AU2007211873A1 - Novel aggrecanase molecules - Google Patents

Description

AUSTRALIA

Patents Act COMPLETE SPECIFICATION

(ORIGINAL)

Class Int. Class Application Number: Lodged: Complete Specification Lodged: Accepted: Published: Priority Related Art: Name of Applicant: Genetics Institute LLC Actual Inventor(s): Michael John Agostino, Christopher J. Corcoran, Katy E. Georgiadis, Edward R. LaVallie, Lisa Weilan Zeng Carl R. Flannery, Bethany A. Freeman, Anne Racie, Natalie Constance Twine, Address for Service and Correspondence: PHILLIPS ORMONDE FITZPATRICK Patent and Trade Mark Attorneys 367 Collins Street Melbourne 3000 AUSTRALIA Invention Title: NOVEL AGGRECANASE MOLECULES Our Ref: 809709 POF Code: 460048/462231 The following statement is a full description of this invention, including the best method of performing it known to applicant(s):

S

O TITLE OF THE INVENTION

O

O)D NOVEL AGGRECANASE MOLECULES SThe present application is a divisional application from Australian patent application NO 2002245758, the entire disclosure of which is incorporated herein by reference.

0C The present invention relates to the discovery of nucleotide sequences encoding l^- 00 novel aggrecanase molecules, the aggrecanase proteins and processes for producing them.

SThe invention further relates to the development of inhibitors of, as well as antibodies to 0the aggrecanase enzymes. These inhibitors and antibodies may be useful for the treatment of various aggrecanase-associated conditions including osteoarthritis.

BACKGROUND OF THE INVENTION Aggrecan is a major extracellular component of articular cartilage. It is a proteoglycan responsible for providing cartilage with its mechanical properties of compressibility and elasticity. The loss of aggrecan has been implicated in the degradation of articular cartilage in arthritic diseases. Osteoarthritis is a debilitating disease which affects at least 30 million Americans [MacLean et al. J Rheumatol 25:2213-8. (1998)]. Osteoarthritis can severely reduce quality of life due to degradation of articular cartilage and the resulting chronic pain. An early and important characteristic of the osteoarthritic process is loss of aggrecan from the extracellular matrix [Brandt, KD.

and Mankin HJ. Pathogenesis of Osteoarthritis, in Textbook of Rheumatology, WB Saunders Company, Philadelphia, PA pgs. 1355-1373. (1993)]. The large, sugarcontaining portion of aggrecan is thereby lost from the extra-cellular matrix, resulting in deficiencies in the biomechanical characteristics of the cartilage.

bJ) A proteolytic activity termed "aggrecanase" is thought to be responsible for the cleavage of aggrecan thereby having a role in cartilage degradation associated with osteoarthritis and inflammatory joint disease. Work has been conducted to identify the enzyme responsible for the degradation of aggrecan in human osteoarthritic cartilage.

00 5 Two enzymatic cleavage sites have been identified within the interglobular domain of aggrecan. One (Asn41-Phe 2 is observed to be cleaved by several known metalloproteases [Flannery, CR et al. J Biol Chem 267:1008-14. 1992; Fosang, AJ et al.

NBiochemical J. 304:347-351. (1994)]. The aggrecan fragment found in human synovial fluid, and generated by IL-1 induced cartilage aggrecan cleavage is at the Glu 3 73 -Ala3 7 4 bond [Sandy, JD, et al. J Clin Invest 69:1512-1516. (1992); Lohmander LS, et al.

Arthritis Rheum 36: 1214-1222. (1993); Sandy JD et al. J Biol Chem. 266: 8683-8685.

(1991)], indicating that none of the known enzymes are responsible for aggrecan cleavage in vivo.

Recently, identification of two enzymes, aggrecanase-1(ADAMTS 4) and aggrecanase -2 (ADAMTS-11) within the "Disintegrin-like and Metalloprotease with Thrombospondin type 1 motif" (ADAM-TS) family have been identified which are synthesized by IL-1 stimulated cartilage and cleave aggrecan at the appropriate site [Tortorella MD, et al Science 284:1664-6. (1999); Abbaszade, I, et al. J Biol Chem 274: 23443-23450. (1999)]. It is possible that these enzymes could be synthesized by osteoarthritic human articular cartilage. It is also contemplated that there are other, related enzymes in the ADAM-TS family which are capable of cleaving aggrecan at the Glu 373 -Ala3 7 4 bond and could contribute to aggrecan cleavage in osteoarthritis.

SUMMARY OF THE INVENTION SThe present invention is directed to the identification of aggrecanase protein molecules capable of cleaving aggrecanase, the nucleotide sequences which encode the aggrecanase enzymes, and processes for the production of aggrecanases. These enzymes 00 are contemplated to be characterized as having proteolytic aggrecanase activity. The invention further includes compositions comprising these enzymes as well as antibodies Sto these enzymes. In addition, the invention includes methods for developing inhibitors of aggrecanase which block the enzyme's proteolytic activity. These inhibitors and antibodies may be used in various assays and therapies for treatment of conditions characterized by the degradation of articular cartilage.

The nucleotide sequence of the aggrecanase molecule of the present invention is set forth in SEQ ID NO: 3. In another embodiment, the nucleotide sequence of the aggrecanase molecule of the present invention is set forth SEQ ID NO: 1 from nucleotide 1 to #3766. In another embodiment the nucleotide sequence of the invention comprises nucleotide #1086(TCG) to 3396 (CGC)of SEQ ID NO: 1. The invention further includes equivalent degenerative codon sequences of the sequences set forth in SEQ ID NO: 1, as well as fragments thereof which exhibit aggrecanase activity.

The amino acid sequence of an isolated aggrecanase molecule of the invention comprises the sequence set forth in SEQ. ID. NO:4. The amino acid sequence of an isolated aggrecanase molecule comprises the sequence set forth in SEQ ID. No. 2. The invention further includes fragments of the amino acid sequence which encode molecules exhibiting aggrecanase activity.

bI) The human aggrecanase protein or a fragment thereof may be produced by culturing a cell transformed with a DNA sequence of SEQ ID NO: 3 or SEQ ID NO: 1 comprising nucleotide 1 to #3766 of SEQ ID NO: 1 or comprising nucleotide 1086 to #3396 of SEQ ID NO:1 and recovering and purifying from the culture medium a protein 00 5 characterized by the amino acid sequence set forth in SEQ ID NO: 4 or SEQ ID NO: 2, respectively, substantially free from other proteinaceous materials with which it is coproduced. For production in mammalian cells, the DNA sequence further comprises a SDNA sequence encoding a suitable propeptide 5' to and linked in frame to the nucleotide sequence encoding the aggrecanase enzyme.

The invention includes methods for obtaining additional aggrecanase molecules, the DNA sequence obtained by this method and the protein encoded thereby. The method for isolation of the full length sequence involves utilizing the aggrecanase sequence set forth in SEQ ID NO: 3 or SEQ ID NO: 1 from nucleotide 1086 to #3396 to design probes for screening using standard procedures known to those skilled in the art.

It is expected that other species have DNA sequences homologous to human aggrecanase enzyme. The invention, therefore, includes methods for obtaining the DNA sequences encoding other aggrecanase molecules the DNA sequences obtained by those methods, and the protein encoded by those DNA sequences. This method entails utilizing the nucleotide sequence of the invention or portions thereof to design probes to screen libraries for the corresponding gene from other species or coding sequences or fragments thereof from using standard techniques. Thus, the present invention may include DNA sequences from other species, which are homologous to the human aggrecanase protein and can be obtained using the human sequence. The present invention may also include functional fragments of the aggrecanase protein, and DNA sequences encoding such functional fragments, as well as functional fragments of other related proteins. The ability of such a fragment to function is determinable by assay of the protein in the biological assays described for the assay of the aggrecanase protein.

The aggrecanase proteins of the present invention may be produced by culturing 0 5 a cell transformed with the DNA sequence of SEQ ID NO: 3 or SEQ ID NO: 1 comprising nucleotide 1 to 3766 of SEQ ID NO: 1 or comprising nucleotide 1086 O to #3396 of SEQ ID NO 1 and recovering and purifying aggrecanase protein from the culture medium. In one embodiment the protein comprises amino acid sequence of SEQ ID NO: 4 or amino acid #1 to #770 of SEQ ID No:2. The purified expressed protein is substantially free from other proteinaceous materials with which it is co-produced, as well as from other contaminants. The recovered purified protein is contemplated to exhibit proteolytic aggrecanase activity cleaving aggrecan. Thus, the proteins of the invention may be further characterized by the ability to demonstrate aggrecan proteolytic activity in an asssay which determines the presence of an aggrecan-degrading molecule. These assays or the development thereof is within the knowledge of one skilled in the art. Such assays may involve contacting an aggrecan substrate with the aggrecanase molecule and monitoring the production of aggrecan fragments [see for example, Hughes et al., Biochem J 305: 799-804(1995); Mercuri et al, J. Bio Chem. 274:32387-32395 (1999)] In another embodiment, the invention includes methods for developing inhibitors of aggrecanase and the inhibitors produced thereby. These inhibitors prevent cleavage of aggrecan. The method may entail the determination of binding sites based on the three dimensional structure of aggrecanase and aggrecan and developing a molecule reactive with the binding site. Candidate molecules are assayed for inhibitory activity. Additional 6 standard methods for developing inhibitors of the aggrecanase molecule are known to Sthose skilled in the art. Assays for the inhibitors involve contacting a mixture of aggrecan and the inhibitor with an aggrecanase molecule followed by measurement of the aggrecanase inhibition, for instance by detection and measurement of aggrecan fragments 00 produced by cleavage at an aggrecanase susceptible site.

Another aspect of the invention therefore provides pharmaceutical compositions

O

Scontaining a therapeutically effective amount of aggrecanase inhibitors, in a pharmaceutically acceptable vehicle.

Aggrecanase-mediated degradation of aggrecan in cartilage has been implicated in osteoarthritis and other inflammatory diseases. Therefore, these compositions of the invention may be used in the treatment of diseases characterized by the degradation of aggrecan and/or an upregulation of aggrecanase. The compositions may be used in the treatment of these conditions or in the prevention thereof.

The invention includes methods for treating patients suffering from conditions characterized by a degradation of aggrecan or preventing such conditions. These methods, according to the invention, entail administering to a patient needing such treatment, an effective amount of a composition comprising an aggrecanase inhibitor which inhibits the proteolytic activity of aggrecanase enzymes.

Still a further aspect of the invention are DNA sequences coding for expression of an aggrecanase protein. Such sequences include the sequence of nucleotides in a 5' to 3' direction illustrated in SEQ ID NO: 1 comprising nucleotide 1 to 3766 or comprising nucleotide 1086 to #3396 of SEQ ID NO: 1 or SEQ ID NO:3 and DNA sequences which, but for the degeneracy of the genetic code, are identical to the DNA sequence of SEQ ID NO: 1 and SEQ ID NO: 3, and encode an aggrecanase protein. Further included in the present invention are DNA sequences which hybridize under stringent conditions with the DNA sequence of SEQ ID NO: 1 and SEQ ID NO: 3 and encode a 00 protein having the ability to cleave aggrecan. Preferred DNA sequences include those which hybridize under stringent conditions [see, T. Maniatis et al, Molecular Cloning (A C, Laboratory Manual), Cold Spring Harbor Laboratory (1982), pages 387 to 389]. It is generally preferred that such DNA sequences encode a polypeptide which is at least about homologous, and more preferably at least about 90% homologous, to the sequence of set forth in SEQ ID NO: 3 or SEQ ID NO: 1 comprising nucleotide 1 to 3766 or comprising nucleotide 1086 to #3396 of SEQ ID NO: 1. Finally, allelic or other variations of the sequences of SEQ ID NO: 1 or SEQ ID NO: 3, whether such nucleotide changes result in changes in the peptide sequence or not, but where the peptide sequence still has aggrecanase activity, are also included in the present invention. The present invention also includes fragments of the DNA sequence shown in SEQ ID NO: 1 which encode a polypeptide which retains the activity of aggrecanase.

The DNA sequences of the present invention are useful, for example, as probes for the detection of mRNA encoding aggrecanase in a given cell population. Thus, the present invention includes methods of detecting or diagnosing genetic disorders involving the aggrecanase, or disorders involving cellular, organ or tissue disorders in which aggrecanase is irregularly transcribed or expressed. The DNA sequences may also be useful for preparing vectors for gene therapy applications as described below.

A further aspect of the invention includes vectors comprising a DNA sequence as Sdescribed above in operative association with an expression control sequence therefor.

These vectors may be employed in a novel process for producing an aggrecanase protein Sof the invention in which a cell line transformed with a DNA sequence encoding an 00 aggrecanase protein in operative association with an expression control sequence therefor, is cultured in a suitable culture medium and an aggrecanase protein is recovered Sand purified therefrom. This process may employ a number of known cells both prokaryotic and eukaryotic as host cells for expression of the polypeptide. The vectors may be used in gene therapy applications. In such use, the vectors may be transfected into the cells of a patient ex vivo, and the cells may be reintroduced into a patient.

Alternatively, the vectors may be introduced into a patient in vivo through targeted transfection.

Still a further aspect of the invention are aggrecanase proteins or polypeptides.

Such polypeptides are characterized by having an amino acid sequence including the sequence illustrated in SEQ ID NO. 2 or 4, variants of the amino acid sequence of SEQ ID NO.2 or 4, including naturally occurring allelic variants, and other variants in which the protein retains the ability to cleave aggrecan characteristic of aggrecanase molecules.

Preferred polypeptides include a polypeptide which is at least about 80% homologous, and more preferably at least about 90% homologous, to the amino acid sequence shown in SEQ ID NO. 2 or 4. Finally, allelic or other variations of the sequences of SEQ ID NO. 2 or 4, whether such amino acid changes are induced by mutagenesis, chemical alteration, or by alteration of DNA sequence used to produce the polypeptide, where the peptide sequence still has aggrecanase activity, are also included in the present invention. The present invention also includes fragments of the amino acid sequence of SEQ ID NO. 2 or 4 which retain the activity of aggrecanase protein.

The purified proteins of the present inventions may be used to generate antibodies, 00 5 either monoclonal or polyclonal, to aggrecanase and/or other aggrecanase -related Sproteins, using methods that are known in the art of antibody production. Thus, the present invention also includes antibodies to aggrecanase or other related proteins. The antibodies may be useful for detection and/or purification of aggrecanase or related proteins, or for inhibiting or preventing the effects of aggrecanase. The aggrecanase of the invention or portions thereof may be utilized to prepare antibodies that specifically bind to aggrecanase.

DETAILED DESCRIPTION OF THE INVENTION The human aggrecanase of the present invention comprises the nucleotide sequence set in SEQ ID NO: 3. In another embodiment, the human aggrecanase of the present invention comprises nucleotides 1 to 3766 or nucleotides 1086 to #3396 of SEQ ID NO 1. The human aggrecanase protein sequence comprises the amino acid sequence set forth in SEQ ID NO: 4. In another embodiment, the human aggrecanase protein sequence comprises amino acids 1 to 770 set forth in SEQ ID NO. 2. Further sequences of the aggrecanase of the present invention may be obtained using the sequences of SEQ ID NO: 3 or SEQ ID NO. 1 comprising nucleotides 1086 to 3396 to design probes for screening for the full sequence using standard techniques.

1 0 The aggrecanase proteins of the present invention, include polypeptides comprising the amino acid sequence of SEQ ID NO.2 or SEQ ID NO: 4 and having the ability to cleave aggrecan.

c The aggrecanase proteins recovered from the culture medium are purified by 00 isolating them from other proteinaceous materials from which they are co-produced and Sfrom other contaminants present. The isolated and purified proteins may be Scharacterized by the ability to cleave aggrecan substrate. The aggrecanase proteins provided herein also include factors encoded by the sequences similar to those of SEQ ID NO: 3 or the sequence of SEQ ID NO: 1 comprising nucleotide 1 to 3766 or comprising nucleotide 1086 to #3396 of SEQ ID NO 1, but into which modifications or deletions are naturally provided allelic variations in the nucleotide sequence which may result in amino acid changes in the polypeptide) or deliberately engineered. For example, synthetic polypeptides may wholly or partially duplicate continuous sequences of the amino acid residues of SEQ ID NO. 2 or SEQ ID NO: 4. These sequences, by virtue of sharing primary, secondary, or tertiary structural and conformational characteristics with aggrecanase molecules may possess biological properties in common therewith. It is know, for example that numerous conservative amino acid substitutions are possible without significantly modifying the structure and conformation of a protein, thus maintaining the biological properties as well. For example, it is recognized that conservative amino acid substitutions may be made among amino acids with basic side chains, such as lysine (Lys or arginine (Arg or R) and histidine (His or amino acids with acidic side chains, such as aspartic acid (Asp or D) and glutamic acid (Glu or 1 1 amino acids with uncharged polar side chains, such as asparagine (Asn or N), glutamine (Gin or serine (Ser or threonine (Thr or and tyrosine (Tyr or and amino acids with nonpolar side chains, such as alanine (Ala or glycine (Gly or G), valine (Val or leucine (Leu or isoleucine (ie or proline (Pro or P), 00 phenylalanine (Phe or methionine (Met or tryptophan (Trp or W) and cysteine (Cys or Thus, these modifications and deletions of the native aggrecanase may be

O

Semployed as biologically active substitutes for naturally-occurring aggrecanase and in the development of inhibitors other polypeptides in therapeutic processes. It can be readily determined whether a given variant of aggrecanase maintains the biological activity of aggrecanase by subjecting both aggrecanase and the variant of aggrecanase, as well as inhibitors thereof, to the assays described in the examples.

Other specific mutations of the sequences of aggrecanase proteins described herein involve modifications of glycosylation sites. These modifications may involve Olinked or N-linked glycosylation sites. For instance, the absence of glycosylation or only partial glycosylation results from amino acid substitution or deletion at asparagine-linked glycosylation recognition sites. The asparagine-linked glycosylation recognition sites comprise tripeptide sequences which are specifically recognized by appropriate cellular glycosylation enzymes. These tripeptide sequences are either asparagine-X-threonine or asparagine-X-serine, where X is usually any amino acid. A variety of amino acid substitutions or deletions at one or both of the first or third amino acid positions of a glycosylation recognition site (and/or amino acid deletion at the second position) results in non-glycosylation at the modified tripeptide sequence. Additionally, bacterial 1 2 Z expression of aggrecanase-related protein will also result in production of a nonglycosylated protein, even if the glycosylation sites are left unmodified.

The present invention also encompasses the novel DNA sequences,.free of Sassociation with DNA sequences encoding other proteinaceous materials, and coding for expression of aggrecanase proteins. These DNA sequences include those depicted in SEQ -ID NO: 1 or 3 in a 5' to 3' direction and those sequences which hybridize thereto under 0 stringent hybridization washing conditions [for example, 0.1X SSC, 0.1% SDS at 65 0

C;

see, T. Maniatis et al, Molecular Cloning (A Laboratory Manual), Cold Spring Harbor Laboratory (1982), pages 387 to 389] and encode a protein having aggrecanase proteolytic activity. These DNA sequences also include those which comprise the DNA sequence of SEQ ID NO: 1 and those which hybridize thereto under stringent hybridization conditions and encode a protein which maintain the other activities disclosed for aggrecanase.

Similarly, DNA sequences which code for aggrecanase proteins coded for by the sequences of SEQ ID NO: 1 comprising nucleotide 1 to 3766 or comprising nucleotide 1086 to #3396 of SEQ ID NO 1 or the sequence of SEQ ID NO: 3 or aggrecanase proteins which comprise the amino acid sequence of SEQ ID NO. 2 or 4, but which differ in codon sequence due to the degeneracies of the genetic code or allelic variations (naturally-occurring base changes in the species population which may or may not result in an amino acid change) also encode the novel factors described herein.

Variations in the DNA sequences of SEQ ID NO: 3 or SEQ ID NO: 1 comprising nucleotide 1 to 3766 or comprising nucleotide 1086 to #3396 of SEQ ID NO 1 which are caused by point mutations or by induced modifications (including insertion, 1 3 01) 00 protein of the invention, under the control of known regulatory sequences. The deletion, ansformed subst cells are cultured an the aggrctivity, half-anaife proteins recovered and purifiedn of the frpolypeptides encoded aulture medium.also encompassed protein the substinventially free from other proteins with which ther aspect of the present invention p well as from othvides a novel method for producing 10 Suitable cells or cell lines may be mammalian cells, such as Chinese hamster ovaggrecanase proteins. The selection of suitable mammalpresent invention involves culturing a suitable for transformation, culture, amplification, screening, product production and purification are known in the art. See, Gething and Sambrook, Nature 293:620-625 (1981), or alternatively, Kaufman et al, Mol. Cell. Biol.. 5(7):1750-1759 (1985) or Howley et al, U.S. Patent 4,419,446. Another suitable mammalian cell line, which has been transformed with a DNA sequence encoding a aggrecanase accprotein of the ing examplesntion, under the ontrol of known regulatory sequencesline. The mammalian cell CV- may also be suitable.

transformed hostcteria cells may also be suitable hosts. For example, the various straand the aggrecanase proteins recovered and purified from the culture medium. The purified proteins are substantially free from other proteins with which they are co-produced as well as from other contaminants.

Suitable cells or cell ines may be mammalians host cells, such as Chinese hamstechnology.

ovarious straincells (CHO). The selectis, Pseudomonas, other bacillian host cells and the like may also be transformation, culture, amplification, screening, product production and purification are known in the art. See, Gething and Sambrook, Nature. 223:620-625 (1981), or alternatively, Kaufman et al, Mol. Cell. Biol., 5(7):1750-1759 (1985) or Howley et al, U.S. Patent 4,419,446. Another suitable mammalian cell 1ine, which is described in the accompanying examples, is the monkey COS-1 cell line. The mammalian cell CV-1 may also be suitable.

Bacterial cells may also be suitable hosts. For example, the various strains of E. coli HB 101, MC1061) are well-known as host cells in the field of biotechnology.

Various strains of 13. subilis, Pseudomonas, other bacilli and the like may also be employed in this method. For expression of the protein in bacterial cells, DNA encoding the propeptide of Aggrecanase is generally not necessary.

1 4 Many strains of yeast cells known to those skilled in the art may also be available as host cells for expression of the polypeptides of the present invention. Additionally, where desired, insect cells may be utilized as host cells in the method of the present C€ invention. See, e.g. Miller et al, Genetic Engineering. 8:277-298 (Plenum Press 1986) 00 and references cited therein.

Another aspect of the present invention provides vectors for use in the method of Sexpression of these novel aggrecanase polypeptides. Preferably the vectors contain the full novel DNA sequences described above which encode the novel factors of the invention. Additionally, the vectors contain appropriate expression control sequences permitting expression of the aggrecanase protein sequences. Alternatively, vectors incorporating modified sequences as described above are also embodiments of the present invention. Additionally, the sequence of SEQ ID NO:3 or SEQ ID NO: 1 or other sequences encoding aggrecanase proteins could be manipulated to express composite aggrecanase molecules. Thus, the present invention includes chimeric DNA molecules encoding an aggrecanase protein comprising a fragment from SEQ ID NO: 3 or SEQ ID NO: 1 comprising nucleotide 1 to 3766 or comprising nucleotide 1086 to #3396 of SEQ ID NO 1 linked in correct reading frame to a DNA sequence encoding another aggrecanase polypeptide.

The vectors may be employed in the method of transforming cell lines and contain selected regulatory sequences in operative association with the DNA coding sequences of the invention which are capable of directing the replication and expression thereof in selected host cells. Regulatory sequences for such vectors are known to those skilled in 1 the art and may be selected depending upon the host cells. Such selection is routine and does not form part of the present invention.

Various conditions such as osteoarthritis are known to be characterized by degradation of aggrecan. Therefore, an aggrecanase protein of the present invention 00 which cleaves aggrecan may be useful for the development of inhibitors of aggrecanase.

The invention therefore provides compositions comprising an aggrecanase inhibitor. The

O

Sinhibitors may be developed using the aggrecanase in screening assays involving a mixture of aggrecan substrate with the inhibitor followed by exposure to aggrecan. The compositions may be used in the treatment of osteoarthritis and other conditions exhibiting degradation of aggrecan.

The invention further includes antibodies which can be used to detect aggrecanase and also may be used to inhibit the proteolytic activity of aggrecanase.

The therapeutic methods of the invention includes administering the aggrecanase inhibitor compositions topically, systemically, or locally as an implant or device. The dosage regimen will be determined by the attending physician considering various factors which modify the action of the aggrecanase protein, the site of pathology, the severity of disease, the patient's age, sex, and diet, the severity of any inflammation, time of administration and other clinical factors. Generally, systemic or injectable administration will be initiated at a dose which is minimally effective, and the dose will be increased over a preselected time course until a positive effect is observed. Subsequently, incremental increases in dosage will be made limiting such incremental increases to such levels that produce a corresponding increase in effect, while taking into account any 1 6 adverse affects that may appear. The addition of other known factors, to the final composition, may also effect the dosage.

Progress can be monitored by periodic assessment of disease progression. The Sprogress can be monitored, for example, by x-rays, MRI or other imaging modalities, 00 synovial fluid analysis, and/or clinical examination.

The following examples illustrate practice of the present invention in isolating

O

and characterizing human aggrecanase and other aggrecanase-related proteins, obtaining the human proteins and expressing the proteins via recombinant techniques.

EXAMPLES

EXAMPLE 1 Isolation of DNA Potential novel aggrecanase family members were identified using a database screening approach. Aggrecanase-1 Science284:1664-1666 (1999)] has at least six domains: signal, propeptide, catalytic domain, disintegrin, tsp and c-terminal. The catalytic domain contains a zinc binding signature region, TAAHELGHVKF and a "MET turn" which are responsible for protease activity. Substitutions within the zinc binding region in the number of the positions still allow protease activity, but the histidine (H) and glutamic acid residues must be present. The thrombospondin domain of Aggrecanase-l is also a critical domain for substrate recognition and cleavage. It is these two domains that determine our classification of a novel aggrecanase family member.

The protein sequence of the Aggrecanase-l DNA sequence was used to query against the 1 7 SGeneBank ESTs focusing on human ESTs using TBLASTN. The resulting sequences were the starting point in the effort to identify full length sequence for potential family members. The nucleotide sequence of the aggrecanase of the present invention is c comprised of one EST (AA588434) that contains homology over the catalytic domain 00 and zinc binding motif of Aggrecanase-1(ADAMTS4).

This human aggrecanase sequence was isolated from a dT-primed cDNA library

O

0constructed in the plasmid vector pED6-dpc2. cDNA was made from human testes RNA purchased from Clontech. The probe to isolate the aggrecanase of the present invention was generated from the sequence obtained from the database search. The sequence of the probe was as follows: 5'-GGTCAAATCGCGTCAGTGTAAATACGGG-3'. The DNA probe was radioactively labeled with 32P and used to screen the human testes dT-primed cDNA library, under high stringency hybridization/washing conditions, to identify clones containing sequences of the human candidate #8.

Fifty thousand library transformants were plated at a density of approximately 5000 transformants per plate on 10 plates. Nitrocellulose replicas of the transformed colonies were hybridized to the 32 labeled DNA probe in standard hybridization buffer (1X Blotto[25X Blotto %5 nonfat dried milk,0.02% azide in dH20] 1% NP-40 6X SSC +0.05% Pyrophosphate) under high stringency conditions (65C for 2 hours shaking). After 2 hours hybridization, the radioactively labeled DNA probe containing hybridization solution was removed and the filters were washed under high stringency conditions (3X SSC, 0.05% Pyrophosphate for 5 minutes at RT; followed by 2.2X SSC, 0.05% Pyrophosphate for 15 minutes at RT; followed by 2.2X SSC, 0.05% Pyrophosphate for 1-2 minutes at 65 0 The filters were wrapped in Saran wrap and 1 8 exposed to X-ray film for overnight. The autoradiographs were developed and positively hybridizing transformants of various signal intensities were identified. These positive c l clones were picked; grown for 12 hours in selective medium(L-broth plus 100g/ml c ampicillin) and plated at low density (approximately 100 colonies per plate).

00 5 Nitrocellulose replicas of the colonies were hybridized to the IP labeled probe in standard hybridization buffer ((lX Blotto[25X Blotto %5 nonfat dried milk, 0.02% Sazide in dH20] 1% NP-40 6X SSC +0.05% Pyrophosphate) under high stringency conditions (65C for 2 hours). After 2 hours hybridization, the radioactively labeled DNA probe containing hybridization solution was removed and the filters were washed under high stringency conditions (3X SSC, 0.05% Pyrophosphate for 5 minutes at RT; followed by 2.2X SSC, 0.05% Pyrophosphate for 15 minutes at RT; followed by 2.2X SSC, 0.05% Pyrophosphate for 1-2 minutes at 65 0 The filters were wrapped in Saran wrap and exposed to X-ray film for overnight. The autoradiographs were developed and positively hybridizing transformants were identified. Bacterial stocks of purified hybridization positive clones were made and plasmid DNA was isolated. The sequence of the cDNA insert was determined and is set forth in SEQ ID NO. 1 from nucleotide 1086 (TCG) through 3396 (CGC). This sequence has been deposited in the American Type Culture Collection 10801 University Blvd. Manassas, VA 20110-2209 USA as PTA -2284. The cDNA insert contained the sequences of the DNA probe used in the hybridization. The 5'(prime) and 3' (prime) sequences of this isolated sequence was then extracted using the RACE protocol. The fully determined sequence is set forth in SEQ ID NO: 1 from nucleotide 1 to 3766.

1 9 The human candidate #8 sequence obtained aligns with several ESTs in the public database. Candididate #8 shows homology with ADAMTS 7 and 6. The aggrecanase of the present invention contains the zinc binding signature region, a "MET turn", and tsp type -1 motif, however is missing the signal and propeptide regions and c-terminal spacer 00 regions. It is with these criteria that candidate #8 is considered a novel Aggrecanase family member.

O

SThe aggrecanase sequence of the invention can be used to design probes for further screening for full length clones containing the isolated sequence.

The 5P (signal and propeptide) and 3P (C-terminal spacer regions) ends of the full-length version of EST8 were determined by RACE PCR using the Clontech Marathon cDNA Amplification Kit. The testes and stomach Marathon cDNA sources were used as substrates for the RACE reactions. 5P RACE primers used in the reactions were; GSP1 AGTCTAGAAAGCTGGTGATGTAGTCACGGC and GSP2 TAGATGCATATGTCATAGCGTGTGATGAGCACTGC (contains a Nsil site). The Advantage-2 PCR Kit from Clontech was used to set up nested RACE reactions following instructions in the user manual for the Marathon cDNA Amplification Kit; the amount the GSP primers used was 0.2 pmol/ul of each PCR primer/ul of reaction mix.

GSP1 primer was used for the first round of PCR and GSP2 primer was used for the nested reaction. Products from the nested RACE reactions were digested with Nsil (on the GSP2 primer) and Noti (on the AP2 primer provided in the Clontech kit and used in the nested RACE PCR) and ligated into the CS2+ vector cut with Nsil and Notl. Ligated products were transformed into ElectroMAX DH10B cells from Life Technologies.

2 0 to Cloned RACE products were plated at low density (approximately 300 colonies per plate). Nitrocellulose replicas of the transformed colonies were hybridized to a 32P 1 labeled DNA probe in standard hybridization buffer (1X Blotto [25X Blotto nonfat C dried milk, 0.02% azide], 1% NP-40, 6X SSC, 0.05% pyrophosphate) under high r-.

stringency conditions (65C for 2 hours shaking). Sequence at the 5P end of candidate 8- 1 was used as a DNA probe: CTCGAGTCTGGGAAGCACCGTTAACATCC.

SAfter 2 hours, the hybridization solution (hybridization buffer containing 1x10 6 cpm 32P labeled DNA probe) was removed and the filters were washed under high stringency conditions (3X SSC, 0.05% pyrophosphate for 5 minutes at RT standing; followed by 2.2X SSC, 0.05% pyrophosphate for 15 minutes shaking at RT; followed by 2.2X SSC, 0.05% pyrophosphate for 1-2 minutes shaking at 65C). The filters were covered with Saran Wrap and exposed to X-ray film overnight. The autoradiographs were developed and positively hybridizing transformants of various signal intensities were identified. These positive clones were picked and then grown for 12 hours in selective medium (L-broth plus 100ug/ml ampicillin). Plasmid DNA was prepared and sent for DNA sequence analysis. A second round of hybridizations was performed using a probe that was made to sequence more 5P than candidate 8-1. The DNA probe sequence was deduced from the 5P RACE products. The second probe sequence was as follows: GAAGGCGATCTCATAGCTCTCCAGACT. Cloned RACE products were again plated and the same hybridization protocol was followed, except using the more 5P probe. The initiator Met was deduced from a consensus sequence derived from the 5P RACE products generated from both the testes and the stomach cDNAs. 3P RACE primers used 2 1 were; GSPI GCTCTAGACTGGTCTGAGTGCACCCCCAGCT and GSP2 GTCCTTTGCAAGAGCGCAGACCAC. The Advantage GC-2 PCR Kit from Clontech was used to set up nested RACE reactions. Reactions were set up following the instructions in the user manual for the Marathon cDNA Amplification Kit; with the 00 exception that the amount of GC melt used was 5ul per 50ul reaction; the amount the GSP primers used was 0.2 pmol/ul of each PCR primer/ul of reaction mix. GSP1 primer was used for the first round of PCR and GSP2 primer was used for the nested reaction.

Products from the nested RACE reactions were ligated into the pT-Adv vector using the AdvanTAge PCR Cloning Kit, per manufacturer's instructions. Ligated products were transformed into ElectroMAX DH10B cells from Life Technologies. Cloned RACE products were plated at low density (approximately 300 colonies per plate).

Nitrocellulose replicas of the transformed colonies were hybridized to a 3 2 P labeled DNA probe in standard hybridization buffer (1X Blotto [25X Blotto nonfat dried milk, 0.02% azide], 1% NP-40, 6X SSC, 0.05% pyrophosphate) under high stringency conditions (65'C for 2 hours shaking). Sequence at the 3P end of candidate 8-1 was used as a DNA probe: GCACTGTGCAGAGCACTCACCCCA. After 2 hours, the hybridization solution (hybridization buffer containing 1x10 6 cpm 32 P labeled DNA probe) was removed and the filters were washed under high stringency conditions (3X SSC, 0.05% pyrophosphate for 5 minutes at RT standing; followed by 2.2X SSC, 0.05% pyrophosphate for 15 minutes shaking at RT; followed by 2.2X SSC, 0.05% pyrophosphate for 1-2 minutes shaking at 65'C). The filters were covered with Saran Wrap and exposed to X-ray film overnight. The autoradiographs were developed and 2 2 Spositively hybridizing transformants of various signal intensities were identified. The Spositive clones were picked and then grown for 12 hours in selective medium (L-broth CI plus 100ug/ml ampicillin). Plasmid DNA was prepared and sent for DNA sequence Sanalysis. The stop codon was deduced from a consensus sequence derived from the 3P O 5 RACE products generated from both the testes and the stomach cDNAs.

With the exception of the region from base pair 1332 to 1517(for this description l- Sbase pair #1 is A of the initiator Met (ATG), the full-length sequence of EST8 was confirmed. A search of the public databases revealed a partial sequence for EST8 termed ADAMTS10. We used the sequence from this partial clone to construct the contiguous region of our EST8 (base pair 1332 to 1517) with synthetic oligonucleotides.

The full-length sequence for EST8(SEQ ID NO:3) was the consensus sequence derived from the hybridization positive candidate 8-1, the publicly available sequences representing ESTS, and the PCR products from the Clontech testes and stomach cDNAs.

The final EST8 expression construct was assembled from 4 EST8 specific fragments.

The 5P portion of EST8, from base pair 1 1342, was PCR amplified from a pool of stomach and testes cDNAs and will be termed fragment 1. The following primers were used; 5P PCR primer AAATGGGCGAATTCCCACCATGGCTCCCGCCTGCCAGATCCTCCG (contains an 8 base pair linker (AAATGGGC) an EcoR1 cloning site (GAATTC) and a Kozak sequence (CCACC) upstream of the initiator Met) and 3P PCR primer CCGAGTCTAGAAAGCTGGTGATGTAG (contains an Xbal site (TCTAGA)). This PCR product was digested with EcoR1 and Xbal using standard digestion conditions.

2 3 The next portion of the gene, fragment 2, was constructed using synthetic oligonucleotides. The synthetic fragment stretched from an Xbal site to a BsrFl site representing base pair 1333 to 1517 of EST8. The synthetic oligonucleotides consisted of the following sequence: the top strand consisted of 00 CTAGACTCGGGCCTGGGGCTCTGCCTGAACAACCGACCCCCCAGACAGGACr

TGTGTACCCGACAGTGGCACCGGGCCAAGCCTACGATGCAGATGAGCAATG

CCGCrITCAGCATGGAGTCAAATCGCGTCAGTGTAAATACGGGGAGGTCTGC AGCGAGCTGTGGTGTCTGAGCAAGAGCAA; the bottom strand consisted of

CCGGTTGCTCTTGCTCAGACACCACAGCTCGCTGCAGACCCCCCGTAITAC

ACTGACGCGATTGACTCCATGCTGAAAGCGGCATTGCTCATCTGCATCGTAG

GCTTGGCCCGGTGCCACTGTCGGGTACACAAAGTCCTGTCTGGGGGGTCGGTT

GTTCAGGCAGAGCCCCAGGCCCGAGT. The next portion of EST8, fragment 3, was a BsrF1 to Sphl fragment digested from candidate 8-1. This represented from base pair 1518 to 2783 of the full-length version of EST8. The 3P portion of EST8, termed fragment 4 (base pair 2663 to 3314), was PCR amplified. The following primers were used; 5P GGGTITGTAGGGAACTGGTCGCTCTG (located within fragment 3, upstream of the Sphl site) and 3P AAATGGGCCTCGAGCCCTAGTGGCCCTGGCAGGTTTGC (contains an 8 base pair linker (AAATGGGC) and a Xhol site (CTCGAG) downstream of the stop codon This PCR product was digested with Sphl and Xhol using standard digestion conditions. A full-length version of EST8 was constructed by ligating these 4 described fragments, 5P fragment 1 (EcoR1/Xbal), internal fragment 2 (Xbal/BsrFl), internal 24 Sfragment 3 (BsrFl/Sphl), and 3P fragment 4 (Sphl/Xhol) into the Cos expression vector pED6-dpc2 (digested with EcoR1 and Xhol). The final construct had a mutation in the Xhol cloning site, which was destroyed in the ligation. This did not effect the EST8 coding sequence and was left in the construct.

00 C 5 EXAMPLE 2 O Expression of Aggrecanase 1 In order to produce murine, human or other mammalian aggrecanase-related proteins, the DNA encoding it is transferred into an appropriate expression vector and introduced into mammalian cells or other preferred eukaryotic or prokaryotic hosts including insect host cell culture systems by conventional genetic engineering techniques.

Expression system for biologically active recombinant human aggrecanase is contemplated to be stably transformed mammalian cells, insect, yeast or bacterial cells.

One skilled in the art can construct mammalian expression vectors by employing the sequence of SEQ ID NO: 3 or the sequence of SEQ ID NO: 1 comprising nucleotide 1 to 3766 or comprising nuclotide 1086 to #3396 of SEQ ID NO lor other DNA sequences encoding aggrecanase-related proteins or other modified sequences and known vectors, such as pCD [Okayama et al., Mol. Cell BpoL 2:161-170 (1982)], pJL3, pL4 [Gough et al., EMBO L, 4:645-653 (1985)] and pMT2 CXM.

The mammalian expression vector pMT2 CXM is a derivative of p91023(b) (Wong et al., Science 228:810-815, 1985) differing from the latter in that it contains the ampicillin resistance gene in place of the tetracycline resistance gene and further contains 2 a XhoI site for insertion of cDNA clones. The functional elements of pMT2 CXM have been described (Kaufman, 1985, Proc. Natl. Acad. Sci. USA 82:689-693) and include the adenovirus VA genes, the SV40 origin of replication including the 72 bp enhancer, the adenovirus major late promoter including a 5' splice site and the majority of 00 the adenovirus tripartite leader sequence present on adenovirus late mRNAs, a 3' splice U acceptor site, a DHFR insert, the SV40 early polyadenylation site (SV40), and pBR322 C, sequences needed for propagation in E coli.

Plasmid pMT2 CXM is obtained by EcoRI digestion of pMT2-VWF, which has been deposited with the American Type Culture Collection (ATCC), Rockville, MD (USA) under accession number ATCC 67122. EcoRI digestion excises the cDNA insert present in pMT2-VWF, yielding pMT2 in linear form which can be ligated and used to transform E. coli HB 101 or DH-5 to ampicillin resistance. Plasmid pMT2 DNA can be prepared by conventional methods. pMT2 CXM is then constructed using loopout/in mutagenesis [Morinaga, et al., Biotechnology 4: 636 (1984). This removes bases 1075 to 1145 relative to the Hind III site near the SV40 origin of replication and enhancer sequences of pMT2. In addition it inserts the following sequence: PO-CATGGGCAGCTCGAG-3' at nucleotide 1145. This sequence contains the recognition site for the restriction endonuclease Xho I. A derivative of pMT2CXM, termed pMT23, contains recognition sites for the restriction endonucleases PstI, Eco RI, SalI and XhoI. Plasmid pMT2 CXM and pMT23 DNA may be prepared by conventional methods.

2 6 ;Z pEMC2P3l derived from pMT21 may also be suitable in practice of the invention.

pMT21 is derived from pMT2 which is derived from pMT2-VWF. As described above EcoRI digestion excises the cDNA insert present in pMT-VWF, yielding pMT2 in linear Sform which can be ligated and used to transform E Coli HB 101 or DH-5 to ampicillin resistance. Plasmid pMT2 DNA can be prepared by conventional methods.

pMT21 is derived from pMT2 through the following two modifications. First, 76 bp of the 5' untranslated region of the DHFR cDNA including a stretch of 19 G residues from G/C tailing for cDNA cloning is deleted. In this process, a XhoI site is inserted to obtain the following sequence immediately upstream from DHFR: 5' CT CAGGCGAGCCTGAATTCCTCGAGCCATCATG-3' PstI Eco RI XhoI Second, a unique Clal site is introduced by digestion with EcoRV and Xbal, treatment with Klenow fragment of DNA polymerase I, and ligation to a Clal linker (CATCGATG).

This deletes a 250 bp segment from the adenovirus associated RNA (VAI) region but does not interfere with VAI RNA gene expression or function. pMT21 is digested with EcoRI and XhoI, and used to derive the vector pEMC2B1.

A portion of the EMCV leader is obtained from pMT2-ECAT1 Jung, et al, L Virol 63:1651-1660 (1989)] by digestion with Eco RI and PstI, resulting in a 2752 bp fragment. This fragment is digested with TaqI yielding an Eco RI-TaqI fragment of 508 bp which is purified by electrophoresis on low melting agarose gel. A 68 bp adapter and 2 7 Sits complementary strand are synthesized with a 5' TaqI protruding end and a 3' XhoI protruding end which has the following sequence: C l"- 00 TaqI GAAAAACACGATTGC-3'

O

XhoI This sequence matches the EMC virus leader sequence from nucleotide 763 to 827. It also changes the ATG at position 10 within the EMC virus leader to an ATT and is followed by a XhoI site. A three way ligation of the pMT21 Eco RI-16hoI fragment, the EMC virus EcoRI-TaqI fragment, and the 68 bp oligonucleotide adapter TaqI-16hoI adapter resulting in the vector pEMC2p1.

This vector contains the SV40 origin of replication and enhancer, the adenovirus major late promoter, a cDNA copy of the majority of the adenovirus tripartite leader sequence, a small hybrid intervening sequence, an SV40 polyadenylation signal and the adenovirus VA I gene, DHFR and P-lactamase markers and an EMC sequence, in appropriate relationships to direct the high level expression of the desired cDNA in mammalian cells.

The construction of vectors may involve modification of the aggrecanase-related DNA sequences. For instance, aggrecanase cDNA can be modified by removing the noncoding nucleotides on the 5' and 3' ends of the coding region. The deleted non-coding 2 8 t nucleotides may or may not be replaced by other sequences known to be beneficial for expression. These vectors are transformed into appropriate host cells for expression of aggrecanase-related proteins. Additionally, the sequence of SEQ ID NO: 3 or SEQ ID SNO: 1 comprising nucleotide 1 to 3766 or comprising nuclotide 1086 to #3396 of 1- O 5 SEQ ID NO lor other sequences encoding aggrecanase-related proteins can be l ,manipulated to express a mature aggrecanase-related protein by deleting aggrecanase Sencoding propeptide sequences and replacing them with sequences encoding the complete propeptides of other aggrecanase proteins.

One skilled in the art can manipulate the sequences of SEQ ID NO: 3 or SEQ ID NO: 1 by eliminating or replacing the mammalian regulatory sequences flanking the coding sequence with bacterial sequences to create bacterial vectors for intracellular or extracellular expression by bacterial cells. For example, the coding sequences could be further manipulated ligated to other known linkers or modified by deleting noncoding sequences therefrom or altering nucleotides therein by other known techniques).

The modified aggrecanase-related coding sequence could then be inserted into a known bacterial vector using procedures such as described in T. Taniguchi et al., Proc. Natl Acad. Sci. USA, 77:5230-5233 (1980). This exemplary bacterial vector could then be transformed into bacterial host cells and a aggrecanase-related protein expressed thereby.

For a strategy for producing extracellular expression of aggrecanase-related proteins in bacterial cells, see, e.g. European patent application EPA 177,343.

Similar manipulations can be performed for the construction of an insect vector [See, e.g. procedures described in published European patent application 155,476] for 2 9 expression in insect cells. A yeast vector could also be constructed employing yeast regulatory sequences for intracellular or extracellular expression of the factors of the present invention by yeast cells. [See, procedures described in published PCT application W086/00639 and European patent application EPA 123,289].

00 A method for producing high levels of a aggrecanase-related protein of the invention in mammalian, bacterial, yeast or insect host cell systems may involve the construction of cells containing multiple copies of the heterologous Aggrecanase-related gene. The heterologous gene is linked to an amplifiable marker, e.g. the dihydrofolate reductase (DHFR) gene for which cells containing increased gene copies can be selected for propagation in increasing concentrations of methotrexate (MTX) according to the procedures of Kaufman and Sharp, J. Mol. Biol.. 159:601-629 (1982). This approach can be employed with a number of different cell types.

For example, a plasmid containing a DNA sequence for an aggrecanase-related protein of the invention in operative association with other plasmid sequences enabling expression thereof and the DHFR expression plasmid pAdA26SV(A)3 [Kaufman and Sharp, Mol. Cell. Biol., 2:1304 (1982)] can be co-introduced into DHFR-deficient CHO cells, DUKX-BII, by various methods including calcium phosphate coprecipitation and transfection, electroporation or protoplast fusion. DHFR expressing transformants are selected for growth in alpha media with dialyzed fetal calf serum, and subsequently selected for amplification by growth in increasing concentrations of MTX sequential steps in 0.02, 0.2, 1.0 and 5uM MTX) as described in Kaufman et al., Mol Cell Biol., 5:1750 (1983). Transformants are cloned, and biologically active aggrecanase expression 3 0 is monitored by the assays described above. Aggrecanase protein expression should Sincrease with increasing levels of MTX resistance. Aggrecanase polypeptides are characterized using standard techniques known in the art such as pulse labeling with methionine or cysteine and polyacrylamide gel electrophoresis. Similar procedures 00 can be followed to produce other related aggrecanase-related proteins.

In one example the aggrecanase gene of the present invention set forth in SEQ ID

O

SNO:3 is cloned into the expression vector pED6 [Kaufman et al., Nucleic Acid Res.

19:44885-4490(1991)]. COS and CHO DUKX B11 cells are transiently transfected with the aggrecanase sequence of the invention co-transfection of PACE on a separate pED6 plaasmid) by lipofection(LF2000, Invitrogen). Duplicate tranfections are performed for each gene of interest: one for harvesting conditioned media for activity assay and one for 35-S-methionine/cysteine metabolic labeling.

On day one media is changed to DME(COS) or alpha(CHO) media 1% heatinactivated fetal calf serum+/- 1001g/ml heparin on wells(a) to be harvested for activity assay. After 48h (day4), conditioned media is harvested for activity assay.

On day 3, the duplicate wells(b) were changed to MEM (methiooinefree/cyysteine free) media 1% heat-inactivated fetal callf serum +1001pg/ml heparin 100[lCi/ml 35S-methioine/cysteine (Redivue Pro mix, Amersham). Following 6h incubation at 37 0 C, conditioned media was harvested and run on SDS-PAGE gels under reducing conditions. Proteins are visualized by autoradiography.

3 1 EXAMPLE 3 Biological Activity of Expressed Aggrecanase To measure the biological activity of the expressed aggrecanase-related proteins obtained in Example 2 above, the proteins are recovered from the cell culture and purified 00 by isolating the aggrecanase-related proteins from other proteinaceous materials with Swhich they are co-produced as well as from other contaminants. The purified protein may C, be assayed in accordance with assays described above. Purification is carried out using standard techniques known to those skilled in the art.

Protein analysis is conducted using standard techniques such as SDS-PAGE acrylamide [Laemmli, Nature 227:680 (1970)] stained with silver [Oakley, et al. Anal.

Biochem. 105:361 (1980)] and by immunoblot [Towbin, et al. Proc. Natl: Acad. Sci. USA 76:4350 (1979)].

The foregoing descriptions detail presently preferred embodiments of the present invention. Numerous modifications and variations in practice thereof are expected to occur to those skilled in the art upon consideration of these descriptions. Those modifications and variations are believed to be encompassed within the claims appended hereto.

Throughout the description and the claims of this specification the word "comprise" and variations of the word, such as "comprising" and "comprises" is not intended to exclude other additives, components, integers or steps.

The discussion of documents, acts, materials, devices, articles and the like is included in this specification solely for the purpose of providing a context for the present invention. It is not suggested or represented that any or all of these matters formed part of the prior art base or were common general knowledge in the field relevant to the present invention as it existed in Australia before the priority date of each claim of this application.

S32

Claims (21)

1. An isolated DNA molecule comprising a DNA sequence set forth in SEQ ID NO.

3. 00 2. An isolated DNA molecule comprising a DNA sequence set forth in SEQ ID NO. 1 from nucleotide #1086 to 3396. 3. An isolated DNA molecule comprising a DNA sequence selected from the group consisting of a) the sequence of SEQ ID NO. 3, b) the sequence of SEQ ID NO: 1 comprising nuclotide 1086 to #3396 naturally occurring human allelic sequences and equivalent degenerative codon sequences of a) and b).

4. A vector comprising a DNA molecule of claim 1 in operative association with an expression control sequence therefor. A vector comprising a DNA molecule of claim 2 in operative association with an expression control sequence therefor.

6. A host cell transformed with the DNA sequence of claim 1. 3 3

7. A host cell transformed with a DNA sequence of claim 2.

8. A method for producing a purified human aggrecanase protein, said method 00 comprising the steps of: culturing a host cell transformed with a DNA molecule according to claim 1; and recovering and purifying said aggrecanase protein from the culture medium.

9. A method for producing a purified human aggrecanase protein, said method comprising the steps of: culturing a host cell transformed with a DNA molecule according to claim 2; and recovering and purifying said aggrecanase protein from the culture medium. A purified aggrecanase polypeptide comprising the amino acid sequence of SEQ ID NO:4.

11. A purified aggrecanase polypeptide comprising the amino acid sequence set forth in SEQ ID NO 2.

12. A purified aggrecanase polypeptide produced by the steps of 3 4 culturing a cell transformed with a DNA molecule according to claim 1; C1 and recovering and purifying from said culture medium a polypeptide 00 comprising the amino acid sequence set forth in SEQ ID NO.4. S13. A purified aggrecanase polypeptide produced by the steps of 1 culturing a cell transformed with a DNA molecule according to claim 2; and recovering and purifying from said culture medium a polypeptide comprising the amino acid sequence set forth in SEQ ID NO. 2.

14. An antibody that binds to a purified aggrecanase protein of claim A method for developing inhibitors of aggrecanase comprising the use of aggrecanase protein set forth in SEQ ID NO. 4 or a fragment thereof.

16. A method for developing inhibitors of aggrecanase comprising the use of aggrecanase protein set forth in SEQ ID NO. 2 or a fragment thereof.

17. The method of claim 15 or 16 wherein said method comprises three dimensional structural analysis. 3 I I

18. The method of claim 15 or 16 wherein said method comprises computer aided C drug design. 00 19. A composition for inhibiting the proteolytic activity of aggrecanase comprising a peptide molecule which binds to the aggrecanase inhibiting the proteolytic r- degradation of aggrecan. A method for inhibiting the cleavage of aggrecan in a mammal comprising administering to said mammal an effective amount of a compound that inhibits aggrecanase activity.

21. A purified human aggrecanase protein according to claim 9 or 10 when produced by a method according to claim 9 or 10.

22. A DNA molecule according to any one of claims 1 to 3 substantially as hereinbefore described, with reference to any of the Examples.

23. A vector according to claim 4 or 5 substantially as hereinbefore described, with reference to any of the Examples.

24. A host cell according to claim 6 or 7 substantially as hereinbefore described, with reference to any of the Examples. A method according to any one of claims 8, 9, 15, 16 or 20 substantially as hereinbefore described, with reference to any of the Examples.

26. A polypeptide according to any one of claims 10 to 13 substantially as hereinbefore described, with reference to any of the Examples.

27. An antibody according to claim 14 substantially as hereinbefore described, with reference to any of the Examples.

28. A composition according to claim 19 substantially as hereinbefore described, with reference to any of the Examples.

29. A purified human aggrecanase protein according to claim 21 substantially as hereinbefore described, with reference to any of the Examples. 3 6 SEQUENCE LISTING <110> Genetics institute, Inc. <120> NOVEL AGGRECAN.SE MOLECULES <130> GI 5454 <150> 60/242,317 <151> 2000-10-20 <160> 4 <170> FastSEQ for Windows Version <210> 1 <211> 3766 <212> DNA <213> unkmown <400> 1 gcggccgctg aattctaggg aaggcccaga gagggaggcc cccaacacta ctccaccaac tgaacagggg aggcggcact gacacgtggc ctctatggct tgg'gcctcat gttcgaggtc tggagagcta tgagatcgcc tctcgccacc tcctccccgg tcttctacaa agtggcctcg gtctactggc agggcacgtc gggcggcccg gccccactgc atgtggccat cagcacctgt acctgattga gcccctgcac cacatgtggt gtacaagcgt tgagagatga gaaaccgtgg ctgccaggcc cctggggaat gccgagagcg ctacgtggag ggcgccggga tgtggagcag aggactcgag tctgggaagc aggaccagcc cactctggag ag-tggcagaa atccatcgtg tggctaacca tgacacagca aaccctgcgg cacactaggc gCagcgtcaa taaggacatt acacattcgg catgaaccat cagccaagct catggctgC gcagccgtga ctacatcacc cggcccccca gacaggactt gatgagcaat gccgctttca gcagcgagct gtggtgtctg ccgagggcac gctgtgccag gtgtcccctt tgggtcgcgC ggggcgactg cagccggacc gccccaggcc aaccatcggg gcaacacgga tgactgtccc ttgacagcat CCCtttccgt tgaaggcctg ctcgctcacg cagccgtggt ggacgggaca aatgcaagca cgtgggctgc gagtgtgtgg cggtgacggc cacctggggc cgggtacgag tccaggatCt gaacctctct tgctggaggg gctgcccggg ttcaactgcg acaggggcca catctctcat cgtcatggtg atgcccccat cgcccgtgac agtgctcggc ccagtgtgca aggccccggg caggtgr-agg cgaagccccc gtgggggctg cccgcctgcc acgcacgcct ttccccaccc aggcagcgcc cccagcaccc tccgtggagt ctctacgctg ggaggcctgc ggtgggccca tcctctctgc aaagggcggc gaaacagagc accctggtgg tatgtcctgg accgttaaca atcacccacc aaccacagcg gtgctcatca ctggCCCCgg ggcctggcca gacggcgtgg cacattacca agctttctag tgtgtaCCCg gcatggagtc agcaagagca acgcacacca ccagagggtg tg-tggCggCg ggcaagtact cctggctcc gggaaattct tgcctagcgg ccctgccgtc gaccgagtcc agtgcctgcg gatgtcgtct ctcagtcact accccccagc gaccaggtcc ctggcccgga tcgctgcccc ggcggtagcc cgcggcgcag gctccaaaga gagcaggcga gggaaggatc aaaaggagcc cggtgatgct ccggcagccg gggctgggga agatcctccg ctgggccctc tccggtctca agatgagttc gcg'tggacca caacggggca gcggcacggg ggccacagcc acttcctgct gaacctgacc actggacacg ggagggcctg gtcacctgca gggccaggc acggcctgat cgtggcagac agggttctcg gagcccggag gtcaccccca cctggacaca catggtggct gcggaccttg gtggccagcc aggcctgaag tggctgacaa gatgatggtg ccatcatgaa cattgttgcc tcctcgtac tcgcctcatc atgccgggaa gtccctggac gccatggcaa tgccattcca cacgCtatga catctgcatc tgggcggaat gtgtgagcgc cagcgttcac cattgCccaC gaaacagctg tggggcccgt tgaagaccaa cccattcgtg actcagggcc tggggctctg acagtggcaC cgggccaagc aaatcgcgtc agtgtaaata accggtg cat caccaacagc tcgacaaggg gtggtgctac tggacggagc ctgggggCcg gcgtgtcctc ttctagccgt gtctgggtga gagaaggcgg aggacttcag agaagtgcag acaagtggaa aacgtaccgg aaggcttcaa cttctacacg cagacacggt ggacatttgc tgggctccga cctgcgggag agaccatcga gggcgtcttc ggattccaa aggctccgtc tggccctgaa gggagaccag cccaccgtct gcctctagct agagcctcga agccctggga ccgagctgcc tgccctccgc cctactcctg gcactatgcg aggtgcaggc ggtggagtgc agaagaaacc cgtacagggg gcgaaggctg gagacatgtg gccctggggc ctgtccagtc ctgctggcct gagtcccgcc cgcagctccc gcctggcaga agcagctccc gaggaagagt gaaagtggac gcctgtggag aagccaccgc cgatcggtta gcctatcacg aaacttttcc ctgctcacgg agcttctgta gagaacggtg tacaagaaca gagagaagct gagatcgggc ggtcaggacc tggtcatcct cctgaacaac ctacgatgca cgggaggtct atcccggccg aaacgggtct tggactccat cactgcgaca caccgctcct tgttctgaat ggagggggcg gagagggcgg gtcagtggcg gacaagtgcc agcccagcct cacatcttca gagtccctgc gggaccacct ccgattaatg taccgcttca ccctggacca cgcaaccagc 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 tggacagctc cgcggtcgcc ccccactact, agcgcgcctg caacacggag ccttgccctc gcagccgcag ctgcgatgca ggcgtgcgca ctgccgcgga ggagaaggcg ctggacgaca tggaggcctg ccacggcccc acttgccctc gcacccccag ctgcgggccg ggcctccgcc accgcgccac gctgcccccg gcgcactgct gctgcaactt gcgccgctgc cccccggccc ctgcacagtg cggcgtcggg cagcggcagc aggcgtcgca cgag-tgcacg gaggccctgc agtgcgacag cccaaccccc gggggcggcc cctactgccc cctggtgctc aaatttcag-t gctgcaaaac ctgccagggc cactaggggg gtctccgccg ccagtcctgc agcgggccgg ggagggaagg gtgagacgga gccggaagtt tggggggatg gagaggggct ggctatccac <210> 2 <211> 770 <212> PRT <213> unkniown <220> <221> VARIANT <222> (770) <223> Xaa Any Amino Acid gcagtgccca cagcaagctg cagactgggt tgtagggaac gccgctcggt cgtgtgccag gcgcatgccc gcagccgcgc cggagtgggc ggccctcgac accgcgtggt cctttgcaag cacccgccgc Caagccaccg gctgggtggc tggcgagtg gctcggtgcg ctgcaccagc ggccgcccac cacgcagcaa ctgaagagtg caaggatgtg tctgcagccg agcctacttc cgcgcggcac ccggagccac ccagaggggg ccccgggggg atttattggg aacccctgca ctgcccgggc ggccgc cccaaaaggc tggtcgctct cgccgcgtct ccacctgtac tggtc tgagt agcgcagacc gccaccatgc ggtgagtgct cacacgggcc tgtgaggcca aacaaggtcg cgccagatgt agctggcggg gcgggaactg gggccctggC 2880 2940 3000 3060 3120 3180 3240 3300 3360 3420 3480 3540 3600 3660 3720 3766 <400> 2 Ser Ser 1 Leu Thr Ser Leu Gly His Ala Val Cys G2y Arg Ser Ile Ala Gly Asn 130 Ala His 145 Arg Asp Giu Gin Gly Pro Gin Ile 210 Leu Ser 225 Gly Thr Arg Val Trp Gly Gly Val 290 Leu Gly Ser Thr Val Asn Glu Asp Asp Ser Gly Asn Leu Ile Thr ILeu Cys Ser 100 His Giu 115 Ser Cys le Thr Tyr Ile Pro Ala 180 Ser Leu 195 Ala Ser Lys Ser Leu Cys Cys Val 260 Pro Trp Gin Phe Thr Gly Val Ile Gly Met Thr 165 Pro Arg Val Asn Gin 245 Pro Thr Pro Thr Cys Lys Ile Pro 55 Arg Tyr 70 Leu Ala Asn Giu Gly His Ala Arg 135 Lys Thr 150 Ser Phe Gin Thr Cys Arg Xaa Ile 215 Arg Cys 230 Thr His Phe Gly Leu. Trp 40 Giu Asp Pro Asp Th~r 120 Gly Asn Leu Giy Xaa 200 Arg le Thr Ser le Leu Vai Thr Glu Ile Tbhr His 25 Gin Lys Ser Ile Asn Gly Val Ala Ile Cys Ile Tyr Val Gly Gly Met Ile Gly Leu. Ala 105 Phe Gly Met Asn Gin Asp Pro Ala 140 Pro Phe Val Trp 155 Asp Ser Giy Pro 170 Leu. Cvs Vai Pro 185 Aia Met Pro'Leu Giu Val Cys Ser 220 Thr Asn Ser Ile 235 Ile Asp Lys Gly 250 Arg Pro Giu Gly 265 Asp Cys Ser Arg Arg Leu Ile Leu His Ala Val Asn Asn His Lys Asn Cys Giu Thr Ala 110 His Asp 125 Lys Leu. Ser Ser Gly Ala Asp Ser 190 Ser 205 Giu Leu Pro Ala Trp Cys Val Asp 270 Thr Cys 285 Giy His Asp Lys Arg Pbe C-iy Met Cys Leu 175 Gly 'Trp Trp Ala Tjr 255 Gly Gly Pro Trp, Gly 280 Ser Ser Ser Ser Arg His Cys Asp Ser Pro Arg 295 300 Pro Thr Ile Gly Gly Lys Tyr Cys 305 Thr Asp Asp Cys Pro 325 Ser Giu Phe Asp Ser 340 Thr Tyr Ar; Gly Gly 355 Glu Gly Phe Asn Phe 370 Thr Pro Cys Ar; Pro 385 Lys His Val Gly Cys 405 Lys Cys Ar; Val Cys 420 Gly Val Phe Ser Pro 435 Trp Ile Pro Lys Gly 450 Ser Leu Ser His Leu 465 Glu Gly Leu Pro Gly 485 Thr Thi Phe Gin Leu 500 Ala Leu Gly Pro Ile 515 Thr Giu Leu Pro Ala 530 Asp Ser Leu Pro Pro 545 Ser Ala Gin Cys Ala 565 Asn Gin Leu Asp Sex 580 Ser Lys Leu Pro Lys 595 Pro Asp Tip Val Val 610 Ala Gly Val Ar; Sel 625 Ala Giu Giu Lys Ala 645 Pro Val Leu Giu Ale 660 Mla Leu Asp Trp Se2 675 His Ag Val Va) Lei 690 Pro M-a His Cys Set 705 Asn Leu Ar; Ar; Cy 72! Glu Cys Ser Ala Gli 740 Cys Thr Ser His Th 755 Ar; Pro 770 Leu Gly Giu Arg Arg Ar; 310 315 Pro Giy Ser Gin Asp Phe 330 lie Pro Phe Ar; Gly Lys 345 Gly Val Lys Ala Cys Ser 360 Tyr Thr Giu Arg Ala Ala 375 Asp Tbr Val Asp Ile Cys 390 395 Asp Ag Val LeU Gly Ser 410 Gly Giy Asp Giy Ser Ala 425 Ala Ser Pro Giy Ala Gly 440 Ser Val His Ile Phe Ile 455 a Leu Lys Giy Asp Gin 470 475 Thi Pro Gin Pro His Arg 490 Ar; Gin Gly Pro Asp Gin 505 Asn Ala Ser Leu Ile Val 520 Leu Arg Tyr Arg Phe Asn 535 Tyr Ser Trp His Tyr Ala 550 555 Gly Gly Ser Gin Vai Gin 570 Ser Ala Val Ala Pro His 585 Arg Gin Arg Ala Cys Asr 600 Giy Asn Tip Ser Leu Cys 615 Arg Ser Val Vai Cys Glr 630 635 Leu Asp Asp Ser Ala CyE 650 Cys His Gly Pro Thr CyE 665 Glu Cys Thr Pro Ser Cy 680 i Cys Lys Ser Ala Asp Hir 695 Pro Ala Ala Lys Pro Prc 710 71! s Pro Pro Ala Ar; Trp Va 5 730 1 Cys Giy Vai Giy Gin Ars 745 t Gly Gin Ala Ser His Gli 760 His Ar; Ser Cys Asn 320 Ar; Glu Val Phe Tyr Lys 350 Leu Thr Cys 365 Ala Val Val 380 Val Ser Gly Asp Leu Ar; Cys Glu Thr 430 Tyr Glu Asp 445 Gin Asp Leu 460 Giu Ser Leu Leu Pro Leu *Val Gin Ser 510 M Met Val Leu 525 Ala Pro Ile 540 Pro Trp Thr Ala Vai Glu Tyr Cys Ser 590 Thr Giu Pro 605 Ser Ar; Ser 620 i Ar; Ar; Vai Pro Gin Pro Pro Pro Glu 670 5 Gly Pro Gly 685 Arg Ala Thr 700 Ala Thr Met 5 1 Ala Gly Glu g Gin Ar; Ser 750 u Cys Thr Glu 765 335 335 rrp Leu Asp 31u Glu 415 Ile Va) Asn Leu Ala 495 Leu Ala Ala Lys Cys 575 Ala Cys Cys Ser Arg 655 Trp Leu Leu Arg Trp 735 Val Ala Cys Lys Ala Gly Cys 400 Asp Glu Val Leu Leu 480 Gly Glu Ar; Ar; Cys 560 Ar; His Pro Asp Ala 640 Pro SAla Arg Pro Cys 720 Gly Arg Leu <210> 3 <211> 3377 <212> DNA <213> Unknown <220> <223> unknown <400> 3 gaattcccac catggctccc gcctcatgtt cgaggtcacg agagctatga gatcgccttc cgccacctcc tccccggagg tctacaaagt ggcctcgccc tactggcagg gcacgtctcc cggcccggcc ccactgcctc tggccatcag cacctgtgga tgattgagcc cctgcacggt atgtggtgta caagcgttcc gagatgagaa accgtggaaa ccaggcccct ggggaatgaa gagagcgcta cgtggagacc gccgggatgt ggagcagtat actcgagtct gggaagcacc accagcccac tctggagatc ggcagaaatc catcgtgaac ctaaccatga cacagcagtg cctgcggcac actaggcctg gcgtcaatga ggacattggc cattcggcat gaaccatgac ccaagctcat ggctgcccac gccgtgacta catcaccagc cccccagaca ggactttg-tg agcaatgccg ctttcagcat gcgagctgtg gtgtctgagc agggcacgct gtgccagacg tcccctttgg gtcgcgccca gcgactgcag ccggacctgt ccaggccaac catcgggggc acacggatga ctgtccccct acagcatccc tttccgtggg aggcctgctc gctcacgtgc ccgtggtgga cgggacaccc gcaagcacgt gggctgcgac tgtgtggcgg tgacggcagt ctggggccgg gtacgaggat aggatetgaa cctctctctc tggaggggct gcccgggacc aactgcgaca ggggccagac ctctcatcgt catggtgctg cccccatcgc ccgtgactcg gctcggccca gtgtgcaggc acagctccgc ggtcgccccc gcgcctgcaa cacggagcct gccgcagctg cgatgcaggc ccgcggagga gaaggcgctg aggcctgcca cggccccact cccccagttg cgggccgggc gcgccacgct gcccccggcg gcaacttgcg ccgctgcccc cacagtgcgg cgtcgggcag Cgtcgcacga gtgcacggag gcgacagccc aacccccggg actgccccct ggtgctcaaa gcaaaacctg ccagggccac atcacactgg cggccgc gcctgccaga tcctccgctg ggccctcgcc ctggggctgg cacgccttcc ggtctcaaga tgagttcctg tccagtctgg cccacccgcg tggaccacaa cggggcactg ctggccttct cagcgccgcg gcacgggggc cacagccgag tcccgcctct agcacccact tcctgctgaa cctgacccgc agctcccgtc gtggagtact ggacacggga gggcctggcc tggcagagag tacgctggtc acctgcaggg ccaggccagc agctcccatg ggcctgcacg gcctgatcgt ggcagacgag gaagagtacc gggcccaagg gttctcggag cccggaggaa agtggaccac tctctgcg-tc acccccacct ggacacagcc tgtggagtga gggcggccat ggtggctgcg gaccttgaag ccaccgcctg acagagcgtg gccagccagg cctgaagcga tcggtcagcc ctggtggtgg ctgacaagat gatggtggcc tatcacgggc gtcctggcca tcatgaacat tg-ttgccaaa cttttccagg gttaacatcc tcgtaactcg cctcatcctg ctcacggagg acccaccatg ccgggaagtc cctggacagc ttctgtaagt cacagcggtc atggcaatgc cattccagag aacggtgtgg ctcatcacac gctatgacai ctgcatctac aagaacaaac gccccggtgg gcggaatgtg tgagcgcgag agaagctgca ctggccacag cgttcaccat tgcccacgag atcgggcaca ggcgtgggaa acagctgtgg ggcccgtggt caggacccag attaccatga agaccaaccc gttcgtgtgg tcatcctgca tttctagact cgggcctggg gctctgectg aacaaccgac tacccgacag tggcaccggg ccaagcctac gatgcagatg ggagtcaaat cgcgtcagtg taaatacggg gaggtctgca aagagcaacc ggtgcatcac caacagcatc ccggccgccg cacaccatcg acaaggggtg gtgctacaaa cgggtctgtg gagggtgtgg acggagcctg ggggccgtgg actccatggg ggcggcggcg tgtcctcttc tagccgtcac tgcgacagcc aagtactgtc tgggtgagag aaggcggcac cgctcctgca ggctcccagg acttcagaga agtgcagtgt tctgaatttg aaattctaca agtggaaaac gtaccgggga gggggcgtga ctagcggaag gcttcaactt ctacacggag agggcggcag tgccgtccag acacggtgga catttgcgtc agtggcgaat cgagtcctgg gctccgacct gcgggaggac aagtgccgag gcctgcgaga ccatcgaggg cgtcttcagc ccagcctcac gtcgtctgga ttcccaaagg ctccgtccac atcttcatcc agtcacttgg ccctgaaggg agaccaggag tccctgctgc ccccagcccc accgtctgcc tctagctggg accacctttc caggtccaga gcctcgaagc cctgggaccg attaatgcat gcccggaccg agctgcctgc cctccgctac cgcttcaatg ctacccccct actcctggca ctatgcgccc t.-gaccaa-.t ggtagccagg tgcaggcggt ggagtgccgc aaccagctgg cactactgca gtgcccacag caagctgccc aaaaggcagc tgccctccag actgggttgt agggaactgg tcgctctgca gtgcgcagcc gctcggtcgt gtgccagcgc cgcgtctctg gacgacagcg catgcccgca gccgcgccca cctgtactgg tgccctccgg agtgggcggc cctcgactgg tctgagtgca ctccgccacc gcgtggtcct ttgcaagagc gcagaccacc cactgctcac ccgccgccaa gccaccggcc accatgcgct ccggcccgct gggtggctgg cgagtggggt gagtgctctg cggcagcgct cggtgcgctg caccagccac acgggccagg gccctgcggc cgcccaccac gcagcagtgt gaggccaagt gacggccctg aagagtgcaa ggatgtgaac aaggtcgcct tttcagttct gcagccgagc ctacttccgc cagatgtgct tagggtcgag gcccatttaa gccgaattct gcagatatcc 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3060 3120 3180 3240 3300 3360 3377 <210> 4 to <211> 1104 <212> PRT <213> unknown <400> 4 SMet Ala Pro Ala Cys Gin Ile Leu Arg Trp Ala Leu Ala Leu Gly Leu 1 5 10 Gly Leu Met Phe Glu Val Thr His Ala Phe Arg Ser Gin Asp Glu Phe 25 SLeu Ser Ser Leu Glu Ser Tyr Glu Ile Ala Phe Pro Thr Arg Val Asp 40 00 His Asn Gly Ala Leu Leu Ala Phe Ser Pro Pro Pro Pro Arg Arg Gin 55 Arg Arg Gly Thr Gly Ala Thr Ala Glu Ser Arg Leu Phe Tyr Lys Val C 65 70 75 Ala Ser Pro Ser Thr His Phe Leu Leu Asn Leu Thr Arg Ser Ser Arg 85 90 O Leu Leu Ala Gly His Val Ser Val Glu Tyr Trp Thr Arg Glu Gly Leu 100 105 110 Ala Trp Gin Arg Ala Ala Arg Pro His Cys Leu Tyr Ala Gly His Leu 115 120 125 Gin Gly Gin Ala Ser Ser Ser His Val Ala Ile Ser Thr Cys Gly Gly 130 135 140 Leu His Gly Leu Ile Val Ala Asp Glu Glu Glu Tyr Leu Ile Glu Pro 145 150 155 160 Leu His Gly Gly Pro Lys Gly Ser Arg Ser Pro Glu Glu Ser Gly Pro 165 170 175 His Val Val Tyr Lys Arg Ser Ser Leu Arg His Pro His Leu Asp Thr 180 185 190 Ala Cys Gly Val Arg Asp Glu Lys Pro Trp Lys Gly Arg Pro Trp Trp 195 200 205 Leu Arg Thr Leu Lys Pro Pro Pro Ala Arg Pro Leu Gly Asn Glu Thr 210 215 220 Glu Arg Gly Gin Pro Gly Leu Lys Arg Ser Val Ser Arg Glu Arg Tyr 225 230 235 240 Val Glu Thr Leu Val Val Ala Asp Lys Met Met Val Ala Tyr His Gly 245 250 255 Arg Arg Asp Val Glu Gin Tyr Val Leu Ala Ile Met Asn Ile Val Ala 260 265 270 Lys Leu Phe Gin Asp Ser Ser Leu Gly Ser Thr Val Asn Ile Leu Val 275 280 285 Thr Arg Leu Ile Leu Leu Thr Glu Asp Gin Pro Thr Leu Glu Ile Thr 290 295 300 His His Ala Gly Lys Ser Leu Asp Ser Phe Cys Lys Trp Gin Lys Ser 305 310 315 320 Ile Val Asn His Ser Gly His Gly Asn Ala Ile Pro Glu Asn Gly Val 325 330 335 Ala Asn His Asp Thr Ala Val Leu Ile Thr Arg Tyr Asp Ile Cys Ile 340 345 350 Tyr Lys Asn Lys Pro Cys Gly Thr Leu Gly Leu Ala Pro Val Gly Gly 355 360 365 Met Cys Glu Arg Glu Arg Ser Cys Ser Val Asn Glu Asp Ile Gly Leu 370 375 380 Ala Thr Ala Phe Thr Ile Ala His Glu Ile Gly His Thr Phe Gly Met 385 390 395 400 Asn His Asp Gly Val Gly Asn Ser Cys Gly Ala Arg Gly Gin Asp Pro 405 410 415 Ala Lys Leu Met Ala Ala His Ile Thr Met Lys Thr Asn Pro Phe Val 420 425 430 Trp Ser Ser Cys Ser Arg Asp Tyr Ile Thr Ser Phe Leu Asp Ser Gly 435 440 445 Leu Gly Leu Cys Leu Asn Asn Arg Pro Pro Arg Gin Asp Phe Val Tyr 450 455 460 Pro Thr Val Ala Pro Gly Gin Ala- Tyr Asp Ala Asp Glu Gin Cys Arg 465 470 475 480 Phe Gin Hi Ser Glu Le Ile Pro Al 51 Gly Trp Cy 530 Gly Val Asl 545 Arg Thr Cys Pro Arg Prc His Arg Sei 595 Arg Glu Val 610 Phe Tyr Lys 625 Leu Thr Cys Ala Val Val Val Ser Gly 675 Asp Leu Arg 690 Cys Glu Thr 705 Tyr Glu Asp Gin Asp Leu Glu Ser Leu 755 Leu Pro Leu 770 Val Gin Ser 785 Met Val Leu Ala Pro Ile Pro Trp Thr 835 Ala Val Glu 850 Tyr Cys Ser 865 Thr Glu Pro Ser Arg Ser Arg Arg Val 915 Pro Gin Pro 930 Pro Pro Glu 945 Gly Pro Gly Arg Ala Thr Ala Thr Met 995 Ala Gly Glu s Gly Val Lys Ser Arg Gin Cys Ly 485 490 u Trp Cys Leu Ser Lys Ser Asn Ar 500 505 a Ala Glu Gly Thr Leu Cys Gin Th, 5 520 s Tyr Lys Arg Val Cys Val Pro Ph 535 Gly Ala Trp Gly Pro Trp Thr Pr 550 55 SGly Gly Gly Val Ser Ser Ser Se 565 570 Thr Ile Gly Gly Lys Tyr Cys Le 580 585 Cys Asn Thr Asp Asp Cys Pro Pr 600 Gin Cys Ser Glu Phe Asp Ser Il 615 Trp Lys Thr Tyr Arg Gly Gly Gl 630 631 Leu Ala Giu Gly Phe Asn Phe Ty3 645 650 *Asp Gly Thr Pro Cys Arg Pro Asj 660 665 Glu Cys Lys His Val Gly Cys Asj 680 Glu Asp Lys Cys Arg Val Cys Gl 695 Ile Glu Gly Val Phe Ser Pro Ala 710 715 SVal Val Trp Ile Pro Lys Gly Ser 725 730 Asn Leu Ser Leu Ser His Leu Ala 740 745 Leu Leu Glu Gly Leu Pro Gly Thr 760 Ala Gly Thr Thr Phe Gin Leu Arg 775 Leu Glu Ala Leu Gly Pro Ile Asn 790 795 Ala Arg Thr Glu Leu Pro Ala Leu 805 810 Ala Arg Asp Ser Leu Pro Pro Tyr 820 825 Lys Cys Ser Ala Gin Cys Ala Gly 840 Cys Arg Asn Gin Leu Asp Ser Ser 855 Ala His Ser Lys Leu Pro Lys Arg 870 875 Cys Pro Pro Asp Trp Val Val Gly 885 890 Cys Asp Ala Gly Val Arg Ser Arg 900 905 Ser Ala Ala Glu Glu Lys Ala Leu 920 Arg Pro Pro Val Leu Glu Ala Cys 935 Trp Ala Ala Leu Asp Trp Ser Glu 950 .955 Leu Arg His Arg Val Val Leu Cys 965 970 Leu Pro Pro Ala His Cys Ser Pro 980 985 Arg Cys Asn Leu Arg Arg Cys Pro 1000 Trp Gly Glu Cys Ser Ala Gin Cys s Tyr Gly Glu Val Cys 495 g Cys Ile Thr Asn Ser 510 r His Thr Ile Asp Lys 525 a Gly Ser Arg Pro Glu 540 o Trp Gly Asp Cys Ser 5 560 r Arg His Cys Asp Ser 575 a Gly Glu Arg Arg Arg 590 o Gly Ser Gin Asp Phe 605 e Pro Phe Arg Gly Lys 620 y Val Lys Ala Cys Ser 5 640 r Thr Glu Arg Ala Ala 655 SThr Val Asp Ile Cys 670 Arg Val Leu Gly Ser 685 SGly Asp Gly Ser Ala 700 Ser Pro Gly Ala Gly 720 Val His Ile Phe Ile 735 Leu Lys Gly Asp Gin 750 Pro Gin Pro His Arg 765 Gln Gly Pro Asp Gin 780 Ala Ser Leu Ile Val 800 Arg Tyr Arg Phe Asn 815 Ser Trp His Tyr Ala 830 Gly Ser Gin Val Gin 845 Ala Val Ala Pro His 860 Gin Arg Ala Cys Asn 880 Asn Trp Ser Leu Cys 895 Ser Val Val Cys Gin 910 Asp Asp Ser Ala Cys 925 His Gly Pro Thr Cys 940 Cys Thr Pro Ser Cys 960 Lys Ser Ala Asp His 975 Ala Ala Lys Pro Pro 990 Pro Ala Arg Trp Val 1005 Gly Val Gly Gin Arg Gin 1010 Agcs1015 1020 to lnArg Ser Val AgCsThr Ser His Thr Gly Gin Ala Ser His Glu ;Z1025 1030 1035 1040 Cys Thr Glu Ala Leu Arg Pro Pro Thr Thr Gin Gin Cys Glu Ala Lys 1045 1050 1055 Cys Asp Ser Pro Thr Pro Gly Asp Gly Pro Glu Glu Cys Lys Asp Val C11060 1065 1070 Asn Lys Val Ala Tyr Cys Pro Leu Val Leu Lys Phe Gin Phe Cys Ser 1075 1080 1085 Arg Ala Tyr Phe Arg Gin Met Cys Cys Lys Thr Cys Gln Gly His Xaa 1090 1095 1100 00