AU2005202233A1 - DNA vaccines for pets and sport animals - Google Patents

Description

AUSTRALIA

Patents Act 1990

MERIAL

COMPLETE SPECIFICATION STANDARD PATENT Invention Title.

DNA vaccines for pets and sport animals The following statement is a full description of this invention including the best method of performing it known to us:- DNA vaccine for pets or for animals used in sports This application is a divisional application of Australian Patent Application No.

55405/00, the contents of which are incorporated herein by reference.

The present invention relates to improved DNA vaccines for pets or for animals used in sports, in particular dogs, cats and horses.

The use of deoxyribonucleic acid (DNA) molecules for vaccination has been known since the beginning of the 1990s (Wolf et. al. Science 1990. 247. 1465-1468). This vaccination technique induces cellular and humoral immunity after in vivo transfection of cells of the subject to be vaccinated with DNA or RNA molecules encoding and expressing immunologically active proteins.

A DNA vaccine is composed of at least one plasmid which may be expressed by the cellular machinery of the subject to be vaccinated and of a pharmaceutically acceptable vehicle or excipient. The nucleotide sequence of this plasmid encodes and expresses, inter alia, one or more immunogens, such as proteins or glycoproteins capable of inducing, in the subject to be vaccinated, a cellular immune response (mobilization of the T lymphocytes) and a humoral immune response (stimulation of the production of antibodies specifically directed against the immunogen) (Davis H.L. Current Opinion Biotech. 1997. 8. 635-640).

All the immunogens derived from a pathogen are not antigens which are naturally sufficiently effective for inducing an optimum protective immune response in the animal to be vaccinated. It is therefore necessary to improve the immune response.

Each route of administration has its own constraints and difficulties; thus, a DNA vaccine which is effective via one route of administration may be ineffective via another.

m:\specifications\500000\503000\53440cmphxg.doc 2 The choice of the route of administration should take into account the needs of practitioners and breeders, the difficulties linked to restraining the animals or to the nature of the product.

Although the intramuscular route can be used, the subcutaneous route is of great interest for the vaccination of pets, especially for animals which are small in size and which are difficult to handle.

DNA vaccines must therefore be improved in order to allow their effective administration via various routes.

DNA vaccines have already been used experimentally, in particular a DNA vaccine encoding haemagglutinin

(HA)

of the measles virus (Etchart et al. J. Gen. Virol.

1997. 78. 1577-1580) whose intranasal administration to mice proved to be more effective than an oral administration. Another example is a DNA vaccine encoding the envelope (Env) protein of the human immunodeficiency virus (HIV) whose subcutaneous administration has not been effective compared to the administration by the intramuscular route (Ishii et al. AIDS Res. Hum. Retro.

1997. 13. 1421-1428).

DNA vaccines have also been used experimentally against animal viruses, in particular against the canine distemper viruses (CDV). Some CDV immunogens are known, in particular the nucleocapsid protein the matrix protein the fusion protein and haemagglutinin (HA) (WO-A-9741236). However, the subcutaneous administration of a DNA vaccine encoding haemagglutinin and the fusion protein of CDV did not make it possible to detect the production of antibodies in mice, and allowed only a small production of antibodies after the intramuscular administration of this DNA vaccine (Sixt et al. J. Virol. 1998. 72. 8472-8476).

3 The induction of an immune response and the relationships between the various components of the immune system coming into play during this response may be different from one animal species to another. The many teachings taken from experiments carried out on the mouse model have made it possible to better understand the functioning of the immune system in mice, but these teachings are not directly transposable to other species, in particular because it is easier to induce an immune response in mice than in the other species (van Drunen Little-van den Hurk et al. J. Gen. Virol.

1998. 79. 831-839; Bhm et al. Vaccine 1998. 16.

949-954).

Various routes of administration of the DNA vaccine have been proposed (intraperitoneal, intravenous, intramuscular, subcutaneous, intradermal, mucosal, and the like). Various means of administration have also been proposed, in particular gold particles coated with DNA and projected so as to penetrate into the cells of the skin of the subject to be vaccinated (Tang et al.

Nature 1992. 356. 152-154) and the liquid jet injectors which make it possible to transfect both skin cells and cells of the underlying tissues (Furth et al.

Analytical Bioch. 1992. 205. 365-368).

Chemical compounds have been used for the in vitro transfection of DNA: A/ cationic lipids.

The cationic lipids are themselves divided into four subgroups.

1) The cationic lipids containing quaternary ammonium salts, such as for example DOTMA (dioleoyloxypropyltrimethylammonium, produced by Gibco under the name Lipofectine), DOTAP (trimethyl-2,3-(octadec-9-eneoyloxy)-l-propaneammonium; Gregoriadis et al. FEBS Letters 4 1997. 402. 107-110), DMRIE (N-(2-hydroxyethyl)- N,N-dimethyl-2,3-bis(tetradecyloxy)-l-propaneammonium; WO-A-9634109), DLRIE (N-(2-hydroxyethyl)-N,N-dimethyl- 2,3-bis(dodecyloxy)-l-propaneammonium; Felgner et al.

Ann. N Y Acad. Sci. 1995. 772. 126-139).

These cationic lipids containing quaternary ammonium salts may be combined or otherwise with an additional neutral lipid, such as DOPC (dioleoylphosphatidylcholine) or DOPE (dioleoylphosphatidylethanolamine) Behr, Bioconjugate Chemistry 1994. 5. 382-389).

2) The lipoamines, such as for example DOGS (dioctadecylamidoglycylspermine, produced by Promega under the name Transfectam; Abdallah et al. Biol. Cell. 1995. DC-Chol (dimethylaminoethane-carbamoylcholesterol; Gao and Huang, Biochem. Biophys. Res.

Commun. 1991. 179. 280-285), BGSC (bis-guanidinespermidine-cholesterol), BGTC (bis-guanidine-trencholesterol) (Vigneron et al. Proc. Natl. Acad. Sci.

USA 1996. 93. 9682-9686).

3) The cationic lipids containing quaternary ammonium salts and lipoamines, such as for example DOSPA (N,N-dimethyl-N-(2-(sperminecarboxamido)ethyl)-2,3-bis- (dioleoyloxy)-l-propaneimidium, pentahydrochloride, marketed by Gibco under the name LipofectAmine®; Hawley-Nelson et al. Focus 1993. 15. 73-79),

GAP-DLRIE

(N-(3-aminopropyl)-N,N-dimethyl-2,3-bis(dodecyloxy)- 1-propaneaminium; Wheeler et al. Proc. Natl. Acad. Sci.

USA 1996. 93. 11454-11459; Norman et al. Vaccine 1997.

801-803).

4) The lipids containing amidine salts, such as for example ADPDE, ADODE (Ruysschaert et al. Biochem.

Biophys. Res. Commun. 1994. 203. 1622-1628).

B/ the polymers, such as for example SuperFect

TM

(molecules of activated dendrimers, produced 5 by Qiagen; Xu et al. Mol. Genet. Metab. 1998. 64.

193-197), and C/ the biochemical agents, such as for example toxins, in particular cholera toxins.

Some of these compounds have also been used in the formulation of DNA vaccines with more than mitigated results. Knowledge in the field of in vitro transfection is not transposable to DNA vaccination where the final objective is to ensure a protective immune reaction. Negative effects on the induction of an effective immune protection have even been observed with compounds known to promote transfection in vitro.

Some formulation chemical compounds are toxic at high doses for the transfected cells.

In the work by Etchart already cited (Etchart et al. J.

Gen. Virol. 1997. 78. 1577-1580), the use of DOTAP did not have an adjuvant effect during the administration of the DNA vaccine by the intranasal route, whereas it had an adjuvant effect by the oral route. DOTAP has also been used in DNA vaccines encoding the influenza virus haemagglutinin (HA) on the mouse model which were administered by the intranasal route (Ban et al.

Vaccine 1997. 15. 811-813), but the addition of DOTAP inhibited the immune response. The use of DC-Chol or of DOTAP/DOPE in DNA vaccines encoding the hepatitis B virus surface protein on the mouse model which were administered by the intramuscular route made it possible to increase the antibody response, whereas the use of Lipofectine (or DOTMA) did not increase this response (Gregoriadis et al. FEBS Letters 1997. 402.

107-110). 'DC.Chol/DOPE has also been used in DNA vaccines against the human immunodeficiency virus (HIV, Env protein) on the mouse model, whose administration by the intramuscular route induced a more effective immune response, whereas the administration by the subcutaneous or intradermal route did not increase it 6 (Ishii et al. AIDS Res. Hum. Retro. 1997. 13.

1421-1428).

Likewise, WO-A-98 40499 proposes preparing nucleic acid cationic lipid complexes for transfecting the mucosal epithelium in mammals, for gene therapy or the expression of an antigen intended to induce an immune response. This document targets the mucosal route, by inhalation, for example the pulmonary epithelium. It specifies that its results differ from previous studies. It also adds that for the intramuscular (parenteral) route, naked DNA is more effective than a DNA lipid mixture.

The addition of certain cytokines, in particular interleukins or interferons, can make it possible to enhance the immune response induced in particular by DNA vaccines. Each cytokine triggers a reaction which is specific to it and orients the immune response to a greater or lesser degree towards a cellular response or towards a humoral response (Pasquini et al. Immunol.

Cell. Biol. 1997. 75. 397-401; Kim et al. J. Interferon Cytokine Res. 1999. 19. 77-84). The adjuvant effects of a cytokine obtained from a given species are not necessarily the same if the immune context varies, in particular if this cytokine is administered to another species, therefore in a heterologous immune system. The addition of cytokine may also have no adjuvant effect, or may even result in a reversal of the effect sought, that is to say a reduction or an inhibition of the immune response. Thus, a DNA vaccine encoding a single chain of an immunoglobulin fused with GM-CSF does not increase the immune response, whereas direct administration of this-fusion protein to mice is effective, in the same way as is the administration of a fusion protein consisting of Fv and of the cytokine IL-lbeta or the administration of a DNA vaccine encoding the latter fusion protein .(Hakim et al. J. Immunol. 1996.

157. 5503-5511). The use of plasmids co-expressing the 7 cytokine IL-2 and the hepatitis B virus envelope protein in a fused or nonfused conformation results in an increase in the humoral and cellular immune responses (Chow et al. J. Virol. 1997. 71. 169-78).

However, the use of a bicistronic plasmid encoding the human acquired immunodeficiency virus (HIV-1) glycoprotein gpl20 and the cytokine IL-2 induced a lower specific anti-gpl20 immune response than that obtained.

by the use of a monocistronic plasmid encoding only gpl20 (Barouch et al. J. Immunol 1998. 161. 1875-1882).

The co-injection, into mice, of two expression vectors, one coding for the rabies virus G glycoprotein, the other for murine GM-CSF stimulates the activity of the B and T lymphocytes, whereas the co-injection with a plasmid encoding gamma-interferon (in place of murine GM-CSF) results in a decrease in the immune response (Xiang et al. Immunity 1995. 2. 129-135).

Certain modifications in the antigens, such as deletions of part of the nucleotide sequence encoding the antigen, insertions of a DNA fragment into the nucleotide sequence encoding the antigen or into nontranslated regions upstream or downstream, can also enhance the efficacy of DNA vaccines, in particular by enhancing the level of expression of the antigen or its presentation.

However in practice, manipulations on the nucleotide sequence encoding the antigen may bring about a reduction or loss of the initial immunological activity. Thus, the deletion of the transmembrane domain from the gene encoding the rabies virus G antigen reduced the level of protection induced in the mouse model after administration by the intramuscular route of a DNA vaccine encoding this modified antigen (Xiang et al. Virol.-1995. 209. 569). The deletion of the transmembrane domain from the gene encoding the bovine herpesvirus. (BHV) gD glycoprotein need not make it possible to increase the antibody response and induced only a partial protection in bovines vaccinated by the intramuscular route (van Drunen Little-van den Hurk et al. J. Gen. Virol. 1998. 79. 831-839). The humoral and cellular immune responses and the protection conferred are identical in guinea pigs challenged after having been immunized with the aid of either a DNA vaccine encoding the Ebola virus GP glycoprotein, or of a DNA vaccine encoding this GP glycoprotein but in a secreted form (Xu et al. Nature Medicine 1998. 4. 37-42).

The insertion of the signal sequence of the human tissue plasminogen activator (tPA) into the gene encoding the malaria Pf332 antigen did not make it possible to increase the antibody response in mice vaccinated by the intramuscular route (Haddad et al.

FEMS 1997. 18. 193-202). The addition, in phase, of a tPA sequence to the gene encoding the murine rotavirus VP7 antigen also did not make it possible to increase the antibody response in mice vaccinated by the intradermal route, whereas the fusion protein consisting of the VP4 antigen and tPA allowed this increase, but without inducing an effective protection (Choi et al. Virology 1998. 250. 230-240).

The modifications carried out on the nucleotide sequence of one antigen cannot in general be directly transposed to another antigen, because antigens do not always have the same structural arrangements.

The invention desirably provides the enhancement of the efficacy of DNA vaccination.

This is in particular to obtain a better immune response and in particular an effective protection in pets and animals used in sports, in particular in dogs, cats and horses, by DNA vaccination, for various routes of administration, and in particular for the subcutaneous route.

The invention desirably provides the production of improved DNA vaccines which induce an effective and protective immune response against the canine distemper virus (CDV), the virus for the respiratory complex or kennel cough (parainfluenza-2 or CPI-2 virus), canine herpesvirus (CHV-1) in dogs.

The invention desirably provides the production of improved DNA vaccines which induce an effective and protective immune response against the feline herpes-virus (FHV-1) in cats.

The invention desirably provides the production of improved DNA vaccines which induce an effective and protective immune response against the equine herpesvirus type 1 (EHV-1), the equine herpesvirus type 4 (EHV-4) in horses.

The invention desirably provides the production of improved DNA vaccines which make it possible to obtain an effective protection in dogs, comprising at least one valency selected from the group consisting of the CDV virus, the CPI-2 virus, the CHV-1 virus, the rabies virus (rhabdovirus), the canine parvovirus (CPV), the canine coronavirus (CCV) and Borrelia burgdorferi.

The invention desirably provides the production of improved DNA vaccines which make it possible to obtain an effective protection in cats comprising at least one valency selected from the group consisting of the feline herpesvirus (FHV-1), the feline calicivirus (FCV), the rabies virus (rhabdovirus), the feline parvovirus (FPV), the feline infectious peritonitis virus (FIPV), the feline leukemia virus (FeLV), and the feline acquired immunodeficiency syndrome virus (FIV).

The invention desirably provides the production of improved DNA vaccines which make it possible to obtain an effective protection in horses, comprising at least 10 one valency selected from the group consisting of the equine herpesvirus type 1 (EHV-1), the equine herpesvirus type 4 (EHV-4), the equine influenza virus, the Eastern equine encephalitis virus, the Western equine encephalitis virus, the Venezuelan equine encephalitis virus, the rabies virus, Clostridium tetani, and Borrelia burgdorferi.

The subject of the invention is improved DNA vaccines which make it possible to obtain an effective protection against at least one pathogen which infects pets or animals used in sports, in particular dogs, cats and horses. The DNA vaccine is improved: either by its formulation, or by the addition of GM-CSF, or by the optimization of the antigen(s), or by combinations of these propositions.

Preferably, the DNA vaccine is improved by its formulation, and optionally either by the addition of GM-CSF, or by the optimization of the antigen(s), or finally by the addition of GM-CSF and by the optimization of the antigen(s).

By definition, the DNA vaccine comprises, as active ingredient, a plasmid encoding and expressing a gene or gene fragment. The term plasmid covers a DNA transcription unit comprising a polynucleotide sequence comprising the sequence of the gene to be expressed and the elements necessary for its expression in vivo. The circular plasmid form, supercoiled or otherwise, is preferred. The linear form also falls within the scope of this invention.

Each plasmid comprises a promoter capable of ensuring, in the host cells, the expression of the gene inserted under its control. It is in general a strong eukaryotic promoter and in particular a cytomegalovirus early promoter CMV-IE, of human or murine origin, or optionally of other origin such as rat or guinea pig. More 11 generally, the promoter is either of viral origin or of cellular origin. As a viral promoter other than CMV-IE, there may be mentioned the SV40 virus early or late promoter or the Rous Sarcoma virus LTR promoter. It may also be a promoter from the virus from which the gene is derived, for example the promoter specific to the gene. As cellular promoter, there may be mentioned the promoter of a cytoskeleton gene, such as for example the desmin. promoter, or alternatively the actin promoter. When several genes are present in the same plasmid, they may be provided in the same transcription unit or in two different units.

According to a first mode, the DNA vaccines according to the invention are formulated by adding, as adjuvant, cationic lipids containing a quaternary ammonium salt, in particular DMRIE, preferably combined with a neutral lipid, in particular DOPE, to preferably form

DMRIE-DOPE.

The subject of the present invention is therefore a DNA vaccine against at least one pathogen affecting pets and animals used in sports, in particular dogs, cats or horses, comprising at least one plasmid containing at least one nucleotide sequence encoding an immunogen of a pathogen of the animal species considered, under conditions allowing the in vivo expression of this sequence, and a cationic lipid containing a quaternary ammonium salt, of formula:

CH

3

R,-O-CH

2 CH -CH 2 N R 2

-X

OR

CH

3 in which RI is a saturated or. unsaturated, linear aliphatic radical having. 12 to 18 carbon atoms, R 2 is another aliphatic radical containing 2 or 3 carbon 12 atoms, and X is a hydroxyl or amine group.

Preferably, it is DMRIE (N-(2-hydroxyethyl)- N,N-dimethyl-2,3-bis(tetradecyloxy)-1-propaneammonium; WO-A-9634109), preferably combined with a neutral lipid, in particular DOPE (dioleoylphosphatidylethanolamine), to form DMRIE-DOPE.

Preferably, the recombinant vector is mixed with this adjuvant immediately before use and it is preferable, before its administration to the animal, to allow the mixture thus prepared to form a complex, for example for a period ranging from 10 to 60 minutes, in particular of the order of 30 minutes.

When DOPE is present, the DMRIE:DOPE molar ratio preferably ranges from 95:5 to 5:95, and is more particularly 1:1.

The plasmid:DMRIE or DMRIE-DOPE adjuvant weight ratio may range in particular from 50:1 to 1:10, in particular from 10:1 to 1:5, preferably from 1:1 to 1:2.

According to a second mode, GM-CSF (granulocyte macrophage-colony stimulating factor; Clark S.C. et al.

Science 1987. 230. 1229; Grant S.M. et al. Drugs 1992.

53. 516) is added to the vaccines according to the invention; this may be carried out by incorporating GM-CSF protein directly into the vaccinal composition or preferably by inserting the sequence encoding GM-CSF into an expression vector under conditions allowing its expression in vivo. As expression vector, the use of a plasmid, e.g. the plasmid containing the nucleotide sequence encoding the antigen(s) of interest or another plasmid, is preferred. The choice of GM-CSF is made according to the animal species to be vaccinated; thus, for dogs, canine GM-CSF is used; for cats, it is feline GM-CSF, and equine GM-CSF for horses.

13 According to a third mode, the nucleotide sequence(s) encoding the immunogen are in an optimized form.

Optimization is understood to mean any modification of the nucleotide sequence, in particular which manifests itself at least by a higher level of expression of this nucleotide sequence, by an increase in the stability of the messenger RNA encoding this antigen, by the triggered secretion of this antigen into the extracellular medium, and having as direct or indirect consequence an increase in the immune response induced.

In the present invention, the optimization of the antigen of interest preferably consists in the deletion of the fragment of the nucleotide sequence encoding the transmembrane domain of the antigen of interest (deletion is understood to mean the complete deletion or a partial deletion sufficient for the transmembrane domain to no longer, or no longer substantially, be functional), and/or in the addition, in phase, of a nucleotide sequence encoding the tPA (tissue plasminogen activator; Montgomery et al. Cell. Mol. Biol. 1997.

43. 285-292; Harris et al. Mol. Biol. Med 1986. 3.

279-292) signal, and/or in the insertion of a stabilizing intron upstream of the gene to be expressed. The deletion of the DNA fragment encoding the transmembrane domain of the antigen of interest promotes the secretion, into the extracellular medium, of the antigens thus truncated and thus increases the possibilities of their coming into contact with the cells of the immune system. The insertion of the nucleotide sequence encoding the tPA signal facilitates the translatability of the messenger RNA to which the tPA signal is joined, and thus increases the .level of expression of this messenger RNA and therefore the production of antigens.

The tPA signal also plays a role in the secretion of the antigen synthesized. The insertion of a stabilizing intron into the gene encoding the antigen of interest avoids the aberrant splicings of its messenger RNA and 14 maintains the physical integrity of the latter.

Preferably, the tPA signal is of human origin. The nucleotide sequence of the human tPA signal is accessible from the GenBank database under the accession number NM_000930. Preferably, the intron is intron II of the rabbit beta-globin gene (van Ooyen et al. Science 1979. 206. 337-344), whose nucleotide sequence is accessible from the GenBank database under the accession number V00882 and designated by a reference under intron No. 2.

The subject of the present invention is an improved DNA vaccine capable of inducing an effective and protective immune response in dogs against canine distemper (Canine Distemper Virus or CDV).

The canine distemper virus is a Morbillivirus, a member of the Paramyxoviridae family. This virus infects the canine species, but also wild-type felines (Harder et al. J. Gen. Virol. 1996. 77. 397-405).

The present invention makes it possible to obtain an effective and protective DNA vaccine against canine distemper in dogs, in particular by the subcutaneous route which had remained up until now a route inducing a marginal level of protection (Sixt et al. J. Virol.

1998. 72. 8472-8476).

According to the invention, the DNA vaccine against CDV is preferably improved by its formulation with an adjuvant according to the invention, in particular DMRIE, preferably DMRIE-DOPE. Optionally, this may be combined either with the.. addition of canine GM-CSF (Nash et al. Blood 1991.. 78. 50-56), or the optimization of at least one CDV. antigen, or finally the addition of canine GM-CSF and the optimization of at least one CDV antigen.

15 A nucleotide sequence encoding canine GM-CSF is accessible from the GenBank database under the accession number S49738.

The addition of canine GM-CSF may be carried out by the incorporation of the canine GM-CSF polypeptide into the vaccinal composition or preferably by the insertion of the nucleotide sequence encoding the canine GM-CSF into an in vivo expression vector, preferably. a plasmid.

Preferably, the nucleotide sequence encoding canine GM-CSF is inserted into a second expression plasmid, different from that (or those) into which the gene(s) encoding the CDV antigen(s) is(are) inserted.

The optimization of the antigens derived from CDV is carried out by substitution, by a "signal" sequence, in particular that of the tPA signal of human origin (GenBank accession number NM_000930), of the sequence of the signal peptide of haemagglutinin (HA) and/or of the fusion protein and/or by the deletion of the DNA fragment encoding the transmembrane *domain of HA and/or of F, and/or by the insertion of an intron, in particular of intron II of the rabbit beta-globin gene (whose nucleotide sequence, noted intron No. 2, is accessible from the GenBank database under the accession number V00882) upstream of the nucleotide sequence .encoding HA and/or F. The DNA vaccine against CDV according to the invention can therefore .encode and express a single optimized CDV antigen (HA or F) or both, that is to say optimized HA and optimized F.

Optionally, the sequence encoding the CDV matrix protein in its native form (without modification) and/or the nucleotide sequence encoding the CDV nucleoprotein in its native form (without modification) may also be inserted and- expressed in a plasmid and combined with the plasmids containing optimized HA and/or optimized F.

16 Nucleotide. sequences encoding the CDV antigens which can be used in the present invention and various constructs of expression vectors are illustrated in the accompanying examples and in WO-A-9803199, in particular in Examples 8 and 9 and Figures 2 and 3.

Preferably, according to the invention, the DNA vaccine against CDV for administration by the intramuscular route is formulated with DMRIE-DOPE, and is composed of an expression plasmid pNS024, Figure 4) encoding the CDV HA antigen optimized by replacement of the HA signal sequence with the human tPA signal peptide sequence, by deletion of the fragment of the nucleotide sequence encoding the transmembrane domain of HA and by insertion of intron II of the rabbit beta-globin gene upstream of the HA gene, and of a second expression plasmid pNS021, Figure 3) encoding the CDV F antigen optimized by the deletion of the fragment of the nucleotide sequence encoding the transmembrane domain and by the insertion of intron II of the rabbit beta-globin gene upstream of the F gene.

Preferably, according to the invention, the DNA vaccine against CDV for administration by the subcutaneous route is formulated with DMRIE-DOPE, and is composed of an expression plasmid encoding canine GM-CSF and the two plasmids previously defined pNS024 and pNS021).

The subject of the present invention is also an improved DNA vaccine capable of inducing an effective and protective immune response in dogs against the respiratory complex or kennel cough (canine parainfluenza-2 or CPI-2 virus).

The CPI-2 virus is a Paramyxovirus, also a member of the Paramyxoviridae family (Bittle et al. J. Am. Vet.

Med. Assoc. 1970. 156. 1771-1773; Moloney et al. Aust Vet J. 1985. 62. 285-286).

17 The DNA vaccine against CPI-2 is preferably formulated with an adjuvant according to the invention, in particular DMRIE, preferably DMRIE-DOPE. This may be optionally combined with either the addition of canine GM-CSF, or the optimization of at least one CPI-2 antigen, or finally the addition of canine GM-CSF and the optimization of at least one CPI-2 antigen.

The addition of canine GM-CSF may be carried out as is described for CDV.

The optimization of the antigens derived from CPI-2 is carried out by substitution, by a "signal" sequence, in particular that of the tPA of human origin, of the signal sequence of the haemagglutinin-neuraminidase (HN) of CPI-2 and/or of the fusion protein of CPI-2, and by the deletion of the DNA fragment encoding the transmembrane domain of HN and/or of F, and by the insertion of an intron, in particular intron II of the rabbit beta-globin gene upstream of the nucleotide sequence encoding HN and/or F. The DNA vaccine against CPI-2 according to the invention may therefore encode and express a single optimized CPI-2 antigen (HN or F) or both (HN and F).

Nucleotide sequences encoding the CPI-2 antigens which can be used in the present invention and various expression vector constructs are given in the accompanying examples.

Preferably, according to the invention, the DNA vaccine against CPI-2 for administration by the intramuscular route-is formulated with DMRIE-DOPE, and is composed of an expression plasmid pSB034, Figure 6) encoding the HN antigen of CPI-2 optimized by the insertion of the signal sequence of the human tPA in place of the signal-sequence of HN, by the deletion of the fragment of the nucleotide sequence of HN encoding the trans- 18 membrane domain and by the insertion of intron II of the rabbit beta-globin gene upstream of HN, and of a second expression plasmid pSB032, Figure encoding the F antigen of CPI-2 optimized by the deletion of the fragment of the nucleotide sequence encoding the transmembrane domain of F and by the insertion of intron II of the rabbit beta-globin gene upstream of F.

Preferably, according to the invention, the DNA vaccine against CPI-2 for administration by the subcutaneous route is formulated with DMRIE-DOPE, and is composed of an expression plasmid encoding canine GM-CSF, and. of the two plasmids previously defined pSB034 and pSB032).

The subject of the present invention is also an improved DNA vaccine capable of inducing an effective and protective immune response in dogs against the canine herpesvirus type 1 (CHV-1).

The CHV-1 virus is a member of the Alphaherpesvirinae family. This virus is responsible for canine viral rhinotracheitis. Nucleotide sequences encoding the gB, gC and gD glycoproteins are known (Limbach et al. J.

Gen. Virol. 1994. 75. 2029-2039).

The DNA vaccine against CHV-1 is preferably formulated with an adjuvant according to the invention, in particular DMRIE, preferably DMRIE-DOPE. This may be optionally combined with either the addition of canine GM-CSF, or the optimization of at least one CHV-1 antigen, or finally the addition of canine GM-CSF and the optimization of at least one CHV-1 antigen.

The addition of canine GM-CSF may be carried out as is described for CDV.

The optimization of the antigens derived from CHV-1 is 19 carried out by the deletion of the DNA fragment encoding the transmembrane domain of the gB glycoprotein and/or of the gC glycoprotein and/or of the gD glycoprotein of CHV-1. The improved DNA vaccine against CHV-1 according to the invention may therefore encode and express a single optimized CHV-1 antigen (gB, gC or gD) or two of them or the three.

Nucleotide sequences encoding the CHV-1 antigens which can be used in the present invention and various expression vector constructs are given in the accompanying examples and in WO-A-98/03199, in particular in Examples 7 and 8, and in Figures 13 and 14.

Preferably, according to the invention, the DNA vaccine against CHV-1 for administration by the intramuscular route is formulated with DMRIE-DOPE, and is composed of an expression plasmid pSB016, Figure 7) encoding the CHV-1 gB antigen, optimized by the deletion of the fragment of the nucleotide sequence encoding the transmembrane domain, of a second expression plasmid pSB019, Figure 8) encoding the CHV-1 gC antigen optimized by the deletion of the fragment of the nucleotide sequence encoding the transmembrane domain and of a third expression plasmid pSB017, Figure 9) encoding the CHV-1 gD antigen optimized ,by the deletion of the fragment of the nucleotide sequence encoding the transmembrane domain.

Preferably, according to the invention, the DNA vaccine against CHV-1 for administration by the subcutaneous route is formulated with DMRIE-DOPE, and is composed of an expression plasmid encoding canine GM-CSF, and the three plasmids previously defined pSB016, pSB019 and pSB017).

The subject of the present invention is an improved DNA vaccine capable of inducing an effective and protective immune response in cats against the feline herpesvirus 20 type 1 (FHV-1).

The FHV-1 virus is a member of the Alphaherpesvirinae family, this virus is responsible for feline viral rhinotracheitis (Fargeaud et al. Arch. Virol. 1984. 69-82).

The DNA vaccine against FHV-1 is preferably formulated -with an adjuvant according to the invention, in particular DMRIE, preferably DMRIE-DOPE. This may be optionally combined either with the addition of feline GM-CSF, or the optimization of at least one FHV-1 antigen, or finally the addition of feline GM-CSF and the optimization of at least one FHV-1 antigen.

The addition of feline GM-CSF may be carried out by the incorporation of the feline GM-CSF polypeptide into the vaccinal composition or by the insertion of a nucleotide sequence encoding the feline GM-CSF (e.g.

accessible from the GenBank database under the accession number AF053007) into an in vivo expression vector, preferably a plasmid. Preferably, the nucleotide sequence encoding feline GM-CSF is inserted into a second expression plasmid, different from that (or those) into which the gene(s) encoding the FHV-1 antigen(s) is(are) inserted.

The optimization of the antigens derived from FHV-1 is carried out by the deletion of the DNA fragment encoding the transmembrane domains of the gB glycoprotein and/or of the gC glycoprotein and/or of the gD glycoprotein of FHV-1. The improved DNA vaccine against FHV-1 according to the invention may therefore encode and express a single optimized FHV-1 antigen (gB, gC or gD) or two- of them or the three.

Nucleotide sequences -encoding the FHV-1 antigens which can be used in the present invention and various expression vector constructs are given in the accom- 21 panying examples and in WO-A-98/03660, in particular in Examples 14 and 15 and in Figures 11 and 12.

Preferably, according to the invention, the DNA vaccine against FHV-1 for administration by the intramuscular route is formulated with DMRIE-DOPE, and is composed of an expression plasmid pSB021, Figure 10) encoding the FHV-1 gB antigen optimized by the deletion of the fragment of the nucleotide sequence encoding the transmembrane domain, of a second expression plasmid pSB023, Figure 11) encoding the FHV-1 gC antigen optimized by the deletion of the fragment of the nucleotide sequence encoding the transmembrane domain and of a third expression plasmid pSB024, Figure 12) encoding the FHV-1 gD antigen optimized by the deletion of the fragment of the nucleotide sequence encoding the transmembrane domain.

Preferably, according to the invention, the DNA vaccine against FHV-1 for administration by the subcutaneous route is formulated with DMRIE-DOPE, and is composed of an expression plasmid encoding feline GM-CSF, and the three plasmids previously defined pSB021, pSB023 and pSB024).

The subject of the present invention is an improved DNA vaccine capable of inducing an effective and protective immune response in horses against the equine herpesvirus type 1 (EHV-1) The EHV-1 virus is a member of the Alphaherpesvirinae family. The EHV-1 virus is responsible for equine viral abortion (Crabb et al. Adv. Virus Res. 1995. 45. 153- 190). The complete, genome of this virus has been determined (Telford et al. Virology 1992. 189.

304-316).

The DNA vaccine against EHV-1 is preferably formulated with an adjuvant according to the invention, in 22 particular DMRIE, preferably DMRIE-DOPE. This may be optionally combined with either the addition of equine GM-CSF, or the optimization of at least one EHV-1 antigen, or finally the addition of equine GM-CSF and the optimization of at least one EHV-1 antigen.

The addition of equine GM-CSF may be carried out by the incorporation of the equine GM-CSF polypeptide into the vaccinal composition or by the insertion of the nucleotide sequence SEQ ID NO 69, Figure 26) encoding equine GM-CSF into an in vivo expression vector, preferably a plasmid. Preferably, the nucleotide sequence encoding equine GM-CSF is inserted into a second expression plasmid, different from that (or those) into which the gene(s) encoding the EHV-1 antigen(s) is(are) inserted.

The optimization of the antigens derived from EHV-1 is carried out by the deletion of the DNA fragment encoding the transmembrane domains of the gB glycoprotein and/or of the gC glycoprotein and/or of the gD glycoprotein of EHV-1. The improved DNA vaccine against EHV-1 according to the invention may therefore encode and express a single optimized EHV-1 antigen (gB, gC or gD) or both of them or the three.

Nucleotide sequences encoding the EHV-1 antigens which can be used in the present invention and various expression vector constructs are given in the accompanying examples and in WO-A-98/03198, in particular in Examples 8 and 10, and in Figures 2 and 4.

The intramuscular route is preferred for horses.

Preferably, according to the invention, the DNA vaccine against EHV-i for administration by the intramuscular route is formulated with DMRIE-DOPE, and is composed of an expression plasmid pSB028, Figure 13) encoding the EHV-1 gB antigen optimized by the deletion of the fragment of the nucleotide sequence encoding the 23 transmembrane domain, of a second expression plasmid pSB029, Figure 14) encoding the EHV-1 gC antigen optimized by the deletion of the fragment of the nucleotide sequence encoding the transmembrane domain and of a third expression plasmid pSB030, Figure 15) encoding the EHV-1 gD antigen optimized by the deletion of the fragment of the nucleotide sequence encoding the transmembrane domain.

It is possible, however, to use the subcutaneous route.

In this case, the DNA vaccine against EHV-1 is preferably formulated with DMRIE-DOPE, and is composed of an expression plasmid encoding equine GM-CSF, and of the three plasmids previously defined pSB028, pSB029 and pSB030).

The subject of the present invention is an improved DNA vaccine capable of inducing an effective and protective immune response in horses against the equine herpesvirus type 4 (EHV-4) The EHV-4 virus is a member of the Alphaherpesvirinae family. The EHV-4 virus is responsible for equine viral rhinopneumonia (Crabb et al. Adv. Virus Res. 1995. 153-190). The complete genome of this virus has been determined (Telford et al. J. Gen. Virol. 1998. 79.

1197-1203).

The DNA vaccine against EHV-4 is preferably formulated with an adjuvant according to the invention, in particular DMRIE, preferably DMRIE-DOPE. This may be optionally combined with either the addition of equine GM-CSF, or the optimization of at least one EHV-4 antigen, or finally the addition of equine GM-CSF and the optimization of at least one EHV-4 antigen.

The addition of equine GM-CSF may be made as is described for EHV-1.

24 The optimization of the antigens derived from EHV-4 is carried out by the deletion of the DNA fragment encoding the transmembrane domain of the glycoprotein gB and/or the glycoprotein gC and/or the glycoprotein gD of EHV-4. The improved DNA vaccine against EHV-4 according to the invention may therefore encode and express a single optimized EHV-4 antigen (gB, gC or gD) or two of them or the three.

Nucleotide sequences encoding the EHV-4 antigens which can be used in the present invention and various expression vector constructs are ,given in the accompanying examples and in WO-A-98/03198, in particular in Examples 9 and 11, and in Figures 3 and Preferably, according to the invention, the DNA vaccine against EHV-4 for administration by the intramuscular route is formulated with DMRIE-DOPE, and is composed of an expression plasmid pSB025, Figure 16) encoding the EHV-4 gB antigen optimized by the deletion of the fragment of the nucleotide sequence encoding the transmembrane domain, of a second expression plasmid pSB026, Figure 17) encoding the EHV-4 gC antigen optimized by the deletion of the fragment of the nucleotide sequence encoding the transmembrane domain and of a third expression plasmid pSB027, Figure 18) encoding the EHV-4 gD antigen optimized by the deletion of the fragment of the nucleotide sequence encoding the transmembrane domain.

For the subcutaneous route, the DNA vaccine against EHV-4 is preferably formulated with DMRIE-DOPE, and is composed of an expression plasmid encoding equine GM-CSF, and the-three plasmids previously defined (e.g.

pSB025, pSB026 and pSB027).

Although the invention is described in relation to specific DNA vaccines, the invention also applies to DNA vaccines directed against other pathogens of these 25 animal species. Thus, the various valencies described in this application may be the subject of an improved vaccine, in particular by the addition of the adjuvant of the invention, or of GM-CSF, or optionally gene optimization, or combinations of these propositions, as is described here in detail for some valencies.

In the same line of thought, the vaccines according to the invention may be, for an animal species, combined with one another and/or with DNA vaccines directed against other pathogens of the same species.

Thus, the subject of the present invention is also improved multivalent DNA vaccines which make it possible to obtain an effective protection in dogs against at least two canine pathogens selected from the group consisting of CDV, CPI-2, CHV-1, rabies virus (rhabdovirus), canine parvovirus (CPV), canine coronavirus (CCV), Borrelia burgdorferi.

The subject of the present invention is also improved multivalent DNA vaccines which make it possible to obtain an effective protection in cats against at least two feline pathogens selected from the group consisting of FHV-1, feline calicivirus (FCV), rabies virus (rhabdovirus), feline parvovirus (FPV), feline infectious peritonitis virus (FIPV), feline leukaemia virus (FeLV), feline acquired immunodeficiency syndrome virus

(FIV).

The subject of the present invention is also improved multivalent DNA vaccines which make it possible to obtain an effective protection in horses against at least two equine pathogens selected from the group consisting of EHV-1, EHV-4, equine influenza virus, Eastern equine encephalitis virus, Western equine encephalitis virus, Venezuelan equine encephalitis virus, rabies virus, .Clostridium tetani, Borrelia burgdorferi.

26 The multivalent DNA vaccines may be improved by their formulation with an adjuvant according to the invention, in particular with DMRIE, preferably with DMRIE-DOPE. This may be optionally combined either with the addition of GM-CSF as previously described, or with the optimization of at least one antigen of interest as previously described, or finally by the addition of GM-CSF -and the optimization of at least one antigen of interest.

The improved multivalent DNA vaccines according to the invention are composed of one or more expression plasmids, such. that these vaccines lead to the in vivo expression of at least one immunogen of a first pathogen and of at least one immunogen of at least one other pathogen, infecting the same animal species. At least one of these immunogens is preferably selected from the members of the following group: F of CDV, HA of CDV, F of CPI-2, HN of CPI-2, gB of CHV-1, gC of CHV-1 and gD of CHV-1 for dogs, gB of FHV-1, gC of FHV-1 and gD- of FHV-1 for cats, and gB of EHV-1, gC of EHV-1, gD of EHV-1, gB of EHV-4, gC of EHV-4 and gD of EHV-4 for horses.

The improved monovalent or multivalent DNA vaccines according to the invention may also be combined with at least one conventional vaccine (inactivated, attenuated live, subunits) or recombinant vaccine using an in vivo expression vector poxvirus, adenovirus, herpesvirus) directed against at least one, in particular different, pathogen infecting the same species.

Persons skilled in the art may refer to WO-A-9803198 for the methods for constructing the plasmids containing these equine valencies, to WO-A-9803660 for the feline valencies and to WO-A-9803199 for the canine valencies.

The subject of the present invention is also a method of vaccinating pets and animals used in sports, in particular dogs, cats or horses. This vaccination method comprises the administration of one of the monovalent or multivalent improved DNA vaccines as described above. This vaccination method comprises the administration of one or more doses of the improved DNA vaccine.

The quantity of DNA used in the vaccines according to the present invention is between about 10 jig and about 1000 gg, and preferably between about 50 jig and about 500 jig, for a given plasmid. Persons skilled in the art possess the competence necessary to precisely define the effective dose of DNA to be used for each vaccination protocol.

The dose volumes may be preferably between 0.5 and 5 ml, preferably between 1 and 3 ml.

The improved DNA vaccines according to the invention may be administered, in the context of this vaccination method, by the various routes of administration proposed in the prior art for polynucleotide vaccination and by means of known techniques of administration.

According to the two preferred modes of the invention, the methods of vaccination comprise the administration of the improved DNA vaccines according to the invention by the intramuscular route or by the subcutaneous route.

The present invention provides a DNA vaccine against a pathogen of a host, wherein the host is a dog and the pathogen is canine distemper virus (CDV), comprising at least one DNA plasmid that contains and expresses, in a host cell, a nucleotide sequence encoding an immunogen of the pathogen, and as an adjuvant a cationic lipid containing a quaternary ammonium salt, of formula: 27a

CH

3

I+

R, -O-CH 2

-CH-CH

2 -N R 2

-X

OR,

CH

3 in which R 1 is a saturated or unsaturated linear aliphatic radical having 12 to 18 carbon atoms, R 2 is another aliphatic radical containing 2 or 3 carbon atoms, and X a hydroxyl or amine group.

The present invention also provides an immunogenic composition against a pathogen of a host, wherein the host is a dog and the pathogen is canine distemper virus (CDV), comprising at least one plasmid that contains and expresses, in a host cell, a nucleotide sequence encoding an immunogen of the pathogen, and as an adjuvant a cationic lipid containing a quaternary ammonium salt, of formula:

CH

3

I+

R

1 O- HCH-CH CH- N R- X OR,

CH

3 in which Ri is a saturated or unsaturated linear aliphatic radical having 12 to 18 carbon atoms, R 2 is another aliphatic radical containing 2 or 3 carbon atoms, and X a hydroxyl or amine group.

The present invention further provides a DNA vaccine against a pathogen of a host, wherein the host is a dog and the pathogen is canine distemper virus (CDV), comprising at least one DNA plasmid that contains and expresses, in a host cell, a nucleotide sequence encoding an immunogen of the pathogen, and as an adjuvant a cationic lipid comprising DMRIE, wherein the vaccine further comprises dioleoylphosphatidylethanolamine (DOPE).

Throughout this specification the word "comprise", or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated element, integer or 27b step, or group of elements, integers or steps, but not the exclusion of any other element, integer or step, or group of elements, integers or steps.

Any discussion of documents, acts, materials, devices, articles or the like which has been included in the present specification is solely for the purpose of providing a context for the present invention. It is not to be taken as an admission that any or all of these matters form part of the prior art base or were common general knowledge in the field relevant to the present invention as it existed in Australia before the priority date of each claim of this application.

The invention will now be described in greater detail with the aid of embodiments taken as nonlimiting examples and referring to the drawing in which: Figure No. 1: Plasmid pAB 28 Figure Figure Figure Figure Figure Figure Figure Figure Figure Figure Figure Figure Figure Figure Figure Figure Figure Figure Figure Figure Figure Figure Figure Figure Figure Figure 1 Figure I No.

No.

No.

No.

No.

No.

No.

No.

No.

No.

No.

No.

No.

No.

No.

No.

No.

No.

No.

No.

No.

No.

No.

No.

No.

NSo.

No.

2: 3: 4: 5: 6: 7: 8: 9: 10: 11: 12: 13: 14: 15: 16: 17: 18: 19: 20.: 21: 22: 23: 24: 25: 26: 27: 28: Plasmid pVR1012 Plasmid pNS021 Plasmid pNS024 Plasmid pSB032 Plasmid pSB034 Plasmid pSB016 Plasmid pSB019 Plasmid pSB017 Plasmid pSB021 Plasmid pSB023 Plasmid pSB024 Plasmid pSB028 Plasmid pSB029 Plasmid pSB030 Plasmid pSB025 Plasmid pSB026 Plasmid pSB027 Plasmid pJP084 sequence of the Plasmid pJP089 sequence of the Plasmid pJP090 sequence of the Plasmid pJP097 sequence of the sequence of the sequence of the canine GM-CSF gene feline GM-CSF gene 3R3 feline GM-CSF gene 3R4 equine GM-CSF gene CPI-2 F gene CPI-2 HN gene Sequence listing: SEQ ID NO 1: oligonucleotide NS030 SEQ ID NO 2: oligonucleotide NS031 SEQ ID NO 3: oligonucleotide NS034 SEQ ID NO 4: oligonucleotide NS035 SEQ ID NO 5: oligonucleotide NS036 SEQ ID NO 6: oligonucleotide NS037 SEQ ID NO 7: oligonucleotide SB090 SEQ ID NO 8: oligonucleotide SB091 SEQ ID NO 9: oligonucleotide PB326 SEQ ID NO 10: oligonucleotide PB329 29

SEQ

SEQ

SEQ

SEQ

SEQ

SEQ

SEQ

SEQ

SEQ

SEQ

SEQ

SEQ

SEQ

SEQ

SEQ

SEQ

SEQ

SEQ

SEQ

SEQ

SEQ

SEQ

SEQ

SEQ

SEQ

SEQ

SEQ

SEQ

SEQ

SEQ:

SEQ

SEQ

SEQ

SEQ

SEQ I

S.EQI

SEQ I SEQ I I

ID

ID

ID

ID

ID

ID

ID

ID

ID

ID

ID

ID

ID

ID

ID

ID

ID

ID

ID

ID

ID

ID

D N D N D N D N D N D N D NC D NC D NC D NC

)NC

)NO

)NO

)NO

)NO

)NO

)NO

)NO

NO

NO

'NO

NO

NO

NO

NO

NO

NO

NO

NO

NO

NO

NO

NO

NO

NO

NO

NO

NO

0 11 0 12 D 13 )14 is1 )16 )17 )18 19.

20 21 22: 23~ 24: 2 5: 26: 27 28: 29: 30: 31: 32: 33: 34: 35: 36: 37: 38: 39 40: 41: 42: 43: 44: 45: 46: 4 7: 48: :oligonucleotide :oligonucleotide :oligonucleotide :oligonucleotide :oligonucleotide :oligonucleotide :oligonucleotide :oligonucleotide :oligonucleotide :oligonucleotide :oligonucleotide :oligonucleotide oligonucleotide Qligonucleotide oligonucleotide oligonucleotide oligonucleotide ci igonucleotide oligonucleotide oligonucleotide ci igonucleot ide oligonucleotide oligonucleotide oligonucleotide oligonucleotide oligonucleotide oligonucleotide oligonucleotide oligonucleotide oligonucleotide

I

oligonucleotide

I

oligonucleotide oligonucl eotide oligonucl eotide E~ oligonucleotide

S

oligonucleoti'de

S

oligonucleotide

S

oligonucleptide

S-

PB3 81 PB382 PB 383 PB3 84 S~ill SB102 SB103 SB104 SB105 SB1 06 SB107 SBl08 SBl 09 SB11O S13i SB112 SBI13 SB114 SB116 SB117 SB118 A13 325 DB326 B3 32 7 %B3 328 %B3 329 MB qS 003 ~S004 Sos00 ~S006 S0 0 7 TS008 :B119 B120 B121.

B122 SEQ ID NO 49: oligonucleotide SB123 30 SEQ ID NO 50: SEQ ID NO 51: SEQ ID NO 52: SEQ ID NO 53: SEQ ID NO 54: SEQ ID NO 55: SEQ ID NO 56: SEQ ID NO 57: SEQ ID NO 58: SEQ ID NO 59: SEQ ID NO 60: SEQ ID NO 61: SEQ ID NO 62: SEQ ID NO 63: SEQ ID NO 64: SEQ ID NO 65: oligonucleotide SB124 oligonucleotide SB125 oligonucleotide SB126 oligonucleotide SB127 oligonucleotide SB128 oligonucleotide SB129 oligonucleotide SB130 oligonucleotide SB131 oligonucleotide SB132 oligonucleotide SB133 oligonucleotide SB134 oligonucleotide SB135 oligonucleotide SB136 oligonucleotide SB137 oligonucleotide JP578 oligonucleotide JP579 SEQ ID NO 66: sequence of the canine GM-CSF gene (see Figure SEQ ID NO 67: sequence of the feline GM-CSF 3R3 gene (see Figure 22) SEQ ID NO 68: sequence of the feline GM-CSF 3R4 gene (see Figure 24) SEQ ID NO 69: sequence of the equine GM-CSF gene (see Figure 26) SEQ ID NO 70: oligonucleotide JP734 SEQ ID NO 71: oligonucleotide JP735 SEQ ID NO 72: sequence of the CPI-2 F gene (see Figure 27) SEQ ID NO 73: sequence of the CPI-2 HN gene (see Figure 28)

EXAMPLES:

For each of the pathogens considered, each gene encoding the principal surface antigens (native form and modified form) was the subject of a particular construction in a eukaryotic expression plasmid. The secreted forms of the surface antigens were obtained by deletion of the fragments of genes encoding the 31 transmembrane and cytoplasmic domains. In all cases, the transmembrane domains of the glycoproteins were identified on the basis of the hydropathy profiles of the corresponding protein sequences. The table given in Example 11 summarizes the sizes of the wild-type proteins (in amino acids), the positions identified in the transmembrane domains, the sizes of the truncated proteins, as well as the names of the corresponding expression plasmids.

Example 1: Basic plasmid constructs The eukaryotic expression plasmid pVR1020 Luke et al. J. of Infectious Diseases 1997, 175: 95-97), derived from the plasmid pVR1012 (Figure 1, Example 7 of WO-A-9803199, repeated in Figure 2 of the present application), contains the coding phase of the signal sequence of the human tissue plasminogen activator (tPA). The plasmid pVR1020 was modified by BamHI-BglII digestion and insertion of a sequence containing several cloning sites (BamHI, NotI, EcoRI, XbaI, PmlI, PstI, BglII) and resulting from the pairing of the following oligonucleotides: PB326 (40 mer) (SEQ ID NO 9) GATCTGCAGCACGTGTCTAGAGGATATCGAATTCGCGGCC 3' and PB329 (40 mer) (SEQ ID NO GATCCGCGGCCGCGAATTCGATATCCTCTAGACACGTGCT 3'.

The resulting vector, pAB110 (Figure No. was used for the construction of the plasmids containing the truncated forms of the genes encoding the canine distemper virus (CDV) haemagglutinin (HA) and the parainfluenza virus type 2 (CPI-2) haemagglutininneuraminidase (HN).

Intron II of the rabbit P-globin gene was cloned into the vector pCRII (Invitrogen, Carlsbad, CA, USA) after production of the corresponding DNA fragment by PCR 32 with the aid of the following oligonucleotides: SB090 (20 mer) (SEQ ID NO 7) TTGGGGACCCTTGATTGTTC 3' and SB091 (21 mer) (SEQ ID NO 8) CTGTAGGAAAAAGAAGAAGGC 3' using as template the genomic DNA of rabbit peripheral blood cells. The resulting plasmid was designated pNS050.

Example 2: Plasmids encoding the various forms of the CDV antigens The genes encoding the fusion protein and the haemagglutinin (HA) of CDV strain Snyder Hill (SH) were obtained by RT-PCR from the viral RNA of the SH strain (accessible from the strain depository American Tissue Culture Collection under the number ATCC VR-526).

2.1. Plasmids encoding the various forms of CDV-F 2.1.1. pPB229: F gene (native form) cloned into the vector pVR1012 The cDNA of the CDV F gene was synthesized with the aid of the primer PB383 and amplified by a PCR reaction with the aid of the following pair of oligonucleotides: PB383 (26 mer) (SEQ ID NO 13) 5' TTTCTAGACAGCCGAGCCCCATGCAC 3' and PB384 (30 mer) (SEQ ID NO 14) TTGGATCCGATATATGACCAGAATACTTCA 3'.

The PCR product was digested with BamHI and XbaI and cloned into the expression vector pVR1012 (Example 1) previously digested with BamHI and XbaI, generating the plasmid pPB229 (6925 base pairs or bp). The CDV wildtype F gene encodes a protein-of 662 residues.

33 2.1.2. pNS021: F gene (form P-globin F ATM) cloned into the vector pVR1012 The plasmid pNS013 (6735 bp) containing the F gene truncated of the transmembrane and C-terminal domain was obtained by ligation of a Bsu36I-BamHI fragment (6593 bp) derived from the plasmid pPB229 (Example and of a 142-bp fragment obtained by PCR from the template pPB229 with the aid of the following oligonucleotides: NS030 (21 mer) (SEQ ID NO 1) ATGAGCCCACTCTTACAACAA 3' and NS031 (35 mer) (SEQ ID NO 2) 5' TTTCGCGGATCCATTAAAGGAAGAGCGCCTAACCG 3' and Bsu36I-BamHI digested. The CDV truncated F gene encodes a protein of 605 residues.

In a second instance, a sequence corresponding to intron II of the rabbit 3-globin gene was inserted upstream of the coding sequence of the truncated F gene, into the SalI site of the plasmid pNS013. The DNA fragment corresponding to the intron (573 bp) was obtained by PCR with the aid of the following oligonucleotides: NS036 (34 mer) (SEQ ID NO TTTACGCGTCGACTTGGGGACCCTTGATTGTTC 3' and NS037 (36 mer) (SEQ ID NO 6) 5' TTTACGCGTCGACCTGTAGGAAAAAGAAGAAGGCAT 3' on the template pNS050 (Example followed by SalI digestion to release SalI compatible ends. The derivative of the plasmid pNS013 containing intron II of the P-globin gene is designated pNS021 (7308 bp) (Figure No. 3).

34 0 2.2. Plasmids encoding the various forms of CDV-HA 2.2.1. pNS018: HA gene (native form) cloned into the vector pVR1012 c The cDNA of the CDV HA gene was synthesized with the aid of the primer PB381 and amplified by PCR reaction c with the aid of the following pair of oligonucleotides: PB381 (30 mer) (SEQ ID NO 11) V 5' TTCTGCAGATGCTCTCCTACCAAGAYAAGG 3' and SPB382 (28 mer) (SEQ ID NO 12) TTGTCGACATGTGTATCATCATMCTGTC 3'.

The PCR product was cloned into the vector pCRII (Invitrogen, Carlsbad, CA, USA), generating the plasmid pPB235. The PstI-SalI fragment of 1846 bp of the plasmid pPB235 containing the HA gene was then cloned into the PstI-SalI digested expression vector pVR1012 (Example generating the plasmid pNS018 (6748 bp) The CDV wild-type HA gene encodes "a protein of 607 residues.

2.2.2. pNS024: HA gene (form 3-globin tPA ATM HA) cloned into the vector pVR1012 The truncated form of the CDV HA gene was obtained by deletion of the DNA fragment encoding the first residues of the HA protein. The signal sequence and the transmembrane sequence of this protein being indistinguishable, the. secretion of the truncated product is ensured by the production of a fusion in phase between the signal sequence of the human tissue plasminogen activator (tPA) and the truncated HA gene. The plasmid pNS019, the derivative of pNS018 encoding a fusion product with the tPA signal,. was obtained by the ligation of the following 3 DNA fragments: Fragment A was obtained by BamHI-EcoRV digestion of 35 pAB110 (Example 1).

Fragment B was obtained by PCR reaction on the template pNS018 (Example 2.2.1) with the aid of the following oligonucleotides: NS034 (30 mer) (SEQ ID NO 3) TTTCGCGGATCCCACAAAGTATCAACTAGC 3' and NS035 (23 mer) (SEQ ID NO 4) 5' GGGATTTGCTGCCGATGCAATAG 3' followed by a BamHI-SapI digestion of the PCR product.

Fragment C is a fragment of SapI-EcoRV digestion of pNS018.

The hybrid gene tPA ATM HA encodes a protein of 574 residues (1725 bp).

Intron II of the rabbit P-globin gene (Example 2.1.2) was inserted upstream of the coding frame of the HAgene into the SalI site of pNS019 to generate the plasmid pNS024 (Figure No. 4).

Example 3: Plasmids encoding the various forms of the antigens of the canine parainfluenza virus type 2 (CPI-2) The F and HN genes of CPI-2 strain D008 (MERIAL) were obtained by RT-PCR from the viral RNA.

3.1. Plasmids encoding the various forms of CPI-2 F 3.1.1. pAB115: F gene (native form) cloned into the vector pVR1012 The cDNA of the CPI-2 F gene was synthesized and amplified by RT-PCR with the aid of the following pair of oligonucleotides: 36 SB131 (38 mer) (SEQ ID NO 57) AAAAACGCGTCGACATGGGTACTATAATTCAATTTCTG 3' SB132 (38 mer) (SEQ ID NO 58) TTTTCTAGTCTAGATTATTTATGATAAACAAAATTCTC 3'.

The PCR product was digested with SalI and XbaI, generating a fragment of 1594 bp, and cloned into the expression vector pVR1012 (Example 1) previously digested with the same enzymes, generating the plasmid pAB115 (6479 bp). The CPI-2 wild-type F gene (SEQ ID NO 72) (Figure 27) cloned into this plasmid encodes a protein of 529 residues.

3.1.2. pSB032: F gene (form 3 -globin F ATM) cloned into the vector pVR1012 The plasmid pSB031 containing the F gene truncated of the transmembrane and C-terminal cytoplasmic domains was obtained in the following manner. A PCR reaction was carried out with the template pAB115 (Example with the aid of the following oligonucleotides: SB131 (SEQ ID NO 57) and SB133 (41 mer) (SEQ.ID NO 59) 5' TTTTCTAGTCTAGATTAGTATGTGTCACTTTGTGCTAAGTG 3' to generate a PCR fragment of about 1450 bp. This fragment was digested with SalI and XbaI in order to isolate the SalI-XbaI restriction fragment of 1436 bp.

This fragment was ligated into the vector pVR1012 (Example 1) previously digested with SalI and XbaI to give the plasmid pSB031. The CPI-2 truncated F gene encodes a protein of 473 residues.

In a second instance, a sequence corresponding to intron II. of the rabbit 3-globin gene was inserted upstream of the coding sequence of.the CPI-2 truncated F gene, into the SalI site of the plasmid pSB031. The DNA fragment corresponding to the intron (573 bp) was obtained by PCR with the aid of the oligonucleotides 37 NS036 (SEQ ID NO 5) and NS037 (SEQ ID NO 6) on the template pNS050 (Example followed by SalI digestion to release the SalI compatible ends. This SalI-SalI restriction fragment was ligated into the plasmid pSB031 previously digested with SalI, and then dephosphorylated to give the plasmid pSB032 (6884 bp) (Figure No. 3.2. Plasmids encoding the various forms of CPI-2 HN 3.2.1. pAB114: HN gene (native form) cloned into the vector pVR1012 The cDNA of the CPI-2 HN gene was synthesized and amplified with the aid of the following oligonucleotides: SB134 (41 mer) (SEQ ID NO AAAAACGCGTCGACATGGTTGCAGAAGATGCCCCTGTTAGG 3' SB135-(35 mer) (SEQ ID NO 61) TTTTGGAAGATCTTTAGGATAGTGTCACCTGACGG 3' in order to generate a PCR fragment of about 1720 bp.

This fragment was digested with SalI and BglII in order to isolate the SalI-BglI fragment of 1704 bp. This fragment was then ligated into the vector pVR1012 (Example previously digested with SalI and BglII, to give the plasmid pAB114 (6566 bp). The CPI-2 wildtype HN gene (SEQ ID NO 73) (Figure 28) cloned into this plasmid encodes a protein of 565 residues.

3.2.2. pSB034: HN gene (form 3 -globin HN tPA ATM) cloned into the vector pVR1012 The truncated form of the CPI-2 HNgene was obtained by deletion of the DNA fragment encoding the first residues of the HN protein. The .signal and transmembrane sequences of this protein being indistinguishable, the secretion of the truncated protein is ensured by the production of a fusion in phase between 38 the signal sequence of the human tissue plasminogen activator (tPA) and the'truncated HN gene. The plasmid pSB033, derived from pAB114 (Example encoding a fusion product with tPA, was obtained by ligation of the EcoRI-PmlI fragment of pAB110 (Example a derivative of pVR1012 containing an open reading frame encoding the tPA signal sequence and of a fragment of (1599 bp) obtained by PCR with the aid of the following oligonucleotides: SB136 (37 mer) (SEQ ID NO 62) TTAAAAGAATTCGACCCAAAAGCAAATCATGAGCCAC 3' SB137 (33 mer) (SEQ ID NO 63) TTAAAAGGCCTTTAGGATAGTGTCACCTGACGG 3' on the template pAB114 and digested with EcoRI and EcoRV.

Intron II of the rabbit -globin gene was inserted upstream of the coding frame of the HN gene into the SalI site of pSB033 to generate the plasmid pSB034 (Figure No. The SalI fragment containing the intron was obtained by PCR with the aid of the oligonucleotides NS036 (SEQ ID NO 5) and NS037 (SEQ ID NO 6) on the template pNS050 (Example 1).

Example 4: Plasmids encoding the various forms of the CHV-1 virus glycoproteins The genes encoding the glycoproteins gB, gC and gD of the Carmichael strain of the canine herpesvirus type I (CHV-1) were isolated by PCR from the viral genome. The cloning of the genes encoding gB and gD into the vector pVR1012 was previously described in patent application WO-A-9803199 (plasmids pAB037 and pAB038, respectively in Figures 7 and 8 and in Examples 13 and 14). On the other hand, the cloning of the gene encoding gC is described in this document.

39 4.1. Plasmid encoding the truncated form of CHV-gB 4.1.1. pSB016: gB gene (ATM form) cloned into the vector pVR1012 Depending on the hydropathy profile, the transmembrane domain of the CHV-1 gB protein (878 amino acids) is positioned between residues 702 and 769. The plasmid containing the truncated form of the gene encoding gB was obtained by ligation of the following three DNA fragments: the vector pVR1012 (Example 1) linearized by a double PstI-XbaI digestion, a fragment of 1997 bp obtained by PstI-NsiI digestion of pAB037 (Example 4) and a fragment of 225 bp obtained by PCR with the aid of the following oligonucleotides: SB101 (22 mer) (SEQ ID NO TATATTGAAGGACAACTTGGGG 3' and SB102 (36 mer) (SEQ ID NO 16) 5' CTAGTCTAGATTAATTATTATCAACTTTTACAACAC 3' using the plasmid pAB037 as template and digested with NsiI and XbaI. The resulting plasmid, pSB016 (6983 bp) (Figure No. 7) contains a truncated gB gene encoding a protein of 701 residues.

4.2. Plasmids encoding the various forms of CHV-gC 4.2.1. pSB018: gC gene (native form) cloned into the vector pVR1012 The DNA fragment containing the open reading frame of the CHV-1 gC gene was obtained by PCR with the aid of the following oligonucleotides: SB105 (32 mer).(SEQ ID NO 19) AAAACTGCAGATGAGTTTTAAAAATTTTTATC 3' and SB106 (30 mer) (SEQ ID NO CTAGTCTAGATTAGATCTTATTATTTTTTG 3' using the viral DNA as template. This PCR product was 40 digested with PstI and XbaI generating a fragment of 1400 bp, which was then ligated into the vector pVR1012 (Example 1) linearized by the same double digestion.

The resulting plasmid, pSB018 (6253 bp), contains the gene encoding the gC glycoprotein of 459 residues.

4.2.2. pSB019: gC gene (ATM form) cloned into the vector pVR1012 Depending on the hydropathy profile, the transmembrane domain of the gC protein is between residues 422 and 452. The plasmid containing the truncated form of the gene encoding gD was obtained by ligation of the following three DNA fragments: the vector pVR1012 (Example 1) linearized by a double PstI-XbaI digestion, a fragment of 934 bp obtained by PstI-StuI digestion of pSB018 (preceding example) and a fragment of 335 bp obtained by PCR with the aid of the following oligonucleotides: SB107 (24 mer) (SEQ ID NO 21) TGGATTGACGGTCTTATAACAGGC 3' and SB108 (37 mer) (SEQ ID NO 22) CTAGTCTAGATTAATTTTCATCCGATGCATCAAACAC 3' using the plasmid pSB018 as template and digested with StuI and XbaI. The resulting plasmid, pSB019 (6139 bp) (Figure No. contains a truncated gC gene encoding a protein of 421 residues.

4.3. Plasmid encoding the truncated form of CHV-gD 4.3.1. pSB017: gD gene (ATM form) cloned into the vector pVR1012 The transmembrane domain of the CHV-1 gD protein (345 amino acids) is between residues 310 -and 328. The plasmid containing the truncated form of the gene encoding gD was obtained by ligation of the following three DNA fragments: the vector pVR1012 (Example 1) 41 linearized by a double PstI-NotI digestion, a fragment of 663 bp obtained by PstI-AvaII digestion of pAB038 (Example 4) and a fragment of 415 bp obtained by PCR with the aid of the following oligonucleotides: SB103 (25 mer) (SEQ ID NO 17) CGAGAAACTTGTTATTTTTCTAAAG 3' and SB104 (51 mer) (SEQ ID NO 18)- 5'ATAAGAATGCGGCCGCAAAGGCTATATATTTTTTGGGGTATTATTTATTGG 3' using the plasmid pAB038 as template and digested with AvaIl and NotI. The resulting plasmid, pSB017 (5819 bp) (Figure No. contains a truncated gD gene encoding a protein of 309 residues.

Example 5: Plasmids encoding the various forms of the FHV-1 glycoproteins The genes encoding the glycoproteins gB, gC and gD of the CO strain of the feline herpesvirus type 1 (FHV-1) were isolated by PCR from the viral genome. In the specific case of the gene encoding gD, whose nucleotide sequence is identical to that of the C-27 strain, we used the plasmid pAB029, derived from pVR1012 containing the corresponding gene cloned from strain C- 27 and described in patent application WO-A-9803660 (plasmid pAB029, Figure 12 and Example 5.1. Plasmids encoding the various forms of FHV-gB 5.1.1. pSB020: gB gene (native form) cloned into the vector pVR1012 The DNA fragment containing the open reading frame of the FHV-1 gB gene was obtained by PCR with the aid of the following oligonucleotides: SB113 (34 mer) (SEQ ID NO 27) 3' and 42 SB114 (40 mer) (SEQ ID NO 28) 3' using the viral DNA as template. The PCR product was digested with PstI and NotI, generating a fragment of 2849 bp, which was then ligated into the vector pVR1012 (Example 1) linearized by the same double digestion.

The resulting plasmid, pSB020 (7728 bp), contains the gene encoding the gB glycoprotein of 949 residues.

5.1.2. pSB021: gB gene (ATM form) cloned into the vector pVR1012 Depending on the hydropathy profile, the transmembrane domain of the. FHV-1 gB protein is situated between residues 761 and 834. The plasmid containing the truncated form of the gene encoding gB was obtained by ligation of the following three DNA fragments: the vector pVR1012 (Example 1) linearized by a double PstI- NotI digestion, a fragment of 1839 bp obtained by PstI-HindII digestion of pSB020 (preceding-example) and a fragment of 447 bp obtained by PCR with the aid of the following oligonucleotides: SB109 (24 mer) (SEQ ID NO 23) 5' CTGTGGACAGAGACCCTAAAACTC 3' and SB110 (50 mer) (SEQ ID NO 24) 3' using the plasmid pSB020 as template and digested with HindII and NotI. The resulting plasmid, pSB021 (7164 bp) (Figure No. 10), contains a truncated gB gene encoding a protein of 760 residues.

5.2. Plasmids encoding the various forms of FHV-gC 5.2.1. pSB022: gC gene (native form) cloned into the vector pVR1012 The DNA fragment containing the open reading frame of the FHV-1 gC gene was obtained by PCR with the aid of 43 the following oligonucleotides: SB115 (34 mer) (SEQ ID NO 29) 3' and SB116 (34 mer) (SEQ ID NO 3' using the viral DNA as template. This PCR product was digested with PstI and NotI, generating a fragment of 1605 bp, which was then ligated into the vector pVR1012 (Example 1) linearized by the same double digestion.

The resulting plasmid, pSB022 (6483 bp), contains the gene encoding the gC glycoprotein of 534 residues.

5.2.2. pSB023: gC gene (ATM form) cloned into the vector pVR1012 Depending on the hydropathy profile, the transmembrane domain of the FHV-1 gC protein is between residues 495 and 526. The. plasmid containing the truncated form of the gene encoding gC was obtained by ligation of the following two DNA fragments: a fragment of 6198 bp obtained by BclI and NotI digestion of pSB022 (preceding example) and a fragment of 168 bp obtained by PCR with the aid of the following oligonucleotides: SB117 (24 mer) (SEQ ID NO 31) 3' and SB118 (41 mer) (SEQ ID NO 32) 5'AGTTTAGCGGCCGCTTATTCAGGGGACGCGTCGTAGACTTG 3' using the plasmid pSB022 as template and digested with BclI and NotI. The resulting plasmid, pSB0.23 (6366 bp) (Figure No. 11), contains a truncated gC gene encoding a protein of 494 residues.

44 5.3. Plasmid encoding the truncated form of FHV-gD 5.3.1. pSB024: gD gene (ATM form) cloned into the vector pVR1012 The transmembrane domain of the FHV-1 gD protein (374 amino acids) is between residues 328 and 353. The plasmid containing the truncated form of the gene encoding gD was obtained by ligation of the following two DNA fragments: a fragment of 5712 bp obtained by XbaI-BglII digestion of pAB029 (Example 5) and a fragment of 129 bp obtained by PCR with the aid of the following oligonucleotides: SB111 (24 mer) (SEQ ID NO 3' and SB112 (39 mer) (SEQ ID NO 26) 3' using the plasmid pAB029 as template and digested with XbaI and BglII. The resulting plasmid, pSB024 (5841 bp) (Figure No. 12), contains a truncated gD gene encoding a protein of 327 residues.

Example 6: Plasmids encoding the various forms of the EHV-1 glycoproteins The genes encoding the glycoproteins gB, gC and gD of the 2234/88-2 strain of EHV-1 were isolated by PCR from the purified viral DNA.

6.1. Plasmids encoding the various forms of EHV-1 gB 6.1.1. pAB127: gB gene (native form) cloned into the vector pVR1012 The coding frame of the EHV-1 gB gene was amplified by PCR with the aid of the following oligonucleotides: NS003 (30 mer) (SEQ ID NO 39) 45 3' and NS004 (30 mer) (SEQ ID NO TTTCTAGATTAAACCATTTTTTCATTTTCC 3', the DNA fragment obtained was digested with PstI and XbaI and ligated into the vector pVR1012 (Example 1) linearized with PstI and XbaI, generating the plasmid pAB127 (7818 bp). The gB gene encodes a protein of 980 amino acids.

6.1.2. pSB028: gB gene (ATM form) cloned into the vector pVR1012 Depending on the hydropathy profile, the transmembrane domain of the .EHV-1 gB protein is positioned between residues 801 and 875. The plasmid containing the truncated form of the gene encoding gB was obtained by ligation of the following two DNA fragments: the plasmid pAB127 (Example 6.1.1) digested with Afel and XbaI, and a fragment of 276 bp obtained by PCR with the aid of the following oligonucleotides: SB125 (24 mer) (SEQ ID NO 51) AACAACAGAGGGTCGATAGAAGGC 3' and SB126 (39 mer) (SEQ ID NO 52) 5'AATTTTTCTAGATTACACGTTGACCACGCTGTCGATGTC 3' using the plasmid pAB127 as template and digested with AfeI and XbaI. The resulting plasmid, pSB028 (7279 bp) contains a truncated EHV-1 gB gene encoding a protein of 800 residues.

6.2. Plasmids encoding the various forms of EHV-1 gC 6.2.1. pAB129: gC gene (native form) cloned into the vector pVR1012 The DNA fragment containing the open reading frame of the EHV-1 gC gene was obtained by PCR with the aid of the following oligonucleotides: 46 NS005 (31 mer) (SEQ ID NO 41) TTGTCGACATGTGGTTGCCTAATCTCGTGAG 3' and NS006 (33 mer) (SEQ ID NO 42) TTGGATCCCTAAAAGTCAGACTTCTTGTACGGC 3'.

This PCR product was digested with SalI and BamHI generating a fragment of 1412 bp, which was then ligated into the vector pVR1012 (Example 1) linearized by the same double digestion. The -resulting plasmid, pAB129 (6281 bp), contains the gene encoding the EHV-1 gC glycoprotein and having a size of 468 residues.

6.2.2. pSB029: gC gene (ATM form) cloned into the vector pVR1012 Depending on the hydropathy profile, the transmembrane domain of the EHV-1 gC protein is between residues 429 and 455. The plasmid containing the truncated form of the gene encoding gC was obtained by ligation of the following two DNA fragments: the plasmid pAB129 (Example linearized by a double AspI-BamHI digestion and a fragment of 287 bp obtained by PCR with the aid of the following oligonucleotides: SB127 (24 mer) (SEQ ID NO 53) GATCCGGAGGAGGAATACACACCC 3' and SB128 (39 mer) (SEQ ID NO 54) AATTTTGGATCCCTAAACCGGCCTGTCCTCAACAATCGG 3' using the plasmid pAB129 as template and digested with AspI and BamHI. The resulting plasmid, pSB029 (6161 bp), contains a truncated gC gene encoding a protein of 428 residues.

6.3. Plasmids encoding the truncated form of EHV-1 gD 6.3.1. pAB131: gD gene (native form) cloned into the vector pVR1012 The DNA fragment containing the open reading frame of 47 the EHV-1 gD gene was obtained by PCR with the aid of the following oligonucleotides: NS007 (33 mer) (SEQ ID NO 43) 5' TTGTCGACATGTCTACCTTCAAGCTTATGATGG 3' and NS008 (32 mer) (SEQ ID NO 44) TTGGATCCTTACGGAAGCTGGGTATATTTAAC 3'.

This PCR product was digested with SalI and BamHI generating a fragment of 1214 bp, which was then ligated into the vector pVR1012 (Example 1) linearized by the same double digestion. The resulting plasmid, pAB138 (6083 bp) contains the gene encoding the gD glycoprotein of 402 residues.

6.3.2. pSB030: gD gene (ATM form) cloned into the vector pVR1012 Depending on .the hydropathy profile, the transmembrane domain of the EHV-1 gD protein is between residues 348 and 371. The plasmid containing the truncated form of the gene encoding gD was obtained by ligation of the following three DNA fragments: the plasmid pVR1012 (Example 1) linearized by a double SalI-BamHI digestion, the fragment of 825 bp derived from the digestion of pAB131 (Example with SalI and BsmI and a fragment of 239 bp obtained by PCR with the aid of the following oligonucleotides: SB129 (24 mer) (SEQ ID NO CGGTTTCTTGGTGAATTCAACTTC 3' and SB130 (42 mer) (SEQ ID NO 56) AATTTTGGATCCTTACGTAGAGTTGCTCTTAGACGTTTTTGG 3' using the plasmid pAB131 as template and digested with BsmI and BamHI. The resulting plasmid pSB030 (5921 bp), contains a truncated gD gene encoding a protein of 347 residues.

48 Example 7: Plasmids encoding the various forms of the EHV-4 glycoproteins The genes encoding the gB, gC and gD glycoproteins of the KYT445/2 strain of EHV-4 were isolated by PCR from the purified viral DNA.

7.1. Plasmids encoding the various forms of EHV-4 gB 7.1.1. pAB136: gB gene (native form) cloned into the vector pVR1012 The coding frame of the EHV-4 gB gene was amplified by PCR with the aid of the following oligonucleotides: AB325 (35 mer) (SEQ ID NO 33) TTTCTGCAGATGTCCACTTGTTGCCGTGCTATTTG 3' and AB326 (31 mer) (SEQ ID NO 34) TTTTCTAGAT.TAAACCATTTTTTCGCTTTCC 3' the DNA fragment obtained was digested with PstI and XbaI and ligated into the vector pVR1012 (Example 1) linearized with PstI and XbaI, generating the plasmid pAB136 (7801 bp). The EHV-4 gB gene encodes a protein of 975 amino acids.

7.1.2. pSB025: gB gene (ATM form) cloned into the vector pVR1012 Depending on the hydropathy profile, the transmembrane domain of the EHV-4 gB protein is positioned between residues 797 and 867. The plasmid containing the truncated form of the gene encoding gB was obtained by the ligation of the following two DNA fragments: (a) the plasmid pAB136 (Example digested with-SplI and XbaI, and a fragment of 231 bp obtained by PCR with the aid of the following oligonucleotides: SB119 (36 mer) (SEQ ID NO TTTTGGTCTAGATTAGTCCACGTTGACAACGCTGTC 3' and 49 SB120 (23 mer) (SEQ ID NO 46) CGCAAGCTTATCGAGCCGTGCGC 3' using the plasmid pAB136 as template and digested with SplI and XbaI. The resulting plasmid, pSB025 (7264 bp), contains a truncated gB gene encoding a protein of 796 residues.

7.2. Plasmids encoding the various forms of EHV-4 gC 7.2.1. pAB137: gC gene (native form) cloned into the vector pVR1012 The DNA fragment containing the open reading frame of the EHV-4 gC gene was obtained by PCR with the aid of the following oligonucleotides: AB327 (32 mer) (SEQ ID NO TTTGTCGACATGGGTTTGGTAAATATAATGCG 3' and AB328 (33 mer) (SEQ ID NO 36) 5' TTTGGATCCTTAGAAGTCTGCTTTCTTGTAGGG 3'.

This PCR product was digested with SalI and BamHI generating a fragment of 1463 bp, which was then ligated into the vector pVR1012 (Example 1) linearized by the same double digestion. The resulting plasmid, pAB137 (6330 bp), contains the gene encoding the gC glycoprotein of 485 residues.

7.2.2. pSB026: gC gene (ATM form) cloned into the vector pVR1012 Depending on the hydropathy profile, the transmembrane domain of the EHV-4 gC protein is between residues 425 and 472. The plasmid containing the truncated form of the gene encoding gC was obtained by ligation of -the following two DNA, fragments the plasmid pAB137 (Example linearized by a double AclI-BamHI digestion and a fragment of 237 bp obtained by PCR with the aid of the following oligonucleotides: 50 SB121 (24 mer) (SEQ ID NO 47) GTATCAATCCCAGCTGACCCCGAC 3' and SB122 (41 mer) (SEQ ID NO 48) 5' AATTTTGGATCCTTAGCCGTCCGGGTAACCCTCTATGATGC 3' using the plasmid pAB137 as template and digested with AclI and BamHI. The resulting plasmid, pSB026 (6147 bp), contains a truncated gC gene encoding a protein of 424 residues.

7.3. Plasmids encoding the truncated form of EHV-4 gD 7.3.1. pAB138: gD gene (native form) cloned into the vector pVR1012 The DNA fragment containing the open reading frame of the EHV-4 gD gene was obtained by PCR with the aid of the following oligonucleotides: -AB329 (33 mer) (SEQ ID NO 37) TTTGTCGACATGTCTACCTTCAAGCCTATGATG 3' and AB330 (33 mer) (SEQ ID NO 38) TTTGGATCCTTACGGAAGCTGAGTATATTTGAC 3'.

This PCR product was digested with SalI and BamHI generating a fragment of 1214 bp, which was then ligated into the vector pVR1012 (Example 1) linearized by the same double digestion. The resulting plasmid, pAB138 (6081 bp) contains the gene encoding the gD glycoprotein of 402 residues.

7.3.2. pSB027: gD gene (ATM form) cloned into the vector pVR1012 Depending on the hydropathy profile, the transmembrane domain of the EHV-4 gD protein is between residues 348.

and 371. The plasmid containing the truncated form of the gene encoding gD was obtained by ligation of the following two DNA fragments: the plasmid pAB138 51 (Example linearized by a double EcoRI-BamHI digestion and a fragment of 310 bp obtained by PCR with the aid of the following oligonucleotides: SB123 (24 mer) (SEQ ID NO 49) TTTTCCGTAACAATTCCGAGCAGC 3' and SB124 (39 mer) (SEQ ID NO AATTTTGGATCCTTACGTAGAGTTGCTATTAGACGCTGG 3' -using the plasmid pAB138 as template and digested with EcoRI and BamHI. The resulting plasmid, pSB027 (5919 bp), contains a truncated gD gene encoding a protein of 347 residues.

Example 8: Plasmid encoding the canine GM-CSF 8.1. Preparation of the total RNA of dog lymphocytes stimulated in vitro by mitogens Dog blood was collected over a tube containing EDTA by a blood collection made on a Beagle dog. The mononucleated cells were harvested by centrifugation on a Ficoll gradient, and then cultured on a Petri dish mm in diameter. The dog mononucleated cells were then stimulated with concanavalin A (ConA) (final concentration of about 4 Ag/ml) and with phytohaemagglutinin (PHA) (final concentration of about Ag/ml). After stimulation, the "ConA" and "PHA" lymphoblasts were harvested by scraping the culture dishes, and the total RNA of these cells was extracted using the kit "mRNA isolation kit for White Blood Cells" (Boehringer Mannheim/Roche Cat 1 934 325).

8.2. Isolation of the gene encoding canine GM-CSF and construction of the plasmid pJP074 The total RNA extracted from the dog lymphoblasts stimulated by ConA or by PHA (Example served as template for the synthesis of the complementary DNA.

first strand. This complementary DNA first strand was 52 produced by extension of the oligonucleotide p(dT) (Boehringer Mannheim/Roche Cat 814 270). The singlestranded complementary DNA obtained was then used as template for a PCR reaction with the following oligonucleotides: JP578 (SEQ ID NO 64) (33 mer) TATGCGGCCGCCACCATGTGGCTGCAGAACCTG 3' and JP579 (SEQ ID NO 65) (36 mer) 5' TATGCGGCCGCTACGTATCACTTCTTGACTGGTTTC 3' in order to amplify a PCR fragment of about 450 base pairs This fragment was purified by agarose gel electrophoresis, and then ligated into the vector pCR2.1 (InVitrogen, Carlsbad, CA, USA) to give the plasmid pJP074. The sequence of the canine GM-CSF gene cloned in the plasmid pJP074 was found to be equivalent to that of the canine GM-CSF sequence available on GenBank (accession number S49738).

8.3. Construction of the plasmid pJP084 and sequence of the canine GM-CSF gene The plasmid pJP074 (Example 8.2) was digested with NotI in order to isolate, after agarose gel electrophoresis, the NotI-NotI fragment of about 450 bp containing the canine GM-CSF gene. This fragment was ligated into the plasmid pVR1012 (Example The clone containing the canine GM-CSF sequence (SEQ ID NO 66, Figure No. 20) in the correct orientation relative to the hCMV/IE promoter was identified pJP084. This plasmid has a size of 5364 bp (Figure No. 19).

Example 9: Plasmid encoding feline GM-CSF 9.1. Preparation of the total RNA of cat lymphocytes stimulated in vitro by mitogens Cat blood was collected over a tube containing EDTA by a blood collection. The mononucleated cells were 53 harvested by centrifugation on a Ficoll gradient, and then cultured on a Petri dish 60 mm in diameter. The cat mononucleated cells were then stimulated with concanavalin A (ConA) (final concentration of about 4 gg/ml) and with phytohaemagglutinin (PHA) (final concentration of about 10 pg/ml) After stimulation, the "ConA" and "PHA" lymphoblasts were harvested by scraping the culture dishes, and the total RNA of these cells was extracted using the kit "mRNA isolation kit for White Blood Cells" (Boehringer Mannheim/Roche Cat 1 934 325).

9.2. Isolation of the gene encoding feline GM-CSF and construction of the plasmids pJP089 and pJP090 The total RNA extracted from the cat lymphoblasts stimulated by ConA or by PHA (Example served as template for the synthesis of the complementary DNA first strand. This complementary DNA first strand was produced- by extension of the oligonucleotide p(dT) (Boehringer Mannheim/Roche Cat #814 270). The singlestranded complementary DNA obtained was then used as template for a PCR reaction with the following oligonucleotides: JP578 (SEQ ID NO 64) (33 mer) TATGCGGCCGCCACCATGTGGCTGCAGAACCTG 3' and JP579 (SEQ ID NO 65) (36 mer) TATGCGGCCGCTACGTATCACTTCTTGACTGGTTTC 3' in order to amplify a PCR fragment of about 450 base pairs This fragment was digested with NotI in order to isolate, after agarose gel electrophoresis, the NotI-NotI fragment of 450 bp. This fragment was then ligated into the plasmid pVR1012 (Example Two clones containing the feline GM-CSF sequence (SEQ ID NO 67 and SEQ ID NO 68), in the correct orientation relative to the hCMV/IE promoter were identified pJPO89 and pJP090 respectively. These two plasmids have a size of 5364 bp (Figures No. 21 and 23).

55 10.2. Isolation of the gene encoding equine GM-CSF The total RNA extracted from the horse lymphoblasts stimulated by ConA or by PHA (Example 10.1.) served as template for the synthesis of the complementary DNA first strand. This complementary DNA first strand was produced by extension of the oligonucleotide p(dT) (Boehringer Mannheim/Roche Cat 814 270). The singlestranded complementary DNA obtained was then used as template for a PCR reaction with the following oligonucleotides: JP734 (SEQ ID NO 70) (44 mer) CATCATCATGTCGACGCCACCATGTGGCTGCAGAACCTGCTTCT 3' and JP735 (SEQ ID NO 71) (41 mer) CATCATCATGCGGCCGCTACTTCTGGGCTGCTGGCTTCCAG 3' in order to 'amplify a PCR fragment of about 500 base pairs This fragment was purified by agarose gel electrophoresis.

10.3. Construction of the plasmid pJP097 and sequence of the equine GM-CSF gene The purified PCR fragment obtained in Example 10.2. was digested with NotI in order to isolate, after agarose gel electrophoresis, the NotI-NotI fragment of about 450 bp containing the equine GM-CSF gene. This fragment was ligated into the plasmid pVR1012 (Example The clone containing the equine GM-CSF sequence (SEQ ID NO 69, Figure No. 26) in the correct orientation relative to the hCMV/IE promoter was identified pJP097. This plasmid has a size of 5334 bp (Figure No. 2005202233 23 May 2005 56 Example 11: Summary table for the plasinids Pathogen I Anitigen No. of residues native form T;M doma i n CDV F 662 CPI-2 HA 607 1-60** F 529 j 474-517

HN

CHV-1 g3B gC gD FHV- 1 gB gC gD EHV- 1 gB gC gD EHV-4 gB gC gDT 565 878 459 345 949 534 374 980 468 402 975 485 402 1-40** 422-452 310-328 761-834 495-526 328-353 801-875 429 -455 348-371 797 -867 425 -472 348 -371 No. ofExpression plasmids resi dues truncated form 605 pPB229 and pNSO21* 574 pNS018 and pNSO24* 473 pABilS and pSBO32* 557 pAB114 and pSBO34* 701 pA.B037 and pSBO16* 421 pSBO18 and pSB019* 309 pABO38 and pSBO17* 760 pSBO20 and pSBO21* 494 pSBO22 and pSBO23* 327 pA-B029 and pSBO24* 800 PAB127 and pSB028* 428 pA.B12 9 and pSBO29* 347 pAB131 and pSBO3O* 796 pAB136 and 424 pAB137 and pSBO26* 347 pAB138 and pSBO27* Plasmids encoding the truncated forms of the antigens Specific case of the CDV HA and CPI-2 HN genes: transmembrane domain and signal sequence indistinguishable 57 Example 12: Molecular biology methods Culture and purification of the viruses The viruses were cultured on appropriate cellular systems until a cytopathic effect was obtained. The cellular systems to be used for each virus are well known to persons skilled in the art. Briefly, the appropriate cells were infected with the viral strain studied at a multiplicity of infection of one and were incubated at 370°C for the time necessary to obtain a cytopathic effect (on average 36 hours).

In the case of the DNA viruses, after the culture, the supernatant and the lysed cells were harvested and the cellular debris was removed by centrifugation at 1000 g and at 4 0 C for 10 minutes. The viral particles were harvested by ultracentrifugation at 400,000 g and for 1 hour. .The pellets were taken up in a minimum volume of buffer (10 mM Tris, 1 mM EDTA).

The RNA viruses were purified according to standard purification techniques well known to persons skilled in the art.

Extraction of the viral genomic DNA The concentrated viral suspensions were treated with proteinase K (100 mg/ml final) in the presence of sodium dodecyl sulphate (SDS) final) for 2 hours at 370°C. The viral DNA was then extracted with the aid of a phenol/chloroform mixture, and then precipitated with two volumes of absolute ethanol at -200C for 16 hours and then centrifuged at 10,000 g for minutes at 40°C. The DNA pellets were dried, and then taken up in a minimum volume of sterile ultrapure water.

58 Isolation of viral genomic RNA The genomic RNA of each virus was extracted using the "guanidinium thiocyanate/phenol-chloroform" technique described by P. Chomczynski and N. Sacchi (Anal.

Biochem. 1987. 162. 156-159).

Molecular biology techniques All the constructions of plasmids were carried out using the standard molecular biology techniques described by Sambrook et al. (Molecular Cloning: A Laboratory Manual. 2nd Edition. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1989). All the restriction fragments used for the present invention were isolated with the aid of the "Geneclean" kit (BIO101 Inc., La Jolla, CA). For all the constructs, the cloned DNA fragments, as well as the junctions with the expression vector, were sequenced by the Sanger method (Sambrook et al., 1989).

PCR and RT-PCR The oligonucleotides specific to the genes or gene fragments cloned were synthesized, some of them containing, in some cases, at their 5' end, restriction sites facilitating the cloning of the amplified fragments. The reverse transcription (RT) reactions and the polymerase chain reaction (PCR) were carried out according to standard techniques (Sambrook et al., 1989).

Large-scale purification of plasmids The production, on the scale of about ten mg, of purified plasmids entering into the vaccinal compositions was carried out by the caesium chloride-ethidium bromide gradient method (Sambrook et al., 1989).

59 Example 13: Formulation of the vaccinal plasmids The DNA solution containing one or more plasmids according to Examples 2 to 10 is concentrated by ethanolic precipitation as described in Sambrook et al.

(1989). The DNA pellet is taken up in a 0.9% NaCi solution so as to obtain a concentration of 1 mg/ml. A 0.75 mM DMRIE-DOPE solution is prepared by taking up a lyophilisate of DMRIE-DOPE with an appropriate volume of sterile H 2 0.

The formation of the plasmid DNA-lipid complexes is achieved by diluting, in equal parts, the 0.75 mM DMRIE-DOPE solution with the DNA solution at 1 mg/ml in 0.9% NaCl. The DNA solution is gradually introduced, with the aid of a seamed 26G needle, along the wall of the vial containing the cationic lipid solution so as to avoid the formation of foam. Gentle shaking is carried out -as soon as the two solutions have been mixed. A composition comprising 0.375 mM of DMRIE-DOPE and 500 Ag/ml of plasmid is finally obtained.

It is desirable for all the solutions used to be at room temperature for all the operations described above. The DNA/DMRIE-DOPE complex formation is allowed to take place at room temperature for 30 minutes before immunizing the animals.

Example 14: Immunization of dogs against CDV An injection of 2 ml by the subcutaneous or intramuscular route repeated 28 days later. The total mass of plasmid used during each immunization is 100, 500, 1000 or 2000 yg according to the vaccines. Persons skilled in the art possess the knowledge necessary to adjust the volume or the concentration as a function of the plasmid dose required.

60 14.1. Virulent challenge The challenge strain used corresponds to a ground product of the spleen removed from a dog infected with the canine distemper virus, strain Snyder Hill, and diluted one hundred fold in PBS buffer. The dilution is kept on crushed ice until used.

After general anaesthetic, the challenge strain, diluted one hundred fold, is administered by the intracranial route in a volume of 0.5 ml, 49 days after the first injection.

14.2. Post-challenge clinical monitoring This daily clinical monitoring was carried out for 21 days following the challenge and included, for each dog, a clinical examination to detect possible clinical signs of canine distemper and taking of rectal temperature.

The clinical examination comprises: An observation of the general state of the animal on a 4-point scale: "good" with a score of 0, "apathy" with a score of i, "depression" with a score of 2 and "prostration" with a score of 3. The death of the animal is equivalent to a clinical score of An evaluation of the oculonasal symptoms (test for serous or purulent discharge, rhinitis and/or conjunctivitis) Conjunctivitis/rhinitis with a serous nasal discharge is equivalent to a score of 1, that with a purulent nasal discharge is equivalent to a score of 2.

An evaluation of the digestive symptoms (test for signs of gastroenteritis) A mild gastroenteritis is

I

61 equivalent to a score of 1, a severe gastroenteritis to a score of 2.

An evaluation of the nervous symptoms (test for myoclonias, convulsions and/or paralysis). Myoclonia is equivalent to a score of i, convulsion to a score of 2 and paralysis to ascore of 3.

The monitoring of the body temperature of the animal.

A temperature of less than or equal to 37.5C is equivalent to a score of 3, a temperature of between 37.50C and 39.5 0 C is equivalent to a score of 0, a temperature equal to 39.50C or between 39.5 0 C and 400C is equivalent to a score of 1, a temperature equal to 0 C or between 40 0 C and 40.50C is equivalent to a score of 2, and finally a temperature greater than 40.5 0 C is equivalent to a score of 3.

Of the animals that succumbed to the challenge, the spleen was removed in order to identify the canine distemper virus by immunofluorescence.

An overall clinical score was calculated in the following manner: for each clinical sign, a mean score was established per group of animals over the observation period and the total score is the sum of the mean scores for the five clinical signs considered.

2005202233 23 May 2005 62 Results 'of the challenge experiments after immunization of dogs by the intramuscular route: Plasmid Formulation Antigens Dose Cytokine Mortality Clinical Antibody response control 4/4 26.1 0.3 0.3pNS018 Native HA 5 0 jig 4/5 21.6 0.3 0.2 pPB229 Native-F 50 PNS018 DMRIE-DOPE Native HA 50 jug 1/5 7.8 08+ 0.3 pPB229 Native F 50 jig PNS024 DMRIE-DOPE Optimized HA 50 jig 1/5 7.2 1.9 0.8 pNSO2l Optimized F 50 jig pNSO24 DMRIE-DOPE Optimized HA 500 jig 0- /5 0.6 1.5 0.3 pNSO21 Optimized F 500 jug mean titre standard deviation 2005202233 23 May 2005 63 Plasmid Formulation Antigens Dose Cytokine Mortality Clinical Antibody score response control 4/4 25.0 0.2 0.0 pNS018 DMRIE-DOPE Native HA 50 g 5/5 24.4 0.2 0.0 pPB229 Native F 50 pg pNS018 DMRIE-DOPE Native HA 500 jg 3/5 19.0 0.4 0.2 pPB229 Native. F 500 ig pNS024 DMRIE-DOPE Optimized HA 500 Pg 1/5 9.2 0.6 0.7 pNS021 Optimized F 500 jg pNS024 DMRIE-DOPE Optimized HA 500 pg 0/5 2.4 1.7 0.9 pNS021 Optimized F 500 jg pJP084 200 ig GM-CSF pNS024 DMRIE-DOPE Optimized HA 500 /g 0/5 0.8 1.4 pNS024 DMRIE-DOPE Optimized HA 500 pg 0/5 5 1.4 1.3 pNS021 Optimized F 500 ig pNS016 Native M 500 ig pNS017 Native N 500 Pg mean titre standard deviation 64 The plasmids pNS016 and pNS017 inserting the native gene M and the native gene N, respectively, were constructed in the same manner as the plasmid pNS018.

It is surprising to observe that the protection result obtained with optimized HA alone is greater than or equal to the results obtained with optimized HA and F or with optimized HA and F native M and N.

It should be clearly understood that the invention defined by the appended claims is not limited to the specific embodiments indicated in the description above, but encompasses the variants which depart neither from the scope nor the spirit of the present invention.

Claims (42)

1. DNA vaccine against a pathogen affecting pets or animals used in sports, in particular dogs, cats or horses, comprising a plasmid containing a nucleotide sequence encoding an immunogen of a pathogen of the animal species considered, under conditions allowing the in vivo expression of this sequence, and a cationic lipid containing a quaternary ammonium salt of formula CH, I+ R, O CH CCH N -R 2 X OR, CH 3 in which RI is a saturated or unsaturated, linear aliphatic radical having 12 to 18 carbon atoms, Rs is another aliphatic radical containing 2 or 3 carbon atoms, and X is a hydroxyl or amine group, this lipid being preferably DMRIE.

2. Vaccine according to Claim 1, characterized in that it also comprises DOPE.

3. Vaccine according to Claim 1 or 2, characterized in that it comprises, in addition, a GM-CSF protein of the animal species considered.

4. Vaccine according to Claim 1 or 2, characterized in that it comprises, in addition, an expression vector containing the gene encoding the GM-CSF pro.tein of the animal species considered, under conditions allowing the in vivo expression of this sequence. 66 Vaccine according to Claim 4, characterized in that the expression vector is a plasmid.

6. Vaccine according to any one of Claims 1 to characterized in that the nucleotide sequence encoding a pathogen immunogen is the sequence of a gene from which the part encoding the trans- membrane domain has been deleted.

7. Vaccine according to any one of Claims 1 to 6, characterized in that the plasmid containing the nucleotide sequence encoding a pathogen immunogen also contains a nucleotide sequence encoding tPA.

8. Vaccine according to any one of Claims 1 to 7, characterized in that the plasmid containing the nucleotide sequence encoding a pathogen immunogen also contains a stabilizing intron.

9. Vaccine according to Claim 7, characterized in that the intron is intron II of the rabbit beta- globin gene. Vaccine according to one of Claims 1 to 5, charac- terized in that it comprises a CDV nucleotide sequence.

11. Vaccine according to Claim 10, characterized in that it comprises the sequence of the HA gene optimized by a signal sequence, in particular that of the tPA signal of human origin, in place of the sequence of the signal peptide of HA, and/or by the deletion of the DNA fragment encoding the transmembrane domain of HA, and/or by the inser- tion of an intron, in particular intron II of the rabbit beta-globin gene upstream of the HA gene.

12. -Vaccine according to Claim 10, characterized in that it comprises the sequence of the F gene 67 optimized by a signal sequence, in particular that of the tPA signal of human origin, in place of the sequence of the signal peptide of F, and/or by the deletion of the DNA fragment encoding the transmembrane domain of F, and/or by the insertion of an intron, in particular intron II of the rabbit beta-globin gene upstream of the F gene.

13. Vaccine according to one of Claims 10 to 12, characterized in that it comprises, in the same plasmid or in another plasmid, the sequence of the M or N gene.

14. Vaccine according to Claim 10, characterized in that it comprises DMRIE-DOPE, an expression plasmid encoding the CDV HA antigen optimized by the replacement of the HA signal peptide sequence with the human tPA signal sequence, by deletion of the fragment of the nucleotide sequence encoding the transmembrane domain of HA and by insertion of intron II of the rabbit beta-globin gene upstream of the HA gene, of a second expression plasmid encoding the CDV F antigen optimized by the deletion of the fragment of the nucleotide sequence encoding the transmembrane domain of F and by the insertion of intron II of the rabbit beta-globin gene upstream of the F gene. Vaccine according to Claim 14, characterized in that it comprises, in addition, an expression plasmid encoding canine GM-CSF.

16. Vaccine according to one of Claims 1 to 5, charac- terized in that it comprises a CPI-2 nucleotide sequence.

17. Vaccine according to Claim 16, characterized in that it comprises the sequence of the CPI-2 F gene optimized by substitution, by a signal sequence, 68 in particular that of the tPA of human origin, of the signal sequence of protein F, and/or by the deletion of the DNA fragment encoding the transmembrane domain of F, and/or by the insertion of an intron, in particular intron II of the rabbit beta-globin gene upstream of the F gene.

18. Vaccine according to Claim 16, characterized in that it comprises the sequence of the CPI-2 HN gene optimized by substitution, by a signal sequence, in particular that of the .tPA of human origin, of the signal sequence of HN, and/or by the deletion of the DNA fragment encoding the transmembrane domain of HN, and/or by the insertion of an intron, in particular intron II of the rabbit beta-globin gene upstream of the HN gene.

19. Vaccine .according to Claim 16, characterized in that it comprises DMRIE-DOPE, an expression plasmid encoding the CPI-2 F antigen optimized by the deletion of the fragment of the nucleotide sequence of F encoding the transmembrane domain and by the insertion of intron II of the rabbit beta-globin upstream of F, and a second expression plasmid encoding the CPI-2 HN antigen optimized by the insertion of the signal sequence of human tPA in place of the signal sequence of HN, by the deletion of the fragment of the nucleotide sequence encoding the transmembrane domain of HN and by the insertion of intron II of rabbit beta- globin upstream of HN. Vaccine according to Claim 19, characterized in that it comprises, in addition, an expression plasmid encoding canine GM-CSF.

21. Vaccine according to one of Claims 1 to 5, charac- terized in that it comprises a CHV-1 nucleotide 69 sequence.

22. Vaccine .according to Claim 21, characterized in that it comprises the sequence of the CHV-1 gB gene optimized by the deletion of the DNA fragment encoding the transmembrane domain of gB.

23. Vaccine according to Claim 21, characterized in that it comprises the sequence of the CHV-1 gC gene optimized by the deletion of the DNA fragment encoding the transmembrane domain of gC.

24. Vaccine according to Claim 21, characterized in that it comprises the sequence of the CHV-1 gD gene optimized by the deletion of the DNA fragment encoding the transmembrane domain of gD. Vaccine according to Claim 21, characterized in that it comprises DMRIE-DOPE, an expression plasmid encoding -the gB antigen, a second plasmid encoding the gC antigen, a third plasmid encoding the gD antigen; gB, gC and gD being optimized by the deletion of the fragment of the nucleotide sequence encoding the transmembrane domain.

26. Vaccine according to Claim 25, characterized in that it comprises, in addition, an expression plasmid encoding canine GM-CSF.

27. Vaccine according to one of Claims 1 to 5, charac- terized in that it comprises a FHV-1 nucleotide sequence.

28. Vaccine according to Claim 27, characterized in that it comprises the sequence of the FHV-1 gB gene.optimized by the deletion of the DNA fragment encoding the transmembrane domain of gB.

29. Vaccine according to Claim 27, characterized in 70 that it comprises the sequence of the FHV-1 gC gene optimized by the deletion of the DNA fragment encoding the transmembrane domain of gC.

30. Vaccine according to Claim 27, characterized in that it comprises the sequence of the FHV-1 gD gene optimized by the deletion of the DNA fragment encoding the transmembrane domain of gD.

31. Vaccine according to Claim 27, characterized in that it comprises DMRIE-DOPE, an expression plasmid encoding the gB antigen, a second plasmid encoding the gC antigen, a third plasmid encoding the gD antigen; gB, gC and gD being optimized by the deletion of the DNA fragment encoding the transmembrane domain.

32. Vaccine according to Claim 31, characterized in that it. comprises, in addition, an expression plasmid encoding feline.GM-CSF.

33. Vaccine according to one of Claims 1 to 5, charac- terized in that it comprises a EHV-1 nucleotide sequence.

34. Vaccine according to Claim 33, characterized in that it comprises the sequence of the gB gene optimized by the deletion of the DNA fragment encoding the transmembrane domain of gB. Vaccine according to Claim 33, characterized in that it comprises the sequence of the gC gene optimized by the deletion of the DNA fragment encoding the transmembrane domain of gC.

36. Vaccine according to Claim 33, characterized in that it comprises the sequence of the gD gene optimized by the deletion of the DNA fragment encoding the transmembrane domain of gD. 71 D

37. Vaccine according to Claim 33, characterized in that it comprises DMRIE-DOPE, an expression encoding the gB antigen, a second plasmid encoding the gC antigen, a C 0 third expression plasmid encoding the gD antigen; gB, gC and gD being optimized by the deletion of the fragment of the nucleotide sequence encoding Cq the transmembrane domain. C

38. Vaccine according to Claim 37, characterized in that it comprises, in addition, an expression q plasmid encoding equine GM-CSF.

39. Vaccine according to one of Claims 1 to 5, charac- terized in that it comprises a EHV-4 nucleotide sequence. Vaccine according to Claim 33, characterized in that it comprises the sequence of the gB gene optimized by the deletion of the DNA fragment encoding the transmembrane domain of gB.

41. Vaccine according to Claim 33, characterized in that it comprises the sequence of the gC gene optimized by the deletion of the DNA fragment encoding the transmembrane domain of gC.

42. Vaccine according to Claim 33, characterized in that it comprises the sequence of the gD gene optimized by the deletion of the DNA fragment encoding the transmembrane domain of gD.

43. Vaccine according to Claim 33, characterized in that it comprises DMRIE-DOPE, an expression plasmid -encoding the gB antigen, a second expression plasmid encoding the- gC antigen, a third expression plasmid encoding the gD antigen; gB, gC and gD being optimized by the deletion of 72 the fragment of the nucleotide sequence encoding the transmembrane domain.

44. Vaccine according to Claim 37, characterized in that it comprises, in addition, an expression plasmid encoding equine GM-CSF. Vaccine according to any one of Claims 1 to characterized in that it comprises a nucleotide sequence encoding an immunogen of a pathogen chosen from the group consisting of: rabies virus, CPV, CCV, Borrelia burgdorferi, FCV, FPV, FIPV, FeLV, FIV, equine influenza virus, Eastern equine encephalitis virus, Western equine encephalitis virus, Venezuelan equine encephalitis virus and Clostridium tetani.

46. Vaccine against dog pathologies, comprising two or three vaccines chosen from the group consisting of: vaccines according -to one of -Claims 10 to vaccine according to one of Claims 16 to 20 and vaccine according to one of Claims 21 to 26.

47. Vaccine against equine herpes virus, comprising a vaccine according to Claims 33 to'38 and a vaccine according to one of Claims 39 to 44.

48. Multivalent vaccine comprising a vaccine according to any one of Claims 1 to 47 and a conventional vaccine of the inactivated vaccine type, attenuated live vaccine, or subunit vaccine, or recombinant vaccine using an in vivo expression vector.

49. Vaccine according to any one of Claims 1 to 47, characterized in that it comprises a quantity of DNA of between 10 g and 1000 preferably between 50 g and 500 ag, for each plasmid. 73 Use of a DNA vaccine according to any one of Claims 1 to 47 and 49, for producing a vaccine intended to be administered by the intramuscular route.

51. Use of a DNA vaccine according to any one of Claims 1 to 47 and 49, for producing a vaccine intended to be administered by the subcutaneous route.