AU2007214300B2 - Method for Ameliorating Pruritus - Google Patents

Description

ASAN LABORATORIES COMPANY (CAYMAN), LIMITED AUSTRALIA Patents Act 1990 COMPLETE STANDARD PATENT Invention Title: Method for Ameliorating Pruritus The following statement is a full description of this invention, including the best method of performing it known to us: BACKGROUND OF THE INVENTION Field of the Invention The present invention relates to a method for ameliorating pruritus. and in particular 5 relates to a method of using a phenylbutyric acid or short-chain fatty acid derivative for preventing, treating, or ameliorating pruritus associated with localized or systemic diseases or disorders. Description of the Related Art As it is known, the cutaneous sensation referred to as pruritus, is characterized by an 10 unpleasant, itchy sensation of the skin which provokes scratching. The scratching is sometimes severe enough to irritate and inflame the skin of afflicted subjects. Pruritus may also be characterized as a uniformed response to a wide variety of physical, chemical, and/or biological stimuli, which may be of an endogenous or exogenous nature that may be associated with specific dermatologic conditions such as allergic reactions to drugs, insect bites and to 15 environmental allergens, or a systemic disease such as thyrotoxicosis, diabetes mellitus, uremia, iron deficiency anemia, delusions of parasitosis, polycythernia rubra vera, cholestasis and Hodgkin's disease. Although usually occurring in the skin, pruritus can also occur in non cutaneous areas such as mucous membranes. Thus, the cause of pruritus can be multifactorial or due to a single underlying disorder. The pathophysiology of pruritus involves central and 20 peripheral nervous systems as well as multiple cytokine release and molecular mediators. When the origin of pruritus is in the skin, sensory nerve endings in the dermoepidermal junction are stimulated. The sensation of pruritus is transmitted along dedicated unmyelinated C fibers which are distinct from fibers that transmit pain and touch. The irritated skin will transmit the sensation of pruritus by stimulating local nerves in the spinal cord. From there, the 25 stimulus travels via the lateral spinothalamic tract to the thalamus, and then on to the cerebral cortex, where it causes the sensation of pruritus (Weldon D. Allergy Asthma Proc 28: 153-62, 2007). Gastrin-releasing peptide receptor (GRPR), histamine, substance P, and tumor necrosis factor a (TNF-a) seem to play significant roles in the perception of pruritus (Sun YG, et al. Nature 448:700-703, 2007). Moreover, for the central neural mechanism where itching is detected, the opioid peptides and the ja receptor have been implicated in provoking the pruritus 5 of cholestasis, which responds to intravenous naloxone (Jones EA, et al. JAMA 268:3359-62, 1992). Meanwhile, serotonin reuptake inhibitors can improve systemic pruritus induced by cholestasis, suggesting that serotonergic pathways are also important in the perception of itching (Mayo MJ, et al. Hepatology 45:666-74, 2007). On the other hand, locally-released substances including histamine, tachykinins, 10 serotonin (5-hydroxytryptamine (5-HT)), interferon (IFN)-gamma, interleukin 2 (IL-2) and IL-4 released from activated macrophage, mast or T cells at the site of pruritoceptive origin have been implicated to cause the symptoms and signs of itching sensation, scratching, swelling, rash, urticaria, and/or scaling (Greaves MW, et al. Lancet 348:938-40, 1996; Inagaki N, et al. Eur J Pharmacol 546:189-96, 2006). Subjects suffering from pruritus induced by a dermatological 15 disorder or systemic disease can possibly worsen the pruritus by excessively scratching the affected area so extensively that the excessive scratching will lead to irritation, inflammation, wound formation and possibly infection. For the peripheral mechanism of pruritus, the role of multiple cytokine release and molecular mediators in the generation of signs and symptoms of pruritus in diseased skin or mucosa has been defined. Histamine-induced pruritus involves H I 20 receptors (Davies MG, et al. Br J Clin Pharmacol 9:461-65, 1980). Tachykinins including the neuropeptides substance P, calcitonin gene-related peptide, and vasoactive intestinal peptide are found in the cutaneous free-nerve endings of unmyelinated nociceptor neurons which initiate the sensations of pruritis. Intradermal 5-HT can evoke itching and scratching by acting on 5 HT2 and 5-HT3 receptors (Nojima H, et al. J Pharmacol Exp Ther 306:245-52, 2003). These 25 observations have led to the use of a 5-HT2 or 5-HT3 receptor antagonist for treating pruritus (Schworer 1-, et al. Lancet 341:1277, 1993). IL-2 when given subcutaneously causes intense localized itching in both atopic and normal subjects (Wahlgren CF, et al. Arch Dermatol Res 287:572-80, 1995). Inhibition of IL-2 biosynthesis by immunosuppressive agents such as cyclosporine A relieves the pruritus of atopic dermatitis (Wahigren CF, et al. Acta Derm Venereol (Stockh) 70:323-29, 1990). 5 Although antihistamines are widely used for suppression of pruritis, the extent to which suppression is attributable to the side-effect of central sedation rather than local histamine antagonism in the skin is unclear (Krause L, et al. BMJ 287:1199-200, 1983). Many patients report persistent pruritus even with current antihistamines therapies, 5--IT receptor antagonists, and/or immunosuppressive agents, as most are ineffective for chronic pruritus, and only provide 10 short-term relief with side-effects. Pruritus may be quite debilitating for some patients. Thus, there is a continuing need for development of new and improved methods and compositions for preventing, treating, or ameliorating pruritus resulting from a wide variety of causes. Phenylbutyrate, a short-chain fatty acid, has been approved by the FDA as an orphan drug for inborn error with urea cycle disorder to treat hyperammonemia (Brusilow SW, et al. N 15 EngI J Med 310: 1630-4, 1984). In the human body, phenylbutyrate is metabolized to phenylacetate via p-oxidation. Phenylacetate subsequently undergoes conjugation with glutamine to form phenylacetylglutamine, which serves as a vehicle for waste nitrogen excretion. Recently, phenylbutyrate has also been found to have the ability to inhibit deacetylase, to increase acetylation on histones and non-histone proteins, to remodel chromatin 20 structures and to alter activities of multiple transcriptional factors, resulting in simultaneously, epigenetically modulating many genes and thus, controlling diseases (Marks PA, et al. J Natl Cancer Inst 92: 1210-6, 2000). In preclinical and clinical studies, the gene modulatory effects of phenylbutyrate have exhibited therapeutic potential in many hematologic and solid tumors, inherited genetic disorders such as cystic fibrosis, sickle cell anemia, p-thalassemia, X-linked 25 adrenoleukodystrophy. spinal muscular atrophy, and neurodegenerative disorders, aging, and inflammatory diseases such as autoimmune diseases (Kemp S, et al. Nat Med 4: 1261-8, 1998;

A

et al. Proc Natl Acad Sci USA 102: 11023-8, 2005; Kang HL, et al. Proc Natl Acad Sci USA 99: 838-43, 2002; Blanchard F, et al. Drug Discov Today 10: 197-204, 2005). Moreover, phenylbutyrate can also act as a chemical chaperone to protect normal cells from oxidative stress injury and prevent neurotoxicity (Yam GH, et al. Invest Ophthalmol Vis Sci 48:1683-90, 5 2007). BRIEF SUMMARY OF INVENTION The invention provides a pharmaceutical composition and method for preventing, treating, or ameliorating pruritus associated with a cutaneous, mucosal or systemic disease or disorder. The method comprises administering to a subject with pruritus or topically applying 10 to an affected area with pruritus an effective amount of a pharmaceutical composition comprising a phenylbutyric acid or short-chain fatty acid derivative and a pharmaceutically acceptable carrier, salt or solvate thereof. The invention further provides a pharmaceutical composition and method for preventing, treating, or ameliorating pruritus associated with a cutaneous, mucosal or systemic disease or 15 disorder. The method comprises administering to a subject with pruritus or topically applying to an affected area with pruritus an effective amount of a pharmaceutical composition comprising a phenylbutyric acid or short-chain fatty acid derivative of 2 to 6 carbons in length in combination with other anti-pruritic agents and a pharmaceutically acceptable carrier, salt or solvate thereof. 20 A definition of the specific embodiment of the invention as claimed herein follows. According to a first embodiment of the invention, there is provided a pharmaceutical composition when used for preventing, treating, or ameliorating pruritus associated with a cutaneous, mucosal or systemic disease or disorder, wherein the pharmaceutical composition comprises an effective amount of a phenylbutyric acid, phenylproprionic acid, phenylacetic 25 acid, phenylbutyrate, phenylproprionate, phenylacetate, phenylacetylglutamine, phenoxybutyric acid, phenoxyproprionic acid, phenoxyacetic acid, phenoxybutyrate, phenoxyproprionate, 5 phenoxyacetate, bromophenylbutyric acid, bromophenylproprionic acid, bromophenylacetic acid, bromophenylbutyrate, bromophenylproprionate, bromophenylacetate, chlorophenylbutyric acid, chlorophenylproprionic acid, chlorophenylacetic acid, chlorophenylbutyrate, chlorophenylproprionate, chlorophenylacetate, fluorophenylbutyric acid, 5 fluorophenylproprionic acid, fluorophenylacetic acid, fluorophenylbutyrate, fluorophenylproprionate, fluorophenylacetate, iodophenylbutyric acid, iodophenylproprionic acid, iodophenylacetic acid, iodophenylbutyrate, iodophenylproprionate, iodophenylacetate, hydroxyphenylbutyric acid, hydroxyphenylproprionic acid, hydroxyphenylacetic acid, hydroxyphenylbutyrate, hydroxyphenylproprionate, hydroxyphenylacetate, 10 methylphenylbutyric acid, methylphenylproprionic acid, methylphenylacetic acid, methylphenylbutyrate, methylphenylproprionate, methylphenylacetate, ethylphenylbutyric acid, ethylphenylproprionic acid, ethylphenylacetic acid, ethylphenylbutyrate, ethylphenylproprionate, ethylphenylacetate, naphthylbutyric acid, naphthylproprionic acid, naphthylbutyrate, naphthylproprionate, or tributyrin and a pharmaceutically acceptable carrier, 15 salt or solvate thereof. A detailed description is given in the following embodiments with reference to the accompanying drawings. BRIEF DESCRIPTION OF DRAWINGS The present invention can be more fully understood by reading the subsequent detailed 20 description and examples with references made to the accompanying drawings, wherein: FIG. 1 shows a topical 2.5% phenylbutyric acid gel rapidly relieving pruritus associated 5a with skin disorders caused by radiation dermatitis, sun burn, surgical wound healing, psoriasis, and atopic dermatitis; FIGs. 2A-2C are human Thl-Th2-Th3 gene expression profiling demonstrating phenylbutyrate simultaneously suppressing the induction of multiple cytokine expression in 5 activated T cells stimulated with PMA and ionomycin. Jurkat T cells were pre-incubated with phenylbutyrate (I mM) for 24 hrs, and then stimulated with ionomycin (I pM) and PMA (10 ng/ml) for 6 hrs. Using real-time PCR, the expression of a panel of genes related to helper T cells with or without T-cell stimulation and phenylbutyrate treatment was analyzed. The array includes cytokine genes representative of Thl, Th2 and Th3 cells, gene encoding transcriptional 10 factors regulating the expression of cytokines as well as other markers of CD4+ T lymphocytes, genes involved in immune cell activation in the ThI and Th2 type immune responses, and genes involved in the antimicrobial humoral response. Results are the mean ± SE of three determinations, expressed as the fold induction (observed experimental relative unit/basal control relative unit in the absence of any stimuli or treatment); I5 FIGs. 2D1-2D2 disclose the various human Thl-Th2-Th3 genes. FIG. 3 is a chromatin immunoprecipitation (ChIP) assay demonstrating the modulatory effects of phenylbutyrate on the status of histones that remodel chromatin structure and the binding of transcription-factors that regulate gene expression. Results show that 4 phenylbutyrate sodium was effective in not only modifying histones but also decreasing binding 20 of transcriptional factors of NF-KB, NFAT, and AP-1 to the IL-2 promoter in activated Jurkat T cells stimulated by ionomycin and PMA. Anti-SpI antibody was used as a negative control because Spi does not bind to IL-2 promoter. DETAILED DESCRIPTION OF INVENTION The following description is of the best-contemplated mode of carrying out the 25 invention. This description is made for the purpose of illustrating the general principles of the invention and should not be taken in a limiting sense. The scope of the invention is best determined by reference to the appended claims. The invention is broadly intended for use of phenylbutyric acid or a short-chain fatty acid and its pharmaceutically acceptable derivatives to prevent, treat or ameliorate all types of 5 pruritus from various diseases or disorders including, but not limited to, allergic dermatoses, pruritic dermatoses, vascular dermatoses, sebaceous gland disorders, autoimmune disorders, rheumatoid arthritis, systemic lupus erythematosus, progressive systemic sclerosis, sjogren's syndrome, dermatomyositis, mixed connective tissue disease, papulosquamous dermatoses, bacterial dermatoses, viral dermatoses, mycolic skin infections, granulomatous dermatoses, 10 parasitic skin dermatoses, exfoliative dermatitis, bullous dermatoses, pigmented dermatoses, photosensitive dermatoses, dermatoses caused by collagen diseases, dermatoses due to internal diseases, xerosis, urticaria, atopic dermatitis, eczyma, vasculitis, lichen simplex chronicus, psoriasis, scabies, pediculosis corporis and pubis, multiple sclerosis, thyrotoxicosis, diabetes, renal insufficiency, uremia, iron deficiency anemia, delusions of parasitosis, polycythemia 15 rubra vera, cholestasis, wound, sun burn, cold sores, acne, insect bite, radiotherapy or chemotherapy-induced dermatitis or mucositis, paraneoplastic syndrome, malignancy, primary skin cancer, and metastatic skin cancer. In the invention, the compounds of phenylbutyric acid derivatives include, but are not limited to, phenylbutyric acid, phenylproprionic acid, phenylacetic acid, phenylbutyrate, 20 phenylproprionate, phenylacetate, phenylacetylglutamine, phenoxybutyric acid, phenoxyproprionic acid, phenoxyacetic acid, phenoxybutyrate, phenoxyproprionate, phenoxyacetate, bromophenylbutyric acid, bromophenylproprionic acid, bromophenylacetic acid, bromophenylbutyrate, bromophenylproprionate, bromophenylacetate, chlorophenylbutyric acid, chlorophenylproprionic acid, chlorophenylacetic acid, chlorophenylbutyrate, 25 chlorophenylproprionate, chlorophenylacetate, fluorophenylbutyric acid, fluorophenylproprionic acid, fl uorophenylacetic acid, fl uorophenylbutyrate, -7 fluorophenylproprionate, fluorophenylacetate, iodophenylbutyric acid, lodophenylproprionic acid, iodophenylacetic acid, iodophenylbutyrate, iodophenylproprionate, iodophenylacetate, hydroxyphenylbutyric acid, hydroxyphenylproprionic acid, hydroxyphenylacetic acid, hydroxyphenylbutyrate, hydroxyphenylproprionate, hydroxyphenylacetate, 5 methylphenylbutyric acid, methylphenylproprionic acid, methylphenylacetic acid, methylphenylbutyrate, methylphenylproprionate, methyIphenylacetate, ethyl phenyl butyric acid, ethylphenylproprionic acid, ethylphenylacetic acid, ethylphenylbutyrate, ethylphenylproprionate, ethyIphenylacetate, naphthylbutyric acid, naphthylproprionic acid, naphthylacetic acid, naphthylbutyrate, naphthylproprionate, naphthylacetate, and tributyrin. 10 Also other short-chain fatty acids of 2 to 6 carbons in length include, but are not limited to, butyric acid, butyrate, 2,2 dimethyl butyric acid, a-methylhydrocinnamic acid, 3,5 dimethoxy 4-hydrocinnamic acid, cinnamic acid, butyryl hydroxamate, propionate, bromopropionate, E-3 3 pyridyl-2-propenoic acid, levulinic acid, Kemp triacid, isovalerate, valerate, butrymide, isobutyramide, valproic acid, and valproate. 15 The second compounds for combination with the phenylbutyric acid or short-chain fatty acid derivative include, but are not limited to, an anti-histamine, an anticholinergics, a non steroid anti-inflammation drug, a steroid, an anti-oxidant agent, a vitamin, a leukotriene modifier, an interleukin antagonist, a mast cell inhibitor, an anti-IgE antibody, a selective serotonin reuptake inhibitor (SSRI), a 5-hydroxytryptamine (5-HT) receptor antagonist, an 20 antibiotics, a calcineurin inhibitor, a histone deacetylase inhibitor, a gastrin-releasing peptide receptor antagonist, gabapentin, and naloxone. The compounds of the invention can be formulated as pharmaceutical compositions. Such compositions can be administered orally, parenterally, by inhalation spray, rectally, vaginally, intradermally, transdermally, or topically in dosage unit formulations containing 25 conventional nontoxic pharmaceutically acceptable carriers, adjuvants, and vehicles as desired. Topical administration may also involve the use of transdermal administration such as

R

transdermal patches or iontophoresis devices. The term parenteral as used herein includes subcutaneous, intravenous, intramuscular, or intrasternal injection, or infusion techniques. Formulation of drugs is discussed in, for example, Hoover, John E., Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Penn. (1975), and Liberman, -1. A. and 5 Lachman, L., Eds., Pharmaceutical Dosage Forms, Marcel Decker, New York, N.Y. (1980). In one embodiment, the preparations for treatment of skin pruritis are generally aimed at providing a condition for increasing skin manageability. There are recognized categories of formulations for skin care compositions, including creams, ointments, gels, sprays, lotions, skin tonics, shampoos or mousses as referred to above. Skin sprays are generally composed of .0 aerosolized copolymers, such as polyvinylpyrrolidone, vinyl acetate and the like, and may also function as a setting lotion. Skin gel preparations are similar to sprays in composition, but are in gel and alcohol free form, and can coat the skin. Skin mousse is foam released under pressure from an aerosolized can. The phenylbutyric acid derivative or short-chain fatty acid active ingredient in a topical skin care composition according to the present invention is preferably 15 present at a concentration of 0.00001 to 100.00% by weight relative to the total weight of the composition, or in a dosage of I to 1000 mg. A skin care composition for treating pruritus according to the present invention may be formulated as a hydrophobic or hydrophilic cream, ointment, gel, emollient, spray, lotion, skin tonic, shampoo or mousse as referred to above, suitably with additional ingredients suitable for use in skin care compositions of types known in 20 the art, and such further ingredients can include petrolatum, waxes, lanolin, silicone, liposomes, vegetable, mineral oils, plasticizers, fragrances, preservatives, a penetration enhancing agent, a pH adjusting agent or other suitable ingredients for topical skin compositions. Such ingredients can moisturize skin, stabilize the active compound, increase drug-skin contact and local concentration. control drug slow release, and/or aid in decreasing skin breakage, preventing 25 skin atrophy, fibrosis and infection, and promoting skin wound healing. The invention also provides a method for treatment of skin pruritus as described herein,

Q

which method comprises a composition providing at least a phenylbutyric acid derivative or short-chain fatty acid thereof, together with at least one or more other agents. including an anti histamine, an anticholinergics, a non-steroid anti-inflammation drug, a steroid, an anti-oxidant agent, a vitamin, a leukotriene modifier, an interleukin antagonist, a mast cell inhibitor, an anti 5 IgE antibody, a selective serotonin reuptake inhibitor, a 5-hydroxytryptamine receptor antagonist, an antibiotics, a calcineurin inhibitor, a histone deacetylase inhibitor, gabapentin, and naloxone, in which active ingredients are present in free form or in the form of a pharmaceutically acceptable salt and optionally at least one pharmaceutically acceptable carrier, for systemically or topically simultaneous, separate or sequential use. 10 Suitable salts for the components to be employed according to the present subject matter are also those with inorganic cations, for example alkali metal salts, in particular sodium, potassium, or ammonium salts, alkaline earth metal salts such as, in particular, the magnesium or calcium salts, as well as salts with bi- or tetravalent cations, for example the zinc, aluminum, or zirconium salts. Also contemplated are salts with organic bases, such as dicyclohexylamine 15 salts; methyl-D-glucamine; and salts with amino acids, such as arginine, lysine, histidine, glutamine and so forth. Also, the basic nitrogen-containing groups can be quaternized with such agents as: lower alkyl halides, such as methyl, ethyl, propyl, and butyl chlorides, bromides, and iodides; dialkyl sulfates, such as dimethyl, diethyl, dibutyl, and diamyl sulfates; long chain halides, such as decyl, lauryl, myristyl, and stearyl chlorides, bromides, and iodides; asthma 20 halides, such as benzyl and phenethyl bromides; and others. Salt-forming agents, for example, low molecular weight alkylamines such as methylamine, ethylamine, or triethylamine can also be employed. Water or oil-soluble or dispersible products are thereby obtained. The amount of active ingredient that can be combined with the carrier materials to produce a single dosage form will vary depending upon the subject and the particular mode of 25 administration. The dosage required will vary according to a number of factors known to those skilled in the art, including, but not limited to, the compound or compounds used, the species of 1 n subject, the size of the subject, and the severity of the associated disease condition that causes pruritus. The compounds can be administered in a single dose, in multiple doses throughout a 24-hour period, or by continuous infusion. When administered by continuous infusion, the compounds can be supplied by methods well known in the art, such as, but not limited to, 5 intravenous gravity drip, intravenous infusion pump, implantable infusion pump, or any topical routes. Length of treatment will vary depending on many factors, for example, the duration and severity of the skin, mucosa or systemic diseases or disorders that cause localized or generalized pruritus. Treatment of the subject with the phenylbutyric acid derivative or short chain fatty acid derivative alone or in combination with other agents of the invention may last 0 until pruritus disappears, or treatment will continue for the life of the subject. EXAMPLES Example 1: Various topical compositions-oleaginous ointment, cream, and gel A. Preparation of an Oleaginous Ointment of Phenylbutyrate: 65 g of white petrolatum (Riedel-de Haen), 15 g of cetyl alcohol (Riedel-de Haen), 260 5 g of soft paraffin (Merck), 155 g of liquid paraffin (Merck), and 5 g of 4-phenylbutyrate (Merck) were mixed in a beaker and heated at 70*C to form a paste. The paste was stirred at 400 rpm for I hour, and then cooled at room temperature. B. Preparation of Cream of Phenylbutyrate: Part 1: 70 g of Tefose 63.RTM., 20 g of Superpolystate.RTM., 10 g of Coster 20 5000.RTM., 15 g of Myriyol 318.RTM., 15 g of Coster 5088.RTM., and 15 g of GMS SE.RTM. (all commercially available from a local supplier) were mixed in a beaker and heated at 70'C. Part II: 5.739 g of sodium 4-phenylbutyrate (Triple Crown America, Inc.), 0.125 g of methylparaben (Merck), 0.075 g of propylparaben (Merck), and 149.061 g of deionized water were mixed in a beaker and heated at 70'C. 25 Part II was slowly added into part I and continually stirred at 400 rpm for 5 minutes to form a mixture. 2% Stabileze QM.RTM. (prepared by dissolving 2 g of Stabileze QM.RTM. in I I 98 g of demonized water, heating and stirring at 70'C to form a paste, and cooling at room temperature) was added into the mixture and stirred for 5 minutes. The p-I of the mixture was adjusted to 5.34 with 0.85% phosphoric acid (Merck), and stirred at 600 rpm for 20 minutes. The mixture was cooled at room temperature. 5 C. Preparation of Gel of Phenylbutyrate: Part 1: 10 g of Stabileze QM.RTM. and 232.035 g of deionized water were mixed in a beaker and heated at 70*C. Part II: 5.739 g of sodium 4-phenylbutyrate (Triple Crown America, Inc.), 0.125 g of methylparaben (Merck), 0.075 g of propylparaben (Merck), 232.035 g of deionized water, and 10 20 g of 10% NaO-l were mixed in a beaker and heated at 70'C. Part II was slowly added into part I and continually stirred at 400 rpm for 20 minutes to form a mixture. The mixture was cooled at room temperature. D: Preparation of Liposomal Formulation of Phenylbutyrate: In this liposomal formulation, egg phosphatidylcholine (EPC) and cholesterol were used 15 in equi- or different-molar concentrations as primary lipid components. Various liposomes located with 4-phenylbutyrate were obtained by varying the lipid:phenylbutyrate ratio. Liposomes were prepared by thin film hydration, sized by membrane extrusion, and physically evaluated. Example 2: Topical phenylbutyric acid to the affected skin of different disorders to treat 20 pruritus A 2.5% phenylbutyric acid gel was applied to the affected skin six times per day for 1 week. There were four patients in each group, who completed a daily itch diary in which they graded the severity of their pruritus on a continuous scale from 0 ( no pruritus) to 10 (the worse pruritus imaginable) using a visual analog scale (VAS) with points anchored with facial 25 expressions to guide their selection (Mayo MJ, et al. Hepatology 45:666-74, 2007). Referring to FIG. 1, the 2.5% phenylbutyric acid gel rapidly relieved the itchy sensation I1? within 2-10 minutes, and improved the mean VASs from 7.25, 7, 6.75, 8, and 7.75 to 2, 1, 1.5, 2.5 and 2.25 in 1-2 days in patients with radiation-induced dermatitis, sun burn, surgical wound healing. psoriasis, or atopic dermatitis, respectively. The pruritus-related symptoms of erythema, urticaria, swelling, and desqumation also subsided simultaneously. 5 Example 3: suppression of multiple itching-associated molecular mediators by 4 phenylbutyrate sodium Itching is the most important problem in many allergic and inflammatory skin diseases. The skin barrier (stratum corneum) is a major factor for determining the nature of immune responses to allergens presented at the skin surface. 10 Abnormalities in skin barrier function may result in Thl, Th2 and Th3 responses to infectious agents, chemicals, or protein antigens, which induce several cytokines and molecular mediators in the skin lesion to cause symptoms and signs of pruritus. The cytokine profile subsequently produced depends upon the type of allergen stimulation. Distinct subsets of helper T cell activation have been identified by virtue of cytokines that they produce. Activated Thi 15 cells produce IFN-gamma and IL-2. Thl cells regulate delayed type hypersensitivity reactions. Thl responses are promoted by local release of the IL-12 superfamily of cytokines. These responses are further enhanced by IL-15 and IL-18 production. Activated Th2 cells produce IL 4 and IL-10. Th2 cells mediate allergic and antibody responses. Th2 responses are favored by local production of IL-4, IL-33, and IL-18 in synergy. Some cytokines, such as IL-3, GM-CSF 20 (CSF2), and TNF-alpha, are produced by both Thl and Th2 subsets. On the other hand, IL-6 is a pro-inflammatory cytokine secreted by activated T cells to stimulate immune response to trauma, especially burns or other tissue damage leading to inflammation. Th3 cells are related to negative regulation of immune response. In order to demonstrate whether phenylbutyrate can suppress multiple itching-associated 25 cytokines, molecular mediators or markers at one time, a panel of gene expression profiling was analyzed by using real-time PCR (RT 2 ProfilerTM PCR Array Human Th I -Th2-Th3: APHS-034, SuperArray Bioscience Corporation). Jurkat T cells were treated in the presence of increasing concentrations of 4 phenylbutyrate, ionomycin, and/or phorbol 12-myristate 13-acetate (PMA) for 24-72 hr at 37 0 C. At the doses of I mM of 4-phenylbutyrate for 48 hrs, and I [tM of ionomycin plus 10 ng/ml of 5 PMA incubated for 24 hrs, no significant differences were found by flow cytometry in cell proliferation, cytotoxicity, and apoptosis between control and treated cells. However, 48 hrs after stimulation with ionomycin (1 pM) plus PMA (10 ng/ml), T cells were full cycling and progressed through the S, G2, and M phases of the cell cycle due to the induction of T cell growth and survival factors (interleukins), whereas pre-treatment with phenylbutyrate (1 mM) 10 for 24 hrs almost completely prevented entry of the cells into the S phase of the cell cycle. Jurkat T-cells were nonstimulated or stimulated with ionomycin (I pM) and PMA (10 ng/ml) for 6 hrs in the absence or presence of pre-incubation of 4-phenylbutyrate sodium (I mM) for 24 hrs, RNA was extracted and then RT-PCR was performed for profiling the expression of 84 genes related to Th I -Th2-Th3 responses shown in the gene table (FIG. 2). 15 Referring to FIGs. 2A-2D and Table 1, phenylbutyrate completely suppresses or significantly decreases the induction of Thl cytokines and related genes (CCR5, CSF2, IFN gamma, IL2B, ILI2RB2, IL18, ILI8RI, 1L2, IL2RA, IRFI, STAT4, TLR4. TLR6), Th2 cytokines and related genes (CCLII, CCL7, CCR2, CCR4, IL13, ILI3RAl, ILIRl, ILIR2, IL4R, IL9, IRF4, MAF), T-cell activation markers (BCL3, CD69, IL6, IL6R, JAK2, LAT, 20 TNFRSF9), T-helper I type immune response (IL2B, IL18. IRF4. SFTPD, TLR4, TLR6), T helper 2 type immune response (IL18. IL4R, IRF4), and antimicrobial humoral response (CCL7. CCR2. IL1213, ILI3, SFTPD) in PMA/ionomycin-induced Jurkat T-cell activation. On the other hand, phenylbutyrate upregulates more expression of SOCSI, a suppressor of cytokine signaling as a Th3 response, which is involved in negative regulation of cytokines. 25 IL-I and IL-6 are pro-inflammatory cytokines. Antigen binding to the T cell receptor stimulates the secretion of IL-2, and the expression of IL-2 receptors. The IL-2/IL-2R interaction then stimulates the growth, differentiation and survival of antigen-selected cytotoxic T cells. IL-4 stimulates activated B-cell and T-cell proliferation, and the differentiation of CD4+T-cells into Th2 cells, and induces B-cell class switching to IgE. IL-9 elicits many functions on lymphoid cells and mast cell lineages, and has been thought to have a 5 role in asthma. IL-12 is known as a T cell stimulating factor in response to antigenic stimulation, which can stimulate the growth and function of T cells. IL-13 secreted by many cell types, but especially Th2 cells, is an important mediator of allergic inflammation. IL-18 works together with IL-12 to induce cell-mediated immunity following infection with microbial products like lipopolysaccharide. Taken, together, the effects of phenylbutyrate on inhibiting 10 the complicated interrelated signaling network pathways of IL-1, IL-2, IL-4. IL-6, IL-9, IL-12, IL-13, and IL-18, and on upregulating SOCSI (a suppressor of cytokine signaling) are correlated with the novel finding in the present invention that phenylbutyrate has the ability to ameliorate pruritus in some allergic and inflammatory dermatitis-associated pruritus. Table 1. At least 2-Fold difference in induction by T-cell stimulation when compared to 15 control, and suppressive effects of phenylbutyrate Th I cytokines and related genes Mitogen stimulation Phenylbutyrate + mitogen stimulation CCR5 2.68 0.98 CSF2 229.13 88.77 IFN-gamma 126.24 99.18 IL 1 2B 2.68 0.98 I1. 12RB2 2.68 0.98 IL18 2.68 0.98 IL18RI 19.97 0.98 1L2 831.75 304.86 IL-2RA 151.17 64.98 IRFI 5.86 1.7 SOCS1 4.82 8.59 STAT4 7.89 3.32 TLR4 2.68 0.98 TLR6 29.04 10.43 Th2 cytokines and related genes CCL 1 2.68 0.98 CCL7 2.68 1.04 CCR2 4.20 0.84 CCR4 7.41 1.93 IL13 2.68 0.98 IL3RAI 2.68 0.98 ILIRI 11.31 3.92 L I R2 2.25 0.82 IL4R 42.81 9.53 11L9 2.68 0.98 IRF4 26.17 16.50 MAF 2.68 0.98 Other T-cell activation markers BCL3 58.08 19.73 CD69 87.43 48.57 11L6 2.68 0.98 IL6R 2.68 0.98 JAK2 4.72 2.27 LAT 3.12 1.57 SFTPD 2.68 0.98 TNFRSF9 89.26 13.01 The induction of multiple cytokine expression depends on the coordinated activation of transcription factors, mostly including NFKB, NF-AT, and AP-1 (Sancho R, et al. J Immunol 172:2341-51, 2004; Ii-Weber M, et al. Eur J Immunol 34 :1111-18, 2004). Because induction of cytokines is regulated mainly at the transcriptional level, chromatin immunoprecipitation 5 (ChIP) analysis in Jurkat T cells was performed to determine the binding of NFKB, NF-AT, and AP-I to IL-2 promoter. Jurkat T cells were nonstimulated or stimulated with ionomycin (1 PM) and PMA (10 ng/ml) for 6 hrs in the absence or presence of pre-incubation of 4-phenylbutyrate sodium (1 mM) for 24 hrs, then formaldehyde crosslinking between protein and DNA and ChIP using anti- NFKB, NF-AT, AP-1, Spi or acetyl 1-13 antibodies (Santa Cruz) were performed. 10 PCR primers were designed to amplify the human IL-2 promoter: F 5' GAGTTACTTTTGTATCCCCACCCCC (-317 to -292 in the IL-2 promoter), R 5' CCTGTACATTGTGGCAGGAGTTGAGG (+33 to 58). PCR amplifications used a three-step protocol with 90'C (30 s) denaturing temperature, 59'C (45 s) primer annealing temperature, and 72'C (30 s) enzyme reaction temperature for 35 cycles. Referring to FIG. 3, phenylbutyrate 15 affects chromatin structure by altering acetyl H3 status, and decreases DNA binding of NFKB, NF-AT, and AP-l to IL-2 promoter, suggesting the suppression of phenylbutyrate on cytokine expression during T-cell activation could be mediated by decreasing binding of transcriptional factors to promoters. While the invention has been described by way of example and in terms of the preferred 20 embodiments, it is to be understood that the invention is not limited to the disclosed embodiments. To the contrary, it is intended to cover various modifications and similar arrangements (as would be apparent to those skilled in the art). Therefore, the scope of the appended claims should be accorded the broadest interpretation so as to encompass all such modifications and similar arrangements. 17 The term "comprise" and variants of the term such as "comprises" or "comprising" are used herein to denote the inclusion of a stated integer or stated integers but not to exclude any other integer or any other integers, unless in the context or usage an exclusive interpretation of the term is required. 5 Any reference to publications cited in this specification is not an admission that the disclosures constitute common general knowledge in Australia.

Claims (8)

1. A pharmaceutical composition when used for preventing, treating, or ameliorating pruritus associated with a cutaneous, mucosal or systemic disease or disorder, wherein the pharmaceutical composition comprises an effective amount of a 5 phenylbutyric acid, phenylproprionic acid, phenylacetic acid, phenylbutyrate, phenylproprionate, phenylacetate, phenylacetylglutamine, phenoxybutyric acid, phenoxyproprionic acid, phenoxyacetic acid, phenoxybutyrate, phenoxyproprionate, phenoxyacetate, bromophenylbutyric acid, bromophenylproprionic acid, bromophenylacetic acid, bromophenylbutyrate, bromophenylproprionate, 10 bromophenylacetate, chlorophenylbutyric acid, chlorophenylproprionic acid, chlorophenylacetic acid, chlorophenylbutyrate, chlorophenylproprionate, chlorophenylacetate, fluorophenylbutyric acid, fluorophenylproprionic acid, fluorophenylacetic acid, fluorophenylbutyrate, fluorophenylproprionate, fluorophenylacetate, iodophenylbutyric acid, iodophenylproprionic acid, 15 iodophenylacetic acid, iodophenylbutyrate, iodophenylproprionate, iodophenylacetate, hydroxyphenylbutyric acid, hydroxyphenylproprionic acid, hydroxyphenylacetic acid, hydroxyphenylbutyrate, hydroxyphenylproprionate, hydroxyphenylacetate, methylphenylbutyric acid, methylphenylproprionic acid, methylphenylacetic acid, methylphenylbutyrate, methylphenylproprionate, 20 methylphenylacetate, ethylphenylbutyric acid, ethylphenylproprionic acid, ethylphenylacetic acid, ethylphenylbutyrate, ethylphenylproprionate, ethylphenylacetate, naphthylbutyric acid, naphthylproprionic acid, naphthylbutyrate, naphthylproprionate, or tributyrin and a pharmaceutically acceptable carrier, salt or solvate thereof. 25

2. The pharmaceutical composition as claimed in claim 1, wherein the disease or disorder is selected from a group consisting of allergic dermatoses, pruritic dermatoses, vascular dermatoses, sebaceous gland disorders, autoimmune disorders, rheumatoid arthritis, systemic lupus erythematosus, progressive systemic sclerosis, sjogren's syndrome, dermatomyositis, mixed connective tissue disease, 19 papulosquamous dermatoses, bacterial dermatoses, viral dermatoses, mycolic skin infections, granulomatous dermatoses, parasitic skin dermatoses, exfoliative dermatitis, bullous dermatoses, pigmented dermatoses, photosensitive dermatoses, dermatoses caused by collagen diseases, dermatoses due to internal diseases, xerosis, 5 urticaria, atopic dermatitis, eczyma, vasculitis, lichen simplex chronicus, psoriasis, scabies, pediculosis corporis and pubis, multiple sclerosis, thyrotoxicosis, diabetes, renal insufficiency, uremia, iron deficiency anemia, cholestasis, delusions of parasitosis, polycythemia rubra vera, wound, sun burn, cold sores, acne, insect bite, radiotherapy or chemotherapy-induced dermatitis or mucositis and paraneoplastic 0 syndrome.

3. The pharmaceutical composition as claimed in either claim I or claim 2, wherein the phenylbutyric acid is present in an amount from about 0.00001% to about 100.00% by weight of the formulation.

4. The pharmaceutical composition as claimed in any one of claims 1 to 5 3, wherein the pharmaceutical composition is formed into a cream, a gel, a lotion, and a paste, an ointment, an emollient, a liposome, a nanosphere, a skin tonic, a mouth wash, an oral rinse, a shampoo, a mousse, a spray, a pack, a capsule, a tablet, a powder, a granule, a solution, a suspension, a patch, or an occlusive skin conditioning agent. 20

5. The pharmaceutical composition as claimed in any one of claims 1 to 4, wherein the pharmaceutical composition further comprises a penetration enhancing agent, or a pH adjusting agent to provide a formulation pH in the range of approximately 3.0 to 13.0.

6. The pharmaceutical composition as claimed in any one of claims I to 25 5, wherein the pharmaceutical composition is administered in combination with a second agent comprising of an anti-histamine, an anticholinergics, a non-steroid anti inflammation drug, a steroid, an anti-oxidant agent, a vitamin, a leukotriene modifier, an interleukin antagonist, a mast cell inhibitor, an anti-IgE antibody, a selective 20 serotonin reuptake inhibitor (SSRI), a 5-hydroxytryptamine (5-HT) receptor antagonist, an antibiotics, a calcineurin inhibitor, a histone deacetylase inhibitor, a gastrin-releasing peptide receptor antagonist, gabapentin, naloxone, or combination thereof. 5

7. The pharmaceutical composition as claimed in claim 6, wherein the pharmaceutical composition and the second agent are systemically or topically administered simultaneously or sequentially.

8. A pharmaceutical composition as defined in claim 1 and substantially as hereinbefore described in one or more of the accompanying Examples. 0 Dated: 17 September 2009 21