AU2005289372B2 - Variants of hepatitis B virus with resistance to anti-viral nucleoside agents and applications thereof - Google Patents
Variants of hepatitis B virus with resistance to anti-viral nucleoside agents and applications thereof Download PDFInfo
- Publication number
- AU2005289372B2 AU2005289372B2 AU2005289372A AU2005289372A AU2005289372B2 AU 2005289372 B2 AU2005289372 B2 AU 2005289372B2 AU 2005289372 A AU2005289372 A AU 2005289372A AU 2005289372 A AU2005289372 A AU 2005289372A AU 2005289372 B2 AU2005289372 B2 AU 2005289372B2
- Authority
- AU
- Australia
- Prior art keywords
- hbv
- tdf
- lmv
- variant
- dna polymerase
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Description
WO 2006/034545 PCT/AU2005/001489 Variants of Hepatitis B virus with resistance to anti-viral nucleoside agents and applications thereof BACKGROUND OF THE INVENTION 5 FIELD OF THE INVENTION The present invention relates generally to viral variants exhibiting reduced sensitivity to particular agents and/or reduced interactivity with immunological reagents. More particularly, the present invention is directed to hepatitis B virus (HBV) variants exhibiting 10 complete or partial resistance to nucleoside or nucleotide analogs or other antagonists of HBV DNA polymerase activity and/or reduced interactivity with antibodies to viral surface components including reduced sensitivity to these antibodies. The present invention further contemplates assays for detecting such viral variants, which assays are useful in monitoring anti-viral therapeutic regimens and in developing new or modified vaccines 15 directed against viral agents and in particular the resistant HBV variants of the present invention. The present invention also contemplates the use of the viral variants to screen for agents capable of inhibiting infection, replication and/or release of the virus. DESCRIPTION OF THE PRIOR ART 20 Bibliographic details of the publications referred to by author in this specification are collected at the end of the description. The reference to any prior art in this specification is not, and should not be taken as, an 25 acknowledgment or any form of suggestion that that prior art forms part of the common general knowledge in any country. Specific mutations in an amino acid sequence are represented herein as 'XaainXaa 2 ' where Xaai is the original amino acid residue before mutation, n is the residue number and Xaa 2 30 is the mutant amino acid. The abbreviation 'Xaa' may be the three letter or single letter (i.e. 'X') code. The amino acid residues for Hepatitis B virus DNA polymerase are WO 2006/034545 PCT/AU2005/001489 -2 numbered with the residue methionine in the motif Tyr Met Asp Asp (YMDD) being residue number 204 (Stuyver et al., Hepatology 33: 751-757, 2001). The amino acid residues for hepatitis B virus surface antigen are number according to Norder et al. (J. Gen. Virol. 74: 341-1348, 1993). 5 The term nucleoside analogs has been used in reference to both nucleotide and nucleoside analogs. Hepatitis B virus (HBV) can cause debilitating disease conditions and can lead to acute 10 liver failure. HBV is a DNA virus which replicates via an RNA intermediate and utilizes reverse transcription in its replication strategy (Summers and Mason, Cell 29: 403-415, 1982). The HBV genome is of a complex nature having a partially double-stranded DNA structure with overlapping open reading frames encoding surface, core, polymerase and X genes. The complex nature of the HBV genome is represented in Figure 1. The polymerase 15 consists of four functional regions, the terminal protein (TP), spacer, reverse transcriptase (rt) and ribonuclease (RNAse). The polymerase gene of HBV overlaps the envelope gene, mutations in the catalytic domain of the polymerase can affect the amino acid sequence of the envelope protein and 20 vice versa. In particular, the genetic sequence for the neutralization domain of HBV known as the 'a' determinant, which is found within the HBsAg and located between amino acids 99 and 169, actually overlaps the major catalytic regions of the viral polymerase protein and in particular domains A and B. 25 The presence of an HBV DNA polymerase has led to the proposition that nucleoside and nucleotide analogs could act as effective anti-viral agents. Examples of nucleoside analogs currently being tested are penciclovir and its oral form (FAM or FCV) [Vere Hodge, Antiviral Chem Chemother 4: 67-84, 1993; Boyd et al., Antiviral Chem Chemother. 32: 358-363, 1987; Kruger et al., Hepatology 22: 219A, 1994; Main et al., J. Viral Hepatitis 3: 30 211-215, 1996] Lamivudine[(-)-B-2'-deoxy-3'-thiacytidine; (3TC or LMV) [Severini et al., Antimicrobial Agents Chemother 39: 1430-1435, 1995; Dienstag et al., New England J Med 333: 1657-1661, 1995]. New nucleoside analogs which have already progressed to WO 2006/034545 PCT/AU2005/001489 -3 clinical trials include the pyriamidines Emtricitabine, ((-)-B-L-2'-3'-dideoxy-5-fluoro-3' thiacydidine; FTC), the 5-fluoro derivative of 3TC, and Clevudine (1-(2-fluoro-5-methyl B-L-arabino-furanosyl) uracil; L-FMAU), a thymidine analog. Like 3TC, these are pyrimidine derivatives with an unnatural "L"- configuration. Several purine derivatives 5 have also progressed to clinical trials; they include Entecavir (BMS-200,475; ETV), a carbocyclic deoxyguanosine analog, diaminopurine dioxolane (DAPD), an oral pro-drug for dioxolane guanine ((-)-B-D-2-aminopurine dioxolane; DXG) and Adefovir dipivoxil, an oral prodrug for the acyclic deoxyadenosine monophosphate nucleoside analog Adefovir (9-[phosphonyl-methoxyethyl]-adenine; PMEA). Tenofovir disoproxil fumarate (TDF) has 10 activity against HBV in vitro [Lada 0 et al., Antivir Ther. ;9:353-63, 2004] . TDF has been approved for the treatment of HIV and has been used in co-infected HIV- HBV patients for the treatment of both HBV and HIV. Whilst these agents are highly effective in inhibiting HBV DNA synthesis, there is the 15 potential for resistant mutants of HBV to emerge during long term antiviral chemotherapy. In patients on prolonged LMV therapy key resistance mutations are selected in the rt domain within the polymerase at rtM204I/V +/- rtL1 80M. The nomenclature used for the polymerase mutations is in accordance with that proposed by Stuyver et al., 2001, supra. Only LMV and ADV have been approved for use against chronic HBV infection. LMV 20 and ADV are both potent inhibitors of HBV replication and reduce HBV DNA viral load. Unfortunately, both LMV-resistant and ADV-resistant strains of HBV are selected during therapy. HIV and HBV are both blood borne viruses and have similar potential routes of 25 transmission. Approximately 10% of HIV infected individuals are co-infected with HBV. The improved prognosis of HIV-infection that has occurred since the introduction of highly active antiretroviral therapy (HAART) has resulted in renewed emphasis being placed on co-morbidities associated with HIV-infection, and chronic viral hepatitis in particular. Hepatitis B virus (HBV) infection is an important infection in HIV-1 infected 30 individuals because of the influence of HIV-1 co-infection on the natural history of HBV infection. Antiviral therapies with activity against both viruses have enabled targeted WO 2006/034545 PCT/AU2005/001489 -4 therapy in co-infected individuals. However, antiviral resistance is an important issue for both HIV and HBV. TDF is also a potent inhibitor of HBV replication. TDF has activity against both 5 hepadnaviruses and HIV. TDF was formerly referred to as bis-POC PMPA the oral derivative of 9-[(R)-2-(phosphonomethoxy)propyl]adenine (PMPA) [Shaw JP et al., Pharm Res. 14(12):1824-9, 1997]. Preclinical studies demonstrate that TDF is a highly potent inhibitor of HBV in vitro and is effective against the LMV resistant viruses [Ying C et al., J Viral Hepat. 7(2):161-5, 2000]. TDF has been used successfully to treat patients 10 with the LMV resistant HBV mutations. No specific TDF resistant mutations had been described for HBV. Nucleoside or nucleotide analog therapy may be administered as monotherapy or combination therapy where two or more nucleoside or nucleotide analogs may be 15 administered. There is a need to monitor for development of nucleoside-/nucleotide resistant variants of HBV as well as variants resistant to other HBV DNA polymerase antagonists and variants resistant to antibodies to HBV surface components. The rapid identification can lead to altered therapeutic protocols being pursued. In addition, resistant HBV variants are useful as targets for screening of new antiviral agents.
WO 2006/034545 PCT/AU2005/001489 -5 SUMMARY OF THE INVENTION Throughout this specification, unless the context requires otherwise, the word "comprise", or variations such as "comprises" or "comprising", will be understood to imply the 5 inclusion of a stated element or integer or group of elements or integers but not the exclusion of any other element or integer or group of elements or integers. Nucleotide and amino acid sequences are referred to by a sequence identifier number (SEQ ID NO:). The SEQ ID NOs: correspond numerically to the sequence identifiers <400>1, 10 <400>2, etc. A sequence listing is provided after the claims. The positions of nucleotide and amino acid mutations identified using nomenclature from genotypes B, C or F where the methionine residue in the YMDD motif of the DNA polymerase was designated position 550 (see Australian Patent No. 734831). The 15 nucleotide and amino acid positions given in the present specification are based on a new nomenclature where the methionine residue is YMDD is position 204 and is referred to as rtM204 where rt is an abbreviation for "reverse transcriptase". In accordance with the present invention, HBV resistant variants were identified in two 20 patients (patient A and patient B) with chronic hepatitis B and HIV, treated with both LMV and TDF. In combination therapy, accordance with the present invention, resistant variants of HBV were identified, following LMV and TDF treatment, with mutations in the HBV DNA polymerase gene which reduce the sensitivity of HBV to nucleoside and nucleotide analogs. The identification of these HBV variants is important for the 25 development of assays to monitor LMV and/or TDF resistance and/or resistance to other nucleoside or nucleotide analog therapeutic regimes and to screen for agents which are useful as alternative therapeutic agents. The mutations detected in the HBV isolated from patients A and B were the LMV resistant mutations namely the rtV173L+rtL180M + rtM204V in association with a unique mutation at rtA194T. 30 The detection of such HBV variants is particularly important in the management of therapeutic protocols including the selection of appropriate agents for treating HBV WO 2006/034545 PCT/AU2005/001489 -6 infection. The method of this aspect of the present invention is predicated in part on monitoring the development in a subject of an increased HBV load in the presence of a nucleoside or nucleotide analog and/or the presence of antibodies to viral surface components. The clinician is then able to modify an existing treatment protocol or select an 5 alternative treatment protocol accordingly. In addition, the present invention encompasses HBV variants obtained from subjects following exposure to LMV and/or TDF but which are still sensitive to one or both of LMV and/or TDF. Such variants may exhibit resistance to other nucleoside or nucleotide analogs and/or to antibodies to viral surface components. 10 One aspect of the present invention, therefore, is directed to an isolated HBV variant comprising a nucleotide mutation in a gene encoding a DNA polymerase resulting in at least one amino acid addition, substitution and/or deletion to the DNA polymerase and which exhibits decreased sensitivity to TDF and/or LMV and optionally, in addition or alternatively, other nucleoside or nucleotide analogs, other HBV DNA polymerase 15 antagonists and/or or immunological reagents. In this regard, exposure of a patient to TDF and/or LMV may result in the selection of an HBV variant which exhibits resistance or reduced sensitivity to a nucleoside or nucleotide analog other than TDF or LMV or to an immunology reagent such as an antibody to an HBV surface antigen. Preferably, the DNA polymerase exhibits reduced sensitivity to TDF, or and LMV. The variant HBV comprises 20 a mutation in an overlapping open reading frame in its genome in a region defined by one or more of domains F and A through E of HBV DNA polymerase. The present invention further contemplates a method for determining the potential for an HBV to exhibit reduced sensitivity to TDF and/or LMV or optionally, in addition or 25 alternatively, other nucleoside or nucleotide analogs, other HBV DNA polymerase antagonists and/or immunological reagents by isolating DNA or corresponding mRNA from the HBV and screening for a mutation in the nucleotide sequence encoding HBV DNA polymerase resulting in at least one amino acid substitution, deletion and/or addition in any one or more of domains F and A through E or a region proximal thereto of the DNA 30 polymerase and associated with resistance or decreased sensitivity to TDF and/or LMV. The presence of such a mutation is an indication of the likelihood of resistance to said WO 2006/034545 PCT/AU2005/001489 -7 entecavir and/or LMV. Preferably, the HBV variant exhibits reduced sensitivity to TDF, or both TDF and LMV. The present invention also provides a composition comprising a variant HBV resistant to 5 TDF and/or LMV and optionally, in addition or alternatively, other nucleoside or nucleotide analogs, other HBV DNA polymerase antagonists and/or immunological reagents or a recombinant or derivative form thereof or its chemical equivalent and one or more pharmaceutically acceptable carriers and/or diluents. Yet another aspect of the present invention provides a use of the aforementioned composition or a variant HBV 10 comprising a nucleotide mutation in a gene encoding a DNA polymerase resulting in at least one amino acid addition, substitution and/or deletion to the DNA polymerase and a decreased sensitivity to TDF and/or LMV and optionally in addition or alternatively other nucleoside or nucleotide analogs or other HBV DNA polymerase antagonists or immunological reagents in the manufacture of a medicament for the treatment and/or 15 prophylaxis of HBV infection. The present invention also contemplates a method for determining whether an HBV strain exhibits reduced sensitivity to a nucleoside or nucleotide analog, or other HBV DNA polymerase antagonist by isolating DNA or corresponding mRNA from the HBV and 20 screening for a mutation in the nucleotide sequence encoding the DNA polymerase wherein the presence of the following mutations in the rt region: rtV173L, rtLl180M, rtA194T and rtM204V or combinations thereof or an equivalent one or more other mutation is indicative of a variant which exhibits a decreased sensitivity to TDF and/or LMV and optionally other nucleoside or nucleotide analogs and/or other HBV DNA 25 polymerase antagonists and/or an immunological reagent. The subject method may also be practiced by screening for a mutation in the nucleotide sequence encoding the DNA polymerase wherein the presence of the following mutations in the B or C domain of the rt region: rtVl73L, rtLl80M, rtAl94T and rt M204V or 30 combinations thereof or an equivalent one or more other mutations is indicative of a variant which exhibits a decreased sensitivity to TDF and/or LMV and optionally other WO 2006/034545 PCT/AU2005/001489 -8 nucleoside or nucleotide analogs, or other HBV DNA polymerase antagonists and/or an immunological reagent. It should be noted that mutants, rtVl73L, rtL180M and rtM204V correspond to mutants, 5 V519L, L526M, and M550V, respectively in Australian Patent No. 734831 (using an earlier nomenclature system). Still a ftirther methodology comprises screening for a mutation in the nucleotide sequence encoding the envelope genes wherein the presence of the following mutations in the PreS 1, 10 PreS2 and S genes (changes in the overlapping reverse transcriptase region are indicated in parenthesis): sE164D (= rtV173L), sS193L (no change), sIl95M (= rtM204V), combinations thereof or an equivalent one or more other mutation is indicative of a variant which exhibits a decreased sensitivity to TDF and/or LMV and optionally other nucleoside or nucleotide analogs, or other HBV DNA polymerase antagonists and/or an 15 immunological reagent. Another aspect of the present invention is directed to a variant HBV comprising a surface antigen having an amino acid sequence with a single or multiple amino acid substitution, addition and/or deletion or a truncation compared to a surface antigen from a reference or 20 wild type HBV and wherein an antibody generated to the reference or wild type surface antigen exhibits an altered immunological profile relative to said HBV variant. One altered profile includes a reduced capacity for neutralizing the HBV. More particularly, the surface antigen of the variant HBV exhibits an altered immunological profile compared to a pre-treatment HBV where the variant HBV is selected for by a nucleoside or nucleotide 25 analog or other antagonist of the HBV DNA polymerase. The variant HBV of this aspect of the invention may also comprise a nucleotide sequence comprising a single or multiple nucleotide substitution, addition and/or deletion compared to a pre-treatment HBV. The present invention extends to an isolated HBsAg or a recombinant form thereof or 30 derivative or chemical equivalent thereof corresponding to the variant HBV. Generally, the HBsAg or its recombinant or derivative form or its chemical equivalent comprises an amino acid sequence with a single or multiple amino acid substitution, addition and/or WO 2006/034545 PCT/AU2005/001489 -9 deletion or a truncation compared to an HBsAg from a reference HBV and wherein an antibody directed to a reference HBV exhibits an altered immunological profile to an HBV carrying said variant HBsAg. In one embodiment, the altered immunological profile comprises a reduction in the ability to neutralize the variant HBV. 5 The present invention is predicated in part on the identification and isolation of variants of HBV that have a plurality of mutations and exhibit two or more characteristics selected from decreased or reduced sensitivity to one or more nucleoside or nucleotide analogs or other HBV DNA polymerase antagonist, a reduced level and/or functional activity of 10 Hepatitis Be antigen, or a reduced, abrogated or otherwise impaired immunological interactivity, relative to wild-type HBV. Thus, the identification of HBV variants with these mutational patterns is important inter alia for the development of assays to detect HBV variants and assays to screen for agents which are useful in treating and/or preventing infections by those variants and/or other HBV isolates and for the development 15 of alternative therapeutic regimes for managing HBV infections. Accordingly, one aspect of the present invention is directed to an isolated HBV variant comprising a plurality of nucleotide mutations that correlate with at least two characteristics selected from (a) resistance to one or more nucleoside analogs, (b) a 20 reduced level and/or functional activity of Hepatitis Be antigen, or (c) a reduced, abrogated or otherwise impaired immunological interactivity. Another aspect of the present invention contemplates an isolated HBV variant comprising a plurality of nucleotide mutations that correlate with (a) resistance to one or more 25 nucleoside or nucleotide analogs or other antagonists of HBV DNA polymerase activity, (b) a reduced level and/or functional activity of Hepatitis Be antigen, and (c) a reduced, abrogated or otherwise impaired immunological interactivity. Yet another aspect of the present invention provides an isolated HBV variant comprising a 30 plurality of nucleotide mutations selected from two or more of (a) a nucleotide mutation in a gene encoding a DNA polymerase resulting in at least one amino acid addition, substitution and/or deletion to said DNA polymerase wherein said variant exhibits WO 2006/034545 PCT/AU2005/001489 -10 decreased sensitivity to TDF and/or LMV and optionally other nucleoside or nucleotide analogs or other antagonists of HBV DNA polymerase activity, (b) a nucleotide mutation in a gene encoding a Hepatitis Be antigen or in a transcriptional control element of said gene wherein said mutation results in a reduced level and/or functional activity of said 5 Hepatitis Be antigen, or (c) a nucleotide mutation in a gene encoding a hepatitis B polypeptide resulting in at least one amino acid addition, substitution and/or deletion to said polypeptide which reduces, abrogates or otherwise impairs its immunological interactivity. 10 Another aspect of the present invention contemplates a method for detecting an agent which exhibits inhibitory activity to an HBV by generating a genetic construct comprising a replication competent-effective amount of the genome from the HBV contained in a plasmid vector and then transfecting said cells with said construct, contacting the cells, before, during and/or after transfection, with the agent to be tested, culturing the cells for a 15 time and under conditions sufficient for the HBV to replicate, express genetic sequences and/or assemble and/or release virus or virus-like particles if resistant to said agents; and the subjecting the cells, cell lysates or culture supernatant fluid to viral- or viral component-detection means to determine whether or not the virus has replicated, expressed genetic material and/or assembled and/or been released in the presence of the agent. In a 20 preferred embodiment, the plasmid vector in a baculovirus vector and the method comprises generating a genetic construct comprising a replication competent-effective amount of the genome from the HBV contained in or fused to an amount of a baculovirus genome effective to infect cells and then infecting said cells with said construct, contacting the cells, before, during and/or after infection, with the agent to be tested, culturing the 25 cells for a time and under conditions sufficient for the HBV to replicate, express genetic sequences and/or assemble and/or release virus or virus-like particles if resistant to said agent and then subjecting the cells, cell lysates or culture supernatant fluid to viral- or viral-component-detection means to determine whether or not the virus has replicated, expressed genetic material and/or assembled and/or been released in the presence of the 30 agent.
WO 2006/034545 PCT/AU2005/001489 - 11 In an alternative embodiment, the method comprises generating a continuous cell line comprising an infectious copy of the genome of the HBV in a replication competent effective amount such that said infectious HBV genome is stably integrated into said continuous cell line such as but not limited to 2.2.15 or AD, contacting the cells with the 5 agent to be tested, culturing the cells for a time and under conditions sufficient for the HBV to replicate, express genetic sequences and/or assemble and/or release virus or virus like particles if resistant to the agent and then subjecting the cells, cell lysates or culture supernatant fluid to viral- or viral-component-detection means to determine whether or not the virus has replicated, expressed genetic material and/or assembled and/or been released 10 in the presence of the agent. In an alternative embodiment, the present invention also contemplate a method for detecting an agent which exhibits inhibitory activity to an HBV polymerase in an in vitro polymerase assay. The HBV polymerase activity can be examined using established assays 15 (Gaillard et al., Antimicrob Agents Chemother. 46(4): 1005-1013, 2002; Xiong et al., Hepatology. 28(6): 1669-73, 1998). The HBV polymerase may be a wild-type or reference HBV polymerase or mutant HBV polymerase. In connection with these methods, the plasmid vector may include genes encoding part or 20 all of other viral vectors such as baculovirus vectors or adenovirus vectors (see Ren and Nassal, J. Virol. 75(3): 1104-1116, 2001). The identification of viral variants enables the production of vaccines comprising particular recombinant viral components such as polymerases or envelope genes PreS 1, 25 PreS2, S encoding for L, M, S proteins as well as therapeutic vaccines comprising defective HBV variants. Rational drug design may also be employed to identify or generate therapeutic molecules capable of interacting with a polymerase or envelope genes PreS1, PreS2, S encoding for L, M, S proteins or other component of the HBV. Such drugs may also have diagnostic potential. 30 The abbreviations defined in Table 1 are used in the subject specification WO 2006/034545 PCT/AU2005/001489 -12 TABLE 1 Abbreviations ABBREVIATION DESCRIPTION 3TC (LMV); (-)-B-2'-deoxy-3'-thiacytidine ADV Adefovir DAPD diaminopurine dioxolane DDI Didanosine DXG dioxolane guanine ETV Entecavir FAM Famciclovir FTC Emtricitabine HBsAg hepatitis B surface antigen HBV hepatitis B virus HIV human immunodeficiency virus LMV Lamividuine LPV/r Lopinavir/ritonavir nt nucleotide PMEA Adefovir PMPA 9- [(R)-2-(phosphonomethoxy)propyl]adenine RNAse Ribonuclease rt reverse transcriptase TDF Tenofovir disoproxil fumarate YMDD Tyr Met Asp Asp-a motif in the polymerase protein; where the Met residue is designated residue number 204 of the reverse transcriptase 5 A summary of sequence identifiers used throughout the subject specification is provided in Table 2.
WO 2006/034545 PCT/AU2005/001489 - 13 TABLE 2 Summary of sequence identifiers SEQUENCE ID NO: DESCRIPTION 1 primer 1 forward 2 primer 2 forward 3 primer 3 reverse 4 primer 4 reverse 5 Patient A HBV nucleotide (nt) sequence encoding catalytic region of DNA polymerase Week 0 (Figure 3) 6 Patient A HBV amino acid sequence of catalytic region of DNA polymerase Week 0 (Figure 4) 7 Patient A HBV amino acid sequence of surface antigen (HBsAg) Week 0 (Figure 5) 8 Patient A HBV nt sequence of encoding catalytic region of DNA polymerase Week 48 (Figure 6) 9 Patient A HBV amino acid sequence of catalytic region of DNA polymerase gene Week 48 (Figure 7) 10 Patient A HBV amino acid sequence of surface antigen (HBsAg) Week 48 (Figure 8) 11 Patient A HBV nt sequence of encoding catalytic region of DNA polymerase Week 62 (Figure 9) 12 Patient A HBV amino acid sequence of catalytic region of DNA polymerase gene Week 62 (Figure 10) 13 Patient A HBV amino acid sequence of surface antigen (HBsAg) Week 62 (Figure 11) 14 Patient B HBV nt sequence of encoding catalytic region of DNA polymerase Week 77 (Figure 12) 15 Patient B HBV amino acid sequence of catalytic region of DNA polymerase gene Week 77 (Figure 13) WO 2006/034545 PCT/AU2005/001489 -14 SEQUENCE ID NO: DESCRIPTION 16 Patient B HBV amino acid sequence of surface antigen (HbsAg) Week 77 (Figure 14) 17 rtM204V forward primer 18 rtM204V reverse primer 19 rt180 forward primer 20 rt180 reverse primer 21 A194T forward primer 22 Al 94T reverse primer 23 3FL-XHybprobe probe 24 5LC-XHybprobe probe 25 X sense probe 26 X antisense probe WO 2006/034545 PCT/AU2005/001489 - 15 BRIEF DESCRIPTION OF THE FIGURES Figure 1 is a diagrammatic representation showing the partially double stranded DNA HBV genome showing the overlapping open reading frames encoding surface (S), core 5 (C), polymerase (P) and X gene. Figure 2 is a diagrammatic representation of a computer system for determining the potency value (PA) of a variant HBV. 10 Figure 3 is a representation showing the HBV nucleotide sequence encoding the catalytic region of the polymerase gene from Patient A at week 0 of TDF treatment. Figure 4 is a representation showing the deduced amino acid sequence of the catalytic region of the polymerase gene from Patient A at week 0 of TDF treatment. 15 Figure 5 is a representation showing the deduced amino acid sequence of the envelope gene from Patient A week 0 of TDF treatment. Figure 6 is a representation showing the HBV nucleotide sequence encoding the catalytic 20 region of the polymerase gene from Patient A at week 48 of TDF treatment. Figure 7 is a representation showing the deduced amino acid sequence of the catalytic region of the polymerase gene from Patient A at week 48 of TDF treatment. 25 Figure 8 is a representation showing the deduced amino acid sequence of the envelope gene from Patient A week 48 of TDF treatment. Figure 9 is a representation showing the HBV nucleotide sequence encoding the catalytic region of the polymerase gene from Patient A at week 62 of TDF treatment. 30 Figure 10 is a representation showing the deduced amino acid sequence of the catalytic region of the polymerase gene from Patient A at week 62 of TDF treatment.
WO 2006/034545 PCT/AU2005/001489 -16 Figure 11 is a representation showing the deduced amino acid sequence of the envelope gene from Patient A week 62 of TDF treatment. 5 Figure 12 is a representation showing the HBV nucleotide sequence encoding the catalytic region of the polymerase gene from Patient B at week 77 of TDF treatment. Figure 13 is a representation showing the deduced amino acid sequence of the catalytic region of the polymerase gene from Patient B at week 77 of TDF treatment. 10 Figure 14 is a representation showing the deduced amino acid sequence of the envelope gene from Patient B week 77 of TDF treatment. Figure 15 is a diagrammatic representation of the HBV polymerase. Residue aa194 from 15 the wild type is highlighted in Fig. 15b. Residue aal94T is highlighted in Fig. 15c. Figure 16 is a diagrammatic representation of the chemical structure of TDF. Figure 17 is a graphical representation showing HBV DNA version TDF treatment in (a) 20 Patient A and (b) Patient B.
WO 2006/034545 PCT/AU2005/001489 -17 DETAILED DESCRIPTION OF THE PRESENT INVENTION The present invention is predicated in part on the identification and isolation of nucleoside or nucleotide analog resistant variants of HBV or variants resistant to other DNA 5 polymerase antagonists or immunological reagents which bind to a surface compound of HBV following treatment of patients with TDF or LMV or TDF and LMV and optionally other nucleoside or nucleotide analogs. In particular, TDF, or TDF and LMV treated patients gave rise to variants of HBV exhibiting decreased or reduced sensitivity to TDF and/or LMV. Reference herein to "decreased" or "reduced" in relation to sensitivity to 10 TDF and/or LMV includes and encompasses a complete or substantial resistance to the nucleoside or nucleotide analog as well as partial resistance and includes a replication rate or replication efficiency (yield phenotype) which is more than a wild-type in the presence of a nucleoside or nucleotide analog or other DNA polymerase antagonist. In one aspect, this is conveniently measured by an increase in viral load to a level similar or greater than 15 pre-treatment levels. Accordingly, one aspect of the present invention is directed to an isolated HBV variant wherein said variant comprises a nucleotide mutation in a gene encoding a DNA polymerase resulting in at least one amino acid addition, substitution and/or deletion to 20 said DNA polymerase and wherein said variant exhibits decreased sensitivity to TDF and/or LMV and optionally other nucleoside or nucleotide analogs, or other HBV DNA polymerase antagonists and/or an immunological reagent. In a related aspect, the present invention provides an isolated Hepatitis B virus (HBV) 25 variant wherein said variant comprises a nucleotide mutation in a gene encoding a DNA polymerase resulting in at least one amino acid addition, substitution and/or deletion to said DNA polymerase and wherein said variant either exhibits decreased sensitivity to one or more of TDF and/or LMV or is selected following exposure to one or both of TDF and/or LMV. 30 Preferably, the decreased sensitivity is in respect of TDF, or both TDF and LMV. Alternatively or in addition, the decreased sensitivity is in respect of a nucleoside or WO 2006/034545 PCT/AU2005/001489 -18 nucleotide analog other than TDF or LMV and/or may be in respective of an immunological reagent such as an antibody to a surface compound of HBV. In addition to a mutation in the gene encoding DNA polymerase, due to the overlapping 5 nature of the HBV genome (Figure 1), a corresponding mutation may also occur in the gene encoding the surface antigen (HBsAg) resulting in reduced interactivity of immunological reagents such as antibodies and immune cells to HBsAg. The reduction in the interactivity of immunological reagents to a viral surface component generally includes the absence of immunological memory to recognise or substantially recognize the viral 10 surface component. The present invention extends, therefore, to an HBV variant exhibiting decreased sensitivity to TDF and/or LMV and reduced interactivity of an immunological reagent to HBsAg wherein the variant is selected for following TDF and/or LMV combination or sequential treatment. The term "sequential" in this respect means TDF followed by LMV or LMV followed by TDF or multiple sequential administrations of each 15 of TDF and LMV or LMV and TDF. A viral variant may, therefore, carry mutation only in the DNA polymerase or both in the DNA polymerase and the HBsAg. The term "mutation" is to be read in its broadest context and includes multiple mutations. 20 The present invention extends to a mutation and any domain of the HBV DNA polymerase and in particular regions F and A through E provided said mutation leads to decreased sensitivity to LMV and/or TDF. 25 Preferably, the mutation results in an altered amino acid sequence in any one or more of domains F and A through E or regions proximal thereto of the HBV DNA polymerase. Another aspect of the present invention provides an HBV variant comprising a mutation in an overlapping open reading frame in its genome wherein said mutation is in a region 30 defined by one or more of domains F and A through E of HBV DNA polymerase and wherein said variant exhibits decreased sensitivity to TDF and/or LMV and optionally WO 2006/034545 PCT/AU2005/001489 -19 other nucleoside or nucleotide analogs, or other HBV DNA polymerase antagonists and/or an immunological reagent. In a related embodiment, there is provided an HBV variant comprising a mutation in the 5 nucleotide sequence encoding a DNA polymerase resulting in an amino acid addition, substitution and/or deletion in said DNA polymerase in one or more amino acids and wherein said variant exhibits decreased sensitivity to TDF and/or LTV and optionally other nucleoside or nucleotide analogs, or other HBV DNA polymerase antagonists and/or an immunological reagent. Preferably, the decreased sensitivity is to TDF, or both LMV 10 and/or TDF. The term "combination therapy" means that both TDF and LMV are co-administered in the same composition or simultaneously in separate compositions. The term "sequential therapy" means that the two agents are administered within seconds, minutes, hours, days 15 or weeks of each other and in either order. Sequential therapy also encompasses completing a therapeutic course with one or other of TDF or LMV and then completing a second therapeutic course with the other of TDF or LMV. Accordingly, another aspect of the present invention contemplates an HBV variant 20 comprising a surface antigen having an amino acid sequence with a single or multiple amino acid substitution, addition and/or deletion or truncation compared to the pretreatment HBV and wherein the surface antigen of the variant HBV exhibits an altered immunological profile compared to the pretreatment HBV where the said the variant HBV is selected for by a nucleoside or nucleotide analog of the HBV DNA polymerase or other 25 antagonist of the DNA polymerase, said variant selected by exposure of a subject to TDF and/or LMV in combination or sequential therapy. In a related embodiment, the present invention provides an HBV variant comprising a nucleotide sequence comprising a single or multiple nucleotide substitution, addition 30 and/or deletion compared to the pretreatment HBV and which HBV variant has a surface antigen exhibiting an altered immunological profile compared to the pretreatment HBV, WO 2006/034545 PCT/AU2005/001489 -20 said variant selected by exposure of a subject to TDF and/or LMV in combination or sequential therapy. Preferably, the variants are in isolated form such that they have undergone at least one 5 purification step away from naturally occurring body fluid. Alternatively, the variants may be maintained in isolated body fluid or may be in DNA form. The present invention also contemplates infectious molecular clones comprising the genome or parts thereof from a variant HBV. Furthermore, the present invention provides isolated components from the variant HBVs such as but not limited to an isolated HBsAg. Accordingly, the present 10 invention provides an isolated HBsAg or a recombinant form thereof or derivative or chemical equivalent thereof, said HBsAg being from a variant HBV selected by exposure of a subject to TDF and/or LMV in combination or sequential therapy. More particularly, yet another aspect of the present invention is directed to an isolated 15 variant HBsAg or a recombinant or derivative form thereof or a chemical equivalent thereof wherein said HBsAg or its recombinant or derivative form or its chemical equivalent exhibits an altered immunological profile compared to an HBsAg from a reference HBV, said HBsAg being from a variant HBV selected by exposure of a subject to TDF and/or LMV in combination or sequential therapy. 20 Even more particularly, the present invention provides an isolated variant HBsAg or a recombinant or derivative form thereof or a chemical equivalent thereof wherein said HBsAg or its recombinant or derivative form or its chemical equivalent comprises an amino acid sequence with a single or multiple amino acid substitution, addition and/or 25 deletion or a truncation compared to an HBsAg from a reference HBV and wherein a neutralising antibody directed to a reference HBV exhibits no or reduced neutralising activity to an HBV carrying said variant HBsAg, said HBsAg being from a variant HBV selected by exposure of a subject to TDF and/or LMV in combination or sequential therapy. 30 Preferred mutations in the HBV DNA polymerase include variants selected from patients with HBV recurrence following TDF and/or LMV treatment. Preferably, the treatment WO 2006/034545 PCT/AU2005/001489 -21 involves TDF or both TDF and/or LMV in combination or sequential therapy. Nucleoside or nucleotide analog treatment or other DNA polymerase antagonist treatment may occur in relation to the treatment of patients diagnosed with hepatitis in patients with HBV alone or with HBV/HIV co-infection. Following selection of variants, viral loads are obtainable 5 at levels greater than pre-treatment levels. Preferred mutations in the HBV DNA polymerase include one or more of rtVl73L, rtL180M, rtA194T, rtM204V, or combinations thereof or an equivalent one or more other mutation is indicative of a variant wherein said variant exhibits a decreased sensitivity to 10 TDF and/or LMV and optionally other nucleoside or nucleotide analogs, or other HBV DNA polymerase antagonists and/or an immunological reagent. It should be noted that the nomenclature system for amino acid positions is based on the methionine residues in the YMDD motif being designated codon rtM204. This numbering system is different to that in Australian Patent No. 734831 where the methionine residue in the YMDD motif within 15 the polymerase gene is designated codon 550. In this regard, rtV173L, rtLl8OM and rtM204V correspond to V519L, L526M and M550V, respectively, in Australian Patent No. 734831. Corresponding mutations may also occur in envelope genes such as in one or more of PreSl, PreS2 and HBsAg. Particular mutations are as follows: sE164D, sS193L, sIl95M, or combinations thereof or an equivalent one or more other mutation is indicative 20 of a variant wherein said variant exhibits a decreased sensitivity to TDF and/or LMV and optionally other nucleoside or nucleotide analogs, or other HBV DNA polymerase antagonists and/or an immunological reagent. The mutations in gene encoding HBsAg at sEl64D, or sI195M also result in mutation in the in the polymerase gene rtVl73L, or rtM204V respectively. 25 The identification of the variants of the present invention permits the generation of a range of assays to detect such variants. The detection of such variants may be important in identifying resistant variants to determine the appropriate form of chemotherapy. 30 Still another aspect of the present invention contemplates a method for determining the potential for an HBV to exhibit reduced sensitivity to TDF and/or LMV or optionally other nucleoside or nucleotide analogs, or other HBV DNA polymerase antagonists and/or an WO 2006/034545 PCT/AU2005/001489 - 22 immunological reagent, said method comprising isolating DNA or corresponding mRNA from said HBV and screening for a mutation in the nucleotide sequence encoding HBV DNA polymerase resulting in at least one amino acid substitution, deletion and/or addition in any one or more of domains F and A through E or a region proximal thereto of said 5 DNA polymerase and associated with resistance or decreased sensitivity to TDF and/or LMV wherein the presence of such a mutation is an indication of the likelihood of resistance to said TDF and/or LMV. Preferably, the assay detects one or more of the following mutations in the rt region: 10 rtVl73L, rtLl8OM, rtA194T, rtM204V, or combinations thereof or an equivalent one or more other mutation is indicative of a variant wherein said variant exhibits a decreased sensitivity to TDF and/or LMV and optionally other nucleoside or nucleotide analogs, or other HBV DNA polymerase antagonists and/or an immunological reagent. 15 Accordingly, another aspect of the present invention produces a method for determining whether an HBV strain exhibits reduced sensitivity to a nucleoside or nucleotide analogs, or other HBV DNA polymerase antagonists and/or an immunological reagent, said method comprising isolating DNA or corresponding mRNA from said HBV and screening for a mutation in the nucleotide sequence encoding the DNA polymerase wherein the presence 20 of the following mutations in the rt region: rtVl73L, rtLl8OM, rtA194T, rtM204V, or combinations thereof or an equivalent one or more other mutation is indicative of a variant wherein said variant exhibits a decreased sensitivity to TDF and/or LMV and optionally other nucleoside or nucleotide analogs. 25 In a related embodiment, the present invention contemplates a method for a method for determining the potential for an HBV to exhibit reduced sensitivity to a nucleoside or nucleotide analog selected from TDF and LMV or optionally other nucleoside or nucleotide analogs or an immunological agent, said method comprising isolating DNA or corresponding mRNA from said 1BV and screening for a mutation in the nucleotide 30 sequence encoding HBV DNA polymerase resulting in at least one amino acid substitution, deletion and/or addition in any one or more of domains F and A through E or a region proximal thereto of said DNA polymerase and associated with resistance or decreases WO 2006/034545 PCT/AU2005/001489 -23 sensitivity to one or more of TDF and/or LMV and/or an immunological agent wherein the presence of such a mutation is an indication of the likelihood of resistance to said one or more of TDF, LMV or an immunological reagent. 5 The preferred mutation in the reverse transcriptase is at rtA194T or combinations thereof or an equivalent one or more other mutation is indicative of a variant wherein said variant exhibits a decreased sensitivity to TDF and/or LMV and optionally other nucleoside or nucleotide analogs, or other HBV DNA polymerase antagonists and/or an immunological reagent. 10 Accordingly, another aspect of the present invention contemplates a method for determining whether an HBV strain exhibits reduced sensitivity to a nucleoside or nucleotide analogs, or other HBV DNA polymerase antagonists and/or an immunological reagent, said method comprising isolating DNA or corresponding mRNA from said HBV 15 and screening for a mutation in the nucleotide sequence encoding the DNA polymerase wherein the presence of the following mutations in the B or C domain, or the B/C interdomain of the rt region:, rtV173L, rtLl80M, rtA194T, rtM204V or combinations thereof or an equivalent one or more other mutation is indicative of a variant wherein said variant exhibits a decreased sensitivity to TDF and/or LMV and optionally other 20 nucleoside or nucleotide analogs, or other HBV DNA polymerase antagonists and/or an immunological reagent. The detection of HBV or its components in cells, cell lysates, cultured supernatant fluid and bodily fluid may be by any convenient means including any nucleic acid-based 25 detection means, for example, by nucleic acid hybridization techniques or via one or more polymerase chain reactions (PCRs). The term "bodily fluid" includes any fluid derived from the blood, lymph, tissue or organ systems including serum, whole blood, biopsy and biopsy fluid, organ explants and organ suspension such as liver suspensions. The invention further encompasses the use of different assay formats of said nucleic acid-based detection 30 means, including restriction fragment length polymorphism (RFLP), amplified fragment length polymorphism (AFLP), single-strand chain polymorphism (SSCP), amplification and mismatch detection (AMD), interspersed repetitive sequence polymerase chain WO 2006/034545 PCT/AU2005/001489 -24 reaction (IRS-PCR), inverse polymerase chain reaction (iPCR) and reverse transcription polymerase chain reaction (RT-PCR), amongst others. Other forms of detection include Northern blots, Southern blots, PCR sequencing, antibody procedures such as ELISA, Western blot and immunohistochemistry. A particularly useful assay includes the reagents 5 and components required for immobilized oligonucleotide- or oligopeptide-mediated detection systems. One particularly useful nucleic acid detection system is the reverse hybridization technique. In this technique, DNA from an HBV sample is amplified using a biotin or 10 other ligand-labeled primer to generate a labeled amplificon. Oligonucleotides immobilized to a solid support such as a nitrocellulose film are then used to capture amplified DNA by hybridization. Specific nucleic acid fragments are identified via biotin or the ligand. Generally, the labeled primer is specific for a particular nucleotide variation to be detected. Amplification occurs only if the variation to be detected is present. There 15 are many forms of the reverse hybridization assay and all are encompassed by the present invention. Detecting HBV replication in cell culture is particularly useful. 20 Another aspect of the present invention contemplates a method for detecting an agent which exhibits inhibitory activity to an HBV by: generating a genetic construct comprising a replication competent-effective amount of the genome from the HBV contained in a plasmid vector and then transfecting 25 said cells with said construct; contacting the cells, before, during and/or after transfection, with the agent to be tested; 30 culturing the cells for a time and under conditions sufficient for the HBV to replicate, express genetic sequences and/or assemble and/or release virus or virus-like particles if resistant to said agents; and WO 2006/034545 PCT/AU2005/001489 - 25 then subjecting the cells, cell lysates or culture supernatant fluid to viral- or viral-component-detection means to determine whether or not the virus has replicated, expressed genetic material and/or assembled and/or been released in the presence of the 5 agent. In a preferred embodiment, the plasmid vector may include genes encoding part or all of other viral vectors such as baculovirus or adenovirus (Ren and Nassal, 2001, supra) and the method comprises: 10 generating a genetic construct comprising a replication competent-effective amount of the genome from the HBV contained in or fused to an amount of a baculovirus genome or adenovirus genome effective to infect cells and then infecting said cells with said construct; 15 contacting the cells, before, during and/or after infection, with the agent to be tested; culturing the cells for a time and under conditions sufficient for the HBV to 20 replicate, express genetic sequences and/or assemble and/or release virus or virus-like particles if resistant to said agent; and then subjecting the cells, cell lysates or culture supernatant fluid to viral- or viral-component-detection means to determine whether or not the virus has replicated, 25 expressed genetic material and/or assembled and/or been released in the presence of the agent. In an alternative embodiment, the method comprises: 30 generating a continuous cell line comprising an infectious copy of the genome of the HBV in a replication competent effective amount such that said infectious HBV WO 2006/034545 PCT/AU2005/001489 -26 genome is stably integrated into said continuous cell line such as but not limited to 2.2.15 or AD; contacting the cells with the agent to be tested; 5 culturing the cells for a time and under conditions sufficient for the HBV to replicate, express genetic sequences and/or assemble and/or release virus or virus-like particles if resistant to the agent; and 10 then subjecting the cells, cell lysates or culture supernatant fluid to viral- or viral-component-detection means to determine whether or not the virus has replicated, expressed genetic material and/or assembled and/or been released in the presence of the agent. 15 As indicated above, variants may also be detected with reference to the HBsAg (s gene) and Presl, Pres2 envelop genes. Preferred mutations in this regard include one or more of sE164D, sS193L, or sIl95M. The above methods are useful for detecting an agent which exhibits inhibitory activity to an HBV which exhibits resistance to one or more of TDF, LMV, a nucleoside analog other than TDF or LMV or an immunological reagent. 20 Accordingly, another aspect of the present invention contemplates a method for determining whether an HBV strain exhibits reduced sensitivity to a nucleoside or nucleotide analogs, or other HBV DNA polymerase antagonists and/or an immunological reagent, said method comprising isolating DNA or corresponding mRNA from said HBV 25 and screening for a mutation in the nucleotide sequence encoding the envelope genes wherein the presence of the following mutations in the HBsAg: sE164D, sS193L, or sIl95M or combinations thereof or an equivalent one or more other mutation is indicative of a variant wherein said variant exhibits a decreased sensitivity to TDF and/or LMV and optionally other nucleoside or nucleotide analogs, or other HBV DNA polymerase 30 antagonists and/or an immunological reagent.
WO 2006/034545 PCT/AU2005/001489 - 27 The present invention is predicated in part on the identification and isolation of variants of HBV that have a plurality of mutations and exhibit two or more characteristics selected from decreased or reduced sensitivity to one or more nucleoside or nucleotide analogs or other antagonists of HBV DNA polymerase activity, a reduced level and/or functional 5 activity of Hepatitis Be antigen, or a reduced, abrogated or otherwise impaired immunological interactivity, relative to wild-type HBV. Thus, the identification of HBV variants with these mutational patterns is important inter alia for the development of assays to detect HBV variants and assays to screen for agents which are useful in treating and/or preventing infections by those variants and/or other HBV isolates and for the 10 development of alternative therapeutic regimes for managing HBV infections. Accordingly, one aspect of the present invention is directed to an isolated HBV variant comprising a plurality of nucleotide mutations that correlate with at least two characteristics selected from (a) resistance to one or more nucleoside or nucleotide analogs 15 or other antagonists of HBV DNA polymerase activity, (b) a reduced level and/or functional activity of Hepatitis Be antigen, or (c) a reduced, abrogated or otherwise impaired immunological interactivity. Another aspect of the present invention contemplates an isolated HBV variant comprising 20 a plurality of nucleotide mutations that correlate with (a) resistance to one or more nucleoside or nucleotide analogs or other antagonists of HBV DNA polymerase activity, (b) a reduced level and/or functional activity of Hepatitis Be antigen, and (c) a reduced, abrogated or otherwise impaired immunological interactivity. 25 Yet another aspect of the present invention provides an isolated HBV variant comprising a plurality of nucleotide mutations selected from two or more of (a) a nucleotide mutation in a gene encoding a DNA polymerase resulting in at least one amino acid addition, substitution and/or deletion to said DNA polymerase wherein said variant exhibits decreased sensitivity to TDF and/or LMV and optionally other nucleoside or nucleotide 30 analogs or other antagonists of HBV DNA polymerase activity, (b) a nucleotide mutation in a gene encoding a Hepatitis Be antigen or in a transcriptional control element of said gene wherein said mutation results in a reduced level and/or functional activity of said WO 2006/034545 PCT/AU2005/001489 -28 Hepatitis Be antigen, or (c) a nucleotide mutation in a gene encoding a hepatitis B polypeptide resulting in at least one amino acid addition, substitution and/or deletion to said polypeptide which reduces, abrogates or otherwise impairs its immunological interactivity. 5 The detection of amino acid variants of DNA polymerase is conveniently accomplished by comparison to reference sequences. The polymorphisms shown represent the variations shown in various databases for active pathogenic HBV strains. Where an HBV variant comprises an amino acid different to what is represented, then such an isolate is considered 10 a putative HBV variant having an altered DNA polymerase activity. The present invention further contemplates agents which inhibit TDF and/or LMV resistant HBV variants. Such agents will be particularly useful if long-term treatment by TDF and/or LMV and/or optionally other nucleoside or nucleotide analogs, or other HBV DNA 15 polymerase antagonists and/or an immunological reagent is contemplated by the clinician. The agents may be DNA or RNA or proteinaceous or non-proteinaceous chemical molecules. Natural product screening such as from plants, coral and microorganisms is also contemplated as a useful potential source of masking agents. The agents may be in isolated form or in the form of a pharmaceutical composition and may be administered 20 sequentially or simultaneously with the nucleoside or nucleotide analogs, or other HBV DNA polymerase antagonists and/or an immunological reagent. Accordingly, another aspect of the present invention contemplates a method for detecting an agent which exhibits inhibitory activity to an HBV, exhibiting resistance or decreased 25 sensitivity to TDF and/or LMV, or nucleoside analog other than TDF or LMV or an immunological reagent said method comprising: generating a genetic construct comprising a replication competent-effective amount of the genome from said HBV contained in a plasmid vector and then transfecting 30 said cells with said construct; WO 2006/034545 PCT/AU2005/001489 -29 contacting said cells, before, during and/or after transfection, with the agent to be tested; culturing said cells for a time and under conditions sufficient for the HBV 5 to replicate, express genetic sequences and/or assemble and/or release virus or virus-like particles if resistant to said agent; and subjecting the cells, cell lysates or culture supernatant fluid to viral- or viral-component-detection means to determine whether or not the virus has replicated, 10 expressed genetic material and/or assembled and/or been released in the presence of said agent. Still another aspect of the present invention provides a method for detecting an agent which exhibits inhibitory activity to an HBV, exhibiting resistance or decreased sensitivity 15 to TDF and/or LMV, or nucleoside analog other than TDF or LMV or an immunological reagent said method comprising: generating a genetic construct comprising a replication competent-effective amount of the genome from said HBV contained in or fused to an amount of a baculovirus 20 genome effective to infect cells and then infecting said cells with said construct; contacting said cells, before, during and/or after infection, with the agent to be tested; 25 culturing said cells for a time and under conditions sufficient for the HBV to replicate, express genetic sequences and/or assemble and/or release virus or virus-like particles if resistant to said agent; and subjecting the cells, cell lysates or culture supernatant fluid to viral- or viral 30 component-detection means to determine whether or not the virus has replicated, expressed genetic material and/or assembled and/or been released in the presence of said agent.
WO 2006/034545 PCT/AU2005/001489 -30 Still another aspect of the present invention provides a method for detecting an agent which exhibits inhibitory activity to an HBV, exhibiting resistance or decreased sensitivity to TDF and/or LMV, or nucleoside analog other than TDF or LMV or an immunological reagent said method comprising: 5 generating a genetic construct comprising a replication competent-effective amount of the genome from said HBV contained in or fused to an amount of a baculovirus genome effective to infect cells and then infecting said cells with said construct; 10 contacting said cells, before, during and/or after infection, with the agent to be tested; culturing said cells for a time and under conditions sufficient for the HBV to replicate, express genetic sequences and/or assemble and/or release virus or virus-like 15 particles if resistant to said agent; and subjecting the cells, cell lysates or culture supernatant fluid to viral- or viral component-detection means to determine whether or not the virus has replicated, expressed genetic material and/or assembled and/or been released in the presence of said agent. 20 Preferably, the HBV genome is stably integrated into the cells' genome. Whilst the baculovirus vector is a particularly useful in the practice of the present invention, the subject invention extends to a range of other vectors such as but not limited 25 to adenoviral vectors. The present invention further extends to cell lines carrying genetic constructs comprising all or a portion of an HBV genome or a gene or part of a gene therefrom. 30 The present invention also provides for the use of the subject HBV variants to screen for anti-viral agents. These anti-viral agents inhibit the virus. The term "inhibit" includes antagonizing or otherwise preventing infection, replication, assembly and/or release or any WO 2006/034545 PCT/AU2005/001489 -31 intermediate step. Preferred anti-viral agents include nucleoside analogs, however, the present invention extends to non-nucleoside/non-nucleotide analog molecules. In addition, rational drug design is also contemplated to identify or generate chemical 5 molecules which either mimic a nucleoside or nucleotide analog or other DNA polymerase antagonist or which interact with a particular nucleotide sequence or a particular nucleotide. Combinatorial chemistry and two hybrid screening are some of a number of techniques which can be employed to identify potential therapeutic or diagnostic agents. 10 In one example, the crystal structure of polymerase is used to rationally design small chemical molecules likely to interact with key regions of the molecule required for function and/or antigenicity. Such agents may be useful as inhibitors of polymerase activity. 15 Several models of the HBV polymerase have been prepared due to the similarity with reverse transcriptase from HIV (Das et al., J. Virol. 75(10): 4771-4779, 2001; Bartholomeusz et al., Antivir Ther. 9:149-60, 2004; Allen et al., Hepatology 27(6): 1670 1677, 1998). The models of the HBV polymerase can be used for the rational drug design of new agents effective against HBV encoding the resistant mutations as well as wild type 20 virus. The rational drug that is designed may be based on a modification of an existing antiviral agent such as the agent used in the selection of the HBV encoding the mutations associated with resistance. Viruses or clones expressing HBV genomic material encoding the mutations may also be used to screen for new antiviral agents. 25 The above methods are particularly useful in identifying an inhibitor of a TDF- and/or LMV-resistant HBV. The present invention extends, therefore, to compositions of the inhibitors. The inhibitors may also be in the form of antibodies or genetic molecules such as ribozymes, antisense molecules and/or sense molecules for co-suppression or the induction of RNAi. 30 The term "composition" includes a "pharmaceutical composition".
WO 2006/034545 PCT/AU2005/001489 - 32 The inhibitor is referred to below as an "active ingredient" or "active compound" and may be selected from the list of inhibitors given above. The composition may include an antigenic component of the HBV, a defective HBV 5 variant or an agent identified through natural product screening or rational drug design (including combinatorial chemistry). Pharmaceutically acceptable carriers and/or diluents include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption 10 delaying agents and the like. The use of such media and agents for pharmaceutical active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active ingredient, use thereof in the therapeutic compositions is contemplated. Supplementary active ingredients can also be incorporated into the compositions. 15 The pharmaceutical composition may also comprise genetic molecules such as a vector capable of transfecting target cells where the vector carries a nucleic acid molecule capable of encoding an aspartyl protease inhibitor. The vector may, for example, be a viral vector. 20 Pharmaceutical forms suitable for injectable use include sterile aqueous solutions (where water soluble) and sterile powders for the extemporaneous preparation of sterile injectable solutions. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dilution medium comprising, for example, water, ethanol, 25 polyol (for example, glycerol, propylene glycol and liquid polyethylene glycol, and the like), suitable mixtures thereof and vegetable oils. The proper fluidity can be maintained, for example, by the use of superfactants. The preventions of the action of microorganisms can be brought about by various anti-bacterial and anti-fungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thirmerosal and the like. In many cases, it 30 will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the WO 2006/034545 PCT/AU2005/001489 - 33 compositions of agents delaying absorption, for example, aluminium monostearate and gelatin. Sterile injectable solutions are prepared by incorporating the active compounds in the 5 required amount in the appropriate solvent with the active ingredient and optionally other active ingredients as required, followed by filtered sterilization or other appropriate means of sterilization. In the case of sterile powders for the preparation of sterile injectable solutions, suitable methods of preparation include vacuum drying and the freeze-drying technique which yield a powder of active ingredient plus any additionally desired 10 ingredient. When the active ingredient is suitably protected, it may be orally administered, for example, with an inert diluent or with an assimilable edible carrier, or it may be enclosed in hard or soft shell gelatin capsule, or it may be compressed into tablets. For oral 15 therapeutic administration, the active ingredient may be incorporated with excipients and used in the form of ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, wafers and the like. Such compositions and preparations should contain at least 1% by weight of active compound. The percentage of the compositions and preparations may, of course, b varied and may conveniently be between about 5 to about 80% of the weight 20 of the unit. The amount of active compound in such therapeutically useful compositions is such that a suitable dosage will be obtained. Preferred compositions or preparations according to the present invention are prepared so that an oral dosage unit form contains between about 0.1 pLg and 300 mg of active compound (TDF is administered at 300mg single dose). Alternative dosage amounts include from about 1 pg to about 1000 mg and 25 from about 10 4g to about 500 mg. These dosages may be per individual or per kg body weight. Administration may be per hour, day, week, month or year. The tablets, troches, pills, capsules and the like may also contain the components as listed hereafter. A binder such as gum, acacia, corn starch or gelatin; excipients such as 30 dicalcium phosphate; a disintegrating agent such as corn starch, potato starch, alginic acid and the like; a lubricant such as magnesium stearate; and a sweetening agent such as sucrose, lactose or saccharin may be added or a flavoring agent such as peppermint, oil of WO 2006/034545 PCT/AU2005/001489 - 34 wintergreen or cherry flavoring. When the dosage unit form is a capsule, it may contain, in addition to materials of the above type, a liquid carrier. Various other materials may be present as coatings or to otherwise modify the physical form of the dosage unit. For instance, tablets, pills or capsules may be coated with shellac, sugar or both. A syrup or 5 elixir may contain the active compound, sucrose as a sweetening agent, methyl and propylparabens as preservatives, a dye and a flavoring. Of course, any material used in preparing any dosage unit form should be pharmaceutically pure and substantially non toxic in the amounts employed. In addition, the active compound(s) may be incorporated into sustained-release preparations and formulations. 10 As stated above, the present invention further extends to an isolated HBsAg from the HBV variants herein described. More particularly, the present invention provides an HBsAg or a recombinant form thereof or derivative or chemical equivalent thereof. The isolated surface component and, more particularly, isolated surface antigen or its recombinant, 15 derivative or chemical equivalents are useful in the development of biological compositions such as vaccine formulations. Yet another aspect of the present invention provides a composition comprising a variant HBV resistant to TDF and/or LMV and optionally other nucleoside analogs or an HBV 20 surface antigen from said variant HBV or a recombinant or derivative form thereof or its chemical equivalent and one or more pharmaceutically acceptable carriers and/or diluents. As indicated above, antibodies may be generated to the mutant HBV agents and used for passive or direct vaccination against infection by these viruses. The antibodies may be 25 generated in humans or non-human animals. In the case of the latter, the non-human antibodies may need to be deimmunized or more specifically humanized prior to use. Deimmunized may include, for example, grafting complimentary determining regions (CDRs) from the variable region of a murine or non-human animal anti-HBV antibody onto a human consensus fragment antibody binding (Fab) polypeptide. Alternatively, 30 amino acids defining epitopes in the variable region of the antibody may be mutated so that the epitopes are no longer recognized by the human MHC II complex.
WO 2006/034545 PCT/AU2005/001489 -35 Insofar as ribozyme, antisense or co-suppression (RNAi) repression is concerned, this is conveniently aimed at post-transcription gene silencing. DNA or RNA may be administered or a complex comprising RNAi or a chemical analog thereof specific for HBV mRNA may be employed. 5 All such molecules may be incorporated into pharmaceutical compositions. Generally, if an HBV is used, it is first attenuated. The biological composition according to this aspect of the present invention generally further comprises one or more 10 pharmaceutically acceptable carriers and/or diluents. The present invention extends to vaccines. For example, the vaccine may comprise (1) an HBV variant as described herein alone; (2) the viral variant in combination with an anti HBV agent; and/or (3) an agent capable of inhibiting the subject HBV variants. 15 The present invention is further directed to the use of defective HBV variants in the manufacture of therapeutic vaccines to vaccinate individuals against infection by HBV strains having a particular nucleotide sequence or encoding a particular polymerase. 20 The subject invention extends to kits for assays for variant HBV resistant to TDF and/or LMV. Such kits may, for example, contain the reagents from PCR or other nucleic acid hybridization technology or reagents for immunologically based detection techniques. A particularly useful assay includes the reagents and components required for immobilized oligonucleotide- or oligopeptide-mediated detection systems. 25 Still another aspect of the present invention contemplates a method for determining the potential for an HBV to exhibit reduced sensitivity to TDF and/or LMV or optionally other nucleoside analogs, said method comprising isolating DNA or corresponding mRNA from said HBV and screening for a mutation in the nucleotide sequence encoding HBV DNA 30 polymerase resulting in at least one amino acid substitution, deletion and/or addition in any one or more of domains F and A through E or a region proximal thereto of said DNA polymerase and associated with resistance or decreased sensitivity to TDF and/or LMV WO 2006/034545 PCT/AU2005/001489 -36 wherein the presence of such a mutation is an indication of the likelihood of resistance to said TDF and/or LMV. An assessment of a potential viral variant is important for selection of an appropriate 5 therapeutic protocol. Such an assessment is suitably facilitated with the assistance of a computer programmed with software, which inter alia adds index values (Ivs) for at least two features associated with the viral variants to provide a potency value (PA) corresponding to the resistance or sensitivity of a viral variant to a particular chemical compound or immunological agent. The Iys can be selected from (a) the ability to exhibit 10 resistance for reduced sensitivity to a particular compound or immunological agent; (b) an altered DNA polymerase from wild-type HBV; (c) an altered surface antigen from wild type HBV; or (d) morbidity or recovery potential of a patient. Thus, in accordance with the present invention, Ivs for such features are stored in a machine-readable storage medium, which is capable of processing the data to provide a PA for a particular viral variant or a 15 biological specimen comprising same. Thus, in another aspect, the invention contemplates a computer program product for assessing the likely usefulness of a viral variant or biological sample comprising same for determining an appropriate therapeutic protocol in a subject, said product comprising: 20 (1) code that receives as input Ivs for at least two features associated with said viral agents or biological sample comprising same, wherein said features are selected from: 25 (a) the ability to exhibit resistance for reduced sensitivity to a particular compound or immunological agent; (b) an altered DNA polymerase from wild-type HBV; (c) an altered surface antigen from wild-type HBV; or (d) morbidity or recovery potential of a patient; 30 (e) altered replication capacity (increased or decreased); WO 2006/034545 PCT/AU2005/001489 -37 (2) code that adds said Ivs to provide a sum corresponding to a Pv for said viral variants or biological samples; and (3) a computer readable medium that stores the codes. 5 In a related aspect, the invention extends to a computer for assessing the likely usefulness of a viral variant or biological sample comprising same in a subject, wherein said computer comprises: 10 (1) a machine-readable data storage medium comprising a data storage material encoded with machine-readable data, wherein said machine-readable data comprise Iys for at least two features associated with said viral variant or biological sample; wherein said features are selected from: 15 (a) the ability to exhibit resistance for reduced sensitivity to a particular compound or immunological agent; (b) an altered DNA polymerase from wild-type HBV; (c) an altered surface antigen from wild-type HBV; or (d) morbidity or recovery potential of a patient; 20 (e) altered replication capacity (increased or decreased); (2) a working memory for storing instructions for processing said machine-readable data; 25 (3) a central-processing unit coupled to said working memory and to said machine readable data storage medium, for processing said machine readable data to provide a sum of said Ivs corresponding to a Pv for said compound(s); and (4) an output hardware coupled to said central processing unit, for receiving said Pv. 30 Any general or special purpose computer system is contemplated by the present invention and includes a processor in electrical communication with both a memory and at least one WO 2006/034545 PCT/AU2005/001489 -38 input/output device, such as a terminal. Such a system may include, but is not limited, to personal computers, work stations or mainframes. The processor may be a general purpose processor or microprocessor or a specialised processor executing programs located in RAM memory. The programs may be placed in RAM from a storage device, such as a disk 5 or pre-programmed ROM memory. The RAM memory in one embodiment is used both for data storage and program execution. The computer system also embraces systems where the processor and memory reside in different physical entities but which are in electrical communication by means of a network. For example, a computer system having the overall characteristics set forth in Figure 2 may be useful in the practice of the instant invention. 10 More specifically, Figure 2 is a schematic representation of a typical computer work station having in electrical communication (100) with one another via, for example, an internal bus or external network, a processor (101), a RAM (102), a ROM (103), a terminal (104), and optionally an external storage device, for example, a diskette, CD ROM, or magnetic tape (105). 15 The present invention further provides a kit. In one embodiment, the present invention provides a kit for an assay for variant HBV resistant to TDF, LMV, a nucleoside analog other than TDF or LMV or an immunological 20 reagent said kit comprising the reagents from PCR or other nucleic acid hybridization technology or reagents for immunologically based detection techniques. The present invention is further described by the following non-limiting Examples.
WO 2006/034545 PCT/AU2005/001489 -39 EXAMPLE 1 Overlapping genome of HB V The overlapping genome of HBV is represented in Figure 1. The gene encoding DNA 5 polymerase (P), overlaps the viral envelope genes, Pre-S1 and Pre-S2, and partially overlaps the X and core (C) genes. The HBV envelope comprises small, middle and large HBV surface antigens. The large protein component is referred to as the HBV surface antigen (HBsAg) and is enclosed by the S gene sequence. The Pre-S1 and Pre-S2 gene sequences encode the other envelope components. 10 EXAMPLE 2 Patient and Treatment A total of 20 (47%) individuals were infected with WT HBV RT despite prolonged exposure to LMV and TDF, whilst of the remaining 23 (53%), two selected de novo 15 mutations known to be associated with LMV resistance, 19 showed the same LMV associated mutations already present at baseline, and 2 patients reverted to WT. Overall, 6 distinct LMV mutational patterns were observed (see Table 3) rtL180M + rtM204V, rtL180M + rtM204V+rtV207M/I, rtVl73L + rtL180M + rtM204V, rtL180M + rtM204I, rtM204I and rtV191I. 20 Two patients selected viruses with novel mutations (see Table 3), both were HBeAg positive and genotype A.
WO 2006/034545 PCT/AU2005/001489 -40 TABLE 3 Mutational patterns of the HBVpol in 23 HBV/HIV-coinfected individuals exposed to tenofovir for longer than 6 months. Pattern No. of patients Mutational pattern A 10 rtL180M + rtM204V B 4 rtL180M + rtM204V+V207M/I C 4 rtV173L + rtL180M + rtM204V D 1 rtL180M+rtM204I E 1 rM204I F 1 rtVl9lI G 1 rtA194T+rtL180M+rtM204V H 1 rtA194T+ rtV173L + rtL180M + rtM204V 5 Patterns A-F correspond to lamivudine resistance while patterns G-H correspond to novel mutational patterns. Italic represents the novel amino acid change. Patient A: 10 31 year old male, HIV+, HBsAg+, was treatment at Hospital Carlos III, Madrid, with DDI, TDF + LPV/r. After 36 weeks therapy changed to AZT, 3TC, TDF + LPV/r. After commencing treatment, plasma HIV RNA remained below detectable levels (<50 cop/mL) and absolute CD4 counts steadily increased from 224 to 594 cel/uL (% from 7% to 22%). The patient is infected with HBV genotype A, positive for HBeAg, antiHBc, and negative 15 for antiHBs, antiHBc IgM. Plasma HBV DNA and ALT were measured every 3-4 months. HBV DNA was measured using Roche COBAS Monitor (see Table 4).
WO 2006/034545 PCT/AU2005/001489 -41 TABLE 4 The HIV and HBVDNA viral load and Liver function test (alanine transaminase; ALT) for Patient A week HIV HBV ALT (cop/mL) (cop/mL) (IU/mL) 79 <200 <50 56 62 300 <50 41 48 1000 <50 212 36 700 <50 29 16 13000 <50 46 0 <50 41 -8 34966 61 5 Patient B: 44 year old male, HIV+, HBsAg+, HAV+, started treatment in 1995 with AZT and DDC (see Table 4 for AntiRetroviral therapy history). Patient B presented with mutations in the HBV RT of rtV173L, rtA194T, rtL180M and rtM204V, 77 weeks after the start of TDF 10 therapy. He had initiated his treatment with zidovudine and zalcitabine in 1995. Treatment with TDF along with LMV and lopinavir boosted with ritonavir was prescribed in 2002. After 8 weeks, the patient voluntarily stopped therapy for 37 weeks. Antiretroviral treatment was resumed with TDF, LMV and efavirenz. Plasma HBV-DNA decreased from 7.2 log copies/ml to 1.7 log copies/ml in 64 weeks after restart of ART. During this period, 15 ALT levels remained constantly normal and CD4+ counts ranged from 315 to 553 cells/pl, always with undetectable plasma HIV-RNA levels during treatment (Figure 17b).
WO 2006/034545 PCT/AU2005/001489 -42 TABLE 5 Antiviral History for Patient B HAART Week AZT/ddC -338 ddi/3TC -308 ddl/3TC/IDV -286 D4T/ddl/NVP -142 D4T/3TC/ABC -111 D4T/ABC/APVr -100 D4T/APVr -96 D4T/3TC/LPVr -49 ddl/3TC/LPVr -45 3TC/LPVr -1 TDF/3TC/LPVr 0 No treatment 33 TDF/3TC/EFV 46 5 After treatment with TDF, HIV RNA, HBV DNA and ALT were measured and levels are listed in Table 6. Absolute CD4 counts ranged from 324 to 602 cel/uL (mean 457 cel/uL) (mean CD4 %; 13%). The patient was infected with HBV genotype A, and was HBeAg +. TABLE 6 10 HIVRNA, HBV DNA andALTLevels week HIV HBV ALT (cop/mL) (cop/mL) (IU/mL) 116 50 48 N.D. 101 50 84 18 89 50 479 23 77 50 3840 26 57 50 39700 30 52 50 18600000 26 42 5120 200000 37 33 2430 7440 40 -2 50 3,49E+11 WO 2006/034545 PCT/AU2005/001489 -43 EXAMPLE 3 Detection of Viral Markers Hepatitis B surface antigen (HBsAg), hepatitis Be antigen (HBeAg), anti-HBe and 5 hepatitis B core antigen (HBcAg) specific IgG and IgM were measured using commercially available immunoassays. Hepatitis B viral DNA levels were measured using Roche COBAS Monitor assay according to the manufacturer's directions. EXAMPLE 4 10 Sequencing of HBV DNA HBV DNA was extracted and sequenced using standard published methods. The following primers were used for amplification and sequencing: 15 (5'-3') Primer 1 forward: TCTTGTTGACAAGAATCCTCAC, (SEQ ID NO:1) (5'-3') Primer 2 forward: AGACTCGTGGTGGACTTCTCT (SEQ ID NO:2) (5'-3') Primer 3 reverse: CCCAAAAGACCCACAATTC (SEQ ID NO:3), and (5'-3') Primer 4 reverse: TGACATACTTTCCAATCAAT (SEQ ID NO:4). 20 Both 1st and 2nd round PCR conditions were as follows: 2min 95C, (30sec 95C, 30sec 50C, 90sec 72C)x 30 cycles, 72C for 4mins. EXAMPLE 5 Analysis of HBVDNA 25 Patient A: At week 48 the patient had no mutations associated to resistance nor any novel amino-acid changes. However, at week 62 the patient selected mutations rtLl80M and rtM204V as well as a novel mutation rtA194T. See Table 7. 30 Patient B: No sera for sequence analysis was available before the treatment with TDF commenced, but at week 77 the patient presented mutations rtV173L, rtLl80M and rtM204V together WO 2006/034545 PCT/AU2005/001489 -44 with novel mutation rtA194T. The HBsAg mutations included sE164D, sS193L and sI195M. See Table 8. TABLE 7 5 Summary of HB V mutations in patient A treated with TDF and LMV Sample name Genotype Polymerase* Surface 0 A rtS54T 48 A rtS54T 62 A rtL180M sI195M rtA194T rtM204V * Nomenclature according to Stuyver et al., 2001, supra 10 TABLE 8 Summary of HB V mutations in patient B treated with TDF and LMV Sample name Genotype Polymerase* Surface 77 A rtV173L sE164D rtL180M sS193L rtA194T sI195M rtM204V 15 EXAMPLE 6 Modelling of the HBVpolymerase with rtA194T 20 The HBV polymerase has not been crystallized and a homology model based on similarity with HIV has been developed (Bartholomeusz et al, 2004 supra). Using this model mutations were located at rtA 1 94T. The HBV reverse transcriptase mutation rtA194T is located away from the active site 25 towards the end of the alpha helix in a potential hinge region which contains the B domain (Figure 15).
WO 2006/034545 PCT/AU2005/001489 - 45 Two potential mechanisms by which the mutation at rtA194T may influence resistance to TDF and/ or LMV. 1. The mutation at rtA 1 94T in the hinge region may still have the ability to affect the 5 position alpha helix that encodes the B domain. This is where codon rtl80 is located, and this region has the potential to interact with the DNA template. Changes to this region may alter the position of the DNA template strand relative to the dNTP binding site. 2. The reverse transcriptase (rt) region is only part of the polymerase protein. The 10 entire HBV polymerase is a large protein (90kd). The mutation is on the external surface of the rt region. There is no structural homologues for the terminal protein and spacer region components of the HBV polymerase protein that also includes an RNase H component. Therefore, the mutation has the potential to interact with the rest of components the polymerase protein. This has been demonstrated in HIV in 15 which mutations which affect the RNAse H component have been known to also alter antiviral sensitivity. EXAMPLE 7 TDF 20 TDF is a potent inhibitor of HBV replication. TDF has activity against hepadnaviruses and HIV. The structure of TDF is shown in Figure 16 and its synthesis is described in a review by Grim SA, Romanelli F, Ann Pharinacother 37(6):849-59, 2003. Preclinical studies indicate that TDF is a highly potent inhibitor of HBV in enzyme- and cell-based assays 25 EXAMPLE 8 Replication competent HB Vplasmids An extended (1.28x) HBV genome was cloned (HBV genotype A, subtype adw2) into a 30 pBluescript KS (+) plasmid (Stratagene, La Jolla, CA, USA), as described by Tacke et al, J Virol 78:8524-8535, 2004.
WO 2006/034545 PCT/AU2005/001489 -46 EXAMPLE 9 Site-directed mutagenesis 5 Three mutated HBV plasmids were constructed using a Quikchange (Registered) II site directed mutagenesis kit (Stratagene, La Jolla, CA, USA). Plasmids contained either mutations rtL180M and rtM204V (LM), rtL180M, rtM204V and rtAl94T(LMAT), or rtAl94T (AT). To create LAM-specific mutations rtL180M and rtM204V, primers rtM204VF (CTT TCA GCT ATG TGG ATG ATG TGG TAT TGG (SEQ ID NO:17)) and 10 rtM204VR (CCA ATA CCA CAT CAT CCA CAT AGC TGA AAG (SEQ ID NO:18)), and rtL180MF (TCC GTT TCT CAT GGC TCA GTT TAC TAG TG (SEQ ID NO:19)) and rtL180MR (CAC TAG TAA ACT GAG CCA TGA GAA ACG GA (SEQ ID NO:20)), respectively, were designed. Mutations were created according to Bock et al, Gastroneterology 122:264-273, 2002. 15 Mutation rtA194T was engineered using mutagenic primers A194TR (AGT GGT TCG TAG GAC TTT CCC CCA CTG TTT GG (SEQ ID NO:21)) and A194TF (AGC CAA ACA GTG GGG GAA AGT CCT ACG AAC CAC (SEQ ID NO:22)). All plasmids were ultimately sequenced to verify that only the intended mutations had been introduced. 20 EXAMPLE 10 Cell culture and viral transfection HepG2 cells were grown in Eagles minimum essential medium (LGC Promochem, 25 Middlesex, UK), supplemented with 10% v/v fetal bovine serum at 37'C and 5% v/v C0 2 . For cDNA transfections, 3 x 105 cells were seeded to semi-confluence onto each well of a 6-well plate and allowed to adhere overnight. The following day, 950 ng of HBV cDNA plasmid was co-transfected with 50 ng of pCMV P-Galactosidase vector (Promega, Mannheim, Germany) into each well, using the Fugene6 transfection agent and following 30 the manufacturer's instructions (Roche, Indianapolis, USA). Five hours after transfection, cells were washed with PBS and the culture medium was replaced with media containing TDF at concentrations from 0 to 100 pM. Seventy-two hours after transfection, the cells WO 2006/034545 PCT/AU2005/001489 - 47 were washed and the media changed again with the appropriate drug concentrations. Media and cell lysates were harvested for analysis 5 days after transfection. Transfection efficiency was controlled by measuring p-galactosidase activity from cell lysates according to manufacturer's instructions (Promega). 5 EXAMPLE 11 Quantification of extracellular HB V-DNA HBV viral particles from the cell culture supernatant were precipitated using 26% 10 polyethylene glycol (PEG 8000, Sigma, St. Louis, MO, USA), followed by DNase 1 digestion (Takara, Shiga, Japan). DNA was extracted using a QiaAMP viral DNA extraction kit (Qiagen). A quantitative real-time PCR was used to quantify HBV-DNA. Briefly, a 189-bp fragment of the X region was amplified in a LightCycler system (Roche), using the QuantiTect Probe PCR kit (Qiagen) and the following probes and primers: 3FL 15 XHybprobe (5'-ACG GGG CGC ACC TCT CTT TAC GCG G fluorescein-3' (SEQ ID NO:23)), 5LC-Xhybprobe (5'LCRed 640nm-CTC CCC GTC TGT GCC TTC TCA TCT GC PH-3' (SEQ ID NO:24)), X sense (5'-GAC GTC CTT TGT YTA CGT CCC GTC-3' (SEQ ID NO:25)), and X antisense (5'-TGC AGA GGT GAA GCG AAG TGC ACA-3' (SEQ ID NO:26)). The LightCycler program consisted of an initial activation step (95'C, 20 15 min, slope 20 0 C/sec), 40 cycles of amplification with touch down (95 0 C 10 sec, 62 55 0 C 15 see, 72*C 13 sec, slope of 5 0 C/sec), melting curve (cooling from 95'C to 50'C for 10 see with a slope of 20*C/sec and heating again to 95*C for 0 see with a slope of 0.l*C/sec), and cooling (40'C for 30 see with a slope of 20*C/sec). Standard dilutions of a plasmid containing the HBV X gene (X-pScript, Stratagene) were used to generate a 25 standard curve. All measurements were carried out in triplicate. After adjusting for transfection efficiency, IC 50 values were calculated from the HBV viral load using the following formula (Vandamme et al, Antiviral methods and protocols:23 1, 2000): 30 log IC 50 = log conc. HPP -[(HPP-50)/(HPP-LPP) x log d HPP, highest protective percentage; LPP, lowest protective percentage; d, dilution.
WO 2006/034545 PCT/AU2005/001489 -48 EXAMPLE 12 Toxicity determination The toxicity of TDF was measured by transfecting HepG2 cells in 96-wells plates and 5 continually exposing the test drugs up to 10mM for 5 days. MTT [3-(4,5-dimethylthiazol 2-yl)-2,5-diphenyltetrazolium bromide] was added to each well at a final concentration of 500ptg/mL five hours before dissolving crystals in 200uL of DMSO and measuring at 550nm UV wavelengths. 10 EXAMPLE 13 Phenotypic analyses Following the genetic analysis, further analyses of the novel mutations observed in the two patients described above were undertaken. As the clinical data suggested a particular 15 relevance of the novel rtA1 94T mutation, especially in combination with LMV resistance, site-directed mutagenesis was performed and 3 replication-competent HBV plasmids carrying the following mutations: rtL18OM+rtM204V (LM), rtL180M+rtA194T+rtM204V (LMAT), and rtA 1 94T (AT) were constructed. The antiviral activity of TDF was examined in a transient transfection cell culture assay system along side a WT construct as described 20 above. Extracellular HBV-DNA was examined by real-time PCR, 5 days post-transfection and
IC
50 values were calculated. The results are summarized in Table 9, which shows the resistance profile for the mutant HBV. 25 WO 2006/034545 PCT/AU2005/001489 - 49 TABLE 9 ICso values for tenofovir obtained from transient transfection cell culture assays using WT and mutant HBV-DNA constructs transfected into HepG2 cells. Effect of clinical mutations on HBV susceptibility to tenofovir in vitro. Extracellular DNA
IC
50 (stmol/L) Fold IC 50 WT 12.4 1 A194T (AT) 95 7.6a L1 80M + M204V (LM) 71 5.7a L180M, A194T, M204V (LMAT) >120* >10*b 5 * IC 50 values above the cell toxic level of tenofovir. a 5-10 fold increase in the IC 50 confers to partial resistance [24] b >10-fold increase in the IC 50 confers to resistance [24] 10 Those skilled in the art will appreciate that the invention described herein is susceptible to variations and modifications other than those specifically described. It is to be understood that the invention includes all such variations and modifications. The invention also includes all of the steps, features, compositions and compounds referred to or indicated in 15 this specification, individually or collectively, and any and all combinations of any two or more of said steps or features.
WO 2006/034545 PCT/AU2005/001489 -50 BIBLIOGRAPHY Allen et al., Hepatology 27(6): 1670-1677, 1998 Aye et al., JHepatol. 26: 1148-53, 1997 Bartholomeusz et al., Antivir Ther. 9(2):149-160, 2004 Bock et al, Gastroneterology 122:264-273, 2002 Boyd et al., Antiviral Chem Chemother. 32: 358-363, 1987 Das et al., J. Virol. 75(10): 4771-4779, 2001 Delaney et al., Antimicrob Agents Chemother 45(6): 1705-1013, 2001 Dienstag et al., New England J Med 333: 1657-1661, 1995 Gaillard et al., Antimicrob Agents Chemother. 46(4): 1005-1013, 2002 Grim SA, Romanelli F, Ann Pharmacother. ;37(6):849-59, 2003 Kruger et al., Hepatology 22: 219A, 1994 Main et al., J. Viral Hepatitis 3: 211-215, 1996 Lada 0 et al., Antivir Ther. ;9:353-63, 2004 Norder et al., J. Gen. Virol. 74: 341-1348, 1993 Ren and Nassal, J. Virol. 75(3): 1104-1116, 2001 WO 2006/034545 PCT/AU2005/001489 - 51 Severini et al., Antimicrobial Agents Chemother 39: 1430-1435, 1995 Shaw JP et al., Pharm Res. 14(12):1824-9, 1997 Stuyver et al., Hepatology 33: 751-757, 2001 Summers and Mason, Cell 29: 403-415, 1982 Tacke et al, J Virol 78:8524-8535, 2004 Vandamme et al, Antiviral methods and protocols:231, 2000 Vere Hodge, Antiviral Chem Chemother 4: 67-84, 1993 Ying C et al., J Viral Hepat. 7(2):161-5, 2000 Xiong et al., Hepatology. 28(6): 1669-73, 1998
Claims (21)
1. An isolated Hepatitis B virus (HBV) variant wherein said variant comprises nucleotide mutations in a gene encoding a DNA polymerase resulting in the amino acid substitution mutation rtLl80M+rtAI94T+rtM204V in said DNA polymerase and wherein said variant exhibits decreased sensitivity to TDF.
2. The isolated HBV variant of Claim I wherein said variant further exhibits reduced sensitivity to LMV.
3. The isolated HBV variant of Claim 1 or 2 wherein the variant further comprises an rtV173L amino acid substitution mutation in the DNA polymerase.
4. The isolated HBV variant of Claim 1 or 2 or 3 wherein the variant further exhibits decreased sensitivity to an antibody to a surface component of HBV.
5. The isolated HBV variant of Claim 4 wherein the surface component is the hepatitis B surface antigen (HBsAg).
6. The isolated HBV variant of Claim 5 wherein the variant comprises the amino acid substitution mutation sS193L in said HBsAg.
7. The isolated HBV variant of Claim 6 further comprising an sE164D amino acid substitution mutation in said HBsAg
8. The isolated HBV variant of Claim 6 or 7 further comprising an sI195M substitution mutation in said HBsAg.
9. A method for determining the potential for an HBV to exhibit reduced sensitivity to TDF and/or LMV said method comprising isolating DNA or corresponding mRNA from said HBV and screening for mutations in the nucleotide sequence encoding HBV DNA C:\NRPortbDCC\AAR\29XI4i .DOC27/05/2010 - 53 polymerase resulting in the amino acid substitution rtL180M+rtAl94T+rtM204V in said DNA polymerase wherein the presence of such a mutation is indicative of reduced sensitivity to TDF and/or LMV.
10. The method of Claim 8 further comprising identifying an rtV173L amino acid substitution mutation in the DNA polymerase.
11. A method for determining the potential for an HBV to exhibit reduced sensitivity to TDF and/or LMV said method comprising isolating DNA or corresponding mRNA from said HBV and screening for the substitution mutation sS193L and sE164D in HBsAg wherein the presence of such a mutation is indicative of reduced sensitivity to TDF and/or LMV.
12. The method of Claim I further comprising screening for the presence of an sll195M substitution in the said HBsAg.
13. A method for detecting an agent which exhibits inhibitory activity to an HIBV which exhibits resistance or decreased sensitivity to TDF and/or LMV said method comprising: generating a genetic construct comprising a replication competent-effective amount of the genome from an HBV which carries the substitution mutation in its DNA polymerase rtL180M+rtAl94T+rtM204V contained in a plasmid vector and then transfecting said cells with said construct; contacting said cells, before, during and/or after transfection, with TDF and/or LMV to be tested; culturing said cells for a time and under conditions sufficient for the HBV to replicate, express genetic sequences and/or assemble and/or release virus or virus-like particles if resistant to TDF and/or LMV; and C:NfRPortbl\DCC\AAR\')N 15491 DOC-27/)5/2010 - 54 subjecting the cells, cell lysates or culture supernatant fluid to viral- or viral component-detection means to determine whether or not the virus has replicated, expressed genetic material and/or assembled and/or been released in the presence of TDF and/or LMV.
14. The method of Claim 13 wherein the HBV carriers a further rtV173L substitution in the DNA polymerase.
15. The method of Claim 13 wherein the HBV carriers a further sS193L substitution mutation in the gene encoding HBsAg
16. The method of Claim 13 or 14 wherein the HBV carries a further sE164D and/or sl 195M substitution in the gene encoding HBsAg.
17. A computer product for assessing the likely sensitivity to an HBV to TDF and/or LMV, said product comprising: (1) code that receives as input code for at least one feature associated with said viral agents wherein said features is a substitution mutation in a DNA polymerase which is rtL1 80M+rtA194T+rtM204V; (2) a computer readable medium that stores and records the codes; and (3) an output hardware for receiving and reporting the presence of a mutation associated with resistance to TDF and/or LMV.
18. The computer product of Claim 17 further comprising a feature which is an rtV173L substitution mutation in the DNA polymerase. C :NRPrb\DCC\AAR\29154) I DOC-27/15/2))l)> - 55
19. Use of an HBV variant resistant to TDF and/or LMV as defined in any one of Claims I to 8 in the manufacture of a medicament for the treatment or prophylaxis of HBV infection.
20. A vaccine comprising an isolated HBV of any one of Claims I to 8 or an antigenic component thereof and one or more pharmaceutically acceptable carriers and/or diluents.
21. A variant in accordance with any one of Claims I to 8 or a method of Claims 9 to 16 or a computer product of Claim 17 or 18 or a use of Claim 19 or a vaccine of Claim 20 substantially as herein described with reference to the Figures and/or Examples.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU2005289372A AU2005289372B2 (en) | 2004-09-28 | 2005-09-28 | Variants of hepatitis B virus with resistance to anti-viral nucleoside agents and applications thereof |
Applications Claiming Priority (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU2004905615A AU2004905615A0 (en) | 2004-09-28 | Viral variants and applications thereof | |
AU2004905615 | 2004-09-28 | ||
AU2005289372A AU2005289372B2 (en) | 2004-09-28 | 2005-09-28 | Variants of hepatitis B virus with resistance to anti-viral nucleoside agents and applications thereof |
PCT/AU2005/001489 WO2006034545A1 (en) | 2004-09-28 | 2005-09-28 | Variants of hepatitis b virus with resistance to anti-viral nucleoside agents and applications thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
AU2005289372A1 AU2005289372A1 (en) | 2006-04-06 |
AU2005289372B2 true AU2005289372B2 (en) | 2010-06-24 |
Family
ID=38009100
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
AU2005289372A Ceased AU2005289372B2 (en) | 2004-09-28 | 2005-09-28 | Variants of hepatitis B virus with resistance to anti-viral nucleoside agents and applications thereof |
Country Status (1)
Country | Link |
---|---|
AU (1) | AU2005289372B2 (en) |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2003066841A1 (en) * | 2002-02-07 | 2003-08-14 | Melbourne Health | Viral variants with altered susceptibility to nucleoside analogs and uses thereof |
-
2005
- 2005-09-28 AU AU2005289372A patent/AU2005289372B2/en not_active Ceased
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2003066841A1 (en) * | 2002-02-07 | 2003-08-14 | Melbourne Health | Viral variants with altered susceptibility to nucleoside analogs and uses thereof |
Also Published As
Publication number | Publication date |
---|---|
AU2005289372A1 (en) | 2006-04-06 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US9932646B2 (en) | Detection and use of antiviral resistance mutations | |
US7927601B2 (en) | Variants of hepatitis B virus with resistance to anti-viral nucleoside agents and applications thereof | |
US7384747B2 (en) | Hepatitis B viral variants with reduced susceptibility to nucleoside analogs and uses thereof | |
US8008000B2 (en) | Viral variants detection and application | |
US9701982B2 (en) | Variants of hepatitis B virus with resistance to anti-viral nucleoside agents and applications thereof | |
CA2475446C (en) | Viral variants with altered susceptibility to nucleoside analogs and uses thereof | |
US8211633B2 (en) | Viral variants with altered susceptibility to nucleoside analogs and uses thereof | |
US8211443B2 (en) | Variants of hepatitis B virus with resistance to anti-viral nucleoside agents and applications thereof | |
AU2005289372B2 (en) | Variants of hepatitis B virus with resistance to anti-viral nucleoside agents and applications thereof | |
US9682109B2 (en) | Antiviral resistance mutants and applications thereof | |
WO2006039739A1 (en) | Hepatitis b viral (hbv) mutants detection and application | |
AU2003202301A1 (en) | Viral variants with altered susceptibility to nucleoside analogs and uses thereof | |
AU2012202645A1 (en) | Variants of Hepatitis B virus with resistance to anti-viral nucleoside agents and applications thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
FGA | Letters patent sealed or granted (standard patent) | ||
MK14 | Patent ceased section 143(a) (annual fees not paid) or expired |