AU2005200014A1 - Molecular markers in clovers - Google Patents

Description

P/00/011 Regulation 3.2

AUSTRALIA

Patents Act 1990 COMPLETE SPECIFICATION STANDARD PATENT Invention Title: Molecular markers in clovers The following statement is a full description of this invention, including the best method of performing it known to us: MOLECULAR MARKERS IN CLOVERS The present invention relates to simple sequence repeats (SSRs) and, more particularly, to SSRs in clover species. The invention also relates to primers suitable for amplifying SSRs, methods for identifying SSRs, libraries enriched for SSRs and methods of preparing same, and uses of SSRs.

A number of clover species are agronomically important pasture legumes.

Examples include white clover (Trifolium repens the predominant legume of temperate pastures, red clover (Trifolium pratense), subterranean clover (Trifolium subterraneum), Caucasian clover (Trifolium ambiguum) and Persian clover (Trifolium persicum). Many clover species have the potential to enhance pasture production systems and to significantly improve livestock production. Cultivars well adapted to specific environments and management systems are needed to fulfil these tasks. Moreover, contemporary agriculture is faced with rapidly changing demands and therefore faster and more specific breeding methods are needed to improve cultivars.

White clover (Trifolium repens is one of the most important legumes grown in temperate pastures, due to its excellent nutritive value and ability to fix atmospheric nitrogen. It is an outbreeding, allotetraploid (2n 4x =32) species with a high level of genetic heterogeneity. White clover cultivars that are well adapted to specific environments and management conditions can significantly enhance pasture production systems. Breeding aims for this species include improved persistence, increased dry matter yield, improved competitive ability, higher stolon density, extended climatic suitability, improved disease resistance, higher digestibility and improved seed yield. More than six decades of plant breeding have resulted in significant genetic improvement of white clover, but most of the target traits are complex, making breeding costly and progress slow.

A basic prerequisite for any molecular breeding program is a robust set of polymorphic markers for the species under investigation. Among the large variety of marker systems available, simple sequence repeats (SSRs, also called microsatellites), are based on a 1-7 nucleotide core element, more typically a 1-4

I

2 nucleotide core element, that is tandemly repeated. The SSR array is embedded in complex flanking DNA sequences. Microsatellites are thought to arise due to the property of replication slippage, in which the DNA polymerase enzyme pauses and briefly slips in terms of its template, so that short adjacent sequences are repeated. Some sequence motifs are more slip-prone than others, giving rise to variations in the relative numbers of SSR loci based on different motif types. Once duplicated, the SSR array may further expand (or contract) due to further slippage and/or unequal sister chromatid exchange. The total number of SSR sites in eukaryotic genomes is very high, such that in principle such loci are capable of providing tags for any linked gene.

SSRs are highly polymorphic due to variation in repeat number and are codominantly inherited. Their detection is based on the polymerase chain reaction (PCR), requiring only small amounts of DNA and suitable for automation. They are ubiquitous in eukaryotic genomes and have been found to occur every 21 to 65 kb in plant genomes. Consequently, SSRs are ideal markers for a broad range of applications such as genome mapping, trait mapping and marker-assisted selection. However, in order to be of value as molecular markers, SSR loci must be identified, sequence characterised, primer pairs aimed at the specific locus designed and the markers screened for their ability to detect polymorphisms.

Molecular markers allow for selection of desired traits based on genotype rather than phenotype and can therefore complement and accelerate plant breeding programs. They can also be used for early selection of traits that are not expressed during the juvenile phase such as persistence, competitive ability and seed yield. Molecular markers have been successfully used for the construction of genetic linkage maps and for the identification and tagging of economically important genes and quantitative trait loci (QTL) in a large number of plant species. However, no such information is available for clovers such as white clover.

It is an object of the present invention to overcome, or at least alleviate, one or more of the difficulties or deficiencies associated with the prior art.

2A .j In one aspect, the present invention provides a substantially purified or isolated nucleic acid molecule from a clover species including a simple sequence repeat (SSR), said SSR including five or more repeated nucleotide core elements of 2 nucleotides in length, four or more repeated nucleotide core elements of 3 nucleotides in length, or three or more repeated core elements of 4 to 6 nucleotides in length, wherein at least two of the repeated core elements are tandemly repeated.

In another aspect, the present invention provides a substantially purified or isolated nucleic acid molecule from a clover species including a simple sequence repeat (SSR).

By a SSR is meant a nucleotide sequence including two or more 1-7, preferably 2-6, more preferably 2-4, nucleotide core elements that are tandemly repeated.

In a preferred embodiment, the nucleic acid molecule according to the invention consists essentially of the SSR.

SThe nucleic acid fragment may be of any suitable type and includes DNA (such as cDNA or genomic DNA) and RNA (such as mRNA) that is single- or double-stranded, optionally containing synthetic, non-natural or altered nucleotide bases, and combinations thereof.

The term "isolated" means that the material is removed from its original environment (eg. the natural environment if it is naturally occurring). For example, a naturally occurring nucleic acid fragment present in a living plant is not isolated, but the same nucleic acid fragment separated from some or all of the co-existing materials in the natural system, is isolated. Such nucleic acid fragments could be part of a vector and/or such nucleic acid fragments could be part of a composition, and still be isolated in that such a vector or composition is not part of its natural environment.

The clover species may be of any suitable type, including white clover, red clover, subterranean clover, Caucasian clover and Persian clover. Preferably the clover species is white clover.

Preferably the SSR includes one or more of the following sequences:

[TG]

[TA]n [AC]n [CT]n [AG]n [GT]n

[TC].

[AT],

[CTT]n [TTC]n [GAA]n [AAG]n [TAC], [GGGTGTT]n wherein n is the number of repeats and is a number between 2 and approximately more preferably between approximately 5 and approximately In a particularly preferred embodiment of this aspect of the invention, the SSR may have one of the following nucleotide sequences:

[GT]

7

[GGGTGTT]

4

[CA]

8 [GA]s GG[GA]15 [GAA] 20

[AC]

1 0 [GT]sT[GT] 2 C[GT]3

[TA]

7

[CA]

19

[TG]

11 [GT]io [CA]sCC[CA] 3

[CTT]

15 [CA]lo[GA] 6

[GAA]

23

[CA]

9 [TAC]s [CA] 3 CC[CA]7 or a fragment or variant thereof which is a SSR.

Such variants (such as analogues, derivatives and mutants) include naturally occurring allelic variants and non-naturally occurring variants. Additions, deletions, substitutions and derivatizations of one or more of the nucleotides are contemplated so long as the modifications result in a nucleotide sequence which is still a SSR. Preferably the functionally active fragment or variant has at least approximately 80% identity to the relevant part of the above mentioned sequence, more preferably at least approximately 90% identity, most preferably at least approximately 95% identity. Preferably the fragment has a size of at least 4 nucleotides, more preferably at least 8 nucleotides, most preferably at least nucleotides.

In a second aspect of the present invention there is provided a nucleic acid primer suitable for amplifying a SSR in a clover species.

The clover species may be of any suitable type, including white clover, red clover, subterranean clover, Caucasian clover and Persian clover. Preferably the clover species is white clover.

In a particularly preferred embodiment of this aspect of the invention the primer may include one or more of the following nucleotide sequences: 5'-TCTGTTTTGTTGGCCATGC-3' 5'-TTGCAAAGTGTTTGGAAGGA-3' 5'-TGACAGAAGACCTGATGTACCG-3' 5'-TTCCACTCTTAGCATCAACTGG -3' 5'-TTTrGAAATCACGGTGACACG-3' 5'-CCTGCATCAGCTCCTATTCC-3' 5'-AAGTGTTGGACAAGGAAACTAGG-3' 5'-TCTCTAGATGAGCGGCATTG-3' 5*-GGAGACCTGTGGCAAGTATG-3' 5'-CCTCCAACAAGCATGTAACG-3' 5'-AGAAAGGTGAATGATGAAA-3' 5'-TCTAATTCTTCCAATAGGG-3' 5'-CAGTAAAGGAATCTGUTCAAACTAmT3' 5'-AAACACCAATCAGACCGAAA-3' 5'-TTTTGCTAATAAGTAATGCTGC-3' 5'-GGACAT-TATGCAATGGTGAG-3' 5'-TTTTCGCATTGTTTCAGACC-3' 5'-CCCTTTCTCAAOCCACATC-3' 5*-AAATAAAACCACAAGTAACTAG-3' 5'-TATAGGTGATTTGAAATGGC-3' CTGGTAGATAAACTTAAA-3' 5'-TGCTCTGGAGATTGATGG-3' 5'-TGGCTATTACAACTTGGAGA-3' 5'-CGAGGCATACTTGATGATGG-3' or a fragment or analogue thereof which is suitable for amplifying a SSR in a clover species.

In a further aspect of the present invention there is provided a method of identifying a SSR in clovers, said method including preparing a library of clover genomic DNA enriched for SSRs and identifying clones in said library containing SSRs.

I

The clover species may be of any suitable type, including white clover, red clover, subterranean clover, Caucasian clover and Persian clover. Preferably the clover species is white clover.

The clones containing SSRs may be identified by any suitable technique, as s would be apparent to those skilled In the art.

The library of clover genomic DNA enriched for SSRs may be prepared by any suitable technique. Preferably it is prepared by a method including providing genomic DNA from a clover species, a first restriction enzyme, symmetrical adaptors each containing a second restriction enzyme site, primers complementary to the adaptors, a hybridization membrane carrying bound oligonucleotides including the sequence [CA]n, a second restriction enzyme, and a vector digesting the genomic DNA with the first restriction enzyme; ligating the adaptors to the digested genomic DNA; amplifying the ligated DNA by PCR using the primers; hybridizing the PCR amplified DNA to the membrane; amplifying the PCR amplified DNA which preferentially hybridized to the membrane; digesting the amplified DNA with the second restriction enzyme; and ligating the digested and amplified DNA into the vector to generate the library.

The first restriction enzyme may be of any suitable type. Preferably it is a blunt end restriction. enzyme such as Alul, Dral, EcoRV, Rsal, Sspl. Haelll or Hincl. More preferably a plurality of such restriction enzymes is used.

The symmetrical adaptors may be of any suitable type. Preferably they each contain a Mlul restriction enzyme site.

The hybridization membrane may be of any suitable type. Preferably it is a nylon membrane such as Hybond N. The bound oligonucleotides may be of any suitable type. Preferably they include a SSR. In a particularly preferred embodiment, the oligonucleotides include the sequence

[CA]

2 o. The PCR amplified DNA may be hybridized to the membrane by any suitable technique, as will be readily apparent to those skilled in the art.

Such techniques are described in Maniatis et al, Molecular Cloning:

A

Laboratory Manual, Cold Spring Harbor, the entire disclosure of which is Incorporated herein by reference. Preferably a reduced washing temperature of approximately 50 0 C, preferably In the presence of approximately 0.5 x SSC, is used.

The second restriction enzyme may be of any suitable type but should be compatible with the restriction enzyme site in the adaptors. Preferably the second restriction enzyme is M/ul.

The vector may be of any suitable type. Preferably it is a pUC18 derivative such as pJV1.

In a further aspect of the present invention there is provided a library of clover genomic DNA enriched for SSRs. Preferably the library is prepared by a method as described herein above.

The dover species may be of any suitable type, including white clover, red clover, subterranean clover, Caucasian clover and Persian clover. Preferably the clover species Is white clover.

The SSRs of the present invention have a number of uses including selection of genes in clover breeding and breeding in other legume species,

DNA

7a profiling of clover varieties and other legume species and testing the purity of batches of seeds from clover or other legume species.

Accordingly, in a further aspect of the present invention there is provided a method of selecting for a gene in legume breeding, said method including identifying a SSR according to the present invention that is closely associated with said gene and selecting for said SSR in said breeding.

By "closely associated" is meant that the SSR and the gene are preferentially coinherited. Preferably the SSR and the gene have a genetic map distance of approximately 5 cM or less.

Preferably the legume is a clover, including white clover, red clover, subterranean clover, Caucasian clover and Persian clover, more preferably white clover.

The gene may be of suitable type. Preferably the gene is capable of influencing clover cyst nematode (TCN) resistance, herbage yield and/or quality, or drought tolerance.

The principle used for the selection of valuable agronomic genes in breeding programs is the association between a polymorphic genetic marker (e.g.

an SSRP locus) and a target gene nearby on the same chromosome. This leads to the phenomenon of genetic linkage, so that the marker and the linked gene are preferentially coinhereted. The degree of linkage which is required depends on the exact nature of the breeding program. In practice, a map distance of 5 cM (corresponding to 5% recombination leading to disassociation of the target gene and the marker) or less is preferred.

Associations between markers and target genes may be established by the construction of a genetic map using a large number of polymorphic genetic markers in a cross showing variation for one or more physical characters.

Appropriate analysis may locate the relevant target genes. The closely linked markers may then act as selection "tags" for the transfer of the target genes into unimproved germplasm.

In the particular case of clover cyst nematode (TCN) resistance, a cross may be made between parents which are respectively resistant and susceptible to this pathogen. A population showing variation for the character may then be used for genetic mapping with SSR markers. The most closely linked markers to the gene for TCN resistance (ideally one on either side) may then be used for selection of the gene in a donor cross. The same principle may be used for characters showing a more complex genetic basis, such as drought tolerance and herbage yield/quality.

SSR markers may also be used for DNA profiling in order to establish the distinct identity, uniformity and/or stability of a cultivar. This process is more complex for species such as white clover than for cereals such as maize and wheat, as white clover is an outbreeding species. Consequently, variation must be assessed both within and between cultivars. In this case, either individual SSR alleles may be diagnostic of particular cultivars, or the frequencies of particular alleles may be so dissimilar between cultivars that they act as discriminatory features.

Accordingly, in a further aspect of the present invention there is provided a method for DNA profiling legume species varieties, said method including assessing variation between said varieties of a SSR according to the present invention.

Preferably the legume is a clover, including white clover, red clover, subterranean clover, Caucasian clover and Persian clover, more preferably white clover.

Another aspect of DNA profiling relates to the use of SSR markers for detection of seed batch contamination with seed from an undesirable cultivar. As described above, the allele profile of each population may be discriminated, allowing detection of likely contaminated batches.

Accordingly, in a further aspect of the present invention there is provided a method for testing the purity of legume seed batches, said method including assessing variation within said batch of a SSR according to the present invention.

I

Preferably the legume is a clover, including white clover, red clover, subterranean clover, Caucasian clover and Persian clover, more preferably white clover.

The present invention will now be more fully described with reference to the accompanying Example and drawings. It should be understood, however, that the description following is illustrative only and should not be taken in any way as a restriction on the generality of the invention described above.

In the Figures Figure 1 Amplification across seven T. repens genotypes Dusi 35, 2 Haifa 27, 3 Haifa 38, 4 Prop16, 5 Prop 39 6 15J, 7 14R) for SSR locus TRSSRA01H11 Figure 2 Amplification pattern of SSR locus TRSSRA01H11 in a segregating T.

repens population (P1, P2 inbred parents, F 1 3 F 1 plants from P1 x P2, F 2

F

2 plants obtained through selfing of a single F 1 plant). Size markers indicate segregating alleles Figure 3 Amplification across nine legume species pratense T.

subterraneum T. ambiguum T. nigrescens Glycine max (GM), Medicago sativa Lotus comiculatus Melilotus alba (MA) and T. repens (TR) for SSR locus TRSSRA02B09 Figure 4 Cross-species amplification of T. repens SSRs. Fifty-four primer pairs were tested for amplification in T. pratense T. subterraneum T. ambiguum T. nigrescens Glycine max Medicago sativa Lotus corniculatus (LC) and Melilotus alba Successful amplification in each species is shown as percentage of the total number of primer pairs screened Figure Sequence comparison of SSR loci in T. repens T. pratense T.

subterraneum T. ambiguum T. nigrescens Medicago sativa (MS), and Melilotus alba Sequences were obtained by cloning PCR products amplified using primers to locus TRSSRA02B09 and aligned using the multiple alignment procedure of CLUSTAL W (Thompson et al. 1994). Blocked areas indicate sequence identity. Primer sequences are indicated by arrows and the line indicates the SSR motif. TR is the sequence in which the SSR was originally discovered, TR and TR are two T. repens inbred genotypes (15J and 14R) which were used as a control in cross-species amplification Figure 6 Construction of SSR enriched libraries according to Edwards et al. (1996) Figure 7 Results of sequence annotations of selected TRSSR clones, with numbers related to logio E value.

Figure 8 Location of the TRSSRB03HO9 SSR in the intron of a soybean phosphotidylinositol 3-kinase gene. The primer sequences are shown in underline, the SSR in italics, splice junctions with asterisks and translated amino acids are shown beneath the nucleotide sequence.

Figure 9 Segregating alleles in the I(J) x I(R) F2 reference genetic mapping population with primer pairs for locus TRSSRA01H11 by detection of FAMlabelled amplification products in the ABI3700 capillary electrophoresis system.

Figure Distribution of TRSSR loci on linkage group 11 of the white clover reference genetic map.

EXAMPLE 1 Development and characterisation of simple sequence repeat (SSR) markers for white clover (Trifolium repens L.) Introduction Highly informative molecular markers, such as simple sequence repeats (SSRs), can greatly accelerate breeding programs, The aim of this study was to develop and characterise a comprehensive set of SSR markers for white clover repens which can be used to tag genes and quantitative trait loci controlling traits of agronomic interest. Sequencing 1123 clones from genomic libraries enriched for [CA]n repeats yielded 793 clones containing SSR loci. The majority of SSRs consisted of perfect dinucleotide repeats with only 7% being trinucleotide repeats. After excluding redundant sequences and SSR loci with less than 25 bp flanking sequence, 397 potentially useful SSRs remained. Primer pairs were designed to 117 SSR loci and with 101 products in the expected size range were amplified. These markers were highly polymorphic with 88% detecting polymorphism across seven white clover genotypes and with an average allele number of 4.8. Four primer pairs were tested in an F 2 population and showed Mendelian segregation. Successful cross-species amplification was achieved in at least one out of eight legume species for 46 out of 54 primers. The rate of successful amplification was significantly higher for Trifolium species when compared to species of other genera. The markers developed in this study not only provide valuable tools for molecular breeding of white clover but may also have applications in related taxa.

Material and methods Plant material and DNA extraction S Enriched libraries were constructed from the inbred T. repens genotype 17J (Joyce et al. 1999). SSR primers were screened for polymorphism across a set of seven T. repens genotypes; a single genotype from the cultivar Dusi, two genotypes each from the cultivars Haifa and Prop and two inbred genotypes, and 14R. Segregation of SSR loci was assayed using three Fi and 20 F 2 progeny individuals of a cross between 15J x 14R (Michealson-Yeates and Abberton, unpublished). Cross-species amplification of T. repens SSRs was tested using single genotypes from the following species: T. pratense T. subterraneum T.

ambiguum Bieb., T. nigrescens Viv., Glycine max L. (Merr.), Medicago sativa L., Lotus corniculatus Melilotus alba Medik.

Genomic DNA from inbred genotypes and segregating progeny was provided by the Institute of Grassland and Environmental Research, IGER, Aberyswyth UK and extracted using a 2 x CTAB method (Doyle and Doyle 1987). DNA of all the other genotypes was extracted using a 1 x CTAB method (Fulton et al. 1995).

Construction of SSR enriched libraries and sequencing Six SSR enriched libraries of T. repens were constructed using the procedure of Edwards et al. (1996), with modifications as described below.

Different restriction enzymes (Alul, Dral, EcoRV, Haelll, Rsal or Sspl) were used to restrict DNA prior to enrichment for each library. Enrichment was carried out with [CA]20 synthetic oligonucleotides bound to the selection filter. We used [CA]n filters, because they proved to be superior to filters containing other repeat motifs in the enrichment of Lolium perenne L. partial genomic libraries. Hybridisation was carried out at 50 OC for 16 h followed by 3 washes in 2 x SSC (30mM sodium citrate, 300mM NaCI, pH 7.0) and 0.1% sodium dodecyl sulfate (SDS) at 50 °C and 5 washes in 0.5 x SSC and 0.1% SDS. Eluted fragments were run through a MICROSPIN T M S-300 HR column (Pharmacia Biotech) and cloned into the BssHI site of a modified pUC19 vector (pJV1).

Plasmids were transformed into MAX EFFICIENCY® DH5aTM competent cells (Life Technologies), plated onto LB agar plates (Sambrook et al. 1989), containing ig/ml ampicillin, 50 p.g/ml X-galactosidase and 0.5 mM IPTG, and incubated for 16 h at 37 DNA from white colonies was extracted using the WIZARD® PLUS SV (Promega Co., Madison, Wis., USA) or the QIAPREP® TURBO (Qiagen) purification kit and sequenced on an ABI automated sequencer (PE Applied Biosystems) using the M13 forward primer and the BIGDYETM TERMINATOR (PE Applied Biosystems) cycle sequencing kit.

After sequencing 10 clones from each library, the two libraries with the highest level of enrichment were selected for further SSR development.

Classification of SSRs and primer design Sequences containing at least 5 uninterrupted dinucleotide repeats, 4 uninterrupted trinucleotide repeats or 3 uninterrupted tetranucleotide (or larger) repeats were classified into perfect, imperfect and compound SSRs. Primers were designed to the flanking regions of the SSR using the PRIMERPREMIER 4 (Premier Biosoft International, Palo Alto, CA, USA) software, based on criteria of GC content, melting temperature and the lack of secondary structure. Primers were designed in the 18 27 bp range to yield amplification products of 80 350 bp.

PCR amplification and product electrophoresis PCR amplifications were performed in a 20 Il volume containing 25 ng of genomic DNA, 1 x PCR buffer (Finnzyme, Espoo, Finland), 0.2 mM of each dNTP, iM of each forward and reverse primer and 0.4 U of DYNAZYMETM II (Finnzyme) DNA polymerase. The forward primer was end-labelled with y-33P-ATP (400 Ci/mmol, Geneworks, Adelaide, SA, Australia). PCR was performed in a MJ PT-200 (MJ Research Inc., Waltham, MA, USA) thermocycler using one of the following touch-down profiles, depending on the Tm value of the primer pairs: (1) cycles of 60 s at 94 OC, 30 s at 65 OC, 60 s at 72 OC with a reduction of the annealing temperature of 1 OC by every cycle, followed by 20 cycles of 30 s at 94 0 C, 30 s at 55 OC and 30s at 72 OC similar profile as with an initial annealing temperature of 60 °C and a final annealing temperature of 50 °C (3) similar profile as with an initial annealing temperature of 55 OC and a final annealing temperature of 45 OC similar profile as with an initial annealing temperature of 50 OC and a final annealing temperature of 40 oC. The PCR products were denatured by adding 15 C 1 of denaturing gel loading buffer (Sambrook et al. 1989) and heating at 94 °C for 5 min. SSR alleles were separated by running PCR products on a denaturing 6% acrylamide gel (19:1 acrylamide:bis-acrylamide, Amresco, Solon, OH, USA) in 1 x TBE (Sambrook et al. 1989) at 80 W for 5000 Vh using a BIOMAX T M STS 451 DNA sequencing unit (Kodak). A 100 bp size ladder (Promega Co., Madison, Wis., USA) was included on each gel and the size of amplification products was estimated by extrapolation. Gels were transferred onto Whatman 3 MM paper and dried in a gel dryer (BioRad 583) at 80 °C for 45 min. Banding patterns were visualised using a PHOSPHORIMAGER 400B (Molecular Dynamics, Sunnyvale CA, USA) or by exposing gels for 48 to 72 h to X-ray film (BIOMAX M MR, Kodak).

Primer evaluation All primer pairs were screened on the set of 7 diverse genotypes for their ability to yield an amplification product of the expected size and to detect polymorphism. For primers that detected polymorphism, the number of alleles and the polymorphism information content (PIC) of the SSR was calculated as described by Saal and Wricke (1999), based on expected heterozygosity (Hedrick 1985) k PIC=H =1-Jp2 i=1 where p is the frequency of the i-th allele out of the total number of alleles and k is the number of different alleles in the sample.

Cloning and sequencing of PCR amplification products To verify the presence of SSR loci, products of successful cross-species amplification with primer pairs TRSSRA02B08, TRSSRA02B09, TRSSRA02C04 were cloned and sequenced. 2 li of unlabelled PCR product was cloned into the pGEM®-T EASY VECTOR (Promega), transformed using XL ultracompetent cells (Stratagene, La Jolla, CA, USA), plated on LB agar plates (Sambrook et al. 1989), containing 50 I.g/ml ampicillin, 50 ig/ml X-galactosidase and 0.5 mM IPTG, and incubated for 16 h at 37 OC. DNA from three to six white colonies of each PCR reaction was extracted and sequenced as described above.

Sequences containing SSRs were compared to each other using the multiple sequence alignment procedure of CLUSTAL W (Thompson et al. 1994).

Results Preliminary screening of enriched libraries TABLE 1 Preliminary screening for SSR frequency in enriched T. repens libraries constructed using different restriction enzymes.

TRSSRA TRSSRB TRSSRC TRSSRD TRSSRF TRSSRG Restriction enzyme Alu I Dra I EcoR V Rsa I Ssp I Hae III Number of clones 10 10 10 10 10 9 sequenced Number of clones 9 7 4 6 3 4 containing SSR loci Percent library 90 70 40 60 30 44 enrichment Fifty-nine clones were sequenced from across six libraries, which were constructed using different restriction enzymes, in order to identify those libraries most suitable for large scale SSR discovery. The level of SSR enrichment ranged from 30% in library TRSSRF to 90% in TRSSRA (Table All but one SSRs consisted of dinucleotide motifs of the type used for enrichment and had an average repeat number of 11, with a range from to 28 (data not shown). The two libraries showing the highest enrichment for SSRs (TRSSRA and TRSSRB) were selected for large-scale SSR discovery in T.

repens.

2005200014 04 Jan 2005 Large-scale SSR discovery and characterisation of SSR loci TABLE 2 Large-scale SSR discovery in different libraries of T. repens.

Library' Total TRSSRA TRSSRB Other Number of clones sequenced- 583 498 42 1123 Clones containing SSR loci (percentage of clones 445 (76) 329 (66) 19 (45) 793 (71) sequenced) Redundant SSR clones 4 (percentage of clones 61 (14) 32 (10) 4 (10) 97 (12) containing SSRSs) Unique SSR clones (percentage of clones sequenced) 384 (66) 297 (60) 15 (36) 696 (62) Unique, non-truncated 25 bp flanking sequence) SSR 210 (36) 174 (35) 13 (31) 397 clones (percentage of clones sequenced) 1 For description of libraries see Table 1 2 Number of clones with readable DNA sequence 3 SSRs were defined as sequences containing at least 5 unintertupted dinucleotide repeats, 4 uninterrupted trinucleotide repeats or 3 uninterrupted tetranucleotide (or larger) repeats 4 Duplicate SSRs with >95% sequence similarity Readable DNA sequences were obtained from a total of 1123 clones (Table Seventy-one percent of these clones contained SSR loci (Table 2).

Approximately one tenth of all SSR clones were redundant, i.e. they consisted of the same SSR locus (or a variant of it) and showed more than 95% similarity in flanking sequences. Most redundant SSRs were found to be repeated only once across all libraries. However, one redundant SSR was found in 28 clones, consisting of four variants of the SSR motif ([AC] 5 GG[AC]6, [AC] 5

GG[AC]

5 [AC]sGG[AC] 7 [AC]sGG[AC]sCGAC). The flanking sequences of these clones were almost identical, with only six clones showing single base-pair mutations.

After eliminating redundant sequences, 696 unique SSR clones remained, which corresponded to an enrichment rate of 62% across all libraries (Table Almost of all unique SSR clones were non-truncated, i.e. they had more than 25 bp flanking sequence at both ends of the SSR, so that successful primer design was highly probable. Total SSR enrichment was 10% higher for library TRSSRA when compared to library TRSSRB (Table However, library TRSSRA contained more redundant and truncated SSR clones than TRSSRB, so that enrichment for unique non-truncated SSR clones was almost the same for both libraries (Table 2).

TABLE 3 Frequency and type of di-, tri- and tetranucleotide repeats found across six T. repens enriched libraries based on a total of 696 unique SSRs Type Total Perfect Imperfect Compound 1 Dinucleotide repeats2 57% 15% 21% 93% Trinucleotide repeats 3 4% 2% 0% 7% tetranucleotide repeats 4 1% 1% 0% 1% Total 62% 17% 21% 1 Compound repeats include perfect as well as imperfect repeats 2 SSRs with at least 5 uninterrupted dinucleotide repeats 3 SSRs with at least 4 uninterrupted trinucleotide repeats 4 SSRs with at least 3 uninterrupted tetra (or larger) nucleotide repeats TABLE 4 Frequency of dinucleotide and trinucleotide SSR motifs found across six T. repens enriched libraries Total Number Percentage Dinucleotide SSRs" 645 [GT] 485 75.2 [TC] 9 1.4 [TA] 3 [GC] 0 0.0 compoundsb 148 22.9 Trinucleotide SSRs' 46 [GAA], [TTC] 23 50.0 [AAG], [CTT] 18 39.1 [AGT], [GAT], [TAG], [GTT], [TAC] 5 10.9 5 6 7 SSRs with at least 5 uninterrupted dinucleotide repeats All compound dinucleotide repeats contained [GT] SSRs with at least 4 uninterrupted trinucleotide repeats or [TG] motifs The majority of unique SSRs consisted of dinucleotide repeats with 7% being trinucleotide repeats (Table There were only two tetra-, two pentaand one septanucleotide repeat. Across all categories, more than 80% of all SSRs were perfect or compound repeats. There was no difference in SSR type observed among different libraries. The size of dinucleotide SSRs ranged from 5 to 54 repeats with an average of 12.3, and that of trinucleotide SSRs from 4 to 118 with an average of 29 repeats (data not shown). Most SSRs consisted of less than 21 repeats with only 5% being larger than 30 repeats. The average repeat length was slightly lower for TRSSRA (12.8) when compared to TRSSRB Table 4 shows that more than 75% of all dinucleotides contained SSRs of the motif that was used to construct the enriched libraries Together with the compound dinucleotide repeats, which all also contained repeats, these motifs accounted for 91% of all SSRs. While some dinucleotide SSRs consisted of and repeats, the motif was never found. The most frequent trinucleotide motif was [GAA]/[TTC] closely followed by the [AAG]/[CTT] motif.

2005200014 04 Jan 2005 Primer evaluation TABLE A selection of primer sequences designed to SSR loci that yielded amplification products of the expected size across seven T. repens genotypes.

SSR Primer sequence(5'-3') Repeat motif I Expected Polymorphic No. of Pic, repeat class size alleles TRSSRA01 Hi 1 F AGAAAGGTGAATGATGAAA [GAA] 20 212 yes 6 0.78 R TCTAATTCTTCCAATAGGG perfect F CAGTAAAGGAATCTGTTCAAACTATT [GTh5T[GT] 2 C[GT]3 119 yes 4 0.66 R AAACACCAATCAGACCGAAA imperfect TRSSRA02BO08 F TTTTGCTAATAAGTAATGCTGC fTG1 1 1 121 yes 3 0.53 R GGACATTATGCAATGGTGAG perfect TRSSRA02BO9 F TTTTCGCATTGTTTCAGACC [CA] 5

CC[CA]

3 169 no n.a n.a.

CCCTTTCTCAACCCACATC imperfect TRSSRAO2CO2 F AAATAAAACCACAAGTAACTAG [CA]iaIGA]6 147 yes 7 0.79

R

.R TATAGGTGATTTGAAATGGC compound TRSSRAO2CO3 F TATGCTGGTAGATAAACTTAAA [CA1 9 117 yes 6 0.81 R TGCTCTGGAGATTGATGG perfectI 2005200014 04 Jan 2005 SSR Primer sequence(5'-3') Repeat motif I Expected Polymorphic No. of PIC repeat class size alleles TRSSRA02C04 F TGGCTATTACAACTTGGAGA [CAb3CC[CA 7 84 no n.a. n.a.

R CGAGGCATACTTGATGATGG imperfect TRSSRAXX31 F TCTGTTTTGTTGGCCATGC [GT17 123 yes 3 0.60 R TTGCAAAGTGTTTGGAAGGA perfect TRSSRAXX34 F TGACAGAAGACCTGATGTACCG (CA]8[GAI 5

GG[GA

15 196 yes 5 0.78 R TTCCACTCTTAGCATCAACTGG compound TRSSRDXX1 6 F AAGTGTTGGACAAGGAAACTAGG [TA] 7

[CA]

19 167 yes 5 0.75 R ITCTCTAGATCACCGGCATTG Icompound 1 Polymorphism information content as described in materials and methods 2 Not applicable 2005200014 04 Jan 2005 TABLE 6 Amplification and polymorphism across eight T. repens genotypes for different SSR types.

No. of primer Successful amplification Polymorphic across test Average number of Average PIC 1 pairs screened (percentage of primer genotypes (percentage of alleles detected pairs screened) successful amplifications) All SSRs 117 101 (86) 89 (88) 4.8 0.69 By SSR class: Perfect SSRs 69 59 (86) 53 (90) 4.4 0.68 Imperfect SSRs 25 23 (92) 19 (83) 5.2 0.66 Compound SSRs 23 19 (83) 17 (89) 6 0.78 By SSR types' Dinucleotide SSRs 108 94 (87) 84 (89) 4.8 0.69 Trinucleotide SSRs 8 6 (75) 5 (83) 5.5 0.77 By repeat number: 10 repeats 66 57 (86) 49 (86) 4.2 0.68 11 -20 repeats 37 33 (89) 30 (91) 5.6 0.69 21 32 repeats 14 7 (79) 10 (91) 6 0.80 1 2 Polymorphism information content as described in materials and methods Primers to one septanucleotide SSR were tested but failed to amplify Primer pairs were designed and evaluated for 117 SSR loci. Primers were 18 to 27 bp long (average 21 bp) and had a GC content of 27 to 58 (average The size of expected amplification products ranged from 84 to 312 with an average of 178. Details of ten primer pairs are given in Table 5. Out of the 117 primers, 101 amplified a product of the expected size (Table There was no correlation between primer length, GC content or expected product size and successful amplification. However, the percentage of successful amplification was highest for imperfect SSRs, dinucleotide repeats and SSRs with 11-20 repeats.

Eighty-eight percent of all amplified SSRs were polymorphic across seven T.

repens genotypes and detected an average of 4.8 alleles (Table An example of a typical amplification pattern is shown in Fig. 1. The average primer information content for all polymorphic SSRs was 0.69 Compound SSRs had a higher polymorphism information content (PIC) and detected more alleles than perfect or imperfect SSRs. PIC and number of alleles increased with increasing repeat length (Table Four primer pairs were tested for Mendelian segregation in a segregating population. In all cases, primers detected a single SSR allele in the inbred parents, the two parental alleles in each F 1 and segregating parental alleles in the F 2 Segregation did not significantly deviate from Mendelian ratios (Fig 2).

Cross-species amplification Of the 54 primer pairs screened for cross-species amplification, 46 amplified a product in at least one species that was comparable in size and appearance to the SSR detected in T repens (Figure The rate of successful amplification ranged from 76% for T. nigrescens to 7% for Glycine max and was significantly higher for Trifolium species when compared to species of other genera (Figure Fifty percent of all primer pairs that amplified a product in at least one species were shown to be polymorphic across the seven white clover genotypes (data not shown).

All of the 18 PCR products that were cloned from successful cross-species amplifications were shown to contain SSR loci upon sequencing. At least one of the three to six clones sequenced for each PCR product contained an SSR locus, but clones from the same PCR reaction were not always identical. Figure 5 shows sequence alignment for SSR locus TRSSRA02B09 using one representative clone per PCR reaction. The sequences are highly conserved across species and similarity ranged from 82% (when comparing M. sativa to T. nigrescens) to 100% for the comparison of T. repens, T. pratense and M. alba. However, similarity between clones of the same PCR reaction also ranged in average from 89% to 99%, making comparisons of individual species difficult.

Discussion The enrichment procedure used in this study proved to be highly effective and enabled the development of several T. repens DNA libraries highly enriched for SSR loci. Across all libraries, more than 70% of the clones that were sequenced contained SSR loci. This corresponds to a 200 to 700-fold enrichment when compared to the 0.1 to 0.3% of SSRs identified by screening non-enriched genomic libraries. The percentage of clones containing no SSRs is comparable to the rate of false positives encountered by colony screening. However, the enrichment procedure used in this paper does not require the screening of several thousands of colonies with radionucleotides, and, once established, libraries provide an extensive source of SSR loci, resulting in a considerable reduction of time and labour spent per locus.

Due to the [CA]n oligonucleotides used for library enrichment, the vast majority of SSR repeats were dinucleotides with a motif.

Although database surveys showed that these motifs are relatively rare in plants, the high SSR enrichment reported in this study suggests that [CA]/[AC/[TG][GT] repeats occur at a considerable frequency in the white clover genome. Among the SSR motifs that did not correspond to the oligonucleotide used for enrichment, the motif, usually the most frequent repeat in plants, was found at a much lower frequency when compared to the [GAA]/[TTC] or [AAG/[CTT] motifs. These trinucleotide repeats may be of particular interest since [AAG] repeats, together with [AAT], have been found to be particularly common in intron sequences.

The restriction enzymes used for the construction of genomic libraries had a clear influence on the level of SSR enrichment. Although the number of clones sequenced per library in the preliminary screening was small, a difference in enrichment between the two libraries selected for large-scale SSR discovery (TRSSRA and TRSSRB) remained after more than 1000 clones were sequenced.

However, library TRSSRB yielded significantly more clones with more than 25 bp flanking sequence, resulting in little difference between the two libraries in terms of potentially useful SSRs. Alul, the enzyme used in the construction of library TRSSRA, has a four base pair recognition site and is therefore more likely to cut close to an SSR than Dral, used in the construction of library TRSSRB, which has a six base pair recognition site. The use of more than one restriction enzyme in library construction not only maximises the yield of potentially useful SSRs, it may also support even distribution of SSRs across the genome and may prevent the clustering of markers in future mapping applications.

For 86% of the 117 primer pairs that were designed, an amplification product of the expected size was amplified. Given a total number of 397 unique SSR clones suitable for primer design with more than 25 bp flanking region), of all clones sequenced are expected to successfully amplify SSRs. Primers designed to compound SSRs, trinucleotide SSRs and SSRs with more than 21 repeats showed a lower rate of successful amplification when compared to other SSR types. Compound repeats and trinucleotide repeats were generally larger than dinucleotide repeats, averaging 20 bp and 29 bp, respectively (data not shown) and larger SSRs may be more difficult to amplify. Degradation of the SSR and its flanking region is unlikely to be responsible for the lower amplification success of these loci since imperfect SSRs, which are believed to be degraded perfect SSRs.

Some SSR primer pairs amplified more than one allele in either or both of the inbred genotypes 15J and 14R. Although both plants were inbred for four to five generations, a certain amount of residual heterozygosity can not be excluded.

Additional alleles could also be due to the allotetraploid nature of the species.

Residual heterozygosity and allotetraploidy could also be the reasons for the different variants of the same SSR being found during the sequencing of clones from enriched libraries. However, we observed one redundant SSR with four /variants of the SSR. motif and, in addition, single basepair mutations in the flanking sequences of six clones. Since no more than four alleles at a single locus would be expected in a tetraploid species, other factors such as sequencing errors, mutations in the cloning step or multiple copies of the SSR locus and its flanking regions in the genome must be responsible for this variation. Mapping alleles amplified with primers designed to the different SSR variants may help to elucidate the source of these variants.

As expected for a highly heterogeneous, outbreeding species, the percentage of polymorphic SSR loci (88% of successful amplifications) was very high. The polymorphism information content (PIC) was comparable to values found in other outbreeding species such as rye or apple. There was an increase in the level of polymorphism with increasing SSR array length. The differences were small, possibly due to the small range of SSR lengths (5 32 bp) observed.

However, even the shortest SSRs were highly polymorphic, detecting more than 4 alleles with an average PIC of 0.68. Polymorphism not only occurred among genotypes of different cultivars or accessions, but also between genotypes of the same cultivar. Therefore the SSR markers developed in this study provide a valuable tool for the separation of closely related individuals.

Of the 54 primer pairs tested across eight legume species, 46 showed successful amplification in at least one species. More than seventy percent of.the primers amplified products in T. ambiguum and T. nigrescens. These two species are very close relatives and may have played an important role in the origin of white clover. Successful amplification was more frequent for species of the same genus than for more distantly related species. The relatively high success rate in red clover pratense) is particularly noteworthy since this is another important pasture-legume species in which there has been limited development for molecular marker technologies. A large proportion of the primers showing successful cross-species amplifications are expected to detect polymorphism in these species since 50% of these primers detected polymorphism in T. repens.

Cloning and sequencing confirmed the presence of SSR motifs in all species from which an amplification product was analysed. Large parts of the /flanking sequences of these SSR loci were highly conserved across species.

However, some sequence variation was observed between clones isolated from the same PCR amplification. This could be due to the fact that SSR loci were directly cloned from the PCR amplification product and not by isolation of single bands from the gel or could be due to allelic variants. The variation between clones may also be due to the same processes responsible for the often observed stuttering of SSR bands or to several copies of the SSR and its flanking regions.

In conclusion, this paper reports the development of a large set of highly polymorphic SSR markers for T. repens. The possible applications of these markers range from cultivar identification, analysis of genetic diversity to trait mapping and marker-assisted selection.

The optimised procedure described here has been demonstrated to allow efficient recovery of SSR clones from white clover, and is suitable for the construction of similar enrichment libraries from other clover species which are agronomically important pasture legumes, such as red clover (Trifolium pratense), subterranean clover (Trifolium subterraneum), Caucasian clover (Trifolium ambiguum) and Persian clover (Trifolium persicum). Additionally; a high proportion of the existing SSR loci derived from white clover are likely to be transferable directly to other species, as we have demonstrated in several specific instances.

EXAMPLE 2 Development and implementation of SSR technology for white clover (Trifolium repens L.) DNA sequence analysis of TRSSR clones A representative set of TRSSR clones were screened for sequence identity by BLASTN analysis using the BLASTN algorithm provided as part of the suite of molecular biology tools at the NCBI Internet site (http://www.ncbi.nlm.nih.gov). A total of 138 TRSSR clones were selected, of which the majority were derived from the TRSSRB library. Sequence searches were conducted against the GenBank /database. The E value of the highest sequence match (probability against sequence matching by chance) was determined for each query sequence. Figure 7 shows a graphical representation of the number of clones against the logio E value.

In summary, 93% of the sequence produce short 20 bp) and low level (E 10' 2 matches to database accessions, with the majority matching human, Drosophila melanogaster and Caenorhabditis elegans gDNA sequences. This probably reflects the high abundance of such sequences in public databases due to the completion of complete genome sequencing projects for these species. No significant matches to chloroplast DNA sequences were obtained. There were also no matches to known repetitive DNA sequences.

Single matches were also observed to four known genic sequences: an Arabidopsis thaliana helicase gene (E 6 x 10"1), a Petroselinum crispum acyl- CoA oxidase gene (E 4 x 10'9), a tobacco (Nicotiana tabacum) diacylglycerol acyl-CoA acyltransferase gene (E 8 x 10- 24 and a soybean phosphotidylinositol 3-kinase gene (E 10-39). The sequence similarity with the kinase gene was detected using primer pairs specific for locus TRSSRB03HO9. Further analysis of the query sequence using the BLASTX algorithm to determine amino acid sequence alignment revealed the location of the SSR in an intron (Figure 8).

A number of high level matches to unannotated Arabidopsis thaliana genomic sequences were also detected, probably corresponding to currently undescribed genes.

Construction of an SSR-based linkage map Screening for SSR polymorphism in the reference population The reference population for SSR-based genetic map construction in white clover is based on parental genotypes which have been derived from four and five generations of selfing from J and R heterosis groups containing Sf self-fertile mutations (Joyce et al., 1999). A single F, plant was selfed to produce an F 2 population of 125 individuals.

Efficiently amplified TRSSR loci have been screened for genetic polymorphism using the parental genotypes and F, parent. The screening was performed by 33P end-labelling of amplification primers and autoradiographic detection following vertical polyacrylamide gel electrophoresis. Primer pairs from a total of 171 loci were screened, with 108 detecting polymorphism between the two parents. Some primer pairs detected duplicate loci, which may correspond to homoeoloci located in the two progenitor genomes of the allotetraploid white clover genome.

(ii) Genetic mapping of SSR loci in reference population High-throughput genetic mapping of polymorphic markers has been performed for selected using automated capillary electrophoresis of fluorochrome labelled PCR-products. An ABI3700 96-channel DNA sequencer provides the operating platform for this work. Sets of triplexed markers based on the pooling of PCR products have been designed, with amplification primers labelled with the dyes FAM, HEX and NED. Figure 9 shows data from the fluorescence detection system.

Segregation data has been obtained for 54 TRSSR loci, of which 30 were assigned to 14 different linkage groups using the genetic map construction algorithm JOINMAP 2.0. Figure 10 shows the distribution of SSR loci on linkage group 11, which currently has the highest marker density. Data will be obtained for another 36 loci, with an expected total of 90 loci on the reference genetic map, with an average density per linkage group (2n=4x=32) of

REFERENCES

Documents referred to herein are for reference purposes only and the inclusion of such references should not be taken as an indication that the references form part of the common general knowledge in the art, nor that they would have been ascertained, understood and regarded as relevant to the invention disclosed herein by a person skilled in the art at the priority date.

S Doyle JJ, Doyle JL (1987) A rapid DNA isolation procedure for small r quantities of fresh leaf tissue. Phytochem Bull 19: 11-15 Edwards, Barker, Daly, Jones, C. Karp, A. (1996) Microsatellite libraries enriched for several microsatellite sequences in plants.

BioTechniques 20:758-759.

Fulton, Chunwongse, Tanksley, S.D. (1995) Microprep protocol for extraction of DNA from tomato and other herbaceous plants. Plant Molecular Biology Reporter 13:207-209.

Hedrick PW (1985) Genetics of populations. Jones Bartlett Publ. Inc., Boston, Mass.

Joyce TA, Abberton MT, Michaelson-Yeates TPT, Forster JW (1999) Relationships between genetic distance measured by RAPD-PCR and heterosis in inbred lines of white clover (Trifolium repens Euphytica 107: 159-165 Michaleson-Yeates, Marshall, Abberton, Rhodes, I. (1997) Self-compatibility and heterosis in white clover (Trifolium repens Euphytica 94:341-348.

Morchen, Cuguen, Michealis, Hanni, Saumitou-Laprade, P.

(1996) Abundance and length polymorphism or microsatellite repeats in Beta vulgaris. Theor Appl Genet 92:326-333.

Peakall, Gilmore, Keys, Morgante, Fafalski, A. (1998) Cross-species amplification of soybean (Glycine max) simple sequence repeats (SSRs) within the genus and other legume genera: implications for the transferability of SSRs in plants. Mol Biol Evol 15:1275-1287.

Rico, Rico, Hewitt, (1996) 470 million years of conservation of microsatellite loci among fish species. R Soc Lond B Biol Sci 263:549-557.

Saal B, Wricke G (1999) Development of simple sequence repeat markers in rye (Secale cereale Genome 42: 964-972 Sambrook J, Fritsch EF, Maniatis T (1989) Molecular cloning: a laboratory manual, 2nd edition. Cold Spring Harbor Laboratory Press, Plainview, New York Smulders, Breudemeijer, Ruskortekaas, Arens, P., Vosman, B. (1997) Use of short microsatellites from database sequences to generate polymorphisms among Lycopersicon esculentum cultivars and accessions of other Lycopersicon species. Theor Appl Genet 93: 534-538.

Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTAL W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions-specific gap penalties and weight matrix choice. Nucleic Acids Res 22: 4673-4680 Finally, it is to be understood that various alterations, modifications and/or additions may be made without departing from the spirit of the present invention as outlined herein.

It will also be understood that the term "comprises" (or its grammatical variants) as used in this specification is equivalent to the term "includes" and should not be taken as excluding the presence of other elements or features.

Claims (18)

1. A substantially purified or isolated nucleic acid molecule from a clover species including a simple sequence repeat (SSR), said SSR including five or more repeated nucleotide core elements of 2 nucleotides in length, four or more repeated nucleotide core elements of 3 nucleotides in length, or three or more repeated core elements of 4 to 6 nucleotides in length, wherein at least two of the repeated core elements are tandemly repeated.

2. said SSR. A nucleic acid molecule according to claim 1 consisting essentially of

3. A nucleic acid molecule according to claim 1 or 2 wherein said nucleic acid molecule is isolated from a clover species selected from the group consisting of white clover, red clover, subterranean clover, Caucasian clover and Persian clover.

4. A nucleic acid molecule according to any one of claims 1 to 3 wherein said nucleic acid molecule is isolated from white clover. A nucleic acid molecule according to claim 1 or 2 wherein said SSR includes one or more nucleotide sequences selected from the group consisting of: [CA]n [TA]n [CT]n [GT]n [GA]n [TG]n [AC]n [AG]n [TC]n [AT]n wherein n is the number of repeats and is a number between 5 and approximately 004581201v1. 34

6. A nucleic acid molecule according to claim 1 or 2 wherein said SSR includes one or more nucleotide sequences selected from the group consisting of: [CTT]n [GAA]n [TAC]n [TTC]n [AAG]n [GGGTGTT]n wherein n is the number of repeats and is a number between 4 and approximately

7. A nucleic acid molecule according to claim 5 or 6 wherein said SSR includes one or more nucleotide sequences selected from the group consisting of: [GT] 7 [CA] 8 [GA] 5 GG[GA] 15 [AC]io [TA] 7 [CA] 19 [GT]io [CTT] 15 [GAA] 23 [TAC] 8 or a fragment or variant thereof. [GGGTGTT] 4 [GAA] 20 [GT] 5 T[GT] 2 C[GT] 3 [TG] 11 [CA]5CC[CA] 3 [CA] 10 [GA] 6 [CA] 9 [CA]3CC[CA]7

8. A nucleic acid primer pair suitable for amplifying a SSR according to claim 1.

9. A nucleic acid primer pair according to claim 8 wherein said nucleic acid primer pair is selected from the group consisting of: 5'-TCTGTTTTGTTGGCCATGC-3' 5'-TTGCAAAGTGTTTGGAAGGA-3' 5'-TGACAGAAGACCTGATGTACCG-3' 5'-TTCCACTCTTAGCATCAACTGG-3' 004581 20101. 5'-TTTGAAATCACGGTGACACG-3' 5'-CCTGCATCAGCTCCTATTCC-3' 5'-AAGTGTTGGACAAGGAAACTAGG-3' 5'-TCTCTAGATGAGCGGCATTG-3' 5'-GGAGACCTGTGGCAAGTATG-3' 5'-CCTCCAACAAGCATGTAACG-3' 5'-AGAAAGGTGAATGATGAAA-3' 5'-TCTAATTCTTCCAATAGGG-3' 5'-CAGTAAAGGAATCTGTTCAAACTATT-3' I 5'-AAACACCAATCAGACCGAAA-3' 5'-TTTTGCTAATAAGTAATGCTGC-3' 5'-GGACATTATGCAATGGTGAG-3' 5'-TTTTCGCATTGTTTCAGACC-3' 5'-CCCTTTCTCAACCCACATC-3' 5'-AAATAAAACCACAAGTAACTAG-3' I 5'-TATAGGTGATTTGAAATGGC-3' 5'-TATGCTGGTAGATAAACTTAAA-3' 5'-TGCTCTGGAGATTGATGG-3' 5'-TGGCTATTACAACTTGGAGA-3' I 5'-CGAGGCATACTTGATGATGG-3'. A fragment or analogue of a primer according to claim 9 which fragment or analogue is suitable for amplifying a SSR in a clover species

11. A method of identifying a SSR according to claim 1, said method including preparing a library of clover genomic DNA enriched for SSRs and identifying clones in said library containing SSRs, wherein said library is prepared by a method including providing genomic DNA from a clover species, a first restriction enzyme, symmetrical adaptors each containing a second restriction enzyme site, primers complementary to the adaptors, a hybridization membrane carrying bound oligonucleotides including the sequence [CA]n, 004581201v1. 36 a second restriction enzyme, and a vector; digesting the genomic DNA with the first restriction enzyme; ligating the adaptors to the digested genomic DNA; amplifying the ligated DNA by PCR using the primers; hybridizing the PCR amplified DNA to the membrane; amplifying the PCR amplified DNA which preferentially hybridized to the membrane; digesting the amplified DNA with the second restriction enzyme; and ligating the digested and amplified DNA into the vector to generate the library.

12. A method according to claim 11 wherein said first restriction enzyme is a blunt end restriction enzyme or plurality of blunt end restriction enzymes.

13. A method according to claim 12 wherein said blunt end restriction enzyme(s) are selected from the group consisting of Alul, Dral, EcoRV, Rsal, Sspl, Haelll and Hincld.

14. A method according to claim 13 where the enzyme is Alul. A method according to any one of claims 11 to 14, wherein all bound oligonucleotides include the sequence

16. A method according to any one of claims 11 to 15 where n

17. A substantially purified or isolated nucleic acid molecule according to any one of claims 1 to 7, wherein said nucleic acid molecule is purified or isolated from a library of clover genomic DNA enriched for SSRs according to a method of any one of claims 11 to 16.

18. A nucleic acid molecule according to claim 17 consisting essentially of said SSR.

19. A nucleic acid molecule according to either claim 17 or 18, wherein said nucleic acid molecule is isolated from a clover species selected from the 004581201v1. 37 group consisting of white clover, red clover, subterranean clover, Caucasian clover, and Persian clover. A nucleic acid molecule according to either claim 17 or 18, wherein said SSR includes one or more nucleotide sequences selected from the group consisting of: [CA]n [TA]n [CT]n [GT]n [GAIn [TG]n [AC]n [AG]n [TC]n [AT]n wherein n is the number of repeats and is a number between 5 and approximately

21. A nucleic acid molecule according to either claim 17 or 18, wherein said SSR includes one or more nucleotide sequences selected from the group consisting of: [CTT]n [GAA]n [TAC]n [TTC]n [AAG]n [GGGTGTT]n wherein n is the number of repeats and is a number between 4 and approximately

00458120101. 38 22. A nucleic acid molecule according to either claim 17 or 18, wherein said SSR includes one or more nucleotide sequences selected from the group consisting of: [GT] 7 [GGGTGTT] 4 [CA] 8 [GA] 5 GG[GA] 15 [GAA] 20 [AC]iO [GT] 5 T[GT] 2 0[GT] 3 [TA] 7 [CA] 19 [TG]j, [GT]lo [OA] 5 00[OA] 3 [OTT] 15 [CA] 1 o[GA] 6 [GAA1 23 [CA] 9 [TAO] 8 [CA]3OC[OA]7 or a fragment or variant thereof. 23. A nucleic acid primer pair suitable for amplifying an SSR according to claim 17. 24. A nucleic acid primer pair according to claim 23 wherein said nucleic acid primer pair is selected from the group consisting of: 5'-TCTGTTTTGTTGGCCATGO-3' 5'-TTGCAAAGTGTTTGGAAGGA-3' 5'-TGACAGAAGAOOTGATGTACCG-3' 5'-TTOOAOTCTTAGOATOAAOTGG-3' 5'-TTTGAAATCAOGGTGAOAOG-3' 5'-OOTGOATOAGCTCCTATTOO-3' 5'-AAGTGTTGGAOAAGGAAAOTAGG-3' 5'-TOTOTAGATGAGOGGOATTG-3' 5'-GGAGAOOTGTGGOAAGTATG-3' 5'-OOTOOAAOAAGOATGTAAOG-3' 5'-AGAAAGGTGAATGATGAAA-3' 5'-TOTAATTOTTOOAATAGGG-3' 5'-OAGTAAAGGAATOTGTTOAAACTATT-3' 5'-AAACACCAATCAGAOOGAAA-3' 5'-TTTTGOTAATAAGTAATGOTGC-3' 5'-GGACATTATGCAATGGTGAG-3' 004581201v1. 39 5'-TTTTCGCATTGTTTCAGACC-3' 5'-CCCTTTCTCAACCCACATC-3' 5'-AAATAAAACCACAAGTAACTAG-3' 5'-TATAGGTGATTTGAAATGGC-3' 5'-TATGCTGGTAGATAAACTTAAA-3' 5'-TGCTCTGGAGATTGATGG-3' 5'-TGGCTATTACAACTTGGAGA-3' 5'-CGAGGCATACTTGATGATGG-3'. 25. A fragment or analogue of a nucleic acid primer according to claim 24 which fragment or analogue is suitable for amplifying a SSR in a clover species. 26. A library of clover genomic DNA enriched for SSRs and prepared by a method according to claim 11. 27. A method of selecting for a gene in clover breeding, said method including identifying a nucleic acid molecule including an SSR according to any one of claims 1 to 7 or claims 17 to 22 that is closely associated with said gene such that said gene and said SSR are preferentially coinherited, and selecting for said SSR in said breeding. 28. A method according to claim 18 to 27 wherein the SSR and the gene have a genetic map distance of approximately 5 cM or less. 29. A method according to claims 27 or 28 wherein said gene is capable of influencing clover cyst nematode (TCN) resistance, herbage yield and/or quality, or drought tolerance. A method for DNA profiling legume species varieties, said method including assessing variation between said varieties of a SSR according to claim 1. 31. A method according to claim 30 wherein said legume is a clover. 32. A method for testing the purity of legume seed batches, said method including assessing variation within said batch of a SSR according to claim 1. 33. A method according to claim 32 wherein said legume is a clover. 004581201v4. 34. A method for construction of a genetic map of the association between the locus of an SSR according to any one of claims 1 to 7 or claims 17 to 22 and a target gene nearly on the same chromosome. A method according to claim 34 wherein the distance between the locus and the gene is 5 cM or less. 36. A method for construction of a genetic map of the association between loci of SSRs according to any one of either claims 1 to 7 or claims 17 to 22 and target genes in a clover species including: identifying the loci of the SSRs as polymorphic genetic markers; linking the polymorphic genetic markers to one or more physical characters; and analysing a cross of the species to locate the target genes. 37. A method according to claim 36 wherein the distance between each SSR locus and its target gene is 5 cM or less. 38. A method according to claim 36 or 37 wherein the genetic map has a density of c.100 loci. 39. A nucleic acid molecule according to claim 1, hereinbefore described with reference to the examples. A method according to claim 11 substantially described with reference to the examples. 41. A method according to claim 36 substantially described with reference to the examples. Agriculture Victoria Services Pty Ltd By its Registered Patent Attorneys Freehills Patent Trade Mark Attorneys substantially as as hereinbefore as hereinbefore 4 January 2005