AU2006261226B2 - Novel genes and proteins of brachyspira pilosicoli and use of same for diagnosis and therapy - Google Patents

Description

WO 2006/136392 PCT/EP2006/005961 Novel Genes and Proteins of Brachyspirapilosicoli and Use of Same for Diagnosis and Therapy Field of Invention 5 This invention relates to novel genes in Brachyspirapilosicoli and the proteins encoded therein. This invention further relates to use of these novel genes and proteins for diagnosis of B. pilosicoli disease, vaccines against B. pilosicoli and for screening for compounds that kill B. pilosicoli or block the pathogenic effects of B. pilosicoli. These sequences may also be useful for diagnostic and therapeutic and/or prophylactic treatment of 10 diseases in animals caused by other Brachyspira species, including B. intermedia, B. alvinipulli, B. aalborgi, B. innocens, B. murdochii, and B. hyodysenteriae. Background of Invention Intestinal spirochaetosis, also known as colonic spirochaetosis or spirochaetal 15 diarrhoea, is an important production-limiting disease of pigs and adult layer and broiler breeder hens. Intestinal spirochaetosis results from infection of the large intestine with the intestinal spirochaete Brachyspira (formerly Serpulina) pilosicoli. This spirochaete also infects a number of other animal species, including dogs and horses, as well as human beings. The associated disease is best understood and has been most studied in pigs. The prevalence 20 of the infection in the Australian pig industry is uncertain, but studies in Europe and Scandinavia suggest that 30% or more of pig herds are infected. The associated disease is a colitis/typhlitis with intermittent diarrhoea and reduced growth rates. The economic significance of the disease in pigs is not clear, but it may be large because it is widespread. B. pilosicoli also commonly infects adult chickens. In a recent survey in Australia, intestinal 25 spirochaetes were recovered from 43% of broiler breeder flocks and 68% of layer flocks, and B. pilosicoli was the spirochaete involved in 44% of a subset of these flocks. Infected flocks on average had 14% wetter faeces than uninfected flocks. Experimental infection of broiler breeder hens with a B. pilosicoli isolate from this study resulted in a significant delay in onset of egg production and a sustained reduction in egg production. Besides layers, loss of egg 30 production in broiler breeder flocks can cause considerable disruption to the whole broiler industry. The costs of these problems are difficult to estimate, but the Industries are significant in Australia. The Chicken Meat Industry produces meat with a retail value of $2.5 billion, whilst the Egg Industry produces eggs valued at $340 million. 1 The role of B. pilosicoli as a pathogen of dogs and other animal species is still not firmly established, although it seems likely that it is capable of impacting on health to a greater or lesser extent depending on a number of other factors. B. pilosicoli also infects large numbers of people in developing countries. In developed countries 5 infection is mainly confined to immunocompromised individuals and homosexual males. It has been recorded as a cause of spirochaetaemia in elderly and/or immunocompromised individuals. The full extent of the pathogenic impact of B. pilosicoli in these human population groups is still debated. Few attempts have been made to develop means to control infections with B. 10 pilosicoli. Where intestinal spirochaetosis is identified as a problem in piggeries, animals are routinely treated with antimicrobials, although the disease tends to recur following withdrawal of treatment. The disease in chickens is not well understood, and the chicken industries have not specifically tried to control the infection. There is only one recorded study of the use of a vaccine to control intestinal spirochaetosis in pigs 15 and this autogenous bacterin failed to offer protection (Hampson DJ, Robertson ID, La T, Oxberry SL and Pethick DW. 2000. Influences of diet and vaccination on colonization of pigs by the intestinal spirochaete Brachyspira (Serpulina) pilosicoli. Veterinary Microbiology 74:75-84). Nevertheless, because there is a specific end-on attachment of the spirochaete to the large intestinal mucosa, it seems likely that this 20 colonisation can be reduced or prevented by the use of a suitable vaccine-induced immunity. The present invention provides novel B. pilosicoli amino acid sequences and the polynucleotide sequences that encode them, which have not been identified previously. The present invention also demonstrates that these novel amino acid sequences and 25 DNA sequences can be used for diagnostic assays and vaccines for B. pilosicoli. These sequences may also be useful for diagnostic and therapeutic and/or prophylactic treatment of diseases in animals caused by other Brachyspira species, including B. intermedia, B. alvinipulli, B. aalborgi, B. innocens, B. murdochii, and B. hyodysenteriae. 30 Brief Summary of Invention The present invention relates to novel genes from B. pilosicoli and the proteins encoded by those genes. Further, the present invention relates to novel genes and the proteins encoded by those genes can be used for therapeutic and diagnostic purposes. 35 One can use the genes and/or the proteins in a vaccine against B. pilosicoli and to diagnose B. pilosicoli infections. 2 17613661 (GHMatters) 14110/09 In a first aspect, the present invention provides an isolated polynucleotide comprising a sequence as shown in SEQ ID No: 3. In a second aspect, the present invention provides an isolated polypeptide comprising a sequence as shown in SEQ ID No: 4. s The present invention provides novel B. pilosicoli genes having the nucleotide sequence contained in SEQ ID NOs: 1, 3, 5, 7, and 9. An aspect of this invention provides nucleotide sequences that are homologous to SEQ ID NOs: 1, 3, 5, 7, and 9 where the homology can be 95%, 90%, 85%, 80%, 75% and 70%. This invention also includes a DNA vaccine or DNA immunogenic composition containing the nucleotide io sequence of SEQ ID NOs: 1, 3, 5, 7, and 9 and sequences that are 95%, 90%, 85%, 80%, 75% and 70% homologous to these sequences. This invention further includes a diagnostic assay containing DNA having the nucleotide sequence of SEQ ID NOs: 1, 3, 5, 7, and 9 and sequences that are 95%, 90%, 85%, 80%, 75% and 70% homologous to these sequences. 15 The present invention also provides plasmids containing DNA having the sequence of SEQ ID NOs: 1, 3, 5, 7, and 9; prokaryotic and/or eukaryotic expression vectors containing DNA having the sequence of SEQ ID NOs: 1, 3, 5, 7, and 9; and a cell containing the plasmids which contain DNA having the sequence of SEQ ID NOs: 1, 3, 5, 7, and 9. 20 This invention also provides novel B. pilosicoli proteins having the amino acid sequence contained in SEQ ID NOs: 2, 4, 6, 8, and 10. It is another object of this invention to have proteins that are 95%, 90%, 85%, 80%, 75% and 70% homologous to the sequences contained in SEQ ID NOs: 2, 4, 6, 8, and 10. In one aspect this invention provides a vaccine or immunogenic composition to contain the proteins having the 25 amino acid sequence contained in SEQ ID NOs: 2, 4, 6, 8, and 10, or amino acid sequences that are 95%, 90%, 85%, 80%, 75% and 70% homologous to the sequences contained in SEQ ID NOs: 2, 4, 6, 8, and 10. It is a further aspect of this invention to have a diagnostic kit containing one or more proteins having a sequence contained in SEQ ID NOs: 2, 4, 6, 8, and 10 or that are 95%, 90%, 85%, 80%, 75% and 70% 30 homologous to the sequences contained in SEQ ID NOs: 2, 4, 6, 8, and 10. It is another aspect of this invention to have nucleotide sequences which encode the proteins having the amino acid sequence contained in SEQ ID NOs: 2, 4, 6, 8, and 10. The invention also covers plasmids, eukaryotic and prokaryotic expression vectors, and DNA vaccines which contain DNA having a sequence which encodes a protein 35 having the amino acid sequence contained in SEQ ID NOs: 2, 4, 6, 8, and 10. Cells which contain these plasmids and expression vectors are included in this invention. 3 17613661 (GHMatters) 14/10/09 This invention includes monoclonal antibodies that bind to proteins having an amino acid sequence contained in SEQ ID NOs: 2, 4, 6, 8, and 10 or bind to proteins that are 95%, 90%, 85%, 80%, 75% and 70% homologous to the sequences contained in SEQ ID NOs: 2, 4, 6, 8, and 10. Diagnostic kits containing the monoclonal antibodies 5 that bind to proteins having an amino acid sequence contained in SEQ ID NOs: 2, 4, 6, 8, and 10 or bind to proteins that are 95%, 90%, 85%, 80%, 75% and 70% homologous to the sequences contained in SEQ ID NOs: 2, 4, 6, 8, and 10 are included in this invention. These diagnostic kits can detect the presence of B. pilosicoli in an animal. The animal is preferably any mammal and bird; more preferably, chicken, goose, duck, io turkey, parakeet, dog, cat, hamster, gerbil, rabbit, ferret, horse, cow, sheep, pig, monkey, and human. The invention also contemplates the method of preventing or treating an infection of B. pilosicoli in an animal by administering to an animal a DNA vaccine containing one or more nucleotide sequences listed in SEQ ID NOs: 1, 3, 5, 7, and 9 or is sequences that are 95%, 90%, 85%, 80%, 75% and 70% homologous to these sequences. This invention also covers a method of preventing or treating an infection of B. pilosicoli in an animal by administering to an animal a vaccine containing one or more proteins having the amino acid sequence containing in SEQ ID NOs: 2, 4, 6, 8, and 10 or sequences that are 95%, 90%, 85%, 80%, 75% and 70% homologous to these 20 sequences. The animal is preferably any mammal and bird; more preferably, chicken, goose, duck, turkey, parakeet, dog, cat, hamster, gerbil, rabbit, ferret, horse, cow, sheep, pig, monkey, and human. The invention also contemplates the method of generating an immune response in an animal by administering to an animal an immunogenic composition containing 25 one or more nucleotide sequences listed in SEQ ID NOs: 1, 3, 5, 7, and 9 or sequences that are 95%, 90%, 85%, 80%, 75% and 70% homologous to these sequences. This invention also covers a method of generating an immune response in an animal by administering to an animal an immunogenic composition containing one or more proteins having the amino acid sequence containing in SEQ ID NOs: 2, 4, 6, 8, and 10 30 or sequences that are 95%, 90%, 85%, 80%, 75% and 70% homologous to these sequences. The animal is preferably any mammal and bird; more preferably, chicken, goose, duck, turkey, parakeet, dog, cat, hamster, gerbil, rabbit, ferret, horse, cow, sheep, pig, monkey, and human. In the claims which follow and in the preceding description of the invention, 35 except where the context requires otherwise due to express language or necessary implication, the word "comprise" or variations such as "comprises" or "comprising" is 4 1761366_1 (GHMatters) 14/10/09 used in an inclusive sense, i.e. to specify the presence of the stated features but not to preclude the presence or addition of further features in various embodiments of the invention.It is to be understood that, if any prior art publication is referred to herein, such reference does not constitute an admission that the publication forms a part of the 5 common general knowledge in the art, in Australia or any other country. Detailed Summary of Invention The articles "a" and "an" are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, "an io element" means one element or more than one element. The term "amino acid" is intended to embrace all molecules, whether natural or synthetic, which include both an amino functionality and an acid functionality and capable of 4a 1761366_1 (GHMatters) 14/10109 WO 2006/136392 PCT/EP2006/005961 being included in a polymer of naturally-occurring amino acids. Exemplary amino acids include naturally-occurring amino acids; analogs, derivatives and congeners thereof; amino acid analogs having variant side chains; and all stereoisomers of any of any of the foregoing. An animal can be any mammal or bird. Examples of mammals include dog, cat, 5 hamster, gerbil, rabbit, ferret, horse, cow, sheep, pig, monkey, and human. Examples of birds include chicken, goose, duck, turkey, and parakeet. The term "conserved residue" refers to an amino acid that is a member of a group of amino acids having certain common properties. The term "conservative amino acid substitution" refers to the substitution (conceptually or otherwise) of an amino acid from one 10 such group with a different amino acid from the same group. A functional way to define common properties between individual amino acids is to analyze the normalized frequencies of amino acid changes between corresponding proteins of homologous organisms (Schulz, G. E. and R. H. Schinner., Principles of Protein Structure, Springer-Verlag). According to such analyses, groups of amino acids may be defined where amino acids within a group exchange 15 preferentially with each other, and therefore resemble each other most in their impact on the overall protein structure (Schulz, G. E. and R. H. Schirmer, Principles of Protein Structure, Springer-Verlag). Examples of amino acid groups defined in this manner include: (i) a positively-charged group containing Lys, Arg and His, (ii) a negatively-charged group containing Glu and Asp, (iii) an aromatic group containing Phe, Tyr and Trp, (iv) a nitrogen 20 ring group containing His and Trp, (v) a large aliphatic nonpolar group containing Val, Leu and De, (vi) a slightly-polar group containing Met and Cys, (vii) a small-residue group containing Ser, Thr, Asp, Asn, Gly, Ala, Glu, GIn and Pro, (viii) an aliphatic group containing Val, Leu, De, Met and Cys, and (ix) a small, hydroxyl group containing Ser and Thr. 25 A "fusion protein" or "fusion polypeptide" refers to a chimeric protein as that term is known in the art and may be constructed using methods known in the art. In many examples of fusion proteins, there are two different polypeptide sequences, and in certain cases, there may be more. The polynucleotide sequences encoding the fusion protein may be operably linked in frame so that the fusion protein may be translated correctly. A fusion protein may 30 include polypeptide sequences from the same species or from different species. In various embodiments, the. fusion polypeptide may contain one or more amino acid sequences linked to a first polypeptide. In the case where more than one amino acid sequence is fused to a first polypeptide, the fusion sequences may be multiple copies of the same sequence, or alternatively, may be different amino acid sequences. The fusion polypeptides may be fused 5 WO 2006/136392 PCT/EP2006/005961 to the N-terminus, the C-terminus, or the N- and C-terminus of the first polypeptide. Exemplary fusion proteins include polypeptides containing a glutathione S-transferase tag (GST-tag), histidine tag (His-tag), an immunoglobulin domain or an immunoglobulin binding domain. 5 The term "isolated polypeptide" refers to a polypeptide, in certain embodiments prepared from recombinant DNA or RNA, or of synthetic origin or natural origin, or some combination thereof, which (1) is not associated with proteins that it is normally found with in nature, (2) is separated from the cell in which it normally occurs, (3) is free of other proteins from the same cellular source, (4) is expressed by a cell from a different species, or 10 (5) does not occur in nature. It is possible for an isolated polypeptide to exist but not qualify as a purified polypeptide. The term "isolated nucleic acid" and "isolated polynucleotide" refers to a polynucleotide whether genomic DNA, cDNA, mRNA, tRNA, rRNA, iRNA, or a polynucleotide obtained from a cellular organelle (such as mitochondria and chloroplast), or 15 whether from synthetic origin, which (1) is not associated with the cell in which the "isolated nucleic acid" is found in nature, or (2) is operably linked to a polynucleotide to which it is not linked in nature. It is possible for an isolated polynucleotide to exist but not qualify as a purified polynucleotide. The term "nucleic acid" and "polynucleotide" refers to a polymeric form of 20 nucleotides, either ribonucleotides or deoxyribonucleotides or a modified form of either type of nucleotide. The terms should also be understood to include, as equivalents, analogs of either RNA or DNA made from nucleotide analogs, and, as applicable to the embodiment being described, single-stranded (such as sense or antisense) and double-stranded polynucleotides. 25 The term "nucleic acid of the invention" and "polynucleotide of the invention" refers to a nucleic acid encoding a polypeptide of the invention. A polynucleotide of the invention may comprise all, or a portion of, a subject nucleic acid sequence; a nucleotide sequence at least 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98% or 99% identical to a subject nucleic acid sequence; a nucleotide sequence that hybridizes under stringent conditions to a subject 30 nucleic acid sequence; nucleotide sequences encoding polypeptides that are functionally equivalent to polypeptides of the invention; nucleotide sequences encoding polypeptides at least about 60%, 70%, 80%, 85%, 90%, 95%, 98%, 99% homologous or identical with a subject amino acid sequence; nucleotide sequences encoding polypeptides having an activity of a polypeptide of the invention and having at least about 60%, 70%, 80%, 85%, 90%, 95%, 6 WO 2006/136392 PCT/EP2006/005961 98%, 99% or more homology or identity with a subject amino acid sequence; nucleotide sequences that differ by I to about 2, 3, 5, 7, 10, 15, 20, 30, 50, 75 or more nucleotide substitutions, additions or deletions, such as allelic variants, of a subject nucleic acid sequence; nucleic acids derived from and evolutionarily related to a subject nucleic acid 5 sequence; and complements of, and nucleotide sequences resulting from the degeneracy of the genetic code, for all of the foregoing and other nucleic acids of the invention. Nucleic acids of the invention also include homologs, e.g., orthologs and paralogs, of a subject nucleic acid sequence and also variants of a subject nucleic acid sequence which have been codon optimized for expression in a particular organism (e.g., host cell). 10 The term "operably linked", when describing the relationship between two nucleic acid regions, refers to a juxtaposition wherein the regions are in a relationship permitting them to function in their intended manner. For example, a control sequence "operably linked" to a coding sequence is ligated in such a way that expression of the coding sequence is achieved under conditions compatible with the control sequences, such as when the 15 appropriate molecules (e.g., inducers and polymerases) are bound to the control or regulatory sequence(s). The term "polypeptide", and the terms "protein" and "peptide" which are used interchangeably herein, refers to a polymer of amino acids. Exemplary polypeptides include gene products, naturally-occurring proteins, homologs, orthologs, paralogs, fragments, and 20 other equivalents, variants and analogs of the foregoing. The terms "polypeptide fragment" or "fragment", when used in reference to a reference polypeptide, refers to a polypeptide in which amino acid residues are deleted as compared to the reference polypeptide itself, but where the remaining amino acid sequence is usually identical to the corresponding positions in the reference polypeptide. Such deletions 25 may occur at the amino-terminus or carboxy-terminus of the reference polypeptide, or alternatively both. Fragments typically are at least 5, 6, 8 or 10 amino acids long, at least 14 amino acids long, at least 20, 30, 40 or 50 amino acids long, at least 75 amino acids long, or at least 100, 150,200,300,500 or more amino acids long. A fragment can retain one or more of the biological activities of the reference polypeptide. In certain embodiments, a fragment 30 may comprise a domain having the desired biological activity, and optionally additional amino acids on one or both sides of the domain, which additional amino acids may number from 5, 10, 15, 20, 30, 40, 50, or up to 100 or more residues. Further, fragments can include a sub-fragment of a specific region, which sub-fragment retains a function of the region from which it is derived. In another embodiment, a fragment may have immunogenic properties. 7 WO 2006/136392 PCT/EP2006/005961 The term "polypeptide of the invention" refers to a polypeptide containing a subject amino acid sequence, or an equivalent or fragment thereof. Polypeptides of the invention include polypeptides containing all or a portion of a subject amino acid sequence; a subject amino acid sequence with I to about 2, 3, 5, 7, 10, 15, 20, 30, 50, 75 or more conservative 5 amino acid substitutions; an amino acid sequence that is at least 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, or 99% identical to a subject amino acid sequence; and functional fragments thereof. Polypeptides of the invention also include homologs, e.g., orthologs and paralogs, of a subject amino acid sequence. It is also possible to modify the structure of the polypeptides of the invention for such 10 purposes as enhancing therapeutic or prophylactic efficacy, or stability (e.g., ex vivo shelf life, resistance to proteolytic degradation in vivo, etc.). Such modified polypeptides, when designed to retain at least one activity of the naturally-occurring form of the protein, are considered "functional equivalents" of the polypeptides described in more detail herein. Such modified polypeptides may be produced, for instance, by amino acid substitution, deletion, or 15 addition, which substitutions may consist in whole or part by conservative amino acid substitutions. For instance, it is reasonable to expect that an isolated conservative amino acid substitution, such as replacement of a leucine with an isoleucine or valine, an aspartate with a glutamate, a threonine with a serine, will not have a major affect on the biological activity of 20 the resulting molecule. Whether a change in the amino acid sequence of a polypeptide results in a functional homolog may be readily determined by assessing the ability of the variant polypeptide to produce a response similar to that of the wild-type protein. Polypeptides in which more than one replacement has taken place may readily be tested in the same manner. The term "purified" refers to an object species that is the predominant species present 25 (i.e., on a molar basis it is more abundant than any other individual species in the composition). A "purified fraction" is a composition wherein the object species is at least about 50 percent (on a molar basis) of all species present. In making the determination of the purity or a species in solution or dispersion, the solvent or matrix in which the species is dissolved or dispersed is usually not included in such determination; instead, only the species 30 (including the one of interest) dissolved or dispersed are taken into account. Generally, a purified composition will have one species that is more than about 80% of all species present in the composition, more than about 85%, 90%, 95%, 99% or more of all species present. The object species may be purified to essential homogeneity (contaminant species cannot be detected in the composition by conventional detection methods) wherein the composition is 8 WO 2006/136392 PCT/EP2006/005961 essentially a single species. A skilled artisan may purify a polypeptide of the invention using standard techniques for protein purification in light of the teachings herein. Purity of a polypeptide may be determined by a number of methods known to those of skill in the art, including for example, amino-terminal amino acid sequence analysis, gel electrophoresis, 5 mass-spectrometry analysis and the methods described herein. The terms "recombinant protein" or "recombinant polypeptide" refer to a polypeptide which is produced by recombinant DNA techniques. An example of such techniques includes the case when DNA encoding the expressed protein is inserted into a suitable expression vector which is in turn used to transform a host cell to produce the protein or 10 polypeptide encoded by the DNA. The term "regulatory sequence" is a generic term used throughout the specification to refer to polynucleotide sequences, such as initiation signals, enhancers, regulators and promoters, that are necessary or desirable to affect the expression of coding and non-coding sequences to which they are operably linked. Exemplary regulatory sequences are described 15 in Goeddel; Gene Expression Technology: Methods in Enzymology, Academic Press, San Diego, CA (1990), and include, for example, the early and late promoters of SV40, adenovirus or cytomegalovirus immediate early promoter, the lac system, the trp system, the TAC or TRC system, T7 promoter whose expression is directed by T7 RNA polymerase, the major operator and promoter regions of phage lambda, the control regions for fd coat protein, 20 the promoter for 3-phosphoglycerate kinase or other glycolytic enzymes, the promoters of acid phosphatase (e.g., Pho5), the promoters of the yeast a-mating factors, the polyhedron promoter of the baculovirus system and other sequences known to control the expression of genes of prokaryotic or eukaryotic cells or their viruses, and various combinations thereof. The nature and use of such control sequences may differ depending upon the host organism. 25 In prokaryotes, such regulatory sequences generally include promoter, ribosomal binding site, and transcription termination sequences. The term "regulatory sequence" is intended to include, at a minimum, components whose presence may influence expression, and may also include additional components whose presence is advantageous, for example, leader sequences and fusion partner sequences. In certain embodiments, transcription of a 30 polynucleotide sequence is under the control of a promoter sequence (or other regulatory sequence) which controls the expression of the polynucleotide in a cell-type in which expression is intended. It will also be understood that the polynucleotide can be under the control of regulatory sequences which are the same or different from those sequences which control expression of the naturally-occurring form of the polynucleotide. 9 WO 2006/136392 PCT/EP2006/005961 The term "sequence homology" refers to the proportion of base matches between two nucleic acid sequences or the proportion of amino acid matches between two amino acid sequences. When sequence homology is expressed as a percentage, e.g., 50%, the percentage denotes the proportion of matches over the length of sequence from a desired sequence that is 5 compared to some other sequence. Gaps (in either of the two sequences) are permitted to maximize matching; gap lengths of 15 bases or less are usually used, 6 bases or less are used more frequently, with 2 bases or less used even more frequently. The term "sequence identity" means that sequences are identical (i.e., on a nucleotide-by-nucleotide basis for nucleic acids or amino acid-by-amino acid basis for polypeptides) over a window of 10 comparison. The term "percentage of sequence identity" is calculated by comparing two optimally aligned sequences over the comparison window, determining the number of positions at which the identical amino acids or nucleotides occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the comparison window, and multiplying the result by 100 to yield the 15 percentage of sequence identity. Methods to calculate sequence identity are known to those of skill in the art and described in further detail below. The term "soluble" as used herein with reference to a polypeptide of the invention or other protein, means that upon expression in cell culture, at least some portion of the polypeptide or protein expressed remains in the cytoplasmic fraction of the cell and does not 20 fractionate with the cellular debris upon lysis and centrifugation of the lysate. Solubility of a polypeptide may be increased by a variety of art recognized methods, including fusion to a heterologous amino acid sequence, deletion of amino acid residues, amino acid substitution (e.g., enriching the sequence with amino acid residues having hydrophilic side chains), and chemical modification (e.g., addition of hydrophilic groups). 25 The solubility of polypeptides may be measured using a variety of art recognized techniques, including, dynamic light scattering to determine aggregation state, UV absorption, centrifugation to separate aggregated from non-aggregated material, and SDS gel electrophoresis (e.g., the amount of protein in the soluble fraction is compared to the amount of protein in the soluble and insoluble fractions combined). When expressed in a host cell, 30 the polypeptides of the invention may be at least about 1%, 2%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more soluble, e.g., at least about 1%, 2%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more of the total amount of protein expressed in the cell is found in the cytoplasmic fraction. In certain embodiments, a one liter culture of cells expressing a polypeptide of the invention will produce at least about 0.1, 0.2, 0.5, 1, 2, 10 WO 2006/136392 PCT/EP2006/005961 5, 10, 20, 30, 40, 50 milligrams of more of soluble protein. In an exemplary embodiment, a polypeptide of the invention is at least about 10% soluble and will produce at least about 1 milligram of protein from a one liter cell culture. The term "specifically hybridizes" refers to detectable and specific nucleic acid 5 binding. Polynucleotides, oligonucleotides and nucleic acids of the invention selectively hybridize to nucleic acid strands under hybridization and wash conditions that minimize appreciable amounts of detectable binding to nonspecific nucleic acids. Stringent conditions may be used to achieve selective hybridization conditions as known in the art and discussed herein. Generally, the nucleic acid sequence homology between the polynucleotides, 10 oligonucleotides, and nucleic acids of the invention and a nucleic acid sequence of interest will be at least 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, 98%, 99%, or more. In certain instances, hybridization and washing conditions are performed under stringent conditions according to conventional hybridization procedures and as described further herein. 15 The terms "stringent conditions" or "stringent hybridization conditions" refer to conditions which promote specific hybridization between two complementary polynucleotide strands so as to form a duplex. Stringent conditions may be selected to be about 5'C lower than the thermal melting point (Tm) for a given polynucleotide duplex at a defined ionic strength and pH. The length of the complementary polynucleotide strands and their GC 20 content will determine the Tm of the duplex, and thus the hybridization conditions necessary for obtaining a desired specificity of hybridization. The Tm is the temperature (under defined ionic strength and pH) at which 50% of a polynucleotide sequence hybridizes to a perfectly matched complementary strand. In certain cases it may be desirable to increase the stringency of the hybridization conditions to be about equal to the Tm for a particular duplex. 25 A variety of techniques for estimating the Tm are available. Typically, G-C base pairs in a duplex are estimated to contribute about 3*C to the Tm, while A-T base pairs are estimated to contribute about 2*C, up to a theoretical maximum of about 80-100 C. However, more sophisticated models of Tm are available in which G-C stacking interactions, solvent effects, the desired assay temperature and the like are taken into account. 30 For example, probes can be designed to have a dissociation temperature (Td) of approximately 60'C, using the formula: Td = (((3 x #GC) + (2 x #AT)) x 37) - 562)/#bp) - 5; where #GC, #AT, and #bp are the number of guanine-cytosine base pairs, the number of adenine-thymine base pairs, and the number of total base pairs, respectively, involved in the formation of the duplex. 11 WO 2006/136392 PCT/EP2006/005961 Hybridization may be carried out in 5x SSC, 4x SSC, 3x SSC, 2x SSC, 1x SSC or 0.2x SSC for at least about 1 hour, 2 hours, 5 hours, 12 hours, or 24 hours. The temperature of the hybridization may be increased to adjust the stringency of the reaction, for example, from about 25*C (room temperature), to about 45'C, 50*C, 55*C, 60*C, or 65*C. The 5 hybridization reaction may also include another agent affecting the stringency, for example, hybridization conducted in the presence of 50% formamide increases the stringency of hybridization at a defined temperature. The hybridization reaction may be followed by a single wash step, or two or more wash steps, which may be at the same or a different salinity and temperature. For example, 10 the temperature of the wash may be increased to adjust the stringency from about 25*C (room temperature), to about 45*C, 50*C, 55*C, 60'C, 65*C, or higher. The wash step may be conducted in the presence of a detergent, e.g., 0.1 or 0.2% SDS. For example, hybridization may be followed by two wash steps at 65*C each for about 20 minutes in 2x SSC, 0.1% SDS, and optionally two additional wash steps at 65*C each for about 20 minutes in 0.2x SSC, 15 0.1%SDS. Exemplary stringent hybridization conditions include overnight hybridization at 65*C in a solution containing 50% formamide, 1Ox Denhardt (0.2% Ficoll, 0.2% polyvinylpyrrolidone, 0.2% bovine serum albumin) and 200 pg/ml of denatured carrier DNA, e.g., sheared salmon sperm DNA, followed by two wash steps at 65*C each for about 20 20 minutes in 2x SSC, 0.1% SDS, and two wash steps at 65*C each for about 20 minutes in 0.2x SSC, 0.1% SDS. Hybridization may consist of hybridizing two nucleic acids in solution, or a nucleic acid in solution to a nucleic acid attached to a solid support, e.g., a filter. When one nucleic acid is on a solid support, a prehybridization step may be conducted prior to hybridization. 25 Prehybridization may be carried out for at least about 1 hour, 3 hours or 10 hours in the same solution and at the same temperature as the hybridization solution (without the complementary polynucleotide strand). Appropriate stringency conditions are known to those skilled in the art or may be determined experimentally by the skilled artisan. See, for example, Current Protocols in 30 Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.1-12.3.6; Sambrook et al., 1989, Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Press, N.Y.; S. Agrawal (ed.) Methods in Molecular Biology, volume 20; Tijssen (1993) Laboratory Techniques in Biochemistry and Molecular Biology -- Hybridization With Nucleic Acid Probes, e.g., part I chapter 2 "Overview of principles of hybridization and the strategy of nucleic acid probe 12 WO 2006/136392 PCT/EP2006/005961 assays", Elsevier, New York; and Tibanyenda, N. et al., Eur. J. Biochem. 139:19 (1984) and Ebel, S. et al., Biochem. 31:12083 (1992). The term "vector" refers to a nucleic acid capable of transporting another nucleic acid to which it has been linked. One type of vector which may be used in accord with the 5 invention is an episome, i.e., a nucleic acid capable of extra-chromosomal replication. Other vectors include those capable of autonomous replication and expression of nucleic acids to which they are linked. Vectors capable of directing the expression of genes to which they are operatively linked are referred to herein as "expression vectors". In general, expression vectors of utility in recombinant DNA techniques are often in the form of "plasmids" which 10 refer to circular double stranded DNA molecules which, in their vector form are not bound to the chromosome. In the present specification, "plasmid" and "vector" are used interchangeably as the plasmid is the most commonly used form of vector. However, the invention is intended to include such other forms of expression vectors which serve equivalent functions and which become known in the art subsequently hereto. 15 The nucleic acids of the invention may be used as diagnostic reagents to detect the presence or absence of the target DNA or RNA sequences to which they specifically bind, such as for determining the level of expression of a nucleic acid of the invention. In one aspect, the present invention contemplates a method for detecting the presence of a nucleic acid of the invention or a portion thereof in a sample, the method of the steps of: (a) 20 providing an oligonucleotide at least eight nucleotides in length, the oligonucleotide being complementary to a portion of a nucleic acid of the invention; (b) contacting the oligonucleotide with a sample containing at least one nucleic acid under conditions that permit hybridization of the oligonucleotide with a nucleic acid of the invention or a portion thereof; and (c) detecting hybridization of the oligonucleotide to a nucleic acid in the sample, 25 thereby detecting the presence of a nucleic acid of the invention or a portion thereof in the sample. In another aspect, the present invention contemplates a method for detecting the presence of a nucleic acid of the invention or a portion thereof in a sample, by (a) providing a pair of single stranded oligonucleotides, each of which is at least eight nucleotides in length, complementary to sequences of a nucleic acid of the invention, and wherein the sequences to 30 which the oligonucleotides are complementary are at least ten nucleotides apart; and (b) contacting the oligonucleotides with a sample containing at least one nucleic acid under hybridization conditions; (c) amplifying the nucleotide sequence between the two oligonucleotide primers; and (d) detecting the presence of the amplified sequence, thereby detecting the presence of a nucleic acid of the invention or a portion thereof in the sample. 13 WO 2006/136392 PCT/EP2006/005961 In another aspect of the invention, the polynucleotide of the invention is provided in an expression vector containing a nucleotide sequence encoding a polypeptide of the invention and operably linked to at least one regulatory sequence. It should be understood that the design of the expression vector may depend on such factors as the choice of the host 5 cell to be transformed and/or the type of protein desired to be expressed. The vector's copy number, the ability to control that copy number and the expression of any other protein encoded by the vector, such as antibiotic markers, should be considered. An expression vector containing the polynucleotide of the invention can then be used as a pharmaceutical agent to treat an animal infected with B. pilosicoli or as a vaccine (also a 10 pharmaceutical agent) to prevent an animal from being infected with B. pilosicoli, or to reduce the symptoms and course of the disease if the animal does become infected. One manner of using an expression vector as a pharmaceutical agent is to administer a nucleic acid vaccine to the animal at risk of being infected or to the animal after being infected. Nucleic acid vaccine technology is well-described in the art. Some descriptions can be found 15 in U.S. Patent 6,562,376 (Hooper et al.); U.S. Patent 5,589,466 (Felgner, et al.); U.S. Patent 6,673,776 (Felgner, et al.); and U.S. Patent 6,710,035 (Felgner, et al.). Nucleic acid vaccines can be injected into muscle or intradermally, can be electroporated into the animal (see WO 01/23537, King et al.; and WO 01/68889, Malone et al.), via lipid compositions (see U.S. Patent 5,703,055, Felgner, et al), or other mechanisms known in the art field. 20 Expression vectors can also be transfected into bacteria which can be administered to the target animal to induce an immune response to the protein encoded by the nucleotides of this invention contained on the expression vector. The expression vector can contain eukaryotic expression sequences such that the nucleotides of this invention are transcribed and translated in the host animal. Alternatively, the expression vector can be transcribed in 25 the bacteria and then translated in the host animal. The bacteria used as a carrier of the expression vector should be attenuated but still invasive. One can use Shigella spp., Salmonella spp., Escherichia spp., and Aeromonas spp., just to name a few, that have been attenuated but still invasive. Examples of these methods can be found in U.S. Patent 5,824,538 (Branstrom et al); U.S. Patent 5,877,159 (Powell, et al.); U.S. Patent 6,150,170 30 (Powell, et al.); U.S. Patent 6,500,419 (Hone, et al.); and U.S. Patent 6,682,729 (Powell, et al.). Alternatively, the polynucleotides of this invention can be placed in certain viruses which act a vector. Viral vectors can either express the proteins of this invention on the surface of the virus, or carry polynucleotides of this invention into an animal cell where the 14 WO 2006/136392 PCT/EP2006/005961 polynucleotide is transcribed and translated into a protein. The animal infected with the viral vectors can develop an immune response to the proteins encoded by the polynucleotides of this invention. Thereby one can alleviate or prevent an infection by B. pilosicoli in the animal which received the viral vectors. Examples of viral vectors can be found U.S. Patent 5 5,283,191 (Morgan et al.); U.S. Patent 5,554,525 (Sondermeijer et al) and U.S. Patent 5,712,118 (Murphy). The polynucleotide of the invention may be used to cause expression and over expression of a polypeptide of the invention in cells propagated in culture, e.g. to produce proteins or polypeptides, including fusion proteins or polypeptides. 10 This invention pertains to a host cell transfected with a recombinant gene in order to express a polypeptide of the invention. The host cell may be any prokaryotic or eukaryotic cell. For example, a polypeptide of the invention may be expressed in bacterial cells, such as E. coli, insect cells (baculovirus), yeast, plant, or mammalian cells. In those instances when the host cell is human, it may or may not be in a live subject. Other suitable host cells are 15 known to those skilled in the art. Additionally, the host cell may be supplemented with tRNA molecules not typically found in the host so as to optimize expression of the polypeptide. Alternatively, the nucleotide sequence may be altered to optimize expression in the host cell, yet the protein produced would have high homology to the originally encoded protein. Other methods suitable for maximizing expression of the polypeptide will be known to those in the 20 art. The present invention further pertains to methods of producing the polypeptides of the invention. For example, a host cell transfected with an expression vector encoding a polypeptide of the invention may be cultured under appropriate conditions to allow expression of the polypeptide to occur. The polypeptide may be secreted and isolated from a 25 mixture of cells and medium containing the polypeptide. Alternatively, the polypeptide may be retained cytoplasmically and the cells harvested, lysed and the protein isolated. A cell culture includes host cells, media and other byproducts. Suitable media for cell culture are well known in the art. The polypeptide may be isolated from cell culture medium, host cells, or both using techniques known in the art for purifying proteins, including ion 30 exchange chromatography, gel filtration chromatography, ultrafiltration, electrophoresis, and immunoaffinity purification with antibodies specific for particular epitopes of a polypeptide of the invention. Thus, a nucleotide sequence encoding all or a selected portion of polypeptide of the invention, may be used to produce a recombinant form of the protein via microbial or 15 WO 2006/136392 PCT/EP2006/005961 eukaryotic cellular processes. Ligating the sequence into a polynucleotide construct, such as an expression vector, and transforming or transfecting into hosts, either eukaryotic (yeast, avian, insect or mammalian) or prokaryotic (bacterial cells), are standard procedures. Similar procedures, or modifications thereof, may be employed to prepare recombinant polypeptides 5 of the invention by microbial means or tissue-culture technology. Suitable vectors for the expression of a polypeptide of the invention include plasmids of the types: pTrcHis-derived plasmids, pET-derived plasmids, pBR322-derived plasmids, pEMBL-derived plasmids, pEX-derived plasmids, pBTac-derived plasmids and pUC-derived plasmids for expression in prokaryotic cells, such as E. coli. The various methods employed 10 in the preparation of the plasmids and transformation of host organisms are well known in the art. For other suitable expression systems for both prokaryotic and eukaryotic cells, as well as general recombinant procedures, see Molecular Cloning, A Laboratory Manual, 2nd Ed., ed. by Sambrook, Fritsch and Maniatis (Cold Spring Harbor Laboratory Press, 1989) Chapters 16 and 17. 15 Coding sequences for a polypeptide of interest may be incorporated as a part of a fusion gene including a nucleotide sequence encoding a different polypeptide. The present invention contemplates an isolated polynucleotide containing a nucleic acid of the invention and at least one heterologous sequence encoding a heterologous peptide linked in frame to the nucleotide sequence of the nucleic acid of the invention so as to encode a fusion protein 20 containing the heterologous polypeptide. The heterologous polypeptide may be fused to (a) the C-terminus of the polypeptide of the invention, (b) the N-terminus of the polypeptide of the invention, or (c) the C-terminus and the N-terminus of the polypeptide of the invention. In certain instances, the heterologous sequence encodes a polypeptide permitting the detection, isolation, solubilization and/or stabilization of the polypeptide to which it is fused. 25 In still other embodiments, the heterologous sequence encodes a polypeptide such as a poly His tag, myc, HA, GST, protein A, protein G, calmodulin-binding peptide, thioredoxin, maltose-binding protein, poly arginine, poly His-Asp, FLAG, a portion of an immunoglobulin protein, and a transcytosis peptide. Fusion expression systems can be useful when it is desirable to produce an 30 immunogenic fragment of a polypeptide of the invention. For example, the VP6 capsid protein of rotavirus may be used as an immunologic carrier protein for portions of polypeptide, either in the monomeric form or in the form of a viral particle. The nucleic acid sequences corresponding to the portion of a polypeptide of the invention to which antibodies are to be raised may be incorporated into a fusion gene construct which includes coding 16 WO 2006/136392 PCT/EP2006/005961 sequences for a late vaccinia virus structural protein to produce a set of recombinant viruses expressing fusion proteins comprising a portion of the protein as part of the virion. The Hepatitis B surface antigen may also be utilized in this role as well. Similarly, chimeric constructs coding for fusion proteins containing a portion of a polypeptide of the invention 5 and the poliovirus capsid protein may be created to enhance immunogenicity (see, for example, EP Publication NO: 0259149; and Evans et al., (1989) Nature 339:385; Huang et al., (1988) J. Virol. 62:3855; and Schlienger et al., (1992) J. Virol. 66:2). Fusion proteins may facilitate the expression and/or purification of proteins. For example, a polypeptide of the invention may be generated as a glutathione-S-transferase 10 (GST) fusion protein. Such GST fusion proteins may be used to simplify purification of a polypeptide of the invention, such as through the use of glutathione-derivatized matrices (see, for example, Current Protocols in Molecular Biology, eds. Ausubel et al., (N.Y.: John Wiley & Sons, 1991)). In another embodiment, a fusion gene coding for a purification leader sequence, such as a poly-(His)/enterokinase cleavage site sequence at the N-terminus of the 15 desired portion of the recombinant protein, may allow purification of the expressed fusion protein by affinity chromatography using a Ni 2 + metal resin. The purification leader sequence may then be subsequently removed by treatment with enterokinase to provide the purified protein (e.g., see Hochuli et al., (1987) J. Chromatography 411: 177; and Janknecht et al., PNAS USA 88:8972). 20 Techniques for making fusion genes are well known. Essentially, the joining of various DNA fragments coding for different polypeptide sequences is performed in accordance with conventional techniques, employing blunt-ended or stagger-ended termini for ligation, restriction enzyme digestion to provide for appropriate termini, filling-in of cohesive ends as appropriate, alkaline phosphatase treatment to avoid undesirable joining, 25 and enzymatic ligation. In another embodiment, the fusion gene may be synthesized by conventional techniques including automated DNA synthesizers. Alternatively, PCR amplification of gene fragments may be carried out using anchor primers which give rise to complementary overhangs between two consecutive gene fragments which may subsequently be annealed to generate a chimeric gene sequence (see, for example, Current Protocols in 30 Molecular Biology, eds. Ausubel et al., John Wiley & Sons: 1992). In other embodiments, the invention provides for nucleic acids of the invention immobilized onto a solid surface, including, plates, microtiter plates, slides, beads, particles, spheres, films, strands, precipitates, gels, sheets, tubing, containers, capillaries, pads, slices, etc. The nucleic acids of the invention may be immobilized onto a chip as part of an array. 17 WO 2006/136392 PCT/EP2006/005961 The array may contain one or more polynucleotides of the invention as described herein. In one embodiment, the chip contains one or more polynucleotides of the invention as part of an array of polynucleotide sequences from the same pathogenic species as such polynucleotide(s). 5 In a preferred form of the invention there is provided isolated B. pilosicoli polypeptides as herein described, and also the polynucleotide sequences encoding these polypeptides. More desirably the B. pilosicoli polypeptides are provided in substantially purified form. Preferred polypeptides of the invention will have one or more biological properties 10 (e.g., in vivo, in vitro or immunological properties) of the native full-length polypeptide. Non-functional polypeptides are also included within the scope of the invention because they may be useful, for example, as antagonists of the functional polypeptides. The biological properties of analogues, fragments, or derivatives relative to wild type may be determined, for example, by means of biological assays. 15 Polypeptides, including analogues, fragments and derivatives, can be prepared synthetically (e.g., using the well known techniques of solid phase or solution phase peptide synthesis). Preferably, solid phase synthetic techniques are employed. Alternatively, the polypeptides of the invention can be prepared using well known genetic engineering techniques, as described infra. In yet another embodiment, the polypeptides can be purified 20 (e.g., by immunoaffinity purification) from a biological fluid, such as but not limited to plasma, faeces, serum, or urine from animals, including, but not limited to, pig, chicken, goose, duck, turkey, parakeet, human, monkey, dog, cat, horse, hamster, gerbil, rabbit, ferret, horse, cattle, and sheep. An animal can be any mammal, fish, or bird. The B. pilosicoli polypeptide analogues include those polypeptides having the amino 25 acid sequence, wherein one or more of the amino acids are substituted with another amino acid which substitutions do not substantially alter the biological activity of the molecule. According to the invention, the polypeptides of the invention produced recombinantly or by chemical synthesis and fragments or other derivatives or analogues thereof, including fusion proteins, may be used as an immunogen to generate antibodies that recognize the 30 polypeptides. A molecule is "antigenic" when it is capable of specifically interacting with an antigen recognition molecule of the immune system, such as an immunoglobulin (antibody) or T cell antigen receptor. An antigenic amino acid sequence contains at least about 5, and preferably at least about 10, amino acids. An antigenic portion of a molecule can be the portion that is 18 WO 2006/136392 PCT/EP2006/005961 immunodominant for antibody or T cell receptor recognition, or it can be a portion used to generate an antibody to the molecule by conjugating the antigenic portion to a carrier molecule for immunization. A molecule that is antigenic need not be itself immunogenic, i.e., capable of eliciting an immune response without a carrier. 5 An "antibody" is any immunoglobulin, including antibodies and fragments thereof, that binds a specific epitope. The term encompasses polyclonal, monoclonal, and chimeric antibodies, the last mentioned described in further detail in U.S. Patent Nos. 4,816,397 and 4,816,567, as well as antigen binding portions of antibodies, including Fab, F(ab') 2 and F(v) (including single chain antibodies). Accordingly, the phrase "antibody molecule" in its 10 various grammatical forms as used herein contemplates both an intact immunoglobulin molecule and an immunologically active portion of an immunoglobulin molecule containing the antibody combining site. An "antibody combining site" is that structural portion of an antibody molecule comprised of heavy and light chain variable and hypervariable regions that specifically binds an antigen. 15 Exemplary antibody molecules are intact immunoglobulin molecules, substantially intact immunoglobulin molecules and those portions of an immunoglobulin molecule that contain the paratope, including those portions known in the art as Fab, Fab', F(ab') 2 and F(v), which portions are preferred for use in the therapeutic methods described herein. Fab and F(ab') 2 portions of antibody molecules are prepared by the proteolytic 20 reaction of papain and pepsin, respectively, on substantially intact antibody molecules by methods that are well-known. See for example, U.S. Patent No. 4,342,566 to Theofilopolous et al. Fab' antibody molecule portions are also well-known and are produced from F(ab') 2 portions followed by reduction with mercaptoethanol of the disulfide bonds linking the two heavy chain portions, and followed by alkylation of the resulting protein mercaptan with a 25 reagent such as iodoacetamide. An antibody containing intact antibody molecules is preferred herein. The phrase "monoclonal antibody" in its various grammatical forms refers to an antibody having only one species of antibody combining site capable of immunoreacting with a particular antigen. A monoclonal antibody thus typically displays a single binding affinity 30 for any antigen with which it immunoreacts. A monoclonal antibody may therefore contain an antibody molecule having a plurality of antibody combining sites, each immunospecific for a different antigen; e.g., a bispecific (chimeric) monoclonal antibody. The term "adjuvant" refers to a compound or mixture that enhances the immune response to an antigen. An adjuvant can serve as a tissue depot that slowly releases the 19 WO 2006/136392 PCT/EP2006/005961 antigen and also as a lymphoid system activator that non-specifically enhances the immune response [Hood et al., in Immunology, p. 384, Second Ed., Benjamin/Cummings, Menlo Park, California (1984)]. Often, a primary challenge with an antigen alone, in the absence of an adjuvant, will fail to elicit a humoral or cellular immune response. Adjuvants include, but 5 are not limited to, complete Freund's adjuvant, incomplete Freund's adjuvant, saponin, mineral gels such as aluminium hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil or hydrocarbon emulsions, keyhole limpet hemocyanins, dinitrophenol, and potentially useful human adjuvants such as BCG (bacillus Calmette-Guerin) and Corynebacterium parvum. Preferably, the adjuvant is 10 pharmaceutically acceptable. Various procedures known in the art may be used for the production of polyclonal antibodies to the polypeptides of the invention. For the production of antibody, various host animals can be immunised by injection with the polypeptide of the invention, including but not limited to rabbits, mice, rats, sheep, goats, etc. In one embodiment, a polypeptide of the 15 invention can be conjugated to an immunogenic carrier, e.g., bovine serum albumin (BSA) or keyhole limpet hemocyanin (KLH). Various adjuvants may be used to increase the immunological response, depending on the host species, including but not limited to Freund's (complete and incomplete), mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, 20 keyhole limpet hemocyanins, dinitrophenol, and potentially useful human adjuvants such as BCG (bacille Calmette-Guerin) and Corynebacterium parvum. For preparation of monoclonal antibodies directed toward a polypeptide of the invention, any technique that provides for the production of antibody molecules by continuous cell lines in culture may be used. These include but are not limited to the 25 hybridoma technique originally developed by Kohler et al., (1975) Nature, 256:495-497, the trioma technique, the human B-cell hybridoma technique [Kozbor et al., (1983) Immunology Today, 4:72], and the EBV-hybridoma technique to produce human monoclonal antibodies [Cole et al., (1985) in Monoclonal Antibodies and Cancer Therapy, pp. 77-96, Alan R. Liss, Inc.]. Immortal, antibody-producing cell lines can be created by techniques other than fusion, 30 such as direct transformation of B lymphocytes with oncogenic DNA, or transfection with Epstein-Barr virus. See, e.g., U.S. Patent Nos. 4,341,761; 4,399,121; 4,427,783; 4,444,887; 4,451,570; 4,466,917; 4,472,500; 4,491,632; and 4,493,890. In an additional embodiment of the invention, monoclonal antibodies can be produced in germ-free animals utilising recent technology. According to the invention, chicken or 20 WO 2006/136392 PCT/EP2006/005961 swine antibodies may be used and can be obtained by using chicken or swine hybridomas or by transforming B cells with EBV virus in vitro. In fact, according to the invention, techniques developed for the production of "chimeric antibodies" [Morrison et al., (1984) J. Bacteriol., 159-870; Neuberger et al., (1984) Nature, 312:604-608; Takeda et al., (1985) 5 Nature, 314:452-454] by splicing the genes from a mouse antibody molecule specific for a polypeptide of the invention together with genes from an antibody molecule of appropriate biological activity can be used; such antibodies are within the scope of this invention. Such chimeric antibodies are preferred for use in therapy of intestinal diseases or disorders (described infra), since the antibodies are much less likely than xenogenic antibodies to 10 induce an immune response, in particular an allergic response, themselves. According to the invention, techniques described for the production of single chain antibodies (U.S. Patent 4,946,778) can be adapted to produce single chain antibodies specific for a polypeptide of the invention. An additional embodiment of the invention utilises the techniques described for the construction of Fab expression libraries [Huse et al., (1989) 15 Science, 246:1275-1281] to allow rapid and easy identification of monoclonal Fab fragments with the desired specificity for a polypeptide of the invention. Antibody fragments, which contain the idiotype of the antibody molecule, can be generated by known techniques. For example, such fragments include but are not limited to: the F(ab') 2 fragment which can be produced by pepsin digestion of the antibody molecule; the 20 Fab' fragments which can be generated by reducing the disulfide bridges of the F(ab') 2 fragment, and the Fab fragments which can be generated by treating the antibody molecule with papain and a reducing agent. In the production of antibodies, screening for the desired antibody can be accomplished by techniques known in the art, e.g., radioimmunoassay, ELISA, "sandwich" 25 immunoassays, immunoradiometric assays, gel diffusion precipitin reactions, immunodiffusion assays, in situ immunoassays (using colloidal gold, enzyme or radioisotope labels, for example), Western blots, precipitation reactions, agglutination assays (e.g., gel agglutination assays, hemagglutination assays), complement fixation assays, immunofluorescence assays, protein A assays, immunoelectrophoresis assays, etc. In one 30 embodiment, antibody binding is detected by detecting a label on the primary antibody. In another embodiment, the primary antibody is detected by detecting binding of a secondary antibody or reagent to the primary antibody. In a further embodiment, the secondary antibody is labelled. Many means are known in the art for detecting binding in an immunoassay and are within the scope of the present invention. For example, to select 21 WO 2006/136392 PCT/EP2006/005961 antibodies that recognise a specific epitope of a polypeptide of the invention, one may assay generated hybridomas for a product that binds to a fragment of a polypeptide of the invention containing such epitope. The invention also covers diagnostic and prognostic methods to detect the presence of 5 B. pilosicoli using a polypeptide of the invention and/or antibodies which bind to the polypeptide of the invention and kits useful for diagnosis and prognosis of B. pilosicoli infections. Diagnostic and prognostic methods will generally be conducted using a biological sample obtained from an animal, such as chicken or swine. A "sample" refers to an animal's 10 tissue or fluid suspected of containing a Brachyspira species, such as B. pilosicoli, or its polynucleotides or its polypeptides. Examples of such tissue or fluids include, but not limited to, plasma, serum, faecal material, urine, lung, heart, skeletal muscle, stomach, intestines, and in vitro cell culture constituents. The invention provides methods for detecting the presence of a polypeptide of the 15 invention in a sample, with the following steps: (a) contacting a sample suspected of containing a polypeptide of the invention with an antibody (preferably bound to a solid support) that specifically binds to the polypeptide of the invention under conditions which allow for the formation of reaction complexes comprising the antibody and the polypeptide of the invention; and (b) detecting the formation of reaction complexes comprising the antibody 20 and polypeptide of the invention in the sample, wherein detection of the formation of reaction complexes indicates the presence of the polypeptide of the invention in the sample. Preferably, the antibody used in this method is derived from an affinity-purified polyclonal antibody, and more preferably a monoclonal antibody. In addition, it is preferable for the antibody molecules used herein be in the form of Fab, Fab', F(ab') 2 or F(v) portions or 25 whole antibody molecules. Particularly preferred methods for detecting B. pilosicoli based on the above method include enzyme linked immunosorbent assays, radioimmunoassays, immunoradiometric assays and immunoenzymatic assays, including sandwich assays using monoclonal and/or polyclonal antibodies. 30 Three such procedures that are especially useful utilise either polypeptide of the invention (or a fragment thereof) labelled with a detectable label, antibody Abi labelled with a detectable label, or antibody Ab 2 labelled with a detectable label. The procedures may be summarized by the following equations wherein the asterisk indicates that the particle is labelled and "AA" stands for the polypeptide of the invention: 22 WO 2006/136392 PCT/EP2006/005961 A. AA* + Abi = AA*Abi B. AA + Ab* 1 = AA Abl* C. AA + Abi + Ab 2 *= Abi AA Ab 2 * The procedures and their application are all familiar to those skilled in the art and 5 accordingly may be utilised within the scope of the present invention. The "competitive" procedure, Procedure A, is described in U.S. Patent Nos. 3,654,090 and 3,850,752. Procedure B is representative of well-known competitive assay techniques. Procedure C, the "sandwich" procedure, is described in U.S. Patent Nos. RE 31,006 and 4,016,043. Still other procedures are known, such as the "double antibody" or "DASP" procedure, and can be used. 10 In each instance, the polypeptide of the invention form complexes with one or more antibody(ies) or binding partners and one member of the complex is labelled with a detectable label. The fact that a complex has formed and, if desired, the amount thereof, can be determined by known methods applicable to the detection of labels. It will be seen from the above, that a characteristic property of Ab 2 is that it will react 15 with Abi. This reaction is because Abi, raised in one mammalian species, has been used in another species as an antigen to raise the antibody, Ab 2 . For example, Ab 2 may be raised in goats using rabbit antibodies as antigens. Ab 2 therefore would be anti-rabbit antibody raised in goats. For purposes of this description and claims, Abi will be referred to as a primary antibody, and Ab 2 will be referred to as a secondary or anti-Ab antibody. 20 The labels most commonly employed for these studies are radioactive elements, enzymes, chemicals that fluoresce when exposed to ultraviolet light, and others. Examples of fluorescent materials capable of being utilised as labels include fluorescein, rhodamine and auramine. A particular detecting material is anti-rabbit antibody prepared in goats and conjugated with fluorescein through an isothiocyanate. Examples of preferred isotope 25 include 3 H, 1C, 3P, 5S, 36Cl, 51 Cr, 57 Co, 58 Co, 59 Fe, 90Y 12s 131I, and 1 86 Re. The radioactive label can be detected by any of the currently available counting procedures. While many enzymes can be used, examples of preferred enzymes are peroxidase, B-glucuronidase, B-D-glucosidase, B-D-galactosidase, urease, glucose oxidase plus peroxidase and alkaline phosphatase. Enzymes are conjugated to the selected particle by reaction with bridging 30 molecules such as carbodiimides, diisocyanates, glutaraldehyde and the like. Enzyme labels can be detected by any of the presently utilized colorimetric, spectrophotometric, fluorospectrophotometric, amperometric or gasometric techniques. U.S. Patent Nos. 3,654,090; 3,850,752; and 4,016,043 are referred to by way of example for their disclosure of alternate labelling material and methods. 23 WO 2006/136392 PCT/EP2006/005961 The invention also provides a method of detecting antibodies to a polypeptide of the invention in biological samples, using the following steps: (a) providing a polypeptide of the invention or a fragment thereof; (b) incubating a biological sample with said polypeptide of the invention under conditions which allow for the formation of an antibody-antigen 5 complex; and (c) determining whether an antibody-antigen complex with the polypeptide of the invention is formed. In another embodiment of the invention there are provided in vitro methods for evaluating the level of antibodies to a polypeptide of the invention in a biological sample using the following steps: (a) detecting the formation of reaction complexes in a biological 10 sample according to the method noted above; and (b) evaluating the amount of reaction complexes formed, which amount of reaction complexes corresponds to the level of polypeptide of the invention in the biological sample. Further there are provided in vitro methods for monitoring therapeutic treatment of a disease associated with B. pilosicoli in an animal host by evaluating, as describe above, the 15 levels of antibodies to a polypeptide of the invention in a series of biological samples obtained at different time points from an animal host undergoing such therapeutic treatment. The present invention further provides methods for detecting the presence or absence of B. pilosicoli in a biological sample by: (a) bringing the biological sample into contact with a polynucleotide probe or primer of polynucleotide of the invention under suitable 20 hybridizing conditions; and (b) detecting any duplex formed between the probe or primer and nucleic acid in the sample. According to one embodiment of the invention, detection of B. pilosicoli may be accomplished by directly amplifying polynucleotide sequences from biological sample, using known techniques and then detecting the presence of polynucleotide of the invention 25 sequences. In one form of the invention, the target nucleic acid sequence is amplified by PCR and then detected using any of the specific methods mentioned above. Other useful diagnostic techniques for detecting the presence of polynucleotide sequences include, but are not limited to: 1) allele-specific PCR; 2) single stranded conformation analysis; 3) denaturing gradient 30 gel electrophoresis; 4) RNase protection assays; 5) the use of proteins which recognize nucleotide mismatches, such as the E coli mutS protein; 6) allele-specific oligonucleotides; and 7) fluorescent in situ hybridisation. In addition to the above methods polynucleotide sequences may be detected using conventional probe technology. When probes are used to detect the presence of the desired 24 WO 2006/136392 PCT/EP2006/005961 polynucleotide sequences, the biological sample to be analysed, such as blood or serum, may be treated, if desired, to extract the nucleic acids. The sample polynucleotide sequences may be prepared in various ways to facilitate detection of the target sequence; e.g. denaturation, restriction digestion, electrophoresis or dot blotting. The targeted region of the sample 5 polynucleotide sequence usually must be at least partially single-stranded to form hybrids with the targeting sequence of the probe. If the sequence is naturally single-stranded, denaturation will not be required. However, if the sequence is double-stranded, the sequence will probably need to be denatured. Denaturation can be carried out by various techniques known in the art. 10 Sample polynucleotide sequences and probes are incubated under conditions that promote stable hybrid formation of the target sequence in the probe with the putative desired polynucleotide sequence in the sample. Preferably, high stringency conditions are used in order to prevent false positives. Detection, if any, of the resulting hybrid is usually accomplished by the use of 15 labelled probes. Alternatively, the probe may be unlabeled, but may be detectable by specific binding with a ligand that is labelled, either directly or indirectly. Suitable labels and methods for labelling probes and ligands are known in the art, and include, for example, radioactive labels which may be incorporated by known methods (e.g., nick translation, random priming or kinasing), biotin, fluorescent groups, chemiluminescent groups (e.g., 20 dioxetanes, particularly triggered dioxetanes), enzymes, antibodies and the like. Variations of this basic scheme are known in the art, and include those variations that facilitate separation of the hybrids to be detected from extraneous materials and/or that amplify the signal from the labelled moiety. It is also contemplated within the scope of this invention that the nucleic acid probe 25 assays of this invention may employ a cocktail of nucleic acid probes capable of detecting the desired polynucleotide sequences of this invention. Thus, in one example to detect the presence of polynucleotide sequences of this invention in a cell sample, more than one probe complementary to a polynucleotide sequences is employed and in particular the number of different probes is alternatively 2, 3, or 5 different nucleic acid probe sequences. 30 The polynucleotide sequences described herein (preferably in the form of probes) may also be immobilised to a solid phase support for the detection of Brachyspira species, including but not limited to B. hyodysenteriae, B. intermedia, B. alvinipulli, B. aalborgi, B. innocens, B. murdochii, and B. pilosicoli. Alternatively the polynucleotide sequences described herein will form part of a library of DNA molecules that may be used to detect 25 WO 2006/136392 PCT/EP2006/005961 simultaneously a number of different genes from Brachyspira species, such as B. pilosicoli. In a further alternate form of the invention polynucleotide sequences described herein together with other polynucleotide sequences (such as from other bacteria or viruses) may be immobilised on a solid support in such a manner permitting identification of the presence of a 5 Brachyspira species, such as B. pilosicoli and/or any of the other polynucleotide sequences bound onto the solid support. Techniques for producing immobilised libraries of DNA molecules have been described in the art. Generally, most prior art methods describe the synthesis of single stranded nucleic acid molecule libraries, using for example masking techniques to build up 10 various permutations of sequences at the various discrete positions on the solid substrate. U.S. Patent No. 5,837,832 describes an improved method for producing DNA arrays immobilised to silicon substrates based on very large scale integration technology. In particular, U.S. Patent No. 5,837,832 describes a strategy called "tiling" to synthesize specific sets of probes at spatially defined locations on a substrate that may be used to produce the 15 immobilised DNA libraries of the present invention. U.S. Patent No. 5,837,832 also provides references for earlier techniques that may also be used. Thus polynucleotide sequence probes may be synthesised in situ on the surface of the substrate. Alternatively, single-stranded molecules may be synthesised off the solid substrate and each pre-formed sequence applied to a discrete position on the solid substrate. For 20 example, polynucleotide sequences may be printed directly onto the substrate using robotic devices equipped with either pins or pizo-electric devices. The library sequences are typically immobilised onto or in discrete regions of a solid substrate. The substrate may be porous to allow immobilisation within the substrate or substantially non-porous, in which case the library sequences are typically immobilised on 25 the surface of the substrate. The solid substrate may be made of any material to which polypeptides can bind, either directly or indirectly. Examples of suitable solid substrates include flat glass, silicon wafers, mica, ceramics and organic polymers such as plastics, including polystyrene and polymethacrylate. It may also be possible to use semi-permeable membranes such as nitrocellulose or nylon membranes, which are widely available. The 30 semi-permeable membranes may be mounted on a more robust solid surface such as glass. The surfaces may optionally be coated with a layer of metal, such as gold, platinum or other transition metal. Preferably, the solid substrate is generally a material having a rigid or semi-rigid surface. In preferred embodiments, at least one surface of the substrate will be substantially 26 WO 2006/136392 PCT/EP2006/005961 flat, although in some embodiments it may be desirable to physically separate synthesis regions for different polymers with, for example, raised regions or etched trenches. It is also preferred that the solid substrate is suitable for the high density application of DNA sequences in discrete areas of typically from 50 to 100 pim, giving a density of 10000 to 5 40000 dots/cm 2 . The solid substrate is conveniently divided up into sections. This may be achieved by techniques such as photoetching, or by the application of hydrophobic inks, for example teflon-based inks (Cel-line, USA). Discrete positions, in which each different member of the library is located may have 10 any convenient shape, e.g., circular, rectangular, elliptical, wedge-shaped, etc. Attachment of the polynucleotide sequences to the substrate may be by covalent or non-covalent means. The polynucleotide sequences may be attached to the substrate via a layer of molecules to which the library sequences bind. For example, the polynucleotide sequences may be labelled with biotin and the substrate coated with avidin and/or 15 streptavidin. A convenient feature of using biotinylated polynucleotide sequences is that the efficiency of coupling to the solid substrate can be determined easily. Since the polynucleotide sequences may bind only poorly to some solid substrates, it is often necessary to provide a chemical interface between the solid substrate (such as in the case of glass) and the nucleic acid sequences. Examples of suitable chemical interfaces include hexaethylene 20 glycol. Another example is the use of polylysine coated glass, the polylysine then being chemically modified using standard procedures to introduce an affinity ligand. Other methods for attaching molecules to the surfaces of solid substrate by the use of coupling agents are known in the art, see for example W098/49557. Binding of complementary polynucleotide sequences to the immobilised nucleic acid 25 library may be determined by a variety of means such as changes in the optical characteristics of the bound polynucleotide sequence (i.e. by the use of ethidium bromide) or by the use of labelled nucleic acids, such as polypeptides labelled with fluorophores. Other detection techniques that do not require the use of labels include optical techniques such as optoacoustics, reflectometry, ellipsometry and surface plasmon resonance (see 30 W097/49989). Thus, the present invention provides a solid substrate having immobilized thereon at least one polynucleotide of the present invention, preferably two or more different polynucleotide sequences of the present invention. 27 WO 2006/136392 PCT/EP2006/005961 The present invention also can be used as a prophylactic or therapeutic, which may be utilised for the purpose of stimulating humoral and cell mediated responses in animals, such as chickens and swine, thereby providing protection against colonisation with Brachyspira species, including but not limited to B. hyodysenteriae, B. intermedia, B. alvinipulli, B. 5 aalborgi, B. innocens, B. murdochii, and B. pilosicoli. Natural infection with a Brachyspira species, such as B. pilosicoli, induces circulating antibody titres against the proteins described herein. The treated animal can be any mammal or bird, such as but not limited to, chicken, goose, duck, turkey, parakeet, dog, cat, hamster, gerbil, rabbit, ferret, horse, cow, sheep, pig, monkey, and human. Therefore, the amino acid sequences described herein or parts thereof, 10 have the potential to form the basis of a systemically or orally administered prophylactic or therapeutic to provide protection against intestinal spirochaetosis. Accordingly, in one embodiment the present invention provides the amino acid sequences described herein or fragments thereof or antibodies that bind the amino acid sequences or the polynucleotide sequences described herein in a therapeutically effective 15 amount admixed with a pharmaceutically acceptable carrier, diluent, or excipient. The phrase "therapeutically effective amount" is used herein to mean an amount sufficient to reduce by at least about 15%, preferably by at least 50%, more preferably by at least 90%, and most preferably prevent, a clinically significant deficit in the activity, function and response of the animal host. Alternatively, a therapeutically effective amount is 20 sufficient to cause an improvement in a clinically significant condition in the animal host. The phrase "pharmaceutically acceptable" refers to molecular entities and compositions that are physiologically tolerable and do not typically produce an allergic or similarly untoward reaction, such as gastric upset and the like, when administered to an animal. The term "carrier" refers to a diluent, adjuvant, excipient, or vehicle with which the 25 compound is administered. Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water or saline solutions and aqueous dextrose and glycerol solutions are preferably employed as carriers, particularly for injectable solutions. Suitable pharmaceutical carriers are described in Martin, Remington's 30 Pharmaceutical Sciences, 18th Ed., Mack Publishing Co., Easton, PA, (1990). In a more specific form of the invention there are provided pharmaceutical compositions comprising therapeutically effective amounts of the amino acid sequences described herein or an analogue, fragment or derivative product thereof or antibodies thereto together with pharmaceutically acceptable diluents, preservatives, solubilizes, emulsifiers, 28 WO 2006/136392 PCT/EP2006/005961 adjuvants and/or carriers. Such compositions include diluents of various buffer content (e.g., Tris-HCl, acetate, phosphate), pH and ionic strength and additives such as detergents and solubilizing agents (e.g., Tween 80, Polysorbate 80), anti-oxidants (e.g., ascorbic acid, sodium metabisulfite), preservatives (e.g., Thimersol, benzyl alcohol) and bulking substances 5 (e.g., lactose, mannitol). The material may be incorporated into particulate preparations of polymeric compounds such as polylactic acid, polyglycolic acid, etc. or into liposomes. Hylauronic acid may also be used. Such compositions may influence the physical state, stability, rate of in vivo release, and rate of in vivo clearance of the present proteins and derivatives. See, e.g., Martin, Remington's Pharmaceutical Sciences, 18th Ed. (1990, Mack 10 Publishing Co., Easton, PA 18042) pages 1435-1712 that are herein incorporated by reference. The compositions may be prepared in liquid form, or may be in dried powder, such as lyophilised form. Alternatively, the polynucleotides of the invention can be optimized for expression in plants (e.g., corn). The plant may be transformed with plasmids containing the optimized 15 polynucleotides. Then the plant is grown, and the proteins of the invention are expressed in the plant, or the plant-optimized version is expressed. The plant is later harvested, and the section of the plant containing the proteins of the invention is processed into feed for the animal. This animal feed will impart immunity against B. pilosicoli when eaten by the animal. Examples of prior art detailing these methods can be found in U.S. Patent 5,914,123 20 (Arntzen, et al.); U.S. Patent 6,034,298 (Lam, et al.); and U.S. Patent 6,136,320 (Arntzen, et al.). It will be appreciated that pharmaceutical compositions provided accordingly to the invention may be administered by any means known in the art. Preferably, the pharmaceutical compositions for administration are administered by injection, orally, or by 25 the pulmonary, or nasal route. The amino acid sequences described herein or antibodies derived therefrom are more preferably delivered by intravenous, intraarterial, intraperitoneal, intramuscular, or subcutaneous routes of administration. Alternatively, the amino acid sequence described herein or antibodies derived therefrom, properly formulated, can be administered by nasal or oral administration. 30 Also encompassed by the present invention is the use of polynucleotide sequences of the invention, as well as antisense and ribozyme polynucleotide sequences hybridisable to a polynucleotide sequence encoding an amino acid sequence according to the invention, for manufacture of a medicament for modulation of a disease associated B. pilosicoli. 29 WO 2006/136392 PCT/EP2006/005961 Polynucleotide sequences encoding antisense constructs or ribozymes for use in therapeutic methods are desirably administered directly as a naked nucleic acid construct. Uptake of naked nucleic acid constructs by bacterial cells is enhanced by several known transfection techniques, for example those including the use of transfection agents. Examples 5 of these agents include cationic agents (for example calcium phosphate and DEAE-dextran) and lipofectants. Typically, nucleic acid constructs are mixed with the transfection agent to produce a composition. Alternatively the antisense construct or ribozymes may be combined with a pharmaceutically acceptable carrier or diluent to produce a pharmaceutical composition. 10 Suitable carriers and diluents include isotonic saline solutions, for example phosphate buffered saline. The composition may be formulated for parenteral, intramuscular, intravenous, subcutaneous, intraocular, oral or transdermal administration. The routes of administration described are intended only as a guide since a skilled practitioner will be able to determine readily the optimum route of administration and any dosage for any particular 15 animal and condition. The invention also includes kits for screening animals suspected of being infected with a Brachyspira species, such as B. pilosicoli or to confirm that an animal is infected with a Brachyspira species, such as B. pilosicoli. In a further embodiment of this invention, kits suitable for use by a specialist may be prepared to determine the presence or absence of 20 Brachyspira species, including but not limited to B. hyodysenteriae, B. intermedia, B. alvinipulli, B. aalborgi, B. innocens, B. murdochii, and B. pilosicoli in suspected infected animals or to quantitatively measure a Brachyspira species, including but not limited to B. hyodysenteriae, B. intermedia, B. alvinipulli, B. aalborgi and B. pilosicoli infection. The tested animal can be any mammal or bird, such as but not limited to, chicken, goose, duck, 25 turkey, parakeet, dog, cat, hamster, gerbil, rabbit, ferret, horse, cow, sheep, pig, monkey, and human. In accordance with the testing techniques discussed above, such kits can contain at least a labelled version of one of the amino acid sequences described herein or its binding partner, for instance an antibody specific thereto, and directions depending upon the method selected, e.g., "competitive," "sandwich," "DASP" and the like. Alternatively, such kits can 30 contain at least a polynucleotide sequence complementary to a portion of one of the polynucleotide sequences described herein together with instructions for its use. The kits may also contain peripheral reagents such as buffers, stabilizers, etc. 30 WO 2006/136392 PCT/EP2006/005961 Accordingly, a test kit for the demonstration of the presence of a Brachyspira species, including but not limited to B. hyodysenteriae, B. intermedia, B. alvinipulli, B. aalborgi, B. innocens, B. murdochii, and B. pilosicoli, may contain the following: (a) a predetermined amount of at least one labelled immunochemically reactive 5 component obtained by the direct or indirect attachment of one of the amino acid sequences described herein or a specific binding partner thereto, to a detectable label; (b) other reagents; and (c) directions for use of said kit. More specifically, the diagnostic test kit may contain: 10 (a) a known amount of one of the amino acid sequences described herein as described above (or a binding partner) generally bound to a solid phase to form an immunosorbent, or in the alternative, bound to a suitable tag, or there are a plural of such end products, etc; (b) if necessary, other reagents; and 15 (c) directions for use of said test kit. In a further variation, the test kit may contain: (a) a labelled component which has been obtained by coupling one of the amino acid sequences described herein to a detectable label; (b) one or more additional immunochemical reagents of which at least one reagent 20 is a ligand or an immobilized ligand, which ligand is selected from the group consisting of: (i) a ligand capable of binding with the labelled component (a); (ii) a ligand capable of binding with a binding partner of the labelled component (a); (iii) a ligand capable of binding with at least one of the component(s) to be 25 determined; or (iv) a ligand capable of binding with at least one of the binding partners of at least one of the component(s) to be determined; and (c) directions for the performance of a protocol for the detection and/or determination of one or more components of an immunochemical reaction between one of the 30 amino acid sequences described herein and a specific binding partner thereto. In this invention, only ACI clone (the DNA sequence is in SEQ ID NO: 1 and the amino acid sequence is in SEQ ID NO: 2) is identified by screening a bacteriophage library with a B. pilosicoli-specific monoclonal antibody which reacted with a 30 kDa outer membrane protein. The other clones, NAV- P4, NAV-P6, NAV-Pl 1, and NAV-P14, are 31 WO 2006/136392 PCT/EP2006/005961 obtained by screening a shot-gun genomic library prepared using an Australian porcine field isolate of B. pilosicoli (strain 95/1000). All clones are screened for homology to known sequences, cloned into pTrcHis expression vectors, the proteins are expressed, and tested in vitro and in-vivo, as described below. 5 Identification of ACl sequences The generation of the monoclonal antibody is described in Lee, B.J. and Hampson, D.J., A monoclonal antibody reacting with the cell envelope of spirochaetes isolated from cases of intestinal spirochaetosis in pigs and humans, FEMS Microbiology Letters, 131:178 184 (1995). The protocol for generating the monoclonal antibody is as follows: B. pilosicoli 10 strain 3295 is grown to late log-phase in 200 ml trypticase soy broth supplemented with 2% fetal bovine serum and a 1% ethanolic cholesterol solution, and is pelleted by centrifugation 6,800 x g for ten minutes at room temperature. The bacteria is resuspended and washed in PBS three times with centrifugation to pellet the cells after each wash. The spirochaetes are resuspended in 20 ml of extraction buffer containing 0.1% (v/v) Triton X- 114, 10 mM Tris 15 HCI (pH 7.5), and 5 mM EDTA and gently mixed for 18 hours at 4C. The cellular debris is pelleted by centrifugation at 20,000 x g for 30 minutes at 4C, and the aqueous phase (soluble fraction) is precipitated with 10 volumes of ice-cold acetone. The precipitated protein is harvested by centrifugation at 1000 x g for 10 minutes, and the pellet is resuspeneded with 20 ml of PBS. The extracted outer membrane proteins are quantified using the Biorad Protein 20 Assay Kit (Biorad). Commercially available bovine serum albumin (BSA) protein standard (Sigma) is serially diluted with PBS in 2-fold serial dilutions from 6.25 pg/ml to 100 tg/ml. The extracted proteins are also diluted with the same buffer in 2-fold serial dilutions from 2 fold to 32-fold. Twenty pl of the Biorad Protein Assay reagent is added to the wells of a 96 well microtitre plate. Eighty pl of the corresponding protein standards and the membrane 25 protein sample are added to the appropriate wells, and the microtitre plate is gently vortexed to mix. The BSA standards are performed in triplicate, and the diluted membrane protein samples are performed in duplicate. The microtitre plate is then placed into the microplate reader (Biorad Model 3550-UV), and the optical density at 600 nm is recorded. The standard curve generated from the optical density of the BSA standard is used to interpolate the 30 concentration of the extracted outer membrane protein sample. Female Balb/cJ mice are immunized intraperitoneally with 0.5 ml of vaccine preparation consisting of 0.25 ml of extracted B. pilosicoli outer membrane proteins (with a protein content of approximately 400 pg/ml) emulsified with 0.25 ml of Freund's complete adjuvant. The mice then receive weekly injections of the B. pilosicoli outer membrane 32 WO 2006/136392 PCT/EP2006/005961 proteins without adjuvant for six weeks. Four days after the last injection, the spleen of the mice are harvested. The cells are isolated and are fused with NS-1 myeloma cells using polyethylene glycol and the supernatants are screened using an ELISA with 100 gl outer membrane protein of B. pilosicoli strain 3295 (5 gg/ml) per well as plate coated antigen. 5 Assaying conditions involve an overnight antigen coating in 100 pl of 0.1 M carbonate buffer (pH 9.6) at 4C followed by blocking of unbound sites with 150 pl of PBS containing 1% (w/v) BSA (Sigma). The wells are washed three times with 150 pil of PBST (0.05% v/v Tween 20) before the addition of undiluted cell culture supernatants. After 2 hours incubation at room temperature (RT), the wells are washed (as above), and the bound mouse 10 antibodies are detected with goat anti-mouse IgG (whole molecule)-horseradish peroxidase (Sigma) diluted 5,000-fold in PBST. The wells are washed three times with 150 [tl of PBST (as above). Color development involved the commercially available K-Blue TMB substrate (ELISA Systems) and is allowed to occur for 15 minutes at RT. The color development is stopped by the addition of 50 pl of I M sulphuric acid, and the absorbance of the colored 15 substrate reaction is recorded at 450 nm using the microplate reader (Biorad Model 3550 UV). One monoclonal antibody (BJL/ACI) binds to a 30 kDa outer envelope protein of B. pilosicoli as determined via a Western blot of the outer membrane proteins of B. pilosicoli. The outer membrane preparation of B. pilosicoli is run on a 12% discontinous SDS-PAGE 20 and blotted to nitrocellulose. The blotted proteins are immunostained with undiluted hybridoma cell supernatant from clone BJL/AC I followed by detection with horseradish peroxidase conjugated goat anti-mouse serum (Biorad) and developed using 4-chloro-1 naphthol. The protein nature of the antigen is confirmed by treating it with proteinase K (2 mg/ml) in proteinase K buffer (150 mM Tris-HCl, 7 mM EDTA, 0.05% SDS, pH 8.0) at 25 55'C for two hours, then performing a Western blot on the digested sampleusing the monoclonal antibody BJL/AC 1. To obtain a usable amount of monoclonal antibody BL/AC 1, frozen stocks of hybridoma are taken from liquid nitrogen and immediately thawed in a 37'C waterbath. The thawed cells are transferred to a 10 ml centrifuge tube containing 9 ml pre-warmed DMEM 30 and centrifuged at 1,000 x g for 5 minutes. The supernatant is discarded, and the cell pellet is resuspended with 2 ml DMEM supplemented with 100 ptM hypoxanthine, 0.4 ptM aminopterin, 16 ptM thymidine, 0.58 mg/ml glutamine, 0.22 mg/ml sodium pyruvate, 200 i.u./ml penicillin, 200 ptg/ml streptomycin, 0.05 mg/ml gentamycin (DMEM-HAT) and containing 20% (v/v) fetal calf serum. The hybridomas are first recovered in 96-well flat 33 WO 2006/136392 PCT/EP2006/005961 bottom tissue culture plates, then in 24-well tissue culture plates, and finally in 25 cm 2 tissue culture flasks. During flask culture, the DMEM-HAT medium is supplemented with 10% (v/v) fetal calf serum. At this stage, the hybridoma cells are allowed to grow until the cells are at the point of death and then the culture supernatant is clarified by centrifugation at 2,500 5 x g for 5 minutes. Prior to storage at -20*C, tissue culture supernatant is tested by Western blot analysis against a whole-cell preparation of B. pilosicoli. Undiluted tissue culture supernatant containing the mAb is used in all plaque-lift assays and Western blotting, unless otherwise stated. A genomic library of B. pilosicoli strain P43/6/78T is generated using a QIAamp 10 tissue kit (Qiagen) using the following protocol. A pure broth culture of B. pilosicoli P43/6/78T is centrifuged at 6800 x g for 10 minutes at room temperature. Cells are resuspended in 180 d of ATL buffer to which 20 gl of proteinase K (20 mg/ml) is added and incubated at 55*C until complete lysis occurs. RNA-free DNA is obtained by incubation of the extract at room temperature for 5 minutes with 2 mg/mi RNase A. Two hundred pl of AL 15 buffer is added before incubation at 70*C for 10 minutes. After the addition of 200 pl ethanol the sample was passed through a QIAamp spin column at 8000 x g for 1 minute. The column is washed twice with 500 p.L AWL buffer, and the genomic DNA is eluted with 200 p of AE buffer preheated to 70'C. A partial digest of P43/6/78T genomic DNA is made by restricting 50 p.L of the purified DNA with 0.5U of Sau3Al for 1 hour. The partially digested DNA is 20 electrophoresed in a 0.4 % (w/v) agarose gel in IX TBE (90 mM Tris-borate and 1 mM EDTA pH 8.0). Fragments of 2-7 kb size are excised from the gel and are dissolved in I ml of sterile water at 70'C. The dissolved agarose is extracted twice with a phenol:chloroform solution, and the aqueous phase is precipitated with isopropanol. The precipitated partially digested DNA is resuspended in 20 ptL 10 mM Tris-HCl (pH 7.5). The partially-digested 25 DNA fragments are ligated into BamH1 . bacteriophage arms (Stratagene) and packaged into phage particles using the Gigapack II packaging extracts. Packaged phage are amplified in E. coli XLI-MRF' to form a random genomic library. The ?, bacteriophage library is screened for expression of the 30 kDa B. pilosicoli antigen using mAb BJL/AC in a plaque-lift assay. 200 pl of E coli XL1-Blue is grown in 30 Luria-Bertani (LB) broth supplemented with 0.2% (w/v) maltose and 10 mM MgSO 4 , adjusted to an optical density of 1.0 at 600 nm and mixed in 10 ml tubes with 100 pl of library suspension containing 5 x 104 plaque forming bacteriophages. After incubation for 15 minutes at 37*C, 3 ml of melted sterile LB top agar at 48*C is added to each tube, mixed, and 34 WO 2006/136392 PCT/EP2006/005961 is immediately poured over an LB agar plate and swirled for even distribution. After the top agar hardens for 15 minutes at room temperature, the plates are incubated at 3 7*C for 6-8 hours until the plaques are approximately 1 mm in diameter. Nitrocellulose disk filters impregnated with 10 mM isopropyl thio-p-3-D-galactoside (IPTG) are carefully placed on the 5 plates which are incubated for another 4-6 hours at 37*C. The nitrocellulose filters are removed into Tris-buffered saline (TBS) and are blocked with 5% (w/v) skim milk powder in TBS for 1 hour at room temperature. After incubation with mAb BJL/AC I for 1 hour, washing twice for 10 minutes each in TBS, and incubating for 1 hour in a 2000-fold dilution of horseradish peroxidase (HRP)-conjugated goat anti-mouse serum (Biorad Laboratories, 10 CA, U.S.A.), the plaques that react with the mAb are visualised using hydrogen peroxide and 4-chloro-I -napthol. Clones that react with mAb BJL/ACl are selected, and are excised into phagemid pBK-CMV by co-infection of E.coli XLI-MRF' with the ExAssist T M Interference Resistant Helper Phage (Stratagene, La Jolla, CA). The E. coli clones harbouring the recombinant plasmids are streaked out onto LB agar 15 plates supplemented with 50 mg/L kanamycin and incubated at 37*C overnight. A single colony is used to inoculate 10 ml of LB broth supplemented with 50 mg/l kanamycin, 1 mM PMSF and 1 mM IPTG. The broth culture is incubated at 37*C for 12 hours with shaking. One ml of each culture is centrifuged at 2,500 x g for 15 minutes and is washed three times. The washing process involves resuspension of the cell pellet with 1 ml phosphate buffered 20 saline (PBS) and centrifugation at 2,500 x g. The washed cell pellets are resuspended in 100 pl of PBS ready for SDS-PAGE and Western blotting. SDS-PAGE analysis of the protein involves electrophoretic separation using a discontinuous Tris-glycine buffer system. Thirty d of protein sample are mixed with 10lu of 4x sample treatment buffer (250 mM Tris-HCl (pH 6.0), 8% (w/v) SDS, 200 mM DTT, 40% 25 (v/v) glycerol and 0.04 % (w/v) bromophenol blue). Samples are boiled for 5 minutes immediately prior to loading 10 pl of the sample into wells in the gel. The gel comprises a stacking gel (125 mM Tris-HCI ph 6.8, 4% w/v acylamide, 0.15% w/v bis-acrylamide and 0.1% w/v SDS) and a separating gel (375 mM Tris-HCl ph 8.8, 12% w/v acylamide, 0.3 1% w/v bis-acrylamide and 0.1% w/v SDS). These gels are polymerised by the addition of 0.1% 30 (v/v) TEMED and 0.05% (w/v) freshly prepared ammonium sulphate solution and cast into the mini-Protean dual slab cell (Biorad). Samples are run at 150 V at room temperature (RT) until the bromophenol blue dye-front reachs the bottom of the gel. Pre-stained molecular weight standards are electrophoresed in parallel with the samples in order to allow molecular 35 WO 2006/136392 PCT/EP2006/005961 weight estimations. After electrophoresis, the gel is immediately subjected to electro-transfer onto nitrocellulose membrane for Western blotting. Electrophoretic transfer of separated proteins from the SDS-PAGE gel to nitrocellulose membrane is performed using the Towbin transfer buffer system. After 5 electrophoresis, the gel is equilibrated in transfer buffer (25 mM Tris, 192 mM glycine, 20% v/v methanol, pH 8.3) for 15 minutes. The proteins in the gel are transferred to nitrocellulose membrane (Protran) using the mini-Protean transblot apparatus (Biorad) at 30 V overnight at 4C. The freshly transferred nitrocellulose membrane containing the separated proteins is blocked with 10 ml of Tris-buffered saline (TBS) containing 5% (w/v) skim milk powder for 10 1 hour at RT. The membrane is washed with TBS containing 0.1% (v/v) Tween 20 (TBST) and then incubated with 10 mL AHPS (diluted 5,000-fold with TBST) for 1 hour at room temperature. After washing three times for 5 minutes with TBST, the membrane is incubated with 10 mL goat anti-swine IgG (whole molecule)-HRP diluted 5,000-fold in TBST for I hour at room temperature. The membrane is developed with 10 mL with DAB substrate 15 solution (0.5 mg/ml 3,3'-diaminobenzidine, 0.003% w/v hydrogen peroxide, TBS). The development reaction is stopped by washing the membrane with distilled water. The membrane is then dried and scanned for presentation. The B. pilosicoli phage library produces six clones that express a protein with the molecular weight of 30 kDa. The protein from all of these clones react strongly with mAb 20 BJL/AC1. One plasmid (AC 1) is chosen for direct sequencing of the B. pilosicoli genomic insert using the ABI 373A DNA Sequencer (PE Applied Biosystems). The plasmid is purified from the . coli cells using the QlAprep Spin Miniprep Kit (Qiagen). The initial insert sequences are obtained using commercially available T3 and T7 oligonucleotides which annealed to the 25 vector regions flanking either ends of the insert. The oligonucleotides required to completely identify the insert sequence are designed based on the 3'-OH end sequence of each newly obtained insert sequences (Table 1). Each sequencing reaction is performed in a 10 p volume consisting of 300 ng of phagemid, 4 pmol of primer, and 4 pl of the ABI PRISM T M Dye Terminator Cycle Sequencing Ready Reaction Mix (PE Applied Biosystems). Cycling 30 conditions are a 2 minute denaturing step at 96*C, followed by 25 cycles of denaturation at 96'C for 10 seconds, annealing at the primer's melting temperature (see Table 1) for 5 seconds, and primer extension at 60*C for 4 minutes. Residual dye terminators are removed from the sequencing products by precipitation with 95% (v/v) ethanol containing 120 mM 36 WO 2006/136392 PCT/EP2006/005961 sodium acetate (pH 4.6), and vacuum dried. The sequencing products are analysed using an ABI 373A DNA Sequencer. Sequence results are edited and compiled using SeqEd vl.0.3 (PE Applied Biosystems). The nucleotide sequences are analysed using Vector NTI version 6 (InforMax) 5 and the University of Wisconsin Genetics Computer Group program. The deduced hypothetical open reading frame (ORF) was used to search for homology against all sequence databases available at the National Center of Bioinformatics (NCBI). The ORF lacks homology to any known protein (see Table 2). The DNA and amino acid sequences of ACI are found in SEQ ID NOs: I and 2, respectively. The ORF of the clone is 824 bp long and 10 encodes a protein with an estimated weight of 30.6 kDa. Table I Primer name TA (*C) Sequence (5'-3') T3 60 taaccctcactaaagggaac (SEQ ID NO: 47) T7 60 gtaatacgactcactatagggc (SEQ ID NO: 48) AC I -FO 50 gcatcattaatggattttgaagc (SEQ ID NO: 49) ACI-Fl 50 ctgtaggaggagtttgcggttc (SEQ ID NO: 50) AC I -F2 50 ttactttagttaaagcttcatcac (SEQ ID NO: 51) ACl-F3 50 agcagtaaaagcattgtcattatc (SEQ ID NO: 52) AC 1 -F4 50 tgataatattagtatagtttgcag (SEQ ID NO: 53) ACI-F5 50 taaatgtatagtctctcctgcaac (SEQ ID NO: 54) ACI-Rl 50 ttaccctatgcaagctggcggaac (SEQ ID NO: 55) AC I -R2 50 tttaatttaagagtattaaatgac (SEQ ID NO: 56) Preparation of genomic library for shot-gun sequencing A genomic library is prepared using an Australian porcine field isolate of B. pilosicoli 15 (strain 95/1000). This strain has been well-characterised and shown to be virulent following experimental challenge of pigs. The cetyltrimethylammonium bromide (CTAB) method is used to prepare high quality chromosomal DNA suitable for preparation of genomic DNA libraries. B. pilosicoli is grown in 100 ml anaerobic trypticase soy broth culture to a cell density of 109 cells/ml. The cells are harvested at 4,000 x g for 10 minutes, and the cell pellet 20 resuspended in 9.5 ml TE buffer. SDS is added to a final concentration of 0.5 % (w/v), and the cells lysed at 37*C for 1 hour with 100 pg of Proteinase K. NaCl is added to a final concentration of 0.7 M and 1.5 ml CTAB/NaCl solution (10% w/v CTAB, 0.7 M NaCl) is added before incubating the solution at 65*C for 20 minutes. The lysate is extracted with an 37 WO 2006/136392 PCT/EP2006/005961 equal volume of chloroform/isoamyl alcohol, and the tube is centrifuged at 6,000 x g for 10 minutes to separate the phases. The aqueous phase is transferred to a fresh tube and 0.6 volumes of isopropanol are added to precipitate the high molecular weight DNA. The precipitated DNA is collected using a hooked glass rod and transferred to a tube containing 1 5 ml of 70 % (v/v) ethanol. The tube is centrifuged at 10,000 x g and the pelleted DNA redissolved in 4 ml TE buffer overnight. A cesium chloride gradient containing 1.05 g/ml CsCl and 0.5 mg/ml ethidium bromide is prepared using the redissolved DNA solution. The gradient is transferred to 4 ml sealable centrifuge tubes and centrifuged at 70,000 x g overnight at 15*C. The separated DNA is visualized under an ultraviolet light, and the high 10 molecular weight DNA is withdrawn from the gradient using a 15-g needle. The ethidium bromide is removed from the DNA by sequential extraction with CsCl-saturated isopropanol. The purified chromosomal DNA is dialysed against 2 litres TE buffer and precipitated with isopropanol. The resuspended genomic DNA is sheared using a GeneMachines Hydroshear (Genomic Solutions, Ann Arbor, MI), and the sheared DNA is filled-in using Klenow DNA 15 polymerase to generate blunt-end fragments. One hundred ng of the blunt-end DNA fragments is ligated with 25 ng of pSMART VC vector (Lucigen, Meddleton, WI) using CloneSmart DNA ligase. The ligated DNA is then electroporated into E. coli electrocompetent cells. A small insert (2-3 kb) library and medium insert (3-10 kb) library is constructed into the low copy version of the pSMART VC vector. 20 Genomic sequencing After the genomic library is obtained, individual clones of E coli containing the pSMART VC vector are picked. The plasmid DNA is purified and sequenced. The purified plasmids are subjected to automated direct sequencing of the pSMART VC vector using the forward and reverse primers specific for the pSMART VC vector. Each sequencing reaction 25 is performed in a 10 p1 volume consisting of 200 ng of plasmid DNA, 2 pmol of primer, and 4 p of the ABI PRISM T M BigDye Terminator Cycle Sequencing Ready Reaction Mix (PE Applied Biosystems, Foster City, CA). Cycling conditions involve a 2 minute denaturing step at 96*C, followed by 25 cycles of denaturation at 96*C for 10 seconds, and a combined primer annealing and extension step at 60*C for 4 minutes. Residual dye terminators are 30 removed from the sequencing products by precipitation with 95% (v/v) ethanol containing 85 mM sodium acetate (pH 5.2), 3mM EDTA (pH 8), and vacuum dried. The plasmids are sequenced in duplicate using each primer. Sequencing products are analysed using an ABI 373A DNA Sequencer (PE Applied Biosystems). 38 WO 2006/136392 PCT/EP2006/005961 Annotation Partial genome sequences for B. pilosicoli are assembled and annotated using a range of public domain bioinformatics tools to analyse and re-analyse the sequences as part of a quality assurance procedure on data analysis. Open reading frames (ORFs) are predicted 5 using a variety of programs including GeneMark, GLIMMER, ORPHEUS, SELFID and GetORF. Putative ORFs are examined for homology (DNA and protein) with existing international databases using searches including BLAST and FASTA. All the predicted ORFs are analysed to determine their cellular localisation using programs including PSI-BLAST, FASTA, MOTIFS, FINDPATTERNS, PHD, SIGNALP and PSORT. Databases including 10 Interpro, Prosite, ProDom, Pfam and Blocks are used to predict surface associated proteins such as transmembrane domains, leader peptides, homologies to known surface proteins, lipoprotein signature, outer membrane anchoring motifs and host cell binding domains. Phylogenetic and other molecular evolution analysis is conducted with the identified genes and with other species to assist in the assignment of function. The in silico analysis of both 15 partially sequenced genomes produces a comprehensive list of all the predicted ORFs present in the sequence data available. Each ORF is interrogated for descriptive information such as predicted molecular weight, isoelectric point, hydrophobicity, and subcellular localisation to enable correlation with the in vitro properties of the native gene product. Predicted genes which encode proteins similar to surface localized components and/or virulence factors in 20 other pathogenic bacteria are selected as potential vaccine targets. Bioinformatics Results The shotgun sequencing of the B. pilosicoli genome results in 84% (2058.6 kb out of a predicted 2450 kb) of the genome being sequenced. The B. pilosicoli sequence is comprised of 134 contigs with an average contig size of 132 kb. For B. pilosicoli, 1892 open-reading 25 frames (ORFs) are predicted from the 134 contigs. Comparison of the predicted ORFs with genes present in the nucleic acid and protein databases indicate that approximately 70% of the ORFs have homology with genes contained in the public databases. The remaining 30% of the predicted ORFs have no known identity. Vaccine candidates 30 To help reduce the number of ORFs that would be tested as a vaccine candidate, a two part test is established. Potential vaccine candidates are required to have some, albeit minor, homology with outer surface proteins and virulence factors present in the public databases. The potential vaccine candidate ORFs also have to be present in many strains of B. pilosicoli. Of the 1892 ORFs obtained in the genomic shotgun sequencing, many passed one or both 39 WO 2006/136392 PCT/EP2006/005961 prongs of this test but the results of only four are presented here. Table 2 shows four clones obtained from the shot-gun genomic sequencing selected as potential vaccine targets and their similarity with other known amino acid sequences obtained from SWISS-PROT database. Table 2 also provides information on the lack of homology of ACI's ORF to any known 5 protein. It is noted that the percent identity of amino acids does not rise above 41% while the percent similarity of amino acids remains less than 61%, thus indicating that these ORFs are unique. Table 2 Identity of Protein With Highest Identity Similarity Accession Gene Homology (amino (amino Number acids) acids) NAV- protective surface antigen D15 of 24% 45% P46024 P4 Haemophillus influenzae (95/393) (180/393) NAV- D-methionine binding lipoprotein 41% 61% Q8Z992 P6 (MetQ) of Salmonella typhi (106/255) (157/255) NAV- metal binding protein/surface 41% 58% P11 adhesm of Clostridium (117/280) (163/280) ZP00313604 thermocellum NAV- Basic membrane protein D (BmpD) 30% 51% Q44743 P14 of Borrelia burgdorferi (101/335) (172/335) No significant homology with ACI proteins in the Swiss-Prot protein na na na database. 10 The DNA and amino acid sequences of NAV-P4 are found in SEQ ID NOs: 3 and 4, respectively. The DNA and amino acid sequences of NAV-P6 are found in SEQ ID NOs: 5 and 6, respectively. The DNA and amino acid sequences of NAV-PI I are found in SEQ ID NOs: 7 and 8, respectively. The DNA and amino acid sequences of NAV-P 14 are found in 15 SEQ ID NOs: 9 and 10, respectively. Analysis of gene distribution using polymerase chain reaction (PCR) Two primer pairs which anneal to different regions of the target gene encoding region are designed and optimised for PCR detection. Individual primers are designed using Oligo Explorer 1.2 and primer sets with calculated melting temperatures of approximately 55-60*C 20 are selected. These primers sets are also selected to generate PCR products greater than 200bp. A medium-stringency primer annealing temperature of 50*C is selected for the distribution analysis PCR. The medium-stringency conditions would allow potential minor mismatched sequences (because of strain differences) occurring at the primer binding sites to not affect primer binding. Distribution analysis of the five B. pilosicoli target genes are 40 WO 2006/136392 PCT/EP2006/005961 performed on 19 strains of B. pilosicoli. Primer sets used in the distribution analysis are shown in Table 3. PCR analysis is performed in a 25 tl total volume using Taq DNA polymerase (Biotech International, Thurmont, MD). The amplification mixture consists of Ix PCR buffer (containing 1.5 mM of MgCl 2 ), 1 U of Taq DNA polymerase, 0.2 mM of each 5 dNTP (Amersham Pharmacia Biotech, Piscataway, NJ), 0.5 pM of the primer pair, and 1 d purified chromosomal template DNA. Cycling conditions involve an initial template denaturation step of 5 minutes at 94*C, follow by 35 cycles of denaturation at 94*C for 30 seconds, annealing at 50*C for 15 seconds, and primer extension at 68*C for 4 minutes. The PCR products are subjected to electrophoresis in 1% (w/v) agarose gels in 1x TAE buffer (40 10 mM Tris-acetate, 1 mM EDTA), staining with a 1 ptg/ml ethidium bromide solution and viewing over UV light. All five of the B. pilosicoli ORFs selected as vaccine candidates are present in each strain tested. 15 Table 3 Gene Primer name Primer Sequence (5'-3') ACI ACI-F7 atcgctaagataatttttatactg (SEQ ID NO: 11) AC1-R822 gctttgttgctcttgctctaaag (SEQ ID NO: 12) AC 1 -F226 ccatttccgcttatagcagcatac (SEQ ID NO: 13) ACI-R542 gatacttttaatactcttgcattg (SEQ ID NO: 14) NAV- P4 P4-F4 cgtgtgggagacccttatatacc (SEQ ID NO: 15) P4-RI 113 aaatcccaaatatataggcaaattaag (SEQ ID NO: 16) P4-F 1072 gcagagccttatttgcttaatttg (SEQ ID NO: 17) P4-R2193 atagaatgggtggttcattgtaaag (SEQ ID NO: 18) P4-F458 ttggagatattggctttaagggta (SEQ ID NO: 19) P4-RI659 ggcatcgttttgaataggaaga (SEQ ID NO: 20) NAV-P6 P6-F35 tgtttttagcttcttgcggc (SEQ ID NO: 21) P6-R713 tcattatccttatcagaagcccttg (SEQ ID NO: 22) P6-F219 tgacggcgatatagatttagatgc (SEQ ID NO: 23) P6-R578 accgcacaagcaacatcagg (SEQ ID NO: 24) NAV-PII PI1-F33 actttctttaatctcttgtaacaata (SEQ ID NO: 25) P1 1-R864 ccatttgttatagcttctagattctt (SEQ ID NO: 26) P1 l-F263 tggagcattgggcagacact (SEQ ID NO: 27) P11-R566 aaatgtccgaatgcagggtg (SEQ ID NO: 28) NAV-P14 P14-F41 ttatcggaattttgcttggt (SEQ ID NO: 29) P14-R 1142 tcaccagatacattacaagcagt (SEQ ID NO: 30) P14-F332 gaattgctgatgctgctggt (SEQ ID NO: 31) P14-R858 agcacaaagaggtactacgaaa (SEQ ID NO: 32) The five ORFs selected for further testing as potential vaccine candidates are next cloned into expression vectors, expressed, purified, and evaluated for immunogenicity. 41 WO 2006/136392 PCT/EP2006/005961 pTrcHis Plasmid Extraction Escherichia coli JM 109 clones harboring the pTrcHis plasmid (Invitrogen, Carlsbad, CA) are streaked out from glycerol stock storage onto Luria-Bertani (LB) agar plates supplemented with 100 mg/i ampicillin and incubated at 37*C for 16 hours. A single colony 5 is used to inoculate 10 ml of LB broth supplemented with 100 mg/l ampicillin, and the broth culture is incubated at 37'C for 12 hours with shaking. The entire overnight culture is centrifuged at 5,000 x g for 10 minutes, and the plasmid contained in the cells is extracted using the QlAprep Spin Miniprep Kit (Qiagen, Doncaster VIC). The pelleted cells are resuspended with 250 pl cell resuspension buffer P1 and then are lysed with the addition of 10 250 p1 cell lysis buffer P2. The lysed cells are neutralized with 350 p1 neutralization buffer N3, and the precipitated cell debris is pelleted by centrifugation at 20,000 x g for 10 minutes. The supernatant is transferred to a spin column and centrifuged at 10,000 x g for 1 minute. After discarding the flow-through, 500 p1 wash buffer PE is applied to the column and centrifuged as before. The flow-through is discarded, and the column is dried by 15 centrifugation at 20,000 x g for 3 minutes. The plasmid DNA is eluted from the column with 100 p1 elution buffer EB. The purified plasmid is quantified using a Dynaquant DNA fluorometer (Hoefer, San Francisco, CA), and the DNA concentration is adjusted to 100 pg/ml by dilution with TE buffer. The purified pTrcHis plasmid is stored at -20*C. Vector Preparation 20 Two pg of the purified pTrcHis plasmid is digested at 37*C for 1-4 hours in a total volume of 50 pl containing 5 U of EcoR1 (New England Biolabs, Beverly, MA) and 5 U of Xho 1 (New England Biolabs) in 100 mM Tris-HCl (pH 7.5), 50 mM NaCl, 10 mM MgCl 2 , I mM DTT and 100 pg/mI BSA. The restricted vector is verified by electrophoresing 1 p1 of the digestion reaction through a 1% (w/v) agarose gel in IX TAE buffer at 90V for 1 hour. 25 The electrophoresed DNA is stained with I pg/ml ethidium bromide and is viewed over ultraviolet (UV) light. Linearised pTrcHis vector is purified using the UltraClean PCR Clean-up Kit (Mo Bio Laboratories, Carlsbad, CA). Briefly, the restriction reaction (50 pL) is mixed with 250 p1 SpinBind buffer B 1, and the entire volume is added to a spin-column. After centrifugation at 30 8,000 x g for 1 minute, the flow-through is discarded and 300 pl SpinClean buffer B2 is added to the column. The column is centrifuged as before, and the flow-through is discarded before drying the column at 20,000 x g for 3 minutes. The purified vector is eluted from the column with 50 pl TE buffer. Purified linear vector is quantified using a fluorometer, and the 42 WO 2006/136392 PCT/EP2006/005961 DNA concentration is adjusted to 50 pg/ml by dilution with TE buffer. The purified restricted vector is stored at -20 0 C. Primer Design for Insert Preparation Primer pairs are designed to amplify as much of the coding region of the target gene 5 as possible using genomic DNA as the starting point. All primers sequences include terminal restriction enzyme sites to enable cohesive-end ligation of the resultant amplicon into the linearised pTrcHis vector. The primer sequences used for cloning are shown in Table 4. The primers are tested using Amplify 1.2 (University of Wisconsin, Madison, WI) and the theoretical amplicon sequence is inserted into the appropriate position in the pTrcHis vector 10 sequence. Deduced translation of the chimeric pTrcHis expression cassette is performed using Vector NTI version 6 (InforMax) to confirm that the gene inserts would be in the correct reading frame. Table 4 also provides the predicted molecular weight of the native protein in daltons and the apparent molecular weight of the expressed protein in kDa as determined from SDS-PAGE. The histidine-fusion of the recombinant protein adds 15 approximately 4 kDa to the native protein. Table 4 Predicted Apparent Primer MW of MW of Gene name Primer Sequence (5'-3') native recombinant protein protein S(Da) (kDa) AC1-Fl ACl Xhol aaactcgagatgaccctacatattttttcacag (SEQ ID NO: 33) 30569 34.7 AC I -R822- aaagaattcgctttgttgctcttgctctaaag (SEQ ID NO: 34) EcoRJ NAV-P4 p4-F4-Xhol N - P4-RI 113- ctactcgagcgtgtgggagacccttatatacc (SEQ ID NO: 35) 503 trNal) PEcoRI agagaattcaaatcccaaatatataggcaaattaag (SEQ ID NO: 36) terminal) cR NAV-P4 P4-F1072- 84090 (C- Xhol gttctcgaggcagagccttatttgcttaatttg (SEQ ID NO: 37) 51.2 P4-R2193- gttgaattcatagaatgggtggttcattgtaaag (SEQ ID NO: 38) terminal) EcoR I P6-F52-Xbol NAV-P6 P6-R807- gctctcgaggcggaaataatgataataaaaaag (SEQ ID NO: 39) 28785 33.9 EcoR 1 gttgaattctttccaagcaggtatataagctc (SEQ ID NO: 40) P1 I-F52 NAV- Xhol atcctcgagaacaataataataatcaaaacacaac (SEQ ID NO: 41) 32225 35.9 P11 P1 I-R852- gttgaattcattattaagaccatttgttatagcttc (SEQ ID NO: 42) EcoRi NAV- P14-F4-Xbol atactcgaggaaaaaaaatttaaacttggattagtg (SEQ ID NO: 43) 42653 49.4 P14 EcoR 1 gttgaattcagcttttacaacttctttttatatattg (SEQ ID NO: 44) Amplification of the gene inserts 43 WO 2006/136392 PCT/EP2006/005961 Using genomic DNA, all target gene inserts are amplified by PCR in a 100 gl total volume using Taq DNA polymerase (Biotech International) and Pfu DNA polymerase (Promega, Madison, WI). The amplification mixture consists of lx PCR buffer (containing 1.5 mM of MgCl 2 ), I U of Taq DNA polymerase, 0.01 U Pfu DNA polymerase, 0.2 mM of 5 each dNTP (Amersham Pharmacia Biotech), 0.5 tM of the appropriate primer pair and I pl of purified chromosomal DNA. The chromosomal DNA is prepared from the same B. pilosicoli strain used for genome sequencing. Cycling conditions involve an initial template denaturation step of 5 minutes at 94*C, followed by 35 cycles of denaturation at 94*C for 30 seconds, annealing at 50*C for 15 seconds, and primer extension at 68*C for 4 minutes. The 10 PCR products are subjected to electrophoresis in 1% (w/v) agarose gels in lx TAE buffer, are stained with a I ptg/ml ethidium bromide solution and are viewed over UV light. After verifying the presence of the correct size PCR product, the PCR reaction is purified using the UltraClean PCR Clean-up Kit (Mo Bio Laboratories, Carlsbad, CA). The PCR reaction (100 pl) is mixed with 500 pl SpinBind buffer B 1, and the entire volume is added to a spin 15 column. After centrifugation at 8,000 x g for 1 minute, the flow-through is discarded, and 300 pl SpinClean buffer B2 is added to the column. The column is centrifuged as before and the flow-through is discarded before drying the column at 20,000 x g for 3 minutes. The purified vector is eluted from the column with 100 p1 TE buffer. Restriction enzyme digestion of the gene inserts 20 Thirty pl of the purified PCR product is digested in a 50 pl total volume with I U of EcoRl and I U of Xhol in 100 mM Tris-HCl (pH 7.5), 50 mM NaCl, 10 mM MgCl 2 , 1 mM DTT and 100 pg/ml BSA at 37*C for 1-4 hours. The digested insert DNA is purified using the UltraClean PCR Clean-up Kit (see above). Purified digested insert DNA is quantified using a fluorometer, and the DNA concentration is adjusted to 20 pg/ml by dilution with TE 25 buffer. The purified restricted insert DNA is used immediately for vector ligation. Ligation of the gene inserts into the pTrcHis vector Ligation reactions are all performed in a total volume of 20 pd. One hundred ng of Xhol/EcoRl-linearised pTrcHis is incubated with 20 ng ofXhol/EcoRl-restricted insert at 16*C for 16 hours in 30 mM Tris-HCl (pH 7.8), 10 mM MgC 2 , 10 mM DTT and 1 mM ATP 30 containing 1 U of T4 DNA ligase (Promega). An identical ligation reaction containing no insert DNA is also included as a vector re-circularisation negative control. Transformation of pTrcHis ligations into E. coli cells 44 WO 2006/136392 PCT/EP2006/005961 Competent . coli JM 109 (Promega) cells are thawed from -80*C storage on ice and then 50 pl of the cells are transferred into ice-cold 1.5 ml microfuge tubes containing 5 pl of the overnight ligation reactions (equivalent to 25 ng of pTrcHis vector). The tubes are mixed by gently tapping the bottom of each tube on the bench and left on ice for 30 minutes. The 5 cells are then heat-shocked by placing the tubes into a 42*C waterbath for 45 seconds before returning the tube to ice for 2 minutes. The transformed cells are recovered in I ml LB broth for 1 hour at 37*C with gentle mixing. The recovered cells are harvested at 2,500 x g for 5 minutes, and the cells are resuspended in 50 pl of fresh LB broth. The entire 50 pl of resuspended cells are spread evenly onto a LB agar plate containing 100 mg/l ampicillin 10 using a sterile glass rod. Plates are incubated at 37'C for 16 hours. Detection of recombinant pTrcHis constructs in E. coli by PCR Twelve single transformant colonies for each construct are streaked onto fresh LB agar plates containing 100 mg/l ampicillin and incubated at 37*C for 16 hours. A single colony from each transformation event is resuspended in 50 pl of TE buffer and is boiled for 15 1 minute. Two pl of boiled cells are used as template for PCR. The amplification mixture consists of lx PCR buffer (containing 1.5 mM of MgCl 2 ), 1 U of Taq DNA polymerase, 0.2 mM of each dNTP, 0.5 pM of the pTrcHis-F primer (5' CAATTTATCAGACAATCTGTGTG-3' SEQ ID NO: 45) and 0.5 ptM of the pTrcHis-R primer (5'-TGCCTGGCAGTTCCCTACTCTCG-3' SEQ ID NO: 46). Cycling conditions 20 involve an initial template denaturation step of 5 minutes at 94'C, followed by 35 cycles of denaturation at 94*C for 30 seconds, annealing at 60'C for 15 seconds, and a primer extension at 72'C for 1 minute. The PCR products are subjected to electrophoresis in 1% (w/v) agarose gels in lx TAE buffer, are stained with a 1 pg/ml ethidium bromide solution and are viewed over UV light. Cloning of the various inserts into the pTrcHis expression 25 vector produces recombinant constructs of various sizes. Pilot expression of recombinant His-tagged proteins Five to ten isolated colonies of recombinant pTrcHis construct in E. coli JM109 are inoculated into 3 ml LB broth in a 5 ml tube containing 100 mg/l ampicillin and 1 mM IPTG and incubated at 37'C for 16 hours with shaking. The cells are harvested by centrifugation at 30 5,000 x g for 10 minutes at 4*C. The supernatant is discarded, and each pellet is resuspended with 10 pl Ni-NTA denaturing lysis buffer (100 mM NaH 2

PO

4 , 10 mM Tris-HCl, 8 M urea, pH 8.0). After vortexing the tube for 1 minute, the cellular debris is pelleted by centrifugation 45 WO 2006/136392 PCT/EP2006/005961 at 10,000 x g for 10 minute at 4*C. The supernatant is transferred to a new tube and stored at -20*C until analysis. Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) SDS-PAGE analysis of protein is performed using a discontinuous Tris-glycine buffer 5 system. Thirty pd of protein sample are mixed with 10 p.l of 4x sample treatment buffer (250 mM Tris-HCI (pH 6.0), 8% (w/v) SDS, 200 mM DTT, 40% (v/v) glycerol and 0.04 % (w/v) bromophenol blue). Samples are boiled for 5 minutes immediately prior to loading 10 pl of the sample into wells in the gel. The gel comprises a stacking gel (125 mM Tris-HCI ph 6.8, 4% w/v acylamide, 0.15% w/v bis-acrylamide and 0.1% w/v SDS) and a separating gel (375 10 mM Tris-HCI ph 8.8, 12% w/v acylamide, 0.3 1% w/v bis-acrylamide and 0.1% w/v SDS). These gels are polymerised by the addition of 0.1% (v/v) TEMED and 0.05% (w/v) freshly prepared ammonium sulphate solution and cast into the mini-Protean dual slab cell (Biorad, Hercules, California). Samples are run at 150 V at room temperature (RT) until the bromophenol blue dye reaches the bottom of the gel. Pre-stained molecular weight standards 15 are electrophoresed in parallel with the samples in order to allow molecular weight estimations. After electrophoresis, the gel is immediately stained using Coomassie Brilliant Blue G250 (Biorad) or is subjected to electro-transfer onto nitrocellulose membrane for Western blotting. Western Blot Analysis 20 Electrophoretic transfer of separated proteins from the SDS-PAGE gel to nitrocellulose membrane is performed using the Towbin transfer buffer system. After electrophoresis, the gel is equilibrated in transfer buffer (25 mM Tris, 192 mM glycine, 20% v/v methanol, pH 8.3) for 15 minutes. The proteins in the gel are electro-transferred to nitrocellulose membrane (Protran, Schleicher and Schuell BioScience, Inc., Keene, NH) 25 using the mini-Protean transblot apparatus (Biorad) at 30 V overnight at 4*C. The freshly transferred nitrocellulose membrane containing the separated proteins is blocked with 10 ml of tris-buffered saline (TBS) containing 5% (w/v) skim milk powder for 1 hour at RT. The membrane is washed with TBS containing 0.1% (v/v) Tween 20 (TBST) and then is incubated with 10 mL mouse anti-his antibody (diluted 5,000-fold with TBST) for 1 hour at 30 RT. After washing three times for 5 minutes with TBST, the membrane is incubated with 10 mL goat anti-mouse IgG (whole molecule)-AP diluted 5,000-fold in TBST for 1 hour at RT. The membrane is developed using the Alkaline Phosphatase Substrate Kit (Biorad). The 46 WO 2006/136392 PCT/EP2006/005961 development reaction is stopped by washing the membrane with distilled water. The membrane is then dried and scanned for presentation. Verification of reading frame of the recombinant pTrcHis constructs by direct sequence analysis 5 Two transformant clones for each construct which produced the correct sized PCR products are inoculated into 10 ml LB broth containing 100 mg/i ampicillin and incubated at 37'C for 12 hours with shaking. The entire overnight cultures are centrifuged at 5,000 x g for 10 minutes, and the plasmid contained in the cells are extracted using the QlAprep Spin Miniprep Kit as described previously. The purified plasmid is quantified using a fluorometer. 10 Both purified plasmids are subjected to automated direct sequencing of the pTrcHis expression cassette using the pTrcHis-F and pTrcHis-R primers. Each sequencing reaction is performed in a 10 pl volume consisting of 200 ng of plasmid DNA, 2 pmol of primer, and 4 pl of the ABI PRISM TM BigDye Terminator Cycle Sequencing Ready Reaction Mix (PE Applied Biosystems, Foster City, CA). Cycling conditions involve a 2 minute denaturing step 15 at 96'C, followed by 25 cycles of denaturation at 96*C for 10 seconds, and a combined primer annealing and extension step at 60'C for 4 minutes. Residual dye terminators are removed from the sequencing products by precipitation with 95% (v/v) ethanol containing 85 mM sodium acetate (pH 5.2), 3mM EDTA (pH 8), and vacuum dried. The plasmids are sequenced in duplicate using each primer. Sequencing products are analysed using an ABI 20 373A DNA Sequencer (PE Applied Biosystems). Nucleotide sequencing of the pTrcHis constructs verifies that the expression cassette is in the correct reading frame for all the constructs. The predicted translation of the pTrcHis expression cassette indicates that all the recombinant his-tagged proteins and the deduced amino acid sequence of the native B. pilosicoli proteins are identical. 25 Expression and purification of recombinant His-tagged proteins A single colony of the recombinant pTrcHis construct in E. coli JM109 is inoculated into 50 ml LB broth in a 250 ml conical flask containing 100 mg/I ampicillin and incubated at 37*C for 16 hours with shaking. A 2 1 conical flask containing 11 of LB broth supplemented with 100 mg/I ampicillin is inoculated with 10 ml of the overnight culture and incubated at 30 37*C until the optical density of the cells at 600 nrm is 0.5 (approximately 3-4 hours). The culture is then induced by adding IPTG to a final concentration of 1 mM, and the cells are returned to 37*C with shaking. After 5 hours of induction, the culture is transferred to 250 ml centrifuge bottles, and the bottles are centrifuged at 5,000 x g for 20 minutes at 4*C. The 47 WO 2006/136392 PCT/EP2006/005961 supernatant is discarded, and each pellet is resuspended with 8 ml Ni-NTA denaturing lysis buffer (100 mM NaH 2

PO

4 , 10 mM Tris-HCI, 8 M urea, pH 8.0). The resuspended cells are stored at -20'C overnight. The cell suspension is removed from -20*C storage and thawed on ice. The cell lysate 5 is then sonicated on ice 3 times for 30 seconds with 1 minute incubation on ice between sonication rounds. The lysed cells are cleared by centrifugation at 20,000 x g for 10 minutes at 4*C, and the supernatant is transferred to a 15 ml column containing a 0.5 ml bed volume of Ni-NTA agarose resin (Qiagen). The recombinant His 6 -tagged protein is allowed to bind to the resin for 1 hour at 4'C with end-over-end mixing. The resin is then washed with 30 ml of 10 Ni-NTA denaturing wash buffer (100 mM NaH 2

PO

4 , 10 mM Tris-HCI, 8 M urea, pH 6.3) before elution with 12 ml of Ni-NTA denaturing elution buffer (100 mM NaH 2

PO

4 , 10 mM Tris-HCl, 8 M urea, pH 4.5). Four 3 ml fractions of the eluate are collected and stored at 4*C. Thirty pl of each eluate is treated with 10 pl of 4x sample treatment buffer and boiled for 5 minutes. The samples are subjected to SDS-PAGE and stained with Coomassie Brilliant Blue 15 G250 (Biorad). The stained gel is equilibrated in distilled water for 1 hour and dried between two sheets of cellulose overnight at RT. Expression of the selected recombinant E. coli clones is performed in medium-scale to generate sufficient recombinant protein for vaccination of mice (see below). All recombinant proteins possessing the hexa-histidine fusion (4 kDa) produce a major protein 20 with an apparent molecular weight similar to the predicted molecular weight of the native protein (see Table 4). These proteins are highly reactive in Western blotting using the anti His antibody. Purification of the his-tagged recombinant proteins by affinity chromatography under denaturing conditions is successful. SDS-PAGE and Coomassie blue staining of all recombinant proteins show that a purification of at least 85% is achieved. Recombinant 25 protein yields of 2 mg/L are consistently obtained using this expression protocol. Dialysis and lyophilisation of the purified recombinant His-tagged protein The eluted proteins are pooled and transferred into a hydrated dialysis tube (Spectrum Laboratories, Inc., Los Angeles, CA) with a molecular weight cut-off (MWCO) of 3,500 Da. A 200 ptl aliquot of the pooled eluate is taken and quantified using a commercial Protein 30 Assay (Biorad). The proteins are dialysed against 2 1 of distilled water at 4*C with stirring. The dialysis buffer is changed 8 times at 12-hourly intervals. The dialysed proteins are transferred from the dialysis tube into a 50 ml centrifuge tubes (40 ml maximum volume), and the tubes are placed at -80*C overnight. Tubes are placed into a MAXI freeze-drier 48 WO 2006/136392 PCT/EP2006/005961 (Heto-Holten, Allerod, Denmark) and lyophilised to dryness. The lyophilised proteins are then re-hydrated with PBS to a calculated concentration of 2 mg/ml and stored at -20*C. Following dialysis and lyophilisation, stable recombinant antigen is successfully produced. Serology using purified recombinant protein 5 Twenty ig of purified recombinant protein is loaded into a 7 cm IEF well, electrophoresed through a 10% (w/v) SDS-PAGE gel, and electro-transferred to nitrocellulose membrane. The membrane is blocked with TBS-skim milk (5% w/v) and assembled into the multi-screen apparatus (Biorad). The wells are incubated with 100 [pl of diluted pig serum (100-fold) for 1 hour at RT. The pig serum was obtained from high health 10 status pigs (n=3), experimentally challenged pigs showing fecal shedding (n=6), and naturally infected pigs showing fecal shedding (n=7). The membrane then is removed from the apparatus and washed three times with TBST (0.1% v/v) before incubating with 10 ml of goat anti-swine IgG (whole molecule)-AP (5,000-fold) for 1 hour at RT. The membrane is washed three times with TBST before color development using an Alkaline Phosphatase Substrate 15 Kit (Biorad). The membrane is washed with tap water when sufficient development has occurred, dried and scanned for presentation. All the proteins cloned are recognized by 80-100% of the panel of pig serum, regardless of health status, thus indicating that the genes had been expressed in vivo and that the pigs were able to induce a systemic immune response following exposure to the 20 spirochaete. Vaccination of mice using the purified recombinant his-tagged proteins For each of the purified recombinant his-tagged proteins, ten mice are systemically and orally immunized to determine whether the recombinant protein would be immunogenic. The recombinant protein is emulsified with 30% (v/v) water in oil adjuvant and injected 25 intramuscularly into the quadraceps muscle of ten mice (Balb/cJ: 5 weeks old males). All mice receive 100 pg of protein in a total volume of 100 pl. Three weeks after the first vaccination, all mice receive a second intramuscular vaccination identical to the first vaccination. All mice are killed two weeks after the second vaccination. Sera are obtained from the heart at post-mortem and tested in Western blot analysis for antibodies against 30 cellular extracts of B. pilosicoli. Western blot analysis Twenty pg of purified recombinant protein is loaded into a 7 cm IEF well, electrophoresed through a 10% (w/v) SDS-PAGE gel, and electro-transferred to 49 WO 2006/136392 PCT/EP2006/005961 nitrocellulose membrane. The membrane is blocked with TBS-skim milk (5% w/v) and assembled into the multi-screen apparatus (Biorad). The wells are incubated with 100 pl of diluted mouse serum (100-fold) for 1 hour at RT. The membrane is removed from the apparatus and washed three times with TBST (0.1% v/v) before incubating with 10 ml of goat 5 anti-mouse IgG (whole molecule)-AP (5,000-fold) for 1 hour at RT. The membrane is washed three times with TBST before color development using an Alkaline Phosphatase Substrate Kit (Biorad). The membrane is washed with tap water when sufficient development has occurred, dried and scanned for presentation. Western blot analysis shows a significant increase in antibody reactivity in the mice 10 towards the recombinant vaccine antigens following vaccination. All the mice recognize recombinant proteins which are similar in molecular weight to that of the Coomassie blue stained purified recombinant proteins. These experiments provide evidence that the recombinant proteins are immunogenic when used to vaccinate mice, and that the vaccination protocol employed can induce specific circulating antibody titres against the antigen. 15 Vaccination of pigs using the purified recombinant his-tagged proteins For each of the purified recombinant his-tagged proteins, ten sero-negative pigs are injected intramuscularly with I mg of the particular antigen in 1 ml vaccine volume. The antigen is emulsified with an equal volume of a water-in-oil adjuvant. The pigs are vaccinated at three weeks of age and again at six weeks of age. A second group of ten sero 20 negative pigs is used as negative controls and are left unvaccinated. All pigs are challenged with 100 ml of an active B. pilosicoli culture (~109 cells/ml) at eight weeks of age, and the pigs are observed for clinical signs of infection during the experiment (up to six weeks post challenge) and at post-mortem examination. Diagnostic kit 25 Serum is obtained from pigs in a piggery with known infection of B. pilosicoli, from pigs known not to have been infected with B. pilosicoli, and from pigs in a piggery with unknown infection status with B. pilosicoli. Twenty ptg of purified recombinant protein is loaded into a 7 cm IEF well, electrophoresed through a 10% (w/v) SDS-PAGE gel, and electro-transferred to nitrocellulose membrane. The membrane is blocked with TBS-skim 30 milk (5% w/v) and assembled into the multi-screen apparatus (Biorad). The wells are incubated with 100 pl of diluted pig serum (100-fold) for 1 hour at RT. The membrane then is removed from the apparatus and washed three times with TBST (0.1% v/v) before incubating with 10 ml of goat anti-swine IgG (whole molecule)-AP (5,000-fold) for 1 hour at 50 WO 2006/136392 PCT/EP2006/005961 RT. The membrane is washed three times with TBST before color development using an Alkaline Phosphatase Substrate Kit (Biorad). The membrane is washed with tap water when sufficient development has occurred, dried and scanned for presentation. The sera from the pigs known to be infected with B. pilosicoli (positive controls) reacts with the recombinant 5 proteins while the sera from the pigs without infection (negative controls) do not react. One can determine if pigs are infected with B. pilosicoli by comparing the results to the positive and negative controls. While this invention has been described with a reference to specific embodiments, it will be obvious to those of ordinary skill in the art that variations in these methods and 10 compositions may be used and that it is intended that the invention may be practiced otherwise than as specifically described herein. Accordingly this invention includes all modifications encompassed within the spirit and scope of the invention as defined by the claims. 51

Claims (20)

1. An isolated polynucleotide comprising a sequence as shown in SEQ ID No: 3. 5

2. An isolated DNA molecule comprising a sequence that is at least 70% homologous to a polynucleotide according to claim 1.

3. A DNA molecule according to claim 2, wherein said DNA molecule is at least 80% homologous to a polynucleotide according to claim 1. 10

4. A DNA molecule according to claim 2, wherein said DNA molecule is at least 90% homologous to a polynucleotide according to claim 1.

5. An isolated polypeptide comprising a sequence as shown in SEQ ID NO. 4. 15

6. An isolated polynucleotide comprising a sequence which encodes a polypeptide according to claim 5.

7. A plasmid comprising a polynucleotide according to claim I or 6, or a DNA 20 molecule according to anyone of claims 2 to 4.

8. A plasmid according to claim 7, wherein said plasmid is an expression vector.

9. A cell containing a plasmid according to claim 7 or 8. 25

10. An immunogenic composition comprising a plasmid according to claim 7 or 8, or a cell according to claim 9.

11. An isolated protein comprising a sequence that is at least 70% homologous to a 30 polypeptide according to claim 5.

12. A protein according to claim 11, wherein said protein is at least 80% homologous to a polypeptide according to claim 5. 35

13. A protein according to claim 11, wherein said protein is at least 90% homologous to a polypeptide according to claim 5. 52 1761366_1 (GHMatters) 14/10/09

14. An immunogenic composition comprising a polypeptide according to claim 5 or a protein according to any one of claims 11 to 13.

15. A vaccine composition for the treatment or prevention of Brachyspira pilosicoli 5 comprising a plasmid according to claim 7 or 8, a cell according to claim 9, or a polypeptide according to claim 5.

16. A monoclonal antibody that specifically binds to polypeptide according to claim 5. 10

17. A kit for the diagnosis of presence of Brachyspira pilosicoli in an animal, said kit comprising a polynucleotide according to claim 1, a polypedtide according to claim 5, or a monoclonal antibody according to claim 16. is

18. A method of generating an immune response to Brachyspira pilosicoli in an animal comprising administering to said animal an immunogenic composition according to claim 10 or 14.

19. A method of treating or preventing a disease caused by Brachyspira pilosicoli in 20 an animal in need of said treatment comprising administering to said animal a therapeutically effective amount of a vaccine composition according to claim 15.

20. An isolated polynucleotide or isolated polypeptide, substantially as hereinbefore described with reference to any one of the examples. 25 53 17613661 (GHMatters) 14/10/09