AU2006252031A1 - Modulating cytokine or hormone signalling in an animal comprising up-regulating the expression of SOCS sequences in the animal - Google Patents
Modulating cytokine or hormone signalling in an animal comprising up-regulating the expression of SOCS sequences in the animal Download PDFInfo
- Publication number
- AU2006252031A1 AU2006252031A1 AU2006252031A AU2006252031A AU2006252031A1 AU 2006252031 A1 AU2006252031 A1 AU 2006252031A1 AU 2006252031 A AU2006252031 A AU 2006252031A AU 2006252031 A AU2006252031 A AU 2006252031A AU 2006252031 A1 AU2006252031 A1 AU 2006252031A1
- Authority
- AU
- Australia
- Prior art keywords
- socs
- animal
- seq
- amino acid
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Abandoned
Links
Landscapes
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Peptides Or Proteins (AREA)
Description
P/00/011 Regulation 3.2
AUSTRALIA
Patents Act 1990 COMPLETE SPECIFICATION STANDARD PATENT
(ORIGINAL)
Name of Applicant: AMRAD Operations Pty Ltd, of 576 Swan Street, Richmond, Victoria 3121, Australia Actual Inventors: NASH, Andrew MACCARONE, Pino EGAN, Paul WICKS, Ian Address for Service: DAVIES COLLISON CAVE, Patent Trademark Attorneys, of 1 Nicholson Street, Melbourne, 3000, Victoria, Australia Ph: 03 9254 2777 Fax: 03 9254 2770 Attorney Code: DM "Modulating cytokine or hormone signalling in an animal comprising up-regulating the expression of SOCS sequences in the animal" Invention Title: The following statement is a full description of this invention, including the best method of performing it known to us:- P:\OPER\EjhEjhdivisio.lskl3048361 Ilrdd.13/12/2006 0-1- Modulating cytokine or hormone signalling in an animal comprising up- Sregulating the expression of SOCS sequences in the animal FIELD OF THE INVENTION tt This application is a divisional of Australian Application No. 2001293519, the entire I contents of which are incorporated herein by reference.
The present invention relates generally to a method for the treatment and/or prophylaxis of conditions arising from or otherwise associated with aberrations in hormone signalling.
More particularly, the present invention contemplates a method for the treatment and/or prophylaxis of conditions, the amelioration of symptoms of which are facilitated by an over-expression of a gene encoding a suppressor of cytokine signalling molecule. The present invention further contemplates agents useful for the prophylaxis and/or treatment of such conditions in mammals including humans.
BACKGROUND OF THE INVENTION Bibliographic details of the publications numerically referred to in this specification are collected at the end of the description.
Reference to any prior art in this specification is not, and should not be taken as, an acknowledgment or any form of suggestion that this prior art forms part of the common general knowledge in Australia or any other country.
The gene encoding Suppressor of Cytokine Signalling-1 (SOCS-1), the SOCS protein family prototype, was discovered in a functional genetic screen designed to identify inhibitors of cytokine signalling. Comparison to existing sequences on genetic databases identified a number of additional proteins that could be grouped into a "SOCS protein family" on the basis of homology within a novel COOH-terminal 'SOCS-box' sequence motif. Proteins containing the SOCS-box could be further divided into sub-families on the p:\OPEREjhEIh-ivisnls30148361 mmrad doc-13/122006
ID
-2basis of additional protein sequence motifs including, for example, SH2 domains (SOCS1c WD40 repeats (WSB1,2), ankyrin repeats (ASBl-3) and a SPRY domain (SSBI-3).
Subsequent analysis has revealed that SOCS-1 and other SOCS family members, most notably those which incorporate an SH2 domain, represent the key components of a classic ("1 t negative feedback loop that regulates cytokine signalling. SOCS protein expression is ,0 induced by cytokine signalling and SOCS proteins interact with components of that Sprocess to turn signalling off.
SOCS-1, which inhibits the in vitro activity of a variety of cytokines including IL-6, LIF, and type I/II interferons, binds directly to, and inhibits the action of, Janus kinases (JAKs).
Published analysis indicates that this activity against JAKs may be mediated by three distinct functional domains within SOCS-1: the SH2 domain and preceding 12 amino acids (extended SH2 subdomain) of SOCS-1 are required for binding to the phosphorylated (Y1007) activation loop of JAK2; an additional 12 N-terminal amino acids (kinase inhibitory region) of SOCS-1 contribute to high affinity binding to the JAK2 tyrosine kinase domain and are required for the inhibition of JAK2 activity; and the SOCS-box has been found to mediate the interaction of SOCS proteins with elongin B and elongin C, intracellular proteins responsible for targeting proteins for degradation within the cell.
In addition to inhibiting the activity of cytokines that signal through the JAK/STAT pathway, SOCS-1 has also been reported to inhibit TNFa activities such as induction of cell death Although the mechanism for this activity remains unclear, there is some evidence to suggest that SOCS-1 regulates the activity of p38 MAP kinase which in turn may act as a survival factor in TNF treated cells.
SOCS-3 has also been demonstrated to inhibit the in vitro activity of LIF and IL-6, however, in contrast to SOCS-1, it does not appear to bind directly to JAKs. Structurefunction studies have identified an interaction between SOCS-3 and the cytoplasmic domain of shared receptor component gpl30. In particular a single peptide representing the P\oPER\Ejh\Ejhin.o1l3048361 smrad doc. I32/2 -3amino acid stretch 750-764 of gpl30 and centred around the phosphorylated tyrosine residue 757 (pY757) is able to bind to the SOCS-3 protein with high affinity (Kd=42 nM).
Thus, SOCS proteins appear to inhibit cytokine signalling by at least two mechanisms: they are able to bind to, and inhibit the activity of, signalling intermediates activated following receptor oligermerization JAKs) or they interact with receptor components gpl30) to inhibit the phosphorlyation and activation of downstream substrates.
Cytokines are key mediators of a number of severe and debilitating diseases. For example, a number of cytokines including IL-1, IL-6, TNFa, GM-CSF and type I/II interferons are central to the pathophysiology of both acute and chronic inflammatory disease. This is reflected in the development and marketing of new therapeutic strategies which focus on inhibition of cytokine action. For example, specific antagonists of TNFa (monoclonal antibodies, soluble receptors) are now used successfully in the treatment of rheumatoid arthritis and Chrones disease.
As potent negative regulators of cytokine signalling SOCS proteins provide for a new approach to the treatment of cytokine mediated disease such as rheumatoid arthritis.
Targeted over-expression of SOCS proteins SOCS proteins as gene therapeutics) should turn off cytokine signalling and ameliorate cytokine-mediated disease. Rheumatoid arthritis represents a useful example. When over-expressed, SOCS-1 has been demonstrated to interact with and inhibit the activity of JAKs. JAK activation and subsequent action represents an important downstream event in signalling through both IL- 6 and GM-CSF receptors. Furthermore SOCS-1 has also been demonstrated to be a potent antagonist of TNFa mediated activities. In work leading up to the present invention, the inventors reasoned that over-expression of SOCS-1 could be expected to interfere in IL-6, GM-CSF and TNF signalling, all key mediators of rheumatoid arthritis.
For SOCS therapeutics to be effective, it is likely that they will need to be expressed at a high level such as being over-expressed in the majority of target cells within a pathological lesion. Gene based therapies clearly represent the best way to achieve this, with viral P:OPER\Ejh\Ejh\ivionlls0148361 mrad doc.13/12/2006 0 -4- Svectors such as adenovirus, adeno-associated virus (AAV) and retrovirus likely to Crepresent the delivery mechanism of choice.
\O
t(N tiq t(N P \0PER\Ejh\Ejhdd-j..1s 149361 -nvd do.I 3112/26 SSUMMARY OF THE INVENTION Nucleotide and amino acid sequences are referred to by a sequence identifier number (SEQ ID The SEQ ID NOs: correspond numerically to the sequence identifiers <400>1, <400>2, etc. A sequence listing is provided after the claims.
INO Throughout this specification, unless the context requires otherwise, the word "comprise", or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated element or integer or group of elements or integers but not the exclusion of any other element or integer or group of elements or integers.
The present invention is predicated in part on the use of genetic therapeutic protocols to increase, enhance or otherwise facilitate expression of nucleotide sequences encoding a SOCS molecule in a cell. Over-expression of such nucleotide sequences thereby elevates levels of the SOCS protein or other expression products mRNA or spliced out introns from mRNA encoded by genomic DNA). The "over-expression" in this context means, in one particular embodiment, a level of expression statistically greater than a standardized normal control. However, the present invention also contemplates maintenance of normal expression levels. The "level" of expression may readily be determined by, for example, nuclear run-on analysis or determination of SOCS protein levels amongst other methods.
Accordingly, one aspect of the present invention contemplates a method for modulating cytokine or hormone signalling in an animal, said method comprising up-regulating expression of a genetic sequence encoding a SOCS protein or its derivative or homolog in said animal.
Another aspect of the present invention provides a method of modulating cytokine or hormone signalling in an animal and in particular a human, said method comprising upregulating expression of a genetic sequence encoding a SOCS protein in said animal and wherein said SOCS protein comprises a protein:molecule interacting region such as but not P.\OPER\Ejh\Ejhdivlllonis30148361 mrad doc-13/12/2006 -6limited to an SH2 domain, WD-40 repeats and/or ankyrin repeats, N terminal of a SOCS C box, wherein said SOCS box comprises the amino acid sequence: Xl X 2
X
3
X
4
X
5
X
6
X
7
X
8
X
9 Xlo X 1 1
X
12
X
1 3
X
14 X15 X 1 6 [Xi]n X17 X 1 8
X
1 9
X
2 0
X
2 1
X
2 2
X
2 3 [Xj]n X 24
X
2 5
X
2 6
X
2 7
X
2 8 N0 wherein: XI is L, I, V, M, A or P;
SX
2 is any amino acid residue;
X
3 is P, T or S;
X
4 isL, I, V, M, A orP;
X
5 is any amino acid;
X
6 is any amino acid; X7 is L, I, V, M, A, F, Y or W; Xs is C, T or S;
X
9 is R, K or H; Xlo is any amino acid; XII is any amino acid;
X
1 2 is L, I, V, M, A orP;
X
1 3 is any amino acid;
X
1 4 is any amino acid; Xi 5 is any amino acid;
X
1 6 is L, I, V, M, A, P, G, C, T or S; [Xi]n is a sequence of n amino acids wherein n is from 1 to 50 amino acids and wherein the sequence Xi may comprise the same or different amino acids selected from any amino acid residue; Xi 7 is L, I, V, M, A or P;
X
1 8 is any amino acid;
X
1 9 is any amino acid;
X
20 is L, I, V, M, A or P;
X
2 1 is P;
X
22 is L, I, V, M, A, P or G; P.NOPEREjhjhhdivisimalsk3Ol48361 -d moc 31121206
IO
-7- X23 is P or N; C [Xj]n is a sequence of n amino acids wherein n is from 0 to 50 amino acids and wherein the Xj may comprise the same or different amino acids selected Sfrom any amino acid residue;
X
24 is L, I, V, M, A or P; n X 25 is any amino acid;
X
26 is any amino acid; SX27 is Y or F;
X
28 is L, I, V, M, A or P.
Still another aspect of the present invention contemplates a method for controlling cytokine or hormone signalling, such as pro-inflammatory cytokine signalling IL-6, GM-CSF, TNFa), in an animal such as a human or livestock animal, said method comprising modulating expression of a genetic sequence encoding a SOCS protein comprising a SOCS box and a protein:molecule interacting region N-terminal of said SOCS box wherein said SOCS box comprises the amino acid sequence:
X
1
X
2
X
3
X
4
X
5
X
6 X7 X 8
X
9 Xlo XI 1
X
12
X
13
X
14
X
1 5
X
1 6 [Xi]n X 17
X
18
X
1 9
X
20
X
2 1
X
2 2
X
2 3 [Xj]n X 2 4
X
2 5
X
2 6
X
2 7
X
2 8 wherein: Xi is L, I, V, M, A or P;
X
2 is any amino acid residue;
X
3 is P, T or S;
X
4 isL, I, V, M, A or P;
X
5 is any amino acid;
X
6 is any amino acid;
X
7 is L, I, V, M, A, F, Y or W; Xs is C, T or S; X9 is R, K or H; Xio is any amino acid;
X
11 is any amino acid; P \OPER\EjhEjhdivsOnals\30148361 amad doc-13/12/2006 -8- X12 is L, I, V, M, A or P;
CX
1 3 is any amino acid;
X
14 is any amino acid; Xl 5 is any amino acid;
X
1 6 is L, I, V, M, A, P, G, C, T or S; ~[Xi]n is a sequence of n amino acids wherein n is from 1 to 50 amino acids I\D and wherein the sequence Xi may comprise the same or different amino Sacids selected from any amino acid residue;
X
1 7 is L, I, V, M, A or P;
X
1 8 is any amino acid;
X
1 9 is any amino acid;
X
20 is L, I, V, M, A or P;
X
21 is P;
X
22 is L, I, V, M, A, P or G;
X
23 is P or N; [Xj]n is a sequence of n amino acids wherein n is from 0 to 50 amino acids and wherein the Xj may comprise the same or different amino acids selected from any amino acid residue;
X
24 is L, I, V, M, A or P;
X
25 is any amino acid;
X
26 is any amino acid;
X
27 is Y or F;
X
28 is L, I, V, M, A or P.
Yet another aspect of the present invention contemplates a method for controlling cytokine or hormone signalling in an animal such as human or livestock animal, said method comprising administering to said animal a genetic molecule encoding a SOCS protein for a time and under conditions sufficient to modulate growth hormone signalling.
Another aspect of the present invention contemplates a method for the treatment of cytokine-mediated disease in an animal, said method comprising modulating cytokine or PkOPR\Eh\Eh\di~simols\3014861 um.d docI3/I212 -9hormone signalling in an animal by up-regulating the expression of a genetic sequence encoding a SOCS protein or its derivative or homologue in said animal.
In a preferred embodiment, the SOCS gene is expressed at a high level such as being overexpressed.
P \0PEREjh\Ejhhiyisiw&1sk301431 dnrddo-13/12120 A summary of sequence identifiers used throughout the subject specification is provided below.
SUMMARY OF SEQUENCE IDENTIFIERS SEQUENCE ID NO: DESCRIPTION 1 Mouse SOCS-1 (nucleotide) 2 Mouse SOCS-1 (amino acid) 3 Mouse SOCS-3 (nucleotide) 4 Mouse SOCS-3 (amino acid) Human SOCS-1 (nucleotide) 6 Human SOCS-1 (amino acid) 7 Rat SOCS-1 (nucleotide) 8 Rat SOCS-1 (amino acid) 9 Primer Primer 11 Primer 12 Primer 13 Primer 14 Primer P:\OPER\EjhlEjh\dvlionOls30148361 unrad doc.13/12/206 -11 BRIEF DESCRIPTION OF THE FIGURES Figure 1 is a graphical representation of SOCS-1' IFN-y mice compared to SOCS- 1Y IFN-y"" mice following injection of BSA and IL-1 subcutaneously to knee joints in three daily injections. A histological score was measured in oxodate, synovitis, pannus, cartilage and bone.
P \OPER\Ejh\Ejhdiislals\30148361 mrad doc. 13/I12/2006 S-12- SDETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS One aspect of the present invention contemplates a method for modulating cytokine or hormone signalling in an animal, said method comprising up-regulating expression of a genetic sequence encoding a SOCS protein or its derivative or homolog in said animal.
0 Reference herein to "SOCS" encompasses any or all members of the SOCS family.
SSpecific SOCS molecules may be defined numerically such as, for example, SOCS-1, SOCS-2 and SOCS-3. The species from which the SOCS has been obtained may be indicated by a preface of single letter abbreviation where is human, is mouse and is rat. Accordingly, "mSOCS-2", for example, is a specific SOCS from a murine animal. Reference herein to "SOCS" is not to imply that the protein solely suppresses cytokine-mediated signal transduction, as the molecule may modulate other effectormediated signal transductions such as by hormones or other endogenous or exogenous molecules, antigen, microbes and microbial products, viruses or components thereof, ions, hormones and parasites. The term "modulates" encompasses up-regulation as well as at least maintenance of particular levels. Preferably, the expression is up-regulated. Reference herein to "murine" includes both mouse and rat.
Reference herein to a "hormone" includes protein hormones as well as non-proteinaceous hormones. One particularly useful hormone is growth hormone. Another useful hormones are insulin-like growth factor I (IGF-I) and prolactin. A cytokine refers to any cytokine or cytokine-like molecule such as interleukin IL-1, IL-6), tumour necrosis factor (e.g.
TNFa), a colony stimulating factor GM-CSF) or an interferon.
An "animal" is preferably a mammal such as but not limited to a human, primate, livestock animal sheep, cow, pig, horse, donkey), laboratory test animal rabbit, mouse, rat, guinea pig), companion animal cat, dog) or captive wild animal. The animal may be in the form of an animal model. Useful animals for this purpose are laboratory test animals.
Genetically modifying livestock animals is useful in assisting in food production. The P.\OPER\EJh\Ejh\diviinls430148361 ~dradoc.1312/2006 0 -13-
U
Spreferred animal is a human, primate animal or laboratory test animal. The most preferred C animal is a human.
Reference herein to "SOCS" includes a protein comprising a SOCS box in its C-terminal Sregion comprising the amino acid sequence: I0 XI X 2
X
3
X
4
X
5
X
6
X
7
X
8
X
9 Xlo X 1 1
X
12
X
13
X
14
X
1 5
X
1 6 [Xi]n X 1 7 X18 X 1 9
X
20
SX
2 1
X
2 2
X
2 3 [Xj]n X 2 4
X
2 5
X
2 6
X
2 7
X
2 8 wherein: X 1 is L, I, V, M, A or P;
X
2 is any amino acid residue;
X
3 is P, T or S;
X
4 is L, I, V, M, A or P;
X
5 is any amino acid;
X
6 is any amino acid;
X
7 is L, I, V, M, A, F, Y or W;
X
8 is C, T or S; X9 is R, K or H; Xio is any amino acid;
X
1 1 is any amino acid;
X
1 2 is L, I, V, M, A or P;
X
13 is any amino acid;
X
14 is any amino acid;
X
15 is any amino acid;
X
1 6 is L, I, V, M, A, P, G, C, T or S; is a sequence of n amino acids wherein n is from 1 to 50 amino acids and wherein the sequence Xi may comprise the same or different amino acids selected from any amino acid residue;
X
17 is L, I, V, M, A or P;
X
1 8 is any amino acid;
X
19 is any amino acid; P %OPER\Eh\Eh\d-siws1A30149 ,rid dcI 3I212OO6
ID
S-14-
¢U
is L, I, V, M, A or P; mX 2 1 is P;
X
22 is L, I, V, M, A, P or G;
X
23 is P or N; 0 is a sequence of n amino acids wherein n is from 0 to 50 amino acids and wherein the Xj may comprise the same or different amino acids selected from any amino acid residue; SX24 is L, I, V, M, A or P;
X
25 is any amino acid;
X
26 is any amino acid;
X
27 is Y or F;
X
28 is L, I, V, M, A or P.
The SOCS protein also comprises a protein:molecule interacting region such as but not limited to one or more of an SH2 domain, WD-40 repeats and/or ankyrin repeats, Nterminal of the SOCS box.
In an important aspect, the present invention contemplates up-regulating expression of a nucleotide sequence encoding a SOCS protein in the treatment of inflammatory diseases such as rheumatic arthritis.
Another aspect of the present invention provides a method of modulating cytokine or hormone signalling in an animal and in particular a human, said method comprising upregulating expression of a genetic sequence encoding a SOCS protein in said animal and wherein said SOCS protein comprises a protein:molecule interacting region such as but not limited to an SH2 domain, WD-40 repeats and/or ankyrin repeats, N terminal of a SOCS box, wherein said SOCS box comprises the amino acid sequence: X, X 2
X
3
X
4
X
5 X6 X 7
X
8 X9 Xlo XI 1
X
12
X
1 3
X
14 X15 X 1 6 [Xi]n X 17
X
18
X
19
X
20
X
2 1
X
22
X
23 [Xj]n X 24
X
25
X
26
X
27
X
2 8 P:\OPER\EjhEjhndiviionlw 0148361 inrid doc.-112/2006 0 wherein: XI is L, I, V, M, A or P; C X 2 is any amino acid residue;
X
3 is P, T or S;
X
4 is L, I, V, M, A or P;
X
5 is any amino acid;
SX
6 is any amino acid; IND X7 is L, I, V, M, A, F, Y or W; SXs is C, T or S; X9 is R, K or H; Xlo is any amino acid; XII is any amino acid;
X
12 is L, I, V, M, A or P;
XI
3 is any amino acid;
X
1 4 is any amino acid;
X
1 5 is any amino acid;
X
1 6 is L, I, V, M, A, P, G, C, T or S; [Xi]n is a sequence of n amino acids wherein n is from 1 to 50 amino acids and wherein the sequence Xi may comprise the same or different amino acids selected from any amino acid residue;
X
1 7 is L, I, V, M, A or P; Xl 8 is any amino acid;
X
1 9 is any amino acid;
X
2 0 is L, I, V, M, A or P;
X
2 1 is P;
X
22 is L, I, V, M, A, P or G;
X
23 is P or N; is a sequence of n amino acids wherein n is from 0 to 50 amino acids and wherein the Xj may comprise the same or different amino acids selected from any amino acid residue;
X
24 is L, I, V, M, A or P;
X
25 is any amino acid; P:\PER\Ejh\Ejhdiviimiall30148361 und doc-13/12/2006
IO
S-16-
X
26 is any amino acid; SX27 is Y or F;
X
28 is L, I, V, M, A or P.
The present invention extends to any SOCS molecule such as those disclosed in n International Patent Application No. PCT/AU99/00729 [WO 98/20023] which is s0 incorporated herein by reference. However, in a particularly preferred embodiment, the Spresent invention is directed to manipulating levels of SOCS-1, which murine form (mSOCS-1) comprises the nucleotide and corresponding amino acid sequence as set forth in SEQ ID NO:1 and SEQ ID NO:2, respectively. The present invention is hereinafter described with reference to murine SOCS-1 (mSOCS-1), however, this is done with the understanding that the present invention encompasses the manipulation of levels of any SOCS molecule, such as but not limited to human SOCS-2 (hSOCS-2). Reference herein to a "SOCS" molecule such as SOCS-1 includes any mutants thereof such as functional mutants. An example of a mutant is a single or multiple amino acid substitution, addition and/or deletion or truncation to the SOCS molecule or its corresponding DNA or RNA.
Accordingly, another aspect of the present invention contemplates a method for controlling cytokine or hormone signalling such as pro-inflammatory cytokine signalling IL-6, GM-CSF, TNFa), in an animal such as a human or livestock animal, said method comprising modulating expression of a genetic sequence encoding a SOCS protein comprising a SOCS box and a protein:molecule interacting region N-terminal of said SOCS box wherein said SOCS box comprises the amino acid sequence:
X
1
X
2
X
3
X
4
X
5
X
6
X
7
X
8
X
9 XIo XI 1
X
12
X
1 3
X
1 4
X
1 5
X
1 6 [Xi]n X 1 7
X
1 8
X
1 9
X
2 0
X
2 1
X
2 2
X
2 3 [Xj]n X 2 4
X
2 5
X
2 6
X
2 7
X
2 8 wherein: X 1 is L, I, V, M, A or P;
X
2 is any amino acid residue;
X
3 is P, T or S;
X
4 is L, I, V, M, A or P; P OPER\Ejh\EjhMiv,.onls.30I48361 imraddoc-13/12/2006 -17- SXs is any amino acid; CC X 6 is any amino acid; X7 is L, I, V, M, A, F, Y or W;
X
8 is C, T or S; X9 is R, K or H;
(N
Xlo is any amino acid; N X 11 is any amino acid; 0X 12 is L, I, V, M, A or P;
X
1 3 is any amino acid;
X
1 4 is any amino acid;
X
1 5 is any amino acid;
X
16 is L, I, V, M, A, P, G, C, T or S; [Xi]n is a sequence of n amino acids wherein n is from 1 to 50 amino acids and wherein the sequence Xi may comprise the same or different amino acids selected from any amino acid residue;
X
1 7 is L, I, V, M, A or P;
X
1 8 is any amino acid;
X
1 9 is any amino acid;
X
20 is L, I, V, M, A or P;
X
21 is P;
X
22 is L, I, V, M, A, P or G;
X
23 is P or N; [Xj]n is a sequence of n amino acids wherein n is from 0 to 50 amino acids and wherein the Xj may comprise the same or different amino acids selected from any amino acid residue;
X
24 is L, I, V, M, A or P;
X
25 is any amino acid;
X
26 is any amino acid;
X
27 is Y or F;
X
28 is L, I, V, M, A or P.
Pk0PER\Ejhhijhhdiu siw.10014 ,1 ddoc-131122 -18- Preferably, the SOCS protein-encoding genetic sequence comprises a nucleotide sequence mc substantially as set forth in SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5 or SEQ ID NO:7 or a nucleotide sequence having at least 60% similarity thereto or a nucleotide sequence capable of hybridizing to SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5 or SEQ ID NO:7 or its complementary form under low stringency conditions at 42 0 C. Even more preferably, the SOCS protein in a human homolog of the nucleotide sequence set forth in SEQ ID SNO: 1, SEQ ID NO:3, SEQ ID NO:5 or SEQ ID NO:7.
The term "similarity" as used herein includes exact identity between compared sequences at the nucleotide or amino acid level. Where there is non-identity at the nucleotide level, "similarity" includes differences between sequences which result in different amino acids that are nevertheless related to each other at the structural, functional, biochemical and/or conformational levels. Where there is non-identity at the amino acid level, "similarity" includes amino acids that are nevertheless related to each other at the structural, functional, biochemical and/or conformational levels. In a particularly preferred embodiment, nucleotide and sequence comparisons are made at the level of identity rather than similarity.
Terms used to describe sequence relationships between two or more polynucleotides or polypeptides include "reference sequence", "comparison window", "sequence similarity", "sequence identity", "percentage of sequence similarity", "percentage of sequence identity", "substantially similar" and "substantial identity". A "reference sequence" is at least 12 but frequently 15 to 18 and often at least 25 or above, such as 30 monomer units, inclusive of nucleotides and amino acid residues, in length. Because two polynucleotides may each comprise a sequence only a portion of the complete polynucleotide sequence) that is similar between the two polynucleotides, and a sequence that is divergent between the two polynucleotides, sequence comparisons between two (or more) polynucleotides are typically performed by comparing sequences of the two polynucleotides over a "comparison window" to identify and compare local regions of sequence similarity. A "comparison window" refers to a conceptual segment of typically 12 contiguous residues that is compared to a reference sequence. The comparison window OPER\Elh\Ejhd lsoali30148361 ~n.d doc- 13/112006 -19may comprise additions or deletions gaps) of about 20% or less as compared to the Cc reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. Optimal alignment of sequences for aligning a comparison window may be conducted by computerized implementations of algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package Release 7.0, Genetics SComputer Group, 575 Science Drive Madison, WI, USA) or by inspection and the best Salignment resulting in the highest percentage homology over the comparison window) generated by any of the various methods selected. Reference also may be made to the BLAST family of programs as, for example, disclosed by Altschul et al. A detailed discussion of sequence analysis can be found in Unit 19.3 of Ausubel et al. The terms "sequence similarity" and "sequence identity" as used herein refers to the extent that sequences are identical or functionally or structurally similar on a nucleotide-bynucleotide basis or an amino acid-by-amino acid basis over a window of comparison.
Thus, a "percentage of sequence identity", for example, is calculated by comparing two optimally aligned sequences over the window of comparison, determining the number of positions at which the identical nucleic acid base A, T, C, G, I) or the identical amino acid residue Ala, Pro, Ser, Thr, Gly, Val, Leu, Ile, Phe, Tyr, Trp, Lys, Arg, His, Asp, Glu, Asn, Gin, Cys and Met) occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison the window size), and multiplying the result by 100 to yield the percentage of sequence identity. For the purposes of the present invention, "sequence identity" will be understood to mean the "match percentage" calculated by the DNASIS computer program (Version 2.5 for windows; available from Hitachi Software engineering Co., Ltd., South San Francisco, California, USA) using standard defaults as used in the reference manual accompanying the software. Similar comments apply in relation to sequence similarity.
Reference herein to a low stringency includes and encompasses from at least about 0 to at least about 15% v/v formamide and from at least about 1 M to at least about 2 M salt for hybridization, and at least about 1 M to at least about 2 M salt for washing conditions.
P \OPER\Eh\Ejhdivsionl>\30148361 imr d doc-13/12/206
NO
S Generally, low stringency is at from about 25-30 0 C to about 42 0 C. The temperature may C be altered and higher temperatures used to replace formamide and/or to give alternative stringency conditions. Alternative stringency conditions may be applied where necessary, such as medium stringency, which includes and encompasses from at least about 16% v/v to at least about 30% v/v formamide and from at least about 0.5 M to at least about 0.9 M t salt for hybridization, and at least about 0.5 M to at least about 0.9 M salt for washing ,O conditions, or high stringency, which includes and encompasses from at least about 31%
O
Sv/v to at least about 50% v/v formamide and from at least about 0.01 M to at least about 0.15 M salt for hybridization, and at least about 0.01 M to at least about 0.15 M salt for washing conditions. In general, washing is carried out Tm 69.3 0.41 However, the Tm of a duplex DNA decreases by 1 C with every increase of 1% in the number of mismatch base pairs Formamide is optional in these hybridization conditions. Accordingly, particularly preferred levels of stringency are defined as follows: low stringency is 6 x SSC buffer, 0.1% w/v SDS at 25-42 0 C; a moderate stringency is 2 x SSC buffer, 0.1% w/v SDS at a temperature in the range 20 0 C to 65 0 C; high stringency is 0.1 x SSC buffer, 0.1% w/v SDS at a temperature of at least 65 0
C.
Most preferably, an expression vector is administered capable of expressing high levels of a SOCS gene.
Another aspect of the present invention contemplates a method for the treatment of cytokine-mediated disease in an animal, said method comprising modulating cytokine or hormone signalling in an animal by up-regulating the expression of a genetic sequence encoding a SOCS protein or its derivative or homolog in said animal.
In accordance with the this and other aspects of the present invention, the expression of a genetic sequence encoding a SOCS protein is preferably up-regulated by the administration to the animal of an expression vector comprising a SOCS gene.
The present invention contemplates a range of derivatives of the SOCS molecule.
P:\OPER\Ejh\Ejh\divisionmls30148361 mrad doc-13/12/2006 0 -21- A "derivative" includes a part, portion or fragment thereof such as a molecule comprising a C single or multiple amino acid substitution, deletion and/or addition. A "homolog" includes a functionally similar molecule from either the same species or another species.
Other derivatives contemplated by the present invention include a range of glycosylation variants from a completely unglycosylated molecule to a modified I\ glycosylated molecule. Altered glycosylation patterns may result from expression of Srecombinant molecules in different host cells.
The present invention provides, therefore, the genetic control of SOCS levels in animals in the treatment of a range of physiological conditions. Preferably, the level of SOCS protein is increased by the administration of an expression vector comprising the SOCS gene.
Preferably, the expression vector is a viral vector, such as an adenovirus, adeno-associated virus (AAV) or retrovirus, although other vectors, including plasmid-based vectors, are contemplated.
Preferably, the genetic sequence encoding a SOCS protein is the SOCS-1 genetic sequence encoding the SOCS-1 protein.
For example, compositions comprising antisense RNA or sense or antisense DNA, ribozymes or sense molecules (for co-suppression) may be administered either locally or systemically to manipulate expression of SOCS genes or translation of SOCS mRNA.
The present invention is further described by the following non-limiting Examples.
P \PER\Ejh\EjhdlivsionIls\30148361 mrad dao.13/12/206
IO
0 -22- EXAMPLE 1 C Construction of recombinant Adenovirus for expression of selected SOCS proteins Recombinant human adenovirus type 5 expressing selected SOCS proteins (for analysis in t mouse models of disease mouse SOCS proteins are preferable) are generated following C\ recombination between an adenovirus shuttle vector, into which a SOCS encoding cDNA Shas been cloned, and a mutant adenovirus. The El region has been deleted in the mutant adenovirus rendering it incapable of replication except in a packaging cell line that complements the defect (for example, human 293 cells expressing viral ElA and E1B proteins). Recombination, and subsequent selection of recombinants, can be carried out in the packaging cell line but a bacterial system, referred to as the pAdEasy system is preferred (6) The pAdEasy system is used to generate recombinant adenovirus expressing murine SOCS proteins by the following means.
Murine SOCS-1 cDNA is amplified by the polymerase chain reaction (PCR), using the following primer set: 5' primer ATATCTCGAGGCCACCATGGTAGCACGCAACCAGG [SEQ ID NO: 3' primer ATATAAGCTTTCAGATCTGGAAGGGGAAGG [SEQ ID The 5' primer contains a Kozak sequence and a XhoI restriction site, while the 3' primer contains a HindIII restriction site.
Murine SOCS-2 cDNA is amplified by PCR, using the following primer set: 5' primer ATATGCGGCCGCGCCACCATGACCCTGCGGTGCCT [SEQ ID NO:11]; 3' primer ATATTCTAGATTATACCTGGAATTTATATTCTTCC [SEQ ID NO:12]. The 5' primer contains a Kozak sequence and a NotI restriction site, and the 3' primer contains a XbaI restriction site.
Murine SOCS-3 cDNA was amplified by PCR, using the following primer set: 5' primer TATAGCGGCCGCGCCACCATGGTCACCCACAGCAA [SEQ ID NO:13]; 3' primer P IOPEREjhTlhiim&Is\I314R361 mrd dmlI 3/1212OD6 0 -23- ATATAAGCTTTTAAAGTGGAGCATCATACTA [SEQ ID NO:14]. The 5' primer contains a C Kozak sequence and a NotI restriction site, and the 3' primer contains a HindIII restriction site.
All three SOCS genes are amplified under the same PCR conditions: one cycle at 96 0 C for i 2 mins then 35 cycles of 96 0 C for 10 seconds, 55 C for 10 seconds and 72 0 C for 1 minute.
(NO
SPCR products are cloned into the adenovirus shuttle vector, pShuttle-CMV, by standard ligation reactions. Generation of recombinant adenovirus plasmids by homologous recombination is then carried out in the E.coli strain BJ5183 1 g of pShuttle-CMV (containing selected SOCS gene) was linearized with PmeI restriction enzyme and purified with a DNA purification kit (Qiagen), then mixed with 100 ng of the adenovirus backbone plasmid, pAdEasy-1. The DNA was then electroporated into E.coli BJ5183, which was then plated out onto LB-agar plates containing 30 utg/ml of kanamycin and left at 37 0 C for 18 hrs. The smallest colonies were picked and grown in 2 ml LB broth containing 30 p.g/ml of kanamycin and placed at 37 0 C for 8 hrs. Adenovirus plasmid DNA was extracted from each culture and was screened for the presence of recombinant adenoviral DNA by restriction enzyme digestion in comparison with pAdEasy-1. Direct sequencing of the recombinant adenovirus DNA clones confirmed the presence of SOCS encoding sequence.
Production of recombinant adenovirus for in vivo studies is carried out in 293 cells (viral El transformed). 93 cells are cultured in 25cm 2 flasks, in OptiMEM media (Gibco BRL), at 37°C and 10% CO 2 until they are 70% confluent. 4 tg of recombinant adenovirus, digested with the Pad restriction enzyme, is transfected into 293 cells with Lipofectamine (Gibco-BRL), according to the manufacturer's instructions. Cells are left for 7-10 days and then harvested by scrapping cells off the bottom of the flask into PBS. Cells are subjected to 5 cycles of a freeze/thawing, and the supernatant can then be used to infect more 293 cells to build up viral stocks. Cell lysis should be evident in the majority of cells approximately 3 days post infection, and should be harvested as described above.
P \OPER\Eh\EhW,,,.iwonl\301481 -addoc3/121206 -24- STo purify the recombinant adenovirus, the infected 293 cells are harvested and spun at ¢C 7000 g 4°C for 10 minutes. The supernatant is discarded and the cells are resuspended in of PBS and subject to 5 cycles of a freeze/thawing. The recombinant adenovirus is _then purified through a CsCI gradient, comprising two layers of 1.5 ml and 2.5 ml at densities of 1.45 g/ml and 1.25 g/ml respectively. The CsCI is made-up in 5 mM Tris Cl, 1 tt mM EDTA pH 7.8. The CsCI gradient containing the recombinant adenovirus is spun at \90,000 g for 2 hrs and the virus fraction collected with a 19-gauge needle.
The adenovirus is subject to a second round of CsCI purification. The adenovirus is diluted in CsCI solution at a density of 1.33 g/ml and centrifuged at 105 g for 18 hrs. The adenovirus is recovered with a 19-gauge needle and then placed through a G-25 Sephadex column (Amersham) and the virus fractions collected in PBS containing 10% glycerol. The recombinant adenovirus can then be stored at -70 0 C until ready for use.
EXAMPLE 2 Adenovirus expressing SOCS-1 have a beneficial therapeutic effect in a mouse model of rheumatoid arthritis Collagen-induced arthritis (CIA) is a model of chronic arthritis that is induced following intradermal immunization of mice with collagen in Complete Freund's Adjuvant. It affects articular joints and is characterized by synovial hyperplasia and inflammation, pannus formation and progressive cartilage and bone degradation. The importance of individual cytokines such as GM-CSF and TNFca in CIA has been extensively studied by antibody neutralisation in vivo over the course of disease or by initiating disease in cytokine gene knockout mice.
For induction of CIA, type II collagen (of bovine or chick origin for example) is dissolved to a concentration of 2 mg/ml in 10 mM acetic acid (overnight at 4°C) then emulsified in an equal volume of Complete Freunds Adjuvant. Male DBA/I mice are injected intradermally at several sights into the base of the tail with a total of 100 microliters of the emulsion containing 100 micrograms of collagen. On day 21 mice are given an P:\oPEREjh\Ejhhdidisimelf,301461 =asd dm13112/20
IO
intraperitoneal booster injection of 100 microgram of type II collagen dissolved in ¢C phosphate buffered saline with onset of arthritis occurring at around day 25-28.
SJust prior to expected onset of CIA, mice are scored visually for appearance of arthritis.
C¢€
Mice without macroscopic signs of arthritis in their paws are selected for treatment groups.
t Alternatively, to study the impact of treatment on existing disease, mice can be left for \O longer and those that develop overt arthritis selected for treatment groups.
O
For treatment selected mice are anaesthetized and a small incision in the skin of the knee joint is performed for the intra-articular injection procedure. Intra-articular injection is performed with 107/6 microlitre of either a SOCS-1 (or other SOCS protein) expressing or an empty or P-galactosidase expressing control recombinant adenovirus. At days 1, 5, and 20 after treatment mice are sacrificed and the skin of the knee joint removed. The appearance of arthritis was assessed and severity score was recorded as per routine methods described elsewhere For histological assessment whole knee joints are removed, fixed, decalcified and paraffin embedded. Tissue sections are stained with hematoxylin and eosin and evaluated without knowledge of the treatment groups.
Histological changes can be scored according to standard methods. For example, infiltration of cells is scored on a scale of 0-3, depending on the amount of inflammatory cells in the synovial cavity (exudate) and synovial tissue (infiltrate). A characteristic parameter in CIA is the progressive loss of bone. This destruction can be graded on a scale of 0-3, ranging from no damage to complete loss of bone structure. Additional analysis may encompass, for example, immunohistological determination of other cell surface/tissue specific markers of disease progression and severity.
Over-expression of SOCS-1 (or other selected SOCS proteins) within the joint may decrease both incidence and severity of CIA and this may be reflected in histological analysis where cellular accumulation within the joint and/or the level of bone and cartilage destruction is significantly ameliorated.
PAOPpERelhhejhdini-m.1U01U .r8 d doc-13/11206 -26- EXAMPLE 3 CAnalysis of arthritis in an animal model demonstrates a regulatory role for SOCS-1 and supports the use of SOCS-based gene therapy for the treatment of human inflammatory disease i Genetically modified mice with a targeted deletion of the SOCS-1 gene (SOCS-1"') die 0 within 3 weeks of birth. The primary mediator of this lethal phenotype is interferon-y.
O SOCS-1 1' animals crossed onto an IFN-y"' background survive as do SOCS-1'" treated with an antibody that inhibits IFN-y activity. SOCS-1"'IFN-y mice are ideal for studying the role of SOCS-1 in the development of various disease pathologies. In the present example, the role of SOCS-1 in regulating the activity of the pro-inflammatory cytokines responsibe for the development of arthritis was assessed.
SOCS-1 IFN-y- and SOCS-1-' IFN-y"' mice were anaesthetiZed and injected intraarticularly into the knee joint with 10 1l of a 20 mg/ml solution of methylated bovine serum albumin (mBSA). At the same time, mice were also injected with 250 ng recombinant human IL-Ip subcutaneously into the rear footpad. The IL-1 injection was repeated on the next 2 days. The mice were sacrificed on day 7 and the knee joints fixed in v/v neutral buffered formalin for at least 2 days, decalcified and embedded in paraffin. Frontal sections of the knee joints were cut at 4 depths, approximately 100 pm apart and stained with haemotoxylin and eosin.
Assessment of arthritis: Joint pathology was assessed in a blinded manner and 5 parameters of arthritis were graded for severity from 0 (normal) to 5 (severe). Exudate was scored according to the presence and relative numbers of inflammatory cells and fibrin-like debris in the joint space.
Synovitis was defined as thickening of the synovial lining layer and soft tissue inflammation in the infrapatellar fat pad, joint capsule and the area adjacent to the periosteal sheath. Pannus was defined as the encroachment of hyperplastic synovium over the articular surface or at the cartilage-bone junction. Cartilage degradation was evaluated PNOPER Ejh\EjhhdivIwiM&0048361 ukddoc13/12/2006 -27- Son patellofemoral and tibiofemoral articular surfaces. Bone degradation was evaluated as ¢C the extent and depth of subchondral and periosteal bone erosion. The Mann-Whitney 2sample rank test was used to compare mean histologic scores of test and control groups.
The results demonstrate a role for SOCS-1 in down-regulating/controlling the development tt of arthritis, in this model of the disease. SOCS-1'"IFN-y"' animals develop more severe 0 arthritis than control SOCS-1 IFN-y" animals (Figure The severity of the disease in Sthe SOCS-1 animals was identical to that routinely observed in wildtype controls (not shown) indicating that the lack of functional SOCS-1 and not INF-y was responsible for the exacerbation in disease phenotype. Given the clearly demonstrated role for SOCS-1 in the negative regulation of cytokine signalling it is assumed that the exacerbation of disease is the result of the increased activity of proinflammatory cytokines. Overexpression of SOCS-1, following SOCS-1 based gene therapy would inhibit proinflammatory cytokine activity and thus ameliorate disease pathology.
The results are shown in tabular form in Table 1 and graphically in Figure 1.
Those skilled in the art will appreciate that the invention described herein is susceptible to variations and modifications other than those specifically described. It is to be understood that the invention includes all such variations and modifications. The invention also includes all of the steps, features, compositions and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations of any two or more of said steps or features.
P:NPEREjhjh'i~iimasUO4831 -doc.13/lV2006 28 TABLE 1 Exudate Synovitis Pannus Cartilage loss Bone loss 2980 2981 2982 2983 2984 2985 3 3.33 3 3 3 3.25 3.75 4.67 4 3.75 3 3.5 2.5 2.33 3.25 3 2.5 2 2.5 2 2.5 2.5 2.75 1.25 2.5 1.67 3.25 2.75 2 14.25 14 16 13.25 11 Average Std.
Dev.
3.096666667 0.062003584 3 .77833333 0.22576413 2986 2987 2988 2989 2990 2991 2992 2993 2994 2995 2.25 3 2 4 3.75 2.5 3 2 2.75 3 2.59666667 0.18577 166 1.25 3 1.75 2.75 1.75 2.75 2 2 2.75 1.75 2.25 0.2236068 2.195 0.32943133 2.25 2 2 1.5 2.5 1.25 2 1.5 1.25 2.75 1.25 2 2 2 1.75 1.5 1.5 13 .9166667 0.69721669 7.75 13 8 12.75 11 11.25 10.5 11 9.25 Average 1.8 Std. Dev 0.152752523 2.825 0.2 1424934 2.175 0.18652524 1.7 0. 165 83 124 1.7 0.16 158933 10.2 0.63113654 2996 2997 2998 2999 3000 3001 4.75 4 5 5 4.5 2.5 2.75 2.5 3.5 3.25 3 2 3.25 3 2 Average 3.25 Std. Dev 0.359397644 Ttest 0.000736214 4.29166667 0.3 895332 3 .58333333 0.23 863035 2.83333333 0.22047928 2.95 833 333 0.24509069 16.9 166667 1.3 1286371 0.0028622 0.00038333 0.00099983 00022 00033 0.0005242 0.00013435 P %0ER\Eh\Ej~d--s\304936 -dd=c-13112/2006 -29
BIBLIOGRAPHY
Altschul et al, Nuci. Acids Res. 25:3389. 1997 Ausubel et al, "Current Protocols in Molecular Biology" John Wiley Sons Inc, 1994- 1998, Chapter Bonner and Laskey, Eur. J Biochem. 46: 83, 1974 Campbell et al, Annals. Rheum. Dis. 56: 364-368, 1997 He etal, PNAS 95: 2509-2514, 1998 Marmur and Doty, J Mci. Biol. 5: 109, 1962 Moriata et al, PNAS 97. 5405-54 10, 2000
Claims (13)
1. A method for modulating cytokine or hormone signaling in an animal, said method comprising over-expressing a genetic sequence encoding a SOCS-1 protein in said animal.
2. A method according to claim 1 wherein said method comprises administering an expression vector comprising a SOCS-1 genetic sequence encoding a SOCS-1 protein to said animal.
3. A method according to Claim 2 wherein the expression vector is a viral vector.
4. A method according to claim 3 wherein the viral vector is an adenovirus, adeno- associated virus or retrovirus. A method according to claim 2 wherein the expression vector is a plasmid-based vector.
6. A method according to claim 1 wherein the animal is a human, primate, livestock animal, laboratory test animal or a companion animal.
7. A method according to claim 6 wherein the animal is a human.
8. A method according to claim 1 wherein the hormone is selected from a growth hormone, insulin-like growth factor-I or prolactin.
9. A method according to claim 8 wherein the hormone is growth hormone. A method according to claim 1 wherein the cytokine is an interleukin, tumor necrosis factor, a colony stimulating factor or an interferon. P:\OPEREh\Ejhdimnals\301 48361 )amd.doc. 1312/2006 -31-
11. A method according to any one of claims 1 to 10 wherein said SOCS-1 protein is C human SOCS-1, murine SOCS-1 or rat SOCS-1. _12. A method according to any one of claims 1 to 10 wherein said genetic sequence comprises a nucleotide sequence set forth in SEQ ID NO: 1, SEQ ID NO: 5 or SEQ ID NO: 7 or a nucleotide sequence capable of hybridizing to SEQ ID NO: 1, SEQ ID NO: 5 or 0 SEQ ID NO: 7 or their complements under high stringency conditions.
13. A method according to claim 12 wherein said genetic sequence comprises the nucleotide sequence of SEQ ID NO: 1.
14. A method according to any one of claims 1 to 10 wherein said SOCS-1 protein comprises an amino acid sequence selected from SEQ ID NO: 2, SEQ ID NO: 6 or SEQ ID NO: 8. A method according to claim 14 wherein said SOCS-1 protein comprises the amino acid sequence of SEQ ID NO: 2.
16. A method according to any one of claims 1 to 15 for the treatment of an inflammatory disease.
17. A method according to claim 16 wherein said inflammatory disease is rheumatoid arthritis.
Applications Claiming Priority (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AUPR0647 | 2000-10-09 | ||
AUPR1942 | 2000-12-07 | ||
AU2001293519 | 2001-10-09 |
Related Parent Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
AU2001293519 Division | 2000-10-09 | 2001-10-09 |
Publications (1)
Publication Number | Publication Date |
---|---|
AU2006252031A1 true AU2006252031A1 (en) | 2007-01-11 |
Family
ID=37649706
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
AU2006252031A Abandoned AU2006252031A1 (en) | 2000-10-09 | 2006-12-13 | Modulating cytokine or hormone signalling in an animal comprising up-regulating the expression of SOCS sequences in the animal |
Country Status (1)
Country | Link |
---|---|
AU (1) | AU2006252031A1 (en) |
-
2006
- 2006-12-13 AU AU2006252031A patent/AU2006252031A1/en not_active Abandoned
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Sime et al. | Adenovector-mediated gene transfer of active transforming growth factor-beta1 induces prolonged severe fibrosis in rat lung. | |
Akassoglou et al. | Astrocyte-specific but not neuron-specific transmembrane TNF triggers inflammation and degeneration in the central nervous system of transgenic mice. | |
JP3859703B2 (en) | Novel growth / differentiation factors of the TGF-β family | |
Müller et al. | Transgenic pigs carrying cDNA copies encoding the murine Mx1 protein which confers resistance to influenza virus infection | |
JP4411330B2 (en) | Tumor necrosis factor-related ligand | |
Renkawitz et al. | Expression of a chicken lysozyme recombinant gene is regulated by progesterone and dexamethasone after microinjection into oviduct cells | |
AU1074495A (en) | Translational enhancer dna | |
CA2182958A1 (en) | Mammal with enhanced liver expression of a transgene | |
TW200536859A (en) | Gastrointestinal proliferative factor and uses thereof | |
US20080009447A1 (en) | Modulating cytokine or hormone signalling in an animal comprising up-regulating the expression of SOCS sequence in the animal | |
Howes et al. | Photoreceptor cell tumors in transgenic mice. | |
KR20080032139A (en) | Protein preparation containing s1-5 | |
WO2008024919A9 (en) | Interferon antagonists, antibodies thereto, and associated methods of use | |
JPWO2003042387A1 (en) | Novel hair keratin-associated protein | |
JPH08508409A (en) | Mutant insulin-like growth factor I receptor subunits and methods of using them | |
McHenry et al. | Overexpression of fra-2 in transgenic mice perturbs normal eye development | |
AU2006252031A1 (en) | Modulating cytokine or hormone signalling in an animal comprising up-regulating the expression of SOCS sequences in the animal | |
EP2128261A1 (en) | A recombinant adenovirus comprising recombinant khp50 gene and preparation method and uses thereof | |
JPH08509863A (en) | Human C / EBP gene and vector for its expression | |
WO1998033819A9 (en) | Cellular receptors for subgroup c adenoviruses and group b coxsackieviruses | |
AU2001293519A1 (en) | Modulating cytokine or hormone signalling in an animal comprising up-regulating the expression of SOCS sequence in the animal | |
WO1998033819A1 (en) | Cellular receptors for subgroup c adenoviruses and group b coxsackieviruses | |
JPH09510357A (en) | Recombinant adenovirus encoding acidic fibroblast growth factor (aFGF) | |
US6835381B1 (en) | Methods for modulating angiogenesis by using the anti-angiogenic angiotensin-7 and polynucleotides encoding therefor | |
JP2002534077A (en) | Expression of secreted human alpha-fetoprotein in transgenic animals |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
MK4 | Application lapsed section 142(2)(d) - no continuation fee paid for the application |