AU2006323930B2 - Methods, plasmid vectors and primers for assessing HIV viral fitness - Google Patents

Methods, plasmid vectors and primers for assessing HIV viral fitness Download PDF

Info

Publication number
AU2006323930B2
AU2006323930B2 AU2006323930A AU2006323930A AU2006323930B2 AU 2006323930 B2 AU2006323930 B2 AU 2006323930B2 AU 2006323930 A AU2006323930 A AU 2006323930A AU 2006323930 A AU2006323930 A AU 2006323930A AU 2006323930 B2 AU2006323930 B2 AU 2006323930B2
Authority
AU
Australia
Prior art keywords
tagged
hiv
virus
dna
hxb2d
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
AU2006323930A
Other versions
AU2006323930A1 (en
Inventor
Inky Paul Madeleine De Baere
Marie-Pierre T.M.M.G De Bethune
Guenter Kraus
Bart Anna Julien Maes
Elisa Mokany
Laurence Tatiana Rimsky
Alison Velyian Todd
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
SpeeDx Pty Ltd
Janssen Sciences Ireland ULC
Original Assignee
SpeeDx Pty Ltd
Janssen Sciences Ireland ULC
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by SpeeDx Pty Ltd, Janssen Sciences Ireland ULC filed Critical SpeeDx Pty Ltd
Publication of AU2006323930A1 publication Critical patent/AU2006323930A1/en
Assigned to TIBOTEC PHARMACEUTICALS LTD., SPEEDX PTY LTD reassignment TIBOTEC PHARMACEUTICALS LTD. Request for Assignment Assignors: JOHNSON & JOHNSON RESEARCH PTY LIMITED, TIBOTEC PHARMACEUTICALS LTD.
Application granted granted Critical
Publication of AU2006323930B2 publication Critical patent/AU2006323930B2/en
Assigned to JANSSEN SCIENCES IRELAND UC, SPEEDX PTY LTD reassignment JANSSEN SCIENCES IRELAND UC Request for Assignment Assignors: SPEEDX PTY LTD, TIBOTEC PHARMACEUTICALS LTD.
Ceased legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701Specific hybridization probes
    • C12Q1/702Specific hybridization probes for retroviruses
    • C12Q1/703Viruses associated with AIDS

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Virology (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Immunology (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Analytical Chemistry (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • AIDS & HIV (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention relates to methods and means for the evaluation of HIV replicat ive capacity in a given environment. In particular, the invention provides a growth competition assay that can determine relative viral fitness using a recombinant tagged HIV-1 virus system. The methods rely on plasmid vectors, amplicons, primers and probes, and the generation of replication-competent viruses therefrom. Said methods and materials may find use in multiple fields including diagnostics, drug screening, pharmacogenetics and drug development.

Description

WO 2007/065926 PCT/EP2006/069422 METHODS, PLASMID VECTORS AND PRIMERS FOR ASSESSING HIV VIRAL FITNESS 5 Filed of the invention The present invention relates to methods and means for the evaluation of HIV replicative capacity in a given environment. In particular, the invention provides a growth competition assay that can determine relative viral fitness using a recombinant 10 tagged HIV- 1 virus system. The methods rely on plasmid vectors, amplicons, primers and probes, and the generation of replication-competent viruses therefrom. Said methods and materials may find use in multiple fields including diagnostics, drug screening, pharmacogenetics and drug development. 15 Background of the art The ultimate goal of antiretroviral therapy is to suppress HIV- 1 replication as much and for as long as possible. Maintaining low-to-undetectable HIV-1 RNA levels will prevent progression to Acquired Immunodeficiency syndrome (AIDS) and minimize the emergence of antiretroviral resistance (Hirsch et al., 1998). However, even highly 20 active antiretroviral therapy (HAART) does not completely suppress HIV- 1 replication in all tissue compartments. Effectiveness of every antiretroviral drug is limited by the emergence of drug-resistant variants, frequently showing extensive cross-resistance within each drug class (Miller, 2001; Deeks, 2001; Loveday, 2001). In the absence of antiretroviral therapy (ART), these drug-resistant strains have reduced fitness compared 25 to wild-type (WT) clones within the quasispecies (Coffin, 1995). Fitness is a complex parameter that describes the replicative adaptability of an organism to its environment (reviewed in Domingo and Holland, 1997; Domingo et al. 1999). Usually, an initial decrease in fitness coincides with the appearance of primary substitutions conferring direct drug resistance. Continued drug pressure allows the virus to select secondary 30 mutations that compensate for the primary mutations and restore enzymatic activity of the drug-targeted enzyme [Protease (PR) or Reverse Transcriptase (RT)]. This continual evolution will lead to a recovery in fitness to levels sometimes lower, similar or even higher than that of the WT virus (Hirsch et al., 1998; Nijhuis et al., 2001; Berkhout, 1999a; Clavel et al., 2000; Doyon et al., 1996; Quifiones-Mateu and Arts, 35 2001). Thus, each clone within the 'swarm' or quasispecies is subject to various selective pressures and has a fitness that reflects a combination of properties, such as activity and stability, in a particular environment. During quasispecies turnover or replication, different genomes are rapidly generated and subjected to a continuous WO 2007/065926 PCT/EP2006/069422 -2 process of competition and selection (Domingo et al., 1999). Newly arising variants of higher fitness often out-compete clones of lower fitness and thus, the quasispecies can rapidly adapt to a changing environment. 5 Considerable attention has been focused on the relation between drug resistance and viral fitness. Several mutations that confer resistance to antiretroviral agents reduce the replicative capacity and relative fitness of HIV-1 isolates as compared with WT isolates (Croteau et al. J Virol 1997; 71:1089 - 96; Larder et al. Science 1995; 269:696 - 9; Harrigan et al. J Virol 1998; 72:3773 - 8; Kosalaraksa et al. J Virol 1999; 73:5356 - 63; 10 Wrin et al. Conference on Retroviruses and Opportunistic Infections, San Francisco, January 30-February 2, 2000). The reduced replicative capacity of highly drug resistant variants of HIV-1 may contribute to persistent immunologic benefits in patients considered to be "failing" antiretroviral therapy (Deeks et al. N Engl J Med 2001; 344:472 - 80). The relatively rapid replacement of drug-resistant virus by WT 15 virus on interruption of therapy provides evidence that WT virus has a significant fitness advantage over drug-resistant variants in the absence of drug pressure (Devereux et al. AIDS 1999; 13(Suppl):F123 - 7; Verhofstede et al. AIDS 1999; 13:2541 - 6; Miller et al. AIDS 2000; 14:2857 - 67). Thus, accumulation of drug resistance mutations in HIV-1 PR and RT significantly impairs viral fitness (Lu et al., J. 20 Acquir. Immune Defic. Syndr. 27:7 - 13; Martinez-Picado et al., J. Virol. 73:3744 3752). Reduced viral fitness contributes to the continued benefit of antiretroviral therapy despite the presence of high-level drug resistance (Deeks et al., N. Engl. J. Med. 344:472 - 480). However, not all resistance mutations necessarily reduce viral fitness in the absence of drug. For example, certain mutations selected during therapy 25 with regimen containing a protease inhibitor (PI) can improve viral replication, leading to a mutant that is fitter than the initial WT isolate (Nijhuis et al., Proc. Natl. Acad. Sci. USA 89:10537 - 10541). A number of assays have been reported for the estimation of relative viral fitness in 30 vitro. Most of these approaches rely on point mutation assays, direct population sequencing, or depend on the sequencing of a large number of molecular clones to estimate the frequency of WT and mutant alleles in a population (Martinez-Picado et al. J Virol 1999; 73:3744 - 52; Nijhuis et al. AIDS 1999; 13:2349 - 59). Alternatively, allele frequency is estimated by analysis of relative peak heights from sequencing 35 chromatogram (Kosalaraksa et al. J Virol 1999). Clonal analysis and point mutation assays tend to be time-consuming and labor-intensive, however. In addition, unique primers need to be designed and validated for each allele studied by the point mutation assay. Although direct population sequencing is more straight-forward, the comparison WO 2007/065926 PCT/EP2006/069422 -3 of relative peak heights on sequencing chromatograms is an imprecise means of estimating allele frequency in a mixed population (Harrigan et al. J Virol 1998; 72:3773 - 8). 5 Recombinant virus assays have provided a relatively rapid and reproducible method of isolating HIV from plasma (Kellam et al. J Virol. 38 (1994), pp. 23 - 30; Maschera et al. J Virol. 69 (1995), pp. 5431 - 5436; Hertogs et al. Antimicrob. Agents Chemother. 42 (1998), pp. 269 - 276; and Robinson et al. AIDS Res. Hum. Retr. 16 (2000), pp. 1149 - 1156). The drug target genes PR and/or RT are amplified by production of 10 a cDNA followed by polymerase chain reaction (PCR) and co-transfected with a cloned proviral DNA with a specific deletion in the region corresponding to the amplified region. Overlapping regions in the co-transfected DNA fragments recombine to produce replicative virus. A method for culturing HIV- 1 is described by Robinson et al., Journal of Virological Methods, 104(2002) 147 - 160; in which all of the Gag gene 15 including the Gag-Pol cleavage sites are derived from the isolate of interest, in addition to the entire PR and RT sequences. A modified single-cycle recombinant virus assay has been used to determine replicative capacity of different HIV-1 isolates but does not provide actual data on comparative 20 fitness, because this assay does not measure the competitive growth of different viral species (Wrin et al.). In addition, single-cycle recombinant virus assay are limited to HIV- 1 clones containing a subject derived gene or specific mutation, and furthermore the viruses tested do not complete full cycle of replications (Quifiones-Mateu et al., 2002). 25 A PCR-based differential probe hybridization assay that uses chemiluminescent detection accurately quantifies the proportion of WT and mutant sequences in a mixture, but specific probes must be designed for each allele of interest (Eastman et al. J Clin Microbiol 1995; 33:2777 - 80). Sequencing a sufficiently large number 30 of clones to estimate allele frequences is laborious, whereas peak height comparisons are relatively imprecise methods for quantifying mixtures in the virus quasispecies. Growth competition experiments involve dual infection with two different HIV-1 35 isolates. Relative fitness of the two virus strains may be directly compared in mixed infections in which each strain is accurately quantified and genetically and/or phenotypically distinguishable from the other. Outgrowth of one isolate over the other is a measure of relative fitness (Holland et al., 1991). Despite being more laborious, WO 2007/065926 PCT/EP2006/069422 -4 growth competition assays provide an accurate estimate of viral fitness by permitting direct comparison of mutant and WT strains. Using this concept of viral competition, different techniques have been developed to quantify the final proportion of two viruses in an in vitro infection setting, and thereby measure relative viral fitness. Many of 5 these methods compare the fitness of HIV- 1 clones differing by single amino acid substitutions and must rely on the sequencing of a large number of clones (Sharma and Crumpacker, 1997; Harrigan et al., 1998; Martinez-Picado et al., 1999, 2000; Imamichi et al., 2000). Recent studies have employed more rapid techniques to estimate the relative frequency of two viruses in a population (Quifiones-Mateu and Arts, 2001). 10 For example, different versions of the heteroduplex tracking assay (HTA) have been used to accurately detect and quantify two HIV- 1 variants in a competition (Quifiones Mateu et al., 2000; Nelson et al., 2000; Resch et al., 2001). New technologies such as real-time PCR have also been applied to dual viral detection (De Ronde et al., 2001). Quifiones-Mateu et al. (2002) recently developed a novel real-time PCR/TaqMan assay 15 that measured the relative production of HIV- 1 subtype B strains by direct competition with non-subtype B HIV-1 controls. Lu and Kuritzkes (JAIDS, 27:7-13, May 2001) developed a novel recombinant marker virus assay (RMVA) to detect two HIV- 1 clones following growth competition assays. The nef gene was replaced by two different marker genes in RT-deleted proviral clones (hisD or PLAP). Following 20 growth competition experiments, a proportion of the two RMV clones (pHlVdeltaenvBSTEIldelta nef-hisD and pHlVdeltaenvBSTEIldelta nef-PLAP) containing different RT coding regions was quantified via real-time PCR for the corresponding marker. However, since the envelope (env) region is the most variable region of the HIV genome, i.e. highest frequency of mutations providing numerous 25 escape mutants to either drugs or neutralizing antibodies, the removal and replacement of the nef gene by an alien gene shall inevitably affect the properties of the original virus. Thus, such a method still fails to provide an in vitro model which can mimic the in vivo effects of target viruses. 30 There is thus a need for a method for testing viral fitness which is standardized, which can mimic an in vivo setting, is easy to use and easy to quantify in an accurate and precise manner. There is also a need for a method which allows multiplex analyses of a plurality of virus in a single analysis tube. 35 It is an object of the invention to provide a method for assessing viral fitness which can measure the replicative capacity of a virus in an environment.
WO 2007/065926 PCT/EP2006/069422 -5 It is an object of the invention to provide a method for assessing viral fitness which can measure the competitive growth of different viral species. It is an object of the invention to provide a method for assessing viral fitness which 5 does not need to employ primers or probes designed and validated for each allele studied. It is an object of the invention to provide a method for assessing viral fitness which tests the complete full cycle of replication. 10 It is an object of the invention to provide a method for assessing viral fitness which is precise for quantifying mixtures in the virus quasispecies. It is an object of the invention to provide a method for assessing viral fitness which is 15 accurate in estimating viral fitness. It is an object of the invention to provide a model for assessing viral fitness which can mimic in vivo conditions. 20 W003/020878 provides oligonucleotide primer sets, probes, and combinations thereof useful for amplifying and detecting HIV-1 target sequences in a test sample. EP1283272 by Tibotec Pharmaceuticals Ltd. relates to methods and products for the evaluation of HIV treatment. In particular, molecular events at the HIV envelope 25 protein and their effect on therapeutic efficacy of drugs are determined. The methods rely on providing HIV envelope nucleic acid material and evaluating a treatment either through genotyping or phenotyping. W003/011334 discloses the use of an HIV Tat protein or polynucleotide; or an HIV 30 Nef protein or polynucleotide; or an HIV Tat protein or polynucleotide linked to an HIV Nef protein or polynucleotide; and an HIV gp 120 protein or polynucleotide in the manufacture of a vaccine suitable for a prime-boost delivery for the prophylactic or therapeutic immunisation of humans against HIV, wherein the protein or polynucleotide is delivered via a bombardment approach. 35 WO00/296 11 relates to a method for the subtype and/or species-comprehensive detection of HIV in a sample while using at least one oligonucleotide which contains at least 10 successive nucleotides from (i) a highly preserved region of the LTR region, of WO 2007/065926 PCT/EP2006/069422 -6 the gag gene or of the polgene of HIV, (ii) of a corresponding region of another HIV isolate, (iii) of a corresponding region of a consensus sequence stemming from a plurality of HIV isolates or of sequences complementary thereto. 5 FR2869045 provides a method of analysis of a sample likely to contain an HIV virus, comprising the following steps: (a) the extraction of the viral RNA; (b) the reverse transcription of the RNA obtained at step (a) and amplification with a first pair of primers thereby allowing the generation of an amplified reverse transcription product comprising the whole or the part of at least two successive genes of the HIV genome; 10 (c) the sequencing of the amplified reverse transcription product; (d) the amplification of the amplified reverse transcription product obtained at step (b) with one second pair of primers; (e) homologous recombination with a vector of the aforesaid amplification product prepared at step (d); (f) functional analysis of viral proteins coded by whole or part of the aforesaid at least two genes; (g) the measurement of the replicative capacity 15 of the recombination viruses obtained at step (e). EP1285971 by Tibotec Pharmaceuticals Ltd. relates to methods and products for the evaluation of HIV treatment. The methods are based on evaluating molecular events at the HIV integrase (int) resulting in altered therapeutic efficacy of the investigated 20 compounds. The methods rely on providing an integrase gene and evaluating either through genotyping or phenotyping said integrase gene. US2005/244818 discloses a single-cell-level phenotypic assay, which can simultaneously analyze HIV- 1 drug susceptibility and intrinsic replication capacity. 25 This allows quantitative dissection of the functions of antiretroviral drugs into suppression of viral replication and selection of resistant viruses with diminished replication capacities. The disclosed assay provides a tool for the rational evaluation of treatment decisions for patients failing antiretroviral therapy. 30 Weber Jan et al., The Journal of General Virology, Aug 2003, vol. 84, no. Pt 8 discloses a TaqMan real-time PCR assay to estimate ex vivo human immunodeficiency virus type 1 fitness in the era of multi-target (pol and env) antiretroviral therapy. W005/108588 relates to HIV-based recombinant viral clones, which are the result of 35 the following genetic manipulations: deletion of HIV fragments (e.g. the Nef gene) without loss of infective capacity; insertion of a gene that is not expressed in human cells; insertion of the LacZ gene; and introduction of restriction sites in order to extract DNA fragments from the matrix provirus and substitute same with genes from the -7 patients to be assessed. In addition, the invention relates to the application of said clones in analytical methods that are associated with AIDS. Van Maarseveen et al., Journal of Virological methods, vol. 133, 2006, pages 185-194, 5 disclose a real-time PCR assay to determine relative replication capacity for HIV-1 protease variants and/or reverse transcriptase variants. Any discussion of the prior art throughout the specification should in no way be considered as an admission that such prior art is widely known or forms part of common 10 general knowledge in the field. Summary of the invention The present invention relates to an ex vivo or in vitro method for determining the replicative capacity of two HIV viruses in an environment, said method comprising the 15 steps of: a) generating a tagged recombinant infectious virus comprising a tagged HIV DNA vector, and a first amplicon derived from a first target HIV virus; wherein the tagged HIV DNA vector is generated by introduction of one or more silent mutations in one of the HIV genes selected from gag, pol, env, tat, rev, nef, vif, vpr, and vpu; wherein 20 the tagged HIV DNA vector has a deletion in its DNA sequence that corresponds at most with or overlaps with the flanking regions of the first amplicon derived from the first target HIV virus; wherein the one or more silent mutations are introduced in a gene not comprised by the first amplicon derived from the first target HIV virus; and wherein the first amplicon comprises the gag, pol, or env genes from the first 25 target HIV virus, portions thereof, and combinations thereof; b) generating a non-tagged recombinant infectious virus comprising a non-tagged HIV DNA vector, and a second amplicon derived from a second target HIV virus; wherein the non-tagged HIV DNA vector does not comprise the one or more silent mutations introduced in the tagged HIV DNA vector of step a); wherein the non 30 tagged HIV DNA vector has a deletion in its DNA sequence that corresponds at most with or overlaps with the flanking regions of the second amplicon derived from the second target HIV virus; and wherein the second amplicon comprises the the gag, pol, or env genes from the second target HIV virus, portions thereof, and combinations thereof, 35 c) mixing the recombinant infectious viruses of steps a) and b) in a cell culture in a given environment; and -7a d) determining by quantitative amplification the proportion of the tagged recombinant infectious virus and of the non-tagged recombinant infectious virus within the overall viral population, by detecting the one or more silent mutations in the HIV DNA vector portion of the tagged recombinant infectious virus, and by detecting 5 WO 2007/065926 PCT/EP2006/069422 -8 the lack of the one or more silent mutations in the HIV DNA vector portion of the non-tagged recombinant infectious virus. In particular, the first target virus may be a WT virus and the second target virus a 5 mutant virus strain, or vice versa. Alternatively, the first target virus may be a mutant virus strain and the second target virus a different mutant virus strain. In one embodiment, the present invention relates to the method mentioned supra, wherein the replicative capacity is determined for three or more target HIV viruses in 10 an environment, said method comprising the steps of: a) generating the tagged recombinant infectious virus of step a) of the method mentioned supra; b) generating the non-tagged recombinant infectious virus of step b) of the method mentioned supra; 15 c) generating additional one or more tagged recombinant infectious virus, each comprising a tagged HIV DNA vector, and a third or subsequent amplicon derived from the additional one or more target HIV virus; wherein the tagged HIV DNA vector is generated by introduction of one or more silent mutations in one of the HIV genes selected from gag, pol, env, tat, rev, nef, vif, vpr, and vpu, said one or 20 more silent mutations being different from the one or more silent mutations of the first tagged HIV DNA vector of step a) of this method; wherein each of the tagged HIV DNA vectors has a deletion in its DNA sequence that corresponds at most with or overlaps with the flanking regions of the third or subsequent amplicon derived from the third or subsequent target HIV virus; wherein the one or more silent 25 mutations are introduced in a gene not comprised by the third or subsequent amplicon derived from the third or subsequent target HIV virus; and wherein the third or subsequent amplicon comprises the gag, pol, or env genes from the third or subsequent target HIV virus, portions thereof, and combinations thereof; d) mixing the recombinant infectious viruses of step c) with the recombinant 30 infectious viruses of steps a) and b) in a cell culture in a given environment; and e) determining by quantitative amplification the proportion of each of the tagged recombinant infectious virus and of the non-tagged recombinant infectious virus within the overall viral population, by detecting the one or more silent mutations in the HIV DNA vector portion of each of the tagged recombinant infectious virus, 35 and by detecting the lack of the one or more silent mutations in the HIV DNA vector portion of the non-tagged recombinant infectious virus.
-9 The present invention provides a recombinant virus marker virus system wherein each of the tagged HIV DNA vector and the non-tagged HIV DNA vector comprises the backbone of a wild-type or a mutant strain. 5 The recombinant virus marker virus system further provides proviral DNA, plasmid constructs, primers, and probes designed for the retrieval, preparation and analysis of several and diverse HIV genetic material. In one embodiment, the tagged HIV DNA vector or the non-tagged HIV DNA vector is a proviral HIV DNA or a plasmid DNA. 10 In another aspect the present invention provides a tagged HIV plasmid vector wherein the backbone of the plasmid vector is wild-type HXB2D, said vector comprising - a tagged sequence; and - a deletion of the gag, pol, or env genetic sequences, portions thereof, and combinations thereof; 15 wherein the tagged sequence comprises one or more silent mutations in one of the genes selected from gag, pol, env, tat, rev, nef, vif, vpr, and vpu; and with the proviso that the one or more silent mutations are not located in the deleted genetic sequence. Because one or more of the vectors is tagged, the proportion of viruses in a mixed 20 culture that carry each of the tagged sequence can easily be determined by quantifying the frequency of each of the tagged genes with quantitative amplification. Thus, the need to design unique primers for each allele is avoided. Moreover, using recombinant viruses as opposed to primary isolates eliminates possible effects of polymorphisms or mutations outside the coding region of interest on relative fitness. One of the main 25 advantages of these recombinant clones is the flexibility for studying specific coding regions under selection by current protease and reverse transcriptase inhibitors in the same genetic background. In fact, using recombinant viruses, as opposed to HIV-1 primary isolates, it eliminates possible fitness effects of polymorphisms or mutations outside the targeted coding region. As such, a fully standardized protocol is obtained 30 which can be applied to investigate the fitness of all kinds of HIV variants. The methods for determining viral fitness may be useful for designing a treatment regimen. For example, a method may comprise determining the relative replicative capacity of a clinical isolate of a patient in the presence of one or more drugs and using 35 said relative replicative capacity to determine an appropriate drug regimen for the patient.
-10 The present invention also provides a method to aid scientists in studying the evolution of the different HIV strains in the presence or absence of environmental factors, such as and without being limited to, drug pressure, dilution factors, competitive binding proteins such as albumin, al -glycoprotein, cell lines, etc. 5 In addition, the present invention provides the primers selected from SEQ ID N' 1-12, 19-20 and 24-25; HIV plasmid vectors comprising tagged or non-tagged sequences in the HIV genes and a deletion of the gag, pol, or env genes genetic sequences, portions thereof, and combinations thereof, wherein the tagged sequence comprises one or more 10 silent mutations in one of the genes selected from gag, pol, env, tat, rev, nef, vif, vpr, and vpu. The invention further provides a kit for quantifying viral fitness of HIV viruses. Such a kit for determining the viral fitness of two or more -IIV viruses in an environment comprises: i) one or more primers selected from SEQ ID N' 1-12, 19-20 and 24-25; and/or ii) one or more of the tagged HIV plasmid vectors and optionally a 15 non-tagged HIV HXB2D plasmid vector; and iii) optionally probes for quantitative amplification, as described in the present invention. Such a kit may be further completed with at least one HIV inhibitor. Optionally, a reference proviral DNA or plasmid bearing a WT HIV sequence may be added. Optionally, cells susceptible to HIV infection may be added to the kit. In addition, other environmental factors may be 20 added. In another aspect the present invention provides a tagged HIV envelope encoding nucleic acid wherein the sequence of said tagged HIV envelope encoding nucleic acid is SEQ ID N* 26. 25 In another aspect the present invention provides a tagged HIV integrase-encoding nucleic acid wherein the sequence of said tagged HIV integrase-encoding nucleic acid is SEQ ID N* 27. 30 In another aspect the present invention provides a kit for the ex vivo or in vitro determination of the replicative capacity of two or more HIV virus in an environment, said kit comprising: - one or more oligonucleotides selected from SEQ ID N 0 1-12, 19-20, and 24-25; and/or 35 - one or more of the tagged HIV plasmid vectors according to the previous aspects and optionally a non-tagged IIV HXB2D plasmid vector.
-11 The determination by quantitative amplification of the proportion of the one or more tagged recombinant infectious virus and of the non-tagged recombinant infectious virus within the overall viral population is performed by in vitro amplification techniques including, but not limited to, polymerase chain reaction (PCR), strand displacement 5 amplification (SDA), transcription-mediated amplification (TMA), nucleic acid sequence based amplification (NASBA), self-sustained sequence replication (3SR), transcription-based amplification (TAS), rolling circle amplification (RCA), loop-mediated isothermal amplification (LAMP) and ligase chain reaction (LCR) (reviewed Schweitzer, B. and Kingsmore, S., 2001, Combining nucleic acid 10 amplification and detection. Current Opinion in Biotechnology, 12: 21-27). The accumulation of amplicons generated by in vitro amplification techniques can be monitored in real time using protocols which employ LuxTM fluorogenic primers, probes cleavable by DNAzymes, QZymes, or MNAzymes, TaqMan@ probes, molecular beacons, scorpions or any other FRET probes. 15 The present invention further provides a method wherein the quantitative amplification is performed by polymerase chain reaction employing the NNAzymes as monitoring technology. 20 Results from the viral fitness experiments can be used to develop a database of replicative capacity levels of specific amplicons in the presence or absence of particular environmental factors for a large number of WT and mutant HIV strains. The genotype or phenotype of a particular amplicon may be correlated to the replicative capacity of said particular amplicon in the presence of other viruses. Identical genotypes or 25 phenotypes are retrieved and the database is further interrogated to identify if a corresponding viral fitness is known for any of the retrieved sequences. In this latter case a virtual viral fitness may be determined. A report may be prepared including the viral fitness of the viral strain against one or more other strains, including WT, the genotype and/or phenotype of the strain under investigation, and other information such 30 as environmental factors tested, biological cut-offs, etc. Such a database may be analyzed in combination with gag, pol, or env genetic sequence information and the results used in the determination of appropriate treatment strategies. Unless the context clearly requires otherwise, throughout the description and the claims, 35 the words "comprise", "comprising", and the like are to be construed in an inclusive sense as opposed to an exclusive or exhaustive sense; that is to say, in the sense of "including, but not limited to".
-1]a Description of the drawings - Figure 1, in the central part, is a schematic representation ofthe complete HIV genome. In the upper part, the envelope gene is highlighted indicating the position of the tag and the position where the primers bind for detecting the tag. In the lower part 5 there is a schematic overview of the position where the primers bind for amplifying the gag-protease amplicon which later can be recombined with the appropriate tagged or non-tagged plasmid vector. - Figure 2 shows a map of the pGEM vector pGEM-HIVdelGPRT (accession nr LMBP4568, deposited at the Belgian Coordinated Collections of Micro-Organisms 10 located at the Universiteit Gent - Laboratorium voor Moleculaire Biologic on July 1, 2002) wherein the subcloned HIV genes are identified. Said vector has a deletion of the gag-protease-reverse transcriptase encoding sequences. - Figure 3 shows a map of the pGEM vector (pGEM-HIVdelGPRTtagged(env)) (accession nr LMBP 5112, deposited at the Belgian Coordinated Collections of 15 Micro-Organisms located at the Universiteit Gent - Plasmidecollectie vakgroep moleculaire biologic on December 2 0 th, 2005) wherein the subcloned HIV genes are identified. Said vector has a deletion of the gag-protease-reverse transcriptase encoding sequences, and further comprises a tagged envelope gene. - Figure 4 shows a map of the pGEM vector (pGEM-HIVdelGPRT tagged(int)) 20 (accession nr LMBP 5113, deposited at the Belgian Coordinated Collections of Micro-Organisms located at the Universiteit Gent - Plasmidecollectie vakgroep moleculaire biologic on December 20*, 2005) wherein the subcloned HIV genes are identified. Said vector has a deletion of the gag-protease-reverse transcriptase encoding sequences, and further comprises a tagged integrase sequence. 25 - Figure 5 is a comparison of the viral growth of HIV HXB2D WT and HIV HXB2D-tagged in MT4 cells overtime at various relative input concentrations. - Figure 6 plots the detection of HIV HXB2D WT and HIV HXB2D-tagged DNA from co-infected MT4 cells using dual labeling. - Figures 7a, 7b and 7c show the amplification curves for the templates HIV 30 HXB2D and HIV HXB2D-tagged DNA, amplified with primers SEQ ID N 7 and 6. The B-FAM label corresponds to the HIV HXB2D DNA (figure 7a), the D-JOE WO 2007/065926 PCT/EP2006/069422 -12 corresponds to the HIV HXB2D-tagged DNA (figure 7b) and the TAMRA corresponds to the housekeeping gene (GAPD) (figure 7c). - Figures 8a, 8b and 8c show the amplification curves for the templates HIV HXB2D and HIV HXB2D-tagged DNA, amplified with primers SEQ ID N' 5 and 6. 5 The B-FAM label corresponds to the HIV HXB2D DNA (figure 8a), the D-JOE corresponds to the HIV HXB2D-tagged DNA (figure 8b) and the TAMRA corresponds to the housekeeping gene (GAPD) (figure 8c). - Figures 9a, 9b and 9c show the amplification curves for the templates HIV HXB2D and HIV HXB2D-tagged DNA, amplified with primers SEQ ID N' 8 and 9. 10 The B-FAM label corresponds to the HIV HXB2D DNA (figure 9a), the D-JOE corresponds to the HIV HXB2D-tagged DNA (figure 9b) and the TAMRA corresponds to the housekeeping gene (GAPD) (figure 9c). - Figures 10a, 1 Ob and 1 Oc show the amplification curves for the templates HIV HXB2D and HIV HXB2D-tagged DNA, amplified with primers SEQ ID N' 5, 6, 7, 8 15 and 9. The B-FAM label corresponds to the HIV HXB2D DNA (figure 10a), the D JOE corresponds to the HIV HXB2D-tagged DNA (figure 1 Ob) and the TAMRA corresponds to the housekeeping gene (GAPD) (figure 10C). - Figure 11 provides the pictures of the end point gel electrophoresis for the amplified material shown in Figures 7-10. 20 - Figure 12 is a depiction of an exemplary design for an INAzyme, wherein substrate arm portions (A) of partzymes A and B bind to a Reporter substrate, to which is attached a fluorescent tag (left) and a quencher (right). Catalytic core portions (C) are located between substrate arm portions (A) and sensor arm portions (B). Upon binding of sensor arm portions (B) to a Target, the Reporter substrate is cleaved at the 25 INAzyme Cleavage Site, thereby increasing fluorescence. - Figure 13: Schematic representation of an exemplary multiplex analysis of multiple targets: Two or more targets can be simultaneously detected using two or more substrates, each specific for one INAzyme. Substrates are preferably labeled with different fluorophores. In this example, Target 1 can be detected by monitoring 30 the increase in FAM fluorescence and Target 2 can be detected by monitoring the increase in JOE fluorescence. Q: quencher; FAM, JOE: fluorophores. - Figure 14 represents an example of an MNAzyme PCR assay for monitoring HIV Viral Fitness. A duplex PCR assay is illustrated which used two INAzymes for detection and quantification of two sequences simultaneously. The upper sequence, 35 HIV HXB2D WT, contains wild type (WT) sequence located 5' of a second region which is recognised by MNAzyme 1. The grey circles in the second (3') region correspond to non-tagged wild type bases. The lower sequence, HIV HXB2D-tagged, contains sequences derived by amplification of the HIV target virus of interest (T), WO 2007/065926 PCT/EP2006/069422 -13 which are located 5' of a second region which is recognised by MNAzyme 2. The striped squares in the second (3') region correspond to silent mutations (tagged bases). The forward PCR primer (arrow 5'P) and reverse PCR primer (arrow 3'P) recognise both the upper HXB2D WT and the lower HXB2D-tagged sequences. MNAzyme 1 5 assembles in the presence of the upper HXB2D WT amplicons creating an active nucleic acid enzyme which cleaves substrate 1 (S-1) between FAM (F) and a quencher (Q). MNAzyme 2 assembles in the presence of the lower HXB2D-tagged sequence creating an active nucleic acid enzyme which cleaves substrate 2 (S-2) between JOE (J) and a quencher (Q). 10 Description of the invention Definitions By the term "viral fitness" is meant the replicative capacity of any HIV-1 variant in a given environment, e.g. a cell system in the presence or absence of a drug. 15 The term "tag" refers to a chemical moiety, either a nucleotide, oligonucleotide, or polynucleotide that, when substituted or added to another sequence, provides additional utility or confers useful properties to that sequence, particularly in the detection or isolation thereof. In particular in the present invention, the term "tag" refers to one or 20 more nucleotides that are substituted in an HIV DNA vector by other one or more nucleotides with the peculiarity that these substitutions of nucleotides are all silent mutations which do not disrupt the reading frame of the HIV DNA. In the present invention, the one or more silent mutations are introduced into the HIV DNA vector, in particular in one of the HIV genes selected from gag, pol, env, tat, rev, nef, vif, vpr, and 25 vpu, thereby generating a "tagged HIV DNA vector". The "non-tagged HIV DNA vector" refers to the vector which does not comprise the one or more silent mutations introduced in the tagged HIV DNA vector. 30 An "amplicon" is defined as any nucleic acid molecule produced by an ex vivo or in vitro nucleic acid amplification technique. In particular, an amplicon comprises a sequence that hybridizes with a primer when contacted therewith, and that can be either an entire molecule or a portion thereof. 35 The amplicon derived from the target HIV virus refers to the nucleic acid sequence of the HIV target virus of interest whose replicative capacity is to be determined by the instant invention. In particular, the amplicon derived from the target HIV virus comprises one of the HIV genes or portions thereof, and combinations thereof, which WO 2007/065926 PCT/EP2006/069422 -14 are selected from the gag, pol, and env genes, i.e. the gag gene, the protease encoding region of the pol gene, the reverse transcriptase encoding region of the pol gene, the integrase encoding region of the pol gene, the env gene, portions thereof, and combinations thereof. In particular, the amplicon derived from the target HIV virus is 5 selected from gag-PR-RT-int, gag-PR-RT, gag-PR, gag, PR-RT-int, RT-int, int, PR RT, PR, RT, env, and portions thereof. Additionally, the amplicon may include flanking regions, for example for the gag-PR and PR-RT genes, those flanking regions with 5'LTR sequences, or portions thereof. It should be understood that this amplicon may be of diverse origin, including plasmids, patient derived material, or laboratory 10 viruses including IIIB and NL4-3, or any other mutant or WT viruses. The amplicon derived from the target HIV virus is not to be confused with the sequence which is amplified during quantitative amplification. This last sequence or amplicon corresponds to the tagged or non-tagged region of the tagged HIV DNA vector or 15 non-tagged HIV DNA vector, respectively. These tagged HIV DNA vector or non-tagged HIV DNA vector are ultimately recombined with the amplicon derived from the target HIV virus, and the sequence that is quantitatively amplified originates from the recombinant viruses. In particular, the amplicon that is quantitatively amplified comprises or lacks the one or more silent mutations introduced in one of the 20 HIV genes selected from gag, pol, env, tat, rev, nef, vif, vpr, and vpu. "Primer" shall mean a short segment of DNA or DNA-containing nucleic acid molecule, which (i) anneals under amplification conditions to a suitable portion of a DNA or RNA sequence to be amplified, and (ii) initiates, and is itself physically 25 extended, via polymerase-mediated synthesis. "Amplification" of a target nucleic acid sequence shall mean an in vitro target amplification technique whereby target sequences are copied, producing amplicons which serve as templates for further cycles of amplification. Such in vitro 30 amplification techniques include, but are not limited to, polymerase chain reaction (PCR), strand displacement amplification (SDA), transcription-mediated amplification (TMA), nucleic acid sequence based amplification (NASBA), self-sustained sequence replication (3SR), transcription-based amplification (TAS), rolling circle amplification (RCA), loop-mediated isothermal amplification (LAMP) and ligase chain reaction 35 (LCR). By "environment" is meant drug pressure such as antiviral drugs, antibiotics, or any other drug, competitive binding proteins such as albumin, al-glycoprotein, toxins, WO 2007/065926 PCT/EP2006/069422 -15 specific types of medium, serum, and components thereof, dilution factors, cell lines, temperature, pressure, radiation, etc. Treatment or treatment regimen refers to the management or handling of an individual 5 medical condition by the administration of drugs, at directed dosages, time intervals, duration, alone or in different combinations, via different administration routes, in suitable formulations, etc. By "drug" is meant any agent such as a chemotherapeutic, peptide, antibody, antisense, 10 ribozyme and any combination thereof, be it marketed or under development. Examples of anti-HIV drugs that can be tested in the assay of the present invention include all approved and under development, nucleotide, nucleoside, and non nucleoside RT inhibitors, PR inhibitors, entry inhibitors, envelope inhibitors and integrase inhibitors. HIV inhibitors comprise nucleoside reverse transcriptase 15 inhibitors (NRTIs), nucleotide reverse transcriptase inhibitors (NtRTIs), non-nucleoside reverse transcriptase inhibitors (NNRTIs), protease inhibitors (PIs), entry inhibitors, fusion inhibitors, gp41 inhibitors, gp120 inhibitors, integrase inhibitors, co-receptors inhibitors (e.g. CCR5, CXCR4, ...), budding/maturation inhibitors, etc. 20 HIV nucleoside RT inhibitors include those compounds whose mechanism of action comprises an inhibition of the viral RT enzyme. As example, and with no limitation to existing and future new compounds, HIV nucleoside reverse transcriptase inhibitors include zidovudine (AZT), lamivudine (3TC), stavudine (d4T), zalcitabine (ddC), didanosine (ddl), abacavir (ABC) 25 HIV non-nucleoside reverse transcriptase inhibitors include those compounds whose mechanism of action comprises an inhibition of the viral reverse transcriptase enzyme. As example, and with no limitation to existing and future new compounds, HIV non nucleoside reverse transcriptase inhibitors include nevirapine, delavirdine, efavirenz, 30 TMC120, TMC125, capravirine, calanolide, UC781, SJ-1366, benzophenones, PETT compounds, TSAO compounds. HIV nucleotide reverse transcriptase inhibitors include those compounds whose mechanism of action comprises an inhibition of the viral reverse transcriptase enzyme. 35 As example, and with no limitation to existing and future new compounds, HIV non-nucleotide reverse transcriptase inhibitors include adefovir (PMEA), tenofovir (PMPA), and other phosphonates.
WO 2007/065926 PCT/EP2006/069422 -16 HIV protease inhibitors include those compounds whose mechanism of action comprises an inhibition of the viral protease enzyme. As example, and with no limitation to existing and future new compounds, HIV protease inhibitors include ritonavir (RTV), indinavir (IDV), nelfinavir (NFV), amprenavir (APV), telinavir 5 (SC-52151), tipranavir (TPV), saquinavir (SQV), lopinavir (LPV), atazanavir, palinavir, mozenavir, BMS 186316, DPC 681, DPC 684, AG1776, GS3333, KNI-413, KNI-272, L754394, L756425, LG-71350, PD161374, PD173606, PD177298, PD178390, PD178392, PNU 140135, maslinic acid, U-140690, R0033-4649, TMC 114, TMC 126, their prodrugs, metabolites, N-oxides and salts. 10 HIV entry inhibitors or gp120 inhibitors include those compounds whose mechanism of action comprises an inhibition of the viral entry or gp120 glycoprotein. As example, and with no limitation to existing and future new compounds, HIV entry or gp120 inhibitors include BMS806, dextran sulfate, suramin, chicoric acid. 15 HIV fusion inhibitors or gp4l inhibitors include those compounds whose mechanism of action comprises an inhibition of the viral fusion or gp4l glycoprotein. As example, and with no limitation to existing and future new compounds, HIV fusion or gp41 inhibitors include T20, T1249. 20 HIV integrase inhibitors include those compounds whose mechanism of action comprises an inhibition of the viral integrase enzyme. As example, and with no limitation to existing and future new compounds, HIV integrase inhibitors include L-870810, L-870812, pyranodipyrimydines, S-1360. 25 Co-receptors inhibitors include those compounds whose mechanism of action comprises an inhibition of the interaction of HIV with cellular receptors present on the cell membrane (e.g. CCR5, CXCR4). As example, and with no limitation to existing and future new compounds, co-receptors inhibitors include TAK 779, AMD3 100, AMD8664, AMD070, SHC-C, SHC-D, AK602, TAK-220, UK-427,857, T22. 30 HIV budding/maturation inhibitors include those compounds whose mechanism of action comprises an inhibition of the viral budding/maturation. As example, and with no limitation to existing and future new compounds, HIV budding/maturation inhibitors include PA-457. 35 The term "chimeric" means a construct comprising nucleic acid material from different origin such as, for example, a combination of WT virus with a laboratory strain, a combination of WT sequences and subject-derived clinical isolate sequences.
WO 2007/065926 PCT/EP2006/069422 -17 Viruses A human immunodeficiency virus (HIV), as used herein refers to any HIV including laboratory strains, wild type strains, mutant strains and any biological sample 5 comprising at least one HIV virus, such as, for example, an HIV clinical isolate. HIV strains compatible with the present invention are any such strains that are capable of infecting mammals, particularly humans. Examples are HIV-1, HIV-2, and SIV. For reduction to practice of the present invention, an HIV virus refers to any sample 10 comprising at least one HIV virus. A sample may be obtained for example from an individual, from cell cultures, or generated using recombinant technology, or cloning. HIV strains compatible with the present invention are any such strains that are capable of infecting cell lines and humans. Viral strains used for obtaining a plasmid are 15 preferably HIV wild-type sequences, such as LAI, HXB2D for HIV subtye B studies. LAI, also known as IIIB, is a wild-type HIV strain. One particular clone thereof, this means one sequence, is HXB2D. This HXB2D sequence may be incorporated into a plasmid. Other clones of HIV from other subtypes or groups may also be used. 20 Instead of viral RNA, HIV DNA, e.g. proviral DNA, may be used for the methods described herein. In case RNA is used, reverse transcription into cDNA by a suitable reverse transcriptase is needed. The protocols describing the analysis of RNA are also amenable for DNA analysis. However, if a protocol starts from DNA, the person skilled in the art will know that no reverse transcription is needed. The primers 25 designed to amplify the RNA strand, also anneal to, and amplify DNA. Reverse transcription and amplification may be performed with a single set of primers. Suitably a hemi-nested and more suitably a nested approach may also be used to reverse transcribe and amplify the genetic material. 30 Amplicons derived from the target HIV virus The amplicons derived from the target HIV virus may be obtained from HIV- 1 clinical isolates, site directed mutants or viruses emerging from selection experiments. Any type of patient sample may be used to obtain the desired amplicons, such as, for example, serum, blood, and tissue. 35 Viral RNA may be isolated using known methods such as that described in Boom, R. et al. (J. Clin. Microbiol. 28(3): 495-503 (1990); incorporated herein by reference), or through other conventional methods such as the acid phenol method (e.g., the acid WO 2007/065926 PCT/EP2006/069422 -18 guanidinum-phenol- chloroform (AGPC) method), the guanidinium isothiocyanate procedure, thus employing the method of Chomczynski and Sacchi (Anal. Biochem. 162, 156-159 (1987)). Alternatively, a number of commercial methods such as the QIAAMP* viral RNA kit (Qiagen, Inc.) may be used to obtain viral RNA from bodily 5 fluids such as plasma, serum, or cell-free fluids. Viral RNA may also be isolated from a pelleted virus using Trizol (Gibco) as described by the manufacturer. Other commercial kits for the isolation of viral RNA include, without being limited to, Qiagen RNeasy Kit, Catrimox-14@ RNA Isolation Kit Ver.2.11 (TaKaRa), RNAgents Total RNA Isolation System (Promega), RNAzol, Tel-Test, Stratagene, Tri-Reagent 10 BD (Sigma), PUREscript Total RNA Isolation Kit (Gentra Systems, or Qiagen). DNA may be extracted from tissue using methods known by the skilled in the art such as the procedure described by Maniatis et al. (1982) which involves the preparation of a cell lysate followed by digestion with proteinase K, obtaining DNA purification by a 15 multi-step phenol extraction, ethanol precipitation and ribonuclease digestion. Optionally, available commercial methods may also be employed to obtain DNA from bodily fluids, such as QIAAMP* Blood kits for DNA isolation from blood and body fluids (Qiagen, Inc.). 20 Complementary DNA may be synthetised with Sensiscript RT (Qiagen). Nucleic acid may be amplified by techniques such as polymerase chain reaction (PCR), strand displacement amplification (SDA), rolling circle amplification (RCA), loop-mediated isothermal amplification (LAMP), transcription-mediated amplification (TMA), nucleic acid sequence based amplification (NASBA), self-sustained sequence replication 25 (3SR), transcription-based amplification (TAS), and ligase chain reaction (LCR). HIV DNA vectors The invention relates to tagged and non-tagged HIV DNA vectors. This viral DNA may be a proviral DNA, i.e. a pseudotype virus which is replication-competent, or other 30 types of vectors such as plasmids. In particular, the proviral DNA and vectors or plasmids have a deletion in their DNA sequence that corresponds at most with or overlaps with the flanking regions of the amplicon derived from the target HIV virus referred above. 35 In one embodiment, the present invention relates to tagged and non-tagged plasmids and to the use of said plasmids in the methods disclosed herein. The complete HIV sequence may be incorporated in the plasmid or only part(s) thereof, such as, for example, the plasmids used in the present invention lack the gag, pol, and env genes, WO 2007/065926 PCT/EP2006/069422 -19 portions thereof, and combinations thereof. The deletion may also comprise parts of flanking genes, or eventually more than one gene. A suitable plasmid backbone may be selected from the group including pUC, pBR322 and pGEM. 5 In one embodiment, each of the tagged HIV DNA vector and the non-tagged HIV DNA vector comprises the backbone of a wild-type or a mutant strain. In one embodiment, the plasmid DNA encompassed by the tagged and non-tagged HIV DNA vectors comprises the genome of the HXB2D wild-type strain. 10 A deletion construct containing the DNA of the present invention can be prepared, for example, by treating a longer DNA with appropriate restriction enzymes and purifying the digest with an appropriate purification method and then subjecting the thus obtained DNA fragment of interest to self-ligation. As such, the construction of the deletion 15 constructs of the present invention may be accomplished by digestion with restriction enzymes, such as Clal and BcII restriction enzymes, which cleave the plasmid backbone at specific sites and therefore remove the gag and protease sequences. Alternatively, before removal of the gag and protease sequences, a MunI or NheI site may be inserted into the plasmid by silent mutation, prior to digestion with MunI/BssH 20 II or NheI/BcII, respectively, and subsequent removal of gag and protease sequences. Unique restriction site refers to a single occurrence of a site on the nucleic acid that is recognized by a restriction enzyme, or that it does not occur anywhere else in the construct. The unique restriction site may be created after amplification by re-ligating 25 both 5' and 3' ends of the amplified plasmid's DNA. Alternatively, the unique restriction site may not have to be created, as it may be already fully located in one of the ends, 5' or 3' end. Optionally, the unique restriction site may be inserted. Optionally, part of the unique restriction site may be present in the region to be amplified. The creation of a unique restriction site deriving from amplification is a 30 preferred method since this is a one-step, direct, simple and fast method. The unique restriction site is further relevant for the production of recombinant virus. As one skilled in the art will understand, the creation of a unique restriction site will depend upon the sequence of the HIV genome, and upon the sequence to be deleted 35 therefrom. Unique restriction sites that can be employed in the present invention are those present only once in the HIV genome and may flank the region of interest to be deleted and that do not change the reading frame or the sequence of the protein coded by the nucleic acid sequence of interest. Optionally, the primers used for amplification WO 2007/065926 PCT/EP2006/069422 -20 may contain the same or other specific restriction endonuclease sites to facilitate insertion into a different vector. Additionally, one of the primers used for amplification may contain a phosphorylated 5' end-linker to facilitate insertion of a foreign amplicon. 5 Optionally, the method for obtaining a plasmid containing the WT HIV sequence with a deletion in the region that corresponds at most with or overlaps with the flanking regions of the amplicon to be recombined with, may be performed in a second cloning vector. For instance, the protease-reverse transcriptase region may be inserted into a cloning vector such as pGEM plasmid, for example the backbone of pGEM3 vector 10 may be used, and manipulated, by amplification, to remove part of the protease and/or reverse transcriptase-coding region such that insertion of the remaining protease reverse transcriptase sequence from the samples is performed in a way that would not disrupt the reading frame. The manipulated protease-reverse transcriptase region is then placed in a pGEM-HXB2D vector such that it contains the complete wild type 15 HIV sequence except for the relevant protease-reverse transcriptase deletion. An example of a protease-reverse transcriptase deletion vector is pGEM-HXB2DAPR RT, which has a deletion comprising the entire protease coding region and a large portion of the reverse transcriptase coding region. An example of a reverse 20 transcriptase deletion vector is pGEM-HXB2DART, which has a deletion of the reverse transcriptase coding region. Those of skill in the art will appreciate that other HIV vectors and cloning procedures known in the art may also be used to create deficient gag-PR-RT-int, gag-PR-RT, 25 gag-PR, gag, PR-RT-int, RT-int, int, PR-RT, PR, RT, or env plasmids for recombination or ligation with subject derived sequences and creation of infectious viruses. For instance, deletion constructs may be prepared by re-introducing portions of the gag-PR-RT-int, gag-PR-RT, gag-PR, gag, PR-RT-int, RT-int, int, PR-RT, PR, RT, or env genes into a plasmid wherein the gag-PR-RT-int, gag-PR-RT, gag-PR, gag, 30 PR-RT-int, RT-int, int, PR-RT, PR, RT, or env genes, respectively, have been previously deleted. Primers for amplifying the regions of interest, i.e. the portions to be re-introduced, are known to the skilled in the art. In general, vectors must be created to allow re-insertion of the deleted sequences without disrupting the reading frame of the gag-PR-RT-int, gag-PR-RT, gag-PR, gag, PR-RT-int, RT-int, int, PR-RT, PR, RT, and 35 env genes. The tagged HIV DNA vector may be obtained by introduction of one or more silent mutations into the plasmid constructs discussed above. Introduction of the silent WO 2007/065926 PCT/EP2006/069422 -21 mutations will be applied on those genes forming part of the plasmid, i.e. those genes which are not forming part of the amplicon derived from the target HIV virus. The one or more silent mutations may be incorporated in any of the HIV genes of the plasmid provided that the phenotype of the resulting recombinant virus remains unchanged. 5 In one embodiment, introduction of one or more silent mutations is performed in one of the HIV genes selected from gag, pol, env, tat, rev, nef, vif, vpr, and vpu. In another embodiment, introduction of the silent mutations is performed in the env or pol genes, in particular in the env region encoding the envelope protein, or in the pol region 10 encoding the integrase enzyme. In another embodiment, introduction of silent mutations is performed in the env gene, between codons 1 and 857, in particular between codons 100 and 800, more in particular between codons 200 and 600, yet more in particular between codons 300 and 500, for example between codons 400 and 500, for example between codons 430 and 490, particularly between codons 468 and 475. 15 In another embodiment, introduction of silent mutations is performed in the region of the pol gene encoding the integrase enzyme, between codons 1 and 288, in particular between codons 50 and 275, more in particular between codons 100 and 250, yet more in particular between codons 150 and 250, for example between codons 200 and 250, particularly between codons 230 and 231. 20 This introduction of silent mutations may be accomplished by using the QuickChange site-directed mutagenesis kit (Stratagene) and suitable mutagenic oligonucleotide primers for the region of interest. Site-directed mutagenesis allows the generation of point mutations, the switching of nucleotides and deletion or insertion of single or 25 multiple nucleotides, possibly with changes on the amino-acid level. For the scope of the present invention, site-directed mutagenesis is applied to insert silent mutations in the gene of interest. The basic procedure uses plasmid DNA and two oligonucleotide primers which are complementary to opposite strands of the plasmid and contain the desired mutation(s). These primers are extended during polymerase chain reaction 30 (PCR) which is followed by a digestion with the restriction enzyme DpnI, which is a specific endonuclease for methylated and hemimethylated DNA. During this digest the parental plasmid will be removed. The newly created plasmid with the desired mutation(s) can be used for transformation in E. coli. 35 In particular, suitable mutagenic oligonucleotide primers are the primers described herein below and their homologues, which are herein claimed. Primers with SEQ ID n' 1-2 are useful for the incorporation of silent mutations in the integrase encoding WO 2007/065926 PCT/EP2006/069422 -22 region of the pol gene and SEQ ID n' 3-4 are useful for the incorporation of silent mutations in the envelope gene of an HIV derived plasmid. Table 1: mutagenic oligonucleotide primers 5 SEQ. ID n' Primer sequence listed in 5' to 3' direction 1 (forward) TCGGGTTTAT TACAGGGACt cacGtAATCC ACTTTGGAAA GGACCAGC 2 (reverse) GCTGGTCCTT TCCAAAGTGG ATTaCgtgaG TCCCTGTAAT AAACCCGA 3 (forward) CCGAGATCTT CAGGCCCGGA GGAGGTGACA TGAGGGACAA TTG 4 (reverse) CAATTGTCCC TCATGTCACC TCCTCCGGGC CTGAAGATCT CGG Such primers are chosen from SEQ. ID N' 1-4 or have at least 80% homology, preferably 90% homology, more preferably 95% homology as determined using algorithms known to the person skilled in the art such as FASTA and BLAST. The 10 primer sequences listed herein may optionally be labeled. Suitably, this label may be detected using fluorescence, luminescence or absorbance. In addition primers located in a region of 50 nucleotides (nt) upstream or downstream from the sequences given herein constitute part of the present invention. Specifically, the primers may be located in a region of 20 nt upstream or downstream from the sequences given herein and, 15 constitute, as well, part of the present invention. Also, primers comprising at least 8 consecutive bases present in either of the primers described herein constitute an embodiment of the invention. Interestingly, the primers comprise at least 12 consecutive bases present in either of the primers described herein. In one aspect of the present invention the primers may contain linker regions for cloning. Optionally, the 20 linker region of a primer may contain a restriction enzyme recognition site. Preferably, said restriction enzyme recognition site is a unique restriction enzyme recognition site. Alternatively, primers may partially anneal to the target region. The presence of mutant sequences may be confirmed by DNA sequencing of the final 25 plasmid clone. The present invention provides HIV plasmid vectors comprising a tagged sequence; and a deletion of the gag, pol, or env genetic sequences, portions thereof, and WO 2007/065926 PCT/EP2006/069422 -23 combinations thereof; characterized in that the tagged sequence comprises one or more silent mutations in one of the genes selected from gag, pol, env, tat, rev, nef, vif, vpr, and vpu; and with the proviso that the one or more silent mutations are not located in the deleted genetic sequence. The present invention further provides HIV plasmid 5 vectors comprising a deletion of the gag, pol, or env genetic sequences, portions thereof, and combinations thereof; and no tagged sequence. Suitably, the HIV plasmid vector is derived from the HIV wild-type strain HXB2D (Ratner et al. (1987) AIDS Res. Hum. Retrovir. 3:57- 69]). Suitably, the tagged sequence is located in one or more of the genes selected from gag, pol, env, tat, rev, nef, vif, vpr, and vpu, preferably in 10 the env or pol genes, more preferably in the env region encoding the envelope protein, or in the pol region encoding the integrase enzyme. In one embodiment of the present invention, the tagged HIV plasmid vector comprises a tagged sequence in the env gene between codons 1 and 857, in particular between 15 codons 100 and 800, more in particular between codons 200 and 600, yet more in particular between codons 300 and 500, for example between codons 400 and 500, for example between codons 430 and 490, particularly between codons 468 and 475. These HIV plasmid vectors comprising a tagged sequence in the env gene are claimed. 20 In another embodiment of the present invention, the tagged HIV plasmid vector comprises a tagged sequence in the region of the pol gene encoding the integrase enzyme between codons 1 and 288, in particular between codons 50 and 275, more in particular between codons 100 and 250, yet more in particular between codons 150 and 250, for example between codons 200 and 250, particularly between codons 230 and 25 231. These HIV plasmid vectors comprising a tagged sequence in the integrase encoding region of the pol gene are claimed. In particular, the present invention provides the tagged HIV DNA vectors pGEM-HIVdelGPRTtagged(env) (accession number LMBP 5112, SEQ ID N' 28), 30 and pGEM-HIVdelGPRTtagged(int) (accession number LMBP 5113, SEQ ID N' 29), which have been deposited at the Belgian Coordinated Collections of Micro-Organisms located at the Universiteit Gent - Plasmidecollectie vakgroep moleculaire biologic on December 2 0 th, 2005. 35 Generation of tagged and non-tagged recombinant infectious viruses Recombinant tagged and non-tagged infectious viruses may be generated by transfection of each of the tagged or non-tagged HIV DNA vectors together with the coding fragments of interest, i.e. the amplicons derived from the target HIV virus, into WO 2007/065926 PCT/EP2006/069422 -24 cells followed by passage of cell-free viral supernatants in cells. Transfection may be achieved by electroporation, ligation, lipofection or any other method. To prepare recombinant HIV viruses, the amplified sequences of gag-PR-RT-int, 5 gag-PR-RT, gag-PR, gag, PR-RT-int, RT-int, int, PR-RT, PR, RT, env, or portions thereof, are incorporated into a tagged or non-tagged HIV DNA vector comprising the HIV wild-type or a mutant strain thereof with a deletion of the portion corresponding at most to the amplicon. An infectious clone is generated upon exchange of genetic material between the amplicon and the deletion construct to yield an HIV sequence. 10 The amplicons derived from the target HIV virus may be incorporated into the appropriate HIV DNA vector by homologous recombination in a suitable host cell between overlapping DNA segments of the vector and the amplicon sequence. Alternatively, the amplicons derived from the target HIV virus can be incorporated into 15 the vector at a unique restriction site according to cloning procedures standard in the art. The latter is a direct cloning strategy. Suitable for direct cloning strategies are two different restriction sites that are used to facilitate ligation of the amplicon in the appropriate orientation. 20 Recombinant virus stocks may be stored for future analysis, such as for example, viability testing. Cell culture The cells may be chosen from T cells, monocytes, macrophages, dendritic cells, 25 Langerhans cells, hematopoietic stem cells, peripheral blood mononuclear cells (PBMC) or, precursor cells, human T-lymphoblastoid cell lines, MT4, MT2, CEM, and PM-I cells. Suitable host cells for homologous recombination of HIV sequences include MT4 and PM-i. MT4 is a CD4+ T-cell line containing the CXCR4 co-receptor. The PM-I cell line expresses both the CXCR4 and CCR5 co-receptors. All the above 30 mentioned cells are capable of producing new infectious virus particles upon recombination of the HIV DNA vectors with the amplicons derived from the target HIV virus. In a cell culture, the cells are usually maintained in a protein-rich medium, such as 35 RPM11640 supplemented with fetal calf serum at 10%, L-glutamine (2mM), and antibiotics such as penicillin, and streptomycin. Interestingly, prior to HIV infection, PBMC cells may be stimulated with phytohemagglutinin for some days and maintained WO 2007/065926 PCT/EP2006/069422 -25 in R-20 medium (RPMI 1640 supplemented with fetal calf serum 20%), L-glutamine, HEPES buffer, recombinant human interleukin-2; penicillin, and streptomycin. Growth competition assay 5 Recombinant tagged and non-tagged viruses are then mixed together at different ratios, such as 0/100, 25/75, 50/50, 75/25, 100/0. Other ratios may be 0/100, 20/80, 40/60, 60/40, 80/20, 100/0. If more than two virus are tested, for example three, the ratios may be for instance 0/0/100, 0/33/66, 33/66/0. The mixed viral sample is used to infect cells suspended in the absence or presence of antiviral drugs or any other 10 environmental components, as described herein. Thus cells usually suspended in medium are inoculated with infectious doses of the recombinant tagged and/or non-tagged viruses. The viral titer is determined (expressed as multiplicity of infection, MOI) and adapted to a suitable range, preferably between 0.000 1 and 0.01, more preferably around 0.001 infectious viral units/cell. 15 In one embodiment of the present invention the tagged recombinant infectious virus comprising a tagged HIV DNA vector and a first target amplicon derived from a first target HIV virus, is mixed with a non-tagged recombinant infectious virus comprising a non-tagged HIV DNA vector and a second target amplicon derived from a second 20 target HIV virus. These virus are mixed in a cell culture in a given environment, and the replicative capacities of the tagged and non-tagged recombinant viruses in said environment are determined by quantitative amplification. Cells are incubated, washed, resuspended, reincubated, all the foregoing as needed. 25 Supernatants are harvested at different time points, for example on days 1, 4, 7, 10, and 14. Starting from a certain day, for instance the fourth day after initial incubation, cultures are passaged and after incubation, washing, resuspension, and reincubation, viral RNA is extracted from culture supernatants at specific time points, e.g. on days 1, 4, 7, 10, 14, or any other day. Viral RNA extraction may be accomplished according to 30 several techniques known in the art, for example by using the Qiagen RNA kit. Alternatively, cells are grown with the recombinant infectious viruses and at specific time points, cells are collected and genomic DNA extraction is performed. Genomic DNA extraction may be accomplished according to several techniques known in the art, for example by using the kit Invisorb DNA cell HTS 96 kit/V for purification of 35 genomic DNA from Invitek. The proportion of tagged recombinant virus versus non-tagged recombinant virus in the population is determined by quantitative amplification.
WO 2007/065926 PCT/EP2006/069422 -26 Quantitative amplification Quantitative amplification provides the data required for the direct quantification of the virus whose replicative capacity is to be determined. During quantitative amplification, 5 the tagged and corresponding non-tagged regions of the recombinant virus extracted from the cell cultures or supernatants as described above, are amplified and detected, usually simultaneously. Optionally, a house-keeping gene may be used as an internal control. 10 The results can be expressed in absolute terms by reference to external quantified standards, i.e. in number of proviral DNA copies / amount of cells, or in relative terms compared to an overall viral population or another HIV virus present within the sample. Techniques for the amplification of nucleic acid sequences are known in the art. These 15 include techniques mediated by a DNA polymerase, such as the polymerase chain reaction ("PCR") (see, for example, U.S. Patent No. 4,683,202; U.S. Patent No. 4,683,195; U.S. Patent No. 4,000,159; U.S. Patent No. 4,965,188; U.S. Patent No. 5,176,995) (Saiki et al., 1985; Chehab et al., 1987), strand displacement amplification ("SDA") (Walker et al., 1992), rolling circle amplification ("RCA") (Lizardi et al., 20 1998), reverse transcription polymerase chain reaction (RT-PCR) and loop-mediated isothermal amplification ("LAMP") (Notomi et al., 2000; Nagamine et al., 2002). Other target amplification techniques are mediated by an RNA polymerase, for example, transcription-mediated amplification ("TMA") (Jonas et al., 1993), self-sustained sequence replication ("3SR") (Fahy et al., 1991) and nucleic acid 25 sequence replication based amplification ("NASBA") (Compton, 1991). The amplification products ("amplicons") produced by PCR, RT-PCR, SDA, RCA and LAMP are composed of DNA, whereas RNA amplicons are produced by TMA, 3SR and NASBA. 30 One known quantitative amplification technique is real time PCR. The polymerase chain reaction (PCR) is described in patents nos. US4683195 and US4683202. The term "real time PCR" as used herein means that a signal emitted from the PCR assay is monitored during the reaction as an indicator of amplicon production during 35 each PCR amplification cycle, i.e. in "real time", as opposed to conventional PCR methods, in which an assay signal is detected at the endpoint of the PCR reaction. Real time PCR is generally based on the detection and quantitation of a fluorescent reporter. The signal increases in direct proportion to the amount of PCR product in a reaction.
WO 2007/065926 PCT/EP2006/069422 -27 By recording the amount of fluorescence emission at each cycle, it is possible to monitor the PCR reaction during exponential phase where the first significant increase in the amount of PCR product correlates to the initial amount of target template. For a general description of "real time PCR" see Dehee et al. J. Virol. Meth. 102:37-51 5 (2002); and Aldea et al. J. Clin. Microbiol. 40:1060-1062 (2002) (referring to the "LightCycler," where real-time, kinetic quantification allows measurements to be made during the log-linear phase of a PCR). In one embodiment of the present invention, the sequence of the HIV tagged 10 recombinant virus that is quantitatively amplified comprises one or more silent mutations in one of the HIV genes selected from gag, pol, env, tat, rev, nef, vif, vpr, and vpu. In one embodiment of the present invention, the sequence of the HIV non-tagged recombinant virus that is quantitatively amplified does not comprise the one or more silent mutations of the HIV tagged recombinant virus referred in the sentence 15 above, i.e. it lacks all of the one or more silent mutations of the HIV genes selected from gag, pol, env, tat, rev, nef, vif, vpr, and vpu. In another embodiment of the present invention, the sequence of the HIV tagged recombinant virus that is quantitatively amplified comprises one or more silent 20 mutations in the env gene or in the integrase encoding region of the pol gene. In another embodiment of the present invention, the sequence of the HIV non-tagged recombinant virus that is quantitatively amplified does not comprise the one or more silent mutations of the HIV tagged recombinant virus referred in the sentence above, i.e. it lacks all of the one or more silent mutations in the env gene or in the integrase 25 encoding region of the pol gene. In one embodiment, the forward and reverse primers specific for quantitative amplification of tagged and non-tagged recombinant infectious virus include SEQ. ID n' 5-12. SEQ. ID n' 5 is the forward primer which extends the tagged envelope gene, 30 i.e. the envelope gene comprising one or more silent mutations. SEQ. ID n' 6 is the reverse primer which extends both the tagged envelope gene, and WT envelope gene. SEQ. ID n' 7 is the forward primer which extends the WT envelope gene. SEQ. ID n' 8-9 are the forward and reverse primers which extend the housekeeping or control gene. SEQ. ID n' 10 is the forward primer which extends both the tagged integrase 35 encoding sequence, i.e. the integrase encoding sequence comprising one or more silent mutations, and WT integrase encoding sequence. SEQ. ID n' 11 is the reverse primer which extends the tagged integrase encoding sequence. SEQ. ID n' 12 is the reverse primer which extends the WT integrase encoding sequence.
WO 2007/065926 PCT/EP2006/069422 -28 Additional sequences may be appended to the forward primers to allow real time PCR monitoring. Such sequences can include, but are not limited to, fluorogenic probes for LUXTM detection, anti-sense DNAzyme sequences for zymogene detection, and 5 Scorpion probe sequences. Optionally, the appended sequences for real time monitoring may be attached to the reverse primers. Table 2: primers specific for quantitative amplification of tagged and non-tagged recombinant infectious virus 10 SEQ. ID n' Primer sequence listed in 5' to 3' useful for amplifying direction 5 (forward) ATGTCACCTCCTCCGGGC tagged env gene 6 (reverse) CAGGAATGCTTGCTGCTG tagged & WT env gene 7 (forward) ATATCTCCTCCTCCAGGT WT env gene 8 (forward) ACAGGCAACTTGGCAAATCAAA housekeeping gene 9 (reverse) TGCAGAATAAAACAAATTATAAA housekeeping gene 10 (forward) CAGCAGTACAAATGGCAGTATTCA tagged & WT integrase encoding gene 11 (reverse) TCCTTTCCAAAGTGGATTACGTG tagged integrase encoding gene 12 (reverse) TTTCCAAAGTGGATTTCTGCTG WT integrase-encoding gene In a further embodiment, the forward and reverse primers specific for quantitative amplification of tagged and non-tagged recombinant infectious virus include SEQ. ID n' 19-20, and 24-25. SEQ. ID n' 19 is the forward primer which extends both the 15 tagged envelope gene, and the WT envelope gene. SEQ. ID n' 20 is the reverse primer which extends both the tagged envelope gene, and the WT envelope gene. SEQ. ID n' 24 is the forward primer which extends the human genomic RPLPO gene. SEQ. ID n' 25 is the reverse primer which extends the human genomic RPLPO gene. 20 Table 3: primers specific for quantitative amplification of tagged and non-tagged recombinant infectious virus SEQ. ID n' Primer sequence listed in 5' to 3' useful for amplifying direction WO 2007/065926 PCT/EP2006/069422 -29 19 (forward) ATTAACAAGAGATGGTGGTA tagged & WT env gene A 20 (reverse) GTGCTACTCCTAATGGTTCAA tagged & WT env gene 24 (forward) CATTCTATCATCAACGGGTA human genomic RPLPO gene 25 (reverse) CAAAGGCAGATGGATCAG human genomic RPLPO gene The primers described herein above and their homologues are claimed. Such primers are chosen from SEQ. ID N' 5-12, 19-20, and 24-25, or have at least 80% homology, preferably 90% homology, more preferably 95% homology as determined using 5 algorithms known to the person skilled in the art such as FASTA and BLAST. The primer sequences listed herein may optionally be labeled. Suitably, this label may be detected using fluorescence, luminescence or absorbance. In addition primers located in a region of 50 nucleotides (nt) upstream or downstream from the sequences given herein constitute part of the present invention. Specifically, the primers may be located 10 in a region of 20 nt upstream or downstream from the sequences given herein and, constitute, as well, part of the present invention. Also, primers comprising at least 8 consecutive bases present in either of the primers described herein constitute an embodiment of the invention. Interestingly, the primers comprise at least 12 consecutive bases present in either of the primers described herein. In one aspect of the 15 present invention the primers may contain linker regions for cloning. Optionally, the linker region of a primer may contain a restriction enzyme recognition site. Preferably, said restriction enzyme recognition site is a unique restriction enzyme recognition site. Alternatively, primers may partially anneal to the target region. 20 Methods for real time PCR use fluorescent primers or probes such as LUXTM fluorogenic primers, probes cleavable by DNAzymes or MNAzymes, TaqMan@ probes, molecular beacons, scorpions, or any other FRET probes. In one embodiment of the present invention, the quantitative amplification employs MNAzymes capable of cleaving fluorescent probes. 25 In the method according to the invention, the quantitative amplification may be performed by polymerase chain reaction, strand displacement amplification, or transcription-mediated amplification, employing LUXTM fluorogenic primers, TaqMan@ probes, molecular beacons, scorpions, DNAzymes, MNAzymes, or any 30 other primers coupled to FRET probes. In one embodiment, the quantitative amplification is performed by polymerase chain reaction and employing MNAzymes, WO 2007/065926 PCT/EP2006/069422 -30 i.e. employing primers in the vicinity of MNAzymes, and probes that are cleaved by the MNAzymes.
LUX
T M primers are oligonucleotides labeled with a single fluorophore. Typically 5 20-30 bases in length, they are designed with a fluorophore close to the 3' end in a hairpin structure. This configuration intrinsically renders fluorescence quenching capability; no separate quenching moiety is needed. When the primer becomes incorporated into double-stranded PCR product, the fluorophore is dequenched, resulting in a significant increase in fluorescent signal. 10 The TaqMan@ probes (Heid et al., 1996) use the fluorogenic 5' exonuclease activity of Taq polymerase to measure the amount of target sequences in cDNA samples. TaqMan@ probes are oligonucleotides that contain a fluorescent dye usually at or near the 5' base, and a quenching moiety typically at or near the 3' base. The quencher 15 moiety may be a dye such as TAMRA or may be a non-fluorescent molecule such as 4-(4-dimethylaminophenylazo)benzoic acid (DABCYL). When irradiated, the excited fluorescent dye transfers energy to the nearby quenching dye molecule rather than fluorescing (this is called FRET=F6rster or fluorescence resonance energy transfer). Thus, the close proximity of the reporter and quencher prevents emission of any 20 fluorescence while the probe is intact. TaqMan@ probes are designed to anneal to an internal region of a PCR product. When the polymerase replicates a template on which a TaqMan@ probe is bound, its 5' exonuclease activity cleaves the probe. This ends the activity of quencher (no FRET) and the reporter dye starts to emit fluorescence which increases in each cycle proportional to the rate of probe cleavage. Accumulation 25 of PCR products is detected by monitoring the increase in fluorescence of the reporter dye (note that primers are not labeled). TaqMan@ assay uses universal thermal cycling parameters and PCR reaction conditions. Because the cleavage occurs only if the probe hybridizes to the target, the fluorescence detected originates from specific amplification. The process of hybridization and cleavage does not interfere with the 30 exponential accumulation of the product. One specific requirement for fluorogenic probes is that there be no G at the 5' end. A "G" adjacent to the reporter dye quenches reporter fluorescence even after cleavage. Molecular beacons are probes for the identification of specific nucleotide sequences 35 present within cells (Tyagi et al., (1998) Nature Biotechnology 16:49-53). The molecular beacon can be composed of nucleic acid only such as DNA or RNA, or it can be composed of a peptide nucleic acid (PNA) conjugate. Binding of the molecular beacon to specific nucleotide sequences allows for the identification of the presence of WO 2007/065926 PCT/EP2006/069422 -31 those sequences either in vitro or in vivo. A molecular beacon includes a conjugate (e.g., a structure such as a quantum dot-tagged bead), a probe, a fluorophore, and a quenching moiety. The probe is a single-stranded oligonucleotide comprising a stem and loop structure wherein a hydrophilic attachment group is attached to one end of the 5 single- stranded oligonucleotide and the quenching moiety is attached to the other end of the single-stranded oligonucleotide. The fluorophore can be any fluorescent organic dye or a single quantum dot such that its emission does not overlap with that of the quantum dot-tagged bead. The quenching moiety desirably quenches the luminescence of the fluorophore. Any suitable quenching moiety that quenches the luminescence of 10 the fluorophore can be used in the conjugate described above. Scorpions are bi-functional molecules containing a PCR primer covalently linked to a probe. The fluorophore in the probe interacts with a quencher which reduces fluorescence. During a PCR reaction the fluorophore and quencher are separated which 15 leads to an increase in light output from the reaction tube. Scorpions are described more fully in Whitcombe, D., Theaker J., Guy, S.P., Brown, T., Little, S. (1999) Detection of PCR products using self-probing amplicons and fluorescence. Nature Biotech 17, 804-807, and are protected under patent EP1088102. 20 A DNAzyme (Santoro, S. and Joyce, G., 1997, A general purpose RNA cleaving DNA enzyme. Proc Natl Acad Sci U S A. 94: 4262-4266. Reviewed Emilsson, G.M. and Breaker, R.R., 2002, Deoxyribozymes: new activities and new applications. Cell. Mol. Life Sci. 59, 596-607) is a catalytically active oligonucleotide that can, for example, cleave nucleic acid substrates at specific phosphodiester bonds. The DNAzyme 25 consists of a catalytic domain flanked by two substrate recognition domains. It observes standard Watson-Crick base-pairing rules and must hybridize with its substrate to properly catalyze the cleavage. DNAzymes can be used in combination with in vitro amplification techniques, for example PCR, as a means of generating a detectable signal, thus allowing real time monitoring of amplified nucleic acid target 30 sequences (US 6,140,055). The DNAzymes are introduced into the amplicons by using primers with 5' tags that are inactive, anti-sense sequences of DNAzymes. When these sequences are copied during in vitro amplification the catalytically active sense DNAzyme sequences are co-amplified along with target sequence. This results in amplicons that function as DNAzymes capable of cleaving a reporter substrate. The 35 essential reagents include one gene-specific primer conjoined to the inactive, antisense strand of the DNAzyme; and a second gene-specific primer. In an embodiment of the present invention, the 5' and 3' primers are specific for the target amplicons.
WO 2007/065926 PCT/EP2006/069422 -32 In addition to the DNAzyme, there is a DNAzyme-specific fluorogenic substrate. This universal probe consists of a short nucleic acid segment tagged with a fluorophore at one end and a Black Hole QuencherTM dye (BHQ) at the other. The DNAzyme substrate ultimately serves as a measure of DNA copy number. With each round of 5 amplification, the number of active DNAzymes increases in direct proportion to the DNA copy number. The exponential increase in DNAzyme activity leads to a corresponding increase in fluorescence, allowing the monitoring of DNA amplification in real time. In a preferred embodiment, the method starts with many copies of target DNA, because fewer cycles will be needed to reach a threshold level of detection, 10 usually represented by the "Ct" value. The fluorophores present in the DNAzyme specific fluorogenic substrate include FAM, CAL Fluor Orange
TM
, JOE, and TAMRA dyes amongst other. They emit strongly in their excited states but only weakly in their quenched states. 15 INAzymes (patent application PCT/AU2006/001473 by Johnson & Johnson Research Pty Limited, Australia) are catalytic nucleic acids based on DNAzymes. INAzymes consist of two or more oligonucleotide sequences (e.g. partzymes) which, only in the presence of a MNAzyme assembly facilitator molecule (in this patent, the tagged or corresponding non-tagged region which is quantitatively amplified), form an active 20 nucleic acid enzyme that is capable of catalytically modifying a substrate, for example a reporter substrate. An exemplary INAzyme comprising partzyme A and partzyme B is depicted in Figure 12. With reference to Figure 12, DNA partzymes A and B each bind to a target, i.e. the INAzyme assembly facilitator molecule (e.g., through Watson-Crick base pairing with a nucleic acid target). The MNAzyme only forms 25 when the sensor arms of partzymes A and B hybridize adjacent to each other on the target. The substrate arms of the INAzyme engage the reporter substrate, the cleavage of which is catalyzed by the catalytic core of the MNAzyme, formed by the interaction of the catalytic domains of partzymes A and B. The INAzyme cleaves the substrate between a fluorophore and a quencher dye pair, thus generating signal. Cleavage of a 30 DNA/RNA chimera (reporter substrate) is exemplified in the drawing. The term "MNAzyme" is also referred to as "multi-component nucleic acid enzyme". An INAzyme may also comprise a stabilizing oligonucleotide which provides stability of the MNAzyme by interacting with an assembly facilitator or substrate. It is apparent that formation of an INAzyme requires the assembly of at least the partzyme 35 components with the target (or assembly facilitator), as well as the binding of a reporter substrate, for catalytic activity to be detectable, and that the absence of any of these components will result in a lack of catalytic activity.
WO 2007/065926 PCT/EP2006/069422 -33 The reporter substrate used with the MNAzymes can be labeled by any of a large variety of means including, for example, fluorophores (with or without one or more additional components, such as quenchers), radioactive labels, labeling with biotin (e.g. biotinylation) or chemiluminescent labels. Reporter substrates for catalytic nucleic 5 acids may also include protein or nucleic acid enzymes, for example, covalently attached to their termini. The reporter substrates used with the MNAzymes may be generic reporter substrate systems, which allow rapid assay development by allowing facile design changes to 10 create new MNAzymes which recognize different targets. The substrate arm portion and the catalytic core portion of the partzymes may remain unchanged, with changes only to the sensor arm portion of one or more partzymes required for new targets. Generic substrate sequences are provided and the same substrate can therefore be incorporated in assays for many different targets. Further, the same substrate can be 15 incorporated into the methods in various embodiments herein, including assays where the substrate is free in solution or is tethered or attached to a support. A series of generic substrates can be used in a multiplex reaction allowing simultaneous detection of multiple targets. MNAzyme strategies using generic substrates offer a major advantage over technologies such as TaqMan@ or Beacons which require the design 20 and use of probes specific for each new target. As described in more detail below, MNAzymes have an advantageous property in certain embodiments of being able to utilize a universal or generic reporter substrate. Such a substrate is shown in Figure 12 in a presently preferred configuration wherein 25 the reporter substrate comprises both a detectable portion and a quencher portion. The quencher portion is adapted to diminish or eliminate a detectable signal from the detectable portion of the substrate until the substrate is cleaved by the MNAzyme. For example, the quencher portion may comprise "Black Hole Quencher 1" (BHQ1) or "Black Hole Quencher 2" (BHQ2). Thus, the MNAzyme cleaves the reporter substrate 30 between the detectable portion and the quencher portion allowing the two portions to separate in solution, thereby allowing the detectable signal to appear or increase as the quencher portion is distanced from, or effectively removed from the local environment of the detectable portion. 35 The use of the generic or universal reporter substrate is enabled through the design of the MNAzyme's component partzymes. By altering only the sensor arms of the partzymes, but by leaving the substrate arms unchanged, a large variety of MNAzymes specific for each of a plurality of targets can be designed all of which utilize a universal WO 2007/065926 PCT/EP2006/069422 -34 reporter substrate for detection. The skilled artisan will appreciate the advantages that this offers in terms of eliminating the need for customized or unique substrates for each target. Each new target requires only one or more changes in one or more of the sensor arm portions; the substrate arm portion and the catalytic core portion can remain 5 constant. Thus, a single reporter substrate can be used for a single target using an MNAzyme, and multiple targets in a series of assays using altered MNAzymes. A plurality of reporter substrates allows multiplexing to detect multiple targets in a single assay using multiple MNAzymes, one for each target. Such multiplexed methods of using INAzymes are readily accomplished in solution or with attachment to a support 10 system. It is contemplated herein that multiplexed assays can thus be accomplished in systems involving attaching one or more of the reporter substrate, or the MNAzyme partzymes or assembly facilitator, or additional enzyme activities, to a support as described herein. 15 Substrates can be modified by an MNAzyme thereby providing a detectable effect. In the detection process, the reporter substrate modification by an MNAzyme may involve, for example, cleavage, ligation, porphyrin metallation, formation of carbon-carbon bonds, ester bonds or amide bonds. As a consequence of the reporter substrate modification by an INAzyme, a detectable effect is generated and the 20 magnitude of the effect may therefore be indicative of the quantity of the target sought to be measured. The detectable effect may be detected by a variety of methods, including fluorescence spectroscopy, surface plasmon resonance, mass spectroscopy, NMR, electron spin resonance, polarization fluorescence spectroscopy, circular dichroism, immunoassay, chromatography, radiometry, photometry, scintigraphy, 25 electronic methods, UV, visible light or infra red spectroscopy, enzymatic methods or any combination thereof. In one embodiment, the reporter substrates are SEQ ID n' 17-18, which are each labeled with a different fluorophore. The substrate with SEQ ID n' 17 is end-labeled 30 with a 6-FAM moiety at the 5' end and a BHQ moiety at the 3' end and is designated SubBi-6-FB. This substrate SEQ ID n' 17 is useful to follow the accumulation of non-tagged wild type HXB2D WT amplicons and the cleavage of this substrate may be monitored at 516 nm with excitation at 492 nm. The substrate with SEQ ID n' 18 is end-labeled with a 6-JOE moiety at the 5' end and a BHQ1 moiety at the 3' end and is 35 designated SubBi-2-JB. This substrate SEQ ID n' 18 is useful to follow the accumulation of tagged HXB2D amplicons and the cleavage of this substrate may be monitored at 555 nm with excitation at 535 nm.
WO 2007/065926 PCT/EP2006/069422 -35 In Table 4, these substrates are listed. The lower case bases represent RNA and the upper case bases represent DNA. Table 4: reporter substrates sequences 5 SEQ. Substrate sequences listed in 5' to 3' name ID n' direction 17 ATCACGCCTCguTCCTCCCAG SubBi-6-FB 18 AAGGTTTCCTCguCCCTGGGCA SubBi-2-JB In a further embodiment, the reporter substrates are SEQ ID n' 17-18 and 23, three different reporter substrates, which are each labeled with a different fluorophore. The substrate with SEQ ID n' 17 is end-labeled with a 6-FAM moiety at the 5' end and a 10 BHQ moiety at the 3' end and is designated SubBi-6-FB. The substrate SEQ ID n' 17 is useful to follow the accumulation of non-tagged wild type HXB2D WT amplicons and the cleavage of this substrate may be monitored at 516 nm with excitation at 492 nm. The substrate with SEQ ID n' 18 is end-labeled with a 6-JOE moiety at the 5' end and a BHQ1 moiety at the 3' end and is designated SubBi-2-JB. This substrate SEQ ID 15 n' 18 is useful to follow the accumulation of tagged HXB2D amplicons and the cleavage of this substrate may be monitored at 555 nm with excitation at 535 nm. The substrate with SEQ ID n' 23 is end-labeled with a Quasar 670 moiety at the 5' end and a BHQ2 moiety at the 3' end and is designated SubBi-3-Q6B2. Alternatively, the substrate with SEQ ID n' 23 may be end-labeled with a TAMRA moiety at the 5' end 20 and a BHQ2 moiety at the 3' end. This substrate SEQ ID n' 23 is useful to monitor the accumulation of RPLPO amplicons and the cleavage of this substrate may be monitored at 665 nm with excitation at 635 nm. The sequences of the three substrates are listed in Table 5. The lower case bases represent RNA and the upper case bases represent DNA. 25 Table 5: reporter substrates sequences SEQ. Substrate sequence listed in 5' to 3' Name ID n' direction 17 ATCACGCCTCguTCCTCCCAG SubBi-6-FB 18 AAGGTTTCCTCguCCCTGGGCA SubBi-2-JB 23 CAGCACAACCguCACCAACCG SubBi-3-Q6B2 WO 2007/065926 PCT/EP2006/069422 -36 In one embodiment of the present invention, the MNAzyme structures are based on DNAzymes including the 10:23 and 8:17 DNAzymes. In various embodiments the MNAzymes comprise either or both ribonucleotide bases and deoxyribonucleotide bases. In more preferred embodiments, an MNAzyme structure is based at least in part 5 on the structure of a DNAzyme. In other preferred embodiments, MNAzymes comprise at least some deoxyribonucleotide bases or analogues thereof. In more preferred embodiments, the catalytic core of an INAzyme comprises one or more deoxyribonucleotide bases or analogues thereof. In still more preferred embodiments, one or more deoxyribonucleotide bases or analogues thereof are involved in the 10 catalysis of a substrate. In other embodiments, at least one deoxyribonucleotide base, or its analogue, in the catalytic core improves catalytic activity. In yet other embodiments, there is a strict requirement for at least one deoxyribonucleotide base, or its analogue, in the catalytic core of the MNAzyme for catalysis to occur at a measurable rate, relative to that of a comparable INAzyme without the 15 deoxyribonucleotide base present. MNAzymes may contain one or more substitutions such as analogues, derivatives, modified or altered bases, ribonucleotides, alterations of the sugar or phosphate backbone, various deletions, insertions, substitutions, duplications or other 20 modifications, or any combination of these, well known to those skilled in the art. Such modifications, substitutions, deletions, insertions, etc may be made in the sensor and/or substrate arms and/or in the catalytic core portions such that the molecule retains catalytic activity. Substitutions and modifications to arms that bind the substrate or assembly facilitator may be well tolerated and in fact are the basis of allowing tailoring 25 of the molecules to different substrates/assembly facilitators. For example, modification of the sensor arms will allow tailoring to different assembly facilitators, while modification of the substrate arms will allow tailoring to different substrates. The skilled artisan will appreciate that MNAzymes comprise either 30 deoxyribonucleotides or ribonucleotides, or even both. Those MNAzymes comprising at least one and more preferably, all, deoxyribonucleotide component oligonucleotides are presently preferred. Also preferred are those MNAzymes comprising at least one deoxyribonucleotide base, or its analogue, within the catalytic core of the MNAzyme. Even more preferred are those embodiments where such a base is required for catalytic 35 activity. A basic example of a MNAzyme structure is depicted in Figure 12. The structure shown comprises partzyme A and partzyme B which have base-paired with an WO 2007/065926 PCT/EP2006/069422 -37 MNAzyme assembly facilitator molecule, shown here simply as Target. Partzymes A and B by interacting with Target, have allowed the catalytic core to come into close proximity and thereby form. The substrate arms of the MNAzyme have interacted with and base-paired with a substrate, here Reporter Substrate. Thus the MNAzyme has 5 self-assembled and this process is facilitated through the presence of the MNAzyme assembly facilitator molecule Target. In the absence of Target, no MNAzyme will form. Modification (in this case, cleavage) of the substrate is catalyzed by the catalytic core of the MNAzyme at the MNAzyme Cleavage Site within the substrate denoted by the vertical arrow. The substrate in this particular embodiment of the invention 10 comprises a detectable portion having a detectable signal, for example fluorophore F, and a quencher portion having a quenching effect on the detectable signal F through the action of quencher Q. Upon cleavage at the MNAzyme Cleavage Site, there is a substantial increase in detectable signal, here fluorescence, which is readily detected or quantified. 15 More specifically, the partzyme A and partzyme B, shown in Figure 12, each comprise a substrate arm portion, a catalytic core portion, and a sensor arm portion. In the presence of a target, the sensor arm portions of partzyme A and partzyme B can begin to hybridize to, and base pair with complementary portions of the target, for example a 20 DNA or RNA sequence. Upon contacting the target in this fashion, the MNAzyme self-assembles forming a catalytic core which can modify a substrate which is bound by the substrate arms. Preferably the presence of the MNAzyme is detected through the detection or measurement of its catalytic activity. The substrate arms of the thus assembled MNAzyme can engage a substrate, for example the reporter substrate shown 25 in Figure 12, through the interaction of the complementary sequences on the substrate arms and the substrate. Once the substrate is so engaged with the substrate arms, the catalytic core can promote the modification (eg. cleavage) of the substrate, which can in turn be measured or detected, directly or indirectly. 30 In one embodiment, the invention provides partzymes designed to detect two different target amplicons, namely those amplified from the non-tagged wild type HXB2D WT, and those amplified from the HXB2D-tagged sequences. In the following sequences the bases underlined form part of the catalytic core of the assembled MNAzyme, bases in bold hybridize with the target and bases in italics hybridize to the substrate. The P at 35 the 3' end of the sequence indicates a 3' phosphate group. Table 6: partzymes for the detection of two different target amplicons: the amplified non-tagged HXB2D WT sequences, and the amplified HXB2D-tagged sequences WO 2007/065926 PCT/EP2006/069422 -38 SEQ. Partzyme sequences listed in 5' to 3' name ID n' direction 13 ATATCTCCTCCTCCAGGTACAACG Partzyme A HXB2D (wild type) AGAGGCGTGAT-P WTA4/6-P 14 CTGGGAGGAAGGCTAGCTCTGAAGA Partzyme B HXB2D (wild type) TCTCGGACTCATT-P WTB5/6-P 15 CTTCTCCAATTGTCCCTCATACAA Partzyme A HXB2D (tagged) CGAGA GGAAA CCTT-P TgA4/2-P 16 TGCCCAGGGAGGCTAGCTGTCACCT Partzyme B HXB2D (tagged) CCTCCGGG-P TgB5/2-P In a further embodiment, the invention provides partzymes designed to detect three different target amplicons, namely those amplified from the non-tagged wild type 5 HXB2D WT sequences, those amplified from the HXB2D-tagged sequences and those amplified from the RPLPO gene. In the following sequences the bases underlined form part of the catalytic core of the assembled MNAzyme, bases in bold hybridize with the target and bases in italics hybridize to the substrate. The P at the 3' end of the sequence indicates a 3' phosphate group. 10 Table 7: partzymes for the detection of three different target amplicons: the amplified non-tagged HXB2D WT sequences, the amplified HXB2D-tagged sequences, and the amplified RPLPO sequences SEQ. Partzyme sequences listed in 5' to 3' name ID n' direction 13 ATATCTCCTCCTCCAGGTACAACG Partzyme A HXB2D (wild type) AGAGGCGTGAT-P WTA4/6-P 14 CTGGGAGGAAGGCTAGCTCTGAAGA Partzyme B HXB2D (wild type) TCTCGGACTCATT-P WTB5/6-P 15 CTTCTCCAATTGTCCCTCATACAA Partzyme A HXB2D (tagged) CGAGA GGAAA CCTT-P TgA4/2-P 16 TGCCCAGGGAGGCTAGCTGTCACCT Partzyme B HXB2D (tagged) CCTCCGGG-P TgB5/2-P 21 CAAACGAGTCCTGGCCTTGTCTAC Partzyme A RPLPO R05A4/3-P AACGAGGTTGTGCTG-P 22 CGGTTGGTGAGGCTAGCTGTGGAGA Partzyme B RPLPO R05B5/3-P WO 2007/065926 PCT/EP2006/069422 -39 CGGATTACACCTTC-P Multiple MNAzymes are useful in the present invention as they allow detection of related sequences differing by as little as a single nucleotide. Similarly, a unique reporter substrate is required to detect each of the several targets. In some cases, to 5 multiplex the method requires the use of a distinct or unique detectable signal for each reporter substrate to facilitate the design of the method. The target nucleic acid, encompassing the tagged or corresponding non-tagged regions of the recombinant virus of the present invention, is amplified in accordance with a 10 procedure for amplifying that nucleic acid (i.e. DNA or RNA). Preferably, standard methods of in vitro amplification are used. The amplicons generated during the amplification serve as targets for an MNAzyme, thus MNAzyme activity is indicative of the presence of the target. The skilled artisan will appreciate that such monitoring can be conducted in a single vessel under conditions that permit both the amplification 15 and the MNAzyme assembly and catalytic activity, or the MNAzyme assay can be conducted subsequent to, or at time points throughout the amplification, by removing samples at the end or during the course of the amplification reactions. It is also to be appreciated that methods or protocols that combine target amplification 20 with catalytic nucleic acid activity may require specific reaction conditions. Preferably, reaction conditions are compatible with both polymerase activity (for amplification), and catalytic nucleic acid modification of a substrate (for detection). Protocols for determining conditions for concurrent catalytic activity and polymerase activity at high temperature, such as during PCR, have been described for DNAzymes (Impey et al., 25 2000). The influence of factors including DNAzyme arm length, buffer, temperature, divalent ion concentration and effects of additives was demonstrated in this paper. DNA enzymes are suited for use in combination with in vitro amplification strategies. For example, they are not irreversibly denatured by exposure to high temperatures during amplification. 30 In one embodiment of the present invention, the quantitative amplification is performed according to a method for detecting the presence of at least one target or assembly facilitator, wherein the target or assembly facilitator is one tagged or corresponding non-tagged region of the recombinant virus as described above, said method 35 comprising: a) providing two or more oligonucleotide components, wherein at least a first oligonucleotide component and a second oligonucleotide component self-assemble in WO 2007/065926 PCT/EP2006/069422 -40 the presence of at least a first assembly facilitator to form at least a first catalytically active multi-component nucleic acid enzyme (MNAzyme); b) providing at least a first reporter substrate, said first substrate capable of being modified by said first INAzyme, wherein said modification of said substrate by said 5 INAzyme provides a detectable effect; c) contacting said two or more oligonucleotide components with a sample putatively containing said at least first assembly facilitator under conditions permitting: (1) the self-assembly of said at least first MNAzyme, and (2) the catalytic activity of said at least first INAzyme; and 10 d) detecting said detectable effect. The method for detecting the presence of at least one target or assembly facilitator may further comprise providing at least a third and fourth oligonucleotide component, wherein said at least third and at least fourth oligonucleotide component are capable of 15 self assembling in the presence of at least one additional target or assembly facilitator to form at least one additional catalytically active INAzyme, and wherein at least one additional reporter substrate is present in the sample, said additional reporter substrate is capable of being modified only by the additional INAzyme, wherein said modification provides said additional detectable effect. 20 Determination of the viral replicative capacity Standard curves of threshold cycle (Ct) values over time for the tagged and/or non tagged recombinant viruses are obtained and plotted onto the standard curves, generally obtained from a control or housekeeping gene, and the proportion of a given tagged 25 species in the viral population or in a given environment is visualized and calculated. The protocols and products of the present invention may be used for diverse diagnostic, clinical, toxicological, research and forensic purposes including, drug discovery, designing patient therapy, drug efficacy testing, and patient management. 30 The present methods may be used in combination with other assays. The results may be implemented in computer models and databases. Additionally, the protocols and products of the present invention also allow monitoring of the effect of anti-HIV compounds on viral fitness. 35 The viral fitness assay may be used as or comprise part of a high-throughput screening assay where numerous HIV strains and environmental compositions are evaluated.
WO 2007/065926 PCT/EP2006/069422 -41 Results from viral fitness experiments can be used to develop a database of replicative capacity levels in the presence of other HIV strains, and environmental factors. The present invention also provides a kit. The kit may be used for any of the methods 5 described herein. In one embodiment, the kit may be used to determine the replicative capacity of two or more target HIV viruses in an environment. The kit of the invention may comprise a tagged HIV plasmid vector, a non-tagged HIV plasmid vector, primers, and probes. In another embodiment, a kit comprises a cell line. In one embodiment of the present invention, the kit encompasses one or more primers 10 selected from SEQ ID N' 1-12, 19-20 and 24-25; and/or one or more of the tagged HIV plasmid vectors according to the invention, and optionally a non-tagged HIV HXB2D plasmid vector. The kits may further comprise environmental components. Alternatively, the kits may comprise as well the partzymes SEQ ID N' 13-16 and 21-22. 15 The order of the steps of the methods of the invention may be varied. One of skill in the art would be able to determine which variations in the order of the steps are applicable. Other embodiments of the invention will be apparent to those skilled in the art from consideration of the specification and practice of the invention disclosed 20 herein. It is intended that the specification and examples be considered as exemplary only, with the scope being indicated by the claims. The following non-limiting examples help to illustrate the principles of the invention. 25 Experimental part Abbreviations MNAzyme: multi-component nucleic acid enzyme, or multipartite nucleic acid enzyme; DNAzyme: deoxyribonucleic acid enzyme; RNAzyme: ribonucleic acid enzyme, or ribozyme; 30 PCR: polymerase chain reaction; dH 2 0: deionized distilled water; F: fluorophore; Q: quencher; JOE or 6-JOE: 6-carboxy-4',5'-dichloro-2',7'-dimethoxyfluorescein; 35 FAM or 6-FAM: 6-Carboxyfluorescein; BHQ1: Black Hole Quencher 1; BHQ2: Black Hole Quencher 2.
WO 2007/065926 PCT/EP2006/069422 -42 Example 1 Recombinant virus were prepared according to the protocols explained in detail in EP877937, EP1283272 or EP1285971. The virus having a tagged envelope gene was the result of the recombination of the plasmid vector pGEM-HIVdelGPRTtagged(env) 5 and the amplicon GPRT. The virus having a tagged integrase sequence was the result of the recombination of the plasmid vector pGEM-HIVdelGPRTtagged(int) and the amplicon GPRT. The virus having no tagged sequence was the result of the recombination of the plasmid vector pGEM-HIVdelGPRT and the amplicon GPRT. The amplicon GPRT refers to a sequence consisting of the last 81 amino acids of the 10 gag gene, the full sequence of the protease gene, and the p51 part of the reverse transcriptase gene. The GPRT amplicons were obtained from a mutant virus strain and from a WT virus strain. The GPRT amplicon from the mutant strain was recombined with the tagged plasmid vector. The GPRT amplicon from the WT strain was recombined with the non-tagged plasmid vector. Recombination of the GPRT 15 amplicon from the mutant strain with the non-tagged plasmid vector, and recombination of the GPRT amplicon from the WT strain with the tagged plasmid vector is another option. The sequence of the plasmid vector pGEM-HIVdelGPRT tagged(env) is enclosed as 20 SEQ ID N' 13. The sequence of the plasmid vector pGEM-HIVdelGPRT tagged(int) is enclosed as SEQ ID N' 14. The sequence of the plasmid vector pGEM HIVdelGPRT, i.e. with no tags, is enclosed as SEQ ID N' 15. The sequence of the envelope gene below shows in the underlined region where the 25 silent mutations (marked in bold and in lower case) have been introduced: Tagged envelope gene (SEQ ID N' 26): ATGAGAGTGAAGGAGAAATATCAGCACTTGTGGAGATGGGGGTGGAGATG GGGCACCATGCTCCTTGGGATGTTGATGATCTGTAGTGCTACAGAAAAATT 30 GTGGGTCACAGTCTATTATGGGGTACCTGTGTGGAAGGAAGCAACCACCAC TCTATTTTGTGCATCAGATGCTAAAGCATATGATACAGAGGTACATAATGTT TGGGCCACACATGCCTGTGTACCCACAGACCCCAACCCACAAGAAGTAGTA TTGGTAAATGTGACAGAAAATTTTAACATGTGGAAAAATGACATGGTAGAA CAGATGCATGAGGATATAATCAGTTTATGGGATCAAAGCCTAAAGCCATGT 35 GTAAAATTAACCCCACTCTGTGTTAGTTTAAAGTGCACTGATTTGAAGAAT GATACTAATACCAATAGTAGTAGCGGGAGAATGATAATGGAGAAAGGAGA GATAAAAAACTGCTCTTTCAATATCAGCACAAGCATAAGAGGTAAGGTGCA
GAAAGAATATGCATTTTTTTATAAACTTGATATAATACCAATAGATAATGA
WO 2007/065926 PCT/EP2006/069422 -43 TACTACCAGCTATAAGTTGACAAGTTGTAACACCTCAGTCATTACACAGGC CTGTCCAAAGGTATCCTTTGAGCCAATTCCCATACATTATTGTGCCCCGGCT GGTTTTGCGATTCTAAAATGTAATAATAAGACGTTCAATGGAACAGGACCA TGTACAAATGTCAGCACAGTACAATGTACACATGGAATTAGGCCAGTAGTA 5 TCAACTCAACTGCTGTTAAATGGCAGTCTAGCAGAAGAAGAGGTAGTAATT AGATCTGTCAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTGAAC ACATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAG AATCCGTATCCAGAGAGGACCAGGGAGAGCATTTGTTACAATAGGAAAAA TAGGAAATATGAGACAAGCACATTGTAACATTAGTAGAGCAAAATGGAAT 10 AACACTTTAAAACAGATAGCTAGCAAATTAAGAGAACAATTTGGAAATAAT AAAACAATAATCTTTAAGCAATCCTCAGGAGGGGACCCAGAAATTGTAACG CACAGTTTTAATTGTGGAGGGGAATTTTTCTACTGTAATTCAACACAACTGT TTAATAGTACTTGGTTTAATAGTACTTGGAGTACTGAAGGGTCAAATAACA CTGAAGGAAGTGACACAATCACCCTCCCATGCAGAATAAAACAAATTATAA 15 ACATGTGGCAGAAAGTAGGAAAAGCAATGTATGCCCCTCCCATCAGTGGAC AAATTAGATGTTCATCAAATATTACAGGGCTGCTATTAACAAGAGATGGTG GTAATAGCAACAATGAGTCCGAGATCTTCAGgCCeGGAGGAGGtGAcATGAG GGACAATTGGAGAAGTGAATTATATAAATATAAAGTAGTAAAAATTGAAC CATTAGGAGTAGCACCCACCAAGGCAAAGAGAAGAGTGGTGCAGAGAGAA 20 AAAAGAGCAGTGGGAATAGGAGCTTTGTTCCTTGGGTTCTTGGGAGCAGCA GGAAGCACTATGGGCGCAGCGTCAATGACGCTGACGGTACAGGCCAGACA ATTATTGTCTGGTATAGTGCAGCAGCAGAACAATTTGCTGAGGGCTATTGA GGCGCAACAGCATCTGTTGCAACTCACAGTCTGGGGCATCAAGCAGCTCCA GGCAAGAATCCTGGCTGTGGAAAGATACCTAAAGGATCAACAGCTCCTGG 25 GGATTTGGGGTTGCTCTGGAAAACTCATTTGCACCACTGCTGTGCCTTGGAA TGCTAGTTGGAGTAATAAATCTCTGGAACAGATTTGGAATCACACGACCTG GATGGAGTGGGACAGAGAAATTAACAATTACACAAGCTTAATACACTCCTT AATTGAAGAATCGCAAAACCAGCAAGAAAAGAATGAACAAGAATTATTGG AATTAGATAAATGGGCAAGTTTGTGGAATTGGTTTAACATAACAAATTGGC 30 TGTGGTATATAAAATTATTCATAATGATAGTAGGAGGCTTGGTAGGTTTAA GAATAGTTTTTGCTGTACTTTCTATAGTGAATAGAGTTAGGCAGGGATATTC ACCATTATCGTTTCAGACCCACCTCCCAACCCCGAGGGGACCCGACAGGCC CGAAGGAATAGAAGAAGAAGGTGGAGAGAGAGACAGAGACAGATCCATT CGATTAGTGAACGGATCCTTGGCACTTATCTGGGACGATCTGCGGAGCCTG 35 TGCCTCTTCAGCTACCACCGCTTGAGAGACTTACTCTTGATTGTAACGAGGA TTGTGGAACTTCTGGGACGCAGGGGGTGGGAAGCCCTCAAATATTGGTGGA ATCTCCTACAGTATTGGAGTCAGGAACTAAAGAATAGTGCTGTTAGCTTGC
TCAATGCCACAGCCATAGCAGTAGCTGAGGGGACAGATAGGGTTATAGAA
WO 2007/065926 PCT/EP2006/069422 -44 GTAGTACAAGGAGCTTGTAGAGCTATTCGCCACATACCTAGAAGAATAAGA CAGGGCTTGGAAAGGATTTTGCTATAA The sequence of the integrase encoding region below shows in the underlined region 5 where the silent mutations (marked in bold and in lower case) have been introduced: Tagged integrase-encoding sequence (SEQ ID N' 27): TTTTTAGATGGAATAGATAAGGCCCAAGATGAACATGAGAAATATCACAGT AATTGGAGAGCAATGGCTAGTGATTTTAACCTGCCACCTGTAGTAGCAAAA 10 GAAATAGTAGCCAGCTGTGATAAATGTCAGCTAAAAGGAGAAGCCATGCA TGGACAAGTAGACTGTAGTCCAGGAATATGGCAACTAGATTGTACACATTT AGAAGGAAAAGTTATCCTGGTAGCAGTTCATGTAGCCAGTGGATATATAGA AGCAGAAGTTATTCCAGCAGAAACAGGGCAGGAAACAGCATATTTTCTTTT AAAATTAGCAGGAAGATGGCCAGTAAAAACAATACATACAGACAATGGCA 15 GCAATTTCACCAGTGCTACGGTTAAGGCCGCCTGTTGGTGGGCGGGAATCA AGCAGGAATTTGGAATTCCCTACAATCCCCAAAGTCAAGGAGTAGTAGAAT CTATGAATAAAGAATTAAAGAAAATTATAGGACAGGTAAGAGATCAGGCT GAACATCTTAAGACAGCAGTACAAATGGCAGTATTCATCCACAATTTTAAA AGAAAAGGGGGGATTGGGGGGTACAGTGCAGGGGAAAGAATAGTAGACAT 20 AATAGCAACAGACATACAAACTAAAGAATTACAAAAACAAATTACAAAAA TTCAAAATTTTCGGGTTTATTACAGGGACtcacGtAATCCACTTTGGAAAGGA CCAGCAAAGCTCCTCTGGAAAGGTGAAGGGGCAGTAGTAATACAAGATAA TAGTGACATAAAAGTAGTGCCAAGAAGAAAAGCAAAGATCATTAGGGATT ATGGAAAACAGATGGCAGGTGATGATTGTGTGGCAAGTAGACAGGATGAG 25 GATTAG Once the recombinant viruses had been generated, six tubes containing 7.5 x 106 MT4 LTR-EGFP cells were prepared. Then, 8 ml of the recombinant virus pre-dilutions were prepared according to the following formula (MOI: multiplicity of infection): 30 Final dilution for MOI of 0.001 / 20 = pre-dilution factor The recombinant virus were added to the re-suspended cells according to the following table 8 at the conditions described below: 35 Table 8 Ratio Tag/WT Amount of Tag virus (mL) Amount of WT virus (mL) WO 2007/065926 PCT/EP2006/069422 -45 (HIV HXB2D-tagged) (HIV HXB2D WT) 100/0 2.5 0 0/100 0 2.5 80/20 2 0.5 50/50 1.25 1.25 20/80 0.5 2 Control 0 0 The mixture of virus and cells was incubated for 30 minutes at 37 'C, followed by a spinoculation of 10 minutes at 1200 x g. The supernatants were removed and the cells washed with medium. The tubes were centrifuged for 5 minutes at 200 x g and the 5 pellets re-suspended in culture media. The re-suspended cells were added to culture flasks containing culture media and incubated at 37 'C. The time was carefully annotated. Each every 24 hours after, the flasks were scored for cytopathogenic effect and fluorescence. At Time 0 hours (after wash step), 15h., 24h., 39h., 48h., 63h., 72h. and 10 87h., 6 ml of the re-suspended cell culture was collected. Supernatants and cells were recovered by centrifugation: after 10 minutes at 1800 x g, 2 x 1.5ml of supernatant was collected. 400pl of PBS was added to the remainder of the supernatant to re-suspend the cell pellet. The re-suspended cells were split over 2 tubes and both supernatant and cells 15 were stored at - 80 'C. DNA was extracted from the cell pellets with the Invisorb Spin Blood Mini kit from Invitek (Westburg) according to the protocol provided by the supplier. DNA concentrations were measured with the spectrophotometer, and the DNA concentration was adjusted to 100 ng/pl. Samples were then stored at - 20'C. 20 2 pl of the stored samples were used for testing in the real-time assay. The DNA was added to a real-time PCR mix and placed in the PCR machine. The real-time PCR mix contained wild-type primer Mix, universal substrate FAM, tag primer mix, universal substrate JOE, control primer mix, universal substrate FAMTAM, BD Qtaq PCR buffer 25 with FAMTAM, PCR-grade water, and BD Qtaq DNA polymerase mix. The mix of 2 pl of DNA template and the real-time PCR mix was placed in a thermocycler (ABI 7700) at the following program: 3 minutes 95 0 C I WO 2007/065926 PCT/EP2006/069422 -46 15 seconds 95 0 C 1 minutes 66 0 C -1 0 C/cycle 10 cycles 15 seconds 95 0 C 1 minute 560C 45 cycles The resulting Ct (threshold cycle) values were used for determining the replicative capacity of the tag virus and the wild-type virus. 5 In Figure 5, a comparison of the viral growth of HIV HXB2D WT and HIV HXB2D tagged in MT4 cells overtime at various relative input concentrations. Further in Figure 6, there is plotted the detection of HIV HXB2D and HIV HXB2D-tagged DNA from co-infected MT4 cells using dual labeling, wherein the tagged primer is linked to the JOE probe, and the non-tagged wild-type primer is linked to the FAM probe. 10 In Figure 7a, 7b and 7c, three amplification curves are shown for the templates HIV HXB2D and HIV HXB2D-tagged DNA which were used to co-infect MT4 cells. The primers used were SEQ ID No 7 and 6, and the labels that were used were: B-FAM for the HIV HXB2D DNA (figure 7a) 15 D-JOE for the HIV HXB2D-tagged DNA (figure 7b) TAMRA for the housekeeping gene (GAPD) (figure 7C) In Figure 8a, 8b and 8c, three amplification curves are shown for the templates HIV HXB2D and HIV HXB2D-tagged DNA which were used to co-infect MT4 cells. The 20 primers used were SEQ ID No 5 and 6, and the labels that were used were: B-FAM for the HIV HXB2D DNA (figure 8a) D-JOE for the HIV HXB2D-tagged DNA (figure 8b) TAMRA for the housekeeping gene (GAPD) (figure 8c) 25 In Figure 9a, 9b and 9c, three amplification curves are shown for the templates HIV HXB2D and HIV HXB2D-tagged DNA which were used to co-infect MT4 cells. The primers used were SEQ ID No 8 and 9, and the labels that were used were: B-FAM for the HIV HXB2D DNA (figure 9a) D-JOE for the HIV HXB2D-tagged DNA (figure 9b) 30 TAMRA for the housekeeping gene (GAPD) (figure 9c) WO 2007/065926 PCT/EP2006/069422 -47 In Figure 10a, 1Ob and 1Oc, three amplification curves are shown for the templates HIV HXB2D and HIV HXB2D-tagged DNA which were used to co-infect MT4 cells. The primers used were SEQ ID N' 5, 6, 7, 8 and 9, and the labels that were used were: B-FAM for the HIV HXB2D DNA (figure 10a) 5 D-JOE for the HIV HXB2D-tagged DNA (figure 1Ob) TAMRA for the housekeeping gene (GAPD) (figure 10c) In Figure 11 there is provided the pictures of the end point gel electrophoresis for the amplified material shown in Figures 7-10. The pictures clearly show that a viable 10 triplex assay has been developed which is able to differentiate between non-tagged WT and tagged HIV DNA vector templates (i.e. HIV HXB2D vs. HIV HXB2D-tagged DNA), even in the presence of genomic DNA background. The PCR efficiency is within 90% and 110%, the correlation coefficient of data fit to standard curve is > 0.99. The ACt (i.e. variation of threshold cycle) between 1- and n-plex was < 1 cycle. 15 Example 2: Use of MNAzymes for the quantification of HIV nucleic acid sequences via duplex real time PCR Multicomponent Nucleic Acid enzymes (MNAzymes) contain (i) sensor regions which specifically recognise and bind an assembly facilitator, for example a target nucleic 20 acid; (ii) catalytic core regions; and (iii) substrate regions which bind a substrate. MNAzymes are composed of two (or more) separate oligonucleotide "partzymes" which form an active enzyme only in the presence of an assembly facilitator. The catalytically active MINAzyme can cleave nucleic acid reporter substrates between fluorophore and quencher dye pairs thus generating fluorescent signal. Examples of 25 assembly facilitators include target analytes such as DNA or RNA sequences. MNAzymes can be used to allow detection of target DNA amplicons generated by the polymerase chain reaction (PCR) or other in vitro amplification techniques. Further, real time monitoring of PCR using INAzymes allows the amount of target initially present in the reaction to be quantified. 30 A duplex PCR assay, which used two MNAzymes to facilitate real time monitoring, was developed for the simultaneous detection and quantification of (i) non-tagged HIV HXB2D WT sequences and (ii) tagged HIV HXB2D sequences that were modified to contain four silent mutations (the tag). The tag bases were designed such that they did 35 not affect replication efficiency but did allow discrimination between the tagged HXB2D sequences and the non-tagged HXB2D WT sequence (Figure 14). The absence or presence of the tag provided a surrogate marker for the presence of "wild type" sequence (WT) or those derived by amplification of the HIV target virus of WO 2007/065926 PCT/EP2006/069422 -48 interest (T) respectively which were located upstream of the region which was either non-tagged or tagged. 2.1. Partzyme Oligonucleotides for a duplex PCR assay 5 Multiple targets can be simultaneously detected in one multiplexed reaction that comprises multiple unique MNAzymes. Each MNAzyme has sensor arms specific for one target and substrate arms specific for a unique member of a series of generic reporter substrates, each one of which is labeled with a different fluorophore. In the following example, MNAzymes were designed to detect two different target amplicons, 10 namely those amplified from the non-tagged HXB2D WT, and those amplified from the HXB2D-tagged sequences. The sequences of the partzymes A and B for each target are listed below from 5' to 3'. In the following sequences the bases underlined form part of the catalytic core of the 15 assembled MNAzyme, bases in bold hybridize with the target and bases in italics hybridize to the substrate. The P at the end of each sequences represents a 3' phosphate group. Table 9 20 SEQ. Partzyme sequences listed in 5' to 3' name ID n' direction 13 ATATCTCCTCCTCCAGGTACAACG Partzyme A HXB2D (wild type) AGAGGCGTGA T-P WTA4/6-P 14 CTGGGAGGAAGGCTAGCTCTGAAGA Partzyme B HXB2D (wild type) TCTCGGACTCATT-P WTB5/6-P 15 CTTCTCCAATTGTCCCTCATACAA Partzyme A HXB2D (tagged) CGAGA GGAAA CCTT-P TgA4/2-P 16 TGCCCAGGGAGGCTAGCTGTCACCT Partzyme B HXB2D (tagged) CCTCCGGG-P TgB5/2-P 2.2. Reporter Substrates In this example, two different reporter substrates, each labeled with a different fluorophore, were used. The sequences of the substrates are written 5' to 3' below. In 25 the current example, a first substrate SubBi-6 was end-labeled with a 6-FAM moiety at the 5' end and a BHQ moiety at the 3' end and was designated SubBi-6-FB. The substrate SubBi-6-FB was used to follow the accumulation of non-tagged HXB2D WT WO 2007/065926 PCT/EP2006/069422 -49 amplicons and cleavage of SubBi-6-FB was monitored at 516 nm with excitation at 492 nm. A second substrate SubBi-2 was end-labeled with a 6-JOE moiety at the 5' end and a BHQ1 moiety at the 3' end and was designated SubBi-2-JB. The substrate SubBi-2-JB was used to follow the accumulation of HXB2D-tagged amplicons and 5 cleavage of SubBi-2-JB was monitored at 555 nm with excitation at 535 nm. The lower case bases represent RNA and the upper case bases represent DNA. Table 10 SEQ. Substrate sequences listed in 5' to 3' name ID n' direction 17 ATCACGCCTCguTCCTCCCAG SubBi-6-FB 18 AAGGTTTCCTCguCCCTGGGCA SubBi-2-JB 10 2.3. PCR primers for amplification of the target sequences The primers 5HIV and 3HIV were used for the amplification of both the wild type and tagged target HXB2D sequences. The amplicons were generated by PCR using the oligonucleotide PCR primers listed below. 15 Table 11 SEQ. ID n' Primer sequence listed in 5' to 3' direction name 19 (forward) ATTAACAAGAGATGGTGGTAA 5HIV 20 (reverse) GTGCTACTCCTAATGGTTCAA 3HIV 2.4. Reaction Components: Amplincation and quantification of target sequences 20 Real time amplification and quantification of the target sequences was performed in a total reaction volume of 25 pL. All reactions were conducted on an Mx3005PTM QPCR System (Stratagene). The cycling parameters were, 95'C for 7 minutes, 10 cycles of 95'C for 15 seconds and 60'C for 30 seconds (with a 1 0 C decrease in temperature per cycle), and finally 40 cycles of 95'C for 15 seconds and 50'C for 120 seconds. The 25 reactions contained 40 nM of 3HIV and 400 nM of 5HIV, 200 nM of each partzyme (WTA4/6-P, WTB5/6-P, TgA4/2-P and TgB5/2-P), 200 nM of each substrate (SubBi-6-FB and SubBi-2-JB), 7 mM MgCl 2 , 200 pM of each dNTP, 10 units Rnasin (Promega), 1 x Immobuffer (Bioline), and 1 unit of Immolase (Bioline). Duplicate reactions either contained, or lacked, plasmid or genomic DNA template as indicated in 30 the following Table 12.
WO 2007/065926 PCT/EP2006/069422 -50 Table 12: Target DNA sequence present in reactions. Type of DNA Template present Template in reaction in reactions Non-tagged HXB2D-WT 1E+06 copies (Standard 1) plasmid and HXB2D-tagged 2E+05 copies (Standard 2) plasmid present at a ratio of 1:1 4E+04 copies (Standard 3) diluted in a background of 5 ng 8E+03 copies (Standard 4) of control human K562 genomic 1.6E+03 copies (Standard 5) DNA. Human genomic MT-4 DNA 100% wild type HXB2D WT containing proviral sequences 80% wild type HXB2D WT with 20% tagged from wild type HXB2D HXB2D WTand/or HXB2D-tagged 50% wild type HXB2D WT with 50% tagged (estimated percentages in spiked HXB2D mixtures). 20% wild type HXB2D WT with 80% tagged HXB2 100% tagged HXB2D No target control lacking genomic MT-4 DNA (dH 2 0 only) 5 2.5. Results: Simultaneous amplification of the non-tagged and tagged target sequences and detection via cleavage of two different reporter substrates using target specific INAzymes. Non-tagged HXB2D WT sequences were detected and quantified in real time by monitoring the increase in fluorescence in the FAM channel due to cleavage of 10 SubBi-6-FB by INAzyme 1 (comprising partzymes WTA4/6-P and WTB5/6-P). The MNAzyme 1 was only formed in the presence of the appropriate assembly facilitator, namely amplicons resulting from amplification of either HXB2D WT plasmid or proviral HXB2D WT target sequences (Tables 13 and 14 below). There was no increase in fluorescent signal in the FAM channel over time in the absence of HXB2D 15 WT plasmid or proviral DNA. Further, there was no increase in fluorescent signal in the FAM channel over time in the presence of amplicons derived from tagged proviral DNA alone.
WO 2007/065926 PCT/EP2006/069422 -51 Tagged HXB2D sequences were detected and quantified in real time by monitoring the increase in fluorescence in the JOE channel due to cleavage of SubBi-2-JB by INAzyme 2 (comprising partzymes TgA4/2-P and TgB5/2-P). The INAzyme 2 was only formed in the presence of the appropriate assembly facilitator, namely amplicons 5 resulting from amplification of either tagged HXB2D plasmid or tagged proviral HXB2D target sequences (Tables 13 and 14 below). There was no increase in fluorescent signal in the JOE channel over time in the absence of tagged plasmid or proviral HXB2D template DNA. Further, there was no increase in fluorescent signal in the JOE channel over time in the presence of amplicons derived from non-tagged 10 HXB2D WT proviral DNA alone. Standard curves were generated for the non-tagged and tagged HXB2D plasmid targets by plotting the log of the plasmid concentrations against the cycle number (Ct) at which threshold fluorescence was reached. The Ct values for each of the known amount 15 (standards) as shown in Table 13 below are an average of duplicate reactions. The correlation coefficient (R2) and slope of the standard curves, as well as the reaction efficiencies, are shown for both the non-tagged and tagged target sequences. Table 13: Analysis of reactions containing non-tagged wild type and tagged HXB2D 20 plasmids Threshold Cycle (Ct) Non-tagged (WT) template Tagged template (MNAzyme (MNAzyme 1 /FAM) 2/ JOE) Standard 1 14.2 12.3 Standard 2 16.9 15.1 Standard 3 20.0 18.0 Standard 4 22.9 20.7 Standard 5 25.6 23.3 No plasmid (dH 2 0 only) No Ct No Ct R2= 0.999 R2= 1.000 Standard Curve Slope =-4.135 Slope = -3.951 Efficiency = 75% Efficiency = 79% The copy numbers of the non-tagged WT and the tagged HXB2D provirus within the MT-4 genomic DNA mixtures were estimated from the standard curve generated from WO 2007/065926 PCT/EP2006/069422 -52 the non-tagged and the tagged HXB2D plasmids (Table 14). The copy number of each of the non-tagged and the tagged HXB2D proviral sequences was expressed as a percentage of the total copy number (the non-tagged plus the tagged proviral sequences), and the estimates were compared to the percentage in original spiked MT-4 5 mixtures. Samples with genomic MT-4 containing 100% non-tagged or 100% tagged proviral sequences were easily distinguished from each other (Table 14). No background increase in fluorescence over time was generated by MNAzyme 1 in the presence of 10 tagged proviral sequence only. Similarly, no background increase in fluorescence over time was generated by MNAzyme 2 in the presence of non-tagged proviral sequence only (Table 14). Mixtures with ratios of non-tagged to tagged sequences of 80%, 50% and 20% of non-tagged were calculated to contain 7 7 %, 47% and 21% of non-tagged respectively using the MNAzyme assay. 15 Table 14: Results of reactions for the amplification and detection of non-tagged and tagged proviral DNA sequences present in varying percentages Percentage of proviral Calculated percent Quantity average of duplicates HXB2D sequence present in spiked (in spiked sample) sample Non Non-tagged Tagged Non-tagged Tagged Total tagged Tagged 100l % 0% 1.02E+05 0 1.02E+05 100% 0% 800% 20% 7.88E+04 2.35E+04 1.02E+05 77% 23% 500% 50% 4.96E+04 5.55E+04 1.05E+05 47% 53% 20 % 80% 1 2.55E+04 9.48E+04 1.20E+05 21%1 790 0% 1100% 0 1.16E+05 1.16E+05 10% 1100% 20 The MNAzyme PCR reaction in this example allowed simultaneous detection and generation of standard curves for the quantification of non-tagged and tagged nucleic acid HXB2D sequences in a duplex reaction. The assay allowed discrimination between the non-tagged and the tagged sequences and vice versa. Further, the MNAzyme assay was able to determine the absolute and relative amounts of 25 non-tagged and tagged proviral HXB2D DNA present in a sample. Thus the MNAzyme PCR provides a method for real time monitoring of the HIV- 1 sequences in the HIV viral fitness assay.
WO 2007/065926 PCT/EP2006/069422 -53 Example 3: Use of MNAzymes for the quantification of HIV and control nucleic acid sequences via triplex real time PCR A triplex PCR assay, which used three MNAzymes to facilitate real time monitoring, 5 was developed for the simultaneous detection and quantification of (i) non-tagged HIV HXB2D WT sequences, (ii) tagged HIV HXB2D sequences that were modified to contain four silent mutations (the tag) and (iii) the control human RPLPO gene. The tag bases were designed such that they did not affect replication efficiency but did allow discrimination between the modified tagged HXB2D sequences and the 10 non-tagged HXB2D WT sequence. The absence or presence of the tag provides a surrogate marker for the presence of "wild type" WT sequences or those derived by amplification of the HIV target virus of interest (T) respectively which are located upstream of the region which is either non-tagged or tagged. 15 3.1. Partzyme Oligonucleotides for a triplex PCR assay Multiple targets can be simultaneously detected in one multiplexed reaction that comprises multiple unique MNAzymes. Each MNAzyme has sensor arms specific for one target and substrate arms specific for a unique member of a series of generic 20 reporter substrates, each one of which is labeled with a different fluorophore. In the following example, MNAzymes were designed to detect three different target amplicons, namely those amplified from the non-tagged HXB2 WT, those amplified from the tagged HXB2D sequences and those amplified from the RPLPO gene. 25 The sequences of the partzymes A and B for each target are listed below from 5' to 3'. In the following sequences the bases underlined form part of the catalytic core of the assembled MNAzyme, bases in bold hybridize with the target and bases in italics hybridize to the substrate. The P at the end of the sequence indicates a 3' phosphate group. 30 Table 15 SEQ. Partzyme sequence listed in 5' to 3' name ID n' direction 13 ATATCTCCTCCTCCAGGTACAACG Partzyme A HXB2D (wild type) AGAGGCGTGA T-P WTA4/6-P 14 CTGGGAGGAAGGCTAGCTCTGAAGA Partzyme B HXB2D (wild type) TCTCGGACTCATT-P WTB5/6-P WO 2007/065926 PCT/EP2006/069422 -54 15 CTTCTCCAATTGTCCCTCATACAA Partzyme A HXB2D (tagged) CGAGA GGAAA CCTT-P TgA4/2-P 16 TGCCCAGGGAGGCTAGCTGTCACCT Partzyme B HXB2D (tagged) I CCTCCGGG-P TgB5/2-P 21 CAAACGAGTCCTGGCCTTGTCTAC Partzyme A RPLPO RO5A4/3-P AACGAGGTTGTGCTG-P 22 CGGTTGGTGAGGCTAGCTGTGGAGA Partzyme B RPLPO RO5B5/3-P CGGATTACACCTTC-P 3.2. Reporter Substrates In this example, three different reporter substrates, each labeled with a different fluorophore, were used. The sequences of the substrates are written 5' to 3' below. In 5 the current example, a first substrate SubBi-6 was end-labeled with a 6-FAM moiety at the 5' end and a BHQ moiety at the 3' end and was designated SubBi-6-FB. The substrate SubBi-6-FB was used to follow the accumulation of non-tagged wild type HXB2D WT amplicons and cleavage of SubBi-6-FB was monitored at 516 nm with excitation at 492 nm. A second substrate SubBi-2 was end-labeled with a 6-JOE 10 moiety at the 5' end and a BHQ1 moiety at the 3' end and was designated SubBi-2-JB. The substrate SubBi-2-JB was used to follow the accumulation of tagged HXB2D amplicons and cleavage of SubBi-2-JB was monitored at 555 nm with excitation at 535 nm. The third substrate SubBi-3 was end-labeled with a Quasar 670 moiety at the 5' end and a BHQ2 moiety at the 3' end and was designated SubBi-3-Q6B2. The 15 substrate SubBi-3-Q6B2 was used to monitor the accumulation of RPLPO amplicons and cleavage of SubBi-3-Q6B2 was monitored at 665 nm with excitation at 635 nm. The sequences of the three substrates are listed below. The lower case bases represent RNA and the upper case bases represent DNA. 20 Table 16 SEQ. Substrate sequence listed in 5' to 3' Name ID n' direction 17 ATCACGCCTCguTCCTCCCAG SubBi-6-FB 18 AAGGTTTCCTCguCCCTGGGCA SubBi-2-JB 23 CAGCACAACCguCACCAACCG SubBi-3-Q6B2 3.3. PCR primers for amplification of the target sequences WO 2007/065926 PCT/EP2006/069422 -55 The primers 5HIV and 3HIV were used for the amplification of both the wild type and tagged target HXB2D sequences. The primers 5RO5 and 3 RO5 were used to amplify the human genomic RPLPO gene. The sequences of the oligonucleotide PCR primers are listed below. 5 Table 17 SEQ. ID n' Primer sequence listed in 5' to 3' direction name 19 (forward) ATTAACAAGAGATGGTGGTAA 5HIV 20 (reverse) GTGCTACTCCTAATGGTTCAA 3HIV 24 (forward) CATTCTATCATCAACGGGTA 5RO5 25 (reverse) CAAAGGCAGATGGATCAG 3RO5 3.4. Reaction Components: Amplincation and quantification of target sequences 10 Real time amplification and quantification of the target sequences was performed in a total reaction volume of 25 pL. All reactions were conducted on an Mx3005PTM QPCR System (Stratagene). The cycling parameters were, 95'C for 7 minutes, 10 cycles of 95'C for 15 seconds and 60'C for 30 seconds (with a 1 0 C decrease in temperature per cycle), and finally 40 cycles of 95'C for 15 seconds and 50'C for 120 seconds. The 15 reactions contained 400 nM of 5HIV, 40 nM of 3HIV, 40 nM of 5RO5, 200 nM of 5RO5, 200 nM of each partzyme (WTA4/6-P, WTB5/6-P, TgA4/2-P, TgB5/2-P, R05A4/3-P and R05B5/3-P), 200 nM of each substrate (SubBi-6-FB, SubBi-2-JB and SubBi-3-Q6B2), 7 mM MgCl 2 , 200 pM of each dNTP, 10 units Rnasin (Promega), 1 x Immobuffer (Bioline) and 1 unit of Immolase (Bioline). Duplicate reactions either 20 contained, or lacked, plasmid or genomic DNA template as indicated in the following Table 18. Table 18: Target DNA sequence present in reactions. Type of DNA Template present Template in reaction in reactions Non-tagged HXB2D WT 1E+06 copies (Standard 1) plasmid and tagged HXB2D 2E+05 copies (Standard 2) plasmid present at a ratio of 1:1 4E+04 copies (Standard 3) diluted in a background of 5 ng 8E+03 copies (Standard 4) of control human K562 genomic 1.6E+03 copies (Standard 5)
DNA.
WO 2007/065926 PCT/EP2006/069422 -56 Human genomic MT-4 DNA 100% non-tagged wild type HXB2D-WT containing proviral sequences 80% non-tagged wild type HXB2D-WT with from non-tagged wild type 20% tagged HXB2D HXB2D WT and/or tagged 50% non-tagged wild type HXB2D-WT with HXB2D (estimated percentages 50% tagged HXB2D in spiked mixtures). 20% non-tagged wild type HXB2D-WT with 80% tagged HXB2D 100% tagged HXB2D No target control lacking genomic MT-4 DNA (dH 2 0 only) 3.5. Results: Simultaneous amplification of the non-tagged wild type and tagged target HXB2D sequences and control RPLPO gene sequences with detection via cleavage of three different reporter substrates using target specific MNAzymes. 5 Non-tagged HXB2D-WT sequences were detected and quantified in real time by monitoring the increase in fluorescence in the FAM channel due to cleavage of SubBi-6-FB by INAzyme 1 (comprising partzymes WTA4/6-P and WTB5/6-P). The MNAzyme 1 was only formed in the presence of the appropriate assembly facilitator, namely amplicons resulting from amplification of either non-tagged HXB2D WT 10 plasmid or non-tagged proviral HXB2D WT target sequences (Tables 19 and 20 below). There was no increase in fluorescent signal in the FAM channel over time in the absence of non-tagged HXB2D WT plasmid or proviral DNA. Further, there was no increase in fluorescent signal in the FAM channel over time in the presence of amplicons derived from tagged proviral DNA alone. 15 Tagged HXB2D sequences were detected and quantified in real time by monitoring the increase in fluorescence in the JOE channel due to cleavage of SubBi-2-JB by INAzyme 2 (comprising partzymes TgA4/2-P and TgB5/2-P). The INAzyme 2 was only formed in the presence of the appropriate assembly facilitator, namely amplicons 20 resulting from amplification of either tagged HXB2D plasmid or tagged proviral HXB2D target sequences (Tables 19 and 20 below). There was no increase in fluorescent signal in the JOE channel over time in the absence of tagged plasmid or proviral HXB2D template DNA. Further, there was no increase in fluorescent signal in the JOE channel over time in the presence of amplicons derived from non-tagged 25 HXB2D WT proviral DNA alone.
WO 2007/065926 PCT/EP2006/069422 -57 The RPLPO gene was detected and quantified in real time by monitoring the increase in fluorescence in the Quasar channel due to cleavage of SubBi-3-Q6B2 by MNAzyme 3 (comprising partzymes R05A4/3-P and R05B5/3-P). The INAzyme 3 was only formed in the presence of genomic DNA. An increase in fluorescence was observed in 5 the presence of genomic DNA extracted from either K562 or MT-4 cells. There was no increase in fluorescent signal over time in the absence of genomic DNA. Standard curves were generated for the non-tagged and tagged HXB2D plasmid targets by plotting the log of the plasmid concentrations against the cycle number (Ct) at which 10 threshold fluorescence was reached. The Ct values for each of the known amount of the plasmids (standards) as shown in Table 19 below are an average of duplicate reactions. The Ct values for RPLPO are shown and similar values were obtained for all standards indicating a similar amount of genomic DNA was present in all standards. The correlation coefficient (R2) and slope of the standard curves, as well as the reaction 15 efficiencies, are shown for both the non-tagged and tagged target sequences. Table 19: Results of real time analysis of non-tagged and tagged HXB2D targets and control RPLPO sequences Threshold (Ct) Non-tagged Tagged RPLPO (FAM) (JOE) (Quasar 670) Standard 1 18.3 16.0 23.8 Standard 2 21.0 19.1 24.0 Standard 3 24.4 21.9 24.1 Standard 4 27.3 24.7 24.4 Standard 5 31.2 27.5 24.8 No plasmid No Ct NotNoCt NoCt (water only) R2= 0.996 R2= 1.000 Standard Curve Slope = -4.59 Slope = -4.08 N/A Efficiency = 65% Efficiency = 76% 20 The copy numbers of the non-tagged and the tagged HXB2D provirus within the MT-4 genomic DNA mixtures were estimated from the standard curve generated from the non-tagged and the tagged HXB2D plasmids (Table 20). The copy number of each of WO 2007/065926 PCT/EP2006/069422 -58 the non-tagged and the tagged HXB2D proviral sequences was expressed as a percentage of the total copy number (the non-tagged plus the tagged proviral sequences), and the estimates were compared to the percentage in original spiked MT-4 mixtures. 5 Samples with genomic MT-4 containing 100% non-tagged or 100% tagged proviral sequences were easily distinguished from each other (Table 20). No background increase in fluorescence over time was generated by MNAzyme 1 in the presence of tagged proviral sequence only. Similarly, no background increase in fluorescence over 10 time was generated by MNAzyme 2 in the presence of non-tagged proviral sequences only (Table 20). Mixtures with ratios of non-tagged to tagged sequences of 80%, 50% and 20% of non-tagged were calculated to contain 74%, 47% and 28% of non-tagged respectively using the MNAzyme assay. 15 Table 20: Results of reactions for the amplification and detection of non-tagged and tagged proviral DNA sequences present in varying percentages (in a triplex MNAzyme format) Percentage of proviral Calculated percent Quantity average of duplicates HXB2D sequence present in spiked (in spiked sample) sample Non- Non- Non tagged Tagged tagged Tagged Total tagged Tagged 1000% 0% 854750 0 854750 100% 0% 800% 20% 703150 239500 942650 74% 26% 500% 50% 498850 557250 1056100 47% 53% 200% 80% 324550 835200 1159750 28% 72% 0% 100% 0 1058000 1058000 0% 100% 20 The MNAzyme PCR reaction in this example allowed simultaneous detection and generation of standard curves for the quantification of non-tagged and tagged nucleic acid HXB2D sequences in a triplex reaction. The assay allowed discrimination between the non-tagged and the tagged sequences and vice versa. Further, the MNAzyme assay was able to determine the absolute and relative amounts of 25 non-tagged and tagged proviral HXB2D DNA present in a sample. The RPLPO gene sequence can provide an internal control for the amount of genomic DNA present in a WO 2007/065926 PCT/EP2006/069422 -59 standard or test sample. Thus the triplex MNAzyme PCR provides a method for real time monitoring of the HIV- 1 sequences in the HIV viral fitness assay.

Claims (20)

1. An ex vivo or in vitro method for determining the replicative capacity of two HIIV viruses in an environment, said method comprising the steps of: a) generating a tagged recombinant infectious virus comprising a tagged HIV DNA 5 vector, and a first amplicon derived from a first target HIV virus; wherein the tagged HIV DNA vector is generated by introduction of one or more silent mutations in one of the HIV genes selected from gag, pol, env, tat, rev, nef, vif, vpr, and vpu; wherein the tagged HIV DNA vector has a deletion in its DNA sequence that corresponds at most with or overlaps with the flanking regions of 10 the first amplicon derived from the first target HIV virus; wherein the one or more silent mutations are introduced in a gene not comprised by the first amplicon derived from the first target HIV virus; and wherein the first amplicon comprises the gag, pol, or env genes from the first target HIV virus, portions thereof, and combinations thereof; 15 b) generating a non-tagged recombinant infectious virus comprising a non-tagged HIV DNA vector, and a second amplicon derived from a second target HIV virus; wherein the non-tagged HIV DNA vector does not comprise the one or more silent mutations introduced in the tagged HIV DNA vector of step a); wherein the non-tagged HIV DNA vector has a deletion in its DNA sequence that 20 corresponds at most with or overlaps with the flanking regions of the second amplicon derived from the second target HIV virus; and wherein the second amplicon comprises the the gag, pol, or env genes from the second target HIV virus, portions thereof, and combinations thereof; c) mixing the recombinant infectious viruses of steps a) and b) in a cell culture in a 25 given environment; and d) determining by quantitative amplification the proportion of the tagged recombinant infectious virus and of the non-tagged recombinant infectious virus within the overall viral population, by detecting the one or more silent mutations in the HIV DNA vector portion of the tagged recombinant infectious virus, and 30 by detecting the lack of the one or more silent mutations in the HIV DNA vector portion of the non-tagged recombinant infectious virus.
2. An ex vivo or in vitro method for determining the replicative capacity of three or more HIV viruses in an environment, said method comprising the steps of: 35 a) generating the tagged recombinant infectious virus of step a) in claim 1; b) generating the non-tagged recombinant infectious virus of step b) in claim 1; c) generating additional one or more tagged recombinant infectious virus, each comprising a tagged HIV DNA vector, and a third or subsequent amplicon -61 derived from the additional one or more target [HIV virus; wherein the tagged HIV DNA vector is generated by introduction of one or more silent mutations in one of the HIV genes selected from gag, pol, env, tat, rev, nef, vif, vpr, and vpu, said one or more silent mutations being different from the one or more silent 5 mutations of the first tagged HIV DNA vector of step a) of this claim; wherein each of the tagged HIV DNA vectors has a deletion in its DNA sequence that corresponds at most with or overlaps with the flanking regions of the third or subsequent amplicon derived from the third or subsequent target HIV virus; wherein the one or more silent mutations are introduced in a gene not comprised 10 by the third or subsequent amplicon derived from the third or subsequent target HIV virus; and wherein the third or subsequent amplicon comprises the gag, pol, or env genes from the third or subsequent target HIV virus, portions thereof, and combinations thereof; d) mixing the recombinant infectious viruses of step c) with the recombinant 15 infectious viruses of steps a) and b) in a cell culture in a given environment; and e) determining by quantitative amplification the proportion of each of the tagged recombinant infectious virus and of the non-tagged recombinant infectious virus within the overall viral population, by detecting the one or more silent mutations in the HIV DNA vector portion of each of the tagged recombinant infectious 20 virus, and by detecting the lack of the one or more silent mutations in the HIV DNA vector portion of the non-tagged recombinant infectious virus.
3. The method according to claim 1 or 2, wherein the amplification is performed by polymerase chain reaction (PCR), strand displacement amplification (SDA), 25 transcription-mediated amplification (TMA), nucleic acid sequence based amplification (NASBA), self-sustained sequence replication (3SR), transcription-based amplification (TAS), rolling circle amplification (RCA), loop-mediated isothermal amplification (LAMP) or ligase chain reaction (LCR). 30
4. The method according to any one of claims 1-3, where the quantitative amplification is monitored using LuxTM fluorogenic primers, probes cleavable by DNAzymes or MNAzymes, TaqMan@ probes, molecular beacons, scorpions or any other FRET probes. 35
5. The method according to any one of claims 1-4, wherein the quantitative amplification is performed by polymerase chain reaction, employing primers in the vicinity of MNAzymes, and probes that are cleaved by the MNAzymes. -62
6. The method according to any one of claims 1-5, wherein each of the tagged HIV DNA vector and the non-tagged HIV DNA vector comprises the backbone of a wild type or a mutant strain. 5
7. The method according to claim 6, wherein each of the tagged HIV DNA vector and the non-tagged HIV DNA vector is a proviral HIV DNA or a plasmid DNA.
8. The method according to claim 7, wherein the plasmid DNA comprises the genome of the HXB2D wild-type strain. 10
9. The method according to any one of claims 1-8, wherein the amplicon derived from the target HIV virus comprises one of the sequences selected from gag-PR-RT-int, gag-PR-RT, gag-PR, gag, PR-RT-int, RT-int, int, PR-RT, PR, RT, env, and portions thereof. 15
10. The method according to any one of claims 1-9, wherein the environment comprises one or more drugs, one or more binding proteins, or a mixture thereof.
11. The method according to any one of claims 1-10, wherein the tagged HIV DNA 20 vector is generated by introducing one or more silent mutations in the integrase encoding region of the pol gene of the HIV DNA vector, and wherein said introduction of one or more silent mutations is performed with primers SEQ ID N* 1-2.
12. The method according to any one of claims 1-10, wherein the tagged HIV DNA 25 vector is generated by introducing one or more silent mutations in the env gene of the HIV DNA vector, and wherein said introduction of one or more silent mutations is performed with primers SEQ ID N* 3-4.
13. A tagged HIV plasmid vector wherein the backbone of the plasmid vector is 30 wild-type HXB2D, said vector comprising - a tagged sequence; and - a deletion of the gag, pol, or env genetic sequences, portions thereof, and combinations thereof; wherein the tagged sequence comprises one or more silent mutations in one of the genes 35 selected from gag, pol, env, tat, rev, nef, vif, vpr, and vpu; and with the proviso that the one or more silent mutations are not located in the deleted genetic sequence. -63
14. The tagged HIV plasmid vector according to claim 13, wherein the tagged sequence comprises one or more silent mutations in the env gene or in the integrase encoding region of the pot gene. 5
15. The tagged HIV plasmid vector according to claim 14, wherein the plasmid vector is SEQ ID no. 28 (pGEM-HIVdeiGPRT_tagged(env)) or 29 (pGEM HIVdelGPRTtagged(int)).
16. A tagged HIV envelope encoding nucleic acid wherein the sequence of said 10 tagged HIV envelope encoding nucleic acid is SEQ ID N' 26.
17. A tagged HIV integrase-encoding nucleic acid wherein the sequence of said tagged HIV integrase-encoding nucleic acid is SEQ ID N' 27. 15
18. A kit for the ex vivo or in vitro determination of the replicative capacity of two or more HIV virus in an environment, said kit comprising: - one or more oligonucleotides selected from SEQ ID N* 1-12, 19-20, and 24-25; and/or - one or more of the tagged HIV plasmid vectors according to any one of claims 20 13-15 and optionally a non-tagged HIV HXB2D plasmid vector.
19. A kit according to claim 18 further comprising one or more oligonucleotides selected from SEQ ID N' 13-16 and 21-22. 25
20. An ex vivo or in vitro method according to claim 1 or 2; or a tagged HIV plasmid vector according to any one of claims 13, 16 or 17; or a kit according to claim 18, substantially as herein described with reference to any one or more of the examples but excluding comparative examples.
AU2006323930A 2005-12-07 2006-12-07 Methods, plasmid vectors and primers for assessing HIV viral fitness Ceased AU2006323930B2 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
EP05111802.4 2005-12-07
EP05111802 2005-12-07
PCT/EP2006/069422 WO2007065926A1 (en) 2005-12-07 2006-12-07 Methods, plasmid vectors and primers for assessing hiv viral fitness

Publications (2)

Publication Number Publication Date
AU2006323930A1 AU2006323930A1 (en) 2007-06-14
AU2006323930B2 true AU2006323930B2 (en) 2012-06-21

Family

ID=36087674

Family Applications (1)

Application Number Title Priority Date Filing Date
AU2006323930A Ceased AU2006323930B2 (en) 2005-12-07 2006-12-07 Methods, plasmid vectors and primers for assessing HIV viral fitness

Country Status (7)

Country Link
US (1) US8673551B2 (en)
EP (1) EP1960554B1 (en)
CN (1) CN101365808B (en)
AT (1) ATE512235T1 (en)
AU (1) AU2006323930B2 (en)
CA (1) CA2631881C (en)
WO (1) WO2007065926A1 (en)

Families Citing this family (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DK2385141T3 (en) 2005-10-07 2013-10-28 Speedx Pty Ltd Multicomponent nucleic acid enzymes and methods for their use
EP1987166A4 (en) 2006-02-03 2010-06-02 Univ Columbia Binary deoxyribozyme probes for nucleic acid analysis
CN101600808B (en) * 2006-10-06 2014-07-09 强生研究有限公司 Molecular switches and methods for their use
WO2008122084A1 (en) 2007-04-05 2008-10-16 Johnson & Johnson Research Pty Limited Nucleic acid enzymes and complexes and methods for their use
ES2559812T3 (en) * 2007-04-06 2016-02-16 Janssen Diagnostics Bvba Assay for detection of viral load with respiratory syncytial virus (RSV)
WO2010130731A1 (en) * 2009-05-12 2010-11-18 Virco Bvba Hiv-1-c resistance monitoring
US9051606B2 (en) 2010-09-10 2015-06-09 Qiagen Gaithersburg, Inc. Methods and compositions for nucleic acid detection
AU2013202354A1 (en) * 2012-06-18 2014-01-16 Speedx Pty Ltd Target detection and signal amplification
CN105907720B (en) * 2016-05-11 2019-09-13 南方医科大学 A kind of hiv inhibitor screening model and its preparation method and application
CN111404764B (en) * 2019-01-02 2021-11-19 中国移动通信有限公司研究院 Telecommunication cloud pre-integration deployment test method and device
CN113025746B (en) * 2019-12-09 2022-06-07 北京博奥晶典生物技术有限公司 Method for detecting REV by NASBA and kit used by same

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000029611A2 (en) * 1998-10-30 2000-05-25 Roche Diagnostics Gmbh Novel primers and probes for detecting hiv
WO2002020571A2 (en) * 2000-09-08 2002-03-14 Biomerieux B.V.A. Attenuated hiv strains and use thereof
EP1283272A2 (en) * 2001-08-08 2003-02-12 Tibotec Pharmaceuticals Ltd. Methods and means for assessing HIV envelope inhibitor therapy
WO2003011334A1 (en) * 2001-07-27 2003-02-13 Glaxosmithkline Biologicals S.A. Vaccine comprising gp120 and nef and/or tat for the immunisation against hiv
WO2003020878A2 (en) * 2001-09-04 2003-03-13 Abbott Laboratories Amplification and detection reagents for hiv-1

Family Cites Families (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4000159A (en) * 1974-06-28 1976-12-28 Phillips Petroleum Company Preparation of n,n-disubstituted thioamides
US4965188A (en) * 1986-08-22 1990-10-23 Cetus Corporation Process for amplifying, detecting, and/or cloning nucleic acid sequences using a thermostable enzyme
US4683202A (en) * 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
US4683195A (en) * 1986-01-30 1987-07-28 Cetus Corporation Process for amplifying, detecting, and/or-cloning nucleic acid sequences
US5176995A (en) * 1985-03-28 1993-01-05 Hoffmann-La Roche Inc. Detection of viruses by amplification and hybridization
US5888767A (en) * 1996-11-27 1999-03-30 The Johns Hopkins University School Of Medicine Method of using a conditionally replicating viral vector to express a gene
HU226203B1 (en) 1996-01-26 2008-06-30 Virco B V B A Method for determining of the chemotherapy of patients who are hiv positive based on the phenotypic drug sensitivity of human hiv strains
BR9908567A (en) * 1998-03-05 2000-12-12 Johnson & Johnson Res Pty Ltd Detection processes for zymogenic nucleic acid and related molecules and kits
GB9812768D0 (en) 1998-06-13 1998-08-12 Zeneca Ltd Methods
WO2000068436A1 (en) * 1999-05-07 2000-11-16 Nationales Zentrum Für Retroviren Detection system for human immunodeficiency virus based on nucleic acid amplification
EP1285971B1 (en) 2001-08-08 2007-10-10 Tibotec Pharmaceuticals Ltd. Methods for the phenotypic and genotypic assessment of the drug sensitivity of HIV integrase variants
US7468274B2 (en) * 2004-01-30 2008-12-23 The Johns Hopkins University Single cell analysis of HIV replication capacity and drug resistance
FR2869045A1 (en) * 2004-04-16 2005-10-21 Bioalliance Pharma Sa METHOD OF STUDYING THE GENETIC AND FUNCTIONAL VARIABILITY OF HIV AND KIT FOR ITS IMPLEMENTATION
ES2244332B1 (en) * 2004-05-10 2007-02-16 Fundacion Para La Investigacion Y La Prevencion Del Sida En España NEW RECOMBINANT VIRAL CLONES BASED ON HIV AND ITS USE IN ANALYTICAL METHODS.
DK2385141T3 (en) 2005-10-07 2013-10-28 Speedx Pty Ltd Multicomponent nucleic acid enzymes and methods for their use

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000029611A2 (en) * 1998-10-30 2000-05-25 Roche Diagnostics Gmbh Novel primers and probes for detecting hiv
WO2002020571A2 (en) * 2000-09-08 2002-03-14 Biomerieux B.V.A. Attenuated hiv strains and use thereof
WO2003011334A1 (en) * 2001-07-27 2003-02-13 Glaxosmithkline Biologicals S.A. Vaccine comprising gp120 and nef and/or tat for the immunisation against hiv
EP1283272A2 (en) * 2001-08-08 2003-02-12 Tibotec Pharmaceuticals Ltd. Methods and means for assessing HIV envelope inhibitor therapy
WO2003020878A2 (en) * 2001-09-04 2003-03-13 Abbott Laboratories Amplification and detection reagents for hiv-1

Also Published As

Publication number Publication date
AU2006323930A1 (en) 2007-06-14
WO2007065926A1 (en) 2007-06-14
EP1960554B1 (en) 2011-06-08
ATE512235T1 (en) 2011-06-15
CN101365808B (en) 2012-04-25
CN101365808A (en) 2009-02-11
US20100035229A1 (en) 2010-02-11
CA2631881C (en) 2015-03-24
CA2631881A1 (en) 2007-06-14
EP1960554A1 (en) 2008-08-27
US8673551B2 (en) 2014-03-18

Similar Documents

Publication Publication Date Title
AU2006323930B2 (en) Methods, plasmid vectors and primers for assessing HIV viral fitness
US6958211B2 (en) Methods of assessing HIV integrase inhibitor therapy
US9631220B2 (en) Method for designing a drug regime for HIV-infected patients
US9458516B2 (en) Kit for detecting bovine leukemia virus(BLV), and use thereof
CN110055353B (en) Internal reference-containing double isothermal nucleic acid amplification method for rapidly detecting 7-type adenovirus
US8076062B2 (en) Mutational profiles in HIV-1 protease correlated with phenotypic drug resistance
EP1285971B1 (en) Methods for the phenotypic and genotypic assessment of the drug sensitivity of HIV integrase variants
Kondo et al. Quantitation of HIV-1 group M proviral DNA using TaqMan MGB real-time PCR
JP2023552693A (en) System for detecting target gene mutations and viral genomes, and methods for producing and using the same
AU785387B2 (en) Sequences and methods for detection of HIV-1
AU2007239535B2 (en) Methods and means for assessing HIV gag/protease inhibitor therapy
AU2003251731C1 (en) New mutational profiles in HIV-1 reverse transcriptase correlated with phenotypic drug resistance

Legal Events

Date Code Title Description
PC1 Assignment before grant (sect. 113)

Owner name: TIBOTEC PHARMACEUTICALS LTD.; SPEEDX PTY LTD

Free format text: FORMER APPLICANT(S): JOHNSON & JOHNSON RESEARCH PTY LIMITED; TIBOTEC PHARMACEUTICALS LTD.

FGA Letters patent sealed or granted (standard patent)
PC Assignment registered

Owner name: SPEEDX PTY LTD; JANSSEN SCIENCES IRELAND UC

Free format text: FORMER OWNER WAS: SPEEDX PTY LTD; TIBOTEC PHARMACEUTICALS LTD.

MK14 Patent ceased section 143(a) (annual fees not paid) or expired