AU2006202984A1 - A gene differentially expressed in breast and bladder cancer and encoded polypeptides - Google Patents

Description

P/00/011 Regulation 3.2

AUSTRALIA

Patents Act 1990 COMPLETE SPECIFICATION FOR A DIVISIONAL PATENT

ORIGINAL

TO BE COMPLETED BY APPLICANT Name of Applicant: Actual Inventors: Address for Service: Invention Title: UNIVERSITY OF ROCHESTER Maurice Zauderer, Elizabeth E Evans and Melinda A Borrello CALLINAN LAWRIE, 711 High Street, Kew, Victoria 3101, Australia A GENE DIFFERENTIALLY EXPRESSED IN BREAST AND BLADDER CANCER AND ENCODED POLYPEPTIDES The following statement is a full description of this invention, including the best method of performing it known to us:- 11107/06,ck15817july11front.1 la- N A GENE DIFFERENTIALLY EXPRESSED IN BREAST AND BLADDER CANCER AND ENCODED POLYPEPTIDES BACKGROUND OF THE INVENTION SField of the Invention This application is a divisional of application no. 2001253119, the disclosures \of which are deemed to be incorporated herein.

The present invention relates to a novel human gene that is differentially expressed in human breast and bladder carcinoma. More specifically, the present invention relates to apolynucleotide encoding a novel human polypeptide named This invention also relates to C35 polypeptides, as well as vectors, host cells, antibodies directed toC35 polypeptides, and the recombinant methods for producing the same. The present invention further relates to diagnostic methods for detecting carcinomas, including human breast and bladder carcinomas. The present invention further relates to the formulation and use of the C35 gene and polypeptides in immunogenic compositions or vaccines, to induce antibody and cell-mediated immunity against target cells, such as tumor cells, that express the gene. The invention further relates to screening methods for identifying agonists and antagonists of C35 activity.

Background Art Cancer afflicts approximately 1. 2 million people in the United States each year. About 50% of these cancers are curable with surgery, radiation therapy, and chemotherapy. Despite significant technical advances in these three types of treatments, each year more than 500, 000 people will die of cancer in the United States alone. (Jaffee, E. M.,Ann. N. Y Acad. Sci. 886 67-72 (1999)).

Because most recurrences are at distant sites such as the liver, brain, bone, and lung, there is an urgent need for improved systemic therapies.

The goal of cancer treatment is to develop modalities that specifically target tumor cells, thereby avoiding unnecessary side effects to normal tissue.

Immunotherapy has the potential to provide an alternative systemic treatment for I I/07/06,ckI 587j I I speciI most types of cancer. The advantage of immunotherapy over radiation and Cl chemotherapy is that it can act specifically against the tumor without causing normal tissue damage. One form of immunotherapy, vaccines, is particularly attractive because they can also provide for active immunization, which allows 00 C* 5 for amplification of the immune response. In addition, vaccines can generate a 0memory immune response.

\0 The possibility that altered features of a tumor cell are recognized by the Simmune system as non-self and may induce protective immunity is the basis for attempts to develop cancer vaccines. Whether or not this is a viable strategy depends on how the features of a transformed cell are altered. Appreciation of the central role of mutation in tumor transformation gave rise to the hypothesis that tumor antigens arise as a result of random mutation in genetically unstable cells. Although random mutations might prove immunogenic, it would be predicted that these wouldinduce specific immunity unique for each tumor. This would be unfavorable for development of broadly effective tumor vaccines. An alternate hypothesis, however, is that a tumor antigen may arise as a result of systematic and reproducible tissue specific gene deregulation that is associated with the transformation process. This could give rise to qualitatively or quantitatively different expression of shared antigens in certain types of tumors that might be suitable targets for immunotherapy. Early results, demonstrating that the immunogenicity of some experimental tumors could be traced to random mutations (De Plaen, et al., Proc. Natl. Acad. Sci. USA 85: 2274-2278 (1988); Srivastava, Old, Immunol. Today 9:78 (1989)), clearly supported the first hypothesis. There is, however, no a priori reason why random mutation and systematic gene deregulation could not both give rise to new immunogenic expression in tumors. Indeed, more recent studies in both experimental tumors (Sahasrabudhe et J. Immunol. 151:6202-6310 (1993); Torigoe et al., J.

Immunol. 147:3251 (1991)) and human melanoma (van Der Bruggen et al., Science 254:1643-1647 (1991); Brichard et al., J. Exp. Med. 178:489-495 (1993); Kawakami et al., Proc. Natl. Acad. Sci. USA 91:3515-3519 (1994); Boel et al., Immunity 2:167-175 (1995), Van den Eynde et al., J. Exp. Med. 182: Cl 689-698 (1995)) have clearly demonstrated expression of shared tumor antigens encoded by deregulated normal genes. The identification of MAGE-1 and other antigens common to different human melanoma holds great promise for the 00 future development of multiple tumor vaccines.

In spite ofthe progress in melanoma, very few shared antigens recognized O by cytotoxic T cells have not been described for other human tumors. The major 0challenge is technological. The most widespread and to date most successful approach to identify immunogenic molecules uniquely expressed in tumor cells is to screen a cDNA library with tumor-specific CTLs (cytotoxic T lymphocytes). Application of this strategy has led to identification of several gene families expressed predominantly in human melanoma. Two major limitations of this approach, however, are that screening requires labor intensive transfection of numerous small pools of recombinant DNA into separate target populations, which themselves often need to be modified to express one or more MHC molecules required for antigen presentation, in order to assay T cell stimulation by a minor component of some pool; and with the possible exception of renal cell carcinoma, tumor-specific CTLs have been very difficult to isolate from either tumor infiltrating lymphocytes (TIL) or PBL of patients with other types of tumors, especially the epithelial cell carcinomas that comprise greater than 80% of human tumors. It appears that there may be tissue specific properties that result in tumor-specific CTLs being sequestered in melanoma.

Direct immunization with tumor-specific gene products may be essential to elicit an immune response against some shared tumor antigens. It has been argued that, if a tumor expressed strong antigens, it should have been eradicated prior to clinical manifestation. Perhaps then, tumors express only weak antigens.

Immunologists have long been interested in the issue of what makes an antigen weak or strong. There have been two major hypotheses. Weak antigens may be poorly processed and fail to be presented effectively to T cells. Alternatively, the Snumber of T cells in the organism with appropriate specificity might be NC inadequate for a vigorous response (a so-called "hole in the repertoire").

Elucidation of the complex cellular process whereby antigenic peptides associate with MHC molecules for transport to the cell surface and presentation to T cells 00 S 5 has been one of the triumphs of modern immunology. These experiments have clearly established that failure of presentation due to processing defects or competition from other peptides could render a particular peptide less immunogenic. In contrast, it has, for technical reasons, been more difficult to establish that the frequency of clonal representation in the T cell repertoire is an important mechanism of low responsiveness. Recent studies demonstrating that the relationship between immunodominant and cryptic peptides of a protein antigen change in T cell receptor transgenic mice suggest, however, that the relative frequency ofpeptide-specific T cells can, indeed, be adetermining factor in whether a particular peptide is cryptic or dominant in a T cell response. This has encouraging implications for development of vaccines. With present day methods, it would be a complex and difficult undertaking to modify the way in which antigenic peptides of a tumor are processed and presented to T cells. The relative frequency of a specific T cell population can, however, be directly and effectively increased by prior vaccination. This could, therefore, be the key manipulation required to render an otherwise cryptic response immunoprotective.

These considerations of cryptic or sub-dominant antigens have special relevance in relation to possible immune evasion by tumors through tolerance induction.

Evidence has been presented to suggest that tumor-specific T cells in the tumorbearing host are anergic, possibly as a result of antigen presentation on nonprofessional APC (Morgan, D.J. et al., J. Immunol. 163:723-27 (1999); Sotomayor, E.M. et al., Proc. Natl. Acad. Sci. U.S.A. 96:11476-81 (1999); Lee, P.P. et al., Nature Medicine 5:677-85 (1999)). Prior tolerization of T cells specific for immunodominant antigens of atumor may, therefore, account for the difficulty in developing successful strategies for immunotherapy of cancer.

These observations suggest that T cells specific for immunodominant tumor antigens are less likely to be effective for immunotherapy of established tumors ,1 because they are most likely to have been tolerized. It may, therefore, be that T cells specific for sub-dominant antigens or T cells that are initially present at a lower frequency would prove more effective because they have escaped the 00 C\ 5 tolerizing influence of a growing tumor.

0 Another major concern for the development of broadly effective human IND vaccines is the extreme polymorphism of HLA class I molecules. Class I

O

SMHC:cellular peptide complexes are the target antigens for specific CD8+ CTLs.

The cellular peptides, derived by degradation of endogenously synthesized proteins, are translocated into a pre-Golgi compartment where they bind to class I MHC molecules for transport to the cell surface. The CD8 molecule contributes to the avidity of the interaction between T cell and target by binding to the o3 domain of the class I heavy chain. Since all endogenous proteins turn over, peptides derived from any cytoplasmic or nuclear protein may bind to an MHC molecule and be transported for presentation at the cell surface. This allows T cells to survey a much larger representation of cellular proteins than antibodies which are restricted to recognize conformational determinants of only those proteins that are either secreted or integrated at the cell membrane.

The T cell receptor antigen binding site interacts with determinants of both the peptide and the surrounding MHC. T cell specificity must, therefore, be defined in terms of an MHC:peptide complex. The specificity of peptide binding to MHC molecules is very broad and of relatively low affinity in comparison to the antigen binding sites of specific antibodies. Class I-bound peptides are generally 8-10 residues in length and accommodate amino acid side chains of restricted diversity at certain key positions that match pockets in the MHC peptide binding site. These key features of peptides that bind to a particular MHC molecule constitute a peptide binding motif.

Hence, there exists a need for methods to facilitate the induction and isolation of T cells specific for human tumors, cancers and infected cells and for S-6- T methods to efficiently select the genes that encode the major target antigens C recognized by these T cells in the proper MHC-context.

BRIEF SUMMARY OF THE INVENTION 00 0 The present invention relates to a novel polynucleotide, C35, that is 0 5 differentially expressed in human breast and bladder carcinoma, and to the \0 encoded polypeptide of C35. Moreover, the present invention relates to vectors, Shost cells, antibodies, and recombinant methods for producing C35 polypeptides andpolynucleotides. The present invention further relates to the formulation and use of C35 polypeptides and polynucleotides in immunogenic compositions to induce antibodies and cell-mediated immunity against target cells, such as tumor cells, that express the C35 gene products. Also provided are diagnostic methods for detecting disorders relating to the C35 genes and polypeptides, including use as a prognostic marker for carcinomas, such as human breast carcinoma, and therapeutic methods for treating such disorders. The invention further relates to screening methods for identifying binding partners of BRIEF DESCRIPTION OF THE FIGURES Figure 1 (Panels Panel A shows the DNA coding sequence (SEQ ID NO: 1) of C35. The sequence immediately upstream of the predicted ATG start codon is shown in lower case and conforms to the expected features described by Kozak, J. Biol. Chem. 266(30):19867-19870 (1991). Panel B shows the deduced amino acid sequence (SEQ ID NO:2) of Figure 2. (Panel A to PanelA: C35 is overexpressed in Breast tumor cell lines. Upper Panel: 300ng of poly-A RNA from 3 week old human thymus, normal breast epithelial cell line HI6N2 from patient 21, and 4 breast tumor cell lines derived one year apart from primary or metastatic nodules of the same patient 21; 21NT, 21PT 21MT1, and 21MT2, was resolved on a 1% agarose/formaldehyde gel and transferred to a GeneScreen membrane. This blot Swas hybridized with a 32 P labeled C35 probe. Hybridization was detected by CN exposing the blot to film for 15 hours. Lower Panel: To quanititate RNA loading, the same blotwas stripped and re-hybridizedwith a 32 P labeledprobe for Glyceraldehyde-3 Phosphate Dehydrogenase (GAPDH). For each sample the 00 C35 signal was normalized to the GAPDH signal. The numbers represent the a fold expression of C35 in each sample relative to H16N2. Panel B: C35 is expressed at low levels in normal tissues. A Blot containing 1 microgram of Spoly-A RNA from each of the indicated adult normal tissues (Clontech) was hybridized with a 3 2 P labeled C35 probe. Hybridization was detected by exposing the blot to film for 15 hours (upper panel), or 96 hours (lower panel).

Panel C. C35 is overexpressed in primary Breast tumors. A blot containing 2 micrograms of poly-A RNA from 3 primary infiltrating ductal mammary carcinoma, Tl, T2, T3 and 1 normal breast epithelium, N (Invitrogen) was hybridized with a 32 P labeled C35 probe. To normalize loading a 3 2 P labeled beta-Actin probe was included in the hybridization mix. Hybridization was detected by exposing the blot to film for 6 hours. The numbers represent the fold expression of C35 in each sample relative to normal breast epithelium.

Figure 3. Expression of C35 in Breast Tumor Cell Lines. C35 is overexpressed in different breast tumor cell lines. Upper Panel: 300ng of poly-A RNA from BT474 (ATCC HYB-20, mammary ductal carcinoma), SKBR3 (ATCC HTB-30, mammary adenocarcinoma), T47D (ATCC HTB-133, mammary ductal carcinoma), normal breast epithelial cell line H16N2 from patient 21, and 21-NT breast tumor cell line derived from primary tumor nodule of the same patient 21 was resolved on a agarose/formaldehyde gel and transferred to a GeneScreen membrane. This blot was hybridized with a "P labeled C35 probe. Hybridization was detected by exposing the blot to film for hours. Lower Panel: To quantitate RNA loading, the same blot was stripped and re-hybridized with a 32 P labeled probe for beta-actin. For each sample the signal was normalized to the actin signal. The numbers represent the fold expression of C35 in each sample relative to H16N2.

SFigure 4 (Panels Surface Expression of C35 Protein Detected by CI Flow Cytometry. 1 x 105 breast tumor cells were stained with 3.5 microliters of antiserum raised in BALB/c mice against Line 1 mouse tumor cells transduced with retrovirus encoding human C35 or control, pre-bleedBALB/c serum. After 00 a 30 minute incubation, cells were washed twice with staining buffer (PAB) and incubated with FITC-goat anti-mouse IgG (1 ug/sample) for 30 minutes.

O Samples were washed and analyzed on an EPICS Elite flow cytometer. Panel A: 21NT Panel B: SKBR3. Panel C: MDA-MB-231. These three breast tumor lines were selected to represent tumor cells that express high, intermediate and low levels ofC35 RNA onNorthem blots (see FIG. Abbreviations: nms, us; normal mouse serum; C35; C35 immune serum.

Figure 5 (Panels A and CML Selected Recombinant Vaccinia cDNA Clones Stimulate Tumor Specific CTL. Panel A: CML Selected vaccinia clones were assayed for the ability, following infection of B/C.N, to stimulate tumor specific CTL to secrete interferon gamma. The amount of cytokine was measured by ELISA, and is represented as OD490 An OD490 of 1.4 is approximately equal to 4 ng/ml of IFNg, and an OD490 of 0.65 is approximately equal to 1 ng/ml ofIFNg. Panel B: CML selected clones sensitize host cells to lysis by tumor specific CTL. Monolayers of B/C.N in wells of a 6 well plate were infected with moi=l of the indicated vaccinia virus clones. After 14 hours of infection the infected cells were harvested and along with the indicated control targets labeled with 5 Cr. Target cells were incubated with the indicated ratios of tumor specific Cytotoxic T Lymphocytes for 4 hours at 37 "C and percentage specific lysis was determined This experiment was repeated at least three times with similar results.

Figure 6 (Panels A and The Tumor Antigen Is Encoded by a Ribosomal Protein L3 Gene. Sequence of H2.16 and rpL3 from amino acid position 45 to 56. Panel A: The amino acid (in single letter code) and nucleotide sequence of cDNA clone rpL3 (GenBank Accession no. Y00225). Panel B: A single nucleotide substitution at C170T of the H2.16 tumor cDNA is the only sequence change relative to the published L3 ribosomal allele. This substitution CI results in a T54I amino acid substitution in the protein.

Figure 7 (Panels A and Identification of the Peptide Epitope Recognized by the Tumor Specific CTL. Panel A: CML assay to identify the 00 C\ 5 peptide recognized by tumor specific CTL. Target cells were labeled with t Cr O During the "Cr incubation samples of B/C.N cells were incubated with 0 l1M peptide L3 48 5 100 gM L34,.(T54) or 100 M peptide L34(I54).

O Target cells were incubated with the indicated ratios of tumor specific Cytotoxic T Lymphocytes for 4 hours at 37"C and percentage specific lysis was determined. This experiment was repeated at least three times with similar results. Panel B: Titration ofpeptide L34.- (154). Target cells were labeledwith "tCr. During the 51 Cr incubation samples of B/C.N cells were incubated either with no peptide addition or with the indicated concentrations (1pM, InM) of L3,.

56 (I54) BCA 39 cells were included as a positive control Target cells were incubated with the indicated ratios of Tumor Specific Cytotoxic T Lymphocytes for 4 hours at 37"C and percentage specific lysis was determined. The experiment was repeated twice with similar results.

Figure 8 (Panels 'Analysis of L3 Expressed by Each Cell Line.

Panel A: Sau3AI map of published rpL3 and H2.16. Shown above is the Sau3AI restriction map for the published ribosomal protein L3 gene (Top), and for H2.16 (Bottom). Digestion of cDNA for the published L3 sequence generates fragments of 200, 355, 348, 289, and 84bp. The pattern for H2.16 is identical except for an extra Sau3AI site at position 168 caused by the C170T.

This results in a 168bp digestion product in place of the 200bp fragment Panel B: The BCA tumors express both L3 alleles. RT-PCR products generated from each cell line or from vH2.16 were generated using L3 specific primers and then digested with Sau3AI, and resolved on a 3% agarose gel for 2 hours at 80 volts.

Panel C: The Immunogenic L3 allele is expressed at greatly reduced levels in B/C.N, BCB13, and Thymus. L3 specific RT-PCR products from each indicated sample were generated using a 32 P end labeled 5 prime PCR primer. No PCR 0 product was observed when RNA for each sample was used as template for PCR without cDNA synthesis, indicating that no sample was contaminated with genomic DNA. The PCR products were gel purified to ensure purity, digested with Sau3AI, and resolved on a3% agarose gel for 15hours at 60 volts. NoPCR product was observed in a control PCR sample that had no template added to it This result has been reproduced a total of 3 times.

\O Figure 9 (Panels Immunization with iL3 is Immunoprotective.

Panel A: Immunization with H2.16 induces tumor specific CTL. Balb/c mice (2/group) were immunized by subcutaneous injection with 5X106 pfu of vH2.16, or control vector v7.5/tk. Seven days later splenocytes were harvested and restimulated with peptide L34s 56 (I54) Five days following the second restimulation the lymphocytes were tested in a chromium release assay as described in Figure 11. The L3 48.56(54) peptide was used at a 1 micromolar concentration, and the L34s 5 6 (T54) peptide was used at a 100 micromolar concentration. Similar results were obtained when the immunization experiment was repeated. Panels B and C: Female Balb/cByJ mice were immunized as indicated The mice were challenged by SC injection with 200,000 viable BCA 34 tumor cells into the abdominal wall. Data is from day 35 post challenge.

These data are representative of 4 independent experiments.

Figure 10 (Panels A andB). Panel A: C35 coding sequence with translation; 5' and 3' untranslated regions are shown in lowercase letters. The predicted prenylation site, CVIL, at the 3' terminus is boxed. Panel B: Genomic alignment of C35 gene on chromosome 17.

Figure 11 (Panels A andB). C35Expression in Breast Carcinoma. was labeled with 3 2 P in a random priming reaction and hybridized to Northern blots at 106 cpm/ml. Each blot was stripped andre-probedwith GAPDH or Betaactin to normalize mRNA loads. The numbers indicate densitometry ratios normalized against GAPDH/Beta-actin. A value of 1 has been assigned to normal cell line H16N2, and all values are relative to the level of expression in the normal cell line. Panel A: C35 expression in breast epithelial cell lines.

SPanel B: C35 expression in primary breast tissue/tumors. 300 ng mRNA was NC electrophoresed on 0.8% alkaline agarose gels, then blotted to Genescreen Plus, except leftmost panel of B loaded with 1 pg mRNA from 3 primary tumors and 1 normal tissue control (Real Tumor Blots, Invitrogen). Similar exposures are 00 shown for all blots.

Figure 12. C35 Expression in Bladder Carcinoma. C35 was labeledwith 32 P in a random priming reaction and hybridized to aNorthem blot of tumor and 0normal RNA at 106 cpm/ml. The blot was stripped and re-probedwith Beta-actin to normalize mRNA loads. The numbers indicate densitometry ratios normalized against Beta-actin. Values are relative to the level of expression in the normal bladder samples. 300 ng mRNA was electrophoresed on 0.8% alkaline agarose gels, then blotted to Genescreen Plus.

Figure 13 (Panels A and FACS Analysis with Anti-C35 Antibodies.

Panel A: Breast cell lines were stained with (top panel) sera from mice immunized with Line 1 cells infected with C35 recombinant retrovirus, and (bottom panel) 2C3 purified monoclonal antibody or isotype control. Panel B: Bladder cell lines stained with 2C3 purified monoclonal antibody or isotype control.

Figure 14. Inhibition of Tumor Growth in Presence of 2C3 Antibody.

21NT breast tumor cells or H16N2 normal breast epithelial cells were incubated with the indicated concentrations of2C3 anti-C35 monoclonal antibody or anonspecific isotype control antibody. Cell growth was measured by XTT assay following 72 hour incubation in the presence or absence of antibodies.

Figure 15 (Panels A and CTL stimulated with C35 expressing dendritic cells specifically lyse C35+ Breast (21NT) and Bladder (ppT11A3) tumor cell lines, with minimal activity against normal breast (MEC), immortalized non-tumorigenic breast (H 16N2) andbladder(SV-HUC) cell lines, or an NK sensitive cell line (K562). Panel A: T cell line 4 was generated from normal human PBL. Panel B: T cell clone 10G3 was selected from line 4 for C35-specific activity. Target cell lines MEC, ppT1lA3 and SV-HUC are naturally HLA-A2 positive. Target cell lines 21NT and H16N2 were transected CI with HLA-A2 to provide a required MHC restriction element Figure 16 (Panels A and Cytokine Release from T Cell Clone 10G3 upon Stimulation with Targets. Panel A: IFN-gamma secretion. Panel B: TNF- 00 alpha secretion. Breast and bladder target cell lines were distinguished by the presence or absence of expression of HLA-A2 and C35 tumor antigen, an amino IN terminal 50 amino acid fragment of C35 (C35-50aa), or the irrelevant mouse L3 0ribosomal protein. Each marker was either endogenously expressed or introduced by transfection of an HLA-A2.1 construct (pSV2.A2), or by infection with a vaccinia recombinant of C35 (w.C35, w.C35-50aa), L3 or HLA-A2 (w.A2) DETAILED DESCRIPTION OF THE INVENTION Definitions The following definitions are provided to facilitate understanding of certain terms used throughout this specification.

In the present invention, "isolated" refers to material removed from its native environment the natural environment if it is naturally occurring), and thus is altered "by the hand of man" from its natural state. For example, an isolated polynucleotide could be part of a vector or a composition of matter, or could be contained within a cell, and still be "isolated" because that vector, composition of matter, or particular cell is not the original environment of the polynucleotide.

In the present invention, a "membrane" C35 protein is one expressed on the cell surface through either direct or indirect association with the lipidbilayer, including, in particular, through prenylation of a carboxyl-terminal amino acid motif. Prenylation involves the covalent modification of a protein by the addition of either a famesyl or geranylgeranyl isoprenoid. Prenylation occurs on a cysteine residue located near the carboxyl-terminus of a protein. The C polypeptide contains the amino acids Cys-Val-Ile-Leu at positions 112-115, with the Leu being the C terminal residue of the polypeptide. The motif Cys-X-X- SLeu, where represents any aliphatic amino acid, results in the addition of a 00 0 5 20 carbon geranylgeranyl group onto the Cys residue. Generally, following Saddition of this lipid the three terminal amino acid residues are cleaved off the IN0 polypeptide, and the lipid group is methylated. Prenylation promotes the Smembrane localization of most proteins, with sequence motifs in the polypeptide being involved in directing the prenylated protein to the plasma, nuclear, orgolgi membranes. Prenylation plays a role in protein-protein interactions, and many prenylated proteins are involved in signal transduction. Examples of prenylated proteins include Ras andthe nuclear lamin B. (Zhang, F.L. and Casey, Ann.

Rev. Biochem. 65:241-269 (1996)). The C35 protein has been detected on the surface of two breast tumor cell lines by fluorescence analysis employing as a primary reagent a mouse anti-human C35 antiserum (Figure 4).

In the present invention, a "secreted" C35 protein refers to a protein capable of being directed to the ER, secretory vesicles, or the extracellular space as a result of a signal sequence, as well as a C35 protein released into the extracellular space without necessarily containing a signal sequence. If the secreted protein is released into the extracellular space, the C35 secreted protein can undergo extracellularprocessing to produce a "mature" C35 protein. Release into the extracellular space can occur by many mechanisms, including exocytosis and proteolytic cleavage.

As used herein a C35 "polynucleotide" refers to a molecule having a nucleic acid sequence contained in SEQ ID NO:1. For example, the polynucleotide can contain the nucleotide sequence of the full length cDNA sequence, including the 5' and 3' untranslated sequences, the coding region, with or without the signal sequence, the secreted protein coding region, as well as fragments, epitopes, domains, and variants of the nucleic acid sequence.

Moreover, as used herein, a C35 "polypeptide" refers to a molecule having the Stranslated amino acid sequence generated from the polynucleotide as broadly C defined.

In specific embodiments, the polynucleotides of the invention are less than 300 nt, 200 nt, 100 nt, 50 nt, 15 nt, 10 nt, or 7 nt in length. In a further 00 0 5 embodiment, polynucleotides of the invention comprise at least 15 contiguous 0 nucleotides of C35 coding sequence, but do not comprise all or a portion of any C35 intron. In another embodiment, the nucleic acid comprising C35 coding Ssequence does not contain coding sequences ofa genomic flanking gene or 3' to the C35 gene in the genome).

In the present invention, the full length C35 coding sequence is identified as SEQ IDNO: 1.

A C35 "polynucleotide" also refers to isolated polynucleotides which encode the C35 polypeptides, and polynucleotides closely related thereto.

A C35 "polynucleotide" also refers to isolated polynucleotides which encode the amino acid sequence shown in SEQ ID NO: 2, or abiologically active fragment thereof.

A C35 "polynucleotide" also includes those polynucleotides capable of hybridizing, under stringent hybridization conditions, to sequences contained in SEQ IDNO: 1, the complement thereof, or the cDNA within the deposited clone.

"Stringent hybridization conditions" refers to an overnight incubation at 420 C in a solution comprising 50% formamide, 5x SSC (750 mM NaCI, 75 mM sodium citrate), 50 mM sodium phosphate (pH 5x Denhardt's solution, dextran sulfate, and 20 ig/ml denatured, sheared salmon sperm DNA, followed by washing the filters in 0.1x SSC at about 65 0

C.

Of course, a polynucleotide which hybridizes only to polyA+ sequences (such as any 3' terminal polyA+ tract of a cDNA), or to a complementary stretch ofT (or U) residues, would notbe included in the definition of "polynucleotide," since such a polynucleotide would hybridize to any nucleic acid molecule containing a poly stretch or the complement thereof practically any double-stranded cDNA clone).

SThe C35 polynucleotide can be composed of any polyribonucleotide or C polydeoxyribonucleotide, which may be unmodified RNA or DNA or modified RNA or DNA. For example, C35 polynucleotides can be composed of singleand double-stranded DNA, DNA that is a mixture of single- and double-stranded 00 regions, single- and double-stranded RNA, and RNA that is mixture of singleand double-stranded regions, hybrid molecules comprising DNA and RNA that IN may be single-stranded or, more typically, double-stranded or a mixture of 0single- and double-stranded regions. In addition, the C35 polynucleotides can be composed of triple-stranded regions comprising RNA or DNA or both RNA and DNA. C35 polynucleotides may also contain one ormore modified bases or DNA or RNA backbones modified for stability or for other reasons. "Modified" bases include, for example, tritylated bases and unusual bases such as inosine.

A variety of modifications can be made to DNA and RNA; thus, "polynucleotide" embraces chemically, enzymatically, or metabolically modified forms.

polypeptides can be composed of amino acids joined to each other by peptide bonds or modified peptide bonds, peptide isosteres, and may contain amino acids other than the 20 gene-encoded amino acids. The polypeptides may be modified by either natural processes, such as posttranslational processing, or by chemical modification techniques which are well known in the art. Such modifications are well described in basic texts and in more detailed monographs, as well as in a voluminous research literature.

Modifications can occur anywhere in the C35 polypeptide, including the peptide backbone, the amino acid side-chains and the amino or carboxyl termini. Itwill be appreciated that the same type of modification may be present in the same or varying degrees at several sites in a given C35 polypeptide. Also, a given polypeptide may contain many types of modifications. C35 polypeptides may be branched, for example, as a result of ubiquitination, and they may be cyclic, with or without branching. Cyclic, branched, and branched cyclic polypeptides may result from posttranslation natural processes or may be made -16- Sby synthetic methods. Modifications include acetylation, acylation, ADP-ribosylation, amidation, covalent attachment of flavin, covalent attachment of a heme moiety, covalent attachment of a nucleotide or nucleotide derivative, covalent attachment of a lipid or lipid derivative, covalent attachment of

OO

S5 phosphotidylinositol, cross-linking, cyclization, disulfide bond formation, demethylation, formation of covalent cross-links, formation of cysteine, M\ formation ofpyroglutamate, formylation, gamma-carboxylation, glycosylation, SGPI anchor formation, hydroxylation, iodination, methylation, myristoylation, oxidation, pegylation, proteolytic processing, phosphorylation, prenylation, racemization, selenoylation, sulfation, transfer-RNA mediated addition ofamino acids to proteins such as arginylation, and ubiquitination. (See, for instance, Proteins Structure And Molecular Properties, 2nd Ed., T. E. Creighton, W.

H. Freeman and Company, New York (1993); Posttranslational Covalent Modification of Proteins, B. C. Johnson, Ed., Academic Press, New York, pgs.

1-12 (1983); Seifter et al., Meth Enzymol 182:626-646 (1990); Rattan etal., Ann NYAcad Sci 663:48-62 (1992).) "SEQ ID NO: 1" refers to a C35 polynucleotide sequence while "SEQ ID NO: 2" refers to a C35 polypeptide sequence.

A C35 polypeptide "having biological activity" refers to polypeptides exhibiting activity similar to, but not necessarily identical to, an activity of a polypeptide, including mature forms, as measured in a particular biological assay, with or without dose dependency. In the case where dose dependency does exist, it need not be identical to that of the C35 polypeptide, but rather substantially similar to the dose-dependence in a given activity as compared to the C35 polypeptide the candidate polypeptide will exhibit greater activity or not more than about 25-fold less and, preferably, not more than about tenfold less activity, and most preferably, not more than about three-fold less activity relative to the C35 polypeptide.) Polynucleotides and Polypeptides A 348 base pair fragment of C35 was initially isolated by subtractive hybridization of poly-A RNA from tumor and normal mammary epithelial cell 00 Slines derived from the same patient with primary and infiltrating intraductal mammary carcinoma. Band, V. et al., Cancer Res. 507351-7357 (1990).

I\ Employing primers based on this sequence and that of an overlapping EST 0sequence (Accession No. W57569), a cDNA that includes the full-length coding sequence was then amplified and cloned from the BT-20 breast tumor cell line (ATCC, HTB-19). This C35 cDNA contains the entire coding region identified as SEQ ID NO:1. The C35 clone includes, in addition to the 348 bp coding sequence, 167 bp of 3' untranslated region. The open reading frame begins at an N-terminal methionine located at nucleotide position 1, and ends at a stop codon at nucleotide position 348 (FIG. A representative clone containing all or most of the sequence for SEQ ID NO: 1 was deposited with the American Type Culture Collection ("ATCC") on August 1,2000, andwas given the ATCC Deposit Number PTA-2310. The ATCC is located at 10801 University Boulevard, Manassas, VA 20110-2209, USA. The ATCC deposit was made pursuant to the terms of the Budapest Treaty on the international recognition of the deposit of microorganisms for purposes of patent procedure.

Therefore, SEQ ID NO: 1 and the translated SEQ ID NO: 2 are sufficiently accurate and otherwise suitable for a variety of uses well known in the art and described further below. For instance, SEQ ID NO: 1 is useful for designing nucleic acid hybridization probes that will detect nucleic acid sequences contained in SEQ ID NO: 1 or the cDNA contained in the deposited clone. These probes will also hybridize to nucleic acid molecules in biological samples, thereby enabling a variety of forensic and diagnostic methods of the invention. Similarly, polypeptides identified from SEQ ID NO:2 may be used to generate antibodies which bind specifically to C35, or to stimulate T cells -18- Swhich are specific for C35 derived peptides in association with MHC molecules NC on the cell surface.

Nevertheless, DNA sequences generated by sequencing reactions can contain sequencing errors. The errors exist as misidentified nucleotides, or as 00 5 insertions or deletions of nucleotides in the generated DNA sequence. The erroneously inserted or deleted nucleotides cause frame shifts in the reading I\ frames of the predicted amino acid sequence. In these cases, the predicted amino 0acid sequence diverges from the actual amino acid sequence, even though the generated DNA sequence may be greater than 99.9% identical to the actual DNA sequence (for example, one base insertion or deletion in an open reading frame of over 1000 bases).

Accordingly, for those applications requiring precision in the nucleotide sequence or the amino acid sequence, the present invention provides not only the generated nucleotide sequence identified as SEQ ID NO: 1 and the predicted translated amino acid sequence identified as SEQ ID NO:2. The nucleotide sequence of the deposited C35 clone can readily be determinedby sequencing the deposited clone in accordance with known methods. The predicted C35 amino acid sequence can then be verified from such deposits. Moreover, the amino acid sequence of the protein encoded by the deposited clone can also be directly determined by peptide sequencing or by expressing the protein in a suitable host cell containing the deposited human C35 cDNA, collecting the protein, and determining its sequence.

The present invention also relates to the C35 gene corresponding to SEQ ID NO: 1, or the deposited clone. The C35 gene can be isolated in accordance with known methods using the sequence information disclosed herein. Such methods include preparing probes or primers from the disclosed sequence and identifying or amplifying the C35 gene from appropriate sources of genomic material.

Also provided in the present invention are species homologs of Species homologs may be isolated and identified by making suitable probes or -19primers from the sequences providedherein and screening a suitable nucleic acid source for the desired homologue.

By "C35 polypeptide(s)" is meant all forms of C35 proteins and polypeptides described herein. The C35 polypeptides can be prepared in any 00 0 5 suitable manner. Such polypeptides include isolated naturally occurring O polypeptides, recombinantly produced polypeptides, synthetically produced IN polypeptides, or polypeptides produced by a combination of these methods.

O Means for preparing such polypeptides are well understood in the art.

The C35 polypeptides may be in the form of the membrane protein or a secreted protein, including the mature form, or may be a part of a larger protein, such as a fusion protein (see below). It is often advantageous to include an additional amino acid sequence which contains secretory or leader sequences, pro-sequences, sequences which aid in purification, such as multiple histidine residues, or an additional sequence for stability during recombinant production.

C35 polypeptides are preferably provided in an isolated form, and preferably are substantially purified. A recombinantly produced version ofa C3 polypeptide, including the secreted polypeptide, can be substantially purified by the one-step method described in Smith and Johnson, Gene 67:31-40 (1988).

polypeptides also can be purified from natural or recombinant sources using antibodies of the invention raised against the C35 protein in methods which are well known in the art.

Polynucleotide and Polypeptide Variants "Variant" refers to apolynucleotide orpolypeptide differing fromthe polynucleotide or polypeptide, but retaining essential properties thereof.

Generally, variants are overall closely similar, and, in many regions, identical to the C35 polynucleotide or polypeptide.

By a polynucleotide having a nucleotide sequence at least, for example, "identical" to a reference nucleotide sequence of the present invention, it is Z intended that the nucleotide sequence of the polynucleotide is identical to the N reference sequence except that the polynucleotide sequence may include up to five point mutations per each 100 nucleotides of the reference nucleotide sequence encoding the C35 polypeptide. In other words, to obtain a 0 5 polynucleotide having a nucleotide sequence at least 95% identical to areference nucleotide sequence, up to 5% of the nucleotides in the reference sequence may Sbe deleted or substituted with another nucleotide, or a number of nucleotides up Sto 5% of the total nucleotides in the reference sequence may be inserted into the reference sequence. The query sequence may be an entire sequence shown of SEQ ID NO:1, the ORF (open reading frame), or any fragment specified as described herein.

As a practical matter, whether any particular nucleic acid molecule or polypeptide is at least 90%, 95%, 96%, 97%, 98% or 99% identical to a nucleotide sequence of the presence invention can be determined conventionally using known computer programs. A preferred method for determining the best overall match between a query sequence (a sequence of the present invention) and a subject sequence, also referred to as a global sequence alignment, can be determined using the FASTDB computer program based on the algorithm of Brutlag et al., Comp. App. Biosci. 6:237-245 (1990). In a sequence alignment the query and subject sequences are both DNA sequences. An RNA sequence can be compared by converting U's to T's. The result of said global sequence alignment is in percent identity. Preferred parameters used in a FASTDB alignment of DNA sequences to calculate percent identity are: Matrix=Unitary, k-tuple=4, Mismatch Penalty=l, Joining Penalty=30, Randomization Group Length=0, Cutoff Score=l, Gap Penalty=5, Gap Size Penalty 0.05, Window Size=500 or the length of the subject nucleotide sequence, whichever is shorter.

If the subject sequence is shorter than the query sequence because of or 3' deletions, not because of internal deletions, a manual correction must be made to the results. This is because the FASTDB program does not account for 5' and 3' truncations of the subject sequence when calculating percent identity.

-21- For subject sequences truncated at the 5' or 3' ends, relative to the query CI sequence, the percent identity is corrected by calculating the number of bases of the query sequence that are 5' and 3' of the subject sequence, which are not Smatched/aligned, as a percent of the total bases of the query sequence. Whether 00 C 5 a nucleotide is matched/aligned is determined by results of the FASTDB Ssequence alignment This percentage is then subtracted from the percent identity, \0 calculated by the above FASTDB program using the specified parameters, to Sarrive at a final percent identity score. This corrected score is what is used for the purposes of the present invention. Only bases outside the 5' and 3' bases of the subject sequence, as displayed by the FASTDB alignment, which are not matched/aligned with the query sequence, are calculated for the purposes of manually adjusting the percent identity score.

For example, a 90 base subject sequence is aligned to a 100 base query sequence to determine percent identity. The deletions occur at the 5' end of the subject sequence and therefore, the FASTDB alignment does not show a matched/alignment of the first 10 bases at 5' end. The 10 unpaired bases represent 10% of the sequence (number of bases at the 5' and 3' ends not matched/total number of bases-in the query sequence) so 10% is subtracted from the percent identity score calculated by the FASTDB program. If the remaining 90 bases were perfectly matched the final percent identity would be 90%. In another example, a 90 base subject sequence is compared with a 100 base query sequence. This time the deletions are internal deletions so that there arenobases on the 5' or 3' of the subject sequence which are not matched/aligned with the query. In this case the percent identity calculated by FASTDB is not manually corrected. Once again, only bases 5' and 3' of the subject sequence which are not matched/aligned with the query sequence are manually corrected for. No other manual corrections are to made for the purposes of the present invention.

By a polypeptide having an amino acid sequence at least, for example, "identical" to a query amino acid sequence of the present invention, it is intended that the amino acid sequence of the subject polypeptide is identical to the query sequence except that the subject polypeptide sequence may include up Sto five amino acid alterations per each 100 amino acids of the query amino acid sequence. In otherwords, to obtain apolypeptide having an amino acid sequence at least 95% identical to a query amino acid sequence, up to 5% of the amino 00 5 acid residues in the subject sequence may be inserted, deleted, or substitutedwith Sanother amino acid. These alterations of the reference sequence may occur at the N, amino or carboxy terminal positions of the reference amino acid sequence or Sanywhere between those terminal positions, interspersed either individually

C

among residues in the reference sequence or in one or more contiguous groups within the reference sequence.

As a practical matter, whether any particular polypeptide is at least 96%, 97%, 98% or 99% identical to, for instance, the amino acid sequence shown in SEQ ID NO:2 or to the amino acid sequence encoded by deposited DNA clone, can be determined conventionally using known computer programs.

A preferred method for determining the best overall match between a query sequence (a sequence of the present invention) and a subject sequence, also referred to as a global sequence alignment, can be determined using the FASTDB computer program based on the algorithm of Brutlag et al., Comp. App. Biosci.

6:237-245 (1990). In a sequence alignment the query and subject sequences are either both nucleotide sequences or both amino acid sequences. The result of said global sequence alignment is in percent identity. Preferred parameters used in a FASTDB amino acid alignment are: Matrix=PAM 0, k-tuple=2, Mismatch Penalty=l, Joining Penalty=20, Randomization Group Length=0, Cutoff Score=l, Window Size=sequence length, Gap Penalty=5, Gap Size Penalty=0.05, Window Size=500 or the length of the subject amino acid sequence, whichever is shorter.

If the subject sequence is shorter than the query sequence due to N- or C-terminal deletions, not because of internal deletions, amanual correction must be made to the results. This is because the FASTDB program does not account for N- and C-terminal truncations of the subject sequence when calculating -23- Sglobal percent identity. For subject sequences truncated at the N- and C-termini, relative to the query sequence, the percent identity is correctedby calculating the number of residues of the query sequence that are N- and C-terminal of the subject sequence, which are not matched/aligned with a corresponding subject 00 S 5 residue, as a percent of the total bases of the query sequence. Whether a residue is matched/aligned is determined by results of the FASTDB sequence alignment This percentage is then subtracted from the percent identity, calculated by the above FASTDB program using the specified parameters, to arrive at a final percent identity score. This final percent identity score is what is used for the purposes of the present invention. Only residues to the N- and C-termini of the subject sequence, which are not matched/aligned with the query sequence, are considered for the purposes of manually adjusting the percent identity score.

That is, only query residue positions outside the farthest N- and C-terminal residues of the subject sequence.

For example, a 90 amino acid residue subject sequence is aligned with a 100 residue query sequence to determine percent identity. The deletion occurs at the N-terminus of the subject sequence and therefore, the FASTDB alignment does not show a matching/alignment of the first 10 residues at the N-terminus.

The 10 unpaired residues represent 10% of the sequence (number of residues at the N- and C- termini not matched/total number of residues in the query sequence) so 10% is subtracted from the percent identity score calculated by the FASTDB program. Ifthe remaining 90 residues were perfectly matchedthe final percent identity would be 90%. In another example, a 90 residue subject sequence is compared with a 100 residue query sequence. This time the deletions are internal deletions so there are no residues at the N- or C-termini of the subject sequence which are not matched/aligned with the query. In this case the percent identity calculated by FASTDB is not manually corrected. Once again, only residue positions outside the N- and C-terminal ends of the subject sequence, as displayed in the FASTDB alignment, which are not matched/aligned with the query sequence are manually corrected for. No other manual corrections are to C be made for the purposes of the present invention.

The C35 variants may contain alterations in the coding regions, Snon-coding regions, or both. Especially preferred are polynucleotide variants 00 S 5 containing alterations which produce silent substitutions, additions, or deletions, O but do not alter the properties or activities of the encoded polypeptide.

IND Nucleotide variants produced by silent substitutions due to the degeneracy of the Sgenetic code are preferred. Moreover, variants in which 5-10, 1-5, or 1-2 amino acids are substituted, deleted, or added in any combination are also preferred.

C35 polynucleotide variants can be produced for a variety of reasons, to optimize codon expression for a particular host (change codons in the human mRNA to those preferred by a bacterial host such as E. coli).

Naturally occurring C35 variants are called "allelic variants," and refer to one of several alternate forms of a gene occupying a given locus on a chromosome of an organism. (Genes II, Lewin, ed., John Wiley Sons, New York (1985).) Also, allelic variants can occur as "tandem alleles" which are highly homologous sequences that occur at different loci on chromosomes of an organism. These allelic variants can vary at either the polynucleotide and/or polypeptide level. Alternatively, non-naturally occurring variants may be produced by mutagenesis techniques or by direct synthesis.

Using known methods of protein engineering and recombinant DNA technology, variants may be generated to improve or alter the characteristics of the C35 polypeptides. For instance, one or more amino acids can be deleted from the N-terminus or C-terminus of the secreted protein without substantial loss of biological function. The authors of Ron et al., J. Biol. Chem. 268: 2984-2988 (1993), reported variant KGF proteins havingheparin binding activity even after deleting 3, 8, or 27 amino-terminal amino acid residues. Similarly, Interferon gamma exhibited up to ten times higher activity after deleting 8-10 amino acid residues from the carboxy terminus of this protein (Dobeli et al, J.

Biotechnology 7:199-216 (1988)).

Moreover, ample evidence demonstrates that variants often retain a C- biological activity similar to that ofthe naturally occurring protein. For example, Gayle and coworkers Biol. Chem 268:22105-22111 (1993)) conducted extensive mutational analysis of human cytokine IL-la. They used random 0 0 5 mutagenesis to generate over 3,500 individual IL- a mutants that averaged -1 amino acid changes per variant over the entire length of the molecule. Multiple -O mutations were examined at every possible amino acid position. The Sinvestigators found that "[m]ost of the molecule could be alteredwith little effect on either [binding or biological activity]." (See, Abstract.) In fact, only 23 unique amino acid sequences, out of more than 3,500 nucleotide sequences examined, produced a protein that significantly differed in activity from wild-type.

Furthermore, even if deleting one or more amino acids from the N-terminus or C-terminus of a polypeptide results in modification or loss of one or more biological functions, other biological activities may still be retained. For example, the ability of a deletion.variant to induce and/or to bind antibodies which recognize the secreted form will likely be retained when less than the majority of the residues of the secreted form are removed from the N-terminus or C-terminus. Whether a particular polypeptide lacking or C-terminal residues of a protein retains such immunogenic activities can readily be determined by routine methods described herein and otherwise known in the art.

Thus, the invention further includes C35 polypeptide variants which show substantial biological activity. Such variants include deletions, insertions, inversions, repeats, and substitutions selected according to general rules known in the art so as to have little effect on activity. For example, guidance concerning how to make phenotypically silent amino acid substitutions is providedin Bowie, J. U. et al., Science 247:1306-1310 (1990), wherein the authors indicate that there are two main strategies for studying the tolerance of an amino acid sequence to change.

The first strategy exploits the tolerance of amino acid substitutions by CI natural selection during the process of evolution. By comparing amino acid sequences in different species, conserved amino acids can be identified. These conserved amino acids are likely important for protein function. In contrast, the 00 S 5 amino acid positions where substitutions have been tolerated by natural selection indicates that these positions are not critical for protein function. Thus, positions tolerating amino acid substitution could be modified while still maintaining biological activity of the protein.

The second strategy uses genetic engineering to introduce amino acid changes at specific positions of a cloned gene to identify regions critical for protein function. For example, site directed mutagenesis or alanine-scanning mutagenesis (introduction of single alanine mutations at every residue in the molecule) can be used. (Cunningham and Wells, Science 244:1081-1085 (1989).) The resulting mutant molecules can then be tested for biological activity.

As the authors state, these two strategies have revealed that proteins are surprisingly tolerant of amino acid substitutions. The authors further indicate which amino acid changes are likely to be permissive at certain amino acid positions in the protein. For example, most buried (within the tertiary structure of the protein) amino acid residues require nonpolar side chains, whereas few features of surface side chains are generally conserved. Moreover, tolerated conservative amino acid substitutions involve replacement of the aliphatic or hydrophobic amino acids Ala, Val, Leu and lie; replacement of the hydroxyl residues Ser and Thr, replacement of the acidic residues Asp and Glu; replacement ofthe amideresidues Asn and Gin, replacement ofthe basic residues Lys, Arg, and His; replacement of the aromatic residues Phe, Tyr, and Trp, and replacement of the small-sized amino acids Ala, Ser, Thr, Met, and Gly.

Besides conservative amino acid substitution, variants ofC35 include (i) substitutions with one or more of the non-conserved amino acid residues, where the substituted amino acid residues may or may not be one encoded by the Sgenetic code, or (ii) substitution with one or more of amino acid residues having a substituent group, or (iii) fusion of the mature polypeptide with another compound, such as a compound to increase the stability and/or solubility of the polypeptide (for example, polyethylene glycol), or (iv) fusion of the polypeptide 00 5 with additional amino acids, such as an IgG Fc fusion region peptide, or leader C or secretory sequence, or a sequence facilitating purification. Such variant C polypeptides are deemed to be within the scope of those skilled in the art from 0 the teachings herein.

C

N For example, C35 polypeptide variants containing amino acid substitutions of charged amino acids with other charged or neutral amino acids may produce proteins with improved characteristics, such as less aggregation.

Aggregation of pharmaceutical formulations both reduces activity and increases clearance due to the aggregate's immunogenic activity. (Pinckard et al., Clin.

Exp. Immunol. 2:331-340 (1967); Robbins et al., Diabetes 36: 838-845 (1987); Cleland et al., Crit. Rev. Therapeutic Drug Carrier Systems 10:307-377 (1993).) Polynucleotide and Polypeptide Fragments In the present invention, a "polynucleotide fragment" refers to a short polynucleotide having a nucleic acid sequence contained in the deposited clone or shown in SEQ ID NO: 1. The short nucleotide fragments are preferably at least about 15 nt, and more preferably at least about 20 nt, still more preferably at least about 30 nt, and even more preferably, at least about 40 nt in length. A fragment "at least 20 nt in length," for example, is intended to include 20 or more contiguous bases from the cDNA sequence contained in the deposited clone or the nucleotide sequence shown in SEQ ID NO: 1. These nucleotide fragments are useful as diagnostic probes and primers as discussed herein. Of course, larger fragments at least 50, 100, 150, 200, 250, 300 nucleotides) are preferred.

Moreover, representative examples of C35 polynucleotide fragments include, for example, fragments having a sequence from about nucleotidenumber 1-50,51-100, 101-150, 151- 2 0 0,201-250,251-300, or 301 to the end of SEQ ID c, NO: 1 or the cDNA contained in the deposited clone. In this context "about" includes the particularly recited ranges, larger or smaller by several 4, 3, 2, or 1) nucleotides, at either terminus or at both termini. Preferably, these 00 5 fragments encode a polypeptide which has biological activity. More preferably, Sthese polynucleotides can be used as probes or primers as discussed herein.

0 In the present invention, a "polypeptide fragment" refers to a short amino O acid sequence contained in SEQ ID NO:2 or encoded by the cDNA contained in the deposited clone. Protein fragments may be "free-standing," or comprised within a larger polypeptide of which the fragment forms a part or region, most preferably as a single continuous region. Representative examples ofpolypeptide fragments of the invention, include, for example, fragments from about amino acid number 1-20, 21-40, 41-60, 61-80, 81-100, or 101 to the end of the coding region. Moreover, polypeptide fragments can comprise 9, 15,20,30,40,50,60, 70, 80, 90, or 100 amino acids in length. In this context "about" includes the particularly recited ranges, larger or smaller by several 4, 3, 2, or 1) amino acids, at either extreme or at both extremes.

Preferred polypeptide fragments include the secreted C35 protein as well as the mature form. Further preferred polypeptide fragments include the secreted C35 protein or the mature form having a continuous series of deleted residues from the amino or the carboxy terminus, or both.

As mentioned above, even if deletion of one or more amino acids from the N-terminus of a protein results in modification or loss of one or more biological functions of the protein, other biological activities may still be retained. Thus, the ability of shortened C35 muteins to induce and/or bind to antibodies which recognize the complete or mature forms of the polypeptides generally will be retained when less than the majority of the residues of the complete or mature polypeptide are removed from the N-terminus. Whether a particular polypeptide lacking N-terminal residues of a complete polypeptide retains such immunologic activities can readily be determined by routine -29r methods described herein and otherwise known in the art. It is not unlikely that a C3 5 mutein with alarge number of deletedN-terminal amino acidresidues may retain some biological or immunogenic activities. In fact, peptides composed of as few as 9 C35 amino acid residues may often evoke an immune response.

00 5 Accordingly, the present invention further provides polypeptides having CN one or more residues deleted from the amino terminus of the C35 amino acid C sequence shown in SEQ ID NO:2, up to the Threonine residue at position Snumber 105 and polynucleotides encoding such polypeptides.

C Also as mentioned above, even if deletion of one or more amino acids from the C-terminus of a protein results in modification or loss of one or more biological functions of the protein, other biological activities may still be retained. Thus, the ability of the shortened C35 mutein to induce and/or bind to antibodies which recognize the complete or mature forms of the polypeptide generally will be retained when less than the majority of the residues of the complete or mature polypeptide are removed from the C-terminus. Whether a particular polypeptide lacking C-terminal residues of a complete polypeptide retains such immunologic activities can readily be determined by routine methods described herein and otherwise known in the art. It is not unlikely that a C35 mutein with a large number of deleted C-terminal amino acid residues may retain some biological or immunogenic activities.

Accordingly, the present invention further provides polypeptides having one or more residues deleted from the carboxy terminus of the amino acid sequence of the C35 polypeptide shown in SEQ ID NO:2, up to the valine residue at position number 10, and polynucleotides encoding such polypeptides Moreover, the invention also provides polypeptides having one or more amino acids deleted from both the amino and the carboxyl termini. In preferred embodiments, the invention is directed to polypeptides having residues: S-9 to V-17; V-10 to V-17; E-16 to V-23; E-16 to R-24; E-16 to 1-25; S-21 to F-35; Cto T-38; E-31 to Y-39; E-36 to A-43; A-37 to A-45; A-37 to V-46; Y-39 to V-46; S-44 to 1-53; A-45 to 1-53; G-52 to L-59; E-54 to T-62; S-57 to F-75; R- 58 to 1-67; G-61 to 1-69; G-63 to F-83; E-66 to L-73; E-66 to V-74; F-83 to E- CN 103; D-88 to A-96; L-89 to A-96; A-92 to T-101; R-95 to L-102; A-96 to K-104; K-104 to V-113; 1-105 to V-113; 1-105 to 1-114 of SEQ ID NO:2, and polynucleotides encoding such polypeptides.

00 0, 5 Many polynucleotide sequences, such as EST sequences, are publicly 0 available and accessible through sequence databases.

\0 The human EST sequences referredto below were identified in a BLAST 0 search ofthe EST database. These sequences are believed to be partial sequences of the cDNA inserts identified in the recited GenBank accession numbers. No homologous sequences were identified in a search of the annotated GenBank database. The Expect value is a parameter that describes the number of hits one can "expect" to see just by chance when searching a database of aparticular size. It decreases exponentially with the Score that is assigned to a match between two sequences. Essentially, the E value describes the random background noise that exists for matches between sequences. In BLAST 2.0, the Expect value is also used instead of the P value (probability) to report the significance of matches. For example, an E value of 1 assigned to a hit can be interpreted as meaning that in a database of the current size one might expect to see 1 match with a similar score simply by chance.

For example, the following sequences are related to SEQ ID NO:1, GenBank Accession Nos.: AA971857 (SEQ ID NO:3); W57569 (SEQ ID NO:4); AI288765 (SEQ ID NO:5); W65390 (SEQ ID NO:6 W37432 (SEQ ID NO: N42748 (SEQ ID NO:8 AA971638 (SEQ ID NO:9 R22331 (SEQ ID NO: 10); AA308370 (SEQ ID NO: 11); AA285089 (SEQ ID NO: 12); R68901 (SEQ ID NO:13 AA037285 (SEQ ID NO:14 H94832 (SEQ ID NO: 15); H96058 (SEQ IDNO: 16); H56522 (SEQ IDNO: 17); AA935328 (SEQ ID NO: 18); AW327450 (SEQ ID NO:19); AW406075 (SEQ ID AW406223 (SEQ ID NO:21); AI909652 (SEQ ID NO:22); AA026773 (SEQ ID NO: 23); H96055 (SEQ IDNO:24); H12836 (SEQ IDNO:25); R22401 (SEQ ID NO:26); N34596 (SEQ ID NO:27); W32121 (SEQ IDNO:28); T84927 (SEQ -31- Z ID NO:29); R63575 (SEQ ID NO:30); R23 139 (SEQ ID NO:31); AA337071 c-i (SEQ ID NO:32);- AA8 13244 (SEQ ID NO:33); AA3 13422 (SEQ ID NO:34); N3 1910 (SEQ IDNO:35); N42693 (SEQ ID NO:36); N32532 (SEQ IDNO:37); AA375119 (SEQ ID NO:38); R(32153 (SEQ ID NO:39); R23369 (SEQ ID 00 5 NO:40); AA393628 (SEQ ID NO:41); H112779 (SEQ ED NO:42); AI083674 (SEQ ID NO:43); AA284919 (SEQ ID NO:44); AA375286 (SEQ ID (Ni AA830592 (SEQ ED NO:46); 1195363 (SEQ ED NO:47); T92052 (SEQ ID NO:48); A1336555 (SEQ ID NO:49); A1285284 (SEQ ED NO: 50); AA568537 (SEQ ED NO:51);- A1041967 (SEQ ID NO:52); W44577 (SEQ ID NO:53); R22332 (SEQ ID NO: 54); N27088 (SEQ ID NO: 55); 1196418 (SEQ ID NO: 56); A1025384 (SEQ DD NO: 57); AA707623 (SEQ ID NO: A1051009 (SEQ ID NO: 59); AA026774 (SEQ ID NO:60); W51792 (SEQ ID NO: 61); A1362693 (SEQ ID NO:62); AA91 1823 (SEQ ID NO:63); 1196422 (SEQ ID) NO:64); A1800991 (SEQ ID NO:65); A1525314 (SEQ DD NO:66); A1934846 (SEQ ID NO: 67); A1937133 (S.EQ ID NO: 68); AW006797 (SEQ ID NO: 69); A1914716 (SEQ ID NO:70); A1672936 (SEQ ID NO:71); W61294 (SEQ ID NO:72); A1199227 (SEQ ID NO:73); A1499727 (SEQ ID NO:74); R(32154 (SEQ ID A1439771 (SEQ ID NO:76); AA872671 (SEQ ID NO:77); AA502178 (SEQ ED NO:78); N26715 (SEQ lID NO:79); AA704668 (SEQ ID R(68799 (SEQ IOD NO:81); H56704 (SEQ ID NO:82); A1360416 (SEQ ID NO: 83).

Thus, in one embodiment the present invention is directed to polynucleotides comprising the polynucleotide fragments and full-length polynucleotide the coding region) described herein exclusive of one or more of the above-recited ESTs.

Also preferred are C35 polypeptide, and polynucleotide fragments characterized by structural or fuinctional domains. Preferred embodiments of the invention include fr-agments that comprise MHC binding epitopes and prenylatlon sites.

-32- Other preferred fragments are biologically active C35 fragments.

CI Biologically active fragments are those exhibiting activity similar, but not necessarily identical, to an activity of the C35 polypeptide. The biological activity of the fragments may include an improved desired activity, or a 00 01 5 decreased undesirable activity.

\0 Epitopes Antibodies Cellular peptides derived by degradation of endogenously synthesized proteins are translocated into a pre-Golgi compartment where they bind to Class I MHC molecules for transport to the cell surface. These class I MHC:peptide complexes are the target antigens for specific CD8+ cytotoxic T cells. Since all endogenous proteins "turn over," peptides derived from any cytoplasmic or nuclear protein may bind to an MHC molecule and be transported for presentation at the cell surface. This allows T cells to survey a much larger representation of cellular proteins than antibodies which are restricted to recognize conformational determinants of only those proteins that are either secreted or integrated at the cell membrane. The T cell receptor antigen binding site interacts with determinants of both the peptide and the surrounding MHC.

T cell specificity must, therefore, be defined in terms of an MHC:peptide complex. The specificity of peptide binding to MHC molecules is very broad and of relatively low affinity in comparison to the antigen binding site of specific antibodies. Class I-bound peptides are generally 8-10 residues in length that accommodate amino acid side chains of restricted diversity at certain key positions that match pockets in the MHC peptide binding site. These key features of peptides that bind to a particular MHC molecule constitute a peptide binding motif.

A number of computer algorithms have been described for identification of peptides in a larger protein that may satisfy the requirements of peptide binding motifs for specific MHC class I or MHC class II molecules. Because of Z the extensive polymorphism of MHC molecules, different peptides will often c-i bind to different MIIC molecules. Tables 1-3 list C3 5 peptides predicted to be MHC binding peptides using three different algorithms. Specifically, Tables I and 5 list C35 HLA Class I and HI epitopes predicted using the rules found at the 00 5 SYFPE1THIwebsite (vsiwyjz://35/http://1 34.2.96.221l/scripts/hiaserver.dll/ Erectrtm and are based on the book "MHC Ligands and Peptide Motifs" by Rarmensee, Bachmann, J. and Stevanovic, S. (Chapman Hall, New York 1997). Table 2 lists predicted MHC binding peptides derived from the sequence using the NMH BIMAS program available on the web (htti:/bimlas.dcrtnih.gov/ci-bin/molbio/ken parker comnboform). Finally, Tables 3 and 6 list predicted C35 peptides identified by the Tepitope program, a program for prediction of peptides that may bind to multiple different MHC class 11 molecules. Using Tepitope, four C35 peptides were identified as likely candidates for binding to a variety of LILA class HI molecules. These peptides are, in general, longer than those binding to HLA class I and more degenerate in terms of binding to multiple LILA class It molecules.

TABLE 1 peptides predicted by SYFPEITHI website (score reflects ligation strength): Class I MIEC HiLA-A*02O1 nonamers Position Score 1 2 34 56 78 9 9

SVAPPPEEV

23 88

DLIEAIRRA

37

ATYLELASA

19 97

SNGETLEKI

1.8 00 105 c-I ITNSRPPCV 18 2

SGEPGQTSV

17 c-I

AVKEQYPGI

17 38 T YLE LA SA V 16 61

GTGAFEIEI

16

YEKDLIEAI

16

FE.IEINGQL

107

NSRPPCVIL

41

ELASAVKEQ

14 58

RLGGTGAFE

14 59

LGGTGAFEI

14 66

EIEINGQLV

14 68

EINGQLVFS

14 81

GGFPYEKDL

14 00 9 c-i RRASNGETL 14 HLA-A*O2O1 decamers Pos Score 1 23 4 56 789 0 58

RLGGTGAFEI

22 96

ASNGETLEKI

19 104

KITNSRPPCV

19 37

ATYLELASAV

18 17 VEPGS GVRIV 17 33

CGFEATYLEL

16 44 SAVKI3QYPGI 16 92

AIRRASNGET

16 39

YLELASAVKE

-36- 53

IEIESRLGGT

c-i FEIEINGQLV 1 00 105 c-i ITNSRPPCVI 1 MS GEPGQTS V 14 c-i 63 is GAFEIEINGQ 1 68

EINGQLVFSK

14 69

INGQLVFSKL

14 83

FPYEKDLIEA

14 88

DLIEAIRRAS

14 93

IRRASNGETL

14 72

QLVFSKLENG

13 89

LIEAIRRASN

13 8

TSVAPPPEEV

12 16 EVEPGS GVRI 12 -37-

YPGIEIESRL

12

GGTGAFEIEI

12 00 8

GGFPYEKDLI

12 106

TNSRPPCVIL

12 E[LA-A*OZO3 nonamers Pos Score 1 23 4 56 7 89

FEATYLELA

12 HILA-A*O2O3 decamers Pos Score 1 23 4 567 89 0 36 EAT YL ELA SA 18 LILA-Al nonamers Pos Score 1 23 4 56 78 9 77

KLENGGFPY

-38- 2

SGEPGQTSV

18 21

SGVRIVVEY

18 00 1

EVEPGSGVR

17 29

YCEPCGFEA

17 42

LASAVKEQY

17 31

EPCGFEATY

16 34

GFEATYLEL

16 39 YLE LA SA VK 14 .84

PYEKDLIEA

14 66 EIEINGQLv 13 13

PPEEVEPGS

12 46

VKEQYPGIE

12 52

GIEIESRLG

12 96

ASNGETLEK

12 lFILA-At decamers __Pos Score 1 23 4 567 89 0 00 GS GVRIVVEY C1 29

YCEPCGFBAT

S 10 19 76

SKLENGGFPY

18 2

SGEPGQTSVA

17 52

GIEIESRLGG

17 66

EIEINGQLVF

17 41

ELASAVKBQY

16 46

VKEQYPGIEI

16 16

BVEPGSGVRI

CEPCGFEATY

39 YLE LASA V KB 77

KLENGGFPYE

14 86

EKDLIEAIRR

14 98

NGETLEKITN

14 34

GFEATYLBLA

12 00 64 c-i

AFEIEINGQL

12 101

TLEKITNSRP

12 HILA-A26 nonamers Pos Score 1 2 34 5 678 9 68 EINGQLVFs 24 100

ETLEKITNS

24 88

DLIEAIRRA

23 54

EIESRLGGT

22 41

ELASAVKEQ

21

AVKEQYPGI

31

EPCGFEATY

19 34

GFEATYLEL

19 -41 73

LVFSKLENG

19 16

EVEPGSGVR

18 00 77

KLENGGFPY

18 66

EIEINGQLV

17 21 S GVRIVVEY 16 37

ATYLELASA

16 24

RIVYBYCEP

9

SVAPPPEEV

14 22

GVRIVVEYC

14 51

PGIEIESRL

14

NGQLVFSKL

14 57

SRLGGTGAF

13

FEIEINGQL

13

IVVEYCEPC

12 -42- 48

EQYPGIEIE

12 67

IEINGQLVF

12 00 7 12 81

GGFPYEKDL

12 c-i 104

KITNSRPPC

12 105 ITNS RP PC V 12 ELA-A26 decamers Pos Score 1 23 45 6 789 0 41

ELASAVKEQY

27 66

EIEINGQLVF

26 68

EINGQLVFSK

23 26

VVEYCEPCGF

21 16

EVEPGSGVRI

88

DLIEAIRRAS

-43- 100

ETLEKITNSR

19 74

VFSKLENGGF

18 00 3 c-i CGFEATYLEL 17 54

EIESRLGGTG

17 56

ESRLGGTGAF

17 GS GVRIVVEY 16 31

EPCGFEATYL

16 64

AFEIEINGQL

is 69

INGQLVFSKL

61

GTGAFEIELN

14 73

LVFSKLENGG

14 9

SVAPPPEEVE

13

IVVEYCEPCG

13

AVKEQYPGIE

13 -44- 72

QLVFSKLENG

13 77 1 013 79 C~1 ENGGFPYEKD 13 S 10 4 EP GQTSVAPP 12 7

QTSVAPPPEE

12

CEPCGFBATY

12 36

EATYLELASA

12 37 ATY LBLA SA V 12 76

SKLENGGFPY

12 89

LIEAIRRASN

12 ELA-A3 nonamers Pos Score 12 34 56 7 89 39 YLE LA SA VK 28 77

KLENGGFPY

16

EVEPGSGVR

24 58

RLGGTGAFE

22 00 6 c-i IEINGQLVF 19 96

ASNGBTLEK

18 92

AIRRASNGE

17 9.

SVAPPPEEV

16 101

TLEKITNSR

16 22

GVRIVVEYC

31 EP CGFEATY

AVKEQYPGI

72

QLVFSKLEN

21

SGVRIVVEY

14 68

EINGQLVFS

14 69

LNGQLVFSK

-46- 88

DLIEAIRRA

c-I 14 91

EAIRRASNG

14 00 2

IVVEYCEPC

13 lo 1 37

ATYLELASA

13 c-I

IESRLGGTG

13 57

SRLGGTGAF

13 79

ENGGFPYEK

13 87

KDLIEAIRR

13 104

KITNSRPPC

13 24

RIVVEYCEP

12 42

LASAVKEQY

12 66

EIEINGQLV

12 89

LIEAIRRAS

12

IEAIRRASN

12 -47- 94

RRASNGETL

12 00 111 1 A-A3 decaners 00 Pos Score

IND

68

EINGQLVFSK

22 16

EVEPGSGVRI

38

TYLELASAYK

41 B LA SA VKEQY 66

EIEINGQLVF

9

SVAPPPEEVE

19 58

RLGGTGAFBI

19 39

YLELASAVKE

18 92 AIRRASN GET 18 RASN GETLEBK 18

AVKEQYPGIE

17 -48- 54

EIESRLGGTG

c-I 16 88

DLIEAIRRAS

16 00 8 c-I LIEAIRRASN 16 26 VYBYCEP COF 37 A TYL ELA SA V 22

GVRIVVEYCE

14 77

KLBNGGFPYE

14 93

IRRASNGETL

14

IVVEYCEPCG

13

CEPCGFEATY

13 52

GIEIESRLGG

13 76

SKLENGGFPY

13 78

LENGGFPYEK

13 101

TLEKITNSRP

13 -49- 104

KITNSRPPCV

13 24

RIVVEYCEPC

12 00 7

QLVFSKLENG

12 HLA-B*D7O2 nonamers Pos Score 1 2 34 56 78 9 18 EPGS GVRIV 19 107

NSRPPCVIL

18 4 SPG QT S VAP 11

APPPEEVEP

31

EPCGFEATY

14 34

GFEATYLEL

13 94

RRASNGETL

13 12

PPPEEVEPG

12 19 PGS GVRIVV 12 32

PCGFEATYL

12 83

FPYEKDLIE

12 00 106 c-i TNSRPPCVI 12 IIL-A-B*O7O2 C-i decanters Pos Score 1 23 4 567 89 0 31

EPCGFEATYL

24

YPGIEIESRL

21 18

EPGSGVRIVV

83

FPYEKDLIEA

16 4

EPGQTSVAPP

11

APPPEBVEPG

93

IRRASNGETL

14 106 TNSRPP CVIL 14 69

INGQLVFSKL

13 33

CGFEATYLEL

12 64 1 00 IILA-B*O8 octamers Pos Score ~1 23 45 67 8 83

FPYEKDLI

66

EIEINGQL

16 52

GIEIESRL

18 EPGS GVRI 14 54

EIESRLGG

14 91

EAIRRASN

14

RASNGETL

14 100

ETLEKITN

14 33

CGFEATYL

12

AVKEQYPG

12 -52- 58

RLGGTGAF

c-I 12 68

EINGQLVF

12 00 71

GQLVFSKL

12 ci 10

FSKLENGG

12 c-i 82

GFPYBKDL

12 107 NSRPP CVI 12 108

SRPPCVIL

12 HILAkB*08 nnmr Pos Score 1 2 34 56 78 9

FSKLENGGF

19 83

FPYEKDLIE

19

AVKEQYPGI

18

YEKDLIEAI

18 107

NSRPPCVIL

17 -53- 100

ETLEKITNS

54

EIESRLGGT

14 00 c-I

FEIEINGQL

14 91

EAIRRASNG

14 GS GVRIVVE 12 34

GFEATYLEL

12 51

PGIEIESRL

12 81

GGFPYEKDL

12 HIl[A-B*151O flonamers Pos Score 12 34 56 78 9 107

NSRPPCVIL

34

GFEATYLEL

13 51

PGIEIESRL

13, 81 0GGFP YE KDL 13 -54-.

94

RRASNGETL

c-I 13 EILA..B*2705 00 5 nonamers Pos Score S 12 34 56 78 9 57

SRLGGTGAF

26 94

RRASNGETL

67

IEINGQLVF

19 87

KDLIEAIRR

19 51

PGIEIESRL

17 81

GGFPYEKDL

17

FEIEINGQL

16 69

INGQLVFSK

16 96

ASNGETLEK

16 16

EVEPGSGVR

34 GFEATYL2L

YPGIEIESR

NGQLVFSKL

00 101 Cl TLEKITNSR 10 23

VRIVVEYCE

14 32

PCGFEATYL

14 39

YLELASAVK

14 79

ENGGFPYEK

14 93 IRRA SN GET 14 21 S GVRIVVEY 13 27 V EYCEP C F 13

FSKLENGGF

13 86

EKDLIEAIR

13 107

NSRPPCVIL

13 17

VEPGSGVRI

12 -56- 31

EPCGFEATY

12 77

KLENGGFPY

12 00 HILA-B*2709 nonamers Pos Score 123 45 6 78 9 94

RRASNGETL

57

SRLGGTGAF

81

GGFPYEKDL

16 34

GFEATYLEL

14 51

PGIEIESRL

13

FEIEINGQL

13 23

VRIVVEYCE

12 107

NSRPPCVIL

12 -57- HRLA-B*51O1 nonainers Pos Score 1 23 45 6 78 9 00 1 C~1EP GS GVRIV.

21 IND 81 0 10 GGFPYEKDL 21 51

PGIBIESRL

NGQLVFSKL

19 PGS GVRIVV 19 31 EP CGFEATY 19 2

SGEPGQTSV

18 42

LASAVKEQY

18 59

LGGTGAFEI

18 21

SGVRIVVEY

14 83

FPYEKDLIE

14 97

SNGETLEKI

-58- 13 P PEE VEP OS 13 38

TYLELASAV

13 00 4

AVKEQYPGI

13 63

GAFEIBING

13

RRASNGETL

13 12

PPPEEVEPG

12 33

CGFEATYLE

12

YPGIEIESR

12 66

EIEINGQLV

12

YEKDLIEAI

12

RASNGETLE

12 105

ITNSRPPCV

12 .59.

HLIA-B*51O1 octamners __Pos Score 1 23 45 67 8 83 00

FPYEKDLI

c-i

RASNGETL

23 c-I VAPPPEEV 21 18

EPGSGVRI

21 33

CGFEATYL

21 98

NGETLEKI

19 19

PGSGVRIV

18

GGTGAFEI

18 62

TGAFEIBI

18 63

GAFEIEIN

14 71

GQLVFSKL

14 48

EQYPGIEI

13 67

IEINGQLV

13 106

TNSRPPCV

12 00 Class II MC HLA-DRB1 *010115 -mers Pos Score 1 23 4 567 8.90 12 34 72

QLVFSKLENGGFPYE

29 37 A TYLEBLA SA VKEQYP 26 26

VVEYCEPCGFEATYL

63

GAFEIEINGQLVFSK

24

RIVVEYCEPCGFEAT

24 36

EATYLELASAVKEQY

24 39

YLELASAVKEQYPGI

24 53

IEIESRLGGTGAFEI

24 56

ESRLGGTGAFEIEIN

24 14

PEEVBPGSGVRIVVE

23 -61- 43

ASAVKEQYPGIEIES

23

GSGVRIVVEYCEPCG

00 6 C*62 NI

TGAFEIEINGQLVFS

S 10 32

PCGFEATYLELASAV

19 47

KEQYPGIEIESRLGG

19 64

AFEIEINGQLVFSKL

19 82

GFPYEKDLIEAJRRA

19 34

GFEATYLELASAVKE

18 54

EIESRLGGTGAFEIE

18

IEAIRRASNGETLEK

18 99

GETLEKITNSRPPCV

18 31

EPCGFEATYLELASA

17 49

QYPGIEIESRLGGTG

17 58

RLGGTGAFEIEINGQ

17 -62- 66

EIEINGQLVFSKLBN

17 67

IEINGQLVFSKLENG

17 00 68

EINGQLVFSKLENGG

17 S 10 84

PYBKDLIEAIRRASN

17 86

EKDLIEAIRRASNGE

17 F EA TYLE LAS AVKEQ 16 74

VFSKLBNGGFPYEKD

16 87

KDLIEAIRRASNGET

16 91

EAIRRASNGETLEKI

16 1

MSGEPGQTSVAPPPE

4

EPGQTSVAPPPEEVE

11

APPPEEVEPGSGVRI

*12

PPPEEVEPGSGVRIV

29

YCEPCGFEATYLELA

-63- P GQ TSVAP PPEEVEP 14 6

GQTSVAPPPEEVEPG

14 00 4 c-i SAVKEQYPGIEIESR 14 52

GIEIBSRLGGTGAFE

61 14

GTGAFEIEINGQLVF.

13

YPGIEIESRLGGTGA

12 E[LA-DRB1*O3O1 (DR17) 15 mr Pos Score 1 234 56 7 890 12 34 64

AFEIEINGQLVFSKL

26 39

YLELASAVKEQYPGI

72

QLVFSKLENGGFPYE

23 62

TGAFEIEINGQLVFS

22 24

RIVVEYCEPCGFEAT

19 71

GQLVFSKLENGGFPY

19 -64- 86

EKDLIEAIRRASNGE

rI 19 7

QTSVAPPPEEVEPGS

18 00 23

VRIVVEYCEPCGFEA

18 rI 10

YPGIEIESRLGGTGA

18 c-I

IEAIRRASNGETLEK

18

GSGVRIVVEYCBPCG

-17 87

KDLIEAIRRASNGET

17 99

GETLEKITNSRPPCV

16 28

EYCEPCGFEATYLEL

37

ATYLELASAVKEQYP

14 48

EQYPGIEIESRLGGT

14 78

LENGGFPYEKDLIEA

14 14 PEEVBPGS GVRIVVE 13

NGQLVFSKLENGGFP

43

ASAVKEQYPGIEIES

12 52

GIEIESRLGGTGAFE

12 00 54 c-I EIESRLGGTGAFEIE 12 ~10 74

VFSKLENGGFPYEKD

12 82

GFPYEKDLIEA]RRA

12 HILA-DRBI*04O1 (DR4Dw4) 15 mers Pos Score 12 34 56 78 9 012 34 36

EATYLELASAVKEQY

28 62

TGAFEIEINGQLVFS

28 86

EKDLIEAIRRASNGE

26 87

KDLIEAIRRASNGET

26

IEAIRRASNGETLEK

26 72

QLVFSKLENGGFPYE

22 82

GFPYEKDLIEATRRA

22 -66-

YPGIEIESRL('GTGA

99

GETLEKITNSRPPCV

00 26

VVEYCEPCGFEATYL

16 32

PCGFEATYLELASAV

16 c-I 47

KEQYPGIEIESRLGG

16

NGGFPYEKDLIEAIR

16 14

PEEVEPGSGVRIVVE

14

GSGVRIVVEYCEPCG

14 22

GVRIVVEYCEPCGFE

14 37

ATYLELASAVKEQYP

14 39

YLELASAVKEQYPGI

14 56

ESRLGGTGAFEIEIN

14 64

AFEIEINGQLVFSKL

14 66

EIEINGQLVFSKLEN

14 -67-

VAPPPEEVEPGSGVR

12 12

PPPEEVEPGSGVRIV

12 00 1 c-I EVEPGSGVRIVVEYC 12 S 10 29

YCEPCGFEATYLELA

12 C-I C PP CGF EATYL ELAS 12 31

EPCGFEATYLELASA

12 34

GFEATYLELASAVKE

12 F BA TYLE LA SA VKE Q 12 42

LASAVKEQYPGIEIE

12 48

EQYPGIEIESRLGGT

12 49

QYPGIEIESRLGGTG

12 53

IEIESRLGGTGAFEI

12 58

RLGGTGAFEIEINGQ

12 59

LGGTGAFEIEINGQL

-68- 61

GTGAFEIEINGQLVF

12 63 GAFEIEINGQLVFSK 1 00 67

IEINGQLVFSKLENG

12 S 10 68

EINGQLVFSKLENGG

12 69

INGQLVFSKLENGGF

12

YEKDLIEAIRRASNG

12 93

IRRASNGETLEKITN

12 94

RRASNGETLEKITNS

12 96

ASNGETLEKITNSRP

12 97

SNGETLEKITNSRPP

12 -69- TABLE 2 lILA peptide motif search results User Paraineters and Scorng Inoriationl method selected-to limit number of results exphct num I number o results requestedr HLA molecule type selected

A

length selected for subsequences to be Scored echi~oing mode selected for ipt sequence* length of user~s input peptide sequence 1[153 number of subsequenra scores calculated 10T7.

Inuiber of W-crn usqecsrprEac in Scoring outp ut tableT seorin Results ISubsequence Reiu Score (Etmt fHl ieofDis nodton of.

tartF; Pos- itio i -u Lis'ting a Molecule Containing This Subsequenee) FT- F 77 KLMk4GFPY 2257.. 000.- 2 T E VPGSGVR W-00 CPCGFEA f45.000 YLELASAVK 36.000 r7 f- F SGEPGQTSV 2120.

QrT 2V VVEYCEPCG TIM0 96 ASNGETLEK [1.500 LEKIThsR 40.900 i~CaInnSS 4G 0.900 [TF- 66F FrEEINGOLV [W3- 86 1 ELIEAIR r_

FTV

3 ~777;[ flGQLVFSK -f7 NETTLEL! E T7FTr 91-NELI9 F -79 CNGFPYEK0.0 Echoed User Peptide Sequence (length -115 residues) HLA peptidie motif search results User Parameters and scoring Information method selected to limit number of results xlctnme nurnbcr of results requested HLA molecule type selected Al length selected for subsequcnces to be scored 10 echiolng mode selected or input sequence y I ~length of user's inutpeptide sequence 115 l3 number of subseqfuencne scores calculated jnurub er of lop-sconug i s u iEquncreported Eack isearin outputl' ta1ed Suseuece Reidue Score (Etmate of Hal Tim of Dlisass'odatoa n-o(f' Listing a Molecule Contakng This; Subsequence) -29 YCEPcGFEAT :1 r i ScaGEPI!SVA 2.250 FT FLIr.AiRRSN GGVrl .VVEY ["So0 FI- -6-l EKD~IEAIEFR L250 .1 Tf- 95 RASNgETLEI( 1.000 ITT 68 rihrqLvFsl( I. F1- -T 1 EIFSrLGGTG 0.900 135F-TU j rTLEkITNSR FIF6j1 46 VtCEQyPGIEI 0.2 *j 1T 39 YLELaSAVKE f. 77~1~ KLENgGFPYS Fr 76 S nGGFT' Echoed User Peptide Sequence (length =115 residues) HLA peptide motif search results num be numb c. orrsireute OC0 length seLecte LFo bubSequences to be scored chFoig mode selecte for input seqcc cIechoing formal nu= js Wumbe of suDSequence scores calculatedf1 7 NOzmes 1 top-corng subsequences repouted back insongupt bi 2 ScrF( st m ter L istinge asa a tion o isVA ingV- a Molecule COtaining This Subsequence) FI~j KITNSRPPC231 F'-rrtisitncv _7342- F-4 FXi VVEYC-EPC1.8

F

3 F-ZT StXENGQL .1 F~ h KQYEGICI .1 0 F'-DLIArRR 07 F1D [Th GPY!CD-L 051 [FTh-T- :5ATYLCLA 0.50 13 F13-i Fi-n .41 FrT 111T-- VCPGSGVRI0.4 F1317-" SNGETLEI 0.1 FT6 NGQLVFSKL 06 F~r 22 GVRVVETC .0 F11 F 1 AVKEQYPCI0.6 YEKOLICAI 0151.

FirLSA 0.14 Echoed User Peptide Sequence (length 115 residues) -72- LiLA peptide motif search results User Paritneiers and scoring Informnation mehCUOd selCECae (0 11 M1 number of WE=ults V number 01 resuits requested H LA Molecule type selectd 00 I length s-ele-cte-d brsubsequences tob I echongm a or inptdf~ut soquencechoing tonnat lngth of usess Wnpt;pepbde squene fInumber of top-scorng subsequences reponWe back in. Scoring output a Echoed User Peptide Sequence (length =115 residues) HILA peptide motif search results User Parameters and scoring Information m~ethod selected to limit number of rwsuts ex.phcl nube number of results requested Iw HLA molecule type selected f 00length selected for susqecsto be scored Ehoing mode selected for input sequence y'' echoing fra leng. of user's input peptide sequence 1 1 j nub tf subsequeGc 9 sc calcu--e---[ 107~ Inurnber of top-scorng subsequences reported backm oinFng output table{ Sco ring Resutta- Subsquce Reiue cor( zate o a ofne Vmoa oi FListing a Molecule Containing This Subsequence) F7 I FIEINGQL 3.2 S3F V -APPPEEV K1TNSRPPC .0 [F f1Tf GPFYEKDL f .6 f~ NGOLUTSKL Our--0 ITNSBPCV f .340 r1F- ATYLELJ)AA 0.300 r7FI377 FEATYLELA f ~0!22 r T 7TT f EGGR [FT3- I fT -GTGAFEIEI [0.200- FRT 17 SNGETLEKI [0.150 [1 D f CEPCGMTA 0. 140 Fr- -w I YEIWLIEAI 0. 126 ;L3 I F PGIE IESRL G TGAEri' 0.10- F1TI~~f G"VvvEYc 010 EEVEPGSGV0.8 Echoed User Peptide Sequence (length 115 residues) liLA peptide motif search results 00 User Parameters and Scoring Information Imcthod sciccled to limit number of results -1acphczz nume I number of results requested HLA molecule type selected f -A205 length seetdIor subsequences to be scored 1 ectioing -mod .e -selece ror nput sequence C-- I aehong-K-f Ilength of uacs input peptide sequence L T3 jurnbcr of top-sconng subsequences reported back in scorng output 4F Scoring Results (Rak. artPostio I ubsequence Rese Sgcore (Esimainte oalftim e of Disasociationoi -P-itoI Listing a Molecule Containing This Subsequence) C9FEr'ILEL 6.300 KIT sRPCY 6.00 I FEiN~GQLV IEI~sR.CGT 3 j 3~j FPY~kDLIEA 1.150 RLGG tGAFEI f 1.20Z0 F-7-1 INE61F.1**0 YF PmeisiESRL 1.0150 [T ATYneLAsAv 0.600 11 t'tsnapGuo$sv 0.510 [TF (7yE~7. 0.420 THSRpPCVIL 13 I 1 RIVVeYCEPC [0.3D0 PT-F--42- I AVK YP~i -j0.200 [Tf1ID37-j ITNSrPPCVI f 0.117d SNELE(IT. 0.150 rsEGG FT [W GGTG&VEIZI [F010 92AIR~tnSNGET 0.0- Echoed User Peptide Sequence (length 115 residues) lILA peptide motif search results mehoduser Paramneters Rud Seenuag number of results requestedF- IHLA molecule type selected OC) length selected for subsequences to be scored I echong Mode M'ece Ibiwpu squencc io~ecoing format nr f sasequeti acaed of~ numbec rpore baculate IND mbm' of top-sconng subsequences inotd ac scoring output tabIl l Echoed User Peptide Sequence (length 115S residues) -76lILA Peptide, motif search results user Parrnetpe d Sni~ Echoed User Peptide Sequence (length 115 residues) LILA Peptide motif search results Echoed User Peptide Sequence (Iength 115 residues) -78- HLA peptide motif search results Usew Patrameters and Scoring 19Inforation mlcinod selectad to limit number of results number 01. rsults requesc HLA moleue *yp selected ccbiodcctd tr Iputsequence echog formMI I lengt of nsus iput peTide sequence Iunc sucons caiculatoa -nme f toP--niq subEquece ;ep~rted back in i8 onnga outu a Echoed User Peptide Sequence (length 115 residues) MIA peptide motif search results Usme'iZ Paaetand Scoinag lnfonmaon 17 number of results requested 17 ~HLA molecule type selected T T 00-ent selected for subsequences to be soe I length of usm's!ip ptdo sequence 1E Inumber of-subsequerce scores calculated 07 T IND fnumber of top-scorigi"subsequ=ne iijpafled back in scoring output tabIFW Fk usequence due'I Score (Esimaeo afTm f iascain 1 anr..~aottln Lsting a Molecule Containing This Subsequence) 1-1 W 39EASV Y4 0.400" [~I1 INGLVF5IK, 0.12 EVE PGSG;VR 1.2 Y TIEITSR 1 F7-1 96 GNGE 0.040 a V KDLI EAIRR .O 77 J KLENGGET'Y 0.036 ENGMrPYEK J0.024 ;T7-1 45 AVKEQYPGI j0 FF G TYLEL. 13053: IT NSRPPCV 0.010 GVRIVVFYC 0 .010 I72~T.[

TYLEAA

.87 .1 GFPYEKDLI 0.006 29 F 0. 006

LVFSICLENG

Echoed User Peptide Sequence (length -115I residues) HILA peptide motif search results F- User Parameters and Scoring Inforigatiou method sciected to limit nmnber of results j~~iniie F number ofrresults requested 4 HLX molecule type selected A4 101T length selected for subsequences to be scored F-echoing mode elJectea for 1input sequence ecoing loriat J I numbr of subsequenc scores calculated II 107 [nwnber of top-sconng subsequences reported back in scoring outu tab KuDput bftIFMM Stat Psiton s quenteesinaue Score (Estimate of Ha TMe of 1091isodaton f Fo r oiin Listing a Molecule Containing This Subsequeaee) TLEKITNSR f-2.0 iT~~I V~FG3GVR 0.600- F YPGZEIESR. 87KOLIEAIRR- 240 I ~YLELASAVK 0.200 I I ENGGFPY 0.180 ATYL'ELASA f0.060 IN(QLvFI o024 f .0.020.

FT--F- GTGAFTriZC 0.020 IT17I 9 f- SVAPPPIEV -b.020 I 121 24MVVEYP 0.012 GFEALEL (0.012 ITT W -T3 J LVFSKLFNG f0.012 I TYLE LAAV F 105F-T 7"sihppc~v0.1 FTFi 72 F QLVFSKLEN i O.UOs is 1 82 YEK DLr I.0 V-w V7-rTi.. T'c 0.006 I~~IF'ENGGEK:[.006 Echoed User Peptide Sequence (length =115 residues) -81- LILA peptide motif search results r~l User Parameters and Scoring Kale rrnxtlox 1 meth~od selected to limit number of results Ixlctnbe I nurnber of results requested HLA molecule "ye selected k330 0C) lengti selected for suBsequence to he scored ecihozngmoisee9Fbmput sequencej[ZZL J echoing onumbered iE Tlne legt ofue'mtputpeptide sequence T13 -number of subisequence scores alculae nuniber of top-.scoring subsiences Reprtd backin sconng outu q 2 1 rK1 ScorinZ4g ISubsentienc-e Residue Score mstunate of Half tme of Dhmaaoelnoa4o tart Position Listing a Molecule Containing This Subsequence) FT 6 EvEPGSGVR F2 fT~~T) TJ,EKITNSR 9.O YPGIEIEsR .6 66EIEINGOLV 13500- 1 11 86 EDLIER0.9 SASKQ Dif LIAIRRA F- 0.900 I1 TI~i EAYC 0.500 0.500 AVKE.QYPI3I 0500 Echoed User Peptide Sequence (length 115 residues) lILA peptide motif search results User Parameters and Scoing Information method Weected to limit number of results lexpl!cit number F ~number of results requested -N HLA molecule type selected length selected for subsequences to be scored9 ehoig ode seletedfr inutsequenre, y h length Of uses input peptide sequence t number of subsequence scores calcuLated F-T fnumber of top-soring subsequences reported bac a sewing output tbl Y.

Scorm Results Ran.k Strt Posliod.F Subseuee siue Score (Estimate otf 'Am IMOf issocaion of Listig a Molecle Containing This Subsequene .1 LEKITt4SR F 4 Z l EIEINGQLV ;1.501) ISGGT 1.500 7-F- sT 8EINIGQLVFS f .0 £XO ILAIR 0.900 T 1 j LASAVXEQ [0.900 D LIEPAS "FAA FT-F--6- MNGETlLE! 0..5009~.

FTT- QV2 GVVEYC0.0 0-500 F M4SG9-LEPGOTS NRPCVIL 0.50e -j SVAPPPEEV 0.500 FT-F-3 YEAA 0.500 AVKEQYPG.050 QYFOIC49ES 0.500E Echoed User Peptide Sequence (length 115 residues) -83- HIApeptide motif search results User Parasmeters and Scoring Infornnation method selected to Iiunit number of results lexpios mbernumb1er of results requested 1 2 HLA molecule type selected 'j-7x T 00 length selected for subsequences to be scored9 -11 ecEoing moe selece fa ZNut sequenc= CIU-rf n =r oF sbquence scores calculated I 71 IND Inu~mber of top-scoriig subsequences e'po'rted back in 0cong outp5t table! tar PsitonSubsequence Residue S~co9re (timateoI1HalTmRev ofPlasoiain ol F..k ;_Pstin Listing a Molecule Containing This Subsequence) FlT- I36' EVEPGSGVt .F -rj SV1AP PEEV f1.0 YPGIEIF.SR 567.ooom F-77 1 T F TLE;KITSit .1 .0 I T AV9YPG T iFi7 r__7 I tJGVPYEK F F TELASAVI( 3.000 FT- 6r--f GTGAFiEI f- KDLIEAIR 2.250 fI~f~ IN~LVFS{ 1IND KULIEXP~t 00 0 T_ IU ITNSRPPCV 1.00 FT1 3 F ATYLELASA1.0 rwri E~FSRGGA IVFCP 0 LvFSKLEG 0. 0800 rwr-1 DLFIRRlAi Echoed User Peptide Sequence (length -115 residues) -84liLA peptide motif search results User Parameters and Scorng Information method selected to limit number of results 2plctnbe number ofresults requested 2 HLA molecue type selected A8 length selected for subsequences to be scored9 r echoing mode selecte forinpt eqence- y fechoing forulat msw-dmnumber of r~ subseq un c i-csco e c ce Iatc rnumbe of Gop-sconng subsequcnces xeported backc In sconng output tabtel tAr Position SubequenceResidue ReScore (Estimrtgof HalfTIme f ahsoV= in f FO I Listing ja Molecule Containing This Subsequence) F EESM I n-s'7 00.0 S( I svppppsEV J .12.00 FT- 3 0 F YPIIEI.SR 1.0.000 PT -6 1 ASNGELEI( F- Y.00 V3-r AVx!cirpel 4.000 ENGGFPYEK 600 G1'GAFEIEI {3.000 FT 1 86EWLIEAIR 2.25S0 FTFF 7I 12 8 DLIEAIRR 100 F1T[~T j ATYLELASA [LOU0 ESRLGGTGA 0900 F1~F~3~ IVVEYCEPC o.6 .u 2W Evzczic 0.600F- Echoed User Peptide Sequence (length 115 residues) lILA peptide motif search results User Paramneters and Scoring Informdton method selected to limit number oF rsult-s epw ume number of results requested F M HLA molecule type selected length selected for subequences to be scored L edomgmodeselctedforipsdseqence echoing fon=a num. ke l aezsmptpept-ide sequence 115h numnber o subeeces calcu late f Inumber oftop-scornng subsequences rep8Rted bac m scoring output tablej T ak taequence Residue Soe(Estimate of Hal Time of Djistatin F-rpoitoni Litig a Molecule Containing This Subsequence) 100 1T~ TLEkITNSR 300.000 68 IGqLVF SK 15 T FEEpG.SGVR 3 5[3 RASN FELEFK 3.00 f5 YE'IEA IR -2.230 F7 9 SVAPpPEEVE I 5-F-7F I LVFSkLEN6TG 1-200 1~ rVVEYCEPCG 1.200 Ft1 1U 71 rr~sPPCV3 1.0.00.. ATYLOLASAV TOW,00 F4F- T -I TSV~ 5 pPEEV T 0.6 T3 7 avcsvvaycE 0.60W F T -Tr ISGEOTSV 0.600f .~YLIASAVC. IZF-T h VK-qYPG3Ii 0.400 Echoed User Peptide Sequence (length 115 residues) lIMA peptide motif search results User Paramneters and &oring Wnormiation method selected to lmit nwnber ofresutsIpic nme number of results requested HLA inolecule type selected length selected for susequencs to be scored ehoing format y length of user's input peptie sequence nuiver of subsequence scoies caculatedr l 117 Iniumber of top-scoring subsequences reported back in scoring outpu 20be Echoed User Peptide Sequence (length 115S residues) 00 -87- HiLA peptide motif search results I U, erTParanieIte -ad TS.cor-ng nformation.

F method selected to limit numiber of results .cpuinne number of results requested 2 [HLA molecule type selectedB1 length selected for subsequences to be scoRd0 -echoing mo seected for input sequenceechoing lormat lengho use's inpt pepbd se*q*eIce -f* Fnurn beroatsutisequence scares calculated l jmmnber of top-scoring subsequencem reported back in scoring output tablel I Scring Results~ Rk tSrubsetqu enceRes~ li Score (Emnate f alf ieofDssiaonof 1 Listing a Molecule Containing This Subsequence) 1- 103 T EKITnSRLPIC [6.7507 I- 33 CGF'FarYLEL f .0 £2RA L.I 4.000 E1T r VRI 3.500 DLIF.IFRAS 2.250 I

F-F_

I U 4 K7narPPCIVo 10t, TNSl~pPCVIL TO -Trf ATYLeLPSV 1 1.000 0.750 FTT 6- SXLF.GGFPY 0.750 Fruf 83 F'YE kDtIEA 0.750 FT371 8 TSVAppprE~v06D FIr 9 SGeTLEIO I a0 F~ 4 SVeYG 0.600 57 S FLGTGAFS I T97 f _3 I FI .RLPGT 0.450 savRi~v~yc Echoed User Peptide, Sequence (length 115 residues) -88- RLA peptide motif search results F user Parameters and Scoring iNfrm-ton method sclected to limit numbr of results number of results requested F{LA mnolccule type selected 00) jength selected for subsequences to be scored 011 echoing7mode selected for mjput sequence I ecoingcunam~tlength of user's input peptide sequence number of subsequencesoe c alcld NO Ijnumfberof top-scng subsequenCCeS epolleod bark mn scoring outputM Echoed User Peptide Sequence (length 115 residues) -89- HILA peptide motif search results User Parameters and Scoring Intormalon method selected to limit number of results number oftresults requested HLA molecule type selected 0C) length selected for subseqences to be scored echoin moeslctdfiput sequence echoing forniat length of uses inputpptide'sqec nubr fsusquence scores calculated [number of top-sroring subsequences reported bark in econ ut a Echoed User Peptide Sequence (length -115I residues) LILA peptide motif search results 00 User Paraineters and Scoring luorination Imethod selccted to limit number of results feXpicit number nuro(br of results F ILA molecule type selectedal~U f~-ecn d selected r p sequence b -!V mcoig formatnubrdIeI .1 lengt 0 us ss npu pepIude scquence 1 number of subsequence scoresw calclated0 *jnumber of top-sconng subsequence reported bacin scoin DUtpUt able JU Scoring Results Fk W susequence Resi uc I Score (Estimate of HalnTme ofDzsassociton o Listing ia Molecule Containing This Subsequnce) EPCGFEA TY 40.0'00 NS RPPC 4 LASAVKEQY 6.00 F--F -VEPGSVRIV 4.000 AVKEQYPG I VT 21r SGVRIVVEY r~r KLENGG F1 1.20 FTF--- GGFPYiiDL f 00 11-1~ 1 aGpGQTs 1. r 0 1r2 7 NGOLVFSKL FT3-~ 97 SNOETLEKI -0.00 rrf 8 PYEKOLIE j 0:400 GTGAF~E .0 LGGTGAFEI .0 flT] 1~O~f TlSRPPCVI YovaIERvvr 0300- FWF1-TF I* APP PEEVEP .1 .00 Echoed User Peptide Sequence (length =115 residues) JILA peptide motif search results ~~user rarameters and Scorn nfran mrecthod selected to li mit R-5-15ber .f results lexplicit nuMber number of r-esults requested HLA molecule type selected Ilength selected for subsequences to be soe 01 echoing mode selected for input sequence ecom-n o nnata-t jjnum- Nlength of use' Inu ebesqece Z c-i I ~numburof subsequence scores calcuIaEd R U niffbr of top-scoring subsequences reponedta msconngoOutptal~~ u.tosnnSlbe uence Residue Score (ifstimate o I ej f ListingIa_________ Containing ThsSubsequence) F7 -Y i E EcG-f -YL.1 16.000 F-1- ESR qTGAr r I 0- -F GsG-rIVVEY f10 FPEkD~lauw 6 000 f4SG~pGQ7SV .0 ASNG.TLtKX 2000 J~ Th-[1- f LASRVKcOYF 2.000 -FIT 1 44 AVKm0Y1pG [!.00 GGFPYEXDLI 0.600 26 Fr9-I367.. s -to_ PPPEeVEP3S Echoed User Peptide Sequence (length 115 residues) -92lILA peptide motif search results I user ramniters and Scoring Information I iriethod selected to limit number ofresults jexp Icit number number or rsults requested- 1 I. HA molecule type selected 'F f0r- OC) 4length selected foT subsequences to be scor-ed -eOing snicelected for input sequence lenth f uer inut eptdesequence f l number of subsequence scrscluaeT7 IND pjuniber of top-scoring subsequence rcported bec& in scoriing output tabre 2 Fktart Position Subseqene Reiue Score (-SteB D[a f T ismetin ot-1U I Litin a Molecule Containing This Subsequence) Vv--I RR ASNGETL [27 34 -1 GF"tATYhEL 9.00 F-r F--vf ?YLELASAV 4.000 F-4- 66 EEI IGLV 3.000 rF- r- GG4YEKDL7 1 -3.000.

F§F 79 EPGSGVIV r 1.500 J77 57I RLGGTGAF- L..00.

FT3-vE~ 11.000E FT4- 59 1 GGTGAitI 1.90 T73.j TIG5 INSPPrVv 1.000 F-rT&] -107- NSRPPCVIL.090 F 17-1 74 AVREQYPcI *j*--0.600

-J

P G I E I l I ~0 .6 0 0 I 0DELEK1TNS 0.0 Echoed User Peptide Sequence (length 115 residues) EILA peptide motif search results F -2 User Paraimieters and Scoring Informaifon number or results requested HLA molecule type selectedlengt selected fors ubsequencesto-Fe scord 00 C, 11:1ig Mode 11D r Input sequence ec hoin g ln length of uses input peptide sequence number o s-ubsequence scores calculated fnumbr of top-scoring ubsequencaes reprd ak inm scoring otu a Echoed User Peptide Sequence (length IJ15 reidues) -94- ULA peptide motif search results CK1User Paramneters and Scoringlnforiuhdfon mnethod selected to limit number of results number of results requested H-LK molee yposelected IengtI selectedil Ir sxbIequences1to c score 00 eching modes secte for input sequence I. ~lenAt Of useies nt qidsquce (N]numer f sbseuenice scores calcuilad IND number of top-56conng subsequences reported back in Scoring outputa Echoed User Peptide Sequence (length I IS residues) HILA peptide motif search results User Parameters and Scor-ing Informatlen method selected to limit number or results ncpuzcl nwnb F- number ofresults requested l h HLA molecule type selected -F-gfiselected for subsequences to be scored legthof uers inut peptide sequence fl T n mbaW ofsubsequence scores cluae Jnumber of top-scoring subsejenc reporte back M s*corn' output table-fTh cogReuts Rnk trPoionSubsequence Residne Score "Etmae aM]YG Tie of Diassii fn of i usting a Molecule Containing This Subsequence) F T 55IESR1G.GrGA IXIDu FjF 6F FElEiNGQLV 16.00 F IEIlNgQLVFS Meims j 8:000 5FEATyLELAS KUM0 7KOL~eAIlRRA F VEGsGVRIV CEPCgFEATY 33~ ccGFEayLEL 4 200 12 T3 27 vEycepcrFE 1.200 FT- 3 1 FPYCICOLIEA. LJ .00 FTY3F-4D-[ LEL.AsAVKEO 000 FT~T~TV ns~GEPqTSVAP.[-00 rT( IXA I rtASNG n do tT [T~7 .TNSBpPCVIL .0.750 9 SVAPP~EEV f.0 Fw SGEPgQTSVA uL Echoed User Peptide Sequence (length 115 residues) lILA peptide motif search results User Paramieters and Scoring Jnerunatlon method selected-to limit number of results jexpluit number number of results requested

F-N

lILA molecule type selected BJ201F 00) length selected for subsequences to be scared 0L....echioln MOCIC eleCted ttr iput sequence j Z~ form _jL11~ I length o seiutpeptide sequence nuiber ZlSubsequence, scozes cluae INDbe of to-crn usqecsRprtedback in soting ouut abI-j 2 Start PoSutobf~i~suce Re ue Score (Estimate 57Hl ie fDssocaino (RankListig *Ia Molecule Containing Mhs Subsequence) EPGSGRIV f75.000 F--F-6 IEINGQLVF f .22.500- LGTAE 112,50 [W7 NGETLEKrT? r I 1.

Fr-r 19-- PGSGVRIV r 10.000 EQYPIE 990 F-97[ 2 s(;FPGOTSV I .00 GGFLPYEKDL F .600 -3r7 TYLELASAV vfT 77- 1 F V.EYcePCGr 3.750 FT 3FPYEKoLIE rl1--VI71l VEPGSGVRFI[ 3.000 [l 7 F-w- NGOLVFSKL 240 FT67K G!PGORTSA 220 F TI- I GFPYEKDLI 2.2(X) 97 TT SttGETLEKI *f2.179- F9~7-TF7[ TNS'RPPC*V1~(J Echoed User Peptide Sequence (length -115 residues) BELA peptide motif search results I meth~od selecwe to Imut number of results nlumber ol results requested HLA molecule yp/e selected OC lenthi selce for 1! iuca to 1!111 score 00 aTOurgMods;)ctc foriput sequence echoing fonnat (N2 I nube or sub0sequence scares cluae INDumucr of top-sconrig subsequences reported back in sorng output t 0ja RI 1 LctrA'Ei 320- 7 1.

F T 39 LGGqAFPIE 1. Echoed Useer Peptide Sequence (length 115 residues) -98lILA peptide motif search results r~l JUser Parameters and Scoring lallorination I method selected to limit number of. resul Fs I)P t numbe number of results requested

W

1-ILA molecule type selectedB6 O)length selected for subsequences to be scored9 echoing mode selected for input sequence length of user's iut ppiesqec (Ni number Ot Subsequence scores calculate IND "nuber of top-scoring subsequences reported ibasck in scoring output tabi~f~ ScoRAig Resua-s- SubrsostonF eq uence Resue Score (Estimate .of Hall1 Tune ofD Ise wociatien I sfing a Molecule Containing This Subsequence) I~ 6 3 f rEIOEINQL37.I f VEPWGVf' j 7.

EEVEPGSGV I 1 KIM I 16.000- S ~Yra(DLILAI .0 T-F107 xsRPI Fv .0 DO F'r7-3 EA TYLELA .00O CGFPYEICDL 4.000 [FfI 30 CEPCGFEAT [-4.000 FT1 r 7 IEINGLVr IEAIP.RASN GETLEXITN *f2400 f13{~~j LELASAVK(E [1 fii'13T'I IErF3RLGG f [7

T

7 P~EIESL r0.968 [iT.355' 1 IESRLOGTG SIRASINGETL Fj Echoed User Peptide Sequence (length 115 residues) ILA peptide motif search results user Parameters and Scaring in ormation method selected to liruit number of results Feplici-t numb-Er number 01 results requested I 1-IHLA molecule type selected 00 [length selected for subsequences tobTe score Cl{echoing for mnat nuatbered lines length of user's input peptide sequenice I3 F ~~-unmbr of subsequence scores calculated-. 1 "uuiber ofto-onng subsequence reported back in ;coring Output tabl~ j olng Iesults- F .Sbene Residue S-core (Estimate of hl Ime of0 assoeaino tPosition Listing 8 Molecule Containing This Subsequeaee) F~r~Th rIEiNGQLV 16.000 TNSJpPCVIL [1600 fl 3~ IEIESRLGGT 800 CGTEaTYL EL f .0 Vj 17 VEPGSGVRIV8.0 69 NGQ VTSKL .0 YPGIeIESRL 4.840 GGFPYEKDL lj EPCGCATYL 400 F1TTf I~N9OiVrS 3.200 FI-irF DLIeAIRIA J1.100 [1 7 MNgFPY 0.800go 0W [1 pCVE 0.0 FT- 9 GETLeKI4NS .o F 7.3 i EPC FEATY .0 ~IEAIrRASNG j .j4- GEEGqTSVAP 0.0 I LEfLASAVKEQ 0.09- Echoed User Peptide Sequence (length 115 residues) -100lILA peptide motif search results lUserrarametern ace Scu.1ing lctorMfic method selected to limit nurnber ol results FP E Izc -n-.b number of results requested -w HLA molecule type selected- b-1F length selece for subse-quencew to be scared e hig mode select for input sequeneIY echoing formal l enghofusees iputehesqec nuxnber of top-scorngA subs-equence ;ipoited back in scono output table~ 2p-, Echoed User Peptide Sequence (length 115 residues) 1-.

HLA peptide motif search results User Parameters and Scoiring Inormaton nmje number of results requested j HLA molecule type seece OC) length selected 5FasObsequeuces to be scored I~ I chin ode seetfor ____nputeed lines I~y~ I -length of users input peptide sequence 115 I ~~~mnber ol subsequence scoe actd 0 NO number of top-scofng subsequences eptd acnsongoutput tablegj 2 tart Postin ubsquece Residu I Score (Estimate o0 ai TuE orDiasctour F; i L istng a Molecule Containing This Subsequence) ~T~i VFPGSGVRIV 40. or FT 1SRGGTGA KDLIeAIP.RA fi~o f-Y F1 IEIEsRLGGT

I

1 EEV*PGSGV 4.000 r I -T ATYLeLAAV TSVAPPPEV f-200.

F-FF -7 1 IEILNgQLVFF'S t .600) F"77377rr~r-1.600- EPGSqVRIVV rlrr-r ATYiLASqA f 1.00 r. 1.000 YC PCFE 0.1 30 CP FEATY Tg080 ___LELASAVI(EQ j0160 Echoed User Peptide Sequence (length -115 residues) HIL-A peptide motif search results Ujser Parameters and Scoring Rroormation I ~~method seleced to limit number of results lxlctnme number of results reque"e HLA molecule type selected ~3 length selected for subsequence to be scored Iechoing mode steecte fri input sequence! nmber o1 subseqec crscluae K 7 Inumber oftop-scoring subseque-ne reported bakinZ5Q sc6nutpul aJIT tart SiabsequeneResidue Scr Etmt fH ITm fDsociation OF FListing a Molecule Containing This Subsequence) FT1 77 1 KLENGGFPY 24.0W5 r- 1scVvry 4.5 U) 75 F Sacr etac 3.000 F4--T [1 EPCGMnTY 2.640- 13JWr D--r LIEA]URRtA 4T 7 ASVE0 .000 QypGiciE U .960 rGOLvrsKLE 0.8w0 [T j GQTsvAppp f 0.9()u IEINCQ)LVF .6 11T- j GVRIMvYC StLGGTGAF f0.8 [TF-I 0' 0.0 FI3 1 LGTGAFt 0.40 f~r fFpcEslvoiv 0.466 T7 f~ AVKPQYPGIl 0.3 IWFT TI ,ms~tpc [0.250 F9F7 QLYFSKLEN f 0240 G'rGAFEICI 0.740 Echoed User Peptide Sequence (length =115 residues) -103- ELLA peptide motif search results CK1User PairAmeters andro ScRgi Inasmtion method selected tolimit nu-mber olTretsults number of results requeste 1.-LA miolecul type seilected I len''I f selected for susqecsto be sco-R 00 ecoiig mode selc for input sequence I bOe okrniff 0egt oss in1put Der)d sequence number or subsequeice scares calcuilated Inumrn 01 top-scoring subsequences repote iaci in scoringoptta Results CO NGOIVpsiu. 060 lTRI- 21 .SG~vcUVY-c-- rM 30CEC9cF&ATY 0220 Flu_

VFSINGGF

Echoed User Peptide Sequence (length 115S residues) -104- IELA peptide motif search results -User Pa-mmeters and Scoring [eformaffon method selected fo limit number of results ePli c nmE i number of results requested H1.A molacule type selectedI length selected for subsequences to be scored9 -Ow econ oeseetdfripu eune length or user~s input peptide sequence I nubro suseuec scores calculated J T 7 of top-scoring subsequeEce reporitbacit in scoring output tao Iq- FRi, le on Subsequence Residue Score (Estimate oIallTimie Of Disassoia-tion of t 00 -Listig a Molecule Containing This Subsequence) NSRPPCVIL 000.- Q. AVKEOY PGI .(6.000 I VPuVVEYC f (J M F NGOLVFSiOL -I00 fl3 T j GGFPYEROL 4.000 EPGSGVRIV 4.60 56 A 0.000- V1~,TA- A PPEEVEP .0 FFT 71EPCG EhTY rT7 f 57- 1 LGGTGAFUI.fF F 5 1 0.400SR f -3 PCGFATY0.400 F~gr MC F2U~. AI.R Echoed User Peptide, Sequence (length 115 residues) -105- HJLA peptide motif search results CK1 F User Parameters and Scorng Inwormation method selc e to unmit number of reutsfxp iit nur number of results requested H-LA molecule type selectedf-~ .lengthii sietd for subsequences to be scored.

00 1 .coing mode selce or input sequence echoing format length[1 of usex ll~s iuput sequence scores ca=culate ~I =ber of top-sc-onog ubsequences reported back in scoringotuttbe

W

Scorffg WeSUlts Start Position F enicekesduiore(slaeo Hl ieo issoid, FaF Pstoi Listing a Molecule Cotainng This Subsequence) F1 I I YPGIOeI!SRL (0.000 £PCGfCATYL TNSRpPCVIL 600 F3F~~b 8- 33 CGFEaflYLEL FF~2 AIli5aZNGEF 300 71W- [3 PYECDLZE .0 r'~r r- APPPaCVrPG ''0600 fif1 EVEPgSVRI 0.600 ATYhLAS 4).O00 fiT f GtIvvEE f V ~GGT~aSErEX Echoed User Peptide Sequence (length =115 residues) -106lILA peptide motif search results -User Pa-ramecters and Scoring Information rnethod selected to limit number orresults rexpicit number n~uumber of results r-equest-ed HLA molecule type seleced Iength selected for subsequences to Be scared cch -Ing mode aelected'or input scqucey I.eioing formal nu e I Jengthlaoqus:!s mpul peptidequic .1numboer of subsequence scores calcula ed .108 jnbtr of top-scoingisubseqaences reported baWEi scoring output tableq Vrmnng AsnltstatPsSin usene Residue Soe Usiat ofl~il'Timeof Dsasmotion 1 Listng a Molecule. Contang This Subsequenee) PI 91 E AIBRASN 0.80- F~T GSGVRIVV 0.60 I 1I EPGSGVRI 0.400 RASNGETL rfTSRPPC [iV- 7 iF LvFsKuN1 d .100 fW ASAVEy 300 FTTVIUVEQY '770.170 FT 3 EATYLELA [0.080 QF T F EPCGFEAT 10.080 £IEINGL 1T~fT{ .£GTSVA. 33 CGtEATYL 0.060 -FTWT- 56~ ES 0 30 7- Echoed User Peptide Sequence Qength -115 residues) -107- HLA peptide motif search results (NilUser Parameters anid Scorning lrai on9 nmethod selctEd to li-m-t n-umberofresults I number or ResUlts requested HLA molecule type selected length selected o-r subiqucnesto e scored 00 eceor input sequence: e1 choig tbrna lengt ousees input peptde sequencet [number of Mubsequence, scores calculated ~iunberof op-corng ubsqueces reported back in scoring output tab INDlIS n eut .111 jJ CCSEATYL r71 ES.tLGGrG Te 106 0.040V'6 Echoed User Peptide Sequence (length =115 residues) -108- EOLA peptide motif search results (N2 User Parameters and Scoring lar-rmation I" tbo Rselected to n mt numbcr-ofres-ults numiber ot results requested HLU molecule type seleed length selected far issequencs to be scoEd 00 C Oznm oecel foruip sequence__ li c M o ing a number 017subsequence scare-s caluatd fnuumber of top-sconng subsequences reported kal in scoring output Ga o~rng Resu ts Echoed User Peptide Sequenice (length 115 residues) -109- LILA peptide motif search results -User Paramne ters and Scoring Isonnatioo [r mtflod selocted tolimfit numnberox resuits lexplicit numbner number of results requested t 1iLA molecule type selectedJ

U

length selected for subsequccs io be stored 1 ehoing moide selected for input sequencErii ozng forus legt ff usces 0u ppasquence j T nitnberolsubsequence scores calculated T F Jhtsmber oftop-sconng subsequences reported back- Zinrng tput 2a~~ U~ Echoed User Peptide Sequence (leugtb =1I1I residues) -110- MIA peptfide motif search results I User Parnzneters and Scoring Information Method selected to limit numiber of results jexp licit nurnber numnber ot reSUlt$ requested 2 1-WA molecule type selected f length selected for subsequences to be scored e~on Mode selected for iptsqec I numnber 01 subsequence scores calcuiatgd (numiber of top-scosng subsequences reported back in srig VWalez1 Echoed User Peptide Seqnence (length -115 residues) EILA peptide motif search results User Parskmeters and Scorng Informatnon method selected to limit number ofresula; Fep7ic-it nm number of results requested V *HLA molecule type sclectad I ent selected ror subsequences to'be scared Ry ehinmode selected or inpt sequence echoinglbnnat numer f sbsquence scores caleculated [number of top-scnngsubsequenccs repoied back in scaring o-U bconing kesults Sbeuece Reid-ue scare (2stiazate -07 1 all im of Disassoclaffonor F kItart Position] Subsitin I a Mlcul ontaining This Subseq!Uence) I7YKF-O '1 IRRASNGETL 30cnpcgFEA7Y f3.000 F-T-FRLGGtGAFEI I V~RIvExCnp 2-000 F6- 7 U SRLG9GAFE 2. O 00U I 7T( EQYpqI EXES .0 1 s~rlvE -1 1.000 1 1 1 1 1 GQLVfSKLEiF 1.000 41~ ELT Aea~sViEQY 0900- -ir- 33 CGF~aTYLEL 7 .5 [1T r G PyKOLTfI TNSRtPPCVIL [_0.60 FS -r69- ;1 NGOWVFSiEG 0.600 83~r PYEDLI 0

EAL

96T~ 3 ASt&GeTLCKI. f.W F ESRLgGTGAF- "03 Echoed User Peptide Sequence (length -115 residues), -112lILA peptide motif search results User arameters and Scoring Inforinadtin method selected t; limit number of results tepmn number number of results requested z HILA molecule type selected :1 B_-3701 flengthf selcaed for subsequencea to be scored 00ecfgoing modes,eecM foriptseuceI numbe ol subseqence scores calculated -0 humbor of topi-scrlq subsequences reorE a in sco ng o tabd- Scorig ttesn s nk Subsequence ResidueSce stat liiheofDascadnf FListing a Molecule Containing This Subsequence) [-T1 365 FUICitGQLV 1.

(2 37 IflgQLVrS 5.000 CEPCgFETY- E 000 [3fTVEPvspsVJV f 1.500 AFCIeIGQL f 15b0 INGQ1VFSKL f 9T G ETLeI.TTS- 1.000 71-7[M ccrcarETxT I_ YKIF--4-- VEQyPGIEI S IEIF.WRGT fTF 16 F rvEPgsGVRI F-M F-4 F sivkeQYpGI F .r0o ry ITN7SrPpcvi Too0 77-1 96 ASNGeTLEKI100 F- I 8 NGGFpYEKDL4 T9 -3 IESR1GWfGA IL f .j eFCGfEA YL 100 Echoed User Peptide Sequence (length =115 residues) -113liLA peptide motif search results User Parameters; and Scoring Informastion Method sclecled to limit number of results jePlicit nu.mber_ -number of results requestO d-M HLA molecule type selected [enigthf selected og subEsequences to be scored-.

echoig mode seeteor put sequence .7 u 7i ~el~e length of users input pep e sequence i numbeWr fssequence scores calculated jiurnber of top-scoring subsequences repozted bac*-k in scoring output tabief f I Scoring *Aesulits- Rik 1 Subsequence .Residue IScor (Etmt fhl ie fDssoaln 051tfl 1 Listing 2 Molecule Containing TI& Subsequence) GFEATYLEL 6.000 7~ 7-7W F NGQLVFSKL F j N_3y j TYILAAV r.

(T GGFPYEKDL txi f 7j SNG TLEKI r0.720 r E:IEIIGQLV 0.00 r r9- GFPYSICLI &.6W 49QYPGIEISS F-s- 18 EPGSGVRIV 0.400 FTj 31 EPCGF T.Ay 0.400 89LI EAIRAS 6[~0.9 W NtGEPTLEKIT 0.390 ~1T f 1CLDIG=FPY030 j13J~ r GTGAPEIEI 0.300 M 7 s'pa vco 0.300- FI f0 TRsRPPcv i t F- 9YCEPCGiFEA FM FT4 EIESR1,G? .f-J Echoed User Peptide Sequence (length 115 residues) -114lILA peptide motif search results User Parameters 2nd Scoring Information rnctWo selected to linit number of results Iepcjt mnb .number of results requested HLA mocleicule type selccted[ [length selected for subsequences to be scored echoing mode sele twfolnput sequence i Y length ofMsis Gipppie 'squnceT1 Fnumber f subsequeccsoe c-alctd Fnurrber of top-scoring subsequences rpotRe buck in aconrig output URIc W tart Po~Stbsequipence esiue jScore E .timateofalTniofJssscto o I Listig I a Molecule Containing This Subsequence) [F ArE. JeNGOL [7.300 3 F.PCGfEATYL 4.800 F 1 66 F EIEInGQLVF VVn~cEPCGr .0 FT 1 74 1 vFS KENGGF- 2:00 -I 33 1 CGM~TYLEL 210-5 l~r1 -f TN4S pPCV IL j 1.00 FU -I j NGrGFpYEI(DL 1.006 ETF" VEPgSGVRIF- 0.900* r ASNGeTLEKI0.0 S GFEMtYLELA-- 0.606 I-lY- GGreerCEXe I.0 [T ~RLGGtGAFEI J 0.600 F F EPGSgVRIW 0.520 :F7 83 I FPYEkDLIEA -6.40 P8I :19 EYcSPCGFEA 7A 0.400 V FT9i MSGEpGQTSV .0 SGE PgQTSVA Echoed User Peptide Sequence (length 115 residues) -115lILA peptide motif search results user Parameters and Scoring Informnation fl method selected to limit number of results Icplicit number ~number of results requested liLA molecule type selected -3 langth fleetdor subsequences tobe scored echoing fouat lengthof user's niuppiesqecc number of~ subsequence scores Cced- 107 firnmlcr of top-scoring subsequences reported back in scoring output tablerw Se Soringhesut RaktatPoiio'Subsequencel Rjsiue Store (Esimate of Haf 1%;e of Disass-datimn of Fp-;;k Lisdinga Molecule Containing Thh Subsequence) NGQILVFSKL 2.400 94 tA riGE TL .0 FT GFEFATYLFL bo NSRPPCVIL 0.p60g 5~3 7I 0-500 65 IEINGOL .8 9 P LCGttATYL r0.200 TUr 7 -I FSKLE:NGGF o.86~ I.FlrF U EKLFAPS 0.120* 21 6GQTSVAPPP F I 7r CQLVFSKLEn 0.116 FW -6 KECQy~iE f0.120 IF 17 1 8 LIFAIAS ~.0.120' 21 I SGVRIVVEY F0.120 NGTEI 0.12U EPCCFEA'rY 0.12 Echoed User Peptide Sequence (length =115 residues) -116lILA peptide motif search results User Parameters and Scoring hnration..

method selected to limit number of results lxictnme number of results requested HI-A molecule typ selected length selected for subsequences to'be scored9 echog format ed F Ic5hOf ues input peptule sequence f T j number of subsequen-ce scores calculated I fOumber of top-scoring subsequences reported back iw sconng output tabekf 2W -Scoring Rsut [ank tatP sFusequenceftesnel Score (Estimate cI alI'Jlme ofVDlsssociation of j Listing f a Molecule Containing This Subsequence) N GOLVFSKI. 2.400 r~v GGFPYEKDL f20f T[ f PRASNGETL F f-T-1 34 GFEATYLELZO f 3 [1--TmhF- .NSRPPCVIL 0.600 FGF-T Sk!GrGAP f fF[37 !t~FIEIiGQL 040 r'Wji2 SCGFEATYL fl 0.200- F1D473 FSKLFliGGF CI(DLI1A86 0.120 r 012 CQLVSXL ~0.120 F7- -4 I ViEoYPGsF 0.120 F1 31 89 LIUJIP.PAS [0.0 -SGWUVV 0.120 [57f NGETLr.KIT Mb12 .ETYLLAS F.2 rIVE-r -1 PCGFEATY- 0 Echoed User Peptide Sequence (Iength =115 residues) -117- HLA peptide motif search results User Parameters ad Scoring Informtion metho-d seleced to linift number of resuls number of results requesd HiLA molecule typt sected- Ilength selected for subsequences to be sword 1 econgmd slctdr. npu -sequence lengt of usaes input peptift sequence .1 ~numb er of subsequince sres calcuaedI (umbar of to p-$coRing subsequence reotdbJ eou op Ltb~ Echoed User Peptide Sequence (length 115 residues)

I

-118- PULA peptide motif search results User Parameters an~d Scouing Information I metbod sclccted to limit number of results jexplit 7number number of results requested F IT HLA molecule type selected f F--WTleungth selected for subsequences to be scored echoing mode selected for nut suence 1. Coming fonmat n[mered iiev taigtb ofaueae's input peptide sequence i 3 1 ~~number of subsequencesor ccuaef- lJ~ Inuberoftopsccan suseuenesrre back in scoingg- output n[Start Position Subeqence Ress nil Score (X'stsnte of Half Tie of Disassociationof F L sting a Molecule Containinag This Subsequence) Fl 1 7 -j IEINGQLVF 20 0. 000Z*G 27I VEYCEtCGF MEINGOL 0.000 mTYLE~h 1.000 3 r EPGQVA so VEPGSGVRIl 6.000 F--j 4 LASAVCEQY 4.5(00 F-ff~.j EPCGFEATiY 4.500 F1Tw 1 7EKO7IA r 4.000 TT 3 1 cpEFcGFEAT L MO0 [1 Y~ Tf IQYPGXEI ISAI-w j 1RRASN 3.60T *I'7Tr~ThI -FS'L-E4G-GF.. 99- [1[3j 7-J .1 sRLGGTGAr 0 LENGGFPYL .0 Echoed User Peptide Sequence (length -115 residues) 119lILA peptide motif search results User Parameters and Scoring information method selected to ljmit number ofresults -1;iiFzt numbe number of results requested H LA molecule type selected length selected for subsequences to be scored ectoing Mode selecte for np Utqence !Lechoing torinat nurnb!TIed1 I ou wriputpe2Pbde seque115ce I number o subsequece scores calculated j DT "nrber of top-scaring subsequwnces reported back in scoring o"utp abOij stat osiio ~Subsequence Resi ue Scr(Etimate of Hfalf Time of Dlmodatloni of F-F Pit-I Listing a Molecule Containing This Subsequenice) r71 3 CEPC gFEAY 120.TIM U 67 1EILgRLGPr 30.00 EMN h9LVS 17 ViGQLIV I2.000.

Gs...VE .000 99 GETLeIrTS F[T [3T'-f FeATYLELAS I V F-7~ IX rSaIGGTGiA 0 IT- 40 LELAsAVKEQ- I TI1 76 r Sl(LErGGFP-iTW 1.800- IT_l7JN_ SGVRiVVEYEC rir- 56 1 ESRLgGTGA1' J I IRI--T-- E1JASaVKEQY 0.900 I I/j 15 EEVEpGSGVR [T~TGKPGerSVA 0.675 0.000_7[ Echoed User Peptide Sequence (length 115 residues) -120lILA peptide motif search results Us-er Parameters and Scoring information I m~~~nethod solected to Emoit number of results (rlctnme number of results requeste HLA molecule typ selected 3~ letngth selected oyr subsequences to be scored 17 ecbolng mode 3elect-dfor psequence _Y iJ j lengM sequence~ number of subsequence scores ~Inumber of top-scorng subsequencer, Reported tack m scoan output tablej Stat PsltoaSubsequenceRIdue Score (Estimate of Haff Time of DisaasocladoN o Listinga Molecule Containing This Subsequence) r 1 1 PGSGVRIV 494.000-.

F- 1I SGEPGQTSV rGGFPYFKDL a4.000 *N GQLVF SKL 22.000 SNGETLE KI j5.856 FrT r- T EATYLEIAS 5.11 F-9 T1 PGSG;VRIVV' 1:4f Fr~ 6EIEI4GQLV 4A FT1 4 4.400 FTI-I 82GYPYEKDLI rrm-FT OTGAFCEI f4000 16 105 I ITNB5RPPCV .2.600 LAsAvK~a.y .M 51 PG;Q2'sVAP--

M

SVAPPEEV T Echoed User Peptide Sequence (length -115 residues) -12 1- LILA peptide motif search results r~l rUser Parameters and Scoring Information mcthod selected to lumit number or results lexplict number f number of results requestWd HLA miolecule type selecte c 3~F 0) C ent eted for subsequences to be scored 1 echoing mode seletedt oT iput sequcc -Y (Ni ~lngthe ofusequ; ee scores acted- IND bomber of top-sconug subsequ .ences reported baeckmI scoong .outu k tar P Sit bsnequene Residue [Score (Esime W7 HlTiefDisassoaton of, Listig a Molecule Cont&Wnig This Subsequence) I~ 1T ~Psgvnxv f .000 [2 4TSAVKeQYPGZ 5 6120.0 f= 1EPC fCATYE 2000 -f -I GGFPYEKDLI 176.000 J GrGTCaI'EIEi 7-F-7T I CGF~aTYLEL ri-iF 3 FPYFkDLIEA 3 1.460 EATYIELASA ioo f fT j EVE~qSGVRT f .800 96 ASHKGTLEI Fff-I 105ITN4SrPPCVtj ATYLeLASAT f 4.000 MSG~pGOTSV -f 34 T6- 21SGVR±VVuYC 1 2-420 FiT [F RLGGtGAFEI 240 V~V~77I TSVApP2PEV j- Yaoa PgOT5SVA Echo ed User Peptide Sequence (length 115 residues) -122- ELLA peptide motif search results User Parameters and Scoring Informatin mecthod selecte to limiut number of resulIts 3excphcit number numnber of Results requested 2 FHLA molecule type selected B_5i 02 length sel ected for subsequences to b a scored 37 ecbong mode sewce o nu sequence, K echointna lengt ofusees input pptdsequence -1 3 (inmn We of top-scoring subsequences ;;eport bakIn. SWoAM oumt tabl lc 2 F SCo~rng Nesumt tart P Sidon ece Residueore (EStimat fHl ue Disassocation ofj Li~nga Molecule Containing This Subsequence) [T 8~ EPGSGVRPIV F- 81T GGrPYEKDL 10.0 55 7 IAGGGAFitI Ol6.00-o FT NGQLVFSKL 48.400 F~ flTSGtEPGTSV 24.200 [Tj s PIEIESRL I MOO F 37 FPYEKDLIE. 31.0 F- 7SAGETI.EK-1 3 1.6 F F 39 TnLASAV 6.60 FTW-1T19 PCGVRZVV 3 .840 ITF W 1 TN!SRPPCVI 3*4.400 FrfT 61i~ GTGAFzipi FIT- 3--f I GF.3KL 4.000 FTfF--' f- EPCGFEATY -3.610 FG- 6 AFEITONG 2.750 lr-- 3 EATYLELAS .2.5007 F"7- f YPGIIIS. 2.420 F1~~ AVKEQYPGr .2 Echoed User Peptide Sequence Qleugtb 115 residues) -123lILA peptide motif search results I User Parameters and Wcring lnformatjon method selectod to limitnumnber otresuils Iexplicit u-mber F numer of results requested HLA molecule type selected F1E3~ leghselected for subsequences tobe scored cCoing irC Selee fr input se-quence echboigformat nu- e osbsequence scares calculatedI jnumber of top-scoring subsequ ences reported back in scoring ouput ab1- [6 bu~qence Resde score (z AEslate of l% F~ fls~oito Star Position J~ U~iasseqtuno a Molecule Containing This Subsequence) Fif~"f SAVKeQYPGI.............726.000 F-7 1 0 .GIeY.ESRL [400 000.

IF 81 GGFiiyEKDLI -456 566*..

F4 8 PGSgVaiW j 220.000 FT1 31 E PCG fEATYL 1200 CGFEaTrk'EL 121.000 FflF N Fl'YEkODL~ M GGT~aF.EI 00r NGG.FPYEKL 22.000 1 f 7 f-P- ATYLeLASAY sIFr_ SG!L-1 10.64 8 F~rF--'T-i SGVaivuzyc Frr 7 F__8 TSVApPPEEV fi r F ATY1IABA [TS- 58 r RLGGtGAC [l I StIEiGQL f.

,F-97 6 AFiEIN 7 7 71 M-1 Tj SG pGQTSV i .6 Echoed User Peptide Sequence (length =115 residues) -124lILA peptide mhotif search results, User laraineters and Scoring Information method selecQe to limit number of results aT -epIt nm numberof results requested 2UN HLA molecule type selected Bj3~ leghselected for subsoqueccc to be scored chboing mod;slelefosput:;;quence f Y echoing format lcngtii F ofsrsntpcpt~f*Q sequnce n-umber ~of susequence scores cauate 106f Ounmber of top-sconng subsequences reprted R&c in sroring output table 2 Sc ig Results Rank. tart P SiubFsequence Ri nN-e Scr aEtimat of WufTime of Disassociation of F F T7iuol Listing a Molecule Containing This Subsequence) FT- R T SAVKQQYPGI 110.000 f rF--T GGF~yEI(OiI M2OO FIY-[I W~ E:GSgV IVV SGGTGaFEIEI 44.000 fT~f f CGFWEafl- f7.920 ATYLeAS-AV 6.600 1~ EPCGfEATYL 6.600 E£PYUDIEA 6..600 I F I NGGFPYin(DL I F 1-0 F-SlTI YPoxIeISZ 6.

lt 36 f EATIYELA.SA 5.000 liT F 2 I 1TJ F--Y j SGkUgQTSVA 1 2-420 FITT 1- j rSGEDGQTSV f 2420 rlr- 1- I(ITNSRPRC'TP 2.420 rir i LCGG FEI 2.320 :VTF-37I ASNGeTLEKI 2200 I ITNSrPCVI Echoed User Peptide Sequence (length =115 residues) -125liLA peptide 'motif search results- User Parameters and Scoring Information method selected to limit number of results lxlctnme number aof rsUts requested _2 HI.A molecule type selected BJ03 length selected for subsequences to belsored1 l. ecK oWgr ec fr.Tp sequence_ If7 echoing formatD ies umber ot subsequence scoe calculated I U Inurnber of top-scormg subsequenc reorted bA in scoring output tabl Star PoitiN Fbsiiqience Residue *Jscore (Estie of Hal uie of Disissoigciato Fab Listing a Molecule Containing This Subsequence) Firh -TU h SAVKBeQYPGi fu.0 I-T- 60I GGTGaFE-IEI .000 cG.ETYLEL 7.920 F-r- 37 TY~eABAV6..600 EPCfZATYL. -U rPY~kDLIEA 90~ NWGGEKDL 6.000 rir -3U 'TT. F__77 AY1ELASJA T7 -7SGVRiVVE*YC2.0 rrT_ F SGE!PGOTSV *j2.420 1T3 -T xiTem~ppcv 2.420 RLO~tAFEI2720 :ffT 96~- ASNGeTLEXI ES~pPEEV .00 I I 2200 FWFU j ITNSrPPCVI j 2.M00 Echoed User Peptide Sequence (length =115 residues) -126lILA peptide motif search results User Parimeters and Scoring Information method selected to limit number of Ieuts lexplicit nurabWr number of Tesults requested U liLA molecule type selected 58U iengt selected for.G ;subqunces to be sciored 9 echomg mode selected osnut sequ ien!_f le~~inrt con oml-.usees inpUt pe tid sequence FT1 Jnumber of top-scoring iubseqccs repoxied back in sconnpg output tabd1 Sccg esnl ts ji~k tnr PsiionSbFqin eiie Scor Tl (Estimate of Half Time of I)ssoeiaon of Listing a Molecule ContaWning Ills Subsequenc) F7- 75 F FSIENG 40.000 42 ASAVKEQY F31 07 1 NSRPPCVIL f4.000 T- 1 1 GTGAFEM 3.000 MSGE PGOTS .88 IEU~rGQLVF j 0.86 WI F-Th LSRWGTGA j 0.600 FGVRIVVEY0.4 F7 7VEYCEPCGP............0400 7T1 toETLEnrINs 0.317.

l~ f GSGVRtIVVE.

F177 WT. SAVKEQYPG 0.22 SnLGGTGAF0.0 Echoed User P~eptide Sequence (length 115 residues) -127liLA peptide motif search results User Parameters and Scoring InforM211on 00 mecthod selected to limit number of results exictnun-i number of results requested ElLA molecule type selected length 3elertcd for subsequences to be scored 1 echin mdeseecedfo Upu squnc echoing formal nubrd ie te N t of73i~ input peptide sequence 115 number or subsequenceSGcorescalculate nuinber of top-scoring subsequences reported back in scoig output tab~eJ[--2 Sc8Ngrtnges9&s* Star o S ubse.F quence esvu-ef Score (Estimate Of Half TWIm Ofh)isassoaatiou o F ~Listing I a Molecule Containing This Subsequence 56 ESJgGGAF- F idoo GSGVrIVVFY R~IM rT- JOT XINSrPPCVI 300 T137 ATYLeLASAV f3.066 VF6 1 96G~K. T640 7 1 4 SNG.TLQYPI 2.000 I-T- SVApPPWI2.

F7 F j- VFiEtSK JGGF .F 080 61 rGAftUEIW 0.480 rf- -6 1 EATYIELASA F-1 95RASNgL-TLEEK 0.330 L iiF-6' 1~~EtG 0.26 4 rY-1 83 1 IPYLEkOLJA,024 .rr~r~.I YCEP.GFET.T b .240 337i~w7 CGVE aTYLL 0.22 0 15I7 FSmNGIP .0 Q'rSVaPPPEE ob-, Echoed User Peptide Sequence (length 115 residues) -128- IILA peptide motif search results Imethod selected to limit number of r-esut-s number of results requestedT HLA molecule type selected length selecte for subsequences to be scored- OC0 echoing mode s62lecorinu-tusequence l o rm fnat Ilength of user's etd eu23 number of subsequence scores -calculated Inurnber of top-scoring su bsequecncesireptte bakmscnng outpu tl INDcou~eut Echoed User- Peptide Sequence (length -115 residues) -129- LILA peptide motif search results luser PaRameters "nd Scoig Info~rm atio, method selected to limit number of rwuiltslepi Dme number of resudis requested 2f W FHLA molecule type selected i -C"Jr length seleced for subsequences to be scored echoingrnoeseedfo=r MTut sqeai L 1 echo ing Ion=t il 8thf,-aeesinputpepddesequeics 115 I number of subsequence scores calcmiated fnumber of top-scoring susequences reported back in scorigoutpztable~T art Position Susq SeRd c ore stimate of Hlf Thime IfDisas-s-odation of I Listeing a Molecule Containing This Subsequence) F7t1 44 SAVKeYPGI( 50.00 F--1 3 -i CGF~aTY ,LEL 45.O00 F'VF 6 r5 I 1SKL T2.066 F~ [4 FFTOF TNSRpPCVIL On300 r ~YCtPcGFEAT. 1500 r6 'q~r VSGVRI [Tr- 65 FEIE .iNGOLV j2.1 r 9- T r EPCGfEATYL .0 [TVF _U AFE~eINGQL f2.000 1j 53 f rEIsRLGGT 1.50 83 PPYEkDLIE:A Y:500 F-fI 7 SigEsnoorPY~. 1.500 iT. 21* sOvRivvE yC 1.500 F-9- 37 F _ATyLLASAV 4 1.200* {T-r w F -GPED 77. -3U1 YIeESR1 .71 93 IRUANGETL 4 T115Z2 [iT JRVsYE -1.000" r ~TSAIPPE I~ I L 1000 E-choed User Pepti de Sequence (length 115 residues) -130lILA peptide motif search results F- User Paramgeters and Scorng Imforinnuon method s elected to imit number of results lpicit number F number of results requested 2 M iA molecule typec selected 00 length selected for subsequences to be scored echi-modeselecte rit sequence f y j echong l[rOPmnmbrdtie oe f uses Input peputde sequenc 115 mnmber oi subsequence sc scOM107 [number of top-scoring subsequences reported ba in scrn utput tablelL Susqece Residue 'IScore (stimate of Hal Tie of Disassociation of Listing fa Molecule Coutaining Thi Suseuece FT1 4--GFEWTYLEL24.0 38 GFPYEXDLI ~EPGSGVRIV .f000 EPCGFEuATY 12.000 .F IT f. 4?GVPYEDL 4 .10 1WNSRPPCVIL ~F 379- 75 rsKLMiGGc

ZOO

F7 I SiGETLEKI1.8 FP7 Ir- I AFEIEING07O F-7 1 8 PYtEKDLIEA FT 4F -I OYPGIELES !0 rwr-w1 1 1 t.VV 1.

SGEPGQTSV f .o- 7- 28EYCEPCGrE 0.600 .74) AVKEQYPGI 0.600- 8 9 .S.PP [IIT9 TI 105 pc 0.SSF0 r F KLEi1G(i'PY0.0 Bchoed User Peptide Sequnce (length -115 residues) -131- LILA peptide motif search results CN2I User Parameters and Scoring S Tormation Imethod selected t-o limit number of results number of reutrqesd liLA moleculetyeeete length selected forZ susequecces tobe score 00 ecomoe selecte fr jput sequence ~echoing fcoint- CK1 lenth o use~s iput pephdo sequec nrBMW of subsequence scores calculatedfiumber of top-scoring subieq iences reported back in scoin~g ou tpu ta Moriu Reults Echoed User Peptide Sequence (length =115 restdues) -132- HLA peptide motif search results Praintv and Swilag nformadon number of iRsls requested r LA molecule type selectd Cw 00 Jngthselefe-dforsubsequences to be acored.

4 ~length of users input pepde sequence T3 nubr fsbseqence scores calculaited IND :[nmber Of top-Sconng Subsequences r eported back in -zaing output bicq tortPostio ubequne R tsidu score (Esinaie of MVif Tie 'f is&associatiton' of S Lbng s Molecule Containing This Subseqence) F*Fr F YEKDLIFAI .600 7_ _r F _F1IWM QL 600 I SGRIE WF ai~ y.69 77 EPCGFCATY 3V0- I y_ I T GTGAFEIEI .0.

3.000 GGYPYEICDL 1 RRASNGETL f2_200.

SNGETh.EKI 1zoo V I OLVFsL I I I GnMATYLEL 20 TS -T -1 JT-J-TOT ivT"x'cv. I 1.10 FTJ 47 1 6 IINGQLV 4 .iTh Fw- r15 1FFV G LG 1.00 PuT-43t AVKEQYP I

MF

Echoed User Peptide Sequence (length 115 residues) -133- HILA peptide, motif search results User Parsameters and ScoI ng Inlformation I method selected tolimit number of results lexplicit number I ~~~number of results requested nix molecule type selected f 7f2 lengthi selected for subsequences to be score ecriolng mode selcte for ipu eqce I ~echolnMG foma [i T length of usei's input p t Se suce -f3T Inurnber of top-sconng subsequences iqoirted back in scoring output tabl[ I Scoing Resuilts .k wPositiRI subequnc Rlzescidue IScore (&tiniate of IaIWTinie f Disacon o.

F Listing a Molecule Containing This Subsequcece) FT 31 EPCGPATy 24.000 Ff8I GVRIVVMY 920 F7 42~ LASAVKEQY I Q5PGIEILS .9' 0 0 T~ nGSGVRtIV 42.400 F- V 1F F RSUASNGETL 2.400 F71- 5 1 YEIWL AI 1.478 J-T 1 1.440 I 13 -SI-iiiGQ 1.2i% GT7 77 1 -GFPYuIDL [1.009 73 -T 1 IEINOOLVF f 1.000 76- 97 1 SNGEfILKI 4 .96 FT7E TL 61LGF 0.960 7 sPcvxx. .iI..

I 7.i vltIvE~c l~ -0.800- Echoed User Peptide Sequence (length 115 residues) -134- HILA peptide motif search results user Pgrameters and Scoring Iafo-matiNOn incthod selected to limiat number of reaults.J 1iti~ I-ILA molecule type selected Cv_00 length selected for subsequences to be scored echomigrnocseeedfrrmal &!sequac TOO_ ec oing format m iff leghotsis 113puL paptift sequence f1 number otsubsequ& ftce scora8 ca Icuated otpu a106 unc ftop-sortug subsequences reportedbc cngotptth~ ~~Scvnri e-sults tatPston subeqiuence Rgdfe fScore (Estimate of Half Tim o~lassoiam of, Listing a Molecule Containing This Subsequence) T -F I -F GSGVrIvvE.f 38.4 CFPCQFEATY. y PG F-7 7 I 1 StLnG(crrv 4.00 .1 I .J WGQ1vFSIQ .8 V -fgI EPGSg VRIVV 2.40- V-T.-73T- crpz'rYi m4 o NGGFpYEKDL r 144 FSP.L9GTGAF 1.2W0 fTF1 93 1 IRasNG.ETL f AFEIeINGOL -f [i ~ElEinGQLVF 1.000 [iT IF- fU-1 DL:eAlitR 0.800 rITI.T 7if VtPGsGVRIV 0.800 I 7 .sGVR±VVBYC __2j .12D ~FT I EoypgxiEs 4 0.672 Echoed User Peptide Sequence (length 115S residues) -135- SZ TABLE3 JMPORTANT NOTE: Tepilope was programmed to evalute Cys residues as Ala, since for synthesis and assay limitations it was not possible to systenatically test pcpides containing Cys. So, whenever the predicted sequences contain Cy residues, we suggest you should have then ayn~tesd REPLACING Cys wrr Ala RESIDtUES.

00 Pile Name: Prediction Parameters: ci Quantitative Threshold I1]: 3 Inhibitor Threshold [log of fold hange]: -1 Inhibitor Residues [number]: I DRB1'0101: SGVRXVVEYCEPCGF DR1*0301: SGVRIVEYCEPCGF DRB1*0401: SGVRIVVEZVEP-GF ORBlt01: SCVRIVVEYCEPCGF DRl'0801: SGVRIVVEYCEPCGF DRBl'1101: SGVRIVVEYCEPCGF DRBl'1501: SCVRIVVEYCEPCGF DRB150101: SGWPIVFAlPCGF (binding frame for B5*0101 contains 1 inhibitory residue -100 fold) Quantitative Analysis of 'SGVRXVVEYCSPCGP Threshold 10 09 08 07 06 05 04 03 02 01 DRB1*0101 DRB-0102 ::oXzroXrrCWucOlnnrnnzzn:. DRB1'0301 XXXXXXXXXXXXXXXXX DRB1* 0401 X DRB10402 DRB1*0404 DRB1*0405 rnXXXpDUDD DRB1*0410 DRBIl0421 200 0OC0CE0000d00)0000000C.

ORB-10701 DRB1*0801 xxxxxxxxKX)ODOXXOODOODOOD DRB1O802 )CCU= DR1' 0804 DR2100805 2X fl0000C0000000000000000 DR91*1Oi rX1XOC00o ORB o1104 oo)CXIDooo) fl11'1106 2RB1'1107 3i000000000000= DRB*'1305 XXXXXXXXXXXKKXXX= DRE1*1307 XXOXXXX DRB!1311 20000000CK DRB1'1321 DR8EZ'501 XXXXX 0 DRY31'1502 XXXXX On 0101 2o000oXoB00 o~0 000 000C.

-136- File Name: Prediction Parameters: Quantitative Threshold 3 00 Inhibitor Threshold [log of fold change]: -1 Inhibitor Residues [nmaber]: 1 c DRB1*0101: SRLGGIGAFEIEINGQLVF DRBl'0301: SRLGGTGAFEIEINGQLVF IO DRB1'0401: SRLGGTGAFEIEIQLVF DRB'001: SRLGGTGAFEIEINGQLVF DRB10801: SRLGGTGAFEIEINGQLVF cDRB*1101: SRLGGTGAFEIEINGOLVF OPI3' 1501: SRLGGTGAFEIEINGQLVF 0RD5'C101: SRLGGTGAFEIEINGQLVF (binding frame for '0401 contains 2 inhibitory residues -10 fold each) Quantitative Analysis of *SRLCGTGAFEIEINGQLVF' Threshold 10 09 08 07 06 05 04 03 02 01 DRB1*0l01 xxxxxxxxxxxMODOOOMK DRB1*0102 XXXXXXXXro3 o puur uu DRBI*0301 XXMXXXXXXQOOWWDOODOM. DRB1*0401 DRB1'0402 J03OC DRB1*0404 DRBX 'OdDS X200000000. DRBl'04l0 XX. DRBi'0421 JrfupptDJtnUEfluU:DWtzW0. DRl'0701 IXuCDUE~ar0DXXp0tDWOfuD0: DRB1*0801 DRBl'0802 DRBl00d DRB *10806 000 DRB1*1101 rnazWWMXMJWDDDOu. DREI'1104 XXXX0Cxxx00XX000XXXXX000 0 DRB'1106 XXIUUUUCWMXXxWWWWMRX DRB1107 XX. DRn1'1305 ,ppouuuopuuuuannninrKrXztiUDDD DRB1'1307 DRB11311 000XXXX 1X20000000000000C DRB1*1321 DRl'1501 XXXXXXXXXXXXXzuXrr DRB11502 :,uorcnujXXXX a DRES 0101 :porurucutrnnocuflUDXaC -137- Cl rile Name: Prediction Parameters: 00 Quantitative Threshold 3 Inhibitor Threshold (log of told change]: -1 Cl Inhibitor Residues [number]: I ClDRMl'0l0l: GAFEIEINGQLVFSKLE4GGF DRBB10301: GAFEIEINGQLWFS1OZNGGF DRBl*0401: GAnXEIGLVFSKLENGGF P R31 t O701: GAflIINGLVFSKLENGGF CDRfl1*0801: GAFEIEINGOLVPSRLE-NGGF DRB1I 1501: GAFEISINGQLVPSKLSNGGF 0835*0101: GAXFEIEING9LVESKLENGGF (binding frame for '0401 contains 2 inhibitory residues -1.0 fold each) Quantitative Analysis of QAFSIEIGQLVESfLSNGGP' Thresbold (i:10 09 08 07 06 0.5 04 03 02 01 DRBl'0102 ORPl' 0301 DRBit 0401 DRS1'0402 DRB1*0405 DRB1*0410 nasi1o 421 cooacarocaoaoaoa.. DRB1*0701 XXXXKKXO 0831*0904 )D flRSl'0806 MUD= DRB1'1101 0831' 1104 ORal' 1106......I D231*11017 0831'1305 ORBi *1301 0831 '1311 DRB1*1321 b2B1'1S01 0231' 1502 DUBS*0101 -138- File Name: 00 O\ Prediction Parameters: queNttative Threshold C35: Inhibitor Threshold Clog of fold change): -1 Inhibitor Residues [number]: 1 Va O DRBl*0101: FPYEKDLIAIRRASNGETLS c DRB1*0301: FPYrKDLIEAIRRASNGETLS DRDIA0401: FPYEXDLIF.AMUAfl8GWLE DRBl*0701: FPYEKDLIEAIRRASNGETLE DRBl t 0801: FPYEKDLIEAIRRASRGETLE DRBl t 101: FPYEKDLIEAIRRASNGETLE DRll501: FPYEKDLIEAIRRASNGETLE DR'5*0101: EPYEKDLIEAIRRASNGETLE Quantitative Analysis of MFPYEPDLISAIPASNGETLE' Threshold 10 09 08 07 06 05 04 03 02 01 DRBl0101 MODOODDODDOOCCM DRB1*0102 iXpuurflpnXiOC DRBI*0301 XXXX X)DIr OOprgp D uIOD DRBI*0401 innpupngoupuurpcXflX0U DRE1*0402 ::rapO pEloUDDO DRB1*0404 10000000000000000000 DRB1 t 0405 3t30DDDDflMflMDU3UCWEXI DRBIl0410 ::EcloMpaprnpurorXzEOr::Ou0........

D R S l 0 42 1 t poc o p ptC p X p ppM p pO o o DRB1*0701 X0000000 DRI. 0801 XXXX: aWumuuu DR1*0802 MWWMXX)DDXX DRI*0804 InuXXXXtDOfDDUOlDU DRBl*0806 XX0XXX000tJD DRD1'1101 DRB *1104 XXXXXX)ODDOOXOODOOC DRB11106 XXXXXXXU XXU3fD DRB*1107 XXXXXXIWWWWXXXXDDOOC DRB11305 DRt91*1307 XXXXXXXXXO ]POOODD DRB1*1311 XUUUUUUDCDCXX0 DRE1*1321 XXXXXXrnrn ODm0D OO DRE1 1501 DRB*1502 OOCW O DR5*0101 -139- SAltered Peptide Ligands Identification of immunodominant epitopes of C35 for MHC class I antigens using specific human T cell lines is a key step toward their successful 00 use in cancer vaccines. Modified C35 peptide epitomes containing amino acid c 5 substitutions at MHC binding residues have the potential to be used for

O

C enhancement of immune function. Such altered peptide ligand, or heteroclitic O peptides, can become strong T cell agonists even at 100-fold lower c concentrations that the original peptide (Dressel, A. et al., "Autoantigen recognition by human CD8 T Cell clones: enhanced agonist response induced by alteredpeptide ligand," J. Immunol. 159:4943-51 (1997). These altered peptide ligand can be of two forms: those modifications that enhance T cell receptor contact with the peptide (must be determined experimentally) and those that enhance HLA binding of the peptide by improving the anchor residues. Table 4 specifies modifications that enhance HLA Class I binding by introducing favorable anchor residues or replacing deleterious residues.

TABLE 4 Modifications that Enhance HLA Class I Binding (Unless otherwise indicated, examples apply to peptides of 9 amino acids; for 10-mers the amino acid at position 5 is disregarded and the resultant 9-mer is evaluated (http://bimas.dcrt.nih.gov/cgibin/molbio/hla_coefficient viewingpage. The modifications listed below are provided by way of example based on current data in existing databases and are not intended in any way to be an inclusive list of all potential alterations of peptides binding all potential HLA molecules, both known and unknown to date.) HLA A*0101 Any altered peptide that has S or T at position 2 Any altered peptide that has D or E at position 3 Any altered peptide that has P at position 4 -140- Any atdpeptide thathas A, L,M, P,V,or Yat position 7 Any alterd peptide that has F,K, R,or Yat anchor position 9 Any altered peptide where deleterious residues at the following positions are replaced: P1: P 00 5 P2:. D, E, F, G, H, K,MN,P, Q, R,W, Y PI: B, R, W C'M P4K, R PT D, E,G, R P9: D, E, P HLA A*O2O1 Any altered peptide that bas F, I, L, M, V, W, or Y at position 1 Any altered peptide that has 1, L, M, Q, or V at anchor position 2 Any altered peptide that has F, L, M, W, or Y at position 3 Any altered peptide that has D or E at position 4 Any altered peptide that has F at position Any altered peptide that has F, 1, L, M, V, W or Y at auxiliary anchor position 6 Any altered peptide that has F, or W at position 7 Any altered peptide that has F, W, or Y at position 8 Any altered peptide that has L, L, T or V at anchor position 9 Any altered peptide where deleterious residues at the following positions are replaced: PI: D,F, H, P P2: Q F,HKK,N, P, RS,W, Y P3: D,E, K, R P7: DKEGR P8: I, V P9: H,Y, N,P, Q,R, S,W, Y EILA-A*02O5 Any altered peptide that has F, I, K, L, M, V, W, or Y at position 1 Any altered peptide that has E, 1, 1, M, Q, or V at anchor position 2 36 Any altered peptidethat has F,L, K W, or Yat position 3 Any altered peptide that has D or E at position 4 -141r--9 ~Any altered peptide that has F, Yat position Any altered peptide, that has F, 1, L, K, V, W or Y at auxiliary anchor position 6 Any altered peptide that has F, or W at position 7 Any altered peptidethat has F,W, or Yat position 8 00 C* 5 Any altered peptide that has I, L, Tor Vat anchor position 9 Any altered peptide where deleterious residues at the following positions are replaced: IND PI: D,F, P P2: C D,F1, G, H, K,N,P, R,S,W, Y c-PI PD,, K.,R P7T D,F, R P9: DEF,G,H-KINP,Q,RS,WY ffLA-A*O3 Any altered peptide that has G or K at position 1 Any altered peptide that has 1, L, M, Q, T or V at anchor position 2 Any altered peptide thatbhas F, 1, L,MK V, W, or Yat position 3 Any altered peptide that has E, G or P at position 4 Any altered peptide that has F, L P, V, W, Y at position Any altered peptide that has F, 1, L, M, or V at position 6 Any altered peptide that has F, 1, L, M, W, or Y at position 7 Any altered peptide that has F, 1, K, L, Q or Yat anchor position 9 Any altered peptide where deleterious residues at the following positions are replaced: P 1: D,E, P P2: D, E, 1F,G,H, K, N,RS, W, Y P7T G, K, R P9: D, E,G,H, N, P,Q,S, T EOLA-A* 1101 Any altered peptide that has G, K or R at position 1 Any altered peptide that has 1, L, MK Q, T, V, Y at anchor position 2 Any altered peptide that has F, 1, L, M, V, W, Y at position 3 -142- Any alterdpeptide that has F, I,L,KW or Yat position 7 c-i Any altered peptide that has K or R at anchor position 9 Any altered peptide where deleterious residues at the following positions are replaced: P1: D,F, P 00 5 P2: D,E, G,H, K,N, R,S, W P7: K, R P9: C, D,E, G, N,P, Q,S, T IND HLA-A24 c-IAny altered peptide that has Kor Rat position 1 Any altered peptide that has F or Y at anchor position 2 Any altered peptide that has E, I, L, M, N, P, Q, or Vat position 3 Any altered peptide that has D, E, or P at position 4 Any altered peptide that has 1, L, or V at position Any altered peptide that has F at position 6 Amy altered peptide that has Nor Qat position 7 Any altered peptide that has E or K at position 8 Any altered peptide that has F, 1, L, or M at anchor position 9 Any altered peptide where deleterious residues at the following positions are replaced: P1: P P2: D, E,HLKR P9: D, F. G, H, YK, P, Q, R EH1A-A*3I 01 Any altered peptide that has Kor Rat position I Any altered peptide that has F, 1, L, M, Q, T, V; or Y at anchor position 2 Any altered peptide that has F, I, L, M, VW, or Yat position 3 Any altered peptide that has F, 1, 1, K, or V at position 6 Any altered peptide that has F, 1, 1, M, W, or Y at position 7 Any altered peptide that has K or R at anchor position 9 -143- Any altered peptide where deleterious residues at the following positions are replaced:

D,EZP

P2: 1,E, G, H, K,N, RS P9: C, G, N,P, Q,S, T 00 EILA-A*33D2 Any altered peptide that has D or E at position 1 IND Any altered peptide that has 1, L, M, S, V or Y at anchor position 2 Any altered peptide that has R at anchor position 9 Any altered peptide where deleterious residues at the following positions are replaced- P1: KP, R P2: D, E,K&,R P9: D, E,F, G, N,P,W, Y ELA-B7 Any altered peptide that has A at position I Any altered peptide that has A, P or V at anchor position 2 Any altered peptide that has M or R at position 3 Any altered peptide that has P at position Any altered peptide that has R at position 6 Any altered peptide that has L, L, M or V at anchor position 9 Any altered peptide where deleterious residues at the following positions are replaced: P1: P P2: D,F, R, W, Y P3: D, E P9: D, E,F,G, H, YN, P, Q, R,S,W, Y ILA-B8 Any altered peptide that has D or E at position 1 Any altered peptide that has A, C, L, or P at anchor position 2 Any altered peptide that has K or R at position 3 -144r--9 ~Any altered peptide that has Dor Eat posiion 4 AnatrdetiehtaZr~toiin Any altered peptide that has KL or at co position Any altered peptide whe re deleterous residues at the following positions are replaced: 00 C* 5 PI: K, P, R CIP2: D, E,P1,G, IiKQ, R,W, or Y PI: D, E D, E IND ~P9: D, E,F1,G, H,K, N,P, Q, R,S,W, Y BLA-B8 (8-mer peptides) Any altered peptide that has D or E at position 1 Any altered peptide that has A, C, L, or P at anchor position 2 Any altered peptide that has K or R at position 3 Any altered peptide that has D or E at position 4 Any altered peptide that has Kor Rat position Any altered peptide that has 1, L, K~ or V at anchor position 8 Any altered peptide where deleterious residues at the following positions are replaced: PI: R P2: D,F, F, G,H,KQ,I, W, or Y P3I D, E D, E P8: D, E, F, G, H, KN, P, Q, R, S, W, Y HOLA-BI4 Any altered peptide that has D or E at position 1 Any altered peptide that has K or R at anchor position 2 Any altered peptide that has F, 1, L, M, P, V, W, Y at position 3 Anty altered peptide that has H or R at position Any altered peptide that has 1, L, M, X, or V at position 6 Any altered peptide that has T at position 7 Any altered peptide that has 1, L, M, or V at anchor position 9 -145r--9 Any altered peptide where deleterious residues at the following positions are replaced: P2: D, E, F, W, or Y PI: E, R P5: E, W, Y P9: D, EG, H,K, N, P,Q, R 00 c-I HLA-B*27OZ cIN Any altered peptide that has KL or Rat nco position Any altered peptide that has F, W, or Y at position 3 Any altered peptide that has F, I, L, W or Y at anchor position 9 Any altered peptide where deleterious residues at Ihe following positions are replaced: P1: D, EP P2: D, F,G, lL KW, or Y P7: K P9: D, E,G, K,N, P, Q, RS HL4A-B27*05 (8.-mer peptides) Any altered peptide that has K or R at position 1 Any alteredPpeptide that has E, L, M, N, Q or R at anchor position 2 Any altered peptide that has F, W, or Y at position 3 Any altered peptide that has F, I, L, M, R, V or Y at anchor position 8 Any altered peptide where deleterious residues at the following positions are replaced: PI: D,F, P P2: D, F,G, H,Y,W, or Y P7: K P9: D, E, G,K&N, P,Q,R, S HLA-B*3501 (8-iner peptides) Any altered peptide, that has K or R at position 1 Any altered peptide that has A, P, or S at anchor position 2 Any altered peptide that has Kor Rat position 3 -146r--9 Any altered peptide that has D or E at position 4 ciAny altered peptidethat has Dor Eat position Any altered peptide that has F, 1, L, M, V, W or Y at anchor position 8 Any altered peptide where deleterious residues at the following positions are replaced: 00 C 5 Pl: P P2: D,F, F, H,K, R,W, Y P3: D, E P8: D, E, F,G, H, K.P,Q, R c-KI HLA-B*37O1 Any altered peptide that has D or E at anchor position 2 Any altered peptide that has I or V at position Any altered peptide that has F, L, or M at position 8 Any altered peptide that has F, I, L, M, V or Y at anchor position 9 Any altered peptide where deleterious residues at the following positions are replaced: PI: P P9: D, EG, R HILA-B*38O1 Any altered peptide that has F, H, P, W or Y at anchor position 2 Any altered peptide that has D or E at position 3 Any altered peptide that has D, E, or G at position 4 Any altered petide that has A, I, L, M, or V at position Any altered peptide that has Kor Yat position 8 Any altered peptide that has F, 1, L, M, or V at anchor position 9 Any altered peptide where deleterious residues at the following positions are replaced: Pl: P P2: D, E,K&,R PI R P9: D, E, G, IL K, P, Q, R -147- Z EHLA-B*39O1 (8-iner peptides) Any altered peptide that has H or R at anchor position 2 Any altered peptide that has Z, F, 1, L, M, V, W, or W at position 3 Any altered peptide that has D or E at position 4 00 C- 5 Any altered peptide that has L L,MKor Vat position 6 Any altered peptide that hwsL L, Mor Vat anchor position 8 IND Any altered peptide where deleterious residues at t1he following positions are replaced: PI: P P2: D, E P3: K, R P6: D, E,K, R P8: D,F, Q, R RLIA-B*39D2 Any altered peptide that has K or Q at anchor position 2 Any altered peptide that has F,1, L,KV, W,or Yat position Any altered peptide that has F, 1, or M at anchor position 9 Any altered peptide where deleteious residues at the following positions are replaced: P1: P P2: D, E P3: K, R P9: D,FG, H, K,P, Q, R Any altered peptide that has A or G at position 1 Any altered peptide that has D or E at anchor position 2 Any altered peptide digthas A, F,1, L, M, V, W, or Yat position 3 Any altered peptide that has P at position 4 Any altered peptide that has P at position Any altered peptide that has A, L, M, or W at anchor position 9 -148r--9 Any altered peptide where deleterious residues at the following positions are replaced: Pl: P _P2: P, K K KQ, R, V,W,or Y P3: D,F,K,R P9: D,EZG,H, K,N, P,Q, R 00 ECLA-B44*03 Any altered peptide that has A, D, or S at position 1 IND Any altered peptide that has D or E at anchor position 2 ciAny altered peptide that has A, 1, L, M, or Vat position 3 Any altered peptide tha has F, L, or P at position 4 Any altered peptide that has A, or V at position Any altered peptide that has A, L, T, or V at position 6 Any altered peptide that has F, K& or T at position 7 Any altered peptide that has K at position 8 Any altered peptide that has F, W or Y at anchor position 9 Any altered peptide where deleterious residues at the following positions are replaced: P1: P P2: F, A 1, M, Q, R, V, W, Y P9: D,E, G, H,Y,N, P,Q, R EHLA-B*51 01 (8-mer peptides) Any altered peptide that has D, E, F, 1, L, Kv, V, or Y at position I Any altered peptide that has A, G or P at anchor position 2 Any altered peptide that has F, W or Y at position 3 Any altered peptide that has D, E, G, 1, K, or V at position 4 Any altered peptide that has A, G, 1, S, T, or V at position Any altered peptide that hasl1, K, L, N, or Q at position 6 Any altered peptide that has D, K, Q, or R at position 7 Any altered peptide that has 1, L, Kvi or V at anchor position 8 -149- Any altered peptide where deleterious residues at the following positions are replaced- PI: P, R P2: D,EKK P8: D,F, F, G.H, K,N, P,Q, R,S,W, Y 00 HABSO Any altered peptide that has F or Y at position I Any altered peptide that has A, G, or P at anchor position 2 Any altered peptide that has F, 1, L, V, W, or Y at position 3 Any altered peptide that has E, G,H~ N, Q,F, or Tatposition 4 Any altered peptide that has G, N,Q, T, or Vatposition Any altered peptide that has I, N, Q, or T at position 6 Any altered peptide that has E, K, Q, or R at position 7 Any altered peptide that has Y, R, T, or Y at position 8 Any altered peptide that has 1, L, K, or V at anchor position 9 Any altered peptide where deleterious residues at the following positions are replaced: P1: P P2: D,EF,KY, R P3: D,F,K&,R P9: D,F, F, G,K, N, P, Q,RP,S,W, Y HLA-1B*51O2 (8-mer peptides) Any altered peptide that has F or Y at position 1 Any altered peptide that has A, G, or P at anchor position 2 Any altered peptide that has F, 1, L, V, W, or Y at position 3 Any altered peptide that has E, G, H, K, L. V, W, or Y at position 4 Any altered peptide that has G, N, Q, T, V at position Any altered peptide that has L, N, or Q at position 6 Any altered peptide that has Q, or R at position 7 Any altered peptide that has 1, L, M, or V at position 8 -150r--9 Any altered peptide where deleterious residues at the following positions are replaced: P2: D,,HK ,IR P3: D,F,KYIR P8: D,F, F,G, H, K,N, P,Q, R,S,W, Y 00 EHLA-B*5103 Any altered pq,1.ide that has D, T, or V at position 1 cIDA yatrdp pi et a a ,G rPa nh rp sto Any altered peptide that has A, G, or at c position 2 Any altered peptide that hasDA, F,Q,orY ator Vatpostin Any altered peptide that has 1, or T at position 6 Any altered peptide that has M or V at position 7 Any altered peptide that has I, L, M, or V at anchor position 9 Any altered peptide where deleterious residues at the following positions are replaced: P1: P P2: D, E,H,K, R P9: D,F, F, G, H,V,N, P, Q,R, S,W, Y HOLA-B*5101 (8-mer peptides) Any altered peptide that has 1, L, M, or V at position 1 Any altered peptide that has G, P, or Q at anchor position 2 Any altered peptide that has D, F, 1, L, P, W, or Y at position 3 Any altered peptide that has A, E, 1, K, L, P, or V at position 4 Any altered peptide that has A, F, G, 1, L, M, T or V at position Any altered peptide that hasKY,L, N, S or T at position 6 Any altered peptide that has E, K, Q, or Y at position 7 Any altered peotde that has F, 1, L, M, or V at anchor position 8 1r--9 Any altered peptide where deleterious residues at the following positions are replaced: PI: P P2:HIL &R P3: R P8: D, EG, IL N,P, Q, RS 00 C EHLA-B*58O1 Any altered peptide that hasi1, K, or R at position I IND Any altered peptide that has A, S, or T at anchor position 2 Any altered peptide that has D at position 3 Any altered peptide that has E, K, or P at position 4 Any altered peptide that has F, L, L, M, or V at position Any altered peptide that has F, 1, 1, or V at position 6 Any altered peptide that has L, M, N, or Y at position 7 Any altered peptide that has K,N,RP, or Tat position 8 Any altered peptide that has F, W, or Y at anchor position 9 Any altered peptide where deleterious residues at the following positions are replaced: PI: D,F, P P2: D, E,F,HK, N,Q, P, V,W, Y P9: D, E,G, H,KY,N, P,Q,R, S Any altered peptide that has D or E at anchor position 2 Any altered peptide that hasA L, M, S, or V at position 3 Any altered peptide that has L, 1, or V at position Any altered peptide that has 1, L, M, V, or Y at position 7 Any altered peptide that has K, Q, or R at position 8 Any altered peptide that has I, L, M, or V at anchor position 9 -152r--9 Any altered peptide where deleterious residues at the following positions are replaced: PI: P _P2: K4,,M, Q,R, V,W, Y P9: D, 1 ,G,H,KY,N, P, Q,R, S,W, Y 00 5 E[LA-B*61 CIAnyaeed peptide that has Gor Rat position I Any altered peptide that has D or E at anchor position 2 Any altered peptide that has A, F,1,L, M, T, V,W, or Yat position 3 Any altered peptide that has I at position 6 Any altered peptide that has Y at position 7 Any altered peptide that has A, L, L, K~ or V at anchor position 9 Any altered peptide where deleterious residues at the following positions are replaced: P1: P P2: F, IK& MQ,,VWY P9: D, B, F, G, H, Y,N, P, Q, R, S, W, Y ERLA-B*61 (8-mer peptides) Any altered peptide that has G or R at position I Any altered peptide that has D or E at anchor position 2 Any altered peptide that has A, F, 1, L, M, T, V, W, or Y at position 3 Any altered peptide that has I at position 6 Any altered peptide that has Y at position 7 Any altered peptide that has A, L, L, M, or V at anchor position 8 Any altered peptide where deleterious residues at the following positions are replaced: P1: P P?2: F,HK,Y, Q,R, V,W, Y P8: D,E, F, G, H,K, N, P,Q,R, S,W, Y -153- HLA-B*62 Any altered peptide that has I at position I Any altered peptide that has I, L, Q at anchor position 2 Any altered peptide that has G, K, R at position 3 00 5Ayatrdppieta a ,E ,o tpsto altered peptide that has D, E, G, orV at position IND Any altered peptide that hasp,1, L, Vat Any altered peptide that has T, Y at position 6 Any altered peptide that has T, W,o Y at c position 9 Any altered peptide where deleterious residues at the following positions are replaced: P1: P P2: D,F, F,HFLK&N,RkS,W, Y P3: D, E P6: D, E,K&,R P9: D, E,G, H,K, N,P, Q,R, S RLA-CwO3O1 Any altered peptide that has A or R at anchor position 2 Any altered peptide that has F, 1, L, M, V, or Y at position 3 Any altered peptide that has E, P, or R at position 4 Any altered peptide that has N at position Any altered peptide that has F, K, or Y at position. 6 Any altered peptide that has K& M, R, or S at position 7 Any altered peptide that has T at position 8 Any altered peptide that has F, 1, L, M at anchor position 9 Any altered peptide where deleterious residues at the following positions are replaced: P3I D,K&,R P6: D,EF,Y, R P9: D, E,G, H,Y, N, P,Q, R,S, -154r--9 HLA-CwO4Ol Any altered peptide that has F, P, W, or Y at anchor position 2 Any altered peptide that has D, or H at position 3 Any altered peptide that has D or E at position 4 00 01 5 Any altered peptide that has A, K M, P, or T at position NnatrdetdtahsL ,o~toiin Any altered peptide that has A,1 K at position 6 IDAny altered peptide, that has HA at position 8 Any altered peptide, that has FI Y, M, V oraat co position 9 Any altered peptide, where deleterious residues at the following positions are replaced: P1: P P2: D, FH,K&,R P9: D, E,G,HItK, N, P,Q,R, S ELA-CwO6O2 peptide that has F, 1, K, or Yat position 1 Any altered peptide that has A, P, Q, or R at anchor position 2 Any altered peptide that has F, 1, K, L, or M at position Any altered peptide that has 1, 1, or V at position 6 Any altered peptide, that has KC, N, Q, or R at position 7 Any altered peptide that has 1, L, MK V, or Y at anchor position 9 Any altered peptide, where deleterious residues at the following positions are replaced: P1: P P9: D, 1,G, H,Y,N, P, Q,R, S -155- Examples of predicted human Class I MHC binding peptides continued Rank Start position Subsequence Score (estimated halftime of dissociation) Examples of predicted human Class I MHC binding peptides from the C35 as sequence and how they might be changed to improve binding: HA-A*0101 Rank Start position Subsequence Score (estimated half time of dissociation) 1 77 2 16 3 29 4 39 2 example of improved peptide example of improved peptide HIIA-A*0101 (10-mer 1 66 2 16 3 29 4 26 52 example of improved peptide

KLENGGRPY

EVEPGSGVR

YCEPCGFEA

YLELASAVK

SGEPGQTSV

STEPGQTSV

STEPGQISY

peptides)

EIEINGQLVF

EVEPGSGVRI

YCEPCGFEAT

VVEYCEPCGP

GIEIESRLGG

GTEPSRLGY

225.000 90.000 45.000 36.000 2.250 G is deleterious at P2 22.50 G replaced with T P2 5625.00 V at P9 replaced with Y, P7 enhanced 45.000 18.000 9.000 9.000 2.250 1125.000 replace I with T @P2 replace G with Y @P9 PS enhanced with P IIA-A*0201 (9-mer peptides) 1 9 SVAPPPEEV 2 104 KITNSRPPC 3 105 ITNSRPPCV 4 25 IVVEYCEPC 2.982 2.391 1.642 1.485 -156- Examples of predicted human Class I MHC binding peptides continued Rank Start position Subsequence Score (estimated half time of dissociation) 65 FEIEINGQL 1.018 example of improved peptide FLIEIWVL 16619.000 1ILA-A*02O1 (1O-nier peptides) 1 58 RiLGGTGAFEI 2 104 ITrNSRPPCV 3 65 FEIEENGQLV 4 83 FPYEK.DLIEA example of improved peptide FLYEKDLIEA example of improved peptide FLYEKDLIEV 33 CGFE-ATYLEL 60.510 33.472 25.506 4.502 P is deleeiousat P2 689.606 replace P with L P2 9654.485 replace A with V o 3.173 HLA-A*0205 1 65 2 25 3 9 4 .104 81 example of improved peptide

FEIEINGQL

IVVEYCEPC

SVAPPPEEV

KITNSRPPC

GGFPYEKDL

GVFPYEKDL

8.820 3.060 2.000 1.500 1.260 G is deleterious at P2 50.400 replace G with V P2 HOLA-A*0205 (1O-mer peptides) 1 33 CGEFATYLEL example of improved peptide. CVEFATYLEL 2 104 KrrNSRPPCV 3 65 FEIE[NGQLV 6.300 G is deleterious at P2 11.200 replace G with P2 6.000 2.520 -157- Examples of predicted human Class I MIIC binding peptides continued Rank Start position Subsequence Score (estimated half time of dissociation) 4 53 IEIESRLG~T 1.428 83 FPYEKDLJEA 1.350 Pis deleterious atP12 example of improved peptide FVYEKDLIEA 54.000 replace P with V@ P?2 mUA-A24 1 34 2 49 example of improved peptide 3 70 4 38 82

GFEATYLEL

QYPGIEIES

QYPGIEIEL

NGQLZFSKL

TYLELASAV

GFPYEKDLI

33.000 11.550 462.000 enhance P9 11.088 10.800 7.500 IILA-A24 (10-mer peptides) 1 64 AFEIiEINGQL 2 74 VPSKLENGGF 3 84 PYEEKDLMEA 4 69 INGQLVFSKL example of improved peptide IYGQLVFSKL 28 EYCEPCGFEA 42.000 10.000 9.000 7.392 369.6 enhance P2 6.600 IEELA-A3 1 77 e~xample of improved peptide 2 39 3 101 4 61

KLENGGFPY

KLENGGFPK

YLELASAVK

TLEKJTNSR

GTGAFEIEl 36.000 180.000 enhance P9 20.000 6.000 0.540 -158- Examples of predicted human Class I MHC binding peptides continued Rank Start position Subsequence Score (estimated halftime of dissociation) 69 INGQLVFSK 0.360 Nisdeleterious@P2 example of improved peptide IGQLVFSK 180.000 replace N with L P2 HLA-A3 (lO-mer peptides) 1 68 EINGQLVFSK 2 58 RLGGTGAFE 3 41 ELASAVKEQY 4 78 LENGGPYEK example of improved peptide 95 HI.A-A*1101 1 39 2 69 example of improved peptide 3 16 4 101 61

LLNGGFPYEK

RASNGETLEK

YLELASAVK

LNGQLVFSK

lVGQLVSK

EVEPGSGVR

TLEKITNSR

GTGAFEIEI

8.100 2.700 1.800 0.810 Eisdeleterious@P2 270.000 replace E with L P2 0.400 0.400 0.120 Nis deleterious P2 6.000 replace N with V @P2 0.120 0.080 0.060 HLA-A*1101 (10-mer peptides) 1 95 RASNGETLEK 2 38 TYLELASAVK 3 68 EINGGLVFSK 4 78 LENGGFPYEK 1.200 0.600 0.360 0.120 Eis deleterious P2 4.000 replace E with V P2 0.090 example of improved peptide 100

LVNGGFPYEK

ETLEKITNSR

-159- Examples ofpredicted human Class I MLHC binding peptides continued Rank Start position Subsequence Scare (estimated halftime of dissociation) HLIA-A*3 101 1 101 2 16 3 50 4 87 example of Improved peptide 39 HIA-A*3302 1 16 2 101 3 50 TLEK1TNSR

EVEPGSGVR

YPGIEIESR

KDLIEA~IRR

KLMAIR

YLELASAVK

2.000 0.600 0.400 0.240 D is deleterious P2 12.000 replace D) with I P2 0.200 IILA-A*33Oz (10.-mer 1 49 2 100 3 16 4 28 68

EVEPGSGVR

TLEKITNSR

YPGIEIESR

EIEINGQLV

ESRLGGTGA

peptides)

QYPGIEIESR

ETLEKITNSR

EVEPGSGVRI

EYCEPCGFEA

EINGQLVFSK

45.000 9.000 3.000 1.500 1.500 15.000 9.000 1.500 1.500 1.500 IILA-A68.x 1 16 2 9 3 50

EVEPGSGVR

SVAPPPEEV

YPGIEIESR

900.000 12.000 10.000 -160- Examples of predicted humnan Class I MHC binding peptides continued Rank Start position Subsequence Score (estimated half time of dissociation) example of improved peptide YVGIEIESR 400.000 enhance P2 4 96 ASNGETLEK 9.000 TLEKITNSR 101 HLA-A68.1 (1O-mer peptides) 1 100 ETLEKTNSR 2 16 EVEPGSGVRI 3 68 EINGGLVFSK 4 15 EEVEPGSGVR 5.000 300.000 18.000 9.000 9.000 E is deleterious P2 1200.00 replace E with V P2 3.000 example of improved peptide 95

EVVEPGSGR

RASNGBTLEK

HLA-B14 1 2 example of improved peptide 3 100

RRASNGETL

SRLGGTGAF

SRLGGTGAL

ETLEKITNS

ITNSRPPCV

DLIMAIRRA

20.000 5.000 100.000 enhance P9 3.375 2.000 1.350 HLA-B14 (10-mer peptides) 1 103 EKITNSRPPC 6.750 example of improved peptide 2 33 3 93 4 18

ERITNSRPPL

CGFEATYLEL

IMRASNGET

EPGSGVRrV 900.000 enhance P1O 5.000 4.000 3.000 -161- Examples of predicted human Class I MHC binding peptides continued Rank Start position Subsequence Score (estimated halftime of dissociation) 88 DLIEAERRAS 2.250 1 65 2 3 3 35 4 15 example of improved peptide 67

FEIEUGQL

GEPGQTSVA

PEATYLELA

EEVEPGSGV

EEVEPGSGL

IEINGQLVF

80.000 40.000 40.000 24.000 120.000 enhance P9 16.000 (lO-mer peptides) 1 55 EESRLGGTGA 2 53 IEIESRLGGT example of improved peptide IELESRLGGL 3 65 FEIEINGQLV 4 67 IEINGQLVPS 99 GETLEKITNS 20.000 16.000 80.000 enhance 16.000 16.000 8.000 387.200 17.600 352.000 enhance P9 16.000 16.000 8.800 1 65 2 17 example of improved peptide 3 15 4 47 85

FEIEFNGQL

VEPGSGVRl

VEPGSGVRL

EEVEPGSGV

KEQYPGIEI

YEKDLEAl -162- Examples of predicted human Class I MHC binding peptides continued Rank Start position Subsequence Score (estimated half time of dissociation) (10-mer peptides) 1 65- FEIEINGQLV 16.000 example of improved peptide FEIEINGQLL 320.000 enhance 2 106 TNSRPPCVIL 16.000 3 53 IBIESRLGGT 8.000 4 33 CGFEATYLEL 8.000 17 VEPGSGVRV 8.000 HLA-B61 1 15 2 35 example of improved peptide 3 3 4 65 85

EEVEPGSGV

FEATYLELA

FEATYLELV

GEPGQTSVA

FEIEINGQL

YEKDEEAI

80.000 40.000 160.000 enhance P9 22.000 16.000 16.000 RLA-B61 (10-mer peptides) 1 65 FEIEINGQLV 2 17 VEPGSGVRIV 3 55 IESRLGGTGA 4 87 KDLEARRA 80.000 40.000 20.000 10.000 example of improved peptide 53

KELIEAIRRV

IEJESRLGGT

160.000 enhance P2, 8.000 -163- Examples of predicted human Class I MHC binding peptides continued Rank Start position Subsequence Score (estimated half time of dissociation) HLA-B62 1 77 KLENGGFPY 24.000 2 21 SGVRIVVEY 4.800 3 75 FSKLENGGF 3.000 4 31 EPCGFBATY 2.640 P is deleterious P2 example of improved peptide EQCGFEATY 105.6 replace P with Q P2 88 DLEAIRRA 2.200 KA-B62 (10-mer peptides) 1 41 ELASAVKEQY 2 58 RLGGTGAPEI 3 66 EIEINGQLVF 4 56 ESRLGGTGAF example of improved peptide 20 example of improved peptide HLA-B7 1 107 example of improved peptide 2 45 3 22 4 70 81

EQRLGGTGAF

GSGVRIVVEY

GQGVRTVVEY

NSRPPCVIL

NPRPPCVIL

AVKEQYPGI

GVRIVVEYC

NGQLVFSKL

GGFPYEKDL

40.000 9.600 7.920 6.000 Sisdeleterious@P2 480.000 replace S with Q 0 P2 4.800 S is deleterious P2 384.000 replace S with Q @P2 60.000 1200.000 enhance P2 6.000 5.000 4.000 4.000 -164- Examples of predicted human Class I MI-C binding pepides continued Rank Start position Subsequence Score (estimated halftime of dissociation) BLA-B7 (1-mer peptides) 1 50 YPGIEIESRL 80.000 2 31 EPCCTFEATYL 80.000 3 18 EPGSGVRIVV 6.000 example of improved peptide EPGSGVRIVL 120.000 enhance 4 106 TNSRPPCVIL 6.000 80 NGGFPYEKDL 4.000 HLA-B8 1 107 2 45 3 105 4 56 100 example of improved peptide

NSRPPCVIL

AVKEQYPGI

ITNSRPPCV

ESRLGGTGA

ETLEKITNS

ETLEKITNL

4.000 1.500 0.600 0.400 0.300 Sis deleterious@ P9 12.000 replaceS with L@P9 HLA-B8 (8-mer peptides) 1 83 FPYEKDLI 2 107 NSRPPCVI 3 91 EAIRRASN 6.000 1.000 0.800 Nis deleterious@P8 32.000 replace N with L P9 0.600 0.400 example of improved peptide 4 20 18

EAIRRASL

GSGVRIV

EPGSGVRl -165- Examples of predicted buman Class I WHC binding peptides continued R ank Start position Subsequence Score (estimated halftime of dissociation) HLIA-B8 (1O-mer peptides) 1 50 YPGEEIESRL 0.800 2 93 IIRRANGETL 0.400 example of improved peptide IA RASNGETL 16.000 replace R with A P2 3 31 EPCGFEATYL 0.320 4 104 KITNSRPPCV 0.300 18 EPGSGVRIVV 0.240 HILA-B*2702 1 57 2 94 example of improved peptide 3 93 4 27 77

SRLGGTGAF

RRASNGETL

RRASNGETF

HRRANGET

VEYCEPCGF

KLENGGFPY

200.000 180.000 600.000 enhance IP9 20.000 15.000 9.000 EOLA-B*2702 (10-mer peptides) 1 93 HURASNGETL 2 94 RRASNGETLE 3 30 CEPCGFEATY 4 58 RW3GTGAME 23 VRIVVEYCEP example of improved peptide VRLYVEYCEY 60.000 6.000 3.000 2.700 2.000 P is deleterious PlO 200.000 replace P with Y PIO -166- Examples of predicted human Class I MHC binding peptides continued Rank Start position Subsequence Score (estimated half time of dissociation) HLA-B*270S 1 94 RRASNGETL 6000.000 2 57 SRLGGTGAF 1000.000 3 93 IRRASNGET 200.000 example of improved peptide 4 27 77

IRRASNGEL

VFYCEPCGF

KLENGGFPY

2000.000 enhance P9 75.000 45.000 HLA-B*2705 (lO-mer peptides) 1 93 IRRASNGET 2 94 RRASNGETLE example of improved peptide 3 78 4 95 58 HLA-B*3501 1 31 2 75 example of improved peptide 3 107 4 42 18

RRASNGETL

LENGGFPYEK

RASNGETLEK

RLGGTGAFEI

EPCGFEATY

FSKLENGGF

FPKLENGGM

NSRIPCVIL

LASAVKEQY

EPGSGVRIV

2000.000 60.000 is deleterious P2 6000.000 replace E with L P2 30.000 30.000 27.000 40.000 22.500 120.000 enhance P2, P9 15.000 6.000 4.000 -167- Examples of predicted human Class I MvHC binding peptides continued Rank Start position Subseqnamce Score (estimated half time of dissociation) HLA-B*35O1 (10-iner peptides) 1 31 EPOGFEATYL 30.000 2 50 YPGIEMERL 20.000 3 56 ESRLGGTGAF 15.000 4 20 GSGVRIVVEY 10.000 83 FPYEKDLIEA 6.000 example of improved peptide EOLA-B*3701 1 65 example of improved peptide 2 47 3 85 4 17 35

FPYEKDLEEM

F'EMED'GQL

FDIEINGQL

KEQYPGLEI

YEKDUEAI

VEPGSGVRl

FEATYLELA

120.000 enhance PIO 15.000 60.000 enhance P2 10.000 10.000 10.000 5.000 HLA-B*3701 (1O-mer peptides) 1 65 FEIEINGQLV example of improved peptide FDIEINGQLI 2 67 EEINGQLVFS 3 81 GGPPYEKDLI 4 87 KDLIEAIRA 30 CEPCGFEATY 10.000 200.000 enhance P2, 5.000 5.000 4.000 2.000 -168- Examples of predicted human Class I MHfC binding peptides continued Rank Start position Subsequence Score (estimated half time of dissociation) HILA-B*3801 1 34 GFEATYLEL 6.000 example of improved peptide 2 70 3 38 4 81 97 HiLA-B*3801 (lO-mer 1 64 example of improved peptide 2 31 3 66 4 26 so HIA-B*3901 1 94 example of improved peptide 2 34 3 38 4 66 2

GEREATYLEL

NGQLVFSKL

TYLELASAV

GGFPYEKDL

SNGETLEKI

peptides) AFEWE1NGQL

AB.EIINGQL

EPCGFEATYL

EIEIGQLVF

VVEYCEPO3F

YPGIEIESRL

RRASNGETL

RHA.SNGETL

GFEATYLEL

TYLELASAV

EIEINGQLV

SGEPG9TSV 7.800 90.000 enhance P2 1.560 1.040 1.000 0.720 117.000 enhance P2 4.800 3.000 3.000 2.600 15.000 90.000 enhance P2 9.000 4.000 3.000 3.000 -169- Examples of predicted human Class I MIC binding peptides continued Rank Start position Subsequence Score (estimated half time of dissociation) BLA-B*3901 (10-ner peptides) 1 33 CGFEATYLEL 12.000 example of improved peptide CHIFEATYLEL 360.000 enhance P2 00 2 64 AFEIEINGQL 9.000 3 93 IRRASNGETL 4.500 4 46 VKEQYPGIEI 3.000 16 EVEPGSGVRI 3.000 B1A-B*3902 1 70 NGQLVFSKL 2.400 example of improved peptide NKQLVF!SKL 24.000 enhance P2 2 81 GGFPYEKDL 2.400 3 94 RRASNGETL 2.000 4 34 GFEATYLEL 2.000 107 NSRPPCVIL 0.600 HLA-B*3902 (1O-mer peptides) 1 69 INGQLVFSKL 2.400 2 64 AFEIEINGQL 2.400 3 50 YPGIEIESRL 2.400 4 80 NGGFPYEKDL 2.400 106 TNSRPPCVIL 2.000 -170- Examples of predicted human Class I MHC binding peptides continued Rank Start position Subsequence Score (estimated half time of dissociation) HLA-B*4403 1 67 IEINGQLVP 200.000 example of improved peptide 2 27 3 21 4 65 35

IEINGQLVY

VEYCEPGGF

SGVRIYVEY

FEEEINGQL

FEATYLELA

900.000 enhance IP9 40.000 36.000 20.000 12.000 HLA-B*4403 (10-iner peptides) 1 30 CEPCGFEATY 2 53 IEIESRLGGT example of improved peptide IEIESRLGGY 3 67 IEINGQLVFS 4 65 FEIEINGQLV 17 VEPGSGVRrV 120.000 30.000 900.000 enhance PlO 30.000 20.000 18.000 484.000 114.400 572.000 enhance P2 48.400 4.000 22.000 HLIA-B*5I01 1 18 2 59 example of improved peplide 3 2 4 81 70

EPGSGVRIV

LGGTGAFEI

LPGTGAFEI

SGEPGQTSV

GGFPYEKDL

NGQLVIPSKL

-171- Examples of predicted human Clas I MHC binding peptides continued Rank Start position Subsequence Score (estimated half time of dissociation) HLA-B*5101 (lO-mer peptides) 1 18 EPGiSGVRIVV 2 44 SAVKEQYGI example of improved peptide 3 31 4 81 50 ffLA-B*5102 1 18 2 81 example of improved peptide 3 59 4 70 2

SPVKEQYPGI

EPC2GFEATYL

GGFPYEKDLI

YPGIEIESRL

EPGSGVRIV

GGFPYEKDL

GPFPPYEKDI

LGGTGAFEI

NGQLVPSKL

SGEPGQTSV

440.000 220.000 440.000 enhance P2 220.000 176.000 157.300 242.000 110.000 2200.000 enhance P2, P9 96. 800 48.400 24.200 JLA-B*5102 (lO-mer peptide) 1 44 SAVKEQYPGI example of improved peptide SPVKHQYPGI 2 50 YPGIEEESRL.

3 81 3 81 GGPPYEKDLI

EPGSGVRIVV

EPCC7FEATYL 726.000 1452.000 enhance P2 400.000 400.000 220.000 121.000 -172- Examples of predicted human Class I M}IC binding peptides continued Rank Start position Subsequence Score (estimated half time of dissociation) HLA-B*51O3 1 59 LGGTGAFEI 48.400 eample of improved peptide LAFTGAPEI 145.200 enhance P2 2 2 SGEPGQTSV 44.000 3 18 EPGSGVRIV 44.000 4 70 NGQLVFSKL 7.260 81 GGFPYEKDL 7.200 IHA.-B*5103 (1O-mer peptide) 1 44 SAVKEQYPGI 2 81 GGFPYEKDLI 3 18 EPGSGVR[VV 110.000 52. 800 44.000 example of improved peptide 4 60 33 HIA-B*5201 1 18 2 67 example of improved peptide 3 59 4 98 19 EAGSGVR1VV

GGTGAFEIEI

CGFEATYLEL

WPTGSGVRIV

LEIN~GQLVF

LQINGQLVI

LGGTGAFEI

NGETLEKIT

PGSGVRIVV

110.000 enhance P2 44.000 7.920 75.000 22.500 450.000 enhance P2, P9 11.250 11.000 10.000 -173- Eamples ofpredicted human Class I MHC binding peptides continued Rank Start position Subseqnence Score (estimated half time of dissociation) HLA-B*5201 (lO-mer peptides) 1 18 EPGSGVRVV 100.000 2 17 VEPGSGVRV 45.000 example of improved peptide 3 81 4 105 37 HLA-B*5801 1 75 example of improved peptide 2 42 3 107 4 61 105

VQPGSGVRIV

GGFPYEKDLI

ITNSRPPCVI

ATYLPLASAV

PSKLENGGF

FSKLENGGW

LASAVKEQY

NSRPPCVL

GTGAFEEI

ITNSRPPCV

450.000 enhance P2 33.000 15.000 12.000 40.000 80.000 enhance P9 4.500 4.000 3.000 3.000 ILA-B*5801 (lO-mer peptides) 1 56 ESRLGGTGAF 2 20 GSGVR1VEY example of improved peptide GSGVRIVVEW 3 1 MSGEPGQTSV 4 105 ITNSRPPCVI 37 ATYLELASAV 12.000 10.800 144.000 enhance PIO 4.000 3.000 3.000 -174- Examples of predicted human Class I MHC binding peptides continued Rank Start position Subsequence Score (estimated halftime of dissociatio) 00 HLA-Cw*0301 1 65 2 81 3 70 4 57 34

FEIEINGQL

GGFPYEKDL

NGQLVPSKL

SRLGGTGAF

GFEATYLEL

30.000 18.000 12.000 10.000 10.000 50.000 HLA-Cw*0301 (1O-mer peptides) 1 44 SAVKEQYPGI example of improved peptide 2 33 3 69 4 81 106 HLA-Cw*0401

SAVKBQYPGL

CGFEATYLEL

INGQLVFSKL

GGFPYEKDUI

TNSRPPCVIL

100.000 enhance PIO 45.000 12.000 3.750 3.000 1 34 2 38

GFEATYLEL

TYLELASAV

GFPYEKDLI

EPGSGVRJV

EPGGFEATY

EFCGFEATL

240.000 30.000 25.000 20.000 12.000 31 example of improved peptide 200.000 enhance P2, P9 HLACw*040l (lO-ner peptides) 1 64 AFEIEINGQL 2 74 VFSKLENGGF 200.000 100.000 -175- Examples of predicted human Class I MEC binding peptides continued Rank Start position Subsequence Score (estimated half time of dissociation) examnple of improved peptide 3 50 4 31

VFSKLENGGL

YPGIE]BSRL

EPCGFEATYL

EPGSGVRIVY

200.000 enhance PIO 80.000 80.000 10. 000 18 EILA-Cw* 0602

YEKDLIEA]

FEIEING3QL

SGVRIVVEY

EPCGFEA IY

GTGAGEI

6.600 6.600 6.000 3.300 3.000 ELA-Cw*0702 49

EPQGFEATY

SGVRIVVEY

LASAVKEQY

KLENGGFPY

QYPGIEIES

peptides)

GSGVRIVVEY

CEPCGFEATY

ELASAVKEQY

YPGIEIESRL

SKLENGGFPY

24.000 19.200 8.800 4.000 2.880 HiLA-Cw*0702 (lO-mer 1 20 2 30 38.400 16.000 16.000 7.920 4.000 76 -176- Table Predicted C35 EILA Class I epitopes* lILA restiction element Inclusive amino acids A*0201 9-17 A*0201 10-17 A*0201 16-23 A*0201 16-25 A*0201 36-43 A*0201 37-45 A*0201 37-46 A*0201 39-46 A*0201 44-53 A*0201 45-53 A*0201 52-59 A*0201 54-62 A*0201 58-67 A*0201 6 1-69 A*0201 66-73 A*0201 66-74 A*0201 88-96 A*0201 89-96 A*0201 92-101 A*0201 95-102 A*0201 104-1 13 A*0201 105-1 13 A*0201 105-1 14 A*3 101 16-24 B*3501 30-38 A*30101 supermotif 96-104 Seciuence

SVAPPPBEV

VAPPPEEV

BVEPGSGV

EVEPGSGVRI

EATYLELA

ATYLELASA

ATYLELASAY

YLELASAV

SAVKEQYPGI

AVKEQYPGI

GIEIESRL

ELESRLGGT

RLGGTGAFEI

GTGAFEIBI

EEEINGQL

EfIEINGQLV

DUEBAIRRA

LIFAIRRA

AIRRASNGET

RASNGETL

KITNSRPPCV

ITNSRPPCV

ITNSRPPCVI

EVEPGSGVR

EPCGFEATY

ASNGETLEK

*predicted using rules found at the SYPPEITHI website (wyinJ3S/htt 1342.96.221Scrtip ,a.llervryPxedicttm andamfbasedn the book'7vMHC Ligands and Peptide Motifs" by Rammensee, Bachmann, L. and S. Stevanovic. Chapman Hall, New York, 1997.

-177- Table 6 Predicted C35 ILA class II epitopes* Sequence Inclusive amino acids Restricion elements 00

SGVRIVVEYCEPCGF

SRLGGTGAFELI3NGQLVF 21-35 DRB1*O1O1 DRBI *0102 DRBI *0301 DRBI *040 1 DRBI *0404 DRB1 *0405 DRBI*0410 DRBI *0421 DRBI*0701 DRB*0801 DRBI*0804 DRBI *0806 DRB1I* 1101 DRB 1104 DRBI*1 106 DRB1 *1107 DRB1*1305 DRB I* 1307 DRBI1* 1321 DRB1*1501 DRB1*1502 DRB5*0101 DRB1*0101 DRB 1*0102 DRB 1*0301 DRB1*0401 DRBI *0402 DRBI*0421 DRB1*0701 DRB1*0804 DRBI *0806 DRB 1* 1101 DRB1I* 1104 DRB1*1 106 DRB1I* 1305 DRB1 *1321 DRB1I* 1501 57-75 -178- GAFEIEINGQLVFSKLENGGF 63-83 DRBI1* 1502 101 DRBL*0101 DRB 1*0102 DRBI*0301 DRB 1 *0401 DRB 1*0402 DRB 1*0404 DRB 1*0405 DRB1*0410 DRB1*0421 DRBI1*0701 DRB 1*0804 DRBI *0806 DRB 1* 1101 DRBI1* 1104 DRBI1* 1106 DRB 1 *1107 DRBI*1305 DRB 1*1307 DRR 1 *1311 DRBI*1321 DRB I* 1501 DRBI *1502 DRB5*0101

FPYEKDLEEALRRASNGETLE

83-103 DRB1*0101 DRB1*0102 DRB1*0301 DR.Bl*0401 DRBI *0402 DRB1 *0404 DRBI1 *0405 DRBI*0410 DRB1*0421 DRBI*0701 DRBI*0801 DRB1*0802 DRB1 *0804 DRB1*0806 DRBI1* 1101 DRB1*1104 DRBI*1106 -179- DRB1*1107 DRB1*1305 ¢C DRB1*1307 DRB1*1311 DRB1*1321 DRB1*1501 00 DRB1*1502 DRB5*0101 i *Class II MHC epitopes predicted using TEPITOPE software. Sturniolo, et S 10 al. 1999. Generation of tissue-specific and promiscuous HLA ligand databases O using DNA microarrays and virtual HLA class II matrices. Nature Biotechnology 17:555-571.

In the present invention, "epitopes" refer to C35 polypeptide fragments having antigenic or immunogenic activity in an animal, especially in ahuman, or that are capable of eliciting a T lymphocyte response in an animal, preferably a human. A preferred embodiment of the present invention relates to a polypeptide fragment comprising an epitope, as well as the polynucleotide encoding this fragment. A further preferred embodiment of the present invention relates to a C35 polypeptide fragment consisting of an epitope, as well as the polynucleotide encoding this fragment In specific preferred embodiments of the present invention, the epitope comprises a C35 fragment listed in any of Tables 1-6. In another preferred embodiment of the present invention, the epitope consists of a C35 fragment listed in any of Tables 1-6. A region of a protein molecule to which an antibody can bind is defined as an "antigenic epitope." In contrast, an "immunogenic epitope" is defined as a part of a protein that elicits an antibody response. (See, for instance, Geysen et al., Proc. Natl. Acad. Sci.

USA 81:3998- 4002 (1983)). Thus, a further preferred embodiment of the present invention is an immunogenic C35 peptide fragment that is capable of eliciting a T cell response when bound to the peptide binding cleft of an MHC molecule. In a specific preferred embodiment, the immunogenic C35 peptide -180fragment comprises an epitope listed in any of Tables 1-6. In another preferred embodiment, the immunogenic C35peptide fragment consists of an epitopelisted in any of Tables 1-6. Further embodiments of the invention are directed to pharmaceutical formulations and vaccine compositions comprising said O 5 immunogenic C35 peptide fragments or the polynucleotides encoding them.

Fragments which function as epitopes may be produced by any conventional means. (See, Houghten, R. Proc. Natl. Acad. Sci. USA 82:5131-5135 (1985) further described in U.S. Patent No. 4,631,211.) The sequence of peptide epitopes known to bind to specific MHC molecules can be modified at the known peptide anchor positions in predictable ways that actto increase MHC binding affinity. Such "epitope enhancement" has been employed to improve the immunogenicity of a number of different MHC class I or MHC class II binding peptide epitopes (Berzofsky, J.A. et al., Immunol.

Rev. 170:151-72 (1999); Ahlers, J.D. et al., Proc. Natl. Acad. Sci U.S.A.

94:10856-61 (1997); Overwijk, et al., J. Exp. Med. 188:277-86 (1998); Parkhurst, M.R. et al.,J. Immunol. 157:2539-48 (1996)). Accordingly, a further embodiment of the invention is directed to such enhanced C35 epitopes, and to the polynucleotides encoding such enhanced epitomes.

In the present invention, antigenic epitopes preferably contain a sequence of at least seven, more preferably at least nine, and most preferably between about 15 to about 30 amino acids. Antigenic epitopes are useful to raise antibodies, including monoclonal antibodies, that specifically bind the epitope.

(See, for instance, Wilson et al., Cell 37:767-778 (1984); Sutcliffe, J. G. et al., Science 219:660-666 (1983).) Similarly, immunogenic epitopes can be used to induce B cells and T cells according to methods well known in the art (See Sutcliffe et al., supra; Wilson et al., supra; Chow, M. et al., Proc. Natl. Acad. Sci. USA 82:910-914; and Bittle, F. J. et al., J. Gen. Virol. 66:2347-2354 (1985).) A preferred immunogenic epitope includes the secreted protein. The immunogenic epitopes may be presented together with a carrier protein, such as an albumin, to an -181- Sanimal system (such as rabbit or mouse) or, if it is long enough (at least about C, amino acids), without a carrier. However, immunogenic epitopes comprising as few as 9 amino acids have been shown to be sufficient to raise antibodies capable of binding to, at the very least, linear epitopes in a denatured polypeptide 00 5 in Western blotting.) As used herein, the term "antibody" (Ab) or "monoclonal antibody" (Mab) is meant to include intact molecules as well as antibody fragments (such as, for example, Fab and F(ab')2 fragments) which are capable of specifically binding to protein. Fab and F(ab')2 fragments lack the Fc fragment of intact antibody, clear more rapidly from the circulation, and may have less non-specific tissue binding than an intact antibody. (Wahl et al., J. Nucl. Med. 24:316-325 (1983).) Thus, for some applications these fragments are preferred, as well as the products of a Fab or other immunoglobulin expression library. Moreover, antibodies of the present invention include chimeric, single chain, andhumanized antibodies.

Diagnostic and Therapeutic Uses of Antibodies The present invention further relates to C35 antibodies, C35 antibody fragments and antibody conjugates and single-chain immunotoxins reactive with human carcinoma cells, particularly human breast and bladder carcinoma cells.

Table 7 provides a list of C35-specific monoclonal antibodies that have been isolated and characterized for use in different applications.

TABLE 7: -Specific Murine Monoclonal Antibodies Western Flow Immunohisto- Fusion Hybridoma ELISA Isotype Blot ometr chemistry Blot Cytometry chemistry alpha 1F5 positive IgM positive positive 1F7 positive IgM positive -182- FusonHybidma LIA IotpeWestern Flow Immunohisto- FusonHybidma LIA Iotpe Blot Cytomnetry chemistry iFl I positive 1gM positive 2D9 positive 1gM positive positive positive beta 2G3 positive IgGI 2G8 positive____ 2G10 positive IgG3 2G1 1 positive lgG3 3F9 positive IgGI 4111 positive IgGi 4G3 positive IgG3 7C2 positive 1gM 8B311 positive 1gM 8G2 positive 1gM 10F4 positive IgGi 11BIO positive 1gM positive 12BI0 positive 16CI0 positive 1gM 16FI0 positive____ ELISA assay on bacterially-synthesized blank =not determined As used in this example, the following words or phrases have the meanings specified.

As used in this example, "joined" means to couple directly or indirectly one molecule with another by whatever means, by covalent bonding, by non-covalent bonding, by ionic bonding, or by non-ionic bondinpg. Covalent bonding includes bonding by various linkers such as thioether linkers orthioester linkers. Direct coupling involves one molecule attached to the molecule of interest. Indirect coupling involves one molecule attached to another molecule not of interest which in turn is attached directly or indirectly to the molecule of interest.

I

-183- As used in this example, "recombinant molecule" means a molecule produced by genetic engineering methods.

As used in this example, "fragment" is defined as at least a portion of the variable region of the immunoglobulin molecule which binds to its target, i.e. the 0 0 5 antigen binding region. Some of the constant region of the immunoglobulin may be included.

N, As used in this example, an "immunoconjugate" means any molecule or ligand such as an antibody or growth factor chemically or biologically linked to a cytotoxin, a radioactive agent, an anti-tumor drug or a therapeutic agent The antibody or growth factor may be linked to the cytotoxin, radioactive agent, anti-tumor drug or therapeutic agent at any location along the molecule so long as it is able to bind its target. Examples of immuoconjugates include immunotoxins and antibody conjugates.

As used in this example, "selectively killing" means killing those cells to which the antibody binds.

As used in this example, examples of "carcinomas" include bladder, breast, colon, liver, lung, ovarian, and pancreatic carcinomas.

As used in this example, "immunotoxin" means an antibody or growth factor chemically or biologically linked to a cytotoxin or cytotoxic agent.

As used in this example, an "effective amount" is an amount of the antibody, immunoconjugate, recombinant molecule which kills cells or inhibits the proliferation thereof.

As used in this example, "competitively inhibits" means being capable of binding to the same target as another molecule. With regard to an antibody, competitively inhibits mean that the antibody is capable of recognizing and binding the same antigen binding region to which another antibody is directed.

As used in this example, "antigen-binding region" means that part of the antibody, recombinant molecule, the fusion protein, or the immunoconjugate of the invention which recognizes the target or portions thereof.

-184- SAs used in this example, "therapeutic agent" means any agent useful for C- therapy including anti-tumor drugs, cytotoxins, cytotoxin agents, and radioactive agents.

As used in this example, "anti-tumor drug" means any agent useful to O0 5 combat cancer including, but not limited to, cytotoxins and agents such as c antimetabolites, alkylating agents, anthracyclines, antibiotics, antimitotic agents, N procarbazine, hydroxyurea, asparaginase, corticosteroids, mytotane interferons and radioactive agents.

o C As used in this example, "a cytotoxin orcytotoxic agent" means any agent that is detrimental to cells. Examples include taxol, cytochalasin B, gramicidin D, ethidium bromide, emetine, mitomycin, etoposide, tenoposide, vincristine, vinblastine, colchicin, doxorbicin, daunorubicin, dihydroxy anthracin dione, mitoxantrone, mithramycin, actinomycin D, 1-dehydrotestosterone, glucocorticoids, procaine, tetracaine, lidocaine, propranolol, and puromycin and analogs or homologs thereof.

As used in this example, "radioisotope" includes any radioisotope which is effective in destroying a tumor. Examples include, but are not limited to, andX-rays. Additionally, naturally occurring radioactive elements such as uranium, radium, and thorium which typically represent mixtures of radioisotopes, are suitable examples of a radioactive agent.

As used in this example, "administering" means oral administration, administration as a suppository, topical contact, intravenous, intraperitoneal, intramuscular or subcutaneous administration, or the implantation of a slow-release device such as a miniosmotic pump, to the subject.

As used in this example, "directly" means the use of antibodies coupled to a label. The specimen is incubated with the labeled antibody, unbound antibody is removed by washing, and the specimen may be examined.

As used in this example, "indirectly" means incubating the specimen with an unconjugated antibody, washing and incubating with a -185fluorochrome-conjugated antibody. The second or "sandwich" antibody thus I reveals the presence of the first.

As used in this example "reacting" means to recognize and bind the target. The binding may be non-specific. Specific binding is preferred.

00 5 As usedin this example, "curing" means toprovide substantially complete tumor regression so that the tumor is not palpable for a period of time,

O

C 10 tumor volume doubling delays (TVDD the time in days that it takes for 0 control tumors to double in size).

C1 As used in this example, "tumor targeted antibody" means any antibody which recognizes the C35 antigen on tumor cancer) cells.

As used in this example, "inhibit proliferation" means to interfere with cell growth by whatever means.

As used in this example, "mammalian tumor cells" include cells from animals such as human, ovine, porcine, murine, bovine animals.

As used in this example, "pharmaceutically acceptable carrier" includes any material which when combined with the antibody retains the antibody's immunogenicity and is non-reactive with the subject's immune systems.

Examples include, but are not limited to, any of the standard pharmaceutical carriers such as a phosphate buffered saline solution, water, emulsions such as oil/water emulsion, and various types of wetting agents. Other carriers may also include sterile solutions, tablets including coated tablets and capsules.

Typically such carriers contain excipients such as starch, milk, sugar, certain types of clay, gelatin, stearic acid or salts thereof, magnesium or calcium stearate, talc, vegetable fats or oils, gums, glycols, or other known excipients.

Such carriers may also include flavor and color additives or other ingredients.

Compositions comprising such carriers are formulated by well known conventional methods.

The present invention relates to C35 antibodies that are highly specific for carcinoma cells. More particularly, the antibodies react with a range of carcinomas such as breast, bladder, lung, ovary and colon carcinomas, while -186- Sshowing none or limited reactivity with normal human tissues or other types of tumors such as, for example, sarcomas or lymphomas.

Theterm "C35 antibody" as usedherein includes whole, intactpolyclonal and monoclonal antibody materials, and chimeric antibody molecules. The 00 5 antibody described above includes any fragments thereof containing the active C antigen-binding region of the antibody such as Fab, F(ab)2 and Fv fragments, using techniques well established in the art [see, Rousseaux et al, "Optimal SConditions For The Preparation of Proteolytic Fragments From Monoclonal IgG

C

of Different Rat IgG Subclasses", in Methods Enzymol., 121:663-69 (Academic Press 1986)]. The C35 antibody of the invention also includes fusion proteins.

Also included within the scope of the invention are anti-idiotypic antibodies to the C35 antibody of the invention. These anti-idiotypic antibodies can be produced using the C35 antibody and/or the fragments thereof as immunogen and are useful for diagnostic purposes in detecting humoral response to tumors and in therapeutic applications, in a vaccine, to induce an anti-tumor response in patients [see, Nepom et al., "Anti-Idiotypic Antibodies And The Induction Of Specific Tumor Immunity", in Cancer And Metastasis Reviews, 6:487-501 (1987)].

In addition, the presentinvention encompasses antibodies that are capable of binding to the same antigenic determinant as the C35 antibodies and competing with the antibodies for binding at that site. These include antibodies having the same antigenic specificity as the C35 antibodies but differing in species origin, isotype, binding affinity or biological functions cytotoxicity). For example, class, isotype and other variants of the antibodies of the invention having the antigen-binding region of the C35 antibody can be constructed using recombinant class-switching and fusion techniques known in the art [see, Thammana et al., "Immunoglobulin Heavy Chain Class Switch From IgM to IgG In A Hybridoma", Eur. J. Immunol, 13:614 (1983); Spira et al., "The Identification Of Monoclonal Class Switch Variants By Subselection And ELISA Assay", J. Immunol. Meth. 74:307-15 (1984); Neuberger et al., -187- "Recombinant Antibodies Possessing Novel Effector Functions", Nature 312: 614-608 (1984); and Oi et al., "Chimeric Antibodies", Biotechniques 4 (3):214-21 (1986)]. Thus, other chimeric antibodies or other recombinant antibodies fusion proteins wherein the antibody is combined with a second protein such as a lymphokine or a tumor inhibitory growth factor) having the same binding specificity as the C35-specific antibodies fall within the scope of this invention.

Genetic engineering techniques known in the art may be used as described herein to prepare recombinant immunotoxins produced by fusing antigen binding regions of antibody C35 to atherapeutic or cytotoxic agent at the DNA level and producing the cytotoxic molecule as a chimeric protein.

Examples of therapeutic agents include, but are not limited to, antimetabolites, alkylating agents, anthracyclines, antibiotics, and anti-mitotic agents.

Antimetabolites include methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine, 5-fluorouracil decarbazine. Alkylating agents include mechlorethamine, thioepa chlorambucil, melphalan, carmustine (BSNU) and lomustine (CCNU), cyclothosphamide, busulfan, dibromomannitol, streptozotocin, mitomycin C, and cis-dichlorodiamine platinum (II) (DDP) cisplatin. Anthracyclines include daunorubicin (formerly daunomycin) and doxorubicin (also referred to herein as adriamycin). Additional examples include mitozantrone and bisantrene. Antibiotics include dactinomycin (formerly actinomycin), bleomycin, mithramycin, and anthramycin (AMC). Antimytotic agents include vincristine and vinblastine (which are commonly referred to as vinca alkaloids). Other cytotoxic agents include procarbazine, hydroxyurea, asparaginase, corticosteroids, mytotane interferons. Further examples of cytotoxic agents include, but are not limited to, ricin, doxorubicin, taxol, cytochalasin B, gramicidin D, ethidium bromide, etoposide, tenoposide, coichicin, dihydroxy anthracin dione, 1 -dehydrotestosterone, andglucocorticoid.

Clearly analogs and homologs of such therapeutic and cytotoxic agents are encompassed by the present invention. For example, the chemotherapuetic -188- Sagent aminopterin has a correlative improved analog namely methotrexate.

Further, the improved analog of doxorubicin is an Fe-chelate. Also, the improved analog for 1-methylnitrosourea is lomustine. Further, the improved analog of vinblastine is vincristine. Also, the improved analog of mechlorethamine is 00 5 cyclophosphamide.

c Recombinant immunotoxins, particularly single-chain immunotoxins, have an advantage over drug/antibody conjugates in that they are more readily Sproduced than these conjugates, and generate a population of homogenous C molecules, i.e. single peptides composed of the same amino acid residues. The techniques for cloning and expressing DNA sequences encoding the amino acid sequences corresponding to C35 single-chain immunotoxins, e.g synthesis of oligonucleotides, PCR, transforming cells, constructing vectors, expression systems, and the like are well-established in the art, and most practitioners are familiar with the standard resource materials for specific conditions and procedures [see, e.g. Sambrook et al., eds., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory Press (1989)].

The following include preferred embodiments of the immunoconjugates of the invention. Other embodiments which are known in the art are encompassed by the invention. The invention is not limited to these specific immunoconjugates, but also includes other immunoconjugates incorporating antibodies and/or antibody fragments according to the present invention.

The conjugates comprise at least one drug molecule connected by a linker of the invention to a targeting ligand molecule that is reactive with the desired target cell population. The ligand molecule can be an immunoreactive protein such as an antibody, or fragment thereof, a non-immunoreactive protein or peptide ligand such as bombesin or, a binding ligand recognizing a cell associated receptor such as a lectin or steroid molecule.

Further, because the conjugates of the invention can be used for modifying a given biological response, the drug moiety is not to be construed as limited to classical chemical therapeutic agents. For example, the drug moiety -189j may be a protein or polypeptide possessing a desired biological activity. Such C, proteins may include, for example, a toxin such as abrin, ricin A, pseudomonas exotoxin, or diphtheria toxin; a protein such as tumor necrosis factor, alpha -interferon, beta -interferon, nerve growth factor, platelet derived growth factor, oC 5 tissue plasminogen activator, or, biological response modifiers such as, for example, lymphokines, interleukin-1 interleukin-2 -i interleukin-6 granulocyte macrophase colony stimulating factor granulocyte colony stimulating factor or othergrowth factors.

The preferred drugs for use in the present invention are cytotoxic drugs, particularly those which are used for cancer therapy. Such drugs include, in general, alkylating agents, anti-proliferative agents, tubulin binding agents and the like. Preferred classes of cytotoxic agents include, for example, the anthracycline family of drugs, the vinca drugs, the mitomycins, the bleomycins, the cytotoxic nucleosides, the pteridine family of drugs, diynenes, and the podophyllotoxins. Particularly useful members of those classes include, for example, adriamycin, carminomycin, daunorubicin, aminopterin, methotrexate, methopterin, dichloromethotrexate, mitomycin C, porfiromycin, 6-mercaptopurine, cytosine arabinoside, podophyllotoxin, or podophyllotoxin derivatives such as etoposide or etoposide phosphate, melphalan, vinblastine, vincristine, leurosidine, vindesine, leurosine and the like. As noted previously, one skilled in the art may make chemical modifications to the desired compound in order to make reactions of that compound more convenient for purposes of preparing conjugates of the invention.

As noted, one skilled in the art will appreciate that the invention also encompasses the use of antigen recognizing immunoglobulin fragments. Such immunoglobulin fragments may include, for example, the Fab', F(ab')2, F[v ]or Fab fragments, or other antigen recognizing immunoglobulin fragments. Such immunoglobulin fragments can be prepared, for example, by proteolytic enzyme digestion, for example, by pepsin or papain digestion, reductive alkylation, or 1 -190- Srecombinant techniques. The materials and methods for preparing such CI immunoglobulin fragments are well-known to those skilled in the art. See generally, Parham, J. Immunology, 131, 2895 (1983); Lamoyi et al., J.

Immunological Methods, 56, 235 (1983); Parham, id., 53, 133 (1982); and 0 0 5 Matthew et al., id., 50, 239 (1982).

(N The immunoglobulin can be a "chimeric antibody" as that term is C- recognized in the art. Also, the immunoglobulin may be a "bifunctional" or O "hybrid" antibody, that is, an antibody which may have one arm having a C specificity for one antigenic site, such as a tumor associated antigen while the other arm recognizes a different target, for example, a hapten which is, or to which is bound, an agent lethal to the antigen-bearing tumor cell. Alternatively, the bifunctional antibody may be one in which each arm has specificity for a different epitope of a tumor associated antigen of the cell to be therapeutically or biologically modified. In any case, the hybrid antibodies have a dual specificity, preferably with one or more binding sites specific for the hapten of choice or one or more binding sites specific for a target antigen, for example, an antigen associated with a tumor, an infectious organism, or other disease state.

Biological bifunctional antibodies are described, for example, in European Patent Publication, EPA 0 105 360, to which those skilled in the art are referred. Such hybrid or bifunctional antibodies may be derived, as noted, either biologically, by cell fusion techniques, or chemically, especially with cross-linking agents or disulfide bridge-forming reagents, andmay be comprised of whose antibodies and/or fragments thereof. Methods for obtaining such hybrid antibodies are disclosed, for example, in PCT application W083/03679, published Oct. 27, 1983, and published European Application EPA 0 217 577, published Apr. 8, 1987. Particularly preferred bifunctional antibodies are those biologically prepared from a "polydome" or "quadroma" or which are synthetically preparedwith cross-linking agents such as bis-(maleimideo)-methyl ether or with other cross-linking agents familiar to those skilled in the art.

-191- In addition the immunoglobulinmay be a single chain antibody These may consist of single chain Fv fragments ("scFv") in which the variable light and variable heavy domains are linked by a peptide bridge or by disulfide bonds. Also, the immunoglobulin may consist of single 00 5 V[H ]domains (dAbs) which possess antigen-binding activity. See, G.

C Winter and C. Milstein, Nature 349:295 (1991); R. Glockshuber et al., N Biochemistry 29: 1362 (1990); and, E. S. Ward et al., Nature 341: 544 (1989).

O Especially preferred for use in the present invention are chimeric NC monoclonal antibodies, preferably those chimeric antibodies having specificity toward a tumor associated antigen. As used in this example, the term "chimeric antibody" refers to a monoclonal antibody comprising a variable region, i.e.

binding region, from one source or species and at least a portion of a constant region derived from a different source or species, usually prepared by recombinant DNA techniques. Chimeric antibodies comprising amurine variable region and a human constant region are preferred in certain applications of the invention, particularly human therapy, because such antibodies are readily prepared and may be less immunogenic than purely murine monoclonal antibodies. Such murine/human chimeric antibodies are the product of expressed immunoglobulin genes comprising DNA segments encoding murine immunoglobulin variable regions and DNA segments encoding human immunoglobulin constant regions. Other forms of chimeric antibodies encompassed by the invention are those in which the class or subclass has been modified or changed from that of the original antibody. Such "chimeric" antibodies are also referred to as "class-switched antibodies". Methods for producing chimeric antibodies involve conventional recombinant DNA and gene transfection techniques now well known in the art. See, Morrison, S. L. et al., Proc. Nat'l Acad. Sci., 81, 6851 (1984).

Encompassed by the term "chimeric antibody" is the concept of "humanized antibody", that is those antibodies in which the framework or "complementarity" determining regions have been modified to comprise -192- Sthe CDR of an immunoglobulin of different specificity as compared to that of the parent immunoglobulin. In a preferred embodiment, a murine CDR is grafted into the framework region of a human antibody to prepare the "humanized antibody". See, L. Riechmann et al., Nature 332: 323 (1988); M. S.

0 0 5 Neuberger et al., Nature 314: 268 (1985). Particularly preferred CDR'S Scorrespond to those representing sequences recognizing the antigens noted above for the chimeric and bifunctional antibodies: The reader is referred to the Steaching of EPA 0 239 400 (published Sep. 30, 1987), for its teaching of CDR modified antibodies.

One skilled in the artwill recognize that abifunctional-chimeric antibody can be prepared which would have the benefits of lower immunogenicity of the chimeric or humanized antibody, as well as the flexibility, especially for therapeutic treatment, of the bifunctional antibodies described above. Such bifunctional-chimeric antibodies can be synthesized, for instance, by chemical synthesis using cross-linking agents and/or recombinant methods of the type described above. In any event, the present invention should not be construed as limited in scope by any particular method of production of an antibody whether bifunctional, chimeric, bifunctional-chimeric, humanized, or an antigenrecognizing fragment or derivative thereof.

In addition, the invention encompasses within its scope immunoglobulins (as defined above) or immunoglobulin fragments to which are fused active proteins, for example, an enzyme of the type disclosed in Neuberger, et al., PCT application, W086/01533, published Mar. 13, 1986. The disclosure of such products is incorporated herein by reference.

As noted, "bifunctional", "fused", "chimeric" (includinghumanized), and "bifunctional-chimeric" (including humanized) antibody constructions also include, within their individual contexts constructions comprising antigen recognizing fragments. As one skilled in the art will recognize, such fragments could be prepared by traditional enzymatic cleavage of intact bifunctional, chimeric, humanized, or chimeric-bifunctional antibodies. If, however, intact -193- Santibodies are not susceptible to such cleavage, because of the nature of the N- construction involved, the noted constructions can be prepared with immunoglobulin fragments used as the starting materials; or, if recombinant techniques are used, the DNA sequences, themselves, can be tailored to encode 00 5 the desired "fragment" which, when expressed, can be combined in vivo or in vitro, by chemical or biological means, to prepare the final desired intact immunoglobulin "fragment". It is in this context, therefore, that the term S"fragment" is used.

c Furthermore, as noted above, the immunoglobulin (antibody), or fragment thereof, used in the present invention may be polyclonal ormonoclonal in nature. Monoclonal antibodies are the preferred immunoglobulins, however.

The preparation of such polyclonal or monoclonal antibodies now is well known to those skilled in the art who, of course, are fully capable of producing useful immunoglobulins which can be used in the invention. See, G. Kohler and C. Milstein, Nature 256:495 (1975). In addition, hybridomes and/or monoclonal antibodies which are produced by such hybridomas and which are useful in the practice of the present invention are publicly available from sources such as the American Type Culture Collection ("ATCC") 10801 University Blvd., Manassas, VA. 20110.

Particularly preferred monoclonal antibodies for use in the present invention are those which recognize tumor associated antigens.

Diagnostic Techniques Serologic diagnostic techniques involve the detection and quantitiation of tumor-associated antigens that have been secreted or "shed" into the serum or other biological fluids of patients thought to be suffering from carcinoma. Such antigens can be detected in the body fluids using techniques known in the art such as radioimmunoassays (RIA) or enzyme-linked immunosorbent assays (ELISA) wherein an antibody reactive with the "shed" antigen is used to detect

I

-194- Sthe presence of the antigen in a fluid sample [see, Uotila et al., "Two-Site C Sandwich ELISA With Monoclonal Antibodies To Human AFP", J. Immunol.

Methods, 42:11 (1981) andAllum et al., supra atpp. 48-51]. These assays, using the C35 antibodies disclosed herein, can therefore be used for the detection in 00 5 biological fluids of the antigen with which the C35 antibodies react and thus the C detection of human carcinomain patients. Thus, it is apparent from the foregoing C that the C35 antibodies of the invention can be used in most assays involving Santigen-antibody reactions. These assays include, but are not limited to, standard

C

RIA techniques, both liquid and solid phase, as well as ELISA assays, ELISPOT, immunofluorescence techniques, and other immunocytochemical assays [see, Sikora et al. Monoclonal Antibodies, pp. 32-52 (Blackwell Scientific Publications 1984)].

The invention also encompasses diagnostic kits for carrying out the assays described above. In one embodiment, the diagnostic kit comprises the monoclonal antibody, fragments thereof, fusion proteins or chimeric antibody of the invention, and a conjugate comprising a specific binding partner for the antibody and a label capable of producing a detectable signal. The reagents can also include ancillary agents such as buffering agents and protein stabilizing agents polysaccharides). The diagnostic kit can further comprise, where necessary, other components of the signal-producing system including agents for reducing background interference, control reagents or an apparatus or container for conducting the test.

In another embodiment, the diagnostic kit comprises a conjugate of the antibodies of the invention and a label capable of producing a detectable single. Ancillary agents as mentioned above can also be present.

The C35 antibody of the invention is also useful for in vivo diagnostic applications for the detection of human carcinomas. One such approach involves the detection of tumors in vivo by tumor imaging techniques. According to this approach, the C35 antibody is labeled with an appropriate imaging reagent that produces a detectable signal. Examples of imaging reagents that can be used

I

-195- Sinclude, but at not limited to, radiolabels such as <131> I, <111> In, <123> I, <99m> Tc, <32> P, <125> I, H, and <14> C, fluorescent labels such as fluorescein and rhodamine, and chemiluninescers such as luciferin. The antibody can be labeled with such reagents using techniques known in the art. For 0 0 5 example, see Wensel and Meares, Radioimmunoimaging And C Radioimmunotherapy, Elsevier, New York (1983) for techniques relating to the

C

radiolabeling of antibodies [see also, Colcher et al., "Use Of Monoclonal SAntibodies As Radiopharmaceuticals For The Localization Of Human Carcinoma

C

Xenografts In Athymic Mice", Meth. Enzymol. 121:802-16 (1986)].

In the case of radiolabeled antibody, the antibody is administered to the patient, localizes to the tumor bearing the antigen with which the antibody reacts, and is detected or "imaged" in vivo using known techniques such as radionuclear scanning using, a gamma camera or emission tomography [see, e.g., Bradwell etal., "Developments InAntibody Imaging", in MonoclonalAntibodies For Cancer Detection And Therapy, Baldwin et al. pp. 65-85 (Academic Press 1985)]. the antibody is administered to the patient in a pharmaceutically acceptable carrier such as water, saline, Ringer's solution, Hank's solution or nonaqueous carriers such as fixed oils. The carrier may also contain substances that enhance isotonicity and chemical stability of the antibody such as buffers or preservatives. The antibody formulation is administered, for example, intravenously, at a dosage sufficient to provide enough gamma emission to allow visualization of the tumor target site. Sufficient time should be allowed between administration of the antibody and detection to allow for localization to the tumor target For a general discussion of tumor imaging, see Allum et al., supra at pp.

51-55.

-196- STherapeutic Applications of C35 Antibodies The properties of the C35 antibody suggest a number of in vivo therapeutic applications.

0 0 First, the C35 antibody can be used alone to target andkill tumor cells in c 5 vivo. The antibody can also be used in conjunction with an appropriate therapeutic agent to treat human carcinoma For example, the antibody can be Sused in combination with standard or conventional treatment methods such as chemotherapy, radiation therapy or can be conjugated or linked to a therapeutic drug, or toxin, as well as to a lymphokine or a tumor-inhibitory growth factor, for delivery of the therapeutic agent to the site of the carcinoma.

Techniques for conjugating such therapeutic agents to antibodies arewell known [see, Amon et al., "Monoclonal Antibodies For Immunotargeting Of Drugs In Cancer Therapy", in Monoclonal Antibodies And Cancer Therapy, Reisfeld et al. pp. 243-56 (Alan R. Liss, Inc. 1985); Hellstrom et al., "Antibodies For Drug Delivery", in Controlled Drug Delivery (2nd Ed.), Robinson et al. pp. 623-53 (Marcel Dekker, Inc. 1987); Thorpe, "Antibody Carriers Of Cytotoxic Agents In Cancer Therapy: A Review", in Monoclonal Antibodies '84: Biological And Clinical Applications, Pinchera et al. pp. 475-506 (1985); and Thorpe et al., "The Preparation And Cytotoxic Properties OfAntibody-Toxin Conjugates", Immunol. Rev., 62:119-58 (1982)].

Alternatively, the C35 antibody can be coupled to high-energy radiation, a radioisotope such as <131> I, which, when localized at the tumor site, results in a killing of several cell diameters [see, Order, "Analysis, Results, And Future Prospective Of The Therapeutic Use Of Radiolabeled Antibody In Cancer Therapy", in Monoclonal Antibodies For Cancer Detection And Therapy, Baldwin et al. pp. 303-16 (Academic Press 1985)]. According to yet another embodiment, the C35 antibody can be conjugated to a second antibody to form an antibody heteroconjugate forthe treatment of tumor cells as described by Segal in U.S. Pat. No. 4,676,980.

-197- Z Still other therapeutic applications for the C35 antibody of the invention include conjugation or linkage, by recombinant DNA techniques, to an enzyme capable of converting a prodrug into a cytotoxic drug and the use of that antibody-enzyme conjugate in combination with the prodrug to convert the 00 5 prodrug to a cytotoxic agent at the tumor site [see, Senter et al., CI "Anti-Tumor Effects Of Antibody-alkaline Phosphatase", Proc. Natl. Acad. Sci.

O

C USA, 85:4842-46 (1988); "Enhancement of the in vitro and in vivo Antitumor 0 Activites of Phosphorylated Mitocycin C and Etoposide Derivatives by CI Monoclonal Antibody-Alkaline Phosphatase Conjugates", Cancer Research 49:5789-5792 (1989); and Senter, "Activation of Prodrugs by Antibody-Enzyme Conjugates: A New Approach to Cancer Therapy," FASEB J. 4:188-193 (1990)].

Still another therapeutic use for the C35 antibody involves use, either in the presence of complement or as part of an antibody-drug or antibody-toxin conjugate, to remove tumor cells from the bone marrow of cancer patients.

According to this approach, autologous bone marrow may be purged ex vivo by treatment with the antibody and the marrow infused back into the patient [see, Ramsay et al., "Bone Marrow Purging Using Monoclonal Antibodies", J.

Clin. Immunol., 8(2):81-88 (1988)].

Furthermore, chimeric C35, recombinant immunotoxins and other recombinant constructs of the invention containing the specificity of the antigen-binding region of the C35 monoclonal antibody, as described earlier, may be used therapeutically. For example, the single-chain immunotoxins of the invention, may be used to treat human carcinoma in vivo.

Similarly, a fusion protein comprising at least the antigen-binding region of the C35 antibody joined to at least a functionally active portion of a second protein having anti-tumor acitivty, a lymphokine or oncostatin can be used to treat human carcinoma in vivo. Furthermore, recombinant techniques known in the art can be used to construct bispecific antibodies wherein one of the binding specificities of the antibody is that of C35, while the other binding specificty of the antibody is that of a molecule other than -198- Finally, anti-idiotypic antibodies of the C35 antibody may be used therapeutically in active tumor immunization and tumor therapy [see, e.g., Hellstrom et al., "Immunological Approaches To Tumor Therapy: Monoclonal Antibodies, Tumor Vaccines, And Anti-Idiotypes", in Covalently Modified 0 o 5 Antigens And Antibodies In Diagnosis And Therapy, supra at pp. 35-41].

The present invention provides a method for selectively killing tumor C cells expressing the antigen that specifically binds to the C35 monoclonal Santibody or functional equivalent. This method comprises reacting the immunoconjugate the immunotoxin) of the invention with said tumor cells.

These tumor cells may be from a human carcinoma.

Additionally, this invention provides amethodoftreating carcinomas(for example human carcinomas) in vivo. This method comprises administering to a subject a pharmaceutically effective amount of a composition containing at least one of the immunoconjugates the immunotoxin) of the invention.

In accordance with the practice of this invention, the subject may be a human, equine, porcine, bovine, murine, canine, feline, and avian subjects. Other warm blooded animals are also included in this invention.

The present invention also provides a method for curing a subject suffering from a cancer. The subject may be a human, dog, cat, mouse, rat, rabbit, horse, goat, sheep, cow, chicken. The cancer may be identified as abreast, bladder, retinoblastoma, papillary cystadenocarcinoma of the ovary, Wilm's tumor, or small cell lung carcinoma and is generally characterized as a group of cells having tumor associated antigens on the cell surface. This method comprises administering to the subject a cancer killing amount of a tumor targeted antibody joined to a cytotoxic agent. Generally, the joining of the tumor targeted antibody with the cytotoxic agent is made under conditions which permit the antibody so joined to bind its target on the cell surface. By binding its target, the tumor targeted antibody acts directly or indirectly to cause or contribute to the killing of the cells so bound thereby curing the subject.

-199j Also provided is a method of inhibiting the proliferation of mammalian Ci tumor cells which comprises contacting the mammalian tumor cells with a sufficient concentration of the immunoconjugate of the invention so as to inhibit proliferation of the mammalian tumor cells.

0 0 5 The subject invention further provides methods for inhibiting the growth C of human tumor cells, treating a tumor in a subject, and treating a proliferative O type disease in a subject. These methods comprise administering to the subject San effective amount of the composition of the invention.

C It is apparent therefore that the present invention encompasses pharmaceutical compositions, combinations and methods for treating human carcinomas. For example, the invention includes pharmaceutical compositions for use in the treatment of human carcinomas comprising a pharmaceutically effective amount of a C35 antibody and a pharmaceutically acceptable carrier.

The compositions may contain the C35 antibody or antibody fragments, either unmodified, conjugated to a therapeutic agent drug, toxin, enzyme or second antibody) or in arecombinant form chimeric C35, fragments of chimeric C35, bispecific C35 or single-chain immunotoxin C35). The compositions may additionally include other antibodies or conjugates fortreating carcinomas an antibody cocktail).

The antibody, antibody conjugate and immunotoxin compositions of the invention can be administered using conventional modes of administration including, but not limited to, intravenous, intraperitoneal, oral, intralymphatic or administration directly into the tumor. Intravenous administration is preferred.

The compositions of the invention may be in a variety of dosage forms which include, but are not limited to, liquid solutions or suspension, tablets, pills, powders, suppositories, polymeric microcapsules or microvesicles, liposomes, and injectable or infusible solutions. The preferred form depends upon the mode of administration and the therapeutic application.

The compositions of the invention also preferably include conventional pharmaceutically acceptable carriers and adjuvants known in the art such as -200j human serum albumin, ion exchangers, alumina, lecithin, buffer substances such C1 as phosphates, glycine, sorbic acid, potassium sorbate, and salts or electrolytes such as protamine sulfate.

The most effective mode of administration and dosage regimen for the 00 5 compositions of this invention depends upon the severity and course of the disease, the patient's health and response to treatment and the judgment of the 0 treating physician. Accordingly, the dosages of the compositions should be 0 titrated to the individual patient. Nevertheless, an effective dose of the compositions of this invention may be in the range of from about 1 to about 2000 mg/kg.

The molecules described herein may be in a variety of dosage forms which include, but are not limited to, liquid solutions or suspensions, tablets, pills, powders, suppositories, polymeric microcapsules or microvesicles, liposomes, and injectable or infusible solutions. The preferred form depends upon the mode of administration and the therapeutic application.

The most effective mode of administration and dosage regimen for the molecules of the present invention depends upon the location of the tumor being treated, the severity and course of the cancer, the subject's health and response to treatment and thejudgment of the treating physician. Accordingly, the dosages of the molecules should be titrated to the individual subject.

The interrelationship of dosages for animals of various sizes and species and humans based on mg/kg of surface area is described by Freireich, E. et al.

Cancer Chemother., Rep. 50 219-244 (1966). Adjustments in the dosage regimen may be made to optimize the tumor cell growth inhibiting and killing response, doses may be divided and administered on a daily basis or the dose reduced proportionally depending upon the situation several divided doses may be administered daily or proportionally reduced depending on the specific therapeutic situation.

It would be clear that the dose of the composition of the invention required to achieve cures may be further reduced with schedule optimization.

-201- SIn accordance with the practice of the invention, the pharmaceutical carrier may be a lipid carrier. The lipid carrier may be a phospholipid. Further, the lipid carrier may be a fatty acid. Also, the lipid carrier may be a detergent. As used herein, a detergent is any substance that alters the surface tension of a S 5 liquid, generally lowering it N In one example of the invention, the detergent may be a nonionic N detergent. Examples of nonionic detergents include, but are not limited to, Spolysorbate 80 (also known as Tween 80 or (polyoxyethylenesorbitan

C

monooleate), Brij, and Triton (for example Triton WR-1339 and Triton Alternatively, the detergent may be an ionic detergent. An example of an ionic detergent includes, but is not limited to, alkyltrimethylammonium bromide.

Additionally, in accordance with the invention, the lipid carrier may be a liposome. As used in this application, a "liposome" is any membrane bound vesicle which contains any molecules of the invention or combinations thereof.

Vaccine Formulations The C35 epitopes can be produced in quantity by recombinant DNA methods and formulated with an adjuvant that promotes a cell-mediated immune response. The present invention encompasses the expression of the polypeptides, or C35 epitopes (including cytotoxic or helper T cell eliciting epitopes), in either eucaryotic orprocaryoticrecombinant expression vectors, and the formulation of the same as immunogenic and/or antigenic compositions.

Such compositions are described in, for example, U.S. Patent Appl. No.

08/935,377, the entire contents of which are incorporated herein by reference.

In accordance with the present invention, the recombinantly expressed epitope may be expressed, purified and formulated as a subunit vaccine.

Preferably, the DNA encoding the C35 epitope may also be constructed into viral vectors, preferably pox virus, adenovirus, herpesvirus, and alphavirus vectors, for use in vaccines. In this regard, either a live recombinant viral vaccine, an -202- 3 inactivated recombinant viral vaccine, or a killed recombinant viral vaccine can C be formulated.

Expression of C35 in Procaryotic and Eucaryotic Expression 00 Systems O 5 The present invention encompasses expression systems, both eucaryotic IO and procaryotic expression vectors, which may be used to express the 0 epitope. The C35 epitope may be expressed in both truncated or full-length forms, in particular for the formation of subunit vaccines.

The present invention encompasses the expression of nucleotide sequences encoding the C35 polypeptide and immunologically equivalent fragments. Such immunologically equivalent fragments may be identified by making analogs of the nucleotide sequence encoding the identified epitopes that are truncated at the 5' and/or 3' ends of the sequence and/or have one or more internal deletions, expressing the analog nucleotide sequences, and determining whether the resulting fragments immunologically are recognized by the epitopespecific T lymphocytes and induce a cell-mediated immune response, or epitopespecific B lymphocytes for inductions of a humoral immune response.

The invention encompasses the DNA expression vectors that contain any of the foregoing coding sequences operatively associated with a regulatory element that directs expression of the coding sequences and genetically engineered host cells that contain any of the foregoing coding sequences operatively associated with a regulatory element that directs the expression of the coding sequences in the host cell. As used herein, regulatory elements include but are not limited to, inducible and non-inducible promoters, enhancers, operators and other elements known to those skilled in the art that drive and regulate expression.

The C35 epitope gene products or peptide fragments thereof, may be produced by recombinant DNA technology using techniques well known in the -203r art. Thus, methods for preparing the C35 epitope genepolypeptides andpeptides N of the invention by expressing nucleic acid containing epitope gene sequences are described herein. Methods which are well known to those skilled in the art can be used to construct expression vectors containing epitope gene product coding 00 5 sequences andappropriate transcriptional andtranslational control signals. These N methods include, for example, in vitro recombinant DNA techniques, synthetic

C

techniques, and in vivo genetic recombination. See, for example, the techniques O describedin Sambrook et al., Molecular Cloning: ALaboratory Manual, 2ndEd.,

C

1 (1989), Cold Spring Harbor Laboratory Press, and Ausubel et al., 1989, su Alternatively, RNA capable of encoding glycoprotein epitope gene product sequences may be chemically synthesized using, for example, synthesizers. See, for example, the techniques described in "Oligonucleotide Synthesis", 1984, Gait, M.J. ed., IRL Press, Oxford, which is incorporated by reference herein in its entirety.

The invention also encompasses nucleotidesequences that encode peptide fragments of the C35 epitope gene products. For example, polypeptides or peptides corresponding to the extracellular domain of the C35 epitope may be useful as "soluble" protein which would facilitate secretion, particularly useful in the production of subunit vaccines. The C35 epitope gene product or peptide fragments thereof, can be linked to a heterologous epitope that is recognized by a commercially available antibody is also included in the invention. A durable fusion protein may also be engineered; a fusion protein which has a cleavage site located between the C35 epitope sequence and the heterologous protein sequence, so that the selected C35 can be cleaved away from the heterologous moiety. For example, a collagenase cleavage recognition consensus sequence may be engineered between the C35 epitope protein or peptide and the heterologous peptide or protein. The epitopic domain can be released from this fusion protein by treatment with collagenase. In a preferred embodiment of the invention, a fusion protein of glutathione-S-transferase and the C35 epitope protein may be engineered.

-204- SThe C35 epitope proteins of the present invention for use in vaccine C, preparations, in particular subunit vaccine preparations, are substantially pure or homogeneous. The protein is considered substantially pure or homogeneous when at least 60 to 75% of the sample exhibits a single polypeptide sequence.

00 S 5 A substantially pure protein will preferably comprise 60 to 90% of a protein sample, more preferably about 95% and most preferably 99%. Methods which N are well known to those skilled in the art can be used to determine protein purity or homogeneity, such as polyacrylamide gel electrophoresis of a sample, followed by visualizing a single polypeptide band on a staining gel. Higher resolution may be determined using HPLC or other similar methods well known in the art.

The present invention encompasses C3 5 polypeptides which are typically purified from host cells expressing recombinant nucleotide sequences encoding these proteins. Such protein purification can be accomplished by a variety of methods well known in the art. In a preferred embodiment, the C35 epitope protein of the present invention is expressed as a fusion protein with glutathione- S-transferase. The resulting recombinant fusion proteins purified by affinity chromatography and the epitope protein domain is cleaved away from the heterologous moiety resulting in a substantially pure protein sample. Other methods known to those skilled in the art may be used; see for example, the techniques described in "Methods In Enzymology", 1990, Academic Press, Inc., San Diego, "Protein Purification: Principles and Practice", 1982, Springer- Verlag, New York, which are incorporated by reference herein in their entirety.

(ii) Eucaryotic and Procaryotic Expression Vectors The present invention encompasses expression systems, both eucaryotic and procaryotic expression vectors, which may be used to express the epitope. A variety of host-expression vector systems may be utilized to express the C35 epitope gene of the invention. Such host-expression systems represent -205- Svehicles by which the C35 coding sequence may be produced and subsequently C1 purified, but also represent cells which may, when transformed or transfected with the C35 nucleotide coding sequences, exhibit the C35 epitope gene product of the invention in situ. These include but are not limited to microorganisms 0 5 such as bacteria E. coli, B. subtilis) transformed with recombinant bacteriophage DNA, plasmid DNA or cosmid DNA expression vectors Scontaining the C35 epitope gene product coding sequence; yeast Saccharomyces, Pichia) transformed with recombinant yeast expression vectors containing the C35 epitope gene product coding sequence; insect cell systems infected with recombinant virus expression vectors baculovirus) containing the C35 epitope gene product coding sequence; plant cell systems infected with recombinant virus expression vectors cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or transformed with recombinant plasmid expression vectors Ti plasmid) containing C35 epitope gene product coding sequence; or mammalian cell systems COS, CHO, BHK, 293, 3T3) harboring recombinant expression constructs containing promoters derived from the genome of mammalian cells metallothionein promoter) or from mammalian viruses the adenovirus late promoter, the vaccinia virus promoter).

(iii) Host Cells The present invention encompasses the expression of the C35 epitope in animal and insect cell lines. In a preferred embodiment of the present invention, the C35 epitope is expressed in a baculovirus vector in an insect cell line to produce an unglycosylated antigen. In another preferred embodiment of the invention, the C35 epitope is expressed in a stably transfected mammalian host cell, CHO cell line to produce a glycosylated antigen. The C35 epitopes which are expressed recombinantly by these cell lines may be formulated as subunit vaccines. The present invention is further directed to host cells that -206- Soverexpress the C35 gene product. The cell may be a host cell transiently or stable transected or transformed with any suitable vector which includes a polynucleotide sequence encoding the C35 polypeptide or a fragmentthereof and suitable promoter and enhancer sequences to direct overexpression of the 00 5 gene product. However, the overexpressing cell may also be a product of an Sinsertion, for example via homologous recombination, of a heterologous C promoter or enhancer which will direct overexpression of the endogenous Sgene. The term "overexpression" refers to a level of expression which is higher than a basal level of expression typically characterizing a given cell under otherwise identical conditions.

A host cell strain may be chosen which modulates the expression of the inserted sequences, or modifies and processes the C35 gene product in the specific fashion desired. Such modifications glycosylation) andprocessing cleavage) of protein products may be important for the function of the protein. Different host cells have characteristic and specific mechanisms for the post-translational processing and modification of proteins and gene products.

Appropriate cell lines or host systems can be chosen to ensure the correct modification of the foreign protein expressed. To this end, eucaryotic host cells which possess the cellular machinery for proper processing of the primary transcript, glycosylation, phosphorylation, and prenylation of the C35 gene product may be used. Such mammalian host cells include but arenot limited to CHO, VERO, BHK, HeLa, COS, MDCK, 293, 3T3 and WI38 cell lines.

For long term, high-yield production of recombinant proteins, stable expression is preferred. For example, cell lines which stably express the target epitope may be engineered. Rather than using expression vectors which contain viral origins of replication, host cells can be transformed with DNA controlledby appropriate expression control elements promoter, enhancer, sequences, transcription terminators, polyadenylation sites, etc.), and aselectable marker. Following the introduction of the foreign DNA, engineered cells may be allowed to grow for 1-2 days in an enriched media, and then are switched to -207- Z a selective media. The selectable marker in the recombinant plasmid confers resistance to the selection and allows cells to stably integrate the plasmid into their chromosomes and grow to form foci which in turn can be cloned and expanded into cell lines. This method may advantageously be used to engineer OC 5 cell lines. This method may advantageously be used to engineer cell lines which express the C35 epitope gene products. Such cell lines would be particularly N useful in screening and evaluation of compounds that affect the endogenous activity of the C35 epitope gene product.

A number of selection systems may be used, including but not limited to the herpes simplex virus thymidine kinase (Wigler, et al., 1977, Cell 11:223), hypoxanthine-guaninephosphoribosyltransferase (Szybalska& Szybalski, 1962, Proc. Natl. Acad. Sci. USA 48:2026), and adenine phosphoribosyltransferase (Lowy, et al., 1980, Cell 22:817) genes can be employed in tk-, hgprt or aprt cells, respectively. Also, antimetabolite resistance can be used as the basis of selection for the following genes: dhfr, which confers resistance to methotrexate (Wigler, et al., 1980, Proc. Natl. Acad. Sci. USA 77:3567; O'Hare, et al., 1981, Proc. Natl. Acad. Sci. USA 78:1527); gpt, which confers resistance to mycophenolic acid (Mulligan Berg, 1981, Proc. Natl. Acad. Sci. USA 78:2072); neo, which confers resistance to the aminoglycoside G-418 (Colberre- Garapin, et al., 1981, J. Mol. Biol. 150:1); and hygro, which confers resistance to hygromycin (Santerre, et al., 1984, Gene 30:147).

Alternatively, any fusion protein may be readily purified by utilizing an antibody specific for the fusion protein being expressed. For example, a system described by Janknecht et al. allows for the ready purification of non-denatured fusion proteins expressed in human cell lines (Janknecht, et al., 1991, Proc. Natl.

Acad. Sci. USA 88: 8972-8976). In this system, the gene of interest is subcloned into a vaccinia recombination plasmid such that the gene's open reading frame is translationally fused to an amino-terminal tag consisting of six histidine residues. Extracts from cells infected with recombinant vaccinia virus are loaded -208j onto Ni'-nitriloacetic acid-agarose columns and histidine-tagged proteins are Sselectively eluted with imidazole-containing buffers.

(iv) Expression of C35 Epitope in Recombinant Viral Vaccines 00 r In another embodiment ofthe present invention, either alive recombinant S 5 viral vaccine or an inactivated recombinant viral vaccine expressing the epitope can be engineered. A live vaccine may be preferred because C multiplication in the host leads to a prolonged stimulus of similar kind and magnitude to that occurring in natural infections, and therefore, confers substantial, long-lasting immunity. Production of such live recombinant virus vaccine formulations may be accomplished using conventional methods involving propagation of the virus in cell culture or in the allantois of the chick embryo followed by purification.

In this regard, a variety of viruses may be genetically engineered to express the C35 epitope. For vaccine purposes, it may be required that the recombinant viruses display attenuation characteristics. Current live virus vaccine candidates for use in humans are either cold adapted, temperature sensitive, or attenuated. The introduction of appropriate mutations deletions) into the templates used for transfection may provide the novel viruses with attenuation characteristics. For example, specific multiple missense mutations that are associated with temperature sensitivity or cold adaptation can be made into deletion mutations and/ormultiple mutations can be introduced into individual viral genes. These mutants should be more stable than the cold or temperature sensitive mutants containing single point mutations and reversion frequencies should be extremely low. Alternatively, recombinant viruses with "suicide" characteristics may be constructed. Such viruses go through only one or a few rounds of replication in the host.

For purposes of the invention, any virus may be used in accordance with the present invention which: displays an attenuated phenotype or may be -209- Sengineered to display attenuated characteristics; displays a tropism for mammals, in particular humans, ormay be engineered to display such a tropism; and may be engineered to express the C35 epitope of the present invention.

Vaccinia viral vectors may be used in accordance with the present 00 5 invention, as large fragments of DNA are easily cloned into its genome and recombinant attenuated vaccinia variants have been described (Meyer, et al., ,1 ~1991, J. Gen. Virol. 72:1031-1038). Orthomyxoviruses, including influenza; SParamyxoviruses, including respiratory syncytial virus and Sendai virus; and C, Rhabdovirus es may be engineered to express mutations which resultin attenuated phenotypes (see U.S. Patent Serial No. 5,578,473, issued November 26, 1996).

These viral genomes may also be engineered to express foreign nucleotide sequences, such as the C35 epitopes of the present invention (see U.S. Patent Serial No. 5,166,057, issued November 24, 1992, incorporated herein by reference in its entirety). Reverse genetic techniques can be applied to manipulate negative and positive strand RNA viral genomes to introduce mutations which result in attenuated phenotypes, as demonstrated in influenza virus, Herpes Simplex virus, cytomegalovirus and Epstein-Barr virus, Sindbis virus and poliovirus (see Palese et al., 1996, Proc. Natl. Acad. Sci. USA 93:11354-11358). These techniques may also be utilized to introduce foreign DNA, the C35 epitopes, to create recombinant viral vectors to be used as vaccines in accordance with the present invention. See, for instance, U.S. Patent Appl. No. 08/935,377, the entire contents of which are incorporated herein by reference. In addition, attenuated adenoviruses and retroviruses may be engineered to express the C35 epitope. Therefore, a wide variety of viruses may be engineered to design the vaccines of the present invention, however, by way of example, and not by limitation, recombinant attenuated vaccinia vectors expressing the C35 epitope for use as vaccines are described herein.

In one embodiment, a recombinant modified vaccinia variant, Modified Virus Ankara (MVA) is used in a vaccine formulation. This modified virus has been passaged for 500 cycles in avian cells and is unable to undergo a full -210infectious cycle in mamrnalian cells (Meyer, etal., 1991,J. Gen. Virol. 72:1031- 1038). When used as a vaccine, the recombinant virus goes through a single replication cycle and induces a sufficient level of immune response but does not go further inthe humanhost and cause disease. Recombinant viruses lacking one 00 5 or more of essential vaccinia virus genes are not able to undergo successive rounds of replication. Such defective viruses can beproducedby co-transfecting N, vaccinia vectors lacking a specific gene(s) required for viral replication into cell lines which permanently express this gene(s). Viruses lacking an essential C, gene(s) will be replicated in these cell lines but when administered to the human host will not be able to complete a round of replication. Such preparations may transcribe and translate in this abortive cycle a sufficient number of genes to induce an immune response.

Alternatively, larger quantifies of the strains can be administered, so that these preparations serve as inactivated (killed) virus, vaccines. For inactivated vaccines, it is preferred that the heterologous C35 gene product be expressed as a viral component, so that the C35 gene product is associated with the virion.

The advantage of such preparations is that they contain native proteins and do not undergo inactivation by treatment with formalin or other agents used in the manufacturing of killed virus vaccine..

In another embodiment of the invention, inactivated vaccine formulations are prepared using conventional techniques to "kill" the recombinant viruses.

Inactivated vaccines are "dead" in the sense that their infectivity has been destroyed. Ideally, the infectivity of the virus is destroyed without affecting immunogenicity. In order to prepare inactivated vaccines, the recombinant virus may be grown in cell culture or in the allantois of the chick embryo, purified by zonal ultracentrifugation, inactivated by formaldehyde or P-propiolactone, and pooled. The resulting vaccine is usually inoculated intramuscularly.

Inactivated viruses may be formulated with a suitable adjuvant in order to enhance the immunological response. Such adjuvants may include but are not limited to mineral gels, aluminum hydroxide; surface active substances such -211j as lysolecithin, pluronic polyols, polyanions; peptides; oligonucleotides, oil emulsions; and potentially useful human adjuvants such as BCG and Corynebacterium parvum.

00 Methods of Treatment and/or Vaccination S 5 Since the C35 epitopes of the present invention can be produced in large O amounts, the antigen thus produced and purified has use in vaccine preparations.

The C35 epitope may be formulated into a subunit vaccine preparation, or may be engineered into viral vectors and formulated into vaccine preparations.

Alternatively, the DNA encoding the C35 epitope may be administered directly as a vaccine formulation. The "naked" plasmid DNA once administered to a subject invades cells, is expressed, processed into peptide fragments, some of which can be presented in association with MHC molecules on the surface of the invaded cell, and elicits a cellular immune response so that T lymphocytes will attack cells displaying the C35 epitope. The C35 epitope also has utility in diagnostics, to detect or measure in a sample of body fluid from a subject the presence of tumors that express C35 or the presence of antibodies or T cells that have been induced by C35 expressing tumor andthus to diagnose cancer and tumors and/or to monitor the cellular immune response of the subject subsequent to vaccination.

The recombinant viruses of the invention can be used to treat tumorbearing mammals, including humans, to generate an immune response against the tumor cells. The generation of an adequate and appropriate immune response leads to tumor regression in vivo. Such "vaccines" can be used either alone or in combination with other therapeutic regimens, including but not limited to chemotherapy, radiation therapy, surgery, bone marrow transplantation, etc. for the treatment of tumors. For example, surgical or radiation techniques could be used to debulk the tumor mass, after which, the vaccine formulations of the invention can be administered to ensure the regression and prevent the -212- Sprogression of remaining tumor masses or micrometastases in the body.

Alternatively, administration of the "vaccine" can precede such surgical, radiation or chemotherapeutic treatment.

Alternatively, the recombinant viruses of the invention can be used to S 5 immunize or "vaccinate" tumor-free subjects to prevent tumor formation. With Sthe advent of genetic testing, it is now possible to predict a subject's O, predisposition for certain cancers. Such subjects, therefore, may be immunized using a recombinant vaccinia virus expressing the C35 antigen.

The immunopotency of the C35 epitope vaccine formulations can be determined by monitoring the immune response in test animals following immunization or by use of any immunoassay known in the art. Generation of a cell-mediated and/or humoral immune response may be taken as an indication of an immune response. Test animals may include mice, hamsters, dogs, cats, monkeys, rabbits, chimpanzees, etc., and eventually human subjects.

Suitable preparations of such vaccines include injectables, either as liquid solutions or suspensions; solid forms suitable for solution in, suspension in, liquid prior to injection, may also be prepared. The preparation may also be emulsified, or the polypeptides encapsulated in liposomes. The active immunogenic ingredients are often mixed with excipients which are pharmaceutically acceptable and compatible with the active ingredient Suitable excipients are, for example, water, saline, dextrose, glycerol, ethanol, or the like and combinations thereof. In addition, if desired, the vaccine preparation may also include minor amounts of auxiliary substances such as wetting or emulsifying agents, pH buffering agents, and/or adjuvants which enhance the effectiveness of the vaccine.

Examples of adjuvants which may be effective, include, but are not limited to: aluminum hydroxide, N-acetyl-muramyl-L-threonyl-D-isoglutamine (thr-MDP), N-acetyl-nor-muramyl-L-alanyl-D-isoglutamine, N-acetylmuramyl- L-alanyl-D-isoglutaminyl-L-alanine-2-(l'-2'-dipalmitoyl-sn-glycero-3hydroxyphosphoryloxy)-ethylamine, GM-CSF, QS-21 (investigational drug, -213- Z Progenics Pharmaceuticals,Inc.), DETOX (investigational drug, Ribi NC- Pharmaceuticals), BCG, and CpG rich oligonucleotides.

The effectiveness of an adjuvant may be determined by measuring the induction of the cellular immune response directed against the C35 epitome.

The vaccines of the invention may be multivalent or univalent Multivalent vaccines are made from recombinant viruses that direct the expression of more than one antigen. Multivalent vaccines comprised ofmultiple T cell epitomes, both cytotoxic and helper, are preferred.

The composition, if desired, can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents. The composition can be a liquid solution, suspension, emulsion, tablet, pill, capsule, sustained release formulation, or powder. Oral formulation can include standard carriers such as pharmaceutical grades ofmannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, etc.

Generally, the ingredients are supplied either separately ormixedtogether in unit dosage form, for example, as a dry lyophilized powder or water free concentrate in a hermetically sealed container such as an ampoule or sachette indicating the quantity of active agent. Where the composition is administered by injection, an ampoule of sterile diluent can be provided so that the ingredients may be mixed prior to administration.

In a specific embodiment, a lyophilized C35 epitope of the invention is provided in a first container; a second container comprises diluent consisting of an aqueous solution of 50% glycerin, 0.25% phenol, and an antiseptic 0.005% brilliant green).

Use of purified C35 antigens as vaccine preparations can be carried out by standard methods. For example, the purified C35 epitopes should be adjusted to an appropriate concentration, formulated with any suitable vaccine adjuvant and packaged for use. Suitable adjuvants may include, but are not limited to: mineral gels, aluminum hydroxide; surface active substances such as lysolecithin, pluronic polyols; polyanions; peptides; oil emulsions; alum, and 1 -214- MDP. The immunogen may also be incorporated into liposomes, or conjugated C- to polysaccharides and/or other polymers for use in a vaccine formulation. In instances where the recombinant antigen is a hapten, a molecule that is antigenic in that it can react selectively with cognate antibodies, but not S 5 immunogenic in that it cannot elicit an immune response, the hapten may be covalently bound to a carrier or immunogenic molecule; for instance, a large i protein such as serum albumin will confer immunogenicity to the hapten coupled to it The hapten-carrier may be formulated for use as a vaccine.

Many methods may be used to introduce the vaccine formulations described above into a patient. These include, but are.not limited to, oral, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, transdermal, epidural, pulmonary, gastric, intestinal, rectal, vaginal, or urethral routes. When the method of treatment uses a live recombinant vaccinia vaccine formulation of the invention, it may be preferable to introduce the formulation via the natural route of infection of the vaccinia virus, through a mucosal membrane or surface, such as an oral, nasal, gastric, intestinal, rectal, vaginal or urethral route, or through the skin. To induce a CTL response, the mucosal route of administration may be through an oral or nasal membrane. Alternatively, an intramuscular or intraperitoneal route of administration may be used. Preferably, a dose of 106 107 PFU (plaque forming units) of cold adapted recombinant vaccinia virus is given to a human patient.

The precise dose of vaccine preparation to be employed in the formulation will also depend on the route of administration, andthe nature of the patient, and should be decided according to the judgment of the practitioner and each patient's circumstances according to standard clinical techniques. An effective immunizing amount is that amount sufficient to produce an immune response to the antigen in the host to which the vaccine preparation is administered.

Where subsequent or booster doses are required, a modified vaccinia virus such as MVA can be selected as the parental virus used to generate the -215j recombinant. Alternatively, another virus, adenovirus, canary pox virus, or a subunit preparation can be used to boost Immunization and/or cancer immunotherapy may be accomplished using a combined immunization regimen, immunization with a recombinant vaccinia viral vaccine of the invention 0 5 and a boost of a recombinant adenoviral vaccine. In such an embodiment, a

N

strong secondary CD8 T cell response is induced after priming and boosting N with different viruses expressing the same epitope (for such methods of Simmunization and boosting, see, Murata et al., Cellular Immunol. 173:96- 107). For example, a patient is first primed with a vaccine formulation of the invention comprising a recombinant vaccinia virus expressing an epitope, e.g., a selected tumor-associated antigen or fragment thereof. The patient is then boosted, 21 days later, with a vaccine formulation comprising arecombinant virus other than vaccinia expressing the same epitope. Such priming followed by boosting induces a strong secondary T cell response. Such a priming and boosting immunization regimen is preferably used to treat a patient with atumor, metastasis orneoplastic growth expressing the tumor associate, C35, antigen In yet another embodiment, the recombinant vaccinia viruses can be used Sas a booster immunization subsequent to a primary immunization with inactivated tumor cells, a subunit vaccine containing the C35 antigen or its epitope, or another recombinant viral vaccine, adenovirus, canary pox virus, or MVA.

In an alternate embodiment, recombinant vaccinia virus encoding epitopes or fragment thereof may be used in adoptive immunotherapeutic methods for the activation of T lymphocytes that are histocompatible with the patient and specific for the C35 antigen (for methods of adoptive immunotherapy, see, Rosenberg, U.S. Patent No. 4,690,915, issued September 1, 1987; Zarling, et al., U.S. PatentNo. 5,081,029, issued January 14, 1992). Such T lymphocytes may be isolated from the patient or a histocompatible donor. The T lymphocytes are activated in vitro by exposure to the recombinant vaccinia virus of the invention. Activated T lymphocytes are -216- Sexpanded and inoculated into the patient in order to transfer T cell immunity C, directed against the C35 antigen epitome.

The invention also provides a pharmaceutical pack or kit comprising one or more containers comprising one or more of the ingredients of the vaccine O 5 formulations of the invention. Associated with such container(s) canbe anotice Sin the formprescribedby a governmental agency regulating the manufacture, use

N

or sale of pharmaceuticals or biological products, which notice reflects approval Sby the agency of manufacture, use or sale for human administration.

Cancer Diagnosis and Prognosis There are two classes of genes affecting tumor development Genes influencing the cancer phenotype that act directly as a result of changes mutation) at the DNA level, such as BRCA1, BRCA2, and p53, are one class of genes. Another class of genes affect the phenotype by modulation at the expression level. Development of breast cancer and subsequent malignant progression is associated with alterations of a variety of genes of both classes.

Identification of quantitative changes in gene expression that occur in the malignant mammary gland, if sufficiently characterized, may yield novel molecular markers which may be useful in the diagnosis and treatment of human breast cancer.

The present inventors have identified a new breast cancer that is differentially expressed in primary infiltrating intraductal mammary carcinoma cells. Low expression levels of C35 in normal mammary epithelial cells suggest that overexpression of C35 indicates breast cancer malignant progression. It is possible that C35 may also be overexpressed in tumors of certain other tissue types including bladder and lung.

The present inventors have demonstrated that certain tissues in mammals with cancer express significantly enhanced levels of the C3 5 protein and mRNA encoding the C35 protein when compared to a corresponding "standard" -217- Smammal, a mammal of the same species not having the cancer. Further, it is believed that enhanced levels of the C35 protein, or of antibodies or lymphocytes specific for the C35 protein, can be detected in certain body fluids sera, plasma, urine, and spinal fluid) from mammals with cancer when 00 5 compared to sera from mammals of the same species not having the cancer.

Thus, the present invention provides a diagnostic method useful fortumor diagnosis, which involves assaying the expression level of the gene encoding the protein in mammalian cells or body fluid and comparing the gene expression C, level with a standard C35 gene expression level, whereby an increase in the gene expression level over the standard is indicative of certain tumors. Alternatively, the expression levels of antibodies or lymphocytes specific for C35 protein or polypeptides can be determined in blood or other body fluids and compared with a standard of expression of C35-specific antibodies or lymphocytes.

Where a tumor diagnosis has already been made according to conventional methods, the present invention is useful as a prognostic indicator, whereby patients exhibiting enhanced C35 gene expression may experience a worse clinical outcome relative to patients expressing the gene at a lower level.

By "assaying the expression level of the gene encoding the C35 protein" is intended qualitatively or quantitatively measuring or estimating the level of the C35 protein or the level of the mRNA encoding the C35 protein in a first biological sample either directly by determining or estimating absolute protein level or mRNA level) or relatively by comparing to the C35 protein level or mRNA level in a second biological sample).

Preferably, the C35 protein level or mRNA level in the first biological sample is measured or estimated and compared to a standard C35 protein level or mRNA level, the standard being taken from a second biological sample obtained from an individual not having the cancer. As will be appreciated in the art, once a standard C35 protein level or mRNA level is known, it can be used repeatedly as a standard for comparison.

-218- Z By "biological sample" is intended any biological sample obtained from C an individual, cell line, tissue culture, or other source which contains C35 protein or mRNA. Biological samples include mammalian body fluids (such as sera, plasma, urine, synovial fluid and spinal fluid) which contain secretedmature protein, and ovarian, prostate, heart, placenta, pancreas, liver, spleen, lung, breast, bladder and umbilical tissue whichmay contain precursor ormature forms f3 of The present invention is useful for detecting cancer in mammals. In particular, the invention is useful during diagnosis of the following types of cancers in mammals: breast, bladder, ovarian, prostate, bone, liver, lung, pancreatic, and splenic. Preferred mammals include monkeys, apes, cats, dogs, cows, pigs, horses, rabbits and humans. Particularly preferred are humans.

Total cellular RNA can be isolated from a biological sample using the single-step guanidinium-thiocyanate-phenol-chloroform method described in Chomczynski andSacchi,Anal. Biochem. 162:156-159(1987). Levels ofmRNA encoding the C35 protein are then assayed using any appropriate method. These include Northern blot analysis (Harada et al., Cell 63:303-312 (1990)), S1 nuclease mapping (Fujita et al., Cell 49:357-367 (1987)), the polymerase chain reaction (PCR), reverse transcription in combination with the polymerase chain reaction (RT-PCR) (Makino et al., Technique 2:295-301 and reverse transcription in combination with the ligase chain reaction (RT-LCR).

Assaying C35 protein levels in biological sample can occur using antibody-based techniques. For example, C35 protein expression in tissues can be studied with classical immunohistological methods (Jalkanen, et al., J.

Cell. Biol. 101:976-985 (1985); Jalkanen, etal., J. Cell. Biol. 105:3087-3096 (1987)).

Other antibody-based methods useful for detecting C35 protein expression include immunoassays, such as enzyme linked immunosorbent assay (ELISA), ELISPOT, and the radioimmunoassay (RIA).

-219- SSuitable labels are known in the art and include enzyme labels, such as, Glucose oxidase, and radioisotopes, such as iodine u 1, 1211), carbon sulfur tritium indium 2 In), andtechnetium and fluorescent labels, such as fluorescein and rhodamine, and biotin.

00 5 C35-specific T cells may be detected in a variety of proliferation and lymphokine secretion assays following activation by C35 presented by antigen N presenting cells according to methods known in the art. Tetrameric complexes of a C35 peptide epitope bound to soluble MHC molecules can be employed to C directly stain and enumerate C35-specific T cells in a population of cells (Lee, P.P. et al., Nature Medicine 5:677-85 (1999) the entire contents of which is hereby incorporated by reference.

In addition to assaying secreted protein levels in a biological sample, proteins can also be detected in vivo by imaging. Antibody labels or markers for in vivo imaging of protein include those detectable by X-radiography, NMR or ESR. For X-radiography, suitable labels include radioisotopes such as barium or cesium, which emit detectable radiation but are not overtly harmful to the subject. Suitable markers for NMR and ESR include those with a detectable characteristic spin, such as deuterium, which may be incorporated into the antibody by labeling of nutrients for the relevant hybridoma.

A protein-specific antibody or antibody fragment which has been labeled with an appropriate detectable imaging moiety, such as a radioisotope (for example, 31I, 2 1n, 9mTc), a radio-opaque substance, or a material detectable by nuclear magnetic resonance, is introduced (for example, parenterally, subcutaneously, or intraperitoneally) into the mammal. It will be understood in the art that the size of the subject and the imaging system used will determine the quantity of imaging moiety needed to produce diagnostic images. In the case of a radioisotope moiety, for a human subject, the quantity of radioactivity injected will normally range from about 5 to 20 millicuries of 99mTc. The labeled antibody or antibody fragment will then preferentially accumulate at the location of cells which contain the specific protein. In vivo tumor imaging is described -220in S.W. Burchiel et al., "Immunopharmacokinetics ofRadiolabeled Antibodies and Their Fragments." (Chapter 13 in Tumor Imaging: The Radiochemical Detection ofCancer, S.W. Burchiel and B. A. Rhodes, eds., Masson Publishing Inc. (1982).) 00 5 Fusion Proteins

(O

Any C35 polypeptide can be used to generate fusion proteins. For example, the C35 polypeptide, when fused to a second protein, can be used as an antigenic tag. Antibodies raised against the C35 polypeptide can be used to indirectly detect the second protein by binding to the C35. Moreover, because secreted proteins target cellular locations based on trafficking signals, the polypeptides can be used as a targeting molecule once fused to other proteins.

Examples of domains that can be fused to C35 polypeptides include not only heterologous signal sequences, but also other heterologous functional regions. The fusion does not necessarily need to be direct, but may occur through linker sequences.

In certain preferred embodiments, C35 fusion polypeptides may be constructed which include additional N-terminal and/or C-terminal amino acid residues. In particular, any N-terminally or C-terminally deleted polypeptide disclosedherein may be alteredby inclusion of additional amino acid residues at the N-terminus to produce a C3 5 fusion polypeptide. In addition, fusion polypeptides are contemplatedwhich include additional N-terminal and/or C-terminal amino acid residues fused to a C35 polypeptide comprising any combination of N- and C-terminal deletions set forth above.

Moreover, fusion proteins may also be engineered to improve characteristics of the C35 polypeptide. For instance, aregion of additional amino acids, particularly charged amino acids, may be added to the N-terminus of the polypeptide to improve stability and persistence during purification from the host cell or subsequent handling and storage. Also, peptide moieties may be -221added to the C35 polypeptide to facilitate purification. Such regions may be removed prior to final preparation of the C35 polypeptide. The addition of peptide moieties to facilitate handling of polypeptides are familiar and routine techniques in the art.

0 5 Moreover, C35 polypeptides, including fragments, and specifically epitopes, can be combinedwith parts of the constant domain ofimmunoglobulins O (IgG), resulting in chimeric polypeptides. These fusion proteins facilitate Spurification and show an increased half-life in vivo. One reported example C, describes chimeric proteins consisting of the first two domains of the human CD4-polypeptide and various domains of the constant regions of the heavy or light chains of mammalian immunoglobulins. (EP A 394,827; Traunecker etal., Nature 331:84-86 (1988).) Fusion proteins having disulfide-linked dimericstructures (due to the IgG) can also be more efficient in binding and neutralizing other molecules, than the monomeric secreted protein or protein fragment alone.

(Fountoulakis et al., J. Biochem. 270:3958-3964 (1995).) Similarly, EP-A-O 464 533 (Canadian counterpart 2045869) discloses fusion proteins comprising various portions of constant region of immunoglobulin molecules together with another human protein or part thereof.

In many cases, the Fc part in a fusion protein is beneficial in therapy and diagnosis, and thus can result in, for example, improved pharmacokinetic properties. (EP-A 0232 262.) Alternatively, deleting the Fc part after the fusion protein has been expressed, detected, and purified, would be desired. For example, the Fc portion may hinder therapy and diagnosis if the fusion protein is used as an antigen for immunizations. In drug discovery, for example, human proteins, such as hlL-5, have been fused with Fc portions for the purpose of high-throughput screening assays to identify antagonists of hIL-5. (See, D.

Bennett et al., J. Molecular Recognition 8:52-58 (1995); K. Johanson et al., J.

Biol. Chem. 270:9459-9471 (1995).) Moreover, the C35 polypeptides can be fused to marker sequences, such as a peptide which facilitates purification of C35. In preferred embodiments, the -222marker amino acid sequence is a hexa-histidine peptide, such as the tag provided in apQE vector (QIAGEN, Inc., 9259 Eton Avenue, Chatsworth, CA, 91311), among others, many ofwhich are commercially available. As described in Gentz et al., Proc. Natl. Acad. Sci. USA 86:821-824 (1989), for instance, hexa-histidine 00 5 provides for convenient purification of the fusion protein. Another peptide tag Suseful for purification, the "HA" tag, corresponds to an epitope derived from the influenza hemagglutinin protein. (Wilson et al., Cell 37:767 (1984).) 0 Thus, any of these above fusions can be engineered using the C polynucleotides or the C35 polypeptides.

Vectors, Host Cells, and Protein Production The present invention also relates to vectors containing the polynucleotide, host cells, and the production of C35 polypeptides by recombinant techniques. The vector may be, for example, a phage, plasmid, viral, or retroviral vector. Retroviral vectors may be replication competent or replication defective. In the latter case, viral propagation generally will occur only in complementing host cells.

polynucleotides may be joined to a vector containing a selectable marker for propagation in a host. Generally, a plasmid vector is introduced in a precipitate, such as a calcium phosphate precipitate, or in a complex with a charged lipid. If the vector is a virus, it may be packaged in vitro using an appropriate packaging cell line and then transduced into host cells.

The C35 polynucleotide insert should be operatively linked to an appropriate promoter, such as the phage lambda PL promoter, the E. coli lac, trp, phoA and tac promoters, the SV40 early and late promoters and promoters of retroviral LTRs, to name a few. Other suitable promoters will be known to the skilled artisan. The expression constructs will further contain sites for transcription initiation, termination, and, in the transcribed region, a ribosome binding site for translation. The coding portion of the transcripts expressed by -223- Sthe constructs will preferably include a translation initiating codon at the beginning and a termination codon (UAA, UGA or UAG) appropriately positioned at the end of the polypeptide to be translated.

As indicated, the expression vectors will preferably include at least one O 5 selectable marker. Such markers include dihydrofolate reductase, G418 or neomycin resistance for eukaryotic cell culture and tetracycline, kanamycin or N ampicillin resistance genes for culturing in E. coli and other bacteria.

0 Representative examples of appropriate hosts include, but are not limited to, bacterial cells, such as E. coli, Streptomyces and Salmonella typhimurium cells; fungal cells, such as yeast cells; insect cells such as Drosophila S2 and Spodoptera Sf9 cells; animal cells such as CHO, COS, 293, and Bowes melanoma cells; andplant cells. Appropriate culturemediums and conditions for the above-described host cells are known in the art.

Among vectors preferred for use in bacteria include pHE-4 (and variants thereof); pQE70, pQE60 andpQE-9, available from QIAGEN, Inc.; pBluescript vectors, Phagescript vectors, pNH8A, pNH16a, pNH18A, pNH46A, available from Stratagene Cloning Systems, Inc.; and ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5 available from Pharmacia Biotech, Inc. Among preferred eukaryotic vectors are pWLNEO, pSV2CAT, pOG44, pXTI and pSG available from Stratagene; and pSVK3, pBPV, pMSG and pSVL available from Pharmacia. Other suitable vectors will be readily apparent to the skilled artisan.

Preferred vectors are poxvirus vectors, particularly vaccinia virus vectors such as those described in U.S. Patent Appl. No. 08/935,377, the entire contents of which are incorporated herein by reference.

Introduction of the construct into the host cell can be effected by calcium phosphate transfection, DEAE-dextran mediated transfection, cationic lipid-mediated transfection, electroporation, transduction, infection, or other methods. Such methods are describedin many standard laboratory manuals, such as Davis et al., Basic Methods In Molecular Biology (1986).

-224polypeptides can be recovered and purified from recombinant cell C, cultures by well-known methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, 00 5 affinity chromatography, hydroxylapatite chromatography and lectin chromatography. Most preferably, high performance liquid chromatography N ("HPLC") is employed for purification.

polypeptides can also be recovered from: products purified from natural sources, including bodily fluids, tissues and cells, whether directly isolated or cultured; products of chemical synthetic procedures; and products produced by recombinant techniques from a prokaryotic or eukaryotic host, including, for example, bacterial, yeast, higher plant, insect, and mammalian cells. Depending upon the host employed in a recombinant production procedure, the C35 polypeptides may be glycosylated or may be non-glycosylated. In addition, C35 polypeptides may also include an initial modified methionine residue, in some cases as a result of host-mediated processes. Thus, it is well known in the art that the N-terminal methionine encoded by the translation initiation codon generally is removed with high efficiency from any protein after translation in all eukaryotic cells. While the N-terminal methionine on most proteins also is efficiently removed in most prokaryotes, for some proteins, this prokaryotic removal process is inefficient, depending on the nature of the amino acid to which the N-terminal methionine is covalently linked.

In addition to encompassing host cells containing the vector constructs discussed herein, the invention also encompasses primary, secondary, and immortalized host cells of vertebrate origin, particularly mammalian origin, that have been engineered to delete or replace endogenous genetic material coding sequence), and/or to include genetic material heterologous polynucleotide sequences) that is operably associated with C35 polynucleotides of the invention, and which activates, alters, and/or amplifies endogenous -225- Spolynucleotides. For example, techniques known in the art may be used to operably associate heterologous control regions promoter and/or enhancer) and endogenous C35 polynucleotide sequences via homologous recombination (see, U.S. Patent No. 5,641,670, issued June 24, 1997; International O 5 Publication No. WO 96/29411, published September 26, 1996; International Publication No. WO 94/12650, published August 4, 1994; Koller et al., Proc.

aNatl. Acad Sci. USA 86:8932-8935 (1989); and Zijlstra et al., Nature 342:435- 438 (1989), the disclosures of each of which are incorporated by reference in their entireties).

Having generally described the invention, the same will be more readily understood by reference to the following examples, which are provided by way of illustration and are not intended as limiting.

EXAMPLES

EXAMPLE 1 Differential Expression of C35 in Human Breast Carcinoma Thepresent inventors have characterized a full-length cDNA representing a gene, C35, that is differentially expressed in human breast and bladder cancer (Fig. A 348 base pair DNA fragment of C35 was initially isolated by subtractive hybridization of poly-A RNA from tumor and normal mammary epithelial cell lines derived from the same patient with primary infiltrating intraductal mammary carcinoma. (Band, V. et al., Cancer Res. 50:7351-7357 (1990). Employing primers based on this sequence and that of an overlapping EST sequence (Accession No. W57569), a cDNA that includes the full-length coding sequence was then amplified and cloned from the SKBR3 breast tumor cell line (ATCC, HTB-19). This C35 cDNA includes, in addition to the 348 bp coding sequence, 167 bp of 3' untranslated region.

-226- Differential expression of the C35 sequence is demonstrated in Fig. 2 panel A which compares expression levels of clone C35 in poly-A RNA from cell lines derived from nornal mammary epithelium, from two primary breast tumor nodules, and from two metastatic lung tumor nodules isolated 0C) 5 approximately one year later from the same patient (Band, V. et al, Cancer Res.

50:7351-7357 (1990)). Quantitative analysis indicates that the sequence is expressed at a more than 10 fold higher level in tumor cells than in normal mammary epithelium.- Low expression levels in a panel of other normal tissues is demonstrated by the Northern hybridization results of Fig. 2 panel B. Even though three times as much poly-A RNA was loaded from normal tissues as from the tumor cell lines, little or no expression of RNA homologous to C35 was detected after a comparable 15 hour exposure. Only after an extended 96 hour exposure was low level expression of some homologous sequences detected in normal spleen and kidney tissues. Analysis of expression of C35 homologous sequences in poly-A RNA from three primary infiltrating ductal breast carcinoma from different patients as well as a sample of normal breast epithelium is shown in Fig. 2 panel C. In comnparison to normal breast epithelium, sequences homologous to C35 are overexpressed as much as 45 and 25 fold in two of the three primary breast tumors.

The present inventors previously conducted an analysis of an immunoprotective tumor antigen expressed in several independently derived murine tumors and, at much reduced levels, in normal mouse tissues. (See U.S.

Patent Application filed March 28, 2000, titled "Methods of Producing a Library and Methods of Directly Selecting Cells Expressing Inserts of Interest," the entire contents of which are hereby incorporated herein by reference). In this case, a factor of 9 difference between expression levels in tumor and normal tissues was associated with induction of an immunoprotective tumor-specific response.

As discussed above, the expression level of C35 in some human breast cancers relative to normal tissue exceeds a factor of 9, suggesting that C35 might also be immunoprotective against breast cancer in these individuals.

-227- SEXAMPLE 2 C35 Specific CTL are Cytolytic for C35 Positive Breast Tumor Cells Although a gene product may be overexpressed in tumor cells, as is the 00 case for C35, it is immunologically relevant only ifpeptides derived from that S 5 gene product can be processed andpresented in association with MHC molecules n of the tumor cells. It is conceivable that for any given gene product either no Speptides are produced during the cellular degradation process that satisfy the C, requirements for binding to the MHC molecules expressed by that tumor, or, even if such peptides are generated, that defects in transport or competition for MHC molecules by other tumor peptides would preclude presentation of any peptides from that specific gene product. Even if relevant tumor peptides are processed and presented in association with human MHC in the tumor cells, it must in all cases be determined whether human T cells reactive to these peptides are well-represented in the repertoire or whether T cells may have been rendered tolerant, perhaps due to expression of the same or a related antigen in some other non-homologous normal tissue. For both these reasons, therefore, it is essential to confirm that MHC-restricted, human tumor antigen-specific T cells can be induced by C35 and that they are indeed crossreactive on human tumor cells.

Relevant information on this point can be obtained through in vitro stimulation of human T cell responses with recombinant C35 or C35 peptides presented by autologous antigen presenting cells.

A major technical problem in evaluating T cell responses to recombinant gene products is that a strong immune response against the expression vector can block or obscure the recombinant specific response. This is particularly a problem with primary responses that may require multiple cycles of in vitro stimulation. To minimize vector specific responses, it is possible to alternate stimulation by antigen presenting cells infected with different viral vectors recombinant for the same gene product Convenient vectors include: retroviruses, adenovirus, and pox viruses.

-228- SHuman PBMC were purified using Ficoll-Paque and subject to rosetting with neuraminidase-treated sheep erythrocytes to isolate monocytes (erythrocyte rosette negative, ER-) and T lymphocytes Dendritic cells were generated from the ER- fraction by culture for 7 days in rhGM-CSF (1000 U/ml) and 00 5 rhIL-4 (1000 U/ml) with fresh medium and cytokines being added every other day. At day 7, immature dendritic cells were transduced with retrovirus c, expressing human C35 in the presence of polybrene (1 ug/ml) for 6 hours. Cells Swere washed and incubated under maturation conditions for 4 days in the presence of 12.5% monocyte conditioned medium, 1000 U/ml rhGM-CSF and 1000 rhU/ml IL-4 and 1% autologous serum. At this point, the dendritic cells were incubated with autologous T lymphocytes (cryopreserved BR* fraction) at a ratio of 1 DC:50 T cells for 14 days. Viable T cells were restimulated with autologous, irradiated EBV-B B cells infected at a multiplicity of infection of 1 overnight (16 hours) with a vaccinia recombinant expressing human C35 in the presence of cytokines IL-2 (20U/ml), IL-12 (20 U/ml) and IL-18 (10 ng/ml).

Cells were restimulated two more times with autologous EBV-B cells infected with C35-bearing retrovirus in the presence of IL-2 and IL-7 (10 ng/ml).

Cytotoxic activity was measured after a total of 4 stimulations by "Cr release assay using 5000 targets/well in a 4 hour assay. The results shown in Table 8 below demonstrate specific cytotoxic activity of C35 stimulated T cells against 21NT breast tumor cells that express relatively elevated levels of C35 but not against MDA-MB-231 tumor cells that express the same low levels of C35 as normal nontransformed epithelial cells.

-229- STable 8 C35-specific CTL are Cytolytic for C35 Positive Breast Tumor Cells Target Cells

E:T

HLA Haploype 20:1 10:1 S(Effectors:A2, Al B8, B35) specific lysis) Autologous SEBV-B A2, A11; B8, B35 2 1 0 MDA-MB-231 A2; B8 3 1 low (lx) 21NT A26, A31; B35, B38 22 high (12x).

K562 2 0 EXAMPLE 3 Expression on the Membrane of Breast Carcinoma Cells To determine whether the C35 polypeptide product is expressed on the surface of tumor cells, a C35 specific antiserum was prepared. BALB/c mice were immunized with syngeneic .Line 1 mouse tumor cells that had been transduced with retrovirus encoding human C35. Mice were bled following a series of two or more immunizations. The immune sera were employed to detect surface expression of C35 protein by flow cytometry on three breast tumor cell lines representinghigh (21NT), intermediate (SKBR3), and low (MDA-MB-231 levels of expressionof the C35 transcript in Northern blots (see Fig. 1 x 10 s breast tumor cells were stained with 3.5 microliters ofC35 specific antiserum or control, pre-bleed BALB/c serum. After a 30 minute incubation, cells were washed twice with staining buffer (PAB) and incubated with FITC-goat anti-mouse IgG (1 ug/sample) for 30 minutes. Samples were washed and analyzed on an EPICS Elite flow cytometer. The results presented in Figure 4 demonstrate membrane expression of the C35 antigen recognized by the specific immune serum at high levels on tumor line 21NT (panel intermediate levels -230for tumor line SKBR3 (panel and undetectable levels in tumor line MDA-MB-231 (panel The high level of reactivity of antibody to membranes of tumor cells that express elevated levels of C35 transcripts suggests that specific antibodies may serve as effective immunotherapeutic agents for the large 00 5 number of breast carcinoma that overexpress this gene product (see Figures 2 and 3).

(O

EXAMPLE 4 c A Deregulated Ribosomal Protein L3 Gene Encodes a Shared Murine Tumor Rejection Antigen The present inventors have developednovel antigen discovery technology that allows for the selection of genes encoding CTL epitopes from a cDNA library constructed in a poxvirus. Using this technology the present inventors have determined that a shared murine tumor antigen is encoded by an alternate allele of the ribosomal protein L3 gene. The immunogenic L3 gene is expressed at significant albeit reduced levels in normal tissues including thymus.

Immunization with a vaccinia recombinant of the immunogenic L3 cDNA induces protective immunity against tumor challenge. It is of particular interest that a deregulated allele of a housekeeping gene can serve as an immunoprotective antigen and that thymic expression does not preclude immunogenicity of anupregulatedtumorproduct These observations emphasize that tolerance to a self-protein is not absolute but must be defined in relation to quantitative levels of expression. The ribosomal protein described may be representative of a class of shared tumor antigens that arise as a result of deregulated expression of a self-protein without compromising immunetolerance to normal tissues. Such antigens would be suitable for immunotherapy of cancer in vital organs.

-231- SMethods Total RNA was isolated from BCA 39 tumor cells using the Perfect RNA Total RNA Isolation Kit (5 Prime 3 Prime, Inc., Boulder, CO). Poly A+ mRNA 0 0 was isolated from the total RNA using Dynabeads (Dynal, Lake Success, NY).

Two micrograms of poly A+ mRNA was converted to double stranded cDNA using the Great Lengths cDNA Synthesis Kit (Clontech, Palo Alto, CA). The double stranded cDNA was then inserted in vaccinia virus vector Balb/cByJ (Jackson Labs) mice were immunized intraperitoneally with 2 X 106 irradiated (6,500 cGy) BCA 34 cells. Two weeks later the mice were boosted by subcutaneous injection of 2 X 106 irradiated BCA 34 cells. One week following the second immunization splenocytes were harvested, divided into 12 parts and cultured in 12 well plates with 6 X 10' irradiated (10,000 cGy), mitomycin C treated BCA 34 cells per well. At weekly intervals viable T cells were purified using Lympholyte-M (Accurate Chemical, Westbury, NY) and cultured in 12 well plates at 1.5 X 106 T cells per well. To each well was also added 4 X 10 6 irradiated (5000 cGy) Balb/c spleen, along with 6 X 10 5 irradiated, mitomycin C treated BCA 34 cells.

A specific vaccinia recombinant that encodes the well characterized ovalbumin 257-264 peptide (SIINFEKL) that is immunodominant in association with H-2Kb was diluted with non-recombinant virus so that it initially constituted either 0.01%, or 0.001% of total viral pfu. An adherent monolayer of MC57G cells (H -2b) were infected with this viral mix atm.o.i.=l (approximately x 10 5 cells/well). Following 12 hours infection, ovalbumin peptide-specific CTL, derived by repeated in vitro stimulation of ovalbumin primed splenic T cells with the immunodominant SIINFEKL peptide, were added. During this incubation those adherent cells which were infected with a recombinant particle that expresses the ovalbumin peptide are targeted by specific cytotoxic T cells and undergo a lytic event which causes them to be released from the monolayer.

Following incubation with CTL, the monolayer is gently washed, and both -232- Sfloating cells and the remaining adherent cells are separately harvested. Virus extracted from each cell population was titred for the frequency of recombinant (BRdU resistant) viral pfu. Virus extracted from floating cells was then used as input to another enrichment cycle with fresh adherent MC57G cells and 00 5 ovalbumin peptide-specific CTL. It was observed that following enrichment of SWVVova to greater than 10% of total virus, further enrichment of the recombinant N virus was accelerated if the m.o.i. in succeeding cycles was reduced from 1 to 0.1.

C

,1 Confluent monolayers of BCN in wells of a 12 well plate were infected with moi=1.0 vaccinia BCA39 cDNA library. At 12 hours post-infection the monolayers were washed 3X with media, and 2.5 X 106 CTL were added to the wells in a 250 pl volume. The T cells and targets were incubated at 37 *C for 4 hours. Following the incubation the supernatant was harvested, and the monolayer gently washed 3X with 250 1 media. Virus was released from the cells by freeze/thaw, and titers determined by plaque assay on BSC1 cells. The selected virus population (floating cells in cultures that received specific T cells) was amplified on BSC1 cells in one well of a 12 well plate for 2 days. The virus was then harvested and titered. This viral stock was subjected to three additional enrichment cycles. The selected virus population was not amplified prior to the next cycle.

Virus from the fourth enrichment cycle was dividedinto 40 pools of 5 pfu each. Each pool was amplified on BSCI cells in a 96 well plate, with 1 pool well. After 4 days the virus was harvested and used to infect monolayers of BCN in a 96 well plate at moi=5, with 1 pool per well. As a control, a monolayer of BCN was infected with moi=5 vNotl/tk (Merschlinsky et al., Virology 190:522 (1992)). At 5 hours post-infection, 2X104 washed CTL were added to each well. The final volume in each well was 225 pl. The cells were incubated at 37 °C for 18 hours. The cells were then pelleted by centrifugation, 150gl supernatant was harvested and tested for IFNg by ELISA. Twenty seven of the forty pools of 5 pfu were positive for the ability to stimulate CTL.

-233- SSuggesting, by Poisson analysis, that specific recombinants were enriched to 1 greater than 20%. Individual clones were picked from 5 positive pools and assayed as above.

Monolayers of B/C.N in a 6 well plate were infected with moi=l.0 of OO 5 v7.5/tk, vF5.8, orvH2.16. At 14 hours post-infection cells were harvested along with the control targets: B/C.N, BCA 34, and BCA 39. The target cells were labeled with 100 microcuries "Chromium (Dupont, Boston, MA) for 1 hour at 37°C, and 104 cells were added to wells of a 96 well round bottom plate in quadruplicate. Tumor specific CTL were added to target cells at the indicated ratios. Cells were incubated at 37 "C for 4 hours. Supematants were harvested and "Cr release determined. Spontaneous release was derived by incubating target cells with media alone. Maximal release was determined by incubating target cells with 5% Triton X 100. Percentage of specific lysis was calculated using the formula: specific lysis= ((experimental release-spontaneous release) (maximal release-spontaneous release)) X 100. In each case the mean of quadruplicate wells was used in the above formula.

Two micrograms oftotal RNA was converted to cDNA using a dT primer and Superscript II Reverse Transcriptase (BRL, Gaithersburg, MD). cDNA was used as the template for a PCR using L3 specific primers; L3.Fl.S (CGGCGAGATGTCTCACAGGA) and L3.F.AS (ACCCCACCATCTGCACAAAG); and Klentaq DNA Polymerase Mix (Clontech) in a 20 microliter final volume. Reaction conditions included an initial denaturation step of 94 °C for 3 minutes, followed by 30 cycles of: 94 "C seconds, 60 0 C for 30 seconds, 68"C for 2 minutes. These PCR products contained the region ofL3 between position 3 and 1252. The PCR products were purified using Centricon 100 columns (Amicon, Beverly, MA), digested with Sau3AI, and resolved on a 3% Agarose/ethidium bromide gel.

Adult female Balb/cByJ mice (2 mice per group) were immunized by subcutaneous injection of 5XI06 pfu of vH2.16, or v7.5/tk. Seven days following the immunization splenocytes were harvested and cultured in 12 well -234plates along with 1 micromolar peptide L3 4 8- 56 (I54). After seven days the viable T cells were purified using Lympholyte-M, and IX10 6 T cells were added to wells of a 12 well plate along with 1 micromolar peptide and 4 X 106 irradiated (5000 cGy) Balb/c spleen cells per well.

00 5 Adult female Balb/cByJ mice were immunized by subcutaneous injection CN of 10X10 6 pfu of vH2.16, vPKIa, v7.5/tk or Phosphate Buffered Saline.

C, Secondary immunizations were given 21 days later. Mice were challenged with Stumor by subcutaneous injection of 2X10 5 BCA 34 cells twenty one (primary C, immunization only) or fourteen days following immunization.

Results and Discussion Prospects for development of broadly effective tumor vaccines have been advanced by evidence that several self-proteins can be recognized as tumor antigens by immune T cells (Van den Eynde et al., J. Exp. Med. 173:1373 (1991); M. B. Bloom et al., J. Exp. Med. 185:453 (1997); Van Der Bruggen et al., Science 254:1643 (1991); Gaugler et al., J. Exp. Med. 179:921 (1994); Boel et al., Immunity 2:167 (1995); Van Den Eynde et al., J Exp. Med. 182:689 (1995); Kawakami et al., Proc. Natl. Acad. Sci. U.S.A. 91:3515 (1994); Kawakami et al., Proc. Natl. Acad. Sci. U.S.A. 91:6458 (1994); Brichard et al., J. Exp. Med. 178:489 (1993)). Such normal, nonmutated gene products may serve as common target antigens in tumors of certain types arising in different individuals. Clinical evidence for induction of protective immunity following vaccination with such shared tumor antigens is, currently, very limited (Marchand et al., Int. J. Cancer 80:219 (1999); Rosenberg et al, Nat. Med. 4:321 (1998); Overwijk et al., Proc. Natl. Acad. Sci. 96:2982 (1999); Brandle et al., Eur. J. Immunol. 28:4010 (1998)). It is, moreover, not at all clear whether the T cell responses to these self-proteins represent a surprising breakdown in immunological tolerance or are a consequence of qualitative or quantitative changes in the expression of the self-proteins in tumor cells. In the latter case, -235- Snormal tissue tolerance could be maintained and vaccine induced immunity to self-proteins whose expression is systematically altered in tumors might be applicable even to cancer of vital organs.

The present inventors have shown that a ribosomal protein allele that is 00 5 systematically deregulated in multiple murine tumors during the transformation N process is a tumor rejection antigen and that the principal correlate of N, immunogenicity is a dramatic change in quantitative expression in tumors Srelative to normal tissues and thymus.

c, Previously, the present inventors have reported that cross-protective immunity is induced among three independently derived murine tumor cell lines (Sahasrabudhe et al., J. Immunology 151:6302 (1993)). These tumors, BCA 22, BCA 34, and BCA 39 were derived by in vitro mutagenesis of independent subcultures of the B/C.N line, a cloned, immortalized, anchorage-dependent, contact inhibited, nontumorigenic fibroblast cell line derived from a Balb/c embryo (Collins et al., Nature 299:169 (1982); Lin et al., JNCI74:1025 (1985)).

Strikingly, immunization with any of these tumor cell lines, but not with B/C.N provided protection against challenge with not only homologous tumor cells, but also against challenge with the heterologous tumor cell lines. Following immunization with any of these three tumor cell lines, CD8+ cytolytic .T lymphocyte (CTL) lines and clones could be generated which in vitro displayed crossreactive specificity for the same three tumors, but not for the nontumorigenic B/C.N cells from which they derived.

In order to move from an immunological definition to a molecular definition of this shared tumor antigen(s), the present inventors developed a novel and efficient method for the identification of genes that encode CTL target epitopes. In this approach a cDNA library from the BCA 39 tumor cell line was constructed in a modified vaccinia virus expression vector (Merchlinsky et al., Virology 238:444 (1997); E. Smith et al., Manuscript in preparation). Five hundred thousand plaque forming units (pfu).of this library were used to infect a monolayer of antigen-negative B/C.N cells at a multiplicity of infection (moi) -236of 1. Following 12 hours infection, BCA 34 tumor specific CTL were added to the target cell monolayer at an effector to target ratio that gives approximately lysis in a standard 5 Cr release assay. CTL specific for the heterologous BCA 34 tumor cell line were used in order to facilitate the identification of 00 5 antigen(s) which are sharedbetween these two tumor cell lines. Since adherence C, is an energy dependent process, it was expected that cells that undergo a CTL CI mediated lytic event would come off of the monolayer and could be recovered Sin the supernatant. By harvesting virus from floating cells following cell C1 mediated lymphocytotoxicity (CML), it was possible to enrich for viral recombinants that had sensitized the host cell to lysis. An essential feature of this procedure is that it lends itself to repetition. The virus harvested following one cycle of enrichment can be used as input for additional cycles of selection using fresh monolayers and fresh CTL until the desired level of enrichment has been achieved. In a model experiment with CTL specific for a known recombinant, it was possible to demonstrate that specific recombinants could be enriched from an initial dilution of 0.001% to approximately 20% in 6 cycles of selection (Table At this level it is a simple matter to pick individual plaques for further characterization.

Table 9 Multiple Cycles of Enrichment for VVova A vaccinia cocktail composed of wild type vNotl/tk spiked with the indicated concentrations of VVova was subjected to CML Selection (12) Enrichment Vova in Floating Cells Cycle Expt 1 Expt. 2 Expt. 3 moi=l 0 0.2 0.01 0.001 1 2.1 0.3 nd 2 4.7 1.1 nd 3 9.1 4.9 nd -237- Enrichment Wova in Floating Cells "1 Cycle Expt. 1 Expt. 2 Expt 3 4 14.3 17.9 1.4 24.6 3.3 00 N6 18.6 Smoi=0.1 5 48.8 39.3 S/%Wova= (Titer with BudR/Titer without BudR) X 100

C

1 nd not determined The poxvirus expression library was subjected to 4 cycles of selection with tumor-specific CTL. Individual plaques of the selected viral recombinants were expanded and used to infect separate cultures of B/C.N cells. These cells were assayed for the ability to stimulate specific CTL to secrete interferon gamma (IFN-gamma) (FIG. 5A), or for sensitization to lysis by the tumorspecific CTL (FIG. 5B). Ten viral clones were isolated, all of which conferred upon B/C.N the ability to stimulate a line of tumor-specific CTL to secrete IFN y.

All 10 clones contained the same sized (1,300 bp) insert (Smith et al, unpublished data). Sequence analysis confirmed that clones F5.8 and H2.16 contained the same full-length cDNA. It appeared, therefore, that all ten clones were recombinant for the same cDNA. In all, 6 of 6 CTL lines that were generated by immunization with BCA 34 demonstrated specificity for this antigen.

A search of GenBank revealed that this cDNA is highly homologous to the murine ribosomal protein L3 gene (Peckham et al., Genes and Development 3:2062 (1989)). Sequencing the entire H2.16 clone revealed only a single nucleotide substitution that coded for an amino acid change when compared to the published L3 gene sequence. This C170T substitution generates a Threonine to Isoleucine substitution at amino acid position 54. The F5.8 clone also contained this nucleotide substitution.

-238- Since CTL recognize antigen as peptide presented by a Major Histocompatibility Complex (MHC) molecule, it was of interest to identify the peptide epitope recognized by these class I MHC-restricted tumor-specific CD8+ T cells. It was considered likely that the altered amino acid (Ile 54) would be C0 5 included in the peptide recognized by the CTL. This hypothesis was supported c- by the demonstration that a vaccinia virus clone recombinant for only the first ci 199 bp (63 amino acids) of H2.16 (vH299) was able to sensitize B/C.N to lysis by tumor-specific CTL (Smith et al., unpublished data). A Computer screen of peptide-binding motifs suggested that there are two epitopes encoded within this region that could associate with high affinity to the class I MHC molecule Kd (FIG. 12) (Parker et al., J. Immunology 152:163 (1994)). These two peptides, L3 4 5.,4 (154) and L3456 (154) were synthesized and tested for the ability to sensitize B/C.N cells to lysis by tumor-specific CTL. As shown in FIG. 7A, peptide L3 4 ,4 6 (154) sensitized B/C.N to lysis, while L3 45 s4 (154), and the wild type L3 4856 (T54) did not. It was determined that 10 nM L3U-s (154) was sufficient to sensitize targets to lysis by CTL, whereas 100 mM L348.56 (T54) did not (FIG. 7B). These results demonstrate that peptide L34. (154) is a target epitope recognized by the tumor-specific CTL.

To analyze expression of the different L3 gene products, oligo-dTprimed cDNA was synthesized from RNA of tumors and the B/C.N cell line from which they derived. The first strand cDNA was subjected to PCR amplification using a pair of primers which amplify nearly the entire mouse L3 mRNA. Sequence analysis of these PCR products showed that B/C.N and BCB13 L3 cDNA contained a C at position 170 (same as published sequence). BCB13 is a tumor cell line that was derived from the B/C.N cell line, but that is not immunologically cross-protective with the BCA tumor cell lines (Sahasrabudhe et al., J. Immunology 151:6302 (1993)). Sequence analysis of the PCRproducts from the crossreactive BCA 39, BCA 34, and BCA 22 tumors suggested that these cell lines express two different species of L3 mRNA. One species contains -239a C at 170, and the other contains a T at 170, as in the H2.16 clone. The sequence of all L3 cDNAs were identical except for this one base substitution.

There are two possible ways to account for the origin of the new L3 RNA in tumor cells. Eitherthe L3 (Cl 70T) gene expressed in these tumors is a somatic 00 5 mutant of the wild type gene or there are multiple germ line alleles of L3, at least CI one of which gives rise to an immunogenic product when deregulated during the process of tumor transformation. We considered the first hypothesis unlikely O because the crossreactive BCA 39, BCA 34, and BCA 22 tumors were C, independently derived. It would be remarkable if the same mutant epitope was generated in all three tumors. On the other hand, Southern blots of different restriction digests ofgenomic DNA fromBCA 39 and B/C.N suggested that there are multiple copies of the L3 gene in the mouse genome (Smith et al., unpublished data). The L3 gene has also been reported to be multi-allelic in both the rat and the cow (Kuwano et al., Biochemical and Biophysical Research Communications 187:58 (1992); Simonic et al., Biochemica et BiophysicaActa 1219:706 (1994)). Further analysis was required to test the hypothesis that different L3 alleles in the germ line are subject to differential regulation in tumors and normal cells.

The nucleotide sequence of the published L3 from position 168 to 171 is GACC. The sequence of H2.16 in this same region is GATC (FIG. 8A). This new palindrome is the recognition sequence for a number of restriction endonucleases, including Sau3AI. As shown in the restriction map of FIG. 8A, a Sau3A I digest of L3 is expected to generate fragments of 200, 355, 348, 289, and 84 base pairs, while a Sau 3A I digest of H2.16 would generate a 168bp fragment in place of the 200 bp fragment. This difference in the Sau 3AI digestion products was used to confirm that the three BCA cell lines express at least two different L3 alleles. The L3 RT-PCR products from all 5 cell lines and thymus RNA were digested with Sau 3AI and analyzed on an agarose gel. As shown in FIG. 8B all 3 BCA lines express both versions of L3. Remarkably, when this assay was repeated using greater amounts of starting material, the 168 -240j bp fragment was also detectable in the digests of B/C.N, BCB13 and normal thymus cDNA (Smith et al., unpublished data). To enhance the sensitivity of this assay, the PCR was repeated using a P 3 2 end-labeled 5' L3 specific primer. The radiolabeled PCR products were digested with Sau3AI and resolved on an 00 5 agarose gel. As shown in FIG. 8C, B/C.N, BCB13 andthymus containthe 168bp fragment. Quantitative analysis indicates that the ratio of 200bp: 168bp Sfragments in the BCA tumors is 2:1 while the ratio of the same fragments Sdetected in B/C.N, BCB13, and thymus is approximately 20:1. Low levels of C expression of this immunogenic L3 allele was also observed when RNA from kidney, heart, and skeletal muscle was analyzed (Smith et unpublished data).

These results suggest that gene deregulation associated with the transformation process in the crossreactive tumors leads to the expression of higher levels of this germ line L3 (C 170T) allele, and that this altered L3 gene was not generated by somatic mutation of the L3 gene that is predominantly expressed in normal tissues. The present inventors have termed this new L3 allele (C170T), the immunogenic L3 allele (iL3).

It is particularly intriguing that the immunogenic L3 allele is also expressed, albeit at a 10 fold reduced level, in normal thymus. This level of expression is evidently not sufficient to tolerize all T cells with functional avidity for the level of deregulated iL3 expressed in some tumors. The observation that although B/C.N and BCB13 express low levels of iL3, they are not susceptible to lysis by the tumor specific CTL suggests, however, that higher affinity T cells have been tolerized. This appears to be the first instance in which a tumor antigen has been reported to be expressed in the thymus. These observations emphasize that tolerance to a self-protein is not absolute but must be defined in relation to quantitative levels of expression (Targoni et J. Exp. Med. 187:2055 (1998); C. J. Harrington etal., Immunity 8:571 (1998)).

If broadly effective vaccines are to be developed based on expression of shared tumor antigens, then it is critical to demonstrate that such antigens can be immunoprotective. The largest number of shared antigens have been identified -241for human tumors, but clinical Immunotherapy trials employing these antigens have so far been inconclusive, in part because of uncertainty regarding optimal vaccination strategies (Pardoll, Nat. Med. 4:525 (1998)). In mice, where immunotherapeutic strategies could be more thoroughly investigated, very few 00 5 shared tumor antigens have been identified. It was, therefore, of considerable C interest to determine whether immunization with iL3 recombinant vaccinia virus

O

C1 would induce tumor specific CTL and protect mice from tumor challenge 0 (Overwijk et al., Proc. Natl. Acad. Sci. 96:2982 (1999); Moss, Science C1 252:1662 (1991); Irvine et al., J. Immunology 154:4651 (1995); McCabe et al., Cancer Research 55:1741 (1995); Estin et al., Proc. Natl. Acad. Sci. 85:1052 (1988); J. Kantor et al., JNCI84:1084 (1992); V. Bronte et al., Proc. Natl. Acad.

Sci. 94:3183 (1997)). Immunization of Balb/c mice with vaccinia virus recombinant for the iL3 gene (H2.16) generated CTL that were able to lyse both BCA 34 and BCA 39 tumor cells, but not B/C.N in vitro (FIG. 9A). Mice immunized twice or even once with vaccinia virus recombinant for iL3 were able to reject challenge with BCA 34 tumor cells (FIGS. 9B and 9C). Mice immunized with empty viral vector, or control vaccinia recombinant for the Inhibitor Protein of cAMP-dependent Protein Kinase (PKIa) were unable to reject this tumor challenge (Olsen, S.R. and Uhler, J. Biol. Chem.

266:11158 (1991); Mueller et al., Manuscript in Preparation). These results demonstrate that the iL3 self-protein is an immunoprotective tumor antigen.

The present inventors have developed a new strategy to identify genes that encode CTL epitopes based on CTL-mediated selection from atumor cDNA library in a modified vaccinia virus vector (Merchlinsky et al., Virology 238:444 (1997); E. Smith et al., manuscript in preparation). We have applied this strategy to identify a deregulated housekeeping gene that encodes a tumor rejection antigen shared by three independently derived murine tumors. This ribosomal protein may be representative of a larger class ofimmunoprotective sharedtumor antigens that become immunogenic as a result of deregulated expression of self- -242- Sproteins without compromising immune tolerance to normal tissues. Such 0C antigens would be well suited for immunotherapy of cancer in vital organs.

EXAMPLE 0 0 Expression and Immunogenicity of C35 Tumor Antigen RNA transcripts of the novel C35 tumor gene are overexpressed in S(12/17) of primary human breast carcinomas examined and 50% (5/10) of bladder carcinomas examined when compared to expression in normal human tissues. The full-length gene encodes a novel 115 amino acid protein of unknown function. A monoclonal antibody, 2C3, has been selected that stains the surface membrane of cells expressing C35 by flow cytometric analysis. In addition, human cytotoxic T lymphocytes (CTL) have been generated in vitro that specifically lyse C35+ breast and bladder tumors. The ability to generate CTL in vitro from normal human donors suggests the absence of tolerance to the overexpressed protein. Overexpression of C35 in tumors of different individuals and the ability to induce humoral and cellular immune responses make C35 a promising candidate for immunotherapy.

Material and Methods Cell lines: Human mammary carcinoma cell lines BT20, BT474, MCF7, MDA-MB231, SKBR3, T47D (supplied by ATCC) were grown in RPMI-1640 (BioWhitaker, Walkersville, MD) supplemented with 10% fetal bovine serum (Biofluids, Rockville, MD). An immortalized line derived from normal breast epithelium, H16N2, two metastastic tumors, 21-MT1 and 21-MT2, and two primary tumors, 21-NT and 21-PT all derived from the same patient, and grown in DFCI medium (Band, V. and Sager, "Tumor Progression in Breast Cancer" in Neoplastic Transformation in Human Cell Culture, J.S. Rhim and A.

Dritschilo eds., The Human Press Inc., Totowa, NJ.. (1991), pp. 169-78) were -243- Sgenerously provided by Dr. Vimla Band, New England-Tufts Medical Center.

The bladder tumor cell line ppT11A3 was derived from the immortalized nontumorigenic cell line SV-HUC. These bladder cell lines were generously provided by Dr. Catherine Reznikoff, University of Wisconsin Clinical Cancer 0 0 5 Center, and grown in F12 medium supplemented with 1% PBS, 0.025 units insulin, 1 ug hydrocortisone, 5 ug transferrin, 2.7 g dextrose, 0.1 uM nonessential amino acids, 2 mM L-glutamine, 100 units penicillin, and 100 ug streptomycin per 500 ml. Normal proliferating breast epithelial cells (MEC) were purchased from Clonetics (BioWhittaker) and maintained according to the supplier's directions.

RNA extraction andNorthern BlotAnalysis: Cell lines were harvested for RNA extraction at approximately 80% confluency. Cells were harvested and lysed in QG buffer from Qiagen RNAeasy kit. Total RNA was extracted as per manufacturer's protocol and stored at -80 0 C as precipitates with GITC and alcohol. Tissue samples were provided by the Cooperative Human Tissue Network as snap frozen samples, whichwere homogenized in lysis buffer for use in the RNAeasy protocol. For Northern blots, mRNA was extracted from total RNA (30 ug total RNA/well) using Dynal's (Lake Success, NY) oligo-dTs magnetic beads and electrophoresed in 0.8% SeaKemLE (FMC Bioproducts) with 3% formaldehyde. The mRNA was blotted onto Genescreen Plus (NEN) in 10X SSC overnight by capillary blot, then baked for 2 hours at 80 0

C.

Membranes were probed with random-primed 32 P-labeled cDNA probes (Prime- It, Stratagene, LaJolla, CA) at 106 cpm/ml Quickhyb solution (Stratagene), at 68°C as per manufacturer's protocol. Blots were exposed to Xray film and/or phosphorimager screens overnight. Expression on all blots was normalized to a housekeeping gene, such as GAPDH or beta actin.

Subtractive Hybridization: PCR Select cDNA Subtraction Kit (Clontech, Palo Alto, CA), based on Representational Difference Analysis as first described by Lisitsyn et al.(Lisitsyn, N. and Wigler, Science 259:946-51 (1993)), was employed as per manufacturer's protocol to generate cDNAs enriched for -244- Sgenes overexpressed in tumor compared to normal breast cell lines. Briefly, C, oligo-dT-primed double stranded cDNA was synthesized from 2 ug high quality, DNase-treated mRNA from tumor and normal cells. Adaptors were ligated to short blunt-end (Rsal digested) tumor sequences and hybridized with excess O 5 Rsal digested normal fragments. Following 32 hour hybridization, suppression PCR (Clontech) allowed preferential amplification of overexpressed tumor sequences using adaptor sequences as primers. The products of the PCR Samplification were cloned into pT7Blue3 (Novagen, Madison, WI) to generate Sa subtracted library. Clones were grown in LB/ampicillin (100ug/ml) in 96-well format, inserts were PCR amplified from the overnight cultures and PCR products were spotted on Genescreen Plus using BioDot manifold (BioRad, Hercules, CA). Duplicate dot blots were then probedwith random-primed tumor or normal cDNA, or, alternatively, the PCR products of the forward and reverse subtractive hybridizations. Clones that appeared to be overexpressed in the tumor cDNA and forward subtraction (tumor minus normal) were analyzed by Northern Blot (as described above) to confirm differential gene expression.

cDNA library and full length gene: Oligo-dT primed double stranded cDNA was generated from SKBR3 cell line using SMART cDNA Synthesis (Clontech Laboratories), followed by phenol:chloroform:isoamyl alcohol extraction. Primers were synthesized (C35 sense: GCGATGACGGGG GAGCC, and C35 antisense: CCACGGAATCTTCTATTCTTTCT; Fisher Oligos, The Woodlands, TX) to amplify the coding region of C35, based on the open reading frame deduced from EST homologies, Accession W57569, in particular. PCRproducts were cloned into pT7Blue 3 (Novagen).

Vaccinia and Retroviral C35 recombinants: The coding sequence of was subcloned from the library into vaccinia transfer plasmid, pVTKO at BamHI/Sall sites in a defined orientation. Recombinant virus was generated by transfection of pVTKO.C35 along with NotI and Apal digested V7.5/TK viral DNA into fowlpox virus infected BSC-1 cells. As described elsewhere (U.S.

-245- SUtility Patent Application No. 08/935,377; PCT/US98/24029; T Cells Specific C, for Target Antigens and Vaccines Based Thereon), this is an efficient method for construction of vaccinia virus recombinants. The C35 gene was also cloned into a retroviral vector pLXSN, and viral stocks were generated by co-transfection of OC 5 293-GP cells with pVSVg for pseudotyping. Supematants including infectious virus were collected 48 hours later.

ci Generation ofC35-specific 2C3 monoclonalantibody andFACSanalysis: Linel mouse small cell lung carcinoma cells were infected with c' and 103 2 x 104 cells were injected into three BALB/cByJ mice. Following 21 days, serum was harvested from retro-orbital bleeds and checked for reactivity with human tumor cells known to express low (MDA-MB-231) or very high (21NT) levels of C35 mRNA. Spleens were also harvested for the production of hybridomas by the fusion of spleen cells with P3 myeloma cells using standard mouse hybridoma technology. ELISA was used to screen HAT resistant clones for the presence of Ig. High producers were isotyped, quantitated, and used to screen C35+ and C35- cell lines by flow cytometry. Hybridoma clone supematants containing I ug IgG were incubatedwith 106 cells in PAB (PBS, 1% BSA, 0.1% azide) for 30 min on ice, followed by 3 washes with PAB, and incubation with goat anti-mouse IgG conjugated to FITC (Southern Biotechnology, Birmingham, AL) for 30 minutes on ice. One hybridoma clone, 2C3, recapitulated the surface staining seen with the immune serum (Figure 14) and was selected for expansion and antibody purification (BioExpress, West Lebanon, NY).

Generation of human C35-specific T cell line: Peripheral blood derived from a healthy female donor (HLA A2, 11, B35, 44) was separated into erythrocyte-rosette positive fraction (a source of total T lymphocytes) and negative fraction (a source of monocytes). The T lymphocytes were cryopreserved for later use while the monocytes were incubated under conditions to generate dendritic cells Maturation of DCs was induced as described by Bhardwaj and colleagues (Bender, A. et al., J. Immunol. Meth. 196:121-35 -246- S(1996); Reddy, A. et al., Blood 90:3640-46 (1997); Engelmayer, J. et al., J.

C, Immunology 163:6762-68 (1999)) with some modifications. hGM-CSF andhIL-4 (1000U/ml) were added every other day. At day 7, non-adherent, immature DC were incubated with a retrovirus recombinant for C35 for 6 hours in the presence 00 5 of GM-CSF and EL-4. At this point, the retroviral supernatant was washed out C and immature dendritic cells were subjected to maturation conditions, which again included GM-CSF, IL-4 as well as 12.5% monocyte conditioned medium O (MCM). After 4 days, these mature, C35-expressing DC were used to stimulate 1 autologous T cells at a ratio of 1 DC:50 T cells for a period of 14 days. A fresh pool of autologous DC were generated for restimulation of the T cells, but this time they were infected after 48 hours of maturation in MCM with a vaccinia virus recombinant for C35. Cytokines IL-2 (20 U/ml), IL-12 (20 U/ml) and IL- 18 (10 ng/ml) were added and a 1:50 ratio of DC:T cells was maintained.

Following 12 days culture, T cells were stimulated for 7 additional days with EBV-B cells infected with C35 recombinant retrovirus and with addition of IL-2 U/ml) and IL-7 (10 ng/ml). Cytokines were all purchased from R&D Systems (Minneapolis, MN). At this point, the cells were >90% CD8* and were tested for activity in a standard 51 Cr Release assay. Briefly, one million target cells were incubated with 100 uCi "Cr, washed, then incubated with CTL effectors for 4 hours in RPMI-1640, supplemented with 10% human AB serum (BioWhittaker). Activity of the CTL is expressed as the percent of specific lysis, measured as 5 Cr released into the supernatant upon lysis of labeled targets by CTL spontaneous release)/(maximal release spontaneous release).

Results Characterization of C35: The sequence of clone C35, differentially expressed in human breast tumor cells, is not homologous to any known gene in Genbank, buthomologous EST sequences (prototype Accession# W57569) were identified. Homologous human EST fragments are presentin NCI CGAP (Cancer -247- Z Genome Anatomy Project) libraries, including tumors ofbrain, lung and kidney S(A# AA954696), Soares ovary AA285089) and parathyroid tumors (A# W37432), an endometrial tumor (A#AA337071), and colon carcinoma (A# AA313422). An open reading frame was identified that encodes a 115 amino 00 5 acid protein (Figure 10A). The full-length gene was isolated from a cDNA library of the breast adenocarcinoma cell line SKBR3. Sequencing of full-length Stranscripts from the cell lines SKBR3, 21MT2-D, and H16N2 confirmed that Sthere were no point mutations in the cDNA; the transcript is 100% homologous CI in C35" cell lines, as well as C35' 0 cell lines. The C35 gene aligns on human chromosome 17q12 AC040933) and mouse chromosome 11 (A# AC064803). Exons were deduced fromhomologies with cDNA EST sequences, as well as GRAIL predictions. Interestingly, the gene for C35 is within 1000 base pairs of the Her2/neu oncogene and within 2000 bp of the gene for Growth Factor Receptor-Bound Protein 7 (GRB7), a tyrosine kinase that is involved in activating the cell cycle and that is overexpressed in esophageal carcinomas (Tanaka, S. et al., J. Clin. Invest. 102:821-27 (1998)) (Figure 10B). Her2/neu protein overexpression has been correlated with gene amplification in 30% breast tumors and is associated with poor clinical prognosis (Slamon, D.J. et al., Science 235:177-82 (1987)).

Predicted protein motifs in the C35 amino acid sequence include: casein kinase II phosphorylation sites at amino acids 38 to 41 (TYLE), 76 to 79 (SKLE), and 97 to 100 (SNGE); an N-myristoylation site at amino acids 60 to (GGTGAF); and a cAMP- and cGMP-dependent protein kinase phosphorylation site at amino acids 94 to 97 (RRAS). Finally, the C35 protein contains a prenylation motif at the COOH-terminus, amino acids 112 to 115 (CVIL). Prenylation, the covalent attachment of a hydrophobic isoprenoid moiety, is a post-translational modification that promotes membrane association and also appears to mediate protein-protein interactions (Pu, and Casey, P. Recent Progress in Hormone Research 54:315-43 (1999)). Prenylation has been shown to be required for localization and transforming potential of the

I

-248- Soncogenic Ras family proteins to the cell surface (Jackson, J.H. et al., Proc. Natl.

Acad. Sci. U.S.A. 87:3042-46 (1990); Hancock, J.F. et al., Cell 57:1167-77 (1989)). Inhibitors of prenylation have been shown to possess anti-tumor activities, such as slowing tumor growth (Garcia, A.M. et al., J. Biol. Chem.

00 5 268:18415-18 (1993)) and to promote rejection in animal models (Kohl, N.B. et g al., Nature Med. 1:792-97 (1995)). Three O-glycosylation sites are predicted at Sor near the amino terminus thr8, ser2, and ser9 using Transcript is Overexpressed in Breast and Bladder Carcinoma: An CI ideal target antigen for tumor immunotherapy would be abundantly expressed in multiple independent carcinomas, and would be absent or minimally expressed in normal proliferating and vital tissues. Differential expression of C35 was confirmed by Northern blot analysis. C35 is expressed in 7/10 human tumor cell lines at levels 10-25X higher than expression in a normal immortalized breast epithelial cell line, HI 6N2 (Figure 11A). Importantly, C35 expression is shared among lines derived from both primary (21NT, 21PT) and metastatic (21MT1, 21MT2) lesions of a single patient, suggesting its expression may be associated with early events in the process of tumor transformation. In addition, the overexpression of C35 is shared among independently derivedhuman mammary carcinoma cell lines, including SKBR3, T47D, and BT474. Interestingly, the C35 expression pattern in SKBR3, MDA MB231, H16N2 and tumors derived from the same patient correlates with Her2/neu expression, which may be associated with the close genomic proximity of the two genes and the incidence ofHER2/neu gene amplification.

To investigate whether C35 expression in patient derived tumors is clinically relevant for development of a cancer vaccine, mRNA was extracted from snap frozen human tissue samples obtained from the Cooperative Human Tissue Network (CHTN). 70% of primary breast tumor samples overexpress transcript (Figure 11B), and 35% (7/20) of these breast adenocarcinomas overexpress at levels 10-70 fold higher than normal breast Overexpression of C35 is also seen in 50% of bladder carcinoma primary specimens examined -249- S(Figure 12), while 20% (3/14) of primary bladder carcinoma express at levels greater than 10 fold higher than normal bladder. Overexpression of C35, at levels 9X or greater, was not detected in panels of ovarian prostate or colon (0/15) carcinomas (data not shown).

0o 5 2C3 Monoclonal Antibody reacts with C35+ cells: In order to confirm differential expression of the gene product encoded by C35, a monoclonal antibody against the shared tumor antigen was selected. Hybridomas were produced by immunizing mice with a poorly immunogenic BALB/cByJ tumor C, cell line, which had been transduced with a retroviral human C35 recombinant.

Hybridoma clones were screened for their ability to stain C35++ breast and bladder tumor cell lines (Figures 13A and 13B). Non-tumorigenic breast H16N2 and bladder SV-HUC epithelial cell lines did not show a significant shift in fluorescence intensity when compared to the isotype control. In contrast, 2C3 monoclonal antibody specifically stained C35+ breast tumors, SKBR3 and 21- NT-D, and bladder tumor ppT11A3. The staining was carried out on cells that were neither fixed nor permeabilized, indicating that 2C3 antibody recognizes a surface molecule.

Inhibition of tumor growth with C35 antibodies: Antibodies are useful tools to detect diagnostic markers of cancer, but they may also have potential use for therapeutic applications. Humanized Her2/neu specific antibody (Herceptin) has been successfully employed for treatment of some breast cancers. Herceptin binds HER2/neu and downregulates signal transduction from the growth factor receptor. Growth inhibition studies were performed with C35-specific 2C3 antibody. 21NT-D breast tumor and H16N2 "normal" breast cell lines were grown in vitro in the presence of various antibody concentrations. An XTT assay was performed to evaluate cell expansion at 72 hours. Results shown in Figure 14 indicate that 2C3 inhibits -250growth of 21NT tumor cells by approximately 50% at concentrations as low as C 1 ug/ml.

A C35 Class I epitope is HLA-A2 restricted: 00 Establishment of self-tolerance is a major obstacle to development of vaccines based on self proteins. Tolerance, however, must be defined in terms of quantitative levels of expression. It is possible that even while high affinity antigen-specific T cells are tolerized, T cells with lower affinity receptors that do not have functional avidity for a low concentration of antigen escape tolerance induction. These same T cells could, however, subsequentlybecome functionally significant if there is markedly increased avidity associated with overexpression of the target antigen. Even if they are few in number, such T cells could be expandedbythemost fundamental ofimmunological manipulations, vaccination.

is a self-protein expressed at low basal levels in normal human tissues. It was, therefore, necessary to determine if human T cells are tolerant to.

C35 at levels of expression characteristic of carcinomas. The only way to exclude tolerance is by demonstrating responsiveness, and the only way to demonstrate responsiveness short of a clinical trial is by in vitro stimulation.

Human T cells and autologous dendritic cells were derived from PBL from a normal donor. The T cells were primed by alternate stimulation with autologous dendritic cells infected with retroviral or pox virus recombinants of the cDNA. CTL recovered in vitro following several cycles of stimulation were analyzed for their ability to lyse C35+ target tumor cells (Figure 15) or to secrete cytokines in response to antigen induced activation (Figure 16). The targets either endogenously expressed C35 and/or HLA-A2.1, or were engineered to express these proteins via standard transfection with a mammalian expression vector, or by infection with C35-recombinant vaccinia virus. Previous studies have demonstrated that protein expression by vaccinia -251virus is an efficient means of targeting peptides to the MHC-I processing Spathway (Moss, Science 252:1662-67 (1991).

Following several rounds of stimulation, both a bulk T cell line and a T cell clone were selected that differentially lyse C35+ tumor cells relative to C35 1 00 5 H16N2 normal breast epithelial cell line in a 5 Cr release assay (Figure 15A and C The HLA-A2 restricted C35-specific CTL clone 10G3 efficiently lysed the C HLA-A2 transfected tumorigenic cell line, 21-NT.A2, which expresses 0 antigen at levels 15X greater than H16N2 and is stained with 2C3 monoclonal C1 antibody. Specific lysis was also with the HLA-A2+ bladder tumor cell line ppT11A3 compared to the non-tumorigenic bladder cell line SV-HUC from which it was derived (Figure 15B). The data demonstrate CTL sensitivity of tumors that express high levels of C35 with minimal lysis of C35 1 nontumorigenic immortalized cell lines. Importantly, the same CTL are not reactive with MEC, a primary culture of non-immortalized, non-transformed, HLA-A2' breast epithelial cells that do not express C35 at significant levels.

Further evidence to support C35+ tumor recognition by the T cells is shown in Figure 16A and B. The T cells secrete IFN-gamma and TNF-alpha in response to C35+, HLA-A2+ stimulator. Again, the non-tumorigenic, C35" cell line H16N2.A2 did not induce cytokine secretion by C35-specific T cells. However, infection of this line with vaccinia virus recombinant for C35 confers the ability to activate the T cells. Since the T cells do not secrete IFN-gamma or TNF-alpha in response to H1 6N2.A2 transduced with an irrelevant protein L3, this indicates that the response is specific to C35 protein expression (Figure 16A and B).

Following several rounds of stimulation, both a bulk T cell line and a T cell clone were selected that differentially lyse C35+, HLA-A2+ tumor cells in a 5 Cr release assay. The C35-specific CTL did not lyse the HLA-A2 transfected non-tumorigenic breast epithelial cell line, H16N2.A2 (Figure 15A and B), although this cell line does express C35 at low levels based on the Northern blot data shown in Figure 11A. However, C35-specific CTL efficiently lysed the HLA-A2 transfected tumorigenic cell line, 21-NT.A2, which expresses -252j antigen at levels 15X greater than H16N2 and is stained with 2C3 monoclonal C antibody. C35 tumor-specific lysis was also shown with the bladder tumor cell line ppT 1A3 compared to the non-tumorigenic bladder cell line SV-HUC from which it was derived. The data demonstrate CTL sensitivity of tumors that 00 5 express high levels of C35 with minimal lysis of C35 1 nontumorigenic immortalized cell lines. Importantly, the same CTL are not reactive with MEC, a primary culture of non-immortalized, non-transformed, HLA-A2* breast Sepithelial cells that do not express C35 at significant levels. Further evidence to C'I support C35+ tumor recognition by the T cells is shown in Figure 16A andB.

The T cells secrete IFN-gamma and TNF-alpha in response to C35+, HLA-A2+ stimulator. Again, the non-tumorigenic, C35 1 o cell line H16N2.A2 didnot induce cytokine secretion by C35-specific T cells. However, infection of this line with vaccinia virus recombinant for C35 confers the ability to activate the T cells.

Since the T cells do not secrete IFN-gamma or TNF-alpha in response to H16N2.A2 transduced with an irrelevant protein L3, this indicates that the response is specific to C35 protein expression.

The C35-specific T cells were generated from a donor with HLA haplotype A2, All, B8, B35. The bladder cell lines, SV-HUC and ppT11A3 derive from a donor with haplotype HLA-A2, B18, B44. However, since the H16N2 immortalized breast epithelial cell line and 21-NT and 21-MT breast tumor cell lines derived from the same HLA-A2 negative donor, these cell lines had to be transfected with HLA-A2.1 to provide a required MHC restriction element for recognition by HLA-A2 restricted 10G3 T cell clone (Figure 16A and The T cells were strongly stimulated to secrete these lymphokines by the breast lines that expressed both C35 and HLA-A2 (compare 21-MT2 with 21- MT2.wA2). The data indicate that there is at least one HLA-A2.1 defined epitope of Deletion mutants of C35 coding region were constructed to identify cDNA segments that encode the peptide epitope recognized by the CTL. Figure 15A and B demonstrates almost equivalent IFN-gammaand TNF-alphasecretion -253- Sby T cells stimulated with the full length C35 or a truncated mutant encompassing only the first 50 amino acids.

Discussion 00 C35 is a novel tumor antigen that is overexpressed in breast and bladder CO 5 carcinoma. The gene has properties that make it a promising candidate for tumor Simmunotherapy. It is expressed in a significant number of tumors derived from C different individuals. Expression in vital normal tissues is relatively low, reducing the risk of autoimmune reactions and, equally important, making it unlikely that immune cells have been rendered tolerant to the gene product is characterized as a "tumor antigen" since C35 expressing dendritic cells induce autologous tumor specific human cytotoxic T lymphocytes in vitro.

is a novel gene product of unknown function. However, our studies with monoclonal antibodies have provided some insight into the localization of the protein. Both serum and a monoclonal antibody derived from a immunized mouse specifically stainunfixed cells that express C35. This suggests that the antibody recognizes a tumor surface membrane protein. Although the protein sequence does not conform with known transmembrane motifs based on hydrophobicity, the existence of a prenylation site at the COOH terminus suggests insertion into the membrane. Prenylation is a post-translational lipid modification that produces a substantially more hydrophobic protein with high affinity for the membrane (Fu, and Casey, P. Recent Progress in Hormone Research 54:315-43 (1999)). Other proteins that contain prenylation sites include the Ras oncogene family. Ras GTPases act in signal tranduction cascades with MAPK to induce cell division and proliferation. Ras proteins are anchored to the plasma membrane via prenylation, but the proteins remain in the cytoplasmic face of the membrane. Therefore, it is possible that C35 also remains on the cytoplasmic side of the membrane, but there may be sufficient transport to the outer surface to be detected with a specific antibody.

-254antibodies are valuable tools for studying the protein C, expression of C35, to corroborate Northern blot analysis, and for use in assays such as Western blots and immunohistochemistry. In addition, these antibodies may have therapeutic benefits, such as has been recently been demonstrated for 00 5 Herceptin (Baselga, J. et al., J. Clin. Oncol. 14:737-44 (1996); Pegram, M.D. et Sal., J. Clin. Oncol. 16:2659-71 (1998)), an antibody to the tumor-associated antigen HER2-neu (c-erbB-2) (Schechter, A.L. et al., Nature 312:513-16(1984).

SHerceptin's anti-tumor effects include binding the epidermal growth factor C, receptor, which inhibits tumor cell growth, and eliciting antibody dependent cellmediated cytotoxicity (Dillman, Cancer Biotherapy Radiopharmaceuticals 14:5-10 (1999).

EXAMPLE 6 Induction of Cytotoxic T Cells Specific for Target Antigens of Tumors Human tumor-specific T cells have been induced in vitro by stimulation of PBL with autologous tumors or autologous antigen presenting cells pulsed with tumor lysates (van Der Bruggen, P. et al., Science 254: 1643-1647 (1991); Yasumura, S. et al., Cancer Res. 53: 1461-68 (1993); Yasumura, S. et al., Int.

J. Cancer 57: 297-305 (1994); Simons, J.W. et al., Cancer Res. 57: 1537-46 (1997); Jacob, L. et al., Int. J. Cancer 71:325-332 (1997); Chaux, P. et al., J.

Immunol. 163:2928-2936 (1999)). PBL have been derived from eitherpatients deliberately immunized with tumor, with tumor modified to enhance its immunogenicity, or with tumor extracts, or patients whose only prior stimulation was in the natural course of disease. T cells with reactivity for infectious agents could be similarly derived by in vitro stimulation ofT cells with autologous cells that have been either infected in vitro or were infected in vivo during the natural course of exposure to the infectious agent. CD4+ and CD8+ T cells or antibody selected under these or other conditions to be specific for either tumor cells or cells infected with either a virus, fungus or mycobacteria or T cells or antibodies -255specific for the target antigens of an autoimmune disease could be employed in the selection and screening methods of this invention to detect and isolate cDNA that encode these target antigens and that have been incorporated into a representative cDNA library.

00 5 In spite of demonstrated success in the induction of human T cell responses in vitro against a number of antigens of tumors and infected cells, it is C1 not certain that these represent the full repertoire of responses that might be O induced in vivo. Because safety considerations limit the possibilities of C1 experimental immunization in people, there is a need for an alternative animal model to explore immune responses to human disease antigens. The major obstacle to developing such a model is that numerous molecules expressed in normal human cells are strongly immunogenic in other species. It is, therefore, necessary to devise a means of inducing tolerance to normal human antigens in another species in order to reveal immune responses to any human disease-specific antigens. It is now recognized that activation of antigen-specific T lymphocytes requires two signals of which one involves presentation of a specific antigenic complex to the T cell antigen receptor and the second is an independent costimulator signal commonly mediated by interaction of the B7 family of molecules on the surface of the antigen presenting cell with the CD28 molecule on the T cell membrane. Delivery of an antigen-specific signal in the absence of a costimulator signal not only fails to induce T cell immunity but results in T cell unresponsiveness to subsequent stimulation (Lenschow, D.J. et al., Ann. Rev. Immunol. 14:233-258 (1996)). Additional studies have revealed a key role for another pair of interactions between the CD40 molecule on the antigen presenting cell and CD40 ligand on the T cell. This interaction results in upregulation of the B7 costimulator molecules (Roy, M. et al., Eur. J.

Immunol. 25:596-603 (1995)). In the presence of anti-CD40 ligand antibody either in vivo or in vitro, the interaction with CD40 is blocked, B7 costimulator is not up regulated, and stimulation with a specific antigenic complex results in T cell tolerance rather than T cell immunity (Bluestone, JA. et al., Immunol.

-256- SRev. 165:5-12 (1998)). Various protocols to block either or both CD40/CD40 CN- ligand interactions and B7/CD28 interactions have been shown to effectively induce transplantation tolerance (Larsen, C. et al., Nature 381:434-438 (1996); Kirk et al., Nature Medicine 5:686-693 (1999)). An example of the effect of 0) 5 anti-CD40 ligand antibody (anti-CD154) in blocking the reactivity of murine T c,1 cells to specific transplantation antigens is shown in FIG. 17. DBA/2 (H-2) c mice were immunized with 107 C57B1/6 (H-2b) spleen cells intraperitoneally and, in addition, were injected with either saline or 0.5 mg monoclonal ligand antibody (MRI, anti-CD154, Pharmingen 09021D) administered both at the time of immunization and two days later. On day 10 following immunization, spleen cells from these mice were removed and stimulated in vitro with either C57B/6 or control allogeneic C3H (H-2k) spleen cells that had been irradiated (20 Gy). After 5 days in vitro stimulation, C57B1/6 and C3H specific cytolytic responses were assayed at various effector.target ratios by 51 Cr release assay from specific labeled targets, in this case, either C3H or C57B1/6 dendritic cells pulsed with syngeneic spleen cell lysates. The results in FIG. 17 show that significant cytotoxicity was induced against the control C3H alloantigens in both saline and anti-CD 154 treated mice whereas a cytotoxicresponse to C57B1/6 was induced in the saline treated mice but not the anti-CD154 treated mice. This demonstrates specific tolerance induction to the antigen employed for immune stimulation at the time CD40/CD40 ligand interactions were blocked by anti-CD154.

A tolerization protocol similar to the above employing either anti-CD 154 alone or a combination of anti-CD154 and anti-B7 or anti-CD28 could be employed to induce tolerance to normal human xenoantigens in mice prior to immunization with a human tumor. In one embodiment, the normal antigens would be expressed on immortalized normal cells derived from the same individual and tissue from which a tumor cell line is derived. In another embodiment, the normal and tumor antigens would derive from cell lysates of normal and tumor tissue of the same individual each lysate pulsed onto antigen -257j presenting cells for presentation to syngeneic murine T cells both in vivo and in C, vitro. In a preferred embodiment, the tumors would derive by in vitro mutagenesis or oncogene transformation from an immortalized, contact-inhibited, anchorage-dependent, non-tumorigenic cell line so that very 00 5 well-matched non-tumorigenic cells would be available for tolerance induction.

c An alternative to the tolerization protocols is depletion ofT cells that are c- activated by normal antigens prior to immunization with tumor. Activated T Scells transiently express CD69 and CD25 with peak expression between 24 and C, 48 hours post-stimulation. T cells expressing these markers following activation with normal cells or normal cell lysates can be depleted with anti-CD69 and antibody coupled directly or indirectly to a matrix such as magnetic beads. Subsequent immunization of the remaining T cells with tumor cells or tumor cell lysates either in vitro or in vivo following adoptive transfer will preferentially give rise to a tumor-specific response.

In one embodiment, the mice to be tolerized to normal human cells or lysates and subsequently immunized with tumor cells or lysates are any of a variety of commercially available inbred and outbred strains. Because murine T cells are restricted to recognize peptide antigens in association with murine MHC molecules which are not expressed by human cells, effective tolerization or stimulation requires either transfection of human cells with murine MHC molecules or re-presentation of human normal and tumor antigens by mouse antigen presenting cells. Dendritic cells are especially preferred as antigen presenting cells because of their ability to re-present antigenic peptides in both the class I and class II MHC pathways (Huang, et al., Science 264:961-965 (1994); Inaba, et al., J. Exp. Med. 176:1702 (1992); Inaba, et aL, J. Exp. Med.

178:479-488 (1993)). In another embodiment, mice doubletransgenic forhuman HLA and human CD8 or CD4 are employed. The HLA transgene permits selection ofa high affinity, HLA-restricted T cell repertoire in the mouse thymus.

In addition, a human CD8 or CD4 transgene is required because murine CD8 and CD4 do not interact efficiently with the cognate human class I or class II MHC -258molecules. The use ofnon-transgenic mice to generate human tumor-specific T C cells would lead to identification of any human tumor antigens that can be processed in association with murine MHC molecules. Since multiple murine strains with diverse MHC molecules are available, this could encompass a wide 00 5 range of antigens. However, it would have to be separately determined by C stimulation of human T cells with autologous antigen presenting cells whether Cl these tumor-specific antigens also express peptides that can be processed and 0 presented in association with human HLA. Such peptides may or may not C' overlap with those initially detected in association with murine MHC molecules but would derive from the same set of proteins. By employing HLA transgenic mice it is possible to more directly address the relevance of antigenic peptides to human MHC. There can, however, be no assurance that peptide processing will be identical in murine and human antigen presenting cells. It is essential, therefore, to confirm that HLA-restricted, human tumor antigen-specific T cells are indeed also crossreactive on human tumor cells. Finally, no matter how the issue of processing and presentation in association with human HLA is addressed, it must in all cases be determined whether human T cells are reactive to the identified antigens or whether they have been rendered tolerant, perhaps due to expression of the same or a related antigen in some other non-homologous normal tissue. Relevant information on this point can be obtained through in vitro stimulation of human T cell responses with the identified antigens or antigenic peptides presented by autologous antigen presenting cells. Ideally, it would be shown that patients with antigen positive tumors have an increased frequency of T cells reactive with the purported tumor-specific antigen. To demonstrate that the antigen-specific human T cells induced can be effective in eradicating tumors, the selected human T cells could be adoptively transferred into SCID mice bearing a human tumor xenograft as described by Renner, C. et al., Science 264:833-835 (1994). However, definitive evidence for clinical relevance would await the results of a human clinical trial.

-259- SConditions for in vitro stimulation of primary human T cell responses are Sdescribed in Example 2 and are applicable to both CD4+ and CD8+ responses.

The strategies described for induction of human T cell or antibody responses specific for human tumors are equally applicable to induction of T cell or 00 5 antibody responses to target antigens of human cells infected with either a virus, fungus or mycobacteria Indeed, in this case the same uninfected cell population affords an immediately available normal control population for tolerance induction and to confirm infectious specificity.

The construction of transgenic mice is well known in the art and is described, for example, in Manipulating the Mouse Embroy: A laboratory Manual, Hogan, et al., Cold Spring Harbor Press, second edition (1994). Human CD8 transgenic mice may be constructed by the method of LaFace, et al., J. Exp.

Med. 182:1315-25 (1995). Construction of new lines of transgenic mice expressing the human CD8 alpha and CD8beta subunits may be made by insertion of the corresponding human cDNA into a human CD2 minigene based vector for T cell-specific expression in transgenic mice (Zhumabekov, et al., J. Immunol.

Methods 185:133-140 (1995)). HLA class I transgenic mice may be constructed by the methods of Chamberlain, et al., Proc. Natl. Acad. Sci. USA 85:7690-7694 (1988) or Bernhard, et al., J. Exp. Med. 168:1157-1162 (1988) or Vitiello, et al., J. Exp. Med. 1 73 :1007-1015 (1991) or Barra, et al., J. Immunol. 150:3681-3689 (1993).

Construction of additional HLA class I transgenic mice may be achieved by construction of an H-2Kb cassette that includes 2 kb of upstream regulatory region togetherwith the firsttwo introns previously implicatedin generegulation (Kralova, et al., 1992, EMBO J. 11: 4591-4600). Endogenous translational start sites are eliminated from this region and restriction sites for insertion of HLA cDNA are introduced into the third exon followed by a polyA addition site. By including an additional 3kb of genomic H-2Kb sequence at the 3' end of this construct, the class I gene can be targeted for homologous recombination at the H-2Kb locus in embryonic stem cells. This has the advantage that the transgene -260- Z is likely to be expressed at a defined locus known to be compatible with murine C class I expression and that these mice are likely to be deficient for possible competition by H-2Kb expression at the cell membrane. It is believed that this will give relatively reproducible expression of diverse human HLA class I cDNA oO 5 introduced in the same construct.

O

C EXAMPLE 7 SConstruction of N-Terminal and/or C-Terminal Deletion Mutants The following general approach may be used to clone a N-terminal or C-terminal deletion C35 deletionmutant. Generally, two oligonucleotideprimers of about 15-25 nucleotides are derived from the desired 5' and 3' positions of a polynucleotide of SEQ ID NO: 1. The 5' and 3' positions of the primers are determined based onthe desired C3 5 polynucleotide fragment. An initiation and stop codon are added to the 5' and 3' primers respectively, ifnecessary, to express the C35 polypeptide fragment encoded by the polynucleotide fragment.

Preferred C35 polynucleotide fragments are those encoding the candidate MHC class I and MHC class II binding peptides disclosed above in the "Polynucleotide and Polypeptide Fragments" section of the Specification.

Additional nucleotides containing restriction sites to facilitate cloning of the C35 polynucleotide fragment in a desired vector may also be added to the and 3' primer sequences. The C35 polynucleotide fragment is amplified from genomic DNA or from the cDNA clone using the appropriate PCR oligonucleotide primers and conditions discussed herein or known in the art. The polypeptide fragments encoded by the C35 polynucleotide fragments of the present invention may be expressed and purified in the same general manner as the full length polypeptides, although routine modifications may be necessary due to the differences in chemical and physical properties between a particular fragment and full length polypeptide.

-261- Z As a means of exemplifying but not limiting the present invention, the C polynucleotide encoding the C35 polypeptide fragment is amplified and cloned as follows: A 5' primer is generated comprising a restriction enzyme site followed by an initiation codon in frame with the polynucleotide sequence OC 5 encoding theN-terminal portion of an MHC bindingpeptide epitope listedin any of Tables 1 through 6. A complementary 3' primer is generated comprising a c0 restriction enzyme site followed by a stop codon in framewith the polynucleotide sequence encoding C-terminal portion of a C35 MHC binding peptide epitope listed in any of Tables 1 through 6.

The amplified polynucleotide fragment and the expression vector are digested with restriction enzymes which recognize the sites in the primers. The digested polynucleotides are then ligated together. The C35 polynucleotide fragment is inserted into the restricted expression vector, preferably in a manner which places the C35 polypeptide fragment coding region downstream from the promoter. The ligation mixture is transformed into competent E. coli cells using standard procedures and as described in the Examples herein. Plasmid DNA is isolated from resistant colonies and the identity of the cloned DNA confirmed by restriction analysis, PCR and DNA sequencing.

EXAMPLE 8 Protein Fusions of polypeptides are preferably fused to other proteins. These fusion proteins can be used for a variety of applications. For example, fusion of polypeptides to His-tag, HA-tag, protein A, IgG domains, and maltose binding protein facilitates purification. (See Example 5; see also EP A 394,827; Traunecker et al., Nature 331:84-86 (1988).) Similarly, fusion to IgG-1, IgG-3, and albumin increases the halflife time in vivo. Nuclear localization signals fused to C35 polypeptides can target the protein to a specific subcellular localization, while covalent heterodimer orhomodimers can increase or decrease -262- Sthe activity of a fusion protein. Fusion proteins can also create chimeric i molecules having more than one function. Finally, fusion proteins can increase solubility and/or stability of the fused protein comparedto the non-fused protein.

All of the types of fusion proteins described above can be made by modifying the 00 5 following protocol, which outlines the fusion of a polypeptide to an IgG N molecule.

SBriefly, the human Fc portion of the IgG molecule can be PCR amplified, Susing primers that span the 5' and 3' ends of the sequence described below.

C These primers also should have convenient restriction enzyme sites that will facilitate cloning into an expression vector, preferably a mammalian expression vector.

For example, if pC4 (Accession No. 209646) is used, the human Fe portion can be ligated into the BamHI cloning site. Note that the 3' BamHI site should be destroyed. Next, the vector containing the human Fc portion is re-restrictedwith BamHI, linearizing the vector, and C35 polynucleotide, isolated by the PCR protocol described in Example 1, is ligated into this BamHI site.

Note that the C35 polynucleotide is'cloned without a stop codon, otherwise a fusion protein will not be produced.

If the naturally occurring signal sequence is used to produce the secreted protein, pC4 does not need a second signal peptide. Alternatively, if the naturally occurring signal sequence is not used, the vector can be modified to include a heterologous signal sequence. (See, WO 96/34891.) Human IgG Fc region:

GGGATCCGGAGCCCAAATCTTCTGACAAAACTCCACACTGCCCACCGTGCCC

AGCACCTGAATTCGAGGGTGCACCGTCAGTCTTCCTCTTCCCCCCAAAACCC

AAGGACACCCTCATGATCTCCCGGACTCCTGAGGTCACATGCGTGGTGGTGG

ACGTAAGCCACGAAGACCCTGAGGTCAAGTTCAACTGGTACGTGGACGGCGT

GGAGGTGCATAATGCCAAGACAAAGCCGCGGGAGGAGCAGTACAACAGCACG

TACCGTGTGGTCAGCGTCCTCACCGTCCTGCACCAGGACTGGCTGAATGGCA

AGGAGTACAAGTGCAAGGTCTCCAACAAAGCCCTCCCAACCCCCATCGAGAA

-263-

AACCATCTCCAAAGCCAAAGGGCAGCCCCGAGAACCACAGGTGTACACCCTG

CCCCCATCCCGGGATGAGCTGACCAAGAACCAGGTCAGCCTGACCTGCCTGG

M TCAAAGGCTTCTATCCAAGCGACATCGCCGTGGAGTGGGAGAGCAATGGGCA

GCCGGAGAACAACTACAAGACCACGCCTCCCGTGCTGGACTCCGACGGCTCC

S 5 TTCTTCCTCTACAGCAAGCTCACCGTGGACAAGAGCAGGTGGCAGCAGGGGA 00 a0" *ACGTCTTCTCATGCTCCGTGATGCATGAGGCTCTGCACAACCACTACACGCA

GAAGAGCCTCTCCCTGTCTCCGGGTAAATGAGTGCGACGGCCGCGACTCTAG

AGGAT (SEQ ID NO:[84])

O

C A preferred fusion product is fusion of a C35 peptide to the amino terminus of an MHC molecule in such fashion that the peptide will naturally occupy the MHC peptide binding groove. Kang, X. et al., Cancer Res. 57:202-5 (1997) have reported that such fusion proteins can be employed in vaccine compositions that are especially effective for stimulation of specific T cells.

EXAMPLE 9 Method of Detecting Abnormal Levels of C35 in a Biological Sample polypeptides can be detected in a biological sample, and if an increased or decreased level of C35 is detected, this polypeptide is a marker for a particular phenotype. Methods of detection are numerous, and thus, it is understood that one skilled in the art can modify the following assay to fit their particular needs.

For example, antibody-sandwich ELISAs are used to detect C35 in a sample, preferably a biological sample. Wells of a microtiter plate are coated with specific antibodies to C35, at a final concentration of 0.2 to 10 ug/ml. The antibodies are either monoclonal or polyclonal. The wells are blocked so that non-specific binding of C35 to the well is reduced.

The coated wells are then incubated for 2 hours at RT with a sample containing C35. Preferably, serial dilutions of the sample should be used to -264- Svalidate results. The plates are then washed three times with saline to remove unbounded Next, 50 ul of specific antibody-alkaline phosphatase conjugate that recognizes a C35 antigenic determinant which does not overlap with that 00 5 recognized by the plate bound antibody, at a concentration of 25-400 ng, is added and incubated for 2 hours at room temperature. The plates are again washed three times with deionized or distilled water to remove unbounded conjugate.

Add 75 ul of 4-methylumbelliferyl phosphate (MUP) or p-nitrophenyl C phosphate (NPP) substrate solution to each well and incubate 1 hour at room temperature. Measure the reaction by a microtiter plate reader. Prepare a standard curve, using serial dilutions of a control sample, and plot polypeptide concentration on the X-axis (log scale) and fluorescence or absorbance on the Y-axis (linear scale). Interpolate the concentration of the in the sample using the standard curve.

EXAMPLE Formulating a Polypeptide The C35 composition will be formulated anddosedin afashion consistent with good medical practice, taking into account the clinical condition of the individual patient (especially the side effects of treatment with the polypeptide alone), the site of delivery, the method of administration, the scheduling of administration, and other factors known to practitioners. The "effective amount" forpurposes herein is thus determined by such considerations.

As a general proposition, the total pharmaceutically effective amount of administered parenterally per dose will be in the range of about 1 ug/kg/day to 10 mg/kg/day of patient body weight, although, as noted above, this will be subject to therapeutic discretion. More preferably, this dose is at least 0.01 mg/kg/day, and most preferably for humans between about 0.01 and 1 mg/kg/day. If given continuously, C35 is typically administered at a dose rate

I

-265- 3of about 1 ug/kg/hour to about 50 ug/kg/hour, either by 1-4 injections per day or c' by continuous subcutaneous infusions, for example, using a mini-pump. An intravenous bag solution may also be employed. The length of treatment needed to observe changes and the interval following treatment for responses to occur 00 5 appears to vary depending on the desired effect.

C, Pharmaceutical compositions containing C35 are administered orally, C' rectally, parenterally, intracistemally, intravaginally, intraperitoneally, topically S(as by powders, ointments, gels, drops or transdermal patch), bucally; or as an CI oral or nasal spray. "Pharmaceutically acceptable carrier" refers to a non-toxic solid, semisolid or liquid filler, diluent, encapsulating material or formulation auxiliary of any type. The term "parenteral" as used herein refers to modes of administration which include intravenous, intramuscular, intraperitoneal, intrasternal, subcutaneous and intraarticular injection and infusion.

is also suitably administered by sustained-release systems. Suitable examples of sustained-release compositions include semi-permeable polymer matrices in the form of shaped articles, films, or mirocapsules.

Sustained-release matrices include polylactides Pat. No. 3,773,919, EP 58,481), copolymers of L-glutamic acid and gamma-ethyl-L-glutamate (Sidman, U. et al., Biopolymers 22:547-556 (1983)), poly hydroxyethyl methacrylate) Langer et al., J. Biomed. Mater. Res. 15:167-277 (1981), and R. Langer, Chem. Tech. 12:98-105 (1982)), ethylene vinyl acetate Langer et al.) or poly-D-(-)-3-hydroxybutyric acid (EP 133,988). Sustained-release compositions also include liposomally entrapped C35 polypeptides. Liposomes containing the are prepared by methods known per se: DE 3,218,121; Epstein et al., Proc.

Natl. Acad. Sci. USA 82:3688-3692 (1985); Hwang et al., Proc. Natl. Acad. Sci.

USA 77:4030-4034 (1980); EP 52,322; EP 36,676; EP 88,046; EP 143,949; EP 142,641; Japanese Pat. Appl. 83-118008; U.S. Pat Nos. 4,485,045 and 4,544,545; and EP 102,324. Ordinarily, the liposomes are of the small (about 200-800 Angstroms) unilamellar type in which the lipid content is greater than 1 -266about 30 mol. percent cholesterol, the selected proportion being adjusted for the optimal secreted polypeptide therapy.

For parenteral administration, in one embodiment, C35 is formulated generally by mixing it at the desired degree of purity, in a unit dosage injectable 00 5 form (solution, suspension, or emulsion), with a pharmaceutically acceptable C carrier, one that is non-toxic to recipients at the dosages and concentrations CN employed and is compatible with other ingredients of the formulation. For Sexample, the formulation preferably does not include oxidizing agents and other C1 compounds that are known to be deleterious to polypeptide.

Generally, the formulations are prepared by contacting C35 uniformly and intimately with liquid carriers or finely divided solid carriers or both. Then, if necessary, the product is shaped into the desired formulation. Preferably the carrier is a parenteral carrier, more preferably a solution that is isotonic with the blood of the recipient Examples of such carrier vehicles include water, saline, Ringer's solution, and dextrose solution. Non-aqueous vehicles such as fixed oils and ethyl oleate are also useful herein, as well as liposomes.

The carrier suitably contains minor amounts of additives such as substances that enhance isotonicity and chemical stability. Such materials are non-toxic to recipients at the dosages and concentrations employed, and include buffers such as phosphate, citrate, succinate, acetic acid, and other organic acids or their salts; antioxidants such as ascorbic acid; low molecular weight (less than about ten residues) polypeptides, polyarginine or tripeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids, such as glycine, glutamic acid, aspartic acid, or arginine; monosaccharides, disaccharides, and other carbohydrates including cellulose or its derivatives, glucose, manose, or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; counterions such as sodium; and/or nonionic surfactants such as polysorbates, poloxamers, or PEG.

is typically formulated in such vehicles at a concentration of about 0.1 mg/ml to 100 mg/ml, preferably 1-10 mg/ml, at a pH of about 3 to 8. It will -267be understood that the use of certain of the foregoing excipients, carriers, or stabilizers will result in the formation of polypeptide salts.

used for therapeutic administration can be sterile. Sterility is readily accomplished by filtration through sterile filtration membranes 0.2 micron 00 5 membranes). Therapeutic polypeptide compositions generally are placed into a C1 container having a sterile access port, for example, an intravenous solution bag CI or vial having a stopper pierceable by a hypodermic injection needle.

O C35 polypeptides ordinarily will be stored in unit or multi-dose CI containers, for example, sealed ampoules or vials, as an aqueous solution or as a lyophilized formulation for reconstitution. As an example of a lyophilized formulation, 10-ml vials are filled with 5ml of sterile-filtered 1% aqueous polypeptide solution, and the resulting mixture is lyophilized. The infusion solution is prepared by reconstituting the lyophilized C35 polypeptide using bacteriostatic Water-for-Injection.

The invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions of the invention. Associated with such container(s) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human administration. In addition, C35 may be employed in conjunction with other therapeutic compounds.

It will be clear that the invention may be practiced otherwise than as particularly described in the foregoing description and examples. Numerous modifications and variations of the present invention are possible in light of the above teachings and, therefore, within the scope of the appended claims, the invention may be practiced otherwise than as particularly described.

The entire disclosure of each document cited (including patents, patent applications, journal articles, abstracts, laboratory manuals, books, or other NO-268-

\O

disclosures) in the Background of the Invention, Detailed Description, Examples, and Sequence Listing is hereby incorporated herein by reference.

It will be clear that the invention may be practiced otherwise than as particularly described in the foregoing description and examples. Numerous 00 modifications and variations of the present invention are possible in light of the above teachings and, therefore, within the scope of the appended claims, the ,in invention may be practiced otherwise than as particularly described.

The entire disclosure of each document cited (including patents, patent applications, journal articles, abstracts, laboratory manuals, books, or other disclosures) in the Background of the Invention, Detailed Description, Examples, and Sequence Listing is hereby incorporated herein by reference.

is Throughout this specification and the claims which follow, unless the context requires otherwise, the word "comprise", and variations such as "comprises" and "comprising", will be understood to imply the inclusion of a stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integers or steps.

The reference to any prior art in this specification is not, and should not be taken as, an acknowledgment or any form or suggestion that the prior art forms part of the common general knowledge in Australia.

I 1/07/06,ckI5817jul I speci,268

Claims (27)

1. An isolated nucleic acid molecule comprising a polynucleotide having a nucleotide sequence at least 95% identical to a sequence selected from 0 the group consisting of: 00 a polynucleotide encoding a polypeptide fragment of SEQ ID NO: I N0:2; S(c) a polynucleotide encoding a polypeptide domain of SEQ ID NO:2; a polynucleotide encoding a polypeptide epitopemain of SEQ ID NO:2; a polynucleotide encoding a polypeptide epitope of SEQ ID N NO:2; a polynucleotide encoding a polypeptide of SEQ ID NO:2 having biological activity; a polynucleotide which is a variant of SEQ ID NO: 1; a polynucleotide which is an allelic variant of SEQ ID NO: 1; a polynucleotide which encodes a species homologue of the SEQ ID NO:2; a polynucleotide capable of hybridizing under stringent conditions to any one of the polynucleotides specified in wherein said polynucleotide does not hybridize under stringent conditions to a nucleic acid molecule having a nucleotide sequence of only A residues or of only T residues.

2. The isolated nucleic acid molecule of claim 1, wherein the polynucleotide fragment comprises a nucleotide sequence encoding a mature form or a secreted protein. -270- r 3. The isolated nucleic acid molecule of claim 1, wherein the polynucleotide fragment comprises anucleotide sequence encoding the sequence identified as SEQ ID NO:2. 00 4. The isolated nucleic acid molecule of claim 1, wherein the N 5 polynucleotide fragment comprises the entire nucleotide sequence of SEQ ID NO:1. C1 5. The isolated nucleic acid molecule of claim 2, wherein the nucleotide sequence comprises sequential nucleotide deletions from either or both the C-terminus or the N-terminus.

6. The isolated nucleic acid molecule of claim 3, wherein the nucleotide sequence comprises sequential nucleotide deletions from either or both the C-terminus or the N-terminus.

7. A recombinant vector comprising the isolated nucleic acid molecule of claim 1.

8. A method of making a recombinant host cell comprising the isolated nucleic acid molecule of claim 1.

9. A recombinant host cell produced by the method of claim 8. The recombinant host cell of claim 9 comprising vector sequences.

11. An isolated polypeptide comprising an amino acid sequence at least 95% identical to a sequence selected from the group consisting of: a polypeptide fragment of SEQ ID NO:2; -271- S(b) a polypeptide fragment of SEQ ID NO:2 having biological Sactivity; a polypeptide domain of SEQ ID NO:2; a polypeptide epitope of SEQ ID NO:2; 00 5 a mature form of a secreted protein; c, a full length secreted protein; CI a variant of SEQ ID NO:2; S(h) an allelic variant of SEQ ID NO:2; or C1 a species homologue of the SEQ ID NO:2..

12. The isolated polypeptide of claim 11, wherein the mature form or the full length secreted protein comprises sequential amino acid deletions from either or both the C-terminus or the N-terminus.

13. An isolated antibody that binds specifically to the isolated polypeptide of claim 11.

14. A recombinant host cell that expresses the isolated polypeptide of claim 11. A method of making an isolated polypeptide comprising: culturing the recombinant host cell of claim 14 under conditions such that said polypeptide is expressed; and recovering said polypeptide.

16. The polypeptide produced by claim -272- Z 17. A method for preventing, treating, or ameliorating a medical C condition which comprises administering to a mammalian subject a therapeutically effective amount of the polypeptide of claim 11 or of the polynucleotide of claim 1 or of the antibody of claim 13. 00 C 18. A method of diagnosing a pathological condition or a susceptibility to a pathological condition in a subject related to expression or Sactivity of a secreted protein comprising: I determining the presence or absence of a mutation in the polynucleotide of claim 1; diagnosing a pathological condition or a susceptibility to a pathological condition based on the-presence or absence of said mutation.

19. A method of diagnosing a pathological condition or a susceptibility to a pathological condition in a subject related to expression or activity of a secreted protein comprising: determining the presence or amount of expression of the polypeptide of claim 11 in a biological sample; diagnosing a pathological condition or a susceptibility to a pathological condition based on the presence or amount of expression of the polypeptide. A method for identifying binding partner to the polypeptide of claim 11 comprising: contacting the polypeptide of claim 11 with abinding partner, and determining whether the binding partner effects an activity of the polypeptide. -273-

21. The gene corresponding to the cDNA sequence of SEQ IDNO: 1.

22. A method of identifying an activity in a biological assay, wherein the method comprises: 00 expressing SEQ ID NO:1 in a cell; N 5 isolating the supernatant; CN detecting an activity in a biological assay; and 0 identifying the protein in the supernatant having the activity.

23. The product produced by the method of claim 22.

24. An isolated nucleic acid molecule comprising a polynucleotide having a nucleotide sequence at least 95% identical to a sequence selected from the group consisting of: a polynucleotide fragment of SEQ ID NO: 1; apolynucleotideencoding apolypeptide fragmentofSEQ ID NO:2; a polynucleotide encoding a polypeptide domain of SEQ ID NO:2; a polynucleotide encoding a polypeptide epitope of SEQ ID NO:2; a polynucleotide encoding a polypeptide of SEQ ID NO:2 having biological activity; a polynucleotide which is a variant of SEQ ID NO:2XXXXX]; a polynucleotide which is an allelic variant of SEQ ID NO:1; a polynucleotide which encodes a species homologue of the SEQ ID NO:2; -274- a polynucleotide capable of hybridizing under stringent conditions to any one of the polynucleotides specified in wherein said polynucleotide does not hybridize under stringent conditions to a nucleic acid molecule having a nucleotide sequence of only A residues or of only T residues. 00 C- 5

25. An isolated polypeptide comprising an amino acid sequence at least 95% identical to a sequence selected from the group consisting of: 0 a polypeptide fragment of SEQ ID NO:2; cI apolypeptide fragment ofSEQ IDNO:2 having biological activity; a polypeptide domain of SEQ ID NO:2; a polypeptide epitope of SEQ ID NO:2; a mature form of a secreted form of SEQ ID No:2; a full length secreted form of SEQ ID NO:2; a variant of SEQ ID NO:2; an allelic variant of SEQ ID NO:2; or a species homologue of the SEQ ID NO:2.

26. A method for tumor diagnosis in an individual comprising assaying the expression level of the gene encoding the C35 protein in cells or body fluid of the individual and comparing the gene expression level with a standard C35 gene expression level, whereby an increase in the gene expression level over the standard is indicative of malignant tumor.

27. The method of claim 26, wherein said tumor is human breast carcinoma.

28. A pharmaceutical composition comprising the isolated polypeptide of claim 11, in combination with a pharmaceutically acceptable carrier. -275-

29. an adjuvant The pharmaceutical composition of claim 28, further comprising A method for generating immune responses in a host comprising administering the pharmaceutical composition of claim 28 or claim 29 to said host

31. The method of claim 30, wherein said host is a human.

32. A method for generating specific antibodies and/or T-cells in a host comprising introducing a sufficient amount of a virus vector into said host to stimulate production of specific antibodies and/or T cells, wherein said virus vector contains a polynucleotide encoding a C35 antigen operably linked to a promoter capable of expression in said host.

33. The method of claim 32, wherein said host is human.

34. The method of claim 33, wherein said antibodies and/or T-cells are specific for human carcinoma. The method of claim 32, wherein said virus vector is vaccinia virus.

36. The method of claim 32, wherein said virus vector is live.

37. The method of claim 32, wherein said virus vector is attenuated. DATED this 11 t h day of July 2006 UNIVERSITY OF ROCHESTER By their Patent Attorneys: CALLINAN LAWRIE