AU2004271662A1 - Methods for identifying modulators of protein kinase c-epsilon (PKCe) and method of treatment of aberrant glucose metabolism associated therewith - Google Patents

Description

WO 2005/025602 PCT/AU2004/001255 METHOD FOR IDENTIFYING MODULATORS OF PROTEIN KINASE C-EPSILON (PKCc) AND METHOD OF TREATMfENT OF ABERRANT GLUCOSE METABOLISM ASSOCIATED THEREWTTH 5 FIELD OF THE INrVENTION This invention pertains to methods for regulating or ameliorating metabolic defects associated with glucose and insulin metabolism disorders, especially those associated with Type II diabetes. More particularly the present invention relates to methods for reducing in a subject, such as a vertebrate animal (including a human), at least one of 10 the following indices of metabolism: insulin secretion, insulin resistance, glucose intolerance, byperinsulinemia, hyperglycemia, and body fat stores. The method of the invention comprises reducing the level and/or activity of protein kinase C epsilon (PKCs), thereby reducing insulin clearance by the liver and/or enhancing insulin secretion by 0-islet cells, Protection of 3-islet cells from the adverse effects of a high 15 fat diet and/or elevated circulating lipid levels and/or a propensity to accumulate lipid in p-islet cells is also conferred. The present invention further provides methods for determining an antagonist compound of protein kinase C epsilon (PKCs) based upon the newly-identified roles of PKCe in the liver and pancreas, wherein the identified compounds are suitable for use in the methods of treatment described herein. 20 BACKGROUND TO THE IN"vENTION General This specification contains nucleotide and amino acid sequence information prepared using PatentIn Version 3.1, presented herein after the claims. Each nucleotide 25 sequence is identified in the sequence listing by the numeric indicator <210> followed by the sequence identifier (e g <210>1, <210>2, <213> etc). The length and type of sequence (DNA, protein (PRT), etc), and source organism for each nucleotide sequence, are indicated by information provided in the numeric indicator fields <211>, <212> and <213>, respectively. Nucleotide sequences referred to in the speci5cation 30 are defined by the term "'SEQ ID NO:", followed by the sequence identifier (eg, SEQ ID NO: 1 refers to the sequence in the sequence listing desigqated as <400>1). The designation of nucleotide residues referred to herein are those recommended by the IUPAC-IUB Biochemical Nomenclature Commission, wherein A represents Adenine, 35 C represents Cytosine, G represents Guanine, T represents thymine, Y represents a pyrimidine residue, R represents a purine residue, NI represents Adenine or Cytosine, K WO 2005/025602 PCT/AU2004/001255 2 represents Guanine or Thymine, S represents Guanine or Cytosine, W represents Adenine or Thymine, H represents a nucleotide other than Guanine, B represents a nucleotide other than Adenine, V represents a nucleotide other than Thymine, D represents a nucleotide other than Cytosine and N represents any nucleotide residue. 5 As used herein the term "derived from" shall be taken to indicate that a specified integer may be obtained from a particular source albeit not necessarily directly from that source. 10 Throughout this specification, unless the context requires otherwise, the word "comprise", or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated step or element or integer or group of steps or elements or integers but not the exclusion of any other step or element or integer or group of elements or integers. 15 As used herein, the term "abnormality of glucose metabolism" shall be taken to mean one or more conditions selected from the group consisting of hyperglycemia, glucose intolerance, insulin resistance, hyperinsulinemia and P-islet cell dysfunction. 20 The term "elevated circulating lipid levels" shall be taken to mean a level of lipid clinically associated with an actual or enhanced risk of islet cell dysfunction or increased tendency to cell death. By "islet cll dysfunction" is meant an impaired ability of the islet cell to secrete insulin eg., in response to glucose. Accordingly, a level of circulating lipid or amount of lipid in 13-islet cells is an amount of lipid 25 sufficient to enhance the risk of islet cell dysfunction or capable of causing actual islet cell dysfunction in a subject. As used herein, the term "protein kinase C epsilon" or "PKCe" means an enzyme having the known substrate specificity and cofactor requirements of PKCs, and 30 preferably, comprising an amino acid sequence that is at least about 80% identical to a sequence set forth herein as SEQ ID Nos: 2 or 4 or a portion thereof having PKCa activity. For the purposes of nomenclature, the amino acid sequences of the murine and human PKCs polypeptides are exemplified herein, as SEQ ID Nos: 2 and 4, respectively. Preferably, the percentage identity to SEQ ID NO: 2 or 4 is at least about 35 85%, more preferably at least about 90%, even more preferably at least about 95% and still more preferably at least about 99%. The term 'TKCc" shall further be taken to WO 2005/025602 PCT/AU2004/001255 3 mean a protein that exhibits the known biological activity of PKCs, or the known substrate and cofactor specificity of PKCs eg., by transfer of phosphate to a substrate peptide comprising the amino acid sequence ERMRPRKRQGSVRRRV (SEQ ID NO: 5) in a calcium-independent manner and/or in response to phorbol ester. 5 Those skilled in the art will appreciate that the invention described herein is susceptible to variations and modifications other than those specifically described. It is to be understood that the invention includes all such variations and modifications. The invention also includes all of the steps, features, compositions and compounds referred 10 to or indicated in this specification, individually or collectively, and any and all combinations or any two or more of said steps or features. The present invention is not to be limited in scope by the specific embodiments described herein, which are intended for the purposes of exemplification only. 15 Functionally equivalent products, compositions and methods are clearly within the scope of the invention, as described herein. The embodiments of the invention described herein with respect to any single embodiment shall be taken to apply mutatis mutandis to any other embodiment of the 20 invention described herein, In particular, the processes described herein with respect to the treatment of insulin resistance and'or the determination of modulators for the treatment of insulin resistance shall be taken to apply mnutatis mutandis to processes for the treatment of glucose intolerance, hy.perinsulineanmia, and hyperglycaemia and/or to methods for the determination of modulatory compounds for the treatment of such 25 conditions, particularly in obese subjects or subjects on a high-fat diet or showing elevated circulating lipid levels of having a propensity to accumulate lipid in 1-islet cells or subjects suffering from NIDDM. The present invention is performed without undue experimentation using, unless 30 otherwise indicated, conventional techniques of molecular biology, microbiology, virology, recombinant DNA technology, peptide synthesis in solution, solid phase peptide synthesis, and immunology. Such procedures are described, for example, in the following texts that are incorporated herein by reference: Sambrook, Fritsch & Maniatis, Molecular Cloning: A Laboratory Manual, Cold Spring 35 Harbor Laboratories, New York, Second Edition (1989), whole of Vols I, II, and IM; WO 2005/025602 PCT/AU2004/001255 4 DNA Cloning: A Practical Approach, Vols. I and 11 (D. N. Glover, ed., 1985), IRL Press, Oxford, whole of text; Oligonucleotide Synthesis: A Practical Approach (M, J. Gait, ed., 1984) IRL Press, Oxford, whole of text, and particularly the papers therein by Gait, ppl 1-22; Atkinson et 5 al., pp35-81; Sproat et aL, pp 83-115; and Wu et al., pp 135-151; Nucleic Acid Hybridization: A Practical Approach (B. D. Haines & S. J. Higgins, eds., 1985) IRL Press, Oxford, whole of text; Animal Cell Culture: Practical Approach, Third Edition (John R.W. Masters, ed., 2000), ISBN 0199637970, whole of text; 10 Immobilized Cells and Enzymes: A Practical Approach (1986) IRL Press, Oxford, whole of text; Perbal, B., A Practical Guide to Molecular Cloning (1984); Methods In Enzymology (S. Colowick and N, Kaplan, eds., Academic Press, Inc.), whole of series; 15 J.F. Ramalho Ortiggo, "The Chemistry of Peptide Synthesis" In: Knowledge database of Access to Virtual Laboratory website (Interactiva, Germany); Sakakibara, D., Teichman, J., Lien, E. Land Fenichel, R.L. (1976). Biochem. Biophys. Res, Commun. 73 336-342 Merrifield, R.B. (1963). J. Am. Chem. Soc. 85, 2149-2154. 20 Barany, G. and Merrifield, R.1. (1979) in The Peptides (Gross, E. and Meienhofer, J. eds.), vol. 2, pp. 1-284, Academic Press, New York. Wiinsch, E., ed. (1974) @ynthese von Peptiden in Houben-Weyls Metoden der Organischen Chemie (Miller, E., ed.), vol. 15, 4th edn., Parts I and 2, Thieme, Stuttgart. 25 Bodanszky, M. (1984) Principles ofPeptide Synthesis, Springer-Verlag, Heidelberg. Bodanszky, M. & Bodanszky, A. (1984) The Practice ofPeptide Synthesis, Springer Verlag, Heidelberg. Bodanszky, M. (1985) ht. J. Peptide Protein Res. 25, 449-474. Handbook of Experimental Immunology, Vols. I-IV (D. M. Weir and C. C. Blackwell, 30 eds., 1986, Blackwell Scientific Publications). 2. Description of the related art Noninsulin-dependent diabetes mellitus (NIDDM or Type II diabetes) is a serious health concern, particularly in more developed societies that ingest foodstuffs high in 35 sugars and/or fats. The disease is associated with blindness, heart disease, stroke, WO 2005/025602 PCT/AU2004/001255 5 kidney disease, hearing loss, gangrene and impotence. Type JI diabetes and its complications are leading causes of premature death in the Western world. Generally, NIDDM adversely affects the way the body converts ingested sugars and 5 starches into glucose. In muscle, adipose (fat) and connective tissues, insulin facilitates the entry of glucose into the cells by an action on the cell membranes. In the liver, the ingested glucose is normally converted to carbon dioxide and water (50%), glycogen (5%), and fat (30-40%). The fat is stored as fat deposits. Fatty acids from the adipose tissues are circulated, returned to the liver for re-synthesis of triacylglycerol and 10 metabolized to ketone bodies for utilization by the peripheral tissues. The fatty acids are also metabolized by other organs. NIDDM can be viewed as a failure of pancreatic -cells to secrete sufficient insulin to overcome insulin resistance at the level of liver and skeletal muscle (De Fronzo 15 Diabetes 37, 667-687, 1987; Polonsky et al., N. Engl, J. Med. 334, 777-783, 1996). Although the functional defects obviously differ, there is increasing evidence that an inappropriate accumulation of lipid in each of these tissues, as a result of either oversupply or altered cellular metabolism, might be a common etiological factor in the progression of the disease (Boden et al., Proc. Assoc. Am. Phys. 111, 241-248, 1999; 20 McGarry Diabetes 51, 7-18, 2002; Bergman et al., Trends Endocrinol. Metab. 11, 351 356, 2000; Lewis et al., Endocr Rev 23, 201-209, 2002). In most NIDDM subjects, the metabolic entry of glucose into various "peripheral" tissues is reduced and there is increased liberation of glucose into the circulation from the liver, Thus, there is an excess of extracellular glucose and a deficiency of intracellular glucose. Elevated blood 25 lipids and lipoproteins are a further common complication of diabetes. The cumulative effect of these diabetes-associated abnormalities is severe damage to blood vessels and nerves. Althought the pancreas retains the ability to produce insulin, and in fact may produce higher than normal amounts of insulin (hyperinsulinemia), in diabetic subjects this insulin is insufficient to overcome the cellular resistance to insulin that occurs in 30 obese subjects (ie "insulin resistance. Insulin resistance can be defined as a state in which a normal amount of insulin produces a suboptimal metabolic response compared to the metabolic response of a nonnal or healthy subject. Insulin resistance is therefore a failure of target tissues to 35 increase whole body glucose disposal in response to insulin. In insulin-treated patients suffering from Type II diabetes, insulin resistance is considered to be present whenever WO 2005/025602 PCT/AU2004/001255 6 the therapeutic dose of insulin exceeds the rate of secretion of insulin of a normal or healthy subject. Insulin resistance is commonly observed in obese subjects. It is a major determinant of 5 Type 2 diabetes which occurs in those subjects whose P-cells fail to compensate for insulin resistance by enhanced insulin secretion. Insulin resistance is also associated with hyperglycemia (i.e. the subject has an elevated level of blood glucose associated with elevated levels of plasma insulin), or glucose 10 intolerance. Those skilled in the art are aware that the term "glucose intolerance" refers to a pathological state in which there is a reduced ability to metabolise glucose, as determined by a low fasting plasma glucose level (eg., less than about 140 mg per deciliter for a human subject) and a sustained elevated plasma glucose level in a standard glucose tolerance test, For most glucose intolerant human subjects, the 15 plasma glucose concentration following a glucose tolerance test would generally exceed about 200 mg per deciliter for a period of at least about 30 minutes or at least about 60 minutes or at least about 90 minutes following ingestion of an amount of glucose in a standard glucose tolerance test. Glucose intolerance is seen frequently in NIDDM but also occurs with other diseases and during pregnancy. Given the role of 20 insulin in promoting the metabolism of glucose, glucose intolerance is an end-result of insulin resistance in an NIDDM subject. Aberrant activities of protein kinase C (PKC) isoenzymes the liver and skeletal muscle (the major regulators of glucose disposal) have been correlated to insulin resistance in 25 humans and animal models. The PKC family consists of at least 11 isoforms, grouped into the classical PKCs (PKCC, PKCr, PKCI3n, PKCy), novel PKCs (PKCb, PKCe, PKCl, PKCO, PKCA), and atypical PKCs (PKC(, PKCulJ), which exhibit different substrate and cofactor requirements, and differences in their tissue localization. 30 Intracellular lipid accumulation has also implicated in 0-islet cell dysfunction, in particular loss of secretory responsiveness to glucose, and reduced 13-islet cell mass due to apoptosis. Notwithstanding the correlations between PKC activity and lipid-induced insulin 35 resistance, the specific PKC isoenzyme(s) involved in causing insulin resistance or glucose intolerance, and the tissue-specificity of any), PKC in producing such effects in WO 2005/025602 PCT/AU2004/001255 7 the peripheral tissues, are not known. The precise mechanisms of glucose intolerance or insulin resistance remain to be elucidated for effective and highly-specific treatment regimes to be developed. 5 There remains a need for effective treatments of insulin resistance and/or glucose intolerance and/or hyperglycaemia, particularly in NIDDM subjects. SUMMARY OF THE INVENTION In work leading up to the present invention, the present inventors sought to determine 10 whether or not PKCs is causally implicated in insulin resistance. The inventors determined the glucose tolerances of PKCs null mutant mice having their PKCs encoding gene insertionally inactivated, and showed that the PKCs null mutant mice exhibited enhanced glucose tolerance (i.e. a lower peak of blood glucose which returned to basal levels more quickly) compared to wild type mice, This enhanced s15 glucose tolerance was accompanied by increased plasma insulin. Surprisingly, plasma C-peptide levels were not different between wild type and null mutant chow-fed mice throughout the glucose tolerance test, indicating that the increase in insulin was due to reduced insulin clearance by the liver, rather than to enhanced insulin secretion by pancreatic 0-cells. 20 The inventors have also shown that unsaturated fat-fed wild-type and null mutant animals exhibit similar energy intake and intra-abdominal fat accumulation. Surprisingly, in fat-fed animals, in contrast to ardnimals receiving a normal diet, the plasma C-peptide profiles indicated that insulin secretion was enhanced in the null 25 mutant mice, suggesting that enhanced insulin secretion contributed to the protection of the null mutant mice from lipid-induced glucose intolerance. This conclusion was father supported by a comparison of insulin secretion between chow- and fat-fed null mutant mice. In wild-type mice, however, the high fat-diet causes a a-islet cell defect in the pancreas, thereby preventing compensation of lipid-induced glucose intolerance so30 by enhanced insulin secretion. These results therefore indicate that in addition to reduced liver-mediated clearance of insulin, deletion of PKCe also protects pancreatic P-cells from lipid-induced defects in insulin secretion. The skilled artisan is aware from the foregoing description of the broad applicability of 35 the invention to the treatment of subjects on a high-fat diet or showing elevated circulating lipid levels (hyperlipaemia or hyperlipidemia) or having a propensity to WO 2005/025602 PCT/AU2004/001255 8 accuulate lipid in their P3-islet cells. Without being bound by any theory or mode of action, hyperglycaernia may exert a toxic effect on the O-islet cells via PKCe, because glucose can be converted by the -islet cells into lipid. 5 Moreover, the present inventors observed no measurable differences in the insulin tolerances of wild-type and null mutant animals fed a high-unsaturated fat diet, and insulin resistance was only detected by more sensitive techniques such as by using glucose tracers (e.g., Figures 7c-e and Figure 8). The present inventors have also shown that animal subjects receiving a diet high in saturated fats, peripheral insulin 10 resistance occurs in both wild-type and PKCs animals. Hower, in neither case does PKCs inhibition e.g., by deletion of the PKCs gene or other means of reducing PKCe gene expression, appear to enhance or improve insulin action. Rather, inhibition of PKCs e.g., by deletion of the PKCs gene or other means of reducing PKCs gene expression, reduces liver-mediated clearance of insulin and protects pancreatic 3-cells 15 from lipid-induced defects in insulin secretion. In summary, while PKCs null mutant mice do not exhibit enhanced skeletal muslete insulin sensitivity as predicted from conventional wisdom in the art, the deletion of this PKC isoform reduces insulin clearance by the liver and protects animals from fat 20 induced defects in insulin secretion by the pancreatic 13-islet cells, thereby enhancing glucose tolerance in the whole animal. Accordingly, the present invention provides a method of treatment of an abnormality of glucose metabolism in an animal subject, such as a human in need of treatment thereof 25 e.g., by virtue of suffering from NIDDM, hyperglycaermia, hyperinsulinemia, insulin resistance or glucose intolerance, said method comprising administering to the subject an amount of an antagonist of a protein kinase C epsilon (PKCs) for a time and under conditions sufficient to reduce the level and/or activity of the enzyme int the liver of the subject thereby reducing insulin clearance by the liver. 30 In a related embodiment, there is provided a method of treatment of an abnormality of glucose metabolism in an animal subject, such as a human in need of treatment thereof e.g., by virtue of suffering from NIDDM, hyperglycaemia, hyperinsulinemnia, insulin resistance or glucose intolerance or being on a high fat diet and/or displaying WO 2005/025602 PCT/AU2004/001255 9 hyperlipidemia and/or a susceptibility to lipid deposition in P-islet cells, said method comprising administering to the subject an amount of an antagonist of a protein kinase C epsilon (PKCF) for a time and under conditions sufficient to enhance insulin secretion by the pancreas. 5 Also based on the findings by the inventors that there are differential factors in the development of insulin resistance in peripheral organs such as skeletal muscle compared to internal organs such as liver and pancreas, and that PKCE is involved in insulin resistance in liver and pancreas, the inventors have developed cell-based and 10 animal-based drug screens for identifying new classes of compounds for the treatment of insulin resistance in the liver and/or pancreas. Accordingly, the present invention provides a method of determining an antagonist of a protein kinase C epsilon (PKC&) for the treatment of abnormal glucose metabolism in a 15 human or animal subject said method comprising: (i) incubating a hepatocyte in the presence and absence of a candidate compound; (ii) stimulating the hepatocytes at (i) with insulin or analogue thereof; and (iii) determining the rate of internalization of the insulin receptor in the insulin stimulated hepatocytes wherein reduced insulin receptor internalization in the presence 20 of the candidate compound compared to in the absence of the candidate compound indicates that the compound is an antagonist of PKCs. Preferably, the hepatocyte is from a wild type animal having a functional PKCc enzyme. For example, the hepatocyte is from a non-human animal engineered to 25 express an introduced non-endogenous PKCs gene of humans e.g., a non-human animal is engineered to have reduced or no detectable endogenous PKCs. The hepatocyte can be a human hepatoma cell line, a primary hepatocyte or immortalized hepatocyte e.g., the hepatoma cell line HepG2 (ATCC Accession No. 30 HB-8065) or Huh7. For example, insulin receptor internalization can be measured by determining the uptake of labeled insulin or analogue thereof into cells and wherein reduced uptake of said labeled insulin or insulin analogue indicates that the compound is an antagonist of 35 PKCe.

WO 2005/025602 PCT/AU2004/001255 10 Alternatively, insulin receptor internalization is measured by a process comprising determining a change in signal produced by a pH sensitive tag in the alpha subunit of the insulin receptor relative to the signal produced by a tag in a cytoplasmic domain of the beta subunit of the insulin receptor by virtue of a change in pH of the alpha subunit 5 on internalization. The pH sensitive tag can be pHluorin. For example, the tag in a cytoplasmic domain of the beta subunit of the insulin receptor is selected from the group consisting of FLAG epitope, yellow fluorescent protein, green fluorescent protein and red fluorescent protein e.g., at the C-terminus of the beta subunit of the insulin receptor. The pH sensitive tag is preferably positioned at the N-terminus of the 10 alpha subunit of the insulin receptor. Preferably, the insulin receptor is an in-frame fusion protein with the pH sensitive tag and the tag in a cytoplasmic domain of the beta subunit of the insulin receptor. This embodiment clearly encompasses expressing the in-frame fusion protein in the hepatocyte. Preferably, the method further comprises introducing nucleic acid encoding the in-frame fusion protein into the hepatocyte. 15 Alternatively, internalization of the insulin receptor can be determined by a process comprising incubating hepatocytes in the presence of insulin, biotinylating surface proteins of the hepatocytes, and determining the total amount of insulin receptor in the hepatocytes. 20 Insulin receptor internalization can also be determined by labelling the insulin receptor with a fluorescent tag and determining the amount of tag internalized. Preferably, uptake of insulin is determined as a percentage of total cell-associated 25 insulin or analogue thereof. The method preferably further comprises incubating the hepatocyte in the presence of a compound that inhibits or reduces the efflux of insulin or analogue thereof e.g., chloroquinone or bafilomycin. 30 The present invention also provides a method of determining an antagonist of a protein kinase C epsilon (PKCs) for the treatment of abnormal glucose metabolism in a human or animal subject said method comprising: (i) incubating a pancreatic f3-islet cell with an amount of a lipid or free fatty acid 35 (FFA) and/or glucose; WO 2005/025602 PCT/AU2004/001255 11. (ii) incubating the cell at (i) in the presence and absence of a candidate compound; and (iii) determining the level of insulin, secretion by the cell wherein enhanced insulin secretion in the presence of the candidate compound compared to in the absence of the 5 compound indicates that the compound is an antagonist of PKCs. Preferably, the islet cell is from a wild type animal having a functional PKCs enzyme. The islet cells can also be from a diabetic mouse and the islet cells are incubated in the absence of lipid or FFA. The diabetic mouse can be a db/db mouse. The islet cell can 10 also be from a non-human animal engineered to express an introduced non-endogenous PKCs gene of humans, preferably, a non-human animal engineered to have reduced or no detectable endogenous PKCs. The islet cell can be a cultured murine MIN6 cell, a primary pancreatic islet cell or immortalized pancreatic cell line. 15 The cells can be pre-treated with FFA for a time and under conditions sufficient to increase in basal insulin secretion and inhibit glucose stimulated insulin secretion. The amount of FFA and/or glucose is sufficient to reduce or ablate glucose-stimulated insulin secretion by the cell in the absence of the compound being tested. The lipid or FFA can be selected from the group consisting of palmitic acid, oleic acid, linoleic 20 acid, myristic acid, laurie acid, pentadecanoic acid, stearic acid, and linolenic acid, The insulin secretion determined is preferably glucose-stimulated insulin secretion. Insulin secretion is preferably determined by immunoassay using antibodies against 25 insulin or reverse hemolytic plaque assay. Other methods are also described herein. The method may further comprise incubating the islet cell in the presence of a compound that potentiates glucose-stimulated insulin secretion, preferably in cells having low PKCe activity, e.g., a muscarinic acid receptor agonist such as 30 acetylcholine, a non-hydrolyzable analog of acetylcholine, arecoline, oxotremorine, pilocarpine or a mixture thereof. A preferred non-hydrolyzable analog of acetylcholine is carbamylcholine. Alternatively, the compound is an inhibitor of PI 3-kinase activity e.g., wortmannin, rosiglitazone, LY294002 or mixtures thereof. Alternatively, the compound is glyburide. 35 WO 2005/025602 PCT/AU2004/001255 12 The method preferably further comprises incubating the islet cell in the presence of a compound that potentiates glucose-independent insulin secretion e.g., IBMLX or forskolin or mixtures thereof. 5 Alternatively or in addition, the present invention provides a method of determining an antagonist of a protein kinase C epsilon (PKCs) for the treatment of abnormal glucose metabolism in a human or animal subject said method comprising providing a candidate compound to an animal having normal PKCs expression, providing a diet high in saturated and/or unsaturated fats to the animal and determining the level of one 10 or more indicators of glucose homeostasis for the animal wherein a modified level(s) indicates that the compound is an antagonist or inhibitor of PKCs. The animal may be a wild-type animal epxressing normal endogenous levels of the PKCs enzyme, or an animal that has been engineered to express PKCs of humans 15 (including a PKC " /" or PKCse / mouse engineered to express human PKCs), or a diabetic mouse model e.g., a db/db mouse. Preferably, a modified level of one or more indicators of glucose homeostatis is determined by comparing the level of one or more indicators of glucose homeostasis to 20 the level of the indicator(s) in a wild type or PKC&

"

'

/ or PKCs " control animal maintained on a chow diet or other diet low in fat, wherein a trend toward the level observed for the control animal indicates modified glucose homeostasis. Preferred indicators of glucose homeostasis is selected from the group consisting of blood glucose, serum insulin, serum C peptide and combinations thereof Preferably, the 25 compound decreases serum glucose and/or increases serum insulin and/or increases serum C-peptide in the animal. Preferably, an amount of the compound is provided to the animal before placing the animal on a high fat diet or at the same time as placing the animal on a high fat diet or 30 after placing the animal on a high fat diet. Preferably, the method further comprises determining the ability of the compound to mimic a phenotype of a PKCs " " or PKCs

/"

mouse.

WO 2005/025602 PCT/AU2004/001255 13 Preferably, the methods described herein further comprise determining the ability of the compound to modulate activation, intracellular translocation, catalytic activity or kinase activity of PKCs. 5 The methods described herein can be combined in a number of different permutations and in any order, as primary, secondaryor tertiary screens. In a preferred embodiment, a primary or secondary screen comprises a hepatocyte-based assay or islet cell-based assay and an animal-based assay is performed as a component of a tertiary screen to validate drug efficacy in vivo. 10 Accordingly, the present invention also provides a process for determining an antagonist of a protein kinase C epsilon (PKCs) for the treatment of abnormal glucose metabolism in a human or animal subject said process comprising: (i) identifying a lead compound in a primary screen comprising incubating a 15 hepatocyte in the presence and absence of a candidate compound, stimulating the hepatocytes at with insulin; and determining the rate of internalization of the insulin receptor in the insulin-stimulated hepatocytes wherein reduced insulin receptor internalization in the presence of the candidate compound compared to in the absence of the candidate compound indicates that the compound is a lead compound; and 20 (ii) incubating a pancreatic P-islet cell with an amount of a lipid or free fatty acid (FFA) such as palrnitic acid and/or in the presence of an amount of glucose, incubating the cell in the presence and absence of the lead compound and determining the level of glucose-stimulated insulin secretion by the cell wherein enhanced insulin secretion in the presence of the candidate compound compared to in the absence of the compound 25 indicates that the compound is an antagonist of PKCs. The present invention also provides a process for determining an antagonist of a protein kinase C epsilon (PKCs) for the treatment of abnormal glucose metabolism in a human or animal subject said process comprising: 30 (i) identifying a lead compound in a primary screen comprising incubating a hepatocyte in the presence and absence of a candidate compound, stimulating the hepatocytes at with insulin; and determining the rate of internalization of the bisulin receptor in the insulin-stimulated hepatocytes wherein reduced insulin receptor internalization in the presence of the candidate compound compared to in the absence 35 of the candidate compound indicates that the compound is a lead compound; WO 2005/025602 PCT/AU2004/001255 14 (ii) incubating a pancreatic P-islet cell with an amount of a lipid or free fatty acid (rFA) such as palmnitic acid and/or in the presence of an amount of glucose, incubating the cell in the presence and absence of the lead compound and determining the level of glucose-stimulated insulin secretion by the cell wherein enhanced insulin secretion in S the presence of the candidate compound compared to in the absence of the compound indicates that the compound is an antagonist of PKCs; and (iii) providing the antagonist compound identified at (ii) to an animal having normal PKCc expression, providing a diet high in saturated and/or unsaturated fats to the animal and determining the level of one or more indicators of glucose homeostasis for 10 the animal wherein a modified level(s) indicates that the compound is an antagonist or inhibitor of PKCE in vivo. The present invention also provides a process for determining an antagonist of a protein kinase C epsilon (PKCs) for the treatment of abnormal glucose metabolism in a human 15 or animal subject said process comprising: (i) identifying a lead compound in a primary screen comprising incubating a pancreatic P-islet cell with an amount of a lipid or free fatty acid (FFA) such as palmitie acid and/or in the presence of an amount of glucose, incubating the cell in the presence and absence of a candidate compound and determining the level of glucose 20 stimulated insulin secretion by the cell wherein enhanced insulin secretion in the presence of the candidate compound compared to in the absence of the compound indicates that the compound is a lead compound; and (ii) incubating a hepatocyte in the presence and absence of the lead compound, stimulating the hepatocytes at with insulin; and determining the rate of internalization 25 of the insulin receptor in the insulin-stimulated hepatocytes wherein reduced insulin receptor internalization in the presence of the lead compound compared to in the absence of the lead compound indicates that the compound is an antagonist of PKCs. The present invention also provides a process for determining an antagonist of a protein 30 kinase C epsilon (PKCs) for the treatment of abnormal glucose metabolism in a human or animal subject said process comprising: (i) identifying a lead compound in a primary screen comprising incubating a pancreatic n-islet cell with an amount of a lipid or free fatty acid (FFA) such as palmitic acid and/or in the presence of an amount of glucose, incubating the cel in the 35 presence and absence of a candidate compound and determining the level of glucose stimulated insulin secretion by the cell wherein enhanced insulin secretion in the WO 2005/025602 PCT/AU2004/001255 15 presence of the candidate compound compared to in the absence of the compound indicates that the compound is a lead compound; (ii) incubating a hepatocyte in the presence and absence of the lead compound, stimulating the hepatocytes at with insulin; and determining the rate of internalization 5 of the insulin receptor in the insulin-stimulated hepatocytes wherein reduced insulin receptor internalization in the presence of the lead compound compared to in the absence of the lead compound indicates that the compound is an antagonist of PKCe; and (iii) providing the antagonist compound identified at (ii) to an animal having normal 10 PKCs expression, providing a diet high in saturated and/or unsaturated fats to the animal and determining the level of one or more indicators of glucose homeostasis for the animal wherein a modified level(s) indicates that the compound is an antagonist or inhibitor of PKCs in vivo. 15 The present invention also provides a method for determining a compound that specifically antagonizes a protein kinase C epsilon (PKCs) in a hepatocyte comprising; (i) incubating a hepatocyte and an insulin-responsive cell other than a hepatocyte in the presence and absence of a candidate compound; (ii) stimulating the hepatocyte and the other insulin-responsive cell at (i) with 20 insulin; and (iii) determining the rate of internalization of the insulin receptor in the insulin stimulated hepatocytes wherein reduced insulin receptor internalization in the presence of the candidate compound compared to in the absence of the candidate compound in the hepatocyte but not in the other insulin-responsive cell indicates that the compound 25 specifically antagonizes a PKCe in a hepatocyte. Preferably, the other insulin responsive cell is a muscle cell or an adipocyte. The methods and processes described herein may further comprise testing the 30 compound for its ability to inhibit the activity of a recombinant PKCs protein or bind to a recombinant PKCs protein in a cell that has been transfected with nucleic acid encoding the PKCe protein. In performing the methods and/or processes described herein it is preferred for the 35 antagonist of PKCe to mimic a phenotype in the liver and/or pancreas of an animal WO 2005/025602 PCT/AU2004/001255 16 having reduced PKCE activity by virtue of the endogenous PKCs gene of said animal being deleted or inactivated by mutation. The present invention also provides for the use of a vector capable of expressing a 5 polypeptide antagonist or oligonucleotide antagonist of a protein kinase C epsilon (PKCe) in a format suitable for introduction into a hepatocyte or pancreatic P3-islet cell and expression therein in medicine. The present invention also provides for the use of an isolated hepatocyte or pancreatic 10 P-islet cell comprising introduced nucleic acid encoding a polypeptide antagonist or oligonucleotide antagonist of PKCs in medicine. The present invention also provides for the use of a non-human transformed animal having having reduced PKCe activity by virtue of the endogenous PKCs gene of said 15 animal being deleted or inactivated by mutation in the determination of glucose homeostasis in the animal. The present invention also provides for the use of a hepatocyte or pancreatic islet cell from a non-human transformed animal having having reduced PKCe activity by virtue 20 of the endogenous PKCa gene of said animal being deleted or inactivated by mutation for the determination of insulin receptor internalization, insulin uptake or glucose stimulated insulin secretion by the hepatocyte or pancreatic islet cell. The present invention also provides a non-human transformed animal having teduced 25 endogenous PKCE activity by virtue of the endogenous PKCs gene of said animal being deleted or inactivated by mutation and comprising an introduced PKCe gene of humans. The invention clearly extends to a progeny animal of the non-human transformed animal wherein said progeny animal comprises the introduced PKC6 gene of humans. The present invention also encompasses an isolated cell from the non 30 human transformed animal e.g., a hepatocyte or pancreatic islet cell. BRIEF DESCRIPTION OF THE DRAWINGS Figure la is a schematic representation of the murine PKCs locus in wild type mice (top line) and PKCs null mice (lower line). The position of exon 1 of the PKCs gene is 35 indicated by the arrow. In the PKCE null mouse, a targeting vector comprising a neomycin (Neo) gene operably under the control of a lacZ promoter (lacZ-Neo; light WO 2005/025602 PCT/AU2004/001255 17 shaded arrows) flanked by PKCs exon 1 sequences (black arrows) has been inserted into the exon I sequences by homologous recombination. Restriction enzyme sites for the locus in both wild type and mutant genomes are as follows: B, BamIl; E, EcoRI;'S, Sinai. 5 Figure lb is a copy of a photographic representation showing PCR amplification products of DNA derived from litterrates of a PKCe *- heterozygote intercross. M, marker DNA; +/-, PKCaS'- heterozygote; +/+, wild-type; -/-, PKCe " homozygous null. 10 Figure 2a is a graphical representation showing the effects of an unsaturated fat diet on blood glucose levels in PKCs" " mice compared to wild type animals, during an intraperitoneal glucose tolerance test. Wild type (n=17) (e) and PKCs " (n-15) (a) mice were fed an unsaturated fat diet, and in a control experiment, age-matched wild type (n=12) (+)and PKCe " (n=9) (A) mice fed a standard chow diet. ANOVA: P < 15 0.001 for diet effect in wild type mice; P < 0.001 for genotype effect in fat-fed mice. Figure 2b is a copy of a photographic representation of western immunoblots, showing the levels of the PKC isoforms PKCa, PKCS, PKCO and PKCs, in the cytosolic (C) and solubilised membrane (M) fractions of skeletal muscle from the chow-fed and 20 unsaturated fat-fed mice described in the legend to Figure 2a. Figure 2c is a graphical representation showing the quantification of PKCa in immunoblots in the cytosolic and solubilised membrane fractions of skeletal muscle from the chow-fed and unsaturated fat-fed mice described in the legend to Figure 2b. 25 Data are expressed as a percentage of the average level of PKCat in the cytosol of wild type mice receiving a chow diet. The x-axis shows the genotype of mice and the diet received (i.e., chow or fat). Open bars are cytosolic fraction. Filled bars are solubilised membrane fractions, The means from 5-6 mice per group are shown. 30 Figure 2d is a graphical representation showing the quantification of PKCS in immunoblots in the cytosolic and solubilised membrane fractions of skeletal muscle from the chow-fed and unsaturated fat-fed mice described in the legend to Figure 2b. Data are expressed as a percentage of the average level of PKC5 in the cytosol of wild type mice receiving a chow diet. The x-axis shows the genotype of mice and the diet 35 received (i.e., chow or fat). Open bars are cytosolic fraction. Filled bars are solubilised membrane fractions, The means from 5-6 mice per group are shown.

WO 2005/025602 PCT/AU2004/001255 18 Figure 2e is a graphical representation showing the quantification of PKCO in immunoblots in the cytosolic and solubilised membrane fractions of skeletal muscle from the chow-fed and unsaturated fat-fed mice described in the legend to Figure 2b, 5 Data are expressed as a percentage of the average level of PKC6 in the cytosol of wild type mice receiving a chow diet. The x-axis shows the genotype of mice and the diet received (i.e., chow or fat). Open bars are cytosolic fraction. Filled bars are solubilised membrane fractions. The means from 5-6 mice per group are shown. 10 Figure 2f is a graphical representation showing the quantification of PKCs in immunoblots in the cytosolic and solubilised membrane fractions of skeletal muscle from the chow-fed and unsaturated fat-fed mice described in the legend to Figure 2b. Data are expressed as a percentage of the average level of PKCE in the cytosol of wild type mice receiving a chow diet The x-axis shows the genotype of mice and the diet 15 received (i.e., chow or fat). Open bars are cytosolic fraction. Filled bars are solubilised membrane fractions. The means from 5-6 mice per group are shown. Figure 3a is a graphical representation showing the ratio of the membrane-associated PKCa to the cytosolic PKCa for chow-fed (open bars) and unsaturated fat-fed (filled 20 bars) mice described in the legend to Figure 2b. The x-axis shows the genotype of mice. The means from 5-6 mice per group are shown. ANOVA: * P <0.05; ** P <0.02; *** P <0.0075 for diet effect; t P <0.05 for genotype effect. Figure 3b is a graphical representation showing the ratio of the membrane-associated 25 PKCS to the cytosolic PKCS for chow-fed (open bars) and unsaturated fat-fed (filled bars) mice described in the legend to Figure 2b. The x-axis shows the genotype of mice. The means from 5-6 mice per group are shown. ANOVA: *** P <0.0075 for diet effect. 30 Figure 3c is a graphical representation showing the ratio of the membrane-associated PKCO to the cytosolic PKC6 for chow-fed (open bars) and unsaturated fat-fed (filled bars) mice described in the legend to Figure 2b, The x-axis shows the genotype of mice. The means from 5-6 mice per group are shown. ANOVA: *** P <0.0075 for diet effect 35 WO 2005/025602 PCT/AU2004/001255 19 Figure 3d is a graphical representation showing the ratio of the membrane-associated PKCc to the cytosolic PKCs for cho*-fed (open bars) and unsaturated fat-fed (filled bars) mice described in the legend to Figure 2b. The x-axis shows the genotype of mice. The means from 5-6 mice per group are shown. ANOVA: * P <0.05 for diet 5 effect, Figure 4a is a graphical representation showing the effects of a saturated fat diet on blood glucose levels in PKCes' mice compared to wild type animals, during an intraperitoneal glucose tolerance test. Wild type (n=9) (*) and PKCe "" (n=8) (m) mice 10 were fed a saturated fat diet, and in a control experiment, age-matched wild type (n=10) (.)and PKCsd (n=5) (A) mice fed a standard chow diet. ANOVA: P < 0.001 for diet effect in wild type mice; P < 0.001 for genotype effect in fat-fed mice. Figure 4b is a copy of a photographic representation of western immunoblots, showing 15 the levels of the PKC isoformns PKCa, PKC6, PKCO and PKCs, in the cytosolic (C) and solubilised membrane (Mv) fractions of skeletal muscle from the chow-fed and unsaturated fat-fed mice described in the legend to Figure 4a. Figure 4c is a graphical representation showing the quantification of PKCa in 20 immunoblots in the cytosolic and solubilised membrane fractions of skeletal muscle from tmhe chow-fed and saturated fat-fed mice described in the legend to Figure 4b. Data are expressed as a percentage of the average level of PKCct in the cytosol of wild type mice receiving a chow diet. The x-axis shows the genotype of mice and the diet received (i.e., chow or fat). Open bars are cytosolic fraction. Filled bars are solubilised 25 membrane fractions. The means from 5-6 mice per group are shown. Figure 4d is a graphical representation showing the quantification of PKC8 in immunoblots in the cytosolic and solubilised membrane fractions of skeletal muscle from the chow-fed and saturated fat-fed mice described in the legend to Figure 4b. 30 Data are expressed as a percentage of the average level of PKC8 in the cytosol of wild type mice receiving a chow diet. The x-axis shows the genotype of mice and the diet received (i.e., chow or fat). Open bars are cytosolic fraction. Filled bars are solubilised membrane fractions. The means from 5-6 mice per group are shown. 35 Figure 4e is a graphical representation showing the quantification of PKCO in immunoblots in the cytosolic and solubilised membrane fractions of skeletal muscle WO 2005/025602 PCT/AU2004/001255 20 from the chow-fed and saturated fat-fed mice described in the legend to Figure 4b. Data are expressed as a percentage of the average level of PKC6 in the cytosol of wild type mice receiving a chow diet. The x-axis shows the genotype of mice and the diet received (i.e., chow or fat). Open bars are cytosolic fraction. Filled bars are solubilised 5 membrane fractions. The means from 5-6 mice per group are shown. Figure 4f is a graphical representation showing the quantification of PKCe in immunoblots in the cytosolic and solubilised membrane fractions of skeletal muscle from the chow-fed and saturated fat-fed mice described in the legend to Figure 4b, 10 Data are expressed as a percentage of the average level of PKCs in the cytosol of wild type mice receiving a chow diet, The x-axis shows the genotype of mice and the diet received (i.e., chow or fat). Open bars are cytosolic fraction. Filled bars are solubilised membrane fractions. The means from 5-6 mice per group are shown. 16 Figure 5a is a graphical representation showing the ratio of the membrane-associated PKCa to the cytosolic PKCa for chow-fed (open bars) and saturated fat-fed (filled bars) mice described in the legend to Figure 4b. The x-axis shows the genotype of mice. The means from 5-6 mice per group are shown. 20 Figure 5b is a graphical representation showing the ratio of the membrane-associated PKCS to the cytosolic PKC8 for chow-fed (open bars) and saturated fat-fed (filled bars) mice described in the legend to Figure 4b. The x-axis shows the genotype of mice. The means from 5-6 mice per group are shown. ANOVA: ** P <0.02 for diet effect; P <0.05 for genotype effect. 25 Figure 5c is a graphical representation showing the ratio of the membrance-assooiated PKCO to the eytosolic PKCO for chow-fed (open bars) and saturated fat-fed (filled bars) mice described in the legend to Figure 4b. The x-axis shows the genotype of mice. The means from 5-6 mice per group are shown. 30 Figure 5d is a graphical representation showing the ratio of the membrane-associated PKCs to the cytosolic PKCe for chow-fed (open bars) and saturated fat-fed (filled bars) mice described in the legend to Figure 4b, The x-axis shows the genotype of mice. The means from 5-6 mice per group are shown. ANOVA; * P <0.05 for diet effect. 35 WO 2005/025602 PCT/AU2004/001255 21 Figure 6a is a graphical representation showing the effect of PKC6 deletion on serum insulin levels in wild type (*) and PKCe

"

'

" (w) mice fed an unsaturated fat diet, and age matched wild type (*)and PKCs " (A) mice fed a standard chow diet, during the glucose tolerance test as described in the legend to Figure 2. ANOVA: P < 0.001 for 5 genotype effect; P < 0.01 for combined genotype and diet effect. Results shown are the means+ SEM for 4-12 mice per group. Figure 6b is a graphical representation showing the effect of PKCs deletion on serum C-peptide levels in wild type (*) and PKCs " " (m) mice fed an unsaturated fat diet, and 10 age-matched wild type (*)and PKCs' (A) mice fed a standard chow diet, during the glucose tolerance test as described in the legend to Figure 2. ANOVA: P < 0.005 for genotype effect on fat-fed mice. Results shown are the means ± SEM for 4-12 mice per group. 15 Figure 6c is a graphical representation showing the effect of PKCs deletion on serum insulin levels in wild type (*) and PKCs

"

-' (n) nice fed a saturated fat diet, and age matched wild type (+)and PKCs " 4 " (A) mice fed a standard chow diet, during the glucose tolerance test as described in the legend to Figure 4. ANOVA: P < 0.001 for diet effect; P < 0.002 for genotype effect. Results shown are the means ± SEM for 4-12 20 mice per group. Figure 6d is a graphical representation showing the effect of PKCs deletion on senrum C-peptide levels in wild type (*) and PKCs- (in) mice fed a saturated fat diet, and age matched wild type (*)and PKCs " (A) mice fed a standard chow diet, during the 25 glucose tolerance test as described in the legend to Figure 4. ANOVA: P < 0.001 for genotype effect. Results shown are the means ± SEM for 4-12 mice per group. Figure 6e is a graphical representation showing a comparison of islet area as a percentage of total pancreas from wild type and PKC' / mice fed either a chow diet ( 30 open bars) or a saturated fat diet (filled bars) t-test "* P < 0,01, fat-fed wild type mice versus chow-fed wild type mice. Figure 7a is a graphical representation showing blood glucose levels during an intraperitoneal insulin tolerance test of wild type and PKCs " " mice fed a saturated fat 35 diet, and age-matched wild type mice fed a standard chow diet (n=8-10 per group). 4, wild-type mice on chow diet; *, wild-type mice on saturated fat diet; n, PKCe/" mice WO 2005/025602 PCT/AU2004/001255 22 on saturated fat diet. ANOVA: P < 0.001 for diet effect on wild type mice; P < 0.02 for genotype effect on fat-fed mice. Figure 7b is a graphical representation showing basal and sub-maximal (300tU/ml) 5 insulin-stimulated 2-deoxyglucose uptake by isolated soleus muscle from wild-type and PKCe - / " mice fed a high-saturated fat, compared to wild-type mice fed a chow diet (n=8-10). Open bars represent basal uptake. Filled bars represent insulin-stimulated uptake. ANOVA: P < 0.005 for diet effect. 10 Figure 7c is a graphical representation showing [ 1 4 C]2-deoxyglucose clearance into skeletal muscle during an intravenous insulin tolerance test of wild type (n=17) and

PKC?

" " (n=10) mice fed an unsaturated fat diet (filled bars), and age-matched wild type (n=9) and PKC/" (n=8) mice fed a standard chow diet (open bars). 15 Figure 7d is a graphical representation showing [3-H]2-deoxyglucose clearance during an intraperitoneal glucose tolerance test by skeletal muscle from wild type and PKCs* mice fed a high-unsaturated fat diet (filled bars), and age-matched wild type and PKC - mice fed a standard chow diet (open bars) (n=6 per group). ANOVA: P < 0.0075 for diet effect; P < 0.015 for genotype effect. 20 Figure 7e is a graphical representation showing [14C]glucese clearance into glycogen by skeletal muscle from mice treated as described in the legend to Figure 7d. -ANOVA: P < 0.02 for diet effect; P < 0.002 for genotype effect, Open bars represent mice fed on a chow diet. Filled bars represent mice fed on a high-unsaturated fat diet. 25 Figure 8a is a graphical representation showing [3-H]2-deoxyglucose clearance during an intraperitoneal glucose tolerance test by white adipose tissue from wild type and PKCe

"

t' " mice fed a high-unsaturated fat diet (filled bars), and age-matched wild type and PKC&s

"

' mice fed a standard chow diet (open bars). Results shown are means + 30 SEM from 6-12 mice per group. Figure 8b is a graphical representation showing [14C)glucose clearance into lipid by white adipose tissue from mice treated as described in the legend to Figure Sa. Filled bars represent mice fed the high-unsaturated fat diet. Open bars represent mice fed the 35 chow diet. Results shown are means E SEM from 6-12 mice per group. ANOVA: P < 0.002 for diet effect; P <0,03 for genotype effect.

WO 2005/025602 PCT/AU2004/001255 23 Figure 8c is a graphical representation showing [14C]glucose clearance into lipid by liver from mice treated as described in the legend to Figure 8a. Filled bars represent mice fed the high-unsaturated fat diet. Open bars represent mice fed the chow diet. 5 Results shown are means - SEM from 6-12 mice per group. ANOVA: P < 0.002 for diet effect; P <0.03 for genotype effect. Figure 8d is a graphical representation showing [14C]glucose clearance into glycogen by liver, from mice treated as described in the legend to Figure Sa. Filled bars 10 represent mice fed the high-unsaturated fat diet. Open bars represent mice fed the chow diet. Results shown are means I SEM from 6-12 mice per group. ANOVA: P < 0.03 for genotype effect. Results shown are means I SEM from 6-12 mice per group. Figure 9 is a graphical representation showing [1 25 I]insulin uptake by isolated primary 15 hepatocytes from wild type (*) and PKCs 4 (a) mice (n=8). ANOVA: P < 0.001 for effect of genotype. Insulin uptake is measured as a percentage of total cell associated insulin (i.e., membrane-bound and internalized). The rate of insulin uptake into primary haepatocytes was shown to be lower (about 0.4x-0.6x) for PKCs null mutant mice than for wild-type mice expressing a functional PKCe allele, confirming the 20 reduced insulin clearance when PKCs is inactivated or reduced. Insulin uptake into primary hepatocytes under these conditions was approximately linear for at least about 5 rins. Figure 10a is a copy), of a photographic representation of an immunoblot showing 25 expression of the insulin receptor (IR) in liver extracts from chow-fed and unsaturated diet-fed mice maintained as described in the legend to Figure 2a (first 4 columns), and in the lysates of isolated primary (1") hepatocytes from chow-fed mice. Data show no significant differences in IR levels. 30 Figure I 0b is a copy of a photographic representation of immunoblots showing similar downstream signalling from the insulin receptor (IR) in primary hepatocytes from wild type and PKCs " " mice, as determined by measuring the level of (i) tyrosine phosphorylation of the insulin receptor (P-Y1162/3 IR), (ii) serine phosphorylation of protein kinase B (P-S473-PKB) phosphorylation, and (iii) phosphorylation of a MAP 35 kinase (P=T202/Y204-ERK), in the absence of insulin (0), or following incubation in the presence of 3.2 nM insulin or 10 nM insulin. Data show phosphorylation of the IR WO 2005/025602 PCT/AU2004/001255 24 after 2 min, phosphorylation of PKB and ERK after 10 mins in both wild type and PKCe-" / mice. Figure 1 la is a graphical representation showing quantification of data on insulin 5 receptor (IR) levels in liver and hepatocytes from Figure 10a. The irnununoblot shown in Figure 10a was subjected to densitometry, and data corrected for total protein loading. Data show no significant differences in IR levels between wild-type (WT) and PKCe /" (KO) rice receiving a chow diet (open bars) or a diet high in unsaturated fats (filled bars), or between primary hepatocytes of PKCr- mice fed and wild-type mice 10 fed a chow diet. Figure 1 lb is a graphical representation showing quantification of tyrosine phosphorylation of the insulin receptor (P-Y1 162/3 IR) in primary hepatocytes from Figure 10b following insulin stimulation. The immunoblot shown in row 1 of Figure 15 10Ob was subjected to densitometry, and data corrected for total protein loading. Data show no inability of the insulin receptor from PKCs " / mice (KO) to be phosphorylated in response to insulin compared to wild-type (WT) mice. ANOVA: P < 0.001 for effect of insulin. 20 Figure 110 is a graphical representation showing quantification of serine phosphorylation of protein kinase B (P-S473-PKB) in primary hepatocytes from Figure 10b following insulin stimulation. The immunoblot shown in row 2 of Figure 10b was subjected to densitometry, and data corrected for total protein loading. Data show no differences in phosphorylated PKB between PKCs' mice (KO) and wild-type (WT) 25 mice under each condition. ANOVA: P < 0.015 for effect of insulin. Figure Id is a graphical representation showing quantification of threonine/tyrosine phosphorylatiort of the MAP kinase ERK (P-T202/Y204-ERK) in primary hepatocytes from Figure 10b following insulin stimulation, The immunoblot shown in row 3 of 30 Figure 10b was subjected to densitometry, and data corrected for total levels of signalling proteins. Data show no differences in phosphorylated ERK between PKCK' mice (KO) and wild-type (WT) mice under each condition. ANOVA: P < 0.0075 for effect of insulin. 35 Figure 12 is a graphical representation showing glucose-stimulated insulin secretion by pancreatic islets pretreated in the absence (Con) or presence (Palm) of palmitate (n=3 WO 2005/025602 PCT/AU2004/001255 25 per group). Open bars represent islets, incubated in 2.8 mM glucose. Filled bars represent islets incubated in the presence of 16.7 mM glucose. t-test, * P < 0.05, ** P <0.01, for 16.7 mM glucose versus 2.8 mM glucose. Data indicate that, in the presence of palmitate at 16.7 mM glucose, an inhibitor of PKCs is detectable by virtue of 5 reproducing the effect seen in PKCe"& mice, whereas a compound that does not inhibit PKCs under those conditions has a reduced level of insulin secretion comparable to that seen in wild-type islets. Figure 13 is a graphical representation showing the potentiation of glucose-stimulated 10 insulin secretion from pancreatic islets by the cholinergic muscarinic receptor agonist carbamylcholine,. Insulin secretion by islets isolated from wild type (PKCC't and PKCs null mutant (PKC

"

') mice was measured in the absence of glucose (open bars), or in the presence of 20 mM glucose (diagonally hatched bars), 0.1 mM carbamylcholine (horizontally hatched bars), or in the presence of both 20 rrM glucose 15 and 0.1 mM carbamyleholine (filled bars). Enhanced insulin secretion from PKCe islets compared to wild type islets indicates that inhibitors of PKCs can be assayed by measuring glucose-stimulated insulin secretion from islet cells incubated in the presence of a muscarinic acid receptor agonist such as, for example, carbamylcholine. PKCc inhibitors identified in such a screen would improve glucose tolerance by 20 augmenting the cephalic phase of insulin secretion mediated by the release of acetylcholine from vagal efferent neurons on pancreatic 3-islet cells. DETAILED DESCRIPTION OF THE INVENTION AMethods for identfiing antagonists of PKCe 25 1. hepatocyte-based assays The present invention provides a method of determining an antagonist of a protein kinase C epsilon (PKCs) for the treatment of abnormal glucose metabolism in a hunan or animal subject said method comprising (i) incubating a hepatocyte in the presence and absence of a candidate compound; 30 (ii) stimulating the hepatocytes at (J) with insulin or analogue thereof; and (iii) determining the rate of internalization of the insulin receptor in the insulin stimulated hepatocytes wherein reduced insulin receptor internalization in the presence of the candidate compound compared to in the absence of the candidate compound indicates that the compound is an antagonist of PKCe. 35 WO 2005/025602 PCT/AU2004/001255 26 For the present purpose, any hepatocyte that expresses a functional PKCs enzyme can be used. This can be a naturally-occuring hepatocyte such as, for example, from a wild-type mouse or diabetic or obese mouse (see Example 2), or one produced by transfection of nucleic acid encoding the enzyme. Such trandfected hepatocytes are 5 preferably derived from PKCe " " or PKCs+- animals with an introduced PKCs gene, especially the human gene. Preferably, the hepatocyte is a human hepatoma cell line such as, for example, HepG2 (ATCC Accession No. HB-8065), Huh7, or a primary hepatocyte such as, for example, 10 a primary urine, rat or human hepatocyte. Immortalized hepatocytes from wild-type mice or PKCs "" mice or from PKCS -mice having an introduced human PKCs gene, are particularly preferred because they are subject to less variation between cells than primary hepatocytes. To produce 15 immortalized cells, primary hepatocytes are obtained from the livers of neonates, and immortalized by transfection with a retroviral vector expressing human telomerase reverse transcriptase (hTERT) essentially as described by Waug and Harris (WO 02/48319 published 20 June 2002). Alternatively, hepatocytes are obtained by transfection with ras-transformed simian virus 40 (SV40) or culturing in the presence of 20 SV40 large T-antigen and selecting for clones that grow in culture. Insulin receptor internalization can be measured, for example, by determining the uptake of labeled insulin (e.g. fluorescently labelled insulin, biotinylated insulin, or radiolabelled insulin such as lasI-Insulin or 3 I-insulin) or analogue thereof into cells, 25 preferably as a percentage of total cell-associated insulin or analogue. Alternatively, internalization is assayed by expressing the insulin receptor in cells as a dual-tagged protein such that a first tag, e.g., FLAG epitope or yellow fluorescent protein (YFP) or green fluorescent protein (GFP) or red fluorescent protein(RFP), is 30 positioned at or near the C-terminal portion of the protein that ultimately resides in the cytoso] and a second pH-sensitive tag (e.g., pHluorin) is positioned at or near the N terminal portion of the protein that ultimately resides in the extracellular space, and determining receptor internalization by measuring the change in signal produced by the second pH sensitive tag relative to the first tag by virtue of the change in pH on 35 internalization. A suitable pH sensitive tag for this purpose is pHluorin, which is WO 2005/025602 PCT/AU2004/001255 27 known in the art as a pH-sensitive mutant of green fluorescent protein (Miesenbock et al., Nature 394, 192-195, 1998, incorporated herein in its entirety). More particularly, an insulin receptor double fusion protein is expressed ectopically in 5 liver cells (eg HepG2, HuH7, primary hepatocytes), by transfecting the cells with nucleic acid encoding the insulin receptor fusion protein using hepadnavirus-mediated or adenovirus-mediated transfection. Those skilled in the art are aware that the insulin receptor (IR) (Ullrich et al., 1985, Nature 313:756-61) is the prototype for a family of receptor protein tyrosine kinases (RPTKs) that are structurally defined as a 10 heterotetrameric species of two alpha and two beta subunits wherein the alpha and beta subunits are produced by processing of a single precursor polypeptide and wherein the beta subunit comprises the transmembrane and intracellular domain(s) and the alpha subunit comprises the extracellular domain. Accordingly, a protein-encoding region of a YFP gene (NCBI Accession No. AY613998) or GFP gene (NCBI Accession No, 15 AY613996) or RFP gene (NCBI Accession No. AY613997) is cloned in-framc into an intracellular domain-encoding portion, e.g., downstream or within to the C-terminal encoding portion, of nucleic acid encoding the insulin receptor precursor polypeptide (NCBI Accession No, X02160) using standard techniques ini the art. Similarly, a protein-encoding region of a pHluorin gene (NCBI Accesson No. AY533296 or 20 AF058695 or AF058694) is cloned in-frame into an extracellular domain-encoding portion, e.g., upstream or within the N-terminal-encoding portion, of nucleic acid encoding the insulin receptor precursor polypeptide. The eDNA for this construct is in the form of one gene, which yields both subunits upon post-transcriptional processing. The recombinant nucleic acid construct is introduced to a suitable expression vector 25 and transfected into hepatocytes such that the insulin receptor fusion polypeptide is processed into labelled alpha and labelled beta subunits, wherein the label on the extracellular alpha subunit e.g., at the alpha subunit N-terminus, is the pH-sensitive pHluorin peptide and the label on the intracellular beta subunit is another fluorescent tag such as YFP or RFP or GFP, e.g., at the beta subunit C-terminus. In unstimulated 30 cells, the pHluorin is exposed to the extracellular medium (pH 7.4). Upon insulin binding, the receptor is internalised, and the pHluorin becomes situated in the lumen of an endocytotic vesicle, which then becomes an endosome. Upon acidification (to 5 pH 6) of the endosomrne (the normal process driven by an H*/ATPase, which promotes insulin dissociation from the receptor and subsequent insulin degradation), the 35 fluorescent signal from the pHIuorin is modified, whereas the signal from the YFP or GFP or RFP, which remains exposed to the cytosol, is constant. Thlius, the level of WO 2005/025602 PCT/AU2004/001255 28 fluorescence from the beta subunit C terminal tag provides a measure of total insulin receptor, whereas the level of fluorescence from the alpha subunit N-terminal tag provides a measure of the amount of receptor that is internal. Accordingly, internalization of the receptor is measured in the transfected cells as a change in ratio of 5 the two signals, determined by fluorescence confocal microscopy. To enhance or increase a modified ratio in the signals between samples, insulin efflux is reduced or inhibited by incubating the cells in an amount of chloroquine or bafilomycin sufficient to reduce or inhibit receptor recycling (e.g., Balbis et atl., J. Biol. Chem. 279, 12777 12785, 2004 which is incorporated herein by reference), 10 Alternatively, internalization of the insulin receptor is determined by immunoassay and/or labelling the receptor with biotin (e.g., Balbis at al., J. Biol. Chem. 279, 12777 12785, 2004 which is incorporated herein by reference). For example, hepatocytes are incubated in the presence or absence of insulin for different times e.g., time zero and at 15 times up to about 15 min. Thereafter, hepatocytes are washed, and cell surface proteins are biotinylated by incubation with a cross-linking reagent such as Sulfo-NHS-LC Biotin. Biotinylated and non-biotinylated insulin receptor are immunoprecipitated from total cell lysates and detected in an immunoassay e.g., western blot or ELISA or radioimmunoassay using anti-insulin receptor antibody, to provide a measure of total 20 insulin receptor. A streptavidin-conjugated horseradish peroxidase is also used to detect biotinylated insuylin receptor associated with the plasma membrane at erach time point. The ratio of biotinylated insulin receptor to the total amount of receptor is determined, as an indication of internalization. To enhance or increase the change in this ratio, insulin efflux is reduced or inhibited by incubating the cells in an amount of 25 chloroquine or bafilomycin sufficient to reduce or inhibit receptor recycling Such measurements provide a good approximation of insulin receptor internalization, because the receptor internalizes when associated with insulin or an analogue thereof and because free insulin is not taken into the cells. 30 In performing this assay platform, the rate of insulin or insulin analogue uptake is preferably determined over a period of time for which uptake in the cell is shown to be linear, and then compared in the presence and absence of the candidate compound, wherein a modified rate of uptake by the cells indicates that the compound has 35 modulatory activity with respect to internalization. It will be apparent that this embodiment applies mutatis mutandis to a method a method of determining an WO 2005/025602 PCT/AU2004/001255 29 antagonist of a protein kinase C epsilon (PKCe) for the treatment of abnormal glucose metabolism in a human or animal subject said method comprising: (i) incubating a hepatocyte in the presence and absence of a candidate compound; (ii) stimulating the hepatocytes at (i) with insulin or analogue thereof; and 5 (iii) detennining the rate of insulin uptake in the insulin-stimulated hepatocytes wherein reduced insulin uptake in the presence of the candidate compound compared to in the absence of the candidate compound indicates that the compound is an antagonist of PKC. 10 Insulin receptor internalization can also be measured by labelling the receptor with a fluorescent tag essentially as described by Carpentier et aL Journal of Cell Biology, 122, 1243-1252, 1993, or Hsu et al, Endocrinology, 134, 744-750, 1994. By "insulin analogue" is meant a variant of insulin or other compound having the 15 receptor activating function of insulin ie., it can bind to the insulin receptor and result in internalization of the insulin receptor. A preferred insulin analogue is Insulin lispro (Humalog), which is a polypeptide comprising the amino acid sequence of native insulin wherein the amino acids at positions 28 and 29 on the insulin B-chain are reversed (i.e., Lys(B28), Pro(B29) human insulin analog). 20 In performing the various embodiments of the invention, the signal: noise ratio of the assay is enhanced, such as, for example, by incubating the hepatocyte in the presence of a compound that reduces potentiates insulin uptake e.g., in wild-type cells. By reducing background the ability to detect enhanced insulin uptake into hepatocytes in 25 the presence of an antagonist of PKCe activity is improved. It is also within the scope of the present invention to further enhance the total level of insulin or insulin analogue in hepatocytes by inhibiting or reducing efflux of insulin or analogue thereof during the assay. Because the level of uptake in the assay is 30 expressed as a proportion of total insulin or analogue in the cells, including media, insulin efflux may reduce the signal:noise ratio, by virtue of their being more label outside the cells than would be the case if efflux was inhibited. Accordingly, the present invention clearly encompasses further incubating the hepatocytes in the presence of an inhibitor of insulin efflux such as, ifor example, chloroquinone or 35 bafilomycin.

WO 2005/025602 PCT/AU2004/001255 30 The present invention clearly encompasses the use of any in silico analytical method and/or industrial process for carrying the hepatocyte-based screening method described herein into a pilot scale production or industrial scale production of an inhibitory compound identified in such screens. This invention also provides for the provision of 5 information for any such production. Accordingly, the screening assays are further modified by: (i) optionally, determining the structure of the compound; and (ii) providing the compound or the name or structure of the compound such as, for example, in a paper form, machine-readable form, or computer-readable form. 10, Naturally, for compounds that are known albeit inot previously tested for their function using a screen provided by the present invention, determination of the structure of the compound is implicit This, is because the skilled artisan will be aware of the name and/or structure of the compound at the time of performing the screen. 15 As used herein, the term "providing the compound" shall be taken to include any chemical or recombinant synthetic means for producing said compound or alternatively, the provision of a compound that has been previously synthesized by any person or means. This clearly includes isolating the compound. 20 In a preferred embodiment, the compound or the name or structure of the compound is provided with an indication as to its use e.g., as determined by a screen described herein. 25 The diagnostic assays can be further modified by: (i) optionally, determining the structure of the compound; (ii) optionally, providing the name or structure of the compound such as, for example, in a paper form, machine-readable form, or computer-readable form; and (iii) . providing the compound. 30 In a preferred embodiment, the synthesized compound or the name or structure of the compound is provided with an indication as to its use e.g., as determined by a screen described herein. 35 2. Islet cell-based assays WO 2005/025602 PCT/AU2004/001255 31 The present invention also provides a method of determining an antagonist of a protein kinase C epsilon (PKCs) for the treatment of abnormal glucose metabolism in a human or animal subject said method comprising: (i) incubating a pancreatic 3-islet cell with an amount of a lipid or free fatty acid 5 (FFA) and/or glucose; (ii) incubating the cell at (i) in the presence and absence of a candidate compound; and (iii) determining the level of insulin secretion by the cell wherein enhanced insulin secretion in the presence of the candidate compound compared to in the absence of the 10 compound indicates that the compound is an antagonist of PKCe. For the present purpose, any islet cell that expresses a functional PKCe enzyme can be used. This can be a naturally-occurring islet cell such as, for example, from a wild-type mouse or diabetic or obese mouse (see Example 3), or one produced by transfection of Is nucleic acid encoding the enzyme. Such txansfected islets are preferably derived from PKCe / or PKCs' / animals having an introduced PKCs gene, especially the human gene. Pre-treatment of islet cells (e.g., for about 48 hours in the case of MIvN6 cells) in lipid 20 or FFA leads to an increase in basal insulin secretion and an inhibition of glucose stimulated insulin secretion. Preferably, the amount of FFA and/or glucose is sufficient to reduce or ablate glucose-stimulated insulin secretion by the cell in the absence of the compound being tested. 25 Preferably the lipid or FFA is selected from the group consisting of palmitic acid, oleic acid, linoleic acid, myristic acid, lauric acid, pentadecanoic acid, stearic acid, and linolenic acid. Preferably, the islet cell is a cultured murine MIN6 cell or an isolated human, rat or 30 urine pancreatic islet cell or an immortalized pancreatic cell line. Immortalized islet cells from wild-type mice or PKCC" mice are particularly preferred because they are subject to less variation between cells than primary islets. To produce immortalized cells, primary islets are obtained from the panoreata of neonates, and 35 immortalized by transfection with a retroviral vector expressing human telomerase reverse transcriptase (hTERT) essentially as described by Wang and Harris (WO WO 2005/025602 PCT/AU2004/001255 32 02/48319 published 20 June 2002). Alternatively, islets are obtained by transfection with ras-transformed simian virus 40 (SV40) or culturing in the presence of SV40 large T-antigen and selecting for clones that grow in culture. 5 Preferably, the insulin secretion is glucose-stimulated insulin secretion. However, the present invention clearly encompasses the use of other means to stimulate insulin secretion in the context of assaying for inhibitors of insulin secretion in islet cells. For example, wild-type islets are also known to be stimulated by KCI in the presence or absence of diazoxide. Diazoxide is a selective inhibitor of the Ca- arm of glucose 10 stimulated insulin secretion, KCI can substitute for this armnn (in a manner not inhibited by diazoxide). Thus, the combination of glucose plus KC1 plus diazoxidc unmasks the KSATP-channel independent pathway of glucose-stimulated insulin secretion. Insulin secretion by individual beta cells isolated from mice or from normal rats is also is capable of being assayed using, for example, a reverse hemolytic plaque assay. Pancreata are harvested from female Wistar-Furth rats, the pancreatic islets isolated, and dispersed into single cells which are mixed with protein A-coated ox erythrocytes, placed in a Cunningham chamber in the presence of insulin antiserum, and exposed to candidate inhibitors. Hemolytic plaques develop around the insulin-secreting cells in 20 the presence of complement, and the percentage of plaque-fonnring cells is determined and the plaque areas (reflecting the amount of insulin secreted) are quantitated. Plaque forming (but not nonplaque-forming) cells are also identified as insulin secreting by an independent immunofluorescent technique. Negative control reactions for which no plaques form in the absence of inhibitor compound can also be established such as, for 25 example, (i) deletion of insulin antiserum from the preparation; (ii) preabsorption of insulin antiserum with insulin; (iii) incubation with non-protein A-coated red blood cells (RBC); and (iv) omission of complement In performing this assay, the percentage of plaque-forming cells and the mean plaque are increased by exposure to glucose (0.75-20 mrM) in a concentration-dependent manner over at least about 60 min 30 incubation time. Secretion can also be measured indirectly as an increase in the islet surface area, due to fusion of granule membrane with the plasma membrane. For example, changes in capacitance as determined by patch clamping methods can be used to determine 35 changes in islet surface area.

WO 2005/025602 PCT/AU2004/001255 33 The present invention clearly encompasses high throughput assays. For example, reporter assays for measuring secretion that are amenable to high-throughput screening include transfection of islet cells with growth hormone (GH) and monitoring GH release as a surrogate for insulin, by radioimmunoassay (RIA) or ELISA. Alternatively, 5 cells are transfected with flourescently-tagged protein, such as a transmembrane protein e.g., phogrin, that is targetted to a secretory granule and co-released with insulin, or fused to the plasma membrane during exocytosis. Enhanced fluorescence in medium (or on the plasma membrane) is proportional to secretion. Such assays are modified by using a pH-sensitive flourescent tag e.g., pHluorin, as described herein above, such that 10 a change in flourescence occurs when the intragranular space (low pH) comes into contact with the extracellular space (neutral pH) during fusion of granules with the plasma membrane during exocytosis. Preferably, the islet cell is also incubated in the presence of a compound that 15 potentiates glucose-stimulated insulin secretion, especially in cells having low or reduced PKCs expression, e.g., a muscarinic acid receptor agonist such as, for example, acetylcholine, a non-hydrolyzable analog of acetylcholine e.g., carbamylcholine, arecoline, oxotremorine and pilocarpine. Carbamylcholine and other analogues of acetylcholine are particularly useful. Compounds that inhibit PI 3-kinase activity are 20 also useful for potentiating glucose-stimulated insulin secretion by islet cells, such as for example wortmannin, rosiglitazone or LY294002. Glyburide is also capable of being employed for this purpose. Exposure of islet cells to 100 nMV glyburide in the presence of 20 mM glucose enhances insulin secretion by an effect directly on pancreatic beta cells. 25 Glucose-independent insulin secretion is potentiated using IBMX and/or forskolin. The present invention clearly encompasses the use of any in s1lico analytical method and/or industrial process for carrying the islet cell-based screening method described 30 herein into a pilot scale production or industrial scale production of an inhibitory compound identified in such screens. This invention also provides for the provision of information for any such production. Accordingly, the screening assays are further modified by: (i) optionally, determining the structure of the compound; and 35 (ii) providing the compound or the name of structure of the compound such as, for example, in a paper form, mrachine-readable form, or computer-readable form.

WO 2005/025602 PCT/AU2004/001255 34 Naturally, for compounds that are known albeit not previously tested for their function using a screen provided by the present invention, determination of the structure of the compound is implicit This is because the skilled- artisan will be aware of the name 5 and/or structure of the compound at the time ofperforming the screen. As used herein, the term "providing the compound" shall be taken to include any chemical or recombinant synthetic means for producing said compound or alternatively, the provision of a compound that has been previously synthesized by any 10 person or means. This clearly includes isolating the compound. In a preferred embodiment, the compound or the name or structure of the compound is provided with an indication as to its use e.g., as determined by a screen described herein, 15 The diagnostic assays can be further modified by: (i) optionally, determining the structure of the compound; (ii) optionally, providing the name or structure of the compound such as, for example, in a paper form, machine-readable form, or computer-readable form; and 20 (iii) providing the compound. In a preferred embodiment, the synthesized compound or the name or structure of the compound is provided with an indication as to its use eg., as determined by a screen described herein. 25 3. Animal-based assays The present invention also provides a method of determining an antagonist of a protein kiinase C epsilon (PKCs) for the treatment of abnormal glucose metabolism in a human or animal subject said method comprising providing a candidate compound to an 30 animal having normal PKCs expression, providing a diet high in saturated and/or unsaturated fats to the animal and determining the level of one or more indicators of glucose homeostasis for the animal wherein a modified level(s) indicates that the compound is an antagonist or inhibitor of PKCs. 35 The animal having normal PKCs expression can be any wild type animal with respect to PKCs activity, Alternatively, the animal is a PKC& animal having an introduced WO 2005/025602 PCT/AU2004/001255 35 PKCs gene, especially the human gene. It will be apparent to the skilled artisan from the disclosure herein that such "humanised" animals provide a means of validating an antagonist identified in the screens of the present invention for its ability to antagonize the activity of the human PKCe enzyme. Such animals also provide a source of 5 "humanized" hepatocytes and islet cells. A modified level of one or more indicators of glucose homeostatis may be determined, for example, by comparing the level of one or more indicators of glucose homeostasis in a wild qype animal to the level of the indicator(s) in PKCs " / or PKCs+ " control 10 animal maintained on a chow diet or other diet low in fat, wherein a trend toward the level observed for the control animal indicates modified glucose homnostasis. It is to be understood that the level of the indicator(s) for the control animal may also be intermediate between the level determined for the wild type animal receiving the compound and a wild type animal not receiving the compound and yet be considered to 15 exhibit "a trend toward the level observed for the control animal". Preferred indicators of glucose homeostasis are selected from the group consisting of blood glucose, serum insulin, serum C peptide, decrease fasting insulin and glucose levels, glucose excursions following a glucose tolerance test, and increased insulin and/or c-peptide levels during the glucose tolerance test, Preferably, the compound will enhance or 20 increase serum glucose and/or serum insulin and/or serum C-peptide levels. In performing this embodiment of the invention, it is preferred to provide an amount of the compound to the animal for a time and under conditions sufficient to protect against the effects of the high fat diet, such as, for example, by commencing the administration 25 of compound before placing the animal on a high fat diet. To assay for the ability of the compound to reduce insulin clearance by the liver, it is preferred to administer the compound at the same time as placing the animal on a high fat diet, or more preferably, after placing the animal on a high fat diet. 30 Preferably, the effect of the -compound on the animal is determined by virtue of its ability to mimic a phenotype of the PKCst or PKCe" " mouse. For example, PKCs activity or sub-cellular localization of PKCs in the liver and/or pancreas of the animal may be determined. Hepatocytes and/or islet cells may also be obtained from the animal following administration of the compound and assayed in the cell-based assays 35 described herein to determine long term effects of the compound on cellular function.

WO 2005/025602 PCT/AU2004/001255 36 Based on the data provided herein for the PKCC-' mouse, the skilled artisan is readily able to conduct such experimentation without the exercise of inventive effort, It is also within the scope of the present invention to further test for adverse effects of a 5 compound on the test animals. The present invention clearly encompasses the use of any in silico analytical method and/or industrial process for carrying the animal-based screening method described herein into a pilot scale production or industrial scale production of an inhibitory 10 compound identified in such screens. This invention also provides for the provision of information for any such production. Accordingly, the screening assays are further modified by: (i) optionally, determining the structure of the compound; and (ii) providing the compound or the name or structure of the compound such as, for 15 example, in a paper form, machine-readable form, or computer-readable form. Naturally, for compounds that are known albeit not previously tested for their function using a screen provided by the present invention, determination of the structure of the compound is implicit. This is because the skilled artisan will be aware of the name 20 and/or structure of the corupounid at the time of performing the screen. As used herein, the term "providing the compound" shall be taken to include any chemical or recombinant synthetic means for producing said compound or alternatively, the provision of a compound that has been previously synthesized by any 25 person or means. This clearly includes isolating the compound. In a preferred embodiment, the compound or the name or structure of the compound is provided with an indication as to its use e.g., as determined by a screen described herein. 30 The diagnostic assays can be further modified by: (i) optionally, determining the structure of the compound; (ii) optionally, providing the name or structure of the compound such as, for example, in a paper form, machine-readable form, or computer-readable formn; and 35 (iii) providing the compound.

WO 2005/025602 PCT/AU2004/001255 37 In a preferred embodiment, the synthesized compound or the name or structure of the compound is provided with an indication as to its use e.g., as determined by a screen described herein, 5 4. Other readout systems for assaying inhibition of PKCs Inhibitors of PKCs can also be identified using assays that measure the activation, intracellular translocation, binding to intracellular receptors (e.g. RACKs) or catalytic activity of PKCs. Traditionally, the kinase activity of PKC family members has been assayed using at least partially purified PKC in a reconstituted phospholipid 10 environment with radioactive ATP as the phosphate donor and a histone protein or a short peptide as the substrate (Kitano et al., Meth. Enzymol. 124, 349-352, 1986; Messing et aL, J. Biol. Chem. 266, 23428-23432, 1991). Recent improvements include a rapid, highly sensitive chemiluminescent assay that measures protein kinase activity at physiological concentrations and can be automated and/or used in high-throughput 15 screening (Lehel et al., Anal. Biochem. 244, 340-346, 1997) and an assay using PKC in isolated membranes and a selective peptide substrate that is derived from the MARCKS protein (Chakravarthy ert al. Anal. Biochem. 196, 144-150, 1991). The present invention also encompasses assays wherein modified expression of one or 20 more PKCs-regulated genes is determined. Inhibitors that affect the intracellular translocation of PKCs are identified by assays in which the intracellular localization of PKCs is determined by fractionation (Messing at al., J. Biol. Chem. 266, 23428-23432, 1991), or by immunohistochemical means (U.S. 25 Pat. No. 5,783,405; U.S. patent application Ser, No. 08/686,796). Monoclonal and polyclonal antibodies useful for such imamunobistochemical assays, that bind specifically to human, rat or murine PKCs, are publicly available (eg., United States Biological, Swampscott, MA 01907, USA). For example, PKCs localization can be determined by confocal microscopy. Immunofluorescence is also useful for 30 determining the localization of PKCs in hepatocytes, especially in plasma membrane and early endosomes, which is consistent with a role in insulin receptor (IR) endocytosis. Alternatively, a PKCs-GFP fusion protein can be employed. 5. Validation of PKCs antagonists WO 2005/025602 PCT/AU2004/001255 38 Validation of the activity of any candidate PKCE antagonist is primarily achieved by ensuring efficacy of the compound in isolated hepatocytes and pancreatic islet cells and optionally, in animals, as described herein above. 5 Additionally, various surrogate assays to validate efficacy of the compounds can be performed. For example, assays can be performed using recombinant PKCs eg., produced by transfection of nucleic acid encoding wild type PKCs or a constitutively active variant thereof e.g., a kinase-dead PKCa variant, PKCs (Al59E) and/or PKCe (K437R), in a baculovirus expression system in insect cells (Hug and Sarre, Biochem. 10 J. 291, 329-343, 1993; Koide et atl., Proc. Natl. Acad. Sci. USA 89, 1149-1153, 1992; and Kazanietz et al., Mol. Pharm. 44, 298-307, 1993 which are incorporated by reference herein). To facilitate purification of the recombinant PKCs protein, it is preferred to express the protein as a fusion protein with a detectable ligand such as, for example, a hexahistidine peptide or FLAG epitope. 15 The selectivity of a PKCs antagonist is generally determined by comparing the effect of the inhibitor on PKCe to its effect on other PKC isozymes similarly expressed in transfected cells. 20 Alternative surrogate assays may employ hepatocytes or islet cells that overexpress wild type PKCe or a constitutively activated variant thereof or PKCs analogue lackiing an active kinase domain (i.e., a "kinase-dead variant"), stimulated with ligands and activators such as insulin, glucagon, norepinephrine and phorbol esters, and combinations thereof, or alternatively, lysates/extracts thereof. For example, specificity 25 of a candidate PKCs antagonist for activity in particular cell type, such as hepatocyte and/or pancreas, but not for a skeletal muscle cell or fibroblast, can be determined. This is achieved by assaying the compound in a range of different cells, and selecting those compounds that selectively modulate PKCs activity in hepatocytes and/or pancreatic P3-islet cells. 30 For example, the present invention also provides a method for determining a compound that specifically antagonizes a protein kinase C epsilon (PKCE) in a hepatocyte comprising: (i) incubating a'hepatocyte and an insulin-responsive cell other than a hepatocyte in 35 the presence and absence of a candidate compound; WO 2005/025602 PCT/AU2004/001255 39 (ii) stimulating the hepatocyte and the other insulin-responsive cell at (i) with insulin; and (iii) determining the rate of internalization of the insulin receptor in the insulin stimulated hepatocytes and the other insulin-responsive cell line wherein reduced 5 insulin receptor internalization in the presence of the candidate compound compared to in the absence of the candidate compound in the insulin-stimulated hepatocyte but not in the other insulin-responsive cell indicates that the compound specifically antagonizes a PKCs in a hepatocyte. 10 Preferably, the hepatocyte is a human hepatoma cell line such as, for example, Huh7, or a primary hepatocyte such as, for example, a primary murine, rat or human hepatocyte. Preferably, the other insulin-responsive cell is a muscle cell (eg,, C 2

C

1 2 or Ls myoblast or human, rat or mutine skeletal muscle cell or cardiac muscle cell), an islet cell (eg., 15 MIN6 or isolated human, rat or murine pancreatic islet cell), or an adipocyte (eg., 3T3 L1 adipocyte). Other cells are not to be excluded. Cells that have been transfected to express an insulin receptor, to make them insulin-responsive can also be used, In an alternative embodiment, the present invention provides a method of determining a 20 compound that specifically antagonizes a protein kinase C epsilon (PKCs) in a pancreatic P-islet cell comprising: (i) incubating a pancreatic P-islet cell and an insulin-responsive cell other than a pancreatic 0-islet cell with an amount of a lipid or free fatty acid (FFA) and/or glucose; (ii) incubating the cells at (i) in the presence and absence of a candidate compound; 25 and (iii) deterrairing the level of glucose-stimulated insulin secretion by the cells wherein enhanced insulin secretion in the presence of the candidate compound compared to in the absence of the compound in the pancreatic n-islet cell but not in the other insulin-responsive cell indicates that the compound that the compound 30 specifically antagonizes a PKCs in a pancreatic P-islet cell. Preferably the lipid or FFA is selected from the group consisting of palmitic acid, oleic acid, linoleic acid, myristic acid, laurie acid, pentadecanoic acid, stearic acid, and linolenic acid. 35 WO 2005/025602 PCT/AU2004/001255 40 Preferably, the islet cell is a cultured murine MJN6 cell or an isolated human, rat or murine pancreatic islet cell. Preferably, the other insulin-responsive cell is a hepatocyte (eg,, a human hepatoma cell line such as, for example, Huh7, or a primary hepatocyte such as, for example, a primary murine, rat or human hepatocyte), a muscle 5 cell (eg., C 2

C

1 2 or L6 myoblast or human, rat or inmurine skeletal muscle cell or cardiac muscle cell), or an adipocyte (eg., 3T3-L1 adipocyte). Other cells are not to be excluded. For example, MIN6 cells overexpressing a PKCs protein in the presence or absence of 10 free fatty acid (e.g., oleate or palmitate), are assayed for PKCs activity in the presence of siRNA against PKCP. A growth hormone reporter gene is also employed to allow the effects of overexpression and inhibition or expression to be determined without the confounding issue of transfection efficiency. The PKCE phenotype of the cell is established fn vitro. The specificity of the siRNA is determined by analyzing gene s15 expression, or by expressing various other PKCGs substimtution or deletion mutants in the siRNA-treated MIN6 cells and determining whether or not activity is restored. For such gain of function assays, the wild type, kinase-inactivated and constitutively active mutants of PKCs are useful, as is a short peptide corresponding to the V1-2 region which inhibits translocation of PKCe. 20 To confirm the ability of an antagonist compound to inhibit PKCs by binding directly to the enzyme, an immunoassay can be performed. Cells expressing recombinant PKCc in vitro can be contacted with the compound, which may be labelled such as using a radioligand or chromophore, under conditions permitting binding of the compound to 25 the PKCs polypeptide and the binding is detected. For example, the compound bound to a recombinant PKCs, preferably expressed as a fusion protein with a detectable tag, is purified from Sf9 cell lysates expressing recombinant PKCs by virtue of the ligand attached to the compound, and the identity of PKCs confirmed by any method known to the skilled artisan. For example, tryptic digestion and microcapillary liquid 30 chromatography electrospray ionisation tandem mass spectrometry (4LC/ESI-MS/MS) can be employed to identify a fragment of PKCe by virtue of its amino acid sequence. Alternatively, an immunoassay such as a radioimmunoassay or ELISA can be employed, using antibodies against PKCs. Alternatively, or in addition, labelled compounds can be detected bound to PKCs by co-immunoprecipitation of compound 35 PKCe complexes from cell lysates and subsequently identifying the PKCE protein in the labelled fraction by silver-staining and/or trypsin digestion and/or ijLC/ESI- WO 2005/025602 PCT/AU2004/001255 41 MS/MS, or immunoblotting, Co-localization of PKCs with antagonist compounds is also investigated in intact cells. Antagonists of PKCe and methods for their delivery to cells 5 In the present context, the term "antagonist" shall be taken to mean a small molecule, nucleic acid, protein, polypeptide, peptide, or antibody capable of inhibiting PKCs selectively or non-selectively, by inhibiting the activity of PKCs and/or by reducing transcription or translation of PKCs-encoding nucleic acid in a cell and preferably in a hepatocyte and/or pancreatic (3-islet cell or a cell line derived therefrom. An inhibitor 10 of enzyme activity may be a competitive or non-competitive inhibitor with respect to a known substrate of the PKCE enzyme, or an inhibitor of the translocation of the PKCe, or an inhibitor of the kinase activity of the PKCs such as, for example, by competing with the endogenous PKCs for the ATP substrate. S15 In one embodiment, the antagonist is a specific antagonist of protein kinase C epsilon (PKCs). Alternatively, or in addition, the antagonist is a compound that exerts its effect on a protein kinase C epsilon (PKCE) in a tissue other than adipose or skeletal muscle or 20 cardiac muscle, such as, for example, in the liver or pancreas. In accordance with this embodiment, the effect of the antagonist on a protein kinase C epsilon (PKCs) in a tissue other than adipose or skeletal muscle or cardiac muscle may be a consequence of tissue-specificity of the compound per se or alternatively, a consequence of tissue specific targeting of the compound to a particular tissue or cell of the animal or human 25 subject. Accordingly, the antagonist may not modulate the uptake of glucose by skeletal muscle and/or may not modulate insulin sensitivity of skeletal muscle. Preferred antagonist compounds modify insulin clearance by the liver and/or insulin secretion by the pancreas in addition to modulating glucose uptake and/or insulin 30 sensitivity of skeletal muscle. Although any molecule that inhibits PKCs is sufficient to reduce or ameliorate an abnormality in glucose metabolism, molecules that selectively inhibit PKCs are preferred because, as shown by PKCs null mutant mice, elimination of PKCs does not 35 cause major developmental abnormalities or serious side effects. Since molecules that are capable of generally inhibiting PKC isozymnes interfere with the various functions WO 2005/025602 PCT/AU2004/001255 42 performed by those isozymes, such non-selective inhibitors, whilst effective, are likely to have unwanted side effects. In a preferred embodiment, the antagonist is a polypeptide antagonist or 5 oligonucleotide antagonist of PKCs, such as for example, a peptide comprising a sequence selected from the group consisting of SEQ ID Nos: 6-12, or a dominant negative mutant of PKCs comprising the amino acid sequence of SEQ ID NO: 15 or an oligonucleotide antagonist selected from the group consisting of SEQ ID Nos: 16-27. 10 For example, U.S. Pat. No. 5,783,405 describes a large number of antagonist peptides that inhibit PKC isozymes. Of these, one or more peptides or polypeptide comprising the amino acid sequence of a peptide selected from the group consisting of epsilon VI I (NGLLKIK; SEQ ID NO: 6), epsilon VI-2 (EAVSLKPT; SEQ ID NO: 7), epsilon V1-3 (LAVFHDAPIGY; SEQ ID NO: 8), epsilon V1-4 (DDFVANCTI; SEQ ID NO: 15 9), epsilon VI-5 (WIDLEPEGRV ; SEQ ID NO;: 10) and epsilon V1-6 (HAVGPRPQTF ; SEQ ID NO: 11) is particularly preferred as selective antagonists of PKCs. A peptide comprising the amino acid sequence set forth in SEQ ID NO: 7 is particularly preferred. 20 Another inhibitory peptide that the inventors have employed is that corresponding to pseudo substrate region (149-164) of PKCa comprising the amino acid sequence ERMRPRKRQGAVRRRV (SEQ ID NO: 12). Preferably, a peptide antagonist is myristolylated at the N-terminus to facilitate cell 25 entry. Alternatively, or in addition, the peptide is conjugated to a targeting moiety such as, for example Drosophila penetratin heptapeptide comprising the amino acid sequence RRMKWKK (SEQ ID NO: 13) to form a bioactive derivative. A preferred polypeptide antagonist is a dominant negative mutant of PKCz, such as, for 30 example, a protein that comprises one or more mutations in one or more domains of the full-length protein thereby producing a catalytically-inactive PKCe polypeptide that competitively inhibits the action of the native or endogenous PKCe enzyme in a cell. A "kinase-dead" PKCz polypeptide which comprises an amino acid sequence of a native PKCs polypeptide wherein the ATP-binding site is inactivated is particularly preferred. 35 As exemplified herein, the amino acid sequence of a "kinase-dead" PKCe polypeptide comprising a substitution of lysine for arginine at position 437 of the human or murine WO 2005/025602 PCT/AU2004/001255 43 PKCs polypeptide set forth in SEQ ID Nos: 2 or 4 (the "K437R mutant") is set forth in SEQ ID NO: 14 or 15, respectively. The K437R mutant competes with wild-type PKCs for ATP,, thereby competitively inhibiting the activity of the eidogenous PKCE polypeptide in a cell. 5 In a particularly preferred embodiment, the antagonist is targeted to the liver or pancreas of the subject. In one embodiment, liver or pancreas delivery is achieved using a suitable vector. 10 Accordingly, the present invention also provides a vector capable of expressing a polypeptide antagonist (eftg,, dominant negative mutant or peptide inhibitor) or oligonucleotide antagonist (eg., antisense, ribozyme, siRNA or RNAi) of a protein kinase C epsilon (PKCc) in a format suitable for introduction into a hepatocyte or pancreatic r-islet cell and expression therein. 15 For liver-specific delivery of polypeptide inhibitors, expression vectors designed to interact with specific receptors on liver cell surfaces that mediate receptor-mediated endocytosis can be used. Adenovirus vectors have been shown to efficiently deliver to cultured hepatocytes and to mouse liver cells in vivo (Herz and Gerard, Proc. Natl. 20 Acad. Sci, USA 90, 2812-2816, 1993; Engelhardt et al., Proc. Natl, Acad. Sci, USA 91, 6196-6200, 1994; Raper et al., Hum. Gene Ther. 9, 671-679, 1998). Preferably, a replication-defective hepadnavirus (hepatotropic DNA virus) vector is used for liver-specific delivery (see, for example, Ganem, D. Fields, B. N., Knipe, D. 25 M., & Howley, P. M., eds. (1996) in Fields Virology (Lippincott, Philadephia). Complementation in trans by a helper virus genome carrying a deletion in the viral packaging signal 6 is used in combination with the hepadnavirus (hepatotropic DNA virus) vector. This is a key cis-acting element required for incorporation of the genomic viral RNA into virus particles (Junker-Niepmaan et al., EMBO J. 9, 3389-3396, 1990), 30 where it can be reverse-transcribed. The helper, therefore, provides all of the essential replication functions, but cannot itself be propagated as an infectious virus. Co transfection of the chimeric genore and helper genome into a permissive cultured hepatoma cell results in the release of encapsidated chimeric progeny. These progeny then can be used to infect either primary hepatocytes in vitro or animal hosts in vivo. In 35 a particularly preferred embodiment, the hepadnavirus vector is a replication-deficient human hepatitis B virus (HBV).

WO 2005/025602 PCT/AU2004/001255 44 Other suitable viral delivery vectors, such as, for example, adeno-associated virus, can also be employed in this context. 5 For liver-specific expression of the peptides, nucleic acid encoding the peptides is placed operably under the control of a promoter such as, for example, the human phenylalanine hydroxylase gene promoter (Chatterjee et al,, Proc. Natl Acad. Sci USA 93, 728-733, 1996), transthyrctin promoter (Aurisicchio eta!., J. Virol., 74, 4816-4823, 2000), serum albumin gene promoter, cytochrome P450 2B gene promoter, 10 apolipoprotein A-1 gene promoter, phosphoenolpyruvate carboxykinase gene promoter, ornithine transearbamylase gene promoter, UDP-glucuronosyltransferase gene promoter or hepatocyte nuclear factor 4 gene promoter. For expression in pancreatic j3-islet cells, the use of a promoter from a gene encoding Is insulin (KIulkami etal., Cell 96, 329-339, 1999) or is preferred. Alternatively, the pdx-I promoter/enhancer (Gannon et aL, Genesis 26, 143-144, 2000) can be used. By "promoter" in the present context is meant sufficient nucleic acid from a genomnic gene fragment to confer expression at least in a [3-islet cell and/or a hepatocyte and 20 preferably at an enhanced level in the islet cell and/or hepatocyte. Even more preferably, expression is substantially in the islet cell and/or hepatocyte compared to other cells in the body of the subject. Placing a nucleic acid molecule encoding the polypeptide antagonist under the 25 regulatory control of, i.e., "in operable connection with", a promoter sequence means positioning said molecule such that expression is controlled by the promoter sequence, generally by positioning the promoter 5' (upstreamn) of the peptide-encoding sequence. Means for introducing the nucleic acid or a gene construct comprising same into a cell 30 for expression are well-known to those skilled in the art. The technique used for a given organism depends on the known successful techniques. Means for introducing recombinant DNA into animal cells include microinjection, transfection mediated by DEAE-dextran, transfection mediated by liposomes such as by using lipofectamine (Gibco, MD, USA) and/or cellfectin (Gibco, MD, USA), PEG-mediated DNA uptake, 35 electroporation and microparticle bombardment such as by using DNA-coated tungsten or gold particles (Agracetus Inc., WI, USA) amongst others.

WO 2005/025602 PCT/AU2004/001255 45 Preferred cell lines for testing the expression and/or efficacy of such polypeptide antagonists in hepatocytes include the human hepatoma cell line Huh7, or primary mouse or rat hepatocytes. 5 For delivery to pancreatic 0-islet cells, it is particularly preferred to transfect a cultured pancreatic cultured cell line or embryonic stem cell line capable of differentiating into a pancreatic islet cell with the recombinant gene construct expressing the polypeptide antagonist and then transplant the transfecled cell into the kidney capsule or pancreas of o10 a subject in need of treatment. Small molecule inhibitors of PKC are described in U.S. Pat. Nos. 5,141,957, 5,204,370, 5,216,014, 5,270,310, 5,292,737, 5,344,841, 5,360,818, and 5,432,198. These molecules belong to the following classes: N,N -Bis-(sulfonamrnido)-2-amino-4 15 iminonaphthalen- 1-ones; N,N-Bis-(amido)-2-amino-4-iminonaphtha en- 1-ones; vicinal-substituted carbocycics; 1,3-dioxane derivatives; 1,4-Bis-(amnino hydroxyalkylamnino)-anthraquinones; furo-coumarinsulfonamides; Bis (hydroxyalkylamino)-anthraquinones; and N-aminoalkyl amides. A 0-adrenergic agonist compound may also be used. Due to their relative ease of administration eg., 20 by transdermnal delivery or ingestion, small molecule inhibitors of PKCs are also preferred. U.S. Pat. No. 6,339,066 incorporated herein by reference describes several antisense oligonuclcotides that specifically inhibit the transcription and/or translation of niRNA 25 encoding PKCg. Such oligonucleotides are complementary to, and specifically hybridizable with, nucleic acid encoding PKCs thereby modulating expression of a PKC.s-encoding gene. By "nucleic acid encoding PKC&" is meant nucleic acid comprising a nucleotide sequence that is at least about 80% identical to at least about 20 contiguous nucleotides of the sequence of the murine or human PKCE mRNA set 30 forth in SEQ ID NO: 1 or 3 or a genomic gene equivalent thereof. Preferably, the percentage identity of an antisense oligonucleotide to SEQ ID NO: 1 or 3 or to a genomic gene equivalent thereof is at least about 85%, more preferably at least about 90%, even more preferably at least about 95% and still more preferably at least about 99%. Preferred antisense oligonucleotides comprise at least about 50 contiguous 35 nucleotides or at least about 100 or 500 contiguous nucleotides complementary to the target mRNA sequence, and preferably complementary to the 5'-untranslated region WO 2005/025602 PCT/AU2004/001255 46 and/or 3'-untranslated region and/or coding region, or alternatively, to -the entire target mnRNA sequence. Such oligonucleotides may be conveniently and desirably presented in a pharmaceutically acceptable carrier to an animal in need of modulation of PKCs expression and/or activity. 5 Preferred antisense oligonuclectides comprise substantially chirally pure phosphorothioate intersugar linkages. The term "substantially chirally pure" is intended to indicate that the intersugar linkages of the oligonucleotides of the invention are either substantially all Sp, or substantially all Rp, phosphorothioate intersugar linkages. 10 For example, such oligonucteotides have an increased thermodynamic stability, compared to phosphodiester oligonucleotides of identical sequence, in heteroduplexes formed with the target RNA. In a particularly preferred embodiment, an antisense oligonucleotide against PKCs will 15 comprise a nucleotide sequence selected from the group consisting of: (i) CATGAGGGCCGATGTGACCT (SEQ ID NO: 16); (ii) TGCCACACAGCCCAGGCGCA (SEQ ID NO: 17); (iii) AAGGAAAGTCTGCGGCCGGG (SEQ ID NO: 18); (iv) TGGCGGCTCCCGTTCTGCAG (SEQ ID NO: 19); 20 (v) GCTTCCTCGGCCGCATGCGT (SEQ ID NO: 20); (vi) T'TGACGCTGAACCGCTGGGA (SEQ ID NO: 21); (vii) GCCCGGTOCTCCTCTCCTCG (SEQ ID NO: 22); (viii) GGGCCGATGTGACCTCTGCA (SEQ ID NO: 23); (ix) TGGAGGAACATGAGGGCCGA (SEQ ID NO: 24); 25 (x) CCCCCAGGGCCCACCAGTCC (SEQ ID NO: 25); (xi) TGCGATOCCACACAGCCCAG (SEQ IDNO: 26); and (xii) TGCCTCTCACGGCATCAGG (SEQ ID NO: 27). Nucleic acid antagonists may also comprise ribozymes or small interfering RNA 30 (siRNA). As used herein, a "ribozyme" is a nucleic acid molecule having nuclease activity for a specific nucleic acid sequence. A ribozyme specific for PKCe-encoding mnRNA, for example, binds to and cleaves specific regions of the mRNA, thereby rendering it 35 untranslatable. To achieve specificity, preferred ribozyrmes will comprise a nucleotide WO 2005/025602 PCT/AU2004/001255 47 sequence that is complementary to at least about 12-15 contiguous nucleotides of a sequence encoding the amino acid sequence set forth in SEQ ID NO: 1 or 3. As used herein, the terms "small interfering RNA", and "RNAi" refer to homologous 5 double stranded RNA (dsRNA) that specifically targets a gene product, thereby resulting in a null or hypomorphic phenotype. Specifically, the dsRNA comprises two short nucleotide sequences derived from the target RNA encoding PKC4 and having self-complementarity such that they can anneal, and interfere with expression of a target gene, presumably at the post-transcriptional level. RNAi molecules are 10 described by Fire et al., Nature 391, 806-811, 1998, and reviewed by Sharp, Genes & Development, 13, 139-141, 1999). DNA-containing complexes designed to interact with specific receptors on liver cell surfaces that mediate receptor-mediated endocytosis can be used to target nucleic acid 15 antagonists (eg., antisense, ribozyme, siRNA, RNAi) to the liver (reviewed by Smith and Wu Semnin. Liver Dis., 19, 83-92, 1999). Adenovirus vectors have been shown to efficiently deliver genes to cultured hepatocytes and to mouse liver cells in vivo (Herz and Gerard, Proc. Natl. Acad. Sci. USA 90, 2812-2816, 1993; Engelhardt et al., Proc. Natl, Acad. Sci. USA 91, 6196-6200, 1994; Raper et al., Hum. Gene Ther. 9, 671-679, 20 1998). Preferably, a replication-defective hepadnavirius (hepatotropic DNA virus) vector is used for liver-specific gene transfer to deliver the oligonucleotide antagonist (see, for example, Ganem, D. Fields, B. N., Knipe, D. M., & Howley, P. M., eds. (1996) in 25 Fields Virology (Lippincott, Philadephia). Complemrnentation in trans by a helper virus genome carrying a deletion in the viral packaging signal t is used in combination with the hepadnavirus (hepatotropic DNA virus) vector. This is a key cis-acting element required for incorporation of the genomic viral RNA into virus particles (Junker Niepmann et al, EMBO J. 9, 3389-3396, 1990), where it can be reverse-transcribed. 30 The helper, therefore, provides all of the essential replication functions, but cannot itself be propagated as an infectious virus. Co-tratnsfection of the chimeric genome and helper genome into a permissive cultured hepatoma cell results in the release of encapsidated chimeric progeny. These progeny then can be used to infect either primary hepatocytes in vitro or animal hosts in vivo. In a particularly preferred 35 embodiment, the hepadnavirus vector is a replication-deficient human hepatitis B virus "f-V).

WO 2005/025602 PCT/AU2004/001255 48 Other appropriate viral vectors, such as, for example, an adeno-associated vector, can also be employed. 5 Alternatively, oligonucleotide antagonists are expressed under the control of a liver specific promoter such as, for example, the human phenylalanine hydroxylase gene promoter (Chatterjee et a., Proc. Natl Acad. Sci USA 93, 728-733, 1996), transthyretin promoter (Aurisicchio et al., J. Virol., 74, 4816-4823, 2000), serum albumin gene promoter, cytochrome P450 2B gene promoter, apolipoprotein A-1 gene promoter, 10 phosphoenolpyravate carboxykinase gene promoter, ornithine transcarbamylase gene promoter, UDP-glucuronosyltransferase gene promoter or hepatocyte nuclear factor 4 gene promoter. Means for placing an oligonuclleotide antagonist operably under the control of a liver-specific promoter, and introducing the expression construct into a hepatocyte are described herein above for expression constructs encoding polypeptide 15 antagonists. For expression in pancreatic 03-islet cells, the use of a promoter from a gene encoding insulin (Kulkarni et al., Cell 96, 329-339, 1999) or is preferred. Alternatively, the pdx-I promoter/enhancer (Cannon eta!., Genesis 26, 143-144, 2000) can be used. 20 For delivery to pancreatic P-islet cells, it is particularly preferred to transfect a cultured pancreatic cultured cell line or embryonic stem cell line capable of differentiating into a pancreatic islet cell with the recombinant gene construct expressing the oligonucleotide antagonist and then transplant the transfected cell into the kidney capsule or pancreas of 25 a subject in need of treatment. The present invention clearly extends to any isolated hepatocyte or pancreatic j-islet cell comprising introduced nucleic acid encoding a polypeptide antagonist or oligonucleotide antagonist of PKCs. 30 Administration ofPKCe antagonists The present invention provides for the use of an antagonist of a protein kinase C epsilon (PKCa) in the preparation of a medicament for the treatment of aberrant glucose metabolism in an animal or human subject. 35 WO 2005/025602 PCT/AU2004/001255 49 The present invention also provides for the use of a vector capable of expressing a polypeptide antagonist or oligonucleotide antagonist of a protein kinase C epsilon (PKCe) in a format suitable for introduction into a hepatocyte or pancreatic P-islet cell and expression therein in medicine, and preferably in the preparation of a medicament 5 for the treatment of aberrant glucose metabolism in an animal or human subject. The present invention also clearly extends to the use of an isolated hepatocyte or pancreatic P-islet cell comprising introduced nucleic acid encoding a polypeptide antagonist or oligonucleotide antagonist of PKCs in medicine, atd preferably in the 10 preparation of a medicament for the treatment of aberrant glucose metabolism in an animal or human subject, Because PKCs is an intracellular protein, preferred embodiments of the invention involve administering pharmaceutically acceptable antagonist formulations capable of 15 permeating the plasma membrane. Small, apolar molecules are often membrane permeable. The membrane permeability of other molecules can be enhanced by a variety of methods known to those of skill in the art, including dissolving them in hypotonic solutions, coupling them to transport proteins, and packaging them in micelles. 20 PKCs antagonists are administered hourly, several times per day, daily or as often as the subject in need thereof, or the subject's physician sees fit. Preferably, the administration interval will be in the range of 8 to 24 hours. Treatment can continue over the course of several days, one month, several months, one year, several years or 25 the duration of the patient's lifetime. Inhibitor dosage will vary according to many parameters, including the nature of the inhibitor and the mode of administration. For the epsilon PKC-vl peptide, a 150 pg/rml intracellular concentration inhibited PKCs translocation and downstream effects of 30 PKCs activation (U.S. Pat. No. 5,783,405). Daily dosages in the range of 1 pg/kg body weight to about 100 mg/kg of body weight, preferably I pg/kg to about 1 mg/kg and most preferably 10 pg/kg to about 1mg/kg are contemplated for PKCs antagonists that are N,N -Bis-(sulfonamido)-2-aaino-4-iminonaphthalen-I -ones or N,N -Bis-(amido)-2 amino-4-iminonaphthalen- 1-ones or vicinal-substituted carbocyclics. Dally dosages in 35 the range of 5-400 mg/kg of body weight, preferably 10-200 mg/kg and most preferably 10-50 mg/kg are contemplated for PKCs antagonists that are 1,4-Bis- WO 2005/025602 PCT/AU2004/001255 50 (amino-hydroxyalkylamino)-ant8aquinones, Bis-(hydroxyakylmino)-anthraquinones, or N-aminoalkyl amides. Daily dosages in the range of 0.1-40 mg/kg of body weight preferably 1-20 mg/kg, are contemplated for PKC inhibitors that are 1,3-dioxane derivatives. Daily dosages in the range of 1-100 mg/kg of body weight are 5 contemplated for PKC inhibitors that are furo-coumarinsulfonamides. The methods of this invention are useful for treating mammals in general and humans in particular. 10 A preferred embodiment of the present invention is the administration of a pharmaceutically acceptable formulation of an inhibitor of PKCs. A "pharmaceutically acceptable formulation" comprises one that is suitable for administering the PKCa antagonist in a manner that gives the desired results and does not also produce adverse side effects sufficient to convince a physician that the potential harm to a patient is 15 greater than the potential benefit to that patient The basic ingredient for an injectable formulation is a water vehicle. The water used will be of a purity meeting USP standards for sterile water for injection. Aqueous vehicles that are useful include sodium chloride (NaC1) solution, Ringer's solution, NaCVdextrose solution, and the like. Water-miscible vehicles are also useful to effect full solubility of the PKCs 20 inhibitor. Antimicrobial agents, buffers and antioxidants are useful, depending on the need. In preparing PKCs antagonist compositions for this invention, one can follow the standard recommendations of well known pharmaceutical sources such as Remington: 25 The Science and Practice of Pharmacy, 19.sup.th ed., (Mack Publishing, 1995). In general, the pharmaceutical composition of this invention is powder- or aqueous-based with added excipients that aid in the solubility of the PKCs antagonist, the isotonicity of the composition, the chemical stability and the deterrence of microorganism growth. For oral administration, it is preferable to include substances that protect the PKCs o30 antagonist from degradation by digestive agents. The present invention additionally provides a genetically modified non-human mammal that lacks a functional endogenous PKC-s gene and comprises a heterologous PKC-s gene or a fragment thereof. For example, the non-human mammal comprises and 35 expresses a human PKC-e gene. Such a mammal is referred to as a "non-human PKC-s knock-in mammal" or a "PKC-s knock-in mammal". Accordingly, the invention WO 2005/025602 PCT/AU2004/001255 51 provides a source of a cell, a tissue, a cellular extract, an organelle or a manual that comprises or expresses human PKC-e, preferably at normal levels. As used herein, the term "normal levels" shall be taken to mean that the heterologous 5 PKC-s is expressed at a level substantially similar to the level of expression of the endogenous PKC-s in the non-huma mammal. Furthermnnore, gene expression occurs in the same or similar cells and/or tissues as the endogenous PKC-s gene. Methods for determining the level of expression of a gene product and/or the site of gene expression are known in the art and described, for example, in Ausubel et al (In: Current Protocols 10 in Molecular Biology. Wiley Interseience, ISBN 047 150338, 1987) and (Sambrook et at (In: Molecular Cloning: Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratories, New York, Third Edition 2001). Such mammals are useful for screening to determine a compound that inhibits human 15 PKC-s. Alternatively, or in addition this embodiment of the invention provides a source of a cell, a tissue, a cellular extract, an organelle or a mammal useful for determining a compound that inhibits human PKC-E. Any suitable mammal! can be used to produce the PKC-e knock-in mammal described 20 herein. For example, a suitable mammal can be, a mouse, a rat, a rabbit, a pig, a sheep or a cow. Preferably, a mouse is used to produce a PKC-s knock-in mammal. As will be apparent to the skilled artisan, to produce a knock-in mammal it is not necessary to replace the entire endogenous PKC-s gene. For example, only the region 25 of the endogenous PKC-c gene that encodes a protein is replaced. Clearly, this encompasses replacement of exons that encode a PKC-e protein and intervening intronic regions. By retaining one or more regions of the endogenous PKC-e gene, e.g., a promoter region, the expression of the heterologous PKC-E gene is retained at normal levels, 30 WO 2005/025602 PCT/AU2004/001255 52 In one embodiment, the invention provides a knock-in mammal whose genome comprises either a homozygous or heterozygous replacement of the endogenous PKC-E gene or a region thereof. A knock-in mammal whose genome comprises a homozygous replacement is characterized by somatic and germ cells which contain two copies of the 5 heterologous PKC-e gene or region thereof while a knock-in mutant whose genome comprises a hderozygous replacement is characterized by somatic and germ cells which contain one endogenous allele and one heterologous allele of the PXC-s gene. As used herein, the tenn "genotype" refers to the genetic makeup of a mammal with 10 respect to the PKC-e chromosomal locus. More specifically the term genotype refers to the status of the mammal's PKC-s alleles, which can either be intact (e.g., endogenous or +/+); or replaced in a manner that confers either a heterozygous (e.g., -/h); or homozygous (/h) knock-in genotype (wherein the symbol "h" refers to a heterologous PKC-e gene or region thereof). 15 The present invention also provides a method for producing a non-human PKC-s knock-in mammal. Methods for producing a "knock-in mammal" are known in the art and described, for example, in Nagy et al eds. Manipulating the Mouse Embryo, Cold Spring Harbor Laboratory, 3rd Edition, 2002, ISBN 0879695749 and Tymms and Kola 20 eds Gene Knockout Protocols, Humana Press, 2001, ISBN: 0896035727. In one embodiment, the PKC-s knock-in mammal is produced using homologous recombination to replace the endogenous PKC-c gene or region thereof (e.g., a coding region) with a heterologous PKC-s gene or region thereof For example, a mouse is 25 produced in which the endogenous PKC-s gene is replaced with a human PKC-s gene. To produce a mutant mouse strain by homologous recombination, two elements are generally used. An embryonic stem (ES) cell line capable of contributing to the germ line of the mammal of interest, and a targeting construct containing target-gene 30 sequences, e.g, a heterologous PKC-E gene or region thereof ES cell lines are derived from the inner cell mass of a blastocyst-stage embryo. The targeting construct is WO 2005/025602 PCT/AU2004/001255 53 transfected into cultured ES cells. Homologous recombination occurs in a number of the transfected cells, resulting in introduction of the PKC-s gene or region thereof present in the targeting construct into the target gene. Once identified, mutant ES cell clones are microinjected into a normal blastocyst and the blastocyst introduced into a 5 female (e.g., a pseudopregnant female) to produce a chimeric mammal, e.g. a chimeric mouse, As ES cell lines retain the ability has cells and/or tissues, including the germ line cells, with contribution from both the normal blastocyst and the mutant ES cells. Breeding germ-line chimeras yields mammals that are heterozygous for the mutation introduced into the ES cell, and that can be interbred to produce homrnozygous mutant 10 mice. Production ofa knock-in (gene-targeting) construct A replacement construct is generally used to produce a knock-in mammal. Such a replacement construct usually contains two regions of homology to the target gone 15 located on either side of a heterologous nucleic acid (for example, encoding a heterologous PKC-s protein or region thereof and, optionally, one or more reporter genes for selection of a cell carrying the construct (e.g. enhanced green fluorescent protein), P-galactosidase, an antibiotic resistance protein (e.g. neomycin resistance or zeocin resistance) or a fusion protein (e.g. the ; P-galactosidase - neomycin resistance 20 protein, 3-geo,). Homologous recombination proceeds by a double cross-over event that replaces the target-gene sequences with the replacement-construct sequences (i.e. a region of the gene that occurs between the regions of homology with regions of the targeting construct are replaced with the heterologous nucleic acid). 25 Should a reporter gene be used it is preferably flanked by recombination sites to thereby facilitate its removal from the genomic DNA of a cell or mammal. For example, the reporter gene is flanked by Loxi sites (which are recognition sites of the P1 recombination enzyme Cre) or frt sites (which are recognition sites of the yeast recombinase fip). Methods for using such recombinase sites for the production of a 30 targeting vector and of the production of a knock-in mammal are known in the art and WO 2005/025602 PCT/AU2004/001255 54 described, for example, in Fiering et al., Genes Dev.;9:2203-2213, 1995; Vooijs et al., Oncogene. 17:1-12 1998. For example, If there are two loxP sites in the same orientation near each other in a 5 nucleic acid, Cre removes the sequence between the two sites, leaving a single loxP site in the original DNA and a second loxP in a circular piece of DNA containing the intervening sequence. Accordingly, loxP sites or frt sites that are inserted flanking a reporter gene are useful for the removal of the intervening sequence. 10 The present invention provides a vector construct (e.g., a PKC-s targeting vector or PKCs targeting construct) designed to replace an endogenos mammalian PKC-a gene with a heterologous PKC-a gene. In general terms, an effective PKC-e targeting vector comprises a nucleic acid comprising a nucleotide sequence that is effective for homologous recombination with the endogenous PKC-s gene. For example, a 15 replacement targeting vector comprises a nucleic acid encoding a beterologous PKC-c gene or region thereof and optionally a selectable marker gene flanked by regions of nucleic acid homologous to or substantially identical to a genomic sequence of the endogenous PKC-s gene or a region thereof. For example, the nucleic acid encoding a heterologous PKC-c gene or region thereof and optionally a selectable marker gene is 20 flanked by a region homologous to or substantially identical to a region of the endogenous PKC-e genomic DNA 5' to the first coding exon of the endogenous PKC-6 gene and another region homologous to or substantially identical to a region of the endogenous PKC-s genomic DNA 3' to the last coding exon of the endogenous PKC-s gene, 25 Alternatively, the entire endogenous PKC-s genomic gene is replaced with a heterologous PKC-e genomic gene. For example, the promoter region, 5' untranslated region, exons, introns and 3' untranslated regions of the endogenous PKC-s genomrnic gene is replaced with the same regions of the heterologous PKC-e gene. Alternatively, 30 the endogenous PKC-z gene is replaced with a region of the heterologous PKC-s gene WO 2005/025602 PCT/AU2004/001255 55 or a minigene (e.g., a eDNA operably under control of a promoter) encoding a heterologous PKC-s. One of skill in the art will recognize that any PKC-s genomic nucleic acid of 5 appropriate length and composition to facilitate homologous recombination at a specific site that has been preselected for disruption can be employed to construct a PKC-e targeting vector. Guidelines for the selection and use of sequences are described for example in Deng and Cappecehi, Mol. Cell. Biol., 12:3365-3371, 1992 and B3ollag, et al., Annu. Rev. Genat., 23:199-225, 1989. 10 Suitable targeting constructs of the invention are prepared using standard molecular biology techniques known to those of skill in the art. For example, techniques useful for the preparation of suitable vectors are described by Maniatis, et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, 15 N.Y. One of skilled in the art will readily recognize that any of a number of appropriate vectors known in the art can be used as the basis of a suitable targeting vector. In practice, any vector that is capable of accommodating the recombinant nucleic acid required for 20 homologous recombination and the heterologous PKC-e gene or region thereof is suitable. For example, pBR322, pACY164, pKK223-3, pucks, pKG, pUC19, pLG339, pR290, pKC101 or other plasmid vectors are useful. Alternatively, a viral vector such as the lambda gt I 1 vector system is useful in the production of a targeting construct. As a further alternative a bacterial artificial chromosome (BAC) or a yeast artificial 25 chromosome (YAC) is used as a targeting vector, for example, for replacing an entire endogenous PKC-e gene. Production of a PKC-s knock-in cell Following production o' a suitable gene construct comprising nucleic acid encoding a 30 functional PKCc protein e.g., human PKCs, the coustruct is introduced into a relevant cell. Methods for introducing the gene construct into a cell are known to those skilled WO 2005/025602 PCT/AU2004/001255 56 in the art and are described for example, in Ausubel et al (In: Current Protocols in Molecular Biology. Wiley lnterseience, ISBN 047 150338, 1987) and (Sambrook et al (In; Molecular Cloning: Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratories, New York, Third Edition 2001). Means for introducing recombinant 5 DNA into a cell include, but are not limited to electroporation, microinjection, transfection mediated by DEAE<-dextran, trausfection mediated by calcium phosphate, transfection mediated by liposomes such as by using Lipofectamine (Iavitrogen) and/or cellfectin (Invitrogen), transduction by Adenoviuses, Herpesviruses, Togaviruses or Retroviruses and microparticle bombardment such as by using DNA-coated tungsten or 10 gold particles (Agacetus Inc., VI, USA). F1or example, a cell is electroporated with a targeting construct of the invention. A suitable cell for the production of a knock-in mammal is, for example, an embryonic stem cell. Those of skill in the art will recognize that various stem cells and stem cell 15 lines are known in the art, such as, for example, AB-1, FIM-1, D3. CC1.2, E-14T62a, RW4 or JI (Teratomacarcinoma and Embryonic Stem Cells: A Practical Approach, E. J. Roberston, ed., IRL Press). Clearly, a suitable stem cell or stern cell line will depend upon the type of knock-in mammal to be produced. For example, should a knock-in mouse be desired a mouse ES cel line is used. Furthermore, should an inbred strain of 20 knock-in mice be preferred, an ES cell line derived from the same strain of mouse that is to be used is preferred, Following transfection cells are maintained under conditions sufficient for homologous recombination to occur while maintaining the pluripotency of the ES cell. 25 In an example of the invention, an ES cell is selected that has homologously recombined to introduce the targeting vector into it's genome (as opposed to random integration). A method used for eliminating cells in which the construct integrated into the genome randomly, thus further enriching for homologous recombinants, is known 30 as positive-negative selection. Such methods are described, for example, in US 5,464,764. Briefly, a construct useful for positive-negative selection comprise a WO 2005/025602 PCT/AU2004/001255 57 negative selectable marker (e.g., herpes simplex virus thymidine kinase, HSV-TK) outside the region of homology to the target gene (i.e. in a region that will not be incorporated into the genome of a cell following homologous recombination). In the presence of the TI( gene, the cells are sensitive to acyclovir and/or an analog thereof 5 (e.g., gancyclovir, GANC). The HSV-TK enzyme activates these drugs, resulting in their incorporation into growing DNA, causing chain termination and cell death. During homologous recombination, sequences outside the regions of homology to the target gene are lost due to crossing over. In contrast, during random integration substantially all of the sequences in the construct are retained as recombination usually 10 occurs at the ends of the construct. The presence of the TK gene is selected against by growing the cells in gancyclovir; the homologous recombinants are gancyclovir resistant, whereas clones in which the construct integrated randomly are gancyclovir sensitive.. Other markers that are lethal to cells have also been used instead of TK and gancyclovir (e.g., diphtheria toxin; Yagi et al., Proc Natl Acad Set U S A. 87:9918 15 9922,1990). Alternatively, or in addition, a cell is screened using, for example, PCR or Southern blotting to determine a targeting construct that has integrated into the correct region of the genomine rather than randomly integrated. Methods for such screening are known in 20 the art, and described, for example, in Nagy et al eds. Manipulating the Mouse Embryo, Cold Spring Harbor Laboratory, 3rd Edition, 2002, ISBN 0879695749 and Tymms, Kola eds Gene Knockout Protocols, Humana Press, 2001, ISBN: 0896035727, Ausubel et al (In: Current Protocols in Molecular Biology. Wiley Interscience, ISBN 047 150338, 1987) and (Sambrook et al (In: Molecular Cloning: Molecular Cloning: A 25 Laboratory Manual, Cold Spring Harbor Laboratories, New York, Third Edition 2001), At this stage the reporter gene can be removed, if used, by expression or introduction of the relevant recombinase into the cell comprising the targeting vector. Alternatively, the reporter gene is removed by expressing the recombinase in a mnouse carrying the 30 targeting construct by production of a transgenic mouse or crossing the mouse with another mouse carrying a transgene expressing the recombinase, WO 2005/025602 PCT/AU2004/001255 58 Production ofa PKC-s knock-in mammal Following production of an ES cell in which at least one copy of the PKC-s gene has incorporated the targeting construct the cell is preferably grown to form an ES cell 5 colony using methods known in the art. One or more cells from the colony are then used to produce a chimeric mammal. An example of a method used to generate chimeras involves the injection of the genetically modified ES cells into the blastocoel cavity of a developing embryo. For 10 example, should the targeted ES cell be of mouse origin, an ES cell is injected into the blastocoel cavity of a 3.5-day-old mouse embryo. The injected embryo is surgically implanted into the uterus of a foster mother, for example, a pseudopregnant female. A resultant offspring is a chimera as its tissues are produced from cells from both the host embryo and from the ES cell. Should the ES cell populate the germ line, the chimera 15 can pass an altered gene to offspring, resulting in a new mouse strain in which all cells contain an altered gene. By breeding a mouse of the new mouse strain with a wild-type mouse offspring that are heterozygous for the mutation are produced, i.e., PKC-s t i'. However, breeding two 20 heterozygous mice, or two homozygous mice or a heterozygous mouse and a homozygous mouse produces at least one offspring that are homozygous for the mutation, i.e., PKCsE The present invention clearly contemplates both heterozygous and homozygous knock 25 in non-human mammals. It is to be understood that a PKC-s knock-in mammal described herein can be produced by methods other than the embryonic stem cell method described above, for example by the pronuclear injection of a gene construct into the pronucleus of a one-cell embryo 30 or other gene targeting methods which do not rely on the use of a transfected ES cell, WO 2005/025602 PCT/AU2004/001255 59 and that the exemplification of the.single method outlined above is not intended to limit the scope of the invention to mammals produced solely by this protocol. Production of a transgenic PKC-e khockout mammal 5 In another embodiment of the invention, a PKC-c knockout mammal is produced and said mammal is additionally genetically modified to express a heterologous PKC-s gene. Methods for producing a knock-out mammal are known in the art and described, for 10 example, in Nagy et al eds. Manipulating the Mouse Embryo, Cold Spring 'Harbor Laboratory, 3rd Edition, 2002, ISBN 0879695749 and Tymms and Kola eds Gene KItockoutProtocols, Humana Press, 2001, ISBN: 0896035727. For example, a replacement vector described supra is used, however, rather than 15 replacing the endogenous PKC-s gene with a heterologous PKC-e gene it is replaced with, for example, a reporter gene. Preferably, the expression of the endogenous PKC a gene is partially or completely inhibited. Alternatively, or in addition, a region of the PKC-s gene required for a biological activity of interest is removed or replaced thereby producing an inactive PKC-e. 20 Methods for producing a PKC-e knockout mouse are known in the art and described, for example, in Khasar et al., Neuron 24:253-260, 1999. Such a PKC-a knockout mouse (B6.129S4-Prkce""*/J) is also commercially available from Jackson Laboratories, Maine, USA. 25 Following producing or obtaining a PKC-s kockout mammal a trausgene expressing a heterologous PKC-e is introduced into the knockout mammal. Such introduction is facilitated, for example, by crossing the mknockout mammal with a mammal carrying a PKC-s transgene or by producing a PKC-E transgenic mammal using the knockout 30 mammal.

WO 2005/025602 PCT/AU2004/001255 60 Means of producing a transgenic mammal are known in the art and described, for example, in Hogan et al (In: Manipulating the Mouse Embryo. A Laboratory Manual, 2 ,d Edition. Cold Spring Harbour Laboratory. ISBN: 0879693843, 1994). For example, a gene conatruct comprising a human PKC-s eDNA or genomic gene is 5 produced using a method described herein and minicroinjected into the pronucleus of a fertilised mammalian oocyte. The oocyte is then microinjected into a uterus of a pseudopregnant recipient female mammal. Offspring that are screened for presence of the transgene in their genome using, for example, PCR screening or Southern hybridisation using methods known in the art. Those mice that comprise the transgene 10 are bred, and their offspring assayed for transgene expression, using, for example, Northern blotting, RT-PCR and/or Western blotting. Such mice are then useful foi the screening assay of the present invention. Transgenic mammals are also produced by nuclear transfer technology as described in 15 Schnieke, A.E. et al., 1997, Science, 278: 2130 and Cibelli, J.B. et at, 1998, Science, 280: 1256. Using this method, cells, e.g. fibroblasts, from donor mammals are stably transfected with a gene construct incorporating the coding sequences for a form of a PKC-e polypeptide. Stable transfectants are then fused to enucleated oocytes, cultured and transferred into female recipients. 20 By using a tissue specific promoter, a mammal expressing a heterologous PKC-e in a specific tissue or tissues or a particular cell type/s is produced. By selecting or breeding for a mammal that is homozygous for the knockout of 25 endogenous PKC-s and heterozygous or heterozygous for the heterologous PKC-s transgene a mouse expressing only the heterologous PKC-s is obtained. The present invention clearly encompasses a mouse with a genotype selected from the group consisting of PKC-'tg ' , PKC-e tg

'

"

, PKC-s'tg + " and PKC-a +-tg + . In this context the symbol "tg" shall be taken to refer to a transgene; the symbol "-/-" shall be taken to 30 refer to a knockout mammal; the symbol "+/-" shall be taken to refer to a mammal that WO 2005/025602 PCT/AU2004/001255 61 comprises a heterozygous form of a gene; and the symbol "+/+" shall be taken to refer to a mammal that contains two copies of a gene, e.g., a transgene. As will be apparent from the preceding discussion, the present invention contemplates a 5 non-human mammal (e.g. a mouse) that has been genetically modified to express a heterologous PKC-s (e.g., human PKC-e) in place of endogenous PKC-E. The present invention additionally contemplates a cell, a cell line, a cell culture, a primary tissue, a cellular extract or a cell organelle isolated from a PKC-s knock-in 10 mammal of the present invention. For example, a cell culture, or cell line or cell is derived from any desired tissue or cell-type from a PKC-s knock-in, mouse. In one embodiment, a cell culture, or cell line or cell is derived a tissue or cell-type that express high levels of PKC-s in nature. 15 In another embodiment, a PKC-s knock-in mammal produced in accordance with the present invention is utilized as a source of cells for the establishment of cultures or cell lines (e.g., primary, immortalized) useful for determining a PKC-s inhibitory compound. 20 Ir another embodiment, the present invention encompasses the use of a mouse expressing a heterologous PKC-e, for example, a PKC-s knock-in mouse or a cell or tissue derived therefrom in a screening method of the present invention. The present invention is further described with reference to the following non-limiting 25 examples. Example 1 PKCe null(PKCs " /) mice In order to address whether activation of PKCs was causally implicated in insulin 30 resistance the inventors have made use of PKCs null mice developed by targeted disruption of the PKCa gene, by insertion of a neomycin and LacZ cassette in exon 1 of the mouse gene (Figure l a). As a consequence of the insertion, transcription is abolished and leads to a null allele.

WO 2005/025602 PCT/AU2004/001255 62 For initial genotyping of adult mice with a background of 129/SVxOla, Southern blot analysis of EcoRI digested genomic DNA was performed. DNA was extracted from adult tail tissue and hybridised with an endogenous 5 -probe distinguishing wild type, 5 heterozygote mutant, and homozygote mutant alleles. The 5-probe corresponded to a 0.8-kb Smial fragment hybridising to a 9 kb band in the wVild type and a 6 kb band in the successfully mutated allele (not shown). Routine genotyping was carried out by PCR analysis of tail tip DNA, using a forward primer corresponding to a 5'-untranslated region of the PKCe locus and reverse primers corresponding to sequences in either 10 exon 1 (wild type) or the Lac-Neo insert (mutant). The wild type allele gave rise to a 207 kb PCR product while the mutated allele gave rise to a 400 kb product (Figure lb). Mice were maintained on a hybrid 129/SV C57BL/6 background, while experiments involving high-fat feeding were also performed on mice backvrossed at least 6 times on 15 the C57BL/6 background, giving similar results. Ethical approval for mouse studies was granted by the Garvan Institute Animal Experimentation Ethics Committee, Sydney, Australia. The PKCg null mouse is crossed into each of the following genetic backgrounds that 20 produce suitable diabetic models in mice, thereby producing double mutants: (i) yellow obese mouse (A"a), a dominant mutation causes the ectopic, ubiquitous expression of the agouti protein, resulting in a condition similar to adult-onset obesity and non-insulin-dependent diabetes mellitus (Michaud et al., Proc Natl Acad Sci USA 91: 2562-2566, 1994); 25 (ii) Obese (ob/ob) (Zhang et al., N&ture 372: 425-432, 1994) which are leptin deficient; (iii) diabetes (db/db) (Tartaglia et al., Cell 83: 1263-1271, 1995) which are deficient in active leptin receptor; (iv) adipose (cpe/cpe) (Naggert et al., Nat. Genet. 10: 135-142, 1995) which are 30 deficient in carboxypeptidase E; and (v) tubby (tub/tub) (Kleyn et al., Cell 85: 281-290, 1996; Noben-Trauth et al., Nature 380: 534-548, 1996). Obese mice exhibit hyperglycemia, glucose intolerance, and elevated plasma insulin, 35 which develops after the onset of obesity. In db/db mice, elevation of plasma insulin occurs at 2 weeks of age, preceding the onset of obesity at 3-4 weeks and elevation of WO 2005/025602 PCT/AU2004/001255 63 blood glucose levels at 4-8 weeks. Adipose mice have hyperinsulinemnia throughout life in association with hypertrophy and hyperplasia of the islets of Langerhans, with transient hyperglycemia. Tubby mice have normal blood glucose, however plasma insulin is elevated prior to obvious signs of obesity, and the islets of Langerhans are 5 enlarged. The glucose metabolism phenotype of each double mutant is determined to establish the effect(s) of the reduced PKCs expression on the diabetic model. 10 In addition to performing such crosses into a diabetic mouse background, pancreatic islets are isolated from the diabeticmouse models, maintained in culture for various periods in the presence or absence of one or more PKC& inhibitors, or kinase-dead constructs, siRNAs etc for a time and under conditions sufficient for the secretory defects of the islet cells, which are maintained for at least 1-2 days ex vivo, to be 15 reversed. Example 2 Conditional knockout of PKC6 expression in the liver A conditional PKCe liver-null mouse on a Cre+ background is produced using a floxed 20 PKCe allele, PKCs(fl/fl), and Cre recombinase under control of the albumin promoter (AlbCre) essentially as described by Matsusue et al., J Clin Invest. 111 (5), 737-747, 2003. The PKCs allele for producing the knockout was the same as that used previously. The liver of PKCs(fl/fl)AlbCre+ mice is shown to have a deletion of exon I and a corresponding loss of full-length PKCs mRNA and protein. The PKCs 25 deficient mice are shown to have the same phenotype on a chow diet as non-conditional knockout mice. The same conditional knockouts of PKCs expression in the liver are produced by crossing or recombinant means in each of the following genetic backgrounds: 30 (i) yellow obese mouse (Ay'), a dominant mutation causes the ectopic, ubiquitous expression of the agouti protein, resulting in a condition similar to adult-onset obesity and non-insulin-dependent diabetes mellitus (Michaud et al., Proc Natl Acad Sci USA 91: 2562-2566, 1994); (ii) Obese (ob/ob) (Zhang et al., Nature 372: 425-432, 1994) which are leptin 35 deficient; WO 2005/025602 PCT/AU2004/001255 64 (iii) diabetes (db/db) (Tartaglia et al., Cell 83: 1263-1271, 1995) which are deficient in active leptin receptor; (iv) adipose (cpe/cpe) (Naggert et al., Nat. Genet 10: 135-142, 1995) which are deficient in carboxypeptidase E; and 5 (v) tubby (tub/tub) (Kleyn et al., Cell 85: 281-290, 1996; Noben-Trauth et al.-, Nature 380: 534-548, 1996). The glucose metabolism phenotype of each mutant is determined to establish the effect(s) of the reduced PKCs expression on the diabetic model. 10 Example 3 Conditional knockout of PKCs expression in the pancreatic 1-islet cells A conditional PKCs 0-islet cell-null mouse on a Cre+ background is produced using a floxed PKCe allele, PKCE(fl/fl), and Cre recombinase under control of the pdx-1 15 promoter (PdxlCre) essentially as described by Matsusue et al., J Clin Invest. 111, 737-747, 2003 for production of a liver-specific knockout. The PKCs allele for producing the knockout is the same as that used previously. The liver of PKCs(fl/fl)A]bCre+ mice is shown to have a deletion of exon 1 and a corresponding loss of full-length PKCs mRNA and protein. The PKCs-deficient mice are shown to 20 have the same phenotype on a chow diet as non-conditional knockout mice. The same conditional knockouts of PKCe expression in the 0-islet cells are produced by crossing or recombinant means in each of the following genetic backgrounds: (i) yellow obese mouse (AYa), a dominant mutation causes the ectopic, ubiquitous 25 expression of the agouti protein, resulting in a condition similar to adult-onset obesity and non-insulin-dependent diabetes mellitus (Michaud et al., Proc Natl Acad Sci. USA 91; 2562-2566, 1994); (ii) Obese (ob/ob) (Zhang et al., Nature 372: 425-432, 1994) which are leptin deficient; 30 (iii) diabetes (db/db) (Tartaglia et al., Cell 83: 1263-1271, 1995) which are deficient in active leptin receptor; (iv) adipose (epe/ope) (Naggert et al., Nat. Genet. 10: 135-142, 1995) which are deficient in carboxypeptidase E; and (v) tubby (tub/tub) (Kleyn et al., Cell 85: 281-290, 1996; Noben-Trauth et al., 35 Nature 380: 534-548, 1996).

WO 2005/025602 PCT/AU2004/001255 65 The, glucose, metabolism phenotype of each mutant is determined to establish the effect(s) of the reduced PKCs expression on the diabetic model. Example 4 5 Conditional knockout of PKCs expression in the liver and pancreatic 3-islet cells The conditional PKCs liver-null mouse and PKCs P-islet cell-null mouse are crossed and double null mutants isolated and tested for glucose metabolism on a variety of diets. The double null conditional knockout is also crossed into each of the following genetic 10 backgrounds that produce suitable diabetic models in mice: (i) yellow obese mouse (Ayia), a dominant mutation causes the ectopic, ubiquitous expression of the agouti protein, resulting in a condition similar to adult-onset obesity and non-insulin-dependent diabetes inmeUitus (Michaud et al., Proc Natl Acad Sci USA 91: 2562-2566, 1994); 15 (ii) Obese (ob/ob) (Zhang et al., Nature 372: 425-432, 1994) which are leptin deficient; (iii) diabetes (db/db) (Tartaglia et al., Cell 83: 1263-1271, 1995) which are deficient in active leptin receptor; (iv) adipose (cpe/cpe) (Naggert et aL, Nat. Genet. 10: 135-142, 1995) which are 20 deficient in carboxypeptidase E; and (v) tubby (tub/tub) (Kleyn et al., Cell 85: 281-290, 1996; Noben-Trauth et al,, Nature 380: 534-548, 1996). The glucose metabolism phenotype of each mutant is determined to establish the 25 effect(s) of the reduced PKCs expression on the diabetic model. Example 5 Glucose homeostasis in chow-fed and fat-fed mice 30 Materials and methods Animals Wild type and PKCs -/- mutant mice (example 1) were used in all experiments referred to in this Example.

WO 2005/025602 PCT/AU2004/001255 66 To induce insulin resistance in whole animals, 7-week-old mice were fed either a safflower oil-based high-fat diet for 3 weeks, or a coconut fat/sucrose-based high-fat diet, adapted from Research Diets Inc. Diet D12451, for 16 weeks. 5 Antibodies The commercial antibodies the inventors used were PKCct, PKCS, PKCO and IR (Transduction Labs.), PKCe (Santa Cruz), protein kinase B (PKB), phospho-PKB (P S473), p42/44 mitogen activated protein kinase (MAPK) and phospho-p42/44 MAPK (P-T202/Y204) (Cell Signaling Technology) and phospho-IR (pYl162, pYl163) 10 (Biosource). Analysis ofPKC translocation. The inventors fractionated quadriceps muscle from chow- and fat-fed mice and determined the distribution of PKC isoforms in cytosolic and solubilised-membrane 15 compartments by immunoblotting and densitometry as described previously. Glucose and insulin tolerance tests. For glucose tolerance tests, the inventors fasted mice overnight and injected them intraperitoneally with glucose (2 g/kg). The inventors obtained blood samples from the 20 tail tip, and measured glucose concentrations using an Accu-chek Advantage II glucometer (Roche). The inventors measured serum insulin by ELISA (Mercodia AB), and serum C-peptide by RIA (Linco). For insulin tolerance tests, the inventors injected Actrapid insulin (NovoNordisk Pty Ltd) intraperitoneally (0.75 U/kg unless otherwise stated) into overnight fasted mice-and collected blood samples from the tail for glucose 25 determination. Determination of islet area. A quantitative evaluation of islet area was performed from pancreas sections stained with hernatoxylin and eosin, using a digitizing tablet and BioQuant software 30 (BIOQUANT; R&M Biometrics, Nashville, TN). Results of cross-sectional islet area are expressed as percentage of the total pancreas area, Analysis of glucose uptake by isolated muscle strips.

WO 2005/025602 PCT/AU2004/001255 67 The inventors killed mice by cervical dislocation and removed soleus muscles immediately. The inventors preincubated muscles in the presence or absence of insuln, and glucose transport activity was assayed as described previously. 5 Assessment of insulin action in vivo The inventors injected tracer amounts of [U-14C]glucose and [3- 3 H]2-deoxyglucose (10 4Ci per mouse), with glucose(2 g/kg), intraperitoneally into overnight fasted mice. Alternatively, the inventors injected [1-14C]2-deoxyglucose (10 gCi per mouse) with insulin (0.5 U/kg). During these radiolabeled glucose and insulin tolerance tests, the 10 inventors collected blood from tail tips and determined blood radioactivity to calculate the areas under the curves. The inventors determined uptake of [3- 3 HJ2-deoxyglucose or (1[-14C]2-deoxyglucose, and incorporation of [U-14C]glucose into glycogen or lipid, in samples of muscle, liver and adipose tissue as described previously, and made correction for the area under the curve for radioactive glucose and for the weight of the 15 tissue sample used. Statistical analysis. The inventors analysed results by Student's t-test or ANOVA using Statview 4.5 for Macintosh (Abacus Concepts). Results are expressed ± standard error, and differences 20 were considered to be statistically significant at P <0.05. Results Effect of high-saturated and -unsaturated fat diets on glucose homeostasis in wild type and PKCse t " mice 25 Fat-feeding is a well-documented protocol for inducing obesity and insulin resistance in rodents. The inventors firstly employed a diet predominantly enriched in the unsaturated fatty acid linoleate (59% of calories derived from safflower oil) which promotes skeletal muscle and liver insulin resistance in the absence of gross hyperglycemnia and hyperinsulinemia. As expected, wild type mice fed this diet for 3 30 weeks were unable to restore blood glucose levels as efficiently as chow-fed control animals when subjected to a glucose tolerance test (Figure 2a). In contrast, PKCs - / mice were profoundly protected from the effect of the fat diet, and were significantly more glucose tolerant than even chow-fed wild type mice (Figure 2a). This protection could not be explained by differences between fat-fed wild type and PKCs/ mice in 35 energy intake, adipose tissue accumulation or liver and muscle triglyceride content WO 2005/025602 PCT/AU2004/001255 68 (Table 1), suggesting a specific requirement for PKCE in the development of fat induced insulin resistance. TABLE 1 5 Effect of unsaturated fat diet on wild type and PKCs

"

' mice Wild type PKCc"" Chow (n=12) Fat (n=17) Chow (n=9) Fat (n=15) Body weight (g) 27,1 t 0.7 27.9 ± 0.6 26.2 - 1.0 24.8 t 0.8§ Energy Intke 2.3 + 0.1 2,6 : 01 2.3 + 0.1 2.4 4; 0.2 Fasting blood glucose 6.2 t 0.8 7.4 t 0.7 5.9 0.4 7.2 * 0.6 Energy intake 3.1 ± 0.2 2.6 0,1 3.1 ± 0.2 2.4 ± 0.2 Epidydimal fatt 14.1 ± 1.7 23.7 * 3.0* 16.1 ± 2,3 28.0 ± 4.11 Retroperirenal fatf 3.9 ± 0.8 8.0 ± 1.5* 3.0 ± 0.4 8.2 ± 1.7: Brown adipose tissuet 2.9 t 0.4 3.6 ± 0.2 3.7 t 0.3 2.9 ± 0.4 Livert 41.1 t 2.9 41.9 t 3.0 44.7 ±3.9 34.6 2.8t!! Heart 5.9 ± 0.6 6.2 ± 0.5 6.5 ± 1.3 5.8 ± 0.3 Spleent 3.0 ± 0.3 2.8 ± 0.2 2.7 0.6 3.4 ± 0.4 Pancreasf 7.8 ± 1.0 8.7 ± 1.1 7.1 1.2 7.8 ± 1.1 Liver triglyceridestt 1.5 - 0.2 4.5 ± 0.9* 1.5 0.1 4.0 1.3: Muscle triglyceridestt 1.2 ± 0.1 2.0 ± 0.3* 1.1. 0.2 1.8 ± 0.4: I (mM); T$(kJ.g body wt' .d'); f(mg.g body wC.'); tj(mol.g'). Significance of comparisons: *P<0.05 fat-fed wild type versus chow-fed wild typemrnice; §P<0,0I PKCe" versrs appropriate wild type control; .fP<0.05 fat-fed PKCc

"

' versus chow-fed PKC " / " mice 10 Consistent with this interpretation, and with the inventors earlier studies involving rats, wild type mice fed this diet also showed specific patterns of PKC redistribution in skeletal muscle: minimal effects on PKCa; increased translocatiorn of PKCs from cytosol to membrane (indicating activation) and diminished expression of PKCS and PKC in cytosol, most likely resulting from translocation to, and subsequent down 15 regulation in membrane fractions (Figures 2b-2f; Figure 3a-3d). The inventors observed essentially similar alterations in skeletal muscle from fat-fed PKC'

/

' mice, apart from WO 2005/025602 PCT/AU2004/001255 69 the absence of PKCs itself, clearly suggesting that the expression or activation of other novel PKCs had not been altered in compensation for the deletion of PKCs (Figures 2b-2f; Figure 3a-3d). 5 The inventors additionally employed a high-saturated fat diet for 16 weeks, in which 45% of calories are derived from fat (principally the saturated free fatty acid palmitate). This regimen significantly increased fasting blood glucose levels in wild type mice (Table 2) and, compared to the unsaturated fat diet, provoked an even greater impairment of glucose disposal during the glucose, tolerance test (Figure 4a). 10 TABLE 2 Effect of high-saturated fat diet on wild type and PKCs

-

- mice Wild type PKCe Chow (n=10) Fat (n=9) Chow (n=5) Fat 0(n=8) Body weight (g) 32.1 t 0.7 43.4 t 2.6** 30.9 ± 1.6 42.6 1 .8* Fasting blood glucose 7.0 - 0.3 9.4 ± 0.4* 7.2 ± 0.3 8,1 * 0.3# Epidydimal fatt 15.2 a 1.0 46.2 -t 4.6 ' 17.2 0.9 55.7 * 4,7** Retroperirenal fatt 6.0 : 0.7 17.6 t 1. 1* 6.4 0.9 18.5 + 1.6** Brown adipose tissue 3.3 ± 0.3 5.4 ± 0.41 3.6 t 0.3 6.9 ± 0,8* Liver 47.6 :t 1.6 39.4 t 1.7* 50.9 ± 2.5 37,8 ± 3.1* Heart 4.6 ± 0,2 3.6 -0.1* 4.5 -± 0.4 3.8 e 0.2** 1 (mM); ifl(kJ.g body vwt.d' 1 ); t(mg.g body wt.'). Significance of comparisons: *P<0.05, '**P<0.01, P<0.001 fat-fed wild type or PKC&' versus chow-fed wild type; * P<0.02 fat-fed PKC'" versus fat-fed 15 wild type. Remarkably, the fasting hyperglycemia was reduced in fat-fed PKC& / mice and glucose tolerance was completely normalised. Consistent with an obligatory role for PKCg in mediating insulin resistance, the saturated fat diet also promoted translocation 20 of this PKC isoformn in skeletal muscle (Figures 4b-4f and Figures 5a-5d). Expression of the other PKC isoforms was again riot different between muscle from wild type and PKCs"" mice, and cellular redistribution was generally similar to the effects seen with the unsaturated dietL The exception was PKCO which was unaltered by saturated fat- WO 2005/025602 PCT/AU2004/001255 70 feeding, suggesting that its activation is not necessary for the pronounced insulin resistance that accompanies this model (Figures 4b-4f and Figures 5a-54), As above, the protection afforded by deletion of PKCs could not be explained by alterations in tissue or body weight, or energy intake (Table 2). 5 Taken together these data suggest that an enhancement of insulin sensitivity in skeletal muscle would be the most obvious explanation for the pronounced improvement in glucose tolerance seen in PKC

"

/ mice and the protection against the effects of fat feeding. 10 Insulin and C-peptide levels in wild type and PKCe ' mice Alternative explanations, however, were suggested by alterations in the profiles of serum insulin and C-peptide during the glucose tolerance tests. Insulin levels are a combined measure of secretion from P3-cells and clearance by the liver, whereas C 15 peptide is a more direct measure of P3-cell responsiveness, because it is co-secreted with insulin but not rapidly cleared by the liver. Insulin levels during the glucose tolerance tdst were similar in wild type mice irrespective of whether they had been maintained on standard chow or an unsaturated 20 fat diet (Fig. 6a). Insulin excursions, however, were significantly increased in the PKCe " mice, especially those fed the high-fat diet (Figures 6a, 6e). Comparison with the corresponding C-peptide data indicates that two independent effects contributed to this augmentation in PKCs

"

' mice (Figure 6b). Firstly, there was 25 a diminished capacity to clear insulin which was independent of diet, since insulin, but not C-peptide, was increased in chow-fed PKCs / mice. Secondly, ablation of PKCs enhanced secretory capacity specifically in the animals maintained on the fat diet, as witnessed by C-peptide levels (Figure 6b), These results were broadly confirmed in animals fed the longer-term saturated fat diet (Figure 6d), although under these 30 conditions wild type mice exhibited both higher insulin and C-peptide levels compared to chow-fed controls at the commencement of the glucose tolerance test, which did not increase further over the ensuing time course (Figures 6c, 6d). In contrast, both plasma insulin (Figure 6c) and C-peptide levels (Figure 6d) were robustly increased following the glucose challenge in fat-fed PKC

/

' mice despite, in the case of C-peptide, starting 35 from a lower baseline (Figure 6d).

WO 2005/025602 PCT/AU2004/001255 71 Enhanced secretory responsiveness was not simply a function of alterations in islet size (Figure 6e). Indeed, fat-fed wild type mice showed islet hyperplasia as previously seen in insulin resistant models, but this was normalised by deletion of PKC& in keeping with the restoration of glucose tolerance. In pancreatic sections from chow-fed mice, 5 islet area was found to be independent of PKC expression. Taken together, the above experiments demonstrate that deletion of PKCs facilitates a compensatory enhancement of insulin secretion specifically in mica maintained on either of the high-fat diets. Moreover, insulin clearance is diminished in the PKCs 10 mice irrespective of diet. Effect offat diets oiz peripheral tissue insulin action in wild type and PKC "" mice While the above data indicate that increased availability of insulin might contribute to the improvement in glucose tolerance observed in PKCC mice, they do not exclude an 15 independent effect on insulin sensitivity. The inventors therefore investigated this more directly using intraperitoneal insulin tolerance tests. Although, as expected, wild type mice maintained on the saturated fat diet were unable to reduce blood glucose levels to the same concentration as chow-fed mice in response to insulin (Figure 7a), PKCe deletion did not overcome this defect. 20 The inventors examrnined insulin action more closely in skeletal muscle using isolated soleus muscle preparations. The saturated fat diet reduced sub-maximal insulin stimulated glucose uptake by soleus muscle, but once again this was not reversed by PKCs deletion (Figure 7b). 25 To determine whether these negative findings were dependent on the type of fat diet employed, the inventors carried out the same experiments using unsaturated fat-fed mice. This diet, however, did not give rise to significant differences in either whole body insulin tolerance or in sub-maximal insulin-stimulated glucose uptake by isolated 30 solcus muscle (not shown). The inventors therefore re-investigated glucose disposal in these animals using radiolabeled glucose tracers to determine glucose clearance by selected tissues. In this manner the inventors now observed skeletal muscle insulin resistance during an insulin tolerance test in response to 'unsaturated fat-feeding, but this was again not reversed by PKCs deletion (Figure 7c). In contrast, when the 35 inventors measured glucose clearance by muscle during a glucose tolerance test, the inventors observed improved glucose uptake (Figure 74) and conversion into glycogen WO 2005/025602 PCT/AU2004/001255 72 (Figure 7e) by PKC&

"

' mice compared to wild type mice, highly consistent with the improved blood glucose profiles observed under these conditions (Figure 2a). Taken in their entirety these data strongly suggest that the improved glucose tolerance 5 displayed by fat-fed PKCs

"

- mice is due to an enhanced availability of insulin in the peripheral circulation, rather than an increase in insulin sensitivity per se. Consistent with that conclusion the inventors also observed similar effects of diet and genotype on glucose clearance by white adipose tissue but not liver (Figure 8a-8d). The 10 contribution of liver to whole body glucose clearance, however, was relatively low when compared to muscle, when the total mass of each tissue was taken into account. Furthermore, while the inventors do not exclude an effect of PKCe deletion on hepatic glucose production in these animals, the inventors did not observe alterations in liver 15 mRNA levels of the gluconeogenic enzymes phosphoenolpyruvate carboxykldnase or fructose-l1,6-bisphosphatase, or protein levels of fiuctose-l1,6-bisphosphatase (not shown). In addition, isolated hepatocytes from PKCE

"

'

/" mice, pretreated with unsaturated fatty 20 acids and insulin, did not exhibit diminished glucose or glycogen production from lactate compared to cells from wild type mice (not shown). Discussion The inventors compared the effects of two dietary models of insulin resistance on wild 25 type and PKCC

"

" mice. This PKC isoform undergoes translocation, but not down regulation, in several models of chronic insulin resistance. The inventors were unable to demonstrate any attenuation of insulin resistance by deletion of PKCs as determined by whole body tracer studies, measurements of insulin 30 tolerance, or ex vivo analysis of glucose uptake in skeletal muscle. These negative results were explained neither by a failure of the diets to cause muscle insulin resistance or PKCe activation, nor by compensatory increases in expression of other PKC isoforms. 35 Although chow-fed PKCC

"

? mice secrete similar amounts of C-peptide to wild type mice during a glucose tolerance test, they display considerably higher levels of WO 2005/025602 PCT/AU2004/001255 73 circulating insulin under these conditions. Measurement of insulin uptake by isolated hepatocytes confirmed that PKCE deletion in these cells inhibits insulin internalisation. The approximately 30% inhibition observed in the rate of insulin uptake by PKCZ "" hepatocytes is likely to have a major influence on whole-body insulin clearance 5 because of the direct circulatory link between pancreas and liver. Indeed, approximately 50% of secreted insulin is normally extracted by the liver during the first pass via the hepatic portal vein. The reduced clearance is therefore probably sufficient to explain the higher insulin levels of chow-fed PKCs " mice, both when fasted and during the glucose tolerance test. 10 Very little is known of the molecular mechanisms involved in regulating hepatic insulin clearance, although recent work suggests a role for the cell adhesion protein CAECAM-1 in mediating endocytosis of the IR. Insulin clearance is diminished in L SACCI transgenic mice, which overexpress a dominant negative form of CEACAM-1 15 in liver and L-SACC1 hepatocytes exhibit a greater than 50% reduction in insulin internalization. However a direct interaction between PKCE and CEACAM-1 is unlikely since the defective insulin clearance of L-SACCI mice is much more pronounced than that demonstrated here, and probably accounts for the increased body weight, secondary insulin resistance and altered fat metabolism displayed by those 20 animals. Moreover CEACAM-1I appears to play an additional role in the regulation of insulin signaling through IRS-1 and Shc. The inventors did not, however, observe any defect in downstream signaling in hepatocytes from PKCs

"

' mice, which is perhaps surpris-ing given evidence that IR internalization is implicated in the activation of MAPK following insulin binding. Presumably there is sufficient residual internalisation 25 of IRs in PKCsa' mice to maintain MAPK signaling. The inventors did not observe PKCs co-precipitation with the IR in hepatocytes from wild type mice (not shown). It is therefore likely that PKCc modulates IR internalization in the absence of a direct association. Because the inventors observed 30 only partial inhibition of insulin internalisation in PKCe / mice, the role of this PKC isoform is most probably indirect, potentially mediated through alterations in cytoskeletal remodelling or vesicular trafficking, processes which are both known to be modulated by PKCs. 35 The second novel site of PKCs action described here is at the level of insulin secretion. This was most apparent using the saturated fat diet which induced defects in insulin and WO 2005/025602 PCT/AU2004/001255 74 C-peptide secretion in wild type animals during the glucose tolerance test that were reminiscent of those seen in Type 2 diabetic subjects: an enhanced fasting secretion, which was barely increased in response to the glucose load. Deletion of PKCs lowered fasting C-peptide levels under these conditions, and facilitated a robust secretory 5 response to glucose much greater than that seen in either chow-fed animals, or fat-fed wild type mice. The protection due to PKCe deletion appears to be mediated directly at the level of the P3-cell since the analogous secretory defects, generated by chronic exposure of isolated islets to elevated fatty acids, were only observed in islets from wild type but not PKC -/- mice. 10 The identification of PKC as a single molecular target in both development of elevated basal secretion, and loss of responsiveness to glucose, is unprecedented. This suggests that PKCs activation is involved at a very early stage in the sequence by which fatty acids exert their pleiotropic effects, and most probably regulates a cohort of genes 15 whose altered expression potentially underlies the onset of secretory dysfunction. Down regulation of global PKC expression has previously been shown to modulate expression of some candidate genes in P-cells exposed to lipid. On the other hand the inventors results do not support a requirement for PKCs during glucose-stimulated secretion, as witnessed by the similar.excursions in C-peptide levels seen in chow-fed 20 wild type versus PKCe " / mice during the glucose tolerance tests, and demonstrated more directly ex vive using islets isolated from these animals. Although previous studies suggest PKCt may be activated during nutrient-stimulated insulin release, the inventors findings suggest that this activation is not essential for the secretory response. As with skeletal muscle insulin resistance, failure to observe a role for PKCs 25 in glucose-stimulated secretion was not due to a compensatory up-regulation of other PKC isofouns in islets of the PKCE" mice (not shown), The findings presented here have important implications for the treatment of Type 2 diabetes, since development of specific PKC inhibitors may exert beneficial (possibly 30 synergistic) effects at the level of both liver and pancreas. Current therapeutics are targeted principally to separate tissues and act as muscle insulin sensitisers (thiazolidinediones), suppressors of hepatic glucose output (biguanides) or stimldators of insulin secretion (sulfonylureas). In particular the inventors results highlight a rationale for regulating hepatic insulin clearance as a therapy for insulin resistance and 35 diabetes. In this regard it is probably fortuitous that PKCs appears to play a modulatory, rather than essential, role in IR internalisatiorn, and that the 30% decrease WO 2005/025602 PCT/AU2004/001255 75 in IR uptake that the inventors observed in hepatocytes of PKC s / mice is insufficient to alter IR signaling in liver. The inventors results also raise the novel possibility of therapeutic intervention at the level of the P3-cell, not simply by directly stimulating insulin release, but by specifically counteracting the two major secretory defects 5 observed in Type 2 diabetic subjects. Moreover, the inventors definition of novel pancreatic and hepatic sites of action of PKCs opens up new avenues for further investigating the contribution of these two tissues to the progression of Type 2 diabetes, and for elucidation of the underlying molecular events. 10 Example 6 Insulin uptake and signaling by primary cultured hepatocytes Methods Isolation ofprimnary hepatocytes. The inventors infused livers firstly with 0.5 mM EDTA in Hank's solution 15 (GibcoBRL), then with 80 ptg/ml collagenase (Serva) and 4 mM CaC] 2 in EMEM (Trace). The inventors debrided livers into 40 g/ml collagenase in L-15 medium, and digested further for 3-8 min. The inventors filtered the cells and washed 3 times with L 15 medium. Cells were finally resuspended in RPMI 1640 medium (Gibco) containing 10% FCS (Trace Biosciences) and 50 pM 2-mercaptoethanol. The inventors seeded 20 cells at 3 x 105 cells/well of a six-well tissue culture plate (Falcon). Insulin internalisation assay. Insulin was prepared by radiolabeling insulin (Roche) with Nal 25 by the lodogen method (Pierce). The inventors cultured primary hepatocytes for 20 h after seeding, 25 prior to insulin binding (30 pM) on ice for 4 h in serum-free RPMI/0.2% BSA. The inventors washed the cells in PBS/0.2% BSA then incubated them at 37 0 C for 0-15 min in RPMI/0.2% BSA before washing in 0.2% BSA-PBS (pH 3) and PBS (pH 7.4) and lysing with 1 M KOH. The inventors counted the acid wash as surface-bound, non intemalised insulin and KOH-solubilised cells as internalised cell-associated ligand. ao The inventors calculated internalised insulin as percent cell-associated per specifically bound ligand (the sum of surface-bound plus cell-associated ligand). Analysis of insulin signaling. The inventors cultured primary hepatocytes for 20 h prior to incubation in serum free 35 RPMI 1640 for 6 h. The inventors stimulated cells with 10 nM insulin and WO 2005/025602 PCT/AU2004/001255 76 immnunoblotted lysates for phosphorylated and total levels of insulin signaling components. Statistical analysis. 5 The inventors analysed results by Student's t-test or ANOVA using Statview 4.5 for Macintosh (Abacus Concepts). Results are expressed d standard error, and differences were considered to be statistically significant at P < 0.05. Results 10 Because of the surprising indications that specific alterations in liver and pancreatic j cells, rather than skeletal muscle, appeared to account for the improved glucose tolerance seen in PKCs'" mice, the inventors therefore examined these tissues in more detail. Firstly the inventors measured insulin internalisation by primary hepatocytes and observed a 30% reduction in the initial rate of insulin uptake by cells from PKCs " / 15 versus wild type mice (Figure 9). These differences could not be explained by alterations in insulin receptor (IR) levels, measured either in liver extracts or in lysates from primary cultured hepatocytes (Figures 10a and I Ia). In addition, the inventors found no change in the affinity of the IR for insulin measured by insulin binding to intact hepatocytes at 4 0 C (insulin ICs 5 0 = 1.23 _- 0.3 nM (wild type) and 1.33 + 0,3 nM 20 (PKCs

"

') in 3 experiments). Furthermore, the inventors also found no significant difference between wild type and PKCs "" cells in the activation of insulin signaling components over a range of insulin doses and time points (Figure 10b and Figures 1 Ilb lId), 25 These data suggest that while reduced insulin uptake by PKCse / hepatocytes could explain the elevated insulin levels of chow-fed PKCs "" mice, the this was not accompanied by diminished insulin signaling. Data presented in Figure 9 also indicate that insulin uptake into primary hepatocytes 30 was approximately linear for at least about 5-7.5 mains.

WO 2005/025602 PCT/AU2004/001255 77 Example 7 Insulin secretion in isolated pancreatic islets Methods Measurement ofglucose-stimulated insulin secretion in pancreatic islets. 5 The inventors isolated mouse islets by ductal perfusion of pancreata with collagenase and separation on a Ficoll gradient. The inventors cultured islets for 48 h in RPMI 1640 supplemented with either BSA alone or BSA coupled to palmitate. The inventors picked islets in groups of 15 for batch incubations, firstly preincubating them for 30 min in 2.8 mM glucose KRB, and then in KRB containing 2.8 mM or 16.7 mM glucose 10 for 1 h. The inventors then determined insulin secreted into the KRB by RIA (Linco). Statistical analysis. The inventors analysed results by Student's t-test or ANOVA using Statview 4.5 for Macintosh (Abacus Concepts). Results are expressed I standard error, and differences 15 were considered to be statistically significant at P < 0.05. Results Because the additional elevation of serum insulin levels observed in fat-fed PKCS "" mice correlated with increased C-peptide concentrations, it was likely that this involved 20 enhanced insulin secretion from pancreatic O-cells. To investigate this further, the inventors examined glucose-stimulated insulin secretion from pancreatic islets, isolated from wild type and PKCc' mice and then cultured for 48h in absence or presence of the saturated fatty acid palmitate. As well-documented, chronic exposure of wild type islets to fatty acid resulted in both an enhanced basal secretion and a diminished 25 response to high glucose, such that a statistically significant difference between the two acute treatment conditions was no longer observed (Figure 12). In contrast, glucose. stimulated insulin secretion was essentially normal in palmitate-cultured islets isolated from PKC

"

' mice. These in vitro results are entirely consistent with the C-peptide data from mice fed the saturated fat diet, in which deletion of PKCs resulted in a decrease in 30 fasting levels, and enhanced response during the glucose tolerance test (Figure 6d). The data from isolated hepatocytes and islets (Figures 9 and 12) therefore confirm that loss of PKC activity exerts two distinct effects on liver and pancreas which, together, enhance insulin levels in the peripheral circulation and thus help maintain glucose tolerance. 35 WO 2005/025602 PCT/AU2004/001255 78 Example 8 Inhibition of PKCs in pancreatic 13-islet cells by expression of the dominant negative mutant PKCs K437R MIN6 cells were passaged in 75 cm flasks with 20 ml of DMEM containing 25 mM 5 glucose, 24 mM NaHCO3, 10 maM Hepes, 10% (v/v) fetal calf serum, 50 lU/m1 penicillin and 50 pg/ml streptomycin. Cells were seeded at 3 x 10 5 /well in 0.5 rrml in a 24 well dish for secretory experiments. At 48h prior to the experiment (24h after seeding), the medium was replaced with DMEM (as above but with 6mM glucose) and supplemented with ither bovine serum albumin (BSA) alone or BSA coupled to 10 palmitate or oleate. Included in this medium was 100 plaque-forming units recombinant adenovirus expressing either green fluorescent protein alone (control) or green fluorescent protein as well as either PKCE wild-type (SEQ ID NO: 2 or 4) or a kinase dead PKCs (SEQ ID NO: 15). The latter was generated by the K437R mutation in the ATP-binding site of PKCE. All recombinant adenovirus were generated using the 15 pAdEasy system. For FA coupling, 18.4% BSA was dissolved in DMEM (25mM glucose) by gentle agitation at room temperature for 3h. Palrlmitate or oleate (8mM) were then added as Na salts, and the mixture agitated overnight at 370C. The pH was then adjusted to 7.4, 20 and after sterile filtering. FA concentrations were verified using a commercial kit and aliquots were stored at -200C. Similar couplings were made using glucose-free modified Krebs-Ringer bicarbonate (KRB) buffer containing 5 mM NaHCO3, 1 mM CaCI2, 0.5% (w/v) BSA, and 10 rM 25 Hepes (pH 7.4) instead of DMEM. This procedure generated BSA-coupled PA in molar ratio of 3:1 (generally 0.4rmM:0.92% BSA final). 30 Cultured cells were washed once in modified KRB buffer containing 2.8 mrM glucose, and then preincubated for a further 30 min in 0.5 ml of the same medium at 37 0 C. This was then replaced with 0.5 mrl of prewarmed KRB containing other additions as indicated, for a further 60 min at 370C. An aliquot was then removed for analysis of insulin content by radioimmunoassay. The cell monolayers were washed twice in PBS, 35 and then extracted for measurement of total insulin content by lysis in 0.5rin H 2 0/well followed by sonication.

WO 2005/025602 PCT/AU2004/001255 79 Results are confirmed in whole animals expressing the K437R mutant in the islet cells, in a variety of genetic backgrounds. Transgenic animals expressing the K437R mutant are produced as described herein above, using the insulin or pdx-1 promoter to confer s islet-cell expression, and introduced into a variety of diabetic model backgrounds as described in Examples 1-4. Example 9 nhibition of PKCs by peptide antagonists 10 The peptide EAVSLKPT (sV1-2) (SEQ ID NO: 7) corresponding to residues in the variable region of PKC is conjugated to the penetratin heptapeptide to form the bioactive peptide RRMKWKKEAVSLKPT for delivery to intact cells eg., in screening assays or for treatment. 15 Another inhibitory peptide that the inventors have employed is that corresponding to pseudo substrate region (149-164) of PKCs namely ERMRPRKRQGAVRRRV (SEQ ID NO: 13) which was myristolylated at the N-terminus to facilitate cell entry (myrPSPs). 20 For determining liver-specific effects the human hepatomna cell line Huh7, or primary mouse or rat hepatocytes is used. Control cells and those pretreated with PKCs inhibitory peptides are stimulated with insulin or an analogue thereof and activity of the insulin receptor monitored. 25 For P3-cell effects the urine cell line MIN6, or isolated mouse or rat pancreatic islets, are used. Experiments are conducted using cells pretreated with 0.4mM oleate coupled to BSA, or BSA alone as negative control. The chronic effect of the PKC inhibitory peptides to overcome the ablation of glucose-stimulated insulin secretion due to oleate pre-treatmeut is determined. 30 Example 10 Effects of conditional knockout of PKCs expression Reduced PKCc expression in the liver and/or pancreatic islet cells in one or more of the lines produced as described in Examples 1-4 restores insulin sensitivity and protects 35 pancreatic 3-islet cells against the effects of a high fat diet.

Claims (93)

1. A method of determining an antagonist of a protein ki-nase C epsilon (PKCe) for the treatment of abnormal glucose metabolism in a human or animal subject said method comprising: 5 (i) incubating a hepatocyte in the presence and absence of a candidate compound; (ii) stimulating the hepatocytes at (i) with insulin or analogue thereof; and (iii) determining the rate of internalization of the insulin receptor in the insulin stimulated hepatocytes wherein reduced insulin receptor internalization in the presence of the candidate compound compared to in the absence of the candidate compound 10 indicates that the compound is an antagonist of PKCe,.

2. The method of claim 1 wherein the hepatocyte is from a wild type animal having a functional PKCz enzyme. 15

3. The method of claim 1 wherein the hepatocyte is from a non-human animal engineered to express an introduced non-endogenous PKC& gene of humans.

4. The method of claim 3 wherein the non-human animal is engineered to have reduced or no detectable endogenous PKCs 20

5. The method according to claim 1 wherein the hepatocyte is a human hepatoma cell line, a primary hepatocyte or immortalized hepatocyte.

6. The method of claim 5 wherein the hepatoma cell line is HepG2 (ATCC 25 Accession No. 1HB-8065) or Huh7.

7. The method of claim 5 wherein the hepatocyte is a primary hepatocyte.

S. The method of claim I wherein insulin receptor internalization is measured by 30 determining the uptake of labeled insulin or analogue thereof into ceils and wherein reduced uptake of said labeled insulin or insulin analogue indicates that the compound is an antagonist of PKCE.

9. The method of claim 1 wherein insulin receptor internalization is measured by a 35 process comprising determniining a change in signal produced by a pH sensitive tag in thbe alpha subunit of the insulin receptor relative to the signal produced by a tag in a WO 2005/025602 PCT/AU2004/001255 81 cytoplasmic domain of the beta subunit of the insulin receptor by virtue of a change in pH of the alpha subunit on internalization.

10. The method of claim 9 wherein the pH sensitive tag is pHluorin. 5

11. The method of claim 9 wherein tag in a cytoplasmic domain of the beta subunit of the insulin receptor is selected from the group consisting of FLAG epitope, yellow fluorescent protein, green fluorescent protein and red fluorescent protein. 10

12. The metod of claim 9 wherein the pH sensitive tag is positioned at the N terminus of the alpha subunit of the insulin receptor.

13. The method of claim 9 wherien the tag in a cytoplasmic domain of the beta subunit of the insulin receptor is at the C-terminus of the beta subunit of the insulin 15 receptor.

14. The method of claim 9 wherein the insulin receptor is an in-frame fusion protein with the pH sensitive tag and the.tag in a cytoplasmic domain of the beta subunit of the insulin receptor. 20

15. The method of claim 14 further comprising expressing the in-frame fusion protein in the hepatocyte.

16. The method of claim 15 further comprising introducing nucleic acid encoding 25 the in-frame fusion protein into the hepatocyte.

17. The method of claim 1 wherein internalization of the insulin receptor is determined by a process comprising incubating hepatocytes in the presence of insulin, biotinylating surface proteins of the hepatocytes, and determining the total amount of 30 insulin receptor in the hepatocytes.

18. The method according to any one of claims 1 to 17 wherein uptake of insulin is determined as a percentage of total cell-associated insulin or analogue thereof. WO 2005/025602 PCT/AU2004/001255 82

19. The method of claim 1 wherein insulin receptor internalization is determined by labelling the insulin receptor with a fluorescent tag and determining the amount of tag internalized. 5

20. The method of claim 1 further comprising incubating the hepatocyte in the presence of a compound that inhibits or reduces the efflux of insulin or analogue thereof.

21. The method of claim 20 wherein the compound is chloroquinone or 10 bafilomycin.

22. The method of claim 1 further comprising (i) optionally, determining the structure of the compound; and (ii) providing the compound or the name or structure of the compound such as, for 15 example, in a paper form, machine-readable form, or computer-readable form.

23. The method of claim 1 further comprising: (i) optionally, detennrmining the structure of the compound; (ii) optionally, providing the name or structure of the compound such as, for 20 example, in a paper form, machine-readable form, or computer-readable form; and (iii) providing the compound.

24. A method of determining an antagonist of a protein kinase C epsilon (PKCs) for the treatment of abnormal glucose metabolism in a human or animal subject said 25 method comprising: (i) incubating a pancreatic 3-islet cell with an amount of a lipid or free fatty acid (FFA) and/or glucose; (ii) incubating the cell at (i) in the presence and absence of a candidate compound; and 30 (iii) determining the level of insulin secretion by the cell wherein enhanced insulin secretion in the presence of the candidate compound compared to in the absence of the compound indicates that the compound is an antagonist of PKCE.

25. The method of claim 1 wherein the islet cell is from a wild type animal having a 35 functional PKCs enzyme. WO 2005/025602 PCT/AU2004/001255 83

26. The emthod of claim 24 wherein the islet cells are from a diabetic mouse and the islet cells are incubated in the absence of lipid or FFA.

27. The method of claim 26 wherein the diabetic mouse is a db/db mouse. 5

28. The method of claim 24 wherein the islet cell is from a non-human animal engineered to express an introduced non-endogenous PKCs gene of humans.

29. The method of claim 28 wherein the non-human animal is engineered to have 10 reduced or no detectable endogenous PKCs

30. The method of claim 24 wherein the cells are pre-treated with FFA for a time and under conditions sufficient to increase in basal insulin secretion and inhibit glucose stimulated insulin secretion. 15

31. The method of claim 30 wherein the amount of FFA and/or glucose is sufficient to reduce or ablate glucose-stimulated insulin secretion by the cell in the absence of the compound being tested. 20

32. The method of claim 24 wherein the lipid or FFA is selected from the group consisting of palmitic acid, oleic acid, linoleic acid, myristic acid, lauric acid, pentadecanoic acid, stearic acid, and linolenic acid.

33. The method of claim 32 wherein the lipid or FFA is palmitic acid. 25

34. The method of claim 24 wherein the islet cell is a cultured murine MIN6 cell, a primary pancreatic islet cell or immortalized pancreatic cell line.

35. The method of claim 24 wherein the insulin secretion determined is glucose 30 stimulated insulin secretion.

36. The method of claim 24 wherein insulin secretion is determined by immunoassay using antibodies against insulin. 35

37. The method of claim 24 wherein insulin secretion is determined by reverse hemolytic plaque assay. WO 2005/025602 PCT/AU2004/001255 84

38. The method of claim 24 further comprising incubating the islet cell in the presence of a compound that potentiates glucose-stimulated insulin secretion. 5

39. The method of claim 38 wherein the compound potentiates glucose-stimulated insulin secretion in cells having low PKCs activity.

40. The method of claim 38 wherein the compound is a muscarinic acid receptor agonist. 10

41. The method of claim 40 wherein the muscarinic acid receptor agonist is selected from the group consisting of acetylcholine, a non-hydrolyzable analog of acetylcholine, arecoline, oxotremorine, pilocarpine and mixtures thereof. 15

42. The method of claim 41 wherein the a non-hydrolyzable analog of acetylcholine is carbamylcholine.

43. The method of claim 38 wherein the compound is an inhibitor of PI 3-kinase activity. 20

44. The method of claim 43 wherein the compound is selected from the group consisting of wortmannin, rosiglitazone, LY294002 and mixtures thereof.

45. The method of claim 38 wherein the compound is glyburide. 25

46. The method of claim 24 further comprising incubating the islet cell in the presence of a compound that potentiates glucose-independent insulin secretion.

47. The method of claim 46 wherein the compound is IBMX or forskolin or 30 mixtures thereof.

48. The method of claim 24 further comprising (i) optionally, determining the structure of the compound; and (ii) providing the compound or the name or structure of the compound such as, for 35 example, in a paper form, machine-readable form, or computer-readable form. WO 2005/025602 PCT/AU2004/001255 85

49. The method of claim 24 further comprising: (i) optionally, determining the structure of the compound; (ii) optionally, providing the name or structure of the compound such as, for example, in a paper form, machine-readable form, or computer-readable form; and 5 (iii) providing the compound.

50. A method of determining an antagonist of a protein kinase C epsilon (PKCs) for the treatment of abnormal glucose metabolism in a human or animal subject said method comprising providing a candidate compound to an animal having normal PKCs 10 expression, providing a diet high in saturated and/or unsaturated fats to the animal and determining the level of one or more indicators of glucose homeostasis for the animal wherein a modified level(s) indicates that the compound is an antagonist or inhibitor of PKCs. 15

51. The method of claim 50 wherein a modified level of one or more indicators of glucose homeostatis is determined by comparing the level of one or more indicators of glucose homeostasis to the level of the indicator(s) in a wild type or PKCS " ' / or PKCse " control animal maintained on a chow diet or other diet low in fat, wherein a trend toward the level observed for the control animal indicates modified glucose 20 homeostasis.

52. The method of claim 52 wherein an indicator of glucose homeostasis is selected from the group consisting of blood glucose, serum insulin, serum C peptide and combinations thereof. 25

53. The method of claim 52 wherein the compound decreases serum glucose and/or increases serum insulin and/or increases serum C-peptide in the animal.

54. The method of claim 50 wherein an amount of the compound is provided to the 30 animal before placing the animal on a high fat diet.

55. The method of claim 50 wherein the compound is provided to the animal at the same time as placing the animal on a high fat diet or after placing the animal on a high fat diet. 35 WO 2005/025602 PCT/AU2004/001255 86

56. The method of claim 50 further comprising determining the ability of the compound to mimic a phenotype of a PKCs~/ or PKC "/- mouse.

57. The method of claim 50 further comprising: 5 (i) optionally, determining the structure of the compound; and (ii) providing the compound or the name or structure of the compound such as, for example, in a paper form, machine-readable form, or computer-readable form.

58. The method of claim 50 further comprising: 10 (i) optionally, determining the structure of the compound; (ii) optionally, providing the name or structure of the compound such as, for example, in a paper form, machine-readable form, or computer-readable form; and (iii) providing the compound. 15

59. The method according to any one of claims 1 to 58 further comprising determining the ability of the compound to modulate activation, intracellular translocation, catalytic activity or kinase activity of PKCs.

60. A process for determining an antagonist of a protein kinase C epsilon (PKCs) 20 for the treatment of abnormal glucose metabolism in a human or animal subject said process comprising: (i) identifying a lead compound in a primary screen comprising incubating a hepatocyte in the presence and absence of a candidate compound, stimulating the hepatocytes at with insulin; and determining the rate of internalization of the insulin 25 receptor in the insulin-stimulated hepatocytes wherein reduced insulin receptor internalization in the presence of the candidate compound compared to in the absence of the candidate compound indicates that the compound is a lead compound; and (ii) incubating a pancreatic (3-islet cell with an amount of a lipid or free fatty acid (FFA) and/or in the presence of an amount of glucose, incubating the cell in the 30 presence and absence of the lead compound and determining the level of glucose stimulated insulin secretion by the cell wherein enhanced insulin secretion in the presence of the candidate compound compared to in the absence of the compound indicates that the compound is an antagonist of PKCs. 35

61. The process of claim 60 further comprising providing the antagonist compound identified at (ii) to an animal having normal PKCs expression, providing a diet high in WO 2005/025602 PCT/AU2004/001255 87 saturated and/or unsaturated fats to the animal and determining the level of one or more indicators of glucose homeostasis for the animal wherein a modified level(s) indicates that the compound is an antagonist or inhibitor of PKCs in vivo. 5

62. A process for determining an antagonist of a protein kinase C epsilon (PKCs) for the treatment of abnormal glucose metabolism in a human or animal subject said process comprising: (i) identifying a lead compound in a primary screen comprising incubating a pancreatic P3-islet cell with an amount of a lipid or free fatty acid (FFA) and/or in the 10 presence of an amount of glucose, incubating the cell in the presence and absence of a candidate compound and determining the level of glucose-stimulated insulin secretion by the cell wherein enhanced insulin secretion in the presence of the candidate compound compared to in the absence of the compound indicates that the compound is a lead compound; and 15 (ii) incubating a hepatocyte in the presence and absence of the lead compound, stimulating the hepatocytes at with insulin; and determining the rate of internalization of the insulin receptor in the insulin-stimulated hepatocytes wherein reduced insulin receptor internalization in the presence of the lead compound compared to in the absence of the lead compound indicates that the compound is an antagonist of PKCs. 20

63. The process of claim 62 further comprising providing the antagonist compound identified at (ii) to an animal having normal PKCs expression, providing a diet high in saturated and/or unsaturated fats to the animal and determining the level of one or more indicators of glucose homeostasis for the animal wherein a modified level(s) indicates 25 that the compound is an antagonist or inhibitor of PKCe in vivo.

64. A method for determining a compound that specifically antagonizes a protein kinase C epsilon (PKCs) in a hepatocyte comprising: (i) incubating a hepatocyte and an insulin-responsive cell other than a hepatocyte in 30 the presence and absence of a candidate compound; (ii) stimulating the hepatocyte and the other insulin-responsive cell at (i) with insulin; and (iii) determining the rate of internalization of the insulin receptor in the insulin stimulated hepatocytes wherein reduced insulin receptor internalization in the presence 35 of the candidate compound compared to in the absence of the candidate compound in WO 2005/025602 PCT/AU2004/001255 88 the hepatocyte but not in the other insulin-responsive cell indicates that the compound specifically antagonizes a PKCc in a hepatocyte.

65. A method of determining a compound that specifically antagonizes a protein 5 kinase C epsilon (PKCs) in a pancreatic P-islet cell comprising: (i) incubating a pancreatic P-islet cell and an insulin-responsive cell other than a pancreatic P-islet cell with an amount of a lipid or free fatty acid (FFA) and/or glucose; (ii) incubating the cells at (i) in the presence and absence of a candidate compound; and 10 (iii) determining the level of glucose-stimulated insulin secretion by the cells wherein enhanced insulin secretion in the presence of the candidate compound compared to in the absence of the compound in the pancreatic J3-islet cell but not in the other insulin-responsive cell indicates that the compound that the compound specifically antagonizes a PKCs in a pancreatic P-islet cell. 15

66. The method of claim 64 or 65 wherein the other insulin responsive cell is a muscle cell or an adipocyte.

67. The method or process according to any one of claims 1 to 66 further 20 comprising testing the compound for its ability to inhibit the activity of a recombinant PKCs protein or bind to a recombinant PKCc protein in a cell that has been transfected with nucleic acid encoding the PKCs protein.

68. The method or process according to any one of claims 1 to 67 wherein the 25 compound is a polypeptide.

69. The method or process according to any one of claims 1 to 67 wherein the compound is an oligonucleotide. 30

70. The method or process according to any one of claims 1 to 67 wherein the compound is a small molecule.

71. A method of treatment of an abnormality of glucose metabolism in an animal subject comprising administering to the subject an amount of an antagonist of a protein 35 kinase C epsilon (PKCc) for a time and under conditions sufficient to reduce the level WO 2005/025602 PCT/AU2004/001255 89 and/or activity of the enzyme in the liver of the subject thereby reducing insulin clearance by the liver.

72. A method of treatment of an abnormality of glucose metabolism in an animal 5 subject comprising administering to the subject an amount of an antagonist of a protein kinase C epsilon (PKCs) for a time and under conditions sufficient to enhance insulin secretion by the pancreas.

73. The method of claim 71 or 72 wherein the subject is a human in need of 10 treatment thereof.

74. The method of claim 73 wherein the subject suffers from a condition selected from the group consisting of Type 2 diabetes, hyperglycaemia, hyperinsulinemia, insulin resistance, glucose intolerance and combinations thereof. 15

75. The method according to claim 71 or 72 wherein the antagonist comprises a polypeptide comprising a sequence selected from the group consisting of SEQ ID Nos: 6-12, SEQ ID NO: 15 and mixtures thereof. 20

76. The method of claim 71 or 72 wherein the polypeptide comprises a dominant negative mutant of PKCs.

77. The method of claim 75 or 76 wherein the polypeptide is myristolylated at the N-terminus to facilitate cell entry. 25

78. The method according to claim 71 or 72 wherein the antagonist comprises nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID Nos: 16-27 and mixtures thereof. 30

79. The method of claim 78 wherein the antagonist is targeted to the liver of the subject.

80. The method of claim 79 wherein targeting is achieved by expressing the antagonist in an expression vector capable of binding to a receptor on a liver cell that 35 mediates endocytosis of the vector. WO 2005/025602 PCT/AU2004/001255 90

81. The method of claim 80 wherein the expression vector is a replication-defective hepadnavirus or an adenovirus vector.

82. The method of claim 80 wherein the antagonist is expressed in a liver cell 5 operably under the control of a promoter selected from the group consisting of human phenylalanine hydroxylase gene promoter, transthyretin promoter, serum albumin gene promoter, cytochrome P450 2B gene promoter, apolipoprotein A-1 gene promoter, phosphoenolpyruvate carboxykinase gene promoter, ornithine transcarbamylase gene promoter, UDP-glucuronosyltransferase gene promoter and hepatocyte nuclear factor 4 10 gene promoter.

83. The method of claim 72 wherein the antagonist is targeted to the pancreas of the subject. 15

84. The method of claim 83 wherein the antagonist is expressed in a pancreatic cell operably under the control of a promoter selected from the group consisting of insulin promoter and pdx-1 promoter/enhancer.

85. Use of a. vector capable of expressing a polypeptide antagonist or 20 oligonucleotide antagonist of a protein kinase C epsilon (PKCs) in a format suitable for introduction into a hepatocyte or pancreatic 13-islet cell and expression therein in medicine.

86. Use of an isolated hepatocyte or pancreatic 3-islet cell comprising introduced 25 nucleic acid encoding a polypeptide antagonist or oligonucleotide antagonist of PKCe in medicine.

87. The method or process according to any one of claims 1 to 70 wherein the antagonist of PKCs mimics a phenotype in the liver and/or pancreas of an animal 30 having reduced PKCs activity by virtue of the endogenous PKCs gene of said animal being deleted or inactivated by mutation.

88. Use of a non-human transformed animal having having reduced PKCs activity by virtue of the endogenous PKCE gene of said animal being deleted or inactivated by 35 mutation in the determinaton of glucose homeostasis in the animal. WO 2005/025602 PCT/AU2004/001255 91

89. Use of a hepatocyte or pancreatic islet cell from a non-human transformed animal having having reduced PKCs activity by virtue of the endogenous PKCs gene of said animal being deleted or inactivated by mutation for the determinaton of insulin receptor internalization, insulin uptake or glucose-stimulated insulin secretion by the 5 hepatocyte or pancreatic islet cell.

90. A non-human transformed animal having having reduced endogenous PKCs activity by virtue of the endogenous PKCs gene of said animal being deleted or inactivated by mutation and comprising an introduced PKCc gene of humans. 10

91. A progeny animal of the non-human transformed animal of claim 90 wherein saiud progeny animal comprises the introduced PKCs gene of humans.

92. An isolated cell from the non-human transformed animal of claim 90. 15

93. The isolated cel of claim 92 consisting of a hepatocyte or pancreatic islet cell.