Tth XL PCR kit. The PCR product was cloned into the expression plasmid pET24a using the Eco RI and Not I restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates.

Purification was not done for these studies.

PG53 The methods used for PG53 were essentially the same as for with the following exceptions. The predicted N-terminal signal sequence was removed from the recombinant protein. The 5' oligonucleotide primer sequence was GGCTGAATTCGCGAATCCCCTTACGGGCCAATCG, the 3' oligonucleotide primer sequence was CTATGCGGCCGCGTCCGAAAGGCAGCCGTAATAGG and DNA was amplified with the Tth XL PCR kit. The PCR product was cloned into the expression plasmid pET24a using the Eco RI and Not I restriction sites and WO 99/29870 PCT/AU98/01023 S59 O transformed into E. coli BL21DE3. Expression studies and immunoreactivity Z studies were carried out on whole E. coli lysates. Purification was not done n for these studies.

0 PG54 The methods used for PG54 were essentially the same as for 00 with the following exceptions. The predicted N-terminal signal sequence was removed from the recombinant protein. The 5' oligonucleotide primer N sequence was CGCTGAATICCAGA'TICGTTCGGAGGGGAACCC, the 3' oligonucleotide primer sequence was CTATGCGGCCGCCTGCTTCACGATCTTTTGGCTCA and DNA was amplified with the Tth XL PCR kit. The PCR product was cloned into the expression plasmid pET24a using the Eco RI and Not I restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates. Purification was not done for these studies.

The methods used for PG55 were essentially the same as for with the following exceptions. The predicted N-terminal signal sequence was removed from the recombinant protein. The 5' oligonucleotide primer sequence was CGAGGGATCCGAGCTCTCTATT'GCGATGGCGAG, the 3' oligonucleotide primer sequence was GAGTGCGGCCGCTCTTACCTGACTTCTTGTCACGAAT and DNA was amplified with the Tth XL PCR kit. The PCR product was cloned into the expression plasmid pET24a using the Barn HI and Not I restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates. Purification was not done for these studies.

PG56 The methods used for PG56 were essentially the same as for with the following exceptions. The 5' oligonucleotide primer sequence was AAATGGATCCCGAAAAATTTTGAGCTITTTGATG, the 3' oligonucleotide primer sequence was CTATGCGGCCGCTTTGATrCGTAATTTTTCCGTATC and DNA was amplified with the Tth XL PCR kit. The PCR product was SWO 99/29870 PCT/AU98/01023 0 cloned into the expression plasmid pET24a using the Barn HI and Not I Z restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates.

Purification was not done for these studies.

C PG57 00 The methods used for PG57 were essentially the same as for C with the following exceptions. The predicted N-terminal signal sequence was removed from the recombinant protein. The 5' oligonucleotide primer sequence was TGCTGGATCCCAAGAGATCTCAGGCATGAATGCA, the 3' oligonucleotide primer sequence was GAGTGCGGCCGCTCGGCCTCTTTATCTCTACCTTTC and DNA was amplified with the Tth XL PCR kit. The PCR product was cloned into the expression plasmid pET24a using the Barn HI and Not I restriction sites and transformed into E. coli BL21DE3, Expression studies and immunoreactivity studies were carried out on whole E. coli lysates. Purification was not done for these studies.

PG58 The methods used for PG58 were essentially the same as for with the following exceptions. The predicted N-terminal signal sequence was removed from the recombinant protein. The 5' oligonucleotide primer sequence was CGGTGAATTCCAAACCCCACGAAATACAGAAACC, the 3' oligonucleotide primer sequence was GAGTGCGGCCGCTGAAAGTCCAGCTAAAACCGGCGAA and DNA was amplified with the Tth XL PCR kit The PCR product was cloned into the expression plasmid pET24a using the Eco RI and Not I restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates. Purification was not done for these studies.

PG59 The methods used for PG59 were essentially the same as for with the following exceptions. The predicted N-terminal signal sequence was removed from the recombinant protein. The 5' oligonucleotide primer sequence was TGCTGAATTCCAACAAGAGAAGCAGGTGTITCAT, the 3' WO 99/29870 PCT/AU98/01023 61 O oligonucleotide primer sequence was GAGTGCGGCCGCTGAAGATGCTCT'ATCGTCCAAACG and DNA was amplified with the Tth XL PCR kit. The PCR product was cloned into the expression plasmid pET24a using the Eco RI and Not I restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates. Purification was not done 00 for these studies.

The methods used for PG60 were essentially the same as for with the following exceptions. The predicted N-terminal signal sequence was removed from the recombinant protein. The 5' oligonucleotide primer sequence was GGCGGAATTCCAGATGCTCAATACTCCTTTCGAG, the 3' oligonucleotide primer sequence was GAGTGCGGCCGCTGAAGAGGTAGGAGATATTGCAGAT and DNA was amplified with the Tth XL PCR kit. The PCR product was cloned into the expression plasmid pET24a using the Eco RI and Not I restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates. Purification was not done for these studies.

PG61 The methods used for PG61 were essentially the same as for with the following exceptions. The predicted N-terminal signal sequence was removed from the recombinant protein. The 5' oligonucleotide primer sequence was AGCAGAATCCCCGTCTCCAACAGCGAGATAGAT, the 3' oligonucleotide primer sequence was GAGTGCGGCCGCTGAAATCGATTGTCAGACTACCCAG and DNA was amplified with the Tth XL PCR kit. The PCR product was cloned into the expression plasmid pET24a using the Eco RI and Not I restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates. Purification was not done for these studies.

WO 99/29870 PCT/AU98/01023 <U 62 0 PG62 z P The methods used for PG62 were essentially the same as for O with the following exceptions. The predicted N-terminal signal sequence was removed from the recombinant protein. The 5' oligonucleotide primer sequence was TGCTGAATTCCAGCGGTTTCCGATGGTGCAGGGA, the 3' Soligonucleotide primer sequence was 0 GAGTGCGGCCGCTGAAGTGAAATCCGACACGCAGCTG and DNA was Samplified with the Tth XL PCR kit The PCR product was cloned into the expression plasmid pET24a using the Eco RI and Not I restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity Sstudies were carried out on whole E. coli lysates. Purification was not done for these studies.

PG63 The methods used for PG63 were essentially the same as for with the following exceptions. The predicted N-terminal signal sequence was removed from the recombinant protein. The 5' oligonucleotide primer sequence was GGCAGAATrCCAAGAAGCAAACACTGCATCTGAC, the 3' oligonucleotide primer sequence was GAGTGCGGCCGCTGAAAGTGTACGCAACACCCACGCC and DNA was amplified with the Tth XL PCR kit. The PCR product was cloned into the expression plasmid pET24a using the Eco RI and Not I restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates. Purification was not done for these studies.

PG64 The methods used for PG64 were essentially the same as for with the following exceptions. The predicted N-terminal signal sequence was removed from the recombinant protein. The 5' oligonucleotide primer sequence was TGCTGAATTCCAGAGTCGTCCTGCTCTTAGACTG, the 3' oligonucleotide primer sequence was GAGTGCGGCCGCTGAAGCGAACACCGAGACCCACAAA and DNA was amplified with the Tth XL PCR kit. The PCR product was cloned into the expression plasmid pET24a using the Eco RI and Not I restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity WO 99/2980 PCT/AU98/01023 0 63 Sstudies were carried out on whole E. coli lysates. Purification was not done 0 for these studies.

The methods used for PG65 were essentially the same as for Swith the following exceptions. The predicted N-terminal signal sequence was removed from the recombinant protein. The 5' oligonucleotide primer 00 sequence was GGCCGGATCCATCGGACAAAGCCGCCCGGCACTT, the 3' (Sr oligonucleotide primer sequence was GAGTGCGGCCGCTAAAGCGCTAACCTATGCCCACGAA and DNA was Samplified with the Tth XL PCR kit. The PCR product was cloned into the Nq expression plasmid pET24a using the Barn HI and Not I restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates. Purification was not done for these studies.

PG66 The methods used for PG66 were essentially the same as for with the following exceptions. The predicted N-terminal signal sequence was removed from the recombinant protein. The 5' oligonucleotide primer sequence was GTTTGAATTCCAAGACGTTATCAGACCATGGTCA, the 3' oligonucleotide primer sequence was GAGTGCGGCCGCTAAAATGAGTGGAGAGCGTGGCCAT and DNA was amplified with the Tth XL PCR kit. The PCR product was cloned into the expression plasmid pET24a using the Eco RI and Not I restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates. Purification was not done for these studies.

PG67 The methods used for PG67 were essentially the same as for with the following exceptions. The predicted N-terminal signal sequence was removed from the recombinant protein. The 5' oligonucleotide primer sequence was GAACGAGCTCGCGGAACGTCCTATGGCCGGAGCA, the 3' oligonucleotide primer sequence was GAGTGCGGCCGCTATACCAAGTATTCGTGATGGGACG and DNA was WO 99/29870 WO 99/29870 PCT/AU98/01023 64 0 amplified with the Tth XL PCR kit. The PCR product was cloned into the z expression plasmid pET24a using the Sac I and Not I restriction sites and t transformed into E. coli BL21DE3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates. Purification was not done for these studies.

0 PG68 SThe methods used for PG68 were essentially the same as for Swith the following exceptions. The predicted N-terminal signal sequence was removed from the recombinant protein. The 5' oligonucleotide primer 0 sequence was GCTTGCGGCCGCCCTTATGAAAGATITGCAGAT, the 3' oligonucleotide primer sequence was GGTGCTCGAGTATACTCAACAAGCACCTTATGCAC and DNA was amplified with the Tth XL PCR kit The PCR product was cloned into the expression plasmid pET24a using the Not I and Xho I restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates. Purification was not done for these studies.

PG69 The methods used for PG69 were essentially the same as for with the following exceptions. The predicted N-terminal signal sequence was removed from the recombinant protein. The 5' oligonucleotide primer sequence was TGCTGAATTCCAGGAAGGGGAGGGGAGTGCCCGA, the 3' oligonucleotide primer sequence was GAGTGCGGCCGCTGAAGCTGTAGCGGGCTITGAACCA and DNA was amplified with the Tth XL PCR kit. The PCR product was cloned into the expression plasmid pET24a using the Eco RI and Not I restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity studies were carried out on whole E. co li lysates. Purification was not done for these studies.

The methods used for PG70 were essentially the same as for with the following exceptions. The predicted N-terminal signal sequence was removed from the recombinant protein. The 5' oligonucleotide primer WO 99/29870 PCT/AU98/01023 6 O sequence was CGGTCGATCCTCGCAAATGCTCTTCTCAGAGAAT, the 3' Z oligonucleotide primer sequence was SGAGTGCGGCCGCTAAACGAAATATCGATACCAACATC and DNA was O amplified with the Tth XL PCR kit. The PCR product was cloned into the expression plasmid pET24a using the Barn HI and Not I restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity 0 studies were carried out on whole E. coli lysates. Purification was not done for these studies.

PG71 SThe methods used for PG71 were essentially the same as for with the following exceptions. The predicted N-terminal signal sequence was removed from the recombinant protein. The 5' oligonucleotide primer sequence was TGCTGAATTCCAGAACAATACCCTCGATGTACAC, the 3' oligonucleotide primer sequence was GAGTGCGGCCGCTATTGCCGGTAGGATTTCCTTGTCC and DNA was amplified with the Tth XL PCR kit. The PCR product was cloned into the expression plasmid pET24a using the Eco RI and Not I restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates. Purification was not done for these studies.

PG72 The methods used for PG72 were essentially the same as for with the following exceptions. The predicted N-terminal signal sequence was removed from the recombinant protein. The 5' oligonucleotide primer sequence was TGCTGAATTCGGAGAGCGACTGGAGACGGACAGC, the 3' oligonucleotide primer sequence was GAGTGCGGCCGCTATGATTGCCTTTCAGAAAAGCTAT and DNA was amplified with the Tth XL PCR kit. The PCR product was cloned into the expression plasmid pET24a using the Eco RI and Not I restriction sites and transformed TGCTGAATTCGGAGAGCGACTGGAGACGGACAGC into E. coli BL21DE3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates. Purification was not done for these studies.

WO 99/29870 PCT/AU98/01023 66 0 PG73 Z The methods used for PG73 were essentially the same as for t with the following exceptions. The predicted N-terminal signal sequence was removed from the recombinant protein. The 5' oligonucleotide primer sequence was CGGTGAATTCCAACAGACAGGACCGGCCGAACGC, the 3' oligonucleotide primer sequence was 00 GAGTGCGGCCGCTITAAGAAAGGTATCTGATAGATCAG and DNA was c amplified with the Tth XL PCR kit. The PCR product was cloned into the Cq expression plasmid pET24a using the Eco RI and Not I restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates. Purification was not done for these studies.

PG74 The methods used for PG74 were essentially the same as for with the following exceptions. The predicted N-terminal signal sequence was removed from the recombinant protein. The 5' oligonucleotide primer sequence was TGCTGAATTCCAAGAAAATAATACAGAAAAGTCA, the 3' oligonucleotide primer sequence was GAGTGCGGCCGCTGAGGTTTAATCCTATGCCAATACT and DNA was amplified with the Tth XL PCR kit. The PCR product was cloned into the expression plasmid pET24a using the Eco RI and Not I restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates. Purification was not done for these studies.

The methods used for PG75 were essentially the same as for with the following exceptions. The predicted N-terminal signal sequence was removed from the recombinant protein. The 5' oligonucleotide primer sequence was GGCGGGATCCGCTCAGGAGCAACTGAATTGTGTA, the 3' oligonucleotide primer sequence was GAGTGCGGCCGCTGTGGAACAAATTGCGCAATCCATC and DNA was amplified with the Tth XL PCR kit. The PCR product was cloned into the expression plasmid pET24a using the Barn HI and Not I restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity WO 99/29870 PCT/AU98/01023 -67 O studies were carried out on whole E. coli lysates. Purification was not done Z for these studies.

0 PG76 The methods used for PG76 were essentially the same as for with the following exceptions. The predicted N-terminal signal sequence was OQ removed from the recombinant protein. The 5' oligonucleotide primer sequence was AGCAGAATTCGGAAACGCACAGAGCTITIGGGAA, the 3' Soligonucleotide primer sequence was GAGTGCGGCCGCTTACCTGCACCTTATGACTGAATAC and DNA was O amplified with the Tth XL PCR kit The PCR product was cloned into the expression plasmid pET24a using the Eco RI and Not I restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates. Purification was not done for these studies.

PG77 The methods used for PG77 were essentially the same as for with the following exceptions. The predicted N-terminal signal sequence was removed from the recombinant protein. The 5' oligonucleotide primer sequence was TGCTGAATTCCAAGAGAAAAAGGATAGTCTCTCT, the 3' oligonucleotide primer sequence was GAGTGCGGCCGCTCTTCTTATCGCCATAGAATACAGG and DNA was amplified with the Tth XL PCR kit. The PCR product was cloned into the expression plasmid pET24a using the Eco RI and Not I restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates. Purification was not done for these studies.

PG78 The methods used for PG78 were essentially the same as for with the following exceptions. The predicted N-terminal signal sequence was removed from the recombinant protein. The 5' oligonucleotide primer sequence was GGCAGAATTCCAGGATTCTTCCCACGGTAGCAAT, the 3' oligonucleotide primer sequence was GAGTGCGGCCGCTATCATGATAGTAAAGACTGGTTCT and DNA was WO 99/29870 PCT/AU98/01023 S68 O amplified with the Tth XL PCR kit. The PCR product was cloned into the Z expression plasmid pET24a using the Eco RI and Not I restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates. Purification was not done for these studies.

00 PG79 The methods used for PG79 were essentially the same as for Nc with the following exceptions. The 5' oligonucleotide primer sequence was TGCTGAAITCGTAGTGACGCTGCTCGTAATTGTC, the 3' oligonucleotide Sprimer sequence was GAGTGCGGCCGCTGCCGTCCTGCCTTICTGCCTGACG and DNA was amplified with the Tth XL PCR kit. The PCR product was cloned into the expression plasmid pET24a using the Eco RI and Not I restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates. Purification was not done for these studies.

The methods used for PG80 were essentially the same as for with the following exceptions. The predicted N-terminal signal sequence was removed from the recombinant protein. The 5' oligonucleotide primer sequence was GGCCGAATTCCAAAACGTGCAGTTGCACTACGAT, the 3' oligonucleotide primer sequence was GAGTGCGGCCGCTGTIGAAAGTCCATTTGACCGCAAG and DNA was amplified with the Tth XL PCR kit. The PCR product was cloned into the expression plasmid pET24a using the Eco RI and Not I restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates. Purification was not done for these studies.

PG81 The methods used for PG81 were essentially the same as for with the following exceptions. The predicted N-terminal signal sequence was removed from the recombinant protein. The 5' oligonucleotide primer sequence was GTTTGAATTCCAGGATTTCTCTATGAAATAGGA, the 3' WO 99/29870 PCT/AU98/01023 S69 0 oligonucleotide primer sequence was Z GAGTGCGGCCGCTTTGTTTATTACAAAAAGTCTTACG and DNA was amplified with the Tth XL PCR kit. The PCR product was cloned into the 0 expression plasmid pET24a using the Eco RI and Not I restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates. Purification was not done 0 for these studies.

0"0 M PG82 The methods used for PG82 were essentially the same as for 0with the following exceptions. The predicted N-terminal signal sequence was removed from the recombinant protein. The 5' oligonucleotide primer sequence was GAACGAATTCCAGAACAACAACTTTACCGAGTCG, the 3' oligonucleotide primer sequence was GAGTGCGGCCGCTGTTCAGTTTCAGCTTTITAAACCA and DNA was amplified with the Tth XL PCR kit. The PCR product was cloned into the expression plasmid pET24a using the Eco RI and Not I restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates. Purification was not done for these studies.

PG84 The methods used for PG84 were essentially the same as for with the following exceptions. The predicted N-terminal signal sequence was removed from the recombinant protein. The 5' oligonucleotide primer sequence was TGCTGGATCCCAGAATGATGACATCTTCGAAGAT, the 3' oligonucleotide primer sequence was GAGTGCGGCCGCTATTGCGTCCCCGGCCACTACGTCC and DNA was amplified with the Tth XL PCR kit. The PCR product was cloned into the expression plasmid pET24a using the Barn HI and Not I restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates. Purification was not done for these studies.

WO 99/29870 PCT/AU98/01023 O Z The methods used for PG85 were essentially the same as for with the following exceptions. The predicted N-terminal signal sequence was removed from the recombinant protein. The 5' oligonucleotide primer sequence was CGGTGAATTCGTACCAACGGACAGCACGGAATCG, the 3' oligonucleotide primer sequence was OO GAGTGCGGCCGCTCAGATTGGTGCTATAAGAAAGGTA and DNA was amplified with the Tth XL PCR kit. The PCR product was cloned into the C expression plasmid pET24a using the Eco RI and Not I restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity Sstudies were carried out on whole E. coli lysates. Purification was not done Sfor these studies.

PG86 The methods used for PG86 were essentially the same as for with the following exceptions. The predicted N-terminal signal sequence was removed from the recombinant protein. The 5' oligonucleotide primer sequence was TGCTGGATCCCAAACGCATGATCATCTCATCGAA, the 3' oligonucleotide primer sequence was GAGTGCGGCCGCTGTGGTTCAGGCCGTGGGCAAATCT and DNA was amplified with the Tth XL PCR kit. The PCR product was cloned into the expression plasmid pET24a using the Bam HI and Not I restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates. Purification was not done for these studies.

PG87 The methods used for PG87 were essentially the same as for with the following exceptions. The predicted N-terminal signal sequence was removed from the recombinant protein. The 5' oligonucleotide primer sequence was GGCGGAATTCCAGAGCTATGTGGACTACGTCGAT, the 3' oligonucleotide primer sequence was GAGTGCGGCCGCTATTACTGTGATTAGCGCGACGCTG and DNA was amplified with the Tth XL PCR kit. The PCR product was cloned into the expression plasmid pET24a using the Eco RI and Not I restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity WO 99/29870 PCT/AU98/01023 71 0 studies were carried out on whole E. coli lysates. Purification was not done Z for these studies.

SPG88 The methods used for PG88 were essentially the same as for with the following exceptions. The predicted N-terminal signal sequence was 00 removed from the recombinant protein. The 5' oligonucleotide primer 00sequence was AGCAGAATCGCCGAATCGAAGTCTGTCTCTTC, the 3' NC oligonucleotide primer sequence was GAGTGCGGCCGCTCGGCAAGTAACGCITTAGTGGGGA and DNA was O amplified with the Tth XL PCR kit. The PCR product was cloned into the expression plasmid pET24a using the Eco RI and Not I restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates. Purification was not done for these studies.

PG89 The methods used for PG89 were essentially the same as for with the following exceptions. The predicted N-terminal signal sequence was removed from the recombinant protein. The 5' oligonucleotide primer sequence was TGCTGAATTCCAATCGAAGTTAAAGATCAAGAGC, the 3' oligonucleotide primer sequence was GAGTGCGGCCGCTATTAGTCCAAAGACCCACGGTAAA and DNA was amplified with the Tth XL PCR kit. The PCR product was cloned into the expression plasmid pET24a using the Eco RI and Not I restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates. Purification was not done for these studies.

The methods used for PG90 were essentially the same as for with the following exceptions. The predicted N-terminal signal sequence was removed from the recombinant protein. The 5' oligonucleotide primer sequence was GGCAGAATTCCAAACAACGACGAACAGTAGCCGG, the 3' oligonucleotide primer sequence was GAGTGCGGCCGC'1TTT1 GTTGTGATACTGTTTGGGC and DNA was WO 99/29870 PCT/AU98/01023 72 O amplified with the Tth XL PCR kit. The PCR product was cloned into the Z expression plasmid pET24a using the Eco RI and Not I restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates. Purification was not done for these studies.

00 PG91 SThe methods used for PG91 were essentially the same as for with the following exceptions. The predicted N-terminal signal sequence was removed from the recombinant protein. The 5' oligonucleotide primer sequence was TGCTGAATrCCAGACGATGGGAGGAGATGATGTC, the 3' oligonucleotide primer sequence was GAGTGCGGCCGCTTTCCACGATGAGCTTCTCTACGAA and DNA was amplified with the Tth XL PCR kit. The PCR product was cloned into the expression plasmid pET24a using the Eco RI and Not I restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates. Purification was not done for these studies.

PG92 The methods used for PG92 were essentially the same as for with the following exceptions. The predicted N-terminal signal sequence was removed from the recombinant protein. The 5' oligonucleotide primer sequence was GGCCGAATTCGCCGATGCACAAAGCTCTGTTCT, the 3' oligonucleotide primer sequence was GAGTGCGGCCGCTTCGAGGACGATTGCTTAGTTCGTA and DNA was amplified with the Tth XL PCR kit. The PCR product was cloned into the expression plasmid pET24a using the Eco RI and Not I restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates. Purification was not done for these studies.

PG93 The methods used for PG93 were essentially the same as for with the following exceptions. The predicted N-terminal signal sequence was removed from the recombinant protein. The 5' oligonucleotide primer WO 99/29870 PCT/AU98/01023 73 O sequence was GGCCGAGCTCCAAGAGGAAGGTATIGGAATACC, the 3' Z oligonucleotide primer sequence was V) GAGTGCGGCCGCTGCGAATCACTGCGAAGCGAATTAG and DNA was amplified with the Tth XL PCR kit. The PCR product was cloned into the expression plasmid pET24a using the Sac I and Not I restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity 00 studies were carried out on whole E. coli lysates. Purification was not done c for these studies.

PG94 The methods used for PG94 were essentially the same as for with the following exceptions. The predicted N-terminal signal sequence was removed from the recombinant protein. The 5' oligonucleotide primer sequence was GGCCGAGCTCCAAGAGGAAGGTATTTGGAATACC, the 3' oligonucleotide primer sequence was GAGTGCGGCCGCTTTGT CCACCACGATCATT'CTT and DNA was amplified with the Tth XL PCR kit. The PCR product was cloned into the expression plasmid pET24a using the Eco RI and Not I restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates. Purification was not done for these studies.

The methods used for PG95 were essentially the same as for with the following exceptions. The predicted N-terminal signal sequence was removed from the recombinant protein. The 5' oligonucleotide primer sequence was GGCCGAGCTCTGTGGAAAAAAAGAAAAACACTCT, the 3' oligonucleotide primer sequence was GAGTGCGGCCGCTAACTGTCTCCTTGTCGCTCCCCGG and DNA was amplified with the Tth XL PCR kit. The PCR product was cloned into the expression plasmid pET24a using the Sac I and Not I restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates. Purification was not done for these studies.

WO 99/29870 PCT/AU98/01023 74 O PG96 Z The methods used for PG96 were essentially the same as for Swith the following exceptions. The predicted N-terminal signal sequence was removed from the recombinant protein. The 5' oligonucleotide primer sequence was TGCTGAGCTCCAAACGCAAATGCAAGCAGACCGA, the 3' oligonucleotide primer sequence was 00 GAGTGCGGCCGCITI'GAGAATTTCATTGTCTCACG and DNA was amplified with the Tth XL PCR kit. The PCR product was cloned into the N expression plasmid pET24a using the Sac I and Not I restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity Sstudies were carried out on whole E. coli lysates. Purification was not done for these studies.

PG97 The methods used for PG97 were essentially the same as for with the following exceptions. The predicted N-terminal signal sequence was removed from the recombinant protein. The 5' oligonucleotide primer sequence was GGCGGGATCCCAGTTTGTTCCGGCTCCCACCACA, the 3' oligonucleotide primer sequence was GAGTGCGGCCGCTCTGTITGATGAGCTTAGTGGTATA and DNA was amplified with the Tth XL PCR kit. The PCR product was cloned into the expression plasmid pET24a using the Barn HI and Not I restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates. Purification was not done for these studies.

PG98 The methods used for PG98 were essentially the same as for with the following exceptions. The predicted N-terminal signal sequence was removed from the recombinant protein. The 5' oligonucleotide primer sequence was AGCAGAATTCCAAGAAAGAGTCGATGAAAAAGTA, the 3' oligonucleotide primer sequence was GAGTGCGGCCGCTTAGCTGTGTAACATTAAGTTTTTTATGAT and DNA was amplified with the Tth XL PCR kit. The PCR product was cloned into the expression plasmid pET24a using the Eco RI and Not I restriction sites and transformed into E. coli BL21DE3. Expression studies and WO 99/29870 PCT/AU98/01023 O immunoreactivity studies were carried out on whole E. coli lysates.

z Purification was not done for these studies.

PG99 The methods used for PG99 were essentially the same as for Swith the following exceptions. The predicted N-terminal signal sequence was 00 removed from the recombinant protein. The 5' oligonucleotide primer sequence was TGCTGAATTCAAGGACAATTCTTCTTACAAACCT, the 3' N oligonucleotide primer sequence was GAGTGCGGCCGCTTCGAATCACGACTTTTCTCACAAA and DNA was Samplified with the Tth XL PCR kit. The PCR product was cloned into the expression plasmid pET24a using the Eco RI and Not I restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates. Purification was not done for these studies.

PG100 The methods used for PG100 were essentially the same as for with the following exceptions. The predicted N-terminal signal sequence was removed from the recombinant protein. The 5' oligonucleotide primer sequence was GGCAGAATTCCAGTCTTGAGCACAATCAAAGTA, the 3' oligonucleotide primer sequence was GAGTGCGGCCGCTGATAGCCAGCTTGATGCTCTTAGC and DNA was amplified with the Tth XL PCR kit The PCR product was cloned into the expression plasmid pET24a using the Eco RI and Not I restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates. Purification was not done for these studies.

PG101 The methods used for PG101 were essentially the same as for with the following exceptions. The 5' oligonucleotide primer sequence was TGCTGAATTCAAAGGCAAGGGCGATCTGGTCGGG, the 3' oligonucleotide primer sequence was GAGTGCGGCCGCTTCTCTCTCGAACTGGCCGAGTA and DNA was amplified with the Tth XL PCR kit. The PCR product was cloned into the WO 99/29870 PCT/AU98/01023 76 O expression plasmid pET24a using the Eco RI and Not I restriction sites and Z transformed into E. coli BL21DE3. Expression studies and immunoreactivity It studies were carried out on whole E. coli lysates. Purification was not done for these studies.

PG102 00 The methods used for PG102 were essentially the same as for with the following exceptions. The predicted N-terminal signal sequence was Sremoved from the recombinant protein. The 5' oligonucleotide primer sequence was GGCCGAATICCAGATGGATATTGGTGGAGACGAT, the 3' 0 oligonucleotide primer sequence was GAGTGCGGCCGCTCTCTACAATGATITITICCACGAA and DNA was amplified with the Tth XL PCR kit. The PCR product was cloned into the expression plasmid pET24a using the Eco RI and Not I restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates. Purification was not done for these studies.

PG104 The methods used for PG104 were essentially the same as for with the following exceptions. The predicted N-terminal signal sequence was removed from the recombinant protein. The 5' oligonucleotide primer sequence was GAACGGATCCAACGTGTCTGCTCAGTCACCCCGA, the 3' oligonucleotide primer sequence was GAGTGCGGCCGCTTCTGAGCGATACTTTTGCACGTAT and DNA was amplified with the Tth XL PCR kit. The PCR product was cloned into the expression plasmid pET24a using the Bam HI and Not I restriction sites and transformed into E. coli BL21DE3. Expression studies and immunoreactivity studies were carried out on whole E. coli lysates. Purification was not done for these studies.

Animal antisera and human patient sera.

Various antisera were raised for detecting the expression and refolding of the recombinant P. gingivalis proteins. A whole cell antisera was raised by injecting New Zealand White rabbits with 3 doses of sonicated WO 99/29870 PCT/AU98/01023 S77 0 P. gingivalis (strain W50) containing approximately 2mg of protein. The first Z dose was given in Freunds complete adjuvant (FCA) and the second and third I) doses were given in Freunds incomplete adjuvant (IFA) at 3 week intervals.

Doses (iml) were given intramuscularly into the hind legs and rabbits bled 7 days after the last dose, the blood clotted and serum removed and stored at until required. A second rabbit antisera was produced in a similar 00 manner but using a sarkosyl insoluble fraction (each dose was 0.69mg of Sprotein) derived from P. gingivalis W50 according to the method of Doidg and C( Trust T. et al 1994 as the immunogen. A third rabbit antisera was produced in a similar manner to the first only the sarkosyl soluble fraction (1mg of protein per dose) derived from P. gingivalis W50 cells according to the method of Doidg P. and Trust TJ. (1994 Infect Immun 62:4526-33) was used as the immunogen.

A "protected rat serum" pool was also used in these studies and was obtained from rats immunised with formalin killed whole P. gingivalis cells in FIA (strain ATCC 33277; 2 doses of 2x10 9 cells, 3 weeks apart). Rats were then challenged 2 weeks after their last dose with live P. gingivalis cells (strain 33277) given orally as previously described (Klaussen B. et al. 1991, Oral Microbiol Immunol 6:193-201) and the serum obtained from these rats 6 weeks after the final challenge inoculation at the time of sacrifice.

Human sera were obtained from adult patients undergoing treatment or assessment for periodontitis at an outpatient clinic. These patients had at least 6 teeth with 6mm attachment loss and had P. gingivalis present in their sub-gingival plaque as detected using a P. gingivalis specific DNA probe.

Sera was pooled from these patients and compared to a pool of sera from periodontally healthy patients.

Immunization and Murine Lesion Model Protocols The mouse abscess model was used to assess the efficacy of immunising mice with recombinant P. gingivalis proteins in protecting mice from formation of a subcutaneous abscess. This model has been used by others as a predictor of potential vaccines against periodontal disease (Bird PS, et al. 1995 J. Periodontol. 66:351-362. BALB/c mice 6-8 weeks old were immunised by subcutaneously injecting them with 0.1 ml containing either or 20gg of recombinant P. gingivalis protein, 20pg of E. coli lysate protein, WO 99/29870 PCT/AU98/01023 S78 2 x 109 formalin killed cells of P. gingivalis strain 33277 emulsified in Sincomplete Freund's adjuvant (IFA; Sigma) on day 0. At day 21 mice were lt re-injected with the same dose and then bled 1 week later and evaluated for O antibody levels. At day 35 mice all mice were challenged with approximately 2 x 10' cells of live P. gingivalis (ATCC 33277) by subcutaneous injection in the abdomen. Following challenge mice were 0 monitored daily for weight loss and the size of the lesion measured for the next 10 days. Lesion sizes were measured by length and width and expressed N as mm. Groups were statistically analysed using a Kruskal-Wallis one-way ANOVA and were also individually examined using the unpaired t test or 0Mann-Whitney rank sum test using the Instat statistical package.

Figure 1 shows the results of one experiment at day 4 after challenge (lesions were at maximum size at this time point). Control mice immunised with E. coli lysate showed large lesions while mice immunised with killed cells of P. gingivalis strain 33277 were fully protected. This indicates that whole cells provide protection against P. gingivalis while E. coli protein immunised mice were not protected. Mice given the various PG recombinant proteins showed significant levels of protection for PG2, PG22, PG24 and PG29 (p<0.05 unpaired t test) while PG8A was not quite significantly different (p=0.07) compared to the E. coli control group.

Figure 2 shows the results of a separate experiment using combinations of recombinant proteins. Mice given PG1 PG2 showed a significant level of protection compared to control mice give E. coli lysate (p<0.026 unpaired t test).

Immunoscreening Cloned candidates were cultured in 15ml of Terrific broth, induced with IPTG and sampled at 4h post-induction. One ml of culture was removed, pelleted and the cells resuspended in a volume of PBS determined by dividing the OD Acoonm of the culture by 8. An aliquot of lysate (100l) was added to 100pl of 2x sample reducing buffer (125mM Tris pH 6.8, glycerol, 4% SDS, 80mM DIT, 0.03% bromophenol blue) and boiled for SDS-PAGE was performed according to the method of Laemmli UK.

1970 (Nature 227:680-685) using 4-20% 1.0mm Tris-Glycine gels (Novex) according to the manufacturers recommendations. Proteins were transferred WO 99/29870 PCT/AU98/01023 79 O onto Hybond-C Extra nitrocellulose membranes (Amersham) by transblotting Z and the membranes were then blocked for 2h at room temperature (RT) in In skim milk in 20mM Tris, 0.5M NaCI, 0.05% Tween-20, pH 7.5 (TTBS).

Immunoscreening was performed separately with the rabbit anti-P. gingivalis whole cell serum, the rat protective serum, a pool of human periodontal patients serum, and in many cases an anti-T7-Tag antibody HRP 0 conjugate (Novagen). Prior to use, the rabbit, rat and human sera were diluted 1/5000, 1/1000 and 1/500 respectively in 5% skim milk in TTBS and NC absorbed with 100p (for the rabbit serum) or 25041 (for the rat and human sera) E. coli extract (20mg/ml; Promega) for 6h at RT.

O Membranes were incubated overnight at RT with the absorbed antisera, or for 1 hr at RT with 1/5000 diluted anti-T7-Teg conjugate.

Following 3xl0min washes with TTBS, HRP-conjugated anti-rabbit (Silenus), anti-mouse (Silenus) or anti-human (KPL) antibody, diluted 1/5000 in skim milk in TTBS, was added for Ih at RT. Membranes were washed as before, prior to addition of TMB membrane peroxidase substrate (KPL) for detection of immunoreactive proteins. Results of reactivity for the recombinant P. gingivalis proteins is shown in Table 7.

In addition some of the sera (pooled sera diluted 1/1000) from the mice immunised with P. gingivalis recombinant proteins (prior to challenge) were analysed for their reactivity against Western blots of whole native P. gingivalis proteins using similar techniques as those outlined above. PG2, PG8A, PG29 and PG3 all showed bands at a similar molecular weight to that of the recombinant PG protein in the native W50 blot. This indicates that PG proteins are expressed in the W50 strain and that the recombinant proteins have at least some identical immunogenicity to the native proteins.

m-RNA analysis Hot Phenol RNA Extraction P. gingivalis W50 cells (150ml culture) were grown anaerobically to mid log phase (OD Aon=0.18) mixed with 50% glycerol and stored at -70 0

C

until RNA extraction. Cells were pelleted by centrifugation at 6 000g, and resuspended in 8ml ASE (20mM NaOAc, 0.5% SDS, 1mM EDTA). An equal volume of 20mM NaOAc(pH 4.5)-saturated phenol was added and mixed by WO 99/29870 PCT/AU98/01023 Sshaking for 30 seconds, incubated at 65"C for 5 minutes, followed by a Z further 5 second shaking and repeated incubation. After cooling, 2ml l chloroform was added and mixed by shaking for 5 seconds, and the mixture Sspun at 10000g for 10 minutes at 4 0 C. The top aqueous phase was transferred and re-extracted by repeating the phenol and chloroform steps. The aqueous phase was transferred again and 100U RNase inhibitor (RNAsin; Promega) OO were added. RNA was precipitated with 3 volumes 100% ethanol at overnight. The RNA precipitate was recovered by centrifugation at 10000g at 4 0 C for 15 minutes, then washed with 100% ethanol, dried and resuspended 1 10 in 600pl sterile, deionised, d-hO with 11 of fresh RNase inhibitor. RNA was aliquoted and stored at -70 0 C. The RNA concentration was determined spectrophotometrically. A formaldehyde RNA gel confirmed RNA integrity (Sambrook J. et al. 1989, Molecular Cloning. A laboratory manual. Cold Spring Laboratory Press, New York. 2nd Edition).

RT-PCR

The isolated RNA was used as a template for Reverse Transcription (RT) to produce cDNA. Varying RNA concentrations were used for the RT as each RNA transcript was potentially present at different levels. Subsequent amplification of the cDNA was performed using Polymerase Chain Reaction (PCR). RT-PCR was performed using GeneAmp® RNA PCR Kit (Perkin Elmer) according to the manufacturer's protocol with the following exception to the PCR; 35 cycles were performed as follows: Melt phase 95"C for seconds, Anneal phase varied between 50-60 0 C for 30 seconds, Extension phase 72 0 C for 1 minute. Amplification was performed in a PTC-100 Programable Thermal Controller (MJ Research Inc.). As a control to demonstrate that the amplified product did not arise from contaminating DNA, Reverse Transcriptase (RTase) was omitted from a parallel tube. The PCR products were examined against DNA markers (GIBCO IkB ladder) on a 1% agarose gel stained with ethidium bromide.

RT-PCR results are shown in Table 6 using the oligonucleotide primers as used in "Cloning, expression and purification of recombinant P. gingivalis genes" section described above,except for the following changes.

For PG1 the 3' reverse primer used was WO 99/29870 PCT/AU98/01023 81 GCGCCTCGAGAITCAITCCTTATAGAG,. for PG4 the 5' forward primer was CTTCTTGTCGACTACAGCGGACATCATAAAATC and the 3' reverse primer was TTCCACCTCGAGTTAACGCAACTCTTCTTCGAT, for PG6 the forward primer was TAAAGAATTCTGCCTCGAACCCATAATrGCTCCG, for PGO10 the 5' forward primer was CGCGCATATGGATAAAGTGAGCTATGC and the 3' reverse primer was CGCGCTCGAGTIGTTGATACTCAATAATTC, for PG13 the 5' forward primer was GCCCGGCGCCATGCGGACAAAAACTATCI IITIIGCG and the 3' reverse primer was GCCCGGCGCCTTAGTrGTTGAATCGAATCGCTATTGAGC. Amplification of P. gingivalis transcripts is a likely indication that RNA for a specific candidate is present and that the protein is produced. However, where there is no amplification achieved this does not indicate that this gene is never transcribed and may be the result of the culture conditions or the state of the cells when harvested.

Table 6. Expression of PG m-RNA with in vitro grown P. gingivalis W50. The symbols are band visible on agarose gel, no band present on agarose gel, ND not detected.

PG RNA Annealing RT-PCR PCR Approx. Expected Pg temp. *C fragment fragment size bp size bp 1 0.15 55 1300 1362 2 1.0 50 3200 3051 3 0.15 60 720 690 4 2.9 55 N.D. 2000 0.02 50 1000 947 6 1.0 55 1000 972 8A 0.15 50 1200 1278 0.15 55 590 585 11 0.10 60 960 942 12 0.02 60 880 831 13 1.0 50 2150 2274 14 0.15 60 1050 996 WO 99t29870 WO 9929870PCT/AU98/01 023 PG RNA Annealing RT-PCR PCR Approx. Expected i'9 temp. TC fragment fragment bp size bp 22 1.0 60 N.D. 228 24 1.0 55 1150 1194 29 0.15 60 -880 Table 7: Immunoblot results of proteins expressed in E.coli against rabbit, rat and human antisera. Deduced MW was calculated from amino acid sequence of the P. gin givalis proteins, some of which had their N-terminal signal sequences removed. Apparent M was determined from SDS-PAGE gels.

The N- and C-termiinal tags add approximately 2.5 KDa to the deduced MW of the recombinant proteins. The symbols are positive, negative, weak positive, ND) not done.

.0 Protein Deduced Apparent Antisera reactivity number 1MW (KDa) 1MW iT7 Rabbit Rat !Human ~PG1~ 47.5 63 ND PG2 112.4 125.7 ND PG3 226 118.3~N PG4 75 90.6 ND 34.9 43.8 ND PG6~ 36.7 47 ND I ~PG !67.5 63.1 1 ND IPG8A N7. 90.

PI 21.3 25.5 ND 'PG11 36 42.4 ND I PG12I 30.7 30.6 ND ~PG13 I 84.5 101 IND LPG4 36~4 ND -i PG22 86.1. D i w !PG24A 47l 63.1 ND I PG29 31.1I 40.9 ND WO 99t29870 WO 99l9870PCT/AU9810t 023 Protein Deduced =Apparent Antisera reactivity numberj MW (K.Da) T7 Rabbit* a ua 35.1 46.9 PG32 41.2 59.5 PG33i 39.9 52.7+ 92.6....116.6 PG36 98.9 F637 18.8 23.1 PG38[ 16.1 22.9 PG39 87.9 1 116.6 76.6 1103.1LL.

P041 4.3 81.1 !PG42 1 59.3 73.9

I

P4 271 50.3 PG44 28.6 323 84 100.6 PG4 8 977 PG47 1 93.7 42.5 IPG48 1 4.5. 37.9 PG49~ 33.3 64.1 3+ 91.9 113.2++r i G5 1.627.2+ PG52 I 50.4 64.4 I PG3 47.4 45.4+1+ PG54 1 101.4- I P055 1 70.4 142.3 I PG57 I 100 PG58 163 iPG59 33.3 55.6.- PG61 I81.5 46.7 68.4 134.5 82.9 43.6 77.8 WO 99/29870 PCT/AU98/0 1023 84 zProtein IDeduced Appari IEn 11t Antisera reactivity number MW (KDaJ MW Ka T7 Rabbit Rat Human PG62 51.9 58.4 PG63. 29. 00 PG64 18.5 26.9 2. 8 ciPG66 2. 25.1 PG67 103.7 105 PG68I 133.3 30.7 PGC9 25.9 PG71 88.9 105.5 PG72~ 40.7 49.8 PG73 40.7 1 22.2 32.5+ 40 5 PG76 48.1i 55.6 PG77 29.6 36+ 35.4 PGP 33.3 35.4 PG79 25.93 PG81 4 8 4 5 .4 4 5.4 PG82 44727. ++1 8 3. 9 1 1P952622.4 23 2.4+ P 8 3 4 1 1 0 4 WO 99/29870 PCT/AU98/01023 Protein Deduced Apparent Antisera reactivity number MW (KDa) MW (KDa) T7 Rabbit Rat Human SPG96 59.3 70.3 PG97 44.4 57.5 PG98 33.3 36 i i PG99 40.7 55.6 PG100I 29.6 10. PG102 59.3 70.3 PG104 40.7 57.5 i .L a. Positive reaction detected with the P. gingivalis antigen.

rabbit antiserum to sarkosyl insoluble b. Purified protein demonstrated weak positive reaction with the rabbit antiserum to whole P. gingivalis.

It will be appreciated by persons skilled in the art that numerous variations and/or modifications may be made to the invention as shown in the specific embodiments without departing from the spirit or scope of the invention as broadly described. The present embodiments are, therefore, to be considered in all respects as illustrative and not restrictive.

WO 99/29870 PCT/AU98/01023 86 0 References.

1. Lipman DJ, Pearson WR. 1985. Rapid and sensitive protein similarity searches. Science 277:1435-1441.

2. Horton, P. and Nakai, K. (1996). A probabilistic classification system for predicting the cellular localization sites of proteins. Intellig. Syst.

00 Mol. Biol. 4: 109-115.

3. Nakai K, Kanehisa M. 1991. Expert systems for predicting protein I localization sites in Gram-negative bacteria. Proteins: Structure, Function, and Genetics 11:95-110.

4. Nielsen H, Engelbrecht J, Brunak S and von Heijne G. 1997.

Identification of prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites. Protein Engineering 10, 1-6.

Claros MG and G von Heijne. (1994). TopPred II: an improved software for membrane protein structure predictions. Comput. Appl.

Biosci. 10: 685-686.

6. Borodovsky M, Rudd KE, and EV Koonin. (1994). Intrinsic and extrinsic approaches for detecting genes in a bacterial genome.

Nucleic Acids Res. 22:4756-4767.

7. Struvye M, Moons M, Tommassen J, 1991. Carboxy-terminal phenylalanine is essential for the correct assembly of a bacterial outer membrane protein J. Mol. Biol. 218:141-148.

8. Aduse-Opoku J, Slaney JM, Rangarajan M, Muir J, Young KA, Curtis MA. 1997. The Tla receptor protein of Porphyromonas gingivalis W50: a homolog of the RI precursor (PrpRI) is an outer membrane receptor required for growth on low levels of hemin. J. Bacteriol.

179:4778-4788.

9. Needleman SB, Munsch CD. 1970. Ageneral method applicable to the search of similarity in the amino acid sequence of two proteins.

J. Molec. Biol. 48: 443-453.

Claims (22)

1. 3. A polypeptide as claimed in claim 1 in which the polypeptide comprises an amino acid sequence at least 85%, preferably at least 95%, identical to an amino acid sequence selected from the group consisting of SEQ ID NO. 267, SEQ ID NO. 269, SEQ ID NO. 270, SEQ ID NO. 301, SEQ ID NO. 305, SEQ ID NO. 306, SEQ ID NO. 307, SEQ ID NO. 336, SEQ ID NO. 339, SEQ ID NO. 351, SEQ ID NO. 359, SEQ ID NO. 360, SEQ ID NO. 377, SEQ ID NO. 380, SEQ ID NO. 382, SEQ ID NO. 383, SEQ ID NO. 384, SEQ ID NO. 385, SEQ ID NO. 388, SEQ ID NO. 389, SEQ ID NO. 390, SEQ ID NO. 391, SEQ ID NO. 426, SEQ ID NO. 430, SEQ ID NO. 431, SEQ ID NO. 432, SEQ ID NO. 463, SEQ ID NO. 467, SEQ ID NO. 468, SEQ ID NO. 469, SEQ ID NO. 484, SEQ ID NO. 485, SEQ ID NO. 494, SEQ ID 8 89 NO. 520, SEQ ID NO. 523, SEQ ID NO. 525, SEQ ID NO. 526, SEQ ID NO. 527, SSEQ ID NO. 528. t 4. A polypeptide as claimed in claim 1 in which the polypeptide comprises at least amino acid having a contiguous sequence of at least 40 amino acids identical to a contiguous amino acid sequence selected from the group consisting of SEQ ID NO. 00 267, SEQ ID NO. 269, SEQ ID NO. 270, SEQ ID NO. 301, SEQ ID NO. 305, SEQ Cc ID NO. 306, SEQ ID NO. 307, SEQ ID NO. 336, SEQ ID NO. 339, SEQ ID NO. 1 351, SEQ ID NO. 359, SEQ ID NO. 360, SEQ ID NO. 377, SEQ ID NO. 380, SEQ OID NO. 382, SEQ ID NO. 383, SEQ ID NO. 384, SEQ ID NO. 385, SEQ ID NO. 388, SEQ ID NO. 389, SEQ ID NO. 390, SEQ ID NO. 391, SEQ ID NO. 426, SEQ ID NO. 430, SEQ ID NO. 431, SEQ ID NO. 432, SEQ ID NO. 463, SEQ ID NO. 467, SEQ ID NO. 468, SEQ ID NO. 469, SEQ ID NO. 484, SEQ ID NO. 485, SEQ ID NO. 494, SEQ ID NO. 520, SEQ ID NO. 523, SEQ ID NO. 525, SEQ ID NO. 526, SEQ ID NO. 527, SEQ ID NO. 528. An isolated antigenic Porphyromonas gingivalis polypeptide, the polypeptide comprising; An amino acid sequence selected from the group consisting of SEQ ID NO. 388, SEQ ID NO. 389, SEQ ID NO. 390, SEQ ID NO. 391, SEQ ID NO. 426, SEQ ID NO. 430, SEQ ID NO. 431, SEQ ID NO. 432, SEQ ID NO. 463, SEQ ID NO. 467, SEQ ID NO. 468, SEQ ID NO. 469, SEQ ID NO. 484, SEQ ID NO. 485, SEQ ID NO. 494, SEQ ID NO. 520, SEQ ID NO. 523, SEQ ID NO. 525, SEQ ID NO. 526, SEQ ID NO. 527, SEQ ID NO. 528; or an amino acid sequence at least 85%, preferably at least 95%, identical to an amino acid sequence selected from the group consisting of SEQ ID NO. 388, SEQ ID NO. 389, SEQ ID NO. 390, SEQ ID NO. 391, SEQ ID NO. 426, SEQ ID NO. 430, SEQ ID NO. 431, SEQ ID NO. 432, SEQ ID NO. 463, SEQ ID NO. 467, SEQ ID NO. 468, SEQ ID NO. 469, SEQ ID NO. 484, SEQ ID NO. 485, SEQ ID NO. 494, SEQ ID NO. 520, SEQ ID NO. 523, SEQ ID NO. 525, SEQ ID NO. 526, SEQ ID NO. 527, SEQ ID NO. 528; or O Z at least 40 amino acids having a contiguous sequence of at least 40 amino acids identical to a contiguous amino acid sequence selected from the group consisting of SEQ ID NO. 388, SEQ ID NO. 389, SEQ ID NO. 390, SEQ ID NO. 391, SEQ ID NO. 426, SEQ ID NO. 430, SEQ ID NO. 431, SEQ ID NO. 432, SEQ ID NO. 463, 00 SEQ ID NO. 467, SEQ ID NO. 468, SEQ ID NO. 469, SEQ ID NO. 484, SEQ ID c NO. 485, SEQ ID NO. 494, SEQ ID NO. 520, SEQ ID NO. 523, SEQ ID NO. 525, 1 SEQ ID NO. 526, SEQ ID NO. 527, SEQ ID NO. 528. S6. A polypeptide as claimed in claim 1 in which the polypeptide comprises an amino acid sequence selected from the group consisting of SEQ ID NO. 388, SEQ ID NO. 389, SEQ ID NO. 390, SEQ ID NO. 391, SEQ ID NO. 426, SEQ ID NO. 430, SEQ ID NO. 431, SEQ ID NO. 432, SEQ ID NO. 463, SEQ ID NO. 467, SEQ ID NO. 468, SEQ ID NO. 469, SEQ ID NO. 484, SEQ ID NO. 485, SEQ ID NO. 494, SEQ ID NO. 520, SEQ ID NO. 523, SEQ ID NO. 525, SEQ ID NO. 526, SEQ ID NO. 527, SEQ ID NO. 528.
2. 7. A polypeptide as claimed in claim 1 in which the polypeptide comprises an amino acid sequence at least 85%, preferably at least 95%, identical to an amino acid sequence selected from the group consisting of SEQ ID NO. 388, SEQ ID NO. 389, SEQ ID NO. 390, SEQ ID NO. 391, SEQ ID NO. 426, SEQ ID NO. 430, SEQ ID NO. 431, SEQ ID NO. 432, SEQ ID NO. 463, SEQ ID NO. 467, SEQ ID NO. 468, SEQ ID NO. 469, SEQ ID NO. 484, SEQ ID NO. 485, SEQ ID NO. 494, SEQ ID NO. 520, SEQ ID NO. 523, SEQ ID NO. 525, SEQ ID NO. 526, SEQ ID NO. 527, SEQ ID NO. 528.
3. 8. A polypeptide as claimed in claim 1 in which the polypeptide comprises at least amino acid having a contiguous sequence of at least 40 amino acids identical to a contiguous amino acid sequence selected from the group consisting of SEQ ID NO. 388, SEQ ID NO. 389, SEQ ID NO. 390, SEQ ID NO. 391, SEQ ID NO. 426, SEQ ID NO. 430, SEQ ID NO. 431, SEQ ID NO. 432, SEQ ID NO. 463, SEQ ID NO. 91 (N 467, SEQ ID NO. 468, SEQ ID NO. 469, SEQ ID NO. 484, SEQ ID NO. 485, SEQ O Z ID NO. 494, SEQ ID NO. 520, SEQ ID NO. 523, SEQ ID NO. 525, SEQ ID NO. t 526, SEQ ID NO. 527, SEQ ID NO. 528.
4. 9. A polypeptide as claimed in claim 6 in which the polypeptide comprises an amino acid sequence selected from the group consisting of SEQ ID NO. 389, SEQ ID NO. 0 0 390, SEQ ID NO. 391, SEQ ID NO. 463, SEQ ID NO. 467, SEQ ID NO. 468, SEQ ID NO. 469, SEQ ID NO. 484, SEQ ID NO. 485, SEQ ID NO. 494, SEQ ID NO. 520, SEQ ID NO. 525, SEQ ID NO. 526, SEQ ID NO. 528. N 10. An isolated antigenic Porphyromonas gingivalis polypeptide, the polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NO. 267, SEQ ID NO. 269, SEQ ID NO. 270, SEQ ID NO. 301, SEQ ID NO. 305, SEQ ID NO. 306, SEQ ID NO. 307, SEQ ID NO. 336, SEQ ID NO. 339, SEQ ID NO. 351, SEQ ID NO. 359, SEQ ID NO. 360, SEQ ID NO. 377, SEQ ID NO. 380, SEQ ID NO. 382, SEQ ID NO. 383, SEQ ID NO. 384, SEQ ID NO. 385, SEQ ID NO. 388, SEQ ID NO. 389, SEQ ID NO. 390, SEQ ID NO. 391, SEQ ID NO. 426, SEQ ID NO. 430, SEQ ID NO. 431, SEQ ID NO. 432, SEQ ID NO. 463, SEQ ID NO. 467, SEQ ID NO. 468, SEQ ID NO. 469, SEQ ID NO. 484, SEQ ID NO. 485, SEQ ID NO. 494, SEQ ID NO. 520, SEQ ID NO. 523, SEQ ID NO. 525, SEQ ID NO. 526, SEQ ID NO. 527, SEQ ID NO. 528 less the leader sequence set out in Table 3.
5. 11. An isolated DNA molecule, the DNA molecule comprising a nucleotide sequence which encodes the polypeptide as claimed in any one of claims 1 to 10 or a sequence which hybridises thereto under conditions of high stringency.
6. 12. An isolated DNA molecule as claimed in claim 11 in which the DNA molecule comprises a nucleotide sequence selected from the group consisting of SEQ ID NO. 3, SEQ ID NO. 5, SEQ ID NO. 6, SEQ ID NO. 37, SEQ ID NO. 41, SEQ ID NO. 42, SEQ ID NO. 43, SEQ ID NO. 72, SEQ ID NO. 75, SEQ ID NO. 87, SEQ ID NO. 95, SEQ ID NO. 96, SEQ ID NO. 113, SEQ ID NO. 116, SEQ ID NO. 118, SEQ ID NO. 119, SEQ ID NO. 120, SEQ ID NO. 121, SEQ ID NO. 124, SEQ ID 92 NO. 125, SEQ ID NO. 126, SEQ ID NO. 127, SEQ ID NO. 162, SEQ ID NO. 166, Z SEQ ID NO. 167, SEQ ID NO. 168, SEQ ID NO. 199, SEQ ID NO. 203, SEQ ID tn NO. 204, SEQ ID NO. 205, SEQ ID NO. 220, SEQ ID NO. 221, SEQ ID NO. 229, SEQ ID NO. 230, SEQ ID NO. 256, SEQ ID NO. 259, SEQ ID NO. 261, SEQ ID SNO. 262, SEQ ID NO. 263, SEQ ID NO. 264. 00 13. A recombinant expression vector comprising the DNA molecule as claimed in ¢C claim 11 or claim 12 operably linked to a transcription regulatory element.
7. 14. A cell comprising the recombinant expression vector as claimed in claim 13. C
8. 15. A method for producing a P.gingivalis polypeptide comprising culturing the cell as claimed in claim 14 under conditions that permit expression of the polypeptide.
9. 16. A composition for use in raising an immune response directed to P.gingivalis in a subject, the composition comprising an effective amount of at least one polypeptide as claimed in any one of claims 1 to 10 and a pharmaceutically acceptable carrier.
10. 17. A composition as claimed in claim 16 in which the composition further comprises at least one DNA molecule as claimed in claim 11 or claim 12.
11. 18. A composition as claimed in claim 16 or claim 17 in which the pharmaceutically acceptable carrier is an adjuvant.
12. 19. A method of treating a subject for P.gingivalis infection comprising administering to the subject a composition as claimed in any one of claims 16 or claims 18 such that treatment of P.gingivalis infection occurs. A method as claimed in claim 19, wherein the treatment is a prophylactic treatment.
13. 21. A method as claimed in claim 19, wherein the treatment is a therapeutic treatment.
14. 22. A composition for use in raising an immune response directed against P.gingivalis in a subject, the composition comprising an effective amount of at least one DNA molecule as claimed in claim 11 or claim 12 and a pharmaceutically acceptable carrier. 0 93
15. 23. A composition as claimed in claim 22 in which the pharmaceutically acceptable O Scarrier is an adjuvant.
16. 24. A method of treating a subject for P.gingivalis infection comprising administering to the subject a composition as claimed in claim 22 or claim 23 such that treatment of P.gingivalis infection occurs. A method as claimed in claim 24, wherein the treatment is a prophylactic treatment. 1 26. A method as claimed in claim 24, wherein the treatment is a therapeutic treatment. S27. An antibody raised against a polypeptide as claimed in any one of claims 1 to
17. 28. An antibody as claimed in claim 27 in which the antibody is polyclonal.
18. 29. An antibody as claimed in claim 27 in which the antibody is monoclonal. A composition comprising at least one antibody as claimed in any one of claims 27 to 29.
19. 31. A composition as claimed in claim 30 in which the composition adapted for oral use.
20. 32. A nucleotide probe comprising at least 18 nucleotides and having a contiguous sequence of at least 18 nucleotides identical to a contiguous nucleotide sequence selected from a group consisting of SEQ ID NO. 3, SEQ ID NO. 5, SEQ ID NO. 6, SEQ ID NO. 37, SEQ ID NO. 41, SEQ ID NO. 42, SEQ ID NO. 43, SEQ ID NO. 72, SEQ ID NO. 75, SEQ ID NO. 87, SEQ ID NO. 95, SEQ ID NO. 96, SEQ ID NO. 113, SEQ ID NO. 116, SEQ ID NO. 118, SEQ ID NO. 119, SEQ ID NO. 120, SEQ ID NO. 121.
21. 33. A nucleotide probe as claimed in claim 32 in which the probe further comprises a detectable label.
22. 34. A method for detecting the presence of P.gingivalis nucleic acid in a sample comprising: 94 0 contacting a sample with the nucleotide probe as claimed in claim 32 or z claim 33 under conditions in which a hybrid can form between the probe and a ~P.gingivalis nucleic acid in the sample; and detecting the hybrid formed in step wherein detection of a hybrid indicates the presence of a P.gingivalis nucleic acid in the sample. 00