AU2004228983A1 - Identification of Streptococcus pneumoniae serotypes - Google Patents

Description

WO 2004/090159 PCT/AU2004/000480 1 IDENTIFICATION OF STREPTOCOCCUS PNEUMONL4E SEROTYPES FIELD OF THE INVENTION The present invention relates to molecular methods of serotyping Streptococcus 5 pneumoniae, as well as polynucleotides useful in such methods. BACKGROUND OF THE INVENTION Streptococcus pneumoniae is a leading cause of morbidity and mortality causing invasive disease such as meningitis and pneumonia as well as more localised disease 10 such as acute otitis media and sinusitis. Polysaccharide and protein-conjugate pneumococcal vaccines have the potential to prevent a significant proportion of cases. Effective protein-conjugate vaccines are particularly important because of the dramatic increase in prevalence and international dissemination of antibiotic resistant S. pneumoniae serotypes that commonly cause invasive disease in children (Hausdorff et 15 el., 2001; Huebner, et al., 2000). However these vaccines protect against only the relatively small minority (Dunne et al., 2001; Hausdorff et el., 2001) of pneumococcal serotypes that most commonly cause disease. There is theoretical and limited empirical evidence that widespread use of these vaccines could lead to substitution of "vaccine" serotypes with other nonvaccine serotypes, against which the vaccines do not provide 20 protection. Continued surveillance will be critical to monitor vaccine efficacy and changes in incidence and distribution of colonising and invasive serotypes (Hausdoiff et el., 2001; Rubins et al., 1999). Any increase in disease caused by previously uncommon nonvaccine serotypes could necessitate a change in vaccine composition (Lipsitch, 2001). 25 S. pneumoniae comprises at least 90 serotypes, distinguished by capsular polysaccharide antigens. Pneumococcal serotype/group identification is currently performed, using large panels of expensive antisera, by various methods, including capsular swelling (Quellung) reaction - the traditional "gold standard" - latex agglutination and coagglutination (Arai et al., 2001; Lalitha et al., 1999). Cross 30 reactions between serotypes and discrepancies between methods can occur and some strains are nonserotypable (Henrichsen, 1999). The capsular polysaccharide synthesis (cps) gene clusters for at least 16 pneumococcal serotypes have been sequenced and serotype-specific genes identified (Jiang et al., 2001; van Selm et al., 2002). The cps gene cluster contains genes 35 responsible for synthesis of the serotype-specific polysaccharide including - except in serotype 3 - wzy (polysaccharide polymerase gene) and wzx (polysocharide flippase WO 2004/090159 PCT/AU2004/000480 2 gene). At the 5'-end of the cps gene cluster are four relatively conserved open reading frames - cpsA (wzg)-cpsB (wzh)-cpsC (wzd)-cpsD (wze). Sequence differences in this region were used to classify 11 S. pneumoniae serotypes into two classes and, in the region between the 3'-end of cpsA and the 5'-end of cpsB, there were sites of 5 heterogeneity between and within serotypes (Jiang et al., 2001; Lawrence et al., 2000). S. pneumoniae is characterised by high frequency recombination within the cps gene cluster, leading to serotype "switching" among isolates within genetic lineages defined by relationships between their more conserved housekeeping genes (Coffey et al., 1998; Jiang et al., 2001). 10 The relatively low percentage of polymorphisms between strains which is linked to actual serotype, and the large number of different serotypes, has made the development of assays which can be used for typing a significant portion of S. pneumoniae strains difficult. Accordingly, there is a need for further methods which can be used to identify different Streptococcus pneumoniae serotypes. 15 SUMMARY OF THE INVENTION Through the complex analysis of a large number of polymorphisms which exist between at least 132 molecular capsular sequence types of Streptococcus pneumoniae the present inventors have devised methods which can be used to distinguish between a 20 majority of different S. pneumoniae serotypes. In particular, prior art methods of nucleic acid based typing techniques could serotype only about 20 serotypes of S. pneunoniae. In contrast, the methods of the invention can be used to serotype most of the about 90 serotypes of S. pneumoniae. The methods of the invention can also be used to subtype some serotypes. 25 Thus, in a first aspect, the present invention provides a method of distinguishing between at least 25 different serotypes of Streptococcus pneumoniae in a sample, the method comprising, i) analysing at least a portion of the nucleotide sequence between the 3' end of the cpsA gene and the 5' end of the cpsB gene, and/or 30 ii) analysing at least a portion of the wzy and/or wzx gene(s). Preferably, the method can be used to type at least 40, more preferably at least 50, more preferably at least 70, more preferably at least 90, more preferably at least 100, even more preferably at least about 132 different molecular capsular sequence types of S. pneumoniae. 35 The present inventors are the first to provide suitable nucleic acid based techniques for typing a large number of Streptococcus pneumoniae serotypes.

WO 2004/090159 PCT/AU2004/000480 3 Accordingly, in another aspect the present invention provides a method of detennining the serotype of Streptococcus pneumoniae in a sample, the method comprising, i) analysing at least a portion of the nucleotide sequence between the 3' end of the cpsA gene and the 5' end of the cpsB gene, and/or 5 ii) analysing at least a portion of the wzy and/or wzx gene(s), wherein the serotype is selected from the group consisting of: 2, 7A, 7B, 7C, 9A, 9L, 10F, 10A, 10B, 10C, 11F, 11A, 11B, 11C, 11D, 12F, 12A, 12B, 13, 15F, 15A, 15B, 15C, 16A, 17F, 17A, 18F, 18A, 18B, 21, 22F, 22A, 24F, 24A, 24B, 25F, 25A, 27, 28F, 28A, 31, 32F, 32A, 33F, 33A, 33B, 33C, 33D, 34, 35A, 35B, 35C, 36, 37, 38, 39, 40, 10 41F, 41A, 42, 43, 44, 45, 46, 47, 47A and 48. The present inventors have surprisingly found that at least about 102 molecular capsular sequence types of S. pneumoniae can be directly serotyped by analysing the 3' end of the cpsA gene and the 5' end of the cpsB gene of the S. pneumoniae genome. Thus, in another aspect the present invention provides a method of determining 15 the serotype of Streptococcus pneumoniae in a sample, the method comprising analysing at least a portion of the nucleotide sequence between the 3' end of the cpsA gene and the 5' end of the cpsB gene. In a preferred embodiment, the portion of the nucleotide sequence between the 3' end of the cpsA gene and the 5' end of the cpsB gene which is analysed is any 20 nucleotide which is polymorphic between at least some of the S. pneumoniae serotypes referred to in Figure 2. In a particularly preferred embodiment, the method comprises amplifying at least a portion of the nucleotide sequence between the 3' end of the cpsA gene and the 5' end of the cpsB gene, and sequencing the amplification product. More preferably, 25 the entire approximate 800 bp region as provided in Figure 2 is amplified and sequenced. In the case of sequencing to identify the serotype, the sequencing primers are selected such that they hybridise specifically to a region within or near to a region within which a polymorphism is present. The primers need not be specific to particular 30 serotypes since it is the actual sequence information obtained during the sequencing process which is used to determine the S. pneumoniae serotype. Thus the primers may hybridise specifically to genomic DNA from all S. pneumoniae serotypes (or at least those serotypes referred to in Figure 2), or to genomic DNA from some, but not all, S. pneumoniae serotypes. 35 When a portion of the nucleotide sequence between the 3' end of the cpsA gene and the 5' end of the cpsB gene is amplified, it is preferable that the amplification is WO 2004/090159 PCT/AU2004/000480 4 performed using primer pairs comprising a sequence selected from the group consisting of: 1) GGCATT(/C)TATGGAGTTGATTCG(/A)TCCATT(/C)CACAC(C/T)TTAG (SEQ ID NO:68) and 5 GC(/T)TCAATG(/A)TGG(/A)GCAATG(/T)ACTGGA(/C)GTA(/G)ATTCCCA(/G)A CATCH (SEQ ID NO:73), 2) GGCATT(/C)TATGGAGTTGATTCG(/A)TCCATT(/C)CACACC(/T) TTAG (SEQ ID NO:68) and CCATCAC(/T)ATAGAGGTTAC(/A)TG(/A)TCTGGCATT(/C)GC (SEQ ID NO:71), 10 3) GAAAGTGGG(/A/T)GGG(/A/T)A(/G)A(/C)T(/G)TAT(/C)AAAGTA(/G) AATTCT(/G)CAAGAT(/C)TTA(/G)AAA(/G)G (SEQ ID NO:70) and T(/G)CATG(/A)CTA(/G)AAC(/T)TCT(/A)ATC(/T)AAG(/A)GCATAACGACTATC(/ T) (SEQ ID NO:72), and 4) primer pairs that amplify the same region, or diagnostic portion thereof, from 15 the genome of a strain of S. pneunoniae as the primers provided in 1) to 3). In an alternate embodiment, the nucleotide sequence analysis step comprises determining whether a polynucleotide obtained from S. pneumoniae selectively hybridises to a polynucleotide probe comprising one or more polymorphic regions of the nucleotide sequence between the 3' end of the cpsA gene and the 5' end of the cpsB 20 gene, wherein such polymorphic regions are shown in Figure 2. More preferably, the nucleotide sequence analysis step comprises a plurality of said polynucleotide probes. In a particularly preferred embodiment, where hybridisation to a plurality of probes is used as a means of analysis, the plurality of polynucleotide probes are present as a microarray. 25 It has been noted that the method of analysing at least a portion of the nucleotide sequence between the 3' end of the cpsA gene and the 5' end of the cpsB gene does not enable the identification of all known S. pneumoniae serotypes, for example shared sequences were noted in the following cases; 6A and 6B; 1OA and 17A, 10A and 23F, 23F and 23A; 15B, 15C, 22F and 22A; 17F, 35B, 35C and 42. Accordingly, in these 30 instances further analysis will need to be performed to determine the correct serotype. To this end, the present inventors have discovered that polymorphisms in the wzy and/or wzx genes can also be useful for S. pneumoniae serotyping. Accordingly, in a further aspect the present invention provides a method of determining the serotype of Streptococcus pneumoniae in a sample, the method 35 comprising analysing at least a portion of the wzy and/or wzx gene(s).

WO 2004/090159 PCT/AU2004/000480 5 In a preferred embodiment, the method comprises amplifying at least a portion of the wzy and/or wzx gene(s), and determining the length of the amplification product. In a particularly preferred embodiment, at least a portion of the wzy and/or wzx gene(s) is amplified using primer pairs comprising a sequence selected from the group 5 consisting of: 1) GTAGGTGTAGTTTTTTCAGGGACTTTAATTTTATGCAGTG (SEQ ID NO:74) and TCGCTTAACACAATGGCTTTAGAAGGTAGAG (SEQ ID NO:75), 2) GTTATTTTATTTTTTTTGTCGGCATTGTATTCTTTATATCG (SEQ ID 10 NO:76) and CAAATTCATCGTTTGTATCCATTTAACTGCATC (SEQ ID NO:77), 3) CTTATATCTAATTATGTTCCGTCTATATTTATATGGGTTTGCTTTC (SEQ ID NO:78) and TTTCTCTTCATTTTCCTGATAATTTTGTACTTCTGAATG (SEQ ID NO:79), 4) ATGCTTTTAAATTTCTTATTCATATCTATTTTTC (SEQ ID NO:80) and 15 GTAAACAGAGAGCGAGTGATCATTTTAAAACTTTTGG (SEQ ID NO:83), 5) G(/A)GATTTT(/G)TTTCAACCT(/C)GCAGTAATTTTAACAA(/C)TC(/T) G(/A) (SEQ ID NO:81) and CCTGAAAACAA(/G)TACT(/C)ACTTTCTGAATTTCAC(/T)GGA(/G)TATAAAG (SEQ ID NO:82), 20 6) GTTTTATTGACTTTAAAGATGTTAGTTTCTTCGATTCCAG (SEQ ID NO:84) and TTTTTATTACTCTTCTTAAATCATAATGAATCGTACCAATCAAC (SEQ ID NO:85), 7) GGATCAATGGCAACTATATTTACCCTACTCTCCACAG (SEQ ID NO:86) and GAGTCGAAACCAACCGGAAAAAGCAATTGAG (SEQ ID NO:87), 25 8) CCTTTGGTTTATTATCCTACTTCCAAAACAGTTTATGC (SEQ ID NO:88) and CATATATCTCTTTATCCTGTCAATATTGATTGGCATTTTC (SEQ ID NO:89), 9) GATATTAGCTATACCAACAATTGTTCTTTTCCTGTACTCAGTC (SEQ ID NO:91) and GCATTTCTAGTACCGAACCATTGAAACTATCATCTG (SEQ ID 30 NO:93), 10) GAAATTATAGTCGGAGCTTTCATTTATATTAGTTTACTGGTTCTG (SEQ ID NO:90) and CAGAATAAAGAGAGCTGTAATAGGTGCAACTTCATGC (SEQ ID NO:93), 11) CTGTAATGTTTCTAATTAGTTCAGTATTTGCACTGGTTAATTC 35 (SEQ ID NO:94) and WO 2004/090159 PCT/AU2004/000480 6 CCCGTATATCCATTACTAAGAACAAGGTTGTATATTTCCTTC (SEQ ID NO:95), 12) GTTTCTCATTAGTTCTGTATTTGCCCTTATTAATGTGC (SEQ ID NO:96) and CCATGGCTAAGTGCAAGATTATGAATCTCTCTC (SEQ ID NO:97), 5 13) GTTTCTTATGTTTACCCTCAGCTTATATTGGCACAG (SEQ ID NO:98) and GATACCACAAATCTCCGAATTCTCTTAAAATAGATGG (SEQ ID NO:99), 14) TTAAGTAGTTCACAAGTGATAGTGAACTTGGGATTGTC (SEQ ID NO:100) and CACTGAGATTATTTATTAGCTTTATCGGTAAGGTGGATAAG 10 (SEQIDNO:101), 15) ATTACTTGTAATACTATGTATTCAACTAGTCA(/C)AGGATTTGAT GG (SEQ ID NO:103) and GAACAAATTTCCGTATCAGATTTGCGATTTC (SEQ ID NO:104), 16) CCAATGAAAAGGAAAGTTCAATGTGTTTTGTTTCTGC (SEQ ID 15 NO:102) and GGTGCTTCAGCAAAAATCCCCGTATTTCTTATCAG (SEQ ID NO:105), 17) TAGCTGATGTTCCGATAAATTATGGTGGGGTAATAATAG (SEQ ID NO:106) and CTGCGACACTGTATATACCTACATTATAACTACTAGACATTTGC (SEQ ID NO:107), 20 18) GCAACTTTGGTTCTAAAATTTTAGTCTTTTTAATGGTTCC (SEQ ID NO:108) and TGTTAAACCCCAATATAGAAATTGTATTGAGAATAGCAGC (SEQ ID NO:109), 19) CGTTAATAGCTTATGTTCAACTGGTGATTGATTTTGG (SEQ ID NO: 110) and TGATAGTTTTAGAAATAATATAAGGAATTGCAACTGCATGC 25 (SEQ ID NO:111), 20) TTCATGTC(/T)T(/C)TTTTG(/A)TCTAATCTGATTACAATTG(/C) TC(/T)A CAT CG(/A) (SEQ ID NO:113) and T(/C)GCATTTG(/T)GATCTGTCACAA(/G)TCAATAAGTTAAAACC (SEQ ID NO:114), 30 21) GGTAGGTATTTTAATTGGAGGAAGAGAGTCTTGAATGG (SEQ ID NO:112) and ATCTTCCCTTCATAAATTGACATAGGAAAAATAAGAGCC (SEQ ID NO:115), 22) CAATTCTAACTATGTCCAGTTTTATTTTTCCACTCATCAG (SEQ ID NO:116) and GACGTGATAATAATAAGCTGCCATTCCTGTCTAAAACG (SEQ ID 35 NO:117), WO 2004/090159 PCT/AU2004/000480 7 23) CGGCGGTATTAAGTAGAATATTAACACCTGAAGAGTATGGC (SEQ ID NO:118) and GGCAATCAGACTCAATAAGTTCATCCGTTTAAAGTTC (SEQ ID NO:119), 24) GGTATTGCCTTTCCTTTGATAACTTCTCCTTATTTATCAC (SEQ ID 5 NO:120) and TGAACTTGTAACTCGACACCCAAAAATATAAATAAATGAG (SEQ ID NO:121), 25) GAATCGGACAATAGCACAGGTACGAACAAG (SEQ ID NO:123) and GCCATGTAATCAACTGACCAAGCAGGGTACTC (SEQ ID NO:124), 26) CAAAGGAACGTTATCAGCAATTGTGTCAAATTTCAG (SEQ ID 10 NO:122) and AAGATTAGGGCGCACAAAGTTTACTTGTTTTAGC (SEQ ID NO:125), 27) GTTATTTCTTCAAATCTGCTCATAGTTTTAACCTCATCAC (SEQ ID NO:126) and TATCTTGCGTTTTCATCCCTTACAGTTATTAGGTTCAAAG (SEQ ID NO:127), 15 28) TTCTTCAAATCTTTTGACAGTCTTGACCTCTTCCTTG (SEQ ID NO: 128) and TATCGTGCATTCGAATCTGTTACAGCTAATACATTTAAAC (SEQ ID NO: 129), 29) GTCCTGACGCTATCAAATATCATTTTCCCATTAATCAC (SEQ ID NO:130) and CCCACATGTGATCAATAGGAGTGAAAATTCTCTATTC (SEQ ID 20 NO:131), 30) GCTTTGGCTAACTTTTCATCAAAGATTTTAATTTTTTTGTTAG (SEQ ID NO133) and CCAGAGATAGCTGTAACACCAATTTTATCAATTCCCTTAG (SEQ ID NO: 134), 31) CCTTTGGCTAATTTCTTGGACGATAATGAATTTGTATATG (SEQ ID 25 NO:132) and CCACAAACATTAGCAATAAAGAAACCTAACAATCCC (SEQ ID NO:135), 32) GATCATACTCCCTATCATTACGACTCCCTATGTAACG (SEQ ID NO:137) and CCAAGAAATATCCAAACCTTTTGACACTAAACTTAATCC (SEQ ID NO:138), 30 33) GTTGTTTTAGCTCAAGGAGGGATAATGTTGGCTTCG (SEQ ID NO:136) and GCTGATTTTACAAATAGGAAAATAGAGATTGCACCAAC (SEQ ID NO:139), and 34) a primer comprising a sequence selected from any one of SEQ ID NO's 144 to 333, and WO 2004/090159 PCT/AU2004/000480 8 35) a primer that can be used to amplify the same region, or diagnostic portion thereof, from the genome of a strain of S. pneumoniae as a primer provided as any one of SEQ ID NO's 75 to 139 or 144 to 333. Guidance regarding the seirotypes these primer pairs target, and the length of 5 resulting amplification products, is provided in Tables 2, 3 and 7. It has been noted that some of the above primer pairs formed non-serotype specific amplicons, for example; PCR targeting serotype 6B also amplified 6A; PCR targeting 18C amplified all serotypes in serogroup 18; PCR targeting wzx (but not wzy) of serotype 23F, amplified three serotype 23A strains; PCR targeting wzx and wzy of 10 serotypes 33/37 amplified a 33A isolate and that targeting wzx amplified a serotype 33B isolate. Accordingly, in these instances further analysis will need to be performed to determine the correct serotype. For instance, traditional serological typing can be performed. Serotype 3 does not contain wzy and wzx genes. Accordingly, upon obtaining 15 results using the method of analysing at least a portion of the nucleotide sequence between the 3' end of the cpsA gene and the 5' end of the cpsB gene, the presence of serotype 3 can be confirmed by analysing the oif2 (wze)-cap3A-cap3B region. Preferably, serotype 3 is identified by amplifying a portion of the oi2 (wze)-cap3A cap3B region using primer pairs selected from the group consisting of: 20 1) GCACAAAAAAAAGTTTGATATTCCCCTTGACAATAG (SEQ ID NO:140) and GCAGGATCTAAGGAGGCTTCAAGATTCAACTC (SEQ ID NO:141), 2) CGAACCTACTATTGAGTGTGATACTTTTATGGGATACAGAG (SEQ ID NO:142) and CTGACAGCATGAAAATATATAACCGCCCAACGAATAAG 25 (SEQ ID NO:143), and 3) primer pairs that amplify the same region, or diagnostic portion thereof, from the genome of a strain of S. pneumoniae as the primers provided in 1) or 2). During routine analysis of a sample comprising bacteria it will typically be desirable to ensure that the sample being analysed actually contains Streptococcus 30 pneunoniae. Thus, it is preferred that the methods of the present invention include detecting any serotype of Streptococcus pneumoniae in the sample. Such methods are known in the art and include, but are not limited to, amplifying portions of the psaA and/or pneumolysin genes followed by detection of the amplification products. 35 In a preferred embodiment, a portion of the psaA gene is amplified using primers comprising the sequence WO 2004/090159 PCT/AU2004/000480 9 TACATTACTCGTTCTCTTTCTTTCTGCAATCATTCTTG (SEQ ID NO:64) and TAGTAGCTGTCGCCTTCTTTACCTTGTTCTGC (SEQ ID NO:65), or primer pairs that amplify the same region, or diagnostic portion thereof, from the genome of a strain of S. pneunoniae as SEQ ID NO:64 and SEQ ID NO:65. In another preferred 5 embodiment, a portion of the pneumolysin gene is amplified using primers comprising the sequence AGAATAATCCCACTCTTCTTGCGGTTGA (SEQ ID NO:66) and CATGCTGTGAGCCGTTATTTTTTCATACTG (SEQ ID NO:67) or primer pairs that amplify the same region, or diagnostic portion thereof, from the genome of a strain of S. pneumoniae as SEQ ID NO:66 and SEQ ID NO:67. 10 The present inventors have observed a strong correlation between the molecular capsular sequence typing techniques of the invention and the actual serotype of a strain as determined by traditional antibody based serological typing. However, the typing methods of the invention may be assisted by further serotyping the S. pneunioniae strain. For instance, to ensure recombination events have not occurred, upon typing 15 with the methods of the invention the serotype can be confirmed by serologically typing for the strain suggested by the methods of the invention. Furthermore, the inventors have noted that a few serotypes are.difficult to resolve using the methods of the invention, for example; 6A and 6B; 15B and 15C; 22F and 22A; and 35C and 42. Upon identification of any of these serotypes by the molecular techniques of the 20 invention the serotype can be unequivocally typed using traditional serological methods. In another aspect, the present invention provides an isolated polynucleotide comprising a sequence of nucleotides selected from those provided as SEQ ID NO's 2 to 63, or a fragment thereof which is at least 10 nucleotides in length, with the proviso 25 that the polynucleotide does not comprise the entire wzy and/or wzx gene(s) of a S. pneumoniae serotype selected from the group consisting of: 1, 2, 4, 6A, 6B, 8, 9V, 14, 18C, 19F, 19A, 19B, 23F, 33F and 37, or the entire wzx gene of S. pneumoniae serotype 19C. In a further aspect, the present invention provides an isolated polynucleotide 30 comprising a sequence of nucleotides selected from the group consisting of: 1 AF532632, 1OA-AF532633, 10A-AF532634, 1OB-AY508586, 1OF-AF532635, 1OF AF532636, 1OF-AY508587, 11A-AF532637, 11A-AF532638, 11 B-AF532639, 11C AY508588, 11C-AY508589, 12A-AY508590, 12A-AY508591, 12F-AF532640, 12F AF532641, 13-AF532642, 14-AF532643, 14-AF532644, 14-AF532645, 15A 35 AF532646, 15A-AF532647, 15B-AF532648, 15B-AF532649, 15B-AF532650, 15C AF532651, 15C-AF532652, 15C-AY330714, 15C-AY330715, 15C-AY508592, 15C- WO 2004/090159 PCT/AU2004/000480 10 AY508593, 15F-AY508594, 15F-AY508595, 16A-AY508596, 16F-AF532653, 16F AF532654, 17A-AF532655, 17A-AY508597, 17F-AF532656, 17F-AF532657, 18A AF532658, 18A-AF532659, 18B-AF532660, 18C-AF532661, 18F-AF532662, 18F AY330716, 18F-AY508598, 19A-AF532663, 19A-AF532664, 19B-AY508599, 19C 5 AY508600, 19C-AY508601, 19F-AF532665, 19F-AF532666, 19F-AF532667, 19F AF532668, 2-AF532669, 20-AF532670, 21-AF532671, 21-AY508602, 22A AF532672, 22F-AF532673, 23A-AF532674, 23A-AF532675, 23B-AF532676, 23B AY330717, 23F-AF532677, 23F-AF532678, 23 F-AF532679, 24A-AY508603, 24B AY508604, 24F-AY508605, 24F-AY508606, 24F-AY508607, 25F-AF532711, 27 10 AY508608, 28A-AY508609, 28F-AY508610, 28F-AY508611, 29-AF532680, 29 AY330718, 3-AF532681, 3-AF532682, 3-AF532683, 31-AF532684, 32A-AY508612, 32A-AY508613, 32F-AY508614, 33A-AF532685, 33B-AF532686, 33B-AY508615, 33C-AY508616, 33F-AF532687, 33F-AF532688, 33F-AF532689, 34-AF532690, 35A AY508617, 35B-AF532691, 35C-AY508618, 35F-AF532692, 36-AY508619, 37 15 AF532713, 38-AF532712, 39-AY508620, 39-AY508621, 4-AF532693, 40-AY508622, 41A-AY508623, 41F-AY508624, 42-AY508625, 43-AY508626, 45-AY508628, 46 AY508629, 47A-AY508630, 47F-AY508631, 48-AY508632, 48-AY508633, 5 AF532696, 5-AF532697, 5-AY508634, 6A-AF532698, 6A-AF532699, 6A-AF532700, 6A-AF532701, 6A-AF532702, 6A-AY508641, 6B-AF532703, 6B-AF532704, 6B 20 AF532705, 7A-AY508635, 7B-AY508636, 7C-AF532706, 7F-AF532707, 8 AF532708, 9A-AY508637, 9L-AY508638, 9N-AF532709, 9V-AF532710 and 9V AY508639 as provided in Figure 2, or a fragment thereof which is at least 10 nucleotides in length, with the proviso the polynucleotide does not comprise the 3' end of the epsA gene to the 5' end of the cpsB gene of a S. pneumoniae serotype selected 25 from the group consisting of: 1, 2, 3, 4, 6A, 6B, 8, 9V, 14, 18C, 19F, 19A, 23F, 33F and 37. In a preferred embodiment, the polynucleotide of these aspects is at least 15 nucleotides, more preferably at least 20 nucleotides, more preferably at least 25 nucleotides, more preferably at least 30 nucleotides, more preferably at least 50 30 nucleotides in length, and even more preferably at least 100 nucleotides in length. In a further aspect, the present invention provides an isolated polynucleotide consisting essentially of 10 to 50 contiguous nucleotides corresponding to a portion of the 3' end of the cpsA S. pneumoniae gene or the 5' end of the cpsB S. pneumoniae gene,.

WO 2004/090159 PCT/AU2004/000480 11 In a further aspect, the present invention provides a polynucleotide consisting essentially of 10 to 50 contiguous nucleotides corresponding to a portion of the S. pneumoniae wzy and/or wzx gene(s). Preferably, said polynucleotide of 10 to 50 contiguous nucleotides comprises 5 one or more nucleotides which differ between different S. pneumoniae serotypes. Polynucleotides of 10 to 50 contiguous nucleotides can be used as amplification primers, or as probes, for the identification of different S. pneumoniae serotypes. Preferably the nucleotides which differ between S. pneumoniae serotypes correspond to one or more of positions as shown in Figure 2. 10 Preferably, the polynucleotide is detectably labelled. The label can be any suitable label known in the art including, but not limited to, radionuclides, enzymes, fluorescent, and chemiluminescent labels. Also provided is a vector comprising a polynucleotide of the invention. Preferably, the vector is an expression vector. Furthermore, provided is a host cell 15 comprising a vector of the invention. Suitable vectors and host cells would be well known to those skilled in the art. In yet another aspect, the present invention provides a composition comprising a plurality of polynucleotides according to the invention and an acceptable carrier or excipient. Preferably, the carrier or excipient is water or a suitable buffer. The 20 composition may be used in methods of typing different S. pneumoniae serotypes. In a further aspect the present invention provides a microarray comprising a plurality of polynucleotides according to the invention. The microarray may be used in methods of typing different S. pneumoniae serotypes. In another aspect, the present invention provides a kit comprising at least one 25 polynucleotide of the present invention. Preferably, the polynucleotide is 10 to 50 nucleotides in length. In one embodiment, the kit further comprises reagents necessary for nucleic acid amplification. In another embodiment, the polynucleotide is detectably labelled and the kit further comprises means for detecting the labelled polynucleotide. 30 As will be apparent, preferred features and characteristics of one aspect of the invention are applicable to many other aspects of the invention. Throughout this specification the word "comprise", or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated element, integer or step, or group of elements, integers or steps, but not the exclusion of 35 any other element, integer or step, or group of elements, integers or steps.

WO 2004/090159 PCT/AU2004/000480 12 The invention is hereinafter described by way of the following non-limiting examples and with reference to the accompanying figures. BRIEF DESCRIPTION OF THE ACCOMPANYING DRAWINGS 5 Figure 1. The genomic sequence of cpsA (wzg) and cpsB (wzh) genes of serotype 4 of S. pneumoniae as published by Jiang et al. (2001) and deposited as GenBank Accession Number AF316639. The remaining 3' sequence of GenBank Accession Number AF316639 has not been provided. Nucleotides 1520 to 2965 encode cpsA whilst nucleotides 2967 to 3698 encode cpsB. 10 Figure 2. Multiple sequence alignments for the region between the 3'-end of cpsA (wzg) and the 5'-end of cpsB (wzh) of 132 molecular capsular sequence types of S. pneumoniae. The alignment numbering start point "1" refer to the position "2470" of S. pneumroniae serotype 4 cpsA (wzg) gene (GenBank accession number: AF316639) 15 (Figure 1). Figure 3. Phylogenetic tree inferred from sequences in the region between the 3'-end of cpsA (wzg) and the 5'-end of cpsB (wzhz,) genes for 132 molecular capsular sequence types of S. pneumoniae. Most of the tree input sequences are from Figure 2; for 20 GenBank accession numbers see Tables 1 and 8. Figure 4. Phylogenctic tree of wzx genes of 83 S. pneumoniae cps serotypes. The tree is generated by the neighbour-joining method based on all nucleotide sites. 25 Figure 5. Phylogenetic tree of wzy genes of total 83 S. pneumoniae cps serotypes. The tree is generated by the neighbour-joining method based on all nucleotide sites. Figure 6. Schematic representation of the closely related wzx genes. Each block represents wzx genes from one or more S. pneumoniae serotype cps gene cluster. 30 Similar patterns and shading represent regions with DNA sequence identity > 75% among different nucleotide sequences. KEY TO THE SEQUENCE LISTING SEQ ID NO: 1 - Genomic sequence of epsA (wzg) and cpsB (wzh) genes of serotype 4 35 of S. pneumoniae (Figure 1). SEQ ID NO:2 - Partial sequence of strain 00-251-3185 wzx gene.

WO 2004/090159 PCT/AU2004/000480 13 SEQ ID NO:3 - Partial sequence of strain 01-122-0226 wzx gene. SEQ ID NO:4 - Partial sequence of strain 01-192-2471 wzx gene. SEQ ID NO:5 - Partial sequence of strain MA055100 wzx gene. SEQ ID NO:6 - Partial sequence of strain NZSPN01/329 wzx gene. 5 SEQ ID NO:7 - Partial sequence of strain 00-256-1986 wzx gene. SEQ ID NO:8 - Partial sequence of strain NZSPNO1/276 wzx gene. SEQ ID NO:9 - Partial sequence of strain 00-201-1422 wzx gene. SEQ ID NO:10 - Partial sequence of strain 00-211-1669 wzx gene. SEQ ID NO:1 1 - Partial sequence of strain 00S002 wzx gene. 10 SEQ ID NO:12 - Partial sequence of strain 00-251-3185 wzy gene. SEQ ID NO:13 - Partial sequence of strain 01-122-0226 wzy gene. SEQ ID NO:14 - Partial sequence of strain 01-192-2471 wzy gene. SEQ ID NO:15 - Partial sequence of strain MA055 100 wzy gene. SEQ ID NO:16 - Partial sequence of strain NZSPNO1/329 wzy gene. 15 SEQ ID NO:17 - Partial sequence of strain 00-256-1986 wzy gene. SEQ ID NO:18 - Partial sequence of strain NZSPNO1/276 wzy gene. SEQ ID NO:19 - Partial sequence of strain 00-201-1422 wzy gene. SEQ ID NO:20 - Partial sequence of strain 00-211-1669 wzy gene. SEQ ID NO:21 - Partial sequence of strain 00S002 wzy gene. 20 SEQ ID NO:22 - Partial sequence of strain NZSPN01/509 cpsI and wzx genes. SEQ ID NO:23 - Partial sequence of strain MA050408 cpsI and wzx genes. SEQ ID NO:24 - Partial sequence of strain MA052433 cpsI and wzx genes. SEQ ID NO:25 - Partial sequence of strain 00S009 cpsl and ivzx genes. SEQ ID NO:26 - Partial sequence of strain 99-325-0373 cpsl and wzx genes. 25 SEQ ID NO:27 - Partial sequence of strain NZSPNOO/454 cpsI and wzx genes. SEQ ID NO:28 - Partial sequence of strain NZSPN00/484 cpsl and wzx genes. SEQ ID NO:29 - Partial sequence of strain 00-081-2291 wzy and wzx genes. SEQ ID NO:30 - Partial sequence of strain OS168 wzy and wzx genes. SEQ ID NO:31 - Partial sequence of strain 00-280-1493 wzy and wzx genes. 30 SEQ ID NO:32 - Partial sequence of strain MA063073 wzy and wzx genes. SEQ ID NO:33 - Partial sequence of strain NZSPN00/410 wzy and wzx genes. SEQ ID NO:34 - Partial sequence of strain NZSPNO1/243 wzy and wzx genes. SEQ ID NO:35 - Partial sequence of strain MA063087 wzy and wzx genes. SEQ ID NO:36 - Partial sequence of strain MA063207 wzy and wzx genes. 35 SEQ ID NO:37 - Partial sequence of strain 01S333 wzx gene. SEQ ID NO:38 - Partial sequence of strain MA050663 wciW and wzx genes.

WO 2004/090159 PCT/AU2004/000480 14 SEQ ID NO:39 - Partial sequence of strain 01S319 wciW and wzx genes. SEQ ID NO:40 - Partial sequence of strain NZSPNOO/353 wciW and wzx genes. SEQ ID NO:41 - Partial sequence of strain MA062610 wciW and wzx genes. SEQ ID NO:42 - Partial sequence of strain MA053392 wciW and wzx genes. 5 SEQ ID NO:43 - Partial sequence of strain NZSPNOO/319 wciW and wzx genes. SEQ ID NO:44 - Partial sequence of strain NZSPNO1/278 wciW and wzx genes. SEQ ID NO:45 - Partial sequence of strain 01S009 wciW and wzx genes. SEQ ID NO:46 - Partial sequence of strain MA052628 wciW and wzx genes. SEQ ID NO:47 - Partial sequence of strain 00-081-2291 cpsJ and wzy genes. 10 SEQ ID NO:48 - Partial sequence of strain 00-280-1493 cpsJ and wzy genes. SEQ ID NO:49 - Partial sequence of strain NZSPNOO/410 cpsJ and wzy genes. SEQ ID NO:50 - Partial sequence of strain NZSPNO1/243 cpsJ and wzy genes. SEQ ID NO:51 - Partial sequence of strain MA063073 cpsJ and wzy genes. SEQ ID NO:52 - Partial sequence of strain 00S168 cpsJ and wzy genes. 15 SEQ ID NO:53 - Partial sequence of strain MA063087 cpsJ and wzy genes. SEQ ID NO:54 - Partial sequence of strain MA063207 cpsJ and wzy genes. SEQ ID NO:55 - Partial sequence of strain 01S319 wzx and wzy genes. SEQ ID NO:56 - Partial sequence of strain NZSPNOO/353 wzx and wzy genes. SEQ ID NO:57 - Partial sequence of strain MA062610 wzx and wzy genes. 20 SEQ ID NO:58 - Partial sequence of strain MA053392 wzx and wzy genes. SEQ ID NO:59 - Partial sequence of strain NZSPN00/319 wzx and wzy genes. SEQ ID NO:60 - Partial sequence of strain NZSPN01/278 wzx and wzy genes. SEQ ID NO:61 - Partial sequence of strain MA050663 wzx and wzy genes. SEQ ID NO:62 - Partial sequence of strain MA052628 wzx and wzy genes. 25 SEQ ID NO:63 - Partial sequence of strain 01S009 wzx and wzy genes. SEQ ID NO's 64 to 143 - Oligonucleotide primers provided in Table 2. SEQ ID NO's 144 to 333 - Oligonucleotide primers provided in Table 7. SEQ ID NO:334* - Sequence of serotype 33C wzx gene. SEQ ID NO:335* - Sequence of serotype 10B wzx gene. 30 SEQ ID NO:336* - Sequence of serotype 10C wzx gene. SEQ ID NO:337* - Sequence of serotype 10F wzx gene. SEQ ID NO:338* - Sequence of serotype 11 A wzx gene. SEQ ID NO:339* - Sequence of serotype li D wzx gene. SEQ ID NO:340* - Sequence of serotype 12A wzx gene. 35 SEQ ID NO:341* - Sequence of serotype 12B wzx gene. SEQ ID NO:342* - Sequence of serotype 12F wzx gene.

WO 2004/090159 PCT/AU2004/000480 15 SEQ ID NO:343* - Sequence of serotype 13 wzx gene. SEQ ID NO:344* - Sequence of serotype 14 wzx gene. SEQ ID NO:345* - Sequence of serotype 15A wzx gene. SEQ ID NO:346* - Sequence of serotype 15B wzx gene. 5 SEQ ID NO:347* - Sequence of serotype 15C wzx gene. SEQ ID NO:348* - Sequence of serotype 15F wzx gene. SEQ ID NO:349* - Sequence of serotype 16A wzx gene. SEQ ID NO:350* - Sequence of serotype 16F wzx gene. SEQ ID NO:351* - Sequence of serotype 17A wzx gene. 10 SEQ ID NO:352* - Sequence of serotype 17F wzx gene. SEQ ID NO:353* - Sequence of serotype 18A wzx gene. SEQ ID NO:354* - Sequence of serotype 18B wzx gene. SEQ ID NO:355* - Sequence of serotype 18F wzx gene. SEQ ID NO:356* - Sequence of serotype 20 wzx gene. 15 SEQ ID NO:357* - Sequence of serotype 22A wzx gene. SEQ ID NO:358* - Sequence of serotype 22F wzx gene. SEQ ID NO:359* - Sequence of serotype 23A wzx gene. SEQ ID NO:360* - Sequence of serotype 23B wzx gene. SEQ ID NO:361* - Sequence of serotype 24B wzx gene. 20 SEQ ID NO:362* - Sequence of serotype 25A wzx gene. SEQ ID NO:363* - Sequence of serotype 25F wzx gene. SEQ ID NO:364* - Sequence of serotype 27 wzx gene. SEQ ID NO:365* - Sequence of serotype 28A wzx gene. SEQ ID NO:366* - Sequence of serotype 28F wzx gene. 25 SEQ ID NO:367* - Sequence of serotype 29 wzx gene. SEQ ID NO:368* - Sequence of serotype 31 wzx gene. SEQ ID NO:369* - Sequence of serotype 32A wzx gene. SEQ ID NO:370* - Sequence of serotype 32F wzx gene. SEQ ID NO:371* - Sequence of serotype 33A wzx gene. 30 SEQ ID NO:372* - Sequence of serotype 33B wzx gene. SEQ ID NO:373* - Sequence of serotype 10A wzx gene. SEQ ID NO:374* - Sequence of serotype 9N wzx gene. SEQ ID NO:375* - Sequence of serotype 34 wzx gene. SEQ ID NO:376* - Sequence of serotype 35A wzx gene. 35 SEQ ID NO:377* - Sequence of serotype 35B wzx gene. SEQ ID NO:378* - Sequence of serotype 35C wzx gene.

WO 2004/090159 PCT/AU2004/000480 16 SEQ ID NO:379* - Sequence of serotype 35F wzx gene. SEQ ID NO:380* - Sequence of serotype 36 wzx gene. SEQ ID NO:381* - Sequence of serotype 38 wzx gene. SEQ ID NO:382* - Sequence of serotype 39 wzx gene. 5 SEQ ID NO:383* - Sequence of serotype 40 wzx gene. SEQ ID NO:384* - Sequence of serotype 41A wzx gene. SEQ ID NO:385* - Sequence of serotype 41F wzx gene. SEQ ID NO:386* - Sequence of serotype 42 wzx gene. SEQ ID NO:387* - Sequence of serotype 43 wzx gene. 10 SEQ ID NO:388* - Sequence of serotype 44 wzx gene. SEQ ID NO:389* - Sequence of serotype 45 wzx gene. SEQ ID NO:390* - Sequence of serotype 46 wzx gene. SEQ ID NO:391 * - Sequence of serotype 47A wzx gene. SEQ ID NO:392* - Sequence of serotype 47F wzx gene. 15 SEQ ID NO:393* - Sequence of serotype 48 wzx gene. SEQ ID NO:394* - Sequence of serotype 48(1) wzx gene. SEQ ID NO:395* - Sequence of serotype 7A wzx gene. SEQ ID NO:396* - Sequence of serotype 7C iwzx gene. SEQ ID NO:397* - Sequence of serotype 7F wzx gene. 20 SEQ ID NO:398* - Sequence of serotype 9A wzx gene. SEQ ID NO:399* - Sequence of serotype 9L wzx gene. SEQ ID NO:400* - Sequence of serotype 33D wzx gene. SEQ ID NO:401* - Sequence of serotype 33B wzy gene. SEQ ID NO:402* - Sequence of serotype 10B wzy gene. 25 SEQ ID NO:403* - Sequence of serotype 10C wzy gene. SEQ ID NO:404* - Sequence of serotype 1OF wzy gene. SEQ ID NO:405* - Sequence of serotype 11A wzy gene. SEQ ID NO:406* - Sequence of serotype 1 1D wzy gene. SEQ ID NO:407* - Sequence of serotype 12A wzy gene. 30 SEQ ID NO:408* - Sequence of serotype 12B wzy gene. SEQ ID NO:409* - Sequence of serotype 12F wzy gene. SEQ ID NO:410* - Sequence of serotype 13 wzy gene. SEQ ID NO:411* - Sequence of serotype 14 wzy gene. SEQ ID NO:412* - Sequence of serotype 15A wzy gene. 35 SEQ ID NO:413* - Sequence of serotype 15B wzy gene. SEQ ID NO:414* - Sequence of serotype 15C wzy gene.

WO 2004/090159 PCT/AU2004/000480 17 SEQ ID NO:415* - Sequence of serotype 15F wzy gene. SEQ ID NO:416* - Sequence of serotype 16A wzy gene. SEQ ID NO:417* - Sequence of serotype 16F wzy gene. SEQ ID NO:418* - Sequence of serotype 17A wzy gene. 5 SEQ ID NO:419* - Sequence of serotype 17F wzy gene. SEQ ID NO:420* - Sequence of serotype 18A wzy gene. SEQ ID NO:421* - Sequence of serotype 18B wzy gene. SEQ ID NO:422* - Sequence of serotype 18F wzy gene. SEQ ID NO:423* - Sequence of serotype 19C wzy gene. 10 SEQ ID NO:424* - Sequence of serotype 20 wzy gene. SEQ ID NO:425* - Sequence of serotype 22A wzy gene. SEQ ID NO:426* - Sequence of serotype 22F wzy gene. SEQ ID NO:427* - Sequence of serotype 23A wzy gene. SEQ ID NO:428* - Sequence of serotype 23B wzy gene. 15 SEQ ID NO:429* - Sequence of serotype 24B wzy gene. SEQ ID NO:430* - Sequence of serotype 25A wzy gene, SEQ ID NO:431* - Sequence of serotype 25F wzy gene. SEQ ID NO:432* - Sequence of serotype 27 wzy gene. SEQ ID NO:433* - Sequence of serotype 28A wzy gene. 20 SEQ ID NO:434* - Sequence of seotype 28F wzy gene. SEQ ID NO:435* - Sequence of serotype 29 wzy gene. SEQ ID NO:436* - Sequence of serotype 31 wzy gene. SEQ ID NO:437* - Sequence of serotype 32A wzy gene. SEQ ID NO:438* - Sequence of serotype 32F wzy gene. 25 SEQ ID NO:439* - Sequence of serotype 33A wzy gene. SEQ ID NO:440* - Sequence of serotype 10A wzy gene. SEQ ID NO:441* - Sequence of serotype 9N wzy gene. SEQ ID NO:442* - Sequence of serotype 33D wzy gene. SEQ ID NO:443* - Sequence of serotype 34 wzy gene. 30 SEQ ID NO:444* - Sequence of serotype 35A wzy gene. SEQ ID NO:445* - Sequence of serotype 35B wzy gene. SEQ ID NO:446* - Sequence of serotype 35C wzy gene. SEQ ID NO:447* - Sequence of serotype 35F wzy gene. SEQ ID NO:448* - Sequence of serotype 36 wzy gene. 35 SEQ ID NO:449* - Sequence of serotype 38 wzy gene. SEQ ID NO:450* - Sequence of serotype 39 wzy gene.

WO 2004/090159 PCT/AU2004/000480 18 SEQ ID NO:451* - Sequence of serotype 40 wzy gene. SEQ ID NO:452* - Sequence of serotype 41A wzy gene. SEQ ID NO:453* - Sequence of serotype 41F wzy gene. SEQ ID NO:454* - Sequence of serotype 42 wzy gene. 5 SEQ ID NO:455* - Sequence of serotype 43 wzy gene. SEQ ID NO:456* - Sequence of serotype 44 wzy gene. SEQ ID NO:457* - Sequence of serotype 45 wzy gene. SEQ ID NO:458* - Sequence of serotype 46 wzy gene. SEQ ID NO:459* - Sequence of serotype 47A wzy gene. 10 SEQ ID NO:460* - Sequence of serotype 47F wzy gene. SEQ ID NO:461* - Sequence of serotype 48 wzy gene. SEQ ID NO:462* - Sequence of serotype 48(1) wzy gene. SEQ ID NO:463* - Sequence of serotype 7A wzy gene. SEQ ID NO:464* - Sequence of serotype 7C wzy gene. 15 SEQ ID NO:465* - Sequence of serotype 7F wzy gene. SEQ ID NO:466* - Sequence of serotype 9A wzy gene. SEQ ID NO:467* - Sequence of serotype 9L wzy gene. SEQ ID NO:468* - Sequence of serotype 33C wzy gene. SEQ ID NO:469 - Sequence of serotype 9V wzx gene (Genbank accesion no. 20 AF402095). SEQ ID NO:470 - Sequence of serotype 19B wzx gene (Genbank accesion no. AF004325). SEQ ID NO:471 - Sequence of serotype 19C wzx gene (Genbank accesion no. AF105116). 25 SEQ ID NO:472 - Sequence of serotype 19F wzx gene (Genbank accesion no. U09239). SEQ ID NO:473 - Sequence of serotype 2 wzx gene (Genbank accesion no. AF026471). SEQ ID NO:474 - Sequence of serotype 23F wzx gene (Genbank accesion no. AF057294). SEQ ID NO:475 - Sequence of serotype 33F wzx gene (Genbank accesion no. 30 AFAJ006986). SEQ ID NO:476 - Sequence of serotype 37 wzx gene (Genbank accesion no. AJ131984). SEQ ID NO:477 - Sequence of serotype 6A wzx gene (Genbank accesion no.AY078347). 35 SEQ ID NO:478 - Sequence of serotype 6B wzx gene (Genbank accesion no. AF316640).

WO 2004/090159 PCT/AU2004/000480 19 SEQ ID NO:479 - Sequence of serotype 8 wzx gene (Genbank accesion no. AF316641). SEQ ID NO:480 - Sequence of serotype 18C wzx gene (Genbank accesion no. AF316642). SEQ ID NO:481 - Sequence of serotype 9V wzy gene (Genbank accesion no. 5 AF402095). SEQ ID NO:482 - Sequence of serotype 19B wzy gene (Genbank accesion no. AF004325). SEQ ID NO:483 - Sequence of serotype 19F wzy gene (Genbank accesion no. U09239). SEQ ID NO:484 - Sequence of serotype 2 wzy gene (Genbank accesion no. AF026471). 10 SEQ ID NO:485 - Sequence of serotype 23F wzy gene (Genbank accesion no. AF057294). SEQ ID NO:486 - Sequence of serotype 33F wzy gene (Genbank accesion no. AFAJ006986). SEQ ID NO:487 - Sequence of serotype 37 wzy gene (Genbank accesion no. 15 AJ131984). SEQ ID NO:488 - Sequence of serotype 6A wzy gene (Genbank accesion no.AY078347). SEQ ID NO:489 - Sequence of serotype 6B wzy gene (Genbank accesion no. AF316640). 20 SEQ ID NO:490 - Sequence of serotype 8 wzy gene (Genbank accesion no. AF316641). SEQ ID NTO:491 - Sequence of serotype 18C wzy gene (Genbank accesion no. AF316642). SEQ ID NO:492 - Consensus sequence for 3' end of the cpsA gene and the 5' end of the cpsB gene of S. pneumoniae strains that were analysed. 25 * Indicates that these sequences were extracted from unnannotated sequence data from the Sanger Institute website. DETAILED DESCRIPTION OF THE INVENTION 30 Definitions Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art (e.g., in cell culture, molecular genetics, nucleic acid chemistry, hybridization techniques and biochemistry). 35 As used herein, the term "nucleotide sequence between the 3' end of the cpsA gene and the 5' end of the cpsB gene" at least refers to the region spanning from WO 2004/090159 PCT/AU2004/000480 20 nucleotide 2470 to nucleotide 3268 of Figure 1. Figure 1 provides the genomic sequence of cpsA (wzg) and cpsB (wzh) genes of serotype 4 as published by Jiang et al. (2001) and submitted as GenBank Accession Number AF316639. As the skilled addressee would be aware, the same region from other serotypes of S. pneumoniae can 5 be identified using standard techniques such as DNA cloning, sequencing and nucleotide sequence alignment. Such techniques are described in further detail in the Examples section. In addition, these techniques have been used to determine the nucleotide sequence between the 3' end of the cpsA gene and the 5' end of the cpsB gene from many different serotypes of S. pneumoniae, the results of which, including a 10 consensus sequence for this region, are also provided in Figure 2. As used herein, the term "primer pairs that amplify the same region, or diagnostic portion thereof, from the genome of a strain of S. pneumoniae", or variations thereof, refers to the capability of the skilled addressee to determine where the identified primers of the claimed invention hybridize the S. pneumoniae genome of a 15 particular strain(s), and subsequent ability to design alternate primers which can be used for the same purpose as the primers defined herein. Typically, these alternate primers will hybridize the same region of the genome but be larger or smaller in size, or these alternate primers will hybridize to a region of the genome which is in close proximity, for example within 500 basepairs, to where the specifically defined primers 20 hybridize. Naturally, the term "diagnostic portion thereof" refers to the alternate primers being capable of amplifying a portion of the region of the defined primers but still capable of amplifying enough of the region to determine the serotype of a particular S. pneumoniae isolate. 25 General Techniques Unless otherwise indicated, the recombinant DNA and immunological techniques utilized in the present invention are standard procedures, well known to those skilled in the art. Such techniques are described and explained throughout the literature in sources such as, J. Perbal, A Practical Guide to Molecular Cloning, John 30 Wiley and Sons (1984), J. Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbour Laboratory Press (1989), T.A. Brown (editor), Essential Molecular Biology: A Practical Approach, Volumes 1 and 2, IRL Press (1991), D.M. Glover and B.D. Hames (editors), DNA Cloning: A Practical Approach, Volumes 1-4, IRL Press (1995 and 1996), and F.M. Ausubel et al. (editors), Current Protocols in 35 Molecular Biology, Greene Pub. Associates and Wiley-Interscience (1988, including all updates until present), Ed Harlow and David Lane (editors) Antibodies: A WO 2004/090159 PCT/AU2004/000480 21 Laboratory Manual, Cold Spring Harbour Laboratory, (1988), and J.E. Coligan et al. (editors) Current Protocols in Immunology, John Wiley & Sons (including all updates until present), and are incorporated herein by reference. 5 Detection of Polymorphisms Any technique known in the art can be used to detect a polymorphism described herein. Examples of such techniques include, but are not limited to, sequencing of the DNA at one or more of the relevant positions; differential hybridisation of an oligonucleotide probe designed to hybridise at the relevant positions of a particular S. 10 pneumoniae serotype(s); denaturing gel electrophoresis following digestion with an appropriate restriction enzyme, preferably following amplification of the relevant DNA regions; S1 nuclease sequence analysis; non-denaturing gel electrophoresis, preferably following amplification of the relevant DNA regions; conventional RFLP (restriction fragment length polymorphism) assays; selective DNA amplification using 15 oligonucleotides which are matched for a particular S. pneumoniae serotype(s) unmatched for other S. pneumoniae serotype(s); or the selective introduction of a restriction site using a PCR (or similar) primer matched for a particular S. pneuinoniae serotype(s), followed by a restriction digest. As outlined above, it is preferred that the nucleotide sequence between the 3' end of the cpsA gene and the 5' end of the cpsB 20 gene is characterized by DNA sequencing, whilst the analysis at least a portion of the wzy and/or wzx gene is performed by procedures involving the detection of amplification products. In one embodiment, the informative serotyping information provided herein is adapted to produce a molecular capsular sequence typing database as generally 25 described by Robertson et al. (2004). PCR-based methods of detection may rely upon the use of primer pairs, at least one of which binds specifically to a region of interest in one or more, but not all, serotypes. Unless both primers bind, no PCR product will be obtained. Consequently, the presence or absence of a specific PCR product may be used to determine the 30 presence of a sequence indicative of a specific S. pneumoniae serotype(s). However, as mentioned, only one primer need correspond to a region of heterogeneity in the genes/regions of interest. The other primer may bind to a conserved or heterogenous region within said gene/region or even a region within another part of the S. pneumoniae genome, whether said region is conserved or heterogeneous between 35 serotypes.

WO 2004/090159 PCT/AU2004/000480 22 Alternatively, primers that bind to conserved regions of the S. pneumoniae genome but which flank a region whose length varies between serotypes may be used. In this case, a PCR product will always be obtained when S. pneumoniae bacteria are present but the size of the PCR product varies between serotypes. Examples of such 5 varying amplification product lengths are disclosed herein in relation to the wzy and wzx genes. Furthermore, a combination of specific binding of one or both primers and variations in the length of PCR primer may be used as a means of identifying particular molecular serotypes. 10 In some cases, PCR and other specific hybridisation- based serotyping methods will involve the use of nucleotide primers/probes which bind specifically to a region of the genome of a S. pneumoniae serotype which includes a nucleotide which varies between two or more serotypes. Thus the primers/probes may comprise a sequence which is complementary to one of such regions. Where positions of heterogeneity are 15 close together (for instance within 5 or so nucleotides), it may be desirable to use a primer/probe which hybridises specifically to a region of the S. pneunoniae genome that comprises two or more positions of heterogeneity. Such primers/probes are likely to have improved specificity and reduce the likelihood of false positives. PCR techniques that utilize fluorescent dyes may be used in the detection 20 methods of the present invention. These include, but are not limited to, the following five techniques. i) Fluorescent dyes can be used to detect specific PCR amplified double stranded DNA product (e.g. ethidium bromide, or SYBR Green I). ii) The 5' nuclease (TaqMan) assay can be used which utilizes a specially 25 constructed primer whose fluorescence is quenched until it is released by the nuclease activity of the Taq DNA polymerase during extension of the PCR product. iii) Assays based on Molecular Beacon technology can be used which rely on a specially constructed oligonucleotide that when self-hybridized quenches fluorescence (fluorescent dye and quencher molecule are adjacent). Upon hybridization to a specific 30 amplified PCR product, fluorescence is increased due to separation of the quencher from the fluorescent molecule. iv) Assays based on Amplifluor (Intergen) technology can be used which utilize specially prepared primers, where again fluorescence is quenched due to self hybridization. In this case, fluorescence is released during PCR amplification by 35 extension through the primer sequence, which results in the separation of fluorescent and quencher molecules.

WO 2004/090159 PCT/AU2004/000480 23 v) Assays that rely on an increase in fluorescence resonance energy transfer can be used which utilize two specially designed adjacent primers, which have different fluorochromes on their ends. When these primers anneal to a specific PCR amplified product, the two fluorochromes are brought together. The excitation of one 5 fluorochrome results in an increase in fluorescence of the other fluorochrome. Probes and primers may be fragments of DNA isolated from nature or may be synthetic. In one embodiment, primers/probes have a high melting temperature of >70"C so that they may be used in rapid cycle PCR. Preferably, the primers/probes comprise at least 10, 15 or 20 nucleotides. Typically, primers/probes consist of fewer 10 than 50 or 30 nucleotides. Primers/probes are generally polynucleotides comprising deoxynucleotides. They may also be polynucleotides which include within them synthetic or modified nucleotides. A number of different types of modification to oligonucleotides are known in the art. These include methylphosphonate and phosphorothioate backbones, addition of acridine or polylysine chains at the 3' and/or 5' 15 ends of the molecule. For the purposes of the present invention, it is to be understood that the polynucleotides described herein may be modified by any method available in the art. Primers/probes may be labelled with any suitable detectable label such as radioactive atoms, fluorescent molecules or biotin. The primers be synthesized using techniques which are well known in the art. 20 Generally, the primers can be made using synthesizing machines which are commercially available. If required, in order to facilitate subsequent cloning of amplified sequences, primers may have restriction enzyme sites appended to their 5' ends. Thus, all nucleotides of the primers are derived from the gene sequence of interest or sequences 25 adjacent to that gene except the few nucleotides necessary to form a restriction enzyme site. Such enzymes and sites are well known in the art. A sample to be typed for the presence and/or identification of a S. pneumoniae serotype may be from a bacterial culture or a clinical sample from a patient, typically a human patient. Clinical samples may be cultured to produce a bacterial culture. 30 However, it is also possible to test clinical samples directly with a culturing step. The methods of the present invention can be used in a multi-step serotyping strategy. An example of such a multi-step serotyping strategy (algorithm) is shown in Table 6. However, a variety of other strategies are envisaged and can be designed by the skilled person using the sequence heterogeneity information presented herein. In 35 particular, it is preferred that the serotyping procedure comprise at least one analysis step based on analysing one or regions between the 3' end of the cpsA gene and the 5' WO 2004/090159 PCT/AU2004/000480 24 end of the cpsB gene. This analysis may optionally be combined with an analysis of one or more regions within the wzy and/or wzx genes. Microarrays 5 Analysis of S. pneumoniae genomic sequences using the above techniques may take place in solution followed by standard resolution using methods such as gel electrophoresis. However in a preferred aspect of the invention, the primers/probes are immobilised onto a solid substrate to form arrays. The polynucleotide probes are typically immobilised onto or in discrete regions 10 of a solid substrate. The substrate may be porous to allow immobilisation within the substrate or substantially non-porous, in which case the probes are typically immobilised on the surface of the substrate. Examples of suitable solid substrates include flat glass (such as borosilicate glass), silicon wafers, mica, ceramics and organic polymers such as plastics, including polystyrene and polymethacrylate. It may 15 also be possible to use semi-penneable membranes such as nitrocellulose or nylon membranes, which are widely available. The semi-permeable membranes may be mounted on a more robust solid surface such as glass. The surfaces may optionally be coated with a layer of metal, such as gold, platinum or other transition metal. Preferably, the solid substrate is generally a material having a rigid or semi-rigid 20 surface. In preferred embodiments, at least one surface of the substrate will be substantially flat, although in some embodiments it may be desirable to physically separate synthesis regions for different polymers with, for example, raised regions or etched trenches. It is also preferred that the solid substrate is suitable for the high density application of DNA sequences in discrete areas of typically from 50 to 100 pm, 25 giving a density of 10000 to 40000 cm- 2 . The solid substrate is conveniently divided up into sections. This may be achieved by techniques such as photoetching, or by the application of hydrophobic inks, for example teflon-based inks (Cel-line, USA). Discrete positions, in which each different probes are located may have any convenient shape, e.g., circular, rectangular, 30 elliptical, wedge-shaped, etc. Attachment of the library sequences to the substrate may be by covalent or non covalent means. The library sequences may be attached to the substrate via a layer of molecules to which the library sequences bind. For example, the probes may be labelled with biotin and the substrate coated with avidin and/or streptavidin. A 35 convenient feature of using biotinylated probes is that the efficiency of coupling to the solid substrate can be determined easily. Since the polynucleotide probes may bind WO 2004/090159 PCT/AU2004/000480 25 only poorly to some solid substrates, it is often necessary to provide a chemical interface between the solid substrate (such as in the case of glass) and the probes. Thus, the surface of the substrate may be prepared by, for example, coating with a chemical that increases or decreases the hydrophobicity or coating with a chemical that 5 allows covalent linkage of the polynucleotide probes. Some chemical coatings may both alter the hydrophobicity and allow covalent linkage. Hydrophobicity on a solid substrate may readily be increased by silane treatment or other treatments known in the art. Examples of suitable chemical coatings include polylysine and poly(ethyleneimine). Further details of methods for the attachment of are provided in 10 US 6,248,521. Techniques for producing immobilised arrays of nucleic acid molecules have been described in the art. A useful review is provided in Schena et al. (1998), which also gives references for the techniques described therein. Microarray-manufacturing technologies fall into two main categories-synthesis 15 and delivery. In the synthesis approaches, microarrays are prepared in a stepwise fashion by the in situ synthesis of nucleic acids from biochemical building blocks. With each round of synthesis, nucleotides are added to growing chains until the desired length is achieved. A number of prior art methods describe how to synthesise single stranded nucleic acid molecule libraries in situ, using for example masking techniques 20 (photolithography) to build up various permutations of sequences at the various discrete positions on the solid substrate. US 5,837,832 describes an improved method for producing DNA arrays immobilised to silicon substrates based on very large scale integration technology. In particular, U.S. Patent No. 5,837,832 describes a strategy called "tiling" to synthesize specific sets of probes at spatially-defined locations on a 25 substrate which may be used to produced the immobilised DNA libraries of the present invention. US 5,837,832 also provides references for earlier techniques that may also be used. The delivery technologies, by contrast, use the exogenous deposition of prepared biochemical substances for chip fabrication. For example, DNA may also be 30 printed directly onto the substrate using for example robotic devices equipped with either pins (mechanical microspotting) or piezo electric devices (ink jetting). In mechanical microspotting, a biochemical sample is loaded into a spotting pin by capillary action, and a small volume is transferred to a solid surface by physical contact between the pin and the solid substrate. After the first spotting cycle, the pin is washed 35 and a second sample is loaded and deposited to an adjacent address. Robotic control systems and multiplexed printheads allow automated microarray fabrication. Ink jetting WO 2004/090159 PCT/AU2004/000480 26 involves loading a biochemical sample, such as a polynucleotide into a miniature nozzle equipped with a piezoelectric fitting and an electrical current is used to expel a precise amount of liquid from the jet onto the substrate. After the first jetting step, the jet is washed and a second sample is loaded and deposited to an adjacent address. A 5 repeated series of cycles with multiple jets enables rapid microarray production. In one embodiment, the microarray is a high density array, comprising greater than about 50, preferably greater than about 100 or 200 different nucleic acid probes. Such high density probes comprise a probe density of greater than about 50, preferably greater than about 500, more preferably greater than about 1,000, most preferably 10 greater than about 2,000 different nucleic acid probes per cm 2 . The array may further comprise mismatch control probes and/or reference probes (such as positive controls). Microarrays of the invention will typically comprise a plurality of primers/probes as described above. The primers/probes may be grouped on the array in any order. 15 Elements in an array may contain only one type of probe/primer or a number of different probes/primers. Detection of binding of S. pneumoniae DNA to immobilised probes/primers may be performed using a number of techniques. For example, the immobilised probes which are specific for one or a number of serotypes, may function as capture probes. 20 Following binding of the genomic DNA to the array, the array is washed and incubated with one or more labelled detection probes which hybridise specifically to regions of the S. pneumoniae genome which are conserved (for example the S. pneuioniae psaA or pneumolysin probes/primers described herein could be utilized for this purpose). The binding of these detection probes may then be determined by detecting the 25 presence of the label. For example, the label may be a fluorescent label and the array may be placed in an X-Y reader under a charge-coupled device (CCD) camera. Other techniques include labelling the genomic DNA prior to contact with the array (using nick-translation and labelled dNTPs for example). Binding of the genomic DNA can then be detected directly. 30 It is also possible to employ a single PCR amplification step using labelled dNTPs. In this embodiment, the genomic DNA fragment binds to a first primer present in the array. The addition of polymerase, dNTPs, including some labelled dNTPs and a second primer results in synthesis of a PCR product incorporating labelled nucleotides. The labelled PCR fragment captured on the plate may then be detected. 35 A number of available detection techniques do not require labels but instead rely on changes in mass upon ligand binding (e.g. surface plasmon resonance- SPR). The WO 2004/090159 PCT/AU2004/000480 27 principles of SPR and the types of solid substrates required for use in SPR (e.g. BIACore chips) are described in Ausubel et al., Short Protocols in Molecular Biology (1999) 4' Ed, John Wiley & Sons, Inc. Examples of the utilization of microarrays in genotyping include the use of 5 microarrays to differentiate between closely related Cryptosporidium parvum isolates and Cryptosporidium species (Straub et al., 2002), the use of microarrays to differentiate between species of Listeria (Volokhov et al., 2002), and the use of microarrays to differentiate within species of Staphylococcus aureus (van Leeuwen et al., 2003). The detection principles applied in these studies can be used with the 10 polymorphisms/primers/probes identified by the present inventors to identify different serotypes of S. pneumoniae in a sample. In the present instance, according to 800bp cpsA-cpsB alignment results (Figure 2) regions, such as the first 20 nucleotides provided in Figure 2, are scanned to see whether they contains polymorphisms. Where polymorphisms occur, probes can be 15 designed for each "type" (allele)-specific probes (and name them as 1-1, 1-2 , etc.), which will cover all the cpsA-cpsB regions for all the known sequence types. The combination of all the above allele-specific probes (about or less than 20 allele x 40~50 =800~1000 probes all together) hybridisation results will define the microarray hybridisation types like MLST (1-0-10-------etc), which would be nearly equal to the 20 sequencing results. Bioinformatics software will tell which sequence type the "specimen/strain" is. Kits In one embodiment, kits of the present invention include, in an amount 25 sufficient for at least one assay, a polynucleotide probe of the invention which preferentially hybridizes to a target nucleic acid sequence in a test sample under hybridization assay conditions. Kits containing multiple probes are also contemplated by the present invention where the multiple probes are designed to target different nucleic acid sequences from different S. pneumoniae serotypes and may include 30 distinct labels which permit the probes to be differentially detected in a test sample. Kits according to the present invention may further comprise at least one of the following: (i) one or more amplification primers for amplifying a target sequence contained in or derived from the target nucleic acid; (ii) a capture probe for isolating and purifying target nucleic acid present in a test sample; and (iii) if a capture probe is 35 included, a solid support material (e.g., magnetically responsive particles) for WO 2004/090159 PCT/AU2004/000480 28 immobilizing the capture probe, either directly or indirectly, in a test sample. Kits of the present invention may further include one or more helper probes. Typically, the kits will also include instructions recorded in a tangible form (e.g., contained on paper or an electronic medium) for using the packaged 5 polynucleotide in a detection assay for determining the presence or amount of a target nucleic acid sequence in a test sample. The assay described in the written instructions may include steps for isolating and purifying the target nucleic acid prior to detection with the polynucleotide probe, and/or amplifying a target sequence contained in the target nucleic acid. The instructions will typically indicate the reagents and/or 10 concentrations of reagents and at least one assay method parameter which might be, for example, the relative amounts of reagents to use per amount of sample. In addition, such specifies as maintenance, time periods, temperature and buffer conditions may also be included. 15 Uses As discussed above, S. pneumoniae is a leading cause of morbidity and mortality causing invasive disease such as meningitis and pneumonia as well as more localised disease such as acute otitis media and sinusitis. Continued surveillance is critical to monitor vaccine efficacy and changes in incidence and distribution of colonising and invasive 20 serotypes. Any increase in disease caused by previously uncommon nonvaccine serotypes could necessitate a change in vaccine composition. Thus, the detection methods, probes/primer and microarrays of the invention may be used to monitor the epidemiology of invasive S. pneumoniae infections to assist in disease control and to inform vaccine policy. 25 The molecular typing methods of the invention may also assist in comprehensive serotype identification that will be useful for epidemiological and other related studies that will be needed to monitor S. pneumoniae before and after introduction of S. pneumoniae vaccines. 30 35 WO 2004/090159 PCT/AU2004/000480 29 EXAMPLES EXAMPLE 1 - Serotyping based on the polymorphisms of the 3' end of the cpsA gene and the 5' end of the cpsB gene, combined in some instances with the analysis of the wzx and/or wzy genes 5 MATERIALS AND METHODS Pneumococcal reference panels (Table 1) Reference panels 1-4, which consisted of 118 isolates, were kindly provided and serotyped by colleagues in Australia and Canada. All had been serotyped using the standard Quellung method and included all 23 serotypes represented in the 10 polysaccharide vaccine, and 28 additional serotypes; there were multiple isolates of 40 serotypes and five isolates that could not be serotyped with available antisera. Reference panel 5 consisted of 21 invasive isolates from our diagnostic laboratory at the Centre for Infectious Diseases and Microbiology (CIDM), Sydney, for which serotypes were known at the beginning of the study. These five reference panels were 15 used for the development and preliminary evaluation of molecular capsular sequence methods. Panels 2 and 4 were tested by molecular capsular sequence, initially, without knowledge of the conventional serotyping (CS) results. Clinical isolates 20 179 consecutive S. pneumoniae clinical isolates from normally sterile sites, collected during the period January 1999 to June 2001, by the CIDM diagnostic laboratory, were studied; 21 were randomly selected to make up reference panel 5 (see above). Dr Diana Martin, Institute of Enviromnental Science and Research (ESR), Wellington, New Zealand provided 103 clinical isolates from diagnostic laboratories 25 throughout New Zealand. Clinical isolates were initially tested using the MCT method, without knowledge of their CS results (single-blind study). Isolates were retrieved from storage by subculture on blood agar plates (Columbia II agar base supplemented with 5% horse blood) and incubated overnight at 37'C CO 2 incubator. 30 35 WO 2004/090159 PCT/AU2004/000480 30 Table 1. Conventional serotyping (CS) and molecular capsular typing (MCT) results of S. pneumoniae strains used in this study. Strain numbers and CS MCT-Seq 2

MCT-PCR

2 GenBankz geographic origin accession numbers Reference panel I Queensland 00S001 19F 19F 19F AF532666 00S002 6B 6B-q 6B AF532705; AY163 180, AY163190 00S006 19A 19A 19A AF532663 00S009 23F 23F-g 23F AF532677; AY163214, AY163232 00S014 1 1 1 AF532632 00S016 9V 9V 9V AF532710 00S023 5 5-q AF532697 00S033 17F 17F-35B AF532657 00S036 11A 11A-q AF532637 00S042 18C 18C/18B 18C AF532661 00S059 9N 9N AF532709 00S063 12F 12F AF532640 00S067 8 8 8 AF532708 00S124 7F 7F AF532707 00S154 15B 15B-q AF532649 00S159 4 4 4 00S168 33F 33F-q 33F/37 AF532687; AY163199, AY163221 00S246 22F 22F AF532673 00S259 2 2-q 2 AF532669 00S300 22A 22A AF532672 01S009 18C 18C/18B 18C 01S020 7C 7C AF532706 01S043 10A 1OA-q AF532633 01S143 3 3 3 AF532682 01S146 1OF 1OF AF532635 01S305 20 20/13 AF532670 01S319 18A 18A 18C AF532658; AY163208, AY163224 01S333 33B 33B 33F-X; AF532686 33F-Y-NEG 01S358 35B 35B AF532691 01S666 14 14-g 14 AF532643 01S682 16F 16F AF532653 01S691 15C 15C-q AF532651 01S753 4 4 4 AF532693 Reference panel 24 Victoria 0013856 35B 35B 0013976 6A 6A-ca 6B 0017666 9V 9V 9V 0019532 23F 23F-g 23F 0102206 8 8 8 0103678 19F 19F 19F 0104603 6B 6B-q 6B 0104604 22F 22F WO 2004/090159 PCT/AU20041000480 31 0104912 4 4 4 0105015 14 14-g 14 AF532644 Reference panel 35 Canada MvA007753 31 31 AF532684 MA007765 5 5-q MA008229 lOF lOF AF532636 MA008562 11A 11IA-q MA008622 31 31 MA050408 23A 23A-23F 23F-X; AF532674 23F-Y-NEG MA050663 18F 18F 18C AF532662; AY163207, AY163230 MA050910 2 2-q 2 MA050947 38 38/2SF AF532712 MA051117 22A 22A MIA051617 35F 35F AF532692 MA051950 31 (see Example 31 AF532695 2) MA052002 15A iSA-cal AF532646 MA052150 11B 11B AF532639 MIA052217 7C 7C MA052253 17F 17F-3513 MA0524-33 23A 23A-ca 23F-X; AF532675 23F-Y-NEG MA052434 15A 15A-ca2 AF532647 MA052628 18C 18C/18B 18C ;AY163215, AY163231 MA052979 15C 15C-ca AF532652 MA053096 20 20/13 MA053188 15B 15B-q MA053392 18B 18B/18C 18C AF532660; AY163211, AY163227 MA053567 12F 12F Na053684 38 38/25F MA053782 13 13/20 AF532642 MA053909 35B 35B MA054004 13 13/20 MA054006 13 13/20 MA054242 38 38/2SF MA054294 16F 16F Na054338 35F 3SF MA054357 1 1I MIA054490 34 34 AF532690 MlA054545 3 3 3 MA054735 1OA 1OA-q MA054832 34 34 MA054883 7F 7F MIA055006 9V 9V 9V MA055054 22F 22F MA055100 6A 6A-ca 6B AF532702; AY163 174, AY163 184 MA056382 19A 19A 19A AF532664 MIA059287 25F 25F/38 AF532711 MIA061296 41A (see Example 41A AF532694 2) NIA061378 17A 17A AF532655 WO 2004/090159 PCT/AU2004/000480 32 MA061938 21 21 AF532671 MA062028 29 29 AF532680 MA062610 18B 18B/18C 18C -; AY163210, AY163226 MA063013 9N 9N MA063073 33F 33F-g/33A 33F/37 AF532689; AY163201, AY163220 MA063087 33A 33A/33F-g 33F/37 AF532685; AY163204, AY163222 MA063189 Nonserotypeable No-amplicon MA063207 37 37 33F/37 AF532713; AY163205, AY163223 MA063745 Nonserotypeable Nonserotypeable-ca AF532715 Reference panel 4' New South Wales 00-177-0145 19A 19A 19A 01-184-0091 18C 18C/18B 18C 00-237-0230 17F 17F-35B AF532656 01-273-0175 16F 16F 00-201-0306 14 14-g 14 01-117-0176 13 13/20 01-239-0283 12F 12F 00-206-0233 11A 1IA-q 00-222-0342 10A 1OA-23F 23F-NEG AF532634 01-180-0149 1 1 1 01-122-0226 6A 6A-ca 6B AF532698; AY163172, AY1 63182 99-308-0385 4 4 00-234-0199 38 38/25F 00-074-0065 35F 35F 00-280-0121 3 3 3 99-308-0290 23F 23F-g 23F 00-244-0101 22F 22F 00-250-0302 22A 22A 00-244-0108 20 20/13 01-009-0101 19F 19F 19F AF532668 01-254-0150 7F 7F Reference panel 57 New South Wales, (CIDM) 00-163-0650 14 14-g 14 00-141-1399 19F 19F 19F 00-070-0212 23F 23F-g 23F 01-018-1842 4 4 4 00-201-1422 6B 6B-g 6B AF532703; AY163178, AY163188 00-180-2749 9V 9V 9V 00-339-3084 9N 9N 00-017-0985 11A 11A-q 01-072-0391 12F 12F AF532641 00-315-3100 15B 15B-c AF532648 99-259-1456 18C 18C/18B 18C 00-273-2862 4 4 4 00-081-2291 33F 33F-g/33A 33F/37 -; AY163198, AY163216 00-118-2067 5 5-c AF532696 WO 2004/090159 PCT/AU2004/000480 33 01-175-0822 7F 7F 00-324-0978 8 8 8 00-152-1664 22F 22F 00-211-1414 22F 22F 00-200-0078 14 14-g 14 00-118-0159 19F 19F 19F 00-310-1104 4 4 4 Clinical isolates New South Wales, (CIDM) 01-192-3558 6B 6B-g 6B 01-192-2471 6A 6A-c 6B AF532699; AY163173, AY163183 01-192-1205 6B 6B-g 6B 01-191-1265 14 14-g 14 01-189-0296 19F 19F 19F 01-185-0511 15B 15B-22F AF532650 01-184-0328 8 8 8 01-179-2448 14 14-g 14 01-178-0165 14 14-g 14 01-176-3302 1 1 1 01-173-2782 4 4 4 01-170-0873 9V 9V 9V 01-159-0505 14 14-g 14 01-157-3399 4 4 4 01-157-3394 4 4 4 01-157-2062 4 4 4 01-152-3295 14 14-g 14 01-150-3706 14 14-g 14 01-144-1862 7F 7F 01-143-3353 4 4 4 01-124-2300 12F 12F 01-117-1910 4 4 4 01-096-2050a 9V 9V 9V 01-096-2050b 9V 9V 9V 01-096-2027 9V 9V 9V 01-077-1533 7F 7F 01-075-3257 9N 9N 01-058-3662 14 14-g 14 01-048-1320 19A 19A 19A 01-005-0764 19F 19F 19F AF532650 00-361-1217 6B 6B-q 6B 00-357-1164 14 14-g 14 00-339-2918 9N 9N 00-324-0977 8 8 8 00-315-2993 23F 23F-g= 23F IOA-23F 00-315-2254 23F 23F-g= 23F IOA-23F 00-310-0630 14 14-g 14 00-303-0303 19F 19F 19F 00-293-1660 19F 19F 19F 00-280-1493 33F 33F-q 33F/37 AY163200, AY163217 00-267-0653 8 8 8 WO 2004/090159 PCT/AU2004/000480 34 00-258-1120 14 14-g 14 00-257-0881 9V 9V 9V 00-256-1986 6A 6A-ca 6B AY163176, AY163186 00-251-3185 6A 6A-6B-g= 6B AF532700; 6B-g AY163171,AY163181 00-245-3950 23F 23F-g= 23F 1OA-23F, 00-243-2229 3 3 3 00-242-0394 14 14-g 14 00-241-2964 9V 9V 9V 00-238-3448 23F 23F-g= 23F 1OA-23F 00-235-3584 19F 19F 19F AF532665 00-228-3777 35B 35B 00-225-1482 3 3 3 00-225-0333 19F 19F 19F 00-217-3003 4 4 4 00-211-1669 6B 6B-c 6B AF532704; AY163179, AY163189 00-211-0475 22F 22F 00-211-0469 22F 22F 00-209-3409 3 3 3 00-208-0179 4 4 4 00-200-1013 14 14-g 14 00-200-1012 14 14-g 14 00-199-0498 4 4 4 00-196-2923 9V 9V 9V 00-192-2087 19A 19A 19A 00-184-1203 6B 6B-q 6B 00-181-1568 23F 23F-g= 23F 1OA-23F 00-181-1567 23F 23F-g= 23F 10A-23F 00-173-3686 4 4 4 00-164-1705 6B 6B-q 6B 00-163-1533 14 14-g 14 00-149-1265 7F 7F 00-149-1264 7F 7F 00-143-1473 15B 15B-22F 00-138-3435 3 3 3 00-118-2891 19F 19F 19F 00-093-1315 3 3 3 AF532681 00-078-0883 14 14-g 14 00-074-3370 14 14-g 14 00-070-0212 23F 23F-g= 23F 1OA-23F 00-066-3506 4 4 4 00-043-0876 19A 19A 19A 00-036-1378 19F 19F 19F 00-008-0865 8 8 8 99-348-3354 6A 6A-ca 6B 99-338-1052 19F 19F 19F 99-325-0373 23F 23F-c 23F AF532678 99-324-1010 4 4 4 99-404-0191 4 4 4 WO 2004/090159 PCT/AU2004/000480 35 99-310-0070 4 4 4 99-302-1894 9V 9V 9V 99-293-1704 19A 19A 19A 99-287-2376 35B 35B 99-287-2320 35B 35B 99-287-2298 35B 35B 99-284-1034 14 14-c 14 AF532645 99-276-0568 9V 9v 9V 99-242-0442A 6B 6B-q 6B 99-241-1187A 4 4 4 99-237-2839 9V 9V 9V 99-235-2193 4 4 4 99-226-1026B 7F 7F 99-221-2755 9V 9V 9V 99-221-2745A1 23F 23F-g= 23F 1OA-23F 99-221-0278 4 4 4 99-218-2527 23F 23F-g= 23F 1OA-23F 99-201-1708 3 3 3 99-196-2909B 10A 1OA-23F 23F-NEG =23F-g 99-196-2908B 10A 1OA-23F= 23F-NEG 23F-g 99-196-2882A 10A 10A-23F 23F-NEG =23F-g 99-196-2880A IA 1OA-23F 23F-NEG =23F-g 99-195-0430 14 14-g 14 99-193-2919A 4 4 4 99-193-2918B 4 4 4 99-193-2747B 4 4 4 99-193-2491A 18C 18C/18B 18C 99-192-0047B 23F 23F-g= 23F 1OA-23F 99-188-2369A 4 4 4 99-186-2831 7F 7F 99-186-1038 14 14-g 14 99-186-0417 14 14-g 14 99-184-0894 14 14-g 14 99-182-1919 4 4 4 99-180-2653 4 4 4 99-178-0901 14 14-g 14 99-177-1060 11A 11A-q 99-176-1983 18C 18C/18B 18C 99-173-2956 4 4 4 99-169-0432 6B 6B-g 6B 99-159-2018 7F 7F 99-158-1250 14 14-g 14 99-157-0650 19F 19F 19F 99-146-2324 19F 19F 19F 99-144-1497 22F 22F 99-134-2273 3 3 3 99-132-2724 15B 15B-q 99-132-2558 15B 15B-q 99-132-2557 15B 15B-q WO 2004/090159 PCT/AU2004/000480 36 99-130-2037 14 14-g 14 99-110-2820 9N 9N 99-108-0976 23F 23F-g= 23F 1OA-23F 99-107-0715 14 14-g 14 99-104-1860 4 4 4 99-099-0423 19F 19F 19F 99-095-1044 20 20/13 99-091-2295 23B 23B 23F-NEG AF532676 99-090-2551 14 14-g 14 99-090-2390 3 3 3 99-090-2387 3 3 3 99-033-2630 23F 23F-g= 23F 1OA-23F 99-028-0057 7C 7C 99-011-0311A 4 4 4 Clinical isolates New Zealand (ESR) 9 NZSPNOO/9 4 4 4 NZSPNOO/42 18C 18C/18B 18C NZSPNOO/59 5 5-q NZSPNOO/87 13 13/20 NZSPNOO/88 6B 6B-g 6B NZSPNOO/91 8 8 8 NZSPNOO/319 18B 18B/18C 18C AY163212, AY163228 NZSPNOO/366 7F 7F NZSPNOO/426 3 3 3 NZSPNOO/454 23F 23F-23A= 23F AF532679 23A-23F NZSPNOO/470 9V 9V 9V NZSPNOO/480 6A 6A-ca 6B NZSPNOO/484 23F 23F-g= 23F IOA-23F NZSPNOO/499 19F 19F 19F NZSPNO1/162 2 2-q 2 NZSPNO1/243 33F 33F-q 33F/37 AY163203, AY163219 NZSPNO1/393 35F 35F NZSPNO1/468 11A 11A-q NZSPNO1/481 16F 16F NZSPNO1/484 23F 23F-g= 23F 1OA-23F NZSPNO1/490 22F 22F NZSPNO1/493 9N 9N NZSPNO1/509 23A 23A-ca 23F-X; 23F-Y-NEG NZSPN01/510 12F 12F NZSPNO1/520 9V 9V 9V NZSPNO1/531 8 8 8 NZSPNO1/534 3 3 3 NZSPNO1/538 38 38/25F NZSPNO1/543 10A 1OA-q NZSPNO1/546 4 4 4 NZSPNO1/547 20 20/13 WO 2004/090159 PCT/AU2004/000480 37 NZSPNO1/548 7F 7F NZSPNOI/549 1 1 1 NZSPNOI/553 17F 17F-c NZSPNOI/554 19F 19F 19F NZSPN01/555 18C 18C/18B 18C NZSPNO1/557 19A 19A 19A NZSPN01/559 6A 6A-c 6B NZSPN01/560 14 14-g 14 NZSPNOI/561 6B 6B-q 6B NZSPNO0/12 17F 17F-c NZSPNOO/50 Nonserotypeable Nonserotypeable-nz AF532714 NZSPNO0/59 5 5-q NZSPNOO/75 Nonserotypeable No-amplicon NZSPNO0/180 9V+14 9V 9V+14 NZSPNO0/221 38 38/25F NZSPNOO/225 13 13/20 NZSPNOO/242 35F 35F NZSPNO0/353 18A 18A 18C AF532659; AY163209, AY163225 NZSPNOO/410 33F 33F-q 33F/37 AF532688; AY163202, AY163218 NZSPN1/93 16F 16F NZSPN01/122 10A IOA-q NZSPN01/146 38 38/25F NZSPN1/166 16F 16F AF532654 NZSPN01/204 35B 35B NZSPNO1/209 22A 22A NZSPNO1/240 12F 12F NZSPNO1/254 35F 35F NZSPN1/262 8 8 8 NZSPN01/276 6A 6A-6B-q 6B =6B-q AY163177, AY163187 NZSPN1/278 18B 18B/18C 18C AY163213, AY163229 NZSPN01/291 6B 6B-q 6B NZSPN01/303 Nonserotypeable No-amplicon NZSPN01/313 18C 18C/18B 18C NZSPN01/329 6A 6A-6B-g 6B AF532701; =6B-g AY163175, AY163185 NZSPN1/335 19A 19A 19A NZSPN01/344 18C 18C/18B 18C NZSPN01/361 9N 9N NZSPN01/363 18C 18C/18B 18C NZSPN1/366 6A 6A-ca 6B NZSPN1/369 1sC 18C/18B 18C NZSPN01/374 35B 35B NZSPN01/387 22F 22F NZSPN1/388 12F 12F NZSPN01/389 20 20/13 NZSPN01/403 20 20/13 NZSPN1/411 11A 11A-nz AF532638 NZSPN01/418 8 8 8 NZSPN1/428 3 3 3 AF532683 NZSPNO1/431 1 1 1 NZSPN1/437 1 1 1 NZSPNO1/438 22F 22F WO 2004/090159 PCT/AU2004/000480 38 NZSPNO1/448 11A 11A-q NZSPNO1/455 19A 19A 19A NZSPN01/463 IA IOA-q NZSPN01/465 22F 22F NZSPNO 1/477 1OA 1OA-23F 23F-NEG =23F-g NZSPNO1/478 20 20/13 NZSPNO1/483 8 8 8 NZSPNO1/485 12F 12F NZSPN01/489 3 3 3 NZSPNO1/497 9N 9N NZSPNO1/505 19A 19A 19A NZSPNO1/512 7F 7F NZSPNOI/515 3 3 3 NZSPN01/516 1 1 1 NZSPNO1/529 1 1 1 NZSPNO1/532 4 4 4 NZSPNO1/535 7F 7F NZSPN01/539 19F 19F 19F NZSPN01/545 18C 18C/18B 18C NZSPN01/556 6B 6B-q 6B NZSPN01/558 14 14-g 14 Notes, 1. CS of selected S. pneunoniae isolates from reference panels 1 and 3 was 5 repeated by Gail Stewart and Robert Gange at Department of Microbiology, Children's Hospital at Westmead, New South Wales, Australia. 2. MCT was performed and GenBank accession numbers generated by Fanrong Kong at Centre for Infectious Diseases and Microbiology (CIDM), Institute of Clinical Pathology and Medical Research (ICPMR), Westmead Hospital, Westmead, New 10 South Wales, Australia. See text for molecular capsular subtype (mctsp) nomenclature. 3. Provided by Denise Murphy, Pneumococcal Reference Laboratory, Public Health Microbiology, Queensland Health Scientific Services, Queensland, Australia. 4. Provided by Associate Professor Geoff Hogg and Jenny Davis, Microbiological Diagnostic Unit (MDU), Public Health Laboratory, Department of Microbiology and 15 Immunology, University of Melbourne, Victoria, Australia. 5. Provided by Dr. Louise P. Jette, Institut National de Sante Publique du Quebec Laboratoire de Sante Publique du Quebec, Sainte-Anne-de-Bellevue, Quebec H9X 3R5, Canada. 6. Provided by Dr. Michael Watson, Department of Microbiology, Children's 20 Hospital at Westmead, New South Wales, Australia. 7. Selected 21 S. pneumoniae clinical isolates, of which CS results were known, from the CIDM diagnostic laboratory.

WO 2004/090159 PCT/AU2004/000480 39 8. 152 Australian S. pneunoniae clinical isolates, of which CS results were known, from the CIDM diagnostic laboratory. 9. 103 New Zealand S. pneumoniae clinical isolates Provided by Dr. Diana Martin, from Streptococcus Reference Laboratory, at Institute of Environmental Science and 5 Research (ESR), Wellington, New Zealand. Conventional serotyping (CS) CS was performed by the Quellung reaction using rabbit polyclonal antisera 10 from the Statens Serum Institute, Copenhagen, Denmark (Sorensen, 1993). Briefly, 2 pL of a suspension of isolate, in 10% formalin saline, and 1 iL of antisera, under a glass coverslip were examined for capsular swelling using a light microscope at 400x magnification. Clinical isolates from CIDM were serotyped at Department of Microbiology, Children's Hospital at Westmead, Sydney, Australia and those from 15 New Zealand by the Streptococcus Reference Laboratory, at ESR, Wellington, New Zealand. Selected New Zealand clinical isolates for which only serogroup results were available and selected isolates from reference panels 1 and 3 were re-tested at Children's Hospital at Westmead. 20 Molecular capsular sequence typing - development of method Oligonucleotide primers The oligonucleotide primers used in this study, their target sites and melting temperatures are shown in Table 2 and the primer pair specificities and expected amplicon lengths in Table 3. Primers were designed with high melting temperatures to 25 be used in rapid cycle PCR (Kong et al., 2000). Four previously published S. pneumoniae-specific primers, targeting psaA (P1, P2) (Morrison et al., 2000) and pneumolysin (Ila, Ilb) (Salo et al., 1995) were modified to give high melting temperatures and used to confirm that isolates were S. pneumoniae. Primers were designed to amplify and sequence portion of the cpsA-cpsB 30 gene region and to amplify serotype/serogroup-specific sequences in the wzy and wzx genes of 16 S. pneumoniae serotypes for which cps gene cluster sequences were available. In order to further explore the sequence heterogeneity, part of the wzx and wzy genes of isolates belonging to serogroups 6, 18, 23 and 33/37 were also sequenced. For serotype 3, which does not contain wzy and wzx genes, serotype-specific PCR 35 targeted the orf2 (wze)-cap3A-cap3B region (Arrecubieta et al., 1996).

WO 2004/090159 PCT/AU2004/000480 40 uQ u 0U CIDP, H0 0- 0 enH H~~Z~ E-4 H H ~ ~ 0 H H H~ 0 ~~0~LQ H H ~ C), HFHH. C) L)~ Oz z~ 0 I uH H HZ ZJ R ~HU ~ c)GIH~'0 r~ C, 0 u u fzH-t4 E ~Ho~7u E-1 w E- - Wf 00) = 0 - 0 0 0 C0 0Z en 10 C 11 en M 0 V e e'= = - LO) = 0 Hl u~ r-- v- ur rr C6- C7\ C -- 0 20 WO 2004/090159 PCT/AU2004/000480 41 H H 0 H 0 0 ~ 00 inH el~ 0 HU 00 U oc H Z -u ON E-4 00O H U 0 H~~~. EHH-4 ~U~ o u0 E-ZH (go~. RHH U~ HZ 2) H- E. 0 , -<CJH u0 o 0 0 re 4 00 ozo m~ ;tn N g E-o op~ U - 2 C.-' 0 c)f ~ .* " ~ ~~0 o~~~ C) CD 0 t- i *c-6 C Nl N N '0 N0 0 m N N N N1 N0 0. C'. m e oo' U U U U U con CIO \.0 CIO 0 - l C14 lzr I- t '.0 \.0 '. .0 0 00- WO 2004/090159 PCT/AU2004/000480 42 H- H H Z 0 Q HH z u 0 C u Y& 0 u 0~' C Q-H H Z~0 H H< U~~ ~Z W au ~ ~ p =u l C [-40 H = UW H. * F' C)0 OH 0 (5 ~HH H H? ZC) 000 e4 0 n w a -~~E .- - , , c o n ' - t- < - P- t - 0 - u < E- W-C -) C5 u l <4 WO 2004/090159 PCT/AU2004/000480 43 UU ,! 0 uH Hw z E m kn e ~ OHF-:Z 0w0w - H~ Qu - HH F4 < = u r 71~ H 0 00< HE- e4 oQ oc< I u ( Ecc-4 Hc E- CN tCN u I~ z e ~ ~ ~ ~ t' CO t'- cc - e\o0- ~ oo Go 00 m~ 0 a, 'IT \,D 'TC C, m O r r 0 n M0 , 'N

C

rf) en~ WO 2004/090159 PCT/AU2004/000480 44 H H H0~~ u ,~ 0 H0zwp p u 0 u rH- E.HUZU - S H HI u p H H<>o 0 FHH '0g C Y rUH 0 CYc 0 E-1 uH0 H8 IT 0 H U-01 p 0 - M =~ p ~ c' n -1 Cu ' I U Ul 0 m- I> C v ~ cn0 co U cc P- In r Pn "4 U "4 V - uN u crq 00 0 WO 2004/090159 PCT/AU2004/000480 45 P,4 07 U ~~~- uZ~ aH 0 H F- F -IF. H " 0 - 2 zr V E .7 ZF ci 7i Cu ~ z Z Q 0 u -e (D P 0 14 E. W U CD u u H u uuH u u F - 3 u0 WO 2004/090159 PCT/AU2004/000480 46 0 -4 5. P.4 U8U z ~ -' 00 ., WO 2004/090159 PCT/AU2004/000480 47 Table 3. Specificity and expected lengths of amplicons of primer pairs used in this study. Primer pairs' Specificity Length of amplicons (base pairs) P1/P2 S. pneumoniae 864 Ia/IIb S. pneumoniae 224 cpsSl/cpsA3 2 S. pneumoniae 1001 cpsS1/cpsA1 2 S. pneumoniae 520 cpsS3/cpsA2 2 S. pneumoniae 503 1YS/1YA serotype 1 296 2YS/2YA serotype 2 348 4YS/4YA serotype 4 348 6A6BYS/6A6BYA serogroup 6 315 6A6BYSO/6A6BYA12 serogroup 6 747 8YS/8YA serotype 8 277 9V9AYS/9V9AYA serotypes 9V and 9A 338 14YS/14YA serotype 14 310 18CYS/18CYA serogroup 18 302 18CYSO/18CYA1 2 serogroup 18 671 19FYS/19FYA serotype 19F 286 19AYS/19AYA serotype 19A 270 19B19CYS/19B19CYA serotypes 19B and 19C 428 23FYS/23FYA serotype 23F 280 33F37YS/33F37YA serotypes 33F/33A/37 310 33F37YSO/33F37YA12 serotypes 33F/33A/37 668 1XS/1XA serotype 1 426 2XS/2XA serotype 2 429 4XS/4XA serotype 4 324 6A6BXS/6A6BXA serogroup 6 305 6A6BXSO/6A6BXA1 2 serogroup 6 1102 8XS/8XA serotype 8 325 9V9AXS/9V9AXA serotypes 9V and 9A 368 14XS/14XA serotype 14 289 18CXS/18CXA serogroup18 368 18CXSO/18CXA1 2 serogroup 18 721 19FXS/19FXA serotype 19F 305 WO 2004/090159 PCT/AU2004/000480 48 19AXS/19AXA serotype 19A 300 19Bl9CXS/19B19CXA serotypes 19B and 19C 327 23FXS/23FXA serotypes 23F/23A 401 23FXSO/23FXA1 2 serotypes 23F/23A 744 33F37XS/33F37XA serogroups 33/37 328 33F37XSO/33F37XA12 serotypes 33F/33A/37 746 3S1/3A1 serotype 3 321 3S2/3A2 serotype 3 297 Notes. 1. See Table 2 for primer sequences. 2. For sequencing use only. 5 DNA preparation, PCR and sequencing DNA extraction, PCR and -sequencing were performed as previously described (Kong et al., 2002). 10 Sequence comparison, multiple sequence alignments, and phylogenetic analysis Sequences were compared using Bestfit in Comparison program group. Multiple sequence alignments were performed with Pileup and Pretty in Multiple Sequence Analysis program group. Phylogenetic relationships were studied using Ednadist and 15 Ekitsch in Evolutionary Analysis program group. All programs are provided in WebANGIS, ANGIS (Australian National Genomic Information Service), 3 rd version. Nucleotide sequence accession numbers The new partial sequence data for cpsA-cpsB, wzy (polymerase) and wzx 20 (flippase) genes for selected reference and clinical isolates reported in this paper have appeared in the GenBank Nucleotide Sequence Databases, with accession numbers AF532632-AF532715, and AF163171-AF163232, respectively (Table 1). Previously reported sequence data used in this paper, in addition to those listed in Table 2, have appeared in GenBank Nucleotide Sequence Databases with the 25 following accession numbers: U15171, U66846 and U66845 (cps gene cluster for serotype 3); NC_003028 serotypee 4 genome); AJ239004 (cps gene cluster for serotype 8); AF030367-AF030372 (cps gene cluster for serotype 19F); AF105113 (partial cps gene cluster for serotype 19A); AF 105114 and AF106137 (partial cps gene WO 2004/090159 PCT/AU2004/000480 49 clusters for serotype 19B); AF105115 (partial cps gene clusters for serotype 19C); AF030373 and AF030374 (cps gene clusters for serotype 23F). RESULTS 5 Both pairs of S. pneumoniae species-specific primers (targeting psaA and pneumolysin genes) produced amplicons of the expected size from all reference and clinical isolates except six of 179 CIDM isolates, which, on retesting, were optochin resistant and therefore excluded from further study as they were not S. pneumoniae. The sequencing primers, cpsS1/cpsA3, formed amplicons from all but 13 10 reference and clinical isolates. Of these 13 isolates, 10 (eight belonging to serotypes 38/25F and two that were nonserotypable) formed amplicons with primer pairs cpsS1/cpsA 1 and cpsS3/cpsA2. Three nonserotypable isolates did not form amplicons using any of the primer pairs targeting the cpsA-cpsB region, although they had been confirmed to be S. pneumoniae using both species-specific PCR. 15 Sequence heterogeneity in the region between the 3'-end of cPsA and the 5'-end of cpsB The present inventors sequenced and analyzed 800 bp fragments of the region between the 3'-end of cpsA (starting at base pair 951) and the 5'-end of cpsB (see 20 Figure 2). Representative sequences were deposited into GenBank (see Table 1 for accession numbers). There were 424 sites that were identical for all 51 serotypes represented among the isolates examined, leaving 376 (47%) heterogeneity sites. Intra- and inter-serotype/subtype heterogeneity 25 Only single isolates were available for 11 serotypes and the mixed serotype 9V/14 (see below). Among 40 serotypes, for which multiple isolates were available, 14 were divided into molecular capsular sequence types, on the basis of major and/or stable intra-serotype heterogeneity. Molecular capsular sequence types were named according to their conventional serotype (cs) and, generally, the source of the isolate in 30 which the sequence difference was first identified [-g = Genbank sequence; -c (CIDM); -q (Queensland); - ca (Canada); -nz (New Zealand)]. When sequences characteristic of two serotypes were present in the cpsA-cpsB region subtype names included both, with the CS first (e.g 23F-23A when CS was 23F; 23A-23F when CS was 23A). Seventeen serotypes had no intra-serotype heterogeneity and in nine there were minor and/or less 35 stable variations between isolates and/or between sequences disclosed herein with corresponding sequences in GenBank (Table 4, Figure 2).

WO 2004/090159 PCT/AU2004/000180 50 00 in 0 in E0 N~ r-C1 0 n - I - t ;tg 0 p 0 *0 0 0 w c -cf m t fce 1 CI) 0 '-~r~c~1 c~1 '~t- O ". 0C 0~~t kn~i '~'o i ~~~- t--1 cf" 0nI~ +R O Ln 'o \ +~ eq u Z z + + 0 I N qt ) o WO 2004/090159 PCT/AU2004/000480 -o00 00 00 H QCi'\D ) 00 O C)N D 00 00 t-~ 11 0-0 00. . 0 '' C ~~~1 I c IC d

I

C) ~ ~ u & 't' ON1 Ui cicO \ NN cq N c c t- ooi MNC Ln 00 +~ L- \0 ,I '-t L(Nq kc t ''en t -- O 0 04 $ ci ,'~" II I I WO 2004/090159 PCT/AU2004/000480 52 LIn &u 00 Cln 000 1r & CD0 Clq C*cr cN kO) m c 00 1 I ~ t C - '00 CI rl-~O C) enC4 , C)Nl co tr) tn kn CdO(O 0 T * ** * Q l C~ rf~~0 I/ 00 C - NO ef~ l~lt~/m Ur C \ O t-:II ON 00I0IN / NO clC QQ o C II 0 P I/N -n tn W n n V t 0 0 --1 -1 r. - - -q r i r WO 2004/090159 PCT/AU2004/000480 Q l Cl In 1 Cl q CfCl 00 ~ "~0L u I * Cl I C) 0 00 x~ m N /N CNN 000 C c m LN 0 00 ~ r Cl 00N CIO C7,C ON + XCCD + C+ C)-1m - 4" Cl lCt ZZ- WO 2004/090159 PCTIAU2004/000480 54I m N C\cq I 0 NQ

.E

Q~r 00 l O HOO 0 000 ON ON mmm ni WO 2004/090159 PCT/AU2004/000480 55 There were 368 heterogeneity sites that allowed differentiation between molecular capsular sequence types, including both specific and shared sites (Table 4, Figure 2). 5 Phylogenetic tree based on region of the 3'-end of cpsA -the 5'-end of cpsB genes Using these 800bp sequences, a phylogenetic tree was inferred for the 132 (included the new sequences from Example 2) S. pneumoniae molecular capsular sequence type analysis of the cpsA-cpsB region (Figure 3 - it should be noted that in Figure 3 the sequence types were renamed based on serotype and their GenBank 10 accession numbers). Typical class I serotypes (e.g. 1, 18C, 19F), a typical class II serotype (e.g 33F, represented by 33F-g) and a nontypical class II serotype (19A) were each in different clusters of the tree (Jiang et al., 2001). The phylogenetic tree provides evidence for, and suggests possible sources of, recombination between cpsA-cpsB genes of classes I and II. For example, subtype 23F 15 c (or 23F-AF532678) clustered with 15A-c2 (or 15A-AF532647), but in a separate cluster from other 23F and 15A subtypes, suggesting that they may have arisen by recombination between 23F and 15A, respectively, and other serotypes. Molecular capsular sequence typing based on cpsA-cpsB region sequences 20 The molecular capsular sequence type, assigned on the basis of cpsA-cpsB sequence, was the same as the CS for all isolates belonging to 36 of 51 serotypes (or 304 of 394 [77%] isolates), and for the majority of isolates (25 of 39) belonging to another five serotypes (Table 5). The remaining isolates in these serotypes shared sequences with other serotypes, namely 6A with 6B, 10A and 23A with 23F, 15B with 25 22F and 17F with 35B, presumably as -a result of recombination. There were five serotype pairs, represented by 46 isolates, whose members had identical sequences: namely 20/13, 18C/18B, 38/25F, 31/42 and 33F-g/33A.

WO 2004/090159 PCT/AU2004/000480 ~56 M 00 0 cc --- 4 W20 1-1 j o Uo 00 48 Q* n- n 4 - nN0 PQ L) ) oot-t-= C C WO 2004/090159 PCT/AU2004/000480 rj~ ~57 000 ,0 0)c 0 c) 0~ 0 c 0 000 tn r- 0 0 00 00 00m "00 - -, m lC kn knm 0 00 00 C ll lC: m m -- q~~~~C Cl -- q -4Cl.4 - 4 ' WO 2004/090159 PCT/AU2004/000480 58 0 0 0000 0 0 A

PZI

4 PT 00 m m 00 0 0 Q. Q M ~ C Ln CCf M nLnr n mf kn Cf\ m n n WO 2004/090159 PCT/AU2004/000480 59 4- 0 0 0 0) U A 5U o 4, L o U I: 00 r ~. t US 1I. tr4 pq Cd t0 Elil C14 tn ~ WO 2004/090159 PCT/AU2004/000480 60 Molecular capsular sequence typing based on PCR targeting wzv and wzx (orf2 [wzef cap3A-cap3B for serotype 3) There is significant sequence heterogeneity in wzy and wzx (data not shown), which made them suitable PCR targets for serogroup or serotype identification (Tables 5 2 and 3). With few exceptions, primer pairs targeting these genes formed amplicons only from the corresponding serotypes represented in the five reference panels. Exceptions were: PCR targeting serotype 6B also amplified 6A; PCR targeting 18C amplified all serotypes in serogroup 18; PCR targeting wzx (but not wzy) of serotype 23F, amplified three serotype 23A strains; PCR targeting wzx and wzy of serotypes 10 33/37 amplified a 33A isolate and that targeting wzx amplified a serotype 33B isolate. The specificity of serotype 3-specific primers targeting the orf2 (wze)-cap3A cap3B genes (Arrecubieta et al., 1996) was confirmed by production of an amplicon of the expected size from all 17 serotype 3 isolates. Thus, a serotype or serogroup was assigned by PCR to all 239 isolates belonging to serotypes/serogroups for which 15 specific PCR was developed (Table 5). Comparison of molecular capsular sequence typing based on cpsA-cpsB sequencing and PCR/sequencing targeting wzx and wzv The results of PCR and cpsA-cpsB sequencing were consistent except that PCR 20 could not distinguish between some members of serogroups 6, 18, 23 and 33/37 and further sequencing (of wzx, wzy) was required to identify individual molecular capsular sequence types (see below). The cpsA-cpsB sequences of six 10A isolates were identical to those of 23F, but the isolates were negative in the 23F-specific PCR targeting wzx and wzy (10A-23F). 25 Relationships within serogroups Sequence analysis of the cpsA-cpsB region and wzy and wzx genes (data not shown) showed variable phylogenetic relationships between members of different serogroups. 30 Serogroup 6 Serotypes 6A and 6B were divided into five and three subtypes, respectively, based on different sequence patterns in the cpsA-cpsB region. Three 6A isolates had sequences in this region characteristic of serotype 6B (Table 4). Serotypes 6A and 6B 35 could not be distinguished by PCR targeting wzx and wzy. Sequencing of these genes correctly identified all except one 6A isolates, but some 6A and 6B subtypes share WO 2004/090159 PCT/AU2004/000480 61 identical or very similar sequences. The serotype of the discrepant isolate (serotype 6A, 6B-q) was checked independently by two laboratories (Vakevainen et al., 2001). Serogroup 18 5 Serotypes 18C and 18B had identical cspA-cpsB region sequences and were close to 1SA and 18F in the class I cluster (Figure 3). PCR targeting both wzx and wzy genes amplified all four serotypes. Sequences of 18C and 18B were identical to each other, but different from those of serotypes 18A and 18F, which were also distinguishable from each other. 10 Serogroup 23 Serotypes 23F, 23A (except 23F-23A and 23A-23F) and 23B were separated into different clusters based on cpsA-cpsB sequence differences. Serotype 23A (including 23A-23F) was identified on the basis of a positive result with 23F-specific 15 primers targeting wzx and a negative result with the corresponding wzy PCR. Sequencing could differentiate individual serotypes (23A, 23F and 23B) except 23F 23A and 23A-23F. Mcst 23F-c, 23A-23F and 23F-23A have apparently arisen by recombination between 23F, 23A and/or others, producing sequences in the cpsA-cpsB regions that are quite different from their parental types. 20 Serogroups 33 and 37 Serotypes 33A and 33F-g share identical cpsA-cpsB sequences and that of 33B is similar; 37 and 33F-g cluster together, as do 33B and 33F-q (Figure 3). The 33F/37 specific wzx PCR amplified 37, 33F, 33A and 33B, indicating similarities at that site, 25 although sequencing showed clear differences between 33B and the others. The 33F/37-specific wzy PCR amplified 37, 33F and 33A but not 33B. Thus, met 33B was identified on the basis of a positive result with 33F/37-specific primers targeting wzx and a negative result with the corresponding wzy PCR. 30 Other serogroups Despite antigenic similarities that determine their membership of the same serogroup, serotypes 9N and 9V appear to be genetically distant, on the basis of significant differences between their cpsA-cpsB sequences and the fact that 9V-specific PCR did not amplify 9N. 35 Similarly, met 19F and 19A had quite different cpsA-cpsB region sequences and separated into different clusters. 19F-specific PCR did not amplify 19A and vice versa.

WO 2004/090159 PCT/AU2004/000480 62 There were differences between met 19F, 19A, 19B, 19C in wzx and wzy sequences (except wzy sequence of 19C was not available in GenBank), but they formed two groups - 19F, 19A and 19B, 19C. Serotypes 7F and 7C separated into different clusters based on cpsA-cpsB 5 sequences, as did 11A and 11B (Figure 3). Serotypes 15B and 15C had similar cpsA cpsB sequences and clustered together, except for 15B-22F. Serotypes 17F (including 17F-c and 17F-35B) and 17A were clustered together. Serotypes 35F and 35B are closely related based on similar cpsA-cpsB sequences. 10 Mixed culture One clinical isolate identified as serotype 9/14 using antisera was positive in 9V- and 14-specific PCR (targeting both wzx and wzy), but was identified as met 9V by sequencing. The isolate was subcultured and 16 individual colonies were rested. All 16 colonies were positive in both met 9V-specific and negative in both 14-specific PCR 15 assays and were identified as met 9V by sequencing. The serotype of the original isolate was rechecked and the results (mixed serotype 9/14) were as before. It was therefore assumed that the original isolate was a mixture, predominantly of serotype 9V with a minor component of serotype 14. 20 Comparison of serotype identification results between molecular capsular sequence typing and CS After CS and molecular capsular sequence typing had been completed, the results were compared. Initial results were discrepant for 29 isolates; repeat serotyping and/or correction of clerical errors resolved all but five discrepancies. Final results 25 correlated between CS and molecular capsular sequence typing methods for all isolates of 38 serotypes (318 isolates), 20 of 25 of another three serotypes and all five nonserotypable isolates (total 343 isolates). In addition, there were 46 isolates belonging to pairs of serotypes whose members could not be distinguished from each other by molecular capsular sequence typing but all were assigned to the pair that 30 included the serotype to which they had been assigned by CS. These results were classified as consistent. The five discrepant results were: one isolate of serotype 6A was identified as 6B-q, two isolates of serotype 15B were identified as 22Fand two isolates of serotype 17F as 35B. 35 WO 2004/090159 PCT/AU2004/000480 63 Algorithm for serotype assignment of S. pneumoniae by molecular capsular sequence typing An algorithm for practical use of the molecular capsular sequence typing method for the identification of S. pneumoniae serotypes is shown in Table 6. 5 DISCUSSION Sequences of 16 cps gene clusters showed that all have the same four genes at their 5' ends - cpsA (wzg)-cpsB (wzh)-cpsC (wzd)-cpsD (wze) - which are the sites for recombination events that generate new forms of capsular polysaccharide. The 10 sequences for different serotypes can be divided into two classes and show evidence of interesting recombination patterns. The study of 51 serotypes, of which 40 were represented by more than one isolate, showed that the cpsA-cpsB sequences for the same serotypes were generally stable or could be consistently divided into a small number of subtypes. This shows that 15 sequence patterns in this region can be used to identify different serotypes/serosubtypes. It has been shown previously that PCR-RFLP based on the cpsA-cpsB region can predict S. pneuioniae serotypes (Lawrence et al., 2000). However, the method generates a long amplicon (1.8kbp), requires the use of three restriction enzymes and 20 special equipment and has limited discriminatory ability. The present inventors identified 376 sequence heterogeneity sites, in the cpsA cpsB region, among the 51 serotypes studied (Table 4, Figure 2), which allowed a practical MCT assay based on sequencing to be developed. Several pairs of primers were designed to amplify a 1001 bp segment within the cpsA-cpsB region, based on the 25 following considerations. The primers formed amplicons from virtually all, S. pneumoniae isolates (>99% of those examined); the amplicon is small enough to be amplified using normal PCR protocols; the region of interest (800bp) can be sequenced using a single reaction and the method is objective. The target included most of the variable sites (bp 951 to 1747), providing maximum discrimination between closely 30 related serotypes (e.g. members of serogroups 33 and 37 that could not be distinguished by serotype/group-specific PCR).

WO 2004/090159 PCT/AU2004/000480 64 M un CC .4-15 M~ ~~40, IN 00S~0 u 0 0 UE ~C 1 00- WO 2004/090159 PCT/AU2004/000480 65 Some of the 376 heterogeneity sites in the cpsA-cpsB region were specific for individual molecular capsular sequence type (Table 4, Figure 2), while others were shared between several. Based on these patterns, plus PCR and selective sequencing of type-specific regions of wzx and wzy, most of the 51 serotypes represented among our 5 394 isolates could be distinguished and further divide them into a total of 71 molecular capsular sequence types, with the aid of sequence analysis software. The final CS and molecular capsular sequence typing results correlated for 343 isolates of 389 (88%) for which results for both methods were available, including five that were nontypable by either method. For 46 isolates belonging to five serotype pairs, members of which 10 could not be distinguished by sequencing, results were classified as consistent leaving unresolved discrepancies between methods for only five (1.2%) isolates. Sequence analysis of the cps gene clusters of 16 serotypes showed that wzy (capsular polysecharide polymerase gene) and wzx (capsular polysocharide flippase gene) are highly variable, making them suitable targets for direct serotype identification 15 by PCR. The present inventors designed serotype-specific PCR primers for these serotypes, targeting wzx and wzy and, for serotype 3, which has no wzy and wzx genes, targeting orf2 (wze)-cap3A- cap3B (Arrecubieta et al., 1996). It was found that presumed serotype-specific primers for 6A, 18C, 23F and 33F/37 were not serotype specific, but amplified other related serotypes. To improve the molecular capsular 20 sequence typing methods, portions of the wzy and wzx genes of serotypes within these groups were sequenced, which allowed molecular capsular sequence types to be distinguished within these serotypes/groups and demonstrate relationships between them. The present inventors have recognized that the large number of pneumococcal 25 serotypes would make it impractical to use serotype-specific PCR for all of them. Nevertheless, wzy and wzx PCR can be used to resolve discrepancies between CS and cpsA-cpsB region sequencing assays e.g. for molecular capsular sequence types 10A 23F and 23A-23F. Moreover, the use of two target regions in the cps gene cluster helps to clarify the relationships between mcst that have apparently arisen by recombination. 30 Serotype/group-specific primers were evaluated using three reference panels, which had been characterised by CS and used to identify clinical isolates of unknown es. By PCR alone, 239 (61%) of our 394 clinical isolates were assigned to a serotype or serogroup (Table 5). This method can be extended to other met, when additional wzx and wzy sequences are available.

WO 2004/090159 PCT/AU2004/000480 66 In some circumstances, sequencing of the cpsA-cpsB region may be more practical than type-specific PCR. For most serotypes only a single method and fewer primers (cpsS l/cpsA3-for most serotypes/isolates) are needed. Previous studies have shown that serotypes included in 23-valent polysaccharide 5 and 11-, 9-, 7-valent protein conjugate vaccines are those most frequently isolated from normally sterile sites (CSF, blood) (Colman et al., 1998; Huebner et al., 2000). Among 173 consecutive pneumococcal "sterile site" isolates from adults in the CIDM diagnostic laboratory, over a 2.5-year period, correlation between the met and cs was good (171/173 CIDM isolates were correctly identified). The exceptions were two 10 serotype 15B isolates that were identified as molecular capsular sequence type 22F. Five serotypes (4, 14, 19F, 23F, 9V -covered by all pneumococcal vaccines) accounted for 57% of isolates. Five of 394 isolates studied were nontypable by both CS and molecular capsular sequence typing (Barker et al., 1999). Isolates may be nonserotypable because of 15 decreased type-specific-antigen synthesis, nonencapsulated phase variation or insertion or mutation of genes of cps gene .clusters. Failure to type them by molecular capsular sequence typing reflects the fact that the sequence database is still incomplete (also the reason for the further research in Example 2), although the target regions of two of the five nonserotypable isolates have been sequenced. 20 In summary, the present inventors have developed a molecular capsular sequence typing system for S. pneumoniae, which is reproducible, can be performed by any laboratory with access to PCR/sequencing and does not require large panels of expensive serotype-specific antisera. Work on an international collection of isolates in our reference panels demonstrated a strong correlation between the cpsA-cpsB 25 sequence and CS. Heterogeneity in a relatively short sequence (800bp) in this region, supplemented by serotype/group-specific PCR targeting wzx and wzy, correctly predicted the serotype of most unknown isolates belonging to 51 serotypes. These novel molecular capsular sequence typing methods provide comprehensive strain identification that will be useful for epidemiological studies that will be needed to 30 monitor serotype distribution and detect serotype switching, if any, among S. pneumoniae isolates before and following introduction and widespread use of conjugate vaccines. 35 WO 2004/090159 PCT/AU2004/000480 67 EXAMPLE 2 - Identification of S. pneumoniae serotypes by analysis of the wzx and/or wzy genes MATERIALS AND METHODS Pneumococcal clinical isolates 5 This study was based on 92 well-characterized S. pneumoniae isolates, which represented 55 serotypes and including about 31 of 39 serotypes that were not included in Example 1. The sources of these isolates were 72 from China Medical Bacteria Culture Collection Center, Beijing, PR China; 17 from Royal College of Pathologists of Australasia, Quality Assurance Program Pty Limited, New South Wales, Australia; 10 three from Associate Professor Geoff Hogg and Ms Jenny Davis, Microbiological Diagnostic Unit (MDU), Public Health Laboratory, Department of Microbiology and Immunology, University of Melbourne, Victoria. Conventional serotyping (CS) had been performed by donor laboratory and serotypes of the 75 strains were known at time of receipt and 23 selected isolates (including all of serotypes 27, 28F and 16A isolates 15 and two from Example 1 - which had been identified as one each of serotype 42 and 41F strains each) were re-tested by the Quellung reaction - as described above - at Department of Microbiology, Children's Hospital at Westmead (Henrichsen, 1999). Isolates were retrieved from storage by subculture on blood agar plates (Columbia II agar base supplemented with 5% horse blood) and incubated overnight at 20 37"C in 5% CO 2 . Annotation and analysis of wzx and wzv Analysis of homology and protein hydrophobicity was performed to annotate the wzx and wzy genes in S. pneumoniae cps gene cluster. Blast and PSI-blast (Altschul 25 et al., 1997) were used for searching databases including GenBank and Pfam protein motif database (Bateman et al., 2002) for possible gene functions. The TMHMM v2.0 analysis program (Chen et al., 2003) was used to identify potential transmembrane segments from the amino acid sequence. Sequence alignment and comparison were done using the program ClustalW (Thompson et al., 1994). The phylogenetic trees were 30 generated by neighbour-joining method using programme MEGA (Kumar et al. 1994) (Figures 4 and 5). Oligonucleotide primers In addition to our previous MCT primers (Example 1) numerous serotype(s) 35 specific oligonucleotide primers, targeting wzy and wzx (one pair), were designed for this study. The specificity, sequences, numbered base positions and melting WO 2004/090159 PCT/AU2004/000480 68 temperatures (Tm) are shown in Table 7. Expected amplicon lengths of different primer pairs can be calculated from the 5'-end positions of the corresponding primers. DNA preparation, PCR, sequencing and sequence analysis 5 DNA extraction, PCR, sequencing and sequence analysis were performed as described Example 1. The only exception was that, for the new PCRs, 55-60'C was used as annealing temperature because of the low Tm values of the new primers. Nucleotide sequence accession numbers 10 56 new sequences generated in this study, for partial cpsA (wzg)-cpsB (wzh) genes were deposited in GenBank with accession numbers: AY508586-AY508641. These sequences form part of the present invention. RESULTS AND DISCUSSION 15 Conventional serotyping (CS) results Conventional serotyping, of 23 strains, was repeated because of apparent sharing of sequence types between two or more serotypes. After careful repetitions by two different persons, a previous serotype 42 isolate was confirmed to be serotype 31 and a previous serotype 41F isolate to be serotype 41A (Example 1); serotypes of three 20 additional isolates were also corrected. The serotypes of the other 15 isolates were confirmed to be as previously defined (including all the serotypes 27, 28F and 16A isolates, one each of serotypes 6A, 38 and 25F isolate). The final results are shown in Table 8. 25 Partial cpsA-cpsB sequencing primers The sequencing primers cpsSl-cpsA3 produced amplicons from all strains studied in this and our previous study, except for two belonging to rare serotypes, 25F and 38, and five that were non-serotypeable (Example 1). Two additional primer pairs, cpsSl-cpsAl and cpsS3-cpsA2, formed amplicons from strains belonging to serotypes 30 25F and 38 and two non-serotypeable isolates. 35 WO 2004/090159 PCT/AU2004/000480 69 Table 7. Oligonucleotide primers used in this study. Name of primers Sequence and orientation of oligo-nucleotides Positions Tm 1OA-10B-wzy-sense 5'-TTGAGCTATTTAAGGACCTGGG-3' 395 58.4 (SEQ IDNO:144) 1OA-1OB-wzy-antisense 3'-AGTTCTTTCACTGCGAACGATT-5' 677 58.4 (SEQ ID NO:145) 1OC-10F-wzy-sense 5'-GTCAATAAGTTTAAGTGTTATAGGGC-3' 51 59.0 (SEQ ID NO:146) 1OC-10F-wzy-antisense 3'-CAAGCGTTGTGGGTAGTGATAT-5' 337 63.5 (SEQ ID NO: 147) 13-wzy-sense 5'-GATGGGAAAATACGATATGCTC-3' 427 56.1 (SEQ ID NO:148) 13-wzy-antisense 3'-CGACCTCAAAACAGTACCTCAA-5' 736 58.5 (SEQ ID NO:149) 20-wzy-sense 5'-CTTTATCAGGAATACGCCAATC-3' 383 56.5 (SEQ ID NO:150) 20-wzy-antisense 3'-GCAACCAAGAGCAATAATATGTCC-5' 683 58.3 (SEQ ID NO:151) 13-wzx-sense 5'-CTTTTCTTCGTATGCTTTAGGG-3' 93 56.3 (SEQ ID NO:152) 13-wzx-antisense 3'-GACTATCCACATTAGAGATAGAAGG-5' 460 53.9 (SEQ ID NO:153) 20-wzx-sense 5'-GTTCTTTGTTTGACCCTTCCTT-3' 289 57.2 (SEQ ID NO:154) 20-wzx-antisense 3'-TATCTTATGCGGTCTGTCGTAA-5' 604 56.4 (SEQ ID NO:155) 16F-wzy-sense 5'-TTGTTCTTACATTTAGCCGTAGTG-3' 434 56.9 (SEQ ID NO:156) 16F-wzy-antisense 3'-GACAGTGAGATAGTGAGTCGTTTA-5' 777 55.9 (SEQ ID NO:157) 27-wzy-sense 5'-CAGAGTTTGGTCGAGGTTCCTA-3' 455 58.7 (SEQ ID NO:158) 27-wzy-antisense 3'-GAGTTAGTTGCTGCCTTTAGTG-5' 782 59.7 (SEQ ID NO:159) 28F-16A-wzy-sense 5'-GATCCGCTCACGGTATGGACTA-3' 261 61.6 (SEQ ID NO:160) 28F- 1 6A-wzy-antisense 3'-GAATAACCGACTGTCGTTTTAA-5' 581 57.1 (SEQ ID NO:161) 16F-wzx-sense 5'-TTTATGAGGAGAGTACTGTATCAGA-3' 1219 53.1 (SEQ ID NO:162) 16F-wzx-antisense 3'-ACTCAAGCTATCGATAGTAATTGT-5' 1433 56.6 (SEQ ID NO:163) 27-wzx-sense 5'-TACATTTTTATGAGAAGAGCATTG-3' 1213 54.6 (SEQ ID NO:164) 27-wzx-antisense 3'-GCTATCAGTACTATTTTGTCAC-5' 1439 56.4 (SEQ ID NO:165) 33A-specific-sense 5'-TGTTGTTGGGATTGTCTTGGG-3' length 62.1 (SEQ ID NO:166) WO 2004/090159 PCT/AU2004/000480 70 33A-specific-antisense 3'-GTTTCAAGGCTTTAGGTTTCCG-5' 246bp 62.9 (SEQ ID NO:167) 9V-specific-sense 5'- TCTTTGATTTCATCAGGGATTG-3' length 57.0 (SEQ ID NO:168) 9V-specific-antisense 3'-ATCACCATTGACGCAATCAGGA-5' 545bp 54.2 (SEQ ID NO:169) 15A- 1 5B-15C-wzx-sense 5'-ATTGCGACTGTTAAACGAGAAG-3' 202 57.0 (SEQ ID NO:170) 15A-15B-15C-wzx- 3'-CCGTGTCTAAATACCTTTATGT-5' 514 55.0 antisense (SEQ ID NO:171) 15B-15C-wzy-sense 5'-TAATAAGCGGATGATTGTAGCG-3' 693 58.1 (SEQ ID NO:172) 15B-i 5C-wzy-antisense 3'-GGGTAGACCTTTCAATTAGTCA-5' 1041 55.5 (SEQ ID NO:173) 15A-wzy-sense 5'-TATTTCCTTCCTATGGGACAAC-3' 840 55.6 (SEQ ID NO:174) 15A-wzy-antisense 3'-CACCACTACTAATCGTAATAACA-5' 1100 54.2 (SEQ ID NO:175.) 22F-22A-wzy-sense 5'-AGGATGCAGTAGATACCAGTGG-3' 398 56.1 (SEQ ID NO:176) 22F-22A-wzy-antisense 3'-CCTGTTGTTGGAGGCAAATATC-5' 752 56.2 (SEQ ID NO:177) 22F-22A-wzx-sense 5'-GGTTCTATCAAGGAAAAGAGGAC-3' 404 56.3 (SEQ ID NO:178) 22F-22A-wzx-antisense 3'-CAACCCAAGTCACTAACGATAA-5' 672 56.3 (SEQ ID NO:179) 11A-specific-sense 5'-CACTTCCATATCCAGCAT-3' 727-744 47.5 (SEQ ID NO:180) 1 1A-specific-antisense 3'-GACAGAGGACTATCAAGAGT-5' 970-989 46.4 (SEQ ID NO:181) 7A-wzy-specific-sense 5'-GCAAGTGTTTCAATGGGAGTA-3' 76 55.3 (SEQ ID NO:182) 7A-wzy-specific-antisense 3'-GAATAACATACCAGGGAGGCA-5' 420 56.1 (SEQ ID NO:183) 7A-wzx-specific-sense 5'-TTTGAGAATGCGGATAAGGTG-3' 730 58.0 (SEQ ID NO:184) 7A-wzx-specific-antisense 3'-GAGTAACATTGTCCCGTTTGAA-5' 1060 56.7 (SEQ ID NO:185) 11A-11D-wzy-specific- 5'-CGAAATATCGCCATTCATCAG-3' 190 58.4 sense (SEQ ID NO: 186) 11A-11D-wzy-specific- 3'-TCACCGTGTCAACGACAACTAA-5' 570 59.8 antisense (SEQ ID NO:187) 1lA-11D-wzx-specific- 5'-CAATCAATAATGCCGCATAC-3' 856 54.3 sense (SEQ ID NO: 188) 1lA-11D-wzx-specific- 3'-CTAAAGCAATCAAAGGTGTCCA-5' 1140 55.6 antisense (SEQ ID NO: 189) 12B-wzy-specific-sense 5'-TGGAGGAGCAACTGACGTATT-3' 518 57.3 (SEQ ID NO:190) 12B-wzy-specific- 3'-GAGAACTTATACCTGCCACCT-5' 783 57.5 antisense (SEQ ID NO:191) WO 2004/090159 PCT/AU2004/000480 71 12B-wzx-specific-sense 5'-GTATGTTATTCGTTAGACAAACTGG-3' 1058 55.6 (SEQ ID NO:192) 12B-wzx-specific- 3'-GACATCCAAATACATAACGCTCAA-5' 1363 56.0 antisense (SEQ IDNO:193) 17F-wzy-specific-sense 5'-CTATTTACCTTGTTTCCTGCAAC-3' 490 56.1 (SEQ ID NO:194-) 17F-wzy-specific-antisense 3'-CTATTGCGATACAGTCGTTAAG-5' 838 54.9 (SEQ ID NO:195) 17F-wzx-specific-sense 5'-GGATTACAAGAAATTCCCTCG-3' 722 56.0 (SEQ ID NO: 196) 17F-wzx-specific-antisense 3'-TCCACTATACGCCTCGGTTAT-5' 1094 59.8 (SEQ ID NO:197) 47F-wzy-specific-sense 5'-TTTGGGTCTCCTTTACCTATC-3' 725 53.2 (SEQ ID NO:198) 47F-wzy-specific-antisense 3'-CACTACTTCTCAATCCCCTTT-5' 1195 53.7 (SEQ ID NO:199) 25A-29-wzy-specific-sense 5'-CCGAAAATTGTTCACAGGATAC-3' 112 56.8 (SEQ ID NO:200) 25A-29-wzy-specific- 3'-CTATACGGAACATAGGTAGTTAG-5' 474 55.9 antisense (SEQ ID NO:201) 47F-wzx-specific-sense 5'-AGCAGCAATTGTTTCTGTCTTAACA-3' 1128 60.6 (SEQ ID NO:202) 47F-wzx-specific-antisense 3'-GAGATTTTCACTATCTACACTATCTT-5' 1389 52.8 (SEQ ID NO:203) 25A-29-wzx-specific-sense 5'-CTCCCTATCATTACTACTCCCTATG-3' 58 56.2 (SEQ ID NO:204) 25A-29-wzx-specific- 3'-AATCCACGCTGTCAAGAAAGTG-5' 274 57.4 antisense (SEQ ID NO:205) 1OC-10F-wzy-specific- 5'-GTCAATAAGTTTAAGTGTTATAGGGC-3' 51 56.2 sense (SEQ ID NO:206) 1OC-10F-wzy-specific- 3'-CAAGCGTTGTGGGTAGTGATAT-5' 337 57.8 antisense (SEQ ID NO:207) 7C-wzy-sense 5'-ACTCAAGTATCTGTGC/TCACCTT-3' 453 55.7 (SEQ ID NO:208) 7C-wzy-antisense 3'-CCTCGTCCATCTCCTTCACTAA-5' 703 57.1 (SEQ ID NO:209) 7C-wzx-sense 5'-TGAGTTTCCGATTAGAGCAG-3' 317 53.0 (SEQ ID NO:210) 7C-wzx-antisense 3'-CCTTTACTACGCCATCCATA-5' 740 54.4 (SEQ ID NO:21 1) 9L-9N-wzy-sense 5'-TCAATGGCGACTTTATTTGC-3' 72 55.0 (SEQ ID NO:212) 9L-9N-wzy-antisense 3'-CGTGGGATGTCCTCTATTATCTGA-5' 434 56.2 (SEQ ID NO:213) 9L-9N-wzx-sense 5'-GTACCGCAAGCTATTCTAATGA-3' 388 54.9 (SEQ ID NO:214) 9L-9N-wzx-antisense 3'-GTCATTCTATCCGCTTCAAATAG-5' 853 53.4 (SEQ ID NO:215) 17A-wzy-sense 5'-TAGACTTCTTAGAGCCTATTGTGG-3' 722 55.3 (SEQ ID NO:216) WO 2004/090159 PCT/AU2004/000480 72 17A-wzy-antisense 3'-CTGGTTATCGCGTTTGACAATA-5' 1040 56.9 (SEQ ID NO:217) 17A-wzx-sense 5'-CAAACCCTTAGTCCAATATGGCTG-3' 624 62.2 (SEQ ID NO:218) 17A-wzx-antisense 3'-CCGATGGATAATAAGGGAAGCAAC-5' 988 61.0 (SEQ ID NO:219) 23A-wzy-sense 5'-CATTTGGTATGGGAGTAGGGAG-3' 1049 58.1 (SEQ ID NO:220) 23A-wzy-antisense 3'-GTGAAAGAGGATTGAGTACGTGG-5' 1326 58.5 (SEQ ID NO:221) 33B-48-wzy-sense 5'-TAATCAA/GTGGTCTGGTGGTCA/GA-3' 453 57.9 (SEQ ID NO:222) 33B-48-wzy-antisense 3'-GAAAC/TAAT/CGAGGATAACT/CGACT-5' 815 57.2 (SEQ ID NO:223) 23F-wzy-sense 5'-TGTCAGCAGAAAATATGACGC-3' 402 56.4 (SEQ ID NO:224) 23F-wzy-antisense 3'-CCTTTATGCTGCTTCCCAATAC-5' 766 58.4 (SEQ ID NO:225) 34-wzy-sense 5'-TGTTGTAGTGGCAGTTGCTCC-3' 740 60.4 (SEQ ID NO:226) 34-wzy-antisense 3'-CGGATGTCCCTTACAGAAATGTTG-5' 1070 59.4 (SEQ ID NO:227) 35A-wzy-sense 5'-TCCTGATTATG/ATTGAGATTTG/CG-3' 399 54.7 (SEQ ID NO:228) 35A-wzy-antisense 3'-GACCTAACGCTTCTGAATGAAT-5' 747 54.8 (SEQ ID NO:229) 36-wzy-sense 5'-CAATTTCCCCTTATTCTGTAGTTC-3' 692 56.8 (SEQ ID NO:230) 36-wzy-antisense 3'-CTCTCTTGTCATATTTGTCCCAGTT-5' 1026 57.0 (SEQ ID NO:231) 39(1)-wzy-sense 5'-GATTGGTTTGGGAACTTGATGTC-3' 232 60.2 (SEQ ID NO:232) 39-wzy-antisense 3'-CACCATACTCCATAGTAAATCGTCC-5' 518 59.5 (SEQ ID NO:233) 41A-wzy-sense 5'-GTAGTTACTGGCCCTTTCTTATTCC-3' 511 59.7 (SEQ ID NO:234) 41A-wzy-antisense 3'-GTTCTACGTCTATCAAAGAGCGAT-5' 828 59.0 (SEQ ID NO:235) 41A-wzx-sense 5'-CAGCAAATGCAGGTTCTCAAA-3' 278 59.0 (SEQ ID NO:236) 41A-wzx-antisense 3'-ACTGTGGAGCAGATCGTATAGTAAT-5' 566 58.9 (SEQ ID NO:237) 43-wzy-sense 5'-GATCAAATGGTGGTATTAGGAA-3' 251 54.0 (SEQ ID NO:238) 43-wzy-antisense 3'-CGGTCAGTATAAAAGGTTAAGA-5' 601 55.8 (SEQ ID NO:239) 43-wzx-sense 5'-TTCTTATCGCTTCCATTGTCAG-3' 907 57.5 (SEQ ID NO:240) 43-wzx-antisense 3'-CCACATTCACCTCGTCGTAAA-5' 1182 57.1 (SEQ ID NO:241) WO 2004/090159 PCT/AU2004/000480 73 47A-wzy-sense 5'-TATTTGCCATAACGGACTCTAGAAC-3' 485 59.5 (SEQ ID NO:242) 47A-wzy-antisense 3'-CACCAATACACCCAAATTAAGAAGC-5' 830 61.5 (SEQ ID NO:243) 47A-wzx-sense 5'-TTTGGGCTCTTTAGGTAGTGTAT-3' 687 55.4 (SEQ ID NO:244) 47A-wzx-antisense 3'-CTGCCTATTACAAGCTATGAAATG-5' 1064 55.3 (SEQ ID NO:245) 48-wzy-sense 5'-CATTTGGAGTTATTGCCCTAC-3' 602 54.5 (SEQ ID NO:246) 48-wzy-antisense 3'-CCCCAGAATTAAATCTTATACCC-5' 909 56.6 (SEQ ID NO:247) 48-wzx-sense 5'-AGGGCTTAACTGTTTCAGTGTT-3' 782 55.5 (SEQ ID NO:248) 48-wzx-antisense 3'-CTAAACCATATCGTCCTGACTT-5' 1113 54.2 (SEQ ID NO:249) 33C-wzy-sense 5'-TTATCTATATGTTAGGGCTG-3' 197 45.3 (SEQ ID NO:250) 33C-wzy-antisense 3'-CTGTGAAGACTTACAACATG-5' 445 43.7 (SEQ ID NO:251) 23B-wzy-sense 5'-TTGGATCGTTGTTCATAGCGG-3' 639 61.0 (SEQ ID NO:252) 23B-wzy-antisense 3'-GACACCTTTACGGCAACGATTC-5' 947 62.5 (SEQ ID NO:253) 23B-wzx-sense 5'-AGCGAGCGGTATCATTCTATTTG-3' 897 60.8 (SEQ ID NO:254) 23B-wzx-antisense 3'-CTATCACAACTTCTTTAACGAGGTC-5' 1219 59.6 (SEQ ID NO:255) 24B-wzy-sense 5'-TCAACACTTATGATGGTGCCTG-3' 685 58.5 (SEQ ID NO:256) 24B-wzy-antisense 3'-ATCTTCACCCTAATAGCCCGA-5' 1025 58.3 (SEQ ID NO:257) 25F-38-wzy-sense 5'-AATCTGAGGAAACTTGGAGCAA-3' 641 58.5 (SEQ ID NO:258) 25F-38-wzy-antisense 3'-GCATAATTGCTAATCTTAACAAGG-5' 977 55.8 (SEQ ID NO:259) 25F-38-wzx-sense 5'-GCAATGGTTTATGGATGATAGAGCG-3' 702 64.3 (SEQ ID NO:260) 25F-38-wzx-antisense 3'-TGTGCTGCTAACGACCACGAAA-5' 1088 64.4 (SEQ ID NO:261) 31-wzy-sense 5'-TGAAAATCCCTTAGTGACATCTG-3' 492 56.5 (SEQ ID NO:262) 31 -wzy-antisense 3'-GACCAGCATCGTAAAGAGTCTA-5' 794 56.5 (SEQ ID NO:263) 32A-32F-wzy-sense 5'-CGGTATGCTTACAATGAGACGC-3' 813 60.2 (SEQ ID NO:264) 32A-32F-wzy-antisense 3'-GTAGAATAGGCCCTTGCTTAAG-5' 1163 60.5 (SEQ ID NO:265) 32A-32F-wzx-sense 5'-GTAACGATGCCTAGAATGACTT-3' 799 53.6 (SEQ ID NO:266) WO 2004/090159 PCT/AU2004/000480 74 32A-32F-wzx-antisense 3'-CACACCATTATCCACGACAATAG-5' 1107 53.9 (SEQ ID NO:267) 35B-wzy-sense 5'-CTAATTTGGCTATGAAGCTAATCCC-3' 626 60.6 (SEQ ID NO:268) 35B-wzy-antisense 3'-CAAATGACTGACGCTGAAATCACTT-5' 1019 58.2 (SEQ ID NO:269) 45-wzy-sense 5'-CTATGCAGGAAATATCCGAGAAGG-3' 111 61.7 (SEQ ID NO:270) 45-wzy-antisense 3'-GTATCGCAAAGACAAAGTGCCTAG-5' 497 63.0 (SEQ ID NO:271) 45-wzx-sense 5'-AATGGCTTGCTCCTATTGCTGT-3' 929 60.9 (SEQ ID NO:272) 45-wzx-antisense 3'-CGTTTAGCAAGAACCCTATCATC-5' 1306 58.1 (SEQ ID NO:273) 41F-wzx-sense 5'-GTCAAAGACAGGAATGACATCTATG-3' 493 57.7 (SEQ ID NO:274) 41F-wzx-antisense 3'-CCCTCCTTCACGAAAATAAAGA-5' 972 56.9 (SEQ ID NO:275) 18A-18-B-18C-18F-wzx- 5'-GGAATCGGACAATAGCAC-3' 35 50.2 sense (SEQ ID NO:276) 18A-18-B-18C-18F-wzx- 3'-ACCAGAACTTCTCAAAGCAT-5' 265 50.5 antisense (SEQ ID NO:277) 19B-19C-wzx-sense 5'-GGCATCAAAGGTTAAGTG-3' 744 48.0 (SEQ ID NO:278) 19B-19C-wzx-antisense 3'-GAAGACAGCGTTGAGAAA-5' 1171 47.5 (SEQ ID NO:279) 19F-wzx-sense 5'-GCTATCTAACATTGCGAGTA-3' 672 48.4 (SEQ ID NO:280) 19F-wzx-antisence 3'-AAACCGAAGGACGAATAT-5' 967 49.1 (SEQ ID NO:281) 2-wzx-sense 5'-TAGCGGTGAATGGCATCT-3' 644 54.1 (SEQ ID NO:282) 2-wzx-antisense 3'-AGTTGGAATCATCCTCGCT-5' 1012 50.6 (SEQ ID NO:283.) 23A-23F-wzx-sense 5'-GGGAAATGGTTTACTATGC-3' 623 49.7 (SEQ ID NO:284) 23A-23F-wzx-antisense 3'-GTTCTTCTATTCTCGCC(T)A-5' 843 47.0 (SEQ ID NO:285) 6A-6B-wzx-sense 5'-ATTTATGAAGGGAAGATGG-3' 1003 49.0 (SEQ ID NO:286) 6A-6B-wzx-antisense 3'-CCGAGCGTCATTATCAAA-5' 1324 47.6 (SEQ ID NO:287) 8-wzx-sense 5'-TATGTTTCAAGGGTTCTG-3' 88 45.2 (SEQ ID NO:288) 8-wzx-antisense 3'-CCTTACCGTCGAATAATA-5' 356 47.4 (SEQ ID NO:289) 9A-9V-wzx-sense 5'-TGATAAGGCTTACCAGTT-3' 732 44.6 (SEQ ID NO:290) 9A-9V-wzx-antisense 3'-CTGACCATAACCCTGATT-5' 1360 44.0 (SEQ ID NO:291) WO 2004/090159 PCT/AU2004/000480 75 12F-12B-44-46-wzy-sense 5'-TGAATATGGACGGTGGAG-3' 767 51.1 (SEQ ID NO:292) 12F-12B-44-46-wzy- 3'-GAAAGCCGAAAGAAACGA-5' 1008 53.1 antisense (SEQ ID NO:293) 14-wzy-sense 5'-GATTGGCTGTTCAAGTGT-3' 230 47.3 (SEQ ID NO:294) 14-wzy-antisense 3'-CCCTGCCTAAATGTAATC-5' 463 47.2 (SEQ ID NO:295) 16F-wzy-sense 5'-TTGTTCTTACATTTAGCCGT-3' 434 50.6 (SEQ ID NO:296) 16F-wzy-antisense 3'-CCCTGAACCTAAACCATT-5' 737 49.9 (SEQ ID NO:297) 1 SA-1 8-B-1 8C-1 8F-wzy- 5'-CATGAAGTTGCACCTATT-3' 409 45.2 sense (SEQ ID NO:298) 18A-1 8-B-1 8C-1 8F-wzy- 3'-CCCTATCCCAAACATTGT-5' 840 47.2 antisense (SEQ ID NO:299) 19F-wzy-sense 5'-AAACGGAAAGTTGGATGG-3' 667 52.8 (SEQ ID NO:300) 19F-wzy-antisense 3'-CAGAAACGACATCCACGAA-5' 1075 49.9 (SEQ ID NO:301) 2-3-wzy-sense 5'-TGTCGGCATTGTATTCTTTA-3' 59 51.9 (SEQ ID NO:302) 2-3-wzy-antisense 3'-CCCAGTCCTAAACCACCA-5' 855 54.4 (SEQ ID NO:303) 37-33F-33A-wzy-sense 5'-TAGGGAAATGGGCGACTC-3' 101 55. (SEQ ID NO:304) 37-33F-33A-wzy-antisense 3'-ACCTCAAACCATAACTCGGA-5' 596 54.7 (SEQ ID NO:305) 6A-6B-wzy-sense 5'-ATTCCAGCGACTACACTT-3' 496 46.7 (SEQ ID NO:306) 6A-6B-wzy-antisense 3'-AATCACCACCATCTAACG-5' 634 45.2 (SEQ ID NO:307) 8-wzy-sense 5'-CACGCAGACTAGAACAGC-3' 606 48.5 (SEQ ID NO:308) 8-wzy-antisense 3'-GAACCAGATACATACGCCA-5' 1055 50.5 (SEQ ID NO:309) 9A-9V-wzy-sense 5'-GTTGGTTTCGACTCTTTG-3' 394 47.5 (SEQ ID NO:310) 9A-9V-wzy-antisense 3'-ITTGCGATGACTGTTAC-5' 1017 45.7 (SEQ ID NO:311) 19B-19C-wzy-sense 5'-TTCGGAGATTTGTGGTAT-3' 478 47.5 (SEQ ID NO:312) 19B-19C-wzy-antisense 3'-AGCAAATACCTCCACCTA-5' 772 50.0 (SEQ ID NO:313) 1-wzx-sense 5'-TGGAGAATTTGCGATTACG-3' 744 54.5 (SEQ ID NO:314) 1 -wzx-antisense 3'-TAGAGTCCCATTTGTCTCAC-5' 886 48.6 (SEQ ID NO:315) 4-wzx-sense 5'-AATGCTTGTACTACTCCCTC-3' 88 48.5 (SEQ ID NO:316) WO 2004/090159 PCT/AU2004/000480 76 4-wzx-antisense 3'-GATACTAAATGCCTACCG-5' 898 48.1 (SEQ ID NO:317) 19A-wzx-sense 5'-TTCCCTATGTCAGTCTATGAA-3' 1000 49.7 (SEQ ID NO:318) 19A-wzx-antisense 3'-TCTTCATAGTATCGGCTTAA-5' 1214 48.8 (SEQ ID NO:319) 1 -wzy-sense 5'-TATTCTATTTCTTACCCGCTAC-3' 211 51.6 (SEQ ID NO:320) 1-wzy-antisense 3'-ATTCACCCGTTCAAAGTAGA-5' 801 52.4 (SEQ ID NO:321) 4-wzy-sense 5'-GTGCCTAGTAGCATTCCATA-3' 1003 50.5 (SEQ ID NO:322) 4-wzy-antisense 3'-GAAACCAATGATACCACCAC-5' 1198 50.4 (SEQ ID NO:323) 19A-wzy-sense 5'-TCGCCTAGTCTAAATACCAA-3' 235 50.7 (SEQ ID NO:324) 19A-wzy-antisense 3'-AAGTGAATCTTAAAGCCGTC-5' 975 53.4 (SEQ ID NO:325) 17F-YS2-sense 5'-AGAGGGATTGTTGAAGGTATTC-3' 754 59.8 (SEQ ID NO:326) 17F-YA2-antisense 3'-CCTACTATCTTTACGCTCTGAT-5' 1060 59.7 (SEQ ID NO:327) 25F-38-YS-sense 5'-GGCGTTGTCAGTGCTAGTTTAG-3' 121 62.6 (SEQ ID NO:328) 25F-38-YA-antisense 3'-CTCATATTACCGACGAAATTGTCC-5' 713 61.6 (SEQ ID NO:329) 35F-47F-YS-sense 5'-ATAAAAAGAAAGTCTTTGCCAGAG-3' 13 60.6 (SEQ ID NO:330) 35F-47F-YA-antisense 3'-CTACTACTTGTATCAGCGATAAC-5' 499 60.0 (SEQ ID NO:331) 25A-29-YS-sense 5'-CCGAAAATTGTTCACAGGATAC-3' 112 62.0 (SEQ ID NO:332) 25A-29-YA-antisense 3'-CTATACGGAACATAGGTAGTTAG-5' 474 60.9 (SEQ ID NO:333) Updated sequence type nomenclature (compared with Example 1) Sequence types were generally named according to the corresponding serotype, 5 with a suffix representing the source of the isolate for which the sequence type was first identified. When sequences characteristic of two to five serotypes were identified, the sequence type name included all, with the lower number serotype first (e.g 15B-15C 22F-22A etc.) (Henrichsen, 1995). Representative sequences of all sequence types were deposited into GenBank (see Table 8 for sequence type nomenclature and 10 corresponding GenBank accession numbers).

WO 2004/090159 PCT/AU2004/000480 77 o 000 000000 00 4 -+ 1 1 rn Ln m0 0 . N N 000 Cdf 5-' - + + 1 CC - ~ON C) ' ~- -'00 000 1~ ' 0\ 0 WO 2004/090159 PCT/AU2004/000480 78 000~ og00 0 000000 0 0 0 00 0 00 0 U QQQQ Q~ QQ Q QQ C) 00 0- C: c:: m N 00 00 00000IC-400 00 00 0000 0 0q 0 0 rJ - cjn cn znMc -N" N- Ni N N 0 ~ N 000 WO 2004/090159 PCT/AU2004/000480 79 Q) Q 0 0 0 0 00 0 00 0 0 0i Q~ 0 u u u u 0 004 000 00 00 ON -z -- 4 co ' - N4 -4 ON _ 00 _c - r NN ON ON M *l 00 04 0 0 00 0 O N N Z0 NN CN 000 0 m tC 0 = 0 0 0- = kn 0 t in m kn M "Ir C 00W n ( 0 n c)m ni ON 4- \ 0 0 ON0 ONW )W)C4V '-.--~~C1 c - 0 0 '- ''O IOn 00 cq + ++ Ci+ + 0d +n e I ' 0 00 C N 0 WO 2004/090159 PCT/AU2004/000480 80 QA Qi wQ WDQ~ rrQQ Q +- + 02 c 0 0 C-Uci Mama-ie ~ on \0 000 c\ m"m 00~~~~,I r-i 0 0,.2 00~ 0 0 n 0 0 , C oo r- 0 0 0 0 I.-, o 0+ + 0c 0 00 ON m -- - - -I r m 1- WO 2004/090159 PCT/AU2004/000480 81 00 00 v0 S0 0 0 0 0 0 0 0 - - Q - - u uj ud Cu Cu Cu C n to I0 0 0 in M~ * -n - . . . . -.

[I0 0 000 - - -- C 00 -l C1- - - , 4 N 4 0 0 00 00 000 '-+ Cd tn Cl Cl In e u , =I M, 4 4 n kn t n ln I k n i n I WO 2004/090159 PCT/AU2004/000480 82 0 0 0 0 0 00 N00 00 00 N N 0000 00 0000c 00 00 00 00 00C CC C~ 0 0 t0 bN N N u2)0 u200 - ' -- -000~~ 0 00 0 ~~ N 00 co In I I I 00 t- cq '. ,N _0 o 0 -C n CP I-~ C 7 tnI -- I c " ~' 0 C~00 5-+ + +2 m_ + ++S 00 00. 00 I -- I I WO 2004/090159 PCT/AU2004/000480 83 0 0 0 00 0 0 00 0) C QQQQ C )C)Q01 C C CN V O) ON ONON NO\N ONO C N ON ON ON 4 - -. C'4 CN N t N 00 VN W) c,0 e r-, '-* '-o 't '-, S- G .o ~ t- ON D 0 - n m -- S m 4 Z kn L - c \It 0 )N wC> mNf 00 00 t~kn Cl ON00 CN* ONO o l c 1-. 1- -4 0 ~ l in e- j O - " WO 2004/090159 PCT/AU2004/000480 84 o~~ 0 _ 00 0 0 0 c-4 -. 4 N -l N N N~ C14 N ~ .- - . - - -n 0q ue 0 0 0 0 ~~~ 000 00 00 0 0 U UUQ ~ QU QQ UU QU Nf - -4z NtC1 0 0 cok c ON N N _N ? 0? ClI GO c, 0 Cl C) 00 -L0 ONor Cr) Cl o cl) C C l\ Cl l tnr-e : ON Cl L- W) I m W C+ ++ + + en + l ol rv e eq 0 Nl 0- C 0 N r* "0 10e INc C 14 ell ml e C 1 cl l (9 Cl Cl C4C WO 2004/090159 PCT/AU2004/000180 85 00 0 0 00 00 0 0 0 0 0 cN O ~ ~ 000 00 O en "0 el e e4 e -4 ;o ;. -- ;, ; 1 ZI,'- 0 ~ 0 0 ,~ 0 1-- 0 +0 t 0 knr-r 00 00 00 ± tnc cq c- t I m n C) co trC n enic 01C1 CN cq ci i Il I ~ C? I I I? I? e:T rn 10 tl -- 10 -- 00 00 00 0000 - 00 0c00 00o ,"0 In In Ln t 00 0O\ in tNnn In N~ N~ m 0 D~ 0N V CA _ + rAA -n e o ~~ ~ M AC~0 00 0 N~00~ ' o oo C- ci N c0 q0 = 40 I I _ hIT kn0c in t- 00 Ni ciciq mi cii- C-cn.cii c WO 2004/090159 PCT/AU2004/000480 86 0 00 0 000 1o 0 o0or0 0 0 0 00 n 00 0 0 ,.-, ~ ~ ~ -, I-, 1- 1 1 e ~ en en) en en en~ en en en en) en f~ n en r) n C 000 0 000000 en m cl en m n m en rn m en en mnememememen rn en n men en meen MMn Rn 00 NN rn en) 0Ne0i0 O kn ci e0 kei 0n en en o tn ooI 0 00 W) kn - N enc > o \CO %.o 00 0 0000 c 00 0o Q - G - ' 'cc ~ a, C clq 00 00 0 ' n D M cM ON ON ON C) m Q\ 00 C: en 00 enC)cf kIN ID,- e n n 00 ) in M n ~ Le 00 me m r o n ++ + ~ ,+ 0en e en n 4 1., t e en to v enn ene C eq m' m- fn en en m m'm'mnm' m 1- 4 tn en en ~ ~ nn en m~e en 't k en een nme en- m e f WO 2004/090159 PCT/AU2004/000480 87 0 0 0 0, 000 uo d 4. ~ Q Q Q cq I It 00 r0 00 V0 _ 000 C , Zl- e 000 0c O\0 00 00 00 CD ~ C>M 0 C:) C)l I00 00 N~0 0C 00 kn + ++ en enI + + ~ + n+ kn) +n + 00+ en en C.) en ' r- ,-' t- 0 r2 in in \0 enr en. ene i WO 2004/090159 PCT/AU2004/000480 88 to ~ +-A _ c A, o 0 0 0 00 0 00C0 00 0 uQ Q Q Q u cl Q Q 4.4 00 00 en 0 fn 't , 64 .~I. en een 0 0 oo en \o C m) A m e n I Ie A 00 ~ 0O\ 0 0 Ln co =0 00 r- Mn M~ Mn =0) Mn C ~ k n M en e n Men Men L 00 0 ' 0~0 0 0 00 00 00 q i Ln V- f ) V)~ C 0 t- W) 0 ) en 0 In Wen 0 etn 1,0 kn L C:) enD 0-n 0' C> - e en C)ne ++ NT tn ~ eq +n0 n0 It Zt' 't.- WO 2004/090159 PCT/AU2004/000480 89 0 t 01- rj) 0 0 :n 0 +' 0 0 u 00 ccZ ,DZ~~0 bl)0 4 0.0 00 0 c0 a~ 00 0 0 c0 rt.0 C 0r 0 0 0> 0 ~r~ ~0 40,~ 0 ,O ~ ~ D Pa0 0C~0 cl 0 .- , 0mo ro 0 0 0 o CI 0 L) 0 co 9 1. .0 0 ,a. 4- 4-4 0 GO* ~'' 000 0 Rp 0 > ( - 0 (D OI 00 0 ;- CC- 4 co Q 4C PJJ C -r, E 000 0~~ -0~ 11P4 u ,- WO 2004/090159 PCT/AU2004/000480 90 Are the shared sequence types plausible? In order to explain the many shared sequence types, we studied their antigenic formula (Henrichsen, 1995). Among the 31 shared sequence types (Table 9), six were shared between unrelated serotypes (2-41A, 1OA-17A, 1OA-23F, 13-20, 25A-29, 33D 5 48), three were shared between two to three related and at least another unrelated serotype (7B-40, 11A-11D-18F, 27-28F-28A, 17F-35B-35C-42) and 20 were shared between antigenically related serotypes. The remaining shared sequence type involved serotypes 16A and 28F; although they are not directly related, 28F is related to serogroup 16 (Table 9) (Henrichsen, 1995). Thus most shared molecular capsular or 10 sequence types (genotypes) involve closely related serotypes (or phenotypes). The 10 shared sequence types that involve unrelated or more distantly related (such as 16A 28F) serotypes probably can be explained by recombination events between serotypes. Are wzx and wzv helpful? 15 In Example 1 it was shown that wzy and wzx based PCRs increase the accuracy of cpsA-cpsB sequence-based serotype prediction. Thus, in order to extend our serotype-prediction strategy to all 90 serotypes, we examined the wzx and wzy sequences of the 90 serotypes, especially the 31 shared sequence types (Tables 7 and 9). In addition to the sequences we have determined, the unannotated sequences from 20 the cps gene clusters of all 90 serotypes as determined by the Sanger Institute was used to determine the 90 wzx and wzy sequences. The identical of suitable serotype-specific wzx and wzy based primers was far from straightforward. For most of the 90 serotypes, wzy is shorter but more heterogeneous than wzx and therefore a more suitable single target for serotype-specific PCR. The wzy sequencing results showed that it would be 25 helpful for the discrimination of 7C-40, 10F-10C, 12A/46 (identical)-12F/12B/44 (identical), 35A-35C/42 (identical), 35F-47F serotype(s) pairs. It is shown that wzx genes from 28 different serotypes share high-level homology (72% to 100%). We found three main recombination sites in these 28 wzx (base positions 395, 775 and 1150) using the programme PhylPro 1.0 (Weiller 1998), 30 which generated the diagrammatic representation of polymorphic sites and hypothetical recombination events of the wzx gene shown in Figure 6.

WO 2004/090159 PCT/AU2004/000480 91 NC C0 C\ 0*j . C> ---, P. 0 0 0 C') C>I A. 0) - - U n 1" 4 - 4U c00 C) C)O e~O A, 00- 60 C 0)0 C'~~~ 0 00 0C ON 6> r. 6 4 C CT (N :I m r CD rA0 ell- t-' t LnQQ cc M = U. eq t-It t- C WO 2004/090159 PCT/AU2004/000480 92 10 0 N 0N CN .c O 11C\C n W ON C6I/ e n 00 a) ~ ~ L Q)i ))r-k Cl ~(ON LO 0 0 0 C14 0 Cn CD 00 0 6 t r 000 ON 0 0C 0 ON Q~ i cn i\ .ON iON *Cn v) !a 12, Z! 00C - ~ *OO 00 kn C: m M ' -4 -0 C>nC I00~K00 F.0 I CIco 0 00 C j' - 0 - e4 C n tn tf) h - - -- - - -j - l C1 el C 4 q C 0mC Ct 0 C \C 00 t- nI* , ei~cCd Ni]NN WO 2004/090159 PCT/AU2004/000480 93 00 0 0 00 00 m f e In m ink 00 0 nk ~rN0000 00 0 0 0> 00 0 0 1 0 (= ** 0 O) 0 0n kn 60o 6 6 6 ) C>00 C 0 0 000 0 m in 000 in 0~ 0n 00 00 1 t 0n M ffMl 0 j N ON0e0 - q0 O N N N 14 e I en M -it- m g On cii en 11 M 00 kf) CC q en 0e el el en m en fn UC Pf) <f ;r wo !e r ==P 00 k 0 0 M ON - 0 00 eqe nMkne ne 00 M t -4"""e le 4e q e e ne ne ne Ve WO 2004/090159 PCT/AU2004/000480 94 CD 0 02 C) L) .0 Q)) 1 0 -4 cd 0 , 'm) 0 m P 4- " 0 0 . C) as u) : 0 -4 ~~~ 0Z)02C c) '. J ) C C44 m WO 2004/090159 PCT/AU2004/000480 95 Comprehensive molecular capsular sequence typing results The final molecular capsular sequence typing results for 519 isolates (427 previously studied and 92 new isolates) are shown in Table 9. Our database now includes 90 S. pneumoniae serotypes and 134 sequence types (including two non 5 serotypeable strains). 83 serotypes are represented by 2 or more strains. 102 sequence types (not including two nonscrotypeable strains), including 47 that are represented by two or more isolates, correspond to a single serotype; 23 sequence types are shared by two serotypes, six are shared by three serotypes and two are shared by four serotypes (Table 8). 10 It will be appreciated by persons skilled in the art that numerous variations and/or modifications may be made to the invention as shown in the specific embodiments without departing from the spirit or scope of the invention as broadly 15 described. The present embodiments are, therefore, to be considered in all respects as illustrative and not restrictive. All publications discussed above are incorporated herein in their entirety. Any discussion of documents, acts, materials, devices, articles or the like which has been included in the present specification is solely for the purpose of providing a 20 context for the present invention. It is not to be taken as an admission that any or all of these matters form part of the prior art base or were common general knowledge in the field relevant to the present invention as it existed before the priority date of each claim of this application. 25 WO 2004/090159 PCT/AU2004/000480 96 REFERENCES Arai, S. et al. (2001) Microbiol. Immunol. 45;159-62. Astschul, S.F. et al. (1997) Nucl. Acids Res. 25;3389-402. 5 Arrecubieta, C. et al. (1996) J. Exp. Med. 184;449-55. Barker, J.H. et al. (1999) J. Clin. Microbiol. 37;4039-41. Bateman, A. et al. (2002) Nucl. Acids Res. 30;276-80. Chen, Y. et al. (2003) Mamm. Genome 14;859-65. Coffey, T.J. et al. (1998) Mol. Microbiol. 27;73-83. 10 Colman, G. et al. (1998). J. Med. Microbiol. 47;17-27. Dunne, W.M., Jr. (2001) J. Clin. Microbiol. 39;1791-1795. Hausdorff, W.P. et al. (2001) Lancet 357;950-2. Henrichsen, J. (1995) J. Clin. Microbiol. 33;2759-62. Henrichsen, J. (1999) Am. J. Med. 107;50S-54S. 15 Huebner, R.E. et al. (2000) S. Afr. Med. J. 90;1116-21. Huebner, R.E. et al. (2000) Int. J. Infect. Dis. 4;214-8. Jiang, S M. et al. (2001) Infect. Immun. 69;1244-55. Kong, F. et al. (2000) J. Clin. Microbiol. 38;4256-9. Kong, F. et al. (2002) J. Clin. Microbiol. 40;216-26. 20 Kumar, S. et al. (1994) Comput. Appl. Biosci. 10:189-91. Lalitha, M.K. et al. (1999) J. Clin. Microbiol. 37;263-5. Lawrence, E.R. et al. (2000) J. Clin. Microbiol. 38;1319-23. Lipsitch, M. (2001) Am. J. Epidemiol. 154;85-92. Morrison, K.E. et al. (2000) J. Clin. Microbiol. 38;434-7. 25 Robertson, G.A. et al. (2004) J. Med. Microbiol. 53;35-45. Rubins, J.B. et al. (1999) Infect. Immun. 67;5979-84. Salo, P. et al. (1995). J. Infect. Dis. 171;479-82. Schena. M. et al. (1998) Trends Biotechnol. 16;301-6. Sorensen, U.B. (1993) J.Clin. Microbiol. 31;2097-2100. 30 Straub, T.M. et al. (2002) Appl. Environ. Microbiol. 68;1817-26. Thompson, J.D. et al. (1994) Nucl. Acids Res. 22;4673-80. Vakevainen, M. et al. (2001) J. Infect. Dis. 184;789-93. van Leeuwen, W.B. et al. (2003) J. Clin. Microbiol. 41;3323-6. van Selm, S. et al. (2002) Microbiology 148;1747-55. 35 Volokhov, D. et al. (2002) J. Clin. Microbiol. 40;4720-8. Weiller, G.F. (1998) Mol. Biol. Evol. 15;326-35.

Claims (22)

1. A method of distinguishing between at least 25 different serotypes of Streptococcus pneumoniae in a sample, the method comprising, 5 i) analysing at least a portion of the nucleotide sequence between the 3' end of the cpsA gene and the 5' end of the cpsB gene, and/or ii) analysing at least a portion of the wzy and/or wzx gene(s).

2. The method of claim 1 which distinguishes between at least 70 different 10 serotypes of Streptococcus pneumoniae in a sample.

3. A method of determining the serotype of Streptococcus pneumoniae in a sample, the method comprising, i) analysing at least a portion of the nucleotide sequence between the 3' end of 15 the cpsA gene and the 5' end of the cpsB gene, and/or ii) analysing at least a portion of the wzy and/or wzx gene(s), wherein the serotype is selected from the group consisting of: 2, 7A, 7B, 7C, 9A, 9L, 1OF, IA, 1OB, 10C, 1lF, 11A, 11B, 11C, iD, 12F, 12A, 12B, 13, 15F, 15A, 15B, 15C, 16A, 17F, 17A, 18F, 18A, 18B, 21, 22F, 22A, 24F, 24A, 24B, 25F, 25A, 27, 28F, 20 28A, 31, 32F, 32A, 33F, 33A, 33B, 33C, 33D, 34, 35A, 35B, 35C, 36, 37, 38, 39, 40, 41F, 41A, 42, 43, 44, 45, 46, 47, 47A and 48.

4. A method of determining the serotype of Streptococcus pneumoniae in a sample, the method comprising analysing at least a portion of the nucleotide sequence 25 between the 3' end of the cpsA gene and the 5' end of the cpsB gene.

5. The method of claim 4, wherein the portion of the nucleotide sequence between the 3' end of the cpsA gene and the 5' end of the cpsB gene which is analysed is any nucleotide which is polymorphic between at least some of the S. pneumoniae serotypes 30 referred to in Figure 2.

6. The method of claim 4 or claim 5, wherein the method comprises amplifying at least a portion of the nucleotide sequence between the 3' end of the cpsA gene and the 5' end of the cpsB gene, and sequencing the amplification product. 35

7. The method of claim 6, wherein the entire approximate 800 bp region as provided in Figure 2 is amplified and sequenced. WO 2004/090159 PCT/AU2004/000480 98

8. The method of claim 7, wherein the amplification is performed using primer pairs comprising a sequence selected from the group consisting of: 1) GGCATT(/C)TATGGAGTTGATTCG(/A)TCCATT(/C)CACAC(C/T)TTAG (SEQ ID NO:68) and 5 GC(/T)TCAATG(/A)TGG(/A)GCAATG(/T)ACTGGA(/C)GTA(/G)ATTCCCA(/G)A CATC (SEQ ID NO:73), 2) GGCATT(/C)TATGGAGTTGATTCG(/A)TCCATT(/C)CACACC(/T) TTAG (SEQ ID NO:68) and CCATCAC(/T)ATAGAGGTTAC(/A)TG(/A)TCTGGCATT(/C)GC (SEQ ID NO:71), 10 3) GAAAGTGGG(/A/T)GGG(/A/T)A(/G)A(/C)T(/G)TAT(/C)AAAGTA(/G) AATTCT(/G)CAAGAT(/C)TTA(/G)AAA(/G)G (SEQ ID NO:70) and T(/G)CATG(/A)CTA(/G)AAC(/T)TCT(/A)ATC(/T)AAG(/A)GCATAACGACTATC(/ T) (SEQ ID NO:72), and 4) primer pairs that amplify the same region, or diagnostic portion thereof, from 15 the genome of a strain of S. pneumoniae as the primers provided in 1) to 3).

9. The method of claim 4, wherein the nucleotide sequence analysis step comprises determining whether a polynucleotide obtained from S. pneumoniae selectively hybridises to a polynucleotide probe comprising one or more polymorphic regions of 20 the nucleotide sequence between the 3' end of the cpsA gene and the 5' end of the cpsB gene, wherein such polymorphic regions are shown in Figure 2.

10. The method of claim 9, wherein the nucleotide sequence analysis step comprises a plurality of said polynucleotide probes. 25

11. The method of claim 9 or claim 10, wherein the polynucleotide probe(s) is present as a microarray.

12. A method of determining the serotype of Streptococcus pneumoniae in a 30 sample, the method comprising analysing at least a portion of the wzy and/or wzx gene(s).

13. The method of claim 12 which comprises amplifying at least a portion of the wzy and/or wzx gene(s), and determining the length of the amplification product. 35

14. The method of claim 13, wherein at least a portion of the wzy and/or wzx gene(s) is amplified using a primer comprising a sequence selected from any one of SEQ ID WO 2004/090159 PCT/AU2004/000480 99 NO's 75 to 139 or 144 to 333, or a primer that can be used to amplify the same region, or diagnostic portion thereof, from the genome of a strain of S. pneumoniae as a primers provided as any one of SEQ ID NO's 75 to 139 or 144 to 333. 5 15. A method of determining the serotype of Streptococcus pneumoniae in a sample, the method comprising performing a method according to any one of claims 4 to 11, and the method according to any one of claims 12 to 14.

16. A method of identifying serotype 3 of Streptococcus pneumoniae in a sample, 10 the method comprising a method according to any one of claims 4 to 11, and analysing the orf2 (wze)-cap3A-cap3B region.

17. The method of claim 16, wherein the orJ2 (wze)-cap3A-cap3B region is analysed by amplifying a portion of the orf2 (wze)-cap3A-cap3B region using primer 15 pairs selected from the group consisting of: 1) GCACAAAAAAAGTTTGATATTCCCCTTGACAATAG (SEQ ID NO:140) and GCAGGATCTAAGGAGGCTTCAAGATTCAACTC (SEQ ID NO:141), 2) CGAACCTACTATTGAGTGTGATACTTTTATGGGATACAGAG (SEQ 20 ID NO:142) and CTGACAGCATGAAAATATATAACCGCCCAACGAATAAG (SEQ ID NO: 143), and 3) primer pairs that amplify the same region, or diagnostic portion thereof, from the genome of a strain of S. pneumoniae as the primers provided in 1) or 2) 25 18. The method according to any one of claims 1 to 17, the method further comprising detecting any serotype of Streptococcuspneumoniae in the sample.

19. The method of claim 18, wherein the psaA and/or pneumolysin genes, or a portion thereof, is amplified. 30

20. The method of claim 19, wherein a portion of the psaA gene is amplified using primers comprising the sequence TACATTACTCGTTCTCTTTCTTTCTGCAATCATTCTTG (SEQ ID NO:64) and TAGTAGCTGTCGCCTTCTTTACCTTGTTCTGC (SEQ ID NO:65), or primer pairs 35 that amplify the same region, or diagnostic portion thereof, from the genome of a strain of S. pneumoniae as SEQ ID NO:64 and SEQ ID NO:65. WO 2004/090159 PCT/AU2004/000480 100 21 . The method of claim 19, wherein a portion of the pneumolysin gene is amplified using primers comprising the sequence AGAATAATCCCACTCTTCTTGCGGTTGA (SEQ ID NO:66) and CATGCTGTGAGCCGTTATTTTTTCATACTG (SEQ ID NO:67) or primer pairs that amplify the same region, or diagnostic portion thereof, 5 from the genome of a strain of S. pneumoniae as SEQ ID NO:66 and SEQ ID NO:67.

22. An isolated polynucleotide comprising a sequence of nucleotides selected from those provided as SEQ ID NO's 2 to 63, or a fragment thereof which is at least 10 nucleotides in length, with the proviso that the polynucleotide does not comprise the 10 entire wzy and/or wzx gene(s) of a S. pneumoniae serotype selected from the group consisting of: 1, 2, 4, 6A, 6B, 8, 9V, 14, 18C, 19F, 19A, 19B, 23F, 33F and 37, or the entire wzx gene of S. pneumoniae serotype 19C.

23. An isolated polynucleotide comprising a sequence of nucleotides selected from 15 the group consisting of: 1-AF532632, 1OA-AF532633, 1OA-AF532634, 1OB AY508586, 1OF-AF532635, 1OF-AF532636, 10F-AY508587, 11A-AF532637, 11A AF532638, 11B-AF532639, 11C-AY508588, l1C-AY508589, 12A-AY508590, 12A AY508591, 12F-AF532640, 12F-AF532641, 13-AF532642, 14-AF532643, 14 AF532644, 14-AF532645, 15A-AF532646, 15A-AF532647, 15B-AF532648, 15B 20 AF532649, 15B-AF532650, 15C-AF532651, 15C-AF532652, 15C-AY330714, 15C AY330715, 15C-AY508592, 15C-AY508593, 15F-AY508594, 15F-AY508595, 16A AY508596, 16F-AF532653, 16F-AF532654, 17A-AF532655, 17A-AY508597, 17F AF532656, 17F-AF532657, 18A-AF532658, 18A-AF532659, 18B-AF532660, 18C AF532661, 18F-AF532662, 18F-AY330716, 18F-AY508598, 19A-AF532663, 19A 25 AF532664, 19B-AY508599, 19C-AY508600, 19C-AY508601, 19F-AF532665, 19F AF532666, 19F-AF532667, 19F-AF532668, 2-AF532669, 20-AF532670, 21 AF532671, 21-AY508602, 22A-AF532672, 22F-AF532673, 23A-AF532674, 23A AF532675, 23B-AF532676, 23B-AY330717, 23F-AF532677, 23F-AF532678, 23 F AF532679, 24A-AY508603, 24B-AY508604, 24F-AY508605, 24F-AY508606, 24F 30 AY508607, 25F-AF532711, 27-AY508608, 28A-AY508609, 28F-AY508610, 28F AY50861 1, 29-AF532680, 29-AY330718, 3-AF532681, 3-AF532682, 3-AF532683,

31-AF532684, 32A-AY508612, 32A-AY508613, 32F-AY508614, 33A-AF532685, 33B-AF532686, 33B-AY508615,. 33C-AY508616, 33F-AF532687, 33F-AF532688, 33F-AF532689,

34-AF532690, 35A-AY508617, 35B-AF532691, 35C-AY508618, 35 35F-AF532692, 36-AY508619, 37-AF532713, 38-AF532712, 39-AY508620, 39 AY508621, 4-AF532693, 40-AY508622, 41A-AY508623, 41F-AY508624, 42 AY508625, 43-AY508626, 45-AY508628, 46-AY508629, 47A-AY508630, 47F- WO 2004/090159 PCT/AU2004/000480 101 AY508631, 48-AY508632, 48-AY508633, 5-AF532696, 5-AF532697, 5-AY508634, 6A-AF532698, 6A-AF532699, 6A-AF532700, 6A-AF532701, 6A-AF532702, 6A AY508641, 6B-AF532703, 6B-AF532704, 6B-AF532705, 7A-AY508635, 7B AY508636, 7C-AF532706, 7F-AF532707, 8-AF532708, 9A-AY508637, 9L 5 AY508638, 9N-AF532709, 9V-AF532710 and 9V-AY508639 as provided in Figure 2, or a fragment thereof which is at least 10 nucleotides in length, with the proviso the polynucleotide does not comprise the 3' end of the cpsA gene to the 5' end of the cpsB gene of a S. pneumoniae serotype selected from the group consisting of: 1, 2, 3, 4, 6A, 6B, 8, 9V, 14, 18C, 19F, 19A, 23F, 33F and 37. 10 24. An isolated polynucleotide consisting essentially of 10 to 50 contiguous nucleotides corresponding to a portion of the 3' end of the cpsA S. pneumoniae gene or the 5' end of the cpsB S. pneumoniae gene. 15 25. A polynucleotide consisting essentially of 10 to 50 contiguous nucleotides corresponding to a portion of the S. pneumoniae wzy and/or wzx gene(s). 26. The polynucleotide of claim 24 or claim 25, wherein said polynucleotide comprises one or more nucleotides which differ between different S. pneuinoniae 20 serotypes. 27. The polynucleotide of claim 26, wherein the nucleotides which differ between S. pneumoniae serotypes correspond to one or more of positions as shown in Figure 2. 25 28. A composition comprising a plurality of polynucleotides according to any one of claims 22 to 27 and an acceptable carrier or excipient. 29. A microarray comprising a plurality of polynucleotides according to any one of claims 22 to 27. 30 30. The use of a microarray according to claim 29 for serotyping a strain of S. pneumoniae. 31. A kit comprising at least one polynucleotide according to any one of claims 22 35 to 27.