AU2006230803B2 - Plant genetic sequences associated with vacuolar pH and uses thereof - Google Patents

Description

WO 2006/105598 PCT/AU2006/000451 PLANT GENETIC SEQUENCES ASSOCIATED WITH VACUOLAR PH AND USES THEREOF BACKGROUND OF THE INVENTION 5 FIELD OF THE INVENTION The present invention relates generally to the field of plant molecular biology and agents useful in the manipulation of plant physiological or biochemical properties. More particularly, the present invention provides genetic and proteinaceous agents capable of 10 modulating or altering the level of acidity or alkalinity in a cell, group of cells, organelle, part or reproductive portion of a plant. Even more particularly, the present invention contemplates methods and agents for modulating or altering pH levels in the vacuole of a cell, group of cells, organelle, part or reproductive portion of a plant. The present invention further provides genetically altered plants, plant parts, progeny, subsequent 15 generations and reproductive material including flowers or flowering parts having cells exhibiting an altered vacuolar pH compared to a non-genetically altered plant. The present invention still further provides methods for modulating or altering flower color in a plant. Even more particularly, the present invention provides for down regulation of pH in a plant which results in a bluer color in the plant; especially in the flower 20 DESCRIPTION OF PRIOR ART Reference to any prior art in this specification is not, and should not be taken as, an acknowledgment or any form of suggestion that this prior art forms part of the common 25 general knowledge in any country. Bibliographic details of references provided in the subject specification are listed at the end of the specification. 30 The cut-flower, ornamental and agricultural plant industries strive to develop new and different varieties of plants with features such as novel flower colors, better taste/flavour of WO 2006/105598 PCT/AU2006/000451 -2 fruits (e.g. grapes, apples, lemons, oranges) and berries (e.g. strawberries, blueberries), improved yield, longer life, more nutritious, novel colored seeds for use as proprietary tags, etc. 5 Furthermore, plant byproduct industries which utilize plant parts value novel products which have the potential to impart altered characteristics to their products (e.g. juices, wine) such as, appearance, style, taste, smell and texture. In the cut flower and ornamental plant industries, an effective way to create such novel 10 varieties is through the manipulation of flower color. Classical breeding techniques have been used with some success to produce a wide range of colors for almost all of the commercial varieties of flowers and/or plants available today. This approach has been limited, however, by the constraints of a particular species' gene pool and for this reason it is rare for a single species to have the full spectrum of colored varieties. For example, the 15 development of novel colored varieties of plants or plant parts such as flowers, foliage and stems would offer a significant opportunity in both the cut flower and ornamental markets. In the cut flower or ornamental plant industry, the development of novel colored varieties of major flowering species such as rose, chrysanthemum, tulip, lily, carnation, gerbera, orchid, lisianthus, begonia, torenia, geranium, petunia, nierembergia, pelargonium, iris, 20 impatiens and cyclamen would be of great interest. A more specific example would be the development of a blue rose for the cut flower market. To date, creation of a "true" blue shade in cut flowers has proven to be extremely difficult. Success in creating colors in the "blue" range has provided a series of purple colored 25 carnation flowers (see the website for FlorigenePty Ltd, Melbourne, Australia) (International Patent Application PCT/AU96/00296). These are now on the market in several countries around the world. There is a need, however, to generate altered flower colors in other species in addition to bluer colors in carnation and other cut flower species such as rose, gerbera and chysanthemum. It is apparent that other plants have been 30 recalcitrant to genetic manipulation of flower color due to certain physiological characteristics of the cells. One such physiological characteristics is vacuolar pH.

WO 2006/105598 PCT/AU2006/000451 -3 In all living cells, the pH of the cytoplasm is about neutral, whereas in the vacuoles and lysosomes an acidic environment is maintained. The H+-gradient across the vacuolar membrane is a driving force that enables various antiporters and symporters to transport 5 compounds across the vacuolar membrane. The acidification of the vacuolar lumen is an active process. Physiological work indicated that two proton pumps, a vacuolar H+ pumping ATPase (vATPase) and a vacuolar pyrophosphatase (V-PPase), are involved in vacuolar acidification. 10 Vacuoles have many different functions and different types of vacuoles may perform these different functions. The existence of different vacuoles also opens complementary questions about vacuole generation and control of the vacuolar content. The studies devoted to finding an answer to 15 this question are complicated by the fact that isolation and evacuolation of cells (protoplast isolation and culture) induces stress that results in changes in the nature of the vacuolar environment and content. Mutants in which the process of vacuolar genesis and/or the control of the internal 20 vacuolar environment are affected are highly valuable to allow the study of these phenomena in intact cells in the original tissue. Mutants of this type are not well described in the literature. This has hampered research in this area. Flower color is predominantly due to three types of pigment: flavonoids, carotenoids and 25 betalains. Of the three, the flavonoids are the most common and contribute a range of colors from yellow to red to blue. The flavonoid pigments are secondary metabolites of the phenylpropanoid pathway. The biosynthetic pathway for the flavonoid pigments (flavonoid pathway) is well established, (Holton and Cornish, Plant Cell 7:1071-1083, 1995; Mol et al, Trends Plant Sci. 3: 212-217, 1998; Winkel-Shirley, Plant Physiol. 126:485-493, 30 2001a; Winkel-Shirley, Plant Physiol. 127:1399-1404, 2001b, Tanaka et al, Plant Cell, WO 2006/105598 PCT/AU2006/000451 -4 Tissue and Organ Culture 80 (1):1-24, 2005, Koes et al. Trends in Plant Science, May 2005). The flavonoid molecules that make the major contribution to flower or fruit color are the 5 anthocyanins, which are glycosylated derivatives of anthocyanidins. Anthocyanins are generally localized in the vacuole of the epidermal cells of petals or fruits or the vacuole of the sub epidermal cells of leaves. Anthocyanins can be further modified through the addition of glycosyl groups, acyl groups and methyl groups. The final visible color of a flower or fruit is generally a combination of a number of factors including the type of 10 anthocyanin accumulating, modifications to the anthocyanidin molecule, co-pigmentation with other flavonoids such as flavonols and flavones, complexation with metal ions and the pH of the vacuole. The vacuolar pH is a factor in anthocyanin stability and color. Although a neutral to 15 alkaline pH generally yields bluer anthocyanidin colors, these molecules are less stable at this pH. Vacuoles, occupy a large part of the plant cell volume and play a crucial role in the maintenance of cell homeostasis. In mature cells, these organelles can approach 90% of 20 the total cell volume, can store a large variety of molecules (ions, organic acids, sugar, enzymes, storage proteins and different types of secondary metabolites) and serve as reservoirs of protons and other metabolically important ions. Different transporters on the membrane of the vacuoles regulate the accumulation of solutes in this compartment and drive the accumulation of water producing the turgor of the cell. These structurally simple 25 organelles play a wide range of essential roles in the life of a plant and this requires their internal environment to be tightly regulated. There is a need to be able to manipulate vacuolar pH in plant cells and organelles in order to generate desired flower colors. 30 WO 2006/105598 PCT/AU2006/000451 -5 SUMMARY OF THE INVENTION Throughout this specification, unless the context requires otherwise, the word "comprise", or variations such as "comprises" or "comprising", will be understood to imply the 5 inclusion of a stated element or integer or group of elements or integers but not the exclusion of any other element or integer or group of elements or integers. Nucleotide and amino acid sequences are referred to by a sequence identifier number (SEQ ID NO:). The SEQ ID NOs: correspond numerically to the sequence identifiers <400>1 10 (SEQ ID NO:1), <400>2 (SEQ ID NO:2), etc. A summary of the sequence identifiers is provided in Table 1. A sequence listing is provided after the claims. The present invention provides a novel nucleic acid molecule encoding a polypeptide having pH modulating or altering activity and to the use of the nucleic acid molecules 15 and/or corresponding polypeptides to generate genetic agents or constructs or other molecules which manipulate vacuolar pH in a cell, groups of cells, organelles, parts or reproductions of a plant. Manipulation of the pH pathway, and optionally, together with manipulation of the anthocyanin pathway provides a powerful technique to generate novel colors or traits, especially in carnation and rose. 20 Accordingly, the present invention provides genetic agents and proteinaceous agents which increase or decrease the level of acidity or alkalinity in the vacuole of a plant cell. The ability to alter pH of the vacuole enables manipulation of flower color. The agents include nucleic acid molecules such as cDNA and genomic DNA or parts or fragments thereof, 25 antisense, sense or RNAi molecules or complexes comprising same, ribozymes, peptides and proteins. The present invention further provides a nucleic acid comprising a sequence of nucleotides encoding or complementary to a sequence encoding a protein which exhibits a direct or 30 indirect effect on vacuolar pH.

WO 2006/105598 PCT/AU2006/000451 -6 The present invention enables, therefore, levels of expression of the subject nucleic acid molecules to be manipulated or to introduce the nucleic acid to a plant cell in order to alter vacuolar pH. This in turn permits flower color or taste or other characteristics to be manipulated. 5 The present invention provides, therefore, genetically modified plants exhibiting altered flower color or taste or other characteristics. Reference to genetically modified plants exhibiting altered flower color or taste or other characteristics. Reference to genetically modified plants includes the first generation plant or plantlet as well as progeny and 10 subsequent generations of the plant. Reference to a "plant" includes reference to plant parts including reproductive portions, seeds, flowers, stems, leaves, stalks, pollen and germ plasm, callus including immature and mature callus. A particularly preferred aspect of the present invention relates to down regulation of the 15 pH modulating or altering genetic and proteinaceous agents capable of modulating or altering the level of acidity or alkalinity, leading to an increase in vacuolar pH in a plant, resulting in bluer colored flowers in said plant. The present invention further contemplates cut flowers including severed stems containing 20 flowers of the genetically altered plants or their progeny in isolated form or packaged for sale or arranged on display.

WO 2006/105598 PCT/AU2006/000451 -7 A summary of sequence identifiers used throughout the subject specification is provided in Table 1: TABLE 1 5 Summary of sequence identifiers SEQ ID NO: Sequence name Type of sequence Description 1 MAC F55.nt nucleotide PPM1 cDNA clone 2 MAC F55.aa amino acid translation of PPM1 cDNA 3 MAC 9F1.nt nucleotide 4 MAC 9F1.aa amino acid 5 CAC16.5.nt nucleotide 6 CAC 16.5.aa amino acid 7 Mse Al nucleotide primer 8 MseA2 nucleotide primer 9 mse+O nucleotide primer 10 Mse+A nucleotide primer 11 Mse+C nucleotide primer 12 Mse+G nucleotide primer 13 Mse+T nucleotide primer 14 Eco+A1 nucleotide primer 15 Eco+A2 nucleotide primer 16 Eco+A nucleotide primer 17 Eco+C nucleotide primer 18 Eco+G nucleotide primer 19 Eco+T nucleotide primer 20 Mse+AA nucleotide primer 21 Mse+AC nucleotide primer 22 Mse+AG nucleotide primer 23 Mse+AT nucleotide primer 24 Mse+CA nucleotide primer 25 Mse+CC nucleotide primer 26 Mse+CG nucleotide primer 27 Mse+CT nucleotide primer 28 Mse+GA nucleotide primer WO 2006/105598 PCT/AU2006/000451 -8 SEQ ID NO: Sequence name Type of sequence Description 29 Mse+GC nucleotide primer 30 Mse+GG nucleotide primer 31 Mse+GT nucleotide primer 32 Mse+TA nucleotide primer 33 Mse+TC nucleotide primer 34 Mse+TG nucleotide primer 35 Mse+TT nucleotide primer 36 Eco+AA nucleotide primer 37 Eco+AC nucleotide primer 38 Eco+AG nucleotide primer 39 Eco+AT nucleotide primer 40 Eco+CA nucleotide primer 41 Eco+CC nucleotide primer 42 Eco+CG nucleotide primer 43 Eco+CT nucleotide primer 44 Eco+GA nucleotide primer 45 Eco+GC nucleotide primer 46 Eco+GG nucleotide primer 47 Eco+GT nucleotide primer 48 Eco+TA nucleotide primer 49 Eco+TC nucleotide primer 50 Eco+TG nucleotide primer 51 Eco+TT nucleotide primer 52 1702 nucleotide primer 53 1703 nucleotide primer 54 1741 nucleotide primer 55 1742 nucleotide primer 56 1750 nucleotide primer 57 1788 nucleotide primer 58 1789 nucleotide primer 59 1812 nucleotide primer 60 1831 nucleotide primer 61 1832 nucleotide primer 62 1847 nucleotide primer 63 1848 nucleotide primer WO 2006/105598 PCT/AU2006/000451 -9 SEQ ID NO: Sequence name Type of sequence Description 64 1861 nucleotide primer 65 1864 nucleotide primer 66 1885 nucleotide primer 67 1886 nucleotide primer 68 1956 nucleotide primer 69 2035 nucleotide primer 70 2037 nucleotide primer 71 2038 nucleotide primer 72 2039 nucleotide primer 73 2040 nucleotide primer 74 2073 nucleotide primer 75 2075 nucleotide primer 76 2078 nucleotide primer 77 2123 nucleotide primer 78 2124 nucleotide primer 79 2196 nucleotide primer 80 2270 nucleotide primer 81 2271 nucleotide primer 82 1706 nucleotide primer 83 1707 nucleotide primer 84 1743 nucleotide primer 85 1768 nucleotide primer 86 1876 nucleotide primer 87 1877 nucleotide primer 88 1878 nucleotide primer 89 2061 nucleotide primer 90 2101 nucleotide primer 91 2178 nucleotide primer 92 1654 nucleotide primer 93 1655 nucleotide primer 94 1769 nucleotide primer 95 1770 nucleotide primer 96 1870 nucleotide primer 97 1871 nucleotide Primer 98 1-2contig.fa nucleotide Rose PPM1 homologue cDNA WO 2006/105598 PCT/AU2006/000451 -10 SEQ ID NO: Sequence name Type of sequence Description 99 amino acid Translation of Rose PPM1 homologue 1-2protein.fa cDNA 100 #2124: 5' nucleotide primer 101 #2078: 5' nucleotide primer WO 2006/105598 PCT/AU2006/000451 - 11 BRIEF DESCRIPTION OF THE FIGURES Figure 1 is a diagrammatical representation of replicon pK7GWIWG2(I) PPM1-1 10639bp. 5 Figure 2 is a diagrammatical representation of replicon pK7GWIWG2(I) PPM1-2 1171bp. Figure 3 is a diagrammatical representation of replicon pK7GWIWG2(I) MAC9F1 10801bp. 10 Figure 4 is a diagrammatical representation of replicon pK7GWIWG2(I) CAC16.5 10763bp. Figure 5 is a photographic representation of an autoradiograph of a Southern blot probed 15 with 32 P-labelled Rose PPM1 fragment. Each lane contained 10pjg of DNA digested with EcoRI. Washing conditions were: twice in 6xSSC/1%SDS at 50 0 C for 1 hour. Lanes contain DNA from: M: markers, 1:Anemone , 2:Carnation, 3:Chrysanthemum, 4: Gerbera, 5:Hyacinth, 6:Iris, 7:Liatrus, 8:Pansy (Viola), 9:Petunia, 10:Nierembergia, 11:Rose, 12:Tobacco 20 Figure 6 is a photographic representation of an autoradiograph of a Southern blot probed with 32 P-labelled Petunia CAC16.5 fragment. Each lane contained 1O g of DNA digested with EcoRI. Washing conditions were: 6xSSC/1%SDS at 50 0 C for 30 mins. Lanes contain DNA from: M: markers, 1:Anemone , 2:Carnation, 3:Chrysanthemum, 4: Gerbera, 25 5:Hyacinth, 6:Iris, 7:Liatrus, 8:Pansy (Viola), 9:Petunia, 10:Nierembergia, 11:Rose, 12:Tobacco Figure 7 is a photographic representation of an autoradiograph of a Southern blot probed with 32 P-labelled Petunia MAC9F 1 fragment. Each lane contained 10pg of DNA digested 30 with EcoRI. Washing conditions were: 6xSSC/1%SDS at 50 0 C for 30 mins. Lanes contain DNA from: M: markers, 1:Anemone , 2:Carnation, 3:Chrysanthemum, 4: Gerbera, WO 2006/105598 PCT/AU2006/000451 -12 5:Hyacinth, 6:Iris, 7:Liatrus, 8:Pansy (Viola), 9:Petunia, 10:Nierembergia, 11:Rose, 12:Tobacco Figure 8 is a diagrammatical representation of replicon pBinPLUS. 5 Figure 9 is a diagrammatical representation of replicon pBluescript. Figure 10 is a diagrammatical representation of replicon pCGP1275. 10 Figure 11is a disgrammatical representation of replicon pWTT2132 p. Figure 12 is a diagrammatical representation of replicon pWTT2132 19.5kb Xhol (blunt). Figure 13 is a diagrammatical representation of replicon pBinPLUS 12.3kb KpnI (blunt). 15 Figure 14 is a diagrammatical representation of replicon pWTT2132. Figure 15 is a diagrammatical representation of replicon pCGP2355 26.8kb HincIl (blunt). 20 Figure 16 is a diagrammatical representation of replicon pRTppoptcAFP EcoRI/XbaI 3.3kb. Figure 17 is a diagrammatical representation of replicon pCGP2756 3.3kb. 25 Figure 18 is a diagrammatical representation of replicon pWTT2132 19.5kb PstI. Figure 19 is a diagrammatical representation of replicon pBinPLUS 12.3kb HindIl. Figure 20 is a diagrammatical representation of replicaon pCGP2355 26.8kb HinclI 30 (blunt).

WO 2006/105598 PCT/AU2006/000451 - 13 DETAILED DESCRIPTION OF THE INVENTION In accordance with the present invention, nucleic acid sequences encoding polypeptides having pH modulating or altering activities have been identified, cloned and assessed. The 5 recombinant genetic sequences of the present invention permit the modulation of expression of genes or nucleic acids encoding pH modulating or altering activities by, for example, de novo expression, over-expression, sense suppression, antisense inhibition, ribozyme, minizyme and DNAzyme activity, RNAi-induction or methylation-induction or other transcriptional or post-transcriptional silencing activities. RNAi-induction includes 10 genetic molecules such as hairpin, short double stranded DNA or RNA, and partially double stranded DNAs or RNAs with one or two single stranded nucleotide over hangs. The ability to control vacuolar pH in plants thereby enables the manipulation of petal color in response to pH change. Moreover, the present invention extends to plants and reproductive or vegetative parts thereof including flowers, fruits, seeds, vegetables, leaves, 15 stems and the like. The present invention further extends to ornamental transgenic or genetically modified plants. The term "transgenic" also includes progeny plants and plants from subsequent genetic manipulation and/or crosses thereof from the primary transgenic plants. 20 Accordingly, one aspect of the present invention provides an isolated nucleic acid molecule comprising a sequence of nucleotides encoding or complementary to a sequence encoding a pH modulating or altering gene or a polypeptide having pH modulating or altering activity wherein expression of said nucleic acid molecule alters or modulates pH inside the cell or vacuole. 25 Preferably the nucleic acid of the present invention modulates vacuolar pH. Another aspect of the present invention contemplates an isolated nucleic acid molecule comprising a sequence of nucleotides encoding or complementary to a sequence encoding 30 a pH modulating or altering gene operably linked to a nucleic acid sequence comprising a WO 2006/105598 PCT/AU2006/000451 - 14 sequence of nucleotides encoding or complementary to a sequence encoding an anthocyanin pathway gene. By the term "nucleic acid molecule" is meant a genetic sequence in a non-naturally 5 occurring condition. Generally, this means isolated away from its natural state or synthesized or derived in a non-naturally-occurring environment. More specifically, it includes nucleic acid molecules formed or maintained in vitro, including genomic DNA fragments recombinant or synthetic molecules and nucleic acids in combination with heterologous nucleic acids. It also extends to the genomic DNA or cDNA or part thereof 10 encoding F3'5'H or a part thereof in reverse orientation relative to its own or another promoter. It further extends to naturally occurring sequences following at least a partial purification relative to other nucleic acid sequences. The term "genetic sequences" is used herein in its most general sense and encompasses 15 any contiguous series of nucleotide bases specifying directly, or via a complementary series of bases, a sequence of amino acids in a pH modulating protein. Such a sequence of amino acids may constitute a full-length pH modulating or altering enzyme such as is set forth in SEQ ID NO: 2, 4 or 6 or an amino acid sequence having at least 50% similarity thereto such as SEQ ID NO: 99, or an active truncated form thereof or may correspond to a 20 particular region such as an N-terminal, C-terminal or internal portion of the enzyme. A genetic sequence may also be referred to as a sequence of nucleotides or a nucleotide sequence and includes a recombinant fusion of two or more sequences. In accordance with the above aspects of the present invention there is provided a nucleic 25 acid molecule comprising a nucleotide sequence or complementary nucleotide sequence substantially as set forth in SEQ ID NO: 1, 3 or 5 or having at least about 50% similarity thereto or capable of hybridizing to the sequence set forth in SEQ ID NO: 1, 3 or 5 under low stringency conditions such as SEQ ID NO: 98. 30 In accordance with the present invention, the anthocyanin pathway genes optionally contemplated to be used in conjunction with the pH modulating or altering nucleic acids, WO 2006/105598 PCT/AU2006/000451 - 15 set forth in SEQ ID NO: 1, 3 or 5 or having at least about 50% similarity thereto or capable of hybridizing to the sequence set forth in SEQ ID NO: 1, 3 or 5 under low stringency conditions, have been previously described in a series of patents and application from the same assignee (including, for example, patents and patent application for the families 5 relating to PCT/AU92/00334; PCTAU96/00296; PCT/AU93/00127; PCT/AU97/00124; PCT/AU93/00387; PCT/AU93/00400; PCT/AU01/00358; PCT/AU03/00079; PCT/AU03/01111; JP 2003-293121) Table 1 provides a summary of the sequence identifiers. 10 Alternative percentage similarities and identities (at the nucleotide or amino acid level) encompassed by the present invention include at least about 60% or at least about 65% or at least about 70% or at least about 75% or at least about 80% or at least about 85% or at least about 90% or above, such as about 95% or about 96% or about 97% or about 98% or 15 about 99%, such as at least about 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%. 20 In a particularly preferred embodiment, there is provided an isolated nucleic acid molecule comprising a nucleotide sequence or complementary nucleotide sequence substantially as set forth in SEQ ID NO: 1, 3 or 5 or having at least about 50% similarity thereto or capable of hybridizing to the sequence set forth in SEQ ID NO: 1, 3 or 5 or complementary strands of either under low stringency conditions, wherein said nucleotide sequence encodes a 25 polypeptide having pH modulating or altering activity. For the purposes of determining the level of stringency to define nucleic acid molecules capable of hybridizing to SEQ ID NO: 1, 3 or 5 reference herein to a low stringency includes and encompasses from at least about 0% to at least about 15% v/v formamide and 30 from at least about 1M to at least about 2 M salt for hybridization, and at least about 1 M to at least about 2 M salt for washing conditions. Generally, low stringency is from about 25- WO 2006/105598 PCT/AU2006/000451 -16 30"C to about 42*C. The temperature may be altered and higher temperatures used to replace the inclusion of formamide and/or to give alternative stringency conditions. Alternative stringency conditions may be applied where necessary, such as medium stringency, which includes and encompasses from at least about 16% v/v to at least about 5 30% v/v formamide and from at least about 0.5 M to at least about 0.9 M salt for hybridization, and at least about 0.5 M to at least about 0.9 M salt for washing conditions, or high stringency, which includes and encompasses from at least about 31% v/v to at least about 50% v/v formamide and from at least about 0.01 M to at least about 0.15 M salt for hybridization, and at least about 0.01 M to at least about 0.15 M salt for washing 10 conditions. In general, washing is carried out Tm = 69.3 + 0.41 (G+C)% (Marmur and Doty, J. Mol. Biol. 5: 109, 1962). However, the Tm of a duplex DNA decreases by 1 0 C with every increase of 1% in the number of mismatch base pairs (Bonner and Laskey, Eur. J. Biochem. 46: 83, 1974). Formamide is optional in these hybridization conditions. Accordingly, particularly preferred levels of stringency are defined as follows: low 15 stringency is 6 x SSC buffer, 1.0% w/v SDS at 25-42*C; a moderate stringency is 2 x SSC buffer, 1.0% w/v SDS at a temperature in the range 20*C to 654C; high stringency is 0.1 x SSC buffer, 0.1% w/v SDS at a temperature of at least 65*C. Another aspect of the present invention provides a nucleic acid molecule comprising a 20 sequence of nucleotides encoding or complementary to a sequence encoding an amino acid sequence substantially as set forth in SEQ ID NO: 2, 4 or.6 or an amino acid sequence having at least about 50% similarity thereto. The term similarity as used herein includes exact identity between compared sequences at 25 the nucleotide or amino acid level. Where there is non-identity at the nucleotide level, similarity includes differences between sequences which result in different amino acids that are nevertheless related to each other at the structural, functional, biochemical and/or conformational levels. Where there is non-identity at the amino acid level, similarity includes amino acids that are nevertheless related to each other at the structural, functional, 30 biochemical and/or conformational levels. In a particularly preferred embodiment, WO 2006/105598 PCT/AU2006/000451 -17 nucleotide and sequence comparisons are made at the level of identity rather than similarity. Terms used to describe sequence relationships between two or more polynucleotides or 5 polypeptides include "reference sequence", "comparison window", "sequence similarity", "sequence identity", "percentage of sequence similarity", "percentage of sequence identity", "substantially similar" and "substantial identity". A "reference sequence" is at least 12 but frequently 15 to 18 and often at least 25 or above, such as 30 monomer units, inclusive of nucleotides and amino acid residues, in length. Because two polynucleotides 10 may each comprise (1) a sequence (i.e. only a portion of the complete polynucleotide sequence) that is similar between the two polynucleotides, and (2) a sequence that is divergent between the two polynucleotides, sequence comparisons between two (or more) polynucleotides are typically performed by comparing sequences of the two polynucleotides over a "comparison window" to identify and compare local regions of 15 sequence similarity. A "comparison window" refers to a conceptual segment of typically 12 contiguous residues that is compared to a reference sequence. The comparison window may comprise additions or deletions (i.e. gaps) of about 20% or less as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. Optimal alignment of sequences for aligning a comparison window 20 may be conducted by computerized implementations of algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package Release 7.0, Genetics Computer Group, 575 Science Drive Madison, WI, USA) or by inspection and the best alignment (i.e. resulting in the highest percentage homology over the comparison window) generated by any of the various methods selected. Reference also may be made to the 25 BLAST family of programs as, for example, disclosed by Altschul et al. (Nucl. Acids Res. 25: 3389-3402, 1997). A detailed discussion of sequence analysis can be found in Unit 19.3 of Ausubel et al. ("Current Protocols in Molecular Biology" John Wiley & Sons Inc, 1994-1998, Chapter 15, 1998). 30 The terms "sequence similarity" and "sequence identity" as used herein refers to the extent that sequences are identical or functionally or structurally similar on a nucleotide-by- WO 2006/105598 PCT/AU2006/000451 - 18 nucleotide basis or an amino acid-by-amino acid basis over a window of comparison. Thus, a "percentage of sequence identity", for example, is calculated by comparing two optimally aligned sequences over the window of comparison, determining the number of positions at which the identical nucleic acid base (e.g. A, T, C, G, I) or the identical amino 5 acid residue (e.g. Ala, Pro, Ser, Thr, Gly, Val, Leu, Ile, Phe, Tyr, Trp, Lys, Arg, His, Asp, Glu, Asn, Gln, Cys and Met) occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison (i.e., the window size), and multiplying the result by 100 to yield the percentage of sequence identity. For the purposes of the present invention, "sequence 10 identity" will be understood to mean the "match percentage" calculated by the DNASIS computer program (Version 2.5 for windows; available from Hitachi Software engineering Co., Ltd., South San Francisco, California, USA) using standard defaults as used in the reference manual accompanying the software. Similar comments apply in relation to sequence similarity. 15 The nucleic acid sequences contemplated herein also encompass oligonucleotides useful as genetic probes for amplification reactions or as antisense or sense molecules capable of regulating expression of the corresponding gene in a plant. Sense molecules include hairpin constructs, short double stranded DNAs and RNAs and partially double stranded 20 DNAs and RNAs which one or more single stranded nucleotide over hangs. An antisense molecule as used herein may also encompass a genetic construct comprising the structural genomic or cDNA gene or part thereof in reverse orientation relative to its own or another promoter. It may also encompass a homologous genetic sequence. An antisense or sense molecule may also be directed to terminal or internal portions of the gene encoding a 25 polypeptide having a pH modulating or altering activity or to combinations of the above such that the expression of the gene is reduced or eliminated. With respect to this aspect of the invention, there is provided an oligonucleotide of 5-50 nucleotides such as 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 30 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55 having substantial similarity to a part or region of a molecule WO 2006/105598 PCT/AU2006/000451 -19 with a nucleotide sequence set forth in SEQ ID NO: 1, 3 or 5. By substantial similarity or complementarity in this context is meant a hybridizable similarity under low, alternatively and preferably medium and alternatively and most preferably high stringency conditions specific for oligonucleotide hybridization (Sambrook et al, Molecular Cloning: A 5 Laboratory Manual, 2 "d edition, Cold Spring Harbor Laboratories, Cold Spring Harbor, NY, USA, 1989). Such an oligonucleotide is useful, for example, in screening for pH modulating or altering genetic sequences from various sources or for monitoring an introduced genetic sequence in a transgenic plant. The preferred oligonucleotide is directed to a conserved pH modulating or altering genetic sequence or a sequence conserved within 10 a plant genus, plant species and/or plant variety. In one aspect of the present invention, the oligonucleotide corresponds to the 5' or the 3' end of the nucleic acid modulating or altering pH sequences. For convenience, the 5' end is considered herein to define a region substantially between the start codon of the structural 15 gene to a centre portion of the gene, and the 3' end is considered herein to define a region substantially between the centre portion of the gene and the terminating codon of the structural gene. It is clear, therefore, that oligonucleotides or probes may hybridize to the 5' end or the 3' end or to a region common to both the 5' and the 3' ends. The present invention extends to all such probes. 20 In one embodiment, the nucleic acid sequence encoding a pH modulating or altering proteins or various functional derivatives thereof is used to reduce the level of an endogenous pH modulating or altering protein (e.g. via co-suppression or antisense mediated suppression) or other post-transcriptional gene silencing (PTGS) processes 25 including RNAi or alternatively the nucleic acid sequence encoding this enzyme or various derivatives or parts thereof is used in the sense or antisense orientation to reduce the level of a pH modulating or altering protein. The use of sense strands, double or partially single stranded such as constructs with hairpin loops is particularly useful in inducing a PTGS response. In a further alternative, ribozymes, minizymes or DNAzymes could be used to 30 inactivate target nucleic acid sequences.

WO 2006/105598 PCT/AU2006/000451 -20 Still a further embodiment encompasses post-transcriptional inhibition to reduce translation into polypeptide material. Still yet another embodiment involves specifically inducing or removing methylation. 5 Reference herein to the changing of a pH modulating or altering activity relates to an elevation or reduction in activity of up to 30% or more preferably of 30-50%, or even more preferably 50-75% or still more preferably 75% or greater above or below the normal endogenous or existing levels of activity. Such elevation or reduction may be referred to as modulation or alteration of a pH modulating protein. Often, modulation is at the level of 10 transcription or translation of pH modulating or altering genetic sequences. The nucleic acids of the present invention may be a ribonucleic acid or deoxyribonucleic acids, single or double stranded and linear or covalently closed circular molecules. Preferably, the nucleic acid molecule is cDNA. The present invention also extends to other 15 nucleic acid molecules which hybridize under low, preferably under medium and most preferably under high stringency conditions with the nucleic acid molecules of the present invention and in particular to the sequence of nucleotides set forth in SEQ ID NO: 1, 3 or 5 or a part or region thereof. In its most preferred embodiment, the present invention extends to a nucleic acid molecule having a nucleotide sequence set forth in SEQ ID NO: 1, 3 or 5 20 or to a molecule having at least 40%, more preferably at least 45%, even more preferably at least 55%, still more preferably at least 65%-70%, and yet even more preferably greater than 85% similarity at the level of nucleotide or amino acid sequence to at least one or more regions of the sequence set forth in SEQ ID NO: 1, 3 or 5 and wherein the nucleic acid encodes or is complementary to a sequence which encodes an enzyme having a pH 25 modulating or altering activity. It should be noted, however, that nucleotide or amino acid sequences may have similarities below the above given percentages and yet still encode a pH modulating or altering activity and such molecules may still be considered in the scope of the present invention where they have regions of sequence conservation. The present invention further extends to nucleic acid molecules in the form of oligonucleotide primers 30 or probes capable of hybridizing to a portion of the nucleic acid molecules contemplated above, and in particular those set forth in SEQ ID NO: 1, 3 or 5, under low, preferably WO 2006/105598 PCT/AU2006/000451 -21 under medium and most preferably under high stringency conditions. Preferably the portion corresponds to the 5' or the 3' end of the gene. For convenience the 5' end is considered herein to define a region substantially between the start codon of the structural genetic sequence to a centre portion of the gene, and the 3' end is considered herein to 5 define a region substantially between the centre portion of the gene and the terminating codon of the structural genetic sequence. It is clear, therefore, that oligonucleotides or probes may hybridize to the 5' end or the 3' end or to a region common to both the 5' and the 3' ends. The present invention extends to all such probes. 10 The term gene is used in its broadest sense and includes cDNA corresponding to the exons of a gene. Accordingly, reference herein to a gene is to be taken to include: (i) a classical genomic gene consisting of transcriptional and/or translational regulatory sequences and/or a coding region and/or non-translated sequences (i.e. introns, 15 5'- and 3'- untranslated sequences); or (ii) mRNA or cDNA corresponding to the coding regions (i.e. exons) and 5'- and 3' untranslated sequences of the gene. 20 The term gene is also used to describe synthetic or fusion molecules encoding all or part of an expression product. In particular embodiments, the term nucleic acid molecule and gene may be used interchangeably. The nucleic acid or its complementary form may encode the full-length enzyme or a part or 25 derivative thereof. By "derivative" is meant any single or multiple amino acid substitutions, deletions, and/or additions relative to the naturally occurring enzyme and which retains a pH modulating or altering activity. In this regard, the nucleic acid includes the naturally occurring nucleotide sequence encoding a pH modulating or altering activity or may contain single or multiple nucleotide substitutions, deletions and/or additions to 30 said naturally occurring sequence. The nucleic acid of the present invention or its complementary form may also encode a "part" of the pH modulating or altering protein, WO 2006/105598 PCT/AU2006/000451 -22 whether active or inactive, and such a nucleic acid molecule may be useful as an oligonucleotide probe, primer for polymerase chain reactions or in various mutagenic techniques, or for the generation of antisense molecules. 5 Reference herein to a "part" of a nucleic acid molecule, nucleotide sequence or amino acid sequence, preferably relates to a molecule which contains at least about 10 contiguous nucleotides or five contiguous amino acids, as appropriate. Amino acid insertional derivatives of the pH modulating or altering protein of the present 10 invention include amino and/or carboxyl terminal fusions as well as intra-sequence insertions of single or multiple amino acids. Insertional amino acid sequence variants are those in which one or more amino acid residues are introduced into a predetermined site in the protein although random insertion is also possible with suitable screening of the resulting product. Deletional variants are characterized by the removal of one or more 15 amino acids from the sequence. Substitutional amino acid variants are those in which at least one residue in the sequence has been removed and a different residue inserted in its place. Typical substitutions are those made in accordance with Table 2.

WO 2006/105598 PCT/AU2006/000451 - 23 TABLE 2 Suitable residues for amino acid substitutions Original residue Exemplary substitutions Ala Ser Arg Lys Asn Gln; His Asp Glu Cys Ser Gln Asn; Glu Glu Asp Gly Pro His Asn; Gin Ile Leu; Val Leu Ile; Val Lys Arg; Gln; Glu Met Leu; Ile; Val Phe Met; Leu; Tyr Ser Thr Thr Ser Trp Tyr Tyr Trp; Phe Val Ile; Leu; Met Where the pH modulating or altering protein is derivatized by amino acid substitution, the 5 amino acids are generally replaced by other amino acids having like properties, such as hydrophobicity, hydrophilicity, electronegativity, bulky side chains and the like. Amino acid substitutions are typically of single residues. Amino acid insertions will usually be in the order of about 1-10 amino acid residues and deletions will range from about 1-20 residues. Preferably, deletions or insertions are made in adjacent pairs, i.e. a deletion of 10 two residues or insertion of two residues.

WO 2006/105598 PCT/AU2006/000451 -24 The amino acid variants referred to above may readily be made using peptide synthetic techniques well known in the art, such as solid phase peptide synthesis (Merrifield, J. Am. Chem. Soc. 85:2149, 1964) and the like, or by recombinant DNA manipulations. 5 Techniques for making substitution mutations at predetermined sites in DNA having known or partially known sequence are well known and include, for example, M13 mutagenesis. The manipulation of DNA sequence to produce variant proteins which manifest as substitutional, insertional or deletional variants are conveniently described, for example, in Sambrook et al. (1989, supra). 10 Other examples of recombinant or synthetic mutants and derivatives of the pH modulating or altering proteins of the present invention include single or multiple substitutions, deletions and/or additions of any molecule associated with the enzyme such as carbohydrates, lipids and/or proteins or polypeptides. 15 The terms "analogs" and "derivatives" also extend to any functional chemical equivalent of pH modulating or altering proteins and also to any amino acid derivative described above. For convenience, reference to pH modulating or altering proteins herein includes reference to any functional mutant, derivative, part, fragment, homolog or analog thereof. 20 The present invention is exemplified using nucleic acid sequences derived from pansy, salvia, sollya or lavender or kennedia since this represents the most convenient and preferred source of material to date. However, one skilled in the art will immediately appreciate that similar sequences can be isolated from any number of sources such as other plants or certain microorganisms. All such nucleic acid sequences encoding directly or 25 indirectly a pH modulating protein are encompassed by the present invention regardless of their source. Examples of other suitable sources of genes encoding pH modulating or altering proteins include, but are not limited to Dianthus spp. Rosa spp. Chrysanthemum spp. Cyclamen spp., Gerbera spp., Iris spp., Pelargonium spp., Liparieae, Geranium spp., Saintpaulia spp., Plumbago spp., etc. 30 WO 2006/105598 PCT/AU2006/000451 -25 In accordance with the present invention, a nucleic acid sequence encoding a pH modulating or altering protein may be introduced into and expressed in a transgenic plant in either orientation thereby providing a means to modulate or alter the vacuolar pH by either reducing or eliminating endogenous or existing pH modulating or altering protein 5 activity thereby allowing the vacuolar pH to increase. A particularly preferred effect is a visible effect of a shift to blue in the color of the anthocyanins and/or in the resultant flower color. Expression of the nucleic acid sequence in the plant may be constitutive, inducible or developmental and may also be tissue-specific. The word "expression" is used in its broadest sense to include production of RNA or of both RNA and protein. It also 10 extends to partial expression of a nucleic acid molecule. According to this aspect of the present invention, there is provided a method for producing a transgenic flowering plant capable of synthesizing a pH modulating or altering protein, said method comprising stably transforming a cell of a suitable plant with a nucleic acid 15 sequence which comprises a sequence of nucleotides encoding said pH modulating or altering proteins under conditions permitting the eventual expression of said nucleic acid sequence, regenerating a transgenic plant from the cell and growing said transgenic plant for a time and under conditions sufficient to permit the expression of the nucleic acid sequence. The transgenic plant may thereby produce non-indigenous pH modulating or 20 altering proteins at elevated levels relative to the amount expressed in a comparable non transgenic plant. Another aspect of the present invention contemplates a method for producing a transgenic plant with reduced indigenous or existing pH modulating or altering activity, said method 25 comprising stably transforming a cell of a suitable plant with a nucleic acid molecule which comprises a sequence of nucleotides encoding or complementary to a sequence encoding a pH modulating activity, regenerating a transgenic plant from the cell and where necessary growing said transgenic plant under conditions sufficient to permit the expression of the nucleic acid. 30 WO 2006/105598 PCT/AU2006/000451 -26 Yet another aspect of the present invention contemplates a method for producing a genetically modified plant with reduced indigenous or existing pH modulating or altering protein activity, said method comprising altering the pH modulating or altering gene through modification of the indigenous sequences via homologous recombination from an 5 appropriately altered pH modulating or altering gene or derivative or part thereof introduced into the plant cell, and regenerating the genetically modified plant from the cell. As used herein an "indigenous" enzyme is one, which is native to or naturally expressed in a particular cell. A "non-indigenous" enzyme is an enzyme not native to the cell but 10 expressed through the introduction of genetic material into a plant cell, for example, through a transgene. An "endogenous" enzyme is an enzyme produced by a cell but which may or may not be indigenous to that cell. In a preferred embodiment, the present invention contemplates a method for producing a 15 transgenic flowering plant exhibiting altered floral or inflorescence properties, said method comprising stably transforming a cell of a suitable plant with a nucleic acid sequence of the present invention, regenerating a transgenic plant from the cell and growing said transgenic plant for a time and under conditions sufficient to permit the expression of the nucleic acid sequence. 20 The term "inflorescence" as used herein refers to the flowering part of a plant or any flowering system of more than one flower which is usually separated from the vegetative parts by an extended internode, and normally comprises individual flowers, bracts and peduncles, and pedicels. As indicated above, reference to a "transgenic plant" may also be 25 read as a "genetically modified plant". Alternatively, said method may comprise stably transforming a cell of a suitable plant with a nucleic acid sequence of the present invention or its complementary sequence, regenerating a transgenic plant from the cell and growing said transgenic plant for a time 30 and under conditions sufficient to alter the level of activity of the indigenous or existing pH modulating or altering proteins. Preferably the altered level would be less than the WO 2006/105598 PCT/AU2006/000451 - 27 indigenous or existing level of pH modulating or altering activity in a comparable non transgenic plant. Without wishing to limit the present invention, one theory of mode of action is that reduction of the indigenous pH modulating protein activity requires the expression of the introduced nucleic acid sequence or its complementary sequence. 5 However, expression of the introduced genetic sequence or its complement may not be required to achieve the desired effect: namely, a flowering plant exhibiting altered floral or inflorescence properties. In a related embodiment, the present invention contemplates a method for producing a 10 flowering plant exhibiting altered floral or inflorescence properties, said method comprising alteration of the pH modulating or altering gene through modification of the indigenous sequences via homologous recombination from an appropriately altered pH modulating or altering gene or derivative or part thereof introduced into the plant cell, and regenerating the genetically modified plant from the cell. 15 Preferably, the altered floral or inflorescence includes the production of different shades of blue or purple or red flowers or other colors, depending on the genotype and physiological conditions of the recipient plant. 20 Accordingly, the present invention extends to a method for producing a transgenic plant capable of expressing a recombinant gene encoding a pH modulating or altering protein or part thereof or which carries a nucleic acid sequence which is substantially complementary to all or a part of a mRNA molecule encoding a pH modulating or altering protein, said method comprising stably transforming a cell of a suitable plant with the isolated nucleic 25 acid molecule comprising a sequence of nucleotides encoding, or complementary to a sequence encoding, a pH modulating or altering protein, where necessary under conditions permitting the eventual expression of said isolated nucleic acid molecule, and regenerating a transgenic plant from the cell. 30 One skilled in the art will immediately recognise the variations applicable to the methods of the present invention, such as increasing or decreasing the expression of the enzyme WO 2006/105598 PCT/AU2006/000451 -28 naturally present in a target plant leading to differing shades of colors such as different shades of blue, purple or red. The present invention, therefore, extends to all transgenic plants or parts or cells therefrom 5 of transgenic plants or progeny of the transgenic plants containing all or part of the nucleic acid sequences of the present invention, or antisense forms thereof and/or any homologs or related forms thereof and, in particular, those transgenic plants which exhibit altered floral or inflorescence properties. The transgenic plants may contain an introduced nucleic acid molecule comprising a nucleotide sequence encoding or complementary to a sequence 10 encoding a pH modulating or altering protein. Generally, the nucleic acid would be stably introduced into the plant genome, although the present invention also extends to the introduction of a pH modulating or altering nucleotide sequence within an autonomously replicating nucleic acid sequence such as a DNA or RNA virus capable of replicating within the plant cell. The invention also extends to seeds from such transgenic plants. Such 15 seeds, especially if colored, are useful as proprietary tags for plants. Any and all methods for introducing genetic material into plant cells including but not limited to Agrobacterium-mediated transformation, biolistic particle bombardment etc. are encompassed by the present invention. 20 Another aspect of the present invention contemplates the use of the extracts from transgenic plants or plant parts or cells therefrom of transgenic plants or progeny of the transgenic plants containing all or part of the nucleic acid sequences of the present invention and, in particular, the extracts from those transgenic plants when used as a flavouring or food additive or health product or beverage or juice or coloring. 25 Plant parts contemplated by the present invention includes, but is not limited to flowers, fruits, vegetables, nuts, roots, stems, leaves or seeds. The extracts of the present invention may be derived from the plants or plant part or cells 30 therefrom in a number of different ways including but not limited to chemical extraction or heat extraction or filtration or squeezing or pulverization.

WO 2006/105598 PCT/AU2006/000451 -29 The plant, plant part or cells therefrom or extract can be utilized in any number of different ways such as for the production of a flavouring (e.g. a food essence), a food additive (e.g. a stabilizer, a colorant) a health product (e.g. an antioxidant, a tablet) a beverage (e.g. wine, 5 spirit, tea) or a juice (e.g. fruit juice) or coloring (e.g. food coloring, fabric coloring, dye, paint, tint). A further aspect of the present invention is directed to recombinant forms of pH modulating or altering proteins. The recombinant forms of the enzyme will provide a 10 source of material for research, for example, more active enzymes and may be useful in developing in vitro systems for production of colored compounds. Still a further aspect of the present invention contemplates the use of the genetic sequences described herein in the manufacture of a genetic construct capable of expressing a pH 15 modulating or altering protein or down-regulating an indigenous pH modulating protein in a plant. The term genetic construct has been used interchangeably throughout the specification and claims with the terms "fusion molecule", "recombinant molecule", "recombinant 20 nucleotide sequence". A genetic construct may include a single nucleic acid molecule comprising a nucleotide sequence encoding a single protein or may contain multiple open reading frames encoding 2 or more proteins. It may also contain a promoter operably linked to I or more of the open reading frames. 25 Another aspect of the present invention is directed to a prokaryotic or eukaryotic organism carrying a genetic sequence encoding a pH modulating or altering proteins extrachromasomally in plasmid form. The present invention further extends to a recombinant polypeptide comprising a sequence 30 of amino acids substantially as set forth in SEQ ID NO: 2, 4 or 6 or an amino acid WO 2006/105598 PCT/AU2006/000451 -30 sequence having at least about 50% similarity to SEQ ID NO: 2, 4 or 6 or a derivative of said polypeptide. How should rose SEQ be included here? SEQs 98 & 99. 5 A "recombinant polypeptide" means a polypeptide encoded by a nucleotide sequence introduced into a cell directly or indirectly by human intervention or into a parent or other relative or precursor of the cell. A recombinant polypeptide may also be made using cell free, in vitro transcription systems. The term "recombinant polypeptide" includes an 10 isolated polypeptide or when present in a cell or cell preparation. It may also be in a plant or parts of a plant regenerated from a cell which produces said polypeptide. A "polypeptide" includes a peptide or protein and is encompassed by the term "enzyme". 15 The recombinant polypeptide may also be a fusion molecule comprising two or more heterologous amino acid sequences. Still yet another aspect of the present invention contemplates a pH modulating or altering nucleic acid sequence linked to a nucleic acid sequence involved in modulating or altering 20 the anthocyanin pathway. pH4 is a member of the MYB family of transcription factors that is expressed in the petal epidermis and that can physically interact with AN1 and JAF13. This indicates that AN1 is present in at least two distinct transcription complexes. One complex includes pH4 and activates a set of unknown target genes involved in vacuolar acidification, whereas another 25 (pH4-independent) complex activates the structural anthocyanin genes. The present invention is further described by the following non-limiting Examples.

WO 2006/105598 PCT/AU2006/000451 -31 EXAMPLE 1 General methods In general, the methods followed were as described in Sambrook et al. (1989, supra) or 5 Sambrook and Russell, Molecular Cloning: A Laboratory Manual 3 rd edition, Cold Spring Harbor Laboratories, Cold Spring Harbor, NY, USA, 2001 or Plant Molecular Biology Manual ( 2 "d edition), Gelvin and Schilperoot (eds), Kluwer Academic Publisher, The Netherlands, 1994 or Plant Molecular Biology Labfax, Croy (ed), Bios scientific Publishers, Oxford, UK, 1993. 10 Stages offlower development Petunia hybrida cv. M1 x V30 flowers were harvested at developmental stages defined as follows: Stage 1: Unpigmented flower bud (less than 10 mm in length) 15 Stage 2: Unpigmented flower bud (10 to 20 mm in length) Stage 3: Lightly pigmented closed flower bud (20 to 27mm in length) Stage 4: Pigmented closed flower bud (27 to 35 mm in length) Stage 5: Fully pigmented closed flower bud (35 to 45 mm in length) Stage 6: Fully pigmented bud with emerging corolla (45 to 55 mm in length) 20 Stage 7: Fully opened flower (55 to 60 mm in length) Other petunia cultivars (such as R27 and W 115) were grouped into similar developmental stages as described above however the overall lengths of the buds varied between cultivars. 25 Plant material The Petunia hybrida lines used in the cDNA-AFLP screening were R27 (wild-type (wt)), W225 (an], frame-shift mutation in R27 background), R144 (ph3-V2068 transposon insertion in PH3 in R27 background), R147 (ph4-X2058 transposon insertion in PH4 in R27 background) and Ri 53 (ph5 transposon insertion in PH5 crossed into a R27 30 background). All lines have genetically identical background and to diminish differences in WO 2006/105598 PCT/AU2006/000451 - 32 environmental conditions which could lead to differences in transcript levels, the plants were grown in a greenhouse adjacent to each other. The Petunia hybrida line M1 x V30 used in transformations experiments was an F1 hybrid 5 of M1 (AN], AN2, AN4, PH4, PPM, PPM2)crossed with line V30 (AN], AN2, AN4, PH4, PPM1, PPM2). Flowers of M1 x V30 are red-violet and generally accumulate anthocyanins based upon malvidin and low levels of the flavonol quercetin. Petunia hybrida transformations) 10 As described in Holton et al. (Nature, 366: 276-279, 1993) or Brugliera et al, (Plant J. 5, 81-92, 1994) or de Vetten N et al (Genes and Development 11: 1422-1434, 1997) or by any other method well known in the art. Preparation ofpetunia R27petal cDNA library 15 A petunia petal cDNA library was prepared from R27 petals using standard methods as described in Holton et al. (1993, supra) or Brugliera et al, (1994, supra) or de Vetten N et al (1997, supra). Transient assays 20 Transient expression assays were performed by particle bombardment of petunia petals as described previously (de Vetten et al, supra; Quattrocchio et al, Plant J. 13, 475-488, 1998). pH assay. 25 The pH of petal extracts was measured by grinding the petal limbs of two corollas in 6 mL distilled water. The pH was measured directly (within 1 min) with a normal pH electrode, to avoid that atmospheric CO 2 would alter pH of the extract HPLC and TLC analysis 30 HPLC analysis was as described in de Vetten et al. (Plant Cell 11(8):1433-1444, 1999). TLC analysis was as described in van Houwelingen et al, (Plant J. 13(1): 39-50, 1998) WO 2006/105598 PCT/AU2006/000451 - 33 Analysis of nucloetide and predicted amino acid sequences Nucleotide and predicted amino acid sequences were analyzed with the program Geneworks (Intelligenetics, Mountain View, CA). Multiple sequence alignments were 5 produced with a web-based version of the program ClustalW (http://dot.imgen.bem.tme.edu:9331/multi-align/multi-align.html) using defaults settings (Matrix = blossom; GAPOPEN = 0, GAPEXT = 0, GAPDIST = 8, MAXDIV = 40). The phylogenetic tree was build with PHYLIP (bootstrap count = 1000) via the same website, and visualized with Treeviewer version 1.6.6 10 (http://taxonomy.zoology. ala.ac.uk/rod/rod.html) RNA isolation andRT-PCR RNA isolation and RT-PCR analysis were carried out as described by de Vetten et al, (1997, supra). Rapid amplification of cDNA (3') ends (RACE) was done as described by 15 Frohman et al. (PNAS85: 8998-9002, 1988).

WO 2006/105598 PCT/AU2006/000451 - 34 EXAMPLE 2 Transcript profile analysis A combination of cDNA-AFLP and microarray analysis were utilised in order to identify transcripts that were downregulated in anT, phY and ph4~ mutants. A summary of results 5 is shown in Table 3 TABLE: 3 Trancripts identified by cDNA-AFLP or microarray analysis that are down regulated in an1~, ph3 and ph4~ mutants and found at wild-type levels in ph2~ and phS~ mutants Name Size (bp) Normal | Down regulated NCBI Blast search CAC 4.4 116 wt, ph2, ph5 an ], ph3, ph4 No significant similarity CAC 5.6 250 wt, ph2, ph5 an], ph3, ph4 putative outer membrane protein CAC 7.0 300 wt, ph2, ph5 an1, ph3, ph4 No significant similarity CAC 7.4 150 wt, ph2, ph5 an1, ph3, ph4 No significant similarity CAC 7.5 170 wt, ph2, ph5 an], ph3, ph4 putative PM-type protein CAC 8.3 150 wt, ph2, ph5 an], ph3, ph4 No significant similarity CAC 8.9 252 wt, ph2, ph5 an], ph3, ph4 PREGI like neg. regulator putative phosphatidylinositol CAC 10.6 181 wt, ph2, ph5 an], ph3, ph4 kinase CAC 12.1 71 TBD TBD TBD 3'-5' exonuclease containing CAC 12.3 803 wt, ph2, ph5 an], ph3, ph4 protein CAG 13.4 126 wt, ph2, ph5 an], ph3, ph4 unknown protein GAC 13.10 452 wt, ph2, ph5 an1, ph3, ph4 membrane transporter like protein GAC 14.2 1276 wt, ph2, ph5 an], ph3, ph4 no long ORF putative SPFH domain containing CAC 14.3 1312 wt, ph2, ph5 an], ph3, ph4 protein GAC 14.4 TBD TBD TBD CAC 16.1 188 wt, ph2, ph5 an], ph3, ph4 No significant similarity CGAC 16.2 1440 wt, ph2, ph5 an], ph3, ph4 no long ORF CAG 16.5 1025 wt, ph2, ph5 an], ph3, ph4 cysteine proteinase MAC F55 full length wt, ph2, ph5 an], ph3, ph4 Plasma membrane ATPase MAC 1D2 1164 wt, ph2, ph5 an], ph3, ph4 putative myosin protein MAC 9F1 956 wt, ph2, ph5 an], ph3, ph4 unknown protein MAC 10F12 TBD TBD TBD

TBD

WO 2006/105598 PCT/AU2006/000451 -35 ORF = open reading frame TBD = to be done CAC = transcript identified using cDNA-AFLP 5 MAC = transcript identified using microarray NCBI- Blast search = Any similarities to known sequences were discovered by using a BLAST search (Altschul et al. Nucl. Acids Res. 25: 3389-3402, 1997) on the National Center for Biotechnology Information (NCBI) website (as of February 2005). 10 EXAMPLE 3 Description of cDNA-AFLP Using 256 primer combinations of MseI+NN / EcoRI+NN, around 20,000 fragments were analysed which covered around 25% of total transcripts. 80 fragments were isolated from the gel and 20 were further characterised by RT-PCR of total RNA isolated from petunia 15 mutant lines including wild-type and an1, ph2, ph3, ph4, ph5 mutants. Sixteen of these fragments (see Table 3) were confirmed as being down-regulated in an1, ph3 and ph4 petunia lines compared to their expression levels in wild-type, ph2 and ph5 petunia lines. RNA isolation and cDNA synthesis 20 The petunia lines R27 (wt), W225 (an1), R144 (ph 3 ), R147 (ph4) and R153 (ph5) were used in the cDNA-AFLP screening. Around 25 to 30 flower buds (flower developmental stage 5, 6) were harvested from each petunia line and stored at -70*C. Total RNA was extracted from 10 corollas according to Logemann et al. (Anal Biochem. 163():16-20, 1987). PolyA+ RNA was then isolated from 500 micrograms of total RNA using oligo(dT) 25 coupled to magnetic beads according to the PolyATract@ System (PROMEGA) protocol. One microgram of polyA+ RNA was then used for synthesizing double stranded (ds) cDNA using the GIBCO-BRL Superscript II system. After synthesis of ds cDNAs, the cDNAs were phenol extracted (Sambrook et al, 2001, supra) and the cDNA precipitated with the addition of salt and ethanol. The DNA pellet was then resuspended in 30 pL of 30 distilled water.

WO 2006/105598 PCT/AU2006/000451 -36 Template preparation Restriction endonuclaseses MseI (digests a 4 base recognition sequence) and EcoRI (digests a 6 base recognition sequence) were used for the template preparation for cDNA 5 AFLP analysis. The cDNAs were digested with both restriction endonucleases in combination with ligation of adapters (Mse Al (SEQ ID NO: 7) and Mse A2 (SEQ ID NO: 8)) annealed to each other and EcoAl (SEQ ID NO: 14) and EcoA2 (SEQ ID NO: 15) also annealed to each other to form respectively a PCR adaptor for the MseI site and one for the EcoRI site) to the MseI and EcoRI ends. Each "restriction-ligation" reaction was performed 10 in a total volume of 50piL which included 24ptL ds cDNA, 10jiL 5 x RL buffer (50mM Tris HAc pH7.5, 50mM MgAc, 250mM KAc, 25mM DTT, 250tg/piL BSA), 0.lpL 100mM ATP, 5 units MseI (New England Biolabs), 5 units EcoRI (New England Biolabs), 50 pmol MseI adapter (Mse Al and Mse A2) (SEQ ID NO: 7 and 8) and 50pmol EcoRI adapter (EcoAl and EcoA2) (SEQ ID NO: 14 and 15). The adapters had previously been 15 boiled for 2 minutes and then slowly allowed to cool to room temperature prior to their addition to the reaction. The "restriction-ligation" reaction was incubated for 4 hours at 37 0 C. Amplification 20 Prior to amplification, cDNA templates were diluted 10-fold in water and then a volume of 10tL was used in the first, non-radioactive, PCR amplification step with one nucleotide selective extension (EcoRI+N, MseI+N) primers (SEQ ID NO: 10 to 13 and 16 to 19))(see Table 4) in a touch-down PCR program. The PCR cycle included a 94*C denaturation step followed by annealing step of 30 seconds at temperatures starting at 65 0 C and reducing in 25 0.7'C increments down to 56*C over 17 cycles followed by 18 cycles of 56*C for 30 sec and finally an elongation step at 72'C for 1 min. Eight microliters of the products from this first PCR were electrophoresced through a 1% agarose gel and the expected DNA smear between 200 and 750bp was detected. Subsequently, 0.5pL of these products were used as template in a second "hot" PCR using 2 nucleotide extension (EcoRI+NN, MseI+NN) 30 primers (SEQ ID NO. 20 to 51) (see Table 5) in standard PCR conditions with a touch down PCR program as described previously. The EcoRI primers in the second PCR were WO 2006/105598 PCT/AU2006/000451 -37 radio-labeled with 33 P in a reaction which included 5Ong primer, 5p L 1 Ox T4 kinase buffer, 10pL 33 P-CTP, 24gL water and 9 units T4 polynucleotide kinase. The reaction was incubated for 1 hour at 37 0 C, followed by inactivation of the T4 kinase by treatment at 65*C for 10 minutes. 5 TABLE: 4 Primers used in the cDNA-AFLP analysis Primer SEQ ID NO. Primer No. Primer sequence (5' to 3') name 7 701 Mse Al GAC GAT GAG TCC TGA G 8 702 Mse A2 TAC TCA GGA CTC AT 9 703 mse+0 GAC GAT GAG TCC TGA GTA A 10 704 Mse+A GAC GAT GAG TCC TGA GTA AA 11 705 Mse+C GAC GAT GAG TCC TGA GTA AC 12 706 Mse+G GAC GAT GAG TCC TGA GTA AG 13 707 Mse+T GAC GAT GAG TCC TGA GTA AT 14 724 EcoAl GTG ATA TCT CCA CTG ACG T 15 725 EcoA2 CTC GTA GAC TGC GTA CC 16 726 Eco+A AAT TGG TAC GCA GTC 17 727 Eco+C AGA CTG CGT ACC AAT TCA 18 728 Eco+G AGA CTG CGT ACC AAT TCC 19 729 Eco+T AGA CTG CGT ACC AAT TCG WO 2006/105598 PCT/AU2006/000451 -38 TABLE: 5 Primers with 2 nucleotide extensions used in the cDNA-AFLP analysis Primer SEQ ID NO. Primer No. Primer sequence (5' to 3') name 20 708 Mse+AA GAT GAG TCC TGA GTA AAA 21 709 Mse+AC GAT GAG TCC TGA GTA AAC 22 710 Mse+AG GAT GAG TCC TGA GTA AAG 23 711 Mse+AT GAT GAG TCC TGA GTA AAT 24 712 Mse+CA GAT GAG TCC TGA GTA ACA 25 713 Mse+CC GAT GAG TCC TGA GTA ACC 26 714 Mse+CG GAT GAG TCC TGA GTA ACG 27 715 Mse+CT GAT GAG TCC TGA GTA ACT 28 716 Mse+GA GAT GAG TCC TGA GTA AGA 29 717 Mse+GC GAT GAG TCC TGA GTA AGC 30 718 Mse+GG GAT GAG TCC TGA GTA AGG 31 719 Mse+GT GAT GAG TCC TGA GTA AGT 32 720 Mse+TA GAT GAG TCC TGA GTA ATA 33 721 Mse+TC GAT GAG TCC TGA GTA ATC 34 722 Mse+TG GAT GAG TCC TGA GTA ATG 35 723 Mse+TT GAT GAG TCC TGA GTA ATT 36 730 Eco+AA GAC TGC GTA CCA ATT CAA 37 731 Eco+AC GAC TGC GTA CCA ATT CAC 38 732 Eco+AG GAC TGC GTA CCA ATT CAG 39 733 Eco+AT GAC TGC GTA CCA ATT CAT 40 734 Eco+CA GAC TGC GTA CCA ATT CCA 41 735 Eco+CC GAC TGC GTA CCA ATT CCC 42 736 Eco+CG GAC TGC GTA CCA ATT CCG 43 737 Eco+CT GAC TGC GTA CCA ATT CCT 44 738 Eco+GA GAC TGC GTA CCA ATT CGA 45 739 Eco+GC GAC TGC GTA CCA ATT CGC 46 740 Eco+GG GAC TGC GTA CCA ATT CGG 47 741 Eco+GT GAC TGC GTA CCA ATT CGT 48 742 Eco+TA GAC TGC GTA CCA ATT CTA 49 743 Eco+TC GAC TGC GTA CCA ATT CTC 50 744 Eco+TG GAC TGC GTA CCA ATT CTG 51 745 Eco+TT GAC TGC GTA CCA ATT CTT WO 2006/105598 PCT/AU2006/000451 -39 Analysis of PCR products: The reaction products were analyzed by electrophorescing through a 5% denaturing polyacrylamide gel. After electrophoresis the gels were dried on a slab gel dryer and then exposed overnight. The radiolabelled signals of the reaction products were then detected 5 using a Phosphor imager (Molecular Dynamics, Sunnyvale, CA, USA). In summary using 256 primer combinations of MseI+NN/EcoRI+NN, around 20,000 fragments were analysed which covered around 25% of total transcripts. 80 fragments were isolated from the gel and 20 were further characterised by RT-PCR of total RNA 10 isolated from petunia mutant lines including wild-type and an], ph2, ph3, ph4, ph5 mutants. Sixteen of these CAC fragments (see Table 3) were confirmed as being down regulated in an], ph3 and ph4 petunia lines compared to their expression levels in wild type, ph2 and ph5 petunia lines. A summary of the CAC fragments and their respective sizes along with detected sequence similarities to known sequences is shown in Table 6. 15 TABLE 6 A summary offragments isolated by cDNA-A FLP that are down-regulated in an], ph3 and ph4 petunia lines compared to their expression levels in wild-type, ph2 andph5 petunia lines. Fragment Further info BLASTx result Similarity Fragment size E-value CAC 4.4 NSS - 114bp CAC 5.6 Putative membrane prot. 1 250bp CAC 6.6 NSS - 191bp CAC 7.0 ESTc74501(rice)/lipid transfer 0.021/0.17 279 protein (A. th) CAC 7.4 Putative senescence ass. prot. 1x E- 350 CAC 7.5 Putative plasma membrane prot. 0.2 543bp CAC 8.3 No sequence - CAC 8.8 Glycolate oxidase 0.015 95bp CAC 8.9 PREGI -like negative regulator Ix E - 245bp CAC10.6 Put. phosphatidyl kinase x E - 181bp CAC 12.1 NSS - 71bp WO 2006/105598 PCT/AU2006/000451 - 40 Fragment Further info BLASTx result Similarity Fragment size E-value CAC 12.3 3contains 3'-5'exonucl. domain 2x E- 845bp CAC 13.4 Unknown prot. (A.th.) 2x E-'0 124bp CAC 13.10 Membrane transporter 1x E- 346bp CAC 14.2 Same than 16.2 - 1261bp CAC 14.3 Putative SPFH protein IxE-137 1312bp CAC 14.4 No sequence data - CAC 16.1 Histone H2B-like prot. (TAIR) 0.0077 87bp CAC 16.2 No long ORF - 1405bp CAC 16.4 No sequence data - CAC 16.5 Cystein proteinase 2x E- 1169bp CAC 13.2 Only down in Anthocyanins 3-0- 6x E-" 215bp an1 mutants glucosyltransferase CAC 8.11 Up in ph3, ph4 Hypothetical Protein AF420410 1x E- 255bp and an] mutants CAC 4.5 Only down in Anthocyanins 5- 0 - 1 251bp an] mutants glucosyltransferase Similarity E-value = a parameter generated by a BLASTX search that indicates the relative identity to an aligned sequence. The closer to 0 the E-value is the more significant the match NSS = no sequence similarity WO 2006/105598 PCT/AU2006/000451 -41 EXAMPLE 4 Micro array analysis For the micro-array hybridization, petal tissue of developmental stage 5 of both wildtype (R27) and an1- mutant line (W225) was used to isolate polyA* RNA according to protocol 5 of the supplier (polyATtract mRNA Isolation System III, Promega). Microarrays were prepared and hybridised using conditions described by Verdonk et al. (Phytochemistry 62: 997-1008, 2003). Description of microarray 10 Of 1415 ESTs spotted onto microarrays, 9 ESTs were found to be down-regulated by more than 10-fold in the an] mutant petunia line (W225). Five of these sequences represented genes previously isolated and characterised (see Table 7). Four ESTs were further characterised by RT-PCR of total RNA isolated from petunia mutant lines including wild type and an], ph2, ph3, ph4, ph5 mutants. Two of these ESTs (MAC F55 and MAC 9F1) 15 were confirmed as being down-regulated in an] petunia lines.

WO 2006/105598 PCT/AU2006/000451 -42 TABLE 7 Clones identified in the microarray screen that showed 50 to 100 times downregulation in anI mutants. Fragment Further info BLASTx result Similarity Fragment size E-value MAC F55 Plasma ATP-ase Ix E- 9 2850bp MAC ID12 Putative myosin 2x E~ 4 1511 bp heavy chain MAC 9F1 A. thaliana 1xE~ 6 687bp At2g17710 expressed prot. MAC C90 No sequence data - MAC 10F12 TBD TBD TBD MAC M33 Already known Cyt. b5 like 0 Full size cDNA AN] target MAC Already known Petunia DFR-A 0 Full size cDNA DFRA AN] target MAC Rt Already known Petunia RT 0 Full size cDNA AN] target MAC AN9 Already known Petunia GST 0 Full size cDNA AN] target 5 Several more clones show a lower level of down regulation and could be considered in a second round of analysis. The expression pattern and genetic control was determined for several of these genes by RT PCR in different petunia tissues and in flowers of wild type and mutant plants. The 10 majority of these genes show higher expression in petals than in other parts of the plant and the expression studies in the mutants confirmed the pattern previously seen by transcript profiling.

WO 2006/105598 PCT/AU2006/000451 -43 EXAMPLE 5: Construction of RNAi constructs for expression in Petunia In order to asses the role of these genes in the acidification of the vacuolar lumen in flower 5 epidermal cells inverted repeat constructs of each gene were or are expressed in wild-type petunia plants with the aim of silencing the endogenous gene. To date down regulation of three genes has resulted in a change in flower color with a concomitant change in vacuolar pH. These include MAC F55 (PPM1) (SEQ ID NO: 1), 10 MAC 9F1 (SEQ ID NO: 3) and CAC 16.5 (SEQ ID NO: 5). Down regulation of MAC F55 (PPM1) The MAC F55 clone codes for a plasma membrane ATPase (PPM1, Petunia Plasma Membrane ATPase 1) (SEQ ID NO: 1) and has a relatively high sequence identity with 15 ATPase genes already isolated. However, alignment of the different members of the ATPase gene family, show that PPM1 groups together with AHA10 from Arabidopsis and PMA9 from Tobacco in the class III (Arango et al. Planta, 216: 335-365, 2003). These proteins all diverge from the other plasma ATPases in the C terminal part, which represents the site of interaction with 14.3.3 factors regulating the activity of the pump. 20 Cellular localization and function have never been defined for any member of this group, leaving open the possibility that PPM1 resides in other cellular membranes than the plasma membrane. A recent publication by Baxter et al, (PNAS, 102: 2649-2654, 2005) describes analysis of Arabidopsis AHA 10 mutants. AHA 10 was described as having a specific effect on proanthocyanidin and vacuole biogenesis. The aha10 mutants characterised had 25 decreased levels of proanthocyanidins in their seed coats and the seed coat endothelial cells displayed many small vacuoles rather than one central vacuole as observed in wild-type seeds. In order to asses the role of PPM1 gene in the acidification of the vacuolar lumen in flower 30 epidermal cells, wild type petunia plants (V30 x Ml) were transformed with two inverted repeat constructs: a 233 bp inverted repeat spanning from nucleotide 2937 to nucleotide WO 2006/105598 PCT/AU2006/000451 -44 3170 of the PPM1 full size cDNA (SEQ ID NO: 1) and a 499bp inverted repeat spanning from nucleotide 2671 to nucleotide 3170 of the PPM1 full size cDNA (SEQ ID NO: 1), both under the control of the CaMV 35S promoter. 5 Inverted repeat constructs (Gateway) A P. hybrida R27 petal cDNA library was hybridized with 32 P-labelled fragments of PPM1. The PPM1 fragment was generated using PCR amplification with first stand cDNA from RNA isolated from petunia petals as template and the primers #1702 (SEQ ID NO: 52) and #1703 (SEQ ID NO: 53). The full length PPM1 sequence was obtained using a 10 double 5' Rapid Amplification of cDNA (5'/3'-RACE KIT 2" generation, Roche, USA) according to the manufacturer's protocols. Primers #1703 (SEQ ID NO: 53), #1742 (SEQ ID NO: 55) and #1832 (SEQ ID NO: 61) were used for the first 5'-RACE whilst primers #1789 (SEQ ID NO: 58), #1812 (SEQ ID NO: 59) and #1831 (SEQ ID NO: 60) were used for the second 5'-RACE. 15 PCR conditions in all amplifications was as follows: 96'C, 30 seconds, 65'C, 30 seconds and 72'C for 3 minutes, 32 cycles (T3 thermocycler, Biometra). TABLE 8 Primers used in amplification of PPM1 fragments. SEQ ID Primer NO: No. Direction Sequence 5' to 3' 52 1702 Forward GGACCTTAACAAAATTCAAACAG 53 1703 reverse AAATTAATGAATGATATGAGG 54 1741 Forward TGAAGAAATGTCATCAGCCG 55 1742 reverse GTTCAGCAATCATAGATGGC 56 1750 Forward GCTCTGACTGGAGAAGCCTGG 57 1788 Forward CCAAGAGAAGCAACAGATAGCTGCAA 58 1789 reverse TTGCAGCTATCTGTTGCTTCTCTTGG 59 1812 reverse GAATCAATGTAAGTGATTGCAGTCCG 60 1831 reverse AACTGATAGGACTGTTGGCATAGC 61 1832 reverse GCTGGTGCATCATTTACTCCATC 62 1847 Forward ATGGCCGAAGATCTGGAGAGACC WO 2006/105598 PCT/AU2006/000451 -45 SEQ ID Primer NO: No. Direction Sequence 5' to 3' 63 1848 reverse CTGCAGGGATGATATCACCAAGC 64 1861 Forward CTGATAATAGCAATCCTAAATGATGG 65 1864 Forward CGGAATTCATGGCCGAAGATCTGGAGAGACCTTTAC 66 1885 reverse CCCGGGCTTCTCCAGTCAGAGCATATCAAACAGCAA 67 1886 Forward AAGAATTCGTTTGTTATGCTCTGACTGGAGA 68 1956 reverse GACTGCGGGTAACAAATATTAGCG 69 2035 Forward GCAAATATCAGGGAAGTGCATTTCC 70 2037 Forward CGGAATTCTCGCAAATATCAGGGAAGTGCATTTCCTT 71 2038 reverse TTATGAATCAATGTAAGTGATTGCAGTCCG 72 2039 Forward TAGCCCATGGCCGAAGATCTGGAGAGACC 73 2040 reverse CATGAGCCATGGACAAACTGTATGAGCTGTTTG 74 2073 Forward GCTTGCTGATCCAAAGGAGGCACGT 75 2075 reverse GTAAGGATTCCCCAGTAAGAGC 76 2078 reverse CGGGATCCTGGAGCCAGAAGTTTGTTATAGGAGG 77 2123 reverse GGTCTTGGAGATGGTTTAACCC 78 2124 Forward GCTGCTAGGAGTGCTGCTGATCTTG 79 2196 reverse GCATGATACAATGTCCTAGATTCACTTC 80 2270 Forward CTAACCATGGCCGAAGACCTGGAGAGACCT 81 2271 reverse GTTTGATCAGACGTCACATGTCTCCAAACTGTATGAGCTGTTTGA Two PPM1 cDNA fragments (A and B) were amplified using the following primers: A, #1703 (SEQ ID NO: 53) and # 1702 (SEQ ID NO: 52) and B, #1703 (SEQ ID NO: 53) and #1750 (SEQ ID NO: 56). The PCR products were then ligated into the vector pGemt-easy 5 (Promega). Clones containing the correct insert were selected by PCR, digested with EcoRI and subsequently cloned into the EcoRI restriction site of the entry vector pDONR207(l) of the Gateway system (INVITROGEN). Using the Gateway LR recombination reaction (INVITROGEN), the inserts were translocated into pK7GWIWG2(I) and transformed into competent E.coli DH5c cells. With the primer 10 combinations 35S promoter (#27) together with the pK7GWIWG2(I) intron reverse primer (#1777), and 35S terminator (#629) together with the intron forward primer (#1778) clones containing the insert in an inverted repeat arrangement were selected. Subsequently, these WO 2006/105598 PCT/AU2006/000451 -46 clones, pK7GWIWG2 (I) PPMl-l (Figure 1) and pK7GWIWG2 (I) PPM1-2, (Figure 2) were introduced into Agrobacterium tumefaciens by electroporation and transfected into petunia via leaf disk transformation. Transformed plants were selected on MS plates containing 250 microgram/ml of kanamycin, and after rooting, were grown in normal 5 greenhouse conditions. Of the 6 transgenic plants produced using p K7GWIWG2 (I) PPM1-1, 6 resulted in a change in flower color from red to purple/blue. Of the 3 transgenic plants produced using p K7GWIWG2 (I) PPM1-2, 3 resulted in a change in flower color from red to purple/blue. 10 The changes in color correlated with silencing of the endogenous PPM1 transcript and a pH increase of the crude flower extract of about 0.5 units. No effect was detectable on the amount and type of anthocyanin pigment accumulated in the flowers of the silenced plants as determined by TLC and HPLC. 15 Petunia plants mutated in different petunia pH loci as well as those transgenic plants showing silencing of PPM1, still express another member of the plasma membrane ATPase family from Petunia namely, PPM2. PPM2 shows high homology with class II of plasma ATPase proteins containing PMA4 20 from Nicotiana and AHA2 from Arabidopsis for which plasma membrane localization in plant cells has been shown, as well as the capability of complementing pmp1 mutants in yeast and their regulation by 14.3.3 proteins (Jahn et al, JBC, 277,6353-6358, 2002). TABLE 9 25 Primers used in amplification of PPM2 fragments. SEQ ID NO: PPM2 Direction Sequence (5' to 3') 82 1969 forward CTTGTTGACAGCACCAACAATG 83 1970 reverse CAAGGATCTATCGACACTCAACTTG WO 2006/105598 PCT/AU2006/000451 -47 The PPM-1 gene is intriguing because the possible involvement of a P-type ATPase in vacuolar acidification has never been proposed before. From preliminary analysis of PPM1 expression in Petunia it was found that the gene is specifically expressed in the flower limb (nowhere else in the plant). Because petunia flowers mutated in AN1, PH3 or PH4 do not 5 show any expression of PPM-1, and still look healthy, it is tempting to think that the function of this specific gene is confined to the control of the vacuole environment, while it does not contribute to the regulation of the cytosolic pH. It is also possible that other members of the P-ATPase family are expressed in these same cells and control the proton gradient through the plasma membrane. 10 A question of considerable significance concerns the cellular localization of this protein. P ATPases are membrane associated proteins but in this specific case it was not expected that the PPM-I protein to be localized on the plasma membrane as this would not explain its contribution to vacuolar pH control. A GFP fusion of the full-size PPM-1 cDNA was 15 expressed in petunia cells (transient expression in flowers via particle bombardment) and its localization was visualized by confocal microscopy. The different cellular compartment and vacuolar types are identified by marker GFP fusions (Di Sansebastiano et al, Plant Physiology, 126, 78-86, 2001). The PPM-1 protein appeared to be localized on the tonoplast or in vesicles that later fuse to the central vacuole of the flower epidermal cells, 20 which opens a new view of the role of these proteins in cellular homeostasis. The capability of a PPM-1 expression construct to complement the yeast Pmal mutant missing the endogenous P-ATPase activity is tested to make sure that PPM-i encoded proteins has indeed P-ATPase activity. 25 Further studies on the role of PPM-1 in the pathway leading to flower vacuole acidification will suggest studies on how the activity of this class of P-ATPases is regulated. As already mentioned, nothing is known about the function and regulation of class III P-ATPases in plants. Although the protein sequences are overall very homologous to those of other P 30 ATPases, these proteins have a different sequence in the C-terminal tail that has been demonstrated to enable interaction with 14-3-3 proteins required for reaching a high state WO 2006/105598 PCT/AU2006/000451 -48 of activation (Arango et al, 2003, supra). This raises the question whether P-ATPases of this class interact with 14-3-3 regulators or not. A yeast two hybrid screening of a petunia corolla cDNA library was performed to look for proteins interacting with this part of PPM 1 and the purified PPM-1 protein was analysed for binding to 14-3-3 protein in vitro 5 (overlay assay). Phosphorylation of Thr947 has also been recognized as an important step in the regulation of the ATPase activity (Jahn et al, 2001, supra). The PH2 gene from petunia has been cloned andshown that this encodes a THr/Ser protein kinase and it was sought to be 10 determined if PPM-1 is (directly or indirectly, e.g. via a cascade of Protein Kinases) the target of this kinase. To test this possibility, a full-size PPM-1 cDNA fused to a Hys-tag was expressed in wild type and inph2~ petunia plants. The recombinant PPM-1 protein was purified from flower extracts using a nickel column, then visualised using SDS-PAGE and immunodetection with anti-ATPase and antiphosphothreonine antibodies. This therefore 15 may assist in reconstructing a new small part of this pH-controlling pathway. Down regulation of MA C 9F1, a target gene of AN1, PH3 and PH4 essentialfor vacuolar acidification The nucleotide and derived amino acid sequence of the clone MAC 9F1 (SEQ ID NO: 3 20 and 4, respectively) do not show clear homology with any identified nucleic acid sequence or protein of known function, respectively. However when inverted repeats of 9F1 were expressed in petunia wild-type plants the silencing of the 9F1 endogenous gene resulted in blue flowers with increased flower extract pH. 25 Inverted repeat constructs (Gateway) An inverted repeat construct, pK7GWIWG2(I) MAC9F1 (Figure 3), of 9F1 was prepared using primers described in Table 10 and the Gateway system as described above. The inverted repeat 9F1 construct was introduced into Agrobacterium tumefaciens by electroporation and transfected into petunia via leaf disk transformation. Transformed 30 plants were selected on MS plates containing 250 microgram/ml of kanamycin, and after rooting, were grown under normal greenhouse conditions.

WO 2006/105598 PCT/AU2006/000451 -49 Of 2 transgenic plants produced, 1 resulted in a change in flower color from red to purple/blue. The change in flower color correlated with silencing of the endogenous 9F1 gene and a pH increase of the crude flower extract of 0.5 units. No effect was detectable on 5 the amount and type of anthocyanin pigment accumulated in the flowers of the silenced plants as determined by TLC and HPLC. TABLE 10 Primers used in amplification of MA C9F1 fragments. 10 SEQ ID NO: Primer No. Direction Sequence 5' to 3' 84 1706 reverse GTTCGCAAGCGCAATACTTAC 85 1707 forward GGAATTCGGCACGAGGTCAC 86 1743 forward AAGAGTAGCTGATCATGG 87 1768 forward GATGAGGACATGAAGGAGCAAAGAG 88 1876 reverse CTTCAGTCTTGCGTTTCTGCTTCC 89 1877 reverse CTCCTGTTTTGTCAGGCTTGGTGC 90 1878 reverse CGGCGGCGGTGGACTTGTCTTC 91 2061 reverse GCTCTAGACTAGAATATGCCAAAAGTGGTTGCAAC 92 2101 forward ATCGAATTCATGGCTGCACCAAGCCTAACAAAACAG 93 2178 reverse ACCGCTCGAGCTAGAATATGCCAAAAGTGGTTGCAAC To gain more insight into the function of the small protein encoded by the 9F1 gene, cellular localization is identified by studying a GFP fusion in transient assay and possible interacting partners identified by yeast two hybrid screening of a cDNA library. An 15 indication of the biochemical function of 9F1 could also come from the phenotype of plants overexpressing this gene. The result of a BLAST search with this protein identifies a small family of proteins of which the two members with the highest homology to 9F1 come from Arabidopsis and 20 rice. The characterization of an Arabidopsis knockout (KO) mutant for the 9F1 homologue might therefore be helpful.

WO 2006/105598 PCT/AU2006/000451 -50 Down regulation of CAC16.5 The nucleotide and derived amino acid sequence of the clone CAC16.5 is shown in SEQ ID NO: 5 and 6, respectively. The predicted amino acid sequence shows relatively high 5 homology with Cysteine Proteases. The localization of these enzymes is typically vacuolar and their activity is dependent on relatively low environmental pH. When a construct containing inverted repeats of CAC 16.5 was introduced into petunia wild-type plants the silencing of the CAC 16.5 endogenous gene surprisingly resulted in blue flowers with increased flower extract pH. 10 Inverted repeat constructs (Gateway) An inverted repeat construct, pK7GWIWG2(I) CAC16.5 (Figure 4), of CAC16.5 was prepared using primers described in Table 11 and the Gateway system as described above. 15 The inverted repeat CAC16.5 construct was introduced into Agrobacterium tumefaciens by electroporation and transfected into petunia via leaf disk transformation. Transformed plants were selected on MS plates containing 250 microgram/ml of kanamycin, and after rooting, were grown in normal greenhouse conditions. 20 Of 4 transgenic plants produced, 3 resulted in a change in flower color from red to purple/blue. The change in flower color correlated with silencing of the endogenous CAC16.5 and a pH increase of the crude flower extract of 0.3 units. No effect was detectable on the amount and type of anthocyanin pigment accumulated in the flowers of the silenced plants as determined by TLC and HPLC. 25 WO 2006/105598 PCT/AU2006/000451 - 51 TABLE 11 Primers used in amplification of CA C1 6.5fragments. SEQ ID NO: Primer No. Direction Sequence 5' to 3' 94 1654 reverse CCTGTATATAGTTGGAAATCC 95 1655 forward CAAGGCACTTGCAATATCACC 96 1769 reverse GTAATGACATTCAAACAGCATCC 97 1770 forward CTTCGTCGCCTCCTTATCCATCTCC 98 1870 reverse GGATTATCAAGAATTCATGGGG 99 1871 reverse GCCTCCTTATCCATCTCCAGCCC 5 Because the function of Cysteine Proteases is the cleavage of a variety of other peptides, it would be interesting to identify the target of the proteolitic action of CAC16.5. To do this a "bait" plasmid is constructed for yeast two hybrid screening in which the Cys25 residue in the active site of the CAC16.5 gene is mutated. This will avoid the cleavage of the substrate when the two protein interact with each other and will allow to isolate the "prey" 10 plasmid(s) containing the gene(s) that encodes for the target of CAC16.5. The characterization of the target of this proteolitic activity will help to further reconstruct the acidification pathway. Detailed analysis of flowers from wild type, pH mutant and plants overexpressing 15 regulators of the pH pathway has recently shown structural differences in the vacuoles of the epidermal cells (Quattrocchio et al, unpublished results). The most relevant difference involves the dimension and shape of the vacuoles in these cells and points towards a role of the PH genes in defining the height and width of vacuolar structure. Because the papillar shape of the cells in the corolla epidermis is peculiar to this tissue (to which this entire 20 acidification pathway is restricted as shown by expression studies of the genes involved), it is proposed that the genes controlling acidity in the vacuolar lumen possibly also definine the vacuole type (e.g. lytic or storage vacuole) and with it cell identity.

WO 2006/105598 PCT/AU2006/000451 -52 With this in mind, the pathway of events of AN1, PH3 and PH4 are dissected to understand if specific steps are related with the gaining of identity of the vacuole (and therefore of the cell) or the cell shape is simply a secondary effect of the internal pH of the vacuole compartment. The microscopic analysis of epidermal cells in flowers of plants 5 silenced for different genes along the pH regulating pathway will provide an answer to this question and will possibly open a window on the mechanism of vacuolar diversification. EXAMPLE 6 Isolation ofpH modulating cDNAs from other species 10 Anthocyanins of an array of colors are produced in various species such as but not limited to Petunia sp., Plumbago sp., Vitis sp., Babiana stricta, Pinus sp., Picea sp., Larix sp., Phaseolus sp., Solanum sp., Vaccinium sp., Cyclamen sp., Iris sp., Pelargonium sp., Geranium sp., Pisum sp., Lathyrus sp., Clitoria sp., Catharanthus sp., Malvia sp., Mucuna 15 sp., Vicia sp., Saintpaulia sp., Lagerstroemia sp., Tibouchina sp., Hypocalyptus sp., Rhododendron sp., Linum sp., Macroptilium sp., Hibiscus sp., Hydrangea sp., Ipomoea sp., Nicotiana sp., Cymbidium sp., Millettia sp., Hedysarum sp., Lespedeza sp., Antigonon sp., Pisum sp., Begonia sp., Centaurea sp., Commelina sp., Rosa sp., Dianthus sp. (carnation), Chrysanthemum sp. (chrysanthemums), Gerbera sp., Gentiana sp. Torenia sp., 20 Nierembergia sp, Liatrus sp.etc.. It is expected that a number of these plants contain pH modulating sequences and that down regulation of these pH modulating sequences will result in a change in flower color. 25 Detection ofputative pH-modulating sequences in other plant species The presence of pH-modulating polypeptides such as PPM1 (SEQ ID NO 2) MAC9F1 (SEQ ID NO 4) and CAC16.5 (SEQ ID NO 6) or other sequences identified as such is correlated with the occurrence of genes encoding these proteins. It would be expected that such genes from other species would hybridize with petunia sequences such as PPM1 30 (SEQ ID NO 1), MAC9F1 (SEQ ID NO 3) and CAC16.5 (SEQ ID NO 5) under conditions of low stringency. As an example of this DNA was isolated from a number of floral WO 2006/105598 PCT/AU2006/000451 - 53 species and subjected to Southern analysis whereby fractionated DNA was transferred to a membrane and hybridized with (i) 32P-labelled rose PPM1 (SEQ ID NO 98), Figure 5 or (ii) 32P-labelled petunia MAC9F1 (SEQ ID NO 3) and petunia CAC16.5 (SEQ ID NO 5), Figures 6 and 7 respectively. Therefore the isolation of pH-modulating genes from other 5 floral species should be possible using petunia or rose probes from genes identified as encoding pH-modulating proteins. The isolation of pH modulating cDNAs from the plants listed above and others is accomplished by the screening of respective petal cDNA libraries with SEQ ID NO:1 10 and/or 3 and/or 5 using low stringency hybridisation conditions such as those described below or in the introduction of the instant specification. Alternatively, the isolation of pH modulating cDNA fragments are accomplished using the polymerase chain reaction using primers such as those listed in the Examples above or 15 specifically designed degenerate primers. The amplification products are cloned into bacterial plasmid vectors and DNA fragments used as probes to screen respective cDNA libraries to isolate longer and full-length pH modulating cDNA clones. The functionality and specificity of the cDNA clones are ascertained using methods described in Examples described above. 20 Isolation of pH sequences from other species such as carnation, rose, gerbera, chrysanthemum etc. The isolation of sequences that surprisingly modulate the pH of the petal vacuole without any obvious impact on other metabolic pathways (SEQ ID NO: I to 6) allow for the 25 possibility of isolating similar sequences from any other species by various molecular biology and/or protein chemistry methods. These include but are not limited to preparation of cDNA libraries from RNA isolated from petal tissue, screening the petal cDNA libraries using low stringency hybridisation conditions using the labelled petunia sequences (SEQ ID NO: 1, 3 and 5) as probes, sequencing the hybridising purified cDNA clones and 30 comparing these sequences with the petunia sequences (SEQ ID NO: 1 to 6) and searching for any sequence identity and similarity, determining expression profiles of the isolated WO 2006/105598 PCT/AU2006/000451 -54 cDNA clones and selecting those that are preferentially expressed in petals, preparing gene constructs that allow for the specific sequence to be silenced in the plant using for example, antisense expression, co-suppression or RNAi expression. Ideally the plant of interest would also be producing delphinidin (or its derivatives). This could be achieved by 5 expressing a Flavonoid 3', 5' hydroxylase (F3'5'H) sequence as described in International Patent Applications PCT/AU92/00334 and/or PCT/AU96/00296 and/or PCT/JP04/11958 and/or PCT/AU03/01111. Preparation ofpetal cDNA libraries 10 Total RNA is isolated from the petal tissue of flowers using the method of Turpen and Griffith (BioTechniques 4: 11-15, 1986). Poly(A)+ RNA is selected from the total RNA, using oligotex-dT (Trade Mark) (Qiagen) or by three cycles of oligo-dT cellulose chromatography (Aviv and Leder, Proc. Natl. Acad. Sci. USA 69: 1408, 1972). 15 XZAPII/ Gigapack II Cloning kit (Stratagene, USA) (Short et al, Nucl. Acids Res. 16: 7583-7600, 1988) is used to construct directional petal cDNA libraries in AZAPII using around 5 tg of poly(A)*RNA isolated from petal as template. After transfecting XL1 -Blue MRF' cells, the packaged cDNA mixtures are plated at around 20 50,000 pfu per 15 cm diameter plate. The plates are incubated at 37"C for 8 hours, and the phage is eluted in 100 mM NaCl, 8 mM MgSO 4 , 50 mM Tris-HCl pH 8.0, 0.01% (w/v) gelatin (Phage Storage Buffer (PSB)) (Sambrook et al, 1989, supra). Chloroform is added and the phages stored at 4 0 C as amplified libraries. 25 Around 100,000 pfu of the amplified libraries are plated onto NZY plates (Sambrook et al, 1989, supra) at a density of around 10,000 pfu per 15 cm plate after transfecting XL 1-Blue MRF' cells, and are then incubated at 37*C for 8 hours. After incubation at 4*C overnight, duplicate lifts are taken onto Colony/Plaque Screen T M filters (DuPont) and are treated as recommended by the manufacturer. 30 WO 2006/105598 PCT/AU2006/000451 - 55 Plasmid Isolation Helper phage R408 (Stratagene, USA) is used to excise pBluescript phagemids containing cDNA inserts from amplified XZAPII or XZAP cDNA libraries using methods described by the manufacturer. 5 Screening ofpetal cDNA Libraries Prior to hybridization, duplicate plaque lifts are washed in prewashing solution (50 mM Tris-HCJ pH7.5, 1 M NaCl, 1 mM EDTA, 0.1% (w/v) sarcosine) at 65*C for 30 minutes; followed by washing in 0.4 M sodium hydroxide at 65'C for 30 minutes; then washed in a 10 solution of 0.2 M Tris-HCl pH 8.0, 0.1 x SSC, 0.1% (w/v) SDS at 65"C for 30 minutes and finally rinsed in 2 x SSC, 1.0% (w/v) SDS. The membrane lifts from the petal cDNA libraries are hybridized with 3 2 P-labelled fragments of petunia PPM1 (SEQ ID NO: 1) or petunia 9F1 (SEQ ID NO: 3) or petunia 15 CAC 16.5 (SEQ ID NO: 5). Hybridization conditions include a prehybridization step in 10% v/v formamide, 1 M NaCl, 10% w/v dextran sulphate, 1% w/v SDS at 42*C for at least 1 hour. The "P-labelled fragments (each at lx106 cpm/mL) are then added to the hybridization solution and 20 hybridization is continued at 42'C for a further 16 hours. The filters are then washed in 2 x SSC, 1% w/v SDS at 42*C for 2 x 1 hour and exposed to Kodak XAR film with an intensifying screen at -70*C for 16 hours. Strongly hybridizing plaques are picked into PSB (Sambrook et al, 1989, supra) and 25 rescreened to isolate purified plaques, using plating and hybridization conditions as described for the initial screening of the cDNA library. The plasmids contained in the XZAPII or XZAP bacteriophage vectors are rescued and sequence data is generated from the 3' and 5' ends of the cDNA inserts. New pH modulating cDNA clones are identified based on nucleic acid and predicted amino acid sequence similarity to the petunia PPM] 30 (SEQ ID NO: 1 and 2), MAC9F1 (SEQ ID NO: 3 and 4) or CAC16.5 (SEQ ID NO: 5 and 6) WO 2006/105598 PCT/AU2006/000451 - 56 Isolation of PPM cDNA homologues from rose A Rose (cv. 'rote rose') petal cDNA library was constructed utilizing total RNA isolated from rose petal tissue and a XZAP cDNA synthesis kit (Stratagene) according to 5 procedures described above and those recommended by the manufacturer. A library of 3 x 101 pfu was thus constructed for isolation of a rose PPM1 cDNA. The cDNA library was probed as follows. DIG-labelled petunia PPM-1 R27 cDNA fragement. Primer sets for DIG-labelling of PPM1 fragment were designed based on the 10 petunia PPM1 sequence (Sequence ID NO: 1). #2124: 5'-GCTAGGAGTGCTGCTGATCTTG #2078:5'-GGAGCCAGAAGTTTGTTATAGGAGG The PCR conditions used for labelling of the probe were as follows. 94C 1minx 1 15 94C 30sec, 55 "C 30sec, 72 C 1min x 25 72 C 7min x 1 Hybond-N(Amersham) membranes were used and treated according to the manufacture's instructions. Prior to hybridization, duplicate plaques lifts were washed in a prewash 20 solution (50mM Tris-HCl, pH7.5, 1 M NaCl, 1 mM EDTA, 0.1% sarcosine) at 65C for 30 minutes. This was followed by washing in 0.4M sodium hydroxide at 65C for 30 minutes, then in a solution of 0.2M Tris-HCl, pH 8.0, 0.1 x SSC, 0.1% (w/v) SDS at 65oC for 30 minutes and finally rinsed in 2 x SSC, 1.0% (w/v) SDS. 25 Hybridization conditions included a prehybridization step at 37 C for 2-3 hr in Hybridization Buffer (5 x SSC, 30% Formamide, 2% Blocking Reagent, 0.1% N lauroylsarcosine (Sodium salt), 1% SDS, 50mM Na-Phosphate Buffer (pH7.0)). Following removal of the prehybridization buffer hybridization mix was added which contained Hybridization Buffer (5 x SSC, 30% Formamide, 2% Blocking Reagent, 0.1% 30 N-lauroylsarcosine (Sodium salt), 1% SDS, 50mM Na-Phosphate Buffer (pH7.0)) with WO 2006/105598 PCT/AU2006/000451 -.57 DIG labelled probe added. Hybridization was carried out overnight at 37'C. Subsequent to this the filters were washed twice at 55 "C for 1 hr each. 300,000 pfu of the rose cDNA library was initially plated for screening. Two rounds of 5 screening yielded 36 positively hybridizing clones. These were in vivo excised according to the manufacture's instructions. In each case the excised cDNA was cloned in a phagemid vector pBluescript SK- and the inserts were subsequently sequenced. Of the original 36 three clones were found to encode an identical cDNA, the longest of them, PPM1 was used for further analysis. This sequence (SEQUENCE ID NO 98) was 10 identified as a rose PPM I clone by reason of homology with the petunia PPM 1 clone. The deduced amino acid sequence (SEQUENCE ID NO 99) when aligned with the petunia PPM1 sequence (SEQUENCE ID NO 2) also contained the same 3 amino acid residues at the C-terminus which have been identified as 'telletale' or typical of this class of P ATPases. 15 Isolation of PPM cDNA homologues from carnation Screening for a carnation PPM1 cDNA could utlilize either combined rose and petunia probes or individual probes. Initially a rosePPM1 was used to screen a carnation cDNA library. 20 Construction of Carnation cv. Kortina Chanel cDNA library Twenty micrograms of total RNA was isolated from stages 1, 2 and 3 of Kortina Chanel flowers and reverse transcribed in a 50 [tL volume containing 1 x Superscriptim reaction buffer, 10 mM dithiothreitol (DTT), 500 iM dATP, 500 iM dGTP, 500 pM dTTP, 500 [LM 25 5-methyl-dCTP, 2.8 pLg Primer-Linker oligo from ZAP-cDNA Gigapack III Gold cloning kit (Stratagene) and 2 pL Superscript" reverse transcriptase (BRL). The reaction mix was incubated at 37"C for 60 minutes, then placed on ice. A ZAP-cDNA Gigapack III Gold Cloning kit (Stratagene) was used to complete the library construction. The total number of 6 recombinants was 2.4 x 10 30 WO 2006/105598 PCT/AU2006/000451 - 58 The library was subsequently titred, prior to screening for PPM1 sequences, at 1.95 x 105 pfu (total). A 25 ml Culture of XL1 Blue IRF' cells in 25ml LB supplemented with 250pl 20% Maltose and 250ptl 1M MgSO 4 was incubated until OD 600 0.6-1. Cells were centrifuged at 4,000rpm for 10mins and then gently resuspended in 10mM MgSO 4 . The 5 mixture was stored on ice. 200ptl of the XL1 Blue MRF' cells was placed in a 12ml falcon tube and add 10[d of diluted library and incubated at 37'C for 15mins. To this was added 5ml NZY top agar (held at 50"C ) invert gently to ensure no bubbles and pour onto small (30ml) NZY plates pre-warmed at 42 0 C. These were incubated at RT to set for approximately 15mins. Plates were inverted and incubated at 37 0 C overnight to allow 10 plaques to form. The library was plated at 40,000 Pfu per plate over 12 large plates thus including 500,000 plaques in the primary screen. A 25 ml Culture of XLl Blue MRF' cells in 25ml LB supplemented with 250pl 20% Maltose and 250ul 1M MgSO 4 was incubated until OD 6 00 15 0.6-1.0 Cells were centrifuged at 4,000rpm (approx 3,000g) for 10mins in an eppendorf centrifuge and then gently resuspended in 10mM MgSO 4 and placed on ice An appropriate dilution of the library so was made to generate 40,000pfu/10i1 per plate. Following the procedure outlined above 12 plates were generated for transfer to nylon memebranes preparatory to screening for pH-modulating sequences such as PPM1, MAC9F and 20 CAC16.5. Following transfer the filters were transferred into prewash solution for 15 mins at 65'C and then into denaturing solution for 15 mins at RT and then into neutralising solution for 15 mins at RT. 25 Filters were subjected to prehybridization (6 large per bottle) in 20ml of 20% NEN (low stringency) at 42'C for at least 1 hour before overnight hybridization at 42"C with a 3P labelled rose PPM1 DNA probe generated using PCR. Low stringency washes were carried out as follows: 6xSSC/1%SDS 55 0 C for lhr x 2, 2xSSC/1%SDS 42 0 C for 40mins, 30 2xSSC/1%SDS 50 0 C for 20mins and 2xSSC/1%SDS 65 0 C for 30mins. 24 putative WO 2006/105598 PCT/AU2006/000451 -59 positives were seected based on relative hybridization signal and these collected for secondary screening. Positive "plugs" were excised and placed into an eppendorf tube containing 500pl of PSB 5 and 20pl Chloroform. These were agitated for 4hrs at room temperature, allowed to settle before removal of Ipl into PSB for plating as before.. 14 plaques were chosen for rescue and sequencing. As in the case of rose (see above) sequence analysis will reveal whether any of the clones isolated are in fact carnation PPM1 by virture of sequence alignment and a closer examination of the C-terminal sequence of the deduced amino acid sequence 10 derived from the cDNAs isolated as described. EXAMPLE 7 Use ofpH modulating sequences 15 In order to modulate (increase or decrease) the petal vacuolar pH in species or cultivars of species that do not normally produce delphinidin-based pigments and do not contain a flavonoid 3' 5' hydroxylases capable of hydroxylating dihydroflavonols, specifically dihydrokaempferol and/or dihydroquercetin, constructs containing the combination of a F3'3'H gene (such as but not limited to F3'5'H genes described in International Patent 20 Applications PCT/AU92/00334 and/or PCT/AU03/01 11) and a pH modulating or altering sequence are introduced into a species that does not normally produce delphinidin-based pigments. Such plants may include but are not limited to rose, carnation, chrysanthemum, gerbera, orchids, Euphorbia, Begonia and apple. 25 In order to modulate the petal vacuolar pH in species or cultivars of species that produce delphinidin or cyanidin but have a vacuolar pH such that the color exhibited is not blue, constructs containing one or more pH modulating sequences are introduced into such species. Such plants include but are not limited to pansy, Nierembergia, lisianthus, cultivars of grapevine, lily, Kalanchoe, pelargonium, Impatiens, Catharanthus, cyclamen, 30 Torenia, Petunia and Fuchsia.

WO 2006/105598 PCT/AU2006/000451 -60 Isolation of pH sequences from other species such as carnation, rose, gerbera, chrysanthemum etc. The isolation of sequences that surprisingly modulate the pH of the petal vacuole without any obvious impact on other metabolic pathways (SEQ ID NO: 1 to 6) allow for the 5 possibility of isolating similar sequences from any other species by various molecular biology and/or protein chemistry methods. These include but are not limited to preparation of cDNA libraries from RNA isolated from petal tissue, screening the petal cDNA libraries using low stringency hybridisation conditions using the labelled petunia sequences (SEQ ID NO: 1, 3 and 5) as probes, sequencing the hybridising purified cDNA clones and 10 comparing these sequences with the petunia sequences (SEQ ID NO: 1 to 6) and searching for any sequence identity and similarity, determining expression profiles of the isolated cDNA clones and selecting those that are preferentially expressed in petals, preparing gene constructs that allow for the specific sequence to be silenced in the plant using for example, antisense expression, co-suppression or RNAi expression. Ideally the plant of 15 interest would also be producing delphinidin (or its derivatives). This could be achieved by expressing a Flavonoid 3', 5' hydroxylase (F3'5'H) sequence as described in International Patent Applications PCT/AU92/00334 and/or PCT/AU96/00296 and/or PCT/JP04/11958 and/or PCT/AU03/01 111. 20 Preparation ofpetal cDNA libraries Total RNA is isolated from the petal tissue of flowers using the method of Turpen and Griffith (BioTechniques 4: 11-15, 1986). Poly(A)+ RNA is selected from the total RNA, using oligotex-dT (Trade Mark) (Qiagen) or by three cycles of oligo-dT cellulose chromatography (Aviv and Leder, Proc. Nati. A cad. Sci. USA 69: 1408, 1972). 25 XZAPII/ Gigapack II Cloning kit (Stratagene, USA) (Short et al, Nucl. Acids Res. 16: 7583-7600, 1988) is used to construct directional petal cDNA libraries in XZAPII using around 5 ptg of poly(A)*RNA isolated from petal as template. 30 After transfecting XL 1-Blue MRF' cells, the packaged cDNA mixtures are plated at around 50,000 pfu per 15 cm diameter plate. The plates are incubated at 37*C for 8 hours, and the WO 2006/105598 PCT/AU2006/000451 -61 phage is eluted in 100 mM NaCl, 8 mM MgSO 4 , 50 mM Tris-HC1 pH 8.0, 0.01% (w/v) gelatin (Phage Storage Buffer (PSB)) (Sambrook et al, 1989, supra). Chloroform is added and the phages stored at 4"C as amplified libraries. 5 Around 100,000 pfu of the amplified libraries are plated onto NZY plates (Sambrook et al, 1989, supra) at a density of around 10,000 pfu per 15 cm plate after transfecting XL1-Blue MRF cells, and are then incubated at 37 0 C for 8 hours. After incubation at 4 0 C overnight, duplicate lifts are taken onto Colony/Plaque Screen TM filters (DuPont) and are treated as recommended by the manufacturer. 10 Plasmid Isolation Helper phage R408 (Stratagene, USA) is used to excise pBluescript phagemids containing cDNA inserts from amplified XZAPII or %ZAP cDNA libraries using methods described by the manufacturer. 15 Screening ofpetal cDNA Libraries Prior to hybridization, duplicate plaque lifts are washed in prewashing solution (50 mM Tris-HCl pH7.5, 1 M NaCl, 1 mM EDTA, 0.1% (w/v) sarcosine) at 654C for 30 minutes; followed by washing in 0.4 M sodium hydroxide at 65*C for 30 minutes; then washed in a 20 solution of 0.2 M Tris-HCl pH 8.0, 0.1 x SSC, 0.1% (w/v) SDS at 65"C for 30 minutes and finally rinsed in 2 x SSC, 1.0% (w/v) SDS. The membrane lifts from the petal cDNA libraries are hybridized with "P-labelled fragments of petunia PPM1 (SEQ ID NO: 1) or petunia 9F1 (SEQ ID NO: 3) or petunia 25 CAC 16.5 (SEQ ID NO: 5). Hybridization conditions include a prehybridization step in 10% v/v formamide, 1 M NaCl, 10% w/v dextran sulphate, 1% w/v SDS at 42 0 C for at least 1 hour. The 32 P-labelled fragments (each at lx106 cpm/mL) are then added to the hybridization solution and 30 hybridization is continued at 42*C for a further 16 hours. The filters are then washed in 2 x WO 2006/105598 PCT/AU2006/000451 -62 SSC, 1% w/v SDS at 42 0 C for 2 x 1 hour and exposed to Kodak XAR film with an intensifying screen at -70'C for 16 hours. Strongly hybridizing plaques are picked into PSB (Sambrook et al, 1989, supra) and 5 rescreened to isolate purified plaques, using plating and hybridization conditions as described for the initial screening of the cDNA library, The plasmids contained in the UZAPII or XZAP bacteriophage vectors are rescued and sequence data is generated from the 3' and 5' ends of the cDNA inserts. New pH modulating cDNA clones are identified based on nucleic acid and predicted amino acid sequence similarity to the petunia PPM1 10 (SEQ ID NO: 1 and 2), MAC9FI (SEQ ID NO: 3 and 4) or CAC16.5 (SEQ ID NO: 5 and 6) Construction of a Plant transformation vetcor for down regulation of rose PPM1. The rose PPM cDNA was used as a basis for construction of a plant transformation vector 15 aimed at downregulation or gene knockout of rose PPMl in rose petals. Knockout of rose PPM1 would thus lead to elevation of petal vacuolar pH and change of flower color. To achieve gene knockout a strategy aimed at production of dsRNA for rose PPM1 was used. Thus a hairpin structure was engineered using 600bp of 5' sequence of the cDNA and incorporated into a CaMV 35S:mas expression cassette in the binary vector pBinPLUS. 20 This construct was named pSFL631 (Figure 8). It was transferred into Agrobacterium tumefaciens preparatory to transformation of rose tissue according to the method described below. A further construct aimed at confining expression of the rose PPM1 knockout cassette to petal tissue is now in progress. On example of such a strategy will include the use of a rose CHS promoter. Other genes of the anthocyanin biosynthetic pathway will be 25 a useful source of promoters for limiting expression of a gene cassestte to petals as desired. Manipulation of the sequences included in firther constructs will be used to alter the specificity of (i) gene knockout or silencing, and (ii) gene expression, that is expression of the pH-modulating sequences which are typically configured, using technology such as RNAi, to downregulate or silence the target gene. Such pH-modulating sequences will 30 include PPM1, MAC9F1 and CAC16.5 homologues from rose.

WO 2006/105598 PCT/AU2006/000451 - 63 Construction of a plant transformation vector for down regulation of carnation PPM1. The carnation PPM cDNA will be used as a basis for construction of a plant transformation vectors aimed at down regulation or gene knockout of carnation PPM1 in carnation petals. Knockout of carnation PPM1 would thus lead to elevation of petal vacuolar pH and change 5 in flower color. To achieve gene knockout a strategy aimed at production of dsRNA for carnation PPM1 is to be used. Thus a hairpin structure will be engineered using sequence of the cDNA from a region specific to the PPMl sequence and incorporated into both (i) constitutive, and (ii) petal-specific gene expression cassettes. In the former a CaMV 35S expression cassette (CaMV 35S promoter and terminator elements) and in the latter a petal 10 specific promoter from carnation. A promoter from a carnation ANS gene is one example of a promoter for petal-specific expression which could be engineered. The anthocyanin pathway genes provide a useful source of promoters for controlling petal-specific gene expression. However, such expression is not confined to the use of these promoters. dsRNA (RNAi) gene silencing constructs are based on a 500bp inverted repeat with an 15 intervening 182bp intron all under the control of 35S promoter or a petal specific promoter such as that from a carnation ANS gene. Carnation PPM1- ANS intermediate The intron will be cloned into pCGP1275 (Figure 9) using BamHI creating pCGP1275i. 20 The sense carnation PPMI (carnPPMl) will then be cloned into pCGP1275i using Xbal/BamHI creating pCGP1275i-s-carnPPMI. The antisense PPM1 will then be cloned into pCGP1275i-s-carnPPM1 using PstI/XbaI creating pCGP3210 (Figure 10). Carnation PPM1 - ANS in pWTT2132 binary transformation vector 25 The carnPPMl/ANS cassette will then be cut out of pCGP3210 with Xhol (blunt) to be ligated into the binary transformation vector pWTT2132 (Figure 11) to create the binary transformation vector pCGP321 1 (Figure 12) Carnation PPM1 - ANS in pBinPLUS binary WO 2006/105598 PCT/AU2006/000451 - 64 The carnPPM1/ANS cassette will be again cut out of pCGP3210 XhoI (blunt) and ligated into pBinPLUS KpnI (blunt) to create the binary transformation vector pCGP3215 (Figure 13). 5 Carnation PPM1 - ANS in pCGP2355 binary The carnPPMl/ANS cassette will again be cut out of pCGP3210 with to be ligated into pCGP2355 (Figure 14)to create the binary transformation vector pCGP3217 (Figure 15) PPM1- 35S intermediate 10 The carnation ANS intron will also be cloned into pCGP2756 (Figure 16) using BamHI creating pCGP2756i. The sense carnPPMI will then be cloned into pCGP2756i using EcoRI/BamHI creating pCGP2756i-s-carnPPMl. The antisense PPM1 will then be cloned into pCGP2756i-s-carnPPM1 using SacI/XbaI creating pCGP3212 (Figure 17). 15 Carnation PPM1 - 35S in pWTT2132 binary The carnPPMl/ANS cassette will then be cut out of pCGP3212 with PstI to be ligated into pWTT2132 to create the binary transformation vector pCGP3213 (Figure 18) Carnation PPM1 - 35S in pBinPLUS binary 20 The carnPPM1/ANS cassette will then be cut out of pCGP3212 with HindIII to be ligated into pWTT2132 to create the binary transformation vector pCGP3214 (Figure 19). Carnation PPM1 - 35S in pCGP2355 binary The carnPPMl/ANS cassette will be cut out of pCGP3212 with HindJII to be ligated into 25 pCGP2355 to create the binary transformation vector pCGP3216 (Figure 20). The transformation vectors generated above are to be used to engineer pH-modulation in a number of different targets and tissues. In general expression of pH-modulating sequences, such as silencing of carnation PPM1, will be either constitutive or petal 30 specific. Targets for transformation will include both carnations which produc delphindin WO 2006/105598 PCT/AU2006/000451 - 65 and those that do not. In each case assessment of the efficacy of pH modulation will be measured through measurement of pH and/or visualisation of color chanage. Construction of plant transformation vectors for down regulation of pH modulating genes. 5 It is envisaged that the above strategy would be used to downregulate or silence pH modulating genes such as PPM1, MAC9F1 and CAC16.5 and their homologues in carnation, rose, gerbera, chrysanthemum and other floral species of commercial value. Typically such a strategy would involve isolation of a homologue forom the target species. However, the strategy is not confined to this approach as gene silencing technologies such 10 as RNAi can be applied across species given conservation of appropriate sequences. Determination of whether such a strategy would be effective across species could best be arrived at through the isolation and characterisation of homologues form a traget species however. Such charcaterisation would include determination of the nucleotide sequence and subsequently the deduced amino acid sequence of pH-modulateing genes such as 15 PPM1, MAC9F1 and CAC16.5. It is thus conceivable that a rose PPM1 sequence could be used to design effective pH-modulating gene silencing constructs for use in another species such as carnation, gerbera or chrysanthemum. Binary transformation vectors, such as those described above, are used in plant 20 transformation experiments to generate plants carrying the desired genes, in this case pH modulating genes. It is in this fashion that it is intended to use pH-modulating genes from petunia, rose and carnation to alter petal pH and thus flower color in rose, carnation, gerbera, chrysanthemum and other floral species of commercial value. 25 Plant transformations Rosa hybrida transformations Introduction of pH modulating sequences into roses is achieved using methods as described in U.S. Patent Application No. 542,841 (PCT/US91/04412) or Robinson and 30 Firoozabady (Scientia Horticulturae, 55: 83-99, 1993) or Rout et al. (Scientia Horticulturae, 81: 201-238, 1999) or Marchant et al. (Molecular Breeding 4: 187-194, WO 2006/105598 PCT/AU2006/000451 - 66 1998) or Li et al (Plant Physiol Biochem., 40, 453-459, 2002) or Kim et al (Plant Cell Tissue and Organ Culture, 78, 107-111, 2004) or by any other method well known in the art. 5 Dianthus caryophyllus transformations Introduction of pH modulating sequences into carnations is achieved using methods as described in International Patent Application No. PCT/US92/02612, or International Patent Application No. PCT/AU96/00296, Lu et al. (Bio/Technology 9: 864-868, 1991), Robinson and Firoozabady (1993, supra) or by any other method well known in the art. 10 Chrysanthemum transformations Introduction of pH modulating sequences into chrysanthemum is achieved using methods as described in da Silva (Biotechnology Advances, 21, 715-766, 2003) or Aswath et al (Plant Science 166, 847-854, 2004) or Aida et al (Breeding Sci. 54, 51-58, 2004) or by any 15 other method well known in the art. Gerbera transformations Introduction of pH modulating sequences into gerbera is achieved using methods as described in Elomaa and Teeri (In YPS Bajaj, ed, Biotechnology in Agriculture and 20 Forestry, Transgenic Crops III,. Springer-Verlag, Berlin, 48, 139-154, 2001) or by any other method well known in the art. Ornamental plant transformations Introduction of pH modulating sequences into ornamental plants is achieved using methods 25 as described or reviewed in Deroles et al (In: Geneve RL, Preece JE & Markle SA (eds) Biotechnology of Ornamental Plants CAB International, Wallingford 87 119, 1997) or Tanaka et al (In: Chopra VL, Malik VS & Bhat SR (eds) Applied Plant Biotechnology. Oxford & IBH, New Delhi, 177-231, 1999) or Tanaka et al (Plant Cell, Tissue and Organ Culture 80, 1-24, 2005) by any other method well known in the art. 30 WO 2006/105598 PCT/AU2006/000451 - 67 Those skilled in the art will appreciate that the invention described herein is susceptible to variations and modifications other than those specifically described. It is to be understood that the invention includes all such variations and modifications. The invention also includes all of the steps, features, compositions and compounds referred to or indicated in 5 this specification, individually or collectively, and any and all combinations of any two or more of said steps or features.

WO 2006/105598 PCT/AU2006/000451 - 68 BIBLIOGRAPHY Altschul et al, Nucl. Acids Res. 25: 33 89-3402, 1997 Arango et al, Planta, 216:335-365, 2003 Ausubel et al., "Current Protocols in Molecular Biology" John Wiley & Sons Inc, 1994 1998, Chapter 15. Baxter et al, PNAS, 102:2649-2654, 2005 Bonner and Laskey, Eur. J Biochem. 46: 83, 1974. Brugliera et al, Plant J. 5, 81-92, 1994 de Vetten et al, Genes Dev. 11: 1422-1434, 1997 de Vetten et al, Plant Cell 11(8):1433-1444, 1999 de Vlaming et al Theor. Appl. Genet. 66, 271-278, 1983 Di Sansebastiano et al, Plant Physiology, 126, 78-86, 2001 Frohman et al, PNAS 85: 8998-9002, 1988 Fukada-Tanaka et al Nature 407, 581, 2000 Holton et al, Nature 366: 276-279, 1993 Holton and Cornish, Plant Cell 7: 1071-1083, 1995 WO 2006/105598 PCT/AU2006/000451 - 69 Jahn et al JBC, 277,6353-6358, 2002 Koes et al, Trends in Plant Science, May 2005 Logemann et al, Anal Biochem. 163(1):16-20, 1987 Merrifield, J. Am. Chem. Soc. 85:2149, 1964 Mol et al, Trends Plant Sci. 3: 212-217, 1998 Plant Molecular Biology Labfax, Croy (ed), Bios scientific Publishers, Oxford, UK, 1993 Plant Molecular Biology Manual ( 2 "d edition), Gelvin and Schilperoot (eds), Kluwer Academic Publisher, The Netherlands, 1994 Quattrocchio et al, Plant J 13, 475-488, 1998 Quattrocchio et al, Plant Cell, 2005 (submitted) Sambrook et al, Molecular Cloning. A Laboratory Manual, 2 "d edition, Cold Spring Harbor Laboratories, Cold Spring Harbor, NY, USA, 1989 Sambrook and Russell, Molecular Cloning: A Laboratory Manual 3 rd edition, Cold Spring Harbor Laboratories, Cold Spring Harbor, NY, USA, 2001 Spelt, C. et al. Plant Cell 14, 2121-2135, 2002 Tanaka et al, Plant Cell, Tissue and Organ Culture 80 (1): 1-24, 2005 van Houwelingen et al, Plant J. 13(l).: 39-50, 1998 WO 2006/105598 PCT/AU2006/000451 - 70 Verdonk et al. Phytochemistry 62:997-1008, 2003. Winkel-Shirley, Plant Physiol. 126: 485-493, 2001a Winkel-Shirley, Plant Physiol. 127: 1399-1404, 200 1b Yoshida et al. Nature 373, 291, 1995

Claims (21)

1. An isolated nucleic acid molecule comprising a sequence of nucleotides as set forth in SEQ ID NO: I or a nucleotide sequence having at least 95% identity thereto, said nucleic acid molecule encoding or complementary to a sequence encoding ATPase, wherein expression of said nucleic acid molecule in a cell alters or modulates p-I inside the vacuole.

2. The isolated nucleic acid molecule of Claim I comprising the nucleotide sequence set forth in SEQ 11) NO: 1.

3. The isolated nucleic acid molecule of Claim I encoding an amino acid sequence set forth in SEQ ID NO:2 or an amino acid sequence having at least 95% similarity thereto or a truncated form of SEQ ID NO:2.

4. The isolated nucleic acid molecule of Claim 3 encoding the amino acid sequence set forth in SEQ ID NO:2.

5. The isolated nucleic acid molecule of any one of Claims I to 4 fused to a gene encoding enzyme of the anthocyanin pathway.

6. A genetic construct comprising a nucleic acid molecule operably linked to a promoter such that upon expression a mRNA transcript is produced which is antisense to the nucleic acid molecule of any one of Claims I to 5.

7. A method for modulating the pH in a vacuole of a plant cell said method comprising introducing into said plant cell or a parent of said plant cell a genetic construct comprising a nucleic acid molecule operably linked to a promoter such that upon expression a mRNA transcript is produced which is antisense or sense to a nucleic acid molecule comprising a sequence of nucleotides as set forth in SEQ ID NO: I or a nucleotide sequence having at least 75% identity thereto or a nucleotide sequence capable of hybridizing to SEQ ID NO:1 or its complementary form under high stringency CV4RPonbl\DCC\AAR\3IK79XTI DOC-16/19/21iO - 72 conditions of from at least 31% v/v to at least 50% v/v formamide and at least 0.01 M to at least 0.15M salt for hybridization and from at least 0.01M to at least 0.15M salt for washing and at a temperature of at least 65C, said nucleic acid molecule encoding or complementary to a sequence encoding an ATPase wherein expression of said nucleic acid molecule in a cell alters or modulates pH inside the vacuole and culturing the plant cell or plant comprising said cell or parent or relative of said cell under conditions to permit expression of the nucleic acid molecule in the genetic construct.

8. The method of Claim 7 wherein the nucleic acid molecule comprises a nucleotide sequence set forth in SEQ ID NO:].

9. The method of Claim 7 wherein the nucleic acid molecule encodes an amino acid sequence set forth in SEQ ID NO:2 or an amino acid sequence having at least 75% similarity thereto or a truncated form of SEQ ID NO:2.

10. The method of Claim 9 wherein the isolated nucleic acid molecule encodes the amino acid sequence set forth in SEQ ID NO:2.

11. The method of any one of Claims 7 to 10, wherein the isolated nucleic acid molecule is fused to a gene encoding enzyme of the anthocyanin pathway.

12. A method for producing a transgenic flowering plant which synthesizes a vacuole pH modulating or altering protein, said method comprising stably transforming a cell of a suitable plant with a nucleic acid molecule as defined in any one of Claims 7 to I I under conditions permitting the expression of said nucleic acid sequence, regenerating a transgenic plant from the cell and growing said transgenic plant or a progeny thereof for a time and under conditions sufficient to permit the expression of the nucleic acid sequence.

13. A method for producing a transgenic plant with reduced indigenous or existing vacuole pl- modulating or altering activity, said method comprising stably transforming a cell of a suitable plant with a nucleic acid molecule as defined in any one of Claims 7 to I I C:\NRPonbhDCC\AAR\J X797_ .DOC-6'09/2..10 -73 which regulates expression of the corresponding indigenous gene in said plant, regenerating a transgenic plant from the cell and where necessary growing said transgenic plant or a progeny thereof under conditions sufficient to permit the expression of the nucleic acid.

14. A method for producing a genetically modified plant with reduced indigenous or existing vacuole pH modulating or altering protein activity, said method comprising altering the pI modulating or altering nucleic acid molecule encoding said activity, wherein said nucleic acid molecule is as defined in any one of Claims 7 to 11, through modification of said indigenous nucleic acid molecule via homologous recombination with a homologous non-functional or partially functional p-I modulating or altering gene with a sequence as defined in any one of Claims 7 to 11 or a part thereof with at least 10 nucleotides introduced into the plant cell, and regenerating the genetically modified plant from the cell.

15. A method for producing a transgenic plant expressing a recombinant gene encoding a pH modulating or altering protein or part thereof of at least 5 amino acids or which carries a nucleic acid sequence which is complementary to all or a part of at least 10 nucleotides of a mRNA molecule encoding a p1-I modulating or altering protein, said method comprising stably transforming a cell of a suitable plant with an isolated nucleic acid molecule as defined in any one of Claims 7 to 11, where necessary under conditions permitting the expression of' said isolated nucleic acid molecule and regenerating a transgenic plant from the cell.

16. The method of any one of Claims 7 to 15 wherein the nucleic acid sequence or the indigenous nucleic acid sequence comprises the nucleotide sequence set forth in SEQ ID NO:1.

17. The method of any one of Claims 7 to 16 wherein the plant is, or plant cell is from, a plant selected from Dianthus spp, Rosa spp, Chrysanthemum spp, Gerbera spp, C \NRPobI\DCC\AARM\ 797_1 DOC-MN92 10 - 74 Cyclamen spp, Iris spp, Pelargonium spp, Liparieae, Geranium spp, Sainipaulic spp and Plumbago spp.

18. A genetically modified plant or an isolated cell, part or progeny thereof which cell, plant or part comprises altered vacuolar p1-I in the cell or cells of the plant or plant parts, wherein said cell, plant or part has been genetically modified to introduce a nucleic acid molecule as defined in any one of Claims I to 5.

19. The plant part of Claim 18 selected from a flower, fruit, vegetable, nut, root, stem, leaf or seed.

20. The use of a nucleic acid molecule as defined in any one of Claims 7 to I 1 in the manufacture of a genetic construct for expressing a vacuole p-I modulating or altering protein or down-regulating an indigenous pH modulating protein in a plant.

21. An isolated nucleic acid according to any one of Claims I to 5 or a construct of Claim 6 or a method of any one of Claims 7 to 17 or a genetically modified plant of Claim 18 or a plant part of Claim 19 or the use of Claim 20 substantially as herein described with reference to the Figures and/or Examples.