AU2006252290B2 - RTD receptor - Google Patents

Description

AUSTRALIA Patents Act 1990 COMPLETE SPECIFICATION Standard Patent Applicants: GENENTECH, INC. Invention Title: RTD RECEPTOR The following statement is a full description of this invention, including the best method for performing it known to us: P) 129RI RTD IECEPTOR FIELD OF THE iNVENTION The present invention relates generally to the identification, isolation, and recombinant proddcdion of novel polypeptides, designated herein as "RTD" and to anti-RTD antibodies. 5 BACKGROUND OF THE INVENTION Apontosis or "Prorammed ClDeath" Control of cell numbers in mammals is believed to be determined, in part, by a balance between cell proliferation and cell death. One frm of cell death, sometimes referred to as necrotic cell death, is typically characterized as a pathologic fonn of cell death resulting from some trauma or cellular injury. In contrast, 10 there is another, "physiologic"form ofcell death which usually proceeds in an orderly or controlled manner. This orderly or controlled form of cell death is often referred to as "apoptosis" [see, e.g., Barr et al, Big/Technology.12:487-493 (1994); Steller et al., Scince. 267;1445-1449 (1995)]. Apoptotic cell death naturally occurs in many physiological processes, including embryonic development and clonal selection in the immune system [Itoh et al., Cll, -:233-243 (1991)]. Decreased levels of apoptotic cell death have been 15 associated with a variety of pathological conditions, including cancer, lupus, and herpes virus infection [Thompson,Scien, 2.2:1456-1462(1995)]. Increased levels of apoptotic cell death may be associated with a variety of other pathological conditions, including AIDS, Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, multiple sclerosis, retinitis pigmentosa, cerebellar degenerationaplastic anemia, myocardial infarction, stroke, reperfusion injury, and toxin-induced liver disease [see, Thompson, mupra). 20 Apoptotic cell death is typically accompanied by one or wore characteristic morphological and biochemical changes in cells, such as condensation of cytoplasm, loss of plasma membrane microvilli, segmentation of the nucleus, degradation of chromosomal DNA or loss of mitochondrial function. A variety of extrinsic and intrinsic signals are believedto trigger or induce such morphological and biochemical cellular changes [Raff, Natue 356:397-400 (1992); Steller, supM; Sachs e at, Blgod.82:15 (1993)]. For instance, 25 they can be triggered by hormonal stimuli, such as glucocorticoidhormones for immature thymocytes, as well as withdrawalof certain growth factors [Watanabe-Fukunagaet al, Nature, 5:314-317(1992)]. Also, some identified oncogenes such as myc, rel, and EIA, and tumor suppressors, like p53, have been reported to have a role in inducing apoptosis. Certain chemotherapy drugs and some forms of radiation have likewise been observed to have apoptosis-inducing activity [Thompson, supra]. 30 TNFFamily of Cytokines Various molecules, such as tumor necrosis factor-a ("TNF-;"), tumor necrosis factor-p ("TNF-O" or "lymphotoxin"),CD30 ligand, CD27 ligand, CD40 ligand, OX-40 ligand, 4-1BB ligand, Apo-l ligand (also referred to as Fas ligand or CD95 ligand), and Apo-2 ligand (also referred to as TRAIL) have been identified as members of the tumor necrosis factor ("TNF") family of cytokines [See, e.g., Gruss and Dower, Blod, 35 15:3378-3404(1995); Wiley at at, Immmni, 2673-682 (1995); Pitti et al., J. iL Chem, 21:12687-12690 Pl129R1 (1996)]. Among these molecules, TNF-! TNF-p, CD30 ligand, 4-IBB ligand, Apo-I ligand, and Apo-2 ligand (TRAIL) have been reported to be involved in apoptotic cell death. Both TNF-a and TNF-P have been reported to induce apoptotic death in susceptible tumor cells [Schmid et al, Proc, Nati..Acd . Sci 1881 (1986); Dealtry at al., Eur. I TmmunoL .12:689 (1987)]. Zheng et al. have reported that TNF-c; is involved 5 in post-stimulation apoptosis of CDt-positive T cells [Zheng et al., Nature .2:348-351 (1995)]. Other investigators have reported that CD30 ligand may be involved in deletion of sef-reactiveT cells in the tffymus [Amakawa et al., Cold Spring Harbor Laboratory Symposium on Programmed Cell Death, Abstr. No. 10, (1995)]. Mutations in the mouse Fas/Apo-l receptor or ligand genes (called lpr and gd, respectively) have 10 been associatedwith some autoimmunedisorders, indicating that Apo-1 ligand may play a role in regulating the clonal deletionofself-reactivelymphocytesin the periphery [Krammeret al., ur. Op. mmunoLt6:279 289 (1994); Nagata et al., Scine 2E:1449-1456 (1995)). Apo-l ligand is also reported to induce post stimulation apoptosis in CD4-positive T lymphocytes and in B lymphocytes, and may be involved in the eliminationof activated lymphocytes when their function is no longer needed [Kramnmer et at, spa; Nagata 15 at aL, supra]. Agonist mouse monoclonal antibodies specifically binding to the Apo-1 receptor have been reported to exhibit cell killing activity that is comparable to or similar to that of TNF-a [Yonehara et al, L Exp. Med...M2:1747-1756 (1989)]. TNF Family of Receptors Induction of various cellular responses mediated by such TNF family cytokines is believed to be 20 initiated by their binding to specific cell receptors. Two distinct TNF receptors of approximately 55-kDa (INFRI) and 75-kDa (TNFR2) have been identified [Iohman et al., J. Biol Chem- 20:14927-14934(1989); Brockhaus at al., Proc. NtL Acad. ScL 1:3127-3131 (1990); EP 417,563, published March 20, 1991] and human and mouse cDNAs corresponding to both receptor types have been isolated and characterized jLoetscheret at _EJL fj.:351(1990); Schalet al., _Call, §:361 (1990); Smith et al., Science 24.: 1019-1023 25 (1990); Lewis at at, Proc. Ndati. Aced, Sci., M:2830-2834 (1991); Goodwin et al., Mol Cell. BioL .. :3020 3026(1991)). Extensivepolymorphismshave been associatedwith both TNF receptorgenes [see, e.g., Takeo et al., Immuno&gentics, 32:199-203(1993)]. Both TNFRs share the typical structure of cell surface receptors including cxtracellulartransmembrane and intracellularregions. The extracellular portions of both receptors are found naturally also as soluble TNF-binding proteins [Nophar, Y. et al., EMBOI. 2;3269 (1990); and 30 Kohno, T. et al., Proc. Nal. Acad. Sci. U.S.A.. 12:8331 (1990)). More recently, the cloning of recombinant soluble TNF receptors was reported by Hale at al. [J. Cell. Biochem. Supplement 15F, 1991, p. 113 (P424)]. The extracellular portion of type I and type 2 TNFRs (TNFRI and TNFR2) contains a repetitive amino acid sequence pattern of four cysteine-rich domains (CRDs) designated I through 4, starting from the

NH

2 -terminus. Each CR is about 40 amino acids long and contains 4 to 6 cysteine residues at positions 35 which are well conserved [Schall et a., 1pM; Loetscheret al., supam; Smith et at, sUm; Nophar et al., supa; Kohnoet aL,spm1. In TNFRI, the approximateboundaries of the four CRDs are as follows: CRD I- amino acids 14 to about 53; CRD2- amino acids from about 54 to about 97; CRD3- amino acids from about 98 to about 138; CRD4- amino acids from about 139 to about 167. In TNFR2, CRDI includes amino acids 17 to about 54; CRD2- amino acids from about 55 to about97; CRD3- amino acids from about 98 to about 140; and -2- P1129RI CRD4- amino acids from about 141 to about 179 [Bannere at, ll, 7.:431-435 (1993)]. The potential role of the CRDs in ligand binding is also described by Baner et al, jan. A similar repetitive pattern of CRDs exists in several other cell-surface proteins including the p75 nerve growth factor receptor (NGFR) [Johnson et al., C1 41:545 (1986); Radeke et al, Nature.d:s93 5 (1987)], the B cell antigen CD40 [Stamenkovic et al., BMbO 1. :1403 (1989)], the T cell antigen OX40 [Mallet et al., EMBO.L 2:1063 (1990)] and the Fas antigen [Yonehara et al., supra and Itoh et al., sna]. CRDs are also found in the soluble TNFR (sTNFR)-like 72 proteins of the Shope and myxoma poxviruses [Upton et al., Yjrolog, .Mh:20-29 (1987); Smith et al., Biochem. Bionhys. Res. Commun.. ll:335 (1991); Upton et al., Virology,.J4:370 (1991)]. Optimal alignment of these sequences indicates that the positions 10 of the cysteine residues are well conserved. These receptors are sometimes collectively referred to as members of the TNF/NGF receptor superfamily. Recent studies on p75NGFR showed that the deletion of CR01 [Welcher, A.A. etal., Proc. Natt Aced. Sl. USA. fL:159-163 (1991)] ora 5-amino acid insertion in this domain [Yan, H. and Chao, MV.,. iolCmA, 2.2 12099-12104(1991)]had little or no effect on NGF binding [Yan, H. and Chao, M.V., ana]. p75 NGFR contains a proline-rich stretch of about 60 amino acids, 15 between its CRD4 and transmembrane region, which is not involved in NGF binding [Peetre, C. et al., MLr, j.IHematot.4.j414-419 (1988); Seckinger, P. e a., LiLChjQen.- 2i4:11966-11973 (1989); Yan, H. and Chao, M.V., sunral. A similar proline-rich region is found in TNFR2 but not in TNFR I. atoh et al. disclose that the Apo-I receptor can signal an apoptotic cell death similar to that signaled by the 55-kDa TNFRI [Itoh at al., in]. Expression of the Apo-] antigen has also been reported to be 20 down-regulate d along with that of TNFR I when cells are treated with either TNF-a or anti-Apo- I mouse monoclonal antibody [Krammer et al., am; Nagata et at, an]. Accordingly, some investigators have hypothesized that cell lines that co-express both Apo-I and TNFRI receptors may mediate cell killing through common signaling pathways [Jdd. The TNF family ligands identified to date, with the exception of lymphotoxin-a, are type 11 25 transmembrane proteins, whose C-terminus is extracellular. In contrast, the receptors in the TNF receptor (TNFR) family identified to date are type I transmembrane proteins. In both the TNF ligand and receptor families,however, homology identified between family members has been found mainly in the extracellular domain ("ECD"). Several of the TNF family cytokines, including TNF-a, Apo- I ligand and CD40 ligand, are cleaved proteolytically at the cell surface; the resulting protein in each case typically forms a hornotrimeric 30 molecule that functions as a soluble cytokine. TNF receptor family proteins are also usually cleaved proteolytically to release soluble receptor ECDs that can fUnction as inhibitors of the cognate cytokines. Recently, other members of the TNFR family have been identified. In Marsters et al., Curr.DiLn !:750 (1996), investigators describe a full length native sequence human polypeptide, called Apo-3, which exhibits similarity to the TNFR family in its extracellular cysteine-rich repeats and resembles TNFRI and 35 CD95 in that it contains a cytoplasmic death domain sequence [see also Marsters et al., Cum. Biol., k:1669 (1996)]. Apo-3 has also been referred to by other investigators as DR3, wal- I and TRAMP [Chinnalyan at al., Science. 224:990 (1996); Kitson et al., Nature, 2U4:372 (1996); Bodmer et al, Immunity :79 (1997)]. Pan et al. have disclosed another TNF receptor family member referred to as "DR4" [Pan at al., Science 221:111-113 (1997)]. The DR4 was reported to contain a cytoplasmic death domain capable of -3- PIl 129RI engaging the cell suicide apparatus. Pan et al. disclose that DR4 is believed to be a receptor for the ligand known as Apo-2 ligand or TRAIL. In Sheridan et al, Sciencm:818-821(1997)andP talSin 222:815-818(1997), another molecule believed to be a receptor for the Apo-2 ligand (TRAIL) is described. That molecule is referred to 5 as DRS (it has also been alternatively referred to as Apo-2). Like DR4, DRS is reported to contain a cytoplasmic death domain and be capable of signaling apoptosis. In Sheridan et al., sg, a receptor called DeRI (or alternatively, Apo-2DcR) is disclosed as being a potential decoy receptor for Apo-2 ligand (TRAIL), Sheridan at al. report that DeRI can inhibit Apo-2 ligand function in virro. See also, Pan at al., jizpa, for disclosure on the decoy receptor reed to as TRID. 10 The Apoptosis-Inducing Signaline Complex As presentlyunderstood, the cell death program contains at leastthree importantelements- activators, inhibitors, and effectors; in C. algans, these elements are encoded respectively by three genes, Ced-4, Ced-9 and Ced-3 [Steller,Ssiemn 22:1445 (1995); Chinnaiyanet al., Science 275:1122-1126(1997); Wang at al., Cl 2:1-20 (1997)]. Two of the TNFR family members, TNFRI and Fas/ApoI (CD95), can activate 15 apoptotic cell death [Chinnaiyanand Dixit, CurtLo&W, i:555-562(1996); Faserand Evan, Cu|; |115:781 784(1996)]- TNFRl is also known to mediate activation of the transcription factor, NF-xB (Tartaglia et al., ulL, 14:845-953 (1993); Hsu at al., QulL 4:299-308 (1996)]. In additionto some ECD homology, these two receptors share homology in their intracellular domain (ICD) in an oligomerization interface known as the death domain [Tartagliaet al., z=m; Nagata, Cull. .5:355 (1997)]. Death domains are also found in several 20 metazoma proteins that regulate apoptosis, namely, the Drosophila protein, Reaper, and the mammalian proteins referred to as FADD/MORTI, TRADD, and RIP [Cleaveland and Ihle, Cal l..L:479-482 (1995)]. Using the yeast-twohybrid system, Raven at al. reportthe identification of protein, wsl-l, which binds to the TNFRI death domain [Raven at al., Programmed Cell Death Meeting, September 20-24, 1995, Abstract at page 127; Raven at al-, European Cytokine Network 7:Abstr. 82 at page 210 (April-June 1996); see also, 25 Kitson at al., Nature, 31:372-375 (1996)]. The wsl-l protein is described as being homologous to TNFRI (48% identity)and having a restricted tissue distribution, According to Raven at al., the tissue distribution of wsl-1 is significantly different from the TNFRI binding protein, TRADD. Upon ligand binding and receptor clustering,, TNFRI and CD95 are believed to recruit FADD into a death-inducing signalling complex. CD95 purportedly binds FADD directly, while TNFR1 binds FADD 30 indirectlyvia TRADD [Chionaiyanet al, Cell ,L:505-512(1995);Boldin et al., J. BioL Chem 220:397-391 (1995); Hsu at al., supra; Chinnaiyanet al., J. Biol. Chem., 221:4961-4965 (1996)]. It has been reported that FADD serves as an adaptor protein which recruits the Ced-3-related protease, MACHa/FLICE (caspase 8), into the death signalling complex [Boldin at al., gi&M U :803-815 (1996); Muzio et al., Celt t:817-827 (1996)]. MACHa/FLICE appears to be the trigger that sets off a cascade of apoptotic proteases, including the 35 interleukin-10 converting enzyme (ICE) and CPP32/Yama, which may execute some critical aspects of the cell death programme [Fraser and Evan, supra]. It was recently disclosed that programmed cell death involves the activity of members of a family of cysteine proteasesrelated to the C. elegant cell death gene, ced-3, and to the mammalian IL-l-converting enzyme, ICE. The activity of the ICE and CPP32/Yama proteases can be inhibited by the product of the -4cowpox virus gene, crmA [Ray et al., Cell, 69:597-604 (1992); Tewari et al., Cell S:801-809 (1995)]. Recent studies show that CrmA can inhibit TNFR1- and CD95-induced cell death [Enari et al., Nature, 375:78-81 (1995); Tewari et al., J. Biol. Chem., 270:3255-3260 (1995)]. As reviewed recently by Tewari et al., TNFR1, TNFR2 and CD40 modulate the expression of proinflarnmatory and costimulatory cytokines, cytokine receptors, and cell adhesion molecules through activation of the transcription factor, NF-KB [Tewan et al., Curr Op. Genet. Develop. 6:39-44 (1996)]. NF KB is the prototype of a family of dimeric transcription factors whose subunits contain conserved Rel regions [Verma et al., Genes Develop., 9:2723-2735 (1996); Baldwin, Ann. Rev. Imnunol., 14:649-681 (1996)]. In its latent form, NF-xB is complexed with members ofthe ImB inhibitor family; upon inactivation ofthe IKB in response to certain stimuli, released NF-KB translocates to the nucleus where it binds to specific DNA sequences and activates gene transcription. For a review of the TNF family of cytokines and their receptors, see Gruss and Dower, supra. All references, including any patents or patent applications, cited in this specification are hereby incorporated by reference. No admission is made that any reference constitutes prior art. The discussion of the references states what their authors assert, and the applicants reserve the right to challenge the accuracy and pertinency of the cited documents. It will be clearly understood that, although a number of prior art publications are referred to herein, this reference does not constitute an admission that any ofthese documents forms part of the common general knowledge in the art, in Australia or in any other country. SUMMARY OF THE INVENTION A first aspect provides isolated RTD polypeptide having at least about 80% amino acid sequence identity with native sequence RTD polypeptide comprising amino acid residues I to 386 of Fig. 1A (SEQ ID NO:1. A second aspect provides isolated native sequence RTD polypeptide comprising amino acid residues I to 386 ofFig. IA (SEQ ID NO: 1). A third aspect provides isolated RTD polypeptide comprising amino acid residues 56 to 386 of Fig. IA (SEQ ID NO: 1). A fourth aspect provides isolated extracellular domain sequence ofRTD polypeptide comprising (a) amino acid residues 56 to 212 of Fig. IA (SEQ ID NO: 1); or (b) fragments of the sequence of(a) whichretain biological activity of a native sequence RTD polypeptide. A fifth aspect provides isolated extracellular domain sequence of RTD polypeptide comprising amino acid residues 99 to 139 of Fig. IA (SEQ ID NO:1). A sixth aspect provides a chimeric molecule comprising a RTD polypeptide fused to a heterologous amino acid sequence. A seventh aspect provides an antibody which specifically binds to a RTD polypeptide. An eighth aspect provides isolated nucleic acid comprising a nucleotide sequence encoding the RTD polypeptide of the first aspect or the extracellular domain sequence of the fourth aspect. A ninth aspect provides a vector comprising the nucleic acid of the eighth aspect. A tenth aspect provides a host cell comprising the vector of the ninth aspect. 2109617_1 (GHMaters) 2-No09 An eleventh aspect provides a process of using a nucleic acid molecule encoding RTD polypeptide to effect production of RTD polypeptide comprising culturing the host cell of the tenth aspect. A twelfth aspect provides a composition comprising RTD polypeptide and a carrier. A thirteenth aspect provides an article of manufacture, comprising a container and a composition contained within said container, wherein the composition includes RTD polypeptide or RTD antibody. A fourteenth aspect provides a method of modulating apoptosis in rammanalian cells comprising exposing said cells to RTD polypeptide. Applicants have identified cDNA clones that encode novel polypeptides, designated in the present application as "RTD." It is believed that RTD is a member ofthe TNFR family; full-length native sequence human RTD polypeptide exhibits similarity to the TNFR family in its extracellular cysteine-rich repeats. Applicants found that RTD can bind Apo-2 ligand (Apo-2L) and block Apo-2L induced apoptosis. It is presently believed that RTD may function as an inhibitory Apo-2L receptor. Disclosed herein is an isolated RTD polypeptide. In particular, an isolated native sequence RTD polypeptide, which may include an amino acid sequence comprising residues I to 386 of Figure 1A (SEQ ID NO: 1), is disclosed. The isolated RTD polypeptide may comprise at least about 80% amino acid sequence identity with native sequence RTD polypeptide comprising residues I to 386 of Figure 1 A (SEQ ID NO: 1). The isolated RTD polypeptide may also comprise a polypeptide which lacks a signal sequence. Optionally, such polypeptide may comprise residues 56 to 386 of Figure IA (SEQ ID NO:1). Also disclosed is an isolated extracellular domain (ECD) sequence of RTD. Optionally, the isolated extracellular domain sequence comprises amino acid residues 56 to 212 of Fig. lA (SEQ ID NO:1). The isolated RTD ECD polypeptide may also comprise a polypeptide containing one or more cysteine rich domains. The polypeptide may comprise one or both cysteine rich domains identified in Figure 1B as residues 99 to 139 and 141 to 180, respectively, of SEQ ID NO:1. Also disclosed are chimeric molecules comprising RTD polypeptide fused to a heterologous polypeptide or amino acid sequence. An example of such a chimeric molecule comprises a RTD fused to an immunoglobulin sequence. Another example comprises an extracellular domain sequence of RTD fused to a heterologous polypeptide or amino acid sequence, such as an immunoglobulin sequence. Disclosed herein is an isolated nucleic acid molecule encoding RTD polypeptide. The nucleic acid molecule may be RNA or DNA that encodes a RTD polypeptide or a particular domain of RTD, or may be complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. The nucleic acid sequence may be selected from: (a) the coding region of the nucleic acid sequence of Figure lA (SEQ ID NO:2) that codes for residue 1 to residue 386 (i.e., nucleotides 157-159 through 1312-13 14), inclusive; (b) the coding region of the nucleic acid sequence of Figure IA (SEQ ID NO:2) that codes for residue 56 to residue 212 (i.e., nucleotides 321-323 through 789-791), inclusive; or (c) a sequence corresponding to the sequence of(a) or (b) within the scope of degeneracy of the genetic code. 2109517_1(GMMatters)2-No-6 Also disclosed is a vector comprising the nucleic acid molecule encoding the RTD polypeptide or particular domain of RTD. A host cell comprising the vector or the nucleic acid molecule is also disclosed. A method of producing RTD is further disclosed. Also disclosed is an antibody which specifically binds to RTD. The antibody may be an agonistic, antagonistic or neutralizing antibody. Also disclosed are non-human, transgenic or knock-out animals. Also disclosed are articles of manufacture and kits that include RTD or RTD antibodies. BRIEF DESCRIPTION OF THE DRAWINGS Figure lA shows the nucleotide sequence of a native sequence human RTD cDNA and its derived amino acid sequence. In Figure 1A, the signal sequence (residues 1-55) and the transmembrane sequence (residues 213-232) are underlined. The potential N-linked glycosylation sites (residues 127, 171, and 182) are also underlined. Figure IB shows the deduced amino acid sequence of human RTD ECD aligned with corresponding ECDs of DR4, DR5, and DcR1. The cysteine rich domains are identified as CRD1 and CRD2. Figure 1 C shows the deduced amino acid sequence of the human RTD intracellular region aligned with corresponding intracellular regions of DR4 and DR5. The death domain is identified as DD. Figure ID is a schematic diagram of the putative domain organization of RTD, DR4, DR5, and DcRI and showing the extracellular region [including the signal (S) and cysteine rich domains (CRD 1 and CRD2)], transmembrane (TM) and truncated death domain (TD) or death domain (DD). In DcR1, 1-5 indicate 15 amino acid pseudorepeats. Figure 2A shows binding of radioiodinated Apo-2L to purified RTD ECD immunoadhesin as measured in a co-precipitation assay. Figure 2B shows inhibition of Apo-2L induction of apoptosis by RTD ECD immunoadhesin in cultured HeLa cells. Figure 3A shows apoptosis induction in HeLa cells transfected with DR4 or DR5; HeLa cells transfected with full-length RTD (clone DNA35663 or clone DNA35664) did not result in any difference in apoptosis as compared to control transfected cells. Figure 3B shows the results of an electrophoretic mobility shift assay testing for NF-KB activation. 293 cells were transfected with vector alone, RTD (clone DNA35663 or clone DNA3 5664) or DR4 or DR5. RTD transfection did not result in an increase in NF-KB activity. Figure 3C shows blocking of Apo-2 ligand induced apoptosis in 293 cells transfected with RTD (clone DNA35663 or clone DNA35664). Figure 4 shows expression of RTD mRNA in human tissues as analyzed by Northern blot hybridization. The sizes of molecular weight standards are shown on the right in kb. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS I. Definitions In the claims which follow and in the description of the invention, except where the context requires otherwise due to express language or necessary implication, the word "comprise" or variations such as 21098171 (GHMOUer) 2.Nov.09 -7- "comprises" or "comprising" is used in an inclusive sense, i.e. to specify the presence of the stated features but not to preclude the presence or addition of further features in various embodiments of the invention. The terms "RTD polypeptide" and "RTD" when used herein encompass native sequence RTD and RTD variants (which are further defined herein). These terms encompass RTD from a variety of mammals, including humans. The RTD may be isolated from a variety of sources, such as from human tissue types or from another source, or prepared by recombinant or synthetic methods. A "native sequence RTD " comprises a polypeptide having the same amino acid sequence as an RTD derived from nature. Thus, a native sequence RTD can have the amino acid sequence of naturally-occurring RTD from any mammal. Such native sequence RTD can be isolated from nature or can be produced by recombinant or synthetic means. The term "native sequence RTD" specifically encompasses naturally occurring truncated or secreted forms of the RTD (e.g., an extracellular domain sequence), naturally occurring variant forms (e.g., alternatively spliced forms) and naturally-occurring allelic variants of the RTD. A naturally-occurring variant form of the RTD includes a RTD having an amino acid substitution shown in Fig. IA (SEQ ID NO:1). In one embodiment of such naturally-occurring variant form, the serine residue at position 310 is substituted by a leucine residue. In Fig. 1 A (SEQ ID NO: 1), the amino acid residue at position 310 is identified as "Xaa" to indicate that the amino acid may, optionally, be either serine or leucine. In Fig. 1A (SEQ ID NO:2), the nucleotide at position 1085 is identified as "Y" to indicate that the nucleotide may be either cytosine (C) or thymine (T) or uracil (U). In one embodiment of the invention, the native sequence RTD is a mature or full-length native sequence RTD comprising amino acids 1 to 386 of Fig. 1A (SEQ ID NO: 1). Optionally, the RTD is one which lacks a signal sequence, and may comprise residues 56 to 386 of Figure IA (SEQ ID NO:1). The "RTD extracellular domain" or "RTD ECD" refers to a form of RTD which is essentially free of transmembrane and cytoplasmic domains. Ordinarily, RTD ECD will have less than 1% of such transmembrane and cytoplasmic domains and preferably, will have less than 0.5% of such domains. Optionally, RTD ECD will comprise amino acid residues 56 to 212 of Fig. 1A (SEQ ID NO:1). The RTD ECD may also comprise a polypeptide containing one or more cysteine rich domains, and may comprise a polypeptide which includes one or both cysteine rich domains identified as residues 99 to 139 and 141 to 180, respectively, of Figure IA (SEQ ID NO:1). Also disclosed are fragments of such soluble RTD ECD molecules. Preferably, the ECD fragments retain the biological activity and/or properties of the full length RTD or the ECD identified herein as having amino acid residues 56 to 212 of Figure 1A (SEQ ID NO:1). "RTD variant" means a biologically active RTD as defined below having at least about 80% amino acid sequence identity with the RTD having the deduced amino acid sequence shown in Fig. 1A (SEQ ID NO: 1) for a full-length native sequence human RTD, Such RTD variants include, for instance, RTD polypeptides wherein one or more amino acid residues are added, or deleted, at the N- or C-terminus of the 2109617_1 GHMaUers) 2-Nov-09 P1129RI squenc Of Fig. IA (SEQ D NO, m). Ordinarily, an RTD variant will have at least about 80% am Sequence identity, more preferablyat leastabout 90% amino acid sequence identity, and even more p 9%amino acid sequence identity, with the 'or -rf at least about 95% amino acid sequence identity with the amino acid sequence of Fig, IA (SEQ ID NO :) "Percent (%o) amino acid sequence identity" with respect to the RTD sequences identified herein is S definiedjas the percentage of amino acid residues in a candidate sequence that are identical with the amino acid residues in the RTD sequence, after aligning the sequences and introducing gaps, ifnecessay, to achie the maimum percentsequenceidmntit, and not consideringany consevaivesubstitutionsas part of the sequence identity. Alignment for purposes of determining percent amino acid sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computet software such 10 as ALIGN or Megalign (DNASTAR)software. Those skilled in the art can detenine appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared. The term "epitope tagged" when used herein refers to a chimeric polypeptide comprising RTD, or a domain sequence thereof, fined to a "tag polypeptide". The tag polypeptide has enough residues to provide is an epitope against which an antibody can be made, yet is short enough such that it does not interfere with activity of the RTD. The tag polypeptide preferably also is fairly unique so that the antibody does not substantiallycross-reactwith other epitopes. Suitabletag polypeptides generally have at least six amino acid residues and usually between about 8 to about 50 amino acid residues (preferably, between about 10 to about 20 residues). 20 "Isolated,"when used to describe the various polypeptides disclosed herein, means polypeptide that has been identifledand separatedand/or recovered from a componentof its natural environment. Contaminant components of its natural environment are materials that would typically interfere with diagnostic or therapeutic uses for the polypeptide, and may include enzymes, hormones, and other proteinaceous or non proteinaceous solutes. In preferred embodiments, the polypeptide will be purified (1) to a degree sufficient 25 to obtain at least 15 residues of N-terminal or internal amino acid sequence by use of a spinning cup sequenator, or (2) to homogeneityby SDS-PAGE undernon-reducingor reducing conditions using Coomassie blue or, preferably, silver stain. Isolated polypeptido includes polypeptide in situ within recombinant cells, since at least one component of the RTD natural environment will not be present. Ordinarily, however, isolated polypeptide will be prepared by at least one purification step. 30 An "isolated"RTD nucleic acid molecule is a nucleic acid molecule that is identified and separated from at least one contaminantnucleic acid molecule with which it is ordinarily associatedin the natural source of the RTD nucleic acid. An isolated RTD nucleic acid molecule is other than in the form or seating in which it is found in nature. Isolated RTD nucleic acid molecules therefore are distinguished from the RTD nucleic acid molecule as it exists in natural cells. However, an isolated RTD nucleic acid molecule includes RTD 35 nucleic acid molecules contained in cells that ordinarily express RTD where, for example, the nucleic acid molecule is in a chromosomal location different from that of natural cells. The term "controlsequences"refers to DNA sequences necessary for the expression of an operably linked coding sequence in a particular host organism. The control sequences that are suitable for prokaryotes, -8for example, include a promoter, optionally an operator sequence, and a ribosome binding site. Eukaryotic cells are known to utilize promoters, polyadenylation signals, and enhancers. Nucleic acid is "operably linked" when it is placed into a functional relationship with another nucleic acid sequence. For example, DNA for a presequence or secretory leader is operably linked to DNA for a polypeptide if it is expressed as a preprotein that participates in the secretion of the polypeptide; a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence; or a ribosome binding site is operably linked to a coding sequence if it is positioned so as to facilitate translation. Generally, "operably linked" means that the DNA sequences being linked are contiguous, and, in the case of a secretory leader, contiguous and in reading phase. However, enhancers do not have to be contiguous. Linking is accomplished by ligation at convenient restriction sites. If such sites do not exist, the synthetic oligonucleotide adaptors or linkers are used in accordance with conventional practice. The term "antibody" is used in the broadest sense and specifically covers single anti-RTD monoclonal antibodies (including agonist, antagonist, and neutralizing antibodies) and anti-RTID antibody compositions with polyepitopic specificity. The term "monoclonal antibody" as used herein refers to an antibody obtained from a population of substantially homogeneous antibodies, i.e., the individual antibodies comprising the population are identical except for possible naturally-occurring mutations that may be present in minor amounts. Monoclonal antibodies are highly specific, being directed against a single antigenic site. Furthermore, in contrast to conventional (polyclonal) antibody preparations which typically include different antibodies directed against different determinants (epitopes), each monoclonal antibody is directed against a single determinant on the antigen. The monoclonal antibodies herein include hybrid and recombinant antibodies produced by splicing a variable (including hypervariable) domain of an anti-RTD antibody with a constant domain (e.g. "humanized" antibodies), or a light chain with a heavy chain, or a chain from one species with a chain from another species, or fusions with heterologous proteins, regardless of species of origin or immunoglobulin class or subclass designation, as well as antibody fragments (e.g., Fab, F(ab') 2 , and Fv), so long as they exhibit the desired biological activity. See, e.g. U.S. Pat. No. 4,816,567 and Mage et al., in Monoclonal Antibody Production Techniques and Applications, pp.7 9

-

9 7 (Marcel Dekker, Inc.: New York, 1987). Thus, the modifier "monoclonal" indicates the character of the antibody as being obtained from a substantially homogeneous population of antibodies, and is not to be construed as requiring production of the antibody by any particular method. For example, monoclonal antibodies rnay be made by the hybridoma method first described by Kohler and Milstein, Nature, 256:495 (1975), or may be made by recombinant DNA methods such as described in U.S. Pat. No. 4,816,567. The "monoclonal antibodies" may also be isolated fromphage libraries generatedusing the techniques described in McCafferty et al., Nature, 348:552 554 (1990), for example. "Humanized" forms of non-human (e.g. murine) antibodies are specific chimeric immunoglobulins, 21096171 (GHMatters) 2-Nov-09 immunoglobulin chains, or fragments thereof (such as Fv, Fab, Fab', F(ab')z or other antigen-binding subsequences of antibodies) which contain minimal sequence derived from non-human immunoglobulin. For the most part, humanized antibodies are human immunoglobulins (recipient antibody) in which residues from 21096171 (GHMatters) 2-Nov-09 -9a- P1 129R1 a complementary determining region (CDR) of the recipient are replaced by residues from a CDR of a non human species (donor antibody) such as mouse, rat, or rabbit having the desired specificity, affinity, and capacity. In some instances,Fv framework region (FR) residues of the human immunoglobulin are replaced by correspondingnon-humanresidues. Furthermore, the humanized antibody may comprise residues which 5 are found neither in the recipient antibody nor in the imported CDR or framework sequences. These modifications are made to further refine and optimize antibody performance. In general, the humahized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the CDR regions correspond to those of a non-human immnunoglobulin and all or substantially all of the FR regions are those of a human immunoglobulinconsensus sequence. The iumanized 10 antibody optimally also will comprise at least a portion of an immunoglobulinconstant region or domain (Fc), typically that of a human inmunoglobulin. "Biologicallyactive" and "desired biological activity" for the purposes herein means (1) having the ability to modulate apoptosis (either in an agonistic or stimulating manner or in an antagonistic or blocking manner) in at least one type of mammaliancell in vivo or ex vivo; (2) having the ability to bind Apo-2 ligand; 15 or (3) having the ability to modulate the activity of Apo-2 ligand. The terms "apoptosis" and "apoptotic activity" are used in a broad sense and refer to the orderly or controlled form of cell death in mammals that is typically accompanied by one or more characteristic cell changes, including condensation of cytoplasm, loss of plasma membrane microvilli, segmentation of the nucleus, degradationofchromosomalDNA or loss ofrmitochondrialfunction. This acrivitycan be determined 20 and measured, for instance, by cell viability assays, FACS analysis or DNA electrophoresis, all of which are known in the art. The terms "cancer" and "cancerous"refer to or describe the physiologicalcondition in mammals that is typically characterized by unregulated cell growth. Examples of cancer include but are not limited to, carcinoma, lymphoma, blastoma, sarcoma, and leukemia. More particular examples of such cancers include 25 squamous cell cancer, small-cell lung cancer, non-small cell lung cancer, blastona, gastrointestinal cancer, renal cancer, pancreatic cancer, glioblastoma, neuroblastoma, cervical cancer, ovarian cancer, liver cancer, stomach cancer, bladder cancer, hepatoma, breast cancer, colon cancer, colorectal cancer, endometrial cancer, salivary gland cancer, kidney cancer, prostate cancer, vulval cancer, thyroid cancer, hepatic carcinoma, and various types of head and neck cancer. 30 The tenms "treating," "treatment,"and "therapy" as used herein refer to curative therapy, prophylactic therapy, and preventative therapy. The term "mammal" as used herein refers to any mammal classified as a mammal, including humans, cows, horses, dogs and cats. In a preferred embodiment of the invention, the mammal is a human. II. Compositions and Methods of the Invention 35 The present invention provides newly identified and isolated RTD polypeptides. In particular, Applicants have identified and isolated various human RTD polypeptides, The properties and characteristics of some of these RTD polypeptides are described in further detail in the Examples below. Based upon the properties and characteristics of the RTD polypeptides disclosed herein, it is Applicants' present belief that RTD is a member of the TNFR family, and particularly, is a receptor for Apo-2 ligand. -10.

PS 129R A description follows as to how RTD, as well as RTD chimeric molecules and ani-RTD antibodies *may be Prepared. RDciei oeue n niRJ niois A. PeMparatioiMnf'RT The description below relates primarily to production of RTD by culturing ce1s transformed or 5 transfected with a vector conltainjing RT nule 'd.~me Itr gTD nuclac acid. It is of course, contemplated that alternative methods, which are well known in the art, may be employed to prepare RTD. The DNA encoding RTID may be obtained from any cDNA library prepared from tissue believedto possess the RTD mRNA and to express it at a detectable level. Accordingly, humjin RTD DNA 10 can be conveniently obtained from a cDNA library prepared from human tissues, such as libraries of human eDNA describedin Example 1. The RTD-encodinggene may also be obtained from a genomic library or by oligonucleotide synthesis. Libraries can be screened with probes (such as antibodies to the RTD or oligonucleotides of at least about 20-80 bases) designed to identify the gene of interest or the protein encoded by it. Screening the cDNA 15 or genomic library with the selected probe may be conducted using standard procedures, such as described in Sambrook et al., Mol lar Cloning!A1boatRvjv al (New York: Cold Spring Harbor Laboratory Press, 1989). An alternativemeans to isolate the gene encoding RTD is to use PCR methodology (Sambrook at al., supra; Dieffenbach et aL, PCR Primer:A Laboratory Manual (Cold Spring Harbor Laboratory Press, 1995)]. 20 One method of screening employs selected oligonueleoridesequences to screen cDNA libraries from various human tissues. Example I below describes techniques for screening a cDNA library. The oligonucleotidesequences selected as probes should be of sufficient length and sufficiently unambiguous that false positives are minimized. The oligonucleotide is preferably labeled such that it can be detected upon hybridization to DNA in the library being screened. Methods of labeling are well known in the art, and 25 include the use of radiolabels like 32 P-labeled ATP, biotinylation or enzyme labeling. Hybridization conditions, including moderate stringency and high stringency, are provided in Sambrook et al., supa. Nucleic acid having all the protein coding sequence may be obtained by screening selected cDNA or genonic libraries using the deduced amino acid sequence disclosed herein for the first time, and, if necessary, using conventional primer extension procedures as described in Sambrook et al, syjn, to detect 30 precursors and processing intermediates of mRNA that may not have been reverse-transcribed into cDNA. RTD variants can be prepared by introducing appropriatenucleotide changes into the RTD DNA, or by synthesis of the desired RTD polypeptide. Those skilled in the art will appreciate that amino acid changes may alter post-translational processes of the RTD, such as changing the number or position of glycosylation sites or altering the membrane anchoring characteristics. 35 Variations in the native full-lengthsequence RTD or in various domains ofthe RTD described herein, can be made, for example, using any ofthe techniques and guidelines for conservative and non-conservative mutations set forth, for instance, in U.S. Pat. No. 5,364,934. Variations may be a substitution, deletion or insertion of one or more codons encoding the RTD that results in a change in the amino acid sequence of the RTD as compared with the native sequence RTD. Optionally the variation is by substitution of at least one -1l- P1129R1 amino acid with any other amino acid in one or more of the domains of the RTD molecule. The variations can be made using methods known in the art such as oligonucleotide-medliated (site-directed) mutagenesis, alanine scanning, and FCR mutagenesis. Site-directed mutagenesis [Carter et al, Nuc. AcidRes. D4331 (1986); Zoller et al., huci. AcidsRs. J2:6487 (1987)], cassette mutagenesis [Wells et al., Gen. 3A:315 5 (1985), reMiction selection mutagenesis (Wells at al, Philos. Trans. R. Soc. London SerA.. 3Z:415 (1986)J or other known techniques can be performed on the cloned DNA to produce the RTD variant DNA. Scanning amino acid analysis can also be employed to identify one or more amino acids along a contiguous sequence which are involved in the interaction with a particular ligand or receptor. Among the preferred scanning amino acids are relatively small, neutral amino acids. Such amino acids include alanine, 10 glyoine, serine, and cysteine. Alanine is the preferred scanning amino acid among this group because it elimimatesthe side-chain beyond the beta-carbonand is less likely to alter the main-chain conformation of ie variant. Alanine is also preferred because it is the most common amino acid. Further, it is frequently found in both buried and exposed positions [Creighton,The Proteins,(W.. Freeman& Co., N.Y.); Chotia, I Mol. kioL U .:I (1976)]. Ifalanine substitutiondoes not yield adequate amounts of variant, an isoteric amino acid 15 can be used. Once selected RTD variants are produced, they can be contacted with, for instance, Apo-2L, and the interaction, if any, can be determined. The interaction between the RTD variant and Apo-2L can be measured by an in vitro assay, such as described in the Examples below. While any number of analytical measurements can be used to compare activities and properties between a native sequence RTD and a RTD varian, a 20 convenient one for binding is the dissociation constant Kd of the complex formed between the RTD variant and Apo-2L as comparedto the Kd for the native sequence RTD. Generally, a t 3-fbid increase or decrease in Kd per substituted residue indicates that the substituted residue(s) is active In the interaction of the native sequence RTD with the Apo-2L. Selected RTD variants may also be analyzed for biological activity, such as the ability to modulate apoptosis, in the in vitro assays described in the Examples. 25 Optionally, representative sites in the RTD sequence suitable for mutagenesis would include sites within the extracellular domain, and particularly, within one or more of the cysteine-rich domains. Such variations can be accomplishedusing the methods described above. Deletional variants of the ECD, such as fragments resulting from the deletion of one or more amino acids, are encompassed by the invention. Preferably, such deletional variants or fragments retain at least one biological activity or property of the full 30 length or soluble forms of RTD. 2. Insertion of Nucleic Acid into A Replicable Vector The nucleic acid (e.g., cDNA or genomic DNA) encoding RTD may be inserted into a replicable vector for further cloning (amplification of the DNA) or for expression. Various vectors are publicly available. The vector components generally include, but am not limited to, one or more of the 35 following: a signal sequence, an origin of replication, one or more marker genes, an enhancer element, a promoter, and a transcription termination sequence, each of which is described below. (I) Signal Sequence Component The RID may be produced recombinantlynot only directly, but also as a fusion polypeptide with a heterologous polypeptide, which may be a signal sequence or other polypeptide having a specific -12- P1129RI cleavage site at the N-tenninus Of the mature protein or polypeptide. In general, the signal sequence may be a Component of the vector, or it may be a part of the RTD DNA that is inserted into the vector. The heterologous signal sequence selected preferably is one that is recognized and processed (e., cleaved by a signal peptidase) by the host coil. The signal sequence may be a prokazyotic signal sequence selected, for 5 example, from the group of the alkaline phosphatase, penicillinase, Ipp, or heat-stable enterotoxin H7 leaders. For yeast secretion the signal sequence may be, e.g., the yeast invertase leader, alpha factor leader includingg Saccharomycesand Khveromywc a-factor leaders, the latter described in U.S. Pat. No. 5,010,182), or acid phosphatase leader, the C. albicans glucoamylase leader (EP 362,179 published 4 April 1990), or the signal described in WO 90/13646 published 15 November 1990. In mammalian cell expression tIte native RTD 10 presequence that normally directs insertion of RTD in the cell membrane of human cells in vivo is satisfactory, although other mammalian signal sequences may be used to direct secretion of the protein, such as signal sequences from secreted polypeptides of the same or related species, as well as viral secretory leaders, for example, the herpes simplex glycoprotein D signal. The DNA for such precursor region is preferably ligated in reading frame to DNA encoding RTD. 15 (ii) Origin of Replication Component Both expression and cloning vectors contain a nucleic acid sequence that enables the vector to replicate in one or more selected host cells. Generally, in cloning vectors this sequence is one that enables the vector to replicate independently of the host chromosomal DNA, and includes origins of replication or autonomously replicating sequences. Such sequences are well known for a variety of bacteria, yeast, and 20 viruses. The origin of replication from the plasmid pBR322 is suitable for most Gram-negative bacteria, the 2p plasmid origin is suitable for yeast, and various viral origins (SV40, polyoma, adenovirus, VSV or BPV) are useful for cloning vectors in mammalian cells. Generally, the origin of replication component is not needed for mammalianexpressionvectors (the SV40 origin may typically be used because it contains the early promoter). 25 Most expression vectors are "shuttle"vectors, le., they arc capable of replicationin at least one class of organisms but can be transfected into another organism for expression. For example, a vector is cloned in Z coil and then the same vector is transfected into yeast or mammalian cells for expression even though it is not capable of replicating independently of the host cell chromosome. DNA may also be amplified by insertion into the host genoMe. This is readily accomplished using 30 Bacillus species as hosts, for example, by including in the vector a DNA sequence that is complementary to a sequence found in Bacillur genomic DNA. Transfectionof Bacillus with this vector results in homologous recombination with the genome and insertion of RTD DNA. However, the recovery of genomic DNA encoding RTD is more complex than that of an exogenously replicated vector because restriction enzyme digestion is required to excise the RTD DNA. 35 (1ii) Selection Gene Component Expression and cloning vectors typically contain a selection gene, also termed a selectable marker. This gene encodes a protein necessary for the survival or growth of transformed host cells grown in a selective culture medium. Host cells not transformed with the vector containing the selection gene will not survive in the culture medium. Typical selection genes encode proteins that (a) confer resistance to antibiotics -13- PI129Rl or other toxins, eg., ampicillin, neomycin, metbotexate, or tetracycline, (b) complement auxo-ophic deficiencies, or (c) supply critical nutrients not available from complex media, e.g., re gene encoding D alanine racemase for Bacilli. One example of a selection scheme utilizes a drug to arrest growth of a host cell. Those cells that are 5 successfully transformed with a heterologous gene produce a protein confbrring drug resistance and thus survive the selection regimen. Examplesof such dominant selection use the drugs neomycin [Southern't al, Mlec. Ap], Genet,. 1:327 (1982)], mycophenolic acid (Mulligan at al., Science. 2,22:1422 (1980)] or hygromycin [Sugden et al., Mol. Calli oL- :410-413 (1985)1. The three examples given above employ bacterial genes under eukaryotic control to convey resistance to the appropriate drug 0418 or neomycin 10 (geneticin), xgpt (mycophenolic acid), or hygromycin, respectively. Another example of suitable selectable markers for mammalian cells am those that enable the identification of cells competent to take up the RTD nucleic acid, such as DHFR or thymidine kinase. The mammalian cell transformants are placed under selection pressure that only the transformants are uniquely adapted to survive by virtue of having taken up the marker. Selection pressure is imposed by culturing the 15 transformants under conditions in which the concentration of selection agent in the medium is successively changed, thereby leading to amplification of both the selection gene and the DNA that encodes RTD. Amplification is the process by which genes in greater demand for the production of a protein critical for growth are reiterated in tandem within the chromosomes of successive generations of recombinant cells. Increased quantitiesof RTD are synthesized from the amplified DNA. Other examples of amplifiable genes 20 include metallothionein-I and -11, adenosine deaminase, and ornithine decarboxylase. Cells transformed with the DHFR selection gene may first be identified by culturing all of the transformantsin a culturemedium that contains methotrexate (Mtx), a competitive antagonist of DHFR. An appropriate host cell when wild-type DHFR is employed is the Chinese hamster ovaay (CHO) cell line deficient in DHFR activity, prepared and propagatedas described by Urlaub at al., Proc. Natl, Acad. Sci. USA. 25 12:4216 (1980). The transformed cells are then exposed to increased levels of methotrexate. This leads to the synthesis of multiple copies of the DHFR gene, and, concomitantly, multiple copies of other DNA comprising the expressionvectors, such as the DNA encoding RTD. This amnplificationtechnique can be used with any otherwise suitable host, e.g., ATCC No. CCL61 CHO-KI, notwithstanding the presence of endogenous DHFR if for example, a mutant DHFR gene that is highly resistant to Mtx is employed (EP 30 117,060). Alternatively, host cells (particularly wild-type hosts that contain endogenous DHFR) transformed or co-transformed with DNA sequences encoding RTD, wild-type DHFR protein, and another selectable marker such as aminoglycoside 3'-phosphotransferase (APH) can be selected by cell growth in medium containing a selection agent for the selectable marker such as an aminoglycosidic antibiotic, e.g., kanamycin, 35 neomycin, or G418. See U.S. Patent No. 4,965,199. A suitable selection gene for use in yeast is the trpl gene present in the yeast plasmid YRp7 [Stinchcomb et al., Natgi., 22:39 (1979); Kingsman et al., Gene, 2:141 (1979); Tschemper et al., Qm, JQ:157 (1980)]. The srpl gene provides a selection marker for a mutant strain of yeast lacking the ability to grow in tryptophan, for example, ATCC No. 44076 or PEP4-1 rJones, Genetic, ;12 (1977)]. The presence -14- P1129R1 of the trpi lesion in the yeast host cell genome then provides an effective environment for detecting tansformatonbygrowth in the absence of tryptophan Similarly,Lea.defiientyeaststrns (ATCC 20,622 or 38,626) are complemented by known plasmids bearing the Leu2 gene. In addition, vectors derived from the 1.6 pm circular plasmid pKD1 can be used for transformation 5 ofKI eropees yeasts [Bianchi et al, Curr. Genet. 2:185 (1987)]. More recently, an expression system for large-scale production of recombinant calf chymosin was reported for K lactis [Van den Berg, BWIofchnogy, 1: 135 (1990)]. Stable multi-copy expression vectors for secretion of mature recombinant human serum albumin by industrial strains of Khoveromyces have also been disclosed (Fleer et al., Bio/Teghnog.2:968-975 (1991)). 10v) Pm teC on Expression and cloning vectors usually contain a promoter that is recognized by the host organism and is operably linked to the RTD nucleic acid sequence. Promoters are untranslated sequences located upstream (5') to the start codon of a structural gene (generally within about 100 to 1000 bp) that control the transcription and translation of particular nucleic acid sequence, such as the RTD nucleic acid 15 sequence, to which they are operably linked. Such promoters typically 611 into two classes. inducible and constitutive. Induciblepromoters are promoters that initiate increased levels of transcription from DNA under their control in response to some change in culture conditions, e.g., the presence or absence of a nutrient or a change in temperature. At this time a large number of promoters recognized by a variety of potential host cells are well known. These promoters are operably linked to RTD encoding DNA by removing the promoter 20 from the source DNA by restriction enzyme digestion and inserting the isolated promoter sequence into the vector. Both the native RTD promoter sequence and many heterologous promoters may be used to direct amplification and/or expression of the RTD DNA. Promoters suitable for use with prokaryotic hosts include the p-lactamase and lactose promoter systems [Chang et al., Natiur 225;615 (1978); Goeddel et al., 281,:544(1979)], alkaline phosphatase, 25 a tryptophan (trp) promoter system (Goeddel, Nucleic Acids Res. :4057 (1980); EP 36,776], and hybrid promoters such as the tac promoter (defoer et al., Proc. NatI Acad. Sci. USA. -:21-25 (1983)]. However, other known bacterial promoters are suitable. Their nucleotide sequences have been published, thereby enabling a skilled worker operably to ligate them to DNA encoding RTD [Siebenlist et al., £cil, 22:269 (1980)] using linkers or adaptors to supply any required restriction sites. Promoters for use in bacterial 30 systems also will contain a Shine-Dalgarno (S.D.) sequence operably linked to the DNA encoding RTD. Promoter sequences are known for eukaryotes. Virtuallyall eukaryotic genes have an AT-rich region located pproximately25 to 30 bases upstream from the site where transcription is initiated. Anothersequence found 70 to 80 bases upstream from the start of transcription of many genes is a CXCAAT region where X may be any nucleotide. At the 3' end of most eukaryotic genes is an AATAAA sequence that may be the 35 signal for addition of the poly A tail to the 3' end ofthe coding sequence. All of these sequences are suitably inserted into eukaryotic expression vectors. Examples of suitable promoting sequences for use with yeast hosts include the promoters for 3 phosphoglycerate kinase [Hitzeman et a., JBiol.Cem. 2:2073 (1980)] or other glycolytic enzymes (Hess at at, J. Adv. Enzyme Ree.. 2:149 (1968); Holland, Biocheistv, jl:4900 (1978)], such as enolase, -Is- P1 129R glyceraldehyde-3-phosphat dehydrogenae, hexokinas, pyruvate decarboxylase. phosphofructokinase, glucose-6-phosphate isomerase, 3 -phosphoglyeate mutase, pyruvate kinase, triosephosphate isomerase phosphoglucosa isomerase, and glucokinase. Otheryeastpromoters,whioh ere induciblepromotershavingthe additionaladvantageofrascripdo, 5 controlled by growth conditions, are the promoter regions for alcohol dehydrogenase2, lsocytochromeC, acid phosphatase, degradative enzymes associated with nitrogen metabolism, metallothionein, glyceraldehyde3. phosphate dehydrogenase, and enzymes responsible for maltose and galactose utilization. Suitable vectors and promoters for use in yeast expression are further described in EP 73,657. Yeast enhancers also are advantageously used with yeast promoters. 10 RTD transcription from vectors in mammalian host cells is controlled, for example by promoters obtained from the genomes of viruses such as polyoma virus, fowIpox virus (UK 2,211,504 published 5 July 1989), adenovirus (such as Adenovirus 2), bovine papilloma virus, avian sarcoma virus, cytomegalovirus, a retrovirus, hepatitis-B virus and most preferably Simian Virus 40 (SV40), from heterologous mammalian promoters, e.g., the actin promoteror an immunoglobulinpromoter, from heat-shock promoters, and from the 15 promoternonnally associated with the RTD sequence, provided such promoters are compatible with the host cell systems. The early and late promoters of the SV40 virus are conveniently obtained as an SV40 restriction fragment that also contains the SV40 viral origin of replication [Fiers et al, Nature, 27'113 (1978); Mulligan and Berg, Science, M: 1422-1427(1980); Pavlakis et al, Proc. Natl. Aced. Sri. USA, 21:7398-7402 (1981). 20 The immediate early promoter of the human cyromegalovirus is conveniently obtained as a Hindlil E restriction fragment [Greenaway et al, Qg=, 11:355-360 (1982)). A system for expressing DNA in mammalian hosts using the bovine papilloma virus as a vector is disclosed in U.S. Patent No. 4,419,446. A modificationof this system is described in U.S. Patent No. 4,601,978 [See also Gray et at., Nature 22:503 508 (1982) on expressingcDNA encoding immune interferon in monkey cells; Reyes et at., Natur 297:598 25 601 (1982) on expression of human P-interferoncDNA in mouse cells under the control of a thymidine kinase promoter from herpes simplex virus; Cauaani and Berg, Proc. Nati. Aced. Sci. USA 19:5166-5170 (1982) on expression of the human interferon PI gene in cultured mouse and rabbit cells; and Gorman et al., Erc...Natt Acad ScL.USA. 2:6777-6781 (1982) on expression of bacterial CAT sequences in CV-1 monkey kidney cells, chicken embryo fibroblasts, Chinese hamster ovary cells, HeLa cells, and mouse NIH-3T3 cells using 30 the Rous sarcoma virus long terminal repeat as a promoter). (v) Enhancer Element Comnonent Transcription of a DNA encoding the RTD of this invention by higher eukaryotes may be increased by inserting an enhancer sequence into the vector. Enhancers are cis-acting elements of DNA, usually about from 10 to 300 bp, that act on a promoter to increase its transcription. Enhancers are relatively 35 orientation and position independent, having been found 5'[Laimins et al., Proc. Nati. Acad. Sci. USA, 1:993 (198 1])and 3'(Lusky et al., Mol ell Bio.. 1:1108 (1983])to the transcription unit, within an intron (Banerji et al.,.Cali, f:729 (1983)), as well as within the coding sequence itself [Osborneet al., Molt Cell Bio- 4:1293 (1984)]. Many enhancer sequences are now known from mammalian genes (globin, elastase, albumin, a fetoprotein, and insulin). Typically, however, one will use an enhancer ftrm a eukaryotic cell virus. Examples -16- P1 129RI include the SV40 enhanceron the late side of the replication origin (bp 100-270), the cytonegalovirus early promoterenhaner, thepolyomaenhancer on the late side of the replication origin, and adenovirus enhancer, See also Yamnv, Ntr 22:17-18

(

19 8 2)on enhancing elements. for activation of ukartic promoters. The enhancer may be spliced into the vector at a position 5' or 3' to the RTD coding sequence, but is preferably 5 located at a site 5' from the promoter. (vi) Transcription Termination Component Expression vectors used in eukaryotic host cells (yeast, fungi, insect, plant, animal, human, or nucleated cells from other multicellularorganisms) will also contain sequences necessary fbr the termination of transcription and fbr stabilizing the mRNA. Such sequences are commonly available frgi the 5' and, 10 occasionally 3', untranslatedregions of eukaryotic or viral DNAs or cDNAs. These regions contain nucleotide segments transcribed as polyadenylated fragments in the untranslated portion of the mRNA encoding RTD. (vii) Construction and Analysis of Vectors Construction of suitable vectors containing one or more of the above-listed components employs standard ligation techniques. Isolated plasmids or DNA fragments are cleaved, tailored, and re 15 ligated in the form desired to generate the plasmids required. For analysis to confirm correct sequences in plasmids constructed, the ligation mixtures can be used to tmnsform E. coli K12 strain 294 (ATCC 31,446) and successful transformants selected by ampicillin or tetracycline resistance where appropriate. Plasmids from the t-ansformants are prepared, analyzed by restriction endonuclease digestion, and/or sequenced by the method of Messing et al., Nucleic Acids Res.. 20 2:309 (1981) or by the method of Maxam et aL, Methods in EnZymologv. d.499 (1980). (viii) Transient Expression Vectors Expression vectors that provide for the transient expression in mammalian cells of DNA encoding RTD may be employed. In general, transient expression involves the use of an expression vector that is able to replicate efficiently in a host cell, such that the host cell accumulates many copies of the 25 expression vector and, in turn, synthesizes high levels of a desired polypeptide encoded by the expression vector [Sambrook at al,, supra]. Transient expression systems, comprising a suitable expression vector and a host cell, allow for the convenient positive identification of polypeptides encoded by cloned DNAs, as well as for the rapid screening of such polypeptides for desired biological or physiological properties. Thus, transient expression systems are particularlyuseful in the Invention for purposes of identifying RTD variants. 30 (ix) Suitable Exemplarvvertebrate Cell Vectors Other methods, vectors, and host cells suitable for adaptation to the synthesis of RTD in recombinantvertebrate cell culture are described in Gething et al., Nature, 29M:620-625 (1981); Mantei et al., Nature. Z]:40-46 (1979); EP 117,060; and EP 117,058. 3. selection And Transformation of Host Cells 35 Suitable host cells for cloning or expressing the DNA in the vectors herein are the prokaryote, yeast, or higher eukaryote cells described above. Suitable prokaryotes for this purpose include but are not limited to eubacteria, such as Gram-negative or Gram-positive organisms, for example, Enterobacteriaceaesuch as Rscherlchla, e.g., E coil, Enterobater, Erwinia, Klabsiella, Proteus, Salmonella, e.g., Salmonslla typhimurtum, Serrafia, e.g., Serratia marcescans, and Shigella, as well as Bacilli such as B. -17- PI 129RI subtilis and B. I/chengarmgs (e.g., B. lichwmrms 41P disclosed in DD 266,710 published 12 April 1989), Pseudomonas such as P aerginoa, and Streptomyces. Preferably, the host cell should secrete minitnal amounts of proteolytic enzymes. In additionto prokaryotes,eukaryotiomicrobessuch as filaMentoufungi or yeastare suitablecloning 5 or expression hosts for RTD-encoding vectors. SacchrOmycas carevisiae, or common bakers yeast, is the most commonly used among lower eukaryotic host microorganisms. However, a number of other gdnera, species, and strains are commonly available and useful herein. Suitable host cells fbr the expression of glycosylatedRTD are derived from multicellular organisms. Such host cells are capable of complex processing and glycosylation activities. In principJi, any higher 10 eukaryotic cell culture is workable, whether from vertebrate or invertebrate culture. Examples of invertebrate cells include plant and insect cells. Numerous baculoviral strains and variants and corresponding permissive insect host cells from hosts such as Spodopterafrugiperda (caterpillar), Aedes aegypti (niosquito), Aede, albgpictus (mosquito),Drosophilamdanogaster (fruitfly), and Bombyx mort have been identified [See, e.g., Luckow et at, B iorechnolog. fi:47-55 (1988); Miller et al., in Qgnetig Eninenfl e Setlow et al., eds., VoL 15 8 (Plenum Publishing, 1986), pp. 277-279; and Maedaet al., Naur .f1:592-594 (1985)]. A variety of viral strains fortransfectionare publiclyavailable,e.g., the L-1 variant ofAutoraphacalifornicaNPV and the Bm 5 strain of Bombyx mori NPV. Plant cell cultures of cotton, corn, potato, soybean, petunia, tomato, and tobacco can be utilized as hosts. Typically,plant cells are transfectedby incubation with certain strains of the bacterium Agrobacterium 20 tumefaciens. During incubation of the plant cell culture with A. tumfaciens, the DNA encoding the RTD can be transferred to the plant cell host such that it is transfected, and will, under appropriate conditions, express the RTD-encoding DNA. In addition, regulatory and signal sequences compatible with plant cells are available, such as the nopaline synthase promoter and polyadenylation signal sequences [Depicker et at, L Mol. Apple. Gen., 1:561 (1982)]. In addition, DNA segments isolated from the upstream region of the T-DNA 25 780 gene are capable of activating or increasing transcription levels ofplant-expressiblegenes in recombinant DNA-containing plant tissue [EP 321,196 published 21 June 1989]. Propagation of vertebrate cells in culture (tissue culture) is also well known in the art [See, e.g.. Tissue Cultur. Academic Press, Kruse and Patterson, editors (1973)]. Examples of useful mammalian host cell lines are monkey kidney CVI line transformed by SV40 (COS-7, ATCC CRL 1651); human embryonic 30 kidney line (293 or 293 cells subcloned for growth in suspension culture, Graham et aL, L Gen ViroL 2:59 (1977)); baby hamster kidney cells (BH, ATCC CCL 10); Chinese hamsterovary cells/-DHFR(CHO, Urlaub and Chasin, Proc. Nati, Acad. Si. USA, 22:4216 (1980)); mouse sertoli cells (TM4, Mather, Biol eprod., 22;243-251 (1980)); monkeykidney cells (CVl ATCC CCL 70); African green monkey kidney cells (VERO 76, ATCC CRL-1587); human cervical carcinoma cells (HELA, ATCC CCL 2); canine kidney cells (MDCK, 35 ATCC CCL 34); buffalo rat liver cells (BRL 3A, ATCC CRL 1442); human lung cells (W138, ATCC CCL 75); human liver cells (Hep G2, MB 8065); mouse mammary tumor (MMT 060562, ATCC CCL5 1); TRI cells (Mather et al., Annals N.Y. Acad. Sd.. 383:44-68 (1982)); MRC 5 cells; and FS4 cells. -18- P1 129R1 Host cells are tansfectedand Preferablytranisformdwith the above-descrbedcwetuionor cloning vectors for RTD production and cultured in conventional nutrient Media modified as apoprite for inducing promoters, selecting transfonnants, or amplifying the genes encoding the desired sequences. Trmnsfectionrefers to the taking up of an expression vector by a host cell whether or not any coding sequences are in fhct expressed. Numerous methods of transfectionam known to the ordinarilyskilled artisan, forexample, CaPO 4 and clectroporation. SuccessfjUtransfectionis generallyrecognind when any indidation ofthe operation of this vector occurs within the host coll. Transfrmationmeans introducingDNA into an organism so that the DNA is replicable, either as an extrachromosomal element or by chromosomal integrant. Depending on the host cell used, Lansformation 10 is done using standard techniques appropriate to such cells. The calcium treatment employing calcium chloride, as described in Sambrook et al, Lura, or electroporation is generally used for prokaryotes or other cells that contain substantial cell-wall barriers. Infection with Agrobacterium tumfacln is used for transformation of certain plant cells, as described by Shaw et al., Gene, 23:315 (1913) and WO 89/05859 published 29 June 1989. In addition, plants may be transfectedusing ultrasoundtreainentas described in WO 15 91/00358 published 10 January 1991. For mammalian cells without such cell walls, the calcium phosphate precipitationmethod of Graham and van der Eb, Viroloy. 2:456-457 (1978) is preferred. General aspects of mammalian cell host system transformations have been described in U.S. Pat. No. 4,399,216. Transformations into yeast are typically cried out according to the method of Van Solingen et al., J. Bact. 10946 (1977) and 1-Isiao et al., Pc. 20 NatI. Acad. Sci. (USA\- 2&:3829 (1979). However,other methods for introducing DNA into cells, such as by nuclear microinjection, electroporation, bacterial protoplast fusion with intact cells, or polycations, e.g, polybrene, polyornithine, may also be used. For various techniques for transforming mammalian cells, see Keown et al., Methods in Enzvmolorv. JM:527-537 (1990) and Mansouret al, .atgm, l4:348-352 (1988). 4. Culturing the Host Cells 25 Prokaryotic cells used to produce RTD may be cultured in suitable media as described generally in Sambrook et al., Mi=. The mammalian host cells used to produce RTD may be cultured in a variety of media. Examples of commerciallyavailable media include Ham's 10 (Sigma), Minimal Essential Medium ("MEM", Sigma), RPMI-1640 (Sigma), and Dulbecco's Modified Eagle's Medium ("DMEM", Sigma). Any such media may 30 be supplemented as necessary with hormones and/or other growth factors (such as insulin, transferring, or epidermal growth factor), salts (such as sodium chloride, calcium, magnesium, and phosphate), buffers (such as HEPES), nucleosides (such as adenosine and thymidine), antibiotics (such as GentamycinTM drug), trace elements (defined as inorganic compounds usually present at final concentrations in the micromolar range), and glucose or an equivalent energy source. Any other necessary supplements may also be included at 35 appropriate concentrations that would be known to those skilled in the art. The culture conditions, such as temperature, pH, and the like, are those previouslyused with the host cell selected for expmssion, and will be apparent to the ordinarily skilled artisan. -19- P112911 In general, principles, protocols, and practical techniques for maximizing the Productivity of mammalian cell cultures can be found in usfomal Cl I. a mcc gIrah M. fmutger, ed. (IRL Press, 199 1). The host cells referredto in this disclosureencmps cells in cultreas w a s that a in 5 a host animal. tu welI as cl a are ith 5. Detecting (Gene Amnlificatin/Exoression Gene amplification and/or expression may be measured in a sample directly, for example by conventional Southern blotting, Northern blotting to quantitate the transcription of mRNA [Thomas, Eroc. Natl. Acad. Sci. USA22:5201-5205 (1980)], dot blotting (DNA analysis), or in situ hybridize iion, using an 10 appropriately labeled probe, based on the sequences provided herein. Various labels may be employed, most commonly radioisotopes, and particularly 32 P. However, other techniques may also be employed, such as using biotin-modiflednucleotdes for introduction into a polyncleotide. The biotin then serves as the site for binding to avidin or antibodies,which may be labeled with a wide variety of labels, such as radionucleotides fluorescers or enzymes. Alternatively, antibodies may be employed that den recognize specific duplexes, 15 including DNA duplexes, RNA duplexes, and DNA-RNA hybrid duplexes or DNA-protein duplexes. The antibodies in turn may be labeled and the assay may be carried out where the duplex is bound to a surface, so that upon the formation of duplex on the surface, the presence of antibody bound to the duplex can be detected. Gene expression, alternatively, may be measured by immunological methods, such as 20 immunobistochemicalstining of cells or tissue sections and assay of cell culture or body fluids, to quantitate directly the expression of gene product. With immunohistochemical staining techniques, a cell sample is prepared,typically by dehydration and fixation, followed by reaction with labeled antibodies specific for the gene product coupled, where the labels are usually visually detectable, such as enzymatic labels, fluorescent labels, or luminescent labels. 25 Antibodies useful fbr imnunohistochemical shining and/or assay of sample fluids may be either monoclonal or polyclonal, and may be prepared in any mammal. Conveniently, the antibodies may be prepared against a native sequence RTD polypeptide or against a synthetic peptide based on the DNA sequences provided herein or against exogenous sequence fused to RTD DNA and encoding a specific antibody epitope. 30 6. Purification of R)TD Polypntide Forms of RTD may be recovered from culture medium or from host cell lysates. If the RTD is membrane-bound, it can be released from the membrane using a suitable detergent solution (e.g. Triton-X 100) or its extracellulardomain may be released by enzymatic cleavage. RTD can also be released from the cell-surface by enzymatic cleavage of its glycophospholipid membrane anchor. 35 When RTD is produced in a recombinant cell other than one of human origin, the RTD is free of proteins or polypeptidesof human origin. However, it may be desired w purify RTD from recombinant cell proteins or polypeptidesto obtain preparationsthat are substantiallyhomogeneous as to RTD. As first step, the culture medium or lysate may be centrifuged to remove particulate cell debris. RTD thereafter is purified from contaminant soluble proteins and polypeptides, with the fbllowintg procedures being exemplary of -20- PIl29RI suitablepurification Procedures: by fractionation on an ion-exchange column; ethanol precipitation; reverse phase HPLC; chromatographyon silica 0r on a cation-exchangeresin such as DEAE; chromatofocusing;SDS PAGE; ammonium sulfate precipitation; gel filtration using, for example, Sephadex G-75; and protein A Sepharose columns to remove contaminants such as IgG. 5 RTD variants in which residues have been deleted, inserted, or substituted can be recovered in the same fashion as native sequence RTD, taking account of changes in properties occasioned by the variation. For example, preparation of an RTD fusion with another protein or polypeptide, e.g., a bacterial or viral antigen, immunoglobulin sequence, or receptor sequence, may facilitate purification; an immunoaetmity column containing antibody to the sequence can be used to adsorb the fusion polypeptide. Other types of 10 affinity macices also can be used. A protease inhibitor such as phenyl methyl sulfonyl fluoride (PMSF) also may be useful to inhibit proteolytic degradation during purification, and antibiotics may be included to prevent the growth of adventitious contaminants. One skilled in the art will appreciate that purification methods suitable for native sequence RTD may require modification to account for changes in the character of RTD or its variants upon 15 expression in recombinant cell culture. 7. Covalent Modifications of RTD Polpenides Covalentnmodifications of RTD are included within the scope of this invention. One type of covalent modificationof the RTD is introducedinto the molecule by reacting targeted amino acid residues of the RTD with an organic derivatizing agent that is capable of reacting with selected side chains or the N 20 or C- terminal residues of the RTD. Derivatization with bifunctional agents is useful for crosslinking RTD to a water-insoluble support matrix or surface for use in the method for purifying anti-RTD antibodies, and vice-versa. Derivatizationwith one or more bifunctional agents will also be useful for crosslinking RTD molecules to generate RTD diners. Such diners may increase binding avidity and extend half-life of the molecule in vivo. Commonly used 25 crosslinkingagents include, e.g., 1,1-bis(diazoacetyl)-2-phenylethanglutaraldehyde,N-hydoxysuccinimide esters, for example, esters with 4-azidosalicylicacid, homobifunctionalimidoesters, including disuccinimidyl esters such as 3,3'-dithiobis(succinimidylpropionate), and bifunctional maleimides such as bis-N-maleimido 1,8-octane. Derivatizing agents such as methyl-3-((p-azidophenyl)dithioJpropioimidateyield photoactivatable intermediates that are capable of forming crosslinks in the presence of light Alternatively, reactive water 30 insoluble matrices such as cyanogen bromide-activated carbohydrates and the reactive substraes described in U.S. Patent Nos. 3,969,287;3,691,016;4,195,128; 4,247,642; 4,229,537; and 4,330,440 are employed for protein immobilization. Other modifications include deamidationof glutaminyland asparaginyl residues to the corresponding glutamyland aspartyl residues, respectively,hydroxylationof prolineand lysine,phosphorylationofhydroxyl 35 groups of seryl or threonyl residues,methylationof the m-amino groups of lysine, arginine, and histidine side chains [T.E. Creighton, Proteins: Structure and.Molecular Properties. W.H. Freeman & Co., San Francisco, pp. 79-86 (1983)], acetylation of the N-terminal amine, and amidatiUon of any C-terminal carboxylgroup. The modified forms of the residues fail within the scope of the present invention. -21- P1 129R1 Another type of covalent modification of the RTD polypeptide included within the scope of this invention comprises altering the native glycosylation pattern of the polypeptide. "Altering the native glycosylation pattern" is intended for purposes herein to mean deleting one or more carbohydrate moieties found in native sequence RTD, and/oradding one or moreglycosyltionsites that are not presentin the native 5 sequence RTD. Glycosylation of polypeptides is typically either N-linked or 0-linked. N-linked refers fo the attachment of the carbohydrate moiety to the side chain of an asparagine residue. The tripeptide sequences asparagine-X-serine and asparagine-X-threonine, where X is any amino acid except proline, are the recognition sequences for enzymatic attachment of the carbohydrate moiety to the asparagiie side chain. 10 Thus, the presence of either of these tripeptide sequences in a polypeptide creates a potential glycosylationsite 0-linked glycosylation refers to the attachmentofone of the sugars N-aceylgalactosaminegalactoseor xylose to a hydroxylaminoacid, most commonlyserine or threonine,although 5-hydroxyproline or 5-hydroxylysine may also be used. Addition of glycosylationsites to the RTD polypeptide may be accomplished by altering the amino 15 acid sequence such that it contains one or more of the above-described tripeptide sequences (for N-linked glycosylation sites). The alteration may also be made by the addition of, or substitution by, one or more serine or threonine residues to the native sequence RTD (for 0-linked glycosylation sites). The RD amino acid sequence may optionally be altered through changes at the DNA level, particularly by mutating the DNA encoding the RTD polypeptideat preselected bases such that coons are generated that will translate into the 20 desired amino acids. The DNA mutation(s)may be made using methods described above and in U.S. Par. No. 5,364,934, mapm. Another means of increasing the number of carbohydrate moieties on the RTD polypeptide is by chemical or enzymatic coupling ofglycosides to the polypeptide. Depending on the coupling mode used, the sugar(s) may be attached to (a) arginine and histidine, (b) free carboxyl groups, (c) free sulfhydryl groups such 25 as those of cysteine, (d) free hydroxyl groups such as those of series, threonine, or hydroxyproline, (e) aromatic residues such as those of phenylalanine,tyrosine, or tryptophan, or (f) the arnide group of glutamine. These methods are described in WO 87/05330 published 11 September 1987, and in Aplin and Wriston,.CtC CriL Rev. Biochem. pp. 259-306 (1981). Removal of carbohydratemoleties presenton the RTD polypeptide may be accomplishedchemically 30 or enzymaticallyor by mutationalsubstitutionof codons encoding for amino acid residuesthat serve as targets for glycosylation. For instance, chemical deglycosylation by exposing the polypeptide to the compound trifluoromethanesulfonic acid, or an equivalent compound can result in the cleavage of most or all sugars except the linking sugar (N-acetylglucosamineor N-acetylgalactosamine),while leaving the polypeptide intact. Chemical deglycosylation is described by Hakimuddin, at al., Arch. Biochem. Biophys., 25i:52 (1987) and 35 by Edge et al., Anal. Biochem.. JUj:131 (1981). Enzymatic cleavage of carbohydrate moieties on polypeptidescan be achievedby the use of a varietyof endo-and exo-glycosidasesas describedby Thotakura St al, Met. Envml., 3.L_:350 (1987). -22- PI 129R1 Glycosylation at potential glycosylation sites may be prevented by the use of the compound tunicamycIn as described by Duskin et al., LBiol Chem. 212:3105 (1982). Tkanicawycin blocks the formation ofprotein-N-glycoside linkages. Another type of covalent modification of RTD comprises linking the RTD polypeptide to one of a 5 VIety Of nonproteinaceouspolymers, e-g. polyethylene glycol, Polypropylene glycol, or polyoxyakylenes, in the manner set forth in U.S. Patent Nos. 4,640,835; 4,496,689; 4,301,144; 4,670,417; 4,791,192 or 4,179,337. 8. RTlChmera The present invention also provides chimericmolecules comprising RTD fised to another 10 heterologous polypeptide or amino acid sequence. In one embodiment, the chimeric molecule comprises a fusion of the RTD with a tag popeptid which provides an epitope to which an antl-tag antibody can selectively bind. The epitope tag is generally placed at the amino- or carboxyl- terminus of the RTD. The presence of such epitope-tagged forms of the RTD can be detected using an antibody against the tag polypeptide. Also, provision of the epitope tag enables 15 the RTD to be readily purified by affinity purification using an anti-tag antibody or another type of affinity matrix that binds to the epitope tag. Various tag polypeptides and their respective antibodies are well known in the art. Examples include the poly his tag; flu HA tag polypeptide and its antibody 12CA5 [Field et al., Mol. Cll. BioL. ?:2159-2165 (198)]; the c-myc tag and the 8F9, 3C7, 6E10, G4, B7 and 9EI0 antibodies thereto [Evan et al., Molecular 20 and Cellular Bioloy. 1:3610-3616 (1985)); and the Herpes Simplex virus glycoprorcin D (gD) tag and its antibody [Paborskyet al., Promtin Enrierine a(6):547-553(1990)]. Other tag polypeptides include the Flag peptide [Hopp et al., Bioechnologx. : 1204-1210 (1983)]; the KT3 epitope peptide [Martin et al., ijnsa, 2:192-194(1992)1; an a-tubulin epitopepeptide (Skinner at al., LigLgChem., 2[i:15163-15166(1991)); and the T7 gene 10 protein peptide tag [Lutz-Freyermuth et al., Proc. Natl. Acad. ScL USA, 87:393-6397 25 (1990)). Once the tag polypeptide has been selected, an antibody thereto can be generated using the techniques disclosed herein. Generally, epitope-taggedRTD may be constructedand producedaccordingto the methods described above. RTD-tagpolypeptide fusions are preferably constructed by fusing the cDNA sequence encoding the RTD portion in-frameto the tag polypeptide DNA sequence and expressing the resultantDNA fusion construct 30 in appropriate host cells. Ordinarily, when preparing the RTD-tag polypeptide chimeras of the present invention, nucleic acid encoding the RTD will be fused at its 3' end to nucleic acid encoding the N-terminus of the tag polypeptide, however 5' fusions are also possible. For example, a polyhistidin sequence of about 5 to about 10 histidine residues may be fused at the N- terminus or the C- terminus and used as a purification handle in affinity chromatography. 35 Epitope-tagged RTD can be purified by affinity chromatography using the anti-tag antibody. The matrix to which the affinity antibody is attached may include, for instance, agarose, controlled pore glass or poly(styrenedivinyl)benzene. The epitopetagged RTD can then be eluted from the affity column using techniques known in the art. -23- P1 129R1 In another embodiment, the chimeric molecule comprises an RTD polypeptide fused to an immunoglobulinsequence. The chimericmoleculemay also comprise a particular domain sequence of RTD, such as the extracellulardomain sequenceofnative RTD faed to an nmunoglobulinsequence. This includes chimeras in monomeric, homo- or heteromultimeric, and particularly homo- or heterodimeric, or -tetrameric 5 forms; optionally, the chimeras may be in dimerle forms or homodimericheavy chain forms. Generally, these assembled immunogtobulins will have known unit structures as represented by the following diagrans. X or A CH orC X or A 10 y_ V C or CL A A \ CL \ CH 1 15 A VH \ CL \CH VL A \ A__ 20 C X A \CT x C 25 A X \ CL CH A basic four chain structuralunit is the form in which IgG, IgD, and IgE exist. A four chain unit as repeated in the higher molecularweight immunoglobulins; IgM generally exists as a pentaner of basic four 30 chain units held together by disulfide bonds. IgA globulin, and occasionally [gG globulin, may also exist in a multimeric form in serum. In the case of multimers, each four chain unit may be the same or different. The following diagrams depict some exemplary monomer, homo- and heterodimer and homo- and heteromultimer structures. These diagrams are merely illustrative, and the chains ofthe multimers are believed to be disulfide bonded in the same fashion as native immunoglobulins. -24- Pl 129RI monomer: A CL or CH homodimer: A \ CL or CH 5 CL or C 11 A heterodimer: A \CL or C 11 10 CLOrC X A homotetramer: A \__CL CL or CH 15 CL or C 1 / CL A/ A A 20 beterotetramer A \ CL CLOrCII CL or CH 1 X / 25 X and A X \_ CL 30 \ CL Or CH CLorC 8 / -CL A / X 35 In the foregoing diagrams, "A" means an RTD sequence or a RTD sequence fused to a heterologous sequence; X is an additional agent, which may be the same as A or different, a portion of an immunoglobulin superfamilymember such as a variable region or a variable region-like domain, including a native or chimeric immunoglobulin variable region, a toxin such a pseudomonas exotoxin or ricin, or a sequence functionally 40 binding to another protein, such as other cytokines (i.e., IL-1, interferon-y) or cell surface molecules (i.e., NGFR, CD40, OX40, Fas antigen, T2 proteins of Shope and myxomapoxviruses), or a polypeptidetherapeutic agent not otherwise normally associated with a constant domain; Y is a linker or another receptor sequence; and V 1 , VH, CL and CH represent light or heavy chain variable or constant domains of an immunoglobulin. -25- P I129RI Sncturesconmprisingat least one CRD of a RTD sequence as "A" and another cell-surface protein having a repetitive pattern of CRDs (such as TNFR) as "X n specifically included. It will be understoodthatthe above diagrams are merely exemplary of the possible stuctures of the chimeras of the present invention, and do not encompass all possibilities. For example, there might desirably 5 be several different "A"s, "X"s, or "Y"s in any of these constructs, Also, the heavy or light chain constant domains may be originated from the same or different immunoglobulins. All possible permutations Of the illustrated and similar structures a all within the scope of the invention herein. In general, the chimeric molecules can be constructed in a fashion similar to chimeric antibodies in which a variable domain from an antibody of one species is substituted for the variable domain of another 10 species. See, for example, EP 0 125 023; EP 173,494; Munro, Natr, 112:597 (13 December 1984); Neuberger at al., Nature, 12:604-608 (13 December 1984); Sharon et al., Nture. "92:364-367 (24 May 1934); Morrison et al., Proc. Nat'l, Acad. Sci. USA. it:6851-6855(1984); Morrison et aL, Scien, 222:1202 1207 (1985); Boulianneet al., NAurn- M:643-646 (13 December 1984); Capon et al, Natre .3LZ525-53 (1989); Traunecker et al, Nature. 32:68-70 (1989). 15 Alternatively, the chimeric molecules may be constructed as follows. The DNA including a region encoding the desired sequence, such as a RTD and/or TNFR sequence, is cleaved by a restriction enzyme at or proximal to the 3' end of the DNA encoding the immunoglobulin-like domain(s) and at a point at or near the DNA encoding the N-terminal end of the RTD or TNFR polypeptide (where use of a different leader is contemplated) or at or proximal to the N-terminal coding region for TNFR (where the native signal is 20 employed). This DNA fragmeatthen is readily inserted proximal to DNA encoding an immunoglobulin light or heavy chain constant region and, if necessary, the resulting construct tailored by deletional mutagenesis. Preferably, the Ig is a human immunoglobulinwhen the chimeric molecule is intended for in vvo therapy for humans. DNA encoding immunoglobulinlight or heavy chain constantregions is known or readily available from aDNA libraries or is synthesized. See for example, Adams et al., BiochemistrY 12:2711-2719 (1980); 25 Gough at al., Biochemistv 12:2702-2710 (1980); Dolby et al., Proc. Nat]. Acad. Sci. USA. 22:6027-6031 (1980); Rice et al., Proc. Natl.Acad. Sci., 22:7862-7865 (1982); Falkner et al., Natu. 29_:286-288 (1982); and Morrison et al., Ann. Rev. Immune., Z;239-256 (1984), Further details of how to prepare such fusions are found in publications concerning the preparation of immunoadhesins. Inmunoadhesins in general, and CD4-Ig fusion molecules specifically are disclosed in 30 WO 89/02922, published6 April 1989). Molecules comprisingthe extracellular portion of CD4, the receptor for human immunodeficiencyvirus (HIV), linked to IgG heavy chain constant region are known in the art and have been found to have a markedly longer half-life and lower clearance than the soluble extracellular portion of CD4 [Capon et al., m=nra; Byrn at al., Nature 2d:667 (1990)]. The construction of specific chimeric TNFR-IgG molecules is also described in Asbkenazi et al. Proc. Nat]. Acad. Sc...l:10535-10539 (1991); 35 Lesslauer et al. [Cell. Biochem Supglement5F. 1991, p. 115 (P 432)]; and Peppel and Beutler, L-QIL Bioche.upplement 5"1991, p. 118 (P439)]. B. Therapcutic and Non-therapeutic Uses for RTD RTD, as disclosed in the present specification,can be employed therapeuticallyto modulate apoptosis and/orNF-xB activation by Apo-2L or by another ligand that RTD binds to in mammaliancells. This therapy -26- Pl129R1 can be accomplished for instance, using In vivo or ex vivo gene therapy techniques. The RTD chimeric molecules (including the chimericmolecules containingan extracellulardomain sequence of RITD) comprising immunoglobulinsequencescan also be employed to inhibit Apo-2L activities, for example, apoptosis or NF KB induction or the activity of another ligand that RTD binds to. 5 Suitable carriers and their formulationsare described in Remington's Pha aeut Sciens-- 16th ed., 1980, Mack PublishingCo., edited by Oslo et al. Typically,an appropriate amount of a phamaceutltally acceptable salt is used in the fbrnulation to tender the formulation isotonic. Examples of the carier include buffers such as saline, Ringer's solution and dextrose solution. The pH of the solution is preferably from about 5 to about 8, and more preferably from about 7.4 to about 7.8. It will be apparent to those persons skilled in 10 the art that certain carriers may be more preferable depending upon, for instance, the route ofadministration. Administration to a mammal may be accomplished by injection (e.g., intravenous, intraperitoneal subcutaneous, intramuscular), or by other methods such as infusion that ensure delivery to the bloodstream in an effective form. Effetive dosages and schedules fbr administration may be determined empirically, and making such determinations is within the skill in the art. is It is contemplated that other, additional therapies may be administered to the mammal, and such includes but is not limitedto, chemotherapy and radiationtherapy, immunoadjuvantscytokines, and antibody based therapies. Examples include interleukins (e.g., IL-1, IL-2, IL-3, IL-6), leukemia inhibitory factor, interferons, TGF-beta, erythropoietin,thtombopoietin, and HER-2 antibody. Other agents may also employed, and such agents include TNF-a, TNF-0 (lymphotoxin-at), CD30 ligand, 4-1 BB ligand, and Apo- 1 ligand. 20 Chemotherapies contemplated by the invention include chemical substances or drugs which are known in the art and are commercially available, such as Doxorubicin, S-Fluorouracil, Cytosine arabinoside ("Ara-C"), Cyclophosphamide, Thiotepa, Busulfan, Cytoxin, Taxol, Methotrexate, Cisplatin, Melphalan, Vinblastine and Carboplatin. Preparationand dosing schedules for such chenotherapymay be used according to manufacturers'instructionsor as determinedempiricallyby the skilled practitioner. Preparation and dosing 25 schedules for such chemotherapy are also described in Chemotherapy Service Ed., M.C. Perry, Williams & Wilkins, Baltimore, MD (1992). The chemotherapy is preferably administered in a pharmaceutically acceptable carrier, such as those described above. The RT) of the invention also has utility in non-therapeutic applications. Nucleic acid sequences encoding the RTD may be used as a diagnostic for tissue-specifictyping. For example, procedures like in situ 30 hybridization, Northern and Southern blotting, and PCR analysis may be used to determine whether DNA and/or RNA encoding RTD is present in the cell type(s)being evaluated. RTD nucleic acid will also be useful for the preparation of RTD by the recombinant techniques described herein. The isolated RTD may be used in quantitative diagnostic assays as a control against which samples containing unknown quantities of RTD may be prepared. RTD preparations are also useful in generating 35 antibodies, as standards in assays for RTD (e.g., by labeling RTD for use as a standard in a radloimmunoassay, radioreceptorassay, or enzyme-linked immunoassay), in affinity purification techniques, and in competitive type receptor binding assays when labeled with, for instance, radioiodine, enzymes, or fluorophores. Isolated, native forms of RTD, such as described in the Examples, may be employed to identify alternate forms of RTD; for example, forms that possess cytoplasmic domain(s) which may be involved in -27signaling pathway(s). Modified forms of the RTD, such as the RTD-IgG chimeric molecules (immunoadhesins) described above, can be used as immunogens in producing anti-RTD antibodies. Nucleic acids which encode RTD or its modified forms can also be used to generate either transgenic animals or "knock out" animals which, in turn, are useful in the development and screening of therapeutically useful reagents. A transgenic animal (e.g., a mouse or rat) is an animal having cells that contain a transgene, which transgene was introduced into the animal or an ancestor of the animal at a prenatal, e.g., an embryonic stage. A transgene is a DNA which is integrated into the genome of a cell from which a transgenic animal develops. cDNA encoding RTD or an appropriate sequence thereof (such as RTD-IgG) can be used to clone genomic DNA encoding RTD in accordance with established techniques and the genomic sequences used to generate transgenic animals that contain cells which express DNA encoding RTD. Methods for generating transgenic animals, particularly animals such as mice or rats, have become conventional in the art and are described, for example, in U.S. Patent Nos. 4,736,866 and 4,870,009. Typically, particular cells would be targeted for RTD transgene incorporation with tissue-specific enhancers. Transgenic animals that include a copy of a transgene encoding RID introduced into the germ line of the animal at an embryonic stage can be used to examine the effect of increased expression of DNA encoding RTD. Such animals can be used as tester animals for reagents thought to confer protection from, for example, pathological conditions associated with excessive apoptosis. Accordingly, an animal may be treated with the reagent and a reduced incidence of the pathological condition, compared to untreated animals bearing the transgene, would indicate a potential therapeutic intervention for the pathological condition. Transgenic animals that carry a soluble form of RTD such as the RTD ECD or an immunoglobulin chimera of such form could be constructed to test the effect of chronic neutralization of Apo-2L, a ligand of RTD. Alternatively, non-human homologues of RTD can be used to construct a RTD "knock out" animal which has a defective or altered gene encoding RTD as a result of homologous recombination between the endogenous gene encoding RTD and altered genomic DNA encoding RTD introduced into an embryonic cell of the animal. For example, cDNA encoding RTD can be used to clone genomic DNA encoding RTD in accordance with established techniques. A portion of the genomic DNA encoding RTD can be deleted or replaced with another gene, such as a gene encoding a selectable marker which can be used to monitor integration. Typically, several kilobases of unaltered flanking DNA (both at the 5' and 3' ends) are included in the vector [see e.g., Thomas and Capecchi, Cell, 51:503 (1987) for a description of homologous recombination vectors]. The vector is introduced into an embryonic stem cell line (e.g., by electroporation) and cells in which the introduced DNA has homologously recombined with the endogenous DNA are selected [see e.g., Li et al., Cell 69:915 (1992)]. The selected cells are then injected into a blastocyst of an animal (e.g., a mouse or rat) to form aggregation chimeras [see e.g., Bradley, in Teratocarcinomas and Embryonic Stem Cells: A Practical Approach, E. J. Robertson, ed. (IRL, Oxford, 1987), pp. 113-152]. A chimeric embryo can then be implanted into a suitable pseudopregnant female foster animal and the embryo brought to term to create a "knock out" animal. Progeny harboring the homologously recombined DNA in their germ cells can be identified by standard techniques and used to breed animals in which all cells of the animal contain the homologously recombined DNA. Knockout animals can be characterized for instance, for their ability to 2109617_1 (GHMaters) 2-Nov-09 -28- PI129RI defend against certain pathological conditions and for their development of pathological conditions due to absence of the RTD polypeptide, including for example, development of tumors. C. Anti-RTD Antibody Preparation The present invention further provides anti-RTD antibodies. Antibodies against RTD may be S prepared as follows. Exenplary antibodies include polyclonal, monoclonal, humanized, bispecific, and heteroconjugate antibodies. I. PolyclonaLAntibdis The RTD antibodies may comprise polyclonal antibodies, Methods of preparing polyclonal antibodies are known to the skilled artisan. Polyclonal antibodies can be raised in a mammal, for example, 10 by one or more injections of an immunizing agent and, if desired, an adjuvant. Typically, the immunizing agent and/or adjuvant will be injected in the mammal by multiple subcutaneous or intraperitoneal injectio The immunizing agent may include the RTD polypeptide or a fusion protein thereof. An example of a suitable immunizing agent is a RTD-IgG fusion protein or chimeric molecule (including a RTD ECD-IgG fusion protein). Cells expressing RTD at their surface may also be employed. It may be useful to conjugate the 15 immunizing agent to a protein known to be immunogenicin the mammal being immunized. Examples of such immunogenic proteins which may be employed include but are not limited to keyhole limpet hemocyanin, serum albumin, bovine thyroglobulin,and soybean trypsin inhibitor. An aggregating agent such as alum may also be employed to enhance the mammal's immune response. Examples ofadjuvants which may be employed include Freund's complete adjuvant and MPL-TDM adjuvant (monophosphoryl Lipid A. synthetic trehalose 20 dicorynomycolate). The immunization protocol may be selected by one skilled in the art without undue experimentation. The mammal can then be bled, and the serum assayed for antibody titer. If desired, the mammal can be boosted until the antibody titer increases or plateaus. 2. Monoclonal Antibodies The RTD antibodies may, alternatively, be monoclonal antibodies. Monoclonal antibodies 25 may be prepared using hybridoma methods, such as those described by Kohler and Milstein, §pr. In a hybridoma method, a mouse, hamster, or other appropriate host animal, is typically immunized (such as described above) with an immunizing agent to elicit lymphocytes that produce or are capable of producing antibodies that will specifically bind to the immunizing agent. Alternatively, the lymphocytes may be immunized in vitro. 30 The immunizing agent will typically include the RTD polypeptide or a fusion protein thereof. An example of a suitable immunizing agent is a RTD-IgG fusion protein or chimeric molecule. Cells expressing RTD at their surface may also be employed. Generally,eitherperipheral blood lymphocytes(TBLs") are used if cells of human origin are desired, or spleen cells or lymph node cells are used if non-human mammalian sources are desired. The lymphocytes are then fused with an immortalized cell line using a suitable fusing 35 agent such as polyethylene glycol, to form a hybridoma cell [Goding, MonoclnalAntibodies: Principles and Practice. Academic Press, (1986) pp. 59-103J. Immortalized cell lines are usually transformed mammalian cells, particularly myeloma cells of rodent, bovine and human origin. Usually, rat or mouse myeloma cell lines are employed. The hybridomacells may be cultured in a suitable Culturemedium that preferablycoains one or more substances that inhibit the growth or survival of the unfused, immortalized cells. For example, -29- P1129RI if the parental cells lack the enzyme hypoxanthine guanine phosphoribosyl transfbrase (HGPRT or HPRT), the culture medium for the hybridomas typically will include hypoxanthine, aminopterin, and thymidine ("HAT medium"), which substances prevent the growth of HGPRT-deficient cells. Preferred immortalized cell lines are those that fuse efficiently, support stable high level expression 5 of antibody by the selected antibody-producing cells, and are sensitive to a medium such as HAT medium. More preferred immortalized cell lines are marine myeloma lines, which can be obtained, for instance;from the Salk Institute Cell Distribution Center, San Diego, California and the American Type Culture Collection, Manassas, Virginia. Human myeloma and Mouse-humanheteromyeloma cell lines also have been described for the production of human monoclonal antibodies [Kozbor, LJ Immundl.L.O:3001 (1 9 84);.Brodeur at al., 10 MonocIonal Antiody&Pouction Tec u A ios. Marcel Dekker, Inc., New York, (1987) pp. 51-63].

The culture medium in which the hybridoma calls are cultured can then be assayed for die presence of monoclonal antibodies directed against RTD. Preferablythe binding specificity of monoclonal antibodies produced by the hybridoma calls is determined by immunopreclpitation or by an in vitro binding assay, such 15 as radioimmunoassay(RIA)or enzyme-linkedimmunoabsorbentessay(E[SA). Such techniques and assays are known in the at. The binding affinity of the monoclonal antibody can, for example, be determined by the Scatchard analysis of Munson and Pollard, Anal. Biochem., .. 7:220 (1930). After the desired hybridoma cells are identifed, the clones may be subcloned by limiting dilution procedures and grown by standard methods [Goding, am]. Suitable culture media for this purpose include, 20 for example, Dulbecco's Modified Eagle's Medium and RPMI-1640 medium. Alternatively, the hybridoma cells may be grown in vivo as ascites in a mammal. The monoclonal antibodies secreted by the subclones may be isolated or purified from the culture medium or ascites fluidby conventionalimmunoglobulinpurificationproceduressuch as, for example, protein A-Sepharose, hydroxylapatite chromatography, gel electrophoresis, dialysis, or affinity chromatography. 25 The monoclonal antibodiesmay also be made by recombinant DNA methods, such as those described in U.S. Patent No. 4,816,567, DNA encoding the monoclonal antibodies of the invention can be readily isolated and sequenced using conventionalprocedures (e.g., by using oligonucleotide probes that are capable of binding specifically to genes encoding the heavy and light chains of murine antibodies). The hybridoma cells of the invention serve as a preferred source of such DNA. Once isolated, the DNA may be placed Into 30 expression vectors, which are then transfected into host cells such as sitnian COS cells, Chinesehamster ovary (CHO) cells, or myeloma cells that do not otherwise produce immunoglobulin protein, to obtain the synthesis of monoclonal antibodies in the recombinant host cells. The DNA also may be modified, for example, by substituting the coding sequence for human heavy and light chain constant domains in place of the homologous murine sequences [U.S. Patent No. 4,816,567; Morrison et al., supr] or by covalently joining 35 to the immunoglobulin coding sequence all or part of the coding sequence for a non-immunoglobulin polypeptide. Such a non-immunoglobulin polypeptide can be substituted for the constant domains of an antibody of the invention, or can be substituted for the variable domains of one antigen-combining site of an antibody of the invention to create a chimeric bivalent antibody. -30- PI 129R1 The antibodiesmay be monovalentantibodies. Methods for prperingmonovalentantibodiesare weU knownin the art For example, one method involves recombinant expression of immunoglobulin light chain and modified heavy chain. The heavy chain is truncated generally at any point in the Fc region so as to prevent heavy chain crosslinking. Alternatively, the relevant cysteine residues are substituted with another 5 amino acid residue or are deleted so as to prevent crosslinking. In vitro methods are also suitable for preparing monovalent antibodies. Digestion of antibodies to produce fragments thereof particularly,Fab fragments, can be accomplished using routine techniques known in the art. For instance, digesti6n can be perfbrmedusing papain. Examplesof papain digestion are described in WO 94/29348 published 12/22/94 and U.S. PatentNo. 4,342,566. Papain digestion of antibo~aies typically 10 produces two identical antigen binding fragments, called Fab fragments, each with a single antigen bindinG site, and a residual Pc fragment. Pepsin treatment yields an F(ab) 2 fragment that has two antigen combining sites and is still capable of cross-linking antigen. The Fab fragments produced in the antibody digestion also contain the constant domains of the light chain and the first constant domain (CHI) of the heavy chain. Fab' fragments differ from Fab fragments by 15 the addition of a few residues at the carboxy terminus of the heavy chain CHI domain including one or more cysteines from the antibody hinge region. Fah'-SH is the designation herein for Fab' in which the cysteine residue(s) of the constant domains bear a free thiol group. F(ab') 2 antibody fragments originally were produced as pairs of Pab' fragments which have hinge cysteines between them. Other chemical couplings of antibody fragments are also known. 20 3. Humanized Antibodies The RTD antibodies of the invention may further comprise humanized antibodies or human antibodies. Humanized forms of non-human (e.g., murine) antibodies are chimeric immunoglobulins, immunoglobulin chains or fragments thereof (such as Fv, Fab, Fab', F(ab')2 or other antigen-binding subsequences of antibodies) which contain minimal sequence derived from non-human immunoglobuiin. 25 Humanized antibodies include human immunoglobulins (recipient antibody) in which residues from a complementary determining region (CDR) of the recipient are replaced by residues from a CDR of a non human species (donor antibody) such as mouse, rat or rabbit having the desired specificity, affinity and capacity. In some instances, Fv framework residues of the human immunoglobulin are replaced by corresponding non-human residues. Humanized antibodies may also comprise residues which are found 30 neither in the recipient antibody nor in the imported CDR or framework sequences. In general, the humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the CDR regions correspond to those of a non-human immunoglobulin and all or substantially all of the FR regions are those of a human immunoglobuliuconsensus sequence. The humanized antibody optimallyalso will comprise at least a portion of an immunoglobulin constant region (Fe), typically 35 that of a human immunoglobulin {Jones et al., Natur. 21.:522-525 (1986); Riechmann et al., Nltu 332:323-329 (1988); and Presta, Curr. Op. Struct. m il.,2:593-596 (1992)]. Methods for humanizing non-human antibodies are well known in the art. Generally, a humanized antibody has one or more amino acid residues introduced into it from a source which is non-human. These non-human amino acid residues are often referred to as "import" residues, which are typically taken from an -31- P1 129R1 "import"variable domain. Humanization can be essentially perfonned following the method of Winter and co-workers [Jones et al., Nagi, =21:522-525 (1986); Riechmann et al., btuM D2:323-327 (1988); Verhoeyen et al., Scialw 22:1534-1536 (1988)], by substituting rodent CDRs or CDR sequences for the corresponding sequences of a human antibody. Accordingly, such "humanized" antibodies are chimeric 5 antibodiea(U.S. PatentNo. 4,816,567), wherein substantially less than an intact human variable domain has been substitutedby the correspondingsequence from a non-human species. In practice, humanized antibodies are typically human antibodies in which some CDR residues and possibly some FR residues are substituted by residues from analogous sites in rodent antibodies. The choice of human variable domains, both light and heavy, to be used in making the humanized 10 antibodiesis very important in order to reduce antigenicity. According to the "best-fit' method, the sequence of the variable domain of a rodent antibody is screened against the entire library of known human variable domain sequences. The human sequence which is closest to that of the rodent is then accepted as the human framework (FR) for the humanized antibody [Sims et al, IIntuuL I.L:2296 (1993); Chothia and Lesk, L4MLoBiigL 19:901 (1987)]. Another method uses a particular framework derived from the consensus 15 sequence of all human antibodiesof a particularsubgroupof light or heavy chains. The same framework may be used for several differenthumanized antibodies [Carter et aL, Proc. Natt Acad. SciUSA, 12:4285 (1992); Presta a al., L ImmunoL. 151:2623 (1993)]. It is further important that antibodies be humanized with retentionofhigh affinity for the antigen and other favorable biological properties, To achieve this goal, according to a preferred method, humanized 20 antibodies are prepared by a process of analysis of the parental sequences and various conceptual humanized products using three dimensional models of the parental and humanized sequences. Three dimensional immunoglobulin models are commonly available and are familiar to those skilled in the art. Computer programs are available which illustrate and display probable three-dimensional conformarional structures of selected candidate immunoglobulinsequences. Inspection of these displays permits analysis of the likely role 25 of the residues in the fuwctioning ofthe candidate immunoglobulin sequence, i.e., the analysis of residues that influence the ability of the candidate immunoglobulin to bind its antigen, In this way, FR residues can be selected and combined from the consensus and import sequence so that the desired antibody characteristic, such as increased affinity for the target antigen(s), is achieved. In general, the CDR residues are directly and most substantially involved in influencing antigen binding [see, WO 94/04679 published 3 March 1994] 30 Transgenic animals (e.g., mice) that are capable, upon immunization, of producing a fUll repertoire of human antibodies in the absence of endogenous immunoglobulin production can be employed. For example, it has been described that the homozygous deletion of the antibody heavy chain joining region (J 1 ) gene in chimeric and germ-linemutant mice results in complete inhibitionof endogenous antibodyproduction. Transferof the human germ-line immunoglobulingene array in such germ-line mutant mice will result in the 35 production of human antibodies upon antigen challenge [see, e.g., Jakobovits et at, Proc. Nat. Ad. Sci. US, 2Q:2551-255 (1993); Jakobovits et al., Nature, M62:255-258 (1993); Bruggenuann cc al., Year in lmmuno, 2:33 (1993)]. Human antibodies can also be produced in phage display libraries [Hoogenboom and Winter, . MoL ioL 22;381 (1991); Marks et l., . MoLBioiL :581 (1991)]. The techniques of Cole at al. and Boerner et al. are also available for the preparation of human monoclonal antibodies (Cole cc al., -32- PI 129RI Monoclonal Antibodies and Cancer Therapv Alan R. Liss, p. 77 (1985) and Boemer et al., ldImmnL 147(Lk:86-95 (1991)]. 4. Bisecific Antbodies Bispecifle antibodies are monoclonal, preferably human or humanized,antibodiesthat have 5 binding specificities for at least two different antigens. In the present case, one of the binding specificilies is for the RTD, the other one is for any other antigen, and preferably for a cell-surface protein or receptor or receptor subunit. Methods for making bispecific antibodies are known in the art. Traditionally, the recombinant production of bispecific antibodies is based on the co-expression of two immunoglobulin heavy-chain/light 10 chain pairs, where the two heavy chains have differentspocificities [Milstein and Cuello, Natu. :57539 (1983)]. Because of the random assortment of inununoglobulin heavy and light chains, these hybridoma (quadromas) produce a potential mixture of ten different antibody molecules, of which only one has the correct bispecific structure. The purification of the correct molecule is usually accomplished by atffnity chromatography steps. Similar procedures are disclosed in WO 93/08829, publislied 13 May 1993. and in 15 Traunecker et al., EMOJ 1Q:3655-3659 (1991). According to a different and more preferred approach, antibody variable domains with the desired binding specificities (antibody-antigen combining sites) are fused to immunoglobulin constant domain sequences. The fusionpreferablyis with an immunoglobulinheavy-chainconstandomain, comprisingat least part of the hinge, CH2, and CH3 regions. it is preferred to have the first heavy-chain constant region (CH1) 20 containing the site necessary for light-chain binding present in at least one of the fusions. DNAs encoding the immunoglobulin heavy-chainfusions and, if desired,the immunoglobulinlight chain, are inserted into separate expression vectors, and are co-transfectedinto a suitable host organism. This provides for great flexibility in adjusting the mutual proportions of the three polypeptide fragments in embodiments when unequal ratios of the three polypeptide chains used in the construction provide the optimum yields. It is, however, possible to 25 insert the coding sequences for two or all three polypeptide chains in one expression vector when the expressionof at least two polypeptide chains in equal ratios results in high yields or when the ratios are of no particular significance. Ia a preferred embodiment of this approach, the bispecific antibodies are composed of a hybrid immunoglobulin heavy chain with a first binding specificity in one arm, and a hybrid immunoglobulin heavy-chain/light-chainpair (providing a second binding specificity)in the other arm. It was 30 found that this asymmetric structure facilitates the separation of-the desired bispecific compound from unwanted immunoglobulinchain combinations, as the presence of an immunoglobulin light chain in only one half of the bispecific molecule provides for a facile way of separation. This approach is disclosed in WO 94/04690 published 3 March 1994. For further details of generating bispecific antibodies see, for example, Suresh et al., Methods in Enzymology, .121:210 (1986). 35 5. Heteroconiugate Antibodies Heteroconjugate antibodies are also within the scope of the present invention. Heteroconjugate antibodies are composed of two covalently joined antibodies. Such antibodies have, for example, been proposed to target immune system cells to unwanted cells [US Patent No. 4,676,980], and for treatment of HlIV infection [WO 91/00360; WO 92/200373;EP 03089]. It is contemplatedthat the antibodies -33may be prepared in vitro using known methods in synthetic protein chemistry, including those involving crosslinking agents. For example, immunotoxins may be constructed using a disulfide exchange reaction or by forming a thioether bond. Examples of suitable reagents for this purpose include iminothiolate and methyl 4-mercaptobutyrimidate and those disclosed, for example, in U.S. Pat. No. 4,676,980. D. Therapeutic and Non-therapeutic Uses for RTD Antibodies The RTD antibodies of the invention have therapeutic utility. For example, antagonistic antibodies may be used to sensitize cells to Apo-2 ligand induced apoptosis. RTD antibodies may further be used in diagnostic assays for RTD, e.g., detecting its expression in specific cells, tissues, or serum. Various diagnostic assay techniques known in the art may be used, such as competitive binding assays, direct or indirect sandwich assays and immunoprecipitation assays conducted in either heterogeneous or homogeneous phases [Zola, Monoclonal Antibodies: A Manual ofTechniques, CRC Press, Inc. (1987) pp. 147-158]. The antibodies used in the diagnostic assays can be labeled with a detectable moiety. The detectable moiety should be capable of producing, either directly or indirectly, a detectable signal. For example, the detectable moiety may be a radioisotope, such as 3 H, 1 4 c, 32 P, 35s, or 121, a fluorescent or chemiluminescent compound, such as fluorescein isothiocyanate, rhodamine, or luciferin, or an enzyme, such as alkaline phosphatase, beta-galactosidase or horseradish peroxidase. Any method known in the art for conjugating the antibody to the detectable moiety may be employed, including those methods described by Hunter et al., Nature, 144:945 (1962); David et al., Biochemistry 13:1014(1974); Pain et al., . Immunol. Meth, 40:219 (1981); and Nygren, J. Histochem. and Cytochem., 30:407 (1982). RTD antibodies also are useful for the affinity purification of RTD from recombinant cell culture or natural sources. In this process, the antibodies against RTD are unmobilized on a suitable support, such a Sephadex resin or filter paper, using methods well known in the art. The immobilized antibody then is contacted with a sample containing the RTD to be purified, and thereafter the support is washed with a suitable solvent that will remove substantially all the material in the sample except the RTD, which is bound to the immobilized antibody. Finally, the support is washed with another suitable solvent that will release the RTD from the antibody. E. Kits Containing RTD or RTD Antibodies Also disclosed are articles of manufacture and kits containing RTD or RTD antibodies which can be used, for instance, for the therapeutic or non-therapeutic applications described above. The article of manufacture comprises a container with a label. Suitable containers include, for example, bottles, vials, and test tubes. The containers may be formed from a variety of materials such as glass or plastic. The container holds a composition which includes an active agent that is effective for therapeutic or non therapeutic applications, such as described above. The active agent in the composition is RTD or a RTD antibody. The label on the container indicates that the composition is used for a specific therapy or non therapeutic application, and may also indicate directions for either in vivo or in vitro use, such as those described above. 2109617_1 (GHMatters) 2-No-09 -34- The kit will typically comprise the container described above and one or more other containers comprising materials desirable from a commercial and user standpoint, including buffers, diluents, filters, needles, syringes, and package inserts with instructions for use. 2109617 1 (GHMatters) 2-Nov-9 -34a- P1129R The following examples are offered for illustrative purposes only, and are not intended to limit the scope of the present invention in any way. All patent and literature references cited in the present specification are hereby incorporated by reference in their entirety. EXAMPLES All restriction enzymes referred to in the examples were purchased from New England Biolabs and used according to manufacturer's instructions. All other commercially available reagents referred to in the examples were used according to manufacturer's instructionsunless otherwise indicated. The source of those cells identified in the following examples, and throughout the specification, by ATCC accession numbers is 10 the American Type Culture Collection, Manassas, Virginia. EXAMPLE ] Isolation of cDNA clones Encoding Human RTD A synthetic probe based on the sequence encoding the DcRl ECD [Sheridan at al., qu2p] and having the following sequence: 15 CATAAAAGTTCCTGCACCATGACCAGAG ACACAGTGTGT TOTAAAGA (SEQ ID NO:3) was used to screen a human fetal lung cDNA library. To prepare the cDNA library, mRNA was isolated fror human fetal lung tissue using reagents and protocols from Invitrogen, San Diego, CA (Fast Track 2)- This RNA was used to generate an oligo dT primed cDNA library in the vecror pRKSD using reagents and protocols from Life Technologies, Gaithersburg, MD (Super Script Plasmid System). In this procedure, the 20 double stranded cDNA was sized to greater than 1000 bp and the Sall/Noll linkered cDNA was cloned into Xhol/Not cleaved vector. pRK5D is a cloning vector that has au sp6 transcription initiation site followed by an Sfil restriction enzyme site preceding the XhoI/Not[ cDNA cloning sites. Two full length clones were identified (DNA35663 and DNA35664) that contained a single open reading frame with an apparenttranslationalinitiation site at nucleotide positions 157-159[Kozak ec al., supral 25 and ending at the stop codon found at nuclotide positions 1315-1317 (Fig. IA; SEQ ID NO:2). There is a single base difference between the two clones at nucleotide position 1085 (either a C or T) (Fig. 1A), resulting in a serine codon (TCG) (clone DNA35663) or a leucine codon (TTO) (clone DNA35664) at amino acid position 310 (Fig. IA). These clones are referredto as pRK5-35663 and pRK5-35664 and deposited as ATCC Nos. 209201 and 209202, respectively. 30 Tho predicted polypeptideprecursoris 386 amino acids long and has a calculated molecular weight of approximately 41.8 kDa. Sequence analysis indicated a N-terminal signal peptide (amino acids 1-55). followed by an BCD (amino acids 56-212), transmembrane domain (amino acids 213-232) and intracellular region (amino acids 233-386). (Figure lA)- The signal peptide cleavage site was confirmed by N-terminal protein sequencing of an RTD ECD immunoadhesin (not shown). This structure suggests that RTD is a type 35 1 transmembraneprotein. RTD contains 3 potentialN-linkedglycosylationsites, at amino acid positions 127, 171 and 182. (Fig. 1A) The RTD polypeptides are obtained or obtainable by expressing the polypeptide encoded by the cDNA insert of the vectors deposited as ATCC 209201 or ATCC 209202. TNF receptor family proteins are typically characterized by the presence of multiple (usually four) cysteine-rich domainsin their extracellularregions- each cystsine-richdomain being approximately45 amino -35- PI129R1 acids long and coUtainingapproximately6, regularly spaced, cysteine residues. Based on the crystal structure of the type I TNF receptor, the cysteines in each domain typically form three disulfide bonds in which usually cysteines 1 and 2, 3 and 5, and 4 and 6'are paired together. Like DR4, DRS, and DcRI, RTD contains two extracellular cysteine-rich pseudorepeats (Fig. ID), whereas other identified mammalian TNFR family 5 members contain three or more such domains [Smith et al., ClI, 7A:959 (1994)]. Based on an alignment analysis of the ECD sequence shown in Figure lB (SEQ 1i) NO:1),-RTD shows more sequence identityto the BCD of DR4 (55%), DRS (56%), or DcRl (67%) than to other apoptosis linked receptors, such as TNFRI (26%), Fas/Apo-l (27%) or DR3 (19%). The predicted intracellular sequence of RTD also shows more homology to the corresponding region of DR4 (60%) or DR5 (49%) as 10 compared to TNFR (18%), Fas (14%) or DR3 (10%).(Fig. IC) The intracellular region of RTD is about 50 residues shorter than the intracellular regions identified for DR4 or DR5. It is presently believed that RTD may contain an truncated death domain (amino acids 340-364; Fig. ID), which corresponds to the carboxy terminal portion ofthe death domainsequences of DR4 and DRU. Five out of six amino acids that are essential for signalingby TNFRI [Tartaglia et al., aLgRa] and that are conserved or semi-conserved in DR4 and DRS, 15 are absent in RTD. (Figure IC). EXAMPLE2 A. Expression of R TD EU) as an Immunoadhesin A RTD ECD immunoadhesin was constructed by fusing a cDNA sequence encoding the extracellularregion of RTD (amino acids 1-212; see Fig. I A) to a cDNA encoding the hinge, CH2, and CH3 20 regions of human IgG 1, as described in Ashkenazi et aL, asnw. Immunoadhesins based on the exracellular region of DR5 [Sheridan et al., supra Pan et al., agg1 or TNFRI [Ashkenazi et al., suprul were similarly constructed. The immunoadhesinswere expressed as recombinant proteins by transfecting SW9 cells (ATCC CRL 1711) and purified by protein A affmity chromatography. B. Immunoprecipitation Assay Showing 25 Bindins Interaction between RTD ECD and Apo-2 ligand The RTD, DR5 or TNFRI immunoadhesin(2.5 pg) was incubated with 1 I-labeled soluble Apo-2 ligand [Pitti et al., supral (I ng, specific activity 10.7 pCi/pg) in the absence or presence of I pg unlabeled Apo-2 ligand for 1 hour at roar temperature. Complexes were precipitated by proteinA sepharose, and resolved by electrophoresis* on a 4-20% gradient SDS polyacrylamide gel (Novex) under reducing 30 conditions. The gel was dried and subjected to phosphorimager analysis on a BAS2000 system (Fuji). The results are shown in Figure 2A. Both the RTD and DR5 immunoadhesins, but not the TNFR I immunoadhesin, co-precipitated the labeled Apo-2 Ligand. This co-precipitation was blocked by excess unlabeled Apo-2 ligand. The binding interaction was further analyzed on a BIACORETM instriment. BIACORETM analysis demonstrated that the RTD immunoadhesin bound to Apo-2 ligand, but not to other 35 apopcosis-inducingfhmily members, namely, TNF-alpha, lymphotoxin-alpha or Fas ligand (data not shown). These results show that the extracellular region of RTD binds specifically to Apo-2 ligand, supporting the belief that RTD is a receptor for Apo-2 ligand. EXAMPLEI3 Inhibition of Apo-2 ligand Function by RTD ECP -36- P1129RI HeLa S3 cells (ATCC CCL 2.2) were incubated with PBS buffer or Apo-2 ligand (Pitti at al., m~la 125 ngtl) in the presence of RTD orTNFRl hniunoadhesins(describedin Example2 above; 10 sg/ml) for 5 hours, and analyzed for apoptosis by annexin V binding as described in Marsters et al., suon. The data, shown in Figure 2B, are the means ± SE of triplicate determinations, 5 The RTD immunoadhesin, but not the TNFR1 immunoadhesin, blocked Apo-2 ligand's ability to induce apoptosis in HeLa cells (Figure 2B), supporting further the ability of the RTD ECD to bind to Apo-2 ligand, and demonstrating that RTD immunoadhesin is capable of neutralizing Apo-2 ligand. EXAMPLE 4 Inhibition of Ano-2 limandFunctionj by Full-length RTD 10 Because death domains can function as oligomerization interfaces, overexpression of receptors that contain such domains can lead to activation of signaling in the absence of ligand [see, Nagata, _Cl, f:35 365 (1997)]. It has been reported that overexpmssion of DR4 or DRS can lead to activation of apoptosis and of NF?-xB [Sheridan et al., hm=a Pan et al, ag]. To investigate whether RTD can activate apoptosis, HeLa S3 cells were co-transfetted with a pRK5-based expression plasmid encoding full-length RTD. along with a 15 plasmid encoding human CD4 as a marker for transfection. Human HeLa S3 cells (1 x 106 per assay) were transfected by electroporation with pRK5 [Schall et al., g[1, -6:361-370 (1990); Suva, Simnce. 22,893-896 (1987)], or with pRK5-based plasmids encoding RTD (clone DNA35663 or clone DNA35664), DR4 or DRS (16 mg), along with pRK5 encoding CD4 (4 yg) as a tiransfection marker. The level ofapoptosis in CD4.expressing cells was assessed 24 hours later, by FACS 20 analysis of annexin V binding, as described in Marstors Ct al., a=ma. As shown in Figure 3A (data represented are means ± SE of triplicate detenninations), the RTD transfected cells showed no difference in the level of apoptosis as compared to pRKS-transfected (control) cells, whereas cells transfected by DR4 or DR5 showed a marked increase in Apoptosis. In another experience, human 293 calls (ATCC CRL 1573) (5 x 106 per assay) were transfected in 25 10 cm plates by calcium phosphate precipitation with pRKS or pRKS-based plasmids encoding RTD (clone DNA35663 or clone DNA35664) or DRS (20 jug). The cells were analyzed 24 hours later for NF-<B activation by an electrophoreticmobility shift assay, as described by Marsters et al., EMMa The results, shown in Figure 3B, reveal that transfectionof293 cells by RTD did not cause an increase in NF-rB activity, whereas transfection by DR5 caused NF-KB activation. Thus, unlike DR4 and DRS, RTD does not appear to signal 30 poptosis or NF-xB activation upon overexpression. This suggests that the truncated death domain of RTD is not able to trigger such responses. In another experiment,293 cells (1 x 106) were transfected in 6 cm plates by pRK5 or pRK5-based plasmids encoding RTD (clone DNA35663 or clone DNA35664) (4 pg), along with pRK5 encoding green fluorescentprotein (GFP; available front Clontech) (1 g). The cells were treated 24 hours later with Apo-2 35 ligand (Pitti et al., a=a; 0.5 pg/ml), stained with Hoechst 33342 dye (10 pg/mli), and double positive cells were scored for apoptotie morphology under a fluorescence microscope (Leica) equipped with Hoffmann optics. The results, shown as means ± SE of triplicate determinations, are illustrated in Figure 3C. Cells transfected by either one of the RTD cDNA clones were significantly less sensitive to Apo-2 ligand-induced -37- P1129R1 apoptosis. Similar results were obtained with HeLa cells (data not shown). These results suggest that RTD does not signal cell death and demonstrate that RTD can inhibit Apo-2 ligand function when it is expressed at high levels. EXAMPE S 5 Northern Blot Analysis Expression of RTD mRNA in human tissues was examined by Northern blot analysis. HumantNA blots were hybridized to a 200 bp 32 P-labelled DNA probe based on the 3' untranslated region of the RTD. The probe was generated by PCR with the following oligonucleotide primers: CrTCAGGAAACCAGAGCTTCCCTC (SEQ ID NO:4); TTCTCCCGTTTGCTTATCACACGC (SEQ ID 10 NO:5). Probes specific for beta-actin were used as controls. Human fetal RNA blot MTN (Clontech) and human adult RNA blot MTN-II (Clontech) were incubated with the DNA probes. Blots were incubated with the probes in hybridizationbuffer (5X SSPE; 2X Denhardt's solution; 100 mgfmL denatured sheared salmon sperm DNA; 50% formamide; 2% SDS) for 60 hours at 42 0 C. The blots were washed several times in 2X SSC; 0.05% SDS for 1 hour at room temperature, followed by a 30 minute wash ino.IX SSC; 0.1% SDS at 15 50 0 C. The blots were developed after overnight exposure by phosphorimager analysis (Fuji). As shown in Fig. 4, a single RTD mRNA transcript of about 4 kb was detected. This transcript was expressed in fetal kidney, liver and lung, and in multiple adult tissues, particularly in testis and kidney. This mRNA expression pattern differs from that of DR4, DR5 and DcRl. DR4 and DcRI are particularly abundant in peripheral blood leukocytes and spleen, and DRS is most abundant in ovary, liver and lung. 20 EXAMPLE 6 Chromosomal Localization of the RTD. DR. DR4 and DcR] genes Chromosomal localization of these human genes was examined by radiation hybrid (RH) panel analysis. RH mapping was performed by PCR using a human-niouse cell radiation hybrid panel (Research Genetics) and primers based on the coding region of the DRS cDNA [Gelb et a., Hum. Genet, 21:141(1996)). 25 Analysis of the PCR data using the Stanford Human Genome Center Database and the Whitehead Institute for Biomedical Research/MITCenter for Genome Research indicates that DRS is linked to the marker DSS481, with an LOD of 11.05; D8S481 is linked in turn to D8S2055, which maps to human chromosome Sp 2 1. A similar analysis of DR4 showed that DR4 is linked to the marker DSS2127 (with an LOD of 13.00), which maps also to human chromosome 8p2l. Analysis of DcRl using radiation hybrid panel examination showed 30 that the DcRI gene is linked to the marker WI-6536, which in turn is linked to D8S298, which maps also to human chromosome Up21 and is nested between D8S2005 and D8S2127. Using a primerbased on the 3' untranslatedregion of the RTD cDNA, an analysis revealed that RTD was linked to marker SHGC-33989 (LOD of 7.2). Marker SHGC.-33989 is linked to D8S2055, which maps to human chromosome 8p2 . Thus, the human genes for RTD, DRS, DcR1 and DR4, all map to chromosome 35 8p21. Deposit of Material The following materials have been deposited with the American Type Culture Collection, 10801 University Blvd., Manassas, Virginia, USA (ATCC): -38- P1129RI1 MaeilATCC Den. -No. VtD PRK5-35663 209201 pRKS-35664 209202 Aug. 18, 1997 Thisdepsitwas adeundr th prvisonsAug. 18, 1997 This deposit was made under the provisions ofthe Budapest Treaty on the International Recognition 5 of the Deposit of Microorganisms for the Purpose of Patent Procedure and the Regulations thereunder (Budapest Treaty). This assures maintenance of a viable culture of the deposit for 30 years from the date of deposit, The deposit will be made available by ATCC under the trms of the Budapest Treaty, and subject to an agreement between Genentech, Inc. and ATCC, which assures permanent and unrestricted availability of the progeny of the culture ofthe deposit to the public upon issuance ofthe pertinentU.S. patent drupon laying 10 open to the public of any U.S. or foreign patent application, whichever comes first, and assures availability of the progenyto one determinedby the U.S. Commissionerof Patents and Trademarks to be entitled thereto according to 35 USC §i22 and the Commissioners rules pursuant thereto (including 37 CFR §1.14 with particular reference to 886 OG 638), The assigned of the present application has agreed that if a cuture ofthe materials on deposit should 15 die or be lost or destroyed when cultivated under suitable conditions, the materials will be promptly replaced on notification with another of the same. Availability of the deposited material is hot to be construed as a license to practice the invention in contraventionofthe rights granted under the authority of any government in accordance with its patent laws. The foregoing written specification is considered to be sufficient to enable one skilled in the arr to 20 practice the invention. The present invention is not to be limited in scope by the construct deposited, since the deposited embodiment is intended as a single illustration of certain aspects of the invention and any constructs that are functionally equivalent are within the scope of this invention. The deposit of material herein does not constitute an admission that the written description herein contained is inadequate to enable the practice of any aspect of the invention, including the best mode thereof, nor is it to be construedas limiting 25 the scope of the claims to the specific illustrations that it represents. Indeed, various modifications of the invention in addition to those shown and described herein will become apparent to those skilled in the art from the foregoing description and fall within the scope of the appended claims. The entire disclosure in the complete specification of our Australian Patent Applioation No. 84850/98 is by this cross-reference incorporated into the present specification. -39-

Claims (34)

1. Isolated RTD polypeptide having at least about S0% amino acid sequence idettity with native sequence RTD polypeptide comprising amino acid residues 1 to 386 of Fig. IA (SEQ ID NO:1).

2. The RTD polypeptide of claim 1 wherein said RTD polypeptide has at least about 90% amino acid 5 sequence identity.

3. The RTD polypeptide of claim 2 wherein said RTD polypeptide has at least about 95% amino acid sequence identity.

4. Isolated native sequence RTD polypeptide comprising amino acid residues I to 386 of Fig. IA (SE% ID NO:1). 10

5. Isolated RTD polypeptide comprising amino acid residues 56 to 386 of Fi. IA (SEQ ID NO:1).

6. Isolated extracellular domain sequence of RTD polypeptide comprising (a) amino acid residues 56 to 212 of Fig. IA (SEQ ID NO:1); or (b) fragments of the sequence of (a) which retain biological activity of a native sequence RTD polypeptide.

7. The extracellular domain sequence of claim 6 comprising amino acid residues I to 212 of Fig. IA 15 (SEQ ID NO:1).

8. Isolated extracellular domain sequence of RTD polypeptide comprising amino acid residues 99 to 139 of Fig. IA (SEQ ID NO:1),

9- The extracellulardomain sequence of claim 8 further comprising amino acid residues 141 to 180 of Fig. IA (SEQ ID NO:1). 20

10. A chimeric molecule comprising a RTD polypeptide fused to a heterologous amino acid sequence.

11. The chimeric molecule of claim 10 wherein said RTD polypeptide comprises an extracellulardomain sequence,

12. The chimericmolecule of claim 10 wherein said beterologousamino acid sequence is an epitope tag sequence, 25

13. The chimeric molecule of claim 10 wherein said heterologous amino acid sequence is an immunoglobulin sequence. -46-

14. The chimeric molecule of claim 13 wherein said immunoglobulin sequence is an IgG.

15. An antibody which specifically binds to a RTD polypeptide.

16. The antibody of claim 15 wherein said antibody is a monoclonal antibody.

17. The antibody of claim 15 or claim 16 which is an agonist antibody.

18. The antibody of any one of claims 15 to 17 which comprises a chimeric antibody.

19. The antibody of any one of claims 15 to 17 which comprises a human antibody.

20. Isolated nucleic acid comprising a nucleotide sequence encoding the RTD polypeptide of any one of claims 1 to 3 or the extracellular domain sequence of claim 6 or claim 7.

21. The nucleic acid of claim 20 wherein said nucleotide sequence encodes native sequence RTD polypeptide comprising amino acid residues 1 to 386 of Fig. IA (SEQ ID NO:1).

22. A vector comprising the nucleic acid of claim 20 or claim 21.

23. The vector of claim 22 operably linked to control sequences recognized by a host cell transformed with the vector.

24. A host cell comprising the vector of claim 22 or claim 23.

25. The host cell of claim 24 which comprises a CHO cell.

26. The host cell of claim 24 which comprises a yeast cell.

27. The host cell of claim 24 which comprises E, coli.

28. A process of using a nucleic acid molecule encoding RTD polypeptide to effect production of RTD polypeptide comprising culturing the host cell of any one of claims 24 to 27.

29. A composition comprising RTD polypeptide and a carrier.

30. An article of manufacture, comprising a container and a composition contained within said container, wherein the composition includes RTD polypeptide or RTD antibody.

2109617-1 (GHMsners) 2.Ncv.09 -47-

31. The article of manufacture of claim 30 further comprising instructions for using the RTD polypeptide or RTD antibody in vivo or ex vivo.

32. A method of modulating apoptosis in mammalian cells comprising exposing said cells to RTD polypeptide.

33. The method of claim 32 wherein said cells are also exposed to Apo-2 ligand.

34. An isolated RTD polypeptide according to claim 1 or claim 5, an isolated native sequence RTD polypeptide according to claim 4, an isolated extracellular domain sequence of RTD polypeptide according to claim 6 or claim 8, a chimeric molecule according to claim 10, an antibody according to claim 15, an isolated nucleic acid according to claim 20, a vector according to claim 22, a host cell according to claim 24, a process according to claim 28, a composition according to claim 29, a kit according to claim 30 or a method according to claim 32, substantially as hereinbefore described with reference to any one of the examples or figures. 2109617_1 (GHMaters) 2-Nov-09 -48-