AU2007231638A1 - Humanized antibodies that recognize beta amyloid peptide - Google Patents

Description

S&F Ref: 638701D3

AUSTRALIA

PATENTS ACT 1990 COMPLETE SPECIFICATION FOR A STANDARD PATENT Name and Address of Applicants: Actual Inventor(s): Address for Service: Invention Title: Elan Pharma International Limited, of Monksland, Athlone, County Westmeath, Republic of Ireland Wyeth, of Five Giralda Farms, Madison, New Jersey, 07940, United States of America Guriq Basi Jose Saldanha Ted Yednock Spruson Ferguson St Martins Tower Level 31 Market Street Sydney NSW 2000 (CCN 3710000177) Humanized antibodies that recognize beta amyloid peptide The following statement is a full description of this invention, including the best method of performing it known to me/us:- 5845c(1000212_1) HUMANIZED ANTIBODIES THAT RECOGNIZE BETA AMYLOID PEPTIDE

O

(N

Related Applications 0 This application claims the benefit of prior-filed provisional patent C 5 application U.S. Serial No. 60/251,892 (filed December 6, 2000) entitled "Humanized Antibodies That Recognize Beta-Amyloid Peptide". The entire content of the above- 00 referenced application is incorporated herein by reference.

C Background of the Invention S 10 Alzheimer's disease (AD) is a progressive disease resulting in senile C, dementia. See generally Selkoe, TINS 16:403 (1993); Hardy et al., WO 92/13069; Selkoe, J Neuropathol. Exp. Neurol. 53:438 (1994); Duff et al., Nature 373:476 (1995); Games et al., Nature 373:523 (1995). Broadly speaking, the disease falls into two categories: late onset, which occurs in old age (65 years) and early onset, which develops well before the senile period, between 35 and 60 years. In both types of disease, the pathology is the same but the abnormalities tend to be more severe and widespread in cases beginning at an earlier age. The disease is characterized by at least two types of lesions in the brain, neurofibrillary tangles and senile plaques.

Neurofibrillary tangles are intracellular deposits ofmicrotubule associated tau protein consisting of two filaments twisted about each other in pairs. Senile plaques amyloid plaques) are areas of disorganized neuropil up to 150 pm across with extracellular amyloid deposits at the center which are visible by microscopic analysis of sections of brain tissue. The accumulation of amyloid plaques within the brain is also associated with Down's syndrome and other cognitive disorders.

The principal constituent of the plaques is a peptide termed A3 or pamyloid peptide. AP peptide is a 4-kDa internal fragment of 39-43 amino acids of a larger transmembrane glycoprotein named protein termed amyloid precursor protein (APP). As a result of proteolytic processing of APP by different secretase enzymes, AP is primarily found in both a short form, 40 amino acids in length, and a long form, ranging from 42-43 amino acids in length. Part of the hydrophobic transmembrane domain of APP is found at the carboxy end of Ap, and may account for the ability of Ap to aggregate into plaques, particularly in the case of the long form. Accumulation of amyloid plaques in the brain eventually leads to neuronal cell death. The physical 0 symptoms associated with this type of neural deterioration characterize Alzheimer's disease.

0 Several mutations within the APP protein have been correlated with the presence of Alzheimer's disease. See, Goate et al., Nature 349:704) (1991) (valine 717 to isoleucine); Chartier Harlan et al. Nature 353:844 (1991)) (valine 71 7 to 00 glycine); Murrell et al., Science 254:97 (1991) (Valine 717 to phenylalanine); Mullan et IN al., Nature Genet. 1:345 (1992) (a double mutation changing lysineS Smethionine596 to asparagine -leucine 5 96 Such mutations are thought to cause Alzheimer's disease by 10 increased or altered processing of APP to Af3, particularly processing of APP to 0¢-q increased amounts of the long form of A3 AP1-42 and AP 1-43). Mutations in other genes, such as the presenilin genes, PSI and PS2, are thought indirectly to affect processing of APP to generate increased amounts of long form AP3 (see Hardy, TINS 154 (1997)).

Mouse models have been used successfully to determine the significance of amyloid plaques in Alzheimer's (Games et al., supra, Johnson-Wood et al., Proc.

Natl. Acad. Sci. USA 94:1550 (1997)). In particular, when PDAPP transgenic mice, (which express a mutant form of human APP and develop Alzheimer's disease at a young age), are injected with the long form of A3, they display both a decrease in the progression of Alzheimer's and an increase in antibody titers to the Ap peptide (Schenk et al., Nature 400, 173 (1999)). The observations discussed above indicate that A3, particularly in its long form, is a causative element in Alzheimer's disease.

McMichael, EP 526,511, proposes administration of homeopathic dosages (less than or equal to 102 mg/day) of A3 to patients with preestablished AD. In a typical human with about 5 liters of plasma, even the upper limit of this dosage would be expected to generate a concentration of no more than 2 pg/ml. The normal concentration of AP in human plasma is typically in the range of 50-200 pg/ml (Seubert et al., Nature 359:325 (1992)). Because EP 5 2 6,51 I's proposed dosage would barely alter the level of endogenous circulating A3 and because EP 526,511 does not recommend use of an adjuvant, as an immunostimulant, it seems implausible that any therapeutic benefit would result.

3 C Accordingly, there exists the need for new therapies and reagents for the treatment o of Alzheimer's disease, in particular, therapies and reagents capable of effecting a 0 therapeutic benefit at physiologic non-toxic) doses.

Summary of the Invention 00 5 According to a first embodiment of the invention, there is provided a humanized O immunoglobulin light chain comprising at least one variable region complementarity determining region (CDR) from Sthe 3D6 immunoglobulin light chain variable region sequence set forth as SEQ ID NO:2, Sand (ii) a variable framework region from a human acceptor immunoglobulin light chain sequence, wherein the light chain comprises at least one substitution of a canonical framework residue; and at least one substitution of an interchain packing framework residue; and, optionally at least one substitution of a vernier zone framework residue or at least one substitution of a rare framework residue, and, wherein the substitution is with the corresponding amino acid residue from the mouse 3D6 light chain variable region sequence.

According to a second embodiment of the invention, there is provided a humanized immunoglobulin heavy chain comprising at least one variable region complementarity determining region (CDR) from the 3D6 immunoglobulin heavy chain variable region sequence set forth as SEQ ID NO:4, and (ii) a variable framework region from a human acceptor immunoglobulin heavy chain sequence, wherein the heavy chain comprises at least one substitution of a canonical framework residue, at least one substitution of an interchain packing framework residue, and at least one substitution of a vernier zone framework residue or at least one substitution of a rare framework residue, 991747-1 gcc 3a O a CN and wherein the substitution is the corresponding amino acid residue from the O mouse 3D6 heavy chain variable region sequence.

O According to a third embodiment of the invention, there is provided a humanized CN immunoglobulin which specifically binds to beta amyloid peptide comprising the light chain in accordance with the first embodiment of the present invention, and the 00 heavy chain in accordance with the second embodiment of the present invention, or an O antigen-binding fragment of said immunoglobulin.

According to a fourth embodiment of the invention, there is provided a humanized immunoglobulin, or antigen-binding fragment thereof, which specifically binds to beta S 10 amyloid peptide (AP) with a binding affinity of at least 10 7 M-1, comprising a light chain comprising at least one variable region complementarity determining region (CDR) from the 3D6 immunoglobulin light chain variable region sequence set forth as SEQ ID NO:2, and a variable framework region from a human acceptor immunoglobulin light chain sequence, and (ii) a heavy chain comprising at least one variable region CDR from the 3D6 immunoglobulin heavy chain variable region sequence set forth as SEQ ID NO:4, and a variable framework region from a human acceptor immunoglobulin heavy chain, provided that the humanized immunoglobulin, or antigen-binding fragment thereof, comprises: at least one substitution of a canonical framework residue selected from the group consisting of L2, L48, L64, L71, H24, H26, H27, H29, H71, and H94 (Kabat numbering convention), at least one substitution of an interchain packing framework residue selected from the group consisting of L36, L38, L44, L46, L87, L98, H37, H39, H47, H91, H93, and H103 (Kabat numbering convention), and at least one substitution of a vernier zone framework residue selected from the group consisting of L4, L35, L47, L49, L66, L68, L69, H2, H28, H30, H48, H49, H67, H69, and H80 (Kabat numbering convention), or at least one substitution of a rare framework residue selected from the group consisting of Ll, L15, L83, L85, H40 and H42 (Kabat numbering convention), 9 9 1 7 47-l:gcc 3b N wherein the substitution is with the corresponding amino acid residue from the mouse 3D6 light chain variable region sequence or the mouse 3D6 heavy chain variable 0 region sequence.

C According to a fifth embodiment of the invention, there is provided a pharmaceutical composition comprising the humanized immunoglobulin or antigen- 00 binding fragment in accordance with the third or fourth embodiment of the present IN invention and a pharmaceutical carrier.

According to a sixth embodiment of the invention, there is provided a kit comprising the humanized immunoglobulin or antigen-binding fragment in accordance with any one of the third to fifth embodiments of the present invention together with instructions for use.

According to a seventh embodiment of the invention, there is provided the use of a humanized immunoglobulin or antigen binding fragment in accordance with the fourth or fifth embodiment of the present invention in the manufacture of a medicament for the is prevention or treatment of an amyloidogenic disease in a patient.

According to an eighth embodiment of the invention, there is provided the use of a humanized immunoglobulin or antigen binding fragment in accordance with the fourth or fifth embodiment of the present invention in the manufacture of a medicament for the prevention or treatment of Alzheimer's disease in a patient.

According to a ninth embodiment of the invention, there is provided an isolated nucleic acid molecule encoding the light chain in accordance with the first embodiment of the present invention.

According to a tenth embodiment of the invention, there is provided an isolated nucleic acid molecule encoding the heavy chain in accordance with the second embodiment of the present invention.

According to an eleventh embodiment of the invention, there is provided a vector comprising the nucleic acid molecule in accordance with the ninth or tenth embodiment of the present invention.

According to a twelfth embodiment of the invention, there is provided a host cell comprising the nucleic acid molecule in accordance with the ninth or tenth embodiment of the present invention.

According to a thirteenth embodiment of the invention, there is provided a host cell comprising the vector in accordance with the eleventh embodiment of the present invention.

991747- I:gcc 3c CN According to a fourteenth embodiment of the invention, there is provided a method 0 of producing an antibody, or fragment thereof, comprising culturing the host cell in O accordance with the twelfth or thirteenth embodiment of the present invention under C1 conditions such that the antibody or fragment is produced and isolating said antibody from the host cell or culture.

00 According to a fifteenth embodiment of the invention, there is provided a I humanized immunoglobulin, or an antigen-binding fragment thereof, which specifically binds to beta amyloid peptide (AP) with a binding affinity of at least 10 7 wherein the humanized antibody comprises: C 10 a light chain comprising a variable light chain region comprising the complementarity determining regions (CDRs) and at least one variable light chain framework residue selected from the group consisting of L1, L2, L4, L15, L35, L36, L38, L44, L46, L47, L48, L49, L64, L66, L68, L69, L71, L83, L85, L87, and L98 (Kabat numbering convention) from the 3D6 immunoglobulin light chain variable region sequence set forth as SEQ ID NO:2, wherein the remainder of the variable light chain region is from a human acceptor immunoglobulin light chain, and a heavy chain comprising a variable heavy chain region having the sequence as set forth in residues 1-119 of SEQ ID NO:8 or SEQ ID NO:12.

According to a sixteenth embodiment of the invention, there is provided a humanized immunoglobulin, or an antigen-binding fragment thereof, which specifically binds to beta amyloid peptide (Ap) with a binding affinity of at least 10 7 M-1, wherein the humanized antibody comprises: a heavy chain comprising a variable heavy chain region comprising the complementarity determining regions (CDRs) and at least one variable heavy chain framework residue selected from the group consisting of H2, H24, H26, H27, H28, H29, H37, H39, H40, H42, H45, H47, H48, H49, H67, H69, H71, H80, H91, H93, H94, and H103 (Kabat numbering convention) from the 3D6 immunoglobulin heavy chain variable region sequence set forth as SEQ ID NO:4, wherein the remainder of the variable heavy chain region is from a human acceptor immunoglobulin heavy chain, and a light chain comprising a variable light chain region having the sequence as set forth in residues 1-112 of SEQ ID NO:5 or SEQ ID NO: 11.

According to a seventeenth embodiment of the invention, there is provided a humanized immunoglobulin, or an antigen-binding fragment thereof, which specifically 991747-1 gcc 3d binds to beta amyloid peptide (Ap) with a binding affinity of at least 10 7

M

1 wherein the humanized antibody comprises: O a light chain comprising a variable light chain region comprising CI the complementarity determining regions (CDRs) from the 3D6 immunoglobulin light chain variable region sequence set forth as SEQ ID NO:2; 0 at least one variable light chain canonical framework residue selected IN from the group consisting of L2, L48, L64, and L71 (Kabat numbering convention) from SEQ ID NO:2; and at least one variable light chain interchain packing framework residue selected from the group consisting of L36, L38, L44, L46, L87, and L98 (Kabat numbering convention) from SEQ ID NO:2; and, optionally, at least one variable light chain vernier zone framework residue selected from the group consisting of L4, L35, L47, L49, L66, L68, and L69 (Kabat numbering convention) from SEQ ID NO:2, or at least one variable light chain rare framework residue selected from the group consisting of L1, L15, L83, and L85 (Kabat numbering convention) from SEQ ID NO:2; wherein the remainder of the variable light chain region is from a human acceptor immunoglobulin light chain; and (ii) a heavy chain comprising a variable heavy chain region having the sequence as set forth in residues 1-119 of SEQ ID NO:8 or SEQ ID NO:12.

According to an eighteenth embodiment of the invention, there is provided a humanized immunoglobulin, or an antigen-binding fragment thereof, which specifically binds to beta amyloid peptide (AP) with a binding affinity of at least 10 7 wherein the humanized antibody comprises: a heavy chain comprising a variable heavy chain region comprising the complementarity determining regions (CDRs) from the 3D6 immunoglobulin heavy chain variable region sequence set forth as SEQ ID NO:4; at least one variable heavy chain canonical framework residue selected from the group consisting of H24, H26, H27, H29, H71, and H94 (Kabat numbering convention) from SEQ ID NO:4; at least one variable heavy chain interchain packing framework residue selected from the group consisting of H37, H39, H45, H47, H91, H93, and H103 (Kabat numbering convention) from SEQ ID NO:4; and, 991747.1-:cc 3e S(d) at least one variable heavy chain vernier zone framework residue Sselected from the group consisting of H2, H28, H30, H48, H49, H67, H69, and O (Kabat numbering convention) from SEQ ID NO:4, or at least one variable heavy chain CN rare framework residue selected from the group consisting of H40 and H42 (Kabat s numbering convention) from SEQ ID NO:4; o 0 wherein the remainder of the variable heavy chain region is from a human acceptor N immunoglobulin heavy chain; and (ii) a light chain comprising a variable light chain region having the sequence as set forth in residues 1-112 of SEQ ID NO:5 or SEQ ID NO:11.

S 10 According to a nineteenth embodiment of the invention, there is provided a humanized immunoglobulin, or an antigen-binding fragment thereof, which specifically binds to beta amyloid peptide (Ap) with a binding affinity of at least 10 7 wherein the humanized antibody comprises: a light chain comprising a variable light chain region comprising the Is complementarity determining regions (CDRs) and at least one variable light chain framework residue selected from the group consisting of LI, L2, L36, and L46 (Kabat numbering convention) from the 3D6 immunoglobulin light chain variable region sequence set forth as SEQ ID NO:2, wherein the remainder of the variable framework region is from a human acceptor immunoglobulin light chain, and a heavy chain comprising a variable heavy chain region having the sequence as set forth in residues 1-119 of SEQ ID NO:8 or SEQ ID NO:12.

According to a twentieth embodiment of the invention, there is provided a humanized immunoglobulin, or an antigen-binding fragment thereof, which specifically binds to beta amyloid peptide (AP) with a binding affinity of at least 10 7 wherein the humanized antibody comprises: a heavy chain comprising a variable heavy chain region comprising the complementarity determining regions (CDRs) and at least one variable heavy chain framework residue selected from the group consisting of H49, H93 and H94 (Kabat numbering convention) from the 3D6 immunoglobulin heavy chain variable region sequence set forth as SEQ ID NO:4, wherein the remainder of the variable framework region is from a human acceptor immunoglobulin heavy chain, and a light chain comprising a variable light chain region having the sequence as set forth in residues 1-112 of SEQ ID NO:5 or SEQ ID NO: 11.

991747-1 gcc

I

3f C According to a twenty-first embodiment of the invention, there is provided a 0 humanized immunoglobulin, or an antigen-binding fragment thereof which specifically O binds to beta amyloid peptide (AP) with a binding affinity of at least 10 7 wherein the N humanized antibody comprises: a light chain comprising a variable light chain region comprising the

O

00 complementarity determining regions (CDRs) and variable framework residues L2, L36, Sand L46 (Kabat numbering convention) from the 3D6 immunoglobulin light chain variable region sequence set forth as SEQ ID NO:2, wherein the remainder of the variable light chain region is from a human acceptor immunoglobulin light chain, and a heavy chain comprising a variable heavy chain region having the sequence as set forth in residues 1-119 of SEQ ID NO:8 or SEQ ID NO:12.

According to a twenty-second embodiment of the invention, there is provided a humanized immunoglobulin, or an antigen-binding fragment thereof, which specifically binds to beta amyloid peptide (AP) with a binding affinity of at least 10 7 wherein the humanized antibody comprises: a heavy chain comprising a variable heavy chain region comprising the complementarity determining regions (CDRs) and variable framework residues 1149, H93 and H94 (Kabat numbering convention) from the 3D6 immunoglobulin heavy chain variable region sequence set forth as SEQ ID NO:4, wherein the remainder of the variable heavy chain region is from a human acceptor immunoglobulin heavy chain, and a light chain comprising a variable light chain region having the sequence as set forth in residues 1-112 of SEQ ID NO:5 or SEQ ID NO: 11.

According to a twenty-third embodiment of the invention, there is provided a humanized immunoglobulin, or an antigen-binding fragment thereof, which specifically binds to beta amyloid peptide (Ap) with a binding affinity of at least 107 M wherein the humanized antibody comprises: a light chain comprising a variable light chain region comprising the complementarity determining regions (CDRs) and variable framework residues LI, L2, L36, and L46 (Kabat numbering convention) from the 3D6 immunoglobulin light chain variable region sequence set forth as SEQ ID NO:2, wherein the remainder of the variable light chain region is from a human acceptor immunoglobulin light chain, and a heavy chain comprising a variable heavy chain region having the sequence as set forth in residues 1-119 of SEQ ID NO:8 or SEQ ID NO:12.

991 7 47-l:gcc 3g C According to a twenty-fourth embodiment of the invention, there is provided an S immunoglobulin which specifically binds to beta amyloid peptide (Ap) with a binding O affinity of at least 10 7 or antigen-binding fragment thereof, comprising a variable CN heavy chain region set as forth in residues 1-119 of SEQ ID NO:8 and a variable light chain region as set forth in residues 1-112 of SEQ ID NO: 11.

00 According to a twenty-fifth embodiment of the invention, there is provided an Simmunoglobulin which specifically binds to beta amyloid peptide (Ap) with a binding affinity of at least 10 7

M

1 or antigen-binding fragment thereof, comprising a variable heavy chain region as set forth in residues 1-119 of SEQ ID NO:12, and a variable light C 10 chain region as set forth in residues 1-112 of SEQ ID According to a twenty-sixth embodiment of the invention, there is provided an immunoglobulin which specifically binds to beta amyloid peptide (Ap) with a binding affinity of at least 10 7 comprising a variable heavy chain region as set forth in residues 1-119 of SEQ ID NO:8, a variable light chain region as set forth in residues 1- 112 of SEQ ID NO: 11, and constant regions from human IgG1.

According to a twenty-seventh embodiment of the invention, there is provided an immunoglobulin which specifically binds to beta amyloid peptide (Ap) with a binding affinity of at least 10 7 comprising a variable heavy chain region as set forth in residues 1-119 of SEQ ID NO:12, a light chain region as set forth in residues 1-112 of SEQ ID NO:5, and constant regions from human IgG1.

According to a twenty-eighth embodiment of the invention, there is provided an isolated polypeptide comprising an amino acid sequence having at least 95% sequence identity with residues 1-112 of the amino acid sequence set forth as SEQ ID According to a twenty-ninth embodiment of the invention, there is provided an isolated polypeptide comprising an amino acid sequence having at least 99% sequence identity with residues 1-119 of the amino acid sequence set forth as SEQ ID NO:8.

According to a thirtieth embodiment of the invention, there is provided an isolated polypeptide comprising an amino acid sequence having at least 95% sequence identity with residues 1-112 of the amino acid sequence set forth as SEQ ID NO:1 1.

According to a thirty-first embodiment of the invention, there is provided an isolated polypeptide comprising an amino acid sequence having at least 99% sequence identity with amino acids 1-112 of the amino acid sequence set forth as SEQ ID NO:12.

991747-I.gcc 3h N, According to a thirty-second embodiment of the invention, there is provided an isolated polypeptide comprising residues 1-112 of the amino acid sequence set forth as SSEQ ID NO:11.

C According to a thirty-third embodiment of the invention, there is provided an s isolated polypeptide comprising residues 1-119 of the amino acid sequence set forth as 00 00 SEQ ID NO:12.

IAccording to a thirty-fourth embodiment of the invention, there is provided a variant of a polypeptide comprising residues 1-112 of the amino acid sequence of SEQ ID or SEQ ID NO: 1, said variant comprising at least one conservative amino acid 10 substitution, wherein the variant retains the ability to direct specific binding to beta amyloid peptide (AP) with a binding affinity of at least 10 7

M

1 According to a thirty-fifth embodiment of the invention, there is provided a variant of a polypeptide comprising residues 1-119 of the amino acid sequence of SEQ ID NO:8 or SEQ ID NO:12, said variant comprising at least one conservative amino acid is substitution, wherein the variant retains the ability to specifically bind beta amyloid peptide (A3) with a binding affinity of at least 10 7

M

1 According to a thirty-sixth embodiment of the invention, there is provided an isolated polypeptide comprising residues 1-112 of the amino acid sequence of SEQ ID NO:8 or comprising residues 1-119 of the amino acid sequence of SEQ ID According to a thirty-seventh embodiment of the invention, there is provided a pharmaceutical composition comprising the humanized immunoglobulin or antigenbinding fragment in accordance with any one of the fifteenth to twenty-seventh embodiments of the present invention and a pharmaceutical carrier.

According to a thirty-eighth embodiment of the invention, there is provided a kit comprising the immunoglobulin or antigen-binding fragment in accordance with any one of the fifteenth to twenty-seventh embodiments of the present invention, together with instructions for use.

The present invention features new immunological reagents, in particular, therapeutic antibody reagents for the prevention and treatment of amyloidogenic disease Alzheimer's disease). The invention is based, at least in part, on the identification and characterization of two monoclonal antibodies that specifically bind to A3 peptide and are effective at reducing plaque burden and/or reducing the neuritic dystrophy associated with amyloidogenic disorders. Structural and functional analysis of these antibodies leads to the design of various humanized antibodies for prophylactic and/or 991747-1:gcc 3i C therapeutic use. In particular, the invention features humanization of the variable regions Sof these antibodies and, accordingly provides for humanized immunoglobulin or antibody 0 chains, intact humanized immunoglobulins or antibodies, and functional immunoglobulin Ci or antibody fragments, in particular, antigen binding fragments, of the featured antibodies.

Polypeptides comprising the complementarity determining regions of the featured 00 monoclonal antibodies are also disclosed, as are polynucleotide reagents, vectors and.

host suitable for encoding said polypeptides.

Methods of treatment of amyloidogenic diseases or disorders Alzheimer's disease) are disclosed, as are pharmaceutical compositions and kits for use in such Ci applications.

Also featured are methods of identifying residues within the featured monoclonal antibodies which are important for proper immunologic function and for identifying residues which are amenable to substitution in the design of humanized antibodies having improved binding affinities and/or reduced immunogenicity, when used as therapeutic reagents.

Brief Description of the Drawings Figure 1 depicts an alignment of the amino acid sequences of the light chain of mouse 3D6, humanized 3D6, Kabat ID 109230 and germline A19 antibodies.

991747-1 gcc r^ CDR regions are indicated by arrows. Bold italics indicate rare murine residues. Bold N indicates packing (VH VL) residues. Solid fill indicates canonical/CDR interacting o residues. Asterisks indicate residues selected for backmutation in humanized 3D6, version 1.

S 5 Figure 2 depicts an alignment of the amino acid sequences of the heavy chain of mouse 3D6, humanized 3D6, Kabat ID 045919 and germline VH3-23 00 M antibodies. Annotation is the same as for Figure 1.

IO

Figure 3 graphically depicts the Ap binding properties of 3D6, chimeric 3D6 and 10D5. Figure 3A is a graph depicting binding of AP to chimeric 3D6 S 10 (PK1614) as compared to murine 3D6. Figure 3B is a graph depicting competition of biotinylated 3D6 versus unlabeled 3D6, PK1614 and 10D5 for bindding to Ap.

Figure 4 depicts a homology model of 3D6 VH and VL, showing acarbon backbone trace. VH is shown in as a stippled line, and VL is shown as a solid line. CDR regions are indicated in ribbon form.

Figure 5 graphically depicts the AP binding properties of chimeric 3D6 and humanized 3D6. Figure SA depicts ELISA results measuring the binding of humanized 3D6vl and chimeric 3D6 to aggregated Ap. Figure 5B depicts ELISA results measuring the binding of humanized 3D6vl and humanized 3D6v2 to aggregated Ap.

Figure 6 is a graph quantitating the binding of humanized 3D6 and chimeric 3D6 to Ap plaques from brain sections of PDAPP mice.

Figure 7 is a graph showing results of a competitive binding assay testing the ability of humanized 3D6 versions 1 and 2, chimeric 3D6, murine 3D6, and 10D5 to compete with murine 3D6 for binding to Ap.

Figure 8 graphically depicts of an ex vivo phagocytosis assay testing the ability of humanized 3D6v2, chimeric 3D6, and human IgG to mediate the uptake of AP by microglial cells.

Figure 9 depicts an alignment ofthelOD5 VL and 3D6 VL amino acid sequences. Bold indicates residues that match 10D5 exactly.

Figure 10 depicts an alignment ofthelOD5 VH and 3D6 VH amino acid sequences. Bold indicates residues that match 10D5 exactly.

Detailed Description of the Invention 0 The present invention features new immunological reagents and methods N 5 for preventing or treating Alzheimer's disease or other amyloidogenic diseases. The invention is based, at least in part, on the characterization of two monoclonal 00 O uimmunoglobulins, 3D6 and 10D5, effective at binding beta amyloid protein (AP) binding soluble and/or aggregated Ap), mediating phagocytosis of aggregated

AP),

reducing plaque burden and/or reducing neuritic dystrophy in patient). The 10 invention is further based on the determination and structural characterization of the CN primary and secondary structure ofthe variable light and heavy chains of these immunoglobulins and the identification of residues important for activity and immunogenicity.

Immunoglobulins are featured which include a variable light and/or variable heavy chain of the preferred monoclonal immunoglobulins described herein.

Preferred immunoglobulins, therapeutic immunoglobulins, are featured which include a humanized variable light and/or humanized variable heavy chain. Preferred variable light and/or variable heavy chains include a complementarity determining region (CDR) from the monoclonal immunoglobulin donor immunoglobulin) and variable framework regions substantially from a human acceptor immunoglobulin. The phrase "substantially from a human acceptor immunoglobulin" means that the majority or key framework residues are from the human acceptor sequence, allowing however, for substitution of residues at certain positions with residues selected to improve activity of the humanized immunoglobulin alter activity such that it more closely mimics the activity of the donor immunoglobulin) or selected to decrease the immunogenicity of the humanized immunoglobulin.

In one embodiment, the invention features a humanized immunoglobulin light or heavy chain that includes 3D6 variable region complementarity determining regions (CDRs) includes one, two or three CDRs from the light chain variable region sequence set forth as SEQ ID NO:2 or includes one, two or three CDRs from the heavy chain variable region sequence set forth as SEQ ID NO:4), and includes a variable framework region substantially from a human acceptor immunoglobulin light or heavy chain sequence, provided that at least one residue of the framework residue is backmutated to a corresponding murine residue, wherein said backmutation does not U substantially affect the ability of the chain to direct AP binding.

0 In another embodiment, the invention features a humanized immunoglobulin light or heavy chain that includes 3D6 variable region complementarity 00 determining regions (CDRs) includes one, two or three CDRs from the light chain M variable region sequence set forth as SEQ ID NO:2 and/or includes one, two or three CDRs from the heavy chain variable region sequence set forth as SEQ ID NO:4), and includes a variable framework region substantially from a human acceptor O 10 immunoglobulin light or heavy chain sequence, provided that at least one framework residue is substituted with the corresponding amino acid residue from the mouse 3D6 light or heavy chain variable region sequence, where the framework residue is selected from the group consisting of a residue that non-covalently binds antigen directly; (b) a residue adjacent to a CDR; a CDR-interacting residue identified by modeling the light or heavy chain on the solved structure of a homologous known immunoglobulin chain); and a residue participating in the VL-VH interface.

In another embodiment, the invention features a humanized immunoglobulin light or heavy chain that includes 3D6 variable region CDRs and variable framework regions from a human acceptor immunoglobulin light or heavy chain sequence, provided that at least one framework residue is substituted with the corresponding amino acid residue from the mouse 3D6 light or heavy chain variable region sequence, where the framework residue is a residue capable of affecting light chain variable region conformation or function as identified by analysis of a threedimensional model of the variable region, for example a residue capable of interacting with antigen, a residue proximal to the antigen binding site, a residue capable of interacting with a CDR, a residue adjacent to a CDR, a residue within 6 A of a CDR residue, a canonical residue, a vernier zone residue, an interchain packing residue, an unusual residue, or a glycoslyation site residue on the surface of the structural model.

In another embodiment, the invention features a humanized immunoglobulin light chain that includes 3D6 variable region CDRs from the 3D6 light chain variable region sequence set forth as SEQ ID NO:2), and includes a human acceptor immunoglobulin variable framework region, provided that at least one framework residue selected from the group consisting of L1, L2, L36 and L46 (Kabat N- numbering convention) is substituted with the corresponding amino acid residue from o the mouse 3D6 light chain variable region sequence. In another embodiment, the invention features a humanized immunoglobulin heavy chain that includes 3D6 variable cN 5 region CDRs from the 3D6 heavy chain variable region sequence set forth as SEQ ID NO:4), and includes a human acceptor immunoglobulin variable framework region, 00 0C provided that at least one framework residue selected from the group consisting of H49, H93 and H94 (Kabat numbering convention) is substituted with the corresponding C-i amino acid residue from the mouse 3D6 heavy chain variable region sequence.

10 Preferred light chains include kappa II framework regions of the subtype cN kappa II (Kabat convention), for example, framework regions from the acceptor immunoglobulin Kabat ID 019230, Kabat ID 005131, Kabat ID 005058, Kabat ID 005057, Kabat ID 005059, Kabat ID U21040 and Kabat ID U41645. Preferred heavy chains include framework regions of the subtype I (Kabat convention), for example, framework regions from the acceptor immunoglobulin Kabat ID 045919, Kabat ID 000459, Kabat ID 000553, Kabat ID 000386 and Kabat ID M23691.

In one embodiment, the invention features a humanized immunoglobulin light or heavy chain that includes 10D5 variable region complementarity determining regions (CDRs) includes one, two or three CDRs from the light chain variable region sequence set forth as SEQ ID NO:14 or includes one, two or three CDRs from the heavy chain variable region sequence set forth as SEQ ID NO:16), and includes a variable framework region substantially from a human acceptor immunoglobulin light or heavy chain sequence, provided that at least one residue of the framework residue is backmutated to a corresponding murine residue, wherein said backmutation does not substantially affect the ability of the chain to direct A3 binding.

In another embodiment, the invention features a humanized immunoglobulin light or heavy chain that includes 10D5 variable region complementarity determining regions (CDRs) includes one, two or three CDRs from the light chain variable region sequence set forth as SEQ ID NO:14 and/or includes one, two or three CDRs from the heavy chain variable region sequence set forth as SEQ ID NO:16), and includes a variable framework region substantially from a human acceptor immunoglobulin light or heavy chain sequence, provided that at least one framework residue is substituted with the corresponding amino acid residue from the mouse 3D6 light or heavy chain variable region sequence, where the framework residue is selected from the group consisting of a residue that non-covalently binds antigen 0 directly; a residue adjacent to a CDR; a CDR-interacting residue identified N 5 by modeling the light or heavy chain on the solved structure of a homologous known imniunoglobulin chain); and a residue participating in the VL-VH interface.

00 In another embodiment, the invention features a humanized immunoglobulin light or heavy chain that includes 10D5 variable region CDRs and variable framework regions from a human acceptor immunoglobulin light or heavy 10 chain sequence, provided that at least one framework residue is substituted with the N.1 corresponding amino acid residue from the mouse 10D5 light or heavy chain variable region sequence, where the framework residue is a residue capable of affecting light chain variable region conformation or function as identified by analysis of a threedimensional model of the variable region, for example a residue capable of interacting with antigen, a residue proximal to the antigen binding site, a residue capable of interacting with a CDR, a residue adjacent to a CDR, a residue within 6 A of a CDR residue, a canonical residue, a vernier zone residue, an interchain packing residue, an unusual residue, or a glycoslyation site residue on the surface of the structural model.

In another embodiment, the invention features, in addition to the substitutions described above, a substitution of at least one rare human framework residue. For example, a rare residue can be substituted with an amino acid residue which is common for human variable chain sequences at that position. Alternatively, a rare residue can be substituted with a corresponding amino acid residue from a homologous germline variable chain sequence a rare light chain framework residue can be substituted with a corresponding germline residue from an A 1, A 17, A 18, A2, or A19 germline immunoglobulin sequence or a rare heavy chain framework residue can be substituted with a corresponding germline residue from a VH3-48, VH3-23, VH3-7, VH3-21 or VH3-11 germline immunoglobulin sequence.

In another embodiment, the invention features a humanized immunoglobulin that includes a light chain and a heavy chain, as described above, or an antigen-binding fragment of said immunoglobulin. In an exemplary embodiment, the humanized immunoglobulin binds specifically binds) to beta amyloid peptide (A3) 6 with a binding affinity of at least 10 7 10 8 or 10 9

M

1 In another embodiment, C the immunoglobulin or antigen binding fragment includes a heavy chain having isotype yl. In another embodiment, the immunoglobulin or antigen binding fragment binds Sspecifically binds) to both soluble beta amyloid peptide (AP) and aggregated Ap. In C 5 another embodiment, the immunoglobulin or antigen binding fragment mediates phagocytosis induces phagocytosis) of beta amyloid peptide In yet another 00 M embodiment, the immunoglobulin or antigen binding fragment crosses the blood-brain Sbarrier in a subject In yet another embodiment, the immunoglobulin or antigen binding fragment reduces both beta amyloid peptide (AP) burden and neuritic dystrophy in a O 10 subject.

In another embodiment, the invention features chimeric immunoglobulins that include 3D6 variable regions the variable region sequences set forth as SEQ ID NO:2 or SEQ ID NO:4). In yet another embodiment, the invention features an immunoglobulin, or antigen-binding fragment thereof, including a variable heavy chain region as set forth in SEQ ID NO:8 and a variable light chain region as set forth in SEQ ID NO:5. In yet another embodiment, the invention features an immunoglobulin, or antigen-binding fragment thereof, including a variable heavy chain region as set forth in SEQ ID NO:12 and a variable light chain region as set forth in SEQ ID NO:11. In another embodiment, the invention features chimeric immunoglobulins that include 10D5 variable regions the variable region sequences set forth as SEQ ID NO:14 or SEQ ID NO:16). In yet another embodiment, the immunoglobulin, or antigen-binding fragment thereof, further includes constant regions from IgG1.

The immunoglobulins described herein are particularly suited for use in therapeutic methods aimed at preventing or treating amyloidogenic diseases. In one embodiment, the invention features a method of preventing or treating an amyloidogenic disease Alzheimer's disease) that involves administering to the patient an effective dosage of a humanized immunoglobulin as described herein. In another embodiment, the invention features pharmaceutical compositions that include a humanized immunoglobulin as described herein and a pharmaceutical carrier. Also featured are isolated nucleic acid molecules, vectors and host cells for producing the immunoglobulins or immunoglobulin fragments or chains described herein, as well as methods for producing said immunoglobulins, immunoglobulin fragments or Simmunoglobulin chains oS The present invention further features a method for identifying 3D6 or O 10D5 residues amenable to substitution when producing a humanized 3D6 or 10D5 CN 5 immunoglobulin, respectively. For example, a method for identifying variable framework region residues amenable to substitution involves modeling the three- 00 00 dimensional structure of the 3D6 or 10D5 variable region on a solved homologous immunoglobulin structure and analyzing said model for residues capable of affecting 3D6 or 10D5 immunoglobulin variable region conformation or function, such that 0 10 residues amenable to substitution are identified. The invention further features use of CN the variable region sequence set forth as SEQ ID NO:2 or SEQ ID NO:4, or any portion thereof, in producing a three-dimensional image of a 3D6 immunoglobulin, 3D6 immunoglobulin chain, or domain thereof. Also featured is the use of the variable region sequence set forth as SEQ ID NO:14 or SEQ ID NO:16, or any portion thereof, in producing a three-dimensional image of a 10D5 immunoglobulin, 1 immunoglobulin chain, or domain thereof.

Prior to describing the invention, it may be helpful to an understanding thereof to set forth definitions of certain terms to be used hereinafter.

The term "immunoglobulin" or "antibody" (used interchangeably herein) refers to an antigen-binding protein having a basic four-polypeptide chain structure consisting of two heavy and two light chains, said chains being stabilized, for example, by interchain disulfide bonds, which has the ability to specifically bind antigen. Both heavy and light chains are folded into domains. The term "domain" refers to a globular region of a heavy or light chain polypeptide comprising peptide loops comprising 3 to 4 peptide loops) stabilized, for example, by P-pleated sheet and/or intrachain disulfide bond. Domains are further referred to herein as "constant" or "variable", based on the relative lack of sequence variation within the domains of various class members in the case of a "constant" domain, or the significant variation within the domains of various class members in the case of a "variable" domain. "Constant" domains on the light chain are referred to interchangeably as "light chain constant regions", "light chain constant domains", "CL" regions or "CL" domains). "Constant" domains on the heavy chain are referred to interchangeably as "heavy chain constant regions", "heavy chain constant domains", "CIT' regions or "CIT' domains). "Variable" domains on the light chain are referred to interchangeably as "light chain variable regions", "light chain 01 variable domains", "VU regions or "VL" domains). "Variable' domains on the heavy 5 chain are referred to interchangeably as "heavy chain constant regions", "heavy chain constant domains", "CIT' regions or "CI" domains).

M The term "region" refers to a part or portion of an antibody chain and includes constant or variable domains as defined herein, as well as more discrete parts or c.1 portions of said domains. For example, light chain variable domains *or regions include 10 "complementarity determining regions" or "CDRs" interspersed among "framework regions" or FRs", as defined herein.

Immunoglobulins or antibodies can exist in monomeric or polymeric form. The term "antigen-binding fragment" refers to a polypeptide fragment of an immunoglobulin or antibody binds antigen or competes with intact antibody with the intact antibody from which they were derived) for antigen binding specific binding). The term "conformation" refers to the tertiary structure of a protein or polypeptide an antibody, antibody chain, domain or region thereof). For example, the phrase "light (or heavy) chain conformation" refers to the tertiary structure of a light (or heavy) chain variable region, and the phrase "antibody conformation" or "antibody fragment conformation" refers to the tertiary structure of an antibody or fragment thereof.

"Specific binding" of an antibody mean that the antibody exhibits appreciable affinity for antigen or a preferred epitope and, preferably, does not exhibit significant crossreactivity. "Appreciable" or preferred binding include binding with an affinity of at least 106, i0, 108, 109 M 1 or 1010 M' Affinities greater than 10 7

M

l preferably greater than 108 M 1 are more preferred. Values intermediate of those set forth herein are also intended to be within the scope of the present invention and a preferred bing affinity can be indicated as a range of affinities, for example, 106 to 1010 M l preferably 107 to 1010 more preferably 108 to 101 1W. An antibody that "does not exhibit significant crossreactivity" is one that will not appreciably bind to an undesirable entity an undesirable proteinaceous entity). For example, an antibody that specifically binds to A3 will appreciably bind A3 but will not significantly react 0 with non-Ap proteins or peptides non-Ap proteins or peptides included in l plaques). An antibody specific for a preferred epitope will, for example, not o significantly crossreact with remote epitopes on the same protein or peptide. Specific binding can be determined according to any art-recognized means for determining such 5 binding. Preferably, specific binding is determined according to Scatchard analysis and/or competitive binding assays.

00 M Binding fragments are produced by recombinant DNA techniques, or by enzymatic or chemical cleavage of intact immunoglobulins. Binding fragments include .N Fab, Fab', F(ab') 2 Fabc, Fv, single chains, and single-chain antibodies. Other than S 10 "bispecific" or "bifunctional" immunoglobulins or antibodies, an immunoglobulin or C antibody is understood to have each of its binding sites identical. A "bispecific" or "bifunctional antibody" is an artificial hybrid antibody having two different heavy/light chain pairs and two different binding sites. Bispecific antibodies can be produced by a variety of methods including fusion of hybridomas or linking of Fab' fragments. See, Songsivilai Lachmann, Clin. Exp. Immunol. 79:315-321 (1990); Kostelny et al., J. Immunol. 148, 1547-1553 (1992).

The term "humanized immunoglobulin"' or "humanized antibody" refers to an immunoglobulin or antibody that includes at least one humanized immunoglobulin or antibody chain at least one humanized light or heavy chain). The term "humanized immunoglobulin chain" or "humanized antibody chain" a "humanized immunoglobulin light chain" or "humanized immunoglobulin heavy chain") refers to an immunoglobulin or antibody chain a light or heavy chain, respectively) having a variable region that includes a variable framework region substantially from a human immunoglobulin or antibody and complementarity determining regions (CDRs) at least one CDR, preferably two CDRs, more preferably three CDRs) substantially from a non-human immunoglobulin or antibody, and further includes constant regions at least one constant region or portion thereof, in the case of a light chain, and preferably three constant regions in the case of a heavy chain). The term "humanized variable region" "humanized light chain variable region" or "humanized heavy chain variable region") refers to a variable region that includes a variable framework region substantially from a human immunoglobulin or antibody and complementarity determining regions (CDRs) substantially from a non-human immunoglobulin or antibody.

o The phrase "substantially from a human immunoglobulin or antibody" or o "substantially human" means that, when aligned to a human immunoglobulin or ci 5 antibody amino sequence for comparison purposes, the region shares at least 80-90%, preferably 90-95%, more preferably 95-99% identity local sequence identity) with 00 c the human framework or constant region sequence, allowing, for example, for conservative substitutions, consensus sequence substitutions, germline substitutions, CI backmutations, and the like. The introduction of conservative substitutions, consensus 0 10 sequence substitutions, germline substitutions, backmutations, and the like, is often iN referred to as "optimization" of a humanized antibody or chain. The phrase "substantially from a non-human immunoglobulin or antibody" or "substantially nonhuman" means having an immunoglobulin or antibody sequence at least 80-95%, preferably 90-95%, more preferably, 96%, 97%, 98%, or 99% identical to that of a nonhuman organism, a non-human mammal.

Accordingly, all regions or residues of a humanized immunoglobulin or antibody, or of a humanized immunoglobulin or antibody chain, except possibly the CDRs, are substantially identical to the corresponding regions or residues of one or more native human immunoglobulin sequences. The term "corresponding region" or "corresponding residue" refers to a region or residue on a second amino acid or nucleotide sequence which occupies the same equivalent) position as a region or residue on a first amino acid or nucleotide sequence, when the first and second sequences are optimally aligned for comparison purposes.

The terms "humanized immunoglobulin" or "humanized antibody" are not intended to encompass chimeric immunoglobulins or antibodies, as defined infra.

Although humanized immunoglobulins or antibodies are chimeric in their construction comprise regions from more than one species of protein), they include additional features variable regions comprising donor CDR residues and acceptor framework residues) not found in chimeric immunoglobulins or antibodies, as defined herein.

The term "significant identity" means that two polypeptide sequences, when optimally aligned, such as by the programs GAP or BESTFIT using default gap weights, share at least 50-60% sequence identity, preferably 60-70% sequence identity, more preferably 70-80% sequence identity, more preferably at least 80-90% identity, even more preferably at least 90-95% identity, and even more preferably at least o seqivence identity or more 99% sequence identity or more). The term "substantial oC identity" means that two polypeptide sequences, when optimally aligned, such as by the N- programs GAP or BESTFIT using default gap weights, share at least 80-90% sequence identity, preferably 90-95% sequence identity, and more preferably at least 00 sequence identity or more 99% sequence identity or more). Forsequence comparison, typically one sequence acts as a reference sequence, to which test c-i sequences are compared. When using a sequence comparison algorithm, test and S 10 reference sequences are input into a computer, subsequence coordinates are designated, c-I if necessary, and sequence algorithm program parameters are designated. The sequence comparison algorithm then calculates the percent sequence identity for the test ,sequence(s) relative to the reference sequence, based on the designated program parameters. The terms "sequence identity" and "sequence identity" are used interchangeably herein.

Optimal alignment of sequences for comparison can be conducted, e.g, by the local homology algorithm of Smith Waterman, Adv. App?. Math. 2:482 (198 1), by the homology alignment algorithm of Needleman Wunsch, J1 Mo?. Biol 48:443 (1970), by the search for similarity method of Pearson Lipman, Proc. Nat'. Acad Sci.

USA 85:2444 (1988), by computerized implementations of these algorithms

(GAP,

BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, WI), or by visual inspection (see generally Ausubel et al., Current Protocols in Molecular Biology). One example of algorithm that is suitable for determining percent sequence identity and sequence similarity is the BLAST algorithm, which is described in Altschul et al., J Mo!. Biol.

215:403 (1990). Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (publicly accessible through the National Institutes of Health NCBI internet server). Typically, default program parameters can be used to perform the sequence comparison, although customized parameters can also be used. For amino acid sequences, the BLAST? program uses as defaults a wordlength of 3, an expectation of 10, and the BLOSUM62 scoring matrix (see Henikoff Henikoff, Proc. Nat. Acad Sci. USA4 89:10915 (1989)).

Preferably, residue positions which are not identical differ by Sconservative amino acid substitutions. For purposes of classifying amino acids Ssubstitutions as conservative or nonconservative, amino acids are grouped as follows: SGroup I (hydrophobic sidechains): leu, met, ala, val, leu, ile; Group II (neutral ,N 5 hydrophilic side chains): cys, ser, thr; Group III (acidic side chains): asp, glu; Group IV (basic side chains): asn, gin, his, lys, arg; Group V (residues influencing chain 00 0 orientation): gly, pro; and Group VI (aromatic side chains): trp, tyr, phe. Conservative substitutions involve substitutions between amino acids in the same class. Nonconservative substitutions constitute exchanging a member of one of these classes for a S 10 member of another.

C Preferably, humanized immunoglobulins or antibodies bind antigen with an affinity that is within a factor of three, four, or five of that of the corresponding nonhuman antibody. For example, if the nonhuman antibody has a binding affinity of 109 MI', humanized antibodies will have a binding affinity of at least 3 x 10 9 M 4 x 10 9 Mv 1 or 109 M- 1 When describing the binding properties of an immunoglobulin or antibody chain, the chain can be described based on its ability to "direct antigen Ap) binding". A chain is said to "direct antigen binding" when it confers upon an intact immunoglobulin or antibody (or antigen binding fragment thereof) a specific binding property or binding affinity. A mutation a backmutation) is said to substantially affect the ability of a heavy or light chain to direct antigen binding if it affects decreases) the binding affinity of an intact immunoglobulin or antibody (or antigen binding fragment thereof) comprising said chain by at least an order of magnitude compared to that of the antibody (or antigen binding fragment thereof) comprising an equivalent chain lacking said mutation. A mutation "does not substantially affect decrease) the ability of a chain to direct antigen binding" if it affects decreases) the binding affinity of an intact immunoglobulin or antibody (or antigen binding fragment thereof) comprising said chain by only a factor of two, three, or four of that of the antibody (or antigen binding fragment thereof) comprising an equivalent chain lacking said mutation.

The term "chimeric immunoglobulin" or antibody refers to an immunoglobulin or antibody whose light and heavy chains are derived from different species. Chimeric immunoglobulins or antibodies can be constructed, for example by Sgenetic engineering, from immunoglobulin gene segments belonging to different 0 species.

SAn "antigen" is an entity a protenaceous entity or peptide) to which o an antibody specifically binds.

N 5 The term "epitope" or "antigenic determinant" refers to a site on an antigen to which an immunoglobulin or antibody (or antigen binding fragment thereof) cl specifically binds. Epitopes can be formed both from contiguous amino acids or noncontiguous amino acids juxtaposed by tertiary folding of a protein. Epitopes formed c from contiguous amino acids are typically retained on exposure to denaturing solvents 10 whereas epitopes formed by tertiary folding are typically lost on treatment with cIN denaturing solvents. An epitope typically includes at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15 amino acids in a unique spatial conformation. Methods of determining spatial conformation of epitopes include, for example, x-ray crystallography and 2dimensional nuclear magnetic resonance. See, Epitope Mapping Protocols in Methods in Molecular Biology, Vol. 66, G. E. Morris, Ed. (1996).

Antibodies that recognize the same epitope can be identified in a simple immunoassay showing the ability of one antibody to block the binding of another antibody to a target antigen, a competitive binding assay. Competitive binding is determined in an assay in which the immunoglobulin under test inhibits specific binding of a reference antibody to a common antigen, such as Ap. Numerous types of competitive binding assays are known, for example: solid phase direct or indirect radioimmunoassay (RIA), solid phase direct or indirect enzyme immunoassay

(EIA),

sandwich competition assay (see Stahli et al., Methods in Enzymology 9:242 (1983)); solid phase direct biotin-avidin EIA (see Kirkland et al., J Immunol. 137:3614 (1986)); solid phase direct labeled assay, solid phase direct labeled sandwich assay (see Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Press (1988)); solid phase direct label RIA using 1-125 label (see Morel et al., Mol. Immunol. 25(1):7 (1988)); solid phase direct biotin-avidin EIA (Cheung et al., Virology 176:546 (1990)); and direct labeled RIA. (Moldenhauer et al., Scand J Immunol. 32:77 (1990)).

Typically, such an assay involves the use of purified antigen bound to a solid surface or cells bearing either of these, an unlabeled test immunoglobulin and a labeled reference immunoglobulin. Competitive inhibition is measured by determining the amount of Slabel bound to the solid surface or cells in the presence of the test immunoglobulin.

CI Usually the test immunoglobulin is present in excess. Usually, when a competing antibody is present in excess, it will inhibit specific binding of a reference antibody to a 0 common antigen by at least 50-55%, 55-60%, 60-65%, 65-70% 70-75% or more.

N 5 An epitope is also recognized by immunologic cells, for example, B cells and/or T cells. Cellular recognition of an epitope can be determined by in vitro assays 0 that measure antigen-dependent proliferation, as determined by 3 H-thymidine Sincorporation, by cytokine secretion, by antibody secretion, or by antigen-dependent CI killing (cytotoxic T lymphocyte assay).

10 Exemplary epitopes or antigenic determinants can be found within the CI human amyloid precursor protein (APP), but are preferably found within the Ap peptide of APP. Multiple isoforms of APP exist, for example APP 695

APP

7 5 1 and APP 770 Amino acids within APP are assigned numbers according to the sequence of the APP 770 isoform (see GenBank Accession No. P05067, also set forth as SEQ ID NO:38).

AP (also referred to herein as beta amyloid peptide and A-beta) peptide is a -4-kDa internal fragment of 39-43 amino acids of APP (Ap39, AB40, Ap41, Ap42 and Ap43).

for example, consists of residues 672-711 of APP and Ap42 consists of residues 673-713 of APP. As a result ofproteolytic processing of APP by different secretase enzymes iv vivo or in situ, A is found in both a "short form", 40 amino acids in length, and a "long form", ranging from 42-43 amino acids in length. Preferred epitopes or antigenic determinants, as described herein, are located within the N-terminus of the Ap peptide and include residues within amino acids 1-10 of Ap, preferably from residues 1- 3, 1-4, 1-5, 1-6, 1-7 or 3-7 of Ap42. Additional referred epitopes or antigenic determinants include residues 2-4, 5, 6, 7 or 8 of Ap, residues 3-5, 6, 7, 8 or 9 of AP, or residues 4-7, 8, 9 or 10 of Ap42.

The term "amyloidogenic disease" includes any disease associated with (or caused by) the formation or deposition of insoluble amyloid fibrils. Exemplary amyloidogenic diseases include, but are not limited to systemic amyloidosis, Alzheimer's disease, mature onset diabetes, Parkinson's disease, Huntington's disease, fronto-temporal dementia, and the prion-related transmissible spongiform encephalopathies (kuru and Creutzfeldt-Jacob disease in humans and scrapie and BSE in sheep and cattle, respectively). Different amyloidogenic diseases are defined or 6 characterized by the nature of the polypeptide component of the fibrils deposited. For :example, in subjects or patients having Alzheimer's disease, P-amyloid protein o wild-type, variant, or truncated P-amyloid protein) is the characterizing polypeptide 0 component of the amyloid deposit Accordingly, Alzheimer's disease is an example of a S 5 "disease characterized by deposits of Ap" or a "disease associated with deposits of Ap", o in the brain of a subject or patient The terms "p-amyloid protein", "p-amyloid Speptide", "p-amyloid", "Ap" and "Ap peptide" are used interchangeably herein.

SThe term "effective dose" or "effective dosage" is defined as an amount sufficient to achieve or at least partially achieve the desired effect. The term "therapeutically effective dose" is defined as an amount sufficient to cure or at least partially arrest the disease and its complications in a patient already suffering from the disease. Amounts effective for this use will depend upon the severity of the infection and the general state of the patient's own immune system.

The term "patient" includes human and other mammalian subjects that receive either prophylactic or therapeutic treatment.

"Soluble" or "dissociated" AP refers to non-aggregating or disaggregated AP polypeptide. "Insoluble" AP refers to aggregating Ap polypeptide, for example, Ap held together by noncovalent bonds. AP Ap42) is believed to aggregate, at least in part, due to the presence ofhydrophobic residues at the C-terminus of the peptide (part of the transmembrane domain of APP). One method to prepare soluble AP is to dissolve lyophilized peptide in neat DMSO with sonication. The resulting solution is centrifuged to remove any insoluble particulates.

I. Immunological and Therapeutic Reagents Immunological and therapeutic reagents of the invention comprise or consist ofimmunogens or antibodies, or functional or antigen binding fragments thereof, as defined herein. The basic antibody structural unit is known to comprise a tetramer of subunits. Each tetramer is composed of two identical pairs of polypeptide chains, each pair having one "light" (about 25 kDa) and one "heavy" chain (about 50-70 kDa). The amino-terminal portion of each chain includes a variable region of about 100 to 110 or more amino acids primarily responsible for antigen recognition. The carboxy-terminal portion of each chain defines a constant region primarily responsible for effector 0 function.

o Light chains are classified as either kappa or lambda and are about 230 O residues in length. Heavy chains are classified as gamma mu alpha delta N 5 or epsilon are about 450-600 residues in length, and define the antibody's isotype as IgG, IgM, IgA, IgD and IgE, respectively. Both heavy and light chains are 0 folded into domains. The term "domain" refers to a globular region of a protein, for example, an immunoglobulin or antibody. Immunoglobulin or antibody domains include, for example, 3 or four peptide loops stabilized by P-pleated sheet and an 10 interchain disulfide bond. Intact light chains have, for example, two domains (VL and C1 CL) and intact heavy chains have, for example, four or five domains (VH, CH1, CH2, and CH3).

Within light and heavy chains, the variable and constant regions are joined by a region of about 12 or more amino acids, with the heavy chain also including a region of about 10 more amino acids. (See generally, Fundamental Immunology (Paul, ed., 2nd ed. Raven Press, N.Y. (1989), Ch. 7, incorporated by reference in its entirety for all purposes).

The variable regions of each light/heavy chain pair form the antibody binding site. Thus, an intact antibody has two binding sites. Except in bifunctional or bispecific antibodies, the two binding sites are the same. The chains all exhibit the same general structure of relatively conserved framework regions (FR) joined by three hypervariable regions, also called complementarity determining regions or CDRs.

Naturally-occurring chains or recombinantly produced chains can be expressed with a leader sequence which is removed during cellular processing to produce a mature chain.

Mature chains can also be recombinantly produced having a non-naturally occurring leader sequence, for example, to enhance secretion or alter the processing of a particular chain of interest.

The CDRs of the two mature chains of each pair are aligned by the framework regions, enabling binding to a specific epitope. From N-terminal to Cterminal, both light and heavy chains comprise the domains FR1, CDR1, FR2, CDR2, FR3, CDR3 and FR4. "FR4" also is referred to in the art as the D/J region of the variable heavy chain and the J region of the variable light chain. The assignment of amino acids to each domain is in accordance with the definitions ofKabat, Sequences of Proteins oflmmunological Interest (National Institutes of Health, Bethesda, MD, 1987 o and 1991). An alternative structural definition has been proposed by Chothia et al., J 0 Mol. Biol. 196:901 (1987); Nature 342:878 (1989); andJ Mol. Biol. 186:651 (1989) N 5 (hereinafter collectively referred to as "Chothia et al." and incorporated by reference in their entirety for all purposes).

00 A. AB Antibodies c Therapeutic agents of the invention include antibodies that specifically 0 10 bind to Ap or other component of amyloid plaques. Such antibodies can be monoclonal or polyclonal. Some such antibodies bind specifically to the aggregated form of Ap without binding to the soluble form. Some bind specifically to the soluble form without binding to the aggregated form. Some bind to both aggregated and soluble forms. Some such antibodies bind to a naturally occurring short form of Ap Ap39, 40 or 41) without binding to a naturally occurring long form of Ap Ap42 and Ap43). Some antibodies bind to a long form of Ap without binding to a short form. Some antibodies bind to AP without binding to full-length amyloid precursor protein. Antibodies used in therapeutic methods preferably have an intact constant region or at least sufficient of the constant region to interact with an Fc receptor. Human isotype IgG1 is preferred because of it having highest affinity of human isotypes for the FcRI receptor on phagocytic cells. Bispecific Fab fragments can also be used, in which one arm of the antibody has specificity for Ap, and the other for an Fc receptor. Preferred antibodies bind to A3 with a binding affinity greater than (or equal to) about 106, 10, 108, 109, or 100 MT' (including affinities intermediate of these values).

Polyclonal sera typically contain mixed populations of antibodies binding to several epitopes along the length ofAp. However, polyclonal sera can be specific to a particular segment of A, such as Apl-10. Monoclonal antibodies bind to a specific epitope within AB that can be a conformational or nonconformational epitope.

Prophylactic and therapeutic efficacy of antibodies can be tested using the transgenic animal model procedures described in the Examples. Preferred monoclonal antibodies bind to an epitope within residues 1-10 of Ap (with the first N terminal residue of 0 natural Ap designated Some preferred monoclonal antibodies bind to an epitope l within amino acids 1-5, and some to an epitope within 5-10. Some preferred antibodies Sbind to epitopes within amino acids 1-3, 1-4, 1-5, 1-6, 1-7 or 3-7. Some preferred 0 antibodies bind to an epitope starting at resides 1-3 and ending at residues 7-11 of Ap.

S 5 Less preferred antibodies include those binding to epitopes with residues 10-15, 15-20, 25-30, 10-20, 20, 30, or 10-25 ofAp. It is recommended that such antibodies be M screened for activity in the mouse models described in the Examples before use. For example, it has been found that certain antibodies to epitopes within residues 10-18, 16- 24, 18-21 and 33-42 lack activity lack the ability to reduce plaque burden and/or S 10 resolve the neuritic pathology associated with Alzheimer's disease). In some methods, multiple monoclonal antibodies having binding specificities to different epitopes are used Such antibodies can be administered sequentially or simultaneously. Antibodies to amyloid components other than Ap can also be used administered or coadministered). For example, antibodies can be directed to the amyloid associated protein synuclein.

When an antibody is said to bind to an epitope within specified residues, such as A3 1-5 for example, what is meant is that the antibody specifically binds to a polypeptide containing the specified residues Ap 1-5 in this an example). Such an antibody does not necessarily contact every residue within Ap 1-5. Nor does every single amino acid substitution or deletion with in Apl-5 necessarily significantly affect binding affinity. Epitope specificity of an antibody can be determined, for example, by forming a phage display library in which different members display different subsequences of A3. The phage display library is then selected for members specifically binding to an antibody under test. A family of sequences is isolated. Typically, such a family contains a common core sequence, and varying lengths of flanking sequences in different members. The shortest core sequence showing specific binding to the antibody defines the epitope bound by the antibody. Antibodies can also be tested for epitope specificity in a competition assay with an antibody whose epitope specificity has already been determined. For example, antibodies that compete with the 3D6 antibody for binding to Ap bind to the same or similar epitope as 3D6, within residues Ap Likewise antibodies that compete with the 10D5 antibody bind to the same or similar epitope, within residues Ap 3-7. Screening antibodies for epitope specificity is a useful predictor of therapeutic efficacy. For example, an antibody determined to bind to 0 an epitope within residues 1-7 of AP3 is likely to be effective in preventing and treating o Alzheimer's disease according to the methodologies of the present invention.

0 Monoclonal or polyclonal antibodies that specifically bind to a preferred N- 5 segment of AP without binding to other regions of AP have a number of advantages 00 relative to monoclonal antibodies binding to other regions or polyclonal sera to intact rn Af. First, for equal mass dosages, dosages of antibodies that specifically bind to preferred segments contain a higher molar dosage of antibodies effective in clearing c-i amyloid plaques. Second, antibodies specifically binding to preferred segments can C) 10 induce a clearing response against amyloid deposits without inducing a clearing N- response against intact APP polypeptide, thereby reducing the potential side effects.

1. Production of Nonhuman Antibodies The present invention features non-human antibodies, for example, antibodies having specificity for the preferred AP3 epitopes of the invention. Such antibodies can be used in formulating various therapeutic compositions of the invention or, preferably, provide complementarity determining regions for the production of humanized or chimeric antibodies (described in detail below). The production of nonhuman monoclonal antibodies, murine, guinea pig, primate, rabbit or rat, can be accomplished by, for example, immunizing the animal with Af3. A longer polypeptide comprising Af3 or an immunogenic fragment of API or anti-idiotypic antibodies to an antibody to AP can also be used. See Harlow Lane, supra, incorporated by reference for all purposes). Such an immunogen can be obtained from a natural source, by peptide synthesis or by recombinant expression. Optionally, the immunogen can be administered fused or otherwise complexed with a carrier protein, as described below.

Optionally, the immunogen can be administered with an adjuvant. The term t adjuvant" refers to a compound that when administered in conjunction with an antigen augments the immune response to the antigen, but when administered alone does not generate an immune response to the antigen. Adjuvants can augment an immune response by several mechanisms including lymphocyte recruitment stimulation of B and/or T cells, and stimulation of macrophages. Several types of adjuvant can be used as described Sbelow. Complete Freund's adjuvant followed by incomplete adjuvant is preferred for N immunization of laboratory animals.

c-I o Rabbits or guinea pigs are typically used for making polyclonal Santibodies. Exemplary preparation of polyclonal antibodies, for passive protection, N 5 can be performed as follows. 125 non-transgenic mice are immunized with 100 pg Apl- 42, plus CFA/IFA adjuvant, and euthanized at 4-5 months. Blood is collected from 0 immunized mice. IgG is separated from other blood components. Antibody specific for Sthe immunogen may be partially purified by affinity chromatography. An average of N about 0.5-1 mg of immunogen-specific antibody is obtained per mouse, giving a total of 10 6 0-120 mg.

Mice are typically used for making monoclonal antibodies. Monoclonals can be prepared against a fragment by injecting the fragment or longer form of AP into a mouse, preparing hybridomas and screening the hybridomas for an antibody that specifically binds to Ap. Optionally, antibodies are screened for binding to a specific region or desired fragment of Ap without binding to other nonoverlapping fragments of AP. The latter screening can be accomplished by determining binding of an antibody to a collection of deletion mutants of an Ap peptide and determining which deletion mutants bind to the antibody. Binding can be assessed, for example, by Western blot or ELISA. The smallest fragment to show specific binding to the antibody defines the epitope of the antibody. Alternatively, epitope specificity can be determined by a competition assay is which a test and reference antibody compete for binding to Ap. If the test and reference antibodies compete, then they bind to the same epitope or epitopes sufficiently proximal such that binding of one antibody interferes with binding of the other. The preferred isotype for such antibodies is mouse isotype IgG2a or equivalent isotype in other species. Mouse isotype IgG2a is the equivalent of human isotype IgG1.

2. Chimeric and HumanizedAntibodies The present invention also features chimeric and/or humanized antibodies chimeric and/or humanized immunoglobulins) specific for beta amyloid peptide.

Chimeric and/or humanized antibodies have the same or similar binding specificity and affinity as a mouse or other nonhuman antibody that provides the starting material for construction of a chimeric or humanized antibody.

A. Production of Chimeric Antibodies The term "chimneric antibody" refers to an antibody whose light and 0 heavy chain genes have been constructed, typically by genetic engineering, from ininunoglobulin gene segments belonging to different species. For example, the variable segments of the genes from a mouse monoclonal antibody may be joined to 0C) human constant segments, such as IgGI -and IgG4. Human isotype IgGI is IND preferred. A typical chimeric antibody is thus a hybrid protein consisting of the V or antigen-binding domain from a mouse antibody and the C or effector domain from a S 10 human antibody.

B. Production of Humanized Antibodies The term "humanized antibody" refers to an antibody comprising at least one chain comprising variable region framework residues substantially from a human antibody chain (referred to as the acceptor immunoglobulin or antibody) and at least one complementarity determining region substantially from a mouse-antibody,(freferred to as thle donor inimunoglobulin or antibody). See, Queen et al., Proc. NatI. Acad Sci.

USA 86:10029-10033 (1989), US 5,530,101, US 5,585,089, US 5,693,761, US 5,693,762, Selick et al., WO 90/07861, and Winter, US 5,225,539 (incorporated by reference in their entirety for all purposes). The constant region(s), if present, are also substantially or entirely from a human immunoglobulin.

The substitution of mouse CDRs into a human variable domain framework is most likely to result in retention of their correct spatial orientation if the human variable domain framework adopts the same or similar confornmation to the mouse variable framework from which the CDRs originated. This is achieved by obtaining the human variable domains from human antibodies whose framework sequences exhibit a high degree of sequence identity with the murine variable framework domains from which the CDRs were derived. The heavy and light chain variable framework regions can be derived from the same or different human antibody sequences. The human antibody sequences can be the sequence s of naturally occurring human antibodies or can be consensus sequences of several human antibodies. See Kettleborough et al., Protein Engineering 4:773 (1991); Kolbinger et al., Protein SEngineering 6:971 (1993) and Carter et al., WO 92/22653.

SHaving identified the complementarity determining regions of the murine O donor immunoglobulin and appropriate human acceptor immunoglobulins, the next step 5 is to determine which, if any, residues from these components should be substituted to optimize the properties of the resulting humanized antibody. In general, substitution of m human amino acid residues with murine should be minimized, because introduction of IN murine residues increases the risk of the antibody eliciting a human-anti-mouse-antibody (HAMA) response in humans. Art-recognized methods of determining immune response can be performed to monitor a HAMA response in a particular patient or C, during clinical trials. Patients administered humanized antibodies can be given an immunogenicity assessment at the beginning and throughout the administration of said therapy. The HAMA response is measured, for example, by detecting antibodies to the humanized therapeutic reagent, in serum samples from the patient using a method known to one in the art, including surface plasmon resonance technology

(BIACORE)

and/or solid-phase ELISA analysis.

Certain amino acids from the human variable region framework residues are selected for substitution based on their possible influence on CDR conformation and/or binding to antigen. The unnatural juxtaposition of murine CDR regions with human variable framework region can result in unnatural conformational restraints, which, unless corrected by substitution of certain amino acid residues, lead to loss of binding affinity.

The selection of amino acid residues for substitution is determined, in part, by computer modeling. Computer hardware and software are described herein for producing three-dimensional images of immunoglobulin molecules. In general, molecular models are produced starting from solved structures for immunoglobulin chains or domains thereof. The chains to be modeled are compared for amino acid sequence similarity with chains or domains of solved three-dimensional structures, and the chains or domains showing the greatest sequence similarity is/are selected as starting points for construction of the molecular model. Chains or domains sharing at least sequence identity are selected for modeling, and preferably those sharing at least 80%, 90% sequence identity or more are selected for modeling. The solved starting structures are modified to allow for differences between the actual amino acids Sin the immunoglobulin chains or domains being modeled, and those in the starting Sstructure. The modified structures are then assembled into a composite 0 immunoglobulin. Finally, the model is refined by energy minimization and by verifying N 5 that all atoms are within appropriate distances from one another and that bond lengths and angles are within chemically acceptable limits.

00 CM The selection of amino acid residues for substitution can also be Sdetermined, in part, by examination of the characteristics of the amino acids at particular c- locations, or empirical observation of the effects of substitution or mutagenesis of S 10 particular amino acids. For example, when an amino acid differs between a murine cN variable region framework residue and a selected human variable region framework residue, the human framework amino acid should usually be substituted by the equivalent framework amino acid from the mouse antibody when it is reasonably expected that the amino acid: noncovalently binds antigen directly, is adjacent to a CDR region, otherwise interacts with a CDR region is within about 3-6 A of a CDR region as determined by computer modeling), or participates in the VL-VH interface.

Residues which "noncovalently bind antigen directly" include amino acids in positions in framework regions which are have a good probability of directly interacting with amino acids on the antigen according to established chemical forces, for example, by hydrogen bonding, Van der Waals forces, hydrophobic interactions, and the like.

CDR and framework regions are as defined by Kabat et al. or Chothia et al., supra. When framework residues, as defined by Kabat et al., supra, constitute structural loop residues as defined by Chothia et al., supra, the amino acids present in the mouse antibody may be selected for substitution into the humanized antibody.

Residues which are "adjacent to a CDR region" include amino acid residues in positions immediately adjacent to one or more of the CDRs in the primary sequence of the humanized immunoglobulin chain, for example, in positions immediately adjacent to a CDR as defined by Kabat, or a CDR as defined by Chothia (See Chothia and Lesk M 196:901 (1987)). These amino acids are particularly likely to interact wihte c-Ni amino acids in the CDRs and, if chosen from the acceptor, to distort the donor CDRs o and reduce affinity. Moreover, the adjacent amino acids may interact directly with the 0 antigen (Amit et al., Science, 233:747 (1986), which is incorporated herein by reference) N- 5 and selecting these amnino acids from the donor may be desirable to keep all the antigen contacts that provide affinity in the original antibody.

00 Residues that "otherwise interact with a CDR region" include those that are determined by secondary structural analysis to be in a spatial orientation suffcient to c-i effect a CDR region. In one embodiment, residues that "otherwise interact with a CDR S 10 region" are identified by analyzing a three-dimensional model of-the donor N- immunoglobulin a computer-generated model). A three-dimensional model, typically of the original donor antibody, shows that certain amino acids outside of the CDRs are close to the CDRs and have a good probability of interacting with amino acids in the CDRs by hydrogen bonding, Van der Waals forces, hydrophobic interactions, etc.

At those amino acid positions, the donor immunoglobulin amino acid rather than the acceptor iminunoglobulin amino acid may be selected. Amino acids according to this criterion will generally have a side chain atom within about 3 angstrom units of some atom in the CDRs and must contain an atom that could interact with the CDR atoms according to established chemical forces, such as those listed above.

In the case of atoms that may form a hydrogen bond, the 3 A is measured between their nuclei, but for atoms that do not form a bond, the 3 A is measured between their Van der Waals surfaces. Hence, in the latter case, the nuclei must be within about 6 A (3 A plus the sum of the Van der Waals radii) for t 'he atoms to be considered capable of interacting. In many cases the nuclei will be from 4 or 5 to 6 A apart. In determining whether an amino acid can interact with the CDRs, it is preferred not to consider the last 8 amino acids of heavy chain CDR 2 as part of the CDRs, because from the viewpoint of structure, these 8 amino acids behave more as part of the framework.

Amino acids that are capable of interacting with amino acids in the CDRs, may be identified in yet another way. The solvent accessible surface area of each framework amino acid is calculated in two ways: in the intact antibody, and in a hypothetical molecule consisting of the antibody with its CDRs removed. A significant difference between these numbers of about 10 square angstroms or more shows that Saccess of the framework amino acid to solvent is at least partly blocked by the CDRs, Sand therefore that the amino acid is making contact with the CDRs. Solvent accessible Ssurface area of an amino acid may be calculated based on a three-dimensional model of 0 an antibody, using algorithms known in the art Connolly, J. Appl. Cryst. 16:548 (1983) and Lee and Richards, J. Mol. Biol. 55:379 (1971), both of which are incorporated herein by reference). Framework amino acids may also occasionally Sinteract with the CDRs indirectly, by affecting the conformation of another framework amino acid that in turn contacts the CDRs.

N The amino acids at several positions in the framework are known to be 10 capable of interacting with the CDRs in many antibodies (Chothia and Lesk, supra, C1 Chothia et al., supra and Tramontano etal., J. Mol. Biol. 215:175 (1990), all of which are incorporated herein by reference). Notably, the amino acids at positions 2, 48, 64 and 71 of the light chain and 26-30, 71 and 94 of the heavy chain (numbering according to Kabat) are known to be capable of interacting with the CDRs in many antibodies.

The amino acids at positions 35 in the light chain and 93 and 103 in the heavy chain are also likely to interact with the CDRs. At all these numbered positions, choice of the donor amino acid rather than the acceptor amino acid (when they differ) to be in the humanized immunoglobulin is preferred. On the other hand, certain residues capable of interacting with the CDR region, such as the first 5 amino acids of the light chain, may sometimes be chosen from the acceptor immunoglobulin without loss of affinity in the humanized immunoglobulin.

Residues which "participate in the VL-VH interface" or "packing residues" include those residues at the interface between VL and VH as defined, for example, by Novotny and Haber, Proc. Natl. Acad. Sci. USA, 82:4592-66 (1985) or Chothia et al, supra. Generally, unusual packing residues should be retained in the humanized antibody if they differ from those in the human frameworks.

In general, one or more of the amino acids fulfilling the above criteria is substituted. In some embodiments, all or most of the amino acids fulfilling the above criteria are substituted. Occasionally, there is some ambiguity about whether a particular amino acid meets the above criteria, and alternative variant immunoglobulins are produced, one of which has that particular substitution, the other of which does not.

SAlternative variant immunoglobulins so produced can be tested in any of the assays 0 described herein for the desired activity, and the preferred immunoglobulin selected.

0 Usually the CDR regions in humanized antibodies are substantially identical, and more usually, identical to the corresponding CDR regions of the donor N 5 antibody. Although not usually desirable, it is sometimes possible to make one or more conservative amino acid substitutions of CDR residues without appreciably affecting the 00 rn binding affinity of the resulting humanized immunoglobulin. By conservative substitutions is intended combinations such as gly, ala; val, ile, leu; asp, glu; asn, gin; ser, thr; lys, arg; and phe, tyr.

10 Additional candidates for substitution are acceptor human framework CN amino acids that are unusual or "rare" for a human immunoglobulin at that position.

These amino acids can be substituted with amino acids from the equivalent position of the mouse donor antibody or from the equivalent positions of more typical human immunoglobulins. For example, substitution may be desirable when the amino acid in a human framework region of the acceptor immunoglobulin is rare for that position and the corresponding amino acid in the donor immunoglobulin is common for that position in human immunoglobulin sequences; or when the amino acid in the acceptor immunoglobulin is rare for that position and the corresponding amino acid in the donor immunoglobulin is also rare, relative to other human sequences. These criterion help ensure that an atypical amino acid in the human framework does not disrupt the antibody structure. Moreover, by replacing an unusual human acceptor amino acid with an amino acid from the donor antibody that happens to be typical for human antibodies, the humanized antibody may be made less immunogenic.

The term "rare", as used herein, indicates an amino acid occurring at that position in less than about 20% but usually less than about 10% of sequences in a representative sample of sequences, and the term "common", as used herein, indicates an amino acid occurring in more than about 25% but usually more than about 50% of sequences in a representative sample. For example, all human light and heavy chain variable region sequences are respectively grouped into "subgroups" of sequences that are especially homologous to each other and have the same amino acids at certain critical positions (Kabat et al., supra). When deciding whether an amino acid in a human acceptor sequence is "rare" or "common" among human sequences, it will often be preferable to consider only those human sequences in the same subgroup as the c-i acceptor sequence.

o Additional candidates for substitution are acceptor human framework 0 amino acids that would be identified as part of a CDR region under the alternative N- 5 definition proposed by Chothia et al, supra. Additional candidates for substitution are acceptor human framework amino acids that would be identified as part of a CDR region 00 M under the AbM and/or contact definitions. Notably, ODRI in the variable heavy chain is defined as including residues 26-3 2.

c-I Additional candidates for substitution are acceptor framework residues 0 10 that correspond to a rare or unusual donor framework residue. Rare or unusual donor c-I framework residues are those that are rare or unusual (as defined herein) for murine antibodies at. that position. For murine antibodies, the subgroup can be determined according to Kabat and residue positions identified which differ from the consensus.

These donor specific differences may point to somatic mutations in the murine sequence which enhance activity. Unusual residues that are predicted to affect bindig are retained, whereas residues predicted to be unimportant for binding can be substituted.

Additional candidates for substitution are non-germline residues occurring in an acceptor framework region. For example, when an acceptor antibody chain a human antibody chain sharing significant sequence identity with the donor antibody chain) is aligned to a germline antibody chain (likewise sharing significant sequence identity with the donor chain), residues not matching between acceptor chain framework and the gerxnline. chain framework can be substituted with corresponding residues from the germline sequence.

Other than the specific amino acid substitutions discussed above, the framework regions of humanized immunoglobulins are usually substantially identical, and more usually, identical to the framework regions of the human antibodies from which they were derived. Of course, many of the amino acids in the framework region make little or no direct contribution to the specificity or affinity of an antibody. Thus, many individual conservative substitutions of framework residues can be tolerated without appreciable change of the specificity or affinity of the resulting humanized inimunoglobulin. Thus, in one embodiment the variable framework region of the humanized immunoglobulin shares at least 85% sequence identity to a human variable framework region sequence or consensus of such sequences. In another embodiment, 0 the variable framework region of the humanized immunoglobulin shares at least o preferably 95%, more preferably 96%, 97%, 98% or 99% sequence identity to a human 0 variable framework region sequence or consensus of such sequences. In general, C- 5 however, such substitutions are undesirable.

The humanized antibodies preferably exhibit a:specific binding affinity 0 for antigen of at least 107, 10O 109or 1010 M. Usually the upper limit of binding Saffinity of the humanized antibodies for antigen is within a factor of three, four or five of that of the donor immunoglobulin. Often the lower limit of binding affinity is also 10 within a factor of three, four or five of that of donor immunoglobulin. Alternatively, the cN binding affinity can be compared to that of a humanized antibody having no substitutions an antibody having donor CDRs and acceptor FRs, but no FR substitutions). In such instances, the binding of the optimized antibody (with substitutions) is preferably at least two- to three-fold greater, or three- to four-fold greater, than that of the unsubstituted antibody. For making comparisons, activity of the various antibodies can be determined, for example, by BIACORE surface plasmon resonance using unlabelled reagents) or competitive binding assays.

C. Production of Humanized 3D6 Antibodies A preferred embodiment of the present invention features a humanized antibody to the N-terminus of AP, in particular, for use in the therapeutic and/or diagnostic methodologies described herein. A particularly preferred starting material for production of humanized antibodies is 3D6. 3D6 is specific for the N-terminus of AP and has been shown to mediate phagocytosis induce phagocytosis) of amyloid plaque (see Examples The cloning and sequencing of cDNA encoding the 3D6 antibody heavy and light chain variable regions is described in Example VI.

Suitable human acceptor antibody sequences are identified by computer comparisons of the amino acid sequences of the mouse variable regions with the sequences of known human antibodies. The comparison is performed separately for heavy and light chains but the principles are similar for each. In particular, variable domains from human antibodies whose framework sequences exhibit a high degree of sequence identity with the murine VL and VH framework regions were identified by query of the Kabat Database using NCBI BLAST (publicly accessible through the National Institutes of Health NCBI internet server) with the respective murine ofamework sequences. In one embodiment, acceptor sequences sharing greater that 0 sequence identity with murine donor sequences are selected. Preferably, acceptor cI 5 antibody sequences sharing 60%, 70%, 80%, 90% or more are selected.

A computer comparison of 3D6 revealed that the 3D6 light chain shows 00 M the greatest sequence identity to human light chains of subtype kappa II, and that the 3D6 heavy chain shows greatest sequence identity to human heavy chains of subtype MI, c-I as defined by Kabat et al., supra. Thus, light and heavy human framework regions are 0 10 preferably derived from human antibodies of these subtypes, or from consensus c-I sequences of such subtypes. The preferred light chain human variable regions showing greatest sequence identity to the corresponding region from 3D6 are from antibodies having Kabat ID Numbers 019230, 005131, 005058, 005057, 005059, U21040 and U41645, with 019230 being more preferred. The preferred heavy chain human variable regions showing greatest sequence identity to the corresponding region from 3D6 are from antibodies having Kabat ID Numbers 045919, 000459, 000553, 000386 and M23691, with 045919 being more preferred.

Residues are next selected for substitution, as follows. When an amino acid differs between a 3D6 variable fr-amework region and an equivalent human variable framework region, the human framework amino acid should usually be substituted by the equivalent mouse amino acid if it is reasonably expected that the amino acid: noncovalently binds antigen directly, is adjacent to a CDR region, is part of a CDR region under the alternative definition proposed by Chothia et al., supra, or otherwise interacts with a CDR region is within about 3A of a CDR region) amino acids at positions L2, H49 and H94 of 3D6), or participates in the VL-VH interface amino acids at positions L36, L46 and H193 of 3D6).

Computer modeling of the 3D6 antibody heavy and light chain variable regions, and humanization of the 3D6 antibody is described in Example VII. Briefly, a three-dimensional model was generated based on the closest solved murine antibody structures for the heavy and light chamns. For this purpose, an antibody designated 1 CR9 (Protein Data Bank (PDB) ID: 1CR9, Kanyo et J Mol. Biol. 293:855 (1999)) was chosen as a template for modeling the 3D6 light chain, and an antibody designated I OPG (PDB ID: lOPG, Kodandapani et al., J Biol. Chem. 270:2268 (1995)) was 0 chosen as the template for modeling the heavy chain. The model was further refined by N 5 a series of energy minimization steps to relieve unfavorable atomic contacts and Soptimize electrostatic and van der Walls interactions. The solved structure of Iqkz S(PDB ID: IQKZ, Derrick et al., J. Mol. Biol. 293:81 (1999)) was chosen as a template Sfor modeling CDR3 of the heavy chain as 3D6 and 1OPG did not exhibit significant sequence homology in this region when aligned for comparison purposes.

10 Three-dimensional structural information for the antibodies described CN herein is publicly available, for example, from the Research Collaboratory for Structural- Bioinformatics' Protein Data Bank (PDB). The PDB is freely accessible via the World Wide Web internet and is described by Berman et al. (2000) Nucleic Acids Research, 28:235. Computer modeling allows for the identification of CDR-interacting residues.

The computer model of the structure of 3D6 can in turn serve as a starting point for predicting the three-dimensional structure of an antibody containing the 3D6 complementarity determining regions substituted in human framework structures.

Additional models can be constructed representing the structure as further amino acid substitutions are introduced.

In general, substitution of one, most or all of the amino acids fulfilling the above criteria is desirable. Accordingly, the humanized antibodies of the present invention will usually contain a substitution of a human light chain framework residue with a corresponding 3D6 residue in at least 1, 2 or 3, and more usually 4, of the following positions: L1, L2, L36 and L46. The humanized antibodies also usually contain a substitution of a human heavy chain framework residue with a corresponding 3D6 residue in at least 1, 2, and sometimes 3, of the following positions: H49, H93 and H94. Humanized antibodies can also contain a substitution of a heavy chain framework residue with a corresponding germline residue in at least 1, 2, and sometimes 3, of the following positions: H74, H77 and H89.

Occasionally, however, there is some ambiguity about whether a particular amino acid meets the above criteria, and alternative variant immunoglobulins are produced, one of which has that particular substitution, the other of which does not.

r- In instances where substitution with a murine residue would introduce a residue that is 0 0 rare in human immunoglobulins at a particular position, it may be desirable to test the antibody for activity with or without the particular substitution. If activity binding 0 affinity and/or binding specificity) is about the same with or without the substitution, the Ni 5 antibody without substitution may be preferred, as it would be expected to elicit less of a HAHA response, as described herein.

00 Other candidates for substitution are acceptor human framework amino _acids that are unusual for a human immunoglobulin at that position. These amino acids c",1 can be substituted with amino acids from the equivalent position of more typical human immunoglobulins. Alternatively, amino acids from equivalent positions in the mouse c",1 3D6 can be introduced into the human framework regions when such amino acids are typical of human immunoglobulin at the equivalent positions.

In additional embodiments, when the human light chain framework acceptor immunoglobulin is Kabat ID Number 019230, the light chain contains substitutions in at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 or more usually 13, of the following positions: L7, L10, L12, L15, L17, L39, L45, L63, L78, L83, L85, L100 or L104. In additional embodiments when the human heavy chain framework acceptor immunoglobulin is Kabat ID Number 045919, the heavy chain contains substitutions in at least 1, 2, 3, 4, 5, 6,7, 8, 9, 10, 11, 12, 13, 14, or more usually 15, of the following positions: H3, H5, H13, H16, H19, H40, H41, H42, H44, H72, H77, H82A, H83, H84, or H108. These positions are substituted with the amino acid from the equivalent position of a human immunoglobulin having a more typical amino acid residue.

Examples of appropriate amino acids to substitute are shown in Figures 1 and 2.

Other candidates for substitution are non-germline residues occurring in a framework region. A computer comparison of 3D6 with known germline sequences revealed that heavy chains showing the greatest degree of sequence identity include germline variable region sequences VH3-48, VH3-23, VH3-7, VH3-21 and VH3-1 1, with VH3-23 being more preferred. Alignment of Kabat ID 045919 with VH3-23 reveals that residues H74, H77 and/or H89 may be selected for substitution with corresponding germline residues residues H74, H77 and/or H89 when comparing Kabat ID 045919 and VH3-23). Likewise, germline sequences having the greatest degree of identity to the 3D6 light chain include Al, A17, Al8, A2 and A19, with A19 being most preferred. Residues not matching between a selected light chain acceptor 0 framework and one of these germline sequences could be selected for substitution with the corresponding gernline residue.

O Table 1 summarizes the sequence analysis of the 3D6 VH and VL regions. Additional mouse and human structures that can be used for computer modeling of the 3D6 antibody and additional human antibodies are set forth as well as 0 germline sequences that can be used in selecting amino acid substitutions. Rare mouse N residues are also set forth in Table 1. Rare mouse residues are identified by comparing the donor VL and/or VH sequences with the sequences of other members of the subgroup to which the donor VL and/or VH sequences belong (according to Kabat) and identifying the residue positions which differ from the consensus. These donor specific differences may point to somatic mutations which enhance activity. Unusual or rare residues close to the binding site may possibly contact the antigen, making it desirable to retain the mouse residue. However, if the unusual mouse residue is not important for binding, use of the corresponding acceptor residue is preferred as the mouse residue may create immunogenic neoepitopes in the humanized antibody. In the situation where an unusual residue in the donor sequence is actually a common residues in the corresponding acceptor sequence, the preferred residue is clearly the acceptor residue.

Table 1: Summary of 3D6 V-region sequence Human Subgroup Chotia canonical CDR groupings [pdb Closest solved-mouse structures Closest solved human structures Germine query (Hu) results (top 4) M (000488-00491, 000503, 000624) HI: class 1 [2bj H12: class 3 [1ligc] PDB ID: I PG Ko-dandapani et a., supra, (72% 2A) IVH nmr) 443560 IgG, myeloma, 1 .8A) KOL/2FB4H myeloma, 3A) VH3-48 (45 12283/BAA75032.1) Vff3-23 (45 12287/BAA75046. 1) VH3-7 (45 12300/BAA75056. 1) VH3-21 (45 12287fB3AA75047.1) K91O6A (0.295%/o) 11(005046) Li: class 4 [lrmf] L2: classi [llmk] L3: class I [itet] PDB ID: I CR9; Kanyo et!. supra 2A) upa PDB ID: INLD; Davies et A4cta ystailOgr. D. Biol Crystallog. 53: 18 6 (1997); 2.8A) I LVE (57/a, LWN I1B6DA B-J dimer, 2.8A); I VOEL autoAb) AI(x63402) A 17 (x63403) A 18 (X63396) A2 (m3 1952) LVH-1 (4152300tBAA75053l1) A19 (x63397) *heavy chain and light chain from the same antibody (0-8 1, Hirabayashi et a. NAR 20:2601i).

Kabat ID sequences referenced herein are publicly available, for example, from the Northwestern. University Biomedical Engineering Department's Kabat Database of Sequences of Proteins of Immunological Interest. Three-dimnsional structural information for antibodies described herein is publicly available, for example, from the Research Collaboratory for Structural Bioinformatics' Protein Data Bank (PDB). The PDB is freely accessible via the World Wide Web internet and is described by Berman et al. (2000) Nucleic Acids Research, p235-242. (ierniline gene sequences referenced herein are publicly available, for example, from the National Center for Biotechnology Information (NCBI) database of sequences in collections of Igb, Ig kappa and Ig lambda gerilne V genes (as a division of th National Library of Medicine (NLM) at the National Institutes of Health Homology searching of the NCBI "Ig Gennline Genes" database is provided by IgG BLASTIm.

In a preferred embodiment, a humanized antibody of the present invention contains a light chain comprising a variable domain comprising murine 3D6 VL CDRs and a human acceptor framework, the framework having at least one, o) preferably two, three or four residues selected from the group consisting ofL L2, L36, ci 5 and L46 substituted with the corresponding 3D6 residue and (ii) a heavy chain.

comprising 3D6 VII CDRs and a human acceptor framework, the framework having at 00 l ato e r f r b y t o o h e ei u ssl c e r mt eg o p c ni tn f H 9 lesMnpeeal w rtrersde eetdfo h ru ossigo 19 IND H93 and H94 substituted with the corresponding 3D6 residue, and, optionally, at least c-i one, preferably two or three residues selected from the group consisting of H74, 1177 S 10 and H89 is substituted with a corresponding human germline residue..

c-I In a more preferred embodiment, a humanized antibody of the present invention contains a light chain comprising a variable domain comprising murine 3D6 VL CDRs and a human acceptor fr-amework, the framework having residue 1 substituted with a tyr residue 2 substituted with a val residue 36 substituted with a leu and/or residue 46 substituted with an arg and (ii) a heavy chain comprising 3136 VH CDRs and a human acceptor framework, the framework having residue 49 substituted with an ala residue 93 substituted with a val and/or residue 94 substituted with an arg and, optionally, having residue 74 substituted with a ser residue 77 substituted with a dir and/or residue 89 substituted with a val In a particularly preferred embodiment, a humanized antibody of the present invention has structural features, as described herein, and fRther has at least one (preferably two, three, four or all) of the following activities: binds aggregated AP I 42 as determined by ELISA); binds AP3 in plaques staining of Al) and/or PDAPP plaques); binds AP3 with two- to three- fold higher binding affinity as compared to chimeric 3D6 3D6 having murine CDRs and human acceptor FRs); mediates phagocytosis of AP in an ex vivo phagocytosis assay, as described herein); and crosses the blood-brain barrier demonstrates short-term brain localization, for example, in a PDAPP animal model, as described herein).

In another embodiment, a humanized antibody of the present invention has structural features, as described herein, binds AP3 in a manner or with an affinity sufficient to elicit at least one of the following in vivo effects: reduce APi plaque burden;'(2) prevent plaque formation; reduce levels of soluble Ap; reduce the C neuritic pathology associated with an amyloidogenic disorder; lessens or ameliorate 0 at least one physiological symptom associated with an amyloidogenic disorder; and/or 0 improves cognitive function.

N 5 In another embodiment, a humanized antibody of the present invention has structural features, as described herein, and specifically binds to an epitope 00 00 comprising residues 1-5 or 3-7 of Ap.

\0 ¢C 3. Human Antibodies 0 10 Human antibodies against AP are provided by a variety of techniques Nc- described below. Some human antibodies are selected by competitive binding experiments, or otherwise, to have the same epitope specificity as a particular mouse antibody, such as one of the mouse monoclonals described herein. Human antibodies can also be screened for a particular epitope specificity by using only a fragment of AP as the immunogen, and/or by screening antibodies against a collection of deletion mutants of Ap. Human antibodies preferably have human IgGI isotype specificity.

a. Trioma Methodology The basic approach and an exemplary cell fusion partner, SPAZ-4, for use in this approach have been described by Oestberg et al., Hybridoma 2:361 (1983); Oestberg, US Patent No. 4,634,664; and Engleman et al., US Patent 4,634,666 (each of which is incorporated by reference in its entirety for all purposes). The antibodyproducing cell lines obtained by this method are called triomas, because they are descended from three cells; two human and one mouse. Initially, a mouse myeloma line is fused with a human B-lymphocyte to obtaina non-antibody-producing xenogeneic hybrid cell, such as the SPAZ-4 cell line described by Oestberg, supra. The xenogeneic cell is then fused with an immunized human B-lymphocyte to obtain an antibodyproducing trioma cell line. Triomas have been found to produce antibody more stably than ordinary hybridomas made from human cells.

The immunized B-lymphocytes are obtained from the blood, spleen, lymph nodes or bone marrow of a human donor. If antibodies against a specific antigen or epitope are desired, it is preferable to use that antigen or epitope thereof for immunization. Immunization can be either in vivo or in vitro. For in vivo immunization, B cells are typically isolated from a human immunized with AJ, a fragment thereof, larger polypeptide containing Ap or fragment, or an anti-idiotypic antibody to an 0 antibody to Ap. In some methods, B cells are isolated from the same patient who is 0 ultimately to be administered antibody therapy. For in vitro immunization, B- 5 lymphocytes are typically exposed to antigen for a period of 7-14 days in a media such as RPMI-1640-(see Engleman, supra) supplemented with 10% human plasma.

00 M The immunized B-lymphocytes are fused to a xenogeneic hybrid cell such as SPAZ-4 by well-known methods. For example, the cells are treated with N 50% polyethylene glycol of MW 1000-4000, at about 37 degrees C, for about 5-10 min.

Cells are separated from the fusion nixture and propagated in media selective for the desired hybrids HAT or AH). Clones secreting antibodies having the required binding specificity are identified by assaying the trioma culture medium for the ability to bind to Ap or a fragment thereof. Triomas producing human antibodies having the desired specificity are subcloned by the limiting dilution technique and grown in vitro in culture medium. The trioma cell lines obtained are then tested for the ability to bind Ap or a fragment thereof.

Although triomas are genetically stable they do not produce antibodies at very high levels. Expression levels can be increased by cloning antibody genes from the trioma into one or more expression vectors, and transforming the vector into standard mammalian, bacterial or yeast cell lines.

b. Transgenic Non-Human Mammals Human antibodies against Ap can also be produced from non-human transgenic mammals having transgenes encoding at least a segment of the human immunoglobulin locus. Usually, the endogenous immunoglobulin locus of such transgenic mammals is functionally inactivated. Preferably, the segment of the human immunoglobulin locus includes unrearranged sequences of heavy and light chain components. Both inactivation of endogenous immunoglobulin genes and introduction of exogenous immunoglobulin genes can be achieved by targeted homologous recombination, or by introduction of YAC chromosomes. The transgenic mammals resulting from this process are capable of functionally rearranging the immunoglobulin component sequences, and expressing a repertoire of antibodies of various isotypes encoded by human immunoglobulin genes, without expressing endogenous immunoglobulin genes. The production and properties of mammals having these properties are described in detail by, Lonberg et al., W093/12227 (1993); US O 5,877,397, US 5,874,299, US 5,814,318, US 5,789,650, US 5,770,429, US 5,661,016, S 5 US 5,633,425, US 5,625,126, US 5,569,825, US 5,545,806, Nature 148:1547 (1994), Nature Biotechnology 14:826 (1996), Kucherlapati, WO 91/10741 (1991) (each of OC which is incorporated by reference in its entirety for all purposes). Transgenic mice are N particularly suitable. Anti-AP antibodies are obtained by immunizing a transgenic c- nonhuman mammal, such as described by Lonberg or Kucherlapati, supra, with Ap or a 10 fragment thereof. Monoclonal antibodies are prepared by, fusing B-cells from such C1N mammals to suitable myeloma cell lines using conventional Kohler-Milstein technology.

Human polyclonal antibodies can also be provided in the form of serum from humans immunized with an immunogenic agent. Optionally, such polyclonal antibodies can be concentrated by affinity purification using Ap or other amyloid peptide as an affinity reagent.

c. Phage Display Methods A further approach for obtaining human anti-Ap antibodies is to screen a DNA library from human B cells according to the general protocol outlined by Huse et al., Science 246:1275-1281 (1989). As described for trioma methodology, such B cells can be obtained from a human immunized with Ap, fragments, longer polypeptides containing AP or fragments or anti-idiotypic antibodies. Optionally, such B cells are obtained from a patient who is ultimately to receive antibody treatment. Antibodies binding to Ap or a fragment thereof are selected. Sequences encoding such antibodies (or a binding fragments) are then cloned and amplified. The protocol described by Huse is rendered more efficient in combination with phage-display technology. See, e.g., Dower et al., WO 91/17271, McCafferty et al., WO 92/01047, Herzig et al., US 5,877,218, Winter et al., US 5,871,907, Winter et al., US 5,858,657, Holliger et al., US 5,837,242, Johnson et al., US 5,733,743 and Hoogenboom et al., US 5,565,332 (each of which is incorporated by reference in its entirety for all purposes). In these methods, libraries of phage are produced in which members display different antibodies on their outer surfaces. Antibodies are usually displayed as Fv or Fab fragments. Phage displaying antibodies with a desired specificity are selected by affinity enrichment to an 0 Ap peptide or fragment thereof.

In a variation of the phage-display method, human antibodies having the 0 binding specificity of a selected murine antibody can be produced. See Winter, WO 92/20791. In this method, either the heavy or light chain variable region of the selected murine antibody is used as a starting material. If, for example, a light chain variable 0 region is selected as the starting material, a phage library is constructed in which I members display the same light chain variable region the murine starting material) and a different heavy chain variable region. The heavy chain variable regions are S 10 obtained from a library of rearranged human heavy chain variable regions. A phage showing strong specific binding for AP at least 108 and preferably at least 109 M') is selected. The human heavy chain variable region from this phage then serves as a starting material for constructing a further phage library. In this library, each phage displays the same heavy chain variable region the region identified from the first display library) and a different light chain variable region. The light chain variable regions are obtained from a library of rearranged human variable light chain regions.

Again, phage showing strong specific binding for Ap are selected. These phage display the variable regions of completely human anti-AP antibodies. These antibodies usually have the same or similar epitope specificity as the murine starting material.

4. Production of Variable Regions Having conceptually selected the CDR and framework components of humanized immunoglobulins, a variety of methods are available for producing such immunoglobulins. Because of the degeneracy of the code, a variety of nucleic acid sequences will encode each immunoglobulin amino acid sequence. The desired nucleic acid sequences can be produced by e novo solid-phase DNA synthesis or by PCR mutagenesis of an earlier prepared variant of the desired polynucleotide.

Oligonucleotide-mediated mutagenesis is a preferred method for preparing substitution, deletion and insertion variants of target polypeptide DNA. See Adelman et al., DNA 2:183 (1983). Briefly, the target polypeptide DNA is altered by hybridizing an oligonucleotide encoding the desired mutation to a single-stranded DNA template. After hybridization, a DNA polymerase is used to synthesize an entire second'complementary strand of the template that incorporates the oligonucleotide primer, and encodes the selected alteration in the target polypeptide

DNA.

0 5. Selection of Constant Regions The variable segments of antibodies produced as described supra the heavy and light chain variable regions of chimeric, humanized, or human antibodies) 00 are typically linked to at least a portion of an immunoglobulin constant region (Fc), IN typically that of a human immunoglobulin. Human constant region DNA sequences can be isolated in accordance with well known procedures from a variety of human cells, but preferably immortalized B cells (see Kabat et al., supra, and Liu et al., W087/02671) (each of which is incorporated by reference in its entirety for all purposes). Ordinarily, the antibody will contain both light chain and heavy chain constant regions. The heavy chain constant region usually includes CHI, hinge, CH2, CH3, and CH4 regions. The antibodies described herein include antibodies having all types of constant regions, including IgM, IgG, IgD, IgA and IgE, and any isotype, including IgGl, IgG2, IgG3 and IgG4. The choice of constant region depends, in part, whether antibody-dependent complement and/or cellular mediated toxicity is desired. For example, isotopes IgGl and IgG3 have complement activity and isotypes IgG2 and IgG4 do not. When it is desired that the antibody humanized antibody) exhibit cytotoxic activity, the constant domain is usually a complement fixing constant domain and the class is typically IgGI. When such cytotoxic activity is not desirable, the constant domain may be of the IgG2 class. Choice of isotype can also affect passage of antibody into the brain- Human isotype IgGI is preferred. Light chain constant regions can be lambda or kappa. The humanized antibody may comprise sequences from more than one class or isotype. Antibodies can be expressed as tetramers containing two light and two heavy chains, as separate heavy chains, light chains, as Fab, Fab' F(ab')2, and Fv, or as single chain antibodies in which heavy and light chain variable domains are linked through a spacer.

6. Expression ofRecombinant Antibodies SChimeric, humanized and human antibodies are typically produced by recombinant expression. Nucleic acids encoding humanized light and heavy chain O variable regions, optionally linked to constant regions, are inserted into expression vectors. The light and heavy chains can be cloned in the same or different expression vectors. The DNA segments encoding immunoglobulin chains are operably linked to 00 control sequences in the expression vector(s) that ensure the expression of Simmunoglobulin polypeptides. Expression control sequences include, but are not limited to, promoters naturally-associated or heterologous promoters), signal S 10 sequences, enhancer elements, and transcription termination sequences. Preferably, the 1 expression control sequences are eukaryotic promoter systems in vectors capable of transforming or transfecting eukaryotic host cells. Once the vector has been incorporated into the appropriate host, the host is maintained under conditions suitable for high level expression of the nucleotide sequences, and the collection and purification of the crossreacting antibodies.

These expression vectors are typically replicable in the host organisms either as episomes or as an integral part of the host chromosomal DNA. Commonly, expression vectors contain selection markers ampicillin-resistance, hygromycinresistance, tetracycline resistance or neomycin resistance) to permit detection of those cells transformed with the desired DNA sequences (see, Itakura et al., US Patent 4,704,362).

E. coli is one prokaryotic host particularly useful for cloning the polynucleotides DNA sequences) of the present invention. Other microbial hosts suitable for use include bacilli, such as Bacillus subtilus, and other enterobacteriaceae, such as Salmonella, Serratia, and various Pseudomonas species. In these prokaryotic hosts, one can also make expression vectors, which will typically contain expression control sequences compatible with the host cell an origin of replication). In addition, any number of a variety of well-known promoters will be present, such as the lactose promoter system, a tryptophan (trp) promoter system, a beta-lactamase promoter system, or a promoter system from phage lambda. The promoters will typically control expression, optionally with an operator sequence, and have ribosome binding site sequences and the like, for initiating and completing transcription and translation.

Other microbes, such as yeast, are also useful for expression.

0 Saccharomyces is a preferred yeast host, with suitable vectors having expression control sequences ,promoters), an origin of replication, termination sequences and the like 0 as desired. Typical promoters include 3 -phosphoglycerate kinase and other glycolytic ,N 5 enzymes. Inducible yeast promoters include, among others, promoters from alcohol dehydrogenase, isocytochrome C, and enzymes responsible for maltose and galactose 00 utilization.

SIn addition to microorganisms, mammalian tissue cell culture may also be Sused to express and produce the polypeptides of the present invention polynucleotides encoding immunoglobulins or fragments thereof). See Winnacker, From Genes to Clones, VCH Publishers, N.Y. (1987). Eukaryotic cells are actually preferred, because a number of suitable host cell lines capable of secreting heterologous proteins intact immunoglobulins) have been developed in the art, and include CHO cell lines, various Cos cell lines, HeLa cells, preferably, myeloma cell lines, or transformed B-cells or hybridomas. Preferably, the cells are nonhuman.

Expression vectors for these cells can include expression control sequences, such as an origin of replication, a promoter, and an enhancer (Queen et al., Immunol. Rev. 89:49 (1986)), and necessary processing information sites, such as ribosome binding sites, RNA splice sites, polyadenylation sites, and transcriptional terminator sequences.

Preferred expression control sequences are promoters derived from immunoglobulin genes, SV40, adenovirus, bovine papilloma virus, cytomegalovirus and the like. See Co et al., J Immunol. 148:1149 (1992).

Alternatively, antibody-coding sequences can be incorporated in transgenes for introduction into the genome of a transgenic animal and subsequent expression in the milk of the transgenic animal (see, Deboer et al., US 5,741,957, Rosen, US 5,304,489, and Meade et al., US 5,849,992). Suitable transgenes include coding sequences for light and/or heavy chains in operable linkage with a promoter and enhancer from a mammary gland specific gene, such as casein or beta lactoglobulin.

The vectors containing the polynucleotide sequences of interest the heavy and light chain encoding sequences and expression control sequences) can be transferred into the host cell by well-known methods, which vary depending on the type of cellular host. For example, calcium chloride transfection is commonly utilized for prokaryotic cells, whereas calcium phosphate treatment, electroporation, lipofection, O biolistics or viral-based transfection may be used for other cellular hosts. (See generally Sambrook et al., Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Press, O 2nd ed., 1989) (incorporated by reference in its entirety for all purposes). Other methods S 5 used to transform mammalian cells include the use ofpolybrene, protoplast fusion, liposomes, electroporation, and microinjection (see generally, Sambrook et al., supra).

SFor production of transgenic animals, transgenes can be microinjected into fertilized Soocytes, or can be incorporated into the genome of embryonic stem cells, and the nuclei of such cells transferred into enucleated oocytes.

10 When heavy and light chains are cloned on separate expression vectors, the vectors are co-transfected to obtain expression and assembly of intact immunoglobulins. Once expressed, the whole antibodies, their dimers, individual light and heavy chains, or other immunoglobulin forms of the present invention can be purified according to standard procedures of the art, including ammonium sulfate precipitation, affinity columns, column chromatography, HPLC purification, gel electrophoresis and the like (see generally Scopes, Protein Purification (Springer-Verlag, (1982)). Substantially pure immunoglobulins of at least about 90 to homogeneity are preferred, and 98 to 99% or more homogeneity most preferred, for pharmaceutical uses.

7. Antibody Fragments Also contemplated within the scope of the instant invention are antibody fragments. In one embodiment, fragments of non-human, chimeric and/or human antibodies are provided. In another embodiment, fragments of humanized antibodies are provided. Typically, these fragments exhibit specific binding to antigen with an affinity of at least 107, and more typically 10' or 109 Humanized antibody fragments include separate heavy chains, light chains Fab, Fab' F(ab')2, Fabc, and Fv. Fragments are produced by recombinant DNA techniques, or by enzymatic or chemical separation of intact immunoglobulins.

8. Testing Antibodies for Therapeutic Efficacy in Animal Models Groups of 7-9 month old PDAPP mice each are injected with 0.5 mg in PBS ofpolyclonal anti-A3 or specific anti-Ap monoclonal antibodies. All antibody preparations are purified to have low endotoxin levels. Monoclonals can be prepared S 5 against a fragment by injecting the fragment or longer form of Ap into a mouse, preparing hybridomas and screening the hybridomas for an antibody that specifically 00 M binds to a desired fragment of Ap without binding to other nonoverlapping fragments of

AD.

Mice are injected intraperitoneally as needed over a 4 month period to S 10 maintain a circulating antibody concentration measured by ELISA titer of greater than C1 1/1000 defined by ELISA to Ap42 or other immunogen. Titers are monitored and mice are euthanized at the end of 6 months of injections. Histochemistry, Ap levels and toxicology are performed post mortem. Ten mice are used per group.

9. ScreeningAntibodies for Clearing Activity The invention also provides methods of screening an antibody for activity in clearing an amyloid deposit or any other antigen, or associated biological entity, for which clearing activity is desired. To screen for activity against an amyloid deposit, a tissue sample from a brain of a patient with Alzheimer's disease or an animal model having characteristic Alzheimer's pathology is contacted with phagocytic cells bearing an Fc receptor, such as microglial cells, and the antibody under test in a medium in vitro.

The phagocytic cells can be a primary culture or a cell line, such as BV-2, C8-B4, or THP-1. In some methods, the components are combined on a microscope slide to facilitate microscopic monitoring. In some methods, multiple reactions are performed in parallel in the wells of a microtiter dish. In such a format, a separate miniature microscope slide can be mounted in the separate wells, or a nonmicroscopic detection format, such as ELISA detection of Ap can be used. Preferably, a series of measurements is made of the amount of amyloid deposit in the in vitro reaction mixture, starting from a baseline value before the reaction has proceeded, and one or more test values during the reaction. The antigen can be detected by staining, for example, with a fluorescently labeled antibody to Ap or other component ofamyloid plaques. The antibody used for staining may or may not be the same as the antibody being tested for clearing activity. A reduction relativetAo baseline during the reaction of the amyloid deposits indicates that the antibody under test has clearing activity. Such antibodies are o likely to be useful in preventing or treating Alzheimer's and other amyloidogenic o diseases.

Analogous methods can be used to screen antibodies for activity in clearing other types of biological entities. The assay can be used to detect clearing 0C) activity against virtually any kind of biological entity. Typically, the-biological entity has some role in human or animal disease. The biological entity can be provided as a c-i tissue sample or in isolated form. If provided as a tissue sample, the tissue sample is C) 10 preferably unfixed to allow ready access to components of the tissue sample and to 0- avoid perturbing the conformation of the components incidental to fixing. Examples of tissue samples that can be tested in this assay include cancerous tissue, precancerous tissue, tissue containing benign growths such as warts or moles, tissue infected with pathogenic microorganisms, tissue infiltrated with inflammatory cells, tissue bearing pathological matrices between cells fibrinous pericarditis), tissue bearing aberrant antigens, and scar tissue. Examples of isolated biological entities that can be used include AP, viral antigens or viruses, proteoglycans, antigens of other pathogenic nicroorganisms, tumor antigens, and adhesion molecules. Such antigens can be obtained from natural sources, recombinant expression or chemical synthesis, among other means. The tissue sample or. isolated- biological entity is. contacted with phagocytic cells bearing Fc receptors, such as monocytes or microglial cells, and an antibody to be tested in a medium. The antibody can be directed to the biological entity under test or to an antigen associated with the entity. In the latter situation, the object is to test whether the biological entity is vicariously phagocytosed with the antigen.

Usually,,although not necessarily, the antibody and biological entity (sometimes with an associated antigen), are contacted with each other before adding the phagocytic cells.

The concentration of the biological entity and/or the associated antigen remaining in the medium, if present, is then monitored. A reduction in the amount or concentration of antigen or the associated biological entity in the medium indicates the antibody has a clearing response against the antigen and/or associated biological entity in conjunction with the phagocytic cells (see, e.g, Example

WV).

c, B. Nucleic Acid Encoding Immunologic and Therapeutic Agents SImmune responses against amyloid deposits can also be induced by 0 administration of nucleic acids encoding antibodies and their component chains used for N 5 passive immunization. Such nucleic acids can be DNA or RNA. A nucleic acid segment encoding an immunogen is typically linked to regulatory elements, such as a 00 00 promoter and enhancer, that allow expression of the DNA segment in the intended target Scells of a patient. For expression in blood cells, as is desirable for induction of an c. immune response, promoter and enhancer elements from light or heavy chain 10 immunoglobulin genes or the CMV major intermediate early promoter and enhancer are N suitable to direct expression. The linked regulatory elements and coding sequences are often cloned into a vector. For administration of double-chain antibodies, the two chains can be cloned in the same or separate vectors.

A number of viral vector systems are available including retroviral systems (see, Lawrie and Tumin, Cur. Opin. Genet. Develop. 3:102-109 (1993)); adenoviral vectors (see, Bett et al., J Virol. 67:5911 (1993)); adeno-associated virus vectors (see, Zhou et al., J. Exp. Med 179:1867 (1994)), viral vectors from the pox family including vaccinia virus and the avian pox viruses, viral vectors from the alpha virus genus such as those derived from Sindbis and Semliki Forest Viruses (see, Dubensky et al., J. Virol. 70:508 (1996)), Venezuelan equine encephalitis virus (see Johnston et al., US 5,643,576) and rhabdoviruses, such as vesicular stomatitis virus (see Rose, WO 9 6 /34625)and papillomaviruses (Ohe et al., Human Gene Therapy 6:325 (1995); Woo et al., WO 94/12629 and Xiao Brandsma, Nucleic Acids. Res. 24, 2630- 2622 (1996)).

DNA encoding an immunogen, or a vector containing the same, can be packaged into liposomes. Suitable lipids and related analogs are described by Eppstein et al., US 5,208,036, Felgner et al., US 5,264,618, Rose, US 5,279,833, and Epand et al., US 5,283,185. Vectors and DNA encoding an immunogen can also be adsorbed to or associated with particulate carriers, examples of which include polymethyl methacrylate polymers and polylactides and poly (lactide-co-glycolides), see, McGee et al., J.

Micro Encap. (1996).

Gene therapy vectors or naked polypeptides DNA) can be delivered Sin vivo by administration to an individual patient, typically by systemic administration intravenous, intraperitoneal, nasal, gastric, intradermal, intramuscular, subdermal, O or intracranial infusion) or topical application (see Anderson et al., US 5,399,346).

,I 5 The term "naked polynucleotide" refers to a polynucleotide not complexed with colloidal materials. Naked polynucleotides are sometimes cloned in a plasmid vector.

00 Such vectors can further include facilitating agents such as bupivacine (Attardo et al., SUS 5,593,970). DNA can also be administered using a gene gun. See Xiao Brandsma, supra. The DNA encoding an immunogen is precipitated onto the surface of microscopic metal beads. The microprojectiles are accelerated with a shock wave or c, expanding helium gas, and penetrate tissues to a depth of several cell layers. For example, The Accel T Gene Delivery Device manufactured by Agacetus, Inc. Middleton WI is suitable. Alternatively, naked DNA can pass through skin into the blood stream simply by spotting the DNA onto skin with chemical or mechanical irritation (see Howell et al., WO 95/05853).

In a further variation, vectors encoding immunogens can be delivered to cells ex vivo, such as cells explanted from an individual patient lymphocytes, bone marrow aspirates, tissue biopsy) or universal donor hematopoietic stem cells, followed by reimplantation of the cells into a patient, usually after selection for cells which have incorporated the vector.

II. Prophylactic and Therapeutic Methods The present invention is directed inter alia to treatment of Alzheimer's and other amyloidogenic diseases by administration of therapeutic immunological reagents humanized immunoglobulins) to specific epitopes within AP to a patient under conditions that generate a beneficial therapeutic response in a patient induction ofphagocytosis of AP, reduction of plaque burden, inhibition of plaque formation, reduction of neuritic dystrophy, improving cognitive function, and/or reversing, treating or preventing cognitive decline) in the patient, for example, for the prevention or treatment of an amyloidogenic disease. The invention is also directed to use of the disclosed immunological reagents humanized immunoglobulins) in the manufacture of a medicament for the treatment or prevention of an amyloidogenic 0 disease.

OS The term "treatment" as used herein, is defined as the application or O administration of a therapeutic agent to a patient, or application or administration of a S 5 therapeutic agent to an isolated tissue or cell line from a patient, who has a disease, a symptom of disease or a predisposition toward a disease, with the purpose to cure, heal, 00 alleviate, relieve, alter, remedy, ameliorate, improve or affect the disease, the symptoms of disease or the predisposition toward disease.

CN¢ In one aspect, the invention provides methods of preventing or treating a 0 10 disease associated with amyloid deposits of AP in the brain of a patient. Such diseases CN include Alzheimer's disease, Down's syndrome and cognitive impairment. The latter can occur with or without other characteristics of an amyloidogenic disease. Some methods of the invention entail administering an effective dosage of an antibody that specifically binds to a component of an amyloid deposit to the patient. Such methods are particularly useful for preventing or treating Alzheimer's disease in human patients.

Exemplary methods entail administering an effective dosage of an antibody that binds to AP. Preferred methods entail administering an effective dosage of an antibody that specifically binds to an epitope within residues 1-10 ofAp, for example, antibodies that specifically bind to an epitope within residues 1-3 of A, antibodies that specifically bind to an epitope within residues 1-4 of AP, antibodies that specifically bind to an epitope within residues 1-5 of Ap, antibodies that specifically bind to an epitope within residues 1-6 ofAp, antibodies that specifically bind to an epitope within residues 1-7 of AP, or antibodies that specifically bind to an epitope within residues 3-7 ofA3. In yet another aspect, the invention features administering antibodies that bind to an epitope comprising a free N-terminal residue of Ap. In yet another aspect, the invention features administering antibodies that bind to an epitope within residues of 1-10 of AB wherein residue 1 and/or residue 7 of Ap is aspartic acid. In yet another aspect, the invention features administering antibodies that specifically bind to AP peptide without binding to full-length amyloid precursor protein (APP). In yet another aspect, the isotype of the antibody is human IgGl.

In yet another aspect, the invention features administering antibodies that C) bind to an amyloid deposit in the patient and induce a clearing response against the anryloid deposit. For example, such a clearing response can be effected by Fc receptor 0 mediated phagocytosis.

Therapeutic agents of the invention are typically substantially pure from undesired contaminant. This means that an agent is typically at least about 50% w/w 00 (weight/weight) purity, as well as being substantially free from interfering proteins and IND contaminants. Sometimes the agents are at least about 80% w/w and, more preferably at least 90 or about 95% w/w purity. However, using conventional protein purification 10 techniques, homogeneous peptides of at least 99% wfw can be obtained.

The methods can be used on both asymptomatic patients and those currently showing symptoms of disease. The antibodies used in such methods can be human, humanized, chimeric or nonhuman antibodies, or fragments thereof antigen binding fragments) and can be monoclonal or polyclonal, as described herein. In yet another aspect, the invention features administering antibodies prepared from a human immunized with AP peptide, which human can be the patient to be treated with antibody.

In another aspect, the invention features administering an antibody with a pharmaceutical carrier as a pharmaceutical composition. Alternatively, the antibody can be administered to a patient by administering a polynucleotide encoding at least one antibody chain. The polynucleotide is expressed to produce the antibody chain in the -patient. Optionally, the polynucleotide encodes heavy and light chains of the antibody.

The polynucleotide is expressed to produce the heavy and light chains in the patient. In exemplary embodiments, the patient is monitored for level of administered antibody in the blood of the patient The invention thus fulfills a longstanding need for therapeutic regimes for preventing or ameliorating the neuropathology and, in some patients, the cognitive impairment associated with Alzheimer's disease.

A. Patients Amenable to Treatmnent 0 Patients amenable to treatment include individuals at risk of disease but not showing symptoms, as well as patients presently showing symptoms. In the case of 0 Alzheimer's disease, virtually anyone is at risk of suffering from Alzheimer's disease if he or she lives long enough. Therefore, the present methods can be administered prophylactically to the general population without the need for any assessment of the 0 0ri k o th su j c p a i n T h p r s n m e h d ar es e i l y u e u fo i n i i u l Miko h ujc ain h rsn ehd r seilyueu o niiul IND who have a known genetic risk of Alzheimer's disease. Such individuals include those having relatives who hav e experienced this. disease, and those whose risk Th determined S 10 by analysis of genetic or biochemical markers. Genetic markers of risk toward Alzheimer's disease include mutations in the APP gene, particularly mutations at position 717 and positions 670 and. 671 referred to as the Hardy and Swedish mutations respectively (see Hardy, supra): Other markers of risk are mutations in -the' presenilin genes, PSI and PS2, and ApoE4, family history of AD, hypercholesteroleniia or atherosclerosis. Individuals presently suffering from Alzheimer's disease can be recognized from characteristic dementia, as well as the presence of risk factors described above. In addition, a number of diagnostic tests are available for identify'ing individuals who have AD. These include measurement of CSF tau and Af342 levels. Elevated tau and decreased At342 levels signify the presence of AD. Individuals suffering from Alzheimer's disease can also be diagnosed by ADRDA criteria as discussed in the Examples section.

In asymptomatic patients, treatment can begin at any age 10, Usually, however, it is not necessary to begin treatment until a patient reaches 60 or 70. Treatment typically entails multiple dosages over a period of time.

Treatment can be monitored by assaying antibody levels over time. If the response falls, a booster dosage is indicated. In the case of potential Down's syndrome patients, treatment can begin antenatally by administering therapeutic agent to the mother or shortly after birth.

B. Treatment Regimes and Dosages SIn prophylactic applications, pharmaceutical compositions or medicaments are administered to a patient susceptible to, or otherwise at risk of, 0 Alzheimer's disease in an amount sufficient to eliminate or reduce the risk, lessen the cN 5. severity, or delay the outset of the disease, including biochemical, histologic and/or behavioral symptoms of the disease, its complications and intermediate pathological 0 phenotypes presenting during development of the disease. In therapeutic applications, I compositions or medicants are administered to a patient suspected of, or already Ssuffering from such a disease in an amount sufficient to cure, or at least partially arrest, the symptoms of the disease (biochemical, histologic and/or behavioral), including its C. complications and intermediate pathological phenotypes in development of the disease.

In some methods, administration of agent reduces or eliminates myocognitive impairment in patients that have not yet developed characteristic Alzheimer's pathology. An amount adequate to accomplish therapeutic or prophylactic treatment is defined as a therapeutically- or prophylactically-effective dose. In both prophylactic and therapeutic regimes, agents are usually administered in several dosages until a sufficient immune response has been achieved. The term "immune response" or "immunological response" includes the development of a humoral (antibody mediated) and/or a cellular (mediated by antigen-specific T cells or their secretion products) response directed against an antigen in a recipient subject Such a response can be an active response, induced by administration ofimmunogen, or a passive response, induced by administration ofimmunoglobulin or antibody or primed T-cells.

An "immunogenic agent" or "immunogen" is capable of inducing an immunological response against itself on administration to a mammal, optionally in conjunction with an adjuvant. Typically, the immune response is monitored and repeated dosages are given if the immune response starts to wane.

Effective doses of the compositions of the present invention, for the treatment of the above described conditions vary depending upon many different factors, including means of administration, target site, physiological state of the patient, whether the patient is human or an animal, other medications administered, and whether treatment is prophylactic or therapeutic. Usually, the patient is a human but non-human mammals including transgenic mammals can also be treated. Treatment dosages need to be titrated to optimize safety and efficacy.

For passive immunization with an antibody, the dosage ranges from about 0 0.000 1 to 100 mg/kg, and more usually 0.0 1 to 5 mg/kg, of the host body weight For 5 example dosages can be 1 mg/kg body weight or 10 mg/kg body weight or within the range of 1-10-mg/kg, preferably at least 1 mg/kg. Subjects can be administered such 00 doses daily, on alternative days, weekly or according to an y other schedule determined by empirical analysis. An exemplary treatment entails administration in multiple dosages over a prolonged period, or example, of at least six months. Additional exemplary treatment regimes entail administration once per every two weeks or once a month or once every 3 to 6 months., Exemplary dosage schedules include 1-10 mg/kg or mg/kg on consecutive days, 30 mg/kg on alternate days or 60 mg/kg weekly. In some methods, two or more monoclonal, antibodies with different binding specificities are administered simultaneously, in which case the dosage of each antibody administered falls within the ranges indicated.

Antibody is usually administered on multiple occasions. Intervals between single dosages can be weekly, monthly or yearly. Intervals can also be irregular as indicated by measuring blood levels of antibody to AP in the patient. In some methods, dosage is adjusted to achieve a plasma antibody concentration of 1 -1000 itg/ml and in some methods 25-300 jig/ml., Alternatively, antibody can be administered as a sustained release formulation, in which case less frequent administration is required.

Dosage and frequency vary depending on the half-life of the antibody in the patient. In general, human antibodies show the longest half-life, followed by humanized antibodies, chimneric antibodies, and nonhuman antibodies.

The dosage and frequency of administration can vary depending on whether the treatment is prophylactic or therapeutic. In prophylactic applications, compositions containing the present antibodies or a cocktail thereof are administered to a patient not already in the disease state to enhance the patient's resistance. Such an amount is defined to be a "prophylactic effective dose." In this use, the precise amounts again depend upon the patient's state of health and general immunity, but generally range from 0. 1 to 25 mg per dose, especially 0.5 to 2.5 mg per dose. A relatively low r- dosage is administered at relatively infrequent intervals over a long period of time.

Some patients continue to receive treatment for the rest of their lives.

In therapeutic applications, a relatively high dosage from about 1 to 0 200 mg of antibody per dose, with dosages of from 5 to 25 mg being more commonly used) at relatively short intervals is sometimes required until progression of the disease is reduced or terminated, and preferably until the patient shows partial or complete 00amloainosyposodies.Teefeteptncabeamnseea amloainoMyposo ies.Teefeteptn a eamnsee INO prophylactic regime.

Doses for nucleic acids encoding antibodies range from about 10 ng to C) 10 1 g, 100 ng to 100 mng, 1 jig to 10 mg, or 3 0-3 00 jig DNA per patient. Doses for infectious viral vectors vary from 10- 100, or more, virions per dose.

Therapeutic agents can be administered by parenteral, topical, intravenous, oral, subcutaneous, intraarterial, intracranial, intraperitoneal, intranasal or intramuscular means for prophylactic and/or therapeutic treatment. The most typical route of administration of an immunogenic agent is subcutaneous although other routes can be equally effective. The next most common route is intramuscular injection. This type of injection is most typically performed in the arm or leg muscles. In some methods, agents are injected directly into a particular tissue where deposits have accumulated, for example intracranial injection. Intramuscular injection or intravenous infusion are preferred for administration of antibody. In some methods, particular therapeutic antibodies are injected directly into the cranium. In some methods, antibodies are administered as a sustained release composition or device, such as a Medipad

T

l m device.

Agents of the invention can optionally be administered in combination with other agents that are at least partly effective in treatment of amyloidogenic disease.

In the case of Alzheimer's and Down's syndrome, in which amyloid deposits occur in the brain, agents of the invention can also be administered in conjunction with other agents that increase passage of the agents of the invention across the blood-brain barrier.

C. Pharmaceutical. compositions Agents of the invention are often administered as pharmaceutical compositions comprising an active therapeutic agent and a variety of other 0 pharmaceutically acceptable components. See Remington's Pharmacetical Science ci 5 (1 5th ed., Mack Publishing Company, Easton, Pennsylvania (1980)). The preferred form depends on the intended mode of administration and therapeutic application. The 00 compositions can also include, depending on the formulation desired, pharmaceuticallyacceptable, non-toxic carriers or diluents, which are defined as vehicles commonly used c-i to formulate pharmaceutical compositions for animal or human administration. The S 10 diluent is selected so as not to affect the biological activity of the combination.

c-i Examples of such diluents; are distilled water, physiological phosphate-buffered saline, Ringer's solutions, dextrose solution, and Hanks solution. In addition, the pharmaceutical composition or formulation may also include other carriers, adjuvants, or nontoxic, nontherapeutic, nonimmunogenic stabilizers and the like.

Pharmaceutical'compositions can also include large, slowly metabolized macromolecules such as proteins, polysaccharides such as chitosan, polylactic acids, polyglycolic acids and copolymers (such as latex functionalized sepharose(TM), agarose, cellulose, and the like), polymeric amino acids, amino acid copolymers, and lipid aggregates (such as oil droplets or liposomes). Additionally, these carriers can function as inimunostimulating agents adjuvants).

For parenteral administration, agents of the invention can be administered as injectable dosages of a solution or suspension of the substance in a physiologically acceptable diluent with a pharmaceutical carrier that can be a sterile liquid such as water oils, saline, glycerol, or ethanol. Additionally, auxiliary substances, such as wetting or emulsifying agents, surfactants, pH buffering substances and the like can be present in compositions. Other components of pharmaceutical compositions are those of petroleum, animal, vegetable, or synthetic origin, for example, peanut oil, soybean oil, and mineral oil. In general, glycols such as propylene glycol or polyethylene glycol are preferred liquid carriers, particularly for injectable solutions. Antibodies can be admiinistered in the form of a depot injection or implant preparation, which can be formulated in such a manner as to permit a sustained release of the active ingredient. An exemplary composition comprises monoclonal antibody at 5 mg/mL, formulated in r aqueous buffer consisting of 50 mM L-histidine, 150 mM NaCI, adjusted to pH 6.0 with SHC1.

STypically, compositions are prepared as injectables, either as liquid O solutions or suspensions; solid forms suitable for solution in, or suspension in, liquid vehicles prior to injection can also be prepared. The preparation also can be emulsified or encapsulated in liposomes or micro particles such as polylactide, polyglycolide, or 00 copolymer for enhanced adjuvant effect, as discussed above (see Langer, Science 249: S1527 (1990) and Hanes, Advanced Drug Delivery Reviews 28:97 (1997)). The agents of C this invention can be administered in the form of a depot injection or implant preparation, which can be formulated in such a manner as to permit a sustained or pulsatile release of the active ingredient.

Additional formulations suitable for other modes of administration include oral, intranasal, and pulmonary formulations, suppositories, and transdermal applications. For suppositories, binders and carriers include, for example, polyalkylene glycols or triglycerides; such suppositories can be formed from mixtures containing the active ingredient in the range of 0.5% to 10%, preferably Oral formulations include excipients, such as pharmaceutical grades ofmannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, and magnesium carbonate. These compositions take the form of solutions, suspensions, tablets, pills, capsules, sustained release formulations or powders and contain 10%-95% of active ingredient, preferably 25%-70%.

Topical application can result in transdermal or intradermal delivery.

Topical administration can be facilitated by co-administration of the agent with cholera toxin or detoxified derivatives or subunits thereof or other similar bacterial toxins (See Glenn et al., Nature 391, 851 (1998)). Co-administration can be achieved by using the components as a mixture or as linked molecules obtained by chemical crosslinking or expression as a fusion protein.

Alternatively, transdermal delivery can be achieved using a skin path or using transferosomes (Paul etal., Eur. J Immunol. 25:3521 (1995); Cevc et al., Biochem. Biophys. Acta 1368:201-15 (1998)).

Il. Monitoringz the Course of Treatment The invention provides methods of monitoring treatment in a patient suffering from or susceptible to Aizheimer's, for monitoring a course of treatment o being administered to a patient. The methods can be used to monitor both therapeutic treatment on symptomatic. patients and prophylactic treatment on asymptomatic patients.

In particular, the methods are useful for monitoring passive immunization 00 measuring level of administered antibody).

IND Some methods entail. determining a baseline value, for example, of an antibody level or profile in a patient, before administering a dosage of agent, and 10 comparing this with a value for the profile or level after treatment A significant 0 ~increase (ite., greater than the typical margin of experimental error in repeat measurements of the same sample, expressed as one standard deviation from the mean of such measurements) in value of the level or profile signals a positive treatment outcome that administration of the agent has achieved a desired response). If the value for immune response does not change significantly, or decreases, a negative treatment outcome is indicated.

In other methods, a control value a mean and standard deviation) of level or profile is determined for a control population. Typically the individuals in the control population have not received prior treatment. Measured values of the level or profile in a patie 'nt after administering a therapeutic agent are then compared with the control value. A significant increase relative to the control value greater than one standard deviation from the mean) signals. a positive or. sufficient treatment outcome. A lack of significant increase or a decrease signals a negative or insufficient treatment outcome. Administration of agent is generally continued while the level is increasing relative to the control value. As before, attainment of a plateau relative to control values is an indicator that the administration of treatment can be discontinued or reduced in dosage and/or frequency.

In other methods, a control value of the level or profile a mean and standard deviation) is determined from a control population of individuals who have undergone treatment with a therapeutic agent and whose levels or profiles have plateaued in response to treatment. Measured values of levels or profiles in a patient are compared with the control value. If the measured level in a patient is not significantly different more than one standard deviation) from the conrol value, treatment can 0 be discontinued. If the level in a patient is significantly below the control value, continued administration of agent is warranted. If the level in the patient persists below 0 the control value, then a change in treatment may be indicated.

In other methods, a patient who is not presently receiving treatment but has undergone a previous, course of treatment is monitored for antibody levels or profiles 00 to determine whether a resumption of treatment is required. The measured level or profile in the patient can be compared with a value previously achieved in the patient after a previous course of treatment. A signifcant decrease relative to the previous 10 measurement greater than a typical margin of error in repeat 'measurements of the same sample) is an indication that treatment can be resumed. Alternatively, the value measured in a patient can be compared with a control value (mean plus standard deviation) determined in a population of patients after undergoing a course of treatment.

Alternatively, the measured value in a patient can be compared with a control value in populations of prophylactically treated patients who remain free of symptoms of disease, or populations of therapeutically treated patients who show amelioration of disease characteristics. In all of these cases, a significant decrease relative to the control level more than a standard deviation) is an indicator that treatment should be resumed in a patient.

The tissue sample for analysis is typically blood, plasma, serum, mucous fluid or cerebrospinal fluid from the patient. The sample is analyzed, for example, for levels or profiles of antibodies to Af) peptide, levels or profiles of humanized antibodies. ELISA methods of detecting antibodies specific to Aj3 are described in the Examples section. In some methods, the level or profile of an administered antibody is determined using a clearing assay, for example, in an in vitro phagocytosis assay, as described herein. In such methods, a tissue sample from a patient being tested is contacted with amyloid deposits from a PDAPP mouse) and phagocytic cells bearing Fc receptors. Subsequent clearing of the amyloid deposit is then monitored.

The existence and extent of clearing response provides an indication of the existence and level of antibodies effective to clear AD3 in the tissue sample of the patient under test.

The antibody profile following passive immunization typically shows an 0 immediate peak in antibody concentration followed by an exponential decay. Without a fuirther dosage, the decay approaches pretreatment levels within a period of days to o months depending on the half-life of the antibody administered. For example the halflife of some human antibodies is of the order of 20 days.

In some methods, a baseline measurement of antibody to AP3 in the 0 0 p t e t i a e b f r d i i t a i n e o d m a u e e t i a e s o h r a t r t painrsmdneoeamnsrtoascodmaueeti aeso hratrt determine the peak antibody level, and one or more fur-ther measurements are made at intervals to monitor decay of antibody levels. When the level of antibody has declined to baseline or a predetermined percentage of the peak less baseline 50%, 25% or administration of a further dosage of antibody is administered. In soine methods, peak or subsequent measured levels less background are compared with reference levels previously determined to constitute a beneficial prophylactic or therapeutic treatment regime in other patients. If the measured antibody level is significantly less tan a reference level less than the mean minus one standard deviation of the reference value in population of patients benefiting from treatment) administration of an additional dosage of antibody is indicated.

Additional methods include monitoring, over the course of treatment, any art-recognized physiologic symptom physical or mental symptom) routinely relied on by researchers or physicians to diagnose or monitor amyloidogenic diseases Alzheimner's disease). For example, one can monitor cognitive impairment. The latter is a symptom of Alzheimer's disease and Down's syndrome but can also occur without other characteristics of either of these diseases. For example, cognitive impairment can be monitored by determining a patient's score on the Mini-Mental State Exam in accordance with convention throughout the course of treatment.

C. Kits The invention fuirther provides kits for performing the monitoring methods described above. Typically, such kits contain an agent that specifically binds to antibodies to AP. The it can also include a label. For detection of antibodies to AP3, the label is typically in the form of labeled anti-idiotypic antibodies. For detection of antibodies, the agent can be supplied prebound to a solid phase, such as to the wells of a microtiter dish. Kits also typically contain labeling providing directions for use of the kit The labeling may also include a chart or other correspondence regime correlating levels of measured label with levels of antibodies to Af3. The term labeling refers to any 0 written or recorded material that is attached to, or otherwise accompanies a-kit at any 5 time during its manufacture, transport, sale or use. For example, the term labeling encompasses advertising leaflets and brochures, packaging materials, instructions, audio 00 or videocassettes, computer discs, as well as writing imprinted directly on kits.

IND The invention also provides diagnostic kits, for example, research, detection and/or diagnostic kits for performing in vivo imaging). Such kits typically contain an antibody for binding to an epitope of AP3, preferably within residues 0 1 -10. Preferably, the antibody is labeled or a secondary labeling reagent is included in the kit. Preferably, the kit is labeled with instructions for performing the intended application, for example, for performing an in vivo imaging assay. Exemplary antibodies are those described herein.

D. In vivo Imaging The invention provides methods of in vivo imaging aniyloid deposits in a patient. Such methods are useful to diagnose or confinn diagnosis of Alzheimer' s disease, or susceptibility thereto. For example, the methods can be used on a patient presenting with symptoms of dementia. If the patient has abnormal amyloid deposits, then the patient is likely suffering from Alzheimer's disease. The methods can also be used on asymptomatic patients. Presence of abnormal deposits of amyloid indicates susceptibility to future symptomatic disease. The methods are also useful for -monitoring disease progression and/or response to treatment in patients who have been previously diagnosed with Alzheimer's disease.

The methods work by administering a reagent such as antibody that binds to Afp, to the patient and then detecting the agent after it has bound. Preferred antibodies bind to AP3 deposits in a patient without binding to full length APP polypeptide.

Antibodies binding to an epitope of AP3 within amino acids 1 -10 are particularly preferred. In some methods, the antibody binds to an epitope within amino acids 7- 10 of AJ3. Such antibodies typically bind without inducing a substantial clearing response. In other methods, the antibody binds to an epitope within amino acids 1-7 of Ap. Such antibodies typically bind and induce a clearing response to Ap. However, the clearing 0 response can be avoided by using antibody fragments lacking a full-length constant Sregion, such as Fabs. In some methods, the same antibody can serve as both a treatment O and diagnostic reagent. In general, antibodies binding to epitopes C-terminal to residue N 5 10 of A do not show as strong a signal as antibodies binding to epitopes within residues 1-10, presumably because the C-terminal epitopes are inaccessible in amyloid deposits.

00 00 Accordingly, such antibodies are less preferred.

Diagnostic reagents can be administered by intravenous injection into the body of the patient, or directly into the brain by intracranial injection or by drilling a S 10 hole through the skull. The dosage of reagent should be within the same ranges as for C' treatment methods. Typically, the reagent is labeled, although in some methods, the primary reagent with affinity for A3 is unlabelled and a secondary labeling agent is used to bind to the primary reagent. The choice of label depends on the means of detection.

For example, a fluorescent label is suitable for optical detection. Use of paramagnetic labels is suitable for tomographic detection without surgical intervention. Radioactive labels can also be detected using PET or SPECT.

Diagnosis is performed by comparing the number, size, and/or intensity of labeled loci, to corresponding baseline values. The base line values can represent the mean levels in a population ofundiseased individuals. Baseline values can also represent previous levels determined in the same patient. For example, baseline values can be determined in a patient before beginning treatment, and measured values thereafter compared with the baseline values. A decrease in values relative to baseline signals a positive response to treatment.

The present invention will be more fully described by the following nonlimiting examples.

EXAMPLES

ExapleI.:TheapeticEfficacy of Anti-AD Antibodies: mAb 2H3, niAb o mAb.266. mAb 21F12 and pAb Af§-42 N- 5 This example tests the capacity of various monoclonal and polyclonal antibodies to A,8 to inhibit accumulation of AP3 in the brain of heterozygotic transgenic 00 mice.

A. Studyj Design C) 10 Sixty male and female, heterozygous PDAPP transgenic miice, 8.5 to 10.5 months of age were obtained from Charles River Laboratory. The mice were sorted into six groups to be treated with various antibodies directed to AP. Animals were distributed to match the gender, age, parentage and source of the animals withiin the groups as closely as possible. Table 2 depicts the Experimental design.

Table 2: Experimental Desin Treatment Traten Antibody r Antibody roup Antibody specificity stp 1 9 none NbN (PBS alone) NbN 2 10 Polyclonal A131-42 mixed 3 0 mAbd2143 AfPl-12 IgGI 4 8 mAb 10D5 AJ33-7 IgGI 6 mAb 266 Af313-28 IgGi 6 8 mAb 21F12 A4333-42 IgG2a a. Number of mice in group at terminiation of the experiment. All groups started with 10 animals per group.

b. NA: not applicable c. mouse polyclonal: anti-aggregated A1342 d. mAb: monoclonal antibody As shown in Table 2, the antibodies included four murine AP3-specific monoclonal antibodies, 2H13 (directed to A3 residues 1-12), 1OD5 (directed to A3 o residues 266 (directed to A3 residues 13-28 and binds to soluble but not to aggregated AN1792), 21F12 (directed to AP residues 33-42). A fifth group was treated 5 with an AB3-specific polyclonal antibody fraction (raised by immunization with 00 aggregated AN1792). The negative control group received the diluent, PBS, alone M without antibody.

B. Monitoring the Course of Treatment p 10 The monoclonal antibodies were injected at a dose of about 10 mg/kg (assuming that the mice weighed 50 Antibody titers were monitored over the 28 weeks of treatment. Injections were administered intraperitoneally every seven days on average to maintain anti-AP3 titers above 1000. Although lower titers were measured for mAb 266 since it does not bind well to the aggregated AN1792 used as the capture antigen in the assay, the same dosing schedule was maintained for this group. The group receiving monoclonal antibody 2H3 was discontinued within the first three weeks since the antibody was cleared too rapidly in vivo.

For determination of antibody titers, a subset of three randomly chosen mice from each group were bled just prior to each intraperitoneal inoculation, for a total of 30 bleeds. Antibody titers were measured as AP 1-42-binding antibody using a sandwich ELISA with plastic multi-well plates coated with A3 1-42 as described in detail in the General Materials and Methods. Mean titers for each bleed are set forth in Table 3 for the polyclonal antibody and the monoclonals 1OD5 and 21F12.

Table 3: weeks 21F12 weeks I1D5 weeks poly poly 21F12 10D5 0.15 500 0.15 3000 0.15 1600 800 0.5 14000 0.5 4000 1 2500 1 5000 1 4500 1800 1.1 5000 1.5 3000 2 1400 1.2 1300 2 1300 3 6000 2 3000 3 1600 550 3 4000 3.5 650 4 1600 3.5 500 4 1300 925 4 2400 5 450 6 3300 5 925 6 2100 7 4000 6 1700 7 1300 8 1400 7 1600 8 2300 9 1900 8 4000 9 700 1700 9 1800 10 600 11 1600 10 1800 11 600 12 1000 11 2300 12 1000 13 1500 12 2100 13 900 O 14 1300 13 2800 14 1900 1000 14 1900 15 1200 16 1700 15 2700. 16 700 17 1700 16 1300 17 2100 18 5000 17 2200 18 1800 00 19 900 18 2200 19 1800 M 20 300 19 2500 -20 1200 22 1750 20 980 22 1000 23 1600 22 2000 23 1200 24 1000 23 1000 24 675 1100 24 850 25 850 26 2250 25 600 26 1600 27 1400 26 1100 27 1900 28 27 1450 28 28 Titers averaged about 1000 over this time period for the polyclonal antibody preparation and were slightly above this level for the 1OD5- and 21F 12-treated animals.

Treatment was continued over a six-month period for a total of 196 days.

Animals were euthanized one week after the final dose.

C. Ab3 and APP Levels in the Brain: Following about six months of treatment with the various anti-AP3 antibody preparations, brains were removed from the animals following saline perfusion.

One hemisphere was prepared for immunohistochemical analysis and the second was used for the quantitation of A3 and APP levels. To measure the concentrations of various forms of beta amyloid peptide and amyloid precursor protein (APP), the hemisphere was dissected and homogenates of the hippocampal, cortical, and cerebellar regions were prepared in 5M guanidine. These were serially diluted and the level of amyloid peptide or APP was quantitated by comparison to a series of dilutions of standards of AP peptide or APP of known concentrations in an ELISA format.

The levels of total AP3 and of AP 1-42 measured by ELISA in homogenates of the cortex, and the hippocampus and the level of total A3 in the cerebellum are shown in Tables 4, 5, and 6, respectively. The median concentration of total AP for the control group, inoculated with PBS, was 3.6-fold higher in the hippocampus than in the cortex (median of 63,389 ng/g hippocampal tissue compared to 17,818 ng/g for the cortex). The median level in the cerebellum of the control group 0 (30.6 ng/g tissue) was more than 2,000-fold lower than in the hippocampus. These levels are similar to those previously reported for heterozygous PDAPP transgenic mice of this age (Johnson-Wood et al., supra).

00 0 .For the cortex, one treatment group had a median AP level, measured as AP 1-42, which differed significantly from that of the control group (p 0.05), those c-i animals receiving the polyclonal anti-AP antibody as shown in Table 4. The median 0 10 level of AP1-42 was reduced by 65%, compared to the control for this treatment group.

The median levels ofA31-42 were also significantly reduced by 55% compared to the control in one additional treatment group, those animals dosed with the mAb 10D5 (p 0.0433).

2007231638 24 Oct 2007 Table 4

CORTEX

T r e a t m e n t M e i nM a s Group NaMeinMen Total AP3 A042 Total AP3AM ELISA P value" Change ELISA P value Change EIAvauELSvle valueb value ISvau LAvle PBS 9 17818 NAd NA 13802 NA NA 16150+/-7456e 12621+/-5738 mAb 266 6 9144 0.1255 -49 .8481 0.1255 -39 9204+/-9293 7489+-6921 rn~~ l l28 51 8 0 28 8 1513 780.7003 -2 12481+/-7082 11005+/-6324 Footnotes: a- Number Of animals per group at the end of the experiment b. ng/g tissue c- Mann Whitney analysis d. NA: not applicable e. Standard Deviation 0 In the hippocampus, the median percent reduction of total AP associated with treatment with polyclonal anti-Ap antibody p 0.0055) was not as great as O that observed in the cortex (Table However, the absolute magnitude of the S 5 reduction was almost 3-fold greater in the hippocampus than in the cortex, a net reduction of 31,683 ng/g tissue in the hippocampus versus 11,658 ng/g tissue in the 00 cortex. When measured as the level of the more amyloidogenic form of Ap, Apl-42, IN rather than as total Ap, the reduction achieved with the polyclonal antibody was CS significant (p 0.0025). The median levels in groups treated with the mAbs 10D5 and S 10 266 were reduced by 33% and 21%, respectively.

O

t(, 2007231638 24 Oct 2007 Table

HIPPOCAMPUS

Treatment Group

PBS

Polyclonal N Medians Total AP AP42 ELISA P %ELISA

P%

value' value' Change value value Change 9 63389 NA NA 54429- NTA-

NRA

10 -1706 0.0-055 -50 77 17 61 Means Total AP3 ELISA value L83 Tl+I/ 1 33 0 8 30058+/-224-54 1 anti-AL342 mAb lODS 8 46779 0.0675 -26 niAb 266 6 48689 0.0990 -23 mAb 21FI128 V51563 0.77728 -19 a. Number of animals per group at the end of the experiment b. ng/g tissue Mann Whitney analysis d. NA: not applicable e. Standard Deviation 36290 43034 47961 0.0543 1 0.U990 0-6.8099

U

Al342 ELISA value 5',801+/-14701 24853+/-18262 36465+1-17146 32919+/-25372 50305:R--23927 -33- 44581T/-18632 f-21 36419+/-27304 -12 57327+/-282 Total Ap was also measured in the cerebellum (Table Those groups dosed with the polyclonal anti-AP and the 266 antibody showed significant reductions of the levels of total Ap (43% and 46%, p 0.0033 and p 0.0184, respectively) and that group treated with 10D5 had a near significant reduction p 0.0675).

Table 6

CEREBELLUMI

Treatment Group N Medians Group Total Ap ELISA P valueb value" Change PBS 9 30.64 NAd NA Polyclonal Polyclonal 10 17.61 0.0033 -43 anti-A342 mAb 10D5 8 21.68 0.0675 -29 mAb 266 6 16.59 0.0184 -46 mAb21F12 8 29.80 >0.9999 -3 a. Number of animals per group at the end of the experiment b. ng/g tissue c. Mann Whitney analysis d. NA: not applicable e. Standard Deviation Means Total Ap ELISA value 40.00+/-31.89 e 18.15+/-4.36 27.29+/-19.43 19.59+/-6.59 32.88+/-9.90 APP concentration was also determined by ELISA in the cortex and cerebellum from antibody-treated and control, PBS-treated mice. Two different APP assays were utilized. The first, designated APP-a/FL, recognizes both APP-alpha (a, the secreted form of APP which has been cleaved within the AP sequence), and fulllength forms (FL) of APP, while the second recognizes only APP-a. In contrast to the treatment-associated diminution of A in a subset of treatment groups, the levels of APP Swere virtually unchanged in all of the treated compared to the control animals. These O results indicate that the immunizations with Ap antibodies deplete AP without depleting

SAPP.

O In summary, AP levels were significantly reduced in the cortex, S 5 hippocampus and cerebellum in animals treated with the polyclonal antibody raised against AN1792. To a lesser extent monoclonal antibodies to the amino terminal region 00 ofApl-42, specifically amino acids 1-16 and 13-28 also showed significant treatment I effects.

r- 10 D. Histochemical Analyses: The morphology of Ap-immunoreactive plaques in subsets of brains from mice in the PBS, polyclonal A142, 21F12, 266 and 10D5 treatment groups was qualitatively compared to that of previous studies in which standard immunization procedures with Ap42 were followed.

The largest alteration in both the extent and appearance of amyloid plaques occurred in the animals immunized with the polyclonal Ap42 antibody. The reduction of amyloid load, eroded plaque morphology and cell-associated Ap immunoreactivity closely resembled effects produced by the standard immunization procedure. These observations support the ELISA results in which significant reductions in both total AP and AP42 were achieved by administration of the polyclonal Ap42 antibody.

In similar qualitative evaluations, amyloid plaques in the 10D5 group were also reduced in number and appearance, with some evidence of cell-associated

AP

immunoreactivity. Relative to control-treated animals, the polyclonal Ig fraction against AP and one of the monoclonal antibodies (10D5) reduced plaque burden by 93% and 81%, respectively (p<0.005). 21F12 appeared to have a relatively modest effect on plaque burden. Micrographs of brain after treatment with pAbAp3 142 show diffuse deposits and absence of many of the larger compacted plaques in the pAbAP- 4 2 treated group relative to control treated animals.

0 E. Lymphoproliferative Responses aAP-dependent lymphoproliferation was measured using spleen cells o harvested eight days following the final antibody infusion. Freshly harvested cells, 10 per well, were cultured for 5 days in the presence of AP3l-40 at a concentration of 5 JIM for stimulation. As a positive control, additional cells were cultured with the T cell 00 mitogen, PHA, and, as a negative control, cells were cultured without added peptide.

IN Splenocytes from aged PDAPP mice passively immunized with various anti-Ap antibodies were stimulated in vitro with AN1792 and proliferative and cytokine 10 responses were measured. The purpose of these assays was to determine if passive immunization facilitated antigen presentation, and thus priming ofT cell responses specific for AN1792. No AN1792-specific proliferative or cytokine responses were observed in mice passively immunized with the anti-Ap3 antibodies.

Example II: Therapeutic Efficacy of Anti-AD Antibodies: mAb 2H3. mAb 10D5.

mAb 266, mAb 21F12, mAb 3D6, mAb 16C11 and pAb Ap31-472 In a second study, treatment with 10 OD5 was repeated and two additional anti-Ap3 antibodies were tested, monoclonals 3D6 (AP3l-5) and 16C 11 (AP333-42).

Control groups received either PBS or an irrelevant isotype-matched antibody (TM2a).

The mice were older (11.5-12 month old heterozygotes) than in the previous study, otherwise the experimental design was the same. Once again, after six months of treatment, 1 OD5 reduced plaque burden by greater than 80% relative to either the PBS or isotype-matched antibody controls (p=0.003). One of the other antibodies against Ap3, 3D6, was equally effective, producing an 86% reduction (p=0.003). In contrast, the third antibody against the peptide, 16C 11, failed to have any effect on plaque burden.

Similar findings were obtained with Ap342 ELISA measurements.

These results demonstrate that an antibody response against AP3 peptide, in the absence of T cell immunity, is sufficient to decrease amyloid deposition in PDAPP mice, but that not all anti-Ap antibodies are equally efficacious. Antibodies directed to epitopes comprising amino acids 1-5 or 3-7 of A3 are particularly efficacious. In summary, it can be demonstrated that passively administered antibodies against AP3 passive immunization) reduces the extent of plaque deposition in a mouse model of 0 Alzheimer's disease.

0 Example H: Monitoring of Antibody Binding in the CNS This Example demonstrates that when held at modest serum concentrations (25-70 gg/ml), the antibodies gained access to the CNS at levels 00 sufficient to decorate P-amyloid plaques.

IN To determine whether antibodies against Ap could be acting directly within the CNS, brains taken from saline-perfused mice at the end of the Example

II,

were examined for the presence of the peripherally-administered antibodies. Unfixed cryostat brain sections were exposed to a fluorescent reagent against mouse immunoglobulin (goat anti-mouse IgG-Cy3). Plaques within brains of the 10D5 and 3D6 groups were strongly decorated with antibody, while there was no staining in the 16C1 1 group. To reveal the full extent of plaque deposition, serial sections of each brain were first immunoreacted with an anti-Ap3 antibody, and then with the secondary reagentI 1OD5 and 3D6, following peripheral administration, gained access to most plaques within the CNS. The plaque burden was greatly reduced in these treatment groups compared to the 16C1 1 group. Antibody entry into the CNS was not due to abnormal leakage of the blood-brain barrier since there was no increase in vascular permeability as measured by Evans Blue in PDAPP mice. In addition, the concentration of antibody in the brain parenchyma of aged PDAPP mice was the same as in nontransgenic mice, representing 0.1% of the antibody concentration in serum (regardless of isotype).

These data indicate that peripherally administered antibodies can enter the CNS where they can directly trigger amyloid clearance. It is likely that 16C 11 also had access to the plaques but was unable to bind.

Example IV: Ex vivo Screening Assay for Activity of an Antibody Against Amyloid Deposits To examine the effect of antibodies on plaque clearance, we established an ex vivo assay in which primary microglial cells were cultured with unfixed cryostat sections of either PDAPP mouse or human AD brains. Microglial cells were obtained from the cerebral cortices of neonate DBA/2N mice (1-3 days). The cortices were mechanically dissociated in HBSS- (Hanks' Balanced Salt Solution, Sigma) with -q pg/ml DNase I (Sigma). The dissociated cells were filtered with a 100 pm cell strainer O (Falcon), and centrifuged at 1000 rpn for 5 minutes. The pellet was resuspended in C 5 growth medium (high glucose DMEM, 10%FBS, 25ng/ml rmGM-CSF), and the cells were plated at a density of 2 brains per T-75 plastic culture flask. After 7-9 days, the 0C flasks were rotated on an orbital shaker at 200 rpm for 2h at 37°C. The cell suspension was centrifuged at 1000rpm and resuspended in the assay medium.

C- 10-pm cryostat sections of PDAPP mouse or human AD brains (post- 0 10 mortem interval 3hr) were thaw mounted onto poly-lysine coated round glass C coverslips and placed in wells of 24-well tissue culture plates. The coverslips were washed twice with assay medium consisting ofH-SFM (Hybridoma-serum free medium, Gibco BRL) with 1% FBS, glutamine, penicillin/streptomycin, and 5ng/ml rmGM-CSF Control or anti-A3 antibodies were added at a 2x concentration (5 pg/ml final) for 1 hour. The microglial cells were then seeded at a density of 0.8x 106 cells/ml assay medium. The cultures were maintained in a humidified incubator (37 0 C, 5%C0 2 for 24hr or more. At the end of the incubation, the cultures were fixed with 4% paraformaldehyde and permeabilized with 0.1% Triton-X100. The sections were stained with biotinylated 3D6 followed by a streptavidin Cy3 conjugate (Jackson ImmunoResearch). The exogenous microglial cells were visualized by a nuclear stain (DAPI). The cultures were observed with an inverted fluorescent microscope (Nikon, TE300) and photomicrographs were taken with a SPOT digital camera using SPOT software (Diagnostic instruments). For Western blot analysis, the cultures were extracted in 8M urea, diluted 1:1 in reducing tricine sample buffer and loaded onto a 16% tricine gel (Novex). After transfer onto immobilon, blots were exposed to 5 pg/ml of the pabAp42 followed by an HRP-conjugated anti-mouse antibody, and developed with ECL (Amersham) When the assay was performed with PDAPP brain sections in the presence of 16C11 (one of the antibodies against AP that was not efficacious in vivo), pamyloid plaques remained intact and no phagocytosis was observed. In contrast, when adjacent sections were cultured in the presence of 10D5, the amyloid deposits were largely gone and the microglial cells showed numerous phagocytic vesicles containing c.) 0 AJ. Identical results were obtained with AD brain sections; 10D5 induced phagocytosis of AD plaques, while 16C11 was ineffective. In addition, the assay provided comparable results when performed with either mouse or human microglial cells, and with mouse, rabbit, or primate antibodies against Ap.

Table 7 compares AB binding versus phagocytosis for several different antibody binding specificities. It can be seen that antibodies binding to epitopes within aa 1-7 both bind and clear amyloid deposits, whereas antibodies binding to epitopes within amino acids 4-10 bind without clearing amyloid deposits. Antibodies binding to epitopes C-terminal to residue 10 neither bind nor clear amyloid deposits.

Table 7: Analysis of Epitope Specificity Antibody epitope isotype Staining Phagocytosis N-Term mab 3D6 10D5 22C8 6E10 14A8 aa 13-28 18G11 266 22D12 C-Term 2G3 16C11 21F12 Immune serum rabbit (CFA) mouse (CFA) mouse (QS-21) monkey (QS-21) mouse (MAPI-7) 1-5 3-7 3-7 5-10 4-10 10-18 16-24 18-21 -40 -40/-42 -42 IgG2b IgGI IgG2a IgG rat IgG rat IgGI IgGI IgG2b IgG1 IgGI IgG2a N Table 8 shows results obtained with several antibodies against Ap, comparing o their abilities to induce phagocytosis in the ex vivo assay and to reduce in vivo plaque 0 burden in passive transfer studies. Although 16C11 and 21F12 bound to aggregated (N 5 synthetic AP peptide with high avidity, these antibodies were unable to react with pamyloid plaques in unfixed brain sections, could not trigger phagocytosis in the ex vivo 00 M assay, and were not efficacious in vivo. 10D5, 3D6, and the polyclonal antibody against AB were active by all three measures. These results show that efficacy in vivo is due to direct antibody mediated clearance of the plaques within the CNS, and that the ex vivo S 10 assay is predictive of in vivo efficacy.

Table 8: The ex vivo assay as predictor of in vivo efficacy Antibody Isotype Avidity for Binding to Ex vivo In vivo aggregated P-amyloid efficacy efficacy AP (pM) plaques monoclonal 3D6 IgG2b 470 10D5 IgGI 43 16C11 IgGI 21F12 IgG2a 500 TM2a IgG1 polyclonal 1-42 mix 600 The same assay has been used to test clearing activity of an antibody against a fragment of synuclein referred to as NAC. Synuclein has been shown to be an amyloid plaque-associated protein. An antibody to NAC was contacted with a brain tissue sample containing amyloid plaques, and microglial cells, as before. Rabbit serum was used as a control. Subsequent monitoring showed a marked reduction in the number and size of plaques indicative of clearing activity of the antibody.

Confocal microscopy was used to confirm that Ap was internalized during the course of the ex vivo assay. In the presence of control antibodies, the exogenous microglial cells remained in a confocal plane above the tissue, there were no phagocytic vesicles containing Ap, and the plaques remained intact within the section.

SIn the presence of 10D5, nearly all plaque material was contained.in vesicles within the exogenous microglial cells. To determine the fate of the internalized peptide, 10D5 0 treated cultures were extracted with 8M urea at various time-points, and examined by 5 Western blot analysis. At the one hour time point, when no phagocytosis had yet occurred, reaction with a polyclonal antibody against Ap revealed a strong 4 kD band 00 M (corresponding to the AP peptide). Ap immunoreactivity decreased at day 1 and was absent by day 3. Thus, antibody-mediated phagocytosis of AP leads to its degradation.

To determine if phagocytosis in the ex vivo assay was Fc-mediated, 0 10 F(ab')2 fragments of the anti-AB antibody 3D6 were prepared. Although the F(ab')2 1 fragments retained their full ability to react with plaques, they were unable to trigger phagocytosis by microglial cells. In addition, phagocytosis with the whole antibody could be blocked by a reagent against murine Fc receptors (anti-CD16/32). These data indicate that in vivo clearance of A3 occurs through Fc-receptor mediated phagocytosis.

Example V: Passage of Antibodies Through the Blood-Brain Barrier This example determines the concentration of antibody delivered to the brain following intravenous injection into a peripheral tissue of either normal or PDAPP mice. Following treatment, PDAPP or control normal mice were perfused with 0.9% NaCI. Brain regions (hippocampus or cortex) were dissected and rapidly frozen. Brain were homogenized in 0.1% triton protease inhibitors. Immunoglobulin was detected in the extracts by ELISA. F(ab)'2 goat anti-mouse IgG were coated onto an RIA plate as capture reagent The serum or the brain extracts were incubated for Ihr. The isotypes were detected with anti-mouse IgGl-HRP or IgG2a-HRP or IgG2b-HRP (Caltag).

Antibodies, regardless ofisotype, were present in the CNS at a concentration that is 1:1000 that found in the blood. For example, when the concentration ofIgG1 was three times that of IgG2a in the blood, it was three times IgG2a in the brain as well, both being present at 0.1% of their respective levels in the blood. This result was observed in both transgenic and nontransgenic mice indicating that the PDAPP does not have a uniquely leak blood brain barrier.

Example VI. Cloning and Sequencing of the Mouse 3D6 Variable Regions Cloning andSequence Analysis of3D6 VH. The heavy chain variable VH region of 3D6 was cloned by RT-PCR using mRNA prepared from hybridoma cells O by two independent methods. In the first, consensus primers were employed to VH 5 region leader peptide encompassing the translation initiation codon as the 5' primer (DNA #3818-3829), and a g2b (DNA #3832) constant regions specific 3' priiner. The 00 sequences from PCR amplified product, as well as from multiple, independently-derived clones, were in complete agreement with one another. As a further check on the sequence of the 3D6 VH region, the result was confirmed by sequencing a VH fragment obtained by 5' RACE RT-PCR methodology and the 3' g2b specific primer (DNA #3832). Again, the sequence was derived from the PCR product, as well as multiple, independently-isolated clones. Both sequences are in complete agreement with one another, (with the exception of V8I substitution in the leader region from the 5' RACE product), indicating that the sequences are derived from the mRNA encoding the VH region of 3D6. The nucleotide (SEQ ID NO:3) and amino acid sequence (SEQ ID NO:4) of the VH region of 3D6 are set forth in Table 9A and in Figure 2, respectively.

Table 9A: Mouse 3D6 VH Nucleotide Sequence

ATGAACTTCGGGCTCAGCTTGATTTTCCTTGTCCTTGTTTTAAAAGGTGTCCAGTGTGA

AGTGAAGCTGGTGGAGTCTGGGGGAGGCTTAGTGAAGCCTGGAGCGTCTCTGAAACTCT

CCTGTGCAGCCTCTGGATTCACTTTCAGTAACTATGGCATGTCTTGGGTTCGCCAGAAT

TCAGACAAGAGGCTGGAGTGGGTTGCATCCATTAGGAGTGGTGGTGGTAGAACCTACTA

TTCAGACAATGTAAAGGGCCGATTCACCATCTCCAGAGAGAATGCCAAGAACACCCTGT

ACCTGCAAATGAGTAGTCTGAAGTCTGAGGACACGGCCTTGTATTATTGTGTCAGATAT

GATCACTATAGTGGTAGCTCCGACTACTGGGGCCAGGGCACCACT (SEQ ID NO:3) *Leader peptide is underlined.

Cloning and Sequence Analysis of3D6 VL. The light chain variable VL region of 3D6 was cloned in an analogous manner as the VH region. In the first trial, a consensus primer set was designed for amplification ofmurine VL regions as follows: 5' primers (DNA #3806-3816) were designed to hybridize to the VL region encompassing the translation initiation codon, and a 3' primer (DNA#3817) was specific for the murine Ck region downstream of the V-J joining region. DNA sequence analysis of the PCR fragment, as well as independently-derived clones isolated using this consensus light chain primer set, revealed that the cDNA obtained was derived from a 0 non-functionally rearranged message as the sequence contained a frameshift mutation S 5 between the V-J region junction.

In a second trial, 5'RACE was employed to clone a second VL encoding 00cDNA. DNA sequence analysis of this product(consensus 11) showed it encoded a functional mRNA. Thus, it can be concluded that the sequence encodes the correct 3D6 light chain mRNA. The nucleotide (SEQ ID NO:1) and amino acid sequence (SEQ ID NO:2) of the VL region of 3D6 are set forth in Table 9B and in Figure 1, respectively.

Table 9B: Mouse 3D6 VL Nucleotide Sequence

ATGATGAGTCCTGCCCAGTTCCTGTTTCTGTTAGTGCTCTGGATTCGGGAAACCAACGG

TTATGTTGTGATGACCCAGACTCCACTCACTTTGTCGGTTACCATTGGACAACCAGCCT

CCATCTCTTGCAAGTCAAGTCAGAGCCTCTTAGATAGTGATGGAAAGACATATTTGAAT

TGGTTGTTACAGAGGCCAGGCCAGTCTCCAAAGCGCCTAATCTATCTGGTGTCTAAACT

GGACTCTGGAGTCCCTGACAGGTTCACTGGCAGTGGATCAGGGACAGATTTTACACTGA

AAATCAGCAGAATAGAGGCTGAGGATTTGGGACTTTATTATTGCTGGCAAGGTACACAT

TTTCCTCGGACGTTCGGTGGAGGCACCAAGCTGGAAATCAAA (SEQ ID NO:1) *Leader peptide is underlined Primers used for the cloning of the 3D6 VL cDNA are set forth in Table DNA Size Coding Strand? DNASequence Comments nouse kappa variable rimer 1 806 40 Yes CT.AGT.CGA.CAT.GAA.GTT.GCC.TGT.TA PRIMER 1, MRC set; 3.GCT.GTT.GGT.GCT.G (SEQ ID NO:39) A+T 50.00 20); +G 50.00 120] avis, Botstein, Roth elting Temp C. 72.90 Yes 3807 ouse kappa variable rimer 2 ACT.AGT.CGA.CAT.AGWC AC.AC PRIMER 2, MRC set T.CCT.GYT.ATG.GGT (SEQ ID NO:40) 4.15 (11; avis,Botstein, Roth elting Temp C. 72.05 ACT. AGT. OGA. CAT. GAG. TOT. GCT. CAC TC A.GGT.CCT.GGS.G-TT.G (SEQ ID NO:41) roue kappa variable rimer 3 KVPRIMER 3, MRC set; k A+T 45.00 (18]; 2+G 52.50 (21) Davis,Botstein,Roth 4elting Temp C. 73.93 rouse kappa variable ?rimer 4 4VPRIMER 4, NRC set; A+T 41.66 (181; 9, C+G =46.51 Dai,Botstein, Roth Helting Temp C. 72.34 3809 ACT. AGT. CGA. CAT. GAG. GRC. CCC. TGC .TC A.GWT.TYT.TGG.MWT.CrTTG (SEQ ID N'O: 4 2) 3810 ACT .AGT. CGA. CAT.GGA. TTT. WCA.GGT.G A.GAT.TWT.CAG.CTT.C (SEQ ID NO :43) kouse kappa variable rimer PRIMER 5, MRC set A+T 52.50 V6 +G 42.50 (17) ravis, Botstejn,Roth elting Temp C. 69.83 ouse kappa variable rimer 6 MICV PRIMER 6, MRC set; t A+T =37.84 t6 C+G 40.54 Davis, Botstein,Roth ~4elting Temp C. 68.01 3811 37 Yes ACT. AGT .CGA. CAT. GAG. GTK. CY.TGY. TS A.GYT.YCT.GRG.G (SEQ ID NO:44) ACT.AGT. CGA. CAT.GGG.CWT. CAA. OAT .00 A.GTC.ACA.KWY.YC.GG (SEQ ID UO :45) kouse kappa variable rimer 7 KV PRIMER 7, MRC set; AT= 39.02 t6 +0 46.34 [19] avis, Botstein, Roth elting Temp C. 71.70 ouse kappa variable rimer 8 MKV PRIMER 8, NRC set; A+T -53.66 C+G =34.15 [141 Di, Botstein, Roth 4elting Temp c. 66.70 ACT. AGT GA. CAT .GTO .000.AYC .TKT .TT Y.CMM.TTT.TTC.AAT.TG (SEQ ID NO :46) 0 M0 381.4 35 nouae kappa variable ?rimer~ 9 kCT.AGT.CGA.CATGGTRTCCCCTC V PRIMER 9, NRC set.

k.GTT.CCT.TG (SEQ ID NO:47) A+T -45.71 [16]; +G 45.71 [16] avis, Hotstejf,Roth lelting Temp C. 69.36 3815 37 Yes Yes iCT .AA3T. CGA. CAT. OTA. TAT. AT TTT.G r.GTC.TAT.TTC.T (SEQ ID KO:48) ose kappa variable rimer PRIMER 10, NRC set; A+T 70.27 [26]; 29.73 (11) 0avis, Botstein, Roth elting Temp C. 63.58 Ouse kappa variable primer 11 MKV PRIMER 11, NRC set; W A+T =44-74

I

CG= 55.26 [21] :)avis, Botstein, Roth 4elting Temp, C. 74.40 3816 P.CT.AGT.

OGA.CAT.GGA.AC.CCCAC.TC

A,.GCT.TCT.CTT.CC (SEQ ID 140:49) 3817 No Yes 3GA. TCC. COG. OTO .AT. GGT. 0. AAG3. AT 3(SEQ ID K40:50) ouse kappa light chain everse primer, aa 116- 1222; constant region rimer, MRC seti-Smal ite; W A+T 4 7. 06 8] !k C+G 4E rimer 1,RCst 3818 r CT .AGT. OGA. CAT. QAA. ATG. GAG. CTG .00 t.CAT.STT.CTT.C (SEQ ID 140:51) 3819 kC.G.G.A.GGAGGGCRT rimer 2ayvral T.CAT.SYr.CTT (SEQ ID 140:52) primer 2, MRC set; 3820 CT. AGT. CGA CAT. GAA. GKT. GTG. GTT. AA CTG.GGT.TTT.T (SEQ ID NO:533)) YT _C *GTG GTT

*AA

kCT. AGT. CGA. CAT. GRA. CTT. TGG. GYT. CAA 3.CTT.GRT.TT (SEQ ID NO:54) aOuse heavy variable Typrimer 4, MRC set; 3821 3822 40 T Yes ACT .AL3T .CGA .CAT. OGA. CTC AG. OCT. CA xk.TTT.AGT.TIT.CCT.T (SEQ ID ,17: 55) mouse heavy variable primer 4RV primer 5, NRC set; mouse heavy variable 823 37CT.AGT.CGA.CAT.GGCTCYTRGS.GC orimer 6 383 7 Ye .RCT.CTT.CTG.C (SEQ ID NO:56) Wprimer 6, MRC set; 0 use heavy variable 8 24 36 Yes ACT.AGT.CGA.CAT.GGR.ATG.GAG.CKG.GR 'rimer 7 T.CTr.TMT.CTT (SEQ ID N0:57) MVprimer 7, MRC set; 00 mouse heavy variable 825 33 Yes rie8 IN.rTTT.GTG (SEQ ID NO:58) X1Vprimer 8, NRC set; kCT .AGT. CGA.CAT. GGM. TTG.GGT.GTG.G muse heavy variable 826 40 Yes I.CTT.GCT.ATT.CCT.G (SEQ ID primer 9 0 :59) 4Vprimer 9, MRC set; mouse heavy variable 82 3 Ys CT.AGT.CGA.CAT.GGGAG.CTAC.AT primer .CTC.ATT.CCT.G (SEQ ID NO:60) 4Wprimer 10, NRC set; nouse heavy variable 3828 38 Yes ACT.AGT.CGA.CATGATTGGCG primer 11 r.TTT.TTT.TAT.TG (SEQ ID NO:61) Wprimer 11, NRC set; FCT AG ouse heavy variable 3829 37 Yes CT.AGT.CGA.CAT.GAT.GT.TT.AAG.TC arimer 12 .T.GTACCT. (SEQ ID NO:62) vJVprimer 12, NRC set; mouse IgG2b heavy chain 832 27.TCC. CGG.A.TG.ATAGACtGATo reverse primer 382 2 o 3(SEQ ID NO:63) aa position 119-124, NRC set; From N-terminal to C-terminal, both light and heavy chains comprise the domains FRI, CDR1, FR2, CDR2, FR3, CDR3 and FR4. The assignment of amino acids to each domain is in accordance with the numbering convention of Kabat et al., suipra.

Exression of Chimeric 3D6 Antibody: The variable heavy and light chain regions were re-engineered to encode splice donor sequences downstream of the respective VDJ or VJ junctions, and cloned into the mammalian expression vector pCMV-hyl for the heavy chain, and pCMY-hxl for the light chain. These vectors encode human yl and Ck constant regions as exonic fragments downstream of the inserted variable region cassette. Following sequence verification, the heavy chain and light chain expression vectors were co-transfected into COS cells. Two different heavy 0 chain clones (H2.2 H3.2) were independently co-transfected with 3 different chimeric light chain clones (L3, L4, &L10) to confirm reproducibility of the result. A chimeric IN 5 21.6 antibody transfection was carried out as a positive control for the vectors.

Conditioned media was collected 48 hrs post transfection and assayed by western blot 00 rn analysis for antibody production or ELISA for AP binding.

SThe multiple transfectants all expressed heavy chain light chain combinations which are recognized by a goat anti-human IgG antibody on a 0 10 western blot.

O

Direct binding of 3D6 and chimeric 3D6 (PK1614) antibodies to Ap was tested by ELISA analysis. Chimeric 3D6 was found to bind to Ap with high avidity, similar to that demonstrated by 3D6 (Figure 3A). Furthermore, an ELISA based competitive inhibition assay revealed that the chimeric 3D6 and the murine 3D6 antibody competed equally with biotinylated-3D6 binding to Ap (Figure 3B). The chimeric antibody displayed binding properties indistinguishable from the 3D6 reference sample.

Table 11.

Conc (pglmi) 3D6 PK1614 IgG1 0.037 119.3 0.11 118.6 118.9 0.33 99.7 71.25 1 98.63 84.53 134.4 Moreover, both 3D6 and PK1614 were effective at clearing Ap plaques.

The ex vivo assay demonstrates that as the concentration of antibody increases, the amount of A decreases in a similar manner for both murine and chimeric 3D6 antibodies. Hence, it can be concluded that the sequences encode functional 3D6 heavy chain and light chains respectively.

Example VII. 3D6 Humanization Homology/Molecular Modeling. In order to identify key structural framework residues in the murine 3D6 antibody, a three-dimensional model was Sgenerated based on the closest murine antibodies for the heavy and light chains. For this tC purpose, an antibody designated 1CR9 was chosen as a template for modeling the 3D6 0 light chain (PDB ID: 1CR9, Kanyo et al., supra), and an antibody designated 1OPG was 0 chosen as the template for modeling the heavy chain. (PDB ID: 10PG Kodandapani et N 5 al., supra). (See also Table Amino acid sequence alignment of 3D6 with the light Schain and heavy chain of these antibodies revealed that, with the exception of CDR3 of Sthe heavy chain, the 1CR9 and 1OPG antibodies share significant sequence homology with 3D6. In addition, the CDR loops of the selected antibodies fall into the same N canonical Chothia structural classes as do the CDR loops of 3D6, again excepting CDR3 0 10 of the heavy chain. Therefore, 1CR9 and 10PG were initially selected as antibodies of CN- solved structure for homology modeling of 3D6.

A first pass homology model of 3D6 variable region based on the antibodies noted above was constructed using the Look SegMod Modules GeneMine software package. This software was purchased under a perpetual license from Molecular Applications Group (Palo Alto, CA). This software package, authored by Drs. Michael Levitt and Chris Lee, facilitates the process of molecular modeling by automating the steps involved in structural modeling a primary sequence on a template of known structure based on sequence homology. Working on a Silicon Graphics IRIS workstation under a UNIX environment, the modeled structure is automatically refined by a series of energy minimization steps to relieve unfavorable atomic contacts and optimize electrostatic and van der Walls interactions.

A further refined model was built using the modeling capability of Quanta@. A query of the PDB database with CDR3 of the heavy chain of 3D6 identified Iqkz as most homologous and having the identical number of residues as 3D6.

Hence, CDR3 of the heavy chain of 3D6 was modeled using the crystal structure of lqkz as template. The a-carbon backbone trace of the 3D6 model is shown in Figure 4. The VH domain is shown as a stippled line, and VL domain is shown as a solid line, and CDR loops are indicated in ribbon form.

Selection ofHuman Acceptor Antibody Sequences. Suitable human acceptor antibody sequences were identified by computer comparisons of the amino acid sequences of the mouse variable regions with the sequences of known human antibodies.

The comparison was performed separately for the 3D6 heavy and light chains. In particular, variable domains from human antibodies whose framework sequences o exhibited a high degree of sequence identity with the murine VL and VII framework 0 regions were identified by query of the Kabat Database using NCBI BLAST (publicly accessible through the National Institutes of Health NCBI internet server) with the respective murine framework sequences.

00 M Two candidate sequences were chosen as acceptor sequences based on the following criteria: homology with the subject sequence; sharing canonical CDR structures with the donor sequence; and not containing any rare amino acid F 10 residues in the framework regions. The selected acceptor sequence for VL is Kabat ID Number (KABID) 019230 (Genbank Accession No. S40342), and for VH is KABID 045919 (Genbank Accession No. AFI 15110). First versions of humanized 3D6 antibody utilize these selected acceptor antibody sequences.

Substitution ofAmino Acid Residues. As noted supra, the humanized antibodies of the invention comprise variable framework regions substantially from a human immunoglobulin (acceptor immunoglobulin) and complementarity determining regions substantially from a mouse immunoglobulin (donor immunoglobulin) termed 3D6. Having identified the complementarity determining regions of 3D6 and appropriate human acceptor immunoglobulins, the next step was to determine which, if any, residues from these components to substitute to optimize the properties of the resulting humanized antibody. The criteria described supra were used to select residues for substitution.

Figures 1 and 2 depict alignments of the original murine 3D6 VL and VII, respectively, with the respective version 1 of the humanized sequence, the corresponding human framework acceptor sequence and, lastly, the human germline V region sequence showing highest homology to the human framework acceptor sequence.

The shaded residues indicate the canonical (solid fill), vernier (dotted outline), packing (bold), and rare amino acids (bold italics), and are indicated on the figure. The asterisks indicate residues backmutated to murine residues in the human acceptor framework sequence, and CDR regions are shown overlined. A summary of the changes incorporated into version 1 of humanized 3D6 VII and VL is presented in Table 12.

Table 12. Summary of changes in humanized 3D6.vl Changes VL (112 residues) VII (119 residues) Hu->Mu: Framework 4/112 3/119 (1 canon, 1 packing) ODRI 6/16 CDR2 4/7 7/14 CDR3 5/8 4/10 IHu->Mu 19/112 17/119 (14%) Mu->Hu: Framework 1 3/112 14/119 Backmutation notes 12V which is a canonical 4. S49A Vernier/beneath the position. CDRs.

2. Y36L which is a packing 5. A93V which is a packing residue and also ties under the and vernier zone residue CD~s 6. K94R which is a canonical 3. L46R which is a packing residue residue and lies beneath the CDRs Acceptor notes Acceptor Germline 7. KABID 0 19230/Genbank Acc#S40342 8. Hlu K LC subgroup Hi 9. CDRs from same canonical structural group as donor (m3D6) LI =class 4 L2 class 1 L3=classl Unknown specificity 15. VH43-23 I11. KASBI]DO4591I9/Genbank Acc#AF 115110 12. Hu HG subgroup M 13. CDRs from same canonical structural group as donor (m3D6) Hlkclass 1 H2=;class3 14. Recognizes capsular polysaccharide of Neisseria meningitidis 16. A3 &A19 Tables 13 and 14 set forth Kabat numbering keys for the various light and heavy chains, respectively.

Table 13: Key to Kabat Numbering for Light Chain mouse A19- KAB 3D6 HUM KABID Germ- 1# TYPE VL 3D6VL 019230 line Comment I 1 FRI 2 2 Y Y D D Rare mouse, may contact

CDR

V V I Canonicaj/CDR contact 24 24 CDRI K K R R 25 S S S S ci26 26 S S S S 27 27 Q Q Q

Q

C0 27A 28 S S S S 27B129 L L L L CI27C 30 L L L L 27D 31 D D H H 0027E 32 S S S S M28 33 D D N N _29 34 G G G G 35 K K Y Y 31 36 T T N N 32 37 Y Y Y Y 33 38 L L L L 34 39 N N D D 40 FR2 W W W W 36 41 L L Y Y Packing residue 37 42 L L L L 38 43 Q Q Q

Q

39 44 R K K K 45 P P P P 41 46 G G G 6 42 47 Q Q Q

Q

43 48 S S S S 44 49 P P P P 50 K Q Q Q 46 51 R R L L Packing residue 47 52 L L L L 48 53 1 1 1 1 49 54 y y y y 55 CDR2 L L L L 51 56 V v G G 52 57 S S S S 53 58 K K N N 54 59 L L R R 60 D D A A 56 61 S S S S 57 62 FR3 G G G G 58 63 V V V V ci59 64 P P P P 65 D D D D o61 66 R R R R 62 67 F F1 F F ci63 68 T S s S 64 69 G G G G 70 S S S rn66 71 G G G G 67 72 S S S s 68 73 G G G G 69 74 T T T T 75 D D D D 71 76 F F F F 72 77 T T T T 73 78 L L L L 74 79 K K K K 80 1 1 76 81 S s S s 77 82 R R R R 78 83 1 V v v 79 84 E E E E 85 A A A A 81 86 E E E E 82 87 D D D D 83 88 L v v v 84 89 G G G G 90 L V V V 86 91 y y y y 87 92 Y Y Y y 88 93 C c C C 89 94 CDR3 W W M M 95 Q Q Q

Q

91 96 G G A A 92 97 T T L L 93 98 H H Q

Q

94 99 F F T T 100 P P P p 96 101 R R R 97 102 T T T 98 103 FR4 F F F 99 104 Gi G G 100 105 Gi Q

Q

101 106 G Gi G o102 107 T T T 103 108 K K K ci104 109 L V v 105 110 E E E 00 106 111 1 1 1 M106A 112 K K K cIN Table 14. Key to Kabat Numbering for Heavy Chain Mouse KAB 3D6 HlUM K~Ai]D VH13-23 #t f TYPE VI 3D6 -VII 045919 Germ Comment o) line I I FRI E E E E 2 2 V V V

V

00 3 3 K Q Q Q M4 4 L L L

L

5 V L L

L

6 6 E E E E 7 7 S s s

S

8 8 G G G

G

ci9 9 G G G G 10 G G G G I 11L L L L 12 12 V V V

V

13 13 K Q Q

Q

14 14 P P P

P

15 G G G

G

16 16 A G G G 17 17 S S s

S

18 18 L L L

L

19 19 K R- R R 20 L L L L 21 21 S S s

S

22 22 C C c

C

23 23 A A A A 24 24 A A A A 25 S S s

S

26 26 G G G G 27 27 F F F

F

28 28 T T T

T

29 29 F F F F 30 S S S

S

31 31 CDR1 N N s s 32 32 Y Y Y Y 33 33 G G A A 34 34. M M V M 35 S S s

S

36 36 FR2 37 37 38 38 39 39 40 41 41 42 42 43, 43 44 44 45 46 46 47 47 48 48 49 49 50 CDR2 51 51 52 52 52A 53 53 54 54 55 56 56 57 57 58 58 59 59 60 61 61 62 62 63 63 64 64 65 66 w

V

R

Q

A

p

G

K

G

L

E3 w

V

A

R

S

G

G

G

R

T

Y

Y

S

D

N

V

K.

G

w

V

R

Q

A

p

G

K

G

L

13 w

V

S

A

I

S

G

S

G

G

S

T

Y

Y

A

D

S

V

K

G

w

V

R

Q

A Rare mouse, replace wfHum.

p G Rare mouse, replace wlHum

K

G

L

E

w

V

S CDR contact/veneer

A

I

S

Gi

S

G

G

S

T

Y

Y

A

D

S

V

K

G

66 67 FR3 R R R R 67 68 F F F F ci68 69 T T T T 69 70 1 1 I I C0 70 71 S S S S 71 72 R R R R cI72 73 E D D D 73 74 N N N N 0074 75 A A A S 76 K K K K IN 76 77 N N N

N

77 78 T S S T 78 79 L L L L 79 80 Y Y Y Y 81 L L L L 81 82 Q Q Q

Q

82 83 M M M, M 82A 84 S N N N 82B 85 S S S S 82C 86 L L L L 83 87 K R R R 84 88 S A A A 89 E E E E 86 90 D D D D 87 91 T T T T 88 92 A A A A 89 93 L L L V 94 Y Y Y Y 91 95 Y Y Y Y 92 96 C C C 93 97 V v A A Packing residue, use mouse 94 98 R R K K Canonical, use mouse 99 CDR3 Y Y D 96 100 D D N 97 101 HI H y 98 102 Y Y D 99 103 S S F 100 104 G G W ]OOA 105 S S S 10013 106 S S G lOOC 107

T

INOD 108

F

101 109 D D D 102 110 Y Y Y 103 111 FR4 W W W 104 112 G G G o 105 113 Q Q Q O 106 114 G G G z 107 115 T T T 108 116 T L L 109 117 V V V 00 110 118 T T T M 111 119 V V V 112 120 S S S 113 121 S S S SThe humanized antibodies preferably exhibit a specific binding affinity for AB of at least 107, 10, 10 9 or 101o Nf'. Usually the upper limit of binding affinity of the humanized antibodies for AP is within a factor of three, four or five of that of 3D6 -10 9 Often the lower limit of binding affinity is also within a factor of three, four or five of that of 3D6.

Assembly and Expression ofHumanized 3D6 VH and VL, Version 1 Briefly, for each V region, 4 large single stranded overlapping oligonucleotides were synthesized. In addition, 4 short PCR primers were synthesized for each V region to further facilitate assembly of the particular V region. The DNA sequences of the oligonucleotides employed for this purpose are shown in Table Table 15: DNA oligonucleotides DNA# SIZE Coding? Sequence comments 4060 136 Yes tccgc aagct tgccg ccacc hum3D6 VLA ATGGA CATGC GCGTG CCCGC CCAGC TGCTG GGCCT GCTGA TGCTG TGGGT GTCCG GCTCC TCCGG CTACG TGGTG ATGAC CCAGT CCCCC CTGTC CCTGC CCGTG ACCCC CGGCG A (SEQ ID NO:17) 4061 131 No CTGGG GGGAC TGGCC GGGCT hum 3D6 VLB TCTGC AGCAG CCAGT TCAGG TAGGT CTTGC CGTCG GAGTC CAGCA GGGAC TGGGA GGACT TGCAG GAGAT GGAGG CGGGC TCGCC GGGGG TCACG GGCAG GGACA GGG G (SEQ ID NO:18) 4062 146 Yes ACCTG AACTG GCTGC TGCAG hum 3D6 VL-C AAGCC CGGCC AGTCC CCCCA GCGCC TGATC TACCT GGTGT CCAAG CTGGA CTCCG GCGTG CCCGA CCGCT TCTCC GGCTC CGGCT CCGGC ACCGA CTTCA CCCTG AAGAT CTCCC GCGTG GAGGC C (SEQ ID NO:19) 4063 142 No aattc tagga. tccac tcacg hum 3D6 VL-D CTTGA TCTCC ACCTT GGTGC CCTGG CCGAA GGTGC GGGGG AAGTG GGTGC CCTGC CAGCA GTAGT ACACG CCCAC GTCCT CGGCC TCCAC GCGGG AGATC TTCAG GGTGA AGTCG GTGCC G (SEQ ID 4064 16 N0 CTGGG GGGZAC TGGCC G hum 3D6 VL A+B (SEQ ID NO: 21) back %A+T =18.75 [31; C+G 81.2[131 Davis,Botstein,Roth Melting Temp C.

4065 22 Yes ACCTG AACTG GCTGC TGCAG hum 3D36 VL C4-D AA (SEQ ID NO:22) forward A+T =45.45 C+G =54.55 [12] Davis ,Iotstein,Roth Melting Temp C.

64.54 4066 138 Yes acaga aagct tgccg ccacc hum 3D6 VH-A ATGGA GTTTG GGCTG AGCTG GCTTT TTCTT GTGGC TATTT TAAAA GGTGT CCAGT GTGAG GTGCA GCTGC TGGAG TCCGG CGGCG GCCTG GTGCA GCCCG GCGGC TCCCT GCGCC TGT (SEQ ID NQ:23) 4067 135 No GCCGC CGGAG CGGAT GGAGG hum 3D6 VH-B CCACC CACTC CAGGC CCTTG CCGGG GGCCT GGCGC A.CCCA GOACA TGCCG TAGTT GGAGA AGGTG AAGCC GGAGG CGGCG CAGGA CAGGC GCAGG GAGCC GCCGG GCTGC ACCAG ID NO:24) 4068 142 Yes CTGGA GTGGG TGGCC TCCAT hum 3D6 VH-C CCGCT CCGGC GGOGG CCGCA CCTAC TACTC CGACA ACGTG AAGGG CCGCT TCACC ATCTC CCGCG ACAAC GCCAA GAACT CCCTG TACCT GCAGA TGAAC TCCCT GCGCG CCGALG GACAC (SEQ ID 409 144 No 4070 16 No 4071 120 1 Yes 4072 19 Yesctgca aggat 'ccact caccG hum 3D6 VH-D GAGGA CACOG TCACC AGGGT GCCC~T GGCCC CAGTA GTCGG AGGAG CCGGA GTAGT GGTCG TAGCG CACGC AGTAG TACAG GGCGG TGTCC TCGGC GCGCA OGGAG TTCAT CTGCA GGTAC AGGG (SEQ ID NO:26) CCCCGGAG COGAT G hum 3D6 Vii A+B (SEQ ID NQ:2?) .back A+T 18.75 C+G 81.25(131 Davis,Botstein,Roffi Melting Temp C.

66.96 CTGGA GTGGG TGGCC TC-CAT hum 3D6 VII C+D (SEQ ID) NO:28) forward A+T 35.00 C+G 65.00 [13] Davis,BotstinRoth Melting Temp C 66.55 tcc gca agc ttg cg cca Hum 3D6 VL A+B c (SEQ ID NO:29) Forward A+T =31.58 [61; C+G 68.42[131 Davis,Botstein,Roffi Melting Temp C 66.64 aat tct agg 'atc cac tca Hfum3D6 VL C+D cgC TTG ATC TC Back (SEQ ID NO:30) A+T =55.17[16]; C+G 44.83 [131 DavisBotsteiRoth Melting Temp C ca ga agc tg cc66.04 .ca u ga g t c c T3D6 VH A+B cA TG Forward SEQ ID NO:31) A+T =43.48 [101; C+G =56.52 [131 Davis,Botstein,Roth Melting Temp C.

66.33 tg caa gga tcc act cac Hum 3D6 VH C+D GG A Back SEQ ID) NO:32) A+T 40.91 C+G =59.09[131 Davis,Bosten~oth Melting Temp C.

66.40 4073 -29 No 4074 123 1 4075 122 1 No SThe humanized light chain was assembled using PCR. DNA sequence analysis of greater than two dozen clones revealed scattered point mutations and Sdeletions throughout the VL region with respect to the expected sequence. Analysis of O the sequences indicated that clone 2.3 was amenable to repair of 2 closely spaced single nucleotide deletions in the amino-terminal region. Hence site directed mutagenesis was performed on clone pCRShum3D6vl2.3 using oligonucleotides to introduce the 2 0 deleted nucleotides, and repair of the point mutations was confirmed by DNA sequence I analysis, and the VL insert was cloned into the light chain expression vector pCMV-cK.

Assembly of humanized VH using PCR-based methods resulted in clones with gross deletions in the 5' half of the sequence. Further efforts to optimize the PCR conditions met with partial success. The clones assembled via optimized PCR conditions still had 10-20 nt deletions in the region mapping to the overlap of the A+B fragments. Consequently, an alternate strategy was employed for VH assembly utilizing DNA polymerase (T4, Klenow, and Sequenase) mediated overlap extension, followed by T4 DNA ligase to covalently join the overlapping ends. DNA sequence analysis of a subset of the clones resulting from VH assembly using the latter approach revealed scattered point mutations and deletions among the clones. Analysis of over two dozen clones revealed essentially the same pattern as illustrated for the clones. The similar results observed following first pass assembly of VH and VL clones suggests the DNA sequence errors observed resulted from automated synthesizer errors during the synthesis of the long DNAs employed for the assembly.

Humanized VH clone 2.7 was selected for site-directed mutagenesismediated repair of the 3 nucleotide deletions it was observed to contain.

Example XII: Characterization of Humanized 3D6v2 Antibody A second version of humanized 3D6 was created having each of the substitutions indicated for version 1, except for the D- Y substitution at residue 1.

Substitution at this residue was performed in version 1 because the residue was identified as a CDR interacting residue. However, substitution deleted a residue which was rare for human immunoglobulins at that position. Hence, a version was created without the substitution. Moreover, non-germline residues in the heavy chain framework regions were substituted with germline residues, namely, H74 S, H77 T and H89 V. Kabat numbering for the version 2 light and heavy chains, is the same as 0 that depicted in Tables 13 and 14, respectively, except that residue 1 of the version 2 Slight chain is asp residue 74 of the heavy chain is ser residue 77 of the heavy 0 chain is thr and residue 89 of the heavy chain is val The nucleotide sequence of humanized 3D6 version 1 light and heavy chains are set forth as SEQ ID NOs: 34 and 36, respectively. The nucleotide sequence of humanized 3D6 version 2 light and heavy 00 chains are set forth as SEQ ID NOs: 35 and 37, respectively.

Example IX: Functional Testing of Humanized 3D6 Antibodies S 10 Binding of humanized 3D6v to aggregated Af. Functional testing of ,1 humanized 3D6vl was conducted using conditioned media from transiently transfected COS cells. The cells were transfected with fully chimeric antibody, a mixture of either chimeric heavy chain humanized light chain, or chimeric light chain humanized heavy chain, and lastly, fully humanized antibody. The conditioned media was tested for binding to aggregated Ap1-42 by ELISA assay. The humanized antibody showed good activity within experimental error, and displayed binding properties indistinguishable from the chimeric 3D6 reference sample. The results are shown in Table 16.

Table 16: huVH/ ChVH/ Hu VH/ ng/ml Chimeric ChVL HuVL HuVL o 690 0.867 o 600 0.895 260 0.83 c'i 230 0.774 200 0.81 190 0.811 0 87 0.675 IND 77 0.594 67 0.689 63 0.648 29 0.45 0.381 22 0.496 21 0.438 9.6 0.251 0.198 7.4 0.278 7 0.232 3.2 0.129 2.3 0.124 To compare the binding affinities of humanized 3D6vl and 3D6v2 antibodies, ELISA analysis was performed using aggregated AP as the antigen. The results show that both 3D6vl (HILl) and 3D6v2 (H2L2) have nearly identical A3 binding properties (Figure Replacement NET (rNE7) analysis of h3D6v2. The rNET epitope map assay provides information about the contribution of individual residues within the epitope to the overall binding activity of the antibody. rNET analysis uses synthesized systematic single substituted peptide analogs. Binding of an antibody being tested is determined against native peptide (native antigen) and against 19 alternative "single substituted" peptides, each peptide being substituted at a first position with one of 19 non-native amino acids for that position. A profile is generated reflecting the effect of substitution at that position with the various non-native residues. Profiles are likewise generated at successive positions along the antigenic peptide. The combined profile, or epitope map, (reflecting substitution at each position with all 19 non-native residues) can then be compared to a map similarly generated for a second antibody. Substantially similar or identical maps indicate that antibodies being compared have the same or similar epitope specificity.

0

M

IN

This analysis was performed for 3D6 and humanized 3D6, version 2.

Antibodies were tested for binding against the native A3 peptide DAEFRHDSGY

(SEQ

ID NO:33). Residues 1-8 were systematically substituted with each of the 19 non-native residues for that position. Maps were generated accordingly for 3D6 and h3D6v2. The results are presented in tabular form in Table 17.

Table 17: A3: replacement Net Epitope (rNET) mapping of wt3D6 and humanized 3D6 Substitution Residue 1 Residue 2 Wildtype 3D6

COD]

0.464 0.450 0.577 0.576 0. 034 0.569 0. 054 0.048 0.033 0. 073 0.039 0.587 0.069 0.441 0.056 0.569 0.450 0.057 0.031 0.341 0.548 0.553 0.119 0.563 0.577 0.527 0.534 0.522 0.548 0.482 0.535 0.525 0.445 0.567 0.562 Humanized 3D6 COD] Substitutio: 0.643 Residue 5 0.628 0.692 0.700 0.062 0.738 0.117 1 0.118 0.057 1 0.148 I 0.072 b 0.757 b 0.144 1 0.689

Q

0.155

R

0.762

S

0.702

T

0.190 V 0.070

W

0.498 y 0.698 Residue 6 A 0.694

C

0.222

D

0.702

E

0.717

F

0.720

G

0.741 H 0.722 I 0.722 K 0.705 L 0.705 M 0.735

N

0.707

P

0.756

Q

0.719 R Wildtype 3D6 n

COD]

A 0.275 C 0.359 D 0.080 E 0.115 0.439 G 0.485 4 0.577 0.510 0.573 0.517 0.418 0.476 0.093 0.388 0.613 0.487 0.530 0.493 0.393 0.278 0.587 0.585 0.584 0.579 0.586 0.592 0.596 0.602 0.585 0.584 0.583 0.580 0.587 0.570 0.576 Humanized 3D6

COD]

0.435 0.635 0.163 0.187 0.569 0.679 0.680 0.671 0.693 0.691 0.611 0.655 0.198 0.565 0.702 0.633 0.639 0.562 0.461 0.230 0.707 0.703 0.701 0.702 0.704 0.709 0.688 0.708 0.691 0.688 0.687 0.686 0.705 0.695 0.686 S 0.5 T 0.5 V 0.5 W 0.5 Y 0.5 Residue 3 A 0.0 C 0.2: D 0.0: E 0.5 F 0.0 G 0.0: H 0.0 I 0.03 K 0.0 1 L 0.0] M 0.01 N 0.02 P 0.02 Q 0.15 R 0.01 S 0.01 T 0.01 V 0.01 W 0.14 Y 0.01 Residue 4 A 0.01 C 0.02 D 0.01 E 0.01 F 0.55" G 0.01 H 0.47 I 0.11i K 0.01! L 0.55_ M 0.549 N 0.085 P 0.03C Q 0.065 R 0.016 S 0.026 T 0.016 V 0.213 W 0.291 Y 0.529 4 3 5 i.

l 2 l 9 5 9 9 5 87 0.705 52 0.712 50 0.702 53 0.701 47 0.704 38 0.061 Residue 7 22 0.410 19 0.027 12 0.689 34 0.060 16 0.019 16 0.020 L9 0.024 53 0.090 .9 0.026 .9 0.027 4 0.032 .7 0.020 3 0.406 5 0.023 6 0.021 5 0.019 6 0.021 9 0.304 6 0.020 6 0.020 Residue 8 0 0.023

C

7 0.020 r S0.021 E 7 0.703

F

6 0.020

G

0.723 H S 0.360 I S 0.018

K

0.716 L 0.725

M

0.089

N

0.056 p 0.110 Q 0. 019 R 0.031 8 0.021 T 0.494

V

0.568

W

0.7301 Y S 0.573 0.689 T 0.573 0.700 V 0.588 0.715 W 0.576 0.696 Y 0.595 0.708 A 0.580 0.688 C 0.559 0.676 D 0.573 0.681 E 0.565 0.677 F 0.546 0.668 G 0.562 0.679 H 0.557 0.675 I 0.552 0.681 K 0.565 0.685 L 0.566 0.701 M 0.562 0.697 N 0.573 0.688 P 0.582 0.678 5 0.563 0.679 R 0.551 0.677 3 0.563 0.674 V 0.560 0.685 -0.563 0.687 0.547 0.685 S0.560 0.682 0.573 0.687 0.583 0.700 0.586 0.697 0.601 0.701 0.586 0.687 0.569 0.681 0.559 0.683 0.568 0.686 0.557 0.698 0.570 0.686 0.571 0.693 0.573 0.700 0.574 0.694 0.590 0.703 0.589 0. 699 0.599 0.719 0.586 0.689 0.578 0.688 0.567 0.687 0.574 0.680 Notably, the profiles are virtually identical for 3D6 and h3D6v2 when one looks at the substitutions at each position the values fluctuate in an identical 101 manner when comparing the data in column 1 (3D6) versus column 2 (h3D6v2). These 0 data demonstrate that the specificity ofh3D6v2 is preserved, as the h3D6v2 rNET S',epitope map is virtually identical to m3D6 using both AP residues 1-4 and 5-8.

O Immunohistochemistry on PDAPP brain sections demonstrates specificity ofh3D6vl antibody. Humanized 3D6vl antibody recognized AP in cryostat prepared brain sections from PDAPP mice. Humanized 3D6vl and PK1614 both bound to 00 PDAPP plaques in the same dose response fashion, as measured by the amount of ND fluorescence (quantitated in pixels) per slide versus the amount of antibody used.to stain the tissue (Figure Identical anti-human secondary antibodies were used in this S 10 experiment. Sectioning, staining, and image procedures were previously described. In identical experiments, image analysis of h3D6v2 staining on PDAPP and AD brain sections revealed that h3D6v2 recognizes AP plaques in a similar manner to 3D6vl highly decorated plaques).

Competitive binding analysis ofh3D6. The ability ofh3D6 antibodies v1 and v2 to compete with murine 3D6 was measured by ELISA using a biotinylated 3D6 antibody. Competitive binding analysis revealed that h3D6vl, h3D6v2, and chimeric PK1614 can all compete with m3D6 to bind AP (Figure h3D6vl and h3D6v2 were identical in their ability to compete with 3D6 to Ap. The 10D5 antibody was used as a negative control, as it has a different binding epitope than 3D6. BIAcore analysis also revealed a high affinity of h3D6vl and h3D6v2 for Ap (Table 18).

Table 18: Affinity Measurements of A Antibodies Using BIAcore Technology Antibody kal (l/Ms) kdl Kd (nM) Mu 3D6 4.06E +05 3.57E-04 0.88 Chimeric 3D6 4.58E+05 3.86E-04 0.84 Hu 3D6vl 1.85E+05 3.82E-04 2.06 Hu 3D6v2 1.70E+05 3.78E-04 224 In comparison to 3D6, which has a Kd of 0.88 nM, both h3D6vl and h3D6v2 had about a 2 to 3 fold less binding affinity, measured at 2.06 nM and 2.24 nM for h3D6vl and h3D6v2, respectively. The ELISA competitive binding assay revealed an approximate 6-fold less binding affinity for h3D6vl and h3D6v2. Typically 0 humanized antibodies lose about 3-4 fold in binding affinity in comparison to their murine counterparts. Therefore, a loss of about 3 fold (average of ELISA and BIAcore O results) for h3D6vl and h3D6v2 is within the accepted range.

Ex vivo assay using h3D6v2 antibody. The ability of h3D6v2 to stimulate microglial cells was tested through an ex vivo phagocytosis assay (Figure h3D6v2 00 was as effective as chimeric 3D6 at inducing phagocytosis of Ap aggregates from O PDAPP mouse brain tissue. IgG was used as a negative control in this experiment because it is incapable of binding A3 and therefore cannot induce phagocytosis.

10 In vivo brain localization ofh3D6. 25I labeled h3D6v2, m3D6, and 0 antibody DAE13 were each IV-injected into 14 individual PDAPP mice in separate experiments. Mice were sacrificed after Day 7 and perfused for further analysis. Their brain regions were dissected and measured for 1251 activity in specific brain regions.

Radiolabel activity in the brain was compared with activity in serum samples. Results are set forth in Tables 19 and 20, for serum and brain regions, respectively.

Table 19 m3D6 DAE13 Hu3D6 30389.1 17463.9 40963.8 12171 13200.6 24202.2 3418.2 36284.7 12472.4 18678.9 421.3 33851.8 27241 19702 27187.3 26398.8 24855.8 29016.9 27924.8 29287.4 33830.7 12008.4 12733.1 26734.9 29487.8 27722.5 30144.5 25498.6 30460.7 35126.9 9652 23320.1 28414.8 24599.3 7119.1 16956.1 29240 28093.5 18190.7 11922.7 24659.7 25671.4 17443.1 26748.9 103 0 0

IN

Table m3D6 DAE13 Hu3D6 (H2L2) cere cort hipp cere cort hipp cere cort hipp 1991.9 1201.1 4024 1277.5 2522.9 5711.9 2424.6 i379.4 11622 238.9 746.1 2523 502.5 2123.5 6965.8 1509.8 2274.9 7018.2 645.9 603 1241.1 2325 3528.2 7801.6 500 2265.9 5316.3 1000 2508.2 4644.2 232.7 849.8 1891.9 2736.2 5703.7 10395.5 1266.9 3737.9 7975.8 891.6 2621 82452 1192.2 3188 10170 1422 2398.7 7731.1 1102.6 2087.5 7292.3 2269.4 3481.4 9621.6 1700.4 2154.4 7124.1 1650.6 3488.4 10284.8 1526.7 3028 8331.3 542.5 812.4 2456.8 712.9 2318.5 6643.3 1538.1 4194.1 11244.8 1309 3010.5 8693.5 1172.9 1953.6 7363 1245.7 1699.4 6831.2 1372.2 997.5 2425.4 1067.9 3697.2 12280.7 2708.8 2789 7887.4 778.6 1291.9 5654.4 1952.2 2120.7 6412.7 2251.3 3897.5 11121.5 1199.3 1683.4 4887.3 1005.2 1852.5 5121.4 1529.6 1772.2 7986.9 1021.8 3234.5 8036.2 961.5 3382.9 8473.1 644.1 1663.4 5056.5 742.1 1056.7 3405.2 852.3 1943.2 6717.4 1516.4 1620.6 9888 1273.7 1320.8 4262.6 997.5 3065.7 10213.1 The data show that h3D6v2 localized to the brain, and was particularly concentrated in the hippocampal region where A3 is known to aggregate. Brain counts for m3D6 and DAE13 were comparable to h3D6v2. All three antibodies were able to cross the blood barrier as demonstrated by AP plaque binding in vivo.

Example X. Cloning and Sequencing of the Mouse OD5 Variable Regions Cloning and Sequence Analysis ofIOD5 I. The VH and VL regions of 1 0D5 from hybridoma cells were cloned by RT-PCR using 5' RACE procedures. The nucleotide sequence (SEQ ID NO: 13) and deduced amino acid sequence (SEQ ID NO: 14) derived from two independent cDNA clones encoding the presumed 10D5 VL domain, are set forth in Table 21 and Figure 9. The nucleotide sequence (SEQ ID NO: 15) and deduced amino acid sequence (SEQ ID NO: 16) derived from two independent cDNA clones encoding the presumed 1OD5 VH domain, are set forth in Table 22 and Figure 10. The 1 OD5 VL and VH sequences meet the criteria for functional V regions in so far as they contain a contiguous ORF from the initiator methionine to the C-region, and share conserved residues characteristic of immunoglobulin V region genes.

Table 21: Mouse 10D5 VL DNA sequence A.)AAGTT CCT TTTGGCTT

TATTTCTGATGTTCTT

TGTTTTGATGACCCAAACTCCCTCTCCCTGCCTGTCAGTCTTGGAGAT

TCTCTTGCAGATCTAGTCAGAACATTATACATAGTAATGGTAGTG

TACCTGCAGAACCAGGCAGTCTCAAAGCTCCTGATCTACAAGTT

TTCTGGGTCCCAGACAGGTTCAGTGGCAGTGGATCAGGGAATAG

00 00) TCAAGAAAGTGGGGCTGAGGATCTG

GGAATTTATTACTAGTAAGT

IND CCGCTCACGTTCGGTGCTGGGACAAGCTGGAGCTGGAA (SEQ ID NO:13) C- 10 *Leader peptide underlined Table 22: Mouse 10D5 VH DNA sequence.

ATGGACAGGCTTACTTCCTCATTCCTGCTGCTGATTGTCCCTGCATATGTCC

GGCTACTCTGAAAGAGTCTGGCCCTGGAATATTGCAGTCCTCCCAGACCCTC

CTTGTTCTTTCTCTGGGTTTTCACTGAGCACTTCTGGTATGGGAGTGAGCT

CAGCCTTCAGGAAAGGGTCTGGAGTGGCTGGCACACATTTACTGGGATGATG

CTATAACCCATCCCTGAGAGCCGGCTCACTCTCCGGATACCTCCAGG

TATTCCTCAAGATCACCAGTGTGGACCGTGCAGATACTGCCACATACTAC

'AGGCCCATTACTCCGGTACTAGTCGATGCTATGGACTACTGGGGTCAAGGAACCTCAGT

CACCGTCTCCTCA (SEQ ID *Leader peptide underlined.

Example X. Prevention and Treatment of Human Subjects A single-dose phase I trial is performed to determine safety in humans. A therapeutic agent is administered in increasing dosages to different patients starting from about 0.01 the level of presumed efficacy, and increasing by a factor of three until a level of about 10 times the effective mouse dosage is reached.

A phase II trial is performed to determine therapeutic efficacy. Patients with early to mid Alzheimer's Disease defined using Alzheimer's disease and Related Disorders Association (ADRDA) criteria for probable AD are selected. Suitable patients score in the 12-26 range on the Mini-Mental State Exam (MMSE). Other selection criteria are that patients are likely to survive the duration of the study and lack complicating issues such as use of concomitant medications that may interfere. Baseline Sevaluations of patient function are made using classic psychometric measures, such as N the MMSE, and the ADAS, which is a comprehensive scale for evaluating patients with O Alzheimer's Disease status and function. These psychometric scales provide a measure S 5 of progression of the Alzheimer's condition. Suitable qualitative life scales can also be used to monitor treatment. Disease progression can also be monitored by MRI. Blood o0 profiles of patients can also be monitored including assays of immunogen-specific sO antibodies and T-cells responses.

SFollowing baseline measures, patients begin receiving treatment. They S 10 are randomized and treated with either therapeutic agent or placebo in a blinded fashion.

SPatients are monitored at least every six months. Efficacy is determined by a significant reduction in progression of a treatment group relative to a placebo group.

A second phase II trial is performed to evaluate conversion of patients from non-Alzheimer's Disease early memory loss, sometimes referred to as ageassociated memory impairment (AAMI) or mild cognitive impairment (MCI), to probable Alzheimer's disease as defined as by ADRDA criteria. Patients with high risk for conversion to Alzheimer's Disease are selected from a non-clinical population by screening reference populations for early signs of memory loss or other difficulties associated with pre-Alzheimer's symptomatology, a family history of Alzheimer's Disease, genetic risk factors, age, sex, and other features found to predict high-risk for Alzheimer's Disease. Baseline scores on suitable metrics including the MMSE and the ADAS together with other metrics designed to evaluate a more normal population are collected. These patient populations are divided into suitable groups with placebo comparison against dosing alternatives with the agent. These patient populations are followed at intervals of about six months, and the endpoint for each patient is whether or not he or she converts to probable Alzheimer's Disease as defined by ADRDA criteria at the end of the observation.

General Materials and Methods A. Preparation of Polyclonal and Monoclonal AB Antibodies The anti-Ap polyclonal antibody was prepared from blood collected from two groups of animals. The first group consisted of 100 female Swiss Webster mice, 6 to 8 weeks of age. They were immunized on days 0, 15, and 29 with 100 g ofAN1792 Scombined with CFA/IFA. A fourth injection was given on day 36 with one-half the dose ofAN1792. Animals were exsanguinated upon sacrifice at day 42, serum was prepared 0 and the sera were pooled to create a total of 64 ml. The second group consisted of 24 female mice isogenic with the PDAPP mice but nontransgenic for the human APP gene, 6 to 9 weeks of age. They were immunized on days 0, 14, 28 and 56 with 100 tg of 00 AN1792 combined with CFA/IFA. These animals were also exsanguinated upon Ssacrifice at day 63, serum was prepared and pooled for a total of 14 ml. The two lots of sera were pooled. The antibody fraction was purified using two sequential rounds of precipitation with 50% saturated ammonium sulfate. The final precipitate was dialyzed against PBS and tested for endotoxin. The level of endotoxin was less than 1 EU/mg.

The anti-A monoclonal antibodies were prepared from ascites fluid.

The fluid was first delipidated by the addition of concentrated sodium dextran sulfate to ice-cold ascites fluid by stirring on ice to a reach a final concentration of 0.23.8%.

Concentrated CaC 2 l was then added with stirring to reach a final concentration of 64mM. This solution was centrifuged at 10,000 x g and the pellet was discarded. The supernatant was stirred on ice with an equal volume of saturated ammonium sulfate added dropwise. The solution was centrifuged again at 10,000 x g and the supernatant was discarded. The pellet was resuspended and dialyzed against 20 mM Tris-HCI 0.4 M NaCI, pH 7.5. This fraction was applied to a Pharmacia FPLC Sepharose Q Column and eluted with a reverse gradient from 0.4 M to 0.275 M NaCI in 20 mM Tris-HCl, pH The antibody peak was identified by absorbance at 280 nm and appropriate fractions were pooled. The purified antibody preparation was characterized by measuring the protein concentration using the BCA method and the purity using SDS-PAGE. The pool was also tested for endotoxin. The level of endotoxin was less than 1 EU/mg. titers, titers less than 100 were arbitrarily assigned a titer value of B. Measurement of Antibody Titers Mice were bled by making a small nick in the tail vein and collecting about 200 fl of blood into a microfuge tube. Guinea pigs were bled by first shaving the back hock area and then using an 18 gauge needle to nick the metatarsal vein and collecting the blood into microfuge tubes. Blood was allowed to clot for one hr at room 0 temperature vortexed, then centrifuged at 14,000 x g for 10 min to separate the clot from the serum. Serum was then transferred to a clean microfuge tube and stored at O 4°C until titered.

Antibody titers were measured by ELISA. 96-well microtiter plates (Costar EIA plates) were coated with 100 pl of a solution containing either 10 Pg/ml 00 either Ap42 or SAPP or other antigens as noted in each of the individual reports in Well Coating Buffer (0.1 M sodium phosphate, pH 8.5, 0.1% sodium azide) and held overnight at RT. The wells were aspirated and sera were added to the wells starting at a 0 10 1/100 dilution in Specimen Diluent (0.014 M sodium phosphate, pH 7.4,0.15 M NaCI, CI 0.6% bovine serum albumin, 0.05% thimerosal). Seven serial dilutions of the samples were made directly in the plates in three-fold steps to reach a final dilution of 1/218,700.

The dilutions were incubated in the coated-plate wells for one hr at RT. The plates were then washed four times with PBS containing 0.05% Tween 20. The second antibody, a goat anti-mouse Ig conjugated to horseradish peroxidase (obtained from Boehringer Mannheim), was added to the wells as 100 p1 of a 1/3000 dilution in Specimen Diluent and incubated for one hr at RT. Plates were again washed four times in PBS, Tween To develop the chromogen, 100 tl of Slow TMB 3 3 ',5,5'-tetramethyl benzidine obtained from Pierce Chemicals) was added to each well and incubated for 15 min at RT. The reaction was stopped by the addition of 25 lp of 2 M H2S04. The color intensity was then read on a Molecular Devices Vmax at (450 nm 650 nm).

Titers were defined as the reciprocal of the dilution of serum giving one half the maximum OD. Maximal OD was generally taken from an initial 1/100 dilution, except in cases with very high titers, in which case a higher initial dilution was necessary to establish the maximal OD. If the 50% point fell between two dilutions, a linear extrapolation was made to calculate the final titer. To calculate geometric mean antibody titers, titers less than 100 were arbitrarily assigned a titer value of C. Brain Tissue Preparation After euthanasia, the brains were removed and one hemisphere was prepared for immunohistochemical analysis, while three brain regions (hippocampus, cortex and cerebellum) were dissected from the other hemisphere and used to measure r the concentration of various Ap proteins and APP forms using specific ELISAs O (Johnson-Wood et al., supra).

Tissues destined for ELISAs were homogenized in 10 volumes ofice- O cold guanidine buffer (5.0 M guanidine-HCl, 50 mM Tris-HCl, pH The homogenates were mixed by gentle agitation using an Adams Nutator (Fisher) for three to four hr at RT, then stored at -20°C prior to quantitation of Ap and APP. Previous 00 experiments had shown that the analytes were stable under this storage condition, and Sthat synthetic Ap protein (Bachem) could be quantitatively recovered when spiked into .1 homogenates of control brain tissue from mouse littermates (Johnson-Wood et al., supra).

D. Measurement of Ap Levels The brain homogenates were diluted 1:10 with ice cold Casein Diluent (0.25% casein, PBS, 0.05% sodium azide, 20 pg/ml aprotinin, 5 mM EDTA pH 8.0, pg/ml leupeptin) and then centrifuged at 16,000 x g for 20 min at 4° C. The synthetic AP protein standards (1-42 amino acids) and the APP standards were prepared to include M guanidine and 0.1% bovine serum albumin (BSA) in the final composition. The "total" Ap sandwich ELISA utilizes monoclonal antibody monoclonal antibody 266, specific for amino acids 13-28 of Ap (Seubert et al., supra), as the capture antibody, and biotinylated monoclonal antibody 3D6, specific for amino acids 1-5 ofA (Johnson- Wood et supra), as the reporter antibody. The 3D6 monoclonal antibody does not recognize secreted APP or full-length APP, but detects only Ap species with an aminoterminal aspartic acid. This assay has a lower limit of sensitivity of 50 ng/ml (1 lnM) and shows no cross-reactivity to the endogenous murine AP protein at concentrations up to 1 ng/ml (Johnson-Wood et al., supra).

The A1l-42 specific sandwich ELISA employs mAp 21F12, specific for amino acids 33-42 of Ap (Johnson-Wood, et al. supra), as the capture antibody.

Biotinylated mAP 3D6 is also the reporter antibody in this assay which has a lower limit of sensitivity of about 125 pg/ml (28 pM, Johnson-Wood et al., supra). For the Ap ELISAs, 100 p of either mAp 266 (at 10 pg/ml) or mAp 21F12 at (5 pg/ml) was coated into the wells of 96-well immunoassay plates (Costar) by overnight incubation at 109 RT. The solution was removed by aspiration and the wells were blocked by the addition 0of 200 pl of 0.25% human serum albumin in PBS buffer for at least 1 hr at RT.

Blocking solution was removed and the plates were stored desiccated at 4 0 C until used.

0 The plates were rehydrated with Wash Buffer [Tris-buffered saline (0.15 M NaCI, 0.01 S 5 M Tris-HC1, pH plus 0.05% Tween 20] prior to use. The samples and standards were added in triplicate aliquots of 100 gl per well and then incubated overnight at OC C. The plates were washed at least three times with Wash Buffer between each step of the assay. The biotinylated mA3 3D6, diluted to 0.5 pg/ml in Casein Assay Buffer (0.25% casein, PBS, 0.05% Tween 20, pH was added and incubated in the wells for 0 10 1 hr at RT. An avidin-horseradish peroxidase conjugate, (Avidin-HRP obtained from -N Vector, Burlingame, CA), diluted 1:4000 in Casein Assay Buffer, was added to the wells for 1 hr at RT. The colorimetric substrate, Slow TMB-ELISA (Pierce), was added and allowed to react for 15 minutes at RT, after which the enzymatic reaction was stopped by the addition of 25 pl 2 N H2S04. The reaction product was quantified using a Molecular Devices Vmax measuring the.difference in absorbance at 450 nm and 650 nm.

E. Measurement of APP Levels Two different APP assays were utilized. The first, designated APP-a/FL, recognizes both APP-alpha and full-length (FL) forms of APP. The second assay is specific for APP-c. The APP-a /FL assay recognizes secreted APP including the first 12 amino acids of A. Since the reporter antibody (2H3) is not specific to the a-clipsite, occurring between amino acids 612-613 of APP 6 95 (Esch et al., Science 248:1122- 1124 (1990)); this assay also recognizes full length APP (APP-FL). Preliminary experiments using immobilized APP antibodies to the cytoplasmic tail of APP-FL to deplete brain homogenates of APP-FL suggest that approximately 30-40% of the APP-a /FL APP is FL (data not shown). The capture antibody for both the APP-a/FL and APPa assays is mAb 8E5, raised against amino acids 444 to 592 of the APP 6 9 5 form (Games et al., supra). The reporter mAb for the APP-a/FL assay is mAb 2H3, specific for amino acids 597-608 of APP 69 5 (Johnson-Wood et al., supra) and the reporter antibody for the APP-a assay is a biotinylated derivative of mAb 16H9, raised to amino acids 605 110 to 611 of APP. The lower limit of sensitivity of the APP-aFL assay is about 11 ng/ml (150 pM) (Johnson-Wood et al.) and that of the APP-a specific assay is 22 ng/ml (0.3 SnM). For both APP assays, mAb 8E5 was coated onto the wells of 96-well EIA plates as o described above for mAb 266. Purified, recombinant secreted APP-a was used as the N 5 reference standard for the APP-a assay and the APP-a/FL assay (Esch et al., supra).

The brain homogenate samples in 5 M guanidine were diluted 1:10 in ELISA Specimen 00 Diluent (0.014 M phosphate buffer, pH 7.4, 0.6% bovine serum albumin, 0.05% Sthimerosal, 0.5 M NaCl, 0.1% NP40). They were then diluted 1:4 in Specimen Diluent c containing 0.5 M guanidine. Diluted homogenates were then centrifuged at 16,000 x g g 10 for 15 seconds at RT. The APP standards and samples were added to the plate in iN duplicate aliquots and incubated for 1.5 hr at RT. The biotinylated reporter antibody 2H3 or 16H9 was incubated with samples for 1 hr at RT. Streptavidin-alkaline phosphatase (Boehringer Mannheim), diluted 1:1000 in specimen diluent, was incubated in the wells for 1 hr at RT. The fluorescent substrate 4 -methyl-umbellipheryl-phosphate was added for a 30-min RT incubation and the plates were read on a Cytofluor tm 2350 fluorimeter (Millipore) at 365 nm excitation and 450 nm emission.

F. Immunohistochemistry Brains were fixed for three days at 40C in 4% paraformaldehyde in PBS and then stored from one to seven days at 4°C in 1% paraformaldehyde, PBS until sectioned. Forty-micron-thick coronal sections were cut on a vibratome at RT and stored in cryoprotectant (30% glycerol, 30% ethylene glycol in phosphate buffer) at 0 C prior to immunohistochemical processing. For each brain, six sections at the level of the dorsal hippocampus, each separated by consecutive 240 plm intervals, were incubated overnight with one of the following antibodies: a biotinylated anti-Ap (mAb, 3D6, specific for human Ap) diluted to a concentration of 2 pg/ml in PBS and 1% horse serum; or a biotinylated mAb specific for human APP, 8E5, diluted to a concentration of 3 pg/ml in PBS and 1.0% horse serum; or a mAb specific for glial fibrillary acidic protein (GFAP; Sigma Chemical Co.) diluted 1:500 with 0.25% Triton X-100 and 1% horse serum, in Tris-buffered saline, pH 7.4 (TBS); or a mAb specific for CD1 ib, MAC-1 antigen, (Chemicon International) diluted 1:100 with 0.25% Triton X-100 and 1% rabbit serum in TBS; or a mAb specific for MHC II antigen, 1^ (Pharmingen) diluted 1:100 with 0.25% Triton X-100 and 1% rabbit serum in TBS; or a rat Ab specific for CD 43 (Pharingen) diluted 1:100 with rabbit seru in PBS or a rat mAb specific for CD 45RA (Pharmingen) diluted 1:100 with 1% rabbit serum in SPBS or a rat mAb specific for CD 45RA (Pharmingen) diluted 1:100 with 1% rabbit 0 serum in PBS; or a rat monoclonal AP specific for CD 45RB (Pharmingen) diluted 1:100 with 1% rabbit serum in PBS; or a rat monoclonal Ap specific for CD (Pharmingen) diluted 1:100 with 1% rabbit serum in PBS; or (10) a biotinylated 00 polyclonal hamster AP specific for CD3e (Pharmingen) diluted 1:100 with 1% rabbit

ID

Sserum in PBS or (11) a rat mAb specific for CD3 (Serotec) diluted 1:200 with 1% rabbit ci. serum in PBS; or with (12) a solution of PBS lacking a primary antibody containing 1% 0 10 normal horse serum.

Sections reacted with antibody solutions listed in 1,2 and 6-12 above were pretreated with 1.0% Triton X-100, 0.4% hydrogen peroxide in PBS for 20 min at RT to block endogenous peroxidase. They were next incubated overnight at 4°C with primary antibody. Sections reacted with 3D6 or 8E5 or CD3e mAbs were then reacted for one hr at RT with a horseradish peroxidase-avidin-biotin-complex with kit components and diluted 1:75 in PBS (Vector Elitd Standard Kit, Vector Labs, Burlingame, Sections reacted with antibodies specific for CD 45RA, CD CD 45, CD3 and the PBS solution devoid of primary antibody were incubated for 1 hour at RT with biotinylated anti-rat IgG (Vector) diluted 1:75 in PBS or biotinylated antimouse IgG (Vector) diluted 1:75 in PBS, respectively., Sections were then reacted for one hr at RT with a horseradish peroxidase-avidin-biotin-complex with kit components and diluted 1:75 in PBS (Vector Elite Standard Kit, Vector Labs, Burlingame,

CA.).

Sections were developed in 0.01% hydrogen peroxide, 0.05% 3,3'diaminobenzidine (DAB) at RT. Sections destined for incubation with the GFAP-, MAC-1- AND MHC 1-specific antibodies were pretreated with 0.6% hydrogen peroxide at RT to block endogenous peroxidase then incubated overnight with the primary antibody at 4 0 C. Sections reacted with the GFAP antibody were incubated for 1 hr at RT with biotinylated anti-mouse IgG made in horse (Vector Laboratories; Vectastain Elite ABC Kit) diluted 1:200 with TBS. The sections were next reacted for one hr with an avidin-biotin-peroxidase complex (Vector Laboratories; Vectastain Elite ABC Kit) diluted 1:1000 with TBS. Sections incubated with the MAC-1-or MHC IIspecific monoclonal antibody as the primary antibody were subsequently reacted for 1 hr Sat RT with biotinylated anti-rat IgG made in rabbit diluted 1:200 with TBS, followed by incubation for one hr with avidin-biotin-peroxidase complex diluted 1:1000 with TBS.

O Sections incubated with GFAP-, MAC-1- and MHC II-specific antibodies, were then C 5 visualized by treatment at RT with 0.05% DAB, 0.01% hydrogen peroxide, 0.04% nickel chloride, TBS for 4 and 11 min, respectively.

0 Immunolabeled sections were mounted on glass slides (VWR, Superfrost Sslides), air dried overnight, dipped in Propar (Anatech) and overlaid with coverslips using Permount (Fisher) as the mounting medium.

O 10 To counterstain A3 plaques, a subset of the GFAP-positive sections were C. mounted on Superfrost slides and incubated in aqueous 1% Thioflavin S (Sigma) for 7 min following immunohistochemical processing. Sections were then dehydrated and cleared in Propar, then overlaid with coverslips mounted with Permount.

G. Image Analysis A Videometric 150 Image Analysis System (Oncor, Inc., Gaithersburg, MD) linked to a Nikon Microphot-FX microscope through a CCD video camera and a Sony Trinitron monitor was used for quantification of the immunoreactive slides. The image of the section was stored in a video buffer and a color-and saturation-based threshold was determined to select and calculate the total pixel area occupied by the immunolabeled structures. For each section, the hippocampus was manually outlined and the total pixel area occupied by the hippocampus was calculated. The percent amyloid burden was measured as: (the fraction of the hippocampal area containing

AP

deposits immunoreactive with mAb 3D6) x 100. Similarly, the percent neuritic burden was measured as: (the fraction of the hippocampal area containing dystrophic neurites reactive with monoclonal antibody 8E5) xl00. The C-Imaging System (Compix, Inc., Cranberry Township, PA) operating the Simple 32 Software Application program was linked to a Nikon Microphot-FX microscope through an Optronics camera and used to quantitate the percentage of the retrospenial cortex occupied by GFAP-positive astrocytes and MAC-1-and MHC II-positive microglia. The image of the immunoreacted section was stored in a video buffer and a monochrome-based threshold was determined to select and calculate the total pixel area occupied by immunolabeled cells. For each section, the retrosplenial cortex (RSC) was manually outlined and the Stotal pixel area occupied by the RSC was calculated. The percent astrocytosis was defined as: (the fraction of RSC occupied by GFAP-reactive astrocytes) X 100.

O Similarly, percent microgliosis was defined as: (the fraction of the RSC occupied by C 5 MAC-1- or MHC II-reactive microglia) X 100. For all image analyses, six sections at the level of the dorsal hippocampus, each separated by consecutive 240 Vnm intervals, 00 c were quantitated for each animal. In all cases, the treatment status of the animals was unknown to the observer.

O C-i Although the foregoing invention has been described in detail for purposes of clarity of understanding, it will be obvious that certain modifications may be practiced within the scope of the appended claims. All publications and patent documents cited herein, as well as text appearing in the figures and sequence listing, are hereby incorporated by reference in their entirety for all purposes to the same extent as if each were so individually denoted.

From the foregoing it will be apparent that the invention provides for a number of uses. For example, the invention provides for the use of any of the antibodies to AP described above in the treatment, prophylaxis or diagnosis of amyloidogenic disease, or in the manufacture of a medicament or diagnostic composition for use in the same.

Claims (7)

1. 2. The light chain of claim 1, which comprises at least one substitution of a vernier zone framework residue or at least one substitution of a rare framework residue.
2. 3. The light chain of claim 1 or 2, which comprises at least one substitution of a vernier zone framework residue.
3. 4. The light chain of claim 1 or 2, which comprises at least one substitution of a rare framework residue. The light chain of any one of the preceding claims, wherein the canonical framework residue is selected from the group consisting of L2, L48, L64, and L71 (Kabat numbering convention).
4. 6. The light chain of any one of the preceding claims, wherein the interchain packing framework residue is selected from the group consisting of L36, L38, L44, L46, L87, and L98 (Kabat numbering convention).
5. 7. The light chain of any one of the preceding claims, wherein the vernier zone framework residue is selected from the group consisting of L4, L35, L47, L49, L66, L68, and L69 (Kabat numbering convention).
6. 8. The light chain of any one of the preceding claims, wherein the rare framework residue is selected from the group consisting of LI, L15, L83, and L85 (Kabat numbering convention).
7. 991747-1:gcc 116 1 9. The light chain of any one of the preceding claims, which comprises three complementarity determining regions (CDRs 1-3) from the 3D6 immunoglobulin light O chain variable region sequence. 10. The light chain of any one of the preceding claims, which comprises a substitution of the L2 canonical framework residue (Kabat numbering 0 0 convention), IN a substitution of the L36 and L46 interchain packing framework residue (Kabat numbering convention), and a substitution of the L1 rare framework residue (Kabat numbering S 10 convention), wherein the substitution is with the corresponding amino acid residue from the mouse 3D6 light chain variable region sequence, and wherein the remainder of the light chain is from a human immunoglobulin. 11. The light chain of any one of the preceding claims, which comprises a substitution of the L2 canonical framework residue (Kabat numbering convention), and a substitution of the L36 and L46 interchain packing framework residue (Kabat numbering convention), wherein the substitution is with the corresponding amino acid residue from the mouse 3D6 light chain variable region sequence, and wherein the remainder of the light chain is from a human immunoglobulin. 12. The light chain of any one of the preceding claims, wherein human immunoglobulin acceptor light chain sequence is of the subtype kappa II (Kabat convention). 13. The light chain of claim 12, wherein the human acceptor immunoglobulin light chain sequence is selected from the group consisting of Kabat ID 019230, Kabat ID 00131, Kabat ID 005058, Kabat ID 005057, Kabat ID 005059, Kabat ID U21040 and Kabat ID U41645. 14. The light chain of any one of the preceding claims, wherein at least one rare framework residue of the light chain is substituted with an amino acid residue which is common for human variable light chain sequences at that position. The light chain of any one of the preceding claims, wherein at least one rare framework residue of the light chain is substituted with a corresponding amino acid residue from a germline variable light chain sequence. 991747-I:gcc t 117 S16. The light chain of claim 15, wherein the germline variable light chain Ssequence is selected from the group consisting of Al, A17, A18, A2, and A19. C 17. The light chain of any one of claims 14-16, wherein the rare framework C residue of the light chain is selected based on occurrence at that position in less than of human light chain variable region sequences in the light chain variable region 00 00subgroup, and the common residue is selected based on an occurrence at that position in INO greater than 50% of sequences in the light chain variable region subgroup. 18. A humanized immunoglobulin heavy chain comprising at least one variable region complementarity determining region (CDR) from the 3D6 immunoglobulin heavy chain variable region sequence set forth as SEQ ID NO:4, and (ii) a variable framework region from a human acceptor immunoglobulin heavy chain sequence, wherein the heavy chain comprises at least one substitution of a canonical framework residue, at least one substitution of an interchain packing framework residue, and at least one substitution of a vernier zone framework residue or at least one substitution of a rare framework residue, and wherein the substitution is the corresponding amino acid residue from the mouse 3D6 heavy chain variable region sequence. 19. The heavy chain of claim 18, which comprises at least one substitution of a vernier zone framework residue. The heavy chain of claim 18, which comprises at least one substitution of a rare framework residue. 21. The heavy chain of claim 18, wherein the canonical framework residue is selected from the group consisting of H24, H26, H27, H29, H71, and H94 (Kabat numbering convention). 22. The heavy chain of claim 18 or 19, wherein the interchain packing framework residue is selected from the group consisting of H37, H39, H45, H47, H91, H93, and H 103 (Kabat numbering convention). 23. The heavy chain of any one of claims 18-20, wherein the vernier zone framework residue is selected from the group consisting of H2, H28, H30, H48, H49, H67, 1-169, and H80 (Kabat numbering convention). 991747-Igcc 118 C 24. The heavy chain of any one of claims 18-23, wherein the rare framework Sresidue is selected from the group consisting of H40 and H42 (Kabat numbering 0 convention). CN 25. The heavy chain of any one of claims 18-24, which comprises three complementarity determining regions (CDRs 1-3) from the 3D6 immunoglobulin heavy 0 c chain variable region sequence. 26. The heavy chain of any one of claims 18-25, which comprises a substitution of the H94 canonical framework residue (Kabat numbering convention), a substitution of the H93 interchain packing framework residue (Kabat numbering convention), and a substitution of the H49 vernier zone framework residue (Kabat numbering convention), wherein, the substitution is the corresponding amino acid residue from the mouse 3D6 heavy chain variable region sequence, and wherein the remainder of the heavy chain is from a human immunoglobulin. 27. The heavy chain of any one of claims 18-26, wherein human immunoglobulin acceptor heavy chain sequence is of the subtype III (Kabat convention). 28. The heavy chain of claim 27, wherein the human acceptor immunoglobulin heavy chain sequence is selected from the group consisting of Kabat ID 045919, Kabat ID 000459, Kabat ID 000553, Kabat ID 000386 and Kabat ID M23691. 29. The heavy chain of any one of claims 18-28, wherein at least one rare framework residue of the heavy chain is substituted with an amino acid residue which is common for human variable heavy chain sequences at that position. 30. The heavy chain of any one of claims 18-29, wherein at least one rare framework residue of the heavy chain is substituted with a corresponding amino acid residue from a germline variable heavy chain sequence. 31. The heavy chain of claim 30, wherein the germline variable heavy chain sequence is selected from the group consisting of VH3-48, VH3-23, VH3-7, VH3-21 and VH3-11. 32. The heavy chain of any one of claims 29-31, wherein the rare framework residue of the heavy chain is selected based on occurrence at that position in less than of human heavy chain variable region sequences in the heavy chain variable region 991747- :gcc 119 subgroup, and the common residue is selected based on an occurrence at that position in 0 greater than 50% of sequences in the heavy chain variable region subgroup. O 33. A humanized immunoglobulin which specifically binds to beta amyloid c peptide comprising the light chain of any one of claims 1-17, and the heavy chain of any one of claims 18-32, or an antigen-binding fragment of said immunoglobulin. 0 0 34. A humanized immunoglobulin, or antigen-binding fragment thereof, which i specifically binds to beta amyloid peptide (Ap) with a binding affinity of at least 10 7 comprising a light chain comprising at least one variable region complementarity S to determining region (CDR) from the 3D6 immunoglobulin light chain variable region sequence set forth as SEQ ID NO:2, and a variable framework region from a human acceptor immunoglobulin light chain sequence, and (ii) a heavy chain comprising at least one variable region CDR from the 3D6 immunoglobulin heavy chain variable region sequence set forth as SEQ ID NO:4, and a variable framework region from a human acceptor immunoglobulin heavy chain, provided that the humanized immunoglobulin, or antigen-binding fragment thereof, comprises: at least one substitution of a canonical framework residue selected from the group consisting of L2, L48, L64, L71, H24, H26, H27, H29, H71, and H94 (Kabat numbering convention), at least one substitution of an interchain packing framework residue selected from the group consisting of L36, L38, L44, L46, L87, L98, H37, H39, H47, H91, H93, and H103 (Kabat numbering convention), and at least one substitution of a vernier zone framework residue selected from the group consisting of L4, L35, L47, L49, L66, L68, L69, H2, H28, H48, H49, H67, H69, and H80 (Kabat numbering convention), or at least one substitution of a rare framework residue selected from the group consisting of L1, L15, L83, L85, and H42 (Kabat numbering convention), wherein the substitution is with the corresponding amino acid residue from the mouse 3D6 light chain variable region sequence or the mouse 3D6 heavy chain variable region sequence. The humanized immunoglobulin or antigen-binding fragment of claim 34, comprising at least one substitution of a vernier zone framework residue selected from the 991747-1:gcc 120 N group consisting of L4, L35, L47, L49, L66, L68, L69, H2, H28, H30, H48, H49, H67, .H69, and O 36. The humanized immunoglobulin or antigen-binding fragment of claim 34, N comprising at least one substitution of a rare framework residue selected from the group s consisting of L1, L15, L83, L85, H40 and H42. 0037. The humanized immunoglobulin or antigen-binding fragment of claim 34, IN wherein the light chain comprises three complementarity determining regions (CDRs 1-3) from the 3D6 immunoglobulin light chain variable region sequence. 38. The humanized immunoglobulin or antigen-binding fragment of claim 28 or S 10 35, wherein the heavy chain comprises three complementarity determining regions (CDRs 1-3) from the 3D6 immunoglobulin heavy chain variable region sequence. 39. The humanized immunoglobulin or antigen-binding fragment of any one of claims 36-38, wherein the light chain comprises three complementarity determining regions (CDRs 1-3) from the 3D6 immunoglobulin light chain variable region sequence is and the heavy chain comprises three complementarity determining regions (CDRs 1-3) from the 3D6 immunoglobulin heavy chain variable region sequence. The humanized immunoglobulin or antigen-binding fragment of any one of claims 36-39, comprising: at least one substitution of a vernier zone framework residue selected from the group consisting of L4, L35, L47, L49, L66, L68, L69, H2, H28, H30, H48, H49, H67, H69, and H80 (Kabat numbering convention), and (ii) at least one substitution of a rare framework residue selected from the group consisting of LI, L15, L83, L85, H40 and H42 (Kabat numbering convention). 41. The humanized immunoglobulin or antigen-binding fragment of any one of claims 36-40, wherein human acceptor immunoglobulin light chain sequence is of the subtype kappa II (Kabat convention). 42. The humanized immunoglobulin or antigen-binding fragment of any one of claims 36-41, wherein human acceptor immunoglobulin heavy chain sequence is of the subtype III (Kabat convention). 43. The humanized immunoglobulin or antigen-binding fragment of claim 41, wherein the human acceptor immunoglobulin light chain sequence is selected from the group consisting of Kabat ID 019230, Kabat ID 005131, Kabat ID 005058, Kabat ID 005057, Kabat ID 005059, Kabat ID U21040 and Kabat ID U41645. 991747-1:gcc 121 44. The humanized immunoglobulin or antigen-binding fragment of any one of Sclaims 36-43, wherein at least one rare framework residue of the light chain is substituted O with an amino acid residue which is common for human variable light chain sequences at Ci that position. 45. The humanized immunoglobulin or antigen-binding fragment of any one of 0 0 claims 36-44, wherein at least one rare human framework residue of the light chain is I substituted with a corresponding amino acid residue from a germline variable light chain C sequence. 46. The humanized immunoglobulin or antigen-binding fragment of claim wherein the germline variable light chain sequence is selected from the group consisting ofAl, A17, A18, A2, and A19. 47. The humanized immunoglobulin or antigen-binding fragment of any one of claims 44-46, wherein the rare framework residue of the light chain is selected based on occurrence at that position in less than 10% of human light chain variable region sequences in the light chain variable region subgroup, and the common residue is selected based on an occurrence at that position in greater than 50% of sequences in the light chain variable region subgroup. 48. The humanized immunoglobulin or antigen-binding fragment of any one of claims 36-47, wherein the human acceptor immunoglobulin heavy chain is selected from the group consisting of Kabat ID 045919, Kabat ID 000459, Kabat ID 000553, Kabat ID 000386 and Kabat ID M23691. 49. The humanized immunoglobulin or antigen-binding fragment of any one of claims 36-48, wherein at least one rare framework residue of the heavy chain is substituted with an amino acid residue which is common for human variable heavy chain sequences at that position. The humanized immunoglobulin or antigen-binding fragment of any one of claims 36-49, wherein at least one rare human framework residue of the heavy chain is substituted with a corresponding amino acid residue from a germline variable heavy chain sequence. 51. The humanized immunoglobulin or antigen-binding fragment of claim 42, wherein the germline variable heavy chain sequence is selected from the group consisting of VH3-48, VH3-23, VH3-7, VH3-21 and VH3-1 1. 52. The humanized immunoglobulin or antigen-binding fragment of any one of claims 49-51, wherein the rare framework residue of the heavy chain is selected based on 991747-1:gcc 122 C occurrence at that position in less than 10% of human heavy chain variable region a sequences in the heavy chain variable region subgroup, and the common residue is O selected based on an occurrence at that position in greater than 50% of sequences in the CN heavy chain variable region subgroup. 53. The humanized immunoglobulin or antigen-binding fragment of any one of 0 O claims 33-52, wherein the humanized immunoglobulin or antigen-binding fragment ,O specifically binds to beta amyloid peptide (AP) with a binding affinity of at least 108 M'. 54. The humanized immunoglobulin or antigen-binding fragment of any one of claims 33-52, wherein the humanized immunoglobulin or antigen-binding fragment 1to specifically binds to beta amyloid peptide (AP) with a binding affinity of at least 10 9 M-. The humanized immunoglobulin or antigen-binding fragment of any one of claims 33-54, which binds to both soluble beta amyloid peptide (AP) and aggregated Ap. 56. The humanized immunoglobulin or antigen-binding fragment of claim wherein the soluble beta amyloid peptide (Ap) is disaggregated Ap. 57. The humanized immunoglobulin or antigen-binding fragment of any one of claims 33-56, which mediates phagocytosis of beta amyloid peptide (Ap). 58. The humanized immunoglobulin or antigen-binding fragment of any one of claims 33-57, which crosses the blood-brain barrier in a subject. 59. The humanized immunoglobulin or antigen-binding fragment of any one of claims 33-58, which reduces both beta amyloid peptide (AP) burden and neuritic dystrophy in a subject. The humanized immunoglobulin or antigen-binding fragment of any one of claims 33-59, wherein the fragment is selected from the group consisting of a Fab, a Fab', a Fabc, a Fv, and a Fab'2 fragment. 61. A pharmaceutical composition comprising the humanized immunoglobulin or antigen-binding fragment of any one of claims 33-60 and a pharmaceutical carrier. 62. A kit comprising the humanized immunoglobulin or antigen-binding fragment of any one of claims 33-61 together with instructions for use. 63. The humanized immunoglobulin or antigen binding fragment of any one of claims 34-61 for use as a medicament. 64. The humanized immunoglobulin or antigen binding fragment of any one of claims 34-61 for use in preventing or treating an amyloidogenic disease in a patient by administration of an effective dosage of the immunoglobulin or antigen binding fragment. 991747-:1gcc 123 I 65. The humanized immunoglobulin or antigen binding fragment of any one of claims 34-61 for use in preventing or treating Alzheimer's disease in a patient by O administration of an effective dosage of the immunoglobulin or antigen binding fragment. c 66. The humanized immunoglobulin or antigen binding fragment of claim 64 or 65, wherein the effective dosage is 1 mg/kg body weight. 0 0 67. The humanized immunoglobulin or antigen binding fragment of claim 64 or IND 65, wherein the effective dosage is 10 mg/kg body weight. n 68. Use of a humanized immunoglobulin or antigen binding fragment of any one of claims 34-61 in the manufacture of a medicament for the prevention or treatment of an amyloidogenic disease in a patient. 69. Use of a humanized immunoglobulin or antigen binding fragment of any one of claims 34-61 in the manufacture of a medicament for the prevention or treatment of Alzheimer's disease in a patient. An isolated nucleic acid molecule encoding the light chain of any one of claims 1-17. 71. An isolated nucleic acid molecule encoding the heavy chain of any one of claims 18-32. 72. A vector comprising the nucleic acid molecule of claim 70 or 71. 73. A host cell comprising the nucleic acid molecule of claim 70 or 71. 74. A host cell comprising the vector of claim 72. A method of producing an antibody, or fragment thereof, comprising culturing the host cell of claim 73 or 74 under conditions such that the antibody or fragment is produced and isolating said antibody from the host cell or culture. 76. A humanized immunoglobulin, or an antigen-binding fragment thereof, which specifically binds to beta amyloid peptide (Ap) with a binding affinity of at least 107 M', wherein the humanized antibody comprises: a light chain comprising a variable light chain region comprising the complementarity determining regions (CDRs) and at least one variable light chain framework residue selected from the group consisting of L1, L2, L4, L15, L35, L36, L38, L44, L46, L47, L48, L49, L64, L66, L68, L69, L71, L83, L85, L87, and L98 (Kabat numbering convention) from the 3D6 immunoglobulin light chain variable region sequence set forth as SEQ ID NO:2, wherein the remainder of the variable light chain region is from a human acceptor immunoglobulin light chain, and 991747-1 gcC 124 C- a heavy chain comprising a variable heavy chain region having the Ssequence as set forth in residues 1-119 ofSEQ ID NO:8 or SEQ ID NO:12. O 77. A humanized immunoglobulin, or an antigen-binding fragment thereof, which i specifically binds to beta amyloid peptide (AP) with a binding affinity of at least 10 7 M", wherein the humanized antibody comprises: o 0 a heavy chain comprising a variable heavy chain region comprising the N complementarity determining regions (CDRs) and at least one variable heavy chain framework residue selected from the group consisting of H2, H24, H26, H27, H28, H29, H37, H39, H40, H42, H45, H47, H48, H49, H67, H69, H71, H80, H91, H93, H94, S to and H103 (Kabat numbering convention) from the 3D6 immunoglobulin heavy chain variable region sequence set forth as SEQ ID NO:4, wherein the remainder of the variable heavy chain region is from a human acceptor immunoglobulin heavy chain, and a light chain comprising a variable light chain region having the sequence as set forth in residues 1-112 of SEQ ID NO:5 or SEQ ID NO:1 1. is 78. The humanized immunoglobulin of claim 76, wherein at least three variable light chain framework residues are selected from the group consisting of L1, L2, L4, L36, L38, L44, L46, L47, L48, L49, L64, L66, L68, L69, L71, L83, L85, L87, and L98 (Kabat numbering convention). 79. The humanized immunoglobulin of claim 77, wherein at least three variable heavy chain framework residues are selected from the group consisting of H2, H24, H26, H27, H28, H29, H30, H37, H39, H40, H42, H45, H47, H48, H49, H67, H69, H71, H91, H93, H94, and H103 (Kabat numbering convention). A humanized immunoglobulin, or an antigen-binding fragment thereof, which specifically binds to beta amyloid peptide (AP) with a binding affinity of at least 107 M 1 wherein the humanized antibody comprises: a light chain comprising a variable light chain region comprising the complementarity determining regions (CDRs) from the 3D6 immunoglobulin light chain variable region sequence set forth as SEQ ID NO:2; at least one variable light chain canonical framework residue selected from the group consisting of L2, L48, L64, and L71 (Kabat numbering convention) from SEQ ID NO:2; and at least one variable light chain interchain packing framework residue selected from the group consisting of L36, L38, L44, L46, L87, and L98 (Kabat numbering convention) from SEQ ID NO:2; and, optionally, 991747-l:gcc 125 S(d) at least one variable light chain vernier zone framework residue Sselected from the group consisting of L4, L35, L47, L49, L66, L68, and L69 (Kabat O numbering convention) from SEQ ID NO:2, or at least one variable light chain rare N framework residue selected from the group consisting of LI, L15, L83, and L85 (Kabat numbering convention) from SEQ ID NO:2; O 0 wherein the remainder of the variable light chain region is from a human acceptor immunoglobulin light chain; and (ii) a heavy chain comprising a variable heavy chain region having the sequence as set forth in residues 1-119 of SEQ ID NO:8 or SEQ ID NO:12. o0 81. A humanized immunoglobulin, or an antigen-binding fragment thereof, which specifically binds to beta amyloid peptide (AP) with a binding affinity of at least 10 7 wherein the humanized antibody comprises: a heavy chain comprising a variable heavy chain region comprising the complementarity determining regions (CDRs) from the 3D6 immunoglobulin heavy chain variable region sequence set forth as SEQ ID NO:4; at least one variable heavy chain canonical framework residue selected from the group consisting of H24, H26, H27, H29, H71, and H94 (Kabat numbering convention) from SEQ ID NO:4; at least one variable heavy chain interchain packing framework residue selected from the group consisting of H37, H39, H45, H47, H91, H93, and H103 (Kabat numbering convention) from SEQ ID NO:4; and, at least one variable heavy chain vernier zone framework residue selected from the group consisting of H2, H28, H30, H48, H49, H67, H69, and (Kabat numbering convention) from SEQ ID NO:4, or at least one variable heavy chain rare framework residue selected from the group consisting of H40 and H42 (Kabat numbering convention) from SEQ ID NO:4; wherein the remainder of the variable heavy chain region is from a human acceptor immunoglobulin heavy chain; and (ii) a light chain comprising a variable light chain region having the sequence as set forth in residues 1-112 of SEQ ID NO:5 or SEQ ID NO: 11. 82. The humanized immunoglobulin or antigen binding fragment of claim wherein the light chain comprises at least one substitution of a vernier zone framework residue selected from the group consisting of L4, L35, L47, L49, L66, L68, and L69 (Kabat numbering convention). 991747-1:gcc t 126 C 83. The humanized immunoglobulin or antigen-binding fragment of claim 0 wherein the light chain comprises at least one substitution of a rare framework residue O selected from the group consisting of LI, L15, L83, and L85 (Kabat numbering C1 convention). 84. The humanized immunoglobulin or antigen-binding fragment of claim 81, 0 0 wherein the heavy chain comprises at least one substitution of a vernier zone framework Sresidue selected from the group consisting of H2, H28, H30, H48, H49, H67, H69, and (Kabat numbering convention). The humanized immunoglobulin or antigen-binding fragment of claim 81, wherein the heavy chain comprises at least one substitution of a rare framework residue selected from the group consisting of H40 and H42 (Kabat numbering convention). 86. A humanized immunoglobulin, or an antigen-binding fragment thereof, which specifically binds to beta amyloid peptide (Ap) with a binding affinity of at least 10 7 wherein the humanized antibody comprises: a light chain comprising a variable light chain region comprising the complementarity determining regions (CDRs) and at least one variable light chain framework residue selected from the group consisting of LI, L2, L36, and L46 (Kabat numbering convention) from the 3D6 immunoglobulin light chain variable region sequence set forth as SEQ ID NO:2, wherein the remainder of the variable framework region is from a human acceptor immunoglobulin light chain, and a heavy chain comprising a variable heavy chain region having the sequence as set forth in residues 1-119 of SEQ ID NO:8 or SEQ ID NO:12. 87. A humanized immunoglobulin, or an antigen-binding fragment thereof, which specifically binds to beta amyloid peptide (AP) with a binding affinity of at least 10 7 wherein the humanized antibody comprises: a heavy chain comprising a variable heavy chain region comprising the complementarity determining regions (CDRs) and at least one variable heavy chain framework residue selected from the group consisting of H49, H93 and H94 (Kabat numbering convention) from the 3D6 immunoglobulin heavy chain variable region sequence set forth as SEQ ID NO:4, wherein the remainder of the variable framework region is from a human acceptor immunoglobulin heavy chain, and a light chain comprising a variable light chain region having the sequence as set forth in residues 1-112 of SEQ ID NO:5 or SEQ ID NO:1 1. 991747-I:gcc 127 0C 88. A humanized immunoglobulin, or an antigen-binding fragment thereof which a specifically binds to beta amyloid peptide (Ap) with a binding affinity of at least 10 7 M', 0 wherein the humanized antibody comprises: C1 a light chain comprising a variable light chain region comprising the complementarity determining regions (CDRs) and variable framework residues L2, L36, 0 0 and L46 (Kabat numbering convention) from the 3D6 immunoglobulin light chain variable region sequence set forth as SEQ ID NO:2, wherein the remainder of the variable light chain region is from a human acceptor immunoglobulin light chain, and a heavy chain comprising a variable heavy chain region having the o 1 sequence as set forth in residues 1-119 of SEQ ID NO:8 or SEQ ID NO: 12. 89. A humanized immunoglobulin, or an antigen-binding fragment thereof, which specifically binds to beta amyloid peptide (Ap) with a binding affinity of at least 10 7 M wherein the humanized antibody comprises: a heavy chain comprising a variable heavy chain region comprising the complementarity determining regions (CDRs) and variable framework residues 1149, H93 and H94 (Kabat numbering convention) from the 3D6 immunoglobulin heavy chain variable region sequence set forth as SEQ ID NO:4, wherein the remainder of the variable heavy chain region is from a human acceptor immunoglobulin heavy chain, and a light chain comprising a variable light chain region having the sequence as set forth in residues 1-112 of SEQ ID NO:5 or SEQ ID NO: 11. A humanized immunoglobulin, or an antigen-binding fragment thereof, which specifically binds to beta amyloid peptide (Ap) with a binding affinity of at least 10 7 wherein the humanized antibody comprises: a light chain comprising a variable light chain region comprising the complementarity determining regions (CDRs) and variable framework residues LI, L2, L36, and L46 (Kabat numbering convention) from the 3D6 immunoglobulin light chain variable region sequence set forth as SEQ ID NO:2, wherein the remainder of the variable light chain region is from a human acceptor immunoglobulin light chain, and a heavy chain comprising a variable heavy chain region having the sequence as set forth in residues 1-119 of SEQ ID NO:8 or SEQ ID NO:12. 91. The immunoglobulin of any one of claims 76, 78, 80, 82, 83, 86, 88, and wherein the human acceptor light chain is of the subtype kappa II (Kabat convention). 92. The immunoglobulin of any one of claims 77, 79, 81, 84, 85, 87, and 89, wherein the human acceptor heavy chain is of the subtype III (Kabat convention). 991747-1:gcc 128 93. The immunoglobulin of claim 89, wherein the human acceptor light chain is Sselected from the group consisting of Kabat ID 019230, Kabat ID 005131, Kabat ID O 005058, Kabat ID 005057, Kabat ID 005059, Kabat ID U21040 and Kabat ID U41645. CN 94. The immunoglobulin of claim 89, wherein the human acceptor light chain is Kabat ID 019230. 00 0. 95. The immunoglobulin of claim 90, wherein the human acceptor heavy chain is Sselected from the group consisting of Kabat ID 045919, Kabat ID 000459, Kabat ID C 000553, Kabat ID 000386 and Kabat ID M23691. 96. The immunoglobulin of claim 90, wherein the human acceptor heavy chain is C 10 Kabat ID 045919. 97. The immunoglobulin of any one of claims 76, 78, 82, 83, 86, 88, 90, 91, 93, and 94, wherein at least one rare human light chain framework residue is substituted with an amino acid residue which is common for human variable light chain sequences at that position. 98. The immunoglobulin of any one of claims 76, 78, 82, 83, 86, 88, 90, 91, 93, and 94, wherein at least one rare human light chain framework residue is substituted with a corresponding amino acid residue from a germline variable light chain sequence. 99. The immunoglobulin of claim 98, wherein the germline variable light chain sequence is selected from the group consisting ofAl, A17, A18, A2, and A19. 100. The immunoglobulin of any one of claims 77, 79, 81, 84, 85, 87, 89, 92, and 96 wherein at least one rare human heavy chain framework residue is substituted with an amino acid residue which is common for human variable heavy chain sequences at that position. 101. The immunoglobulin of any one of claims 77, 79, 81, 84, 85, 87, 89, 92, and 96, wherein at least one rare human heavy chain framework residue is substituted with a corresponding amino acid residue from a germline variable heavy chain sequence. 102. The immunoglobulin of claim 101, wherein the germline variable heavy chain sequence is selected from the group consisting of VH3-48, VH3-23, VH3-7, VH3-21 and VH3-11. 103. The immunoglobulin of claim 101, wherein the germline variable heavy chain sequence is VH3-23. 104. The immunoglobulin claim 97, wherein the rare framework residue is selected based on occurrence at that position in less than 10% of human light chain variable region sequences in the light chain variable region subgroup, and the common residue is selected 991 7 4 7 -1:gcc 129 CN based on an occurrence at that position in greater than 50% of sequences in the light chain 0 variable region subgroup. 0 105. The immunoglobulin of claim 100, wherein the rare framework residue is N selected based on occurrence at that position in less than 10% of human heavy chain s variable region sequences in the heavy chain variable region subgroup, and the common 00 M r residue is selected based on an occurrence at that position in greater than 50% of sequences in the heavy chain variable region subgroup. S106. The humanized immunoglobulin of any one of claims 76, 78, 82, 83, 86, 88, 91, 93, and 94, wherein the human light chain variable region framework is a human C 10 kappa light chain variable region. 107. The humanized immunoglobulin of any one of claims 77, 79, 81, 84, 85, 87, 89, 92, 95, and 96, wherein the human heavy chain variable region framework is a human immunoglobulin IgGI heavy chain variable region. 108. The humanized immunoglobulin of any one of claims 76-90, wherein the Is constant regions are derived from human IgG1. 109. The immunoglobulin of any one of claims 76-90, wherein the constant regions are derived from human IgG4. 110. The immunoglobulin or antigen binding fragment of any one of claims 76-90, which specifically binds to beta amyloid peptide (AP) with a binding affinity of at least 108 M-. 111. The immunoglobulin or antigen binding fragment of claim 110, which specifically binds to beta amyloid peptide (AP) with a binding affinity of at least 109 M1. 112. The immunoglobulin or antigen binding fragment of any one of claims 76-90, wherein the heavy chain isotype is yl. 113. The immunoglobulin or antigen binding fragment of any one of claims 76-90, which binds to both soluble beta amyloid peptide (Ap) and aggregated Ap. 114. The immunoglobulin of claim 113, wherein the soluble beta amyloid peptide (Ap) is disaggregated Ap. 115. The immunoglobulin or antigen binding fragment of any one of claims 76-90, which mediates phagocytosis of beta amyloid peptide (Ap). 116. The immunoglobulin or antigen binding fragment of any one of claims 76-90, which crosses the blood-brain barrier in a subject. 117. The immunoglobulin or antigen binding fragment of any one of claims 76-90, which reduces both beta amyloid peptide (Ap) burden and neuritic dystrophy in a subject. 9 9 174 7 -1Igcc 130 C 118. An immunoglobulin which specifically binds to beta amyloid peptide (Ap) S with a binding affinity of at least 10 7 or antigen-binding fragment thereof, comprising a variable heavy chain region set as forth in residues 1-119 of SEQ ID NO:8 C and a variable light chain region as set forth in residues 1-112 of SEQ ID NO:1 1. 119. An immunoglobulin which specifically binds to beta amyloid peptide (Ap) 00 with a binding affinity of at least 10 7 or antigen-binding fragment thereof, comprising a variable heavy chain region as set forth in residues 1-119 of SEQ ID NO:12, "i and a variable light chain region as set forth in residues 1-112 of SEQ ID 120. An immunoglobulin which specifically binds to beta amyloid peptide (AP) 1to with a binding affinity of at least 10 7 comprising a variable heavy chain region as set forth in residues 1-119 of SEQ ID NO:8, a variable light chain region as set forth in residues 1-112 of SEQ ID NO: 11, and constant regions from human IgG1. 121. An immunoglobulin which specifically binds to beta amyloid peptide (Ap) with a binding affinity of at least 10 7 comprising a variable heavy chain region as set is forth in residues 1-119 of SEQ ID NO:12, a light chain region as set forth in residues 1- 112 of SEQ ID NO:5, and constant regions from human IgG1. 122. An isolated polypeptide comprising an amino acid sequence having at least sequence identity with residues 1-112 of the amino acid sequence set forth as SEQ ID 123. An isolated polypeptide comprising an amino acid sequence having at least 99% sequence identity with residues 1-119 of the amino acid sequence set forth as SEQ ID NO:8. 124. An isolated polypeptide comprising an amino acid sequence having at least sequence identity with residues 1-112 of the amino acid sequence set forth as SEQ ID NO:11. 125. An isolated polypeptide comprising an amino acid sequence having at least 99% sequence identity with amino acids 1-112 of the amino acid sequence set forth as SEQ ID NO:12. 126. An isolated polypeptide comprising residues 1-112 of the amino acid sequence set forth as SEQ ID NO: 11. 127. An isolated polypeptide comprising residues 1-119 of the amino acid sequence set forth as SEQ ID NO:12. 128. A variant of a polypeptide comprising residues 1-112 of the amino acid sequence of SEQ ID NO:5 or SEQ ID NO:11, said variant comprising at least one 991747-1 gcc 131 Sconservative amino acid substitution, wherein the variant retains the ability to direct Sspecific binding to beta amyloid peptide (AP) with a binding affinity of at least 10 7 M'. O 129. A variant of a polypeptide comprising residues 1-119 of the amino acid 1 sequence of SEQ ID NO:8 or SEQ ID NO:12, said variant comprising at least one conservative amino acid substitution, wherein the variant retains the ability to specifically 0 bind beta amyloid peptide (Ap) with a binding affinity of at least 10 7 M 1 130. An isolated polypeptide comprising residues 1-112 of the amino acid Ssequence of SEQ ID NO:8 or comprising residues 1-119 of the amino acid sequence of SEQ ID o 131. A pharmaceutical composition comprising the humanized immunoglobulin or antigen-binding fragment of any one of claims 76-121 and a pharmaceutical carrier. 132. A kit comprising the immunoglobulin or antigen-binding fragment of any one of claims 76-121, together with instructions for use. 133. The humanized immunoglobulin light chain of claim 1, substantially as hereinbefore described with reference to any one of the examples. 134. The humanized immunoglobulin heavy chain of claim 18, substantially as hereinbefore described with reference to any one of the examples. 135. The humanized immunoglobulin, or antigen-binding fragment thereof of claim 34, substantially as hereinbefore described with reference to any one of the examples. 136. Use of a humanized immunoglobulin or antigen binding fragment of claim 135 in the manufacture of a medicament for the prevention or treatment of an amyloidogenic disease in a patient. 137. Use of a humanized immunoglobulin or antigen binding fragment of claim 135 in the manufacture of a medicament for the prevention or treatment of Alzheimer's disease in a patient. 138. An isolated nucleic acid molecule encoding the light chain of claim 133. 139. An isolated nucleic acid molecule encoding the heavy chain of claim 134. 991747-1 gcc 132 C 140. A humanized immunoglobulin, or an antigen-binding fragment thereof, which aS specifically binds to beta amyloid peptide (AP) with a binding affinity of at least 10 7 substantially as hereinbefore described with reference to any one of the examples. Dated 19 October, 2007 0 Elan Pharma International Limited IN Wyeth SPatent Attorneys for the Applicant/Nominated Person SPRUSON FERGUSON 991747-1:gcc