AU2007201796A1 - Thermophilic polymerase III holoenzyme - Google Patents

Description

P/00/01 I Regulation 32 k e, Cc,

\O

AUSTRALIA

Patents Act 1990 COMPLETE SPECIFICATION STANDARD PATENT

(ORIGINAL)

Name of Applicant(s): Actual Inventor(s): Address for Service: Invention Title: Replidyne, Inc., of 1450 Infinite Drive, Louisville, Colorado 80027, United States of America JANJIC, Nebojsa; KERY, Vladimir; BULLARD, John Randall; and McHENRY, Charles S.

DAVIES COLLISON CAVE, Patent Trademark Attorneys, of 1 Nicholson Street, Melbourne, 3000, Victoria, Australia Ph: 03 9254 2777 Fax: 03 9254 2770 Attorney Code: DM "Thermophilic polymerase III holoenzyme" The following statement is a full description of this invention, including the best method of performing it known to us:- WO 01/73052 PCT/r/US01/09950 THERMOPHILIC POLYMERASE m HOLOENZYME BACKGROUND OF THE INVENTION Field of the Invention The present invention relates to gene and amino acid seqquences encoding DNA polymerase III holoenzyme subunits and structural genees from thermophilic organisms. In particular, the present invention provides:s DNA polymerase Ill holoenzyme subunits and accessory proteins of T.

thennophilus. The present invention also provides antibodies andd other reagents useful to identify DNA Polymerase III molecules.

Background Art Bacterial cells contain three types of DNA polymerases t termed polymerase I, II and II. DNA polymerase III (pol III) is responsible I for the replication of the majority of the chromosome. Pol II is referred tito as a replicative polymerase; replicative polymerases are rapid and highly processive enzymes. Pol I and I are referred to as non-repllicative polymerases although both enzymes appear to have roles in replicationn. DNA polymerase I is the most abundant polymerase and is responsible fonr some types of DNA repair, including a repair-like reaction that permits the j joining of Okazaki fragments during DNA replication. Pol I is essential for thee repair of DNA damage induced by UV irradiation and radiomimetic drugs. PPol II is thought to play a role in repairing DNA damage which induces thhie SOS response and in mutants which lack both pol I and III, pol II repailirs UVinduced lesions. Pol I and II are monomeric polymerases while pol III comprises a multisubunit complex.

In E. coli, pol III comprises the catalytic core of the E. coli repplicase.

In E. coli, there are approximately 400 copies of DNA polymerase I pper cell, but only 10-20 copies of pol III (Kornberg and Baker, DNA Replicatition, 2d ed., W.H. Freeman Company, [1992], pp. 167; and Wu et al. J. Biol. Chem., 259:12117-12122 [1984]). The low abundance of pol m and its relatively feeble activity on gapped DNA templates typically used as a I general WO 01/73052 PCrT//U S 1/09950 i -2replication assays delayed its discovery until the availability of rrmutants

M

n defective in DNA polymerase I (Kornberg and Gefter, J. Biol. (Chem., 47:5369-5375 [1972]).

O The catalytic subunit of pol II is distinguished as a componennt of E.

5 coli major replicative complex, apparently not by its intrinsic catalytic aactivity, O but by its ability to interact with other replication proteins at the fork. These interactions confer upon the enzyme enormous processivity. Once thee DNA 0polymerase III holoenzyme associates with primed DNA, it dooes not dissociate for over 40 minutes-the time required for the synthesis of the entire 4 Mb E. coli chromosome (McHenry, Ann. Rev. Biochem., 57:5519-550 [1988]). Studies in coupled rolling circle models of the replicatioon fork suggest the enzyme can synthesize DNA 150 kb or longer without dissoociation in vitro (Mok and Marians, J. Biol. Chem., 262:16644-16654 [1987];; Wu et al., J. Biol. Chem., 267:4030-4044 [1992]). The essential interaction re:equired for this high processivity is an interaction between the ca catalytic subuunit and a dimer of p, a sliding clamp processivity factor that encircles thee DNA template like a bracelet, permitting it to rapidly slide along with the asscociated polymerase, but preventing it from falling off (LaDuca et al., J. Biol. Chem., 261:7550-7557 [1986]; Kong et al., Cell 69:425-437 [1992]). TFhe 3-a association apparently retains the polymerase on the template during trransient thermal fluctuations when it might otherwise dissociate.

The P2 bracelet cannot spontaneously associate with high moolecular weight DNA, it requires a multiprotein DnaX-complex to open and c close it around DNA using the energy of ATP hydrolysis (Wickner, Proc. Natli. Acad.

Sci. USA 73:35411-3515 [1976]; Naktinis et al., J. Biol. Chem., 270:):13358- 13365 [1985]; and Dallmann et al., J. Biol. Chem., 270:29555-29562 [1[1995]).

In E. coli, the dnaX gene encodes two proteins, r and y. y is generateted by a programmed ribosomal frameshifting mechanism five-sevenths of thhe way through dnaX mRNA, placing the ribosome in a -1 reading frame wwvhere it immediately encounters a stop codon (Flower and McHenry Proc. Natl. Acad.

Sci. USA 87:3713-3717 [1990]; Blinkowa and Walker, Nucl. Acidds Res., WO 01/73052 PC ,/Umso 1/09950 -3- 18:1725-1729 [1990]; and Tsuchihashi and Kornberg, Proc. Natl. Acaad. Sci.

USA 87:2516-2520 11990]). In E. coli, the DnaX-complex hfias the stoichiometry Y21281 6 '1 X11i (Dallmann and McHenry, J. Biol. (Chem., 270:29563-29569 [1995]). The r protein contains an additional canrboxylterminal domain that interacts tightly with the polymerase, holdinng two polymerases.together in one complex that.can coordinately replicxate the leading.and lagging strand of.the replication fork simultaneously (McHdenry,.J.

Biol. Chem., 257:2657-2663 [1982]; Studwell and O'Donnell, Biol. (Chem., 266:19833-19841 [1991]; McHenry, Ann. Rev. Biochem. 57:5519-550 [1988]).

Conservation- of a framneshifting mechanism to generate -related ATPases is significant in that, by analogy to E. coli, can. both asseemble .a processivity factor onto primed DNA. In E. coli, ribosomes frameshiftft at the sequence.. A AAA AAG into a -1 frame where the lysine UIU antiticodon tRNA can base pair with 6As before, elongating (Flower and McHenryy, Proc.

Natl. Acad. Sci. TJSA 87:3713-3717 [1990]; Blinkowa and Walker,r, Nuci.

Acids Res., 18:1725-1729 [1990); and Tsuchihashi and Kornberg, Prooc. Natl.

Acad. Sci. USA 87:2516-2520 [1990]).

Pol I[s are apparently conserved throughout mesophilic eubacteteria. In addition to E. coli and related proteobacteria, the enzyme has been rpurified from the firmicute Bacillus subtilis (Low et al., J. Biol. Chem., 251:13111-1325 [1976]; Hammond and Brown [1992]). With the proliferation of bbacterial genomes sequenced, by inference from DNA sequence, pol III excxists in organisms as widely divergent as Caulobacter, Mycobacteria, Mycoplaasma, B.

subtilis and Synechocystis. The existence of dnaX and dnaN (structuriral gene for p) is also apparent in these organisms. These general repolication mechanisms are conserved even more broadly in biology. AAlthough eukaryotes do not contain polymerases homologous to pol El, eukkaryotes contain special polymerases devoted to chromosomal replication and I P -like processivitY factors (PCNA) and DnaX-like ATPases (RFC, Activatonr I) that assemble these processivity factors on DNA (Yoder and Burgers, J. Biol.

WO 01/73052 PCT/F/US01/09950 -4- Chem., 266:22689-22697 [1991]; Brush and Stillman, Meth. Enzizymol., 262:522-548 [1995]; Uhlmann et al., Proc. Natl. Acad. Sci. USA 933:6521- 6526 [1996]).

Helicases serve a variety of functions in DNA metabolism. Celldular (E.

coli dnaB, priA, and rep proteins), phage (T4 gene 41 and dda proteiins; T7 gene 4 protein), and viral (SV40 T antigen; HSV-1 UL5/UL52 compldex and UL9 protein) helicases are involved in the initiation of replicatidon, by unwinding DNA so that other proteins of the replication compldex can.

assemble on the ssDNA. These proteins also participate in the elonngation phase of replication, by unwinding the duplex DNA ahead of this compplex to provide the required template. Other helicases the E. coli recBCCD:and.

recQ. proteins). are implicated in recombination by genetic criteria. AAnother.

class of helicases ificludes the E. coli uvrAB and uvrD. These helicaseas act in.

nucleotide excision repair or methyl-directed mismatch repair during booth pre- 15 incision (recognition of DNA damage or alteration) and. post-incision (displacement. of .damaged fragment) steps. See, for example, USPN 5,747,247.

DNA mispairing can occur in vivo and is recognized and correected by repair proteins. Mismatch repair has been studied most intensively in 1 E. coli, Salmonella typhimurium, and S. pneumoniae. The MutS, MutH andd MutL proteins of E. coli are involved in the repair of DNA mismatches, aas is the product of the uvrD gene in E. coli, helicase II. See, for example,:, USPN 5,750,335.

The best defined mismatch repair pathway is the E.coli IVMutHLS pathway that promotes a long-patch (approximately 3 Kb) excisionn repair reaction which is dependent on the mutH, mutL, mutS and mutU (uvrb-D) gene products. The MutHLS pathway appears to be the most active mismatclch repair pathway in E.coli and is known to both increase the fidelity oof DNA replication and to act on recombination intermediates containing mnispaired bases. The system has been reconstituted in vitro, and requires thee mutH, mutL, mutS and uvrD (helicase II) proteins along with DNA polymeerase 1n WO 01/73052 Pcrrius O (1(19950 holoenzyme, DNA ligase, single-stranded DNA binding protein (SSEB) and one of the single-stranded DNA exonucleases, Exo I, Exo VII or RRecJ. A similar pathway in yeast includes the yeast MSH2 gene and two mutltL-like genes referred to as PMS1 and MLH1. See, for example, USPN 6,191,2C68.

The E. coli bacterial Uvr proteins are capable of excising daamaged DNA sites caused by a broad spectrum of chemical agents that distctort the backbone geometry of the DNA double helix. As a result, if the DNfA were damaged by chemicals in the environmental sample, the Uvr proteirins will cleave and excise the damaged region. Subsequent resynthesis byy DNA polymerase I will incorporate labeled or unlabeled nucleotides into thee DNA.

See, for example, USPN 6,060,288.

Replication of the lagging strand of DNA is mediated by a multitiprotein complex composed of proteins priA, dnaT, dnaB, dnaC, and dnaGG. This complex is referred to as a primosome. Purified priA has ATPase, heielicase, translocase, and primosome assembly activities. This gene may be esserntial in recombination and DNA repair since it binds to D-loops, interacts witlth recG and has helicase activity. The DNA helicase activity of priA i3inhibits recombination. See, for example, USPN 6,146,846.

BRIEF SUMMARY OF THE INVENTION The invention is directed to an isolated polypeptide wherei:in said polypeptide comprises an amino acid sequence having at least 95% seequence identity to the amino acid sequence of SEQ ID NO: (uvrD helicase) 68. The invention is directed to an isolated polypeptide wherei.in said polypeptide comprises an amino acid sequence having at least 95% seequence identity to the amino acid sequence of SEQ ID NO: (DNA-G Primase) 772.

The invention is directed to an isolated polypeptide whereibin said polypeptide comprises an amino acid sequence having at least 95% seequence identity to the amino acid sequence of SEQ ID NO: (priA helicase) 76.

WO 01/73052 PCT/T/U S01/09950 -6- The invention is directed to an isolated polypeptide wherei:in said polypeptide comprises an amino acid sequence having at least 95% seequence identity to the amino acid sequence of SEQ ID NO: (delta subunit) The invention is directed to an isolated polypeptide whereihin said polypeptide comprises an amino acid sequence having at least 95% seequence identity to the amino acid sequence of SEQ ID NO: (delta prime subunitit) 17.

The invention is directed to an isolated polypeptide wherei-in said polypeptide comprises an amino acid sequence having at least 95% seequence identity to the amino acid sequence of SEQ ID NO: (beta subunit) 23.

The invention is directed to an isolated polypeptide wherei-in said polypeptide comprises an amino acid sequence having at least 95% seequence identity to the amino acid sequence of SEQ ID NO: (ssb protein) 32.

The invention is directed to an isolated polypeptide wherei-in said polypeptide comprises an amino acid sequence having at least 95% seequence identity to the amino acid sequence of SEQ ID NO: (epsilon-1, dnaQ-1) 37.

The invention is directed to an isolated polypeptide wherei-in said polypeptide comprises an amino acid sequence having at least 95% seequence identity to the amino acid sequence of SEQ ID NO: (epsilon-2, dnaQ-2)) 82.

The invention is directed to a method of producing a polyppeptide encoded by a nucleotide sequence, wherein said polypeptide compririses an amino acid sequence having at least 95% sequence identity to the amirino acid sequence of one of SEQ ID NOS: 68, 72, 76, 10, 17, 23, 32, 37, aand 82, comprising culturing a host cell comprising said nucleotide sequencee under conditions such that said polypeptide is expressed, and recoverinpg said polypeptide.

The invention is directed to a method of synthesizing DNA which comprises utilizing one or more polypeptides, said one or more polypoeptides comprising an amino acid sequence having at least 95% sequence iderntity to an amino acid sequence selected from the group consisting of SEQ IDD NOS: 68, 72, 76, 10, 17, 23, 32, 37 and 82.

WO 01/73052 PCT/T/U SO 1/09950 -7- Further objects and advantages of the present invention will boe clear from the descri ption that follows.

BRIEF DESCRIPTION OF THE FIGURES In all of the following Figures that show alignments (DNA or amino acids), the indicates similar, but not identical residues. In the DNA sequences with underlined regions, unless otherwise indicated, the undeerlining indicates bases generated by the degenerate primers used to generate thae DNA of interest. Also unless otherwise indicated, the sequences betweeen the sequences generated by the primers were used in the searches to gqenerate deduced amino acid sequences the primer-generated sequencess were excluded from the searches).

FIG. 1. Protein concentration profile of Ni'-NTA column purifification of N-terminal tagged T. thennophilus a.

FIG. 2. SDS-PAGE analysis of expression optimization of i pTAC-

CCA-TE.

FIG. 3. Protein concentration profile of ammonium :sulfate precipitation optimization of native T. thermophilus a.

FIG. 4 SDS-PAGE analysis of ammonium sulfate precippitation optimization of T. thermophilus a.

FIG. 5. Activity assay analysis of ammonium sulfate precippitation optimization of T. thermophilus a using the gap-filling assay.

FIG. 6. SDS-polyacrylamide summary gel of the different purifification steps of native T. thernnophilus expressed as a translationally coupled prcrotein.

FIG. 7. Biotin blot analysis of the growth optimization for exppression of N-terminal tagged T. thernnophilus DnaX subunits from pAAl-NB- TX/AP1.L1.

FIG. 8. Protein concentration profile of the fractions from thee Ni++- NTA column purification of N-terminal tagged T. thennophilus DnaX.

WO 11/73052 PC'T/f/lJS01/)9950 -8- FIGs. 9A and B. SDS-PAGE analysis of the fraction from thee Ni"- NTA column purification of N-terminal tagged T. thennophilus DnaX.

FIGs. 10A and B. SDS-PAGE analysis of the fraction from the avidin column purification of N-terminal tagged T. thennophilus DnaX.

FIG. 11. Western analysis of various antiserum dilutionns for determination of dilutions to use in T. thennophilus DnaX detection.

FIG. 12. Western analysis of various T. thermophilus DnaX dililutions for determination of the limit of DnaX detection at antiserum dilutition of 1:6400.

FIG. 13 The DNA sequence (SEQ ID NO:9) of the T. thennoophilus holA gene (6 subunit).

FIG. 14. The amino acid sequence (SEQ ID NO: 10) of T.

thennophilus 8-subunit (holA gene).

FIG. 15. Alignment of the amino acid sequence of 8 frirom T.

thennophilus and E. coli.

FIG. 16 Alignment of the amino acid sequence of 8-subunit fifrom A.

aerolicus, T. thennophilus, B. subtilis, E. coli and H. influenzae.

FIG. 17 Biotin blot analysis of growth/induction time optimizatation of expression of T. thermophilus 6 by pAl-NB-TD/AP1.L1.

FIG. 18. Optimization of precipitation of T. thennophilus s 6 by ammonium sulfate. FIGs. 19A and B. SDS-PAGE analysis of fractions from the Ni -NTA column purification of T. thennophilus 6.

FIG. 20. Protein concentration profile of fractions from the avidin column purification of T. thennophilus 6.

FIG. 21 SDS-PAGE analysis of fractions from the avidin ccolumn purification of T. thermophilus 6.

FIG. 22. The DNA sequence (SEQ ID NO: 16 of the T. thennaophilus holB gene encoding the 6'-subunit of the T. thennophilus Pol I holoenazyme.

WO 01/73052 PCT//I/ SO 1/09950 S-9- FIG. 23. The amino acid sequence (SEQ ID NO:17) of the T.

thlenwnophilus 6'-subunit derived from the DNA sequence of t the T.

thennophilus holB gene.

O FIG. 24. Alignment of the amino acid sequence comparing E. ccoli and 5 T. thermophilus 8'.

SFIG. 25. Alignment of the amino acid sequence of 8'-subunit fifrom A.

aerolicus, T. thermophilus, B. subtilis, E. coli and H. influenzaae and Rickettsia.

FIG. 26. Biotin blot analysis of growth/induction time optimiza.ation of expression of T. thermophilus 6' by pAl-NB-TD'/AP1.L1.

FIGs. 27A and B. SDS-PAGE Analysis Ni+-NTA ccolumn purification of N-terminal tagged T. thermophilus 6'.

FIG. 28. Protein concentration profile of fractions eluting frcrom the Sephacryl S-300 gel filtration column purification of T. thermophilus FIG. 29. SDS-PAGE analysis of fractions from the Sephycryll S-300 column purification of T. thermophilus 8'.

FIG. 30. SDS-PAGE summary of the purification of T. thenmaophilus 8' as a translationally coupled protein.

FIG. 31. Biotin blot analysis of growth/induction time optimizaation at different temperatures of expression of T. thennophilus 3 by pAA1-NB- TN/AP1.L1.

FIG. 32. Protein concentration profile of fractions eluting frcrom the Ni'+-NTA column purification of T. thermophilus P.

FIG. 33. Primer extension assay to determine stimulation n of T.

thermophilus a by T. thermophilus p.

FIG. 34. Protein concentration profile of fractions eluting f from a Sephacryl S-300 gel filtration column purification of T. thennophilus FIGs. 35A and B. SDS-PAGE analysis of fractions eluting 1 from a Sephacryl S-300 gel filtration column purification of T. thermophilus P. WO 01/73052 PCT/TIUSOII0990S FIG. 36. The pooled fractions of T. thennophilus from the Sepphacryl S-300 gel filtration column that was used in production of antibodies dilirected against p.

FIG. 37. Western analysis of various antiserum dilutionns for determination of dilutions to use in T. thermophilus 3 detection.

FIG. 38. Western analysis of various T. thermophilus P diluticons for determination of the limit of p detection at antiserum dilution of 1:6400. FIG. 39. M13gori reconstitution of T. thennophilus Pol III subunnits.

FIG. 40. Temperature dependence for a functional T. thernoophilus holoenzyme in the reconstitution assay.

FIG. 41. The reconstitution assay in which T. therinophilus B.

T/y C. P, D. and E. 8' is/are titrated while the other subunits anre held constant.

FIG. 42. Reconstitution assay in the absence of all subunits exxcept a to determine the background activity present due to spurious bindinpg of a alone to the template and extending the primer a short distance at each bbinding event.

FIG. 43. Reconstitution assay in the absence of P, but in the preresence of the other subunits, to determine the effect of the other subunnits on background activity present due to spurious binding of a.

FIGs. 44A-E. Sephacryl S-200 gel filtration of subunits of the clamp loading complex showing protein-protein interactions.

FIGs. 45A-C. Sephacryl S-200 gel filtration of T. thermophilus c a with the subunits of the clamp loading complex showing protein-I-protein interactions.

FIG. 46. Sephacryl S-200 gel filtration of T. thennophilus P.

FIG. 47. The DNA sequence (SEQ ID NO: 31) of the gene enocoding T. thennophilus SSB.

FIG. 48. The amino acid sequence of (SEQ ID NO:32) the T.

thennophilus SSB protein.

O

\O

WO 01/73052 PCT/f/USO 1/09950) -11- FIG. 49. Sequence alignment of T. thennophilus SSB compareed with SSB amino acid sequences from Aquifex, B. subtilus, E. coli and H. influaenzae.

FIG. 50. Sequence alignment of the N-terminal region of T.

thennophilus SSB with the C-terminal region of T. thernophilus SSB.

FIG. 51. Biotin blot analysis of relevant fractions from the Nif'-NTA column purification of T. thermophilus SSB.

FIG. 52. The DNA sequence of the gene encoding T. thennopphilus epsilon-1 dnaQ-1)(SEQ ID NO:36).

FIG. 53. The amino acid sequence (SEQ ID NO:37) of a T thennophilus epsilon-1 subunit FIG. 54. The DNA sequence (SEQ ID NO:67) of the gene encodding T.

thermnophilus uvrD.

FIG. 55. The amino acid sequence thennophilus uvrD protein.

FIG. 56. The DNA sequence (SEQ ID dnaG gene.

FIG. 57. The amino acid sequence thermophilus dnaG protein.

FIG. 58. The DNA sequence (SEQ ID priA gene.

FIG. 59. The amino acid sequence thenmophilus priA protein.

FIG. 60. The DNA sequence (SEQ ID dnaQ-2 gene (E2 subunit).

FIG. 61. The amino acid sequence thennophilus e2 subunit.

(SEQ ID NO:68) of' a T NO:71) of a T. thennopphilus (SEQ ID NO:72) of' a T.

NO:75) of a T. thennopphilus (SEQ ID NO:76) of' a T.

NO: 81) of a T. thennopphilus (SEQ ID NO: 82) off a T.

FIG. 62. The DNA sequence (SEQ ID NO: 22) of a T.

dnaN gene (0 subunit).

FIG. 63. The amino acid sequence (SEQ ID NO: thennophilus subunit.

thennopphilus 23) of a T.

WO 01/73052 PCT/rIUS0i0/995 1 -12- DETAILED DESCRIPTION OF THE INVENTION A. Definitions 5 In order to provide a clear and consistent understanding of the 0 specification and claims, including the scope to be given such terrrms, the following definitions are provided. It is also to be noted that the term i or 0 "an" entity, refers to one or more of that entity, for exampple, "a polynucleotide," is understood to represent one or more polynucleotides.s.

As used herein, the term "DNA polymerase III holoenzyme" re:efers to the entire DNA polymerase III entity all of the polymerase subunnits, as well as the other associated accessory proteins, such as ssb, dnaG, uvr/rD and priA, required for processive replication of a chromosome or genome),), while "DNA polymerase In" is just the core E, "DNA polymeraase III holoenzyme subunit" is used in reference to any of the subunit entiticies that comprise the DNA polymerase III holoenzyme. Thus, the term "DNA polymerase IlI" encompasses "DNA polymerase Ill holoenzyme subunitits" and "DNA polymerase HI subunits." The term exonuclease activity" refers to the presence of an aactivity in a protein which is capable of removing nucleotides from the 5' endd of an oligonucleotide. 5' exonuclease activity may be measured using any of the assays provided herein.

The term."3' exonuclease activity" refers to the presence of an aactivity in a protein which is capable of removing nucleotides from the 3' endd of an oligonucleotide. 3' exonuclease activity may be measured using any of the assays provided herein.

The terms "DNA polymerase activity," "synthetic activityy" and "polymerase activity" are used interchangeably and refer to the abilityy of an enzyme to synthesize new DNA strands by the incorporatidon of deoxynucleoside triphosphates. The examples below provide assays 1 for the measurement of DNA polymerase activity. A protein which can dirtrect the WO 011/73052 PCT/I/USO 1/09950 -13synthesis of new DNA strands (DNA synthesis) by the incorporatition of deoxynucleoside triphosphates in a template-dependent manner is saidd to be "capable of DNA synthetic activity." A DNA synthesis terminating agent which terminates DNA syiynthesis at a specific nucleotide base refers to compounds, including but not limilited to, dideoxynucleosides having a 3' dideoxy structure ddATP, dddCTP, ddGTP and ddTIP). Any compound capable of specifically terminaating a DNA sequencing reaction at a specific base may be employed as aa DNA synthesis terminating agent.

The term "gene" refers to a nucleic acid DNA) sequencce that comprises coding sequences necessary for the production of a polypepptide or precursor DNA polymerase III holoenzyme, holoenzyme subuunit, or accessory protein as appropriate). The polypeptide can be encoded byy a full length coding sequence or by any portion of the coding sequence so l, long as the desired activity or functional properties enzymatic activity,, ligand binding, signal transduction, etc.) of the full-length polypeptide or fra-agment are retained. The term also encompasses the coding region of a structuraal gene and includes sequences located adjacent to the coding region on bothh the and 3' ends for a distance of about 1 kb on either end such that thhe gene corresponds to the length of the full-length mRNA.

The term "gene" encompasses both cDNA and genomic formns of a gene. A genomic form or clone of a gene contains the coding; region interrupted with non-coding sequences termed "intervening regioons" or "intervening sequences." The mRNA functions during translation to specify the sequence or order of amino acids in a nascent polypeptide.

In particular, the terms "DNA polymerase I1 holoenzymee" and "holoenzyme subunit gene" refer to the full-length DNA polymenrase III holoenzyme, and holoenzyme subunit nucleotide sequence(s), respeectively.

However, it is also intended that the term encompass fragments of thee DNA polymerase m holoenzyme and holoenzyme subunit sequences, such aas those that encode particular domains of interest, including subunit proteins, i as well WO 01/73052 PCIU/IJUS01/09950 -14as other domains within the full-length DNA polymerase III holoenzyyme or holoenzyme subunit nucleotide sequence. Furthermore, the terms "DNA polymerase II holoenzyme," "holoenzyme subunit nucleotide seqquence," "DNA polymerase II holoenzyme," and "holoenzyme subunit polynuclcleotide sequence" encompasses DNA, cDNA, and RNA mRNA) sequence:es.

As used herein, the term "accessory protein(s)" refers to a probtein or polypeptide required for, or involved in, processive replication 1 of a chromosome or genome. The term further encompasses the full length polypeptide or protein. Where fragments of accessory proteins are intitended, the fragment of the polypeptide or protein will be clearly indicated.

"Where "amino acid sequence" is recited herein to refer to an i amino acid sequence of a naturally occurring protein molecule, "aminoo acid sequence" and like terms, such as "polypeptide" or "protein" are not maeant to limit the amino acid sequence to the complete, native amino acid seequence associated with the recited proteins. Further, "polypeptide" and "proteiin" are used interchangeably unless clearly indicated otherwise. Where a distitinction between "polypeptide" and "protein" is intended, such will be made cleaar.

Genomic forms of a gene may also include sequences located oon both the 5' and 3' end of the sequences which are present on the RNA trannscript.

These sequences are referred to as "flanking" sequences or regions (these flanking sequences are located 5' or 3' to the translated sequences pres:sent on the mRNA transcript). The 5' flanking region may contain reggulatory sequences such as promoters and enhancers which control or influennce the transcription of the gene. The 3' flanking region may contain sequences s which direct the termination of transcription, post-transcriptional cleavagge and polyadenylation.

The term "wild-type" refers to a gene or gene product which hhas the characteristics of that gene or gene product when isolated from a naaturally occurring source. A wild-type gene is that which is most frequently obbserved in a population and is thus arbitrarily designated the "normal" or "wildd-type" form of the gene. In contrast, the term "modified" or "mutant" refers to a gene WO 01/73052 PCT/f/U SO 1/09950 or gene product which displays modifications in sequence and or funoctional properties altered characteristics) when compared to the wild-typoe gene or gene product. It is noted that naturally-occurring mutants can be iscsolated; these are identified by the fact that they have altered characteristics s when compared to the wild-type gene or gene product.

The terms "nucleotide sequence encoding," "nucleic acid maolecule encoding," "DNA sequence encoding," and "DNA encoding" refer to thee order or sequence of deoxyribonucleotides along a strand of deoxyribonucleiic acid.

The order of these deoxyribonucleotides determines the order of aminao acids along the polypeptide (protein) chain. The DNA sequence thus codes i for the amino acid sequence.

The term "oligonucleotide" is defined as a molecule comprised i of two or more deoxyribonucleotides or ribonucleotides, preferably more thann three, and usually more than ten. The exact size will depend on many factors,:, which in turn depends on the ultimate function or use of the oligonucleotidee. The oligonucleotide may be generated in any manner, including chhemical synthesis, DNA replication, reverse transcription, PCR, or a combbination thereof.

Because mononucleotides are reacted to make oligonucleotideles in a manner such that the 5' phosphate of one mononucleotide pentose I ring is attached to the 3' oxygen of its neighbor in one direction via a phosphoodiester linkage, an end of an oligonucleotide is referred to as the end" ifif its phosphate is not linked to the 3' oxygen of a mononucleotide pentose riring and as the end" if its 3' oxygen is not linked to a 5' phosphate of a substsequent mononucleotide pentose ring. As used herein, a nucleic acid sequence, even if internal to a larger oligonucleotide, also may be said to have 5' and 3' encids.

When two different, non-overlapping oligonucleotides annneal to different regions of the same linear complementary nucleic acid sequenace, and the 3' end of one oligonucleotide points towards the 5' end of the othher, the former may be called the "upstream" oligonucleotide and the latttter the "downstream" oligonucleotide. In either a linear or circular DNA moolecule, WO 01/73052 PCT/lUS 1/09950 -16discrete elements are referred to as being "upstream" or 5' cof the "downstream" or 3' elements. This terminology reflects the faact that transcription proceeds in a 5' to 3' fashion along the DNA strand.l. The promoter and enhancer elements which direct transcription of a linkeed gene are generally located 5' or upstream of the coding region. However, enhhancer elements can exert their effect even when located 3' of the promoter eblement and the coding region. Transcription termination and polyadenylation s signals are located 3' or downstream of the coding region.

The term "coding region" when used in reference to a structura-al gene refers to the nucleotide sequences which encode the amino acids foundd in the nascent polypeptide as a result of translation of a mRNA molecule.s. The coding region is bounded on the 5' side by the nucleotide triplet "ATG" which encodes the initiator methionine and on the 3' side by one of the three t triplets which specify stop codons TAA, TAG, TGA). Occasionally, the AATG is replaced by GTG.

The term "polynucleotide molecule comprising a nucleotide secquence encoding a gene," means a nucleic acid sequence comprising the coding region of a gene or in other words the nucleic acid sequence which encodes a gene product. The coding region may be present in either a cDNA, genomidc DNA or RNA form. When present in a DNA form, the polynucleotide mnay be single-stranded the sense strand) or double-stranded. Suitable c control elements such as enhancers/promoters, splice junctions, polyadenpylation signals, etc. may be placed in close proximity to the coding region of thhe gene if needed to permit proper initiation of transcription and/or correct proocessing of the primary RNA transcript. Alternatively, the coding region utilizedd in the expression vectors of the present invention may contain endopgenous enhancers/promoters, splice junctions, intervening sequences, polyadennylation signals, etc., or a combination of both endogenous and exogenous c control elements.

The term "regulatory element" refers to a genetic element: which controls some aspect of the expression of nucleic acid sequences.s. For WO 01/73052 I'CT/I/soJS1/09950 -17example, a promoter is a regulatory element which facilitates the initiatation of transcription of an operably linked coding region. Other regulatory eldements are splicing signals, polyadenylation signals, termination signals, etc. (cdefined infra).

Transcriptional control signals in eukaryotes comprise "promoteter" and "enhancer" elements. Promoters and enhancers consist of short arrays obf DNA sequences that interact specifically with cellular proteins involvIved in transcription (Maniatis et al., Science 236:1237 [1987]). Promoteter and enhancer elements have been isolated from a variety of eukaryotic s sources including genes in yeast, insect and mammalian cells and viruses (anaalogous control elements, promoters, are also found in prokaryotes). The seelection of a particular promoter and enhancer depends on what cell type is to bbe used to express the protein of interest. Some eukaryotic promoters and enhhancers have a broad host range while others are functional in a limited subset t of cell types (for review see, Voss et al., Trends Biochem. Sci., 11:287 [19866]; and Maniatis et al., supra). For example, the SV40 early gene enhancer i is very active in a wide variety of cell types from many mammalian species aand has been widely used for the expression of proteins in mammalian cells (DDijkema et al., EMBO J. 4:761 [1985]). Two other examples of promoter/ennhancer elements active in a broad range of mammalian cell types are those fr(rom the human elongation factor la gene (Uetsuki et al., J. Biol. Chem., 2664:5791 [1989]; Kim et al., Gene 91:217 [1990]; and Mizushima and Nagataa, Nucl.

Acids. Res., 18:5322 [1990]) and the long terminal repeats of thee Rous sarcoma virus (Gorman et al., Proc. Natl. Acad. Sci. USA 79:6777 [19832]) and the human cytomegalovirus (Boshart et al., Cell 41:521 [1985]).

The term "promoter/enhancer" denotes a segment of DNA, which contains sequences capable of providing both promoter and ennhancer functions the functions provided by a promoter element and an ennhancer element, see above for a discussion of these functions). For example, tithe long terminal repeats of retroviruses contain both promoter and enhancer funnctions.

The enhancer/promoter may be "endogenous" or "exogenouus" or WO 01/73052 PCT/r/USO11/09950 -18- "heterologous." An "endogenous" enhancer/promoter is one whhich is naturally linked with a given gene in the genome. An "exogenoous" or "heterologous" enhancer/promoter is one which is placed in juxtapositiion to a gene by means of genetic manipulation molecular biological technniques) such that transcription of that gene is directed by the linked enhancer/promoter. Many promoter/enhancer sequences can be ussed to express the proteins of the invention.

Efficient expression of recombinant DNA sequences in eukkaryotic cells requires expression of signals directing the efficient temninatidon and polyadenylation of the resulting transcript. Transcription termination signals are generally found downstream of the polyadenylation signal and aree a few hundred nucleotides in length. The term "poly A site" or "poly A seqquence" denotes a DNA sequence which directs both the terminatioon and polyadenylation of the nascent RNA transcript. Efficient polyadenylalation of the recombinant transcript is desirable as transcripts lacking a poly A t tail are unstable and are rapidly degraded. The poly A signal utilized in an exppression vector may be "heterologous" or "endogenous." An endogenous poly Ak signal is one that is found naturally at the 3' end of the coding region of a giveen gene in the genome. A heterologous poly A signal is one which is isolateed from one gene and placed 3' of another gene. A commonly used heterologouus poly A signal is the SV40 poly A signal. The SV40 poly A signal is containced on a 237 bp BamHIJBclI restriction fragment and directs both terminatiion and polyadenylation (Sambrook, supra, at 16.6-16.7).

As used herein, the term "vector" is used in reference to nucleeic acid molecules that transfer DNA segment(s) from one cell to another. Thhe term "vehicle" is sometimes used interchangeably with "vector." "Vector" is also used interchangeably with "plasmid." Where a difference is intendded, the difference will be made clear.

The term "expression vector" refers to a recombinant DNA moolecule containing a desired coding sequence and appropriate nucleic acid seqquences necessary for the expression of the operably linked coding sequencee" in a WO 01/73052 PCTIT/US( 1/09950 -19particular host organism. Nucleic acid sequences necessary for expresssion in prokaryotes usually include a promoter, an operator (optional), and a ribbosome binding site, often along with other sequences. Eukaryotic cells are knoown to utilize promoters, enhancers, and termination and polyadenylation signahls.

The term "transformation" as used herein refers to the introducttion of foreign DNA into eukaryotic cells. Transformation may be accomplisheed by a variety of means known to the art including calcium phosphate-DNNA coprecipitation, DEAE-dextran-mediated transfection, polybrene-meediated transfection, transfection, electroporation, microinjection, liposome I fusion, lipofection, protoplast fusion, retroviral infection, and biolistics.

The term "selectable marker" refers to the use of a gene which erncodes an enzymatic activity that confers the ability to grow in medium lackinpg what would otherwise be an essential nutrient the HIS3 gene in yeast celells); in addition, a selectable marker may confer resistance to an antibiotic oor drug upon the cell in which the selectable marker is expressed. Selectable narkers may be "dominant"; a dominant selectable marker encodes an enzzymatic activity that can be detected in any eukaryotic cell line. Examples of doominant selectable markers include the bacterial aminoglycoside 3' phosphotrannsferase gene (also referred to as the ieo gene) which confers resistance to thhe drug G418 in mammalian cells, the bacterial hygromycin G phosphotrannsferase (hyg) gene which confers resistance to the antibiotic hygromycin aland the bacterial xanthine-guanine phosphoribosyl transferase gene (also referreied to as the gpt gene) which confers the ability to grow in the presennce of mycophenolic acid. Other selectable markers are not dominant in thaat their use must be in conjunction with a cell line that lacks the relevant e:enzyme activity. Examples of non-dominant selectable markers include the thyymidine kinase (tk) gene which is used in conjunction with tk- cell lines, the CALD gene which is used in conjunction with CAD-deficient cells and the mamnmalian hypoxanthine-guanine phosphoribosyl transferase (hprt) gene which is t used in conjunction with hprr cell lines. A review of the use of selectable marlrkers in mammalian cell lines is provided in Sambrook et al., Molecular Clonning: A

I

WO 01/73052 PCT/r/US01/09950 Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press, Nevw York (1989) pp.16.9-16.15.

Eukaryotic expression vectors may also contain "viral replicoons "or "viral origins of replication." Viral replicons are viral DNA sequences s which allow for the extrachromosomal replication of a vector in a hoost cell expressing the appropriate replication factors. Vectors which containn either the SV40 or polyoma virus origin of replication replicate to high copy nuumber.

Vectors which contain the replicons from bovine papillomavirus or Elpstein- Barr virus replicate extrachromosomally at low copy number (-100 copies/cell).

The thermophilic DNA polymerase III holoenzyme or holoeenzyme subunits or accessory proteins (for example, dnaG, priA, uvrD) nmay be expressed in either prokaryotic or eukaryotic host cells. Nucleic acid enicoding the thermophilic DNA polymerase I holoenzyme or holoenzyme subbunit or accessory proteins (for example, dnaG, priA, uvrD) may be introduceed into bacterial host cells by a number of means including transformation of baacterial cells made competent for transformation by treatment with calcium chlooride or by electroporation. If the thermophilic DNA polymerase III holoenzy.yme or holoenzyme subunit or accessory proteins (for example, dnaG, priA, uvvrD)are to be expressed in eukaryotic host cells, nucleic acid encodinng the thermophilic DNA polymerase III holoenzyme or holoenzyme subuunit or accessory proteins (for example, dnaG, priA, uvrD) may be introduceed into eukaryotic host cells by a number of means including calcium phoosphate co-precipitation, spheroplast fusion, electroporation and the like. Whhen the eukaryotic host cell is a yeast cell, transformation may be affectted by treatment of the host cells with lithium acetate or by electroporation i or any other method known in the art. It is contemplated that any host cell will be useful in producing the peptides or proteins or fragments thereof of the invention.

"Hybridization" methods involve the annealing of a complemnentary sequence to the target nucleic acid (the sequence to be detected). The ability WO 0(11/73052 PCT//U SO 1/09950 -21of two polymers of nucleic acid containing complementary sequences 1 to find each other and anneal through base pairing interaction is a well-recopgnized phenomenon. The initial observations of the "hybridization" proccess by Marmur and Lane, (See Marmur and Lane, Proc. Natl. Acad. Sci:i. USA 46:453 [1960]); and Doty et al., Proc. Natl. Acad. Sci. USA 46:461 [1960]) have been followed by the refinement of this process into an essential i tool of modem biology. Nonetheless, a number of problems have prevented thhe wide scale use of hybridization as a tool in diagnostics. Among thee more formidable problems are: 1) the inefficiency of hybridization; 2) thhe low concentration of specific target sequences in a mixture of genomic DNAA; and 3) the hybridization of only partially complementary probes and targets...

With regard to efficiency, it is experimentally observed that I only a fraction of the possible number of probe-target complexes are formeied in a hybridization reaction. This is particularly true with short oligonuccleotide probes (less than 100 bases in length). There are three fundamental cauases: a) hybridization cannot occur because of secondary and tertiary stitructure interactions; b) strands of DNA containing the target sequencee have rehybridized (reannealed) to their complementary strand; and c) somee target molecules are prevented from hybridization when they are usised in hybridization formats that immobilize the target nucleic acids to aa solid surface.

Even where the sequence of a probe is completely complemenntary to the sequence of the target the target's primary structure), the target sequence must be made accessible to the probe via rearrangeme:ents of higher-order structure. These higher-order structural rearrangementats may concern either the secondary structure or tertiary structure of the moolecule.

Secondary structure is determined by intramolecular bonding. In the c case of DNA or RNA targets this consists of hybridization within a single, contitinuous strand of bases (as opposed to hybridization between two different stitrands).

Depending on the extent and position of intramolecular bonding, the proobe can be displaced from the target sequence preventing hybridization.

WO 01/73052 PCT/'/U SO 1/09950 -22- Solution hybridization of oligonucleotide probes to dennatured double-stranded DNA is further complicated by the fact that the longer complementary target strands can renature or reanneal. Again, hyboridized probe is displaced by this process. This results in a low yield of hybridilization (low "coverage") relative to the starting concentrations of probe and targiget.

With regard to low target sequence concentration, the DNA fra-agment containing the target sequence is usually in relatively low abundaiance in genomic DNA. This presents great technical difficulties; most convenntional methods that use oligonucleotide probes lack the sensitivity necess.sary to detect hybridization at such low levels.

One attempt at a solution to the target sequence concentration pnroblem is the amplification of the detection signal. Most often this entails placiing one or more labels on an oligonucleotide probe. In the case of non-radidoactive labels, even the highest affinity reagents have been found to be unsuitalable for the detection of single copy genes in genomic DNA with oligonuclleotide probes. (See, Wallace et al., Biochimie 67:755 [1985]). In the cease of radioactive oligonucleotide probes, only extremely high specific activitities are found to show satisfactory results. (See, Studencki and Wallace, DNNA 3:1 [1984]; and Studencki et al., Human Genetics 37:42 [1985]).

With regard to complementarity, it is important for some diapgnostic applications to determine whether the hybridization represents compplete or partial complementarity. For example, where it is desired to detect simpply the presence or absence of pathogen DNA (such as from a virus, bacterium,i, fungi, mycoplasma, protozoan) it is only important that the hybridization nmethod ensures hybridization when the relevant sequence is present; conditions 3 can be selected where both partially complementary probes and comppletely complementary probes will hybridize. Other diagnostic appliccations, however, may require that the hybridization method distinguish boetween partial and complete complementarity. It may be of interest to detect g genetic polymorphisms. For example, human hemoglobin is composed, in ppart, of four polypeptide chains. Two of these chains are identical chains of 141 WO 01/73052 PCT/r/USOI/09950 -23amino acids (alpha chains) and two of these chains are identical chains c of 146 amino acids (beta chains). The gene encoding the beta chain is knoown to exhibit polymorphism. The normal allele encodes a beta chain I having glutamic acid at the sixth position. The mutant allele encodes a betaa chain having valine at the sixth position. This difference in amino acids 5 has a profound (most profound when the individual is homozygous for the r mutant allele) physiological impact known clinically as sickle cell anemia. It i is well known that the genetic basis of the amino acid change involves a singlgle base difference between the normal allele DNA sequence and the mutantit allele DNA sequence.

Unless combined with other techniques (such as restriction eenzyme analysis), methods that allow for the same level of hybridization in the c case of both partial as well as complete complementarity are typically unsuitited for such applications; the probe will hybridize to both the normal and variant target sequence. Hybridization, regardless of the method used, requiress some degree of complementarity between the sequence being assayed (the target sequence) and the fragment of DNA used to perform the test (the proboe). Of course, those of skill in the art know that one can obtain binding withoout any complementarity but this binding is nonspecific and to be avoided.

As used herein, the terms "complementary" or "complementaritity" are used in reference to polynucleotides a sequence of nucleotides) relaated by the base-pairing rules. For example, for the sequence is complementary to the sequence Complementarity may be "ppartial," in which only some of the nucleic acids' bases are matched accordingg to the base pairing rules. Or, there may be "complete" or "total" complemeentarity between the nucleic acids. The degree of complementarity between r nucleic acid strands has significant effects on the efficiency and strenpgth of hybridization between nucleic acid strands. This is of particular importaance in amplification reactions, as well as detection methods that depend upon bbinding between nucleic acids.

WO 01/73052 PCT/I/U SO 1/09950 -24- The term "homology" refers to a degree of complementarity. There may be partial homology or complete homology identity). A poartially complementary sequence is one that at least partially inhibits a comppletely complementary sequence from hybridizing to a target nucleic acid and is referred to using the functional term "substantially homologous."" The inhibition of hybridization of the completely complementary sequencee to the target sequence may be examined using a hybridization assay (Southhern or Northern blot, solution hybridization and the like) under conditions of low stringency. A substantially homologous sequence or probe will comppete for and inhibit the binding the hybridization) of a completely homologgous to a target under conditions of low stringency. This is not to say that connditions of low stringency are such that non-specific binding is permitteed; low stringency conditions require that the binding of two sequences to one a another be a specific selective) interaction. The absence of non-specific bbinding may be tested by the use of a second target which lacks even a partial I degree of complementarity less than about 30% identity); in the absence c of nonspecific binding the probe will not hybridize to the second non-complemnentary target.

Numerous equivalent conditions are known in the art that rmay be employed to comprise low stringency conditions; factors such as the: length and nature (DNA, RNA, base composition) of the probe and nature of the target (DNA, RNA, base composition, present in solution or immobbilized, etc.) and the concentration of the salts and other components the presence or absence of formamide, dextran sulfate, polyethylene glyccol) are considered and the hybridization solution may be varied to generate connditions of low stringency hybridization different from, but equivalent to, thee above listed conditions. In addition, the art knows conditions that ppromote hybridization under conditions of high stringency increasiring the temperature of the hybridization and/or wash steps, the use of formanmide in the hybridization solution, etc.).

WO 01/73052 PCTI'/USO1/J9950 When used in reference to a double-stranded nucleic acid seequence such as a cDNA or genomic clone, the term "substantially homologous";" refers to any probe which can hybridize to either or both strands of the ddoublestranded nucleic acid sequence under conditions of low stringenncy as described above.

The following terms are used to describe the sequence relatioonships between two or more polynucleotides: "reference sequence", "compparison window", "sequence identity", "percentage of sequence identity"/", and "substantial identity". The term "sequence identity" means thaat two polynucleotide sequences are identical on a nucleotide-by-nuctleotide basis) over the window of comparison. The term "percentage of seequence identity" is calculated by comparing two optimally aligned sequences o'ver the window of comparison, determining the number of positions at whitich the identical nucleic acid base A, T, C, G, U, or I) occurs in both seqquences to yield the number of matched positions, dividing the number of mnatched positions by the total number of positions in the window of comparisioon the window size), and multiplying the result by 100 to yield the percentitage of sequence identity.

A "reference sequence" is a defined sequence used as a basisis for a sequence comparision; a reference sequence may be a subset of a i larger sequence, for example, as a segment of a full-length cDNA or gene seequence given in a sequence listing, such as any of the polynucleotide seqquences provided herein, or may comprise a complete cDNA or gene seqquence.

Generally, but not always, a reference sequence is at least 20 nucleotitides in length, frequently at least 25 nucleotides in length, and often at leeast nucleotides in length. Since two polynucleotides may each compprise a sequence a portion of the complete polynucleotide sequence) 1 that is similar between the two polynucleotides, and may further compprise a sequence that is divergent between the two polynucleotides, seequence comparisons between two (or more) polynucleotides are typically perfrformed by comparing sequences of the two polynucleotides over a "compparison WO 01/73052 PCT/r/USOI/09950 -26window" to identify and compare local regions of sequence similanrity. A "comparison window", as used herein, refers to a conceptual segmentit of at least 20 contiguous nucleotide positions wherein a polynucleotide seqquence may be compared to a reference sequence of at least 20 contiguous nucldeotides and wherein the portion of the polynucleotide sequence in the comp.parison window may comprise additions or deletions gaps) of 20 percent or less as compared to the reference sequence (which does not comprise addititions or deletions) for optimal alignment of the two sequences. Optimal alignmnent of sequences for aligning a comparison window may be conducted by thee local homology algorithm of Smith and Waterman (1981) Adv. Appl. Math. 22: 482, by the homology alignment algorithm of Needleman and Wunsch (19970) J.

Mol. Biol. 48: 443, by the search for similarity method of Pearson and LLipman (1988) Proc. Natl. Acad. Sci. 85: 2444, by computterized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFFASTA in the Wisconsin Genetics Software Package Release 7.0, Genetics Cormputer Group, 575 Science Dr., Madison, Wis.), or by inspection, and thhe best alignment resulting in the highest percentage of homology ovver the comparison window) generated by the various methods is selected. Thhe term "substantial identity" denotes a characteristic of a polynucleotide seqquence, wherein the polynucleotide comprises a sequence that has at least 85 ppercent sequence identity, preferably at least 90 to 95 percent sequence identityy, more usually at least 99 percent sequence identity as compared to a refiference sequence over a comparison window of at least 20 nucleotide pos)sitions, frequently over a window of at least 25-50 nucleotides, wherein the perccentage of sequence identity is calculated by comparing the reference sequencee to the polynucleotide sequence which may include deletions or additions whic.ch total percent or less of the reference sequence over the window of compoarison.

The reference sequence may be a subset of a larger sequence, for examnple, as a segment of the full-length polynucleotide sequence or the full-length i cDNA sequence.

WO 01/73052 PCT/I/U SO 1/09950 C( -27- As applied to polypeptides, the term "substantial identity" meaians that two peptide sequences, when optimally aligned, such as by the programns GAP or BESTFIT using default gap weights, share at least 80 percent secquence I0 identity, preferably at least 90 percent sequence identity, more prefera-ably at 5 least 95 percent sequence identity or more 99 percent sequence idelentity).

O Preferably, residue positions which are not identical differ by consecrvative amino acid substitutions. Conservative amino acid substitutions refer r to the Sinterchangeability of residues having similar side chains. For example, aa group of amino acids having aliphatic side chains is glycine, alanine, valine, leleucine, and isoleucine; a group of amino acids having aliphatic-hydroxyl side chains is serine and threonine; a group of amino acids having amide-containinng side chains is asparagine and glutamine; a group of amino acids having ar(romatic side chains is phenylalanine, tyrosine, and tryptophan; a group of aminao acids having basic side chains is lysine, arginine, and histidine; and a grcroup of amino acids having sulfur-containing side chains is cysteine and methhionine.

Preferred conservative amino acids substitution groups are: valine-ldeucineisoleucine, phenylalanine-tyrosine, lysine-arginine, alanine-valine;, and asparagine-glutamine. see A gene may produce multiple RNA species which are generalated by differential splicing of the primary RNA transcript. cDNAs that aree splice variants of the same gene will contain regions of sequence identitity or complete homology (representing the presence of the same exon or porrtion of the same exon on both cDNAs) and regions of complete non-identitity (for example, representing the presence of exon on cDNA 1 wherein cLDNA 2 contains exon instead). Because the two cDNAs contain regitions of sequence identity they will both hybridize to a probe derived from thee entire gene or portions of the gene containing sequences found on both cDNAAs; the two splice variants are therefore substantially homologous to such a proobe and to each other.

When used in reference to a single-stranded nucleic acid sequennce, the term "substantially homologous" refers to any probe which can hybridizize WO 01/73052 PCT/T/U S01/09950 -28it is the complement of) the single-stranded nucleic acid sequence under conditions of low stringency as described. As used herein, thee term "hybridization" is used in reference to the pairing of complementary r nucleic acids. Hybridization and the strength of hybridization the strengthh of the association between the nucleic acids) is impacted by such factors: as the degree of complementary between the nucleic acids, stringency of the conditions involved, the Tm of the formed hybrid, and the G:C ratio witlthin the nucleic acids.

The term "Ti" is used in reference to the "melting temperature-e." The melting temperature is the temperature at which a population of ddoublestranded nucleic acid molecules becomes half dissociated into single s strands.

The equation for calculating the Tm of nucleic acids is well known in t the art.

As indicated by standard references, a simple estimate of the Tm value r may be calculated by the equation: Tm 81.5 0.41(% G when a nucleeic acid is in aqueous solution at 1 M NaC1 (See Anderson and Young, Quantitative Filter Hybridization, in Nucleic Acid Hybridization [11985]).

Other references include more sophisticated computations whichh take structural as well as sequence characteristics into account for the calculaation of Tm.

The term "stringency" is used in reference to the conditidons of temperature, ionic strength, and the presence of other compounds sisuch as organic solvents, under which nucleic acid hybridizations are conductedd. With "high stringency" conditions, nucleic acid base pairing will occuur only between nucleic acid fragments that have a high frequency of complemnentary base sequences. Thus, conditions of "weak" or "low" stringency arere often required with nucleic acids that are derived from organisms thhat are genetically diverse, as the frequency of complementary sequences is i usually less.

"Amplification" is a special case of nucleic acid replication involving template specificity. It is to be contrasted with non-specific te:emplate WO 01/73052 PCT/f/O S01/0995( -29replication replication that is template-dependent but not dependernt on a specific template). Template specificity is here distinguished from fiddelity of replication synthesis of the proper polynucleotide sequencee) and nucleotide (ribo- or deoxyribo-) specificity. Template specificity is freqquently described in terms of "target" specificity. Target sequences are "targets";" in the sense that they are sought to be sorted out from other nucleicc acid.

Amplification techniques have been designed primarily for this sorting oout.

Template specificity is achieved in most amplification techniqques by the choice of enzyme. Amplification enzymes are enzymes that,, under conditions they are used, will process only specific sequences of nucleieic acid in a heterogeneous mixture of nucleic acid. For example, in the case of QP replicase, MDV-1 RNA is the specific template for the replicase (Kaacian et al., Proc. Natl. Acad. Sci. USA 69:3038 [1972]). Other nucleic acids wwill not be replicated by this amplification enzyme. Similarly, in the case of T77 RNA polymerase, this amplification enzyme has a stringent specificity for itits own promoters (Chamberlin et al., Nature 228:227 [1970]). In the case of T44 DNA ligase, the enzyme will not ligate the two oligonucleotides or polynucle.eotides, where there is a mismatch between the oligonucleotide or polynucbleotide substrate and the template at the ligation junction (Wu and Wallace, Gennomics 4:560 [1989]). Finally, Taq and Pfu polymerases, by virtue of their abbility to function at high temperature, are found to display high specificity f for the sequences bounded and thus defined by the primers; the high tempperature results in thermodynamic conditions that favor primer hybridization wwith the target sequences and not hybridization with non-target sequences (Erlichh PCR Technology, Stockton Press [1989]).

The term "amplifiable nucleic acid" is used in reference to r nucleic acids which may be amplified by any amplification method. It is contemplated that "amplifiable nucleic acid" will usually comprise "e'sample template." The term "sample template" refers to nucleic acid originating I from a sample which is analyzed for the presence of "target" (defined belovw). In WO 01/73052 PCT//U SO 1/09950 contrast, "background template" is used in reference to nucleic acid otheer than sample template which may or may not be present in a sample. Backgground template is most often inadvertent. It may be the result of carryover, or r it may be due to the presence of nucleic acid contaminants sought to be purifiedd away from the sample. For example, nucleic acids from organisms other thann those to be detected may be present as background in a test sample.

As used herein, the term "primer" refers to an oligonucleotide, wvhether occurring naturally as in a purified restriction digest or produced synthettically, which is capable of acting as a point of initiation of synthesis when placed under conditions in which synthesis of a primer extension product wbhich is complementary to a nucleic acid strand is induced, in the preseence of nucleotides and an inducing agent such as DNA polymerase and at a sisuitable temperature and pH). The primer is preferably single stranded for maxuimum efficiency in amplification, but may alternatively be double strandeled. If double stranded, the primer is first treated to separate its strands before-e being used to prepare extension products. Preferably, the primer is an oligodeoxyribonucleotide. The primer must be sufficiently long to pririme the synthesis of extension products in the presence of the inducing agentit. The exact lengths of the primers will depend on many factors, inccluding temperature, source of primer and the use of the method.

A primer is selected to be "substantially" complementary to a strtrand of specific sequence of the template. A primer must be suffiiciently complementary to hybridize with a template strand for primer elongatation to occur. A primer sequence need not reflect the exact sequence of the tenmplate.

For example, a non-complementary nucleotide fragment may be attaciched to the 5' end of the primer, with the remainder of the primer sequencee being substantially complementary to the strand. Non-complementary ba;ases or longer sequences can be interspersed into the primer, provided that the I primer sequence has sufficient complementarity with the sequence of the tempplate to hybridize and thereby form a template primer complex for synthesis of the extension product of the primer.

WO 01/73052 PC'/I'/U S 1/09950 -31- The term "nested primers" refers to primers that anneal to thee target sequence in an area that is inside the annealing boundaries used to startrt PCR.

(See, Mullis et al., Cold Spring Harbor Symposia, Vol. LI, pp. 2e63-273 [1986]). Because the nested primers anneal to the target inside the annnealing boundaries of the starting primers, the predominant PCR-amplified prooduct of the starting primers is necessarily a longer sequence, than that defined I by the annealing boundaries of the nested primers. The PCR-amplified prodduct of the nested primers is an amplified segment of the target sequence that ccannot, therefore, anneal with the starting primers.

The term "probe" refers to an oligonucleotide a sequeence of nucleotides), whether occurring naturally as in a purified restriction dipigest or produced synthetically, recombinantly or by PCR amplification, whhich is capable of hybridizing to another oligonucleotide of interest. A probe nmay be single-stranded or double-stranded. Probes are useful in the detetection, identification and isolation of particular gene sequences. It is contemnplated that any probe used in the present invention will be labelled with any "raeporter molecule," so that is detectable in any detection system, including, bbut not limited to enzyme ELISA, as well as enzyme-based histochhemical assays), fluorescent, radioactive, and luminescent systems. It is not inntended that the present invention be limited to any particular detection syststem or label.

The term "label" as used herein refers to any atom or molecule s which can be used to provide a detectable (preferably quantifiable) signal, and which can be attached to a nucleic acid or protein. Labels may provide signals detectable by fluorescence, radioactivity, colorimetry, gravimetry, X-ray diffraction or absorption, magnetism, enzymatic activity, and the like.

The term "target," when used in reference to the polymerasee chain reaction, refers to the region of nucleic acid bounded by the primers uused for polymerase chain reaction. Thus, the "target" is sought to be sorted ouut from other nucleic acid sequences. A "segment" is defined as a region of r nucleic acid within the target sequence.

WO 01/73052 PCT/F/U SO 1/09950 -32- The term "substantially single-stranded" when used in referenace to a nucleic acid target means that the target molecule exists primarily as aa single strand of nucleic acid in contrast to a double-stranded target which exxists as two strands of nucleic acid which are held together by inter-strand base I pairing interactions.

Nucleic acids form secondary structures which depend on base--pairing for stability. When single strands of nucleic acids (single-stranded 1 DNA, denatured double-stranded DNA or RNA) with different sequences.s, even closely related ones, are allowed to fold on themselves, they a assume characteristic secondary structures. An alteration in the sequence of thee target may cause the destruction of a duplex region(s), or an increase in stabilility of a thereby altering the accessibility of some regions to hybridization of the probes oligonucleotides. While not being limited to any particular theonry, it is thought that individual molecules in the target population may each a assume only one or a few of the structures duplexed regions), but whhen the sample is analyzed as a whole, a composite pattern from the hybridizatation of the probes can be created. Many of the structures that can alter the binoding of the probes are likely to be only a few base-pairs long and would appeaar to be unstable. Some of these structures may be displaced by the hybridizatidon of a probe in that region; others may by stabilized by the hybridization of a a probe nearby, such that the probe/substrate duplex can stack coaxially with thee target intrastrand duplex, thereby increasing the stability of both. The formalation or disruption of these structures in response to small sequence changes ressults in changes in the patterns of probe/target complex formation. As used herein, the term "polymerase chain reaction" refers to the method of f Mullis U.S. Patent Nos. 4,683,195 4,683,202, and 4,965,188, hereby incorpora-ated by reference, which describe a method for increasing the concentratioon of a segment of a target sequence in a mixture of genomic DNA without cloDning or purification. This process for amplifying the target sequence consisists of introducing a large excess of two oligonucleotide primers to the DNA nmixture containing the desired target sequence, followed by a precise sequeence of WO 01/73052 PCTIF/US01/09950 -33thermal cycling in the presence of a DNA polymerase. The two primoers are complementary to their respective strands of the double stranded I target sequence. To effect amplification, the mixture is denatured and the pprimers then annealed to their complementary sequences within the target moblecule.

Following annealing, the primers are extended with a polymerase soo as to form a new pair of complementary strands. The steps of denaturation, I primer annealing and polymerase extension can be repeated many timess denaturation, annealing and extension constitute one "cycle"; there c can be numerous "cycles") to obtain a high concentration of an amplified segmnent of the desired target sequence. The length of the amplified segment of the desired target sequence is determined by the relative positions of the pprimers with respect to each other, and therefore, this length is a contrnrollable parameter. By virtue of the repeating aspect of the process, the metthod is referred to as the "polymerase chain reaction" (hereinafter B3ecause the desired amplified segments of the target sequence become the predoominant sequences (in terms of concentration) in the mixture, they are said to be-e "PCR amplified".

With PCR, it is possible to amplify a single copy of a specificc target sequence in genomic DNA to a level detectable by several dilifferent methodologies hybridization with a labeled probe; incorporatition of biotinylated primers followed by avidin-enzyme conjugate detetection; incorporation of 32 p-labeled deoxynucleotide triphosphates, such as dGCTP or dATP, into the amplified segment). In addition to genomic DNAA, any oligonucleotide or polynucleotide sequence can be amplified wirith the appropriate set of primer molecules. In particular, the amplified sepgments created by the PCR process itself are, themselves, efficient templatates for subsequent PCR amplifications.

The terms "PCR product," "PCR fragment," and "amplifification product" refer to the resultant mixture of compounds after two or more a cycles of the PCR steps of denaturation, annealing and extension are conmplete.

WO 01/73052 2PC'F//LS01/09950 -34- These terms encompass the case where there has been amplification of one or more segments of one or more target sequences.

The term "amplification reagents" refers to those re:eagents (deoxyribonucleotide triphosphates, buffer, etc.), needed for amplifification except for primers, nucleic acid template and the amplification ennzyme.

Typically, amplification reagents along with other reaction componennts are placed and contained in a reaction vessel (test tube, microwell, etc.).

As used in reference to amplification methods such as PCR, thhe term "polymerase" refers to any polymerase suitable for use in the amplificatation of nucleic acids of interest. It is intended that the term encompass suchh DNA polymerases as the polymerase III of the present invention, as well a as Taq DNA polymerase the type I polymerase obtained from Tihennus aquaticus), although other polymerases, both thermostable and thermoolabile are also encompassed by this definition.

The term "RT-PCR" refers to the replication and amplification obf RNA sequences. In this method, reverse transcription is coupled to PCR, mosist often using a one enzyme procedure in which a thermostable polymer:rase is employed, as described in U.S. Patent No. 5,322,770, herein incorporaated by reference. In RT-PCR, the RNA template is converted to cDNA due to the reverse transcriptase activity of the polymerase, and then amplified usising the polymerizing activity of the polymerase as in other PCR methods)). The proteins and polypeptides of the invention can be used in any methhod of synthesizing or replicating DNA.

The terms "restriction endonucleases" and "restriction enzymes's" refer to bacterial enzymes, each of which cut double-stranded DNA at or near a specific nucleotide sequence.

The term "recombinant DNA molecule" as used herein refers to i a DNA molecule which is comprised of segments of DNA joined together by t means of molecular biological techniques.

The terms "in operable combination," "in operable order,r," and "operably linked" refer to the linkage of nucleic acid sequences in such a WO 01/73052 PCT/'/US01/09950 manner that a nucleic acid molecule capable of directing the transcriptidon of a given gene and/or the synthesis of a desired protein molecule is prooduced.

The term also refers to the linkage of amino acid sequences in such a nmanner so that a functional protein is produced.

As used herein, the term "isolated" when used in relation to a r nucleic acid, as in "an isolated oligonucleotide" or "isolated polynucleotide" refefers to a nucleic acid sequence that is identified and separated from at lea:ast one contaminant nucleic acid with which it is ordinarily associated in its i natural source. Isolated nucleic acid is such present in a form or setting that is different from that in which it is found in nature. In contrast, non-isisolated nucleic acids as nucleic acids such as DNA and RNA found in the statate they exist in nature. The isolated nucleic acid, oligonucleotide, or polynuccleotide may be present in single-stranded or double-stranded form. When an isisolated nucleic acid, oligonucleotide or polynucleotide is to be utilized to exppress a protein, the oligonucleotide or polynucleotide will contain at a minimnum the sense or coding strand the oligonucleotide or polynucleotide may singlestranded), but may contain both the sense and anti-sense strands the oligonucleotide or polynucleotide may be double-stranded).

As used herein, the term "purified" or "to purify" refers to the reemoval of contaminants from a sample. For example, anti-DNA polymeraase lI holoenzyme and holoenzyme subunit and accessory protein antibodilies are purified by removal of contaminating non-immunoglobulin proteins; tithey are also purified by the removal of immunoglobulin that does not bindd DNA polymerase m holoenzyme or holoenzyme subunit or accessory proteinns. The removal of non-immunoglobulin proteins and/or the removval of immunoglobulins that do not bind DNA polymerase MII holoenzyyme or holoenzyme subunit or accessory proteins results in an increase in the I percent of DNA polymerase III holoenzyme or holoenzyme subunit or acccessory protein-reactive immunoglobulins in the sample. In another exxample, recombinant DNA polymerase ILI holoenzyme or holoenzyme subunnit or accessory protein polypeptides are expressed in bacterial host cells aand the WO 01/73052 PCT/ /uS01/109950 -36polypeptides are purified by the removal of host cell proteins; the percrcent of recombinant DNA polymerase II holoenzyme or holoenzyme subuunit or accessory protein polypeptides is thereby increased in the sample.

The term "recombinant DNA molecule" as used herein refers to a DNA molecule which is comprised of segments of DNA joined together by means of molecular biological techniques.

The term "recombinant protein" or "recombinant polypeptide" a as used herein refers to a protein molecule which is expressed from a recomnbinant DNA molecule.

The term "native protein" as used herein to indicate that a proteihin does not contain amino acid residues encoded by vector sequences; that t is the native protein contains only those amino acids found in the protein as it t occurs in nature. A native protein may be produced by recombinant means or r may be isolated from a naturally occurring source.

As used herein, the term "fusion protein" refers to a chimeric I protein containing the protein of interest DNA polymerase III holoenzyyme or holoenzyme subunit or accessory proteins and fragments of the holoennzyme, subunit or accessory protein) joined to a fusion partner, which is an exopgenous protein or peptide fragment. The fusion partner consists of a norm-DNA polymerase III holoenzyme or holoenzyme subunit protein or acccessory protein. The fusion partner may enhance solubility of the DNA polymeerase 1I holoenzyme or holoenzyme subunit protein or accessory protein as exppressed in a host cell, may provide an affinity tag to allow purification of the recombinant fusion protein from the host cell or culture supernatant, o:or both.

If desired, the fusion protein may be removed from the protein of intereest DNA polymerase I holoenzyme, holoenzyme subunit protein, or acccessory proteins or fragments of any of the foregoing) by a variety of enzymnatic or chemical means known to the art.

In the present invention, the subunits and accessory proteins of the invention are fused to an N-terminal peptide that contains a hexahistiditine site, a biotinylation site and a thrombin cleavage site. In other embodimennts, the WO 01/73052 PCT/r/US01/09950 -37subunits and accessory proteins are expressed as translationally ccoupled proteins. In yet another embodiment, the amino terminal tag comprrises a hexahistine site and a biotinylation site. In yet another embodimernt, the subunits and accessory proteins of the invention are fused to a C-tejerminal peptide comprising a hexahistidine site and a biotinylation site. Other r marker sequences are known in the art and can be linked to the subunitits and accessory proteins of the invention.

A "variant" of DNA polymerase 1I holoenzyme or holoeenzyme subunit or accessory protein refers to an amino acid sequence that is alte:ered by one or more amino acids. The variant may have "conservative" chhanges, wherein a substituted amino acid has similar structural or chemical propperties replacement of leucine with isoleucine). More rarely, a variannt may have "nonconservative" changes replacement of a glycine v with a tryptophan). Similar minor variations may also include amino acid debletions or insertions, or both. Guidance in determining which amino acid re'esidues may be substituted, inserted, or deleted without abolishing biologiical or immunological activity may be found using computer programs well knoown in the art, for example, DNASTAR software.

The term "sequence variation" refers to differences in nucleieic acid sequence between two nucleic acid templates. For example, a wilild-type structural gene and a mutant form of this wild-type structural gene may vary in sequence by the presence of single base substitutions and/or deletiions or insertions of one or more nucleotides. These two forms of the structuraal gene are said to vary in sequence from one another. A second mutant forma of the structural gene may exist. This second mutant form is said to vary in seequence from both the wild-type gene and the first mutant form of the gene. It is s noted, however, that the invention does not require that a comparison bee made between one or more forms of a gene to detect sequence variations. B3ecause the method of the invention generates a characteristic and reproducible I pattern of complex formation for a given nucleic acid target, a charactteristic "fingerprint" may be obtained from any nucleic target without referenace to a WO 01/73052 PCT//IJUS01/09950 -38wild-type or other control. The invention contemplates the use of the nmethod for both "fingerprinting" nucleic acids without reference to a contrrol and identification of mutant forms of a target nucleic acid by comparison 1 of the mutant form of the target with a wild-type or known mutant control.

The term "target nucleic acid" refers to the region of nucleieic acid bounded by the primers used for polymerase chain reaction. Thus, the "l"target" is sought to be sorted out from other nucleic acid sequences. A "segmnent" is defined as a region of nucleic acid within the target sequence.

The term "nucleotide analog" refers to modified or non-naiaturally occurring nucleotides such as 7-deaza purines 7-deaza-dATFP and 7-deaza-dGTP). Nucleotide analogs include base analogs and coDmprise modified forms of deoxyribonucleotides as well as ribonucleotides. Thhe term "nucleotide analog" when used in reference to targets present in a a PCR mixture refers to the use of nucleotides other than dATP, dGTP, dCTTP and dTTP; thus, the use of dUTP (a naturally occurring dNTP) in a PCR would comprise the use of a nucleotide analog in the PCR. A PCR product gennerated using dUTP, 7-deaza-dATP, 7-deaza-dGTP or any other nucleotide anaalog in the reaction mixture is said to contain nucleotide analogs.

Oligonucleotide primers matching or complementary to aa gene sequence refers to oligonucleotide primers capable of facilitatinng the template-dependent synthesis of single or double-stranded nucleic acids.

Oligonucleotide primers matching or complementary to a gene sequenace may be used in PCRs, RT-PCRs and the like.

A "consensus gene sequence" refers to a gene sequence whhich is derived by comparison of two or more gene sequences and which deescribes the nucleotides most often present in a given segment of the genaes; the consensus sequence is the canonical sequence. "Consensus prerotein," "consensus amino acid," consensus peptide," and consensus polyppeptide sequences refer to sequences that are shared between multiple organiisms or proteins.

WO 01/73052 PCT'/U SO 1/09950 -39- The term "biologically active," refers to a protein or other biolopgically active molecules catalytic RNA) having structural, regulatoory, or biochemical functions of a naturally occurring molecule. Likkewise, "immunologically active" refers to the capability of the natural, recomhbinant, or synthetic DNA polymerase II holoenzyme or holoenzyme subuunit, or accessory proteins, or any oligopeptide or polynucleotide thereof, to innduce a specific immune response in appropriate animals or cells and to binnd with specific antibodies.

The term "agonist" refers to a molecule which, when bound too DNA polymerase III holoenzyme or holoenzyme subunit or accessory pprotein, causes a change in DNA polymerase III holoenzyme or holoenzyme subbunit or accessory protein, which modulates the activity of DNA polymera-ase I holoenzyme or holoenzyme subunit or accessory protein. Agoniststs may include proteins, nucleic acids, carbohydrates, or any other molecules s which bind or interact with DNA polymerase I holoenzyme or holoenzyme s subunit or accessory protein.

The terms "antagonist" or "inhibitor" refer to a molecule whichh, when bound to DNA polymerase III holoenzyme or holoenzyme subunit, bldocks or modulates the biological or immunological activity of DNA polymer:rase III holoenzyme or holoenzyme subunit or accessory protein. Antagonisists and inhibitors may include proteins, nucleic acids, carbohydrates, or anyy other molecules which bind or interact with DNA polymerase III holoenzyyme or holoenzyme subunit or accessory protein.

The term "modulate" refers to a change or an alteration in the biological activity of DNA polymerase III holoenzyme or holoenzyme s subunit or accessory protein. Modulation may be an increase or a decrease in I protein activity, a change in binding characteristics, or any other change in the biological, functional, or immunological properties of DNA polymer:rase III holoenzyme or holoenzyme subunit or accessory protein.

The term "derivative" refers to the chemical modification of a i nucleic acid encoding DNA polymerase III holoenzyme or holoenzyme subounit or WO 01/73052 PCT/1/U SO1/09950 accessory protein, or the encoded DNA polymerase [II holoenzyyme or r n holoenzyme subunit or accessory protein. Illustrative of such modifiications would be replacement of hydrogen by an alkyl, acyl, or amino grouup. A ksO nucleic acid derivative would encode a polypeptide which retains es:ssential 5 biological characteristics of the natural molecule.

The term "Southern blot (analysis)" refers to the analysis of DDNA on agarose or acrylamide gels to fractionate the DNA according to size foollowed 0by transfer of the DNA from the gel to a solid support, such as nitroceellulose or a nylon membrane. The immobilized DNA is then probed with a 1 labeled probe to detect DNA species complementary to the probe used. Thee DNA may be cleaved with restriction enzymes prior to electrophoresis. Fol)llowing electrophoresis, the DNA may be partially depurinated and denatured p prior to or during transfer to the solid support. Southern blots are a standard I tool of molecular biologists (Sambrook et al., Molecular Cloning: A Labooratory Manual, Cold Spring Harbor Press, NY, pp 9.31-9.58 [1989]).

The term "Northern blot (analysis)" refers to the analysis of RRNA by electrophoresis of RNA on agarose gels to fractionate the RNA accorcrding to size followed by transfer of the RNA from the gel to a solid support, s such as nitrocellulose or a nylon membrane. The immobilized RNA is then probed with a labeled probe to detect RNA species complementary to the probbe used.

Northern blots are a standard tool of molecular biologists (Sambrookk et al., supra, pp 7.39-7.52 [1989]).

The term "Western blot" or "Western analysis" refers to the anallysis of protein(s) (or polypeptides) immobilized onto a support such as nitroceellulose or a membrane. The proteins are run on acrylamide gels to separtrate the proteins, followed by transfer of the protein from the gel to a solid sisupport, such as nitrocellulose or a nylon membrane. The immobilized prote:eins are then exposed to antibodies with reactivity against an antigen of interes:st. The binding of the antibodies may be detected by various methods, includding the use of radiolabelled antibodies.

WO 01/73052 PCTIAVUI SI)1/0995( -41- An "immunogenic epitope" is defined as a part of a protein that.t elicits an antibody response when the whole protein is the immunogen. These immunogenic epitopes are believed to be confined to a few loci c on the molecule. On the other hand, a region of a protein molecule to whhich an antibody can bind is defined as an "antigenic epitope." The numhber of immunogenic epitopes of a protein is generally less than the numhber of antigenic epitopes. See, for instance, Geysen, et al., Proc. Natl. Acaod. Sci.

USA 81:3998-4002 (1983). See, for example, USPN 6,011,012.

The term "antigenic determinant" as used herein refers to that Fportion of an antigen that makes contact with a particular antibody an eppitope).

When a protein or fragment of a protein is used to immunize a host aanimal, numerous regions of the protein may induce the production of antilibodies which bind specifically to a given region or three-dimensional structure on the protein; these regions or structures are referred to as antigenic determninants.

An antigenic determinant may compete with the intact antigen the "immunogen" used to elicit the immune response) for binding to an antitibody.

See, for example, USPN 6,011,012.

The terms "specific binding" or specifically binding" when uused in reference to the interaction of an antibody and a protein or peptide meaans that the interaction is dependent upon the presence of a particular structurre the antigenic determinant or epitope) on the protein; in other wornrds the antibody is recognizing and binding to a specific protein structure rathoer than to proteins in general. For example, if an antibody is specific for epitoppe the presence of a protein containing epitope A (or free, unlabelled AA) in a reaction containing labelled and the antibody will reduce the amaount of labelled A bound to the antibody.

As used herein, the term "cell culture" refers to any in vitro cultlture of cells. Included within this term are continuous cell lines wNith an immortal phenotype), primary cell cultures, finite cell lines nontransformed cells), and any other cell population maintained in vitro.

WO 01/73052 PCTA'II/USO1/09950 -42- The terms "test DNA polymerase III holoenzyme" and I "test M holoenzyme subunit" or "test protein" refers to a sample suspectted of containing DNA polymerase m holoenzyme or holoenzyme subuunit or O accessory protein, respectively. The concentration of DNA polymera'ase III holoenzyme or holoenzyme subunit or accessory protein in the test sarmple is determined by various means, and may be compared with a "quanntitated amount of DNA polymerase II holoenzyme or holoenzyme subuunit or 0accessory protein" a positive control sample containing a known aamount of DNA polymerase III holoenzyme or holoenzyme subunit or acccessory protein), in order to determine whether the concentration of test t DNA polymerase II holoenzyme or holoenzyme subunit or accessory protein n in the sample is within the range usually found within samples from wilild-type organisms.

The term "microorganism" or "organism"as used herein meaans an organism too small to be observed with the unaided eye and includes,:, but is not limited to bacteria, virus, protozoans, fungi, and ciliates.

The term "microbial gene sequences" refers to gene sequences dderived from a microorganism.

The term "bacteria" refers to any bacterial species including eubaacterial and archaebacterial species.

The term "virus" refers to obligate, ultramicroscopic, intraccellular parasites incapable of autonomous replication replication requires t the use of the host cell's machinery).

B. Methodologies Unless otherwise indicated, all nucleotide sequences determirined by sequencing a DNA molecule herein were determined using an auttomated DNA sequencer. A variety of sequencers are known in the art, such 1 as the Model 373 from Applied Biosystems, Inc., for example. Aminoo acid sequences of polypeptides encoded by DNA molecules determined I herein WO 01/73052 PCT/r/USO1/09950 -43were predicted by translation of a DNA sequence determined as ;above.

Alternatively the sequence can be determined by directly sequenciiing the polypeptide. As is known in the art for any DNA sequence determined I by this IND automated approach, any nucleotide sequence determined herein may ccontain 5 some errors. Nucleotide sequences determined by automation are typiccally at Sleast about 90% identical, more typically at least about 95% to at least3t about 99.9% identical to the actual nucleotide sequence of the sequencedd DNA Smolecule. The actual sequence can be more precisely determined byy other approaches including manual DNA sequencing methods well known in t the art.

As is also known in the art, a single insertion or deletion in a deterrmined nucleotide sequence cause a frame shift in translation of the nuclleotide sequence such that the predicted amino acid sequence compared to the e actual sequence will encoded by a determined nucleotide sequence wvill be completely different from the amino acid sequence actually encoded by the sequenced DNA molecule, beginning at the point of such an insertrtion or deletion. See for example, USPN 6,171,816 and 6,040,157.

"Identity" per se has an art-recognized meaning and can be caldculated using published techniques. (See, (COMPUTATIONAL MOLECULAR BIOLOGY, Lesk, A. ed., Oxford University Press, New York, ((1988); BIOCOMPUTING: INFORMATICS AND GENOME PROJECTS, Smnith, D.

ed., Academic Press, New York, (1993); COMPUTER ANALYSSIS OF SEQUENCE DATA, PART I, Griffin, A. and Griffin, H. eds., Humana Press, New Jersey, (1994); SEQUENCE ANALYSI;IS IN MOLECULAR BIOLOGY, von Heinje, Academic Press, (1987.7); and SEQUENCE ANALYSIS PRIMER, Gribskov, M. and Devereux, eeds., M Stockton Press, New York, (1991).) While there exists a number of metithods to measure identity between two polynucleotide or polypeptide sequencices, the term "identity" is well known to skilled artisans. (Carillo, and Liptoton, D., SIAM J Applied Math 48:1073 (1988)). Methods commonly emplooyed to determine identity or similarity between two sequences include, but z are not limited to, those disclosed in Guide to Huge Computers, Martin J. Bishoop, ed., WO 01/73052 PCT/Fr/U SoI/09950 -44- Academic Press, San Diego, (1994), and Carillo, and Lipton, SEIAM J Applied Math 48:1073 (1988). Methods for aligning polynucleoticides or polypeptides are codified in computer programs, including the GCG pnrogram package (Devereux, et al., Nucleic Acids Research (1984) 12(,(1):387 (1984)), BLASTP, BLASTN, FASTA (Atschul, S. F. et al., J. Molecc. Biol.

215:403 (1990), Bestfit program (Wisconsin Sequence Analysis Pa'ackage, Version 8 for Unix, Genetics Computer Group, University Research Panrk, 575 Science Drive, Madison, Wis. 53711 (using the local homology algoririthm of Smith and Waterman, Advances in Applied Mathematics 2:482-489 (1(1981)).

See USPN 6,040,157 In certain embodiments, polynucleotides of the invention compprise a nucleic acid, the sequence of which is at least 90%, 91%, 92%, 93%L, 94%, 96%, 97%, 98% or 99% identical to a sequence selected from thee group consisting of SEQ ID NOS: 9, 16, 22, 31, 36, 67, 71, 75 and 811, or a complementary sequence thereof.

By a polynucleotide comprising a nucleic acid, the sequence off which is at least, for example, 95% "identical" to a reference nucleotide sequuence is intended that the nucleic acid sequence is identical to the reference seequence except that the nucleic acid sequence may include up to five point muutations per each 100 nucleotides of the reference nucleic acid sequence. Irin other words, to obtain a nucleic acid, the sequence of which is at least 95% iddentical to a reference nucleic acid sequence, up to 5% of the nucleotides in the reference sequence may be deleted or substituted with another nucleotidde, or a number of nucleotides up to 5% of the total nucleotides in the refiference sequence may be inserted into the reference sequence. These mutationsis of the reference sequence may occur at the 5' or 3' terminal positions of the reference nucleotide sequence or anywhere between those terminal poositions, interspersed either individually among nucleotides in the reference seequence or in one or more contiguous groups within the reference sequencce. The reference (query) sequence may be any one of the entire nucleotide seqquences shown in SEQ ID NOS: 9, 16, 22, 31, 36, 67, 71, 75 and 81, or any fra-agment WO 01/73052 PCT/1/u S0 1/09950 of any of these sequences, as described infra. See USPN 6,040,1557 and 6,171,816, for example.

As a practical matter, whether any particular nucleic acid moleecule is at least 95%, 96%, 97%, 98% or 99% identical to, for instance, the nucl:leotide sequence shown in SEQ ID NOS: 9, 16, 22, 31, 36, 67, 71, 75 and 81, can be determined conventionally using known computer programs such as the Bestfit program (Wisconsin Sequence Analysis Package, Version 8 for-r Unix, Genetics Computer Group, University Research Park, 575 Science Drive, Madison, Wis. 53711). Bestfit uses the local homology algorithm of Smiiith and Waterman, Advances in Applied Mathematics 2:482-489 (1981), to fiiind the best segment of homology between two sequences. When using Bestfit t or any other sequence alignment program to determine whether a particular seqquence is, for instance, 95% identical to a reference sequence according to the ppresent invention, the parameters are set, of course, such that the percentatage of identity is calculated over the full length of the reference nucleotide seqquence and that gaps in homology of up to 5% of the total number of nucleotitides in the reference sequence are allowed. Other sequence analysis programs, I known in the art, can be used to determine percent identity. See USPN 6,040,1557 and 6,171,816.

Of course, due to the degeneracy of the genetic code, one of orerdinary skill in the art will immediately recognize that a large number of the nnucleic acid molecules having a sequence at least 95%, 96%, 97%, 98%, oDr 99% identical to the nucleic acid sequences shown in SEQ ID NOS: 9, 16, 222, 31, 36, 67, 71, 75 and 81 will encode a polypeptide or protein having bioblogical activity. In fact, since degenerate variants of these nucleotide sequenoces all encode the same polypeptide, this will be clear to the skilled artisann even without performing the comparison assays. It will be further recognizedd in the art that, for such nucleic acid molecules that are not degenerate variiants, a reasonable number will also encode a polypeptide have biological aactivity.

This is because the skilled artisan is fully aware of amino acid substititutions that are either less likely or not likely to significantly effect protein fu'unction WO 01/73052 PCT/r/US0 119950 -46replacing one aliphatic amino acid with a second aliphatic aminoo acid).

See, USPN 6,011,012; 6,171,186; 6,040,157.

One embodiment of the present invention is directeted to polynucleotides comprising a nucleic acid, the sequence of which is aat least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identicral to a nucleic acid sequence of SEQ ID NOS: 9, 16, 22, 31, 36, 67, 71, 75 andd 81, or a complementary sequence thereof, irrespective of whether theyy have functional activity. This is because even where a particular polynuclleotide does not have functional activity, one of skill in the art would still knoxw how to use the nucleic acid molecule, for instance, as a hybridization probe,:, an S1 nuclease mapping probe, or a polymerase chain reaction (PCR) primer.

Preferred, however, are polynucleotides comprising a nucleic acicid, the sequence of which is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%b, 97%, 98% or 99% identical to a nucleic acid sequence of SEQ ID NOS: 9, 116, 22, 31, 36, 67, 71, 75 and 81, or a complementary sequence thereof, whichh do, in fact, encode proteins which have functional activity.

The present invention further relates to variants of the nucleitic acid molecules of the present invention, which encode portions, analdogs or derivatives of the DNA III subunits and accessory proteins. Variantits may occur naturally, such as a natural allelic variant. By an "allelic variiant" is intended one of several alternate forms of a gene occupying a given locus on a chromosome of an organism. Genes II, Lewin, ed., John Wiley &k Sons, New York (1985).

Non-naturally occurring variants may be produced using art-l-known mutagenesis techniques. Such variants include those produced by nucbleotide substitutions, deletions or additions. The substitutions, deletions or addditions may involve one or more nucleotides. The variants may be altered in coding regions, non-coding regions, or both. Alterations in the coding regionns may produce conservative or non-conservative amino acid substitutions, deeletions or additions. Especially preferred among these are silent substititutions, additions and deletions, which do not alter the properties and activities s of the WO 01/73052 PCT/r/US 1/09950 -47- DNA Pol III subunits and accessory proteins or fragments or portions tithereof.

Also especially preferred in this regard are conservative substitutionss. Most highly preferred are nucleic acid molecules encoding the mature pproteins having the amino acid sequence shown in SEQ ID NOS: 10, 17, 23, 2 32, 37, 68, 72, 76 and 82.

By a polypeptide having an amino acid sequence at least, for exxample, "identical" to a reference amino acid sequence of a polypepptide is intended that the amino acid sequence of the claimed polypeptide is iddentical to the reference sequence except that the claimed polypeptide sequenace may include up to five amino acid alterations per each 100 amino acids of the reference amino acid of the polypeptide. In other words, to obbtain a polypeptide having an amino acid sequence at least 95% identicaal to a reference amino acid sequence, up to 5% of the amino acid residues s in the reference sequence may be deleted or substituted with another amino aciid, or a number of amino acids up to 5% of the total amino acid residues; in the reference sequence may be inserted into the reference sequence. These alterations of the reference sequence may occur at the amino or ccarboxy terminal positions of the reference amino acid sequence or anywhere bbetween those terminal positions, interspersed either individually among residuess in the reference sequence or in one or more contiguous groups within the refeference sequence.

As a practical matter, whether any particular polypeptide is a at least 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to, for innstance, the amino acid sequence shown in SEQ ID NOS: 10, 17, 23, 32, 37, 72, 76 and 82 or to the amino acid sequence encoded by a nucleic acid sequennce can be determined conventionally using known computer programs suuch the Bestfit program (Wisconsin Sequence Analysis Package, Version 8 foDr Unix, Genetics Computer Group, University Research Park, 575 Science Drive, Madison, WI 53711). When using Bestfit or any other sequence aliggnment program to determine whether a particular sequence is, for instancee, identical to a reference sequence according to the present inventidon, the WO 01/73052 PCT/r/US01/09950 -48parameters are set, of course, such that the percentage of identity is caldculated over the full length of the reference amino acid sequence and that ggaps in homology of up to 5% of the total number of amino acid residues in the reference sequence are allowed. See for example, USPN 6,040,1557 and 6,171,816.

For example, the identity between a reference sequence (query sequence, a sequence of the present invention) and a subject sequencce, also referred to as a global sequence alignment, is determined using the FAASTDB computer program based on the algorithm of Brutlag et al. (Compp. App.

Biosci. 6:237-245 (1990)). Preferred parameters used in a FASTDB I amino acid alignment are: Matrix=PAM 0, k-tuple=2, Mismatch Penalty=l, J Joining Randomization Group Length=0, Cutoff Score=l, WVindow Size=sequence length, Gap Penalty=5, Gap Size Penalty=0.05, WVindow Size=500 or the length of the subject amino acid sequence, whichaever is shorter. According to this embodiment, if the subject sequence is shortter than the query sequence due to N- or C-terminal deletions, not because of iinteral deletions, a manual correction is made to the results to take into considderation the fact that the FASTDB program does not account for N- and C-te:erminal truncations of the subject sequence when calculating global percent iddentity.

For subject sequences truncated at the N- and C-termini, relative to thee query sequence, the percent identity is corrected by calculating the numnber of residues of the query sequence that are N- and C-terminal of the subject sequence, which are not matched/aligned with a corresponding 'subject residue, as a percent of the total bases of the query sequence. A determiination of whether a residue is matched/aligned is determined by results of the FASTDB sequence alignment. This percentage is then subtracted frcrom the percent identity, calculated by the above FASTDB program usiring the specified parameters, to arrive at a final percent identity score. Thilis final percent identity score is what is used for the purposes of this emboddiment.

Only residues to the N- and C-termini of the subject sequence, which i are not matched/aligned with the query sequence, are considered for the purpooses of WO 01/73052 PCTA'/U S 1/09950 -49manually adjusting the percent identity score. That is, only query r residue positions outside the farthest N- and C-terminal residues of the s subject sequence. For example, a 90 amino acid residue subject sequence is a aligned with a 100 residue query sequence to determine percent identity. The ddeletion occurs at the N-terminus of the subject sequence and therefore, the FASTDB alignment does not show a matching/alignment of the first 10 residuess at the N-terminus. The 10 unpaired residues represent 10% of the sequence (nnumber of residues at the N- and C-termini not matched/total number of residuess in the query sequence) so 10% is subtracted from the percent identityy score calculated by the FASTDB program. If the remaining 90 residuess were perfectly matched the final percent identity would be 90%. In a another example, a 90 residue subject sequence is compared with a 100 residuee query sequence. This time the deletions are internal deletions so there are no residues at the N- or C-termini of the subject sequence which aare not matched/aligned with the query. In this case the percent identity calculdated by FASTDB is not manually corrected. Once again, only residue poositions outside the N- and C-terminal ends of the subject sequence, as displayedd in the FASTDB alignment, which are not matched/aligned with the query seequence are manually corrected for. See for example, USPN 6,040,157.

Guidance concerning how to make phenotypically silent aminno acid substitutions is provided in Bowie, J. U. et al., "Deciphering the Messsage in Protein Sequences: Tolerance to Amino Acid Substitutions," SScience 247:1306-1310 (1990), wherein the authors indicate that there are twuo main approaches for studying the tolerance of an amino acid sequence to cchange.

The first method relies on the process of evolution, in which mutatidons are either accepted or rejected by natural selection. The second approac.ch uses genetic engineering to introduce amino acid changes at specific positioons of a cloned gene and selections or screens to identify sequences that mnaintain functionality. As the authors state, these studies have revealed that prote:eins are surprisingly tolerant of amino acid substitutions. The authors further irindicate which amino acid changes are likely to be permissive at a certain posi;ition of WO 01/73052 PCT/r/USOI/O9950 the protein. For example, most buried amino acid residues require noonpolar side chains, whereas few features of surface side chains are geonerally conserved. Other such phenotypically silent substitutions are descritibed in Bowie, J. U. et al., supra, and the references cited therein. See for exxample, USPN 6,040,157 and 6,171,816.

The DNA Pol m subunit polypeptides and accessory proteins s of the invention may be expressed in a modified form, such as a fragment or a a fusion protein, and may include not only secretion signals, but also addditional heterologous functional regions. For instance, a region of additional I amino acids, particularly charged amino acids, may be added to the N-terminusis of the polypeptide to improve stability and persistence in the host cell, during purification, or during subsequent handling and storage. Alternatimvely, a region of amino acids may be added to the C-terminus of the polyppeptide.

Methods for adding N-terminal linked peptides and C-terminal linked poeptides are known in the art. Also, peptide moieties may be added to the polyppeptide to facilitate purification. Such regions may be removed prior tao final preparation of the polypeptide. The addition of peptide moiet:ties to polypeptides to engender secretion or excretion, to improve stability and to facilitate purification, among others, are familiar and routine techniques s in the art. Many such peptide moieties are known in the art and contemplated I for use in the practice of the invention herei.

The present invention also provides methods for producing antiti-DNA polymerase III holoenzyme and anti-DNA polymerase n holoenzyme s subunit and anti accessory protein antibodies comprising, exposing an animal I having immunocompetent cells to an immunogen comprising at least an anntigenic portion (determinant) of DNA polymerase III holoenzyme (or holoeenzyme subunit or accessory) protein, under conditions such that immunoconmpetent cells produce antibodies directed against the portion of DNA polymeerase III protein holoenzyme or holoenzyme subunit or accessory protein. In one embodiment, the method further comprises the step of harvestiring the antibodies. In an alternative embodiment, the method comprises the step of WO 01/73052 PCTIT/USOI/09950 -51fusing the immunocompetent cells with an immortal cell line under conoditions such that a hybridoma is produced.

The antibodies used in the methods invention may be preparedd using various immunogens. In one embodiment, the immunogen is; DNA polymerase II holoenzyme or holoenzyme subunit peptide, to ggenerate antibodies that recognize DNA polymerase III holoenzyme or holoe:enzyme subunit(s). Antibodies binding to accessory proteins are preparedd using identical or similar methods. Such antibodies include, but are not limnited to polyclonal, monoclonal, chimeric, single chain, Fab fragments, and a an Fab expression library.

Various procedures known in the art may be used for the produclction of polyclonal antibodies to DNA polymerase Im holoenzyme or holoe:enzyme subunit or accessory proteins. For the production of antibody, variouus host animals can be immunized by injection with the peptide correspondingg to the DNA polymerase III holoenzyme or holoenzyme subunit or accessory I protein epitope including but not limited to rabbits, mice, rats, sheep, goats, etctc. In a preferred embodiment, the peptide is conjugated to an immunogenic carrier diphtheria toxoid, bovine serum albumin (BSA), or keyhole limpet hemocyanin Various adjuvants may be used to increa:ase the immunological response, depending on the host species, including bbut not limited to Freund's (complete and incomplete), mineral gels such as aluuminum hydroxide, surface active substances such as lysolecithin, pluronic ppolyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyaninns, and dinitrophenol.

For preparation of monoclonal antibodies directed toward DNA polymerase III holoenzyme or holoenzyme subunit or accessory proteisin, any technique that provides for the production of antibody molecuhles by continuous cell lines in culture may be used (See, Harlow andd Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory i Press, Cold Spring Harbor, NY). These include but are not limited to the hyboridoma WO 01/73052 PCT/I/USO 1/09950 -52technique originally developed by Kihler and Milstein (Kihler and Mililstein, Nature 256:495-497 [1975]), as well as other techniques known in the anrt.

According to the invention, techniques described for the producCtion of single chain antibodies Patent 4,946,778; herein incorporatated by reference) can be adapted to produce DNA polymerase III holoenzyyme or holoenzyme subunit or accessory protein -specific single chain antibodiees. An additional embodiment of the invention utilizes the techniques describbed for the construction of Fab expression libraries (Huse et al., SScience 246:1275-1281 [1989]) to allow rapid and easy identification of monaoclonal Fab fragments with the desired specificity for DNA polymeraase III holoenzyme or holoenzyme subunit or accessory proteins.

Antibody fragments which contain the idiotype (antigen bbinding region) of the antibody molecule can be generated by known techniquaes. For example, such fragments include but are not limited to: the F(ab')2 fraagment which can be produced by pepsin digestion of the antibody molecule; tithe Fab' fragments which can be generated by reducing the disulfide bridges of the F(ab')2 fragment, and the Fab fragments which can be generated by trtreating the antibody molecule with papain and a reducing agent.

In the production of antibodies, screening for the desired antiboody can be accomplished by techniques known in the art radioimmunooassay, ELISA [enzyme-linked immunosorbent assay], "sandwich" immunooassays, immunoradiometric assays, gel diffusion precipitin reaactions, immunodiffusion assays, in situ immunoassays [using colloidal gold, eenzyme or radioisotope labels, for example], Western Blots, precipitation rea'actions, agglutination assays gel agglutination assays, hemagglutination i assays, etc.), complement fixation assays, immunofluorescence assays, probtein A assays, and immunoelectrophoresis assays, etc.

In one method, antibody binding is detected by detecting a label :1 on the primary antibody. In another method, the primary antibody is deteccted by detecting binding of a secondary antibody or reagent to the primary anttibody.

In a further method, the secondary antibody is labeled. Many meaans are WO 01/73052 PCT/T/USO 1/0995( -53known in the art for detecting binding in an immunoassay and are wittthin the scope of the present invention. (As is well known in the art, the immuncogenic peptide should be provided free of the carrier molecule used iiin any immunization protocol. For example, if the peptide was conjugated to KKLH, it may be conjugated to BSA, or used directly, in a screening assay.) The foregoing antibodies can be used in methods known in t the art relating to the localization and structure of DNA polymerase III holoeenzyme or holoenzyme subunit or accessory protein for Western blootting), measuring levels thereof in appropriate biological samples, etc. The bioblogical samples can be tested directly for the presence of DNA polymeraase II holoenzyme or holoenzyme subunit or accessory protein using an apprcropriate strategy ELISA or radioimmunoassay) and format micrcrowells, dipstick as described in International Patent Publication WO 93/003367], etc.). Alternatively, proteins in the sample can be size separated by polyacrylamide gel electrophoresis (PAGE), in the presence or not of s.sodium dodecyl sulfate (SDS), and the presence of DNA polymerase III holoeenzyme or holoenzyme subunit detected by immunoblotting (Western bldotting).

Immunoblotting techniques are generally more effective with antitibodies generated against a peptide corresponding to an epitope or antatigenic determinant of a protein, and hence, are particularly suited to the p present invention.

The present invention provides isolatd DNA polymeraase I holoenzyme subunits and accessory proteins from a thermophilic orgganism.

In preferred embodiments, the thermophilic organism is a thermcophilic organism. The thermophilic organism can be selected from a member r of the genera Thermus, Thennotoga, and Aquifex.

The present invention also provides full-length polypeptiddes or proteins. The invention also provides methods for providing, ass well, fragments of any size of the protein the entire amino acid sequencee of the protein, as well as short peptides). Primers and gene amplification techhniques are used to amplify the nucleotide sequence encoding the nucleotide reggion of WO 01/73052 PCT//USO 1/09951 -54interest, which upon ligation into a vector and transfection into a hoost cell, results in expression of the protein or peptide of interest.

The invention is directed to an isolated polypeptide whereitin said polypeptide comprises an amino acid sequence having at least 95% seequence identity to the amino acid sequence of SEQ ID NO: (uvrD helicase) 68. In one embodiment, the polypeptide has the amino acid sequence of SEQ ID NNO: 68.

In another embodiment, the invention is directed to an isolated polynucjcleotide molecule comprising a nucleotide sequence encoding a polyppeptide comprising an amino acid sequence having at least 95% sequence idenntity to the amino acid sequence of SEQ ID NO: (uvrD helicase) 68. In a dififferent embodiment, the isolated polynucleotide molecule comprises a nucbleotide sequence having the sequence of SEQ ID NO: 67. The inventioon also provides a vector comprising a polynucleotide encoding the polygppeptide comprising an amino acid having at least 95% sequence identity to the e amino acid sequence of SEQ ID NO: (uvrD helicase) 68. The inventioon also provides a host cell comprising a vector comprising a nucleotide seequence encoding a polypeptide comprising an amino acid sequence having a at least sequence identity to the amino acid sequence of SEQ ID NO: (uvrD helicase) 68 In one embodiment, the polypeptide is a uvrD helicase from a thermophilic organism. In a different embodiment, the thermophilic orgganism is Thennus thermophilus.

The invention is also directed to an isolated polypeptide where:ein said polypeptide comprises an amino acid sequence having at least 95% seequence identity to the amino acid sequence of SEQ ID NO: (DNA-G Primase):) 72. In one embodiment, the polypeptide has the amino acid sequence of SEQ IID NO: 72. The invention also provides an isolated polynucleotide moolecule comprising a nucleotide sequence encoding a polypeptide comprisising an amino acid sequence having at least 95% sequence identity to the amirino acid sequence of SEQ ID NO: (DNA-G Primase) 72. In one embodime:ent, the isolated polynucleotide molecule comprises a nucleotide sequence haviving the sequence of SEQ ID NO: 71. The invention also provides a vector WO 01/73052 PCT/AVUS01/0995(0 comprising a nucleotide sequence encoding a polypeptide comprisising an amino acid sequence having at least 95% sequence identity to the aminno acid sequence of SEQ ID NO: (DNA-G Primase) 72. The invention also provides a host cell comprising the vector. In one embodiment, the isolated polypepptide is a DNA G primase from a thermophilic organism. In another embodimelent, the thermophilic organism is Tlermus thermophilus.

The invention also provides an isolated polypeptide whereitin said polypeptide comprises an amino acid sequence having at least 95% seequence identity to the amino acid sequence of SEQ ID NO: (priA helicase) 76. In one embodiment, the polypeptide has the amino acid sequence of SEQ ID NNO: 76.

The invention also provides an isolated polynucleotide molecule compnrising a nucleotide sequence encoding a polypeptide comprising an aminoo acid sequence having at least 95% sequence identity to the amino acid sequeence of SEQ ID NO: (priA helicase) 76. In one embodiment, the icisolated polynucleotide molecule comprises a nucleotide sequence having the seequence of SEQ ID NO: 75. The invention further provides a vector comprirising a nucleotide sequence encoding a polypeptide comprising an aminno acid sequence having at least 95% sequence identity to the amino acid sequeence of SEQ ID NO: (priA helicase) 76. The invention provides a host cell compprising the vector. In one embodiment, the isolated polypeptide is a priA hhelicase from a thermophilic organism. In another embodiment, the thermoophilic organism is Thennus thennophilus.

The invention provides an isolated polypeptide whereirin said polypeptide comprises an amino acid sequence having at least 95% seequence identity to the amino acid sequence of SEQ ID NO: (delta subunit) In one embodiment, the polypeptide has the amino acid sequence of SEQ ID NNO: The invention also provides an isolated polynucleotide molecule compnrising a nucleotide sequence encoding a polypeptide having at least 95% seequence identity to the amino acid sequence of SEQ ID NO: (delta subunit) In one embodiment, the isolated polynucleotide molecule has the sequence oof SEQ ID NO: 9. The invention provides a vector comprising a nucleotide seequence WO 111/73052 PCTf/US 1/09950 -56encoding a polypeptide comprising an amino acid sequence having aiat least sequence identity to the amino acid sequence of SEQ ID NO: (delta subunit) 10. The invention provides a host cell comprising said vector. In one embodiment, the isolated polypeptide is a delta subunit from a thermoophilic organism. In one embodiment, the thermophilic organism is 7Th'7ermus thernophilus. The invention further provides an isolated antibody moblecule, wherein said antibody specifically binds to at least one antigenic detenrminant on a polypeptide which comprises an amino acid sequence having at leaast sequence identity to the amino acid sequence of SEQ ID NO: (delta suubunit) The invention provides an isolated polypeptide whereinn said polypeptide comprises an amino acid sequence having at least 95% secquence identity to the amino acid sequence of SEQ ID NO: (delta prime subunnit) 17.

In one embodiment, the polypeptide has the amino acid sequence of SBEQ ID NO: 17. The invention is further directed to an isolated polynuctleotide molecule comprising a nucleotide sequence encoding a polyppeptide comprising an amino acid sequence having at least 95% sequence idenntity to the amino acid sequence of SEQ ID NO: (delta prime subunit) 17. 1 In one embodiment, the isolated polynucleotide molecule has the sequence oof SEQ ID NO: 16. The invention also provides a vector comprising a nucbleotide sequence encoding a polypeptide comprising an amino acid sequence 1 having at least 95% sequence identity to the amino acid sequence of SEQ IIID NO: (delta prime subunit) 17. The invention further provides a host cell compprising the vector. In one embodiment, the isolated polypeptide is a 6' subunit I from a thermophilic organism. In another embodiment, the thermophilic organnism is Thennus thermophilus. The invention further provides an isolated anntibody molecule, where in said antibody specifically binds to at least one antatigenic determinant on the polypeptide which comprises an amino acid secquence having at least 95% sequence identity to the amino acid sequence of SBEQ ID NO: (delta prime subunit) 17.

WO 01/73052 PCT/f/US01/09950 -57- The invention is directed to an isolated polypeptide whereiiin said polypeptide comprises an amino acid sequence having at least 95% seqquence identity to the amino acid sequence of SEQ ID NO: (beta subunit) 23. In one embodiment, the polypeptide has the amino acid sequence of SEQ ID NNIO: 23.

The invention is also directed to an isolated polynucleotide maolecule comprising a nucleotide sequence encoding a polypeptide comprisi;ing an amino acid sequence having at least 95% sequence identity to the aminno acid sequence of SEQ ID NO: (beta subunit) 23. In one embodiment, the isisolated polynucleotide molecule has the sequence of SEQ ID NO: 22. The invvention further provides a vector comprising a nucleotide sequence encooding a polypeptide comprising an amino acid sequence having at least 95% secquence identity to the amino acid sequence of SEQ ID NO: (beta subunit) 223. The invention also provides a host cell comprising the vector. In one emboddiment, the isolated polypeptide of is a 8' subunit from a thermophilic organihism. In another embodiment, the thermophilic organism is Thennus thennophildus. The invention further provides an isolated antibody molecule, whereirin said antibody specifically binds to at least one antigenic determinant t on a polypeptide comprising an amino acid sequence having at least 95% secquence identity to the amino acid sequence of SEQ ID NO: (beta subunit) 23.

The invention is directed to an isolated polypeptide whereiiin said polypeptide comprises an amino acid sequence having at least 95% secquence identity to the amino acid sequence of SEQ ID NO: (ssb protein) 32.. In one embodiment, the polypeptide has the amino acid sequence of SEQ ID NNO: 32.

The invention is also directed to an isolated polynucleotide moolecule comprising a nucleotide sequence encoding a polypeptide comprisising an amino acid sequence having at least 95% sequence identity to the aminno acid sequence of SEQ ID NO: (ssb protein) 32. In one embodiment, the iisolated polynucleotide molecule has the sequence of SEQ ID NO: 31. The invvention further provides a vector comprising a nucleotide sequence encooding a polypeptide comprising an amino acid sequence having at least 95% seequence identity to the amino acid sequence of SEQ ID NO: (ssb protein) 322. The WO 01/73052 PCT/TI/US01/09950 -58invention provides a host cell comprising the vector. In one embodimetent, the isolated polypeptide is an SSB protein from a thermophilic organisism. In another embodiment, the thermophilic organism is Thennus thennophildus. The invention further provides an isolated antibody molecule, whereitin said antibody specifically binds to at least one antigenic determinant (on the polypeptide which comprises an amino acid sequence having at leasist sequence identity to the amino acid sequence of SEQ ID NO: (ssb protei:in).

The invention is directed to an isolated polypeptide whereitin said polypeptide comprises an amino acid sequence having at least 95% seequence identity to the amino acid sequence of SEQ ID NO: (epsilon-1, dnaQ-1).) 37. In one embodiment, the polypeptide has the amino acid sequence of SEQ LID NO: 37. The invention is further directed to an isolated polynucleotide mcolecule comprising a nucleotide sequence encoding a polypeptide comprisising an amino acid sequence having at least 95% sequence identity to the aminno acid sequence of SEQ ID NO: (epsilon, dnaQ-1) 37. In one embodimeent, the isolated polynucleotide molecule has the sequence of SEQ ID NO: 3,36. The invention also provides a vector comprising a nucleotide sequence encooding a polypeptide comprising an amino acid sequence having at least 95% seequence identity to the amino acid sequence of SEQ ID NO: (epsilon, dnaQ-1) 337 The invention further provides a host cell comprising the vector. ILIn one embodiment, the isolated polypeptide is an epsilon-1 subunit fifrom a thermophilic organism. In another embodiment, the thermophilic organnism is Thennus thermophilus. The invention further provides an isolated anntibody molecule, where in said antibody specifically binds to at least one anitigenic determinant on a polypeptide which comprises an amino acid sequence b having at least 95% sequence identity to the amino acid sequence of SEQ IIID NO: (epsilon, dnaQ-1) 37.

The invention is directed to an isolated polypeptide whereiin said polypeptide comprises an amino acid sequence having at least 95% seequence identity to the amino acid sequence of SEQ ID NO: (dnaQ-2) 82. 1 In one embodiment, the polypeptide has the amino acid sequence of SEQ ID 'NO: 82.

WO 01/73052 PCT/r/U SO 1/09950 -59- The invention is further directed to an isolated polynucleotide moolecule comprising a nucleotide sequence encoding a polypeptide comprisising an amino acid sequence having at least 95% sequence identity to the aminno acid sequence of SEQ ID NO: (dnaQ-2) 82. In one embodiment, the isisolated polynucleotide molecule has the sequence of SEQ ID NO: 81. The invvention is further directed to a vector comprising a nucleotide sequence encooding a polypeptide comprising an amino acid sequence having at least 95% seequence identity to the amino acid sequence of SEQ ID NO: (dnaQ-2) 822. The invention is also directed to a host cell comprising the vector. I In one embodiment, the isolated polypeptide is an epsilon-2 subunit fifrom a thermophilic organism. In another embodiment, the thermophilic organnism is Thermus thermophilus. The invention further provides an isolated anntibody molecule, where in said antibody specifically binds to at least one anttigenic determinant on a polypeptide which comprises an amino acid sequence i having at least 95% sequence identity to the amino acid sequence of SEQ DID NO: (epsilon-2, dnaQ-2) 82.

The invention is directed to a method of producing a polyppeptide encoded by a nucleotide sequence, wherein said polypeptide compririses an amino acid sequence having at least 95% sequence identity to the aminno acid sequence of one of SEQ ID NOS: 68, 72, 76, 10, 17, 23, 32, 37, aand 82, comprising culturing a host cell comprising said nucleotide sequencee under conditions such that said polypeptide is expressed, and recoverinng said polypeptide.

The invention is also directed to a method of synthesizing DNA\ which comprises utilizing one or more polypeptides, said one or more polypoeptides comprising an amino acid sequence having at least 95% sequence idenntity to an amino acid sequence selected from the group consisting of SEQ IDD NOS: 68, 72, 76, 10, 17, 23, 32, 37 and 82. In one embodiment, the method I further comprises providing in any order: a reaction mixture comprising compponents comprising template, and nucleotides, and incubating said reaction mixt'ture for a length of time and at a temperature sufficient to obtain DNA syntheesis. In WO 01/73052 PCT/f/U SO 1/09950 another embodiment of the method, the method further comprises an Nterminal linked peptide or a C-terminal linked peptide.

It is contemplated that purified DnaQ-1 protein (epsilon subunit t 1) and DnaQ-2 (epsilon subunit 2) find use in PCR and other applications in i which high fidelity DNA synthesis is required or desirable. Althoupgh an understanding of the mechanism is not necessary in order to use the ppresent invention, DnaQ-1 protein or DnaQ-2 protein bind to the a subunit ofif DNA polymerase III, and works with it to efficiently remove errors made 1 by the DNA polymerase iI.

It is also contemplated that DnaQ-1 or DnaQ-2 will find use inn place of an adjunct proofreading polymerase in PCR and other amplifification amplifications. For example, when combined in an amplification re-eaction with a DNA polymerase that lacks a proofreading exonuclease, the DnaaQ-l or DnaQ-2 will facilitate elongation of PCR product as it is capable of remnoving mismatches within the PCR product. Thus, it is contemplated that the p present invention (DnaQ-1 or DnaQ-2 will find use in such applications asts longrange PCR PCR involving 5-50 kb targets).

It is contemplated that the DnaN protein will find use in purificalation of the p subunit the critical subunit that permits pol I to cataalyze a processive long-distance without dissociating) amplification reeaction.

DnaN is useful with pol III alone ax or a plus E) on linear tempblates in the absence of additional subunits, or it can be used with the DnaX conmplex, as well as with additional proteins single-stranded binding preroteins, helicases, and/or other accessory factors), to permit very long PCR reactitions.

It is contemplated that the a subunit, 0 subunit, 8 subunit, 5' suubunit, e-1 subunit, e-2 subunit, y subunit, T subunit, ssb protein, uvrD proteinn, dnaG protein, and priA protein will find use separately or together in PCR anad other applications in which high fidelity DNA synthesis is required or dessirable, such as, for example, very long PCR reactions (5-50 kb targets). It is i further contemplated that the foregoing N-terminal or C-terminal linked subunnits and proteins will find use separately or together in PCR and other applicatitions in WO 01/73052 PC'T/r/U SO /09950) -61which high fidelity DNA synthesis is required or desireable, such as for example, very long PCR reactions (5-50kb).

Existing PCR technology is limited by relatively non-proocessive repair-like DNA polymerases. The present invention provides a thermoophilic replicase capable of rapid replication and highly processive properlrties at elevated temperatures. It is contemplated that the compositions of the U present invention will find use in many molecular biology applications, inc.cluding megabase PCR by removing the current length restrictions, long range;e DNA sequencing and sequencing through DNA with high secondary structiture, as well as enabling new technological advances in molecular biology.

All patents and publications referred to herein are exppressly incorporated by reference in their entirety.

EXAMPLES

The following examples serve to illustrate certain prcreferred embodiments and aspects of the present invention and are not to be connstrued as limiting the scope thereof.

In the experimental disclosure which follows, the follllowing abbreviations apply: g (gram); L (liter); Ag (microgram); ml (millilit(ter); bp (base pair); °C (degrees Centigrade); kb or Kb (kilobases); kDa or kd (kilodaltons); EDTA (ethylenediaminetetraacetic acid); DTT (dithiothireitol); LB (Luria Broth); -mer (oligomer); DMV (DMV International, Frazier:r, NY); PAGE (polyacrylamide gel electrophoresis); SDS (sodium dodecyl suulfate); SDS-PAGE (sodium dodecyl sulfate polyacrylamide gel electrophQoresis); SSPE (2x SSPE contains 0.36 mM NaC1, 20 mM NaH 2

PO

4 pH 7.4, and mM EDTA, pH 7.4; the concentration of SSPE used may vary), SOP media g/1 tryptone (Difco), 10 g/1 yeast extract (Difco), 5 g/l NaCI, 2.5 g/1 potassium phosphate, dibasic (Fisher), 1 g/l MgSO 4 7H20 (Fisher), pbH 7.2); TE buffer (10 mM Tris, 1 mM EDTA); 50 x TAE (242 g Tris base, 557.1 ml WO 101/73052 PCT//U SO 1/09950 -62glacial acetic acid, 100 ml 0.5 M EDTA pH Blotto (10% skinm milk dissolved in dH20 and 0.2% sodium azide); Gel Loading Dye Bromophenol blue, 0.25% xylene cyanol, 25% Ficoll (Type 400) in c Pre-hybndization mix (50% Formamide, 5X SSPE, 1% SDS,, 5 CARNATION M non-fat dried milk, 10% skim milk, 0.2% Na Azide); FBS O (fetal bovine serum); ABS, Inc. (ABS, Inc., Wilmington, DE); GenaeCodes (GeneCodes, Ann Arbor, MI); Boehringer Mannheim (Boehringer Mannnheim, SIndianapolis, IN); Champion Industries (Champion Industries, Cliftonn, NJ); Organon (Organon Teknika Corp., Durham NC); Difco (Difco, Detroiit, MI); Enzyco (Enzyco Inc., Denver, Co); Fisher Scientific (Fisher Scientifiic, Fair Lawn, NJ); FMC (FMC, Rockland, Maine); Gibco BRL (Gibcoo BRL Gaithersburg, MD); Hyclone (Hyclone, Logan UT); Intermountain c or ISC (ISC BioExpress, Bountiful, Utah); Invitrogen (Invitrogen, Carlsbadd, CA); Millipore (Millipore, Marlborough, MA); MJ Research (MJ Reesearch, Watertown, MA); Molecular Probes (Molecular Probes, Eugene,:, OR); National Diagnostics (National Diagnostics, Manville, NJ); Pharmacia EBiotech (Pharmacia Biotech., Piscataway, NJ); Promega (Promega Corp., Mdadison, WI); Qiagen (Qiagen, Chatsworth, CA); Sigma PE/ABI (Perkin Elmer Applied Biosystems Division, Foster City, CA); (Sigma, St. Louis,;, MO); Stratagene (Stratagene, LaJolla CA); Tecan (Tecan, Research Trianglde Park, NC); Whatman (Whatman, Maidstone, England); Lofstrand Labs (LoDfstrand Labs, Ltd., Gaithersburg, Maryland) and LSPI (LSPI Filtration Productts, Life Science Products, Denver, CO); Irvine (Irvine Scientific, Irvine CAA); and Jackson Labs (Jackson Labs, Bar Harbor, Maine).

In Examples in which a molecular weight based on SDS-PAGE gels is reported for a protein, the molecular weight values reported are approoximate values.

WO 01/73052 PCT/r/US01/09950 -63- EXAMPLE 1 Construction of Starting Vectors Construction of pAl-CB-Cla-2 Plasmid pAl-CB-Cla-1 was described in U.S. Patent Applilication 09/151,888, incorporated herein by reference. For the pAl-CB-Cla-1 pplasmid to be useful for expression of several of the T. thennophilus genes, modifications were needed. To remove a Kpnl restriction site downstrcream of the C-terminal biotin tag, pAl-CB-Cla-1 plasmid DNA was prepareed. All plasmid DNA preparations listed here and below were purified 1 using Promega's Wizard® and Wizard® Plus DNA Purification Systems accorcrding to instruction from manufacturer. The pAl-CB-Cla-1 DNA plasmidsls were digested with KpnI. The resulting 3' and 5' overhanging ends were reemoved by filling in with Klenow fragment and resealed with T4 DNA ligasee in the presence of 1 mM ATP. Plasmids were transformed into DHSc, and pllasmidcontaining colonies were selected for ampicillin-resistance. Growth of s starting vector are in 2xYT culture media (16 g/L bacto-tryptone, 10 g/L bactcto-yeast extract, 5 g/L NaCl (pH 7.0) here and in following sections. Destructionn of the KpnI site in these plasmids was confirmed by DNA sequencing (ATCG seq.# 630-631; primers P64-A215 and P38-S5576). One of the coloniies that contained isolates that could not be cleaved by KpnI was selected, growwn, and used for preparation of the intermediate plasmid pAl-CB-Clal(Kpn-)) (ATG glycerol stock #424). Subunits of T. thennophilus DNA polymeraase II holoenzyme were expressed in E. coli host cells. Nucleic acid (plasmidds) may be introduced into bacterial host cells by a number of means inacluding transformation of bacterial cells made competent for transformatition by treatment with calcium chloride or by electroporation. A review of thee use of transformation techniques is provided in Sambrook et al., Molecular CCloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Presss, New WO 01/73052 PCT/flUSOl/09950 -64- York (1989) pp.1.74-1.

8 4 The strategy used to introduce plasmids into bacteria here is also used in all following similar transformation reactionns.

The plasmid pAl-CB-Clal(Kpn) was digested with the resttriction endonucleases ClaI and Spe to remove the polylinker containiring the restrictions sites EagI, BamnHI, XhoI, XbaII and DraIll. Two oligonucldeotides (ATG linker/adaptor #P67-S1 and P67-A1) were annealed to fonrm the adaptor/linker (shown below) (SEQ ID NO: 1).

AAAAAAAAGG CCGGCCGCTA GCGGTACCA-3' 3'-TAT TTTTTTTTCC GGCCGGCGAT CGCCATGGTG This adaptor/linker contained ClaI and Spel sticky ends to) allow insertion into these restriction sites present on the plasmid pAl-CEB-Clal The introduction of this adaptor/linker into Clal /SpcI digestecd pAl- CB-Clal(Kpn-) formed a new polylinker containing the restriction sitees ClaIspacer-Fse-Nhe KpnI-SpeI and resulted in a new plasmid pAl-CB-3-Cla-2.

This plasmid was transformed into DH5 and plasmid containing ccolonies were selected by ampicillin-resistance. Plasmids were isolated fronm one positive clone and the sequence of the inserted DNA was confirmed byy DNA sequencing (ATG seq.# 649, primer P38-S5576). The isolate containihing the confirmed pAl-CB-Cla-2 plasmid was grown and stored as a stock culture (ATG glycerol stock #440).

Construction of pAl-CB-Nco-1 To construct pAl-CB-Nco-l pDRK-C was first modified (Seee, Kim, D.R. and McHenry,C.S. (1996) 1 Biol Chem 271, 20690-20698). PPlasmid pDRKC DNA was prepared and digested with KpnI. The resulting reecessed and overhanging 3' ends were blunted with Klenow fragment and the pplasmid was resealed. Plasmids were transformed into DH5ca and plasmid-contitaining colonies were selected by ampicillin-resistance. The plasmids were pnrepared and screened for loss of the KpnI site. One positive clone containing a pplasmid WO 01/73052 PCT/T/USOI/09950) that could not be cleaved by KpnI was selected and the DNA sequenoce was M confirmed by DNA sequencing (ATG SEQ 627 and 632; primers P38--S5576 and P64-A215). This plasmid was named pDRK-C (Kpn-) and the isolaate was NO stored as a glycerol stock culture (ATG glycerol stock #414).

The plasmid pDRK-C (Kpn-) was digested with reststriction C endonucleases XbaI and SpeI to remove the polylinker containining the restriction sites NcoI, EagI, and DrafI. Two oligonucleotides (ATG Slinker/adaptor #P63-S 1 and P63-A1) were annealed to form the adaptorr/linker (shown below) (SEQ ID NO:2).

-CTAGAGGAGGTTAATTAACCATGGAAAAAAAAAGGTACCAAAAAAAAAGGCCGGCCCA-3' 3' This adaptor/linker contained Xbal and Spel sticky ends to) allow insertion into the corresponding restriction sites present on the pDDRK-C (Kpn-) plasmid. The plasmid containing the inserted region was resealied and transformed into DHSc. The introduction of this adaptor/linker into pEDRK-C (Kpn-) formed a new polylinker containing the restriction sites XbaII-Pacl- Ncol-spacer-KpnI-spacer-FseI-SpeI. The resulting ampicillin-resistant t clones were screened for introduction of a KpnI restriction site. The plasmidid from one positive clone was sequenced and was found to have the correct seequence in the region of the inserted linker/adaptor (ATG SEQ 646 and 647; pprimers p38-S5576 and P65-A106). This plasmid was named pAl-CB-Nco-1-1. This isolate was grown and stored as a stock culture (ATG glycerol stock #4338).

Construction of pAl-CB-Nsi 1 To prepare the pAl-CB-Nsil plasmid, pAl-CB-Nco-l was diligested with restriction endonucleases PacI and KpnI to remove the polblylinker containing the restriction sites PacI-NcoI-spacer-KpnI. Two oligonuclleotides (ATG linker/adaptor #P68-S1 and P68-Al) were annealed to fonrm the adaptor/linker (shown below) (SEQ ID NO:3).

WO 01/73052 PCT//USO 1/09950 -66- -TTAAATGCATAAAAAAAAAGGTAC-3' This adaptor/linker contained Pac and KpnI sticky ends to allow insertion into the corresponding PacI/KpnI digested pAl-CB-Nco-1 pblasmid.

The plasmid was resealed and transformed into DHSa. Introduction of this adaptor/linker into pAl-CB-Nco-1 formed a new polylinker containiiing the restriction sites XbaI-PacI-NsiI-spacer-KpnI-spacer-FseI-SpeI. Thee only change was replacement of the NcoI restriction site with an Nsil reststriction site. The resulting clones were selected for ampicillin-resistance and isisolated plasmids were screened for introduction of an NsiI restriction sitete. The plasmid from one positive isolate was sequenced and was found to haave the correct sequence in the region of the inserted linker/adaptor (ATG SEQ 663, primer P65-A106). This plasmid was named pAl-CB-Nsi-1 and the isolate was grown and stored as a stock culture (ATG glycerol stock #445).

Construction of pAl-CB-NdeI To construct plasmid pAl-CB-NdeI, pAl-CB-NcoI was digeste:ed with NdeI. The overhanging ends were blunted with Klenow fragment to c destroy the NdeI restriction site outside of the polylinker region. The linear pplasmid was resealed forming pAl-CB-NcoI(NdeI-). This plasmid was transisformed into DH5a and plasmids were isolated from one resulting ampicillin-reesistant colony. The plasmids were screened for loss of a Ndel site. The region fifilled in by Klenow fragment was sequenced to confirm the loss of the NdeI site:e (ATG SEQ 661, primer P65-S2529). pAl-CB-NcoI(NdeI-) was digested witlth Pac and SpeI restriction enzymes. This removed the polylinker containingg PacI- NcoI-spacer-KpnI-spacer-FseI-SpeI restriction sites. An annealed DNA k duplex or adaptor/linker (shown below) (SEQ ID NO:4) containing Pad annd Spel sticky ends (ATG linker/adaptor P65-S1 and P65-A1) was inserted irinto the digested pAl-CB-NcoI(NdeI-) plasmid.

WO 01/73052 WO 0173052PCT/r/1JS0 /09950 -67 -TAACATATG'AAAAAACCAGGTTGCTAGCGGTACCA-3' 3' The introduction of this adaptor/linker into pAl-CB-NcoICi(NdeIf) formned a new polylinker containing the restriction sites PacI-NdeI-s- spacer- NheI-KpnI-FseI-SpeI. This plasmnid was transformed into DH5oc annd the plasmiids were isolated from one resulting ampicillin -resistant colony. These plasmids were screened for the introduction of a NdeI site. The :region containing the inserted sequence was subjected to DNA sequencing to cconfirm insertion of the correct sequence (ATG SEQ #7 18, primer P38-S5576).). This plasmid was named pAl-CB-NdeI and the positive isolate was gro\&wn and stored as a stock culture (ATG glycerol stock #464) Construction of pAl-NB-Avr-2 To construct pAl-NB-Avr-2, DRK-N(M), a plasmid designeied for expression of proteins with an amino-terminal tag was used as the sistarting plasmid. The amnino-terminal tag is composed of a 30 amino acid peptidde that is biotinylated in vivo, a hexahistidine site, and thrombin cleavage sitfte (See, Kim and McHenry, J. Biol. Chem., 271:20690-20698 [1996]). Also, theere is a pBR322 origin of replication, a gene expressing the laqIQ repressor pprotein, and a semnisynthetic E. coli promoter (pAl) that is repressed by thee lacIQ repressor.

The following two oligonucleotides were separately synthniesized, annealed to form a duplex with sticky ends (Avrll and Sall), and insert~ted into the AvrllSalI digested pDRK-N(M). The synthetic linker/adaptor consisisted of two annealed oligonucleotides (ATG linker/adaptor P64-SI and Pe64-A 1) (shown below) (SEQ ID -CTAGGAAAAAAAAAGGTACCAAAAAAAAAGGCCGGCCACTAGTG-3' 3' WO 01/73052 PCT//USO 1/09950 -68- The insertion of these annealed DNA fragments into pDRKC-N(M) converted the polylinker following the fusion peptide from AvrlI-DraDllI-Sal to AvrlI--spacer--KpnI--spacer--FseI--SpeI--SalIl. These plasmids were transformed into DH5a and the resulting ampicillin-resistant colonies were screened for plasmids that contained a SpeI site carried by the linker/aadaptor.

One positive clone was selected and the sequence of the inserted regidcion was confirmed by DNA sequencing across the linkerladaptor region (ATCG SEQ #648, primer P64-A215). This plasmid was named pAl-NB-Avr-2 aiand the isolate was grown and stored as a glycerol stock culture (ATG glycerobl stock #439).

Construction of pAl-NB-Kpnl1 The pAl-NB-Avr-2 plasmid was modified to construct pAl-NBB-Kpnl by replacing the polylinker containing the Avrll--spacer--KpnI--spacer----Fse-- SpeI--Sall with a polylinker containing the restriction sites Pstl-KpnI-SSpacer- Nsil-SacI-Nhe-HindllI-spacer-SpeI. This was accomplished by digestition of pAl-NB-Avr-2 with PstI and Spel restriction enzymes and insertion I of the annealed DNA duplex shown below (ATG adaptor/linker P64--S1 anad P64- Al). The ends of the annealed duplex DNA formed sticky ends correspoonding to PstlISpeI restriction sites (shown below) (SEQ ID NO:6).

-GGTACCAAAAATGCATGAGCTCGCTAGCAAGCTTAAAAAAAAA-3' 3' The first spacer allows PstlINsil double digests and the last: spacer allows HindfflSpel double digests. The plasmids were transformeed into bacteria and ampicillin-resistant colonies were screened for plhlasmnids that contained HindM restriction site carried by the linker/adaptor. Thee DNA sequence of the linker/adaptor region was confirmed by DNA sequuencing WO 01/73052 WO 0173052PC'I'il'/USO 1/09950 69 (ATG SEQ #662, primer P64-A215). This plasmid was named pAl-NEB-Kpn- 1 and the isolate was grown and stored as a glycerol stock culture (ATG glycerol stock #446).

of pAl-NB-AgeI The pAl-NB-Avr-2 plasmid was modified to construct pAl-NBB-AgeI.

This was done by replacing the polylinker in pAl-NB-Avr-2 which coTnntained the restriction sites Pstl-AvrII-KpnI-FseI-SpeI with a polylinker containhing the restriction sites PstI-spacer-AgeI-BamI{1I-SacII-spacer-NcoI-SpeI. Hiirst, a BamIAI site upstream of the polylinker was destroyed. This was accompplished by digesting pAl-N-B-Avr-2 with BarnHI and filling in the sticky ends c created by the digestion with Kienow fragment. The blunted ends of the DNAA were resealed. The plasmid was transformed into DH5Qx and positive isolatees were selected by ampicilIIin -resistance. Plasmi ds were isolated from one ppositive isolate and were screened for by the loss of the Bamll restriction sitite. The loss of the BainHIl restriction site was confirmed by DNA sequencingg (ATG SEQ #1171, primer P64-A215). This plasm-id was named pAMl-NB- Avr2(BarnET) and the positive isolate was stored as a stock culturef. (ATG glycerol stock #688).

pAl-NB-Avr2(BamInHT) was digested with PsIIISpeI reststniction enzymes. This removed the polylinker containing the restriction site.es PstI- Arv-Kpnil-Fsel-SpeI. An annealed duplex (ATG adaptor/linker #P1 164~-S 1 and P116-Al) (shown below) was inserted into digested pAl-NB-Avr2(B3amHVl) (SEQ ID NO:7).

-GAAAAAAAAAACCGGTGGATCCGCGGAAAAAAAACCATGGA-3' 3' -ACGTCTTTTTTTTTTGGCCACCTAGGCGCCTTTTTTTTGGTACCTGATC- The ends of the annealed duplex DNA forms stickyy ends cooresponding to PstI and SpeI restriction sites. This plasmid was transisformed WO 01/73052 PCT/I/USO1/09950 into DH5ac and plasmids isolated from the growth of one clone were sc;creened for by the ability to be digested with AgeI, BamHI, SacI and NcoI reststriction enzymes. The sequence of the inserted region in this plasmid was connfirmed by DNA sequencing (ATG SEQ #1176, primer #P64-A215). This plasmnid was named pAl-NB-AgeI and the positive isolate was stored as a stock culture (ATG glycerol stock #698).

Construction of pTAC-CCA-ClaI In an attempt to express native proteins from T. thennophilus in i E. coli that have not expressed well, a vector system was constructed that can bbe used to express proteins as translationally coupled proteins. Plasmid (pTA\CCCA (pTC9) contains a gene encoding E. coli ATP(CTP):tRNA nuclcleotidyl transferase (referred to as CCA adding enzyme) under control off a tac promoter. This gene is expressed at very high levels. All of this genne was removed except the 5' 12 codons so that the T. thermophilus dnaE genne could be coupled to this remaining 5' end as a translationally coupled protein (pTAC-CCA-TE) (discussed below). Beginning with the plasmid I pTAC- CCA-TE, a plasmid was designed containing a polylinker that willll allow insertion of other target proteins that can be expressed as translatitionally coupled proteins. First, pTAC-CCA-TE was digested with Nsil and SpeeI. The NsiI restriction site is approximately 35 nucleotide downstream of thoe CCA adding enzyme start ATG and the SpeI is downstream of the T. thennaophilus dnaE stop TAG. This removed the entire T. thernmophilus dnaE (TE) geene and the region linking the CCA adding enzyme gene 5' end to the TE gene. Next, the annealed DNA duplex (below) (SEQ ID NO:8) (ATG adaptonr/linker #P152-SL and P152-AL), containing NsiI and Spel sticky ends was iiinserted into the digested pTAC-CCA-TE plasmid.

5 -TTGAGGAGGTATCGAtaaAAAAACCGGTCCTAGGCTAGCTCGAGA- 3 3' WO 01/73052 PCTIr/US1I/09950 -71- This DNA duplex contains "AGGAGG" (italics), the ribosome bbinding site (RBS), downstream of the NsiI sticky end, followed by a ClaI reststriction site (underlined) for insertion of the 5' end of target genes. The Clal restitriction site contains the of the "taa" stop (lower case) for terminating trannslation of the CCA adding enzyme gene 5' end including the linker region. Thee added sequence provided by the adaptor/linker (including the ribosome bindiiing site and ClaI restriction site) is such that codon maintenance is in frame wwith the CCA adding enzyme gene 5' end up to the "taa" stop codon. Here andd in the remainder of the text, when a region of DNA is addressed as being "in I frame" with another DNA region, this indicates that the codon maintenance f for the two regions is such that continued protein expression (translation) is poossible without encountering a "stop" codon and therefore terminating the synthhesis of the protein. The second of the stop will be used to form the first nucbleotide of the "ATG" start codon of the target translationally coupled gene, wlvhich is out of frame with the CCA adding enzyme. The remainder c of the adaptor/linker contains a polylinker containing the restriction sites Cl;laI-taaspacer-Agel-AvrI-Nhel-XhoI-SpeI to accommodate internal restriction s sites or sites downstream of stop codons for insertion of target genes. This pplasmid was transformed into DH5a and plasmid containing colonies were selectted for by ampicillin-resistance. One positive colony was selected and the isisolated plasmids were screened for by digesting with Nsil, ClaI and SpeI givingg single cuts resulting in linear fragments (5.5 kb). The sequence of the inserted 1 region in this plasmid was confirmed by DNA sequencing (ATG SEQ #1617, primer #P144-S23). This plasmid was named pTAC-CCA-ClaI and the ppositive isolate was grown and stored as a stock culture (ATG glycerol stock #98'80).

Target genes will be amplified using PCR in which the forward-d/sense primer contains ATCGATAatg....... The underlined sequence %will be complementary to the 5' end of the target gene, while the upper case i is noncomplementary and contains the ClaI site needed for insertion into I pTAC- CCA-ClaI. Adjacent to the Clal site is the 5' TA of the stop codon. TThe "a" (italics) corresponds to the final of the stop "TAa" and also to the: of WO (11/73052 PCT//US) 1/09950 N -72the start "atg" which are overlapping. The reverse/antisense primer:r must M include one of the restriction sites in the polylinker region to allow insertrtion of the 3' end of the target gene into pTAC-CCA-Clal. The mechanitism of ND translationally coupling is that the messenger RNA (mRNA) of a 1 highly r- 5 expressed protein (CCA adding enzyme) is partially translated and thhen the O ribosome encounters the premature stop codon. The inserted RBS irinhibits disengagement of the ribosome from the mRNA until the ribosome recopgnizes Sthe new start codon and proceeds to translate the target protein.. Our assumption is that the ribosome RNA helicase activity disrupts seccondary structure in the GC-rich T. thermophilus sequences, permitting more efifficient translational initiation.

EXAMPLE 2 Verification of Expression of T. thermophilus a-subunit Fused to an i N- Terminal Peptide That Contains Hexahistidine and a Biotinylation Sit(te by pAl-NB-TE/MGC1030 In U.S. Patent Application No. 09/151,888, the cloning of Tthh dnaE gene into the pAl-NB-Avr-2 and transformation into MGC10300 was described. Insertion of the dnaE gene into this vector allows the a-subbunit to be expressed as an N-terminal tagged protein. The verification of expnression was as described below.

PA1-NB-TE was transformed into MGC1030 E. coli bacteria ((mcrA, mcrB, lamBDA(-), (RRND-RRNE)1, lexA3) (ATG glycerol stock #9338) and AP1.L1 E. coli (ATG glycerol stock #939). The parent to the AAP1.L1 bacterial strain was Novagen BLR bacterial strain ompT hsdSB(rB-3- mB-) gal dcm.(srl-recA)306::TnlO. A TI phage-resistant version of this BLRR strain was designated AP1.L1. Single colonies (3 colonies from each transformation) of transformed cells selected for by ampicillin-resistancce were inoculated into 2 ml of 2xYT culture media containing 100 gg/ml amppicillin and grown overnight at 37 0 C in a shaking incubator. In the morning, 0.55 ml of the turbid culture from the overnight growth was inoculated into 1.55 ml of WO 01/73052 PCTII/IJSO 11)099511 -73fresh 2xYT culture media. The cultures were grown for 1 hour at 37°°C with shaking and expression was induced by addition of isopropyyl--Dthiogalactopyranoside (IPTG) to a final concentration of 1 mM. Thhe cells were harvested by centrifugation 3 hours post-induction. The cell pelletts were immediately resuspended in 1/10 culture volume of 2x Laemelli samplee buffer (2x solution: 125 mM Tris-HCl (pH 20% glycerol, 4% sodium ddodecyl sulfate (SDS), 5% 3-mercaptoethanol, and 0.005% bromophenol bluae w/v), and sonicated to complete lysis of cells and to shear the DNA. The ssamples were heated for 10 minutes at 90-100 0 C, and centrifuged to remove innsoluble debris. A small aliquot of each supernatant (3 l1) containing total c cellular protein was electrophoresised onto a 4-20% SDS-polyacrylamide mnini-gel (Novex, EC60255; 1 mm thick, with 15 wells/gel) in 25 mM in Tris baase, 192 mM glycine, and 0.1% SDS. The mini-gels were stained with Cooomassie Blue. A protein migrating just above the 120 kDa molecular weight statandard of the Gibco 10 kDa protein ladder could be detected as a distinct 1 protein band, but was not observed in the uninduced control. This proteirin band corresponds to the expected molecular weight of the T. thennophiiilus casubunit fused to the N-terminal fusion protein (141 kDa).

Next, the total protein in each lysate was transferred (blottedd) from polyacrylamide gel to nitrocellulose. The total protein in each lysaate was transferred (blotted) from polyacrylamide gel to nitrocellulose menmbrane using a Novex transfer apparatus at 30 V constant voltage in 12 mM Triris base, 96 mM glycine, 0.01% SDS and 20% methanol for 60 minnutes at room temperature. The membrane was blocked in 0.2% Tween 20 (vNv)-TBS (TBST) (tris-buffered saline; 8 g/L NaC1, 0.2 g/L KC1, 3 g/L Tris-H(ICl (pH containing 5% non-fat dry milk for 1 hour at room tempoerature.

The blotted nitrocellulose was next rinsed TBST, and then incubateled in 2 .tg/ml alkaline phosphatase-conjugated streptavidin (Pierce Chemic;cal Co.

#21324) in TBST for 1 hour at room temperature. Following exktensive washing TBST, the blot was developed with BCIP/NBT (KPL #50-81-C-07; one component system). The endogenous E. coli biotin-carboxyl carrier 1 protein WO 01/73052 PCT//US0 1/09950 -74- (biotin-CCP), -20 kDa was detectable in both induced and non-irinduced samples. A very intense protein band corresponding to ac migrated aboove the 140 kDa molecular weight standards of the Gibco 10 kDa protein laddenr. This protein was observed as a distinct band in the induced cultures, but wwas not observed in the uninduced control.

The proceedures described here to verify protein expression, which includes lysing cells, obtaining total cellular protein and analysing the I protein in SDS-polyacrylamide gel electrophoresis and biotin blot analysis v will be used in all following procedures to verify expression of native and tagged proteins. All protein concentrations here and below are determined usising the Coomassie Protein Assay Reagent from Pierce and bovine serum alalbumin (BSA) as a standard.

Large Scale Growth of pAl-NB-TE/MGC1030 Strain pAl-NB-TE/MGC1030 was grown in a 250 L fermeontor to produce cells for purification of T. thermophilus a as described in the section entitled "Large Scale Growth of Native T. thermophilus dnaE (a-subuunit) by pTAC-CCA-TE". Cell harvest was initiated 3 hours after induction, atit OD 6 0 0 of 7.2, and the cells were chilled to 10 oC during harvest. The harvest V volume was 175 L, and the final harvest weight was approximately 2.47 kg of cell paste. An equal amount of 50 mM Tris (pH 7.5) and 10% ssucrose solution was added to the cell paste. Quality control results showed 100 out of positive colonies on ampicillin-containing medium in the inoculuum and 10/10 positive colonies at harvest. Cells were frozen by pouring thhe cells suspension into liquid nitrogen, and stored at -20 0 C, until processed.

Purification of T. thennophilus a Fused to an N-terminal Peptide Contaiaining a Hexahistidine and a Biotinylation Site Lysis was accomplished by creation of spheroplasts of thne cells carrying the expressed T. thermophilus a-subunits. First, from 600 g oof a 1:1 WO 01/73052 PCT/F/USO1/09950 K1N suspension of frozen cells (300 g cells) in Tris-sucrose which had been 1 stored at -20 0 C, FrI was prepared (875 ml, 21.6 mg/ml). The preparation vwas as described in the section entitled "Determination of Optimal Ammnonium I Sulfate Precipitation Conditions of T. thermophilus a-subunit Expresse.ed as a Translationally Coupled Protein." To Fr I, ammonium sulfate (0.258 g tito each 0 initial ml Fraction 1-45% saturation) was added over a 15 min intervahl. The mixture stirred for an additional 30 min at 4 0 C and the precipitatite was 0 collected by centrifugation (23,000 x g, 45 min, The resulting I pellets were quick frozen by immersion in liquid nitrogen and stored at -80 0

C.

The pellets from Fr I were resuspended in 90 ml of Nim--NTA suspension buffer and homogenized using a Dounce homogenizer. The sample was clarified by centrifugation (16,000 x g) and the supenmatant constituted Fr II (98 ml, 25 mg/ml). Fr II was added to 50 ml of a 50%' slurry of Ni-NTA resin and rocked for 1.5 hours at 4°C. This slurry was then 1 loaded onto a BioRad Econo-column (2.5 x 5 cm). The column was washed wirith 250 ml of Ni+-NTA wash buffer at a flow rate of 0.5 ml/min. T. thennophhilus a was eluted in 150 ml of Ni'-NTA elution buffer containing a 10-2000 mM imidazole gradient. The eluate was collected in 80 x 2 ml fractions (FFIG. 1).

Fractions 30-50 were pooled (see FIG. 1) and constitute Frill (63ml, 2 mng/ml).

Construction of Plasmids (pTAC-CCA-TE) that Overexpress T. thennoophilus a-Subunit as a Translationally Coupled Protein In the preceeding patent application Application 09/1551888) the T. thennophilus dnaE gene (TE) expressing the a-subunit was clonaed into pAl-CB-NcoI resulting in the plasmid pAl-TE. This plasmid was desiggned to express the native form of the a-subunit, but yields of the a-subunit vwere at very low levels (as previously discussed). In an attempt to increase thne level of expression of the native a-subunit a vector was designed to express 3 the asubunit as a translationally coupled protein. Translational coupling wwith an upstream highly expressed protein will be used to disrupt strong seccondary structures present in the GC-rich T. thermophilus dnaE mRNA, penrmitting WO 01/73052 PCT/I/USI) 1S/09950 -76more efficient translational initiation and higher levels of T. thennoopphilus expression. The starting plasmid was pTACCCA (pTC9) and containned the CCA adding enzyme under control of a pTAC promoter. This pblasmid D expresses the CCA adding enzyme at high levels. The strategy was to rcremove 5 most of the CCA adding enzyme leaving only the 5'-12 codons by diggesting O pTACCCA plasmid with Nsil and KpnI. The Nsil restriction s site is approximately 12 codons downstream of the ATG start site of the CCA e adding Senzyme and the KpnI restriction site is downstream of the stop codon.

The TE gene was inserted behind the CCA adding enzymne and translationally coupled in two steps. First, the 5' end of the TE genne was amplified using pAl-TE as a template by polymerase chain reaction ((PCR).

The forward primer (ATG primer #P69-S541) is shown below.

-GGATATGCATTGAGGAGGATCGATTAatgggccgcaaactccgc-3' (SEQ ID The non-complementary portion of the primer is shown as uppoer case and the portion of the primer complementary to the 5' end of the ggene is shown as lower case. The NsiI site (ATGCAT) and the ClaI site (ATCCGAT) are shown as underlined italic. The RBS (AGGAGG) is shown as undeerlined.

Both the RBS and the ClaI restriction site maintain codons that are irinframe with the structural gene for the CCA adding enzyme. The last two nucldeotides of the non-complementary portion of the primer "TA" and the first nucldeotides of the complementary portion of the primer form a premature stop codon, in frame with the 5' end of the CCA adding enzyme. The also is tthe first nucleotide of the "atg" start codon of the TE gene. This places the geene for the CCA adding enzyme and the TE gene out of frame with respect tcto each other. The sequence of the reverse primer CGGCTCGCCAGGCGCACCAGG-3') (SEQ ID NO:21) (ATG primer r #P69- A971) is complementary to a region just down stream of a unique Kpnn I site located approximately 316 bp downstream of the start "ATG" codon.

WO 01/73052 PCT/T/USI/995t) -77- The PCR product resulting from the forward and reverse pprimers described in the preceding paragraph (430 base pairs in length) was cuut with NsiI and KpnI yielding a 350 bp fragment and inserted into the NsisiI/KpnI digested pTACCCA plasmid. By cutting the pTACCCA plasmid witith these two enzymes the C-terminal ca. 95% of the CCA adding enzymne gene along with approximately 600 bp of sequence downstream of the stop p codon was removed. The resulting plasmid was transformed into DH5c and ppositive isolates were selected by ampicillin-resistance. Plasmid isolated froom one positive isolate was verified by digestion with NsiI and KpnI (yieldiling the expected 0.35 and 5.3 kb fragments). The sequence of the inseert was confirmed by DNA sequencing (ATG SEQ #1512 and 1513, primers i #P144- S23 and P144-A1965, respectively). This plasmid was named pTACC-CCA- TEmp and the isolate was stored as a glycerol stock culture (ATG gglycerol stock #898).

To reconstruct the remainder of the T. thennophilus dnaE gerne, the pAl-TE plasmid was digested using the restriction enzymes KpnI annd Sall.

The Sall restriction site is approximately 254 bp downstream of the endd of the TE gene. It is also located downstream of a C-terminal biotin-hexahilistidine fusion peptide. The resulting 3601 base pair KpnI-Sall fraagment encompassing the C-terminal 95% of the T. thennophilus dnaE genne, was inserted into the Kpnl/SalI digested pTAC-CCA-TEmp plasmid. The pplasmid was ligated, transformed into DH5a and positive isolates were seleccted for ampicillin-resistance. Plasmid isolated from one positive isolate was verified by digestion with KpnI and Sal restriction enzymes (yielding the expeccted 3.6 and 5.6 kb fragments). The sequence of the insert was confirmed byy DNA sequencing (ATG SEQ #1550 and 1551, primers #P144-S23 and P144- 1 -A1965, respectively). This plasmid was named pTAC-CCA-TE and the: isolate pTAC-CCA-TE/ DH5a was stored as a glycerol stock culture (ATG gglycerol stock #933).

WO 01/73052 PCT/rIUSOI/09950 -78- Verification of Expression of Native T. thennophilus dnaE gene (a-subuunit) as a Translationally Coupled Protein by pTAC-CCA-TE pTAC-CCA-TE plasmids were transformed into MGC1030 I (ATG glycerol stock #938) and AP1.L1 E. coli (ATG glycerol stock #939).1. Three isolates from each transformation were grown and total protein isolalated as described above. An aliquot (3 jil) of each supernatant was subjeccted to electrophoresis in a 4-20% SDS-polyacrylamide mini-gel (Novex, EC600255; 1 mm thick, with 15 wells/gel) in 25 mM in Tris base, 192 mM glycinne, and 0.1% SDS. The resulting gels were stained with Coomassie Brilliantat Blue.

Distinct protein bands from both MGC1030 and AP1.L1 baacterial preparations, migrating slightly above the 120 kDa molecular weight sttandard, of the Gibco 10 kDa protein ladder, were observed as distinct bands s in the induced cultures, but were not observed in the'uninduced controls. These proteins were determined to be consistent with the expected molecular weight expected for native T. thermophilus a (137.5 kDa). The detected pproteins represented approximately 5% of the total E. coli protein, based on the intensity of Coomassie Blue staining of the protein bands on the gel.

Optimization of T. thennophilus Protein Expression In an attempt to optimize the yield of expressed recombinnant T.

thennophilus proteins, induction times were analyzed for each new protetein. Fmedia (Bacto Yeast Extract, 14 g/L, Bacto Tryptone, 8 g/L, pottassium phosphate-dibasic, 12 g/L, potassium phosphate-monobasic, 1.2 g/L, (ppH 7.2), 1% glucose) is used as a growth medium. A small amount of F-media 1 (10-20 ml) containing a ampicillin is innoculated with the target bacteria and i grown overnight at 37°C while shaking. This overnight growth is used to innoculate fresh F-media containing ampicillin pre-warmed to 37 0 C. The fresh mnedia is inoculated at a 20:1 ratio using the culture grown overnight. This; allows enough time for cell density to double 3-4 times before induction. The: freshly innoculated culture is grown to an OD 6 00 oo 0.6-0.8 (The optical (density WO 01/73052 PCT/I/U SO 1/09950 -79-

(OD)

6 oo is a unit used to measure light scattered by cells in solution at 600 nanometers in calculating the density of cells in the solution) and exproression induced by addition of IPTG to 1 mM. At the time of induction d-bioiotin is added to proteins containing hexahistidine and a biotinylation site to a final concentration of 10 The control culture received d-biotin only--theNy were not induced with IPTG.

Equal sample volumes (5ml) of culture are collected at the titime of induction and every hour after induction up to 5 hours post inductiion for analysis to determine optimum growth times. The OD 600 is each samnple is determined. The samples collected are centrifuged in a Fisher Centrific I Model 228 (1380 x g) for 10 min. The supernatant is discarded and the cell pellets were retained for analysis. To maintain equal concentration of total prootein in each sample, 50 ul of Laemmli lysis buffer (125 mM Tris-HCl, (pH 6.83), glycerol, 5% SDS) was added per OD 6 00 of each sample multiplied 1 by the sample volumes (5 ml). The cell pellets are resuspended and heated I to 100 0 C for 10 min. The samples are centrifuged at maximum rpm (16,0000 x g) for 10 min using a table top microfuge, and the supernatant is retained. Small aliquots containing total cellular protein, of each supernatant (5 p.1) are I loaded onto a 10% SDS-polyacrylamide gel electrophoresis gel (16 x 18 x 0.75 i cm) in 25 mM in Tris base, 192 mM glycine, and 0.1% SDS. The geels are electrophoresised for 2 h at 250 volts. The gels are stained with Cooomassie Blue or (for proteins containing hexahistidine and a biotinylationn site) transferred to nitrocellulose and analyzed by biotin blot analysis. Biotitin blot analysis is used to refer to proteins that have been transferred fromn SDSpolyacrylamide gels to nitrocellulose membrane and proteins detectted by virtue of biotin bound to an N- or C-terminal peptide that contatains a biotinylation site In normally growing cells a certain percentage of pproteins containing a biotinylation site is bound by biotin. The detection obf these proteins is by virtue of avidin binding to the biotin bound to the: fusion peptide. Alkaline phosphatase-conjugated streptavidin (Pierce Chemidcal Co.

WO 01/73052 PCT/r/USI01/09950 #21324) is used and can be detected using chemicals that allow the ahlkaline phosphatase and therefore the protein of interest to be visualized.

Optimization of Expression of T. thermophilus dnaE gene (a-subunnit) by pTAC-CCA-TE In preliminary experiments, T. thennophilus a appeared to be synthesized at higher levels in the AP1.L1 strain. Therefore, the opptimum induction times for expression of T. thennophilus from pTAC-CCCA-TE carried in AP1.L1 were analyzed. The yield of T. thennophilus a was analyzed at 1, 2, 3, 4, and 5 h induction times as described above in s section "Optimization of T. thermophilus Protein Expression. The optimum yiyield of T. thermophilus a was attained by 3 h post induction; this induction tinme was used in subsequent experiments (FIG. 2).

Gap-Filling Assay for Determination of T. thermophilus a-subunit Activvity The catalytic subunit of a replicative complex has a ver:ry low processivity in the absence of other holoenzyme subunits on a pprimedtemplate. However, the catalytic subunit can fill the gaps of nuucleaseactivated (gapped) DNA very effectively by fast association and dissoociation reactions in low salt conditions (shown below) (See, McHenry and Crow (1979), J. Biol. Chem., 254, 1748-1753). To be able to assay for actitivity in different purification steps of T. thennophilus a-subunit the gap-fillingg assay was used.

Assay mixtures (25p1) contained 32 mM Hepes (pH 13% glycerol, 0.01% Nonidet P40, 0.13 mg/ml BSA, 10mM MgC1 2 0.22mg/ml activated calf-thymus DNA, 57uM each of dGTP, dATP, and dCTrP, and 21MM [3H] TTP (approximately 100 cpm/pmol). The mixturcre was assembleded on ice, and reactions were started by the addition of a diluution of samples of DNA polymerase and placing in a 60 0 C water bath for 5 mninutes.

The reactions were stopped by placing the tubes on ice and thee DNA WO 01/73052 PCT/F/USO1/09950 -81precipitated by adding 2 drops of 0.2M sodium pyrophosphate (PPi) aiand ml of 10% TCA. Trapping of precipitated DNA and remouval of unincorporated nucleotide triphosphates was accomplished by filteriring the mixture through GFC filters (Whatman) and washing the filters with i 12 ml 0.2M sodium PPi/1M HCL and then 4 ml of ethanol. The filters werlre then allowed to dry and 3 H]TTP incorporated was quantified by immersiiing the filters in 5 ml of liquid scintillation fluid (Ecoscint-O, National Diagnnostics) and counting on a Beckman LS 3801 scintillation counter. One uunit of enzyme activity is defined as one picomole of total nucleotides incorpporated per min at 60 0 C. Positive controls, containing E. coli DNA pol III (asssayed at 0 and negative controls, containing no polymerase, were included i: in each set of assays Large Scale Growth of Native T. thennophilus a by pTAC-CCA-TE/APPI.L1 Strain pTAC-CCA-TE/AP1.L1 was grown in a 250 L fermerntor to produce cells for purification of T. thennophilus dnaE product F-mnedium yeast extract, 0.8% tryptone, 1.2% K 2

HPO

4 and 0.12% KH 2

PO

4 pH to 7.2 with NaOH) was sterilized, glucose was added to 1% from a 40% b sterile solution and ampicillin (100 mg/L) was added. A large-scale inoculum (28 L), was initiated from a 1 ml glycerol stock culture culture stored ilin glycerol at -80 0 C) and grown overnight at 37 0 C with 40 L/min aerationn. The inoculum was transferred (approximately 4.2 L) to the 250 L fern-mentor containing 180 L of F-medium with 1% glucose, and 100 mg/L amppicillin (starting OD 600 of 0.06). To calculate the amount of overnight culture to add to the fermentor, in this fermentation there was 180 L initial F-media, e enough should be added to bring the media present in the fermentor to an ODD 6 00 0.06. This allows enough time for the cell density to double 3-4 times 3 before induction. The culture was incubated at 37 0 C, with 40 LPM aeratioon, and stirred at 20 rpm. Expression of T. thennophilus a was induced by additition of IPTG to 1 mM when the culture reached an OD 600 of 0.79 (expresssion of WO 01/73052 PCT/I/USO 1/09950 N -82foreign proteins in E. coli is induced when the cell density nreaches N approximately an OD 60 0 Additional ampicillin (100 mg/LL) was added at same time as induction. The temperature was maintairined at Sapproximately 37 0 C throughout the growth. The pH was maintained I at 7.2 5 throughout the growth by addition of NH 4 0H. Cell harvest was inititiated 3 O hours after induction at OD 6 oo= 4.88, and the cells were chilled to 10 0 C J during harvest. The harvest volume was 180 L, and the final harvest weiglht was O approximately 1.9 kg of cell paste. An equal amount of 50 mhM Tris (pH 7.5) and 10% sucrose solution was added to the cell paste. Cellils were frozen by pouring the cells suspension into liquid nitrogen, and staored at 0 C, until processed. Quality control results showed 10 out of 10 ppositive colonies on ampicillin-containing medium in the inoculum and 10 outt of positive colonies on ampicillin-containing medium at harvest. PPositive colonies are colonies grown from samples streaked on LB plates thnat also grow when the colony is transferred to LB plates containing a selelective antibiotic. Luria-Bertani (LB) growth medium (bacto-tryptone, 10 bactoyeast extract, 5 g/L, NaC1, 10 g/L) is used in selection of positive ccolonies here and in following sections.

Determination of Optimal Ammonium Sulfate Precipitation Conditionns of T.

thennophilus a Expressed as a Translationally Coupled Protein Lysis was accomplished by creation of spheroplasts of thee cells carrying the expressed T. thermophilus a-subunits. First, 50 g off a 1:1 suspension of frozen cells (25 g cells) in Tris-sucrose which had been sttored at 0 C were added to 69 ml tris-sucrose that had been pre-warmed tcto (2.75 ml/g of cells). To the stirred mixture, 1.25 ml of 0.5 M 1,4-dithiobthreitol (DTT) (0.05 ml/g of cells) and 6.25 ml of lysis buffer (2M NaCI,l, 0.3M spermidine in Tris-sucrose adjusted to pH 7.5) (0.25 ml/g of cells) was 5 added.

The presence of 18 mM spermidine kept the nucleoid condensed I within partially disrupted cells and displaced DNA binding proteins. The pHI of the slurry was adjusted to pH 8.0 by the addition of 0.5 ml of 2 M Tris basee (pH is WO 01/73052 PCTA'/USO11(9950 -83adjusted to 8.0 with 2 M Tris base), and 125 mg lysozyme was; added resuspended in 4.5 ml of Tris-sucrose buffer (5 mg lysozyme/g of cells)). The slurry was distributed into 250 ml centrifuge bottles after stirring 5 mnin and incubated at 4 0 C for 1 hour. The 250 ml centrifuge bottles were then pllaced in a 37 0 C swirling water bath and gently inverted every 30 seconds 3 for 4 minutes. The supernatant was separated form insoluble cellular debbris by centrifugation (23,000 x g, 60 min, The recovered supernatant (0.1 1) constituted Fraction I (Fr I) (13 mg protein/ml). All protein concentitrations here and below are determined using the Coomassie Protein Assay Raeagent from Pierce and bovine serum albumin (BSA) as a standard. FrI was ddivided into 5 equal volumes and 0.164, 0.226, 0.291, 0.361 and 0.4366 g of ammonium sulfate 40%, 50%, 60% and 70% saturation) was addded for each ml of FrI in the separate sample, respectively, over a 15 min inteerval at 4°C. The mixture was stirred for an additional 30 min at 4 0 C. The preccipitate was collected by centrifugation (23,000 x g, 45 min, The rersulting pellets were resuspended in 2 ml Ni-NTA suspension buffer (50 mM Triris-HCl (pH 40 mM KC1, 7 mM MgC12 and 10% glycerol. The I protein concentration of each sample was determined using the Coomassie I Protein Assay Reagent (Pierce) and bovine serum albumin (BSA) as a standardd. The 30%, 40%, 50%, 60% and 70% ammonium sulfate precipitated ssamples contained protein concentrations of 2.4, 8.0, 18.0, 35.0 and 38.0 rmg/ml, respectively (FIG. 3).

The samples were analyzed by SDS-polyacrylamidde gel electrophoresis (FIG. The 40% ammonium sulfate precipitated saamples contained over 90% of the a-subunit.

Each ammonium sulfate cut was also assayed for activity in gap-p-filling assays describe above in the section entitled "Gap Filling Asssay for Determination of T. thermophilus a-subunit Activity". The activity apppears to be highest at 40% ammonium sulfate saturation and drops as p percent ammonium sulfate saturation increased (FIG. This is due to either r higher salt being retained in the resuspended pellet and effecting the gap filling WO 01/73052 PCTi/IJSO1/09950 84reaction, or an inhibiting contaminant precipitating at the higher ammnonium sulfate concentrations and effecting activity of the T. thennophilus a-sisubunit.

Since SDS-polyacrylamide gel electrophoresis and activity assays indiccate that most of the a-subunit is being recovered in 40% ammonium sulfate cuuts, this concentration of ammonium sulfate was used in subsequent preparationsis.

Purification of T. thennophilus dnaE Product (a-subunit) from pTAC2-CCA-

TE

Lysis was accomplished by creation of spheroplasts of cells ccarrying the expressed T. thernophilus a (large-scale preparation of 7-10-2000).). First, 500 g of a 1:1 suspension of frozen cells (250 g cells) in Tris-sucrose stctored at °C were used to prepare FrI (770 ml, 27.4 mg/ml). The preparaticion was as described in the section entitled "Determination of Optimal Ammnonium Sulfate Precipitation Conditions of T. thennophilus a-subunit Expresseed as a Translationally Coupled Protein". To Fr I, ammonium sulfate (0.258 g t to each initial ml Fraction 1-45% saturation) was added over a 15 min intervaal. The mixture was stirred for an additional 30 min at 4°C and the precipitaate was collected by centrifugation (23,000 x g, 45 min, 0 The resulting; pellets were quick frozen by immersion in liquid nitrogen and stored at -80 0

C..

The pellets from Fr I were resuspended in 160 ml of 50 mM Triris-HCl, (pH 25% glycerol, 1 mM EDTA, 1 mM DTT and homogenized i using a Dounce homogenizer. The sample was clarified by centrifugation (16,0000 x g) and the supematant constituted Fr II (164 ml, 11.4 mg/ml). Fr I was further purifed using a Butyl Sepharose Fast Flow (Pharmacia Biotech) columnn. The butyl resin (360 ml) was equilibrated in butyl equilibration buffer (350 mM Tris-HCl, (pH 25% glycerol, 1 mM EDTA, 1 mM DTT, 0.5 M ammonium sulfate). The column was poured using 250 ml of Butyl res.sin. The remaining 110 ml of Butyl resin was mixed with Fr II giving 274 ml. To this mixture, 0.5 volume of saturated amonium sulfate was added slowlyy while stirring over a period of 1 hour. This mixture was added to the columnn at 1.3 ml/min. The column was then washed with 1 L of equilibration buffeer. The WO 01/73052 PCOW/rU S01/09950 protein was eluted in 10 column volumes of a gradient begining witth butyl equilibration buffer and ending in a buffer containing 50 mM Tris-HCC1, (pH 25 glycerol, 1 mM EDTA, 1 mM DTT, 50 mM KC1. Remnaining protein was removed from the column by eluting with an additional 10 ccolumn volumes "bump" of the end buffer. The a-subunit eluted in the first halflf of the "bump", and was pooled (242 ml, 0.15 mg/ml). The gap-filling asssay was used to assay fractions for activity.

The pool was concentrated to 27 ml (1.5 mg/ml) using polyetethylene glycol (PEG) 8000 in powder form (Fisher). T. thermophilus a was further purified using a Sephacryl S300 HR (Pharmacia Biotech) gel filtration ccolumn (510 ml, 3 cm x 120 cm) equilibrated in 50 mM Tris-HCl, (pH 20 glycerol, 100 mM NaCI, 1 mM EDTA, 5 mM DTT. The column was loaded and the protein eluted at a flow rate of 0.7 ml/min. The a-subunit was iisolated as a highly purified protein (35 ml, 0.23 mg/ml). A 10% SDS-polyacryylamide gel summarized the stages of purification of native T. thennophilus a (FFIG. 6).

EXAMPLE 3 Construction of pAl-NB-TX that Expresses T. thennophilus dnaX (Tr and ysubunits) Fused to an N-Terminal Peptide That Contains Hexahistidinee and a Biotinylation Site The T. thennophilus dnaX gene was previously inserted into pAAl-CB- Clal to be expressed as both native (pAl-TX) and C-terminal tagged pproteins (pAl-CB-TX) Application No. 09/151,888). Both t and y stubunits were expressed at low levels from both constructs. The T. thennophiluus dnaX gene was also previously inserted into pET-CB-ClaI plasmids to be exppressed as both native (pET-TE) and C-terminal tagged proteins (pET-CB-TX() (U.S.

Application 09/151,888). As when under control of the pAl promoter:r, when expressed under control of the T7 promoter, both t and y-subunitits were express at low levels. In an attempt to increase expression levels of i T and y subunits, plasmids were designed to fuse the dnaX gene to DNA encooding an N-terminal peptide that contains hexahistidine and a biotinylation site.e (ATG WO 01/73052 PCT//U S 1/09950 -86project First, a PCR reaction was designed to amplify a fragment of f the Nterminus of the dnaX gene from the plasmid pAl-TX. The forwardi (ATG primer #P38-S1586, 5'-AACTGCAGAGCGCCCTCTACCG-3') (SEEQ ID NO:47) adds a Pstl site to the 5' end of the dnaX gene so that the actuaal PCR product excludes the ATG start codon and begins at codon 2. Thhe PstI restriction site adjacent to codon 2 brings the 5' portion of the dnaX ggene in frame with the N-terminal fusion peptide coding sequences. The rreverse primer (ATG primer #P38-A2050, 5'-CGGTGGTGGCGAAGACGAA4GAG- (SEQ ID NO:48) was designed so that it is downstream of the BBamH1 restriction site within T. thermophilus dnaX (the BamH1 restriction site is approximately 318 bases downstream of the start codon). This PCR pproduct was cut with PstI and BamHl and ligated into pAI-NB-AgeI that had beeen cut with the same two restriction enzymes. This plasmid was transformaed into and positive isolates were selected by ampicillin-resistance. Pldasmids from one positive clone were verified by BamHIJlPstI restriction digest (yielding the expected 5.5 kb and 0.32 kb fragments) and Ncol digest (yi/ielding the expected 5.6 and 0.16 kb fragments). The sequence of the inserted I region was confirmed by DNA sequencing (ATG SEQ #1185 and 1186, primer:rs P64- S 10 and P64-A215) and compared to the sequence of pAl-TX. This pre-ecursor plasmid was named pAI-NB-TX5' and the isolate (pAl-NB-TX5'/ was stored as a stock culture (ATG glycerol stock #702).

Next, the 3' region (C-terminus) of the dnaX gene (1.6 kb) was c cut out of the pAl-TX plasmid using the restrictions enzymes BamH1 and Spel:I. This fragment was ligated into the precursor plasmid pAI-NB TX5' that haas been cut with the same two restriction enzymes. This plasmid was transformed into and plasmid containing colonies were selected by ampicillin-resisistance.

Positive isolates were verified by BamHIJSpeI digest yielding the expectted 5.9 and 1.6 kb fragments. This plasmid containing the entire gene for TX linked to the N-terminal fusion peptide was named pAI-NB-TX and the isolatee (pAl- NB-TX/ DH5a) was stored as a stock culture (ATG glycerol stock #7409).

WO 01/73052 PCT/Tr/ S01/09950 -87- Verification of Expression of T. thennophilus dnaX gene (z and y-subbunits) Fused to an N-Terminal Peptide That Contains Hexahistidine and a Biotinylation Site by pAl-NB-TX/AP1.L1 The pAl-NB-TX plasmid was prepared and transformed intto both MGC1030 (ATG glycerol stock #740) and AP1.L1 bacteria (ATG gl;lycerol stock #741). The bacterial growth and isolation of total protein ,was as described in Example 2. An aliquot of supernatant (3 pl) containinpg total protein was loaded onto a 4-20% SDS-polyacrylamide mini-gel (r1Novex, EC60255; 1 mm thick, with 15 wells/gel) in 25 mM in Tris base, 1992 mM glycine, and 0.1% SDS. The mini-gel was stained with Coomassie Bluue, and one protein (doublet band) was observed to be migrating below 60 kEDa and the other protein band slightly above the 60 kDa molecular weight stanndards, of the Gibco 10 kDa protein ladder. These protein bands were obserArved as distinct bands in the induced cultures from both bacterial strains, but wwas not observed in the uninduced controls. These proteins were determinedd to be consistent with the expected molecular weights of 53.6 and 61.9 kDa.a. The detected proteins bands representing T. thermophilus DnaX representeted less than 2% of the total E. coli protein, based on the intensity of Coomassicie Blue staining of the protein bands on the gel.

In T. thermophilus, the putative frameshift site, allowing expresssion of both (z and y-subunits, has the sequence A AAA AAA A, which would i enable either a +1 or -1 frameshift. The +1 frameshift product would extennd only one residue beyond the lys-lys encoding sequence, similar to the E. ccoli -1 frameshift product. However, the -1 frameshift would encode a protein i with a 12-amino acid extension. This would allow the expression of two y-suubunits differing in size by 11 amino acids. Alternatively, recent work has inodicated that the T. thennophilus y-subunit may be expressed as the res:sult of transcriptional slippage producing a sub-population of different length mRNAs encoding two different length gamma subunits (Larsen, WVills, et al., Proc. Natl. Acad. Sci. 97:1683-1688 (2000)). We observe y-subunnit as a doublet protein band, confirming that one of these processes is occurrngg.

WO 01/73052 PCTirUS01/09950 -88- Next, the expressed proteins were subjected to biotin blot anal)lysis as described in Example 2. The endogenous E. coli biotin-CCP protein, -220 kDa was detectable in both induced and non-induced samples. Two bands obf equal intensity were visualized, one just below 60 kDa and the other slightly y above 60 kDa molecular weight standards, of the Gibco 10 kDa protein ladderr in the induced cultures from both bacterial strains, but was not observed in the uninduced control.

Optimization of Expression of T. thermophilus DnaX by pAl-NB-TX Since expression of T. thennophilus dnaX gene yielded low v or no detectable proteins when expressed as both a native or coupled to an Cterminal fusion peptide, extra care was taken with dnaX linked to an Nterminal fusion peptide to achieve optimum expression. Expressioon was analyzed using both E. coli strains MGC1030 and AP1.LI carrying pAA1-NB- TX at different induction times and also at different growth temperatuures and 37 0 Growth of bacterial cultures and analysis were carried I out as described in Example 2. Biotin blot analysis indicated that expressionn levels were higher at 37C and also slightly better when expressed in the AAP1.LI bacterial strain (FIG. The optimum yield of T. thernnophilus DnnaXwas attained by 4 h post induction and at 37 0 C; this induction time will be t used in subsequent experiments.

Large Scale Growth of pAl-NB-TX/AP1.L1 Strain pAl-NB-TX/AP1.L1 was grown in a 250 L fenrmentor (fermentation run #99-17), to produce cells for purification of T. thernmophilus dnaX (c and y-subunits) fused to an N-terminal peptide that ccontains hexahistidine and biotinylation site as described Example 2. Cell harveest was initiated 4 hours after induction at OD 600 7.0, and the cells were chiilled to 0 C during harvest. The harvest volume was 172 L, and the final I harvest WO (11/73052 PCT/rIUSOI/09950 -89weight was approximately 2.2 kg of cell paste. An equal amount of mM Tris-HCI (pH 7.5) and 10% sucrose solution was used to resuspeend the cell paste. Cells were frozen by pouring the cell suspension into liquid nitrogen, and stored at -20 0 C until processed. Quality control results sishowed 10 out of 10 positive colonies on ampicillin-containing medium :in the inoculum and 10 out of 10 positive colonies at harvest.

Purification of T. thennophilus dnaX Product and y-subunits) Fuseed to an N-Terminal Peptide That Contains Hexahistidine and a Biotinylation Sitte Lysis of 800 g of a 1:1 suspension of frozen cells (400 g off cells) containing pAl-NB-TX stored in Tris-sucrose at -20 0 C, was preformmed as described in Example 2. The recovered supernatant (1.75 1) consistituted Fraction I (Fr I) (13.5 mg/ml). To Fr I, ammonium sulfate (0.226 g tito each initial ml Fraction 1-40% saturation) was added over a 15 min intervalal. The mixture was stirred for an additional 30 min at 4 0 C and the precipitalate was collected by centrifugation (23,000 x g, 45 min, The resulting; pellets were quick frozen by immersion in liquid nitrogen and stored at -80 0

C.

The pellets from Fr I were resuspended in 125 ml of Ni+*+-NTA suspension buffer (50 mM Tris-HCI (pH 40 mM KC1, 7 mM MgCl:1 2 glycerol, 7 mM (3ME, 0.1 mM PMSF) and homogenized using a EDounce homogenizer. The sample was clarified by centrifugation (16,000 x g) a and the supernatant constituted Fr II (13.3 mg/ml). Fr II was added to 60 ml of f a slurry of Ni-NTA resin in Ni+-NTA suspension buffer and rocked I for hours at 4°C. This slurry was then loaded onto a BioRad Econo-columnn (2.5 x cm). The column was washed with 300 ml of Ni"-NTA wash buffffer mM Tris-HCI (pH 1 M KC1, 7 mM MgCl2, 10% glycerol, 1110 mM Imidazole, 7 mM IME) at a flow rate of 0.5 ml/min. The NB-TX prote.ein was eluted in 300 ml of Ni+-NTA elution buffer (50 mM Tris-HC1 (pH 77.5), mM KC1, 7 mM MgCl 2 10% glycerol, 7 mM PME) containing a 10-2200 mM imidazole-HC1 (pH 7.5) gradient. The eluate was collected in 150 xx 2 ml fractions. The protein concentration of each fraction was determined (FFIG. 8).

WO 01/73052 PCT/I/USOI/09950 Fractions were analyzed by SDS-polyacrylamide gel electrophhoresis, (FIGs. 9A and 9B) and observed to contain only one major higher moblecular weight contaminant. This contaminant migrated just above the T-subunnit and disappeared by fraction 96. Fractions 66-95 and 96-113 were pooled aand the proteins were precipitated by addition of ammonium sulfate (0.226 g tito each initial ml Fraction 1-40% saturation). The precipitate was collectcted by centrifugation (23,000 x g, 45 min, 0 C) and stored at -80 0 C. A portionn of Nterminal tagged T. thermophilus DnaX purified using Ni"-NTA c column chromatography was stored as laboratory stocks.

In an additional purification step for antibody production, pellets containing ammonium sulfate precipitated N-terminal tagged T. thennaophilus DnaX were resuspended in 30ml of phosphate buffered saline (PBS) (1337 mM NaCI, 2.7 mM KCI, 4.3 mM Na 2

HPO

4 :7H 2 0, 1.4 mM KH 2 P0 4 (pH 7.33)) plus glycerol and homogenized using a Dounce 75 homogenizer.. The resulting solution was clarified by centrifugation (16,000 x g) annd the supernatant constituted Fr III (2.9 mg/ml).

Fr III was loaded onto a 2 ml UltraLink T M Immobilized Moncomeric Avidin column (1.1 cm x 2.5 cm) (Pierce) equilibrated in PBS pluus glycerol as per manufacturer instructions. The sample was loaded at a flow rate of 0.09 ml/min. The flow through was passed back through the ccolumn three times to allow all biotinylated protein to bind the avidin. The ccolumn was next washed with 10 ml PBS plus 10% glycerol at a flow rate oof 0.08 ml/min. The protein was eluted from the column in 20 ml of elution buuffer (2 mM D-biotin, 10% glycerol in PBS) at a flow rate of 0.09 ml/min (FIG3s. and This purification step removed the upper molecular weight contaminant observed in the Ni"-NTA column purification. Fractionns 1-24 (19 ml) were pooled (0.43 mg/ml) and the protein was precipitated by aaddition of ammonium sulfate (0.258 g to each ml of pooled fractions) and centrtrifuged as described above and stored at -80C. This sample was used in prodduction of polyclonal antibodies described below.

WO 01/73(152 PCT/IJU SO 1/09950 -91- Production of polyclonal antibodies against T. thennophilus DnaX (T and ysubunits) For production of polyclonal antibodies, the pellets containiling Ntagged T. thennophilus DnaX from the avidin purification were dissolveed in 2 ml of PBS and dialyzed against 500 ml of PBS two times (2.5 mg/ml,, 2 ml).

The sample was diluted to 50 tg/ml in PBS and 2 ml was injected directtly into a vial containing adjuvant (RIBI Adjuvant System This solutidon was mixed and allowed to come to room temperature. One ml of the adjuvannt/NB- TX mixture was used to inoculate a rabbit 0.05 ml in each of si;ix sites intradermal injections, 0.3 ml intramuscular injections in each hind leeg, and 0.1 ml subcutaneous injection in the neck region. Before the initial injeection a ml preinjection bleed was collected. The rabbit received a booster:r using one-half the initial injection volume 28 days post initial inoculation. A test bleed (10 ml) was collected on day 37. The rabbit received a second bbooster using the same formulation as original inoculation at day 58. Total bloood was collected on day 72.

The optimum dilutions of anti-serum for binding NB-TXX was determined after the test bleed and after the final bleed. This was carriried out using SDS-polyacrylamide gel electrophoresis in which a small aliquoot of T.

thennophilus N-terminal tagged DnaX (1.0 Ag/well) was electrophoreseed onto a 10% SDS-polyacrylamide mini-gel (10 x 10 cm), and then the proteiein was transferred onto nitrocellulose membrane. The membrane was cut intoo strips with each strip containing an identical band of T. thermophilus N-te:enninal tagged DnaX. The membrane was blocked in 0.2% Tween 20 (v/Vv)-TBS (TBST) containing 5% non-fat dry milk for 1 hour at room tempeerature, rinsed with TBST. The strips were placed in antiserum/TBST (dilutidons of; 1:100,1:200, 1:400, 1:800, 1:1600, 1:3200, 1:6400, and 1:12800) for 1 hour and then washed 4 times for 5 min in TBST. Next, the strips were plalaced in secondary antibody-conjugated to alkaline phosphatase (goat anti-rabbbit IgG 1:3000 dilution in TBST) (BioRad) for 1 hour. The strips were then WO 01/73052 PCT/r/USOI/09950 -91- Production of polyclonal antibodies against T. thermophilus DnaX (T and ysubunits) For production of polyclonal antibodies, the pellets containiling Ntagged T. thermophilus DnaX from the avidin purification were dissolveled in 2 ml of PBS and dialyzed against 500 ml of PBS two times (2.5 mg/ml,, 2 ml).

The sample was diluted to 50 Jtg/ml in PBS and 2 ml was injected directitly into a vial containing adjuvant (RIBI Adjuvant System This solutidon was mixed and allowed to come to room temperature. One ml of the adjuvannt/NB- TX mixture was used to inoculate a rabbit 0.05 ml in each of si;ix sites intradermal injections, 0.3 ml intramuscular injections in each hind le.eg, and 0.1 ml subcutaneous injection in the neck region. Before the initial injeection a ml preinjection bleed was collected. The rabbit received a booster:r using one-half the initial injection volume 28 days post initial inoculation. A test bleed (10 ml) was collected on day 37. The rabbit received a second bbooster using the same formulation as original inoculation at day 58. Total bloood was collected on day 72.

The optimum dilutions of anti-serum for binding NB-TXX was determined after the test bleed and after the final bleed. This was carriried out using SDS-polyacrylamide gel electrophoresis in which a small aliquoot of T.

thennophilus N-terminal tagged DnaX (1.0 g/well) was electrophoreseed onto a 10% SDS-polyacrylamide mini-gel (10 x 10 cm), and then the protejein was transferred onto nitrocellulose membrane. The membrane was cut intao strips with each strip containing an identical band of T. thermophilus N-te:erninal tagged DnaX. The membrane was blocked in 0.2% Tween 20 (vNv)-TBS (TBST) containing 5% non-fat dry milk for 1 hour at room tempeerature, rinsed with TBST. The strips were placed in antiserum/TBST (dilutidons of; 1:100,1:200, 1:400, 1:800, 1:1600, 1:3200, 1:6400, and 1:12800) for 1: hour and then washed 4 times for 5 min in TBST. Next, the strips were plalaced in secondary antibody-conjugated to alkaline phosphatase (goat anti-rabbbit IgG 1:3000 dilution in TBST) (BioRad) for 1 hour. The strips wenre then WO 01/73052 PCT/t/U SO 1/09950 -92washed 4 times for 5 min with TBST. Following this extensive washiiing, the blots were developed with BCIP/NBT (KPL #50-81-07; one compponent system). Proteins corresponding to the z and y-subunits were visualilized as distinct bands even at the highest dilution of antiserum. These bands bbecame more intense as the dilution of antiserum was decreased. The negative c control contained antiserum taken from the rabbit prior to inoculating with aantigen.

The positive control is a biotin blot analysis of the antigen at thee same concentration (1.0 gg) as used in antiserum detection (FIG. 11).

Next, the minimum amount of T. thennophilus N-terminal tagged DnaX needed for recognition by antibody serum was determined. Th'his was carried out using SDS-polyacrylamide gel electrophoresis in whichh small aliquots of T. thermophilus N-terminal tagged DnaX (0.02, 0.04, 0.088, 0.16, 0.32, 0.625, 1.25, 2.50, and 5.0 jtg/well) were electrophoresed onto, a SDS-polyacrylamide mini-gel (10 x 10 cm). The protein was transferreed onto nitrocellulose membrane. The blotted nitrocellulose was blocked in i TBST containing 5% non-fat dry milk for 1 hour at room temperature,:, rinsed with TBST. The blot were placed in antiserum/TBST (dilution of 1:64400) for 1 hour and then washed 4 times for 5 min in TBST. Next, the blot was s placed in secondary antibody-conjugated to alkaline phosphatase (goat antiti-rabbit IgG 1:3000 dilution in TBST) (BioRad) for 1 hour. The blot wivas then washed 4 times for 5 min with TBST. Following this extensive washiling, the blot was developed with BCIP/NBT (KPL #50-81-07; one component s system) (FIG. 12).

Proteins corresponding to r and y were visualized as distinct boands at 0.02 jig of DnaX. These bands became more intense as the concentra-ation of DnaX was increased (FIG. 12).

Production of monoclonal antibodies against T. thennophilus dnaX (Tz and ysubunits) Two ml of the sample of T. thennophilus DnaX was dilutedd to tg/ml in PBS (described above) was injected directly into a vial conntaining WO 01/73052 PCT//US01/09950 -93adjuvant (RIBI Adjuvant System On day 0, three mice:e were inoculated with the DnaX-adjuvant sample (0.2 ml/mouse). At day 2h1, each mouse received a booster of 0.2 ml of the DnaX-adjuvant sample. On dday 41, a test bleed was collected from tail clippings. The three mice were booosted a second time on day 44, and a second bleed from tail clippings was coollected on day 58. Antiserum from this bleed was used for Western anal9ysis as described in the section entitled "Production of polyclonal antibodies against T. thennophilus dnaX (t and y-subunits)". The antiserum was used at aa 1:400 dilution to detect 1jig/lane of T. thennophilus DnaX. The antiserum wivas also used in ELISA screening (Tissue Culture/Monoclonal Antibody FFacility, UCHSC). Mouse #2 and #3 gave equal response to T. thermophilus DDnaX in both Western analysis and ELISA screening, while mouse #1 gave aa lower response. Mouse #2 was selected and given to the Tissue Culture/Moncoclonal Antibody Facility (UCHSC) for production of mono-clonal antibodies against N- terminal tagged T. thennophilus DnaX.

Cloning T. thennophilus dnaX gene into a translationally coupled v vector pTAC-CCA-ClaI To efficiently express T/y as a native protein a vector was desiggned to express t/y as a translationally coupled proteins. The goal here is againn to use translational coupling as described Example The dnaX gene was irinserted behind the CCA adding enzyme and translationally coupled as describbed for native T. thennophilus a. First, the dnaX gene was amplified by usinpg pAl- TX as a template by PCR. The forward/sense primer (ATG primer r #P38- Slcla2, 5'-ACTTATCGATAATGAGCGCCCTCTACCGCC-3') (SEEQ ID NO:49) has a Clal restriction site in the non-complementary region. Th'he noncomplementary region also contains the "TA" of the stop (TAA) I for the upstream CCA-adding protein fragment. The region of the primer complementary to the 5' end of the T. thermophilus holA gene begins wiith "A" which is the first nucleotide of the "ATG" start codon and the final of the "TAA" stop codon. The reverse/antisence primer (ATG primer: #P38- WO 01/73052 PCTIT/USOI/09950 -94- A1603STOPspe, ATC-3) (SEQ ID NO:50) contains a SpeI restriction site in thee noncomplementary portion of the primer and also an additional stop codon adjacent to the native stop codon, giving two stop codons in tandem. There was also a clamp region for efficient cutting with SpeI. Next, the PCR pproduct was digested with ClaIISpeI restriction enzymes and inserted into the pTAC- CCA-ClaI plasmid digested with the same enzymes. The plasmiid was transformed into DH5a bacteria and plasmids from ampicillin-reesistant positive isolates were screened for by digestion with ClaIISpeI restitriction enzymes yielding 1.6 and 5.5 kb fragments. The sequence of both straands of the insert were verified by DNA sequencing (ATG SEQ #1666-1674,-, 1617, 1719; primers, P144-S23, P144-A1965, P38-S394, P38-S809, P38-SS1169, P38-A1272, P38-A946, P38-A541, P38-A282, P38-A106). Sequence annalysis confirmed the correct sequence was contained within the inserted regionn. This plasmid was named pTAC-CCA-TX and the isolate was stored as aa stock culture (ATG glycerol stock #1030).

Verification of expression of native T. thermophilus DnaX proteins by PTAC- CCA-TX/MGC1030 and pTAC-CCA-TX/AP1.L1 The pTAC-CCA-TX plasmid was prepared and transformeed into MGC1030 bacteria (ATG glycerol stock #1067, 1068, 1069) and AAP1.L1 (ATG glycerol stock #1075, 1076, 1077). The bacterial growths and iscolation of total cellular protein were as described in Example 2. A small aliqquot of each supernatant (3 jil) containing total cellular protein was electrophhoresed onto a 4-20% SDS-polyacrylamide mini-gel (Novex, EC60255; 1 mmn thick, with 15 wells/gel) in 25 mM in Tris base, 192 mM glycine, and 0.10%o SDS.

The mini-gels were stained with Coomassie Blue. The region of thhe gels expected to contain T (58.3 kDa) ory (51.0 kDa) contained many native E. coli proteins and T or y could not be visualized in any of the isolates.

WO 01/73052 PCT/r/USOI/09950 EXAMPLE 4 Identification of T. thennophilus holA gene (6-subunit) The sequences of 8-subunits from E. coli and Haemophilus inflrluenzae and putative 8-subunit sequences from Bacillus subtilis, Aquiflex aaeolicus were used to search the T. thennophilus genome database at Goetettingen Genomics Laboratory. A partial crude sequence of a region of the T.

thennophilus genome containing a putative T. thermophilus holA genne was identified (using BLAST) and obtained (from Dr. Carsten Jacobi, Goetttingen Genomics Laboratory, Institute of Microbiology and Geenetics, Grisebachstrasse 8, Goettingen, Germany). There appeared to be s several possible start sites that were all ATG and also a number of possibble stop codons. Unsure of the accuracy of the crude sequence, the region off the T.

thermophilus genome suspected of containing the T. thennophilus holAA gene and flanking regions were amplified by PCR. PCR primers were delesigned using sequences derived from the crude sequence. The forward/sense primer (ATG primer P134-S415, 5'-CGGGAGGGTGAAGCGCAAGATG3TC-3) (SEQ ID NO:51) and reverse/antisense primer (ATG primer P134-A20099, GCCGCACCCCCGCCCCGTAGT-3) (SEQ ID NO:52) usinng T.

thermophilus genomic DNA as a template yielded a PCR product 16835 bp in length which contained the region of DNA encoding holA. Thiis PCR fragment was inserted into pGEM-T Easy T M (Promega) vector per dircrections furnished by the manufacturer. The pGEM-T Easy T Vector Systemns takes advantage of the template independent addition of a single deoxyadelenosine onto the 3'-end of PCR products by some thermostable DNA polymnerases.

The PCR fragments were ligated to linearized vector DNA that haad been cleaved at the EcoRV site and had a single 3'-terminal thymidine addded to both ends. By using these vectors, PCR products can be directly cloned without further enzymatic manipulation while taking advantage of thhe high efficiency of a cohesive-end ligation. This plasmid was transformeed into bacteria and positive isolates were selected by ampicillin-resisistance.

WO 01/73052 PCT/I'/US 1/09950 -96- Plasmids from one positive clone were isolated and screened by digestioon with EcoRI restriction digest yielding 1.7 and 3.1 kb fragments. The sequaence of the inserted DNA region was confirmed by DNA sequencing (ATCG SEQ #1336-1345; primers, SP6, T7, P134-S621, P134-S1016, P134-S1279,), P134- S1633, P134-A1849, P134-A1464, P134-A1091 and P134-A655). Nunmerous base changes were observed in the PCR clone compared to the crude seequence obtained from Goettingen Genomics Laboratory. An 876 bp open r reading frame (ORF) was identified in the region containing the putatitive T.

thermophilus holA gene. This isolate was stored as a stock culture (ATG glycerol stock #787).

The ORF identified in the PCR product above was amplified bby PCR with T. thermophilus genomic DNA as a template. The forward/sense primer (ATG primer #P134-S585de).

5'-GGATCCAAGCTTCATATGGTCATCGCCTTCAC-3) (SEEQ ID NO:53) contained a region complementary to the 5' end of the ORF. AAn NdeI site overlapped the ATG start codon, and there was also an upstream I HindIII and BamHI site. The reverse/antisense primer (ATG primer #P134- A1493kpn, 5'-AGATCTGGTACCTCATCAACGGGCGAGGCGGAAG-3') (SEQ ID NO:54) contained an additional stop codon adjacent to the native stop codon in the non-complementary region, giving two stop coddons in tandem. There was a KpnI site upstream of the stop codons and a BgM restriction site upstream of the KpnI restriction site. This PCR fragmetent was inserted into pGEM-T Easy T M plasmids (Promega) as per manuf:facturer directions. The plasmid was then transformed into DH5ca bactenria and plasmids from ampicillin-resistant positive isolates were screenned by NdeI/KpnI restriction digest yielding 0.9 and 3.0 kb fragments. The seequence of both DNA strands of the inserted region was confirmed by y DNA sequencing (ATG SEQ #1392-1397, 1408; primers, SP6, T7, P134-;-S1279, P134-S1633, P134-A1464, P134-A790 and P134-A1849). This plasmnid was named pT-TD(Kpn) and the isolate was stored as a stock culture (ATG glycerol stock #817).

WO 01/73052 PCT//U S 1/09950 -97- The DNA coding sequence of the T. thermophilus holA gene (SBEQ ID NO:9) is shown in FIG. 13. The start codon (atg) and the stop codon (tgtga) are in bold print. Also shown, in FIG. 14, is the protein (amino acid) secquence (SEQ ID NO:10) derived from the DNA coding sequence.

The amino acid sequence of T. thermophilus 8-subunit was cormpared with the E. coli 5-subunit (FIG. 15). Alignments were also made withh all of the 8-subunit sequences used in the T. thermophilus database search, 1 E. coli and Haemophilus influenzae and putative 5-subunit sequences from BBacillus subtilis and Aquiflex aeolicus (FIG. 16). The T. thermophilus 5-subunnit was 34 29%, 31% and 27% identical over a 193, 182, 110 and 169 aminno acid overlap with E. coli, H. influenzae, A. aeolicus and B. subtilis respectively.

Construction of a Plasmid (pAl-NB-TD) that Overexpress T. thennaophilus holA (8-subunit) Fused to an N-Terminal Peptide That Contains Hexahiiistidine and a Biotinylation Site Since the 8-subunit coupled to a C-terminal fusion peptide exppressed poorly (described below), it was decided to attempt enhancemoent of expression by coupling the holA gene to an N-terminal fusion peptide. The T.

thennophilus holA gene was inserted into the pAl-NB-Avr2 plasmidd to be expressed fused to an N-terminal peptide containing hexahistidine and a biotinylation site. The holA gene was amplified by PCR using the phAl-TD plasmid as a template. The forward/sense primer adds a Pstl site to thee of the gene so that the actual PCR product excludes the ATG start coddon and begins at codon 2, with the Pstl site adjacent to codon 2 (ATG primer:r P134- S592pst, 5'-GAATTCTGCAGGTCATCGCCT TCACCG-3') (SEEQ ID NO:11). The PstI site will bring the holA gene into frame with the N-te:erminal fusion peptide and will add two amino acids (Leu and Gin) between the Nterminal fusion peptide and the second codon of the holA gene. The r reverse primer was the same primer used in making pAl-TD (P134-A1493kpn)i). This primer was designed so two things could be accomplished. First, an addditional WO 01/73052 PCT/f/USOI/09950 -98- TGA (stop codon) was added to the end of the gene giving two stop coddons in tandem (the natural stop codon and another one added in thee noncomplementary part of the primer). Second, a KpnI restriction site was s added in the non-complementary region of the primer for insertion into the 1 vector.

There was also a clamp region for efficient digestion with KpnI. Thae PCR product was digested with PstI and KpnI restriction enzymes and inserteted into the pAl-NB-Avr2 plasmid digested with the same enzymes. The plasmnid was transformed into DHSc5 bacteria and plasmids from ampicillin-reesistant positive isolates were screened for by digestion with PstI and KpnI rest3triction enzymes yielding 0.9 and 5.62 kb fragments. This plasmid was selectcted and the sequence of both strands of the insert was verified by DNA sequuencing (ATG SEQ #1530-1536; primers, P64-S10, P64-A215, P134-S1279,, P134- S1633, P134-A1849, P134-A1464, P134-A790). This plasmid was i named pAl-NB-TD and the isolate was stored as a stock culture (ATG glycerobl stock #915).

Verification of Expression of T. thermophilus &subunit Fused to an N- Terminal Peptide That Contains Hexahistidine and a Biotinylation SSite by pAl-NB-TD/MGC1030 The pAl-NB-TD plasmid was prepared and transformedd into MGC1030 bacteria (ATG glycerol stock #931). The bacterial growtlths and isolation of total cellular protein were as described in Example 2. Ak small aliquot of each supernatant (3 pIl) containing total cellular proteiiin was electrophoresised onto a 4-20% SDS-polyacrylamide mini-gel (FNovex, EC60255; 1 mm thick, with 15 wells/gel) in 25 mM in Tris base, 1992 mM glycine, and 0.1% SDS. The mini-gels were stained with Coomassie BBlue. A protein migrating just below the 40 kDa molecular weight standard I of the Gibco 10 kDa protein ladder could be detected as a distinct protein bannd, but was not observed in the uninduced control. This protein band correspoonds to the expected molecular weight of the T. thermophilus 5-subunit fusedI to the N-terminal fusion protein (36.2 kDa).

WO 01/73052 PCT/rUSO 1/09950 -99- Next, the total protein in each lysate was transferred (blottedd) from polyacrylamide gel to nitrocellulose as described in Example 2. Eactch lane contained 1.5 ul of the supernatant. The endogenous E. coli biotin-caarboxyl carrier protein (biotin-CCP), -20 kDa, was detectable in both inducced and non-induced samples. A very intense protein band corresponding to) the 6subunit migrated just below the 40 kDa molecular weight standards i of the Gibco 10 kDa protein ladder. This protein was observed as a distinct bband in the induced cultures, but was not observed in the uninduced control.

Optimization of Expression of T. thermophilus holA gene (8-subunit) bpy pAl-

NB-TD

Expression was analyzed using the bacterial strains AP1.LI ccarrying the pAl-NB-TD plasmid at different induction times. Bacterial growt)ths and analysis were carried out as described Example 2. The growths and aanalysis were at 37C. The total protein was analyzed using both SDS-polyacry.ylamide gel electrophoresis and biotin blot analysis (FIG. 17). Distinct proteinn bands corresponding to the 6-subunit was observed by both forms of analysis. Biotin blot analysis indicates that most of the 5-subunit is being expressed in 44 hours and at 37°C, these growth condition were used in subsequent preparationns.

Large Scale Growth of T. thennophilus holA Gene Product (8-subunit)t) Fused to an N-Terminal Peptide That Contains Hexahistidine and Biotinylaticion Site by pAl-NB-TD/MGC1030 Strain pAl-NB-TD/MGC1030 was grown in a 250 L fermeentor to produce cells for purification of T. thermophilus 6-subunit as descriribed in Example 2. Cell harvest was initiated 3 hours after induction, at OD 600 0 of 7.2, and the cells were chilled to 10°C during harvest. The harvest volunme was 175 L, and the final harvest weight was approximately 2.47 kg of cellll paste.

An equal amount of 50 mM Tris (pH 7.5) and 10% sucrose solutidon was added to the cell paste. Quality control results showed 10 out of 10 ppositive colonies on ampicillin-containing medium in the inoculum and 10/10 ppositive WO 01/73052 PCT/r/US01/09950 -100colonies at harvest. Cells were frozen by pouring the cell suspensioon into liquid nitrogen, and stored at -20°C, until processed.

Determination of Optimal Ammonium Sulfate Precipitation Conditionns of 8 Fused to an N-Terminal Peptide That Contains Hexahistidince and Biotinylation Site by pAl-NB-TD/MGC1030 Lysis was accomplished by creation of spheroplasts of thee cells carrying the expressed T. thennophilus 8-subunits. First, from 100 g otf a 1:1 suspension of frozen cells (50 g cells) in Tris-sucrose which had been sttored at 0 C, FrI was prepared (160 ml, 23 mg/ml). The preparation vwas as described in Example 2. FrI was added to 2.4 ml of a 50% slurry of NNi-NTA resin equilibrated in Ni-NTA suspension buffer (50 mM Tris-HC1, (pbH mM KC1, 7 mM MgCl2, 10 glycerol, 7 mM PME). The resin and s sample were rocked for 1.5 hours at 4 0 C. The sample was then passed through i a 5 ml fritted polypropylene column (Qiagen) to filter out the Ni-NTA resisin and bound 8. The resin was washed by passing 50 ml of Ni-NTA wash i buffer through the column and eluted in 9 ml of Ni-NTA elution buffer (2.6 mgg/ml).

The eluted sample was brought to 40 ml by added Ni-NTA susppension buffer. The sample was then divided into 4 equal volumes (10 ml) anad 1.64, 2.26, 2.91 and 3.61 g of ammonium sulfate 40%, 50% anad saturation) was added to each separate sample, respectively, over a 115 min interval at 4 0 C. The mixture was stirred for an additional 30 min at 4'°C and the precipitate was collected by centrifugation (23,000 x g, 45 min, 0 The resulting pellets were resuspended in 1 ml Ni-NTA suspension bufferr. The protein concentration of each sample was determined using the Cooomassie Protein Assay Reagent (Pierce) and bovine serum albumin (BSA\) as a standard. The 30%, 40%, 50% and 60% ammonium sulfate preciipitated samples contained protein concentrations of 0.4, 2.6, 3.2 and 3.5 i mg/ml, respectively. The samples were analyzed by SDS-polyacrylamidde gel electrophoresis (FIG. 18).

WO 01/73052 PCT/I/U SO 1/09950 -101- The 50% and 60% ammonium sulfate precipitated samples conntained equal amounts of the 6-subunit. The 40% ammonium sulfate precilipitated samples contained approximately 90 of that of the 50% andd ammonium sulfate precipitated samples, while the 30% ammonium :sulfate precipitated sample contained very small amounts of the 8-subunit. Allll future preparations of the 8-subunit will be ammonium sulfate precipitated a at saturation.

Purification of T. thennophilus holA Product (8-subunit) Fused to an N- Terminal Peptide That Contains Hexahistidine and a Biotinylation Site bby pAl-NB-TD/MGC1030 Lysis was accomplished by creation of spheroplasts of thee cells carrying expressed T. thermophilus 6. First, from 800 g of a 1:1 suspennsion of frozen cells (400 g cells) in Tris-sucrose which had been stored at FrI was prepared (1280 ml, 30.8 mg/ml). The preparation was as desscribed Example 2. To Fr I, ammonium sulfate (0.226 g to each initial ml Fraaction Isaturation) was added over a 15 min interval. The mixture stirredd for an additional 30 min at 4°C and the precipitate was collected by centrifu'ugation (23,000 x g, 45 min, The resulting pellets were quick froazen by immersion in liquid nitrogen and stored at -80 0

C.

The pellets from Fr I were resuspended in 160 ml of Nil-NTA suspension buffer and homogenized using a Dounce homogenizer.:. The sample was clarified by centrifugation (16,000 x g) and the supermatant constituted Fr II (27.6 mg/ml). Fr II was added to 50 ml of a 50% sldurry of Ni-NTA resin and rocked for 1.5 hours at 4°C. This slurry was then loaded onto a BioRad Econo-column (2.5 x 5 cm). The column was washed wilith 250 ml of Ni+-NTA wash buffer at a flow rate of 0.5 ml/min. The proteiein was eluted in 230 ml of Ni++-NTA elution buffer containing a 10-2000 mM imidazole gradient. The eluate was collected in 92 x 2.5 ml fraactions.

Fractions were analyzed by SDS-polyacrylamide gel electrophoresisis, and fractions 25-92 were found to contain 5 that was over 95% pure (FIGgs. 19A WO 01/73052 PCT/r/USOI/09950 -102and 19B). Fractions 25-92 were pooled (160 ml, 2.3 mg/ml) and dicialyzed against 3.5 L of HG.04 buffer (20 mM Hepes, (pH 40 mM KC1, 1 mM MgCI 2 0.1 mM EDTA, 6 mM PME, 10% glycerol). The dialyzed ssample constituted Fr III (160 ml, 2.1 mg/ml). The sample was aliquoted, fast t frozen in liquid nitrogen and stored at -80 0

C.

Production of polyclonal antibodies against T. thermophilus holA (8-subounits) To recover ultra-pure protein for antibody production thirty mlil of subunit Fr m from above (2.1 mg/ml) was precipitated using ammnonium sulfate (7.75 g per initial ml of Frim, 45% saturation). The precipitated 1 pellets were resuspended in 20 ml PBS and purified using UltraLink Immobbilized Monomeric Avidin column as described in Example 3. The protein eelution profile of the avidin column is shown in FIG. 20. Fractions 2-6 (5 ml)l) were pooled (0.35 mg/ml). FIG. 21 shows the SDS-PAGE analysis of the AAviden column profile for T. thermophilus The pooled samples were used to produce polyclonal antilibodies against T. thermophilus holA gene product (5-subunit) as descrihbed in Example 3.

Construction of Plasmid (pAl-TD) that Overexpresses T. thennophilus hholA gene (6 -Subunit) as a Native Protein Prior to construction of vector pAl-NB-TD to express 8 as an Nterminal tagged protein, several attempts were made to first express i 8 as a native and a C-terminal tagged protein. These attempts were unsucces:ssful in producing adequate yields of 8 to justify purification attempts. These atittempts are described in this section.

The T. thennophilus holA gene contained within the plasmiid pT- TD(Kpn) was extracted by digestion of the plasmid with Nde'eIIKpnI restriction enzymes. This 0.9 kb fragment was inserted into pAl-CEB-NdeI WO 01/73052 PCT/I/USOI/09950 -103which had been digested with the same restriction enzymes. The "A'TG" of the NdeI site served as the start codon for the holA gene. This placed thhe start codon the correct distance (11 nucleotides) from the RBS for opptimum translation. This plasmid was then transformed into DH5c bacteriria, and plasmids from ampicillin-resistant positive isolates were screened :for by digestion with NdeI and KpnI restriction enzymes yielding 0.9 and 55.65 kb fragments. One plasmid was selected and the sequence of the insert vverified by DNA sequencing (ATG SEQ #1428 and 1429, primers P38-S55576 and P134-S1633). This plasmid was named pAl-TD and the isolate was stctored as a stock culture (ATG glycerol stock #841).

Verification of Expression of Plasmid (pAl-TD) that Overexpres:sses T.

thermnophilus holA Gene (8-Subunit) as a Native Protein fromn pAl- TD/MGC1030 Plasmid pAl-TD was prepared from DH5co bacteria and transisformed into MGC1030 bacteria (ATG glycerol stock #856, 857, 858). The boacterial growths of three isolates and isolation of total cellular protein wwere as described Example 2. A small aliquot (3 ld) of supernatant containinng total cellular protein from each of the three isolates was electrophoresed onnto a 4- SDS-polyacrylamide mini-gel (Novex, EC60255; 1 mm thick, mwith wells/gel) in 25 mM in Tris base, 192 mM glycine, and 0.1% SDS. Thce minigel was stained with Coomassie Blue. There were no visible proteinn bands from any of the isolates corresponding to the predicted molecular weighht of 8.

Construction of a Plasmid (pAl-CB-TD) that Overexpresses T. thermncophilus holA gene (5-subunit) Fused to a C-Terminal Peptide That CContains Hexahistidine and a Biotinylation Site Again, since attempts to express the native -subunit failed, wwe next tried to express this protein coupled to a C-terminal fusion peptide. Thhe holA gene was amplified by PCR with T. thermophilus genomic DNA as a tecmplate.

The forward/sense primer (ATG primer #P134-S585'de) was the same primer WO 01/73052 PCT/f/USO01/09950 S-104used in construction of named pT-TD(Kpn) and contained a region C1 complementary to the 5' end of the gene. Also, a NdeI site overlappped the ATG start codon, and there was also an upstream HindII and BamEHI site.

The reverse/antisense primer was complementary to the 3' end of thhe ORF r 5 excluding the stop codon (ATG primer #P134-A1486spee, SGAGGACTAGTACGGGCGAGGCGGAGGACC-3') (SEQ ID NO:43)1). This primer contained a SpeI restriction site adjacent to the complementary region Sof the primer. The SpeI site allowed for the expressed protein to contatain two additional amino acids (Thr and Ser) between the C-terminal amino acidd of the 8-subunit and the C-terminal fusion peptide. This 901 bp PCR produuct was inserted into pGEM-T Easy M as previously described in the section e entitled "Identification of T. thermophilus holA gene (8-subunit)". This plasmnid was transformed into DH5at bacteria and plasmids from ampicillin-reresistant positive isolates were screened for by digestion with Ndel and KpnI reststriction enzymes yielding 0.9 and 3.0 kb fragments. Both strands of the inseert were verified by DNA sequencing (ATG SEQ #1398-1403 and 1409-1411; pprimers, SP6, T7, P134-S1279, P134-S1633, P134-A1464, P134-A790, P134-4-S1279, P134-A1849). This plasmid was named pT-TD(Spe) and the isolaiate was stored as a stock culture (ATG glycerol stock #818).

Plasmid pT-TD(spe) was prepared and the holA gene was extraacted by digestion with NdeI and KpnI restriction enzymes. This 0.9 kb fragmaent was inserted into the pAl-CB-NdeI plasmid digested with the same reststriction enzymes. This plasmid was transformed into DH5a bacteria and phlasmids from ampicillin-resistant positive isolates were screened for by digestidon with NdeI and KpnI restriction enzymes yielding 0.9 and 5.65 kb fragmentats. The sequence of the inserted DNA fragment was confirmed by DNA sequuencing (ATG SEQ 1430,1431; primers, P38-S5576 and P134-S1633). This pplasmid was named pAl-CB-TD and the positive isolate was stored as a stock c culture (ATG glycerol stock #842).

WO 01/73052 PCT/f/US01/09950 -105- Verification of Expression of T. thennophilus 8-subunit Fused to a C-Te:erminal Peptide That Contains Hexahistidine and a Biotinylation Site by pA41-CB- TD/MGC1030 The pAl-CB-TD plasmid was prepared and transformedd into MGC1030 bacteria (ATG glycerol stock #859). The bacterial growths oof three isolates and isolation of total cellular protein were as described Examnple 2.

A small aliquot of each supernatant (3 pl) containing total cellular I protein from each isolate was electrophoresised onto a 4-20% SDS-polyacrylylamide mini-gel (Novex, EC60255; 1 mm thick, with 15 wells/gel) in 25 mM i in Tris base, 192 mM glycine, and 0.1% SDS. The mini-gels were staineed with Coomassie Blue. The region of the gel in which CB-TD was exxpected contained other intense protein bands and 8 could not be visualized.

Next, the total protein in each lysate was transferred (blotted'd) from polyacrylamide gel to nitrocellulose as described in Example 2. Eac.ch lane contained 1.5 ul of the supernatant. The endogenous E. coli biotin-CCEP, kDa was detectable in both induced and non-induced samples. A ver:ry faint protein band corresponding to 5 migrated just below the 40 kDa moblecular weight standard of the Gibco 10 kDa protein ladder. The predicted moblecular weight of 8 is 36.2 kDa. This protein was observed as a faint band 1 in the induced cultures, but was not observed in the uninduced control in I lysates.

The intensity of the protein bands indicated 8 was being expressed at veery low levels.

Cloning T. thermophilus holA gene into a translationally coupled vecctor pTAC-CCA-ClaI To efficiently express 8 as a native protein we designed a veector to express 8 as a translationally coupled protein. As with expression of DInaX as a translationally coupled protein, our goal here is also to use translational coupling as described in the Example 2. The holA gene was inserted 1 behind the CCA adding enzyme and translationally coupled in two steps. Firirst, the WO 01/73052 PCT/f/US01/09950 106holA gene was amplified using pAl-TD as a template by PCRR. The forward/sense primer (ATG primer #P134-S588cla2, ACTGATCGATAATGGTCATCGCCTTCAC-3) (SEQ ID NO:55) has a ClaI restriction site in the non-complementary region. As in the ccloning strategy developed for pTAC-CCA-TX, the non-complementary regioon also contains the "TA" of the stop (TAA) for the upstream CCA-adding T protein fragment. The region of the primer complementary to the 5' end of C the T.

thermophilus holA gene begins with which is the first nucleotide of the "ATG" start codon and the final of the "TAA" stop codon.. The reverse/antisence primer (ATG primer #P134-A1491stopspep, GAGGTACTAGTCATCAACGGGCGAGGCGGAGGA-3) (SEQ ID 1SNO:56) contains a Spel restriction site in the non-complementary portion of the primer and also an additional stop codon adjacent to the native stop codon, giviiing two stop codons in tandem. There was also a clamp region for efficient cutting with Spel. Next, the PCR product was digested with ClaIlSpeI reststriction enzymes and inserted into the pTAC-CCA-ClaI plasmid digested wivith the same enzymes. The plasmid was transformed into DH5ca bacteriria and plasmids from ampicillin-resistant positive isolates were screened 1 for by digestion with ClalISpeI restriction enzymes yielding 0.9 and 55.5 kb fragments. The sequence of both strands of the insert were verified byy DNA sequencing (ATG SEQ #1675-1681; primers, P144-S23, P144-A19655, A106, P134-S1279, P134-S1633, P134-A1849, P134-A1464, P134--A790).

Sequence analysis confirmed that the correct sequence was contained I within the inserted region. This plasmid was named pTAC-CCA-TD and the isolate was stored as a stock culture (ATG glycerol stock #1031).

Verification of expression of native T. thermophilus 8-subunit by PTACC-CCA- TD/MGC1030 and pTAC-CCA-TD/AP1.L1 The pTAC-CCA-TD plasmid was prepared and transformeed into MGC1030 bacteria (ATG glycerol stock #1070) and API.L1 (ATG gglycerol stock #1078). The bacterial growths and isolation of total cellular protei-in were WO 01/73052 PCT/F/IS01 /09950 -107as described in Example A small aliquot of each supernatant (3 p.1) containing total cellular protein was electrophoresised onto a 4-20% SDSpolyacrylamide mini-gel (Novex, EC60255; 1 mm thick, with 15 wells/;/gel) in mM in Tris base, 192 mM glycine, and 0.1% SDS. The mini-gelsis were stained with Coomassie Blue. A protein band corresponding to the preredicted molecular mass of T. thennophilus 5 (32.5 kDa) was visualized mipgrating mid-way between the 30 and 40 kDa molecular weight standard of the 2 Gibco kDa protein ladder.

Large Scale Growth of pAl-CCA-TD/AP1.L1 Strain pAl-CCA-TD/AP1.LI was grown in a 250 L fermenntor to produce cells for purification of native T. thennophilus 8 as descrilibed in Example Optimum induction times were determined as descriibed in Example Cell harvest was initiated 3 hours after induction, at ODD 00 oo of 3.38, and the cells were chilled to 10 0 C during harvest. The harvest vvolume was 180 L, and the final harvest weight was approximately 1.56 kg of cell paste. An equal amount of 50 mM Tris (pH 7.5) and 10% s sucrose solution was added to the cell paste. Quality control results showed 100 out of 10 positive colonies on ampicillin-containing medium in the inoculuum and 10/10 positive colonies at induction and 10/10 positive colonies at hharvest.

Cells were frozen by pouring the cells suspension into liquid nitrogeen, and stored at -20 0 C, until processed.

Purification of native T. thennophilus 8 from pAl-CCA-TD Lysis was accomplished by creation of spheroplasts of thne cells carrying the expressed T. thermophilus 8 -subunits. First, from 300 g oof a 1:1 suspension of frozen cells (150 g cells) in Tris-sucrose which had beenn stored at -20 OC, FrI was prepared (930 ml, 16.4 mg/ml). The preparation was as described in Example To Fr I, ammonium sulfate (0.258 g to eachh initial WO (11/73052 PCT/r/ISO 1/1)9950 -108ml Fraction 1-45% saturation) was added over a 15 min interval. The rrmixture stirred for an additional 30 min at 4 °C and the precipitate was collec:cted by centrifugation (23,000 x g, 45 min, 0 OC). The resulting pellets weree quick frozen by immersion in liquid nitrogen and stored at -80 OC.

In the following purification steps, fractions from purification ccolumns were assayed using the reconstitution assay (described in Examplee 7) to determine fractions that contained activity and therefore the 8-subunitit. The first purification step was conducted by Q Sepharose High Perfonrmance (Amersham Pharmacia) column chromatography (200 ml, 5.5 x 13 cm1). The Q Sepharose resin was equilibrated in Q-sepharose equilibration buffffer mM Tris-HC1, (pH 10% glycerol, 1 mM EDTA, 1 mM DTT, 110 mM KCI). The pellets from Fr I was resuspended in Q-sepharose resusppension buffer (25 mM Tris-HC1, (pH 10% glycerol, 1 mM EDTA, 1 mMA DTT) and homogenized using a Dounce homogenizer and clarified by centrififugation (16,000 x The sample was diluted in Q-sepharose resuspension buffefer until the conductivity reached that of the equilibrated column and constituteed Fr II (2250 ml, 0.8 mg/ml). Fraction II contained 3.5 x 10 9 units of activity r at 1.84 x 106 units/mg protein. The sample was loaded onto the column and vwashed with 5 column volumns of Q-sepharose equilibration buffer. The waash was collected in 17 ml fractions (50 fractions). Analysis of the flow througlgh from the column load and the fractionated wash indicated that 8 was presentit in the flow through from the column load and the first fractions from the ccolumn wash. The flow through from the column load and fractions 1-13 1 of the column wash were pooled and constituted FrI (2470 ml, 0.05 SDSpolyacrylamide gel analysis of the pool indicated that T. thermophilus.s 5 had been purified over 16 fold by this purification step and contained 3.55 x 109 units of activity at 3.2 x 10 7 units/mg protein.

Fr IH was further purifed using Macro Prep Methyl HIC SSupport (BioRad) column chromatography. The methyl resin (60 ml) was equililibrated in methyl equilibration buffer (50 mM Tris-HCI, (pH 10% glyccerol, 1 mM EDTA, 1 mM DTT, 1 M ammonium sulfate). The column was poured WO 01/73052 PCT/F/USO1/09950 -109using 40 ml of methyl resin. The remaining 20 ml of methyl resin was mixed with Fr III giving 2490 ml. To this mixture, saturated ammonium sulfatate sample volume) was added slowly while stirring over a 1 hour period.l. This mixture was added to the column and allowed to flow through the coluumn by gravity. The column was then washed with 5 column volumns (300 1 ml) of methyl equilibration buffer. The protein was eluted in 10 column volunmes of mM Tris-HC1, (pH 10 glycerol, 1 mM EDTA, 1 mM DTT buffer containing a 0.9 to 0.1 M gradient of ammonium sulfate and collected ilin 7 ml fractions (80 fractions). Fractions 29-42 contained T. thermophilus 8 thhat was over 90% pure. These fractions were pooled and analyzed using reconstititution assays (see Example 7) and SDS-polyacrylamide gels. The pooled fra-actions (100 ml, 0.14 mg/ml) constituted Fr IV and contained 1.7 x 10 9 unnits of activity at 1.23 x 108 units/mg protein.

T. thennophilus 8 was further purified using a Sephacryl S3000 HR (Pharmacia Biotech) gel filtration column (510 ml, 3 cm x 1220 cm) equilibrated in 50 mM Tris-HC1, (pH 20 glycerol, 100 mM NNaCI, 1 mM EDTA, 5 mM DTT. The volume of Fr IV was reduced using PEG 8-8000 to ml (0.22 mg/ml, 8.2 x 10 8 Units). The sample was loaded onnto the Sephacryl S-300 column and the protein eluted at a flow rate of 0.7 mnl/min.

The 8-subunit was isolated as a highly purified protein (24 ml, 0.2 mng/ml).

The pooled fractions constituted Fr V and contained 5.8 x 10 8 units of aactivity at 1.23 x 108 units/mg protein.

EXAMPLE Identification of T. thennophilus holB gene (8'-subunit) The amino acid sequence of 8' from E. coli was used to search h the T.

thermophilus genome database at Goettingen Genomics Laboratory. A k partial crude sequence of a region of the T. thermophilus genome contaitining a putative T. thermophilus holB gene was identified (using BLAS'IT) and obtained (from Dr. Carsten Jacobi, Goettingen Genomics Laboratory, Irinstitute WO 01/73052 PCT/T/U S0/09950 cN -110of Microbiology and Genetics, Grisebachstrasse 8, Goettingen, Gem-many).

Unsure of the accuracy of the crude sequence, the region of i the T.

thermophilus genome suspected of containing the T. thennophilus hoIIlB gene IN and flanking regions were amplified by PCR. Two sets of PCR primerrs were 5 designed using sequences derived from the crude sequence to insure tithat the 0 proper sequence was identified. The first PCR reaction (ATG primerss P139- S 181, 5'-GGGGGACCGGATCGCCTTCTA-3' (SEQ ID NO:12) and P139- 0 A1082, 5'-GTACGCCCACGGTCATGTCTCTAAGTCT AAG-3' (SBEQ ID NO: 13)) used T. thennophilus genomic DNA as a template and yielded I a PCR product of 901 bp fragment. This PCR fragment was inserted into pCGEM-T Easy M (Promega) vector per manufacturers directions. This plasmiid was transformed into DH5a bacteria and ampicillin-resistant positive isolate:es were screened for by plasmid digestion with EcoRI restriction digest yieldiling 0.9 and 3.0 kb fragments. The correct sequence of both strands of the DNAA in the inserted region were identified by DNA sequencing across the inserted 1 region (ATG SEQ #1363, 1365-1367, 1379-1380; primers, SP6, T7, P1399-S651, P139-S321, P139-A681, P139-A287). Three base changes (deletions obf a "C" at positions 845 and 849, and G>C change at position 681) were obsecrved in the PCR clone compared to the crude sequence obtained from Goetttingen Genomics Laboratory. The deletions caused a frameshift leading to aa larger open reading frame (ORF) (804 bp) than was seen in the crude sequencee. This plasmid was named pT-TD'-1 and the isolate was stored as a stock 1 culture (ATG glycerol stock #811).

The second PCR reaction utilized primers placed farther out frcrom the putative holB gene (ATG primers #P139-S91, 5'-CTCCCCCCCTCG3GTGC GGGCCCTGGTGAA-3' (SEQ ID NO:14) and #P139-A1407, CTGTAGTGGATGACG-3' (SEQ ID NO:15)) and also used t the T.

thennophilus genomic DNA as a template and yielded a PCR product oof 1361 bp fragment. This PCR fragment was also inserted into pGEM-T I EasyTM (Promega) vector per manufacturer directions. This plasmid waas also transformed into DH5a bacteria and ampicillin-resistant positive isolatetes were WO 01/73052 PCT//US01109950 -111screened for by plasmid digestion with EcoRI restriction digest yieldiling 1.3 and 3.0 kb fragments. The correct sequence of both strands of the DNAA in the inserted region were identified by DNA sequencing (ATG SEQ #13688-1372, 1381-1383; primers, SP6, T7, P139-S651, P139-S321, P139-1042,, P139- A681, P139-A287, P139-A1082). Other base changes were observed inn the 3' non-translated region when compared to the crude sequence obtaineed from Goettingen Genomics Laboratory. This plasmid was named pT-TD'-2 a and the isolate was stored as a stock culture (ATG glycerol stock #812).

The DNA coding sequence of the T. thermophilus holB gene (SSEQ ID NO:16) is in FIG. 22. The start codon (atg) and the stop codon (tga)L) are in bold print. Also shown, in FIG. 23, is the protein (amino acid) sequencee (SEQ ID NO: 17) derived from the DNA coding sequence.

The amino acid sequence of T. thermophilus 6' was compareied with that of the E. coli 6'-subunit (FIG. 24). Other sequence alignmentits were carried out with 6' sequences from Bacillus subtilis, E. coli, and Haemaophilus influenzae, Rickettsia and putative 8' sequences from Aquiflex aaeolicus (FIG. 25). The T. thermophilus 6'-subunit was 30 29%, 31%, 399% and 31% identical over a 163, 149, 229, 104 and 104 amino acid overla:ap with Bacillus subtilis, E. coli, and Haemophilus influenzae, Rickettsia and a putative 5'-subunit sequences from Aquiflex aeolicus, respectively.

Construction of a Plasmid (pAl-NB-TD') that Overexpress T. thennaophilus holB Fused to an N-Terminal Peptide That Contains Hexahistidinoe and a Biotinylation Site To enhance expression of the T. thermophilus 5'-subunit, thae holB gene was cloned into the pAl-NB-AgeI plasmid to be expressed fuseed to an N-terminal peptide containing hexahistidine and a biotinylation site. Thhe holB gene was amplified by PCR using the pAl-TD' plasmid (described beblow) as a template. The forward/sense primer adds a Pstl site to the 5' end of thhe gene so that the actual PCR product excludes the ATG start codon and bepgins at codon 2 with the Pstl site adjacent to codon 2 (ATG primer P139-S3254pst, WO 01/73052 PCT/f/US0O1/09950 S-112- ACCCGGCTCACCC (SEQ ID NO: 18)).

The PstI site will bring the holB gene into frame with the N-terminal I fusion peptide and will add two amino acids (Leu and Gin) between the N-teerminal O fusion peptide and the second codon of the holB gene. The reverse primer 5 (ATG primer P139-A1081stopspe, O GGACACTAGTTCATCATGTCTCTAAGTCTAA-3' (SEQ ID NO:1 9) was complementary to the 3' end of the holB gene including the additionahl TGA O (stop codon). Also, a SpeI restriction site was added in thee noncomplementary region of the primer for insertion into the vector. Theere was also a clamp region for efficient cutting with SpeI. The PCR produuct was digested with PstIISpeI restriction enzymes and inserted into the pAM1-NB- Agel plasmid digested with the same enzymes. The plasmid was transfiformed into DH5a bacteria and plasmids from ampicillin-resistant positive iisolates were screened for by digestion with PstIISpeI restriction enzymes yieldiling 0.8 and 5.6 kb fragments. The sequence of both strands of the insert were v.verified by DNA sequencing (ATG SEQ #1537-1541, 1543; primers, P64-S100, P64- A215, P139-S321, P139-S651, P139-A681, P64-A215). Sequence aianalysis confirmed that the correct sequence was contained within the inserted i region.

This plasmid was named pAl-NB-TD' and the isolate was stored as aa stock culture (ATG glycerol stock #913).

Verification of Expression of T. thernophilus 8'-subunit Fused to an N- Terminal Peptide That Contains Hexahistidine and a Biotinylation SSite by pAl-NB-TD'/MGC1030 The pAl-NB-TD' plasmid was prepared and transformeed into MGC1030 bacteria (ATG glycerol stock #930). The bacterial growttths and isolation of total cellular protein were as Example 2. A small aliquot c of each supernatant (3 containing total cellular protein was electrophoresiseed onto a 4-20% SDS-polyacrylamide mini-gel (Novex, EC60255; 1 mm thickk, with wells/gel) in 25 mM in Tris base, 192 mM glycine, and 0.1% SDSS. The mini-gels were stained with Coomassie Blue. A protein migrating just;t below WO 01/73052 PCT/r/USOI/09950 -113the 40 kDa molecular weight standard of the Gibco 10 kDa protein I ladder could not be detected in the lysates.

Next, the total protein in each lysate was transferred (blotted)) from polyacrylamide gel to nitrocellulose as described Example 2. The endopgenous E. coli biotin-CCP, -20 kDa, was detectable in both induced and non-irinduced samples. An intense protein band corresponding to T. thermophizilus migrated midway between the 30 and 40 kDa molecular weight standalards of the Gibco 10 kDa protein ladder. The predicted molecular weightit of T.

thennophilus 8' is 33 kDa. This protein was observed as a distinct bandd in the induced cultures, but was not observed in the uninduced control in lysatetes.

Optimization of Expression of T. thennophilus holB gene (8'-subunnit) by pA -NB-TD' Expression was analyzed using the bacterial strains API.L1 caarrying the pAl-NB-TD' plasmid at different induction times. Bacterial growt'ths and analysis were carried out as described Example 2. The growths and aianalysis were at 37°C. The total protein was analyzed using both SDS-polyacrylylamide gel electrophoresis and biotin blot analysis (FIG. 26). Distinct proteinn bands corresponding to 8' were observed by both forms of analysis. Biotitin blot analysis indicated that most of the 8'-subunit is being expressed in 4 houurs and at 37°C, these growth condition were used in subsequent preparations.

Determination of Optimal Ammonium Sulfate Precipitation Conditions s of the 5'-subunit Fused to an N-Terminal Peptide That Contains Hexahistidiiine and Biotinylation Site by pAl-NB-TD'/MGC1030 Lysis was accomplished by creation of spheroplasts of thee cells carrying the expressed T. thennophilus 8'-subunits. First, from 76.4 g oof a 1:1 suspension of frozen cells (38.2 g cells) in Tris-sucrose which had beenn stored at -20 0 C, FrII was prepared and purified using a Ni"-NTA coluumn as described in Example 2. The eluted sample was brought to 40 ml byy added WO 01/73052 PCT/T/U SO 1/09950 C- 114- Ni-NTA suspension buffer. The sample was then divided into 4 equal Svolumes (10 ml) and 1.64, 2.26, 2.91 and 3.61 g of ammonium sulfate- 50% and 60% saturation) was added to each separate s:sample, I respectively, over a 15 min interval at 4 0 C. The mixture rested for an additional 30 min at 4 0 C and was then centrifuged at 23,000 x g for 45 i min at O 0C. The resulting pellets were resuspended in 1 ml Ni-NTA susppension buffer. The 30%, 40%, 50% and 60% ammonium sulfate precipitated ssamples Ocontained protein concentrations of 0.47, 0.55, 1.3 and 1.2 rmg/ml, respectively. The samples were analyzed by SDS-polyacrylamicide gel electrophoresis. All four ammonium sulfate precipitated samples conntained equal amounts of the 5'-subunit. All future preparations of the 5'-subunnit will be ammonium sulfate precipitated at 35% saturation.

Large Scale Growth of T. thermophilus holB Gene Product (5'-subunit):) Fused to an N-Terminal Peptide That Contains Hexahistidine and Biotinylatidon Site by pAl-NB-TD'/MGC1030 Strain pAl-NB-TD'/MGC1030 was grown in a 250 L fermenntor, to produce cells for purification of T. thermophilus 8'-subunit as descriribed in Example 2. Cell harvest was initiated 3 hours after induction, at OD 6 oo of 5.8, and the cells were chilled to 10°C during harvest. The harvest volumne was 186 L, and the final harvest weight was approximately 2.1 kg of cell pasiste. An equal amount of 50 mM Tris (pH 7.5) and 10% sucrose solutidon was added to the cell paste. Cells were frozen by pouring the cells suspensidon into liquid nitrogen, and stored at -20 0 C, until processed. Quality control I results showed 10 out of 10 positive colonies on ampicillin-containing mediunm in the inoculum, 10/10 positive colonies at induction and 7/10 positive coloonies at harvest.

WO 01/73052 PCT/r/US1o/09950 115- Purification of T. thennophilus holB Product (8'-subunit) Fused to, an N- Terminal Peptide That Contains Hexahistidine and a Biotinylation SSite by pAl-NB-TDO/MGC1030 Lysis was accomplished by creation of spheroplasts of thee cells carrying the expressed T. thennophilus 8'-subunits as described in Exanmple 2.

First, from 800 g of a 1:1 suspension of frozen cells (400 g cells) inn Trissucrose which had been stored at -20 0 C, FrI was prepared (1200 i ml, 17 mg/ml). To Fr I, ammonium sulfate (0.194 g to each initial ml Fraction n 1-35% saturation) was added over a 15 min interval. The mixture stirred I for an additional 30 min at 4 0 C and the precipitate was collected by centriftfugation (23,000 x g, 45 min, 0 The resulting pellets were quick froazen by immersion in liquid nitrogen and stored at -80 0

C.

The pellets from Fr I were resuspended in 150 ml of Ni-"-NTA suspension buffer and homogenized using a Dounce homogenizer.r. The sample was clarified by centrifugation (16,000 x g) and the supermatant constituted Fr II (4 mg/ml). Fr II was added to 50 ml of a 50% slurry y of Ni- NTA resin and rocked for 1.5 hours at 4°C. This slurry was then loadedd onto a BioRad Econo-column (2.5 x 5 cm). The column was washed with 4000 ml of Ni"-NTA wash buffer at a flow rate of 1.5 ml/min. The NB-TD' prote:ein was eluted in 200 ml of Ni++-NTA elution buffer containing a 10-2000 mM imidazole gradient. The eluate was collected in 92 x 2 ml fractions. Frractions were analyzed by SDS-polyacrylamide gel electrophoresis, and fractioons were found to contain 8' that was over 95% pure (FIGs. 27A and 27EB).

Fractions 40-75 were pooled (70 ml, 0.7 mg/ml) and dialyzed against L of HG.04 buffer (20 mM Hepes, (pH 40 mM KC1, 1 mM I MgC1 2 0.1 mM EDTA, 6 mM PME, 10% glycerol). The dialyzed sample consistituted Fr III (70 ml, 0.5 mg/ml). From the pool, 75% of the sample was alicquoted, fast frozen in liquid nitrogen and stored at -80 0 C. The remaining 255% was further purified for antibody production.

WO 01/73052 PCT//USU 1/09950 C- 116- Production of polyclonal antibodies against T. thernophilus The 25% of T. thennophilus 5' Frll discussed above was preccipitate

INS

D by adding ammonium sulfate to 40% saturation (0.226 g of ammonium a sulfate per initial ml). The protein pellet was resuspended in 2 ml of 2(0 mM 0 potassium phosphate, pH 6.5, 100 mM KC1, 25% glycerol and 5 mlM DTT buffer. The sample was loaded onto a Sephacryl S-300 column (88 mhl, 40:1 height:width ratio) equilibrated in the same buffer. This was accomplisished by running the column head down to the resin bed, adding the sample ml), running the sample into the resin and rebuilding the column head. The s sample was then eluted in the same buffer at a flow rate of 0.2 ml/min and colleected in ml fractions. Protein concentrations of each fraction was determinedd using the Coomassie Protein Assay Reagent (FIG. 28). Fractions were analyyzed by SDS-polyacrylamide gel electrophoresis and the fractions were obser'rved to contain homologous 8" (FIG. 29).

Fractions 30 to 40 were pooled and the protein was precipititate by adding ammonium sulfate to 40% saturation as previously described-. The protein was then resuspended in 3 ml of PBS and dialyzed against 500 mnml PBS two times. This constituted Fr IV and was used for antibody prodduction (0.133 mg/ml). The dialyzed samples were used to produce polyyclonal antibodies against T. thennophilus holB gene product (8'-subunit) as desscribed in Example 3.

Construction of Plasmid (pAl-TD') that Overexpresses T. thennophilus s holB gene (8'-Subunit) as a Native Protein Prior to construction of vector pAl-NB-TD' to express 6'-subuunit as an N-terminal tagged protein, several attempts were made to first expres:ss 5' as a native and a C-terminal tagged protein. These attempts were unsucces:ssful in producing adequate yields of 5' to justify purification attempts. These attempts are described in this section.

WO 01/73052 PCT/flUS01/09950 N -117- The hoIB gene was amplified by PCR using pT-TD'-2 as a teemplate C, and expressed as a native protein. The forward/sense primer (ATG primer #P139-S253, 5'-CTTTCCCCCATGGCTCTACACCCG- (SEQ ID NNO:44) D contained a region complementary to the 5' end of the gene. An NccoI site overlapped the ATG start codon. The reverse/antisense primer (ATG 1 primer O #P139-A1085, U GGATCCGGCCGGCCTCATCATGTCTCTAAGTCTAAGGC-3') (SEEQ ID contained and additional stop codon adjacent to the native stop o codon, giving two stop codons in tandem. There is a FseI site adjacent to the E second stop codon and a BamlI restriction site adjacent to the FseI restrictioon site.

This PCR fragment was digested with NcoI and Fsel restriction enzymnes and inserted into the plasmid pAl-CB-NcoI digested with the same two en2izymes.

The plasmid was resealed and transformed into DH5a bacteria. Phlasmids from ampicillin-resistant positive isolates were screened by NcoI anad FseI restriction digest yielding 0.8 and 5.6 kb fragments. The sequence: of the inserted region was confirmed by DNA sequencing (ATG SEQ #14477-1450; primers, P38-S5576, P65- A106, P139-S651 and P139-A681). The seequence of the clone showed unexpected extra bases downstream of the FseI rest;triction site, although the remainder of the insert had the correct sequence. The:erefore, the NcoI/FseI fragment contained the correct sequence. This plasmiid was named pAl-TD'(a) and the isolate was stored as a stock culture (ATG glycerol stock #844). To insure that the downstream region contained the correct sequence, pAl-TD'(a) was digested with Ncol/Fsel restriction enzymnes and inserted into another pAl-CB-NcoI plasmid digested with the same reststriction enzymes. This plasmid was resealed and also transformed into bacteria. Plasmids from ampicillin-resistant colonies were again screeened by NcoI and FseI restriction digest yielding 0.8 and 5.6 kb fragmentss. The sequence of the inserted region was again confirmed by DNA sequuencing (ATG SEQ #1473-1476, 1485; primers, P38-S5576, P65- A106, P1399-S651, P139-A681 and P139-S321). Sequence analysis confirmed the (correct WO 01/73052 PCT/I/US01/09950 118sequence throughout the region sequenced. This plasmid was namedd pAl- TD' and the isolate was stored as a stock culture (ATG glycerol stock #8878).

Verification of Expression of Plasmid (pAl-TD') that Overexpres:sses T.

thermophilus holB gene (8'-Subunit) as a Native Protein from i pAl- TD'/MGC1030 Plasmid pAl-TD' was prepared from DH5a bacteria. The pplasmid was transformed into MGC1030 bacteria (ATG glycerol stock #8933, 894, 895). The bacterial growths of three isolates and isolation of total ccellular protein were as described in Example 2. A small aliquot (3 p1) of supernatant containing total cellular protein from each of the three isolatees was electrophoresised onto a 4-20% SDS-polyacrylamide mini-gel (1(Novex, EC60255; 1 mm thick, with 15 wells/gel) in 25 mM in Tris base, 1992 mM glycine, and 0.1% SDS. The mini-gel was stained with Coomassiee Blue.

There were no visible protein bands from any of the isolates corresponoding to the predicted molecular weight of T. thennophilus 6'.

Construction of a Plasmid (pAl-CB-TD') that Overexpresses T. thennaophilus holB (8'-subunit) Fused to a C-Terminal Peptide That Contains Hexahilistidine and a Biotinylation Site Again, since attempts to express native 6' failed, expression of this protein was attempted by coupling the protein to a C-terminal fusion ppeptide.

The gene encoding T. thennophilus hoIB above was amplified by PCRR using pT-TD'-2 plasmid as a template. The forward/sense primer (ATG primer #P139-S253) was the same primer used in construction of pAl-TFD' and contained a region complementary to the 5' end of the T. thennophiluus holB gene. As before, an NcoI site overlapped the ATG start codon.i. The reverse/antisense primer was complementary to the 3' end of the T.

thennophilus holB gene excluding the stop codon (ATG primer #P139-i-A1075, GGC (SEQ ID NO:46).

This primer contained a Spel restriction site adjacent to the complemnentary WO 01/73052 PCT/f/US01/09950 -119region of the primer. The SpeI site allowed for the expressed protein to contain two additional amino acids (Thr and Ser) between the C-te:erminal amino acid of the 8'-subunit and the C-terminal fusion peptide. This 1 822 bp PCR product was digested with Ncol and Spel and inserted into the pplasmid pAl-CB-Ncol digested with the same restriction enzymes. This plasmnid was transformed into DH5a bacteria and plasmids from ampicillin-re-esistant positive isolates were screened for by digestion with NcoI and Spel reststriction enzymes yielding 0.8 and 5.6 kb fragments. The sequence of the inseert was verified by DNA sequencing (ATG SEQ #1500-1503; primers, P38-'-S5576, P65-A106, P139-S651, P139-S321). This plasmid was named pAl-CBB-TD[ and the isolate was stored as a stock culture (ATG glycerol stock #896). Verification of Expression of T. thennophilus 8'-subunit Fused too a C- Terminal Peptide That Contains Hexahistidine and a Biotinylation SSite by pAl-CB-TD'/MGC1030 The pAl-CB-TD' plasmid was prepared and transformeed into MGC1030 bacteria (ATG glycerol stock #920). The bacterial growths oof three isolates and isolation of total cellular protein were as described in Exanmple 2.

A small aliquot of each supernatant (3 pIl) containing total cellular prote:ein was electrophoresised onto a 4-20% SDS-polyacrylamide mini-gel (r(Novex, EC60255; 1 mm thick, with 15 wells/gel) in 25 mM in Tris base, 1992 mM glycine, and 0.1% SDS. The mini-gels were stained with Coomasside Blue.

The region of the gel in which 8' was expected contained other intense protein bands and 8' could not be visualized.

Next, the total protein in each lysate was transferred (blottedd) from polyacrylamide gel to nitrocellulose as described in Example 2. Eaach lane contained 1.5 ul of the supernatant. Proteins on the blotted nitrocellulosse were visualized by interactions with phosphatase-conjugated streptaviddin as described above. The endogenous E. coli biotin-CCP, -20 kD0a, was detectable in both induced and non-induced samples. A very faint 1 protein band corresponding to 6' migrated midway between the 30 and 440 kDa WO 01/73052 PCT/I/U S 1/09950 -120molecular weight standard of the Gibco 10 kDa protein ladder. The pre-edicted molecular weight of 8' is 33 kDa. This protein was observed as a faint bband in the induced cultures, but was not observed in the uninduced control in Illysates.

T. thennophilus 8' was not expressed in great enough quantities to justify growth and purification.

Cloning T. thermophilus holB gene into a translationally coupled veector pTAC-CCA-ClaI To efficiently express 8' as a native protein we designed a veector to express 5' as a translationally coupled protein. The goal is to use transhlational coupling as described in Example The holB gene was inserted behilind the CCA adding enzyme and translationally coupled in two steps. First, thae holB gene was amplified by using pAl-TD' as a template by PCRR. The forward/sense primer (ATG primer #P139-S250cla2, ACTGATCGATAATGGCTCTACACCCGGCTCACCC-3') (SEQ ID NNO:57) has a ClaI restriction site in the non-complementary region. Thee noncomplementary region also contains the "TA" of the stop (TAA) f for the upstream CCA-adding protein fragment. The region of the I primer complementary to the 5' end of the T. thermophilus holB gene begins wi7ith "A" which is the first nucleotide of the "ATG" start codon and the final of the "TAA" stop codon. The reverse/antisence primer (ATG primer i#P139- A1081stopspe, 5'-GGACACTAGTTCATCATGTCTCTAAGTCTiAA-3') (SEQ ID NO:58) contains a SpeI restriction site in the non-complemnentary portion of the primer and also an additional stop codon adjacent to the native stop codon, giving two stop codons in tandem. There was also a clamp region for efficient cutting with Spel. In the second step the PCR produact was digested with ClaIlSpeI restriction enzymes and inserted into the pTAC-2-CCA- Clal plasmid digested with the same enzymes. The plasmid was transf;formed into DH5a bacteria and plasmids from ampicillin-resistant positive iisolates were screened for by digestion with ClalISpeI restriction enzymes yieldiling 0.8 and 5.5 kb fragments. The sequence of both strands of the insert were v.verified WO 01/73052 PCT//US01/09950 121by DNA sequencing (ATG SEQ #1737-1742; primers, P144-S23, P65-i-A106, P139-S321, P139-S651, P139-A681, P139-A1081stopspe). Sequence annalysis confirmed that the correct sequence was contained within the inserted r region.

This plasmid was named pTAC-CCA-TD' and the isolate was storeed as a stock culture (ATG glycerol stock #1055).

Verification of expression of native T. thermophilus 8' -subunit expresseed from pTAC-CCA-TD'/MGC1030 and pTAC-CCA-TD'/AP1.L1 The pTAC-CCA-TD' plasmid was prepared and transformeed into MGC1030 bacteria (ATG glycerol stock #1083) and API.L1 (ATG gl;lycerol stock #1080, 1081, 1082). The bacterial growths and isolation of total ccellular protein were as described in Example A small aliquot of each supemrnatant (3 containing total cellular protein was electrophoresised onto a 4-20% SDS-polyacrylamide mini-gel (Novex, EC60255; 1 mm thick, wivith wells/gel) in 25 mM in Tris base, 192 mM glycine, and 0.1% SDS. Thee minigels were stained with Coomassie Blue. The expected location of the T.

thennophilus 8' protein band was in an area containing many bands of f native E. coli proteins and T. thennophilus 6' could not be resolved from thesse other protein bands.

Large Scale Growth of pAl-CCA-TD'/AP1.L1 Strain pAl-CCA-TD'/AP1.L1 was grown in a 250 L fermenrtor to produce cells for purification of T. thermophilus 5' as described in Ex xample Optimum induction times were determined as described in Exampple #2.

Cell harvest was initiated 3 hours after induction, at OD 6 oo of 3.12, aand the cells were chilled to 10 0 C during harvest. The harvest volume was 175 i L, and the final harvest weight was approximately 1.37 kg of cell paste. Ann equal amount of 50 mM Tris (pH 7.5) and 10% sucrose solution was addded to the cell paste. Quality control results showed 10 out of 10 positive colonnies on ampicillin-containing medium in the inoculum and 10/10 positive coloonies at WO 01/73052 PCT/Ir/US1/09950 -122induction and 10/10 positive colonies at harvest. Cells were frozen by ppouring the cells suspension into liquid nitrogen, and stored at -20 0 C, until proceessed.

Purification of native T. thermophilus 6' from pAl-CCA-TD' Lysis was accomplished by creation of spheroplasts of thee cells carrying the expressed T. thermophilus First, from 400 g of a 1:1 suspension of frozen cells (200 g cells) in Tris-sucrose which had been I stored at -20 OC, FrI was prepared (700 ml, 13.7 mg/ml). The preparation was as described in Example To Fr I, ammonium sulfate (0.258 g to eachh initial ml Fraction 1-45% saturation) was added over a 15 min interval. The mnixture stirred for an additional 30 min at 4 OC and the precipitate was colleccted by centrifugation (23,000 x g, 45 min, 0 The resulting pellets weree quick frozen by immersion in liquid nitrogen and stored at -80 OC.

In the following purification steps, fractions from purification ccolumns were assayed using the reconstitution assay (described in Examplee 7) to determine fractions that contained activity and therefore the 8' -subunit.t. Onehalf of the pellets from Fr I was resuspended in 270 ml of 50 mM Triris-HC1, (pH 25% glycerol, 1 mM EDTA, 1 mM DTT and homogenized Lusing a Dounce homogenizer. The sample was clarified by centrifugation (16,0000 x g) and the supernatant constituted Fr II (270 ml, 7.7 mg/ml). Fr UI was further purifed using a Butyl Sepharose Fast Flow (Pharmacia Biotech) columnn. The butyl resin (400 ml) was equilibrated in butyl equilibration buffer (550 mM Tris-HCl, (pH 25% glycerol, 1 mM EDTA, 1 mM DTT, (0.5 M ammonium sulfate). The column was poured using 260 ml of butyl resisin. The remaining 140 ml of butyl resin was mixed with Fr II giving 410 ml. To this mixture, saturated ammonium sulfate (0.5 sample volume) was added I slowly while stirring over a 1 hour period. This mixture was added to the cohlumn at 1.3 ml/min. The column was then washed with 4 L of butyl equililibration buffer. The protein was eluted in 10 column volumes of a gradient begginning with butyl equilibration buffer and ending in a buffer containing 50 mlM Tris- WO 01/73052 PCT/r/USOl/09950 -123- HC1, (pH 25 glycerol, 1 mM EDTA, 1 mM DTT, 50 mNM KCI.

Remaining protein was removed from the column by eluting with a addditional column volumes "bump" of the end buffer. The 8'-subunit elutedi in the first half of the "bump", and was pooled (485 ml, 0.1 mg/ml). The otheer onehalf of the pellets from Fr I was purified exactly the same as describoe. The two preparations were combined to give 972 ml (0.1 mg/ml) of Fr III.

Fr m was further purifed using an Octyl Sepharose Fast;t Flow (Pharmacia Biotech) column. The octyl resin (20 ml) was equilibrated ilin octyl equilibration buffer (50 mM Tris-HC1, (pH 10% glycerol, 1 mM EDTT, 1 mM EDTA, 0.5 M ammonium sulfate). The column was poured usingg 13 ml of octyl resin. The remaining 7 ml of octyl resin was mixed with Fr II I giving 979 ml. To this mixture saturated ammonium sulfate (0.5 sample volumne) was added slowly while stirring over a 1 hour period. This mixture was addded to the column at 1.3 ml/min. The column was then washed with 600 ml oof octyl wash buffer (50 mM Tris-HC1, (pH 10% glycerol, 1 mM DTT,, 1 mM EDTA, 200 mM ammonium sulfate). The wash was collected in fractiaons ml). The protein was eluted in 10 column volumes (200 ml) of a ggradient beginning with octyl wash buffer and ending in a buffer containing 550 mM Tris-HC1, (pH 25 glycerol, 1 mM EDTA, 1 mM DTT, 50 mivM KC1.

The 6'-subunit was recovered in fractions making up the wash. These fractions were pooled (210 ml, 0.07 mg/ml) and concentrated using PECG 8000 and constitute Fr IV (38 ml, 0.26 mg/ml).

T. thermophilus 8' was further purified using a Sephacryl S3600 HR (Pharmacia Biotech) gel filtration column (510 ml, 3 cm x 1220 cm) equilibrated in 50 mM Tris-HC1, (pH 20 glycerol, 100 mM NNaC1, 1 mM EDTA, 5 mM DTT. The column was loaded and the protein elutited at a flow rate of 0.7 ml/min. The 8' -subunit was isolated as a highly ppurified protein (54 ml, 0.08 mg/ml). The products of the different purificatioon steps for S' expressed as a translationally coupled protein were analyzed by Z a SDSpolyacrylamide gel (FIG. WO 01/73052 PCT/I/I S) 1/09950) C' -124- EXAMPLE 6 N Construction of a Plasmnid (pAl-NB-TN) that Overexpresses T thennopphilus dnaN (P-subunit) Fused to an N-Terminal Peptide That Contains Hexahistidine and a Biotinylation Site O In E. coli the 1-subunit is functional as a homodimer (see Johhanson, K.O. and Charles S. "Purification and Characterization of the P-subunitit of the DNA Polymerase III Holoenzyme of Escherichia coli", J. Biol. (Chenm., 255:10984-10990 (1980)). This dimer confers the ability of high proocessive synthesis to the core polymerase. In the previous patent applicationn (U.S.

Application 09/151888), the identification of the T. thermophiluss gene (dnaN) encoding the 0-subunit was described. From the lambda vector preparation described in Example 9 of the previous application i (U.S.

Application 09/151888), the 2.2 kb Dral/EcoRI fragment was clonedd into a pBluescript II SK' vector (Stratagene). This sub-clone was then transfiformed into XL I Blue cells. A total of ten ligation reactions were attempted I before achieving a successful clone. This clone (UCO9) was grown and pplasmid DNA was isolated. Both strands of the DNA from the inserted regiaon was sequenced (Lark Technologies Inc., DNA SEQ# UCO: 9.2.T7X, 9.23.AAPI24, 9.AP110, 9.2.AP114, 9.23.AP125, 9.2.AP112, 9.2.AP113, 9.23.PAPI28, 9.6.AP119, 9.25.AP35, 9.6.AP118, 9.25.AP36, 9.23.AP126, 9.25.AAP34B, 9.23.AP32B, 9.6.AP121, 9.25.AP40, 9.23.AP121, 9.2.-4R, 9.6.PAP116, 9.23.AP131, 9.6.AP122, 9.23.AP122). Each nucleotide in the inserted I region was confirmed using at least three individual primers. This sub-clonne was designated UCO9.

In the DNA coding sequence of the T. tlhennophilus dnaN genae (SEQ ID NO:22) (FIG. 62) the start codon (atg) and the stop codon (tag) are i in bold print. The 5' and 3' UTRs are also shown (lower case). Also shownn is the protein (amino acid) sequence (SEQ ID NO:23) (FIG. 63) derived frcrom the DNA coding sequence.

To simplify purification, the B-subunit coupled to an N-terminal I fusion peptide that contains hexahistidine and a biotinylation site was expresseed first.

WO 01/73052 PCT/r/US01/09950 -125- Plasmids were designed to fuse the dnaN gene to DNA encoding. an Nterminal peptide that contains hexahistidine and a biotinylation. First, a PCR fragment containing the 5'-portion of the Tth dnaN gene was amplifieed from plasmid UCO9 using a forward primer (ATG #P118-S855, AACTGCAGAACATAACGGTTCCCAAGAAACTCC-3') (SEQ ID NNO:24) that adds a Pstl site to the 5'-end of the gene so that the actual PCR pproduct excluded the ATG start codon and begins at codon 2. The underlined I region of forward primers indicates nucleotides that are complementary to the 5' end of the gene, here and in all other primers used. The Pstl site is adjaacent to codon 2, so that when this fragment was inserted into the pAI-NB: Age-1 plasmid the dnaN gene was in frame with the DNA encoding the N-te:erminal fusion peptide. The reverse primer (ATG #P118-A731.1, GACCCGCACCATCTCGTCCACG-3') (SEQ ID NO:25) is downstra-eam of the SacI restriction site (which is near position 496 downstream of thoe ATG start codon). The resulting PCR product was digested with Pstl and SaacII and ligated into the Pstl/SacII cut pAI-NB Age-I and transformed into I DHSa.

Plasmids from ampicillin-selected positive isolates were verified by diggestion with Pstl/SacII restriction digestion yielding the expected 0.5 and 5.5 kb fragments. This plasmid (pAl-NB-TN5') was sequenced across thfe PCR inserted regions to confirm the correct sequence (ATG SEQ #11877-1190, primers P64-S10, P64-A215, P118-S290 and P118-A411). This sequennce was also compared to that from the UCO9 insert. This precursor plasmihid was named pAI-NB-TN5' and the positive isolate (pAl-NB-TN5'/ DH56ca) was stored as a stock culture (ATG glycerol stock #708).

The 3' region (C-terminus) of the T. thennophilus dnaN gene Mwas cut out of the UCO9 plasmid in a partial digest using the two restriction ennzymes SacII and NcoI. The Ncol digested site is approximately 150) bases downstream of the stop codon. This gave a fragment size of approxi:imately 800 bases. There is also a second SacII restriction site further downstru-eam of the NcoI restriction site approximately 400 bases. This second site ggave an additional fragment of approximately 400 bases in length. The proper WO 011/73052 PCT/I/USO /09950 -126fragment was easily identified, as it was twice as large as the fragmentit given by the secondary SacI restriction site. The fragments were separaiated by electrophoresis, and the 800 bp fragment was eluted in water. This fraagment containing the 3' portion of the TN gene was inserted into the plasmid that had been digested with both SacII and NcoI restriction ennzymes.

This plasmid (pAI-NB-TN) contained the entire T. thennophilus dnalNT fused to the DNA encoding an N-terminal fusion peptide. This plasmilid was transformed into DH5a. Plasmids from ampicillin-resistant coloniees were verified by cleavage with SaclI/NcoI yielding the expected 6.1 kb and I 0.8 kb fragments. The positive isolate (pAI-NB-TN/ DH5c) was stored as a a stock culture (ATG glycerol stock #722).

Verification of Expression of T. thennophilus P-subunit Fused to an N- Terminal Peptide That Contains Hexahistidine and a Biotinylation Site pAl-NB-TN was prepared and transformed into MGC1030) (ATG glycerol stock #765) and AP1.L1 bacteria (ATG glycerol stock The bacterial growths of three isolates and isolation of total cellular protein vwere as described in Example 2. An aliquot (4 |L1) of each supernatant containinng total cellular protein was loaded onto a 4-20% SDS-polyacrylamide mnini-gel (Novex, EC60255; 1 mm thick, with 15 wells/gel) in 25 mM in Tris baase, 192 mM glycine, and 0.1% SDS. The mini-gels were stained with Cooomassie Blue. The region of the gel in which N-tagged T. thennophilus 3 was expected contained many other very intensely stained protein bands E and Nterminal tagged T. thermophilus 0 could not be visualized.

The total protein in each lysate was analyzed by biotin blot anahlysis as described in Example 2. The endogenous E. coli biotin-CCP, -20 kEDa was detectable in both induced and non-induced samples. A proteinn band corresponding to the 3-subunit migrated approximately midway betweeen the 40 and 50 molecular weight standards of the Gibco 10 kDa protein i ladder.

This protein was observed as a distinct band in the induced cultures, bbut was WO 01/73052 PCT/T/US01/09950 -127not observed in the uninduced control in lysates from the AP1.L1 straiiin. No expression could be detected in the MGC1030 strain.

Optimization of Expression of T. thennophilus dnaN gene (p-subunit) Expression was analyzed using the bacterial strains AP1.L1 caarrying the pAl-NB-TN plasmid at different induction times and also at dilifferent growth temperatures (25 0 C and 37 0 Growth of bacterial culturaes and analysis were carried out as described in Example 2. Biotin blot annalysis indicated that expression levels were highest at 37 0 C (FIG. 31). Sincee SDSpolyacrylamide gel electrophoresis indicates that most of the 0-subbunit is being expressed in 4 hours and at 37 0 C, these growth condition were uused in subsequent preparations.

Large Scale Growth of pAl-NB-TN/AP1.L1 Strain pAl-NB-TN/APl.L1 was grown in a 250 L fermentor to produce cells for purification of T. thennophilus p-subunit as descrilibed in Example 2. Cell harvest was initiated 4 hours after induction, at ODoo of 6.7, and the cells were chilled to 10 0 C during harvest. The harvest volumne was 180 L, and the final harvest weight was approximately 2.2 kg of cell paslste. An equal amount of 50 mM Tris (pH 7.5) and 10% sucrose solutidon was added to the cell paste. Cells were frozen by pouring the cells suspensidon into liquid nitrogen, and stored at -20 0 C, until processed. Quality control I results showed 10 out of 10 positive colonies on ampicillin-containing mediumn in the inoculum and 10/10 positive colonies at harvest.

WO 01/73052 PCT/f/US01/09950 -128- Determination of Optimal Ammonium Sulfate Precipitation Conditioons for N-terminal Tagged T. thermophilus 3 Lysis was accomplished by creation of spheroplasts of thee cells carrying the expressed T. thennophilus P-subunits. First, from 100 g obf a 1:1 suspension of frozen cells (50 g cells) in Tris-sucrose which had been stctored at -200C, FrI was prepared (390 ml, 9.8 mg/ml). The preparation vwas as described in Example 2. FrI was divided into 5 equal volumes and 1 0.164, 0.226, 0.291, 0.361 and 0.436 g of ammonium sulfate 40%, 50%/o, and 70% saturation) was added to each separate sample, respectively, over a min interval at 4 0 C. The mixture stirred for an additional 30 min at 4 C and the precipitate was collected by centrifugation (23,000 x g, 45 min,i, 0°C).

The resulting pellets were resuspended in 1 ml Ni-NTA suspension bufffer mM Tris-HC1 (pH 40 mM KC1, 7 mM MgCl 2 and 10% glycerol)l). The protein concentration of each sample was determined using the CooDmassie Protein Assay Reagent (Pierce) and bovine serum albumin (BSA)0 as a standard. The 30%, 40%, 50%, 60% and 70% ammonium sulfate precilipitated samples contained protein concentrations of 2.4, 8.0, 18.0, 35.0 ancd 38.0 mg/ml, respectively. The samples were analyzed by SDS-polyacrylamiiide gel electrophoresis. The 40% ammonium sulfate precipitated samples conntained over 90% of the 0-subunit, this concentration of ammonium sulfate wa'as used in subsequent preparations.

Purification of T. thennophilus N-Terminal Tagged 3 Lysis was accomplished by creation of spheroplasts of thee cells carrying the expressed T. thermophilus P-subunits. First, from 600 g oDf a 1:1 suspension of frozen cells (300 g cells) in Tris-sucrose which had been a stored at -20 FrI was prepared (1.05 L, 15.4 mg/ml). The prepatation N was as described in Example 2. To Fr I, ammonium sulfate (0.266 g to each iniitial ml Fraction 1-40% saturation) was added over a 15 min interval. The mixtaure was stirred for an additional 30 min at 4°C and the precipitate was collec:cted by WO 01/73052 PCT/r/U SO /09950 -129centrifugation (23,000 x g, 45 min, The resulting pellets weree quick frozen by immersion in liquid nitrogen and stored at -80 0

C.

The pellets from FrI ammonium sulfate precipitation were resusppended in 100 ml of Ni+-NTA suspension buffer and homogenized using a EDounce homogenizer. The sample was clarified by centrifugation (16,000 x g) a and the supernatant constituted Fr II (19.5 mg/ml, 100 ml). Fr II was added too 30 ml of a 50% slurry of Ni-NTA resin and rocked for 1.5 hours at 4 0 C. Thisis slurry was then loaded onto a BioRad Econo-column (2.5 x 5 cm). The colunmn was washed with 200 ml of Ni++-NTA wash buffer at a flow rate of 0.5 mnl/min.

The N-terminal tagged P was eluted with a 150 ml 10-200 mM imiidazole gradient in Ni+-NTA elution buffer. The eluate was collected in 75 x 2 ml fractions. Fractions were analyzed by SDS-polyacrylamidde gel electrophoresis, and fractions 26-60 were found to contain over 90% cof total 3-subunit protein (FIG. 32). These fractions also contained most of the 2 ability to stimulate the P-subunit in primer extension assays (discussed below)..

Fractions 26-60 were pooled (67 ml) and dialyzed two times aggainst 1 L of buffer HG.04 (20 mM Hepes (pH 40 mM KC1, 1 mM MgCCl 2 0.1 mM EDTA, 10% glycerol and 6 mM 3ME). The sample constituted FrrHI ml, 3.8 mg/ml), which was aliquoted and fast frozen in liquid nitroggen and stored at -80 0

C.

Development of a Simple Processivity Assay for T. thennophilus f on a Defined Linear Template Replicative polymerases ranging from E. coli to yeast are stinmulated by their cognate "sliding clamp processivity factors", 3 and PCNA respectively, in the absence of other holoenzyme subunits if they are pre-esent at high non-physiological concentrations on linear templates (see Crute,, et al., J.Biol.Chem. 258:11344-11349 (1983)). This is due to the ability t<to these factors to assemble on linear DNA in the absence of the clamp loader r (DnaX or RFC) at high concentrations. To develop an assay for detectionn of T.

WO 01/73052 PCT/r/USO1/09950 -130thenrophilus 1 we have taken advantage of the low processitivity off DNA replicative polymerases in the absence of other members of the repblicative complex. In the absence of 1 the DNA polymerase (a-subunit) wilill only extend a primer by approximately 10 nucleotides per each binding eveent (see Crute, et al., J.Biol.Chem. 258:11344-11349 (1983)). The suubstrate (shown below) (SEQ ID NO:28) allows detection of stimulation by P.

-TGCAAATCGCGTTAGCTTAG-3' (EO-E-8) 3' -ACGTTTAGCGCAATCGAATCTGTCCTGTGTGTTCCTGCTGTCTCCGTTTCAAAAAAAAAA AAAAAAAAAAA-5' (EO--7) T. thermophilus P would be expected to bind the annnealed primer/template and extend the primer for a relatively short distanace per binding event in the absence of p. The template lacks "A"s for the f first nucleotides and then contains a string of If replication is alloxwed to proceed in a large excess of template primer and limiting polymeerase, a template, on average, will only encounter a polymerase once during the 2 course of the assay. Thus, in the absence of P T. thennophilus a would not be expected to incorporate significant levels of radiolabeled dTTPs oppossite the terminal sequence of Therefore, it should be possible to use this s system to detect stimulation of the processitivity of the DNA polymerase in the presence of 3.

To allow annealing, the template (E07) and primer (E08) were e diluted to 10 1pM each in annealing buffer (10 mM Tris-HC1, pH 7.5, 0.1 mM EEDTA), heated to 90 0 C in a heating block and allowed to slowly cool too room temperature. Reactions (25 41) were carried out at 30 0 C for 5 min in eenzyme dilution buffer (EDB) (50 mM Hepes (pH 20% glycerol, 0.02% NNonidet 0.2 mg/ml BSA, 10 mM DTT, 10 mM MgCl 2 dNTP mix (50 pM I dATP, dCTP, dGTP and 18 pM 3 H]dTTP, 100 cpm/pmol) and varying amoounts of DNA polymerase (1 3 and annealed DNA.

WO 01/73052 PCT/1/USOI/09950 -131- In reactions using E. coli DNA polymerase a, the concentratition of primer/template was varied between 0.1-1.3 uM to determine the aamount needed to maintain the level of incorporation of radioactivity to that t of the background signal, due to single binding events. These reactions were c carried out in the absence of 3 at 0.3, 0.6, and 1.2 nM a. There was no increase;e in the total dTTP incorporated between 0.6 and 1.3 )nM of primer/tenmplate.

Therefore, in reactions to optimize levels of T. thermophilus cx, 1.1.3 |M primer/template was used.

To determine the optimum amount of T. thennophilus polymenrase (1 mg/ml) to use, assays were set up using 100, 250, 500, 1000, 2000 and L 4000:1 dilution ratios of T. thennophilus N-terminal tagged T. thermophilus a tl.

polymerase/reaction). The samples containing 250:1 dilution of T.

thermophilus cc gave a signal equal to the background signal, therefoore this concentration of N-terminal tagged T. thennophilus a was used in reactitions to screen for p stimulation.

To assay for the ability of various amounts of N-terminal taggged T.

thermophilus P to stimulate the activity of the T. thermophilus a, the pprimerextension assay was used. Using a 250:1 dilution of the a-subunit (1 nmg/ml) and 1.3 tM of annealed primer/template, assays were carried out at 00, 0.25, 0.5, 1.0, 2.0 and 4.0 RM T. thennophilus 1 (FIG. 33). T. thennophilus s a was stimulated by increasing concentrations of P (FIG. 33) consistent i with a functional 3, proving the capability of purified T. thermophilus a anad 3 to cooperate in a processive replicative reaction at elevated temperatures.

Production of polyclonal antibodies against T. thenrophilus P From N-terminal tagged T. thermophilus 3 Frm described in the section entitled "Purification of T. thennophilus dnaN Product (P-suubunit) Fused to an N-Terminal Peptide That Contains Hexahistidine and a Biotinylation Site by pAl-NB-TN/AP1.LI", 2 ml (3.8 mg/ml) was loaded WO 01/73052 PCT/r/USO 1/09950 -132onto an Sephacryl S-300 column (88 ml, 40:1 height:width ratio) equililibrated in 20 mM potassium phosphate, pH 6.5, 100 mM KCI, 25% glycerol 1 and mM DTT. This was accomplished by running the buffer above the ccolumn bed down to the resin bed, adding the sample (2 ml), running the sampple into the resin and rebuilding the buffer above column bed. The sample wa'as then eluted in in the same buffer at a flow rate of 0.2 ml/min and collected ilin 1 ml fractions. Protein concentrations of each fraction was determined usiting the Coomassie Protein Assay Reagent (FIG. 34). The fractions were analyyzed by SDS-polyacrylamide gel electrophoresis and fractions 43-66 were poolded ml, 0.15 mg/ml) (FIG. Protein in the pooled fractions were precipitated by additition of ammonium sulfate (0.436 g to each ml of pooled fractions-70% satuuration) and the precipitate was collected by centrifugation (23,000 x g, 45 min,i, 0°C).

The ammonium sulfate precipitated pellets were dissolved in 2 ml oof PBS (0.24 mg/ml) and dialyzed against 500 ml of PBS two times. This dilialyzed sample was analyzed by SDS-polyacrylamide gel electrophoresis (FIG. 2 36).

Polyclonal antibodies against T. thennophilus 3 were produaced by inoculation of a rabbit with N-terminal tagged T. thermophilus P and hanrvested from the rabbit as described in Example 3. The optimum dilution oof antiserum for binding N-tagged T. thennophilus 3 was determined after tithe test bleed and after the final bleed. This was carried out by SDS-polyacryylamide gel electrophoresis, in which a small aliquot of N-terminal taggged T.

thermophilus 3 (0.5 utg/well) was electrophoresed onto a 10% SDSpolyacrylamide mini-gel (10 x 10 cm). The protein was transferreed onto nitrocellulose membrane as described above in Example 3. The menmbrane was cut into strips with each strip containing an identical band of N-te:erminal tagged T. thennophilus P. The membrane was blocked in 0.2% Twueen (v/v)-TBS (TBST) containing 5% non-fat dry milk for 1 hour att room temperature, rinsed with TBST. The strips were placed in antiserumxn/TBST (dilutions: 1:100, 1:200, 1:400, 1:800, 1:1600, 1:3200, 1:6400, and 1:1:12800) for 1 hour and then washed 4 times for 5 min in TBST. Next, the stripps were WO 01/73052 PCT/r/USO1/09950 -133placed in secondary antibody-conjugated to alkaline phosphatase (goaat antirabbit IgG 1:3000 dilution in TBST) (BioRad) for I hour. Thee strips were then washed 4 times for 5 min with TBST. Following this exttensive washing, the blots were developed with BCIP/NBT (KPL #50-81-0')7; one component system). Proteins corresponding to P were visualized as ddistinct bands even at the highest dilution of antiserum (FIG. 37). These: bands became more intense as the dilution of antiserum was decreased. The neegative control contained antiserum taken from the rabbit prior to inoculatinpg with antigen. The positive control is a biotin blot analysis of the antigen a at the same concentration (0.5 Gpg) as used in antiserum detection.

Next, the minimum amount of 3 needed for recognition by anntibody serum was determined. This was carried out using SDS-polyacrylamiide gel electrophoresis in which small aliquots of P (0.02, 0.04, 0.08, 0.16, 0.322, 0.64, 1.25, 2.50, and 5.0 .tg/well) were electrophoresed onto a 10% SDSpolyacrylamide mini-gel (10 x 10 cm). The protein was transferreed onto nitrocellulose membrane. The blotted nitrocellulose was blocked in i TBST containing 5% non-fat dry milk for 1 hour at room temperature,:, rinsed with TBSt. The blot were placed in antiserum/TBST (dilution of 1:64000) for 1 hour and then washed 4 times for 5 min in TBSt. Next, the blot was pldaced in secondary antibody-conjugated to alkaline phosphatase (goat anti-rabbbit IgG 1:3000 dilution in TBST) (BioRad) for 1 hour. The blot waas then washed 4 times for 5 min with TBST. Following this extensive washiling, the blot was developed with BCIP/NBT (KPL #50-81-07; one component s:system) (FIG. 38). The lowest level (0.02 lig) of N-tagged T. thermophilus p ccould be detected.

Construction of a Plasmid (pAl-TN) that Overexpress Native T. thermopphilus dnaN (P-subunit) To express native (un-tagged) T. thennophilus P the dnaN genne was inserted into the vector pAl-CB-NdeI. The C-terminal biotin-hexahhis tag WO 01/73052 PCT/r/U SO1/09950 -134carried by this plasmid will be downstream and out of frame with the irinserted dnaN gene. The forward primer was designed so that CAT was addedd in the non-complementary region of the primer immediately proceeding thee ATG start codon. This resulted in CATATG, an NdeI restriction site (ATG I primer #P118-S74, AAA-3') (SEQ ID NO:41) The reverse primer was designed so tithat an additional stop codon was added in the non-complementary region prooducing two stop codons in tandem. The non-complementary region of the r reverse primer contains an Nhel restriction site and additional nucleotides for efifficient digestion of the PCR product with the restriction enzyme (ATG primer i#P118- 1231, 5'-GAGCAGCTAGCCTACTAGACCCTGAGGGGCACCLAC-3') (SEQ ID NO:42). The PCR reaction resulted in a product which contairined the entire T. thennophilus dnaN gene with an NdeI site overlapping thhe start codon and an additional stop codon in tandem with the natural stop) codon (TAG) and an Nhel site downstream of the tandem stop. Digestion of thhe PCR product and the pGEM-T Easy plasmid with NdeI and NheI allowed 1 the T.

thennophilus dnaN gene to be inserted the pGEM-T Easy plasmid. Thhe PCR product was ligated into the pGEM-T Easy plasmid as a preliminary pplasmid for sequencing of the insert region. This plasmid was transformed into I and ampicillin-resistant positive isolates were selected. Plasmids froDm one positive isolate was isolated and screened by EcoRI digestion of pllasmids yielding 1.15 and 3.0 kb fragments. The correct sequence of bothh DNA strands of the insert containing the dnaN gene were verified by DNA sequencing (ATG SEQ #1420-1427; primers, SP6 sequencing primner, T7 sequencing primer, P118-S290, P118-S639, P118-S1003, P118-A996,., P118- A731 and P118-A411). This sequence was compared to the seequence obtained in the section entitled "Construction of a Plasmid (pAl-NB-TTN) that Overexpresses T. thennophilus dnaN (13-subunit) Fused to an N-Te'erminal Peptide That Contains Hexahistidine and a Biotinylation Site". This pplasmid was named pT-TN and the positive isolate (pT-TN/ DH5ca) was store-ed as a stock culture (ATG glycerol stock #839).

WO 01/73052 PCT/I/U SO 1/09950 -135- The T. thermophilus dnaN gene was recovered from the preliriminary pT-TN plasmid and inserted into an expression vector. The pT-TN pplasmid was digested with NdellNhel restriction enzymes and the entire TN genne was inserted into the pAl-CB-NdeI plasmid digested with the same restitriction enzymes. This placed the dnaN gene into the pAl-CB-Ndel plasmid I out of frame with the downstream biotin-hexahis tag. This also placed thhe start codon 11 nucleotides downstream of the RBS. The plasmid was transfiformed into DH5oa and positive isolates were selected by ampicillin-resisistance.

Plasmid from one positive clone was verified by NdeIINheI andd XbaI restriction digest yielding the expected 1.1 and 5.6 kDa and 0.1 and 6.5.7 kDa fragments, respectively. The sequence of the inserted region was contifirmed by DNA sequencing (ATG SEQ #1443 and #1444, primers P118-S10003 and P38-S5576). This sequence was compared to the sequence obtained I in the section entitled "Construction of a Plasmid (pAl-NB-TN) that Overexppresses T. thennophilus dnaN (p-subunit) Fused to an N-Terminal Peptidele That Contains Hexahistidine and a Biotinylation Site". This plasmid was i named pAl-TN and the isolate (pAl-TN/ DH5a) was stored as a stock culturee (ATG glycerol stock #845).

Verification of Expression of T. thermophilus 3 by pA1-TN/AP1.L1 The pAl-TN plasmid was prepared and transformed into AAP1.L1 bacteria (ATG glycerol stock #860, 861, 871). The bacterial growths oof three isolates and isolation of total cellular protein were as described Examplde 2. A small aliquot (3 gl) of supernatant from each of the three isolates was i loaded onto a 4-20% SDS-polyacrylamide mini-gel (Novex, EC60255; 1 mmn thick, with 15 wells/gel) in 25 mM in Tris base, 192 mM glycine, and 0.1%yo SDS.

The mini-gel was stained with Coomassie Blue. There were no visible I protein bands from any of the isolates corresponding to the predicted migration i region of p. Perhaps secondary structure of the high GC. T. thennophilus seqquences was interfering with initiation. In an attempt to overcome this difficuhlty, we WO 01/73052 PCT/T/USOI109950 N- 136constructed vectors with a gene encoding the native T. thermophhilus 3 translationally coupled to the highly expressed E. coli cca gene.

SCloning T. thermophilus dnaN gene into a Translationally Coupled Wector 5 pTAC-CCA-ClaI CN To efficiently express 1 as a native protein we designed a veector to O express 3 as a translationally coupled protein. As with expression of otther T.

thennophilus proteins in native form, our goal here is again to use transhlational coupling as described in Example The dnaN gene was inserted behiiind the CCA adding enzyme and translationally coupled described for T. thermo.ophilus P. First, the dnaN gene was amplified by using pAl-TN as a template byy PCR.

The forward/sense primer (ATG primer #P118-S78cla2,', AGTCATCGATAATGAACATAACGGTTCCCAAG AAA-33) (SEGQ ID NO:59) has a Clal restriction site in the non-complementary region. As.s in the cloning strategy developed for pTAC-CCA-TX, the non-complemnentary region also contains the "TA" of the stop (TAA) for the upstream CCA-+-adding protein fragment. The region of the primer complementary to the 5' endd of the T. thermophilus holA gene begins with which is the first nucleotidee of the "ATG" start codon and the final of the "TAA" stop codon.. The reverse/antisence primer (ATG primer #P118-A1230spe,, GAGGACTAGTCTACTAGACCCTGAGGGGCACCAC-3) (SEQ) ID contains a Spel restriction site in the non-complementary portrtion of the primer and also an additional stop codon adjacent to the native stop o codon, giving two stop codons in tandem. There was also a clamp region for ef:fficient cutting with Spel. Next, the PCR product was digested with CldalISpeI restriction enzymes and inserted into the pTAC-CCA-ClaI plasmid diligested with the same enzymes. The plasmid was transformed into DH5ca bacterria and plasmids from ampicillin-resistant positive isolates were screened I for by digestion with ClalISpeI restriction enzymes yielding 1.1 and 55.5 kb fragments. The sequence of both strands of the insert were verified byy DNA sequencing (ATG SEQ #1749-1756; primers, P144-S23, P144-A1965, P118- WO 01/73052 PCT/r/USOI/09950 -137- S290, P118-S639, P118-S1003, P118-A996, P118-A731, P118--A411).

Sequence analysis confirmed the correct sequence was contained withlhin the inserted region. This plasmid was named pTAC-CCA-TN and the isolaate was stored as a stock culture (ATG glycerol stock #1074).

Verification of Expression of Native T. thermophilus P-Subunit by IPTAC- CCA-TN/MGC1030 and pTAC-CCA-TN/AP1.LI The pTAC-CCA-TN plasmid was prepared and transformeed into MGC1030 bacteria (ATG glycerol stock #1087, 1088, 1089) and AAP1.L1 (ATG glycerol stock #1090, 1091). The bacterial growths and isolation c of total cellular protein were as described in Example A small aliquot oof each supernatant (3 itl) containing total cellular protein was electrophoresiseed onto a 4-20% SDS-polyacrylamide mini-gel (Novex, EC60255; 1 mm thickk, with 15 wells/gel) in 25 mM in Tris base, 192 mM glycine, and 0.1% SDDS. The mini-gels were stained with Coomassie Blue. A faint protein band corresponding to the predicted molecular mass of T. thermophilus 3(3 (40.5 kDa) was visualized slightly above the 40 kDa molecular weight standdard of the Gibco 10 kDa protein ladder from the MGC1030 isolates, but could i not be discerned in the AP1.L1 isolates.

Large Scale Growth of pAl-CCA-TN/AP1.L1 Strain pAl-CCA-TN/AP1.L1 was grown in a 250 L fenrmentor (fermentor run #00-13), to produce cells for purification of T. thennopbhilus 3 as described in Example Optimum induction times were determilined as described in Example Cell harvest was initiated 3 hours after inducttion, at

OD

6 00 of 3.04, and the cells were chilled to 10 0 C during harvest. The I harvest volume was 170 L, and the final harvest weight was approximately O.S.9 kg of cell paste. An equal amount of 50 mM Tris (pH 7.5) and 10% s sucrose solution was added to the cell paste. Quality control results showed 100 out of positive colonies on ampicillin-containing medium in the inoculuum and WO 01/73052 PCTX/IUSO1/09950 -138- 10/10 positive colonies at induction and 10/10 positive colonies at hharvest.

Cells were frozen by pouring the cells suspension into liquid nitroge;en, and stored at -20 0 C, until processed.

EXAMPLE 7 Reconstitution of T. thermophilus DNA polymerase III holoenzymne A primary goal of our endeavor has been to obtain the m-ninimal assembly of the essential subunits of a processive thermophilic replica:ase that should permit processive synthesis of long stretches of DNA rapibidly at elevated temperatures. We hypothesized that, minimally, T. thermnophhilus ct, 3, DnaX, 8 and 8' would be required. With the availability of these protteins in N-terminal tagged forms, these proteins were used in an initial succcessful attempt at reconstitution. A modified form of the standard assay for the E. coli DNA polymerase Il holoenzyme was used. The method comprised syynthesis on a long single-stranded circular template primed by an RNA primer.r. M13 Gori single-stranded DNA was primed by the action of the E. coli i DnaG primase in a large volume reaction that was aliquoted and frozen away t for use in all reported assays. RNA primed M13 Gori single-stranded D3NA is prepared (9.5 ml) by adding: 0.5 ml MgOAc (250 mM), 1.125 ml M113 Gori (240 pM, nt), 0.2 m] purified E. coli SSB proteins (4.3 mg/ml), 1.5 mill dNTP mix (400 tM dATP, dCTP, dGTP and 150 |tM 1 3 H]-dTTP (100 cpmh/pmol), ml rNTP mix (5 mM of each ATP, CTP, GTP and UTP), 0.025 ml ppurified E. coli primase (0.665 mg/ml) and 5.65 ml EDB (50 mM HEPES (pbH 20% glycerol, 0.02 NP40, 0.2 mg/ml BSA). The radioactive dNTP mnix was not used in the priming reaction but was used by the replication polyymerase when it is added in the actual replication reaction (M13 Gori reaction)). The priming mix was incubated at 30 0 C for 5 min and then placed on icee. The mixture was divided into 400 ul aliquots and stored at -80°C until usee. This mixture was used in all M13 Gori assays and is referred to as the pprimedtemplate mix.

WO 01/73052 PCT/f/US01/09950 -139- Initially all of the purified T. thermophilus subunits (N-terminal 1 tagged c, 3, DnaX, 8 and 8) were assayed together to determine if the complexx could support processive polymerization of the M13 Gori primed templates. The initial concentration of each T. thennophilus subunit used in this initialal assay was arbitrarily set at 10 times the concentration of the E. coli Pol II suubunits used in similar assays (Olson, et al., J. Biol. Chem. 270:29570-29577 (1:1995)).

The subunits were diluted in EDB buffer so that when combined (6 uhl total) and combined with 19 ul of the primed-template mix to yield a 25 gl reeaction, the total levels of a, 3, 8, 8' and DnaX were 1.25, 1.25, 1.0, 1.0 and 2.0 1 pmols, respectively (all subunit concentrations are as monomers). The rezactions contained approximately 550 pmol of primed-template (total nuclecotides).

Reactions were initiated by combining the enzyme mix and the pprimedtemplate mix and incubating for 5 min at 50 0 C. The reactions were termninated by placing the reaction tubes on ice and adding 2 drops of 0.2 M NaPPPI and 0.5 ml 10% TCA. The solution was filtered under vacuum through Wfhatman GF/C glass microfibre filters. The filters were then washed with 3 ml I of IM HCl/0.2 M NaPPI and 1 ml 95% EtOH and dried using a heat lamp. Thae pmol of nucleotides incorporated were quantified by scintillation counting. Other reactions were carried out, in which a different subunit was sequeentially omitted from the reaction (FIG. 39). The final reaction (far right, FIG. 39) in which all subunits were present, but the concentration of a was increaased to pmols. From the graph of these reactions in Fig. 39, when any subbunit is omitted from the reaction the synthesis of DNA is decreased to veery low levels, however, in the presence of all reactants maximum synthaesis is observed. The results of these assays indicated that each subunnit was functional and required for processive polymerization.

The optimum temperature for the M13 Gori assay usi;ing T.

thennophilus Pol II subunits was determined. Reconstituted holoeenzyme reactions were carried out as described above (using 4 pmol of The reactions were incubated for 5 min at the indicated temperatures. IResults indicated that 50-65 0 C provided optimal temperatures for assayiying T.

WO 01/73052 PCT'/USO1119950 -140thennophilus replicative complex subunits (FIG. 40). Future assays v will be carried out at 60 0

C.

The activity of each of the subunits used to reconstitttute T.

thermophilus holoenzyme was assessed individually in the presence of f excess levels of the other four subunits. M13 Gori assays were initially desiggned so all of the subunits were present at the concentrations described :in the experiment 3, 6, 6' and DnaX were 1.25, 1.0, 1.0 and 2.0 pmols, respecictively) except cx. The a-subunit was added to different reactions in amounts vvarying from 0.125 to 4.2 pmol. Reactions were carried out at 60 0 C for 5 minn. The results indicate that all available M13 Gori template has been replicatedd in the presence of 1 pmol of a (FIG. 41A).

In the absence of the other subunits, there is a background level c of nonprocessive synthesis catalyzed by a. To define the background, a was assayed in the M13 Gori reactions in varying amounts (0.125 to 8.41 pmol) (FIG. 42).

In the assay in which a was titrated in M13 Gori holoenzyme assays, all the available template were replicated in the presence of 2 pmol off ca. In assays used to determine the background activity of a at a concentraticion of 2 pmol, only 17 pmol nucleotide were incorporated. Therefore, all future assays will contain 2 pmol a.

To determine the influence of p on the ability of the a to processsively replicate the primed-template, a was assayed at varying amounts in the presence of all of the other subunits excluding 0 (FIG. 43). As can bbe seen when compared with the activity of a alone (FIG. 42), a was only s slightly stimulated by the presence of the other holoenzyme subunits in the abseence of the 3-subunit.

As discussed above, translation of the T. thennophilus dna)iX gene results in the expression of both T-and y-subunits. The dnaX gene prodducts in E. coli function as part of the clamp loading apparatus which catalywzes the assembly of the P-sliding clamp. The "c-subunit also functions to dimeririze Pol WO 01/73052 PCT/AIUS01/09950 -141- III by direct contact with a (Dallmann, and McHenry, JJ. Biol.

Chem. 270:29563-29569 (1995)). From the Coomassie Blue stained geel (FIG.

of T-and y it appears that approximately 60% expression is of the ysubunit, while approximately 40% expression is of the T-subunit. The:erefore, to determine the optimum amounts of T-and y to use in the M13 Gori asssays a wider range of concentrations were assayed (0.312 to 20 pmol). These assays are shown in FIG. 41B, and approximately 4 pmol of T-and y are requiiired to achieve maximum reconstitution of the replicative complex. In futurre M13 Gori assays, 4 pmol of DnaX will be used.

The 1-subunit of replicative polymerases dramatically increasised the processivity by linking the catalytic subunit to the DNA. To test the abbility of p to reconstitute holoenzyme activity in the T. thennophilus system, 3 was titrated in the M13 Gori assay (0.08 to 10.0 pmol) (FIG. 41C). To) insure maximum activity in following M13 Gori assays 3 will be present at 4 ppmol.

Both 6 and the 6' are constituents of the clamp loading complezx in E.

coli and likely serve a similar function in T. thermophilus. In E. coli tlthey are both present in single copies and therefore smaller amounts may be neeeded to fully stimulate processive replications.

In future M13 Gori reactions, 8 and the 6' will be at 2 pmol. These assays (FIGs. 41D and 41E) have allowed us to determine the concentra'ation of all of the holoenzyme subunits required for optimal polymerization 1 by the catalytic subunit All of the subunits are required for proocessive polymerization. In the future, for purification of native subunits,;, assay conditions determined here will be used to follow each native protein ttthrough different purification steps. The assays will be designed so that the N-te:erminal tagged subunit corresponding to the native target subunit is omitted frcrom the reaction mixes and aliquots from column elution fractions will be subststituted.

In this way fractions containing the target native protein will be detectedd.

WO 01/73052 PCT//US0 1/09950 -142- EXAMPLE 8 Protein-Protein Interactions Involving the Subunits of T. thernnophilus POol III IO In view of considerable homology between DNA polymerase IIII genes 5 of E. coli and T. thennophilus, we tested whether some of the I known 0 interactions of subunits in E. coli also occur in T. thermophilus. Gel fililtration analysis of the interaction of Pol II subunits was preformed ussing a SSephacryl® S-200 (Pharmacia Biotech) column (0.7 x 30 cm) equilibrate:ed with HG.04 buffer. In all gel filtration experiments, the subunits (alone e or in various combinations) were incubated at 60 0 C for 5 minutes (300 tl) pprior to loading onto a Sephacryl S-200 column. The first three fractions (1 mhl each) contained the void volume and all subsequent fractions contained 3300 J1.

Fractions were analyzed in 10% SDS-polyacrylamide gels stainedd with Commassie Brilliant Blue. The fractions were also analyzed in reconst3titution activity assays in which all of the subunits were present as descriibed in Example 7, except the subunit(s) being analyzed. In these reactions, 22 p1l of each fraction was added to the reconstitution assay. If there was aactivity observed it was indicative of the presence of the subunit being analyzed 1 in that fraction. All of these assays were carried out with N-terminal tagged prcroteins.

Protein Interactions of Subunits Composing the Clamp-Loading Apparatatus In the E. coli clamp-loading complex, 8 and 8' interact with eaclh other and together with the DnaX subunits (z and Therefore, to determine e if this interaction is exist between the subunits composing the T. thermaophilus clamp-loading complex we first carried out gel filtration experiments uusing 8, and tW/ alone and in different combinations. Analysis of 6, 8' a and T/Y alone was performed using 200, 100 and 70 pg of protein, respectivel.ly. The elution profiles of the proteins assayed alone are shown in panel A, B annd D of Figure 44. 8 eluted two fractions (fraction 18) before 6' (fraction 220). T/y likewise eluted two fractions (fraction 16) before 8. The activity observed for WO 01/73052 PCT/f/U S 1/09950 (N -143fractions in reconstitution assays are shown in the boxes beneath thee SDS- Spolyacrylamide gels (Figure 44) and correspond to the fractions contitaining protein bands. Next, 8 (150 Gug) and 8' (150 pg) were assayed togetther to NO determine if an interaction occurs. A shift in the elution position .would 5 indicate an interaction between the tested subunits to form a larger coomplex 0 than either subunit alone. In this assay (Figure 44, panel 8 and 85'' eluted two fraction earlier than 8 alone indicating an interaction between theese two proteins was occuring. There is also a shift if the activity profile corroboorating the protein elution profiles and further support an interaction between tithe two subunits. Unfortunately, 8 and 8' are similar in size and could not be re:esolved on either 10% or on gradient polyacrylamide gels (data not shown). WFhen t/y pig) was assayed with 8 (70 ig) and 8' (85 the elution profifile was shifted to fractions earlier than any of the subunits alone (Figure 44, pannel E).

The SDS-polyacrylamide gels indicate that all subunits are contained I within the shifted fractions and the activity profile supports this observation.

To determine if the clamp-loading complex formed tlthrough interactions with either 8 or 8' and T/y, gel filtration experiments were carried out in which t/y (60 p.g) and 8 (75 Gg) or 8' (40 G.g) were analyzed. VWhen t and y/8 were assayed together, no interaction was seen in either r SDSpolyacrylamide gels or activity assays. However, when T/y and 88' were assayed together both DnaX proteins and 8' were observed to be shifted together in both SDS-polyacrylamide gels and also in activity assays 3 of the elution profile (data not shown). From these data, we theorize that the c clamploader apparatus forms through interaction between 8' and both T/y and 158.

Protein Interactions of the Catalytic Subunit a and Subunits Composing g the Clamp-Loading Apparatus In the E. coli Pol 1I holoenzyme, two a catalytic subunitits that replicate the leading and lagging DNA strands are held togetlther by interactions with the DnaX protein T. (See, McHenry, J. Biol. (Chem., WO 01/73052 PCT/r/USO1/09950 -144- 257:2657-2663, [1982]). To determine if there are similar interaactions occurring in the T. thermophilus holoenzyme the interaction of the a-s-subunit with the DnaX proteins and other members of the clamp-loading appparatus were assayed by gel filtration. When ca (75.tg) was subjected to gel fililtration in the absence of other subunits the peak fraction eluted in fraction 16 (.(Figure panel In the presence of t/y (170 gg), the elution is shifted to fifraction 14 (Figure 45, panel From the previous section r/y alone elduted in fraction 16 (Figure 44, panel These observations indicate that a innteracts with t/y and probably through interactions with T since a larger r relative amount of T appears to be shifted than y when in the presence of a (comnparing Figure 44, panel D and Figure 45 panel B).

Next, a (40 fig), T/y (115 Rg), 5 (50 rig) and 6' (50 |tg) are aassayed together to determine if 8 and 8' are also shifted in the presence of a aand T/y.

In these assays, 8/8' appear to be shifted to fraction 14 (Figure 45, paanel C) from fraction 18 when they are assayed together (Figure 44, panel C).

A dimer of 3 forms a ring structure that is loaded onto DNA annd acts to tether the replicative complex to DNA during replication thereby connstruing the processivity characteristic to the Pol III holoenzyme in E. coli. In an attempt to determine the interaction of T. thenrophilus 3 with other moembers of the T. thenrophilus holoenzyme, 3 was assayed in gel fililtration experiments. Initially, 3 was assayed alone (250 Gig, 20 lM) to determnine the elution profile in the absence of other proteins. The 3 subunit eluted frirom the Sephacryl S-200 column in fractions 12-20, suggesting the formation oof large molecular weight multimers (Figure 46). To address the possibilitity that formation of multimers might be concentration dependent, 3 was re-asssayed at a 10 fold lower concentration (25 gig, 20pM). The results of these assayys were identical to that seen at the higher concentration. Therefore, the interac.ction of 3 subunit with other components of the DNA polymerase III holoeenzyme could not be examined by this method.

WO 01/73052 PCT/F/U S 1/09950 -145- EXAMPLE 9 Identification of T. thermophilus ssb gene The ssb gene sequences from A. aeolicus, B. subtilis, E. coli, and H.

influenzae was used to search the T. thermophilus genome databbase at Goettingen Genomics Laboratory. A sequence of a region of the T.

thermophilus genome containing a putative T. thermophilus ssb genne was identified (using BLAST) and obtained (from Dr. Carsten Jacobi, Goeettingen Genomics Laboratory, Institute of Microbiology and Geienetics, Grisebachstrasse 8, Goettingen, Germany). Using the crude sequenace, two PCR primers were designed to amplify the ssb gene. In the PCR reactition, the forward/sense primer (ATG primers P138-S540, GATCCATGGCTCGAGGCCTGAACCGC-3') (SEQ ID NO:29))) was designed so that an NcoI site overlapped the start "ATG" codon.i. The reverse/antisense primer (P138-A1348, GGCAAATCCTC-3') (SEQ ID NO:30) was designed to add an addditional "TGA" stop codon adjacent to the native "TGA" stop codon and a KpnI restriction site in the non-complementary' region. Both primers conntained addition nucleotides to allow for efficient digestion with the NcoI anad KpnI restriction enzymes. The PCR reaction used T. thennophilus genomic DDNA as a template and yielded a PCR product of 808 bp in length. This PCR fraragment was inserted into pGEM-T Easy T (Promega) vector per manufifacturer directions. This plasmid was transformed into DH5a bacteria and ppositive isolates were screened for by plasmid digestion with EcoRI restrictionn digest yielding 0.8 and 3.0 kb fragments. The plasmids from one positive isollate was selected and the correct sequence of both strands of the DNA were iddentified by DNA sequencing across the inserted region (ATG SEQ #14332-1436; primers, SP6, T7, P138-S913, P138-A1148, P138-A824). This plasmnid was named pT-TSSB and the isolate was stored as a glycerol stock culture-e (ATG glycerol stock #838).

WO 1/73052 PCT//U SO 1/09950 -146- The DNA coding sequence of the T. thennophilus ssb gene (SBEQ ID NO:31) in FIG. 47. The start codon (atg) and the stop codon (tga) are i in bold print. Also shown below (FIG. 48) is the protein (amino acid).sequencee (SEQ ID NO:32) derived from the DNA coding sequence.

The amino acid sequence of the T. thennophilus SSB protei.in was compared by sequence alignment with the sequence of several othe.er SSB proteins (FIG. 49). The sequence of the T. thermophilus SSB proteiin was shown to contained an additional 50-70 amino acids in these compaiarisons.

This is approximately 25% of the entire protein.

We know from previous studies that the SSB proteins from E. ccoli are functional in a homotetrameric form (Lowman and Ferrari, Annuu. Rev.

Biochem. 63:527-570 (1994)). The N-terminal 115 amino acids of the E. coli SSB contain the ssDNA-binding region. Other identified SSB proteinss share similarities with E. coli SSB and contain the ssDNA binding region witlthin the N-terminal region. These other SSB proteins are also thought to be acctive as tetramers. As shown (in FIG. 49) the T. thennophilus SSB contains s an Nterminal region similar to the E. coli SSB and others, but is approxiiimately larger than the E. coli SSB. The sequence of the additional regiion (Cterminal region) of the T. thermophilus SSB was compared with its oown Nterminal ssDNA binding regions (FIG. 50). Surprisingly, there was exttensive sequence homology suggesting that this additional region may conntain a second ssDNA binding region. If the T. thennophilus SSB contairins two ssDNA binding regions it would be unique in SSB proteins yet studided and might explain the ability of T. thennophilus SSB to bind ssDNA at eblevated temperatures.

Construction of Plasmid (pAl-TSSB) that Overexpresses T. thermophiiilus ssb gene (SSB) as a Native Protein The TSSB gene contained an internal KpnI restriction site, thercrefore a partial NcolIKpnI restriction digest allowed the entire T. thennophililus ssb gene to be extracted from the pT-TSSB plasmid. The NcollKpnI rest3triction WO 01/73052 PCT/r/US01/09950 -147fragment containing the entire T. thennophilus ssb gene was inserted irinto the pAl-CB-NcoI plasmid digested with the same two restriction enzymes's. The pAl-CB-NcoI plasmid contains a downstream hexahistidine a and a biotinylation site, but it is downstream of the stop codon of the ssb geone and out of frame and will not be expressed. This plastmid was transformeed into bacteria and positive isolates were screened for by plasmid diggestion with NcoIIKpnI restriction enzymes yielding 161 bp, 642 bp and 23.0 kb fragments. The plasmids from one positive isolate was selected annd the correct sequence of the inserted DNA were confirmed by DNA sequlencing across the inserted region (ATG SEQ #1445 and 1446; primers, P138-SS5576, P138-S913). This plasmid was named pAl-TSSB and the isolate was 3 stored as a glycerol stock culture (ATG glycerol stock #846).

Verification of Expression of Plasmid (pAl-TSSB) that Overexpres:sses T.

thennophilus ssb gene as a Native Protein from pAl-TSSB/MGC1030 Plasmid pAl-TSSB was prepared from DH5a bacteria as prevviously described. The plasmid was transformed into MGC1030 bacteria I (ATG glycerol stock #872, 873, 874). The bacterial growths and isolation oof total cellular protein. were as described in Example 2. A small aliqquot of supernatant (3 tl) containing total cellular protein from each of thee three isolates was loaded onto a 4-20% SDS-polyacrylamide mini-gel (INovex, EC60255; 1 mm thick, with 15 wells/gel) in 25 mM in Tris base, 1992 mM glycine, and 0.1% SDS. The mini-gel was stained with Coomassiee Blue.

There were no visible protein bands from any of the isolates corresponoding to the predicted molecular weight of the T. thermophilus SSB.

Construction of a Plasmid (pAl-CB-TSSB) that Overexpress T. thermaophilus SSB Gene Fused to a C-Terminal Peptide That Contains Hexahistidinee and a Biotinylation Site The gene encoding T. thennophilus SSB above was amplified bby PCR using the pAl-TSSB plasmid as a template. The forward/sense primer:r (ATG WO 01/73052 PCT/r/U SO1/09950 -148primer #P138-S540) was the same primer used in construction of pAl-1-TSSB and contained a region complementary to the 5' end of the T. themiaophilus SSB gene. As before, a NcoI site overlapped the ATG start codonn. The reverse/antisense primer was complementary to the 3' end of 1 the T.

thermophilus SSB gene excluding the stop codon (ATG primer ,#P138- A1343spe, 5'-GACGACTAGTAAACGGCAAATCCTCCTCC (SBEQ ID NO:33). This primer contained a Spel restriction site adjacent to the complementary region of the primer. The Spel site allowed for the exppressed protein to contain two additional amino acids (Thr and Ser) between t the Cterminal amino acid of the SSB protein and the C-terminal fusion ppeptide.

This 800 bp PCR product was digested with NcoVISpeI and inserted irinto the plasmid pAl-CB-NcoI digested with the same restriction enzyrrmes as previously described. This plasmid was transformed into DH5c bacteeria and plasmids from positive isolates were screened for by digestion with NccoIISpeI restriction enzymes yielding 0.8 and 5.6 kb fragments. One positive pplasmid was selected and the sequence of the insert verified by DNA sequencingg (ATG SEQ #1504-1507; primers, P38-S5576, P65-A106, P138-S913, P138-AA1148).

This plasmid was named pAl-CB-TSSB and the isolate was storeed as a glycerol stock culture (ATG glycerol stock #897).

Verification of Expression of T. thennophilus SSB Protein Fused tcto a C- Terminal Peptide That Contains Hexahistidine and a Biotinylation SSite by pAl-CB-TSSB/MGC1030 The pAl-CB-TSSB plasmid was prepared and transformeed into MGC1030 bacteria (ATG glycerol stock #919). The bacterial growiths and isolation of total cellular protein were as described Example 2. A A small aliquot of each supernatant (3 .tl) containing total cellular protein was loaded onto a 4-20% SDS-polyacrylamide mini-gel (Novex, EC60255; 1 mmn thick, with 15 wells/gel) in 25 mM in Tris base, 192 mM glycine, and 0.10/p SDS.

The mini-gels were stained with Coomassie Blue. The region of thee gel in WO 01/73(52 PCT/f/USO1109950 -149which CB-TSSB was expected contained other intense protein bands a and the T. thennophilus SSB protein could not be visualized.

Next, the total protein in each lysate was transferred (blottedd) from polyacrylamide gel to nitrocellulose as described in Example 2. Eacich lane contained 1.5 .l of the supernatant. Proteins on the blotted nitrocellulosise were visualized by interactions with phosphatase-conjugated streptaviddin as described above. The endogenous E. coli biotin binding protein, -20 kLDa was detectable in both induced and non-induced samples. A proteinn band corresponding to the T. thennophilus SSB protein migrated just below i the kDa molecular weight standard of the Gibco 10 kDa protein ladderr. The predicted molecular weight of CB-TSSB is 33.5 kDa. This proteiin was observed as a faint band in the induced cultures, but was not observedd in the uninduced control lysates.

Large Scale Growth of T. thennophilus ssb Gene Product Fused tcto a C- Terminal Peptide That Contains Hexahistidine and Biotinylation Site bpy pAl- CB-TSSB/MGC1030 Strain pAl-CB-TSSB/MGC1030 was grown in a 250 L fermeentor to produce cells for purification of T. thennophilus SSB protein as descriribed in Example 2. Cell harvest was initiated 3 hours after induction, at OD 600 0 of 8.4, and the cells were chilled to 10 0 C during harvest. The harvest volumne was 178 L, and the final harvest weight was approximately 2.4 kg of cell pasiste. An equal amount of 50 mM Tris (pH 7.5) and 10% sucrose solutidon was added to the cell paste. Quality control results showed 10 out of 10 ppositive colonies on ampicillin-containing medium in the inoculum, 8/10 ppositive colonies at induction and 8/10 positive colonies at harvest. Cells were frozen by pouring the cells suspension into liquid nitrogen, and stored at -20 0 CC, until processed.

WO 01/73052 PCT//USOI/09950 -150- Determination of Optimal Ammonium Sulfate Precipitation Conditidons of SSB Fused to a C-Terminal Peptide That Contains Hexahistidinne and Biotinylation Site by pAl-CB-TSSB/MGC1030 Lysis was accomplished by creation of spheroplasts of thee cells carrying the expressed T. thennophilus SSB proteins. First, from 100 g of a 1:1 suspension of frozen cells (50 g cells) in Tris-sucrose which haad been stored at -20°C, Fr I (170 ml, 14 mg/ml) was prepared. The preparaticion was as described in Example 2. The sample was then divided into 4 equal vc/olumes (40 ml) and 6.56, 9.04, 11.64 and 14.44 g of ammonium sulfate (30%io, and 60% saturation) was added to each separate sample, respecctively, over a 15 min interval at 4°C. The mixture rested for an additional 30 min at 4 0 C and was then centrifuged at 23,000 x g for 45 min at 0°C. The reesulting pellets were resuspended in 2 ml Ni-NTA suspension buffer. The 30%o, 50% and 60% ammonium sulfate precipitated samples contained protein concentrations of 0.04, 0.18, 1.6 and 2.9 mg/ml, respectively. The saamples were analyzed by SDS-polyacrylamide gel electrophoresis. The 30% annd ammonium sulfate precipitated samples contained no detectable SSB pprotein.

The 50% and 60% samples contained bands of equal intensity of a i protein migrating in the region corresponding to the molecular weight of T.

thermophilus SSB. This band was faint compared to other proteinns cited above and yields from large-scale preparations of the protein were thouught to be small. Analysis by SDS-polyacrylamide gel electrophoresis of ssamples purified using Ni-NTA resin, but not ammonium sulfate precipitateted also failed to allow a distinctive T. thennophilus protein band to be visualizeed.

Purification of T. thennophilus SSB Protein Fused to an C-Terminal FPeptide That Contains Hexahistidine and a Biotinylation Site by pAA1-CB- TSSB/MGC1030 Even though the initial analysis of expression levels of T. thennaophilus SSB indicated low yields, enough protein could be isolated from largge-scale preparations for antibody production. Lysis was accomplished by crealation of WO 01/73052 PCIT/IUSO 1/09950 -151spheroplasts of the cells carrying the expressed T. thermophilus SSBB. FrI (1270 ml, 10.6 mg/ml) was prepared from 800 g of a 1:1 suspension of f frozen cells (400 g cells) stored in Tris-sucrose which had been stored at -200 OC as described in Example 2. To Fr I, ammonium sulfate (0.291 g to each inilitial ml Fraction 1-50% saturation) was added over a 15 min interval. The mnixture rested for an additional 30 min at 4°C and was then centrifuged at 23,0000 x g for 45 min at 0°C. The resulting pellets were quick frozen by immers~sion in liquid nitrogen and stored at -80 0

C.

The protein pellets were resuspended in 150 ml of Ni+-NTA suspension buffer and homogenized using a Dounce homogenizer.:. The sample was clarified by centrifugation (16,000 x g) and the supernmatant constituted Fr II (30 mg/ml). Fr II was added to 50 ml of a 50% slurry y of Ni- NTA resin and rocked for 1.5 hours at 4 0 C. This slurry was then loaded I onto a BioRad Econo-column (2.5 x 5 cm). The column was washed with 4000 ml of Ni"-NTA wash buffer at a flow rate of 1.5 ml/min. T. thepmophilus SSSB was eluted in 250 ml of Ni+-NTA elution buffer containing a 10-2000 mM imidazole gradient. The eluate was collected in 96 x 2.5 ml fracactions.

Fractions were subjected to SDS-polyacrylamide gel electrophoresisis and biotin blot analysis, and fractions 28-70 were found to contain over 995% of total SSB protein (FIG. 51). E. coli 8 was used as a control sinnce the molecular weight is similar to T. thermophilus SSB. In the Coomassicie Blue stained gel, no clear protein bands corresponding to T. thennophiluus SSB could be defined, however, the biotin blot analysis allowed us to detttermine fractions containing T. thennophilus SSB protein. Fractions 28-700 were pooled (100 ml, 0.76 mg/ml) and precipitated by addition of ammnonium sulfate to 50% saturation. This sample was centrifuged as prevviously described resulting in two protein pellets.

WO 01/73052 PCT/r/US)1/09950 -152- Production of Polyclonal Antibodies Against T. thennophilus SSB Prote:ein One of the two T. thennophilus SSB precipitated protein pellet:ts from above was resuspended in 20 ml of PBS and represented Fr III (1.5 mg/r/ml). A 2 ml UltraLink T M Immobilized Monomeric Avidin column (1.1 cm x 22.5 cm) (Pierce) was equilibrate in PBS plus 10% glycerol as per manufaacturers instructions. The Fr I sample was loaded onto the avidin column, whitich was then washed (15 ml) and eluted (40 ml) in fractions as described in Exanmple 3.

The fractions were analyzed by SDS-polyacrylamide gel electrophoresisis, and faint protein bands corresponding to T. thermophilus SSB could be deteected in fractions 4-35. These fractions were pooled (27 ml, 0.01 mg/ml) aand the protein was precipitated by adding ammonium sulfate to 50% saturatidon and the precipitate was collected by centrifugation (23,000 x g, 45 min, 0°eC) and stored at -80°C. The pellet was then resuspended in 2 ml of PBS (0.01 r mg/ml) and subjected to SDS-polyacrylamide gel electrophoresis and biotitin blot analysis. This sample contained two faint upper molecular weight contaminating proteins, however because of the low yield of SSB prottein, we decided to use this sample for antibody production.

The dialyzed samples were used to produce polyclonal antitibodies against T. thermophilus ssb gene product (SSB protein) as descrihbed in Example 3.

Construction of a Plasmid (pAl-NB-TSSB) that Overexpress T. thennaophilus ssb Gene Fused to an N-Terminal Peptide That Contains Hexahistidinee and a Biotinylation Site To increase expression of T. thermophilus SSB a vector was ddesigned to express SSB as an N-terminal tagged protein. The forward/sense primer (ATG primer P138-S539pst, CCGCGTTTTCC-3') (SEQ ID NO:61) is designed so that thee noncomplementary portion contains a "AAA" clamp region and a PstI sitete. The complementary portion of the primer is complementary to the first 25 ntt of the WO 01/73052 PCT/r/US01/09950 153ssb gene beginning at codon 2, so that the first codon (the "ATG" start c codon) is excluded. This will allow the PCR product to be inserted into the vector pAl-NB-AgeI at the PstI site therefore fusing the ssb gene inframe wvith the N-terminal tagged peptide. The reverse/antisense primer (ATG primer r P138- A1348stopspe, 5'-GACAACTAGTCATCAAAACGGCAAATCCTCCC-3') (SEQ ID NO:62) contains a "GACA" clamp region and a Spel restricticion site in the non-complementary region. The non-complementary regionn also contains an additional "TGA" (TCA) stop codon that will be adjacentit to the native "TGA" stop codon, giving two stop codons in tandem.

The PCR reaction used pAl-TSSB as a template and yielded a PCR product of 815 bp in length. This PCR fragment digested with PstI annd Spel was inserted into pAl-NB-AgeI digested with PstI and Spel and resultedd in the plasmid pAl-NB-TSSB which contained the entire gene encoding the T.

thennophilus SSB. PAl-NB-TSSB was transformed into DH5ct bacteeria and positive isolates were screened for by plasmid digestion with PstI annd Spel restriction digest yielding 5.6 and 0.8 kb fragments. The plasmids froom one positive isolate was selected and the correct sequence of both strands s of the DNA were identified by DNA sequencing across the inserted region i (ATG SEQ #1855-1859 and #1884-1885; primers: P138-S913, P138-A1148,;, P138- A824, NB-Sseq, p64-A215). This isolate was stored as a glycerobl stock culture (ATG glycerol stock #1101).

Verification of Expression of T. thennophilus SSB Fused to an N-te:erminal Peptide that contains Hexahistidine and a Biotinylation Site The pAl-NB-TSSB plasmid was prepared and transformeed into MGC1030 (ATG glycerol stock #1128) and AP1.L1 bacteria (ATG gglycerol stock #1129). Three isolates from each tranformation were selected for r farther study. The bacterial growths and isolation of total cellular protein wwere as described in Example A small aliquot of supernatant (3 gl) conttaining total cellular protein from each of the three isolates was loaded onto a 1 4-20% SDS-polyacrylamide mini-gel (Novex, EC60255; 1 mm thick, wyith WO 01/73052 PCT/f/USr 1/09950 -154wells/gel) in 25 mM in Tris base, 192 mM glycine, and 0.1% SDS. Thee minigel was stained with Coomassie Blue. Distinct protein bands from all I of the isolates corresponding to the predicted migration region of T. thermoophilus SSSB (approximately 33.5 kDa) were visualized.

5 Next, the total protein in each lysate was transferred (blotted)1) from Spolyacrylamide gel to nitrocellulose as described in Example Eaclch lane contained 1.5 ul of the supernatant containing total protein. Proteins I on the Sblotted nitrocellulose were visualized by interactions with phospbhataseconjugated streptavidin as described above. The endogenous E. coli i biotin binding protein, -20 kDa was detectable in both induced and non-irinduced samples. A protein band corresponding to the T. thennophilus SSB protein migrated midway between the 30 and 40 kDa molecular weight standardd of the Gibco 10 kDa protein ladder. This protein was observed as a very intensise band in the induced cultures, but was not observed in the uninduced control lyysates.

Optimization of Expression of T. thennophilus SSB by pA 1-NB-TSSB Since expression of T. thennophilus ssb gene yielded low or no detectable proteins when expressed as both a native or coupled to, an Cterminal fusion peptide, extra care was taken with T. themophilus SSB linked to an N-terminal fusion peptide to achieve optimum expression. Exporession was analyzed using both E. coli strains MGC1030 and AP1.L1 carryinpg pAl- NB-TSSB at different induction times. Growth of bacterial culturcres and analysis were carried out as described in Example Biotin blot aanalysis indicated that expression levels were higher at 37 °C and also slightlyy better when expressed in the AP1.L1 bacterial strain. The optimum yieldd of T.

thermophilus SSB was attained by 3 h post induction and at 37 °CC; this induction time will be used in subsequent experiments.

WO 01/73052 PC'T/r/U S01/09950 -155- Large Scale Growth of pAl-NB-TSSB/AP1.L1 Strain pAl-NB-TSSB/AP1.L was grown in a 250 L fermenntor to produce cells for purification of T. thermophilus SSB fused to an N-te:erminal peptide that contains hexahistidine and biotinylation site as descriibed in Example Cell harvest was initiated 3 hours after induction at OD 600 0o and the cells were chilled to 10 OC during harvest. The harvest volurrmne was 180 L, and the final harvest weight was approximately 2.07 kg of cellll paste.

An equal amount of 50 mM Tris-HCI (pH 7.5) and 10% sisucrose solution was used to resuspend the cell paste. Cells were frozen by ppouring the cell suspension into liquid nitrogen, and stored at -20 'C until proocessed.

Quality control results showed 10 out of 10 positive colonies on amppicillincontaining medium in the inoculum, 10 out of 10 positive colonnies at induction and 10 out of 10 positive colonies at harvest.

Purification of T. thennophilus ssb Product Fused to an N-Terminal FPeptide That Contains Hexahistidine and a Biotinylation Site Lysis of 800 g of a 1:1 suspension of frozen cells (400 g of>f cells) containing pAl-NB-TSSB stored in Tris-sucrose at -20 oC was prefonrmed as described Example The recovered supernatant (1.4 1) constituteted Fr I (10.7 mg/ml). To Fr I, ammonium sulfate (0.291 g to each initial ml Ffraction 1-50% saturation) was added over a 15 min interval. The mixture was s stirred for an additional 30 min at 4 OC and the precipitate was collectted by centrifugation (23,000 x g, 45 min, 0 OC). The resulting pellets were-e quick frozen by immersion in liquid nitrogen and stored at -80 °C.

The pellets from Fr I were resuspended in 100 ml of Ni'-NTA suspension buffer (50 mM Tris-HCl (pH 40 mM KCI, 7 mM MgClI;z, glycerol, 7 mM 3PME, 0.1 mM PMSF) and homogenized using a -Dounce homogenizer. The sample was clarified by centrifugation (16,000 x g) e and the supernatant constituted Fr II. Fr II was added to 40 ml of a 50% slilurry of Ni++-NTA resin in Ni"-NTA suspension buffer and rocked for 1.5 houurs at 4 WO 01/73052 PCT/T/USO /09950 -155- Large Scale Growth of pAl-NB-TSSB/AP1.L1 Strain pAl-NB-TSSB/AP1.L1 was grown in a 250 L fermenntor to produce cells for purification of T. thermophilus SSB fused to an N-te:erminal peptide that contains hexahistidine and biotinylation site as descrilibed in Example Cell harvest was initiated 3 hours after induction at OD 00 oo and the cells were chilled to 10 OC during harvest. The harvest volumne was 180 L, and the final harvest weight was approximately 2.07 kg of cellil paste.

An equal amount of 50 mM Tris-HCI (pH 7.5) and 10% s.sucrose solution was used to resuspend the cell paste. Cells were frozen by ppouring the cell suspension into liquid nitrogen, and stored at -20 oC until proocessed.

Quality control results showed 10 out of 10 positive colonies on amppicillincontaining medium in the inoculum, 10 out of 10 positive colonnies at induction and 10 out of 10 positive colonies at harvest.

Purification of T. thennophilus ssb Product Fused to an N-Terminal FPeptide That Contains Hexahistidine and a Biotinylation Site Lysis of 800 g of a 1:1 suspension of frozen cells (400 g off cells) containing pAl-NB-TSSB stored in Tris-sucrose at -20 OC was prefonrmed as described Example The recovered supematant (1.4 1) constituteied Fr I (10.7 mg/ml). To Fr I, ammonium sulfate (0.291 g to each initial ml Ffraction 1-50% saturation) was added over a 15 min interval. The mixture was 3 stirred for an additional 30 min at 4 °C and the precipitate was collectted by centrifugation (23,000 x g, 45 min, 0 OC). The resulting pellets were-e quick frozen by immersion in liquid nitrogen and stored at -80 °C.

The pellets from Fr I were resuspended in 100 ml of Ni-+-NTA suspension buffer (50 mM Tris-HCI (pH 40 mM KCI, 7 mM MgCll1 2 glycerol, 7 mM PME, 0.1 mM PMSF) and homogenized using a IDounce homogenizer. The sample was clarified by centrifugation (16,000 x g) e and the supernatant constituted Fr II. Fr II was added to 40 ml of a 50% sllurry of Ni"-NTA resin in Ni"-NTA suspension buffer and rocked for 1.5 houurs at 4 WO 01/73052 PCT/l'IUSOI/09950 i -156- OC. This slurry was then loaded onto a BioRad Econo-column (2.5 x 5 cm).

n The column was washed with 300 ml of Ni"-NTA wash buffer (50 mINM Tris- HCI (pH 1 M KC1, 7 mM MgCl 2 10% glycerol, 10 mM Imidaazole, 7 D0 mM 3ME) at a flow rate of 0.5 ml/min. The protein was eluted in 3000 ml of 5 Ni+-NTA elution buffer (50 mM Tris-HC1 (pH 40 mM KC1, 7 mM 0 MgCl 2 10% glycerol, 7 mM 3ME) containing a 10-200 mM imidazoble-HCI (pH 7.5) gradient. The T. thermophilus SSB eluted across the second 1 half of O the gradient and contained a number of contaminating proteins as deteermined by SDS-polyacrylamide gels. These fractions were pooled and the I protein isolated by precipitation with ammonium sulfate (0.291 g to each initiahl ml of saturation).

One-third of the precipitated protein was was resuspended in 2(0 ml of PBS containing 10% glycerol and further purified using a monomeric: avidin column as describe in Example The yield from this column was almost homologous T. thermophilus SSB (20 ml, 0.23 mg/ml).

The remaining two-thirds of the precipitated protein was resusppended in 20 ml of Ni+-NTA suspension buffer, mixed with 10 ml of a 50% shlurry of NiHNTA resin and rocked for 1.5 hours at 4 The resin was pouredd into a column and purified as before. The yield from this column was also almost homologous T. thermophilus SSB (68 ml, 0.5 mg/ml). Both I protein purifications were frozen by imersion in liquid nitrogen and stored at t -80 °C for future analysis.

Cloning T. thermophilus ssb Gene (SSB) into a Translationally Cloupled Vector pTAC-CCA-ClaI To efficiently express SSB as a native protein we designed a veector to express SSB as a translationally coupled protein. We again use transllational coupling as described in Example 2. The T. thennophilus ssb genne was inserted behind the CCA adding enzyme and translationally couppled as described for the other T. thermophilus proteins expressed by translatitionally coupling. First, the ssb gene was amplified by using pAl-TSSB as a te:emplate WO 01/73052 PCT/T/US01/09950 -157by PCR. The forward/sense primer (ATG primer #P138-S533claa2, ACTGATCGATAATGGCTCGAGGCCTGAACCGC-3) (SEQ ID bNO:63) has a ClaI restriction site in the non-complementary region. Theie noncomplementary region also contains the "TA" of the stop (TAA) f for the upstream CCA-adding protein fragment. The region of the primer complementary to the 5'end of the T. thennophilus holA gene begins wivith "A" which is the first nucleotide of the "ATG" start codon and the final of the "TAA" stop codon. The reverse/antisence primer (ATG primer ,#P138- A1348stopspe, 5'-GACAACTAGTCATCAAAACGGCAAATCCTCC-3') (SEQ ID NO:64) contains a Spel restriction site in the non-complemnentary portion of the primer and also an additional stop codon adjacent to thee native stop codon, giving two stop codons in tandem. There was also a clamp region for efficient cutting with Spel. Next, the PCR product was digesteed with ClaIISpeI restriction enzymes and inserted into the pTAC-CCA-ClaI pplasmid digested with the same enzymes. The plasmid was transformed into bacteria and plasmids from ampicillin-resistant positive isolates were sccreened for by digestion with ClaIISpeI restriction enzymes yielding 0.8 and 1 5.5 kb fragments. The sequence of both strands of the insert were verified byy DNA sequencing (ATG SEQ #1688-1692, 1721; primers, P144-S23, P144-/-A1965, P65-A106, P138-S913, P138-A1148, P138-A828). Sequence aanalysis confirmed that the correct sequence was contained within the inserted I region.

This plasmid was named pTAC-CCA-TSSB and the isolate was store-ed as a stock culture (ATG glycerol stock #1033).

Verification of Expression of Native T. thermophilus SSB by PTAC.-CCA- TSSB/MGC1030 and pTAC-CCA-TSSB/AP.LI The pTAC-CCA-TSSB plasmid was prepared and transformaed into MGC1030 bacteria (ATG glycerol stock #1071, 1072, 1073) and AAP1.L1 (ATG glycerol stock #1079). The bacterial growths and isolation oof total cellular protein were as described in Example 2. A small aliquot oof each supernatant (3 tl1) containing total cellular protein was electrophoresise;ed onto WO 01/73052 PCT/f/USO 1/09950 -158a 4-20% SDS-polyacrylamide mini-gel (Novex, EC60255; 1 mm thickk, with wells/gel) in 25 mM in Tris base, 192 mM glycine, and 0.1% SDDS. The mini-gels were stained with Coomassie Blue. A faint protein band corresponding to the predicted molecular mass of T. thermophilus SSBB (29.8 kDa) was visualized migrating just above the 30 kDa molecular 1 weight standard of the Gibco 10 kDa protein ladder in the AP1.L1 isolates.

EXAMPLE Identification of Two T. thermophilus dnaQ genes (e-subunits) From the previous Tth patent application Applilication #09/151888), the probe 5'-CCT CGA ACA CCT CCT GCC GCA AGAA CCC TTC GAC CCA-3' (SEQ ID NO:34) was used to screen a lambda I library containing T. thermophilus genomic DNA. Using this probe, over 100) strong positive plaques were identified and verified by replating. Three were grown up and the DNA purified as described for dnaE. One (cl#5.1.1) was seelected for further sequencing. The sequence of a major portion of the dnaQ geene was obtained by direct sequencing of the insert in the isolated lambda DNAA using sequences selected from the PCR product to initiate sequencingg. As previously described Application 09/151888), upon preliriminary examination of the sequence, it was found to encode one continuouus open reading frame (ORF) that showed significant homology to other r DNA polymerase m e-subunits from other bacteria (based on a BLAST searcrch). A strong secondary structure or other block prevented obtaining mnore 3' sequence of the T. thermophilus dnaQ gene.

The T. thennophilus genome database at Goettingen Gennomics Laboratory was searched for using the sequence of the ORF identified I above.

It indicated two open reading frames that showed close similarity to our r partial Tth dnaQ sequence. The closest match was designated dnaQ-1 aand the poorer-scoring match dnaQ-2. DnaQ2 is described in Example 14.. Only homology scores, not the actual sequence data was available from thhe web WO 01/73052 PCT/'/US0 1/09950 -159site. Dr. Carsten Jacobi (Goettingen Genomics Laboratory, Instititute of Microbiology and Genetics, Grisebachstrasse 8, Goettingen, Germany) i agreed to provide crude, unannotated incomplete sequence information in the r regions of our BLAST hits on their website. Examination of the sequences inadicated two clearly independent but homologous dnaQ-like genes. Initially, foocusing on dnaQ-1, several restriction sites (NgoMIV, BamHI, NcoI and SacTI) were identified upstream and downstream of the dnaQ-1 gene. To obtain thete entire correct sequence of the T. thermophilus dnaQ-1 gene, the lambda clone #5.1.1 (described in U.S. Application 09/151888) was digested with NggoMIV, BamHI, NcoI and SacI restriction enzymes. Restriction digest was carriried out on 5 .tl (approx. 2.8 glg DNA) of the lambda clone The digesteed DNA samples were electrophoresised on a 1% agarose gel and transfenrred by capillary transfer to MSI Magnagraph nylon membrane. The blot (G10 x cm) was treated with 20 ml of Ambion Ultrahyb M hybridization soluution at 42 0 C for 2 h, then 20 ng of the biotinylated probe (probe 5'-CCT CGAA ACA CCT CCT GCC GCA AGA CCC TTC GAC CCA-3' (SEQ ID NO:335) was added to the hybridization bag and the blot was incubated at 42 0 C oveemight.

The blot was processed and detected using an NEB Phototope CDDP-Star chemiluminescence detection kit per manufacturer's instructions (New England BioLabs). The probe hybridized with a 1 kb NgoMIVISacI restatriction fragment. This 1 kb NgoMIVISacI restriction fragment was chossen for subcloning and sequencing.

A pUC21 cloning vector (Sigma) was chosen as the recipient t DNA, and was subjected to NgoMIVISacI digestion. The NgoMIV/SacI fragmnent of the lambda clone #5.1.1 was ligated into the digested pUC21. The reesulting plasmid was transformed into DH5a and isolates were selected 1 for by ampicillin-resistance. Plasmids were purified from one isolate and sccreened by NgoMIVISacI and XhoI digestion of plasmids yielding the expected 11.0 and 2.7 kb and 480 bp and 3.3 kb fragments, respectively. Both DNA stra-ands of the inserted region were sequenced (ATG SEQ #1437-1442; primers's, M13 reverse primer, P140-S839, P140-S1209, P140-A1443, P140-A10889 and WO 01/73052 PCT/r/USO1/09950 C- 160pUC21-A829). This plasmid was named pUC21-TQ and the isolatate was Sstored as a stock culture (ATG glycerol stock #843).

The DNA coding sequence of the T. thermophilus dnaQ-1 genee (SEQ 0 ID:NO:36) is shown in FIG. 52. The start codon (gtg) and the stop codon 5 (tga) are in bold print. Also shown in FIG. 53 is the protein (aminoo acid) O sequence (SEQ ID NO:37) derived from the DNA coding sequence.

SConstruction of Plasmid (pAl-TQ) that Expresses T. thermophilus ddnaQ-1 C gene Expression of T. thennophilus dnaQ-1 gene product (El-subunhit) as a native protein was accomplished. The construction of pAl-TQ was pertrformed by insertion of the native T. thennophilus dnaQ-1 gene into the pAl-CBB-Cla-2 plasmid. The pUC21-TQ plasmid was prepared and the T. thennaophilus dnaQ-1 gene was amplified out of the pUC21-TQ plasmid using PCRR. The forward/sense primer (ATG primer #P140-S96cla; CCATCGATGCCTGCAGGTCTGGAGG-3') (SEQ ID NO:38) used I in the PCR reaction was designed to have an upstream ClaI site that overlaps t the AT of the ATG start codon used for the dnaQ-1 gene. The native start coodon for the dnaQ-1 gene is GTG, this has been replace in the primer with an ATIG start codon to allow for expression in E. coli. The reverse/antisense primer:r (ATG primer #P140-A713kpn; 5'-GACGGTACCTCATCAGTACCTG3AGCC GGGCCAA-3') (SEQ ID NO:39) was designed to have an additionnal stop codon placed in tandem with the native stop codon. This additionnal stop codon was adjacent to a KpnI restriction site in the non-complementary y region of the primer. The PCR product was digested with ClaI and KpnI reststriction enzymes. The digested PCR product was inserted into the Cla/KpnI diligested pAl-CB-Cla-2 plasmid. These plasmids were transformed into bacteria and positive isolates were selected by ampicillin-resistance. PIlasmids were purified from one clone and screened by ClallKpnI digest of ppurified plasmids yielding 0.6 and 5.6 kb fragments. The inserted region in this plasmid was subjected to DNA sequencing to confirm the correct seequence WO 01/73052 PCT/fr/USO1/09950 -161- (ATG SEQ #1508-1511; primers, P38-S5576, P65-A106, P140-S8339 and P140-A1089). This plasmid was named pAl-TQ and the isolate was stctored as a stock culture (ATG glycerol stock #900).

Verification of Expression of Plasmid (pAl-TQ) that Overexpresisses T.

thermophilus dnaQ-1 gene (e -Subunit) as a Native Protein froma pAl- TQ/MGC1030 The pAl-TQ plasmid was prepared and transformed into MGGC1030 bacteria. Three isolates were selected (ATG glycerol stock #921, 9222, 923) for further study. The bacterial growths and isolation of total cellular protein were as described in Example 2. A small aliquot (3 [tl) of supeernatant containing total cellular protein from each of the three isolates, was loaded onto a 4-20% SDS-polyacrylamide mini-gel (Novex, EC60255; 1 mmn thick, with 15 wells/gel) in 25 mM in Tris base, 192 mM glycine, and 0.1%o SDS.

The mini-gel was stained with Coomassie Blue. There were no visible i protein bands from any of the isolates corresponding to the predicted migration 1 region of the E-subunit.

Construction of a Plasmid (pAl-CB-TQ) that Overexpress T. thennaophilus dnaQ-1 (el-subunit) Fused to a C-Terminal Peptide That CContains Hexahistidine and a Biotinylation Site Since initial attempts to express the native e-subunit failed, a 1 vector was designed to couple the T. thermophilus dnaQ-1 gene to a fusion peptide containing a hexahistidine and a biotinylation site. The construction onf pAl- CB-TQ was also performed by insertion of the T. thermophilus dnaQ-'-l gene into the pAl-CB-Cla-2 plasmid. The reverse/antisense primer howevwer was designed to add a Spel site onto the 3' end of the gene allowing insertidon into the pAl-CB-Cla-2 plasmid in frame with the DNA encoding the C-te:erminal peptide that contains hexahistidine and a biotinylation site. The pUC:21-TQ plasmid was prepared for use as the PCR template. The T. thermaophilus dnaQ-1 gene was amplified out of the pUC21-TQ plasmid using PCRR. The WO 01/73052 PCT'/USOI/09950 -162forward/sense primer (ATG primer P140-S96cla) was the same as uused in producing pAl-TQ. The reverse/antisense primer (ATG primer ##P140- A708Spe; 5'-CCTCACTAGTGTACCTGAGCCGGGCCAA-3') (SEEQ ID was designed so that a SpeI restriction site was adjacent to the penultimate codon (the stop codons were excluded). The SpeI site allowwed for the expressed protein to contain two additional amino acids (Thr annd Ser) between the C-terminal amino acid of the e-subunit and the C-terminal 1 fusion peptide. The PCR product was digested with Clal and SpeI restitriction enzymes and inserted into the ClaIISpeI digested pAl-CB-Cla-2 plasmidd. The plasmid was then transformed into DH5a bacteria and plasmids from ppositive isolates were selected by ampicillin-resistance. Plasmids were isolateed from one positive isolate and screened by digestion with ClaI and SpeI restitriction enzymes yielding 0.6 and 5.6 kb fragments. The correct sequence of the inserted region was confirmed by DNA sequencing (ATG SEQ #15266-1529; primers, P38-S5576, P65-A106, P140-S839 and P140-A1089). This pplasmid was named pAl-CB-TQ and the isolate was stored as a stock culture (ATG glycerol stock #911).

Verification of Expression of Plasmid (pAl-CB-TQ1) that Overexpressses T.

thennophilus dnaQ-1 gene (el-Subunit) Fused to a C-Terminal Peptidde That Contains Hexahistidine and a Biotinylation Site from pAl-CB-TQ/MGCC1030 The pAl-CB-TQ1 plasmid was prepared and transformeed into MGC1030 bacteria. Three isolate was selected (ATG glycerol stock #9329) for further study. The bacterial growths and isolation of total cellular I protein were as described in Example 2. A small aliquot (3 l) of supeernatant containing total cellular protein from each of the three isolatees was electrophoresised onto a 4-20% SDS-polyacrylamide mini-gel (I(Novex, EC60255; 1 mm thick, with 15 wells/gel) in 25 mM in Tris base, 1992 mM glycine, and 0.1% SDS. The mini-gel was stained with Coomassiee Blue.

There were no protein bands from any of the isolates corresponding; to the predicted migration region of the el-subunit.

WO 01/73052 PCT/I/U S 1/09950 -163- Next, the total protein from the lysate was transferred (blottedd) from polyacrylamide gel to nitrocellulose as described in Example 2. Proteteins on the blotted nitrocellulose were visualized by interactions with phospbhataseconjugated streptavidin. The endogenous E. coli biotin-CCP protein, -2-20 kDa was detectable in both induced and non-induced samples. A proteirin band corresponding to the el-subunit migrated approximately midway betweeen the and 30 molecular weight standards of the Gibco 10 kDa protein I ladder.

This is consistent with the expected molecular weight of 25.8 kDa.t. This protein was observed as a faint band in the induced cultures, but wwvas not observed in the uninduced control in lysates from the AP1.L1 strainn. The protein was expressed at levels too low to justify purification attempts.

EXAMPLE 11 T. thermophilus UvrD Helicase Identification and Cloning T. thennophilus uvrD Gene The UvrD protein sequence from E. coli was used to search i the T.

thennophilus genome database at Goettingen Genomics Laboratoryy. The region of the T. thennophilus genome (2-4-2000 contig working.0.).15372, region 40201-46740) containing a putative T. thermophilus uvrD genne was identified (using BLAST) and obtained (from Dr. Carsten Jacobi, Goeettingen Genomics Laboratory, Institute of Microbiology and Geenetics, Grisebachstrasse 8, Goettingen, Germany). Using the crude sequencce, two PCR primers were designed to amplify the uvrD gene. All of the vectaors that we have for expressing N-terminal tagged proteins require a PstI s site for insertion of the 5' end of the gene into the vectors. However, there is a PPstI site within the uvrD gene. To overcome this problem a Nsil site was addedd to the non-complementary portion of the forward/sense primer (ATG primer:r P159- S1689, 5'-GACTATGCATAGCGACGCCCTCCTAGCCCCCCTCAAAC-3') (SEQ ID NO:65). The Nsil restriction cut site of the PCR product will I leave a WO 01/73052 PCT/Ir/SO 1/09950 -164four nucleotide overhang (TGCA) that can be utilized (annealed) by a PstI restriction cut site on the pAl-NB-AgeI plasmid. The PstI and the N.VsiI site will be destroyed by the ligation, but the uvrD gene will be inserted irinframe with the DNA encoding the N-terminal fusion peptide. The PCR produuct will exclude the GTG start codon and begins at codon 2, with the Nsil site aadjacent to codon 2. The reverse/antisense primer (ATG primer P159-A37886, GACTACTAGTCTATCATGCCGGCTTAAGCTCCGCG-3') (SEQ2 ID NO:66) was designed to add an additional "TAG" stop codon adjacentit to the native "TGA" stop codon and a SpeI restriction site in the non-complenmentary region. Both primers contained addition nucleotides to allow for efficient digestion with the NsiI and SpeI restriction enzymes. The PCR reactioxn used T. thennophilus genomic DNA as a template and yielded a PCR prooduct of 2410 bp in length. This PCR fragment digested with NsiI and Spoel was inserted into pAl-NB-AgeI digested with PstI and SpeI and resulted I in the plasmid pAl-NB-TuvrD which contained the entire gene encoding the T.

thermophilus UvrD helicase.

PAl-NB-TuvrD was transformed into DH5ax bacteria and ppositive isolates were screened for by plasmid digestion with NdiI and Spel rest3triction digest yielding 5.5 and 2.5 kb fragments. The plasmids from one ppositive isolate was selected and the correct sequence of both strands of the DNAA were identified by DNA sequencing across the inserted region (ATG SEQ 4 #1993- 2005; primers: P159-S1926, P159-S2326, P159-S2733, P159-S3134,, P159- S3540, P159-A3592, P159-A3332, P159-A3154, P159-A2770, P159-1-A2471, P159-A2060, NB-Sseq, p64-A215). This isolate was stored as a glycerool stock culture (ATG glycerol stock #1161).

Upon comparing this DNA sequence with the crude sequence obbtained from the T. thermophilus genome database at Goettingen Gennomics Laboratory several discrepancies were observed. Therefore, to confifirm the sequence of the DNA encoding the uvrD gene obtained by sequenci:ing the inserted region of this isolate a second clone was sequenced in the critical areas (ATG SEQ #2007-2008, primers: P159-A3154 and P159-A24711). The WO 01/73052 PCT/'/US 1/09950 CM -165changes observed by sequencing the gene from those reported for thee crude DNA sequence were: C>G at position 337 (no amino acid change); CC>T at position 466 (no amino acid change); G deletion at position 731 (framaeshift); G insertion at position 776 (frameshift); T>C at postion 1474 (no aminno acid 5 change); T>C at position 1475 (Ser>Pro amino acid change); G>C at poosition 0 1481 (Pro>Ala amino acid change).

The DNA coding sequence of the T. thermophilus uvrD gene is shown S(FIG. 54, SEQ ID NO:67). The start codon (gtg) and the stop codon (ttga) are in bold print. Also shown is the protein (amino acid) sequence (FIG. 555, SEQ ID NO:68) derived from the DNA coding sequence.

Verification of Expression of T. thermophilus UvrD Fused to an N-termiiinal Peptide that contains Hexahistidine and a Biotinylation Site The pAl-NB-TuvrD plasmid was prepared and transformeed into MGC1030 and AP1.L1 bacteria. Three isolates from each tranformatioon were selected for farther study. The bacterial growths and isolation of total ccellular protein were as described in Example 2. A small aliquot of supernatantit (3 p1) containing total cellular protein from each of the three isolates was. loaded onto a 4-20% SDS-polyacrylamide mini-gel (Novex, EC60255; 1 mmn thick, with 15 wells/gel) in 25 mM in Tris base, 192 mM glycine, and SDS.

The mini-gel was stained with Coomassie Blue. There were no proteinn bands from any of the isolates corresponding to the predicted migration reggion of uvrD (approximately 80 kDa).

Next, the total protein in each lysate was transferred (blottedd) from polyacrylamide gel to nitrocellulose as described in Example 2. Eac.ch lane contained 1.5 ul of the supernatant. Protein bands on the blotted nitroceellulose were visualized by interactions with phosphatase-conjugated streptavividin as described above. The endogenous E. coli biotin-CCP protein, -20 kEDa was detectable in both induced and non-induced samples. A proteinn band corresponding to the T. thennophilus UvrD protein migrated just below v the kDa molecular weight standard of the Gibco 10 kDa protein ladder.r. This WO 01/73052 PCT/r/USl0/09950 -166protein was observed as a faint band in the induced cultures, but wwas not observed in the uninduced control lysates. The glycerol stocks of pAI-NB- TuvrD in MGC1030 and AP1.L1 (ATG glycerol stock #1177 and 11178, respectively) were stored at -80 OC.

EXAMPLE 12 T. thermophilus DnaG Primase Identification and Cloning T. thermophilus dnaG Gene The DnaG protein sequence from E. coli was used to search i the T.

thernnophilus genome database at Goettingen Genomics Laboratoryy. The region of the T. thennophilus genome (2-4-2000 contig working.0..24624, region 42961-48060) containing a putative T. thermophilus dnaG genne was identified (using BLAST) and obtained (from Dr. Carsten Jacobi, Goetttingen Genomics Laboratory, Institute of Microbiology and Geenetics, Grisebachstrasse 8, Goettingen, Germany). Using the crude sequencce, two PCR primers were designed to amplify the dnaG gene. The forwardd/sense primer (ATG primer P161-S1922, AGGCGGTGGAGCTGA-3') (SEQ ID NO:69) is designed so that thhe noncomplementary portion contains a "GACT" clamp region and a PstI sitite. The complementary portion of the primer is complementary to the first 25 ntit of the dnaG gene beginning at codon 2, so that the first codon (the "ATG3" start codon) is excluded. This will allow the PCR product to be inserted irinto the vector pAl-NB-Avr2(BamH1-) at the PstI site therefore fusing thee gene inframe with the N-terminal tagged peptide. The reverse/antisense primer (ATG primer .P161-A3714, CCCGAAGGA-3') (SEQ ID NO:70) contains a "GACT" clamp regionn and a SpeI restriction site in the non-complementary region. The noncomplementary region also contains an additional "TAG" (CTA) stop codon WO 01/73052 PCT/r/U SO 1/09950 -167that will be adjacent to the native "TAG" stop codon, giving two stop c codons in tandem.

The sequence for the T. thennophilus dnaG gene is (FIG. 56, SBEQ ID NO:71). The start (atg) and the stop (tga) are shown as bold. Also showrn is the protein (amino acid) sequence derived from the DNA coding sequencee (FIG.

57, SEQ ID NO:72).

The PCR reaction used T. thermophilus genomic DNA as a teemplate and yielded a PCR product of 2148 bp in length. This PCR fragment diligested with PstI and SpeI was inserted into pAl-NB-Avr2(BamH1-) digesteed with PstI and SpeI and resulted in the plasmid pAl-NB-TdnaG which contairined the entire gene encoding the T. thermophilus DnaG primase. PAl-NB-TdnaaG was transformed into DH5a bacteria and positive isolates were screened for by plasmid digestion with PstI and SpeI restriction digest yielding 5.6 and 22.15 kb fragments. The plasmids from one positive isolate was selected and the c correct sequence of both strands of the DNA were identified by DNA sequuencing across the inserted region (ATG SEQ #2022-2031; primers: P161-'-S2260, P161-S2650, P161-S3056, P161-S3349, P161-A3375, P161-A3048,, P161- A2694, P161-A2389, NB-Sseq, p64-A215). The DNA sequence deteermined here was compared to the crude sequence from Goettingen Gennomics Laboratory and no changes were observed. This isolate was storeed as a glycerol stock culture (ATG glycerol stock #1173).

Verification of Expression of T. thennophilus DnaG Fused to an N-Termninal Peptide that contains Hexahistidine and a Biotinylation Site The pAl-NB-TdnaG plasmid was prepared and transformeed into MGC1030 and AP1.L1 bacteria. Three isolates from each tranformatioDn were selected for farther study. The bacterial growths and isolation of total ccellular protein were as described Example 2. A small aliquot of supernatantit (3 tl) containing total cellular protein from each of the three isolates was loaded onto a 4-20% SDS-polyacrylamide mini-gel (Novex, EC60255; 1 mmn thick, with 15 wells/gel) in 25 mM in Tris base, 192 mM glycine, and 0.1%o SDS.

I

WO 01/73052 PCT//U SO 1/09950 -168- The mini-gel was stained with Coomassie Blue. Distinct protein bandds from all of the isolates corresponding to the predicted migration region off DnaG (approximately 80 kDa) were visualized.

Next, the total protein in each lysate was transferred (blottedd) from polyacrylamide gel to nitrocellulose as described in Example 2. Eacch lane contained 1.5 ul of the supernatant. Proteins on the blotted nitrocellulosse were visualized by interactions with phosphatase-conjugated streptavidirin. The endogenous E. coli biotin-CCP protein, -20 kDa was detectable iin both induced and non-induced samples. A protein band corresponding to) the T.

theimophilus DnaG protein migrated midway between the 70 and 880 kDa molecular weight standard of the Gibco 10 kDa protein ladder. This 1 protein was observed as a very intense band in the induced cultures, but wwas not observed in the uninduced control lysates. The glycerol stocks of pAAl-NB- TdnaG in MGC1030 and AP1.L1 (ATG glycerol stock #1182 andd 1183, respectively) were stored at -80 °C.

EXAMPLE 13 T. thennophilus PriA Helicase Identification and Cloning T. thennophilus priA Gene The PriA protein sequence from E. coli was used to search 1 the T.

thennophilus genome database at Goettingen Genomics Laboratoryy. The region of the T. thermophilus genome (2-4-2000 contig working.C.0.2196, region 36541-42840) containing a putative T. thennophilus priA gecne was identified (using BLAST) and obtained (from Dr. Carsten Jacobi, Goeettingen Genomics Laboratory, Institute of Microbiology and G6enetics, Grisebachstrasse 8, Goettingen, Germany). Unsure of the crude sequennce and proper placement of the start and stop codons we decided to sequennce the region beginning approximately 200 bp upstream of the putative start ccodon to approximately 200 bp downstream of the putative stop codon. Using thne crude WO 01/73052 PCT/IU SO 1/09950 -169sequence, two PCR primers were designed to amplify the priA gence. The forward/sense primer (ATG primer P162-S963, CCGAAGAGCCTCTCCAGGAGGGGGAGGAGGGGAACCA-3) (SEEQ ID O NO:73) and the reverse/antisense primer (ATG primer P162-A36325, GGGGCAGCCGCAAGGGGTAAGGGTAGAAAA-3) (SEQ ID ISNO:74) O using T. thermophilus genomic DNA as a substrate yielded a 2676 bpp DNA fragment. This DNA fragment was inserted into the T/A cloning site of pGEM-TEasy plasmid per manufacturer instructions creating pT-TpriAA. This plasmid was transformed into DH5x bacteria and positive isolates:s were screened for by plasmid digestion with EcoRI restriction digest yieldiing 2.7 and 3.0 kb fragments and digestion with HinDU yielding 0.6 and 5.1 kb fragments. The plasmids from one positive isolate was selected annd the sequence of both strands of the DNA were identified by DNA sequuencing across the inserted region (ATG SEQ #1969-1982, 2009-2017, and 1 2042- 2043; primers: SP6, T7-Seq2, P162-S1292, P162-S1656, P162-S2026,1, P162- S2408, P162-S2781, P162-S3173, P162-A3257, P162-A2825, P162-AA2446, P162-A2038, P162-A709, P162-A1243, P162-S963, P162-A1335,. P162- S1146). The sequence obtained here was compared to the crude sequencce from Goettingen Genomics Laboratory and no descrepancies were discernedd. This isolate was stored as a glycerol stock culture (ATG glycerol stock #11555).

The sequence for the T. thermophilus priA gene is shown (FIFIG. 58, SEQ ID NO:75). The start (gtg) and the stop (tag) are shown as boldd. Also shown is the protein (amino acid) sequence (FIG. 59, SEQ ID NO:76) dderived from the DNA coding sequence.

To insert the T. thermophilus gene into the expression vector pAk1-NB- Agel to be expressed as an N-terminal tagged protein a 5' PstI restrictidion site and a 3' Spel restriction site was needed. This was accomplished byy PCR amplifying the T. thermophilus gene using the forward/sense primer r (ATG primer P162-S1052, 3' (SEQ ID NO:77) designed so that the non-complementary portion ccontains a "GACT" clamp region and a PstI restriction site. The complenrmentary 1 WO 011/73052 PCT//USOl/09950 N -170portion of the primer is complementary to the first 22 nt of the priAA gene beginning at codon 2, so that the first codon (the start codon in this c case is "GTG") is excluded. The reverse/antisense primer (ATG primer P162-AA3180, 0 5'-CAGTACTAGTCTAGTCCTCCAAAAGCCCCACGA-3') (SEQ) ID S 5 NO:78) contains a "CAGT" clamp region and a Spel restriction site: in the 0 non-complementary region. This PCR primer can not contain an addditional stop codon or it will create an additional Spel site that will be adjacentit to the Snative "TAG" (cta). The PCR reaction used pT-TpriA as a templalate and yielded a PCR product of 2130 bp in length. This PCR fragment was diligested with PstI and Spel was inserted into pAl-NB-AgeI digested with PstI annd SpeI and resulted in the plasmid pAl-NB-TpriA which contained the entinre gene encoding the T. thermophilus PriA helicase. pAl-NB-TpriA was transtformed into DH5ca bacteria and positive isolates were screened for by pplasmid digestion with PstI and SpeI restriction digest yielding 5.6 and 22.13 kb fragments. The plasmids from one positive isolate was selected and the c correct sequence of both strands of the DNA were identified by DNA sequuencing across the inserted region (ATG SEQ #2057-2070; primers: P162-'-S1146, P162-S1292, P162-S1656, P162-S2026, P162-S2408, P162-S2781, P162- A2825, P162-A2446, P162-A2038, P162-A1709, P162-A1335, P162--A1243, NB-Sseq, p64-A215). This isolate was stored as a glycerol stock culturee (ATG glycerol stock #1192).

Verification of Expression of T. thermophilus PriA Fused to an N-Termilinal Peptide that contains Hexahistidine and a Biotinylation Site The pAl-NB-TpriA plasmid was prepared and transformeed into MGC1030 and AP1.L1 bacteria. Three isolates from each tranformatioDn were selected for farther study. The bacterial growths and isolation of total ccellular protein were as described in Example 2. A small aliquot of supernatantit (3 p1) containing total cellular protein from each of the three isolates was loaded onto a 4-20% SDS-polyacrylamide mini-gel (Novex, EC60255; 1 mmn thick, with 15 wells/gel) in 25 mM in Tris base, 192 mM glycine, and 0.11% SDS.

WO 01/73052 PCI'r/IU SO1/09950 CM- 171- The mini-gel was stained with Coomassie Blue. Distinct protein bandds from all of the isolates corresponding to the predicted migration region oDf PriA (approximately 81.5 kDa) were visualized.

DO Next, the total protein in each lysate was transferred (blottedd) from 5 polyacrylamide gel to nitrocellulose as described in Example 2. Eac.ch lane O contained 1.5 ul of the supernatant. The endogenous E. coli biotiin-CCP protein, -20 kDa was detectable in both induced and non-induced sampples. A O protein band corresponding to the T. thennophilus PriA protein mihigrated midway between the 80 and 90 kDa molecular weight standard of the Gibco 10 kDa protein ladder. This protein was observed as a very intense bandd in the induced cultures, but was not observed in the uninduced control lysatetes. The glycerol stocks of pAl-NB-TpriA in MGC1030 and AP1.L1 (ATG gllycerol stock #1196 and 1197, respectively) were stored at -80 OC.

EXAMPLE 14 Cloning T. thennophilus dnaQ-2 The ORF encoding T. thennophilus dnaQ-2 gene containeed two possible start sites that were out of frame with each other. Thereftfore to determine the correct start codon and to confirm the sequenc thee gene encoding the T. thennophilus dnaQ-2 gene from T. thennophilus, geenomic DNA was amplified by PCR using two primers located approximately 200 bp upstream and downstream of the start and stop codon. Using a forwarcrd/sense primer (ATG primer #P133-S150, 5'-TGGGGGCGAACCTCACG-3))

(SEQ

ID NO: 79) and a reverse/antisense primer (ATG primer #P133-A12237, ACCCCGGCCTTCCAGTCCA-3)(SEQ ID NO: 80) and T. thennaophilus genomic DNA as a substrate resulted in a 1088 bp PCR product. Thiis PCR fragment was inserted into a pGEM-T Easy plasmid and transformeed into and isolates were selected for by ampicillin-resistance. Plasmidds were purified from one isolate and screened by EcoRI digestion of phlasmids yielding the expected 1.1 and 3.0 kb fragments. Both DNA strands s of the WO 01/73052 PCT/r/JUS 1/09950 I- 172inserted region were sequenced (ATG SEQ #1330-1335; primers, SPP6, T7, P133-S456, P133-S894, P133-A896, P133-A527). There was a one ba ase pair descreptancy with the DNA sequence when compared with the. crude NO sequence. There were four "T"s shown in the crude sequence beginnning 61 S 5 bases downstream of the first GTG start codon. The DNA sequenccing by O ATG, Inc. indicated and confirmed only three This indicated thnat both possible GTG start codons were in frame and that the first GTG was likkely the O native start codon. This plasmid was named pT-TQ2 and the isolate wasts stored as a stock culture (ATG glycerol stock #785).

The DNA coding sequence of the T. thennophilus dnaQ-1 genee (SEQ ID:NO:81) is shown in FIG. 60. The two possible start codons (gtg) aand the stop codon (tga) are in bold print. Also shown in FIG. 61 is the protein 6 (amino acid) sequence (SEQ ID NO:82) derived from the DNA coding sequencce.

Construction of a Plasmid (pAl-TQ2) that Expresses T. thennophilus adnaQ-2 gene Expression of T. thennophilus dnaQ-2 gene product (e2-subunhit) as a native protein was accomplished. The construction of pAl-TQ22 was performed by insertion of the native T. thermophilus dnaQ-2 gene irinto the pAl-CB-Ncol plasmid. The T. thennophilus dnaQ-2 gene was amplifified out of T. thennophilus genomic DNA using PCR. The forward/sense primer (ATG primer #P133-S442nco; GGATCCATGGAGCGGGTGGTGCGGCCCCTTCTG-3) (SEQ ID 1NO:83) used in the PCR reaction was designed to have an upstream NcoI sisite that overlaps the TGG of the ATG start codon used for the dnaQ-2 gence. The native start codon for the dnaQ-2 gene is GTG, this has been replacee in the primer with an ATG start codon to allow for expression in E. colili. The reverse/antisense primer (ATG primer #P133-A109kpn;l; AAGCTAGGTACCTACTACCTCCCGAGTTCCCAAAG-3) (SEQ2 ID NO:84) was designed to have an additional stop codon placed in tandeem with the native stop codon. This additional stop codon was adjacent to a Kpnl WO 01/73052 PCT/I'1USO1109950 -173restriction site in the non-complementary region of the primer. Thae PCR product was digested with NcoI and KpnI restriction enzymes. The diiigested PCR product was inserted into the NcoIIKpnI digested pAl-CB-NcoI phlasmid.

These plasmids were transformed into DH5a bacteria and positive iisolates were selected by ampicillin-resistance. Plasmids were purified from onee clone and screened by NcoI/KpnI digest of purified plasmids yielding 0.65 aand 5.7 kb fragments. The inserted region in this plasmid was subjected too DNA sequencing to confirm the correct sequence (ATG SEQ #1384-1387,, 1404- 1405; primers, P38-S5576, P65-A106, P133-S635, and P133-A817)... This plasmid was named pAl-TQ2 and the isolate was stored as a stock c culture (ATG glycerol stock #815).

Verification of Expression of Plasmid (pAl-TQ2) that Overexpres:sses T.

thennophilus dnaQ-2 gene (e2-Subunit) as a Native Protein fromn pAl- TQ2/MGC1030 and pAl-TQ2/AP1.L1 The pAl-TQ2 plasmid was prepared and transformed into MGG3C1030 and AP1.L1 bacteria. Three isolates were selected from pAl-TQ2/MGG3C1030 (ATG glycerol stock #828, 829, 830) and from pAl-TQ2/AP1.L1

(ATG

glycerol stock #847, 848, 849) for further study. The bacterial growtlths and isolation of total cellular protein were as described in Example 2. A4 small aliquot (3 tl) of supernatant containing total cellular protein from eachh of the six isolates, was loaded onto a 4-20% SDS-polyacrylamide mini-gel (I(Novex, EC60255; 1 mm thick, with 15 wells/gel) in 25 mM in Tris base, 1992 mM glycine, and 0.1% SDS. The mini-gel was stained with Coomassiee Blue.

There were no protein bands that could be resolved from surroounding endogenous E. coli from any of the isolates corresponding to the preredicted migration region of the E2-subunit.

WO 01/73052 PcTr//US01/09950 -174- Construction of a Plasmid (pAl-CB-TQ2) that Overexpress T. thennaophilus dnaQ-2 (E2-subunit) Fused to a C-Terminal Peptide That Ccontains Hexahistidine and a Biotinylation Site Since initial attempts to express the native E-subunit failed, a vector was designed to couple the T. thennophilus dnaQ-2 gene to a fusion ppeptide containing a hexahistidine and a biotinylation site. The construction oDf pAl- CB-TQ2 was also performed by insertion of the T. thermophilus dnaQ-)-2 gene into the pAl-CB-NcoI plasmid. The forward/sense primer was the samne used in construction of pAl-TQ2 (ATG primer #P133-S442nco). TThe T.

thennophilus genomic DNA was used as the PCR template. The reverse/antisense primer (ATG primer #P133-A1084Spe;; CCTCACTAGTCCTCCCGAGTTCCCAAAGCGT-3) (SEQ ID NO:835) was designed so that a SpeI restriction site was adjacent to the penultimate, codon (the stop codon was excluded). The Spel site allowed for the exppressed protein to contain two additional amino acids (Thr and Ser) between i the Cterminal amino acid of the E2-subunit and the C-terminal fusion peptidde. The PCR product was digested with NcoI and Spel restriction enzymces and inserted into the Ncol/SpeI digested pAl-CB-NcoI plasmid. The plasmnid was then transformed into DH50 bacteria and plasmids from positive isolate:es were selected by ampicillin-resistance. Plasmids were isolated from one ppositive isolate and screened by digestion with NcoI and SpeI restriction ennzymes yielding 0.65 and 5.7 kb fragments. The correct sequence of the irinserted region was confirmed by DNA sequencing (ATG SEQ #1388-1391,, 1406- 1407; primers, P38-S5576, P65-A106, P133-S635 and P133-A817).,. This plasmid was named pAl-CB-TQ2 and the isolate was stored as a stock culture (ATG glycerol stock #816).

WO 01/73052 PCT//lUSO1/09950 -175- Verification of Expression of Plasmid (pAl-CB-TQ) that Overexpreesses T.

thennophilus dnaQ-2 gene(e2-Subunit) Fused to a C-Terminal Peptidde That Contains Hexahistidine and a Biotinylation Site from pAl-CB-TQ/MGCC1030 The pAl-CB-TQ2 plasmid was prepared and transformeed into MGC1030 and AP1.L1 bacteria. Three isolate was selected from pAA1-CB- TQ2/MGC1030 (ATG glycerol stock #831, 832, 833) and from pAA1-CB- TQ2/AP1.L1 (ATG glycerol stock #850,851, 852) for further study.y. The bacterial growths and isolation of total cellular protein were as descriribed in Example 2. A small aliquot (3 tl) of supernatant containing total ccellular protein from each of the six isolates was electrophoresed onto a 4-20%/7 SDSpolyacrylamide mini-gel (Novex, EC60255; 1 mm thick, with 15 wells/3/gel) in mM in Tris base, 192 mM glycine, and 0.1% SDS. The mini-ggel was stained with Coomassie Blue. There were no protein bands from anyy of the isolates that could be resolved from endogenous E. coli proteins in the s region corresponding to the predicted migration region of the E2-subunit.

Next, the total protein from the lysate was transferred (blottedd) from polyacrylamide gel to nitrocellulose as described in Example 2. Proteteins on the blotted nitrocellulose were visualized by interactions with phospphataseconjugated streptavidin. The endogenous E. coli biotin-CCP protein, -420 kDa was detectable in both induced and non-induced samples. A proteirin band corresponding to the E2-subunit could not be detected. The proteitin was expressed at levels too low to justify purification attempts.

Having now fully described the present invention in some deetail by way of illustration and example for purposes of clarity of understanoding, it will be obvious to one of ordinary skill in the art that same can be perrformed by modifying or changing the invention with a wide and equivalent ra-ange of conditions, formulations and other parameters thereof, and thalat such P OrEP\y:,% 2C. -1 5 C- dN I i/ I 21! 176modifications or changes are intended to be encompassed within the scope of the appended claims.

All publications, patents and patent applications mentioned in this specification are indicative of the level of skill of those skilled in the art to which this invention pertains, and are herein incorporated by reference to the same extent as if each individual publication, patent or patent application was to be specifically and individually indicated to be incorporated by reference.

Throughout this specification and the claims which follow, unless the context requires otherwise, the word "comprise", and or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integers or steps.

The reference in this specification to any prior publication (or information derived from it), or to any matter which is known, is not, and should not be taken as an acknowledgment or admission or any form of suggestion that that prior publication (or information derived from it) or known matter forms part of the common general knowledge in the field of endeavour to which this specification relates.

Claims (66)

1. An isolated polypeptide wherein said polypeptide compririses an amino acid sequence having at least 95% sequence identity to the aminno acid sequence of SEQ ID NO: (uvrD helicase) 68.

2. The polypeptide of claim 1 wherein said polypeptide hhas the amino acid sequence of SEQ ID NO: 68.

3. An isolated polynucleotide molecule comprising a nuclleotide sequence encoding a polypeptide of claim 1.

4. The isolated polynucleotide molecule of claim 3 comprirising a nucleic acid having the sequence of SEQ ID NO: 67. A vector comprising an isolated polynucleotide of claim 33.

6. A host cell comprising a vector of claim

7. The isolated polypeptide of claim 1 wherein said polypepptide is a uvrD helicase from a thermophilic organism.

8. The isolated polypeptide of claim 7 wherein said thermoophilic organism is Thermus thennophilus.

9. An isolated polypeptide wherein said polypeptide compririses an amino acid sequence having at least 95% sequence identity to the aminno acid sequence of SEQ ID NO: (DNA-G Primase) 72.

10. The polypeptide of claim 9 wherein said polypeptide hhas the amino acid sequence of SEQ ID NO: 72. WO 01/73052 PCT/r/USOI/09950 -178-

11. An isolated polynucleotide molecule comprising a nuctleotide sequence encoding a polypeptide of claim 9.

12. The isolated polynucleotide molecule of claim 11 compnrising a nucleotide sequence having the sequence of SEQ ID NO: 71.

13. A vector comprising an isolated polynucleotide of claim 11.

14. A host cell comprising a vector of claim 13. The isolated polypeptide of claim 9 wherein said polypepptide is a DNA G primase from a thermophilic organism.

16. The isolated polypeptide of claim 15 wherein said thermoophilic organism is Thennus thermophilus.

17. An isolated polypeptide wherein said polypeptide compnrises an amino acid sequence having at least 95% sequence identity to the aminno acid sequence of SEQ ID NO: (priA helicase) 76.

18. The polypeptide of claim 17 wherein said polypeptide i has the amino acid sequence of SEQ ID NO: 76.

19. An isolated polynucleotide molecule comprising a nuccleotide sequence encoding a polypeptide of claim 17. The isolated polynucleotide molecule of claim 19 compnrising a nucleotide sequence having the sequence of SEQ ID NO:

21. A vector comprising an isolated polynucleotide of claim 1 19. WO 01/73052 PCT/I/USOl/09950 ,I -179- C 22. A host cell comprising a vector of claim 21. N 23. The isolated polypeptide of claim 17 wherein said polyppeptide is a priA helicase from a thermophilic organism.

24. The isolated polypeptide of claim 23 wherein said thermoophilic organism is Thennus thennophilus.

25. An isolated polypeptide wherein said polypeptide compririses an amino acid sequence having at least 95% sequence identity to the aminno acid sequence of SEQ ID NO: (delta subunit)

26. The polypeptide of claim 25 wherein said polypeptide i has the amino acid sequence of SEQ ID NO:

27. An isolated polynucleotide molecule comprising a nuccleotide sequence encoding a polypeptide of claim

28. The isolated polynucleotide molecule of claim 27 compnrising a nucleotide sequence having the sequence of SEQ ID NO: 9.

29. A vector comprising an isolated polynucleotide of claim .27.

30. A host cell comprising a vector of claim 29.

31. The isolated polypeptide of claim 25 wherein said polyypeptide is a delta subunit from a thermophilic organism.

32. The isolated polypeptide of claim 31 wherein said thermnophilic organism is Thermus thennophilus. WO 01/73052 PCT/'/USOI/09950 C- -180- C 33. An isolated antibody molecule, where in said anntibody specifically binds to at least one antigenic determinant on a polypepbtide of I claim S34. An isolated polypeptide wherein said polypeptide compririses an amino acid sequence having at least 95% sequence identity to the aminno acid Ssequence of SEQ ID NO: (delta prime subunit) 17.

35. The polypeptide of claim 34 wherein said polypeptide hhas the amino acid sequence of SEQ ID NO: 17.

36. An isolated polynucleotide molecule comprising a nucbleotide sequence encoding a polypeptide of claim 34.

37. The isolated polynucleotide molecule of claim 36 compnrising a nucleotide sequence having the sequence of SEQ ID NO: 16.

38. A vector comprising an isolated polynucleotide of claim 2 36.

39. A host cell comprising a vector of claim 38. The isolated polypeptide of claim 34 wherein said polyppeptide is a delta prime subunit from a thermophilic organism.

41. The isolated polypeptide of claim 40 wherein said thermoophilic organism is Thennus thermophilus.

42. An isolated antibody molecule, wherein said anntibody specifically binds to at least one antigenic determinant on a polypepptide of claim 37. PCT/r/US01/09950 WO 01/73052 -181-

43. An isolated polypeptide wherein said polypeptide compririses an amino acid sequence having at least 95% sequence identity to the aminno acid sequence of SEQ ID NO: (beta subunit) 23.

44. The polypeptide of claim 43 wherein said polypeptide hhas the amino acid sequence of SEQ ID NO: 23. An isolated polynucleotide molecule comprising a nucbleotide sequence encoding a polypeptide of claim 43.

46. The isolated polynucleotide molecule of claim 45 comprirising a nucleotide sequence having the sequence of SEQ ID NO: 22.

47. A vector comprising an isolated polynucleotide of claim 4

48. A host cell comprising a vector of claim 47.

49. The isolated polypeptide of claim 43 wherein said polyppeptide is a beta subunit from a thermophilic organism. The isolated polypeptide of claim 49 wherein said thermoophilic organism is Thermus thennophilus.

51. An isolated antibody molecule, wherein said anntibody specifically binds to at least one antigenic determinant on a polypepbtide of claim 43.

52. An isolated polypeptide wherein said polypeptide compririses an amino acid sequence having at least 95% sequence identity to the aminno acid sequence of SEQ ID NO: (ssb protein) 32. WO 01/73052 PCT/f/US01/09950 -182-

53. The polypeptide of claim 52 wherein said polypeptide lhhas the amino acid sequence of SEQ ID NO: 32.

54. An isolated polynucleotide molecule comprising a nuckleotide sequence encoding a polypeptide of claim 52. The isolated polynucleotide molecule of claim 54 comprrising a nucleotide sequence having the sequence of SEQ ID NO: 31.

56. A vector comprising an isolated polynucleotide of claim 54.

57. A host cell comprising a vector of claim 56.

58. The isolated polypeptide of claim 52 wherein said polyppeptide is an SSB protein from a thermophilic organism.

59. The isolated polypeptide of claim 58 wherein said thermoophilic organism is Thermus thennophilus.

60. An isolated antibody molecule, where in said anntibody specifically binds to at least one antigenic determinant on a polypepptide of claim

61. An isolated polypeptide wherein said polypeptide compnrises an amino acid sequence having at least 95% sequence identity to the amirino acid sequence of SEQ ID NO: (epsilonl, dnaQ-1) 37.

62. The polypeptide of claim 61 wherein said polypeptide I has the amino acid sequence of SEQ ID NO: 37. WO 01/73052 PCT/f/USU1/09950 -183-

63. An isolated polynucleotide molecule comprising a nuccleotide sequence encoding a polypeptide of claim 61.

64. The isolated polynucleotide molecule of claim 63 compnrising a nucleotide sequence having the sequence of SEQ ID NO: 36. A vector comprising an isolated polynucleotide of claim 63.

66. A host cell comprising a vector of claim

67. The isolated polypeptide of claim 61 wherein said polyppeptide is an epsilon subunit from a thermophilic organism.

68. The isolated polypeptide of claim 67 wherein said thermoophilic organism is Thernus thennophilus.

69. An isolated antibody molecule, where in said anntibody specifically binds to at least one antigenic determinant on a polypepptide of claim 61. An isolated polypeptide wherein said polypeptide compnrises an amino acid sequence having at least 95% sequence identity to the amirino acid sequence of SEQ ID NO: (dnaQ-2 protein) 82.

71. The polypeptide of claim 70 wherein said polypeptide I has the amino acid sequence of SEQ ID NO: 82.

72. An isolated polynucleotide molecule comprising a nuc.cleotide sequence encoding a polypeptide of claim WO 0(1/73052 PCT/r/US1/09950 -184-

73. The isolated polynucleotide molecule of claim 72 comprirising a C nucleotide sequence having the sequence of SEQ ID NO: 81. IN 74. A vector comprising an isolated polynucleotide of claim 7 72. O 75. A host cell comprising a vector of claim 74. O 76. The isolated polypeptide of claim 70 wherein said polyppeptide is an epsilon-2 subunit from a thermophilic organism.

77. The isolated polypeptide of claim 76 wherein said thermnophilic organism is Thennus thennophilus.

78. An isolated antibody molecule, where in said anntibody specifically binds to at least one antigenic determinant on a polypepbtide of claim 73.

79. A method of producing a polypeptide encoded by a nucbleotide sequence, wherein said polypeptide comprises an amino acid sequence I having at least 95% sequence identity to the amino acid sequence of one of SBEQ ID NOS: 68, 72, 76, 10, 17, 23, 32, 37, and 82, comprising culturing a haost cell comprising said nucleotide sequence under conditions such thatat said polypeptide is expressed, and recovering said polypeptide.

80. A method of synthesizing DNA which comprises utiliziting one or more polypeptides, said one or more polypeptides comprising an i amino acid sequence having at least 95% sequence identity to an aminno acid sequence selected from the group consisting of SEQ ID NOS: 68, 72,, 76, 17, 23, 32, 37 and 82. WO 01/73052 PCT/r/US01/09950 -185-

81. The method of claim 80 further comprising providing in any C order: a reaction mixture comprising components comprising template, a and nucleotides, and incubating said reaction mixture for a length of time annd at a 0 temperature sufficient to obtain DNA synthesis.

82. The method of claim 81 wherein said one or more polypoeptides further comprises an N-terminal linked peptide or a C-terminal linked peeptide. (N