AU2007201025A1 - Mutated Abl kinase domains - Google Patents

Description

P/00/0 I Regulation 3.2

AUSTRALIA

Patents Act 1990 COMPLETE SPECIFICATION STANDARD PATENT

(ORIGINAL)

Name of Applicants: Actual Inventor(s): Universite Victor Segalen Bordeaux 2 AND Technische Universitat Munchen AND Oregon Health Science University AND University of Heidelberg AND CHRU de Lille AND Medvet Science Pty. Ltd., Christophe BARTHE, Susan BRANFORD, Amie CORBIN, Brian Jay DRUKER, Justus DUYSTER, Andreas HOCHHAUS, Timothy HUGHES, Sebastian KREIL, Thibaut LEGAUY, Francois-Xavier MAHON, Gerald MARIT, Martin MULLER, Christian PESCHEL, Claude PREUDHOMME, Catherine ROCHE LESTIENNE and Zbigniew RUDZKI.

Address for Service: DAVIES COLLISON CAVE, Patent Trademark Attorneys, of 1 Nicholson Street, Melbourne, 3000, Victoria, Australia Ph: 03 9254 2777 Fax: 03 9254 2770 Attorney Code: DM Invention Title: "Mutated Abl kinase domains" The following statement is a full description of this invention, including the best method of performing it known to us:- %QOO3 t-jL I T -1- Mutated Abl kinase domains G Field of the Invention: 00 This invention relates to isolated polypeptides which comprise a functional kinase domain comprising the amino acid sequence of the native human Abl kinase domain or an essentially similar sequence thereof in which at least one amino acid selected from Met244, O Leu248, Gly250, Glu252, Tyr253, Val256, Glu258, Phe311, lle313, Phe317, Met318, Met351, Glu355, Glu359, Ile360, His361, Leu370, Asp381, Phe382, His396, Ser417, Glu459 Sand Phe486 is replaced by another amino acid, said mutated functional kinase domain being Sresistant to inhibition of its tyrosine kinase activity by N-[4-methyl-3-(4-pyridin-3-yl-pyrimidin- C 2-ylamine)-phenyl]-4-(4-methyl-piperazin-1-ylmethyl)-benzamide or a salt thereof, to the use of such polypeptides to screen for compounds which inhibit the tyrosine kinese activity of such polypeptides, to nucleic acid molecules encoding such polypeptides, to recombinant vectors and host cells comprising such nucleic acid molecules and to the use of such nucleic acid molecules in the production of such polypeptides for use in screening for compounds which inhibit the tyrosine kinase activity of such polypeptides.

Background of the Invention: Bcr-Abl, a constitutively activated tyrosine kinase resulting from the formation of the Philadelphia chromosome [Nowell P.C. and Hungerford Science 132,1497 (1960)] by reciprocal translocation between the long arms of chromosomes 9 and 22 [Rowley J.D., Nature 243, 290-293 (1973)], has been established as the characteristic molecular abnormality present in virtually all cases of chronic myeloid leukemia (CML) and up to percent of adult acute lymphoblastic leukemia (ALL) [Faderl S. et al., N EngI J Med 341, 164-172 (1999); Sawyers N EngI J Med 340, 1330-1340 (1999)]. Bcr-Abl is sufficient to cause CML in mice [Daley G.Q. et al., Science 247, 824-830 (1990)] and its transforming capacity is absolutely dependent on tyrosine kinase activity [Lugo T.G. et al., Science 247, 1079 (1990)]. The compound N-[4-methyl-3-(4-pyridin-3-yl-pyrimidin-2-ylamino)-phenyl]-4-(4methyl-piperazin-1-ylmethyl)-benzamide (hereinafter also referred to as "STI571"; STI571 is described in EP 0 564 409 and, in the form of the methane sulfonate salt, in WO 99/03854), a competitive inhibitor at the ATP-binding site of Bcr-Abl, as well as of the receptor for platelet-derived growth factor, and c-kit tyrosine kinase [Lugo T.G. et al., Science 247, 1079 (1990)], has been shown to be capable of very rapidly reversing the clinical and hematological abnormalities of CML in chronic phase and in blast crisis as well as of Ph 3C*I I I Vr% -2- 0 O chromosome-positive acute lymphoblastic leukemia (Ph+ ALL) [Druker B.J. et al., N Engl J Med 344, 1031-1037 (2001); Druker B.J. et al., N Engl J Med 344, 1038-1042 (2001)].

Whereas almost all chronic phase CML patients durably respond, remissions in CML blast 00 crisis and Ph+ ALL are transient, and most patients relapse after several months, despite continued therapy with STI571 [Druker B. J. et al., N Engl J Med 344, 1038-1042 (2001)].

The mechanism of resistance to STI571 is subject of intense research.

N It was now surprisingly found that mutations present in the kinase domain of the Bcr-Abl gene of patients suffering from CML or Ph+ ALL account for the biological resistance of CN these patients towards STI571 treatment in that said mutations lead to resistance of the Bcr- 0 Abl tyrosine kinase towards inhibition by STI571.

C- These findings are extremely valuable in e.g. finding new compounds or combinations of compounds which are capable to overcome resistance towards treatment with STI571.

Moreover, knowledge of such mutations is also very useful in the diagnosis of Ph+ leukemias in that it allows e.g. the detection of drug-resistant clones before clinical relapse of the patient.

Definitions: Within the context of this disclosure the following expressions, terms and abbreviations have the meanings as defined below: In the expression "a functional kinase domain", the term "functional" indicates that the respective kinase domain possesses tyrosine kinase activity. Preferably, the kinase activity of such a functional kinase domain is in the range of that of the native human Abl kinase domain.

In the expression "a functional kinase domain being resistant to inhibition of its tyrosine kinase activity by STI571 or a salt thereof", the term "resistant" means that STI571 inhibits the respective functional kinase domain with an ICso that is higher than that of the native human Abl kinase domain, i.e. higher than about 0.025 pM, preferably higher than about 0.15 JM, more preferably higher than about 0.25 piM, most preferably higher than about pM.

In the expression "amino acid sequence of the native human Abl kinase domain or an essentially similar sequence thereof", the part "or an essentially similar sequence thereof" refers to the amino acid sequence of the native human Abl kinase domain containing K-CO I V U -3- 0 O mutations, including amino acid exchanges, amino acid deletions and/or amino acid additions, that are not essential for the functionality of the kinase and its resistance to G inhibition by STI571 or a salt thereof within the meaning of the term "functional" and 0o "resistant" as defined hereinabove.

The expression "replaced by another amino acid" refers to the replacement of a certain C1 natural amino acid by another natural amino acid.

CN The names of the amino acids are either written out or the one letter or three letter codes are used. Mutations are referred to by accepted nomenclature, e.g. "Ala380Thr" or C "380 Ala-+Thr" both indicating that alanine at position 380 is replaced by threonine.

SEQ ID NO:1 represents the cDNA coding for the native human Abl protein (human cabl mRNA; GenBank Accession No.: X16416).

SEQ ID NO:2 represents the amino acid sequence of the native human Abl protein (human c-Abl; SwissProt Acc. No.: P00519).

Unless indicated otherwise, the number given for a certain amino acid refers to the numbering of the amino acids in SEQ ID NO:2. In an amino acid sequence that is essentially similar to the amino acid sequence of the native human Abl kinase domain within the meaning as defined above, the amino acids are numbered in accordance with the numbering of the amino acids in SEQ ID NO:2.

The term "isolated" means that the material is removed from its original environment the natural environment if it is naturally occurring).

A "host cell", refers to a prokaryotic or eukaryotic cell that contains heterologous DNA that has been introduced into the cell by any means, electroporation, calcium phosphate precipitation, microinjection, transformation, viral infection, and the like.

Description of the Invention: ~s~3C: L~-3L II vn -4- S In practicing the present invention, many conventional techniques in molecular biology, microbiology, and recombinant DNA are used. These techniques are well known and are explained in, for example, Current Protocols in Molecular Biology, Volumes I, II, and III, 1997 00 M. Ausubel Sambrook et al., 1989, Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, DNA Cloning: A Practical Approach, Volumes I and II, 1985 N. Glover Oligonucleotide S Synthesis, 1984 L. Gait Nucleic Acid Hybridization, 1985, (Hames and Higgins); Transcription and Translation, 1984 (Hames and Higgins eds.); Animal Cell Culture, 1986 C1 I. Freshney Immobilized Cells and Enzymes, 1986 (IRL Press); Perbal, 1984, A Practical Guide to Molecular Cloning; the series, Methods in Enzymology (Academic Press, C- Inc.); Gene Transfer Vectors for Mammalian Cells, 1987 H. Miller and M. P. Calos eds., Cold Spring Harbor Laboratory); and Methods in Enzymology Vol. 154 and Vol. 155 (Wu and Grossman, and Wu, eds., respectively).

In particular, the polypeptides of the present invention can be produced by recombinant DNA technology using techniques well-known in the art. Methods which are well known to those skilled in the art can be used to construct expression vectors containing the sequences encoding the polypeptides of the invention and appropriate transcriptional/translational control signals. A variety of host-expression vector systems can be utilized to express the polypeptides of the invention.

The invention relates to an isolated polypeptide which comprises a functional kinase domain comprising the amino acid sequence of the native human Abl kinase domain or an essentially similar sequence thereof in which at least one amino acid selected from Gly250, Tyr253, Val256, Glu258, Ile313, Met318, Leu370, Phe382 and His396 is replaced by another amino acid, said functional kinase domain being resistant to inhibition of its tyrosine kinase activity by N-[4-methyl-3-(4-pyridin-3-yl-pyrimidin-2-ylamino)-phenyl]-4-(4-methyl-piperazin-1ylmethyl)-benzamide or a salt thereof.

The invention especially relates to an isolated polypeptide which comprises a functional kinase domain comprising the amino acid sequence of the native human Abl kinase domain or an essentially similar sequence thereof in which at least one amino acid selected from Gly250, Tyr253, Glu258 and His396 is replaced by another amino acid, said functional kinase domain being resistant to inhibition of its tyrosine kinase activity by N-[4-methyl-3-(4- Uase 4-321 16A Spyridin-3-yl-pyrimidin-2-ylamino)-phenyl]-4-(4-methyl-piperazin-1-ylmethyl)-benzamide or a salt thereof.

00 The invention relates to an isolated polypeptide which comprises a functional kinase domain comprising the amino acid sequence of the native human Abl kinase domain or an n essentially similar sequence thereof in which at least one amino acid selected from Met244, Gly250, Tyr253, Val256, Glu258, lle313, Phe317, Met318, Met351, Ile360, His361, Leu370, Asp381, Phe382, His396 and Phe486 is replaced by another amino acid, said functional kinase domain being resistant to inhibition of its tyrosine kinase activity by N-[4-methyl-3-(4pyridin-3-yl-pyrimidin-2-ylamino)-phenyl]-4-(4-methyl-piperazin-1 -ylmethyl)-benzamide or a NC salt thereof.

The invention further relates to an isolated polypeptide which comprises a functional kinase domain comprising the amino acid sequence of the native human Abl kinase domain or an essentially similar sequence thereof in which at least one amino acid selected from Met244, Gly250, Tyr253, Val256, Glu258, Ile313, Phe317, Met318, lle360, His361, Leu370, Asp381, Phe382, His396 and Phe486 is replaced by another amino acid, said functional kinase domain being resistant to inhibition of its tyrosine kinase activity by N-[4-methyl-3-(4pyridin-3-yl-pyrimidin-2-ylamino)-phenyl]-4-(4-methyl-piperazin-1-ylmethyl)-benzamide or a salt thereof.

The invention especially relates to an isolated polypeptide which comprises a functional kinase domain comprising the amino acid sequence of the native human Abl kinase domain or an essentially similar sequence thereof in which at least one amino acid selected from Met244, Gly250, Tyr253, Glu258, Phe317, Met351, His396 and Phe486 is replaced by another amino acid, said functional kinase domain being resistant to inhibition of its tyrosine kinase activity by N-[4-methyl-3-(4-pyridin-3-yl-pyrimidin-2-ylamino)-phenyl]-4-(4-methylpiperazin-1-ylmethyl)-benzamide or a salt thereof.

The invention relates also especially to an isolated polypeptide which comprises a functional kinase domain comprising the amino acid sequence of the native human Abl kinase domain or an essentially similar sequence thereof in which at least one amino acid selected from Met244, Gly250, Tyr253, Glu258, Phe317, His396 and Phe486 is replaced by another amino acid, said functional kinase domain being resistant to inhibition of its tyrosine d~C I I U' -6- O kinase activity by N-[4-methyl-3-(4-pyridin-3-yl-pyrimidin-2-ylamino)-phenyl]-4-(4-methylpiperazin-1-ylmethyl)-benzamide or a salt thereof.

00 The invention relates to an isolated polypeptide which comprises a functional kinase domain comprising the amino acid sequence of the native human Abl kinase domain or an essentially similar sequence thereof in which at least one amino acid selected from Met244, CN Phe317, Met351, Ile360, His361, Asp381, and Phe486 is replaced by another amino acid, S said functional kinase domain being resistant to inhibition of its tyrosine kinase activity by N- C [4-methyl-3-(4-pyridin-3-y -pyrimidin-2-ylamino)-phenyl]-4-(4-methyl-piperazin-1-ylmethyl)- S benzamide or a salt thereof, and wherein optionally at least one additional amino acid C selected from Gly250, Tyr253, Val256, Glu258, Ile313, Met318, Leu370, Phe382 and His396 is replaced by another amino acid.

The invention relates to an isolated polypeptide which comprises a functional kinase domain comprising the amino acid sequence of the native human Abl kinase domain or an essentially similar sequence thereof in which the amino acid Phe311 is replaced by another amino acid, said functional kinase domain being resistant to inhibition of its tyrosine kinase activity by N-[4-methyl-3-(4-pyridin-3-yl-pyrimidin-2-ylamino)-phenyl]-4-(4-methyl-piperazin-1ylmethyl)-benzamide or a salt thereof.

In a preferred embodiment the invention relates to an isolated polypeptide according to the preceding paragraph wherein optionally at least one additional amino acid selected from Met244, Gly250, Tyr253, Val256, Glu258, lle313, Phe317, Met318, Met351, Ile360, His361, Leu370, Asp381, Phe382, His396 and Phe486 is replaced by another amino acid.

In a preferred embodiment the invention relates to an isolated polypeptide according to the preceding paragraph wherein optionally at least one additional amino acid selected from Met244, Gly250, Tyr253, Val256, Glu258, lle313, Phe317, Met318, Ile360, His361, Leu370, Asp381, Phe382, His396 and Phe486 is replaced by another amino acid.

(11) The invention relates to an isolated polypeptide which comprises a functional kinase domain comprising the amino acid sequence of the native human Abl kinase domain or an essentially similar sequence thereof in which at least one amino acid selected from Met244, Gly250, Tyr253, Val256, Glu258, Phe311, Ile313, Phe317, Met318, Met351, Ile360, His361, ase 4-3L i i OM -7- Leu370, Asp381, Phe382, His396 and Phe486 is replaced by another amino acid, said functional kinase domain being resistant to inhibition of its tyrosine kinase activity by N-[4methyl-3-(4-pyridin-3-yl-pyrimidin-2-ylamino)-phenyl]-4-(4-methyl-piperazin-1 -ylmethyl)- 00 benzamide or a salt thereof.

0 (12) The invention further relates to an isolated polypeptide which comprises a functional S kinase domain comprising the amino acid sequence of the native human Abl kinase domain or an essentially similar sequence thereof in which at least one amino acid selected from CN Met244, Gly250, Tyr253, Val256, Glu258, Phe311, Ile313, Phe317, Met318, Ile360, His361, Leu370, Asp381, Phe382, His396 and Phe486 is replaced by another amino acid, said CN functional kinase domain being resistant to inhibition of its tyrosine kinase activity by N-[4methyl-3-(4-pyridin-3-yl-pyrimidin-2-ylamino)-phenyl]-4-(4-methyl-piperazin-1-ylmethyl)benzamide or a salt thereof.

(13) The invention especially relates to an isolated polypeptide which comprises a functional kinase domain comprising the amino acid sequence of the native human Abl kinase domain or an essentially similar sequence thereof in which at least one amino acid selected from Met244, Gly250, Tyr253, Glu258, Phe311, Phe317, Met351, His396 and Phe486 is replaced by another amino acid, said functional kinase domain being resistant to inhibition of its tyrosine kinase activity by N-[4-methyl-3-(4-pyridin-3-yl-pyrimidin-2-ylamino)-phenyl]-4-(4methyl-piperazin-1-ylmethyl)-benzamide or a salt thereof.

(14) The invention relates also especially to an isolated polypeptide which comprises a functional kinase domain comprising the amino acid sequence of the native human Abl kinase domain or an essentially similar sequence thereof in which at least one amino acid selected from Met244, Gly250, Tyr253, Glu258, Phe311, Phe317, His396 and Phe486 is replaced by another amino acid, said functional kinase domain being resistant to inhibition of its tyrosine kinase activity by N-[4-methyl-3-(4-pyridin-3-yl-pyrimidin-2-ylamino)-phenyl]-4-(4methyl-piperazin-1-ylmethyl)-benzamide or a salt thereof.

The invention relates very especially to an isolated polypeptide which comprises a functional kinase domain comprising the amino acid sequence of the native human Abl kinase domain or an essentially similar sequence thereof in which at least one amino acid selected from Gly250, Tyr253, Glu258, Phe317 and His396 is replaced by another amino tdst: 9+-3 I I O -8- 0 acid, said functional kinase domain being resistant to inhibition of its tyrosine kinase activity by N-[4-methyl-3-(4-pyridin-3-yl-pyrimidin-2-ylamino)-phenyl]-4-(4-methyl-piperazin-1 G ylmethyl)-benzamide or a salt thereof.

00 (16) The invention relates to an isolated polypeptide which comprises a functional kinase domain comprising the amino acid sequence of the native human Abl kinase domain or an C1 essentially similar sequence thereof in which at least one amino acid selected from Leu248, S Glu252, Gly250, Glu355, Glu359, His396, Ser417, Glu459 is replaced by another amino CN acid, said functional kinase domain being resistant to inhibition of its tyrosine kinase activity S by N-[4-methyl-3-(4-pyridin-3-yl-pyrimidin-2-ylamino)-phenyl]-4-(4-methyl-piperazin-1- NC ylmethyl)-benzamide or a salt thereof.

(17) The invention relates to an isolated polypeptide which comprises a functional kinase domain comprising the amino acid sequence of the native human Abl kinase domain or an essentially similar sequence thereof in which at least one amino acid selected from Leu248, Gly250, Glu252, Glu355, Glu359, His396, Ser417, Glu459, is replaced by another amino acid and in which optionally at least one other amino acid selected from Met244, Gly250, Tyr253, Val256, Glu258, Phe311, Ile313, Phe317, Met318, Met351, Ile360, His361, Leu370, Asp381, Phe382, His396 and Phe486 is replaced by another amino acid, said functional kinase domain being resistant to inhibition of its tyrosine kinase activity by N-[4-methyl-3-(4pyridin-3-yl-pyrimidin-2-ylamino)-phenyl]-4-(4-methyl-piperazin-1-ylmethyl)-benzamide or a salt thereof.

(18) The invention relates to an isolated polypeptide which comprises a functional kinase domain comprising the amino acid sequence of the native human Abl kinase domain or an essentially similar sequence thereof in which at least one amino acid selected from Met244, Leu248, Gly250, Glu252, Tyr253, Val256, Glu258, Phe311, Ile313, Phe317, Met318, Met351, Glu355, Glu359, lle360, His361, Leu370, Asp381, Phe382, His396, Ser417, Glu459 and Phe486 is replaced by another amino acid, said functional kinase domain being resistant to inhibition of its tyrosine kinase activity by N-[4-methyl-3-(4-pyridin-3-yl-pyrimidin-2ylamino)-phenyl]-4-(4-methyl-piperazin-1-ylmethyl)-benzamide or a salt thereof.

(19) The invention relates to an isolated polypeptide which comprises a functional kinase domain comprising the amino acid sequence of the native human Abl kinase domain or an ase 4-3LI I OM -9- Sessentially similar sequence thereof in which at least one amino acid selected from Met244, Leu248, Gly250, Glu252, Tyr253, Val256, Glu258, Phe311, lle313, Phe317, Met318, G Glu355, Glu359, Ile360, His361, Leu370, Asp381, Phe382, His396, Ser417, Glu459 and 00 Phe486 is replaced by another amino acid, said functional kinase domain being resistant to inhibition of its tyrosine kinase activity by N-[4-methyl-3-(4-pyridin-3-yl-pyrimidin-2-ylamino)phenyl]-4-(4-methyl-piperazin-1-ylmethyl)-benzamide or a salt thereof.

The invention relates to an isolated polypeptide which comprises a functional kinase C1 domain comprising the amino acid sequence of the native human Abl kinase domain or an essentially similar sequence thereof in which at least one amino acid selected from Met244, C1 Leu248, Gly250, Glu252, Tyr253, Glu258, Phe311, Phe317, Met351, Glu355, Glu359, His396, Ser417, Glu459 and Phe486 is replaced by another amino acid, said functional kinase domain being resistant to inhibition of its tyrosine kinase activity by N-[4-methyl-3-(4pyridin-3-yl-pyrimidin-2-ylamino)-phenyl]-4-(4-methyl-piperazin-1-ylmethyl)-benzamide or a salt thereof.

(21) The invention relates to an isolated polypeptide which comprises a functional kinase domain comprising the amino acid sequence of the native human Abl kinase domain or an essentially similar sequence thereof in which at least one amino acid selected from Met244, Leu248, Gly250, Glu252, Tyr253, Glu258, Phe311, Phe317, Glu355, Glu359, His396, Ser417, Glu459 and Phe486 is replaced by another amino acid, said functional kinase domain being resistant to inhibition of its tyrosine kinase activity by N-[4-methyl-3-(4-pyridin- 3-yl-pyrimidin-2-ylamino)-phenyl]-4-(4-methyl-piperazin-1-ylmethyl)-benzamide or a salt thereof.

(22) A preferred embodiment of the invention relates to an isolated polypeptide according to any one of the preceding paragraphs wherein in the amino acid sequence of the native human Abl kinase domain or an essentially similar sequence thereof a single amino acid is replaced by another amino acid.

(23) In a very preferred embodiment the invention relates to an isolated polypeptide which comprises a functional kinase domain comprising the amino acid sequence of the native human Abl kinase domain or an essentially similar sequence thereof that contains at least one amino acid mutation selected from Leu248Val, Gly250AI, Glu252His, Glu355Gly, uase 4-321 (bA Glu359Va, His396Arg, Ser4 17Tyr and Glu459Lys, said functional kinase domain being resistant to inhibition of its tyrosine kinase activity by N-[4-methyl-3-(4-pyridin-3-yl-pyrimidin- 2-ylamino)-phenyl]-4-(4-methyl-piperazin-1-ylmethyl)-benzamide or a salt thereof.

00 (24) In a preferred embodiment the invention relates to an isolated polypeptide according to any one of the preceding paragraph wherein the amino acid sequence of the native human AbI kinase domain may contain at least one additional amino acid mutation selected from Met244Val, Gly250Glu, Tyr253His, Tyr253Phe, Glu258Gly, Phe3 11Leu, Phe317Leu, C Met351Thr, His396Pro and Phe486Ser N (25) In a preferred embodiment the invention relates to an isolated polypeptide according to any one of the preceding paragraphs wherein the amino acid sequence of the native human Abi kinase domain may contain at least one additional amino acid mutation selected from Met244Val, Gly250Glu, Tyr253His, Tyr253Phe, Glu258Gly, Phe311Leu, Phe317Leu, His396Pro and Phe486Ser (26) In a second preferred embodiment the invention relates to an isolated polypeptide which comprises a functional kinase domain comprising the amino acid sequence of the native human AbI kinase domain or an essentially similar sequence thereof that contains at least one amino acid mutation selected from Met244Val, Leu248Val, Gly250Glu, Gly250AI, Glu252His, Tyr253His, Tyr253Phe, Glu258Gly, Phe3l 1 Leu, Phe31 7Leu, Met351Thr, Glu355Gly, Glu359Val, His396Pro, His396Arg, Ser417Tyr, Glu459Lys and Phe486Ser, said functional kinase domain being resistant to inhibition of its tyrosine kinase activity by N-[4methyl-3-(4-pyridin-3-yl-pyrimidin-2-ylamino)-phenyl]-4-(4-methyl-piperazin-1 -ylmethyl)benzamide or a salt thereof.

(27) In a very preferred embodiment the invention relates to an isolated polypeptide which comprises a functional kinase domain comprising the amino acid sequence of the native human Abl kinase domain or an essentially similar sequence thereof that contains at least one amino acid mutation selected from Met244Val, Leu248Val, Gly250Glu, Gly250AI, Glu252His, Tyr253His, Tyr253Phe, Glu258Gly, Phe3l 1 Leu, Phe317Leu, Glu355Gly, Glu359Val, His396Pro, His396Arg, Ser417Tyr, Glu459Lys and Phe486Ser, said functional kinase domain being resistant to inhibition of its tyrosine kinase activity by N-[4-methyl-3-(4uase 4-z321 iA -11 pyridin-3-yl-pyrimidin-2-ylamino)-phenyl]-4-(4-methyl-piperazin-1 -ylmethyl)-benzamide or a salt thereof.

00 (28) In a very preferred embodiment the invention relates to an isolated polypeptide which comprises a functional kinase domain comprising the amino acid sequence of the native human Abl kinase domain or an essentially similar sequence thereof that contains at least N one amino acid mutation selected from Met244Val, Gly250Glu, Tyr253His, Tyr253Phe, Glu258Gly, Phe311Leu, Phe317Leu, Met351Thr, His396Pro and Phe486Ser, said functional kinase domain being resistant to inhibition of its tyrosine kinase activity by N-[4-methyl-3-(4- O pyridin-3-yl-pyrimidin-2-ylamino)-phenyl]-4-(4-methyl-piperazin-1 -ylmethyl)-benzamide or a N salt thereof.

(29) The invention further relates especially to an isolated polypeptide which comprises a functional kinase domain comprising the amino acid sequence of the native human Abl kinase domain or an essentially similar sequence thereof that contains at least one amino acid mutation selected from Met244Val, Gly250Glu, Tyr253His, Tyr253Phe, Glu258Gly, Phe311Leu, Phe317Leu, His396Pro and Phe486Ser, said functional kinase domain being resistant to inhibition of its tyrosine kinase activity by N-[4-methyl-3-(4-pyridin-3-yl-pyrimidin- 2-ylamino)-phenyl]-4-(4-methyl-piperazin-1-ylmethyl)-benzamide or a salt thereof.

The invention further relates very especially to an isolated polypeptide which comprises a functional kinase domain comprising the amino acid sequence of the native human Abl kinase domain or an essentially similar sequence thereof that contains at least one amino acid mutation selected from Gly250Glu, Tyr253His, Tyr253Phe, Glu258Gly, Phe317Leu and His396Pro, said functional kinase domain being resistant to inhibition of its tyrosine kinase activity by N-[4-methyl-3-(4-pyridin-3-yl-pyrimidin-2-ylamino)-phenyl]-4-(4-methyl-piperazin-1ylmethyl)-benzamide or a salt thereof.

(31) Similarly, the invention relates especially to an isolated polypeptide which comprises a functional kinase domain comprising the amino acid sequence of the native human Abl kinase domain or an essentially similar sequence thereof that contains the amino acid mutation Met351Thr, said functional kinase domain being resistant to inhibition of its tyrosine kinase activity by N-[4-methyl-3-(4-pyridin-3-yl-pyrimidin-2-ylamino)-phenyl]-4-(4-methylpiperazin-1-ylmethyl)-benzamide or a salt thereof.

kbase w -12- (32) Similarly, the invention relates especially to an isolated polypeptide which comprises a S functional kinase domain comprising the amino acid sequence of the native human Abl 00 kinase domain or an essentially similar sequence thereof that contains the amino acid mutation Met244Val, said functional kinase domain being resistant to inhibition of its tyrosine kinase activity by N-[4-methyl-3-(4-pyridin-3-yl-pyrimidin-2-ylamino)-phenyl]-4-(4-methylpiperazin-1-ylmethyl)-benzamide or a salt thereof.

C1 (33) Similarly, the invention relates especially to an isolated polypeptide which comprises a 0 functional kinase domain comprising the amino acid sequence of the native human Abl N kinase domain or an essentially similar sequence thereof that contains the amino acid mutation Gly250Glu, said functional kinase domain being resistant to inhibition of its tyrosine kinase activity by N-[4-methyl-3-(4-pyridin-3-yl-pyrimidin-2-ylamino)-phenyl]-4-(4-methylpiperazin-1-ylmethyl)-benzamide or a salt thereof.

(34) Similarly, the invention relates especially to an isolated polypeptide which comprises a functional kinase domain comprising the amino acid sequence of the native human Abl kinase domain or an essentially similar sequence thereof that contains the amino acid mutation Tyr253His, said functional kinase domain being resistant to inhibition of its tyrosine kinase activity by N-[4-methyl-3-(4-pyridin-3-yl-pyrimidin-2-ylamino)-phenyl]-4-(4-methylpiperazin-1-ylmethyl)-benzamide or a salt thereof.

Similarly, the invention relates especially to an isolated polypeptide which comprises a functional kinase domain comprising the amino acid sequence of the native human Abl kinase domain or an essentially similar sequence thereof that contains the amino acid mutation Tyr253Phe, said functional kinase domain being resistant to inhibition of its tyrosine kinase activity by N-[4-methyl-3-(4-pyridin-3-yl-pyrimidin-2-ylamino)-phenyl]-4-(4-methylpiperazin-1-ylmethyl)-benzamide or a salt thereof.

(36) The invention relates also especially to an isolated polypeptide which comprises a functional kinase domain comprising the amino acid sequence of the native human Abl kinase domain or an essentially similar sequence thereof that contains the amino acid mutation Glu258Gly, said functional kinase domain being resistant to inhibition of its tyrosine tase 4-JzI /bA -13p kinase activity by N-[4-methyl-3-(4-pyridin-3-yl-pyrimidin-2-ylamino)-phenyl]-4-(4-methylpiperazin-1-ylmethyl)-benzamide or a salt thereof.

00 (37) The invention relates also especially to an isolated polypeptide which comprises a functional kinase domain comprising the amino acid sequence of the native human Abl kinase domain or an essentially similar sequence thereof that contains the amino acid mutation Phe311Leu, said functional kinase domain being resistant to inhibition of its tyrosine kinase activity by N-[4-methyl-3-(4-pyridin-3-yl-pyrimidin-2-ylamino)-phenyl]-4-(4methyl-piperazin-1-ylmethyl)-benzamide or a salt thereof.

N (38) The invention relates also especially to an isolated polypeptide which comprises a functional kinase domain comprising the amino acid sequence of the native human Abl kinase domain or an essentially similar sequence thereof that contains the amino acid mutation Phe317Leu, said functional kinase domain being resistant to inhibition of its tyrosine kinase activity by N-[4-methyl-3-(4-pyridin-3-yl-pyrimidin-2-ylamino)-phenyl]-4-(4methyl-piperazin-1-ylmethyl)-benzamide or a salt thereof.

(39) Similarly, the invention relates especially to an isolated polypeptide which comprises a functional kinase domain comprising the amino acid sequence of the native human Abl kinase domain or an essentially similar sequence thereof that contains the amino acid mutation His396Pro, said functional kinase domain being resistant to inhibition of its tyrosine kinase activity by N-[4-methyl-3-(4-pyridin-3-yl-pyrimidin-2-ylamino)-phenyl]-4-(4-methylpiperazin-1-ylmethyl)-benzamide or a salt thereof.

The invention relates also especially to an isolated polypeptide which comprises a functional kinase domain comprising the amino acid sequence of the native human Abl kinase domain or an essentially similar sequence thereof that contains the amino acid mutation Phe486Ser, said functional kinase domain being resistant to inhibition of its tyrosine kinase activity by N-[4-methyl-3-(4-pyridin-3-yl-pyrimidin-2-ylamino)-phenyl]-4-(4methyl-piperazin-1-ylmethyl)-benzamide or a salt thereof.

(41) Similarly, the invention relates especially to an isolated polypeptide which comprises a functional kinase domain comprising the amino acid sequence of the native human Abl kinase domain or an essentially similar sequence thereof that contains the amino acid t..ase 4-31 I I o -14mutation Leu248Val, said functional kinase domain being resistant to inhibition of its tyrosine kinase activity by N-[4-methyl-3-(4-pyridin-3-yl-pyrimidin-2-ylamino)-phenyl]-4-(4-methyl- G piperazin-1-ylmethyl)-benzamide or a salt thereof.

00 (42) Similarly, the invention relates especially to an isolated polypeptide which comprises a S functional kinase domain comprising the amino acid sequence of the native human Abl kinase domain or an essentially similar sequence thereof that contains the amino acid mutation Gly250Ala, said functional kinase domain being resistant to inhibition of its tyrosine kinase activity by N-[4-methyl-3-(4-pyridin-3-yl-pyrimidin-2-ylamino)-phenyl-4-(4-methylpiperazin-l-ylmethyl)-benzamide or a salt thereof.

(43) Similarly, the invention relates especially to an isolated polypeptide which comprises a functional kinase domain comprising the amino acid sequence of the native human Abl kinase domain or an essentially similar sequence thereof that contains the amino acid mutation Glu252His, said functional kinase domain being resistant to inhibition of its tyrosine kinase activity by N-[4-methyl-3-(4-pyridin-3-yl-pyrimidin-2-ylamino)-phenyl]-4-(4-methylpiperazin-1-ylmethyl)-benzamide or a salt thereof.

(44) Similarly, the invention relates especially to an isolated polypeptide which comprises a functional kinase domain comprising the amino acid sequence of the native human Abl kinase domain or an essentially similar sequence thereof that contains the amino acid mutation Glu355Gly, said functional kinase domain being resistant to inhibition of its tyrosine kinase activity by N-[4-methyl-3-(4-pyridin-3-yl-pyrimidin-2-ylamino)-phenyl]-4-(4-methylpiperazin-1-ylmethyl)-benzamide or a salt thereof.

Similarly, the invention relates especially to an isolated polypeptide which comprises a functional kinase domain comprising the amino acid sequence of the native human Abl kinase domain or an essentially similar sequence thereof that contains the amino acid mutation Glu359Val, said functional kinase domain being resistant to inhibition of its tyrosine kinase activity by N-[4-methyl-3-(4-pyridin-3-yl-pyrimidin-2-ylamino)-phenyl]-4-(4-methylpiperazin-1-ylmethyl)-benzamide or a salt thereof.

(46) Similarly, the invention relates especially to an isolated polypeptide which comprises a functional kinase domain comprising the amino acid sequence of the native human Abl Case 4-32176A kinase domain or an essentially similar sequence thereof that contains the amino acid mutation His396Arg, said functional kinase domain being resistant to inhibition of its tyrosine kinase activity by N-[4-methyl-3-(4-pyridin-3-yl-pyrimidin-2-ylamino)-phenyl]-4-(4-methyl- 00 piperazin-1-ylmethyl)-benzamide or a salt thereof.

(47) Similarly, the invention relates especially to an isolated polypeptide which comprises a functional kinase domain comprising the amino acid sequence of the native human Abl kinase domain or an essentially similar sequence thereof that contains the amino acid S mutation Ser417Tyr, said functional kinase domain being resistant to inhibition of its tyrosine 0 kinase activity by N-[4-methyl-3-(4-pyridin-3-yl-pyrimidin-2-ylamino)-phenyl]-4-(4-methyl- S piperazin-1 -ylmethyl)-benzamide or a salt thereof.

(48) Similarly, the invention relates especially to an isolated polypeptide which comprises a functional kinase domain comprising the amino acid sequence of the native human Abl kinase domain or an essentially similar sequence thereof that contains the amino acid mutation Glu459Lys, said functional kinase domain being resistant to inhibition of its tyrosine kinase activity by N-[4-methyl-3-(4-pyridin-3-yl-pyrimidin-2-ylamino)-phenyl]-4-(4-methylpiperazin-1-ylmethyl)-benzamide or a salt thereof.

(49) In another embodiment the invention relates to an isolated polypeptide according to any one of the preceding paragraphs (31) wherein the amino acid sequence of the native human Abl kinase domain may contain at least one additional amino acid mutation selected from Met244Val, Leu248Val, Gly250Glu, Gly250AI, Glu252His, Tyr253His, Tyr253Phe, Glu258Gly, Phe311Leu, Phe317Leu, Met351Thr, Glu355Gly, Glu359Val, His396Pro, His396Arg, Ser417Tyr, Glu459Lys and Phe486Ser.

In a preferred embodiment the invention relates to an isolated polypeptide according to any one of the preceding paragraphs wherein the amino acid sequence of the native human Abl kinase domain consists of amino acids 229-500 of SEQ ID NO:2.

(51) In another preferred embodiment the invention relates to an isolated polypeptide according to any one of the preceding paragraphs said isolated polypeptide being a Bcr-Abl tyrosine kinase.

asf I IDA -16- S (52) In yet another preferred embodiment the invention relates to the use of an isolated polypeptide of any one of the preceding paragraphs (51) to screen for compounds G which inhibit the tyrosine kinase activity of said polypeptide.

00 (53) The invention also relates to an isolated nucleic acid molecule comprising a nucleotide sequence that encodes a polypeptide according to any one of the preceding paragraphs g (51).

N (54) The invention further relates to the use of a nucleic acid molecule of the preceding r^paragraph (53) in the production of a polypeptide of any one of the preceding paragraphs (1) C (51) for use in screening for compounds which inhibit the tyrosine kinase activity of said polypeptide.

The invention also relates to a recombinant vector comprising a nucleic acid molecule according to the preceding paragraph (53).

(56) The invention further relates especially to a recombinant vector according to the preceding paragraph which is a recombinant expression vector.

(57) The invention also relates to a host cell comprising a recombinant vector according to the preceding paragraph (55) or (56).

Preferably the invention relates to an isolated polypeptide which comprises a functional kinase domain comprising the amino acid sequence of the native human Abl kinase domain in which at least one amino acid is replaced by another amino acid, said functional kinase domain being resistant to inhibition of its tyrosine kinase activity by N-[4-methyl-3-(4-pyridin- 3-yl-pyrimidin-2-ylamino)-phenyl]-4-(4-methyl-piperazin-1-ylmethyl)-benzamide or a salt thereof.

A preferred salt of STI571 is the methane sulfonate salt described in WO 99/03854.

Screening for compounds which inhibit the tyrosine kinase activity of the polypeptides of the invention may be done for example by using an isolated polypeptide of the invention in any in vitro tyrosine kinase phosphorylation assay known in the art and determining the potential of Case 4-32176A -17- CN a compound to inhibit the tyrosine kinase activity of a polypeptide of the invention in such an assay.

High-throughput screening assays known in the art may be used to screen large compound 00 libraries for compounds which inhibit the tyrosine kinase activity of the polypeptides of the invention.

SBesides the random screening of large compound libraries, the polypeptides of the present invention may also be used in the following screening approach: The 3-dimensional structure of a polypeptide of the invention is determined by e.g. X-ray crystallography. The atomic coordinates of a polypeptide of the invention are then used to design a potential inhibitor.

Said potential inhibitor is then synthesized and tested for its ability to inhibit the tyrosine kinase activity of the polypeptide of the invention in any in vitro tyrosine kinase phosphorylation assay.

Examples: The following Examples serve to illustrate the invention without limiting its scope.

Example 1: Numerous mutations in the Abl kinase domain were generated based on three models of ST1571 bound to the Abl kinase domain, and these mutant kinases were assessed for sensitivity to STI571.

A variety of point mutations were generated based on a model of the Abl kinase domain cocrytallized with a ST1571-related 2-phenylaminopyrimidine Abl-specific inhibitor [Schindler T.

et al., Science 289, 1938-42 (2000)]. The amino acids identified by the Abl crystal structure as potential contact sites for ST1571 include hydrogen bonds with T315, M290, E286, K271 and the peptide backbone at D381 and M318, as well as hydrophobic interactions with 1313, F382, V256, Y253 and L370. Mutations were generated to eliminate the potential for hydrogen bonding or hydrophobic interactions between the Abl kinase and ST1571 [The Abl kinase domain consisting of c-Abl amino acids 220 to 458 was subcloned into the Bam HI site of pGEX KG (Pharmacia). A Hemagglutin (12CA5) antibody recognition tag was inserted at the 5' end of the Abl kinase domain sequence both as an Abl phosphorylation site and for detection of protein expression. All mutations within the kinase domain were constructed using polymerase chain reaction amplification of the Abl kinase pGEX KG plasmid with primers containing appropriate point mutations.].

;ase 4-321 /bA -18- SAs M318 and D381 are predicted to form hydrogen bonds with STI571 via the peptide backbone, mutations at these sites are irrelevant. The ICso values of the mutations are summarized in Table 1 [GST fusion proteins of the Abl kinase domain mutations as well as 00 wild type Abl kinase were generated by inducing exponentially-growing transformed bacteria with 1 mM isopropylphenylthiogalactoside (IPTG). The cells were lysed via sonication in MT PBS (150 mM NaCI, 16 mM Na 2

HPO

4 4 mM Na 2

H

2

PO

4 pH 7.3) containing 1% Triton-X 100, 10 pg/ml aprotinin, 1mM sodium vanadate, 1mM phenylmethylsulfonyl fluoride and 10 AM p-mercaptoethanol. The GST-Abl kinase mutants were purified from the lysate by binding to glutathione sepharose overnight at 4 OC. Bound proteins were washed twice with 0.5 M LiCI, twice with PBS (Phosphate Buffered Saline pH 7.5) and once with Abl kinase wash buffer (20 mM Tris pH 7.5, 10 mM MgCI 2 Bound protein concentrations were determined by SDS PAGE followed by Coomassie Blue staining. All Abl kinase proteins and mutations were expressed and purified in this manner. 500 ng of bound protein was used in each kinase reaction. Kinase reactions were performed in 30 pl of Abl kinase buffer (20 mM Tris pH 7.5, 10 mM MgCI 2 10 AM Sodium Vanadate, 1 pM DTT, 1% Dimethyl Sulfoxide (DMSO)). STI571 was dissolved in 3% DMSO prior to addition to the kinase reaction. The Abl kinase mutations were incubated with concentrations of STI571 ranging from 0 pM to 1 PM for 10 minutes, after which 10 PCi of y 32 P ATP (100 PM total ATP) was added and the kinase reaction allowed to proceed for 30 minutes. The reactions were terminated by boiling in SDS loading dye and samples were analyzed by SDS PAGE (Equal protein loading was demonstrated by immunoblots using the anti-AbI kinase domain antibody Ab-2 (Santa Cruz)). Abl autophosphorylation signal intensity was quantitated with a phosphorimager (Molecular Dynamics) and ICo5 values were determined]. Consistent with what has been reported using similar kinase assays, the IC5o value for wild type Abl kinase was 0.025 pM.

K271R, E286L, M290A and 1313G yielded kinase inactive mutations. Mutation of L370G did not change the sensitivity to STI571. In contrast, T315V demonstrated a decreased sensitivity to STI571. The ICso value of this mutation averaged to 0.30 pM, approximately ten-fold higher than that of wild type Abl kinase. The decreased sensitivity of this mutation to ST1571 relative to wild type Abl is consistent with predictions from the crystal structure that illustrates a critical hydrogen bond between the secondary amino group of the inhibitor and the side chain of T315.

Prior to the availability of the crystal structure, mutations were generated based on computer modeling of STI571 bound to Abl, based on published kinase domain structures. These mutations were analyzed to determine whether the activity of these mutations could be fit to Case 4-32176A -19- C- the published Abl kinase domain structure. For example, a computer model of Abl based on the crystal structure of the Src family member Lck was initially analyzed [Yamaguchi H. and G Hendrickson Nature 384, 484 (1996)]. Mutations of the predicted contact points from 00 the Lck-based model were made to the corresponding residues in either Src or Fms (Table The majority of these mutations were either kinase inactive or did not display any change in sensitivity to STI571. These results support predictions from the crystal structure that suggests that topological differences rather than amino acid sequence differences in the ATP binding pocket of the Abl kinase and the Src family kinases are responsible for the specificity of STI571. Interestingly, mutation of A380T raised the IC0 for STI571 binding tenfold over that of wild type Abl kinase. While this residue is not a predicted contact point in the C- Schindler et al. model [Schindler T. et al., Science 289, 1938-42 (2000)], the adjacent residue D381 forms a critical hydrogen bond with STI571. Because mutation of A380 to the smaller glycine did not alter the sensitivity to STI571, it is likely that mutation to a slightly larger residue either introduces steric effects or small conformational changes in the ST1571 binding surface that can account for the decrease in sensitivity of the A380T mutation. Thus, all of the predictions from the Lck kinase can be explained by the Abl crystal structure.

A third model of STI571 binding to the Abl kinase is extrapolated from computer modeling of fibroblast growth factor receptor (FGFR) [Mohammadi M. et al., Science 276, 955 (1997)]. In this model STI571 binds in reverse orientation relative to that seen in the Schindler et al.

model. Additionally, several new potential contact points are identified including E258, M318 and L248. This binding mode also predicts STI571 contacts V256 and L370 which are predicted contact sites in the crystal structure. Mutations of these residues were examined for their sensitivity to STI571 (Table As with many of the previous mutations, several of these were kinase inactive. Interestingly, the E258G mutation demonstrated an IC0 value of 0.18 pM, eight-fold higher than that of wild type Abl kinase. The decrease in sensitivity of the mutation to STI571 suggests that the hydrogen bonding capabilities of E258 may be critical to interactions between STI571 and the Abl kinase.

Potential Contact Mutations Sensitivity to STI571 Sites wild-type (wt) IC 50 0.025 pM K271 R kinase inactive E286 L kinase inactive M290 A kinase inactive Case 4-321 /bA 1313 G kinase inactive T315 V IC0 0.30 uM M318 L370 G same as wt D381 Table 1. Mutations were made to residues lacking either hydrogen bond-forming capabilities or hydrophobicity. ST1571 was predicted to form hydrogen bonds with the peptide backbone at M318 and D381, therefore mutations of these residues were not made. Many of the mutations resulted in a kinase inactive Abl. L370G did not change the sensitivity to STI571. Mutation of T315V decreased the sensitivity to ST1571 ten-fold relative to wild type Abl kinase.

Potential Contact Mutations Sensitivity to STI571 Sites wild-type (wt) IC 50 0.025 p.M L248 A kinase inactive Y320 K same as wt N322 S same as wt E373 N same as wt H375 L kinase inactive A380 C same as wt A380 T IC5o 0.34 pM A380 L kinase inactive Table 2. Abl kinase domain mutations based on an Lck computer model of inhibitor binding. The structure of the inactive form of the Abl kinase was modeled using information from the crystal structure of inhibitor-bound Lck (from Kinetix Pharmaceuticals). Mutations were made of the predicted contact points of Abl with STI571 to the corresponding residues in either Src or fms. Most of the mutations resulted in either no change in sensitivity to ST1571 or a kinase inactive Abl. Mutation of A380T decreased the sensitivity to ST1571 ten-fold relative to wild type Abl kinase. This is likely due to steric effects or conformational changes in the STI571 binding surface of the mutated Abl.

Potential Contact Mutations ISensitivity to ST571 ase 4-321 /bA -21- 1t 00 0 Sites wild-type (wt) ICo 0.025 .M L248 A kinase inactive V256 G kinase inactive E258 G ICso 0.18 pM M318 A kinase inactive L370 G same as wt Table 3. Abl kinase domain mutations based on a Fibroblast Growth Factor Receptor model of inhibitor binding. Mutations were made of the predicted contact points of Abl with STI571 that would eliminate hydrogen bonding or large hydrophobic side chains. Many of the mutations yielded a kinase inactive Abl. Mutation of E258G decreased the sensitivity to STI571 eight-fold relative to wild type Abl kinase.

Further structural studies revealed that also the residues lle360 and His361 of the Abl kinase domain are involved in the binding of STI571. Amino acid mutations at these positions therefore have the potential to confer STI571-resistance.

Example 2: Clinical samples of six patients prior to therapy with ST1571 and at the time of relapse under therapy with the drug were analyzed for the presence of mutations in the ATP-binding pocket and the activation loop of the Abl kinase domain. Of the patients analyzed, two suffered from advanced stage CML (lymphoid blast crisis, one patient; accelerated phase CML progressing to blast crisis at the time of relapse, one patient), three patients from Ph+ ALL, and one patient from biphenotypic Ph+ acute leukemia (see Table 4).

Pat.

No.

1 2 Disease Ph+ ALL CML AP/BC myeloid Bcr-Abltranscript p210 p210 Previous therapy (y/n) y y Additional cytogenetic abnormalities* (yln) n n Duration of therapy (weeks) 28** 9 Max. response, duration (weeks) CHR PCR RCP uase 4-21 /bA -22r-

O

S 3 CML BC lymphoid p210 y n 7 No# 4 Ph+ AL biph. p190 y y 15 No" S 5 Ph+ ALL p190 y n 30 CHR PCR 00 6 Ph+ ALL p190 y n 8* CHR (4) O 6" NLE (2) Table 4. Clinical data S Ph+: Philadelphia-chromosome-positive; ALL: Acute lymphoblastic leukemia; CML: Chronic myeloid leukemia; AP: Accelerated phase, based on percentage of blasts in bone marrow >15% but BC: Blast crisis, based on percentage of blasts in bone marrow CHR: Complete hematological remission, based on all of the following criteria: Blast count in bone marrow, no circulating Speripheral blood blasts, absolute neutrophil count >1.5xl0/L, platelet count >100x10 9 no evidence Cl of extramedullary involvement; PCR: Partial cytogenetic remission, based on the finding of 5/100 phchromosome-positive metaphases; RCP: Retum to chronic phase, based on all of the following criteria: Percentage of blasts in blood or bone marrow percentage of blasts plus promyelocytes in peripheral blood or bone marrow peripheral blood basophils Biph.: Biphenotypic disease due to expression of both myeloid, and lymphoid surface markers.

*Prior to therapy with STI571 *Continuing with STI571, 800 mg per day due to relapse of Ph+ ALL ***Fulminant relapse to CML blast crisis receiving STI571 600 mg per day #Pancytopenia with persistence of blastoid cells in peripheral blood and >30% blastoid cells in bone marrow "No circulating peripheral blood blasts and absolute neutrophil count >1.0x10 9 /L for a period of weeks, but persistent blast count in bone marrow *STI571, 600 mg per day "Switch to STI571, 800 mg per day due to relapse (White cell count 360x10 9 85% blastoid cells) receiving ST1571 600 mg per day §Bone marrow not evaluated No leukemic evidence in peripheral blood, based on the following findings: No circulating peripheral blood blasts, absolute neutrophil count >1.0xI0 9 platelet count >20x109/L, bone marrow has not been evaluated.

Total RNA from purified peripheral blood and/or bone marrow cells was extracted using RNAClean (Hybaid GmbH, Heidelberg, Germany). 10 ng RNA per clinical sample, 10 pg K562 total RNA as positive-control and a reaction without template as negative-control were subjected to reverse transcriptase-polymerase chain reaction (RT-PCR) using a 3' Ablspecific primer (5'-GCCAGGCTCTCGGGTGCAGTCC-3') and a 5' Abl-specific primer GCGCAACAAGCCCACTGTCTATGG-3'). AMV reverse transcriptase was used for first Case 4-32176A -23- N strand synthesis, Expand high fidelity (Taq DNA polymerase and a proofreading polymerase; Roche Molecular Biochemicals, Mannheim, Germany) for amplification. Human P-actin served as control using forward primer 00 5'-CCAAGGCCAACCGCGAGAAGATGAC-3' and reverse primer 5'-AGGGTACATGGTGGTGCCGCCAGAC-3' (Roche Molecular Biochemicals, Mannheim, SGermany). The amplified 579bp fragment was sequenced with an ABI 3700 sequencer (PE Biosystems, Foster City, CA, USA) using two 3' Abl-specific primers (5'-GCCAGGCTCTCGGGTGCAGTCC-3' and 5'-CAAGTTCCCCATCAAATG-3') and two different 5' Abl-specific primers, (5'-GCGCAACAAGCCCACTGTCTATGG-3' and 5'-ATGGAGGTGGAAGAGTTC-3'), respectively. Sequence analysis was performed using Lasergene software (DNA*, Madison, USA). Two to nine RT-PCR reactions per patient and time point were performed and analyzed independently showing a sequence identity of 100% at each patient and time point. Overall sequence identity of all probes excluding the six single point mutations found at the time of STI571-refractory disease to one another and to the sequence of human c-Abl (GI:28236) was 100%.

Prior to STI571 At the time of resistence to STI571 Pat.

No. No. of No. of No. of No. of No. of No. of Position of mutation' RT-PCR- identical mutations RT-PCR- Identical mutations reactions sequences found reactions sequences found Nucleotide Amino acid 1 9' 9* 0 6 6 1 911 A-)T 255 Glu-+Val 2 2 2 0 2 2 0 3 4 4 0 2 2 1 910 G-A 255 Glu-Lys 4 2 2 0 2 2 1 904 T--C 253 Tyr-+His 4 4 0 2 2 1 1334 A-+C 396 His-+Pro 6 2 2 0 2* 2* 1 1091 C-+T 315 Thr-lle 1 1091 C-T 315 Thr-lle Table 5. Sequence analysis 1 st relapse receiving STI571 600 mg per day **2nd relapse receiving STI571 800 mg per day %-dbW 't-3 I I OM -24r-

O

O Nucleotides amino acid residues are numbered from the first nucleotide amino acid of human c-Abl (Accession number: Gl:28236) Analysis of different time points 00 Of six patients, sequence analysis revealed the presence of a single point mutation in clinical samples of five patients. All five mutations result in an amino acid exchange within the ATP- C binding site (Patients 1, 3, 4 and 6, see Table 5) or activation loop (Patient 5) of Abl kinase domain and were present only in the samples obtained at the time of refractory disease. In CN one patient (No. 6, see Table we were able to detect a point mutation of human c-Abl kinase domain at nucleotide 1091 C-T (numbered from the first nucleotide of human c-Abl, CN GI:28236) leading to a Thr>lle change at position 315 of the ATP-binding site (numbered from the first amino acid of human c-Abl, Gl:28236). Interestingly, this patient experienced a second response after increasing the daily dose of ST1571 from 600 to 800mg despite the presence of T3151 at the time of refractory disease receiving the lower dose (see Table 4 Having in mind the presence of Thr315 being a key requirement for STI571 to bind and thus inhibit Abl [Schindler T. et al., Science 289, 1938-42 (2000)] this observation should require the presence of unmutated Bcr-AbI contributing to growth of the malignant clone.

This seems to be true: Single nucleotide polymorphism (SNP) analysis of all the four samples obtained at the time of refractory disease showed evidence for a SNP at position 1091 of c-Abl, visible in the chromatographs as C-background behind the T-signal and, comparing the samples obtained at the time of refractoriness to 600 mg and those obtained at the time of refractoriness to 800mg, this heterogeneity significantly decreases in favour of the mutated transcript. This finding strongly suggests, that T3151, when present in the majority of Bcr-AbI molecules, abrogates the biologic activity of STI571.

A tyrosine at position 253, which is changed to histidine in patient no. 4 (see Table has been shown to form a hydrogene bond with asparagine 322, holding in place a folded loop between two P strands, increasing the surface complementarity with ST1571 and, furthermore to hold a van der Waals interaction with the aromatic rings of STI571 [Schindler T. et al., Science 289, 1938-42 (2000)].

Both point mutations seen in patients 1 and 3, respectively (see Table 5) result in an exchange of glutamic acid (hydrophilic, negatively charged) at position 255 of ATP-binding site to valine (hydrophobic) in patient 1 and lysine (hydrophilic, positively charged) in patient 3. Considering the interaction of neighbouring valine 256 with one of the aromatic rings of Case 4-32176A r- SST1571 [Schindler T. et al., Science 289, 1938-42 (2000)], this change may also lead to a conformational change impairing the binding of the drug.

G The mutation found in patient 5, a change of histidine at position 396 to proline, is located 00 within the activation loop. This region of Abl does not interact directly with ST1571, except for the anchor region, located NH 2 -terminal of His 396, but is in its inactive (closed) Sconformation a prerequisite for specific binding of ST1571 to Abl [Schindler T. et al., Science S289, 1938-42 (2000)]. One may speculate that this mutation may stabilize the activation loop in an open conformation, which has been shown to be less susceptible to inhibition by SSTI571 after stabilizing the open conformation by phosphorylation of Tyr393, the major site Sof phosphorylation in Abl [Schindler T. et al., Science 289, 1938-42 (2000)].

In summary, our analysis of six patients shows that in cases of STI571 refractory Ph+ leukemia, mutations within the ATP-binding site or activation loop occur frequently. Thus, Bcr-Abl dependent proliferation of the malignant clone may be restored by impairing the binding of STI571 to Bcr-Abl without compromising Bcr-Abl kinase-activity.

Example 3: A PCR strategy was used to amplify the ATP binding region of Bcr-Abl cDNA and the entire region was sequenced in both directions. Bcr-Abl mutations were found in 4/6 patients on STI571 for blast crisis CML (2 myeloid, 2 lymphoid BC), accelerated phase or second chronic phase CML who had developed haematological resistance to STI571. One patient had the mutation Thr31511e. Two patients had mutations at position 250, which substituted glycine for glutamic acid. One patient had a mutation at amino acid 253, which substituted tyrosine for histidine. Amino acid 250 does not form a hydrogen bond with STI571, as does amino acid 315, nor is it involved in van der Waals interaction with the inhibitor, as is amino acid 253. Where samples were available (3 cases) we confirmed that the mutation was not present prior to STI571 therapy, nor was it present in the normal Abl allele. We also sequenced the ATP binding region of Bcr-Abl in 8 patients with advanced phase or chronic phase CML who had achieved and maintained haematological responses but only had minor or no cytogenetic response on STI571. None of these patients had evidence of mutations after 6-9 months of STI571 therapy. We postulate that several point mutations in Bcr-Abl emerge in patients with advanced phase CML which are likely to totally or partially abrogate STI571 binding to Bcr-Abl.

Case 4-32176A -26- N Example 4: An RT-PCR strategy was used to amplify and sequence the Abl kinase domain of Bcr-Abl in G 28 patients. We selected STI571-refractory and STI571-resistant patients from 253 patients 0 0 enrolled in expanded access studies at 5 Australian centres. The aim was to determine the frequency and timing of acquired mutations within carefully defined clinical groups, Sdetermine their distribution within the Bcr-Abl kinase domain and identify any association Sbetween specific mutations and clinical features.

SStudy Design O STI571-resistant patients (n=18) were defined as those with a loss of complete C haematological remission which had been present for at least 3 months or evolution to acute phase CML or relapsed Ph+ ALL. ST1571-refractory patients (n=10) were those who failed to achieve a major cytogenetic response after at least 6 months of therapy.

Extraction of RNA from blood, reverse transcription and DNA sequencing procedures have been previously described [Branford S. et al., Br. J. Haematol. 107, 587-599 (1999)]. A long PCR method [Branford S. et al., Br. J. Haematol. 109, 635-637 (2000)] was used to amplify the Abl kinase domain of Bcr-Abl with forward primer BcrF tgaccaactcgtgtgtgaaactc) and reverse primer AblKinaseR tccacttcgtctgagatactggatt). A second stage PCR used forward primer AblkinaseF cgcaacaagcccactgtct) and reverse primer AblkinaseR. The entire kinase domain was sequenced, an area including 863 bases (GenBank accession number M14752).

Results STI571-resistant patients: Twelve of 18 STI571-resistant patients had mutations in the ATP binding region of Bcr-Abl (Table In 9 cases where samples were available, we confirmed that the mutation was not present before starting ST1571 therapy, nor was it present in 4 cases tested at 3-9 months, which in each case was before the onset of resistance. Three of the 6 resistant patients without Bcr-Abl mutations had evidence of clonal evolution at the time of relapse including an additional Philadelphia (Ph) chromosome in 2 cases. One patient had both a mutation and an extra Ph chromosome at time of relapse.

Case 4-32176A -27r-

O

0 The 6 mutations identified are T3151 (n=3 patients), Y253H F317L E255K G250E and M351T 00 The 18 STl571-resistant patients could be subdivided into those who relapsed into blast crisis or Ph+ ALL those relapsing into accelerated phase and those with Sevidence of loss of hematological remission who remained in chronic phase All 3 Sgroups included patients with mutations. Six of the 8 patients who relapsed directly into blast crisis/ALL had mutations. In 3 of these the T3151 mutation was present. Two of the 6 C patients relapsing into accelerated phase had mutations. The remaining 4 patients relapsing 0 into chronic phase all had mutations.

STI571-refractory patients: Only 1 of 10 refractory patients had a mutation (Table There was no evidence of the mutation pre-STI571 therapy or 3 months after starting treatment. The mutant clone mixed with wild-type Bcr-Abl emerged at 8 months and persisted in a mixed pattern until the mutant clone became predominant at 11 months. To date there has been no clinical evidence of resistance in this patient.

Table 6. Clinical course and mutation analysis of patients treated with ST1571 Patient Age Disease Duration Best Response Time of Mutation Nucleotide ID /Sex status at of STI571 Response at Time of Mutation Result Substitution start of Treatment to Mutation Analysis t (GenBank no.

STI571' ST1571* Analysis* M14752) Emerging Resistance 01 61 F 3 (3 r 9m lb Pre Study NM 7 7 3m NM 7 6m NM lb 9m T3151 G to C nt 944 02 75 F la 4.5m la Pre study 4 la 4.5m T3151 G to C nt 944 03 62 M lb 2m lb Pre study 4 lb 2m T3151 G to C nt 944 04§ 59 F 1c 3m 1c Pre Study NM 7 Ic 5m Y253H Tto C nt757 ic 5.5m Y253H T to C nt 757 LUase 4-JZI (bA -28-

M

66 M 54 F

BM*

10.5m 41 M

M

44 M 4.5m Pre Study 4m 7m 8m Pre Study 6m 9m 1 om 10.5m 6m 3m 6m Pre Study 4m Pre Study 3m Pre Study 6m 7m 8m gm I om 8m 7m 6m 8m

NM

F317L F317L G250E

NM

NM

NM

G250E G250E E255K

NM

E255K

NM

E255K

NM

E255K

NM

NM

NM

M351T M351T C to Gnt 951 C to Gnt 951 G to C nt 749 G to Cnt 749 G to C nt 749 G to A nt 769 G to A nt 769 G to A nt 769 G to A nt 769 11§ 60 F ic 3m 52 F 13 64 M 78 F 47 M 56 F 37 M 63 M 10.5m 8m 9rn 7m 7m 7m 3 7 7 6 2"p 2"p 2 C+p 1ic 2 la 2 T to C nt 1052 T to C nt 1052 Refractory 19 55 F 63 M 6m lrn 3.5m Pre Study 3m 8m 9m I om

NM

NM

NM

M351 T M351 T M351T T to C nt 1052 T to C nt 1052 T to C nt 1052 %dt ;-30 I I UP -29r-

O

2 c 11m M351T Tto C nt 1052 21 62 F 2 10.5m 5 4 9m NM G 22 54 M 2 8m 5 5 6m NM 00 23 61F 3 6m 5 4 5m NM 24 61 F 3 10.5m 5 4 6m NM lf 25 47 F 3 10m 5 5 6m NM 26 40 F 3 6m 5 5 3m NM 27 60 M 3 6m 5 5 4m NM 28 42 M 3 7m 5 5 6m NM F: female; M: male; m: months.

NM Indicates no mutation detected following sequencing of the kinase region of Bcr-Abl in both directions.

Clndicates clonal evolution.

Plndicates double Philadelphia chromosome.

*Disease Status/Response: 1 a) myeloid blast crisis b) lymphoid blast crisis c) Ph-positive ALL relapse. 2) Accelerated Phase, 3) Chronic Phase, 4) Partial Response (blasts in blood bone marrow 5) Complete Haematologic Response (WBC<10.0, Pits 450, no blasts, myelocytes metamyelocytes no promyelocytes, no disease-related symptoms or extramedullary disease), 6) Major Cytogenetic Response, 7) Complete Cytogenetic Response.

tMonths since treatment start.

tAlthough patient was on study for 8 months, STI571 was alternated monthly with oral arsenic and therefore the patient received only 4 months of STI571 over this period.

§Ph-positive ALL patients.

Further studies revealed the presence of two additional mutations, i.e. Met244Val and Phe486Ser, in ST1571-resistant/refractory patients suffering from Ph chromosome-positive leukemia.

In another study, CML patients from 12 centers within Australia and New Zealand were tested for mutation analysis. The samples were primarily collected for molecular assessment of BCR-ABL levels and only proceeded to mutation analysis if stored RNA contained a measurable level of BCR-ABL and the control gene level indicated non-degraded RNA.

Patients had either received 6 or more months of imatinib therapy or had developed resistance and ceased therapy before 6 months Samples from 156 patients were available but 12 could not be tested, 4 due to low levels of BCR-ABL and 8 due to inadequate RNA quality. The remaining 144 patients were grouped according to the disease stage at start of imatinib; 40 in AP, 64 in late-CP defined as 212 months since diagnosis and uase't-3 I(OA in early-CP defined as <12 months since diagnosis. Sixteen of the early-CP patients had failed previous interferon therapy and 24 had only received hydroxyurea prior to imatinib therapy. Response to imatinib was categorised by the cytogenetic analysis at 6 months as 00 either a major cytogenetic response (MCR) if the number of Philadelphia chromosome positive cells was <35% or no MCR if 35-100%. Imatinib resistance was defined as loss of a complete hematologic remission (CHR) that had been present for at least 3 months, loss of SCHR with transformation to accelerated or blastic phase, or loss of an established MCR or a complete cytogenetic response (CCR defined as Philadelphia chromosome negative). 346 C RNA samples were analysed as already mentioned herein. Depending on available RNA, S patients were tested for mutations at between 1-15 different time-points. The median N duration of imatinib therapy was therefore determined from the last time-point of analysis. AP patients had received a median of 9 months of imatinib (range 4 to 24), late-CP 10 months (range 6-24) and early-CP 14 months (range 5-24).

Imatinib resistance in accelerated phase patients Fourteen of 40 AP patients developed imatinib resistance, 5 with transformation to blast phase, 8 with recurrence of AP and 1 with loss of CCR. Mutations were detected in 12 of 14 resistant patients at a median of 8 months of imatinib therapy (range 4-13).

Imatinib resistance in late chronic phase patients (late-CP) Thirteen of 64 late-CP patients developed imatinib resistance, 5 with transformation to blast phase, 6 to AP and 2 lost a MCR. Mutations were detected in 11 of 13 resistant patients at a median of 8 months of imatinib therapy (range 3-18).

Imatinib resistance in early chronic phase patients (early-CP) Six of 40 early-CP patients developed resistance, 1 transformed to blast crisis, 2 to AP, 2 lost CCR and 1 lost MCR. No mutations were detected in the resistant patients.

Duration of CML and the development of mutations When all the patients in the study who achieved a major cytogenetic response (MCR) within 6 months were studied, those treated >4 years since diagnosis had a 9 times higher incidence of mutations than those treated within 4 years (6 of 22 versus 2 of 72 When all the patients who did not achieve a MCR within 6 months were studied, those treated >4 years since diagnosis had a 2 times higher incidence of mutations than those treated within 4 years (12 of 22 versus 7 of 28 The highest incidence of mutations was in AP patients treated >4 years from diagnosis and who failed to achieve a Ldbt: 14-3L I I OtA -31 MCR by 6 months (8 of 12, In this study 27 of the 144 patients developed mutations.

The median duration of CML prior to commencing imatinib therapy of the 27 patients with mutations (5.3 years, range 1.1 to 11) was statistically different to the 117 patients without mutations (1.3 years, range 0.02-17.7) p<0.0001.

Mutations in the BCR-ABL kinase domain Table 7 details the 17 different mutations in the BCR-ABL kinase domain detected in 27 patients. These were all point mutations and were located within a sequence of 728 nucleotides involving amino acids 244 to 486. Seven patients had 2-4 mutations and one patient had 2 different mutations at the same nucleotide which both altered the amino acid at position 252 from glutamine to histidine. The mutations, L248V at the N-terminal and S417Y, E459K and F486S at the C-terminal of the kinase domain have not previously been described. The first 3 mutations were all detected in one imatinib resistant patient who also had the G250E mutation.

Table 7. BCR-ABL kinase domain mutations Mutation Nucleotide Substitution (GenBank number M14752) M244V 730A>G L248V 742C>G G250E 749G>A Q252H 756G>C Q252H 756G>T Y253F 758A>T E255K 763G>A E255V 764A>T T3151 944C>T F317L 951C>G M351T 1052T>C E355G 1064T>C F359V 1075T>G H396R 1187A>G Number of patients with the mutation* 1 1 3 3 1 2 1 2 2 8 3 2 1 uase 4-421 /bA -32- N S417Y 1250C>A 1 E459K 1375G>A 1 G F486S 1457T>C 1 0 *7 patients had multiple mutations i Example Four molecular and chromosomal mechanisms of resistance were inverstigated in 42 patients (pts.) (21 males, 21 females; median age 60, range 26-70 years) refractory or Sresistant to STI571 monotherapy (400-800 mg p.o./day) out of a total of 290 pts. treated with STI571 for chronic myeloid leukemia (CML) in chronic phase (CP, n=136), accelerated C phase (AP, n=80), myeloid blast crisis (BC, n=73), and lymphoid BC Pts. were recruited into six multicenter phase II studies. Prior to STI571 therapy resistant pts. were in myeloid (n=28) or lymphoid BC AP or CP The median duration of therapy was 123 (range 13-741) days. Prior to STI571 and at the time of resistance the expression of Bcr-Abl transcripts was determined in peripheral blood leukocytes by quantitative RT-PCR, the number of genomic Bcr-Abl copies by interphase fluorescence in situ hybridization (IP-FISH), and clonal karyotypic evolution by metaphase cytogenetics. The ST1571 binding site of the Bcr-Abl tyrosine kinase domain was sequenced from cDNA derived from resistant blasts. Results: The median level of Bcr-Abl transcripts, expressed as the ratio Bcr-Abl/Glyceraldehyde-3-phosphate dehydrogenase was 4.6% (0.1-43) prior to STI571 therapy and 5.3% (0.07-100) at the time of resistance 3/21 pts. showed a Bcr-Abl overexpression; (ii) genomic amplification of Bcr-Abl was found in 2/21 pts.

investigated by IP-FISH; (iii) additional chromosomal aberrations resulting in clonal evolution were observed in 7/23 pts., of whom five developed aneuploidy; (iv) point mutations of the ATP binding site of the Abl tyrosine kinase domain were detected in 6/40 pts.. Mutations lead to amino acid substitutions (Y253F, n=1; E255K, n=2; E255V, n=1; T3151, n=2) which changed the conformation of the binding site. Mutations have been confirmed by DNA restriction digest analysis and excluded in pretherapeutic samples. Reactivation of Bcr-Abl was confirmed by Crkl immunoblotting in five pts. with point mutations demonstrating insensitivity to ST1571 with a median proportion of phosphorylated Crkl of 63% (range 38- The Abl autophosphorylation assay demonstrated an increase of the ICso for STI571 from 0.025 pM for wildtype Abl to 0.5 pM for Y253F, 0.4 M for E255K, >0.5 M for E255V, and 0.30 AM for T3151.

;ase 4-J21 IbA -33- N Further studies revealed the presence of additional mutations, i.e. Leu248Val, Glu252His, Tyr253His, Met351Thr, Glu355Gly, and His396Arg in ST1571-resistant/refractory patients S suffering from Ph chromosome-positive leukemia.

00 Example 6: Materials and methods Patients Seventy-one CML patients resistant or intolerant to Interferon alpha (INF-a) were treated S with STI571 in 3 multicenter phase 2 trials. After 3 months of therapy, 34 of them showed hematological and cytogenetic response to STI571 normal blood counts and greater C than 65% of Ph-positive mitoses), whereas 29 showed no cytogenetic response. Twenty-four of them, including 16 in chronic phase and 8 in accelerated phase, were analyzed for Abl gene mutation. No material was available for the 5 remaining patients.

RT-PCR-RFLP assay RNA extraction. Total RNA was extracted from frozen aliquots of 107 Peripheral Blood Leucocytes with Trizol reagent (Life Technologies, UK) according to the manufacturer's instructions. RNA pellets were resuspended in 10 jl of RNAse-free water and quantity was estimated by ultraviolet spectrofluorometry.

Reverse transcription. cDNA was synthesized from 1 pg of total RNA in a 20 gil reaction mixture as previously described [Morschhauser F. et al., J. Clin. Oncology 18, 788-794 (2000)].

PCR amplification of a 412 bp fragment was performed with 2 gl of cDNA (corresponding to 100 ng of total RNA), 1X TaqGold reaction buffer (Applied Biosystem, USA), 1.5 mM MgCI 2 250 gM each dATP, dCTP, dGTP, dTTP (Pharmacia, Sweden), 0.5U of AmpliTaq Gold polymerase (Applied Biosystem, USA) and 50 pmol of primer F2: 5'-GAG GGC GTG TGG AAG AAA TA-3' and R2: 5'-GCT GTG TAG GTG TCC CCT GT-3'. Thermocycling conditions used were 12 minutes at 94*C followed by 35 cycles of denaturation at 94 0 C for 1 minute, annealing at 57 0 C for 1 minute, extension at 72 0 C for 1 minute and a final extension step of minutes at 72 0

C.

RFLP analysis. 1/5 of PCR product was digested by 5U of restriction enzyme Dde I (Roche, Switzerland) and electrophoresed on 2.5% Ethidium Bromide stained agarose gel.

DNA extraction Lase Lt3 I I OM -34r-

O

Genomic DNA was extracted from 5.106 Peripheral Blood Mononuclear Cells (PBMCs) using QIAmp DNA minikit (Qiagen, Germany) according to the manufacturer's recommendations.

S Quantity was estimated by ultraviolet spectrofluorometry.

00 Sequence analysis The whole kinase and ATP-loop Abl domain (amino acid 242 to 395) was amplified on cDNA C in reaction mixture and PCR conditions as described above, using forward primer F3: CAC CAT GAA GCA CAA GC-3' and reverse primer R2 at 60*C for annealing.

C1 After purification on QIAquick PCR purification column (Qiagen, Germany), 462 bp PCR S fragments were sequenced following the ABI protocol for Taq-Dye Terminator Sequencing C on an automated ABI377 sequencer. Sequences were analyzed with the Sequence Analysis software V3.3 and the Sequence Navigator software V1.0.1 (Applied Biosystem, USA).

Sequencing was performed on both strands.

Detected mutations were always confirmed by sequencing both strands of 207 bp PCR products from DNA. PCR conditions are described above, using forward primer F4: CTC GTT GTC TTG TTG GC-3' and reverse primer R4: 5'-CCC CTA CCT GTG GAT GAA GT-3' at 60C for annealing.

ASO-PCR assays Mutated or wild-type sequences were specifically amplified in a non competitive PCR reaction performed on DNA in 50 pl reaction mixture and PCR conditions as described above, using allele-specific and reverse primers as follows: for the Thr31511e mutation, F315C: 5'-GCC CCC GTT CTA TAT CAT CAC-3' or F315T: 5'-CCC GTT CTA TAT CAT CAT-3' and R1: 5'-GGA TGA AGT TTT TCT TCT CCA G-3' (annealing at 64 0 C; 158 bp PCR product); for the Phe311Leu mutation, F311T: 5'-CAC CCG GGA GCC CCC GT-3' or F311C: 5'-CAC CCG GGA GCC CCC GC-3' and R4 (annealing at 64 0 C; 174 bp PCR fragment); for the Met351Thr mutation, F351T: 5'-CCA CTC AGA TCT CGT CAG CCA T-3' or F351C: 5'-CCA CTC AGA TCT CGT CAG CCA C-3' and R5: 5'-GCC CTG AGA CCT CCT AGG CT-3' (annealing at 68 112 bp PCR fragment).

The sensitivity of this assay was determined for each mutation by amplification of limited dilutions of 100 ng of patient's DNA at time of resistance in 100 ng of healthy control

DNA.

Results 0 Analysis of Thr31511e mutation The Thr31511e mutation was investigated by studying the loss of Dde I restriction enzyme site G induced by C to T base change in the 24 STI571 resistant patients. Analysis was performed oO after cDNA amplification of a 412 bp PCR fragment at diagnosis and at the time of resistance.

In 3 CML patients in accelerated phase with resistance to STI571, the Dde I restricted C- pattern showed two populations of Abl transcripts, a wild-type sequence characterized by 2 fragments of 171 and 36 bp, respectively, and a mutated sequence characterized by a 207 LC bp uncut fragment. Differences in band intensities suggested a minor proportion of mutated transcript for one patient and a major proportion of mutated transcript for the two other C patients. This RT-PCR-RFLP assay failed to detect Thr315l1e mutated transcript at diagnosis as only a 207 bp uncut fragment was detected in those patients.

Analysis was also performed on 16 patients with complete cytogenetic remission after 3 months of therapy with ST1571. None of those patients presented the Thr315le mutation.

Direct sequence analysis on DNA and RNA In the 24 STI571 resistant patients, the Abl kinase domain and ATP-loop region were directly sequenced from PCR DNA and cDNA products (a 207 bp F4R4-PCR fragment and a 462 bp F3R2-PCR fragment, respectively) at the time of resistance and prior to ST1571 therapy.

Sequencing data confirmed the Thr315Ile mutation in 2 of the 3 previously RT-PCR-RFLP detected patients, but failed in the remaining patient who presented a lower level of mutated transcript. The heterozygous rate for each patient is presented by comparison of specific C and T signal ranges on chromatographic primary sequence data, accordingly to RT-PCR- RFLP pattern.

Two of the 21 remaining patients showed 2 previously unreported mutations: one patient in accelerated phase after 12 months of ST1571 therapy had a Phe311Leu substitution induced by a T to C base change, and one patient in chronic phase after 18 months of STI571 therapy had a Met351Thr mutation induced by a T to C base change.

No mutation affecting the Glu255 amino acid was detected by this direct sequencing method.

ASO-PCR monitoring In order to increase the sensitivity of mutation detection, ASO-PCR assays were developed.

The ASO-PCR monitoring showed that in patients having Thr31511e, Phe311Leu or Lase 4-3ZLI I/O -36- S Met351Thr mutations, these mutations were present prior to STI571 treatment, providing evidence that those point mutations preexisted to ST1571 treatment. An increased proportion G of mutated cells over time is shown by PCR signal intensities on Ethidium Bromide stained 00 agarose gel in the 3 analyzed mutations. This last result strongly suggests clonal selection by functional STI571 resistance of mutated cells during therapy. As specific PCR products of mutated Abl gene were detected even after a 10000-fold dilution range, a very sensitive C ASO-PCR test was developed: assuming that 100 ng of DNA represent approximately 15000 cells, it was possible to detect 1.5 Abl mutated cell in 15000 wild-type cells. As expected, for CN each point dilution, signal intensity of non-mutated cells remained constant. The strong S specificity of the assay was demonstrated for each mutation by lack of mutated detected Abl CNi sequence from healthy DNA controls.

Example 7: In this example we studied 43 CML patients (18 in chronic phase and 25 in advanced phase of the disease) who become either cytogenetical or hematological resistant to imatinib mesylate treatment. The advanced phase patients were treated with imatinib mesylate during a median time of 3 months and chronic phase patients during a median time of 13 months. After a first amplification including BCR-ABL fusion (1300pb), we carried out nested PCR to amplify a fragment of 584pb including the ATP binding domain and a fragment of 386pb containing the SH2 and SH3 domains. PCR products were sequenced allowing to cover the different ABL domains including amino acid 72 to 180 and amino acid 234 to 396 to study respectively SH2/SH3 and ATP binding domains.

Regarding the ATP binding domain among the 43 patients, 5 cases of mutations were detected. Three patients (one in accelerated phase, and 2 in blast crisis) exhibited the T3151 mutation. In one other accelerated phase patient the E255K mutation was detected. In a cytogenetic resistant patient (in chronic phase) treated by imatinib mesylatemore than one year, the investigations found a newly described Gly250Ala substitution. Regarding the SH2 and SH3 domains no mutation were detected in the different samples providing from the all the 43 CML patients studied.

Our data confirm that in CML patients treated with STI571, ABL mutations are not restricted to the accelerated phase of the disease and we report a new point mutation not described before.

After in vitro mutagenesis, Ba/F3 cell lines were engineered to express either wild-type and T3151, E255K, A250G mutants, in the aim to study the differential sensitivity to imatinib p/'t S\OPER\UMSU,,-Mr 0712432250 065 doc-A3/2007 0 -37- Smesylate. Preliminary results confirmed the high level of resistance from the 00 BaF/BCR-ABL*T3151. The other functional studies are in progress in the laboratory

O

and will be compared to this one.

i Throughout this specification and the claims which follow, unless the context requires O 5 otherwise, the word "comprise", and or variations such as "comprises" or "comprising", 0 will be understood to imply the inclusion of a stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integers or steps.

O

O The reference in this specification to any prior publication (or information derived from it), or to any matter which is known, is not, and should not be taken as an acknowledgment or admission or any form of suggestion that that prior publication (or information derived from it) or known matter forms part of the common general knowledge in the field of endeavour to which this specification relates.

Claims (25)

1. An isolated polypeptide which comprises a functional kinase domain comprising the amino acid sequence of the native human Abi kinase domain in which at least one amino acid (i selected from Met244, Leu248, Gly25O, Glu252. Tyr253, Va1256, Glu258, Phe3ll1, l1e013. Phe3l7. Met:3l8, Met35l. Glu355. Phe359. 1e360. His36l, Leti370, Asp38l. Phe382. His396, Ser4l7. Glu459 and PhW46 is replaced by another amnino acid, said functional kinase domain being resistant to inhibition of its tyrosine kinase activity by N-[4-methyl.-3-(4- pyridin-3-yi-pyrmidin-2-ylamino)-phenyt]-4-(4-methyl-piperazin-1 -ylmethyl)-benzamide or a salt thereof.

2. An isolated polypeptide according to claim 1, wherein in the amino acid sequence of the native humnan Abl kinase domain at least one amino acid selected from Met244. Leu248, Glu252, Tyr253. VaI256, Glu258, Phe3ll1. 11013, Phe3l7, Met3l 8, Glu355, Phe359, 1e360, His36l, Leu.37O, Asp381. Phe382, His396, SeW47, Glu.459 and Phe486 is replaced by another amino acid.

3. An isolated polypeptide according to claim 1, wherein in the amnino acid sequence of the native human Abi kinase domain at least one amino acid selecled from Met244, Leu248, Glu252. Tyr253. Glu258, Phe3l 1, Phe3l7, Met35l, G10355, Phe359, His396. Ser4l7. Glu459 and Phe486 is replaced by another amino acid.

4. An isolated polypeptide according to claim 3, wherein in the ;-imino acid sequence of the native human AbN kinase domain at least one amino acid selected from Met244, Leu248, Glu252. Tyr253, Glu258, Phe3ll1. Phe3l7, Glu355,* Phe359, His396, Ser4l7. Glu459 and Phe486 is replaced by another amino acid. An isolated polypeptide according to claim 4, wherein in the ;imino acid sequence of the native human AbI kinase domain at least one amino acid selected from (31y250, Tyr253, Glu258, Phe3ll and His396 is replaced by another amino acid. B. An isolated polypeptide according to any one of claims 1 to 15, wherein in the amino acid sequence of the native human Abl kinase domain a single amnino acid is replaced by another amino acid. -39-

7. An isolated potypeptide according to claim 3, wherein the amino acid sequence of the 0C) native human ANi kinase domain contains at least one amino acid mutation selected from Met244Val. Leu248Val, Gly250Glu. Gly25OAI. Glu252His. Tyr253His, Tyr253Phe, Glu258Gly. Phe3ll Leu, Phe3l7Leu, Met35l Thr. Glu355Gly, Phe359Val. His396Pro, His396Arg, Ser4l7Tyr. Glu459Lys and Phe486Ser. B. An isolated polypeptide according to claim 7, wherein the amino acid sequence of the native human Abi kinase domain contains at least one amino acid mutation selected from c-i Met244Val. LeuZ48Val, Gly250Glu. Gly25OAJ. Glu252His. Tyr253H-is, Tyr253Phe. Glu258)Gly. Phe311lLeu. Phe3l71Leu. Glu355Gly, Phe359Val, His396Pro. His396,Arg, Ser41Tryr. Glu459Lys and Phe486Ser.

9. An isolated polypeptide according to claim 8, wherein the amrino acid sequence of the native human AbN kinase domain contains at least one amino acid mutation selected from Tyr253H-is, Tyr253Phe, Glu258Gly. Phe3l7Leu and His396Pro. An isolated polypeptide according to claim 7. wherein the amino acid sequence of the native human ANi kinase domain contains the amino acid muta tion Met35l1Thr.

11. An isolated polypeptide accrding to claim 8, wherein the amino acid sequence of the native human Abi kinase domain contains the amino acid mutation Met244Val.

12. An isolated polypeptide according to claim 9, wherein the amino acid sequence of the native human AbN kinase domain contains the amino acid mutation

13. An isolated potypeptide according to claim 9. wherein the amino acid sequence of the native human Abi kinase domain contains the amino acid mutation Tyr253His.

14. An isolated polypeptide according to claim 9. wherein the amino acid sequence of the native human Abi kinase domain or an essentially similar seque~nce thereof contains the amino acid mutation Tyr253Phe. An isolated polypeptide according to claim 9, wherein the amino acid sequence of the 0 0 native human Abl kinase domain or an essentially similar sequence thereof contains the amino acid mutation Glu258Gly. L C

16. An isolated polypeptide according to claim 8, wherein the amnino acid sequence of the native human Abl kinase domain or an essentially similar sequcnce thereof contains the C1 amino acid mutation Phe3l 1 Leu. C' 17. An isolated polypeptide according to claim 9. wherein the amino acid sequence of the native human Abi kinase domain or an essentially similar sequence thereof contains the amino acid mutation Phe317Leu.

18. An isolated polypeptide according to claim 9. wherein the amino acid sequence of the native human Abl kinase domain or an essentially similar sequence thereof contains the amino acid mutation His396Pro.

19. An isolated polypeptide according to claim 8. wherein the amino acid sequence of the native human Abl kinase domain or an essentially similar sequence thereof contains the amino acid mutation Phe486Ser. An isolated polypeptide according to claim 8, wherein the amino acid sequence of the native human Abl kinase domain or an essentially similar sequence thereof contains the amino acid mutation Leu248Val.

21. An isolated polypeptide according to claim 8. wherein the anino acid sequence of the native human Abl kinase domain or an essentially similar sequence thereof contains the amino acid mutation Gly250Ala.

22. An isolated polypeptide according to claim 8. wherein the amino acid sequence of the native human Abl kinase domain or an essentially similar sequence thereof contains the amino acid mutation Glu252His. amino adid mutation Glu252His. -41-

23. An isolated polypeptide according to claim 8, wherein the ainino acid sequence of the 00 native human AN kinase domain or an essentially similar sequcnce thereof contains the amino acid mutation Glu355Gly.

24. An isolated polypeptide according to diaim 8. wherein the amnino acid sequence of the native human AbI kinase domain or an essentially similar seque~nce thereof contains the C1 amino acid mutation Phe359Val. An isolated polypeptide according to claim 8, wherein the amino acid sequence of the native human Abi kinase domain or an essentially similar sequence thereof contains the amino acid mutation His395Arg.

26. An, isolated polypeptide according to claim 8, wherein the amino acid sequence of the native human AbI kinase domain or an essentially similar sequence thereof contains the amino acid mutation Ser4l7Tyr.

27. An isolated polypeplide according to claim 8, wherein the amino acid sequence of the native human Abi kinase domain or an essentially similar sequiince thereof contains the amino acid mutation Glu4SLys.

28. An isolated polypeptide according to any one of claims 10 to 27. wherein the amino acid sequence of the native human ANE kinase domain may contain at least one additional amino acid mutation selected from Met244Val, Leu248Val. Gly25OGlu, Gly25OAI, Glu252His, Tyr253H-is, Tyr253Phe, Glu258Gly. Phe3ll1Leu, Phe3l7Leu. Met35l Thr. Glu355Gly, Phe359Val, His396Pro, His396Arg, Ser4Tyr, Glu459Lys and Phe,486Ser.

29. An isolated polypeptide according to any one of claims 1 to 28. wherein the amino acid sequence of the native human AbI kinase domain consists orf amino acids 229-500 of SEQ ID NO:2- An isolated polypeptide according to any one of claims 1 to 29, which is a Bcr-AbI tyrosine kinase. Cg -42-

31. Use of a polypeptide according to any one of claims 1 to 30 to screen for compounds 0 0 which inhibit the tyrosine kinase activity of said polypeptide. S 32. An isolated nucleic acid molecule comprising a nucleotide sequence that encodes a S polypeptide according to any one of daims 1 to Cl 33. Use of a nucleic acid molecule according to claim 32 in the production of a polypeptide according to any one of claims 1 to 30 for use in screening for compounds which inhibit the C- tyrosine kinase activity of said polypeptide.

34. A recombinant vector comprising a nucleic acid molecule according to claim 32. A recombinant vector according to claim 34. which is a recombinant expression vector.

36. A host cell comprising a recombinant vector according to claim 34 or I I V- YCVTA [1- 1- SEQUENCE LISTING <110> <110> <110> <110> <110> <110> <120> <130> <150> <151> Universit6 Victor Segalen Bordeaux 2 Oregon Health Science University University of Heidelberg Le Centre Hospitalier Regional Universitaire de Lille Medvet Science Pty Ltd Technische UniversitAt M~inchen Mutated Abi kinase domains Case 4-32176A US 60/327389

2001-10-5 <150> US 60/328740 <151> 2001-10-12 <150> US 60/347351 <151> 2002-01-11 <160> 2 <170> Patentln version <210> <211> <212> <213> <220> <221> <222> 1 3393 DNA Homo sapiens CDS (3393) <400> 1 atg ttg gag atc tgc ctg Met Leu Glu Ile Cys Leu aag ctg gtg ggc tgc aaa tcc aag aag ggg Lys Leu Val Gly Cys Lys Ser Lys Lys Gly ctg tcc tcg tcc tcc agc tgt tat ctg gaa gaa gcc ctt cag cgg cca (.ase 4-321 (bA -2- Leu Ser Ser Ser Ser Ser Cys Tyr Leu Giu Giu Ala Leu Gin Arg Pro gcc gct cgt tgg Ala Ala Arg Trp gta gca tct Val Ala Ser gac ttt gag cct Asp Phe Glu Pro cag ggt Gin Gly 40 ctg agt gaa Leu Ser Glu aac tcc Asn Ser aag gaa aac ctt Lys Giu Asn Leu ctc Leu 55 gct gga ccc agt Ala Gly Pro Ser gaa aat gac ccc aac Giu Asn Asp Pro Asn 192 240 ttc gtt gca ctg Phe Val Ala Leu tat Tyr gat ttt gtg gcc Asp Phe Val Ala agt Ser 75 gga gat aac act Gly Asp Asn Thr cta Leu agc ata act aaa Ser Ile Thr Lys ggt Gly gaa aag ctc cgg Giu Lys Leu Arg tta ggc tat aat Leu Gly Tyr Asn cac aat His Asn ggg gaa tgg Gly Giu Trp agc aac tac Ser Asn Tyr 115 tgt Cys 100 gaa 9CC caa acc Giu Aia Gin Thr aaa Lys 105 aat ggc caa Asn Giy Gin atc acg cca gtc Ile Thr Pro Val aac Asn 120 agt ctg gag aaa Ser Leu Giu Lys ggc tgg gtc cca Giy Trp Val Pro 110 cac tcc tgg tac His Ser Trp, Tyr 125 ctg agc agc ggg Leu Ser Ser Gly 336 384 cat ggg His Gly 130 cct gtg tcc cgc Pro Val Ser Arg gcc gct gag tat Ala Ala Glu Tyr ctg Leu 140 atc Ile 145 aat ggc agc ttc Aen Gly Ser Phe gtg cgt gag agt gag Val Arg Giu Ser Glu 155 agc agt cct ggc Ser Ser Pro Giy cag Gin 160 432 480 528 agg tcc atc tcg Arg Ser Ile Ser ctg Leu 165 aga tac gaa ggg Arg Tyr Glu Gly agg Arg 170 gtg tac Val Tyr cat tac agg atc His Tyr Arg Ile 175 aac act gct tct gat ggc aag ctc tac gtc tcc tcc gag agc cgc ttc Asn Thr Ala Ser Asp Giy Lye Leu Tyr Val Ser Ser Giu Ser Arg Phe Gase 4-321 YbA -3- 185 aac acc ctg Asn Thr Leu 195 gcc gag ttg gtt Ala Giu Leu Val cat His 200 cat cat ica acg His His Ser Thr gig Val1 205 qcc gac ggg Ala Asp Gly ctc Leu gic Val 225 gac Asp atc acc acg cic cat Ile Thr Thr Leu His 210 tat ggt gig tcc ccc Tyr Gly Val Ser Pro 230 aic acc aig aag cac Ile Thr Met Lys His 245 tat Tyr 215 cca gcc cca aag Pro Ala Pro Lys aac aag ccc act Asn Lys Pro Thr aac tac gac aag Asn Tyr Asp Lys tgg Trp 235 gag atg gaa cgc Glu Met Glu Arg acg Thr 240 aag ctg ggc Lys Leu Gly ggg Gly 250 ggc cag tac ggg Gly Gin Tyr Gly gag gig Giu Val 255 tac gag ggc Tyr Glu Gly gig Val 260 gac Asp tgg aag aaa tac agc Trp, Lys Lys Tyr Ser 265 acc aig gag gig gaa Thr Met Glu Val Glu 280 cig acg gig gcc Leu Thr Vai Ala gig aag acc Val Lys Thr 270 gaa gct gca Glu Ala Ala 816 864 ttg aag Leu Lys gag Glu 275 gag tic tig Glu Phe Leu aaa Lys 285 gic aig Val Met 290 aaa gag aic aaa Lys Glu Ile Lys cac His 295 cci aac ctg gig Pro Asn Leu Val cag ctc cii ggg gtc Gin Leu Leu Giy Val 300 gag tic aig acc tac Glu Phe Met Thr Tvr tgc Cys 305 acc cgg gag ccc Thr Arg Glu Pro ccg Pro 310 tic tat aic atc Phe Tyr Ile Ile act Thr 315 ggg aac cic ctg Gly Asn Leu Leu tac cig agg gag Tyr Leu Arg Giu tgc Cys 330 aac cgg cag gag Asn Arg Gin Glu gig aac Val Asn 335 aig gag Met Giu 1008 1056 gcc gig gig Ala Val Val cig Leu 340 cig tac atg gcc act Leu Tyr Met Ala Thr cag atc tcg ica Gin Ile Ser Ser gc Al a 350 Case 4-32176A -4- 00 tac ctg gag Tyr Leu Giu 355 aag aaa aac ttc Lys Lys Aen Phe cac aga gat ctt His Arg Asp Leu gct 9CC cga aac Ala Ala Arg Asn 365 1104 1152 tgc ctg Cys Leu 370 gta ggg gag aac cac Val Gly Giu Aen His 375 ttg gtg aag gta gct gat ttt ggc ctg Leu Val Lye Val Ala Asp Phe Gly Leu 380 agg ttg atg aca Arg Leu Met Thr gac acc tac aca Asp Thr Tyr Thr 9CC Ala 395 cat gct gga gcc His Ala Gly Ala 1200 1248 ttc ccc atc aaa Phe Pro Ile Lys tgg Trp 405 act gca ccc gag Thr Ala Pro Giu ctg gcc tac aac Leu Ala Tyr Aen aag ttc Lye Phe 415 tcc atc aag Ser Ile Lye gct acc tat Ala Thr Tyr 435 tat gag ctg Tyr Giu Leu 450 tcc Ser 420 gac gtc tgg gca ttt Asp Val Trp, Ala Phe 425 gga gta ttg ctt Gly Val Leu Leu ggc atg tcc cct Gly Met Ser Pro tac Tyr 440 tac Tyr ccg gga att gac Pro Gly Ile Asp cgc atg gag cgc Arg Met Glu Arg 460 ctg Leu 445 cca Pro tgg gaa att Trp Glu Ile 430 tcc cag gtg Ser Gin Val gaa ggc tgc Giu Gly Cys 1296 1344 1392 cta gag aag Leu Glu Lye gac Asp 455 gag aag gtc tat Giu Lye Val Tyr gaa Giu 470 ctc atg cga gca Leu Met Arg Ala tgg cag tgg aat Trp Gin Trp Asn ccc Pro 480 1440 1488 tct gac cgg ccc Ser Asp Arg Pro tcc Ser 485 ttt gct gaa atc Phe Ala Glu Ile cac His 490 caa 9cc ttt gaa Gin Ala Phe Giu aca atg Thr Met 495 ttc cag gaa Phe Gin Glu agt atc tca gac Ser Ile Ser Asp gaa Giu 505 gtg gaa aag gag Val Glu Lys Giu ctg ggg aaa Leu Gly Lye 510 1536 caa ggc gtc cgt ggg Gin Gly Val Arg Gly gct gtg agt acc ttg ctg cag gcc cca gag ctg Ala Val Ser Thr Leu Leu Gin Ala Pro Glu Leu 1584 Case 4-32 176A ccc acc Pro Thr 530 aag acg agg acc Lys Thr Arg Thr tcc Ser 535 agg aga gct gca gag Arg Arg Ala Ala Giu 540 cac aga gac acc His Arg Asp Thr act Thr 545 gac gtg cct gag Asp Val Pro Glu cct cac tcc aag Pro His Ser Lys cag gga gag agc Gin Gly Glu Ser gat Asp 56D 1632 1680 1728 cct ctg gac cat Pro Leu Asp His gag Giu 565 cct gcc gtg tct Pro Ala Val Ser cca Pro 570 ttg ctc cct cga Leu Leu Pro Arg aaa gag Lys Giu 575 cga ggt ccc ccg Arg Gly Pro Pro 580 aaa gac aaa aag Lys Asp Lys Lys 595 gag ggc ggc ctg Glu Gly Gly Leu gaa gat gag Glu Asp Giu acc aac ttg Thr Asn Leu ttc Phe 600 agc gcc ttg atc Ser Ala Leu Ile cgc ctt ctc ccc Arg Leu Leu Pro 590 aag aag aag aag Lys Lys Lys Lys 605 ttc cgg gag atg Phe Arg Giu Met 1776 1824 aag aca Lys Thr 610 gac ggc Asp Gly gcc cca acc cct Ala Pro Thr Pro ccc Pro 615 aga Arg aaa cgc agc agc tcc Lys Arg Ser Ser Ser 620 ggg gcc ggc gag gaa Gly Ala Gly Giu Glu 635 cag ccg gag Gin Pro Glu gag ggc cga Giu Gly Arg 1872 1920 1968 atc agc aac ggg Ile Ser Asn Gly gca Al a 645 ctg gct ttc acc Leu Ala Phe Thr ccc Pro 650 ttg gac aca gct Leu Asp Thr Ala gac cca Asp Pro 655 gcc aag tcc Ala Lys Ser cca Pro 660 aag ccc agc aat Lys Pro Ser Asn ggg Gly 665 gct ggg gtc ccc Ala Gly Val Pro aat gga gcc Asn Gly Ala 670 ctg tgg aag Leu Trp Lys 2016 ctc cgg Leu Arg gag Giu 675 tcc ggg ggc tca Ser Gly Gly Ser ggc Gly 680 ttc cgg tct ccc Phe Arg Ser Pro cac His 685 2064 uase 4-321 NtA aag tcc agc acg ctg acc agc Lys Ser 690 Ser Thr Leu Thr Ser 695 agc cgc cta 9CC acc ggc Ser Arg Leu Ala Thr Gly 700 gag gag gag Giu Glu Glu 2112 2160 ggc Gly 705 ggt ggc agc tcc agc Gly Gly Ser Ser Ser 710 aag cgc ttc ctg cgc Lys Arg Phe Leu Arg 715 tct tgc tcc gcc Ser Cys Ser Ala tcc Ser 720 tgc gtt ccc cat Cys Val Pro His ggg Giy 725 gcc aag gac acg Ala Lys Asp Thr gag tgg agg Giu Trp, Arg 730 cag ttt gac Gin Phe Asp cct cgg gac Pro Arg Asp gga ggg cac Gly Gly His 755 ttg Leu 740 cag tcc acg gga Gin Ser Thr Gly aga Arg 745 tca gtc acg ctg Ser Val Thr Leu 735 tcg tcc aca ttt Ser Ser Thr Phe 750 aag agg gca ggg Lys Arg Ala Gly 765 2208 2256 2304 aaa agt gag aag Lys Ser Giu Lys gct ctg cct cgg Ala Leu Pro Arg gag aac Giu Asn 770 agg tct gac cag Arg Ser Asp Gin gtg Val 775 acc cga ggc aca Thr Arg Gly Thr gta acg cct ccc ccc Val Thr Pro Pro Pro 780 gag gtc ttc aaa gac Giu Val Phe Lys Asp 2352 2400 2448 agg Arg 785 atc Ile ctg gtg aaa aag Leu Val Lys Lys aat Asn 790 ccg Pro gag gaa gct gct Glu Glu Ala Ala ggc tcc agc ccg Gly Ser Ser Pro 810 atg gag tcc Met Glu Ser aac ctg act Asn Leu Thr cca Pro 815 ccc ctc cgg Pro Leu Arg Cgg Arg 820 cag gtc acc Gin Vai Thr gaa aag ggc Giu Lys Gly gtg gcc Val Aia 825 agt gcc Ser Ala 840 cct gcc tcg ggc Pro Ala Ser Giy ctc ccc cac Leu Pro His 830 gct gca gct Ala Ala Ala 2496 2544 aag gaa gaa gct Lye Giu Giu Ala 835 tta ggg acc Leu Gly Thr cct Pro 845 gag cca gtg acc ccc acc agc aaa gca ggc tca ggt gca cca ggg ggc Glu Pro Val Thr Pro Thr Ser Lye Ala Gly Ser Gly Ala Pro Gly Gly 2592 Case 4-32176A 850 860 acc Thr 865 agc aag ggc ccc Ser Lys Gly Pro gag gag tcc aga gtg Glu Giu Ser Arg Val 875 agg agg cac Arg Arg His aag cac Lys His 880 2640 tcc tct gag tcg Ser Ser Glu Ser cca ggg agg gac aag Pro Gly Arg Asp Lys 885 ggg aaa ttg Gly Lys Leu 890 tct gca ggg Ser Ala Giy cct gcc ccg Pro Ala Pro aag ccc tcg Lys Pro Ser 915 ccg Pro 900 ccc cca cca gca Pro Pro Pro Ala gcc Ala 905 tcc agg ctc aaa Ser Arg Leu Lys 895 aag gct gga gga Lys Ala Gly Gly 910 gag gca gtc ctg Giu Ala Val Leu 925 2688 2736 2784 cag agc ccg agc Gln Ser Pro Ser cag Oln 920 gag gcg gcc ggg Giu Ala Ala Gly ggc gca Gly Ala 930 aag aca aaa gcc Lys Thr Lys Ala agt ctg gtt gat Ser Leu Val Asp gct gtg aac agt gac Ala Val Aen Ser Asp 940 aaa aag ccc gtg ctc Lys Lys Pro Vai Leu gcc aag ccc agc Ala Lys Pro Ser cag Gin 950 ccg gga gag ggc Pro Gly Glu Gly 2832 2880 2928 2976 ccg gcc act cca Pro Ala Thr Pro aag Lys 965 gtt Val1 cca cag tcc gcc Pro Gin Ser Ala aag Lys 970 cca Pro ccg tcg ggg acc Pro Ser Gly Thr ccc atc Pro Ile 975 gcc ctg Ala Leu agc cca 9CC Ser Pro Ala ccc tcc acg Pro Ser Thr tca gca tcc Ser Ala Ser tcg Ser 990 gca ggg gac cag ccg Ala Giy Asp Gin Pro 995 tct tcc act Ser Ser Thr 1000 gcc ttc atc cct ctc Aia Phe Ile Pro Leu 1005 ata tca acc Ile Ser Thr 3024 cga gtg Arg Val 1010 tct ctt cgg aaa acc cgc cag cct cca gag cgg atc gcc Ser Leu Arg Lys Thr Arg Gin Pro Pro Giu Arg Ile Ala 1015 1020 3069 Case 4-32176tA -8- agc ggc Ser Gly 1025 ctg tgc Leu Cys 1040 9CC atc acc aag Ala Ile Thr Lys ctc gcc atc tct Leu Ala Ile Ser gtg ctg gag gcc Val Leu Glu Ala ggc Gly 1030 agg Arg 1045 ggc Gly 1060 gtg gtc ctg gac agc Val Val Leu Asp Ser 1035 aac tcc gag Asn Ser Glu cag atg Gin Met 1050 agc gca Ser Ala 1055 agc tat Ser Tyr 1070 cga gag Arg Giu 1085 atc tgc Ile Cys 1100 ttc agc Phe Ser 1115 gtg gat tcc atc cag Val Asp Ser Ile Gin 1075 gcc atc aac aaa Ala Ile Asn Lys ccg gcg aca gca Pro Ala Thr Ala aag ctc ctc agt Lys Leu Leu Ser ctg Leu 1090 ggc Gly 1105 tcg Ser 1120 aaa aac ctc tac Lye Asn Leu Tyr caa atg agg aac Gin Met Arg Asn gag aat aat ctc Giu Asn Aen Leu agt ggt ccg gcg Ser Gly Pro Ala gtg aag gaa atc Val Lys Giu Ile acg Thr 1065 aag Lye 1080 Cgg Arg 1095 9CC Ala 1110 agt Ser 1125 acc gag gcg Thr GiU Ala 9CC agc cac Ala Ser His ttc tgc gtg Phe CyB Val ttt 9CC ttc Phe Ala Phe gag ctt cag Giu Leu Gin act cag gac Thr Gin Asp gac ata gtg Asp Ile Val 3114 3159 3204 3249 3294 3339 3384 cag agg tag Gin Arg 1130 <210> 2 3393 <211> <212> <213> 1130 PRT Homo sapiens <400> 2 Met Leu Giu Ilie Cys Leu Lye Leu Val Gly Cys Lys Ser Lye Lye Gly 1 5 10 1s Case 4-32 176A Leu Ser Ser Ser Ser Ser Cys Tyr Leu Glu Glu Ala Leu Gin Arg Pro Asp Val Ala Ser Asn Ser Lys Phe Glu Pro Gin 40 Ala Leu Ser Glu Ala Ala Arg Trp Asn Asp Pro Asn Giu Asn Leu Leu Phe Leu 55 Asp Gly Pro Ser Giu Gly Val Ala Leu Ser Tyr 70 Giu Phe Val Ala Asp Asn Thr Leu Ile Thr Lys Gly Lys Leu Arg Val1 90 Asn Gly Tyr Aen His Asn Gly Glu Trp Ser Asn Tyr 115 His Gly Pro Cys Glu 100 Ile Thr Val Ser Ala Gin Thr Pro Val Asn 120 Arci Asn Ala Gly Gin Gly Leu Glu Lys His 125 Leu Trp Val Pro 110 Ser Trp Tyr Ser Ser Gly Ala Glu Tyr 130 Ile Asn 135 Val Leu 140 Ser Gly Ser Phe 145 Arg Leu 150 Arg Arg Glu Ser Ser Pro Gly Gin 160 Ile Ser Ile Ser Tyr Giu Gly Arg 170 Tyr His Tyr Asn Thr Ala Asn Thr Leu 195 Leu Ile Thr 210 Ser 180 Asp Gly Lys Leu Tyr 185 Val Ser Ser Giu Ser Arg Phe 190 Ala Asp Gly Lys Pro Thr Ala Glu Leu Val His 200 Pro His His Ser Thr Ala Pro Lys Arg 220 Val1 205 Asn Thr Leu His Tyr 215 Val Tyr Gly Val Ser Pro Asn Tyr Asp Lys Trp, Giu Met (flu Arg Thr Case 4-32 176A 230 HisB 235 Gly Ile Thr Met Lys 245 Trp Lys Leu Gly Gly 250 Leu Gin Tyr Gly 240 Giu Val 255 Tyr Giu Giy Leu Lys Giu 275 Val Met Lys Lys Lys Tyr Ser 265 Giu Thr Vai Ala Thr Met Giu Vai 280 Pro Giu Phe Leu Lys 285 Leu Val Lys Thr 270 Glu Ala Ala Leu Gly Val Giu Ile Lys Asn Leu Val 290 Cys Thr Gin 300 Glu Arg Glu Pro 305 Gly Pro 310 Tyr Tyr Ile Ile Thr 315 Asn Phe Met Thr Tyr 320 Asn Leu Leu Leu Arg Giu Cys 330 Gin Arg Gin Giu Val Asn 335 Ala Val Val Tyr Leu Glu 355 Cys Leu Val Leu Leu Tyr 340 Lys Lys Asn Gly Glu Asn Met Ala Phe Ile 360 His Leu Thr 345 His Ile Ser Ser Arg Asp Leu Al a 365 Asp Ala Met Glu 350 Ala Arg Aen Phe Gly Leu Vai Lys Val 370 Ser Arg Leu Met Thr 385 Phe Giy 390 Thr Thr Tyr Thr Ala 395 Leu Ala Gly Ala Pro Ile Lys Trp 405 Ala Pro Glu Ala Tyr Asn Lye 415 Ser Ile Lys Ser 420 Ala Thr Tyr Gly 435 Asp Val Trp Met Ser Pro Ala Phe 425 Tyr Pro 440 Gly Val Leu Leu Trp Giu Ile 430 Gly Ile Asp Leu Ser Gin Vai 445 Case 4-32 176A 11 Tyr Giu Leu Leu Giu Lys Asp Tyr Arg Met Giu 450 455 Arg Pro 460 Glu Gly Cys Pro 465 Glu Lys Val Tyr Leu Met Arg Ala Trp, Gin Trp Asn Pro 480 Ser Asp Arg Pro Ser 485 Phe Ala Glu Ile Gin Ala Phe Glu Thr Met 495 Phe Gin Giu Gin Gly Val 515 Ser Ile Ser Asp Val Glu Lys Giu Leu Gly Lys 510 Pro Giu Leu Arg Gly Ala Val Ser 520 Thr Leu Leu Gin Pro Thr 530 Lys Thr Arg Thr Ser 535 Arg Arg Ala Ala Glu 540 His Arg Asp Thr Thr 545 Asp Val Pro Glu Pro His Ser Lys Gin Gly Glu Ser Asp 560 Pro Leu Asp His Glu 565 Pro Ala Val Ser Leu Leu Pro Arg Lys Glu 575 Arg Gly Pro Glu Gly Gly Leu Asn Glu Asp Glu Arg 585 Leu Leu Pro 590 Lys Lys Lys Lys Asp Lys 595 Lys Thr Asn Leu Ser Ala Leu Ile Lys 605 Lys Thr 610 Ala Pro Thr Pro Pro 615 Lys Arg Ser Ser Ser 620 Phe Arg Giu Met Asp 625 Gly Gin Pro Giu Arg 630 Arg Gly Ala Gly Giu 635 Glu Giu Gly Arg Asp 640 Ile Ser Asn Gly Ala 645 Leu Aia Phe Thr Pro 650 Leu Asp Thr Ala Asp Pro 655 '.ase 14-.5- 1i O/A -12- Ala Lys Ser Pro Lys Pro Ser Asn Gly Ala Gly Val Pro 660 665 Asn Gly Ala 670 Leu Trp Lys Leu Arg Glu 675 Ser Gly Gly Ser Gly Phe 680 Arg Ser Pro His 685 Lys Ser 690 Ser Thr Leu Thr Ser 695 Ser Arg Leu Ala Gly Glu Glu Glu Gly 705 Gly Gly Ser Ser Ser 710 Lys Arg Phe Leu Arg 715 Ser Cys Ser Ala Cys Val Pro His Gly 725 Ala Lys Asp Thr Glu Trp Arg Ser Val 730 Thr Leu 735 Pro Arg Asp Giy Gly His 755 Leu 740 Gin Ser Thr Gly Arg 745 Gin Phe Asp Ser Ser Thr Phe 750 Arg Ala Gly Lye Ser Glu Lys Pro 760 Ala Leu Pro Arg Lys 765 Giu Asn 770 Arg Ser Asp Gin Thr Arg Gly Thr Thr Pro Pro Pro Arg 785 Leu Val Lys Lys Aen 790 Glu Glu Ala Ala Asp 795 Glu Val Phe Lys Ile Met Glu Ser Pro Gly Ser Ser Pro 810 Pro Asn Leu Thr Pro Lye 815 Pro Leu Arg Arg 820 Gin Val Thr Val Ala Pro Ala Ser Gly 825 Leu Pro His 830 Ala Ala Ala Lye Giu Giu 835 Ala Glu Lye Gly Ser 840 Ala Leu Gly Thr Pro 845 Glu Pro Val Thr Pro Thr 850 Ser 855 Lye Ala Gly Ser Gly Ala Pro Gly Gly 860 Thr Ser Lys Gly Pro Ala Ciu Glu Ser Arg Val Arg Arg His Lys His Case 4-3217bA -13- 00 0 870 Gly Ser Giu Ser Pro 885 Pro Arg Asp Lys Gly 890 Leu Ser Arg Leu Lys 895 Pro Ala Pro Lys Pro Ser 915 Gly Ala Lys Pro 900 Gin Pro Pro Ala Ser Ala Gly Lys Ser Pro Ser Gin 920 Ser Ala Ala Gly Giu 925 Val Ala Gly Gly 910 Ala Val Leu Aen Ser Asp Thr Lys Ala Leu Val Asp 930 Ala Ala Ala 940 Lys Lys Pro Ser Gin 950 Pro Gly Glu Gly Leu 955 Pro Lys Pro Val Ala Thr Pro Gin Ser Ala Ser Gly Thr Pro Ile 975 Ala Leu Ser Pro Ala Ala Gly Asp 995 Pro 980 Gin Pro Ser Thr Leu Pro Ser Ala Ser Ser Pro Ser Ser Thr Ala Phe Ile Pro Leu Ile Ser Thr 1000 1005 Arg Val 1010 Ser Gly 1025 Leu Cys 1040 Ser Ala 1055 Ser Tyr 1070 Ser Leu Arg Lys Ala Ile Thr Lye Leu Ala Ile Ser Val Leu Giu Ala Val Asp Ser Ile Thr 1015 Gly 1030 Arg 1045 Gly 1060 Gin 1075 Arg Gin Pro Pro Val Val Leu Asp Aen Ser Giu Gin Lys Asn Leu Tyr Gin Met Arg Aen Giu 1020 Ser 1035 Met 1050 Thr 1065 Lys 1080 Arg Ile Ala Thr Giu Ala Ala Ser His Phe Cys Val Phe Ala Phe tq.,dbe 4-04 1 f Om -14- Arg Glu Ala Ile Aen Lys Leu Giu Aen Asn Leu Arg Glu Leu Gin 1085 1090 1095 00 Ile Cys Pro Ala Thr Ala Gly Ser Gly Pro Ala Ala Thr Gin Asp 1100 1105 1110 Phe Ser Lye Leu Leu Ser Ser Val Lye Gu Ile Ser Asp Ile Val i115 1120 1125 Gin Arg 1130